 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Jun 30, 2023 |
| Title |
High_Poly_5_S20 |
| Sample type |
SRA |
| |
|
| Source name |
PC3 cells
|
| Organism |
Homo sapiens |
| Characteristics |
cell type: PC3 cells
fraction: High polysome fractions
|
| Treatment protocol |
Cells were transfected with 16 µg MPRA plasmid library DNA per 15cm plate for 16 hours, then washed and placed in fresh media for a subsequent 24 hours before collection.
|
| Growth protocol |
PC3 cells were cultured in RPMI + 10% fetal bovine serum + 1x penicillin/streptomycin + 2mM L-Glutamine at 37°C with 5% CO2
|
| Extracted molecule |
total RNA |
| Extraction protocol |
~15-20 x106 cells were collected per sample and treated with 100µg of cycloheximide on ice for 10 minutes. Cells were lysed and for each sample, ~10% saved for plasmid DNA isolation, ~25% saved for total mRNA isolation, and ~65% loaded onto a sucrose gradient for polysome mRNA isolation.
Plasmid DNA was isolated using Qiagen Spin Miniprep Kit.
Total mRNA and polysome mRNA was isolated using Zymo Direct-zol RNA Miniprep Plus kit with DNase I treatment. cDNA was made using SuperScript III first-strand synthesis system and RT primer: 5’- GGTTTGTCCAAACTCATCAATGT -3’.
Library construction was performed using a two-step PCR amplicon approach.
First amplification was performed at 98°C for 30” followed by ten cycles of 98°C for 10”, 71°C for 30”, 72°C for 30”, and final elongation at 72°C for 5’ with Forward primer: 5’-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGgccagcgccaggatcaac -3’ and Reverse Primer: 5’- GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGcgccccgactctagctagac -3’ using Q5 Polymerase. PCR product was purified using 1.8X Ampure XP beads.
Second amplification was was performed at 98°C for 30” followed by ten cycles of 98°C for 10”, 67°C for 30”, 72°C for 30”, and final elongation at 72°C for 5’ with IDT for Illumina Nextera UDI primers using Q5 Polymerase. PCR product was purified using 0.7X Ampure XP beads.
|
| |
|
| Library strategy |
OTHER |
| Library source |
transcriptomic |
| Library selection |
other |
| Instrument model |
Illumina HiSeq 2500 |
| |
|
| Description |
High Polysome Fractions replicate 5
|
| Data processing |
Sequencing was performed using an Illumina HiSeq 2500 in Rapid Run mode and employed a single-end, 50 base read length (SE50) sequencing strategy.
Files were aligned to guides using bowtie2 for each sample. Next, the barcodes for WT and mutant were segregated for each sample.
log2 CPM values for each barcode using edgeR.
Assembly: hg38
Supplementary files format and content: tab-delimited text files include log2 cpm values for each Sample.
Library strategy: Polysome-Seq
|
| |
|
| Submission date |
Apr 06, 2022 |
| Last update date |
Jun 30, 2023 |
| Contact name |
Sonali Arora |
| E-mail(s) |
sarora@fredhutch.org
|
| Organization name |
FHCRC
|
| Street address |
1100 Fairview Ave N,
|
| City |
Seattle |
| State/province |
WA |
| ZIP/Postal code |
98109 |
| Country |
USA |
| |
|
| Platform ID |
GPL16791 |
| Series (2) |
| GSE200302 |
A genome-wide functional study of 3’UTR mutations in advanced prostate cancer [Polysome-Seq] |
| GSE200304 |
A genome-wide functional study of 3’UTR mutations in advanced prostate cancer |
|
| Relations |
| BioSample |
SAMN27381274 |
| SRA |
SRX14759755 |
| Supplementary data files not provided |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data are available on Series record |
|
|
|
|
 |
