 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Jun 21, 2023 |
| Title |
gtgE_inf_bulk |
| Sample type |
SRA |
| |
|
| Source name |
infected BMDMs
|
| Organism |
synthetic construct |
| Characteristics |
infected with: ∆gtgE
|
| Treatment protocol |
LB-grown cultures of WT or each of 24 MIB-tagged SPI-2 mutant strains were opsonized with 20% mouse serum for 30 min and washed with PBS. BMDMs were infected with each of SPI-2 mutants separately at MOIs of 5:1 and spun down for 5 min at 400g to synchronize internalization. After 30 min, cells were washed with media containing 50 μg/ml gentamicin to remove S.Tm that were not internalized. Fresh media containing 50 μg/ml gentamicin was then added back to the cells for the duration of infection
|
| Growth protocol |
BMDMs (8x[10^5] cells/well) were plated in non-tissue culture treated six–well plates supplemented with DMEM containing 20% FBS and 25 ng/ml rmM-CSF
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Cells were harvested 4 hours post infection by a PBS wash followed by incubation of 10 min with ice-cold EDTA (5mM) and analyzed by flow cytometry (BD FACS Aria III) under continuous cooling at 4°C. Infected cells were sorted into 1.7ml low–bind tubes containing 25μl of lysis buffer (0.1% Triton in RNase-free water), placed immediately on dry ice and stored in minus 80.
scPAIR-seq relies on the CEL-seq library preparation protocol (Hashimshony et al., 2016) up to in-vitro transcription (IVT) step. After IVT, amplified RNA (aRNA) was treated with EXO-SAP enzyme (15 min at 37°C) to remove unused primers leftovers. aRNA sample was split and half of the sample volume (11 µl) was used to perform nucleic acid purification with RNAClean XP beads. The purified aRNA was converted to cDNA using superscript Ⅲ with specific GFP primer and cDNA was purified with AMPure XP beads. MIB library was amplified by 25 PCR cycles using a nested GFP primer to improve specificity of MIB amplification. To ensure exclusive sequencing of MIB reads by a custom GFP primer in the downstream steps, the nested GFP-primer was attached with a 5′-tail containing Illumina 3′-adaptor that was modified in its binding site for the Illumina sequencing primer
|
| |
|
| Library strategy |
OTHER |
| Library source |
transcriptomic |
| Library selection |
other |
| Instrument model |
Illumina MiniSeq |
| |
|
| Data processing |
Library strategy: scPAIR-seq
Fastq reads were demultiplexed to samples based on the CEL-Seq barcode located in positions 7-12 of R1.
R2 reads were filtered to contain the GFP sequence preceding the MIB (positions 1-37 of R2; GFP sequence: TGGGATTACACATGGCATGGATGAACTATACAAATAA, for ∆sseJ the sequence is TGGGATCACACATGGCATGGATGAACTATACAAATAA due to mutation in the plasmid during cloning). To account for sequencing errors, 1 mismatch was allowed for the GFP sequence identification.
The sequence of 10 nucleotides following the GFP (positions 38-47 of R2) is the bacterial barcode, i.e., the MIB sequence. In each sample, we counted the number of reads that correspond to each bacterial barcode allowing 1 mismatch in the MIB sequence
Using this procedure, we generated a matrix with the counts of each mutant (MIB) in each sample
Supplementary files format and content: Text files include MIB counts per sample
|
| |
|
| Submission date |
Mar 15, 2022 |
| Last update date |
Jun 21, 2023 |
| Contact name |
Noa Bossel Ben-Moshe |
| Organization name |
Weizmann
|
| Street address |
Hertzl Street
|
| City |
Rehovot |
| ZIP/Postal code |
76100 |
| Country |
Israel |
| |
|
| Platform ID |
GPL26967 |
| Series (2) |
| GSE198727 |
Paired single-cell host profiling with multiplex-tagged bacterial mutants reveals intracellular virulence-immune networks VI |
| GSE198728 |
Paired single-cell host profiling with multiplex-tagged bacterial mutants reveals intracellular virulence-immune networks |
|
| Relations |
| BioSample |
SAMN26680806 |
| SRA |
SRX14470689 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM5955875_gtgE_inf_bulk.txt.gz |
211 b |
(ftp)(http) |
TXT |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data provided as supplementary file |
| Processed data are available on Series record |
|
|
|
|
 |
