NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Sample GSM7179675 Query DataSets for GSM7179675
Status Public on Jun 13, 2023
Title CH12_RNAseq_Rif1KO_shMcm6_rep3
Sample type SRA
 
Source name CH12
Organism Mus musculus
Characteristics genotype: Rif1KO
infection: shMcm6
Growth protocol RNA-seq was performed on CH12 and two independent RIF1-deficient (RIF1-/-) CH12 clonal derivatives 30 with three replicates. Cells were expanded in complete RPMI and 1 million cells were collected by centrifugation
Extracted molecule total RNA
Extraction protocol RNA was extracted with TRIzol (Invitrogen) according to manufacturer’s instructions.
TruSeq RNA Library Prep Kit v2 (Illumina) was used to prepare a whole-transcriptome sequencing library
 
Library strategy RNA-Seq
Library source transcriptomic
Library selection cDNA
Instrument model Illumina NovaSeq 6000
 
Data processing RNA-seq
Read alignment: 3' adaptors or reads were removed using cutadapt (v1.4.2, Read1: cutadapt --match-read-wildcards -O 1 -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC) and trimmed reads with a length of less than 18bp were discarded.
The trimmed reads were filtered with a contaminants database consisting of rDNA sequences (gi|374088139, gi|38176281) with bowtie2(v2.1.0 --very-sensitive-local).
The recovered non matching reads were aligned to the genome/transcriptome using STAR-align (v2.4.2a, STAR --outSAMstrandField None --outFilterIntronMotifs RemoveNoncanonical --outFilterMismatchNoverLmax 0.1 --outFilterMismatchNmax 10 --outFilterScoreMinOverLread 0.30 --outFilterMatchNminOverLread 0.30 --outFilterMatchNmin 30 --chimSegmentMin 15 --quantMode TranscriptomeSAM --chimJunctionOverhangMin 15 --twopassMode Basic --outSAMtype SAM --outSAMattributes All --outReadsUnmapped Fastx intronMotif --alignIntronMax 200000 --outSJfilterIntronMaxVsReadN 10000 20000 30000 50000 --outSJfilterOverhangMin 20 12 12 12 --outFilterType BySJout --alignMatesGapMax 0 --outFilterMultimapNmax 20).
The STAR-index used for alignment was generated from the combination of the mouse genome build NCBI m37 (GCA_000001635.18) and a transcriptome GTF file created from all refGenes and ensGenes gtfs downloaded from the UCSC Table Browser on the 1. March 2014.
Unique mappers from the resulting BAM file were used to create unstranded, stranded and reverse stranded coverage tracks for visualisation using bedtools (v2.27, bedtools genomecov -split -bg, bedtools genomecov -split -bg -strand '+' ,bedtools genomecov -split -bg -strand '-') and bedGraphToBigWig from the kent-tools (bedGraphToBigWig v4, bedGraphToBigWig -blockSize=256 -itemsPerSlot=1024).
Normalised coverage tracks were created by dividing the coverage at each position with the total number of aligned reads per million.
Differential gene expression analysis: Read counts for genes were quantified using featureCounts v2.0.0.
As a reference, we downloaded all mm9 refSeq genes from the UCSC table browser (https://hgdownload.soe.ucsc.edu/goldenPath/mm9/bigZips/genes/) on February 28, 2020.
In addition, we downloaded the Igh, Igk and Igl gene Ensembl Gene IDs from IMGT (http://www.imgt.org, August 11, 2020) and extracted the corresponding genes from Gencode M25 (www.gencodegenes.org) and lifted them over to mm9 coordinates and added them in addition to the Elambda 3_1 enhancer.
Differential gene expression analysis was performed with DESeq2 v1.22.2 and shrinking log2-foldchanges with ashr v2.2-47.
Assembly: NCBI mm9
Supplementary files format and content: Tab-delimited table with TPMs and DESeq2 log2-foldchanges, adjusted p-values and control TPMs
 
Submission date Apr 17, 2023
Last update date Jun 13, 2023
Contact name Tobias Neumann
Organization name IMP
Street address Campus-Vienna-Biocenter 1
City Vienna
ZIP/Postal code 1030
Country Austria
 
Platform ID GPL24247
Series (2)
GSE228880 RIF1 regulates early replication timing in murine B cells.
GSE229885 RIF1 regulates replication origin activity and early replication timing in B cells [RNA-seq]
Relations
BioSample SAMN34224163
SRA SRX19992621

Supplementary data files not provided
SRA Run SelectorHelp
Raw data are available in SRA
Processed data are available on Series record

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap