NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Sample GSM6226340 Query DataSets for GSM6226340
Status Public on Apr 28, 2023
Title RNA-seq of Del(CBS2) stembryos at 96h, rep1
Sample type SRA
 
Source name stembryo
Organism Mus musculus
Characteristics tissue: stembryo
cell type: mES cells
genotype: Del(CBS2)
stage (in_hours_after_aggregation): 96
Extracted molecule total RNA
Extraction protocol Stembryos for each condition were collected and pooled in a 2 ml Eppendorf tube. After centrifugation and medium removal, pelleted stembryos were stored at -80°C until RNA extraction.
RNeasy Plus Micro kit (Qiagen) with on-column DNase digestion was used for RNA extraction following the manufacturer’s instructions.
RNA-seq library preparation with Poly-A selection was performed with 1 µg of purified RNA using the TruSeq Stranded mRNA kit from Illumina and following the manufacturer’s protocol. Library quality was assessed with Fragment analyzer.
 
Library strategy RNA-Seq
Library source transcriptomic
Library selection cDNA
Instrument model Illumina NextSeq 500
 
Data processing All scripts are available on https://github.com/lldelisle/scriptsForRekaikEtAl2022
Adapter sequences were trimmed from reads using cutadapt (Martin et al 2011) version 1.16 (-a 'GATCGGAAGAGCACACGTCTGAACTCCAGTCAC' -A 'GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT').
Trimmed reads were aligned on mm10 with STAR version 2.7.7a (Dobin et al. 2013) with ENCODE options using a custom gtf based on Ensembl version 102 (https://doi.org/10.5281/zenodo.4596490).
Only uniquely mapped reads (tag NH:i:1) were kept using bamFilter version 2.4.1 (Barnett et al. 2011).
FPKM values were computed using cufflinks version 2.2.1 (Trapnell et al. 2010; Roberts et al. 2011) with default parameters.
Assembly: mm10
Supplementary files format and content: *_FPKM.txt.gz: output of cufflinks with FPKM values per gene
Supplementary files format and content: all_FPKM.txt.gz: all FPKM values combined into a single table, one raw per gene_id and one column per sample
 
Submission date Jun 09, 2022
Last update date Apr 28, 2023
Contact name Lucille Lopez-Delisle
E-mail(s) lucille.delisle@epfl.ch
Organization name EPFL
Street address Station 19
City Lausanne
ZIP/Postal code 1015
Country Switzerland
 
Platform ID GPL19057
Series (2)
GSE205781 Sequential and directional insulation by conserved CTCF sites underlies the Hox timer in stembryos [RNA-seq]
GSE205783 Sequential and directional insulation by conserved CTCF sites underlies the Hox timer in stembryos
Relations
BioSample SAMN28944736
SRA SRX15651649

Supplementary file Size Download File type/resource
GSM6226340_Del_CBS2_96h_RNAseq_rep1_FPKM.txt.gz 1.4 Mb (ftp)(http) TXT
SRA Run SelectorHelp
Raw data are available in SRA
Processed data provided as supplementary file
Processed data are available on Series record

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap