NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Sample GSM655623 Query DataSets for GSM655623
Status Public on Feb 01, 2011
Title Chickpea salt stressed and control roots and nodules - salt stressed Nodules
Sample type SRA
 
Source name Chickpea variety Inrat-93 nodules - salt stressed
Organism Cicer arietinum
Characteristics treatment: salt
Biomaterial provider ICARDA
Treatment protocol 2h 25 Mm NaCl
Growth protocol Seedlings were further grown for 20 days in a temperature-controlled glasshouse with a day/night temperature regime of 28/20°C and a 16h photoperiod with additional light of 400 µmol PAR m-2s-1. Micro- and macro-nutrient concentrations in the growth medium were adjusted to 0.7mM K2SO4, 1mM MgSO4.7H2O, 1.65 mM CaCl2, 22.5 mM H2PO4 (macronutrients), and 6.6 mM Mn2+, 4 mM Bo3+, 1.5 mM Cu2+, 1.5 mM Zn2+(micronutrients) and additionally 2.0 g L-1 CaCO3 as pH regulator. After one round of compression and filtering, a constant air flow of 400 mL (compressed air) / liter of solution / minute was applied to each bucket through ‘‘spaghetti” tubes system
Extracted molecule polyA RNA
Extraction protocol CTAB LiCl gradient; PolyA+ RNA capture
 
Library strategy RNA-Seq
Library source transcriptomic
Library selection cDNA
Instrument model 454 GS
 
Description Sequencing Instrument: First gerenration 454-Machine
Place of sequencing: 454 Life Sciences, Branford, CT, USA
Data processing Discovery Space software data processing
 
Submission date Jan 14, 2011
Last update date Jun 11, 2013
Contact name Carlos Mauricio Molina
E-mail(s) carmolin@gmail.com, carlos.molina@dijon.inra.fr
Organization name INRA
Department UMRLEG
Lab P. sativum
Street address 17 Rue Sully
City Dijon
State/province Bourgogne
ZIP/Postal code 21000
Country France
 
Platform ID GPL11675
Series (1)
GSE26638 The salt-responsive transcriptome of chickpea roots and nodules via deepSuperSAGE
Relations
BioSample SAMN02197099

Data table header descriptions
SEQUENCE
COUNT

Data table
SEQUENCE COUNT
AATGGATTAACGAGATTCCCAC 300
CAAACGCTGATGATGTGTAGTT 241
TGTGATGTATTGTTGTAATTGT 225
TGTAAGCAAATATAGCTAATAT 177
CATTGTCTATGTGGTTCGGTTC 169
GGCTTAAAGACGTATTTATGTA 149
CCAAGCGTGTTACAATTATGCC 146
GACTAGTAGTGATTGGAAGGGT 132
CGTCAAACTGTTGCTGTCGGTG 130
CTGGAAAGCAACGTTCAATCAA 116
AAATTGTAGATAACTGTTTGTG 115
TGTTAACGTTGCCTAAAGATAT 111
GGTGTTTGTGTATCGCACAATT 109
GGTTAGAGGAAGGCAACCCATT 99
TGTGTGTTGCTTAATGGGCCAA 94
GCATTGTTGTTTGGGATGATAA 84
GATGGGTCTAAGTTGTGGTTGG 77
TGGGTGATGATGAATGCTGTTA 75
GACTACTTTGCCAAATGCACTA 72
ATGAAAGTGAAGATGCAGTGAA 71

Total number of rows: 9809

Table truncated, full table size 239 Kbytes.




Supplementary data files not provided
Raw data not provided for this record
Processed data included within Sample table

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap