NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Sample GSM7757944 Query DataSets for GSM7757944
Status Public on Sep 06, 2023
Title RNAseq KO 3
Sample type SRA
 
Source name Thymus
Organism Mus musculus
Characteristics tissue: Thymus
cell type: Thymocytes
genotype: miR-181a/b-1 KO
Treatment protocol Thymocytes were isolated from mouse thymy using 70µm strainers and were immediately submerged in DPBS containing 0.1mg/ml cycloheximide.
Growth protocol Mice were grown to 6 weeks of age under SPF conditions.
Extracted molecule total RNA
Extraction protocol RPF samples were treated and RNA was isolated according to manufacturers instructions using the Illumina TruSeq Ribo Profile (Mammalian) kit.
Libraries were contrsucted using the Illumina TruSeq Ribo Profile (Mammalian) kit.
 
Library strategy RNA-Seq
Library source transcriptomic
Library selection cDNA
Instrument model Illumina NextSeq 500
 
Description RNA_masterframe.csv
RNAadjusted_countmatrix.csv
Data processing Total RNA reads were checked for quality using FastqC and adapters were removed using Flexbar (version 3.5.0/adapter sequence: "AGATCGGAAGAGCACACGTCT", options: --min-read-length 15 -ao 1).
rRNA was removed with Bowtie2 (version 2.5.1/options: --very-sensitive -x rRNA)
reads were aligned to the mouse genome (gencode M23) using STAR aligner (version: 2.7.10a /options: --outFilterMultimapNmax 5 --alignEndsType EndToEnd).
Reads per gene were counted using htseq-count (version 2.0.3/options: --stranded=yes) with default settings and GENCODE gene annotation (M23)
Differential expression analysis between miR-181 KO and WT samples was performed using DESeq2 (version 1.40.2)
Assembly: gencode.VM23
Supplementary files format and content: Htseq output as .txt table with gene names and counts
Supplementary files format and content: DEseq2 Output (KO vs WT) as .csv tables
 
Submission date Sep 05, 2023
Last update date Sep 06, 2023
Contact name Andreas Krueger
E-mail(s) andreas.krueger@immu.bio.uni-giessen.de
Organization name Justus Liebig University
Lab Molecular Immunology
Street address Schubertstr. 81
City Gießen
ZIP/Postal code 35392
Country Germany
 
Platform ID GPL19057
Series (2)
GSE242304 A high-resolution map of functional miR-181 target sites in the thymus reveals the role of coding sequence targeting and alternative seed binding
GSE242306 mouse thymocytes
Relations
BioSample SAMN37284033
SRA SRX21635920

Supplementary data files not provided
SRA Run SelectorHelp
Raw data are available in SRA
Processed data are available on Series record

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap