|
Status |
Public on Jun 01, 2023 |
Title |
Control, lung alveoli_H06 1 |
Sample type |
SRA |
|
|
Source name |
lung
|
Organism |
Mesocricetus auratus |
Characteristics |
tissue: lung tissue region: alveoli cell type: multiple cell types disease: SARS-CoV-2 infection treatment: Control slide id: H06_H017 roi number: 007 area: 149710.15
|
Extracted molecule |
total RNA |
Extraction protocol |
Samples were incubated with DNA-oligo barcoded RNA-ISH probes which were conjugated with a UV-photocleavable linker following standard ISH protocols, along with flourescently labeled antibodies for visualization of morphological structures. Regions of interest within the tissue were illuminated with UV light and oligo barcodes were physically aspirated from the tissue and collected into microtiter plates by the GeoMx® Digital Spatial Profiler (DSP) platform. For more information about DSP protocols please see Merritt et al. Nature Biotech 2020 (doi: 10.1038/s41598-020-63539-x) Each collection of oligo tags from one well (representing an ROI from the tissue section) was indexed with i7xi5 unique dual indexes using GeoMx SeqCode primers with 18 cycles of PCR. After PCR, indexed AOIs were pooled and purified in two rounds of AMPure XP PCR purification using 1.2x bead:sample ratio.
|
|
|
Library strategy |
OTHER |
Library source |
transcriptomic |
Library selection |
other |
Instrument model |
Illumina NovaSeq 6000 |
|
|
Description |
DSP-1012340078401-G-A08.dcc
|
Data processing |
save-interim-files=false quality-trim-score=20 2color-trimming=True adapter1=AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC adapter2=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT adapter-trim-match-length=10 adapter-trim-max-mismatch=3 barcode-max-mismatch=1 stitching-max-mismatch=2 dedup-hd=1 threads=4 Assembly: N/A, sequencing of synthetic tags and alignment to whitelist of RTS_IDs (probe barcodes) found in the config.ini output from the GeoMx DSP platform, see attached PKC file (Hs_R_NGS_WTA_COVID19_v1.0.pkc) Supplementary files format and content: Digital Count Conversion (DCC) file format outputted from GeoMx NGS Pipeline, contains software versions, scan attributes, GeoMx NGS pipeline parameters and output metrics, Q30 scores, and list of deduplicated counts per RTS_ID (probe barcode) Supplementary files format and content: Values represented in the collapsed target counts tab are the geometric mean of the probes for a given target--in the case that multiple probes were used-- and excludes any targets flagged as outliers. Analyzed counts represent the upper quartile normalized collapsed counts across the study after removing QC flagged segments and features. Library strategy: GeoMx Seq
|
|
|
Submission date |
May 29, 2023 |
Last update date |
Jun 01, 2023 |
Contact name |
Quan Nguyen |
E-mail(s) |
quan.nguyen@uq.edu.au
|
Phone |
61452358651
|
Organization name |
Institute for Molecular Bioscience
|
Street address |
22 Burns Street, Indooroopilly
|
City |
Brisbane |
State/province |
Queensland |
ZIP/Postal code |
4068 |
Country |
Australia |
|
|
Platform ID |
GPL28997 |
Series (1) |
GSE233642 |
In vivo inhibition of nuclear ACE2 translocation protects against SARS-CoV-2 replication and lung damage through epigenetic imprinting |
|
Relations |
BioSample |
SAMN35512803 |
SRA |
SRX20533455 |