NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Sample GSM6509681 Query DataSets for GSM6509681
Status Public on Sep 02, 2022
Title Normal_7
Sample type SRA
 
Source name Myocardium
Organism Homo sapiens
Characteristics tissue: Myocardium
tma: 2
Extracted molecule total RNA
Extraction protocol Samples were incubated with DNA-oligo barcoded RNA-ISH probes which were conjugated with a UV-photocleavable linker following standard ISH protocols, along with flourescently labeled antibodies for visualization of morphological structures. Regions of interest within the tissue were illuminated with UV light and oligo barcodes were physically aspirated from the tissue and collected into microtiter plates by the GeoMx® Digital Spatial Profiler (DSP) platform. For more information about DSP protocols please see Merritt et al. Nature Biotech 2020 (doi: 10.1038/s41598-020-63539-x)
Each collection of oligo tags from one well (representing an ROI from the tissue section) was indexed with i7xi5 unique dual indexes using GeoMx SeqCode primers with 18 cycles of PCR. After PCR, indexed AOIs were pooled and purified in two rounds of AMPure XP PCR purification using 1.2x bead:sample ratio.
OTHER: GeoMx Seq
 
Library strategy OTHER
Library source transcriptomic
Library selection other
Instrument model Illumina NovaSeq 6000
 
Description 007
Data processing save-interim-files = false
quality-trim-score = 20
2color-trimming = True
adapter1 = AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC
adapter2 = AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT
adapter-trim-match-length = 10
adapter-trim-max-mismatch = 3
barcode-max-mismatch = 1
stitching-max-mismatch = 2
dedup-hd = 1
threads = 4
Assembly: N/A, sequencing of synthetic tags and alignment to whitelist of RTS_IDs (probe barcodes) found in the config.ini output from the GeoMx DSP platform, see attached PKC file (Hs_R_NGS_WTA_COVID19_v1.0.pkc)
Supplementary files format and content: Digital Count Conversion (DCC) file format outputted from GeoMx NGS Pipeline, contains software versions, scan attributes, GeoMx NGS pipeline parameters and output metrics, Q30 scores, and list of deduplicated counts per RTS_ID (probe barcode)
Supplementary files format and content: Values represented in the collapsed target counts tab are the geometric mean of the probes for a given target--in the case that multiple probes were used-- and excludes any targets flagged as outliers. Analyzed counts represent the upper quartile normalized collapsed counts across the study after removing QC flagged segments and features.
 
Submission date Aug 26, 2022
Last update date Sep 04, 2022
Contact name Arutha Kulasinghe
E-mail(s) arutha.kulasinghe@uq.edu.au
Organization name University of Queensland
Street address 37 kent st
City brisbane
ZIP/Postal code 4102
Country Australia
 
Platform ID GPL24676
Series (1)
GSE212119 Transcriptomic profiling of cardiac tissues from SARS-CoV-2 patients identifies DNA damage
Relations
BioSample SAMN30522830
SRA SRX17246628

Supplementary file Size Download File type/resource
GSM6509681_DSP-1012340055101-D-A08.dcc.gz 27.4 Kb (ftp)(http) DCC
SRA Run SelectorHelp
Raw data are available in SRA
Processed data provided as supplementary file

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap