NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Sample GSM7191431 Query DataSets for GSM7191431
Status Public on Dec 02, 2023
Title Interphase elongating RPF rep 2
Sample type SRA
 
Source name HeLa
Organism Homo sapiens
Characteristics cell stage: Interphase
treatment: Cycloheximide
replicate: 2
library type: Ribosome protected mRNA fragment
Treatment protocol For mitotic arrest synchronization, HeLa cells were grown to 40% confluency and treated with 2mM thymidine for 24 hours. Cells were released from thymidine arrest by washing twice with warm DMEM and cultured in 8 µM STLC for 16 hours. Mitotically arrested cells were shaken off the plate and harvested. For cycling mitotic cells, HeLa cells were grown to 20% confluency and treated for 2 mM thymidine for 16 hours. Cells were then washed twice with warm DMEM, incubated at 37°C for 8 hours then 2 mM thymidine was added for another 16 hours. After washing twice with warm DMEM and incubation at 37°C for 8 hours, the cycling mitotic cells were shaken off and harvested. For interphase cells, the mitotic cells were removed by physical disruption (mitotic shake off) and the remaining cells adhered to the plate were harvested. For elongating ribosome profiling, cells were treated with 100 μg/mL cycloheximide for 2 minutes then harvested. For initiation site sequencing, cells were treated with 2 μg/mL harringtonine for 2 minutes at 37°C, followed by 12.5 μM puromycin for 2 minutes at 37°C then 100 μg/mL cycloheximide and immediately collected.
Growth protocol HeLa cells were maintained in DMEM supplemented with 10% fetal bovine serum and 100 U/mL penicillin/streptomycin.
Extracted molecule total RNA
Extraction protocol To collect interphase cells, media containing translation inhibitor was poured into a 50mL tube, cells were washed with PBS + 100 μg/mL cycloheximide and then trypsinized in the presence of 100 μg/mL cycloheximide for 3 minutes at 37°C. Cells were then collected using the cold media with inhibitor. For mitotic cells, after addition of cycloheximide, mitotic cells were harvested by shake off and incubated on ice. Cells were centrifuged at 500x g for 3 minutes, washed once with 20 mL PBS+cycloheximide, and the pellet was moved into a new 1.5 mL tube with 1 mL PBS+cycloheximide. Cells were lysed in 900 μL polysome lysis buffer (20 mM Tris pH 7.4, 100 mM KCl, 5 mM MgCl2, 1% (v/v) Triton X-100, 100 μg/mL cycloheximide, 500 U/mL RNaseIn Plus, 1x cOmplete protease inhibitor cocktail) and incubated on ice for 10 minutes. To ensure efficient lysis, cells were passed through a syringe 5 times. Cell debris and nucleus was depleted by spinning the lysate at 1300x g for 10 minutes. 30 μL of the cleared lysate was added to 400 μL TRI Reagent (Invitrogen, AM9738) for input RNA sequencing library. Three 300μL aliquots were generated with the rest of the cleared lysate, flash frozen in liquid nitrogen, and stored at -80°C.
 
Library strategy OTHER
Library source transcriptomic
Library selection other
Instrument model Illumina HiSeq 2500
 
Description CellCycle_ORF_input_counts.txt
Data processing Samples were demultiplexed with bcl2fastq v2.20 to generate fastq files.
Read trimming: Cutadapt (v3.7). cutadapt -m 15 -u 8 -e 0.1 --match-read-wildcards -a TCGTATGCCGTCTTCTGCTTG -O 1
Read mapping: STAR (v2.7.1a): STAR --runMode alignReads --outFilterMultimapNmax 1 --outReadsUnmapped Fastx --outFilterType BySJout --outSAMattributes All --outSAMtype BAM SortedByCoordinate
The RiboTISH pipeline was applied to aligned reads from both translation initiation site sequencing and elongating ribosome profiling to identify high confidence translation initiation sites.
Read counting: htseq-count (0.11.0): For elongating ribosome profiling and matched RNA-seq: htseq-count -f bam -t CDS.
Assembly: hg38, Gencode release 25 annotations.
Supplementary files format and content: Tab delimited files with chromosome position for the translation initiation site and counts at each site along with the associated input mRNA counts is provided for each TIS-seq dataset. Tab delimited file with gene ID and counts within the annotated open reading frames is provided for elongating ribosome profiling and input mRNA sequencing datasets.
Library strategy: Ribosome profiling
 
Submission date Apr 20, 2023
Last update date Dec 02, 2023
Contact name Jimmy Ly
Organization name Whitehead Institute
Department Biology
Lab Iain Cheeseman
Street address 455 main street
City Cambridge
State/province Massachusetts
ZIP/Postal code 02142
Country USA
 
Platform ID GPL16791
Series (1)
GSE230189 Nuclear release of eIF1 globally increases translation initiation stringency during mitosis
Relations
BioSample SAMN34268246
SRA SRX20027524

Supplementary file Size Download File type/resource
GSM7191431_CAGATC_AsyncCycloRPF_Rep2.bedgraph.gz 23.7 Mb (ftp)(http) BEDGRAPH
SRA Run SelectorHelp
Raw data are available in SRA
Processed data provided as supplementary file
Processed data are available on Series record

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap