NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Sample GSM7776596 Query DataSets for GSM7776596
Status Public on Sep 22, 2023
Title FOSL2KD_4
Sample type SRA
 
Source name LSC_1099
Organism Homo sapiens
Characteristics cell line: LSC_1099
cell type: Limbal stem cells
genotype: WT
Treatment protocol siRNA treatment protocol
After reaching 70-80 % confluence, cells were transfected using Lipofectamin 2000 transfection reagent. For this purpose, 5 l Lipofectamin was added to 250 l Optimem and incubated for 5 minutes, at room temperature. In a separate tube, siRNA of interest was diluted in 250 l Optimem. The Lipofectamin was added to the siRNA mixture and incubated for 20 minutes, RT. After the incubation time, transfection mixture was added dropwise to the cells. The cells were incubated at 37°C and 5% CO2 and medium were changed after 24h. Cells were collected 48 hours after transfection for further analysis. FOSL2 siRNA 100 ng Sense: CGAACCUCGUCUUCACCUAtt Antisense: UAGGUGAAGACGAGGUUCGag Ambion. Ctrl siRNA for FOSL2 100 ng Catalog No. 4404021 Ambion. PAX6 siRNA 5 ng combination of two different siRNAs: 5′CCUGGCUAGCGAAAAGCAAUU 5′UGGGCGGAGUUAUGAUACCUU MWG Eurofins. Ctrl siRNA for PAX6 5 ng 5′AGGUAGUGUAAUCGCCUUGUU MWG Eurofins
Growth protocol Primary human limbal epithelial stem cells were isolated from healthy donors and cultivated in 6 well plates in KSFM medium (Cat. Nr. 17005042, Thermo Fisher, Gibco, Life Technologies, Paisley, UK) supplemented with 500 ng Epidermal growth factor (EGF), 12.5 mg Bovin pituitary extract (BPE) (Cat. Nr. 37000015, Thermo Fisher, Gibco, Life Technologies, Paisley, UK) and 0.1% P/S.
Extracted molecule total RNA
Extraction protocol Total RNA was isolated using the Quick–RNA MicroPrep kit, according to the manufacturer’s protocol. RNA concentrations were measured using the the DeNovix DS-11FX spectrometer.
500 ng of RNA was was prepared for sequencing using the KAPA RNA HyperPrep Kit with. Libraries were sequenced on the Illumina NextSeq 500, generating an average of 15–20 million reads per sample.
 
Library strategy RNA-Seq
Library source transcriptomic
Library selection cDNA
Instrument model Illumina NextSeq 500
 
Description FOSL2KD_4
Data processing Preprocessing of reads was done automatically with workflow tool seq2science v0.7.1
Paired-end reads were trimmed with fastp v0.20.1 with default options. Genome assembly GRCh38.p13 was downloaded with genomepy 0.11.1. The effective genome size was estimated per sample by khmer v2.0 by calculating the number of unique kmers with k being the average read length per sample. Reads of RNAseq samples were aligned with STAR v2.7.6a with default options. Afterwards, duplicate reads were marked with Picard MarkDuplicates v2.23.8. General alignment statistics were collected by samtools stats v1.14. Mapped reads were removed if they did not have a minimum mapping quality of 30, were a (secondary) multimapper or aligned inside the ENCODE blacklist. RNAseq sample counting and summarizing to gene-level was performed on filtered bam using HTSeq-count v0.12. Sample sequencing strandedness was inferred using RSeQC v4.0.0 order to improve quantification accuracy.
Assembly: GRCh38.p13
Supplementary files format and content: tab-delimited text files include gene count values for each Sample
 
Submission date Sep 12, 2023
Last update date Sep 22, 2023
Contact name Jo Huiqing Zhou
E-mail(s) jo.zhou@radboudumc.nl
Organization name Radboud University
Street address Geert Grooteplein 26/28
City Nijmegen
ZIP/Postal code 6525GA
Country Netherlands
 
Platform ID GPL18573
Series (2)
GSE206924 Multi-omics analyses identify transcription factor interplay in corneal epithelial fate determination and disease
GSE242990 Multi-omics analysis identifies coordination and hierarchy of transcription factors controlling specific epithelial cell fates in corneal epithelium [Bulk RNA-seq]
Relations
BioSample SAMN37365663
SRA SRX21761663

Supplementary data files not provided
SRA Run SelectorHelp
Raw data are available in SRA

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap