NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Sample GSM5955801 Query DataSets for GSM5955801
Status Public on Jun 21, 2023
Title inf_BMDMs 14 scRNA-seq
Sample type SRA
 
Source name infected BMDMs
Organism synthetic construct
Characteristics time point: 20 hours post infection
Treatment protocol LB-grown cultures of WT or each of 24 MIB-tagged SPI-2 mutant strains were pooled into one tube and opsonized with 20% mouse serum for 30 min and washed with PBS. BMDMs were infected with the pool of SPI-2 mutants at MOIs of 2:1 and spun down for 5 min at 400g to synchronize internalization. After 30 min, cells were washed with media containing 50 μg/ml gentamicin to remove S.Tm that were not internalized. Fresh media containing 50 μg/ml gentamicin was then added back to the cells for the duration of infection
Growth protocol BMDMs (8x[10^5] cells/well) were plated in non-tissue culture treated six–well plates supplemented with DMEM containing 20% FBS and 25 ng/ml rmM-CSF
Extracted molecule total RNA
Extraction protocol Cells were harvested 20 hours post infection by a PBS wash followed by incubation of 10 min with ice-cold EDTA (5mM) and analyzed by flow cytometry (BD FACS Aria III) under continuous cooling at 4°C. Infected single cells were sorted into twin.tec® PCR plate 384 LoBind® containing 1.2μl of Cel-seq Lysis buffer per each well, placed immediately on dry ice and stored in minus 80.
Single cells were processed for libraries generation according to the Cel-seq protocol (Hashimshony et al., 2016)
 
Library strategy RNA-Seq
Library source transcriptomic
Library selection cDNA
Instrument model Illumina MiniSeq
 
Data processing Fastq reads were demultiplexed to single cells based on the CEL-Seq barcode located in positions 7-12 of R1.
R2 reads were filtered to contain the GFP sequence preceding the MIB (positions 1-37 of R2; GFP sequence: TGGGATTACACATGGCATGGATGAACTATACAAATAA, for ∆sseJ the sequence is TGGGATCACACATGGCATGGATGAACTATACAAATAA due to mutation in the plasmid during cloning). To account for sequencing errors, 1 mismatch was allowed for the GFP sequence identification.
The sequence of 10 nucleotides following the GFP (positions 38-47 of R2) is the bacterial barcode, i.e., the MIB sequence. In each single-cell, we counted the number of reads that correspond to each bacterial barcode allowing 1 mismatch in the MIB sequence
Using this procedure, we generated a matrix with the counts of each mutant (MIB) in each cell
Supplementary files format and content: Text files include MIB counts table for each mutant in each cell
 
Submission date Mar 15, 2022
Last update date Jun 21, 2023
Contact name Noa Bossel Ben-Moshe
Organization name Weizmann
Street address Hertzl Street
City Rehovot
ZIP/Postal code 76100
Country Israel
 
Platform ID GPL26967
Series (2)
GSE198724 Paired single-cell host profiling with multiplex-tagged bacterial mutants reveals intracellular virulence-immune networks IV
GSE198728 Paired single-cell host profiling with multiplex-tagged bacterial mutants reveals intracellular virulence-immune networks
Relations
BioSample SAMN26680675
SRA SRX14470949

Supplementary data files not provided
SRA Run SelectorHelp
Raw data are available in SRA
Processed data are available on Series record

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap