|
| Status |
Public on Sep 25, 2024 |
| Title |
WT_Input1_rep1 |
| Sample type |
SRA |
| |
|
| Source name |
blank sample
|
| Organism |
blank sample |
| Characteristics |
screening library: Human Transporter KO (Addgene #213695)
|
| Treatment protocol |
Cells were transduced with lentiviral particles containing KO library in triplicates and selected with blasticidin to remove non-transduced cells. After 13 days of selection, each replicatewas independently was passaged in standard growth media for a total of five weeks. Samples were harvested for NGS analysis 3 to 7 weeks after transduction.
|
| Growth protocol |
HCT116 (RRID:CVCL_0291) cells and HCT116 KO clones were cultivated in RPMI 1640 (R8758 Sigma) supplemented with 10% Fetal Bovine Serum (10270-106, Lot 42F8381K, Gibco) and Penicillin-Streptomycin (15140-122, Gibco).
|
| Extracted molecule |
other |
| Extraction protocol |
Genomic DNA was purified using QIAamp DNA Mini columns (Qiagen)
gDNA was digested overnight with 20U PacI (NEB) and double size-selected to enrich the sgRNA containing fragments (380 bp). Briefly, 0.7 x vol AmpliClean magnetic beads (Nimagen) were added to the sample to bind large gDNA fragments; the cleared supernatant was added to fresh beads (0.6 x volume of the original gDNA sample) to bind the smaller fragments. After size selection, sgRNA sequences were amplified in with Q5 Polymerase (NEB) using the program recommended by the manufacturer (28 cycles, 65°C annealing temperature). PCR products were further double size-selected to remove residual large gDNA fragments as described above. Purified PCR products were used in barcoding PCRs to add Illumina adapters and indices for pooled sequencing. A detailed protocol can be found on Addgene (https://www.addgene.org/pooled-library/human-transporters/).
|
| |
|
| Library strategy |
OTHER |
| Library source |
other |
| Library selection |
other |
| Instrument model |
Illumina HiSeq 4000 |
| |
|
| Data processing |
read trimming (Galaxy Version 4.8+galaxy1): options: g- GTGGAAAGGACGTGTCACCG…GTTTAAGAGCTA --overlap 10 --discard_untrimmed
gRNA mapping: MAGeCK count (Galaxy Version 0.5.9.2.4).
Assembly: GRCh38.p13
Supplementary files format and content: tab-delimited raw gRNA count table
Library strategy: Amplicon-Seq
|
| |
|
| Submission date |
Sep 20, 2024 |
| Last update date |
Sep 25, 2024 |
| Contact name |
Giulio Superti-Furga |
| Organization name |
CeMM Research Center for Molecular Medicine of the Austrian Academy of Sciences
|
| Street address |
Lazarettgasse 14
|
| City |
Vienna |
| ZIP/Postal code |
1090 |
| Country |
Austria |
| |
|
| Platform ID |
GPL27787 |
| Series (1) |
| GSE277685 |
Identification of essential transporter genes in the colorectal carcinoma cell model HCT116 by focused CRISPR/Cas9 KO screens. |
|
| Relations |
| BioSample |
SAMN43846707 |
| SRA |
SRX26142878 |
