|
| Status |
Public on Jun 14, 2023 |
| Title |
Immediate-day5-DS-r4 |
| Sample type |
SRA |
| |
|
| Source name |
regenerative bridge from common peroneal to tibial nerve graft
|
| Organism |
Mus musculus |
| Characteristics |
tissue: regenerative bridge from common peroneal to tibial nerve graft
Sex: M
mouseid: 283686
repair timing: immediate
collection day: 5
cell type: distal stump
|
| Treatment protocol |
common peroneal nerve graft performed to tibial nerve, either immediately or after an 8 week delay period; a single cell suspension was isolated from the regenerative bridge and sorted using FACS to isolate macrophages and Schwann cells.
|
| Growth protocol |
standard mouse housing in research facility
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Total RNA was isolated with Trizol, with an extra chloroform extraction to remove residual phenol and addition of glyco-blue as a carrier to promote RNA precipitation. For RNA extracted from distal stump samples, RNA concentration was determined with a Nanodrop and integrity assessed on a Fragment Analyzer.
For RNA extracted from distal stump samples, rRNA was depleted from 100ng total RNA input using the RiboZero Magnetic Gold H/M/R Kit (Illumina). Directional RNA-seq libraries were prepared from rRNA-depleted RNA using the NEBNext Directional Ultra II RNA Library Prep Kit for Illumina (New England Biolabs). For RNA extracted from 1000 FACS-sorted macrophage and Schwann cells, cDNA was generated and amplified with the SMART-Seq v4 Ultra Low Input RNA Kit (Takara); RNA-seq libraries were prepared with the NEBNext Ultra II FS DNA Library Prep Kit (New England Biolabs) using 4ng amplified cDNA from macrophage samples and 1.5ng from Schwann cell samples.
|
| |
|
| Library strategy |
RNA-Seq |
| Library source |
transcriptomic |
| Library selection |
cDNA |
| Instrument model |
Illumina NextSeq 500 |
| |
|
| Description |
DS_rawCounts.txt
|
| Data processing |
Illumina pipeline software was used for base calling.
Sequenced reads were trimmed for 3' adaptor sequence and low-quality sequence and filtered to remove reads < 50nt with cutadapt v1.8 (-m 50 -q 20 -a AGATCGGAAGAGCACACGTCTGAACTCCAGTC --match-read-wildcards).
Processed reads were mapped to the reference genome/transcriptome with tophat v2.1.1 (--no-novel-juncs --library-type fr-firststrand).
Cuffnorm from the cufflinks package (v2.2.1) was used to quantify transcripts (--library-type fr-firststrand).
Assembly: Mouse mm10 (UCSC)
Supplementary files format and content: tab-delimited text files include raw counts per annotated gene for each sample
|
| |
|
| Submission date |
Nov 03, 2022 |
| Last update date |
Jun 14, 2023 |
| Contact name |
Jennifer K Grenier |
| Organization name |
Cornell University
|
| Department |
Biomedical Sciences
|
| Lab |
Biotechnology Building rm 333
|
| Street address |
526 Campus Rd
|
| City |
Ithaca |
| State/province |
NY |
| ZIP/Postal code |
14853 |
| Country |
USA |
| |
|
| Platform ID |
GPL19057 |
| Series (1) |
| GSE217172 |
Delay Modulates the Immune Response to Nerve Repair |
|
| Relations |
| BioSample |
SAMN31581664 |
| SRA |
SRX18154400 |
