NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Sample GSM958134 Query DataSets for GSM958134
Status Public on Jan 01, 2013
Title Control C2L0
Sample type genomic
 
Source name Rumen content
Organism Bacteria
Characteristics treatment: Control
sample type: cow rumen content
diet: acidogenic
Treatment protocol Whole rumen, liquid fraction (filtered through 0.2 mm) and solid fraction (recovered on the thieve after filtration) was sampled 4h after feeding for 2 days at the end of each period. Sample were frozen at -80 and freeze-dried.
Extracted molecule genomic DNA
Extraction protocol DNA was extracted using Qiagen Stool kit, amplified with 63F and 109R (with Bsg1 restriction site), purifed with phenol/chloroform/ethanol extraction, digested with Bsg1, concatenate, gel purified, inserted in Puc19 and clone in TOPO10.
 
Description Sanger sequencing method
Data processing Base-calling and vector sequence trimming were done using Sequence Analysis software (© Beckman Instruments, Inc.)
RSTs were separated using head-tail border 5’-ACGGGTCG-3’ or the complement 5’-CGACCCGT-3’ created by concatemerization using BioEdit = Raw data
Blast filtering to remove Chimera (95% seq ID over 90% sequence length)
Cluster sequences at 100% sequnece identity (CD-Hit-est) and count unique Tags = Processed data
Tab delimited file of the count of unique tags (100% sequence ID) after blast filtering to remove Chimera: tag sequence, count, tag ID.
 
Submission date Jul 09, 2012
Last update date Jan 01, 2013
Contact name Eric PINLOCHE
E-mail(s) epp@aber.ac.uk
Organization name IBERS
Street address Cledwyn Building
City Aberystwyth
ZIP/Postal code SY233DD
Country United Kingdom
 
Platform ID GPL919
Series (1)
GSE39206 The effects of a probiotic yeast on the bacterial diversity and population structure in the rumen of cattle.

Data table header descriptions
TAG RST sequences (5'->3')
COUNT Frequency of each RST
RST_ID ID of ribosomal sequence tags (RSTs)

Data table
TAG COUNT RST_ID
CGAACGAAGCACCCTCATCCGTGGAAGGGCGTAGCTTGCTACAAACGGACACACCCGAGGGTGACTGAGTGGCGGACGGGT 1 C2L0_10359
CGAACGGAACATTCCACCCGATGAAGAAAGAAGCTTGCTTCGGACTGATTCAACCGGAATGTTTAGTGGCGGACGGGT 1 C2L0_10344
CGAACGGAGTGGTTCTCCCGAAGGCCTGAAGAGCTTGCTCAGATGGAATTCATTTGAATCACTTAGTGGCGGACGGGT 1 C2L0_10350
CGAACGGAGTGGTTCTCCCGAGGATTGACGGTGCTTGCACCTGATTGACTCATTTGAATCACTTAGTGGCGGACGGGT 1 C2L0_10351
CGAACGGAGTGGTCCTCCCGAAGACCTGAAGAGCTTGCTCAGATGGAATTCATTTGGATCACTTAATGGCGGACGGGT 1 C2L0_10352
CGAGCGGGGACATGCGACGGATAGGAAGTTTTCGGATGGAATTGAAGATGTATGTTCTAGCGGCGGACGGGT 2 C2L0_10342
CGAGCGGGGACATGCGACGGAGACGAAGTTTTCGGATGGAGTCGAAGATGCATGTTCTAGCGGCGGACGGGT 1 C2L0_10333
CGAGCGGAGACATACGACGAAGCGGAAGTTTTCGGATGGAAGCGGAGATGTATGTTTTAGCGGCGGACGGGT 1 C2L0_10336
CGAGCGGAGACATACGACGGATTTGAAGTTTTCGGATGGAGATGAAGATGTATGTTTTAGCGGCGGACGGGT 1 C2L0_10337
CGAGCGGAGACATGCGACGAAGCGGAAGTTTTCGGATGGAAGCGGAGATGCATGTTTTAGCGGCGGACGGGT 1 C2L0_10338
CGAGCGGGGACATGCGACGGAGTCAAAGTTTTCGGATGGAGACGAAGATGTATGTTCTAGCGGCGGACGGGT 2 C2L0_10340
CGAGCGGAGACATACAGCGGATAGGAAGTTTTCGGATGGAATTGAAGANGTATGTTTTAGCGGCGGACGGGT 1 C2L0_10341
CGAACGGGGATATACTGATCAGCGAACTTCGGTTCAACGAATGGTATATTCTAGTGGCGGACGGGT 1 C2L0_10307
CGAACGGAGAATTTACGCTGATGAAGCTTCGGCAGATTCTTGTAAATTCTTAGTGGCGGACGGGT 1 C2L0_10286
CGAACGAAGCAATCAAGACAGAATCCTTCGGGAGGAAGATTTGATTGACTGAGTGGCGGACGGGT 1 C2L0_10292
CGAACGAAGCATTTGGAGCTGATCTCTTCGGAGTGACGCACCTTATGACTTAGTGGCGGACGGGT 4 C2L0_10321
CGAACGAAGCATTTGGAGCTGATCTCTTCGGAGTGACGCGCCTTATGACTTAGTGGCGGACGGGT 1 C2L0_10312
CGAACGAAGCACTTTGTTACGATCCCTTCGGGGTGACGACTTTGTGACTGAGTGGCGGACGGGT 2 C2L0_10308
CGAACGGGGATTATTGGAATGAGAGCTTCGGCANGATTTCTGGTAATTCCAGTGGCAGACGGGT 1 C2L0_10299
CGAACGAAGCTCGATCCTCGGAGATTTCGGTCAAAGAGGAAAGATGACTTAGTGGCGGACGGGT 2 C2L0_10314

Total number of rows: 488

Table truncated, full table size 14 Kbytes.




Supplementary file Size Download File type/resource
GSM958134_C2L0.txt.gz 2.7 Kb (ftp)(http) TXT
GSM958134_C2L0_raw.txt.gz 4.0 Kb (ftp)(http) TXT
Processed data included within Sample table
Processed data provided as supplementary file

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap