|
|
GEO help: Mouse over screen elements for information. |
|
Status |
Public on Jun 05, 2024 |
Title |
hFB cells, ATAC, DACPano, BR1 |
Sample type |
SRA |
|
|
Source name |
skin
|
Organism |
Homo sapiens |
Characteristics |
tissue: skin cell line: HDFa cell type: primary dermal fibroblast treatment: 1uM DAC 6 days, 100nM Pano 2 days
|
Extracted molecule |
polyA RNA |
Extraction protocol |
We followed the omniATAC protocol (Corces et al., Nature Methods, 2017) We followed the omniATAC protocol (Corces et al., Nature Methods, 2017)
|
|
|
Library strategy |
ATAC-seq |
Library source |
transcriptomic |
Library selection |
other |
Instrument model |
Illumina NextSeq 500 |
|
|
Data processing |
Sequencing reads were trimmed with using Cutadapt (v1.10) with "-a CTGTCTCTTATACACATCTCCGAGCCCACGAGAC -A CTGTCTCTTATACACATCTGACGCTGCCGACGA --quality-cutoff=15,10 --minimum-length=36" Trimmed reads were aligned to hg38 reference genome using bowtie2 (v2.3.4.1) with " --very-sensitive -X 2000". Reads aligned to chrM were eliminated. Duplicated reads were discarded using Picard (v2.8.1, http://broadinstitute.github.io/picard/). Only properly paired reads with at least 10 mapping quality were retained hg38 bigwig
|
|
|
Submission date |
Mar 09, 2023 |
Last update date |
Jun 05, 2024 |
Contact name |
Daofeng Li |
E-mail(s) |
lidaof@gmail.com
|
Phone |
(314) 286-0866
|
Organization name |
Washington University in St. Louis
|
Department |
Genetics
|
Lab |
Ting Wang Lab
|
Street address |
4515 McKinley Avenue
|
City |
SAINT LOUIS |
State/province |
MO |
ZIP/Postal code |
63110 |
Country |
USA |
|
|
Platform ID |
GPL18573 |
Series (1) |
GSE227059 |
Epigenetic therapy activates TE-chimeric transcripts to provide additional source of antigens in glioblastoma stem cells |
|
Relations |
BioSample |
SAMN33706452 |
SRA |
SRX19627043 |
Supplementary file |
Size |
Download |
File type/resource |
GSM7090845_ATAC_hFB_DACPano_BR1.RPGC_10M.bw |
342.4 Mb |
(ftp)(http) |
BW |
SRA Run Selector |
Raw data are available in SRA |
Processed data provided as supplementary file |
|
|
|
|
|