NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Sample GSM7187731 Query DataSets for GSM7187731
Status Public on Apr 12, 2024
Title 191227_Lec_L5Bc_EZH2 (1)
Sample type SRA
 
Source name HDLEC
Organism Homo sapiens
Characteristics cell line: HDLEC
cell type: Human Dermal Lymphatic Endothelial cells
bait protein: EZH2
Treatment protocol Intact cells were used to capture RNA-protein interactions using UV crosslinking (400 mJoules/cm2) and antibodies for affinity purification of endogenous RNA-protein complexes.
Growth protocol MV2 C22022 Promocell medium Normoxia
Human Umbilical Vein Endothelial Cells (HUVECs) (C-12203), and Human Dermal Lymphatic Endothelial cells (HDLECs) (C-12217) were purchased from Promocell, Germany, and cultured in the recommended growth media (EGM2) according to the manufacturer’s instructions under 5% CO2 at 37 °C. Hypoxia was stimulated in Coy chamber with a gas mixture of 1% O2, 5% CO2 and 94% N2 (Coy Laboratory Products).
Extracted molecule total RNA
Extraction protocol Formaldehyde crosslinking was used during purification step, to stabilize binding of the covalent bait protein-RNA complex to the protein A beads. This step allows column washes under highly denaturing conditions, hence assuring reliable downstream hits. Subsequent linker ligation reactions were performed at 16°C, largely preserving RNA stem structures and allowing formation of chimeras.
RNA-protein complexes were resolved on a NuPage gel, RNA was isolated, the cDNA library was amplified and samples pooled before submitting for sequencing.
 
Library strategy OTHER
Library source transcriptomic
Library selection other
Instrument model Illumina HiSeq 4000
 
Data processing Mircat33 adapters were trimmed from the read pairs using cutadapt version 1.18: 'cutadapt -j 5 -e 0.1 -q 16 -O 3 --trim-n --minimum-length 15 -a TGGAATTCTCGGGTGCCAAGGC -A GCCTTGGCACCCGAGAATTCCA'
PCR duplicates were collapsed using pyDuplicateRemover.py from the pyCRAC suite (https://git.ecdf.ed.ac.uk/sgrannem/pycrac).
Read 1 from each read pair in the collapsed dataset was aligned to the human genome (hg38) using novoalign 2.07: novoalign -f [READS] -c 48 -s 1 -r Random -o Native -l 17 -d [GENOME INDEX], and bed files were generated using pyReadCounters.py and pyGTF2bed.py from the pyCRAC suite.
RNA-RNA hybrids were obtained from the same files using the hyb pipeline (https://github.com/gkudla/hyb): 'hyb align=bowtie2 word=11 format=fasta type=all pref=none'
Assembly: hg38
Supplementary files format and content: Files ending in .hyb.txt.gz describe RNA-RNA hybrids, and are generated using the hyb pipeline.
Supplementary files format and content: Files ending in .bed.gz describe the genomic location of FLASH reads, and are in bed6 format. The fourth field in each read describes the genome features overlapped by the read.
Library strategy: FLASH-seq
 
Submission date Apr 20, 2023
Last update date Apr 12, 2024
Contact name Hywel Dunn-Davies
Organization name University of Edinburgh
Department Wellcome Trust Centre for Cell Biology
Lab Tollervey Lab
Street address Max Born Crescent
City Edinburgh
ZIP/Postal code EH9 3BF
Country United Kingdom
 
Platform ID GPL20301
Series (1)
GSE230112 Histone H3K27 methyltransferase EZH2 interacts with MEG3-lncRNA to directly regulate integrin signaling and endothelial cell function
Relations
BioSample SAMN34258608
SRA SRX20020425

Supplementary file Size Download File type/resource
GSM7187731_191227_Lec_L5Bc_EZH1_trimmed_1_comp_count_output_reads.bed.gz 6.3 Mb (ftp)(http) BED
GSM7187731_191227_Lec_L5Bc_EZH1_trimmed_1_comp_hybrids_ua_dg.hyb.txt.gz 52.3 Kb (ftp)(http) TXT
SRA Run SelectorHelp
Raw data are available in SRA
Processed data provided as supplementary file

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap