|
Status |
Public on Mar 25, 2024 |
Title |
Tumor tissue, rep32 [A4739028ZL] |
Sample type |
SRA |
|
|
Source name |
lung
|
Organism |
metagenomes |
Characteristics |
tissue: lung tissue type: Tumor tissue Stage: IA nicotine exposure: no
|
Treatment protocol |
The tissues obtained after surgery were quickly rinsed with sterile physiological saline, then immediately frozen in 2ml eppendof tube with liquid nitrogen, and then transferred to a -80 degree freezer for storage.
|
Growth protocol |
All of the samples were selected from patients, who have signed informed consent forms.
|
Extracted molecule |
genomic DNA |
Extraction protocol |
The Zymo Research BIOMICS DNA Microprep Kit (Cat # D4301) was used for microbial gDNA purification. The integrity of gDNA was detected by 0.8% agarose gel electrophoresis, followed by nucleic acid concentration detection using Tecan F200 (PicoGreen dye method). Use specific primers with a Barcode full-length of 16S to amplify the designated region of the sample, The primer information is as follows:(8F: 5’AGAGTTTGATCATGGCTCAG3’; 1492R: 5’CGGTTACCTTGTTACGACTT3’). Each sample undergoes 3 replicates, and each PCR reaction terminates at the linear amplification stage. After PCR, the PCR products of the same sample were mixed and subjected to electrophoresis detection. The PCR products were cut and recovered using a gel recovery kit, and the target DNA fragments were washed and recovered using TE buffer. The PCR recovered products were detected and quantified using Qubit 2.0 (Thermo Fisher, Inc., USA), and after passing the quality control, the Nanopore R9.4.1 library kit was used for machine library construction.
|
|
|
Library strategy |
OTHER |
Library source |
genomic |
Library selection |
other |
Instrument model |
MinION |
|
|
Description |
A4739028ZL
|
Data processing |
*library strategy: Full length 16s rDNA The raw data obtained from sequencer were filtered by qcat and NanoFILT tools to obtain high-quality target sequences for subsequent analysis. Assembly: SILVA Supplementary files format and content: tab-delimited text files include OUT for each Samples Supplementary files format and content: tab-delimited text files include tax Supplementary files format and content: tab-delimited text files include grouping information
|
|
|
Submission date |
Mar 20, 2024 |
Last update date |
Mar 25, 2024 |
Contact name |
shuaifeng wang |
E-mail(s) |
shuaifeng.wang.moss@gmail.com
|
Organization name |
The First Affiliated Hospital of Zhengzhou University
|
Street address |
No.1 Jianshe East Road, Erqi District, Zhengzhou City, Henan Province
|
City |
Zhengzhou |
State/province |
Henan |
ZIP/Postal code |
450001 |
Country |
China |
|
|
Platform ID |
GPL34320 |
Series (1) |
GSE262090 |
Unveiling microbial dynamics in lung adenocarcinoma and adjacent nontumor tissues: Insights from nicotine exposure and diverse clinical stages via Nanopore Sequencing Technology |
|
Relations |
BioSample |
SAMN40559359 |
SRA |
SRX24006130 |