 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Jan 26, 2024 |
| Title |
AGO IP, Dicer N1, SINV-GFP MOI 0.02 24 hpi, rep2 |
| Sample type |
SRA |
| |
|
| Source name |
HEK293T
|
| Organisms |
Homo sapiens; Sindbis virus |
| Characteristics |
cell line: HEK293T
cell type: Human embryonic kidney
genotype: NoDice FHA:DICER N1 #6
viral infection_conditions: MOI 0.02, 24 hpi
|
| Treatment protocol |
Cells were infected with a modified version of Sindbis virus expressing GFP (SINV-GFP) at an MOI of 0.02 for 24 h. Cells were maintained in Dulbecco’s modified Eagle medium supplemented with 10 % fetal bovine serum in a humidified atmosphere with 5 % CO2 at 37°C.
|
| Growth protocol |
NoDice FHA:DICER WT #4 or N1 #6 cells were plated in P150mm petri dishes at 25 000 000 cells per dish and infected the following day with SINV-GFP at an MOI of 0.02 for 24 h. Cells were maintained in Dulbecco’s modified Eagle medium supplemented with 10 % fetal bovine serum in a humidified atmosphere with 5 % CO2 at 37°C.
|
| Extracted molecule |
other |
| Extraction protocol |
Cells were collected in 1.3 mL of ice-cold lysis buffer (50 mM Tris-HCl pH 7.5, 150 mM NaCl, 5 mM EDTA, 1 % NP-40, 0.5 mM DTT, 0.1 U/mL of RNase inhibitor and protease inhibitor cocktail (complete Mini, Merck, Sigma Aldrich)). Cells were lysed by putting the extract on ice for 15 min. First, human AGO proteins were immunoprecipitated from whole extract to enrich for loaded small-RNAs. AGO-IP was done following the protocol described in (Hauptmann et al., 2015). Briefly, 50 µL of magnetic Dynabeads coupled to G protein (Invitrogen, Fisher Scientific) were coupled to anti-Flag M2 antibody (F1804, Merck, Sigma Aldrich) overnight at 4°C under rotation. The day after, Flag-TNRC6B WT or mutant (with Tryptophans mutated to Alanines; called TNRC6B Ala) peptides were incubated with the coupled beads for 3 h at 4°C under rotation. Meanwhile, lysates were cleared with a centrifugation step at 10 000 g for 10 min at 4°C and 100 µL were kept as INPUT (20 µL for proteins and 80 µL for RNAs). Then, lysates were divided in two and put on the beads coupled to the peptides and incubated at 4°C for 3 h under rotation. After 4 washing steps with 300 µL of ice-cold washing buffer, beads were split: 280 µL were eluted with 1 mL of TRI Reagent solution (Invitrogen, Fisher Scientific) and RNAs were isolated according to the manufacturer’s instructions
Illumina TruSeq small RNA library preparation kit was used according to the manufacturer’s protocol (RS-200-0012, Illumina).
|
| |
|
| Library strategy |
miRNA-Seq |
| Library source |
other |
| Library selection |
size fractionation |
| Instrument model |
Illumina HiSeq 4000 |
| |
|
| Description |
Homo sapiens and Sindbis-GFP virus
|
| Data processing |
Image analysis and base calling were performed using RTA 2.7.7 and bcl2fastq 2.20.0.422.
Sequencing reads of sRNA-seq libraries were processed and analyzed with the following workflow.
Cutadapt v1.16 was first run to trim the 3' adapter (command: cutadapt -a TGGAATTCTCGGGTGCCAAGG -e 0.1 --no-indels -O 6 -m 18 --discard-untrimmed -o <sample>-cutadapt.fastq <sample>.fastq) and an additional filter was applied to only keep 18- to 32-nt long trimmed reads for further analyses.
Sample quality checks were performed before and after these preprocessing steps using FastQC v0.11.8.
Preprocessed reads were then mapped simultaneously to the human (GENCODE Human (GRCh38.p13) release 41) and SINV-GFP (private sequence derived from NC_001547.1) genomes, using Bowtie v1.3.1. (command: bowtie -q --phred33-quals -v 2 -y -a --best --strata -m 30 -x hg38coreGencodeSINVGFP <sample>-preprocessed.fastq <sample>-hg38coreGencodeSINVGFP.bwtmap).
Only alignments from the lowest mismatch stratum with at most 2 mismatches were reported for each read, provided that their number was not exceeding 30.
For each library, small RNA reads deriving solely from SINV-GFP were computationally extracted and further characterized.
Furthermore, expressed human miRNAs (miRBase v22.1), among which known mirtrons, were also identified and quantified in each library using BEDTools v2.30.0 by comparing their genomic coordinates to those of the original aligned reads and by counting only reads overlapping miRs on at least 80% of their size (command: bedtools intersect -a <sample>-hg38coreGencodeSINVGFP.bwtmap.bed -b hsa-matmir.bed -f 0.80 -wa -wb -s). Multiple mapped reads were weighted by the number of mapping sites in other miRNAs, and the final counts obtained for each miR were rounded down before further analysis.
Differential miRNA expression analysis between the two AGO-IP conditions was then performed with the DESeq2 package by using an adjusted p-value < 0.05 and an absolute log2 fold change > 1 as thresholds to define statistical significance.
Assembly: GRCh38.p13 + private sequence derived from NC_001547.1
processed data files format and content: xxx-2mmMax-onlyViral-stats.txt: tab-delimited text files with properties of reads mapping only against the SINV-GFP genome in each sample
processed data files format and content: xxx-onlyViral-22nt-anyali-anymm-POS.norm.bw: bigWig files with the normalized distribution (per 100000 only viral reads) of 22-nt long only viral reads along the positive strand of SINV-GFP genome for each sample
processed data files format and content: xxx-onlyViral-22nt-anyali-anymm-NEG.norm.bw: bigWig files with the normalized distribution (per 100000 only viral reads) of 22-nt long only viral reads along the negative strand of SINV-GFP genome for each sample
processed data files format and content: hsa-matmir_rawcounts.txt: tab-delimited text file with our pipeline quantification of human mature miRs in each sample
processed data files format and content: hsa-matmir_deseq2_normcounts.txt: tab-delimited text file with DESeq2 normalized human mature miR counts in each AGO IP sample
|
| |
|
| Submission date |
Aug 29, 2023 |
| Last update date |
Jan 26, 2024 |
| Contact name |
Sébastien Pfeffer |
| Organization name |
CNRS - Institut de Biologie Moléculaire et Cellulaire (IBMC)
|
| Department |
UPR 9002 - Architecture et Réactivité de l'ARN
|
| Lab |
RNA regulation in viral infections
|
| Street address |
2 allée Konrad Roentgen
|
| City |
Strasbourg |
| ZIP/Postal code |
67084 |
| Country |
France |
| |
|
| Platform ID |
GPL33716 |
| Series (2) |
| GSE241797 |
The helicase domain of human Dicer prevents RNAi-independent activation of antiviral and inflammatory pathways |
| GSE241798 |
The helicase domain of human Dicer prevents RNAi-independent activation of antiviral and inflammatory pathways |
|
| Relations |
| BioSample |
SAMN37179220 |
| SRA |
SRX21497708 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM7743924_IPAGO-N1-SINV-Rep2-2mmMax-onlyViral-stats.txt.gz |
1.5 Mb |
(ftp)(http) |
TXT |
| GSM7743924_IPAGO-N1-SINV-Rep2-onlyViral-22nt-anyali-anymm-NEG.norm.bw |
33.0 Kb |
(ftp)(http) |
BW |
| GSM7743924_IPAGO-N1-SINV-Rep2-onlyViral-22nt-anyali-anymm-POS.norm.bw |
43.0 Kb |
(ftp)(http) |
BW |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data provided as supplementary file |
|
|
|
|
 |
