NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Sample GSM742257 Query DataSets for GSM742257
Status Public on Aug 06, 2013
Title unbound_fraction_rep2 (EL5)
Sample type SRA
 
Source name 0-24hr-old Oregon-R embryos
Organism Drosophila melanogaster
Characteristics RIP antibody: unbound fraction
replicate: 2
purified length: 55nt
adapter: TCGTATGCCGTCTTCTGCTTG
directional: directional
machine: Illumina Genome Analyzer
original pipeline: 1.131
fastqs from: Re-run Pipeline v1.5.1 (intensities) + Ibis (basecalling)
Treatment protocol Sequential immunopurifications for directional libraries were carried out essentially as described (Lei and Corces 2006) with the following modifications. Nuclear extracts purified from 0-24 h embryos supplemented with 1U/ul Rnasin were preabsorbed to an a-Su(Hw) preimmune sera crosslinked column, then bound to an a-Su(Hw) crosslinked column, washed three times with HBSMT and three times with HBSM (50 mM HEPES, pH 6.7; 150 mM NaCl; 5 mM Kcl; 2.5 mM MgCl2), eluted with 1.25 mL HBSK-100 (50 mM HEPES, pH 6.7; 150 mM NaCl; 100 mM Kcl; 2.5 mM MgCl2) and 1.25 mL HBSK-200 (50 mM HEPES, pH 6.7; 150 mM NaCl; 200 mM Kcl; 2.5 mM MgCl2). The eluates were combined and added to 2.5 mL of HBSX-BSA (50 mM HEPES, pH 6.7; 150 mM NaCl; 2.5 mM MgCl2; 0.6% TritonX-100; 2 mg/mL BSA) including protease inhibitors and 1 U/ul Rnasin, then bound to an a-CP190 crosslinked column, washed and eluted as described previously (Lei and Corces 2006). RNA copurified with 250 mM and 1M MgCl2 elutions was acid:phenol extracted, ethanol precipitated with 20 mg glycogen, and digested with Dnase I.
Extracted molecule nuclear RNA
Extraction protocol For directional libraries, the RNA was phosphatase treated with Shrimp Alkaline Phosphatase (USB corporation), and 5' end labeled with g-[32P]-ATP and T4 polynucleotide kinase (NEB) and run on a 15% denaturing polyacrylamide gel. Bands specific to the IP, ranging from 35 nt to 55 nt, were cut, crushed with a motorized pestle and soaked in 0.3M NaOAc pH 5.2, and extracted RNA was ethanol precipitated with 20 mg glycogen. Samples were digested with RNase H (NEB) using an oligo complimentary to 2S rRNA and then digested with DNase I. Samples were acid:phenol extracted and ethanol precipitated with NH4OAc.3'dapters were ligated with T4 RNA ligase (NEB) (ATP was omitted if adenylated linkers were used), and samples were run on a 15% denaturing polyacrylamide gel and purified as before. Samples were precipitated, and 5' end labeled again with g-[32P]-ATP and T4 polynucleotide kinase. 5' adapter were ligated with T4 RNA ligase, and samples were run on a 12% denaturing polyacrylamide gel and purified and precipitated as before. Samples were reverse transcribed using Superscript III (Invitrogen) using a primer complementary to the 3'adapteand PCR amplified using Pfu Ultra (Stratagene) using primers corresponding to the 5' and 3' adapters. When non-Illumina small RNA adapters were used, libraries were adapted to Illumina compatible ends by PCR amplification. Libraries were sequenced on the Illumina Genome Analyzer I or II platforms using commercial or custom sequencing primers. For non-directional oligo-dT selected libraries, poly(A)+ RNA was selected using a MicroPoly(A)Purist column (Ambion), and 100 ng was cloned using the standard Illumina mRNA-seq v2.2 cloning protocol.
 
Library strategy RNA-Seq
Library source transcriptomic
Library selection cDNA
Instrument model Illumina Genome Analyzer
 
Data processing For directional libraries, the RNA was phosphatase treated with Shrimp Alkaline Phosphatase (USB corporation), and 5' end labeled with g-[32P]-ATP and T4 polynucleotide kinase (NEB) and run on a 15% denaturing polyacrylamide gel. Bands specific to the IP, ranging from 35 nt to 55 nt, were cut, crushed with a motorized pestle and soaked in 0.3M NaOAc pH 5.2, and extracted RNA was ethanol precipitated with 20 mg glycogen. Samples were digested with RNase H (NEB) using an oligo complimentary to 2S rRNA and then digested with DNase I. Samples were acid:phenol extracted and ethanol precipitated with NH4OAc. 3' adapters (Custom: rAppTTTAACCGCGAATTCCAG/3ddC/) were ligated with T4 RNA ligase (NEB) (ATP was omitted if adenylated linkers were used), and samples were run on a 15% denaturing polyacrylamide gel and purified as before. Samples were precipitated, and 5' end labeled again with g-[32P]-ATP and T4 polynucleotide kinase. 5' adapters (Custom: tccgaaattaaccctcactaaaGrGrGrA) were ligated with T4 RNA ligase, and samples were run on a 12% denaturing polyacrylamide gel and purified and precipitated as before. Samples were reverse transcribed using Superscript III (Invitrogen) using a primer complementary to the 3'adapter (CTGGAATTCGCGGTTAAA) and PCR amplified using Pfu Ultra (Stratagene) using primers corresponding to the 5' and 3' adapters (FW: ATTAACCCTCACTAAAGGGA; REV: CATACGATTTAGGTGACACTATAG). When non-Illumina small RNA adapters were used, libraries were adapted to Illumina compatible ends by PCR amplification (FW: AATGATACGGCGACCACCGACGCTCTTCCGATCTCCGAAATTAACCCTCACTAA; REV: CAAGCAGAAGACGGCATACGACTGGAATTCGCGGTTAAA). Libraries were sequenced on the Illumina Genome Analyzer I or II platforms using commercial or custom sequencing primers (Custom: CGCTCTTCCGATCTCCGAAATTAACCCTCACTAAAGGGA).
For non-directional oligo-dT selected libraries, poly(A)+ RNA was selected using a MicroPoly(A)Purist column (Ambion), and 100 ng was cloned using the standard Illumina mRNA-seq v2.2 cloning protocol.
 
Submission date Jun 15, 2011
Last update date Aug 07, 2013
Contact name Ryan Dale
E-mail(s) dalerr@nih.gov
Organization name National Institutes of Health
Department National Institute of Child Health and Human Development
Lab Bioinformatics and Scientific Programming Core
Street address Rm 10D39, 10 Center Drive
City Bethesda
State/province MD
ZIP/Postal code 20892
Country USA
 
Platform ID GPL9058
Series (1)
GSE29991 Messenger RNA is a functional component of a chromatin insulator complex
Relations
BioSample SAMN00627836

Supplementary file Size Download File type/resource
GSM742257_EL5.filtered.nodups.bam 22.7 Mb (ftp)(http) BAM
Raw data provided as supplementary file
Processed data provided as supplementary file

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap