NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Sample GSM825355 Query DataSets for GSM825355
Status Public on Mar 15, 2013
Title K562_mRNA_Rep2
Sample type SRA
 
Source name K562 cells
Organism Homo sapiens
Characteristics cell line: K562
Extracted molecule polyA RNA
Extraction protocol Total RNA was isolated from cell lysates using RNeasy kits (Qiagen). mRNA was extracted from total RNA using MicroPoly(A)Purist™ kits (Ambion) and treated with DNase I using the Turbo DNA-free™ kit (Ambion). First-strand cDNA was synthesized from 400-700 ng mRNA using High Capacity RNA-to-cDNA kits (Applied Biosystems). Tag-Seq sequencing libraries were generated directly from 12% of a cDNA reaction or 50 ng plasmid DNA by 26 cycle PCR using Pfu Ultra HS DNA polymerase 2x master mix (Agilent) and primers AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT and CAAGCAGAAGACGGCATACGAGATXXXXXXXXGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTCGAGGTGCCTAAAGG (where XXXXXXXX is a library-specific index sequence). The resultant PCR products were size-selected using 2% agarose E-Gel EX (Invitrogen).
 
Library strategy OTHER
Library source transcriptomic
Library selection cDNA
Instrument model Illumina HiSeq 2000
 
Description Motif-centered mutagenesis of ENCODE enhancer predictions, reporter mRNA, replicate 2
Data processing To infer the tag copy numbers in each Tag-Seq library, all sequence reads were examined, regardless of their quality scores. If the first ten nucleotides of a read perfectly matched one of the 55,000 designed tags and the remaining nucleotides matched the expected upstream MPRA construct sequence, this was counted as one occurrence of that tag. All reads that did not meet this criterion were discarded.
 
Submission date Nov 01, 2011
Last update date May 15, 2019
Contact name Tarjei S Mikkelsen
Organization name Broad Institute
Street address 7 Cambridge Center
City Cambridge
State/province MA
ZIP/Postal code 02142
Country USA
 
Platform ID GPL11154
Series (1)
GSE33367 Systematic dissection of regulatory motifs in 2,000 predicted human enhancers using a massively parallel reporter assay
Relations
SRA SRX104055
BioSample SAMN00749821

Supplementary file Size Download File type/resource
GSM825355_K562_mRNA_Rep2_counts.txt.gz 473.2 Kb (ftp)(http) TXT
SRA Run SelectorHelp
Raw data are available in SRA
Processed data provided as supplementary file

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap