NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Sample GSM6053236 Query DataSets for GSM6053236
Status Public on Feb 15, 2023
Title WGBS, ago4-4/AGO4-D742A, biol rep 1
Sample type SRA
 
Source name Inflorescence
Organism Arabidopsis thaliana
Characteristics tissue: Inflorescence
genotype: ago4-4/AGO4-D742A
Growth protocol All Arabidopsis thaliana plants were grown at 21 C with 16 h light and 8 h dark in a growth room
Extracted molecule genomic DNA
Extraction protocol For each library, genomic DNA was extracted from the inflorescence tissues of a single plant using Nucleon Phytopure DNA Extraction Kit (Cytiva).
Whole-genome bisulfite sequencing libraries were prepared using Perkin Elmer’s Nextflex Bisulfite-Seq Kit per the manufacturer’s instruction. Approximately 500 ng DNA fragments were end-repaired, 3’ adenylated, and ligated with adapters. Unmethylated cytosines in the adapter-ligated DNA were chemically converted by EZ DNA Methylation-Gold Kit (Zymo Research Corp.) following the manufacturer’s instruction. The CT converted products were purified and subjected to 12 cycles of PCR amplification before single-ended Illumina sequencing.
 
Library strategy Bisulfite-Seq
Library source genomic
Library selection RANDOM
Instrument model Illumina NextSeq 500
 
Data processing To analyze the whole-genome bisulfite sequencing data, 3’ adapters were removed by Cutadapt v1.18 with the following options: -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -m 15 -q 20.
Trimmed reads were aligned to the Arabidopsis TAIR10 genome by bsmap2 with the following options: -w 100 -n 1 -p 3 -v 0.08. Methylation ratios at individual cytosine sites were calculated using methratio.py.
Arabidopsis genome was binned into 100 nt windows with CG, CHG, and CHH (where H represents any nucleotide except G) methylation calculated individually. To avoid regions with low sequencing coverage, only bins with at least 4 cytosines that were each covered by no less than 4 reads were included in this analysis.
Bins that have at least 10% less CHH methylation in the two independent replicates of ago4-4 compared to the two independent replicates of wild-type Ws ecotype plants were defined as differentially methylated bins.
Differentially methylated bins within 200 bp from each other were merged into differentially methylated regions (DMRs). Cytosine methylation levels at methylated regions were caculated.
Assembly: TAIR10
Supplementary files format and content: Tab-delimited text files include chromosome, coordinates of cytosines, strandedness, sequence context, methylation ratio, effective total C counts, total C counts, total G counts on the reverse strand, total G+A counts on the reverse strand, lower bound of 95% confidence interval of methylation ratio, and upper bound of 95% confidence interval of methylation ratio
 
Submission date Apr 21, 2022
Last update date Feb 18, 2023
Contact name Craig S. Pikaard
E-mail(s) cpikaard@indiana.edu
Organization name Howard Hughes Medical Institute, Indiana University
Department Department of Biology and Department of Molecular and Cellular Biochemistry
Street address 915 E. Third Street
City Bloomington
State/province Indiana
ZIP/Postal code 47405
Country USA
 
Platform ID GPL19580
Series (2)
GSE201234 AGO4 slicer activity reveals the passenger strand function of plant 23 nt siRNAs and the post-slicing retention of target RNAs mediating RNA-directed DNA methylation [WGBS]
GSE201235 Enzymatic reactions of AGO4 in RNA-directed DNA methylation: siRNA duplex loading, passenger strand elimination, target RNA slicing, and sliced target retention
Relations
BioSample SAMN27723915
SRA SRX14953997

Supplementary file Size Download File type/resource
GSM6053236_GSF2981-ago4-D742A-Rep1-WGBS_S3_methratio.txt.gz 268.8 Mb (ftp)(http) TXT
SRA Run SelectorHelp
Raw data are available in SRA
Processed data provided as supplementary file

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap