NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Sample GSM8157311 Query DataSets for GSM8157311
Status Public on Mar 25, 2024
Title Tumor tissue, rep5 [A4796392ZL]
Sample type SRA
 
Source name lung
Organism metagenomes
Characteristics tissue: lung
tissue type: Tumor tissue
Stage: IA
nicotine exposure: no
Treatment protocol The tissues obtained after surgery were quickly rinsed with sterile physiological saline, then immediately frozen in 2ml eppendof tube with liquid nitrogen, and then transferred to a -80 degree freezer for storage.
Growth protocol All of the samples were selected from patients, who have signed informed consent forms.
Extracted molecule genomic DNA
Extraction protocol The Zymo Research BIOMICS DNA Microprep Kit (Cat # D4301) was used for microbial gDNA purification. The integrity of gDNA was detected by 0.8% agarose gel electrophoresis, followed by nucleic acid concentration detection using Tecan F200 (PicoGreen dye method).
Use specific primers with a Barcode full-length of 16S to amplify the designated region of the sample, The primer information is as follows:(8F: 5’AGAGTTTGATCATGGCTCAG3’; 1492R: 5’CGGTTACCTTGTTACGACTT3’). Each sample undergoes 3 replicates, and each PCR reaction terminates at the linear amplification stage. After PCR, the PCR products of the same sample were mixed and subjected to electrophoresis detection. The PCR products were cut and recovered using a gel recovery kit, and the target DNA fragments were washed and recovered using TE buffer. The PCR recovered products were detected and quantified using Qubit 2.0 (Thermo Fisher, Inc., USA), and after passing the quality control, the Nanopore R9.4.1 library kit was used for machine library construction.
 
Library strategy OTHER
Library source genomic
Library selection other
Instrument model MinION
 
Description A4796392ZL
Data processing *library strategy: Full length 16s rDNA
The raw data obtained from sequencer were filtered by qcat and NanoFILT tools to obtain high-quality target sequences for subsequent analysis.
Assembly: SILVA
Supplementary files format and content: tab-delimited text files include OUT for each Samples
Supplementary files format and content: tab-delimited text files include tax
Supplementary files format and content: tab-delimited text files include grouping information
 
Submission date Mar 20, 2024
Last update date Mar 25, 2024
Contact name shuaifeng wang
E-mail(s) shuaifeng.wang.moss@gmail.com
Organization name The First Affiliated Hospital of Zhengzhou University
Street address No.1 Jianshe East Road, Erqi District, Zhengzhou City, Henan Province
City Zhengzhou
State/province Henan
ZIP/Postal code 450001
Country China
 
Platform ID GPL34320
Series (1)
GSE262090 Unveiling microbial dynamics in lung adenocarcinoma and adjacent nontumor tissues: Insights from nicotine exposure and diverse clinical stages via Nanopore Sequencing Technology
Relations
BioSample SAMN40559413
SRA SRX24006084

Supplementary data files not provided
SRA Run SelectorHelp
Raw data are available in SRA

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap