NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Sample GSM6226218 Query DataSets for GSM6226218
Status Public on Apr 28, 2023
Title CHi-C of Del(CBS1-5) stembryos at 96h
Sample type SRA
 
Source name stembryo
Organism Mus musculus
Characteristics tissue: stembryo
cell type: mES cells
genotype: Del(CBS1-5)
stage (in_hours_after_aggregation): 96
Extracted molecule genomic DNA
Extraction protocol Collected stembryos were pooled and fixed for 10 min in 1% formaldehyde at room temperature and stored at -80°C until further use.
Lysis was performed with TissueLyser II and metallic beads for 30 sec at 30 hertz before incubation at 4° for 30 min. The rest of the protocol for the capture Hi-C library generation is described in (Bolt et al., 2021). The costume SureSelectXT RNA probe used for DNA capture covers the region chr2:72240000-76840000 (mm9).
 
Library strategy OTHER
Library source genomic
Library selection other
Instrument model Illumina NextSeq 500
 
Data processing All scripts are available on https://github.com/lldelisle/scriptsForRekaikEtAl2022
TruSeq adapters were removed with cutadapt (Martin et al 2011) version 1.16 (-a 'AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC' -A 'AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT').
Trimmed reads were processed with HiCUP version 0.6.1 (doi: 10.12688/f1000research.7334.1) with default paramters on mm10 or on the corresponding mutant genome.
The output BAM was converted to Juicebox format thanks to a custom python script available in https://testtoolshed.g2.bx.psu.edu/repository/download?repository_id=be5040251cd4afb7&changeset_revision=44365a4feb3b&file_type=gz
Only pairs with both mates falling into the capture region (mm10:chr2:72402000-77000000) and with both mates with quality above 30 were kept.
Filtered pairs were loaded into 2kb and 5kb matrices with cooler version 0.7.4 (Abdennur, N., and Mirny, L. (2019), https://doi.org/10.1093/bioinformatics/btz540).
The matrices were balanced with cooler balance (--cis-only).
For the mutant Del(subTAD1), the balancing was done with the option --ignore-diags 5 instead of --ignore-diags 2 to discard the bias due to the presence of a BAC containing the region (mm10:chr2:74747769-74913171).
Assembly: mm10 for wt samples and Del(CBS*) samples and mutant genomes for Del(d1-d4) and Del(sub-TAD1)
Supplementary files format and content: *_validPairs_*.txt.gz: all valid pairs from HiCUP in juicebox format (<readname> <str1> <chr1> <pos1> <frag1> <str2> <chr2> <pos2> <frag2> <mapq1> <mapq2> str = strand (0 for forward, anything else for reverse) pos = middle of the fragment)
Supplementary files format and content: *_*kb_Balanced_*.cool: balanced matrix at 2 or 5kb-bins only in the captured region
Library strategy: Capture Hi-C
 
Submission date Jun 09, 2022
Last update date Apr 28, 2023
Contact name Lucille Lopez-Delisle
E-mail(s) lucille.delisle@epfl.ch
Organization name EPFL
Street address Station 19
City Lausanne
ZIP/Postal code 1015
Country Switzerland
 
Platform ID GPL19057
Series (2)
GSE205778 Sequential and directional insulation by conserved CTCF sites underlies the Hox timer in stembryos [cHi-C]
GSE205783 Sequential and directional insulation by conserved CTCF sites underlies the Hox timer in stembryos
Relations
BioSample SAMN28944795
SRA SRX15652888

Supplementary file Size Download File type/resource
GSM6226218_Del_CBS1-5_96h_CHiC_2kb_Balanced_mm10.cool.gz 7.0 Mb (ftp)(http) COOL
GSM6226218_Del_CBS1-5_96h_CHiC_5kb_Balanced_mm10.cool.gz 3.9 Mb (ftp)(http) COOL
GSM6226218_Del_CBS1-5_96h_CHiC_validPairs_mm10.txt.gz 585.0 Mb (ftp)(http) TXT
SRA Run SelectorHelp
Raw data are available in SRA
Processed data provided as supplementary file

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap