#ID = Agilent feature number
#COL = Column
#ROW = Row
#NAME = NAME
#SPOT_ID = Locus tag
#CONTROL_TYPE = Control type
#CHROMOSOMAL_LOCATION = Chromosomal Location
#SEQUENCE = Sequence
ID	COL	ROW	NAME	SPOT_ID	CONTROL_TYPE	CHROMOSOMAL_LOCATION	SEQUENCE
1	96	164	GE_BrightCorner		pos		
2	96	162	DarkCorner		pos		
3	96	160	DarkCorner		pos		
4	96	158	psma_tiling_029_F		FALSE	unmapped	TTGATGTGAGGTGAGTCTTGTTAGTTTGTTGCAAATAAATGGTCTTGGTTTTTTGTATAG
5	96	156	MW2_CDS_10197	MW1922	FALSE	unmapped	TCCTGTATGTTACTGATACGAAGTATCTGAAATACAAATTTAACGGCATTACACACATGA
6	96	154	MW2_CDS_03839	MW0702	FALSE	unmapped	TGAAGTAAAAGGCGCGATTAAAAATCACATTATGCCAATGATTGAAAAGCAAATTACCGA
7	96	152	MW2_CDS_13720	MW2591	FALSE	unmapped	TGGTGAAGAAGCTTTTGAAGTCGTAATTGAAGCAATTAAAGGTGACAAAAAAGCATTTGT
8	96	150	MW2_CDS_05374	MW0996	FALSE	unmapped	GGAAGTCAAACGTTTGTAAACATTGGCGGTATTTCGGCAACAATTCCATTAACTGGTGTG
9	96	148	MW2_CDS_01886	MW0345	FALSE	unmapped	AGAGACCTTTAAATGAAAACCAAGTTCGTATAAATTTAGAAGGAACATACAGAGTTGCTG
10	96	146	MW2_CDS_06979	MW1303	FALSE	unmapped	ATTCTACAGATGTGGCCAAAGGTTATGATGTGCCAATATTCCATGTCAATGCAGATGACG
11	96	144	MW2_CDS_04525	MW0836	FALSE	unmapped	TGATGGAATAACATTCCACCGTGTCATTAATGACTTCATGATTCAAGGTGGCGATCCAAC
12	96	142	MW2_CDS_03712	MW0680	FALSE	unmapped	TGTGGGAGGCGGATTTGAATTAGATGCATGGTTAGGATCTAACTCAACCGACTTTAATGT
13	96	140	MW2_CDS_06098	MW1133	FALSE	unmapped	GCGTAATCCAGCAAACCCATTTACAACTTCTACATTACAACAAGAGGCGGCACGTAAATT
14	96	138	MW2_CDS_03609	MW0661	FALSE	unmapped	GTACTGCCACGGCATTTGATGAGGACTTAGCAACACGGGACGCTATAGAAAAAATAAAAT
15	96	136	MW2_CDS_03790	MW0693	FALSE	unmapped	TGACATGGTTGCAAACCCAAATGTTGAGAAAAAGAAAAAGAATGCGCGTGAAATGTTGAA
16	96	134	MW2_CDS_12256	MW2319	FALSE	unmapped	AAGAAGCCATTTCAGGCGTAAAACAAAGTGTTGTCATTCAAGTAGCGAAAGAATTTGCGC
17	96	132	MW2_CDS_03026	MW0556	FALSE	unmapped	TGCTATGCGAATCTAAAATCATCAATAAAAACCCCCAATATAGAATTATTAAATATAATG
18	96	130	MW2_CDS_02203	MW0407	FALSE	unmapped	TTTGGTAGTTTATTAAGTATTTGGGTGGCGCGTCATCGATACTCTAAGGGTTTTGCGGTA
19	96	128	agr_tiling 209_R		FALSE	unmapped	ACACTGTTTTATAAATGAATTATTTAAAATGCTTGTTCAACCTCTTGTAATGTTGGCAAA
20	96	126	MW2_CDS_12059	MW2284	FALSE	unmapped	GCCAAATGGACTTATACGTATGTATCTTAAAGATGCACACTACACCTATTCTTCTAGACG
21	96	124	MW2_CDS_08119	MW1528	FALSE	unmapped	AGTTGAACAAGCGACGCAACTAGTGAATTCAGGATATAAGGAAATTGTATTGACGGGAAT
22	96	122	NC_A_106		FALSE	unmapped	AGACATGAGATTATTTTTTTAAATCTATATAAAGTTGACAATACAAATCGATATTGAGAA
23	96	120	MW2_CDS_03585	MW0657	FALSE	unmapped	TGATGTACACATTGAAGCACCAATTTATATGGCTATAGGTGTTTCATTAGCAGGTGTTGT
24	96	118	psma_tiling_056_F		FALSE	unmapped	GCACAAGATAACTATGTACAATGAAGTTAACTCATAAGCAAAGGAGGTAATCTTAATGGG
25	96	116	MW2_CDS_11866	MW2249	FALSE	unmapped	GCAGCAATTGCGTATGCTAAAGAAGGTGCAGATGTAGCGATTAACTATCTTCCGAGTGAA
26	96	114	MW2_CDS_00847	MW0157	FALSE	unmapped	TGGTCGAATCATTACAGCTATTGGCTACAGCGGATGTGAAATTGATCCTAACTGCACATA
27	96	112	MW2_CDS_05784	MW1076	FALSE	unmapped	ACGAAGTTGTTAGCACCAATCTTAGTGCATACAGCTGAAGAAGTTTGGTCTCATACACCA
28	96	110	MW2_CDS_07334	MW1370	FALSE	unmapped	TTTCGGTGAATATCCACCGGCACAAGATCGATGTTGTGACAATGATTCTAATATAACTGA
29	96	108	MW2_CDS_01724	MW0314	FALSE	unmapped	TTTGCGACTGAAGCGCCTGGATTTACTATTGATACACCTCTTGAACAATTAGGAAGTCAA
30	96	106	MW2_CDS_08147	MW1533	FALSE	unmapped	AGGTGTACAAATGGTGCATGAAAGTTTGATTAACGCACTAAAAGATAATGGTCTTGAAGT
31	96	104	MW2_CDS_13017	MW2463	FALSE	unmapped	TGAAAATGCTAAAAACGTTGGCTTTGTTCCGAATACTGTAGCGCAAATTTCACAATGGCA
32	96	102	MW2_CDS_02372	MW0439	FALSE	unmapped	TGTTCAAGGGGAAAACAGTATCTTGAAATTTCTTGAAGAACCACCGGACAATACGATTGC
33	96	100	MW2_CDS_06067	MW1128	FALSE	unmapped	AAACATTTTCGGTGGCATTATGAAATGTGATGTTATCGCAGAAGGTATTGTTGAAGCTGT
34	96	98	MW2_CDS_08274	MW1556	FALSE	unmapped	GAATACAAGTTGAACATACTGTTACAGAGATGCGAGCAGAACGTGATTTGGTTGCAGCAC
35	96	96	agr_tiling 124_R		FALSE	unmapped	TAAAGATTGAAGCAATTAATAATGAAATGCGCAAGTTCCGTCATGATTATGTCAATATCT
36	96	94	MW2_CDS_06333	MW1175	FALSE	unmapped	GTAAAGAACGAAGCCGCAGACCTGAAGACATTATAGATGAAGTACGTGAACTTGCTCGTG
37	96	92	MW2_CDS_11663	MW2210	FALSE	unmapped	TGTTTCAAGTTTAACTCAAAATGCTGTTCGTGCTATTCCACTTGGACAAACTGCTGGTCA
38	96	90	MW2_CDS_09303	MW1748	FALSE	unmapped	ACAGCTGGTATAAGATCTGTTGATGATTTTCAATTTGATACCGATATTTCTTATACAGAT
39	96	88	MW2_CDS_13011	MW2462	FALSE	unmapped	TTTTCTTCATACCGTCAGTTGTAGGTATTATGGATGTTGCTTCCGAAATTACGCTAAATT
40	96	86	MW2_CDS_03111	MW0572	FALSE	unmapped	ACATGGTTAGCACGACATCATTTCAATTATCAAGAGATTAATGAGCGATATAAAGGTGGA
41	96	84	MW2_CDS_07975	MW1502	FALSE	unmapped	AAAATACATTTTACATAAAATGAAGAATTTTAATAAAGCTGAAAAGCGAAAAGCAGACAC
42	96	82	MW2_CDS_06170	MW1145	FALSE	unmapped	TCCAGCTCAACAAGCAGGATTACAAAAAGGTGATAAGATCGTCCAAATTGGCAAATATAA
43	96	80	MW2_CDS_02720	MW0502	FALSE	unmapped	GAAGCTATCCGCCAAGCTACTACTAACGTAGAATTCTACCCAGTACTTTGTGGTACAGCT
44	96	78	MW2_CDS_05735	MW1067	FALSE	unmapped	AAAGCAGAATTGAATTGTTTACGACAGATGGACTTCAAGTAATCGGTGATATTTCGACGA
45	96	76	perR_tiling_029_R		FALSE	unmapped	TAATATTGCTTGTCTTTGAGGTGTAATTCTTACGCCTGCTTGTCGCAATGATGCAATTGA
46	96	74	MW2_CDS_10853	MW2049	FALSE	unmapped	CGCTTCAGCAAAAGCAGTTCGTGACGTTTTAAATAACGACAAAGAAGTTTACGATCCTCG
47	96	72	MW2_CDS_04886	MW0900	FALSE	unmapped	TTGGTCAATAAAAGATTTATTGATGAAGGTAAAACTATTGATGTTTATTTATTCGAAGCA
48	96	70	MW2_CDS_12090	MW2289	FALSE	unmapped	TCAATTGTAACGGTTGATTATACTGGACAAGCAATGGTTACTGATCCAAACTACCAACAA
49	96	68	MW2_CDS_00556	MW0104	FALSE	unmapped	TGCCCCGACAAAGCATCAATTTGTTATGATTGCAAGATTTGCTTATCCAAAATTGCCACA
50	96	66	MW2_CDS_00164	MW0031	FALSE	unmapped	TAATTGGCAAATCCGGTACTGCAGAACTCAAAATGAAACAAGGAGAAACTGGCAGACAAA
51	96	64	MW2_CDS_11419	MW2163	FALSE	unmapped	GAGCTGACATCGCTCGTGCTGAACAATATTCAGAAGGAACTGTTCCACTTCATACGTTAC
52	96	62	agr_tiling 208_F		FALSE	unmapped	TTGAACAAGCATTTTAAATAATTCATTTATAAAACAGTGTAGGAAACAAGTTGAATCTTG
53	96	60	MW2_CDS_05752	MW1070	FALSE	unmapped	TAGGCACAAATATAGACACTTTAACTGATGCGCTTCATGGTATTGATGCGATGTACACAT
54	96	58	MW2_CDS_07010	MW1309	FALSE	unmapped	AGCTAATGCCAATAGGTATACATTTGTGTGGAAGAAAAGTATTCCAAATCACGAATCGAA
55	96	56	MW2_CDS_13366	MW2529	FALSE	unmapped	AGGACAAGAAGAAACATTCGAGCAAAAATTTTTGCGACGTAATAAGCATTTAAAAAACGT
56	96	54	MW2_CDS_04850	MW0894	FALSE	unmapped	CGTTCCATGGCAGTGGTTATCAATTTGATCCTACTTTCTCTGGCGTAGGTTCGTACTTTA
57	96	52	MW2_CDS_12778	MW2418	FALSE	unmapped	AGGATTTAATAAGGAAAGAGACTACATAAAATATCAATGGGCTCCAAAATATAGCAAAGA
58	96	50	MW2_CDS_11822	MW2242	FALSE	unmapped	TTCTATTACGACGGTCTCTACGTTGCTAGCGCCATTCGTTACACCTGCGTTAATATATCT
59	96	48	MW2_CDS_11389	MW2156	FALSE	unmapped	TAAATTATGCCGTATTTGTTTCCGTGAATTAGCTTACAAAGGCCAAATCCCTGGCGTTCG
60	96	46	MW2_CDS_09864	MW1851	FALSE	unmapped	AATAGCTCAATTGTTATTGAAATATTTATACCAAATGATAATAAAATACTACTAACAATT
61	96	44	MW2_CDS_03000	MW0552	FALSE	unmapped	TGGCTAATGACTATAAAACCTCAAAATCTACTGGTATTTATTATGTGGATTATTATTACA
62	96	42	MW2_CDS_05931	MW1103	FALSE	unmapped	AATCAAGCGCCAAAAGGATACATTGCAAATCAAAGTGTAACCGCAAATACTGAAATCGCT
63	96	40	MW2_CDS_12304	MW2329	FALSE	unmapped	AGTAGACGTATCAATCACGAACATAGATTGGTTTATACAGTAGATGACAATCATATAAAA
64	96	38	MW2_CDS_01041	MW0192	FALSE	unmapped	TTACTTCGATACGATTCCAAAAGAACTTGATGAATCTGCCAAAATTGATGGTGCAGGGCA
65	96	36	MW2_CDS_00759	MW0141	FALSE	unmapped	TTTACATCGAGGCTACACGCTACAACAGAAAATTAAAATTTTAATTAGCTTATACATTGT
66	96	34	MW2_CDS_01735	MW0316	FALSE	unmapped	GCAGGCTGATGTGATTTTTATTGGTTTTCCAATTTTTCAAGCTTCCATCCCTGGTGCTTT
67	96	32	MW2_CDS_04151	MW0760	FALSE	unmapped	GGCAAGCATCAAACAGTTACAACTAAAAGTGTTTCTACAGATAAAAAAATGGTTACCGCA
68	96	30	MW2_CDS_09762	MW1833	FALSE	unmapped	ATCCTGCAGGAATGAATGCAAGTTTATCAGTTGGTGAACAATTAGAAGGCGAAAAAGTGT
69	96	28	MW2_CDS_07406	MW1384	FALSE	unmapped	AACAAGCGTAATGAGATAATTTCATACGCTATCATTGGTGGCTTTGAAGAAGGTATTGAT
70	96	26	MW2_CDS_12868	MW2435	FALSE	unmapped	ATGGTGGCTTTTCAAAAGCTTATCAGTCAACAACTGGCATTGCAGGCTATACACTATTGT
71	96	24	MW2_CDS_11320	MW2140	FALSE	unmapped	TTGAACAAGGTAAATATTACGCCATCGTTGGACAAACGGGTAGTGGTAAATCAACATTGA
72	96	22	MW2_CDS_13744	MW2595	FALSE	unmapped	ACGGAGTTAGTAGAAGAATTTTTTAGAGCGGTCGTAATCAATGCAAGATTAACAACGCAT
73	96	20	MW2_CDS_03726	MW0682	FALSE	unmapped	TGGTGTTGTTGGGCCAAATGGAGCTGGTAAAACAACACTCTTAAATATTTTGAGTGGAGA
74	96	18	MW2_CDS_00603	MW0112	FALSE	unmapped	TGTATGTGTGAATCCAACACATGTTAAATATGCAGCAGAGCGACTAGCTGATTCAGAGGT
75	96	16	MW2_CDS_11065	MW2092	FALSE	unmapped	ACTTGGGGAATTACCTTTAGAGCAACCATCTTGGAATCCAAAAGATTTTGCACCGTCAAT
76	96	14	MW2_CDS_00908	MW0167	FALSE	unmapped	TGGCTTAAATGTCAGGTTATTACATGAAACGCATTTACTTGTGTCAACATTTGCGACGCA
77	96	12	MW2_CDS_11753	MW2228	FALSE	unmapped	AGATGATGCAAAACTATTAGATGCTTTAAATGGTGCAATTCGAGGACGTCAAGTCATCAT
78	96	10	MW2_CDS_13765	MW2599	FALSE	unmapped	TGAGGAACGTAATTTATCGGGACTGGTTACATATTTGTCGACTGAACATCCAATCGTGCA
79	96	8	agr_tiling 028_F		FALSE	unmapped	AACCATGTAAAATTAGCAAGTGAGTAACATTTGCTAGTAGAGTTAGTTTCCTTGGACTCA
80	96	6	DarkCorner		pos		
81	96	4	GE_BrightCorner		pos		
82	96	2	GE_BrightCorner		pos		
83	96	163	GE_BrightCorner		pos		
84	96	161	DarkCorner		pos		
85	96	159	MW2_CDS_08813	MW1655	FALSE	unmapped	ACAAAAGAAAAAATCGGGTGAAACAAAGCCAGTTGAAGTATTATTGGCAAATATTCCTGA
86	96	157	MW2_CDS_04663	MW0860	FALSE	unmapped	GAATTATTAAGAGAAGGAGATATAAAGTTTGAAGAAATAAAAGAAAGACTAGGTACAGGT
87	96	155	MW2_CDS_11833	MW2244	FALSE	unmapped	GAAGACAAAGCTGCGTATTACCTCGACGGTTTAGGCGGCAAAGAAAATATCAAAGATGTT
88	96	153	MW2_CDS_00300	MW0058	FALSE	unmapped	GGCGCAGCTATTCGTAAGCAAGCACCTATCGTCGCTAATAATTTATTGCAAGTGATGAAT
89	96	151	MW2_CDS_10878	MW2054	FALSE	unmapped	ATAACGCTTTATTACGCAAAGTTGTGGAAGATTATACTGTGTTACGCGGTTGCAAACCGT
90	96	149	MW2_CDS_05758	MW1071	FALSE	unmapped	ACCATCAGATGCGGTGATCCATTTTATAGGATCATTACAATCTCGAAAAGTTAAGGGCGT
91	96	147	MW2_CDS_12536	MW2372	FALSE	unmapped	GGTGTCGTAAGAGCACTTGCGGCCGAACAAGATATTATTTTAATGGATGAACCTTTTGGT
92	96	145	MW2_CDS_05743	MW1068	FALSE	unmapped	TAGGTGCATGTGTCATTGATATTGGTGAAGACGTTACGCAAGTTGCTTTTTATGAACGCG
93	96	143	MW2_CDS_04785	MW0882	FALSE	unmapped	TGAAATGCCTTATGAAGAAGCTAAAGAGTGGATGTTAAAAGCTTTAGAACCAATGGGTGA
94	96	141	MW2_CDS_07919	MW1492	FALSE	unmapped	AAGAAGGGGGTAACTATAGGGAAGTATGATATTAAGCAAAGTGACCAACAAATTTGTGCT
95	96	139	MW2_CDS_00613	MW0114	FALSE	unmapped	TGGCCCAGGTTCATTTTCAGGTGTATTAGCTTTAGGTATCCATTCTGTAGGTATGCTTGG
96	96	137	MW2_CDS_08134	MW1531	FALSE	unmapped	ATGTTAACAATCCCTGCTGGTACACAAACAGGTAAGCAATTCCGCTTAAAAGAAAAGGGT
97	96	135	MW2_CDS_04804	MW0886	FALSE	unmapped	TGATGGTAAAGCGTATGCTTATCTCATTTTCGTACAAGAAACATGGACGATGTTGCATGA
98	96	133	MW2_CDS_11915	MW2258	FALSE	unmapped	ACCAATGGTCGATTGAATACGAAGCAGTTGCATCAGAAGACACATTGTTTAGTCCTACGA
99	96	131	MW2_CDS_02905	MW0535	FALSE	unmapped	TGTCATGGTTTGTAAAGGCGAAGATGAAGTGCTTAATCCTGGAAATACTGAGGCGATGAT
100	96	129	MW2_CDS_06771	MW1265	FALSE	unmapped	TTTGAGCGTTTAGATCCACATAAGCTGGCCAGTTGTATTGATGTTGCAAATATCGACACG
101	96	127	MW2_CDS_10701	MW2021	FALSE	unmapped	CGCACAAATATTTGAAAAGGAGGATAGAAAAATTGCAACGTTTTGTGTTGCAACGCACCG
102	96	125	MW2_CDS_07501	MW1403	FALSE	unmapped	ATCTTTGTCAAATGTGTTTACGCGAAGATATTGTAACAGATGCAAACATTGTACATCACA
103	96	123	MW2_CDS_00043	MW0008	FALSE	unmapped	GGAACTACAGCTGCTAGACATGGTTATCAAATTATTGAAAATGCAAGACGTGTGCTGGCA
104	96	121	MW2_CDS_04937	MW0910	FALSE	unmapped	CAAAGAGATATTGAATCTAAGCGGTTGCTTACATCAATTGGTGTTGGTATTATTACAGCA
105	96	119	(+)E1A_r60_n11		pos		
106	96	117	MW2_CDS_02861	MW0526	FALSE	unmapped	TGGTTCAGGTTCCACGGAACATTTAAGATTATTAGCAGACAAAGCAAAATCAGTAGGTGC
107	96	115	MW2_CDS_03455	MW0633	FALSE	unmapped	TCATGTACTGCTTTAATAAAATTAATGCAAAGGCTCAAAAAAATCATCAAAAGCCACAAA
108	96	113	MW2_CDS_12291	MW2326	FALSE	unmapped	TTATATATTTTCACAACACTACTATCTTCTATTTCAGTAACGTCAAAATGTGTACCTAAT
109	96	111	MW2_CDS_02572	MW0475	FALSE	unmapped	AGTTGAATATTACTGTACAACGAAACTCATTCGGTAGACAAGTTGACAGCTTTGAAACAG
110	96	109	MW2_CDS_01474	MW0271	FALSE	unmapped	GAGTTAGAAAAGGAGCGTTTGCTTTTGTTGTAATAAGGCCAATATTATTCAGTTGTTGGT
111	96	107	MW2_CDS_11757	MW2229	FALSE	unmapped	CAAGCATCCTAGTGAAATTATGGATGAAGTAGCACGCTTAACACCTCTATATGCTGGGGT
112	96	105	MW2_CDS_09731	MW1827	FALSE	unmapped	TCAGAGTTGAATAAAGTTGAAGCATATTATGCACAAATTGAAACTCAAATTCAACAAACT
113	96	103	MW2_CDS_13814	MW2608	FALSE	unmapped	ATCAATCCTGAAACGAAGGAAATCAAACGACCTTTTGTAAGCCATAAAGCGAATCCTGCA
114	96	101	MW2_CDS_00991	MW0184	FALSE	unmapped	GCAACGTTTCAACGTAATCCAGGATTCAACGAAACAGAAAAAGGTAGTTATGGACCAGCT
115	96	99	MW2_CDS_13398	MW2535	FALSE	unmapped	TGGCGAACGTGCATTAGAAGTATTGAAAACTGCTTCAATACTGGCAAGTGTGCCATTAAT
116	96	97	MW2_CDS_09215	MW1729	FALSE	unmapped	GAGCACCGTTCTTCCCGTTACACCCTACTGTTTACGCTGATTTATTAGGTGAACTTATCG
117	96	95	agr_tiling 080_R		FALSE	unmapped	ATTACATTACTACCAATATACTATTCAAAGGAGGACTAAATTATGAAAAAATTACTCAAC
118	96	93	MW2_CDS_00797	MW0148	FALSE	unmapped	ACTGGGTGGTCATTGTATCGCAATATATTATTTCCCGGGGCATTTAAACAAATCATGGCT
119	96	91	MW2_CDS_08084	MW1522	FALSE	unmapped	ACTGAAGCGGATGAAAAGGAAATGTTTGGTCGACAAGATACAATATTAAACGCATATGGA
120	96	89	MW2_CDS_10828	MW2045	FALSE	unmapped	TCCACCAAGTGGTCGTACATTATCAGGTGGTTTAGATCCTGCATCTTTACACAAACCAAA
121	96	87	MW2_CDS_00228	MW0043	FALSE	unmapped	TATCGACGCTTTTCAGAAGAGTAGGATATTCAGAAAAAGCTGGATCTGGAGGACCAAGGA
122	96	85	MW2_CDS_06848	MW1279	FALSE	unmapped	TACCATGGGAAGATTTACCAAAAGTGAAATCACTATGGCCACAACCTGGTGATCATTTGC
123	96	83	MW2_CDS_05522	MW1023	FALSE	unmapped	GATCAGTTCGCAAAACGCGAAGTGTATAACCATTACGCATTATCCGATATACCACTTCCA
124	96	81	MW2_CDS_08647	MW1628	FALSE	unmapped	ATGCCTAAATTACAGGTGAAATCTCCTGCTACATCATCTTCGACGGGCAAATCTTCAGAA
125	96	79	MW2_CDS_03059	MW0562	FALSE	unmapped	TGACATTCAACTTGATAAAAAATTAGTTATTGCCATATGTTGCATCACATTTATAGGGAT
126	96	77	MW2_CDS_13787	MW2603	FALSE	unmapped	GCATCATTGAGACAAACATCGCTATTTGAAATGGCCGAATATATAGGGATTAGCGAGCCA
127	96	75	MW2_CDS_03327	MW0611	FALSE	unmapped	ACGCAGGTGGCGGATTTGCAATCGCATTATTTATTGCAATTGGTAAAATTAATGCTGACA
128	96	73	MW2_CDS_09531	MW1790	FALSE	unmapped	GATGAAGATTTAGAGTTGCTAGAGTCTGTCGCATTTCAATTAGGGTCAGCCATCAAACGT
129	96	71	MW2_CDS_02166	MW0399	FALSE	unmapped	AAGGAGAAAGAGGATGAGACTTTTATGAGTGATTTTTTGAACTTCGGACCATCACATAGT
130	96	69	MW2_CDS_10296	MW1943	FALSE	unmapped	AGACGATGTCGATGGCTTAATTATTGCTGAACCAACTGGATCTGGAATTTATTATGCACA
131	96	67	(-)3xSLv1		neg		
132	96	65	MW2_CDS_06216	MW1154	FALSE	unmapped	ATACGCGTCATCTGTGGTAAAGGTACATATATTAGAACGCTAGCAACTGATATTGGTGTG
133	96	63	MW2_CDS_09926	MW1861	FALSE	unmapped	ACGTATCAGTCATTGGATGAAGCAATAGCCTTTATTCACCAAAGACCAAAACCTTTGAGT
134	96	61	MW2_CDS_04981	MW0921	FALSE	unmapped	GTTGACCGAAATAAGTGGTTGAAATCAAGGGGGATTATCGCAAGTGAAAGTATGGCAGAA
135	96	59	MW2_CDS_05477	MW1015	FALSE	unmapped	AACTAAATCCGGCGAATTCAGAATCGTACCAACAACTGTTGCATTGACAATGACATTGGA
136	96	57	RC7		pos		
137	96	55	MW2_CDS_12375	MW2343	FALSE	unmapped	CCAGACAGTGAGTTACCACCTCTTGTACAAAGTGGATTTAACCCTTCATTTATCGCCACA
138	96	53	MW2_CDS_11599	MW2198	FALSE	unmapped	TGGATTTCTGGCTTCGGAAGGTGCCATTTTAAAGCGAGATGAATTAAAATCTGTGCTGAT
139	96	51	MW2_CDS_04421	MW0815	FALSE	unmapped	ATTCTTCCCAACGATTTCATCTGGACCAATCGATCGTTACAAACGTTTCGTTAAAGACGA
140	96	49	MW2_CDS_08592	MW1618	FALSE	unmapped	AGAAGTGATTAAGCGCCGTCTTGGTGAAAAAGTTATTGGTTTCTCAAGCAATGAAGCTGA
141	96	47	MW2_CDS_04338	MW0798	FALSE	unmapped	CGACTAACATTTGATATAGAAGACGGCATTATAAAAGATGCTAAGTTTGAAGGTGAAGGT
142	96	45	MW2_CDS_01715	MW0313	FALSE	unmapped	TAATGGCCAACATCGTCTTAGGTGCTGTAGTTGATAAATTCGGATGGGATGTCGGTTTTA
143	96	43	MW2_CDS_05695	MW1060	FALSE	unmapped	GACAAGACCATTAATGGAAGAATGGTTATTTAACACGGTGGCATTTGTTGGAGGACCGAG
144	96	41	MW2_CDS_11355	MW2148	FALSE	unmapped	TGTCTGAGCTTGACAGAAACATTGATGCTGTCATCAATATCGAAGTTCCGGAAGAAGAAT
145	96	39	perR_tiling_050_F		FALSE	unmapped	ATAAATATAGGACGAGGTAGCATAGTTAAAGAAGCGCTCTTAATAGAAGTATTAAAAAGT
146	96	37	MW2_CDS_05219	MW0966	FALSE	unmapped	TTAAGTAAAAATGAAATGACTGAACTTGCTAACCGTGCAGTCGACTGTGCAACGCAAGAA
147	96	35	MW2_CDS_12169	MW2303	FALSE	unmapped	GACGTCCCTCACGGTTTAATGATGAAAATTCATGACATGGGCAAAATGCACATGAAACAC
148	96	33	MW2_CDS_01928	MW0355	FALSE	unmapped	AAGCAACTCATGCACGTAATCATTTACGTCTATGGTCATTGCAAGGTCATCGTGACATTC
149	96	31	MW2_CDS_09522	MW1789	FALSE	unmapped	AGAGCATGAGCACCCTGATATTGTGCTATTAGATTTAGTGATGCCTGGCATGAATGGTAT
150	96	29	MW2_CDS_02558	MW0473	FALSE	unmapped	AACGCCTTCCCATCAATTTCCAACTGGATATGTGATGGACTTAAAAAAGCGAACTCAATT
151	96	27	MW2_CDS_11557	MW2191	FALSE	unmapped	AGGGTCACGTGGTTTTAAAGCGGGGCATACAGTAGATATTATATTGACTGAATCTGACGC
152	96	25	MW2_CDS_11542	MW2188	FALSE	unmapped	TTGTTTGAACGTTATCCGCAAATCAATAATAAAAAGTTTCAAGTTGCTGTAAATGAGGAA
153	96	23	agr_tiling 054_F		FALSE	unmapped	TCTAAGTTATTTCTCTTTTGAAGATACGTGGCAAACTGGTCAATTTTATTATCAAAATAA
154	96	21	NA		ignore		
155	96	19	NC_A_088		FALSE	unmapped	ACCTTCTGACTAAAGCTGTAGTAACTATACTAGAACGTCTAGTTCATAAACACGTTTCAC
156	96	17	MW2_CDS_06093	MW1133	FALSE	unmapped	GCTATGGTAAGTTCATGGCTTGCTCAAACTTCCCGGATTGTCGTAATACAAAAGCGATAG
157	96	15	MW2_CDS_05573	MW1033	FALSE	unmapped	AATAGACTCTGGTGTCGGAGGTTTGACAGTAGCTAAAGAAATTATGCGTCAGTTGCCAAA
158	96	13	MW2_CDS_13116	MW2483	FALSE	unmapped	CGCCGATTTTAAGTGATCATGAAACACATCAGACATACGATGTCGCAAGAAGACTTGGTG
159	96	11	agr_tiling 021_R		FALSE	unmapped	TTTTTCAATCTATTTTTGGGGATGTTATTAATTATGAAAAAAATTTTATTTATCAAATAA
160	96	9	MW2_CDS_10532	MW1988	FALSE	unmapped	ATGGCGAAAGAGTCGAAATCAGCTAATGAAGTTTCACCTGAGCAAATTAACCAATGGATT
161	96	7	MW2_CDS_06391	MW1186	FALSE	unmapped	GCGCGCTATTGAATATTATTTAAAAACAAAAAAACTTTTGAGTAATCGCAAGAAAGTGCA
162	96	5	DarkCorner		pos		
163	96	3	DarkCorner		pos		
164	96	1	GE_BrightCorner		pos		
165	95	164	DarkCorner		pos		
166	95	162	DarkCorner		pos		
167	95	160	MW2_CDS_04072	MW0742	FALSE	unmapped	TGGCATCATGATTAAGGGTACTGGCGAAGATATTCATCCAACAACACTTCAAAAGGTTCA
168	95	158	agr_tiling 003_F		FALSE	unmapped	TTTCGGGCGCTTCTTATTTATACAAATCTAATTTAATACTTTTAAATATAGGTATATTTT
169	95	156	MW2_CDS_03743	MW0685	FALSE	unmapped	AGACCGTAACAATGCATCGTTGATATTATTAGGTGCAATTCCAGCAGCCTTATTGGCAAT
170	95	154	MW2_CDS_01820	MW0332	FALSE	unmapped	TACAGCAATCAATCGTTCACTACAACAAATCGACCGCTCATTATTCTGGGTAAACCCTGA
171	95	152	MW2_CDS_03070	MW0564	FALSE	unmapped	TGTTTGGTGGGAGTAGACCAAACGGTAATACTGCACAATTAACAAAATTCGCTTTGCAAG
172	95	150	MW2_CDS_05985	MW1113	FALSE	unmapped	AAATCATTAGGTGCAAAACGTGTCATGCCTTTAGCAGTATCTGGTCCATTCCATTCATCG
173	95	148	perR_tiling_042_R		FALSE	unmapped	CTAGATTGTTTTTAAAAATATCTAATAAGTCATACTTTGCCTCATAATCATTACCAGTTA
174	95	146	MW2_CDS_04837	MW0892	FALSE	unmapped	AGAAGGTGGTAGCATTGTTGCAACAACATATTTAGGTGGCGAATTCGCAGTTCAAAACTA
175	95	144	MW2_CDS_06198	MW1151	FALSE	unmapped	TGTAAGAGTTACAAAGTTCCATTCAGAAAGTTTGGAAATCGAAATGAATTGGGAATAGCA
176	95	142	MW2_CDS_05722	MW1065	FALSE	unmapped	AACCCTGCTAAAGTGTTTATGGGAGATACAGGTAGCTTAGCTTTAGGTGGTATATTTGCT
177	95	140	MW2_CDS_11143	MW2105	FALSE	unmapped	ATCCCTTTGCAAATTATGATGATTGAAAAAGACCATGTTGTGTGCACAGCTATGGATGGT
178	95	138	MW2_CDS_03738	MW0684	FALSE	unmapped	TGGATTAGAACCTGAAAAATATAAAAACAGAAAACCTGATGAATTGTCAGGGGGGCAACG
179	95	136	MW2_CDS_03494	MW0641	FALSE	unmapped	GGCATTGGATTATTTGCTGTAGAAGATAAAGAGTCCCATCAATGGATAGGCTTTATAGGT
180	95	134	MW2_CDS_05301	MW0982	FALSE	unmapped	AGAAATATTAATGAAATGAGTGGCGGACAAAAGCAACGTGTTGCAATTGCACGTGCTATC
181	95	132	MW2_CDS_09649	MW1811	FALSE	unmapped	ACTTTAGCCTCAGGTACTATTTTAGGCTTAGCATTGATGATGTTGCTCATTTTCAATAAT
182	95	130	MW2_CDS_13599	MW2571	FALSE	unmapped	TTTTTTGAAACTGTTTGGTCATGTTTGGCTCGTCGAACGTTGGATGGAAGACGATATCAA
183	95	128	MW2_CDS_13762	MW2598	FALSE	unmapped	GTTAAGAATCGCCATAGCCAAAGGACGTCTAATGGATAGTTTAATTAACTATTTAGATGT
184	95	126	MW2_CDS_12083	MW2288	FALSE	unmapped	GCGATCTTACCAGAAGAGGCGCTTGTTGCACCAAAGTATCTTAGTGCTCAAGACTTAATT
185	95	124	MW2_CDS_07374	MW1377	FALSE	unmapped	TGTAATGGCTTGAACGAAAATGAAGGACAAGCAATTCAAACGATGGATCAATCTGCCTCT
186	95	122	NC_S_066		FALSE	unmapped	AGTCATGGGTACATTTAATGTTTTTTGATTCAAACTTCCATTTTGGTCAATTTGCTTTTT
187	95	120	MW2_CDS_10180	MW1919	FALSE	unmapped	AGTTGTTGGAATAAAAGAAACAAAATTTAATGGTCGTCGTTGGTATTTAGACGATTATGA
188	95	118	MW2_CDS_08898	MW1670	FALSE	unmapped	CGTTCTTCAAACAGATGCTGCTATTAACCCAGGTAACTCAGGTGGCGCATTAGTAGATAT
189	95	116	MW2_CDS_01691	MW0308	FALSE	unmapped	GACATTTTGTCAACAACACGCATCATTGTAAAAGAACAAGTAAATGATTGGACTGAAGCT
190	95	114	MW2_CDS_07488	MW1400	FALSE	unmapped	ACAGTACTATGAAGAAAACGGTGGAATATTATTCCAAGAGCCTGGTGTTGAAATCGAACC
191	95	112	NC_S_021		FALSE	unmapped	ACATAATAAATTGAACATCTAAATACACCAAATCCCCTCACTATTGCCCTAGTGAGGGGA
192	95	110	MW2_CDS_01709	MW0312	FALSE	unmapped	AGCTAAGAAAACACCGACTAAAGCAGGGTATTTTGTTACATGTTGGACAAAAGACGAGAA
193	95	108	MW2_CDS_03383	MW0621	FALSE	unmapped	ACAATGGGATTTTAATGTTGCTGGTATTGAAGATTTCGGCAAAGTAATGGATACATTTGA
194	95	106	MW2_CDS_01438	MW0264	FALSE	unmapped	AAGCACAGCAAAGGACGTACAAACTGCAAAAACTAGTGCTAATAAGGACAGTGTAACTGT
195	95	104	MW2_CDS_10618	MW2004	FALSE	unmapped	GCACTTCGTCCACCTCATCGTAAAGAAGTACTTCAAGCACGTGAAGATGACATCAAAGAA
196	95	102	MW2_CDS_09337	MW1754	FALSE	unmapped	CAGCGCATACTGAAAGCGGAAACTCTGGATCACCTGTATTAAACAGCAACAACGAATTAG
197	95	100	MW2_CDS_10747	MW2030	FALSE	unmapped	GCTGACGTATTCAAGGCGTTCCAAAGCTTATATAACGGACACTACAATCAAGATTTTGCA
198	95	98	MW2_CDS_06591	MW1231	FALSE	unmapped	GTTTTTTATGGCGACCGGTGCATTGATGTACGTCGTTCCATATTTTAGGCTAACAGGATC
199	95	96	MW2_CDS_04756	MW0877	FALSE	unmapped	TGGCAGCAAAATCAATTGGTACACCCACATATAAAATTATTTTGAAACATCTTTTGCCGA
200	95	94	MW2_CDS_01309	MW0240	FALSE	unmapped	CAATGACTGGCAAACCCTTTGATTCGTCTGACATCGTATTTCATTATCGTCATGCACAGT
201	95	92	MW2_CDS_07280	MW1360	FALSE	unmapped	ACTGCTTCAATGGAAAATGTTAAACTTGTTCATGGTGATGCAATGGAATTGCCGTTTGAA
202	95	90	MW2_CDS_02098	MW0387	FALSE	unmapped	TGTAGATGGTCTGTATAGACAACATTTAACTGATAAAGGTGCATATGTATGGAAAAATCT
203	95	88	MW2_CDS_08356	MW1571	FALSE	unmapped	TTTTTGTGAAACGTGAAAACGACCATGCACTACGTGTTACTTTTGCTGAGCCAGTAAGAG
204	95	86	MW2_CDS_12473	MW2361	FALSE	unmapped	TGAAGAATGGGCAATAATAGGACATACAGGTTGGTATGATTATAGCTTTGCAGCACAACG
205	95	84	MW2_CDS_12253	MW2319	FALSE	unmapped	ATTCTGTGAGAGCGAATCGTCCACGTATTGATACAGCACGTAATGTAGCTGATGCAATAC
206	95	82	MW2_CDS_03500	MW0642	FALSE	unmapped	ATTTGTCATGGCTCCTGGTGGCGCAGGTTCACTAGAAGAATTTTTCGAAATGTATAGTTG
207	95	80	MW2_CDS_11002	MW2080	FALSE	unmapped	AATTTTTAGAAAAATGGGCTGGCGTACCAACTGAAGTACACGTTGCATCAGAGTTTGTCT
208	95	78	perR_tiling_070_R		FALSE	unmapped	TCATCTAAAATGAAAGCTAAAATGTATTCAGATAATTGTTTAGCTTGAACACCTTTTCCA
209	95	76	MW2_CDS_08028	MW1512	FALSE	unmapped	TTCGTTAAATAACCGATTAACGACGGTAAGTCGATTTTTAAAACAAGGTACAATCGCGGA
210	95	74	MW2_CDS_09830	MW1845	FALSE	unmapped	TTAGTACGTATTGAAGGCGAAGTAGCACTTCGTTGCATTAATCCAAAATGCCAAGCACAA
211	95	72	MW2_CDS_08907	MW1672	FALSE	unmapped	ATGGCGCTAATATTTCCGGAATTGCATCCGCTTCATATAGTTTGTTTGGTATTCCACCAA
212	95	70	MW2_CDS_08107	MW1526	FALSE	unmapped	AGCATAACAACGCTCGGTGATAATTTGCTATTTATGCTTGCGAATGTTATCGTTGCCTTG
213	95	68	MW2_CDS_11025	MW2085	FALSE	unmapped	TGAGCCATTTTACGAATGGGTTGTTGAAAAAGATGCATGGTATGGCCCAGAACTAAATCA
214	95	66	MW2_CDS_10417	MW1967	FALSE	unmapped	CTCGGTGTATTAGATTTCGCTGGAGGTACGGTTGTTCATATTACATCAGGTGTTTCTGGT
215	95	64	MW2_CDS_06179	MW1147	FALSE	unmapped	CGTTAAAGGATGTACAGGTGTTAAACGTACAACTGGACAGCATCCAGGGGGTATTATTGT
216	95	62	MW2_CDS_00806	MW0150	FALSE	unmapped	TGAGATGGAAAGTCTTGTAGGCGCTAAGTTTGTAAAATTATTTACAGATATTGATTTGAA
217	95	60	MW2_CDS_01179	MW0217	FALSE	unmapped	TCGATGCTCAAATTATTGGTGAACATGGTGACACTGAATTACCAGTATGGTCACACGCTA
218	95	58	perR_tiling_016_R		FALSE	unmapped	CTTTCAATTTCATTTAACTGTGGATATTGAAAATCAACAATCTTACCACATTGTTCACAT
219	95	56	MW2_CDS_00943	MW0174	FALSE	unmapped	AGCTGAAAGAACAGAAGAAATTGCGATACGACGTGCATTTGGTGCAAAAAGTCGAGATAT
220	95	54	MW2_CDS_04184	MW0765	FALSE	unmapped	CGAGTGCAGTGGTTTCTGGGGAGAAGAATCCATATGTATCTGAGTCGTTGAAACTGACTA
221	95	52	MW2_CDS_04122	MW0754	FALSE	unmapped	ACATACATTAAAGATAAGTTAGCTACTAACGGTATTGAGCTATCACTTAATGGCAGTAGT
222	95	50	MW2_CDS_11446	MW2169	FALSE	unmapped	CTTCATTCGTGAATTCCGCAATGTAGACGTGGATGCTTACGAAGTAGGTCAAGAAGTCTC
223	95	48	MW2_CDS_13850	MW2615	FALSE	unmapped	GCCGGGGCAAAACGTATTCCACTTTCGTTAATAGGATTTATTCAATACGTTGGACCAACA
224	95	46	MW2_CDS_12856	MW2433	FALSE	unmapped	AGATGAACCAATGAATGGCTTAGATCCAAAAGCTGTGCGAGATGTTCGTGAATTGATTGT
225	95	44	MW2_CDS_05438	MW1007	FALSE	unmapped	ACGCTTAACTTCAATGAATAAAAAGTTGAACAATGAAATTGAAACGTTATATATGATGTC
226	95	42	MW2_CDS_05998	MW1115	FALSE	unmapped	AGACGCTGATAAAGTAACTGAAGATGCATCTTTCAAAGATGATTTAGGCGCTGACTCACT
227	95	40	MW2_CDS_12248	MW2318	FALSE	unmapped	TGCAGATCGAGTTCATGAAGCGGCTTCAGCAGTAGACGAGAAAGATTTATACGAAAAACA
228	95	38	MW2_CDS_13071	MW2474	FALSE	unmapped	ACGAGTTATAAAGACAAAAAAAGCATTGTCGAGTAGCTTGCTACAATTGTTAGAACAGCA
229	95	36	MW2_CDS_05708	MW1062	FALSE	unmapped	TGTAAACAGGTGTTCCAAGAATATGAAAAAGGTCCAGAGGTACCAAGAGGATTACCAGTT
230	95	34	MW2_CDS_01787	MW0326	FALSE	unmapped	AGCGACTTGTAGATGAAGAGGTAGATATCGATGCAACAGATCAATATGAATTGCTTGCGA
231	95	32	MW2_CDS_11745	MW2226	FALSE	unmapped	TCTTGTTAGCCATGCATTAGTAGAAACAGGTAACGGCAAATCAGAATTAGCAAAAGGCAT
232	95	30	MW2_CDS_01026	MW0190	FALSE	unmapped	ATTCCTGAAATGCGACAAGTTTGGGAACCGATGGGCAATGCAAGCATATTTATTTCAAAT
233	95	28	MW2_CDS_13353	MW2526	FALSE	unmapped	ACAGGTATCCCTGAAAGTAAACATTTGGGTGGATTCCCTATCAGTGGTCAATTCTTAGCT
234	95	26	MW2_CDS_12530	MW2371	FALSE	unmapped	GTGTATGTAATTAGTTGGGCTACACTTGCAAGTTATGTAGGTGCGGGTGGATTAGGTGAT
235	95	24	MW2_CDS_00077	MW0014	FALSE	unmapped	ATTGCGCATGGTTCAGACGATAAAATTTATCATCCAGTAACAGTTGCACAAGCAGCAGAT
236	95	22	MW2_CDS_09492	MW1783	FALSE	unmapped	TCTCATCATGGTAAGTTAGAGTATGGTTCGCCAAAACTGCCATACTTAAAAGAAGCAGAA
237	95	20	MW2_CDS_07747	MW1461	FALSE	unmapped	AGTGAAAGCTCAAGGTGGAGATGTAGACGCTTTACTTGCGAAATATAAAGATGAGAACCG
238	95	18	MW2_CDS_04430	MW0817	FALSE	unmapped	CCGTACACATCGGTTGGAAAGGTTGGGTTTATATGGATGAGCAAATTGCGAAACATATGA
239	95	16	(-)3xSLv1		neg		
240	95	14	MW2_CDS_10898	MW2057	FALSE	unmapped	GGAGCTGCGATACAGACTGGTTGTGATTATGAATTTGGTCGAATTCAAAACGGTGTGAAT
241	95	12	MW2_CDS_08299	MW1561	FALSE	unmapped	GAATATTACGCCGTTTAACACGAGATACTAAAGAGCGTGGGCGTTCAATGGACTCTGTTA
242	95	10	NC_S_051		FALSE	unmapped	AAAACACCCAGTGACATGCTTGGGTGAACAAGGATAGATGTAAATAGTTGATGCATGTGT
243	95	8	MW2_CDS_06324	MW1174	FALSE	unmapped	TGGAACTTGAATGTCCAAGTATTATTAGCCAAGTTAAGTTTTATCATGTGCCAGATGGCA
244	95	6	MW2_CDS_06176	MW1146	FALSE	unmapped	TATAGCCGTATTTTTGAGAGAGTTGGCATTAACGCAAGACCAGTAGTTGCAGATTCAGGT
245	95	4	DarkCorner		pos		
246	95	2	DarkCorner		pos		
247	95	163	DarkCorner		pos		
248	95	161	MW2_CDS_06223	MW1155	FALSE	unmapped	ACGATGATAAATCGCGTGCTAAATATTTATTAGCAGTTGATTTTGGTGATGAAGTAGCTT
249	95	159	MW2_CDS_09509	MW1786	FALSE	unmapped	TGATTATGCAAATCAATTAGAACAAGCTTTAAGAGAAAGCGAAGAATACAAAGCAATCAA
250	95	157	MW2_CDS_08925	MW1676	FALSE	unmapped	TGGGCGAAAAAAGTATACGGTTTAACGGTGTTAGATACTTGGTGGATGACAGAAACAGGT
251	95	155	MW2_CDS_06972	MW1302	FALSE	unmapped	AAGATATTGATAAGAAACAACAGGCACCGGCATCAACACAAACAACACAACAAGCATCTG
252	95	153	perR_tiling_035_F		FALSE	unmapped	TATTGACACGCGCGCAATACTACAGTTATATTTATAGTAAGTAATAATAATTATTATATA
253	95	151	MW2_CDS_11859	MW2248	FALSE	unmapped	TTTTTGATTTTAGCATTAGCTTTTGGAATAGCGACTGTTTTTCCTGAACAAAAATTACCA
254	95	149	MW2_CDS_03604	MW0660	FALSE	unmapped	ATTCAAGCGAAAGATATCATTGTGGTAACCAATGGTTTAACACATGTAGAAGCTTTACTT
255	95	147	MW2_CDS_10046	MW1887	FALSE	unmapped	GGGTAGCGATATTGTCAGCTATCTTTTTATTTGCTCAAAACATCGCCAAAGCTATTGGGT
256	95	145	MW2_CDS_00394	MW0074	FALSE	unmapped	TGTGGCATACAATCCTGCTCCGTTAGAAGTAAAAAGCATTCGTAATAAATTTGGTAGTCA
257	95	143	MW2_CDS_00443	MW0084	FALSE	unmapped	AACCTGGTAAAGAAGACGGCAACGGAGTACATGTCGTTAAACCTGGTGATACAGTAAATG
258	95	141	MW2_CDS_10645	MW2010	FALSE	unmapped	AGAAGATGTCTATTGTGATGATGTCCTTACGCAAATAAGAGCGACACGTTCGGCGTTAAA
259	95	139	MW2_CDS_00855	MW0158	FALSE	unmapped	CATTGCGGGTCAAGATGTATCAGTCATATTTACACCACATCTCGTACCAATGACACGAGG
260	95	137	MW2_CDS_13539	MW2561	FALSE	unmapped	TCAGACTCGTTGTGAAGCAAAAGCAAAATCCAGTTCAAGCACATCATCATATGGACACTG
261	95	135	MW2_CDS_09437	MW1773	FALSE	unmapped	GGTTGGCAATCTGAAGGTAATACAGGTACACCTTGGTTAGGGCCAGATGTACAAGATTTA
262	95	133	MW2_CDS_10526	MW1987	FALSE	unmapped	GTACAATTCATCATTGTCAATGAAGCGGGCGCTTCAGTATACTCAGCATCAGAAATTGCT
263	95	131	perR_tiling_085_R		FALSE	unmapped	CGCATACGATTCAACCCAACAACTTTCATATATGTCACCCCAAAATGTTTTTAAGTTCTT
264	95	129	MW2_CDS_04744	MW0875	FALSE	unmapped	AAATCCCAAACATCCATATACAAAAGCGTTGATTTCATCAATACCACAAATTGATAAACA
265	95	127	MW2_CDS_01706	MW0311	FALSE	unmapped	TGGACATCATATGGTCGGACTATTTACTACTGATCAAGACATCGTTGAGATGGCGACATT
266	95	125	MW2_CDS_03046	MW0560	FALSE	unmapped	CCCACTTTAAAGAGTCTTTGTTTATCAATAGTTTTATATATTTATTTAGGTGGTGGTTCA
267	95	123	MW2_CDS_00085	MW0016	FALSE	unmapped	CGTTCTTATACCGTGATGATTACTATAACCGTGGCGGCGATGAAGATGATGACGATGATG
268	95	121	MW2_CDS_06783	MW1267	FALSE	unmapped	GACAATGCTGTGTTACCGATTTTCCAACACCCTTTAACTAGCTTTAACCCTGATTGGACG
269	95	119	MW2_CDS_08149	MW1533	FALSE	unmapped	AGACGAATCAGTTGAAAAAAACACTGAATCAACAGTTGAAGAAACAAACGTCAAACAAAA
270	95	117	NC_S_026		FALSE	unmapped	TGTAAAATTAGCAAGTGAGTAACATTTGCTAGTAGAGTTAGTTTCCTTGGACTCAGTGCT
271	95	115	MW2_CDS_07664	MW1446	FALSE	unmapped	TGAAGCAAGTAATGGCCAAGAGGCTTATGAACTTGCAATGGAGAATAATTATGCTTGCAT
272	95	113	MW2_CDS_04401	MW0811	FALSE	unmapped	GAGCATCAGTATATATGTTAGGTGGGAGTGGTTTAAATACTGCGTTAACCGAAGCGGGAC
273	95	111	MW2_CDS_00791	MW0147	FALSE	unmapped	CAAATATAAAGGCTGTGGCATTGGGCCATCATGAAGGCAATGTCATTATGGGACAAAAAG
274	95	109	MW2_CDS_11392	MW2157	FALSE	unmapped	GTAACGACTGCTAACACTGATGAAGAAGCTCGTGAATTGTTAGCTAACTTCGGTATGCCA
275	95	107	MW2_CDS_13379	MW2532	FALSE	unmapped	AATCTTATATGGATGTAGCTAAAGCAGAAGGCGCAACAATTGCTGTTGGTGGTAAACGTC
276	95	105	MW2_CDS_07299	MW1364	FALSE	unmapped	AACCCTACACCAACAGACAAAGGTAGACGTTTGAATGTCTTTTATGCAACACAAGTTGCT
277	95	103	(-)3xSLv1		neg		
278	95	101	MW2_CDS_13385	MW2533	FALSE	unmapped	AAGCAGTGATTTAACTGAAGCTGAAACACAAGAGGCACAAAAAATTAAAGCTCAGCTTGA
279	95	99	MW2_CDS_11367	MW2151	FALSE	unmapped	ACAGTTCAGTAGTTGTTGAAGATAACCCTGCTATTCGTGGGCAAATCAACAAAGTTAAGC
280	95	97	MW2_CDS_12485	MW2363	FALSE	unmapped	TTACCGCAATATTGTCGAATTAACAGAGACACACCGTACTGCATCATTTGTTGAAAAATT
281	95	95	MW2_CDS_00620	MW0115	FALSE	unmapped	TACCGGATTTGCTATTAGCAGCAATCTTTGTGGCTGTATTTGGAATCGGTCAAATTCCAG
282	95	93	MW2_CDS_07955	MW1499	FALSE	unmapped	GTGGAGGAATTATTTCAAATGGTGAAATCGTACATGGTCATAATGGCTCTGGCGCAGAAA
283	95	91	MW2_CDS_12381	MW2344	FALSE	unmapped	TGAATAATGGTTGGGGACCTTATGGACGAGATAGCTTCCACCCAACATATGGTAATGAAC
284	95	89	MW2_CDS_01852	MW0337	FALSE	unmapped	GCAGAAACAATTCCAGGTGAAGGATTTGCTGGAGCTCGAATTATTCGCAAAGAAGTACAA
285	95	87	MW2_CDS_05277	MW0977	FALSE	unmapped	ACATACGGTGCAATGGTTCAAGAATCAATGAAAGCTGCAGAAGAACTTGAAAAAGATGGT
286	95	85	MW2_CDS_12885	MW2438	FALSE	unmapped	AGGTGGCGATGAATTCGATTTATTGCCATTAGGCGAAGCATTGAATGAAAATTATCACTT
287	95	83	MW2_CDS_12638	MW2390	FALSE	unmapped	ACATTAGCAGATATCATTAATGCGCTATTAAATCCAAGATTAAGGGAGGGCGCACGATGA
288	95	81	MW2_CDS_11359	MW2149	FALSE	unmapped	TGGCTGATAACCTTAAGAAACAAGGTAGCTATGTTCCAGGTATTAGACCTGGTGAACAAA
289	95	79	MW2_CDS_04125	MW0755	FALSE	unmapped	AGAAGAGAAAGATAAACTTGAATATTACATGAAAACGGCTCAGGATAGGCTAAATTTGTT
290	95	77	MW2_CDS_02037	MW0377	FALSE	unmapped	TGATTGATGATGTGCAAACTATTGTTTATACGAAAAATATTTCTAGAAAAGTAAACCCGA
291	95	75	MW2_CDS_13724	MW2592	FALSE	unmapped	ATCAGACGGATGTTTCTGCAGGTTTAGCTGCAAGTATATTACATGATCGAGAAACGACGG
292	95	73	MW2_CDS_05297	MW0981	FALSE	unmapped	AGAGGTGTTAGGAACGACGCCAAGTGAATTTTTTAAAGACAGTGAAAATGAAAAAGTATT
293	95	71	MW2_CDS_11114	MW2101	FALSE	unmapped	CCGTTAGCCTCACCTGATGTTATAGGTATTTCTAAAGGTGCCAGTTTAGCTGCTGTGATT
294	95	69	MW2_CDS_06337	MW1177	FALSE	unmapped	CATATATCGTAAACATATATTCATGGCCGCGGTCGGTGAAGTACTTGGAACTGGTGTCAT
295	95	67	MW2_CDS_05012	MW0927	FALSE	unmapped	GACCGTCCGCATGAATTAAGAAGTGTAGGCGCACCACAAGCGATTAATCAAGTAAATATG
296	95	65	MW2_CDS_11288	MW2132	FALSE	unmapped	ATGCATCATTTCCGGTTTTACTAGCTGGAATGAGAAGTTCAAGTGCAGACGAAACGAATG
297	95	63	MW2_CDS_13457	MW2545	FALSE	unmapped	TTGAGACGAACTTATGACTTGTCAGTAGCTAATGATTCATTGACGGTTAAAGGTTGTACA
298	95	61	MW2_CDS_11229	MW2121	FALSE	unmapped	TGTCGTTAAAGGTTTTGTTGAAGGTAAATACGATGGTGGTAGACACCAAATCCGTGTAGA
299	95	59	NA		ignore		
300	95	57	MW2_CDS_00379	MW0072	FALSE	unmapped	TGCAAAAGGATTTTACTATACTAATGAAATAAAGACGGAGAAATACGAAGTAGCTCAGGA
301	95	55	MW2_CDS_02340	MW0432	FALSE	unmapped	ACGATGTCGTTGGACACGTTTTATTAATTGAAGTAGAAATTAATAGTGATGATAAGACGT
302	95	53	MW2_CDS_03809	MW0696	FALSE	unmapped	AGTCTCAGTTTTAGTTTCTGTGTCAACTGCATTAGTAGGACCAATTACATTTTTAGGTTT
303	95	51	MW2_CDS_02639	MW0487	FALSE	unmapped	TGGAAGATACGGTTATTGTTGGTAGGCATGCTGTTAGAGAAGCGATTATTACTGGGCATC
304	95	49	MW2_CDS_01766	MW0321	FALSE	unmapped	GCAAGTGTGATTGGTGGTGCAATTGCCGGACTTGTACTGAGTATTATCTTAGCAATTACG
305	95	47	MW2_CDS_03540	MW0649	FALSE	unmapped	TGCGACTCGATTTTTAGAACGTCATCAATATACCGAAAATACAGTTTCGCTGATGGAAGA
306	95	45	MW2_CDS_05204	MW0963	FALSE	unmapped	TAGCAGCAAGTGAGGCATCTTCAACAACAAGTGTAGATTTGGCTAATCGTTCTCGTAGTT
307	95	43	MW2_CDS_03464	MW0635	FALSE	unmapped	CCATTTATTGGTGCCCAATTAATCGGTTTAAAAGGCTATGCTGGATTGTTTGGTGGAACA
308	95	41	MW2_CDS_10568	MW1996	FALSE	unmapped	CGATGTTGGTCCTATAATGAGACGCTATCGATTAGCAACTTTGACCCTTTATACAGCGGG
309	95	39	MW2_CDS_05770	MW1073	FALSE	unmapped	CGGCATGATTATATATTTCTTTACATCTTGGGTACCAAGTATTAGAGAAACTAAGGTAGG
310	95	37	MW2_CDS_07417	MW1386	FALSE	unmapped	CGGCTTTCGATTTAGAAACAGGAGAAGAAGCGTATCAGGTTAATGCTGACTATGGTGGAA
311	95	35	MW2_CDS_08641	MW1627	FALSE	unmapped	CAGCAATAACTAATGGGGAACAAGTGAAAGGCCTTTACCTTTATGGTCCATTTGGGACAG
312	95	33	MW2_CDS_02202	MW0406	FALSE	unmapped	AAAAGAAGTCTTAAATACGCAGCGTTTTGATTTTGAAAAAGCGAGCGAGTCAGCAGGATG
313	95	31	MW2_CDS_00956	MW0176	FALSE	unmapped	AGAAAAAGTATCGGTTTGTATAGGATGTCAAACACTGATTTTAAACAAATTTACGATTCT
314	95	29	MW2_CDS_01377	MW0252	FALSE	unmapped	AGCAGGTTGGAGTAACTATGGTGGCGGCAATCAAGTAACTATTAAAGAAGCGAACAGTAA
315	95	27	MW2_CDS_06517	MW1216	FALSE	unmapped	GGCGAAATAGAGCTTGTAAACTCTGTCAATCCATTTAGAATCGAAGGGCAAAAGACAGGC
316	95	25	MW2_CDS_04503	MW0832	FALSE	unmapped	AACATATAAAGAATTAGGCACAGATAACGTTGAGAGTATGAAAGGAGTTCCAGAAGATGA
317	95	23	MW2_CDS_09539	MW1791	FALSE	unmapped	ACAAAATAGAGTTTGTGCATCCCTTGACTAAGGAAGTCATTTCCGTTTCTTTGGATGACT
318	95	21	MW2_CDS_13547	MW2562	FALSE	unmapped	AAGATCCATTGCGCATTATACCTGCAAACATCATTGGTGCAATGATTGCATCAGTCATTG
319	95	19	MW2_CDS_00760	MW0141	FALSE	unmapped	TACTGCCAACGACCCCTTTTTTACTCGTAGCAGTTTTTTGTTTTGCTCGAAGTTCAGATC
320	95	17	MW2_CDS_13421	MW2539	FALSE	unmapped	AAGAGTTTGAACCAAGCGATATTGTAGACGCGTATCTAGTTATTGCAGCAACCAATGAGC
321	95	15	MW2_CDS_05241	MW0970	FALSE	unmapped	ATCTTGAGTTGGCAGACGAGCATTCTATTGTAGAATTGAAAGCAACTGAAAAGATGGCGG
322	95	13	MW2_CDS_11411	MW2162	FALSE	unmapped	GTAAAGGTGCGGTTGAAGGCTGGATCGCAGTTGTTAAACCAGGTAGAATTTTATTCGAAG
323	95	11	MW2_CDS_06836	MW1276	FALSE	unmapped	TCGGTATTATGATTGTCCCTCTCATCACAAGTTTGAGTGAGGATGCAATGGCATCTGTAC
324	95	9	MW2_CDS_07059	MW1318	FALSE	unmapped	AAATGCTGATGACACTACTTTTGTAGTTATTAACTCTACATGCGGCTGTGCAGCTGGATT
325	95	7	MW2_CDS_01420	MW0260	FALSE	unmapped	AAGACAGCAAAGCGGTTAATGATGCGATTGCTAAGCAGAAAAAAGAACGACAACAACAAA
326	95	5	MW2_CDS_09851	MW1849	FALSE	unmapped	GTTATGTGTGTAAACATTTAGGTATTGGCACAGCGCCTGTATCAACGCAAACATTGCAAC
327	95	3	DarkCorner		pos		
328	95	1	DarkCorner		pos		
329	94	164	DarkCorner		pos		
330	94	162	MW2_CDS_02550	MW0472	FALSE	unmapped	TAGAATATGGTATGCCTCCGACAGGTGGTCTTGGTATCGGTATTGACAGATTGGTTATGT
331	94	160	MW2_CDS_00882	MW0163	FALSE	unmapped	ATCGCTATCAAACCTTCACAAGGTGAAGTTCGTGCACCATTCAACGGTAAAGTACAAATG
332	94	158	MW2_CDS_01991	MW0366	FALSE	unmapped	CTGAAGAAAGCCCAGGCGCAACAGAAATTTTCCAAGGTAGACAATATAAAGTATACCGCG
333	94	156	MW2_CDS_10687	MW2017	FALSE	unmapped	TGCATACATGAGCGTCGATTTTTCAATATGGCTATGACACTAGAACAATGGGAATTTGGA
334	94	154	MW2_CDS_00549	MW0103	FALSE	unmapped	ACAACTAATTAATGTTGTTAAAGGGGAAATGAGTTTTATTGGACCACGCCCGGAACGTCC
335	94	152	(-)3xSLv1		neg		
336	94	150	MW2_CDS_02320	MW0428	FALSE	unmapped	GTGTTGGTGGCGTGCCAGCATTCATTTCAATTCAAAAAGAATTTTGGCCAGTATATCTCA
337	94	148	MW2_CDS_08951	MW1680	FALSE	unmapped	AAAGATATCATGTTACCAACTGCGAAAGCAGCATTAGCAGTTGGTGCTGATGGAGTTATG
338	94	146	MW2_CDS_12972	MW2455	FALSE	unmapped	GTAGCCGTTATCGCAAGCAGTCTATGGTTACATGTGGCATTCAAACCATTTCAAATCGTA
339	94	144	NC_A_007		FALSE	unmapped	ACGTTAACCTCAATAGAAATTATACAGTCGCTACTCTATACAATTTTTGTAATGGTTAAC
340	94	142	MW2_CDS_06589	MW1231	FALSE	unmapped	TGAAACGATCTAAAGCATTTCCAGTTATTTTGATTTCATTACTTATCATTCGTACTGTGA
341	94	140	agr_tiling 204_F		FALSE	unmapped	CAAAATAAGATTCACGGGGTAGGAAATTGTAGCATTTTATTTATGGAAACTGTCAATTTC
342	94	138	MW2_CDS_09538	MW1791	FALSE	unmapped	ACGCGGATATACAAAGCAAATGTTAAGGCACTTTTACCTTTGAAACCACAAACGATTGAT
343	94	136	MW2_CDS_02141	MW0395	FALSE	unmapped	GGTAATCCATCAACTTGGTTCTATCCATTAGGTGAAAAGAAAGTTGAACGTAAGGCACCA
344	94	134	MW2_CDS_07863	MW1482	FALSE	unmapped	CAGATGGACCATCATTCGATACGATTGTAGCATCTGGTCATAGAGGTGCATTACCACATG
345	94	132	MW2_CDS_12845	MW2431	FALSE	unmapped	TTTTCTGGTTATCACTAGGTCTTGGTGGTATCGGTATTTCAATGGGTATGAGTTGGGCTG
346	94	130	psma_tiling_070_R		FALSE	unmapped	GCAAAGCATATTTATGAAGATGAATTGAACAGACAGAAGTAACATTTTATATACATATGT
347	94	128	MW2_CDS_02535	MW0469	FALSE	unmapped	TGGGTTATGATACAACACCGGTTGAAAGAGATGAAGTAACTGCAGCTACGACTGCATATG
348	94	126	MW2_CDS_03036	MW0558	FALSE	unmapped	TCATGGTCGATTTAGTAAGTACTTGGATTACTTATTTTTTCCCTATGATTAATTGGTTTT
349	94	124	MW2_CDS_10847	MW2048	FALSE	unmapped	AATGCTGCTAAAGAACCGGAAGTAGTTGATGTTGCTAACTTCTTAACAAGTATGGGAGCT
350	94	122	MW2_CDS_12272	MW2322	FALSE	unmapped	TGCTTACTAAAGGTGGAGAAGAGGCATCGCTATCAATTGCTGATATGGCTGATGATGAAA
351	94	120	MW2_CDS_08698	MW1636	FALSE	unmapped	TTGGAAGTTGCAATAAACCAAGTCCATGCCAAGTACTTTGATATTTCATGCGTTCCGATT
352	94	118	MW2_CDS_01485	MW0273	FALSE	unmapped	AGGACATGAACCATGGACATCATGTGAATTTGATTTTACAAGAGATGGTAAATTGAAAGT
353	94	116	MW2_CDS_08838	MW1660	FALSE	unmapped	GTGCGATTGAAATTGCAGAGCAAGCTCTTGAAAGTGTTGAGCCAGGTGTTACTAAACATA
354	94	114	MW2_CDS_00858	MW0159	FALSE	unmapped	ATGAAATTCAAGTTGGTCTTGGTAGAACTGGGAAATGGTTTGCTATGGAATGGGAGCAAG
355	94	112	MW2_CDS_07865	MW1482	FALSE	unmapped	CCTGGCATGACTGGTGCAGAAGCTGATACCATTTCAAGAAACTATTTAGAGTCAAAAGGG
356	94	110	MW2_CDS_12415	MW2350	FALSE	unmapped	TCATCGAGTTTGTATTTTTAAACCATTTCAAACTGAGGAACGCCAAGACGGGACGTTTCC
357	94	108	MW2_CDS_12030	MW2279	FALSE	unmapped	CGCCTTACGACTAGCCCAAAAATTAGGTTTATCTATCGATGGTGTCGGAAGTCATACACC
358	94	106	agr_tiling 046_F		FALSE	unmapped	TGTAATTTGTATTTAATATTTTAACATAAAAAAATTTACAGTTAAGAATAAAAAACGACT
359	94	104	MW2_CDS_08990	MW1686	FALSE	unmapped	AAACAAAAAAGAGATCCAAACGTGATTCAGCGTTTAGAAGCAAATCGTCGTAAATTTAAT
360	94	102	MW2_CDS_10922	MW2061	FALSE	unmapped	CCTGAGTCAACACGTACGCAAATCGATCAAATCATCGATGAAGCGAAAGCATACCATTTT
361	94	100	MW2_CDS_00509	MW0095	FALSE	unmapped	AATGATGAGACACTAGCGCATTTAATTCGTGCAGCTGAAGCAGCGCATATTATACCAATT
362	94	98	MW2_CDS_12476	MW2362	FALSE	unmapped	AAAACGAATGCTGAAAAACTCGCATATGAACAACGACAAAATGACAGCGGTCATTTCAGA
363	94	96	MW2_CDS_03691	MW0676	FALSE	unmapped	AAGTTCACCTCGTGGTATATACTGCGGAGCAATTGGACTATTACTTCCAACTGAAGATGA
364	94	94	MW2_CDS_10876	MW2053	FALSE	unmapped	TGCTGATAGGATTGCTAACGTAGCAATAAACGATAAAAATGAAGTGGTGGGCTTTTTTGT
365	94	92	MW2_CDS_00259	MW0049	FALSE	unmapped	ACAACCAATGGAGACATTAGTAAGTGATTTGACATATGTAAAAGTCGCAGGAACATGGCA
366	94	90	MW2_CDS_07993	MW1506	FALSE	unmapped	ACGCAAAGTATATACAGCAAGTTATGGATGAAAATTATCCTGGAATTTCATTCGACACAA
367	94	88	MW2_CDS_05644	MW1049	FALSE	unmapped	AAGGTTACTGGACTTATGATGAAACATTTACTGGTGGTGTTACGCCAGCAGCTACTTCAT
368	94	86	MW2_CDS_12910	MW2443	FALSE	unmapped	TATGACTGGTCAAGTAAACAAACGTATATCGCATTAGGCAATATGATGACGACAGCCGCA
369	94	84	MW2_CDS_09893	MW1856	FALSE	unmapped	GAAGTCATCAAGGCAGTTGCAGATGATGACACATCGATTGGTGTTGTCCCTATTGAAAAT
370	94	82	(+)E1A_r60_3		pos		
371	94	80	MW2_CDS_00353	MW0068	FALSE	unmapped	TGATAATACCCAAGATGGTGCTGTGAACTGGTCATGCGAAAAACCAAACTTGTTAAACGT
372	94	78	MW2_CDS_08235	MW1549	FALSE	unmapped	TCGTGTCTAATAATAATGAGTCTCGTGTTGCTAGTTTTAGTCAGCATTTAGACATCGATT
373	94	76	MW2_CDS_08911	MW1672	FALSE	unmapped	AGTTCAGGTGGTAGCACAATTACACAACAACTTGTTAAAAATCAAGTTCTTACCAACGAA
374	94	74	MW2_CDS_05420	MW1003	FALSE	unmapped	TGCTCCTGAATCCTATGAAGGCTCAATCGCACCACAAATTATGTTTGATACAATTGCAGA
375	94	72	MW2_CDS_05626	MW1044	FALSE	unmapped	TTCCTTGATCCTAACAAAGCAAGTTCTCTATTATCTTCAGGGTTTTCACCAGACTTCGCT
376	94	70	MW2_CDS_10620	MW2004	FALSE	unmapped	ATTCCAGCAGTACAACGTCAAACAATGTTGTTCTCAGCTACAATGCCTAAAGCAATCCAA
377	94	68	MW2_CDS_09181	MW1722	FALSE	unmapped	TCTGCAGTGTTATTAACTCAATTGTACTAATTTTGTCTATAATTTTTGCAGATCGTTCAA
378	94	66	MW2_CDS_05991	MW1114	FALSE	unmapped	CTATGTTGCAACAAAAGCAGGTGTTATTGGTTTAACTAAATCTGCGGCGCGTGAATTAGC
379	94	64	MW2_CDS_05182	MW0958	FALSE	unmapped	TTGGCTTTGCATTACTCTCTTCCCTGTTCATGATTTTATACGGGAATGGTAGCCATACAA
380	94	62	MW2_CDS_04931	MW0908	FALSE	unmapped	ACGTTGATGTTAAATAGTGATTTAGACGAAGTTCAGAATGCACTAAAAGTTAATCCAGCT
381	94	60	MW2_CDS_12697	MW2402	FALSE	unmapped	AAGCACGTTATTAAAACCAGCACATCAAACCAAAACGCCTGATGATATAAAAAAAGAACT
382	94	58	MW2_CDS_07191	MW1344	FALSE	unmapped	GGTGTTGAACACGTTCGTGAAACAGCGCCATTCCCAAGATTATTAAACCGTTTATATCCA
383	94	56	MW2_CDS_07016	MW1310	FALSE	unmapped	CTTAGTGAATGAAGGTTCAGCTAGCGCTTCTGAAGTGTTTACTGGTGCGCTAAAAGACTA
384	94	54	MW2_CDS_08329	MW1566	FALSE	unmapped	ATAATGAATTAGGTATTGACCAATTAGTAGACATTATTAAAAAACATAATGTGGGTACAG
385	94	52	MW2_CDS_05960	MW1108	FALSE	unmapped	ATTTCAAACGAAGTGATTGCTTCGGTTGTAGGTGGAAAGGCCGTTGAATGTTATGGTATT
386	94	50	perR_tiling_100_R		FALSE	unmapped	CAACATCTAAATCATTGAACATTTCTAAATTGTCTCTAAAGTCACAAGCTTCTGTGGTAC
387	94	48	MW2_CDS_06994	MW1306	FALSE	unmapped	ACGTGTATATCTAGGTGTACATTATCCAACAGATATTATTGCCGGCATTATTGGTGGCGT
388	94	46	MW2_CDS_05034	MW0932	FALSE	unmapped	AACCCTAACAATCCTGATAACCCTAACAACCCTAACAACCCTGATAATCCAGACAATGGC
389	94	44	MW2_CDS_03702	MW0678	FALSE	unmapped	AGAATATATGTTGTTCGTTTGATAGCAACAATTACTACTGTTATAAGCTTTATCCTTGTA
390	94	42	MW2_CDS_03643	MW0667	FALSE	unmapped	ACTATCGACATTGCTATTAGCGATGAAGGTATTGGCATTATACCAGAACTACAAGAACGT
391	94	40	MW2_CDS_10914	MW2060	FALSE	unmapped	ACATTAGGTTCTCAAATGGTTGTACTTGCAAACAAAGCTGAAACGCTTGAAGAAGCGAGA
392	94	38	MW2_CDS_04283	MW0788	FALSE	unmapped	AGAAAGAAACACCTCTTTTACCGAATATAAATAATGAAAGGTTAGTTTTAGTAAATGAAT
393	94	36	MW2_CDS_03820	MW0698	FALSE	unmapped	GCTGCACCTAAAGCGAAAATTGTTTATGTTGGTGCAGATGAAAAGAACTTAATTGGTTCA
394	94	34	MW2_CDS_05047	MW0934	FALSE	unmapped	ACGTGATTCATCCTATCAATGCAGATTGGTTATTGGGAAGTTCACCATATACTTCACTTG
395	94	32	MW2_CDS_03459	MW0634	FALSE	unmapped	AATATCAATCGGGTGTTCTTCTTTGATTGGACAAACCTTACTTCCTGAAGTTTTGAGCCT
396	94	30	MW2_CDS_13890	MW2621	FALSE	unmapped	AATGTTAAAGATCAGGTTATTACTTTGGAAAATGGTAGCGATTCAGGTCGCACGAATTCT
397	94	28	MW2_CDS_11923	MW2259	FALSE	unmapped	TCATTGCGACATTTCAATCATTTCCATCATTCGGAAGAGTATATGCAGCATATGGTGGCG
398	94	26	MW2_CDS_01034	MW0191	FALSE	unmapped	ATGGCTTGGATTCCCATTTGTCTTTGCACTGTTCACTGGAGTACTGCAAAGTATTTCATC
399	94	24	MW2_CDS_12728	MW2408	FALSE	unmapped	ATTCGGCGGAATATCAATTGAGTAACAATGACTACAATGTGAAGCAACTTAGAAAGAGGT
400	94	22	MW2_CDS_03656	MW0670	FALSE	unmapped	ACGTCTACCTAACAAAAAATGGCGACATTAAAAACGGTAAAGAAATCGCAATGGTTGACT
401	94	20	agr_tiling 073_F		FALSE	unmapped	TAATTATAATTGAAAAATATCTTTTTTGCTTTACAAGCCTCGCTGGGATAGGCTTCTTCT
402	94	18	MW2_CDS_04287	MW0789	FALSE	unmapped	AGATAAAGAAGTAAAACGAATTTATGCATTTAAATCGGTGACTGATTTGTTAGAAAATTT
403	94	16	MW2_CDS_09975	MW1871	FALSE	unmapped	TGCTTACTTAACTGATAAAATGATTAGCTCTAACTTTGATTTTAGCAATTGGCAATGGGT
404	94	14	MW2_CDS_10931	MW2063	FALSE	unmapped	AGCAAGCCAATATGTAGACGAATTAGCTGAAAGAATTTTAGCGGTAGGAGGAAACCCTGT
405	94	12	MW2_CDS_00299	MW0057	FALSE	unmapped	ACATTGTCAGTCAGGTGTTAGAAGTTCAATTGCAGTGGGTATATTGGAAAGCAAAGGTTT
406	94	10	(+)eQC-41		pos		
407	94	8	MW2_CDS_02248	MW0415	FALSE	unmapped	TGCTGAAATTGCGAAAGAACACGGTTTGATTTCAGTCGTTGATAACACATTTATGACACC
408	94	6	MW2_CDS_04528	MW0836	FALSE	unmapped	TGGTGAAACTACTTTAGAAGATATTGCAAATACAAAAGTGGGACCACAAGACAAACCACT
409	94	4	MW2_CDS_06171	MW1146	FALSE	unmapped	GAACGTGCGGGTGTCAAATTTAATGATGCCGATTTAATTGGTTTACCACTGCGAATTGTT
410	94	2	DarkCorner		pos		
411	94	163	MW2_CDS_00665	MW0125	FALSE	unmapped	GCTAACAGCTGGCCCTGTACCTCCAAATCCATCTGAGTTAATAGCTTCAGAAAGGTTTAA
412	94	161	MW2_CDS_13563	MW2565	FALSE	unmapped	TGTTGTATTTGAGGCTGGACAATTTGGTGCAGATCAACATTACGGTCATGTAGCATTTGT
413	94	159	MW2_CDS_13721	MW2592	FALSE	unmapped	TACTGTAGGGGGTGGGATTCAAAGTCTCGATGATATTACCCAATTGCTAAATCATGGTGC
414	94	157	MW2_CDS_01775	MW0323	FALSE	unmapped	TTTGGTCCGAAAAAATTACCACAATTTGGTCGTGCTATCGGTTCTACTTTAAAAGAATTT
415	94	155	MW2_CDS_01435	MW0263	FALSE	unmapped	ATATATCGCGCGACGTTTGGCGAATTTGATACACGTCGAACATTTGAAAAATGCAATTCC
416	94	153	MW2_CDS_04231	MW0778	FALSE	unmapped	GAGATTCGCCGCTAACAGAACTTGGAATTGCTCAAGCTCAAAAGGCACGTAGTTATTATG
417	94	151	NA		ignore		
418	94	149	MW2_CDS_11092	MW2096	FALSE	unmapped	AGTAATGACACAATCGTAGAAACATTTAAGGATATCATCCCTTTATCATTTGGAGAAGAA
419	94	147	MW2_CDS_08655	MW1629	FALSE	unmapped	ACAAACAAGGTTGAATGGCAATTACGAGATGAAGGTCATACGGAAGTGTCTTCACGAGAT
420	94	145	MW2_CDS_06883	MW1284	FALSE	unmapped	ACCGAAAGCAACAACGCCATATCAACAATATCAACATATTGCAGATGTTAAAGATGCCGA
421	94	143	MW2_CDS_10354	MW1955	FALSE	unmapped	TCGTATCGTGGCATTTATTATTGCTACAACAGTAAGTTCATTAATATTTGCATTAGCACA
422	94	141	pMW2_081		FALSE	unmapped	ACAAAACTACCAAAAATCATTAGATACGCTTAAAAAGCTTCTGAGTGTCATGTATGAAAT
423	94	139	MW2_CDS_00412	MW0078	FALSE	unmapped	GAGCACAATGAAAACAGGTAATGTGTATTACAGACCTGGTTATGTTCAAACAGGACGCGC
424	94	137	MW2_CDS_05771	MW1073	FALSE	unmapped	TGGATATAAATGTGCTAGCTACAATATTTAAATTTATCCTTTTTGTTGTTGAAATTTATT
425	94	135	MW2_CDS_10136	MW1908	FALSE	unmapped	TAGTGAAATTTATAACGACGCATGACCTGAATGTACAGGCTGTTTGCTATGACCCTTGGA
426	94	133	MW2_CDS_05793	MW1077	FALSE	unmapped	TGTACCGAGATTAGTGAGTCATGCAACAAAATTGTTATGGTTAGGTATTCCAGATGACGC
427	94	131	MW2_CDS_07565	MW1423	FALSE	unmapped	TGCGCGGCGATGAATTATTGTGTGGAAGAAAAGACTCAAAATCTAAAGATGAAGTTGAAT
428	94	129	MW2_CDS_04056	MW0739	FALSE	unmapped	AGCAGGCTTCATCACTTTTTGGAATCGACATACTTATGTGTGGTGGTTTATGTTTGCAGT
429	94	127	MW2_CDS_13708	MW2589	FALSE	unmapped	TTGGGTATTTGCACGCATTTTAAAACAATGTTATTTAATACGATTCAAATGATTAGTGCT
430	94	125	MW2_CDS_09354	MW1757	FALSE	unmapped	AGCAAGTGCTTTAGTATTAACAACATTAGGAACAGGCTTACATTCTTCATACTTAGGATT
431	94	123	MW2_CDS_07923	MW1493	FALSE	unmapped	TCAATAAATTTGGTAGCATAACAATTGACAATAACAATTCAATTTATAGAATAATATTCC
432	94	121	MW2_CDS_10707	MW2022	FALSE	unmapped	ACTGTGAAAAGTATTAAAAATTTTAAAACAACAATGTCTATCGTATTTGAATGTCATATT
433	94	119	MW2_CDS_05790	MW1077	FALSE	unmapped	GTTGAATTACAAAATGGACGTGAACCTTTAATGTCCGAAGCGGGACTGTTTCATATCGCA
434	94	117	MW2_CDS_00584	MW0109	FALSE	unmapped	GTGAATATACAAATCATTTGTTTGCAAACCATCCTTCTGCCGTCATTGCAATGGAACGCT
435	94	115	MW2_CDS_13125	MW2484	FALSE	unmapped	TGGTAGCACTTTACTTGAGCTATACTACACAATTTATTTATCTGCATCGAAGGGTCGGCC
436	94	113	MW2_CDS_01620	MW0296	FALSE	unmapped	GTCGTGACTGCAATTACTGCATGGCTACCGCCAATCACCAATGAATCAACAGAATATTAT
437	94	111	MW2_CDS_10101	MW1900	FALSE	unmapped	ACAGACACACAAGTGAGAAAATCGTTACAATTGGTTACGCTAAAGGCGTCTCACATCGTA
438	94	109	MW2_CDS_06475	MW1208	FALSE	unmapped	AGCGCAAGTATTAAGTCCTACTAAACAATCTATGTTAGTTATGATTACGCGTGAAGCGAT
439	94	107	MW2_CDS_10192	MW1921	FALSE	unmapped	AGAGACCCAGAATTAAGAACCACTCAAAGTGGTGTAAATGTAGCATCATTCACATTAGCA
440	94	105	MW2_CDS_11706	MW2219	FALSE	unmapped	AGAACACTTGAAGACTCAAGTACGATGGTCTTACCTTTAATACCATGGGGAACATCAGGT
441	94	103	MW2_CDS_05967	MW1110	FALSE	unmapped	TCGTCAAGCATATGTCATTTGCCCGCTAATAGAAAGTTCTGAGCATCTCGAAGATGTTCA
442	94	101	MW2_CDS_09827	MW1844	FALSE	unmapped	AGCGAAGTTAAAAAGCAAGGTAAACAAATGGCTAGTGAGATATTATCAAGGTTACGTGAA
443	94	99	MW2_CDS_00927	MW0170	FALSE	unmapped	ATGCTATTAGTTTAATTATACTTACCATCCAAATAAGTGCCGGTTTATCATTAATTGACT
444	94	97	MW2_CDS_10780	MW2036	FALSE	unmapped	GCTTCAGGATGTTGATATTGAAACGCCTGTAACTAAAATGACGGCTAAACGATTAGCTGG
445	94	95	MW2_CDS_05982	MW1112	FALSE	unmapped	TGCTTTAATGTCAGCTGGTTTATTCATTGTTGGACGTATTAAAGGTGTAGCTAGACCGGC
446	94	93	MW2_CDS_02055	MW0380	FALSE	unmapped	ACCTTGAAACGATTGCTACAACTTCCAAAAAGACTAGCGAGACATTTAATATAAGCGTCG
447	94	91	MW2_CDS_11107	MW2099	FALSE	unmapped	ATGGCAATGACAGTAAAGAAAGATAATAATGAAGTGCGTATTCAATGGAGAGTTGCTGAT
448	94	89	psma_tiling_070_F		FALSE	unmapped	ACATATGTATATAAAATGTTACTTCTGTCTGTTCAATTCATCTTCATAAATATGCTTTGC
449	94	87	MW2_CDS_08609	MW1621	FALSE	unmapped	GCGCTAAGTCAATATGAAGTTAAGCGACGCGGCGATATGGAAGAGGATCCATCATATAAA
450	94	85	agr_tiling 030_F		FALSE	unmapped	AGTACTAAAAGTATGAGTTATTAAGCCATCCCAACTTAATAACCATGTAAAATTAGCAAG
451	94	83	MW2_CDS_12079	MW2287	FALSE	unmapped	AAGATGCTGGTAGATTATTCGGCGTTACATTTAAAGAGTTGTGGTTACCAGTTCTTACAA
452	94	81	MW2_CDS_07603	MW1433	FALSE	unmapped	TCGAAGATGTAAAATACGATTTAAATAAACTTAAAAACTCTGGGTTCCTAAACGGCGTGT
453	94	79	MW2_CDS_09060	MW1699	FALSE	unmapped	ATAATGATGCGACGCTCGAAGAACAACAAGCAGCACAACAATTACTTGATCAAGCTGTAG
454	94	77	MW2_CDS_05619	MW1043	FALSE	unmapped	AATTGACGTAGCTAATAAAGTTTTTGAATTGAATATTCAAAATCCAAATGTTGATGAGCA
455	94	75	pMW2_092		FALSE	unmapped	AAAGGTTTCCAGACAAAGTGTTTCTAAATGGGAAAGTGCCAAAAACTATCCTTCCTTAGA
456	94	73	MW2_CDS_11504	MW2180	FALSE	unmapped	CGATCCTGATGTTGAAGTTGATAAAGGTACAGATGCTTTGCAAAATTTGAAAGCGCTTGG
457	94	71	MW2_CDS_12631	MW2389	FALSE	unmapped	TCCCCGCATCTCTTCTAAAGATAAACTTCGTTCTGTGAAAAAAGGAGTGGTGCAATCATG
458	94	69	MW2_CDS_04138	MW0758	FALSE	unmapped	ACAGTCGGTGTTACGTACAGTTTAAATAATGGTGGCGAAAGTAGTATTACGGGTACAGCT
459	94	67	MW2_CDS_09493	MW1783	FALSE	unmapped	TCGCGGAAATAAACAGATGAAAGTCAACCAAATTAGACTAGCGACAACTGAAGATCAATT
460	94	65	MW2_CDS_05759	MW1071	FALSE	unmapped	CTTGCAAGTGAACGTTTCGGGAGAAGCTTCTAAACATGGTATTGCTTTAGAAGATGTTGA
461	94	63	MW2_CDS_02636	MW0486	FALSE	unmapped	TGAATCCATTGACCTTAGCATATATGGGAGACGCAGTCTTAGATCAATATGTACGTACCT
462	94	61	MW2_CDS_00532	MW0099	FALSE	unmapped	ATCGCTTTAGTATTATGCAACTTTGTATCTGCAATACTCTGGTTTGTTTCAGCCATATCT
463	94	59	MW2_CDS_10918	MW2061	FALSE	unmapped	CATTAGGTGCATCGACAACTGCGACGAAAGCATTTGAAACAGAAGATGCGATTCAAAATG
464	94	57	(-)3xSLv1		neg		
465	94	55	MW2_CDS_01858	MW0339	FALSE	unmapped	GTCGTTCGTGCATTTGATGATGATAACGTAACTCATGTTGCTGGTCGAGTAGACCCTATT
466	94	53	(+)E1A_r60_a135		pos		
467	94	51	MW2_CDS_09814	MW1842	FALSE	unmapped	ACAAAACGTTTTACGTGAAGATAAAGCAATTAAAGGTATTCCGCAAGAATTAGCTTTGAA
468	94	49	MW2_CDS_12583	MW2379	FALSE	unmapped	GCAGCGAATACGATTAAACCAGACTTGGCGATAGCTGTCGATGTAGGTATTGCTTATGAT
469	94	47	MW2_CDS_07751	MW1461	FALSE	unmapped	AAGTAAGTATGACATTATGACTGTTGGTGAAGCGAATGGTGTAAGCCCTGATGATGCTGA
470	94	45	perR_tiling_052_R		FALSE	unmapped	CTACCTCGTCCTATATTTATAAAAAGTGCTTCATCTTTCATTAATTCAAAATGTTTTTTC
471	94	43	RC6		pos		
472	94	41	MW2_CDS_08044	MW1515	FALSE	unmapped	GAAAAGAGCGATTAAAACAATTGGGACTAGGTGACACAGCTCGTTATGCAACAGAAGCTC
473	94	39	MW2_CDS_07068	MW1320	FALSE	unmapped	AGATAAAGAAAATGACGCAAATTGGGAAACAGTATTGCCAAAAGTAGAGGCTGTATTCGA
474	94	37	MW2_CDS_11205	MW2116	FALSE	unmapped	AGGTCCATTGGGCATTATCATGGGTACAGGTTTTGGTTTATGGTCATTCGTTCTAGCTAT
475	94	35	MW2_CDS_07658	MW1445	FALSE	unmapped	GTTACAGAACCGGATGAAATAAAAGAATCGCTTGCCATTGTCCTTGATGAATCGAAACGT
476	94	33	MW2_CDS_07425	MW1388	FALSE	unmapped	AAGGCAAGCACGTTTTAGAAATGATATTTTTAGGAGAAGACCCCAAAAATAGAATTGATA
477	94	31	MW2_CDS_00837	MW0155	FALSE	unmapped	TGCTGGAATTATCGGTGGCTTGTTATCTGGAATTGTAAAATTAGGTTGGGAGGTCATGTT
478	94	29	MW2_CDS_08622	MW1623	FALSE	unmapped	ATGAAAACTCACCGCGGAGCAGCTAAACGTGTTAAAAGAACTGCTTCAGGTCAATTAAAA
479	94	27	NC_A_033		FALSE	unmapped	TGGAAGTTACAATCATTTGCGCAATCGAATATTATTATGTTCAAAACTTTACGCTCCAAA
480	94	25	MW2_CDS_09373	MW1760	FALSE	unmapped	AGTGCACAAGATAATTTGAAAATTGTGTGTTTAAATGAAAGCGTTGATTTCAGCGAAATT
481	94	23	MW2_CDS_02417	MW0447	FALSE	unmapped	ACGAGCTGTTGAATGTGATACGATTGAAACGAATGGTAGTGCCATCAACGAACAAACTTT
482	94	21	MW2_CDS_13857	MW2616	FALSE	unmapped	ATTACAATCAGGTTGCTAGTCTCAATATCCATTCCAGCATCACACATGGGTGCTTAGGTT
483	94	19	MW2_CDS_04621	MW0852	FALSE	unmapped	TGATGAACCAGCTAACTGTAGATGAGTTAACTGAGTTTGAAGTGGCTTATGCACCACCAT
484	94	17	MW2_CDS_05176	MW0957	FALSE	unmapped	ACCTTTCGACTGTATTGCACAAGATCATAAACGCGCATTTGATCATGATGAAGGACCAAA
485	94	15	MW2_CDS_09520	MW1788	FALSE	unmapped	TTATTGGAATAACATTGAGACTCGTAATGGGTACATTTTACAAAGTAACAAAGTAAGCAA
486	94	13	MW2_CDS_03661	MW0671	FALSE	unmapped	TCCATTTTTAGCCCCTGCAATTTTCATCATTGGTGGTATTATGTTGTTTATTTCAACATT
487	94	11	MW2_CDS_00589	MW0110	FALSE	unmapped	AATCAGCTGCATTATACATGAATGCAATTTACGCTGGTGTCGAAGCATTAGGTGTGTTCA
488	94	9	MW2_CDS_07692	MW1451	FALSE	unmapped	AATTAATGGTTATCGTGATCGTACGATGTTAGAACTTCTGTACGCAACGGGAATGCGTGT
489	94	7	MW2_CDS_07360	MW1374	FALSE	unmapped	ACTGGTTATACTGAAAATGCAATTATGAAAACGCAGAATAGTGGTTTTAGAAATGAGTAT
490	94	5	MW2_CDS_13220	MW2502	FALSE	unmapped	TGAAAGATTTAGAAGTTATTAACCCAGAGGCCGATATACAAGTCGGTATGCATGGCAGCG
491	94	3	MW2_CDS_03503	MW0643	FALSE	unmapped	GATATATGAATGCACAAATTAGAAAACAAGGTGGTCGCCACAAAGGTCCCCCACCTTTTA
492	94	1	DarkCorner		pos		
493	93	164	NC_A_073		FALSE	unmapped	ACTTCTGTCTGTTCAATTCATCTTCATAAATATGCTTTGCCTAGACGAGACCTAACGTGT
494	93	162	pMW2_044		FALSE	unmapped	GGTACTTCGAACGTATTAGTAATCAAATACCAAAGAACTATACTGCGGCTCAACTCAAGC
495	93	160	MW2_CDS_04486	MW0828	FALSE	unmapped	ATTGAGACTTGAAGATGTATATTCACGTGCACATGCTGCCGGAAAAGCATCAACATTAGG
496	93	158	MW2_CDS_09532	MW1790	FALSE	unmapped	GGTAGAGTGACCTTTCATTCTCAGCCAACAAAGGGTACACAAATACAATTCACAATTCCT
497	93	156	MW2_CDS_09095	MW1706	FALSE	unmapped	AAGAAATGGCTATCATGTGATTATGGGAGATTTGCCTGGTCAAGGTCAAACTTCAAGAGC
498	93	154	(+)E1A_r60_1		pos		
499	93	152	MW2_CDS_04119	MW0754	FALSE	unmapped	TGATAGACGTGAGGGACATATCTACACAGAAGTATCAGACAGTGTAGTTCATGGCTCTGA
500	93	150	agr_tiling 117_F		FALSE	unmapped	AAAATTAAGATACTCAGTAATATAATAATTCCCAAGAATAAAAGCGAATACTGTTTGATT
501	93	148	RC5		pos		
502	93	146	MW2_CDS_08913	MW1674	FALSE	unmapped	CCAAAAACTGGAGAAACAACTTCAAGCCAATCATGGTGGGGCTTATATGCGTTATTAGGT
503	93	144	MW2_CDS_10499	MW1982	FALSE	unmapped	AGCGATGTGTTTACGTGAAAGCTTAAATCAACCAGATGCTGCAGATGAATTAGAACAACA
504	93	142	MW2_CDS_12509	MW2367	FALSE	unmapped	TACGGCAAATGCATTAAGCACAGTGTTGGAGTGTAATATGGCATCGCTGAATGAAAGTAG
505	93	140	MW2_CDS_02712	MW0501	FALSE	unmapped	AGAAGTTAAAGCTCGTCGTGTAGGTGGTTCTAACTATCAAGTACCAGTAGAAGTTCGTCC
506	93	138	MW2_CDS_13415	MW2538	FALSE	unmapped	TGGCAATTGGTTTAGCAGAGGCAAACATGGGCACGTATATTAAGTATGCATTCTTTTGGA
507	93	136	MW2_CDS_12486	MW2363	FALSE	unmapped	CGAGGAACATGATTCACATGAAACACCACCTTCTCGTGTGCGTTACGCATTTATTATGAC
508	93	134	RC7		pos		
509	93	132	MW2_CDS_10391	MW1963	FALSE	unmapped	ACTGAGTCAATTAGATGATCGTTTCTTTAGATGTCATAATAGCTTTGTCGTCAATCGCCA
510	93	130	MW2_CDS_12280	MW2324	FALSE	unmapped	GATACGTTAAAGTCAGCGGCAGTTACTTTAGGTACATCTGCAAGATTGCATCCGTGGTTA
511	93	128	MW2_CDS_00480	MW0090	FALSE	unmapped	CATTGGATGCGGGCTAATCGGAGACAAGCAATTACAAAGTATGTTAGAGCAATTCGATCA
512	93	126	MW2_CDS_09715	MW1824	FALSE	unmapped	ACTTATGGAAGACATGGATGGTGTAGAAGCGACGACTCAGATTAAAAAAGATTTACCGCA
513	93	124	MW2_CDS_06564	MW1225	FALSE	unmapped	TGAAGTATTCTAAACAGAATTCTGAAACTGCACGTAAGCATAGTAAAGATATGGCCAACA
514	93	122	MW2_CDS_05800	MW1079	FALSE	unmapped	TTTGCAGGTGCACTTGGAAACTTTATTGATAGAATTTTAACAGGAGAAGTTGTTGACTTT
515	93	120	MW2_CDS_06659	MW1244	FALSE	unmapped	TGCTAAACAGGTGATTGATCAGTTAAATGCAGCATTAGATGTACATTTTCCTGAAGATGA
516	93	118	MW2_CDS_05050	MW0934	FALSE	unmapped	ACAAACTTTGTTTGTAAATGGACAAATCCAATAATTAATTTACAAAGACCATCACAGTTT
517	93	116	MW2_CDS_00786	MW0146	FALSE	unmapped	ACAACAGCCGTCTCCAGATTGTTTAATGCTATTTCAACATCATAATTTGCTGCCATGGAA
518	93	114	MW2_CDS_13807	MW2606	FALSE	unmapped	CGATGTTGAATTCAACGGAGTAAGTAAAAATCCAATGGATGGTTCTCAAGTAACAGGTGT
519	93	112	MW2_CDS_01824	MW0332	FALSE	unmapped	TAGATTATGATTTCGAAAGCGTGCGTACTTCAAGACAATCACCATTCGCGCAACGTATTG
520	93	110	MW2_CDS_03859	MW0705	FALSE	unmapped	ACTTCCACGGCCCATATGAATATGCATCCATTGATGTTATGGAAAAAGCAGTACAAGTAA
521	93	108	MW2_CDS_08002	MW1508	FALSE	unmapped	AAAGCAAATGCCTTTAATTCAGGTTTCCCAGCAAGTGTTAAAGAAGTTGTTTTAAGCGGA
522	93	106	MW2_CDS_09669	MW1815	FALSE	unmapped	CCTGGAGGATTTTCACCAGATCATTTACGTGGAGATACAGAAGGTCGATATGGCACATTT
523	93	104	MW2_CDS_01444	MW0266	FALSE	unmapped	ACGATTGGGCGTGTTTTAGAAATTGAAATATACAATCATCAAGGTGACCCTCAACAAAGT
524	93	102	MW2_CDS_11802	MW2237	FALSE	unmapped	GTTTTGGAAATGGTGGCCATGCGGTAGGTATTTCTAATCTATGGACAAATGGCGGATTTA
525	93	100	MW2_CDS_01236	MW0228	FALSE	unmapped	ATGATCGTATCGTTCCGCTGCCTAATGCCATTGATTTGAGTACGATTTCATACACAGAGT
526	93	98	MW2_CDS_08151	MW1534	FALSE	unmapped	ATCATTTTGATGAAACGTTAAAAGGTCAAATCGCTGTGATTGGACCTACAGCTATGCATT
527	93	96	MW2_CDS_11733	MW2224	FALSE	unmapped	CGTCGTGCAAGAGCATTTGACATGGATGTACTATACACAGGACCTAATCGCAAAGAAGAA
528	93	94	MW2_CDS_01089	MW0200	FALSE	unmapped	TGTGCATCAATTCCAAAACCATGCGATGCAACTGTCAAAGACGTCTAAAGTCATTGAAGA
529	93	92	perR_tiling_052_F		FALSE	unmapped	GAAAAAACATTTTGAATTAATGAAAGATGAAGCACTTTTTATAAATATAGGACGAGGTAG
530	93	90	MW2_CDS_02603	MW0481	FALSE	unmapped	GATGAACACCACGCATATCGAATTTTGCGAGCTGTTAAAAACCGTTTTGGTTCAACGAAT
531	93	88	MW2_CDS_10727	MW2026	FALSE	unmapped	GTCACTCCTAATGGTTCTGTTTACAATCGTGATAATGTTGAACTCGTTGTTATGCAAACA
532	93	86	MW2_CDS_08868	MW1665	FALSE	unmapped	ACAATTGCTGGTGGTCAAGGCCATCTTAAAGGTCAAATTTTAAGAATTGGTCATATGGGG
533	93	84	pMW2_070		FALSE	unmapped	ATCAAGAGAATTGTTAGTTCTCTAAGCGGTGGTGAACAACAAAGAGTAGCATTGGCAAGA
534	93	82	MW2_CDS_13061	MW2472	FALSE	unmapped	TTGCTAATGAGAATATGTTGTATCGTCTAAGTGCCTTTGGGTTAACAGATGACGCTATCA
535	93	80	MW2_CDS_01636	MW0298	FALSE	unmapped	TGAACGCGTGAATAAAAACGAGCATGATTTTGATCGTAGACCTAATGACGAAGCAATCAC
536	93	78	MW2_CDS_03148	MW0578	FALSE	unmapped	TCCAGCACAAATCATATTAATGATTCAAAGGAATTTGTTTGCTTTACAAATGAATCCAGT
537	93	76	MW2_CDS_06096	MW1133	FALSE	unmapped	GCAAGGTGATAAAGTCACAGCAACTCAAATTGAACCAGCTCAACACTATACACAACCACC
538	93	74	MW2_CDS_09739	MW1828	FALSE	unmapped	AAAAACTTAACAGGTCATGGTGTTGGTTTATCATTACATGAAGCACCAGCACATGTACTT
539	93	72	MW2_CDS_06144	MW1141	FALSE	unmapped	AGTGGCTGAACCTTATATTCGTCGTCGTGCAATTAGACACTTAGAAAAGAAACGCGTAGT
540	93	70	MW2_CDS_12967	MW2453	FALSE	unmapped	ATTAGGACTGACAGGTGTTCCTATGGCTATTGGAGCACTAACATGTACAGGTAGCTCATT
541	93	68	MW2_CDS_06059	MW1127	FALSE	unmapped	TTAGATGAGCGAAAAGGTGTTCAAAATGCCATAGCTAGGCGCAGAAAAGCGTTAGAAAAA
542	93	66	MW2_CDS_02780	MW0512	FALSE	unmapped	ACTTTGAGTTCTGTTGAATTTCAGAAATTCAGTAAAATTTATGATATTTTAACTGAAGAT
543	93	64	MW2_CDS_09897	MW1856	FALSE	unmapped	GGCCCTAAAGGTACATTTTCATATTTGGCTTGTCGTCAGTATTTTTCTGAAAAGGAAACA
544	93	62	MW2_CDS_06976	MW1303	FALSE	unmapped	ACAACTTGCATTTGCGACAATTTTACAAGATGGTACACCGATTCGCTTAACTGGTCAAGA
545	93	60	(+)E1A_r60_a107		pos		
546	93	58	MW2_CDS_10731	MW2027	FALSE	unmapped	CTGAGGTATCTGCATTATTAGGTCGTATGCCTTCTGCAGTAGGTTACCAACCAACACTTG
547	93	56	MW2_CDS_13602	MW2571	FALSE	unmapped	TGCAACTTATGTCGCTCAGCATTTAGATTGCAAAGTATATCGTACAAGCCATGAAGATGA
548	93	54	pMW2_057		FALSE	unmapped	TGAGATGGAAATCAATGATTGTTGGCTATGCGAGAGTATCATCGAACGATCAAAATTTAG
549	93	52	MW2_CDS_10858	MW2050	FALSE	unmapped	TGACTCAACTGATCGTGTATTATTATTCGCACCATTTTATAATGATCAAGTTGCATTAGA
550	93	50	MW2_CDS_02074	MW0383	FALSE	unmapped	ATTGCTTTAATTGGCAAAGATAAGCAACATTATCATACGGGTGTACATCGTAATCTTAAT
551	93	48	MW2_CDS_01560	MW0286	FALSE	unmapped	CTATGGCAGGTGCTTTACAAACGCCGACATCTGGGCACATTTTAATCAATAACCAAGATA
552	93	46	MW2_CDS_09997	MW1875	FALSE	unmapped	AGAGAAAGACGGTTTTGTTACAACAATTAGAGGAAAAGGGACCTTTGTTAAGGAGCAAGA
553	93	44	MW2_CDS_12894	MW2440	FALSE	unmapped	AGGTCAAAGTCAAATGGCAGATATTTTCCCTAAGCATGCTGAGACATTAACAAAAGCGTT
554	93	42	agr_tiling 047_R		FALSE	unmapped	TGTAAATTTTTTTATGTTAAAATATTAAATACAAATTACATTTAACAGTTAAGTATTTAT
555	93	40	MW2_CDS_00954	MW0176	FALSE	unmapped	TGTTTCGTTGTTTATTAGGTTTTCTAAACAAAAAATAACAAAGTCTTGGAGAAAGAGGGA
556	93	38	MW2_CDS_12067	MW2285	FALSE	unmapped	TCAACTATTGGCATATTGTATTATACGCATTTCACAGAAACTACCGTAATGTTGATTTCT
557	93	36	psma_tiling_013_R		FALSE	unmapped	TGAAAAATGGCAAAACCATCGTACCAACTGTTAATTGAAGGTACAATCATTGTTTAACAG
558	93	34	MW2_CDS_09352	MW1757	FALSE	unmapped	ACATGGAATTCTCTAACCGAGAAGTTAAAAGGTCTTGGTTTACTACAAAATGGCCAAAAA
559	93	32	MW2_CDS_09160	MW1718	FALSE	unmapped	ATTAATAAACTGGTTCCTATTTACATCAACCCAAAAACTATACTTTTTCCGTTAAAACAT
560	93	30	MW2_CDS_07972	MW1502	FALSE	unmapped	ACGATTTTCAAATAACATCATTTGAACCGGAATCATTCGATCAACCAGTCGATAAATTGA
561	93	28	MW2_CDS_01777	MW0324	FALSE	unmapped	ATGAAATGGCTGAAGCTGGCATTTATAAATGGCATATCGATATTCAAGCGGGCACTTGTA
562	93	26	MW2_CDS_00342	MW0066	FALSE	unmapped	AAGCTTGATTCACAACGGGTAATGGAAATTGATTCATTGGCAGCAATAATAAACTTAGTT
563	93	24	agr_tiling 040_F		FALSE	unmapped	GATGTGATGGAAAATAGTTGATGAGTTGTTTAATTTTAAGAATTTTTATCTTAATTAAGG
564	93	22	MW2_CDS_01411	MW0259	FALSE	unmapped	TGCAGAGCATCCTATAGGCTTGGCGCTAGTAATATTAACAGTACTTGTGATTATTGGCTT
565	93	20	MW2_CDS_01328	MW0243	FALSE	unmapped	CATTATCTGCAGCAATTAATGTCAATGTCTCACCGCAGACGAAACTTGGCTGGTTAGATT
566	93	18	MW2_CDS_07945	MW1497	FALSE	unmapped	AGGCGATTTACCTTTATTCCCTGGACATGGTCCATATACGACGGTTGATGATGAACAATT
567	93	16	MW2_CDS_13659	MW2581	FALSE	unmapped	TGATGAAGTAATTGGATACATCAACGGTCCAGTCATAAAAGAGCGTTACATTAGCGATGA
568	93	14	MW2_CDS_01456	MW0268	FALSE	unmapped	TGATAAAGAAATAGCACATCCATTTAAACAACAACTTGCACCAGCGGGAATGGGTGGTAT
569	93	12	MW2_CDS_02770	MW0511	FALSE	unmapped	AGCTGAACGTTTTAAAGAACAAAAGCGTATGTTTGAATATGGTGGTGGCTTTGTCCAAGA
570	93	10	MW2_CDS_00173	MW0032	FALSE	unmapped	TGGACAATGACTGTGAAAAAGTATGTGATAGAAACGTTTTAAAAATTTTGAATCGCCATG
571	93	8	MW2_CDS_07170	MW1340	FALSE	unmapped	TAATGATGCACCTAAGAAATTCGCTGCCAAACTTGGCTTAAACTACGAAGGCGATATTGG
572	93	6	MW2_CDS_05848	MW1087	FALSE	unmapped	CAGCTGGTTTAGATGGCGTTGTTTGTTCACCTCTTGAAAGTCGTATGTTGACTGAAAAGT
573	93	4	MW2_CDS_03999	MW0729	FALSE	unmapped	TTACCAGACAGGTTGAGAGAGATTGCTAGAATTCGAGTAGAACATCAAGAAATTTCGTTG
574	93	2	MW2_CDS_00938	MW0172	FALSE	unmapped	TACAAATATGAATACGATAGAACGAAAGAATAAAGTTATGACTGTGCTCAGTGCTGTAGG
575	93	163	MW2_CDS_13571	MW2566	FALSE	unmapped	GCGAATCAGAGAGCAATTGAAGCAGCAAGACAACATCGAATACCAGTCATTTTCATACGT
576	93	161	MW2_CDS_12544	MW2373	FALSE	unmapped	AGCTGAAGCAATTAAAGCTGAAAAAGCTGGTAAAAAAGTTGAAATGAAGAAAACAGAGGA
577	93	159	MW2_CDS_07512	MW1405	FALSE	unmapped	AAGCATGAAAGCGAAAGATTATCTGGATATGCCTGACAGAGTTGATACTAAACAAACAGT
578	93	157	MW2_CDS_13604	MW2571	FALSE	unmapped	AGGATGATTTGCAAAGTCAAGATACCCTAACGGCTATTAATTTGATTAGTTATGGGTCAA
579	93	155	MW2_CDS_01468	MW0270	FALSE	unmapped	TGATACTCTTCGAAAGCCAGGTGCACAAGCCTTAAGTTTAATATCATTGTTTTTGATACT
580	93	153	MW2_CDS_09169	MW1720	FALSE	unmapped	GGGTTAATTGTGTCTAGTTTAGTTTTTGCATCATTACACGAATCTGACACTTGGATTGGT
581	93	151	MW2_CDS_01272	MW0234	FALSE	unmapped	CTGGTCTGGATCGTGGTTATGTATTTGAAGAAGGTATGGCTAGTGTCGTGCTAAAAGACG
582	93	149	MW2_CDS_10994	MW2079	FALSE	unmapped	GGTGCTGGCAAGACAACACTTCTAAATATTTTAAATGCGTATGAGCCTGCAACATCTGGA
583	93	147	MW2_CDS_13213	MW2501	FALSE	unmapped	TACAGCGATAAAATCACCCTACTAAATGGGACAGATTCTAGAGGCTCCTTCCCACAAGAT
584	93	145	MW2_CDS_13028	MW2466	FALSE	unmapped	CGTCCGTTGTTAAAGTTCAAGGCGAAATTGATGTTAAAGATTTAGCAAGGGGCGAGAGAA
585	93	143	RC12		pos		
586	93	141	MW2_CDS_12695	MW2401	FALSE	unmapped	AAGAACAACAAGCGCGCATTACACTTTATCTCAAGCATAACACTAAAGAACCGAACACGA
587	93	139	MW2_CDS_10562	MW1994	FALSE	unmapped	AGCAGGTTCTCTACTAATGGATTGCCAATTCTGTAATGCAATAAGACCAGGAATTTCCCT
588	93	137	MW2_CDS_04422	MW0815	FALSE	unmapped	TTTGCAATGTCTAACGTGGCATTCTTAATCAACTTCTTCATAATGGGAATTTGGCATGGT
589	93	135	agr_tiling 134_F		FALSE	unmapped	AATCGGTATATTCATTTCTTGTGCACGTAAAATTTTAGCTGTTAGAAGACCTTTAATCTC
590	93	133	MW2_CDS_09857	MW1850	FALSE	unmapped	GAAACTCAAGGTAACAATGGTTGGTGTGCAGGCTATACGATGTCTGCATTACTAAATGCG
591	93	131	MW2_CDS_01515	MW0278	FALSE	unmapped	TGCCTATGTAACTGATCAAGGTGGAGAGGTCATTTTTAATTATACTAAACCAGGTAGCGA
592	93	129	MW2_CDS_10628	MW2006	FALSE	unmapped	AGAAGCATTCCAATTTGACCGTAAGCTTGTTATAGAACAAGGCGTTAACGCACGTGAAAT
593	93	127	MW2_CDS_03810	MW0696	FALSE	unmapped	TGGTGTCCTTTTAGGAACATTTTTTAGAAGCATAACAGGTTTTATTCAACTGATTATGGA
594	93	125	NA		ignore		
595	93	123	MW2_CDS_11538	MW2187	FALSE	unmapped	CCAACAATTGCATTTTATAGTCCGAATGCATTAGGCGCTATAACTAAAGCACTACATTCT
596	93	121	MW2_CDS_02948	MW0543	FALSE	unmapped	AATTAGAAGCAATCATTGATGGCGAATTCCAATTTGATGCTGCGATTGTACCAGGTGTTG
597	93	119	MW2_CDS_03623	MW0664	FALSE	unmapped	TGGGTGATATTAAACTATGAATTTAATGAAGCGAGACCTACTATCGGACAGTCTGATGAA
598	93	117	MW2_CDS_13622	MW2574	FALSE	unmapped	TGCAAGTCATATTGTGATTGCGTTGTTAATCATCCTTGTGATAATCACATTGTTTATCTT
599	93	115	MW2_CDS_09023	MW1693	FALSE	unmapped	AATGGTGTGAATGGTGTTACCGTTGAAGATATCCGATGGTTACGTTGCGACATTAAAAGC
600	93	113	MW2_CDS_01409	MW0258	FALSE	unmapped	GGAAGGTCAAGCTTTCAGCCGTTTCGAAGAGCAATTCCAACAACTTAGTCCTAAAGTAGA
601	93	111	MW2_CDS_02039	MW0377	FALSE	unmapped	TGGAGCTATCTATTTTTTACAATGGGCAATTTTTTGTAGCATTGGTAGAATATAAAATGG
602	93	109	MW2_CDS_06064	MW1128	FALSE	unmapped	TTAGCCATGGCAACAATGGATACGATTAATCATTTCGGTGGAAACCCAGCCAATTTCTTA
603	93	107	MW2_CDS_07764	MW1464	FALSE	unmapped	GGCATGTCTCATGAAGACATTGCTCAAACGTTCAAAGACTGGAATGCTGGTGAATTAGAA
604	93	105	MW2_CDS_04456	MW0823	FALSE	unmapped	CGAATACGTTGATCGTGGAACTGTTTGTTCTTTAGGTTCACATGACGGTGTAGGTATGGT
605	93	103	RC6		pos		
606	93	101	MW2_CDS_01240	MW0228	FALSE	unmapped	GTCGAAGCGGCTCTAAAGATTTTGAGCAAGTTGTTGATTTATATCGTAAGTACCCAGACA
607	93	99	MW2_CDS_01437	MW0264	FALSE	unmapped	AGGAAAAGCGCCCAATACGTTATATATCGAAAAAAGAAATTTGATGAAACAAAAGCTTGA
608	93	97	MW2_CDS_02539	MW0469	FALSE	unmapped	ATGGGCGGGTCTGTATGATCATCGTATGTTCCAAATTGTAGCTAAATATGACGCGGAAAT
609	93	95	MW2_CDS_06068	MW1128	FALSE	unmapped	ATCGTAGAAATCAACCCATTAGTTACAACAGCTGATGGTGATGTATTGGCATTAGATGCT
610	93	93	MW2_CDS_06943	MW1297	FALSE	unmapped	AATCATTGCCTCTAAGAGCGTATTCTTTAGAGTGGTTCCCAGTAGCAATTATTGCAACGA
611	93	91	MW2_CDS_08081	MW1521	FALSE	unmapped	ATGCACTTGATGGGCTGAAAATCTTAATTCAAAAAGACTATAAATTTCTTTTACATGTGT
612	93	89	MW2_CDS_13478	MW2550	FALSE	unmapped	CCACTTTCCAAAAAGCGTGATGACAATTTTATAGCAGGTCACTCTATGGGAGGATATGGC
613	93	87	MW2_CDS_01610	MW0294	FALSE	unmapped	TCAATCAAGTCGACATATACTCTTTGCTGGACTAGGTAGCTCTGGTTTATCAGCGACTGA
614	93	85	MW2_CDS_11982	MW2271	FALSE	unmapped	CACAATAGAAGGATTGCCACCAGTTTATATGTTTGGTGGTGGACGTGAAATGACACATCC
615	93	83	MW2_CDS_00913	MW0168	FALSE	unmapped	ACTACTACCTACTCTATAAAAGTCCCGAATACAATCAACGCAAACGATTTAAACATTTCA
616	93	81	MW2_CDS_07385	MW1379	FALSE	unmapped	ACCATATAGTCAAAATCCGAGAGACTATTTTGTTCCAGACAATGAATTACCCCCATTAGT
617	93	79	perR_tiling_039_F		FALSE	unmapped	TTAATTTTCTCAATAAGAATGATCTAATTGAGAATGAAGTTGATGCTAAAAAAGGCTATT
618	93	77	MW2_CDS_03515	MW0645	FALSE	unmapped	ATCAGCATTTACATTTAAAATCGTCATCCAATTAGGATCCGTCTTTGCAGCAGCATGGGT
619	93	75	MW2_CDS_06704	MW1253	FALSE	unmapped	GGAGGATTCACGTATAACGCGATTGAGGGTGAATATTGCCAAATTAAAACTGATGCTGGT
620	93	73	MW2_CDS_10710	MW2023	FALSE	unmapped	TGTCGTTTTAAACGTCAAGTAGTACCTGGTGATACTTTAACGTTGGAAGTAGAAATCACT
621	93	71	MW2_CDS_07114	MW1329	FALSE	unmapped	ATCTTTTCGGCAATACATGAAATACGCCCTACACATGTAGCTGTATGTTGGGATATGGGA
622	93	69	perR_tiling_020_F		FALSE	unmapped	ATTGGAATTGTAAAAGAATTAACATATGGAGACTCATCAAGTCGATTCGACTTTAATACA
623	93	67	MW2_CDS_05403	MW1001	FALSE	unmapped	GAAGCGACCTCTAATGGTTCTGATAGTGTTGAATTTACAGAGGACGCATTAAGAGGGCAA
624	93	65	MW2_CDS_06757	MW1262	FALSE	unmapped	AGCTGCAACAGGAATTGAATGACAAAGAAAATCGTCGTGATCAAATGATGGCGAAAGAAA
625	93	63	MW2_CDS_05428	MW1006	FALSE	unmapped	ATGCGCGTCATTGCAGGTAAACATAAAAGTAAAGCTTTAGAAAGTATGGAAGGCCGTAAT
626	93	61	MW2_CDS_07194	MW1345	FALSE	unmapped	GTGGATGAAGCACATCGCTTACCAGACTATGCCTTAAATCAAGTGACAAATGAGTTGAGT
627	93	59	MW2_CDS_07083	MW1324	FALSE	unmapped	AAAAGCAAAAGCGCTCAAAGAAATTGACGAAGCTGAAAAACGAGCACTACAAAACGTTGA
628	93	57	MW2_CDS_13303	MW2518	FALSE	unmapped	TTTTCCAAGTGCTAAACAAGTGGAAGCAGCGGGTATTGATATGATTCTTGTTGGGGATTC
629	93	55	MW2_CDS_03011	MW0554	FALSE	unmapped	AGCTTGGGGTATGGGGTTAATGTTGTTTTTCTTGATGAATATAACACTCATTGTCAATAA
630	93	53	(+)eQC-40		pos		
631	93	51	MW2_CDS_09242	MW1734	FALSE	unmapped	GAGGGGCGACTCGAATTTCGCCCCCCTTTAGTGGATATAACTCAATTACAACCATATTAA
632	93	49	MW2_CDS_03014	MW0554	FALSE	unmapped	AATTAGTAGAGAAGAGTATGAAAAACTGAACACTGTTAAGCCAGTTAAAAATAAAAATTT
633	93	47	MW2_CDS_02287	MW0423	FALSE	unmapped	CGACATCTGCGAACACGATTTACCTTGCCTTTTTTGGTGGCCAACTTGCTTTATTTATTT
634	93	45	MW2_CDS_10441	MW1972	FALSE	unmapped	AGGTACCAACACAACTGAACGAATTGCCGCTTCAGAATCAGTACTATCATTTTTACATGA
635	93	43	MW2_CDS_09709	MW1823	FALSE	unmapped	TCCAGTGGTGGCTTATTATCTATCGGTTTGATTTTAGCAATTTGGTCAGCTTCAAATGGA
636	93	41	agr_tiling 137_F		FALSE	unmapped	GCGACTTAAATCGATCATATTCAAATTAATGCGAGTTACTTCATCTGGTATTTCTATACT
637	93	39	MW2_CDS_10106	MW1901	FALSE	unmapped	TCGCTTGCATTCAAGAATCTAAAGAATCCGACACTCAAACGAATCTCAATACAGGTAGCA
638	93	37	MW2_CDS_06034	MW1122	FALSE	unmapped	TGAGAGTTGAAGTTGGTCAAATTGTTAACACACATGGTATTAAAGGTGAAATTAAAGTAA
639	93	35	(-)3xSLv1		neg		
640	93	33	MW2_CDS_07498	MW1402	FALSE	unmapped	AGAAACGTATGAATTTTATTGTCGGTTAAGAGATGAACTTAAAAATAGTGATTTGATGAT
641	93	31	NC_A_037		FALSE	unmapped	ACGTTTAATTAAACAGACATTGTCAATCGCGTCTAATACCCCTGCTGTCCGAAAACAAAA
642	93	29	pMW2_097		FALSE	unmapped	CTCAACAAAAACGGGGAATGGTATTATTTCGAAGTAAGAAGTGTCTGGCGTGGCAAACAT
643	93	27	MW2_CDS_08678	MW1633	FALSE	unmapped	TGGTGTAGAAGCTGATCAAGTCGATAGTTTAATGCGTCGTCAAGCAAAAGCAGTTAACTT
644	93	25	MW2_CDS_09727	MW1826	FALSE	unmapped	AACCGGATAACTATACAGTTAATATCTACGTATCAACGTTTATCGGAGACGTAGAGGTGA
645	93	23	MW2_CDS_08177	MW1539	FALSE	unmapped	AACGATTGCAAAGGATTCGCAGTCGCATTTACAATAGTCAACAAAACGGTCAAGTTACAA
646	93	21	NC_A_071		FALSE	unmapped	TGTTGTTACACTGATGAAGCGATGTCACAAAGAAATGTCGTTATCAAACGAAGCCCGAAA
647	93	19	MW2_CDS_08278	MW1557	FALSE	unmapped	ACGAGGTAACAACAGATGTTGCTGGAGAAATTACTGAAATAGTAGCTGATCATGGAACAA
648	93	17	MW2_CDS_00832	MW0154	FALSE	unmapped	GGACAGCCCATCTATGTGAGCTTATCATATAGTTATCCTTATATCGTGTGTGTTGTCGAT
649	93	15	MW2_CDS_07857	MW1481	FALSE	unmapped	GAAAACGTTTAGAGCTGGTGAAAAAGTTGAACCAGCAATGATTGAAAATCGTCGCATGCA
650	93	13	MW2_CDS_13605	MW2572	FALSE	unmapped	CGCAGTATTCCTGGGCGACATAATGATGATTCACCTACCATTGCAAGTTGGTTTGTTAAT
651	93	11	(+)E1A_r60_a135		pos		
652	93	9	MW2_CDS_06215	MW1154	FALSE	unmapped	CCGATTGTTAGAAAGTTTTAAAGGTATCATTGAACAAATTCCGCCGATGTACTCATCCGT
653	93	7	MW2_CDS_11503	MW2180	FALSE	unmapped	ATTAAATAGTTTTGAACGCCGAAATCGTTCAAAAGTGCGCTTGGCTTTAAAGCGAGGTAC
654	93	5	MW2_CDS_11139	MW2105	FALSE	unmapped	GGAATTGCATTAGAAGCACACATGCAAAATACAGTAGTGAACTTGGGGCCACATTTTGAC
655	93	3	NA		ignore		
656	93	1	MW2_CDS_07534	MW1414	FALSE	unmapped	AGCATTTTTAGTAATGTTTTTTATGAGTAAGCTCAAACAAGTTCAAGGGAGCTATGAGGA
657	92	164	MW2_CDS_12816	MW2425	FALSE	unmapped	TGTGAGTCGTTCGCCAATTCGAGATGCATTTAAATTATTGCAACAAAATCAACTCATCCA
658	92	162	MW2_CDS_11895	MW2254	FALSE	unmapped	TGCGATTAAACAAGCATTTGCAGGTTTGCCGGATTTGAATCAATGTGAAACTTTAGTCGA
659	92	160	MW2_CDS_04096	MW0748	FALSE	unmapped	TGTCGCTTTTAGTGTGTACGGCATGATGGTAACTTATGGATTTAATTTAACAGGAGGATT
660	92	158	MW2_CDS_08926	MW1676	FALSE	unmapped	TGCAATTATCGATGATGCAGGTAATGAATTACCACCAAATCGAATGGGCAACCTTGCTAT
661	92	156	MW2_CDS_05121	MW0947	FALSE	unmapped	GTGAAAGTAGCAGTCATTATGGGCAGTTCTTCCGATTGGAAAATTATGCAAGAGAGTTGT
662	92	154	MW2_CDS_07836	MW1477	FALSE	unmapped	TGAATTAACAAAACAATTTAGTGATGATGATCATTATAAATTTATAAATGGTGTATTGAG
663	92	152	MW2_CDS_07239	MW1353	FALSE	unmapped	TCAATTGTTGGAACTAGAGCCAAGTAACGAAAATTGGCATGACGAATTATCAAGATTGCA
664	92	150	(+)E1A_r60_a22		pos		
665	92	148	MW2_CDS_08614	MW1621	FALSE	unmapped	TGCACAGAGAGAATTAGAAGAAGAAGTAGGTTTAAGTGAGCAAGATTCACAAAATATGGA
666	92	146	MW2_CDS_13105	MW2481	FALSE	unmapped	TGTTGCTCCAGGGAAACCATTTGGAGAGAATGGTAATCGTTATGTGAGAATTTCATTGGC
667	92	144	MW2_CDS_13555	MW2563	FALSE	unmapped	ACGGAAGACGAGGATATTCACTTTGTCGGTAATATTAGTGCTATAGTAAGTCATCCTGGA
668	92	142	MW2_CDS_07583	MW1427	FALSE	unmapped	ATTACTTCAATGGGGAGCCGATTTTGTTAAACCATTAGCCAGACTTGCTTATAACGGTGG
669	92	140	agr_tiling 020_R		FALSE	unmapped	AGGGAATGTTTTACAGTTATTTTTTCAATCTATTTTTGGGGATGTTATTAATTATGAAAA
670	92	138	MW2_CDS_09342	MW1755	FALSE	unmapped	TCGAGTAAAGGTAAAGGCGGAGGAAACTACGACGTTAAAGACATTGTAGAATATCCCGGA
671	92	136	MW2_CDS_04803	MW0886	FALSE	unmapped	TCAATGATGAACTAGAATTGACTGAATTCCACCAAGAACTTACTTATATTTTAGACAACA
672	92	134	MW2_CDS_03366	MW0618	FALSE	unmapped	ACATAGCACATTTAAGCCGAATGTAAGGATATTATTAAAAGATGTATTTGTTTCAGGTGT
673	92	132	MW2_CDS_08030	MW1512	FALSE	unmapped	TAGAGCTATCATCTGATGGATTGAAATTCGGACCAAAATTGCTGAACAACAAAAATGAAT
674	92	130	MW2_CDS_12591	MW2382	FALSE	unmapped	ACACTTAGACATAGATTACACAGAAGTTGACATGAAAAAATTAAATAAACGTCTTGGTGT
675	92	128	MW2_CDS_00726	MW0135	FALSE	unmapped	TGCTGACGTATTAAAAATTGCGGATGTATGTATTGCATCGCTGATTAAAGAAGGCGTCGG
676	92	126	MW2_CDS_04829	MW0890	FALSE	unmapped	TTACCAAGAACATTTGCTTGGTATCATCACGATTGATGATATTTTAGACGTTATGGATGA
677	92	124	ETG10_13482		pos		
678	92	122	MW2_CDS_05107	MW0945	FALSE	unmapped	ATCATGTCACTGATTCAGATGGTGCAATTAAAATTTCCACTAGGTATATTGAGGTTAAAT
679	92	120	MW2_CDS_01269	MW0233	FALSE	unmapped	CGTAGCTATACAAAAGCTTATGTATCATCTGAAACCGATATTCCATTCTACGCTGAAGCA
680	92	118	MW2_CDS_12038	MW2280	FALSE	unmapped	CTTGAATGTATATCCGCATCAGTTATCTGGCGGTGAAAAGCAACGTGTTGCGATTATGAG
681	92	116	psma_tiling_085_R		FALSE	unmapped	GATAAGTGGCTTGTTGTTTTTAGCACCAGTTATGCCAATGAGATATATTAAATTACATTT
682	92	114	MW2_CDS_02586	MW0478	FALSE	unmapped	GCAGAGTTCAAGGTGGACAATTTGAGCACGTTGGAAAGACACCACATTCTTCACATAAAA
683	92	112	MW2_CDS_12965	MW2453	FALSE	unmapped	GGCGCCATCGTATTGTTTGGCTTTAATAATGCAGTGACATCAATTGTAACAATCGCAACA
684	92	110	MW2_CDS_11451	MW2170	FALSE	unmapped	GATGTTTCTGGACCAATTCCGTTACCAACTGAGAAATCAGTTTACACAATCATCCGTGCC
685	92	108	MW2_CDS_06349	MW1179	FALSE	unmapped	TTGATCAATTAAGAGAAGCGGAAGATCCATTTACATGTCCACATGGTCGTCCAATTATCA
686	92	106	MW2_CDS_03619	MW0663	FALSE	unmapped	CACATTCTCATCCGGCATCGGTTGCTATTGCTTACCGTATGAAAGGTAATGAACGTTTTT
687	92	104	MW2_CDS_10834	MW2046	FALSE	unmapped	CCAAGTGCGTGTCGGTAATCCAAGAGAAGATGGTACACAAGTAGGCCCTATCATTAGTAA
688	92	102	MW2_CDS_10704	MW2022	FALSE	unmapped	AAGGTTTCAAATTGTGAATGAACACGGCAGAATTATAGAATATGAATTAGAAGATGGCGT
689	92	100	MW2_CDS_03799	MW0695	FALSE	unmapped	ATGCAAAATAAGTTTGTTAGTCCGACTACAGCTGGAACGATGGAATGGGCTAAACTAGGT
690	92	98	MW2_CDS_05560	MW1031	FALSE	unmapped	CCTCATTCCAAGGCGCATTTGAAAAACCACAGTTTACTTATGATGACGTCGATGTGAGTT
691	92	96	psma_tiling_003_F		FALSE	unmapped	AATTGTCATAAATTGCAAACAATTAAGCCACAATTTAAAAATGATTATACTTCATTCAAC
692	92	94	MW2_CDS_02361	MW0436	FALSE	unmapped	ACTTCCAAACATCTAGTCCTTCGTATTTGATTATGGCTAGTTTAGAGTCAGCTGCCGAGT
693	92	92	MW2_CDS_09288	MW1742	FALSE	unmapped	ATTTATACAAAATTAAAGATAACAACGATAATAGTCTAAAGAATTTACATGAAATGATTT
694	92	90	MW2_CDS_12524	MW2370	FALSE	unmapped	GCTTGAATTATGAAGCGGATGGTAAAGGTAAAGAACCTGCTGTCGTCGCAGAAGAATTTT
695	92	88	agr_tiling 012_F		FALSE	unmapped	TATATGAATAAGTCTAATGTTGGAAAAGGTCAAAAAATTAATCAATTTAATTAAGAAAAT
696	92	86	MW2_CDS_09595	MW1802	FALSE	unmapped	GGTCTGAGCAAGTCAGGTCAGAACAAAGATGAGTTTGACGAGATATATACTATCGAATCA
697	92	84	MW2_CDS_02724	MW0503	FALSE	unmapped	GGTGTTGAAATGTTCCGTAAATTATTAGACTACGCTGAAGCTGGTGACAACATTGGTGCA
698	92	82	MW2_CDS_06952	MW1298	FALSE	unmapped	TGCTACAGATGATATGACTGATATGATGACCAAAAAGGGCAAAGGGTCAAACGATACGCT
699	92	80	psma_tiling_042_R		FALSE	unmapped	GATTAGTTGTTACCTAAAAATTTACCAAGTAAATCTTTAAAGAATTTGAATAATTTTGCT
700	92	78	MW2_CDS_01526	MW0280	FALSE	unmapped	TCGCATATGAAATAAAAGATGGTAAGGCAGAGATTAATAGAGAAATAGACCCAATTAAGT
701	92	76	MW2_CDS_10677	MW2016	FALSE	unmapped	TTGGCGAAAAGCGGTGATTCATTAATGGATAATGACACAAAGCAAAACTTGCAGCATACG
702	92	74	MW2_CDS_08681	MW1633	FALSE	unmapped	ACTTCATTGAAAGAAGCGGCCATCCATTTCGAATTAGACGGTGGTAACTATTTGCGAAAT
703	92	72	MW2_CDS_04754	MW0877	FALSE	unmapped	TCGTACAAGCAACATTGTTATTTGCCGGTATGATTGTAGTGGAATCAGGATTGAGCTTTT
704	92	70	MW2_CDS_06396	MW1188	FALSE	unmapped	CAAGGGTTTGTAATTCTAGGTTTCCCTTGTAATCAATTTGGTGGCCAAGAACCTGGATCA
705	92	68	MW2_CDS_12324	MW2334	FALSE	unmapped	GCACTAGCAATGAACCCTAAAGTGATGTTGTTTGATGAACCAACATCTGCACTTGATCCT
706	92	66	MW2_CDS_07101	MW1327	FALSE	unmapped	TATTTGGAATGTGAATACAGTCATCGTACCAGTTGGCGGTGGAGGATTAATTGCAGGTAT
707	92	64	psma_tiling_011_F		FALSE	unmapped	GATGGTTTTGCCATTTTTCATCAAAGCAAACATAAAAAGGACTAAGACATATACATGTCC
708	92	62	MW2_CDS_00183	MW0034	FALSE	unmapped	TGTGATGATTGTTCAGAATGTCCTCTGAAAAATCAATGTATGAACTTCAATTCAAAAACA
709	92	60	MW2_CDS_09154	MW1717	FALSE	unmapped	ACCTTGAAGGATACAAGCAATTTGAAATTGCTGAAATCATGTCATTATCGCTTTCAACGA
710	92	58	ETG05_36762		pos		
711	92	56	MW2_CDS_09406	MW1767	FALSE	unmapped	ACTTACCAAAGAGAAATGGATAGATATACTAATCAATGGAATCGACTACACTGGGTTGGT
712	92	54	MW2_CDS_04185	MW0766	FALSE	unmapped	CGACTACATATACTGAAACAACGACACAGGTACCAATGCCTACAGTTGAGCGTCAAACTC
713	92	52	MW2_CDS_02124	MW0392	FALSE	unmapped	CGAAATGGACAGCAGATTCAAAATTTGAAAATGACGAACGATTCAGCGGATACGGCAAAC
714	92	50	MW2_CDS_00915	MW0168	FALSE	unmapped	TGGTGTTAATTACCTATCAAATCATTTTATTTTTTATTATTAGTCTAAGTTACTATTTAA
715	92	48	agr_tiling 102_F		FALSE	unmapped	ATGATATAAACGAAATTTGCACAATATAAAATGATTTGAGTAACCATTACTAAAAATACA
716	92	46	MW2_CDS_02733	MW0505	FALSE	unmapped	CCAACAGTACCAAGAGGTACAGGACGTGTAAGAAATATGCCTACAGCTGCACATACAAAA
717	92	44	MW2_CDS_00172	MW0032	FALSE	unmapped	TGGGTATTTGGTAGTTTGTTGTGCTTATTTTATATGATTAAGGCATTCCGACAAATTGAT
718	92	42	MW2_CDS_00475	MW0089	FALSE	unmapped	CAATTAAGCAACCTATAGATTATTTTGTCGCGCCAGTCAGCACGACAGGTAGCATTATGG
719	92	40	MW2_CDS_00402	MW0077	FALSE	unmapped	AAAATGGTGCGTTATTTAATCTTTGGCGCAAACATCATACGATACATGGCATGGACAAGG
720	92	38	MW2_CDS_04194	MW0767	FALSE	unmapped	TGGTCACAATTCACATCGTATGCATGTACCAAGTTTCCAAAATAACACAACAGCAACACA
721	92	36	MW2_CDS_09846	MW1847	FALSE	unmapped	ACCTACAGTACTGAACAGTACAGATGTTGTATTTCACAATGGTACATTATTAGAAGCGCT
722	92	34	MW2_CDS_03319	MW0610	FALSE	unmapped	TCCGGCGCTCATAGGTTTAAATTCAGGTGCTTCATTTGCTTTAGCATTAACATATGCAGT
723	92	32	MW2_CDS_07627	MW1439	FALSE	unmapped	TGAAAATGAAGATATGACTGTTTGCTACATTTTAGATCAGGATGATGATGTAATGGACTT
724	92	30	MW2_CDS_07507	MW1404	FALSE	unmapped	TGGGGAACACAATATATGATATCAAGCCAGGAACATTTAAATATATTGAATCAGAAATAT
725	92	28	MW2_CDS_09097	MW1706	FALSE	unmapped	AGAATTGCCAATCGAGGGGATGATGTTAATTTCTCCTATGCTAGAACTTCAAAAGAATGG
726	92	26	MW2_CDS_11766	MW2230	FALSE	unmapped	TGCGACAATCGATATGGATGGTTTGCATAATATGATAGATAGCATCGGCGGTGTTGATGT
727	92	24	MW2_CDS_11641	MW2206	FALSE	unmapped	GATATCGAAATCGAGGCTACGTTCCCCGATGGTACTAAGTTAATCACAGTACATCACCCT
728	92	22	MW2_CDS_12115	MW2293	FALSE	unmapped	CAAAGACGCGCGAAGCAGCTGAAAAAGGATTACCTAATGCCTTATTTACAGTAACCTTGT
729	92	20	MW2_CDS_13444	MW2543	FALSE	unmapped	ACATTTAGAGGGATTCTTAAACAAGTATCCTTCTGAAATCTCGGGGGGTCAGAAGCAACG
730	92	18	MW2_CDS_00325	MW0063	FALSE	unmapped	CGGCGAAGGCAATAAACCATTCGATATTTTAAACGACTCTCAATTTATAGAAGAGCTCGC
731	92	16	MW2_CDS_13374	MW2531	FALSE	unmapped	AGAGCATATTTACATCCAGCGATGAAGCGTAAAAACTTAACCGTTGAAACACGTGCCTTT
732	92	14	MW2_CDS_05412	MW1002	FALSE	unmapped	GATGAAGTTGTTACGAAAATTGCGTACGCTGTTTCAGAGCATGTCAAAATAGAAACAGGT
733	92	12	NC_S_056		FALSE	unmapped	TCCAAAATAAAAAGACGACCAATAAGCCGTCTATTTGATATTTATATTATGGTGTGTTAA
734	92	10	RC8		pos		
735	92	8	NC_A_050		FALSE	unmapped	CTCATTCATGCACGAATGGTTCTTCCCCACCTAATCAGATATTAGGTGACTTATGGGGAG
736	92	6	MW2_CDS_04342	MW0799	FALSE	unmapped	TCGCGGTATTGTTCATTTTGGACGTAAAGCAAAAGGTGCTCGTTCAAATATTGAATGTGA
737	92	4	MW2_CDS_12232	MW2315	FALSE	unmapped	ACGCAAAGAAGAGGGTTATGATTTTGCGGCAATCGCTTTCTATGAATCTAACAAACCATC
738	92	2	(-)3xSLv1		neg		
739	92	163	MW2_CDS_02232	MW0413	FALSE	unmapped	ATGGATTTCATCGTTTCGAATGTATTGATGCCATTAGGCGCATTAGGTACTACGCTTGTC
740	92	161	MW2_CDS_09104	MW1707	FALSE	unmapped	AATTCCAAATGCTCTATGGTTTTAGATCAGAGTTAGCAGAAGAAATCGCAAATGAAGGCT
741	92	159	MW2_CDS_02899	MW0534	FALSE	unmapped	TCGACAGTATCACCATGAAGGCGCACCAGTTTATGAAATTATAACCAAAACGTTTCAGCA
742	92	157	MW2_CDS_04585	MW0846	FALSE	unmapped	ACCGCCTAACAATTTTGTTGTGCTAAATGATCATGATAACAATCAGCATGATTCTAGACA
743	92	155	MW2_CDS_07198	MW1345	FALSE	unmapped	GCAGCTTGAAGTCTTTATATAGCAAAGCTGTAGATCAACTTGGCTTAACATATCGACCGC
744	92	153	NA		ignore		
745	92	151	MW2_CDS_13882	MW2620	FALSE	unmapped	CAAAGAACTGCAGCAGCGAGAGCATTTGTTCACAAACCACAAATCATATTTGCAGATGAG
746	92	149	MW2_CDS_02007	MW0370	FALSE	unmapped	ACTATTACCCAATATTGCAAAGTTTAGTACCGGAAATACAAAGTAGTTATGGCATAACCA
747	92	147	perR_tiling_050_R		FALSE	unmapped	ACTTTTTAATACTTCTATTAAGAGCGCTTCTTTAACTATGCTACCTCGTCCTATATTTAT
748	92	145	MW2_CDS_03078	MW0565	FALSE	unmapped	ACGCTGCGACAACAGTTAATCACTTGTTAGAAGCTTCATATAATGAACATCATTTAAAGA
749	92	143	NC_A_100		FALSE	unmapped	CACAGCAATGTGTTCAAATTTTTATCTATTCGTAAGTTAGCCTTCGGGCTAACTTTTTAT
750	92	141	MW2_CDS_11242	MW2123	FALSE	unmapped	GCAAGTGGCGTTCCAGATTTCCGTTCAATGGGTGGCTTATTTGATGAAATTTCAAAAGAT
751	92	139	MW2_CDS_13627	MW2575	FALSE	unmapped	CAATCAGGTTCAACAAGTACATCAACGTCGACAAGTGCTTCAGTACGTACTTCGGAATCA
752	92	137	MW2_CDS_08086	MW1522	FALSE	unmapped	AAGAAGAGCATATAGAAGACGATGCTGAGCTTTCTGTTACATTTGTAGATAAACAAGAAA
753	92	135	agr_tiling 127_F		FALSE	unmapped	TGAAATAGTCTCGAAGACCGGTCATGTCATCTTCACGAATGTATTCTGAAAGAGTCGTCA
754	92	133	MW2_CDS_11740	MW2225	FALSE	unmapped	ACGTGTCAAACATACTGCAAAAGTAATTAAGCGTTCTAGAAAAATCGGTAAAATTGCCCA
755	92	131	MW2_CDS_09989	MW1873	FALSE	unmapped	TGAAGGCATTGTTAATTAGGAATTTTAAATTACGACGATATACACTTATCATCTATGTTC
756	92	129	MW2_CDS_07176	MW1342	FALSE	unmapped	AGTCATGAGTGTAGCATTTGATGAACCTTCATTAGCTGTTGATACGCATGTAGAACGTGT
757	92	127	MW2_CDS_00031	MW0006	FALSE	unmapped	ACGATTCGTGAGTCAGATACAGATAAAGTTGCAATGGAAAGCTTGCAACAACGCTTCAAA
758	92	125	MW2_CDS_07508	MW1405	FALSE	unmapped	TGTAGCTCAAAATGGGGCATCATTAAGTCAGAAACTACTTCAACTATCTAACGGCGCAGT
759	92	123	MW2_CDS_11303	MW2138	FALSE	unmapped	CTGATGTGCCGAAGCTACTTGAATCAAAGAATCGTAAGAATGTTCCTTTCACTGCAACGG
760	92	121	MW2_CDS_13437	MW2542	FALSE	unmapped	AGAAATGCTAATGGTTTGGGATCGTTTGACAGGTGGACTAATATTTGTAGGTGGCGTAGT
761	92	119	MW2_CDS_13275	MW2513	FALSE	unmapped	AGTTATGTTTCAGGTGCGGGATTGTCTTTTATAAGACATTGGGTAGAAGATCCAAACCGT
762	92	117	MW2_CDS_01731	MW0315	FALSE	unmapped	AGATTTGATTTCTCATGGTAGAGCCGAAATTGTAGCTGGCAGAGCATCAAGAACAGGTAT
763	92	115	MW2_CDS_11966	MW2268	FALSE	unmapped	AACGTGTACTGTTTCCTATGCAAGAGCTAATTGATACAATGAAACAAAATGGTGATTTGA
764	92	113	MW2_CDS_01940	MW0357	FALSE	unmapped	ACGCTAGTACATTAGCTCACAAAATCAAAGCAGCTCAATATGTTCGTAAAAACCCTGGCG
765	92	111	MW2_CDS_03708	MW0679	FALSE	unmapped	TCAAGGTGACCAAGCCATTGTAGTCGCAATTGAAAAAGAAGTATCTAAAAGTTTAACCGA
766	92	109	MW2_CDS_00430	MW0081	FALSE	unmapped	GACAAACGGTAGTATTACGGAAAGCTCTACGTATGGTGATAATGATACACCAGCACCACC
767	92	107	MW2_CDS_06918	MW1292	FALSE	unmapped	AGCATCAAATGTAACAAGCCATCAACTTGAAGAGTTAGAACTAAATCAAAAATTATCGGA
768	92	105	MW2_CDS_03112	MW0572	FALSE	unmapped	TCTTTGAAAGGTATTGGAAGTGAAACAGCAGATGTCTTACTTGTTTATATATTCGGACGT
769	92	103	MW2_CDS_11362	MW2150	FALSE	unmapped	GACAGTGAAAGCTCATAAATTCTCAGCTTCAGCAGCAGAAGCTATTGATGCTAAAGGTGG
770	92	101	RC1		pos		
771	92	99	MW2_CDS_04882	MW0899	FALSE	unmapped	GGCGGCAATGATTGCGGTGTGGAGTAAAGGTACATCTTTAGAAACGATTATTAAAGCTGT
772	92	97	MW2_CDS_13352	MW2526	FALSE	unmapped	CAAACCCACAAGTTATTGAACAACACGATGCCAAAGTTTATGGTAAAGAGCCACCTGGTA
773	92	95	MW2_CDS_11564	MW2192	FALSE	unmapped	AACAATTATTCCGATGTGCCATCCATTACCATTGACTGGCATAGATGTTCACTTCAGCTG
774	92	93	MW2_CDS_06890	MW1286	FALSE	unmapped	TGTTAACCCATTTGCTGATGAAGGCATTGCAGTGATAAGAGATGAAGAAATTACGGCCAG
775	92	91	MW2_CDS_10073	MW1894	FALSE	unmapped	GGATGAGAAAGAGTGGATAGATGGCGGTAAGTTTTATCAGCGTCCAGCTTCTATCATAGC
776	92	89	MW2_CDS_01119	MW0206	FALSE	unmapped	ATACGGAGCTCGCCCGACATACAAGAAGCCAAGTAAAACAAATGCATACAATGTAACAAC
777	92	87	MW2_CDS_09945	MW1866	FALSE	unmapped	AGCTACATACTGATGGACAAATCATTGAACCATGCAATTGTTGAAGTGACACCGAGATCA
778	92	85	MW2_CDS_13245	MW2507	FALSE	unmapped	CAATCTGTTGCTGAAGCAATACGAACTGCGAGCGATAATATACAAAAAGTTGGTGAGGCT
779	92	83	MW2_CDS_08971	MW1683	FALSE	unmapped	TGCAGTATTTCAACCACACACTTTCTCTAGAACACAAGCATTTTTAAATGAATTTGCAGA
780	92	81	MW2_CDS_08531	MW1607	FALSE	unmapped	TTATTGACGAATACGGTGCTGATAGCTTGCGTTACTTCTTAGCAACAGGTTCATCTCCAG
781	92	79	MW2_CDS_08020	MW1511	FALSE	unmapped	GATGTAAATCCGTATGGTGTCAATATGATGTTGGCGAAGGCGATGGGTTTGAAGAACATT
782	92	77	MW2_CDS_06827	MW1274	FALSE	unmapped	TGCAACAAGCAGCTCGTGTATCAGATAAAACTGCATTTTTCTTAAATGGTTATGTCAATG
783	92	75	MW2_CDS_10298	MW1944	FALSE	unmapped	TGGACACTATTATCAAAAAGATGGGAGATCATAATTTGACATTTGCGATTGAATTTTGCT
784	92	73	MW2_CDS_12242	MW2317	FALSE	unmapped	AACTTTTCATCCAAAAACTTTTGAAGAAACAATTTCGACAGATCATCCAGCATATGAAGA
785	92	71	MW2_CDS_02323	MW0429	FALSE	unmapped	ATTTTAGGACAGAAGTCACGAGACAATTCGAGAACGCCTATGCAATGGAGTGATGATGTT
786	92	69	MW2_CDS_00061	MW0011	FALSE	unmapped	ACTCATATGAACATGTTAATACTTATTTTATTGTGTGGTATCGTAACGCTATTAATTCGA
787	92	67	MW2_CDS_05851	MW1087	FALSE	unmapped	TGCATGATATTCCTAATACAGTAGGTAAGGCGATGGAAGGACTAGCTAAATTGAATGTTG
788	92	65	MW2_CDS_02420	MW0447	FALSE	unmapped	GGTGTTGAACATGCCGACTTAATTGATATTAAAGAAGCGTTAATGCATGTTAGTTCACCC
789	92	63	MW2_CDS_11845	MW2246	FALSE	unmapped	TCATGATGCCATGGTGCATGGTTTCGAATTGATGTTTGATAAGATGTACCACGTTATCGA
790	92	61	MW2_CDS_12006	MW2275	FALSE	unmapped	ACGACAAGCCAAAATAGAAATTCAAAACGCACTTGTTGATTTGATGGCTGAATATCCTTT
791	92	59	MW2_CDS_12208	MW2311	FALSE	unmapped	ATATTAATAAACTTCAAGGTAGGCCTATCGTTGGCTTATCTCATGCTGCCGGGTATGCAT
792	92	57	MW2_CDS_01505	MW0276	FALSE	unmapped	TCCATCAGGAAAGGAAAACTACTATATGTATAAAAAGTTTGGTGTTATACCAGAAACGGA
793	92	55	MW2_CDS_08514	MW1604	FALSE	unmapped	CCACGTGAAATTTTTAGTATTGCGGTGAGAGAAAATGCCAATGCAATCATCGCAGTTCAT
794	92	53	MW2_CDS_11561	MW2191	FALSE	unmapped	TTTGAACTATTTGTGAAACCAGCTGTTAAACATATGTGTGGCGCACTAGAAGTCTTCCCG
795	92	51	MW2_CDS_01129	MW0208	FALSE	unmapped	AACCTTTTCTTAATGAAAAAGGCGCATGAAGACGGTCTTGTAGATGATGTCGTTGCACAA
796	92	49	MW2_CDS_06610	MW1235	FALSE	unmapped	CCAATCTGTTATCGACTTTATTATCATCGCGTTTGCTTTATTCATCTTTGTTAAGATTGC
797	92	47	MW2_CDS_05434	MW1007	FALSE	unmapped	GAAGTTGCAGCTTATCGAGCAGATATTTCTGAATTCGTTCCACCTTATGTTGAAAAGGCA
798	92	45	MW2_CDS_01329	MW0243	FALSE	unmapped	CAGCAGCAGGTCTTGAATCATATATTCAAGTTCAACAAGCGAATGCTGTTAAATTGCCCT
799	92	43	MW2_CDS_11492	MW2178	FALSE	unmapped	TGCAATTTTATCTGATTTTACTAGCAATACTTTATCTAATTGTTAGTTTTATTAGTATTT
800	92	41	MW2_CDS_04301	MW0791	FALSE	unmapped	GTGGCCAGAAGTTTGGACTGCAATAGTCGAAACACTATACATGACAGTCGTCTCAACTAT
801	92	39	MW2_CDS_00750	MW0139	FALSE	unmapped	CTAACAGCGCATCGTCGTGAAAATATTGGGGAACCGATGCATCAGATTTTTAAAGCAGTA
802	92	37	MW2_CDS_02277	MW0421	FALSE	unmapped	TATACGCTGGATTGATAAAGATAATGATGCGTTGATTGCGCCTGCTGTCAAAGTTTGGAT
803	92	35	MW2_CDS_11889	MW2253	FALSE	unmapped	TTGGGTAGATGTTGAAAATTTGCCACTCATATTACCAAACAAAAATTCTCAAGTGCGCAA
804	92	33	MW2_CDS_07007	MW1308	FALSE	unmapped	TTGTCGACCAAGACCAAGCAGAATGGTATGATGACATTGACTGGCCAGTAAATAGAGAAG
805	92	31	MW2_CDS_03856	MW0705	FALSE	unmapped	GCAATACGTTTAGGTGAACAATTCGATAGTTTGCTACCTGATAGTGAAGTTCCGGAGCGA
806	92	29	agr_tiling 015_F		FALSE	unmapped	CCTTTTTATTGTAATAAAGAAGGGAAGAGTTAATCCTCATTATGAGATCCACCGTTAAAA
807	92	27	MW2_CDS_02891	MW0532	FALSE	unmapped	GGGCATTTAGAAGATATTGAATGCCGACAGACTCGCAATATCACACGTTATACAATGGCT
808	92	25	MW2_CDS_04962	MW0916	FALSE	unmapped	AAAATAAGTAAGAAAGAAAAAGAACAATTAAAGATACGTTATATAGAACAGTTTGGTCTG
809	92	23	MW2_CDS_12076	MW2287	FALSE	unmapped	GTGTAGCGGCAAAATTGATTTCACCACAATCAATTGCAATTGCAACTGCAGCAGTAAAAC
810	92	21	MW2_CDS_03883	MW0710	FALSE	unmapped	AACAAGATATTTTGGTGGTATTAAATTAGGTGGTGGCGGTTTAATTCGCGCCTATAGCGG
811	92	19	MW2_CDS_01585	MW0290	FALSE	unmapped	GATTCCATGGAGCGAAGCTGTTCCAGCTGGCTCTTTAATGGCGACTAAATTAATTACAAA
812	92	17	MW2_CDS_11097	MW2097	FALSE	unmapped	AAAATAAAGAAGGTAAAGATAGTGTTGCAACTGCAACAGAAGATTTACGTAGAATGGGTT
813	92	15	agr_tiling 156_F		FALSE	unmapped	TTAATAATGGTAACCATGTTTTCTCTTTGTTTTGGATCGTCTTCGCAAATGAAAATTTTC
814	92	13	MW2_CDS_11152	MW2107	FALSE	unmapped	TCGGCGAAATCGTGGATTGAAACTTATAGTAAAGCATTGCTTGGTCTCGTAATCCCACTA
815	92	11	MW2_CDS_10540	MW1989	FALSE	unmapped	AGTGAAGCTGTGACAAATGCAGTTAAACATGCATACAAAGAAAATAACAATGTAGGCATT
816	92	9	MW2_CDS_04452	MW0822	FALSE	unmapped	TGGTACGACTATTGATTTTAAGCAATCATTAATGGGTGGCGGTTTCCAAATCGACAATCC
817	92	7	MW2_CDS_02953	MW0544	FALSE	unmapped	TGCAATCAAAGATCTTGGCGGTGTATTAAATATGACGCCAATTACTCAAGAAGAATGGCA
818	92	5	MW2_CDS_10080	MW1895	FALSE	unmapped	TTGGTATATCGGGGAATACGGGGTTTAGTACAGGACCTCACTTACATTATGAGATGCGTT
819	92	3	MW2_CDS_12086	MW2288	FALSE	unmapped	AACAGCGCACGCGTAGTTATAGTTGAAAATGATATACCTGAAACGTTACAACCAAACGGT
820	92	1	MW2_CDS_06604	MW1233	FALSE	unmapped	TCAACAAAGTTATCTCAATATTGAACGCTTGAGAACTGAGGGTGAACAATTAGGTGATGA
821	91	164	MW2_CDS_03119	MW0573	FALSE	unmapped	AGTTGGTGTTTCAACGGTTGATGATTATCCAAAAGATGTGAAAGAGGGTAAGAAACAATT
822	91	162	MW2_CDS_00838	MW0155	FALSE	unmapped	ATGGAATTGCCTTGGGTAAGCTTTATTGTCCACTTTAGTTTTTCTATCGTCATTGCAATT
823	91	160	MW2_CDS_13625	MW2575	FALSE	unmapped	TCATTGAGTACATCAGATTCAGACTCGACATCGACAAGTACATCGGACTCAACAAGTGGT
824	91	158	MW2_CDS_00029	MW0006	FALSE	unmapped	CATGCATCATTAATTCGATTCCCTGAATCAACATTACGTCCTTTAGGCCGTACAGCAACG
825	91	156	(+)E1A_r60_n9		pos		
826	91	154	MW2_CDS_03499	MW0642	FALSE	unmapped	TGAAACGAATCGCAGTTTATTGTGGTGCAAGCAAAGGTCATGACCCTTCATATGTACAAA
827	91	152	MW2_CDS_02306	MW0426	FALSE	unmapped	AAAGTCTTGCAGCATATGCACCGAAAGGCTTAATGATTCATCATACTGGAGATGCGAATG
828	91	150	MW2_CDS_07375	MW1377	FALSE	unmapped	ATTTTAAACACACAAGCTCATGCGCGTCTTGATCAAATGGCACAACAGTTTGAAGTTGTT
829	91	148	MW2_CDS_00512	MW0096	FALSE	unmapped	AAGAAAGTGCATGGTGCTTGGTATGCCATTTTAAGAGGAGGTACGCAACAATTTAGACTG
830	91	146	MW2_CDS_05594	MW1037	FALSE	unmapped	CGAGTATCAAACAAACTTTAAAAAACAAGTAAATAAAAAAGTTGTGGACGCACAAAAAGC
831	91	144	MW2_CDS_12987	MW2458	FALSE	unmapped	TATTGGTACACAGACAGGCGGTTTTTACAGATTGAGCGATAAGAAGATAACCTCTGTGCC
832	91	142	ETG04_27747		pos		
833	91	140	MW2_CDS_10837	MW2046	FALSE	unmapped	GTGTATTTAACCTTGTTAATGGTGATGGTGCTGGCGTTGGGAATCCTTTATCTGAGCATC
834	91	138	MW2_CDS_10745	MW2029	FALSE	unmapped	AAGTTAAGACAAGCAGGCGCTTTAGACTACACTATTGTTGTAGCAGCATCAGCTTCTGAA
835	91	136	pMW2_017		FALSE	unmapped	TTTCCAGCACACACCATTTGATGATAGTTATATTGAAGATATAGAAAACTACCTGCTAAA
836	91	134	MW2_CDS_09581	MW1799	FALSE	unmapped	TTAGCACTTAAAAGTGGAAAGGTTGAAGGTGCTGTAGTTGAAAAACCTGTAGCAGAAGCA
837	91	132	MW2_CDS_07726	MW1457	FALSE	unmapped	CGAAGATTGTCTAAATGCTGCCGTCGACCGTAGTATTGAACTTTCTAATGTAGAAGACCA
838	91	130	MW2_CDS_00147	MW0027	FALSE	unmapped	TTGGTAAACCTCAAAAGGTAATTACAGATCAGGCACCTTCAACGAAGGTAGCAATGGCTA
839	91	128	MW2_CDS_02168	MW0400	FALSE	unmapped	AGAACATGCACTGGTGAATATTTTGTCAGGATAGTTAAAGAAGACAGTGAGGGCAAGGTA
840	91	126	MW2_CDS_01985	MW0365	FALSE	unmapped	TTAGGAACGATAGGTGCTGGCTTACTTGGGATGGTCGATATTAATCAAGTCAATCATGCC
841	91	124	MW2_CDS_02894	MW0532	FALSE	unmapped	ATTTACTCGATTCTAACCAGCGATTAAATGTGTCATTTTCTAAGGATAGTGTGGCTGCAT
842	91	122	MW2_CDS_12852	MW2432	FALSE	unmapped	ACCTATCGTACCATCGGAAATTATTCTGACATTTGCTGGCCTTATGTCTGTTAAATCACA
843	91	120	MW2_CDS_06263	MW1163	FALSE	unmapped	GCAAGTGAGTGGCAAGAAGATGAACTTCAAGCAATGATAACTGAATTACCACAACAGCGA
844	91	118	MW2_CDS_08041	MW1514	FALSE	unmapped	GCATGGATCCGGATGAATACATTGGTAAGTATGGCAACGACGCATTTACTGCTTTTGTAA
845	91	116	MW2_CDS_09642	MW1810	FALSE	unmapped	TGCTAGTCATTTTGACGATGATTAGTGCATTGGTTAAACCAGTAAACTTCGAAACATCAT
846	91	114	MW2_CDS_12158	MW2301	FALSE	unmapped	CGGAGCTTGCAGTTCAAGAAGAAACTGGTCGTACATTTGAACTCAAGTTAAATCACGACG
847	91	112	MW2_CDS_05825	MW1083	FALSE	unmapped	GGTGCAAACGTAATGTTTAATAGCCCAAATGCTTGGATTGATGATTCTTTAGAAGCACCT
848	91	110	MW2_CDS_01079	MW0199	FALSE	unmapped	CATATCGAAAGTTCTGAAGAAGCGCGTCACCAGACAATTGGTAAAATGATGCTTCAACCA
849	91	108	MW2_CDS_01977	MW0364	FALSE	unmapped	AGGATTATACGATATCGCACAGCAAGCGAATGCTAAGACAGCTGGTATTGGTATTGTTGT
850	91	106	MW2_CDS_07622	MW1438	FALSE	unmapped	TAATAATAATTCAGATCCATCTAATAATACTCCTGCAAATATAAATGAAAACGATTCACA
851	91	104	MW2_CDS_07136	MW1333	FALSE	unmapped	ATTGATCCAGAAATGGTAGAGATTGCTAAGCGTAACGCTGAAGAAGTTGGGTTGTCTGAT
852	91	102	MW2_CDS_04719	MW0871	FALSE	unmapped	TGAAATAAGACCACAGCATTTTGTCTTTAGTACTGAAGAAGAAGCGGCACAACTACGAGA
853	91	100	(+)E1A_r60_a97		pos		
854	91	98	MW2_CDS_10090	MW1898	FALSE	unmapped	GGTTGGCTTGTTCAAAGGTAAATTCACTCGTTCAAGCATCAAAGGGCAAACAAAACAAGA
855	91	96	MW2_CDS_06266	MW1163	FALSE	unmapped	ACGTCAAAGTGACAATGGAAGAATTATTGTAATTTCATCAATTTGGGGTGAGACAGGAGC
856	91	94	agr_tiling 198_R		FALSE	unmapped	GTGAATTAAAAAATGATGTAACGTTTCTTTGTATACCTATTCCTATTACTACATAATTTA
857	91	92	MW2_CDS_13079	MW2475	FALSE	unmapped	TATAAATCAATTGGTACAGGTGTTACAATTCCGCCGTGGAACTTCCCGTTTGCGATTATG
858	91	90	MW2_CDS_02789	MW0514	FALSE	unmapped	GCACAAGCACCAGTTGCTGACACAGATTTAACAGTACCATATATTTGTTTGAATGGTGCT
859	91	88	agr_tiling 070_R		FALSE	unmapped	TGATGTTTTTAGCATTAATAAGTGTTGGAGTAGTGATTAAATATGCACCTGCAGCCACTA
860	91	86	MW2_CDS_01912	MW0351	FALSE	unmapped	ACACAAAAAGATGATATCGTCATTGTTGCACATCAAGTTGTCATTCGTTGTTTGATGGTT
861	91	84	MW2_CDS_05462	MW1012	FALSE	unmapped	ACGCATTTGGAATTTGAAAAAGCAATTCCTACATTAGCTGACGCAGCAAAACCAAACAAT
862	91	82	MW2_CDS_03466	MW0635	FALSE	unmapped	CGGTTATTTAGCTAGTTTATGTGCTGGTTTAGAAGTGCCATTTATGATCATTCTTGGCGT
863	91	80	MW2_CDS_10883	MW2055	FALSE	unmapped	GTGAAGCGTATGTAGGCGTTTGGACAGAAGAAAGTGTGGCCGTATCATTTTTAACAAGTC
864	91	78	MW2_CDS_03832	MW0701	FALSE	unmapped	TTCAACCTCTTAGACAGCCCAGTAAAATATACAAAACATATTGGCGGTACGCATCATTTT
865	91	76	MW2_CDS_10997	MW2080	FALSE	unmapped	ACGTGGTGCACATCCATGTATTATTTCTATGGAGGGTCTTGAAAAAGAAGGCGACACTTA
866	91	74	MW2_CDS_09887	MW1855	FALSE	unmapped	TTAATTCGCTATGCTGGCTATGACAATTGTGGTGATCCTGCTGAAAAAGAAGTTACACGC
867	91	72	MW2_CDS_13775	MW2601	FALSE	unmapped	TCCAAGTTTTGAAGGACAAGGGTACGCATGTGAGGCTATTACAGCAATCACAAATTTTGT
868	91	70	NC_A_099		FALSE	unmapped	GCGCAATTGCCTCTGTAATTTAAAGTGACCAAACCTAAACTAAAGGAGACAATTGCGCCT
869	91	68	MW2_CDS_07432	MW1389	FALSE	unmapped	TCGCAGACATCCTTATTATGTTATTACTTCTCAAATGCCTGGTGTTAAATATGCAGTGAA
870	91	66	MW2_CDS_12923	MW2445	FALSE	unmapped	GAATTGTTCAAGATTGCCTCTGCTGTCGCTCCAAGTAATGATAAGCAGGGTGTTTTAACG
871	91	64	MW2_CDS_06492	MW1211	FALSE	unmapped	ACAACCATTTGGCAAAGAAGCATCAAATTATAGTAAGAAGACATTAACAAATCAAGATGT
872	91	62	MW2_CDS_09146	MW1715	FALSE	unmapped	TGATGCATGGAGAGATGCATCTGCAACTGAAATTAAAAGTGCAATGGATAGCGGTACTTT
873	91	60	MW2_CDS_06378	MW1184	FALSE	unmapped	AGCGTGCTGCTGAAAAAGGCGCAGAAATTATCAACTATACTAAATCTGAACACTTCACTT
874	91	58	MW2_CDS_07625	MW1439	FALSE	unmapped	TGTGAAATTATATTTAACTCAGATGACACATTTACCCTAAAGCGATTATCTAATTACGTT
875	91	56	MW2_CDS_02073	MW0383	FALSE	unmapped	ACATTTGAATTGGATAAAAAGTTACAAGAAGACCGGATGTCCGATGTTATCAATGTCACA
876	91	54	MW2_CDS_04498	MW0831	FALSE	unmapped	TTCTTAGCACTATTAACGATCATCTTTGGTTGTGTCGGTGCTGTTGCATATGCCAACATT
877	91	52	MW2_CDS_10625	MW2005	FALSE	unmapped	AAAAGCGCATGACCGTGTATTAGTTAAAGGATCACGTGGTATGAAATTAGAAGAAGTGGT
878	91	50	MW2_CDS_12726	MW2408	FALSE	unmapped	TGAAAAAGGAGATAAAGGGACTTGGATTGTTGATTCTGAGATGGTAGTTGAGCTGAAGGA
879	91	48	MW2_CDS_04923	MW0907	FALSE	unmapped	TGAAGCAGCATTTAATCAATATACGGCAGAATACAAAAATTTGGAGGCATTTCTCGGTGA
880	91	46	MW2_CDS_03545	MW0650	FALSE	unmapped	CGCATCGTATCATGCCGATACTTGGAACAAGTCAGTTAAAGCGTATTGATCAAGCAATCG
881	91	44	NA		ignore		
882	91	42	psma_tiling_066_R		FALSE	unmapped	ATGAATTTGACATGAAGCAGAAATTTAATTATATTTTATGTTATAAGTTTAAAACGAATA
883	91	40	MW2_CDS_08878	MW1667	FALSE	unmapped	AGGTGCAACGTTTATTGGAACATTAACAGGTTTAAAAGGTAAGGATGCTGCAGGTGAGTT
884	91	38	MW2_CDS_07302	MW1364	FALSE	unmapped	ATTTTAGGTGAAGATCGCGTTATCGTTTCTAATGTTGCAGGGACAACGAGAGACGCTATT
885	91	36	MW2_CDS_00477	MW0090	FALSE	unmapped	GAAGCATGTGCACGCTTTGTTGATAGATGGCAACAACAGCGTCCGGAAATTAATTTTATT
886	91	34	MW2_CDS_03001	MW0552	FALSE	unmapped	AGGATTTATAGGTATTGCAGCATTTTACATTTACTTAAATAAAAAGCTTAAACTAAAGAT
887	91	32	MW2_CDS_05584	MW1035	FALSE	unmapped	GCTGAAAAAGGACTTGAATTAGGTTGTTTGTTTGCATTTTATGGACATACACATGTGGCA
888	91	30	MW2_CDS_05546	MW1028	FALSE	unmapped	TTTTTGGGCAACATGGTGTGGTCCATGTAAAATGATCGCTCCGGTATTAGAAGAATTAGC
889	91	28	MW2_CDS_10768	MW2034	FALSE	unmapped	TTTTGAATGCTATTTAGCTAAAGCTAAAAGACCAGACACTATGCATATTTCAACTGGAAA
890	91	26	MW2_CDS_01531	MW0281	FALSE	unmapped	AGGTGCAATCGGTATGTTTAAAGCATCTAAAAACAAAAAAATGAGTGGTATATTGTTGAT
891	91	24	MW2_CDS_08987	MW1686	FALSE	unmapped	TGGCAGATAAAACCCTTGAGAGTATATCATCTAGTCAAATTATGCCTGTCATTAGAGCGA
892	91	22	MW2_CDS_11372	MW2152	FALSE	unmapped	TTCCGTTTCACTGCATTAGTTGTAGTTGGAGACAAAAATGGTCGTGTAGGTTTCGGTACT
893	91	20	MW2_CDS_08680	MW1633	FALSE	unmapped	ACGAAAACAGGATATTCTACTGCTGTAGATGTCTTAGAGCAATTGCAAGGTGAACATCCT
894	91	18	MW2_CDS_01496	MW0275	FALSE	unmapped	ACCGGTAGAATGGGAAACGGTATATGCAATGGCTTATGTAAATGAAAGAAGTGGAGAAGT
895	91	16	MW2_CDS_06438	MW1200	FALSE	unmapped	TGGTTACATTTCTATAGAAGATTTTTTTAAGCATATGGATGAATTATCGAAGAAAGAAGA
896	91	14	MW2_CDS_00460	MW0087	FALSE	unmapped	CCGTAGCTGGAGCAATCGTCTTTGTGGGTCTTATCGTACCGAATATTAGCAAACGATTAT
897	91	12	NC_A_083		FALSE	unmapped	CTGTAGTACCATGTTTTTTATTAGATAAGACGTTACTATATGTATATAGAGAAAAGAAGT
898	91	10	MW2_CDS_01949	MW0358	FALSE	unmapped	AAACCTTTAAGTGAAGACGTTGTTAAGAAATTGGTAGAAGCTGGACAAAGCGCTTCGACG
899	91	8	MW2_CDS_02096	MW0387	FALSE	unmapped	GTCATAGAAGAAGAACCTGTTAAAGGAAGACAATATTCAATTGGCGGTATAAGTAAGACA
900	91	6	MW2_CDS_01027	MW0190	FALSE	unmapped	CAAAAATGGTACGACAAAGGGTATCTTCCTAAGGCAGCAACACATGATGTCATGATTGGT
901	91	4	MW2_CDS_12777	MW2418	FALSE	unmapped	TCGAAAAGGTCAATAAATTCATAAATGTAGAAGCGTACATATTTTTTCTCACTCAAGAGT
902	91	2	MW2_CDS_06229	MW1157	FALSE	unmapped	ACGCGTGAAATTATCGAAGAGGCTCTAGAACAAGCGAGACGTGGTCGTTTAGAAATAATG
903	91	163	MW2_CDS_11955	MW2266	FALSE	unmapped	TGCAACGCCAAATGCCATGGCAAATTTAGATGTTATTACTAAAAAATATGGTAACTCACC
904	91	161	MW2_CDS_05951	MW1106	FALSE	unmapped	TCTCAGTGGGAGACTTTGATTCAGTCAGTAAAGAAGAACGCCAACTTCTAACAGAACAGT
905	91	159	(+)E1A_r60_n11		pos		
906	91	157	MW2_CDS_02998	MW0552	FALSE	unmapped	CTTTCTAATAAGCATGGGCTCAATTAGTAATAAAAAGGTTTATGCCAAACTTAAAAAGCA
907	91	155	(+)E1A_r60_a107		pos		
908	91	153	MW2_CDS_12166	MW2302	FALSE	unmapped	ATACTAAAACGAATATCCATTCTGCTAAGGTCAAAGAAATTAAAGATAATCCAGCAGCAT
909	91	151	MW2_CDS_00820	MW0152	FALSE	unmapped	TTGATTTCGGGGTTCAGTATCATCATGATGGGTGAATTTTCAATCTCCTCATATATTGCT
910	91	149	MW2_CDS_12046	MW2281	FALSE	unmapped	AAGGTTAATACGGCATTTTATCCAGTGAAAAATTTAACACAACAACAACGTGATGAGCTT
911	91	147	MW2_CDS_04729	MW0873	FALSE	unmapped	TCCTACTTTTGAACCAAGAACTGCTGCGATAAAAGATTTCTGGGAAAAAGTTGGCTTGAA
912	91	145	MW2_CDS_09547	MW1793	FALSE	unmapped	ACTTGATGGGTTTTATGCGAGTTTAACAGGAGTTTTAGGTACGCTTGTTGCTCTAAATCC
913	91	143	MW2_CDS_03948	MW0721	FALSE	unmapped	GCGCAAGTTACAAACACTAGTTGATGTTGGTCTTGGATACGTCACATTAGGTCAACAAGC
914	91	141	MW2_CDS_06425	MW1193	FALSE	unmapped	ATTTCAAAAAACTCAGGTGTACCACGTCAAACAGTTACTGATTTAAAGGTAGGTAAAACT
915	91	139	MW2_CDS_06523	MW1217	FALSE	unmapped	ATCGAAATGAGAAGTGATATTCCATTGGCAAGAGGGTTAGGTTCGTCAGCTTCTGCTTTA
916	91	137	MW2_CDS_08454	MW1590	FALSE	unmapped	CAAATTGAAGGTAATGATTGGGAAGTCTTACTGAAACCAGCTAAGCGTATTAAAGTTGGT
917	91	135	MW2_CDS_04339	MW0798	FALSE	unmapped	AATAATCTAGATCAATTATATAGATCTGTCATTATGGATCATTATAAAAATCCTAGAAAT
918	91	133	MW2_CDS_13519	MW2557	FALSE	unmapped	AATCAAACAGAACAAGAGATGAGAGAAAAGTTTAGACACTATTGTGAACATGAAGTTCTA
919	91	131	MW2_CDS_00261	MW0049	FALSE	unmapped	CAACCTGTTCCATACCGATAGAGGCAAAGACTTTGATAATCATTTGATAGATGAAGTCCT
920	91	129	perR_tiling_066_F		FALSE	unmapped	CATATGATAACCAACGACAACATATATATGATTCGAAAATAACTGGTAAACGCCTATCAG
921	91	127	MW2_CDS_06089	MW1132	FALSE	unmapped	TGCATCATTTGGCAGTAGTAGGTGCAAGAGATTCTACAAGTTATACCCAACAGTCTTTAG
922	91	125	MW2_CDS_08377	MW1576	FALSE	unmapped	TATTTAGAACAGCTTGTAGGTCCTTTAAGAAATGCGGGGTTAATTCGAAGTGTACGCGGT
923	91	123	MW2_CDS_10619	MW2004	FALSE	unmapped	GTACGGGTCGTGCTGGTAAAGAAGGTATCGCGGTAACATTTGTAAATCCAATTGAAATGG
924	91	121	(+)E1A_r60_a107		pos		
925	91	119	MW2_CDS_00773	MW0143	FALSE	unmapped	TGCCCATGTTGTGTTAGATAAAAAATATGAGGGTGATGATTATCAAGCGATTGATCAAGT
926	91	117	MW2_CDS_11524	MW2184	FALSE	unmapped	AGGTACAGCGATTGGCCCATTTCTAGGCATGTTACTTATTACAAAATACCCAATTGATTT
927	91	115	MW2_CDS_12939	MW2448	FALSE	unmapped	TGCAGGACACACTTTCATTGACCGTCCGAACTATCAATTTACAAATCTTAAAGCAGCCAA
928	91	113	MW2_CDS_04842	MW0893	FALSE	unmapped	TGGTGTCGCAAACTTAATTCCTTTCTTAGGTTCATGGTTATCATTTGCACCTGCAGCAAT
929	91	111	MW2_CDS_01997	MW0367	FALSE	unmapped	GGTGTAGACTTCCTTGCGCAAGGAACACTTTATACAGACGTTATCGAATCAGGTACCAAG
930	91	109	MW2_CDS_12734	MW2409	FALSE	unmapped	TTGGGACACATGCCGTTACTAATGGATTTCATACAACAACATTCTATAGATCCAAGCGTT
931	91	107	MW2_CDS_05529	MW1025	FALSE	unmapped	ACATTGTTTTGTAAGTTCATTTTATATCTAATTATCGTAACTTTTGATAAAATAATAGCG
932	91	105	MW2_CDS_09112	MW1709	FALSE	unmapped	CTGGTGTCATTTGTGAGATTATGAATGATGACGGCACGATGGCGAAAGGACAAGATTTAC
933	91	103	MW2_CDS_08098	MW1524	FALSE	unmapped	ATTCGTACTGACATTGATAGAGAAAAAGAAAAGCAAATTGCTAAAATGGAAAAACGTGCT
934	91	101	MW2_CDS_01096	MW0201	FALSE	unmapped	GTGGTGTAGGTATTGACGGACGTCCACTTGTTACGAAAAACTCATTCCGTTTCTTACACT
935	91	99	MW2_CDS_11484	MW2176	FALSE	unmapped	AATCACATGCGTGGATCAGTAGGTATGATGACTGGTGCTATGAATATTGGATTGTTTGCA
936	91	97	MW2_CDS_13442	MW2543	FALSE	unmapped	CGTGCATTAGTTACTAAACCGACGATTTTACTAGCCGATGAACCTACAGGTGCACTTGAT
937	91	95	MW2_CDS_06187	MW1148	FALSE	unmapped	TGGAAGACTTGAATTTTGAACTTGTAGACGTTGAATATGTCAAAGAGGGTAGAGATCATT
938	91	93	MW2_CDS_07499	MW1402	FALSE	unmapped	ACAGCTGAAAGAATATATAGAGGATTATAAAAAATCTGATGACATATTAATTAATTTGTA
939	91	91	MW2_CDS_01382	MW0253	FALSE	unmapped	TTTACAGCAATTAAATTTTGATGATACGTCTGCCAAAGTATCTACATTGTCCGGTGGGAA
940	91	89	MW2_CDS_05059	MW0936	FALSE	unmapped	AACCATCAACTGGTAAATTAACAGTTGCTGCAAACAATGGTGTCGCACAAATCAAACCAA
941	91	87	MW2_CDS_06677	MW1248	FALSE	unmapped	TTCTCAGTCATTGACCCATTAGATACAGGGGGTCAATATCAAGACCGTGGTCCTCAATAT
942	91	85	MW2_CDS_12847	MW2431	FALSE	unmapped	GGGCGATTATTGCCAAAGACTTACCTGAGCAACATAGAATGGTTAATGAAGCGGAGAAAC
943	91	83	MW2_CDS_09013	MW1691	FALSE	unmapped	AGAAATTTTCGAATAAAGGGTCACGTATTTATCGTATGGAAGCGAAATTCCATTCACAAA
944	91	81	MW2_CDS_03099	MW0570	FALSE	unmapped	TCCACTAGATGTTAAAACATTACGCATTTTACATTTCGTAAGTGGAGACGGTGGCAAGCT
945	91	79	MW2_CDS_06207	MW1153	FALSE	unmapped	TGATCAATCAATCGAATATGGTAATAAAATTGAACGAATGATTCAAGATTTACACAAACA
946	91	77	MW2_CDS_13740	MW2595	FALSE	unmapped	AGCATTTCGTTCGTTATGGAACGATGTACATTCCAATGGATGAAACATTAGCACGTGTCG
947	91	75	MW2_CDS_08735	MW1642	FALSE	unmapped	TCACGTTTAGGTGGATATGCGGTAGACTTATTAATGCAAGGTGAAACAGCTAAGGGTGTT
948	91	73	MW2_CDS_00926	MW0170	FALSE	unmapped	ATGCGCTCAGATGCTAATACAAAATCTATATTCTCTGCAACGTTAAGCTACATACTGTTT
949	91	71	MW2_CDS_05468	MW1013	FALSE	unmapped	AGTAAAAACACTGCCAAAGATGAACGCACTTCTGAATTTGAAGTAAGTAAGTTGAACGGT
950	91	69	MW2_CDS_04226	MW0776	FALSE	unmapped	AGAGCATATGTGATGTCTAATTACACAGATCATCAATTAATTGAAACTACAAATAGAGCT
951	91	67	MW2_CDS_13206	MW2500	FALSE	unmapped	ATTCAAAGGTGCGCTCATTATGGGACGTGCACAAGATGGTTTTCTTGATCAAGACAAATA
952	91	65	agr_tiling 031_F		FALSE	unmapped	TAAATTTGTTATCTTCGTATAGTACTAAAAGTATGAGTTATTAAGCCATCCCAACTTAAT
953	91	63	MW2_CDS_02987	MW0550	FALSE	unmapped	AGCAGAATTAACTTGTTTAAATCCTGTTCAATTACGACGCGTGACGACTCAACTTGTCGA
954	91	61	MW2_CDS_11270	MW2129	FALSE	unmapped	TTGCATTTGGTTTAAGTATGACGTCGAAAAACGTCGCACGTTACGAAAGTATCAACGGAG
955	91	59	MW2_CDS_06368	MW1183	FALSE	unmapped	AACTACAGCTTTAGGTGCTGCATTTTTAGCAGGATTAGCAGTTGGATTCTGGGAGAGTAA
956	91	57	RC3		pos		
957	91	55	MW2_CDS_00691	MW0129	FALSE	unmapped	TCAAGTTAATGATCGGAATGTTGAACTAACGCTAAACTACGTGGATGATATCGTCGCTGA
958	91	53	MW2_CDS_07151	MW1336	FALSE	unmapped	GTGACGTTCGATGAATTAACAGCATTCATCAATGACTTACAGTGGTCTGAAGATCAAAGT
959	91	51	MW2_CDS_09359	MW1758	FALSE	unmapped	TCACGTTGCTATTAGCAGTTTTACTCTTTAAAGGATTTAATAAATGGAGCGGTAGAACAA
960	91	49	MW2_CDS_06153	MW1143	FALSE	unmapped	GGCGATGGGCTAAGAAGCGAAAAATGCCTAGAATTAAAGGTCATTACGAAGGTATGCAAA
961	91	47	MW2_CDS_07057	MW1318	FALSE	unmapped	CAGTTTTTGCTGGGCAAGATAAAGAAGCAACTGCTACAATGCGAGAATTCATTCAGCAAG
962	91	45	MW2_CDS_07434	MW1390	FALSE	unmapped	GAGGAAATGCAGGTATAACTCAATCTAGTGCGCTTAGAGACATCAACGTTTTACAGGGCA
963	91	43	agr_tiling 060_F		FALSE	unmapped	GTAATTAAAGTGAAGATAAAAATGTTTAAAATATAGGCAATAGTATACATAACAATTAAT
964	91	41	MW2_CDS_02702	MW0499	FALSE	unmapped	AGCAAACATGCTTTGGGTAAACATGTAGGTATTAACGTCAATGCGACAATAGTAGCATTG
965	91	39	MW2_CDS_11995	MW2273	FALSE	unmapped	TTGGTATGGCATTTATAATGATGCCAATGGTAACTGCAGCTATTAATGCGTTACCGGGAC
966	91	37	MW2_CDS_10644	MW2010	FALSE	unmapped	AATCAAGGTGCTCAGGAAGAGGCGATGGAAGAGTTATTAGTGACTTTTCAAAAATTGATT
967	91	35	MW2_CDS_06845	MW1277	FALSE	unmapped	AAAGCAACAGAGCCTACGAAAAAAACAATTCAAGATAACTCTTATGCATTAAGTAGACCA
968	91	33	MW2_CDS_09800	MW1839	FALSE	unmapped	TGTTGGTCCATTTGCTTATTACATCAAAGGTTTCGAAATGTTACCTCAAATGAAAGCTGT
969	91	31	MW2_CDS_08806	MW1654	FALSE	unmapped	GTCGTTATTCCAACAGATGAAGAAAGTATGATTGCCCGTGATGTTATGACATTCGGTGGT
970	91	29	MW2_CDS_05282	MW0978	FALSE	unmapped	AGAAGCTGGTGAAATCGTTCATAAACATTACTGGAATATCGGTATTGCAGCAGACACTGA
971	91	27	MW2_CDS_02642	MW0487	FALSE	unmapped	TTCCAATGGTTGGACATGTAAACAGTTTGAATGCTTCGGTTGCAGCAAGTTTAATGATGT
972	91	25	MW2_CDS_11644	MW2206	FALSE	unmapped	TTGCATTTTACACAACGAGAGCAAGACAAATTAATGATTGTAGTGGCGGCGGAAGTTGCA
973	91	23	MW2_CDS_11409	MW2161	FALSE	unmapped	ACAAATCAAATCTTCAAAAGAAGAGCTTTTTAACCTACGCTTTCAGTTAGCTACAGGTCA
974	91	21	MW2_CDS_08981	MW1685	FALSE	unmapped	TCTATCACCGAAATTTGTAGTTGGCTACGTTGAAACTAAAGACAAACATCCTGATGCAGA
975	91	19	MW2_CDS_04212	MW0771	FALSE	unmapped	ACAACAAGCGGAAAAGCAATTGTCTATTGTTAAACCGTTGCCTAATGGTAGCTTCCAAAT
976	91	17	MW2_CDS_10573	MW1996	FALSE	unmapped	ACGAAACGGCATTTTATTTTTGGATGAAAAAGTAATACCATATTTTCGTATTCAAAATAT
977	91	15	MW2_CDS_09251	MW1736	FALSE	unmapped	TCCGGATAATGTATTGAATTGCAAGTCGGACTTTTGGAAAACGTTAAAATATAAAAAGGA
978	91	13	MW2_CDS_07630	MW1441	FALSE	unmapped	AACAACTGGGATACCAGGATTTTATACTTACTATGCTCTATCCAATAAGAATTTGGTGTA
979	91	11	MW2_CDS_12823	MW2426	FALSE	unmapped	GCGTCGACGTCTCCAATCACACATTTAAAAGACATAGAGCATGTCATGAGTAAATCAGCT
980	91	9	MW2_CDS_05010	MW0927	FALSE	unmapped	GCTGTTTAGAAGCGGCTTAGACTTAAATGTGGATTTCGTAATTCGTGTTGGGAAACCAGT
981	91	7	MW2_CDS_09641	MW1810	FALSE	unmapped	AAAGTGACACAAACTGATAATCAACAGGATGTTTCAAATGATAGTACAGACGAGGCGGAT
982	91	5	agr_tiling 133_R		FALSE	unmapped	TTGAGAATCTTAAAGTACGTGAGATTAAAGGTCTTCTAACAGCTAAAATTTTACGTGCAC
983	91	3	MW2_CDS_09114	MW1709	FALSE	unmapped	TCAATGAACATGGTGGCATGATTATTTATCTACCTCAAGAAGGTCGTGGCATAGGATTGT
984	91	1	MW2_CDS_11279	MW2131	FALSE	unmapped	TTATTGCAACATGGTGACCTAGGTATCGCTACACTAACAGGTTCAAATGGTGAGGTCATC
985	90	164	MW2_CDS_06680	MW1248	FALSE	unmapped	GAAAAATCCAGAGCGCTATGCAGAAGAACAAAAAATACGCCAAGAATACAAAAATAAGCA
986	90	162	MW2_CDS_12834	MW2428	FALSE	unmapped	ACGGCAAAAAGCGATAGAAATTGCGAATGCAATGTTAAAAGAAGGATATCTTGAAAAAGA
987	90	160	MW2_CDS_04453	MW0822	FALSE	unmapped	ACATACGGTATGGGTGCAGAAGAAGCGCCTGGTGAAAATGATGAAGTCTTAGAATACTTT
988	90	158	MW2_CDS_04565	MW0843	FALSE	unmapped	CAGAGGATGCGTTCGATCTAACAAATGCTTTAGAAGAAACACCAGATGCTGCTGATGAAA
989	90	156	MW2_CDS_04524	MW0836	FALSE	unmapped	AGCTACTGGTATGGGTGGCGAAAGTATTTATGGCGGTGCTTTTGAAGATGAATTTTCATT
990	90	154	MW2_CDS_06092	MW1132	FALSE	unmapped	AGAGGAGGGAAGAAAAAAAGATAGTTATTTATGTGAATGGGTGAATAGGGAAGAAAATGT
991	90	152	MW2_CDS_11249	MW2125	FALSE	unmapped	TGCAATAAACATTTTTGAAGATTTGTTTTCGCCTTCTGATTCTATAAATTTGGTTCATGT
992	90	150	MW2_CDS_08767	MW1648	FALSE	unmapped	ATATAACAGTGCGCTTTGGCATACTAGACGTCGGAAGAAACTTCGCCAAAATAGAAGTGA
993	90	148	perR_tiling_046_F		FALSE	unmapped	TTTAGATGTGTTTGAAAATGAACCTTTGAAACCTAATCATGAATTATATGAATTGGATAA
994	90	146	MW2_CDS_00314	MW0061	FALSE	unmapped	TCCAGGTTCTAAAGAAATGATATTAATTCTAGACTTTACCGAAGCAACAAATCTCACTGA
995	90	144	perR_tiling_072_R		FALSE	unmapped	TAGCTTGAACACCTTTTCCATTAGTTAAAAGTATGCCGTGATCTGCAATATAATCTAACG
996	90	142	MW2_CDS_12180	MW2305	FALSE	unmapped	AAGGAAGTTACATTTAAAGATGAACCTGGTGTAACTTATGTTGTGCAACCAATCAGTACT
997	90	140	MW2_CDS_13138	MW2487	FALSE	unmapped	CTTACGTTGAAGGCGTTAACAGCAACGGTTCTGTTCGTGTTTCAGAAATGAACTATGGAC
998	90	138	MW2_CDS_09109	MW1708	FALSE	unmapped	AGCATTTGTGCCAGGTGCGTTTGAAATTCCTTTAGTAGCTAAAAAATTAGCCTCATCAGG
999	90	136	MW2_CDS_07929	MW1494	FALSE	unmapped	GCGTATGCATTGAAACATAATAGAAATCCATCGTCTATTGAAGACTTAATTGCAGATGGT
1000	90	134	MW2_CDS_10498	MW1982	FALSE	unmapped	CATTGTTCACGTAGCATTTAAATTGGCCGCTTCAAGACGAGGAAAACTAACATCAGTTGA
1001	90	132	MW2_CDS_13540	MW2561	FALSE	unmapped	GCGAAGATGAAATTGCATTTTTAACAATTCATTTTCAAGCTGCCATCGAGCGTCGTACCA
1002	90	130	MW2_CDS_07003	MW1307	FALSE	unmapped	TGGGTGGAAGCTTAGGAAGTAAAAAATTAAATAGCATTATTCGCGAAAACTTAGATGCAT
1003	90	128	MW2_CDS_07907	MW1490	FALSE	unmapped	TGGTTTCATGGGTACCGGTAAATCTACGATTGGTAAATACGTTGCAGATGAGCAAAATTT
1004	90	126	MW2_CDS_07782	MW1467	FALSE	unmapped	AGTATTTGCTGGACAAGATAAAGAAGCGACACAAAGAGCGCGTGAATACTTCGAAGGTTA
1005	90	124	MW2_CDS_02196	MW0405	FALSE	unmapped	ATGCTATTTGTCATTTTAGTTTTATATATCATTGGTATTACATTTATTCTACTCAGTGTT
1006	90	122	MW2_CDS_10464	MW1976	FALSE	unmapped	CGCGCAAGGAGAACATTATGAACAAATTAAGGAGGCAATTATTCATGAATTCGCTGCTCA
1007	90	120	MW2_CDS_12713	MW2405	FALSE	unmapped	GATTGAAGCGCTTATTTTCTCAGACGTAAGTAGCTATGATATTTACGTGAACACTGGTGT
1008	90	118	pMW2_093		FALSE	unmapped	AGCTGAAGCTATAAAAGAACAGAGAGAATTAAAAGGATGGTCTCAAGAGGAATTAGCCAA
1009	90	116	MW2_CDS_10035	MW1885	FALSE	unmapped	TGCTATCCCCTCATTATGTCGAGTTTCCTATTAAACCTGGGACTACACTTACAAAAGAAA
1010	90	114	MW2_CDS_08446	MW1589	FALSE	unmapped	GTCTTACCGACACGTATTGCCAGAAATGGTACTTGTATGACATCGCAAGGTCGTTTAGTT
1011	90	112	MW2_CDS_09586	MW1800	FALSE	unmapped	AGCACTTGGTTATTTTGTCATACCATTTGTATCGGCATTTATTGTTCATGAATTGTGTAA
1012	90	110	MW2_CDS_08429	MW1586	FALSE	unmapped	AAATACTATCAGCACATCAAGAGTTAATCGCTAAATTTGGCGGCCATCATATGGCTGCAG
1013	90	108	MW2_CDS_13854	MW2615	FALSE	unmapped	TTCGCATTCATCGGTGTATTATATATGACGCTCAAGATTGGAGAATTCCCAATCGTTTCT
1014	90	106	MW2_CDS_03801	MW0695	FALSE	unmapped	GCATTGGTAACTGGCTTAACGGGAACTTTGCCATTATCACAAGTGGACGCTATGAAATTT
1015	90	104	MW2_CDS_10867	MW2052	FALSE	unmapped	GGGCGAAGATGAAATGGATGACGACGATGATATTCCAGCTCAAACAGATGATCAAGAAGA
1016	90	102	MW2_CDS_03787	MW0693	FALSE	unmapped	ATGCCAATCGTTGACCAAATTGAACGTCGTACTTATGGTAATGCGGAAACATTTTACCCT
1017	90	100	MW2_CDS_03055	MW0561	FALSE	unmapped	TAATAACTCTAGTAAAGGGAAAATAATTTTATTTCCTTCATTAAAAAACTTTTGTTTCAC
1018	90	98	MW2_CDS_01844	MW0336	FALSE	unmapped	ATTACACAACAAGAAGTAGCGAAGCGATTGAGTAAGTCGCGCCCGTATATAGCGAATATG
1019	90	96	MW2_CDS_01265	MW0232	FALSE	unmapped	ACACGTCTAGTATTGGAAAAAGGACTAACGTTGATTGGTAGTAGTCGAAGTGGTTCAAAA
1020	90	94	MW2_CDS_08916	MW1674	FALSE	unmapped	TACGCTAATGGTCTTTGCACAGCCTATTACTAATAACCCAGACGACTATGTGGATGAGGA
1021	90	92	perR_tiling_057_R		FALSE	unmapped	TTATAATAATGTCAGCATTTGGTAATGTGCTTTCAAGTGATTCGATAGTATATATCTCGT
1022	90	90	MW2_CDS_13485	MW2551	FALSE	unmapped	TTTATGGCGGCAAACTTTACAGTGACTGGACAAGTGAAATCAGGGGATTATTTTACAGCG
1023	90	88	NC_A_036		FALSE	unmapped	AACTGTTCTCTTTCCTCCCTTTTCAACGCAACTAAATTTCTTTTACCGTTAGAGCCCCAA
1024	90	86	MW2_CDS_11386	MW2155	FALSE	unmapped	GGTCAAAACGATGAGCGTGTTATCACAGGATTAAAACGTATTTCAAAACCAGGTTTACGT
1025	90	84	MW2_CDS_11759	MW2229	FALSE	unmapped	CGGCGGTGACTCAGGTAGTATTGAAGATCTAGAAAAAGCGGCAATGTCTGTATTGATAGG
1026	90	82	MW2_CDS_00545	MW0102	FALSE	unmapped	ACGGCGAACGGACGACATTAAATTATTGTTCGTTATATAACATACCAACAGCGGTTGTTA
1027	90	80	MW2_CDS_09861	MW1850	FALSE	unmapped	TGACTCAAGATGCTAAAAACAATGTTATTCCAGTATCCAATGGCGACCATTATCAATGGT
1028	90	78	MW2_CDS_09706	MW1823	FALSE	unmapped	GCTCTAGCATTACCAACGCTTGGTTCTGTAATTAGTCATTTCCTATTCGGTCCACTTGGA
1029	90	76	MW2_CDS_02001	MW0368	FALSE	unmapped	TGGAATTAATTTTACAAACACCTGTGCAAAACATCATAGTGATGAGGAAATGTATGTAAA
1030	90	74	NA		ignore		
1031	90	72	MW2_CDS_13763	MW2599	FALSE	unmapped	AGCAACAAAAGTGGCATACACAGGTTTAATCATTCGGAATAATGAAGCGGCTGTACAAGT
1032	90	70	MW2_CDS_05875	MW1092	FALSE	unmapped	ACAATGGACGAAGGTCATGATGTATTTTTAGAAATTGAAGTAGAAGGTGCAAAGCAAGTT
1033	90	68	MW2_CDS_11834	MW2244	FALSE	unmapped	TGGATACTTTAATGTACGCATTTGGTGTTGTAGGTAACATGGGTGGTGGCTTGTTAGACT
1034	90	66	MW2_CDS_12416	MW2350	FALSE	unmapped	AATTGAGGGTGCTGGGGGAATTGCCGTACCAATATATGAAGGTACAGATGATTTCTACAT
1035	90	64	MW2_CDS_09805	MW1840	FALSE	unmapped	ACACTGGTGTATCAGACGTTAAGATGGAAGAGGGATCTTTACGTTGTGATGCTAACATCT
1036	90	62	MW2_CDS_13199	MW2498	FALSE	unmapped	CTCATTTTAAGCAAATTAAAGATGACTATCATTCTAATTATGAGGTTATGCAAGTGTCGT
1037	90	60	MW2_CDS_01948	MW0358	FALSE	unmapped	GAAAATGGTGCAGCCAAGCCACGCTTACCATTTGACCATGTCTTCCATCATAATAAGTAT
1038	90	58	MW2_CDS_09178	MW1721	FALSE	unmapped	AAGCTTTCAGCTGACAATGTGAGATTAAACGTTACGGCTGTTTACACAATTGAACAAGTT
1039	90	56	MW2_CDS_04563	MW0842	FALSE	unmapped	CAACAACGATTTGAAGATAGTTTAAAACGAATCGATATTAATCCTTTAGGTGCAGCAGCC
1040	90	54	MW2_CDS_13853	MW2615	FALSE	unmapped	CTCGCGGTTGGACAAAAACAACGCAATGCATTTCAACGAGATATGAATCAATTGTTAGGC
1041	90	52	MW2_CDS_01251	MW0230	FALSE	unmapped	TTCTGTTCATTAGAAGATGGACACGCGTCACAACGAATTTGCCAAACGATTTTTAAGTGA
1042	90	50	MW2_CDS_09895	MW1856	FALSE	unmapped	ACACCAATGCATGATAAACCTGGGTTGTTAGCAAGTGTGCTTAATACATTTGCTTTGTTT
1043	90	48	MW2_CDS_02866	MW0527	FALSE	unmapped	CAGCAGTAACATGGGGAGCACATGATGCAAGGTCATTACTTCATTCAAATCCGGATTTTA
1044	90	46	MW2_CDS_02842	MW0523	FALSE	unmapped	ACGCATGCACAACTAAAAGGTGGTAATAAAGAACCTTATCGCATTGGTCTTAAACTATCA
1045	90	44	MW2_CDS_07310	MW1366	FALSE	unmapped	ATTAATATTGCATTAGATGGTCCAGCTGCTGCCGGAAAAAGTACAATTGCGAAACGTGTA
1046	90	42	MW2_CDS_06627	MW1238	FALSE	unmapped	ATCCAGAAAAAGTTAAAGTTAAAACTTGGGTTGAAAAATATTCGAGATTACGTTCAGTGT
1047	90	40	MW2_CDS_13359	MW2528	FALSE	unmapped	AGTAGATGATGAGGGGAATAGCGTACCTGCTAATACGAAAGGGAATATTGCAGTACCACT
1048	90	38	MW2_CDS_00288	MW0056	FALSE	unmapped	TTGCAAATGGTGCTAGAGCTGCTGGAAAAGATGTAACTATCTTCTTTACTTTTTGGGGGC
1049	90	36	MW2_CDS_08685	MW1634	FALSE	unmapped	CGTCACTTCCATATGGTGTCATTTTCAGTCAGATTATAATTTTAAGTATGATTGCAGCGC
1050	90	34	MW2_CDS_09702	MW1821	FALSE	unmapped	ATCTATCAATCCTAATCTTAAGGGACAATTGTTCAAACTGTTAGAATTTAGTAATATGGA
1051	90	32	NC_S_059		FALSE	unmapped	TGCAGTTCGTGTTAATGGGACTAATTAAGAAATTATAGTGGTTCTCAAATAAATCGGACA
1052	90	30	MW2_CDS_01337	MW0244	FALSE	unmapped	ACACCTGAAGATGTTATTAACGCAAAAGACGCTATAATCAATGCAGACTTTGTCGTTGCA
1053	90	28	MW2_CDS_04160	MW0761	FALSE	unmapped	TGGAAATTACTGCTAAAAAAGACGATAAAGATTTAAATCCATCTTCTATTTCTCATGACT
1054	90	26	NC_S_034		FALSE	unmapped	AGTGAGGGGATTGGTGTATAAGTAAATACTTATTTTCGTTGTCTTAATTATACTGCTAAT
1055	90	24	MW2_CDS_13162	MW2491	FALSE	unmapped	TTAGGGGTGCCGTTATCCGTCTTCTTTGGAGGCGTTAAAATGATGATACCTAATATGGTG
1056	90	22	MW2_CDS_11322	MW2141	FALSE	unmapped	AGTTGATATGTTAGAACGTGCAGATTATGAACCTAATGCATTATCGGGGGGACAGAAGCA
1057	90	20	MW2_CDS_06437	MW1199	FALSE	unmapped	ACTGACGTAACTCAGAACGAAGAGCAACTAGACAACAGTGATGAACAATCACAACAGAAT
1058	90	18	MW2_CDS_09260	MW1737	FALSE	unmapped	TCAGCCTGTTCAATGATGTTTAGTAATAATGACAATTCCACTAGTAATCAATCATCAAAA
1059	90	16	MW2_CDS_01794	MW0327	FALSE	unmapped	ACGATTTCTACTAATGAGACAGTTGGATTAATTGGGAAAAATGGCTCAGGTAAATCGACA
1060	90	14	MW2_CDS_11988	MW2272	FALSE	unmapped	TCAAGTGATTACAGAAGCTGACGCTATTCATAACGGCATCATTTTACTGGGCTGTAGCAT
1061	90	12	MW2_CDS_12708	MW2404	FALSE	unmapped	TGTTGTATATTCTTATAACGGCATTAAACGTAATTTTAAACAAGTTGAAAATGAAGGATT
1062	90	10	MW2_CDS_00967	MW0178	FALSE	unmapped	AGTCATTTGCCTAATACAATTTTAGAACTCTCAGAAAATATTTATTTGTTAAAAGATGGA
1063	90	8	MW2_CDS_13134	MW2486	FALSE	unmapped	AACTTTGAGAAGCATGGAAAATTTTGGAACAAATGGTTTTACGTAAGAAAATGGAAACAT
1064	90	6	MW2_CDS_02498	MW0462	FALSE	unmapped	TGAAGAAATTGCGTTAAAAGAAAAGTTGAATAATCTGAATGACAAAGATTATATTGAAAA
1065	90	4	MW2_CDS_12311	MW2331	FALSE	unmapped	ACGACACCAACTGCATTTATTAATGGCGAGAAAGTTGAAGATCCATATGATTATGAAAGT
1066	90	2	MW2_CDS_09037	MW1695	FALSE	unmapped	GATCCTCAAAGCTATAAAGATAATGCTAAGGATAAAGCGACGCAATTAGGAACAATTGCT
1067	90	163	MW2_CDS_03608	MW0661	FALSE	unmapped	AGATATAGTTATTGTTGCTGGAAGTGTACCAAGTAGTATTCCAAGCGATGCGTATGCGCA
1068	90	161	MW2_CDS_09600	MW1803	FALSE	unmapped	ACTGGCGTATATCAGTTAAAAAAATCATTTGGCAAAGAAAGTATGGGCATTGTAAGAACG
1069	90	159	MW2_CDS_02748	MW0507	FALSE	unmapped	CCAGGTGAAAGTGGGCTCATTGCTCTTGATTGGCATAATGGAAATCGAAGTGTATTAAGT
1070	90	157	MW2_CDS_11052	MW2090	FALSE	unmapped	GAAGAGTTGCTTGCTGAACATTGGTTTGGCACACGCTTTCAAAAGAAAGGTGTGAAATAA
1071	90	155	MW2_CDS_13424	MW2540	FALSE	unmapped	GTCATATTTCTCAAGAAGAAGCGGAGACGATATTGCGTCAAATGAAACAGCAACAACGCT
1072	90	153	MW2_CDS_09530	MW1790	FALSE	unmapped	CGCTAAACAAGCATTCAAGACGATTGAGGAAACGAGTCAAAATGCCGTTAATGAAATGCG
1073	90	151	MW2_CDS_08050	MW1516	FALSE	unmapped	TGACACGTATGCCTAATGTCACTTATTTAGAGGAAAGCGAATTAGTCATATACGCAGCAG
1074	90	149	MW2_CDS_01085	MW0200	FALSE	unmapped	AAGTACTGCTTTCAAACTTGCATAACGAAGATTTTTCGGAGCGTGGTGACGTCTTTATGG
1075	90	147	MW2_CDS_07761	MW1463	FALSE	unmapped	ACAAAGCGAAAGCATTTTGGACAGAAACTTTAGAATTTGTTGTTGTAAGTGAAACACCGT
1076	90	145	MW2_CDS_00866	MW0160	FALSE	unmapped	TTTAACGGCTTTTTAGATGGATACAATACCTTAGATGCGCTAGCGTCATTGGCATTTGGT
1077	90	143	MW2_CDS_04537	MW0838	FALSE	unmapped	GTCGTATGCCACTTATCGGTATTGGTTCAATTTTCACAGCTGACGAAGCTTTAGATGCAG
1078	90	141	MW2_CDS_07467	MW1396	FALSE	unmapped	AGAGAGATTTTAAAAGCGACTGAATCAAAATCAGGATTAACCATAATTGTCAGGTCTTCT
1079	90	139	MW2_CDS_08370	MW1574	FALSE	unmapped	AGATAAATGAATATACAGGATCGAATAACGAAGAGAAAAAAGAAAATGAAGATAAAGAGA
1080	90	137	MW2_CDS_00903	MW0166	FALSE	unmapped	TCCTAGGTATCGGAGAACCATTAATCTATGGTGTGACTTTGCCATTAGGTCGACCTTTCT
1081	90	135	MW2_CDS_04286	MW0788	FALSE	unmapped	AGGGTGCAACAGGTTATTGCAGAACCAGTCAATATTATTTGTACTCATGGAACAATGAGT
1082	90	133	MW2_CDS_09937	MW1863	FALSE	unmapped	GGCATGATTAAATGGGCTCCTTTTGCAACATTACCCGAACAATTCGAAACGATTCAACAA
1083	90	131	MW2_CDS_01127	MW0207	FALSE	unmapped	CGAAAATTATGGGTATTGGGCCTGCATATGCGATTCCTGAAGTATTGTCACTCAGCAATC
1084	90	129	MW2_CDS_11333	MW2143	FALSE	unmapped	TGATGTACGTGATGAAGGCGAAGTAACAGCAAGCGACATTACACATGATAGTGATGTTGA
1085	90	127	MW2_CDS_00142	MW0025	FALSE	unmapped	AGATGATCTCATTGACAAAGTATTTAATGTAGAAGCTATTCAGTATAAAGTTTTTGGCGA
1086	90	125	MW2_CDS_10042	MW1886	FALSE	unmapped	CCTGCTCAAAAAGCAGTCGGTAAATCTGCAAGTAAAATAACAGTTGGAAGTAAAGCGCCT
1087	90	123	MW2_CDS_03320	MW0610	FALSE	unmapped	GCTATGATTCTAGCAGGTATTGCAGTTGCTATCGCTGGACAAGTTGCATTTGTAGGTTTG
1088	90	121	MW2_CDS_05359	MW0992	FALSE	unmapped	ATTTGAACGTGTGCAATGTGAAGTGCCACAAGAAAATGCAGGTGCTGTTATTGAATCATT
1089	90	119	MW2_CDS_10659	MW2013	FALSE	unmapped	AAGTCGCTAAAAAAGAAGTACAACCTTTCATTGAAGCGTATGAAAGAGAGCACAACGGCG
1090	90	117	MW2_CDS_04644	MW0857	FALSE	unmapped	TACAAGAAAAACGTGCGCAACTAGATGAAAGTAGACAAGCGTTGGAAGATGCACAAACAA
1091	90	115	MW2_CDS_13879	MW2619	FALSE	unmapped	TGGCAAAAGGAAACCAAGGTATTAAATGGTCTAGTTTAATAATGGGTGTATTATTATTAA
1092	90	113	MW2_CDS_13139	MW2487	FALSE	unmapped	CTGCAGCGCCATCTTCAAATGGTCGTTCAATTTCTAATGGTTATGCATCAGGAAGTAACT
1093	90	111	MW2_CDS_09378	MW1761	FALSE	unmapped	CGCGTGTTTGGTAGTAAAAAAACAGAACTGCTTTGGGTATCAAAAGCGATTGTTCAAGCT
1094	90	109	MW2_CDS_13554	MW2563	FALSE	unmapped	TGCGTGATTTGCACTTAGAGCAAAGTAAAGATGTGATTGAATTAGGCAATCATGAACCAA
1095	90	107	MW2_CDS_01573	MW0288	FALSE	unmapped	AGCTGCTAAACGCTGGAATGATTTAGGTGTTAAAAATGTTATTGTGACAAATGGCGTGAA
1096	90	105	(-)3xSLv1		neg		
1097	90	103	MW2_CDS_08709	MW1638	FALSE	unmapped	AGAAGGCAGAGATGCTGCTAATGCTGCTCAAGAAAAAGCTGAAAAAGAAGGCAAGATTAT
1098	90	101	MW2_CDS_12996	MW2459	FALSE	unmapped	AACGTATTTGGATGGCACAATTGAAAGATGGCGTACCATTTACTGCTGGTGCATTTACTA
1099	90	99	MW2_CDS_00933	MW0171	FALSE	unmapped	ACGGTTGAAAAAGAAAGACAATTAGATTTACAAGGTAAGGCATATCCACGTGAAGTTAAA
1100	90	97	MW2_CDS_01259	MW0231	FALSE	unmapped	CTGATGCTTGTAAGATTATTGTAGAAACAAACAAACCGGTTCGACTTGTAAAAGGTGAGT
1101	90	95	MW2_CDS_07011	MW1309	FALSE	unmapped	ACTGATGCATTAATTGAATCTTTATTTATCCAGTTTCATAGTCAATGTTTAAAGCAAAAT
1102	90	93	MW2_CDS_09057	MW1699	FALSE	unmapped	ACCAGCTGAAGCGATGAAAGTATCACCAAAAGTAATTCAGCCAGCTCCAAAAGTTTGTAC
1103	90	91	MW2_CDS_10891	MW2056	FALSE	unmapped	CGAGATTAAGAATTGGGAATTCCCGTTAGTAATTAAGCCGGGAGATGATCTTCCGACAGC
1104	90	89	MW2_CDS_06141	MW1141	FALSE	unmapped	CTAAAATGGACTGTGAAATCGCAGTAATCGTTGGTGGCGGAAACATTTGGAGAGGTAAAA
1105	90	87	MW2_CDS_04782	MW0882	FALSE	unmapped	CCGACAAACAATGTTCGCAGAATTTGAGCATAAAATTCATGCAATTGAAGAAGCAGGTGA
1106	90	85	MW2_CDS_03392	MW0623	FALSE	unmapped	GTCTATTGAAGAAGGCGAGTTTATTGCTATTATGGGTCCCTCTGGATCTGGGAAAACGAC
1107	90	83	MW2_CDS_07193	MW1345	FALSE	unmapped	AAGGCCATACTGCTTGGTACGTCAACATTTTTTGAAGGTTTTGATTTTCAAGCAAATGGT
1108	90	81	MW2_CDS_06700	MW1252	FALSE	unmapped	TGCAGCTGGTGGTTTTCGTGATATCACTCGTATAGCTAGTAGTAATGCACAAATGTGGAA
1109	90	79	MW2_CDS_03020	MW0555	FALSE	unmapped	GTGCTTTGCGAATCTAGAGTCATTAATCAAAACCCTAAATATAGAATTATTAAATACAAT
1110	90	77	MW2_CDS_03183	MW0585	FALSE	unmapped	GTGGGTATAGGTGGCGGATATGCTCAACACCAACAAGACGCAATAGCATCTATTTATGTA
1111	90	75	MW2_CDS_05231	MW0968	FALSE	unmapped	AAATTCCAACCTGAAAAATTAGCAGCTTATGAATGGCATTTCGATACATCTTCCCATGCT
1112	90	73	MW2_CDS_07164	MW1339	FALSE	unmapped	AGCAAAGGAAACTAAAAACAAGACGTCCTTTCCTTTAAATAATATTCATGACCATCAAGT
1113	90	71	MW2_CDS_03349	MW0615	FALSE	unmapped	ACGAAGAATCATCTGAAATGCATGACTTAGCATTTTTATTGCTTGTGTATCCACTAAGTG
1114	90	69	MW2_CDS_03289	MW0604	FALSE	unmapped	GCACCAACAACGCATGCAGTTACGTATTACACATTCAACTTTTCATTGGAAGGTGCAAAA
1115	90	67	psma_tiling_016_R		FALSE	unmapped	TCATAAAAATGAGTGAAGTAAATGCAGCTATCAATGTACTATTAACACTTACGGTCACAC
1116	90	65	MW2_CDS_06105	MW1135	FALSE	unmapped	CGTATTAGGAAAAGGGAGCAAAGAGCGCTTTGTACCGTTTGGTGCTTATTGTAGACAAAG
1117	90	63	MW2_CDS_01756	MW0320	FALSE	unmapped	AACGACATAGTGGTGCGCCGTTAACAGGTGGGAAAGAGTTTGATGAAATTGACTTAAAAG
1118	90	61	MW2_CDS_09518	MW1788	FALSE	unmapped	TCAATTTGTGCATTATTCAGAGACTCTGAAGTATTAAACAGTACATTTGGCTGTGATCCA
1119	90	59	NC_A_059		FALSE	unmapped	TCAAGTTAATCAGAAAAGCAGTCGAACAATGATGTTACAATCGCCATTGTCCAACTGCTT
1120	90	57	MW2_CDS_10668	MW2014	FALSE	unmapped	CCGATGTTCCGAGTCATCGAACTATTCATGAAGTATTAGAAGCAGCATTAAAGGCAGGGA
1121	90	55	MW2_CDS_13580	MW2567	FALSE	unmapped	AGGCGTTAGAAGACCTAGACCATTTGAATCAGCAAATACACAAATCGAAAGATGCATTGA
1122	90	53	MW2_CDS_09453	MW1776	FALSE	unmapped	GGCCTCAAGTGTGGCCTGTACCTGAAGAGAAGGTAATCAAAGGGTATGAACAGTTTTTAT
1123	90	51	MW2_CDS_12077	MW2287	FALSE	unmapped	ATTTGCACCAATTCAAGCTTCTGTTGCACAACAAATTGGAACAAGTGGTTCACTTCTTGT
1124	90	49	MW2_CDS_01417	MW0260	FALSE	unmapped	AGGATTTGTCATTTTTTCAATTCATAAAGGGAGACGAACGAAAAATGAATCAGCACGTAA
1125	90	47	MW2_CDS_06556	MW1224	FALSE	unmapped	ATCAATGGTCATGATTGGTTCATTATTTGCTGCACACGAAGAATCACCTGGTGAAACTGT
1126	90	45	MW2_CDS_06394	MW1187	FALSE	unmapped	TGCAAACGAAAACATCCAAGACAAAGCACTAGAGAATTTTAAAGCAAACCAAACTGAAGT
1127	90	43	MW2_CDS_09889	MW1855	FALSE	unmapped	GAAAATGGTCTTGGCTAGCGCCGCCATTATCTCCAACATTGACGTCAAATTATCATCATG
1128	90	41	MW2_CDS_06551	MW1222	FALSE	unmapped	TGCGCGTAAACGTAACATTAGCATGCACAGAATGTGGCGATCGTAACTATATCACTACTA
1129	90	39	MW2_CDS_00881	MW0162	FALSE	unmapped	CTGAAAATGCAACAACCGAAATACCACGTTTAATTAATACAGCAATCGCCGAAAGACGCC
1130	90	37	MW2_CDS_00767	MW0142	FALSE	unmapped	CCAGCCATTGCTGCAGGTAATACAATTGTGATTCAACCTTCGTCTTCAACACCATTAAGT
1131	90	35	MW2_CDS_08852	MW1662	FALSE	unmapped	GGTAAACGTGTTGATATTCCATCTTATTCTGTTAAACCTGGTCAAACAATTTCAGTTCGT
1132	90	33	MW2_CDS_11301	MW2137	FALSE	unmapped	ACACACCACACGTTGATACTGGTGATTATGTAATCGTTATTAATGCATCAAAAATCGAAT
1133	90	31	MW2_CDS_07085	MW1324	FALSE	unmapped	AGCGTCAACTGATAAAAAAGAAGCAGTAGACCAAGCGTTACAAGCTGCAGAAAGCATTAC
1134	90	29	MW2_CDS_11131	MW2103	FALSE	unmapped	AACAATTGCTAAAGCTTTAAATAAAGAAAAAGAAGGCGAAAAACGTCTTGCTGAGCATGA
1135	90	27	MW2_CDS_01760	MW0320	FALSE	unmapped	GCGATGGTGATATTATGATTCAAGCATGCTCAAATGATTCGCAAGTATCCTTTCATGCGG
1136	90	25	MW2_CDS_12928	MW2446	FALSE	unmapped	AGTGGAAATATCCCTAAGTCCATTTCTCAAAATGTAACCTTAATATCAAGTTCATCAAAT
1137	90	23	MW2_CDS_12959	MW2452	FALSE	unmapped	TCATCTCGTAATGATGGTCGCTACATTGAAATTATCGGTATTTCAATCGGTGGTGGTACA
1138	90	21	MW2_CDS_13754	MW2597	FALSE	unmapped	TGTTTATTGGACATTATTCGCCAGAGGTCATAGGAGATTACGTTGCAGGTCCAAGTCATG
1139	90	19	NC_A_051		FALSE	unmapped	ACACATGCATCAACTATTTACATCTATCCTTGTTCACCCAAGCATGTCACTGGGTGTTTT
1140	90	17	MW2_CDS_10160	MW1913	FALSE	unmapped	AACTAAAGGATACAACGGGTTAAAAGAATACAGGATTGAATTAAAGCGAATGAATAACGA
1141	90	15	(+)E1A_r60_n9		pos		
1142	90	13	pMW2_101		FALSE	unmapped	AAAGAGTTGCAAGAAAGATCAAAATTGCTTGAGAATCAGCAAGTTCTGGCATTAGAGAGT
1143	90	11	MW2_CDS_08967	MW1683	FALSE	unmapped	AGGTACTGCTTTTGATGTGTATGTGGATGGTGAGTTTTATGATCACTTCCTGTCTCCACA
1144	90	9	MW2_CDS_08961	MW1682	FALSE	unmapped	CAAATGTTGCAATGGAAATTGCAGACAAATGGCAAAATAGACACTACCGTCGTGGAAGTG
1145	90	7	MW2_CDS_00944	MW0174	FALSE	unmapped	TTGTAGCAGCTGTTGCCGGTATTTCACTTTTTATTGCTGGTATTGGAGTTATGAATGTCA
1146	90	5	MW2_CDS_06000	MW1116	FALSE	unmapped	ATAAAAGAAGAGGGACCGGCACATCATCGTCTATTCACTTCAGAAGTTATTCTGCAAGGG
1147	90	3	MW2_CDS_11794	MW2236	FALSE	unmapped	ACGTTCTGAGACGATTTTTATATATGGTTTTGGCGCATCTTTTGTAGTTGCTACCGACTT
1148	90	1	MW2_CDS_00039	MW0007	FALSE	unmapped	TTGGCGAAAACCTTGCAAAAGATATGTATGTGGTGCCACCATCAAGACTTATCAATGAAA
1149	89	164	MW2_CDS_09249	MW1736	FALSE	unmapped	ACCAATTGACATTGCAGATGATGTGGCAACAATGGGTAAATCACCACATCAAAATGACAG
1150	89	162	MW2_CDS_05688	MW1059	FALSE	unmapped	AGTTCAGATTCACCATTTTATGGCATATTTGTCGGAGATCAATTAGGAGCTAGAATGGCA
1151	89	160	MW2_CDS_10770	MW2035	FALSE	unmapped	GTGCCGATTGGACACGTTGAAGCAGGGCTTAGAAGTTATGATAAATATTCACCTTTTCCG
1152	89	158	MW2_CDS_00607	MW0113	FALSE	unmapped	GGTGTAACAGAAGCGGTTCGTACGAAGAGTAACATGGACGGTATGGATCAATTGATGAAA
1153	89	156	MW2_CDS_10323	MW1948	FALSE	unmapped	TGGATAATATAAATAAAAATGAAAAATTTCGTGTTTTGTCAACAATTGCTATTACTATAT
1154	89	154	MW2_CDS_13745	MW2596	FALSE	unmapped	GACGTTGAAATGGCACCACACATTTTAAGAATGCGCACATTATCAAAGGCGTTTGGAATA
1155	89	152	MW2_CDS_02259	MW0417	FALSE	unmapped	TGTGGCACCTTACATTGCAAGACTTGTTGAAAACTCATTATTAGAAGTAGACGAGGGGAT
1156	89	150	MW2_CDS_13015	MW2463	FALSE	unmapped	AAGCTGCTACGCATTGAAGATGCTCATGTACATTGGGAATTAGGTGTTGTTTGGAAGAAG
1157	89	148	MW2_CDS_02788	MW0514	FALSE	unmapped	TAAATACGCTCAAGAACAAGGGATAACGGTTGTTATCGCGACAGGTCGAGCATTTTATGA
1158	89	146	(+)E1A_r60_a104		pos		
1159	89	144	MW2_CDS_12434	MW2354	FALSE	unmapped	TAAATTGAACATCCGTCATACACCTCCTCTCTGCGTTAAAGTAACGCCCGAGATGTTAGG
1160	89	142	psma_tiling_045_F		FALSE	unmapped	TATAAAAATCTCATAGATATGAACATCTTATTTGAAGGGGGCCATTCACATGGAATTCGT
1161	89	140	MW2_CDS_09655	MW1812	FALSE	unmapped	TGGAACAGAAGAAATTGAGTGAGATGTCTGAGCCAGAATTAAGACACGAAATACAACTTT
1162	89	138	MW2_CDS_04960	MW0916	FALSE	unmapped	TGAAAATAAAGTGCTGATTTTAGCAACACATGATATGGCTATTGCAAATCAATGTGACGA
1163	89	136	agr_tiling 032_R		FALSE	unmapped	TAACTCATACTTTTAGTACTATACGAAGATAACAAATTTACAATGAAAGTAATTAATTAT
1164	89	134	MW2_CDS_04331	MW0797	FALSE	unmapped	ATCATTGTGCGCAACCGTTAATGAAATGGTTAAATGTGTCTTCAACAGCTAGAGCGAGTT
1165	89	132	MW2_CDS_05415	MW1003	FALSE	unmapped	ATATCGTGGTCATGCACACACAGCTATACTAACCTTCGATGAGTTGCTGAAGCAATATCC
1166	89	130	MW2_CDS_09647	MW1811	FALSE	unmapped	TTCAAACGTGTTGAGCGCTATAATCATGCAAAACCGCCTAAGTTTTTAGTGCGTTTTTGG
1167	89	128	NC_A_112		FALSE	unmapped	AACGGATGGATTTTTAATTGTATGATTTTGTATAGGTAGTTGAGATATAGTTTATAAAAT
1168	89	126	MW2_CDS_11580	MW2195	FALSE	unmapped	TCATTTGATGAAACAATATCCTATGACATTGTCAGGTGGAGAGGCACAACGTGTAGCACT
1169	89	124	NC_S_053		FALSE	unmapped	AGGCAAGTACCGAAGTACCTGCCTAAAAAAGGATTATCCACTTTTTCATCCTAACTGATT
1170	89	122	MW2_CDS_00557	MW0104	FALSE	unmapped	AATCATGCGCATTTTACATTTATAGGCGATGGACCTACATTAAATGATTGTCAGCAACAA
1171	89	120	MW2_CDS_04091	MW0746	FALSE	unmapped	TGCTGTAAATTGCGATTTAATTGAAGATAATGACTTAAAAAAAGGTTTCATACCCTATGA
1172	89	118	MW2_CDS_01300	MW0238	FALSE	unmapped	TGTATCGAAAATAATTGAATCATTTATGCCAATTCCTATGCCTGGATCAGTAATCGGTTT
1173	89	116	MW2_CDS_03951	MW0721	FALSE	unmapped	CGCAAATTGGGTCGCGTTTGACTGGTGTCTTATATGTATTAGATGAGCCATCAATTGGAC
1174	89	114	MW2_CDS_08471	MW1593	FALSE	unmapped	TTGTCCATTTATGATGCCGTTAAACAGTTTGATCTATCTAGAAGTGCTTTTTATAAATAT
1175	89	112	agr_tiling 147_F		FALSE	unmapped	GATAGACCTAAACCACGACCTTCACCTTTAGTAGAAAAACTTTCTTGGAACAATTCATGA
1176	89	110	MW2_CDS_02445	MW0452	FALSE	unmapped	GGTTGTTTTGGAAGAAGCAGGATCTGATTTGAATTCTGTTGCGAAAGCGACCATTTTCAT
1177	89	108	MW2_CDS_00902	MW0166	FALSE	unmapped	CAAGTAGGTGCCGCATTAGCACTTTGGGTAAGATGTAAACGCAACACAACATTACGTAAT
1178	89	106	MW2_CDS_09218	MW1729	FALSE	unmapped	ATGGTGCGATTTTAGAGAACACTGTAGTTGCAGAAGATGGTTCAGTGGACTTTGAAGACA
1179	89	104	MW2_CDS_12376	MW2343	FALSE	unmapped	ACGGAAGAAACATGGATGTCACTCATGCCATTAAAAGATCAACGCATTATGGCAACAGTT
1180	89	102	(+)E1A_r60_a104		pos		
1181	89	100	MW2_CDS_04900	MW0903	FALSE	unmapped	TATGTTGATGAAAGCTTTCCAAATTGATGCATCAGTAAATCCAGGTAACTCGGGTGGTGC
1182	89	98	MW2_CDS_02634	MW0486	FALSE	unmapped	GAATGGTTTACAGACGAAGAAATGGATATTTTGAAGCGAGGGCGTAACGCGAAAAGTCAT
1183	89	96	MW2_CDS_01842	MW0335	FALSE	unmapped	TCGTAACCGTCAAAGATGAATCACTCGCGCAACAGTTGTTTGATTTTCACAACATGACTG
1184	89	94	MW2_CDS_05652	MW1050	FALSE	unmapped	CAAGAAGCTGAGAACAGAATGCATACAATCAAAGCAGTGATGGTTGCTACATTGGGTGAA
1185	89	92	MW2_CDS_04245	MW0780	FALSE	unmapped	AAATACAACTTTGTTACTAATAACGATAAATCGATTAATAGCGAGCTCATTAATTTCATT
1186	89	90	MW2_CDS_05142	MW0951	FALSE	unmapped	AGTGGTGTTGAAGCGGAATATGTAGATTATAGAGAAACATCACTAAGTGGATTTGATGGC
1187	89	88	MW2_CDS_13771	MW2600	FALSE	unmapped	ACATGGCGCACAGGATAGACATACACAAGCGTATGATTATTTGGTAGATGAAGCAGAGTT
1188	89	86	MW2_CDS_04419	MW0814	FALSE	unmapped	AGAAATTGAAACACAATTACGCCAGTCTGAGTTCGTAAAAGAAGCGATTGTTGTACCTGT
1189	89	84	MW2_CDS_02592	MW0479	FALSE	unmapped	GAAAATGGTTGCAAAGCATTTGATTAGTCCTGAACTAATAAAACAACCAGCAGCCGCAGT
1190	89	82	MW2_CDS_03305	MW0608	FALSE	unmapped	TCAACTAATCCCGACAAACTTGCCAAAGCAATAGACGAGCAAATTGGAAGAGGTTTAACC
1191	89	80	MW2_CDS_08368	MW1573	FALSE	unmapped	ATTATTACAACAATATTTCGGTCCCGCTCACCAACAAGCATATGTTCGTGCTTATCCAGC
1192	89	78	MW2_CDS_02458	MW0455	FALSE	unmapped	GACCAAATGTTGCTGAAGTGATGAACATTGTTGGTGAGATTGAAGGACGTACGGCAATTA
1193	89	76	MW2_CDS_01262	MW0232	FALSE	unmapped	AGGTACAAAAGTAGTTATGGTACCGAATACGCCGACAGAAAAAGACGATGTCATTGCTGA
1194	89	74	MW2_CDS_09205	MW1727	FALSE	unmapped	AGGTCATGTTTATAATGGTATTAGTGGCGGTCAATTTAAAGATTTACCACCAATGGAACA
1195	89	72	agr_tiling 145_F		FALSE	unmapped	TTTCTTGGAACAATTCATGAATACGTGGTATATCATCTGCACATTTATTCATAACAATAA
1196	89	70	MW2_CDS_10349	MW1954	FALSE	unmapped	ACCAATTGGAAATCGTGTGATTATTGAGAAAAAAGAACAAGAACAAACAACTAAAAGTGG
1197	89	68	MW2_CDS_06290	MW1167	FALSE	unmapped	TGGTTCAGATGACACATTAATTGAGCAAGCTGTAATAAAGAAAATTCATGAACCTTTTGT
1198	89	66	MW2_CDS_13533	MW2559	FALSE	unmapped	ACGCGATTAAGTATGATAATGTGAAATTCAATGGTATTAAATTAGCTAAAACGAATACGA
1199	89	64	MW2_CDS_05444	MW1008	FALSE	unmapped	AAAGCAATTAGCACACAGCATTAATGAAATTGAACAATCTGAATCCTTTTCACAAAAAGT
1200	89	62	MW2_CDS_12942	MW2448	FALSE	unmapped	ATGACAAGTATAAGAGATGTTAAGCCTACAGATGTAGAAGTTCTAGATGAACAAAAAGGT
1201	89	60	MW2_CDS_05262	MW0975	FALSE	unmapped	ATCAAAATGACGCGACACAACAAGGTGTTAACGAAAAATCAAAAGCAATAGAACAGAACT
1202	89	58	MW2_CDS_07548	MW1418	FALSE	unmapped	AGTTATTAGCATTATAGATTTTATTACTAAACCAATTTATCTAATTAAGGGGGACGAGTG
1203	89	56	MW2_CDS_07618	MW1437	FALSE	unmapped	TCAGATAGAGAAAAGGCAGGAATTCTCTTTGAAGAATTAGCACATAATAAACTTACATAC
1204	89	54	MW2_CDS_01117	MW0206	FALSE	unmapped	GCCCGACACAAAACAAGCCAAGCAAAACAAATGCATATAACGTAACAACACATGCAAATG
1205	89	52	MW2_CDS_11931	MW2261	FALSE	unmapped	ACCGGAAGAACGCGGTTTACATGGGAAATTGACAGTTGAAGAAGAATTGAAATATTTGGC
1206	89	50	MW2_CDS_11989	MW2272	FALSE	unmapped	CAACGATTAGAACCATTTGATGAGACATTTCAACAATCGAATATTCATCGTGGTAAGCGA
1207	89	48	MW2_CDS_11805	MW2238	FALSE	unmapped	TCATTTTCGGCGCCATATTTTTAACGGTACAAATCGGTGTCATCACTGGGTTAATCATCG
1208	89	46	MW2_CDS_08326	MW1566	FALSE	unmapped	AGAAGCAGATGTTTCAAGACAAAAAAGAAAACAAGTGATTGATAAAATGGCAGCGGTATT
1209	89	44	MW2_CDS_00638	MW0118	FALSE	unmapped	CCTCAGCCAAACACACCAGATGATCATACGCCACCAAATCAGAACGAAAAAGTAACATTT
1210	89	42	MW2_CDS_12813	MW2425	FALSE	unmapped	CGGCAGAATTACGCTTAGGTATTGTGAATGGTCACATAGCTGAAGGTACGTTACTCACTG
1211	89	40	MW2_CDS_06239	MW1159	FALSE	unmapped	GTTGATGGATGATTTAGAACGCAATCAGGTAATCGGTCCACAAAAAGGAAGCAAGCCTAG
1212	89	38	MW2_CDS_13030	MW2466	FALSE	unmapped	AATTGAAGTGCCTATGACATTGGCAATTGTTGGGGGTGGTACGAAAGTATTACCAATAGC
1213	89	36	MW2_CDS_08682	MW1634	FALSE	unmapped	CTTATTGCAATATGTGTTTCGGCGTCGACACTAGTCATTGTTACTCCAATAGAACCAGGT
1214	89	34	MW2_CDS_13202	MW2499	FALSE	unmapped	GTTGTCGTCAACGTATCAAGTGGTTTAGGTTCATTTGGAATGGTTACAAACCCCGAAACA
1215	89	32	MW2_CDS_05608	MW1040	FALSE	unmapped	CAATAGGTATTACTACAACTACAATTGCGTCAACAGCAGATGCGAGCGAAGGATACGGTC
1216	89	30	agr_tiling 204_R		FALSE	unmapped	GAAATTGACAGTTTCCATAAATAAAATGCTACAATTTCCTACCCCGTGAATCTTATTTTG
1217	89	28	MW2_CDS_11872	MW2250	FALSE	unmapped	CTGCAAAGCCAGAACAATGCAACGATCCAGTTATTGTGTTGGCGCAATTGATTAATAGTA
1218	89	26	MW2_CDS_05352	MW0990	FALSE	unmapped	TGACGCCAAGACTTCAACCATGGGATTTTGCTGGCGGATTGGTTATTTTATATGAAGTAA
1219	89	24	agr_tiling 090_F		FALSE	unmapped	GAAACTTGAACAATTACAAATAAAACGTAATTATAATCATTTAATGCTTCCACTTACTAT
1220	89	22	MW2_CDS_05617	MW1042	FALSE	unmapped	TTTTCTTAATTATTTTTGGTATTGTGGCATGTTCTACAAACGTAAACTTTTTCTTCCAGT
1221	89	20	MW2_CDS_11898	MW2255	FALSE	unmapped	ATGCTGAAAAAACAGGTGTAGCTACTGCATCAACGGTCGGTGTTGCTAAAAATGATACTG
1222	89	18	MW2_CDS_00160	MW0030	FALSE	unmapped	TGGGTAGAAGAAGGTAAATACGGAGAAGAAGTTGTAGCAGGAACACAAATGAATAACGTT
1223	89	16	perR_tiling_041_F		FALSE	unmapped	GCAAAGTATGACTTATTAGATATTTTTAAAAACAATCTAGTTAATTTTCTCAATAAGAAT
1224	89	14	MW2_CDS_03242	MW0596	FALSE	unmapped	AGGTGTTAGATTAACAGAGGATGGTTTAACGCATACGCTTGATATCATTAAGAGACATCG
1225	89	12	MW2_CDS_09690	MW1819	FALSE	unmapped	ACTGATGAAGGTTCAAGAAGATTAGGTGAAGTAGCATTAGTACCTGATGATTCACCGATA
1226	89	10	MW2_CDS_04210	MW0770	FALSE	unmapped	GTTTCATCGAAAGAGAAGATGGTAGCGACGTATTCGTACACTTCTCAGCAATCGCTGAAG
1227	89	8	MW2_CDS_02840	MW0523	FALSE	unmapped	TAATTGCAGGTTTTAATTACGAAGGTCAACTCGCTGCAGCACTTCAAATTAGTGAGCGAC
1228	89	6	NC_A_056		FALSE	unmapped	CGTCTTTTTAACGGGCTCACTAGGGTAACATGTTTGCGCATGTTGCCCTTTTTCTATATA
1229	89	4	MW2_CDS_03370	MW0619	FALSE	unmapped	CCGTATATGTTCTACACACCAGGAGAATATGATCCTAGCGTCACGTCGGCTAGTAAACAA
1230	89	2	MW2_CDS_02970	MW0547	FALSE	unmapped	CGGCGTCATCACCACACTTTGTTAGCGAAGTGAAACGTTTGAAATCAGATCCTTCATTTT
1231	89	163	pMW2_023		FALSE	unmapped	TGAGATTGATCGCCTTAAAGTGCAACATTTAGAGCAATTAAGAGCTATTTATGATGAACA
1232	89	161	MW2_CDS_12803	MW2423	FALSE	unmapped	AAGGTACAGAGATGTCTCCAATTTTACTAGCATGGATTGTTGCAGCTGTGCTACGTATCG
1233	89	159	MW2_CDS_11126	MW2103	FALSE	unmapped	GTTGACCGTGATGTTTGGGCAAGATCTCGTGGCTTAATTTCTTCTGAAGAAATGGCTAAA
1234	89	157	MW2_CDS_06119	MW1137	FALSE	unmapped	TGATCAAGAAAGCGCTAACCAAGAAGCGCTTGAATTAGCAGAACAAATGGGTATCATCTT
1235	89	155	MW2_CDS_02152	MW0397	FALSE	unmapped	AGTTTTTATAGCAGGTTGTGGCAAAAGTGATAAAACAAAAGAAGATTCAAAAGAAGCACA
1236	89	153	MW2_CDS_12588	MW2381	FALSE	unmapped	TCACGAACCAATTTATATTAGTGGCAATAATGCCGAAAATAATGCTGTGATTATAGGTTT
1237	89	151	psma_tiling_044_F		FALSE	unmapped	GAACATCTTATTTGAAGGGGGCCATTCACATGGAATTCGTAGCAAAATTATTCAAATTCT
1238	89	149	MW2_CDS_00590	MW0110	FALSE	unmapped	CGCGTTGGTTCTTGTGGCGCGATGCAAGAAAACATTGATTTATATGATGTGATTATTGCA
1239	89	147	MW2_CDS_09316	MW1750	FALSE	unmapped	ATCAAGAAAAGGTAAAAGGAAAATTTTCCTTGCACAAAGTGGAGGTAGTCGAGAAGGTCT
1240	89	145	MW2_CDS_05815	MW1081	FALSE	unmapped	ACTTCTAAAGAGGAAACGGTAAGTGTCTATTTAGAAGAAATGGATCAAAGAAATGCAGTT
1241	89	143	MW2_CDS_00097	MW0018	FALSE	unmapped	TCACATCCTGAATATATTGTGACGCGTAGAGGCGTTGGATATTTCCTCCAACAACATGAG
1242	89	141	MW2_CDS_05592	MW1037	FALSE	unmapped	AATTCATTTCCAACACAGCTATGAAAAGAAAAAATTACAAAGACAAATCGATCTAGTTTT
1243	89	139	MW2_CDS_13188	MW2496	FALSE	unmapped	TGTTAGTTTGCAATCAGCGATGAAAGGTAAGTATGGCTTATACAGTATTCAGCCAATCGT
1244	89	137	MW2_CDS_01678	MW0306	FALSE	unmapped	ACCAAATTCTAAACCTGCATTAGACTGCCCTATTGTGTTCCCTTATGCACAAAATGCAGT
1245	89	135	MW2_CDS_09411	MW1768	FALSE	unmapped	TTTTCAGATGTGAAGGGTAGTGGATATGAATTAACTAAACGAATGATTTGGCCATTCCAA
1246	89	133	MW2_CDS_08277	MW1556	FALSE	unmapped	TTATCCAGTTGTTATCAAAGCTGCCAGTGGCGGTGGTGGTAAAGGTATACGTATTGTAAA
1247	89	131	MW2_CDS_09665	MW1814	FALSE	unmapped	TGTGTCAGCTGATAACATGCCAGAGTATGTTAAAGGTGCCTTTATTTCAATGGAAGATGA
1248	89	129	MW2_CDS_12456	MW2358	FALSE	unmapped	TGTGGCACTCATCATTTTAATTGGCGTCGCTTCTCAATTACCTAAAACATCTAAAGATGA
1249	89	127	MW2_CDS_03015	MW0555	FALSE	unmapped	ACCCGCTAAAAATAATACTTTCTGGCCTGTTGCAGGATTTGCAGTGTTATTAACAACCTT
1250	89	125	MW2_CDS_08775	MW1649	FALSE	unmapped	AACATGCTAATAGCGGTAAATACGAAATTGTTGTTTTAAGTAACCGTAAAGCAGAAGACA
1251	89	123	MW2_CDS_10523	MW1986	FALSE	unmapped	AGCGAATGGTTGAGAATCTTTCGGAAGAAAAATTTGGACGTACGTTTCGACATTGTGCAT
1252	89	121	MW2_CDS_13132	MW2486	FALSE	unmapped	ATCGACCGAGATTAACGCAGTTACTACGCATATTAAAACGAAGAGGTGAACGTCATGACT
1253	89	119	MW2_CDS_09565	MW1797	FALSE	unmapped	CGTATGTCTAATAAAGAATTCAAACAAACATATGGTCACCTTGCAGGTGCTTGGCGTGGT
1254	89	117	MW2_CDS_08726	MW1641	FALSE	unmapped	AGGACGTAAGAGTACAGATGCATTGTTAAACAATGCAGTTGCAACAGCTGTTGAAACTGG
1255	89	115	MW2_CDS_10191	MW1921	FALSE	unmapped	GTAAACCGCACATTTACGAATGCACAAGGAGAGCGCGAGGCAGACTTTATTAATATCATC
1256	89	113	MW2_CDS_00875	MW0161	FALSE	unmapped	CCATCATTTATTAGACAAGAGAGATGACGATTTTGTCATAGACAAACGACATTTTAGTGC
1257	89	111	MW2_CDS_13098	MW2480	FALSE	unmapped	ACGCATTAGACAATGGTGTGATTAAAGGTGCAGCACTTGATACGTATGAATTTGAACGCA
1258	89	109	perR_tiling_053_F		FALSE	unmapped	GAAACGATTCATTTACTAAAGAAAAAACATTTTGAATTAATGAAAGATGAAGCACTTTTT
1259	89	107	MW2_CDS_11949	MW2265	FALSE	unmapped	GACTAAGGCATTTAACATTCCACGGGCTATCGATGGCGCTACGTTAAATGACTGTAGATT
1260	89	105	MW2_CDS_03140	MW0577	FALSE	unmapped	GCTGGTAATTTTGGATATATTGAAAAAGGCAAAACGACTTATCAATTTGCCTCAGCACCA
1261	89	103	MW2_CDS_02060	MW0381	FALSE	unmapped	TCAATGTACGACGCAGGAGCAAGAGGACTATTAGACCAAGAATCCAATGATTTCCAACAA
1262	89	101	MW2_CDS_12176	MW2304	FALSE	unmapped	GTCTTTGCAATGGTGTTCTTTGTATTCGCTATACTAGGACTAGTTGCATGGATGTGTGGT
1263	89	99	MW2_CDS_01647	MW0300	FALSE	unmapped	CATCTGCCAAAATAGCTGCCGAACTAGGTATAGGGCTTTCTGTTGGAACATTTTTGCTAC
1264	89	97	(+)E1A_r60_1		pos		
1265	89	95	MW2_CDS_05515	MW1022	FALSE	unmapped	ATGAGTGAAGCGCATGCGTCATTACGTCAAAGTTTATTACCACATTTAATCGAAGCAGCA
1266	89	93	MW2_CDS_02564	MW0474	FALSE	unmapped	GATGCTGCTTTAATGATGGAATTAGGTGCCGACGGTGTATTCGTTGGATCAGGTATTTTT
1267	89	91	MW2_CDS_04416	MW0814	FALSE	unmapped	CGAATTCTTCTTCTGTGGTGAAATTCTACCTCACAGAGCAGCAAAAGCGTTAGTAAACCG
1268	89	89	MW2_CDS_09552	MW1795	FALSE	unmapped	CTTGATAAAGAAGCGGCTGCAGGTTTACCTGAAGATGTTAAAGCTTACTTTACGTCACGC
1269	89	87	NC_A_001		FALSE	unmapped	TCACATCTTATTGAATCTTATTTGTTTGCGACTCCTATTTTAGCATGGTGAAGTATGCGT
1270	89	85	MW2_CDS_01025	MW0189	FALSE	unmapped	AGTTGTATCCGAACTGTTAGGTTCAGAAATTATGGTACATAGCACATTCCAAGGAATGGA
1271	89	83	MW2_CDS_00645	MW0119	FALSE	unmapped	CAAAGGGACAACGTGTGAGCAATATGATGATTCAAGGTCACGCAGTTGATTTAAAGCAGA
1272	89	81	MW2_CDS_01959	MW0361	FALSE	unmapped	GAAAGCAGAAAATGACAGCACAGCTTCACAGTCTGAAATGTCAGAACCAAAACCTCAAGA
1273	89	79	MW2_CDS_02834	MW0522	FALSE	unmapped	TTGAACGCATGCCTAAAGAAGAACGCCCTCGTTTAACTTTAGTTGCGTTCAGTAATGATG
1274	89	77	MW2_CDS_11819	MW2242	FALSE	unmapped	TGTTGTCCGGGTGGGACATCAAGTAATGTAATGAGTTATTTAGCCAAAGCTAACGTAGCA
1275	89	75	MW2_CDS_13101	MW2480	FALSE	unmapped	TTCAAACGAAAGTGCGGGAGCATGATTTTAGATGGGAACCTACTATTTTATCGAAATCCA
1276	89	73	MW2_CDS_09456	MW1776	FALSE	unmapped	ACCAGGCTTTTTGTATCCTTGGGAGAAAATGATTGCAATCGAACATCGACATCATATGAA
1277	89	71	MW2_CDS_00145	MW0027	FALSE	unmapped	CTCTATATAAAAAGAACCGCAGGTCTCTTCAGATCTACGGATTTTCGCCATGCCACGAAA
1278	89	69	MW2_CDS_00348	MW0067	FALSE	unmapped	ACACTACGATTGGTTTGTCAATTTGTCTAGGCTTATCTCTAGTTTTGGTTCACACTACGA
1279	89	67	MW2_CDS_13029	MW2466	FALSE	unmapped	CTGAAGCTTTGAAAAAAGAACCCCGTGCAAATACACAAGCAGCGGAACGTATTTTACAAG
1280	89	65	MW2_CDS_02562	MW0474	FALSE	unmapped	TGCTGTTTCTATTCCAGTCATGGCTAAAGCACGTATTGGTCATATCACTGAAGCAAGAGT
1281	89	63	(+)E1A_r60_n11		pos		
1282	89	61	MW2_CDS_03266	MW0600	FALSE	unmapped	TGCACCAATTCATGGTGTACCTTTTGTTTATTGGTTATTGGTTGGTATCAGTATGTGGTT
1283	89	59	MW2_CDS_02668	MW0493	FALSE	unmapped	TGATACACGTAAAAATGACCAACAAATCCGTGGTGCAGTTGTATTACCAAACGGAACTGG
1284	89	57	MW2_CDS_01923	MW0354	FALSE	unmapped	TGACAGTCAAACAAAAGTGACTGAAAAACAAGCAGAAACACTTAGCCACTTATCTAACTT
1285	89	55	MW2_CDS_08808	MW1655	FALSE	unmapped	GGTGCCGGTCATTTAAGTGCTACTGTAAAAGAAGTGTTACCTGAAATTGCGGTTATGCAT
1286	89	53	MW2_CDS_06060	MW1127	FALSE	unmapped	TATAAAGCTACTCAAATCGCCATGCAGCGAGCTATTGATGGATTATCAGTACAACCAACG
1287	89	51	agr_tiling 092_F		FALSE	unmapped	TCTTATTCCACTAATAAATGCAGATATAAAGAACATTAATGAAACTTGAACAATTACAAA
1288	89	49	MW2_CDS_05622	MW1044	FALSE	unmapped	ATGGATTCAACGGTAATGTTACTGGTGATGATACAGGAAAAATTGGCGGCCTTATTGGTG
1289	89	47	MW2_CDS_08186	MW1540	FALSE	unmapped	TGAAGGATGTTTAATTGAAGATGGACATTGTATCAGAACGATACATGCAGAAATGAATGC
1290	89	45	MW2_CDS_04866	MW0897	FALSE	unmapped	TTACAAGGTGCCGCAATTGCTGCCCTAGTTCCTATATTACCAACATATGCTACTAAGGTT
1291	89	43	MW2_CDS_13701	MW2588	FALSE	unmapped	AGTGATGATGCTTTTGAGCATTTAATTAAGAGATGGGACGGATTCCATGAAAAAGATTAG
1292	89	41	MW2_CDS_00453	MW0086	FALSE	unmapped	AATTGTTATTGCAGACTTAATTGGGCGTACCTTATTCTTGCCTAAAGAAGTGCCAGCAGG
1293	89	39	MW2_CDS_05151	MW0953	FALSE	unmapped	AAGATTCTGGTGCAAATAAAGTGCATGTGCGTATAGCATCACCGGAATTTATGTTCCCAA
1294	89	37	NA		ignore		
1295	89	35	MW2_CDS_11886	MW2253	FALSE	unmapped	AAACAGATCGATTCGAATCAGCAGTTGGATTTGTTCATCTCGGCTTAGGTTACGCTATCA
1296	89	33	MW2_CDS_10121	MW1905	FALSE	unmapped	GACACTTGGTCTGAAAATCTTGGTGGATTCAAAGAAACGATTTCACGTCGCGCTTTAGAA
1297	89	31	MW2_CDS_10581	MW1998	FALSE	unmapped	AGGTGCTCTGAGTACATTAAAATTATGTATTAAGCCTTTATGGCAATATCATTGTCGCTT
1298	89	29	MW2_CDS_06464	MW1206	FALSE	unmapped	TCCATTACCATTGGAAGAAATAATAGAACTGACGAAATTTGATTCTAGTCAACTGAACCA
1299	89	27	MW2_CDS_02656	MW0491	FALSE	unmapped	GATGTTGAACTCGAAGTTGGCGAGCAAGTTCGTATTAAATCAGGTCCATTTGCGAATCAA
1300	89	25	MW2_CDS_13638	MW2577	FALSE	unmapped	TGCGATGAGCGAAAAACTTCAAGTAAAACAAGAATTTAACGGCGTTACAAGGCAATACTT
1301	89	23	MW2_CDS_05716	MW1064	FALSE	unmapped	GCTGCAAACTATCGTATTGATGGTTATGAGGTCGAAGGTAAGACTGGTACAGCACAAGTC
1302	89	21	MW2_CDS_06701	MW1252	FALSE	unmapped	TCAGTGGTCATCCAATGGCTGGTAGTCATAAATCTGGTGTACTAAATGCTAAAAAGCACT
1303	89	19	NC_A_005		FALSE	unmapped	AGTCGGGCAAATAAGGATACTTCATAACAGGGAATTATGATCTGCCCCGAGACATAGAGA
1304	89	17	MW2_CDS_05607	MW1040	FALSE	unmapped	ACACATACTGTCAGTGCACACAGAAAAGCACAAAAGGCAGTCAACTTAGTTTCGTTTGAA
1305	89	15	MW2_CDS_02689	MW0496	FALSE	unmapped	ATGCTAGATGTTAATCACAGAGCGCTAGCCTTAGTTGAAAAAAACAAAAAAATAAATGGT
1306	89	13	MW2_CDS_10289	MW1942	FALSE	unmapped	ACTGAAATATTAGACCAATTGCCGAAAAATAAAATTTCAACTGCGAAAGTAGACAGTACA
1307	89	11	MW2_CDS_13619	MW2574	FALSE	unmapped	AAAGCATATCAGATGACATGCCAATGCTGACATTTGATAGTCCAATTGGTATTTCGGTGT
1308	89	9	MW2_CDS_02035	MW0377	FALSE	unmapped	AAGCAAAAGCGGAAGCGCTATAAAGAAAAACGTGATGCATTTCAAAAAAGAAAAAGAGAA
1309	89	7	MW2_CDS_07378	MW1378	FALSE	unmapped	ACTCAAAGCTGCTGGAAACATTTATTCTGGCTATACAAAGCCAAATCCAAAAGACACTAT
1310	89	5	MW2_CDS_09279	MW1741	FALSE	unmapped	TACAAAAGAATCCAATGGCCAATTTGGTGTGGCTGGATTATGTCAAATGATCAAACCAAC
1311	89	3	agr_tiling 147_R		FALSE	unmapped	TCATGAATTGTTCCAAGAAAGTTTTTCTACTAAAGGTGAAGGTCGTGGTTTAGGTCTATC
1312	89	1	MW2_CDS_04618	MW0852	FALSE	unmapped	GTGCAGCAAGTATTGTTGCCGAACAAATTGCTGGAAATGACACTATTGAATTCAAAGGCT
1313	88	164	MW2_CDS_08693	MW1635	FALSE	unmapped	ACTGATATTTTAAAAGTAGGATTTGCATCACTTAATGGTCGCTATATCGGAAATATCTTT
1314	88	162	MW2_CDS_00363	MW0069	FALSE	unmapped	TGATTTAATCGTTTGGAGCATAGGTGGTATTATATTTGGCCTCGTATGTTACACAATGGA
1315	88	160	agr_tiling 027_R		FALSE	unmapped	TTAAGAAAAATACATAGCACTGAGTCCAAGGAAACTAACTCTACTAGCAAATGTTACTCA
1316	88	158	perR_tiling_001_R		FALSE	unmapped	TTTGAATATTTTTATGTTTATTTATAAAGGATACTAGTTATTAGTTAATACCACTTCCGT
1317	88	156	NC_A_049		FALSE	unmapped	ATTTTAATGACTAACTAAAAAAAAGTACATTAATTATTCATTAACTATATAGATCTTCTT
1318	88	154	ETG05_66023		pos		
1319	88	152	MW2_CDS_12299	MW2328	FALSE	unmapped	ACATTGAAATATCCTAAAGGTAACCGTGGCGTGAGATTTATGTTTAAATTGGTCGATGGT
1320	88	150	MW2_CDS_04381	MW0807	FALSE	unmapped	GATTTTAGGTGCCGTATGTACAAGAGCTTGTCGTTTTTGTGCGGTTAAGACAGGTTTACC
1321	88	148	MW2_CDS_09543	MW1792	FALSE	unmapped	CGGCTGTTGGTACTGGTATTAATGCGCATCCTGAATTTGGTGATAAAGTGGCACATTATA
1322	88	146	MW2_CDS_03921	MW0716	FALSE	unmapped	CAGAGCTTCTGGTGCAGGTGGTCAGCATATTAACAAAACTGAATCGGCAATACGAATTAC
1323	88	144	MW2_CDS_02614	MW0482	FALSE	unmapped	TTTCGGTTTCCAATTTGGCCTTAAAAAACGAGATGAAATGTTAATGTTTTTACCTGAGAA
1324	88	142	MW2_CDS_01093	MW0201	FALSE	unmapped	GACTTTGAAATCGAAGGCGACTTCCCTAAATACGGTAACAATGACGACCGTGTAGATGAT
1325	88	140	MW2_CDS_02871	MW0528	FALSE	unmapped	TCTTATCAACTTACGAAGCGACAATGCCAGGGTCGTTACCAACGATGTTTTACAGTCATA
1326	88	138	MW2_CDS_05887	MW1095	FALSE	unmapped	CGTGGTTATGCATCGTTTATGTTATGTCGGGATTGTGGATATGTACCGCAATGTCCAAAC
1327	88	136	MW2_CDS_09318	MW1751	FALSE	unmapped	TAAGCGTAAAGCAACGATTGATAAATATAGCTACAGCGCGACATTACAAGAGATCGCCGA
1328	88	134	MW2_CDS_09991	MW1874	FALSE	unmapped	TGAGCCTACTTCAGGTCTTGATCCCTTAGCTAGAAATGAGCTATTGGAGATAATTCAGCA
1329	88	132	MW2_CDS_08720	MW1640	FALSE	unmapped	GCTGCGGGCTTGATTAATTTTGTAGTATTAACCGCTGCTGCTTCATCATGTAATAGTGGT
1330	88	130	MW2_CDS_11109	MW2100	FALSE	unmapped	AAGGAAAGACGGCATTGAGACATGGCTTTGATACTGCAACAGAAGTTGGTATTAAAGCAC
1331	88	128	(-)3xSLv1		neg		
1332	88	126	MW2_CDS_03342	MW0614	FALSE	unmapped	ATTGAAATGTATGATGGTAATCATCGTGTGTTAAAAGTTGATGCACCAATTGTTGAAGGC
1333	88	124	MW2_CDS_01559	MW0286	FALSE	unmapped	CGTGTGGCGATAGCTAAAGCGTTATATACGAATCCGTCGATTATTTTAGCGGATGAACCT
1334	88	122	MW2_CDS_04062	MW0741	FALSE	unmapped	TTTTACAAAAAAAGGGATATACTTCGTATGCACCACAATATGAAGGTCACGCGGCACCAC
1335	88	120	MW2_CDS_11287	MW2132	FALSE	unmapped	AATTAGTAGAGCGTACCAATTTACCCGTTGTAGAAACATTCCAAGGTGCGGGTGTGATTA
1336	88	118	MW2_CDS_04639	MW0856	FALSE	unmapped	TGCCAGTGTCGTTCATCCATCTACATGGATAGCGAAGATATTTTCAAATCCAGTGTTAGT
1337	88	116	MW2_CDS_13855	MW2615	FALSE	unmapped	TGGATTGAACATGTCATCATTTTGGTTGTTATTTTCTGGTGCTATTACGGCAATACCACT
1338	88	114	MW2_CDS_07236	MW1352	FALSE	unmapped	TGCTCAACTAACGGAATCGCCCAGTTATCAAACTTATCTTCATGACTTAAATAGTATGGC
1339	88	112	MW2_CDS_12070	MW2286	FALSE	unmapped	GGGAAGTGATTACAGCAGGGCAACGTGTCCAAGTAATCAAGGATACTGAGGATTCTAAAG
1340	88	110	MW2_CDS_10542	MW1990	FALSE	unmapped	AGGTGTGTCAGATCGTATCGGTAGACTATTTGAAATTACTGGTCTTAAGGATTTAATGCA
1341	88	108	perR_tiling_115_F		FALSE	unmapped	AGCTTTATAAGAACGAGAAGGGGAATTGACACCGCCTAGAATATATTCGTTTGAAAGTTG
1342	88	106	MW2_CDS_06784	MW1267	FALSE	unmapped	ACTTTTGAGTTAAACGCGCAATTATTGACTAAATTACCAAGCGAAGTGAGTGGCGGACAA
1343	88	104	agr_tiling 036_F		FALSE	unmapped	CAAGATATCATTTCAACAATCAGTGACTTAGTAAAATGGATTATCGACACAGTGAACAAA
1344	88	102	MW2_CDS_04232	MW0778	FALSE	unmapped	TATACAAGCCTGAAGACTTATTCGGAGATCGAATTGTTCCTTTCAAAGGAGAGGCAAGGC
1345	88	100	MW2_CDS_04994	MW0924	FALSE	unmapped	AGGCTTTATATCTGATGGACAGATTGAATTATACAAGCACATGTATCATCATTTAATTGT
1346	88	98	MW2_CDS_00640	MW0118	FALSE	unmapped	ACAAAGACTAAGTTGCTTGATTTTGAACGACCAGAGCGTTCAACTGAGCCTGAAAAAGAG
1347	88	96	MW2_CDS_02912	MW0537	FALSE	unmapped	TCACAACCTTCAAACCAACAACAAAGATTAGCGACAGATGATGACATTGGCAATGGTGAA
1348	88	94	MW2_CDS_12402	MW2348	FALSE	unmapped	GCGGCGAATTCAATATTTGTCGGTGATTATCTAATTACTGGTGGGCAACCGAACCAATTA
1349	88	92	MW2_CDS_11150	MW2107	FALSE	unmapped	GTTCGCGCCATTTATAGATTATAAGTGTGTTACAACAATGCGTCTTGAAGATGAGGCACA
1350	88	90	MW2_CDS_08430	MW1586	FALSE	unmapped	TATTGATAGGGAGCAAAATCATGCAAAAGGTTCCGCCAGATCAATTGATCAAGTGTCGAT
1351	88	88	MW2_CDS_09245	MW1735	FALSE	unmapped	TACTCGGCGGTGCTAAATTATCTGCCACTTTGATAGAGACGGCATTACAATATAACCTGC
1352	88	86	MW2_CDS_02266	MW0418	FALSE	unmapped	GAAGCAGCTGGTTTAATAAAACTGAAAAAAGATTTCGGATTAGCAGGTACAGTGAAAGCT
1353	88	84	MW2_CDS_04167	MW0762	FALSE	unmapped	GAATTCGGCAACAGAAGAGCATCATCATAAAGATTATATTAAACTATATAATTTAGGTGG
1354	88	82	MW2_CDS_00579	MW0108	FALSE	unmapped	TGGCGGAGTAGTACCACAAGGAATGACGCAAGCACAATATACTGAATTAGAGAAAGCTTT
1355	88	80	MW2_CDS_10341	MW1953	FALSE	unmapped	GCATCAATTCCAGAAAAAAATAATGACCAACCTAACATGGGTGGCATGCCAGGAATGATG
1356	88	78	MW2_CDS_05309	MW0983	FALSE	unmapped	ACCATCATTCAATTTGTTATTTACAACTGGTGCGTTTTTAGTAGTGGCAAGTTACATTTA
1357	88	76	MW2_CDS_09397	MW1764	FALSE	unmapped	GTCCTTTAACGGCGTCTTTTAATGCTGGCGCTACATTTGGGCGATTTCATCATTTAATTG
1358	88	74	MW2_CDS_07032	MW1314	FALSE	unmapped	CCCAACTGATGATCAAGGGCAATTTTTCGATAGAGGCGAAAGCTATCAACCAGTCATTTT
1359	88	72	MW2_CDS_07387	MW1379	FALSE	unmapped	TGGGGAATAAAAGCTAATTCATTTATCACATCATTAGGTAAAATGTCTGGACATGATCCA
1360	88	70	MW2_CDS_01838	MW0335	FALSE	unmapped	AACACCACTAGCAGAAGGTGCTGATATAGTCTTACATTCAGCCACGAAATATATTGGCGG
1361	88	68	agr_tiling 193_R		FALSE	unmapped	GTATTCAATTGTAAATCTTGTTGGATTTTAACAAGATAACTAGCAAATGCACTGTATAGC
1362	88	66	MW2_CDS_13405	MW2536	FALSE	unmapped	GCAAATGATTGTGCAGAACGTCGAGAGTTATTATCATACATTGACGTTTTAGTAGATGGT
1363	88	64	MW2_CDS_09796	MW1839	FALSE	unmapped	TGGTATCGCAGAAAAGCCTAATCGTCCTAAGCTAGGTGTCATTCCTATGGGTACTGTTAA
1364	88	62	agr_tiling 115_R		FALSE	unmapped	TATTTGCATATTCGCAAATTGATGCGAGTGATGCATCAACAATCAAACAGTATTCGCTTT
1365	88	60	MW2_CDS_08715	MW1639	FALSE	unmapped	TGCGTCCTAGAGCGAAATATATTGGCGAAACGAATCGTAAGTATATCCCGCTTGAAGAAA
1366	88	58	MW2_CDS_03483	MW0638	FALSE	unmapped	ATTTGCCAATGATATCTTTGAATAAAGATTTAGGTTATCAAGTGAGTCATGTGAAAATGT
1367	88	56	MW2_CDS_10163	MW1914	FALSE	unmapped	TGTTTTAAAAAGGCTAAAAAGATGATTGGAGCTTATATTATTCCAACAGAACAGCATGAA
1368	88	54	MW2_CDS_06729	MW1257	FALSE	unmapped	ATCGCAAAATCTAGAAGTGTTAGTTGAAGTACATGATCGCCATGAATTAGAACGTGCCTA
1369	88	52	MW2_CDS_08781	MW1650	FALSE	unmapped	GGTGGTAAAGCAAACTTTGATTTCGGAAGCGTTAAATTTGTTCAAGCATTTCATAGTTCA
1370	88	50	MW2_CDS_00724	MW0134	FALSE	unmapped	TCAAAAATATTTATGCAACAAGCCAATGACTATTATATTGAACATGGTAACTTCCGAAAT
1371	88	48	MW2_CDS_03853	MW0704	FALSE	unmapped	TGCAGCAGTCTTGAATGGACTGTATCAAGCTGAAATATTAACCAGTCATGCATTAGTAGA
1372	88	46	MW2_CDS_06581	MW1229	FALSE	unmapped	ATGTTATCCGTCCTGCTGATGGTAATGAAACAAGAGTAGCATGGGAAGTTGCCTTAGAAT
1373	88	44	MW2_CDS_09152	MW1716	FALSE	unmapped	TCACTAATGAAATGATGTATCGTGATGGTCAAATTGAAGGTACGATTGATTTAAATCAGT
1374	88	42	MW2_CDS_03051	MW0561	FALSE	unmapped	TGTCAAACCTGTTAAAAATAAAGCTTTTTGGCCAGTTGCAGGTAGTACTATTTTGTTCGG
1375	88	40	MW2_CDS_07538	MW1415	FALSE	unmapped	GCGGAGTGGGTTAACACACTTGAGTTTTTTAAAAATTGGAAGAAACAACCAGGTAAGCCA
1376	88	38	MW2_CDS_01575	MW0288	FALSE	unmapped	TGTCGATTTGAATTTAGGCAAAGAGGCATTAAACTTCTTATGTGCCTATACCACGAAACA
1377	88	36	MW2_CDS_13768	MW2599	FALSE	unmapped	TGCTGAAAATGAATCTCGAGTTTTAACAGGTGGTTATTACAAAGGAAGCATCGAAGGGTT
1378	88	34	MW2_CDS_08458	MW1591	FALSE	unmapped	GCTGAGGTTTTAGGCACAGGTATTGATGAAGAAAGTGCCATTGAACTTGCTAAACGTTCT
1379	88	32	MW2_CDS_09526	MW1789	FALSE	unmapped	AATTACAAGTTAGCGATCGTACACAAGCAGCAATTTATGCAATGGAAAATAAGTTGATTT
1380	88	30	MW2_CDS_11871	MW2250	FALSE	unmapped	TACTGGGCGTGTTAAATTCATTTTTCAACCAGCAGAAGAACTAGGACATGGCGCTTTTAA
1381	88	28	MW2_CDS_13278	MW2513	FALSE	unmapped	GATTACTGTGCAACAAATTGCAGATTTAGCTGATGTTAACCGTAGTACATTTTATACGCA
1382	88	26	MW2_CDS_02931	MW0540	FALSE	unmapped	TTCGTTGGTACATGTGGATGGATGGTTTACACCTTATTCTTCAACGGCTTTAATGTGCAC
1383	88	24	MW2_CDS_02681	MW0495	FALSE	unmapped	AATCAAAGTTGTTAAAGCTGTTAAAGAAGCAACTGGTTTAGGATTAAAAGATGCTAAAGA
1384	88	22	MW2_CDS_01080	MW0199	FALSE	unmapped	CGTCAGAATTTACATGTTTTAGTTTGCGACAATGGTATTGGGATGTCGTCATCTCGCCTG
1385	88	20	MW2_CDS_02767	MW0510	FALSE	unmapped	GGAGACACTGCTAATGATATGAAGACAGCAAGTAATGCAAATTTAGGTATGGCAATAGGT
1386	88	18	MW2_CDS_08704	MW1637	FALSE	unmapped	GGAGCTAACACCGAAAGAATTTGAACTCTTGCTTTATTTGATAGAAAGACAAGGCAGAGT
1387	88	16	psma_tiling_022_F		FALSE	unmapped	GATACTCGAGGTCTGAGACATTCATGATTTGGCATACGAAATCTTAATGATTTTCATAAT
1388	88	14	MW2_CDS_02468	MW0456	FALSE	unmapped	AGAAAATCTGGTAAAGTACCAGCAGTAGTATACGGTTACGGTACTAAAAACGTGTCAGTT
1389	88	12	MW2_CDS_06429	MW1196	FALSE	unmapped	TCGTAATAAGTCTTTTTCTGTAGTAAGAGACTTTATCGAGAAGCAAGAATTTCCCGAAAA
1390	88	10	MW2_CDS_01160	MW0213	FALSE	unmapped	GGGATGCAACGATGTATAGTTTTGGGACAATCCCTCGCGGTGATACAGGTTATTTCTTTA
1391	88	8	MW2_CDS_04038	MW0736	FALSE	unmapped	TGAAACAGACGAAGAGCGTGAAAGTGGTAAAGCTAACGATGTTGTAGGTGAGCAAGTTAA
1392	88	6	MW2_CDS_07177	MW1342	FALSE	unmapped	TCGTTGGAAAGATAATGTGAGACAGGTAGAAGACCGTTTATGTTCTGTCATACCTAGAGA
1393	88	4	MW2_CDS_01630	MW0297	FALSE	unmapped	CAATCATGATAAAGCAGCACCAACTTCAACTACACCCCCGTCTAATGATAAAACTGCACC
1394	88	2	MW2_CDS_03337	MW0613	FALSE	unmapped	GGTGACCACGGGGTTAACATGGTTCGTGGGTTTAGTAGTCTTAAAGACAAACTTGATGAT
1395	88	163	MW2_CDS_05633	MW1047	FALSE	unmapped	TGGGGCGCTGAAAGTTGGGGAAATATTAATCAGTTAAAAGGTCGTTACGTAGATGTGTTT
1396	88	161	perR_tiling_065_F		FALSE	unmapped	CATATATATGATTCGAAAATAACTGGTAAACGCCTATCAGGACAAACAGTTTTATTTTTA
1397	88	159	MW2_CDS_12391	MW2346	FALSE	unmapped	GCGCATCCTTATGTCAAAGGAGAACTTTGTGTGTCAGATGACTTAACGTATACGACAGGT
1398	88	157	MW2_CDS_01693	MW0309	FALSE	unmapped	TCTTTGGTAGTAAAGCTAACGATCCCGTTCACCTTGTAATTACATTAGCAACGGACCACC
1399	88	155	MW2_CDS_04733	MW0873	FALSE	unmapped	AATCGTCCCAGGTGAGGCTGTTCAACTTGTTAAATTTGATGATTATTGGCAAGGTAAGCC
1400	88	153	MW2_CDS_12568	MW2377	FALSE	unmapped	GCCATTCAATTTACAGCCAATGAAGTTATACCTATTGGCGGCATGCTTGCTAATAATGGC
1401	88	151	MW2_CDS_05447	MW1009	FALSE	unmapped	ACCAATGAGAGCTTATTCAGAGCAAAGTGACCAAATGTTGACAGTAGGTAATGGTTGGGA
1402	88	149	MW2_CDS_01477	MW0271	FALSE	unmapped	ACAGATAGTTCAAGTGGAATAGTTAATAAATCTGAATATAATTCAGTTGAAAGCTTACGT
1403	88	147	NA		ignore		
1404	88	145	MW2_CDS_13381	MW2532	FALSE	unmapped	GTGCAGGTTCTGAAGTTGGTGACGTAATGTCAGGTCATAAAGAGGTTGACCTTGTATCAT
1405	88	143	MW2_CDS_02856	MW0525	FALSE	unmapped	AGAACCGTTAAATCTGTTATTAAAAATTCTAAAGTTGCAGTAGCAGGTGGAATTAAACCA
1406	88	141	MW2_CDS_04643	MW0857	FALSE	unmapped	GTAACAGACGAAGAAATTGGCGATATTGTCAGCCAATGGACAGGCATACCAGTTTCAAAA
1407	88	139	MW2_CDS_07872	MW1483	FALSE	unmapped	AAACAACTTACAAAAGGACAACAAGCGTTGTCAAAATTAAACTTAAATGCAAAATCATGA
1408	88	137	MW2_CDS_04353	MW0802	FALSE	unmapped	ACATTTAGCAATTGTGTTGGACGAATTTGGTGGTACTGAAGCGATAGTGTCACATGAAGA
1409	88	135	MW2_CDS_01449	MW0266	FALSE	unmapped	AATGGATTTCAAATACGAATTATAAATAAAGACATTGCATGGTGGTCGATTGTACAATCA
1410	88	133	MW2_CDS_05335	MW0987	FALSE	unmapped	TCATGGCTTGGATTGCAAATAGTATTAGTATTATTTATTTATTAGTTATGGGGCTATCCT
1411	88	131	MW2_CDS_12865	MW2434	FALSE	unmapped	TCAACTTTTATCGCACCTATTGTCTTTATTCTACTAATGGTTGCTCAAGGTTATATTGCT
1412	88	129	MW2_CDS_12357	MW2340	FALSE	unmapped	CGAACATCATTTGCACAAAAAAGGTATTTCCTCAGTATACGTTCACCCAGAACCAGACCA
1413	88	127	MW2_CDS_07254	MW1355	FALSE	unmapped	TGCTAAAGGTATTGAAACGAAGCTGGATATTGTTGTTGCAGATGAAAAAGAACAAGGTGT
1414	88	125	MW2_CDS_03600	MW0660	FALSE	unmapped	ACTCCCGATGAGCAAGAGGCATTAGTTAAACAAACAGCAATGTCATTAGCCAATCAATCA
1415	88	123	MW2_CDS_13796	MW2604	FALSE	unmapped	TGGATGGATTGGCCTAAAATTAAATCTTTCTTCAGGCCGATTTTCTAGGAAATCGATGAT
1416	88	121	MW2_CDS_02404	MW0445	FALSE	unmapped	CAAAGAATCAATGCAACCGCCTGCTACTGAAGAGGAAAAAGAAGAGATTCCTAGCAAACC
1417	88	119	MW2_CDS_00184	MW0034	FALSE	unmapped	TTCAATAGAAATTGTCTTTTTTCACTTATCCAAGAACTTTATGTCCCGGACTCATTATGA
1418	88	117	MW2_CDS_11261	MW2128	FALSE	unmapped	TGCTAAAATCAATGCTAGTGATAATCATGATGACAATGTTGAACGTCTTTGGGAGAGAAA
1419	88	115	MW2_CDS_02247	MW0415	FALSE	unmapped	AGATACAACGCATACAGATTCAATTGTACAAGCGATACGCCCAACAACAAAGATGTTGTT
1420	88	113	MW2_CDS_10326	MW1949	FALSE	unmapped	ATAGCGCACATGTGACAGCGTGTAGGTTATTGAAAAAGCCGCACATCAAGCAATATATAC
1421	88	111	MW2_CDS_11775	MW2232	FALSE	unmapped	AGTGCTTAATGAAAGTCAGTCGTACTCGACATTACCATATAAAAGCGAAATCAACGCAAT
1422	88	109	MW2_CDS_04611	MW0850	FALSE	unmapped	CGGCTATACAATTATTAACGATATCACTGATCGCAAAGCACAAAGTGAACAAGATCAAGC
1423	88	107	agr_tiling 031_R		FALSE	unmapped	ATTAAGTTGGGATGGCTTAATAACTCATACTTTTAGTACTATACGAAGATAACAAATTTA
1424	88	105	MW2_CDS_05976	MW1111	FALSE	unmapped	GCGCAATCAATTTTAGATATTACATCGGATTCTGTTTTTCATAAAACTGGAATTGCGCGT
1425	88	103	MW2_CDS_10439	MW1971	FALSE	unmapped	AGGTCTCTAAAGGCGATCATATAGCAATCATTGGGCCAAATGGTATTGGAAAATCGACCT
1426	88	101	MW2_CDS_03543	MW0649	FALSE	unmapped	ACTGATGACCGTCTTGAGAGAATTGATAAGCAATTAGGTATGATTTGTGCAAGTATTCCA
1427	88	99	agr_tiling 047_F		FALSE	unmapped	ATAAATACTTAACTGTTAAATGTAATTTGTATTTAATATTTTAACATAAAAAAATTTACA
1428	88	97	MW2_CDS_10818	MW2043	FALSE	unmapped	CTATCAGCAGATGGACACCGTGTTATTGTTGCTGGATTAGATATGGATTTTAGGGGCGAA
1429	88	95	MW2_CDS_08702	MW1637	FALSE	unmapped	CCTAAGAAGCCACAACTTATTAAAACTGTGCGTGGCTTAGGCTATAAATTGGAAAGACCT
1430	88	93	MW2_CDS_05096	MW0943	FALSE	unmapped	TGCCAAACAATACTCCTGTTGGATTCTGGATTGGTATCTTTATGACTATCGGCGGTTTCT
1431	88	91	(+)E1A_r60_a20		pos		
1432	88	89	MW2_CDS_08095	MW1524	FALSE	unmapped	CAGTGCCTAAAGCAGAACCGGTGGAGCAGAAACATAGACCTTCTAGACAAGATAATTCTG
1433	88	87	NC_A_012		FALSE	unmapped	ACTGCACATAGCTTTTAATATTCCGTTCAAAGGAAAGGGGCATACAATTGAACAATCTGT
1434	88	85	MW2_CDS_12687	MW2399	FALSE	unmapped	AGTTGCATCCGTCATTTATTTAAAAATGAAATATGACGAAAAAGAAAAACAAAAAGCACT
1435	88	83	MW2_CDS_03571	MW0655	FALSE	unmapped	TCTCACCGTTGGCTTAATAGATTAATTGTTGTCGTGCTAATGTTTTTAAATGGATTCGGA
1436	88	81	NA		ignore		
1437	88	79	MW2_CDS_09144	MW1714	FALSE	unmapped	AGTAAGCGGGCCATATTCCCTTTTATTATTGCGAGTGGTTTTATAGCTGACACAACTTCT
1438	88	77	MW2_CDS_04547	MW0840	FALSE	unmapped	TTTAATTCACCAGGTTTCATCACAGGTAAACCAATTGTATTGGGTGGTTCTCATGGACGC
1439	88	75	MW2_CDS_03811	MW0697	FALSE	unmapped	GTCATTATCTGGTGGACAACGTCAGCGTGCATACATTGCAATGACAATAGCACAAGATAC
1440	88	73	MW2_CDS_08618	MW1622	FALSE	unmapped	ACTTCGGTTCAAAACATACATTATACAAAGTAGCTAAGCAACAAGTAATGAAATCAGGTC
1441	88	71	MW2_CDS_01938	MW0356	FALSE	unmapped	AAATAAAGAACCTTATGATGTCTTAATCGTTGGTGGTGGTCCTGCTAGTGGTAGTGCAGC
1442	88	69	MW2_CDS_02801	MW0516	FALSE	unmapped	ACCGACAACTGCAAATGCAGGTACAGATGATGCTGTAGATTCTGATGGACTAACTACAAC
1443	88	67	MW2_CDS_01006	MW0186	FALSE	unmapped	AACTGGTGAATATGACACAACTACAAACGATAGAAAAAATGCTACTGACTCGACATACAA
1444	88	65	MW2_CDS_09467	MW1778	FALSE	unmapped	TCGGTGCAGCATTACCTAAAGTAGCAAATGCTATTAAGCGTGCATTTAATCCTGATGGTT
1445	88	63	psma_tiling_023_R		FALSE	unmapped	TTCGTATGCCAAATCATGAATGTCTCAGACCTCGAGTATCAAACATAAAACACGCCACAA
1446	88	61	MW2_CDS_00452	MW0086	FALSE	unmapped	CCTCACCTGATATTATCGGTATCACAGGTGGTGCTAGCTTAAGTGCCGTTGTCTTTATTG
1447	88	59	MW2_CDS_03253	MW0598	FALSE	unmapped	GCGTAGGTGGTTCTCTTGAAGTATTTGCTGGGGCTAAAAAGAGAGCGCCTTATATCTTTA
1448	88	57	MW2_CDS_13383	MW2533	FALSE	unmapped	CCGAAGCGATTGAAAGCGGTGAAATTTTCAAATATTTCCCAATTCCAGAACAGCCTTCTG
1449	88	55	MW2_CDS_02049	MW0379	FALSE	unmapped	GCAAAAAAAGAAAGGTAGCATTGAGGTTAGGAGAGTTGAGTGAGTATTCAGTTGAATGCA
1450	88	53	MW2_CDS_12360	MW2340	FALSE	unmapped	TGCAGTCAATCAAAGACTAGCGAAAAGAACGAAAAGTAGTTCTTTAAATTCGGCTGCCAA
1451	88	51	MW2_CDS_07274	MW1359	FALSE	unmapped	ACGACGTATCAATCGCAAAACAGCACTGTTAATTCAAATATCAACTGAAGTTGGTGCAAT
1452	88	49	MW2_CDS_07654	MW1445	FALSE	unmapped	TGAATGCACGATTCTTTGTTGTGACCACAAGCTATATCGACAAGATTGAACAGGGAGGTA
1453	88	47	MW2_CDS_13316	MW2520	FALSE	unmapped	AGTGGATGACGTTGTCGTTGAGATACAAAACTTTGAAACATTCCAACAACATTTCCCGGT
1454	88	45	MW2_CDS_13099	MW2480	FALSE	unmapped	TCCGAATTCAATTGCGGAGTTTGCTGTGAACCAGGCTATTAATGTGGTTCGTCATTTTAA
1455	88	43	MW2_CDS_07918	MW1491	FALSE	unmapped	TATAAGTATAACTTTACTAATTGTTCCAGACTTAATTAGACTTAGTAAAACTTTTCTAAT
1456	88	41	MW2_CDS_13671	MW2583	FALSE	unmapped	ATTATGTTTGCAAATCCTGACAGTGCAGTTCAAAGCATTGTAATCACTTCAGAGGCACCA
1457	88	39	MW2_CDS_12584	MW2380	FALSE	unmapped	AGAGCGATATTCAAGAAGAATTAACCATCAGCACAGGGTCGTCTATACCGTAGATGATCG
1458	88	37	MW2_CDS_12429	MW2352	FALSE	unmapped	AAAGATGCGCCTATCATTGTATTAGATGAAGCGACTGCTTACGTTGATCCAGACAACGAA
1459	88	35	MW2_CDS_05221	MW0966	FALSE	unmapped	AGCTGCTGACCGTATGTCAGAGCGTGTATCATATCTATACCAACCATATAACCCTTCAAT
1460	88	33	MW2_CDS_03239	MW0596	FALSE	unmapped	CTGTTAAATTTCCCAGAAACTTGCCCGCACGGCGGTGTGATTCCTAGAAATAATGAATAT
1461	88	31	(+)E1A_r60_a20		pos		
1462	88	29	MW2_CDS_13023	MW2464	FALSE	unmapped	ACGAATTTATGCAAAGTTTTCTTGGTGATGACACACCATTAGGTGAATTGGTTGATTGGA
1463	88	27	psma_tiling_007_F		FALSE	unmapped	AAATTTCTGCTTTATCAAAACTATCACACTTTAGATAGATTGAAAACAAAAAGATCCTAA
1464	88	25	NC_S_014		FALSE	unmapped	ACAAAACAAATTTTGCTCGAAGTACTATGACTGTACCTAGTCCTTACTGTCATATGTACA
1465	88	23	psma_tiling_075_F		FALSE	unmapped	GCAGAAAATTTACTATTGCAGGTTTCAGTTTAACTAGACACTGCATCACGGTACGTTGAT
1466	88	21	MW2_CDS_07358	MW1374	FALSE	unmapped	ACCCTTAATCAAAGAGGATGATAAGTCTTTTAGGGACGGTATGAGAAACTCAAAAAAACA
1467	88	19	psma_tiling_052_F		FALSE	unmapped	AAGTTATCAAAAGCTTAATCGAACAATTCACTGGTAAATAAGATTTCATAACAAACAAAG
1468	88	17	MW2_CDS_10002	MW1877	FALSE	unmapped	TGTGGTGGCAAGAAGGGATGATGACACTTATTACAGGTGGCTTACTAATTATTTTTCGAC
1469	88	15	MW2_CDS_01208	MW0222	FALSE	unmapped	ACAGAAGTTGGACCTTATGAAGACACTGCAGATTTATTAGTTACAACTGCAATGACAAAG
1470	88	13	pMW2_011		FALSE	unmapped	AGAAGATGATAAATCTAAGAAATTACTTAACATTTTAGAAAAAATTTGTGATGAGAAGAA
1471	88	11	MW2_CDS_05514	MW1022	FALSE	unmapped	ACCTTGAATTTAGTTATCGTCGTGCCGATATTGATGGATTACATCCAGGTCGTACAGCTG
1472	88	9	MW2_CDS_10637	MW2007	FALSE	unmapped	TCAGTTGTTACCAATCACTGGTATTCCATTACCATTTATTAGTTATGGTGGTAGTGCGCT
1473	88	7	MW2_CDS_07055	MW1317	FALSE	unmapped	TCAAATCATATTGATGCGATTCAAACACAATTAGCACGTGAAAGCTTCAATCCTCCAACA
1474	88	5	MW2_CDS_03052	MW0561	FALSE	unmapped	TGCAATATTTCTGGGTGTTTTAATACTTTTTTTATTTCTGAATCGTAAGCTAAGGTTGGA
1475	88	3	MW2_CDS_07825	MW1474	FALSE	unmapped	TGCAAAGCGAAGGCCAACCAATTGATCTTGAAACTTTGGAAATGATACACAAAACAAAAA
1476	88	1	MW2_CDS_10978	MW2075	FALSE	unmapped	TAAGGAGTAAATTCATCATGTTTAAGTATATAAGCTCTAAATGTATAATATGCACAGGTT
1477	87	164	MW2_CDS_12796	MW2421	FALSE	unmapped	AGAAGATACTGCAAAAGGAACTATGAGCGGGCAGTACGATGCCAAGCAAATTATTGAAAC
1478	87	162	MW2_CDS_12363	MW2341	FALSE	unmapped	CTGAAAAGAAAGTGGCGCCAAAAGTTGAGGCTCCTCAAATTCAATCACCACAAATTGAAA
1479	87	160	MW2_CDS_06822	MW1274	FALSE	unmapped	ATTAAAGGATAGGTTGCACACAAATGCATATAGTTTATCCGGTGGGCAACAACAACGTGT
1480	87	158	MW2_CDS_12689	MW2400	FALSE	unmapped	ACATTTCACTAACTTTGAAACAAGTCCTATGGGAAGTGCTGTGATTGAAGGCTACATCAA
1481	87	156	MW2_CDS_03827	MW0700	FALSE	unmapped	TAGATCATATCGAAGTATCTGATGATGCGATAATAGCCGGTAGCGGCGCTGCAATTATTG
1482	87	154	MW2_CDS_01516	MW0278	FALSE	unmapped	AAAAAAGAAGGTCTTGAACCATGGACATCATGTGAATTTGATTTTACAAGCGAAGGTAAA
1483	87	152	MW2_CDS_12133	MW2296	FALSE	unmapped	AGTGAAGGATCAAGCTTACAAGGTTCACAAATTGCATCAGCTGTATTAACTGGTATGGGT
1484	87	150	MW2_CDS_13150	MW2489	FALSE	unmapped	ACCTGATTTGGAGAACATCGAACATAACTATTTGAATAATGGAGGGCAATTTTGGCTTGC
1485	87	148	MW2_CDS_06050	MW1125	FALSE	unmapped	TGGTTTATTCACTGGCATTTCTGCGTTTTTGGAAAATGACAGAAAGCAAAATCCCAATGT
1486	87	146	MW2_CDS_12784	MW2419	FALSE	unmapped	ACGCAAAAAGAAGGCGCAGGTAACGAAATTCAGTTAACAGATGCGATTGAACGTATGAAT
1487	87	144	MW2_CDS_09331	MW1753	FALSE	unmapped	TTGAACCCGGGAATTCAGGATCACCAGTTCTAAATTCTAACAATGAGGTCATAGGTGTGG
1488	87	142	MW2_CDS_04118	MW0754	FALSE	unmapped	TGTGACTAATGTAGTGGTTACTGATGATGCGCATGATGTCTTTGTTGGAGACTTTGGACA
1489	87	140	MW2_CDS_09054	MW1698	FALSE	unmapped	AAAAACAGTTTGCATGGTCTAATTGAAGAGCGCTACTTACTGTTCATGCTGGAACAAGCA
1490	87	138	pMW2_049		FALSE	unmapped	TGGTCAAGCAATAACATATGCTTCTAGAAATGATGTTGCTTTTGTTTATCCTAAGGGCCA
1491	87	136	MW2_CDS_07856	MW1480	FALSE	unmapped	AAAGAAAAAGAAACTGAGATTATCACGCCACAAATCTCACAAATGCCAGTTGAAGCTGCG
1492	87	134	MW2_CDS_08210	MW1544	FALSE	unmapped	TGATGATTTAGGTAAAATGTATCAAATTGTTCGACAATACGAATTAGGTAATGATCTACT
1493	87	132	MW2_CDS_13008	MW2461	FALSE	unmapped	TTCGCTAAAAGGTTACAACAAAAATATCCGAACCCATTTTTGAATCCAGCATTAATTGCA
1494	87	130	MW2_CDS_05445	MW1009	FALSE	unmapped	TACTGGAACGTATACAATGCCTTGTGCACGTACTCTTGTACCAGTAAAAGTCCCACTAGA
1495	87	128	MW2_CDS_01646	MW0300	FALSE	unmapped	TTAAAATGGACGCAAAGGTGATGGCATCTGTATTTGTCATTGTAGCTGATAACGAAGCGG
1496	87	126	MW2_CDS_08443	MW1589	FALSE	unmapped	GTAGAATTAGATTTTCCTGGTTATGCAATCGGCGGTTTGTCAGTTGGTGAACCTAAACCG
1497	87	124	MW2_CDS_06351	MW1179	FALSE	unmapped	AGGAACAAAAAGTAAAGACCCTAAACGAAGAATTCCATATATGGAAATTGTTGGCCAAGT
1498	87	122	MW2_CDS_04742	MW0875	FALSE	unmapped	TCAAGATCCGTATGCATCATTGAATCCGATGCAAATGGTTGGAGATATCATTTCAGAACC
1499	87	120	NA		ignore		
1500	87	118	MW2_CDS_02589	MW0478	FALSE	unmapped	TTCGAAGAAGCATTTGTTGTTAAGCAAATTTTACAACATTTAGCTACGAAACATGGCATT
1501	87	116	MW2_CDS_01396	MW0256	FALSE	unmapped	AGTCTATCTTCAAAAGACCGTGAAAAACTTGAAAAAGAAATCGAAAAAAATGGCGGCAAA
1502	87	114	MW2_CDS_01394	MW0255	FALSE	unmapped	TGTTATGGAGTATCGTTGGTGTAGTTTGGATTGTGTTCAGTATTCCGAATACCTTTGAAT
1503	87	112	MW2_CDS_12925	MW2446	FALSE	unmapped	CGAAGCAATACCGTCTAACGTACTACTAAAAAACTTGAGTGATGGTCAAAAACAAAAGCT
1504	87	110	pMW2_046		FALSE	unmapped	AGCACTGTTTGGACTTGACCGTCATATTATAAGTGATAAAAATTCACGTATGTCATGGAA
1505	87	108	MW2_CDS_07249	MW1354	FALSE	unmapped	AGCAGAAGGGTTATCAATTAATACAACCCCTGAAGCAATTCGATACATTAAACCTGCAGA
1506	87	106	(+)E1A_r60_a135		pos		
1507	87	104	MW2_CDS_01141	MW0210	FALSE	unmapped	CGCCAGGATATTGGAATAAACCAGCAGAGACTGCCAAAGCATTTCATGGTCGTTATTTAT
1508	87	102	MW2_CDS_05601	MW1039	FALSE	unmapped	TTTGGTTACAAATAGAAAGAAGCCTTTTCTGTTCTTAAAAACACTCTTTATGGGTGTGGT
1509	87	100	MW2_CDS_04596	MW0848	FALSE	unmapped	TCCCGTTTTGAAGGTTATCAACAATGCCCATTTAAACACTATGCGTCACATGGTCTGAAA
1510	87	98	MW2_CDS_10447	MW1973	FALSE	unmapped	TTGTAAAGAATATGGTGTTCAGCGATTAATTGTTGCTGGTGGCGTGGCGAGTAATAAAGG
1511	87	96	MW2_CDS_02224	MW0410	FALSE	unmapped	ATCGCGCTGATTGTATTTATAGGTATGTTTTACAGTGTAGTGACAAATCAAGAATGGCTT
1512	87	94	MW2_CDS_07707	MW1453	FALSE	unmapped	AGGTACAGTTCACTTAGATGAAGATGAATTTGTCGAAGTCATTAAAGTTCCGATTGAGAA
1513	87	92	MW2_CDS_07163	MW1339	FALSE	unmapped	AAGATTAGACTATCTAAAAGCAGTTGATAAGTTGATATTAGATGAAAGTGAGGACCGCGT
1514	87	90	MW2_CDS_07457	MW1394	FALSE	unmapped	AACAAAACGAATAAGATACCTGTTATATCAACAAAATTTAATTCAAGCATCTAGTCAGTT
1515	87	88	MW2_CDS_05693	MW1060	FALSE	unmapped	AACGACATCAGTATGAAGCAATTTAGAGAAATTCAAGAAACACTCCATCCAATGGGAGGA
1516	87	86	MW2_CDS_13205	MW2499	FALSE	unmapped	AGCTTATTGTTCGTCTAAATCGGCAGTAACAATGCTAACGCTACAATACGCTAAAGGATT
1517	87	84	MW2_CDS_01732	MW0315	FALSE	unmapped	TGCTAATTCACCAGATTATAGAGAAGCGCTAATGGTTGGAAGCCCGCAACAAATTATTGA
1518	87	82	MW2_CDS_10660	MW2013	FALSE	unmapped	CGATGCCAGACGAACAACGTCAAATGGGTTACATGATGATGGTCATTTCACCAATTATGA
1519	87	80	MW2_CDS_11875	MW2251	FALSE	unmapped	CCCTGGTAGTAGTGTCACAAACAACTTACAACTTGTTATGGCGATTGCAGCCTTGAAATT
1520	87	78	perR_tiling_073_F		FALSE	unmapped	AACGGGTGTAAATACATTGCCGTTAGATTATATTGCAGATCACGGCATACTTTTAACTAA
1521	87	76	MW2_CDS_13020	MW2463	FALSE	unmapped	TGGGCACGCCCTTATTTGATAGAAGTAAAAGACATTTAATTCTTACCGATGCAGGTCAAA
1522	87	74	MW2_CDS_11525	MW2185	FALSE	unmapped	ACTTCTCAAAAGAAATTGTTAGATAAAATTACTAAAGAAATAGAAGTGTTAAGCGTTACA
1523	87	72	MW2_CDS_03391	MW0622	FALSE	unmapped	GAACAAACCATTACAGAATTTGTGCACGACATAAAAACACCTGTGACAGCCATGAAATTA
1524	87	70	MW2_CDS_12341	MW2336	FALSE	unmapped	ACAAAAGTTGATGGCTTTAACCAATCAATGGATTTATTATTGTCTAAGCGTGTTGATGGT
1525	87	68	MW2_CDS_09048	MW1697	FALSE	unmapped	AGTGCTGGTTTTGCAGTGAGTTTAATTCCTTTTATTACAAAAACATTTGCAGAAGGTCGC
1526	87	66	MW2_CDS_07444	MW1392	FALSE	unmapped	GGTAAATACCGATGACAATGTTGAGCCAAACATTGCACCAAGCACAGCAACGAATAAAAT
1527	87	64	agr_tiling 033_F		FALSE	unmapped	TTCACTAAAAAATAAGATGAATAATTAATTACTTTCATTGTAAATTTGTTATCTTCGTAT
1528	87	62	MW2_CDS_01765	MW0321	FALSE	unmapped	TTTAGGTAATAGTGGCATTCTTCGTGAAAGTATGGAAGCGGGATTAGGTATTGTTGCGGT
1529	87	60	MW2_CDS_09122	MW1710	FALSE	unmapped	ATGTAGCCAACATATTAATAATCAGTTAGTTAAGCAAGGGTCTATTACTGTGGATGGTGT
1530	87	58	MW2_CDS_12982	MW2456	FALSE	unmapped	CCTGGATATTACCAATTCCATATTTATCCAGTATTTCCGATACCAGAGCGCCGACGCTTT
1531	87	56	MW2_CDS_03874	MW0708	FALSE	unmapped	ACTTTAGCTTCAGCGATAACATTTGTCGATATTTGGCATTTCTTCTCACTCGTAAATCGT
1532	87	54	MW2_CDS_02625	MW0484	FALSE	unmapped	GGAGAAACATGTACAATTGGTGATAATGTGACAATCTATCAAGGCGTGACACTTGGTGGG
1533	87	52	MW2_CDS_07128	MW1331	FALSE	unmapped	ATGGACACAAACGGTGACCTTGGTCAAGGTGAATTAGCGATTAATCCACCTAAATCAGAT
1534	87	50	MW2_CDS_00755	MW0140	FALSE	unmapped	TTAAAGAAGCTCATAAAAATGTACGTTTAAAAAGTGATGACGATGGACAGCAAAGTCCAA
1535	87	48	MW2_CDS_01774	MW0323	FALSE	unmapped	AGATTTAGATAAAGAGTCTCACGATACACCCAGTAAGGAATCGAAGCAACAGCGAGAGCA
1536	87	46	MW2_CDS_06529	MW1218	FALSE	unmapped	CAATGTTTGAAGTCGCAGGTCTAGCTATTGCTATGGGGAATGCATCAGATGAACTTAAGC
1537	87	44	MW2_CDS_07266	MW1358	FALSE	unmapped	GGTTTAACTGTTGGTAGAAATATCATTCACGGTTCAGATTCATTAGATTCTGCTGAACGT
1538	87	42	MW2_CDS_12892	MW2440	FALSE	unmapped	TCGAACGAAACAATCGCTCAATGTCTTTGTCGGAATGAATAGGGCGTTAGACACATTAGA
1539	87	40	MW2_CDS_09831	MW1845	FALSE	unmapped	AAGCAGGTGACATCATACCTGAAGTTGTACGTAGTATTCCAGAACGTAGACCTGAGGATG
1540	87	38	MW2_CDS_05495	MW1018	FALSE	unmapped	AAAATGAAGATGAAAGTAGCCCGATTATCAATAACAAAGTAATTACATATGATATAGGCT
1541	87	36	MW2_CDS_08213	MW1545	FALSE	unmapped	ACAGATGATTATCGACGAGCTTGGTTTTGGAGATATTTGCGACGATGAAATTAAACGTGG
1542	87	34	MW2_CDS_12088	MW2289	FALSE	unmapped	GCGCCGGTTGCACGTCAAATTTATCCGTTTAATGGAAATAAAACTCAAGCTTTACAGCAA
1543	87	32	MW2_CDS_08075	MW1520	FALSE	unmapped	GCTGAACGAGCTAGTTTGGTATCGGCAATTTCTCAAGGATACAGACCAGGTGATTTTGAA
1544	87	30	MW2_CDS_11106	MW2099	FALSE	unmapped	TTACACAAGACCAAGATATTCATGCAGTTCCTAAATTAGACAGCAAAGATGTATCTAGAA
1545	87	28	MW2_CDS_04665	MW0861	FALSE	unmapped	CAGGGTTAACTCGTCCACAAACTATAAATAAACTTTCTAGCAGTAGTAACTTAAGAGTGA
1546	87	26	MW2_CDS_03192	MW0587	FALSE	unmapped	TGAGTATGGGAACGTATGGTTCTAGTAGATCAGAACCACTAATAACTGGTGGAAACCAAT
1547	87	24	MW2_CDS_12413	MW2349	FALSE	unmapped	TAAGTTATTGTCACATATTGAAACGACATCATCAACACTTGAGAAACAGTTGCATGCGCT
1548	87	22	MW2_CDS_05543	MW1027	FALSE	unmapped	GCAGGTACAGATCCGAGTGAAGGTGCTGCATTAGCAATGAGCATTTTAGATCATGTTAGA
1549	87	20	MW2_CDS_11290	MW2133	FALSE	unmapped	TGAGTGATGGAGGATTGATTGATGTGAAGAATTGTTACAATAATTTTTGGATGTCGTGTT
1550	87	18	MW2_CDS_09943	MW1866	FALSE	unmapped	AGCGGTTTAGCTCAAATTGGTCCTGTATCAAGGGTAACTGGAAGAATGGATGGTATGAAT
1551	87	16	MW2_CDS_10650	MW2011	FALSE	unmapped	TTGCAAGTGTTGGAACAGCTAATATGGACCATCGCAGTTTCACATTGAATTTCGAAGTCA
1552	87	14	MW2_CDS_09339	MW1754	FALSE	unmapped	ACATCTGTAACAGGTATTGGAATAACATTGGTTGAGGAAGTACAACAAACTGCCAAAGCA
1553	87	12	MW2_CDS_12106	MW2292	FALSE	unmapped	TTGGACTAGGACTTCTTTATACATGGATACCTTTAAAGGCTGACCATTTAGGTGGAGCCT
1554	87	10	MW2_CDS_04558	MW0842	FALSE	unmapped	AAACGACGTCAAAGTTACGGTTCAACAGGTCAATCATCGGTCAAACAACAACTTGATGTT
1555	87	8	MW2_CDS_04609	MW0850	FALSE	unmapped	GTTGGTGCAGGTATGCAACCACCTAAATTTTTACAACCAGGTGATGAAGTTAAAGTGACT
1556	87	6	MW2_CDS_13425	MW2540	FALSE	unmapped	TACAGCATCGTATAATGGAAGAAAGTGAACGTTTCAATGAATGGATTGAGCAAGGCGCAG
1557	87	4	MW2_CDS_07900	MW1488	FALSE	unmapped	TGCTAAGACGCGTAAGGAATTCGAAGTAGTGGAAATCGATTTAGATGGCACTGTTACAGA
1558	87	2	MW2_CDS_02596	MW0479	FALSE	unmapped	GGTTCGCAAGTTTATGGACATACTTATCAAGTATCCAACCAACTTACACTTGGTAAATCT
1559	87	163	MW2_CDS_00155	MW0029	FALSE	unmapped	AGGTATTACTGGACCGAATGGACTAGCACTTTCTAAAAGTATGGTTAAGCAAGTGGAAGA
1560	87	161	MW2_CDS_04583	MW0846	FALSE	unmapped	AGTTGGTCATGTCATTCCGAATAATGATATGTCACCAACCCTTAACAAAGGGGATCGTGT
1561	87	159	MW2_CDS_10479	MW1978	FALSE	unmapped	TTCGATGATAGATTAGCAAGCAAACCTGATGCCTTTGCACCTAACGCCAAAATTGTACAT
1562	87	157	MW2_CDS_11921	MW2259	FALSE	unmapped	ATCGGTGCAATCATTTGTATTGTAGGTGTTTTAGTAATGTTGCTACCCAGCAGAGCTTGA
1563	87	155	MW2_CDS_13781	MW2602	FALSE	unmapped	ACAAGCACAACAAGCAAGAGGATATGATAATTCGAAAAAGGCGAAATTTACTAGCCGTGT
1564	87	153	MW2_CDS_01081	MW0199	FALSE	unmapped	CAGAACGTCGCTTGCGTGATATTCAGTTAAAGGAAATAGAACGCCAATTCCAACCTCATT
1565	87	151	MW2_CDS_09409	MW1768	FALSE	unmapped	AGGATATAACATTGGAGGTAATTTCCAGTCAGCACCATCTATAGGTGGCAATGGCTCATT
1566	87	149	MW2_CDS_01234	MW0227	FALSE	unmapped	AGATGCATGTAAAATCATTGTCGAATCTGGACATCCAGTTAAATTGGTACGTGGAGAACT
1567	87	147	MW2_CDS_12409	MW2349	FALSE	unmapped	GTTCAACCGGATATTATGTGTTTAGGTAAGGCGATTACAGGTGGCTACTTACCACTTGCA
1568	87	145	MW2_CDS_12032	MW2279	FALSE	unmapped	ATCATAATTGTGTTAGGTGCTGGTATTTTTACCGAATTTGTCACACCAATGCTTGCAGCG
1569	87	143	agr_tiling 082_R		FALSE	unmapped	TTATGAAAAAATTACTCAACAAAGTTATTGAGCTTTTAGTTGACTTTTTCAACAGCATCG
1570	87	141	(-)3xSLv1		neg		
1571	87	139	MW2_CDS_06886	MW1285	FALSE	unmapped	GCGAAGGTACAATGATTGATATGAATGCTACTCTCGGTGGTCGTGCTACAACTGGTAAAA
1572	87	137	MW2_CDS_10889	MW2056	FALSE	unmapped	CTTTGGTGTAGCTGGTTTTGACCTACTCGTCGATGAGGATGATAACGTTTATGCGATTGA
1573	87	135	psma_tiling_082_F		FALSE	unmapped	AATGCAATGATAAGCGCAATAACAAACAGTGAAAATAGCAATTGAAAACTTAACACTGCA
1574	87	133	MW2_CDS_07496	MW1402	FALSE	unmapped	TGGGTTTAACTGCAGCACAAAGAAAAAAGATAGTTCAAGAAGAAGGTGGATTCGGTGACT
1575	87	131	MW2_CDS_12986	MW2457	FALSE	unmapped	CGAAGCATTCCGTGAATTTATTCATCAATATCCGTTAGCAGTTGTACATGTCATGCGCGA
1576	87	129	agr_tiling 141_F		FALSE	unmapped	TCAATAAATGCAACTCGAATGATAGGATCATCAATTTCACTTGATGCCTCTATTGCGTTA
1577	87	127	MW2_CDS_11388	MW2155	FALSE	unmapped	TACTCGTGTAAGAAACGCAAACATGGTGCGTCACGAGAAGTTAGAATTACCTGCATCAAA
1578	87	125	MW2_CDS_01106	MW0203	FALSE	unmapped	ACAATTCAGACCGAAAAGAAAGCATATGCAACTTCAAGAGTGAAGGGGCATATGCTTCTT
1579	87	123	MW2_CDS_11379	MW2154	FALSE	unmapped	CTTGTTGGTGTAGGTTACCGTGCTCAAATGCAAGGTAAAGACTTAATCCTTAACGTTGGT
1580	87	121	MW2_CDS_04672	MW0862	FALSE	unmapped	TGGGTTGTTGGCTGAAGATTTTTCAGAAATAGAAAATCACTATGTAGGACCTACACCACC
1581	87	119	MW2_CDS_11654	MW2208	FALSE	unmapped	AGCAACAAATCCAACTGCACTCATTGAACAAATCAATGCCGGAGCAATTGGATTAAAAGT
1582	87	117	MW2_CDS_13840	MW2612	FALSE	unmapped	ACGCCAGAAACAACATCAATTAGCGGTGAAAAAGTATGGGACGACAAAGACAATCAAGAT
1583	87	115	MW2_CDS_06277	MW1165	FALSE	unmapped	TCAACTACCGAATAAAAATTACAGCGAAGGATTTATTAGAAAATATGCAAGCGTAGTAAA
1584	87	113	MW2_CDS_11049	MW2089	FALSE	unmapped	TGAAATCTTCGGTAGTCGAGATGACTTACAAAATATAAGCGAAGTTGATGCAGAAGTAGA
1585	87	111	MW2_CDS_03138	MW0576	FALSE	unmapped	AGATGGAACATCGATTCATTACAGTACATTAGGTGAAGGCTATCCTATCGTATTGATTCA
1586	87	109	MW2_CDS_13183	MW2495	FALSE	unmapped	AGAAACCCACAAATGTTAGATAAAATGGTCGGCATTCAAATAGGTCAAACAACCGTAATT
1587	87	107	MW2_CDS_02928	MW0540	FALSE	unmapped	TGTTAGAAGTAACACTTATTGCAGGAGCCATCGCATTAGGTTTATTATTCGCCGACCAAA
1588	87	105	MW2_CDS_08250	MW1552	FALSE	unmapped	TTGAATGAGAAGTATAAGTTGTACGAACAAGGTGGCGACATTGTTAAAGGGTATGTTAAA
1589	87	103	MW2_CDS_13100	MW2480	FALSE	unmapped	AAAAAGGGCGCAGTATTTGTCAATTGTGCGAGAGGTTCTTTAGTAGATACTAAGGCGTTA
1590	87	101	agr_tiling 022_F		FALSE	unmapped	TAAACAACATCGATTTATCATTATTTGATAAATAAAATTTTTTTCATAATTAATAACATC
1591	87	99	MW2_CDS_02637	MW0487	FALSE	unmapped	CTAAATTAGATTTTTTAGCAAATGCACCACATCAGGGTGTTGCAGCGCTTATTGCACCAT
1592	87	97	MW2_CDS_06397	MW1188	FALSE	unmapped	GGCGAAGAAGCAGCTCAAAACTGTAAATTAAACTATGGTGTTACCTTCCCTATGCATCAA
1593	87	95	MW2_CDS_05698	MW1061	FALSE	unmapped	TCTATGAAGAATCTGAAGAAAGTTTCGAAGATATTGCTGAAGATTTAATAGATTTTGATT
1594	87	93	MW2_CDS_05032	MW0931	FALSE	unmapped	ACTGGAATCCTTGGGATACAGAATTATCAATCCAAGATGCAGATTCAAGCCTATTACATT
1595	87	91	MW2_CDS_05485	MW1016	FALSE	unmapped	TTCTGGAGCATTATTACAAGCAGCACTACAAAATCCTTTGGCAGAGGCGAATATCATTGG
1596	87	89	MW2_CDS_07581	MW1427	FALSE	unmapped	TGCTACCGAGTCGGATAAACGACCAGCTATAAAGCAATCTGCTGAAGATGATTTTGACAA
1597	87	87	MW2_CDS_03367	MW0618	FALSE	unmapped	AGGTCAGCATTAAAACCATTTAAAAATAAACGCGTTATGGTTACTGGACGTATACAACGT
1598	87	85	MW2_CDS_00355	MW0068	FALSE	unmapped	ACAGGTTGGTATGACGTTAAAGGAAACGCAGTTCAAAAACAATTTGTGAAAGAGCATGGT
1599	87	83	MW2_CDS_05527	MW1025	FALSE	unmapped	TCTATTGTGAGTCATTCATTGATTTTTCACATCCCATATTTATCGGCTTTCACCATTAAT
1600	87	81	MW2_CDS_11698	MW2217	FALSE	unmapped	GTGCATACGGTCACGTTGCATACGTTGAAAGTGTTAACAGCAATGGTTCAGTAAGAGTTT
1601	87	79	MW2_CDS_10162	MW1914	FALSE	unmapped	GAACGAGCAAATAATAGGAAGCATATATACTTTAGCAGGAGGTGTTGTGCTTTATTCAGT
1602	87	77	agr_tiling 103_F		FALSE	unmapped	TTATAATGTATGAAAAAATAATGATATAAACGAAATTTGCACAATATAAAATGATTTGAG
1603	87	75	MW2_CDS_01704	MW0311	FALSE	unmapped	GCAAGGTCGTGGTGCTACAATTATGGCCATTTTACAAGGTGCGATTATCATTCCTGTATT
1604	87	73	MW2_CDS_07848	MW1479	FALSE	unmapped	TAGTGGAAGAAGCACCTTCCCCAATTTTAGATGATGAAACACGTCGTGAAATGGGAAATG
1605	87	71	MW2_CDS_09076	MW1702	FALSE	unmapped	TGGTGGTGTATTAGTTGATGCGTTTAATATGCGCATGATGTTTATCGGTATGATGCTACT
1606	87	69	MW2_CDS_10172	MW1917	FALSE	unmapped	CAAATTGGAAAGAAAGCGAAAGAGAGGTACGAGGCGCAAGTTAAAAGAGGTGCAGTTATT
1607	87	67	MW2_CDS_13382	MW2533	FALSE	unmapped	GAAGGCAGTATGACGCTTGATGAAATGCGTCATCAATTGCAAATGAGCAAACCAAGTATG
1608	87	65	MW2_CDS_02473	MW0457	FALSE	unmapped	AAGTGTTATTTATCGAACCAATGACAATGATGAATTTGTCAGGAGAAGCAGTTGCACCGA
1609	87	63	MW2_CDS_10958	MW2069	FALSE	unmapped	AGATGACATCCACGTAGCAACTATGTTAAAGCAAGCCATACATCACGCGAATCATCCTAA
1610	87	61	MW2_CDS_11690	MW2215	FALSE	unmapped	AAAGTTAAGCGTTTAACTGCACACATACTAATGTTGAAAGTCATTAATGATATGTTGAAA
1611	87	59	MW2_CDS_03149	MW0578	FALSE	unmapped	CATATCCTATTTATATGATAAACAGTATGTTCAGTTTCAAGCTATTACTGGAATGAGTCT
1612	87	57	MW2_CDS_04066	MW0741	FALSE	unmapped	TGACCCAATTTTAGTGATTCAAGCAGAAAACGACAATATGATTGATCCACAATCCGCAAA
1613	87	55	MW2_CDS_00673	MW0126	FALSE	unmapped	TGAAAACAATCTGACACATTTCATCGGTTCAGATGCGCATAACACAGAAATCAGACCGTT
1614	87	53	MW2_CDS_02020	MW0373	FALSE	unmapped	TTTATGTGCAGAAAACACAAAAAGAACGTGGAGTAGGGAAATGCGTTTCTGGTATAGCGG
1615	87	51	MW2_CDS_08800	MW1653	FALSE	unmapped	AGTTACCAGCAGACTTCCAACCACAAGTTGCAACAACTCAATTACGTGAAAAATATCAAA
1616	87	49	MW2_CDS_08215	MW1545	FALSE	unmapped	TCGAGACAAAAATAGTCAAAATGTTGAAAATGCTATGATTGCAATTCAGATACCTAGGGT
1617	87	47	MW2_CDS_10525	MW1987	FALSE	unmapped	GAGATGAATTTCCTGATTTTCAAGTGGAAGAAAGAAGTGCCGTATCAATTGGACGACGCG
1618	87	45	MW2_CDS_00270	MW0051	FALSE	unmapped	AAGTGTGAAAAAATAAGTGAAAATATTTCTGAATGTCTATATGGAGGTACAACACTAAAT
1619	87	43	MW2_CDS_02273	MW0419	FALSE	unmapped	AATGAACTATTCAGCTGCACCAGGTATTTTAACTTACAGAACGGTACCAGCTTACCAAGT
1620	87	41	MW2_CDS_06796	MW1269	FALSE	unmapped	AGCTATCGTTGTCATAGGTGTTACACTAGGTCTATTTGCCGGATATAAAAAAGGGTGGAT
1621	87	39	MW2_CDS_05673	MW1054	FALSE	unmapped	TCAGCAACTGCTTTAAAGAACAGTTTGCCTGTACTTATGTTTCCAGACATTTGGAAAGGT
1622	87	37	MW2_CDS_06379	MW1184	FALSE	unmapped	AAGGCGGCGGTTACTATGTTGAATATCGTACTGACGATGCGCGTTTAACTATTGAAGTTA
1623	87	35	MW2_CDS_11642	MW2206	FALSE	unmapped	GAAGGTGCACGCGATGGTAAGACCGTTGCAGAGTTAATGAGTTATGGTAGACAAATTCTA
1624	87	33	MW2_CDS_10737	MW2028	FALSE	unmapped	CAAGTAGACGTACCTGATCAACCTTCTTTCAAATCTGTTCAAGCACTAGCTAACCATGCT
1625	87	31	MW2_CDS_04451	MW0822	FALSE	unmapped	TGCTTCATGTGGCTGTGGTAGTTCATTTAGAACTGCAAAAGTTGCAGGTAATCCTGAAAA
1626	87	29	MW2_CDS_08597	MW1619	FALSE	unmapped	TCGAAGGTGGACAAGCTGAAGGTTACGATTTAGAAATCGGTTCAGGTTCATTCATACCTG
1627	87	27	MW2_CDS_09900	MW1857	FALSE	unmapped	AGAGAGTTTCTTCTGAAAAAATGGGAAGTTACGTCATCCGTTGCAGATGGTACGATTGCT
1628	87	25	MW2_CDS_05813	MW1081	FALSE	unmapped	AGAGCACATGTCATCACTTACGACAAAAGACGCAATAGACATCGACACAGATATTACAGA
1629	87	23	MW2_CDS_05135	MW0950	FALSE	unmapped	GCAAATACAGTGATTGAAGAATATAGCTATAAAGTGTTAGATGATGAAAAGGAGAATGCA
1630	87	21	MW2_CDS_06926	MW1293	FALSE	unmapped	TGGTTTGACTAGAAAAGACTATCGCTATATTCGAAATCAGTTAAATCATACACACCAAAA
1631	87	19	MW2_CDS_09733	MW1827	FALSE	unmapped	TGAACAGTTTTTGAGAGCAACAGTAAGAAATAATATCAAGCACTACCTTTTAATGCTAGA
1632	87	17	MW2_CDS_04716	MW0871	FALSE	unmapped	TATCAGCCATTCCACAACCTGATCCTGAATCAGAACGCAGTCGCAAACGATTTAGTTATA
1633	87	15	MW2_CDS_12497	MW2365	FALSE	unmapped	TTTATCATCAACAATTGGTGAACCTAATGCCAATCCATATGCTTCGGGCTGGTTTACCAA
1634	87	13	NA		ignore		
1635	87	11	MW2_CDS_08324	MW1565	FALSE	unmapped	ATCATCCTGAATTCAAAAAAGAGTATGTTATCTTAGCTGAAGAAGGTGCTCAATCAGATG
1636	87	9	MW2_CDS_06202	MW1152	FALSE	unmapped	AAATGTTCGTATCATTCATACAGCGGTTGGTGCAATTAATGAGTCAGACGTGACACTTGC
1637	87	7	MW2_CDS_07031	MW1313	FALSE	unmapped	TGTTACACAAGAAAACGGCACTGAACCACCATTTATGAATGAATATTGGAATCATTTTGC
1638	87	5	(+)E1A_r60_a107		pos		
1639	87	3	MW2_CDS_09350	MW1757	FALSE	unmapped	GCAGCGTTTCTGCTCCTGGAAATGATGATGGAGGCCATCTAACACAATCTATAGACTTTA
1640	87	1	MW2_CDS_10895	MW2057	FALSE	unmapped	AGGATCACGTAATTTAGTAGGACATACGCATAGATTTAGAGAAGCGGCTGCGAGTGTACA
1641	86	164	agr_tiling 009_F		FALSE	unmapped	CATTCATTTGCAAAGGGCGAAATGGATTCTTACTGAGTTATCTACTATAAAAAAATAAAC
1642	86	162	NC_A_044		FALSE	unmapped	ATCATTTCGTAATATCGCTAGCTTCATCTAAAAAATTTAATGCTATGATTTAGCCGAATT
1643	86	160	MW2_CDS_07014	MW1310	FALSE	unmapped	ACGCCAGATGGTCATTATATTCACGGTAAAGGCATTAAACCAGACGTTACTATTGACACA
1644	86	158	MW2_CDS_06901	MW1287	FALSE	unmapped	ATCCGCATCGATGAATATACCTTTAAAGGTGTTGGTGCAAATTCTGAACAATTAAGTGCT
1645	86	156	MW2_CDS_06787	MW1267	FALSE	unmapped	AGACCTCATTAAAAGAAGCGTTATATTATTACAGAGGCCTAACTGATAATACTGCTCAGG
1646	86	154	MW2_CDS_12439	MW2355	FALSE	unmapped	ACTAACACAAACGCATGCTGAAATTTTAAAATTTATCATTGTTGGCGGCATTAATACGTT
1647	86	152	MW2_CDS_12776	MW2418	FALSE	unmapped	ACACAGTATTTCACTAAAAGAAATCATTGGTGACATACTTTACAAACAATCTGATGTTGT
1648	86	150	MW2_CDS_06295	MW1168	FALSE	unmapped	GGGTGGCAGCATTTATCGATGCTGAACATGCTTTAGATCCAGAATATGCTCAAGCATTAG
1649	86	148	MW2_CDS_03867	MW0707	FALSE	unmapped	TTTAACGAATTTCTTTGCAGCTGCCATTGCATGTGGCTTCTTCCTATTTATGTTTGGTGG
1650	86	146	MW2_CDS_09921	MW1860	FALSE	unmapped	CGCGTTAGATACATTTAATGTACCTGCTCCGGAATTATTAACGGATGATTTAGATGGTCA
1651	86	144	MW2_CDS_02354	MW0435	FALSE	unmapped	AAGTTAGCGAATTAATCTTAGCTATGAACCCGAACTTAGAGGGGGAATCTACAGCCATGT
1652	86	142	MW2_CDS_10269	MW1939	FALSE	unmapped	AGCCGGATCTATAATTAACCTTCAGGCTATCAATAATGCTTTGAAATCAGCCTGTAGAGT
1653	86	140	MW2_CDS_08633	MW1625	FALSE	unmapped	CATTGCAATTGGTTTATTAACGATTGTCGGAATCATGGGTGGTCATGTTGTAGGATTCGA
1654	86	138	MW2_CDS_05046	MW0934	FALSE	unmapped	TGACGAATTACAACTTGATCCTTTTAACCCAGTATTTGCGTTATGGTTTTTGATCACGCT
1655	86	136	MW2_CDS_02104	MW0388	FALSE	unmapped	TGGCGGAAATTTAGATGCATCAATTGAATCATTTTTAATTAATAAAGAAGAAGTTTCACT
1656	86	134	MW2_CDS_13414	MW2538	FALSE	unmapped	TGGGGATTCGCCATCGTTATGTTAGTAATTGCAATGTTGATGGGCATTGTGACGATTTAA
1657	86	132	MW2_CDS_09650	MW1811	FALSE	unmapped	ACCCGGCAGGTTTATATCAAACGCATAGTTTTAAAAAATTAGCACCATATATGAAATCAA
1658	86	130	MW2_CDS_11513	MW2182	FALSE	unmapped	TCAGTTAGATCGGTTTAGTTTTCCAGGAGATGTTATAAAATTACATTCAGGTGGGTATCA
1659	86	128	MW2_CDS_11930	MW2260	FALSE	unmapped	TGGCAGTTATATGCATTTTTGCCTTTGACTTAAAAGACTTGCTACAAGGTTTTAACGTGG
1660	86	126	MW2_CDS_10425	MW1969	FALSE	unmapped	GGCAAGGATGGATTGCGCTAGCATCAATGATAGTTGGTGTATGGACAATGAGTCATTTTA
1661	86	124	MW2_CDS_04248	MW0781	FALSE	unmapped	AGATATTGATATCGTTTCGCCTGCTCAAGCAGATGGTAAAGCTACTAACCCCGAACAATT
1662	86	122	agr_tiling 079_R		FALSE	unmapped	TGGGTATTATTATACAAGCTATTACATTACTACCAATATACTATTCAAAGGAGGACTAAA
1663	86	120	MW2_CDS_13080	MW2476	FALSE	unmapped	GAAATGAAGGTTTTGAAAAAGCCGGACCCATTCATATTGGCAGTAATACTTGGTTTGGCG
1664	86	118	MW2_CDS_11260	MW2127	FALSE	unmapped	TGTTGCAGGCCATTGCAGATAAATATAACAAATCAATTGCACAAGTTATTTTACGCTGGT
1665	86	116	MW2_CDS_06531	MW1218	FALSE	unmapped	ACGACAAGTAAGCCATTCTTCTTAGAATTTATGGCCAAAGACGTTTCAAAAGGTAATGCA
1666	86	114	MW2_CDS_07741	MW1460	FALSE	unmapped	CAATCATTTAAAATGATTGTCGGCTTATCTCCAGAAGCTTATGCACGCGCGCGTAAAATG
1667	86	112	MW2_CDS_12514	MW2368	FALSE	unmapped	AAGATTTTATCTCAACATGGTCCGAAGCGCCCACTATTACTAGGAAGTGGCTTTACAGTG
1668	86	110	MW2_CDS_13026	MW2465	FALSE	unmapped	TTAAACGTCGCGCACAAGTCGGTAAACCTGTTTCTAATAGATGGGGCAATGCTAAAAATT
1669	86	108	MW2_CDS_05843	MW1086	FALSE	unmapped	CGGATATCCGGTTGTAGTAAGACCTTCTTATGTATTAGGTGGTCGCGCAATGGAAATTGT
1670	86	106	MW2_CDS_09982	MW1872	FALSE	unmapped	ATTGAAACACGTAAAAGTTCATTGCGTGATACGTACTTCAATATAAATCAAAGAGGTGAT
1671	86	104	MW2_CDS_05353	MW0990	FALSE	unmapped	TGGGTTGTTGACCCAATAGACGGTACATTGAATTTTGTTCATCAACAAGAAAATTTCGCA
1672	86	102	MW2_CDS_04463	MW0824	FALSE	unmapped	CGATATTGCAGGTCCAGCAACGACTAATAAAGCTTCATATAATGGTCCAAAAGGGCCAAC
1673	86	100	MW2_CDS_09381	MW1762	FALSE	unmapped	AATCGCGTCAACAAACGGTAGAAAGTTTATTAATGGTGAAATATTAAAGCAATTTTGCGA
1674	86	98	MW2_CDS_13483	MW2551	FALSE	unmapped	AGCGACTCAGATTCAGATAGTGAGTCAGATTCAGATAGTGACTCGGACTCAGATAGCGAT
1675	86	96	MW2_CDS_10869	MW2052	FALSE	unmapped	AGCGTTAGGTGATTATGAGTACGAAGAAATTGAAAATCGTGTTGTACAATTTTACACGGA
1676	86	94	MW2_CDS_00504	MW0094	FALSE	unmapped	CGCCTCATACAATTGAAAATGCAGCGCAAATTACGGATTGGTTAAAGCAGATACAGCAAC
1677	86	92	MW2_CDS_02523	MW0467	FALSE	unmapped	ACAGCAACAGCTATGATGGGCGCAATGTTGAAAGGTGATCAAAAATTAACTGTCACTGTA
1678	86	90	MW2_CDS_11317	MW2140	FALSE	unmapped	AGATGAAGCCAAAAACTATGCCCATCGTCTGTTGATGGATTTAGGCTTTTCAAGAGATGT
1679	86	88	MW2_CDS_02212	MW0408	FALSE	unmapped	TGGGGCTTGGCTAAAAATGCATCATTTATAATTGGACGACGCCAATTAACAAAAGGCATT
1680	86	86	MW2_CDS_08279	MW1557	FALSE	unmapped	TGTGAATGTCGGTGACAAAGTTAACAAGGGAGATATTATAGGATATGTTGAAGCGATGAA
1681	86	84	agr_tiling 188_R		FALSE	unmapped	TCGAAAGAGCGAATTGTCTATTTTAAAAATAAAGAACACTGCTATGCATCGGTGAGAAAC
1682	86	82	MW2_CDS_10232	MW1932	FALSE	unmapped	ACGCAAGGGTGTGGATTATAACATGCCTACACAGTATTCAATGGAACGTGAGTTATTCGA
1683	86	80	MW2_CDS_11589	MW2196	FALSE	unmapped	GTGGAACAAGGTAGAGAAAATGAAGCGTGGTTATGGGTATTAGTGCTAGTCGCATTCTCT
1684	86	78	MW2_CDS_11429	MW2166	FALSE	unmapped	GTACAGTAGTACACAACATCGAGCTTAAACCTGGTAAAGGTGGACAAATCGCTCGTTCAG
1685	86	76	MW2_CDS_13042	MW2468	FALSE	unmapped	GCGATATTTAGAGAGGCGACACAGTGGTTAGACGCGTATTTTAAAGGTGACAATCCTGAA
1686	86	74	agr_tiling 211_R		FALSE	unmapped	CCTCTTGTAATGTTGGCAAACTATTAATAGCACCATACTTCGTTGTCACTATTGCAGCAA
1687	86	72	MW2_CDS_05089	MW0942	FALSE	unmapped	CACGCACACATGAAGGCGAATTAAATAAGCTTGGCTTTTGGATTTTCATTACAGCCGAAT
1688	86	70	MW2_CDS_08011	MW1509	FALSE	unmapped	AATCTTGGTGTAGATTTCTTGCAACAAGAAATTGAAAGAACGCAAGCTATAGGCGCTAAA
1689	86	68	psma_tiling_076_F		FALSE	unmapped	AGTAGATTCTGTACATAATGGCAGAAAATTTACTATTGCAGGTTTCAGTTTAACTAGACA
1690	86	66	MW2_CDS_08524	MW1606	FALSE	unmapped	TTGCGCATACGTTTTATGCAACTGAATTTGATTTTCCGAAAGCGTTACGCAAAGAAGAAA
1691	86	64	(+)E1A_r60_1		pos		
1692	86	62	MW2_CDS_05774	MW1074	FALSE	unmapped	GCAAATGATTTAATATCCATCCAAGGTTTTGGTAGAGCACACATTACTGACTTAGGTGGT
1693	86	60	MW2_CDS_02600	MW0480	FALSE	unmapped	TCCTAAACGACCAATTGGTAGCTTTATCTTCCTTGGACCAACTGGTGTTGGTAAAACTGA
1694	86	58	MW2_CDS_00794	MW0148	FALSE	unmapped	AGTTTGCCAGCGATTGCGATTATTTTTATCGCCGCTTTTTTCCCAATTGTGTTCAATACT
1695	86	56	MW2_CDS_10462	MW1975	FALSE	unmapped	TCGCTGCTCATTGATACATCGAATCAACCATTATCAGTAGCATTGATGCAAAACGATGAA
1696	86	54	MW2_CDS_10258	MW1937	FALSE	unmapped	TCTCTGGGTCAATGGTAAGCAAAATACTATATCTACAGACAAAGTTTCTACTCAAAAAAA
1697	86	52	MW2_CDS_04344	MW0799	FALSE	unmapped	AGTTCTTTACACTCTGCTGTTGTGGAAATCATTGTGCATAAAGATGCGCACGTTCGTTAT
1698	86	50	MW2_CDS_03686	MW0675	FALSE	unmapped	TCCGGTTTTTGGTGTGCAATATCATCCTGAATCTATTTTGAGTGAATACGGTTATCGACA
1699	86	48	MW2_CDS_06395	MW1188	FALSE	unmapped	TGGATCGCGAAGGTAACGTTGTTAAACGATTTGCACCTCAAAAAAAACCTGTTCAAATCG
1700	86	46	MW2_CDS_05894	MW1096	FALSE	unmapped	AAAGATGCGCCATCTCTTGATAAGTTGGATCCATTAATGACAGAAAAGTCGTTTACGAAT
1701	86	44	MW2_CDS_08101	MW1525	FALSE	unmapped	CGCATTATCTAGCAGGAGGAAATGTTGACAGAGTTGTTGACGCTAATATTGCTGCACAAC
1702	86	42	NA		ignore		
1703	86	40	agr_tiling 126_R		FALSE	unmapped	TCATGATTATGTCAATATCTTGACGACTCTTTCAGAATACATTCGTGAAGATGACATGAC
1704	86	38	MW2_CDS_12733	MW2409	FALSE	unmapped	TGGAATAAAAATGGTTCGTCTGTAATCATGGGATACATGATAAGAAGCCAAGAAATGCCA
1705	86	36	MW2_CDS_03174	MW0584	FALSE	unmapped	AGGGCATCAATCTGCTATTGAAACACTAAATTTTATCGGTTTAGAAAATGAGTGTGAACA
1706	86	34	MW2_CDS_06648	MW1242	FALSE	unmapped	AATTTCAACATGGTCGCTATTAGTGATGGTCGTCCAAAATTGATGGGTATTCGTCAAATT
1707	86	32	agr_tiling 184_F		FALSE	unmapped	GGCGATTGACGACAAAGCTATTATGACATCTAAAGAAACGATCATCTAATTGACTCAGTT
1708	86	30	MW2_CDS_08861	MW1664	FALSE	unmapped	TGTGCACCATCCTCAAATTCAAATTCCAAGTGATCAAATAGCACAATTAGAAAAGCGATT
1709	86	28	MW2_CDS_04107	MW0751	FALSE	unmapped	AGTTTGATGAACGTTTTAAATTGAGTGTGTTAGAGGGCAAGACAGCAGTAATTGGCGACG
1710	86	26	MW2_CDS_11010	MW2082	FALSE	unmapped	CACCGCTTGGTGCAGATCAAGCTGCAAAAGCTGGTCAATCAATTTTATACACAATTGAAT
1711	86	24	MW2_CDS_13783	MW2602	FALSE	unmapped	GCTGCAAGTTTAAATCAGCTAGGTGTGAATTATAAAATCAGTTACGCAGTCTCACTAGCA
1712	86	22	ETG04_27747		pos		
1713	86	20	MW2_CDS_12295	MW2327	FALSE	unmapped	TTTTCAAGAACGATAGAAGCACCGATTGAAAAGGTGTTTGATGCCTATACGACAAAAGCA
1714	86	18	MW2_CDS_02821	MW0519	FALSE	unmapped	CGATTAATAGCATAGAATCTGCACAACAGTACAATGCAACTACTATCAGTACAAAGTGGC
1715	86	16	MW2_CDS_10592	MW2000	FALSE	unmapped	GCACAAGCGAATATAGGATTAGCTATGAACTCAGGGACAATTAGTGCTAAAGAGGCAGCT
1716	86	14	MW2_CDS_06022	MW1120	FALSE	unmapped	GATTATCCAGTCAATGACGCCGGCTGAAAGAAACAATCCAGACACATTGAATGTATCACG
1717	86	12	psma_tiling_036_R		FALSE	unmapped	TTTGCGAAAATGTCGATAATTGCTTTGATGATTTTAATGATAGTACCTACAATAGCCATC
1718	86	10	MW2_CDS_03649	MW0668	FALSE	unmapped	TGACCCACTTACTGATCGTGGATGATGAACAAGACATTGTAGACATTTGTCAAACCTATT
1719	86	8	MW2_CDS_11770	MW2231	FALSE	unmapped	GCAACATATTTTCCGGAACACCAACTATTAGCGGAAGAAAAAAGTAATGCAATGATTACG
1720	86	6	MW2_CDS_06711	MW1254	FALSE	unmapped	AGATCAAATTGTAACAACTAATCCTATTGCAGGTACGATTCAACGTGGTGAGACGACACA
1721	86	4	MW2_CDS_02452	MW0454	FALSE	unmapped	CCAGACGTTACAATTGGTAGTGATACAGTCATTGAACCAGGCGTACGAATTAATGGTCGT
1722	86	2	MW2_CDS_07076	MW1321	FALSE	unmapped	AGTTCTGATAAAACGTTTTTCATCCGTGCATATGGTAGTACATTTTTAAGCTCAATAATT
1723	86	163	MW2_CDS_10801	MW2040	FALSE	unmapped	TGGCCGTATCGATGGTATTGTTCAAGCTGAACAAAGTGAAGAAGGATTAGAAAGTACGGT
1724	86	161	MW2_CDS_06909	MW1289	FALSE	unmapped	ACAATGTACATTTAATGACTTTGCCAAAGTTTAATAATTATATTAAAGCAGAGATGATGG
1725	86	159	agr_tiling 144_F		FALSE	unmapped	ATACGTGGTATATCATCTGCACATTTATTCATAACAATAAACGTTACTGAATTTTCGCTT
1726	86	157	MW2_CDS_07843	MW1478	FALSE	unmapped	AAAAAGTTAGTCGTAAAAATTTAAGCCGTGATTTAAAAATCGAGAGTAAAGAAGATGGCA
1727	86	155	MW2_CDS_00192	MW0036	FALSE	unmapped	AGAAGATGAGAATATACTCTCAATCACACATGAACAAGAACAACCCACATACAAATTGGA
1728	86	153	NC_A_018		FALSE	unmapped	TTTTTATACAACTTCACTTCCCTCTTATTAAAAAAGAACATAAAAAAACGTCGTGTCTGA
1729	86	151	MW2_CDS_00301	MW0058	FALSE	unmapped	ATGCCATTTTTACGCATCCAAACACTCCTATAAAGTGTGGAGGTGCGCCTATGAAAATTA
1730	86	149	MW2_CDS_11472	MW2174	FALSE	unmapped	AGTCATAGGCCCTTTCGTGGCTGACAATTATGTATTATCTGTCGATACGTTTGAAACGCT
1731	86	147	MW2_CDS_05669	MW1053	FALSE	unmapped	ATGACACATTTGACAAAGGTTTTAGATACACTAACTGGAATATGCGTAGTATTATTATTT
1732	86	145	MW2_CDS_11308	MW2138	FALSE	unmapped	AATTCAACAAAATGGTCGAACGGTACAGCAACAATTTGAAAAGCTATTACAACGCATGCA
1733	86	143	MW2_CDS_01040	MW0192	FALSE	unmapped	TGTGGACATTTGGCATTTCCCTTAATCCAGGTACGAACTTGTATGGTGCCAAAATGATAC
1734	86	141	MW2_CDS_13911	MW2627	FALSE	unmapped	ATCCATTCAAATTGAACGTATCGTTCCCAACCGTTATCAACCAAGACAGGTGTTTGAACC
1735	86	139	MW2_CDS_05905	MW1098	FALSE	unmapped	AAGTTGAACTAACTGCACATGAAGATGTAGCAAGAATGATTTTGCATATTATAGATCAAA
1736	86	137	(+)eQC-41		pos		
1737	86	135	MW2_CDS_09275	MW1740	FALSE	unmapped	GACAATGCAGAGCATACGCTCTTTACACCTTATATGATGGAAACACTCTCTTCCCTAGGC
1738	86	133	MW2_CDS_01557	MW0285	FALSE	unmapped	TGTTCGGTGTTGAAAAGTCATCATTTTTAGTTCCGAGTTTAATAGAAGGACATAAAGCGA
1739	86	131	MW2_CDS_04105	MW0751	FALSE	unmapped	AAACAGGCGGGACTTTAAGAAGGTTATTGATAGTACCGTTTAATGCCAATTTTAATGGCA
1740	86	129	MW2_CDS_00982	MW0182	FALSE	unmapped	ATGCGCAGCGATTATGTTTTAACTGCTTATGCAAAAGGATTATCGACGACACAAGTTGTT
1741	86	127	MW2_CDS_11595	MW2197	FALSE	unmapped	ATGATAAATTAGCATTAGGTGAAGTGAAAACTGTACCAGCAGGAAAATATGCGAAACAGT
1742	86	125	NA		ignore		
1743	86	123	perR_tiling_108_F		FALSE	unmapped	AATTATTATAATGAAGAAAAAGGTGATTATATGTTGCAAAAAGGAGAACAATTTCCAATA
1744	86	121	MW2_CDS_09515	MW1787	FALSE	unmapped	AAACCAAACAATAGCATCTTTATTGCCAAATCAACTTGTAACATTTTTAGATCAGCATGT
1745	86	119	MW2_CDS_10274	MW1940	FALSE	unmapped	TAAGAACGTTCACGTTATCGGTACACATACACAATCTGAAGATTCACGTTGTGGTGCTGG
1746	86	117	MW2_CDS_00746	MW0138	FALSE	unmapped	ACATGTTGAATTAGATTTTGTGGAACATGATATGTCACATGCTGTCAAAGACGCATCGCT
1747	86	115	MW2_CDS_01663	MW0303	FALSE	unmapped	ATACAAGGGGAGTATATACTGCAACAGTGTAGTCAGCATTGTCATGCTCAAACGTATCGC
1748	86	113	pMW2_080		FALSE	unmapped	TGACGATAGATAACAATGATGAACAGTTCTTTAAGAAGAAATATCAAGCACAAGAACGAG
1749	86	111	MW2_CDS_05687	MW1059	FALSE	unmapped	ACGCTTCAGAATTGATTGATTTTGCAAAGAGTTTCAATATGCCAATTAAAGCCATTGGCA
1750	86	109	MW2_CDS_10963	MW2070	FALSE	unmapped	TTAATTTGGGCATTTGGATGGACAATCGCCGATCCTATCGCAAGTATTTTAGTTTCCGTT
1751	86	107	MW2_CDS_11155	MW2107	FALSE	unmapped	ATGCCGGTTTATCTTTCAGAACATTAGTTCCTAAATACCCAGCTATGTCGCCACACATCA
1752	86	105	MW2_CDS_01039	MW0192	FALSE	unmapped	CACAGTGTTTGCAGCAGGGGCAATTATGATTGCAGTACCTATAGCAATCGTATTCTTGTT
1753	86	103	MW2_CDS_07714	MW1455	FALSE	unmapped	TGTTGCAAGGAAATGTGCTGGGTGTACAAATAATAACTAATAATGATGAATCAACATGCG
1754	86	101	MW2_CDS_02377	MW0439	FALSE	unmapped	AGTTGAACAAGACATGTCTAAGCCAGTAGCTGAAATGATTAGTACTTATACTACGCAAAT
1755	86	99	MW2_CDS_10652	MW2011	FALSE	unmapped	ACCTGATCAAGCCTTTTTAGATTCTATTAAAATTGCGGCATTAGGTGGTGTTGATGTCAA
1756	86	97	MW2_CDS_09096	MW1706	FALSE	unmapped	AATGAGACGATGAAAGATACGATGGCTCATATTCATGACATTCAACCAATGCCAACGCTA
1757	86	95	MW2_CDS_13742	MW2595	FALSE	unmapped	AGTGGGCGCCCATACCTATCATTCAATGCATCATTAAGTAAAGAAAAAGTTGGTACGTTT
1758	86	93	MW2_CDS_03447	MW0632	FALSE	unmapped	AAATCCGGATGGGGAATATACGACTGCAACATTGGGTACTGATATCCAAAATGGAGATGT
1759	86	91	MW2_CDS_04443	MW0820	FALSE	unmapped	CCGAAGTTCAAGGTGATCAAATTGCCGATGTGCTTAAAAAGCAATGGCTAAATGAACCAT
1760	86	89	MW2_CDS_04028	MW0734	FALSE	unmapped	CTACAATTCACGCTTACACAGGTGATCAAAATACACAAGACGCACCTCACAGAAAAGGTG
1761	86	87	agr_tiling 069_R		FALSE	unmapped	TCATATTAATGAAACACTAATGATGTTTTTAGCATTAATAAGTGTTGGAGTAGTGATTAA
1762	86	85	MW2_CDS_04630	MW0854	FALSE	unmapped	ATTGATCAAGTTAAAACAGTATTAGCAGAGATTCCTGAAATACAGGATACTGAAGTGAAT
1763	86	83	MW2_CDS_10551	MW1991	FALSE	unmapped	ACGGATGGTGTGACTGAAGCTAGAAATAGTGAAGGTACCTTTATAGATAAACAAAAACTT
1764	86	81	MW2_CDS_04619	MW0852	FALSE	unmapped	AAGAGCAGCTGCAGTAGGAAAAGAAGGTGCAGATAAACGTATTGATGTACTATCGATGGC
1765	86	79	MW2_CDS_10692	MW2020	FALSE	unmapped	CACAAGAAGTTGAAGCACCACAAAATGCTCAAACTCAACAACCACAAGCATCAACATCAA
1766	86	77	MW2_CDS_10294	MW1943	FALSE	unmapped	AGAGGATGCAAATTATGCATCTGGTCTTACAGCTGTATGTTCGATTATAAATGGCGGCAA
1767	86	75	MW2_CDS_10697	MW2020	FALSE	unmapped	GTGAATCAGGTGGCAATATTCATGCTGTAAATCCAACATCAGGTGCAGCTGGTAAGTATC
1768	86	73	MW2_CDS_04539	MW0838	FALSE	unmapped	TGGATACAGATTATCTCCAGAGGAAGCGGAGTCTCCAGGAATCACAATGGAAATTACAGA
1769	86	71	MW2_CDS_13130	MW2485	FALSE	unmapped	GCGCGTGAAGAAGGTGTCACAATTCATACAGGTGCACGTGTGGACAATATTAAAACATAT
1770	86	69	MW2_CDS_07433	MW1389	FALSE	unmapped	TCAATTTACTATTTGGAACGGTTCTACTGATACGATAAATCCACGATTCAAGCACGATTT
1771	86	67	NA		ignore		
1772	86	65	MW2_CDS_03673	MW0673	FALSE	unmapped	ACTGTTAAATAACTTACCTGCTTTTAAAAACAAAATCCCTTCAACTGAAATCGTAGCGGA
1773	86	63	MW2_CDS_12542	MW2373	FALSE	unmapped	TGCAAGCAGCTCGTCAGTTACGATTTGAAAATTTAACAGAGATTCAAGCACGTAGCGAAG
1774	86	61	MW2_CDS_06366	MW1182	FALSE	unmapped	CCTTTAATTGTCGGAGCATTAATTGTTGCAATCGGATTAAGTTTAGGCGGTGCTACTGGT
1775	86	59	MW2_CDS_13451	MW2544	FALSE	unmapped	TCCATTATGAACCTTGTCATCACGAAGTATTAACTGACGTTAGATGGACCTCTTTACTGA
1776	86	57	NC_S_093		FALSE	unmapped	CATCTGAGTTGTTCGTAAGTTTGCTTTTTAATTTGGGCCTAACACTCTTTGATCAAGGGA
1777	86	55	(+)E1A_r60_3		pos		
1778	86	53	MW2_CDS_01388	MW0254	FALSE	unmapped	TTGTGTCGCTTACTAAACAAGCACAACAATCTATTTCAATTAGCTTAATCTTTGCTGTGA
1779	86	51	MW2_CDS_10088	MW1897	FALSE	unmapped	ACCAGTATAGAACTTCAAAAAGGATTACCAAATGGTCAAGAAGGTATTGAAAAGATTGGA
1780	86	49	MW2_CDS_03658	MW0670	FALSE	unmapped	GATCAAGGTAACAAAACTGAACAAAAAACAAAGTCAGAAGATAGCAATGTTAAAACTGAT
1781	86	47	MW2_CDS_08309	MW1562	FALSE	unmapped	ATCGAATCAATTCCTCAAATGATGGATATTGGTGTGGACTCATTAAAAATTGAAGGACGT
1782	86	45	MW2_CDS_08600	MW1619	FALSE	unmapped	AGACGAGTACAAAGAAAACTTACGTAAACGTTTAGCTGAACAAAAAGCTACAGATGCTGA
1783	86	43	MW2_CDS_04418	MW0814	FALSE	unmapped	ACATATCACACTGGTGATAAAGCGAAGTTTGAAAATGGTCAATGGTTCATTCAAGGTCGT
1784	86	41	MW2_CDS_12937	MW2448	FALSE	unmapped	ATCGCTGGTGTGGTACTTATCCTAGTGGCAGCATATTTGTTTGCTAAACCACATATCGAT
1785	86	39	MW2_CDS_09360	MW1758	FALSE	unmapped	TGTGGCATTCACATGATATGAAAATAACACTTATGTTTATAGGCGTATCATTGTTTTTCA
1786	86	37	NC_A_102		FALSE	unmapped	TGTGATATCGGAACCTCGGATTCCATATCATGTTAGAAGCTTTTAATGTCTAAAGAACAT
1787	86	35	perR_tiling_022_F		FALSE	unmapped	TGTTGCGACAATATATAATAACTTAAGAGTGTTTAAAGATATTGGAATTGTAAAAGAATT
1788	86	33	MW2_CDS_00431	MW0081	FALSE	unmapped	ACGACAAGTCAAAAAATTGCCCGAGAAATATTAATTCACCGACATGGCAAAGCAGAGTCA
1789	86	31	MW2_CDS_06341	MW1177	FALSE	unmapped	AAATCAAGAAAACTGGCTATAACTGCACTTTTAATTGCAATAAATGTTGTATTAAGCAGT
1790	86	29	MW2_CDS_10836	MW2046	FALSE	unmapped	ACGCATGATGTCATTTACAGGATCAGGCCCTACTGGTTCTAAAATTATGGAAAAAGCTGC
1791	86	27	MW2_CDS_08644	MW1627	FALSE	unmapped	AAGCAAACATTTTAATGCTTGATGATATTGGGGCTGAAGAAGTGACTCCATGGGTGAGAG
1792	86	25	MW2_CDS_03502	MW0642	FALSE	unmapped	AGGTATCCATGAAAAGCCTATTGCCATTTATAATATTAATGGCTTTTTCAATCCACTACA
1793	86	23	MW2_CDS_01999	MW0368	FALSE	unmapped	AGCATAAAACTTCCAGAAAAGTTATTGTGTGCATGGTTGAATAGTATCAGGTTTTTGAGA
1794	86	21	MW2_CDS_05867	MW1091	FALSE	unmapped	AGCGCAGATTCAATTACAACATTATGTATCAACTGATGGCGACGATATATATGTTGGCAA
1795	86	19	MW2_CDS_00208	MW0039	FALSE	unmapped	ACATGAATGCTTCACGCTTTGTCTGTGATTTTAAAGGCATCAATGCACAAACACTTGAAG
1796	86	17	MW2_CDS_09802	MW1840	FALSE	unmapped	TGAGCAGTAAAATTGCGAAGAAAGTCTTCCCAGAGTTAGCAGCTAAAGGTGGTAATGCTA
1797	86	15	perR_tiling_036_F		FALSE	unmapped	AAATGAAATCATCATGTAAATATTGACACGCGCGCAATACTACAGTTATATTTATAGTAA
1798	86	13	MW2_CDS_04728	MW0873	FALSE	unmapped	AATGCATCAAAAGATATGGAAGTGTACTTCAGATCATGGGCAGGTGGTACAGATCCAGAC
1799	86	11	MW2_CDS_11233	MW2121	FALSE	unmapped	TGGCGATTATTATTGGTTCAGATGAAGCTGGCAAACGATTAAAAGAAGTCATCAAATCAT
1800	86	9	psma_tiling_027_F		FALSE	unmapped	GGTCTTGGTTTTTTGTATAGGATGTTCTTGGTGGGACGTACGGAATATTCGTGATCTTTG
1801	86	7	psma_tiling_075_R		FALSE	unmapped	ATCAACGTACCGTGATGCAGTGTCTAGTTAAACTGAAACCTGCAATAGTAAATTTTCTGC
1802	86	5	agr_tiling 029_R		FALSE	unmapped	CTACTAGCAAATGTTACTCACTTGCTAATTTTACATGGTTATTAAGTTGGGATGGCTTAA
1803	86	3	MW2_CDS_09930	MW1862	FALSE	unmapped	CGAGCGTCATTTAACAATTCCTGAAAACTTTGATGGAGATACTAAACTTGCAGCAGTGCG
1804	86	1	perR_tiling_024_R		FALSE	unmapped	TATTATATATTGTCGCAACACTTATATTTGGAAAATCAGGTGAAAGTGCTTGATAAATTT
1805	85	164	NA		ignore		
1806	85	162	MW2_CDS_11164	MW2109	FALSE	unmapped	TGGCTAACAATCATAACCAAAACGGACAAGACTCTACACAACAAGTGATTAATTTTTTAA
1807	85	160	MW2_CDS_06161	MW1144	FALSE	unmapped	TGGTCTTATCATCATTATGTTGCCACAACATGCAGGGCCATGGGTACAAGTAATTCAATT
1808	85	158	MW2_CDS_07574	MW1425	FALSE	unmapped	AGCCTGTCGATTGGGCAAAAGGATTGAATTTGAATAGTGACGGATTTACTTCTCCGTTTT
1809	85	156	MW2_CDS_05278	MW0977	FALSE	unmapped	CAATCTCCAGGTCTAAAGGTTGTTATTCCTTCAGGCCCATACGATGCGAAAGGTTTATTA
1810	85	154	MW2_CDS_11843	MW2246	FALSE	unmapped	TCGGCCAGAACGAATAAAGAGATTGAAGCGGACGTTAAAGAAGGCGGTAAATATCGTATT
1811	85	152	pMW2_090		FALSE	unmapped	TGATGATGTAATAGAAAGATTCGTTTTATTCAATCATTATAGAATCCATAAGCGAGAACA
1812	85	150	MW2_CDS_00153	MW0029	FALSE	unmapped	TGCTTCTGCAGGATCTTGGTTTGGTGAAAAATTCAAAGATGAACATTTGCCAACTTTCGA
1813	85	148	MW2_CDS_13328	MW2522	FALSE	unmapped	TGTTAGTTGGTATGTTCCATTACTCACAATACGCAAACAATGCTGAACCTGTTGGTTGGG
1814	85	146	MW2_CDS_05247	MW0972	FALSE	unmapped	CTTTAACACACGATTCAGCACGTAAAGCTGGTCGCATTCCATCTGGTAATGTACTTGTTG
1815	85	144	MW2_CDS_08593	MW1618	FALSE	unmapped	GGTGAAGGTGTTCAACAAGCATTGCTTAAAATCTTAGAAGGTACGACTGCAAGTGTTCCG
1816	85	142	MW2_CDS_02489	MW0460	FALSE	unmapped	TGAGAAGACGAAGGATAAGTCATTTGATGAGGCCTCGTTAAAGCAGTGGCTAGAAAAAGG
1817	85	140	MW2_CDS_06964	MW1301	FALSE	unmapped	AACTTCTTGAAAACTCAATTCGTTTCGGCGATGCAGATATAAGCCCAGGAACAAGACTTC
1818	85	138	MW2_CDS_10064	MW1892	FALSE	unmapped	ACAAGCCAATCCACAATATACAATTCACTATTTATCGCAAGAAATCACAAGACTAACACA
1819	85	136	NC_A_111		FALSE	unmapped	AAAAACAAAAAGCCTACAACCACATGGGTTGCAGGCTTTATAATGGAGACGGCGGGATTT
1820	85	134	MW2_CDS_11894	MW2254	FALSE	unmapped	GGGTAAGTGCGCCTGCAGTGTTAGGTTTGTATCCACATACTGTTCTTGAATTAGCAAAAC
1821	85	132	MW2_CDS_07259	MW1356	FALSE	unmapped	AGCAAGTATCGTCTGCGAACATGTCGTAGCATTTGAAATTGCGAAAGCATTATTGGAAGA
1822	85	130	MW2_CDS_06373	MW1183	FALSE	unmapped	ACGTGTCGATGGTGGTGCAGTTAAAAACAACTTTATTATGCAGTTCCAAGCAGACATTGT
1823	85	128	MW2_CDS_11421	MW2164	FALSE	unmapped	GTGCAAGTGCGATTAACAAACGTACAAGCCACATTACAATCGTCGTAAGTGACGGTAAAG
1824	85	126	MW2_CDS_05295	MW0981	FALSE	unmapped	GCTGAACGTACAGACTTATCGAAAGGCTACATTTCACAAATAGAAAGTGAACATGCCTCA
1825	85	124	MW2_CDS_05789	MW1076	FALSE	unmapped	GCGAAAAATATATTATTGCAGAAGCCTTATCTGACGCTGTAGCAGAAGCACTGGATTGGG
1826	85	122	MW2_CDS_01919	MW0352	FALSE	unmapped	TGAAAGTTCGAATTACTTTTATTATTTTAGCAATTTTATCGACGATTGTTTGCTTGTTCT
1827	85	120	MW2_CDS_06382	MW1185	FALSE	unmapped	CGGACATTCAATGGGATCCGTTATAGCTAGATTGTTTGTAGAAACATATCCGCAATATGT
1828	85	118	MW2_CDS_05370	MW0995	FALSE	unmapped	GGTTTAGTTGACCGCGAAGATGGCAAACAAATTATGTTACGTCTTGAGAAAGAACTTTCA
1829	85	116	MW2_CDS_06484	MW1209	FALSE	unmapped	AGCAGATACTGATAATGGTCTCGATGCAATGAAACTTATTGAAGAATATAATCCTAACGT
1830	85	114	MW2_CDS_06983	MW1304	FALSE	unmapped	TGAGCCAAATTGAAGAATCATTTAATCAACAAAGACAATTTGTTGAAGATGCGTCACATG
1831	85	112	MW2_CDS_04588	MW0847	FALSE	unmapped	ATCGTGAAGTAAGTAAAGATAGCCGTGCGTTTGGCCTCATTGATGAAGACCAAATTGTTG
1832	85	110	MW2_CDS_12665	MW2395	FALSE	unmapped	TTATTGGACTTTGATTTTGAACATGAAGTATTTGATGAATTGTATCTTGCGATTTTAAAA
1833	85	108	MW2_CDS_03074	MW0565	FALSE	unmapped	ACGCTCTTATGAGCCAGAAATGTATGGCGAAAAGTTAGACTTAGCACTTATGTACAAAGC
1834	85	106	MW2_CDS_03719	MW0681	FALSE	unmapped	CACTACCAGCAATTTTAGATCAAAAGCAAGGCTACAAATCTGATGTCATGCACGGTGACT
1835	85	104	MW2_CDS_07244	MW1353	FALSE	unmapped	ACGTGCTACCTCTGAATACGAAACCGTTTTAGAAACTGGTGAATATCAAGTTAATGGTGT
1836	85	102	MW2_CDS_05963	MW1109	FALSE	unmapped	GCTGTTCGTGATACGAAAATTGATGGCGTTGAGATTAAAAAAGACGCGTTTATGGGCTTG
1837	85	100	MW2_CDS_11925	MW2260	FALSE	unmapped	TATATTCCGTTTTTAGCGCCATTTCAATTAGTTGTACGCGCTCAAACTTCAGGGCTTCAA
1838	85	98	MW2_CDS_02790	MW0514	FALSE	unmapped	TGACTTATCAATGTTAGAGAAAGTTGGCTATCCAGTTGCGATGGAAAATGGTGCAGAAGA
1839	85	96	MW2_CDS_08604	MW1620	FALSE	unmapped	ACGATTGACTCAGTCATTAACTGATTTTGATACGTTATCAATGAGGGAACAGACGCACTT
1840	85	94	MW2_CDS_05656	MW1051	FALSE	unmapped	GCTGGAAGAGGATATAGGCGCGTTGTTCCTTCACCACAACCCATCTCTATTATTGAATTA
1841	85	92	MW2_CDS_08866	MW1665	FALSE	unmapped	AGCTTTTGTAGCTTATAGCCACCGTGCAAAAGAACGTTTCAAAGAAGTAACTACGCCAAA
1842	85	90	NC_A_081		FALSE	unmapped	TTGCGTTGGACAAAATACTCTAAGACATATTTACATCCTAACATTTCAATAGCAAGAGAA
1843	85	88	MW2_CDS_10096	MW1899	FALSE	unmapped	AACCGTTATACGAGAGTGACGTCATGTCATTCAGACATATTATAAGAGCAAAAGGCTCGA
1844	85	86	MW2_CDS_03018	MW0555	FALSE	unmapped	ACTTGGATTGCTTATTTTTTGCCCATGATTAATTGGTTTATTCCCAAAAAGTACGCGAAA
1845	85	84	MW2_CDS_06184	MW1148	FALSE	unmapped	ACCAATTGAAGGTGAAAAGGAATGGTTAGGCATTTTACAAGAAGTCAATAATGAAACAAT
1846	85	82	MW2_CDS_06911	MW1289	FALSE	unmapped	TCTTATCCTTAGTTTAGTTGCTAATTTATTAGTTTTCGGTGTATTATCTGCAATTGGATT
1847	85	80	MW2_CDS_02552	MW0472	FALSE	unmapped	AGCCAACGTTTATCTATGGTCATCCGACTGAAATTTCACCTTTAGCGAAGAAAAATCCTG
1848	85	78	MW2_CDS_04675	MW0862	FALSE	unmapped	ACAGTTTATGCGTTAGATCATTCTTTAAATTTGAAGAATGGGTTCTACTTGAATGAATTT
1849	85	76	MW2_CDS_05583	MW1034	FALSE	unmapped	ACCACGTAATAGGTATTTCAGAACTAATACCAGATTTTGATGTGGAAGAAACAGGATCAA
1850	85	74	MW2_CDS_01196	MW0220	FALSE	unmapped	AGCGATGAGTATGTTGATATTACAAGAACCAATATACATGTCAGATGGCACAGCAATCCA
1851	85	72	MW2_CDS_04375	MW0806	FALSE	unmapped	TAGCTCAAAGTGTTTGTGAGTATACACATGCACAATGTGCCATCATCAATGCTGGCTTAC
1852	85	70	MW2_CDS_05386	MW0998	FALSE	unmapped	AATGGCAATCATCATTTATTGTGGTGTTTATACTGGTGCACTAGTGAGACATGCGGATGC
1853	85	68	MW2_CDS_11178	MW2112	FALSE	unmapped	CGGGTGACGTTGTATTTTATGCTGGATCGCCAAATAGACAAGGATCAAATGCGACATATC
1854	85	66	MW2_CDS_13170	MW2492	FALSE	unmapped	GATGCTGCAAAGTCTTGCGAATTAAATAGTGAAGCATTTTGCAACAAAGCACATCAACGT
1855	85	64	MW2_CDS_00176	MW0033	FALSE	unmapped	TGTTGATTGGTCTAAACGAGACAGTGCTAAAGCTAAAATGAGAGTTCAAGTTAGACGCCT
1856	85	62	MW2_CDS_05685	MW1058	FALSE	unmapped	TCCGGAATTTTTTAATTATGTTTTTAATGATATTGGTGAGGATGAAAGACAGCACTCGAT
1857	85	60	MW2_CDS_08399	MW1581	FALSE	unmapped	CCGATGCGAATTTTGGATTGTAAAGTTGACCGTGATAAAGAAGCGATTAAGACTGCACCT
1858	85	58	MW2_CDS_08365	MW1573	FALSE	unmapped	CCGTTCAACCGCCAACACATGAACTACAAAATATATTAACGCCGAGAGAATATGCGATGG
1859	85	56	MW2_CDS_06641	MW1241	FALSE	unmapped	AAAGGCTTCACGTTACAACGTTACAAAGGTTTGGGTGAGATGAACCCTGAACAATTATGG
1860	85	54	MW2_CDS_03012	MW0554	FALSE	unmapped	TGCTTTGTGAAACCGAAATTATCAATAAAAATCCGAAATACAGAGTTATTAAGTATGATG
1861	85	52	MW2_CDS_12333	MW2335	FALSE	unmapped	TATGTGTTAGTTGCGCTAATGTACTGGGTGGTATGCTTTATTATTTCAATTATCCAAGGT
1862	85	50	MW2_CDS_10320	MW1948	FALSE	unmapped	AGGGCTATTAGCGATTGGGAGCAAGAACAAAGAAATAATGTTAAAGATCTGATGATGCTA
1863	85	48	MW2_CDS_03972	MW0725	FALSE	unmapped	TCAAGGTTTAACGCTCAATAAATTAGACTTCATTCATCGCGGCTTGTTAACGCTTTACCA
1864	85	46	MW2_CDS_05367	MW0994	FALSE	unmapped	AGGAGCCGTAAAGTTTCCTATAACATTAGATAGTACGACTTGGATTTTCGATGATAGAAA
1865	85	44	MW2_CDS_04996	MW0925	FALSE	unmapped	CTATATACAGGTGGTCCTTTCCCTATTTCATGGACGCCTTTCGGTGAATTATTCTCAGGC
1866	85	42	MW2_CDS_08543	MW1609	FALSE	unmapped	AGCACTAACACAAATGCTGGTCATGGCTGAACAAGACAAACGTGCTAATTTGTTAGTTGT
1867	85	40	MW2_CDS_03584	MW0657	FALSE	unmapped	TTTCGATTGCTATTACGGGTGGCGGTATATTTGGGGCACTTTTCCAAATCTATTTCTTCG
1868	85	38	MW2_CDS_12164	MW2302	FALSE	unmapped	AGCTTTTTCAGTTCAAAAGAAGATCCAGAACTTTGTGTTTTAAAGGTGACACCACAATCT
1869	85	36	MW2_CDS_01875	MW0343	FALSE	unmapped	TCAACGTATGTTGACTACAGCTATCAAACGTTCTCGTCATATGGCATTATTACCATATGT
1870	85	34	MW2_CDS_13151	MW2489	FALSE	unmapped	TGGCTTCCGTGAAATTAAGCGAGGAGATTTACCAAGTAGTTTTCCTAAATTAGATGTAGA
1871	85	32	MW2_CDS_05834	MW1085	FALSE	unmapped	ATTATCTCAAGGAGCAAGCTCATTTAAAATGAAGTTTGGTCATCGTGGTGCGAACCATCC
1872	85	30	RC11		pos		
1873	85	28	MW2_CDS_00801	MW0149	FALSE	unmapped	GGTTCAAGAGCGTACACACCATATTCGCCACAAGTTCGCAAGTTAAAAGAAGGATTCTTC
1874	85	26	MW2_CDS_13304	MW2518	FALSE	unmapped	AAGCTTTATCAGGAGACGAATGCAAATGCAATTAAAGCAGAAGGAGCGCATATTACACCA
1875	85	24	MW2_CDS_04295	MW0790	FALSE	unmapped	GGTAGAGAAAAGGCTTATCCATCAGAGTTATCAGGTGGACAAAAGCAACGTGTTGGGATT
1876	85	22	MW2_CDS_10884	MW2055	FALSE	unmapped	AAGGTTCTGTTTTCGGAGAATGGCTAGATGAACTTAGAGATGATCATAAAGCCGTTGCGA
1877	85	20	MW2_CDS_02077	MW0384	FALSE	unmapped	ACACGAAACCGAGTTTTGAATTTGAAAAGCAGTTTGGATTTTTGCTCAAACCATGGACGA
1878	85	18	MW2_CDS_13932	MW2630	FALSE	unmapped	AGCGATTGTAACTGAGGTAGCAGGTACTACAAGAGATGTCTTAGAAGAGTACGTCAATGT
1879	85	16	MW2_CDS_08507	MW1602	FALSE	unmapped	AGGTTTAATTTGGTTGCTCGATTTTTTTCAAATAAATAGTGGGTTTTTACCGCACTTTCA
1880	85	14	NC_S_097		FALSE	unmapped	TCTACTTTATAAAGATTGAATGGACATTCGAGCGTTAATCAGTCAGGAGGGAATTTCACT
1881	85	12	MW2_CDS_00305	MW0058	FALSE	unmapped	AAAAGCTACTCTAATGTATTTGCACTTGGTGATGCTTCAAATGTACCTACTTCAAAAACA
1882	85	10	MW2_CDS_11926	MW2260	FALSE	unmapped	CACCAATCCAACATATTTTTGCTAAAATTTTAGGCGTTATAGCAGTTGCCGTGACTCAGA
1883	85	8	MW2_CDS_02915	MW0537	FALSE	unmapped	TGCCATACATATATTAACATCTTTATATGCTTCAACATCAAATACACCACATATTGGTGA
1884	85	6	MW2_CDS_08252	MW1552	FALSE	unmapped	TGGATTGACGGACATCAAGCAGAAATAGAATTAACAGCAGTAAAAACGAAAAAGAAAATT
1885	85	4	MW2_CDS_02209	MW0408	FALSE	unmapped	AGGTGTCTAATCATTGGCTGCGTTTAATGAGCGTTAATGAGGAAGGGCGTTTTAAAAGTT
1886	85	2	NC_A_034		FALSE	unmapped	ATTAGCAGTATAATTAAGACAACGAAAATAAGTATTTACTTATACACCAATCCCCTCACT
1887	85	163	MW2_CDS_06234	MW1158	FALSE	unmapped	AATTATAGCTACTGGTATGCAAGGAGAACCTGTAGAAGCCTTAAGTCAAATGGCGCAACA
1888	85	161	MW2_CDS_09899	MW1857	FALSE	unmapped	AACGATGATTTTACCGATTTTAGCAACGTTGTCTGTTGCTGTTGGAGTGCATCCATTACT
1889	85	159	agr_tiling 094_F		FALSE	unmapped	ACACTATTCCAATAATGTATATATAATCTGATTTTTTGTATCTTATTCCACTAATAAATG
1890	85	157	MW2_CDS_02058	MW0381	FALSE	unmapped	GGCGCGGAAAAGTTCCTGTTCGACAATTAGATTATTTTAATCCCGAAAGCATGGTAGAGG
1891	85	155	MW2_CDS_09737	MW1828	FALSE	unmapped	AGCGATAAAAGTTTTGTTGCTCAAATTGAGCATACGGTTATCGTGACTAAGGATGGTCCG
1892	85	153	MW2_CDS_13181	MW2495	FALSE	unmapped	TAGGTGTGAACACAAATGAAGAAGTTGACCAGTTGGTGAATAAAGTGAAAGAAGCGGGTG
1893	85	151	MW2_CDS_02368	MW0437	FALSE	unmapped	AGGTCATACCAGCTTTAAAAGAAGGTAAGGTTGTGTTGTGTGATCGCTATATCGATAGTT
1894	85	149	MW2_CDS_03849	MW0704	FALSE	unmapped	TATTTAAAAGTGAATTGAAAATTGCAATTGGTCCAGTTGAACGTGGTGGTGCTGGTGGTG
1895	85	147	MW2_CDS_06046	MW1125	FALSE	unmapped	CGGCGAAGATTATACCACGCTTAAAGACGCTTCAAATTCATTAGAGGCTGTCAAAGTTAG
1896	85	145	MW2_CDS_04916	MW0905	FALSE	unmapped	TGCTATCGTAGGCGTTACAGCAGATGGTTTAATGGAAAATGAGTATTCTGAAATGGAGCA
1897	85	143	MW2_CDS_07452	MW1393	FALSE	unmapped	CCCAGAAGCAACAAAAGTAGTTAAACGCATGACATGGGAAGATGAAAAAGGTGGTACAGT
1898	85	141	MW2_CDS_10468	MW1976	FALSE	unmapped	AGTTGAGCAATTGAAAAGTGGTGATTTGATTTTACTTAACGGAGATTTAGGAGCAGGTAA
1899	85	139	MW2_CDS_05265	MW0975	FALSE	unmapped	AAGTTACACAGTGATTACGCGAAAGCATATAAAAAGGCTGTAAACTCAGAGAAAACATTA
1900	85	137	MW2_CDS_07861	MW1481	FALSE	unmapped	GAAGGTATGGAAGTACAAATTCAAACATACGAAGGTGAAACTATCGGTGTTGAATTACCT
1901	85	135	MW2_CDS_11089	MW2096	FALSE	unmapped	TTCTGGTACATATACGCCTATTTTGTTAACAGTTGTAGGTGGTTGGATAGGTTGGACAGT
1902	85	133	MW2_CDS_08677	MW1633	FALSE	unmapped	ATGCCAAAGCTTTAGGTTACGTGGAAACATTGCTACATCGTCGACGCTATATTCCTGATA
1903	85	131	MW2_CDS_04530	MW0837	FALSE	unmapped	CAAAAATTATGAGCGTAAGAAGGAAAAACAATCAGTATTAGATGAAATCAGAGAAACAGA
1904	85	129	MW2_CDS_11662	MW2210	FALSE	unmapped	ATGGGGACTCGCATGGTTAAATTGGCTTTAGAACTTTATAATAGCCCATGGATTGCTTGG
1905	85	127	MW2_CDS_03195	MW0588	FALSE	unmapped	GCAATCGGAATTGCTGCACCTGTTGTGTTAAATGTTACAAGTGATGCAACTGAGTTGAAC
1906	85	125	MW2_CDS_09458	MW1776	FALSE	unmapped	TGCAGTTTTATTAATGGTTTGGTTATCATATCCATTAGTGACAGCAATTATTGGGTGTTT
1907	85	123	MW2_CDS_11141	MW2105	FALSE	unmapped	ACATGTTGAATCAATATCCAGGATTTAAAGTTGCTATGGAACCGTTCGGTGAATATGCAA
1908	85	121	MW2_CDS_09028	MW1694	FALSE	unmapped	TAACTTTTAAATCTGGTGAACGTTACAACATGGTGCCTGATCATGCAGAAGCAAGAGTGC
1909	85	119	MW2_CDS_09624	MW1807	FALSE	unmapped	TCGCGTTTGGTCTGAAACAACAATATTAAAGGGTACTGATCATGTTGTCATTGGTGGCAA
1910	85	117	MW2_CDS_03490	MW0640	FALSE	unmapped	ATGCATGAACAAGATTTTAGAATTTTAGAGGGTCAAGATATTACTTTGCCAGAATTAGGT
1911	85	115	MW2_CDS_03690	MW0676	FALSE	unmapped	CAATTGTTGAAGGCGAAACGTATCAAGTGAACTATACGGCGCGCTTAACGGATAACATTT
1912	85	113	MW2_CDS_00796	MW0148	FALSE	unmapped	ATTAGACCGATATCTCCGATAGCATGGGCACCATTTGTTGTTCTATGGTTTGGTATTGGT
1913	85	111	MW2_CDS_02156	MW0398	FALSE	unmapped	ACCGGGTGAATTGGATGATGAAGGTATGGTTTTAAATCTGGATAGAAATACTCGAACGGC
1914	85	109	MW2_CDS_12522	MW2369	FALSE	unmapped	TTACCGTTATCTGTTTCGGTTATTATCGGTGGCATTCGTATTGCCTTGGTTGTTGCGATA
1915	85	107	MW2_CDS_07641	MW1442	FALSE	unmapped	ACTCATGTAACTGAAAAAATGGATAGAGAACTAACTCAAAAACTCGAAAACATTCCAAGT
1916	85	105	MW2_CDS_07591	MW1429	FALSE	unmapped	AGAAGAGCAATTTGAATTGTTAGCAAGATTGAATGAACAAAGTGATGACCCTAGAGAAAT
1917	85	103	MW2_CDS_12945	MW2449	FALSE	unmapped	GCGACGTTCGGTTCGTTTAGACCTTGGCCAGCATACCTATATACAATCGAACATTCTATT
1918	85	101	MW2_CDS_00912	MW0168	FALSE	unmapped	ATTGCTTTTAGCACCTTCGTATTAGTTCATTTAGCATTAAAATTATTCTTCAGCATTTAA
1919	85	99	psma_tiling_029_R		FALSE	unmapped	CTATACAAAAAACCAAGACCATTTATTTGCAACAAACTAACAAGACTCACCTCACATCAA
1920	85	97	MW2_CDS_00371	MW0071	FALSE	unmapped	ACTATGTCGATGTGACTAAGGACGAGGATGAAGGAAAACCGCACGACAATGAAAAAAGAT
1921	85	95	MW2_CDS_04688	MW0865	FALSE	unmapped	AGTTGTCGGTGCAGATAAATTATCTAAAATAACAGATTTAACTGACCGTTCTACTGCAGT
1922	85	93	MW2_CDS_02127	MW0392	FALSE	unmapped	AGCAGGCGAGTTCTATACACCACAACAAGTATCTAAGATACTGGCGAAGATTGTCACAGA
1923	85	91	MW2_CDS_02360	MW0436	FALSE	unmapped	CGAATGTTTGGAGAAGAAGGGTTTTGAAATGCTTCAAGTTGATGATCCGTTGAAGTTGCT
1924	85	89	MW2_CDS_10817	MW2043	FALSE	unmapped	TCGAACCAATGCCTAAATTGATGGCTGTCAGTGAACAAGTAACGAAACTTCAAGCAGTTT
1925	85	87	MW2_CDS_01175	MW0216	FALSE	unmapped	AAATTACGATATGGATCGCGTACACTACGAAACATTTATTCCAAGACTAAGCGTTGCAGT
1926	85	85	MW2_CDS_03538	MW0648	FALSE	unmapped	AACAAAGTTTTTAAGAAGTACAATCTAACATACCCACAATTTCTTGTCTTAACAATTTTA
1927	85	83	MW2_CDS_00649	MW0121	FALSE	unmapped	AAGTTGAAAAATATAGCGTCTATTGATTTGACAGATTTAATGAAAATATCTTTAAGAGGA
1928	85	81	MW2_CDS_13345	MW2525	FALSE	unmapped	CCAACTTGTTCACGATATGCGTACACGTGTGGTAACTTCACCTTCATTCTCACCAGATAA
1929	85	79	MW2_CDS_12598	MW2383	FALSE	unmapped	AGGTGCTAAGACTCGTGGTGGTCATATGGAAGCTGAAAAGGTAAACGAAGAAATTGCTAA
1930	85	77	MW2_CDS_02632	MW0485	FALSE	unmapped	TGGGTGCTCGTATAGATGCAGGAGAGCATAAAGAAGATGCACTTGATTTTACATTGTGGA
1931	85	75	MW2_CDS_12048	MW2282	FALSE	unmapped	ACTTAGTGACAAAGAGCGTGCGTTTATAAGCGGTACTGACGATTATGTAACCAAACCCTT
1932	85	73	MW2_CDS_05510	MW1021	FALSE	unmapped	AGGTTGTAATGTGTGTAAACACACAGGATGGATTGAAATTTTAGGTGCTGGAATGGTACA
1933	85	71	MW2_CDS_08058	MW1517	FALSE	unmapped	ACGTAAACATGCTGAACACTCTGGTGAAGATTTCAGATACCATGATCCAGAAACGAACGA
1934	85	69	MW2_CDS_08009	MW1509	FALSE	unmapped	TGGCAGGTAAAGGTACAGAGATTGGTCGCTCGTTTGAAGAGTTAGCACGTATTATTGATG
1935	85	67	MW2_CDS_04550	MW0840	FALSE	unmapped	GCAGCATATATCATAGGTATTAAACGTACAGCAGAAGCAGCTAGATATCGTGGTTGGGCA
1936	85	65	MW2_CDS_08536	MW1608	FALSE	unmapped	CCAGAAAAGGTAGCACAAATGACCGCTCAAGATATCGACCGCTTAATGACTTTTCCAAAT
1937	85	63	MW2_CDS_09466	MW1778	FALSE	unmapped	TGGTGAGTTTGCAGATCAATCTGTATTTCATATTCATTTCCACTTAATTCCTCGATATGA
1938	85	61	MW2_CDS_10960	MW2069	FALSE	unmapped	GGCGATTACAATCGAATACGTATCATGGAATTGTTATCAGTCAGTGAAGCAAGTGTTGGT
1939	85	59	MW2_CDS_00565	MW0106	FALSE	unmapped	ATGATGTTTATTGTGCTTGGTGTGGTCAATCATTATTTGCCCCCTACAATGTACGCTACG
1940	85	57	MW2_CDS_02000	MW0368	FALSE	unmapped	TCTGCCAAAAAGCTAAAAGAGTTCAATAGGTTACAAAATGTTTTTTGGAGAGCTATAGAA
1941	85	55	MW2_CDS_08427	MW1585	FALSE	unmapped	TTAAATGGTATTGAAAAAATTAAAGATTACGATGTTATGAGTTTAATCTCATACGACGAA
1942	85	53	MW2_CDS_04939	MW0910	FALSE	unmapped	TGAATAAAATCTCGAAGGCTTTAACTTGGTTTATTATAAGTTTCATTATATTTCATCTCA
1943	85	51	MW2_CDS_12751	MW2412	FALSE	unmapped	ATGAAAGGCTCTAAACAAATACTTTTGATTATGGGCATTATATCTCTTATTGTTTTATTT
1944	85	49	MW2_CDS_02221	MW0410	FALSE	unmapped	TATAATCATTTAGCCGTTGATACAGGCTTTTCATTTCCAAGTGGACATTCCAACGCCAGC
1945	85	47	MW2_CDS_04403	MW0811	FALSE	unmapped	GACGAACAAGTTACATATGAAAAGCTTGCGATTGCAACGTTAGGTGTAAGAAATGGTGCA
1946	85	45	MW2_CDS_01320	MW0242	FALSE	unmapped	AAATGTTGGCACGAAAAGGATATGATGTTGGATGGCAAGAAGGGGACGACAGTATTTTAC
1947	85	43	MW2_CDS_07810	MW1472	FALSE	unmapped	TTGCACGAATGATTTCAGGTGCAAGTGTTACTGATTTAACTCGAGAAAATGCAAGAGAAA
1948	85	41	MW2_CDS_06088	MW1132	FALSE	unmapped	TTATCAGCGGTTTGTCAAAAGGGGTTTTAATTACTGAGGCTAAGGAACAAAGTGGCAGTC
1949	85	39	MW2_CDS_12943	MW2449	FALSE	unmapped	AGTTGCATCAAAAGTTTGCTTTTAAGCATGCCGGCACACTGACCAATGTAGGTTTTAAAT
1950	85	37	MW2_CDS_12149	MW2299	FALSE	unmapped	TAAAACGGGTGGATCATTTATATTCCCGATTGCGACAATGTCTAATGTTGCACAAGGTGG
1951	85	35	MW2_CDS_07610	MW1435	FALSE	unmapped	TGTCAAAAGAATGAAAGCTGAGCGCATTGCTAAAGGCATTTCGATTTCTGATATGGCAAA
1952	85	33	MW2_CDS_01375	MW0252	FALSE	unmapped	GCGCATTACGGTGTCGACTATGCAATGCCTGAAAATTCACCAGTTTACTCATTAACTGAT
1953	85	31	MW2_CDS_01625	MW0297	FALSE	unmapped	TTATCGGTGTGGACTTCCTGGATTTCAAACGTAAAGGTGCAGAACTTGCCAACTTCTATA
1954	85	29	MW2_CDS_00217	MW0041	FALSE	unmapped	TCAGAAAATAGGGATAAACCCATGCAATAATAGCACGCCTTCGAAAGGAGGTGATTGCTA
1955	85	27	MW2_CDS_10353	MW1955	FALSE	unmapped	GAACTGACTAAAGCAGTCATTTACATACAACTTGTTCTATTTTTAATCGCCGCCACGACG
1956	85	25	MW2_CDS_01372	MW0252	FALSE	unmapped	CAATGGAAGCGGCCAAACATATGTGAATCCAGCAATAGCAGGAGATAACAATGACTACAC
1957	85	23	MW2_CDS_03511	MW0644	FALSE	unmapped	ACCAATTGTATTGGTACCGTTAATTGTTGAACGTAAACGTATCAAACAACATCCGGACGT
1958	85	21	MW2_CDS_03621	MW0663	FALSE	unmapped	TATGACGTTTGCACCTGAAGTTGAAGGTGCAAAAGAAGCGCTTGAAACGTATAAAGATGA
1959	85	19	MW2_CDS_02858	MW0526	FALSE	unmapped	TGCAGGTACAAAATATGATGAACAAGGCTCGGCACAACCATTAGGAAGTTTGTTTGAACA
1960	85	17	MW2_CDS_06770	MW1264	FALSE	unmapped	AGATTTGTCTTTGATATTGATGGTACGCTTTGTTTTGACGGCCGATTAATTGACCAGACT
1961	85	15	MW2_CDS_13667	MW2582	FALSE	unmapped	AGGTTACATACCAATCATTGCACATCCTGAAAGAAATAGAAGTATCGCCAAAAATCCGGA
1962	85	13	MW2_CDS_01621	MW0296	FALSE	unmapped	GAACAAGAAGTTGCTATTGAAGGAAGCAGACTGAAAACTGCATATGCAGAGGCGATGAAA
1963	85	11	MW2_CDS_01550	MW0284	FALSE	unmapped	GACGATTTCGGTAAGAAATATATCATTTTCCCTAACCCAATGTATGGTAGTTGGGAAGCT
1964	85	9	MW2_CDS_13324	MW2521	FALSE	unmapped	CCAGCAGAGCGTGTTATCGGTTCAGGTACTGTATTGGACAGTGCACGTTTACAATATTTA
1965	85	7	MW2_CDS_13027	MW2465	FALSE	unmapped	AGTACTTTTCTCAGCAGATTTCACTTATCAATCCGTCGAACAAACGCATCAATCGCATGC
1966	85	5	MW2_CDS_05038	MW0932	FALSE	unmapped	AAACCTGTAGCAACAATGTGGGAAAGTAAAGGAAAAATCACTTACCTCAAAGGCGAAGCT
1967	85	3	psma_tiling_083_F		FALSE	unmapped	AAAACAACAAGCCACTTATCAATGCAATGATAAGCGCAATAACAAACAGTGAAAATAGCA
1968	85	1	MW2_CDS_03777	MW0691	FALSE	unmapped	GCTGGCTTATTCTCAGGTATTTTTGCAGCATCAGCATATACATGTGTTCGAGCACTTAGT
1969	84	164	MW2_CDS_07263	MW1357	FALSE	unmapped	TTTATGTATTAGTAAAAGAATTGATTATATTTTTGAAGTCAAAGTATAACAAAAGCGCTT
1970	84	162	MW2_CDS_07776	MW1466	FALSE	unmapped	GCGTCACTGCTGAAAGAAATTGGTCTAAATGTGAATAGTAATGACTATACAGCAATGCGT
1971	84	160	MW2_CDS_00341	MW0066	FALSE	unmapped	TGCTTTTTAGAAATCAAAAAGGTGCTAAGGCAACTAAAGCAGGCGAAGAATTCTTAGCGT
1972	84	158	MW2_CDS_01843	MW0335	FALSE	unmapped	TCCGCTTATCACTAGGTGTTGAAAATTATGAAGACATCGAACGCGATATCATCCAAGCAT
1973	84	156	MW2_CDS_13842	MW2612	FALSE	unmapped	CAACAGACATCAACGGTACAACAATAACGAACAAGTATACACCAGGAGAGACATCGGCAA
1974	84	154	MW2_CDS_08831	MW1658	FALSE	unmapped	AGCTGAACGTGTTGGACCAATTAAATTGCATATTGTACCATTTACAGAATTGCAAAAACA
1975	84	152	MW2_CDS_01554	MW0285	FALSE	unmapped	TATAATGCGTCACCAGTCATTTTCACGAATGACGCTACCATTGCCAAGATCAATCCTAGA
1976	84	150	MW2_CDS_08453	MW1590	FALSE	unmapped	ACATCGCATTATATCAGTTGGTACAACTTCAACACGTACACTTGAAACAATTCGACGCGA
1977	84	148	MW2_CDS_03288	MW0604	FALSE	unmapped	TGCCGGGTACAGATGGTTTAAAAACTGGATCAAGTGATACAGCAAATTACAACCATACGA
1978	84	146	MW2_CDS_07554	MW1420	FALSE	unmapped	GTAGTAAACGGCACTTATTACTTTCATGGGCATATCGTGCCAGGTTGGCAAAGTGTTAAA
1979	84	144	MW2_CDS_11228	MW2120	FALSE	unmapped	TGAAGATTGCATTAGGATGCGACCATATTGTTACAGATACAAAAATGCGTGTATCTGAAT
1980	84	142	MW2_CDS_04149	MW0759	FALSE	unmapped	ACACAATTTCTTTTGAAGTGCAAACTGATAAGAAAAGTGTAACAGCTCAAGAACTAGACA
1981	84	140	MW2_CDS_07369	MW1376	FALSE	unmapped	GATGCGGTTGAATTTGCGAAAAAGCATAAAGATAAAATTGCTAAACGTGGCGAACAATTT
1982	84	138	MW2_CDS_04872	MW0898	FALSE	unmapped	TCAAGTCAACTTATGATTACGAAACCTGGTGGTATCACAATAACTGAAGGTTTCGCCCGT
1983	84	136	MW2_CDS_12811	MW2424	FALSE	unmapped	TTGTTATGTCTTAACAGAGGACCACTACGTCATCGGAGGTCCTGTAAATAATGGTGGTGT
1984	84	134	MW2_CDS_07212	MW1348	FALSE	unmapped	AACGCTACACGGTACTGATATTACTGTTTTGGGCTATGATCATTCACTCCAAGGTGCAAT
1985	84	132	MW2_CDS_03170	MW0583	FALSE	unmapped	GCATCAAACGACCAAATTAAAACATTCAGCAAACTTATTGAGCGACTTACTGGAGAAACA
1986	84	130	MW2_CDS_03161	MW0580	FALSE	unmapped	TGGCAATTACAAAAATCAATGATTGCTTTGAGTTGTTATCAATGGTCACTTATGCTGACA
1987	84	128	MW2_CDS_04540	MW0839	FALSE	unmapped	GTAACTTCCATGGTCGAACAATGGCGCCAGTTTCATTATCTTCAGAAGCAGAATACCAAC
1988	84	126	MW2_CDS_03121	MW0574	FALSE	unmapped	TAACGGCGATAAATGTCGCATATGTTGGCATCATTGGATTCATTGGTATGGTAATACCGC
1989	84	124	MW2_CDS_00999	MW0185	FALSE	unmapped	AGGTGCACCTGGTGCCATAAGTATCATTGCTAGTGTTGCGCAAACATTAATCAATGTATT
1990	84	122	MW2_CDS_12843	MW2431	FALSE	unmapped	AATCGTTCCAGCAGTAATCGCTGTGATTATGTGGTTCTATGTGAAACCAGATCAACCTTT
1991	84	120	MW2_CDS_13058	MW2471	FALSE	unmapped	GTCATGCTCTGCTAGACTGCCAGTGTATGCGTTGTTCGTAGGTATCTTTTTCAAAGAGAA
1992	84	118	MW2_CDS_05811	MW1081	FALSE	unmapped	GTTTAGCTGCTTTGGTTGATCGAGGACATCGTGAGTTACCAATTCGAGCAGATTTTGTTG
1993	84	116	MW2_CDS_12706	MW2403	FALSE	unmapped	CAGGTAGTGGTATTGGAGAAGCAATTGCAACATTACTACATGAAGAAGGGGCGAAAGTTG
1994	84	114	MW2_CDS_05889	MW1095	FALSE	unmapped	GAGATATCACGCTAGAGAAATTGCCCAATGGCGAAGTGAATATCATCACTGTCCAGTCAT
1995	84	112	NC_A_089		FALSE	unmapped	AAGAGGCAGGTAATCTTGCCTCTTTTTAGTGTATATCAATGCCTCTTTGATTTAATATGA
1996	84	110	perR_tiling_067_R		FALSE	unmapped	ATTTTCGAATCATATATATGTTGTCGTTGGTTATCATATGATAGTTTCATCTTTTTATAA
1997	84	108	ETG02_36680		pos		
1998	84	106	MW2_CDS_11512	MW2182	FALSE	unmapped	GGATGATGATGAAATTAAGCCACCATTTTTTATTCAATGGGAAGAAAGTGATTCCATGCG
1999	84	104	MW2_CDS_07392	MW1380	FALSE	unmapped	TCGCTAAGTATTTAAGACATGCAGGTCACGAAGTTGCATTATATGGTGGCTCAAGTCAAT
2000	84	102	MW2_CDS_12192	MW2307	FALSE	unmapped	TGTAACGAATATATATGAAACAGACGAATTATATTACTTAGAAGCTGAACTAGCAGGTGT
2001	84	100	MW2_CDS_03750	MW0686	FALSE	unmapped	ACAAAGCGGGTAAATGAACTTTATGAAGCACTTTTAAATGTAGGGTGTATTACGCGACCA
2002	84	98	MW2_CDS_11265	MW2128	FALSE	unmapped	TCAAGACACTTTAAGATATTATGAAAAGGTTGGTGTGATTCCACCTGTTAATCGAGATGA
2003	84	96	MW2_CDS_05457	MW1011	FALSE	unmapped	GGTCATGGAAACTACTAATGACGATTACTGGAAAGATTTCATGGTTGAAGGTCAACGTGT
2004	84	94	MW2_CDS_13222	MW2502	FALSE	unmapped	ACCAGCAGTCATCATGAATGAATTTGGGAAAATGAGTGTTGATGGTGCCTTAGTATCTGA
2005	84	92	MW2_CDS_04388	MW0808	FALSE	unmapped	TGGTTGTCCTTACTTTGTATTAAGACATTTGTCTAAACAAGAGGTTAAAAAGTTAATCGA
2006	84	90	MW2_CDS_09258	MW1737	FALSE	unmapped	GAGGAAAAATCAGAAACAGCAACAGATGAGGATTTACAATCAACCGAAGAAGTACCCGCA
2007	84	88	MW2_CDS_01232	MW0227	FALSE	unmapped	ACAGATCAACGTGTCAAAGTAGTTGCAGGTGGTACGGATCGAAACGAAACAATTATGAAC
2008	84	86	MW2_CDS_13849	MW2614	FALSE	unmapped	AACGAAGCGCGTTTATACAGAAATGTATTTTCTGTGATGTTACGCAATGATTTAAAGCGT
2009	84	84	MW2_CDS_08464	MW1592	FALSE	unmapped	TCCCAGGAATTGGTAAGAAAACGGCAAGACAGATTGTCTTAGATTTAAAAGGTAAAGTGA
2010	84	82	MW2_CDS_01629	MW0297	FALSE	unmapped	CCTAAAACACGTTCGACTACAAATGCAGCAGCAGATGCTAAAAAGGTTCGACCACTTAAA
2011	84	80	MW2_CDS_07758	MW1463	FALSE	unmapped	GGGCATGATATAGTAGAAATGAATGGTCAACGTGTATTTAATTTTCAAGATGGCCAAGGT
2012	84	78	MW2_CDS_01509	MW0277	FALSE	unmapped	AGATGATCAAGGTGGAGAGGTCGTTTTTAATTATACTAAACCAGGTAGCGAGGACTTGAA
2013	84	76	MW2_CDS_10428	MW1970	FALSE	unmapped	TGCACAGAAAGTTGCAGATGAACTCGTCCAAGCTGGTGTGAAAGGTATTTTAAACTTCAC
2014	84	74	MW2_CDS_05148	MW0952	FALSE	unmapped	ATGATGACGAAGTTTATGCTGACATTCCAGTTGAACCACTAGCTGATGAAGCACCTGTAT
2015	84	72	MW2_CDS_10657	MW2012	FALSE	unmapped	TGCATACAGATACGGCGAAGATGATTGCTAAAGAACGTCACGACTTTATGATGATGTACT
2016	84	70	MW2_CDS_13013	MW2462	FALSE	unmapped	TGGCACAGAAATTCAAAAGATTTTTCATCTTCCCTTAGCCGGCAGTATTGTTGGTCTATT
2017	84	68	MW2_CDS_01622	MW0296	FALSE	unmapped	TTCCCAATTGCTGATCAGGCTTTACTTGCAAAAGCGTCAGCGATTTCTATTGTAGAGATG
2018	84	66	MW2_CDS_08106	MW1526	FALSE	unmapped	CACCTCGTAGGAAAGACTGCTCAAACAGTTACAGATCTTCGACCTGCAGGGATTATTTTT
2019	84	64	pMW2_037		FALSE	unmapped	TGCGAGGTCAGGAGATACGATTGTTGTTTGGAGATTAGATAGATTGGGACGTAATATGGA
2020	84	62	MW2_CDS_13845	MW2613	FALSE	unmapped	TGGATTTATTCCTTGGTTAAGTAAATCCATTGCTACAAGTCTTGGTGGCTTAAGCTGGCC
2021	84	60	MW2_CDS_08360	MW1572	FALSE	unmapped	GCTGAGACAAATGCATATTTCCATGTTGATGCGGTTCAAGCAATTGGACATCTTGATGTT
2022	84	58	MW2_CDS_01489	MW0273	FALSE	unmapped	TGGATTTATGGATGAAAGTTTATCGAATGTTTGATGAGTTAAGAGAAACTTTTAAAAAAG
2023	84	56	MW2_CDS_03578	MW0656	FALSE	unmapped	GCAATTGTTTCTGCAACTGCTGAAATCATTCTTACTGTAACTGATTTGGACATTCAACGT
2024	84	54	MW2_CDS_04285	MW0788	FALSE	unmapped	AGCCGATTCTGATGACGAAGGAGATCGAATTAGAAATTGGTTTAAACGTTATTTGAGTGA
2025	84	52	MW2_CDS_08354	MW1571	FALSE	unmapped	GCGCAACCGGGTGATATGATAACACTTGATGGTAAGAAAATGGGTAAACATAGTGGGTTG
2026	84	50	MW2_CDS_04648	MW0858	FALSE	unmapped	CGGGATTAGCAGAAATCAACCTAAACTAAGAGAAGTTCATTCTGAAAAAGTATGCGAAGG
2027	84	48	MW2_CDS_03779	MW0691	FALSE	unmapped	GCCAATGTTTGGCAGACTTTCAAGTCAACCCTTATTAATAACACGATCAACACTTGGACT
2028	84	46	MW2_CDS_13608	MW2572	FALSE	unmapped	TGGTGCCTTGTATTATGGTGCTCAGTTAAATCCTCAGGCAATTATTGTTGGTAAACCACT
2029	84	44	MW2_CDS_03465	MW0635	FALSE	unmapped	TCGAACATTGTTGATTTATGGAGCGATTTTTGGTGGTTTATTCTACTTCAGCATTGGGGT
2030	84	42	MW2_CDS_07217	MW1349	FALSE	unmapped	TGTGTTGTTATGTTTAGCGAATTCAATGGGAATAGATATGACAGAGAGCTTTAATGAAAC
2031	84	40	MW2_CDS_04553	MW0841	FALSE	unmapped	TGGCCCGAATGCAAACTATTATATTGAAACAAAGTCACCTGATGTATACCCAGGAATGGA
2032	84	38	MW2_CDS_13406	MW2537	FALSE	unmapped	ACAGTTGATGTCGTTAAACGAACATGTGGTTACTTAGGCAATCCAGTTCAACGTCCAGTA
2033	84	36	MW2_CDS_01628	MW0297	FALSE	unmapped	CGCTGTAGAACTTTATTATTACATTAAAGGTGGTCGCGTAGATTATGGCGCAGCACATGC
2034	84	34	MW2_CDS_02199	MW0406	FALSE	unmapped	TAACAAAAGAACTCGATGCATGCTTAGTCAATGCGCAAGAAATTGATGCAGATTGGCAAC
2035	84	32	MW2_CDS_11876	MW2251	FALSE	unmapped	TAAAGAAGATTATGCAGATGCAAGAGGCATGCTAGACAATAACGGTGCGATTGCATTAGC
2036	84	30	MW2_CDS_00833	MW0154	FALSE	unmapped	TCACAAAGTCGTTGGTCATATAAAAAACCGCGTACAGTCAACTATAGATACAATCAAGAT
2037	84	28	MW2_CDS_07131	MW1332	FALSE	unmapped	AGAGATTGTTAAACATGATGACGTCCCACACGGTTTAATGATGAAAATTCACGACATGCA
2038	84	26	MW2_CDS_08192	MW1541	FALSE	unmapped	GGATAGAGTAGTTGATTTACTTGATAAAGCACAATTATTGGAGGATGCAGATGTAAGTCA
2039	84	24	MW2_CDS_12346	MW2337	FALSE	unmapped	AGTTTGGTCCTAGAAAATTGGCTTTAGTCGGTATGGCGATTGTTGTTATTACTACGGCTT
2040	84	22	MW2_CDS_01672	MW0305	FALSE	unmapped	AATCGAAATGTAAGTAACGAACGTGCAAAAATACTTCTTGGTTGGGAACCGATTGCGACA
2041	84	20	MW2_CDS_07152	MW1336	FALSE	unmapped	ATGGACTGCAGAAGTTGTTATTGAATTACAACGAACATATGATTCGTTAAAGTTTGCTGT
2042	84	18	MW2_CDS_08832	MW1659	FALSE	unmapped	GTCCATGGTGGTGGTCAAGAATATGGCGTTAGAAGTGGAACAGTTAATTTGCCAAATGAT
2043	84	16	MW2_CDS_05260	MW0974	FALSE	unmapped	TGGTGTAATGTTCTATGATCACATTGACAAAGATCACCCATTACAACCACATACAGATGC
2044	84	14	MW2_CDS_06021	MW1120	FALSE	unmapped	TGTTAGTTGTCGATTCAATGACGGGTCAAGATGCTGTCAATGTTGCAGAATCTTTTGACG
2045	84	12	MW2_CDS_04508	MW0833	FALSE	unmapped	TTGTATTGCGACGCCTATCGCAAGTTGGTTTTTAGGCAAAAATTTCTTTACGCATGTCAC
2046	84	10	MW2_CDS_02543	MW0470	FALSE	unmapped	GGGCAAATTTTCAAAGTGGATGTAACTTTGAAAGTAGACTTAGCTGAAGCTGGGCGTACT
2047	84	8	MW2_CDS_03757	MW0687	FALSE	unmapped	GCGGATTTAGGTATTAAAATGGAAGCTTTGAATGGTCAAAAACTTAAACATGTTATTCCT
2048	84	6	MW2_CDS_12143	MW2298	FALSE	unmapped	AACGATTCCATTAGGCATTATTATTGGCAACGGTATTATCGTAACAGTTTGTGACGCTGA
2049	84	4	MW2_CDS_01894	MW0347	FALSE	unmapped	AAAACAAGCCCAGAAGATGCTGTGAAAAAAGCTGAAGAAACCTACAAAGGCCAAAAGTTG
2050	84	2	MW2_CDS_08974	MW1684	FALSE	unmapped	TCATCAAGTGTAGATTCGAGAACGATATTAGACAGTGGTGGAGCAGAACGCTTGTTAGGA
2051	84	163	MW2_CDS_12781	MW2419	FALSE	unmapped	AGTGAAAAAGTTTGTTGAAAAGCCAGCACAAGGTACGGCACCATCAAACCTAGCTATTAT
2052	84	161	MW2_CDS_13728	MW2593	FALSE	unmapped	GCAAGATATTCAACGATTAGCGTCGCTAAATGTTCACGCTGCTATTATAGGAAAGGCTGC
2053	84	159	MW2_CDS_05925	MW1102	FALSE	unmapped	AATCATCTTGTTTTAACGGGTCAAATTACGCCGGAAGAAGCATTTACACATCCACAACGT
2054	84	157	MW2_CDS_10006	MW1878	FALSE	unmapped	GCATGGGGATTCCGTGTTGGGTTTATGACATTTGGAACGTCTGATCAAACAACTAAAGAA
2055	84	155	MW2_CDS_01054	MW0194	FALSE	unmapped	TTCTATAGAAGCATTGAACCATGGTGTCCATGTATTGTGTGAAAAGCCAATGGCGATGAC
2056	84	153	MW2_CDS_00539	MW0100	FALSE	unmapped	AACAATGCCGGCCTTGGACCAACAACACCAATCGATACAATTACTGAAGAACAGTTTAAA
2057	84	151	MW2_CDS_10531	MW1988	FALSE	unmapped	AAAGAGACAGGTGAGCGTATCGGTTTAAGTCAAATGCATGTATCACGACTTCAGAGAACG
2058	84	149	MW2_CDS_12016	MW2276	FALSE	unmapped	TGATGAGAGGCATGACGATGATTCAGATTATCGGTGTAATTTTAGTGACGATTGTATTGC
2059	84	147	MW2_CDS_02991	MW0551	FALSE	unmapped	TTGCAAAAGGCGGAAAATACCTAGGTAAAGGTGTTGCTGGTGTAGGATTTGGTATAGGTA
2060	84	145	MW2_CDS_07943	MW1496	FALSE	unmapped	ACCATTGTCACTTGGCCAAGAAAGTTGTGTTATCAGAATTGTACCTCAATTTTTTCAACA
2061	84	143	MW2_CDS_12935	MW2447	FALSE	unmapped	TTTTCACTCGTTATCTTACAATATATCTTAGTTGTTGGAACGATTAGTATGGTTTCACCT
2062	84	141	MW2_CDS_09905	MW1858	FALSE	unmapped	TATCGAAGATTGTTATTTTGGACCTTCAGAATTGCCCGAAATGGGAAGTTGGAATCGTGC
2063	84	139	MW2_CDS_08270	MW1555	FALSE	unmapped	TGCGAGTTGATTTGAATTGTGATTTAGGCGAAGCATTTGGAAATTATTCCTTTGGTGGTG
2064	84	137	(+)E1A_r60_a20		pos		
2065	84	135	agr_tiling 039_F		FALSE	unmapped	ATGAGTTGTTTAATTTTAAGAATTTTTATCTTAATTAAGGAAGGAGTGATTTCAATGGCA
2066	84	133	MW2_CDS_01397	MW0256	FALSE	unmapped	TGACGTCAAAAATAACACTCAGAAATCTACGTTAAATATCGGCATCAAATATGCTGAAGA
2067	84	131	MW2_CDS_00513	MW0096	FALSE	unmapped	ATGTACACCGAAAGATGTCTTTGCTAGAGAAGTACAGATAGACGCAATCAGTACAGGCGA
2068	84	129	MW2_CDS_12418	MW2350	FALSE	unmapped	TACTGATGTAGGCAAAACCTATGTTACAAAGCATTTATACCATGCTTTGAAAACACGTGG
2069	84	127	agr_tiling 054_R		FALSE	unmapped	TTATTTTGATAATAAAATTGACCAGTTTGCCACGTATCTTCAAAAGAGAAATAACTTAGA
2070	84	125	MW2_CDS_03344	MW0614	FALSE	unmapped	GTTAAAGCAAATGGCAGGTGACGTTGATATTATACCAATCGGGGGATTACCAGATGGTTC
2071	84	123	MW2_CDS_05769	MW1073	FALSE	unmapped	ACAACCATTTAGAAAAGTAATTCCACCTATTGGAATTATCGACATATCATCAATCGCTGC
2072	84	121	MW2_CDS_10212	MW1925	FALSE	unmapped	CGACGAATATACTTTGTCAAACCAACGAGCATTATTGGAAATTGAACGTAATCATCACGG
2073	84	119	MW2_CDS_13904	MW2625	FALSE	unmapped	CACATGTGGTTGATTAGCATTGTTGTTGGTTTCCTAAGCTGGTTCATCAGTGCAGTATGT
2074	84	117	MW2_CDS_08325	MW1565	FALSE	unmapped	CGAAGAAGAATTATTAACTTTATTCGATGAAGAGGGAAATGAAGTTTTATACCGAAAAGT
2075	84	115	MW2_CDS_03088	MW0567	FALSE	unmapped	GGTGTGAAATGGATTACTGATAAAGCTGCTGTTGAAGGCGATGAAGCTAAAGAATATTGG
2076	84	113	MW2_CDS_04901	MW0903	FALSE	unmapped	GGAGAGCCAATATTAGTCGTAGGTAATCCACTTGGTGTAGACTTTAAAGGCACTGTGACA
2077	84	111	MW2_CDS_03477	MW0637	FALSE	unmapped	TGGAAAAAAATGGAAGTAATTTATATTTTGTTTCATTCCCGTTTTCAGTAGTCGTTGGAT
2078	84	109	MW2_CDS_08416	MW1584	FALSE	unmapped	AGAGGTAACTGCGTATGACCGAAATGGCTTGTTGAATGAAGTACTACAAGCTGTTAGCTC
2079	84	107	MW2_CDS_08864	MW1664	FALSE	unmapped	ATGACTTTAAAGTCCAAACTTCTTGGCAAGGTGGTCGTAACAATGTCGGAAACGTTCAAG
2080	84	105	MW2_CDS_12513	MW2368	FALSE	unmapped	TTGGTACTGGTTTAGGATTATATGCTACACCATCAACTGATACAGCAGTTGCTAGTGCGC
2081	84	103	MW2_CDS_08366	MW1573	FALSE	unmapped	ACCTGGAACAGATATGATGACCGCAAGTGCATTAAGACGAGATCAACATGATGGTGTTTA
2082	84	101	MW2_CDS_01043	MW0192	FALSE	unmapped	ACGGGCTGATTACATTTTTGATTTTACAAATGTTCCCTGTATTAATGGCAATGGTCGCAA
2083	84	99	MW2_CDS_08257	MW1553	FALSE	unmapped	TGATGGCAATGGTAGAGTTGGAAGATTTATAATTGCCAAGCTCTTGAGTGATTATTATGA
2084	84	97	MW2_CDS_00695	MW0130	FALSE	unmapped	AGATTCCTGTGTTCCACATGGAAGCGGGTAATAGATGCTTTGATCAGAATGTACCTGAAG
2085	84	95	MW2_CDS_05862	MW1090	FALSE	unmapped	GGACAAGTATTCATGGCGATTGATGCTAATAGTGGCACAGAATTACCAATGAATCCTGCG
2086	84	93	MW2_CDS_10351	MW1955	FALSE	unmapped	TCCATGGGCATTGCTTGGATTTGCATTGGTAATGATTTATCAAATGGTAGTGAGCATTGT
2087	84	91	MW2_CDS_04676	MW0863	FALSE	unmapped	GGAAAGATGGTAGTAAAAAAGAAGTGGATCTTAAGAAAGATAGCTACACAGCAAACTTGT
2088	84	89	MW2_CDS_05292	MW0980	FALSE	unmapped	TTGTGCCTGCTAAAGCAGAGGAAAAACAAATTTTTAATACTTTCGAAAAAAGTAGTGGCT
2089	84	87	MW2_CDS_02390	MW0442	FALSE	unmapped	TACACTTGAAGATTGCATGATTGCAGCCCGTCATTTATTAAAAGAAGGTGGCAGGCTAAA
2090	84	85	MW2_CDS_07251	MW1355	FALSE	unmapped	GGCGCATGATTCTAGTGTTGGCGGTAAAGTGGGTATTAACTCAAAACAAGGTAAAAACCT
2091	84	83	MW2_CDS_05857	MW1088	FALSE	unmapped	AAGCTGTAACATTATCACCAAATGATTTATATACATGGAGTTCAGGTATTAAATCACCGA
2092	84	81	(-)3xSLv1		neg		
2093	84	79	MW2_CDS_07939	MW1496	FALSE	unmapped	TGTTGCCAAGTGTGTTATACAGGCTAGTTTAAGTGGTCACCTTGTTCTGACTACATTGCA
2094	84	77	MW2_CDS_10902	MW2058	FALSE	unmapped	TCGCTCAAGCATTTCTAGACAAACGAAACGAATGGCATGATGTTTTCGGTACAGGAAAAT
2095	84	75	MW2_CDS_00010	MW0002	FALSE	unmapped	ACCAGAAATTGGTACTGTAAAAGAAGAAGTTGATGCAAACGATGTTGAAGGTGGTAGCCT
2096	84	73	MW2_CDS_06961	MW1300	FALSE	unmapped	ACATGAAACTTGGAAAGAACGTACACCAATCAAGAAAGTAGAAGTCATTAATACAGATGC
2097	84	71	MW2_CDS_01884	MW0345	FALSE	unmapped	TCATCTATGGGGGAACATTTGGAATATATCCAAAAGCAGACGCGTCAACACAAAATTCCC
2098	84	69	MW2_CDS_09099	MW1706	FALSE	unmapped	GAAAGGCGTCGTTGTTATTGCTCATAATATATTAGAACATACGGGAAGATATGCATATGT
2099	84	67	MW2_CDS_11267	MW2129	FALSE	unmapped	GACTTCCACGTTGTGAAAGATAATGAATCGGTTTGGGCTGGTGTTAATTACAGCGATAGC
2100	84	65	MW2_CDS_03108	MW0571	FALSE	unmapped	TGGTGCTGATCATCATGGTTATATTAATCGTTTGAAAGCATCTCTTGAAACGTTTGGTGT
2101	84	63	MW2_CDS_03301	MW0607	FALSE	unmapped	AATGAAGTTGAACGTCAACCATTCTTCTCATTCCTTGGAGATTCTGTATTAGCAGCAGGT
2102	84	61	MW2_CDS_01740	MW0317	FALSE	unmapped	GTGGCTTTGGTGGTAGTGATGCACTTAAAATTGCACTTCTTGGTAAACTTGGCAGAGTAT
2103	84	59	MW2_CDS_08405	MW1582	FALSE	unmapped	GTGCTTGATCCTGGTCATGGAGGTAGTGACCAGGGTGCTTCAAGCAATACTAAATATAAA
2104	84	57	MW2_CDS_10082	MW1895	FALSE	unmapped	TTCTTTAAAGTAGTTGATGCAATCGTTGGTTTCGCCAAAGAGATAGGCGCTCAATTAGCC
2105	84	55	MW2_CDS_02594	MW0479	FALSE	unmapped	TGACGCGGATTGCTCAAACCATTAATCGTTTTGGATATACAATCAGAGGTATTTACGGTG
2106	84	53	MW2_CDS_11046	MW2089	FALSE	unmapped	TGCATTTAACAAAAGCGCCTGAAACAGTTAATGTGACTATTTCAGGACCACAATCAAAGA
2107	84	51	MW2_CDS_07183	MW1343	FALSE	unmapped	ATGGATTGATGTTGATAAACACGATAGTGCAATTATACAAGCGGCATTAGACGAGGCGAA
2108	84	49	MW2_CDS_07004	MW1308	FALSE	unmapped	AAGGTCGGTGAACAATTAATGGAATATCCGCCATATGATAAAGGTGAACCATTTTATGCA
2109	84	47	MW2_CDS_12805	MW2423	FALSE	unmapped	TGATAGGAACAGCAGGGACAGCCATGCTAATAGCAGTATTATTTGCAATCGTTACGATGG
2110	84	45	MW2_CDS_08738	MW1643	FALSE	unmapped	TCCAGCAATGATTGGTGGTATTGGCTTTTTAAATGGTCGTGCTGTTACAGTTATTGGACA
2111	84	43	MW2_CDS_02738	MW0505	FALSE	unmapped	TGGCGTTTTTAGTATGGATGGTGATGTGGCTAAATTACCTGAAATTGTAGAAATTGCAGA
2112	84	41	MW2_CDS_10250	MW1936	FALSE	unmapped	TTGCATGTGGTGCAACTGGTGCTGGCATAGGAGAAGAATTATATGATGACATATTGCATG
2113	84	39	MW2_CDS_03692	MW0676	FALSE	unmapped	ACAGACCTAACTCAAATCTTAACATCGTTATTTCCTTGTGGTTCGATTACAGGTGCACCG
2114	84	37	MW2_CDS_00338	MW0065	FALSE	unmapped	TCCTGATAAGTGGAAGTTTGTGAAATATTCATTTATTGAAAATCTTCCAAAGAGTCTCAA
2115	84	35	MW2_CDS_02461	MW0455	FALSE	unmapped	ACAGCTAAATTAGTTGCAAACTTAATCGAAACAGCTGGCGCAACTCGTATGATTGCGTTA
2116	84	33	MW2_CDS_04769	MW0880	FALSE	unmapped	CGAGCAACGAACAAAAGAAAAAGAAGCTCAAGGTTCTAAACGTCAAAAGTCTTCAGCACG
2117	84	31	MW2_CDS_05287	MW0979	FALSE	unmapped	ATGCAATTGGTGATATCGTTCCAGGTTTACCACTTGCTCACAAAGCTAGCTATGAAGCTA
2118	84	29	MW2_CDS_11545	MW2189	FALSE	unmapped	CAGTAGTTGTTTTTACCGGTCATGTTCGCGAATGGACTAAAGGCGTCAAAACGGAATATT
2119	84	27	MW2_CDS_04538	MW0838	FALSE	unmapped	AGAAATGATGTTTGGGCAAATCAATATAAATTCCCGGTCGCTGTGATTGAAGAGGTGCTT
2120	84	25	MW2_CDS_07172	MW1341	FALSE	unmapped	GGGCTATCGACAAATGAAGACCTTTAAAACTGAATTGATTAAAATGAATGCTAGTTATCA
2121	84	23	(+)E1A_r60_a22		pos		
2122	84	21	agr_tiling 153_R		FALSE	unmapped	TGGTTTCTTTATTCAAAAAGTTGAAATTATTAACAACTAGCCATAAGGATGTGAATGTAT
2123	84	19	MW2_CDS_02618	MW0483	FALSE	unmapped	TGATGAAAAGCGTTTGTCAAAATCACCAGCATTTTTCGATAAGCAAAAATTAGCATGGGT
2124	84	17	MW2_CDS_04637	MW0856	FALSE	unmapped	CGGTGAGTCATTTAAGTCATCAGTTCCTAAGTCTAGAATTGATGGAAAAGTAGGGCGTCA
2125	84	15	MW2_CDS_05744	MW1069	FALSE	unmapped	GGTGCACAAGGTGTGCTTATGAATATTACTGGTGGCGAGTCATTGTCATTATTTGAAGCA
2126	84	13	MW2_CDS_13427	MW2540	FALSE	unmapped	TGAGAGAAAAGGTGTATGCTCGGTTCATTTTGCTGAGCGAATTAAACCAGGCGATATAGT
2127	84	11	MW2_CDS_00947	MW0174	FALSE	unmapped	GGATCGGGCTCTGTTTTAGGTGAGTATACATATACAGACACTGAAGAAATTATCAAAAGT
2128	84	9	MW2_CDS_11860	MW2248	FALSE	unmapped	AGGGAGCTATGATGTTTTACCAATTATTATATTTGCAATAAGTATCGTATTGGTTCAAAT
2129	84	7	MW2_CDS_10436	MW1971	FALSE	unmapped	TGAACCTACCAACCACCTCGATATAGATTCAAAAGAAATGTTAGAGCAAGCACTCCAACA
2130	84	5	MW2_CDS_01367	MW0251	FALSE	unmapped	TATTTAAATGACATCGGTGAAGTTCCGCCATTGCATTATCATGTTTCCGATGCAACTGGA
2131	84	3	MW2_CDS_02059	MW0381	FALSE	unmapped	ATGAGCCCGTTTCATTAGAGACATTTGCAGAAATGTACGATGAACCTAAAGGCTTTGGTG
2132	84	1	MW2_CDS_12866	MW2434	FALSE	unmapped	ACGGTACGATTAAAAATTTACTCTATCGTGAATATTCAAGAACAACTATGATTGTTAGCA
2133	83	164	MW2_CDS_09143	MW1714	FALSE	unmapped	TGTTGGCTCGTAAATCAAATGCTTTAAATATTAAGCAAGTCATTAAGGGCGCACCTTGGA
2134	83	162	MW2_CDS_03747	MW0686	FALSE	unmapped	TAGACCACCATTTAATGTGACACGTATATCTGAATACGCAGCAGTTGCAGCACTTGAAGA
2135	83	160	MW2_CDS_03102	MW0570	FALSE	unmapped	GGAACTTGGCAACAAAGGCAATCTAACTTTATTCGGTATGTAGAACAAATTGAGGATGCA
2136	83	158	MW2_CDS_08390	MW1578	FALSE	unmapped	CAATTACACGCTTTAACTACAACGGTAGGACAAAGTAAAGTTTCTTTGATGGAAGAACGT
2137	83	156	MW2_CDS_11571	MW2193	FALSE	unmapped	GATATTTGAGTTATGTTGAAGATGTTGGCACGCGTGCATTATTGTCTCGTGCTGTAGCAG
2138	83	154	MW2_CDS_05302	MW0982	FALSE	unmapped	AGGGCGCATGGTTAGAGATTATGTCGTGAATATTTATGGGCAAGATTTCGAATGTGTCGA
2139	83	152	MW2_CDS_11863	MW2249	FALSE	unmapped	TCATCAACGCTTACAAGGCTATAAAATATTAGTCACAGGTGGTGACTCAGCAATAGGGCG
2140	83	150	MW2_CDS_02381	MW0440	FALSE	unmapped	ACATTTCTATGCAGGTGAAGCTTGAGGGACATGAACAGCCACTTGAATATAAATTAGAAG
2141	83	148	MW2_CDS_01518	MW0278	FALSE	unmapped	AAGTCAAATGTACAATGAAATTGCAGATGAAATCAGTGGAATGATACCAGTAGAATGGGA
2142	83	146	perR_tiling_011_F		FALSE	unmapped	CGAATGGAAATTTATGGAGTTTGTAAAGAATGCCAAGATAAATAATTTAACTTTGGTAGT
2143	83	144	MW2_CDS_01385	MW0254	FALSE	unmapped	TGAACACCTTGAGGATATGAAACAACATCAATCCATCGATGCTATCAACAAGTCCTATCA
2144	83	142	MW2_CDS_00334	MW0064	FALSE	unmapped	TCGGATATTAGCCTTATCACAGACGAAAAGATTATTAATAGTAACTTAACTGCTATTCCT
2145	83	140	MW2_CDS_02332	MW0430	FALSE	unmapped	ACCGTTTGATGAACAAGCATATCAATTGTTTGGTGATGTATCGGTGGCTTATTCAGCAAC
2146	83	138	agr_tiling 121_R		FALSE	unmapped	TTAAAGAAATGAAATATAAACGTAATCAAGAAGAAATTGAAACCTATTATGAATACACAT
2147	83	136	MW2_CDS_07141	MW1333	FALSE	unmapped	ATTGATACAGAAGAACCGGTGGCGTTAATTGGAAATCCTCCATATGGTGAACGTATTGGT
2148	83	134	MW2_CDS_13902	MW2624	FALSE	unmapped	TCAGTAATTGGTATACTCAGCCTCATAATTTTCCTTAGTGTGTATTTGGCAAATAAGTTT
2149	83	132	MW2_CDS_11352	MW2148	FALSE	unmapped	GACGATGCAAAAAAAGGCTTTTTATTAGATGGCTTCCCAAGAACAATCGAGCAAGCTGAG
2150	83	130	MW2_CDS_13737	MW2594	FALSE	unmapped	TTCCATCCTGAAAAAAGCGGTACATATGGGTTACAAATTTTGCGTCAGGCAATACAAGGG
2151	83	128	MW2_CDS_09934	MW1863	FALSE	unmapped	TCGTATTGATGCTATTAATTATGAAATTGATGGTTATGTTTACAATCAGCAACAACGTCA
2152	83	126	MW2_CDS_04942	MW0912	FALSE	unmapped	GAGGCACTTGGAGTCACGGTGTCGGCAGTAAGTATGTTTGGTCTTATTATTATCATGGTC
2153	83	124	MW2_CDS_02597	MW0480	FALSE	unmapped	GCACAAGAATTACAAGATCAACGATTTGCTGGATTCGGTGGTTCAAGTGATGGACAAGAT
2154	83	122	MW2_CDS_08420	MW1584	FALSE	unmapped	GTCATTGCATACTACAGTAGTAGGTCCAAATGGAGACCCGCTCGAAATCCAAATACGAAC
2155	83	120	ETG05_36762		pos		
2156	83	118	MW2_CDS_02144	MW0395	FALSE	unmapped	TTCGCGAATGCAGTAGTGAAAGTATATTCTGACTTAGGTGATGCGCAACTGTTTCCTGAT
2157	83	116	MW2_CDS_09259	MW1737	FALSE	unmapped	TGATGAAATTAACACACCAAACGTTGCAGAAGATAAATCACAAGACGACTTGAAAGATGA
2158	83	114	perR_tiling_025_R		FALSE	unmapped	CTTATATTTGGAAAATCAGGTGAAAGTGCTTGATAAATTTCATCAGCTGTTGGATGAGTA
2159	83	112	MW2_CDS_08313	MW1563	FALSE	unmapped	TGTTGATGGACCCAATTGAAGAAATTCAACCTGATCATCGACCATTTGACGAAGGTTTCT
2160	83	110	MW2_CDS_04310	MW0794	FALSE	unmapped	TGTTAAACTTAACTTTGCAGGTCTTCCTATATTACTTGCAGTCGGATTTGGCGTGCTTGC
2161	83	108	MW2_CDS_03644	MW0667	FALSE	unmapped	AGCCCATGATTTAAAAACACCTTTAGCAAGCATTATTTCATATTCTGAAGGACTACGTGA
2162	83	106	MW2_CDS_13524	MW2558	FALSE	unmapped	TAGATGACGAGGATTTCTTAATGGGTGAAGATGTCTACACACCTGGAAAAGAGGGAGACG
2163	83	104	MW2_CDS_03678	MW0674	FALSE	unmapped	TACAAAAACATTAACATGCTATAACGGTATCATTGGGGATGGCTGTGGTGAATGTCCAGC
2164	83	102	MW2_CDS_06487	MW1211	FALSE	unmapped	GAAATTAAAGTTAGGCTTATAGGGGTTGATACGCCAGAAACGGTGAAACCGAATACGCCT
2165	83	100	MW2_CDS_10504	MW1983	FALSE	unmapped	TGCCGATAACTTCGTTAAATCAGTTGATAAGTGGCGTGAGCTATATTCTGATGACGACGC
2166	83	98	MW2_CDS_01235	MW0227	FALSE	unmapped	AGTGACAACACCGTATGATTTAAAAGTAGCAAATGCCATTATTCAAGGTGATATTGCCGA
2167	83	96	MW2_CDS_06892	MW1286	FALSE	unmapped	GTCGTTTTCATTTTCCAACCTGCAGAAGAAACTGGTGGCGGTGCAAATCGATTAATAAAA
2168	83	94	MW2_CDS_02666	MW0492	FALSE	unmapped	ACCAAACAAAACTAAAGTTGCTACAGTAACTAAAGATCAAGTACGCGAAATTGCTAACAG
2169	83	92	MW2_CDS_00389	MW0074	FALSE	unmapped	ACAGCAAATCGAAAAAAGTATTAATGAAATAGTTGCTAAGGATCAACAATTGGCAGGGCA
2170	83	90	MW2_CDS_07033	MW1314	FALSE	unmapped	TATGTACGAATCAAACCGGCCATGTCGAAGCAGTACAAATTACGTTTGATCCAGAGGTTA
2171	83	88	MW2_CDS_12855	MW2433	FALSE	unmapped	CGGACAAATAGTTGGTCTCGTTGGAGCGAATGGTGCAGGTAAAACAACTTTAATGAAAGT
2172	83	86	MW2_CDS_04724	MW0872	FALSE	unmapped	AGTAACAATTTTGAAGCATCACTTAGTGGTTGGTCTGCAGATTACCCTGATCCTATGGCT
2173	83	84	MW2_CDS_02402	MW0444	FALSE	unmapped	AGGATTTTTGCCACGAAAAGAGAAAGAAAAAAGTGCTGTATTAGAGCAACGTATGCATGA
2174	83	82	MW2_CDS_13086	MW2477	FALSE	unmapped	AGTCATCCATCTTAATAATTTTAAAAATTTACATGCGAAAGAATTTAACCCATCTGATTT
2175	83	80	MW2_CDS_06960	MW1300	FALSE	unmapped	ACAGTTTCTGACATGTTAACGGTTGGCAAACAATATGATGTTATCAACGAAACTGAAGAA
2176	83	78	perR_tiling_101_F		FALSE	unmapped	TAGAGATAATACACCTACTTGTACCACAGAAGCTTGTGACTTTAGAGACAATTTAGAAAT
2177	83	76	MW2_CDS_01792	MW0327	FALSE	unmapped	CTGGACGAGAAGAAGTAATGGAACTATTAGAAGATTTTGTCGCTCAAGGTGGAGGCATCT
2178	83	74	MW2_CDS_00201	MW0038	FALSE	unmapped	TCGGAACAAGGGTTCCAAAGTATGTTCGGCAAACAGTGTAAGAGCTAATGTGATTGAAGA
2179	83	72	MW2_CDS_12412	MW2349	FALSE	unmapped	GAAGCGTCATCGAAATGTTGGTGATGTAAGAGGACGAGGCTTAATGTTTGGAGTTGAATT
2180	83	70	MW2_CDS_10769	MW2034	FALSE	unmapped	ACACACCATGCATTTATCTTAGGATTAATCATTGGTGTTACTGGTTCTGCAATCAACACA
2181	83	68	MW2_CDS_01099	MW0202	FALSE	unmapped	CCCGATGATGAAGCTGTTAAAGCAGCCTACCGTTATGTTAACTTCAAAGGGAAAATTCCC
2182	83	66	MW2_CDS_00074	MW0014	FALSE	unmapped	TGGAACCATACGCAAGTTCGACAGCTGAATTGGTAACAGAGTTACTGGAATATCAACCAA
2183	83	64	(+)E1A_r60_n9		pos		
2184	83	62	MW2_CDS_06568	MW1226	FALSE	unmapped	CAGTTGGCTTAGCATCCAGTTCAACTGTTCATGGTCACCTTTCACGTCTTGAAGAAAAAG
2185	83	60	MW2_CDS_02939	MW0542	FALSE	unmapped	TTTATTTTATGCAGTTGATTGGGCATCATTACGTCTAGTTCCAAAGGACGAACGCGATGC
2186	83	58	RC5		pos		
2187	83	56	MW2_CDS_12927	MW2446	FALSE	unmapped	TGTGATTTAAATTTCTATCTTGGTCAGATCAATCACATTGTTGGTAAAAATGGTGTAGGA
2188	83	54	MW2_CDS_13048	MW2469	FALSE	unmapped	ACTGCTGGTTATGTCGGTTATGATGACAATTCAAACACGTTAACTGAAAAAGTACGCCGT
2189	83	52	MW2_CDS_11842	MW2245	FALSE	unmapped	TCATTATCAGGTGAAACACATGAATTATTAGAAGTAACAAACTTGCTTCAACTTAGACAA
2190	83	50	MW2_CDS_01209	MW0222	FALSE	unmapped	TAGCGTGTGGTGCAGGTATTGCAACGTCAACAGTAGTAAATAATGCAATTGAGGAAATGG
2191	83	48	MW2_CDS_13881	MW2620	FALSE	unmapped	ACAGGCGCACTCGACTCGAAAAGTGCAAATGACTTATTACAACGTTTGGAAGAAATGAAT
2192	83	46	MW2_CDS_00622	MW0115	FALSE	unmapped	ACTTTAGTTATTGTCGTCGTCATTGATTACATCAGTACGAAAGTGAGGGCACATCTCGCA
2193	83	44	MW2_CDS_10854	MW2050	FALSE	unmapped	AGAAATTCAAATGGCCGCCCAATGTTTAATTCAAGCAATTGGTGGCGAAGGTTATGTTTA
2194	83	42	MW2_CDS_10495	MW1982	FALSE	unmapped	ACGATGGTCCAAGATTGTATGAGCCTATTCATGGATCAGCACCAGATATTGCAGGTAAAA
2195	83	40	NC_S_025		FALSE	unmapped	TAATAATAAGTATGGTCGTGAGCCCCTCCCAAGCTCGCGGCCTTTTTATTGTAATAAAGA
2196	83	38	MW2_CDS_12024	MW2278	FALSE	unmapped	ACTGACAAAGGTAGAGCATATTTGAAAGAACGTAATGCGATTATGACAGATATTGCGCAA
2197	83	36	MW2_CDS_05068	MW0938	FALSE	unmapped	AGCCAAGATATGGCTCATTTTAGAAGTGAATTTTTTTACGTCAATCATGAGCATCGAGAA
2198	83	34	perR_tiling_005_F		FALSE	unmapped	AAACGACATGAAAGTTGTTTAACTTCTTTTTTATGCTTATTCTGAAAAATATTTAAATAG
2199	83	32	MW2_CDS_09056	MW1698	FALSE	unmapped	ACGCATCAGTCATCAAATGGATATGTTATTTACTCATTTTGGTATCAGTGGTCCAGCTGC
2200	83	30	MW2_CDS_05467	MW1013	FALSE	unmapped	CCACAAACAAATGCTGGTACACCTGCATATATATATGCAATACCAGTTGCATCCTTAGCA
2201	83	28	perR_tiling_116_R		FALSE	unmapped	TCTAGGCGGTGTCAATTCCCCTTCTCGTTCTTATAAAGCTGTAGGAGGCGGTGCACCTGT
2202	83	26	MW2_CDS_02607	MW0481	FALSE	unmapped	TGCTATATTGGAGAAGTTGGTTTAACGGGTGAGGTACGTCGTGTATCTCGGATAGAACAA
2203	83	24	MW2_CDS_07668	MW1447	FALSE	unmapped	GTGAAGGACGTGTATTGACGCCTCATGAAGTAAAAGTGATGCGTCATTTAGCAGAACATG
2204	83	22	MW2_CDS_12213	MW2312	FALSE	unmapped	TGATGATGAAACATTATGCTGTATTGCTAAAACATATGAAGATGATACGCGTTTCAAAGA
2205	83	20	MW2_CDS_12288	MW2325	FALSE	unmapped	CGCAGTTTGCGAGTACTCACGTAGATGGACTTATCAATTTAATGGGAGCCATTGCTTTTA
2206	83	18	MW2_CDS_10633	MW2006	FALSE	unmapped	TCCAGAACTGATTACAAAACTTATCGAGCTTGCTAAAGAACGTCACCAGGATAAACAGAA
2207	83	16	MW2_CDS_10390	MW1963	FALSE	unmapped	GGCAGTGAAATTCGTAAGCATGACCCAGTTGGTAACATTATTTTCGTTACGAGTCACAGT
2208	83	14	ETG10_195139		pos		
2209	83	12	MW2_CDS_12014	MW2276	FALSE	unmapped	CTGGCGTATGGTCTTTGTCATTCTGACTATCTTTGGCTTCGTCATGGTCATAGGTTCTTT
2210	83	10	MW2_CDS_05937	MW1104	FALSE	unmapped	ACGAAGGCTATATTCATCAAGTGTTTGAGCGGAAAAATGAGTTGAAAAGACCACCTGTAA
2211	83	8	MW2_CDS_06250	MW1160	FALSE	unmapped	ACATGTACAGAGTATCAAATGAGCAATGGATCGATACTAAGTGCGATAAAAGAACAAAGT
2212	83	6	MW2_CDS_05041	MW0933	FALSE	unmapped	TGCCAATGTTCCAGCTCAAATAGCATGTATAACAGCACTTAACGAAGGATTAGAAGCTCC
2213	83	4	MW2_CDS_11499	MW2180	FALSE	unmapped	AGTATACGATGATGAAGTATGCACGTGAACATGGTGCAACAACTTACGATTTCGGTGGTA
2214	83	2	MW2_CDS_01087	MW0200	FALSE	unmapped	TGCAAAAGGTAAATATTACGCAGGTCTAAGCTACGAACAAGATGCACGCACATGGAAAAA
2215	83	163	MW2_CDS_11048	MW2089	FALSE	unmapped	ACAAAGCAAGAAGTTTCACCACAAACAGTTAAAGTAACAGGTGGAGAAGAACAATTGAAT
2216	83	161	MW2_CDS_10403	MW1965	FALSE	unmapped	TCCTCGTGTATTAAATGTAGAAAATGGTCAACTTAAGCAGCGTCCATATCCAGCGTTGGA
2217	83	159	MW2_CDS_02569	MW0475	FALSE	unmapped	ACAATTAGAAGAAATCGAGGGCTTAATATTACCTGGTGGCGAGTCTACAACGTTACGTCG
2218	83	157	MW2_CDS_12147	MW2299	FALSE	unmapped	TCAGCATATATTGCTTTCTTCAAGGTTAAAGCAATCGCATTAGGAACTGCTGGATTGCCA
2219	83	155	MW2_CDS_03396	MW0623	FALSE	unmapped	TGACGATAAACATACCTTTTTCAAAGAAATAATACGTGTACAAAGTGTTTTAGGTGGCGT
2220	83	153	MW2_CDS_01392	MW0255	FALSE	unmapped	GGATTAAACCGTTCAGGTGCATTTAACTTAGAACCGATTCATTTATACGATACGGGCAGT
2221	83	151	MW2_CDS_05866	MW1091	FALSE	unmapped	CACCAAGTGATACGACAATCAAGGAAGCGGCTATGTTAGCAGGATACTTTTCAAAAGCTG
2222	83	149	MW2_CDS_04948	MW0914	FALSE	unmapped	TTGATGCACGAGATAGTCGCCATTTGTCATTTATAGAGGCGCCAATCATTGTGAATGTTC
2223	83	147	MW2_CDS_00712	MW0132	FALSE	unmapped	AGATGCAATGGGAAGAGGAACCGAAGCAACAAGTGGTTTAAATGTTCTTTTTGTAATGCT
2224	83	145	MW2_CDS_03846	MW0703	FALSE	unmapped	ATGAACGCGATATGGACGGTTATTATTTGATTGTCCAACAAGAACGCGATTTGTCAGATT
2225	83	143	MW2_CDS_08460	MW1591	FALSE	unmapped	GCTGGCAGCTTAACAGGTCCACTAAGGGATCGATTTGGTGTGCACTTAAGATTAGAATAT
2226	83	141	MW2_CDS_09035	MW1695	FALSE	unmapped	TAAGACTGACGAAAGTATTGAAAAAGGTAAATTTGATGATGAAGGTGGCGCCGCACCAAA
2227	83	139	MW2_CDS_01387	MW0254	FALSE	unmapped	ACCGATTACCATTCAAGATTTAGACCAAACCACTGCATCAAAATCATTCGTCAATAAAAT
2228	83	137	MW2_CDS_04788	MW0883	FALSE	unmapped	ACAGCAACAACAACTTGTAACGATGGAAGAATTACTTACTATTTATGAATGGCCAGAAAA
2229	83	135	MW2_CDS_00978	MW0182	FALSE	unmapped	CCTGTACTTGTCATTGGAACAAGTATTGCTGCTTCTATCACGCGTATGACAAGGTCTTCT
2230	83	133	MW2_CDS_05665	MW1052	FALSE	unmapped	ACTTTTACGGATGGCTTGTATTGGAGAATAGGTGCTTGTATTGTCGGTGCGATTTTTGTT
2231	83	131	MW2_CDS_11215	MW2118	FALSE	unmapped	CCAGAATACGGTTTACCAGCATCTGATGCACGTAACAAAGATTGTGGATTATTGCTAGCT
2232	83	129	MW2_CDS_07613	MW1436	FALSE	unmapped	TCCCGATACGAAAACGGTAGCAGAAAAATACCTATGGAGGATATAGCTGAAATTGCCAAT
2233	83	127	MW2_CDS_08425	MW1585	FALSE	unmapped	TGGATTTAAAGCAATACGTATCAGAAGTTCAAGATTGGCCGAAACCAGGTGTTAGTTTCA
2234	83	125	MW2_CDS_09791	MW1838	FALSE	unmapped	ATTAAACCAGATGTTGTAATGGTTGATCCGCCAAGAAAGGGCTGTGACGAAACGTTTATT
2235	83	123	(+)E1A_r60_a22		pos		
2236	83	121	MW2_CDS_03473	MW0636	FALSE	unmapped	ATGTATCTATGGCATTGCTAACAATATTAATTTTATGTGCCGACTTTTTAGCTAATAAAT
2237	83	119	MW2_CDS_06840	MW1277	FALSE	unmapped	TCGTCTTAGAAGATAAAGGTAAAGCAGCTGAAGAAGCTGGATATGTAGCAGCACCAGAGA
2238	83	117	MW2_CDS_05100	MW0943	FALSE	unmapped	GCGTTCCTTAGTTTCTTAGTTTGGGTTCACCATTTCTTCACAATGGGTAATGGTGCGTTA
2239	83	115	MW2_CDS_12239	MW2317	FALSE	unmapped	GTGATGGCGAATGCACTTGGTGAAGATAACAATCCATATGCCTATGTGATTCAAGCACTT
2240	83	113	MW2_CDS_00799	MW0148	FALSE	unmapped	ACATTTAGCAATTAGTTTATGGAGATTTGTAGCGGGCTTTGTTGTCGCATTGTTGGTTGC
2241	83	111	MW2_CDS_02986	MW0550	FALSE	unmapped	ACGGGGTAAAGATGGTGGTTATTTATCAAATGATCGTAGCGCTGATGTCTCTCTAGCAAC
2242	83	109	agr_tiling 122_F		FALSE	unmapped	ATTAATTGCTTCAATCTTTAATGTGTATTCATAATAGGTTTCAATTTCTTCTTGATTACG
2243	83	107	MW2_CDS_12794	MW2421	FALSE	unmapped	AACATCACGCTGATGTTGTTGAATATGAAGAGGATACAAATCCAGGTGGTGGTCAGGTTA
2244	83	105	MW2_CDS_03201	MW0589	FALSE	unmapped	AGATAGTTTGTTAAGAAGTATTAAGCATTATGAAGACTTAATATTGGAGGTGTCGCGATG
2245	83	103	NC_A_076		FALSE	unmapped	TATTGCATAGGACCGAAATCTTCAAACACTACGTGCTTTGGGCAGACTTCGCAAAAATAC
2246	83	101	MW2_CDS_08417	MW1584	FALSE	unmapped	TATAACTTTGCAAATGAAGATGATTTATTCGCAGCTGTAGGATTTGGCGGCGTGACATCC
2247	83	99	MW2_CDS_13168	MW2492	FALSE	unmapped	TCAGGCTTAGCATTACATTGGTTTAACACGAGTCAAGAGACAGCCGATGTGTTTATCGAT
2248	83	97	MW2_CDS_00538	MW0100	FALSE	unmapped	AAGTAGCGTTAGTAACTGGCGGAGCACAAGGGATTGGTTTTAAAATTGCAGAACGTTTAG
2249	83	95	MW2_CDS_09246	MW1735	FALSE	unmapped	ATCACGCACATTTCGCTTGTGCCACAAACTTTAAATTGGCTTATGCAACAAGGTTTACAT
2250	83	93	pMW2_050		FALSE	unmapped	AAAAGTGATAAGCCAAATGATAAGTTGATAAGTGAAACCGCCAAGAGTGTAATGAAGGAA
2251	83	91	MW2_CDS_12664	MW2395	FALSE	unmapped	TGAGCTTTTGAATTTAATAGAAAATACGATTCCAGAAGATCGAGATATTAACACGTTTGT
2252	83	89	agr_tiling 052_R		FALSE	unmapped	AATCGTATAATGACAGTGAGGAGAGTGGTGTAAAATTGAATTATTTTGATAATAAAATTG
2253	83	87	MW2_CDS_06338	MW1177	FALSE	unmapped	TCTAGGACCAGTTAAGGCAGCACCAGTACAGCATTTTGTAAATGTATTAAGTGCGGTCAT
2254	83	85	MW2_CDS_11620	MW2201	FALSE	unmapped	TTACAGGCCCGCTTACAGATTTAGCAAAAGCACTACAAAAAGATTCATCTATCGTTCAGT
2255	83	83	MW2_CDS_10614	MW2003	FALSE	unmapped	AAGTGCAAGACAAGAAGAACAAACAATTATTCAAGCTTTAGATAACGGTGCGAATGACTA
2256	83	81	NC_S_069		FALSE	unmapped	GTATCGTTCCAGATTTGTGGGGAGTTAGGGTTTACTTAATTAAAGGGGTCTGCCCTCAAT
2257	83	79	MW2_CDS_12543	MW2373	FALSE	unmapped	ACGCCAGGCAGACAACATCAATATATATATCATATTGGACAAGCTAAACGCAGTGAAACA
2258	83	77	MW2_CDS_01746	MW0318	FALSE	unmapped	CCGAATTGAGATTAGTGCCGCAGTTAATAATGAAAAAAGCCGAGCTATTCCTGAAAGGCT
2259	83	75	MW2_CDS_03110	MW0572	FALSE	unmapped	AGATGGCGAAATGCAGAAATTGCATTGAATCAAGTTAAAGAACACACGCATTTTAATCCA
2260	83	73	MW2_CDS_10785	MW2037	FALSE	unmapped	GTAGACATGGCACATATTGCAGGATTAGTAGCGGCAGGTTTACATCCAAATCCAGTAGAA
2261	83	71	MW2_CDS_06900	MW1287	FALSE	unmapped	ACGTTCACAATGGATGGAAATTGTTGAAGCACTTTTATCTGAAGGTTATCAGTTCGACCT
2262	83	69	MW2_CDS_03022	MW0556	FALSE	unmapped	GCACTTGGATTAGTTTATTTTTTCCTTTTATTAATTGGTTCATCCCCAAAAGATACGTCA
2263	83	67	MW2_CDS_10009	MW1879	FALSE	unmapped	GGTTCGTCAAAATATGTAGACTTAAAAACTGAGTATAAAGATGAAAGAGTATTTAAAGCA
2264	83	65	MW2_CDS_11093	MW2097	FALSE	unmapped	CAACAGGGTCGTATTATGGAAACGCCGAATGGTAATGGTGGCGTGTTTAAATCTTTAGAC
2265	83	63	MW2_CDS_07802	MW1470	FALSE	unmapped	ATCAGCGTTTGGAAAGAAAGACGATGTTAACTCTGGTGGAAAACAAATGCCATCACACTT
2266	83	61	MW2_CDS_06655	MW1243	FALSE	unmapped	CTTCAAGGTATCAAACGTGGTTTATTCTCTAACGAAGCTGGTATGGGTTCTGCGCCGAAT
2267	83	59	MW2_CDS_07560	MW1422	FALSE	unmapped	CATCGAACAAGTTACGGCACAGTATCCACCACAATTAGCATTCGCAATAGGTAATGCAAT
2268	83	57	psma_tiling_085_F		FALSE	unmapped	AAATGTAATTTAATATATCTCATTGGCATAACTGGTGCTAAAAACAACAAGCCACTTATC
2269	83	55	MW2_CDS_12362	MW2341	FALSE	unmapped	AAGCAGAATCACCAAAAGTTGAAGTCCCTCAAATCCAATCACCAAAAGTTGAGGTTCCTC
2270	83	53	MW2_CDS_03061	MW0562	FALSE	unmapped	AGTATATTTTGTTTGGATTGCAGTTATAATGGGTTTTTTTCTAGTTAATATAGCTTTAAT
2271	83	51	MW2_CDS_13000	MW2460	FALSE	unmapped	TGACGGTGCATTCCAAATGGTAATGCAAGACTTCGCTACAGCAGTACAATATGATTTACC
2272	83	49	MW2_CDS_11734	MW2224	FALSE	unmapped	TTGCCAACTATGGCGCTGGTTTTAATAATATTGATATCGAGTATGCCCGAGAAAAAAGTA
2273	83	47	agr_tiling 210_R		FALSE	unmapped	TATTTAAAATGCTTGTTCAACCTCTTGTAATGTTGGCAAACTATTAATAGCACCATACTT
2274	83	45	MW2_CDS_05345	MW0989	FALSE	unmapped	ACTGTTTGTTATGTTTGGAATCATGCATGAAGCAAAAGATAAAGCAACACGTGCAAAAGT
2275	83	43	MW2_CDS_00677	MW0127	FALSE	unmapped	AGACGACATACGCATTACTTATACAGGGATTAGACCCGGCGAAAAAATGTTTGAAGAGCT
2276	83	41	MW2_CDS_00610	MW0113	FALSE	unmapped	CGGTCATCGTCGTGATAAACCAGGTTATGCACAAGCAATTAAAGATTTCGATGATCGCTT
2277	83	39	MW2_CDS_03204	MW0589	FALSE	unmapped	GGGTAGCTATTAAATTTTTAGGTGTTTATTTATATCAATTAATAACATCTAGCATTAGCA
2278	83	37	MW2_CDS_09660	MW1813	FALSE	unmapped	TGCGGAAAGTTTAAAAAATACAATGATTCGCACGACAGATAAAGGACCTAAAATTTATCA
2279	83	35	MW2_CDS_02655	MW0490	FALSE	unmapped	TTTCTTTAAAGGCGTTAAGTCTGAAATGGAAAAAACAAGTTGGCCGACGAAAGAAGAGCT
2280	83	33	MW2_CDS_05385	MW0998	FALSE	unmapped	TAATCGGAGCTGCTGCTGTTATTTGGCAACAAAACGATTACGTTTTAGCATTGCACTTTG
2281	83	31	MW2_CDS_05555	MW1030	FALSE	unmapped	GTTGTGTTCCACTTTGCAAATGGCTTATGGTCATTCTTAGTTACTTGGGGTGGACTTCAA
2282	83	29	MW2_CDS_02590	MW0478	FALSE	unmapped	AAGTTAAAGTTACAAGTAAAAATAAAACAGAAGAAAAAATGGTGTGTCAAACTTGTGCTG
2283	83	27	MW2_CDS_00721	MW0134	FALSE	unmapped	GTTCAGTGAAGAATTAGTCAATATATTATTAGGACATAGCTGGGTTGACGCAATTACAGT
2284	83	25	MW2_CDS_01461	MW0269	FALSE	unmapped	AAATTTGGGGTTATACCAGAAATGGAATATGAAATGGAGGAGGTTAAACAAATCGAGCAA
2285	83	23	MW2_CDS_03120	MW0573	FALSE	unmapped	CGACGGAAGCTAAGACAAGATCAGATTATATGGATATCATCAAAAAAAGAGGTGGATTCA
2286	83	21	MW2_CDS_11890	MW2253	FALSE	unmapped	TGTATGATTTAAGCGTTACATCAGAACCAAGGATAAAAATTGGGACTCTTGAATCTACGA
2287	83	19	MW2_CDS_13536	MW2560	FALSE	unmapped	ATCAACCATCTTCACAGTCAAATGTTCCTAACAACCATTCAACAGCACCATCGAATACGC
2288	83	17	MW2_CDS_05564	MW1031	FALSE	unmapped	TATGAAAAATTCACTGGTGATGACCCACGCAAAGTACCAATGAAGATTTTCCCAGCTGTT
2289	83	15	MW2_CDS_06625	MW1238	FALSE	unmapped	CGGTTGGATCGTTATTTCCCAGATTGGCATGAAGCTTATAGTAAAGTGCAAACGCTCAAT
2290	83	13	MW2_CDS_13187	MW2496	FALSE	unmapped	TCGTAAACTTTCAGACATAGGACATCCGCATTTATCAATCGTTGAAGGTGATCTGAGTGA
2291	83	11	MW2_CDS_12704	MW2403	FALSE	unmapped	AATTGCACAACAAACATTCGGTGGTTTGGATATTGTTATCAATAGTGCGGGGCAAATGTT
2292	83	9	MW2_CDS_08371	MW1574	FALSE	unmapped	GAGTTTTATGGATAAAGCTAAAGACGCAGTAGAAAAATTTAAAAATAGCGATAATGAACA
2293	83	7	MW2_CDS_01570	MW0287	FALSE	unmapped	CAATTGTGATTTATGGTGTAGTAATGGCGATTGTAGGTGCGCTTGCAGGTTATCTTGGTT
2294	83	5	agr_tiling 019_R		FALSE	unmapped	CACGACCATACTTATTATTAAGGGAATGTTTTACAGTTATTTTTTCAATCTATTTTTGGG
2295	83	3	MW2_CDS_11324	MW2141	FALSE	unmapped	AGGTCAGTGGACATCTATTGTTGGTCATAACGGTTCTGGAAAATCTACAATTGCCAAGTT
2296	83	1	MW2_CDS_03197	MW0588	FALSE	unmapped	GAGTTGCGTTTATTATAATGATTTTTGCTATTGGCGGCGTGCCTCCATTTAGTGGCTTTC
2297	82	164	(+)eQC-39		pos		
2298	82	162	MW2_CDS_01644	MW0300	FALSE	unmapped	ACAAAGAGATGATTCAAGCACATCAAGCACGCATCATTGCAGGTACACAAGAAAAGGTTA
2299	82	160	psma_tiling_080_R		FALSE	unmapped	ACATAAGCAATTATGCGAGAGATTAGAAATAAGGAGGTTATGCAGTGTTAAGTTTTCAAT
2300	82	158	MW2_CDS_04512	MW0834	FALSE	unmapped	CTTGTTGATTTCCGTGGTATGGATACTTTATTCGAGTCATCTGTGCTTGGTATCGCAGGA
2301	82	156	MW2_CDS_00702	MW0131	FALSE	unmapped	ACAACAGACGATACATTCACCGCTACAGAAGCTAATAAATTCGGACTGGGTTTTAGTATT
2302	82	154	MW2_CDS_12309	MW2331	FALSE	unmapped	TTGTCAATTTAGCTTTCTTAGGTAAAGACTCAATTGTTGGTTCGCGTGCGAGTCATGCAG
2303	82	152	MW2_CDS_02722	MW0503	FALSE	unmapped	CGAAGGTGGACGTCACACTCCATTCTTCTCAAACTATCGTCCACAATTCTATTTCCGTAC
2304	82	150	MW2_CDS_08809	MW1655	FALSE	unmapped	AATTCCTTTCGATGTGTATCCTCAAGATGCCATCATGCCACTACCATTAGAAGAAGCAGA
2305	82	148	(+)E1A_r60_3		pos		
2306	82	146	MW2_CDS_06482	MW1209	FALSE	unmapped	AATTATTTGCAGATAATCGTTTTGATGCTTGGAAAAAGGCAAATGAAAAAGGCTGGATCT
2307	82	144	MW2_CDS_08333	MW1567	FALSE	unmapped	TGGAAAACTTTGATAAAACAATGAAATTCGACTATGAAGAACTTCCAACGCAAGATGTAA
2308	82	142	MW2_CDS_07713	MW1454	FALSE	unmapped	TGAAACAAGAAGGAATTATACGTGCTTACGGTATTTCTTCTATTCGCCCAAATGTAATTG
2309	82	140	agr_tiling 107_R		FALSE	unmapped	ATAGTTCTACCAATCTTTTTGGTAGTGTATGTATCAATTTCTTATGCACTTGCCTACATT
2310	82	138	MW2_CDS_00349	MW0067	FALSE	unmapped	AGTATCAGCGTTACTTTTTTGGCTTGTCATACTTACCTTTGGTATTGCAGGTATCATTTT
2311	82	136	(+)E1A_r60_a97		pos		
2312	82	134	MW2_CDS_05917	MW1100	FALSE	unmapped	CGTTTCAATTCAAGATAAAAGCTCAATGTTTGTTGCACACATTATGAATGTAGACCGACA
2313	82	132	perR_tiling_093_R		FALSE	unmapped	AAATGATTTTTTTAACTGATATACGCCAGTTTCTTTAGCTAATTTAAAATCTTCATCTAC
2314	82	130	MW2_CDS_07276	MW1359	FALSE	unmapped	TCTGAGTTACCAGATGGACATCCGAAATCACTACTTTTAAGTTTGACGAAAAAAATGGGT
2315	82	128	MW2_CDS_05271	MW0976	FALSE	unmapped	AAAAATGCAGTTGCAATCACTTACACTGGTGACGGTGGTTCTTCACAAGGTGATTTCTAC
2316	82	126	MW2_CDS_06600	MW1233	FALSE	unmapped	ATTAGCTCGTTATCAGGTGGAGAAACTTTCCAATCGTCGCTTGCATTAGCTTTAGGGTTA
2317	82	124	MW2_CDS_07643	MW1443	FALSE	unmapped	AGGCAAATGGGAGCCTTTTCTTAATGATTTAAAAGCAGTGTCACCAATTTTAGATAACCA
2318	82	122	MW2_CDS_07391	MW1380	FALSE	unmapped	ATCACAGGGGTATGACATTGTTCTAGAGATTCATTTAGACGCAGCAGGAGAAAGTGCAAG
2319	82	120	MW2_CDS_13582	MW2568	FALSE	unmapped	TGGAACAAGCGTTTGACTATGAGTTGTTGATTTTAGGTTATCGTCAAACCGCACACCATG
2320	82	118	MW2_CDS_01866	MW0340	FALSE	unmapped	AAATATTGATTGGTCTAAAGATTTTCAAGAATTCCAAGAGATACTTAATAGTGGCATTCA
2321	82	116	MW2_CDS_01249	MW0230	FALSE	unmapped	TTCCATTAGATAAAAAAGTGATTATGTACGCGCCAACTTGGCGTGACGATGAAGCGATTC
2322	82	114	MW2_CDS_06293	MW1168	FALSE	unmapped	TTATATTTATCGCAACCGGATCATGGTGAACAAGGTCTTGAAATCGCCGAAGCATTTGTT
2323	82	112	MW2_CDS_11611	MW2200	FALSE	unmapped	AGTGTTATCGTCTTTTTATTATTAGTAGTTGCTGGCTTGCCACTGTTATCAGGCGGTCGC
2324	82	110	(+)E1A_r60_3		pos		
2325	82	108	MW2_CDS_10211	MW1925	FALSE	unmapped	ACAAAACGAACAATAAGCTTGTACAGATACATGAAATCAATCCGGACAGCCACGAACGAA
2326	82	106	MW2_CDS_09506	MW1786	FALSE	unmapped	AAGTATTCCAAGAAATCAACCAAATTATCGTTAAACCATTAGACGAAATTTACGCTGACT
2327	82	104	perR_tiling_111_R		FALSE	unmapped	TTATGATACGATATTAGATGAAAATATTAAATTAAAAGAGGTTGATATAAATGAATTTTA
2328	82	102	MW2_CDS_11264	MW2128	FALSE	unmapped	AGTGAAAAATTTGCGAAATGCAGGCGTCAGTATTGAATCGCTTATCGAATTTTGCAGGTT
2329	82	100	MW2_CDS_10748	MW2030	FALSE	unmapped	TCCAGATTTAATTGGTGGATTTAGAGTTAAAGTCGGCACAACTGTATTAGATGGTAGTGT
2330	82	98	MW2_CDS_03923	MW0716	FALSE	unmapped	TCAATGGTGAAAGATCATCGTACGAACGAAGAAACAGGTAAGGTTGATGCAGTGATGGAT
2331	82	96	pMW2_067		FALSE	unmapped	TTAACCCACTGTTAAAAGAAAAAGTATCTTATGCCAAAGTTCCAAAAGATACCCAGGACT
2332	82	94	MW2_CDS_08323	MW1565	FALSE	unmapped	AAGACGATATGATTGAGCTTGTACCAATGATCAATGAACCAGATGAGTCAGGTGACGGTG
2333	82	92	MW2_CDS_08941	MW1678	FALSE	unmapped	TATTCTATCCATGAAACCGGAAAATTTCTTTTCCCAGGCTCTGGTCACTATACTGAGCGC
2334	82	90	MW2_CDS_07159	MW1338	FALSE	unmapped	AATCAGCAGAGGTGTATTTGATTTAAATGATTTTATTAGATTAAAAGTATTTTCATCGTA
2335	82	88	MW2_CDS_08772	MW1649	FALSE	unmapped	TAAATTAGCTGGCGAAGGTACAGTCGTAACAGTTTTAAACGCAATCAGCGAACAAGATGC
2336	82	86	MW2_CDS_10455	MW1974	FALSE	unmapped	TGGTTATTTAGGTTTATGGATTGTTATCGATCAAGCTCAAATTACAACAGTTGCAATCGA
2337	82	84	MW2_CDS_03920	MW0716	FALSE	unmapped	GCTGAAAAAGGTGTACACCGACTAGTACGAATTTCTCCATTTGATTCATCAGGACGTCGT
2338	82	82	MW2_CDS_06004	MW1116	FALSE	unmapped	AGGCGTGGTAGATTTTAAAACACAATTCCAAGAATATGTGCACCAGCAAAATAAAGGTGA
2339	82	80	NC_A_096		FALSE	unmapped	TTCTTGTTATCGCCATATACAGACTTTAATTCTCGTCATTATTAAAGTTCTGTATTGGCG
2340	82	78	MW2_CDS_13488	MW2552	FALSE	unmapped	TTTTAACTATTCAACTCATGAGTGATATGGCTGGGATTTCCCGGGAAACAGCTGGTCATA
2341	82	76	MW2_CDS_06155	MW1143	FALSE	unmapped	TGGTGGCAGAGCAGAACTTGTTCATAGTATTAAAAATATGTTTGACGAGCTTCATCAACA
2342	82	74	MW2_CDS_05764	MW1072	FALSE	unmapped	TGATTTTTTAAGCGGTACTGTTTATGCAATCGGTGGAGATATCCAACGTGTAGGTACTGA
2343	82	72	MW2_CDS_09309	MW1749	FALSE	unmapped	GGAATATGGAAGAGGAACTGGGGCATATGGCGATTTTGGCAGATATGTATTTGGTTATGC
2344	82	70	MW2_CDS_05029	MW0931	FALSE	unmapped	ATGCGTACATTATACCCTGAAGTAAGTGAGCAAGACCTTCCTAATTGCTCAACATTCCCT
2345	82	68	MW2_CDS_01083	MW0199	FALSE	unmapped	TGATTCAATATGGTTCACATGCACGACTCCATATTTTTTCAAAGCGTAATCAAGGTACGT
2346	82	66	MW2_CDS_07766	MW1464	FALSE	unmapped	TTGGAGAGAAGGTTGCATTATCCGTGCACAATTCTTACAAAAGATCAAAGATGCTTACGA
2347	82	64	MW2_CDS_02984	MW0549	FALSE	unmapped	AGATCCACCATTATCACGTGTTGGATTAACTAGTAAAGAAGCTGCCGCTCAACATTATGA
2348	82	62	MW2_CDS_03454	MW0633	FALSE	unmapped	ATATCATTGTCGCAGATGACAATTATAAATGGTTGCAAATACTACCTGAAAAGAAACGTT
2349	82	60	MW2_CDS_01650	MW0301	FALSE	unmapped	TGAGCGAAATACAAAAGCGGAAGAAGAACCGACAATTTTAAACTCTGAAAAACCAGAAGA
2350	82	58	MW2_CDS_01974	MW0363	FALSE	unmapped	ACTGTAGTAAATGACACTGGCGAATTATACAACGTAATCAATCAAAAGAAATCTGAAGGT
2351	82	56	MW2_CDS_04126	MW0755	FALSE	unmapped	AGAAAGCTTATATCACTTGAACATGAACCATGTGATCACGAATGAGAACGATATGCTGGT
2352	82	54	MW2_CDS_08917	MW1674	FALSE	unmapped	ACAGTATCCACCAGCAGATGAATCACTACAAGATGCAATTAAAAACCCGGCTATCATCGA
2353	82	52	MW2_CDS_07222	MW1350	FALSE	unmapped	TGTTACGTTACCAGTTGAGTTTGATGCGAGTTCAAGAGCGATGAAACAAATTACGGCATT
2354	82	50	MW2_CDS_08394	MW1580	FALSE	unmapped	TTGGCACTGCGCCAGAAGAAGCTGAGGCAAATGCTTATGACATAGTATTAAATGGTTATG
2355	82	48	MW2_CDS_07036	MW1314	FALSE	unmapped	AGGCTGCTGAGTTTAAAAAGCAACAATTAAATGAACAAGGTATTTTCAAGAAACCAGTGA
2356	82	46	(+)E1A_r60_a104		pos		
2357	82	44	MW2_CDS_10399	MW1964	FALSE	unmapped	TGGTGTAGATGTATCAAAAGTGTATCGCACGAATGAAGCAAACACTGCGTTAGCTTTTGT
2358	82	42	MW2_CDS_06428	MW1195	FALSE	unmapped	CCAGAATATAATATCGCAGTAAGTTGGCAACGTTTAAGAGAAGGAAAAACAATAAAAAGC
2359	82	40	MW2_CDS_01590	MW0291	FALSE	unmapped	TAGCGAGCGACACGAAGTTAACTTTGCACGTTTCATTATCATCATTGCAGGTATTTTCGG
2360	82	38	MW2_CDS_06147	MW1142	FALSE	unmapped	TAATAGCGGCTAACTTAGGTGTCAACCCAACAAGTGATGGTGAAGTGATACGTATTGCAG
2361	82	36	MW2_CDS_10052	MW1889	FALSE	unmapped	TGAAAAAGATTTGCGAAAAAAGTCTGAATTGCAGGGAACAGCTTTAGGCAATCTTAAACA
2362	82	34	MW2_CDS_08474	MW1594	FALSE	unmapped	TGTTTAAAGAAGAAATTGGCGAAGATGTGCCAGTTATTCCAGTTTCAACAATAACGCGTG
2363	82	32	perR_tiling_020_R		FALSE	unmapped	TGTATTAAAGTCGAATCGACTTGATGAGTCTCCATATGTTAATTCTTTTACAATTCCAAT
2364	82	30	MW2_CDS_01943	MW0357	FALSE	unmapped	TGGTGACCCATCACAAACAATCACTCGTAATTTTGATGTATTAGATGAAGCTACTGGTTT
2365	82	28	MW2_CDS_03245	MW0597	FALSE	unmapped	CACAATCTAGACATCTAGCAGGCCAATGGCTTACAACGATTGGTGGTTATTTAATGCCAC
2366	82	26	MW2_CDS_13644	MW2578	FALSE	unmapped	ATTTTGCGTTACGCAACGAATTTAAAACTTGCGAAAGAGCTATACCAAGCCAGTAAACCT
2367	82	24	MW2_CDS_03440	MW0631	FALSE	unmapped	AGGTTGGTGCTTGAACGCGCTAAGACATATTCAGTGCCGAATCATATTATTGAAAAAGCA
2368	82	22	MW2_CDS_13760	MW2598	FALSE	unmapped	AAAAATCACAATTAATAGAGCAATTTATTCGCTCTTTGGAGGTGTCTATTGCCAATGCTT
2369	82	20	MW2_CDS_11835	MW2244	FALSE	unmapped	ATTTATGCACCAATTGAAGTTGGACCAGTAGTAGTCAATCACGGCTTGAAAGCTGAATGG
2370	82	18	MW2_CDS_12279	MW2324	FALSE	unmapped	CGAACATGAAAATGATGATGGCGATTTAGGTGTGATCATGCGCAAAGTATTGATACCCGA
2371	82	16	MW2_CDS_08173	MW1538	FALSE	unmapped	ACTAAAACTCTAAAAAAGCATGCAAGGCTTAAAAAAATAGAGCAAATGTCTGAAGAAGAA
2372	82	14	MW2_CDS_05706	MW1062	FALSE	unmapped	CAAGAAGAAAAGGCGGACATCCTGCAAAACGAGTATTTCAAGCACTACGAATTGCAGTAA
2373	82	12	MW2_CDS_08983	MW1685	FALSE	unmapped	ACAATCCTAAATATGTAGGAGATGTCGCATTTTTACAAATTGAACCAGTTGAAGGTGAAT
2374	82	10	MW2_CDS_08079	MW1521	FALSE	unmapped	AGTTCTCACTGTTGAAGCTTTAAACACTGCTATTGAATATGTTGTCGATTTAGTGACCGT
2375	82	8	MW2_CDS_05858	MW1089	FALSE	unmapped	AGACCATAATGATGATTTATTTAAACATGTAAAGGATATATTACGTAAACAAGGACAAAT
2376	82	6	MW2_CDS_01128	MW0207	FALSE	unmapped	GTGCCTATGAAGCACAACGTGATGGTCGGTTCAACGATGAAATTATCCCAATACAAGTAA
2377	82	4	perR_tiling_051_F		FALSE	unmapped	TGAAAGATGAAGCACTTTTTATAAATATAGGACGAGGTAGCATAGTTAAAGAAGCGCTCT
2378	82	2	MW2_CDS_06713	MW1254	FALSE	unmapped	CCTGAAAAAGAACTGAATGAAACGAAATTGAAAGCTAAAAGCTTATTGGAGGTGAGCCCA
2379	82	163	MW2_CDS_05004	MW0926	FALSE	unmapped	GGCGCCACTGAAGGATGATTCGTATATTAGTTTAATTGATAATTTACATCCAACACCTGC
2380	82	161	MW2_CDS_09808	MW1841	FALSE	unmapped	AGTTGGTCCAACAGCGCCTACAACTGCGTTTAATTTAGGTGAAGAAATTGATGATCCATT
2381	82	159	MW2_CDS_13600	MW2571	FALSE	unmapped	ATTTTGCGTAGAGGACAGCATTATAAATTGCATTTTGATTTTGATGCAACGCCTGCTGGT
2382	82	157	MW2_CDS_02079	MW0384	FALSE	unmapped	TTCACGCGATGTTTCAGAATACATGATTACTAAGGAAGAGATTTCCTTGAAAGAGCTTGA
2383	82	155	MW2_CDS_05826	MW1083	FALSE	unmapped	TTTGAAGGCTTGAATGTATTGATTTGTGGAGACATTAAAAATTCACGTGTCGCACGTAGT
2384	82	153	MW2_CDS_13569	MW2566	FALSE	unmapped	CACCACTAGAAGATGAGCCGATTATTTCTAAGCGACGCTTTAGCGCATTTACAGGTAGTT
2385	82	151	MW2_CDS_05591	MW1036	FALSE	unmapped	TGTTGATGACCCTATAAGGTTGAATCATGTTGATTATTTGGTTAAAAGTGTATTATTAAA
2386	82	149	MW2_CDS_03569	MW0655	FALSE	unmapped	ATGGTTGTCATGCAAGCAGCAATTCTATTATTTGGAAAAGGAGTGCGTTTGAACAAGTGA
2387	82	147	NA		ignore		
2388	82	145	MW2_CDS_08409	MW1582	FALSE	unmapped	AAGGCGATGCCTATTTGAGTATACATAATGATGCATTAGAATCATCTAATGCAAATGGAA
2389	82	143	MW2_CDS_11108	MW2100	FALSE	unmapped	AAATAAAATTCCTGATGAGTATGCTAAGGAGGTACCTGAAAGTGCGCGTACTGAGGCATT
2390	82	141	MW2_CDS_12199	MW2308	FALSE	unmapped	TGCATTATTTACCATGCGTCATTTATACCAAAAAGAATATGGCTCATTGAAAAACGGTTG
2391	82	139	MW2_CDS_11771	MW2231	FALSE	unmapped	TGAATCTAAAAATGACGACTTTAGATGGTAAGGCAATTGATCATTTAAAGGGTGCACCTT
2392	82	137	MW2_CDS_12520	MW2369	FALSE	unmapped	ATATTAAGGATGCTGGCAAAGGTATGGGAATGACACGCAATCAAGTGCTACGAATGATTG
2393	82	135	MW2_CDS_10643	MW2009	FALSE	unmapped	ACGATTTACACAGCGGGAATTGAAACAGAAGAACAAGTAAGTCAATTGACAGAACGCATT
2394	82	133	NC_S_016		FALSE	unmapped	TACAAACGAAGGTAAAAATTTGACTCCCTTTAGTAGTGGACCCGTACGTTAATCGTGCGG
2395	82	131	MW2_CDS_09156	MW1717	FALSE	unmapped	TCCTCTTTTTTATTCACTCGATTAAATTTTTACCTTATCGATTTATTCAGACAACAAAAT
2396	82	129	MW2_CDS_06543	MW1220	FALSE	unmapped	GCGTCAAATGTGCTTTATTTCTGGGACACATTTAAATTTTTCCACCCCATTACTTGGAGC
2397	82	127	MW2_CDS_06563	MW1225	FALSE	unmapped	AGTGATGCTATGGAAAATAGATTAAAAGAACAATATGGAGCACCTTCGAAATCGCTTGCA
2398	82	125	agr_tiling 086_F		FALSE	unmapped	TTCGTGTAATTGAGTTAATTCTTTTGGTACTTCAGCTTCGTCCAATAAAAAATCACAATT
2399	82	123	MW2_CDS_09494	MW1784	FALSE	unmapped	TGCAAGCACAAGTCAGTGATTTAAGTGCACAAATCAATCACATGGAAACTGATACAACGC
2400	82	121	MW2_CDS_11650	MW2208	FALSE	unmapped	TTAACTCTGCCGTAAATGGCGATGCAAATGGTTCTATACCTACATCTGAACCGATGAAGT
2401	82	119	MW2_CDS_10791	MW2038	FALSE	unmapped	ATACGCTTTTCAGCATATGAAGGATCCGATCGTGGTCGAACATATTACTGTTCCTTGTGG
2402	82	117	MW2_CDS_05629	MW1046	FALSE	unmapped	GGAGTTCCATATCAAACAGTACAAGATTTAAGAAATGGGAAAACCAAACTAGAAGATGCT
2403	82	115	MW2_CDS_07030	MW1313	FALSE	unmapped	AGTTTCATTCTGAATGTGGATGGCCTAGCTTTTCCAAAGCGCTTGATGACGATGAAATTA
2404	82	113	MW2_CDS_03135	MW0576	FALSE	unmapped	TGTCGTAGTACCGACAAAAATTATTGCAGGAGAATTCGGTGAAAGAACAACAAGATTGGA
2405	82	111	MW2_CDS_01661	MW0303	FALSE	unmapped	CAACCTGTAGGTCAGTCTTACCTCGCTTTAAAATCCTTGGTGGAAGGTAAACAGTACCAC
2406	82	109	MW2_CDS_07145	MW1335	FALSE	unmapped	TCAAAAAATGGCCGATATGAATAATGAAGTTGTAAAATTATCAGAAGAGAATCATAAACT
2407	82	107	MW2_CDS_13826	MW2610	FALSE	unmapped	TTTAGTAACAGGGTTTGCGCCTTTTGACAATCAAAATATCAATCCCTCATGGGAAGCTGT
2408	82	105	MW2_CDS_06094	MW1133	FALSE	unmapped	AAGATGTTGAACGTGCTGAAGAAGAGATGGAAAAGATTGAAATCAAAGATGAGCCAGCCG
2409	82	103	MW2_CDS_00423	MW0080	FALSE	unmapped	TACAAAAGCCATAACGAAGGCTGACGTTGAGCGTTTAGCAGTTATGTTTGATGTCAATCG
2410	82	101	MW2_CDS_11297	MW2136	FALSE	unmapped	AGTAGCACGTGTACGTTTAGTACCAGGTGAAGGTAACATCACAGTTAATAACCGTGACGT
2411	82	99	MW2_CDS_06863	MW1281	FALSE	unmapped	ATGATGGAAATGAGCGCTTTAGGTGCTGGTGTACTTGAAACAAGAAGTGTTGAATTAGCT
2412	82	97	MW2_CDS_00646	MW0119	FALSE	unmapped	AGAAAAAAGTGACGCAGATGTTGCCTGTACAGCTTTGTTTGATTCTGCTAGTGGTTTCAA
2413	82	95	MW2_CDS_12446	MW2357	FALSE	unmapped	GGCGATCCTGAAGAACACCCGGAACGATACTATAACGGTAGAGATTATCGAAGAGAACAA
2414	82	93	MW2_CDS_02619	MW0483	FALSE	unmapped	CAAACACGCCTAAACAAATTATGATTTATGAAGCATTTGGCTGGGAGCCACCTCGTTTTG
2415	82	91	MW2_CDS_09575	MW1798	FALSE	unmapped	CCAGTCGAAATATTTGAACAACCGCAACATGAAAGAACACAAAATTTCTTAGCAAGAGTA
2416	82	89	MW2_CDS_02252	MW0416	FALSE	unmapped	CAGACTGAGCCAAGTACATCATTGATTCGTCGATTGAATGACGAACAAGTTGGCGATTTT
2417	82	87	MW2_CDS_11315	MW2140	FALSE	unmapped	TGATATTATCGTGGTTGATGAACCCACAGCAGGACTTGATCCACAAAGTAAACGACAAGT
2418	82	85	(+)E1A_r60_a107		pos		
2419	82	83	MW2_CDS_10372	MW1958	FALSE	unmapped	TGAAGCTCAAATAACGCAATGGTTCGAAAAAAATATGAATGCTGAAGTAGATGTAGTCGT
2420	82	81	MW2_CDS_02927	MW0539	FALSE	unmapped	AATGGGAAACTATACACCATTGCGGGCTGGGACGTTTATATTACGGAAATCATTATTGCG
2421	82	79	MW2_CDS_04820	MW0889	FALSE	unmapped	AGATTCTTTGTATGATGGTTTTCATGACAAAATTCATGGTCAAGTACTGCAATGTACGCA
2422	82	77	(+)E1A_r60_n11		pos		
2423	82	75	MW2_CDS_08823	MW1657	FALSE	unmapped	GTATTTTTGGCATCTGCATGTGGCGCATATATTGCAACGATGGTTCCGTCACAAATATTG
2424	82	73	MW2_CDS_07516	MW1407	FALSE	unmapped	GCAACACCTACGATTACTTTTTACACTCACGTGTTGCATCACTCAAAAAATGATGCAACA
2425	82	71	MW2_CDS_01595	MW0292	FALSE	unmapped	TGGAAAATATGCCACAGAACTCGGTTATGATGCACTTTCTGCCGTAACACCATTCTACTA
2426	82	69	MW2_CDS_13081	MW2476	FALSE	unmapped	GCTTAGCGGTTGGAAACCCTTGTAAAGTCGTTCGTAAAATTGATAATGACCTACCATCCG
2427	82	67	MW2_CDS_02567	MW0474	FALSE	unmapped	AGGTGCTGCTATGTTACGTACTAAAGGTGAACCAGGTACAGGTAATATTGTTGAAGCTGT
2428	82	65	MW2_CDS_03834	MW0701	FALSE	unmapped	TGCTTTGCAATTCCATACAAAAAAGCACCAAATATTGCAACATAGCTTAACAATTAGACA
2429	82	63	MW2_CDS_04442	MW0820	FALSE	unmapped	GGTATCGTTGGGTCATTAGGAGATAAGCAAGGTTTTGCATATATCATGGACCGCACTGTA
2430	82	61	MW2_CDS_10600	MW2001	FALSE	unmapped	TAGGACCAATGGTATTAATGATGCTAAATGTTGTATTTGGTGGCGAAGGCGTAGGACTCA
2431	82	59	MW2_CDS_13024	MW2465	FALSE	unmapped	TACAACTTTTATCGCCCATTAAAATACAATACACGTGTACTAAGCAAAAAGGCAGCACGT
2432	82	57	MW2_CDS_05993	MW1114	FALSE	unmapped	AGCTGAAGCAGTAGTCGAAGAAATCAAAGCTAAAGGTGTTGACAGTTTTGCGATTCAAGC
2433	82	55	MW2_CDS_12548	MW2374	FALSE	unmapped	CCGTCGCGCAACACGAATCAATACGAAGATGCGTGAGTCACTAAATAATGAATCAAAGTC
2434	82	53	MW2_CDS_04880	MW0899	FALSE	unmapped	CAAATGATGACCCGAAAATGTTAACGGCAGAATTAGCCAAAGGTGCAACACATCAAAACT
2435	82	51	agr_tiling 110_F		FALSE	unmapped	AAGGAATTTTTTATTAAGAGAAAGGTATGTACCATTTATCCTTTTTAATATTCTATTTAA
2436	82	49	MW2_CDS_12054	MW2283	FALSE	unmapped	ACCATTACAACGCAGCTGAGCGGATTAACAACTGAATTGTTGCTCTTATCCGAATTAGAT
2437	82	47	MW2_CDS_07931	MW1494	FALSE	unmapped	CTTAAGAAAACTCAAGCGTTTACATTGATAGAGATGCTATTAGTGTTATTAATCATCAGT
2438	82	45	MW2_CDS_03248	MW0597	FALSE	unmapped	GATTTAGTCATTGTAACAAGTCCACGAGAGCGACAACAGACATTACAACAAGGATTCGCA
2439	82	43	MW2_CDS_05045	MW0933	FALSE	unmapped	TGCTGAAAATACATTTAGTGGTAAACATGTATCCTTCGCTGAATTTGAAGACATTCGTGA
2440	82	41	(-)3xSLv1		neg		
2441	82	39	RC10		pos		
2442	82	37	MW2_CDS_13422	MW2539	FALSE	unmapped	TTATGGCAGAGCTTGAGGCGTTATATCCACCATCATACAGTTCGTATATCGACTTTTTAT
2443	82	35	MW2_CDS_06480	MW1209	FALSE	unmapped	AGAAATGCCAGGCATGACTGGACTTGAAGTTTTAGCGGAAATTAGAAAAAAGCATTTGAA
2444	82	33	RC3		pos		
2445	82	31	agr_tiling 157_R		FALSE	unmapped	ACGATCCAAAACAAAGAGAAAACATGGTTACCATTATTAAAAATTATATAATGATAGAAG
2446	82	29	MW2_CDS_02691	MW0497	FALSE	unmapped	ATTCAATCGCGAAGAAGGCGACGATACATTATCACCTGGTGTAAACCAATTAGTACGTGT
2447	82	27	MW2_CDS_05305	MW0982	FALSE	unmapped	TCCGCATTAGATTTGAAATTGCGTACTGAAATGCAATATGAATTACGAGAATTGCAATCT
2448	82	25	psma_tiling_072_F		FALSE	unmapped	ATACCTTGTTGCATTGTTCTCTTTAAGCGTGCTCCCATGCACATATGTATATAAAATGTT
2449	82	23	MW2_CDS_06401	MW1189	FALSE	unmapped	TGAAATCAAAAGGCAATTAACTTATTATGATGAGACAATTGCGACGAATAATGCAGATCG
2450	82	21	MW2_CDS_13433	MW2541	FALSE	unmapped	GGATCGTGGGTTTGTAGTGTTGAGTTTTCCGAATAATAATTTTGACAATCGACAACCAGG
2451	82	19	MW2_CDS_00939	MW0172	FALSE	unmapped	AGATCGAGAGTATCATGGTGAATATTTGTTTGAAGGAAGTAATTATCAGACACAATCTGA
2452	82	17	MW2_CDS_05133	MW0949	FALSE	unmapped	TCTGAAACAGAACAATTAGTTAAGCCTGTGAAAATAATTCCATTAGAAGTAGTTGTTCGT
2453	82	15	MW2_CDS_00493	MW0092	FALSE	unmapped	GTATATATATTTGCCACGATTGCATGTGGTTGTAGTGCGATACTGCAAGGTTTAGCGACG
2454	82	13	MW2_CDS_06451	MW1203	FALSE	unmapped	AGGTGGTACGAAGATAGGTGCATTATGCGGAGAAGCAATTGTTTTTACGAAGAATAATGA
2455	82	11	MW2_CDS_09917	MW1860	FALSE	unmapped	GTTGGCGAAGCATTCAATGTTCAATTAGAAGATGACATGGCCTTCTTATCTGGTGTCGTT
2456	82	9	agr_tiling 035_R		FALSE	unmapped	TCATCTTATTTTTTAGTGAATTTGTTCACTGTGTCGATAATCCATTTTACTAAGTCACTG
2457	82	7	MW2_CDS_09138	MW1713	FALSE	unmapped	TGACGTATAAAGAACTAGCAACATTTTTAAAAGTTTTATCAGATTCAAGCAGATTAGAAA
2458	82	5	MW2_CDS_11296	MW2136	FALSE	unmapped	ACGCGAATACTTACCATTCGAATCATTAATTTTAGACTTAAACCAACCATTTGATGTAAC
2459	82	3	perR_tiling_013_R		FALSE	unmapped	ACTCCATAAATTTCCATTCGATGATGTGTTACGTCAAAGTCAGTCATATGCTGAGCTAAT
2460	82	1	MW2_CDS_12666	MW2395	FALSE	unmapped	TCAAGCTATAAGAGAGATTGCAGATAAAATTGGAGATAATCAGTTAGAAACTAATTCCGT
2461	81	164	MW2_CDS_02296	MW0424	FALSE	unmapped	TGGTTGGTCGCAAAGTCGGACTGCAATCGATTTTATCGTTAATCTTGAATTCTATTGCCA
2462	81	162	MW2_CDS_10243	MW1934	FALSE	unmapped	GCTTCAGTTATTTACAAATTAGCATTGAAAAAGTTAGACGAAAAAATCAACGCCACTCCA
2463	81	160	MW2_CDS_04974	MW0919	FALSE	unmapped	AGCAATTTTGTTAAGATACATAATGCTCCAAAACATTTTCAAACTGAAAAAATCGTAGGT
2464	81	158	MW2_CDS_01459	MW0268	FALSE	unmapped	TATTCCATTGCCAGGTATGGGCTTCCTCAAAGGTGCTGGGAAAAGTTTAATGAAATTAGG
2465	81	156	MW2_CDS_02480	MW0458	FALSE	unmapped	GAGAACAACTCCAGATGTTAATGCCAGATGCTAACATTGCAGTTGCTCATGGACAAATGA
2466	81	154	MW2_CDS_03525	MW0646	FALSE	unmapped	GGAAATATATAATGGTGATCAAATTGCACTTGTAGGTCCAAGCGGGGCAGGTAAATCCAC
2467	81	152	(+)E1A_r60_a135		pos		
2468	81	150	MW2_CDS_00725	MW0135	FALSE	unmapped	CAACATGTTGAACAATATGATGCGGGTATCCAAATTGATAATGGCGATGCACATGCCATT
2469	81	148	MW2_CDS_11196	MW2115	FALSE	unmapped	CTGGATGAGAGGTTACGATGGAGAATCTGAAATCACGCATAATGCGACAGGTGATAAAGG
2470	81	146	MW2_CDS_03943	MW0720	FALSE	unmapped	GCGCGTAAACAAGTTTTGGTGGATCATGGATTTAGATTACCGAGTGCATTAGATAACCGT
2471	81	144	pMW2_055		FALSE	unmapped	AGACCAGTACTTCAAGAAGCACTTAACTTTTTGAGGATGGGAGATCGGTTTGTAGTAGAA
2472	81	142	agr_tiling 101_R		FALSE	unmapped	TTTAAAATTAGACTATATTCTGTATTTTTAGTAATGGTTACTCAAATCATTTTATATTGT
2473	81	140	MW2_CDS_03657	MW0670	FALSE	unmapped	AACACCTAACAGGTACATTCAGTTCTAAAAACGGTGAAACTGTTGAAGGTAAAGCTGAGA
2474	81	138	MW2_CDS_04771	MW0880	FALSE	unmapped	TCTGATGATGATGCAACTGATCAATTTGATGAACAAGTTCAAGAATTGTTAGCTCAAACA
2475	81	136	MW2_CDS_00578	MW0108	FALSE	unmapped	AATGCGCATGCCGACACAACTTCAATGAATGTGTCGAATAAACAAAGCCAAAATGTACAA
2476	81	134	MW2_CDS_11749	MW2227	FALSE	unmapped	CGAGAATGTTAAAAACGTCAGCTGTAATTTCTAATACATTATTAGTCATAGGTTTAGTCT
2477	81	132	MW2_CDS_02528	MW0467	FALSE	unmapped	TGAACAAGGATTAACGCCAGAAGGATTACTAAACGAAATCTTAGGTGAAGACCATGTGCA
2478	81	130	MW2_CDS_04895	MW0902	FALSE	unmapped	GCACTTACCACCCGAACAACGTAAAAAAGCTTTGTTTTACGGTTTGTTAGGTGCATTTGT
2479	81	128	MW2_CDS_13906	MW2625	FALSE	unmapped	TTGTATCTGTAACACTACCTTGGAAAGAATTTGGCGGTATATTTGCAACGTTTCCGGCAG
2480	81	126	MW2_CDS_12934	MW2447	FALSE	unmapped	TTTTAATCAGCTTAGGTATCAGCATTGTATATTGGATTGGTTCAGTCATCTTAGTTGCCA
2481	81	124	MW2_CDS_05631	MW1047	FALSE	unmapped	ACCAAGGCAATAAACCAGTATTAACATTGAAAGAAATCGATTTCCGTGCACGAGAAGCGT
2482	81	122	MW2_CDS_03297	MW0605	FALSE	unmapped	AGGCAGTCGGTGCAAGTAGTAGAATATACGAAATCATGCAAGAACCTATTGAACCGACAG
2483	81	120	MW2_CDS_09632	MW1808	FALSE	unmapped	ACGCCGTTTCAGGAGCAATTAACATTGAAACATTACCAGATGACATGATTTGGTTTGATT
2484	81	118	MW2_CDS_11135	MW2104	FALSE	unmapped	TCTGATGCACCAAGTGATGATGATATCTTTATGATTAATCGATTCGTCTCAGCTGTTGAA
2485	81	116	MW2_CDS_01931	MW0355	FALSE	unmapped	ACATCACTATTTGAAATCTGATCAAGCAATTAAAGAGATCACCAGTTATCTACGCAAACA
2486	81	114	MW2_CDS_01373	MW0252	FALSE	unmapped	GTATGTCTGGTGGCATCGGTAATCAATATGCAGTAGACCCAACGTCATACTTGCAAAGTA
2487	81	112	MW2_CDS_04135	MW0757	FALSE	unmapped	TTTAAAGATCAAAGTGGAAATTTTGTAATAACCGACTATGATTTACAAGAATTACAAAGT
2488	81	110	MW2_CDS_07740	MW1460	FALSE	unmapped	TACCAAGTGAACGTTATCCTGCACACTTAGAAAGCCGATTTTTACCTGGCAAACATTGTG
2489	81	108	NC_A_042		FALSE	unmapped	AAAACCATGATTTCGAAGTCTTCATAAACTGAAGCTTCTACTCTCATGGCAATTTATACT
2490	81	106	MW2_CDS_04448	MW0821	FALSE	unmapped	TGGTGATATTGTTGAAGGTGATTCGCCGGAAGAATTATTACAAAATATATATGCACATAT
2491	81	104	MW2_CDS_02775	MW0512	FALSE	unmapped	ACAAACCTTTTATAGCAATTGAAGGTCCTATTGGCGTAGGTAAATCTTCACTTGCACACA
2492	81	102	MW2_CDS_12798	MW2422	FALSE	unmapped	ACAAGCCTTGTGTGACAAGGGTTTATGATGACTTGAATACAATTTATAGGTATATTTCAA
2493	81	100	MW2_CDS_09002	MW1689	FALSE	unmapped	GTCAAAGGCTCATATATCGTTTATGAACCATTCGTTCATCCTGAAACTGATAAATACCGT
2494	81	98	agr_tiling 036_R		FALSE	unmapped	TTTGTTCACTGTGTCGATAATCCATTTTACTAAGTCACTGATTGTTGAAATGATATCTTG
2495	81	96	MW2_CDS_13279	MW2513	FALSE	unmapped	AGACATCGCATTTTATCAATTGATGTTTCGTATGGGTAAAGATTCAAATATCCACGAAAA
2496	81	94	MW2_CDS_02623	MW0484	FALSE	unmapped	CGGCACGTTCAACATTAGAAGTCATTACAACGTATGCAGGTTTACATGCAGTTTGGAGTC
2497	81	92	MW2_CDS_11880	MW2252	FALSE	unmapped	ATATCAAGGACTACCATCACGTATTGCTTGGTTAGGCTATGGAGAAAGAGCGAAAATGGG
2498	81	90	MW2_CDS_07820	MW1473	FALSE	unmapped	GTGCCCAAAAAATCGGTTAGGCATATAAAAATTAGAGAAATTATTTCAAATGAACAGATA
2499	81	88	MW2_CDS_03992	MW0728	FALSE	unmapped	AAGCCAACTTTTTCAGTATCGCTTTGAAGAAAATCAAATTAGCGGTCACTCATTAGGTAA
2500	81	86	MW2_CDS_04143	MW0758	FALSE	unmapped	AAAGTTGGTGATGACTATAATGATCATAAACAATTGATGTTATTTAAAAAGGATATAGAT
2501	81	84	MW2_CDS_02699	MW0498	FALSE	unmapped	ATAAAACTAACCCAATCTTCATGATGAGTGATTCAGGTGCCCGTGGTAACGCATCTAACT
2502	81	82	agr_tiling 050_F		FALSE	unmapped	CTCACTGTCATTATACGATTTAGTACAATCTTTTATCATTATATTGCCTAACTGTAGGAA
2503	81	80	MW2_CDS_04335	MW0798	FALSE	unmapped	GATTTCAATGGCAAGTGCATCGATGATGACACAAGCTGTTAAAGGTCATTCACTTGGAGA
2504	81	78	MW2_CDS_06288	MW1167	FALSE	unmapped	TTACCAGGTCCACCGAAAGAAATGCAACCAATGGTGAAAAATGAATTGTTGTCACATTTT
2505	81	76	MW2_CDS_05534	MW1026	FALSE	unmapped	AAATTATGGAACGATTAGCTAATGCATGTCGCAATCCATACGTGCGACATATAGCGCATC
2506	81	74	agr_tiling 189_F		FALSE	unmapped	TCTTATTATATTTTTTTAACGTTTCTCACCGATGCATAGCAGTGTTCTTTATTTTTAAAA
2507	81	72	MW2_CDS_04986	MW0923	FALSE	unmapped	ACATGCCATTTTTGTCATTTTTACTAAAAAAGCAGATAAAGATGGTTATATTATATTCCC
2508	81	70	MW2_CDS_08282	MW1558	FALSE	unmapped	GTATGGGCTATCGTTTGGAAGGTGACAGCGTTGCACCAATTAATCAAGCAGATATCATTT
2509	81	68	MW2_CDS_00876	MW0162	FALSE	unmapped	ATTTTGTCGAAGTCAAAATGTCTGTCGAAGACGCACCGAAGAAACTCATCGATATCGCTA
2510	81	66	MW2_CDS_01934	MW0356	FALSE	unmapped	ACAGGTATACGTTACGAAGACATGAGCACCGGCGAAGAACATCTACTTAACTTAGATGGT
2511	81	64	MW2_CDS_02387	MW0441	FALSE	unmapped	GGAAACATCAGAATTAAAGGCACTTGCAGTTGAATTAGTAGAAGAAAATGTAGCGCTTCA
2512	81	62	MW2_CDS_02418	MW0447	FALSE	unmapped	AGAAATGCTCAACAAAGTCGAGGCGTTATTGTATTAACAGATCCAGATTTCCCAGGAGAT
2513	81	60	MW2_CDS_04624	MW0853	FALSE	unmapped	CGTGGACACCAAATTATGATTGCGACTGGCAGACCTTATCGTGCAAGTCAAATGTATTAT
2514	81	58	MW2_CDS_00422	MW0080	FALSE	unmapped	CGCATTACAGAAGATGCACAACGCGGTATGGATAAATTATTCAACCATGTTGCTGAGTCA
2515	81	56	MW2_CDS_02008	MW0370	FALSE	unmapped	TTCTGATGAAATAAAATATATAGACTTAATCAAAATAATAGAAAATGCATTACCTGAAGA
2516	81	54	MW2_CDS_02624	MW0484	FALSE	unmapped	ACCAGGACATATTGTTAAGCAAGATGGTGTTCGAGTTGGAAAAACATTTGATCATCGCCA
2517	81	52	MW2_CDS_05906	MW1099	FALSE	unmapped	ATCATTGTTACCGAAGTATAGAGGTGGTGCACCAATTCATCAGGCAATTATCGATGGTGA
2518	81	50	MW2_CDS_11237	MW2122	FALSE	unmapped	GGGCACGATAAGAACGAATGAAATCGTCGAAGGTTTAAATGTGTCTGATATGACAGTTCG
2519	81	48	MW2_CDS_07332	MW1369	FALSE	unmapped	CAAGATAAGTCTAAAGATCATCATAATGGCAAAAAAGGTGCAGCGATCGGTGCTGGAACA
2520	81	46	MW2_CDS_02472	MW0457	FALSE	unmapped	TCGTATTGGTGTGGGAAGACCAACGAATGGTATGACGGTACCTGATTATGTTTTACAACG
2521	81	44	MW2_CDS_01971	MW0363	FALSE	unmapped	AGACGATAAAATGTTAGTTGTAGCGGTTCGTGACAAATCATCACATCAAGAAGTGCATGA
2522	81	42	MW2_CDS_07684	MW1450	FALSE	unmapped	CCTTTTATTGTAGACCATCACATGCGGCGTGATCGTTCAGAAGTGATTTCAGCAAAAGAA
2523	81	40	MW2_CDS_03206	MW0590	FALSE	unmapped	TCTTTTGTAAGTTCTGTTTCAATATCACGCTTTATTGGTGGGGGGCATGTGTTTAATGGA
2524	81	38	MW2_CDS_12992	MW2459	FALSE	unmapped	AGGTGAAATTGTAGCACCGTTTGATGGTACAGTGAAAACAATCTTCCCTACGAAACATGC
2525	81	36	MW2_CDS_03373	MW0619	FALSE	unmapped	TTTAAAAGTGCCGATTTTCAAATCGAAGGCGTTTTAAAAGATAAGTTATTTATCGATGGT
2526	81	34	MW2_CDS_02086	MW0385	FALSE	unmapped	AGGTACAATCTCTCATGATGTTTCAGAATTCAAGATTACTAAAGAACAGATTTCCTTGAA
2527	81	32	MW2_CDS_03855	MW0705	FALSE	unmapped	AGATGGTTCACAATTGTCATTTATGGGGTTACCAACTCCAAACATCTTTACAGGTTGCGG
2528	81	30	MW2_CDS_06376	MW1184	FALSE	unmapped	TGGGCAGGAATTAGACCATTAATTTACGAAGAAGGCAAAGACCCTTCTGAAATCTCTCGT
2529	81	28	MW2_CDS_12589	MW2381	FALSE	unmapped	ATGATTATCACTAGCCCTACAGAAGCGAGAAAAGATTTTTATCAATTACTAAAAAATGTT
2530	81	26	MW2_CDS_01004	MW0186	FALSE	unmapped	ATTCCCAGAAATGCATCAACAAAGGTGGAATTAAAGGGAATGAGTGATTTAAAAGGCAAT
2531	81	24	MW2_CDS_02246	MW0415	FALSE	unmapped	AATGTTACAAGCACATCCAGCTGTGCAACAAGTGTTCCATCCAAGTATTGAAAGTCATTT
2532	81	22	MW2_CDS_09983	MW1872	FALSE	unmapped	AAAGAAAGTTAAGAAATATTCAATGGGGATGAAGCAAAAGTTAGCAATTGCAGTATCTTT
2533	81	20	MW2_CDS_11224	MW2120	FALSE	unmapped	AATGCTGTAAATAAAGTACCTGGCGTTCGTTCAGCACTAGTACGTGATATGACATCAGCG
2534	81	18	MW2_CDS_12620	MW2387	FALSE	unmapped	TGGACAACCTAAAGATGTTATGGAAGTTCAAGCAATTACATTGTTGGAAGAAGTCGGTCT
2535	81	16	MW2_CDS_12490	MW2364	FALSE	unmapped	CGACCGTGATGATTTTGGTATTAGCAGCCAACACTGGATTTACAGCTTTTCCGATGTTAG
2536	81	14	(+)E1A_r60_a104		pos		
2537	81	12	MW2_CDS_12401	MW2347	FALSE	unmapped	AGCATCATGTGTTTACAAGTTATTTAAGGTATCCAACTGTGACTAAGCCAATGTTAAGAA
2538	81	10	agr_tiling 183_F		FALSE	unmapped	TTATGACATCTAAAGAAACGATCATCTAATTGACTCAGTTCTTTTAAATTACCATAAAAT
2539	81	8	MW2_CDS_08714	MW1639	FALSE	unmapped	TGTATGGAAATACCTCATGACTTATTCACGCCAATCTTTGCTGTAAGTCGTTCTGCAGGA
2540	81	6	MW2_CDS_01225	MW0226	FALSE	unmapped	AACCTGGTATGACTGTTGCAGTAATGGGGTGTGGCAGTATAGGTTTGTTAGCTATTCAAT
2541	81	4	MW2_CDS_10207	MW1924	FALSE	unmapped	GTAGTTGTTGTGGTCAACAGTTACCAGCTGAACAAGTGAATGAGGCAAGAGAAAAAGCAT
2542	81	2	MW2_CDS_00351	MW0067	FALSE	unmapped	ACGTTGTTAATTGTTGCGAAAAAAGCTACAAATAAAAATAAAGAAATCGAAACCGTCGAC
2543	81	163	MW2_CDS_13759	MW2598	FALSE	unmapped	TCGTAGATATGGTAGACGGAATTGTCGACATCGTTCAAACAGGTACTACGCTAAAAGCGA
2544	81	161	MW2_CDS_13709	MW2590	FALSE	unmapped	GGGATCATGTTGACTTTGTAGGACAAGACAGTTCTGATACAGTGCGCACAAGAGAAGAAT
2545	81	159	MW2_CDS_10359	MW1956	FALSE	unmapped	AAGTGCGTCAACTGCATATAGTAAAAGTTGGCTAGCAATTGTATGTTCTATGATGGTGGT
2546	81	157	NC_S_028		FALSE	unmapped	AGCATGTTTTAATATAACTAGATCACAGAGATGTGATGGAAAATAGTTGATGAGTTGTTT
2547	81	155	MW2_CDS_09657	MW1813	FALSE	unmapped	AGAGCAAGCGATTTCTGAAGTGATTGAATATTGTTATCGCGAAAAGTTAATCGACCATCA
2548	81	153	MW2_CDS_10478	MW1978	FALSE	unmapped	AGCAATTGTTACTACAGACGTGGGACAACATCAAATGTGGGCAGCTCAATTTTATCCATT
2549	81	151	MW2_CDS_04567	MW0843	FALSE	unmapped	AGACGCTGCTGTTGGCTTTATCGATATCTATGGTTTACCTACTCAAGTAAATTCGATGCT
2550	81	149	MW2_CDS_13711	MW2590	FALSE	unmapped	TTCAAGAGTAGACTTCGGGTTGGCTCAATGGGGTCTAAAACAGAAGCCAAATGAATCATA
2551	81	147	MW2_CDS_02070	MW0383	FALSE	unmapped	ACGTTAATGAGGATAAGAGATTTGAAGGTGCAAAGTACTCCATTGGCGGTATCACGAGTG
2552	81	145	(-)3xSLv1		neg		
2553	81	143	MW2_CDS_12305	MW2329	FALSE	unmapped	GAAATGGTGCATTGGAAGGTATAGGTAAGCCTGAAAAGTTAAAATCGAATCTGACTGGGT
2554	81	141	MW2_CDS_02960	MW0545	FALSE	unmapped	GCGATGTTTACGATGGTATGTTATATGATGCGCCTGACCATCTTAAGTCTTTGGTGAACC
2555	81	139	perR_tiling_044_F		FALSE	unmapped	GAATTATATGAATTGGATAATGTAACTATAACAGCGCATATAACTGGTAATGATTATGAG
2556	81	137	MW2_CDS_12365	MW2341	FALSE	unmapped	TGAAAAAGCAATCGTTCGTCATGATGAGCGTGTGAAATCAGCAAATGATGCAATCTCAAA
2557	81	135	MW2_CDS_11043	MW2088	FALSE	unmapped	TGAGAATGGTCAAATCGTTGACGGTGACCAAATTATGTTTATTATTGGTCAAGAAATGCA
2558	81	133	MW2_CDS_06590	MW1231	FALSE	unmapped	TGGTTTGCTTTTTTCTACAGTTCTAATTTGGACTTCTCGATTTGAAGTCAAAGGTACAGA
2559	81	131	MW2_CDS_02538	MW0469	FALSE	unmapped	TCGTGATGAACCGGTTGTCGAAGAAATGTTAACATCTTTGTTAGCACAAGCACATCAAGC
2560	81	129	MW2_CDS_02989	MW0550	FALSE	unmapped	AAGGAAAAACAATCAAAGATGTCATTGAAGACATTCAAAAGGAGGATTTATGTCATGAAA
2561	81	127	MW2_CDS_05071	MW0938	FALSE	unmapped	GAAGCACTCCTAATTTATTACAAAAATAGTATCGACAATCCTATTGTAGATGGTGCATGT
2562	81	125	MW2_CDS_08573	MW1615	FALSE	unmapped	TTTAGGTACACAGTGGGGTGTAATTTCAGTTGGTGAACGTATATTCATTGACCCGAAGGT
2563	81	123	MW2_CDS_08610	MW1621	FALSE	unmapped	CGAGATATTAGTGTATGAACGATTATCTGGCGGTGGAGAAGCTCGATTGCATGGACAATC
2564	81	121	MW2_CDS_11250	MW2125	FALSE	unmapped	AAAAGGAGAAGGATGATAATATTTTGTGCGAGGAGTTTTCATATAAGTGTTCCATAAAAG
2565	81	119	MW2_CDS_08071	MW1519	FALSE	unmapped	TCAAGGTGTTATGACAAGAGATGACGCGCAAATTATATTCATTGATACGCCAGGTATTCA
2566	81	117	ETG10_195139		pos		
2567	81	115	MW2_CDS_02147	MW0396	FALSE	unmapped	TCGCCGATAAAGGACTACATTCAATCAAAGACATTATCAACAAAGCTAAACAAGACGGCT
2568	81	113	NC_A_029		FALSE	unmapped	ACATTAGACTTATTCATATATTTTAACGGTGGATCTCATAATGAGGATTAACTCTTCCCT
2569	81	111	MW2_CDS_08728	MW1641	FALSE	unmapped	AGAAGCTAGTGACGTTGCCAACGCAATCTATGATGGTACAGATGCAGTAATGTTATCTGG
2570	81	109	MW2_CDS_09873	MW1852	FALSE	unmapped	AAAGATTATGAACCAGAAGAACTGGAAAGTGTAGTAGAACATGAAATTCAAAGTAAATGA
2571	81	107	MW2_CDS_02683	MW0495	FALSE	unmapped	CGACTTAGTAAAAGCAATTGAAGAAGAATTTGGTGTAACTGCAGCTGCTCCAGTAGCAGT
2572	81	105	MW2_CDS_02743	MW0506	FALSE	unmapped	ATTTCTGAAAGTGAGGATGTTCAACAAACATTAGATTGGGCATTAGACAATGACCGCTTT
2573	81	103	MW2_CDS_10407	MW1966	FALSE	unmapped	TATGTGGAAGCACAAAAAGATGTTGCAAATGCTTTGGAAAATGTGGAGCAAGTAGATGCG
2574	81	101	MW2_CDS_01675	MW0305	FALSE	unmapped	TAGAATTTGCCACAATCAATCCAGTTGCAATTTTTGGGCCATCATTAGATGCACACGTTT
2575	81	99	MW2_CDS_13321	MW2521	FALSE	unmapped	TGGTCAATATGGTGGTCACAAAGGCGTTTACCTAGGTGTACCAACATTAGTTAACCAACA
2576	81	97	MW2_CDS_12385	MW2345	FALSE	unmapped	ACCTGTGTGGGTAGTGTTGTTAAACGCGATTCCAGGCGTAATATTCACTTTAATTGTAGC
2577	81	95	MW2_CDS_11906	MW2256	FALSE	unmapped	TGAGACAGGATACTTCTTAGATATGGCAGATCAAGTTATTGTAGGCACTCAAGAGGGTGT
2578	81	93	MW2_CDS_06847	MW1278	FALSE	unmapped	ACGAGAGCTAGGTTTTGTATTAATGGCACTTAATATAAGGAAAATAGCAGCTCAACGAGC
2579	81	91	pMW2_020		FALSE	unmapped	CGGGTATAGAGAAAAAACTATCTCGTTATCCTCAACTATATTCGCGTATAGGTTTTGCGC
2580	81	89	MW2_CDS_05375	MW0996	FALSE	unmapped	GGCTGGTTGGTTACCAAGTTATTTAACTGCCAGATTTAGTACGCTAACAGATCCATTCCA
2581	81	87	MW2_CDS_08519	MW1605	FALSE	unmapped	CGGGCATATATTGGTTATGGTGACGTTTTACTAATATCTGCACTTTCTTTGTTTTTCCCT
2582	81	85	RC8		pos		
2583	81	83	MW2_CDS_07171	MW1340	FALSE	unmapped	ACCAAGCAACAGATCCTCACCCTACTGGTTCATCTTTAAAACCTTTCTTAGCGTATGGAC
2584	81	81	MW2_CDS_04224	MW0775	FALSE	unmapped	TGTTGGCTCCTGCCTGGTATTATCATTTGTGGTGTGATACTCATCGTATCCTTTACCATT
2585	81	79	MW2_CDS_12719	MW2406	FALSE	unmapped	TCTAAAATGATTATTGAGACAAATAATAGCAATATGGAATCTAGAGGAATGGTGCTCTAT
2586	81	77	MW2_CDS_03563	MW0653	FALSE	unmapped	ACAGGTACGGATGCAGTGCCGTATTTTAGAATGTTTAATCCAATAAGACAGAGTGAACGC
2587	81	75	MW2_CDS_10798	MW2039	FALSE	unmapped	AACACATGTCGTAGCCCATTAGCGGAAAGTATTGCAAAAGAGGTTATGCCAAATCATCAA
2588	81	73	MW2_CDS_08615	MW1622	FALSE	unmapped	CGACATTAACCGTAAAATGTTATCAGAAATCGCAATTTCTGACGAAAAAGCATTTGCTCA
2589	81	71	MW2_CDS_06807	MW1271	FALSE	unmapped	TCAACCATTATTAGGATACGCTGCATTTTTAGCGATTATGAGTTTATTAATTAGTTTTCT
2590	81	69	MW2_CDS_13323	MW2521	FALSE	unmapped	TCAAGTGTTGACGCTAGTATTATTGGTGAGCATGGTGATACTGAACTTGCAGTTTGGTCA
2591	81	67	MW2_CDS_04862	MW0896	FALSE	unmapped	GCGCCATTTGAAATTGAAGATGGTGATTTAGATTCTGTCATTGAACAGGTTAGAGCTCGT
2592	81	65	MW2_CDS_12678	MW2397	FALSE	unmapped	ACAAACGTTGCTATGAACTGGTACTTTATCGCAGCGAGTGTCGTTGTATTACTTCCTACG
2593	81	63	MW2_CDS_06355	MW1180	FALSE	unmapped	GCGAGTAAAGCGATTCATCATATTCAGAAAGAAACAAACACACAAGTCATTGCAGGTGGC
2594	81	61	MW2_CDS_00709	MW0132	FALSE	unmapped	TGGACCTAGCAATATTGCAGCTTCTATAGACTATTTGAATTACTATAATGGTTCGTTCAA
2595	81	59	MW2_CDS_09907	MW1858	FALSE	unmapped	AGGTGTGACTATTAAGAATGTAGTGAGTGGTCATGCAATTGATGCTTGCGGGATTAATGG
2596	81	57	MW2_CDS_11210	MW2117	FALSE	unmapped	TTTTGAAATTGTTGCATTTGCAGGGGATGCACGTTCTAAGTTTTTAGAAGCATTGACAGC
2597	81	55	MW2_CDS_02711	MW0501	FALSE	unmapped	AGAGCGTCGTACTACTTTAGGTTTACGTTGGTTAGTTAACTATGCACGTCTTCGTGGTGA
2598	81	53	MW2_CDS_11113	MW2100	FALSE	unmapped	TATTTATCAGTGATAGTATCCTGCCTCGTTGCAGCAGTCATTATGCCAAGAATTTGGCCT
2599	81	51	MW2_CDS_13792	MW2603	FALSE	unmapped	AGCAGGCATACGTGAACCATTATACTGTACAGCGCTTAAATATGCAGAAGTAGATGTCGA
2600	81	49	MW2_CDS_01685	MW0307	FALSE	unmapped	TGCACCATCTGATATCGAAGTTGAACATAGTGACATTATGACAGCAAGTCCAGAGATGGC
2601	81	47	MW2_CDS_00892	MW0164	FALSE	unmapped	ATGCAAATTGTGAGACAAACGCTTAGTGCACATGACAATGTGAATGTTGTTGCACAAATT
2602	81	45	ETG10_234183		pos		
2603	81	43	MW2_CDS_11908	MW2256	FALSE	unmapped	ACCAAAAGGAATTGACCCATATAAGTTCCATGAGTATTTAATTCATCTGACAGGTGTGTT
2604	81	41	MW2_CDS_05298	MW0981	FALSE	unmapped	GTCAGGTCAGATAACACTTAATTTAGGCAAAGAGATATATCAAGCACAAGAAGAAGACGT
2605	81	39	MW2_CDS_05452	MW1010	FALSE	unmapped	AACAAACGTCGTACGCATTTCAAAATTTCAGTACCAGGTATGACTGAATGCCCAAACTGT
2606	81	37	pMW2_054		FALSE	unmapped	AAGGCGTATATAAAGGGCGCCCCTTACTTTATTCACCAAATGCTAAAGATCCACAGAAAC
2607	81	35	MW2_CDS_05628	MW1045	FALSE	unmapped	TGGCTGAATATATTTTTAGGAAATGAAATCATCCATACACTGACTGTTTTAATAACAACA
2608	81	33	agr_tiling 085_R		FALSE	unmapped	GTTACAGAGCCGCGTATATAAATTGTGATTTTTTATTGGACGAAGCTGAAGTACCAAAAG
2609	81	31	MW2_CDS_01664	MW0303	FALSE	unmapped	TCGCTTCTTTGATATGTTGCAAGCGAGTTTACATCCTTATGGCAGTTGGCAAGAGTATTG
2610	81	29	MW2_CDS_00643	MW0119	FALSE	unmapped	TAATCATGCATTTGAGGCACGTGTGGCACCGCATCCTTTTACAAATTTTATGAATTACGC
2611	81	27	MW2_CDS_12047	MW2282	FALSE	unmapped	ACAGCGTGTCGATATTGCAGTGGTAGATATTATGATGGATGGTATGGACGGCTTTCAATT
2612	81	25	MW2_CDS_00785	MW0146	FALSE	unmapped	CGCATGTGCATAAGCCTAACGTTATATTGATGGATGAGCCATTAGGTGCATTAGATGCAT
2613	81	23	MW2_CDS_04049	MW0738	FALSE	unmapped	TCCTATCATTACAATTGAAGACGGTATGGACGAAAACGACTGGGATGGTTGGAAACAACT
2614	81	21	MW2_CDS_11461	MW2172	FALSE	unmapped	CGGTATGATCATCACAGCAATCGTTGGTATGTTCACTGGATTGATTCAAATGCCATCTGG
2615	81	19	MW2_CDS_08499	MW1599	FALSE	unmapped	AGAGATAATATCTCAAAAGGTGATAAAGTCGTTACAAGTGGATTAGCTGATCAACTACCA
2616	81	17	MW2_CDS_09587	MW1800	FALSE	unmapped	ACTCAAGCAATTGGAAATGTAATTCATTCTTTTACAGACTTAAATCCGTTGTTAATGTCT
2617	81	15	MW2_CDS_05234	MW0969	FALSE	unmapped	CGATCTAGATTGGGTGCAGTTACTATTAAGCCCATTTGCTTGGTCTGTAGTATTCTTGGC
2618	81	13	MW2_CDS_02929	MW0540	FALSE	unmapped	ACCTGCCATCATTTTTATGGTAACGGGTATCATTCCATTAGTACCTGGTGGCTTAGCATA
2619	81	11	MW2_CDS_04505	MW0832	FALSE	unmapped	TGGGCGGACTTAAACATGGTACTGTTCCAATTTATGAAGCGAACGTAAAAAGCTATGTTG
2620	81	9	MW2_CDS_01508	MW0277	FALSE	unmapped	TGAATGTTGTATTTGATTATGTTGATTGGATGAATTCAGAATTTGGTCCATCAGGAAAGG
2621	81	7	MW2_CDS_08029	MW1512	FALSE	unmapped	ACAACATCATCAACGTTTAGCTCAAATTAATGACGAAATTGCTGTAATTGAAAGGGTGTT
2622	81	5	MW2_CDS_09992	MW1874	FALSE	unmapped	TGGTTCAAAAGAACAACTGTTACAAAGATATCAAGTTGTGAGTGGTGCTATTGAGGACCT
2623	81	3	MW2_CDS_01617	MW0295	FALSE	unmapped	CGGAAGGTAATGTCATTACACCGGATATGTATAAACGCGTGATGGACTTAGGCGTTCATT
2624	81	1	MW2_CDS_09942	MW1866	FALSE	unmapped	GCACGGTCTTTCAAGGCAAAGACTTCATGGTTAGAAATTATGATTACCACCCTGCAACTT
2625	80	164	MW2_CDS_00492	MW0092	FALSE	unmapped	AAGTGTCATGTTTGTTGTCGTGAATGCGTGTCATCAACAACTTAAAGGCACATTTGTTGG
2626	80	162	MW2_CDS_01244	MW0229	FALSE	unmapped	TGCTGAAGCATTTGGAATTAGAGAAGAAAATGTTGTACCAACAGGTGTACCACGTACTGA
2627	80	160	MW2_CDS_08928	MW1676	FALSE	unmapped	GAGGTTGAGTCTAAATTGGTTGAACACGAAGCAGTTGCCGAAGCAGGAATTATTGGTAAA
2628	80	158	MW2_CDS_08939	MW1678	FALSE	unmapped	TACCGATGCACATCATGGAGATGGTACACAATGGAGTTTCTATGCCGATAACCATGTTAC
2629	80	156	MW2_CDS_04720	MW0871	FALSE	unmapped	AGCTGAAGGTATTGATATCCATCATTTAGCAACTGATAAACGTGACCGTAAAAAACGTGT
2630	80	154	MW2_CDS_00737	MW0137	FALSE	unmapped	CAGCAGCTTTGGTTCACAACAATTCACCTCAAGCAAGGCTATCTGATTATATGCAAGTGA
2631	80	152	MW2_CDS_11881	MW2252	FALSE	unmapped	CTTTGTACCAGCTTACATTAGACCATTATTCTGTGAAGGTAAAGGGCCATTCCGCTTTGC
2632	80	150	MW2_CDS_08530	MW1607	FALSE	unmapped	ACGATTGCAACAGTTACTGATTTAAGTGACAAATATGAATTCGGCGAAGTTGGACGTGCA
2633	80	148	psma_tiling_001_F		FALSE	unmapped	ATGATTATACTTCATTCAACTTATCGTGCTGGTCTAATTTGCCATTGATATGGATCTTCA
2634	80	146	MW2_CDS_11947	MW2265	FALSE	unmapped	CAGGATACCACTCAAACGTATACAGGCTACATCGTGGAAACGGAAGCTTACTTAGGTTTG
2635	80	144	MW2_CDS_09240	MW1734	FALSE	unmapped	AGTCCTTGGATCGTCAAGATTTCACACAGTTACAGTTATTAGCGCGTGAACAGGTTCTTT
2636	80	142	RC6		pos		
2637	80	140	MW2_CDS_10882	MW2054	FALSE	unmapped	CGAACCACCCATTCCCGGTGATTTAACAGCAGCTAATTTTGGTCATGTACTACATCATTT
2638	80	138	MW2_CDS_07343	MW1371	FALSE	unmapped	ACTTATACAAAATTGCTTGAACAATTCACGATGGAAGATATAGCGGCTCAACAACAAGTT
2639	80	136	MW2_CDS_10588	MW1999	FALSE	unmapped	CAGCACTGGACAGAGACACGATATTTTCACGGGAGACCGAGTGCAGTTGATTATAATATG
2640	80	134	MW2_CDS_02946	MW0543	FALSE	unmapped	CTTGTTTATGCTGGTAAAGCAGATGGTTTAGTTAGTGGTGCAGCACATTCAACAGGAGAC
2641	80	132	MW2_CDS_02576	MW0476	FALSE	unmapped	TGACAAAAAAGGAGATACAGTTGCCCGCTTTGGTTTGAAACTATTATTCGGTGCAACACT
2642	80	130	MW2_CDS_00316	MW0061	FALSE	unmapped	AACGCGGTTAAGACAAGAAAGATGATGGGAGAATATATTATTTATTATGATGGCGTGGTT
2643	80	128	MW2_CDS_12883	MW2438	FALSE	unmapped	TGGGTGAATGGTCATGAAATTACAGAAACTGGATTAACGGCTGGTCAACAAATACTTGGG
2644	80	126	MW2_CDS_03902	MW0713	FALSE	unmapped	GGCGATGTTCAAGGTGCTTAAAACACTTAAATCAAGATGAAGCGTATTGTTTAGACTGCA
2645	80	124	MW2_CDS_12858	MW2433	FALSE	unmapped	TTTAACAAAGAAGATAGGCAACAAAACGATTCTCGAAGATGTATCATTTAAGCTGAAACG
2646	80	122	MW2_CDS_01115	MW0205	FALSE	unmapped	ACATACGTATCAACATCAAGCGCTTGTAGATCAATTACATGAATTAATAGCAAACACTGA
2647	80	120	MW2_CDS_10713	MW2023	FALSE	unmapped	TGGAAACAATTTTTGATTATAACCAAATTAAACAAATTATACCTCACAGACAGCCATTTT
2648	80	118	MW2_CDS_13208	MW2500	FALSE	unmapped	AAAGGAAATTATCCTGAAGTAACTGCGGCAACATTTGCTTGTTTTGGTTATGGTTGGCAC
2649	80	116	MW2_CDS_01285	MW0236	FALSE	unmapped	AAATGCCATCAAACATGCGTTTACGAATCGAAAGCAAGGTAACGATATTGACGTGTCAGT
2650	80	114	MW2_CDS_10348	MW1954	FALSE	unmapped	TGATAGTGCTAAAGAAAAATCAAACGAAGGCGTTATCGTTGCAGTAGGAACTGGACGTCT
2651	80	112	MW2_CDS_10759	MW2032	FALSE	unmapped	CAGCAATCGCAATTGGTTTATCAGCATTAGGAGCAGGTATCGGTAACGGTTTAATCGTTT
2652	80	110	MW2_CDS_03389	MW0622	FALSE	unmapped	GAAAACAGGCATTACTATATGAATGGTCTCGTATAAACTCGATGCTGGATACACAGCTGT
2653	80	108	MW2_CDS_04206	MW0769	FALSE	unmapped	GGGATGGCTATCAGTAATGTTTCGAAAGGGCAATACGCAAAGAGGTTTTTCTTTTTCGCT
2654	80	106	MW2_CDS_03926	MW0717	FALSE	unmapped	TGCTGGCCCATATGGACATGTTGGTGTTGTTGAATCTGTAAACCCTAATGGAACAATTAC
2655	80	104	MW2_CDS_07765	MW1464	FALSE	unmapped	TTGTTCTTATGCACAAGGTTTCGCGCAAATGCGTAAAGCAAGTGAAGATAATGAATGGAA
2656	80	102	MW2_CDS_05015	MW0928	FALSE	unmapped	TCATCACTATAGACTTACCAGGACATGGCGAAGATCAGTCTTCAATGGATGAAACGTGGA
2657	80	100	MW2_CDS_01336	MW0244	FALSE	unmapped	CAACCAGGCTATTGCCACTGCACGTATGCAAGCAGACACAACATTTATTACTAAAATTGG
2658	80	98	MW2_CDS_01241	MW0228	FALSE	unmapped	TGCATTTGAATGTGTTGGAGGTAAAGGAAGTCAAGTTGCACTTCAACAAATAGTTGAACA
2659	80	96	(+)eQC-39		pos		
2660	80	94	MW2_CDS_07347	MW1372	FALSE	unmapped	GCAGCGCCAGATATATATGATTACGACGACGAAGGTATTGCTTTCGTAATCCTTGACGAT
2661	80	92	MW2_CDS_00535	MW0100	FALSE	unmapped	TTCAATGAAGAAGGGGCAAAAGCAGCTGCACTTAAGTTATCAAGTGATGGTACAAAAGCT
2662	80	90	MW2_CDS_10563	MW1994	FALSE	unmapped	AGCATTGTTACCTATTGGATATGCAGATGGCTATTTACGCATAATGCAAGGTAGCTTTGT
2663	80	88	MW2_CDS_09843	MW1847	FALSE	unmapped	ACCGGTTATGTATATAGAGTATAGTGGCATTTATGGCGACGTATCAAAGGTTCAAGCTGT
2664	80	86	MW2_CDS_09738	MW1828	FALSE	unmapped	TCGGCTTTGAAGAATGGCTATTATGCAGATACAGGCATTTCATTTGTCGTTGGAGAATCA
2665	80	84	MW2_CDS_07209	MW1347	FALSE	unmapped	AGATAGCGATTGTAACAGGTAAAGTAAGCAACGAAGAAACTGAAATTTTGAAATGGGTGG
2666	80	82	MW2_CDS_02356	MW0435	FALSE	unmapped	TTGCCAAAGCATTAGTAGATGTTAAGAGAGAATTAACATATTGTAGCGTATGTGGTCACA
2667	80	80	MW2_CDS_08752	MW1645	FALSE	unmapped	ATTAAATGAAGACTACTGTATCCCAGGACCGTTTGATAAACGTGTAGCGCCATCAGTTGC
2668	80	78	MW2_CDS_13149	MW2488	FALSE	unmapped	AGGGATATCTGGTTTTGCGGTTCTAATGACTTTGTTCTTTATAGTTGGCGACCAAGATCA
2669	80	76	MW2_CDS_10246	MW1935	FALSE	unmapped	TGGAAAGCTATACAACTACTAGATATACCGGTAGAGAAAATACACTTATATTTTTTTAAA
2670	80	74	MW2_CDS_08482	MW1596	FALSE	unmapped	ACTAATTCTTCAAACAATGCTTGTGTCTTTACAAACTATTGAAGAAGAATATAATGAGAA
2671	80	72	MW2_CDS_00846	MW0157	FALSE	unmapped	TTTAGGTAACGCTGCAGCGACTGCATACGGTTGTGATTTATCCTATGATTATGTGCGTAT
2672	80	70	MW2_CDS_02701	MW0498	FALSE	unmapped	TTAGTTGAAGGTCGTGCGATTCGTCTACATCCACTTGTAACAACAGCTTATAACGCTGAC
2673	80	68	MW2_CDS_03220	MW0592	FALSE	unmapped	GGAATCATTGCAGCAGTAGTTGCAGGACTTGTACATGGTTTCGAACGTGACAGAATTATG
2674	80	66	agr_tiling 202_R		FALSE	unmapped	CAATCCTATGGCGCAATTTTTAACAAAATATACTAAATTTGAAATTGACAGTTTCCATAA
2675	80	64	MW2_CDS_07804	MW1471	FALSE	unmapped	CTCGGCATTAGAATTAGGACTAACAACACACGCACATCCTTCCATCTCTGAAGTGTTGAT
2676	80	62	MW2_CDS_12721	MW2407	FALSE	unmapped	AGTTAATTCTGGAATGAACATCCAATTAAAAGGAGGAGCCTTAAAATCCAGAGAGATGGT
2677	80	60	MW2_CDS_01313	MW0240	FALSE	unmapped	GCTAAGGGCTCTATCTTCGATTATTTAGAATCAAACATGAAACTTCGTATTGGTTTTTCA
2678	80	58	NC_S_020		FALSE	unmapped	ACAGGGGGAGCGATTAAACAAAGGGGTAGAGCTATATAACAGATAGCTTTTAATCGTTCA
2679	80	56	MW2_CDS_03221	MW0593	FALSE	unmapped	GAACAACGTGCCATGATTACAAGTGAAGGTGCCTTCAAGTACTTCTCAAAACAATACGGT
2680	80	54	MW2_CDS_01754	MW0319	FALSE	unmapped	ACAAGGTTCTGTTGACCTATTAAATGAAGTTGCAACTTCTAAAATCACAGGTGAAGAAGA
2681	80	52	MW2_CDS_05401	MW1000	FALSE	unmapped	TTGGAAAAGGGAAATAAATAAACACAAAAATGTTATGTTAGCTGCAGCTGTTTTTGCTTT
2682	80	50	MW2_CDS_12124	MW2295	FALSE	unmapped	TTGGGCACACAGGTATGCTTGCAGGTTTATTGTTGCTATTTTTCCTTTTAAGACAAGCAA
2683	80	48	MW2_CDS_02201	MW0406	FALSE	unmapped	AGATTTATTGATGGATCGTGATCAAAGCGTTGATGAAACAGATGAGCGTTCGATTGCTGA
2684	80	46	MW2_CDS_01188	MW0218	FALSE	unmapped	TTTTCATTTGGCCAAGCATACAAGCCGGCATTTATCATGTTGGTGGATTTGTAACGAAAA
2685	80	44	MW2_CDS_00660	MW0124	FALSE	unmapped	ATCTTAGTGAATCAAACTAAGGGTGACAATCCTCAGTTTATGGCACAAGAGGTTCAAAGT
2686	80	42	MW2_CDS_05499	MW1019	FALSE	unmapped	ACGACCATACATGATACCGATGATGGTCGTTTTTTTAATGAACACAAACATGCTAACAAC
2687	80	40	MW2_CDS_03457	MW0634	FALSE	unmapped	GCCCGTGACATGTTGAAAAGAGAGCGATTATTTTTTGACAAAATGCAGGCACATATTGGT
2688	80	38	MW2_CDS_01849	MW0336	FALSE	unmapped	AGTTGGTGAAAGAAGGTTTAGAGCTTCGAAAATTGCTGGTCTAAAATACGTATCAGCGAT
2689	80	36	perR_tiling_021_R		FALSE	unmapped	TTGATGAGTCTCCATATGTTAATTCTTTTACAATTCCAATATCTTTAAACACTCTTAAGT
2690	80	34	MW2_CDS_11634	MW2204	FALSE	unmapped	AAGTGCATACTTAATCGAATTATCAGTTTTCTTTTAATTGTTCACAGCACGTTCCTTTTT
2691	80	32	MW2_CDS_02064	MW0382	FALSE	unmapped	AGCGATAGCAAAAGCAAGTTTAGCATTGGGAATGTTAGCAACAGGTGTAATTACATCGAA
2692	80	30	MW2_CDS_11702	MW2217	FALSE	unmapped	AGGTGTTGTAACTTCACGTACAATCTCAGCTAGCCAAGCTGCTGGTTATAACTTCATTCA
2693	80	28	MW2_CDS_04586	MW0846	FALSE	unmapped	TTGGTAATATAAGTTTGAGATATTATCCTTTTTCAAAATGGACGATTCAGTTCAAATCTT
2694	80	26	(+)E1A_r60_n11		pos		
2695	80	24	MW2_CDS_03560	MW0653	FALSE	unmapped	CGAAGGGCAAACAGGATTTCCAATCATTGATGCAGCAATAATGGAATTGACACAAACTGG
2696	80	22	MW2_CDS_02469	MW0456	FALSE	unmapped	CGGCGTAGTTGAACAACCATTATTCAACTTAGAAGTAACTGCTACTCCAGACAATATTCC
2697	80	20	psma_tiling_020_R		FALSE	unmapped	GCAACGCAATTCTGCACGTGGCCAATATATCTTGGGATAGATTATGAAAATCATTAAGAT
2698	80	18	MW2_CDS_04043	MW0737	FALSE	unmapped	GCTGACCATGGTAACTCTGATCAAGTATTGACGGATGATGATCAACCAATGACTACGCAT
2699	80	16	MW2_CDS_09594	MW1802	FALSE	unmapped	CGCCTATCAGGACAAACAGTTTTATTTTTAGGTACAGGTGCAATTGCTACTAGAACTGCG
2700	80	14	MW2_CDS_00859	MW0159	FALSE	unmapped	CGCATATAAAGCAGGATTTCACCCCCTACTTCAAGGCACTACAACAGTAGATTTTGGAGA
2701	80	12	MW2_CDS_07414	MW1386	FALSE	unmapped	AGGGTGCTTTCTGGAAGAACTGGAGACATTTCGGACTGGAATTATGTGCCTAAAAATAGT
2702	80	10	psma_tiling_068_F		FALSE	unmapped	TCTTCATAAATATGCTTTGCCTAGACGAGACCTAACGTGTTATTCGTTTTAAACTTATAA
2703	80	8	MW2_CDS_07893	MW1487	FALSE	unmapped	GCGAATTTAAACGCTATTATGGACAAAGTTCGCCCAGGAGATATGGGATTTGATGCTGTT
2704	80	6	MW2_CDS_09939	MW1864	FALSE	unmapped	TGTTGAAACAATACCTGATAGCGAATTCGATGAATTCAGACATCATCGTGGCGCAACATC
2705	80	4	MW2_CDS_04928	MW0908	FALSE	unmapped	ACATCGATGTAGTAAGAAGAATTTCTGGTGGTGGCGCTGTTTATCATGATACTGGCAATT
2706	80	2	MW2_CDS_12630	MW2389	FALSE	unmapped	TTGGCATTCCCAAGTTATGTTGTAACGTTAGCATTAATTGCATTGTTTGGTATGGGTGCC
2707	80	163	MW2_CDS_02881	MW0530	FALSE	unmapped	AGCAAGCACCAGTTGAATCAGTAGGTGTGCTATTTCCAAATGTGGAATTGAAAACAACGA
2708	80	161	MW2_CDS_00960	MW0177	FALSE	unmapped	AAATTTACAAGAGATTTTCTTTCATAATTTAATTTATTTCTTCTCTGCAATATTTGGTTT
2709	80	159	agr_tiling 040_R		FALSE	unmapped	CCTTAATTAAGATAAAAATTCTTAAAATTAAACAACTCATCAACTATTTTCCATCACATC
2710	80	157	MW2_CDS_13548	MW2562	FALSE	unmapped	CCGAAAGAGAAATGGGTAAGGCTTCCTTCACTATGGGACTGTTTGGTATTACTGAAGGTG
2711	80	155	MW2_CDS_07029	MW1313	FALSE	unmapped	AGTCGACAAATCATTTGGTATGTTGAGAACTGAAGTGCGTTCAGAAGAATCAAATAGTCA
2712	80	153	MW2_CDS_00634	MW0117	FALSE	unmapped	CAAGCACAACGTTTCGGTGTAAAAGAAGATGGTTCAGCAAGTAAAGAACTTGTAGATAGT
2713	80	151	MW2_CDS_10859	MW2050	FALSE	unmapped	TGTCAAAAATCTTAAACACACAACTAATAGGTATCTTTAATAGGCTAGAAAAACAATCTT
2714	80	149	MW2_CDS_05538	MW1027	FALSE	unmapped	AAAAAGCATAAAAGTGTTAGTGACTTTAGAGGTGGTATGCCAAGCGAAGGTGGATTTGGC
2715	80	147	MW2_CDS_13014	MW2462	FALSE	unmapped	ATGCACAAAGTCCAATTAATAATCAAACTACTACTACAACTAGGAATCATCATTGTGATT
2716	80	145	RC4		pos		
2717	80	143	MW2_CDS_12933	MW2447	FALSE	unmapped	ACACGCTTGGTGTGCTATTCATATTCCTTTTCTTACTTGGGTATTTTTTACCAATAGGAA
2718	80	141	agr_tiling 129_R		FALSE	unmapped	CGGTCTTCGAGACTATTTCAATAAAAATATTGTACCTATGAAAGATAATTTACAAATGAA
2719	80	139	MW2_CDS_12613	MW2386	FALSE	unmapped	TTAGGTTTATTTATTGCCTGTGCAGACTTAGGTATATCGTTAGGTGGCGCATTGATGGGA
2720	80	137	MW2_CDS_01095	MW0201	FALSE	unmapped	CAATTCTTCGGTGCACGTGCGAACTTAGCTAAAACATTACTTTACGCTATCAATGGTGGT
2721	80	135	MW2_CDS_08935	MW1677	FALSE	unmapped	TGGCAAGAATTGGCAAAAATATTACATTAGAACAGCAACAAGCGTTTGATGATATTCGTT
2722	80	133	MW2_CDS_01853	MW0337	FALSE	unmapped	ACGAACTACTCAATTACAAATGGTACAGCTATCGTTAAAATTCCAGTGTCTGTCGAAGAA
2723	80	131	NA		ignore		
2724	80	129	MW2_CDS_10802	MW2040	FALSE	unmapped	TGAACCTCTAGCTGCTCCAAGTGCTAATTTAAGTGGTAGACCTTCACCAACAACTTTCAA
2725	80	127	MW2_CDS_11334	MW2143	FALSE	unmapped	AGGTGGTCACTTAAAAATTCGTCTAGTTGCTAACAAGGGTAGAGGTTACGCATTAGCAGA
2726	80	125	MW2_CDS_03679	MW0674	FALSE	unmapped	GAAAAAGCCATCGTTGTCTTTAGTGGTGGTCAAGACAGTACAACATGTCTCTTTTATGCA
2727	80	123	MW2_CDS_12406	MW2348	FALSE	unmapped	TCTCAACACCCGCAACTAAAAATCTGTGCATGTTTAGGATTAACGAATGACGAACAAGCT
2728	80	121	MW2_CDS_06752	MW1261	FALSE	unmapped	AGATACGTCAGAATCAAAAGCTTTTGCTGATCGTGATGACAAATTTTACTACAATCGCTT
2729	80	119	MW2_CDS_01600	MW0292	FALSE	unmapped	ACAGCGCCAAACTTCTTCCTACTCGAACGTATTAGAAAAGCATTCCCAGACAAATTAATC
2730	80	117	MW2_CDS_12634	MW2390	FALSE	unmapped	TCACTGATCGTGCGATACGTTCAGTGGCTTTCTTTCTAACTGCATTACCATCATATTGGA
2731	80	115	MW2_CDS_03146	MW0578	FALSE	unmapped	GTGATTTTTCCAATGACTATTGTTGTATACCTAAGGGTGTCACAAAAGAATTACTTGCGT
2732	80	113	MW2_CDS_05443	MW1008	FALSE	unmapped	AAAAGCTACCCTCGTATCATTAGCGAATTATTAGAGCATCATGAAGCACTAGCAAGTCCT
2733	80	111	MW2_CDS_05130	MW0949	FALSE	unmapped	AGCGGATGAAATATCTCCAGATACATGTCGAATTTGGGATAAAGCTACCAATGCAAACTT
2734	80	109	MW2_CDS_07448	MW1392	FALSE	unmapped	TGATGTACCTCAATTCAAAACCAATCCAATTCTAGTCTCAGGCGTATCATTTACACCAGA
2735	80	107	MW2_CDS_10371	MW1958	FALSE	unmapped	ACTTATCTGTTATGATTTACGTTTTCCCGAATTATTAAGATATCCTGCTCGCAGTGGTGC
2736	80	105	MW2_CDS_02942	MW0542	FALSE	unmapped	TGCGCATTGCTGACTTCTTAATCCCTACATATTCATATGTATCAGTCATTGAATTGAGCA
2737	80	103	MW2_CDS_05579	MW1034	FALSE	unmapped	GGTGAGCCAGGTATATACTCTGCACGTTATGCTGGTGAAAATAAAAGCGATGAAGCAAAT
2738	80	101	MW2_CDS_00319	MW0062	FALSE	unmapped	TCGTCTGTACAATTTGGTTTTTCAGATATGTTATATGGCATTGGAGGATTATGTGCAGGT
2739	80	99	MW2_CDS_10490	MW1981	FALSE	unmapped	AAATTGGAAACACTGCAACTACAATATGTCTCTAGCGGCCTTCAAAGTGCTGTTGTTGTT
2740	80	97	MW2_CDS_07024	MW1312	FALSE	unmapped	ACACCATTAACTGGAGAATTCGTGAAAATTGAAGATATTCCAGATCCTGTATTCGCACAA
2741	80	95	MW2_CDS_08060	MW1517	FALSE	unmapped	CGTCCTGAAACAGCACAAGGTATTTTTGTAAACTATAAAAACGTGCAACGTTCAATGCGT
2742	80	93	MW2_CDS_03317	MW0610	FALSE	unmapped	CGATGTGATAGCACGATATTTAGGAGAAGCGCCTGTTGGTGCAATCATTTCATTTATCGG
2743	80	91	MW2_CDS_06430	MW1196	FALSE	unmapped	TGAAGATGATATAAGTAACGGTAAAGGTTCAGTAACTTTTAATAAAAAAGATGCAGAGGT
2744	80	89	(+)E1A_r60_a22		pos		
2745	80	87	NA		ignore		
2746	80	85	MW2_CDS_08300	MW1561	FALSE	unmapped	AGCTACTACAATCATTGGCATAGCTGGTGGATCTGGCTCAGGAAAAACAACTGTAACTAA
2747	80	83	MW2_CDS_09799	MW1839	FALSE	unmapped	GCAGAAAGAGCTATGCATGAAAATTATGATGTATTAATCGCTGCAGGTGGTGATGGAACA
2748	80	81	MW2_CDS_05940	MW1104	FALSE	unmapped	AATGCGAGAGTTTTGGTGACTAAAAAAGATAAAACACCAATTGAAAAGCAGTTCGAAATT
2749	80	79	MW2_CDS_00049	MW0009	FALSE	unmapped	AATGATTATAAAGAAATTAGTTCATGCTCAAACTGTACGGATTTCCAAGCGCGTCGTGCT
2750	80	77	MW2_CDS_05111	MW0946	FALSE	unmapped	ATGTTGGCAATACGCCAGATGAAAATGGCAAATTAAAAGGTGACGTTGATTATGATGCGG
2751	80	75	MW2_CDS_13490	MW2552	FALSE	unmapped	TGAGCAGCAACACATGAACTATAACATGGCATTAACAAGTAAATTTGCTAAAGATCGAAT
2752	80	73	MW2_CDS_09216	MW1729	FALSE	unmapped	TAAATTAGCTGGTACAGAGCGTGGTGTGACAGAACCTGAACCATCATTCTCAACATGTTT
2753	80	71	MW2_CDS_13221	MW2502	FALSE	unmapped	TAGTGGGATTGCAGAACCAGTCTCTGTCTTAGATGCTTGTTTAACGCCTATTTTAGCTCC
2754	80	69	MW2_CDS_02728	MW0504	FALSE	unmapped	TCTTTCTGACTGGTTGTGGTAATGAAAGTAAAGGTATTACAGCGCCACACCATAATCCCA
2755	80	67	MW2_CDS_06674	MW1247	FALSE	unmapped	AAAGCAAGTTCATTAGTGGTTCTTGGAGATCCGTTAGGTGATGAAAATGCCTTTGATGAA
2756	80	65	psma_tiling_043_F		FALSE	unmapped	GCCATTCACATGGAATTCGTAGCAAAATTATTCAAATTCTTTAAAGATTTACTTGGTAAA
2757	80	63	MW2_CDS_01594	MW0291	FALSE	unmapped	ATGAACATTAAAGGCGGTTTTGGCACTGTCTTTGCAGATGCGATTGAGCACAAAAAATTA
2758	80	61	MW2_CDS_04006	MW0731	FALSE	unmapped	GGTCGTTTCGGTATGATTTTATCGAATGAAGGCGGTGCGTTACAAACAATGAAACTACCA
2759	80	59	MW2_CDS_12005	MW2275	FALSE	unmapped	TCATAGGCGGTCAAGCTGGGGTGTTTATTAATTGGCTTTCGAATGGTTGTAATGAATCAC
2760	80	57	MW2_CDS_04759	MW0878	FALSE	unmapped	TACAAGCAGGATGGATGTTAACTACGATTGCTTCTGTTGGAGAATTAGAGCGTATGACGC
2761	80	55	MW2_CDS_06274	MW1164	FALSE	unmapped	ACGTTACCATCAATCAAAGTCGTTGAACATCCAGATTTATTTGTTGAAACAAGTACTTGT
2762	80	53	MW2_CDS_04274	MW0786	FALSE	unmapped	TGCACCAATCTCTGGTAAAGTAGTTGAAGTCAACGAAGAACTAGAAGATAGTCCCGAATT
2763	80	51	MW2_CDS_11646	MW2207	FALSE	unmapped	TGAATATGCTGGCAAACGTAAAATTTTTGGTTTTCGTGGTATGGTCAATGGTCCTATCGA
2764	80	49	MW2_CDS_04907	MW0904	FALSE	unmapped	TTTTTTGAAGTCATGTCTGCATTTGGAACTTGTGGACTATCGCTTGGTGTCACAAGTGAT
2765	80	47	MW2_CDS_07883	MW1485	FALSE	unmapped	ACAGAAGCTCAATTGGCAGAAGTGGAAGAATTAACTGAAAAATATCGTTCAGATGAATGG
2766	80	45	MW2_CDS_07706	MW1453	FALSE	unmapped	GGCAAAATTGTAGATGTAGAAATTCATACAGTGACATTACCAAACGGTGAAACATCAACA
2767	80	43	MW2_CDS_05898	MW1097	FALSE	unmapped	TGCCGGCAAGAATATGCAAGGTATTCTACACTTAATATTCTGTTGGACAGGTATCCCACA
2768	80	41	MW2_CDS_09145	MW1715	FALSE	unmapped	AGCCCTTGATAAAGACCCAATTAAAACAGGTGCAGAATATGCTAAAAAGCATGGTTGGGA
2769	80	39	NA		ignore		
2770	80	37	MW2_CDS_04961	MW0916	FALSE	unmapped	ACCATACAAAAAGGTAATACACATATTTTGAAGAAACTTAATTTGAAATTTCAATGTGGA
2771	80	35	MW2_CDS_13096	MW2480	FALSE	unmapped	ACAAAGATACGATTGAGGAAGCGGTTGAAGGTGCTGATATCGTGACATTACATGTACCTG
2772	80	33	MW2_CDS_10949	MW2067	FALSE	unmapped	GCCTAGAGAGTTCTGTTTAGTTACAGTGTTGGAAGGTGAAGGACAAATGATTGTCGATGG
2773	80	31	MW2_CDS_10065	MW1893	FALSE	unmapped	GGATTGGTTCAAGTCGTTAATGGTGACTATGCTACAGGCGGAGACACTACAATTGAATCA
2774	80	29	MW2_CDS_13274	MW2512	FALSE	unmapped	TTGATTATGATGTTAACAATAAGGAAGATGCTGATAAAGTTGAAGCATTCTATGAGCAAA
2775	80	27	MW2_CDS_03489	MW0640	FALSE	unmapped	TGCTGATTCTACTGGCGAAATTAAGCGTGTAATTGCACATTTACCAAACTTTGAGTCCGA
2776	80	25	MW2_CDS_02032	MW0375	FALSE	unmapped	TGAAAAGCGTTAACATTCTATTAAATTTATTACCAACTGAATTAAAAAATATGTTAGAGA
2777	80	23	MW2_CDS_09555	MW1795	FALSE	unmapped	CGTCAAGGACTAATGGAAGCAAGAGAAATTTTCTTAGTAGTGACAGGTGCTAATAAACGA
2778	80	21	perR_tiling_032_R		FALSE	unmapped	TTCTTCTAGTTCATGTTCAATTGATTCTATTTCAACACTCATCTATATCACCATCTTTCT
2779	80	19	MW2_CDS_05343	MW0989	FALSE	unmapped	CAAAGCGTTCAACGTAGAAGGCTTAGACGCACGAATGGAAGCTTTAAACGAATACATACG
2780	80	17	MW2_CDS_13486	MW2551	FALSE	unmapped	TGTACGTAGTCTTGCAGTTGCTGAACCTGTAGTAAATGCTGCTGATGCTAAAGGTACAAA
2781	80	15	MW2_CDS_10991	MW2079	FALSE	unmapped	CCCCAGGTTTTAATTTTAGATGAGCCAGCAGCTGGTTTAGACTTTATTGCACGAGAATCG
2782	80	13	MW2_CDS_05809	MW1080	FALSE	unmapped	TGCTGGACTTATTGGATTCGAACATCCAGTAACAGGTGAATATATTGAAAGACATGCTGA
2783	80	11	MW2_CDS_00771	MW0143	FALSE	unmapped	ACGCGTAATGCGTGGTTAATTTTAATGGAAAGTGTGCCTCAACATTTGGATACTGATCAA
2784	80	9	MW2_CDS_10488	MW1980	FALSE	unmapped	AGACGTACATTTGTTGAAGGTTCTGCTGTACCATCACTATTTGGTATTCAACAAGACGCT
2785	80	7	MW2_CDS_13696	MW2587	FALSE	unmapped	TGGTCAAGCCCAGACAGAGGGAATACCCAACGCTAAAATCATCGCTAAATATTGTAAGAG
2786	80	5	MW2_CDS_02688	MW0496	FALSE	unmapped	GCAAGGTATGCCATCTGCAAAGAAAAGAATGAATGAACTTTTTGGAAATGTAGAAGTGGT
2787	80	3	MW2_CDS_02593	MW0479	FALSE	unmapped	AAATGAAGAGGACCATATTCGTATTCAAGCTATGGGAACTGACACGACATTACAGGCTTT
2788	80	1	MW2_CDS_13137	MW2486	FALSE	unmapped	TGTTCAACTAAATATAGCAAATTTAGGTACAAGAATTCCTGATAAGTATTTTCGTCAGAA
2789	79	164	MW2_CDS_02526	MW0467	FALSE	unmapped	AAGGATTGGGCGAGGCTGAGATTCAAAATATGATTAAAGAAGATCATGGTGCTGAAGCAG
2790	79	162	MW2_CDS_09998	MW1875	FALSE	unmapped	AAATATTTTAAAGGGACATGTTGCTCCTGGAGAGCATTTGCCGTCAATGAGAGAACTTGC
2791	79	160	MW2_CDS_03796	MW0694	FALSE	unmapped	ACCGGTTTAGATGCACAGCATTTACGAAATGAACTATCTGAAAGTGAGAAACAAAAAGCA
2792	79	158	MW2_CDS_00317	MW0062	FALSE	unmapped	TGTTACACTGCTGCTTGTTAACAAAACAGACAAAATAAAATATGCACATAAAGAAGAGTG
2793	79	156	MW2_CDS_04429	MW0817	FALSE	unmapped	ACATGTTAAACCTGCTACAAAACCAGACGCTTCTTGGGATGAGATGAAACAAAAAGCAGT
2794	79	154	MW2_CDS_04578	MW0845	FALSE	unmapped	TCGTTTCATCAAGTAGAAGAATGGTTTGAGATATTTCGACAGTTTGGTTATTTACCTGGA
2795	79	152	MW2_CDS_10959	MW2069	FALSE	unmapped	CTCGCACCAATTAAAATTACTTAAAAGTGTGCATCTTGTGAAAGCAAAACGACAAGGCCA
2796	79	150	MW2_CDS_10352	MW1955	FALSE	unmapped	TGTCGTTATATTCCAATTACTTAATCCTGAGGCTTTGAAAAAAGCCACGGAACAAGCGAA
2797	79	148	MW2_CDS_10138	MW1908	FALSE	unmapped	TCTTTCCAATAACCCAGATGCGGTTGATGGTAAAGATCCTACAGTTGCTATTTTGGACGA
2798	79	146	MW2_CDS_00356	MW0068	FALSE	unmapped	AGGCATACCTTTATGGGTGCACAGACGATGTTTAAAACCTATGTTCACGATAGCTAACCA
2799	79	144	MW2_CDS_08256	MW1553	FALSE	unmapped	TGATGCGCCTCAGCCGTTCAAAATCATGGCTAGTCATTATCTGTTTGAATATATACATCC
2800	79	142	MW2_CDS_09489	MW1783	FALSE	unmapped	TGGTAAAGTTAGAGAATTGAGTGGTCCTGTTGCGACGTCGTATACAGTCGAAGGTAACTT
2801	79	140	MW2_CDS_01549	MW0284	FALSE	unmapped	CTTGGTAATCAAAATATTATGGCAGTGGCTTGGTATCAAAATTCAGCTGAAGCAAAAGCA
2802	79	138	pMW2_088		FALSE	unmapped	ACGACCCACAATTAGAGAAAGAACGAGAGGATTTTTTAAAACAACTTGAACTGAATTGGG
2803	79	136	MW2_CDS_08076	MW1520	FALSE	unmapped	ACGAAAGACGGTAGAACTTTTTATGGTACCAATGTAGAAAATGCTTCTTATCCATTATCG
2804	79	134	MW2_CDS_12896	MW2440	FALSE	unmapped	AAGTCAATTAGAGGACAAAGGTTGGATTACACGTGAAAAGGATAAAGATGATAAACGTGT
2805	79	132	MW2_CDS_00863	MW0159	FALSE	unmapped	AGGTGAAGGTGGCGTTAATATACCACCGAAAGGATATATTCAAGCTGTGCGTCAACTATG
2806	79	130	MW2_CDS_13340	MW2524	FALSE	unmapped	TCTATGTTATATCCCTTTATTTTTCTTATTTATAGCATTGTATCCCTTTTTAGTATTTAT
2807	79	128	MW2_CDS_04036	MW0736	FALSE	unmapped	AATACATGGCACAAACTGATATTGATGGGGCATTAGTAGGTGGCGCATCACTTAAAGTTG
2808	79	126	MW2_CDS_11254	MW2126	FALSE	unmapped	ACAGGTATCATTATGCATATTACAATGTACTTTGTACCATTTGAATCTCGGAAAATGCCA
2809	79	124	MW2_CDS_06751	MW1261	FALSE	unmapped	AGCACACAACAAGCGAGATAACTTACAACAACAACTTGATGCTAATGAGCAAAAGATTGA
2810	79	122	MW2_CDS_02345	MW0433	FALSE	unmapped	ATTGCTTCATCGCCAAACACAGATGTATTGTTGCAACGTATGGAACAGTTAGAGCAAGAA
2811	79	120	MW2_CDS_12940	MW2448	FALSE	unmapped	AAGATAAAAAGCAGCAAGCTAAACCTCAAATTCCGAAAGATAAATCGAAAGTGGCAGGCT
2812	79	118	MW2_CDS_11442	MW2168	FALSE	unmapped	CAATGGCGTGGCGGTGGTATCGTATTCGGACCAACTCCAAGAAGTTATGCATACAAAATG
2813	79	116	MW2_CDS_10244	MW1934	FALSE	unmapped	TCGAGTTCAACAAATTTTAGAAGGTGTTCTATCAGAAAGTACCACATACGGTGATGCAAG
2814	79	114	MW2_CDS_01717	MW0313	FALSE	unmapped	GGTTCGAAGGTGTATTCATTTACCCTGCACTCTTAGCACTTATCATTGCCGCAATTTCAT
2815	79	112	MW2_CDS_07381	MW1378	FALSE	unmapped	AGATGAAAATAGAGCAACTCATACATCAATTTATGAAGTTGATTGGGAAAATCATACAGT
2816	79	110	MW2_CDS_04641	MW0857	FALSE	unmapped	CTCCAGGATATATTGGACATGATGAAGGGGGTCAATTAACTGAAGCGGTTCGTCGTAATC
2817	79	108	MW2_CDS_09890	MW1855	FALSE	unmapped	TTAGCAAATCACTTAGGTTGGAAAGGAAAAGGTACTAATTTTGACGTGTTACCACTGATT
2818	79	106	MW2_CDS_13750	MW2596	FALSE	unmapped	GCTGGCTTAAGATTAGGTGTCTTAATTAGTACTGCTGGAACGATACAGCGTATTCAAAAA
2819	79	104	MW2_CDS_08563	MW1613	FALSE	unmapped	AAGGATTTGTACCAAAATTCAAGTCGTATTTTGCTATTGGAGAACAAACAGCACGGACCA
2820	79	102	MW2_CDS_07957	MW1499	FALSE	unmapped	AAGAAAATAAGGTTACAGCAAAAGCTGTTTTTGATGCGGCAAAAGCTGGTGACCAATTCT
2821	79	100	MW2_CDS_07473	MW1398	FALSE	unmapped	ACAGCATGGTATGATCAGCAACGTACATTAGACAGTGCATTCAGAATTGCAAAAGCAAAA
2822	79	98	MW2_CDS_03935	MW0718	FALSE	unmapped	TCATTCCAGAAATGTTGACTGAAAACTTTATACCTAGAACAGAATTAAGAGAAACAACCA
2823	79	96	MW2_CDS_01854	MW0337	FALSE	unmapped	AGAAGGTATTAAAACACCTCAACCAATTATGACTGCTTATAATCATAGTGAAAACGGTGT
2824	79	94	MW2_CDS_08539	MW1608	FALSE	unmapped	AGAAGCAGCTGGTTTATATGATGCACATTTAAAAGATTGTCCATCAAAGCCTAAACACAA
2825	79	92	MW2_CDS_09503	MW1785	FALSE	unmapped	TGAAGAAGCAACTATTGAAACGGATAAGACATCTAAGCAAGGTTTATACGAGGTCATTCA
2826	79	90	perR_tiling_040_F		FALSE	unmapped	TATTTTTAAAAACAATCTAGTTAATTTTCTCAATAAGAATGATCTAATTGAGAATGAAGT
2827	79	88	NC_A_023		FALSE	unmapped	TGAACAAGGCGCTCAACGTAATATTACAATTAATGGATTGTTTCACAAGATGGTAAAGCT
2828	79	86	MW2_CDS_06936	MW1296	FALSE	unmapped	TGGGAATACTTTAAAGCCCAAATTAATCAAAAGCTTTCTGAACCAGAAACGAAAAAATCT
2829	79	84	MW2_CDS_11963	MW2268	FALSE	unmapped	TTTTCACCGTTAACATTCATAGCTGGGATTTATGGTATGAACTTTGTAAATATGCCGGCA
2830	79	82	MW2_CDS_06877	MW1283	FALSE	unmapped	ACCAATCGGCACACTGTTATCAGCCCTATCAGTTGATATTAACCCAATTCCTATTAAAGC
2831	79	80	perR_tiling_033_F		FALSE	unmapped	GTAATAATAATTATTATATAAGAAAGATGGTGATATAGATGAGTGTTGAAATAGAATCAA
2832	79	78	MW2_CDS_04617	MW0852	FALSE	unmapped	CAATAGGCGATATTGCAACATCACATTATCGACATGTCGATCTACCGGCTAGTGTTCCTT
2833	79	76	MW2_CDS_01242	MW0229	FALSE	unmapped	ACGTTTAGCAAGATACTGCGAGAAGCATAATGCAGTTGTGTTATTCAAAATGCATCCGTT
2834	79	74	MW2_CDS_06512	MW1215	FALSE	unmapped	ATTAGCAGCTGTAGAGGATGAATATAACGCGATTTATGTCATTGGTGATGCCGTTGGTGA
2835	79	72	NC_A_039		FALSE	unmapped	ACACGCAATTCAATAAAATGTCTAATCAATAAACCTCAATTACATTCAAATTCAAAAACT
2836	79	70	MW2_CDS_04607	MW0850	FALSE	unmapped	ATTTTCAAGAACAAGTACGTAAAGCAGTTGTAGCAGCAGAAGATAGCGGCAAAGCTGAAG
2837	79	68	MW2_CDS_04446	MW0820	FALSE	unmapped	TAACGTTCCAGGAGCCGAAGAATATACACATAGTATTCAAACACTCTCAAAGGCTCGGGA
2838	79	66	MW2_CDS_11273	MW2130	FALSE	unmapped	TGAATTAGCTTCACAACGTGGTGTTACAACAGAAAAAATTAATAATGCGCAAACTGCAAC
2839	79	64	(+)E1A_r60_a22		pos		
2840	79	62	MW2_CDS_07211	MW1348	FALSE	unmapped	TGGTCCTGAATTAGTGCCAATGCGTCAATTGACGAAAGAGTTAAACGTAGAAGAGGATGT
2841	79	60	MW2_CDS_00872	MW0161	FALSE	unmapped	ACGCATATTGGCGTAGATACGACAGCGCGAGATGCCTATCAATTAAACTACAATCAGTTT
2842	79	58	MW2_CDS_06871	MW1282	FALSE	unmapped	GATCAAGATGACCGCGTTGTTTTAGTAGACAATCCAGAGAACAATGAATATCCAATGGCA
2843	79	56	MW2_CDS_10054	MW1890	FALSE	unmapped	TAAATGGCTCGTAGGTGCCATATGGGCGCTTGTAACAATTGTTATGATTGCAGTCATTAC
2844	79	54	MW2_CDS_04454	MW0822	FALSE	unmapped	AAAGCAAATGAAATGCCAGATGGCTATTTAAAAATTAAAGTGAATGGTGGCGGGTGCACT
2845	79	52	MW2_CDS_03660	MW0671	FALSE	unmapped	ATTAACGATTGTTGTCAGTTTAACGCAACGTGTTACCGACTTTTCAAGTACACAATCAAT
2846	79	50	MW2_CDS_03964	MW0724	FALSE	unmapped	ACCAGTGACGATAGGATCTAACACTTTGATTGGTGCAAATGCTACCATTTTACCCGGTAT
2847	79	48	MW2_CDS_11710	MW2219	FALSE	unmapped	TGATGTGGACGACGATACCTGCATCAATCATAGGTTTATTAGTATGGTTTATTGCTGGAT
2848	79	46	MW2_CDS_02459	MW0455	FALSE	unmapped	TATTGTAGTGCCATATTATGGATATGCAAGACAAGATAGAAAAGCCCGTAGCCGTGAGCC
2849	79	44	MW2_CDS_00497	MW0093	FALSE	unmapped	CGATGTCTAAGTTATCACAAGTGATTGAGCAAAGTGGTTTAGCACCAGAAGCATGGCTTG
2850	79	42	MW2_CDS_08953	MW1680	FALSE	unmapped	TCCAAATTGGTGCACGTAATATGCAAAACTTCGAGTTATTAAAAGAAGCTGGCCGTACGA
2851	79	40	MW2_CDS_04246	MW0780	FALSE	unmapped	TGGCTGTTATGAAAACGAAACACTTATCGCAACAGCTGCCTTAGAACAAATTCGATACGT
2852	79	38	MW2_CDS_04204	MW0769	FALSE	unmapped	GCTCAGCAAATGCATCACAAACAGATAACGGCGTAAATAGAAGTGGTTCTGAACATCCAA
2853	79	36	MW2_CDS_00563	MW0105	FALSE	unmapped	TGCATCATTAAATGATAGTGGATCTGAGCGAAGTGTTGTATGGATAAATGCCATTTCAGT
2854	79	34	MW2_CDS_05837	MW1085	FALSE	unmapped	TTACCAGCATTTTCTGTTCAATACCATCCTGAAGCAAATCCAGGACCGTCAGATTCAAAC
2855	79	32	MW2_CDS_13654	MW2580	FALSE	unmapped	AGCAGGAAGAGCAAATGGAAGAAGTTCTAAATTAGACGGTCCGTATGATGGTTATGCTGA
2856	79	30	MW2_CDS_12590	MW2382	FALSE	unmapped	AAACTTGAAAAGCAATTAAAGCACAGAGGCTTAAAAGAAAAAGATAAAATGGACGACAAA
2857	79	28	MW2_CDS_03890	MW0711	FALSE	unmapped	TTTATAATAAAATGGCATCGTCTCAAACGATTCCAACAACAAGCCAACCAGCAATTGGCG
2858	79	26	psma_tiling_076_R		FALSE	unmapped	TGTCTAGTTAAACTGAAACCTGCAATAGTAAATTTTCTGCCATTATGTACAGAATCTACT
2859	79	24	MW2_CDS_02237	MW0413	FALSE	unmapped	AGGTGTTGAAAAAGGATTAGAAAAGGCATCGAAAGTTATGATGCCATTGCTGTTTGTCTT
2860	79	22	agr_tiling 186_F		FALSE	unmapped	TAGACAATTCGCTCTTTCGAATCTATAGATTCAATATTATGGCGATTGACGACAAAGCTA
2861	79	20	MW2_CDS_02888	MW0531	FALSE	unmapped	ACTATGATTGCATCTATGGGGATAGGGGGAGGTCTAGGAAATGCAGCATTATTTACTCGA
2862	79	18	MW2_CDS_08882	MW1667	FALSE	unmapped	GGATCGAAGTTGTATGAAGATGTTGAAAAGAAAATAGCACGAACTACTTTTAAGACAGGT
2863	79	16	(+)E1A_r60_1		pos		
2864	79	14	MW2_CDS_01263	MW0232	FALSE	unmapped	ATTGCAACAATTAATGATCTTACAGAAGCTTTTGAAGCAGACCTGTCTACGTCTTGGGGT
2865	79	12	MW2_CDS_13467	MW2547	FALSE	unmapped	GAAAAAGGTAAGTCGACTGGTCTTGTTTCAACAGCTGAATTAACAGATGCAACACCAGCA
2866	79	10	MW2_CDS_00056	MW0010	FALSE	unmapped	TCTTGTTATATATGCCGGTGCTGCGCAATTTATTATGTGCGCGTTGTTTATAGCAGGTAC
2867	79	8	MW2_CDS_03635	MW0666	FALSE	unmapped	TGGTTGAAGGTTTTATGGAAGGCTATGATCAAGTGATTGCAAAGCGTGATAGAAGTGGTG
2868	79	6	agr_tiling 108_F		FALSE	unmapped	CTTTTTAATATTCTATTTAAAATGTAGGCAAGTGCATAAGAAATTGATACATACACTACC
2869	79	4	MW2_CDS_01951	MW0359	FALSE	unmapped	GCTCATCTCCGTTGAACCATTGATTGACATGGGTAGAACAGCATTAAACGTGAACGATTC
2870	79	2	MW2_CDS_13335	MW2523	FALSE	unmapped	CCGACAAAAAACTCAAAACACGTGATGGCAGTGCGGCACTTAAAATTTGTAATTACTGCT
2871	79	163	MW2_CDS_05336	MW0988	FALSE	unmapped	TGAACCTGTACTAGGTGCAACAATGGGTGCAATCATGAGTACATTATTTGCAGTTGCATT
2872	79	161	MW2_CDS_00743	MW0138	FALSE	unmapped	AAGCTTGTATTGAAGCGGGTAAACGTGTCTATCGCACATTTGTTCAGGGAGAAATGATTG
2873	79	159	MW2_CDS_03393	MW0623	FALSE	unmapped	TGTCTGGTGGACAAAGACAACGAACATCTGCTGCAAGAGCGTTTATTACATTACCTTCTA
2874	79	157	MW2_CDS_08052	MW1516	FALSE	unmapped	ACGATTTTGTTGGTGTGTGTTCAAGAAAAGATTTATTAAGAGCTTCAATGATTGGAGCAG
2875	79	155	MW2_CDS_04673	MW0862	FALSE	unmapped	AATTGAATTACCGGAAGGGACTAAATATCTTGCTTGGTCTTTAATTGACTATGATGCAAT
2876	79	153	MW2_CDS_03216	MW0592	FALSE	unmapped	CGAGGTGCTTTATTAAAACGAAGAGTACAAACGAGAGTGAACTCCGCATCTTCACTTAGT
2877	79	151	MW2_CDS_13480	MW2550	FALSE	unmapped	CACCAACAATTGGTATGCATCAAAATTTGACAGTCATTTTACCGGAAGATCAAAGCTTCT
2878	79	149	MW2_CDS_00115	MW0021	FALSE	unmapped	ATTAAGCCCACAGATGGTGCAGATAAGAAGCATCAAGTGATTGGTGTGAGAAAAGCAATC
2879	79	147	NA		ignore		
2880	79	145	MW2_CDS_03598	MW0659	FALSE	unmapped	ACGCTTGTTCTAGAAAATACAAAACATGAACATTTTGTATTTGTTATCCCAGTAAGTGAA
2881	79	143	MW2_CDS_01829	MW0333	FALSE	unmapped	TGTAGATGCGGTAACACTCGCAGATAATTCATTGGCAACTGTCAGAATTAGCAACATTGC
2882	79	141	MW2_CDS_04947	MW0913	FALSE	unmapped	TGGTTCAAATTAATACTTGATGTTACAACCTTCATTCTGATTGCTATATTGTTATTTGTT
2883	79	139	MW2_CDS_10593	MW2000	FALSE	unmapped	TCAAAGATGAACAAGCGAAAGGCCATATTGTTGCGATGACAGGAGATGGTACAAATGATG
2884	79	137	MW2_CDS_00064	MW0012	FALSE	unmapped	GGGGAAGCCTTGGAGGAATGCAAGCAATGGAACTACTTTACAATCAACAGTTTGAAGTAG
2885	79	135	MW2_CDS_07963	MW1500	FALSE	unmapped	TGAGTCGAAAAATAAATAACTTTTATGATGTACAACAGTTATTGAAAAGTTACGGATTTC
2886	79	133	MW2_CDS_10732	MW2027	FALSE	unmapped	GCGTGTTGCATTATCTGGTTTAACAATGGCTGAATATTTCCGTGACGAACAAGGTCAAGA
2887	79	131	MW2_CDS_06839	MW1276	FALSE	unmapped	GCAAGTGACCGTGCACGACGCATAATTAAACCGATATTAGAAATTTTAGCAGGAATACCA
2888	79	129	MW2_CDS_12255	MW2319	FALSE	unmapped	CCACCACGTTTGCAAAACGGAACAAGTTGGTTCTATTTTGCAACAGACCAATGGAAATAT
2889	79	127	MW2_CDS_13670	MW2583	FALSE	unmapped	TTGCATATGCGCAAGCAGGTTATAAAACACTAATCGTAGACGGGGATATGCGTAAACCTA
2890	79	125	MW2_CDS_03544	MW0649	FALSE	unmapped	AAACAACCTATGGAAAAGTTTCGTTGGAAGAATTGGACTTAACTGTTAAAGACAGAGAGA
2891	79	123	MW2_CDS_08178	MW1539	FALSE	unmapped	AACTTGCCGGAGATTGATATTTTAAAAGTAGGTCATCATGGGAGCAAGACAAGTAGTTCT
2892	79	121	MW2_CDS_04131	MW0756	FALSE	unmapped	ACTTCATAAAGAAAGCGAAAAAATGTTAACTGAAGAAATGCAATTTTTTACTTATTCACT
2893	79	119	MW2_CDS_04758	MW0878	FALSE	unmapped	CGCTATAATGATGTGCTTGTGAAACCTGAAATTCGTATGCCTAAAGTTGGTGGACGTGTC
2894	79	117	MW2_CDS_09189	MW1724	FALSE	unmapped	TCTCAATTATTCACTTTTACAATTCATCATTGGATTTATAGCTTGTTATATTGGCTATCA
2895	79	115	MW2_CDS_11914	MW2257	FALSE	unmapped	TGATCAGCTTTACTTAATACAAGAAGCACCAATCGAACATCGTTTATCTGTACAACAGCT
2896	79	113	MW2_CDS_11832	MW2244	FALSE	unmapped	AAGTTGCGGATACGGAATATTTCACGCATCAACAAATGGCACACGGATTAGTAAAGAGTG
2897	79	111	NC_S_078		FALSE	unmapped	TGTGAAGTTTGATTCAAGTGAAATCGATGTGCAGTTTGAATGATTTTTGTGTCAATGAAA
2898	79	109	MW2_CDS_09903	MW1857	FALSE	unmapped	TGTTATTCCAGCTAAAAATACTGAAAAACATCGCCGTATCATTGACTGGGAAGTTGCAAA
2899	79	107	MW2_CDS_12298	MW2328	FALSE	unmapped	ACCGAAATTCATCCAATTTAGCGATCACAACATTGCACCTAAAAAGGCAGAACACTTCCA
2900	79	105	MW2_CDS_12902	MW2442	FALSE	unmapped	CTATCCGTTAAAAGTTCTGACGATAACACAACCGTATTATCTGTTGGGACTGGTGGCCAT
2901	79	103	MW2_CDS_10299	MW1944	FALSE	unmapped	AAGAGGCTTATCAAGGATAATAAAGATTTAATCGTGGTCAATATAGGTTGTGGCTTAGAT
2902	79	101	MW2_CDS_00635	MW0117	FALSE	unmapped	ACACAAGCTATTCCGAATGACACAATTTCTGTAAGACCAGATATGGATAAAGATTTCCAA
2903	79	99	MW2_CDS_00111	MW0020	FALSE	unmapped	TGCAGATTAACAGTGAACTCGTACCGCGTTGGTATGTAGAATATGATGGCGAATGGTATG
2904	79	97	MW2_CDS_03322	MW0610	FALSE	unmapped	TGGAACTGATTATGCTAAAATTCTACCATTAACAGCCTTGTTAGGTGGGATACTCGTGCT
2905	79	95	MW2_CDS_06069	MW1129	FALSE	unmapped	GGCTGAAGAAGAAGCAGCTGAATGGATTAAAGCGAATATGACAAAACCAGTTGTAGGCTT
2906	79	93	MW2_CDS_10030	MW1884	FALSE	unmapped	AGGCACAAGCTAGCACAAGCTTGCCAACATCGAATGAATATCAAAACGAAAAGTTAGCTA
2907	79	91	MW2_CDS_05863	MW1090	FALSE	unmapped	GATTATAACAATGGCTAAGTATGGTGAAAATGGACCTGGTGATCCCGGGACTGTACAACA
2908	79	89	MW2_CDS_07829	MW1475	FALSE	unmapped	TGACTAAAGAAACGCAAAGTTTTGAAGAAATGATGCAAGAATTAGAGCAAATTGTTCAAA
2909	79	87	MW2_CDS_00481	MW0090	FALSE	unmapped	ACCAGGACGTGAAGACGATGATGAAATCATATTACTTAATCCGATGGGTATGGCTATCGA
2910	79	85	MW2_CDS_06607	MW1234	FALSE	unmapped	GCAATCTTAACAAAGATGAATAAAGCAAACGCGATGATAATAAAGTCGATAACAGATTGG
2911	79	83	MW2_CDS_05946	MW1105	FALSE	unmapped	TGCAGTAAGAAAAGGCACAACATTACCTATAGACGTACATTTGATGATTGAAAATCCAGA
2912	79	81	MW2_CDS_04541	MW0839	FALSE	unmapped	CATTTGGTGGTAATCCACTTGCTTGTGCTGCATCAATTGCTGCATTAGATGTTATCGTTG
2913	79	79	NC_A_019		FALSE	unmapped	TGAACGATTAAAAGCTATCTGTTATATAGCTCTACCCCTTTGTTTAATCGCTCCCCCTGT
2914	79	77	MW2_CDS_04081	MW0744	FALSE	unmapped	GCATACAAGCCATTAGTCAAATGACACCAGCTTTTTGGGTTTACTTTGAATTTGATTTAC
2915	79	75	MW2_CDS_05803	MW1079	FALSE	unmapped	TTTATTGGCACTTCCATTTTAATAGCAGTATTTGTCGTTATATTTGACCAAGTTACTAAA
2916	79	73	MW2_CDS_07185	MW1343	FALSE	unmapped	AGTTTTAGAGGATACATTTGCAAGGCCGTTATCTCCATATGAAATAGAAACGTTAAATCA
2917	79	71	MW2_CDS_04888	MW0901	FALSE	unmapped	CACACGTTCAACGTCATTTATGGCAGACGATAAAGAAACTGTGAATCATGCTGTAGCAGG
2918	79	69	(+)E1A_r60_n9		pos		
2919	79	67	MW2_CDS_06991	MW1305	FALSE	unmapped	CGATGTCAATGGTATTACAATTGATAAGAATGCTTTTAAAGTGACGGTAAATGGCGCAGA
2920	79	65	MW2_CDS_13473	MW2549	FALSE	unmapped	GGAGTCATCATCATGTCGACCAATAAAAACGATTATGAGCATATGTTGTTTTATTTTGCA
2921	79	63	MW2_CDS_08056	MW1517	FALSE	unmapped	ATGAAGAAGGCGTTGAAGGTAGTAAAGATGCACGTACAGTTTTACACTTCCATCCTGCAT
2922	79	61	MW2_CDS_00047	MW0009	FALSE	unmapped	AAAATTCACTGGTCAATCTGCATGTTTCCGTAGTGAAGCAGGATCAGCAGGTAGAGATAC
2923	79	59	NC_S_015		FALSE	unmapped	GTCTGCTATAATGTTTTTAACTTCTTCAATAGAGAAGTTATCTCCTTTGTGTTGTTTATA
2924	79	57	RC2		pos		
2925	79	55	MW2_CDS_08734	MW1642	FALSE	unmapped	TCGACAAAATTAGAGACACTGCGTCAAGTCACGCACGAACATTTATCATTGAAGCAATGG
2926	79	53	MW2_CDS_09627	MW1807	FALSE	unmapped	ACATATGAATCAAATGAATTATCCGCATGATATTGATATTATTTTAAGACGCAACGTGGA
2927	79	51	MW2_CDS_06427	MW1194	FALSE	unmapped	ATTTAACAGGATATGAAATTTCTAAAAAACTGGAGTTTCTCAATACGTACTTTCACAATT
2928	79	49	MW2_CDS_09125	MW1711	FALSE	unmapped	TAGTTTACGCAACAAAAGACAATTCGTTAGACACACATGGTGATGAGACGTTACGGGCTC
2929	79	47	MW2_CDS_03681	MW0674	FALSE	unmapped	GGCTACCCAGACTGTCGCGATAGTTTTATAAAATCAATGAACGTAACATTAAGCCTAGCT
2930	79	45	MW2_CDS_01702	MW0310	FALSE	unmapped	AGGCTGATCAAAAGTTAGAGCAATTTGATATTACAAATGAGCAAGGTCATACGTTAGGTT
2931	79	43	MW2_CDS_07550	MW1419	FALSE	unmapped	AAGCAATAGGGATTATGACGGGGCAAGTGGTCTATAAATATGAGGAGGAGCAGGAAAATG
2932	79	41	MW2_CDS_09713	MW1824	FALSE	unmapped	TATCTATCAACGCAAAGTGATATTGAAGTAGTTGGTGAAGGCGCTTCTGGTAAGGAAGCA
2933	79	39	NC_S_086		FALSE	unmapped	TCATATTAAATCAAAGAGGCATTGATATACACTAAAAAGAGGCAAGATTACCTGCCTCTT
2934	79	37	MW2_CDS_11760	MW2229	FALSE	unmapped	TAACTGTTCAAGATATTGCCAAGCACCTGCAACAAAAGGCTTATTTAGAACGGTTGGACA
2935	79	35	MW2_CDS_09674	MW1816	FALSE	unmapped	TCCTGATGAAGTACGTGTTGAAGATATAGATGAATGGATTGGATTGTTAGATCAGCTTGA
2936	79	33	MW2_CDS_08737	MW1643	FALSE	unmapped	ACCACTTGGCGGTGCACATAAAGATATTGAACAGCAAGCTTTAGCTATTAAATCAGCGTT
2937	79	31	MW2_CDS_11145	MW2106	FALSE	unmapped	GTTCATTTGTATTACATTGATTGGGTTATTTAGTCAATGGGCACGTACGACAAATCGCGT
2938	79	29	MW2_CDS_00569	MW0106	FALSE	unmapped	ACATTTGATCTTGTAATGATTCCGCGTATTACCAAAATGTCTATCCAGCAATCACATAGT
2939	79	27	MW2_CDS_03977	MW0726	FALSE	unmapped	TTATTGCTACAGGTGCAGAATACAAGAAAATTGGTGTTCCGGGTGAACAAGAACTTGGTG
2940	79	25	MW2_CDS_03188	MW0586	FALSE	unmapped	CAGCGTTTATTTTAATGTTTCTGGCTTTTAATGTTGAAGAGGTTTTAGAAAGTTTACCGA
2941	79	23	MW2_CDS_03782	MW0692	FALSE	unmapped	ACAAAGACGTTATTGAATTTAAGAACAAGGTGGGTAATTTTAATGAAAACCATGGAAGAG
2942	79	21	MW2_CDS_00428	MW0081	FALSE	unmapped	TAAACGTGACCCTCTTGCAGGCAAAACGGTTACTGGCGGAATTATTACAATCAATGATTC
2943	79	19	MW2_CDS_12980	MW2456	FALSE	unmapped	GGGTGACTCTGCGGGCGGTCAAATTGCTTTATCATTTGCTCAATTGTTAAAAGAAAAACA
2944	79	17	MW2_CDS_08203	MW1543	FALSE	unmapped	TTATTTTGTTGTAACGCACGGAAATAATGAACGACAAGTTCAAGCGATTGCTAGAGCGGT
2945	79	15	MW2_CDS_02276	MW0420	FALSE	unmapped	CACAACGTTTATCAAGTTTACTAAATGTCGCAGGTTTCATAGTCGACGGCTACAATGGCT
2946	79	13	MW2_CDS_09338	MW1754	FALSE	unmapped	CAGGGGCTAAAGCTGGTGAGCGAATTAAAGTGATTGGTTATCCACACCCATACAAAAATA
2947	79	11	MW2_CDS_00449	MW0085	FALSE	unmapped	ATCATTGAAGCATATATGTTTCGTTTTAAGAAAAAAGTCAAGCCTGAAGTCGATATGACT
2948	79	9	MW2_CDS_06756	MW1262	FALSE	unmapped	CAAAACGGACGGCCCAATTCTAAACCTTGCTTCTGGTGTTTATTTTGCAAATGCATATGA
2949	79	7	MW2_CDS_02745	MW0507	FALSE	unmapped	TTAGGTGCAGTCAGTGGTGGCGCACATAATTCAATTAATGATGCAGTTGATGCTATGAAA
2950	79	5	MW2_CDS_06238	MW1158	FALSE	unmapped	ACGTGAAGCAGAAGAGAAAGTACGTGAAATAGTAGAGGCTGGTTTACAAGAAAAACGCAT
2951	79	3	MW2_CDS_08748	MW1645	FALSE	unmapped	TGACGATCAACATGGTACAGCAATTGTAACAATGGCAGGTTTGGTAAATGCATTGAGAGT
2952	79	1	MW2_CDS_03387	MW0622	FALSE	unmapped	GATATGCCGCGAATATTTGAACGAGGATTTACGTCAACGGCTAACAGAAATGAAACGACG
2953	78	164	MW2_CDS_09881	MW1854	FALSE	unmapped	AAATAAGCGTTTCCTGAATCCACAAGAATATCCAGTCGATTTAAGCAAGGCATGTTGGGA
2954	78	162	MW2_CDS_12718	MW2406	FALSE	unmapped	GATGGTGACATTTCATATAATCCGAATGTGCCAAGTTATTCAGCAAAGTATCAATTAAGT
2955	78	160	MW2_CDS_12009	MW2275	FALSE	unmapped	AGCGAGAGATTACTATCAACAAATTATGAATGACTATAGTACTACAGTAACCAATAAACA
2956	78	158	MW2_CDS_03873	MW0708	FALSE	unmapped	AGAAATGGTGGCGAAGAGTTCTCAGTTGTCATTCACAATTATTCACTTGATCAAAGTGTT
2957	78	156	MW2_CDS_13447	MW2543	FALSE	unmapped	GGAACAGACAATTTTAATGGTAACTCATTCAAATATCGATGCGTCTTATGCAGAGCGAGT
2958	78	154	MW2_CDS_00403	MW0077	FALSE	unmapped	AGACATCTACCATTGTTGAAACGACTTGAGCCACACATCGACCATTTTGTATTTGATGCC
2959	78	152	pMW2_051		FALSE	unmapped	TTTGCCTATGCTTCGACTTCAAAAGCGATAAATAGTGCTATTTTGTTAGAACAAGTACCT
2960	78	150	MW2_CDS_06196	MW1150	FALSE	unmapped	TGCATCCCAAAAAAGATATGATTCGTGTTGTTGTTAATAAAGAAGGCGAAATCTTTGCGG
2961	78	148	MW2_CDS_12395	MW2346	FALSE	unmapped	TGTGGACGATCGTATTGATTTAAATCATTACATATCATTTTTAGAAAGCACACCGAAGCA
2962	78	146	MW2_CDS_02317	MW0428	FALSE	unmapped	TATCGCTGCGATATCAACATCTTGTGTATTGGGGGCAATCGTTGGTATGAATAACGTACT
2963	78	144	MW2_CDS_06190	MW1149	FALSE	unmapped	TCAGTAGCACGTGAAGCTGGCGATCGCTCTAAAATTAGTGTCTTCTCTGAAAACAATGAT
2964	78	142	NC_S_046		FALSE	unmapped	GCAATGTGTTCAAATTTTCATCTATTCATAAGCTAGCCTTCGGGCTAGTTTTTTTTGTGC
2965	78	140	MW2_CDS_08276	MW1556	FALSE	unmapped	TGTTGAGGCTTTTATACCTGTTGCAAAACATGTTGAAGTTCAAGTTATGGGAGATGGGCA
2966	78	138	MW2_CDS_10493	MW1981	FALSE	unmapped	CAGGTAATGCAGCACTTGAAGAAGTCGCGCTTGCACTATACGTTCGAAATGATCATTATG
2967	78	136	NA		ignore		
2968	78	134	MW2_CDS_07489	MW1400	FALSE	unmapped	TCGCGAAAAATGAAGAGTTAAACAGATTTTACTTGCAGCATACCTTATTGCCAATCGTCA
2969	78	132	MW2_CDS_13645	MW2579	FALSE	unmapped	TTATGAGGGTGATTTTAAAATCAATCCACACGCATTACAGGCTGTTTCTCGTTTAGCCGG
2970	78	130	MW2_CDS_08944	MW1679	FALSE	unmapped	GACCACAACTTTCTAGTGTTATTCAACCATTATATGATATCGGTGCAGTAGGGATGCGCT
2971	78	128	MW2_CDS_06647	MW1242	FALSE	unmapped	TGTGACGCTAAAGAAAACCTTATCGAAGTATACGAGTTCACAGAAGAACAGGCTGAAGCA
2972	78	126	MW2_CDS_09468	MW1778	FALSE	unmapped	AGGACATACGTTATTAATTCCTAAAAAAGCTTCTGCTAATATCTTTGAAACTGATGAAGA
2973	78	124	(-)3xSLv1		neg		
2974	78	122	RC3		pos		
2975	78	120	MW2_CDS_04877	MW0898	FALSE	unmapped	AGCAAACTATTTTAATGTCAGCTGGTGCATTTGGTGTATCTAAAGGTTTTGACACGATGA
2976	78	118	MW2_CDS_06931	MW1294	FALSE	unmapped	GCAATCAGTTAGTGCTCAAGTCGATCGCATAACGATTCAACTGCAGAAACATCAAACACA
2977	78	116	perR_tiling_082_R		FALSE	unmapped	TTTTTATAAAATTTAAAATCTAAATCTGAAAAGCGTTGTTGTAATTCAGTTTCAACTTCA
2978	78	114	agr_tiling 099_F		FALSE	unmapped	GAATATAGTCTAATTTTAAAATAGAGAAAAATTATTATAAAAATTGTTATAACAACTAGT
2979	78	112	MW2_CDS_00664	MW0124	FALSE	unmapped	ATTATTAGCGCTATTGTTACATTTTTCGTCTTATCACCTAAATATCAAGCTAATACTCAA
2980	78	110	MW2_CDS_11310	MW2139	FALSE	unmapped	AGGGGTTATGATGCCAATGTTAAGAGAACGAGCTACAGACAGCTTAAATGGCAATTGAGA
2981	78	108	MW2_CDS_01178	MW0217	FALSE	unmapped	CAACCTTTGAAGACATTACTTGAACAACGTCCTGAGGGCAAAGCGCAAATTGAACAAATT
2982	78	106	MW2_CDS_04202	MW0768	FALSE	unmapped	AGTATCAGAGAGTGTTGAAACTAATTTTGTTGTAAAAGATTCGGATAATAAAAATATTTT
2983	78	104	MW2_CDS_13189	MW2496	FALSE	unmapped	AGGAGAATTTGTTAGTGGTGTTGCAGAAAAGCAATGGTTGGAAGAAAAAGGTTATGAAGT
2984	78	102	MW2_CDS_01648	MW0300	FALSE	unmapped	CTACGTTTGAAGTTGATGAGGTGTTAGTAGCACCGCTTATTCCAGGTATTGAACAGCGTT
2985	78	100	MW2_CDS_12482	MW2363	FALSE	unmapped	ACAGCAATCAAATCATACCGCAAGCTATGTTCCATAACCACAAATTGGAAGCATTGTACT
2986	78	98	MW2_CDS_11957	MW2267	FALSE	unmapped	CGTACCAGTAGAAAAGGCTTTGGAAGCAGTTGAATTACTTGAGGCACAAGCGTTACAAAT
2987	78	96	MW2_CDS_02046	MW0379	FALSE	unmapped	AGCTGGTGATAGCGATTTTGTACCTGCTGCTAAACTAGCAAGAACAGAAGGAATTGATTT
2988	78	94	MW2_CDS_10738	MW2028	FALSE	unmapped	TCTCAAGAGGATTCTAGTAAGGGGCATGGTCATTTGTCTTCTTATGAATTTGAGCCAGAT
2989	78	92	MW2_CDS_12154	MW2300	FALSE	unmapped	TGTGCGAATGAAGAAGAAAGACAACAATCAAAACTACTTAAAGCTGATTTTATTAATGGT
2990	78	90	MW2_CDS_06350	MW1179	FALSE	unmapped	TGGAACGTATATTATTGCTCAAAATGAATTTGGCATGTACATGATTGACCAGCATGCAGC
2991	78	88	MW2_CDS_00934	MW0172	FALSE	unmapped	CCTAGATGGCAAAGGTGATTTTACTCCTAGTAAACTATCAGGCGGTCAACAACAACGTGT
2992	78	86	MW2_CDS_05567	MW1032	FALSE	unmapped	GGAGCATGTTCTATGGTTATCAATGGTCGTGCAAGACAATCTTGTTCTGCGATTGTTGAT
2993	78	84	MW2_CDS_07355	MW1374	FALSE	unmapped	GTAGTGGCGACGGCGTAGAAGTATACGTGCATTGTGATGACCACGATATCGTATTTAATG
2994	78	82	MW2_CDS_09075	MW1702	FALSE	unmapped	TGTGCAATGTTTGCAATTTGTTGGGTTGCATATATTCAATGGGAGTCTACAATCGCTTCA
2995	78	80	MW2_CDS_07867	MW1482	FALSE	unmapped	CTTCAAGTTAACAACTGTGTTACAGTAGAACCTGGTGTTTATATAGAAGGTTTGGGCGGT
2996	78	78	agr_tiling 089_F		FALSE	unmapped	TAAAACGTAATTATAATCATTTAATGCTTCCACTTACTATCACACTTTCTCTTATAGTTA
2997	78	76	MW2_CDS_06248	MW1160	FALSE	unmapped	TGCAGGATTTGAATGCGGAACTGAATACTTAAATTTTGATGAGCAACCAGCAACTATGTT
2998	78	74	MW2_CDS_04533	MW0837	FALSE	unmapped	GTAACTGGTATTCAACCATACGGTGCGTTTGTTGAGACCCCTAATCATACTGAAGGACTG
2999	78	72	MW2_CDS_10312	MW1946	FALSE	unmapped	GGGACTAGTTGAAAAAATCGGAAATTCTTTTTTCCAATCAGTAACAACACGAACAGCGGG
3000	78	70	(+)E1A_r60_a135		pos		
3001	78	68	MW2_CDS_12426	MW2352	FALSE	unmapped	AGCTACGGATGAGGCAGTTGAAAAAGCTGCCAAGTTAGCACAATGTCATGAATTTATTGA
3002	78	66	MW2_CDS_06409	MW1190	FALSE	unmapped	TTGAAAGTGTGTTAGATGGGGTTTCTGAGCGTACCAAAGTAATAGCGATTCAACGTTCGA
3003	78	64	MW2_CDS_03045	MW0560	FALSE	unmapped	AGCACTCTTTTTCCCAATGATTAATTGGCTGATTCCAAAAAAGTACGTCAAAATCAGCGA
3004	78	62	MW2_CDS_00918	MW0169	FALSE	unmapped	GCGGAACAACGTCGTAACCAAGAACAAATTAGACGCATTTTAGATCATGCAGATGATCCG
3005	78	60	MW2_CDS_00567	MW0106	FALSE	unmapped	TCTTGCGTTGTTCTTGGTTTAGTAGGCACATACCAACAAGTTGGTATCTTTTCTAACGCA
3006	78	58	MW2_CDS_10202	MW1923	FALSE	unmapped	AACGATACAAGCAAAGCAAATGCCTTATTAGACATGGTAACGCAAGGTTTAAATCCAGCT
3007	78	56	MW2_CDS_05637	MW1048	FALSE	unmapped	ACCATTGATTCTTTTGCATTATCTCAAGAAACGTTTACTGGTGGTGTTACTCCTGCAGCA
3008	78	54	MW2_CDS_08247	MW1551	FALSE	unmapped	AGTCTCGTAACAAAGATAGCTACATACGGCAGTTTTATTGCAATTGCGTCGTTTGTCATT
3009	78	52	MW2_CDS_08249	MW1552	FALSE	unmapped	AGTTTGATTCAAAGCGTCTAAGTAATGCTAAGATGTCATTCATCAATCCAACTCAGCTTG
3010	78	50	MW2_CDS_10934	MW2064	FALSE	unmapped	TATTGGGCGTAGGTTTATGGCTTGTACCTAAACCAGTCCGTAATTTCGGTTATCGAATGT
3011	78	48	MW2_CDS_07552	MW1419	FALSE	unmapped	TGAACAAATTGAACAATCCGTTATAAGTGCTAGTGCGTATAACGGTAATGATACAGAGGG
3012	78	46	MW2_CDS_08761	MW1647	FALSE	unmapped	AAAGATATCGCGAGCGTTTTATATCTTGGTATCGTCGGTGATACTGGGCGATTCCTTTTT
3013	78	44	MW2_CDS_11799	MW2237	FALSE	unmapped	TTTGTTGTATTAACTGCAGCAATGTCAGGATGTAACTCAGGTATTTTCAGTGCGAGTCGT
3014	78	42	MW2_CDS_10384	MW1962	FALSE	unmapped	TGACGACTCTTTCAGAATACATTCGTGAAGATGACATGACCGGTCTTCGAGACTATTTCA
3015	78	40	MW2_CDS_06833	MW1275	FALSE	unmapped	ATGGCAAACGATAAGACGTGTTGTCTTACCAGCAGCGTTACCTGGTATTTTAACTGGATT
3016	78	38	MW2_CDS_05980	MW1112	FALSE	unmapped	TTGCCAACGATTGATGGAAAAGGTTTTGTATTTTTAGACGTTGGTGCAAATGCTGATGCT
3017	78	36	MW2_CDS_04187	MW0766	FALSE	unmapped	TTGACAACGAAAACGACAAGAAACTTGTGGTTTCTGCACCAACAAAGAAACCAACATCAC
3018	78	34	MW2_CDS_02708	MW0500	FALSE	unmapped	GGTACAATGACACCTAAAAAACCTAACTCAGCGTTACGTAAATATGCACGTGTGCGTTTA
3019	78	32	MW2_CDS_09580	MW1799	FALSE	unmapped	TTCACTTATCGGTGTTGCATTAGGTTCTATTTTAGGTGCATTCGTTGCGTTAATGAAATT
3020	78	30	MW2_CDS_12353	MW2339	FALSE	unmapped	TGAAGCGACTAGAGCAGGTGAAAAAGTAAGAGAAAATAACATTGCCATCGATGTAGCTTT
3021	78	28	NA		ignore		
3022	78	26	MW2_CDS_02826	MW0520	FALSE	unmapped	CGCTTAGTATCGTACGTCCCAAAAATAGAGCTTCATATGTATGGTTTTGGTTCTGAAAGT
3023	78	24	MW2_CDS_01192	MW0219	FALSE	unmapped	TACATTTGGAAATTGGACGCCTACAGCAGAATTCAATATTTGGGTAGATGCTGAAGCAGC
3024	78	22	MW2_CDS_10970	MW2071	FALSE	unmapped	CGTTGTTATTCATGCAATCATTTTAATGGGTATCGTTCAATATTACTTAAAACGTGGTCA
3025	78	20	MW2_CDS_13688	MW2586	FALSE	unmapped	GTGAGATGGGCTCAAGGGGGACACGAAGTATTACTACGAGACTTTTTTAGCACAATGAAA
3026	78	18	MW2_CDS_09694	MW1820	FALSE	unmapped	TTTTGTTCAATCAAGAGAAAGATTGTCGCCAAGTGAAGTGACAGCTATTGCTGACGCTTT
3027	78	16	MW2_CDS_07292	MW1363	FALSE	unmapped	CAAGTGGTATCGTAGCTGGAATTGGCTACGGTGATAATGCAAAAGCTGCATTAATGACTC
3028	78	14	MW2_CDS_06904	MW1288	FALSE	unmapped	TCGATGGCGGTATGAGTGATCATATCAGAACTGCACTTTATGACGCAAAGTATCAAGCAT
3029	78	12	MW2_CDS_07435	MW1390	FALSE	unmapped	GTAGACAAAGTAAAATCGTGGTTTGAAGATTTCGGTGGTGGAGGCGATGGAAGCTATCTA
3030	78	10	MW2_CDS_06392	MW1187	FALSE	unmapped	TGTCGTAAGCTTAAATTCTCAAGGCAAACAACACTTGATTTACAAACATGCGATCAGCAC
3031	78	8	MW2_CDS_01917	MW0352	FALSE	unmapped	CGCATTACCTTCACTTGTTTTAGCTATATATGATTATATGAGTTTTAGAATTTCTTCTGC
3032	78	6	MW2_CDS_00593	MW0110	FALSE	unmapped	AGCGATCATTTAATTCATGAAACGTCAACAACACCTGAGGAAAGGGAACGTGCATTTACA
3033	78	4	MW2_CDS_06744	MW1260	FALSE	unmapped	AAAACGAAAAATTGAGTCAATTAAAGCGATAGCCAATGTGCCAGTTGTCGCAGGATTTGG
3034	78	2	MW2_CDS_12222	MW2314	FALSE	unmapped	GTCGGTTGAATTAAGACCCGCTTCTTTGGATGATCTAGGCCTTGAAGCAGCTTTTAAATC
3035	78	163	MW2_CDS_01797	MW0328	FALSE	unmapped	ATGGTATGGTTAGCGGTGCATCGGCATTAGAATTTGAAAAAATTAGCACTGAAGGATGGT
3036	78	161	MW2_CDS_06052	MW1126	FALSE	unmapped	GCGTAGTATTGCGCAGACTGGTAATAAACCAGGTGTGACCAAACAACAACAATGGATTAA
3037	78	159	MW2_CDS_04910	MW0904	FALSE	unmapped	AGAGAAGTACACATTATGGATATTCAACGTTCATTTGCAGTATTTACAATGGCGACAATT
3038	78	157	MW2_CDS_07294	MW1363	FALSE	unmapped	TGAAGATTCTATTTCACCTGAATATAATGCAGGTATTGGCGTGTTGTCAGGGCCAAGTCA
3039	78	155	MW2_CDS_03359	MW0617	FALSE	unmapped	CAAGTAATTATTGGCGGTGATTCTGCAGGTGCTCAATTAGCTAGCCAATTTACGGCAATA
3040	78	153	MW2_CDS_01215	MW0223	FALSE	unmapped	GGTGTGTTAGCAGGTTACAAACCTGGAGACATCATTAATTTAGGAATGTCAATGGCTGCA
3041	78	151	MW2_CDS_07705	MW1453	FALSE	unmapped	ATCGATGCTAATGAATAAAGAAATAGAAGATGCGAAGACTATCATTGCATTGCAACACCT
3042	78	149	MW2_CDS_03552	MW0651	FALSE	unmapped	ACAATGACATTATTCGGACTTTTCTTTGCGTATAATGTAGTCATTTTGTTCATAGCATTT
3043	78	147	MW2_CDS_11332	MW2143	FALSE	unmapped	GCTTAAAACGCGCAGGAATCAATTCTGTTCAAGAGTTAGCTGACAAATCTGAAGCTGACA
3044	78	145	MW2_CDS_09729	MW1826	FALSE	unmapped	ATCAACGCAAATGTTGATCATTTTTACTGCATTAATGATTATTGCCAATTTTTACTACAT
3045	78	143	MW2_CDS_11618	MW2201	FALSE	unmapped	GCTAACGTTAGATGTTAGACAAAGATGGGCGAATGAACGCCAATATACGGGCATTGATTT
3046	78	141	MW2_CDS_11034	MW2087	FALSE	unmapped	AAAGCAAACGAACAAAAAGCGCTTATTGCACAAACTGCAGATGCGACTACTGAAGAAAAA
3047	78	139	ETG09_205211		pos		
3048	78	137	MW2_CDS_09676	MW1817	FALSE	unmapped	ACGTTTAAGAACTGCTAAAAATGTAACGACTAGAAATGACCCGGATGGCCGTAGTCGTTT
3049	78	135	MW2_CDS_05511	MW1021	FALSE	unmapped	ACTTCGAAATGCTGAATTTACCTAAATCACACCCTGCACGTGATATGCAAGATAGTTTCT
3050	78	133	agr_tiling 072_R		FALSE	unmapped	ATATGCACCTGCAGCCACTAAGAAGAAGCCTATCCCAGCGAGGCTTGTAAAGCAAAAAAG
3051	78	131	MW2_CDS_12087	MW2288	FALSE	unmapped	ACTGCCTGTTATTTTGTTACTGACGATCGTCGCGGACCACATTTCATATCACCTAATTCT
3052	78	129	MW2_CDS_11956	MW2266	FALSE	unmapped	GCCACTGAAGTATTCTTCATTCAATTTACAATCGTTGTATTCTGTATGGCAGTTGGAAGT
3053	78	127	MW2_CDS_12995	MW2459	FALSE	unmapped	TTGGTTTACCAGCGGCGGCATTTGCTATTTATAAAAATGCACGACCAGAACGTAAAAAAG
3054	78	125	MW2_CDS_05701	MW1061	FALSE	unmapped	CACAAGAGGCCTTGATAAATGTTTATTCGGTTACACTCTAGACGAATGGCAACAGATTGA
3055	78	123	MW2_CDS_11575	MW2194	FALSE	unmapped	AACCTGCCGTGACGATGGCAACAAGTTTACAATTAAGAGATGCGATGAAAGTATTAACGG
3056	78	121	MW2_CDS_00747	MW0138	FALSE	unmapped	GGCGGTCATTGTTTAGCTGTTGATCCGTACTTTATTATTGCTAAAGACCCTGAAAATGCA
3057	78	119	MW2_CDS_00625	MW0116	FALSE	unmapped	TGAATTTGCAGTCATTGTCGGACTATCTGGTGCTGGGAAATCCACGTTATTAAGATCTGT
3058	78	117	MW2_CDS_01391	MW0255	FALSE	unmapped	TGGCATCTTAGCTTTTCAAGACTTAGCACCGAAAGCATCACATTCTGACAGTATCAATGT
3059	78	115	MW2_CDS_07087	MW1324	FALSE	unmapped	AAGCACTTGAAAGCCAAATAAACAACGCAGCAACTCGTGATGAAGTAGCGCAAAAATTAG
3060	78	113	MW2_CDS_02370	MW0438	FALSE	unmapped	AGGTGGGTTTTTAAGAGCAGGTAATACAACATTCTTATGTGGTGTCAATGATGACCGTGT
3061	78	111	perR_tiling_074_F		FALSE	unmapped	AAATGGATTGCATGGTTTGCAACGGGTGTAAATACATTGCCGTTAGATTATATTGCAGAT
3062	78	109	MW2_CDS_07451	MW1393	FALSE	unmapped	TTTAAAACACGAGGTGAAAAAGCAGAAGCCCCAGAACCTACAAAATTAACAGGTGACTGG
3063	78	107	MW2_CDS_01017	MW0188	FALSE	unmapped	AATAATGAATTGGGCGGCAAGGTATTACAGATTGCCGAAGACAATGGAGAATATCACCAG
3064	78	105	MW2_CDS_09698	MW1821	FALSE	unmapped	ATGTAGCATTTGTCTGTCTTGGCAATATATGTCGTTCTCCAATGGCAGAAGCAATCATGC
3065	78	103	MW2_CDS_03602	MW0660	FALSE	unmapped	TCGCACAAAGATTTTTTGACTTTACAAGAACTAATAGATCGAACTGGATGCAGTGCTTCA
3066	78	101	MW2_CDS_11951	MW2266	FALSE	unmapped	CAGCTGCAACTTTAGGTCTTGTATTTGGAGGGCTTATCGGTGGTCCAGTTGTAAAATTTT
3067	78	99	ETG07_105829		pos		
3068	78	97	agr_tiling 022_R		FALSE	unmapped	GATGTTATTAATTATGAAAAAAATTTTATTTATCAAATAATGATAAATCGATGTTGTTTA
3069	78	95	MW2_CDS_12102	MW2291	FALSE	unmapped	GCGTTTGGCGTCGTCTCGCAAAAGATTTAATGCCTGAAAATTTACATGAGATCAAGCAAG
3070	78	93	MW2_CDS_02089	MW0386	FALSE	unmapped	TGGCGCAAGTAAGGAACTTAAAAATGTTACTGGTTATCGTTATAGCAAAGGTGGCAAGCA
3071	78	91	MW2_CDS_05449	MW1009	FALSE	unmapped	ACGCAATTAAGGAAATATCAAGGTAAGCCATTTGAATTTGATCAAACGGTGAGTTTTGAC
3072	78	89	MW2_CDS_08007	MW1509	FALSE	unmapped	TGATTCTAAAAATGACCGTGGCGCTCAAAAAGACCGACATGAAAATATTGGCTTCGGTTA
3073	78	87	MW2_CDS_11019	MW2084	FALSE	unmapped	ATTCACTCAGGTTTAACATTATTACAAATCCCTGAAGGCGTTGACTGGGATGGCGAAGTA
3074	78	85	MW2_CDS_01915	MW0352	FALSE	unmapped	CGTAAGCGCAATTATCACATTAGCTATTGGTGGTAAGTCTGTTGATAAGAATGACTTCCA
3075	78	83	MW2_CDS_11477	MW2175	FALSE	unmapped	GTAGGTTTCGTTGTACTTGGTGACATCTTTGGTGTTGGTGGAACTGATGCATTGTTCTTC
3076	78	81	MW2_CDS_05358	MW0992	FALSE	unmapped	CCGGCTCGTGGTATGATTGGTTATACGACTGAATTTATGTCAATGACAAGAGGTTACGGT
3077	78	79	MW2_CDS_02329	MW0430	FALSE	unmapped	CGTCGCATATTTAACTGAAGTTGTTGTGAATGAGGTTGTTGAAGCGCATGAAGTTCCAGA
3078	78	77	MW2_CDS_13264	MW2511	FALSE	unmapped	CGTGCTAAAGTGCAAGAACAATTTGTGGAAGATTTTAATCGCAAGACTGGTGCGAATGTG
3079	78	75	MW2_CDS_09299	MW1746	FALSE	unmapped	CCGCCATTTACAAACGTCGAAGGTGTGAAATCATACTCGCGTATAATTTCATTCCTAGGC
3080	78	73	MW2_CDS_07850	MW1479	FALSE	unmapped	AAGAAAATCGCTAAAAAAATTGGCTATCCGGTCATCATTAAAGCTACTGCTGGTGGTGGC
3081	78	71	MW2_CDS_06183	MW1148	FALSE	unmapped	AGCAAGAACGAAAGATATAGAGATACCGAGAGACAAAATAGCAAAAGCACGTCACGCAGT
3082	78	69	MW2_CDS_12755	MW2413	FALSE	unmapped	TGACCGTCAACATCGTGTTTTCTATCGTGTTCTGTATCAGTATGGTTATATTAGGCATTT
3083	78	67	MW2_CDS_07631	MW1441	FALSE	unmapped	TCGAAGGTAACATAATTGAAAAAGGATTCCTTGATAACTATTCAAGAAAACACAATCGAA
3084	78	65	MW2_CDS_07210	MW1347	FALSE	unmapped	TCAAACGATTGATGAAACATTACATCGTTTACCTATGCATAATAGAAAAGACATGATGGT
3085	78	63	psma_tiling_025_R		FALSE	unmapped	AAACATAAAACACGCCACAAAAATATAACGCGTCAGACTACAAAGATCACGAATATTCCG
3086	78	61	MW2_CDS_13848	MW2613	FALSE	unmapped	CATATTCTATCGTCGGTGTAGATTTAATTCTAGCGCCTGCTACACCAAGTAATACCGCGC
3087	78	59	MW2_CDS_03182	MW0585	FALSE	unmapped	TGGTGCGCTATTTCATCTAATGAATCATGCCATCTTTAAATGTGCGCTTTTCATGGGAGT
3088	78	57	MW2_CDS_04205	MW0769	FALSE	unmapped	AAATTGAAGTCGAGTTTGACAAAGGCCAAAGAACTGATAAATATGGACGTGGCTTAGCGT
3089	78	55	MW2_CDS_01779	MW0324	FALSE	unmapped	TGGGGATGACTTACAATATCGTCAACATTCAAGATGGCACTGCAACATACGTACATCAAT
3090	78	53	MW2_CDS_13606	MW2572	FALSE	unmapped	TCCAAATGCATTTCAAGAGCTATTACCTGTATTGACAGCACACCAAGCAAGAGTGATGAA
3091	78	51	MW2_CDS_06045	MW1125	FALSE	unmapped	AAGCGACATCAGGTGATCAAAGTCTTAAAGTTGAACAAGTAAATGGTGTTATGACCGGCA
3092	78	49	MW2_CDS_07150	MW1336	FALSE	unmapped	ACACCGTTCCAAGGACATACAGAAAAGTGGAATGAACATAATCAAAGTAAGTATGCCAAC
3093	78	47	MW2_CDS_08839	MW1660	FALSE	unmapped	TGAAATTGATCATGAAGTTCGTGATGTTAACGAACAATTTAGTGAACGTCCAATACACGT
3094	78	45	MW2_CDS_07258	MW1356	FALSE	unmapped	CTAGAGAAACAGCAGCTCGAGTTGCAGTCGGTGCCTTATGTAAAGTGTTATTACAACAGT
3095	78	43	MW2_CDS_04764	MW0879	FALSE	unmapped	GGACGAGATTCGACGTTTCTTACCTAGAAAAGTTCGTACGTTCCAATTACAAGAAGCACA
3096	78	41	MW2_CDS_13646	MW2579	FALSE	unmapped	AATGTTCAAGATATTAATGAGACTGCAGCGCCGTTAGCATATGGTGACAGTGAGTTGAGT
3097	78	39	perR_tiling_038_R		FALSE	unmapped	TTTACATGATGATTTCATTTAATAGCCTTTTTTAGCATCAACTTCATTCTCAATTAGATC
3098	78	37	pMW2_010		FALSE	unmapped	TGAGTTGTGTGTTTGTGATATTTCTTTGATATTGAAAATGAGTGTTGCTTCAACTTCACA
3099	78	35	MW2_CDS_03582	MW0657	FALSE	unmapped	TGGTGGATTTATGGCAGAAGTTTCACATCGTATGCCATTTTACTTTGCAGGAGCATTAGG
3100	78	33	MW2_CDS_11720	MW2221	FALSE	unmapped	TGGTCCACTGATTATATGGTTATTGAAAAAAGATGAATCGAAACTAGTTGATCGTGCTGG
3101	78	31	MW2_CDS_01190	MW0219	FALSE	unmapped	CTTGAACGTATTGGATATTATGGGACGCCAAGATATAGCAGTAGCGAAAGGTGCGGATAG
3102	78	29	MW2_CDS_01302	MW0239	FALSE	unmapped	TGAAGTGCTTGTTAAACATTGGCATCGTATCATCGGAGGTATTGGTATCGGTACAGTTGT
3103	78	27	MW2_CDS_01893	MW0346	FALSE	unmapped	AGCACTTACTATCATTGGCGCTTATGCTGCTTTATTCATTTTAAAAACAATAGACTCTCA
3104	78	25	MW2_CDS_02992	MW0551	FALSE	unmapped	AGCAGACTTTGCTGTTATAAAGGCATATGCCAAAGAACATCCAGAAGACGATATCCCGAA
3105	78	23	MW2_CDS_08262	MW1554	FALSE	unmapped	TTGGTATTGTGTTATTTGCTGCAGCTATGTCATCAGTAATTGGCTCAGCATACACAAGCG
3106	78	21	MW2_CDS_00078	MW0014	FALSE	unmapped	GCAACACAACTTAAAGGTGTGACAGTCGAAGAGGCGATAGCACAATTACAACAAGCAATT
3107	78	19	agr_tiling 013_F		FALSE	unmapped	TATGAGATCCACCGTTAAAATATATGAATAAGTCTAATGTTGGAAAAGGTCAAAAAATTA
3108	78	17	MW2_CDS_03774	MW0690	FALSE	unmapped	AAATGGCTGAGCATCGTTTGATGAATCATGATTTATATCCCGAAAAAATAGATAATCGTT
3109	78	15	RC4		pos		
3110	78	13	MW2_CDS_13194	MW2498	FALSE	unmapped	AAGGCACTACTGCAATGTATTGAAGCAGGCAACAATAAATTACGTTTTTACCAAAGCGCA
3111	78	11	MW2_CDS_09049	MW1697	FALSE	unmapped	TCACACTCTGGTATTACTGGAGAAAGCGTAAGCATAATATTGATCGTATGGTCGAATCTG
3112	78	9	MW2_CDS_06907	MW1288	FALSE	unmapped	AGACCGCTATGCTAATGATACGGTGCAAGTTGTATTACGAGTTAATCCAGGTGTTGAAGC
3113	78	7	MW2_CDS_12345	MW2337	FALSE	unmapped	TGGGTGTCACAATGGTATCGATGATTGGTTCGGAAACGATTTTACCTATCTTTGTGCAAA
3114	78	5	(-)3xSLv1		neg		
3115	78	3	MW2_CDS_06459	MW1205	FALSE	unmapped	TTATGAGCGCTAAGAAGTCGGTATATTTGCAATCGCCTTATTTCATTCCGGATAACTCAT
3116	78	1	MW2_CDS_07092	MW1325	FALSE	unmapped	ACACTCGGATGCAAGAAACCAATGTTAATTGGAACAGGAGTTCTTATTGTCGGAGAATGT
3117	77	164	MW2_CDS_08716	MW1639	FALSE	unmapped	AAAGCACTTATTTTACACGCTGATCATGAGTTGAACGCATCTGCATTTACAGCACGTTGT
3118	77	162	MW2_CDS_08484	MW1597	FALSE	unmapped	ACTGTATTCACATACAAACGTCGTAAAAATTCAAAACGTAAAAAAGGCCATCGTCAACCA
3119	77	160	MW2_CDS_08264	MW1554	FALSE	unmapped	GTTGTGGCATATGTGATGTTTGTTTCTAATCCACCTTATGGTGATGCTTTTGTGCATACA
3120	77	158	NC_S_044		FALSE	unmapped	TCGTTTTGATTTTTATAGCGAAAAAGTTGAGTATCGGTAATTTTATCATATTGTTCGAGT
3121	77	156	NC_A_024		FALSE	unmapped	TCCCCTCACTAGGGCAATAGTGAGGGGATTTGGTGTATTTAGATGTTCAATTTATTATGT
3122	77	154	MW2_CDS_06837	MW1276	FALSE	unmapped	ACAGTTATTGCGACTATATTTGCAGTTCCAGTCGGGCTTGGTGCAGCAATTTATTTAAGT
3123	77	152	MW2_CDS_01788	MW0326	FALSE	unmapped	AATTGCAGATAAGAATTACACTGAAAAGCGATTGGAAATATTGGATGAAGGTGAACGCCA
3124	77	150	MW2_CDS_02297	MW0424	FALSE	unmapped	ACCACCGAAAGATATCTTCCTAGCCTCAGTGTTAATAGGTTCACTTGGCGCTATTATGGA
3125	77	148	MW2_CDS_08463	MW1592	FALSE	unmapped	CCTACACACGTAGTTGTTGAAACTGCTGGTGTTGGTTATGAAATTCAAACACCAAATTCT
3126	77	146	pMW2_072		FALSE	unmapped	AGATCCGAAAATCATTTTAGCTGATGAACCTACTGGGTCACTAGATACGAAAAATGGAAA
3127	77	144	MW2_CDS_04087	MW0745	FALSE	unmapped	GGTGCGCTAGTGACACAACAACAAAAGTTATTCTTTAAACTATTGTTCTACTCTGGAGCA
3128	77	142	agr_tiling 114_R		FALSE	unmapped	AGTAATAACATTCTCTTTGTTATTTGCATATTCGCAAATTGATGCGAGTGATGCATCAAC
3129	77	140	agr_tiling 166_F		FALSE	unmapped	TAACGAAAATAATGTTACCAACTGGGTCATGCTTACGAATTTCACTGCCTAATTTGATAC
3130	77	138	MW2_CDS_04826	MW0890	FALSE	unmapped	CTGCGACAATTTTAGGGAGATTCGAAAAAACATTAGAAAATGTAGCGCTACTCGCAGCGT
3131	77	136	MW2_CDS_05442	MW1008	FALSE	unmapped	AAACGAGAAAATGCTCAACATCATGATTCATTAATTCAACACCATCAGTTTGCAAGTGGT
3132	77	134	MW2_CDS_06220	MW1155	FALSE	unmapped	GGTGAACGAGTGACCGTGAATTGGCATCATTTCTTACGTCCTGAGATTAAATTTGATGGT
3133	77	132	MW2_CDS_04382	MW0807	FALSE	unmapped	ACATTGCCAAGCTGGACCTTTAGTACGTAGTTCTTATCATGCGGATGAGCAAGTAAATGA
3134	77	130	MW2_CDS_01950	MW0358	FALSE	unmapped	TCGCAAAGAAACATGGTCGCAGCAAATTGAGATGTTCCTAGGAAACAAAGCAAGATTAGA
3135	77	128	MW2_CDS_02155	MW0397	FALSE	unmapped	AGGTTTATCCAATCACAACAAAAAAATCTCCAGTATTAAAATTACATATAGATGGTGACA
3136	77	126	MW2_CDS_01887	MW0345	FALSE	unmapped	ATTAGAGTCGCATAAAGAGCTACAAAAAGATAGGGAAAATGTAAAAATTAATACAGCCGA
3137	77	124	MW2_CDS_03438	MW0630	FALSE	unmapped	TGGGGGTGCAACATTTTGAATACTGAGAAATTAGAAACATTGCTTGGCTTCTATAAACAA
3138	77	122	MW2_CDS_04474	MW0826	FALSE	unmapped	TGGTCATGTTACTGCGACAGCTGAAATTATTCATCAAGGTAAGTCGACACATGTATGGGA
3139	77	120	MW2_CDS_09118	MW1710	FALSE	unmapped	AGGTGTCGTTAAAAGTGTTCAAATTCGTCAATCAGTCAGGACGATTGAAATCGAAGCACA
3140	77	118	MW2_CDS_02609	MW0482	FALSE	unmapped	TTACTGACAAAAATGGGTAAGGAGCCTGGTCAGGCAGTAGGATATCTAGATGATGGTACG
3141	77	116	MW2_CDS_05169	MW0956	FALSE	unmapped	GCAGCACAACATGGTATAAAGGCAATTATCCAACCGGGTGGTTCGATTAAAGATCAAGAT
3142	77	114	MW2_CDS_12663	MW2395	FALSE	unmapped	TGGCTTTGCTAATAATTATTTCCCTGAATTACAAGTATTAGCAAACGAAATAAAATCTGA
3143	77	112	MW2_CDS_01053	MW0194	FALSE	unmapped	TAGGGATAGAAGAGATTGTGGTGAAACCGGAAGAAGCACGCAATGTAAATGCCCTTATAG
3144	77	110	MW2_CDS_07731	MW1458	FALSE	unmapped	GGCACCTGAAACTACAGGTACAATCAATGTTGAAGCGTTAAAAAACATTGGTCTTGAACC
3145	77	108	MW2_CDS_06358	MW1180	FALSE	unmapped	TCAATGAAGCTGTTAAAAATGGAGCGAAATATGTAACAACTAGTTATGATAAACTTTGGT
3146	77	106	MW2_CDS_01921	MW0354	FALSE	unmapped	TAGCTATCAACCGCAAAATAAAATCAATGTAGTCGACGTGCCAACAAAATATGCCGGTGA
3147	77	104	MW2_CDS_09648	MW1811	FALSE	unmapped	ACTTTAGTTCCTGATGATGATAACCGTTTCGTTGCATCCGTTACACAACAACCGATACAA
3148	77	102	MW2_CDS_01237	MW0228	FALSE	unmapped	AGGCAGTATTGCTTTGTTAGGCGTAAGTGAATTACCCGTGGAAGTGAATACACGATTAGT
3149	77	100	MW2_CDS_04993	MW0924	FALSE	unmapped	TGAAGTAGAAAGTAAAGTAGCAGGTTGTATTATTAGCTATAGCGGTGAAAATGAATTGAA
3150	77	98	agr_tiling 155_F		FALSE	unmapped	TTCTCTTTGTTTTGGATCGTCTTCGCAAATGAAAATTTTCATACATTCACATCCTTATGG
3151	77	96	MW2_CDS_09194	MW1725	FALSE	unmapped	TGCCAATATAACTTCGTAGAGCATAGAACATTGATTTATGTCCCAGCCTGTGACAATCCA
3152	77	94	MW2_CDS_01972	MW0363	FALSE	unmapped	ACTGTTAACAGGAGAAGATGGTGAACATGCAGTTTTATCACGTTACAACTTAGCGCCTGA
3153	77	92	MW2_CDS_04860	MW0896	FALSE	unmapped	TGGAGAAGCTGAACATGTTTTTGTGCCACACTTTACAATAGCACAAGGACTATCTAGCCA
3154	77	90	MW2_CDS_01939	MW0357	FALSE	unmapped	CATTCATTATCGACCCAGACGGTGTTGTACAAGCATCTGAAATTAACGCTGACGGAATTG
3155	77	88	MW2_CDS_09557	MW1795	FALSE	unmapped	ATGGCAATGAACTTTAAAGTCTTTGACAATAGTCAACTTGTAGCAGAATATGCTGCTGAT
3156	77	86	MW2_CDS_01734	MW0316	FALSE	unmapped	GGCACAATCCACAATGCGAACTGCCAAAGTACAACAACAAGTGTTTGAAGAAGAAAACAA
3157	77	84	agr_tiling 136_R		FALSE	unmapped	AAGAAATGAATATACCGATTAGTATAGAAATACCAGATGAAGTAACTCGCATTAATTTGA
3158	77	82	pMW2_103		FALSE	unmapped	ATGAAAAGTGTAAAAAGGTTGAGTGAAGAATTAGGGGTTAGTAAGCAAACGATTTTTAAT
3159	77	80	MW2_CDS_03554	MW0652	FALSE	unmapped	GTTTGGTGTAGGTATTTCACTAGGGAACGTTCTTTTGAAAACAGGTGCAGCTCAATGGTT
3160	77	78	MW2_CDS_03670	MW0672	FALSE	unmapped	AAAACGAATTGGTGGCGATTTATTTAATCACGTTACAATTTCTGGTGGTAACCCAGCATT
3161	77	76	MW2_CDS_05885	MW1095	FALSE	unmapped	GGTAGAGCTGGTCGTCATGAAAAGGCAGGTCAAGTCATCATTCAAACGTATAATCCAGAT
3162	77	74	MW2_CDS_05490	MW1017	FALSE	unmapped	ACTTTATCAACGTGCGAAGATGCATATAGTGAAACAACGAAAAGAATTGTTGTTGTCGCA
3163	77	72	MW2_CDS_00905	MW0166	FALSE	unmapped	TAGAAATGATTAACCAATCAGGTGCTACTTACTTATTGCCAATTGCAGCGATGGCTGGTG
3164	77	70	MW2_CDS_11933	MW2261	FALSE	unmapped	TTGGGGCAGTACAATCGTTTATAGTTCTCACCGTATGGAGCATGTTGAAGAATTATGTGA
3165	77	68	MW2_CDS_02176	MW0401	FALSE	unmapped	ACACGGACAGCAAAGGGACATTATTTTGTTAAGACATTTTATGAAAAGGATAAATTCCCA
3166	77	66	MW2_CDS_08710	MW1638	FALSE	unmapped	GCAGTGGGGTTACGATTTAGCATTATCTGAATTTGGTGATCAAGTATTCACTTGGCAACA
3167	77	64	MW2_CDS_00731	MW0136	FALSE	unmapped	AGGTGTGACAGGACTAGCTCAAGTGATGGGGAGAGATGATATCACTGATGATCAAAAAGT
3168	77	62	MW2_CDS_10380	MW1960	FALSE	unmapped	AGGTAAATTAATTGTTATGTATACTATTGCCTATATTTTAAACATTTTTATCTTCACTTT
3169	77	60	MW2_CDS_02133	MW0393	FALSE	unmapped	ACAATTGCACAAGATAGACCAATTAAAAGAGAGGAAAAAGGCGTTTTTACAGAAAATGTT
3170	77	58	perR_tiling_062_F		FALSE	unmapped	GGTACAGGTGCAATTGCTACTAGAACTGCGAAGTTAGCAAAGGCTTTTAATATGAATTTA
3171	77	56	MW2_CDS_13529	MW2559	FALSE	unmapped	AAAACCAGTAAAGTTTGTGTAGCAGCAACATTAGCATTGGGCACACTGATTGGAGTAACA
3172	77	54	MW2_CDS_03509	MW0644	FALSE	unmapped	AAAACGACACAAAGAAGAACAAAAACGCCAACAAGAAGCTGATAAAGCACGCATCAAGTC
3173	77	52	MW2_CDS_07693	MW1451	FALSE	unmapped	AAGAGTGTTTGGGGCATTTAATAGACCAAGGGCAATCTGCTAAATCTATTGCGCGATTTA
3174	77	50	MW2_CDS_05124	MW0948	FALSE	unmapped	AGCAGTTACCGGACAATCATTACCAAATTCAATTGAATTATTAAAGCCAGCAGTCATGAT
3175	77	48	MW2_CDS_08201	MW1543	FALSE	unmapped	AATATTGAAAAGTTATATCAAGATGCACCATTAGAATCATATAGTCAGGTTGCGTATTAA
3176	77	46	MW2_CDS_10057	MW1890	FALSE	unmapped	ACTAGCAAACGAAACAGCTGATCATGTGCTTGAACTTAGAGAGGAACATAAGCAACATCA
3177	77	44	perR_tiling_096_F		FALSE	unmapped	GATTCAAAGAAAAAACACCAAAATTTTATTGAGAAACACGGATTGAATTTCGATTTATTA
3178	77	42	MW2_CDS_01113	MW0205	FALSE	unmapped	AGCGAAACATAGATTAGAAAGTATTTACGATTCAATTTCTAACCCTTTGCATTCACAAAA
3179	77	40	MW2_CDS_10220	MW1928	FALSE	unmapped	TGATGAGCTAATTGGTTATTCATTAGACCCTGTATGGAACATGAGTGACTTAAAGAAGAA
3180	77	38	agr_tiling 020_F		FALSE	unmapped	TTTTCATAATTAATAACATCCCCAAAAATAGATTGAAAAAATAACTGTAAAACATTCCCT
3181	77	36	MW2_CDS_07728	MW1458	FALSE	unmapped	ATATTTTTGGTTTGCCAGGATTACTTTCTAGTCGTTCTTTTCAGGGCGGTGAACAGAAGC
3182	77	34	MW2_CDS_02454	MW0454	FALSE	unmapped	TGATGGCGGCATCGTAGAAGTCTATCGTACCAATGATGTTGAAGAAATCATGGGTGTAAA
3183	77	32	MW2_CDS_13147	MW2488	FALSE	unmapped	TGGTGACTCGGTCATGGTGGATATTGGTAATGTCTTTACTAAGAAAATACCAAATGCACA
3184	77	30	MW2_CDS_04715	MW0870	FALSE	unmapped	CCACCTGATTTATTACACCCACCTAAAGGTGATGCATTTGCGAGACGTAGTCAATATGCA
3185	77	28	MW2_CDS_02828	MW0521	FALSE	unmapped	ACTTTACAAACGAATATGAAACAAAATGCGGCAGGCGTTGATGTTTCTGGGAAATGGTTC
3186	77	26	MW2_CDS_03105	MW0571	FALSE	unmapped	GTACTGGTAATGCGATTACATTAAGAGAAATTATGGACGAAGTTGGCGTTGACGCTGCAC
3187	77	24	(+)eQC-42		pos		
3188	77	22	MW2_CDS_02263	MW0418	FALSE	unmapped	TCATTCAAAAGAAGCTCAAAAAGCGTTGCAGGAAGATGTCAAAGATGGAGAGAAACCTGT
3189	77	20	NC_S_111		FALSE	unmapped	ACGCATGTATTAATAAGTTATCGTATTGCAACGATTATTTTCAAACATGGGTCATACGGA
3190	77	18	MW2_CDS_01015	MW0188	FALSE	unmapped	ACATTTTCAAAGAATGAAGGGTGGCGTAGGTAATGCATATGCAGAAGATCCAAAACCGTT
3191	77	16	MW2_CDS_02322	MW0428	FALSE	unmapped	TTAGCAGTAGATTTCCAATTGATGGGTAGCAGCTTAGGTGGTACGTACTTATGGCCAATC
3192	77	14	MW2_CDS_01857	MW0338	FALSE	unmapped	TGAAAAAACAACATGCGTGTGGAACAAACCGTTTTAAGATTATTAGAATGGGTGCAGACA
3193	77	12	MW2_CDS_06156	MW1143	FALSE	unmapped	GGTGTTAAGTACTTAACTTTATACGCCTTTTCCACTGAAAATTGGTCAAGACCTGAAAGT
3194	77	10	MW2_CDS_03576	MW0656	FALSE	unmapped	TATAACAACCTTTGCAGATGACCAAGACTTAACATTTACATCTGTCAGCGGCATTGGTGC
3195	77	8	MW2_CDS_08342	MW1569	FALSE	unmapped	AAAGGGTATACTATGGCTGATATTCAAGTGCTTGCACCAATGTATAAAGGAAATGCCGGT
3196	77	6	MW2_CDS_09225	MW1731	FALSE	unmapped	GTCAAACTTTAGTGATTGGGCCATACTACCGAGGTAACAATGGGAGTGAAGGTAAAGACG
3197	77	4	MW2_CDS_12017	MW2277	FALSE	unmapped	GAAAACGGTAAGCAAGTAGATAAAGAATATGAGCTTGAACAAGGCTCGCAAGACCGCTTG
3198	77	2	MW2_CDS_10074	MW1894	FALSE	unmapped	CTGGCACGAAACGAGGGCTCCCTAAAGCGATGACAGATTTTCAAATTACCTATAAATGTA
3199	77	163	MW2_CDS_09666	MW1814	FALSE	unmapped	GTCTCACATAACAGTTTTACAAAGCGCTATTTTAGCTAGTAAAGTCAATGCACCTAGCGT
3200	77	161	MW2_CDS_01643	MW0300	FALSE	unmapped	AAGTGCGCATACGTTAGGTGTCCAACCACACATTGATCATTTTCCAGAAATGTGGTTATT
3201	77	159	MW2_CDS_09431	MW1772	FALSE	unmapped	ACCGCATGTACTTGGACATCGAAAAAATGGCCATTTACTACACCAGAAGGTAAGGTTTTG
3202	77	157	agr_tiling 131_F		FALSE	unmapped	ACGTACTTTAAGATTCTCAATACCATTTAACTTAAGAGCATTCATTTGTAAATTATCTTT
3203	77	155	agr_tiling 198_F		FALSE	unmapped	TAAATTATGTAGTAATAGGAATAGGTATACAAAGAAACGTTACATCATTTTTTAATTCAC
3204	77	153	MW2_CDS_10040	MW1886	FALSE	unmapped	GAACTATGACGGTAACGCAAATACGCCTGCAAAGTTACGTTGGGATAATTATTACGGCTG
3205	77	151	MW2_CDS_09024	MW1693	FALSE	unmapped	AAGAATATGCTGTAAAATACAATGCCGTTGAAGCAATCCAACATCGAGGCGAAACTGTCA
3206	77	149	MW2_CDS_01565	MW0287	FALSE	unmapped	ATGGCAGCATTTAGTTCGGCATTTATGAATGGGACGCTATTCCATCGCTTAAAATTAGGT
3207	77	147	MW2_CDS_04831	MW0891	FALSE	unmapped	AAAGTTGCTAAATTAGCCAAAGCACATCAAGTTGAGCGTGTCATTTGCAGACTTGAAAGC
3208	77	145	MW2_CDS_08905	MW1671	FALSE	unmapped	AGAAGAAATTGATCGCTTAGAACAATCTAAAAATGAAGCACCGCATTTACGTGAAGCTCA
3209	77	143	MW2_CDS_00800	MW0149	FALSE	unmapped	ATGCGAAGCAGTTTGCGGCAACTATTCGCCCACAATTTATTGCTTATCAAATTCCAATAG
3210	77	141	MW2_CDS_03168	MW0582	FALSE	unmapped	TAGTGGTACTATCACCAAAGTACATTCTGCTCAAATTATTGATAAAACAACAACTGTTTT
3211	77	139	perR_tiling_055_F		FALSE	unmapped	AAATGCTGACATTATTATAAATGCTTTACCAGAAACGCAAGAAACGATTCATTTACTAAA
3212	77	137	MW2_CDS_08747	MW1644	FALSE	unmapped	TCATATTTAACACATCCAACTACTGGTGGTGTATCTGCAAGTTTTGCATCAGTTGGTGAT
3213	77	135	MW2_CDS_10564	MW1995	FALSE	unmapped	GAAGGGTTCATCGTACATGTTAGTATCTCACACACTGAGCATTATGCGATGAGCCAAGTT
3214	77	133	MW2_CDS_10826	MW2045	FALSE	unmapped	TGCAGCGAGAAATATTGAAGCGGGTGGAAGTTTAACAATACTTGCAACTGCATTAGTTGA
3215	77	131	(+)E1A_r60_1		pos		
3216	77	129	MW2_CDS_13581	MW2568	FALSE	unmapped	GATGCTTTATTAGCACAAAAAGCACATGCACACGAAATCTCGCTTGAACAATTCGAGCAA
3217	77	127	MW2_CDS_04502	MW0831	FALSE	unmapped	ACAGGCACTGCTGATTTAAGACAATTTGGTGGCTTAATTAAACGATATCCTGTACTTGGT
3218	77	125	MW2_CDS_10649	MW2011	FALSE	unmapped	GGAATTCACAAGCCACACGTGACCACATCTCCTATGATGATCGTTATTTCCCAGATGTAA
3219	77	123	MW2_CDS_07752	MW1462	FALSE	unmapped	TATTGCTAGGAATTTCTGAAACGTGTAACCAGCATGGCTATGGTACACAAACGACAGTCT
3220	77	121	MW2_CDS_01024	MW0189	FALSE	unmapped	AGCTGCTGGCTACTTAGACAAGGAAATTATTTTAGGTATTCGAGCTGAAGACATTCATGA
3221	77	119	MW2_CDS_03326	MW0611	FALSE	unmapped	ATTGGCAAAATTGTATTACAACCAGGTGGGGTTCCAGCAGGTATTGTCGTAGCAATTATT
3222	77	117	MW2_CDS_10929	MW2063	FALSE	unmapped	AACGCAATCGAAATTGCTGGTAATGCTGGCGATGATGTATCAGAAGATATGTTTATAGGT
3223	77	115	MW2_CDS_05179	MW0957	FALSE	unmapped	TGCCCGTTTTGGTGATCCTGAAGCTCAAGTATTATTAAGTCGCATGGAAAGTGATTTAAT
3224	77	113	MW2_CDS_01814	MW0331	FALSE	unmapped	ACCAAAAGATGCACCTGGGTTCCCTGTTAGAGCATTTGCAATTAAACCATCAAATGACTA
3225	77	111	MW2_CDS_10546	MW1991	FALSE	unmapped	ATTGACCATAACGATGGCACAATGAGCTTTGCTGTTGCAGATGTCATTGGAAAAGGTATA
3226	77	109	MW2_CDS_09696	MW1820	FALSE	unmapped	GTGGCTATGACAAATGAAGAGAAAGTATTAGCTATTAGAGAGAAGTTAAATATTGTTAAT
3227	77	107	MW2_CDS_03966	MW0724	FALSE	unmapped	ACACATCATCATACAAACCCTTTATGGCGTGTATACCGTCTTGTTAAATTTTCGAAAGTT
3228	77	105	MW2_CDS_11171	MW2111	FALSE	unmapped	TCCGTGGTCATTATAGCGATGATATGGTCGCTTTTAAAATCTTTGAGTGAGGAGAAACCG
3229	77	103	MW2_CDS_01198	MW0220	FALSE	unmapped	TCGTGTGTACACAAGGCACGTCAGTATCACAAATGATGTTATACGAGTTGCGAAACTTAT
3230	77	101	MW2_CDS_09282	MW1741	FALSE	unmapped	AGTACTCATACAACTATCAAAAGAAAGAAAACTTAGTTTACTGCGATTTAATCGAGCATT
3231	77	99	MW2_CDS_09505	MW1785	FALSE	unmapped	ACAAGTGAGAGAAGAAGGAAAAGCCTTTTATCGTTTAACGCTTGTTATTAATAGTGAGAC
3232	77	97	MW2_CDS_12488	MW2364	FALSE	unmapped	TGTGGACGTGGTAGATCGTAATTTAGCAATTGTGCCGATAACAAGTATTACAACAGCAGT
3233	77	95	MW2_CDS_00220	MW0042	FALSE	unmapped	AGCCTACTGCTTTCCTAGAGAAAAAACAAAGCATAACAATATTGAGTACAATGTATCGTT
3234	77	93	MW2_CDS_01101	MW0202	FALSE	unmapped	ATGCTTAAGGGACACTTACATTCTGTCGAAAGTTTAGGTACTGTCGATGGACCGGGATTA
3235	77	91	MW2_CDS_12122	MW2294	FALSE	unmapped	TGTCGTGTTAAAGGATTTGGTAATACGACAACTAGTATACCTGGTATCTATGCGTGTGGA
3236	77	89	MW2_CDS_05123	MW0948	FALSE	unmapped	AGAGTGGCACTTACATATTTATGGTAAGTCTGAGCGTAAAGATAGCAGAAAAATGGGGCA
3237	77	87	MW2_CDS_07477	MW1398	FALSE	unmapped	TCAGAACCATTTGCTAAAAACCAATTACGTGAAAAAGCTCGTCTAACTAACATTAAAGGT
3238	77	85	MW2_CDS_11081	MW2095	FALSE	unmapped	AGCATTGGGCTTATTGTTTTATGGGTCGTATTTTTTAAAGAACAGTCATCTCAATCAAAA
3239	77	83	MW2_CDS_10133	MW1907	FALSE	unmapped	TTGGTTGCTAATTTGGTTAGCATCCTTTTTTTATTAGGTTTGTTTGTGGTTAATGTTTCT
3240	77	81	MW2_CDS_01527	MW0280	FALSE	unmapped	AAGATGGTAAAGTCATTGTTATTGGTATTCAATTATATAAAGATCGTGAAAAAATGTATT
3241	77	79	MW2_CDS_08687	MW1634	FALSE	unmapped	ATGAAGAATTACCGAAAATGACCAAAGTTAAATATATTCCATTTGGTTCAGACGATTCAT
3242	77	77	MW2_CDS_01019	MW0188	FALSE	unmapped	ACAAAGCGACCAAAACGTATTTTGGCAACAATTATCATTTTTCTTTCACTATTATTTACG
3243	77	75	MW2_CDS_04666	MW0861	FALSE	unmapped	ACAATTTATTTCAGTATTAACTTGTTACACAGTTATGGGTTTTGTATCTTCACGTTATTT
3244	77	73	MW2_CDS_05400	MW1000	FALSE	unmapped	TTCCACATTAATTTAGCAACAATTGGTGGTATTCTAGGCCTAGTTCAAATTATTACTGCA
3245	77	71	MW2_CDS_09069	MW1701	FALSE	unmapped	TCAACATATGGTACTGGAGCAATTATGGCAGTACCAGCGCATGATGACAGAGATTATGAA
3246	77	69	MW2_CDS_09182	MW1722	FALSE	unmapped	AGCTTAATGATTATTTTAAGCTTTTTCTTTAATACAAATAACGTTTTCCTAAGTGGACTT
3247	77	67	MW2_CDS_07909	MW1490	FALSE	unmapped	TCGACCTAATGCAAATAATAAGACAATCAAGCAGTTAAATGACTTGTATTGCTCGCGGAA
3248	77	65	MW2_CDS_03353	MW0616	FALSE	unmapped	CTGGTGCAGGCGCAACATTTGAAGAAAGTTATAACATACCTACATGGCTAGGTGCTTTAA
3249	77	63	MW2_CDS_00823	MW0153	FALSE	unmapped	CTTAGATGGTCGGATTGTACGTGTTGGTAATTTGACGAGTCCTTACAATGGAAGATGGCA
3250	77	61	MW2_CDS_07803	MW1470	FALSE	unmapped	GCGATGAAAGAAGCAAGAGATCGAGCTATTTCTGGTCAAGGTTCAACTTTGATTGAAGCA
3251	77	59	MW2_CDS_13868	MW2618	FALSE	unmapped	TACAACAAAAAGGATTTAATCCTGCATTAATGTCAGCTACTATTCACACACCCGGTGGCG
3252	77	57	MW2_CDS_06624	MW1237	FALSE	unmapped	ATTACCACAAGGCGCAACAGCAACTGATTTAGCGTTAAGAGTAACTCAAGAGCTACGTAA
3253	77	55	MW2_CDS_05451	MW1010	FALSE	unmapped	AAATTATCACACCGTGTATGTAAAAACTGTGGTTCTTACAATGGCGAAGAAGTAGCAGCT
3254	77	53	MW2_CDS_07431	MW1389	FALSE	unmapped	AGGCATTATAACATTAGCGCCAGGTAAAAATGAATTTAAGATTAAAGGAGACGTCAGTGA
3255	77	51	MW2_CDS_00198	MW0037	FALSE	unmapped	TCACTCAAGAACTCAAACAATATATAACCCACCTATTCCAACTATCTAATAACGAAGCTT
3256	77	49	MW2_CDS_04472	MW0825	FALSE	unmapped	CGGTTTTGGTTTATGTTTCCCGTATGTGTTATTACCATATGGATTCGGTCAAATTTTCCA
3257	77	47	MW2_CDS_02179	MW0401	FALSE	unmapped	ACAGATTTTGCCAAAAGTAATAAAGCAGACGAATTAAGTAATGAAGGTATGGTCTTATAC
3258	77	45	MW2_CDS_06882	MW1284	FALSE	unmapped	TGCTTTTCCCTTTATTAGATGAAGAGTTTCATTTGCCATTAGTTGTGGCAACAACTGGCG
3259	77	43	MW2_CDS_07039	MW1315	FALSE	unmapped	TAAATGTAACTACACCAGTTATTTCTGCACATACTGGTCAAGGTGCGATTGGCCTCGTAG
3260	77	41	MW2_CDS_03023	MW0556	FALSE	unmapped	ACACATTTACTTGACACTCAACTTGATAGAAAATTAGTTATTGCTATATGTTGTATCACA
3261	77	39	perR_tiling_016_F		FALSE	unmapped	ATGTGAACAATGTGGTAAGATTGTTGATTTTCAATATCCACAGTTAAATGAAATTGAAAG
3262	77	37	MW2_CDS_04347	MW0800	FALSE	unmapped	GATGGTGGATAAAGCGACAACACAAATACAACATGATTGTGGCATTAGAGTGCTGGTCTT
3263	77	35	MW2_CDS_12557	MW2375	FALSE	unmapped	AGCTAATTTTGCTAAAAGCGGTAAAATGCCTTGGCCGATGTATCATAATGAACGTCGCTA
3264	77	33	MW2_CDS_03721	MW0681	FALSE	unmapped	TCAAGTGGGAAAGAGCAATTCACATACTTCCCTAACTTTTTCCATCAAACAGGTCAAGGT
3265	77	31	NC_S_099		FALSE	unmapped	ATAAAAAGTTAGCCCGAAGGCTAACTTACGAATAGATAAAAATTTGAACACATTGCTGTG
3266	77	29	MW2_CDS_00596	MW0111	FALSE	unmapped	CCGGGTTATATAGTAGCAGTCATCGTTGGTGCACTAAGTGGTAAAATCGGCGAATATCTG
3267	77	27	MW2_CDS_11523	MW2184	FALSE	unmapped	CGGCTTTATGGCCGCTTTAGCAATCATTACTATGCTTGTTTACTTCTTAATTCATGGACG
3268	77	25	MW2_CDS_08090	MW1523	FALSE	unmapped	ACTGTTCTTGGGCGTGAACAAACAGAGCGATTTATTGAAAGAGGCATTATCGAAATAGCG
3269	77	23	MW2_CDS_12690	MW2400	FALSE	unmapped	ACAACAAGAGCGCATTACACTTTATCTCAAGCATAATACCAAGGAGCCAAACACAATCAA
3270	77	21	MW2_CDS_08582	MW1616	FALSE	unmapped	TTGATGACTTAAAAGGTTTAGTTGATGCAAACTTACGTGAGCGACAATTAGCGGCTGCAA
3271	77	19	MW2_CDS_05411	MW1002	FALSE	unmapped	TCAGATATTTATGCATCATTTGAGCAAGCTAAACAGGCGCTCGAAAACAATGACGAAGCA
3272	77	17	MW2_CDS_11648	MW2207	FALSE	unmapped	TCCTGAAACAGTTATCGAAGTTGAAAATACAGGAGATCGACCAATTCAAGTGGGCTCACA
3273	77	15	(-)3xSLv1		neg		
3274	77	13	MW2_CDS_11643	MW2206	FALSE	unmapped	GTCGTCGTAAAGCACGTGGTTTGAAACTAAATCATCCTGAGGCATTAGCTTTAATCAGCG
3275	77	11	MW2_CDS_00138	MW0025	FALSE	unmapped	AGAACAGCACAAAAAGATAAGACACTCAAGGAAGTGGAAGCACCTAAAGGAATAATTCCA
3276	77	9	MW2_CDS_08415	MW1583	FALSE	unmapped	CTTTAATATCCAACAAATGAATGGTGAAATACTATCAGTTTCACAATTTACTCTCTATGC
3277	77	7	MW2_CDS_12812	MW2424	FALSE	unmapped	TCCTTTCTAATTTGGGTGTCAATAGCGTTGGTAAAGGAGAAGTTGCTGTCACAATCGGTA
3278	77	5	(+)E1A_r60_3		pos		
3279	77	3	MW2_CDS_03420	MW0627	FALSE	unmapped	TGGCCCATATGGTCATGTTGCTTATGTTGAACGTGTCAATGGTGATGGTAGTATCTTGAT
3280	77	1	MW2_CDS_05751	MW1070	FALSE	unmapped	TCTCTTATCGATTAGAAAAAGGTCAAACAGGACGCATGTTAGCATTCATTGGTCAACAGT
3281	76	164	MW2_CDS_10085	MW1897	FALSE	unmapped	TGTGACAGAACAGGAAGAATACAAAAACAAGCAAGAAGAATACGAAAACAACATGGCTGT
3282	76	162	NC_A_065		FALSE	unmapped	AAGTGCATTAGACAACGAAATTCACCATCAAGATAATGAAGCAACAAGAAACAGCACACA
3283	76	160	MW2_CDS_10483	MW1980	FALSE	unmapped	TCAGGTCAAGCACGTAATATTGCTTTAAGTTATGCAAAAGGTATTGGTGCAACTCGTGCA
3284	76	158	MW2_CDS_10973	MW2071	FALSE	unmapped	AGCACAAGATTCATTAAATGATAATACAACAAAAACAATGACTTCAGATAAACCAGAAGA
3285	76	156	(-)3xSLv1		neg		
3286	76	154	perR_tiling_079_F		FALSE	unmapped	AGCATCAGAAATACCTGAGAGCGACTTGGCTGATTTAGATATATTAGTTGGTTATGATGG
3287	76	152	MW2_CDS_04668	MW0861	FALSE	unmapped	AGAAATACGTACAAAATAAGTCAAATAGCTATATGTTCCTATCATTATTAATTTCAGGGA
3288	76	150	MW2_CDS_04601	MW0849	FALSE	unmapped	GTGGATAAAGAAATGGCATTTCCATCTTTAGCTTCGGTTGCATATAGAGCTGTTGCCGAA
3289	76	148	MW2_CDS_10055	MW1890	FALSE	unmapped	AGCAAACAAAGATATTAAACAGAATTGAAGAAAGATATCAAACGCAAGTAGATGTTGCGC
3290	76	146	MW2_CDS_11573	MW2193	FALSE	unmapped	TCGATTCCAGGATCAACAGGCGCAGTTAAATTAGCATTAGAAAAGCTCATTAAACCAGAA
3291	76	144	MW2_CDS_11201	MW2116	FALSE	unmapped	AAATTGACACGAGACGGCCAAGCAGCCCTTGATTTCGTTCAACAACAATTTGAAAATTAA
3292	76	142	MW2_CDS_05441	MW1008	FALSE	unmapped	AGATGATCATTGGCATCATGTGGTACCTAAAGATATTCAACACTTGTACGTAACACCTCA
3293	76	140	psma_tiling_019_F		FALSE	unmapped	CTATCCCAAGATATATTGGCCACGTGCAGAATTGCGTTGCACGTTTAGACTGAAACACTC
3294	76	138	MW2_CDS_11830	MW2243	FALSE	unmapped	AGCTTACCAAAGCAACAACTTCCATACTTCATTTCATTTTTAAGTTTTCATCAGTATAGT
3295	76	136	MW2_CDS_00152	MW0029	FALSE	unmapped	TAAACAAACCAGCACGTGCAAACCAACTTGCTAATTGGGGAGTTGATGGTATCTTTACAG
3296	76	134	MW2_CDS_04063	MW0741	FALSE	unmapped	GGCAAACGTGCCGTGTTATTATTACATGGATTTACAGGCAATTCGTCTGATGTACGTCAA
3297	76	132	MW2_CDS_08679	MW1633	FALSE	unmapped	TGCGTGTATTAGCACACATTACACAAGATGAGAGTATGAAAGAAGCATTTATCAACGGCG
3298	76	130	MW2_CDS_03528	MW0647	FALSE	unmapped	TGAAGCGGTGCAAGCAATATTTAAGCAATTAGATTTAGAACATTTGGCACTAGAACGTCA
3299	76	128	MW2_CDS_05402	MW1000	FALSE	unmapped	TATGTATTATATCCAGGTGGAGAAACGACATCACTGATTAAAGCAACATTTGGTCATTAA
3300	76	126	MW2_CDS_05927	MW1102	FALSE	unmapped	GGGTACAACATGTGTTTGTGCACTTGTTTTTGAAAAATCAGTTGTGATAGCAAATGTCGG
3301	76	124	MW2_CDS_01436	MW0264	FALSE	unmapped	CGATAAAAATAAAGAATCCCTCCAAAAAGCTAAGGAAATTGCTGGAGAAAAGGCAAGTGA
3302	76	122	MW2_CDS_09962	MW1869	FALSE	unmapped	CAGTAAAGCTCACCCTGATCTTACCGTTAAAGTGAGAGAAAAGGATAACATCGTTAAGGG
3303	76	120	MW2_CDS_04761	MW0878	FALSE	unmapped	ATCGTTCCAGTTGGAGATGACCAAAAGCAGCATATCGAATTGACTCGTAACCTTGTAGAT
3304	76	118	ETG09_35454		pos		
3305	76	116	(+)E1A_r60_a20		pos		
3306	76	114	MW2_CDS_07027	MW1313	FALSE	unmapped	TTCCATATGAAAAGTTAGAAGAATTGGGTTATGGCGATTTAATATCACATTTTGATAAGT
3307	76	112	MW2_CDS_04492	MW0830	FALSE	unmapped	ACACCTGGTACTGTAGTGCTTGGTGTAAGTGACGATCGTACAAAAATTTATATTCATGCC
3308	76	110	MW2_CDS_06571	MW1226	FALSE	unmapped	GCAGAAAATGGAGACATTATTGTTGCTATGACTGAGGAAGATGAAGCAACTGTCAAACGC
3309	76	108	perR_tiling_103_F		FALSE	unmapped	ATACATTAAAAGGTAAAAAGGCGATTATATATTTTTATCCTAGAGATAATACACCTACTT
3310	76	106	MW2_CDS_06998	MW1307	FALSE	unmapped	CCGAGGCGACCAAATTGACAATGCAAATCATTTTGCTGATAAAGGTTATGCTAAAGCGAT
3311	76	104	MW2_CDS_05588	MW1035	FALSE	unmapped	GGTGTTCATGTTATTAATCCTGGAAGTATATCTCAATCTAGAAGTTCAATGGAAGAAACA
3312	76	102	perR_tiling_098_F		FALSE	unmapped	GTTCAATGATTTAGATGTTGCAGTATATGGTATAAGCGGTGATTCAAAGAAAAAACACCA
3313	76	100	MW2_CDS_07862	MW1481	FALSE	unmapped	GCTGACGGAGATAATCATGTATTTATGGATAATGAAAGCTTTGAACAAACAGAACTTTCA
3314	76	98	MW2_CDS_06445	MW1202	FALSE	unmapped	CGAAGGGGTTGTAACTGACTATGAAAATGAATTTGAGAGTGAAACAGGAAATCTTGTTGT
3315	76	96	MW2_CDS_13629	MW2576	FALSE	unmapped	GTCAGTATCAAAACTTAACTTGGGATCCGCCTATGGTTATGTTCGCAGCAAATCAATCCG
3316	76	94	MW2_CDS_11384	MW2155	FALSE	unmapped	TCACTGACAAAGAAGCAAGAAAACGTAATGTTGGTGGAGAAATTATCGCATACGTTTGGT
3317	76	92	MW2_CDS_04097	MW0748	FALSE	unmapped	ATTTTATATAACTTTAACATCGCTGTTAACAATATTATTACTAGCAATATCTAACATGTA
3318	76	90	NC_S_082		FALSE	unmapped	CACTGCAATGATTATCGCAATGGGGGAAAGAGGGGACTTAAAGCATATGTTTAGCTTTGA
3319	76	88	agr_tiling 121_F		FALSE	unmapped	ATGTGTATTCATAATAGGTTTCAATTTCTTCTTGATTACGTTTATATTTCATTTCTTTAA
3320	76	86	MW2_CDS_10306	MW1945	FALSE	unmapped	AAAAGGGGTTGATTATATTGGAGAAAATGATGTTGAAAGAGTTGCTAAAGCAAAACCAGA
3321	76	84	MW2_CDS_07422	MW1388	FALSE	unmapped	AACTTGATAGGTCACATCCATTTGTAAACGCAATAGATGAAGTGTCTTTCAGCAATGAAA
3322	76	82	(+)E1A_r60_a104		pos		
3323	76	80	MW2_CDS_02047	MW0379	FALSE	unmapped	AGAAAGATAAGCGCAAAAGTCTACGGAAAAGTTACAGCGAAAGAAAGAGCTGACGAGTTA
3324	76	78	MW2_CDS_12650	MW2392	FALSE	unmapped	TAACTCGCTATGAAGCAAGTTGCCAGGCGTACAAGGATATGCATCAAGATCAACACTTAT
3325	76	76	MW2_CDS_01292	MW0237	FALSE	unmapped	ATAGCGCAAGTGCAATTGCGAATGATATGTCGGCGAATTTTGATCAAAGTTTACCTGTTG
3326	76	74	MW2_CDS_07884	MW1486	FALSE	unmapped	GAGCCGCTCGTATTTTGAAAAAGAATGGATATACAGATATCTATATGTTAAAAGGCGGCT
3327	76	72	(+)eQC-42		pos		
3328	76	70	MW2_CDS_03737	MW0684	FALSE	unmapped	ACGAAATGCGTTGGGATATTGGATACGTATTGCAGCAGATTGCATTATTCCCACATATGA
3329	76	68	MW2_CDS_03682	MW0674	FALSE	unmapped	TGGACAAAGATTTTGTCATTCATACTCCTTTAATGTGGTTAAACAAAGCAGAAACGTGGA
3330	76	66	MW2_CDS_02195	MW0405	FALSE	unmapped	TTTGGTTCAAAGACTGAAGGATTATCTACGAAACATACTTTATATACCATTGGCAGTGCT
3331	76	64	MW2_CDS_04859	MW0895	FALSE	unmapped	AATGTCATTCTTTGCTTTGACGGATTAGATTTTTTACGTTTCGGGAGAATACAACGTACA
3332	76	62	MW2_CDS_01612	MW0294	FALSE	unmapped	TGGGGCTAAAAGGTAATGTTACTACCGATTCACATTTAATGAAAATATCGGCATCCCTAC
3333	76	60	MW2_CDS_13603	MW2571	FALSE	unmapped	AGAATGGCTTAAAGAACATGTCCCAGGAAATCATGAACTAAAAGATACAAATGTCGAGGT
3334	76	58	MW2_CDS_09755	MW1832	FALSE	unmapped	AAGCTTGTGAACGTAAGGGTATTCCGTTTGAGCCTAAAGAAATAGATAATGAAGCGGAAA
3335	76	56	MW2_CDS_12815	MW2425	FALSE	unmapped	TAAAACCAGTAATGATGGCACTCGTTTTAACATCCATGCGACAACGTATGCAACAGAACC
3336	76	54	MW2_CDS_12571	MW2377	FALSE	unmapped	ATTAATGCATCATGGAATACAATTAGTCGAGCATCACCAGTGATGCATCATGTGTTTTGG
3337	76	52	(-)3xSLv1		neg		
3338	76	50	MW2_CDS_04520	MW0835	FALSE	unmapped	ACGCAAAGCATTAAGCCATTTTGAAAAACGCTATACGAAACGTTCACAATTACGCGACTT
3339	76	48	ETG02_36680		pos		
3340	76	46	MW2_CDS_01627	MW0297	FALSE	unmapped	GGAATCATGCCTAATTGGGAACCTGGTAAAAAGGTACATCTTGTAGGGCATAGTATGGGT
3341	76	44	MW2_CDS_06496	MW1212	FALSE	unmapped	TCGTTACAAGCAATTTAGCTACTAAACATCCGTTTTTCGAGTATGCACGTTCATTTGATT
3342	76	42	MW2_CDS_03955	MW0722	FALSE	unmapped	GGTGTTGGTGTACTAATTACCGGTGATTCAGGAATAGGTAAAAGTGAGACTGCGTTGGAA
3343	76	40	MW2_CDS_06542	MW1220	FALSE	unmapped	AGGTGGTCATACATATGGATTTGAAAACTATACAAAAGGCCAAGCACCGTTTGTTGGTGG
3344	76	38	MW2_CDS_02873	MW0528	FALSE	unmapped	TACGTCGTAAGCTGGAAGAATCACCAGTTTTCGAAAATGATGTTGCAACACAACCAGAAA
3345	76	36	MW2_CDS_02836	MW0522	FALSE	unmapped	TATGCATGTTTAACCCTAGGACAAATGGGCAGAAATTTAGGTAATCCCCCATTTGCAACA
3346	76	34	MW2_CDS_06125	MW1138	FALSE	unmapped	ACACAAAGGTATTGCGGTTGATTTTAAAGATGTAGCACAAACGATTAGTAGCGTAACTGT
3347	76	32	MW2_CDS_11012	MW2083	FALSE	unmapped	AATGCGATGCAATAAACGATCCAACGTCATTCGCTGAACTACTAGAGCAACGATTGATTG
3348	76	30	MW2_CDS_04384	MW0807	FALSE	unmapped	GACATTTTAAACCATAATATTGAAACTGTTCGTCGCTTAACACCGAGAGTTCGTGCGCGT
3349	76	28	MW2_CDS_04064	MW0741	FALSE	unmapped	AAATAGAGATGTAAAGGGTATTGTAACGATGTGTGCACCAATGGGTGGCAAAACTGAAGG
3350	76	26	MW2_CDS_08160	MW1535	FALSE	unmapped	TTGACTGAGAGAATGGAAGAAGAAATGTTTCTTGGTTTGCGTTTAAATGAAGGTGTGAGT
3351	76	24	MW2_CDS_03537	MW0648	FALSE	unmapped	AGTTAAAGAACTTAATCGCTTATTAGGTAAAGTCATTCATGCATTTGATGAAACAAAGGA
3352	76	22	MW2_CDS_01539	MW0282	FALSE	unmapped	ATTCGCCTTTATGGGTTATGAACACGTCGTTTACAACAGTTGCTTATTTATGGGTGGTTT
3353	76	20	MW2_CDS_01762	MW0321	FALSE	unmapped	TTAGGTGCTATGCCGAGACATGTCATTGAAGGATTCCCAACGATTAACTGGTTAGGATTC
3354	76	18	MW2_CDS_09883	MW1854	FALSE	unmapped	TCCATACTTTAAAATCTGGCGTGCCAAACGCAATAAAAGTTGCAAAAGAATTAGGTGACA
3355	76	16	MW2_CDS_11609	MW2199	FALSE	unmapped	AGTTGCAGATGGTGAAGATACAGCAAAAGATATGTATGCAAAGCAAGGTTATGTTTACCA
3356	76	14	MW2_CDS_05500	MW1020	FALSE	unmapped	GCTCATCGATCGTGTTCAAGATCCTGGAAATTTAGGCACATTAATTAGAACTGCGGATGC
3357	76	12	MW2_CDS_12197	MW2308	FALSE	unmapped	AGGAGGATTCTTCCCACCACTAGTAATCACGTACGTAGCTAATTTAACAGGATCAAGTCA
3358	76	10	NC_A_070		FALSE	unmapped	ATTGAGGGCAGACCCCTTTAATTAAGTAAACCCTAACTCCCCACAAATCTGGAACGATAC
3359	76	8	MW2_CDS_08431	MW1586	FALSE	unmapped	GGCATGAAGGTGTCTTAGGTATTGTTGCTTCGAAAATTGTCGAAACATTTGCTTTGCCAA
3360	76	6	MW2_CDS_04467	MW0825	FALSE	unmapped	GACCAACTGCGGGATTAAATGTTGATGGCCAACATGATCATATACGCGATACATGTGTAC
3361	76	4	MW2_CDS_13466	MW2547	FALSE	unmapped	AAAATCAACGGAAAGCATAAAGTTGATGTTTTATTAGGCGGCGGCGCTAAATATTTCGGT
3362	76	2	agr_tiling 051_F		FALSE	unmapped	TTCAATTTTACACCACTCTCCTCACTGTCATTATACGATTTAGTACAATCTTTTATCATT
3363	76	163	MW2_CDS_09420	MW1770	FALSE	unmapped	TCCTAAGTCACAGAACATATTTACAGAAGATGTTGCAAACAAATTGGATGAACATAACAT
3364	76	161	MW2_CDS_07562	MW1423	FALSE	unmapped	GGAACGCCTCAAAAACATTCACGTGATCCGTACTGGTTCGATGTCACTTATAACCAAATG
3365	76	159	MW2_CDS_10445	MW1972	FALSE	unmapped	TGCTCCACAACCTGAAGTCAATTTTAAGCAATTTAGAACAGCACGTCATTTAACGAGTGT
3366	76	157	MW2_CDS_10350	MW1955	FALSE	unmapped	GGCATGGGTGTCATTTTTTCATTAGCATATGTTTGGACAAAACGGCTTGCTGTTCCAATT
3367	76	155	MW2_CDS_06664	MW1246	FALSE	unmapped	GCAACGTTTGCAGAAACGATTGCTAATATTGGCGTTGTGATTGTCACAACACCATTTGTA
3368	76	153	MW2_CDS_06018	MW1119	FALSE	unmapped	ATCGCAGATACTTTTAATGTGAGTAGACAAGCAGTTTATGATAATATAAGAAGAACTGGC
3369	76	151	MW2_CDS_04355	MW0802	FALSE	unmapped	GGAAAAAGAAAAACTTTCTCAACAGCAAATTCAATTTCAACAACGGAAAAATCGCAACGT
3370	76	149	MW2_CDS_03711	MW0680	FALSE	unmapped	TAAAGTAACGAGCAAAGCAAATCGCATGGGGATGATGCTTGAAGGTGAAAAAATCAAAGC
3371	76	147	MW2_CDS_11638	MW2205	FALSE	unmapped	TGGTGGCGTATGTATTTTAATCGGCATATTGATAGCATCAAGAAAAGCAGCACTCTTAGC
3372	76	145	MW2_CDS_08948	MW1679	FALSE	unmapped	ACTGAAGTGTTAAATAAAAATGGCCTTCAATTAGGTGATACATTGAATTGTTCTGGTGCT
3373	76	143	MW2_CDS_01655	MW0302	FALSE	unmapped	GTTGGTCCGCAAATACGTCGATTGCCTGTTTCAAAGATGAATCAGGACTTGTTAGCTAAA
3374	76	141	MW2_CDS_07659	MW1445	FALSE	unmapped	TTGTAAGAAGCGTGTTTGGAGTTATGATATGGATCGCATGGACCAAGTACTAACGAACTT
3375	76	139	MW2_CDS_08658	MW1630	FALSE	unmapped	GCCATCGCACATATTAAAGCAGGTGCCAAAAAAGTTTTGTTAACTGGTCCTTCAAAAGGT
3376	76	137	agr_tiling 074_F		FALSE	unmapped	GATAATGAAAAGAATTGTACTAATTATAATTGAAAAATATCTTTTTTGCTTTACAAGCCT
3377	76	135	MW2_CDS_00098	MW0018	FALSE	unmapped	AGAACTAGGTGCAGATGACTATGTAACGAAACCGTTTAGTACGCGTGAATTAATCGCACG
3378	76	133	MW2_CDS_06371	MW1183	FALSE	unmapped	GTTACCAAACTCGTGACGTTATGGAAGCAATGTCAAAAGACTCTGGCATTGATGTCCAAA
3379	76	131	MW2_CDS_07421	MW1387	FALSE	unmapped	GGCAACAGAAGAAGTTAAAATCAAAGCGCTACTTGAAAACGATAAACAGTACTTTCCAGC
3380	76	129	psma_tiling_037_F		FALSE	unmapped	AACATACAGGAGGACAAAACGATGGCTATTGTAGGTACTATCATTAAAATCATCAAAGCA
3381	76	127	MW2_CDS_02100	MW0388	FALSE	unmapped	AGGCCTTGAAGGCCAGAATGTCTTTGTGGTAAAAGAATTAATTGATCCAAACGGTAGACT
3382	76	125	MW2_CDS_11882	MW2252	FALSE	unmapped	GTGAAACAGAAAGTATGAAAGATGGTAGTGACGCGGTTGGTGATTGGGCTGTATTGAATG
3383	76	123	MW2_CDS_05757	MW1071	FALSE	unmapped	AGAGCGAGCTAAAGAAGCGTATGAGGCTGGAATAAGACATTTTGGTGAGAATAGATTGGA
3384	76	121	MW2_CDS_08829	MW1658	FALSE	unmapped	AGTTGTACATCCAAGATATACAATGACTTCAACGAGACGTATGATGATGCGTGTTGCTGA
3385	76	119	MW2_CDS_12432	MW2353	FALSE	unmapped	ATGGCAGTAGTGAGGGGATTTGGTGTATTTAGATGTTCAATTTATTATGTAATTAATTAT
3386	76	117	MW2_CDS_04447	MW0820	FALSE	unmapped	TTTAGTTGTATGGACAGCAGGAATTCAACCTGTTGAAGTTGTTCGTAACTTGCCGATTGA
3387	76	115	MW2_CDS_07912	MW1490	FALSE	unmapped	AGAAGTATAAGTTAACAATACCAGAAATATTTAGTAAACATGGTGAACAATATTTCAGGA
3388	76	113	(-)3xSLv1		neg		
3389	76	111	MW2_CDS_08033	MW1513	FALSE	unmapped	ATGACGGCAGAACAAGAACACTTGAAGAAGTTGGTAAAGTTTTCGGTGTTACACGTGAAC
3390	76	109	MW2_CDS_11294	MW2136	FALSE	unmapped	CAGAGGTTCTTTAAAACGCGCTGGATTACTTACTCGTGACCCACGTATGAAAGAACGTAA
3391	76	107	MW2_CDS_11780	MW2233	FALSE	unmapped	TGAATCTTTATTTATTCAGTTTCATAATAAAATGCATATCAAAAAAGCTGATTTCTATCA
3392	76	105	MW2_CDS_05478	MW1015	FALSE	unmapped	GCCTAATCGTTATAAAGATGTACCGGAAATTGGTCAACCAATGGAGCCGAATGTTGAAGC
3393	76	103	MW2_CDS_04192	MW0767	FALSE	unmapped	CTGTTCCAAGTTATAGCCCTACACACTACGTTCCTGAATTTAAGGGTAGCTTACCAGCAC
3394	76	101	MW2_CDS_08207	MW1544	FALSE	unmapped	ACGGCTTGCAAAAGAGAAACTGCCAGAGAAACGTTATAATCATTCTTTAAGAGTTGCAGA
3395	76	99	MW2_CDS_09758	MW1832	FALSE	unmapped	AGGAAAAAAATATATCACGCCTGATGGTACAGAATTAGAAGGGTTAGGTATTTTAGATTT
3396	76	97	MW2_CDS_11162	MW2109	FALSE	unmapped	ACTTATCATCGTTTTATGTTTAATTGGTGTAGGTATTGGGTATATGAAAGACCGTAAGCA
3397	76	95	MW2_CDS_09254	MW1736	FALSE	unmapped	TGAAAAAGTCTTTAAAATTCAAGGGGATGAAAATATGTTTAATGCTATATCTACTGATTT
3398	76	93	MW2_CDS_01676	MW0305	FALSE	unmapped	GTGAAGCGTGTGGTGATGACTGCAAACTTTGGTGCAGTTGGTTTTAGCAATAAAGATAAA
3399	76	91	MW2_CDS_11649	MW2208	FALSE	unmapped	TGGTCAATACGGCGGAAACCTTACAAGTACGTCAATGACATTCGTGTCTAAAACTGCTTA
3400	76	89	perR_tiling_102_F		FALSE	unmapped	GCGATTATATATTTTTATCCTAGAGATAATACACCTACTTGTACCACAGAAGCTTGTGAC
3401	76	87	MW2_CDS_06357	MW1180	FALSE	unmapped	GTGTGTGCTTCTAGATATGCATATAGGACATATAAAAAGTATTATGGAATTGCTGAAGCA
3402	76	85	MW2_CDS_08695	MW1636	FALSE	unmapped	TGAAGATGGAGATATTAACGTTCGTGTGTATCGAGATGACTTTCGTGTCATTTTCGAAGT
3403	76	83	MW2_CDS_06691	MW1251	FALSE	unmapped	GTCCAAAGCAGTATCGTTTACAGAAGCAGGTACAAAACACGGCAGATTAGGTTTAATGGC
3404	76	81	MW2_CDS_08853	MW1662	FALSE	unmapped	AATCTCAAAAATTAAACATCATCGTTGAATCAGTTGAAATCAACAATTTCGTACCTGAGT
3405	76	79	MW2_CDS_12529	MW2370	FALSE	unmapped	TTTTTTGATTCGTATGGTTTTGCGAATACGTATGCATTCATGGTAACGAAGGAAACTGCT
3406	76	77	MW2_CDS_00016	MW0004	FALSE	unmapped	ATAAGTTTTGATGTGAATGGCATGGATGCTCAAACATATGGTTCTCAAGGACAGCAACGT
3407	76	75	MW2_CDS_01037	MW0191	FALSE	unmapped	ATTACTTGGACATTAGTATGGACGCTTGTTGCAACGACACTTCAAATTGCATTAGGGCTG
3408	76	73	MW2_CDS_02159	MW0398	FALSE	unmapped	TGATAAAGCTCCAATGTTAAAAATGCATATTGACGGGGACTTAAAAGGTAGTTCTGTTGG
3409	76	71	MW2_CDS_05217	MW0965	FALSE	unmapped	TCAATCATGGGTGTTATGAGCCTTGGTGTTGGTAAAGATGCTGAAATTACAATTTATGCT
3410	76	69	MW2_CDS_08018	MW1510	FALSE	unmapped	TGCTGCAAGATTGGAAGATAATGCAAATATTGCGGTGTTTAGTGCTACAATTCCACAACA
3411	76	67	MW2_CDS_11397	MW2158	FALSE	unmapped	ACAAACGAACCAACTCGTGTAGGTTACAAATTTGTTGATGGTAAAAAAGTTCGTATCGCT
3412	76	65	MW2_CDS_11884	MW2252	FALSE	unmapped	GCGTGCGGATGAAGAAATGCGCAAACTTTTCCCAGAAAATGAAAAGTTATTAAGATGGCT
3413	76	63	MW2_CDS_01293	MW0237	FALSE	unmapped	TGGATGAAAATGGGATCGAATTAGGAGCTAAGATTCAAAAGATGAAAGAGCCACCTGCGA
3414	76	61	(+)E1A_r60_a20		pos		
3415	76	59	MW2_CDS_09976	MW1871	FALSE	unmapped	ACTATTCTTTGGCTTGTTTTTATTCTTAATCACACTTGCATCACAAAAAACAGCAATGAT
3416	76	57	MW2_CDS_01139	MW0209	FALSE	unmapped	AGCTAGCAATGATGCAAGGTAATTTAGCTCAAGCAATGGCAACATGTGCTCAATTAGCTA
3417	76	55	MW2_CDS_03729	MW0683	FALSE	unmapped	ACGGTTGAAGGGGTTGACCGAGTATTATTCAGTCAGTTGGTAGAAGTTCGTAAAAAGTTA
3418	76	53	MW2_CDS_01022	MW0189	FALSE	unmapped	TAGAGAAATATATGATGCCCCTAATTGCATATTTGTGGCGCAATTTATCGGCTCACCAGC
3419	76	51	MW2_CDS_04000	MW0730	FALSE	unmapped	AAATGCAGAAGTAATGATTCACCAACCATTAGGTGGTGCTCAAGGACAAGCAACTGAAAT
3420	76	49	MW2_CDS_08389	MW1578	FALSE	unmapped	ACCGATCCAATGGCCAAAATTATTCGTCAAAAATTGAAAAAACTAGGAATTCGTAAAGGG
3421	76	47	NC_S_043		FALSE	unmapped	AATTCGGCTAAATCATAGCATTAAATTTTTTAGATGAAGCTAGCGATATTACGAAATGAT
3422	76	45	MW2_CDS_05163	MW0955	FALSE	unmapped	ACGGCGCTATATACGGATCATCAAAATGCGTTTTGTATAGATAGAGCAAAAAAGCACGAT
3423	76	43	MW2_CDS_04523	MW0836	FALSE	unmapped	CCAATCGTTGATGCATATGGCGAAAAGGGTGGTACACCATGGTTAGATCAAAAACATACA
3424	76	41	MW2_CDS_02773	MW0511	FALSE	unmapped	TGCAAAAATGCATGAAGAAGAAGGCACAATGAGTAAAGAAGATTTCAAAACATATTCAGA
3425	76	39	MW2_CDS_03223	MW0593	FALSE	unmapped	TGTTGGTGGAGACAACGTCGATATTCATAGTATTGTACCTGTTGGTCAAGATCCTCATGA
3426	76	37	MW2_CDS_05340	MW0988	FALSE	unmapped	CCAAATTGGTTAAGACGTTTAATTACACGTTCCCTTGCTGTCATTCCTGTTATCGTATGC
3427	76	35	MW2_CDS_11391	MW2157	FALSE	unmapped	GTATCATTACCACGTGTACGTGACTTCCAAGGTGTTTCTAAAAAAGCATTTGACGGACGC
3428	76	33	MW2_CDS_04320	MW0795	FALSE	unmapped	AGGTATTAACCAAATGCGTGGGGAAAACTTTGGTGCATTAATGATTACACACTATCAACG
3429	76	31	MW2_CDS_02014	MW0372	FALSE	unmapped	TCACAAAAGCTATTGGTTCACTAGTCTTGACTGCCGTTTTATTAACGTCTGTTTCACCTT
3430	76	29	MW2_CDS_10995	MW2079	FALSE	unmapped	GGTTATTTATCTACAGGTGAAAAACAACGAGTGATGATTGCGCGAGCTTTAATGGGGCAA
3431	76	27	MW2_CDS_05923	MW1101	FALSE	unmapped	ACGACTTTGCGGATGAAGATATCCAAATTAATTTTGCTGTAAGCTTACACGCCGCAAAAG
3432	76	25	MW2_CDS_04398	MW0810	FALSE	unmapped	AGGGAATATGATTATCGATGCATTTATTTTAAGGGATCCTGGTAATTATAAAGATGTGAT
3433	76	23	MW2_CDS_04732	MW0873	FALSE	unmapped	TTGATGTTACGAATGATGCTACCGGTGCAATGGCAAAAGATGCTAAGTCATCTAATGCTG
3434	76	21	MW2_CDS_01975	MW0364	FALSE	unmapped	CCAAAATGGGCATCAACGTTTAGAAGAAGCAGGTTTAACAGTTTCTTCTCTCTGCAAGGT
3435	76	19	MW2_CDS_13662	MW2581	FALSE	unmapped	ATGGTATTAAGAAAAGTAATCATGCAGGACTTAGATCAAATTATTGCACTTGAAAATATT
3436	76	17	MW2_CDS_05011	MW0927	FALSE	unmapped	TGGACCACATAAAGGGCCAATTCATTTTAACTTGCCATTTAGAGATCCGTTAACACCTGA
3437	76	15	MW2_CDS_10494	MW1981	FALSE	unmapped	GCTCATTGCCATGACGATTTAGGAATGGCTGTTTCAAATAGTTTAGCTGCAATTGAAGGC
3438	76	13	MW2_CDS_03346	MW0615	FALSE	unmapped	TGCATGCGATACCAACACCTGTTATTTCAGATAAGAAGGCTTTTGATATCGCCAAGCAAA
3439	76	11	MW2_CDS_09583	MW1800	FALSE	unmapped	TGGCTCATTGCGTGTCAATTCTATTGGTGTAAATGCAGTTTTACTCATAGGAGCTGCAAA
3440	76	9	MW2_CDS_02271	MW0419	FALSE	unmapped	AAAATTAAAAGTATCAGGTACTGCTAGCTCAAGTAACGCTGCGAGCAATAGTAGCCGTCC
3441	76	7	MW2_CDS_09724	MW1826	FALSE	unmapped	AAAATACGTGGCCTTTTGGCGTTTTGGATAGGCGCGCTATTAATTGCATTCACATTATTG
3442	76	5	MW2_CDS_03442	MW0631	FALSE	unmapped	TCACCTAAGATATGAAGGATTTGGCCCAAGCGGATCAATGCTAATTGTTGATGCGTTAAC
3443	76	3	agr_tiling 084_R		FALSE	unmapped	TGACTTTTTCAACAGCATCGGTTACAGAGCCGCGTATATAAATTGTGATTTTTTATTGGA
3444	76	1	MW2_CDS_02945	MW0543	FALSE	unmapped	TTGTCACGTGGCTGCTCAATTGAAGATGTATACAATCTTTCAATTATCACAGCAGCGCAA
3445	75	164	MW2_CDS_05079	MW0940	FALSE	unmapped	TGGTTTCTATGCTAAGCCAACATTGAATAGACTTAACGGGGGATTCTTTGGACAAGTCTT
3446	75	162	MW2_CDS_01239	MW0228	FALSE	unmapped	ACGATGCAAGATATCGTCCAAGCGTTTGAAATGGATTTATCGACATCTTGGGGAAAAACA
3447	75	160	MW2_CDS_04326	MW0796	FALSE	unmapped	TCGTGGTATTTCTCAAAGAGAAGCGGAACGTCTTGTTATACATGGTTTCTTAGATCCAGT
3448	75	158	MW2_CDS_12301	MW2328	FALSE	unmapped	GCTTTAGACAGTGGTGTTAAAGTGAAAGACGACAAAGCTGAAAGTAAACATGACAAAGCA
3449	75	156	MW2_CDS_13753	MW2597	FALSE	unmapped	AGCTAGATTTACCAATGGGTTATCGGTCAATGATTTCTTAACACGGAACACGGTCATCCA
3450	75	154	MW2_CDS_10109	MW1902	FALSE	unmapped	AGTCATCCTCTATTTGCTCGTGCTATATACCCTTTAGCAAGTTACTATTTTGAAAACCGT
3451	75	152	MW2_CDS_00108	MW0019	FALSE	unmapped	ACGTATTCGTATCGTCAATGATATGGCACTCAAGATGCTTGGTATGGCGAAAGAAGACAT
3452	75	150	MW2_CDS_07438	MW1390	FALSE	unmapped	ATTCAGATGCCTCAGATAAAGCTTGGGCGCATTCAAAATCTATTTGGAAAGGGACATCAA
3453	75	148	MW2_CDS_05680	MW1058	FALSE	unmapped	ATTGTTACTAATGGTGTAACCGAAACGCAAAAGAGAAGGTTAAATCAGACGCCGTTGCAT
3454	75	146	MW2_CDS_07702	MW1453	FALSE	unmapped	AGAAATTCCAGCTGGTAAATTAGAAGATGATGAAGATAGAGTCGAAGCGGCAAAGCGTGA
3455	75	144	MW2_CDS_03434	MW0630	FALSE	unmapped	GATGATATATCTAAATTTAATGCTTTATTTGAAGATGTAGAACAATTTTTAAATATTTAA
3456	75	142	MW2_CDS_10305	MW1945	FALSE	unmapped	ACCTTCGTACGGAAAATTTGATTTTGAAAAAACACATACATGGCAGAATATTGAAGCTGT
3457	75	140	MW2_CDS_02117	MW0391	FALSE	unmapped	ACAGCGTAGTTATGAGGGGTTAGATGTGTTTTTTGTTCAAGAAAAAAGAGATAAGCACGA
3458	75	138	MW2_CDS_03049	MW0560	FALSE	unmapped	AATTTGTTGCATCATAATACTAGGTATTTTTCTGTTTTTTTTATATTTAAATCAAAAGTT
3459	75	136	MW2_CDS_04275	MW0786	FALSE	unmapped	TTTCGTTGAATTACCAGAAACAGATGATGAAATTAATGAAGGGGATACGTTTGGTAGCGT
3460	75	134	MW2_CDS_05869	MW1091	FALSE	unmapped	GAACGTGAACGCGTTAAACAACGTGCGAATGATTTAGTTCGATTTGTTCAACAGCAGTTG
3461	75	132	MW2_CDS_05507	MW1021	FALSE	unmapped	TATTACGGATGAAATTTTATTACGTACGCATACATCACCAGTGCAGGCACGTACGATGGA
3462	75	130	MW2_CDS_07370	MW1376	FALSE	unmapped	AGCAAGGAAAGGAGTAGGCTATAAAGCTGCAATAGAAGTACATACAACATTGTTTTCGAG
3463	75	128	MW2_CDS_08965	MW1682	FALSE	unmapped	TAAAGTAAACCGTTTAACTGAGGATATCCAAGGTAAAGTAGATCGTTTAAACTCAGTTGT
3464	75	126	MW2_CDS_09009	MW1690	FALSE	unmapped	ACGATTGAAAGTCAAGGAGATAAAGCAGTTCATATGGGTGATATATTCCCAACTACTGCA
3465	75	124	MW2_CDS_10240	MW1933	FALSE	unmapped	TGGACATAATCGCGATTTGTATCGCAATTTTTAGTTTCTTACTGACTGCACTTAAATATT
3466	75	122	MW2_CDS_08263	MW1554	FALSE	unmapped	GCAGGCGCGATAAATGGATGGATTTTACCTATTACGTTAGGTGCAATTTTGATTGCAAGT
3467	75	120	MW2_CDS_08872	MW1666	FALSE	unmapped	ACTCCAGGTATGGTAGGAAAAACTGGCGCATTGTTAGGTAAATACAATATCAACATTGCA
3468	75	118	MW2_CDS_03732	MW0683	FALSE	unmapped	ACACGTAAGCAAGTTGAAGAGCTTCAAGAAGCCTTAGAAAGCCAGAAAATTGAAAGTGTT
3469	75	116	MW2_CDS_05655	MW1051	FALSE	unmapped	AAAATGATACACTCGTTATTGCTGCTGGCGGTGGAGGTATACCAGTAATTAGAGAGCAAC
3470	75	114	MW2_CDS_05532	MW1026	FALSE	unmapped	AGCAACTGCGCAAAAAGGATTTGTAACAAAAGATAGAGTGATTAACGCATTATCGCGTGA
3471	75	112	MW2_CDS_03495	MW0641	FALSE	unmapped	TGTGAAACAGAGCGTTTAATATTAAGAGACTGGCATGAAGATGATCTGTTACCTTTTCAA
3472	75	110	MW2_CDS_01681	MW0306	FALSE	unmapped	ACTTTGCCGCAGGTGCTGTAGGTCAATTATTCAAAGGTAAGTCTAAATCAACGGAAGAGA
3473	75	108	MW2_CDS_02227	MW0411	FALSE	unmapped	GGATGTGAAGCATCTTGCAGCTGAGTTAAATGACCAAGGATTTAGTTGTTATGCACCGAA
3474	75	106	MW2_CDS_07844	MW1478	FALSE	unmapped	TTGCAAGTATAGCTACTTCGGAAGTCGAAGGCATCACTGGCCATTTTGCTGAATTAAAAG
3475	75	104	MW2_CDS_00744	MW0138	FALSE	unmapped	TAGATGTGATTGAAATGGCAAACAAACATCCGCGTGTTAATATCCATCAACCTGGTCCAG
3476	75	102	MW2_CDS_10861	MW2051	FALSE	unmapped	AGAAGGCACATTGGCACAAGATGTTTATGGTAAAGCGGAAATTGAAGAAAGACATCGTCA
3477	75	100	NC_S_058		FALSE	unmapped	AAGCAGTTGGACAATGGCGATTGTAACATCATTGTTCGACTGCTTTTCTGATTAACTTGA
3478	75	98	MW2_CDS_01350	MW0247	FALSE	unmapped	GGACAAATGAATATCAAGGCGGACAACTTGCAGCACAACATTTAATAGAACTCGGTCACA
3479	75	96	MW2_CDS_07175	MW1342	FALSE	unmapped	AGATGGAATAGGAGCCATCATCAACTCATTTTCTTTGGAAGATACCACTGTTTAGCCCGA
3480	75	94	MW2_CDS_05878	MW1093	FALSE	unmapped	GCAACAACTGCAGCGAAAAGAGCGCGTGAAATTGATGAACAACCTGAAACTGAATTATTA
3481	75	92	MW2_CDS_00654	MW0123	FALSE	unmapped	AAGGGTGATAAAGTTTCAAGAGAGAAAATGCATAACGCATCAACTTTGGCTGGTATGGCA
3482	75	90	MW2_CDS_12580	MW2379	FALSE	unmapped	CAAATGAAGGTATTCCCACGATGACAATCGGTGTTACGCTGCGATACATGCATTCTAATG
3483	75	88	MW2_CDS_00283	MW0054	FALSE	unmapped	TGGTGCTTTTGTCATCAAACTTATTCAAGGTTATATCCCTTTATATGACGCCTTATTCCT
3484	75	86	MW2_CDS_12770	MW2417	FALSE	unmapped	TGTAGAGACCCACATGATAGTAGAAATGTAATCATTGTTGTTTCTGTAAAACAACACAAT
3485	75	84	MW2_CDS_00689	MW0129	FALSE	unmapped	AGCGTGCTATTGAAGGAACTCCAACGATTGAAAATGGTGTACCTACAGTACCAAACGTAT
3486	75	82	MW2_CDS_00215	MW0040	FALSE	unmapped	GAAGGTCAAGGTCGTCAACGTTCAAACGTTCATGGAGAAGTTAAAACGCCTAAGAATTGG
3487	75	80	perR_tiling_002_F		FALSE	unmapped	AAGAAAAGAACATTCTAACTACGGAAGTGGTATTAACTAATAACTAGTATCCTTTATAAA
3488	75	78	MW2_CDS_00840	MW0156	FALSE	unmapped	ATGAAGCATTATCAAACCAGCAAATCGAGCCACACTTTGTTAATGGCCTAAGAGTGACTG
3489	75	76	MW2_CDS_07892	MW1487	FALSE	unmapped	GGTTCAGGTCCAGTCGGTGTAGTAAAAGAACTAGCAAGTTACTTACCAAAGCCAATGGTT
3490	75	74	MW2_CDS_13344	MW2525	FALSE	unmapped	TCGCGAAGTAGAAGGCAAATACACTGCAGATTACTTAGCTGATAAAGGTGTTGTTCCGTT
3491	75	72	MW2_CDS_01167	MW0214	FALSE	unmapped	AAGACATTGCCCCTTCTACTGAGTTGCGACAATGGTTCCAACATGATCCTAAACTTTTTG
3492	75	70	agr_tiling 194_R		FALSE	unmapped	TTGGATTTTAACAAGATAACTAGCAAATGCACTGTATAGCTGGCTTTTTAATTGTTTAAT
3493	75	68	MW2_CDS_13827	MW2610	FALSE	unmapped	GTGGTAGAAATGCCATTACCCCAGAACGTGTCGCCATTAATATTGATGATGCACGTATTC
3494	75	66	MW2_CDS_03271	MW0601	FALSE	unmapped	AGTGGGTTGTGAACAAATGTCACAATGTTTTAAACAGTCTTTAGGTGCAACAGAAGAGCA
3495	75	64	MW2_CDS_01624	MW0296	FALSE	unmapped	CACCATCCCTCGTGAAGAACGTTTGGGACAATTTGAAAGACGGTTTAGAAATGACTGTTG
3496	75	62	MW2_CDS_05002	MW0926	FALSE	unmapped	TGTTGCAATTCGTTCGATGCTTATTAAGAAAGCACAAGCAACTTTATTTGCTGGGTGTGG
3497	75	60	MW2_CDS_13165	MW2491	FALSE	unmapped	TCCCAACAGTTGTTGGCGGTATTTCAGGTGCAATTGGTGTTTTAATATTGTCGTATACGA
3498	75	58	perR_tiling_046_R		FALSE	unmapped	TTATCCAATTCATATAATTCATGATTAGGTTTCAAAGGTTCATTTTCAAACACATCTAAA
3499	75	56	MW2_CDS_02595	MW0479	FALSE	unmapped	CCGTGTTTTTCGCTCGCTAGGTATTTTACAAAACTGTAGAATGATAACTATGGAAGAGGC
3500	75	54	MW2_CDS_06063	MW1128	FALSE	unmapped	GAACCAGCAGCAACAATGGCTGAAGGTGCACAAAAAATTGTTAAACTAGTCAAAGAAGCA
3501	75	52	MW2_CDS_10430	MW1970	FALSE	unmapped	AAATCTGAACTAAGCGAGAGTGACATGATCAAAATCGCAATTGTCGGAGTTGGGAACCTA
3502	75	50	(+)E1A_r60_a97		pos		
3503	75	48	MW2_CDS_04640	MW0857	FALSE	unmapped	GCTTGGCTAGGTCAAGAAGCTTATGAACCTCAATACGGTGCAAGACCATTAAAACGTTTT
3504	75	46	MW2_CDS_07234	MW1352	FALSE	unmapped	ATAACTGTGCTTTTGATATTCAAATTCACTTCGCAAACGTGTCAAAGCGTGAGCAAAGGC
3505	75	44	MW2_CDS_02831	MW0521	FALSE	unmapped	CCTTGTTCAAAAGAAATAAGTGAGTATTCAGCGCACAACCAACGTGGTGTTGTCACTGTT
3506	75	42	MW2_CDS_13097	MW2480	FALSE	unmapped	TGTTATTGGTACAGGTCGAATTGGCCGTGTAGTAGCCGATATATTTGCCAATGGTTATCA
3507	75	40	MW2_CDS_02495	MW0461	FALSE	unmapped	AATGGTAATGTTGCTAAAGCTGGATCGGATGTTAAAGTTGAAGATGTGCTGACGATTCGC
3508	75	38	MW2_CDS_09021	MW1692	FALSE	unmapped	AGAGCATATACCGAGTTTAGATTCACGTTTTTTCACTGTTGTACATGGTGATGTGAATCA
3509	75	36	MW2_CDS_07798	MW1470	FALSE	unmapped	ACCAATATCGTACGAAAGAAGAGCGTGAAGCGCTTAAAAAAGCTGACTGCAATGAAAAGT
3510	75	34	MW2_CDS_11188	MW2113	FALSE	unmapped	AAGTGTTTTAGGAATGCCAGGACAAACAGCATATCATGGTCTGCTTGATATTGGACAACC
3511	75	32	MW2_CDS_00454	MW0086	FALSE	unmapped	ACTCATTACAACGAAGCAATTATCTGCTGCCAAAGCTTATACATGGCTAGTCGGAAGTCT
3512	75	30	MW2_CDS_03984	MW0727	FALSE	unmapped	TTGATGGAACAAGGAAATCCATCCTTAAGAAAAGTGGCAATTGCAATTGATTTAAGAGGT
3513	75	28	MW2_CDS_02416	MW0447	FALSE	unmapped	TAGAGTTGGGGTTAATCGTTGGGAAAGATGCAAGGCGCCGTAGAGAAATTTTAAGTAGAA
3514	75	26	MW2_CDS_06504	MW1214	FALSE	unmapped	AGGTGCTTCGGAAATCTCGATGATGTTTGGAATTCATGTAGATGATGCTGAAAAAGCTGT
3515	75	24	MW2_CDS_07566	MW1423	FALSE	unmapped	GGCTAGAAGAAAAGTTATAAGAGTGCGTATCAAAGGAAAACTAATGACATTGAGAGAAGT
3516	75	22	MW2_CDS_05914	MW1100	FALSE	unmapped	GTTTCAACATCCGATAACTGGAGAGTTGGTCAAAACGTTACAAATCATGCCGCAAGACTT
3517	75	20	MW2_CDS_04076	MW0743	FALSE	unmapped	GCCATTAAAGCTTTATTTGAAGCATGGGCATTGTAAAGTATTACTTGGTGTCGCACGAGG
3518	75	18	MW2_CDS_06855	MW1280	FALSE	unmapped	TGCTTTCAGGTGGAGAAAAAGTACGTTGTATGCTAAGTAAAATGATGTTATCAAGTGCGA
3519	75	16	psma_tiling_013_F		FALSE	unmapped	CTGTTAAACAATGATTGTACCTTCAATTAACAGTTGGTACGATGGTTTTGCCATTTTTCA
3520	75	14	MW2_CDS_03501	MW0642	FALSE	unmapped	GCAAAGCTATTGGCGTCATGCCTAAAATGTTAGATGAACATGAAATCACAAGCCAACGTT
3521	75	12	MW2_CDS_13470	MW2549	FALSE	unmapped	GGATTGGTATGATGTGATGGAAGCATTGGCTAAAGGGCGACCTGGCTTTGATTTTATTAA
3522	75	10	MW2_CDS_01529	MW0280	FALSE	unmapped	TGGCAGGTTGTTCTAATAAAGGTGAAAAGTATCAAAAAGATATTGATAAAGTGTACAAAG
3523	75	8	MW2_CDS_00765	MW0142	FALSE	unmapped	TGCAGCAAAAGAATCAGATGCACAAATTTTAGCAGGTGGTCATCGCTTAACTGAAAATGG
3524	75	6	MW2_CDS_11903	MW2256	FALSE	unmapped	CAATGGTGACATGACGCTGGGAATTGGTACAGGAAGTACAATGGAATTACTCTTACCTCA
3525	75	4	psma_tiling_047_F		FALSE	unmapped	TCATTAAAGGATTAATTGAGAAATTCACTGGTAAGTAAGTTATAAAAATCTCATAGATAT
3526	75	2	MW2_CDS_11974	MW2269	FALSE	unmapped	AGCGGTTGCATTTATTTTTAACATTAACTAAAGAAGATGGTACACTAGCATCAACAAATG
3527	75	163	MW2_CDS_00893	MW0164	FALSE	unmapped	AATCCAAAGGCACAAATATATGGTTTTATTGTAGGGAGTGATTTGCGAGGTCCTTTGCAT
3528	75	161	MW2_CDS_09837	MW1846	FALSE	unmapped	AATCATTCAAGTGGCAAACGACAAACGATACAACCTAAGGCAAAACCTTTTGCTAAACGC
3529	75	159	MW2_CDS_11232	MW2121	FALSE	unmapped	AGGACAGGAAGTTGACTTTGTTGATGCAACTTTGGCTGTAGCAAAAGATGTTCAAAGTCA
3530	75	157	MW2_CDS_03060	MW0562	FALSE	unmapped	TAGTAGAGAAGAGTTTGAAAACTTAAATATTGTTAAACCTGCTAAAAAGAATGTTTTTTG
3531	75	155	MW2_CDS_02251	MW0416	FALSE	unmapped	CGTGTTGCTGTAATGGAAAAGGGTCAAGTGGTTGAAACAGGAACTGTTAAAGAGGTGTTT
3532	75	153	MW2_CDS_00604	MW0112	FALSE	unmapped	CGAAATTGTAAAAGCGAGTGAATTAACAAAAGCGGCTGGTGCGGACTTCGTTAAAACTTC
3533	75	151	agr_tiling 068_F		FALSE	unmapped	TATTAATGCTAAAAACATCATTAGTGTTTCATTAATATGAAAATGCAATACTAATAGAGG
3534	75	149	MW2_CDS_11839	MW2245	FALSE	unmapped	ACCCTTGCTCAAAAAGCAAATTACAACGTCTATGTATCCAGTAACACATTCTACTTAACT
3535	75	147	MW2_CDS_11441	MW2168	FALSE	unmapped	AGACGGAACTAAATCAGGTTCAATCGAATTAAGCGATGCAGTATTCGGTATTGAGCCAAA
3536	75	145	MW2_CDS_08867	MW1665	FALSE	unmapped	GCATACGTTGAAACCGTAAAAGCAGAAGGTTTCAATCACGTAATAGCACGACACTATGCA
3537	75	143	MW2_CDS_05058	MW0936	FALSE	unmapped	TATTCAGTACCTTGGGGCACTTATAAACAAGAAGCTGGTGCAGTTTCTGGTACAGGTAAC
3538	75	141	MW2_CDS_08904	MW1671	FALSE	unmapped	AGAAATTTGGTAAGTCTGAGTCAGGTGCTGTTTGGTTAGATGCTGAAAAAACAAGTCCTT
3539	75	139	MW2_CDS_04889	MW0901	FALSE	unmapped	AAATTCAAGCCAACATGGACCCTAAACACCGTGATAGAATTGCATTTATGCGTGTCGTTA
3540	75	137	MW2_CDS_10469	MW1977	FALSE	unmapped	CGTCGTTGTCATTAGATATGAAGGACCTAAAGGTGGACCAGGTATGCCTGAAATGTTAGC
3541	75	135	MW2_CDS_09348	MW1756	FALSE	unmapped	ACGTATTTACAAATCGCAACTACTCTATCCAAGGCAAAATCGCAAAATCTGATCCCCGAA
3542	75	133	MW2_CDS_00071	MW0013	FALSE	unmapped	TTTACAGGTCAACCGAGTGTGTTCCAGAGCATTCTTTTAAACTTCCAACTTGTGTTATCA
3543	75	131	MW2_CDS_07252	MW1355	FALSE	unmapped	GGGCATGCTGTTGAATACTATCATAAAATACCTCATGGTCATGCAGTGATGGTTGGCATT
3544	75	129	MW2_CDS_07283	MW1361	FALSE	unmapped	ATATTCCAGATGTTGCCAAAGTAGCATGCCTCACAATTGACACATCAATGAGACACCTTG
3545	75	127	MW2_CDS_01532	MW0281	FALSE	unmapped	TGATGCAGAAACAGCAGCAGCAATTTTCACTGTATTATTCTTATTCCTATTCATATTTGG
3546	75	125	agr_tiling 066_F		FALSE	unmapped	AAATGCAATACTAATAGAGGTAGCACAATAAAAAGTGTAATGCTTTCTATATAACACCAA
3547	75	123	MW2_CDS_02961	MW0545	FALSE	unmapped	TGGTGTGAAAGGTTCAACAAGACAAGCAGTAGAAGATGTTCATAAACTTTGTGAGGACCC
3548	75	121	MW2_CDS_00811	MW0151	FALSE	unmapped	GGTGTCGTTGAAGTTACAGGAAGTAATACAGTTAGTGTGGCAGAACATGCGGTTATGGAT
3549	75	119	MW2_CDS_11470	MW2174	FALSE	unmapped	ACTTCGAACCAACCTGACGATGCCGTCTTTAACTTTTCTTTTGAAGAAGGCATTCAACAA
3550	75	117	MW2_CDS_13858	MW2616	FALSE	unmapped	TACGTTCACTGGTTACAACAGAATTTATTTGGTCTGTCCCTGGCCGCTTTGACATATACG
3551	75	115	MW2_CDS_11338	MW2144	FALSE	unmapped	CAGGTTTAGAAGTAACTGCGATCAGAGACGTTACTCCAGTACCTCATAACGGTTGTCGTC
3552	75	113	MW2_CDS_04034	MW0735	FALSE	unmapped	TATTTGCAGATGAATTAGAAGGTGCGCACACTGTTGTATGGAATGGACCTATGGGTGTAT
3553	75	111	RC9		pos		
3554	75	109	MW2_CDS_04168	MW0763	FALSE	unmapped	AGTTGTAGGGCACGGTTTACTAAGTGAAGTTTATCTTGATAACGAGGCACAACGGGAAAT
3555	75	107	MW2_CDS_08223	MW1547	FALSE	unmapped	AAGCGATTAATGCAGGTGCAGTTAACACTGTTTTGATAAAAGATGACAAGTGGATAGGGT
3556	75	105	MW2_CDS_09785	MW1837	FALSE	unmapped	CGACAAATAATTTTCAAATGCGAAGGTTTATTATCTTGCAACTTGTTATTGCGTTATTCG
3557	75	103	MW2_CDS_09954	MW1868	FALSE	unmapped	TGGCGTTGATGAAGGGGAAATTTTAAAGAAGTTAAAAGACCCACAAGATGTTGCAGCTGA
3558	75	101	MW2_CDS_05191	MW0959	FALSE	unmapped	ACATCTGGAATCATGTCGACCGCGTCATTTTGATGGATTATAACGGAAATATCATTGCCG
3559	75	99	MW2_CDS_05110	MW0945	FALSE	unmapped	TTATCAGCCCTCGGTGTTTCTGCTACACTAGTAACACCAAATTTAAATGCAGATGCAACG
3560	75	97	NC_A_108		FALSE	unmapped	TTATTATAAACTGTGTGTGTTGATGACGAAGACAACCCTCCGACACGCTTAATGAGCTCG
3561	75	95	MW2_CDS_01464	MW0269	FALSE	unmapped	AGTTTCATTTGATTATATTGATTGGATAAATACAGAGTTTGATCAATTGGGCCGTCAAAA
3562	75	93	agr_tiling 210_F		FALSE	unmapped	AAGTATGGTGCTATTAATAGTTTGCCAACATTACAAGAGGTTGAACAAGCATTTTAAATA
3563	75	91	MW2_CDS_01427	MW0262	FALSE	unmapped	GCATATGTACGCAAAGTAGGACATACCGTTTTCAAATGGGTTGCTATCGGTATGACAACG
3564	75	89	MW2_CDS_12627	MW2389	FALSE	unmapped	TTATCAGGATATTTCCAAGGGTTTGTTGACGCCTTAATCATGCGTGCGTGTGATGTTATG
3565	75	87	MW2_CDS_12547	MW2373	FALSE	unmapped	TGTTATTCCTAAAGAGTTAGAAGCTAAGTTCGAAGAAATGCCACAGTTAGAGTCTTCATT
3566	75	85	psma_tiling_045_R		FALSE	unmapped	ACGAATTCCATGTGAATGGCCCCCTTCAAATAAGATGTTCATATCTATGAGATTTTTATA
3567	75	83	MW2_CDS_04988	MW0923	FALSE	unmapped	GAAAGTCAATAAAGCCATTTATGTTATTGTTGCATTATTTCTTGGAGGTTTAGGTATTCA
3568	75	81	MW2_CDS_04225	MW0775	FALSE	unmapped	ATGAATAACATTTTGTTAAATGCTATCAATATAGTTATTACTACCACTTTTGTTATCTTT
3569	75	79	psma_tiling_026_R		FALSE	unmapped	AAATATAACGCGTCAGACTACAAAGATCACGAATATTCCGTACGTCCCACCAAGAACATC
3570	75	77	(-)3xSLv1		neg		
3571	75	75	MW2_CDS_11645	MW2207	FALSE	unmapped	GAGTCACGTGTCTATCGCCCAACTGATGAAAATGATGAATATGCAGGTGTATTCGGAGAT
3572	75	73	MW2_CDS_05541	MW1027	FALSE	unmapped	ACTTTGAGTCCAACGTATAAGTTATTAATGGGTGTGCCGGGTCGTTCAAATGCTTTTGAC
3573	75	71	MW2_CDS_09196	MW1726	FALSE	unmapped	TTTGTATCTAGTACATTGGCCAGGTACGAACGAAGCCGTAATGGTTGATACATGGAAAGG
3574	75	69	MW2_CDS_13372	MW2531	FALSE	unmapped	TTGAGCCACGTGTTCATTTACCTGGTGTGGGTGAAAACTTTGAAGATCACTTAGAGGTAT
3575	75	67	MW2_CDS_09770	MW1834	FALSE	unmapped	TTCAACAAGCTAAAGAAGAACGTTTCCATGGACAAAAGATTTATAACTATATTAACGACA
3576	75	65	MW2_CDS_00722	MW0134	FALSE	unmapped	TGGTTTTTCATTATCCTATATCGCAGGCATTACACTAGGATATAAAACGTTTAAAAAGCA
3577	75	63	MW2_CDS_09161	MW1718	FALSE	unmapped	ACTCGTTTCATATTATGCGAAATTGCATTTATCATCACAAAGTGTGCTAATTGAGACTGC
3578	75	61	MW2_CDS_05063	MW0937	FALSE	unmapped	AGCTAAAGATGAAGGTTTTTACGTAGCTACTATGAATGCCCAATGTCATGCTATCCCATT
3579	75	59	MW2_CDS_12254	MW2319	FALSE	unmapped	CATTGTTTTGCCAGCAGCGACTTGGTATGAGAAGCATGATTTGTCATCTACAGATATGCA
3580	75	57	MW2_CDS_07121	MW1330	FALSE	unmapped	ACAATCAGACATTTTTGCTGTATCAAGTCGAAATGCATTACAAGCTGAAGATAAGGGCAT
3581	75	55	MW2_CDS_07201	MW1346	FALSE	unmapped	AGGGATAAGAGATGCGATTCAACATTTTAGTCAAGATGAAGTCAAAGTGAAATGGCCGAA
3582	75	53	MW2_CDS_11190	MW2114	FALSE	unmapped	TGAAGGTGAGCCTGCACAACATAGTCAGCTTCATGAGAATGAAAATGTTGCTAATGAGTT
3583	75	51	MW2_CDS_04345	MW0799	FALSE	unmapped	ACGCCACTACAAGCTTATTTCCGTATTAACTCTGAGAACATGGGTCAATTTGAACGTACA
3584	75	49	MW2_CDS_10764	MW2033	FALSE	unmapped	TTACTTGCTGGCTTATTCTTTAACGAACCAGCATGGGGTTGGATTATTAGTATCCCAGGA
3585	75	47	MW2_CDS_00879	MW0162	FALSE	unmapped	GCATCAATCGAAGCAGCCTATCATCATTACTGGACATGAAATCAACAGTTTTCACCTTCA
3586	75	45	MW2_CDS_08817	MW1656	FALSE	unmapped	TCAAAGGTGGACCAATCCACTTAAAAGGTCAACAAATTAATGAAGGTGATTTTGCACCTG
3587	75	43	MW2_CDS_11082	MW2095	FALSE	unmapped	TGCGATACAATCAGGAATCTTTGGTCCAAACTTACATAATGTGTTAAGTGCTGTTGCTGT
3588	75	41	MW2_CDS_04959	MW0916	FALSE	unmapped	TGGATGCGGTAAATCTACATTATTAAATACTATTGCTGGACTTGAAAAAACGGGGAAACA
3589	75	39	MW2_CDS_06433	MW1197	FALSE	unmapped	ACCGAATTCAATTGTTATGTTACATAACCATCCTGGGCAGTCTAGTTTTTCTCTTACAGA
3590	75	37	MW2_CDS_12210	MW2312	FALSE	unmapped	CCAATCCAAGATTGTAGTGATCTCGTATTTGAGTGGAAGGCATTTATGAACACTATCGCT
3591	75	35	MW2_CDS_01033	MW0191	FALSE	unmapped	GTCCACCAGTGTCAGGGCAGAATGCTGGTAGTACAGATATCTTGATATCTTGGGTGTATA
3592	75	33	MW2_CDS_01773	MW0322	FALSE	unmapped	AGCAAGTATCATTGCACCACCCGATTTAACATTAAATATATTACTCACATTGCCACTCAT
3593	75	31	MW2_CDS_13210	MW2500	FALSE	unmapped	ATCACACCGAGTGGCATGTTAACGAAGCCACAGTTTGATTTAGTCAAGAAAGAAGTAGGT
3594	75	29	MW2_CDS_13201	MW2499	FALSE	unmapped	TCAAGCCAATCATTCAATTAGCAACGATTGGTGCAGATGGCCCAACAGGTACATTTATTA
3595	75	27	MW2_CDS_07430	MW1389	FALSE	unmapped	TGGACCGATAGCGAGTTCTTATTCGACTCTAATTGGATGTTTGAAAATGGAATTCCTCTT
3596	75	25	MW2_CDS_07413	MW1386	FALSE	unmapped	AAGGGGTAGCTGGTTGGAACTTATATGTAGAAGCTTCAAACACAGGTGGCTTTGTTCATA
3597	75	23	MW2_CDS_12523	MW2369	FALSE	unmapped	CCGTTGGATCATTTATAGGAGCACCTACGCTTGGTGACATTGTGATTCGTGGTACAAATG
3598	75	21	MW2_CDS_02229	MW0411	FALSE	unmapped	AGACAAAGAATTAAATGGTCTGAAGGATTCGCATCATTTAATGACGCATGGAGAAGGCAG
3599	75	19	MW2_CDS_07999	MW1507	FALSE	unmapped	AGGCTTAGTCCTAGCTTTCTATATGGACATTTCTCCGGGTGGTGTAATTGTAGTTCTACT
3600	75	17	RC9		pos		
3601	75	15	MW2_CDS_07528	MW1411	FALSE	unmapped	TGTAACTGAGCAAGTGTATATTATGATGACGGCTAATGATGATGTAGAGGCGCCGAGTGA
3602	75	13	MW2_CDS_02383	MW0440	FALSE	unmapped	TGTAAAGACATTGTAAGAGAACAAGGTTTGGACATGCGTTTAGTCAATTGCGAATATACA
3603	75	11	MW2_CDS_03417	MW0627	FALSE	unmapped	CCAAAATTTATACACTGCTGGTCAATGTACATGGTACGTATTTGACCGTCGTGCTCAAGC
3604	75	9	MW2_CDS_08395	MW1580	FALSE	unmapped	AGATACAATCGCATTCCCTAAAACAGCATCTGCTACATGTTTATTAACGAATGCGCCTGG
3605	75	7	MW2_CDS_11905	MW2256	FALSE	unmapped	TGGCATCGCGTTTTGTTGTGGTTGTCGATGAAACGAAAATAGTTCAATACTTAGGTGAGA
3606	75	5	MW2_CDS_01001	MW0185	FALSE	unmapped	GTGATCGTGCGCAATATTTGGCGGATGATAATTTTCATGAGGTGCCTGTACAGTCATTAA
3607	75	3	MW2_CDS_09484	MW1782	FALSE	unmapped	TCTAAGAAAAGCGACAAAGAAGGCTTAGACGATAAAGAAGCGAAACAAAAAGCTGAAGAA
3608	75	1	MW2_CDS_04506	MW0832	FALSE	unmapped	CTCACAGCAATTAGTGTCTATCTCGTTTTGTCTAAAAGTCTGATACGAATTGTTATGGGA
3609	74	164	MW2_CDS_07232	MW1351	FALSE	unmapped	ACATTTTGGCAATATACACTTTATCAACGTTCTTGGTTAATGATGCTACTCATTTGTAAT
3610	74	162	MW2_CDS_02787	MW0514	FALSE	unmapped	CGCATTCAGATGCACAAAAAGGTATTGCGCTAGAAACAATTGCCGAAAGATTAGGGATTG
3611	74	160	MW2_CDS_01413	MW0259	FALSE	unmapped	GGTCGAGCATTAGGCGTAAGAGCGAATGATTTGAACCGTCAAATGGCTAAAAACGATAAA
3612	74	158	RC10		pos		
3613	74	156	MW2_CDS_08547	MW1609	FALSE	unmapped	AGCTTAACGCAAACATCACGAATTATATTTGTTGTTGTTTTAGTACCGTTCATTTCATAT
3614	74	154	MW2_CDS_04851	MW0894	FALSE	unmapped	ATGCAACAGGTAAAGATTATTCAGGTACTGCGATGTATGCACAAGCCGGCATTGATAAAG
3615	74	152	MW2_CDS_06213	MW1154	FALSE	unmapped	AAATTAGGCTTTCCGGCACATATGTCGAAATTAACACGAATCGAGTCTGGTGGATTTGTG
3616	74	150	MW2_CDS_11124	MW2102	FALSE	unmapped	TCAAACGAACAAGTGATGTTTTGGCTTGTCGGTTCATTATCCAGTATGAAGTGGGATGAA
3617	74	148	MW2_CDS_07913	MW1491	FALSE	unmapped	TGTATACAGTATTAATGTCAAAGCTTTTTCGCTCATTGAAATGTTAGTAGCGATGATGGT
3618	74	146	MW2_CDS_12814	MW2425	FALSE	unmapped	GCCGTTTGGGGAACAAGAAAAGAAAGAAATGTACGATTTGCGACTGATGCTAGAGTCTTT
3619	74	144	MW2_CDS_03581	MW0657	FALSE	unmapped	CACGATCCGAAAAAGTCTACGACAAGTGGTTTCCAAAAGTTAGAGCCACAATTGCTAACG
3620	74	142	ETG02_36680		pos		
3621	74	140	MW2_CDS_11696	MW2216	FALSE	unmapped	TCAAAGTTCTTCAAGTATGCGCGAGATTGATATACCTTTTGAGCCTACAAAAAGGAGTCA
3622	74	138	MW2_CDS_00522	MW0097	FALSE	unmapped	TAGGCGAAGCACATTTTCAAGTATGGGAAAAGGTTGTCGCAAGTTATAGTGGTTGTTGTT
3623	74	136	MW2_CDS_10318	MW1947	FALSE	unmapped	ATGAGCATAATTACAAGATTGTTTAATAACAGTGATTTTGAAAAATTAAATCAACTATGT
3624	74	134	MW2_CDS_12505	MW2366	FALSE	unmapped	GCACCTGTTAAAGGTTCTGAATTTGCAGAATGGTATAAAGAACAACTTGGTGTTGAACCA
3625	74	132	MW2_CDS_00256	MW0048	FALSE	unmapped	ACAAAAACATTCTATGATGGCTTAGTCAATAGAATAGACGAAATACAGGAAGATAGTGAA
3626	74	130	MW2_CDS_09832	MW1845	FALSE	unmapped	ATTGGACGAACAGGTGTAGTCACACCTACTGCTATTTTAGAACCAGTAAAAGTAGCTGGT
3627	74	128	MW2_CDS_01061	MW0195	FALSE	unmapped	ACGTGAGGCTACAAATGAATATATCGGTGCTAACTTAGATCCTAGTCATCTATGGTGGCA
3628	74	126	MW2_CDS_06483	MW1209	FALSE	unmapped	TGCAGAAGATCAAAATATGTTACGACAGGCAATGGTTCAATTAATTAAACTACATGGTGA
3629	74	124	MW2_CDS_09463	MW1777	FALSE	unmapped	ACGAAGGTAGAACCGTTCTAATGAGTACACATATTTTAGCAACAGCTGAACGTTATTGTG
3630	74	122	MW2_CDS_11360	MW2149	FALSE	unmapped	ATTCCTGTAATCTTTGCAATGGCGTTCTTCTTACTGCCTAGAACATTAACGTTGTTCTAT
3631	74	120	MW2_CDS_10626	MW2005	FALSE	unmapped	TGATGGCGATGAGCCATTATTGAAACCGCATGTTAAAGAAGTTGAAAATGCAAAATGTAT
3632	74	118	psma_tiling_009_R		FALSE	unmapped	TTTTGATAAAGCAGAAATTTGCATTTTATCCATAGGGCTAGGACATGTATATGTCTTAGT
3633	74	116	MW2_CDS_05611	MW1040	FALSE	unmapped	CAAAGTTAAGAAAATGGTCTTACAAGAGCGAATTGATAATGTATTAAAACAAGGATTAGT
3634	74	114	MW2_CDS_07563	MW1423	FALSE	unmapped	ACCAACGAAATGTGAGAGCGGAATATGAAGAAGAAAGAAAGAGAAGATTGAGACCATGGC
3635	74	112	MW2_CDS_05056	MW0936	FALSE	unmapped	GCTGGTCAAAATACACTTTACAAAATGAGATGGAATCCTGCACATCCAGGAACACACCAA
3636	74	110	MW2_CDS_12958	MW2452	FALSE	unmapped	CTGGTGCAGTAAAGATTGGGAATTCAGCACGCGCAATATTGGGAGATATTCCTAAAAATA
3637	74	108	MW2_CDS_13260	MW2510	FALSE	unmapped	AGTGTTTTCACTTATTTCAACACTTGTCATTGTCATTTTAGCAATTATAAGATTTGTTCA
3638	74	106	NA		ignore		
3639	74	104	pMW2_053		FALSE	unmapped	AACAAGAGAGAAATGAAAGTAAACGTCGACAAGCGCAAGGAATTCAAGTTGCGAAGGAAA
3640	74	102	MW2_CDS_12833	MW2428	FALSE	unmapped	TTGTTCCTATTGCGGCGAAAAAAGCGAAAGATTGGTATCGAGCGTTATCGAAAGAAGAAA
3641	74	100	MW2_CDS_06481	MW1209	FALSE	unmapped	CCGGGATACTTTGAAAAAGCAGTTGTGAATGATGTGGATGCATATGTTTTAAAAGAACGT
3642	74	98	MW2_CDS_09319	MW1751	FALSE	unmapped	TACATTACCTAGACGATGAAGGTACCATGGCAGTCGTACTCCCACATGGTGTATTATTCC
3643	74	96	MW2_CDS_13462	MW2547	FALSE	unmapped	CTTCCGATGGACATACAGGCGAGGATGTTAATACCTACGCTTATGGACCTAGATCAGAAT
3644	74	94	MW2_CDS_13060	MW2472	FALSE	unmapped	GGGCCATGTATTATTGAAGTAAACGGACAACAGTTAAGTATTAGGCATTGCGATGCTTGT
3645	74	92	MW2_CDS_07637	MW1442	FALSE	unmapped	ACAGGTACAATTCACCGCATTAAATACGAGGAAGGATTCGGATACAAAGACACTACAAAG
3646	74	90	psma_tiling_051_F		FALSE	unmapped	GAACAATTCACTGGTAAATAAGATTTCATAACAAACAAAGGAGGTCTTTCACATGGGTAT
3647	74	88	MW2_CDS_13185	MW2496	FALSE	unmapped	ATATTCAACATATTGTGTATAGTACTGCGGGAGGGGTTAATCGAAATCGAACTGGCCCAC
3648	74	86	MW2_CDS_09374	MW1761	FALSE	unmapped	TGCGCCCGGAGGATCATTTGCTTATTTAAATCAATTCGGTGTGGATAAATGGATGAATGA
3649	74	84	MW2_CDS_05291	MW0980	FALSE	unmapped	AGTTACAAAGCAGTTCAAGATGTAAAAACTCACTCTGAAGAACAAAGAGTAACAGCTAAA
3650	74	82	MW2_CDS_03783	MW0692	FALSE	unmapped	CGCAAAAGCGGGTCGCACGATATCAGAAGAGTATAATGTCCCTTTATTAATGAAGTTTGA
3651	74	80	MW2_CDS_01035	MW0191	FALSE	unmapped	TTTATTAGGTGTAGCACCAGCATGGTTAAGTGATCCGTTTTGGGCAAAAGTGGCATTAAT
3652	74	78	MW2_CDS_00231	MW0043	FALSE	unmapped	ACTAATGATGAGAGATATGCGAATATGAGCCAACTGGATTTAATGATAGATTTAGGAGCA
3653	74	76	MW2_CDS_05537	MW1026	FALSE	unmapped	TGCAGTGGGGAACACAAAAGTTTCATTAGAATTAGCGTATGATGATGAAACGATTGGTGT
3654	74	74	MW2_CDS_13778	MW2601	FALSE	unmapped	TGATTCCAAGTTCCTCGCATTTAATTGAACTTTATAATATTTGTAGTCATCCACAAGCAA
3655	74	72	MW2_CDS_01737	MW0316	FALSE	unmapped	TGAACTAGAAGTCATCAATGAGGGACATCAAATAGAGTTGATGGATTTACGAGAACTTGA
3656	74	70	MW2_CDS_11656	MW2209	FALSE	unmapped	AGGCATCCCATATGTTCGAGAAGACCGTAAAGTTAATAAGGCTTTCAGACATATAGGGCA
3657	74	68	MW2_CDS_04780	MW0882	FALSE	unmapped	TGCTGGTGTAGATATGACAACACCTGAACCAATTGAACAAGCTTGTGAAGTTTTTGAACA
3658	74	66	MW2_CDS_11366	MW2150	FALSE	unmapped	TGAAATTACATGAGTTAAAACCGGCAGAAGGTTCACGTAAAGAACGCAATCGTGTTGGAC
3659	74	64	MW2_CDS_07050	MW1317	FALSE	unmapped	AATTGATACAATGGCACTTCCGCCTTGTCATACCATGTTCCAGTTTTATGTCCAAGATGG
3660	74	62	MW2_CDS_03050	MW0561	FALSE	unmapped	AGGCTTTATTGGTTGGTTGGTAATGACTGCAGGTTTCTTTCTGTTAAACATGTCATCGAT
3661	74	60	MW2_CDS_11435	MW2167	FALSE	unmapped	ACACTTTCGACGTTGATACTCGTGTTAACAAAACACAAGTAAAAATGGCTGTTGAAGAAA
3662	74	58	MW2_CDS_13270	MW2512	FALSE	unmapped	ACTATGCATGCTGAGTTTGAAGTGCTTGGCGTAAAAGTGCTATGTTCTGATTCTTTTGGT
3663	74	56	MW2_CDS_05599	MW1038	FALSE	unmapped	AGGTTTAGAAATCGCTAAAAATTTAGCAGACCAAGCTAAAAAGGACGATGAACGTGCTGA
3664	74	54	MW2_CDS_13506	MW2555	FALSE	unmapped	GATCAAGCTGAAAATAGAATGCATACAATTAAGGCAGTAATGGCAGCAACATTGGGGAGT
3665	74	52	MW2_CDS_12475	MW2361	FALSE	unmapped	GTCTAGGCTATCCAAGACAATGGCGTTCAGAAGATATTTACCAGGAAATAAATGAGACGA
3666	74	50	MW2_CDS_10580	MW1998	FALSE	unmapped	TGTCTCATGACGATGTTAAAATAATCGAAGCGAGAACTATGTCGAATTTGAGAGGGGTTG
3667	74	48	MW2_CDS_02205	MW0407	FALSE	unmapped	AACAAGCATCTGCTAAAGACGCTTATGGCTGGATTGTCATGGGACGTGTATTAGCTATTA
3668	74	46	MW2_CDS_02400	MW0444	FALSE	unmapped	TAGTAGTGGCAGCCAGAGAAGCTAATATTAAAGTAGAGACTGTGCCTGGACCTAATGCTG
3669	74	44	MW2_CDS_11185	MW2113	FALSE	unmapped	CGCAATTTCGTCATATAATCATCCTGAAGCAGATATCGGACCACGTATTCAAGGTACGCT
3670	74	42	MW2_CDS_12657	MW2394	FALSE	unmapped	AGATTTTACAGTACATCAGCCAGGGGGCAGTATTTTAGTGACATCAAAGCGATGTCATCA
3671	74	40	MW2_CDS_10205	MW1924	FALSE	unmapped	CGAATTAGAAGAAACATGTTCAACAACGGTTAACGGCGTCGAATACGACAGCGGTTTAAA
3672	74	38	MW2_CDS_13919	MW2628	FALSE	unmapped	CAGAAGATGCTGGAGAGCGCCAGATGTTCATTATTGATAAAAAAAGACAGACGCCGAAAA
3673	74	36	MW2_CDS_08779	MW1650	FALSE	unmapped	TGGTGATACAGGTCTGTTTAGTGACATGTCACTTATTGCGAAACGTCATCCAGTTGATGT
3674	74	34	MW2_CDS_10356	MW1956	FALSE	unmapped	CTGGTGAAATTGGATCAATGCCAGATTTGAAAAAGCCCGAAGATAAGCCGGATTCAAAAC
3675	74	32	MW2_CDS_05613	MW1041	FALSE	unmapped	AGAGCTAAAGCGGCACTTAAGAAAAATGATTTCGTATCAATGGCTGATGCTAAAGTTGCA
3676	74	30	MW2_CDS_01407	MW0257	FALSE	unmapped	GCCAAGCTTCAAGCAATGGCTTCAAAGTAGATAGACACCCAACACGAGGATCAATTTTAC
3677	74	28	MW2_CDS_03032	MW0558	FALSE	unmapped	TGGCCGGTTGCAGGAAGTTCAGTTCTATTTGGAATTATATTGAGAAAGTACGGTAACTTC
3678	74	26	MW2_CDS_03614	MW0662	FALSE	unmapped	AGCTGGTCTTGTAGGTGGTATGTTAGCAATTTCAGGTGGTTCAGGATTTATTGGTGGTAT
3679	74	24	MW2_CDS_02521	MW0466	FALSE	unmapped	TGATGAAACGGTTGATTTAAAAGCAATTTCACAACGTACACCTGGTTTCTCAGGTGCTGA
3680	74	22	MW2_CDS_11119	MW2101	FALSE	unmapped	ATTGAGTTATCAATTAGATGTATTGAATCTAGGTGATGCTGTTGCAACCGCACTCGGTTT
3681	74	20	MW2_CDS_11282	MW2131	FALSE	unmapped	TCAACATGGTACATTAGGCACATTAATGGCAGGATTATTAAAAGGAACTGCATCAATAAA
3682	74	18	MW2_CDS_13804	MW2605	FALSE	unmapped	TGAGGCATTAGAAATAAGAGAAGCGACAAAAAATGAGGATTCTGTTACAGGAAGCATTGA
3683	74	16	NA		ignore		
3684	74	14	MW2_CDS_11788	MW2234	FALSE	unmapped	TTGCGTATATCAAAAAATATTGGCTTAGATTGTCAATAACGTATATTATTGCTCTCATCT
3685	74	12	MW2_CDS_04077	MW0743	FALSE	unmapped	TGCATATAGCACCATACGAAGAAGGGAATCGTTTTAATCACGATCCTCTTCGTTCTCGAA
3686	74	10	MW2_CDS_02379	MW0440	FALSE	unmapped	AGCGCAACATTTAAAAACACGTATCGAGTTGAGACAAATTGGTGTAAGGGATGAAGCCAA
3687	74	8	MW2_CDS_00248	MW0047	FALSE	unmapped	TTCACTGAAGTGGAAGTTATCGAACATCTTGTAAAGGCATATAAAGAAGCAGGAAAGCCT
3688	74	6	MW2_CDS_01447	MW0266	FALSE	unmapped	ACCTCTCGTAAATTTTGAATTGTTTGATCCATCAAATTTTGAAGAAGCTAAAGCGGCTTT
3689	74	4	MW2_CDS_13695	MW2587	FALSE	unmapped	ACAGCACTTATCGCTATATCTTGTGTCTTTTGGATATATTGTTTAGTTGTTCTACTCGTT
3690	74	2	MW2_CDS_08403	MW1581	FALSE	unmapped	TGTTACAATGGGTGATCAAGCAGATCGATATGCTGTGAAGTTATTAAATCATTTGAGACA
3691	74	163	MW2_CDS_01366	MW0251	FALSE	unmapped	TGTAACGATTGAACCTTTAGGCAATGAAGCAGGTACATTTGGATTGCCAGGTGGATTTAC
3692	74	161	MW2_CDS_02901	MW0535	FALSE	unmapped	AGCGCGAAAGCTTTCGTCGCTTCTGCTATTAAAAACGGTTGGAAAATGAATGATTTTGTT
3693	74	159	agr_tiling 038_R		FALSE	unmapped	ATTGTTGAAATGATATCTTGTGCCATTGAAATCACTCCTTCCTTAATTAAGATAAAAATT
3694	74	157	MW2_CDS_12397	MW2347	FALSE	unmapped	AAGGTGTAGATATACTCACTTCTAGTTTATCTAAAGCATGTGGTGCATACGGGGGTGTGA
3695	74	155	MW2_CDS_05595	MW1037	FALSE	unmapped	GCTGCTATTAGTTTAACGGTATCAACGTTTGCCGGTGAATCTCATGCACAAACTAAGGTT
3696	74	153	agr_tiling 043_F		FALSE	unmapped	AGTTAAGAAAAATTGGAAAATAAATGCTTTTAGCATGTTTTAATATAACTAGATCACAGA
3697	74	151	MW2_CDS_01153	MW0212	FALSE	unmapped	GGTGCTGCTATTGGTGCAGGGTTCGCAGTTTTTGAATCAGCAGGTTATATTTTGAATTTC
3698	74	149	MW2_CDS_06524	MW1217	FALSE	unmapped	AACATGAGGTATTACAATTAGCGACTGAAATCGAAGGACATCCTGATAATGTTGCGCCGA
3699	74	147	MW2_CDS_00451	MW0085	FALSE	unmapped	ACTGACTTATTTATTTCATCAGCAAGAAAACACACTTCCATTTAAGAAGATTGTTTCAGA
3700	74	145	MW2_CDS_03113	MW0572	FALSE	unmapped	AGTAGTCACATTACCAAATCATTTTACAAATCAAGATGCTAATGAATTTCATGCTCTGTT
3701	74	143	MW2_CDS_00789	MW0147	FALSE	unmapped	GGCAAAGGTAAGACTTTGAAACATGGTGATGACGTTATACCTGATGCGTATTGCTGTGTG
3702	74	141	MW2_CDS_03526	MW0646	FALSE	unmapped	AGCGCCTGAATTTTATAATGCAATTAAGGACTTAGGGCAAGCGTTCCATACTGGAAAACA
3703	74	139	perR_tiling_108_R		FALSE	unmapped	TATTGGAAATTGTTCTCCTTTTTGCAACATATAATCACCTTTTTCTTCATTATAATAATT
3704	74	137	perR_tiling_022_R		FALSE	unmapped	AATTCTTTTACAATTCCAATATCTTTAAACACTCTTAAGTTATTATATATTGTCGCAACA
3705	74	135	MW2_CDS_13309	MW2519	FALSE	unmapped	CCTCTTGAAGTCGAAGCAATTCAAGGCTTTATTTATCGACGTGCACGTGAACACAATCTT
3706	74	133	MW2_CDS_04133	MW0756	FALSE	unmapped	AGTATTACTAGGTTAATTACTGATGACTATTATTTTACAATTCTTACAGACAGTTTTGGT
3707	74	131	MW2_CDS_08798	MW1653	FALSE	unmapped	AATATTTTAATCGCAGTTGACGGTTCACATGAAGCGGAATGGGCATTTAACAGAGCAGTT
3708	74	129	MW2_CDS_08361	MW1572	FALSE	unmapped	ATTTGAGATCGACGCAATGAGTATTACTGCTCATAAGTTTGGAGGACCAAAAGGTGTCGG
3709	74	127	MW2_CDS_03806	MW0696	FALSE	unmapped	TGCTTTTAGGTCGTGCTGAAGCAATTAATCTTGGGATATCGTATGAAAAATTAACGCGAA
3710	74	125	(+)E1A_r60_n9		pos		
3711	74	123	MW2_CDS_13460	MW2546	FALSE	unmapped	ACAAATGACACGGAAAGTTCAAATCAAGAGCCGTCATTGCAACAGGCTAAAGAACAAAAA
3712	74	121	MW2_CDS_07754	MW1462	FALSE	unmapped	ACATGCAAAATCTACATACGCGCTTGAAGGACCCAAATATTAAACAGGCAATCATTTCGT
3713	74	119	MW2_CDS_08858	MW1663	FALSE	unmapped	ATCGAATGCATCGAAAAGTTAAACACATTGGGCAGTATATATGAATTAGGTGTGCTTTGT
3714	74	117	MW2_CDS_08841	MW1660	FALSE	unmapped	CGTGAAGATGAAGCAGAAGCAGAAGACAATCTGCTACGAGTCCAATCGAAGAAAGAAGAA
3715	74	115	MW2_CDS_12869	MW2435	FALSE	unmapped	GCAGATGAAGGTCGCATTATTAATGGTCACACACCAGTGAAAGAAATCAATGGCGAAGAT
3716	74	113	MW2_CDS_07854	MW1480	FALSE	unmapped	ACTTCAGATAATCACAAAACAATTAATGCACCTATGGTAGGTACATTTTACAAATCGCCA
3717	74	111	MW2_CDS_06158	MW1143	FALSE	unmapped	AATGTCAAAGTTGAAACAATTGGATTTACTGATAAGTTGCCAAAATCAACGATAGAAGCA
3718	74	109	MW2_CDS_04924	MW0907	FALSE	unmapped	AGCACTTCGAGAGGTAAGAAAACGACAGCTCATAGAACTTATAGATGACGCACTCGTCAA
3719	74	107	MW2_CDS_13697	MW2588	FALSE	unmapped	AAATACCGGCAACTGGGTTTATTATCACAGGTCATGTTGGGGAAGAAAACTTTCACAACC
3720	74	105	MW2_CDS_03744	MW0685	FALSE	unmapped	TGGTATTAATTATAGGTACAGCAACACTAGCAGCATTAATTGGTGCAGGCGGACTAGGAG
3721	74	103	MW2_CDS_13843	MW2613	FALSE	unmapped	ATGTTAGGTTTCTTCGGTAACCTATTAGCTTCAACAACACACTATAGTAGTGGCCCAGCG
3722	74	101	MW2_CDS_05901	MW1098	FALSE	unmapped	TGAACGGTATCCCTTTTACAGAACGTGCGGACCGTATTTTAACAGATAAAGAAGTGGAGG
3723	74	99	MW2_CDS_00802	MW0149	FALSE	unmapped	TTAGGGGTAAATGGCTCGGCTACGTATCAAATTACTTTGAATCAAGTCGTAGTGCCACAA
3724	74	97	MW2_CDS_04110	MW0752	FALSE	unmapped	TTGTCCGCCAATGTACTATCTTATTGATGGTAAAGGTCTAAAGCTACCAATCGTAAAGAA
3725	74	95	MW2_CDS_02914	MW0537	FALSE	unmapped	ACAAATGAATCGTCGTATTGCTAACCATAATCAAATGCCACAATCACAAATAACGCAGCC
3726	74	93	MW2_CDS_05290	MW0979	FALSE	unmapped	AGTTGGTGGAGGATACATTGGATCAGAATTAGGTACAGCATTTGCTAACTTTGGTTCAGA
3727	74	91	MW2_CDS_10927	MW2062	FALSE	unmapped	ACAACTTCTTTGATGTAGATACAATCATTCGTATCGGTTCTTGTGGCGCATTACAAGAAA
3728	74	89	MW2_CDS_00320	MW0062	FALSE	unmapped	TGGAGTTATTTCAATCATACCAATGGTGTTTACAATGATCTTTAACATATCATTACCAGG
3729	74	87	agr_tiling 175_F		FALSE	unmapped	CACGTTTTAATTCAATCGTTTCAACGCTATTATCTTTAGACAACAATTGTAAGCGTGTAT
3730	74	85	MW2_CDS_10781	MW2036	FALSE	unmapped	ACAGGTACTAAAGAATTTAGAGAACTTGTAGACGAAGTTGGTATGTTGATGGCATATGAA
3731	74	83	(+)E1A_r60_a97		pos		
3732	74	81	MW2_CDS_13777	MW2601	FALSE	unmapped	AGCAGAAAGGCTTAAATTCAAGCGAGACAAAGCTATGGACGACATTATCAATCAAGGAGA
3733	74	79	MW2_CDS_05098	MW0943	FALSE	unmapped	AGTAGCTCACTTCCACTATACATTGGTTACTGGTGTTGTATTTGCCTGCTTAGCTGGTTT
3734	74	77	MW2_CDS_11462	MW2172	FALSE	unmapped	GCTGCAAACTTTGCTGAGATAAACTGGAAAAGTTTTGAAGTTGCAGTGCCAGCATTCATT
3735	74	75	ETG10_236652		pos		
3736	74	73	MW2_CDS_03742	MW0685	FALSE	unmapped	GCACAAAAAGGTGATAAAATTACGTTAGCTGGAAAGCTTGGCTCCGAGCCATCGATTATT
3737	74	71	psma_tiling_073_R		FALSE	unmapped	GCATGGGAGCACGCTTAAAGAGAACAATGCAACAAGGTATATCAACGTACCGTGATGCAG
3738	74	69	MW2_CDS_09546	MW1793	FALSE	unmapped	ACGACAATTGTTAGTGCTGTATTATATATACTTACAGCTATTGCTACGGTTGAAGCTACT
3739	74	67	MW2_CDS_11576	MW2194	FALSE	unmapped	TTTTAAAGGTGGAAGGTTTTTAATACATGGCATGACACGCACATCAGATGCCACACATCT
3740	74	65	MW2_CDS_01201	MW0221	FALSE	unmapped	TAGAACGATAGGTGTGGCTGTTCTAGAAAAAGAGGTGCCGTTTATTGAAATGGGAACACT
3741	74	63	MW2_CDS_00758	MW0141	FALSE	unmapped	GGTGGATGTTCTTGCAGTACGTATAGGATTAATCATAATGGTTATCATACAAACCGCTGT
3742	74	61	MW2_CDS_08933	MW1677	FALSE	unmapped	CGAATTGGGGGCAATTGAAGTCAGCATCAATTTTAGGCAATTACATCTTGCAGAAAAGCT
3743	74	59	MW2_CDS_07666	MW1447	FALSE	unmapped	GGTCGTAATCGCCAAGTCAGAAGAATGTTCGAACATTTTGGTCATCAAGTGACGAAACTG
3744	74	57	MW2_CDS_12366	MW2341	FALSE	unmapped	GCGGATAAAGCAATTAAAGATTTCCAAGATAACAAAGCACCACACGATAAATCAGCAGCA
3745	74	55	MW2_CDS_00216	MW0040	FALSE	unmapped	TTTGATGAGCTTTCATCTACGACACTTAGAGATACCACGGGTTTGTTATATTCCATCGCT
3746	74	53	MW2_CDS_10655	MW2012	FALSE	unmapped	ACTTTATCTTTAGAAGGTCAAATTGTCAGGGATGCAGATCGTCTTGATGCTATAGGCGCT
3747	74	51	MW2_CDS_00931	MW0171	FALSE	unmapped	TCTTAGTCTACCAATACGTGCAGGTTATTCGTTGGAAATTAAAGTCCCATTAAATGCGAT
3748	74	49	MW2_CDS_00852	MW0158	FALSE	unmapped	GGCAATCGTTTGATAACAATGGAACGAAGCTCATTTCTAATCCTGGCTGTTTCCCTACAG
3749	74	47	MW2_CDS_07651	MW1444	FALSE	unmapped	ACAGGCTTTACAAAAGAGGCAATTAACAAGACACAAAACGTTGGATATCAAAATGAATAC
3750	74	45	MW2_CDS_06689	MW1250	FALSE	unmapped	TGATGCCAATCGTCAATGTAAAATTATTAGAAGGTCGTTCGGATGAACAATTAAAAAATT
3751	74	43	MW2_CDS_02455	MW0454	FALSE	unmapped	AATTTAGTAGCACCTGTAACAATTGGTGATGATGTATTGGTGGCAGCTGGTTCCACAATC
3752	74	41	MW2_CDS_13077	MW2475	FALSE	unmapped	ATCACGTGCGACAGGTACTAGAATTTATGAACGTAGTGCCGTTGTTCAAGAAGGTCAAAA
3753	74	39	agr_tiling 011_R		FALSE	unmapped	TCGCCCTTTGCAAATGAATGATTTTCTTAATTAAATTGATTAATTTTTTGACCTTTTCCA
3754	74	37	MW2_CDS_00110	MW0020	FALSE	unmapped	TAAAAACTTGTCCGAAGATGAAGCGAGTTCCAGCAAAATGGAAGAAACGATTCCAGGAAC
3755	74	35	MW2_CDS_12740	MW2410	FALSE	unmapped	TGATCTAATTGTTGGAGACAAAGTCATAACTACAGAACATGAATATGATTTTGGCATTGT
3756	74	33	MW2_CDS_08778	MW1650	FALSE	unmapped	AGGAGCAACAGTAATTGGAAGTGCAGAAATGGCTGACTATCTTTCTTCATATCACGGTGT
3757	74	31	psma_tiling_080_F		FALSE	unmapped	ATTGAAAACTTAACACTGCATAACCTCCTTATTTCTAATCTCTCGCATAATTGCTTATGT
3758	74	29	MW2_CDS_00996	MW0185	FALSE	unmapped	GGCAGATCAAGTGCGATGGATGCATGACAAATATTGGGTTGATGAAAGTGTCGTTAGAAT
3759	74	27	(+)E1A_r60_a97		pos		
3760	74	25	MW2_CDS_07494	MW1401	FALSE	unmapped	GGGTACCAACTAGATGGACCACTTGTTAATATGGTAGAAGCGGGAAGAGACACCTTAGAT
3761	74	23	MW2_CDS_05836	MW1085	FALSE	unmapped	AATTCCAGGGATTGCAGGTGTTGATACAAGAAGTATTACGCGTAAAATTCGACAACACGG
3762	74	21	perR_tiling_082_F		FALSE	unmapped	TGAAGTTGAAACTGAATTACAACAACGCTTTTCAGATTTAGATTTTAAATTTTATAAAAA
3763	74	19	MW2_CDS_12525	MW2370	FALSE	unmapped	AAACAATTTTTCCCACCTTATGCTGCGAGTGCTGTTGCAACAAATGAATTATTACGCCAA
3764	74	17	MW2_CDS_03134	MW0576	FALSE	unmapped	CAAGAATCAAGTGCATTCCCATTTGTTGAAGAGCAAGAAAGATTCGTCGAAGATACAGCT
3765	74	15	MW2_CDS_06456	MW1205	FALSE	unmapped	TAGACTGGAATTCGCAAGCGCACCGTCCACAGTTTGAATATGATGTTAAGTATTTCCCTA
3766	74	13	MW2_CDS_09123	MW1711	FALSE	unmapped	GTTGGAACTTTGCTAGTCGAGGCAGGTCCAACCACTACTTCAGAATTTCTCCAATCTAAT
3767	74	11	MW2_CDS_08722	MW1640	FALSE	unmapped	TCCAAATGGCACTATTCTCATTTGTAGGAATTGAAATGATTGGTGTTACAGCTGGGGAAA
3768	74	9	MW2_CDS_05489	MW1017	FALSE	unmapped	TCAAATGCTGATGAGCAAACATCAAGCACATGTGAGACCACAATTTGAATCACTTGAAAA
3769	74	7	MW2_CDS_01930	MW0355	FALSE	unmapped	ATTGAGAAGGAAAAGTATGTGAACGAAATCATTATGCTTTTACGTACGATACCTACGTCT
3770	74	5	MW2_CDS_06538	MW1220	FALSE	unmapped	TTGGGGATCAAGCATTTGGTCACAAATACGATTGCGACAAGCTATTAAAAAACAAGGTCA
3771	74	3	MW2_CDS_12464	MW2360	FALSE	unmapped	ACATATCCCTGCTACAGAAATTATGAGACATTGGCCGACACATCCGAACAATCCACATAA
3772	74	1	MW2_CDS_05853	MW1088	FALSE	unmapped	ATAACCGTGTTACGTTAGGTTATCCTTTAGTTCGAGGCGCAATCCGCGATGGTTTAATTA
3773	73	164	MW2_CDS_00046	MW0009	FALSE	unmapped	CGCTTCAAGCGTGACAAAGCAGCTAAACCAGAATTAGCACATACATTAAATGGTAGTGGT
3774	73	162	MW2_CDS_07281	MW1360	FALSE	unmapped	TGGGTTTGGATTAAGGAATGTGCCAGACTATTTAGTCGCGTTAAAAGAAATGAATAGAGT
3775	73	160	MW2_CDS_11783	MW2234	FALSE	unmapped	GGGATTGGCGCATTTTATTTATTTCATTTAAAAGTGATGCCATCAAGGCTTCGAGCTGGT
3776	73	158	MW2_CDS_04971	MW0919	FALSE	unmapped	TTCAGCTTGTTAATAATGATGTATTAGCAGCGGAGTTTGGTTCGAAAGCGAGAGAAAACA
3777	73	156	MW2_CDS_00753	MW0139	FALSE	unmapped	AGAATATTATTTTGGATTGCGCACAGACAAGCCGGATGAATTCGTACCTTTACGTCACAA
3778	73	154	MW2_CDS_10385	MW1962	FALSE	unmapped	ACCACGTATTCATGAATTGTTCCAAGAAAGTTTTTCTACTAAAGGTGAAGGTCGTGGTTT
3779	73	152	MW2_CDS_07973	MW1502	FALSE	unmapped	TGATGTCGATAATAAGGGGATTTACTATCCAACTTCAAAAGGTGAAACAACGAATAACCT
3780	73	150	MW2_CDS_04642	MW0857	FALSE	unmapped	TCACTTAAGTGACATCTTGCATAAACGTGTTGTAGGTCAAGATAAAGCGGTTGACCTGGT
3781	73	148	MW2_CDS_04783	MW0882	FALSE	unmapped	TTCCAACCGTCAAATTCTAGTGACTACACTATTTTTGTCGCTGAAGTTGCATCAACTTGT
3782	73	146	MW2_CDS_13797	MW2604	FALSE	unmapped	AGAAACATCTTATGCATTTTTAGCATTAATATCTGCAATATTTGGGCCTTTTGCTGGTTT
3783	73	144	MW2_CDS_09628	MW1808	FALSE	unmapped	GGCTTAGTTCCCAAAGATCCTGATCAATTTAAAGCGTTAAAAGGTGTTGGCCCATACACA
3784	73	142	MW2_CDS_13572	MW2566	FALSE	unmapped	TCTCGAAAAACGGCGCTATTAGTTTTGGATATGCAAGAAGGTATAGCGAGTAGTGTACCT
3785	73	140	MW2_CDS_09710	MW1823	FALSE	unmapped	TGTCGGTGCTGAAATCAATGCAATCATTCATCAGCGTAGTGTAATTAAAGGTAAAACACC
3786	73	138	MW2_CDS_12318	MW2333	FALSE	unmapped	TATGGGTGCCTACCATTTGCAGTGGGAAATGATTAAGTTTGCTAAAGCGCATCATATTGA
3787	73	136	MW2_CDS_12233	MW2316	FALSE	unmapped	TTTTTTGGACACGTAGTTGGATTGTTAATACCGAAATCATGGATGGATGCAGTGGGTGTG
3788	73	134	MW2_CDS_07624	MW1439	FALSE	unmapped	AGATAGAAGCTACCCAATGTCAAAAATAAATGACGTAAACATTACGGGCAAAGTCGTCAG
3789	73	132	MW2_CDS_10077	MW1895	FALSE	unmapped	ACCACTTAGGGGAAGAAGGATATCCAGAGTGGATAATACCTACTGATCCAAGTAGAGCGA
3790	73	130	MW2_CDS_06177	MW1147	FALSE	unmapped	AAAATTAAGTACATGTTCCCTAAAGCCCATGCAGCAGCATACGTTTTAATGGCAGTACGT
3791	73	128	MW2_CDS_11744	MW2226	FALSE	unmapped	TCACAGAAAAAGTGCCAATGTCGGAATCTGAAGTTAACCAATTGCTAAAAGGTAAGGGGA
3792	73	126	MW2_CDS_05488	MW1016	FALSE	unmapped	TGATTGTCGGTGGTCCAATGCTAATTTACTTAATTTGTCAAAGTCAACGAAATCGAATCT
3793	73	124	MW2_CDS_05542	MW1027	FALSE	unmapped	AGTAATGGCAACGACGCACTATCCTGAACTTAAAGCATATAGTTATAATCGAGAAGGCGT
3794	73	122	MW2_CDS_03456	MW0634	FALSE	unmapped	AGCATGTTGCAATTGCCACAAGTTGATTCTTTTGTAAATCTCATGGCGAGCTTTGTTGAA
3795	73	120	MW2_CDS_09027	MW1693	FALSE	unmapped	CTGAAGGATCTTCAAGTAATGCTTATGCAATTAAAGACGGTGTGATTTATACACATCCGA
3796	73	118	MW2_CDS_02234	MW0413	FALSE	unmapped	CAAATGCATCTAGGCACATTATTCTATTTGGGATTCTTAGTGCTGTTCTTATTTGCGGCT
3797	73	116	NC_A_077		FALSE	unmapped	GTAATTCACGAACGTAACCAAAGTCGTTAGCTAAATCTCGGCTACCCTACGGCACATATG
3798	73	114	MW2_CDS_08480	MW1595	FALSE	unmapped	ATTTTATATCGCCAACGTGGTACTAAAATTTACCCTGGTGAAAATGTAGGTCGTGGTGGC
3799	73	112	MW2_CDS_07257	MW1356	FALSE	unmapped	GTGGGTCAAATCACTTAGGTGGTTTAGAAGGCGGTATGTCAAATGGAATGCCAATTATCG
3800	73	110	MW2_CDS_12660	MW2394	FALSE	unmapped	TTCATTCAAAACATGATGCTAGTGAATATGCATCTATCGCCAATCAGTTGATGGCCGCAA
3801	73	108	MW2_CDS_13601	MW2571	FALSE	unmapped	TGCAGCATCGACGAGTCTTGTATTTAGATGTTTAACAATCACAGAGATGACGCATCAAGA
3802	73	106	MW2_CDS_03567	MW0654	FALSE	unmapped	CATGATGCTGCCATTTGGACTAGGTGTATTTATACAACAAGTGTCGTATTACGAACGACA
3803	73	104	MW2_CDS_02382	MW0440	FALSE	unmapped	TGCTGAAGAGGATGTTGTGTTACCTCTTAAAAATATTATTCGCGTTGCTGATGACAAAGA
3804	73	102	MW2_CDS_02476	MW0458	FALSE	unmapped	AGCTGTAAATGAAAAACGTGGTATTAAGGAACCAGAATCTGAGGTGCCAGAAGTCGAAGT
3805	73	100	MW2_CDS_09061	MW1699	FALSE	unmapped	CGCCAAAGGAGATGGTCTAAATGCCATTAATCCAATTGCTCCTGTAACTGTTGTTAAGCA
3806	73	98	MW2_CDS_04269	MW0784	FALSE	unmapped	TGCAAGCAATCAAAAGTAATGAATCATTTAAATCTGTGATTAATAGCGATACACCTGTAA
3807	73	96	MW2_CDS_13336	MW2523	FALSE	unmapped	TCGTGAACATGGTATTTTAATCGCTGTCGATGATATTCAACAAGGTTTTGGGCGAACAGG
3808	73	94	MW2_CDS_05614	MW1041	FALSE	unmapped	ACAAATCGAATGTATATGCATTAGCTGCAGGAAGCTTAAATCCATATTATAAACGTACGA
3809	73	92	MW2_CDS_03269	MW0601	FALSE	unmapped	TCAAGTCGATGTGTCTGACAAGACAATGGTTCAGCAGTACCGTAAAGTTTATCAAGCGAC
3810	73	90	MW2_CDS_01488	MW0273	FALSE	unmapped	AAATTCGAGGTTATACCAGAAATGGAATATGAAATGGAAGAAATTAAAGAAATCGAACAA
3811	73	88	MW2_CDS_07397	MW1382	FALSE	unmapped	TCAAGATGTGGATTCTAGGATTAATAGGGACGATTCTAAGTACATTTGTTATAGCCTTGT
3812	73	86	MW2_CDS_07143	MW1335	FALSE	unmapped	TCTTCAAATAATGTAGATATTTTAAAACGTATTTCAAACTTAGAAAAAGCTGTATTTGGT
3813	73	84	MW2_CDS_07953	MW1498	FALSE	unmapped	TGCAGATATTCAGAAAAAACTTCAAGAATATAAAGCAATGGGTAAAATTGATTTTCAATT
3814	73	82	MW2_CDS_04958	MW0916	FALSE	unmapped	TCAAACAGTTTAAAAAGAAAAGTTCATACGCTAAGTGGAGGTGAACAACAACGTGTCGCT
3815	73	80	MW2_CDS_11489	MW2178	FALSE	unmapped	AAACATCTTGAATTTAATGTCATTATTTATCTTTGTCATATATTTCATCTTAACCATCGT
3816	73	78	MW2_CDS_12744	MW2411	FALSE	unmapped	TCGCCTTTGAAGAGAGTTACGGTTTTCTATCAGAGCCTTTTGTACGTGATAAAGATGCCG
3817	73	76	MW2_CDS_11439	MW2168	FALSE	unmapped	GCTGACAGCTTAGTAATTACTGAAGCTGCTGCTAAAAAAGTTGAGGAGGTGCTCGGATAA
3818	73	74	MW2_CDS_01102	MW0202	FALSE	unmapped	ACAGTCAGTGGTGGCGAACCATTGTTACAAATGCCATTCTTAGAAAAATTATTTGCGGAA
3819	73	72	MW2_CDS_01966	MW0362	FALSE	unmapped	CGCAAAAGACCTATCCAACCATGATGAGTTAATGACGCAAACATTACATCAAATTGAACA
3820	73	70	MW2_CDS_06270	MW1164	FALSE	unmapped	TGATGGTGCAGTTACTGCCAGAGAATCTAATCCAAAACATCAAGAGCTTGTTAACGAAGT
3821	73	68	agr_tiling 130_R		FALSE	unmapped	ATAAAAATATTGTACCTATGAAAGATAATTTACAAATGAATGCTCTTAAGTTAAATGGTA
3822	73	66	MW2_CDS_09150	MW1715	FALSE	unmapped	AGACCAACGTTATTGAAACATACGGATGATTTCTTAAAAGCTGCTAAAGATAAGCACGTT
3823	73	64	MW2_CDS_06133	MW1139	FALSE	unmapped	AGACGAGGCATACAACTTCTTGAAACAAGTTTCAGAAGATGGTGGACAAGTCTTATTCGT
3824	73	62	MW2_CDS_06403	MW1189	FALSE	unmapped	AAGGTGCAGATTTATTAGTACATGTCGTAGATAGTAGCCATCCTGAATACCGTACGCAGT
3825	73	60	perR_tiling_102_R		FALSE	unmapped	GTCACAAGCTTCTGTGGTACAAGTAGGTGTATTATCTCTAGGATAAAAATATATAATCGC
3826	73	58	MW2_CDS_01945	MW0358	FALSE	unmapped	AGTTGCCGAAAATATTGCGGTAACTGCTGAAGATATGGGGTATGGCATTGTCTTTTTAGG
3827	73	56	MW2_CDS_00195	MW0037	FALSE	unmapped	ATGCCAATAACCAACTCATCAGTGTCGGATACTTAGACCATTTTGACATGGACTTTCTGT
3828	73	54	MW2_CDS_02752	MW0508	FALSE	unmapped	AGGTGGCGGTACTACAGACTATGCTGTTGAAATATACTTCAAAGCAGTAAGAGAGGGTCA
3829	73	52	MW2_CDS_06989	MW1305	FALSE	unmapped	GCCATTTGATATTGAAGAACTTTTAGCAAGAATACGTGCGATTTTACGTCGTCAGCCACA
3830	73	50	MW2_CDS_09424	MW1771	FALSE	unmapped	TAATTTTGAATCCCCTGAAGCGAAGACAGTGGATCAGTGGATTGAAGCTATGACGAAACA
3831	73	48	MW2_CDS_07329	MW1369	FALSE	unmapped	GCAACAACAACGTCAAGGTGGTGGCCAAAGACATACAGTGAATGGTCAAGAAAACTTATA
3832	73	46	MW2_CDS_04491	MW0830	FALSE	unmapped	GTGTTAGGTTTCATCTTTGGCCTAGTTCTTGTTTACCTCTTACACAGAGTGTTACCAGGT
3833	73	44	ETG07_105829		pos		
3834	73	42	MW2_CDS_11929	MW2260	FALSE	unmapped	TGGTATGATTGCATTTTATATCGCGATATTCACGATAAATAATCCTGATGGGCGACTTGC
3835	73	40	MW2_CDS_10117	MW1904	FALSE	unmapped	CAGCAATTGTGATTGAATATGATGATAGTGAACGCGGTGAAGGCGATCTTGGCTTAGAAG
3836	73	38	MW2_CDS_07001	MW1307	FALSE	unmapped	TCATGAATCTGACTTAACACCAGGATTAGCGAATAAGATAGCACTTAAATTTGCCAAGAA
3837	73	36	MW2_CDS_12645	MW2392	FALSE	unmapped	AGCCATTTTCGAAGGGACGGATGTACCGGTTTATGTGTATAAGTTATTTCCTGAAGGACC
3838	73	34	MW2_CDS_06734	MW1258	FALSE	unmapped	AAGGCATCAAACAATTACCCAAATAAAAAAGTTAGCGTCTGCTGTTCCAAATCATATCGA
3839	73	32	MW2_CDS_07821	MW1474	FALSE	unmapped	TAAAAATAAAAGTTCTACAACGGCTGTCAATAGCAAGTGGTCATGTTGGAATGGTCGGCG
3840	73	30	MW2_CDS_00087	MW0016	FALSE	unmapped	GACATGATTGTGATTGACTACTTACAGTTGATTCAAGGTAGTGGTTCACGTGCGTCCGAT
3841	73	28	MW2_CDS_12518	MW2369	FALSE	unmapped	ATGTCTGTCTATGGTGTGCTGTTTGCAGCTTTAATTGGTATTCCATTGGGAATCTTGCTT
3842	73	26	MW2_CDS_09142	MW1714	FALSE	unmapped	TCCAATTACGGTCTATTTAGCACTATTTTGGGAATGGGCTTCATTTCAGCGTTTTTATCA
3843	73	24	MW2_CDS_09964	MW1869	FALSE	unmapped	TCTTTTGGTGTATTAATTGGTTTATATCAATATCGTCATACGAAAACTGTGGATTTGTCT
3844	73	22	MW2_CDS_06511	MW1215	FALSE	unmapped	CACTTGATGAAGCGAAAAGACTTGGTTTTGCTGAAGCGGATCCAACTGATGATGTAGAAG
3845	73	20	MW2_CDS_09477	MW1781	FALSE	unmapped	TTCCCGCAATATGGACATTATTTTATGTTCTTATTGGCATTGAATTTCGGTATTTCCATT
3846	73	18	perR_tiling_104_R		FALSE	unmapped	GGATAAAAATATATAATCGCCTTTTTACCTTTTAATGTATCATTTGTAATGACAGTTCCG
3847	73	16	MW2_CDS_12052	MW2282	FALSE	unmapped	ATGCCACACTTACAATTGAAACAGTAAGAGGACAAGGCTATAAGGTGGAGAATCATGTTT
3848	73	14	MW2_CDS_00693	MW0129	FALSE	unmapped	GGTGACACAGATATGGTAACTATTATGTGGGTGAATGAAATGTTTGATCCAAATCAGCCA
3849	73	12	MW2_CDS_04297	MW0791	FALSE	unmapped	AGTTGCAGGTGTAATTGGTGCCGGTGGTTTAGGAAATTTAGCATACTTAACAGGTTTCAC
3850	73	10	MW2_CDS_07223	MW1350	FALSE	unmapped	CGAAGTTGGTCATGCCATTCAAGATCACCAAGGATATTGGTTCTTAAGATTCAGAGCAGC
3851	73	8	MW2_CDS_01680	MW0306	FALSE	unmapped	GATGGCATTACTTTACTTCATCGCATGCTTATTTGCGGGCGTTAGTTATGTACACGAGTC
3852	73	6	MW2_CDS_07112	MW1328	FALSE	unmapped	TGGTGTAAACATTTACCAAGGACAAGTGACAAATCAAGGATTAGCTTCATCACATGACCT
3853	73	4	MW2_CDS_03532	MW0647	FALSE	unmapped	AAGCTCAAAAAAAGCACGTACTTTAAAGAAACATGCAGCTAATGAACAGGCCCGATTTTT
3854	73	2	MW2_CDS_01710	MW0312	FALSE	unmapped	TCCTAAGTGGTGTAATCAATTGAATAAAACAGCAGGGCAAACACAAAAGTGGCAATGTAA
3855	73	163	MW2_CDS_08705	MW1637	FALSE	unmapped	ACGGTATGGAATTATGAATTTGCAGGAGACTCAAGAATTGTCGATGTACATATCAGTCAT
3856	73	161	MW2_CDS_13545	MW2562	FALSE	unmapped	GAGCACACATCGCATTTAAAAAATGCAATCCTAGAACGTGAAATGGAGTCTACGACAGCT
3857	73	159	MW2_CDS_11272	MW2130	FALSE	unmapped	AGTGAATCTAAAGAAAAATGACGACGCTAAAAATTCAATTGATCCAAGTACAATCAAACA
3858	73	157	MW2_CDS_11067	MW2092	FALSE	unmapped	TAAATTTAGCCGTTGCCTTAGCTCGTGAAGGGAAAAAAGTCGGATTAGTAGATGCCGATA
3859	73	155	MW2_CDS_02374	MW0439	FALSE	unmapped	TGCGCAAAAGTTGTCGTTTAATCAATTAATTTTGATGTTTGATCAACTGACGGAAGCACA
3860	73	153	MW2_CDS_03324	MW0611	FALSE	unmapped	GCTTAGTATTAGTGGTGCAATAGTGCAAAGTGTCACGAAAAATCCAATAGCTGAACCCGG
3861	73	151	agr_tiling 091_F		FALSE	unmapped	CAGATATAAAGAACATTAATGAAACTTGAACAATTACAAATAAAACGTAATTATAATCAT
3862	73	149	MW2_CDS_08242	MW1550	FALSE	unmapped	ACCGGACGTCATTATTAATACAGGTTCTGCTGGAGCTTTAGATGAAAGTTTAAATGTAGG
3863	73	147	MW2_CDS_04517	MW0834	FALSE	unmapped	GCTGCATTTACGGCTGCAATATTCCATTTAATCAACCATGCAACATTTAAAGGTGCCCTA
3864	73	145	MW2_CDS_03952	MW0722	FALSE	unmapped	ACAATTTATTACCAGATAAGGATCGCGCAGGTCGTATGCGTAAACTATGCAGACCAGAAA
3865	73	143	MW2_CDS_09427	MW1771	FALSE	unmapped	TGTACATTCTATGCATGGAAATAGTAGAAATCATTGGTATCAGTGGTTGGAGCATAACTT
3866	73	141	MW2_CDS_08357	MW1571	FALSE	unmapped	AAGGTGATGTGTGTCTTGGTGGAGCAACAATTGACGATGTGTTCAAAAATGAAGGTCAAT
3867	73	139	MW2_CDS_11122	MW2102	FALSE	unmapped	GCTACGAAAGGTATGACACCCATTAAATTAGCATTGGCTGGTATGGCCATCCATTTGTTT
3868	73	137	MW2_CDS_04843	MW0893	FALSE	unmapped	AGCAGCAGGAGATTTAGGTGGCTTTACATTAGTTCTGATTGCAGTGCCATTATATGCTGT
3869	73	135	psma_tiling_028_F		FALSE	unmapped	TTAGTTTGTTGCAAATAAATGGTCTTGGTTTTTTGTATAGGATGTTCTTGGTGGGACGTA
3870	73	133	MW2_CDS_03294	MW0605	FALSE	unmapped	CATGCAATTTGATGAAGGATATGACACGCTTGTAGGTGAACGAGGATTGAAACTGTCTGG
3871	73	131	MW2_CDS_11879	MW2252	FALSE	unmapped	TTCAGCACCAATTGTTATTGGACGAGACCATTTAGATGCTGGTTCAGTTGCTAGTCCTAA
3872	73	129	MW2_CDS_01845	MW0336	FALSE	unmapped	TGGAACTGGCGGTCATCGAAAATTTACAACGAGAAGACTTAAATGCGATTGAAGAAGCTG
3873	73	127	MW2_CDS_01942	MW0357	FALSE	unmapped	TCTCAGTATCAACTGATACTCACTTCGTACACAAAGCATGGCATGACCATTCAGATGCAA
3874	73	125	MW2_CDS_04314	MW0794	FALSE	unmapped	AGCCAACACCATATTCCAACTATGTTTTTCTTTGGTGGATTAATCATTGGTATCGTTCCA
3875	73	123	MW2_CDS_10514	MW1985	FALSE	unmapped	TAAACTTCCCTCAACGCCCTGGTGCATTAAGAGAATTTGTAAATGATGTTTTAGGCCCAC
3876	73	121	MW2_CDS_02706	MW0500	FALSE	unmapped	ACGTGTAAAAGACTTACCAGGTGTGCGTTACCATATTGTACGTGGAGCACTTGATACTTC
3877	73	119	MW2_CDS_07142	MW1334	FALSE	unmapped	TGCTCACACAGTCTGAGATGATTGTAGTGTTCGTGCTTGATGAAACAATAAATCAAGGCA
3878	73	117	MW2_CDS_12586	MW2380	FALSE	unmapped	GAGCAATTACACGGTTAAGATTAAAAATTCAGCGAAATCAGATTTAAAGAAAATAAAACA
3879	73	115	agr_tiling 005_F		FALSE	unmapped	TCATAAATCTATGTTTAGTCATGACATGTGTTAATTATTATTTCGGGCGCTTCTTATTTA
3880	73	113	MW2_CDS_04069	MW0742	FALSE	unmapped	ACTGATGATTATTACCGTTTTGAAGAGCGTCAAATGGCATTAATTGGTGAGCGTCAAGCT
3881	73	111	MW2_CDS_04825	MW0890	FALSE	unmapped	AGAGGCTAGTGAAGACTACTCTCGTTTAGCCGGGGTATCAGATATCGATTCGACTAATGA
3882	73	109	NC_S_033		FALSE	unmapped	TTTGGAGCGTAAAGTTTTGAACATAATAATATTCGATTGCGCAAATGATTGTAACTTCCA
3883	73	107	MW2_CDS_08533	MW1607	FALSE	unmapped	TCTTTTTCTGGGTAGCACGCATGATATTCCAAGGCTTAGAATTTACAGATCGTCGTCCAT
3884	73	105	MW2_CDS_08949	MW1680	FALSE	unmapped	GATCCATCTGTTGCACTTAGTGATGCGGGTCAACAAATGGATTTAGATGAATTCCAAGCA
3885	73	103	MW2_CDS_08503	MW1601	FALSE	unmapped	GGCTGTGTCTGGAATGAATCGCATGGCTTATAATGATCAATATATTATAGGTCAAAGAGG
3886	73	101	MW2_CDS_03251	MW0598	FALSE	unmapped	AAGCGGCACAATATGCATTGCAACAAAGATATCCAAACATATCGTTTGCACATCATCACG
3887	73	99	MW2_CDS_08669	MW1631	FALSE	unmapped	ACAAAACCTTGAGAGATTGTTAGAAGAAGAAGGTTATATTGAAAAGCCGAATTACGGAGA
3888	73	97	MW2_CDS_00830	MW0154	FALSE	unmapped	GTTTATGGTACAGGTATGTTTCTTAGGACAGGCACCCTGGGGGTATAAAAAAGTGTCTGT
3889	73	95	MW2_CDS_08337	MW1568	FALSE	unmapped	GCGTTGAAATCAGTACTGGGTGATCATGTTAACCAAGCTGGTTCACTAGTAGAAGCAGAT
3890	73	93	MW2_CDS_02457	MW0454	FALSE	unmapped	CAATTGAGACCAGGCGCGCAATTAGGTGCAGATGTTAAGGTTGGAAATTTTGTAGAAATT
3891	73	91	MW2_CDS_13223	MW2502	FALSE	unmapped	TTAACACCTGTAGCATTTTCAAAAAAAGTGCCAGAATATTTGGTGCTTATCGGAAAGGGT
3892	73	89	ETG08_142674		pos		
3893	73	87	MW2_CDS_11170	MW2110	FALSE	unmapped	AGTATTTAGTATCTTCAAACCTACGCATCGAAAACCTGGATTATACAAAGACTTCGATGA
3894	73	85	MW2_CDS_03724	MW0682	FALSE	unmapped	ATCTGGTGGAGAGCAAAAGCGTTTGTATTTATTACGTCTACTCGTACACCAGCCAAATGT
3895	73	83	MW2_CDS_03338	MW0613	FALSE	unmapped	GCGCGAGCAGCAGAGAAGCTTGAAAATGGTGAAACTTTAACATTCAATGATTTACAGCAA
3896	73	81	MW2_CDS_07075	MW1321	FALSE	unmapped	GTGATTAAAACTGTAGAAATCTTTGGTATTTCAGCAACTTTAGGTAATGTCATGTTTGCT
3897	73	79	RC11		pos		
3898	73	77	perR_tiling_038_F		FALSE	unmapped	GATCTAATTGAGAATGAAGTTGATGCTAAAAAAGGCTATTAAATGAAATCATCATGTAAA
3899	73	75	MW2_CDS_07008	MW1308	FALSE	unmapped	AGAAGCAAAAGAATTAATGAAAGAACACGACAACGAGCAATGGGACGATCAGTACCCTCT
3900	73	73	MW2_CDS_12112	MW2293	FALSE	unmapped	TCTGTCGAAAGTGCATACGTTAGTCTGATCGCAGACTACCCGGCGGATAAATTATATACA
3901	73	71	NA		ignore		
3902	73	69	MW2_CDS_07301	MW1364	FALSE	unmapped	GGTCATAGATGCAGAACAAGGCATCATTGAACAAGATAAACGTGTTGCAGGATATGCACA
3903	73	67	MW2_CDS_01197	MW0220	FALSE	unmapped	CGATTGTCACACAAAATAAGACATTAGATTTAGCTGACTTGATACCGGCAAGGCACGTGA
3904	73	65	MW2_CDS_02265	MW0418	FALSE	unmapped	GTAACAATTGGTGTCGCATCAAATGACACTAAGGCTTGGGAGAAGGTTAAAGAATTAGCT
3905	73	63	MW2_CDS_11252	MW2125	FALSE	unmapped	TCCAATCAAGACTTTAAAGGGTTAGTTCCAAATATCAATCAGAATGATAATTATTCTGAA
3906	73	61	MW2_CDS_11382	MW2154	FALSE	unmapped	TGACATCCCTAGTGACGTAACAGTAACTTTTGATGGAAATCATGTAACTGTTAAAGGTCC
3907	73	59	MW2_CDS_02690	MW0497	FALSE	unmapped	GGTGTACCATCTCGTATGAACATCGGACAAGTATTAGAGCTACACTTAGGTATGGCTGCT
3908	73	57	MW2_CDS_07492	MW1401	FALSE	unmapped	TATCAGAAACAGAGGACTTTACAGCCGCATGTGCCACTTTTGCATTAGATAATGGCAAAG
3909	73	55	MW2_CDS_12801	MW2423	FALSE	unmapped	GCGGTGGCGGTACATTTAAACAAGTATTAATTGACGGTGGTGTCGGAAATACAATTGCTA
3910	73	53	MW2_CDS_01969	MW0362	FALSE	unmapped	GACAAACTGAAATTGATTACATTCATCCAACTAATGATGGTCACACTAAAAAAGTGGACT
3911	73	51	MW2_CDS_10038	MW1886	FALSE	unmapped	GTCAAAAGGTGCTTATTTTAATGCGAAAATCGACGGCTTAGGTGCTACTTCAGCCACTAG
3912	73	49	MW2_CDS_11368	MW2151	FALSE	unmapped	ACCCTCACTCGTAGTGTTATTGGTCGTCCTGAAACACAACGTAAAACTGTTGAAGCTTTA
3913	73	47	MW2_CDS_06645	MW1242	FALSE	unmapped	GAAGGTGTTTCTGAAAATGATACTATATTGATGGCCACACAACGCGGCTCGTTAAAACGT
3914	73	45	MW2_CDS_06903	MW1288	FALSE	unmapped	ACGTGGAGACTATCTTGCTATATTATCAACTGGTGCATATCATTACTCTATGGCATCCAA
3915	73	43	MW2_CDS_12155	MW2300	FALSE	unmapped	TGCTTTGTTAATTGAACCGAGTATAGGAAGTGTATGTAATGCTTTTGATCATATGTGGGG
3916	73	41	MW2_CDS_11030	MW2086	FALSE	unmapped	TGATACGGCAACAGCAGATACTAATGATATGCAAACATCAGTTGGCTCAGTTGCAAACAA
3917	73	39	perR_tiling_017_F		FALSE	unmapped	CATAATCATTATCATATTATATGTGAACAATGTGGTAAGATTGTTGATTTTCAATATCCA
3918	73	37	MW2_CDS_12554	MW2375	FALSE	unmapped	TCTAGCGCACACTATCGCAGTGCTTACCATATTCTAGATATGGTGTTTTGGTTCGGAAAC
3919	73	35	MW2_CDS_05076	MW0939	FALSE	unmapped	GGCTTTAGCAGTTGCTAGAACTAGACATCATGATTCAGACTTAAAACGTGGACAACGTCA
3920	73	33	agr_tiling 140_F		FALSE	unmapped	GATAGGATCATCAATTTCACTTGATGCCTCTATTGCGTTATCAAGAATAATACCAATACT
3921	73	31	MW2_CDS_05084	MW0940	FALSE	unmapped	TCAGTCCTAAAATAACCAATCCATTATTACATGAGTTTGGTACGAAACAGTATCCAGATG
3922	73	29	MW2_CDS_12203	MW2310	FALSE	unmapped	AGATCAGATTCCGTCTATAAGAATATACTCAAGGCACCAATAAACGACCGTGATTCAATT
3923	73	27	MW2_CDS_08691	MW1635	FALSE	unmapped	ACTTTTATGGGTATCTTACTACCACTCATGCACGATGATTTACAATGGTTTAGCAATTAT
3924	73	25	MW2_CDS_01523	MW0279	FALSE	unmapped	TAGATTGGATTAAATTAGGTTTTGGTCCATCAGGAAAGGAAAACTACTATATGTATAAAA
3925	73	23	MW2_CDS_04845	MW0893	FALSE	unmapped	TGGGTTTGTATCATTACATTAATTGCACACCAACTTGAAGGTAATATCATTACGCCAAAT
3926	73	21	MW2_CDS_13198	MW2498	FALSE	unmapped	AGTGTATTTGCCTTCCAAATAGAGCATCGCCATATTTCAATTGAAGCGTACAGAAATTAT
3927	73	19	MW2_CDS_03527	MW0647	FALSE	unmapped	TGACTTAGATGGTCATACATTATCTGGCGGAGAAATTCAGCGTTTAGCGATTGCAAGGAT
3928	73	17	MW2_CDS_11527	MW2185	FALSE	unmapped	AGCTGAAAAGATTAGCGGTAAAGAATTGAGAGATACATTACATTTTGAAATGCTATGGGA
3929	73	15	MW2_CDS_13034	MW2467	FALSE	unmapped	AAAGATGCTTATATCCGCTCATTCCAACAAAGCTGGAATGAATACGCAAAACGTCAAGGT
3930	73	13	MW2_CDS_10716	MW2024	FALSE	unmapped	CAAAACTCTACCACATCCTGGATTCCCGACTGATATGCAATCACAAATGATGGCATTGTT
3931	73	11	MW2_CDS_04749	MW0876	FALSE	unmapped	TTAGGTGCTGATATTGTAAGTATTTTAGGTGGAGCTGTGATTACTGAGACTATCTTTTCA
3932	73	9	MW2_CDS_01566	MW0287	FALSE	unmapped	GCGTGCGGTGGTATGGATTTATTACCAGGTTTCTTTGCGGGTTATATGATTGGATATGTG
3933	73	7	NA		ignore		
3934	73	5	MW2_CDS_11768	MW2231	FALSE	unmapped	AGATACGGTGCAAGATTTATTTGACGCCTCATTTAGTTATCGTTTAGTTGGTGCTTGCGG
3935	73	3	MW2_CDS_07567	MW1424	FALSE	unmapped	TCAGATTGATAAAGAAAAAGAGAATTTGGCGGACTATTTATTTAATAATCCAGGTGAACT
3936	73	1	MW2_CDS_07688	MW1450	FALSE	unmapped	TCATACTAAGCAACATTATTTCCTATGTCATGACATTTTAGAAGATGCATGGAAAGCTGA
3937	72	164	MW2_CDS_10920	MW2061	FALSE	unmapped	ACATGGTCATCAACATCGGCGCATTAAAAGATGGACGTTTTGATGATGTACAACAAGACA
3938	72	162	MW2_CDS_05697	MW1060	FALSE	unmapped	TATGGCGTTCTATTTATAGATGCGCAGTTTGAGCCGTTAAGAAAAATGGAAGCGCCTATG
3939	72	160	MW2_CDS_00537	MW0100	FALSE	unmapped	CGTTGCAGGTGTGCTATGGGGTATTCAAGCCGCACATGAACAATTTAAAAAATTCAATCA
3940	72	158	NA		ignore		
3941	72	156	MW2_CDS_05230	MW0968	FALSE	unmapped	AAAGACTCAGCAAGTTAAAGGTGCGATTGAATTACCTGGACTATTGAGTTTCTTAGCAGA
3942	72	154	NC_S_005		FALSE	unmapped	TCTCTATGTCTCGGGGCAGATCATAATTCCCTGTTATGAAGTATCCTTATTTGCCCGACT
3943	72	152	MW2_CDS_08984	MW1685	FALSE	unmapped	AATTAACTGATGAACTTGTAAATGTATTCCAAAAGCGTATTTCAGAAGCTGGTTTTGATT
3944	72	150	MW2_CDS_05223	MW0966	FALSE	unmapped	CCTTGCGCAACAAGATATTTTCAGACCACAGCTACGTGCATTATTACGTGCATCAGTTTA
3945	72	148	MW2_CDS_12435	MW2354	FALSE	unmapped	CCAATGTGCAAAAAACGCAACAAGACAGCCGCTTAAAGCTGAAGTCATGATGTCAATTAA
3946	72	146	perR_tiling_047_F		FALSE	unmapped	AAAGTTATTCGACATGCATATTTAGATGTGTTTGAAAATGAACCTTTGAAACCTAATCAT
3947	72	144	MW2_CDS_06230	MW1157	FALSE	unmapped	CCTAGAACGCATGGTTCAGGTCTATTTACACGTGGTCAGACTCAAGCACTTTCAGTTTTA
3948	72	142	MW2_CDS_08228	MW1548	FALSE	unmapped	AATATGGTTTGGAAGCTGACGATGTCGTATTAATTTCAGCTGAAAAAGGCTGGGGCATAG
3949	72	140	MW2_CDS_06933	MW1295	FALSE	unmapped	ATCAAAAAAGCTGATTTCTATCAAATAAATAATAGAAATCAGCTTTTTTACATTGCCTAA
3950	72	138	MW2_CDS_13182	MW2495	FALSE	unmapped	ACAAGCATTTTCAAAATGTAAGTCAGCAAAGCCTTAATACTGAACCAAATGAAGTGATGA
3951	72	136	MW2_CDS_05410	MW1002	FALSE	unmapped	CATTCTTTCAAACATCACATAGTGGTTGTGCGACGGGCGGATCCTGTAATTGTTCATTAT
3952	72	134	MW2_CDS_06569	MW1226	FALSE	unmapped	GGCGACAGTATGATTGAGGCTGGTATATTAGACGGAGACAAAGTAATTGTTCGCAGTCAA
3953	72	132	MW2_CDS_06650	MW1242	FALSE	unmapped	TCTGCAGGTTACGCGACAGATATACCACCACATAATTTAGCTGAAGTGATTCAAGCAACA
3954	72	130	MW2_CDS_07127	MW1331	FALSE	unmapped	AGCCATTGGCATGGGGTTTGTCTCTTGGATAAAGCGTACAAAAAATACTGCAGTAAAAGT
3955	72	128	MW2_CDS_12103	MW2291	FALSE	unmapped	CGGTGCTTCAGGTGGTGTCGGTACTTTAGCAGTACTCATGCTTAATGAACTTGGTTATAA
3956	72	126	MW2_CDS_04078	MW0743	FALSE	unmapped	ATGGCTAAGAAGAAATCACCAGGTACATTAGCGGAAAATCGTAAAGCAAGACATGATTAT
3957	72	124	MW2_CDS_01166	MW0214	FALSE	unmapped	ACGTGATCAGGATGCACAAAAAGATGCTTTTGAAAAATTAAAGGATATTGTAAATCAGCA
3958	72	122	MW2_CDS_06024	MW1120	FALSE	unmapped	TGATGAAACAATTCACTGGTGGCGGTAAAGGTAAAAAAGGTAAACGCAATCAAATGCAAA
3959	72	120	MW2_CDS_11300	MW2137	FALSE	unmapped	AGTTTACTACCGTCACTCAAATCACCCAGGTGGTATCAAATCAATCACTGCTGGTGAATT
3960	72	118	MW2_CDS_01317	MW0241	FALSE	unmapped	TGAAGCAGGGCAAACGTTGTTACAATTCGACCAGCAATATATACAACAACAAGGCTACAA
3961	72	116	MW2_CDS_00242	MW0046	FALSE	unmapped	GAAATACTAAAAAACCTTTAACGATTAAAGAATTAACCAAAATAGTTAATTATAATAGCA
3962	72	114	MW2_CDS_13672	MW2583	FALSE	unmapped	CCACCAGTGAACACAGTTACAGATGCGCAATTATTTTCAAAGTTTACCGGCAATGTTGTC
3963	72	112	MW2_CDS_10755	MW2031	FALSE	unmapped	AGAAATTTCTGAACAAGACCAAAAAGCATTGGTTGACAAGTATCTAAAAGAGGCAGGCGA
3964	72	110	MW2_CDS_08439	MW1587	FALSE	unmapped	TCAACCAATCAATTCTGATAGCGTAGAAATCTCGGGTGGATTTAAAGGACAAGAAGGCGT
3965	72	108	MW2_CDS_13633	MW2576	FALSE	unmapped	TCATCGAAAGCATTGCCACCAGAAGAGGATGAATTTAATTTTGCAGGTGTAACAAAGGAA
3966	72	106	MW2_CDS_05350	MW0990	FALSE	unmapped	CTAAAGTAGGGGAAGGTGCATATCGTGGTAGCCAACCCTTGAAACCATTGAATGATTCTA
3967	72	104	MW2_CDS_06509	MW1214	FALSE	unmapped	TCACCGAAGGAAGCGGGTATTTTTGTTACTGACGTCCCACAAGAAGCACAAATATTAGAT
3968	72	102	MW2_CDS_08766	MW1648	FALSE	unmapped	TGCAACTTTTAGGAAGACAGCCTCAGATGGGTGAAACAATTAACGATCAAATCGCCAAAT
3969	72	100	MW2_CDS_10736	MW2028	FALSE	unmapped	ACACCATATATGGATAAAATGCAAGATGCAATTACTGCAGTTGCAGGGGCAAGTAGCAAT
3970	72	98	MW2_CDS_10228	MW1930	FALSE	unmapped	AGCATGCTAGTTACTGTTTAGAAAGAAGTAACAACCCTGAATTGTTGCGAGCAGTTGCAG
3971	72	96	MW2_CDS_11016	MW2083	FALSE	unmapped	AGCAAGCGAACTTGCTGATAAACTTGGTCAAATATATGACGTCACGTTTAATCAGGCAGA
3972	72	94	ETG09_35454		pos		
3973	72	92	MW2_CDS_11515	MW2183	FALSE	unmapped	TGTACAAAAGCTCCAACAAGCAGTAGTTGCCAAAACAAACATTTCGCAAGATCAAATGCA
3974	72	90	MW2_CDS_09148	MW1715	FALSE	unmapped	GCATTATTAGAAACTGGCGCAGTTAAAAGTGAATTAGCTAATGGAGTCGAAATTGATGGC
3975	72	88	MW2_CDS_12791	MW2420	FALSE	unmapped	AAACTTCGCGAGTTGATTTGCCATCGGAAAAAGTTGCTGATAAGGAAACTACAGGAACTC
3976	72	86	agr_tiling 059_F		FALSE	unmapped	AATGTTTAAAATATAGGCAATAGTATACATAACAATTAATTTACCTATATTTTTAGCTAA
3977	72	84	MW2_CDS_08999	MW1688	FALSE	unmapped	TTAGATGTAGACTTGTATGTTGGCGCAAATGTTCAAGAAGAGGTTGGATTACGAGGTGCG
3978	72	82	MW2_CDS_05274	MW0977	FALSE	unmapped	GAATTAAGTGAACGTGCAATCCTTTCATTAGAAGCACCTATTGGAAGAGTTGCAGCAGCA
3979	72	80	MW2_CDS_08175	MW1538	FALSE	unmapped	AGTAAGACATTATCAACTTGATGAATTATTGAATATTATAGATGCTTGTGCGGAAACTGA
3980	72	78	MW2_CDS_07095	MW1326	FALSE	unmapped	TGTATGTCATTTGTTGCGGTAATAATTTTAAGGAAACGCGAACCAAATATGGAGCGACCA
3981	72	76	MW2_CDS_06043	MW1124	FALSE	unmapped	GCGTTGTAATTAAACGTCGTGGCGGTGGCGTTTCTGAAACGTTTACAGTTCGTAAAATTT
3982	72	74	MW2_CDS_04738	MW0874	FALSE	unmapped	TGATGGTAAACGAATCGATACGCTCAATGAGAAGCAATTGCTAGATATTCGAGGAAATGA
3983	72	72	MW2_CDS_00229	MW0043	FALSE	unmapped	CCGGGTAATATGAGAATAAATAAAGAAGATTTTATTCATGGAGGGCATTCAAAGGACAGA
3984	72	70	MW2_CDS_10336	MW1951	FALSE	unmapped	TGAAAACAACACGATTAGTATTACTAAAACATATTACAATCCAAATAATAACAAGAAGAA
3985	72	68	(-)3xSLv1		neg		
3986	72	66	MW2_CDS_08023	MW1511	FALSE	unmapped	AAAGTCAAGGGCTGAGCAATTAATTAAACAATACCATCCATATGAAACACCGGTATTTGA
3987	72	64	MW2_CDS_12329	MW2334	FALSE	unmapped	AAAAAGTTGAAAAAGGATGAGGCACGTGGGAAATCACTTGAGTTACTTGAGAAAGTTGGT
3988	72	62	MW2_CDS_01098	MW0202	FALSE	unmapped	AAAAGAAAATGGTGTGCACACTTGCTTAGACACATCGGCTGGATGTGCTAATGATACAAA
3989	72	60	MW2_CDS_05638	MW1048	FALSE	unmapped	AGCAGAAACGTTTACTGGCGGATTTCCAGTTTATGAAGGCAATAAGCCTGTTTTAACTTT
3990	72	58	MW2_CDS_03903	MW0713	FALSE	unmapped	TCAAATAGACCAAAACAGTCTCATTTAACTAAGAAAGAGCGTCTGGCAGATGAAAATCCA
3991	72	56	MW2_CDS_07749	MW1461	FALSE	unmapped	GTGGGGTGACGATGACAAGTATTGGTATGAATCAGCAACAAGTCATGCAGCTGTTTATTT
3992	72	54	MW2_CDS_03631	MW0665	FALSE	unmapped	TTGCTGAAAAATATCATAAAACACCAGCACAAGTTGTATTACGTTGGCATTTAGCACACA
3993	72	52	MW2_CDS_12626	MW2388	FALSE	unmapped	ACTAAGGGTGAAACTTTAGGCGTTATTGGAGAAAGTGGTAGCGGTAAATCAATCACTTGT
3994	72	50	MW2_CDS_09529	MW1790	FALSE	unmapped	TGCATTGATTTGGCAACTTAAGCCAGTTGGACTTGAGCAAGGTTTAATTCATGCTTTGAC
3995	72	48	MW2_CDS_05232	MW0968	FALSE	unmapped	AACCCATCGTTTATAGTTCGATCATTTCACGTAATTACTACAGCCGGTATGACGATGGCA
3996	72	46	NC_A_020		FALSE	unmapped	TCGGCTAGTCACGTGCTAGCCGACAAATAGAAAGGAAAGTAAGTAATAAATATTGAAGAT
3997	72	44	MW2_CDS_12929	MW2446	FALSE	unmapped	GGAAGATCATGATTTAATCATATTAGATGAAGTTACAAACGCTTTAGACAAGAAAACAGT
3998	72	42	agr_tiling 158_R		FALSE	unmapped	AACATGGTTACCATTATTAAAAATTATATAATGATAGAAGAAAAGCCTATGGAAATTGCC
3999	72	40	MW2_CDS_08523	MW1605	FALSE	unmapped	CCTTTGCTTTAATACCTATCGTCTTTATTAAGTATGATTTCACATACGTAAATGCTACGC
4000	72	38	MW2_CDS_03077	MW0565	FALSE	unmapped	AGACAAGCAACTGAAAAAGATGTTGTTCAAATTAGAGATGTCGCAACTAAAGCTTGGTTT
4001	72	36	MW2_CDS_08042	MW1514	FALSE	unmapped	TGATGGGGATTTTGCGGGTAGTGAAGCAACACTTAAAACAGGTCAACATTTATTACAGCA
4002	72	34	MW2_CDS_10262	MW1938	FALSE	unmapped	TCAAGAAGAATACAACATTTATGGACATAACGGCACTAAAAAAGGAGAAGAATACGGTCA
4003	72	32	MW2_CDS_07657	MW1445	FALSE	unmapped	ATCGAAGAGCATGGTGGTTCCATAGATGTTAAAAGCGAATTAGGGAAAGGCACAACATTT
4004	72	30	MW2_CDS_04571	MW0844	FALSE	unmapped	AGCGCATACTGATGGTGGTGTTCCTAACATGGTAGTGAACATTCCACAATTAGATGAAGA
4005	72	28	MW2_CDS_00609	MW0113	FALSE	unmapped	AGCGCCAGGTACGGACCATACGAGAGAATATATCCCAGTAATTATGTACAGTCCGAAATT
4006	72	26	MW2_CDS_03360	MW0617	FALSE	unmapped	CAGACGAATGATCGCTTAAGAGAAGCCATGAAATTTGATCAGTCATTCAAACCATCGCAA
4007	72	24	MW2_CDS_04954	MW0915	FALSE	unmapped	TCACCTAGTAGAACGTATGTCGAAATAAAGCATAAAGGGCAATATGTCATATCGATCACA
4008	72	22	MW2_CDS_06858	MW1280	FALSE	unmapped	ATTCAACCATCATCAAGAAGATATCCTTTCGTTAAATTCACGCCTGAGCGTGAGATTGGT
4009	72	20	MW2_CDS_07019	MW1311	FALSE	unmapped	ACTGTCTGATTATATTGAGACACATGGTGATTTCACATTGCCAATGTCTGTATTTGATGA
4010	72	18	MW2_CDS_06957	MW1299	FALSE	unmapped	ATGGCTAAACCTGAAACATTGCCTGTATTAAATGGGGTCTTAGATTATCGTCGTCAAATT
4011	72	16	MW2_CDS_12449	MW2357	FALSE	unmapped	ACGACAATCAAAATCAAAATCATCGTCGTCAATCTGAAGACGCATCGTATAGACAACAAT
4012	72	14	MW2_CDS_13056	MW2471	FALSE	unmapped	TAGTACTTGGGAAAAGGCTAAGGGCTTTGTTCGTAAAGCAGGTACATTTATTTTTGGCGG
4013	72	12	MW2_CDS_01946	MW0358	FALSE	unmapped	AACTGATATGGAAAATGCATATGGTTCAACGGAAGGTTTGCTAGTAGGTGCAATCGATGC
4014	72	10	MW2_CDS_07860	MW1481	FALSE	unmapped	TGTAAACGAAGGTGACGTTTTAATTATCAACACTGGTGATGGAAGCTACATTTCAAGAGG
4015	72	8	MW2_CDS_04372	MW0805	FALSE	unmapped	ACAACACAAGTAGCGATAGGGACGTCTTCAGTCATTCTAATTGTGACAGGACTTTCTTCA
4016	72	6	MW2_CDS_08945	MW1679	FALSE	unmapped	ACGAAGAAGCAATTGGTATTATGCATAGTGCAATGGATGCTGGTATTAAAGTTCCAGAGG
4017	72	4	MW2_CDS_12494	MW2365	FALSE	unmapped	GCATTACCATATCTCATTCTCGGTAGCAATAATTGGTCTTTTGTACTGACTTGGCTACCA
4018	72	2	MW2_CDS_04067	MW0741	FALSE	unmapped	TGACCATGTAGATTCTGATGACAAAGACATCAAGTGGTATAGTCAATCAGGACATGTTAT
4019	72	163	MW2_CDS_10977	MW2073	FALSE	unmapped	TTGATAAGTATTATCCTATCCTCGAAAAATTACTTTCAGACACTAGTGAACAAAAATTTT
4020	72	161	MW2_CDS_09850	MW1848	FALSE	unmapped	TGCAAATTGAAAAATTACGAGGTGCAGCGTTAGATGAATTGTTTGATGCAATACTAACGT
4021	72	159	MW2_CDS_12101	MW2291	FALSE	unmapped	TTCCTGTTGAAGATGATCATAAAAAGCCACTCGCATCATCAACTTGGCAAGCTTGTGTAG
4022	72	157	MW2_CDS_08889	MW1669	FALSE	unmapped	TTGAAAGATAATAAGACAGTTGGTATCTTCCCAACAGGTTCTCGCACATCGCAAGAAGGT
4023	72	155	MW2_CDS_09716	MW1824	FALSE	unmapped	TGCGAAAGGTTACTCAAATCAAGAAATTGCTAGTGCATCGCATATTACTATTAAAACGGT
4024	72	153	MW2_CDS_11299	MW2137	FALSE	unmapped	ACCCAGAACGTTTAATTGAAAACTCAATTAAAGGTATGTTACCAAGCACTCGTTTAGGCG
4025	72	151	MW2_CDS_07069	MW1320	FALSE	unmapped	ACTAAAGTTGATGATTCACAGCCAGCATTTATTAATGACATCTTAAAGGTTGAAGGCGTT
4026	72	149	perR_tiling_110_F		FALSE	unmapped	CTCTTTTAATTTAATATTTTCATCTAATATCGTATCATAAAATTATTATAATGAAGAAAA
4027	72	147	MW2_CDS_11283	MW2132	FALSE	unmapped	GCGTAGACTTCGGTCCTGTAGATTTCGTAAAATATGCTGAATCATTTGGCGCAAAAGGTT
4028	72	145	MW2_CDS_04662	MW0860	FALSE	unmapped	ATGCTCAATAATTCAGATAGTATAGCTATAGGATGTGTACAAAATAAAACGATGAGAAGA
4029	72	143	MW2_CDS_09004	MW1690	FALSE	unmapped	TGTTGTTCCGAAGCCGTTGTGGTCAAAGCAATACAATGCAAATGAACGAAATCAAATCAA
4030	72	141	MW2_CDS_12081	MW2287	FALSE	unmapped	CAGTGGACCTGAATTGGCAGATATTATTCCACCGTTATTAACAATGTTAGCATTAGCAGT
4031	72	139	MW2_CDS_11920	MW2258	FALSE	unmapped	AGCACCGTCAATTTTAAAAGCTGGTGAAGTGTTCAATTCGAAAACAAGTTTCCGTATCGA
4032	72	137	MW2_CDS_09326	MW1752	FALSE	unmapped	AGTAAACACGAAGCTATTGGTGTAATCTATGCCGGTAATAAGCCATCAGGTGAAAGCACA
4033	72	135	MW2_CDS_01601	MW0293	FALSE	unmapped	ATATTGAATGAGTGGGCAGAAGATGTAGCAGAAGGGATTGCCCAAATACAGGTCATGTAT
4034	72	133	MW2_CDS_03143	MW0577	FALSE	unmapped	GTACAAAAATCCTATGTATTCTTACAATGAAGATGGAACTGAACATTATTACGAATTCCA
4035	72	131	pMW2_030		FALSE	unmapped	CCTAGGCGAACAATCTTTATCAAGTATTTCTAAAAGTAAAGGGATTGCGTTAAGCACCCT
4036	72	129	MW2_CDS_13031	MW2466	FALSE	unmapped	ACAGTATCGTGGTATTGCTACATGGCGTTACGATCAAGATCGTCAACGATTGATTGGTAC
4037	72	127	MW2_CDS_04340	MW0799	FALSE	unmapped	GAACTTCCAATGGAATACGCGGTCGAAATGAACCGTTTAATCAAGTTCGAAATGGAAGGT
4038	72	125	MW2_CDS_11182	MW2112	FALSE	unmapped	ACACATGAATTTATGTTTGCGCGTCCAATTCATCGAACGCCTGATATGATTAAACAACAT
4039	72	123	(+)E1A_r60_a20		pos		
4040	72	121	MW2_CDS_06794	MW1269	FALSE	unmapped	CCGGTGATGCACTAAGAGATAGATTGCTGAAACAACGGGGTGAATATGATGAGTCTCATT
4041	72	119	MW2_CDS_02207	MW0407	FALSE	unmapped	TAGCATGGTCATTACTTGTATCTTGGAATCAGATGGTAGCCTTTAGTAAAGGGCGCATGG
4042	72	117	MW2_CDS_00829	MW0154	FALSE	unmapped	GATATCACAACGTTTAGACTGGCGTACGTTAGTGACGTGTTTCTCTACAAACGAAGCACA
4043	72	115	MW2_CDS_11747	MW2227	FALSE	unmapped	ACGATGAAAGTAATCGTTAACGCTTCTTTTTTAATCGTAATATTAGCGATTGTAGTGGCA
4044	72	113	MW2_CDS_03255	MW0598	FALSE	unmapped	GCGCATCGTATACCTGGTATTGAGTTGATGGATGAATGTTTGAAAATTGCTCATGTAAAT
4045	72	111	MW2_CDS_09163	MW1719	FALSE	unmapped	ATCAACAACTGTTGTTATTTTAACAATTATTGGAGCGATTTTATTAATGATTGTTAGCAT
4046	72	109	MW2_CDS_11212	MW2118	FALSE	unmapped	GTGCTGGTGTTTCTGCGGAATTATTCCAAGAAACTTTAAAATTTGCTCACGAAGCTGGTG
4047	72	107	perR_tiling_103_R		FALSE	unmapped	AAGTAGGTGTATTATCTCTAGGATAAAAATATATAATCGCCTTTTTACCTTTTAATGTAT
4048	72	105	MW2_CDS_13089	MW2478	FALSE	unmapped	TGGTGGCGACTTGATGCTTATTCCTAAAGCCATTTATGCAAGTAAAGCAACCATTCGTAA
4049	72	103	MW2_CDS_12290	MW2326	FALSE	unmapped	AGTTATAAGGTTTATTTTACGTACTGCAATTGGTTACAGTGTATTTGCATATGGTTTACA
4050	72	101	MW2_CDS_09185	MW1723	FALSE	unmapped	TCAAACCATCCGACGCTAAAAAAAGCTATTACGACTGGTTTTCTTGGTGCTTTAACGACT
4051	72	99	MW2_CDS_06980	MW1304	FALSE	unmapped	TTGATCGCTTTTATCGAGTGGATAAATCTCGTTCAAGAAGTCAAGGCGGTAATGGACTCG
4052	72	97	MW2_CDS_04972	MW0919	FALSE	unmapped	GCTCAGAAATATGGCGTTATTCATGTTAATCATCATGAAAATTTCGATGATACGGGTGCA
4053	72	95	MW2_CDS_09618	MW1806	FALSE	unmapped	TCCGCCAATTCTTATCTTGGATGAAGCAACAAGTGCACTTGATTTAGAAAGTGAATCCAT
4054	72	93	MW2_CDS_04745	MW0875	FALSE	unmapped	ACCACAATTAAAGGACATTGGTGATGAACATCAAGTTGCTTGTTTTTATGTAAATAAAGT
4055	72	91	MW2_CDS_13657	MW2581	FALSE	unmapped	GTGTTAGGTCTTGTTGTAGCACCAAATTATCAAGGTCAGGGTATTGCAGGTCGCTTACTA
4056	72	89	MW2_CDS_04396	MW0810	FALSE	unmapped	AGCAGGCGATTAATAAAACTGTCGGTATTCGTAAACAATTTACATATGATTACACAGCCT
4057	72	87	MW2_CDS_03264	MW0600	FALSE	unmapped	TGTTATACAATTTCGGTATTGTTGCCATTTTCTTTGCAATTGGTGCGTACCTACACATGA
4058	72	85	MW2_CDS_01606	MW0293	FALSE	unmapped	GGGGGCGGTATATCTGAACAAGGAGATAATCTCATTAAATATATCGAGCCGAAAGTTGCA
4059	72	83	MW2_CDS_08154	MW1534	FALSE	unmapped	TCAATTGTTAGTTGAGAATCAATATGATGTATCATCAGCATTGACATATTTTGCAGATGA
4060	72	81	MW2_CDS_10355	MW1955	FALSE	unmapped	ACGCAAATTTATGGTGGACAACAAGTAAGTCCTAATACAGAAAAGCTAATTATTATTGCT
4061	72	79	MW2_CDS_13090	MW2478	FALSE	unmapped	TGCATTAGTTAAAGCTGATATCGGTATCGCCATTGGTACAGGTACAGAAGTTGCCATTGA
4062	72	77	MW2_CDS_12099	MW2290	FALSE	unmapped	GAGATTAACCATGTAGATTCATTTCATTATTTTTATCAAGAAGATGGTGCGAATGTTGGT
4063	72	75	MW2_CDS_00942	MW0174	FALSE	unmapped	GGACTTCTTTTTGGATGGATACCAGCTCGCGCAGCATCTAAGAAAGAGCTCATAGATATT
4064	72	73	MW2_CDS_08362	MW1572	FALSE	unmapped	TAAAGACCATGTCACATTAGATTATCCTCAACTTGGCGGTGAACAAGAATTGAAACGCCG
4065	72	71	NC_S_084		FALSE	unmapped	AGCATTTGGTTTAGTCAAAAATATCAGCATTTTTTATAATTTACCTTAATTTAATCGCCA
4066	72	69	MW2_CDS_10725	MW2026	FALSE	unmapped	AAAGTGAAATTTCACGATGGAACTGAATATATTGCTGTAAGCGATGGCTTTGTTGAAGTT
4067	72	67	MW2_CDS_06441	MW1201	FALSE	unmapped	AAAAACAAAATGGACATATGTTAGGTCATCATCTATATAATGAAAATAAAAAAAGAGCCA
4068	72	65	MW2_CDS_01220	MW0224	FALSE	unmapped	ATATCAATGGAATTACAGACGGTTACGGTGCAGATGTTGTTGTTGAATGTTCAGGTGCAG
4069	72	63	MW2_CDS_03739	MW0684	FALSE	unmapped	TCAAGAGGCGATGAAACTTGGTGATAAGATTTGTCTTTTGAATGAAGGGCATATTGAACA
4070	72	61	MW2_CDS_09898	MW1857	FALSE	unmapped	GAGCTCCCTTGGGGTGTATTAATTTTATTTGGTGGCGGTTTAGCATTAGCGAAAGGTATT
4071	72	59	MW2_CDS_03786	MW0692	FALSE	unmapped	GAGAACAGAACTTGAAAATACGCTTGAGATTACAGCAGAAAATTGTATGGAACCAGTTCA
4072	72	57	MW2_CDS_02813	MW0518	FALSE	unmapped	AGCAATACAGATCATTCAACTAAACCAGTTGCTACAGCTCCAACAAGTGTTGCACCAAAA
4073	72	55	MW2_CDS_07261	MW1356	FALSE	unmapped	GCACAAGCAATGCGAGATAAAATTGACGAAGCTAAAAACGATGGTGATTCAATAGGGGGA
4074	72	53	MW2_CDS_10283	MW1941	FALSE	unmapped	TGGGCGAAAGATAATTTTACTCCTAAGAATAAGATGCCTGTAACTGTTTCTGAAGGGTTT
4075	72	51	MW2_CDS_05930	MW1103	FALSE	unmapped	TGAGGGTGATGTGATTTCTCAATCTCCTAAAGGAAAATCAGTAGATGAGGGGTCAACGAT
4076	72	49	ETG09_205211		pos		
4077	72	47	MW2_CDS_02384	MW0441	FALSE	unmapped	AAGGCGAATTATTTGGAAAACATCGACATGGTGAAGATTGTCTGTTCTGTTTAGAAGTTT
4078	72	45	psma_tiling_003_R		FALSE	unmapped	GTTGAATGAAGTATAATCATTTTTAAATTGTGGCTTAATTGTTTGCAATTTATGACAATT
4079	72	43	(+)E1A_r60_a107		pos		
4080	72	41	MW2_CDS_09718	MW1825	FALSE	unmapped	CTCGAGAACTTCACGATTCTGTTAGTCAGCAACTTTTTGCGGCAAGTATGATGCTTTCTG
4081	72	39	MW2_CDS_00260	MW0049	FALSE	unmapped	TGTTGGTTACAGTGCAGGTAAAAATAAGGACGCAAATTTAGTATCAAAAGCAATCAGCAG
4082	72	37	MW2_CDS_10913	MW2060	FALSE	unmapped	ATGTGACTGAATTAGTCTCTAACGATATAGGTGTCGCTTCGATGATGTTAGGAGCGGGAC
4083	72	35	MW2_CDS_12837	MW2429	FALSE	unmapped	TTGCAATGGGTATTGTGATTGCAATCATAGGTTTATTTGTCCTTGGACAACGTACCGCAT
4084	72	33	MW2_CDS_04035	MW0735	FALSE	unmapped	TGATGCCAAAATCACTGTAGTACCATCTGATTCAATTCCAGCAGACCAAGAAGGTATGGA
4085	72	31	MW2_CDS_05349	MW0990	FALSE	unmapped	GGAAATCGTGGTCTCCATCAAGAAATTAGCAATGATTATTTAGAGCCCCACCATGATGCG
4086	72	29	MW2_CDS_12082	MW2288	FALSE	unmapped	ACACTCCAAATCACAGTCAATACATTGAGTCTCAAGGTGTTAACGAAGATATTTGGCGTC
4087	72	27	MW2_CDS_08163	MW1536	FALSE	unmapped	CAAGACAGCAATTTGAAGTACCTGTACAGGCTGCAATAGGACAAAAAATTGTAGCGCGTA
4088	72	25	MW2_CDS_01395	MW0255	FALSE	unmapped	AAGCGCGATTGAAAATGTTTCATTTTTCTAAAGAGCGTTTATTAATCATTCGTGTGTTGA
4089	72	23	MW2_CDS_03254	MW0598	FALSE	unmapped	TATATTGTTGCTGATGGGACAGGAGTAGTCAAAGCTTCGCATCGTTTAAAGCAACCTCTA
4090	72	21	MW2_CDS_02542	MW0470	FALSE	unmapped	ATTATGGAAGGTAAGGCCGTTAATTTACTTGAGCATCTAGCTGAACGTATTGCAAATCGT
4091	72	19	MW2_CDS_10840	MW2047	FALSE	unmapped	TGACTGTTCAGCACACTTTTCCGATATGAAAAGAGATTTGAAAACAATAACACCACGTGC
4092	72	17	MW2_CDS_11812	MW2240	FALSE	unmapped	GCGTTGGAAATTTGGTGATTGGTCCTATATTTAACAAACAGACACCATTTCGCGTGCAAG
4093	72	15	MW2_CDS_06132	MW1139	FALSE	unmapped	TGCGGTTAAATTATTAACTGCTAAAATGGCAGATGCAATCTTAGAAGGTCAACAAGGCGT
4094	72	13	MW2_CDS_05589	MW1035	FALSE	unmapped	TGTCTAAATGGATTATTGTGAGTGATAACCATACTGAATCAGGCGTTTTATATCAAATTT
4095	72	11	MW2_CDS_11804	MW2238	FALSE	unmapped	GTGTGATTGCTACGTTTATTTGGGAATTGATTGAAAAAAATAAAGGAGGTCGTTCATCAT
4096	72	9	MW2_CDS_13436	MW2542	FALSE	unmapped	ACACGAAATCAAATGACTTTCTTGTTCGCAATACCAATAACAGTAGCACTGATTCACACA
4097	72	7	MW2_CDS_00413	MW0078	FALSE	unmapped	AAGAAGCAAACCTTGATTTTGGTGTCGAAATATGTGAACCACAACCACCTTCAGAAGACT
4098	72	5	MW2_CDS_04298	MW0791	FALSE	unmapped	TAAAGTCCTTTTACCTGAAGCTATGCCAGCGCTAGTGTCTGGCATTACAGTTACAGCAAT
4099	72	3	MW2_CDS_13731	MW2593	FALSE	unmapped	ACGAAGTCACAAATCATGGACTACTTTGCCGCAGGGATTAATTATTGCATAGTTGGAACG
4100	72	1	MW2_CDS_13356	MW2527	FALSE	unmapped	TGGGATATTCGAGGTTTAACATCTTATATTTTCTCATTCTTAATACTGGTTGCGCTTGTT
4101	71	164	MW2_CDS_13481	MW2551	FALSE	unmapped	TCGGATAGCGACTCGGATTCAGATAGTGACTCCGATTCAAGAGTTACACCACCAAATAAT
4102	71	162	MW2_CDS_03693	MW0676	FALSE	unmapped	TGGACAAGCGATTTATGGAGTCGGAGCAGGTATTACAATTGATTCTAAGCCAAAAGATGA
4103	71	160	MW2_CDS_07054	MW1317	FALSE	unmapped	ACGCTTTATTGACACACCTTATTGCCAAAGAATGTGGACTTGAAGTAGGAGAATTTGTGC
4104	71	158	MW2_CDS_08456	MW1591	FALSE	unmapped	CTTTTTAGAACGTACGCCACGTGGCAGAAAAGCAACACCATTAGCTTATGAACATTTTGC
4105	71	156	MW2_CDS_04848	MW0894	FALSE	unmapped	ACCTAATGCTGTCTTTTGGTTGAAGACATATCCAGAACGTTTAAAACAAGCACGTGCCAA
4106	71	154	MW2_CDS_12999	MW2460	FALSE	unmapped	ATGCAAAATTTGCTGAGGCAGCAGGTGGTAAAGGTTATACAATTAAGAGTGCTAGCGAAG
4107	71	152	MW2_CDS_12977	MW2456	FALSE	unmapped	CTGAAATTCCTGACTACTTAAAGAAAGACCCAATGGTAGGTGTGGATGGCAGTGTGTTCT
4108	71	150	ETG08_142674		pos		
4109	71	148	MW2_CDS_13319	MW2520	FALSE	unmapped	TGTCTTGTATCAACATGGTACATTAGGTACGTTAATGGCTGGCTTACTAGAAGGCACAGC
4110	71	146	MW2_CDS_09322	MW1751	FALSE	unmapped	TGGTTCCGGTTCATTGTTGTTACGTGTTGGTAAAGAAACGCAAGTGTATCGTTATTTCGG
4111	71	144	MW2_CDS_04373	MW0805	FALSE	unmapped	AATGGTTCCATCTTTTTATTTGGACTATTACCAGGTTCATTGCTTGGGTCCTTCATTAGT
4112	71	142	ETG10_234183		pos		
4113	71	140	MW2_CDS_11408	MW2161	FALSE	unmapped	ACTGCACGTATTCGTACAGTAAGAAAAACGATTGCACGTCTAAAAACTGTTGCTCGTGAA
4114	71	138	MW2_CDS_12135	MW2297	FALSE	unmapped	TATCAATCATTCCATCGGAGGCGTTCCAGAGATGTATTTTTACAGTTACGTTTCCGGAGC
4115	71	136	MW2_CDS_02918	MW0538	FALSE	unmapped	TGGTATTATTTTCTTTAGTGGATCATTATATATTTTAGTATTAACTCAAATTAAAGTTTT
4116	71	134	MW2_CDS_11008	MW2082	FALSE	unmapped	TGCAACTTATCAAGCAACAGGATTTGGATTTAAAAGTCCCGCGTCACCAGGTTCATTTAT
4117	71	132	MW2_CDS_11714	MW2220	FALSE	unmapped	TTGCATATGGTTTAGTACTATGGTCAAGCTTAGGTCGTGTTATTGATGTACCGACACCAA
4118	71	130	MW2_CDS_04855	MW0895	FALSE	unmapped	GAAGCGCGTATTGATGATGCGATCATTGTTGGATTCCATTATGAAGACGTTGATAAGCGT
4119	71	128	MW2_CDS_02599	MW0480	FALSE	unmapped	ATTAGCTAGAGCTTTAGCTGAATCAATGTTTGGCGATGATGATGCGATGATCCGTGTAGA
4120	71	126	MW2_CDS_08159	MW1535	FALSE	unmapped	GGGTTGCTTAAACTTCCTAATGAGGATTTAGGTGCTGACATGTATCAGTTGCTGATGTCT
4121	71	124	MW2_CDS_10819	MW2043	FALSE	unmapped	CCACGTTGTCGCGCGCACCATATCGTAGCACCTAGTGATAATAATAAGGAGGAATTATAA
4122	71	122	agr_tiling 076_R		FALSE	unmapped	GTACAATTCTTTTCATTATCACACTTTTTGTAAAAGAACCATATACCCAATTTATTCAAC
4123	71	120	NC_S_095		FALSE	unmapped	CGCCAATACAGAACTTTAATAATGACGAGAATTAAAGTCTGTATATGGCGATAACAAGAA
4124	71	118	MW2_CDS_04208	MW0769	FALSE	unmapped	ACCTGCGACATTAATTAAAGCGATTGATGGTGATACGGTTAAATTAATGTACAAAGGTCA
4125	71	116	MW2_CDS_12683	MW2399	FALSE	unmapped	AGAAAGTGAAAGATTAAGTGAGTTACTAAAACCAGCAAATCAATTAAAATCTCCTGAAAA
4126	71	114	MW2_CDS_02316	MW0427	FALSE	unmapped	TTATGTACTGGTGCACAAAAAGGTAGAGATTTACCTTTAGAAGGACGCATGGGTGATGGT
4127	71	112	MW2_CDS_07340	MW1371	FALSE	unmapped	ACATTTGAAAGCATGGGGCAAACATTTCAAGCAATTCAACTATTAGTGCAAACCATGTCT
4128	71	110	agr_tiling 214_R		FALSE	unmapped	CGCGATTGCTAAACGCTAAAATTTCCTCACCTTCATTTTCAAATAACTGAGTTAAATTTA
4129	71	108	MW2_CDS_02774	MW0511	FALSE	unmapped	TCCATAAGGACCCCGAATCTTTAAATCCTATGATAGACAAAATTGCTCGAATTATTCAAA
4130	71	106	MW2_CDS_12400	MW2347	FALSE	unmapped	GTCGTGTTTTCAGATCAAGAAAATCATGCGAGTATTATTGACGGTATTAAGTTAAGTGGT
4131	71	104	MW2_CDS_04134	MW0757	FALSE	unmapped	TGAGTTTAAATATATTAATATCAATAAAAAGGTACACATTATCTTAAAAAAGCACCAAAA
4132	71	102	(-)3xSLv1		neg		
4133	71	100	MW2_CDS_00366	MW0070	FALSE	unmapped	CAGTTTGGGCAAAGACTCAAGATAAAGATTACCTTACCCAAATGAAGTCGGGAGTCAGGT
4134	71	98	MW2_CDS_09776	MW1835	FALSE	unmapped	AGTCAAATAACAGAAACATTTCATACTCTTGTGAATCCGCAAGACTATTTTTCACAACAA
4135	71	96	MW2_CDS_06086	MW1131	FALSE	unmapped	AAAAAGACTATTGAGATTGGTGTTAAGGTTGAAGATTTATCTATTGAAGAAACAAATCGA
4136	71	94	MW2_CDS_06954	MW1299	FALSE	unmapped	AGCAGGGACAAATTTCTGAAGAAGCCGCTAGTATCCGTGCATTATTAGACTTGTGTGATT
4137	71	92	MW2_CDS_12440	MW2356	FALSE	unmapped	GACCATTATTTTAGGGATTGGTGGCAGTGCAACAAATGATGGTGGTACAGGTATGCTAAG
4138	71	90	MW2_CDS_08505	MW1601	FALSE	unmapped	AAAGAATGTACCATTAAGCCAAATTAAAAATGTATTTAAAATGATAGATAAACAAGAGTT
4139	71	88	MW2_CDS_00969	MW0179	FALSE	unmapped	ATGTTCTACATTAATGGATTAAGTAAACAATTTTTTACATATGTAGTTGGTTTCCCAATT
4140	71	86	MW2_CDS_03548	MW0650	FALSE	unmapped	GATAGTCTACTCATTCATCGTTCTTCACCATTGATGGATCCAGAACAAGTTGCTGATGCA
4141	71	84	MW2_CDS_04504	MW0832	FALSE	unmapped	CGCAAGCACTTATTTTAACAGCAATCGTTATCGCCTTTGCGACAACAGCCTTTTTCTTAG
4142	71	82	MW2_CDS_02785	MW0513	FALSE	unmapped	ACATTAGCGATTGAAGAAGCTAAAAAAGCAGCTCAACTAGGCGAAGTACCTATAGGTGCT
4143	71	80	MW2_CDS_09379	MW1761	FALSE	unmapped	ATGGGCATGGTGAGCTTGATGTGTATAAAGCATTAAATGTAGCAAATCAAAAAGCAAGTT
4144	71	78	MW2_CDS_02675	MW0494	FALSE	unmapped	GTGCAGCTGAAAAAGCTGGTATCGAAGGCTTAGATGAATTCTTAACAGGTCCTACTGCTA
4145	71	76	MW2_CDS_08046	MW1515	FALSE	unmapped	TGAGTGAGAAAGTAGCAGAATTCCAATTGAAGTCTGTCGATATCATGGGGCCATTAATGG
4146	71	74	MW2_CDS_02481	MW0458	FALSE	unmapped	TGTTGGTTATGGTAAAACTGAAGTTGCAGTGAGAGCAGCATTCAAAGCTGTAATGGAAGG
4147	71	72	MW2_CDS_07936	MW1495	FALSE	unmapped	TTCAAAAAACATTGTCTTTTTTCATTACCAGCTTACCTACTATAATTGTAGTAATGCTCA
4148	71	70	MW2_CDS_09155	MW1717	FALSE	unmapped	TTCACCAACATTAACTGAACAACCAACATACTTTAATGAACATGACCTTCGTTTACAAGA
4149	71	68	MW2_CDS_04651	MW0858	FALSE	unmapped	AGCACCTATTTCATTTACATATATATACAGCAAAAAAGAAAGCCCAGAAATATTGGTGTT
4150	71	66	MW2_CDS_10999	MW2080	FALSE	unmapped	GACGATGCACCAATTATGGAACAAATTGCTACAGATTTCTTAGAAACAACACGCAATGCA
4151	71	64	MW2_CDS_07293	MW1363	FALSE	unmapped	TAGGTGAAAAGTTAGGTGCCGATCCTATGACATTTCTAGGTTTAGGTGGTATCGGTGACT
4152	71	62	MW2_CDS_05833	MW1084	FALSE	unmapped	AAAGTTTATGGAAATCCGATCTTAACAATGGTTGAAGGCGAAGTTAAATTTGAGGGGGAT
4153	71	60	agr_tiling 009_R		FALSE	unmapped	GTTTATTTTTTTATAGTAGATAACTCAGTAAGAATCCATTTCGCCCTTTGCAAATGAATG
4154	71	58	MW2_CDS_06815	MW1272	FALSE	unmapped	CAGAAGCATCAATGTACTTTGTTGAAGCCCCTTCTACAATGAATGAAATGTTGATGGCCA
4155	71	56	MW2_CDS_00409	MW0078	FALSE	unmapped	TCGTCACAGCGTTACAAACAGTTGTATCTAGACGACTAAGTCCATTTGAAACCGGTGTTG
4156	71	54	MW2_CDS_09664	MW1814	FALSE	unmapped	AGCATATGAAACACGAACCTCACTATAATACGTATTATCAACCAGTTGGCAAACCGCCGA
4157	71	52	MW2_CDS_13129	MW2485	FALSE	unmapped	CAAAGACGTGTGACGGGTGTCAGATTAGATACAGGTGAGTTTGTAAAGGCAGATTATATT
4158	71	50	MW2_CDS_03881	MW0709	FALSE	unmapped	TTTCGTTGCCAATGGGTACAACGATTCATTTTGGATTTCTTAGTATTCCAATTACTGTGA
4159	71	48	MW2_CDS_01916	MW0352	FALSE	unmapped	AGGGGCTATCTCTTGGTTCTTTTTATCATTGATATTATCGCTCACACAATTTACACCTTT
4160	71	46	MW2_CDS_00624	MW0115	FALSE	unmapped	ACGCCAATGTTAGATACTATTCGAATGGCTATCGTAAGTACAGTATTAGGTAGCATCGTT
4161	71	44	MW2_CDS_00990	MW0184	FALSE	unmapped	TTGCATCACCGATTACACCACTTGTCGATACTGGTAACGAGCAACGTCAAGATTTAGAAA
4162	71	42	MW2_CDS_11395	MW2157	FALSE	unmapped	AGAACAATTAATTTTCCCAGAAATCGACTATGATAAAGTAAGTAAAGTTAGAGGAATGGA
4163	71	40	RC12		pos		
4164	71	38	MW2_CDS_09131	MW1712	FALSE	unmapped	ACCCAATGGGAGGCATACAAATCATTCCGGAAACCAATCAAGTTATTAGTCCAAGGTTTG
4165	71	36	MW2_CDS_12672	MW2396	FALSE	unmapped	TGGCGGTAGACATAGCTGAAGCGGTATCGGAGACTGTCGATAAAATTAAAAGTAATGGTG
4166	71	34	MW2_CDS_00547	MW0103	FALSE	unmapped	CAAAGATGTCTTGTTACACCAGGGTTAACAGGACTTGCGCAAATTCAAGGTGGATATGAC
4167	71	32	MW2_CDS_10743	MW2029	FALSE	unmapped	AAACGATGACTTAGGTGGCGGTTCAATTACTGCATTACCAATTATCGAAACACAAGCTGG
4168	71	30	MW2_CDS_00040	MW0008	FALSE	unmapped	ATTTTCAAGAACAGATTAATGTGGCAGCGCGTATGCGTGATTGGTTAGAAGGATCAACAT
4169	71	28	MW2_CDS_13862	MW2617	FALSE	unmapped	AATTAATCACGCGTAGTTGGCACGTATTGCCACTTGGCTTTTTATTTGGACTTGGTTTTG
4170	71	26	MW2_CDS_01926	MW0354	FALSE	unmapped	AGCTGTTAAAAACGATTTGCATTTCAAGAAATTTGTCACTGAAAACAATATTCCTAAAGA
4171	71	24	MW2_CDS_06345	MW1178	FALSE	unmapped	TGCGGCAGATGATTTGGTTTCAGGTAAGAGTACGTTTATGGTAGAAATGCTAGAAGCACA
4172	71	22	MW2_CDS_01957	MW0360	FALSE	unmapped	CGACCGTTGGCATAAGGGAATTTGTAAACAAATCGTTTTGAATTTAGTAGAGAAAGGTGA
4173	71	20	MW2_CDS_08031	MW1513	FALSE	unmapped	CGTGTTCAACGTCAATTATTACAGGACTTAGGTCGAGATCCAGCACCAGAAGAAATTGGT
4174	71	18	MW2_CDS_00340	MW0065	FALSE	unmapped	TGGATTTTATGATAATGTTATTTCTTCTTTTGGATGGCAAAATATAAATATTGGTGTGAT
4175	71	16	MW2_CDS_07510	MW1405	FALSE	unmapped	ACCAACTCATCAAGTTAGCGAACATATTTTTAAGTGGGAGCTAAGAGACGGATCTGAAGA
4176	71	14	(+)E1A_r60_a97		pos		
4177	71	12	MW2_CDS_03523	MW0646	FALSE	unmapped	TGTTATCTGGTGGACAGATGAGACGCATAGAACTTTGCCGTCTTTTAGTTATGAAGCCAG
4178	71	10	MW2_CDS_11846	MW2246	FALSE	unmapped	TGAATCTTTAGTTATGGATGAATACGTTAAGATGACTATCGGTATGCCTGGACTAAGTGA
4179	71	8	MW2_CDS_12398	MW2347	FALSE	unmapped	TCGCCGATTAAGTTTATTGAGTTTGATGACATAGAAGCGGCTGAGAACATTCATCAAACA
4180	71	6	MW2_CDS_00012	MW0002	FALSE	unmapped	TGCAGTTAGAAGATGTTTCTGAAAACAAAAATGTCATCATTCCAGGTAAGGCTTTAGCTG
4181	71	4	MW2_CDS_00158	MW0030	FALSE	unmapped	TGGACTCGTTACAGTGTCACTTTCAACATACAATGAAAATGAAGAAATTGTATTTAAGGG
4182	71	2	MW2_CDS_13229	MW2503	FALSE	unmapped	TGGGCAATTGAACCGTCAATGTTATGGATCGGATTACAAGGTAATGATATCGTGCCACTA
4183	71	163	MW2_CDS_02964	MW0546	FALSE	unmapped	TGGTGAAGTAATTGAAGAAAATGGTTTGCGTATGCATGCCACGAATCTAGGATCAACACC
4184	71	161	(+)E1A_r60_n11		pos		
4185	71	159	MW2_CDS_05043	MW0933	FALSE	unmapped	TTCTCCAAAGACAAAAGCTGTCTTGTTAAATTATCCGACTAATCCAACTGGCGTAGTTTT
4186	71	157	MW2_CDS_13039	MW2467	FALSE	unmapped	GGCATTAGAGTCAATCATTGATAACGCTGATGAAACAACTCAAGAGCGTTTACGTTCAGG
4187	71	155	MW2_CDS_06209	MW1153	FALSE	unmapped	AGTATTTTTAACTGTATTAGGTAACGATAAAGAAGTAGAAAATACATTTAAAGCACTTGA
4188	71	153	MW2_CDS_07082	MW1323	FALSE	unmapped	TTTGATGCTGCGACGAAAGGAAATCCAGGCATAAGTACATGTGCCATTGTAATCAAAGAA
4189	71	151	MW2_CDS_01607	MW0294	FALSE	unmapped	TGGTACATCACCAGCAACGATGACACGCTTTAGTCATAAGCTGGATTATGAGAATTTCCA
4190	71	149	MW2_CDS_04374	MW0805	FALSE	unmapped	TTTGGTGCGAAAATCGGTGTCAAAGTGAATCAATCAATTAAGTCAGATACGGTAGTAACA
4191	71	147	MW2_CDS_08379	MW1577	FALSE	unmapped	TGATGAAGATGCCATGACCTACTTTTCTACACAAAGTCAAGGTGATGTTCGTAGTGCGTT
4192	71	145	MW2_CDS_02648	MW0489	FALSE	unmapped	ACGGATGTATAGGTCGGTCCAAACATTTGATTTTAGTGGAGAGCAGCCTTTCACAAATTA
4193	71	143	MW2_CDS_03339	MW0613	FALSE	unmapped	AGCTCAATGCAATCATTGTTCAAATCGACTGGTATGGCATTGATGTCAAATGTTGGGGGT
4194	71	141	MW2_CDS_13593	MW2570	FALSE	unmapped	AGCGTTAATCAACGACAAAATGGGCAACGTAACGCTATTTTTGAATACCATAGAGTTGCA
4195	71	139	MW2_CDS_11697	MW2216	FALSE	unmapped	AGACTGGAGCATTGCTTAATTGATATTTTAACTTCTAAGAAGCCTATTGAAGAAATCGCA
4196	71	137	MW2_CDS_08094	MW1524	FALSE	unmapped	CGATGAACTTCCAAAGGAAGAGCCTAAATCGAAACCTGTTGTAGAACCTATGGCACCTAA
4197	71	135	MW2_CDS_08452	MW1590	FALSE	unmapped	AAAGTGGTTCAGCGGCAGCACCAACAGCAGGATTACATTTTACTGATGAGTTATTAACTG
4198	71	133	RC11		pos		
4199	71	131	MW2_CDS_08169	MW1537	FALSE	unmapped	CGCTAAAACAGCTGTTTCAAATAACGCTGATAATAAAAATGAATTAGTAAGCTTAGCAGT
4200	71	129	MW2_CDS_01448	MW0266	FALSE	unmapped	TTGCTACTCATTCGATACCCATTAAAAGATAAAGTACTGAATGTTCATATTGGCGTCATT
4201	71	127	agr_tiling 002_R		FALSE	unmapped	TGAAGTAGAACAGCAACGCGAAAATATACCTATATTTAAAAGTATTAAATTAGATTTGTA
4202	71	125	MW2_CDS_07022	MW1312	FALSE	unmapped	AATGATGGGCGAAGGTTTTGGTATTAATCCAACTGAAGGAGAAGTTGTGTCTCCAATTGC
4203	71	123	MW2_CDS_06797	MW1269	FALSE	unmapped	TGGGAGAGATTTATTTACCCGAATTATTATCGGTGCACGTTCAACATTGTTTGTTACTGT
4204	71	121	(+)eQC-42		pos		
4205	71	119	MW2_CDS_01751	MW0319	FALSE	unmapped	AGCATTTGCGGATGCTGTTAATGCATTAGGAGAGCCACTAAGTAAAATGGCTGTGATTAC
4206	71	117	MW2_CDS_11684	MW2214	FALSE	unmapped	GCAACAAATGAAAGATTAATTATGAATGTAGATATGAATGGCCAATTTTATTATAGAAGT
4207	71	115	MW2_CDS_00981	MW0182	FALSE	unmapped	GTTATATCGTCCAAAAACAACTAATACCTGATATCCCAGCAGTCATGGGTGGGGTCGTAT
4208	71	113	MW2_CDS_06514	MW1215	FALSE	unmapped	AACGAAGAGGAATTAGTGGCGTAACTTTAACTGATATTAATGTAGCCGATCAACTGGGGT
4209	71	111	MW2_CDS_02533	MW0468	FALSE	unmapped	GAGCCAGGTCCACATAAATTACAAGGTTTAGGTGCTGGATTTATTCCAGGCACTTTGAAT
4210	71	109	MW2_CDS_04279	MW0787	FALSE	unmapped	AATCTACTGACCTTGAGGCTATGAAGTTTGATGATTACATGTATTCATGGGATTGCAGCT
4211	71	107	agr_tiling 151_F		FALSE	unmapped	CTTTTTGAATAAAGAAACCATTTTCGATAATTGTATCTAATAAGACATTGTCTGCATTAT
4212	71	105	MW2_CDS_00266	MW0051	FALSE	unmapped	AGGTGATAGTGGCAATGATTTGAGAGTAAAGTTTGCAACTGCTGATTTAGCTCAGAAGTT
4213	71	103	MW2_CDS_12503	MW2366	FALSE	unmapped	TATGGATGGTCAAGTGACACTTTCAGATGGCGTAACATCATTTGTGCATCTTGATGATGC
4214	71	101	MW2_CDS_02017	MW0371	FALSE	unmapped	TTTTCATTATACATTTATCTCCTTTAATAGTGAATTTGCAAAACCAAATGTTTGAAATAT
4215	71	99	MW2_CDS_07071	MW1321	FALSE	unmapped	AAAAAGCATTACACGCAATCTTTGATGTTGTGCCACGTATTGCTTTAGGCTCAATTGTCG
4216	71	97	MW2_CDS_07896	MW1488	FALSE	unmapped	CGTGGCTTTGTATTAACATTACAAGCACGTGAACAACATATTCGACGTGATAAAGCGACA
4217	71	95	MW2_CDS_13218	MW2502	FALSE	unmapped	TACCTTTAAGTGAACTGACAGAGGGGTGTATCTGTTGCGCAATGAAAGCAGATGTATCAG
4218	71	93	MW2_CDS_05146	MW0952	FALSE	unmapped	TAGTAGCTGAAGCTTATCGAAATTTAATTGCCGTGGGTGCAACACCATTAGCAATGACAG
4219	71	91	MW2_CDS_03357	MW0617	FALSE	unmapped	TGCCAGTTATTTTTTGGATGCACGGTGGTGGTTATATTGCGGGTGATAAGCAGTATAAAA
4220	71	89	MW2_CDS_01121	MW0206	FALSE	unmapped	TCAACCGACGACACCGAACCCTATTTTAGAAGGTCTTGAAGGTAGCTCATCTAAACTTGA
4221	71	87	MW2_CDS_07192	MW1344	FALSE	unmapped	GAAGATTTTGGTGCGCCACATGAAACAGCCATTGCTAATCATTATGATTTACCGGTGTTT
4222	71	85	MW2_CDS_05060	MW0936	FALSE	unmapped	GGATTACTTATCTTGGGGTGTCGGTGCAGTCGGTAACCCTAGATTCATCAATGTTGAAAT
4223	71	83	MW2_CDS_08212	MW1545	FALSE	unmapped	ACTTTACGGCGGTCAGTTTAACCCTATCCATACTGCACATATGATAGTAGCTAGCGAAGT
4224	71	81	MW2_CDS_01986	MW0365	FALSE	unmapped	GCCAGTAGCAATGAATTACTTAGCTGGAGGTCAAGGTGCAAAGGACTATGGAGATGTTAA
4225	71	79	MW2_CDS_07833	MW1476	FALSE	unmapped	GCAGTAGGTCATGAAACAGACTTTACATTAAGTGATTTTGCTGCAGACATCAGAGCTGCG
4226	71	77	MW2_CDS_06143	MW1141	FALSE	unmapped	CGTGGAACTGCTGATTACATGGGTATGCTTGCAACTGTAATGAATGCCTTAGCATTACAA
4227	71	75	MW2_CDS_06410	MW1190	FALSE	unmapped	TGTGGATAACTGTTATGGGGAATTTGTTGAAAGACGTGAACCTATAGAATGTGGTGCCGA
4228	71	73	MW2_CDS_00546	MW0102	FALSE	unmapped	TTTGAGCATAACAAGCCATTTACATTTTTTGGTGACGGACTGCAAACTAGAGATTTTGTA
4229	71	71	MW2_CDS_13908	MW2626	FALSE	unmapped	CATCGTGGTACACAATTAGTGGAGATGTCGATGAATCTTAGTACTGGAGCAATTGTCGGT
4230	71	69	MW2_CDS_06175	MW1146	FALSE	unmapped	TAGGCGGTAGCCATACACATGAATTTATGGCATTAAGTGCTATCGGTGAGGATACAATCG
4231	71	67	MW2_CDS_12527	MW2370	FALSE	unmapped	ACTCAGAGAAGTTAGACGTTGCATTAGGTTATTCTACAGATGGTCGAATTGCCGCGTATG
4232	71	65	MW2_CDS_06130	MW1139	FALSE	unmapped	ATCGTAGGTATCGTTGACACTAACTGTGATCCTGACGAAATTGACTACGTTATCCCAGCA
4233	71	63	MW2_CDS_13158	MW2490	FALSE	unmapped	ACTTCAAGTTCAGTGAGATTAAGCAATGGTAATACTGCAGGTGCTACTGGTTCATCAGCA
4234	71	61	MW2_CDS_08290	MW1559	FALSE	unmapped	ATCCGAAGAGACATATCGTAATGTCACAGCAATGGTACGGTGGATACGAGAAAAAGAAAT
4235	71	59	MW2_CDS_08165	MW1536	FALSE	unmapped	TGAGCCATATGTTCGTGCAACTATGATGGTTCCAAATGACTATGTAGGTGCAGTAATGGA
4236	71	57	MW2_CDS_04193	MW0767	FALSE	unmapped	TTATCAAGCATCATTTTGCAGTTCCTGGATATCACGCGCATAAATTTGTTACACCAGGGC
4237	71	55	MW2_CDS_08512	MW1604	FALSE	unmapped	ATCCGGTGATGTAACGCCCTCACAAGAAGATATCATAACAACAATGAGGTTGAAGGAGTG
4238	71	53	MW2_CDS_01465	MW0269	FALSE	unmapped	TCGGAATCAGAATTTATGGATTCAGCGTATGAGTTGTATAAACAATTTCAAAAGTTAAGA
4239	71	51	MW2_CDS_00930	MW0171	FALSE	unmapped	ACGAGTACGGGTAAAACAGGAGCGGGGATTATAAAACAAATCTCTGAGTTGCCTATTAGT
4240	71	49	MW2_CDS_01605	MW0293	FALSE	unmapped	TCAGTTGATCCAACCTGTCATAGGTATTTCATCAGCAGGCGTTGTTGATGAACAAAAAGG
4241	71	47	MW2_CDS_11910	MW2257	FALSE	unmapped	CAATTTCGACAGGAAAAATCCAAGATTTGCCTTATAGCTCGAAAAGACCGATGCGCTCTG
4242	71	45	MW2_CDS_02876	MW0529	FALSE	unmapped	ACAGTATCAAATTTATCTAGGGCTTAAGTTTGATTTTTATAATAGGCAGGTTTACCTGAT
4243	71	43	MW2_CDS_11400	MW2159	FALSE	unmapped	CGGACCTGTTGCTCGTGAATTACGTGAAGGTAACTTCATGAAAATCGTATCATTAGCACC
4244	71	41	MW2_CDS_05040	MW0933	FALSE	unmapped	CCGCTCAACCTGAAGGCGCGTTTTATATTTTCCCAAGTATTAAACATATCACCGATGACG
4245	71	39	MW2_CDS_12808	MW2424	FALSE	unmapped	CCTGCGTGCTTGGACTTAAAGCTGTAGGTGACATTGAAGATTTTTCAATCGTTTCATCGA
4246	71	37	NC_S_077		FALSE	unmapped	AGCTACTTTCTTGAAGACAATTCAGCGTATTATACGTGGAACATGTTTGTGGGAAGTAGC
4247	71	35	MW2_CDS_13623	MW2575	FALSE	unmapped	TCAAGTGAAGCAACAACGAGCACGAGTGAATCTCAGTCTACATTAAGTGCAACATCTGAA
4248	71	33	MW2_CDS_11818	MW2241	FALSE	unmapped	TGATTATATAGAGGTAGTTGTTGGTAGAGAAGATGTTGAACAAGTTAAACCTGATCCTGA
4249	71	31	MW2_CDS_00175	MW0033	FALSE	unmapped	AATATGGCTATCCACCAGATCTTCAAAAAATGGCTGTGGAACAAGTTGTAGAGCAAGCAG
4250	71	29	MW2_CDS_02531	MW0468	FALSE	unmapped	GTTGCTAAAGAGGAAGGTATTTTAGCAGGTATTTCATCAGGTGCTGCGATTTATGCTGCC
4251	71	27	MW2_CDS_08457	MW1591	FALSE	unmapped	CTCCAAGAGTAGCAAATCGACTATTGAAGCGGGTAAGAGACTTCCAGCAAGTGAATGAAG
4252	71	25	MW2_CDS_04270	MW0785	FALSE	unmapped	TCTGATGGTATGTTAGTAAAGCGTCCTCTAGCAGTAATGGGCGATAAGATAACGTTAGGA
4253	71	23	MW2_CDS_13543	MW2561	FALSE	unmapped	TCACGGCATACTGTGCAAATTTTTGAAGAAGCTCAAAAAATATTACAAGCACATCATGCG
4254	71	21	MW2_CDS_08032	MW1513	FALSE	unmapped	GCAATTGCTGACCAAGCACGTACGATTCGTATCCCTGTGCATATGGTAGAAACAATTAAT
4255	71	19	MW2_CDS_02496	MW0461	FALSE	unmapped	TCACGGTTAATAAAGCGACGTACGCTAGCAAAAGAAGTAAGTGATCAAGGTAGAATTACA
4256	71	17	MW2_CDS_03910	MW0714	FALSE	unmapped	ATTCCATTGAAAAATGTTACGTTAAGAGCTGAAGAGCGAAACGATGATTTATACGCAGGT
4257	71	15	(+)E1A_r60_n11		pos		
4258	71	13	MW2_CDS_04631	MW0854	FALSE	unmapped	TGAAGGCGTATGTACAGTTGATATGACTTTAACATCAATGGGATGTCCAATGGGACCTCA
4259	71	11	MW2_CDS_03664	MW0671	FALSE	unmapped	ACTCTGTGTACTATAACGATGTTTATCATTTGGACGATACTACAGTTTTACATTGATAAA
4260	71	9	MW2_CDS_10461	MW1975	FALSE	unmapped	ACAAGATGAATTACAAGGTGAAGTGATTGCGCAGCTACCAAATGCATCAGTCATGTATCA
4261	71	7	MW2_CDS_10571	MW1996	FALSE	unmapped	TGGTCAAGCTGAAATTGAATTAATAGATAGAAGTGAAGCACGTAGATTGAAACGATGGTT
4262	71	5	MW2_CDS_10112	MW1903	FALSE	unmapped	AATATGTTAACAAAAAGCTGAAAGAGCATGGAGTAATACTTGAAAGAGTAAAAGAAGAAT
4263	71	3	MW2_CDS_04037	MW0736	FALSE	unmapped	TGAGCCAATCTGGGCAATCGGAACTGGTAAATCATCAACATCTGAAGATGCAAATGAAAT
4264	71	1	MW2_CDS_08272	MW1556	FALSE	unmapped	TGATAAGTTGAAAGCCACCTTAGATGAAATGGTGATAGATGGATTTTCTACAACTGCCGA
4265	70	164	MW2_CDS_08624	MW1624	FALSE	unmapped	GTAGATTTAGACTTAGTGGTCGTTGCACCGAATGCGAAACCACCAGTTGCAAGAATTATG
4266	70	162	MW2_CDS_02236	MW0413	FALSE	unmapped	CAAGAGTGTCAGAGATTACTGCTGACGGTATCTTGTTTGCGCTAGGCCAATCATTCTTTA
4267	70	160	MW2_CDS_11543	MW2188	FALSE	unmapped	ACAAAAAGCACAGGAAGATATTGTGCTTGAACAAGCATTGACTGTACAACAATTTGAAGA
4268	70	158	MW2_CDS_11825	MW2243	FALSE	unmapped	TGCAAAGCGTTTCGATATCAATATTGATGGCTTGCAAGATGCTTTCATTAAAGACAAAGT
4269	70	156	MW2_CDS_02659	MW0491	FALSE	unmapped	AGTAGTCATACCGGAAGAAGAAGAAACTCAAGTAAAAGATGGCAAAGCTAAAACGACTGT
4270	70	154	MW2_CDS_06058	MW1127	FALSE	unmapped	AGGTCCAGTCGTTGCATGCGCAACAATTTTAAATTCAAATCACAATTATTTGGGCCTTGA
4271	70	152	MW2_CDS_01736	MW0316	FALSE	unmapped	TTCCTGAAATGCATTTAAAACCAATATTGAGTTACATGAAAGCACATACGATGCAAACGT
4272	70	150	MW2_CDS_00599	MW0111	FALSE	unmapped	AGCTCATTTAGATTTTGTTGGCTTAATTCTAGTGGCAACTATTGCTACAACAGTCATGCT
4273	70	148	MW2_CDS_12157	MW2300	FALSE	unmapped	ACGTGGCTATATCGAACAGCTTTGGCGTGAGGAAAAATATCATGTATTGTTACACAGTCA
4274	70	146	MW2_CDS_10559	MW1994	FALSE	unmapped	CTTGTCGAGACGTTTGCCGCGAATCTATCATGATGGTGATCAACGTTTTGTAACAAATGA
4275	70	144	MW2_CDS_01841	MW0335	FALSE	unmapped	TTGACGAAGTACTATATAGCGGGCAAACTGGCATGCTTAGTTTAAGACTTAACAAGGCCT
4276	70	142	MW2_CDS_06097	MW1133	FALSE	unmapped	TGAATCTTACACTTCTAAACGTAAAGCATCAGGGAAACAAGGTGACCAAGATGCCCATGA
4277	70	140	MW2_CDS_03446	MW0632	FALSE	unmapped	TGCAATATGTAGTGCCTAAAGGAACAATTTTTGCTTCTTCAATCGAATTTTCAAATACTT
4278	70	138	MW2_CDS_10457	MW1974	FALSE	unmapped	ACGCATTTTATCATGAAATAGAGCAAAATAACTTTGCGAAATATTTTGTCTTAGAATTTG
4279	70	136	MW2_CDS_06205	MW1152	FALSE	unmapped	ACATTAAATGTTGGGGATGCGATTGTAGTTGGTAATACTTACGGCCGTATTCGTGCAATG
4280	70	134	MW2_CDS_07597	MW1431	FALSE	unmapped	ACTTATGTATCATCTATTCTCCAGCTGGACAGTTAATTAATATTCCGAAGTTAGAAGCGT
4281	70	132	MW2_CDS_00091	MW0017	FALSE	unmapped	CGTTGTAAACCAATCTTTGAAGAGTTACCAGGTTGGACAGAAGACGTAACAAATGTGCGT
4282	70	130	MW2_CDS_11756	MW2229	FALSE	unmapped	ATAGAGGCATTCATGAAGGTGCAGAAGTTAAGCTGATTTCTGAAACAGGAGAAGCGGTAT
4283	70	128	MW2_CDS_03213	MW0591	FALSE	unmapped	AGTGCAATAGGTATCGTGAAATTCCAAGATGTTTTCTTAAGAAGTCACGCTGCGACAAAA
4284	70	126	MW2_CDS_03555	MW0652	FALSE	unmapped	AAGAAGAATTGCATAAACTTGGCCCCGTTAGCCCACGTGAATGGCGTTTAATTGTTATAT
4285	70	124	MW2_CDS_02723	MW0503	FALSE	unmapped	ACGTGGTCAAGTATTAGCTGCTCCTGGTTCAATTACACCACATACTGAATTCAAAGCAGA
4286	70	122	MW2_CDS_06644	MW1241	FALSE	unmapped	AAATTGGGTACTTCTGAAGCTAGAAGTGCTGTTGATTCAGTTGTTGCAGACAAATTGCCA
4287	70	120	agr_tiling 042_F		FALSE	unmapped	TAAATGCTTTTAGCATGTTTTAATATAACTAGATCACAGAGATGTGATGGAAAATAGTTG
4288	70	118	MW2_CDS_09981	MW1872	FALSE	unmapped	GGTAAGGGTTTTGATAAAGCATACACAGACAAAATTATAGATGCATTTGGTATGAGACCT
4289	70	116	agr_tiling 104_F		FALSE	unmapped	AAACACGCTGTGTGAAATTGTTATAATGTATGAAAAAATAATGATATAAACGAAATTTGC
4290	70	114	MW2_CDS_03091	MW0567	FALSE	unmapped	CCCTCTAGATGGTCATAAAGGTACAAATATTGGTTCAATTAGCTTAGACAATATTGCACC
4291	70	112	MW2_CDS_03127	MW0575	FALSE	unmapped	TCCAGCACGAGCTATGGGCATGGTTAGTGTATGGTATAAACAAGAAGATGCTGAAATTGA
4292	70	110	MW2_CDS_12515	MW2368	FALSE	unmapped	AGGATACAGTGGTGCAACTATTTCAAACTTCTTATTAAATGGTGTAGCAGGTGGTGCACT
4293	70	108	MW2_CDS_13269	MW2512	FALSE	unmapped	CGTTAAACGTTTAGAAGTTGGCGAAGAACAAGCGTCACATTTTGGCATGACTAAGGAAGA
4294	70	106	MW2_CDS_06082	MW1131	FALSE	unmapped	AGTAAAACCGAAGAACTAATATTTGAAGATGGACCTGTTTTGGATTTAGCTGCTGCTTTA
4295	70	104	MW2_CDS_00068	MW0013	FALSE	unmapped	ATTACGATGAGCGGTGCCGATGCGAATATGACCCAAATATTAGAAGAAGGGTTTAGACAA
4296	70	102	MW2_CDS_12323	MW2333	FALSE	unmapped	TGGAGTCCAACAATTCAAAAAAGGTTTTAACGCACATGTAGAAGAGTATATCGGCGACTT
4297	70	100	MW2_CDS_11440	MW2168	FALSE	unmapped	TTTACAACGTGCTTCATTACGTCAAGGTACGCATGCTGTTAAGAATCGTTCAGCAGTAAG
4298	70	98	MW2_CDS_11239	MW2122	FALSE	unmapped	TGGCAAAGAAGATTTTACATCATTTTGTCAGTTAAACGAATTGACTGCAGTGGTCATGGA
4299	70	96	MW2_CDS_07564	MW1423	FALSE	unmapped	TCAAATAAAAGATGAAGAAAAAGAGAGAGAAAAAATCAGAAAAAAAGCGATTTTGAACCT
4300	70	94	perR_tiling_068_R		FALSE	unmapped	TTGTCGTTGGTTATCATATGATAGTTTCATCTTTTTATAATCATCTAAAATGAAAGCTAA
4301	70	92	MW2_CDS_01793	MW0327	FALSE	unmapped	AAATGCAGAGCCTTTAAAACACATTGATGACGCTACGAAAATCATAATGCGAGGTGAAGT
4302	70	90	MW2_CDS_02278	MW0421	FALSE	unmapped	TGTAGGTCCTGCATATCCACAACAGGATATGTTAACTGAGTTAAATGGATTTCGCGCATT
4303	70	88	MW2_CDS_09936	MW1863	FALSE	unmapped	TGTATTATCAGATGATCAATTGGCTGAGCTAAACATTCGGCTACACGAGGCGCTACAATA
4304	70	86	MW2_CDS_02732	MW0504	FALSE	unmapped	AAGTGCACAAAAAATAATTTCACGTACGATCGATCCAGTTAAACAAGCTGTACTTTCATT
4305	70	84	MW2_CDS_02002	MW0368	FALSE	unmapped	ACCAGCTTGGGTTTTATTCCAAAATTTTAGTTTTGGAGATTTGTCTACTTTTTATAGAAC
4306	70	82	MW2_CDS_05634	MW1047	FALSE	unmapped	AAAGGTAAGCTTAAGATCACCGGTGGCGGTAATAACTACACTATTGATTTAAGCAAAAGA
4307	70	80	MW2_CDS_06714	MW1255	FALSE	unmapped	TCAACCTATCAACACAAACCCATTTTAGGTATATGTTTAGGGGCTCAGGCACTGACTTGT
4308	70	78	MW2_CDS_10452	MW1974	FALSE	unmapped	ATGTGCCACAAGTCTTTGATATTGAGCGTCGGAGTTTCAATGACAGTTCTTGGACAATTG
4309	70	76	MW2_CDS_10694	MW2020	FALSE	unmapped	ACATTACTCGCATCATCATTAGCAGTAGGTTTAGGAATCGTAGCAGGAAATGCAGGTCAC
4310	70	74	MW2_CDS_12500	MW2366	FALSE	unmapped	ATGGTGTGGTTGGTCTAGAAGAAGAAACGGCTCGTATGGATGAATACGTTGTTTTACGTT
4311	70	72	RC9		pos		
4312	70	70	MW2_CDS_05166	MW0955	FALSE	unmapped	TGCATCAGGTTCAGGAAGTAACTTTGAAAATATAGTTGAGCATGTTGAATCAGGAAAACT
4313	70	68	(+)E1A_r60_a135		pos		
4314	70	66	MW2_CDS_06204	MW1152	FALSE	unmapped	AGAATCAAAATGGCTGGTCCATCAACGCCTGTTGAAATTACAGGTATTAATGATGTGCCA
4315	70	64	MW2_CDS_07408	MW1385	FALSE	unmapped	ACATGAAGCCTTCAAGCAGTCAGTGAATAGTGGTGGTTTAGTCACAAGTGGTTCTACTTC
4316	70	62	MW2_CDS_03079	MW0565	FALSE	unmapped	AGGTGTTTACTTAGAAGTAGATAATAAAAATGAAGAAGCAGTAGCTTACTATAAAGAGCA
4317	70	60	MW2_CDS_09272	MW1739	FALSE	unmapped	TAAAACAAATCTTGAACGAAGTAATGAACATGAATATTATGTTGAACATCTAGTCCGCGA
4318	70	58	psma_tiling_079_F		FALSE	unmapped	TAACCTCCTTATTTCTAATCTCTCGCATAATTGCTTATGTATAAAATAAAAACCTACAAT
4319	70	56	MW2_CDS_07079	MW1323	FALSE	unmapped	TGCAGATAGCATTGAAGCTGGTTATGTGAAAAACGCAAATTTCAAACCTTATTTTGATCA
4320	70	54	agr_tiling 106_R		FALSE	unmapped	CAATTTCACACAGCGTGTTTATAGTTCTACCAATCTTTTTGGTAGTGTATGTATCAATTT
4321	70	52	MW2_CDS_09404	MW1767	FALSE	unmapped	ACGTTAGTACTTAAGGCAGCCGGAAACATTAATTCAGGTTATAAAAAGCCTAATCCAAAA
4322	70	50	MW2_CDS_03611	MW0662	FALSE	unmapped	CGCCACATGGTGGTATTATTGTAATTGTTGGTACGGATGGTGCACACTTACTTCAAACTC
4323	70	48	MW2_CDS_05582	MW1034	FALSE	unmapped	AAACCATGGCTCAACTTTCAAAAGAACAAAAAGGGCAAATTAGTCATAGACGAAATGCGA
4324	70	46	MW2_CDS_05754	MW1070	FALSE	unmapped	GCAATTAGCTGAAGAAATTGCGTTTGATAGAAAAAATTGGGTGTTTCCCATTCAAACACA
4325	70	44	MW2_CDS_11415	MW2163	FALSE	unmapped	AAACCGTGCTTCATTCCGTCGTGTACAAAAACAAGCAATCACTAGAGCTATGAAACTTGG
4326	70	42	MW2_CDS_05849	MW1087	FALSE	unmapped	GTATTAGACCTAAAGGTGCATCTCAAGATGACCAACACCGTATTACGACACCGGAAGAAG
4327	70	40	MW2_CDS_05569	MW1032	FALSE	unmapped	TTAAAACGTATGAAAGCATGGATCCCAATTGATGGAACGTATGATTTAGGTCCGGGACCA
4328	70	38	MW2_CDS_11979	MW2270	FALSE	unmapped	GGAACAACAGCTTGAAGATCAACATTTCCTAGAACATTATGATAAATTTCAAAATGAGGT
4329	70	36	MW2_CDS_13647	MW2579	FALSE	unmapped	CGCCAATGATTGCTATTGCAGTTCAACGTGCAGGAGGTAAGAGAAAAGATACTGCATTAA
4330	70	34	MW2_CDS_12644	MW2391	FALSE	unmapped	GTAATGCCTGCTGGTGAAACAGCATTCCTATCAATGAAAAAAGGTGAAACGAACTTTGCC
4331	70	32	MW2_CDS_02651	MW0489	FALSE	unmapped	TCGAAAAGTTAGTAATGGATCTACAACCATTAATTATTCGACGCATCAAAACATTTGGAT
4332	70	30	agr_tiling 140_R		FALSE	unmapped	AGTATTGGTATTATTCTTGATAACGCAATAGAGGCATCAAGTGAAATTGATGATCCTATC
4333	70	28	MW2_CDS_12727	MW2408	FALSE	unmapped	AAAAGGTTGAGGCTCTGGCTGTATTTAGTATTATTAGCTGTTTTTATTAGCGCGTGTGGT
4334	70	26	MW2_CDS_10856	MW2050	FALSE	unmapped	TTCGAAAGTTTCATTCTACATAGTGATGAGCGTTTAAAATCTAGCCGAAAACTTGACGCT
4335	70	24	RC2		pos		
4336	70	22	MW2_CDS_05184	MW0958	FALSE	unmapped	TGCAACATTTAAAGGTTAAATCAAAAGTTGCTTATGCATTCATGGCTGCCATTCGTATGA
4337	70	20	MW2_CDS_06810	MW1272	FALSE	unmapped	TCTGCTGGCTTAACAATCGGAACTGTCGTTTCTCAAAAGATTAAAAATGAAGGCCAACCA
4338	70	18	MW2_CDS_12132	MW2296	FALSE	unmapped	TTTTGACCATCCAAATCGTATCGCAATTTTTGTAGCATTTGCGATTCTTGGTTTCGTGGG
4339	70	16	MW2_CDS_07838	MW1477	FALSE	unmapped	CATTGGCTAGTTTCTGGCGTTAAAGATCACGAACCTGTATTAGACGAGACAATTAGTCCT
4340	70	14	MW2_CDS_10954	MW2068	FALSE	unmapped	GGGCACTTACAAATGCAGCAGGATCTGGAAAGATAGAAGCTGCACAATATTTTGATGGTA
4341	70	12	MW2_CDS_08783	MW1650	FALSE	unmapped	TGTTTTGTACCAATTGGAGATAATTTTACGATGGGTATTGATGATGCAAGTTATGCTATT
4342	70	10	MW2_CDS_07822	MW1474	FALSE	unmapped	GGGAAAGATGGCGCAGAAGATAAATTGACTTATCATAGAGACGCAGCAGTGGATGAACTA
4343	70	8	MW2_CDS_11751	MW2228	FALSE	unmapped	ACGTTGCCAATCAAGCGAGTCCAAATGCTAAGACAACTATAAGAAGTCTATTGGGCGTAT
4344	70	6	MW2_CDS_05895	MW1096	FALSE	unmapped	AAAGGGATTCAAGGATGGAAAGATTACAAAGAATTAATGGGTAAAGTGGAACTTGCAGAT
4345	70	4	MW2_CDS_12238	MW2316	FALSE	unmapped	TGGGATGTTACGCAACATTAGTAACCAATATACAACATCCAGATTTTAACTACAGAACTT
4346	70	2	MW2_CDS_03157	MW0580	FALSE	unmapped	CGAATCATTATTGAGTCGAGTAAATAAACGAATCACTGAAGCAAACAACGAAATTGAACT
4347	70	163	MW2_CDS_09874	MW1853	FALSE	unmapped	AGCGTATCTTGGTGCGCCAAAGGAATTATATGAAAAAACGCCAACTGCTGATTTAGAAGA
4348	70	161	MW2_CDS_02879	MW0530	FALSE	unmapped	ATTCCAAATGAGCGTTTTGGTCAAATAGGCGTATTGCTTTATTCTGGTGATGTGACACTT
4349	70	159	MW2_CDS_02443	MW0452	FALSE	unmapped	CGTTTGCCAAAAGATGTGAAAGTAGAAATTGAATTAGTAAGTAAAATTAAGGAATTATAA
4350	70	157	MW2_CDS_09039	MW1696	FALSE	unmapped	GGGCGTCGGTACACGTAATGAGGTCAAACAGTTACTTAAAAAAGGCCTTGTAAATGTCAA
4351	70	155	MW2_CDS_04312	MW0794	FALSE	unmapped	TGCAGGTATGTGTGCATCTAGTGCTATGTTACTCCCAGGTATTTCAGGGTCATTTATGTT
4352	70	153	MW2_CDS_13755	MW2597	FALSE	unmapped	CAAGCAGAACATGATGAATTAGCACGTACATATGTCATTGGTGAAGATGCGCAAGTCCTT
4353	70	151	MW2_CDS_00429	MW0081	FALSE	unmapped	AACTGACGAATTAGGTGGTAGTTGGACACTATGGAAAAATTTAGCGCGACAAAGTCCTGA
4354	70	149	MW2_CDS_06834	MW1276	FALSE	unmapped	ATGGACTTGGAGCAACTAAATTAGAAGTAGCAACTAAAGTCGTACTTCCCGCAGCAACAT
4355	70	147	ETG09_48764		pos		
4356	70	145	MW2_CDS_11073	MW2093	FALSE	unmapped	TGGTTGGACCTGCGCTGCTTATACCGCTATATGTTCAAAACAGTTTATCTTTATCTGCCT
4357	70	143	MW2_CDS_00707	MW0132	FALSE	unmapped	TGAGACTTATTACGAGTATTTTTAGTCACCCGACACCATTAATCACATTGATTTCTATGA
4358	70	141	MW2_CDS_10432	MW1970	FALSE	unmapped	TCCTGGTAGAATTAATACGCCTTCAGATGTGCAAGTACATCAAATTGACTTAGGTATAGA
4359	70	139	MW2_CDS_07824	MW1474	FALSE	unmapped	AGACTGCTATGGTGATGAAGCAAAGTTAGGTAAAAAAGTGGGCAGCGATCTTGAAAATAA
4360	70	137	MW2_CDS_11980	MW2270	FALSE	unmapped	ATGACAGATGCATTACAACAAAAGATTCATATCGAATTACTAGATTTATTAGATGATGTT
4361	70	135	MW2_CDS_08024	MW1511	FALSE	unmapped	AAGGATAATGTTGGACCATTTAAAGATAAGCTTAGTGAAAATGGATTAGCGCAAGAAGGT
4362	70	133	MW2_CDS_11857	MW2248	FALSE	unmapped	AAGTGTGTCTATCGTGTTCATTTTTATTGCATTAATGCTTAAATGGTGGCTTTTACTTGT
4363	70	131	MW2_CDS_10682	MW2016	FALSE	unmapped	ACCTCATGCTATTAAAACGGGGATGATTGCTACAGCAGATACTATGGAAACGATTCGTCA
4364	70	129	MW2_CDS_09913	MW1859	FALSE	unmapped	ACAGCAATTTCTGCATACAACTTAGGTTATAAAATTTCAGTACCTGCTGAGGGAGTGGCT
4365	70	127	MW2_CDS_04841	MW0892	FALSE	unmapped	AACAAAACATATGTCATTATGGGAATCGCTAATAAGCGTAGTATTGCTTTTGGTGTCGCT
4366	70	125	MW2_CDS_10842	MW2048	FALSE	unmapped	AAAGCCATCAACATTACATGGTGCTGAAGTTTATGCTAGCGATTTAAGAGCAGGAGCTTG
4367	70	123	MW2_CDS_00445	MW0084	FALSE	unmapped	GAAGACAACAACAAACCTGGTAAAGAAGACGGCAACAAACCTGGCAAAGAAGACGGCAAC
4368	70	121	MW2_CDS_00940	MW0173	FALSE	unmapped	TAATGTCTTTGGGAAATGGCTTTAAAAAACTGCTGCTGATCAATTTTCAGATGCTGGCGC
4369	70	119	MW2_CDS_11476	MW2175	FALSE	unmapped	TATTGTCGGTCTTATTTCTGGTGCATTATGGGCGTTTGGACAAGCGAATCAGCTTAAATC
4370	70	117	MW2_CDS_00803	MW0149	FALSE	unmapped	AAAGTTGAACCTTGAACACACTTATGTTGATGGACAATTGGTTGTCAGTGGACGTATGCC
4371	70	115	MW2_CDS_03620	MW0663	FALSE	unmapped	CATAGAGAACCAGGTGTTTTTGGAGCAGCATGGTTGAATGATGCTCTACATACCGAAATG
4372	70	113	MW2_CDS_05009	MW0927	FALSE	unmapped	GGAAGACACGACCATCAATCGCGTAAGTTGGTTAGAAAAATGGCAACGCTTAGAGAAAAA
4373	70	111	MW2_CDS_05128	MW0948	FALSE	unmapped	ACAAGACCGCTTAACTGAAAAAGAAACATTAAAAAGTGCTGGTACCAAAGTTGTCCCGTT
4374	70	109	MW2_CDS_02647	MW0488	FALSE	unmapped	TAGGACAATCACCAACGCTAAGCGCCATTGCAAAAGAGAATTTAGAAGAAGCTAGAATGC
4375	70	107	MW2_CDS_02235	MW0413	FALSE	unmapped	CTAGCTATATTTCCGGCGTTACATAGTTTTGGCTATGAACCACAAGAAGGGCCTGGATTA
4376	70	105	MW2_CDS_05339	MW0988	FALSE	unmapped	AGTGTTAGGTGCATCACTATTTTTCAACTCAAACGCTGACGATTTAGGTGGTTTCTATGA
4377	70	103	MW2_CDS_06131	MW1139	FALSE	unmapped	TAGGCGGAATTCGTGATATGAAATCAATGCCTCAAGCATTATTCGTAGTTGACCCACGTA
4378	70	101	MW2_CDS_05299	MW0981	FALSE	unmapped	TCAAAGTCAAATGAATATGATATGGAGCCATTAATATTAACTTTAAAGCCTGGAGCATCA
4379	70	99	MW2_CDS_13179	MW2494	FALSE	unmapped	TGTAGCTGAAAAACAAGAACAACATGCATTGCGTCAAGACTACTTAAGCATGATCCGAGG
4380	70	97	MW2_CDS_09455	MW1776	FALSE	unmapped	ACTTACTATTAGCTCCAAAATGGTACATCGCATTTGTGATGGTTGCTTTGCCTGTGTTAA
4381	70	95	MW2_CDS_07903	MW1489	FALSE	unmapped	ACAGGGTGTCAAATTATTTGGAGCAAACGTCATTTTATCTCAGTCAGGTTACACAGGTGA
4382	70	93	MW2_CDS_02731	MW0504	FALSE	unmapped	ATATTCCAGTACGGTGAAGAAATCATGCCAGGTGGTTCTCAAGAAATGATAGATGCTGGA
4383	70	91	MW2_CDS_01484	MW0273	FALSE	unmapped	ACCGGTTGAGTGGGAAAAGGTATATACAATTGCTTATGTAGATAATCAAGGTGGAGAGGT
4384	70	89	MW2_CDS_04598	MW0848	FALSE	unmapped	TGTTTTCTTAGTAGGTATGAATGATGGTACGATGCCACAACCAGTAACTGCGTCAAGCTT
4385	70	87	MW2_CDS_11404	MW2160	FALSE	unmapped	AACTCGTCCTTTATCAGCAACAAAACGTTTTCGTTTAGTAGAGATTGTTGAAGAGTCAGT
4386	70	85	MW2_CDS_01009	MW0187	FALSE	unmapped	TGGCGGCTGGTAAAGCATTTATCGAAACATATCAACAACAACATCCTGATGATGAAGTGA
4387	70	83	MW2_CDS_08527	MW1606	FALSE	unmapped	TGAAGATGCATTAAAATATGTTCGTGAACGCGCAATTGAACAACATGCAAAGCCAATTGA
4388	70	81	MW2_CDS_12179	MW2305	FALSE	unmapped	AGGATTATTTGTTGAAGGCTTTGATACAGAGACTAAGAAAAGTTTGAAAACTGCAAAGCA
4389	70	79	agr_tiling 195_R		FALSE	unmapped	TAGCAAATGCACTGTATAGCTGGCTTTTTAATTGTTTAATAACAAAATTAAATATGACGC
4390	70	77	agr_tiling 193_F		FALSE	unmapped	GCTATACAGTGCATTTGCTAGTTATCTTGTTAAAATCCAACAAGATTTACAATTGAATAC
4391	70	75	MW2_CDS_05108	MW0945	FALSE	unmapped	GCATAAGTGCATTTGATAAAGAAGATGGAGATTTAACCGATAAAATTAAAGTCGATGGCC
4392	70	73	MW2_CDS_12483	MW2363	FALSE	unmapped	TACTATGATATGAGTCGCTCATTAAAGTGGCGTGCACAACGTCGAAAAGAACGTCAAGAA
4393	70	71	psma_tiling_079_R		FALSE	unmapped	ATTGTAGGTTTTTATTTTATACATAAGCAATTATGCGAGAGATTAGAAATAAGGAGGTTA
4394	70	69	MW2_CDS_10506	MW1983	FALSE	unmapped	CAAGAACACATTTAGTATCCCCTGCTATGGCAGCAGCAGCAGCTATTCATGGTAAATTTG
4395	70	67	MW2_CDS_02868	MW0527	FALSE	unmapped	GCAGACCGACCATTAGATGAAGCAGCATTAGCAAAGTTAATCGATACATTTAGACATACA
4396	70	65	MW2_CDS_03647	MW0668	FALSE	unmapped	CGCCTTAACTTTAGGTGCAGATGACTATGTCAAAAAACCATTTAGTCCAAGGGAACTCGT
4397	70	63	MW2_CDS_09371	MW1760	FALSE	unmapped	AGACGAACCATCTAATGGTTTAGACCCATATGGAATCCAAGAACTTAGAGAACTTCTAAA
4398	70	61	MW2_CDS_03210	MW0591	FALSE	unmapped	GCAACGGCGCTTATATGTATCGAAAAAATGATGCTCACACACATGCATCAATATTATTAA
4399	70	59	NC_S_057		FALSE	unmapped	TTTTCCTGTACCGAAAACATCATGCCATTCGTTTCGTTTGTCTAGAAATGCTTGAGCGAT
4400	70	57	MW2_CDS_10229	MW1931	FALSE	unmapped	GCTACGACTTAATGATAGACCCGCGTTTTATTGAAATGACGCTTGAAAGACATCCGCATT
4401	70	55	MW2_CDS_07346	MW1372	FALSE	unmapped	TGATGGATGCCCTACAGATTCTATTAAAATTGCAGACGAATCATTTGATGGGGACGCTTT
4402	70	53	psma_tiling_028_R		FALSE	unmapped	TACGTCCCACCAAGAACATCCTATACAAAAAACCAAGACCATTTATTTGCAACAAACTAA
4403	70	51	MW2_CDS_09683	MW1818	FALSE	unmapped	AAAAATGGTTTTATGATACAGCACCACAACGTGTTGAACGAAGAAAAGCACGTCGCATTG
4404	70	49	MW2_CDS_05070	MW0938	FALSE	unmapped	GCCCTACCTGAAATTTTCAATAGTGTTGATGTTTTCGAATCAGAGTTACCATTTTCATGG
4405	70	47	MW2_CDS_06891	MW1286	FALSE	unmapped	GGCCTGTCAAGTCATGTTGCTGATAAAGAACAAGGTCATTCTTGTGGTGAAGCATTACAA
4406	70	45	MW2_CDS_10606	MW2002	FALSE	unmapped	GCTGGTGCAACAACAGATACATTTCCAGGCATTAATAAATGGTTGATACCAATTGGCACA
4407	70	43	MW2_CDS_02350	MW0434	FALSE	unmapped	AAATGGCTCAAGAACAAGAAAAACTTAAAGAAGAGCGTATTGTAGGAACAGCTGGCGGTG
4408	70	41	MW2_CDS_13865	MW2617	FALSE	unmapped	ACGTCGTGAACACATTGAAGAAGCTGAAGTCGATGCATTACTTGAATCTAGAGGATTGGT
4409	70	39	MW2_CDS_07423	MW1388	FALSE	unmapped	TGGGATTCGATATGCTAATACGCAAACAAATGAAGATATCGAAACACAGGATAAGCTGTT
4410	70	37	MW2_CDS_09622	MW1807	FALSE	unmapped	CATTCTTCAACAATGGATAGAACAGAAGAAGGGCCCATTCGCGCCAGATTTTATCAAAGT
4411	70	35	MW2_CDS_06300	MW1169	FALSE	unmapped	GCAGATGCATTGTCTGCGGCTCGTCCAGGTGCAAGAAAAGAAACATTAGAGAATTATATT
4412	70	33	MW2_CDS_00204	MW0038	FALSE	unmapped	TGGAGTGAAAAACGTCGTAAAGGGCTGAATGATAAACCAGTGATAGCTGAAGGTAAGCAT
4413	70	31	MW2_CDS_13296	MW2516	FALSE	unmapped	AGAGCAAGAGTGACTGAGTCAAATTTAAATTATGTAGGTAGCATTACGATTGATTCAGAT
4414	70	29	MW2_CDS_04945	MW0913	FALSE	unmapped	CGCTAAAAATGAGAACGTAGCAATCTATAAATCAACTTCAAATTATACAAACAAAAACGT
4415	70	27	MW2_CDS_02838	MW0522	FALSE	unmapped	GCAAGTCCTGAAATCGATGGTAAACAACACAGCTTTTTAACAGTCGAACCATATTGGACA
4416	70	25	MW2_CDS_02465	MW0456	FALSE	unmapped	AGAACGTACTGTTGAAGTACCAGTTCAATTAGTTGGTGAAGCAGTAGGCGCTAAAGAAGG
4417	70	23	MW2_CDS_04258	MW0782	FALSE	unmapped	AATGGCAAGCAGATATTGACATTGAAAAACATCAACGAATCATTACACACTTGCAACAGT
4418	70	21	agr_tiling 138_R		FALSE	unmapped	AGTAACTCGCATTAATTTGAATATGATCGATTTAAGTCGCAGTATTGGTATTATTCTTGA
4419	70	19	MW2_CDS_10812	MW2042	FALSE	unmapped	TATCCACAAAGCCGTGTAACAGACCATCGTATAGGTCTAACGCTTCAAAAATTAGGGCAA
4420	70	17	MW2_CDS_12716	MW2406	FALSE	unmapped	AACAACGAAAGGTAATTTTGTTGTTAGAGAAATAACCGAGGATAGTAAAGGGTATTCACA
4421	70	15	MW2_CDS_10746	MW2030	FALSE	unmapped	TGAGCAATTGAAAATGGTTGACAGTAATCCAACTCAAACAGCAGAACAACGTCGTGAGTT
4422	70	13	(+)E1A_r60_n9		pos		
4423	70	11	MW2_CDS_13348	MW2525	FALSE	unmapped	AAACCAATCGACAACTTAGACAGTTTATTAGACCGTGCAAACGAACGTCACATTTTTGGT
4424	70	9	MW2_CDS_11596	MW2197	FALSE	unmapped	TGTCTGCAAATACTAAAGATGTAGATGCATTAAAAGACAAGAATAAAGCGCATGATACAT
4425	70	7	MW2_CDS_09929	MW1862	FALSE	unmapped	ACGCACACAGGTGAAATTATACGTCTAATTCAAGAACTTGCGCATGATTTTCCAACAGGT
4426	70	5	MW2_CDS_03226	MW0593	FALSE	unmapped	TGGGAAATTAACACTGAAAAACAAGGTACACCTGAACAAATGAGACAAGCTATTGAGTTT
4427	70	3	MW2_CDS_10123	MW1905	FALSE	unmapped	GGCAACATTATTGAGGTACGCTCAAATGATAACAACGAAATGGTCATAGAGGGGTATGCG
4428	70	1	MW2_CDS_04836	MW0892	FALSE	unmapped	TCATTCAATCGCATTTGCTAATATGGAAGACTTACGCGGACGCTTTTCTGAAACTTCACG
4429	69	164	MW2_CDS_00519	MW0097	FALSE	unmapped	ATCAGCCATTGAGTTATAAGGAAATTGAAGCGGTTGTTCATAAAGGGGAAACTGTGCCAG
4430	69	162	MW2_CDS_13395	MW2535	FALSE	unmapped	TGCCAATCGTTTATTCTGGGCATTTGCATTGTGCTTATTGCCATTTTCATTGATGCTAGT
4431	69	160	NC_A_068		FALSE	unmapped	AGCCCTGTTACAAAATATTCGCTACAAATTATTCAAATCAACAACAATAACCATCAACTA
4432	69	158	MW2_CDS_01520	MW0279	FALSE	unmapped	AGTTTGGTGTTTTACCAGAAACGGAATATGAAATGGAAGAAATTCGAGAAGTAGAGAAGT
4433	69	156	MW2_CDS_04874	MW0898	FALSE	unmapped	GCGAAAAGTGCAAATGCACAAGTAGTTATGATTTGTGGTAAGAGCAAAGAGCTAAAGCGT
4434	69	154	MW2_CDS_01245	MW0229	FALSE	unmapped	GTTGGCTTTAGTCGTACAGGTAAAAAAGGTGGTCCATTTATCGATTCATTAAACCATCGT
4435	69	152	MW2_CDS_06618	MW1236	FALSE	unmapped	AGTTTTGTTTGGTTTAGTGTCTTTGGTGTATTAGGCATCGAGACAGGTAAGAAACACAAA
4436	69	150	MW2_CDS_08785	MW1651	FALSE	unmapped	AGAAGCTGGCATGGTTATTACAATCGAACCAGGTATTTATGTACCTAGTGTTGCAGGTGT
4437	69	148	MW2_CDS_12194	MW2308	FALSE	unmapped	GTATTCGATCAGGTGTATTCATTGCGCTGGCAACATTCTTAAGACCAATAGGTGGCATTT
4438	69	146	MW2_CDS_10108	MW1902	FALSE	unmapped	ATTGCTTATTTGGATAGGGATTTATCGCTTGCGCCACATATGGTTTTAAGTACGGTGCAT
4439	69	144	MW2_CDS_13785	MW2602	FALSE	unmapped	TGCTCATATTGAATGGAAACAAGTTCGTTTTGTTGTTAAATTCATTCTGTTTTTCACAAT
4440	69	142	MW2_CDS_12003	MW2274	FALSE	unmapped	ACCTGTTAAAATCACTCTAGAATCAGAACCGTCTAAACAAGTTGTTCCTGGAATGAACGC
4441	69	140	MW2_CDS_01533	MW0281	FALSE	unmapped	TAGCAGCATCAGGTGTAATGACTACAGATGTGTCAACAACAGTTAATGGTGAGGTTGACC
4442	69	138	MW2_CDS_11298	MW2137	FALSE	unmapped	AAAAAATTATTTGTATATGGTGGCGCTGAACATCCACACGCTGCACAACAACCAGAAAAC
4443	69	136	MW2_CDS_03452	MW0633	FALSE	unmapped	ACGCAAAAAGGTAATGCGCGTACAGTAGATTTATGTTTAGATGTTTTAGCGTTACCAAGT
4444	69	134	MW2_CDS_05945	MW1105	FALSE	unmapped	CGACTTGAAGAAGCAGGTGTCGACGGAGTTCATTTTGATGTTATGGATGGTCAATTTGTG
4445	69	132	MW2_CDS_01877	MW0343	FALSE	unmapped	ACCAAGAAGAGGCGGACGTCGTCGTAAAAAAGTATGCTATTTCACAGCAAATGGTATTAC
4446	69	130	MW2_CDS_12506	MW2367	FALSE	unmapped	AATGGTCTGAAGCATGAAGAAGTCATTGCGCAGTATGTTGCTCAATCACAAATTGTCAGA
4447	69	128	MW2_CDS_02353	MW0435	FALSE	unmapped	AGGTTTATATCACGTTTTACATGGGTCTATTTCGCCTATGGATGGCATTGGACCAGAAGA
4448	69	126	MW2_CDS_12661	MW2394	FALSE	unmapped	GTTCAAATGCCACAAGCCCATCGTGTTGTGCCAACAACAATTAATATGGGTAATCATTCA
4449	69	124	MW2_CDS_08918	MW1674	FALSE	unmapped	CAGCGAATGCAGATCAAGCGTCAAGCCAACCAGCTCATGAAACAAATTCTAATGGTAATA
4450	69	122	agr_tiling 173_F		FALSE	unmapped	CAACAATTGTAAGCGTGTATGTGCAGTTTCTAAACAATCTATAATTCGAGTTCTTAATTC
4451	69	120	MW2_CDS_12007	MW2275	FALSE	unmapped	GGATACCATCAACTCAAAGCATAAAGAAAAATTCCAATTTCTTCTAAGCGCGCTACATCA
4452	69	118	MW2_CDS_02258	MW0417	FALSE	unmapped	GAAGCGGCGAAAGCGATGGGCGCTTCACCACTACAAATCATTAGATATTTTTTAATTCCT
4453	69	116	MW2_CDS_10227	MW1929	FALSE	unmapped	AGTAATGTTGAAATTTCTAAAAGTATGGCAATTAAACAATCTTTAAAACCTAAGTACCAA
4454	69	114	pMW2_009		FALSE	unmapped	CATTTAAGGCTTTTATATAAAAATGAGGTACTTGATTTTTATAAAGATGGAAAGATGGCA
4455	69	112	MW2_CDS_03196	MW0588	FALSE	unmapped	CGGGGAAAGTACTTATTTTCCAAGGTGCATTGCAAAATGGCAATTATATTGGACTAGCGT
4456	69	110	MW2_CDS_08650	MW1628	FALSE	unmapped	ATTCAATTACAAGTGGACAACAGTTATCCTTTGAAGAAATGCGTAAACAAGCACGCTCGT
4457	69	108	MW2_CDS_12452	MW2358	FALSE	unmapped	TTAGGTGGCGCTGTTGCACCATTAGTTGGCTTAAAAGGCGAATTTAATACATCACCATAT
4458	69	106	MW2_CDS_06505	MW1214	FALSE	unmapped	TGTCGGCGAAGGTATGAATAAAGTCATCGGTACTGCAAATAAAATTACACATGCCTTAGC
4459	69	104	MW2_CDS_04440	MW0819	FALSE	unmapped	GCTATTAAAAAGAAAATACCCAAATATATCATTTAAATATACGTATATAGATATTACAAA
4460	69	102	MW2_CDS_00957	MW0177	FALSE	unmapped	TCAAAGAATGGTAAAGAAAAATAAAATAAAAAATAAGATGTTCCATAATTTTGTAACAAC
4461	69	100	MW2_CDS_13927	MW2629	FALSE	unmapped	GCCGCGACATCAACTTTTCTTAGAGCCTGAAGGTCGTAATACAAATGAAGTATATGTGCA
4462	69	98	MW2_CDS_12300	MW2328	FALSE	unmapped	TGAGCAAGTTAAAGACCGTGAATTAAGCGATTATGCTGGTGAATGGCAATCTGTTTACCC
4463	69	96	MW2_CDS_09102	MW1707	FALSE	unmapped	CTGCTGGCTTAAAACGTGTTGGCATAATTGCAGCTTTAGGAGCTACAGTTATGTTAGGTT
4464	69	94	MW2_CDS_11893	MW2254	FALSE	unmapped	AGTATTGCTGAGATGAATCCAACATATGACGCTGACAATAGAACTGCTAAGCTCGTTGCT
4465	69	92	MW2_CDS_04379	MW0806	FALSE	unmapped	ACATTCATCAAATGTTACCGCATCCGATTAATATGGTAAGGGTTAGACTTTTTGGTGTGA
4466	69	90	MW2_CDS_09414	MW1769	FALSE	unmapped	TTAACGGTGGTACTCACGATAATCCAGATGGAACAATCGCTCCGAAAAGTCATATTCACA
4467	69	88	perR_tiling_071_R		FALSE	unmapped	AATGTATTCAGATAATTGTTTAGCTTGAACACCTTTTCCATTAGTTAAAAGTATGCCGTG
4468	69	86	MW2_CDS_09611	MW1805	FALSE	unmapped	TGCTTTTCACGAGCAAATTTTAGCTAGCCTTTCTAAAAAAGCACGTTATAATGTGACACA
4469	69	84	MW2_CDS_08986	MW1686	FALSE	unmapped	TGAGCATACTGCAGAAACAGCAGTTTATTATGCAGTCGATTTAGGGAAATCATATCGTCT
4470	69	82	agr_tiling 091_R		FALSE	unmapped	ATGATTATAATTACGTTTTATTTGTAATTGTTCAAGTTTCATTAATGTTCTTTATATCTG
4471	69	80	MW2_CDS_06695	MW1251	FALSE	unmapped	TAAGTAAAATTGCTATGGATGTTGAAGCGAAGCATAGTCAAAATGGTATAGCTGAATGGC
4472	69	78	MW2_CDS_10079	MW1895	FALSE	unmapped	TGGATTACTAACGAGATGATGCGTGTTGCGAGTCGTGAATCCAATTATACAGCTAATGCA
4473	69	76	MW2_CDS_13237	MW2505	FALSE	unmapped	AACGAGGAAAATATAGATTCAGTTATTTTTAAAGGTTATTCTGATCAAGATGAGGTTAGA
4474	69	74	MW2_CDS_12223	MW2314	FALSE	unmapped	CCAAGTTCTAAGCCTAAAGGTTCTGGACTCGGTTTATATGGAATGAATGAGCGAGCTGAG
4475	69	72	MW2_CDS_12985	MW2457	FALSE	unmapped	TAGCGTGTGTCATGCCGTTTTACCACAAATTGAAGACTTGATGCAATCATATCCCAATGT
4476	69	70	MW2_CDS_07608	MW1434	FALSE	unmapped	AGCTACAAAAAATCTTGTCTCTATGACACGGAAAGATTGGAAAGAAAGTCATCGAACTAA
4477	69	68	MW2_CDS_06685	MW1249	FALSE	unmapped	ACGCGTGCGACGTCAGCAACAAGTGATGCAAACATTGAAAAAAGAAATGGTTAATTTTAG
4478	69	66	MW2_CDS_06790	MW1268	FALSE	unmapped	ACGAACCAGTTGCATCATTGGATGCTTTGAACGGTAATCAAGTGATGGATTTATTACAGC
4479	69	64	MW2_CDS_10965	MW2070	FALSE	unmapped	AAAGAATGCCACAACTACAAAAACATTTGGTTATAAACGTTTCGAAGTACTCGCAGCGTT
4480	69	62	MW2_CDS_05216	MW0965	FALSE	unmapped	ACGGTAGTGATGAATCTGACGCCATTCAAGCAATCAGTGACGTCTTATCAAAAGAAGGAT
4481	69	60	MW2_CDS_10577	MW1997	FALSE	unmapped	TCGAAGATGATGACAATGATTCAGGTAGTGTGCCGATATTGCCGTTTATTAAACGAGACA
4482	69	58	MW2_CDS_05520	MW1023	FALSE	unmapped	GAATCGAAGTCATTAGCCATTGCAGTGGCAAGCATAATCTCTCGATACGCATTTGTTACA
4483	69	56	MW2_CDS_13173	MW2492	FALSE	unmapped	AGCATTTCTAATGTCATTAATGAAAAGGTTCTGCGTAATATTTTCATTTCAATTGCGAGT
4484	69	54	MW2_CDS_11887	MW2253	FALSE	unmapped	ACCATAAAAAACGCAAACACTCCGAACAAGTACATACATTCGTACAACAATGCCAAGATT
4485	69	52	MW2_CDS_06507	MW1214	FALSE	unmapped	CGAAGAAATCACTTATCGAGAAATGCGTGAATTATCTTATGCTGGTTTTAGTGTTTTCCA
4486	69	50	MW2_CDS_09440	MW1773	FALSE	unmapped	TGACAAACGTGCTGATGAAGAAGCTGCAAAATATGGTATTCAACTTACACATGTGAAACA
4487	69	48	MW2_CDS_05472	MW1014	FALSE	unmapped	TGCAGCTGGCATTGTGTTAGCAACTATTTTACTTATTTCGGCACATTTATACAGCAGAAA
4488	69	46	MW2_CDS_06369	MW1183	FALSE	unmapped	CCACAATCAGAAAGTTATGCGACACGAGTTGACTCTACTGAGGGTGTTTATGTTGTTCCA
4489	69	44	MW2_CDS_13111	MW2482	FALSE	unmapped	ATGATCCTTCTATTTATGTGTATGTACCAGCGGTCGCTGATAAATCACTTGCGCCAGAAG
4490	69	42	agr_tiling 125_F		FALSE	unmapped	GTATTCTGAAAGAGTCGTCAAGATATTGACATAATCATGACGGAACTTGCGCATTTCATT
4491	69	40	MW2_CDS_05136	MW0950	FALSE	unmapped	TGACAGTGGATGAGGTTAGTGATGAAAAGGTACACAACATTATTACAACTCTAAGTGAAA
4492	69	38	MW2_CDS_12477	MW2362	FALSE	unmapped	AGCATCCTGAGGCACATAAAAACAGTAAATTTAAGTTGATTGGTGGCAAGCCTATTGCTT
4493	69	36	MW2_CDS_06743	MW1259	FALSE	unmapped	ATCACAGATATTGAAGAAAGAAGGTCGACTTCCGGATGCAATTGTAGCATGTATCGGTGG
4494	69	34	MW2_CDS_03291	MW0604	FALSE	unmapped	TGCCGCGGCATTAATTTTAGCTAAGAAGGTATCAAAAAACACCAGCGATTTCGTTGATTT
4495	69	32	MW2_CDS_05686	MW1059	FALSE	unmapped	GCGTTTGGCAACAAAGACTTATACATGGTCAATGAGTTAAACGGTCAAATGATTGATGCA
4496	69	30	MW2_CDS_02919	MW0538	FALSE	unmapped	AGGTGTAATTAGTGGTACAACTTCAATCAATGTTAACTGGGCTGGCTGGTTAATATTTGC
4497	69	28	MW2_CDS_06214	MW1154	FALSE	unmapped	ACCGGTATGTATAGGTAATGCAACGAGAGTTAGTGATTATGTTATGGATATGGGCAAAGC
4498	69	26	MW2_CDS_07635	MW1441	FALSE	unmapped	CTCGCTTTCTTTTCTGTAGTTTCTGTTTTTATTTTTTTATTAACTCTTAGTCTGTTTTCA
4499	69	24	MW2_CDS_07125	MW1331	FALSE	unmapped	TATTATTGCTAAATGGTTTACATGGGGCATTCCGCTTCACGAAGGTCATTTATTCGGCAT
4500	69	22	MW2_CDS_05958	MW1108	FALSE	unmapped	TGCTAAAGGCATCAAAGTAACTGAAAATAATGGCGTAGTGGATATAGATATGTACATTAT
4501	69	20	MW2_CDS_01362	MW0250	FALSE	unmapped	CCATATGCCATTGTGGCAGTTGCGATGATTCGTTTAGGTGAAAAAGCAACATTACGTTTC
4502	69	18	MW2_CDS_00362	MW0069	FALSE	unmapped	TGCAATAAGTGGATCTCAAACAGACAAGAATGAAACAACTGAAGAATTAAAAGGGGCAAA
4503	69	16	MW2_CDS_06927	MW1294	FALSE	unmapped	ACAAAATGCGATTGAAACTGCAACAGAAAATGAGCGTGGCATTGTTGACCTTGATACATT
4504	69	14	MW2_CDS_08855	MW1663	FALSE	unmapped	CCAACATTTTGTTGTGATACATGATGAAACAATTGATAGAACATCGGATGGTAAGGGGCG
4505	69	12	MW2_CDS_01822	MW0332	FALSE	unmapped	CTTAGTAACTAAATTCGGTTGGGTGCAATCATATGGTTCACGTGCCGTAAAACCACCAAT
4506	69	10	MW2_CDS_11071	MW2093	FALSE	unmapped	TACATCGCCATCGCATTTAACTGCAACTGAAATTAAACAGCAATCCATTGCTATAGGGGT
4507	69	8	MW2_CDS_08176	MW1538	FALSE	unmapped	AGAGCAAAATGTATTTTTACTGACTGAATACATTCAGAAAAGAAAGAAAGAACAAGCAAT
4508	69	6	MW2_CDS_02293	MW0424	FALSE	unmapped	CTGTTCAACAATACTCACTTTATTGCTCGTTACAGGCTGGCATATGCGCACACTCATTAC
4509	69	4	agr_tiling 160_R		FALSE	unmapped	AAAAGCCTATGGAAATTGCCCTCGCAACTGATAATCCTTATGAGGTGCTTGAGCAAGCTA
4510	69	2	MW2_CDS_11514	MW2183	FALSE	unmapped	AAACCATAAATGTGATGAATCAAATTCATAAAATATTATTAAAGGAGACACACAATGACT
4511	69	163	MW2_CDS_08908	MW1672	FALSE	unmapped	CTGCATACCTTATCGGTTTGTTGCAAAGCCCTTATGGCTATACACCCTACGAAAAAGATG
4512	69	161	NC_A_030		FALSE	unmapped	ATTTGCGGTAGTGAGGGGATTTTTATTGGTGCGGCTATATGTCACCTATTTTGTATTGCG
4513	69	159	MW2_CDS_05465	MW1013	FALSE	unmapped	TCATCATCGCGACATTCAGTAATTCTGCAAATGCCGCAGATAGCGGTACTTTGAATTATG
4514	69	157	MW2_CDS_02019	MW0373	FALSE	unmapped	CAGGAGTAGGAACAGTTACTATTCCAGTAATTGGGACAGTTAGTGGAGGCGTAGTTGGAG
4515	69	155	MW2_CDS_04861	MW0896	FALSE	unmapped	ACCAGCAGTAGAAGTTCATGCTACAAAAGCTTCTAGCTTCAAACCAACGAACAATGTGAT
4516	69	153	MW2_CDS_10176	MW1918	FALSE	unmapped	AGCCGGATATCGACAACTTAATTAAAACGGTATTAGATGCTTGTAATGGCCATGTATGGA
4517	69	151	MW2_CDS_11220	MW2119	FALSE	unmapped	CTGTGATATTGGACTGCTCGGGTGCAACTTTGCAAACAGTTTTGGAAAATCCATACAAAC
4518	69	149	MW2_CDS_08167	MW1536	FALSE	unmapped	GGTTGGTGACACCATCACATTAGCTAGTAGACCTGCATCAGAACCATTGCAAGGTTATAA
4519	69	147	MW2_CDS_03480	MW0638	FALSE	unmapped	GGGAATAGCTACGCAACTGAAGATTGCGCTTGAAAAATGGGCAAAAACTATGAATGCAAA
4520	69	145	MW2_CDS_08850	MW1662	FALSE	unmapped	TTGATGCTGACAGCTTAACTGGTACTTTCGTACGTTTACCAGAACGTAGCGAATTACCTG
4521	69	143	MW2_CDS_06181	MW1147	FALSE	unmapped	GATGGTATCGCACGTAAAATTTTAATAGCATCACAACCCGGCAATCCACTTAATCGCTCA
4522	69	141	MW2_CDS_06587	MW1230	FALSE	unmapped	GGCAACTTGGTTAGCAATTATTTTTATAGTAGCTGCATTAATTTTAGGTTTAATTGGAGG
4523	69	139	MW2_CDS_02673	MW0493	FALSE	unmapped	TCTGCTAAAGGTACATACTTCAAATCTGTTGCTGTAACTACAACAATGGGTCCTGGAGTT
4524	69	137	MW2_CDS_13004	MW2461	FALSE	unmapped	CGGGTATATGAAAGGTGGCAGTTGGATCAACCATATTTTAAACGCAACGGTCGTATGTTT
4525	69	135	MW2_CDS_00375	MW0071	FALSE	unmapped	TACGATAAGGAAGGCTATCGTGATGATCAGTTTGATAAAAATGATAAAGGTACATGGATT
4526	69	133	MW2_CDS_02105	MW0389	FALSE	unmapped	AGGTTTCGAGCGTATGGCAGATGTCATTAATAGTGAACAAATTAAAAACATCGAAGTGAA
4527	69	131	MW2_CDS_00202	MW0038	FALSE	unmapped	TATGGCAGCAAGCAATACCACGAATACACTTAAAGACGGGACCAAGAAACGTATTCGTTA
4528	69	129	MW2_CDS_10150	MW1911	FALSE	unmapped	GCAATGATAAAGATGATAGACAAGTAACTGTGCAAGATGTTAAGAAAGTCGACAAGGAGT
4529	69	127	MW2_CDS_06162	MW1144	FALSE	unmapped	AGCTTTGGCCAGTAATAAGTCCGAATAAAACAATCGAAGGATTCATAGGTGGCTTGTTCT
4530	69	125	MW2_CDS_06048	MW1125	FALSE	unmapped	CGACACACCCACTTGCACTTATAGTAGGTATTATCCTGCTAATGGTGCTTGCCGTTATTT
4531	69	123	MW2_CDS_07188	MW1344	FALSE	unmapped	GTCGTTATGGTAGTGTGCCACACTGTGGATTTGGTTTAGGTTTAGAACGTACAGTAGCAT
4532	69	121	MW2_CDS_05990	MW1113	FALSE	unmapped	TCCTGATTTTACTATGGGGCATAGTTTAGGTGAATATTCAAGTTTAGTTGCAGCTGACGT
4533	69	119	MW2_CDS_13040	MW2468	FALSE	unmapped	CCTTATGGGACTCTAACAACGTATGGTGCTATTGCCAAAAAAGTAGGCAAGCTGCTTAAC
4534	69	117	MW2_CDS_02638	MW0487	FALSE	unmapped	TGTCATTGGCTATTGTAATTGGTAGCGAAGGACAGGGTATGAGTCGCCTAGTAAGTGATA
4535	69	115	MW2_CDS_01851	MW0337	FALSE	unmapped	TACGACTGTGGCAGAGGGAACGGTTAAATCAATAGGACTTCGTTCAACACGAATCAATAC
4536	69	113	(+)E1A_r60_a97		pos		
4537	69	111	MW2_CDS_11764	MW2230	FALSE	unmapped	TCGATTCAGATGCTGATCGTAAGAAAAAGGGTGGCGGAGAGCGTAGTGATAGTATTATGA
4538	69	109	MW2_CDS_08958	MW1681	FALSE	unmapped	AAAAGTGCAGCTGTATCAAATGAAGAATCAAAAGCAGCGGCATTAAAAGCACAACAAGCA
4539	69	107	MW2_CDS_05269	MW0976	FALSE	unmapped	TATTATCGGTGCACAATACATTCAAGCTGCTGGTGTTGCATTTGCACTTAAAAAACGTGG
4540	69	105	MW2_CDS_11998	MW2273	FALSE	unmapped	GGGTACAATGGGTATCGCAATGATTTTAGCACCTGCAATTGGTCCAACATTATCAGGTTA
4541	69	103	MW2_CDS_08445	MW1589	FALSE	unmapped	AGATGTCTAGATGCACACCAAAGACCTGAAGATCAAGCATTGTTCGGCATTATACAAGGT
4542	69	101	MW2_CDS_09011	MW1691	FALSE	unmapped	TTCGCGTATTTATTTGAACTTTTCAGATCCATGGCCAAAAAATCGTCACGCAAAACGACG
4543	69	99	MW2_CDS_06913	MW1290	FALSE	unmapped	AACGCTGAAAAAGGATTCGGCTTTATCGAAGTTGAAGGAGAAAATGACGTATTCGTACAT
4544	69	97	MW2_CDS_04902	MW0903	FALSE	unmapped	TGGTCAGATTTAGCTGTTGTTAAAGCGACTTCTTCAGACAGTTCAGTGAAAGAGATAGCT
4545	69	95	MW2_CDS_03674	MW0673	FALSE	unmapped	ACAATTGTCGGTGATAAACTAGATGACACTGGCTTCTTAGTGAACTTTAGCCATTTGAAA
4546	69	93	MW2_CDS_02315	MW0427	FALSE	unmapped	GTTGTATGGGCGATTAAAGAAGGTAGAGGCGTAGCGAAAGCAGTAGATCAGTATTTAGCG
4547	69	91	MW2_CDS_13887	MW2621	FALSE	unmapped	TGCAAAACAGTTTGGAGACAAAGTCATCACGTATGATGAAATGAAAAAAGAGGTCGATGC
4548	69	89	MW2_CDS_09385	MW1762	FALSE	unmapped	TTTACCTGCGACTTCTAATACGATTAATAAAATTGCAAATGGTATATGTGACAATTTATT
4549	69	87	MW2_CDS_01835	MW0334	FALSE	unmapped	CTCACTACTGCTCATTTAGAACAAGCTAAAAATGGCGGTGCCGTTATTGGCTTTCGTTTA
4550	69	85	MW2_CDS_12978	MW2456	FALSE	unmapped	GTGTTGTATTATACGCACATGGAGGTGCATGGTTCCAAGACCCACTTAAAATTCACTTCG
4551	69	83	agr_tiling 116_R		FALSE	unmapped	GATGCGAGTGATGCATCAACAATCAAACAGTATTCGCTTTTATTCTTGGGAATTATTATA
4552	69	81	MW2_CDS_01176	MW0216	FALSE	unmapped	CCAGGCCAATACATCACAGTTGATGTTTCTAGTGAAAAACTTCCATATAGAGCTAAACGT
4553	69	79	MW2_CDS_11208	MW2117	FALSE	unmapped	CTGAAGCGCATAGAGCACAAACAAGCCTGTTAGCTAAAGAAGCACAAGGTGATGATATTG
4554	69	77	MW2_CDS_02965	MW0546	FALSE	unmapped	AATAGAGCTGGCATCGATTGGTATGCAGAAATTGAAAGCGACAATTTTGTACCAACAGCA
4555	69	75	MW2_CDS_13291	MW2515	FALSE	unmapped	GCGGTAAAGGCAAAAGATTCTAAAATAGTATCCGACTGCAGACATTTACTAAAACATCCA
4556	69	73	ETG09_48764		pos		
4557	69	71	MW2_CDS_12606	MW2384	FALSE	unmapped	TCATACCGTAATTTTATGGTGAGCTATTTTTATCAATTAGCAGTTATACTCGTTTTGCAT
4558	69	69	MW2_CDS_11216	MW2118	FALSE	unmapped	TCGCAAAAGTTAAGCCTAGAAAGGTTAACGAAGCAATGAAATTATTCTCAGAACCACGCT
4559	69	67	MW2_CDS_13259	MW2509	FALSE	unmapped	AGAAAATGAACAAAGGCATCGCACGTTACTTAAAAGATCATCATTTTGACAATGTCAGTG
4560	69	65	MW2_CDS_07596	MW1430	FALSE	unmapped	TACCTAGTAGCAGTACTGTGCTTCACGGTCTTAGCGATTGTACTCATGCCGTTTCTATAC
4561	69	63	MW2_CDS_02363	MW0437	FALSE	unmapped	AAGATTATGATGTCATTATGACAAGAGAACCGGGCGGCGTTCCTACTGGTGAAGAAATAC
4562	69	61	MW2_CDS_04308	MW0793	FALSE	unmapped	ACGAAGGTAAAGAAGATAAAGCTTCTGGTAAAGCGAAAGAATTCGTTGAAAATGCAAAAG
4563	69	59	perR_tiling_044_R		FALSE	unmapped	CTCATAATCATTACCAGTTATATGCGCTGTTATAGTTACATTATCCAATTCATATAATTC
4564	69	57	MW2_CDS_06449	MW1203	FALSE	unmapped	ACTCGAATCAAACATCACGGTGCACTTTTAGCAAAAGGACGGTTAACAGGCATACAATTT
4565	69	55	(+)eQC-39		pos		
4566	69	53	MW2_CDS_04925	MW0907	FALSE	unmapped	TGTTAAACATACAACTTTAGAAGCGTTTGTCACAACCGTCAATGATTTGGGTATTGAATT
4567	69	51	MW2_CDS_06503	MW1213	FALSE	unmapped	AATGAAAACATCATCGCAATTATTTAAATTTCACGGTGAAGTTGCCATGCAGCTTTTCTT
4568	69	49	MW2_CDS_01795	MW0327	FALSE	unmapped	ACTTTTAGCACAATATGGAATTGTTACGACAGGAGATAAAGATGTTGAAATTACTAAGCA
4569	69	47	MW2_CDS_00486	MW0091	FALSE	unmapped	AGCACTAGCTAAGTATGTCATGGTTTGTGATGAAACAGCTTGGTGGTCATATATGGGTCA
4570	69	45	MW2_CDS_03405	MW0625	FALSE	unmapped	AGAAGAGATGGTTTTCAATCTGGATCGTGCTGCTATTGAATTCGGTAAAATGGATTTCAA
4571	69	43	MW2_CDS_03851	MW0704	FALSE	unmapped	GTTACAAGCATTAGGTGCTCAATTCTATGATGACGAAGGGCGTGTCGTAGATATGAGACA
4572	69	41	MW2_CDS_05109	MW0945	FALSE	unmapped	ACGAATACTACACCACAAATTAAAGGCGCTAATGATATCGTTATTAAGAAAGGTCAAGAT
4573	69	39	MW2_CDS_11118	MW2101	FALSE	unmapped	ACCTTTCCAACAGCACCATTGTTTGTATTACCTATAGGTTCATTCTTAGGTGCCTTTGCA
4574	69	37	MW2_CDS_06946	MW1297	FALSE	unmapped	ACTAAAACAAATCAAATATTCAAACAAACTTTGACTGCTGGTTTAATTGCAGCCGTAGCT
4575	69	35	MW2_CDS_03323	MW0611	FALSE	unmapped	ATGTTATCATCTGCTGCTGTAGCAGTAGCAGGTTCGATTTCGTTTATCGGATTAATGGGT
4576	69	33	MW2_CDS_04552	MW0841	FALSE	unmapped	AGATGGCCATTTAGTTGCTATGCATGATGAAACTGTTAACCGTACAACAAATGGACACGG
4577	69	31	(+)E1A_r60_3		pos		
4578	69	29	MW2_CDS_06128	MW1138	FALSE	unmapped	TCGCGTCGAGGTAAAATTTTAGGGTCGAGTCTAAATGAATTATTAAAAAGTCAAAGAATT
4579	69	27	MW2_CDS_08634	MW1625	FALSE	unmapped	TCGTTATCAGTTCGCGTCTATGGTGAAAGTGAATACTGGTTGGCATTGATAAAAGTGGTT
4580	69	25	MW2_CDS_10715	MW2024	FALSE	unmapped	GTTAAAGCGACTGATTTAAGAGCAGCAGCCGCCTTAATTTTAGCTGGATTAGTTGCTGAT
4581	69	23	MW2_CDS_13084	MW2476	FALSE	unmapped	ACAATTGGCGATAATGTTTTTATAGGACCTAATTGTGGATTCTACACAGCGACACATCCA
4582	69	21	MW2_CDS_11562	MW2192	FALSE	unmapped	CTGCATCAGCAACGGCTTTAACCATTTACGACATGACGAAAGCAGTTGATAAAGGTATGA
4583	69	19	MW2_CDS_04009	MW0731	FALSE	unmapped	CGATGTGGTCATCAACTTAGCAGGTGCTACACTGAATAAACGATGGACACCGGAATATAA
4584	69	17	MW2_CDS_13476	MW2550	FALSE	unmapped	GAAGATGGACCAGGAGATCATGATTATGCATATTGGGACCAAGCGATTAAGCGTGCTATA
4585	69	15	MW2_CDS_04592	MW0847	FALSE	unmapped	TTGAAAAAAGAATTATTGGAATGGATTATTTCAATTGCAGTCGCTTTTGTCATTTTATTT
4586	69	13	MW2_CDS_10059	MW1891	FALSE	unmapped	ACAGGCAATCAAAACGGTGTGAAAGTTGTGAAAGAAGTTGTGGATAGAACTGACTTGTCA
4587	69	11	MW2_CDS_03788	MW0693	FALSE	unmapped	TGCACCAGGAGTTAGAAAAGCTAACAGTGAATTACATTCAGTTGGTCTTGGTGTCATGAA
4588	69	9	MW2_CDS_03162	MW0581	FALSE	unmapped	AATGCCTCATATGGGTGCAGCATTAACAACACTTATTGGGATGTTTGGCCAGATTCTAAT
4589	69	7	MW2_CDS_11672	MW2211	FALSE	unmapped	GCTCCCTATGTAGGTGCATCATTAGAACAAATGGCTGAAGATACTAAAGTATTTCGTGGT
4590	69	5	MW2_CDS_07458	MW1394	FALSE	unmapped	ATCTCAGTGAAGAATACTTAATTCAAATAGATGTAGAATCTTCAAATAATCAGAAAACAA
4591	69	3	MW2_CDS_02068	MW0382	FALSE	unmapped	TGGCTTGTATTCAAATGGTCTTAAACAAGGTCAAATTACAATTACAATGAATGATGGCAC
4592	69	1	MW2_CDS_12271	MW2322	FALSE	unmapped	TGGCTTTACAACAGTTGAAGAAGTAACGGCTAAAACAAAAGCGGGGAATTCATGTGGTAA
4593	68	164	MW2_CDS_05733	MW1067	FALSE	unmapped	TCGGTGCTTCATTTATCCCATACCGTGGAAACACGTCTAGTCAATCAGAAAGCGATAAAA
4594	68	162	MW2_CDS_13426	MW2540	FALSE	unmapped	TACAAGAACGTGAAGAACTTGGTATGACTGGGAAAACATGGTTGTTCTTTGGCGATCAAC
4595	68	160	MW2_CDS_13276	MW2513	FALSE	unmapped	GGACCAGCAGTTGGAGGAAATAAGAGACTTCATTCATGATGAGAAGTTAAATGGAGCAGT
4596	68	158	MW2_CDS_02036	MW0377	FALSE	unmapped	ACAACGACAAATTGCTAAGGAGCAAAAGAAACCTAAATATTCTACCCAAGCACAAATAGC
4597	68	156	perR_tiling_086_F		FALSE	unmapped	TAAGGTTAAAACACAAATAGAAGAACTTAAAAACATTTTGGGGTGACATATATGAAAGTT
4598	68	154	MW2_CDS_08013	MW1510	FALSE	unmapped	ACGTCAAGAGCGTAAACAATTTAGTAAGCAGCAAAATAGACAAAAACGTAAGCAAAACAA
4599	68	152	MW2_CDS_05413	MW1002	FALSE	unmapped	ATGCGTTTCGGGAAATATCATCCTGATTATAAGAAAGTCATGTTAGAGACAAGACAACGC
4600	68	150	MW2_CDS_11821	MW2242	FALSE	unmapped	CCAATTGCAGCAGTACCAGGCGCAGTGTTTAGTTTCATTCATAATATAACAGGGCCTATT
4601	68	148	MW2_CDS_13872	MW2618	FALSE	unmapped	TCGACCGAGTATTGAAGCATTAAATTATTATGCAACACGTTTTATGTTAACTGTACCTTT
4602	68	146	perR_tiling_030_F		FALSE	unmapped	TTGAACATGAACTAGAAGAATCAATTGCATCATTGCGACAAGCAGGCGTAAGAATTACAC
4603	68	144	(+)eQC-40		pos		
4604	68	142	MW2_CDS_04073	MW0742	FALSE	unmapped	GAAGACGGTATACCAACAGATGTTCAATTAAGACAACGTGGCGAGGGTGAACGTCTAATT
4605	68	140	MW2_CDS_12118	MW2294	FALSE	unmapped	CTAATGCAGCGAACCTTGCTAAAACATATATCCAACCAGATGCGAATGCAGAGGGTTATG
4606	68	138	MW2_CDS_01688	MW0308	FALSE	unmapped	TGGCATTTTGTGATGAAGATCACTACGCATCTCTCATTTTTGTATTGAGTGCCATCGACA
4607	68	136	MW2_CDS_08202	MW1543	FALSE	unmapped	ACGTATGGAAGGATACAATGAAGCGCGTTGGATATTAATTGACTTAGCTGATGTTGTGGT
4608	68	134	MW2_CDS_08723	MW1640	FALSE	unmapped	ACTCAATTCGGGCATGCCAGTTTCACAAATTTATATGAACACGGCATATTCGCTAAAGGT
4609	68	132	MW2_CDS_05746	MW1069	FALSE	unmapped	TCCATTTAGTTTTGAAGGACGTAAACGTCAAACTCAAGCTGCTGCTGGAGTAGAAGCTAT
4610	68	130	MW2_CDS_01358	MW0249	FALSE	unmapped	TGTTTATTACTTTGGTGATACGTTTTTAATGTGCACGATTATTTCATTCAAGACATTTGA
4611	68	128	MW2_CDS_04868	MW0897	FALSE	unmapped	GGTGGTATCGGCTGTGCAGTTTCGATGCTATTTTTATCGAAACTAATAGATAACCGCAGC
4612	68	126	agr_tiling 068_R		FALSE	unmapped	CCTCTATTAGTATTGCATTTTCATATTAATGAAACACTAATGATGTTTTTAGCATTAATA
4613	68	124	MW2_CDS_01936	MW0356	FALSE	unmapped	GTAAAACAGTCATTATTGCTACTGGTGCAGGTTGGCGTAAGCTAAACATTCCAGGTGAAG
4614	68	122	MW2_CDS_06548	MW1221	FALSE	unmapped	TGCATGGGTTCGGTTCTCACACATACTCTATGTATAATGATTCTGGTGAACGTGTTTGGG
4615	68	120	MW2_CDS_13878	MW2619	FALSE	unmapped	TGTTGGCAGTCGTTATTTTTACATTTCCAATTGAAAATTTTTATGCTATTACCTGGTTGA
4616	68	118	MW2_CDS_12749	MW2412	FALSE	unmapped	AGCCATAATTGAGCAACATACTATGTCGAATTTAGCGTCTCTAGATTTATACGCTCCTGT
4617	68	116	MW2_CDS_02031	MW0375	FALSE	unmapped	TGTCGAACGAAATTTCAGATGAAAAATTAGTATCATATTTATCAAATCTTGCGAATCAAA
4618	68	114	MW2_CDS_13933	MW2630	FALSE	unmapped	CCGGTGCGCAGGGTAAAATTATGCGTGAAGGTTTATCTACAGTTATTGTTGGTAAACCAA
4619	68	112	MW2_CDS_08306	MW1562	FALSE	unmapped	ACCAGCATTCTTTGAGGGAACACCTGGTTATGAAGAACAGATGTTTGGTCAACAACAATC
4620	68	110	MW2_CDS_03292	MW0605	FALSE	unmapped	TCTTAGACAAAGGACAGGTAACAGGTAAAGGTACGCATTCAGAACTGATGGCATCACATG
4621	68	108	MW2_CDS_03350	MW0615	FALSE	unmapped	AGCATATATTTCAAGTGCGCATGAAGTAGAAAGTATGATGTTTTATACATGTATTTTAGA
4622	68	106	MW2_CDS_11566	MW2192	FALSE	unmapped	CAATACCAAAGGCAATGTATTGAACACTGCTCAAATCGCTGGTATTATGGCTGCCAAAAA
4623	68	104	MW2_CDS_09842	MW1847	FALSE	unmapped	TGAGGAAGTAATATTTGAAGGGTATGTCGTGTGCAATGCTGATAGCAAAGTGGCAAAACA
4624	68	102	MW2_CDS_00203	MW0038	FALSE	unmapped	AAAGTACAAATGCGTAAAAAACAAGTCAGTCAAAAACCCCAAGTCCATGGCAAAGGAACG
4625	68	100	MW2_CDS_12020	MW2277	FALSE	unmapped	TGACCGTGAAATGGCATTTTCAAGTTCCAAAACGTATGGTCCATATCCACAAAATAAAGA
4626	68	98	MW2_CDS_04053	MW0738	FALSE	unmapped	GCGAACACGGTGCAAAACGTACAGCTGCAGAACAAGTTGACTACTTAGAACAATTAGTAG
4627	68	96	MW2_CDS_03730	MW0683	FALSE	unmapped	GTGCAGGTCGTGACGGGTTGAAAAGTGAATGTATTTTGTTATTTAGCGAACGCGATATCA
4628	68	94	MW2_CDS_07781	MW1467	FALSE	unmapped	ACATGAACGGTGTTGTAGAACAAGCAAGGAATGAAATTGAATCTGCGGGATATGAGCAAT
4629	68	92	MW2_CDS_07437	MW1390	FALSE	unmapped	ATCGCGCTCGAAATGGGATAATATTTCTAGTACAGCATGGTCGAATGCAAAATCCGTTTG
4630	68	90	MW2_CDS_10915	MW2060	FALSE	unmapped	GTAATACGATGGCGATTATTTCTGATATGAATCAGCCACTTGGACGTGCGATTGGCAATG
4631	68	88	MW2_CDS_00661	MW0124	FALSE	unmapped	AACATCCAAGTTAAAAGTGGTCATAAACAAGATTCGGAAAAAATTGCGAATAGCTTCGCT
4632	68	86	MW2_CDS_00370	MW0070	FALSE	unmapped	ACTTGAGTGCTTATCCAAACGAAACAATTGTGATGTCTATGAAAAAGGACTACGATAGCG
4633	68	84	MW2_CDS_06461	MW1206	FALSE	unmapped	ACTTTCTGGTGGTCAACAACGATTACTCGATTTTGTATTATCTTTAATCGGACAACCACA
4634	68	82	MW2_CDS_06525	MW1217	FALSE	unmapped	AGGTAAACTCATGCAACAAGATGGCTTTCATGAACCGTATCGTCAGCATTTAATTGCTGA
4635	68	80	MW2_CDS_10849	MW2049	FALSE	unmapped	TTCTGAAGGTGCTGCTCGTTACATGAGCGGTTTCTACACAATTGTTAAAATGGTTGAAGG
4636	68	78	MW2_CDS_00003	MW0001	FALSE	unmapped	GTTCACGCTTTGAATGGGGGCTAATTGTTGATATTACGCCACCAGATTATGAAACTCGAA
4637	68	76	psma_tiling_067_F		FALSE	unmapped	CTAGACGAGACCTAACGTGTTATTCGTTTTAAACTTATAACATAAAATATAATTAAATTT
4638	68	74	MW2_CDS_06308	MW1171	FALSE	unmapped	GTAAGACCAGCGAATTTTCCGGATGAAGCGCCGGGAATTGGTATGAGATTTATACAAATT
4639	68	72	MW2_CDS_10340	MW1952	FALSE	unmapped	AACCATTGTAATGAAAAAACTATCAATGTGGATACAAACCATTATGTCACGTACCAGCAT
4640	68	70	MW2_CDS_03654	MW0669	FALSE	unmapped	TCCTCTTCAATTAACTTTCTTTATCCTTTTACTAATGAGTCACTCATTGTTAAAACAGAT
4641	68	68	MW2_CDS_09187	MW1723	FALSE	unmapped	AACAAGTTATGTCTTTGGTATTTTGTTATGTTACGTCGGTATAAAACTAGGTGGTGGTTT
4642	68	66	MW2_CDS_08803	MW1654	FALSE	unmapped	ACAGCAGGTATCGGTGAAAACTCAGTAGAAATTCGTGCGAAAGTTCTTGAAGGCTTAGAA
4643	68	64	MW2_CDS_06226	MW1156	FALSE	unmapped	TACCGTGTACACGAAACTGATACTGGTTCACCAGAAGTACAAATCGCTGTACTTACTGCA
4644	68	62	MW2_CDS_03150	MW0578	FALSE	unmapped	AATCATAAAGGTTTATCACCGCATTTGATTGATGATATTAAAGAGAAAGTAATTACTGAT
4645	68	60	MW2_CDS_11371	MW2152	FALSE	unmapped	AGATTTAGTAGTTGTTCCACGTGTTGAAGGTACAACTCCACACACAATTACTGGCCGTTA
4646	68	58	MW2_CDS_07491	MW1401	FALSE	unmapped	TAAAGAATTATGGCTTTGAAACAGAAGAAACAAGACAAGGGGCTTTGACCTTGAGCCCTG
4647	68	56	MW2_CDS_03029	MW0557	FALSE	unmapped	TAAATCGATAGGATGGACCATATTCGCGGGTATTGTGTTACTTGGTGGTACTGTAAGAAG
4648	68	54	MW2_CDS_00841	MW0156	FALSE	unmapped	TAGTAGCTCAATTTAACCAGCACCAATGTTCTGCAATAGGCTTATGTGGTTTGGATGCAC
4649	68	52	MW2_CDS_01981	MW0365	FALSE	unmapped	CGCTGTACCACAAGCATTTAAAGGTTTAGGTGAACAATTTGCATGGTTGACTCAAAACGG
4650	68	50	MW2_CDS_10674	MW2015	FALSE	unmapped	GCAATGAGTGAAGCTCCCGAAGAAGCTGAAGAATTTTACAAAGTTGCACAAGGGCTATTA
4651	68	48	MW2_CDS_01200	MW0220	FALSE	unmapped	TGTGCAATGGACTGATTTGCAGGAATCAGATAACATATCGAATTTAACGATGGCTATCGC
4652	68	46	MW2_CDS_07311	MW1366	FALSE	unmapped	AAGCAGATGATGCAGTGACATTAGATACGACAGGCAAGTCGATTGAAGAAGTTACTGACG
4653	68	44	pMW2_029		FALSE	unmapped	ACAAATTAGAGAATCCTCGAGACCCAATGAAATATGGCAAGCAGACCATACTTTGCTAGA
4654	68	42	MW2_CDS_03651	MW0668	FALSE	unmapped	ACTTGATATCATGATGCCAGAAGTTAATGGTTACGACATTGTCAAAGAAATGAAAAGGCA
4655	68	40	MW2_CDS_05748	MW1069	FALSE	unmapped	CCAAGGTTCTGCATTAATGGGTATTGGTGTTTCTTCTGGTGAAAATAGAGCGGTAGAAGC
4656	68	38	MW2_CDS_12878	MW2437	FALSE	unmapped	TAAGCAGAAATCATTATCACCTGGATGGTGGTTTGATGCGATTAACTATGCAAGCTTGCA
4657	68	36	agr_tiling 007_R		FALSE	unmapped	GACTAAACATAGATTTATGAGAGATTTTTCATAAGTCTATGTTTATTTTTTTATAGTAGA
4658	68	34	MW2_CDS_03082	MW0566	FALSE	unmapped	TCGTCACAAATCGATGCGGATAGAATGGATTATTTACAACGTGATGCGTATTTCACAGGT
4659	68	32	MW2_CDS_13207	MW2500	FALSE	unmapped	ATTGCACAATATCCCAATCGCTTTGTAGGCTTTGCAACTTTACCTATCAATGAGCCTGAA
4660	68	30	MW2_CDS_04645	MW0857	FALSE	unmapped	TGATTTAGTTGACCAAGCATGTGCAACAATTCGTACGGAAATGGGATCAAATCCAACTGA
4661	68	28	MW2_CDS_09451	MW1775	FALSE	unmapped	TCAAAAGACGCATTAAGTCATTACTTTGGTTCAAGCGGACAACATTCAAGTTATTTTGAA
4662	68	26	MW2_CDS_08559	MW1612	FALSE	unmapped	TCATTGTGGCGTGATTGATGACCATACACATGACGTTGACAATGATAAATCATTGCCACT
4663	68	24	MW2_CDS_02011	MW0372	FALSE	unmapped	TCCTAACTTGCCAATGAATCCAGAAGCACAACAACGAATTGGCGGAACAAAAGTAGTTAA
4664	68	22	MW2_CDS_09681	MW1817	FALSE	unmapped	TCCTCTGATCTTGCTAAATCATTAAATTGTCATTGTTCCGAGTTTAGTTGTTTAGGACCA
4665	68	20	MW2_CDS_11878	MW2251	FALSE	unmapped	TTCCTAGGGCCTCATGCTGTACCTAAAGAGGCAAGTTCAAATGAGGCATTTTTAGAAGAA
4666	68	18	MW2_CDS_06398	MW1188	FALSE	unmapped	AGACGTAAAAGGGGAACATCAATTACCTTTATTTAGATATTTGACTGCGGCACAACACGG
4667	68	16	MW2_CDS_06864	MW1281	FALSE	unmapped	AGCAGTTGCTGGTGTGGCTTTGGATAAACATATGATGCATGTAACAATTAGTTATCCCCT
4668	68	14	MW2_CDS_04140	MW0758	FALSE	unmapped	GCTGCTGAAACAACTGATAGAGACTTATGGAAAAATGTAAGAGATGCTTTGAAAGAAGCA
4669	68	12	MW2_CDS_04496	MW0830	FALSE	unmapped	TCTTAATCGAACTGATTAAAGCTAATTTTGATGTTTTGAAAATTATTATTAAACCTTCGA
4670	68	10	MW2_CDS_10928	MW2062	FALSE	unmapped	TTTGGTTACACTGGTACATATAAAGGTAAAGAAGTTTCTGTAATGGGTTCTGGTATGGGT
4671	68	8	MW2_CDS_13756	MW2597	FALSE	unmapped	TCAAATTGCAGGACCAACAGAAATAGCACTGATTATTGACGACACCGCAGATTTAGATGC
4672	68	6	MW2_CDS_08397	MW1580	FALSE	unmapped	ACAGATTGGCCATTATTGGAATATGATGAAGATGCGAAACGTTACGTTGCAGCACATCAT
4673	68	4	MW2_CDS_13668	MW2582	FALSE	unmapped	TTGTTTATTTAGACAGACCGACTAAGCCAGGAAAAGTGAAGTCGTTTTTGAAATGGTTTT
4674	68	2	MW2_CDS_00681	MW0127	FALSE	unmapped	TGAAATTATGGAAACGTATAAACCATACGCAGTTTATCATGCAGCAGCACACAAGCACGT
4675	68	163	MW2_CDS_10992	MW2079	FALSE	unmapped	AGTTTACTGGAAAAGTTTCAAGAGGGTGAAAGAGTAATCGATGTGGTGATAAGCGGTGCT
4676	68	161	MW2_CDS_07617	MW1437	FALSE	unmapped	GGTGATATAGCCGATTACTCGAAATTCAACAATCGCAAGTTCGAAAATTACGCAAGGCGA
4677	68	159	agr_tiling 041_R		FALSE	unmapped	CTTAAAATTAAACAACTCATCAACTATTTTCCATCACATCTCTGTGATCTAGTTATATTA
4678	68	157	MW2_CDS_12703	MW2403	FALSE	unmapped	AGGCACTTTATATACGGTACAGGCTGCATTACCAACTATGTTAGAACAATCAAGTGGCCA
4679	68	155	MW2_CDS_07879	MW1485	FALSE	unmapped	GTGCTCAAACGAGACAAAAGGGCGTAATCCTCCAACACGGTTCGATTTTACAAGATATTG
4680	68	153	MW2_CDS_12668	MW2396	FALSE	unmapped	ATTCAGAGAAAATCAGAAATGGATGACACCGCTGGGACGTTTAGGTAAACCAGAAGAAGT
4681	68	151	MW2_CDS_02437	MW0451	FALSE	unmapped	GGTACAGTAATTACTACTGCTGGCGCAAGTGGTGGTGTTACGTATAAACCAATGATGAGT
4682	68	149	MW2_CDS_11327	MW2142	FALSE	unmapped	CTTAAACAAGGCCCTCGTCGCGGTGACGGTGCTGAATCAGTAATTATCGAATTAGTATAA
4683	68	147	MW2_CDS_03180	MW0585	FALSE	unmapped	TGATCAATTGGCACCACATGTTTCGCAATGGCATGGATTTAACATACCGCTTCTTTTAAC
4684	68	145	MW2_CDS_01723	MW0314	FALSE	unmapped	GGCCAGTCGAATTAAGAGTTAGAAATGCAGCGCGTACGGTAGAATTTTTGGAAAATGTCT
4685	68	143	MW2_CDS_13896	MW2623	FALSE	unmapped	TGGTTTCATCGAACAAGAAAATGGCGGAGACGTATTCGTACATTTCTCAGGTATCGCTAG
4686	68	141	MW2_CDS_01374	MW0252	FALSE	unmapped	GATGGTAATGGAAAGGTCAATTACCCTAATGGCACATCGAATCAAAATGGCGGATTAGCA
4687	68	139	MW2_CDS_05918	MW1101	FALSE	unmapped	TGATGCTACAGAAGAGCGCGTATCTCAAATTGTCATAATGGGTATCGGTGAACCATTTGA
4688	68	137	MW2_CDS_07144	MW1335	FALSE	unmapped	AGAATTAAGACTACGTGTAGCAACATCAAGACCTCAGGACAATAAAAGTTTTTCTTCGAA
4689	68	135	MW2_CDS_07268	MW1358	FALSE	unmapped	ATTACATCAGCACCAGTGTTCGCAATGGTAGTTGAAGGTGAAGATGCAGTTAATGTATCT
4690	68	133	MW2_CDS_08757	MW1646	FALSE	unmapped	TGTCGCAAGGAGATACGACTGGCATATTCCAATTAGAGTCTGACGGTGTAAGAAGTGTAT
4691	68	131	MW2_CDS_07858	MW1481	FALSE	unmapped	ACTGAAACAGAACCTGGTATTAAAGGTGATACTGCAACTGGTGCTACTAAATCGGCAACT
4692	68	129	MW2_CDS_09212	MW1728	FALSE	unmapped	ACAAACAAACTGCTGCTTATGGTCATTTTGGACGTACAGATGTCTTATTCCCATGGGAAA
4693	68	127	MW2_CDS_05666	MW1052	FALSE	unmapped	CATATTCCTTGCCAGCTCTGTCGGTAGTACATTTTCAACTATTAACCCGTTCTCGGTTGT
4694	68	125	MW2_CDS_03316	MW0609	FALSE	unmapped	GGGAAATCTACTTTGCTAAAGGCATTGTCACGTTTATTGGCAGTTAAAGAAGGCGAAGTA
4695	68	123	MW2_CDS_11607	MW2199	FALSE	unmapped	GACGACGAGCAGTTAATTTATTTAACGCCTTCTTTTCCACAACGATACACAAGCAACACA
4696	68	121	(+)E1A_r60_1		pos		
4697	68	119	MW2_CDS_06386	MW1186	FALSE	unmapped	TTTAGCTCAATTTGATGCGGTTTCTGCAGAAAATATTCACCCTAACAACCGCCAAAGAGT
4698	68	117	MW2_CDS_12015	MW2276	FALSE	unmapped	TTTATGGCATGACTGCAATACAATTTAGTTGGATGTTTGCAGGAATTGGTATTACGCTCA
4699	68	115	MW2_CDS_07336	MW1370	FALSE	unmapped	CCCGATAAACAAGACGTTTTGACAACGTTGCATTCATTCTATAGTATCGGCGCCTTGAAA
4700	68	113	MW2_CDS_11937	MW2263	FALSE	unmapped	GCGAAAGCCCAAAATACCCGTCTACAATTAAAAATCAACCAGTGACATCTGAAACACCGA
4701	68	111	MW2_CDS_13591	MW2569	FALSE	unmapped	GACGCGACTGCGTAAAATTATTGATACACACCGCGCGCAAGATTATATTCGTTTACTAGG
4702	68	109	MW2_CDS_10569	MW1996	FALSE	unmapped	AGCGCCAGTATATCGATATAAGCACTGCAGATATGCATTTGAAAAACACCATTTGCGTGT
4703	68	107	MW2_CDS_05661	MW1052	FALSE	unmapped	CGATTTGTATGGCCGGTAGTTGCTTTTGTATTGATTTTCGGTGGCGGACTACTAATTACG
4704	68	105	MW2_CDS_09448	MW1775	FALSE	unmapped	TTCAGAAACTTTGGTGGCTTTAAAAGCTATCGTTTGTTAAGACCTGCTAAAGGTACAACA
4705	68	103	MW2_CDS_10673	MW2015	FALSE	unmapped	TAATATTGCTGCTGAGGTAGCTGCTGAAAATGAAAATTGTGGTGGTCCTGGTACGTTTTC
4706	68	101	MW2_CDS_00848	MW0157	FALSE	unmapped	GTACATTTTTAGCTAAAGCTATAGCCAGAGATGGCGAAGGCGCAACAAAGTTAATCAGCG
4707	68	99	MW2_CDS_10728	MW2027	FALSE	unmapped	CAGTTGAACGCGCACGTAGAATTCAATTCTTCTTATCTCAAAACTTCCACGTAGCGGAAC
4708	68	97	MW2_CDS_03133	MW0576	FALSE	unmapped	AGTTGCATTTGTATGCCATGAAATGGGTGGAATCATTGGTGCGGATATTTCAGTACGTTA
4709	68	95	MW2_CDS_01635	MW0298	FALSE	unmapped	AAGATCAAATCGCACAACGTTTTTTAATCTACGTTTATGCACGTGGCACAGGTAAATGGA
4710	68	93	NC_S_113		FALSE	unmapped	ATACCCTACTATATATCACAACACATAAATTAAGCATGACACTCATTCAATTTAGTTCAC
4711	68	91	(+)E1A_r60_a97		pos		
4712	68	89	MW2_CDS_07138	MW1333	FALSE	unmapped	AATTGCTCAAAATATCGCACCTGGTTTTAATCGCGAGTTCGTATCAGAGCAATGGAACAT
4713	68	87	MW2_CDS_06460	MW1205	FALSE	unmapped	TGCCAATAGACCGCTGTCTGTTAAGTTTAAAGAATCGTTAGCTAAATTAGTTTCGCCAAT
4714	68	85	MW2_CDS_10718	MW2024	FALSE	unmapped	ACGCACCTAGATAGAGGCTATGTTGACTTACACGGTAAATTGAAGCAATTAGGTGCAGAC
4715	68	83	MW2_CDS_10474	MW1977	FALSE	unmapped	TATCAAAAATAGCACCTAGTTCATCGTATTCAATGCATGATGTGCATGAAGCTGGTGGCG
4716	68	81	MW2_CDS_10982	MW2076	FALSE	unmapped	TGTAACGGATAACTTGAAAATAGTCATGTATAAGCCAAGAAAAGAAAGTACAAGTGGTCG
4717	68	79	MW2_CDS_07524	MW1409	FALSE	unmapped	ATTGCACTCAGGAAAAGCCTTTCCCGTAACTAATATAATCTCAGAAAATTCAACCTTCTT
4718	68	77	MW2_CDS_10676	MW2015	FALSE	unmapped	AACTGCAATAGTAATCACAGGTAAAGAGGACGTTATTGTTCAAGATAATAAAGCCATCGT
4719	68	75	MW2_CDS_04406	MW0811	FALSE	unmapped	TCTACAAATCCTGATGTATCAATTCCTAAAGAGCGTGGTTTATTACCTGGTAATGGTGCT
4720	68	73	MW2_CDS_10078	MW1895	FALSE	unmapped	CATTTAGAGCGTACGCAAAGTCGGGTTACAATAATCCTCTCAACCCAACTCATCAAGCTA
4721	68	71	MW2_CDS_01010	MW0187	FALSE	unmapped	ACTGGTTGGGGAAAAATGAGTAATGGCGAAACGTTAACTGATGATGAACAAATGAAAGTT
4722	68	69	MW2_CDS_11985	MW2271	FALSE	unmapped	TTGTACTGCCTATCTATCCAAAGACACCAGAGTTTCATATTGACGATACTTTCCAAGCGA
4723	68	67	MW2_CDS_08266	MW1555	FALSE	unmapped	ATGGGCAGCTCGTTAGTAGAAAAGAAAGTGATGCTGTGATTACTGATACTGACGAAGCAC
4724	68	65	MW2_CDS_11450	MW2170	FALSE	unmapped	TGCATAAGTATAAAGATTCACGTGAACAATTCGAACAACGTACACACAAACGTTTAATCG
4725	68	63	MW2_CDS_06199	MW1151	FALSE	unmapped	AAAAAAGGAAATTTAAAGCTCGTTATTGTTGCAAATGATGCGTCTGATAATACAGCTAAA
4726	68	61	MW2_CDS_11221	MW2119	FALSE	unmapped	TCCGGTTGGTTCAGGTGATTCTACAGTTGCTGGAATTACTTCAGCAATTCTCAATCATGA
4727	68	59	MW2_CDS_12084	MW2288	FALSE	unmapped	GCGCAACAATTACCACTATCAGATGCTTTATTCAAAGCATATCATGTTGTGGTTCAGGGT
4728	68	57	MW2_CDS_09916	MW1860	FALSE	unmapped	TGGGTGACTATGTGACTCGTATTGCACAAGTTAATGCTGTTGACCTTGACGAAGTGTTAA
4729	68	55	MW2_CDS_11151	MW2107	FALSE	unmapped	TGCATTAGAGGCTCACTTGCAAAATGCTATTGCAACATTTCGGAAAGATGGTCTATTGGA
4730	68	53	MW2_CDS_12063	MW2284	FALSE	unmapped	TGCAAAAGAGACGGAATCTTATATTGATATACATGCACCTAAAATGAATGATCACGTTCA
4731	68	51	MW2_CDS_07278	MW1360	FALSE	unmapped	GGCGTTAGAAAAGGGACGAAAGCATTAGATGTTTGTTGTGGTACTGGTGATTGGACAATC
4732	68	49	MW2_CDS_07450	MW1393	FALSE	unmapped	TACATCTTGGGTAGGAGAGAATACAAGAGCACCGTATGTAACAGTAATTGGCGAATCGGA
4733	68	47	MW2_CDS_03151	MW0579	FALSE	unmapped	ACGAAAAAAATCTTCGAACATTCAGGACATGCACCGCATATTGAAGAACCAGAAGCATTT
4734	68	45	MW2_CDS_09606	MW1804	FALSE	unmapped	GTTATCCCTGATTTAACTGCATTTGGTAAAATTGTTGGCGGTGGTTTACCAATTGGAGGC
4735	68	43	MW2_CDS_02949	MW0543	FALSE	unmapped	GCGCCAGGTGCTAAATTACAAGGTGATGCAAATGTCTTTGTATTCCCAAGTTTAGAAGCT
4736	68	41	MW2_CDS_00583	MW0109	FALSE	unmapped	ATTACCAAAGCGCCCCACTTCAAAAATCATAGTCACGTGTTTGATGGTGATACACATTGT
4737	68	39	MW2_CDS_04358	MW0803	FALSE	unmapped	ATTATGGACGGTAGAGGAGTTTTGGCAAGTATTGTCTTAGGTGCAGAAGGGGTACAAATG
4738	68	37	agr_tiling 100_F		FALSE	unmapped	TAACCATTACTAAAAATACAGAATATAGTCTAATTTTAAAATAGAGAAAAATTATTATAA
4739	68	35	MW2_CDS_08936	MW1677	FALSE	unmapped	TGAAGCTTTGTTAGAAATTACAACATTACCAGAAGGTAGAATTTATGTTGCTCGCCAAGA
4740	68	33	MW2_CDS_09276	MW1740	FALSE	unmapped	CAACTTGAAAAATACACCTTAATGACTATGCATGGTCTTTTTAATCAACTTAAACTCGGT
4741	68	31	MW2_CDS_05663	MW1052	FALSE	unmapped	TATCGTGCCATCATCTTCTGGATTAGCGGTATTATCAATGCCTATCTTTGCACCACTAGC
4742	68	29	MW2_CDS_13530	MW2559	FALSE	unmapped	GGCATCTGGTTTGTCGTTGATCATAATAGAGTTGTCGAAGTAACAGTTGGACATACACCA
4743	68	27	ETG09_35454		pos		
4744	68	25	MW2_CDS_13049	MW2469	FALSE	unmapped	GGCAGTTTCCTATTTGTTGGCCCTACTGGTGTTGGTAAAACAGAGCTTGCTAAACAATTA
4745	68	23	MW2_CDS_05249	MW0972	FALSE	unmapped	ACTTCAGGGCATGGTTCTCAAGGTGATCAACAATTAATGCTTCGATTAATCAAGCCGAAA
4746	68	21	MW2_CDS_11263	MW2128	FALSE	unmapped	AGCGCAGCTTCCTAAAAATGAAAATATTCAAGCACAGCAAAAGCAAATTTTAAATAAGCA
4747	68	19	MW2_CDS_09658	MW1813	FALSE	unmapped	TGAAATGGAAACCATTCATGCTGTATTGAATGAAATGGATTTTACACAAGATGAAGCGGT
4748	68	17	MW2_CDS_11059	MW2091	FALSE	unmapped	TACCTGAAGAGTCACCAAGTGGAAATATTCATGGTATGCCTCTAAGGATTTTGACAGGCG
4749	68	15	MW2_CDS_12187	MW2306	FALSE	unmapped	TGTAGAAAACAGCTATCTTAGCAAACAGTTGTGTTTTTTATTTTATGTTTCTTCAAAAGA
4750	68	13	MW2_CDS_06908	MW1289	FALSE	unmapped	AGATTTTGGATTTGATGAAATTCTGTTTTATACATTATATTTGTTGTTAATTCTTATCGT
4751	68	11	MW2_CDS_04393	MW0809	FALSE	unmapped	TGGTAAGACACTCGTACTTAATATGCAAACAAATAAATTCGGTATTATCGGTACTGATGA
4752	68	9	MW2_CDS_05839	MW1085	FALSE	unmapped	GACCAGGTAATCCTGAAGTTGTAGAATGTGCGATTCCAATGATTCAAGGAATTTTAGGGA
4753	68	7	MW2_CDS_04268	MW0784	FALSE	unmapped	GATGGTGCCCAGACTGTCGTGCTATGGATTTATGGATTGACCCAATCGTAGAACAATATA
4754	68	5	MW2_CDS_12212	MW2312	FALSE	unmapped	AGCATCATACATTTCAGAAGCTGTTAATTATTTTTTGAGCAATGTGAATAAGAGCGACAA
4755	68	3	MW2_CDS_11746	MW2226	FALSE	unmapped	ACGCTATTACAACTTTTTTGGTATAGGAGCATTCGATAGTAGTGCTGTTCGTAGTGGGAA
4756	68	1	MW2_CDS_09485	MW1782	FALSE	unmapped	TTTGGTGAAATCGCTAAAAAAGAATCAATGGATACTGGTTCAGCTAAAAAAGATGGCGAA
4757	67	164	MW2_CDS_13844	MW2613	FALSE	unmapped	CTTATTTGCAAGTTCTACAGCACATATCAGTGCGATGTATGCAGCATTACTAGGCGTTGC
4758	67	162	MW2_CDS_10360	MW1956	FALSE	unmapped	TAAGCCAAATCCTAACCCGTCACCAGATCCCGATCAACCTGGGGATTCCAATCATTCTGG
4759	67	160	MW2_CDS_06122	MW1137	FALSE	unmapped	AGCTGAGATTGCTTATCAAGTAAATCAAGATACAGACAACATTGGTGCACGTCGACTTCA
4760	67	158	MW2_CDS_00951	MW0176	FALSE	unmapped	ACTCGTGATAGTTTTTCTGCGGGGACGGATTTTTTTACTAAATCATTACGTTTTGATTCA
4761	67	156	MW2_CDS_10264	MW1938	FALSE	unmapped	TGACACCTTTTCATATGATTTATTCTACACAGGAGATGATGGGCTACCAAAAAGTTTTTT
4762	67	154	MW2_CDS_09970	MW1870	FALSE	unmapped	ACAAATGGTAAATCACGTGCAATTCCTATCTTCGTATTCTTGAATGATCAATTCGAACAA
4763	67	152	MW2_CDS_01130	MW0208	FALSE	unmapped	GTCGAAGTTGCGCTCAAACGTGCGAAATATGAAGCAGAAACAAACTATATTCCGAATCCT
4764	67	150	MW2_CDS_12947	MW2449	FALSE	unmapped	AGAGGATTTAAACGCTATATTAGCGATATACAATGATGCCATTATCAATACTACAGCTGT
4765	67	148	MW2_CDS_02426	MW0448	FALSE	unmapped	GCCACCACCTAATGTTGATTCAATAGTTGTAAAACTGATGCAGAGAACTGAACCGTTAGT
4766	67	146	MW2_CDS_08293	MW1560	FALSE	unmapped	TGGTAAAGGTTTAGATGATGAAGTTCGTGTTCCACTACCTAATGGTGGCGAAATGAACGT
4767	67	144	MW2_CDS_12332	MW2335	FALSE	unmapped	TGTAGGTGCGTATGCATCGGAAATTATTCGTGGCGGTATTATTTCTATACCGAAAGGACA
4768	67	142	MW2_CDS_07986	MW1505	FALSE	unmapped	TAGAAGAATTTAAAAAAGAATTTGCTGACAAAGCAGCTGCACGCTTTGGTTCAGGTTGGG
4769	67	140	MW2_CDS_10630	MW2006	FALSE	unmapped	GCTTAGAAATATGGCATTAGAGGCATTCAAAGCGACAGATTGTTCTGGTTTAGTCCGTGC
4770	67	138	MW2_CDS_06754	MW1261	FALSE	unmapped	AGGTAAACGTCTACAAGAAGAACATGGTAATGAATTACCTATCTCTGCTGGTTTCTTCTT
4771	67	136	agr_tiling 034_R		FALSE	unmapped	CAATGAAAGTAATTAATTATTCATCTTATTTTTTAGTGAATTTGTTCACTGTGTCGATAA
4772	67	134	MW2_CDS_12774	MW2418	FALSE	unmapped	AAGTCTAGAAACGAAGCAGATGAACGCCGTATTTTTGTTTCAGTTACTCCAATACAACGT
4773	67	132	agr_tiling 044_R		FALSE	unmapped	AAACATGCTAAAAGCATTTATTTTCCAATTTTTCTTAACTAGTCGTTTTTTATTCTTAAC
4774	67	130	MW2_CDS_05263	MW0975	FALSE	unmapped	AGAAGAAGACGCAATTAAGAAGTCTGAACAAGACTTTAAGAAAGCAAAAAGTCACGTTGA
4775	67	128	MW2_CDS_00544	MW0102	FALSE	unmapped	AGTGTTGCTGAGTCGGTTGAGAAACCTATCTTATCTCAAGAAATAAACGTCGTAGCAACA
4776	67	126	MW2_CDS_02922	MW0539	FALSE	unmapped	GGCTCATTTGTATCATTCATTTTCTTAGCGTTGTTATTAGTGCCAGGTTCTCCTGCAGCA
4777	67	124	MW2_CDS_01502	MW0276	FALSE	unmapped	TGCTTATGTAGATGATCAAGGTGGAGAGGTCATTTTTAATTATACAAAACCTGAAAGTGA
4778	67	122	MW2_CDS_12539	MW2372	FALSE	unmapped	TTACGCGTGCCAATGTTGTTGATATTGTATATGACACGATTTGGGGCGATAGTGAGGATA
4779	67	120	MW2_CDS_12425	MW2351	FALSE	unmapped	TGCTCCAGAACTGGATGAGAATGGAAAAAATTTGACGATTAAAAATGAAAATATCGCTTT
4780	67	118	MW2_CDS_00311	MW0059	FALSE	unmapped	CAATTCAAGAGCTTGCGTAGATTCTTTAAAATCTATGTGCGTGGCATAAGAGGCGCTAGC
4781	67	116	MW2_CDS_04068	MW0742	FALSE	unmapped	CCCAGCGCGAGGTAAGACAATTCAAGCCAAAACGCGTGGTAAATCATTAGATAAATCAAA
4782	67	114	MW2_CDS_12587	MW2381	FALSE	unmapped	GAATCTACTGGTACAATGGACAAAGTAAGAGAAAGAGAAAAAGATAATAGTGGTACAACA
4783	67	112	MW2_CDS_12699	MW2402	FALSE	unmapped	AATCTGTGCATTTCACAAGTTTAAAAAGAGGACCTATGGGCGATGCCGTAATTGAAGGTT
4784	67	110	MW2_CDS_13046	MW2469	FALSE	unmapped	AAATTCTTCCGCCCTGAATTCCTTAACCGCTTCAACGGCATCGTTGAATTCTTACATTTA
4785	67	108	MW2_CDS_06614	MW1236	FALSE	unmapped	TTTGGGGAATTTCACAGGCCTTAATAGCATTTGTACTTTTATTAGCTGGTGGCGGTAACG
4786	67	106	MW2_CDS_10208	MW1924	FALSE	unmapped	TGGAACGGTTGCGAACCTTAAAACAAGATTAAAGCAAAACAAACAACAAATCGCACATGA
4787	67	104	MW2_CDS_12576	MW2378	FALSE	unmapped	AGGCGAGAGTATTGCCATTATAGGTCCATCAGGTAGTGGTAAAAGTACATTTCAAAAGCA
4788	67	102	MW2_CDS_04915	MW0905	FALSE	unmapped	AAAGACATTAGTGGCATCAAAACGATGGATTAGATATATCCATGAAGTTGAAGAGCCGGA
4789	67	100	MW2_CDS_06829	MW1275	FALSE	unmapped	GAAACAGCGCCACTTGTGCTAATCGGTATACCGACTATATTATTGGCAACACCTAGAAGT
4790	67	98	MW2_CDS_06800	MW1270	FALSE	unmapped	TGCATATCTATACCGCTCGGCATTATAGCAGCCAAACGATTTCATAAGTGGACGGATAAA
4791	67	96	MW2_CDS_10375	MW1960	FALSE	unmapped	GCAGCCACTAAGAAGAAGCCTATCCCAGCGAGGCTTGTAAAGCAAAAAAGATATTTTTCA
4792	67	94	MW2_CDS_08122	MW1529	FALSE	unmapped	TTAGTAATACTAGTACAGTTGTTGGTCTTGGACCGAGAATTTTACGGGCAGAAACTGCGC
4793	67	92	MW2_CDS_02925	MW0539	FALSE	unmapped	CCGTGGCACCATGGGCATATGTTGGATTTGATAATATTCCACAAACAGCAGAAGAGTTTA
4794	67	90	MW2_CDS_09752	MW1831	FALSE	unmapped	ACCTGATTTACATTTTACAATTATTGATTTTAATCAAGAACTGCTTTGTATTTATATTGA
4795	67	88	MW2_CDS_13329	MW2522	FALSE	unmapped	AGCAGAAGCACTTGACCCTCAAAAGACAATGCCTAGAGGTATTCTTGGTTCTTTAAGTGT
4796	67	86	MW2_CDS_06761	MW1262	FALSE	unmapped	TTGAAGGTAAAACACCCGAAACATTGAAAAAGACATTTGATAGTCAACGTAAACGTAATA
4797	67	84	MW2_CDS_11873	MW2251	FALSE	unmapped	TAGGCGGACTGGAATTAGCAATTGATGAACAAGCAATATCAGCAGACCACTTAGTAGCTT
4798	67	82	MW2_CDS_02721	MW0503	FALSE	unmapped	ACTGGTGTTGTTCACTTACCAGAAGGTACTGAAATGGTAATGCCTGGTGATAACGTTGAA
4799	67	80	MW2_CDS_05966	MW1109	FALSE	unmapped	TTTAATGGCAAGTGAACAAGCAGCGAGTATTGTTGATGCAGAAGCAGTTGTTATTCCAAC
4800	67	78	MW2_CDS_10773	MW2035	FALSE	unmapped	TACTGATTTAGCACTGGTATATCCAATGCATAAAAACCCGAAAGTTCGAGAGGTGGCTCA
4801	67	76	MW2_CDS_05498	MW1018	FALSE	unmapped	TGGCAGAAAATAGGCTGACGTTAACAAAAGGAACAGCAAAAGATATTATAGAACGATTTT
4802	67	74	MW2_CDS_12848	MW2431	FALSE	unmapped	AAGGTAGAGCATCAAGTGCATTATTAGCAGGATCATATTTCGGACCTGTATTAGCACCAA
4803	67	72	MW2_CDS_09807	MW1841	FALSE	unmapped	ATTTCTGTTCCTTGTGGACAATCAAATGGCCGACCAATCGGTTTACAGTTCATTGGTAAA
4804	67	70	MW2_CDS_06055	MW1126	FALSE	unmapped	GCCAAGAGCGATTAGAGCGATGATTGTTGGAATTCCAAATGTTGGTAAATCCACATTAAT
4805	67	68	MW2_CDS_11336	MW2143	FALSE	unmapped	TTCACCTGTTGAACGTGTGAACTATACTGTTGAAAATACACGTGTAGGTCAAAGCAGTGA
4806	67	66	MW2_CDS_12348	MW2338	FALSE	unmapped	GATTTACAGACTGCTCGTCGAAATTTAAATAGCCCTAACATTAAAACAAGAAAGCGTGCT
4807	67	64	MW2_CDS_01430	MW0263	FALSE	unmapped	GACAGCAAAAATTTGCGGTTAAAGATGTAGTGGGTCGAGCATTGTTAAGTAGCGATGACA
4808	67	62	(-)3xSLv1		neg		
4809	67	60	MW2_CDS_02849	MW0524	FALSE	unmapped	AGAAAGAACATTCATATTCCAAATGGAGATGCCGATGATATGAATGCGGAAGCGTCAAAA
4810	67	58	MW2_CDS_06584	MW1229	FALSE	unmapped	TGGTGGATCAGCAGACCTTGCTGGTTCAAACAAATCCAATGTAAATGATGCAACAGATTA
4811	67	56	MW2_CDS_07134	MW1332	FALSE	unmapped	TGTTTAATGATTTTTTCTAGTCAAAAAACGACTTATTTTGGTTATATGAATAGTAATACA
4812	67	54	perR_tiling_012_R		FALSE	unmapped	TATCTTGGCATTCTTTACAAACTCCATAAATTTCCATTCGATGATGTGTTACGTCAAAGT
4813	67	52	perR_tiling_105_R		FALSE	unmapped	CTTTTTACCTTTTAATGTATCATTTGTAATGACAGTTCCGTCTTGATTTTCTAATTTAAA
4814	67	50	MW2_CDS_12469	MW2360	FALSE	unmapped	GTTGGACATCACTTATTCATTAAGCTTGGCAATTATCATCAAACGATATTTCCAGAAGCA
4815	67	48	MW2_CDS_12292	MW2327	FALSE	unmapped	AATACAACGAAAACGACAGTGACATCAACATCGGTATTTCCAACAAAAGAAGCCGCTCAA
4816	67	46	MW2_CDS_12881	MW2438	FALSE	unmapped	ATTAGCTGCAAGTGAACAAGTCATTAACTTGTTTAAGACACGTGGGGCAGTAGTCGAAGA
4817	67	44	ETG05_66023		pos		
4818	67	42	MW2_CDS_09136	MW1713	FALSE	unmapped	AGCTATCATATGAAAGCATTAGTAAAAACCAACTTAGTTACGACACGAAAAATCGGAAAT
4819	67	40	MW2_CDS_03866	MW0707	FALSE	unmapped	GTCATTGCTGGCGGATCCGCATTTTTAACATTCAGCTTTGTGCAACGCTATATACAAATT
4820	67	38	MW2_CDS_10735	MW2028	FALSE	unmapped	CAAGCAGAAATTACGCAACAAATTACTGAAATTGTTGGTGGTTCCGCAGCGCTTGAATAA
4821	67	36	MW2_CDS_03535	MW0648	FALSE	unmapped	ACCAGAATTAAGTAATGCATCTGACAAAGTCGCTTCAGCTTCTTCTTTATCTCAAGATGA
4822	67	34	MW2_CDS_09460	MW1777	FALSE	unmapped	GAATTAAACAAAGGCGAAATCGTTGGACTTATTGGCCTTAATGGCGCTGGTAAGAGTACA
4823	67	32	MW2_CDS_01873	MW0342	FALSE	unmapped	AACGTCAACAAAATGAATTCCAAGATTACGGTCAAGGATTCGGTGGTCAACAATCAGGAC
4824	67	30	MW2_CDS_10084	MW1897	FALSE	unmapped	GGACGAATTACAGGTGGGGAACCTAGCGATACAAAAAAGTTCGTGACAGAGAATCAGAAA
4825	67	28	MW2_CDS_12276	MW2323	FALSE	unmapped	CACATGGCATGAGGCACGGACGACAGAATCAAGCGTTAGAAGCATTTATTTCTGAATTAG
4826	67	26	MW2_CDS_02777	MW0512	FALSE	unmapped	TGCAATAGATATAAGCAATTTCAAGATGTAACACAACTAAATCAAGGTGTAGTTAGTGAT
4827	67	24	MW2_CDS_08440	MW1588	FALSE	unmapped	AATGGTCATGGTACTGAATTAACTTTCGAAAAACCTGCTATTAAACAAGTTGACCCTTCA
4828	67	22	MW2_CDS_10595	MW2000	FALSE	unmapped	TCGAGTAAAGGTGGCACACCATTAATAGTCATTGAAAACAATGTCATGCTTGGCGTGATT
4829	67	20	MW2_CDS_06615	MW1236	FALSE	unmapped	TGCATTCCCATTCTCCTTTGTCGTCATACTCATGATGGTAAGTTTCTACAAGGATGCGAA
4830	67	18	MW2_CDS_03760	MW0688	FALSE	unmapped	TGCACTCAACTTTGTTGGCTTAGGTCTCATTGTTCAAAACGCTGAAAACGTACAAGATGG
4831	67	16	(+)E1A_r60_a20		pos		
4832	67	14	MW2_CDS_08421	MW1584	FALSE	unmapped	TTGGGTTGGTGCATACGTTATGGAAACCGATGCCAGGACGTTTTAAAGATTATATTGCAA
4833	67	12	MW2_CDS_13616	MW2573	FALSE	unmapped	GCACAACAAATACATGAAGATGATCATGTGATTGTGGCTTCAGATGCTAGGCACAATCGA
4834	67	10	MW2_CDS_13052	MW2470	FALSE	unmapped	AAATGTGGTACATGTGACATTAATCGTGATTGTTGTGGAACAGAACAGCACACAGCGAAT
4835	67	8	MW2_CDS_11874	MW2251	FALSE	unmapped	CTGTTACGGTCAATGCTGCTAAAGCAATAGACATTAACGCGGGTACAATTAACACAGGTG
4836	67	6	MW2_CDS_09407	MW1768	FALSE	unmapped	TGTTAAATGGGGTGTTAAAGCAAACGAATTTGTTACGCCTGATGGAAAAAAATCTGCGCA
4837	67	4	MW2_CDS_09241	MW1734	FALSE	unmapped	TCATGTACTGCCTTCATTTTCAGTAGCATATGGAGCGACAGTGAGCGGCTTATCAAATAA
4838	67	2	MW2_CDS_13037	MW2467	FALSE	unmapped	AAGTATTAGTTATTGCTACAGATACAGCACGTTATGGATTGAATTCAGGCGGCGAGCCAA
4839	67	163	MW2_CDS_12313	MW2331	FALSE	unmapped	ACAAGACAAAAGATAGCAAGTCTTGGAAAGCTGCAGAGAAAGATAAAAAAATAGCGAAAG
4840	67	161	MW2_CDS_00985	MW0183	FALSE	unmapped	TAGCTGAATGGGGCAACATTTTACGTACCGGTAGTAACTACTTGGAAACGCACAGTAATT
4841	67	159	MW2_CDS_13330	MW2522	FALSE	unmapped	CATTTATTCCAGAACACAAAGTAACTGCTACAGGTGACTTTGGTGGTTGGCAAGGCATAT
4842	67	157	MW2_CDS_12904	MW2442	FALSE	unmapped	CATTTACGGCACCAGAAGGGTTTGACATCACAGTTCATTCAAATACTGACCTTGTTCCAG
4843	67	155	MW2_CDS_08522	MW1605	FALSE	unmapped	TTCTCTCTCGTTAAGTATGATTTATCCAGTAGCTTTTATCATTATTAGTATGACCACGCA
4844	67	153	MW2_CDS_08423	MW1585	FALSE	unmapped	AATTGTAGAATACGCAAAAGACAGAGATGTTGATATCGTTGTAGGACCTGAAGCGCGTGG
4845	67	151	MW2_CDS_04317	MW0795	FALSE	unmapped	GCGATTATGGGACCAAACGGGACAGGTAAATCAACTTTATCATCTGCAATTATGGGACAC
4846	67	149	MW2_CDS_04070	MW0742	FALSE	unmapped	GCTGAACATACTTCTAAACGTGAACGTCGTGCTATTGAGGCAGAACGTGATACTGATGAA
4847	67	147	MW2_CDS_04392	MW0809	FALSE	unmapped	AAGGCTATATCGCTCATATTTTAGGTGTAAATGCTGAAGAAGGCGATGAAATTACTGAGT
4848	67	145	agr_tiling 169_F		FALSE	unmapped	TAAAATCCATCGCTGCAACTTTGTAGACAAATGTTAAATAGGTAAGTTCACTGTGACTCG
4849	67	143	MW2_CDS_00580	MW0108	FALSE	unmapped	ATGAACCAACAGCCACACATGCAACAAGGTCATATGCAATCATCAAACCATCAAATGATG
4850	67	141	MW2_CDS_03734	MW0684	FALSE	unmapped	TGTTGCGCCATGTGTTGAAGAGAACGCAATTATCCGTGACTTGGATATTATGAAACCAAT
4851	67	139	MW2_CDS_03470	MW0636	FALSE	unmapped	TGGGTTGGCTTTTTAATCTATCAATTTGGCTTTCATAATCAGCATTTATCATGGGTGTTT
4852	67	137	MW2_CDS_09726	MW1826	FALSE	unmapped	TGGGAAGATGTCCAAATTCAACATGGAATTGGCGACCTACATATTGACTTAACAAAAGCT
4853	67	135	MW2_CDS_02933	MW0541	FALSE	unmapped	ATATATGTTGCTAAGCGTGACAGCAGTCTTCCCTTTAAAGGTTTTGCTGCAGCAATGATT
4854	67	133	MW2_CDS_11425	MW2165	FALSE	unmapped	GTCATAAATTAGGTGAGTTTGCTCCTACTCGTACATTCAAAGGACACGTTGCAGACGACA
4855	67	131	MW2_CDS_12371	MW2342	FALSE	unmapped	CAGAACTCTAAAGGTGTTAAATGGGGAGTTAAAGCAAATTCATTCGTTACACCGAATGGT
4856	67	129	MW2_CDS_01264	MW0232	FALSE	unmapped	AAAATCGAGCTACTTCAGATCAAGTGGACATGATGGGTTTATGCAAGATTTTGTGTTGCT
4857	67	127	MW2_CDS_02757	MW0509	FALSE	unmapped	GGTACTGCAGCAGTTATTTCACCTGTGGGTACATTGAGATACGAAGATCGTGAAATCGTT
4858	67	125	MW2_CDS_05149	MW0952	FALSE	unmapped	GCCAACACGTGAGCCAGGTATTTCTCCTTATGAAATGATGCTTTCAGAAACTCAAGAACG
4859	67	123	MW2_CDS_11337	MW2143	FALSE	unmapped	ACATTGGATGTTTGGACTAATGGTTCAATCACACCACAAGAATCAGTTTCATTAGCAGCA
4860	67	121	MW2_CDS_00225	MW0042	FALSE	unmapped	AATGAATATGTACGGTTAGGAGAAAAAATATCGTATACAAAATTGGAGAATCATTGGAAA
4861	67	119	MW2_CDS_07916	MW1491	FALSE	unmapped	TGAAAGTAGGGATTTAACAACTGTAGATTTCGAATTTTTCTCAAGAGATATTCTAGATGA
4862	67	117	perR_tiling_040_R		FALSE	unmapped	ACTTCATTCTCAATTAGATCATTCTTATTGAGAAAATTAACTAGATTGTTTTTAAAAATA
4863	67	115	MW2_CDS_06108	MW1135	FALSE	unmapped	ATGCAATCATGATTTTCTTATTGTAAATATGAAGGGTGAAGCAATCACTGAACGCGGTGT
4864	67	113	MW2_CDS_02197	MW0406	FALSE	unmapped	AGCTGAATGGGATCCAGAATATGGCGATCGTCATACACAATTTGTCATTATTGGTACCGA
4865	67	111	MW2_CDS_11494	MW2179	FALSE	unmapped	AAACAACGACACCAAGTAAATTGACGCAAGAACAAGGAGATTATGCAACGACGGTATCTG
4866	67	109	MW2_CDS_03989	MW0728	FALSE	unmapped	GCGTTAATTCATTCTGATGCGCCTAAGCTATATGTTTCTAATGTGATGACGCAACCTGGG
4867	67	107	MW2_CDS_09341	MW1754	FALSE	unmapped	TGCTTCTGATGTAAAAAATGATGATAACAGAAATGCATATGGCGTCTACTTTACACCAGA
4868	67	105	MW2_CDS_02097	MW0387	FALSE	unmapped	AAAGAAAGAGAAGTCGATGTTAAAGTAACAAGAAAAGCAGACAGAGATACTACATCAACT
4869	67	103	MW2_CDS_03224	MW0593	FALSE	unmapped	CGGTGAAGAAGGCAACAAAGATAAACAAGATCCACACGCATGGTTAAGTTTAGATAACGG
4870	67	101	MW2_CDS_09253	MW1736	FALSE	unmapped	CTCATTGAAAATTTAGATGATGAAGTATTCCATTTAAGTGTATTACAAGACATGAATCGT
4871	67	99	MW2_CDS_00500	MW0094	FALSE	unmapped	CGACAATGGCAATGGGTTAAAGACATTATCGAGGCGTATCAAGAAGCATTTCCAGAGTTG
4872	67	97	MW2_CDS_05765	MW1072	FALSE	unmapped	TGCTACACCAAACAATGCATCACAAGAAAGTTCAAAAATGTGTTTATTCGAACCACGTGT
4873	67	95	MW2_CDS_02250	MW0416	FALSE	unmapped	GGCTATTGCAAGAGCGCTTGTTACTAATCCGAAAATACTCCTATGCGATGAAGCAACAAG
4874	67	93	MW2_CDS_01270	MW0233	FALSE	unmapped	GAAGTTATTCAAGTATGGCATGCCGTTGGTGCCTTTAAAACAGTTGGCTTTAGTCGTACT
4875	67	91	agr_tiling 032_F		FALSE	unmapped	ATAATTAATTACTTTCATTGTAAATTTGTTATCTTCGTATAGTACTAAAAGTATGAGTTA
4876	67	89	MW2_CDS_06656	MW1243	FALSE	unmapped	GCTGGAGGTATTTTCTTAACAATAGCAGTTACACTGTTTGCATTTTCATCTGTGGTAGGT
4877	67	87	MW2_CDS_08387	MW1578	FALSE	unmapped	ATTTATTGAAGCAACAAACTGTTGTCATACTTGGCGTTGGAGGTGTTGGTTCATTTGCTG
4878	67	85	MW2_CDS_02206	MW0407	FALSE	unmapped	TGCAGGAATTGTGAATGCAGGTGGTGTTATTCTAACTCGTTTTGCGCCGATATTTGATAA
4879	67	83	MW2_CDS_02339	MW0432	FALSE	unmapped	ATCCTGAAACGAGTTGGCAAGCACTTGCGAAAGTAAAACATTTAAGAAAATCTCCTTGCT
4880	67	81	MW2_CDS_03307	MW0608	FALSE	unmapped	CAGCATTGTGAATGCCATTTTTGGTGGTGTAAGCGTTGGACTAGGAATCGGAGTAATTAT
4881	67	79	MW2_CDS_01618	MW0295	FALSE	unmapped	TCAGTCGTTGGTGGTGCGATAACACGACCAAAAGAAATTACGAAACGTTTTGTTCAAGTT
4882	67	77	MW2_CDS_05073	MW0939	FALSE	unmapped	ACAGATCAAAACTTAAATCAAAATCAAGGTGGCACACAACAAGCGCCACAAGCTTCAAAT
4883	67	75	MW2_CDS_12859	MW2433	FALSE	unmapped	CCAAAAAGCGCAAGAAGGTGTTACTTTCTTAATTTCGAGTCATATTTTAAGTGAATTAGT
4884	67	73	MW2_CDS_07390	MW1380	FALSE	unmapped	TAGCTGGTGCGATTCATGGTAAGCCTATAGGTGGTTTGGTAGCTGGTAATGTTAAAACAT
4885	67	71	agr_tiling 074_R		FALSE	unmapped	AGGCTTGTAAAGCAAAAAAGATATTTTTCAATTATAATTAGTACAATTCTTTTCATTATC
4886	67	69	MW2_CDS_08080	MW1521	FALSE	unmapped	TTGCAATGATTGTTGCTATTGTCTTTGGTCTCGTACTAAATATTAATCGTATTGAGTGGA
4887	67	67	MW2_CDS_08142	MW1532	FALSE	unmapped	GTCAAAAAAGAAATCGGTAAAGAACCTAACAAAGGAGTAAACCCGGACGAAGTAGTGGCA
4888	67	65	agr_tiling 186_R		FALSE	unmapped	TAGCTTTGTCGTCAATCGCCATAATATTGAATCTATAGATTCGAAAGAGCGAATTGTCTA
4889	67	63	MW2_CDS_03507	MW0643	FALSE	unmapped	AGATCAAAAAGTGTTTGAACAATCACTATTAAAAGTCATTCATCGAATTAAGGAGCTGGA
4890	67	61	MW2_CDS_13498	MW2553	FALSE	unmapped	GGATCGATGTTGCCAAAAATAGAAGCTGCGATACGATTTGTTGAAAGTGGGGAAAACAAA
4891	67	59	NC_S_072		FALSE	unmapped	GAGCACGCTTAAAGAGAACAATGCAACAAGGTATATCAACGTACCGTGATGCAGTGTCTA
4892	67	57	MW2_CDS_13921	MW2628	FALSE	unmapped	ACCGCTAGTTAAAAAAGGTGGACAGTTTGTTGCATTAAAATCTTCAAAAGGTGAAGAAGA
4893	67	55	MW2_CDS_02513	MW0465	FALSE	unmapped	ACCAAACCGTCGTAAAGCGGACATTGAAGCTAAGTATGTAGGTAAAAAAATACCAGATGA
4894	67	53	MW2_CDS_07967	MW1501	FALSE	unmapped	TTTCAGTTGGGGCTAGTGGTGCTATATTTGGTCTGATTGGATCAATTTTTGCGATGATGT
4895	67	51	MW2_CDS_01511	MW0277	FALSE	unmapped	AAGTTTGGTGTTTTACCAGAAACGGAATATGAAATTAATAAAGTTAAAGAAATCGAGCAA
4896	67	49	MW2_CDS_01978	MW0364	FALSE	unmapped	TAAAGGGATTACTAAAATCTTAACCATTGAAGCTTCCGGTATCGCACCTGCAATCATGGC
4897	67	47	MW2_CDS_00471	MW0089	FALSE	unmapped	ATATGCGAATGAGTTAAATTGGCAATCCCATTATCATGGTGCAGGCACAGAGATTGTTGA
4898	67	45	MW2_CDS_11181	MW2112	FALSE	unmapped	ATCAGGGCATTACCAACCAACAACGACACAAGTTTTTGAAGGTTTATCACCTGAAAACTT
4899	67	43	MW2_CDS_11712	MW2220	FALSE	unmapped	AAAATGGTAATCCTGAAGTGCATCCAGGACCAACATTATTGAATGTCGGTCGCATTGATT
4900	67	41	MW2_CDS_12966	MW2453	FALSE	unmapped	AATAGGTAGTGCTGTCACTGCGGTAGGTGATAACAATCCATATGCATTAGCGGTCATTTT
4901	67	39	agr_tiling 089_R		FALSE	unmapped	TAACTATAAGAGAAAGTGTGATAGTAAGTGGAAGCATTAAATGATTATAATTACGTTTTA
4902	67	37	MW2_CDS_01471	MW0270	FALSE	unmapped	ACTTTCTTTTTTGGTTTAGATTATGAAAGGTTTCCAAACTATTTAAAGATAACGACAATT
4903	67	35	psma_tiling_012_F		FALSE	unmapped	CTTCAATTAACAGTTGGTACGATGGTTTTGCCATTTTTCATCAAAGCAAACATAAAAAGG
4904	67	33	MW2_CDS_07243	MW1353	FALSE	unmapped	ATTCTCTCGTATGGCAGATTGTAGTTTACAAAGTGGTAACTATAGTGATGCGATTCGCTT
4905	67	31	MW2_CDS_09896	MW1856	FALSE	unmapped	TCTCGTCCTTTAAAAACACAATTAGGTATGTATCGATTTTTCGTTCAGGCTGATTCTGCA
4906	67	29	MW2_CDS_02845	MW0524	FALSE	unmapped	ACACCCGAATGTTGAGATATATTTAGACGACGAAGCTTGCCCGAAAAATGTTGCGAAAAT
4907	67	27	MW2_CDS_11452	MW2170	FALSE	unmapped	TATGATCACCGCGTGATTGATCAATCAGCAGAGAAGATTGTAGAAACAGCGAAACGTTCT
4908	67	25	pMW2_025		FALSE	unmapped	GTTTTCGAAAGTTGGTGTTCCTCGTGGTCGTGGAAAAATAGAACGATTCTTTCAGACAGT
4909	67	23	MW2_CDS_07133	MW1332	FALSE	unmapped	GCAGAAAAAGTTGTAAGTGAAAAAGATGGATTAGTCAAACATAATATCAAAGTAGAACCA
4910	67	21	MW2_CDS_08764	MW1647	FALSE	unmapped	TGGAGCAATTCGGTATTCAGCCAAATGAAGCATCTCAGTTTGTTAATACAATTGCTGACA
4911	67	19	agr_tiling 048_R		FALSE	unmapped	AATATTAAATACAAATTACATTTAACAGTTAAGTATTTATTTCCTACAGTTAGGCAATAT
4912	67	17	(+)E1A_r60_a22		pos		
4913	67	15	MW2_CDS_12269	MW2322	FALSE	unmapped	GTTGGTAAAGAGTTTTGTCGATTTGGTACGCAATACACGACACGACTTGGCATTCGTTTA
4914	67	13	MW2_CDS_08014	MW1510	FALSE	unmapped	GTTAAAGCGCACAATCAGCGTCAAGCAAGAATGCGCAAAGATGACCATTTAACTAATCAA
4915	67	11	MW2_CDS_01481	MW0272	FALSE	unmapped	TCGAGATCAGGATTTATGAATTCAGTATATGAGTTGCATGATCAATTTGAAAAACTAAGA
4916	67	9	MW2_CDS_01850	MW0337	FALSE	unmapped	GCATTAGTGTTGAAGGTGTTATTGCAAGTGCTGGTGTCGTAGGTTTAGCAGTAGGTTTTG
4917	67	7	MW2_CDS_08942	MW1678	FALSE	unmapped	ACCTAAAAGATGGGAAGATCGTTTAAATGATTATACCTATGTCCCCCGCACAAAAGAAAT
4918	67	5	MW2_CDS_12337	MW2336	FALSE	unmapped	AGGTTTAGACGCAGGGCGTTTTGATGTAATCGCGAACCAAGTAGGTATTAATCCTGATAG
4919	67	3	MW2_CDS_09712	MW1824	FALSE	unmapped	AATCTGTTTTTGAACCGGAAGTTTTAGTGAAAATGCGTAACCGTATGAAAAAGCGCGCAG
4920	67	1	MW2_CDS_07312	MW1366	FALSE	unmapped	TAATGATGTGACGCAACATGTTTCATACGTTGCATCTAAAGAGCCAGTACGTTCATTCGC
4921	66	164	MW2_CDS_12676	MW2397	FALSE	unmapped	AATGTTCGGCGATGCTGTAGGATCAATGGGAACATTTATCGTTATTGTGTTTTTTGCAGC
4922	66	162	MW2_CDS_06956	MW1299	FALSE	unmapped	AGGTCAACAAGAAATTGTCTTTGTAGATGGTCCAGTTATTAAAGCTATGAAAGAGGGGCA
4923	66	160	MW2_CDS_05773	MW1074	FALSE	unmapped	ACGTATCTTTTTATGGTGGACCTAATGCTGAAAGAAAAAGAGCAATCATTTCGCCGAACT
4924	66	158	MW2_CDS_04124	MW0755	FALSE	unmapped	AACAACAGGATGTTATGAGGTACATGTTAAGTAGTGGGAAAGTTAAAAATGAAGGAGTCA
4925	66	156	MW2_CDS_04891	MW0901	FALSE	unmapped	ATAATGACGCGCTGTTGAGTGGAGACTTAACACCTGTATTTTTCGGTTCAGCTTTAGCTA
4926	66	154	MW2_CDS_13723	MW2592	FALSE	unmapped	TAAAGTATATGACTGGGTACAGCAAGTAGAACAGTTAGGTGCAGGTGAGCTCCTCGTTAC
4927	66	152	MW2_CDS_04277	MW0787	FALSE	unmapped	ATCCATCCTTCGCGCTAAAATCAATGTTTGGTGGTTATGATGAATTGATGGAACCTGTGT
4928	66	150	MW2_CDS_05648	MW1049	FALSE	unmapped	AGTGATAAACAACAAACTATCATCGGTGGACATGAATTTTACAAAGGAAATAAACCAGTA
4929	66	148	MW2_CDS_12646	MW2392	FALSE	unmapped	GGGATCGACACATTCAAACTCAACAATGTGTCAACGAATCTCTGCTTTAGCTGAGCAATT
4930	66	146	MW2_CDS_07132	MW1332	FALSE	unmapped	GATTTCAAGCCGAAAAAAGGAGACTTTGTAAAATTAGTTTCTAAAGATGATGGGAAGACA
4931	66	144	MW2_CDS_06941	MW1297	FALSE	unmapped	GGTTCATTCGGAAAATATTTATTGGGCATCATTGTGGCTCTGGCATGTCTAACTACAGCA
4932	66	142	MW2_CDS_02796	MW0515	FALSE	unmapped	TGATAGTGAATTCCAATTACGAGCAAGATTATTTGTCGATCAAATTGTATCTTTTGTGAA
4933	66	140	MW2_CDS_04227	MW0776	FALSE	unmapped	ATTGGCCGAACACGTTAGTGAAGATAAAGCATTCCCTCGATTAGAAGAAAGACACCAAGT
4934	66	138	MW2_CDS_10182	MW1920	FALSE	unmapped	CAAACCTCATGTTAAACAATCAAAAGAAAAAACGCCTAAATGGCTCACAGACGGCACGAG
4935	66	136	agr_tiling 120_R		FALSE	unmapped	TATTTATTCTCAATTTACTCTTAAAGAAATGAAATATAAACGTAATCAAGAAGAAATTGA
4936	66	134	psma_tiling_006_R		FALSE	unmapped	AATAAAAAGTTAAGATGTTCTTAGGATCTTTTTGTTTTCAATCTATCTAAAGTGTGATAG
4937	66	132	MW2_CDS_01503	MW0276	FALSE	unmapped	AGGTCTTGAACCATGGACATCATGTGAATTTGATTTTACAAGAGAGGGTAATTTGAAAGT
4938	66	130	MW2_CDS_07537	MW1415	FALSE	unmapped	AAGAAAATGAAAAGGAACCACGAAAGACAAGATGGAACAGCAGACGCAGGAAAAGGATAC
4939	66	128	MW2_CDS_01530	MW0281	FALSE	unmapped	ATTGGAGCTGTAATAAGTGGTAACATAATTACATTTGCTTTATGGTTAGTCAGTGGTATT
4940	66	126	MW2_CDS_13587	MW2569	FALSE	unmapped	ATATTGATTGGCTTGTCAAAGCGGTTATCGTGGCTAAACGACAAGTGCCAGAATTAACAT
4941	66	124	agr_tiling 203_F		FALSE	unmapped	AGGAAATTGTAGCATTTTATTTATGGAAACTGTCAATTTCAAATTTAGTATATTTTGTTA
4942	66	122	MW2_CDS_09436	MW1773	FALSE	unmapped	CATTTATCGAAGATGCGGTTGAACAAATGCACAATGATGGCATTACTGAAGCAATCACGG
4943	66	120	MW2_CDS_13649	MW2579	FALSE	unmapped	ACGATTAAGACGCCAGGAATTAAAGATGCGAAAATGAGATTCGAATGTAAACTATCGCAA
4944	66	118	NA		ignore		
4945	66	116	MW2_CDS_03770	MW0690	FALSE	unmapped	TCTGGGGCAAGTTCACACCACGTGGTGGAATTTCTATTGATCCTTATACAAACTATGGAC
4946	66	114	(+)E1A_r60_3		pos		
4947	66	112	MW2_CDS_07807	MW1471	FALSE	unmapped	CACAACCTGAAATTGCTTCTATCGGTTTAAACATTGAACAAGCAAAGGCAGAGGGAATGA
4948	66	110	MW2_CDS_10515	MW1985	FALSE	unmapped	TAGTCACATTGCCTAATATCGATAAATTTGTGGACGGTGCATCTGTAGCTAGAGTTGGCG
4949	66	108	MW2_CDS_04432	MW0817	FALSE	unmapped	ACCACAATGGTTTACAAACCATGGTTTAACGAATCAAAACTTTGATGCTCGTATGTCTCA
4950	66	106	MW2_CDS_00844	MW0156	FALSE	unmapped	AGCTGTTTGAAATTACATCTTTTGATCAACAATATGGATATGTCGGTGTTCCGACCGCTT
4951	66	104	perR_tiling_048_F		FALSE	unmapped	TAATAGAAGTATTAAAAAGTAAAGTTATTCGACATGCATATTTAGATGTGTTTGAAAATG
4952	66	102	pMW2_084		FALSE	unmapped	ACTCCTTTTATGTGGCAAAAACACTCCTTTTATGTGGCAAAAACACTCCTTTTATGTGGC
4953	66	100	MW2_CDS_03878	MW0709	FALSE	unmapped	TGGCTGGTCAAATTGCCGCTGCCTTAGTAGTTGCTTTTTATGGTGTGACTATTGATTTTA
4954	66	98	ETG04_27747		pos		
4955	66	96	psma_tiling_006_F		FALSE	unmapped	CTATCACACTTTAGATAGATTGAAAACAAAAAGATCCTAAGAACATCTTAACTTTTTATT
4956	66	94	MW2_CDS_12145	MW2298	FALSE	unmapped	TCACAGCAGATTTGCATTAGAAATTTTAACTACTATTGCCGACCATTATAATCGTAACTT
4957	66	92	MW2_CDS_04735	MW0874	FALSE	unmapped	AATTGCTGATGAACCTACAACAGCATTGGATGTCACGATTCAAGCGCAAATATTAGACTT
4958	66	90	MW2_CDS_06736	MW1258	FALSE	unmapped	TCTTGCATCAGGTATAGAAGTAAATGGGCGAAAAGATATAGAAAAAATGACAGCAATTGT
4959	66	88	MW2_CDS_13892	MW2622	FALSE	unmapped	TTCCAGCTGGTTTATTAGGTGGCGCCTATTATTTAAAACGTCGTGAAGAAAAAGGCAAGT
4960	66	86	MW2_CDS_08351	MW1570	FALSE	unmapped	ACATGTATTAACGATTGATAAAAATCATGTTGATGCAAGATACAATTTGGGCTTAGCGTT
4961	66	84	MW2_CDS_05883	MW1094	FALSE	unmapped	AGGCTTTGCAGCAGAGACTGAAGATATTGAAAATTATGCACAACAAAAATTACGCAAGAA
4962	66	82	MW2_CDS_11583	MW2195	FALSE	unmapped	TGGCAAATACCAATCATATTTGTGACACATTCAAACTATGAAGCAGAACAAATGGCTCAT
4963	66	80	MW2_CDS_09432	MW1772	FALSE	unmapped	TACAATTGTCAATCGTTTGCCGAAAAGTATGCCACAGTACCATGTTGGTCACATTCAACA
4964	66	78	MW2_CDS_10827	MW2045	FALSE	unmapped	CCTGAAGAGGTAACAGATTTAGAACGCTCAGTAGAAGCTGCTGAAGTCGTTCATTCAACG
4965	66	76	MW2_CDS_11972	MW2269	FALSE	unmapped	ACGCTATTTACACTAGAAGAACATACGACATACCTCTCAGAATTGTCTCTTGGCGATGTA
4966	66	74	MW2_CDS_12023	MW2278	FALSE	unmapped	CACGCAAAGACAAGGTGTAAATAAGGCCGCAGTAAGCCGACGAATTAAAAAGTTAATCGA
4967	66	72	MW2_CDS_09592	MW1801	FALSE	unmapped	ATTGCATCATTGCGACAAGCAGGCGTAAGAATTACACCTCAAAGACAAGCAATATTACGT
4968	66	70	MW2_CDS_13409	MW2537	FALSE	unmapped	GCCGAGTGAATCGCTAACGGATCGTTTTTGTCGTTTAGACCAAGAGAGATTTGGAGATAT
4969	66	68	perR_tiling_003_R		FALSE	unmapped	TTAGTTAATACCACTTCCGTAGTTAGAATGTTCTTTTCTTCTATTTAAATATTTTTCAGA
4970	66	66	NC_S_092		FALSE	unmapped	AGTACCAGTGTGACTAGTGCACGTGATGAGTACGATGGAACAGAACATGGCTTATAGAAA
4971	66	64	MW2_CDS_05915	MW1100	FALSE	unmapped	ACGATAAGATACTTGTTGATGCACCATGTAGCGGATTAGGTGTAATGAGACATAAGCCGG
4972	66	62	MW2_CDS_13715	MW2591	FALSE	unmapped	GAAATTGAGGCAGAATTAGCGCGTAGACATCATAAGCGCAATAACTTTAAAGGCGAACGA
4973	66	60	MW2_CDS_00380	MW0072	FALSE	unmapped	GATGGAGATATATCATATAATCCAGAGGTGCCGAGTTATTCAGCTCAATATCAATTAACT
4974	66	58	MW2_CDS_03165	MW0581	FALSE	unmapped	ATTCACTTTTACAATAATCAATCATTTAACTACACATGGGTAGTCGGTGGTTTGCTTGGG
4975	66	56	MW2_CDS_01801	MW0328	FALSE	unmapped	ACATGAAAAAGACTCAAGATGGATGTATTATGTATCTACTTTACCGGTTAAACGTAGTGA
4976	66	54	MW2_CDS_02976	MW0548	FALSE	unmapped	ACCGCCCACTGGCTGCGCTTACTGAAGAAGAATTAATCGAAAAAGTTTCTCAACAATTAA
4977	66	52	perR_tiling_062_R		FALSE	unmapped	TAAATTCATATTAAAAGCCTTTGCTAACTTCGCAGTTCTAGTAGCAATTGCACCTGTACC
4978	66	50	MW2_CDS_01755	MW0319	FALSE	unmapped	AAATATAAAGATAACAACGGCGGTTATGAGTCATTTGAAAAAGTATCTAAGAAAGACCGT
4979	66	48	MW2_CDS_02860	MW0526	FALSE	unmapped	ACTTTGTCACATGTTGAAGCGGATGAGTTTTCAACGTTTGCATCCAAAATACTACATGCT
4980	66	46	MW2_CDS_06243	MW1159	FALSE	unmapped	ATGAAATGCCACACTTATTGGTGGCAGGATCGACGGGTAGTGGTAAATCTGTTTGTATAA
4981	66	44	MW2_CDS_03054	MW0561	FALSE	unmapped	ACGTTTAGAAAATATATTCCTTCACTTAATATTCAATTAGAGAAAAACATGGTGATTGTA
4982	66	42	MW2_CDS_08736	MW1643	FALSE	unmapped	GGTGAAGGTGGCAGTGGAGGTGCTCTAGGTATTGGTATTGCCAATAAAGTATTGATGTTA
4983	66	40	MW2_CDS_02644	MW0488	FALSE	unmapped	AGTGAGCAACATGCTATCTTTGGATCAGGTGCATATAGAATATCATCTCGCGAAATGTGG
4984	66	38	MW2_CDS_01483	MW0272	FALSE	unmapped	TCTTTTGATTATATAGATTGGTTAAATACAGAATTTGATCAATTGGGTCGTGAAAATTAT
4985	66	36	MW2_CDS_01316	MW0241	FALSE	unmapped	GAGAGAAAATGGTAGGCGAAGGCTTGGCAATCAAAGCTCATGAAGAATCCAAAGTAATCG
4986	66	34	MW2_CDS_10224	MW1929	FALSE	unmapped	AGGAACTCTATAGGTTTGATGATGAGATTGTACTTCAAGCACAACAGACCATTAGAGATT
4987	66	32	MW2_CDS_02146	MW0395	FALSE	unmapped	AGCTGGTACTGAGGAAGAAAACACAGATGCTAAAGCTACATACACAACACCACGATATGA
4988	66	30	NA		ignore		
4989	66	28	MW2_CDS_09553	MW1795	FALSE	unmapped	TCGAAGCGTTAGGTGTACCAGCAGGTCAAGTTTATCCAATTGCTTATGAAAAAGATGCAA
4990	66	26	MW2_CDS_01286	MW0236	FALSE	unmapped	AAAGAGTTAAGTCAAGTGCGTGCATACTTATCACTCGAACAAGCACGTTATCCAGGAAGA
4991	66	24	MW2_CDS_08847	MW1661	FALSE	unmapped	GCAGCAAGCCTTATTGAAGATGAACATCATATGATTGCTATTTTAAGTAACATGTCTGCC
4992	66	22	MW2_CDS_12789	MW2420	FALSE	unmapped	TGAGAAGAGTGAACCAATTGAATTAGACATTAAATCAGAGCCGCCAGTGGAGAAGCATGA
4993	66	20	MW2_CDS_06831	MW1275	FALSE	unmapped	AGTCAGGAAGCAATTAGAGCTGTACCTAACTCAGTACGCGAAGCTTCTTATGGTTTAGGT
4994	66	18	MW2_CDS_04707	MW0869	FALSE	unmapped	TTCATTGGTATAGGTGTACCCGCACCTCAAACATCGTTAGGGTCATTAGTAAATGATGGG
4995	66	16	MW2_CDS_00824	MW0153	FALSE	unmapped	ACCAGAAAACATGGATACGATTATTCATGCAGGTGCTCGTACAGATCACTTTGGTGATGA
4996	66	14	pMW2_027		FALSE	unmapped	ACCACGCCTATCAGTCATTGGAATAGTAATCACTTTTTCCCTAATATGCCAAGTAGCTTA
4997	66	12	MW2_CDS_06795	MW1269	FALSE	unmapped	TGGGGCGCTATGTTGCAACAAGGTCGTGATTTTATTTCGTCTCATCCAATTATGTTGATT
4998	66	10	MW2_CDS_06545	MW1221	FALSE	unmapped	TCCTTTTAGTAGAGATGGTCAAATGCGCGTAGTTGACAATAATCAAGGTGGAGGAACACA
4999	66	8	MW2_CDS_05517	MW1022	FALSE	unmapped	TCAACCATTGCACATGTTTGATCAAGATGCGATTGGTTCACAACAAATTGTTGTTCGTCA
5000	66	6	MW2_CDS_11011	MW2083	FALSE	unmapped	AGTCCATATCCTGTTGCGATACCACACCTAAGAGACAATATGATTAAACACCCTATGGTT
5001	66	4	MW2_CDS_11026	MW2085	FALSE	unmapped	TGTGAATACAGGACATGCATATTTAGCGTATGCTGGTAAATTTGCAGGTAAAGCTACCGT
5002	66	2	MW2_CDS_11675	MW2212	FALSE	unmapped	TGGAACATTACTCTCATTACGGCTCTGCTTACTTCATACATGAAGATGTTAACCAAAAAC
5003	66	163	MW2_CDS_12377	MW2343	FALSE	unmapped	ACTGTGAAATACGAGGTCAATTGGAAGACTCATGAAATCAAGGTGAAAGGACAGAATTGA
5004	66	161	MW2_CDS_09016	MW1692	FALSE	unmapped	GATGAACTATTTTTAGTCGATTGGGAAGGTGCAATGATCGCAGACCCGGCAATTGATATC
5005	66	159	MW2_CDS_04473	MW0826	FALSE	unmapped	AGAATGACAAAGAACAATTAATTACAGTTATGCGTGGTACAGTTGCTATTAAGCCTTTAA
5006	66	157	(+)E1A_r60_a135		pos		
5007	66	155	MW2_CDS_05798	MW1078	FALSE	unmapped	GGCTATTTTGGGTTTCACTCGAATGTCAGTTCGAGGAATAAATAAAGTTAAACGAGAGCT
5008	66	153	MW2_CDS_06490	MW1211	FALSE	unmapped	AAAGAAAAACAAGATCGCTATGGTAGAACATTGGCGTATGTATGGATAAGTAAAGATCGT
5009	66	151	perR_tiling_027_R		FALSE	unmapped	CATCAGCTGTTGGATGAGTATGTGAAGAAATTAAATAACGTAATATTGCTTGTCTTTGAG
5010	66	149	(+)E1A_r60_a107		pos		
5011	66	147	psma_tiling_046_F		FALSE	unmapped	AAATTCACTGGTAAGTAAGTTATAAAAATCTCATAGATATGAACATCTTATTTGAAGGGG
5012	66	145	MW2_CDS_05168	MW0956	FALSE	unmapped	CGGTTAAACACATGAATCCATGTGGTGTTGGTATCGGTGACACGATAGAACAAGCATTTC
5013	66	143	MW2_CDS_03861	MW0706	FALSE	unmapped	ACAAGTGCTGTAAATACATTTTTAGAAGTTACACTGATTTCAGGTGCGATTGCTTTCGGT
5014	66	141	NC_A_103		FALSE	unmapped	AATGGAAAGTAATAAGTAATAATTTATTGATAAGCGCCTATGTGATGGTAAATCATGACA
5015	66	139	MW2_CDS_09585	MW1800	FALSE	unmapped	ACCAGTTTTAGTACCTATCGTTAGTGGGGGTATCGGTCTAATCACATTACCTTACATTCG
5016	66	137	MW2_CDS_13376	MW2532	FALSE	unmapped	TAATGATTTCCATCCATATTTTGCACAAGCGCCATGGGGTGGATACAAACAATCAGGTAT
5017	66	135	MW2_CDS_09853	MW1849	FALSE	unmapped	TGCGACATTAGCATTAATCGCGACGTCACTAGAAAAATTTGCCGTTGAAATTCGTAACCT
5018	66	133	MW2_CDS_02995	MW0551	FALSE	unmapped	GACCTTGCAAATGATGATAAAACATTTGGAGAGGCGTTGTCGCATAATGGTATGACGCTT
5019	66	131	MW2_CDS_11598	MW2198	FALSE	unmapped	AAAATTGGTGTTGGCGTCATTTTATCTAAATCAGCTCCGACAACGCTTGCTGTAACCTTA
5020	66	129	MW2_CDS_12241	MW2317	FALSE	unmapped	AGCACCATTATATATGACGTATAACAAATTTGATACGCAAAAAGAACGTGGGCAAATGTT
5021	66	127	MW2_CDS_05018	MW0928	FALSE	unmapped	TTTGGATATTCCATGGGTGGACGTGTTGCATTATATTATGCAATTAATGGTCACATCCCT
5022	66	125	MW2_CDS_04364	MW0804	FALSE	unmapped	ACAGAAAAAATTAGCAATGGTATTGGTTCAATTTCCGCCATGGTTTGACTGCAATGCACA
5023	66	123	MW2_CDS_03959	MW0723	FALSE	unmapped	CCCATTTCAAATTGGTGATATCGTTGCGCCAAGTATAATTTTAGCGCAAGGAATTGGACG
5024	66	121	MW2_CDS_11945	MW2265	FALSE	unmapped	ATACGCGCAATTGAACCAGAAGAAGGTTTATCCGCTATGTTCCGTAACAGAGGTAAGAAA
5025	66	119	MW2_CDS_01109	MW0204	FALSE	unmapped	GTTGAAAAAAGAAGCGCCATATCTCAAGTGTGGTTATATCATTCCGTTGCAGTTTGGTCA
5026	66	117	MW2_CDS_09220	MW1730	FALSE	unmapped	AACTCAACGCAAGTTGTTCCTATTCACAAAAAGCACATACAGTTATCTGCATGGAGCACA
5027	66	115	MW2_CDS_11737	MW2225	FALSE	unmapped	ACCATACATTTCGCGGAACAAGAAAGTGAAGCATTTGATTTATGTATTGGTGCTGATGGA
5028	66	113	MW2_CDS_07045	MW1316	FALSE	unmapped	AATTCCGTGGTGATACGTTCTTTCCACCTTATACATTTGAAGACTGGGAAGTTGCCTCTT
5029	66	111	MW2_CDS_08391	MW1579	FALSE	unmapped	TTATATGAAGGACGTACAAAACAAGAAACAGGGCACCCACCTGTATATAACAGGCCGAAT
5030	66	109	MW2_CDS_06947	MW1298	FALSE	unmapped	TATGGTCAATATGCTATTTTCGTTGAAGGTGTTGCGCATTTACCTGGACATCTCTCTCCA
5031	66	107	agr_tiling 037_R		FALSE	unmapped	TCCATTTTACTAAGTCACTGATTGTTGAAATGATATCTTGTGCCATTGAAATCACTCCTT
5032	66	105	MW2_CDS_07575	MW1426	FALSE	unmapped	TGGAGGCAAAGTTCCTGCAAATCTGAAACTTCCATTACGTGATGGAGATACTGAAAGAGA
5033	66	103	MW2_CDS_11664	MW2210	FALSE	unmapped	CAGTTCTGTGATTCACAGTTTCCAACAGGTGCTTTCAGTCATTCATTTGGTCTTGAAACA
5034	66	101	MW2_CDS_04002	MW0730	FALSE	unmapped	ACCAGGTGGAAGTGTAACAGCTGGTTTTGCGATTTATGATACAATTCAACACATTAAACC
5035	66	99	MW2_CDS_11236	MW2122	FALSE	unmapped	AAAGGTGCTGTGATGACATCTACATTAGATGAAGCCTATACGCAACAATTGGCACTAAGT
5036	66	97	MW2_CDS_10405	MW1965	FALSE	unmapped	TGATAATGGCTTTGATTTCTATGCACCTCAAACATTTTTAGATGAAAAAGGCCGACGAGT
5037	66	95	MW2_CDS_08963	MW1682	FALSE	unmapped	TGCAAAAACACTTGACGGTGTAGAAGGTCAAGTTCAAGGTATTACTCGTGAAACAACAGA
5038	66	93	MW2_CDS_09818	MW1843	FALSE	unmapped	TTGTTGCCATCGCGATTGCATGGAATCCAAACGACACAATTCTAAACTTAGTAGGTAACG
5039	66	91	MW2_CDS_11807	MW2238	FALSE	unmapped	CGGTATGGAAAAACCTGACATCCTATATTTAGTTGGAAGAACTATTATTGCAACACTTGC
5040	66	89	MW2_CDS_10536	MW1989	FALSE	unmapped	TTTATCGAAATGCGCGTGCCAGCATCGGCAGAGTATGTAAGTTTAATTCGTTTAACACTT
5041	66	87	perR_tiling_059_F		FALSE	unmapped	ATTGGTCTGAGCAAGTCAGGTCAGAACAAAGATGAGTTTGACGAGATATATACTATCGAA
5042	66	85	MW2_CDS_05363	MW0993	FALSE	unmapped	ACAAGTGCAATGCATTATCTGTGATGCAAAAGTATTTATAGATGAGCGCACAACTGAGTC
5043	66	83	MW2_CDS_07044	MW1316	FALSE	unmapped	CAACGTAGTGGGCGTTGATGTAATTCACTCTATTGAAGATATTTACCAACTACCGGGCCA
5044	66	81	psma_tiling_002_F		FALSE	unmapped	AATTAAGCCACAATTTAAAAATGATTATACTTCATTCAACTTATCGTGCTGGTCTAATTT
5045	66	79	MW2_CDS_00701	MW0131	FALSE	unmapped	AAGGAACTGGCAAATGATTCAAGGTTCCATATGCAATATTTTGGAACAGGGTCGGAAAAA
5046	66	77	MW2_CDS_07067	MW1319	FALSE	unmapped	TGATCATATGACTCAAGCGCAAACAGCACATGACAATATTGTTTTTATGCGTAAATGGCT
5047	66	75	MW2_CDS_01920	MW0353	FALSE	unmapped	GGCAATTAAAAAAGCATCAAACAGTAATATGCTGCTTGATGCCCAAATGATGACTTTAGC
5048	66	73	MW2_CDS_11935	MW2261	FALSE	unmapped	CCAAGTTGTAGAACCATCATTACAAGATATATTCATTGAGAAGGTTGGTGGCAAGGATGC
5049	66	71	MW2_CDS_01060	MW0195	FALSE	unmapped	GTTGCGACAAGAGCATGGACATTCCGTACAGTTGGTTATGGACATAGTCCATATGTATGG
5050	66	69	MW2_CDS_09922	MW1861	FALSE	unmapped	CAAGCTGCCAGCGAAAATTTAGTTCCTGTGACATTAGAAATGGGTGGTAAATCTCCAGTC
5051	66	67	(+)E1A_r60_a104		pos		
5052	66	65	MW2_CDS_06384	MW1185	FALSE	unmapped	AGTTTCAGGATATGACGATCCTTTAGGTGATTATGGTAAAGGGATTTTAAAATTGGCGAA
5053	66	63	MW2_CDS_13520	MW2557	FALSE	unmapped	AGTGCAACAACAATTGCTAAAGACTTGAAAGAACTTAATATATATCGTGTCCCTATCGAT
5054	66	61	MW2_CDS_12723	MW2407	FALSE	unmapped	TCTATTTTACAGATTCGGTTGAATTTACTCCAAGCGAGGATACAAGTTATGAGTCAAACT
5055	66	59	MW2_CDS_07348	MW1372	FALSE	unmapped	TTGGCAAAATATACAATCGTTGATATGGATACTTGTATTGCATGTGGTGCATGCGGTGCA
5056	66	57	MW2_CDS_07683	MW1449	FALSE	unmapped	TGAGCAACAACGTAATTTTGAAGATATTAACATTATTAGAGGAGTGAACTACCATTTTGG
5057	66	55	MW2_CDS_08762	MW1647	FALSE	unmapped	GTGGACAGCTGGGATGAATTTGAGCAACTTGCTACAGCTTTACGCACAAAACTTAACTAA
5058	66	53	MW2_CDS_02628	MW0485	FALSE	unmapped	ATCAGCACGTAGTGGACTAGAGCGTATTCGCAATAGTTATCAATTAATTGAAGAGCGCGC
5059	66	51	MW2_CDS_06150	MW1142	FALSE	unmapped	ACCTGCCTTAACAGAAGAGCGTAGAAAAGAGCGCGTTAAAGATGTTAAGAAAATTGGTGA
5060	66	49	MW2_CDS_06180	MW1147	FALSE	unmapped	GTTATGCAAATGCGCGTAAACTGTATGGTGAAGACCTGCCTCAAATCGTAATTGATCGAT
5061	66	47	MW2_CDS_05132	MW0949	FALSE	unmapped	TGCTAGTGGATCTATTACAAAGCGTTTAGGTTTTGAAAATGGTGAAGTTTTTAGAGAACC
5062	66	45	MW2_CDS_10151	MW1911	FALSE	unmapped	ACAAGGAGACAAAGTATTGTTTCAAGGTAGTAAATATCTTGTTGATGGATCGATAGGAAA
5063	66	43	MW2_CDS_01899	MW0347	FALSE	unmapped	ACAGTGAATGAAAATGATAACTTTAAATATAGCGATGCTATAGATTACAAAAAAGCCATT
5064	66	41	MW2_CDS_04909	MW0904	FALSE	unmapped	AGGACGTGTTGGCTTAATATCATTTATCATTATGATAGCAGGACGTCGAGAACCAGATAA
5065	66	39	MW2_CDS_08860	MW1664	FALSE	unmapped	TGATTTCAAATGCTGTAAGAAATAATGTGGACATAAAAATTTATCCCATCATTCAGGCCA
5066	66	37	MW2_CDS_08922	MW1675	FALSE	unmapped	CGTTGTTGTTGCGACAATTCGTGCGTTAAAAATGCATGGTGGTGTAGCGAAAGATAATTT
5067	66	35	MW2_CDS_12285	MW2325	FALSE	unmapped	CACCTGGCCGATATATGCTTAAAGCAATGATGGCCGGATTTTTACTCTCAATCGTTACTG
5068	66	33	MW2_CDS_00984	MW0183	FALSE	unmapped	CATTGGCTACTAAAAATCAGTTCAATGCACTGTTACATGGACCGAGTCTAGCCTATCCGT
5069	66	31	MW2_CDS_01023	MW0189	FALSE	unmapped	TATTAGGATTAACTGAGTATCTTGGTCGTAAACCAAAAGCGTTATCTGGCGGACAGCGTC
5070	66	29	MW2_CDS_01379	MW0253	FALSE	unmapped	ACCGTATTACTTGGTGATAATGGCGCTGGAAAATCAACATTACTTCGTATGATCGCTGGT
5071	66	27	MW2_CDS_03761	MW0688	FALSE	unmapped	ACCTGGTAAAAAGATTTCACTTACAACAGATCCAGCAATGAAAGTTGATATTGATGGCGA
5072	66	25	MW2_CDS_04890	MW0901	FALSE	unmapped	CCAATGCCAAATGCAAGACAAACAAAAGAAGAGGTTGAAGTAAGCCCGTTTGATGATTCA
5073	66	23	MW2_CDS_06149	MW1142	FALSE	unmapped	TGGCGACATTACTGAAGATGAGTTGAGAAGTGGTACTGAAGATGTTCAGAAAGCAACAGA
5074	66	21	MW2_CDS_10591	MW1999	FALSE	unmapped	TGAATACGATAAGAAATAGTATTTGTTTAACGATAATAACTATGGTATTATGTGGATTTT
5075	66	19	MW2_CDS_13707	MW2589	FALSE	unmapped	TTCATTGAAAATGTCCTATTAGGTCAATGGTATGGCTATTTTATCGTTGTTATCATGCAA
5076	66	17	MW2_CDS_02503	MW0463	FALSE	unmapped	CCACGTAGACAACATACGAGTAAACCAAGTCATCAAAAACCAGTGCAAAAAGCCGAAGAT
5077	66	15	MW2_CDS_05083	MW0940	FALSE	unmapped	ACAAAAATAGGAGATCCTTTAAAACTTCAGCACACAGCATTTTATGATGAACAACCTTTT
5078	66	13	MW2_CDS_03709	MW0679	FALSE	unmapped	ACCAGCAAGATTTGATTGAAATACCAATTGTGTATGGTTCGAAATATGGTCCGGATTTAG
5079	66	11	MW2_CDS_03443	MW0631	FALSE	unmapped	TGGTAAGGAGATTTATGTTGCAGCAAAATCTGGTGAACCCAATCCAGAATCTAACCAAGC
5080	66	9	MW2_CDS_02664	MW0492	FALSE	unmapped	TAAAGTTGTTAAATTACAAATTCCTGCAGGTAAAGCGAATCCAGCACCACCAGTTGGTCC
5081	66	7	MW2_CDS_05134	MW0949	FALSE	unmapped	TGCTATGAATTTAAAATTAGTAGATTTTAAAATCGAATTTGGAAAGACTGAGACTGGTCA
5082	66	5	MW2_CDS_13227	MW2503	FALSE	unmapped	AGGTGCGACATTATCTATTTTTAGTGTAGCTGGAAAGTCATGGCTATTTATGCCGTACTT
5083	66	3	MW2_CDS_13895	MW2623	FALSE	unmapped	AGTTACTTTCGAAATCACTGAAGGTCAACGTGGAGACCAAGCAGTTAACGTACAAACTGT
5084	66	1	MW2_CDS_04324	MW0796	FALSE	unmapped	TTAATTGATGAAGATGATGTACAAGCTGGTCATGCTGCATCAGTAGGTCGTGTTGATCCA
5085	65	164	MW2_CDS_06774	MW1265	FALSE	unmapped	AGACCCGGCACAAATTACAACTATATTAGACGAGCTAAATAAATACCATCAAGAATTGGA
5086	65	162	MW2_CDS_11202	MW2116	FALSE	unmapped	GGCGGATATGGCGCACATATGGACATTATGAAAGAGTACCAATTAATCATTTTAGCGCCA
5087	65	160	agr_tiling 015_R		FALSE	unmapped	TTTTAACGGTGGATCTCATAATGAGGATTAACTCTTCCCTTCTTTATTACAATAAAAAGG
5088	65	158	MW2_CDS_02781	MW0513	FALSE	unmapped	CATCGTGCAATTGTTGATAAAGGTGTACTTAAAGAAGCATGTAGCACATTATTAACAACA
5089	65	156	MW2_CDS_01869	MW0342	FALSE	unmapped	AAGTTGTGTGTGATAGTGTTCAATTCCTTGAACCTAAAAATGCGCAACAAAATGGTGGCC
5090	65	154	perR_tiling_074_R		FALSE	unmapped	ATCTGCAATATAATCTAACGGCAATGTATTTACACCCGTTGCAAACCATGCAATCCATTT
5091	65	152	MW2_CDS_01684	MW0307	FALSE	unmapped	TGACTTGTTTATTTGTGGTAGAGATTTAGCTGAAAATGCCGAACGTCTAGGGGATGTCTT
5092	65	150	MW2_CDS_00873	MW0161	FALSE	unmapped	TGCACAAAACGAAACGCTACATCAATTTCCAATAGATAATGTATTCCCATTGATGGGACA
5093	65	148	MW2_CDS_06692	MW1251	FALSE	unmapped	TAATGAGGATGAGCGACAGTTAAGTCTGTTTGAAGATGAATACCAACGCAAACGTGACGA
5094	65	146	MW2_CDS_03312	MW0609	FALSE	unmapped	AAATTAGATGTTGAAATACCAGATGGCAAAGTGACGTCAATCATTGGTCCTAACGGCTGC
5095	65	144	agr_tiling 178_R		FALSE	unmapped	GCAGTAATTCAGTGTATGTTCAATATGATGATATTATGTTTTTTGAATCATCAACAAAAT
5096	65	142	MW2_CDS_02408	MW0445	FALSE	unmapped	TGATGGCGAATTACCAGCGTATCAAGGTCCACTTCATGAATTAGATGAAGAAATGGAAGC
5097	65	140	MW2_CDS_08645	MW1627	FALSE	unmapped	TACGCTATTTACAATGCCCATGTAAAATCAAGTACGACGAAGAACGCTTTGAAGCTGAGC
5098	65	138	MW2_CDS_04652	MW0859	FALSE	unmapped	GTGCAAAGCAAATAGAAACTACATTTTTGGGAATTGGTGAGAGAGCGGGTAATGCTCCTA
5099	65	136	MW2_CDS_05817	MW1082	FALSE	unmapped	TGCAGCAAGTGGCTTAAGAATGCTAGTTGAAAGCAAAGTAGATTTTGCGAACAATCGAAA
5100	65	134	MW2_CDS_03281	MW0603	FALSE	unmapped	AAACGTACAGAAGGCATTTCGACGACTAAAATCAAACAAGAATTATATGGTAAAGATGCT
5101	65	132	MW2_CDS_09888	MW1855	FALSE	unmapped	AAAGAAGGCGTATCAATTGTCGATCATTTGACCGCTGCAAAGCAATTCGAACTATTCGAA
5102	65	130	MW2_CDS_10146	MW1910	FALSE	unmapped	AGACAAAAGTAATTTACAGCCTTTGTGTGATGCTTGCCATAACCAAAAGACAAAAGAAGA
5103	65	128	MW2_CDS_00072	MW0013	FALSE	unmapped	TGATTATCGGTACAATACTGACACCTACGACACATATTGTAGGACTACTTGGTGTTATCG
5104	65	126	MW2_CDS_13499	MW2554	FALSE	unmapped	GCAAGCAACTACTAAGCAATGGACGATTGGCATCATAGCCTCAATTTATGCTATATGGCT
5105	65	124	MW2_CDS_10093	MW1898	FALSE	unmapped	CACAAGATACCGAGGAAGATTATGGGGATGATATGGTCGCAGCAACTGCTGTATCTAATG
5106	65	122	MW2_CDS_08116	MW1528	FALSE	unmapped	CTTATTCTCCTAGAATTGGCACGCCAGCTGCAAGAATGGATGACCAAATTGATGAAGAAA
5107	65	120	MW2_CDS_00315	MW0061	FALSE	unmapped	GGTCAAGGCGACTAAAAGTGCCCAGCAGAAATTGCAAGATAATACATTAGTTTCGCCATA
5108	65	118	MW2_CDS_12653	MW2393	FALSE	unmapped	AAAGAAACAGGTGCTTCAGTTATCGGTATTGATATTGATCCACAAGCCGTTGACCTAGGG
5109	65	116	MW2_CDS_09880	MW1854	FALSE	unmapped	GGGCGTTGGTACAAAGCTGATTACAGGATACGATCAACCAGCATTAGGTGCAGTATATAA
5110	65	114	agr_tiling 005_R		FALSE	unmapped	TAAATAAGAAGCGCCCGAAATAATAATTAACACATGTCATGACTAAACATAGATTTATGA
5111	65	112	agr_tiling 061_F		FALSE	unmapped	TTAGATAAAACGATATATTAGTAATTAAAGTGAAGATAAAAATGTTTAAAATATAGGCAA
5112	65	110	MW2_CDS_13666	MW2582	FALSE	unmapped	TGGCTCATTTTGTAGCTTCAGATGCACATTCATGTGACCAAAGACCATTTTTGATGCAAG
5113	65	108	MW2_CDS_04767	MW0879	FALSE	unmapped	CAAGTTGCACATCTTGCCGTAAAGCGAAAGCATGGTTACAAGAACATGACATTCCGTATA
5114	65	106	MW2_CDS_05283	MW0978	FALSE	unmapped	GCGTAGAGCAATTGCGAAAGCAATGGTTAACTCTAAGCATACTGCACCTCATGTAACATT
5115	65	104	MW2_CDS_04178	MW0764	FALSE	unmapped	GGGACAACGAAGTAGCATTTAATAACGGATCAGGTTCTGGTGACGGTATCGATAAACCAG
5116	65	102	MW2_CDS_07818	MW1473	FALSE	unmapped	ACCAAATGATAGAAAATTCCATCCTTTAGAAAAATTGGGACGTTATTTAATGGATTCCTT
5117	65	100	MW2_CDS_05389	MW0998	FALSE	unmapped	TCACAGGTGCATTATCTATTATGACAAATGTTAACCTGATAATCGCACTTTTCCATGCAT
5118	65	98	MW2_CDS_12408	MW2349	FALSE	unmapped	TCAAGGTGCGACAGGCTTGTTTGTTCATCCTAAAGGCTTTTTGAAAGAAGTCGAGAAATT
5119	65	96	MW2_CDS_11844	MW2246	FALSE	unmapped	ACACAAGATGTCATTGAGGTAGAATTTTTTGAACGTGAAACAGGTGGCACCCAAATGCTA
5120	65	94	agr_tiling 190_F		FALSE	unmapped	GCCGTTAACTGACTTTATTATCTTATTATATTTTTTTAACGTTTCTCACCGATGCATAGC
5121	65	92	ETG10_234183		pos		
5122	65	90	DCP_20_9		pos		
5123	65	88	agr_tiling 083_F		FALSE	unmapped	TATATACGCGGCTCTGTAACCGATGCTGTTGAAAAAGTCAACTAAAAGCTCAATAACTTT
5124	65	86	psma_tiling_032_R		FALSE	unmapped	TAAATCAACACAAAGCAAAGCCACCATCCCTATTGGTATAGTGGCCTGAGAATTTTAAGT
5125	65	84	MW2_CDS_06267	MW1163	FALSE	unmapped	AGGTGGTTCTGGTTCAATTGGTTCTGAGATAGTCAAACAATTATTAACTGATGGATTTGA
5126	65	82	MW2_CDS_00439	MW0083	FALSE	unmapped	TGGAAAAGTGCAGGTGCTTTATTGGTCGAAGCAATTAAAGAATTATGGTTACCGATCCTT
5127	65	80	MW2_CDS_10675	MW2015	FALSE	unmapped	GCGTTGATTGATGATACAGCAACTATGAAAGGTACAGATAGTGATGCTAATCTTGATGCG
5128	65	78	MW2_CDS_07837	MW1477	FALSE	unmapped	GGCAACATATGAAATATTACACAGTGATACACCTGCTAAAGTCGTAATGAATGAAGCAGT
5129	65	76	NA		ignore		
5130	65	74	MW2_CDS_04762	MW0878	FALSE	unmapped	ACGCTGGATTAACAGACATGCCAATTAAAGATATTGAGGCAAAATATGAGGGCGAAGGTT
5131	65	72	MW2_CDS_11084	MW2095	FALSE	unmapped	TCTCCATTGCAAAGTGGATTGGTTATTTTTCCTTTATCTTTAGCTTGGATTACATTGAAT
5132	65	70	MW2_CDS_10164	MW1914	FALSE	unmapped	AGAGTTAAGGCAATGGAAGATTTTAAGATGAGTTTCAACAATGAATTTAGTACAAATCAG
5133	65	68	MW2_CDS_00035	MW0007	FALSE	unmapped	ACACATCCAACAAATCATTCAGCATTACATTCTCGTTGCCCAGAAGCGATGGTTATTGAT
5134	65	66	MW2_CDS_03296	MW0605	FALSE	unmapped	CCACAAGGTCAAGTGAGTGCTTTTGTAGGTCCTTCTGGGTCTGGTAAAAGTACGATATTT
5135	65	64	MW2_CDS_07404	MW1384	FALSE	unmapped	TGACTTGCATCAACAGATTGACAGTGAAGAACAAAACACAGTCGCTTCTGATGACATCTT
5136	65	62	MW2_CDS_07089	MW1325	FALSE	unmapped	GGCGTCGCATTGAGTGGTGCAGTATATGCAATCGTATCAAATATGACAAACATTTATACA
5137	65	60	MW2_CDS_00694	MW0129	FALSE	unmapped	TGTGGATGATAGGGGTTCTTTTACAGAATTTATAAAAACACCGGATCGTGGTCAAGTTTC
5138	65	58	MW2_CDS_03293	MW0605	FALSE	unmapped	ATGGAAGGTAGAACAACGATTGTCATTGCGCATCGTTTGTCTACAATTAAAAAAGCCGGT
5139	65	56	MW2_CDS_07805	MW1471	FALSE	unmapped	GATTGGTCCACATGTAACAGAATTGATTAATGAGGCATCACTGTTGCAGTTCATGAATGG
5140	65	54	(-)3xSLv1		neg		
5141	65	52	MW2_CDS_00313	MW0060	FALSE	unmapped	AGGTTGGTGGGATTTATTTTTTGCGATACCTATTTTTCTGCTATTCGCATACCTTCCAAA
5142	65	50	MW2_CDS_08962	MW1682	FALSE	unmapped	AGATGCTGTTAAAGGTATCGGTGACTCAGTACAAACGTTAAACAGCTCTGTAGATCGTGT
5143	65	48	MW2_CDS_11782	MW2233	FALSE	unmapped	TGGCCGTAGAATAGAAAAATTACTTCATAACAGTATTCGAATGATGTGGTTAGCTCAAGA
5144	65	46	MW2_CDS_04265	MW0783	FALSE	unmapped	TGGAATTACAACAAGCAATAGCTAATAGAAGAAGTGTGAAAAAATTTAAAAGAGATATGC
5145	65	44	MW2_CDS_03451	MW0633	FALSE	unmapped	AGTAAAGTATATAGATAAACGTCACTGGCGTCGCCTAATTGATAGGGAATACACAGAGGT
5146	65	42	MW2_CDS_05662	MW1052	FALSE	unmapped	CGATGTTATTCTTAGCGCCGACTGGACTTGTTATGGCCACACTACAAATGTTAAACATGC
5147	65	40	MW2_CDS_03424	MW0628	FALSE	unmapped	GCATTTATAGCATTTGGTATTATTGGTTATTTCTTCGTTGGAGATGCATCGAGTATAGGC
5148	65	38	MW2_CDS_05713	MW1063	FALSE	unmapped	GAAGCAACAACCACAAACTAAGCCCGAAAAGAAGACTGTTTCGAGAAAAGTGGTTGTACA
5149	65	36	(+)E1A_r60_3		pos		
5150	65	34	MW2_CDS_10811	MW2042	FALSE	unmapped	ACAACTGACTCTGCAGTACGTATTACCCATTTACCAACTGGTGTCATTGCAACATCTTCT
5151	65	32	MW2_CDS_01640	MW0299	FALSE	unmapped	CGGTGCCGACTCATTAAAAAATCGTGCAAGATTATGTTTAGAAGTTATGCGTGCGGTACA
5152	65	30	MW2_CDS_01148	MW0211	FALSE	unmapped	TACGGCAATGTCAACGTGTCTTACTTCAATGACCGACTAAATGGATGTGGTGGCTTTATA
5153	65	28	MW2_CDS_07832	MW1476	FALSE	unmapped	CCAACTCAAGCTGCTGTTATTGCAACACCAGACCAATATGAATTGCTGCAACAAATACAG
5154	65	26	MW2_CDS_07265	MW1357	FALSE	unmapped	ATTTCGATTATTTTGGGGATTTTAATGTTCATAAAATTAATGGAATTACTATATGGTGCT
5155	65	24	(-)3xSLv1		neg		
5156	65	22	MW2_CDS_11944	MW2264	FALSE	unmapped	ATGTCACACTGCAATGTTCACGTTTAAAAGAGTCTCAATCTCTGCAAATAAAATATTCCA
5157	65	20	MW2_CDS_03627	MW0664	FALSE	unmapped	AGTTGCCAATGATTTCAGAGACAACACGTATCAGTGATGCATTAATTAGAATGCAACGTG
5158	65	18	MW2_CDS_01718	MW0313	FALSE	unmapped	AGAAAAGCATTTCGACTTAAAAGCATCAGGTTGGGCATACTTCTTATACGAATGGGCTGG
5159	65	16	MW2_CDS_09087	MW1704	FALSE	unmapped	ATTGAACATCATATAAATGATGCACATAAAGGTCATATTGATGCAGCCATCTTTAACCTA
5160	65	14	MW2_CDS_06289	MW1167	FALSE	unmapped	GAGCAGCAATTAAAAGATGCAGTGCAATTTGTTAATAAATTGTTTAATGTGTCATCAGCA
5161	65	12	MW2_CDS_02262	MW0418	FALSE	unmapped	GCACAGCAAACTGCGCGTGCTTTATCTGATGTCGATATTGCAGTTATTAATAACGGTGTA
5162	65	10	MW2_CDS_03048	MW0560	FALSE	unmapped	TGCTTTGTGAAACTGAAAATATTAATAAGAATCCCAAATATAGAATTATCAAATACAAAG
5163	65	8	MW2_CDS_02479	MW0458	FALSE	unmapped	TGAAACAGGTGTCGATGTCCCAAATGCAAATACTTTGATCATTGAAGATGCAGATCGCTT
5164	65	6	MW2_CDS_01143	MW0210	FALSE	unmapped	AATATGGTGAATCAATTGCTGCAGCCATTATACTTCGCGAAGATGAACCTCATTACGCTG
5165	65	4	MW2_CDS_09395	MW1764	FALSE	unmapped	ACTGGTTTGCATTACATATTCATATCGATAAGCCATCGCAAGATACATTTATCATCGACA
5166	65	2	MW2_CDS_05924	MW1102	FALSE	unmapped	GGTATGGGCGGCCATAAAGCAGGAGAAGTTGCAAGTAAATTTGTTACAGATGAGTTGAAA
5167	65	163	MW2_CDS_10688	MW2017	FALSE	unmapped	GGCATTAATGAATAAATTAGCCGAATCAATGTCTGACAAGGAATTGGAACAAGTAAAGCA
5168	65	161	psma_tiling_022_R		FALSE	unmapped	ATTATGAAAATCATTAAGATTTCGTATGCCAAATCATGAATGTCTCAGACCTCGAGTATC
5169	65	159	NC_A_054		FALSE	unmapped	AGTAGGAGTGAACTATATAGCCTGTTAAGTGGCCTAGTAACCTAACACTTATCCTGCAAT
5170	65	157	agr_tiling 021_F		FALSE	unmapped	TTATTTGATAAATAAAATTTTTTTCATAATTAATAACATCCCCAAAAATAGATTGAAAAA
5171	65	155	MW2_CDS_10843	MW2048	FALSE	unmapped	TGGTTAGCGTAGGTGCAACAATTAACATTATGCTAGCTGCAGTTTATGCAACAGGACAAA
5172	65	153	MW2_CDS_04747	MW0876	FALSE	unmapped	GCGGGAGTATTTGCAATTTTTATTTTTTCTTTTGAATTACAATGGTTTCCGTTTCAAGGT
5173	65	151	MW2_CDS_08745	MW1644	FALSE	unmapped	GAGCCAAAAGCGTTGATAGGTTTTGCAGGTCGTCGAGTTATTGAACAGACAATAAACGAA
5174	65	149	MW2_CDS_01064	MW0196	FALSE	unmapped	TGGCTGGTGTAGAGGCATTTATTAATAAAGATACATTTAGCTTTGCAAATGGTATTGGCT
5175	65	147	MW2_CDS_04763	MW0878	FALSE	unmapped	AGAAAGCAGTTGAAGGTATACCTGCTGGTCTATTAACATATCCACCTTTAATGGCAGCTG
5176	65	145	MW2_CDS_11000	MW2080	FALSE	unmapped	TTATTACACGCGGGTCCTGAAATCGCAGTTGCATCTACAAAAGCATATACTGCACAAATT
5177	65	143	MW2_CDS_12854	MW2432	FALSE	unmapped	TGTCATCATTATCGCAGTCATTTACTTTGCTATACGTTACATTGGCAAACGTAAGAGAGT
5178	65	141	MW2_CDS_02006	MW0369	FALSE	unmapped	TATCTGTAGAAATTGGCGTACCAATTTCTTTATGTTGGGGCTCCGCAGTCAACTACTACC
5179	65	139	MW2_CDS_01364	MW0250	FALSE	unmapped	TCATTGGTCCGTTGTTCCCTGTCATCGGCATCACTATTATTAGCATGACTCAATTATCGG
5180	65	137	MW2_CDS_08811	MW1655	FALSE	unmapped	CCTTCACAATTTCAAGGATTTATGACAGAGTTAAATCAGTGGATGGACACAAATCGTCCT
5181	65	135	MW2_CDS_05762	MW1072	FALSE	unmapped	ACAAGATATTGCTGATGAGCTTAAAAACCGCCGTGCGACACTTGTCAATTTACAACGTAT
5182	65	133	MW2_CDS_05856	MW1088	FALSE	unmapped	GAAGGTAAAATTTCTAGTGAAGATATCCAAACATTAGTTGAATGGAGAGACAACTTAGCA
5183	65	131	MW2_CDS_01583	MW0290	FALSE	unmapped	AGGAAAACCTAAGAAAGTTGCCTTTTTCCAAATGATTGGTGATAGTGCGATGGATGGGTT
5184	65	129	MW2_CDS_10102	MW1900	FALSE	unmapped	TGTCAAAGCTGGGGCTATGTCATTAGTCCCGCTTTTAAAAAGTAATACACCTTTTGCGAA
5185	65	127	MW2_CDS_13508	MW2555	FALSE	unmapped	TGGAGATGGACGTAATAATATTGCGCATTCATTAATGGTAGCAGGTGCTATGTTAGGTGT
5186	65	125	MW2_CDS_00498	MW0093	FALSE	unmapped	CACTAATTTTATACGTACGAATGACCTTGAACAGATTGAACGGACAATTGATGCCGCGCA
5187	65	123	MW2_CDS_10888	MW2055	FALSE	unmapped	AATGGACGTTGATCGTTTTGCTACTTATGAATTAGATGAATTGTTTGATGAACAAGACCA
5188	65	121	MW2_CDS_12574	MW2378	FALSE	unmapped	ATAGCGCGCCAACTGATGTATACACCGGATATTCTTTTATTAGATGAATCGACCAGTGCA
5189	65	119	MW2_CDS_13175	MW2493	FALSE	unmapped	TGATACTGTAGAAATCAAGAAAATCGACTGTGAATATACCTATGCTATGCCCATTGCAAT
5190	65	117	MW2_CDS_13377	MW2532	FALSE	unmapped	TAGCAGGTGCTGTATTTTCTAAAGATATTGGAAAAGCGCAACGCGTTGCTAACAAGTTGA
5191	65	115	MW2_CDS_13808	MW2606	FALSE	unmapped	TCAGTATCTGAAAGCAAAGTTGTTGGTGATTTAACAATTAAAGGCATCACTAACGAAGAA
5192	65	113	MW2_CDS_10695	MW2020	FALSE	unmapped	CGCAAATGGCGCAATCAAATGATCAAACATTAAATCAAAAACCAATTGAAGCTGGGGCTT
5193	65	111	MW2_CDS_08358	MW1572	FALSE	unmapped	TGCAGGTACTGAAAATCTTGCACAAATTGTCGGGATGGCTAAAGCATTACAATTAGCAGA
5194	65	109	MW2_CDS_01419	MW0260	FALSE	unmapped	TCAAAATCAAGCGAGTCACTCGACTCGCTTGAATGAAACTAAAAAAGTGTTATTTTCCAA
5195	65	107	MW2_CDS_03371	MW0619	FALSE	unmapped	TTATATCAACATCGTGGAATTGGCCAAGCACTTCTTGATGCCATTATGGCTTGGTGTTTA
5196	65	105	MW2_CDS_05129	MW0949	FALSE	unmapped	TGGAAACGGGGCTAAGAAAGACACAATGGCAGGTAAGGGGCGATTAAATAATCAAATTAC
5197	65	103	MW2_CDS_04415	MW0814	FALSE	unmapped	CAAGTGCGACGATTTACAACACATATGGTCCAACTGAAGCTACGGTAGCAGTTACAAGTA
5198	65	101	MW2_CDS_12336	MW2336	FALSE	unmapped	TTCGTTTTCATATTGGCTGCATGCGGAAACAATTCGTCGAAAGACAAGGAAGCTAGTAAA
5199	65	99	MW2_CDS_03462	MW0635	FALSE	unmapped	AGGATACGCCTCAACACTATTTTCTAATGCAATGGTTATTGGACAGTTAGGCGGTAACCT
5200	65	97	MW2_CDS_11353	MW2148	FALSE	unmapped	AGCTAAGTCTTATATGGACCGTGGCGAATTAGTTCCTGATGAAGTGACTGTAGGTATCGT
5201	65	95	MW2_CDS_07023	MW1312	FALSE	unmapped	TAGACGGTGAAGGATTTGAAGTGTTAGTGTCTAGTGGTGACGAAGTTAACGTCGGAGATC
5202	65	93	MW2_CDS_02808	MW0517	FALSE	unmapped	GCGACTCAGATTCAGATAGCGATTCAGACTCAGACAGTGATTCAGATTCAGATAGCGACT
5203	65	91	MW2_CDS_08132	MW1531	FALSE	unmapped	AAGTACCTGAAGGTGTCGACAATGAACAACAAATTAGATTAGCTGGTGAAGGCTCTCCAG
5204	65	89	MW2_CDS_13120	MW2484	FALSE	unmapped	CTTCACAATCATTGCCCGTAACAGTTTATGAAGGGTTTCCATTTGTTGCATTTCGCATGT
5205	65	87	MW2_CDS_10423	MW1969	FALSE	unmapped	ACTTGGTATCGCGCTGGTGAAGGGCTAATTGGTAGTTGGATTGCATTAGTATTATATGCT
5206	65	85	MW2_CDS_11960	MW2267	FALSE	unmapped	TCATCATGGGGACAGTCTACAGTTGAGTCATTACTTGAAACAACGGCTTATCAAAGCGAA
5207	65	83	perR_tiling_119_F		FALSE	unmapped	TCAATAAATTTATTGCCATCGACATCATATAAATATGCACCGTGTCCTTCTTTCATAACA
5208	65	81	MW2_CDS_09442	MW1774	FALSE	unmapped	ATGTAACAGCTCAAGTCGAAGCAGGTGCCGAATTGATTCAAATTTTCGATTCATGGGTAG
5209	65	79	MW2_CDS_11393	MW2157	FALSE	unmapped	CTAAAAAATCAATCGCGACTTTCCGTTTACGTGAAGGTATGCCAATCGGTGCGAAAGTAA
5210	65	77	MW2_CDS_00718	MW0133	FALSE	unmapped	TGATTGTAAAAACATTTATGAAATCGAAAATATTTAGATTAATGAATACACCACTATTAT
5211	65	75	NC_S_096		FALSE	unmapped	GAAAATCTCATTTAGTCACCGTCTTTTTAACGGGCTCATTAGGCGACATGTTCCTGCATG
5212	65	73	MW2_CDS_13736	MW2594	FALSE	unmapped	GTTTAGGCATGCAATTAATGTATGAGCATAGTGATGAAGGCGATGCATCTGGATTAGGGT
5213	65	71	MW2_CDS_10721	MW2025	FALSE	unmapped	GGATACGCCACTCAATTACAAGTGTGTATGATATTTGTTGCTATTTTATTAGGCACTGCA
5214	65	69	MW2_CDS_11754	MW2228	FALSE	unmapped	TCAGAAGAACAAATTAAGTTAGAAAGTTTAAATGAAGTTACAGAGGCAATTGCAGCGAAT
5215	65	67	MW2_CDS_07493	MW1401	FALSE	unmapped	AGAGTGGGAAAAGGCTAAGAGAACACCAGATGAACGTGGAGATTTTATAACCAAAAGGTT
5216	65	65	MW2_CDS_02643	MW0488	FALSE	unmapped	AGTGAAAACAAGCCAAGAACTCGAATTCCGTTATCTTCTGAAATCCTTGCAGAATTTGAA
5217	65	63	MW2_CDS_11420	MW2163	FALSE	unmapped	TGAAATCAAAAAAGTTGATCTTGACGCTCGTTTAGTAGCTGAAAACATCGCACGTCAATT
5218	65	61	MW2_CDS_00979	MW0182	FALSE	unmapped	TTACCTTTGACTTAGGTACGACTTACAAAGGGAATGAGGTTGTGACTAAAGCAGTTGGCG
5219	65	59	MW2_CDS_08544	MW1609	FALSE	unmapped	TCATGATGGTAACATGCATGCGAATGGAAAGTTAACAAAAGTCTTGCCTTTATCACAAGT
5220	65	57	MW2_CDS_10605	MW2002	FALSE	unmapped	TGTGACGTTACTTAAACAAACGAGAGAATCCATGTTACAGGCTGAACGTCAACTGACACA
5221	65	55	MW2_CDS_07025	MW1312	FALSE	unmapped	TTTATGATGAAAATGCTGTGATTAAAGGTGAAACAAAAGTGATTGATGTGACAATGAACT
5222	65	53	MW2_CDS_02815	MW0518	FALSE	unmapped	CCCGGACGGTACTACAAAATCAGTAAGAACAGATGCTAAAGGTCATTACGAATTCGGTGG
5223	65	51	MW2_CDS_13391	MW2534	FALSE	unmapped	ACATGACAGTTTAGAATCCATCACAAAAAACTTATATGCGACACCTACTTCGGAACTGCC
5224	65	49	MW2_CDS_09855	MW1849	FALSE	unmapped	AGAAATTGAAGTAGGGAAAATGAGTGGTGCAGTAGGTACTTTTGCTAACATTCCTCCTGA
5225	65	47	MW2_CDS_08120	MW1529	FALSE	unmapped	GCCAGTTGATGTTACGATTTGCAGTGGACTAATCAAAGCTGACAAATATGAGTGGTTGCT
5226	65	45	MW2_CDS_10943	MW2065	FALSE	unmapped	GAAACTGAAGAATTTGAACCTGGAAACCAATATACGATTTATACGCACACGTACAACGGT
5227	65	43	perR_tiling_094_R		FALSE	unmapped	ATACGCCAGTTTCTTTAGCTAATTTAAAATCTTCATCTACTAATAAATCGAAATTCAATC
5228	65	41	MW2_CDS_05139	MW0951	FALSE	unmapped	GTACTTATTCCTGGTGGATTTTCATTCGGGGATTACTTAAGATCTGGGGCAATGGCTAGT
5229	65	39	MW2_CDS_02630	MW0485	FALSE	unmapped	TGTTCTGTAATGGCATTTCATGAGCTAGGACCTACAATTGATATACATGCGGGTGGTTCA
5230	65	37	NA		ignore		
5231	65	35	MW2_CDS_05535	MW1026	FALSE	unmapped	ACGTATAGTGATGGTGCGTTTTCTATTCGAGACATGGTAGAAGCAAATATCGCAAAAGGT
5232	65	33	MW2_CDS_12775	MW2418	FALSE	unmapped	AGGTATGCTAATCAAAGAACGATCCCTTGCAGATGAAAGGATTGTGTTAATCAAAATAAA
5233	65	31	MW2_CDS_02470	MW0457	FALSE	unmapped	TAACGATGGAAAAAGTTATCGAACACGCAGCACGCGCAATTGAAAAGTTTGTTGAAACAT
5234	65	29	MW2_CDS_06653	MW1243	FALSE	unmapped	GCCGTACCACACCCTGTTAAGCAAGGTTTAATCCAATCATTAGGTGTGTTCTTTGATACA
5235	65	27	MW2_CDS_10050	MW1889	FALSE	unmapped	TTTGATGGGAAGGTTCAGAGGGGATTAATCGTGTTTCATACTTCTACAGAACCTTCGGTT
5236	65	25	MW2_CDS_06466	MW1206	FALSE	unmapped	TGAAATACAAAAAGTCTCAATTGTTGATTCATACTTCAACAATAAAAAGCAAAGGGGATC
5237	65	23	MW2_CDS_02040	MW0378	FALSE	unmapped	TGGCGATGGTTTTGATGTATGGAATGACGCTGCAAAGGTTGTTACTATTTCGAACAAAGA
5238	65	21	agr_tiling 176_R		FALSE	unmapped	TCTAAAGATAATAGCGTTGAAACGATTGAATTAAAACGTGGCAGTAATTCAGTGTATGTT
5239	65	19	pMW2_013		FALSE	unmapped	TTCACATCATAGCACCAGTCATCAGTGGCTGTGCTGTTGCGTATTATACTTATTGGCTTA
5240	65	17	MW2_CDS_10284	MW1941	FALSE	unmapped	AGTGGTTTAAGAATTCTAGACCCAAATGGTTATTGGAATAGTACATTAAGATGGCCTGGA
5241	65	15	MW2_CDS_00897	MW0165	FALSE	unmapped	TGCACAGTATAAAAAGGGTGGACGATTGATTTATATCGGTGCAGGTACAAGTGGAAGGTT
5242	65	13	MW2_CDS_09947	MW1866	FALSE	unmapped	GTCAGGATTAACTATGGGCTATAACTTTATGCACCGGAAAAAACCAGCAAATGGTTTTGT
5243	65	11	MW2_CDS_07772	MW1465	FALSE	unmapped	AACTACTGCATCAGAATTAGGTGGGAAAGCAGAAGTTACAGTGGAGCAAAGTTATCCAGG
5244	65	9	MW2_CDS_09311	MW1749	FALSE	unmapped	TGCCTCAAAAAAACCATCCGTTAAATATTTGGGCTTTACATAAATTATTGAAACAATGCA
5245	65	7	MW2_CDS_01947	MW0358	FALSE	unmapped	CACAAATGGCAGATTACGACCAGACAATCAGCGAGTACTATAATCAACGTACAAACGGGA
5246	65	5	MW2_CDS_11214	MW2118	FALSE	unmapped	CTGGTGCTGTTCAAGTATACATTGAACAAGGTGAAGATGCTGCTCGTGAATGGTTACGTA
5247	65	3	MW2_CDS_08459	MW1591	FALSE	unmapped	TACAGTATCAGGGCCTTCATTAGAAAGACCTGGTGATTTGGCTGCAATTTTATCAGGACT
5248	65	1	MW2_CDS_11024	MW2085	FALSE	unmapped	TATCTGATGAAGTGACACGTGTCGGACGAGGTACGTTACGTAAAATTGGCCCTAAAGATA
5249	64	164	MW2_CDS_04115	MW0753	FALSE	unmapped	AAGTATCACGAATTATTAGACAAATACTTTCTTCATAATATTTCGTTCTATGAAGAAGAT
5250	64	162	MW2_CDS_13618	MW2574	FALSE	unmapped	CAAGCACGACGCGTATGTTGGTTTGGATCGGCATTAGTTACAATCATTATTGGTATACCG
5251	64	160	(-)3xSLv1		neg		
5252	64	158	MW2_CDS_10799	MW2040	FALSE	unmapped	AGCTTTTATTGTGCCGAGTAATAAGGTGGCGTTTATACCAAGTGAAGCGCAATTCATTCA
5253	64	156	MW2_CDS_02736	MW0505	FALSE	unmapped	ACCATTCAGACATGGATGATTTACGTGCGAAAGCAAAAGAAGCAGTTGAATCAGGTCAAT
5254	64	154	MW2_CDS_07158	MW1338	FALSE	unmapped	AGGAAGTTTTTAGATTTACTTGATTTAACAGATAACACATTTGAAAAAATAGTTAAATCA
5255	64	152	MW2_CDS_02729	MW0504	FALSE	unmapped	TCATGGTGCCAAACCTCATGAAACCATTGACCCAATAGTAATCATGGCAGAGTTCATTTT
5256	64	150	MW2_CDS_04922	MW0906	FALSE	unmapped	TGAATCAATCATTCTTCATGTTTCATACCACAGTTTATGGCATCAATATAACAATTCCAT
5257	64	148	MW2_CDS_06353	MW1179	FALSE	unmapped	TCTGGAGATACAAGTGATTATCACATTGAAGGTTTTGTTGCAAAGCCTGAACATTCTAGA
5258	64	146	MW2_CDS_04575	MW0844	FALSE	unmapped	AGACGGATTAAATTATTTGGCTGGTAAAACAATCGACGAAGTTAACACAAAAGCATTCGA
5259	64	144	MW2_CDS_13607	MW2572	FALSE	unmapped	ATGCGATTACTTAGACCAGAAGAGTTCGGTACAGCATTAGACGTCCTGGTGTCTAATGAA
5260	64	142	MW2_CDS_10013	MW1880	FALSE	unmapped	AACAGGGTCAAAAGCGAAAGCGGATAGCTATGTACCATATACAATTGCAGTAAATGGCAC
5261	64	140	perR_tiling_056_R		FALSE	unmapped	TTGCGTTTCTGGTAAAGCATTTATAATAATGTCAGCATTTGGTAATGTGCTTTCAAGTGA
5262	64	138	MW2_CDS_06630	MW1239	FALSE	unmapped	TGACGATTTAAATGTTGTCGTAGCGGAAAAAGATTTGTGGTACTTTGAAGATGACCACAT
5263	64	136	MW2_CDS_06095	MW1133	FALSE	unmapped	TGGGCGACCATCAACTTATGCACCGACAATAGATACGATTCAAAAGCGTAACTATGTCAA
5264	64	134	MW2_CDS_10431	MW1970	FALSE	unmapped	GACGATTACAGAAGCGTTTGACGTAAAAGAAGATGTTATTGGCCAGAAAATAGGGAACGT
5265	64	132	MW2_CDS_08770	MW1648	FALSE	unmapped	AGCAAGTTGTGCGCATATGATGATTTGGGAAGGTATTGAATTGATTCCTGTCGTTTCGAG
5266	64	130	MW2_CDS_05840	MW1086	FALSE	unmapped	TTCCAATGGCACAATTAGCTATGCGAGCAATCATTGGGGAAAAACTAACAGATATGGGTT
5267	64	128	MW2_CDS_13053	MW2470	FALSE	unmapped	AGCAATTTTCGGATATGCCTTGTATACACTAGTGAAATTTTTCAAACGTTCGAAACAAGG
5268	64	126	MW2_CDS_00485	MW0091	FALSE	unmapped	GCTAAGAAAATATCCCGAAGTGCTAGCCAAAAATGATACGCAACAGCTAGTGTCAATGGC
5269	64	124	MW2_CDS_04481	MW0827	FALSE	unmapped	TCACTACAGATTGCGTCGTTATTGCAATAGGTAGTACAAATATTCCGTTTATGCCTGACA
5270	64	122	MW2_CDS_08093	MW1523	FALSE	unmapped	ATTTGGTATAGGTCCTGCTGGTACAGGTAAGACATTCTTAGCTGTAGTTTATGCAGCAAA
5271	64	120	MW2_CDS_09179	MW1722	FALSE	unmapped	ATTCTAATTGTTATTTTAGTACATATCTTTTCAATTGTTCGTACATTCGGTTTTATTTAA
5272	64	118	MW2_CDS_09305	MW1748	FALSE	unmapped	AGGCGGAATCTTTTTGAAGATGAAATATGACGAAAAGAAATATTATGATGAACAAAAAGA
5273	64	116	MW2_CDS_04623	MW0853	FALSE	unmapped	ATTGCATTCGGTGATGAAGATAATGATATTGAAATGATTGAGTACGCCCGCCATGGTGTT
5274	64	114	MW2_CDS_00442	MW0083	FALSE	unmapped	AATATTCCATGGTCCAGAACTAGCAGACATTATCCCATCACTAGCAACAATGGTGGTGTT
5275	64	112	MW2_CDS_05891	MW1096	FALSE	unmapped	GGATCAAAGGATACTAAAGATGAAGTGTTGCCGGCATTGGCCTATTTCACTTTTTCACCA
5276	64	110	(+)E1A_r60_a104		pos		
5277	64	108	MW2_CDS_10951	MW2067	FALSE	unmapped	TTTTGACTTCTGAAGATTTGGATAGTGTCTTTGAAGGCGATTTCACATTGATGATTAGCT
5278	64	106	MW2_CDS_07096	MW1326	FALSE	unmapped	ATCTGGCGCACCATGGTTTGGCGCAATTATACAACTTATAATCGCTATCATCATGATGTC
5279	64	104	MW2_CDS_06953	MW1299	FALSE	unmapped	AGGTTCAGGGAAAACAAAGTTGGCAGAAACATTAAGTGAAGTTGTTGATACACCCATGCA
5280	64	102	MW2_CDS_11458	MW2172	FALSE	unmapped	ACCAACGTTCGGTGCTGCATTTGAAGCGTTTAAAGACCCAAGTCAATTATTAACGATACA
5281	64	100	MW2_CDS_08404	MW1582	FALSE	unmapped	TCACGATAACTGAAAATGCTGAATTACGTACAGGTCCAAACGCTGCGTATCCAGTCATAT
5282	64	98	MW2_CDS_06716	MW1255	FALSE	unmapped	GGCGACAAGGTTATGCACGGCAAAGTTGATACACTAAAGGTTATATCGCATCATCAACAT
5283	64	96	MW2_CDS_04655	MW0859	FALSE	unmapped	AACTTGTGAACAAGTTTTCACCTGAAGTAGCACCTGAAGATACAGTGGATTTACTTCAGA
5284	64	94	MW2_CDS_02527	MW0467	FALSE	unmapped	ACGTTGGAATGAAAGACTATTTCTCTGGAGCAAGTCCAATTGTTTCAGGAGAACTTGGTG
5285	64	92	MW2_CDS_04593	MW0847	FALSE	unmapped	AAAGTTTCATTTAGATTCTGGCCATTTAGTGAATTTAAACATAATTTCAATCCTGAAAAT
5286	64	90	agr_tiling 049_F		FALSE	unmapped	TAGTACAATCTTTTATCATTATATTGCCTAACTGTAGGAAATAAATACTTAACTGTTAAA
5287	64	88	MW2_CDS_08659	MW1630	FALSE	unmapped	ACGGCATGGCATTACGTGTACCAACAAAGAATGTATCGCTCGTTGATTTAGTTGTTGATT
5288	64	86	MW2_CDS_11029	MW2086	FALSE	unmapped	AAACTAATGATACGCAAACATCAGTTGGCCCAGTTGCAAACAATAAAGCTACGCAAAACG
5289	64	84	(+)E1A_r60_n9		pos		
5290	64	82	MW2_CDS_01125	MW0207	FALSE	unmapped	AGATGAATTTATACGCCCTGACACCACGATGGAGGCATTAGCCAAATTACGTACAGTATT
5291	64	80	agr_tiling 069_F		FALSE	unmapped	TTAATCACTACTCCAACACTTATTAATGCTAAAAACATCATTAGTGTTTCATTAATATGA
5292	64	78	MW2_CDS_06895	MW1286	FALSE	unmapped	ACCTTAACGGTTTGAAACGAAATATTGTTCATATTGGTCATTTTAAAGCTGGTGAAGCGA
5293	64	76	NC_S_047		FALSE	unmapped	TCCAAATCAATGTATATGTGTTATATTGTTTATGGGAAGTAGGTAAGCATTTCGGTGCTT
5294	64	74	MW2_CDS_05505	MW1020	FALSE	unmapped	ACAAGCTAAAAAAGAAACGTGAGAGGGATAAAACTGGATTAGCTTTAATTGAAGGTGTGC
5295	64	72	MW2_CDS_01460	MW0269	FALSE	unmapped	ACCGGTAGAATGGGAAAAGGTATATGCAATGGCATATATAGATGATGAAGGAGGCGAAGT
5296	64	70	MW2_CDS_05106	MW0944	FALSE	unmapped	ACAAATGCGAACTATAAACGACATGGTATGAAGTTGATGATTCTTGGAAATGACGAACCA
5297	64	68	MW2_CDS_07308	MW1365	FALSE	unmapped	TGAACTTTCTCACGAACATGTTCAAACACCAGAAGAAGTAGTTTCAATTGGTCAAGATGT
5298	64	66	MW2_CDS_11438	MW2168	FALSE	unmapped	AGAAAATGCGTCGTTTAGCTTTACGCTCAGCATTATCTTTCAAAGCTCAAGAGAATGGCT
5299	64	64	MW2_CDS_02682	MW0495	FALSE	unmapped	CTGACGCTGCAGCAGAAAAAACTGAATTTGACGTTGAGTTAACTTCAGCTGGTTCATCTA
5300	64	62	pMW2_100		FALSE	unmapped	AAGAAAAGAGTGAAGAAACGGAAGCTAAAAAGGGGTTTTGGAGTCGTCTATTTGGTAACT
5301	64	60	MW2_CDS_02300	MW0425	FALSE	unmapped	AGATGTATACACAATCAGTAGCCAACCACTTGCGCAGTATCTCCTTCGTCAAAAAGAAGG
5302	64	58	MW2_CDS_07928	MW1494	FALSE	unmapped	GCACAAAAGACATGTAAATCAGGAGAGACAATCACAATTAGTAATGGAGAAGCAGTTGCA
5303	64	56	MW2_CDS_01218	MW0224	FALSE	unmapped	CAGTTGTTGGTAGTAGAAGTCAAAAGCCAGCAGATTGGGAACCTTCATTGCAACTTATGG
5304	64	54	MW2_CDS_07557	MW1421	FALSE	unmapped	ACAGACGAACAAGTTAAAGCAATGAGTCATAAAGAAGTTAGCAATGTGATTGAGAACTAT
5305	64	52	MW2_CDS_01289	MW0236	FALSE	unmapped	TGCCGTAGCAATTACAAGCAAAAATGAAATCTTATCGCATGTAGGTGCAGGTAGTGATCA
5306	64	50	DCP_22_0		pos		
5307	64	48	MW2_CDS_10440	MW1972	FALSE	unmapped	GCCTGGCAAAGCAAATACACGTAATGCCATCGAATTATTAAAAATCACTTCATTTCCAGC
5308	64	46	MW2_CDS_07272	MW1359	FALSE	unmapped	ATGCGTAAAAACCCAGACTTCAAATTGAAAATTGAGCAATTACGACGTGACAGCGATCGA
5309	64	44	MW2_CDS_13685	MW2585	FALSE	unmapped	AGAGATAGCAAAATTCTATGATGAATCAAAGATAAAGATGACAAAAGAAGACTTTCAGAA
5310	64	42	MW2_CDS_03579	MW0656	FALSE	unmapped	TTGCAAAAAAGTAATCATACTATACTACTAGTGTTGGAAAAAGGAGAAGATATCGTTGAA
5311	64	40	MW2_CDS_05017	MW0928	FALSE	unmapped	GCAAACGTTGAGACCAATCAAGTTTTAGTATTACTGCATGGTTTTCTTAGCGACAGTCGT
5312	64	38	MW2_CDS_12193	MW2307	FALSE	unmapped	TTGAACTTCAATCAATTCGAGAATCAAAACTTTTTTAACGGTAATCCAAGTGATACATTT
5313	64	36	MW2_CDS_02025	MW0374	FALSE	unmapped	AGGATTTCAAACAATGCTAATTGTATTTGGCATTCCTACAAATAAGATGAATGAGTTACC
5314	64	34	MW2_CDS_07256	MW1355	FALSE	unmapped	AGCAAGGTGTACAAATGGTCTTGATTAGACAATTTGGAGATATCGTTGTACAACATGTTG
5315	64	32	MW2_CDS_09902	MW1857	FALSE	unmapped	ACCTGGTGGTCAGACGTTAATTAAACAAAAGTTAGACGAGCTTGGCAAAATGAAGTATGA
5316	64	30	MW2_CDS_03035	MW0558	FALSE	unmapped	ATCTCGATGTTTTTCTTTTTAGTGAATATGGCTTCGATAGGTAATAAAAATGTTCATGTT
5317	64	28	MW2_CDS_06321	MW1173	FALSE	unmapped	GAACCTGAAGAAGTAGCTATCATCACCGGTATAGGATGTTCTGGCCGTCTTTCAGGATAT
5318	64	26	MW2_CDS_11615	MW2200	FALSE	unmapped	ATTGGTGCGATTCGTGATAGATTCATCAATGAAATTAATTTCTGGATTTTATTCGTTGGT
5319	64	24	MW2_CDS_00810	MW0151	FALSE	unmapped	ATTACAGCAGGTGTAGGATCTGACCATGTAGATTTAGCGGCAGCAAGTGAACACAATATT
5320	64	22	MW2_CDS_04871	MW0897	FALSE	unmapped	AAACGTGGCAAACAAATGGGCTATGTTTATTTTTCATGGTTGTTAGGCCTATTGGTAGGT
5321	64	20	MW2_CDS_01540	MW0282	FALSE	unmapped	ACGCCAGATATGTTAAATCAGTTATCAGCAGTTATTGAGCACAAAACGTTGTCTACTGGT
5322	64	18	MW2_CDS_01512	MW0277	FALSE	unmapped	ACACATATATCCCTAGAGAGTATAATGTCTCTGAAAAAGTATTTTATGATTTGTGGACGG
5323	64	16	MW2_CDS_00478	MW0090	FALSE	unmapped	AAGCACGACAATCCATCGAAACGTAATATGGAGCGTGCAAGTGGTGTCATTATTTTGAAT
5324	64	14	MW2_CDS_11723	MW2222	FALSE	unmapped	GGCGCTATCCTACAATCTTCTGAAGGACCATTTGGTCACGTTGCATATGTAGAAAGTGTA
5325	64	12	MW2_CDS_10754	MW2031	FALSE	unmapped	GGTATGATTGAAACAGCACAAAGTGAAATCAATAGCCAAAAAGAACGTGCCATTGCAGAT
5326	64	10	MW2_CDS_13910	MW2626	FALSE	unmapped	TCAATTGGAAGTGCAATACTTCATTTTGTCATTGGTGGTATCGCTGTTGCATTAGCTTCA
5327	64	8	MW2_CDS_01469	MW0270	FALSE	unmapped	CACTGTAGTATTTGCACTGTGTAACCTTTATTATTTTGCAGCTGTACAAAACCATTACGA
5328	64	6	MW2_CDS_04367	MW0804	FALSE	unmapped	GCAGTAGTTGATGAACCACAAGTGAAAGATGGCAGTGTACCTTTAGTCAATCGAATCACA
5329	64	4	MW2_CDS_12144	MW2298	FALSE	unmapped	GCCATCGAAACAACAGAATTACATCAACGTATCTTAGAAAGTATCACAACATCATACGCT
5330	64	2	MW2_CDS_00411	MW0078	FALSE	unmapped	GATACATCAACCAGCTGAAGAAGTACCACCAGGTGGTGCTAAAGCAATGATTGAAAATGG
5331	64	163	MW2_CDS_02034	MW0376	FALSE	unmapped	ACCAGAAGAAAAAGGTTCTATTACTTTGTCAAAAGAAGCAGCTATCATATTTGCAACTGC
5332	64	161	MW2_CDS_01319	MW0241	FALSE	unmapped	ACCTCAAGTAAAAGTAACAACACCAATTTTAGTGAAAGCACCAATCGCTGGTCGTCGTAT
5333	64	159	MW2_CDS_04507	MW0833	FALSE	unmapped	ACAACAGCAGTATTCTTTGATTTCGGTGTTTTATGTGCAGTAGTTGGTACTGTCATGACA
5334	64	157	perR_tiling_092_F		FALSE	unmapped	AGCTAAAGAAACTGGCGTATATCAGTTAAAAAAATCATTTGGCAAAGAAAGTATGGGCAT
5335	64	155	MW2_CDS_03887	MW0710	FALSE	unmapped	GCATATACTATTGGACCTGAAATGAATATTCAAAAAGCGAATGATGACGGTGAACCGACA
5336	64	153	psma_tiling_053_F		FALSE	unmapped	TATCATCGCTGGCATCATTAAAGTTATCAAAAGCTTAATCGAACAATTCACTGGTAAATA
5337	64	151	MW2_CDS_06588	MW1231	FALSE	unmapped	TAGGCGGCATGTTCTTTTTATTAGCATTCTGTATGATTGTTCCTTGGAGAGCAGCAATGC
5338	64	149	MW2_CDS_04230	MW0777	FALSE	unmapped	ATGGATAATCATAATCAATGTAATTATGTGAATCCACAAAATGTTTCACTTGACTGGGAA
5339	64	147	MW2_CDS_01126	MW0207	FALSE	unmapped	TAAAGTGAAAGAACTAGGCGTGACACCTATTGCACGATTCGTTGGTTATAAGGCAGTAGG
5340	64	145	MW2_CDS_06970	MW1302	FALSE	unmapped	AAAGCTTCTGTAGCAGCTTTGAAAAAGTATCCAGAAGTTAATGCAGAAATCGACGGCGAC
5341	64	143	ETG07_105829		pos		
5342	64	141	MW2_CDS_11132	MW2104	FALSE	unmapped	TTGCGAATAGGTGAAACGTTGTTTAGAGGTGTTGATACAACGACAAATCAAGCGATAGCT
5343	64	139	(-)3xSLv1		neg		
5344	64	137	MW2_CDS_10662	MW2013	FALSE	unmapped	GGTCAGTCAGTGCGGCGTTCCTTGTAGTTCAAACACACTTTGCGAACATTTATTATGAAA
5345	64	135	MW2_CDS_11497	MW2179	FALSE	unmapped	AGTTGGTGGTAGTAGTCCAGTAGATCCAACGGGTAGTACAAATAGTATGGCAATCATGGT
5346	64	133	MW2_CDS_08973	MW1684	FALSE	unmapped	AGCAACTCGGTTATGTTTCGAGTGCTAATGGTTCAAAACCAAGGGATGTTTATGTTACGG
5347	64	131	MW2_CDS_07123	MW1330	FALSE	unmapped	TTGTTGATTCATTAGGGCTACACTCAAATAACCAAAGGCATACAAATGAAACCGAGCAAA
5348	64	129	MW2_CDS_02598	MW0480	FALSE	unmapped	GAGCCGATTAGTTGGTGCTCCTCTAGGATATGTTGGTCATGATGATGGTGGACAATTAAC
5349	64	127	psma_tiling_083_R		FALSE	unmapped	TGCTATTTTCACTGTTTGTTATTGCGCTTATCATTGCATTGATAAGTGGCTTGTTGTTTT
5350	64	125	MW2_CDS_00489	MW0092	FALSE	unmapped	GATGACCGTAGTGTGATTGGATTTTTACAGTCCGCATTTTGGACGGCTTCGATATTAAGC
5351	64	123	MW2_CDS_12931	MW2447	FALSE	unmapped	GGTATCGTTGCTCCATTTGAGGCGAGCAATACGATGTATCGTGCCGTAGAAAAAATATTG
5352	64	121	perR_tiling_094_F		FALSE	unmapped	GATTGAATTTCGATTTATTAGTAGATGAAGATTTTAAATTAGCTAAAGAAACTGGCGTAT
5353	64	119	MW2_CDS_08575	MW1615	FALSE	unmapped	AGAATAGGTAGCGTTGCTACACTTGAATCAATTGTGTTTTACTCAACGTTAAGTGGGTGG
5354	64	117	MW2_CDS_10448	MW1973	FALSE	unmapped	GTGTTAATGCAGCCAAAGCATTGGCATTTGCTTACGATAAGCCACTTATTCCTGTTCATC
5355	64	115	NA		ignore		
5356	64	113	MW2_CDS_09401	MW1767	FALSE	unmapped	AATTTCTTGCCAACACATCAAATGCCTTTATTGGCGCGTGGTAACTTTAACCCAGAATTT
5357	64	111	MW2_CDS_03426	MW0628	FALSE	unmapped	ACTTTGTATGATTTTAATCGTTTAAAAAGAGGTGACTATTCACCAAGAGAAATGGGATTT
5358	64	109	agr_tiling 097_R		FALSE	unmapped	TATCTTCAGTATATTTCTTTGACAAAATCGGAAGTATTTCACTAGTTGTTATAACAATTT
5359	64	107	MW2_CDS_11021	MW2084	FALSE	unmapped	AGCCAAAATGAAGCAATTGAAAAAGCAGGTAAAGCCTTAGTTGATAGTGGTGCTGTAACA
5360	64	105	MW2_CDS_11606	MW2199	FALSE	unmapped	CGCGTAACTCTGACGTTGAAATTGCCATCGTTGACGAGTCGCATATAGATGCCTATTTAA
5361	64	103	MW2_CDS_01910	MW0351	FALSE	unmapped	GCATCAACGACTACGCCTCTATTAAGAGAACGTTCACTTGGCGTATTTGAGGGTGAATAT
5362	64	101	MW2_CDS_05969	MW1110	FALSE	unmapped	TGTCGCATTGTACGAGTCTTTACAACAGTATTATGGTGTTTCCCGTGTAGGGTTATTGCA
5363	64	99	MW2_CDS_05152	MW0953	FALSE	unmapped	TGGGAAAAATATCATTCTTGTTGATGATTCCATTGTTCGCGGTACGACAATTCGACGCAT
5364	64	97	(-)3xSLv1		neg		
5365	64	95	MW2_CDS_05630	MW1046	FALSE	unmapped	TGACAGAGTTGAATAATATTATAAACTCTCTTCAATCTTTGTTTGAGTCTGAATCAGGCT
5366	64	93	MW2_CDS_02977	MW0548	FALSE	unmapped	GATGCTGAAATCGTGATAGGTTGTCAATCTTATTGTGGACCTGGACGCCGAAAAACATTC
5367	64	91	MW2_CDS_13521	MW2557	FALSE	unmapped	ATGAAGAAAAGTAAACGATTAGAAATTGTTTCTACAATAGTTAAAAAGCATAAGATTTAT
5368	64	89	MW2_CDS_09566	MW1797	FALSE	unmapped	GTGGTGATTGTACAATTTGTGTTGATCGTTGTCCAACAAGTGCATTAGTTGGAAATGGCC
5369	64	87	MW2_CDS_03072	MW0564	FALSE	unmapped	AGAGTTATTTTAGTTGGTGGAGATTGTCCAAAAATAAAAGCGAAGCCAGCAATTACGCAA
5370	64	85	MW2_CDS_06051	MW1126	FALSE	unmapped	AGCTGCAGCAATTAAAGCGACTGCTGAAAAATTTGAACGTGAAAAAGCAAAGGGACTTAA
5371	64	83	MW2_CDS_10939	MW2065	FALSE	unmapped	GCGGCTAATGACTTATTGCAAAAAGCGAATGCAAATCCTGTTATAACAACAGGTCATCCT
5372	64	81	pMW2_066		FALSE	unmapped	GGTTATGATCCTACAAAAGAATATGTGAAAGTAAATCATAAAGGGAAATATGTGCGTTCG
5373	64	79	MW2_CDS_10771	MW2035	FALSE	unmapped	TTAATAAGCCAGTTTTAGTTTTGCGAAGCGTTACAGAACGTCCTGAAGGTGTTGAAGCTG
5374	64	77	MW2_CDS_05703	MW1062	FALSE	unmapped	GTAAACCGATTACCGCTACAGAAGAAGATTTAGATGACAATAACAGAGCACGAAGCGCGA
5375	64	75	MW2_CDS_08026	MW1512	FALSE	unmapped	CAACCTGAGGACGTAATCGATAATATCACAATATGTGGTATGGGCGGACCACTTATTGCT
5376	64	73	NC_A_031		FALSE	unmapped	GATGTGAACGAAAATAAGCATCACCTTATACACCTCCTCTCTGCGTCTAAATTGACGCCT
5377	64	71	MW2_CDS_11621	MW2201	FALSE	unmapped	GATATTCAAGTTGCGCCATCATATGAACGAGGAAAAAATCCATTTCCTAAAGAATGGCGT
5378	64	69	MW2_CDS_07103	MW1327	FALSE	unmapped	AAAATGGCATGACAATCGTTCATCCATATGACGATAAGTTTGTAATGGCAGGCCAAGGAA
5379	64	67	MW2_CDS_01016	MW0188	FALSE	unmapped	TTGATTTTGCATTGCCAAAAGGTACACCAATTAAAGCGCCGACGAATGGTAAAGTAACAC
5380	64	65	MW2_CDS_10048	MW1889	FALSE	unmapped	GACTTGTATGGTGCTTATTATGGTTATCAATGTGCGGGTGGTACACCAAACAAAACAGCT
5381	64	63	MW2_CDS_02909	MW0536	FALSE	unmapped	AGCAGTGTCTGATTATAAAGAACATGTTGTCTTTATTTTGTGGGGGAAACCTGCACAGCA
5382	64	61	MW2_CDS_07877	MW1484	FALSE	unmapped	ATGCGTAATATAATATTTTATCTTGTACTTATTATTGCTGCGATTGGATTAGTAATGAAT
5383	64	59	MW2_CDS_04417	MW0814	FALSE	unmapped	ATTCATTTAATTGGTGCAATTGTGCCAACGACTGAAGTTACGGACAATGCAGAAATGACT
5384	64	57	MW2_CDS_08303	MW1561	FALSE	unmapped	CGAAATTATGAAAAACTTAGAAGGTCATAGTGTCGCTTTACTTGCTCAAGATTACTATTA
5385	64	55	MW2_CDS_07871	MW1483	FALSE	unmapped	TGAATGTTACATCAACATACTACGACAAAGTTGCTAAAGCTTTGAAATCCTACTATAACG
5386	64	53	MW2_CDS_07040	MW1315	FALSE	unmapped	AGGAGATCATGAAATCAAATCCATTGGTGTCGCACATGCTAACGTCATTGAATATGTTGA
5387	64	51	MW2_CDS_08703	MW1637	FALSE	unmapped	AACGGCGAAAAATGATGAATTTGATCGGGTATTAGGTTTAGAATTAGGTGCCGATGACTA
5388	64	49	MW2_CDS_07571	MW1425	FALSE	unmapped	TGCCTAGTGGAAGAGCTTTAGCTTATCCAAAAGCTTCAGTTGGTGAAAATAGTTGGGGTA
5389	64	47	agr_tiling 098_F		FALSE	unmapped	ATAGAGAAAAATTATTATAAAAATTGTTATAACAACTAGTGAAATACTTCCGATTTTGTC
5390	64	45	MW2_CDS_10814	MW2042	FALSE	unmapped	AATGAAGATTTAAAAATCGACACGTATCGTTCAAGTGGTGCAGGTGGTCAGCACGTAAAC
5391	64	43	(+)E1A_r60_a97		pos		
5392	64	41	MW2_CDS_11464	MW2173	FALSE	unmapped	TTGTTTGGTAAAGGGAAAGAAGCGGTATATCGTTGTGTTTGTGGACATTCTGAAACGCAA
5393	64	39	MW2_CDS_07619	MW1437	FALSE	unmapped	TGCTTCCAGATAATTTGGATGGGGTATGGTTAGGAGATTTAATTTTAATAAAGCGTGGCT
5394	64	37	MW2_CDS_12974	MW2455	FALSE	unmapped	TCGGTGGTACCGCACTCGCATTTTATTTCTTTATCGACAGTTTACAATACATATCAGCGA
5395	64	35	(+)E1A_r60_a104		pos		
5396	64	33	MW2_CDS_13115	MW2483	FALSE	unmapped	TGACTTGTTACCAGAAGATCAAAGAAAAGCGGTTTGGGCAATTTATGCTGTGTGTCGTAA
5397	64	31	MW2_CDS_02114	MW0390	FALSE	unmapped	ACTTGGTGACGATAAAAATAAATATAAAGAAAAAACACATGGCCTTGATGTCTTTGCAGT
5398	64	29	MW2_CDS_01308	MW0240	FALSE	unmapped	AGGTGAACATCGAATGACAAGTAAGGTACTTGTTTTTAAGGAGATGGCAACGCCACCTAA
5399	64	27	MW2_CDS_03256	MW0598	FALSE	unmapped	ACAGCCAAAGTTGACATTTTAGGAGTCGATTTTGATAATACAACAATGTTGCAAATGGTT
5400	64	25	MW2_CDS_13337	MW2523	FALSE	unmapped	TACCTGCTGACGAAGTAGCATGTATTGTTATTGAAACGATACAAGGCGATGGTGGACTTT
5401	64	23	MW2_CDS_04046	MW0737	FALSE	unmapped	GACCTGATAGAGCAGCACAATTATCGGAAATTTTTGCGAACAGAGCATTCGAAGGCTTTA
5402	64	21	MW2_CDS_01290	MW0237	FALSE	unmapped	GAAACCGTTTGGTCAAAAACGTATTGAACAAGCAGTCAATAAAGTGCGTGCGACTAAAGC
5403	64	19	MW2_CDS_04698	MW0868	FALSE	unmapped	GCGAGAGCTAAAGGTAATTCGACAATGCGTGTACTTTTTGGACATGCACTTAGAAATGCT
5404	64	17	MW2_CDS_02208	MW0407	FALSE	unmapped	CAAAATATAACAACACATGCGACAACGCCGCCTACAGTGAGTGTCATCATTAGTGTTGTC
5405	64	15	MW2_CDS_07200	MW1346	FALSE	unmapped	ACGATGGCTATCTAATTGTTAGAGATGAAGCGGGTGAATCACACCGTTTAATTAGTGCAG
5406	64	13	MW2_CDS_10277	MW1940	FALSE	unmapped	TGAAGTTGTGACTGAAAAACCTAAGCCATGGGATGTATATGCGTTCCCATATTACTACGT
5407	64	11	MW2_CDS_07389	MW1380	FALSE	unmapped	AGCTAAAAACCAAAAGAATCCGCCAGTGCCAGCAGGTTATACACCCGATAAAAATAATGT
5408	64	9	MW2_CDS_00752	MW0139	FALSE	unmapped	GCGTTGAGGCGGGAACATCGAGAGTAATTGGCACAGATTATGACAATATTGTTCGAAATG
5409	64	7	MW2_CDS_13813	MW2608	FALSE	unmapped	GGGGTTATCCAATAGGACAAATATTGATACCAGGCCGAGATGAAGGGCATATGTTACGTT
5410	64	5	MW2_CDS_09328	MW1752	FALSE	unmapped	TGAAAGTCGGTGATGAAATCAAAGCACATCCTAATGGTTTTTATAATAACGGTGGTGGAC
5411	64	3	MW2_CDS_09193	MW1724	FALSE	unmapped	ATATCAATCATTTTAGTCATGATTGGCGGCGGTTTCGGTGCAATTACTAGAAGTGCCATT
5412	64	1	perR_tiling_113_R		FALSE	unmapped	GTTGATATAAATGAATTTTAGTGAAAGTGAACGTTTACAACAACTTTCAAACGAATATAT
5413	63	164	MW2_CDS_12237	MW2316	FALSE	unmapped	TTTATTAACAGCGAGACGTGTTACTACGAAAAGTATTCGAAGATTAAGTTCAGCGTCGGA
5414	63	162	MW2_CDS_04570	MW0844	FALSE	unmapped	ACTGCTGGAATTAACATCGAAGCTATGATGATTGGTGCTGCAAAAGCACGTGAAGAATTA
5415	63	160	MW2_CDS_12244	MW2317	FALSE	unmapped	AGCATTTAGAAATGTAATGATGACATTTTCATTATCAGAAATCAAAGCGATTTATACAGA
5416	63	158	MW2_CDS_07066	MW1319	FALSE	unmapped	ACCGCTACTTGATTTAGCTTTATCTGATGAAAAAGTACCGGTTAGACGTCAAGCGATTGT
5417	63	156	MW2_CDS_03310	MW0608	FALSE	unmapped	TGCATTCCTCGTAATTCATGATGTAAGAGATGTCTATGGTAATGGCTTTCTTGCAGATGA
5418	63	154	MW2_CDS_10852	MW2049	FALSE	unmapped	ACACGGTGGTACTGGTATCCCAACTAAAGATATCCAAAAAGCAATTCCATTTGGTACAGC
5419	63	152	(+)E1A_r60_a104		pos		
5420	63	150	MW2_CDS_02786	MW0514	FALSE	unmapped	GATTTAGACATTTACATAGATATTGCTGAGCGTGCAGGTCAACATGCAAACGTTGAGCGT
5421	63	148	NC_A_048		FALSE	unmapped	AAATTAATAAATTATCAAATTGACATACCTTATTGTATTTATAGAAAAACAAAAAAAGGT
5422	63	146	MW2_CDS_11902	MW2255	FALSE	unmapped	AGAACCTGCGACTTATAAAGAAGACAGACGTTCATCAGTTGTAATTGATGCAGAAAAACA
5423	63	144	MW2_CDS_07053	MW1317	FALSE	unmapped	TGCCAGTTATACCAACGTAGCGCAGATATCTTTTTAGGTGTGCCATTTAATATCGCAAGC
5424	63	142	MW2_CDS_03541	MW0649	FALSE	unmapped	TGCGATCTTAAACAAGAACTTGTCTATGAACTAAAAGCCATTGCTTTAAAAGGGGACGTT
5425	63	140	MW2_CDS_06896	MW1287	FALSE	unmapped	AACTGTAAAAGCACATGTTATTCAAGTGCGCGAAGTACAAGCTGGTGATTATTGCGGTTA
5426	63	138	MW2_CDS_00570	MW0106	FALSE	unmapped	ACTAAAATCAATGTGAAGTTGAATATTGTAAGTACGATTCAATGTGTCATTGCTGCCGTT
5427	63	136	MW2_CDS_13063	MW2473	FALSE	unmapped	CCTGCATTAACGAAATTGTTTGGAAAAGGTTCGTGGTATTTACCAGCATGGTTGAATCGC
5428	63	134	MW2_CDS_09227	MW1731	FALSE	unmapped	ATTTAAGAGGCATGCTACGAAGAATGATTGGTCATCCGAAAAAAGATCGAGCGGCATATG
5429	63	132	MW2_CDS_07383	MW1379	FALSE	unmapped	ACACAGTGGTTTCAATCCTTCATTTATTGCAACTGTTTCTCATGAAAAAGGCTCAGGAGA
5430	63	130	MW2_CDS_10698	MW2021	FALSE	unmapped	GTCCCCTAAATCCCAAAATAATGAAATTCTCTCAGATAGTATTTTAGATATTGACTCTCA
5431	63	128	MW2_CDS_13156	MW2490	FALSE	unmapped	AACAAACACTGTTGACCAACAAATCAACGCAGCTGTTAAAGCATACAAAGCACAAGGTTT
5432	63	126	MW2_CDS_07118	MW1329	FALSE	unmapped	ACGGGCGACAAAGATTTACTGCAATGTATTAATGACAATGTTGAAGTCTGGCTAATTAAA
5433	63	124	MW2_CDS_06154	MW1143	FALSE	unmapped	AAATGTATAAAAATTTATCAGTCACGTCAAAGACGCTTTGGCGGATTGAGTGAGGAGTAG
5434	63	122	MW2_CDS_06121	MW1137	FALSE	unmapped	ATTCGAAGCACCAAGTATGCCGAATGCAGTTGTAGATATTACCCCACAATATGTTGATGA
5435	63	120	MW2_CDS_06817	MW1273	FALSE	unmapped	TAACGCAACGTATCTTATTGATAACGATCCATTTGTCGCTGCACAAGCTCATTTAGCAGC
5436	63	118	MW2_CDS_03854	MW0705	FALSE	unmapped	CATTCGCATTGGATTTACACCAGACGAAGAAATCGGTCGTGGTCCACATAAATTTGATGT
5437	63	116	MW2_CDS_01944	MW0357	FALSE	unmapped	ACCATTTACAGCGCAAGCTTTCGATCCAAAAAAAGATCAATTTAAAGAAGTTACACAAGA
5438	63	114	MW2_CDS_06173	MW1146	FALSE	unmapped	TCAGGCGTTGCACATTTTGCTGAAGGTATTGAAGTTGGTCAAGTATTCAAATTGGGTACT
5439	63	112	MW2_CDS_06561	MW1225	FALSE	unmapped	AGGCAAAGATTAGGCGAACCAGAAACAGAGATTGTTAAAGGTAGAGTGCGTTACGAACAA
5440	63	110	MW2_CDS_09610	MW1805	FALSE	unmapped	TGCAGCCATCGAAGAGTATCGACACCATTTAGAGCATTTAGACCGCATAAGAATTAGCTT
5441	63	108	MW2_CDS_02762	MW0509	FALSE	unmapped	ACTTTAAAACCAACTAAAATCTATGTAGAAGATGAATATGTGCGTGCTGTTCGTGGCGGT
5442	63	106	MW2_CDS_11017	MW2084	FALSE	unmapped	CGTATCGTTCAAGCAAAATCTGCAGAAGAAATTAAACAAGTATTCGAGGAGGCAGATGCA
5443	63	104	MW2_CDS_02799	MW0516	FALSE	unmapped	AATACGCAAACTGCAACTGCAGATCAGCCTAAAGTGACAATGAGTGATAGTGCAACATTT
5444	63	102	MW2_CDS_13078	MW2475	FALSE	unmapped	ACCAGTTGTGGCAGGTAATACAGTGTTATTGAAACCTGCTGAGGATACACCTTATATCGC
5445	63	100	NA		ignore		
5446	63	98	MW2_CDS_05782	MW1075	FALSE	unmapped	GGTTTAGAACCTACTGAAGTTGCTAATTTTTTGGAGCAACTAAGCACTGAAATTGAACGT
5447	63	96	MW2_CDS_07690	MW1451	FALSE	unmapped	CGCGTATTTGGTAAAGGCGATAAAGAAAGAATTGTACCATTAGGCGACGCAGTCATTGAG
5448	63	94	MW2_CDS_03607	MW0661	FALSE	unmapped	AGTTAATCCACAAGGGAAAGTGGTTAATACAGTTGGCTCTGGTGATAGTACAGTTGCAGG
5449	63	92	MW2_CDS_13575	MW2567	FALSE	unmapped	GGTGCAATGGGTGTACTAATGATTTGGTTATCACGACGCAATAAGTTGAAAAATAAAGCA
5450	63	90	MW2_CDS_05892	MW1096	FALSE	unmapped	ACCAGTTCCATATAGCGTAGCTCAAATCAAATCTTTCGGAGTACCTTTAACAAGCGTTTC
5451	63	88	MW2_CDS_05319	MW0985	FALSE	unmapped	GACCGTAATTCGCACCATTTAAAAGAAGCAGAGCGAGATTTAACCAAACTAGCACCACAA
5452	63	86	MW2_CDS_02169	MW0400	FALSE	unmapped	CGTAAGCGATATAATATCCCGACGCAAAAAGCGCCTAAATTATTATTGAAAGGCTCAGGT
5453	63	84	MW2_CDS_13751	MW2597	FALSE	unmapped	CCTTATCCATGCTAGTAATTTTGATGAAGCATGCCATGTCATGAATACAATCGCGCCTGA
5454	63	82	MW2_CDS_06434	MW1198	FALSE	unmapped	AAAGAATACAAGAAAGCAATAGAATTAGAAAATAAGAATAAAGAACAAAAATTAGAAAAA
5455	63	80	MW2_CDS_02122	MW0391	FALSE	unmapped	ACCGATACTACACTGGAAAGACTATGGAAATGAAAAATATTAGTGCTTTGAAACATGGTA
5456	63	78	MW2_CDS_08548	MW1610	FALSE	unmapped	TTTGTAGTCAAAACTGCTAGCGGATATTGTTATCTTAACAAACGTGAAGCTCAAGCAGCA
5457	63	76	MW2_CDS_04824	MW0890	FALSE	unmapped	TAACTTGTGCGATGACGGTGGGGACGTTTGTAGGTTCGATGATTCCATTATTGATGAATA
5458	63	74	MW2_CDS_05741	MW1068	FALSE	unmapped	TGGTCATGCATTCTATGATTCTGCTTCAGATCAAGATATCTTCACTGTTGAACAGGTTGA
5459	63	72	MW2_CDS_10635	MW2007	FALSE	unmapped	GCTGCAATTATTGCAGGTGTGATGTTAGTAAGTGGTATAACATGGCGTATCTTAGCACCT
5460	63	70	MW2_CDS_10751	MW2030	FALSE	unmapped	AATGGTGTATTTACTGACATTAATCCATACATTAAAAATATGATGTACGTGTTAGCAGAT
5461	63	68	agr_tiling 034_F		FALSE	unmapped	TTATCGACACAGTGAACAAATTCACTAAAAAATAAGATGAATAATTAATTACTTTCATTG
5462	63	66	MW2_CDS_10107	MW1901	FALSE	unmapped	AGATTTTTGTGAAGATGTAAGCGAGAGAGTGAACGGAAATCCGATGAAACCGAAGACGAA
5463	63	64	MW2_CDS_01439	MW0264	FALSE	unmapped	AGCATGCTGAAGAGATTGCGCATGAAATTGAAGTTCGTTCTGGATATTTAAGAAAAGCTG
5464	63	62	MW2_CDS_06844	MW1277	FALSE	unmapped	TGGCCAGATAAAAAAATAAATGCTGTATCACCAAACTCAAGTCATGGTACTTATGACTTC
5465	63	60	MW2_CDS_11047	MW2089	FALSE	unmapped	ACTGTAAAAATCAATTTACCAGAACATGTCACTAAAGCACAACCAAGTGAAACGAAGGCT
5466	63	58	MW2_CDS_00304	MW0058	FALSE	unmapped	TTATAACCTTGTTGAAATCGACGGTGACAAAAAAGTGGCTACATTCGAACATATCAAAGC
5467	63	56	MW2_CDS_12214	MW2312	FALSE	unmapped	AGACGCTCTGTATGTGAATTTATTAACGGACACTCTCTAATAGATACCAGCATTTTAAAT
5468	63	54	MW2_CDS_06471	MW1207	FALSE	unmapped	CTTGTATGCTTTAGGGAGTATATTAGCAGTATATTGTATTAGTCATTTTAAAAGGGCGGA
5469	63	52	MW2_CDS_10622	MW2005	FALSE	unmapped	TGGTAATGAAGCGAAGTATATTTATGATTCGGGCCAGCAACATGTCGAAAAAGCACAACA
5470	63	50	MW2_CDS_08830	MW1658	FALSE	unmapped	CACCCCTAAAAATCCAGTAACCGAACCAAACTTTGATAAGGTAGTTCAATATGAAAGCGT
5471	63	48	MW2_CDS_10204	MW1923	FALSE	unmapped	TCTGACTTTGAAGAAATAAAAGAACCTGCAACAGAAAAAGAAAGCGAAGAAGAGCCATTT
5472	63	46	MW2_CDS_07464	MW1395	FALSE	unmapped	GGGATACCTGAAGTGTTGAATAAATTAGAATCGGTATACGGTAAACAAGCAATGCAGGCT
5473	63	44	MW2_CDS_13315	MW2520	FALSE	unmapped	TAACAGGGTCTGATGGCGAAGTAATATTTTTAGACGGGAAGGCATATCATGCTAACGAGC
5474	63	42	MW2_CDS_09556	MW1795	FALSE	unmapped	TCCTACTACAATTGCAGGTTTTCATTTAGATACAGATCAAGCGCCAGTTCTAGATGAATT
5475	63	40	MW2_CDS_04867	MW0897	FALSE	unmapped	CTTGGGGTGTTTTTAATAGTATCCAAGGATTCGGCTCAATGATAGGGCCATTATTTGGCG
5476	63	38	MW2_CDS_13516	MW2556	FALSE	unmapped	AATCCGCAGGCGACGTTTAAAAAAGTAGTAGCAATTGAAATTCCAACTAGTCGAACTTTT
5477	63	36	MW2_CDS_10554	MW1992	FALSE	unmapped	TCCTACAGTTATTGTTGCGGCAATAACTGGTAGGATTAATAAAGCGAAAATACCGACACA
5478	63	34	MW2_CDS_07439	MW1390	FALSE	unmapped	TTGGGACGGCGTAAAAACTAAAACTGGTGAAGCCTTTAGTAAAATGGGCAGAAATGCTAA
5479	63	32	MW2_CDS_07455	MW1393	FALSE	unmapped	AGATGGTTTAACAGGTCAGCCGGTATACGTAGCCTTACTTAAAGGTACTTTTAGTTTAGA
5480	63	30	MW2_CDS_03171	MW0583	FALSE	unmapped	AAGTAGACGCTAACGGCAAACAAACAGAATTTAAGCGTCGATTCGCTAACATTAACCCTG
5481	63	28	(+)E1A_r60_a135		pos		
5482	63	26	MW2_CDS_10068	MW1893	FALSE	unmapped	TCACATTTTGGTATTTCAACATATATTGATGGAGAAGGCGAAGACGGAGGTTCATCCGGT
5483	63	24	MW2_CDS_07576	MW1426	FALSE	unmapped	TAAGGGTATCGCAGTTGGATTGAACAACATTCAACTTGTAGAAAAAGGCGAACCTCTTGG
5484	63	22	perR_tiling_115_R		FALSE	unmapped	CAACTTTCAAACGAATATATTCTAGGCGGTGTCAATTCCCCTTCTCGTTCTTATAAAGCT
5485	63	20	MW2_CDS_04944	MW0913	FALSE	unmapped	AGCAACAACTATCACTCCTTTTAACGCTAAATATAACATTCATTATTTAAGTGACGACGA
5486	63	18	MW2_CDS_03352	MW0616	FALSE	unmapped	TAGCAGAAGTTAACCAAGTAGTGCCTGAAGCAAGTATTTGGAAGGGAATCTGGTTTGGTA
5487	63	16	MW2_CDS_12696	MW2401	FALSE	unmapped	AGTGTTGCAAGTATCTATTTTAAAATGAAATATGACGAAAAAGAAAAACAAAAAGCAATT
5488	63	14	MW2_CDS_05384	MW0997	FALSE	unmapped	AGATCCGTTAAATGATTTCATGCCGGATACTGGAACAATCATTGCTTATCGTTCAAGCGG
5489	63	12	MW2_CDS_04475	MW0826	FALSE	unmapped	ACAGCATGTTCATTAGGATCTGCTAATCTAATTGATACAACCAAATTTATTCCATTAGGT
5490	63	10	psma_tiling_067_R		FALSE	unmapped	AAATTTAATTATATTTTATGTTATAAGTTTAAAACGAATAACACGTTAGGTCTCGTCTAG
5491	63	8	MW2_CDS_04113	MW0752	FALSE	unmapped	AAGAACAATGACAGCACTTCGTTTGTAGAGATTGAGAATGTATTTGAAGAACAAGGTTTT
5492	63	6	RC5		pos		
5493	63	4	MW2_CDS_06326	MW1174	FALSE	unmapped	ACGTAGACGAGGCGATTAAAATAATTGACGAATCTGGTATGCATTTTAGAGTAGGTCCGT
5494	63	2	(-)3xSLv1		neg		
5495	63	163	MW2_CDS_06687	MW1249	FALSE	unmapped	TTGACTGTGCCAATCAAGAACTCATACGAAGATGTCAATACAAATACTGATGGTAGTGCA
5496	63	161	(+)E1A_r60_n9		pos		
5497	63	159	MW2_CDS_03445	MW0632	FALSE	unmapped	AGGTTGTATGTGTCAACCGGCATTTGAGTTTAAGCAGTTTGAATTGTTTAAGCAATCTGA
5498	63	157	MW2_CDS_04293	MW0790	FALSE	unmapped	GTGTCCCTAGAAGGAGAGCTAAGCAAAAAGCATTAGAACTTGTCGAACTCGTCGGTTTAA
5499	63	155	MW2_CDS_08794	MW1652	FALSE	unmapped	TCCTACATATATTAAGCATGGTGTGGTTCATTATGCAGTTGCAAATATGCCAGGTGCAGT
5500	63	153	MW2_CDS_03080	MW0566	FALSE	unmapped	ATTTTGTGAGTGAAGCATTTTCGGATTTGCCATATGACTATGATCGACCGGGGTCAAATC
5501	63	151	MW2_CDS_06862	MW1281	FALSE	unmapped	GTGTGTATGCCACTGACCCAAGACTTTTACCAAAAGCTAAACGACTAGACATCGTCTCAT
5502	63	149	MW2_CDS_12277	MW2323	FALSE	unmapped	TAGCAGGTGAAGAACAACAAGTTGGAGTTATGGTTGTTGCACACGGCAATATTAATGGAA
5503	63	147	MW2_CDS_02462	MW0455	FALSE	unmapped	ACATGCACCACAAATTCAAGGATTCTTTGATATTCCAATTGACCACTTAATGGGTGTGCC
5504	63	145	MW2_CDS_10545	MW1990	FALSE	unmapped	AGAAACAACCACTCAAGATAAATTTTACGAAGTTAAAGTCGGTGGAGAATTAGATGTTTA
5505	63	143	MW2_CDS_08763	MW1647	FALSE	unmapped	ACGTTCTAAAGGGCAATTGATTATTAATGATATTGCGCAAGATTTTGGTGGCGGTGGTCA
5506	63	141	MW2_CDS_02714	MW0501	FALSE	unmapped	ATGCCTCGTAAAGGATCAGTACCTAAAAGAGACGTATTACCAGATCCAATTCATAACTCT
5507	63	139	agr_tiling 172_R		FALSE	unmapped	TTTTTAAAGATGATCCAGCAGAATTAAGAACTCGAATTATAGATTGTTTAGAAACTGCAC
5508	63	137	MW2_CDS_02160	MW0398	FALSE	unmapped	TTCAAAAGAAGATAGGGATATTTCAGTCATTGATTATTTAAGTTATAAGCCAGCGAAAAA
5509	63	135	MW2_CDS_12758	MW2415	FALSE	unmapped	GTGTTTCCAAGTGTGGCGATACTATATATAGGTGCAACTTTAGTGGGACTTGGGCAATCT
5510	63	133	agr_tiling 043_R		FALSE	unmapped	TCTGTGATCTAGTTATATTAAAACATGCTAAAAGCATTTATTTTCCAATTTTTCTTAACT
5511	63	131	MW2_CDS_00671	MW0126	FALSE	unmapped	TTTAATTAACAAAGGTGCTTTAAGTCAAGTGACAACGGCGTCATTAGCGGGTATTTCCGG
5512	63	129	MW2_CDS_03484	MW0638	FALSE	unmapped	AGGACACTTAATAAAGATGAACATAATTATATCAAGCAAATAGCTAATATACATGAGACA
5513	63	127	MW2_CDS_01768	MW0322	FALSE	unmapped	ATCAATTGTGGGCGTTTGTTGCGCCTGGTTTGCATAATAATGAGCGCCAATTTATTTATA
5514	63	125	MW2_CDS_07773	MW1465	FALSE	unmapped	GTGCTCGTAATTTAGGATTATCTGCAAATACAATTATTTCTGGTGGCGGTTCAGACGGCA
5515	63	123	MW2_CDS_06302	MW1169	FALSE	unmapped	AGAAGCAGGTGAACAAGCTACATTTGAAGTGAACGCACATAATATGCATCCTGACTTAGT
5516	63	121	MW2_CDS_12818	MW2425	FALSE	unmapped	ACAACTTGAAATGATGAAAGTGGCAGTAAAATTTGAGGATGCAGAATCATTTACGAAGCA
5517	63	119	MW2_CDS_05006	MW0926	FALSE	unmapped	GGCATTGAACGATTTAATGGATTTGTTCAACAATATATCGGACATAGATGTGGACGAGCA
5518	63	117	MW2_CDS_09362	MW1759	FALSE	unmapped	CGTGGGGGATAATGCAGAGAATCCCGCTTATTACGCTTGGTATACTACCTAATGGTTTAG
5519	63	115	MW2_CDS_10863	MW2051	FALSE	unmapped	GTACCAGGTGGATTTGGTTTCCGTGCAAGTGAAGGTAAAATTAGTGCAATTAAGTATGCT
5520	63	113	MW2_CDS_03653	MW0669	FALSE	unmapped	ACTTTAGAGGTCGTAAGAACAGAGGTGAAAAAATAGATGACCCACTTACTGATCGTGGAT
5521	63	111	MW2_CDS_06107	MW1135	FALSE	unmapped	TGCAACGCATTTATTGAATCAAGGTGCAGACCTAAGAACAGTACAATCGTTATTAGGTCA
5522	63	109	MW2_CDS_08972	MW1683	FALSE	unmapped	AAAGCAGATCGTGTATTCTTATGTGAAATTTTTGGATCAATTAGAGAAAATACTGGCGCA
5523	63	107	MW2_CDS_10365	MW1957	FALSE	unmapped	AGCGATGACGAATTAGAATCAATGATTGCACATGCAGTTAAACATGTTCCTTCATCATTT
5524	63	105	MW2_CDS_03388	MW0622	FALSE	unmapped	AGTCACGTCGACTGTTGGTAAGGGGACAACTGTCAGATTGATTTTCCCATTACAAAATGA
5525	63	103	(+)E1A_r60_a22		pos		
5526	63	101	MW2_CDS_07046	MW1316	FALSE	unmapped	GTTGCACATGACTTGCAACGAGTAATTGGTTTTGAAAATCAATTACCTTGGCACCTACCA
5527	63	99	MW2_CDS_11443	MW2169	FALSE	unmapped	CTTTTGTAGCTGGCGACGTTATTGACGTAACAGGCGTATCAAAAGGTAAAGGTTTCCAAG
5528	63	97	MW2_CDS_07852	MW1480	FALSE	unmapped	CAGGTGAAATTGTTGAAATCTTAGTAGAAGACGGACAAATGGTAGAGTATGGCCAACCGT
5529	63	95	MW2_CDS_13373	MW2531	FALSE	unmapped	CAAACTACATACCATCGATGCTAAAGAAGTCATTTTGTCTGGTGGGGCATTCAATACGCC
5530	63	93	MW2_CDS_07080	MW1323	FALSE	unmapped	TGCACTAGAACATGCACGTGAATTAAATGTTCAAAACGCACTATTATATACAGACTCAAA
5531	63	91	agr_tiling 137_R		FALSE	unmapped	AGTATAGAAATACCAGATGAAGTAACTCGCATTAATTTGAATATGATCGATTTAAGTCGC
5532	63	89	(+)E1A_r60_a22		pos		
5533	63	87	MW2_CDS_06666	MW1246	FALSE	unmapped	GTGTGCAGGCAAATTGCTTGGTATTGTAGGCGTTATTTTAGGTATTCCGGGATATGCTAT
5534	63	85	MW2_CDS_05660	MW1051	FALSE	unmapped	TGCAGTTATAGACAAAGATAAAACAAGTGCATTGTTGGGTGCTAATATTCAATGCGATCA
5535	63	83	MW2_CDS_01252	MW0230	FALSE	unmapped	TGGCGATGAGCTTAGAGGTTTTTACATGGATTATAAAAAAGAGTTGCCAGGTCCAATTGT
5536	63	81	MW2_CDS_09813	MW1842	FALSE	unmapped	TGCCAAAGAAACAGAAGATGGACAATTTAAAGTGCCTACAATCATGAATGAGGAGGACGC
5537	63	79	agr_tiling 073_R		FALSE	unmapped	AGAAGAAGCCTATCCCAGCGAGGCTTGTAAAGCAAAAAAGATATTTTTCAATTATAATTA
5538	63	77	MW2_CDS_06722	MW1256	FALSE	unmapped	AGAAAACGTGCAATCGTTTTACATGGTGCAAATGGTATGGATGAAGCAACACTATCTGGT
5539	63	75	(+)E1A_r60_a107		pos		
5540	63	73	MW2_CDS_08884	MW1668	FALSE	unmapped	CGCAGCTACATTCCATTGGACAGCTGGATTTTCATTTAGTGCAGGTTTGATAGATTATGT
5541	63	71	MW2_CDS_09763	MW1833	FALSE	unmapped	CCAAACTATACATCATTAGCGCCTATGCTTGAACAATTAAACCGTTCGTTTGAAGGAGGT
5542	63	69	MW2_CDS_13351	MW2526	FALSE	unmapped	GAACACGGTAAAGGATTCATCCAATTCGGTACAGAAGTGGTTAACTCACAAGACCACACT
5543	63	67	MW2_CDS_05463	MW1012	FALSE	unmapped	TGTTGCAGTTGAACCTGGATATAAGAGCTTAACTACTAAAGTACATATTGTCGTGCCACA
5544	63	65	MW2_CDS_07629	MW1440	FALSE	unmapped	TGGCGAGTCCGGAAGTGATCAAAAATTAACTAGCGGTCAAGTTGAAAGTTTAATCCAAGA
5545	63	63	MW2_CDS_00636	MW0117	FALSE	unmapped	TCACATGAAGGATACACAGAAACGAAAGATTCAAATTTCGACATTGTAAGAGAGTACGAA
5546	63	61	MW2_CDS_01935	MW0356	FALSE	unmapped	TGTTGCATTCTGCCCTCACTGTGACGGACCTCTATTTGAAAATAAAGACGTAGCAGTTAT
5547	63	59	MW2_CDS_01872	MW0342	FALSE	unmapped	GTATTAGTAGGTCGTTTAACGAAAGATCCGGAATACAGAACCACTCCCTCAGGTGTGAGT
5548	63	57	MW2_CDS_09554	MW1795	FALSE	unmapped	AGAAAATGGTAAAACAAGCTTCGAACCAGCCGATTTAAAAGCACATAGAATGGTAAATGT
5549	63	55	MW2_CDS_03258	MW0599	FALSE	unmapped	GTCAGCGTTATCGCAATTAGTGCTGGCTTGAGTGGACAACTTACAGGGATTGAAAATATC
5550	63	53	MW2_CDS_13047	MW2469	FALSE	unmapped	TGTACATCAAATGCTGGCTTTGGCAATGGCAATGACGCTGAAGAAAAAGATATTATGCAC
5551	63	51	DCP_22_9		pos		
5552	63	49	MW2_CDS_05456	MW1011	FALSE	unmapped	ACAACTCCAACTAAGGTAGTATCTACGACTCAAAATGTTGCAAAACCAACAACTGCTTCA
5553	63	47	MW2_CDS_02385	MW0441	FALSE	unmapped	AAGCCATTACCAAGTAAAGATAATTTGGCTATATTGTATGGAGAAGGATTTCATATTTGT
5554	63	45	MW2_CDS_06619	MW1237	FALSE	unmapped	TGACGCTATGGTTCGTTTTGACTCACTTGTTGAAATGGATTACTATCGTCACGGTGGAAT
5555	63	43	agr_tiling 215_R		FALSE	unmapped	ATTTCCTCACCTTCATTTTCAAATAACTGAGTTAAATTTAACACATCGGTTGCTAAAATC
5556	63	41	MW2_CDS_06495	MW1212	FALSE	unmapped	ACGTTGATGTAAAAAGCTGGGGTGAAAAAACATTTTATCACTTTGATGTACCTGATGAGC
5557	63	39	MW2_CDS_10414	MW1967	FALSE	unmapped	ATGATGCATTAGATGCATTTGGTATCCACGGTGTTGGTGGTATTATTGGTGCTGCTTTAA
5558	63	37	MW2_CDS_01228	MW0226	FALSE	unmapped	TCCAGTAATTTTCCGGGCAAAGAGTGGACGGCAACCTTACATTATATGAAGACGAAAGAT
5559	63	35	MW2_CDS_00070	MW0013	FALSE	unmapped	GGAAGAATTCCACCATCAGCGAGCATAGTAAAACCTTTCAAGCAAACATTACATGAAGCG
5560	63	33	MW2_CDS_01602	MW0293	FALSE	unmapped	TTGGGTATTTATTGTATCGTCCAACTGAAAATACAACGTTTGAGCAACGTGCTGCAACGA
5561	63	31	agr_tiling 067_R		FALSE	unmapped	TTACACTTTTTATTGTGCTACCTCTATTAGTATTGCATTTTCATATTAATGAAACACTAA
5562	63	29	MW2_CDS_05558	MW1030	FALSE	unmapped	CCAAAGAGTGAGTGGTATCTTAACATTTATCTTTATTGGTATCCATTTATGGCAAACACG
5563	63	27	MW2_CDS_13770	MW2600	FALSE	unmapped	GCGCAATGAAACGGGATGGATGGTCATTTGCGAGTCATTCATATGGTCACATTAATTTTG
5564	63	25	MW2_CDS_11112	MW2100	FALSE	unmapped	TTGCCTGTAGTGATGAGTATTGGTACTATTGCTACCATTATTGCGAACTACACGCCCTTT
5565	63	23	MW2_CDS_06015	MW1118	FALSE	unmapped	TGCCGCTAAAAACAAAGGTGTTGATATTTTAATCTGTGATACCGCTGGACGTTTACAAAA
5566	63	21	MW2_CDS_07784	MW1467	FALSE	unmapped	CTTAAACAAGATGGTACAACACTAGTTATGATCAATTCTGTATGTGGTTGTGCAGGTGGT
5567	63	19	MW2_CDS_04819	MW0889	FALSE	unmapped	GTGAGCGCCATTAAAAATAATGGCGCTTTAATTGTTAATGATGAACCAGTCACAGTGCGT
5568	63	17	NC_A_095		FALSE	unmapped	CCCTTGATCAAAGAGTGTTAGGCCCAAATTAAAAAGCAAACTTACGAACAACTCAGATGA
5569	63	15	MW2_CDS_06932	MW1294	FALSE	unmapped	TCAACAACACGGTCGCGAAGAACGACAATTAGCTGAAAAAGAATTACAACAATTAGAACA
5570	63	13	MW2_CDS_11206	MW2116	FALSE	unmapped	GGATGACGAAATCTAAACGAAACAAAGCGATTGGACGTGCATCAGTTGTACCAACATTCT
5571	63	11	MW2_CDS_12026	MW2278	FALSE	unmapped	ACAAGACCATATTCAATTTTTAGAGCAGTTTATAAATAACGTTAACGCATTAACTGCAAA
5572	63	9	MW2_CDS_02719	MW0502	FALSE	unmapped	TGATTACTTACCTTCACCACTAGACGTTAAACCAATTATTGGTCACCGTGCTAGCAACCC
5573	63	7	MW2_CDS_02204	MW0407	FALSE	unmapped	TTAGTCGGCTCTACGATGAGTCAAATGGGCTTTATGTTAGTTCAATGTGCATTGGGTGTA
5574	63	5	MW2_CDS_11682	MW2214	FALSE	unmapped	TGGTAATGTCCCAATGCATGATATTAAAAGTGATAACGTTGAAATGTTTGTTGAATATGT
5575	63	3	MW2_CDS_03731	MW0683	FALSE	unmapped	TGCAGGTTTGAGCAATAAAGAAAGAGAAGAAGCGCAGAATGATTTCTTATTTGATCGTGT
5576	63	1	MW2_CDS_05459	MW1012	FALSE	unmapped	GTTAAACCGGTTCAACCAAAACCAGCTCAACCTAAAACACCTACTGAGCAAACTAAACCA
5577	62	164	MW2_CDS_06244	MW1159	FALSE	unmapped	CGCCAATACCTGGTCGCTCTGCAGTAGGTATTGAAGTGCCAAATGAGAAAATTTCATTAG
5578	62	162	MW2_CDS_11163	MW2109	FALSE	unmapped	TGGAGAATCGTTGGTTTCCTAGCGTTTCTATTAATCGCGATATTATTCTTAACGTTAGGT
5579	62	160	MW2_CDS_00167	MW0031	FALSE	unmapped	AAAATCGATGGTAAAGGTTGGCAAAAAGATAAATCTTGGGGTGGTTACAACGTTACAAGA
5580	62	158	MW2_CDS_09351	MW1757	FALSE	unmapped	TATTCTTCAGATAGCTCTTCTCCAGTCTCGGGTAAAGTGGGAGAAGGAGTAACTAGTGGT
5581	62	156	MW2_CDS_04288	MW0789	FALSE	unmapped	ACTTTTATCCTCAGTTTTGTAAAGATATGCAAATCATGTCTACGCCGATTTTATTGTTGA
5582	62	154	MW2_CDS_10513	MW1985	FALSE	unmapped	TGCTGGCGCATTAAGTGTGAGTGCTCTTGAAAACTACAAAGACCACATTAAGGGTAAAAC
5583	62	152	MW2_CDS_03341	MW0614	FALSE	unmapped	AGTTTTATCGCAGCAGTAAAGCTATCAATCGGCGGTTCAATTGATGATGCATTAGCAGAA
5584	62	150	MW2_CDS_00289	MW0056	FALSE	unmapped	ACCAAATTGAAGTCAAAGTCACAGACCCTGGATTCCCTAGTGACATTAAAAGTTGGGTGA
5585	62	148	MW2_CDS_13293	MW2516	FALSE	unmapped	TGAAGAAGAAATTCAAAACCATGCACCTAAAGTAGCAGTAATGAATGAAGACAATGTCAT
5586	62	146	MW2_CDS_08074	MW1520	FALSE	unmapped	CGTAGATGCAGATAAACCGTCATCACCTTGTGGTGCATGTCGTCAAGTTTTAAAGGAATT
5587	62	144	MW2_CDS_03428	MW0629	FALSE	unmapped	ATGATTGGCGAGTGATAGAGAGCGAGACAATTATGAGTAATTTTGAGGATAGTCAAGTTT
5588	62	142	MW2_CDS_11070	MW2093	FALSE	unmapped	GGATATCTCATTTGCTTTTGTAGCTGTGCTTGTTATGGCAGCTTATGTGATAGCACTTTT
5589	62	140	MW2_CDS_06408	MW1190	FALSE	unmapped	TGCCTGGTTACGAAGATGATGTTATTATGGCTGCTGGTACGTTTATTCAAGGTTCATCGA
5590	62	138	MW2_CDS_07072	MW1321	FALSE	unmapped	TATCGCTTTTTTGGTAAACAAGGTTTAATTGCATGGGTTGCAATTGGCACAATCATTGCC
5591	62	136	MW2_CDS_04296	MW0790	FALSE	unmapped	CCGCAACACACTGTGACAAAACGATTTGTGAAAGACGATTTAAATGATGATTTCGAAACA
5592	62	134	MW2_CDS_12130	MW2296	FALSE	unmapped	GATCACCAAGCAGGTGGTAATGCACCATTCCTAATGTTTATGCCAATTTGGATAGGTTCA
5593	62	132	MW2_CDS_04461	MW0824	FALSE	unmapped	TACGAATGGACAAGGTAAAGCGCTATTTGCGGCAAGTTTTGTAACACATTTTAGTGGTCA
5594	62	130	MW2_CDS_09839	MW1846	FALSE	unmapped	GATGCACTCGGCTAAGGGCCTTGAATTTCCAATTGTCTTTATAATGGGGATGGAAGAATC
5595	62	128	MW2_CDS_12330	MW2335	FALSE	unmapped	TATGACGTATGGTCAAACGATACAACGTATCATTTTACCGCAGGCAATTCGAGTGTCGAT
5596	62	126	MW2_CDS_02536	MW0469	FALSE	unmapped	GACTGGATGAACTTGTTGCAACAGAATATCCAGTTTTATTAGCGACAAGCCGGAAACGTT
5597	62	124	MW2_CDS_13652	MW2580	FALSE	unmapped	AGTTGTGTAGATGACCACTTAATTGAAGCGCGTCAGTTCATTGAACGACGTAAAGACAGA
5598	62	122	MW2_CDS_01351	MW0247	FALSE	unmapped	GCTAACCATTGTTGATGACATCATGGTTCAATCTGCCACTGCAATCTTCGCTATTAACGA
5599	62	120	MW2_CDS_09705	MW1822	FALSE	unmapped	TGGTGCCGTAATTGGTGGTGCAATTAGTTTAGCTGATAAATCTACACGTCAAGCTTTAGT
5600	62	118	MW2_CDS_01097	MW0202	FALSE	unmapped	CAGGAAAGCCTAATACACACATCCTTAACTTCGCGCGCAAACTGTCAGATATGAAACAAC
5601	62	116	MW2_CDS_12819	MW2426	FALSE	unmapped	TGGAGAACTCGCGAAATTATGCAATGTGACAACGCGAACGATTCAATATTATGATCGCAA
5602	62	114	agr_tiling 119_F		FALSE	unmapped	TTTATATTTCATTTCTTTAAGAGTAAATTGAGAATAAATAAAAATTAAGATACTCAGTAA
5603	62	112	MW2_CDS_08286	MW1558	FALSE	unmapped	ACCAAAATTGCAACTGTATGCAAATTTGATCTGCCAAAGTTAGCACAGATGAAACCACAA
5604	62	110	NC_A_098		FALSE	unmapped	AGTGAAATTCCCTCCTGACTGATTAACGCTCGAATGTCCATTCAATCTTTATAAAGTAGA
5605	62	108	NA		ignore		
5606	62	106	MW2_CDS_09704	MW1822	FALSE	unmapped	TGCAAAAAATGGTAACCGCACTCGTAAGCCTTCTAAAGTCAGCAAGATTAAAGACGAAGT
5607	62	104	MW2_CDS_04007	MW0731	FALSE	unmapped	TGTGTATCAATGGGAACGTTTCGCACAACAATTTGAACAATTAGGTACGCGAGTTGTCAT
5608	62	102	DCP_22_6		pos		
5609	62	100	MW2_CDS_02412	MW0446	FALSE	unmapped	AAGACTGTATCGATATCTTATTGGAGGAGCATGCTGAAGAGGTAGGCGGGATTATGCATA
5610	62	98	agr_tiling 113_F		FALSE	unmapped	AATTTGCGAATATGCAAATAACAAAGAGAATGTTATTACTATAACAATAGTTATAACAGT
5611	62	96	MW2_CDS_08697	MW1636	FALSE	unmapped	AGGTCTCAAAAAAGTTTGCAAGGGATTTTAGTTGTGATGCATGACATAACAAATCTGAAA
5612	62	94	MW2_CDS_07357	MW1374	FALSE	unmapped	GATGCGATTGAATTTGCGAAGAAGCATAAAGATAAAATTGCTAAACGTGGCGAACAATTT
5613	62	92	MW2_CDS_02979	MW0549	FALSE	unmapped	CTCATCTTCAAACAACTGTACCGCATATTTATGCTGCAGGTGATGTTAAAGGCGGACTTC
5614	62	90	MW2_CDS_07762	MW1464	FALSE	unmapped	TACCTGCAAACTTAATTCAAGCACAACGTGACTACTTCGGTGCTCATACGTACGAAAGAA
5615	62	88	DCP_1_0		pos		
5616	62	86	MW2_CDS_07275	MW1359	FALSE	unmapped	TCGTTGATGTTTGTAGAGGGGAACTTTTCCAATTTCAAGACCAATTTAACAGTCAACAGA
5617	62	84	MW2_CDS_06500	MW1213	FALSE	unmapped	AATGAGTATTTTCGTTTATGATGTAGTAAACGATGAATGGATTTTTAGATTGGATCCGAA
5618	62	82	MW2_CDS_10129	MW1906	FALSE	unmapped	CCTTAATAATTTCTTGCGAAATGGCACACATGCTGGTGGTATTTTGAAAATGAAAGGTGT
5619	62	80	(+)E1A_r60_3		pos		
5620	62	78	MW2_CDS_02512	MW0465	FALSE	unmapped	TGTTGGTTACGGTTTAGATTATCGTGAATTATACCGAAACTTACCATATATCGGTACGTT
5621	62	76	MW2_CDS_04211	MW0771	FALSE	unmapped	TCATTCTTTACTTGTTTCAGTAGACCCCAAAGCATTAGAAATAAGTATATTTGACGCTGT
5622	62	74	MW2_CDS_04751	MW0876	FALSE	unmapped	AGTAAAATTTATCATACATTTTTGCCTGCATTAACTTTAGGATTATTATCTACTGCTGGT
5623	62	72	MW2_CDS_10962	MW2070	FALSE	unmapped	TGTTGCATTCTTTATGTTTAAAGGCGGCGACACTTCACACAATTTAAATATGCGTGGTGC
5624	62	70	MW2_CDS_00883	MW0163	FALSE	unmapped	GTGCATGCACCATTAACTGGTGAAGTAACACCATTATCAGAAGTGCCTGATCAAGTGTTC
5625	62	68	MW2_CDS_04779	MW0881	FALSE	unmapped	AGTTCAATCATTTTCAAAGTATGTTTATTAATCCATTCACTCGAAAACTTCATACGTTCA
5626	62	66	MW2_CDS_10001	MW1876	FALSE	unmapped	GCAATTATTTTATTTATTATTGGTTATTATTTACAAGCAACTAATCATGAAAGCCAAGGT
5627	62	64	(+)eQC-41		pos		
5628	62	62	MW2_CDS_07485	MW1400	FALSE	unmapped	GGGCTGATAGTGCAACACAAGCAGAAGTGTACTTTAAAGCAGTTCGTAGTGGTTACTACA
5629	62	60	agr_tiling 112_R		FALSE	unmapped	CTCTTAATAAAAAATTCCTTACTGTTATAACTATTGTTATAGTAATAACATTCTCTTTGT
5630	62	58	MW2_CDS_11962	MW2267	FALSE	unmapped	GCCTGAAGGGAATCGTGAATTTGTGACTTGGTTAGATAATATAGCGTCGATTGTATCACG
5631	62	56	MW2_CDS_09746	MW1830	FALSE	unmapped	AAGAGGCGGGGACATAAATCAATGTTCTATGCTCTACGAAGTTATATTGGCAGTAGTTGA
5632	62	54	MW2_CDS_11741	MW2226	FALSE	unmapped	TATGCTGAAAAGGAACAATGGACATCACCAGATAAGGCGATTATTGGTGGTGCAAAGTTC
5633	62	52	MW2_CDS_11091	MW2096	FALSE	unmapped	GCTGTCAAAGTTAACCAAAAGTTAAGCTTAATTGTCTATTTAGTGATGGGCTGGGTAGGT
5634	62	50	MW2_CDS_09313	MW1750	FALSE	unmapped	ACCCCAACTATATTTGAAGAACAGCAAAAAATAGGCAAGTTCTTCAGCAAACTCGACCGA
5635	62	48	MW2_CDS_07786	MW1468	FALSE	unmapped	ACTGGTACATTTGGTTCAGTATCATCAATGGGTATTATAAATCATCCACAAGCAGCGATT
5636	62	46	MW2_CDS_13128	MW2485	FALSE	unmapped	ACCTTGATACTCAACGATTAAACAAATTAGAGAGGGAATTTGAGCCGGCAAGCTCAGGAT
5637	62	44	MW2_CDS_06458	MW1205	FALSE	unmapped	TGCAGCTAAATCAGGGGTAGATGTTCATCTAATGATTCCATGTAAGCCAGATCATCCTTT
5638	62	42	MW2_CDS_07460	MW1394	FALSE	unmapped	TCTGATGCAGAGCTCAAAACACATATAAATTCTAGAATATACTATTACAAAGTCACTGAA
5639	62	40	MW2_CDS_07156	MW1337	FALSE	unmapped	ACTGTAAAGCCATATACTGAACATATTGATAGCATGCTCAATGAGATCAAATTACATCGT
5640	62	38	MW2_CDS_04548	MW0840	FALSE	unmapped	CGTTGTTGAAGCTGCTAATGGACCTACAACACCAGAAGCAACACGTATTTTAACTGAACG
5641	62	36	MW2_CDS_12445	MW2356	FALSE	unmapped	GCACTGGGCGTTCAGTTTACTGATGTAAACGGGGACTTATTACAAATGAATGGTGCTAAT
5642	62	34	MW2_CDS_00146	MW0027	FALSE	unmapped	ATCTGAAATATTAAGGGAACGTGGTGTAAACGTTCATCATTCAACGGTCTACCGTTGGGT
5643	62	32	MW2_CDS_05044	MW0933	FALSE	unmapped	TGGTGGTTTAAGTAAATCACACTCAGCAACCGGAATAAGAATTGGTTTTCTATTAGGACC
5644	62	30	MW2_CDS_02887	MW0531	FALSE	unmapped	AAAATCACATATTCCGAAAGATAACTTTGGCCGATTTAAGCCCGTGATCAAAGGTGGGAC
5645	62	28	MW2_CDS_03756	MW0687	FALSE	unmapped	TCCATTTTTAGATCCTCAGCATTTTGTTTTTTGTGGTAGAAAAAACATCGTTAAAGCTGA
5646	62	26	MW2_CDS_10862	MW2051	FALSE	unmapped	TTGAATTTTCAAGAAACGTATTAGGCCTTGAAGGCGCACATTCAGCTGAATTAGACCCAG
5647	62	24	MW2_CDS_00297	MW0057	FALSE	unmapped	GTCATGGTGCTGGAAGCCCTTGTGGTAAAGCATTAGGTGCCATACCTATATCTACAATAG
5648	62	22	MW2_CDS_00871	MW0161	FALSE	unmapped	GAACAGATTTGGACTTACAATTGCGACGTCGAGGAATTGATACGATTGTTCTTGGTGGTG
5649	62	20	MW2_CDS_10119	MW1904	FALSE	unmapped	CGCAACAGCGTTTATTAGGAGCTAAAATCGAAATTTTACCTGATGAAGTACTAGGGCAAA
5650	62	18	MW2_CDS_06928	MW1294	FALSE	unmapped	CATTAATGAGACAGCGTAATGCAGTTGCTGCACAACGAGCTGTCACTGATACAACTAATG
5651	62	16	MW2_CDS_08667	MW1631	FALSE	unmapped	CAAGTACGAGAAGTCTTTGGTGATGAAGCAATTGATGAAAATGGTGAGATGAATCGTCGT
5652	62	14	MW2_CDS_08590	MW1617	FALSE	unmapped	AGAGAGAGAATTTGCAATTAGTTATTCAATTAGTTGATTTAAGACATGATCCAACACAAG
5653	62	12	MW2_CDS_06660	MW1244	FALSE	unmapped	GCACAAGATGATTTTGTGTCTATGATTAAAAATCACTATCCGATTTGCTATAACACAGCA
5654	62	10	MW2_CDS_05454	MW1011	FALSE	unmapped	GCCTAGCAAACCAACACCATCACCTGTTGAAAAAGAATCACAAAAACAAGACAGCCAAAA
5655	62	8	MW2_CDS_10278	MW1940	FALSE	unmapped	TGATGTTCTATATGCAGGTCATAATAGCACATGGGACCCTCAATCAAATTCAATTGCGAA
5656	62	6	MW2_CDS_05647	MW1049	FALSE	unmapped	ACTGACACAAACCGTTATGTTAAAAATCCTAAAAATGCACAAATTGAAGTCATACTCGAA
5657	62	4	MW2_CDS_02409	MW0445	FALSE	unmapped	CGTGAATTACCATTTGGTTCAGATGGCGTATTTACACCTGAAGCATTTGTTGAGCGTACA
5658	62	2	MW2_CDS_01598	MW0292	FALSE	unmapped	GTTAATGGTCGCCGCGCTAGAAAAATCTTCGACTTAGCAAGACAAGGTCAAATTCAAGAA
5659	62	163	MW2_CDS_09614	MW1805	FALSE	unmapped	TCAGCATGAGTTAATAAATCATCCTTATCAAACGGAATATTCGTTTGCCAATGTTATGCA
5660	62	161	MW2_CDS_11447	MW2169	FALSE	unmapped	TCTCATTTCCACAGAGCACCAGGTTCTGTAGGTATGGCTTCAGATGCTTCTAGAGTATTT
5661	62	159	(+)E1A_r60_a22		pos		
5662	62	157	MW2_CDS_01157	MW0212	FALSE	unmapped	ATCAGCCGTTGGTTTACATGGCATTTGGGATACATCTTTAACTGTACTTGGCAGTGATAC
5663	62	155	MW2_CDS_03612	MW0662	FALSE	unmapped	CTTTATTACAGAAGGTGCGATTCCATTTGCAGCTGCCGATCCATTACGTGTTATTCCTTC
5664	62	153	MW2_CDS_04199	MW0768	FALSE	unmapped	ACGCAAAAATATGAAGATCTCGCTAAGGCAACTGCAAAAGTAAGTACACTTAGTCAGTCT
5665	62	151	perR_tiling_035_R		FALSE	unmapped	TATATAATAATTATTATTACTTACTATAAATATAACTGTAGTATTGCGCGCGTGTCAATA
5666	62	149	MW2_CDS_13856	MW2616	FALSE	unmapped	GAAAGCCTGCAACACGCGCGCTAAATTCACAAGGTATATACACATTAGAAGCAGTATCAC
5667	62	147	MW2_CDS_03958	MW0723	FALSE	unmapped	AGGCACATGGTGGACCTGTGTCACGCGCTTTTTTAGAAAAATTACATTTGCCAAATTTTA
5668	62	145	MW2_CDS_09092	MW1705	FALSE	unmapped	TTTGCAATTAGAAACACTTTTGGGTGACATTAACTCAATTTTCAGCGAGATTGAAAGCGA
5669	62	143	MW2_CDS_11399	MW2158	FALSE	unmapped	AAAGAAGGTAAAGTAATTGCTACTCTACCTAAAAAAGACCGTGTCGTTGTGGAAGGTGTT
5670	62	141	MW2_CDS_00310	MW0059	FALSE	unmapped	GCAGAAAAATATGGCATTGATGGCGTCATGATTGGTAGAGGCATTTTCCACAATCCATTC
5671	62	139	MW2_CDS_03764	MW0689	FALSE	unmapped	ACGCTTCTGCACAAGCAATCAATGGTACTTTAGTTAAGTTAATAGAACCACTAGGTCAAA
5672	62	137	MW2_CDS_05728	MW1066	FALSE	unmapped	ATCGAGGGAATGAATTTGACGAACTCATTCCTTATATGGAAAATGTTCGCGCGATGGTTG
5673	62	135	MW2_CDS_01497	MW0275	FALSE	unmapped	AGGACTCGAACCATGGACATCATGTGAATTTGACTTTACAAGAGATGGCAAATTGAATGT
5674	62	133	MW2_CDS_06342	MW1177	FALSE	unmapped	TCGGATCTATTATAAGTTATTTCTTATTAATTACTCTAAAAAAACGTGGTATTCTTCAAA
5675	62	131	MW2_CDS_06127	MW1138	FALSE	unmapped	GCACTACGTAAATTAGAAAGTGCTGGTGTAATTGAATCACGTTCTTTAGGAATGAAAGGT
5676	62	129	MW2_CDS_01229	MW0226	FALSE	unmapped	TGCGCATAAACTAGATATTGCAACATCATTGGGCGCACATCAAACAATCAATTCAAAAGA
5677	62	127	MW2_CDS_02587	MW0478	FALSE	unmapped	TGAGGAAGCAGCCATTGTTAGAGATGAAATTAAAGCACTAAAAGCTGAGAGTGAGGTGCA
5678	62	125	MW2_CDS_01275	MW0234	FALSE	unmapped	AGGCGAACCATACTTTGAAGGCATTGATATCGCTAAGCCAAAAGTGAAAATGACAGCATT
5679	62	123	MW2_CDS_00376	MW0071	FALSE	unmapped	AAATTCTGAAATGGTTATTCAACCTAATAATGAAGATATGGTAGCTAAAGGCATGGTTCT
5680	62	121	MW2_CDS_05908	MW1099	FALSE	unmapped	AACTGCTGCTTTTGGACAATTATTACCTGAATCATTGTTGGCATTACCAAAACTTGGGGC
5681	62	119	MW2_CDS_09598	MW1802	FALSE	unmapped	TGGATAATGTAACTATAACAGCGCATATAACTGGTAATGATTATGAGGCAAAGTATGACT
5682	62	117	MW2_CDS_01310	MW0240	FALSE	unmapped	TCAAGCACAAGGCAGTGGTATTTATGTGAGAAATATTGCAGATGCCAATCGTATCAACGT
5683	62	115	MW2_CDS_10612	MW2003	FALSE	unmapped	ACAGCCGACAATGCCACACAAGCACACTTTAAAATTCAAATTGATAAACCAGATGTCATT
5684	62	113	MW2_CDS_09074	MW1702	FALSE	unmapped	TGCTGCAATGGGCGGCTTTGTCGCAGAATTTAGCTTTAACTATATCTTTTTAGCCAATCT
5685	62	111	MW2_CDS_02052	MW0380	FALSE	unmapped	AGTATCTTTTTCAAACAAGGTACATTGCCAGTATTGGCACTCATATCAATGCTTTGGTAA
5686	62	109	MW2_CDS_12891	MW2439	FALSE	unmapped	ACAAGACCGTCTTTTAGAGTGCCTAACGATGACGCATTAATGTATTATGAACAGCGCTTT
5687	62	107	MW2_CDS_05506	MW1021	FALSE	unmapped	ATTTGCCCTGGTAAAGTGTATCGTCGTGACTCTGATGATGCGACACATAGTCATCAATTT
5688	62	105	MW2_CDS_04608	MW0850	FALSE	unmapped	ATTTCAAAATATGTTGCACTACATCCGGGAGATATTATTGCAACTGGTACACCAGCAGGC
5689	62	103	MW2_CDS_03892	MW0711	FALSE	unmapped	AAAAAGTGGTCGAATTACTGGTGCTCAAGCATGGGTTGGAACATTATTGAAAATGAAGCC
5690	62	101	MW2_CDS_13074	MW2475	FALSE	unmapped	CCATTTGGTGGTTTCAAAATGTCAGGTACGGACGCTAAAACAGGTAGTCCAGACTACTTA
5691	62	99	MW2_CDS_10484	MW1980	FALSE	unmapped	TGGTGTTATTCAACCACCAGCTGATGTTGATGTATTTTTAGTAGCTCCTAAAGGACCGGG
5692	62	97	MW2_CDS_12094	MW2290	FALSE	unmapped	GAAAGACTTTCAAGGTGGCGGAAGAGGTTCACAATTGATAGAATTGGCCGAAAAAATTGC
5693	62	95	MW2_CDS_02582	MW0477	FALSE	unmapped	TGCTTCAGCTGATTGGACCTTCTATTTCTCAACAACAAGCTTATTATATTATTGATGGGC
5694	62	93	ETG10_13482		pos		
5695	62	91	MW2_CDS_00212	MW0040	FALSE	unmapped	TGTCAACGCCTTAAGAGATAAAGGTTTCATATTAGCTGACCGTGGACGCCAAACAACTAA
5696	62	89	MW2_CDS_01525	MW0279	FALSE	unmapped	ACACATATATCCCTAGAGAGTATAATGTCTCTGAAAAAGTATTTTATGATTTGTGGACGG
5697	62	87	MW2_CDS_01867	MW0341	FALSE	unmapped	AGCTACTGACGAATTCCAACGTCTAGCTAAAATCAGTGACGATATCATTCGTTACATGGT
5698	62	85	MW2_CDS_05198	MW0962	FALSE	unmapped	TGGTTACTTGGTCAAATGGCTATTTGGAATTTCTTGTTCTTGCGCCGAGCTTTACCTTTA
5699	62	83	(-)3xSLv1		neg		
5700	62	81	MW2_CDS_10636	MW2007	FALSE	unmapped	TCACTTAAAGCTATCGGTTCTGGACAGTTACTAGGTAAAGGATACAATCACGGTGAAGTT
5701	62	79	MW2_CDS_07595	MW1430	FALSE	unmapped	ACTACAGCGTGGTCGATTGCGGGATTCGCAAGTATCGCAACATTCATATTCTATAAAGAA
5702	62	77	MW2_CDS_02966	MW0546	FALSE	unmapped	TTTAGCAGCAGCTTGTAATCAAGCGCTAGACATGCAGCTGTCAGATAAGGATTTATCGAG
5703	62	75	MW2_CDS_08912	MW1672	FALSE	unmapped	AGAAAAGCAAATGAACTTCGCCTAGCAATTAGATTAGAACACCTACTCTCAAAAGATGAA
5704	62	73	MW2_CDS_12807	MW2424	FALSE	unmapped	GGTCGGTGCTACAAATAATCATATGCCGTTTGAAGAAAATGTCGCTGTTTACCAAGAGCT
5705	62	71	MW2_CDS_08561	MW1613	FALSE	unmapped	ACATTGCTGTGATAGGAAGTAAGACAGCGCAATATTGTGAATCACTTGGCATTCGAGTTG
5706	62	69	MW2_CDS_07593	MW1429	FALSE	unmapped	TGGAGTATCGAAAACACATGCAAAATCCACACTTTCGAGACTTAAGAAAAAAGGAAAGGT
5707	62	67	MW2_CDS_02551	MW0472	FALSE	unmapped	CGCAACTTGTTGAAAAAGCGCAAGGTAATGATGAAGCGCATGAAATGGATGAAGATTACA
5708	62	65	MW2_CDS_13250	MW2508	FALSE	unmapped	TAGAGGGCTATGGGATGCCAACGATATCAAAGTATATGACAAAGTGCGACGTCAAATTGT
5709	62	63	DCP_22_6		pos		
5710	62	61	MW2_CDS_04437	MW0818	FALSE	unmapped	GCCTACTGAAGATACAACGATGTTTGATCAAGTAGCAGAAGTTATTGAACGTCTTCGTCC
5711	62	59	MW2_CDS_01267	MW0233	FALSE	unmapped	AGGTAAGAAAGTCATTCTTTTCGCACCAACATTTAGAGGTAGTGGTCATGGTACAGCACA
5712	62	57	MW2_CDS_06712	MW1254	FALSE	unmapped	CAACTACTTAATGATCCAAAAGAATGCAGCGAACATCGTATGCTAGTTGATTTAGGGCGT
5713	62	55	MW2_CDS_06417	MW1191	FALSE	unmapped	ATCGAATGATGCAATCAGACGAAATATGGCTGTCTTCTCTATGAGTGTAGTAAGTAAGTT
5714	62	53	MW2_CDS_05388	MW0998	FALSE	unmapped	AGCCGTTTCAGCTTTGTCTTTATTAATGGTCTTATGGTTAGTTATCACTGCATGGAAACA
5715	62	51	MW2_CDS_07041	MW1315	FALSE	unmapped	AGTCAGCCAGCCATAGGTGAATTTATATCTGCTTATGAAGAACTAGGAAAAGATGGCTCT
5716	62	49	perR_tiling_014_F		FALSE	unmapped	CAGTTAAATGAAATTGAAAGATTAGCTCAGCATATGACTGACTTTGACGTAACACATCAT
5717	62	47	MW2_CDS_13440	MW2542	FALSE	unmapped	TTTTGTGGTAGTTGGGATGCGTGTACGTCTTAAAATGAATGCAGTCAGTCTTGCAACAAT
5718	62	45	MW2_CDS_05061	MW0936	FALSE	unmapped	AGATTATACATCTTACTTCCCTAAATACGCATACCGTAACGGCGTAGGTCGTCCTGAAGG
5719	62	43	MW2_CDS_06420	MW1192	FALSE	unmapped	TCACAGCTGGTGTACTTAAAAACGCACGTGGATTTACAGCGGTATGTAACCCATTAGTAA
5720	62	41	MW2_CDS_10166	MW1914	FALSE	unmapped	AAGCAAAGTAAAAAAGCGTATGAAAATGTTATTGGATTTAGACAAATGATTAATTTATCA
5721	62	39	MW2_CDS_09085	MW1704	FALSE	unmapped	GAAGCATGCATTGCTTGATTACTTGAGTACTTTAGATCAAAAGCATGCGCAAGTTTTGCA
5722	62	37	MW2_CDS_13257	MW2509	FALSE	unmapped	ACTATTACCAGCGATTACTGAGACATTTGACGGTATCATCTTAGCAAACACAACGCGACA
5723	62	35	MW2_CDS_01177	MW0217	FALSE	unmapped	CACCATATTCTCCAACAACAGTTCGTGTGAAAGCTGGCGAATACAGTGATTGTCATGATG
5724	62	33	MW2_CDS_00564	MW0105	FALSE	unmapped	TGAATGACCCTAACTATTTCGCGATGACACAGATTATTACATTGGTACTTGCTTACAAGT
5725	62	31	MW2_CDS_06255	MW1161	FALSE	unmapped	AGAGCAACCACAAAGCAAAGAAACATTTATAAATGATATACAGAAGGTAAGTCGCGAAGA
5726	62	29	MW2_CDS_12688	MW2400	FALSE	unmapped	TCAGTTTGGTGGTGCTATGATAGAAAGTGAAAGATTAAGTGAGTTACTAAAACCAGCGCA
5727	62	27	MW2_CDS_11795	MW2236	FALSE	unmapped	ACAAGGGATAATCCCGTAGCACAGGCATCAAATATTGTTTTAACTTATGGGAAAACTGAT
5728	62	25	MW2_CDS_09838	MW1846	FALSE	unmapped	TCATGCGACATCAAGAATGTTATTTGGTCGCCCTCAGTCAAATATGCCATCCAGATTTTT
5729	62	23	MW2_CDS_03302	MW0607	FALSE	unmapped	ACACCACACCATCGTGCGGTTATTACAACATTCTTAATTTCATTTGCAAACTTCTCAACG
5730	62	21	MW2_CDS_08375	MW1576	FALSE	unmapped	GAAAGTATTGAATCAGAACCACCTGCGCAAAAACAACTATGGATTCGCATGAGAGATGCA
5731	62	19	MW2_CDS_00404	MW0077	FALSE	unmapped	CACGTTGCCCTGCATGTCAGTCATAGAAAAGATTTGAAGTTCAACTTGTATGTGACGACA
5732	62	17	perR_tiling_036_R		FALSE	unmapped	TTACTATAAATATAACTGTAGTATTGCGCGCGTGTCAATATTTACATGATGATTTCATTT
5733	62	15	MW2_CDS_13261	MW2510	FALSE	unmapped	AAATCGAGCAAGAGCTACGTGAAATGATGAAAACAGGAGAAAATGAAACGAAAAATGACT
5734	62	13	MW2_CDS_00206	MW0039	FALSE	unmapped	AGTATATATGAGCAAGCGCAGAGACTTCGATTGCAAAAACAAACCAAACAGACACCTTCG
5735	62	11	MW2_CDS_02172	MW0400	FALSE	unmapped	AGGTTGTGATAAATCAAGCGATACTTCAGAAAAATCAAAAGGAGATTCAAAAGAAGCACA
5736	62	9	MW2_CDS_02132	MW0393	FALSE	unmapped	ACAATTGCCACTTCTTGAAGAACAACAGAAAATAAGAGGGTTTCTAGAAGTTTTATCTGG
5737	62	7	MW2_CDS_12049	MW2282	FALSE	unmapped	GGGGCTATGATTATGAAGGAGATGAACGAACAGTTGACGTTCATATTAAGCGACTACGCC
5738	62	5	MW2_CDS_09766	MW1834	FALSE	unmapped	CACACGCATATATGGCAATGGCAGCATACTGTGATAAAGAATCGTACGAAGGATTTGCAA
5739	62	3	MW2_CDS_06025	MW1120	FALSE	unmapped	AAGCGTATTGCTAAAGGGTCTGGTCGTTCATTACAAGAAGTCAATCGTTTGATGAAACAA
5740	62	1	MW2_CDS_07102	MW1327	FALSE	unmapped	TCAGGTGTCATTGAACATGGACTGAATATTGCAGATACAAGCAAGGGTGTGGTAGGTTAA
5741	61	164	MW2_CDS_00612	MW0113	FALSE	unmapped	AGGTGGTCATGCACTAGAAAGTGATACTACATTCAGTTCTATCGGTGCAACTATAGCAGA
5742	61	162	MW2_CDS_09829	MW1845	FALSE	unmapped	TAAGCTACATCAAATGACACGCAATGAAGCATCTAAATGGCTTGCATCACAAGGTGCTAA
5743	61	160	MW2_CDS_10831	MW2045	FALSE	unmapped	AATGCAATCAGTACGAACAAACCAGATGCAAAGCTATTTATTTTGTTAGTTGGCGAGCGT
5744	61	158	MW2_CDS_05641	MW1048	FALSE	unmapped	GGACCTGAAAGTTGGGGCAATATCAACCAATTAAGAAATAAAAGCGTTGATATTTTTGGC
5745	61	156	MW2_CDS_03590	MW0658	FALSE	unmapped	TGTTTATTCCAATGATAATTCAACTAGTAAGCAACATGTAAGTATTTCAAATCAAGGCAT
5746	61	154	MW2_CDS_13757	MW2598	FALSE	unmapped	GCAGCGAAACCTGAAACGACCAATTATCGTAAAATCGCAACGAGTTATGTTCATACTGCT
5747	61	152	MW2_CDS_11681	MW2213	FALSE	unmapped	AGTCAACGCAACATTTCAAGTTAAGAAGTTTTTCAGAGATACAAAAAAGAAGTTCAATTT
5748	61	150	MW2_CDS_13748	MW2596	FALSE	unmapped	AATCCACATAACCCTTCAGGCAAGCAATTTGATACGGCATTTTTAACAGCTATTGCAGAT
5749	61	148	MW2_CDS_00264	MW0050	FALSE	unmapped	CGCGAGTATGATTTAACACCTTCCGCGTTAGGGAAATGGATAAAGCAACATCAAAACACA
5750	61	146	MW2_CDS_02016	MW0372	FALSE	unmapped	AACTAACGCAAATGAAATACAGACAAACAATACAAAAACTGCTCACCAAAGTTATGAAAA
5751	61	144	MW2_CDS_06292	MW1168	FALSE	unmapped	AGACTCAGTTGCTGCTTTAACACCTAAAGCTGAAATTGAAGGAGAAATGGGAGACACTCA
5752	61	142	MW2_CDS_08701	MW1637	FALSE	unmapped	AAGTTGTTGTCGCATTTGATGGTGATGAGGCTTTAGAAAAGGTAGAAAGTGAACAGCCAG
5753	61	140	MW2_CDS_11103	MW2098	FALSE	unmapped	TTGTGAGATTGATCTTTGGACATCGAACCTTTACGCATTCAATATTATTTATCGCAATCA
5754	61	138	MW2_CDS_10510	MW1984	FALSE	unmapped	CCCTCTCTTCAACGACAATATCGATACAGACCAAATCATTCCTAAGGTACACTTAAAGCG
5755	61	136	MW2_CDS_07100	MW1326	FALSE	unmapped	GCAATCGCATCTGCGTTATCTATTGTGTTGATAAATTTCCTAGGTTCAAAAGCAGGCGGA
5756	61	134	MW2_CDS_09778	MW1836	FALSE	unmapped	AGAAAATCAGTAGGGACTGAACGCACATTTGCAACAGACGTGAATGATGATGAAGAGATT
5757	61	132	MW2_CDS_09732	MW1827	FALSE	unmapped	TGCGTTATTTAATTACTAAAAAAGAACAACTTAGCAAGTTAATTGACAGTCTAATGCTAA
5758	61	130	MW2_CDS_04088	MW0746	FALSE	unmapped	TCCTCATTCCCAGGAATATTTATACGCAGGCCTTTACGTGATAATAATGGAATTTTCGAA
5759	61	128	MW2_CDS_09439	MW1773	FALSE	unmapped	AGTTTGCGATGATATTGGTGCGAATTATTATCGTCCAAAAATGCCGAATACACATCCATT
5760	61	126	MW2_CDS_08874	MW1666	FALSE	unmapped	AATGTACAATGCACCAAGCTCTATTAAAATTACGTACGGTGGCGACTTAGCCTCTATTGA
5761	61	124	pMW2_091		FALSE	unmapped	TATGATTTTTGGTGGCTTTTCTTTCCTGTTGCCGGATTTTTAGTTTGGGCCATTCATTCG
5762	61	122	psma_tiling_078_R		FALSE	unmapped	CATTATGTACAGAATCTACTATTGTAGGTTTTTATTTTATACATAAGCAATTATGCGAGA
5763	61	120	MW2_CDS_04628	MW0853	FALSE	unmapped	AGAACTTAAAGATGTAGCGAACAATATTACATTCAACAATAATGAAGATGGCATTGGTCG
5764	61	118	RC1		pos		
5765	61	116	(-)3xSLv1		neg		
5766	61	114	MW2_CDS_12559	MW2375	FALSE	unmapped	ACAACAACTCAATATACAAGATTCAAACGCACAACTATGGCTTGCTGAATTTGCATGGCA
5767	61	112	MW2_CDS_00159	MW0030	FALSE	unmapped	AACCTGTATACCCAGGTAATACATTGTACGTTATCGCTGAAATTACAAATAAGAAATCCA
5768	61	110	MW2_CDS_04158	MW0761	FALSE	unmapped	AGGCGATACTATTGTTAGTGACAAATTTGAAGCTAAAATAAAAGAACCGTTTATCATCAA
5769	61	108	MW2_CDS_00989	MW0183	FALSE	unmapped	AGGTGTGGTTGTATTAACAACAAGTAGTTTAAGTTTCCTAGGACTTGGTGTTGCACCTGA
5770	61	106	MW2_CDS_02490	MW0460	FALSE	unmapped	AGCGATGGTGCGGATAACGTTGTGACATGCCCATTATATGAATTGGATCATGATGAAAAT
5771	61	104	MW2_CDS_05621	MW1043	FALSE	unmapped	GATTGGGAAATTAACGTTGTATACTCAGGAGAGCATGAGGTTGTAACAAATGAAAAGAGT
5772	61	102	MW2_CDS_04016	MW0732	FALSE	unmapped	TCAATCAAATCAGCAAGCAAAACCACAAGCACCACAACAAAATAGCCAATCAACAACAAA
5773	61	100	MW2_CDS_06762	MW1263	FALSE	unmapped	ACGGTTTGGATCATATATCAAAAGGAATAGCATACATTGCCTGTGTGTTAATTCCATTCA
5774	61	98	MW2_CDS_12912	MW2443	FALSE	unmapped	TGGATGCATTTCATTTCAGACATGCGACTAAGCAATTCGATCCACAAAAGAAAGTTTCGA
5775	61	96	agr_tiling 202_F		FALSE	unmapped	TTATGGAAACTGTCAATTTCAAATTTAGTATATTTTGTTAAAAATTGCGCCATAGGATTG
5776	61	94	MW2_CDS_08562	MW1613	FALSE	unmapped	CTAACCAAAAAATACTTTTGCCTTCGAGTGAATTGGCGAGACCATTGTTATTAGCAGCGT
5777	61	92	RC4		pos		
5778	61	90	MW2_CDS_09613	MW1805	FALSE	unmapped	ACCGCCTTTTACAGGTTTGTACTTGTAATGATTGGTGTCATAAGTTCATCTCTAGTTAAC
5779	61	88	MW2_CDS_11537	MW2187	FALSE	unmapped	ATCATGAATTATCAACGGATTATTTGGATGTAAGGGATGTAGATGCGCCCTCATATTGGT
5780	61	86	MW2_CDS_09979	MW1872	FALSE	unmapped	AAGAGACGGACATTTTGTTCAAGATGTAAACATGGAGGAAGGTGTTGCATCTGACACAAC
5781	61	84	MW2_CDS_01649	MW0301	FALSE	unmapped	ATTGGTTGTTCAAATTGGATGATGTCGATAAAGAAGCATTCCTAGCATTACCGGAGGCTT
5782	61	82	MW2_CDS_06990	MW1305	FALSE	unmapped	TTGCCGTCAATTAATGGCTTAGAAATTTGTCGCAAAATTAGACAACAACAATCTACACCT
5783	61	80	MW2_CDS_05209	MW0963	FALSE	unmapped	TGGCGCCTTAAATATCTTATCATCTGAAGGAACATTATTGTTATGTACAAACGCAAGTGT
5784	61	78	MW2_CDS_00976	MW0181	FALSE	unmapped	ATTAACTTGGGTATTAGAAAAGGCGAAACATTAGGCATTGTCGGTGAATCAGGGTCAGGG
5785	61	76	MW2_CDS_13215	MW2501	FALSE	unmapped	GGTTCAAGTTCAGGTTCAATCGTTGCGATGCATGTGTTAAAAGATTACCCTGAAGTCGTT
5786	61	74	MW2_CDS_12570	MW2377	FALSE	unmapped	ACTTGCAGCTACACCTAAATTGGCTTCTAAAGGTGCAATACGTGAAAGTATTCGTTTAGC
5787	61	72	MW2_CDS_04166	MW0762	FALSE	unmapped	AGGATCTATTGGAACATTTATTATGGCTTTATTTTATTTTGTATCAGTTTCAGTTCAACT
5788	61	70	MW2_CDS_08966	MW1682	FALSE	unmapped	AAATTACAAAGCTAATAATGTAGCAACTGATGCAAATCATAGCTATACTTCTCGAGTAGA
5789	61	68	MW2_CDS_07255	MW1355	FALSE	unmapped	GCAGGATTTGTAGCAGCAACACTATTAAGAGGTGTCCATTTTATACAAGTTCCTACAACG
5790	61	66	MW2_CDS_11586	MW2196	FALSE	unmapped	CCGCCAACGGTATTAGGTTTTATTCTATTAATCATCTTCTCGCCAAGAGGACCAATCGGT
5791	61	64	RC12		pos		
5792	61	62	MW2_CDS_08927	MW1676	FALSE	unmapped	TCGGCACATGCAGCACCACGTGAAATCGAATTTAAAGATAAATTACCTAAAACACGCTCA
5793	61	60	MW2_CDS_01918	MW0352	FALSE	unmapped	AGCAATGCATCCAACAGGACCAAACACAGTAACTTTTGAACAGCCATATTTATTCACCCT
5794	61	58	MW2_CDS_06407	MW1190	FALSE	unmapped	GCAGGATCATTAATTAAAAACCCTGGCGGTGGTTTAGCTAAGATTGGTGGATACATTGCT
5795	61	56	MW2_CDS_03864	MW0706	FALSE	unmapped	ACTTTTCTCTATCATTTTCAATGCACCCAAACGCCTCTTAGTAGCATGTGGATTTGTGGG
5796	61	54	MW2_CDS_11326	MW2141	FALSE	unmapped	AAATCAAATGCTGGGATACCAAACATCATTCTTAACTTATGAAGGGCTGGTGGATCAACT
5797	61	52	MW2_CDS_04731	MW0873	FALSE	unmapped	TCTCAAGGTATTATCTGCGCCAAGCTTAGACTACGGTTTAATAGGATTCGTATCTCATGA
5798	61	50	MW2_CDS_09629	MW1808	FALSE	unmapped	TGCATGGTATGTGGCAATTTCCTATGTTTGAAAGTGAGCATGCTAGACGTAAAATGACTG
5799	61	48	MW2_CDS_09941	MW1865	FALSE	unmapped	CGTATTTAGCTTAGTTGCTATTACAACATTAGTTGCTGGTGTTGGTGTAGTAGCATTTGC
5800	61	46	MW2_CDS_02703	MW0499	FALSE	unmapped	TGCTGAAGACGTTGAAGTATATTTAATGACTCGCGTGTTAAGCCAAATCAATCAGAAAAA
5801	61	44	pMW2_014		FALSE	unmapped	CAAGGAAAAAAGCCATTAGCTCAAGCCGGTCATTTTAAATTAAGCTTTTACGAAGAGGAT
5802	61	42	MW2_CDS_04359	MW0803	FALSE	unmapped	CGACATCCCAGATTATCCAATACAAAATGAGCTAACAAGTAGCATAAGAAAAGCCGCGGC
5803	61	40	MW2_CDS_03423	MW0628	FALSE	unmapped	TGAAAGAGCGAGACGGTTCGGTTTAATTATTTCACATATTTACGCTGTAGTGATCGGCTT
5804	61	38	MW2_CDS_10230	MW1931	FALSE	unmapped	AGCTCAAAACAAAAAAGTCATCTATTACTACTATGACGAAGAAGGTAATAGACGACCCGT
5805	61	36	MW2_CDS_10808	MW2041	FALSE	unmapped	ACAACAGTTAGAAGATGATGCAACAATCGTAGATATCGGAACGGGTAGTGGTGTACTTGC
5806	61	34	MW2_CDS_09759	MW1833	FALSE	unmapped	AGGTACACGAGCAGAAGAACTTCAATTGCGATTGAAGTTAGCAGAGGTTGAAGTACCAAT
5807	61	32	MW2_CDS_00213	MW0040	FALSE	unmapped	AGTCTCTGAACGCTCATTAGCTGATAAAGCTATTGATGTCATCATTCAATTTGTGGCACA
5808	61	30	MW2_CDS_02314	MW0427	FALSE	unmapped	GCCAGAAGCAATTACATTTACAGAAAATGCATCATGGCCTTTAGCAATGCCGGTGTTTAA
5809	61	28	MW2_CDS_02044	MW0378	FALSE	unmapped	AATATCAATGTGATACAGTTATTTTAAAAGCAAATAGCCCATCATGTGGATCACAAGAGA
5810	61	26	MW2_CDS_02082	MW0385	FALSE	unmapped	TGTAGACACATCACCACCACAATCGCCAACCACAAAACAAGTACCAACAGAAATAAATCC
5811	61	24	MW2_CDS_13127	MW2485	FALSE	unmapped	GCCAGATGATCCGACCATTTATCTAGTAAATACGAATAAAACTGATCACACACAAGCGCC
5812	61	22	perR_tiling_107_F		FALSE	unmapped	AGGTGATTATATGTTGCAAAAAGGAGAACAATTTCCAATATTTAAATTAGAAAATCAAGA
5813	61	20	MW2_CDS_11083	MW2095	FALSE	unmapped	TGGTATTAAATTGCCGGTACTTATAGCATTTGTGTTGATTTTGGCAGGATTAAGTTTTGG
5814	61	18	MW2_CDS_04032	MW0735	FALSE	unmapped	TGGTGTATGTAAAGCAATTGCAAACCTTAAAGATGCAATTACGATTATCGGTGGCGGTGA
5815	61	16	MW2_CDS_00961	MW0177	FALSE	unmapped	TGGGATGCTTGGTTTATTACTTATTAAATATTGATTTAGGTAAAATGATAGTTGCTCAAG
5816	61	14	MW2_CDS_06432	MW1197	FALSE	unmapped	AGGTCAAACAAAGTACTTAACTAAGACAAAAGAATATTGCAAATCAACTTGTATTGATTG
5817	61	12	MW2_CDS_03028	MW0557	FALSE	unmapped	ACCTATTTACTGGTTTCATGTCTTATGGGGCATTTTACTTGTTGGTATTTGAAAATGTGC
5818	61	10	MW2_CDS_12651	MW2393	FALSE	unmapped	CATTAGAGCGAGACGTCTATTAGACGGACAGGCGTCTACCACAGGTTACTTTGACAATAT
5819	61	8	MW2_CDS_11585	MW2195	FALSE	unmapped	TGCACGTGCACTTAGCACGAAACCAGATTTAATTTTATTAGATGAACCTTTTTCTAGTTT
5820	61	6	MW2_CDS_13235	MW2504	FALSE	unmapped	ACAACACATGATGAATCGACACGTTATCCGAATATTTTTATGATTGGTGCAACAGTTGAA
5821	61	4	ETG08_142674		pos		
5822	61	2	MW2_CDS_11932	MW2261	FALSE	unmapped	AGTGAAAACATGAAGCAAGGTCTTCAGTTGACGATTGAGAATGAAGACGTAGCCAAAGAT
5823	61	163	MW2_CDS_02500	MW0462	FALSE	unmapped	GAAAATGCGTGTTGTTCGTAGGCGTATTACAGTATTTGCGGGCGTATTACTTGCGATAAT
5824	61	161	MW2_CDS_05540	MW1027	FALSE	unmapped	ACTGGACCGTCTTGTAAAAGAAGCGGAGCAAGTGCATGATGATTTATCTAAGCAGTATCA
5825	61	159	MW2_CDS_06706	MW1253	FALSE	unmapped	AGTTTCTATTTGTGCCAAAGATGCTTCAGGTCCATATCATAAGCAATTGAAATCGCACCT
5826	61	157	MW2_CDS_11271	MW2129	FALSE	unmapped	GCGTCAGCGACTGTAATGAAATCATTGTTGAGATTGAGTGATGCCATGGATGATTCAACA
5827	61	155	MW2_CDS_08938	MW1678	FALSE	unmapped	TGGTGGATTGCATCACGCTCAACCTGGTCGAGCTAGTGGTTTTTGTATATACAATGATAT
5828	61	153	MW2_CDS_05177	MW0957	FALSE	unmapped	TGTAGGGGTCATGTTGGCATCAAAAGGATATCCTGATGCATATGAAAAAGGGCATAAAGT
5829	61	151	MW2_CDS_06675	MW1247	FALSE	unmapped	AGCTTTCCGTAGAGCACGTAGGTTGAAACGCCCAGTAAGAATGAGAAATATAGTTGCAAT
5830	61	149	MW2_CDS_04853	MW0894	FALSE	unmapped	GGATTACAATCTGCTTTTGGTGGTATCGTTGGCGCAATGATAGAGATTGGTGTTAAACGT
5831	61	147	MW2_CDS_00886	MW0163	FALSE	unmapped	ACCAACGTATCTTTATCGAACAAATTCGTGAAGGCGCACATTTGACAGCTGGTAAATTCA
5832	61	145	MW2_CDS_02173	MW0400	FALSE	unmapped	TGAAAACAAGGAAGAAAATATTTACTTCACAGATAGTGTCTACTTTAATCCAAGCGAGGA
5833	61	143	MW2_CDS_10955	MW2068	FALSE	unmapped	GGTGCTAATGGCGGTGTAGGTTCGTTACTAGTGCAACAATTAGCAAAAGAAAATGTACCA
5834	61	141	MW2_CDS_05868	MW1091	FALSE	unmapped	ACGAATGAAGAAGTTGTCATTCCTTTAAATCCTACAAAATCCCCATCAGCAAATGCTCAA
5835	61	139	MW2_CDS_09804	MW1840	FALSE	unmapped	ACGCCAAGAAGAAGAATTGTTAAATGGTGGAGAAATCGGACAAGAAACACGTCGATTTGA
5836	61	137	MW2_CDS_12011	MW2276	FALSE	unmapped	CAGTTTTTATTTGGTGGTGTTGCATCGCCATTAGTGGGGGTAAAAGGTGAAGATAATCCT
5837	61	135	NC_S_076		FALSE	unmapped	CATATGTGCCGTAGGGTAGCCGAGATTTAGCTAACGACTTTGGTTACGTTCGTGAATTAC
5838	61	133	MW2_CDS_06442	MW1201	FALSE	unmapped	AAAGAAGCTAAATTACAAGAAAAAGCTAAAAACCAGATGAAAGAAATGATTGAAAGTTGT
5839	61	131	MW2_CDS_03749	MW0686	FALSE	unmapped	TGTGACAGAAGAGGACTACCCGGATACACTTGCTTTGCAACAAAAATATGACAATGCTTT
5840	61	129	MW2_CDS_02254	MW0416	FALSE	unmapped	TCCAGCAACGACTGCTTCGATATTGACGTTATTAAAGAATGTCAATCAAACCTTTGGCAT
5841	61	127	psma_tiling_031_F		FALSE	unmapped	TATACCAATAGGGATGGTGGCTTTGCTTTGTGTTGATTTATTGATGTGAGGTGAGTCTTG
5842	61	125	MW2_CDS_11708	MW2219	FALSE	unmapped	TCATATTTCATCCAGTGTGAAAAGCTTGTTAGAACAGGGTGGTATGATGAGTATGACCCA
5843	61	123	MW2_CDS_13835	MW2611	FALSE	unmapped	TGACTACAAAAACGGTATTTGATGTCATTGATATGGGTTTAGGATATTTAGTAAATGTGT
5844	61	121	MW2_CDS_01576	MW0288	FALSE	unmapped	TGTCCACACCATTTATGAATTTGGATCATGTTCAACAATTTGAAAATGCGAGTACAGGTT
5845	61	119	MW2_CDS_10155	MW1912	FALSE	unmapped	TACTTTATAACTTGCAACAAGAAACCGACACATCGTACACATCGGACAGTTCGGACACAT
5846	61	117	MW2_CDS_13002	MW2460	FALSE	unmapped	AATCTTGGTGTGAACAACAAGTTCATCATTTCAAGTTGGTTAGGTACAATGGGTTGCGGT
5847	61	115	MW2_CDS_11653	MW2208	FALSE	unmapped	GAAGACACAATGGCTGCTGTTAAAGACCGTGTACTTCATATGTACCATACTGAAGGTGCT
5848	61	113	psma_tiling_041_F		FALSE	unmapped	TTAAAGATTTACTTGGTAAATTTTTAGGTAACAACTAATCTCAAACATTAACGATCAACA
5849	61	111	MW2_CDS_08096	MW1524	FALSE	unmapped	AGACAAAATCAAAAGCCACCTCAAAAAACATCTACCGATAATGAACCAAAAAAAGGTGGC
5850	61	109	MW2_CDS_04012	MW0732	FALSE	unmapped	ATCAGAAGAAAACTGATGATAATAAACAACCAGCTCAGCCTAAACCACAGCCGCAACAAC
5851	61	107	MW2_CDS_03228	MW0594	FALSE	unmapped	GTAGTAAAACGAAACCTGACGCCGCTATTGGAATTAGTTTTACCGCTTTCTTAGCTTCGG
5852	61	105	MW2_CDS_09007	MW1690	FALSE	unmapped	ATGGGTAACGGCATATGATGATTATCCTATGCAATCGATTCGTGAAAAAGAACGCATGAT
5853	61	103	MW2_CDS_11657	MW2209	FALSE	unmapped	ACGTATTCAAAGAGTCGTTACAGACCATGGCACTGAAATAGGCATTCGTTTAAAACAACC
5854	61	101	MW2_CDS_00670	MW0125	FALSE	unmapped	AGTTTCGAGGTATACGTTCAAACATCATGTTTTCAAAAGCAAATGGTGAAGTAAAGCGCT
5855	61	99	MW2_CDS_11991	MW2272	FALSE	unmapped	AGTCATTACATTGTATTTCAGTTATATTATTAAAGCACTCGCACAAGAAATTGCAGATGC
5856	61	97	MW2_CDS_02955	MW0544	FALSE	unmapped	TTGCGAAAGTGTGGGCAAAGATATATCAGATAATGTTGTGCGTACTTGGATTCATCAACA
5857	61	95	(+)eQC-40		pos		
5858	61	93	MW2_CDS_13347	MW2525	FALSE	unmapped	AGCTGAACATCCTAATGTTGTTCGTGTCGTTGTATTATCAGGTGGTTACAGCAGAGAAAA
5859	61	91	agr_tiling 105_R		FALSE	unmapped	TATTTTTTCATACATTATAACAATTTCACACAGCGTGTTTATAGTTCTACCAATCTTTTT
5860	61	89	MW2_CDS_04278	MW0787	FALSE	unmapped	TCAAGCGCATTTGAAGTCATTAGATGCTGATAATGAGGATATCCCGTTCAGTGGAGCATT
5861	61	87	MW2_CDS_02214	MW0408	FALSE	unmapped	TGATCGTGAGTTTGACCGAACATCAGACTTACCTGTTGGATTTACTGAGCAAGAGCAAAT
5862	61	85	MW2_CDS_10183	MW1920	FALSE	unmapped	ACTCATGGAAGCGAATCATTCAAAGGCAAAAGTGCCTATTGGAAACCAAATTGTAACCGT
5863	61	83	MW2_CDS_10471	MW1977	FALSE	unmapped	AGAAATTAAGAACTTTGATGTCATTCACCCTCTTGATGCACCATATGATGCACAAGGCGG
5864	61	81	MW2_CDS_04207	MW0769	FALSE	unmapped	ACACCTGAAACAAAGCATCCTAAAAAAGGTGTAGAGAAATATGGTCCTGAAGCAAGTGCA
5865	61	79	MW2_CDS_04936	MW0910	FALSE	unmapped	TCATTAAGTTATGAGTATACTCGACGTATAGCAACAACATCCGTTGCACAAATTGTAGCT
5866	61	77	MW2_CDS_00552	MW0103	FALSE	unmapped	AGACAAACTAGAAGAAGTGAGAAAAAGCTATTACCCAATTAAACGTGCGATTGACTTAAT
5867	61	75	RC10		pos		
5868	61	73	MW2_CDS_04995	MW0925	FALSE	unmapped	TATGGCTAACAATATTCGCGACCGTGTCAAAGATAAAGCAAGTGGTCGCAAAACTTTACC
5869	61	71	MW2_CDS_06594	MW1232	FALSE	unmapped	TGAAACACATCAACAGGGAATTACGCGCTGTATTGAAACAATAGCACCGGAAATTGATGA
5870	61	69	MW2_CDS_02765	MW0510	FALSE	unmapped	TCAGTGATGGGTTCAGGATCTTTACAACAAATTATCCAGGCATTTAATGATGTGACGGGA
5871	61	67	MW2_CDS_02880	MW0530	FALSE	unmapped	CAGCACATGTTGAACGCCTTTTAACGCAATCTTCGAGCATTGATGAAGCAATTATCATCG
5872	61	65	MW2_CDS_04218	MW0773	FALSE	unmapped	CAAAAATGATTGGATGAAAGTTTATCGTTGCAGCTATCCTGGTGCAGGTAAAAAAGCGGC
5873	61	63	psma_tiling_011_R		FALSE	unmapped	GGACATGTATATGTCTTAGTCCTTTTTATGTTTGCTTTGATGAAAAATGGCAAAACCATC
5874	61	61	MW2_CDS_02886	MW0531	FALSE	unmapped	AGAAAATATTGAAGTCATTGAAATTAACGAAGCGTTCAGTGCACAGGTAGTTGCCTGCCA
5875	61	59	MW2_CDS_06271	MW1164	FALSE	unmapped	TGAGCAAGATGCAAAAGATAAGAAAACCTTTCGATTTGAGCGTGAAGATTTAGGCTTGTT
5876	61	57	MW2_CDS_09474	MW1779	FALSE	unmapped	ATGAAAGCATCACGCATTCTATTCGGTATCGGTGTTGGCGTAGCAGCTGGTTTTGTAGTT
5877	61	55	MW2_CDS_11666	MW2210	FALSE	unmapped	ACACATAGATAAACTGATGTTTGTTCAAAACTTACCTAAAGAAACACGTGTTGGTGCAAA
5878	61	53	MW2_CDS_06860	MW1281	FALSE	unmapped	AATTTCATTAATTGGCTCAGGCATGCGTGATATGTCAGGTGTGGCATCAAAAGCATTTTT
5879	61	51	MW2_CDS_08172	MW1538	FALSE	unmapped	GCAATTTTGGTTAAAAATGCATATATATTTACAGGTGAAAAAGCGCCAAAAGATATGGCT
5880	61	49	MW2_CDS_07642	MW1443	FALSE	unmapped	TCACATTATGATGATATGTTTATTTCAAGAAAAGCTTTAACGCCAGTGTTCTCAAGCGTT
5881	61	47	MW2_CDS_03610	MW0661	FALSE	unmapped	AGGACAAGAAACAGAAATCAATGCACCGGGTCCTCATATAACGTCAACACAATTTGAACA
5882	61	45	MW2_CDS_10020	MW1881	FALSE	unmapped	TGATGGTGAAAAAAACAAAATCCAATTCACTAAAAAAAGTTGCAACACTTGCATTAGCAA
5883	61	43	MW2_CDS_02867	MW0527	FALSE	unmapped	TGCGGGTATAACTGAAGCCATTACAAGTTTGTATAACCAAGGGAAAAAACTTTTCGTGGT
5884	61	41	MW2_CDS_08153	MW1534	FALSE	unmapped	ACTGAGTTTAATCAGAATTTACAAGATGATATTGTCTCTTTTGTTCAATCAGAGCAGGAA
5885	61	39	MW2_CDS_04089	MW0746	FALSE	unmapped	GAACAAACCGGAATTTCTAGAAATTCCATAAGCTCATTATTAAATGGTAAGACTAGAGGT
5886	61	37	MW2_CDS_02128	MW0392	FALSE	unmapped	ATATGGAAATTGATATGTTAGGTGATGCATATGAATTCCTAATTGGGCGCTTTGCGGCGA
5887	61	35	MW2_CDS_12252	MW2319	FALSE	unmapped	AAGTTTTCCAACAATTTGGAGAGAGCTTACCAGTATATAAACCGACATTGCCGCCAATGG
5888	61	33	MW2_CDS_08749	MW1645	FALSE	unmapped	CGCGTATGGTGTAAGAAATATGGTTATGTGTGACTCAAGAGGCGCAATTTTTGAAGGACG
5889	61	31	agr_tiling 142_R		FALSE	unmapped	GTGAAATTGATGATCCTATCATTCGAGTTGCATTTATTGAAAGCGAAAATTCAGTAACGT
5890	61	29	MW2_CDS_06601	MW1233	FALSE	unmapped	TCAGATAATCGATACCAACTAATTAGGCGAGAAGCGGTTTCTCATGGTCTTAGTGGCCTA
5891	61	27	MW2_CDS_03169	MW0582	FALSE	unmapped	CCTGTAAAACTGCAATTACCACAATTAAACAACGTAGTGACCGAGCAAGTTGCACGTGAT
5892	61	25	MW2_CDS_09773	MW1835	FALSE	unmapped	GTTCATGGCATACAACCAGAAGATGTTGAAAATGCACCTACGTTTGACTACGTATTTCCA
5893	61	23	MW2_CDS_06469	MW1207	FALSE	unmapped	AGTAGTGAAAACTATGCTGCAATTTGCAATAGCGATATTAGTTATTTTTATGGTTGGACA
5894	61	21	MW2_CDS_06099	MW1134	FALSE	unmapped	TCACAACCAAACATACAGTTTGCGGGACAAATGACTGGTGTTGAAGGTTATGTAGAAAGC
5895	61	19	MW2_CDS_10067	MW1893	FALSE	unmapped	ACTTACAGTGATAGCGGTATGAATGGCATAACAATCAATTCTTATGGCGGTGTAGTCGCT
5896	61	17	MW2_CDS_11169	MW2110	FALSE	unmapped	TGACTTTTTCGTACCAAATAATGTTCAAGTTCAATCTTTAACTGAAGCAATTCGTTCGGA
5897	61	15	MW2_CDS_02645	MW0488	FALSE	unmapped	AACAGCTGATAGTTTCATAGAACGTTATGTTTATGAACTTTATGACAAGCATACTAAGCA
5898	61	13	(+)E1A_r60_a107		pos		
5899	61	11	NC_S_008		FALSE	unmapped	GTTAACCATTACAAAAATTGTATAGAGTAGCGACTGTATAATTTCTATTGAGGTTAACGT
5900	61	9	ETG09_48764		pos		
5901	61	7	MW2_CDS_01495	MW0274	FALSE	unmapped	TGATGATTTATGGATGGATTTATATGATTTGTTTGAGGAATTAAGAAATTTATTTAAAGA
5902	61	5	NC_A_091		FALSE	unmapped	TTAAGTGTTCTTTTCATGAAAAAAGCTCTCCATCATCTAGGAGAGCTAAACTAGTAGTGA
5903	61	3	MW2_CDS_07325	MW1368	FALSE	unmapped	TTTAACAATCGCGACAGGCTATTATGGTCAGCATAATACATTAGAGGTTGAAGGTGCGGA
5904	61	1	MW2_CDS_12788	MW2420	FALSE	unmapped	AATTCAAAACATCACGCTGATGTTGTTGAATATGAAGAGGATACAAACCCAGGTGGTGGC
5905	60	164	MW2_CDS_13231	MW2504	FALSE	unmapped	GAAAGTGGCTTTGATGCTGCATATCAACTTGCAAAAAATGGCTCTGACATCGCACTTTAT
5906	60	162	MW2_CDS_04080	MW0744	FALSE	unmapped	GAGGAAATAATAGATATTAATCCAAAGTTATGCTTAGAAATAAATAAAGATAATAAAACA
5907	60	160	perR_tiling_060_R		FALSE	unmapped	CAAACTCATCTTTGTTCTGACCTGACTTGCTCAGACCAATTAAATTCATATTAAAAGCCT
5908	60	158	MW2_CDS_08631	MW1625	FALSE	unmapped	AGCAACGTCTCCATTCACATTAGTGTTTAAAAATGCTGGATTTGCGTTTGCAGCATCATT
5909	60	156	MW2_CDS_09615	MW1805	FALSE	unmapped	TTAAAACAACGTGTCGAAAAGTTAGAGAAAATTTATGATTACTATAGCGAAGAACGTCCT
5910	60	154	MW2_CDS_00784	MW0146	FALSE	unmapped	AGATTAACGCACAGCTTAAATTAGTTGATTTAGAAGGCAGGGGAAAGCATTTTCCCGAGC
5911	60	152	MW2_CDS_07354	MW1373	FALSE	unmapped	AGGTATCGTTATTTCTATTGTATTTATTTTACTATATAGAAGGCTTGCGAATTTCTTGAA
5912	60	150	MW2_CDS_07952	MW1498	FALSE	unmapped	ACACCAATGAATACTCTAATTGAAGGTGAATTAAGCGATGTATTAGAAGTTGTGCAAGTG
5913	60	148	MW2_CDS_07154	MW1337	FALSE	unmapped	AGTGTTCAATATGATTTACAAAATATATTAGATGGCGTAACAAAAGAGGGTACTGATGGT
5914	60	146	MW2_CDS_06328	MW1175	FALSE	unmapped	AAGCTAAACAGTATTCATTAAATGGCAGTTTTGTAAAGGAAGTAGAGCCGGAAATGGTGA
5915	60	144	MW2_CDS_07646	MW1443	FALSE	unmapped	TTAGATATGGATGGGCGAATTCCAATAAATGTTTGGACAGGAGATTCGATTGCACGTTCC
5916	60	142	MW2_CDS_02937	MW0541	FALSE	unmapped	TCGCGTCAAATTACAAACAATGAAATTTCTTTAGCCGAAGCAAAAACGCAACTTGAAAAA
5917	60	140	perR_tiling_080_R		FALSE	unmapped	ATCTAAATCAGCCAAGTCGCTCTCAGGTATTTCTGATGCTTTTTTATAAAATTTAAAATC
5918	60	138	MW2_CDS_02996	MW0551	FALSE	unmapped	AGCAAGGCGGTATAAATGCAAGTAAATTCGGTGTATTTATCAATACAGCAGGTGGAGTGA
5919	60	136	MW2_CDS_09871	MW1852	FALSE	unmapped	ACGCATTTGGTTTTTCAATAGGTATCATTGTTGGTATGAAAATAGAAGAAAAACTGGCAT
5920	60	134	MW2_CDS_08579	MW1616	FALSE	unmapped	GCGAAGCAACAAAAAGAAAGCAAGGTCAAGGAAATTTCAGCGCGACGTATCTTTAGTTTT
5921	60	132	MW2_CDS_12162	MW2301	FALSE	unmapped	GTCGATGGCTTTTTAGAAACTTATTCAACCGTGGAACAAGTTTATGATGTCATGCAGCGT
5922	60	130	MW2_CDS_06968	MW1302	FALSE	unmapped	TGGATCAATGATGAGTACGCCAATTATCAATGGTAATCAAGCTGCAATCTTAGGCATGCA
5923	60	128	MW2_CDS_12259	MW2320	FALSE	unmapped	ATTACCCGATAGCGATTGTCTTTCAAGCATCGTGTTTTAACGAGTTTGTTGTTAAGGGGC
5924	60	126	MW2_CDS_08699	MW1636	FALSE	unmapped	TCGAAATGGAAAAATCGTTGTTGCAAATAAAGCGTATTATGAACAGTTCAACATCTCGCA
5925	60	124	MW2_CDS_02085	MW0385	FALSE	unmapped	TGCTTTAGTTGGTAAAGATGATAAAAAATATGGTGAAGGAGTACATAGGAATGTCGATGT
5926	60	122	MW2_CDS_03666	MW0672	FALSE	unmapped	GGGTGAAGGTCGAGTAATCGGTAGAAAAACGATGTTTGTGAGAACAGCTGGATGTGATTA
5927	60	120	MW2_CDS_10646	MW2010	FALSE	unmapped	ACGAATCTTAAATCACGTTTAAATCGAATTGAAGGACAAGTGAGAGCGATTAATCGCATG
5928	60	118	(+)E1A_r60_n11		pos		
5929	60	116	MW2_CDS_08355	MW1571	FALSE	unmapped	AGCCTTTTTAGATCATGCGATGAATTTAGGTGCAGATTATGTAGCAACAGGGCATTACGC
5930	60	114	MW2_CDS_02972	MW0547	FALSE	unmapped	ACAAAGTTTAAGTTCATGCGGAGATATTGCTGTGAGTGTATATAGTGGATGGTTAGCGTA
5931	60	112	(+)E1A_r60_n9		pos		
5932	60	110	MW2_CDS_02219	MW0410	FALSE	unmapped	CTTTTCAGATGTCATTGGCGGCACGTCACTAGCAATCATTTGGGTAGCGTTATTCTTAAT
5933	60	108	MW2_CDS_07463	MW1395	FALSE	unmapped	AGGCTTTAAAGAAAGAGTTCGAGAGCTTTAAAGATACGGGTGCCAGTATAGAAGAAATGA
5934	60	106	MW2_CDS_05395	MW0999	FALSE	unmapped	TCAGGCGTACTTGGTCTTATGGGGATTGTAGGTTATGTGTCTTATTACTCAATATGGTCT
5935	60	104	MW2_CDS_02700	MW0498	FALSE	unmapped	CAAAAGAGGCACAAGCTGAAGCAAGAATGTTGATGTTAGCAGCACAAAACATCTTGAACC
5936	60	102	MW2_CDS_11904	MW2256	FALSE	unmapped	GGTGCTGATGAAGTAGATCCATCTTTAAATATAATTAAAGGTGGCGGTGGTGCGCTGTTC
5937	60	100	(+)E1A_r60_a107		pos		
5938	60	98	MW2_CDS_06889	MW1285	FALSE	unmapped	CTTTTGTGAAGCGGATGATTGGAAACCTTTTTACGAAGCATATGGTAGTCAATTCGAAGA
5939	60	96	MW2_CDS_10069	MW1893	FALSE	unmapped	ATTCTATTGAACTAGGTGGTATTGTGCAACGTACTTGGAGAGGGAAACGTTCAACAGACG
5940	60	94	MW2_CDS_00937	MW0172	FALSE	unmapped	ACACATGATCGTAAAGTAGCAGAAAAAGCTGATCGAATAATTCATATTTTGGATGGTCGT
5941	60	92	MW2_CDS_12350	MW2339	FALSE	unmapped	ATGGATTCCTGTATATAAAAGCTGGCGTTTAAATGAACGCCACTATGGTGGATTGCAAGG
5942	60	90	MW2_CDS_09687	MW1818	FALSE	unmapped	TCGTTCAAATTAGAATTGACGATGTATTTAATAACAAGCATGATTTAGCTGCATTAAGTT
5943	60	88	MW2_CDS_08265	MW1554	FALSE	unmapped	ACCTTTGCAGGTGCACATCGTATATTAGACTCTGGCATTAAAGGTAAGCAATATTTACCA
5944	60	86	MW2_CDS_00211	MW0040	FALSE	unmapped	TGATAACAAAGCTGCGAAAGAACTTTTTAAATCCGCTAATGAAGGGATAGGCCCTTCAGG
5945	60	84	MW2_CDS_10810	MW2041	FALSE	unmapped	TGGCTCGTAATAATGCTGAGAAGCATCAATCACAAATACAATTTTTAACAGGGGATGCAT
5946	60	82	MW2_CDS_06030	MW1122	FALSE	unmapped	AAACACCAATAGGTCGTGTAATTAATATATTTGAAACAGGTGCGAATGATGTGTGGGTGA
5947	60	80	MW2_CDS_09879	MW1853	FALSE	unmapped	ATACGAAATGCACACAAACGTGAACTTGCATATACAAGATACACGTGGCCAAAATCCTAA
5948	60	78	MW2_CDS_01072	MW0197	FALSE	unmapped	AGTGTCATGATGGTTAACATTTCATTGTTTGCATTAGGTGCGTTAATCTTTGGTCCGCAA
5949	60	76	MW2_CDS_11177	MW2112	FALSE	unmapped	GGTGTCAGAAGCTATAGTTGCAAAAGCACCACACAACATAAGTGCTAATGAAGCGGTTAG
5950	60	74	MW2_CDS_00669	MW0125	FALSE	unmapped	AGCACTTATGGAAAAAGCAGGCAGTAACATTCTAGGTGTCATTTTGAACAAGACAAAGGT
5951	60	72	NC_A_003		FALSE	unmapped	TGGTAACCATCACAGCTTAATTTAACTCATGCCTAATCTTACTTAGTAACACGTTGGTGT
5952	60	70	(+)E1A_r60_n11		pos		
5953	60	68	MW2_CDS_02178	MW0401	FALSE	unmapped	AGAGGAACAAACGAATAAAACAGATTCAAAAGAAGAACAAATCAAAAAGAGTTTTGCGAA
5954	60	66	MW2_CDS_03785	MW0692	FALSE	unmapped	TGAACCGTTTATTATCGTTACTGGCACTATTGGATTTGGAGAAGTACCAGAACCCGTTCA
5955	60	64	MW2_CDS_07819	MW1473	FALSE	unmapped	AATGTCACTCAAGCAACTGTTTCTCGTGATATTAAAGAACTACAACTTATTAAAGTACCT
5956	60	62	MW2_CDS_13790	MW2603	FALSE	unmapped	AAAGATACGGGTAGAGAATGTGCTCAAAATATGCGGACTTTATGCATTTCGGAATTGGCC
5957	60	60	MW2_CDS_12296	MW2327	FALSE	unmapped	CAAGTCATAAACATGGGTGTTGAACAAGGTATGAATCAAACTTTAGATCAACTTGATGCA
5958	60	58	MW2_CDS_02436	MW0450	FALSE	unmapped	GCGTTACGACGTACATACGAAAATGTGTTATGAGGCCTTAGAAAATCGAGATTATCAACA
5959	60	56	MW2_CDS_11401	MW2159	FALSE	unmapped	ATCAAATTTGATGAAAATGCATGTGTTATCATCCGTGATGACAAAGGCCCACGTGGTACT
5960	60	54	MW2_CDS_12607	MW2385	FALSE	unmapped	AAGCTTGTTACAAGCGCATTTTCGTTCAGTCAACTACTGCCAATATAACTTTGTAGAGCA
5961	60	52	MW2_CDS_06870	MW1282	FALSE	unmapped	TCAGGGATGAAAGGTAAGAAAGATTTAGCTGAAGGTGTAAATGGTAAAGCACCAGAAGCA
5962	60	50	MW2_CDS_00618	MW0114	FALSE	unmapped	GGCCAGTGGTGCGAATAAGATTAAAACACTCGTATTTGCAGTCATACCACAAATTATGCC
5963	60	48	MW2_CDS_06554	MW1223	FALSE	unmapped	AGCAAAAGAGAGAAAAAGAGAAGAGTTAGTAAATAAATATTACGAATTACGTAAAGAGTT
5964	60	46	MW2_CDS_00399	MW0076	FALSE	unmapped	AGCTAAAGGTGATTGGGTTAATAAAGCCATGCAAGACTTAGATAAATTAGGCAATGAGCT
5965	60	44	MW2_CDS_12204	MW2310	FALSE	unmapped	CTCATTTCAAGTTTCTAACTATCATTTCACAGTATTACTTGGAGATAGCCAAAAACCACT
5966	60	42	MW2_CDS_05512	MW1022	FALSE	unmapped	GACAGATGAGCGCGTTTCAAAAGTACAAGCGGAAATTGAAGCAGCATTAATTGAACAAGG
5967	60	40	MW2_CDS_11098	MW2097	FALSE	unmapped	ACTTATGGAACTAGTTTTGTCACGTTACAAGTTCCTAGAGAAGAAGAATTTTCACCTCTT
5968	60	38	MW2_CDS_06029	MW1122	FALSE	unmapped	GTTCGTTTTCAACCCGGTCAAGTGCTGACAGTTGTGCATAACAATAACGACCTTGAATAT
5969	60	36	MW2_CDS_11533	MW2186	FALSE	unmapped	TGATAGAGCAGCACTTTGAAATCGATCCTGTAGAACCAAAATATTTTGGGGAAGTAGCAA
5970	60	34	MW2_CDS_05747	MW1069	FALSE	unmapped	TATTGCAACTGGTTTTGATGACAAACCAACATCACATGGTCGTAAATCTGGTAGCACTGG
5971	60	32	MW2_CDS_00889	MW0164	FALSE	unmapped	CAACGACGCATTGGTTCAGTAACCGTTGATAATTTGAATAACGGACGTTATCAAGGCGAA
5972	60	30	MW2_CDS_09375	MW1761	FALSE	unmapped	CAAGGTAATGGCGAAGTGAAAGATGTTCCTGCATCTATGGACAATGTCGTTACAGTAGGA
5973	60	28	MW2_CDS_11679	MW2213	FALSE	unmapped	AAGAAGTTTACAAGACGAAAGAACAGTTATTGTTTATGTTACAGATACACAAAAAGCAAA
5974	60	26	MW2_CDS_05378	MW0996	FALSE	unmapped	CGGAGGATTGCTAGTTATTACTTTAGAGTTCTTTATTGTATATCGTGCCTTCCAGTTTGC
5975	60	24	MW2_CDS_12797	MW2421	FALSE	unmapped	TAGAAAGTGGTTCTATTGAGGCACCTCAAGGAAATAAAGTAGAGCCACATGCTGGTCAAC
5976	60	22	(+)E1A_r60_1		pos		
5977	60	20	MW2_CDS_04997	MW0925	FALSE	unmapped	GCCCAGAGCTTGTGCTACGATTAGCCATTGCATTTTACATCTTAGCAGCAATATTAGGTT
5978	60	18	MW2_CDS_02605	MW0481	FALSE	unmapped	ATGTTCCAGGTTCAACAATTGTTGCAACCATGGAGGGAACCAGACCACTTTTAATAGAAG
5979	60	16	MW2_CDS_09904	MW1858	FALSE	unmapped	GGTAAAAATGCAGCAGATGTGATGACAGGAAAAGACTTAGGTTCCCAAGCAGGCATAAAT
5980	60	14	MW2_CDS_08164	MW1536	FALSE	unmapped	CGGTGATAAAGTGGATGCGCTAAGCTTCATAGTTCATAGAGATTTTGCATATGAACGTGG
5981	60	12	MW2_CDS_06703	MW1253	FALSE	unmapped	AAGAATATATTGCATTAGATATGGGCGCGTTGGGAGACGGTCAAGCATCGGATGAATATA
5982	60	10	MW2_CDS_05939	MW1104	FALSE	unmapped	GAGTGCTGTCGAGCCAAATTTTTCAACGCAATTATTAGATCGATTTTTAGTTATTGCACA
5983	60	8	MW2_CDS_11377	MW2153	FALSE	unmapped	AAGACATGCTCGTGTTCGTACTAACTTATCAGGTACAGCTGAAAAGCCACGTTTAAACGT
5984	60	6	MW2_CDS_12983	MW2457	FALSE	unmapped	TGGAAAAGAAATGCATCGTCAAGGGCGTTTTATCGATATGCAACGTTTTGAACATCATCT
5985	60	4	MW2_CDS_02952	MW0544	FALSE	unmapped	CGCTGATGTTCAAAGGACAAACAGAAACAACGATTGATGAAGCGTTTACTGTGATGTACC
5986	60	2	MW2_CDS_04251	MW0781	FALSE	unmapped	TGCTCATCCAGAAGTAACACTAACAGTGAGACTAGAAGATGATTCAGACTCAGAAAGTCC
5987	60	163	MW2_CDS_13936	MW2631	FALSE	unmapped	ACAAGATTAAAAGAGCAATACGTGAAAATTTCAAAGTACATAAGTCGCATATATTGGCCA
5988	60	161	agr_tiling 123_R		FALSE	unmapped	AACCTATTATGAATACACATTAAAGATTGAAGCAATTAATAATGAAATGCGCAAGTTCCG
5989	60	159	MW2_CDS_07166	MW1340	FALSE	unmapped	GATAACAACACTACAAATCGTAGTACACACGGTGGTAGTGACACATCAGCAAACAGCAGT
5990	60	157	MW2_CDS_08338	MW1568	FALSE	unmapped	AGTGTCTGCTGAAGTGAACCAAAATGATCGACGTGACATTCAAAAGAACCATAGTGCAAC
5991	60	155	MW2_CDS_13233	MW2504	FALSE	unmapped	GCTATATCTATAAATTCAGAGCGCGATTTGCAGTACTTGCCCATCTTTTAACACAGCGGG
5992	60	153	MW2_CDS_06165	MW1145	FALSE	unmapped	CGGATTCCAACCAGCGAGTGAACGTACGCTCTTCAAACCAATTGTATATGGATTTGAAAG
5993	60	151	MW2_CDS_04161	MW0761	FALSE	unmapped	AAGAGGTGATGGAAATATTAATTTAAATGTCCATAAATACTCAGAAGATAAAACAGTTGA
5994	60	149	MW2_CDS_09441	MW1774	FALSE	unmapped	AAACACATCTTTAATTTAGGACACGGTGTATTCCCAGAAGTGCAACCAGAGACGTTACGT
5995	60	147	MW2_CDS_06450	MW1203	FALSE	unmapped	AGCAATATCAGCTTCCATTATTTATGGATGGTGCACGATTAGGGTATGGATTGATGAGTG
5996	60	145	MW2_CDS_05690	MW1059	FALSE	unmapped	ATGAGTGAAATCAAACGTCTTGAAATTAATTACAAAACTGACGAATTATTCGAAAACTTT
5997	60	143	agr_tiling 135_F		FALSE	unmapped	TCATCTGGTATTTCTATACTAATCGGTATATTCATTTCTTGTGCACGTAAAATTTTAGCT
5998	60	141	MW2_CDS_03880	MW0709	FALSE	unmapped	AGGTGATAGTGGGGCTTTAATGATTGGATTTATCATCGGATTCCTTTCTTTACTCGGATT
5999	60	139	MW2_CDS_07881	MW1485	FALSE	unmapped	TGATATTGATAAGGTTAAAGAGAAAGGTTTTGGTCTCGTAAGGCGTCAAACTGGTGGCCG
6000	60	137	MW2_CDS_09869	MW1852	FALSE	unmapped	GTATGAACCTCGAAACATACATGGTGGATTCTGGACTAAAGGCATTCGTCGTAGAAAGCT
6001	60	135	MW2_CDS_09931	MW1862	FALSE	unmapped	AATCAAACTCCAGATGGTAAGTACGTTGCAGTAACAGATTTAGGTGCTGATCGTATCGTT
6002	60	133	MW2_CDS_10329	MW1949	FALSE	unmapped	GCGTGGAGAATATAAAGAAAATCCACAAAGTGGCAAAGTACAATTAGTCTATAATGAACA
6003	60	131	MW2_CDS_02602	MW0480	FALSE	unmapped	CGCGGCTTTAGAACGTCGTTTCCAACCTGTACAAGTTGATGAACCTTCAGTAGTAGATAC
6004	60	129	MW2_CDS_07662	MW1446	FALSE	unmapped	GAACGCAATCTACAACTGTAGAACAAAGCGAACCTCACGCACGTGATGTGATTGAATTTA
6005	60	127	agr_tiling 016_R		FALSE	unmapped	ATGAGGATTAACTCTTCCCTTCTTTATTACAATAAAAAGGCCGCGAGCTTGGGAGGGGCT
6006	60	125	MW2_CDS_07109	MW1328	FALSE	unmapped	AGCTTACTACTCTGAAGCACAACATGGTGGTCAAGGTACTTTAGTGACTGGTGTACATGA
6007	60	123	MW2_CDS_04029	MW0734	FALSE	unmapped	GCTTCAAACGAATCATTCGGTTACACTGAAGACGAAATCGTTTCTTCAGACGTTGTAGGT
6008	60	121	MW2_CDS_12550	MW2374	FALSE	unmapped	GTGTCATTTGTCGCCGTTACAGGTCGAGTTTTACGAGCAATGGAGAAAAATGGACATATC
6009	60	119	MW2_CDS_03848	MW0704	FALSE	unmapped	GCGTATTGCAGAACTTTGTCATAAACATCAAAAGGTTGCCATTGCAATTTGTGCAACTGC
6010	60	117	MW2_CDS_04846	MW0893	FALSE	unmapped	ATGTTAAAAGACCATGAAAAATTTATCCCAGCTGTTGCTAAATTTTTCAAAGGTGAACGT
6011	60	115	MW2_CDS_13449	MW2544	FALSE	unmapped	ATAAGGGCTATTCAGGTTATAATGGCCAGCGTCAAAGTAACTCAAGTGGGATTGGCTTAT
6012	60	113	MW2_CDS_01202	MW0221	FALSE	unmapped	AATTTGCTACTGGTTTACCAACACATCTATGTTCGGTCGCTATACCGCATACAGATGTCG
6013	60	111	MW2_CDS_03901	MW0713	FALSE	unmapped	AATTCCTTCTTCGCCGGCACATGATTTATCTAGAACATTTAACCCGGTAGAAGCAGTACT
6014	60	109	ETG05_66023		pos		
6015	60	107	MW2_CDS_03793	MW0694	FALSE	unmapped	CAAACTTTGGGGTAAAGAAGCTTCGATATACGACCAATATATGGCCAGAGTTACGAGTGT
6016	60	105	MW2_CDS_09297	MW1745	FALSE	unmapped	AGAACATGCCGTCATAAATATTTTTAATTCTAATAGAAAAGTCTTTGGTACAAGACGAAT
6017	60	103	MW2_CDS_05272	MW0976	FALSE	unmapped	AGACGAAGATGCTGAATGGGAGAAAAAAGACCCATTAGTACGTTTCCGTAAATTCCTTGA
6018	60	101	MW2_CDS_13301	MW2517	FALSE	unmapped	TGGTTTGGCGAAAAGTTCAAGAAATGTTTATTTAACAGAGCAAGAACGACAAGAAGCGGT
6019	60	99	MW2_CDS_00465	MW0088	FALSE	unmapped	TCAGATCCAAATGCGAAAGATGCTGCATTAGTTAAAAAGACTGAAAGCGAATGGACTTCA
6020	60	97	MW2_CDS_04477	MW0827	FALSE	unmapped	GCCGTAAAGCTGCCGAACGCATTGAACAAGCATTTCTAAAATTACAACAATATAGCGCAT
6021	60	95	MW2_CDS_00193	MW0036	FALSE	unmapped	TCCACTAGACCTTCAAATCTTACTTTGGCACATGGTAGAAAAAAAAGATAACCAGCCTCA
6022	60	93	MW2_CDS_13404	MW2536	FALSE	unmapped	GATGATTGCGATCATGATTATATATCTGGGCTAAGTCTATTAGGTGGCGAACCATTTTGT
6023	60	91	MW2_CDS_09238	MW1734	FALSE	unmapped	AGATGTTACACCAGCAGGTTATTATTTTGAACAAGATGTGGTGGCGCATTCAGGCATATT
6024	60	89	DCP_20_1		pos		
6025	60	87	MW2_CDS_00354	MW0068	FALSE	unmapped	TCGCCTTTTTCAGCAGTACAGCAACAGATTAAACGTATGTTAAAGCAACAACTACCGACT
6026	60	85	MW2_CDS_11625	MW2202	FALSE	unmapped	GCTGGTGATTACATTGTGAGTACAAGTGAAGGTAAACCTACACCAGGATATGAATCAACA
6027	60	83	MW2_CDS_00716	MW0133	FALSE	unmapped	ACAAGTTTGCCATTTCCTGCAGATATAACTGTTAGAATGCATAACCCTAATAACATTGTT
6028	60	81	MW2_CDS_10788	MW2038	FALSE	unmapped	GGAAGTCATTGGCGAAAAAATAGGGACTGTCGGTTCGATGGAAGTTGCAGAAACTATTTT
6029	60	79	MW2_CDS_11983	MW2271	FALSE	unmapped	GGTGGATTCAATGCACTACAACCATCACCGTTCCATTGGAGATTGTTGGATAAAATCACT
6030	60	77	MW2_CDS_03570	MW0655	FALSE	unmapped	AGTGAGTGGAAATACTTTACCTATTTACTGCTTGGTGTCTTCTTAGCGGTTTATGTGATG
6031	60	75	MW2_CDS_05066	MW0937	FALSE	unmapped	TGCTTCTATATAAGAAAGAAAGTGTTTGTAGAAGAACAAGGCGTCCCTGAGGAAAGTGAA
6032	60	73	MW2_CDS_12175	MW2304	FALSE	unmapped	AGCTGCTGTAGGTAAAAAAGCAGAACCAGTTAAAGAATTTTTAAGCGGATCGCTTGAAGC
6033	60	71	MW2_CDS_10941	MW2065	FALSE	unmapped	TCCTTCAAGAAAATGCAAAACAGGCTATTGCAAGTATGTCACAAGCACAGTATGATGCAA
6034	60	69	MW2_CDS_08804	MW1654	FALSE	unmapped	GGCATTCGTAAGTATGGTTTCCATGGTACAAGCCATAAATTTGTATCACAAAGAGCGGCA
6035	60	67	MW2_CDS_01071	MW0197	FALSE	unmapped	GAAAAGATGATCCAGAAGAATTAGGATGGAATCGTGCTGAAGAAATTTGGGAAGAGCCGG
6036	60	65	MW2_CDS_04368	MW0804	FALSE	unmapped	ACAGCAATTACAAGCATTTCCAATGTGTGTAGAATTTAGGCATCAATCATGGTTTAGTGA
6037	60	63	MW2_CDS_01823	MW0332	FALSE	unmapped	AACGTTTGAACTTACCGGATTTACCAACAACAACTATTGGATCATTCCCACAAAGCCGAG
6038	60	61	MW2_CDS_08541	MW1608	FALSE	unmapped	AGAAGCAATTGTTAATCAAGCTCAAGGGTATTTAAAAATTGAACAAGCATATGGTAGTTT
6039	60	59	MW2_CDS_05493	MW1017	FALSE	unmapped	GGTAAGACAAATCACGATTATTTAAATTTAGATTTTGAGCGAGAACATCGACGTAAAGGT
6040	60	57	NC_A_104		FALSE	unmapped	AAAAGTGTAATGTTCCCCTGAAAAGAATAAGTTGTCATCTAATTACAGGAAATCCGCATA
6041	60	55	MW2_CDS_13893	MW2622	FALSE	unmapped	TGGTATAACGTCATTGCTTTAGCAATGATTGTTATTGTCTTAAGCGTAGTTACAACACCA
6042	60	53	MW2_CDS_03004	MW0553	FALSE	unmapped	AAACCAGTTAAAAATAAAGCTTTATGGCCAGTTATAGGTAGCATACTTTTATTTGGCACT
6043	60	51	MW2_CDS_07734	MW1459	FALSE	unmapped	TATGGCGAAGGCTATATCGATGGTAAACAAGTTAAAGCATACCGTGATGAAGATCGCGTT
6044	60	49	MW2_CDS_05399	MW1000	FALSE	unmapped	ACCAACGATTAGTACGACATGTATTGTCATTAGTGCAATTTTAATTGCCATTGGTTGGAG
6045	60	47	MW2_CDS_00719	MW0134	FALSE	unmapped	ACCAATACAGAAGTGGGTATTTATGGTATGGCCATAAGAGTACTAGGCATACCAGTGACA
6046	60	45	MW2_CDS_00788	MW0147	FALSE	unmapped	CAAAGTCGTGACGTTTTAACACAGTCAGCGGCATGGACATCCTATGGTGATTTAACAATT
6047	60	43	psma_tiling_049_F		FALSE	unmapped	GAGGTCTTTCACATGGGTATCATTGCAGGAATCATTAAATTCATTAAAGGATTAATTGAG
6048	60	41	MW2_CDS_04576	MW0845	FALSE	unmapped	GTAAACGATTGGTGAACACTGAGAGGATGCAGCGAATTAAACAACGTACTGCTGTTCAAC
6049	60	39	MW2_CDS_00457	MW0086	FALSE	unmapped	TCAGCCATTTAACGATACATTTACTTCCACTATTCGCTGTATTAGGTGGCGCAATTGCAA
6050	60	37	MW2_CDS_07874	MW1483	FALSE	unmapped	TCTAAATCTAAAATTAAAGGGCTTGAAAAGGATAAAGAAAACAGTAAAAAAACTGCATCT
6051	60	35	MW2_CDS_00710	MW0132	FALSE	unmapped	AGCGAGGCGTTAAATAGTACAAGTGTAAGTAATCTTAAAATAGTTGACACGTTGCAGTCA
6052	60	33	MW2_CDS_02286	MW0422	FALSE	unmapped	TAAGTGAAAGTGATTTGAAGTTTGTTAAAACGCCAGAGGAAAATATTACAGCTGCAATGT
6053	60	31	MW2_CDS_07298	MW1364	FALSE	unmapped	AAACGCTATTTAGAGAATCAAATCCGTGCCGCTTTTGGTTTTGAAGGTACACCAATTCAT
6054	60	29	MW2_CDS_01462	MW0269	FALSE	unmapped	AAAAAAGAAGGACATGAACCATGGACATCATGCGAATTTGATTTTACAAATGAAGGTAAA
6055	60	27	MW2_CDS_12072	MW2286	FALSE	unmapped	CTGCATTACTTGGTGCATCACCTGGTGCGTCAACAGCTGTAGATATTATGTTTGATGTTT
6056	60	25	MW2_CDS_00591	MW0110	FALSE	unmapped	TGCAGAAACGGTTCTATTGCCAGGAGATCCGTTAAGAGCTAAGTTCATTGCAGAAACTTA
6057	60	23	MW2_CDS_03125	MW0574	FALSE	unmapped	TGGCAGTGGAAACAATCATTAGGAAGACAATTGGCTTTGAATATTGTAATTGGAGGACAA
6058	60	21	MW2_CDS_06148	MW1142	FALSE	unmapped	TTAAACGGCGTAACAGTTGATTACTATGGTGCACCAACACCTGTACAACAATTAGCAAGC
6059	60	19	MW2_CDS_02153	MW0397	FALSE	unmapped	GGCAACAGGATATTATTACACGAGCAAAGTTCATGATGAATTTAATGAAAAAGAGCATCA
6060	60	17	MW2_CDS_10316	MW1947	FALSE	unmapped	GCTGATTCTGAAGAATTTTCTAAACGGTTGAATTGTAAAGCAATAACACTAAATAGTGGT
6061	60	15	MW2_CDS_05439	MW1008	FALSE	unmapped	CACACATATACAATGCAATAAGCGGGCAACAACAAACAGATTTCAACACGCCTGTCATAC
6062	60	13	MW2_CDS_02809	MW0517	FALSE	unmapped	GATAGCGACTCAGATTCAGATAGCGATTCAGATTCAGATAGCGACTCAGACTCAGACAGC
6063	60	11	MW2_CDS_11793	MW2236	FALSE	unmapped	AGCACAGAATCTTTAAGAACTAAACTCCATACACGTACTACACGCGCACTTAATCATGCT
6064	60	9	MW2_CDS_12108	MW2292	FALSE	unmapped	TCAGCAATTTCATTACCGATGGGTAGTTTTATTGGCGGAATCCTAATAAAAAATCTTGGT
6065	60	7	MW2_CDS_09589	MW1801	FALSE	unmapped	TGTGAACAATGTGGTAAGATTGTTGATTTTCAATATCCACAGTTAAATGAAATTGAAAGA
6066	60	5	MW2_CDS_11732	MW2224	FALSE	unmapped	CAATCGTGCACGAACAAGCACTAGTGCAAGCATTGAAAGATAATGAAATTGAAGGTGCTG
6067	60	3	MW2_CDS_11471	MW2174	FALSE	unmapped	ATTACCGTTTGAAAGGTATCGCTTTCGAGTTGCTTGCGTATGCATTGCAATATGCTTTTG
6068	60	1	MW2_CDS_04821	MW0889	FALSE	unmapped	AGACGGTCAAAGGATAGTATTATAACTAGAGAAGTTGCCTCGGATGGTAAATACGCTAAA
6069	59	164	MW2_CDS_11959	MW2267	FALSE	unmapped	AGACGTTTACGATTGCGCGAAAAATGAATCCTGAAGGCATGATTTTTAGCAATGTTGGTG
6070	59	162	MW2_CDS_11927	MW2260	FALSE	unmapped	AGTATTGTTGGAATTATGGCGTATGTATTACTTGCAGCCATCCTCGGATCATTAACATCT
6071	59	160	MW2_CDS_09914	MW1859	FALSE	unmapped	TGAGAGAAAGAAGTATTAATCAAGTCGAAATCGTTGGTGTATGTACCGATATTTGCGTGT
6072	59	158	MW2_CDS_07639	MW1442	FALSE	unmapped	TTTCTTTAAAAGCAATTATGAAAAGGGTAGGACATGTAGATGAAAAAACAACCATTCGCA
6073	59	156	MW2_CDS_06962	MW1301	FALSE	unmapped	CTGACTATCATGTCCAAGTATTCAAAGTTGGAACGGGTGGTCTAGGTGGCGAAATACATT
6074	59	154	MW2_CDS_02661	MW0491	FALSE	unmapped	AGTAGATATGTTTGGCCGAGAAACACCAGTAGAAGTTGAATTCGATCAAATAGAAAAGCT
6075	59	152	MW2_CDS_05561	MW1031	FALSE	unmapped	CACGTGTTATTACGATTGGTGCATATAACCGTAACGAATCACGCGGTGCCCATTATAAAC
6076	59	150	MW2_CDS_04740	MW0875	FALSE	unmapped	ATTGGCTTTGCGTCCGAGTTTAATTGTTGCTGATGAGCCTGTAAGTGCATTAGATGTATC
6077	59	148	MW2_CDS_12331	MW2335	FALSE	unmapped	CGCTGACAACCAATGGACATTGGCACCTGTAGTGGCTGCTATTATTGGTTTATCATTAAA
6078	59	146	MW2_CDS_02003	MW0368	FALSE	unmapped	TCAGCAAAGGTTAGTTACATTTTTATTAGCTATGAAGAAAATATTTATGAGTATGCCAGA
6079	59	144	MW2_CDS_13069	MW2474	FALSE	unmapped	CAAACGATTACTGTCAATCAAATTTGCGACAACGCACTCGTACACCGCACAACATTTTAT
6080	59	142	MW2_CDS_01092	MW0201	FALSE	unmapped	CCCAATGCATGGCCGTGACCAAAAAGGTGCATTATCTTCATTAAGTTCTGTAGCTAAGAT
6081	59	140	MW2_CDS_09419	MW1770	FALSE	unmapped	ACGGAAGAGACTTACCTATTATAGGAAGCAGTGGTGTTGTTCATAATTTCGACTTTTTTA
6082	59	138	MW2_CDS_11496	MW2179	FALSE	unmapped	ACATGCAGATGGCTTTAAACATCCTGGAGAGTGGAAAAATCAAGATTTAGGAACAGGTGC
6083	59	136	(+)E1A_r60_a20		pos		
6084	59	134	MW2_CDS_07551	MW1419	FALSE	unmapped	AAGAGATTGAGGACGTGTATAAGAAAGCGCGAGCGTTTGATGAAATACTTGAGGGAATGA
6085	59	132	MW2_CDS_04252	MW0781	FALSE	unmapped	ACAAATGGCTCATGAATTTTGTCCATATTCAAAAGCGACTCAAGGAAATATTAATGTCGA
6086	59	130	MW2_CDS_00777	MW0145	FALSE	unmapped	GATATGTCTAAATGTATTTGTTTATACAACGCACCTGATGAAGAAGCGGTACGTCGCGCG
6087	59	128	MW2_CDS_01381	MW0253	FALSE	unmapped	TCAAGTTAATTGGCCAAGATCCTTTTTATCAACATGTTTTAGAGGACAAGCAATGGGCTT
6088	59	126	MW2_CDS_05245	MW0971	FALSE	unmapped	CAACTCGCATTGCCTGTAGAATTTCTTTTCGAAATTCTCTATGTTGGGGCCCCTGACTAG
6089	59	124	MW2_CDS_05873	MW1092	FALSE	unmapped	GCTGAGCACTTAAAAAGAGAGCGCGTAGAAGCTAAGTATAGAAAAATGATTTTGGAGGCT
6090	59	122	MW2_CDS_11351	MW2148	FALSE	unmapped	TATCATTTTGATGGGTTTACCTGGCGCAGGTAAAGGAACTCAAGCAAGTGAAATTGTCAA
6091	59	120	MW2_CDS_13710	MW2590	FALSE	unmapped	AATGGATTTTACGATCTGACGCGTGAGGGTGCAACAGATTTAAATCGTAAAACGTCGTTG
6092	59	118	MW2_CDS_03950	MW0721	FALSE	unmapped	GGTTGATGTGGACATACCACTATCAATCATGACGGTTGTTACAGGTGTATCAGGTTCTGG
6093	59	116	perR_tiling_019_R		FALSE	unmapped	ATAATATGATAATGATTATGTGTATTAAAGTCGAATCGACTTGATGAGTCTCCATATGTT
6094	59	114	MW2_CDS_10297	MW1944	FALSE	unmapped	ACAATTGCGAATAATACAAAGAGACATCAATCGGTATCAAAGTTATCCTCACAACCTGTT
6095	59	112	MW2_CDS_04094	MW0747	FALSE	unmapped	TCAGAAATGTATGATATGCCAATTGATGAGTTATTTTCATCAAAAATTAAAGTAGGAGAA
6096	59	110	perR_tiling_106_R		FALSE	unmapped	CATTTGTAATGACAGTTCCGTCTTGATTTTCTAATTTAAATATTGGAAATTGTTCTCCTT
6097	59	108	NC_A_072		FALSE	unmapped	CTTTGCCATGATTTAAGAGTCACCCCCATACTTTGGGCATTTTGACGCCAGAATAAATCC
6098	59	106	MW2_CDS_01784	MW0326	FALSE	unmapped	TGCCTTTGTAGTGTTACTAATTTTTGTGGTAGGGCAAGCTGAAGCAAATGCAATGCTATT
6099	59	104	MW2_CDS_06090	MW1132	FALSE	unmapped	TGCAGTTTTAGCCTTTGGCCATCAAACACATTATCCCAAAAGTACATTAGCATTAAGAAA
6100	59	102	MW2_CDS_06636	MW1240	FALSE	unmapped	TGGTAATACTGGCGCTACTAATAGCTTTAGAGTATTAGGTCGTCCTGCAGGATTCTTGGT
6101	59	100	MW2_CDS_08733	MW1642	FALSE	unmapped	CAATCGAAAACTTACGTAAAAGAGGGATTGAGGGCCTTGTAGTTATTGGTGGTGACGGTA
6102	59	98	MW2_CDS_04551	MW0840	FALSE	unmapped	GGTGCAAAAATTGTAGGTATCTCTGATGCTTACGGTGCATTACACGATCCAAATGGCTTA
6103	59	96	agr_tiling 180_F		FALSE	unmapped	TCAATTTGACGGTTATCTAAATGGGCAATGAGTCTGTGAGATTTTGTTGATGATTCAAAA
6104	59	94	MW2_CDS_02078	MW0384	FALSE	unmapped	AATCTTTACGGTAACATGGGTTCAGGAACAATCGTTATTAAAATGAAAAACGGTGGGAAA
6105	59	92	MW2_CDS_13087	MW2477	FALSE	unmapped	TCAAAACGATACAAGATCACGAAATGACAAACGACACGAGTCGTCAGTTGTCAGACAACA
6106	59	90	MW2_CDS_05792	MW1077	FALSE	unmapped	ATCGAATGGCTATTATCAACATTTGGCCATGAATGATTGGGTATCAGCAACGAAACGTGT
6107	59	88	MW2_CDS_04770	MW0880	FALSE	unmapped	GTTGTAGAAGGTCCATTATGGATTCAAGTACATGCCTTTGAAAAAGGTGTCGAAGTCACA
6108	59	86	MW2_CDS_03508	MW0643	FALSE	unmapped	AGTCTTAATTGTCATGCATCATAATGGGAAGATATACAATTCCAAAAATATTCAACAACT
6109	59	84	MW2_CDS_06233	MW1158	FALSE	unmapped	TCTGCAAATATGGAAGTTATCATTGCGAATACATTAAATGAGCTTGTACGTGCTGGCGCA
6110	59	82	MW2_CDS_13528	MW2559	FALSE	unmapped	ATTCGGCGCCAACAAGTAAACAGGCACAGGCAGCAATAACCCCATATTATACTTATAATG
6111	59	80	MW2_CDS_11436	MW2167	FALSE	unmapped	AGAGATATTCTTAAGCGCCCCGTAATCACTGAGAAATCTTCTGAAGCAATGGCTGAAGAC
6112	59	78	MW2_CDS_03625	MW0664	FALSE	unmapped	CTGAAGAGTTCGGTATAGAATTTGATGACTCTGAGGATATTGATACGATAGGTGGATGGT
6113	59	76	MW2_CDS_05497	MW1018	FALSE	unmapped	ACACGAGACATGGGATTGAAACATTAGAAGGCTTTGATGGCATGTTTGTTACACAAACTT
6114	59	74	MW2_CDS_07970	MW1502	FALSE	unmapped	TTGTTCCTGGTGTTGGATTTCAAGACGATGGATATAGAATTGGGTATGGTGGTGGCTATT
6115	59	72	MW2_CDS_00433	MW0082	FALSE	unmapped	TGAGCTATATGTCTATCTTCACAGTATTAGAAATTTGGCAAATACAACACCATCATCAAT
6116	59	70	MW2_CDS_08064	MW1518	FALSE	unmapped	AGTTTTAAGTTTGACGGTGCGATTTCAAGGCAAGAGGCTTCTAAAGATGTACATGCAGTT
6117	59	68	MW2_CDS_02784	MW0513	FALSE	unmapped	CGCTAGAGCACATAATTTAAGAGAAACACTACAACAACCAACGGCGCATGCTGAACATAT
6118	59	66	MW2_CDS_12264	MW2321	FALSE	unmapped	GAAGGGACAGTGAGTGGGGAATATGTATTTTGCCCGCTCCACGATCAAAAAATTGATTTA
6119	59	64	MW2_CDS_08345	MW1569	FALSE	unmapped	AGGAAGAGCGTCCAAGAGACTACAAGAGTCAACTGGATTAGAAGCTATGACGATTCATCG
6120	59	62	MW2_CDS_02386	MW0441	FALSE	unmapped	TGGGCAATGATGAACCAACTACTATTGATACTGCGAATTCAAAACCAGCAAAAGCTGTGA
6121	59	60	DCP_22_4		pos		
6122	59	58	NC_S_009		FALSE	unmapped	ACTGCGAACAGCTGCTTCTCTTTGAACGAGAGAGAAAAGCTAGAAGTTCTTATGCAGTTT
6123	59	56	MW2_CDS_04499	MW0831	FALSE	unmapped	CGCAGCATTAAGTTTAGCTGGCATTCCCCCACTCAGTGGCTTTTATGGAAAATTTTTTAT
6124	59	54	MW2_CDS_02669	MW0493	FALSE	unmapped	CTGAAGCAGCAGGTGCTGACTATGTAGGTGAAGCAGAATACGTTCAAAAAATCCAACAAG
6125	59	52	MW2_CDS_07219	MW1349	FALSE	unmapped	TTCACCATTAGCTAACTTAGCTAGATTGACTGAAGAAGTGGGCGAACTTGCACGTGAAAT
6126	59	50	MW2_CDS_02134	MW0393	FALSE	unmapped	TCAAAAGGCGACTTAGCAATGGTATTAAATGATAAAACAAAAGATGGGAAAATTATAGGT
6127	59	48	MW2_CDS_11840	MW2245	FALSE	unmapped	CGATAGTACATTCAGTTATTTAGAACGCGTTGATTACCAGCTTCTTACTGAAAAAATGCA
6128	59	46	agr_tiling 037_F		FALSE	unmapped	AAGGAGTGATTTCAATGGCACAAGATATCATTTCAACAATCAGTGACTTAGTAAAATGGA
6129	59	44	MW2_CDS_11577	MW2194	FALSE	unmapped	ACACATGGACAGGACGTTGACGTTATTATTGATGCAACCGATAACTTTGAAACACGACAA
6130	59	42	MW2_CDS_03655	MW0670	FALSE	unmapped	AGCAAATATGATGAAGTAACAATCTATTGTAAAAAAGCTCACGTCATCTTCGGCGGCGCT
6131	59	40	MW2_CDS_12730	MW2408	FALSE	unmapped	AGGCGATGGTGATTTAAAAGGATCATCTATAGGACACAAAAATTTAGAGTTTACCTTTGT
6132	59	38	(-)3xSLv1		neg		
6133	59	36	MW2_CDS_09792	MW1838	FALSE	unmapped	CCACATGCAAAACATGTATACGGTGTTGAAGTAGTACCTTCTGCAATTGAAGACGCACAA
6134	59	34	MW2_CDS_11617	MW2201	FALSE	unmapped	GCATGCCTTTTTTATGGACGCATTGCCAATTTTAAATGAGCCAGTCAAACATGTTGCTTC
6135	59	32	MW2_CDS_02294	MW0424	FALSE	unmapped	ATTGCTAGTGGTATGCATGAAATTTTACAGCGTACGCCACACATTTCAATGAGGAGATGG
6136	59	30	MW2_CDS_05886	MW1095	FALSE	unmapped	TTAGTTGGTGTGCTGAATGCAGATACAATGTTAAATTTACCTGATTTTCGGGCGAGCGAA
6137	59	28	MW2_CDS_03824	MW0699	FALSE	unmapped	TATAAGTGCCATAATGAGTTTGAAAAGCACGCCATTAAGCGTTGGTCTGAGCCTTCATTT
6138	59	26	MW2_CDS_08233	MW1549	FALSE	unmapped	GCGAGAAAGCCAATGGGGAAAGCGTTTGATAAAGCAATAACTAAGATGAATATCAGACCA
6139	59	24	MW2_CDS_00106	MW0019	FALSE	unmapped	GGAAAGATGAGGAACTTGCGCCACAATTTTTATCTGTTACCCGTGAAGAAACAGAACGAA
6140	59	22	MW2_CDS_05019	MW0929	FALSE	unmapped	TGCTGCTGATAATGCTATTTTTGGACAAACTGGTCCTAAAGTAGGTTCATTTGATGCGGG
6141	59	20	MW2_CDS_10005	MW1878	FALSE	unmapped	ACGAAGTAACATTTCTAGTGGACCTCTTCCAACACAAAGCGCTGTTAAGCATGTATTAAA
6142	59	18	MW2_CDS_02239	MW0414	FALSE	unmapped	AGCTCATGCACATGACACTGAAGGTATCGGTTCTGAGAAATGGCCGATATTTTTAGAGAG
6143	59	16	MW2_CDS_09806	MW1840	FALSE	unmapped	TTGAACCGTCAAGGTACACCGCTAATTGAAATCGTATCTGAACCAGATATTCGTTCACCT
6144	59	14	MW2_CDS_11466	MW2173	FALSE	unmapped	TTAAAACAAACAGGTGGTATCGGCACAGTTGCAACAAGGGCCGACATTATCGATAAATTA
6145	59	12	MW2_CDS_09517	MW1788	FALSE	unmapped	AATCGTTCAAACAATTTCAAGAAATCACTGTGCATATCCAAACCATGCACCAACAAGTGA
6146	59	10	MW2_CDS_05392	MW0999	FALSE	unmapped	AACAGCGATTGCGCTGTTTTTAGTTGTATTTTGTTGGCAACCAATTCATTTTTATGCCTT
6147	59	8	MW2_CDS_01476	MW0271	FALSE	unmapped	TTGGTATCACTTATATTTTTATAGGTGACAGCTATGATCAGTTAACAAATTTCAATGTGA
6148	59	6	agr_tiling 168_F		FALSE	unmapped	TTGTAGACAAATGTTAAATAGGTAAGTTCACTGTGACTCGTAACGAAAATAATGTTACCA
6149	59	4	MW2_CDS_10189	MW1921	FALSE	unmapped	CAAACGCGGAACTATGAAAATAAGGAAGGTCAACGTGTATACGTTACGGAAGTTGTTGCC
6150	59	2	MW2_CDS_12150	MW2299	FALSE	unmapped	AGGTTACTGGTTATCAGATGGTTTAACATGGCTTTATGAATTTGGTGGTGCAATTGGTGG
6151	59	163	MW2_CDS_13726	MW2592	FALSE	unmapped	TCCACAGCTCATTAAACAAGCGAGTGATAAATTCGGTAGACAATGCATCTGCATAGCAAT
6152	59	161	MW2_CDS_10389	MW1963	FALSE	unmapped	CCTATGGAAATTGCCCTCGCAACTGATAATCCTTATGAGGTGCTTGAGCAAGCTAAAAAT
6153	59	159	MW2_CDS_03759	MW0688	FALSE	unmapped	ACAGCAAATGGTCCATTCATTGGTGGTAGTCGTATACCATTGACTGATTTGTCTCCTCAA
6154	59	157	MW2_CDS_01298	MW0238	FALSE	unmapped	ACTTCGAGATCTAAAGGTGACAAAGTCACAAAAAAGATCAAAATAGAGGAGGCACAAGCT
6155	59	155	MW2_CDS_01055	MW0194	FALSE	unmapped	TGAGCCCCGCTTTGGAACTATTTTTGAAAGCAAAGCTAATGTTGAGCATAACGAAGACAT
6156	59	153	MW2_CDS_02107	MW0389	FALSE	unmapped	TGTCTTTGCGGTACCGGAATTAGTAGATTTAGATGGAAGAATATTTAGTGTTAGTGGTGT
6157	59	151	MW2_CDS_07115	MW1329	FALSE	unmapped	TCAGCAATATCAAAGCGTTGAAAATGTGGTTGAAAACATTGATGCATTATCAGCTGGGCA
6158	59	149	MW2_CDS_12732	MW2409	FALSE	unmapped	AGAGAAGCAAGATAAAATGCCGAATGGTTCAAACGTAGTAACGATGGATTTAGCACTCGA
6159	59	147	MW2_CDS_08863	MW1664	FALSE	unmapped	GTGGTGTTGGTTTAGGAACAAATCCCGATGAATTGTTAGTATCAGCCGCTTCATCATGTT
6160	59	145	MW2_CDS_11689	MW2215	FALSE	unmapped	AGCGCTTCAATAGATAGTTTATTAAAAATGAAAGAAATCCAATCTAAGATGGCCCTTCTT
6161	59	143	MW2_CDS_08623	MW1624	FALSE	unmapped	CAGTTGAACAAAAACCTAAAATGGACGGGCGTCAAATGTTTATCATGTTAGCGCCAACAG
6162	59	141	MW2_CDS_02930	MW0540	FALSE	unmapped	ACTCTAGTTTCTTTGGTAGTTTAGCATTAGGCTTGTTAAGTCATTATATGGCTCGTAAAC
6163	59	139	MW2_CDS_12230	MW2315	FALSE	unmapped	AGGTCGTGGATTAGCTGGAACTGTTATGAAAACAGGAAAGCGTATGGTAATAGCCAATGT
6164	59	137	MW2_CDS_07182	MW1343	FALSE	unmapped	GACGCACACAGTTAAAACGGTACCTAAATTTGATTGGTTAAACGGGGAGAACCTTGATGG
6165	59	135	MW2_CDS_12582	MW2379	FALSE	unmapped	CGAGCGATAGTAAACTAGGCGGTGGTCCAGTTGTCATTATGATGGATGCTACAAGTATTG
6166	59	133	MW2_CDS_09173	MW1721	FALSE	unmapped	CTGAAGCAGTAACTGAAGGTGTGCCAACATATGTTTCAGTATTTGCAGGACGTATTGCAG
6167	59	131	MW2_CDS_13870	MW2618	FALSE	unmapped	GCCACAATCATTTGGCCGTGCTACAATGTCTGAAAATCATTTAACTTTAACAAGGAATGG
6168	59	129	MW2_CDS_01874	MW0342	FALSE	unmapped	AATTCATCAAACACGAAACAATCTGATAATCCATTTGCAAATGCAAACGGACCGATTGAT
6169	59	127	MW2_CDS_13791	MW2603	FALSE	unmapped	GTATAGTTGGTCACAATGGTGCCGGCAAATCAACACTTGCTAAAGCAATTTGTGGATTTT
6170	59	125	MW2_CDS_09274	MW1740	FALSE	unmapped	TGAAAGACAGCATTGTCGATTTAATTCATAAAGGGACTGAATTAGAAGACTTTGCAGCAT
6171	59	123	MW2_CDS_03027	MW0557	FALSE	unmapped	TGTTTCTTGGCTTTTCATGACTATGCTATTTATGTTTATGAATATGCATTCAATTATAGA
6172	59	121	MW2_CDS_07902	MW1489	FALSE	unmapped	TTGGAGAAGTAACTTCAGGAACACAGTCTCCATCATCAGGAAAATCAATTGCACTTGCAA
6173	59	119	MW2_CDS_13837	MW2612	FALSE	unmapped	ACACCACCAACTAAACCTGATCACTCTAATAAAGTTAAACCAACTCCCCCAGATAAGCCA
6174	59	117	MW2_CDS_11651	MW2208	FALSE	unmapped	GTGTAGGTGAAGTAATTACACGAACATGGCAAGTAGCACATCGCATGAAAGAACAACGTG
6175	59	115	MW2_CDS_09346	MW1755	FALSE	unmapped	TCTAATCAGCCTCATTCAATTGCCAAAGCAGAAAAGAATGTCAAAGAAATTACCGATGCA
6176	59	113	MW2_CDS_06755	MW1261	FALSE	unmapped	ACAGAAGATGCTGAAGATGCTGGTGTAGTTAAATTCAAAAAAGGTTACAATGCTGAAATT
6177	59	111	MW2_CDS_01783	MW0325	FALSE	unmapped	GTAATCGATTGAAAGAATTACGAGCACGAGATGGCTTAAACCAAACGCAGCTTGCCAAAC
6178	59	109	MW2_CDS_01074	MW0198	FALSE	unmapped	ATTCGTATGCCACGTAAAAATGGCGTCGATTTACTCAATGATATTGCGCATCTAGATTGT
6179	59	107	MW2_CDS_00585	MW0109	FALSE	unmapped	TTTGATGTCAGTCGTATGACTTTGCGCCAAGCTATAAAATTGTTAGCCGAAGATGGCATC
6180	59	105	MW2_CDS_09573	MW1798	FALSE	unmapped	ACCCACTAAAGGTCAAGTGATTTTTGAAGGCAATGACTTAACGGAAAAAGGGACACAAGT
6181	59	103	MW2_CDS_06264	MW1163	FALSE	unmapped	CCGAGTGAGGTTGCTCATACATGCGCCTATTTATATCACCCAAATGCTAGAAGTGTTACT
6182	59	101	MW2_CDS_05097	MW0943	FALSE	unmapped	CTTGGTCGTACTCTAGAGTGGACTACTGCATCAGCAATTCCACCTAAATACAACTTTGCC
6183	59	99	MW2_CDS_02285	MW0422	FALSE	unmapped	AGGAATAGGTAAAGTGGTAATGGAAAAATTGGCGTCATTTATCACTTCAACATTTCAGGA
6184	59	97	MW2_CDS_08022	MW1511	FALSE	unmapped	TTATGGACTTGGCGTTATGGCAGAAGTGGATAATCAAATGACATTGGAAGATTTCGCAGC
6185	59	95	MW2_CDS_10003	MW1878	FALSE	unmapped	TTCAATTGGTGTTATTGCACTTAATGCAACAGATATTCGTATTGCGTTTAGCTGTGTAGA
6186	59	93	MW2_CDS_04671	MW0862	FALSE	unmapped	TCCTGTATGTGGCTTTGCTTGGATTCATTGGAGTGTAGCTAATGTAAGTGTTAGTGGCAA
6187	59	91	MW2_CDS_06763	MW1263	FALSE	unmapped	TGGTTATTCTTTTCGTGTTCTTTATTAAAAGAACGAAAACCAGTTGTCAGATGTTTACCA
6188	59	89	MW2_CDS_09700	MW1821	FALSE	unmapped	AGAGAGTGATGTACCAGATCCATACTACACGAATAATTTTGAAGGTGTATACGACATGGT
6189	59	87	MW2_CDS_06008	MW1117	FALSE	unmapped	TTGACTGTTGAACGTGCGAAATCTGAATATACGAGTGATGAATCGATTGACGCATTACGT
6190	59	85	MW2_CDS_03517	MW0645	FALSE	unmapped	TATTTCCAAGCGTTTGTAATTGGTATCTCTCAAGCAGTAGCTATGTGGCCTGGTTTCAGC
6191	59	83	MW2_CDS_04484	MW0828	FALSE	unmapped	GCGATTATCTTTGTATTAATTACAGGTCCTCTTTCAAGTCATATGATTATGAAAGCAGCA
6192	59	81	MW2_CDS_07601	MW1432	FALSE	unmapped	AAGGGTTTTCAGAAGAGATCACGCGCCAGTAGAATCTTTAACAGAAAATGAACGTCGACT
6193	59	79	MW2_CDS_00745	MW0138	FALSE	unmapped	ATAATTCAATGCCGGCCTATGTTGTTGATACAACGAAGCAAATCATCAAAGCATTGAGCG
6194	59	77	MW2_CDS_12913	MW2444	FALSE	unmapped	TATGACTGTTGCAATTATCGGTACGGGTCGTATCGGTGCTGCTACTGCTAAAATATATGC
6195	59	75	MW2_CDS_12782	MW2419	FALSE	unmapped	GTTGATTGACGTTTATGAAGAAACAGGGCACTCAGTTATAGGTGTCCAAGAAGTTCCGGA
6196	59	73	agr_tiling 161_F		FALSE	unmapped	GCCTATGTCATTCATATTTTTAGCTTGCTCAAGCACCTCATAAGGATTATCAGTTGCGAG
6197	59	71	MW2_CDS_04591	MW0847	FALSE	unmapped	ACTGGGACTTTCCAAGTTAAAGATTTACCGAATGCGAATCCTAAATCAAATGTCATTCCA
6198	59	69	MW2_CDS_05194	MW0960	FALSE	unmapped	ATTTACAATTTATGGTGGTTTGTTTACAATGGTGTGCAAGCTACAGGCCTTCACCTCGAA
6199	59	67	MW2_CDS_10007	MW1878	FALSE	unmapped	ATCCGACAGGTTACACACCTACGCATAAAGAAGTGACTACCATCGTCGATGCAATTAAAG
6200	59	65	MW2_CDS_01578	MW0289	FALSE	unmapped	ATTGGATATCAAACGAATGAATTGCCAGCATTCTTCACTCGCGAAAGCGGTGTTAAGTTA
6201	59	63	MW2_CDS_11848	MW2246	FALSE	unmapped	GTGGCAAAATTTAATGTAGAGAATGAACATGTCGAAGTTGAAGTTGAAAAGCTTTATAAA
6202	59	61	MW2_CDS_06869	MW1282	FALSE	unmapped	AGGTGCTGCATTAAATGCTGTACAAGTATTGGAACAAGTTATGCGTTTAAAAGGAGCGAA
6203	59	59	MW2_CDS_08552	MW1611	FALSE	unmapped	AATCGCTTTCGAAAAATTTGGAGACGATATTGCTGGTGTAATCGTAGAACCTGTTGCTGG
6204	59	57	MW2_CDS_00723	MW0134	FALSE	unmapped	TCAACACCATCAATATTATTAAATAGTTTGTCTTTCTCGGTTGTTGTGTTCTTTATAGGT
6205	59	55	MW2_CDS_06667	MW1246	FALSE	unmapped	CGCCGTGGATGCTCTTAAAATTAGCAGTAGTATGGACTTTAGTACAATTTGTTGAAGGGC
6206	59	53	MW2_CDS_00639	MW0118	FALSE	unmapped	CCGCCGAGTGGTTATAAATGGTATGATCCAACAACATTTAAAGCAGGTAGTTATGGCAGC
6207	59	51	MW2_CDS_02635	MW0486	FALSE	unmapped	GTCTAAAAAATATGTATCTGCCAAAAGTCAGGCGCAAACGTTAGAATATTTAATGGAGCA
6208	59	49	MW2_CDS_01271	MW0233	FALSE	unmapped	CAGATAGACGTGGCATCATCGACAAGTTTAGATTGCCATATTTACTTGGGAAGGCAGACT
6209	59	47	MW2_CDS_13746	MW2596	FALSE	unmapped	GCCGGTAATGAAGGGCTATGTAAGATACTCAATTGCAACAGCACCACAGTTAAACCAATT
6210	59	45	MW2_CDS_07556	MW1421	FALSE	unmapped	ACAAGCATAAGGAATGAAGAACTATATTACGAATGCATGTCGTTTGGACTGCCTAATTGT
6211	59	43	MW2_CDS_11688	MW2215	FALSE	unmapped	TCATCAATGGCTATTGAAAGGAAGAGATCAAAGGGATCAACGTAAATTGACTATTTCGAT
6212	59	41	MW2_CDS_06748	MW1260	FALSE	unmapped	TTGTCATTATGGAGAACAAGCGTTTTTTGAAAAATGTCGAGATACTGGTGTCTACGGCTT
6213	59	39	MW2_CDS_02171	MW0400	FALSE	unmapped	TGACAAAGAGGGATATCGAGATGGAAAATTTAAAAAAGGCGACAAAGGTACTTGGGTTAT
6214	59	37	MW2_CDS_04129	MW0756	FALSE	unmapped	AGCGTAATATATAAATCAAATGGAGAAGATGTGAAAAAAAGTGTGAAAAAATACACGCCA
6215	59	35	RC7		pos		
6216	59	33	MW2_CDS_12853	MW2432	FALSE	unmapped	TCTGTCGTTTAATTTCAGAAGAACGTCTATATCGCTTTATTGATCGACACGGTAAGTGGA
6217	59	31	MW2_CDS_07866	MW1482	FALSE	unmapped	GTGTTGCAAGTGACAAAATTATTGAAAAAGGCGACATGATTACATTAGATTTTGGCGCGT
6218	59	29	perR_tiling_039_R		FALSE	unmapped	AATAGCCTTTTTTAGCATCAACTTCATTCTCAATTAGATCATTCTTATTGAGAAAATTAA
6219	59	27	psma_tiling_017_F		FALSE	unmapped	ACGTTTAGACTGAAACACTCGTGTGACCGTAAGTGTTAATAGTACATTGATAGCTGCATT
6220	59	25	MW2_CDS_00188	MW0035	FALSE	unmapped	AGCTCATCAATCCAGTAACAAATGAAATTATGCATCCACTCAACCCTAAGGCACGTCAAA
6221	59	23	MW2_CDS_00914	MW0168	FALSE	unmapped	GGCAGTCACTGTAGGTAACTTCACTTCAATATTCGGCATGTTCGCAGCCATACTCTTTAT
6222	59	21	MW2_CDS_05094	MW0942	FALSE	unmapped	GACGTTTGCATTATTATTCAGTTCTTACACATGTGGTATTGCTATTTACTACATGCGCCA
6223	59	19	MW2_CDS_00762	MW0142	FALSE	unmapped	CACTTACAACCAAGTACCAGAAGGCGCACCATTTGGTGGTTATAAAAAATCAGGTATCGG
6224	59	17	MW2_CDS_01517	MW0278	FALSE	unmapped	TTTCATTTGATTATATTGATTGGATAAATACAGAGTTTGATCAATTAGGCCGTGAAAACT
6225	59	15	MW2_CDS_02627	MW0485	FALSE	unmapped	GCGTAATGAAGCAAGGAAAAACAAAGATTTTGCACGAGCAGATGAAATTCGAGACATGCT
6226	59	13	MW2_CDS_13799	MW2605	FALSE	unmapped	CGGGTGTAGGTAGTGATAGGCGGAGCATTGCTTGCTTAACATATTCAGGTCATTACATTA
6227	59	11	MW2_CDS_11354	MW2148	FALSE	unmapped	TCCTCCGAAGGTCGAAGGTATTTGTGATATCGATGGTGGTAAATTGTATCAACGAGAAGA
6228	59	9	MW2_CDS_12249	MW2318	FALSE	unmapped	CCAAGACGCATGTCGTGGATGGCGTTACTGTATGACAGGTTGTCCATATAAGAAAGTTTA
6229	59	7	MW2_CDS_13642	MW2578	FALSE	unmapped	ACTCAGCTAGCTTTATCAATAAAAACATTTCTCGCCTTGCATCACTATCAACGATAGGCA
6230	59	5	psma_tiling_066_F		FALSE	unmapped	TATTCGTTTTAAACTTATAACATAAAATATAATTAAATTTCTGCTTCATGTCAAATTCAT
6231	59	3	MW2_CDS_09670	MW1815	FALSE	unmapped	AGGTCGTACGTTAACAGCAGTATTAAATGTACGCAAAGATTTATCAAATGCAGGCGCACA
6232	59	1	MW2_CDS_13399	MW2535	FALSE	unmapped	TTCAAAAGGTCGACGCCTTAAAGAAGTCGTGCTAGGAACAATTATTTATGGAACGCTTGG
6233	58	164	MW2_CDS_12516	MW2368	FALSE	unmapped	AGCAATGTACTTAATCAAACATGCACCTGAGACTAAAGCAGAACCAATCAAAGGTATGAA
6234	58	162	MW2_CDS_03299	MW0607	FALSE	unmapped	TGTATCGGGAGCTATTGTAGGTGCGTATGTACAAATGGTACCAGGAGAACTGGTACTAAC
6235	58	160	MW2_CDS_11628	MW2203	FALSE	unmapped	GTGTTGGTTTTTTCTTAGTGGACAGGAATTTGCCTGGTGTTGAAATTGCCGATAATTGGG
6236	58	158	MW2_CDS_03043	MW0559	FALSE	unmapped	GATGACAATGCTTTTCTTTTTGTTAAATATGACTTCGATAGGTAATGAAAAAGTTCGCGT
6237	58	156	MW2_CDS_03758	MW0688	FALSE	unmapped	GTGATGGCACGGTTAACGAACTTATAAACGGTGTTATGACACATGACCTTCAACTCCCTA
6238	58	154	MW2_CDS_12836	MW2429	FALSE	unmapped	CGCATTGCTTCCTAATGTAATGGCTGAAGTTGTTCGTAAAGAAGCAACGCTCTTCCATTA
6239	58	152	MW2_CDS_00126	MW0022	FALSE	unmapped	TGCGAATGAAAAGACTTGGCAAGCTATTGAAAAGAAAGATAGTCGCATCCCTATGGATCA
6240	58	150	MW2_CDS_03262	MW0599	FALSE	unmapped	TCCAGATATCTTAGTCATTGACGAAGCTTTATCTGTAGGTGACCAAACTTTTGCACAAAA
6241	58	148	NA		ignore		
6242	58	146	MW2_CDS_05865	MW1091	FALSE	unmapped	TGCACAAACCATCAGGTGCAAAGCCTGGGTTTGTAACATATGACAATCAAAAAACTTTGT
6243	58	144	MW2_CDS_08146	MW1533	FALSE	unmapped	ACAAGCTGAAGAAAGTAAAGGTCATTTACAAGATGAAGCAATAGAAGAAACGTCTGACGA
6244	58	142	MW2_CDS_06930	MW1294	FALSE	unmapped	TTTGCAAACTGCGCCACAAATTCGTATGATTCAAAATGTTAATCAAGCACTTGCCGAGAA
6245	58	140	MW2_CDS_04313	MW0794	FALSE	unmapped	CGCTTCAATTAGCGGCATATTCTCACGACGTTTTTGGCCAAGTTTTACATTTTTAATCCC
6246	58	138	MW2_CDS_07846	MW1479	FALSE	unmapped	AGATGAAGCGATTATGGCTGGCATTCGTGCATTAAGTGAATTTGTGGTTCTTGGTATTGA
6247	58	136	MW2_CDS_11342	MW2145	FALSE	unmapped	TCAAAAAACGAAAAACAACGCGCGTACTCGTAAAGGACCAGTTAAAACGGTAGCTAACAA
6248	58	134	MW2_CDS_11600	MW2198	FALSE	unmapped	GGTGAATGGTGAAGAATTTGCGACTGTTATATGCAGTCCAACAAACCTTGAGGAGTTAGT
6249	58	132	MW2_CDS_10247	MW1935	FALSE	unmapped	TGTCAGAGAGAAGTTTATCCTTAAAACTCAACGGTAAAGTTGGTTGGAAAGACAGTGAAA
6250	58	130	MW2_CDS_01204	MW0221	FALSE	unmapped	AAGTGAAGAAAAATTGGAGCAGATTCTGCGAACGAAAGATGAAACGATTTTAGCAACACT
6251	58	128	MW2_CDS_09368	MW1760	FALSE	unmapped	CCAATGACACGAAATGATTTGCACAAAGTTGGTTCGCTTATTGAAACACCTGCGACATAT
6252	58	126	MW2_CDS_13725	MW2592	FALSE	unmapped	TCTTGTAAATATTCCAATCATTGCTTCTGGTGGTGGTGGCAATGCACAACACTTTGTAGA
6253	58	124	MW2_CDS_03562	MW0653	FALSE	unmapped	GCATGATACACAACGCAATGAGTCCAACCTTTTTGAACAGGGGATTGAATTAGGTAGTCA
6254	58	122	MW2_CDS_00853	MW0158	FALSE	unmapped	TGTCATCTATTATTATTGATGCTAAGACCGGCGTGTCAGGTGCTGGTCGTTCATTATCAC
6255	58	120	MW2_CDS_00878	MW0162	FALSE	unmapped	TTCATATACGAATAACGCAACGTTCCCTGCGTATCATCGTCCAACATCACCCGATTATAC
6256	58	118	MW2_CDS_08583	MW1616	FALSE	unmapped	TGATTGATATTGCAGTTCCTCGAGATATTGAACCTGGTATTAGTGCCATCACAAACATCT
6257	58	116	MW2_CDS_10253	MW1936	FALSE	unmapped	GACGAAACGCCATCAAATGCTGATTTTTGTATTTTAGTTAATGGTGATTCAATGGAACCT
6258	58	114	MW2_CDS_04708	MW0869	FALSE	unmapped	CGGTGTTGTTGCAGCGATGTTAGATATTTTTATTGGCGTTGTATATGGTGCGATTTCTGG
6259	58	112	MW2_CDS_05844	MW1086	FALSE	unmapped	CACTATTAAGAAAAATTAACGTGCCACAGCCACAAGGGAAAACAGCTACATCACCTGAGG
6260	58	110	(+)E1A_r60_a135		pos		
6261	58	108	MW2_CDS_12100	MW2291	FALSE	unmapped	GTAACGAGTTATGACCTAGGTGTTAGCCATTATGGCGGTTTTAGTGAATATGCGCGTGTA
6262	58	106	MW2_CDS_13544	MW2561	FALSE	unmapped	AGAGCGTGAGAAATCATCTTCTACATACATAGGTAATTTTATGGCGATTCCTCATGGAGA
6263	58	104	MW2_CDS_10301	MW1944	FALSE	unmapped	ACGAAAACGAAAAACCAATAATAAAAGACGCACTATCTAAAAAAATATTTGATGGTTTAG
6264	58	102	MW2_CDS_01347	MW0246	FALSE	unmapped	GGATTCGGACAAATCATTACATTTAAAGCGTTCGAATTAGTCGGCTCATCTCGTGCCATG
6265	58	100	MW2_CDS_13430	MW2541	FALSE	unmapped	TGGTGTTACATTTCCAGTGCTAGCTAAAATATCTGTGAACGGGAACGATGAACATCCGTT
6266	58	98	MW2_CDS_02649	MW0489	FALSE	unmapped	TGTGTGAACAATATAAGCCGAGAGAAATTGCTCAACTGATGCATGTAAAAGAGAAAGTGA
6267	58	96	MW2_CDS_08004	MW1508	FALSE	unmapped	CGGTGTTGTAGCAGATACTGCTACTGAAGTAGCATGTTTAAATAAGCATTTGCATTTCCA
6268	58	94	MW2_CDS_08187	MW1540	FALSE	unmapped	CAAGCAGGTATAAAGCGTATCTACTATGCAGAAGATTATCATAACCATGAATATGCAACT
6269	58	92	MW2_CDS_08906	MW1671	FALSE	unmapped	TCATGGTGAAGATGCATTAAATGATGCAATCCGTATTTCACAAGCATTATTTAGTGGTGA
6270	58	90	MW2_CDS_08952	MW1680	FALSE	unmapped	TGATAATGGGGGCATTATTGGAGACGGCAATAAATCATTTGTATTTGGGCCATGTTCAGT
6271	58	88	MW2_CDS_06436	MW1199	FALSE	unmapped	AGCTAGAGAACGCAAAAAATCAGATGAACGTATTAAAGATGCGGTTCAAGAAGCTGAGAA
6272	58	86	MW2_CDS_01279	MW0235	FALSE	unmapped	CGAATTATTACAGCGTCTCAATGACGTTGAACAAACGAATACACCAGGTTCGCTTAACCC
6273	58	84	MW2_CDS_00470	MW0089	FALSE	unmapped	GATAACGTCAATTGAAGAAGGTGCAACAATTGTCACGATTTTACCAGATCGAGGCGATCG
6274	58	82	MW2_CDS_03460	MW0634	FALSE	unmapped	GCCCAATTTCCTAATGTTGAAATACAAGTGCAAGTTGGTTCAACTGAACAAATTAAAGCA
6275	58	80	MW2_CDS_10907	MW2059	FALSE	unmapped	ACAATTGCCAACATGGCAACTATATTTAAGGTTACCTATGCAGTTCGTGTTAATGGGACT
6276	58	78	MW2_CDS_13113	MW2482	FALSE	unmapped	ATTGAAATGATGTTTGGTGTGCATTTTATTAAAGGCGGTATGTATGGCATGGCTCAAGGG
6277	58	76	MW2_CDS_03530	MW0647	FALSE	unmapped	TTATGAAGTTAAGGACGCTAGTTTTAAGTATTGGAACCAGCAAACGTATGTGTTGTCGGA
6278	58	74	MW2_CDS_11396	MW2157	FALSE	unmapped	TGAACCGTTTAAAAGAAAAGTTTAACACTGAAGTTACTGAAAACTTAATGAAAAAATTCA
6279	58	72	MW2_CDS_13639	MW2577	FALSE	unmapped	AGTTCAAAAAAGAATTCAAACCTGTTATGCACTTAAAAGGTGATGCATTCAATCAACAGT
6280	58	70	MW2_CDS_03521	MW0646	FALSE	unmapped	TCGCCATTTACAACGACGCTTGTATATAGAAAATGGAAGACTGATTGCTGATGATCGCAA
6281	58	68	MW2_CDS_05101	MW0944	FALSE	unmapped	TCTCAAACTGGTACGTTCAGAGGTCGTAACTCTAACTTCAATGGTGAAGGATTCTCACGT
6282	58	66	MW2_CDS_07594	MW1429	FALSE	unmapped	TGACCTTACAACAAAAAATACTATCACATTTTGCAACATATGACAATTTCAATCCTGATG
6283	58	64	MW2_CDS_04967	MW0918	FALSE	unmapped	TGAAGAAGAATTTTATCATACATATAACGAATTAATTGTTAAATATACTGAGGTAAAGGA
6284	58	62	agr_tiling 080_F		FALSE	unmapped	GTTGAGTAATTTTTTCATAATTTAGTCCTCCTTTGAATAGTATATTGGTAGTAATGTAAT
6285	58	60	MW2_CDS_06054	MW1126	FALSE	unmapped	ACTTTGGCCTAAATTTGAAGATGAAGAAGTCGGTAAGAAGTTGAGTTTAACAGGCGCGAT
6286	58	58	psma_tiling_065_F		FALSE	unmapped	CATAAAATATAATTAAATTTCTGCTTCATGTCAAATTCATGAGCTTAACCTCTATTAAAC
6287	58	56	agr_tiling 177_F		FALSE	unmapped	AACATAATATCATCATATTGAACATACACTGAATTACTGCCACGTTTTAATTCAATCGTT
6288	58	54	MW2_CDS_12491	MW2364	FALSE	unmapped	AGTTGGTATCGTTGGTTTAGCATATGTTTATGGAATTATGCCACAAACGGAAACGACAGT
6289	58	52	MW2_CDS_00650	MW0121	FALSE	unmapped	CGAGCAATGCTTCATTTATTAACTCACGAAGAAGAGGAATGGGGAAATTTAGAAAGACGT
6290	58	50	MW2_CDS_05461	MW1012	FALSE	unmapped	AGTTCAAACACCTGTTAAAGATGTTGCAACAGCGAAATCTGAAAGCAACAATCAAGCTGT
6291	58	48	MW2_CDS_05683	MW1058	FALSE	unmapped	TGCAGAAGAATGGGCGTTTCACTATATGGCGAATGTTTTTAATCATAAAGCAACAAAGGA
6292	58	46	MW2_CDS_04391	MW0808	FALSE	unmapped	ACTTTGAATTAATAGAAAATTATCGCGAATGTTTTAATGAAGAACAATTTATTGCTAGGT
6293	58	44	ETG05_36762		pos		
6294	58	42	MW2_CDS_12725	MW2407	FALSE	unmapped	ACCCTGTCAAGATGGAACATAATAAAATCATACCAACAAAACCTATAAAAGACGAGAAGT
6295	58	40	MW2_CDS_07941	MW1496	FALSE	unmapped	TCCTGTAGAGATGCAAATTCCTGGTATCGTCCAAATTAATGTGAATGATAAAGCTGGCAT
6296	58	38	NC_S_004		FALSE	unmapped	GGGTGACTCAATGAATTTACTCCTTACAATAAAGACATATAGCGGTGTCAATATTGTAGG
6297	58	36	MW2_CDS_10429	MW1970	FALSE	unmapped	GTGTAAATTCAAAAGCGATTAGCGATGCGTTACAAATTGACTCGGCAACAATTCGTCGTG
6298	58	34	MW2_CDS_05033	MW0931	FALSE	unmapped	AGCTACGCCACTACCTGGTAATGTAAAAGAAAAAGAAAGTGCTAAAACAGTTTCATCAAA
6299	58	32	MW2_CDS_12893	MW2440	FALSE	unmapped	AATAAAGGTCCGCAACCAATTCAACGTATTAGAGACCGCGTATTAATTGCAAGTAGCAGC
6300	58	30	agr_tiling 060_R		FALSE	unmapped	ATTAATTGTTATGTATACTATTGCCTATATTTTAAACATTTTTATCTTCACTTTAATTAC
6301	58	28	MW2_CDS_12444	MW2356	FALSE	unmapped	TGGGCGCAGCATTATTAGCGTTTTGTGAGACAACTTTAACAAAAGGTATTGATGTCGTCT
6302	58	26	MW2_CDS_01804	MW0329	FALSE	unmapped	GCCTTATCTTTAAGGGGCATGACCAAGTAATGATTATCTCGGTATCCGTTGCGACTTTCT
6303	58	24	MW2_CDS_06276	MW1165	FALSE	unmapped	AACCAATTAATTCAAGCTCATCAAGATGAAATTCCATCGAACCAAGCCGAATGGGACGAA
6304	58	22	MW2_CDS_12857	MW2433	FALSE	unmapped	TTCCAAAGCGGGAATTTTAATGTTATTAACAGCAAAGACAGCAAAAGCAATATCGGTGCA
6305	58	20	agr_tiling 132_R		FALSE	unmapped	TGCTCTTAAGTTAAATGGTATTGAGAATCTTAAAGTACGTGAGATTAAAGGTCTTCTAAC
6306	58	18	MW2_CDS_09548	MW1793	FALSE	unmapped	TCAAAAGGATTAATCGATGATGTTAATGCGCAAACATTCATTAAAAGTAATCAATCAGGT
6307	58	16	MW2_CDS_08308	MW1562	FALSE	unmapped	AATGGTGAACTTGATGTTTTTTATAATCAAGGTGAAGTTACACCGTTTGCGATGAGTCCT
6308	58	14	MW2_CDS_10434	MW1971	FALSE	unmapped	ACCAAAAAGAACAAAGACGTGAACAACGCAAACTTGAACGACAAATATCCGAGTGTGAAA
6309	58	12	MW2_CDS_08598	MW1619	FALSE	unmapped	AGACGATGCAGAACAACGTGTTAAAACTAACTTAACTTTAACTGCGATCGCTGAAGCTGA
6310	58	10	MW2_CDS_06305	MW1170	FALSE	unmapped	TTTGCAGAATTAGTGGTTATGTCTAACCCATCAAAATTCGAAGATGCAGAGGATATAGCT
6311	58	8	MW2_CDS_01861	MW0339	FALSE	unmapped	AAGCGATTCGTGAATATGCAGCGCAAGAAGACTCTGAAGTGATTGTTATTAGTGCAAAAA
6312	58	6	MW2_CDS_09786	MW1837	FALSE	unmapped	TGCATACTGCTTATTGCTTTATAGATATTCTGCTTGTTGCATTAACAATATCTAGTAGTT
6313	58	4	MW2_CDS_02192	MW0404	FALSE	unmapped	TCTAAAATGAATGCTCAAAAAGAAAACATTCGTTCAGTTGTTGCACCTGAACATAAGCAT
6314	58	2	MW2_CDS_03085	MW0566	FALSE	unmapped	AACTCGATGAAGCGGTAGTTACGTATTATTTGGAAAAATGGACAAAAGAAGATGATGCCA
6315	58	163	MW2_CDS_08621	MW1623	FALSE	unmapped	CGTTCAAGAGCTTTCACATCTCACTTATTCGCAAACAAGAGCACTAAACAAAAACGTCAA
6316	58	161	MW2_CDS_09038	MW1695	FALSE	unmapped	GGCAAAAGGTAATTTATTTAAAGCGATTTTGGGTATAGGTGGCGCTGTAGCAGCTGTACT
6317	58	159	MW2_CDS_07587	MW1428	FALSE	unmapped	ACGAACTTGGTGCGGATAAGCTATCTACTATCAAAGAAGAGCATTATGAAAAAATTGTTG
6318	58	157	agr_tiling 118_R		FALSE	unmapped	TATTCTTGGGAATTATTATATTACTGAGTATCTTAATTTTTATTTATTCTCAATTTACTC
6319	58	155	MW2_CDS_04887	MW0901	FALSE	unmapped	ATGGAGCCAGTAGGCCGTAAAATTGCACGTTGGATTGAAAATGAAGACCAAATTACAGAT
6320	58	153	MW2_CDS_07890	MW1487	FALSE	unmapped	TGTGTTAAGTGGTGTGCGTCAAAAAGAATTTGGTGTACGTACTTTAGACATGGCTAAGCG
6321	58	151	MW2_CDS_00418	MW0079	FALSE	unmapped	ATTGTAGCGAATACATTCGTGCAACAAGGTTTAGGTTATACAGCATTGCAGGCAGGATAC
6322	58	149	MW2_CDS_04354	MW0802	FALSE	unmapped	ACGGCATTTGCTTCAAATGCGACATACGAAGAAGTTTATGAAACGGTTATGAATAAGCCA
6323	58	147	MW2_CDS_11590	MW2196	FALSE	unmapped	TAATGATGAGTTTTGCTCGTGCATTAGGTGAGTTTGGTGCTACATTAATGGTTGCAGGAT
6324	58	145	MW2_CDS_12039	MW2280	FALSE	unmapped	CTCGTAGGTCAAGAAGCGGGAATGACCAAACAACAAAGTTCAACAAGAGCAATACAACTT
6325	58	143	MW2_CDS_12897	MW2440	FALSE	unmapped	TGTGTTAACAAAGGATGAATTAACAATCTTACAACAAGCGTTTAAGAAATTAAGTGCACA
6326	58	141	MW2_CDS_07124	MW1330	FALSE	unmapped	ATTTCGGATGTGCCTTTGTTCAAGCGTACAAAGCAAGATATCCACGAAACATTAACACGT
6327	58	139	MW2_CDS_11815	MW2241	FALSE	unmapped	TTCTATTGGAGGAGCAGCTACAGATTTGCATGACCATTTAATTAAAGCGATTGGTTCGGA
6328	58	137	agr_tiling 038_F		FALSE	unmapped	AATTTTTATCTTAATTAAGGAAGGAGTGATTTCAATGGCACAAGATATCATTTCAACAAT
6329	58	135	MW2_CDS_09878	MW1853	FALSE	unmapped	AAAGAAGCCGGTATTGTTCTTACAGATTTCCAAAAAGGAAATGAAAAAGCGCGTGAACGT
6330	58	133	(-)3xSLv1		neg		
6331	58	131	MW2_CDS_05379	MW0997	FALSE	unmapped	CAGATAAGAGTAATCCAAGTCATATCGGTGCGCAAATGCCAGGTTCAGTAACTGAAGTCA
6332	58	129	MW2_CDS_08489	MW1598	FALSE	unmapped	TGCAATTGGGCTTCTTATTCCAATGCATATAGGTAAGTTTGAACTTGTATTTGTACCACA
6333	58	127	MW2_CDS_00293	MW0056	FALSE	unmapped	CAAGCTATTGAGCAAAATATCAAATTAATCGCTTGTACGATGAGTATGGATGTCATGGGT
6334	58	125	MW2_CDS_05103	MW0944	FALSE	unmapped	ACGAAAAACCACCGAAGAGTGAGAAAGATCCAATGGTTGTATATGCAGTAAGTGCAGGAT
6335	58	123	MW2_CDS_08741	MW1643	FALSE	unmapped	GATCGTGTGCAAATTGCGCGTTTGCAAGAAAGACCTACGACCCTAGATTATATTCCATAT
6336	58	121	MW2_CDS_05202	MW0962	FALSE	unmapped	TGCATTATTTGTATCTGGTGATTGGAAATTATCACAGACACAATATGTTATTGAATGGGT
6337	58	119	MW2_CDS_05554	MW1030	FALSE	unmapped	GCATTTTTGGTCGTTCATTTATTAGTGAATCACCAAGCAACACAAGGTGCTGAAGCGTTT
6338	58	117	MW2_CDS_10331	MW1950	FALSE	unmapped	TGTTGACAGATTAGCGACCGATAAAGAGTTTTATATTTTTGACTCCCTTATACAAGGACT
6339	58	115	ETG10_236652		pos		
6340	58	113	MW2_CDS_03888	MW0710	FALSE	unmapped	TCATTGCTCATATCAAACCTGTTCAAAATGAAGATGAAGCTAAAGCATTTATTGCTGCAA
6341	58	111	MW2_CDS_00050	MW0009	FALSE	unmapped	TTGAACAACCTGAAGATTCATGGAATGCTTTAGAAGAAATGACAACAAACGCAGAAGCAA
6342	58	109	MW2_CDS_07985	MW1505	FALSE	unmapped	ATTTAGACAGTGTACCAGCTAACATCCAAACTGCTGTACGTAATAATGGCGGTGGACATT
6343	58	107	NA		ignore		
6344	58	105	MW2_CDS_01611	MW0294	FALSE	unmapped	TATAAGACAAAATGGTTATAGCGATGCCTTTTCAACGATTAACTCCTTAACCCATGCGAT
6345	58	103	MW2_CDS_04236	MW0778	FALSE	unmapped	TGACATTATGTCTCAAACAAAGAATAATGCATTAGTCGTGAGTCATGGAACAATAATGGG
6346	58	101	MW2_CDS_07823	MW1474	FALSE	unmapped	GGAGCATTATTAACTTTTGCGGTTATGAGTGCAGCAGATATCGCTAATGTCGATGATGCA
6347	58	99	MW2_CDS_00425	MW0080	FALSE	unmapped	AGCTTAAACGCAGCAATCCCTGTGTTACTAGGCGATAATATTGGTACAACGATTACAGCT
6348	58	97	MW2_CDS_05248	MW0972	FALSE	unmapped	GTTAAAAGCACATGGTGAGACTGGTGTTGAATGCGGCGTTGAAGAAGATAATGTCTTCAT
6349	58	95	MW2_CDS_13378	MW2532	FALSE	unmapped	TGCGTATTGTACAAGAAGAGGTTTTCGGACCTGTCGTTACTGTAGAAGGCTTTGAAACTG
6350	58	93	MW2_CDS_06072	MW1129	FALSE	unmapped	GTTCCAGCACCATTTGCTGCAGACTCAATTTTAGAAGCAGCTGATGCAGACTTAGATATG
6351	58	91	MW2_CDS_09963	MW1869	FALSE	unmapped	AAGAACAAAAGTTGGCAATGATTTCTCATCGGTAAAGTATATTGATAGAGATAACCATTT
6352	58	89	MW2_CDS_05348	MW0990	FALSE	unmapped	CAAGGGCATATGGTAGTGCAGCGCTTGAAATCGTTTCAGTTGCTACAGGTAATTTAGAAG
6353	58	87	(+)E1A_r60_a20		pos		
6354	58	85	MW2_CDS_05912	MW1100	FALSE	unmapped	GTGCCAACCTGACGCGAGCATCATTAGATGATATTATTGAAAAGTTGCAAGACGAAGGTT
6355	58	83	MW2_CDS_01088	MW0200	FALSE	unmapped	CCAAATACAACAACGACAGGCTATCAACATATGCGCGCTATTTATAGCATGCATCATCGA
6356	58	81	agr_tiling 092_R		FALSE	unmapped	TTTGTAATTGTTCAAGTTTCATTAATGTTCTTTATATCTGCATTTATTAGTGGAATAAGA
6357	58	79	MW2_CDS_09464	MW1777	FALSE	unmapped	ATGACAGTTAAAGTAGAACAGCTTACAGGTGGATATGGAAAACGCCCTGTAATTAAAGAT
6358	58	77	psma_tiling_032_F		FALSE	unmapped	ACTTAAAATTCTCAGGCCACTATACCAATAGGGATGGTGGCTTTGCTTTGTGTTGATTTA
6359	58	75	MW2_CDS_01147	MW0211	FALSE	unmapped	TCACAATCACTCGAGCAAGAAGTCTATTTTGTTACTGAGCGTGCAGTATTCGAACTCACC
6360	58	73	MW2_CDS_08899	MW1670	FALSE	unmapped	TTAAAACAACAAAAAGAACAACCAAAACGTCAAAGCCGATCAGAACGTCAATCACCTGGC
6361	58	71	pMW2_064		FALSE	unmapped	TGATTGACAATCATTCGGATAAAATAAACGTGTTTATTCCTCCAAGGTTACAATATCAAA
6362	58	69	MW2_CDS_04074	MW0743	FALSE	unmapped	ATTGAAGCGGGAATCGTATTACAAGGTACAGAAATAAAATCGATTCGCCGAGGTAGTGCT
6363	58	67	MW2_CDS_00562	MW0105	FALSE	unmapped	ACATTAGGTTTTGGTGTTGGCTTAGTGGATTATGTACATATTGGCTCGCAAATTAATGGT
6364	58	65	MW2_CDS_07927	MW1493	FALSE	unmapped	TGCAAATTAGAAAGCAGTCAGCATTTACTATGATTGAGATGCTTGTGGTAATGATGTTAA
6365	58	63	MW2_CDS_00461	MW0087	FALSE	unmapped	ACATCAACATCTTGATGACAAGTGACGACATTGCAATCGGCCTCGGTCAAAACATAAAAT
6366	58	61	MW2_CDS_12874	MW2437	FALSE	unmapped	GTCAACCATTCATCAAAGTTTCAACTTACCGTATTGGCTGAGCGCACTCATATTAGTCGC
6367	58	59	perR_tiling_078_F		FALSE	unmapped	GCGACTTGGCTGATTTAGATATATTAGTTGGTTATGATGGCGGTATCAATGAGGCATTTT
6368	58	57	MW2_CDS_08340	MW1569	FALSE	unmapped	ACAGCAACTAATGATACAGGAGCTTCACAAACGACAATAGATGATCAAGTAGAAGCGCCA
6369	58	55	MW2_CDS_09445	MW1774	FALSE	unmapped	CGATTGATGTATTAGGCCTAGATTGGAGAACGTCTATTAATCAGGCTCAACAATTAGGCG
6370	58	53	MW2_CDS_02101	MW0388	FALSE	unmapped	TGGAGAAAAGCAAGAAATTGATTTAGGTGATAAATTGCAATTCGAGCACATGGGCGATGT
6371	58	51	MW2_CDS_06344	MW1178	FALSE	unmapped	AACGTATGACGGTTTAGCTTTAGCGCAGGCAATGATAGAGTATGTAGCTGAAACATCACA
6372	58	49	MW2_CDS_07186	MW1343	FALSE	unmapped	TGATACAACGTGAATTGCTAGAATTACAAGTTCAAAAAGATGAAGAAGGTAGATTTACCG
6373	58	47	MW2_CDS_01870	MW0342	FALSE	unmapped	TACGTTCACGAATGCTCAAGGGGAGCGCGAAGCAGATTTTATTAACTGTGTTGTTTTTAG
6374	58	45	MW2_CDS_10281	MW1941	FALSE	unmapped	ACGTATGGTTATAAAACAGGTGGAGATTTTTCGATTAATCGTGGAGGGTTAACTGGAAAT
6375	58	43	psma_tiling_009_F		FALSE	unmapped	ACTAAGACATATACATGTCCTAGCCCTATGGATAAAATGCAAATTTCTGCTTTATCAAAA
6376	58	41	MW2_CDS_05289	MW0979	FALSE	unmapped	ACCATCCTTGAAGGTGCTAAAGATATCTTAGGTGGCTTCGAAAAACAAATGACACAACCT
6377	58	39	NA		ignore		
6378	58	37	MW2_CDS_10027	MW1884	FALSE	unmapped	AAATATCAACTTCAAAAGATTTATAATGAAATTGACGAAGCACTAAAAAGTAAATATTAA
6379	58	35	pMW2_021		FALSE	unmapped	ACAAAAGGGAATTTTAGGCTGATTCATCGTTTATTTGCGCAGATAGACAGAATTATGGAT
6380	58	33	MW2_CDS_06486	MW1210	FALSE	unmapped	TGAAAATACAGTCACATTAATTGCAGTAATTATCGCAATTATCATTGGTATTTTCCTACA
6381	58	31	MW2_CDS_09270	MW1739	FALSE	unmapped	GCCCTAAATACAACCCAGGTATGAGTGATCATGATGAAACAGATGGTGAGTCAGAAGACA
6382	58	29	MW2_CDS_11823	MW2242	FALSE	unmapped	TGCAAATGAATGGTTGGAAGTATCTTTCTTGAGTATGTTGTGGTCAGTTGTTCAAGTTGT
6383	58	27	NC_A_087		FALSE	unmapped	TCTAACCTTTATTTAAATAATATATAAGCAGCAAACGCCAAGGCTAATATACCAATAAAA
6384	58	25	MW2_CDS_00139	MW0025	FALSE	unmapped	ACAAAAACATCCTATGATAGCTTGGTCAATAGCATAGACGAAATACAGGAAGACAGCGAA
6385	58	23	MW2_CDS_06081	MW1131	FALSE	unmapped	AACAGGCGTCTTTAGTAATGAGGCGGATGATTTTGGTGTTCAACAATTTAAAAAGGGTTT
6386	58	21	MW2_CDS_07951	MW1498	FALSE	unmapped	ACCTTTTGATAAAGGTTTAAGTAGAGTTTGTACAAATATCCGTATTGATGACCGACGAGA
6387	58	19	MW2_CDS_11678	MW2212	FALSE	unmapped	TGATATTTTAACTCCTGGTTATTCAAAAACTGGCGAAGCCTTCAAGTATCAATATATGCA
6388	58	17	MW2_CDS_11146	MW2106	FALSE	unmapped	TCGCTATGACGATGTGTGCCATTGGTGGTATTATTGCAACGCTAGTTTTACCTAGAGTAC
6389	58	15	MW2_CDS_13928	MW2629	FALSE	unmapped	TCAGGGATGATTAAAGGAACCGGGCCACGTTATTGCCCTTCAATTGAAGATAAATTTGTT
6390	58	13	MW2_CDS_01828	MW0333	FALSE	unmapped	ACTCGTACATATTACATGTCGAGACCGAAACTTAATCGGCTTGCAGTCCCATTTACTTGG
6391	58	11	MW2_CDS_10796	MW2039	FALSE	unmapped	ACATCATTTAGCTGAAACGACCTTATCGCAACAATTTACTGAAGCAGATTTGAAAGCAGA
6392	58	9	MW2_CDS_05664	MW1052	FALSE	unmapped	GGGGAGTTATGACGCAAGGTTGGTGGTTCCCAGTTATGGCTTCAGCATTTTTAATATTTA
6393	58	7	MW2_CDS_06557	MW1224	FALSE	unmapped	GAATTAGAAAATGCTGGTGCTGATGCTACCAAAGTCGGTATAGGTCCTGGTAGAGTTTGT
6394	58	5	MW2_CDS_00368	MW0070	FALSE	unmapped	TTTCTTGAGTGTAGCGTCTGGAGGCAGCGCATTTAATAGTACTTATAACTATGCATCACA
6395	58	3	MW2_CDS_01716	MW0313	FALSE	unmapped	GCCTTTGCAAATATATTTGTTTATTTCGTGCGTTATGGTGTACTTGATTGGGCGCCAGTC
6396	58	1	MW2_CDS_10487	MW1980	FALSE	unmapped	TCAAATACTGCTGAATTTGGTGACTATGTTTCAGGACCACGTGTTATCACACCAGATGTT
6397	57	164	MW2_CDS_10449	MW1973	FALSE	unmapped	AGGATCATTTATCATTTGAAGTCATTGGTGAAACACGAGATGACGCAGTAGGTGAGGCTT
6398	57	162	MW2_CDS_12328	MW2334	FALSE	unmapped	TCTGTTGAACAAGGTGAGGTTGTAACCTTAATCGGTCGATCTGGTTCAGGTAAAACAACA
6399	57	160	MW2_CDS_06375	MW1184	FALSE	unmapped	GTAATACAAAAGGTCTGGCAATTTCAGGTGGCGATGTAGGTGGTAGCAAGAACTTTGATG
6400	57	158	MW2_CDS_00935	MW0172	FALSE	unmapped	TCATAGCGATTATGGGACCATCAGGCTCAGGGAAGAGCACACTGATTAATATCTTAGGAT
6401	57	156	MW2_CDS_08827	MW1658	FALSE	unmapped	CGTGGCGTAACAATTGAAGCGATTCATTTCCATAGTCCACCATTTACAAGTGATCAAGCA
6402	57	154	MW2_CDS_07282	MW1360	FALSE	unmapped	AGGACCAACAGGTGAAGTTACTGGTATTGACTTTAGTGAGAATATGTTAGAAGTAGGAAA
6403	57	152	MW2_CDS_07808	MW1471	FALSE	unmapped	AGAAGGTGTTGTGGCTGTTGATCATATGTTTGAGGGGAACCCAATCCCAGTAAACTATAA
6404	57	150	MW2_CDS_00236	MW0045	FALSE	unmapped	TATTGAAAGTATTAAAGACTTGCCAGACTACATTCAAATTTGGCCTGGTCATGGCGCTGG
6405	57	148	MW2_CDS_04706	MW0869	FALSE	unmapped	CAATTATATTGGCTATGTCTATCACAGGCTGGTTAGGCATGAGCAGAGTTGTACGTGGAG
6406	57	146	MW2_CDS_00668	MW0125	FALSE	unmapped	TGGACTATCAAGCTTAATCATTGGTCGAACGACTATGTCAGAAGCAATTACGTCGACAGA
6407	57	144	MW2_CDS_09290	MW1743	FALSE	unmapped	TGGATAGATTAAAATATTCACTTAAAGTTGGAATTTTAGCATTATTATTATTTTGTACTT
6408	57	142	MW2_CDS_06311	MW1171	FALSE	unmapped	TCTGCAAGGAAGAGCGTTTATGCCAGATATTGATGATCCTTTTAAAAAGGCAGATCAATT
6409	57	140	MW2_CDS_13253	MW2508	FALSE	unmapped	GGCGGAATTAGAAAAGCATCAAAGTAAACCGTCTTTATTACATGGTGACCTATGGGGTGG
6410	57	138	NC_S_110		FALSE	unmapped	AAATCCCGCCGTCTCCATTATAAAGCCTGCAACCCATGTGGTTGTAGGCTTTTTGTTTTT
6411	57	136	MW2_CDS_10402	MW1965	FALSE	unmapped	GGTTTATTGCCGACAAATGTTGAAGGTACGACGCGTAGTACGATATTAGACACGCCATTA
6412	57	134	MW2_CDS_05430	MW1006	FALSE	unmapped	AGACTATCAACCGTTTAATATGATTAAACGTTACCATTATGGGTTGACAGACACATTGTT
6413	57	132	MW2_CDS_01705	MW0311	FALSE	unmapped	TCACAGGTGTCATATGGTCATTATTAATTGCTGAGTCACTTTGTGCTTTGGCAGCAATGT
6414	57	130	MW2_CDS_12595	MW2383	FALSE	unmapped	CAAGATGGTGTTGGCTTACCGCTATTTACAGCTCTACCTATTGTGTCTGGCATGTTAGAA
6415	57	128	MW2_CDS_09965	MW1869	FALSE	unmapped	AATGAGAAGTTTGATAAAAAAGGCTATGAAGTAAATAAAAAAATTAAGTTTGATCGTTTT
6416	57	126	MW2_CDS_05677	MW1055	FALSE	unmapped	AGACAGTGATTTGAGCAGTTTACATATATCGAAACAAACAGGAGTTCCACAAAGCACAAT
6417	57	124	MW2_CDS_04223	MW0774	FALSE	unmapped	TGTCTTTACATTTTGCAATTCTGTTTTGGCTAGCATTAATTTTCTTAGTTGCCGCTACGT
6418	57	122	MW2_CDS_01031	MW0190	FALSE	unmapped	AAAGCAGGACAATTTGTCACTGGACCGTGGAACATTAATGAATATCAAGAAACGTTTGGT
6419	57	120	MW2_CDS_03234	MW0595	FALSE	unmapped	TTCAGAATTAAGTGGTGGACAATTACAACGTGTGCTAGTAGCAAGAGCATTGATGTCCGA
6420	57	118	MW2_CDS_01599	MW0292	FALSE	unmapped	TACGTCATCGTGGCATTGATGCAGGATTACCGAAAAGACCTTTCAAACCTTTTAACGAAG
6421	57	116	MW2_CDS_03372	MW0619	FALSE	unmapped	AATACGACACCATTTCAACGCATTAAACATGTTGCTAAAATTGATTTAGGTGTAAAGAAA
6422	57	114	MW2_CDS_07226	MW1350	FALSE	unmapped	AGATCAACTAGTGGTAAAACGGGTCGTGAAGTTGCATTAGAAATTTTACATGCAAACGGT
6423	57	112	agr_tiling 149_R		FALSE	unmapped	GGTCGTGGTTTAGGTCTATCAACTTTAAAAGAAATTGCTGATAATGCAGACAATGTCTTA
6424	57	110	MW2_CDS_02865	MW0527	FALSE	unmapped	TCGGCTATTGGATTAAATCACTTGATTACCGAAGCTGTTGGATCCGATCAAGTAAGTGCA
6425	57	108	MW2_CDS_08448	MW1589	FALSE	unmapped	TCAAGAGCGTATATACGTCATTTAATCAAGGCAGAGGAAACTTTTGGTATTCGTCTTACT
6426	57	106	agr_tiling 107_F		FALSE	unmapped	AATGTAGGCAAGTGCATAAGAAATTGATACATACACTACCAAAAAGATTGGTAGAACTAT
6427	57	104	MW2_CDS_02301	MW0425	FALSE	unmapped	TCTACATTGGCTATGATGAGAGTGACGTATCCCACATGTTACTACCACTTATCCAAACGT
6428	57	102	MW2_CDS_07711	MW1454	FALSE	unmapped	ATTGGTACAAAAGTAGGCAATCGTTTAACAAAAGATGGCAGTACAAAATGGGATCCGAGT
6429	57	100	MW2_CDS_12073	MW2286	FALSE	unmapped	CGATGCTATCGTGATGAATTCAAAGGATGGGAACCAAAGATTAAAGAAATGGTGCCGTCA
6430	57	98	MW2_CDS_01429	MW0262	FALSE	unmapped	AGCACTGGTTATCTGTGCATTCAATGAGAAACAATCATTTGATGCTTTAGTTGAAGGAAA
6431	57	96	MW2_CDS_10974	MW2072	FALSE	unmapped	TGAAATGCTGATGGTTGTATTAACAATCATTGGTTTAGTATTGATTAGTACTCAAGACCA
6432	57	94	MW2_CDS_09564	MW1797	FALSE	unmapped	GTTGGTCGTAATGGCTTTGTCATCAATCCTAAACTAGGAACATGGACATACCTCGGTGAA
6433	57	92	MW2_CDS_08347	MW1570	FALSE	unmapped	TTAAGCTGGCATTGCCGTATTTAATGACTGCTGCGGAACTAGATAAAGACAAAGATGCAG
6434	57	90	MW2_CDS_08131	MW1530	FALSE	unmapped	TCATTGTGAAACGTTAATTGAAGCTGTTCCAGGTAACTTATTGAAAGACGAAACAGAAAA
6435	57	88	MW2_CDS_04117	MW0754	FALSE	unmapped	AACACAGAACATCATGATAAGCTCATCAAAGAGTTGGCACAGATGGGATTAGGTGGACTT
6436	57	86	MW2_CDS_07899	MW1488	FALSE	unmapped	GCAGTGGATGATGAAACAGCAGCTGTTGCAGTACAATATCCAAACTTCTACGGTTCAATT
6437	57	84	MW2_CDS_08793	MW1652	FALSE	unmapped	GCGTACTTCGACGTTAGCTTTAAATAATGCTACGCTACCTTATGCGCTCATGCTAGCTAA
6438	57	82	MW2_CDS_11266	MW2129	FALSE	unmapped	TGACTGGATACTCTATTACAAACAAAAATACGTCGACTTCTAATGAATCCGGCGTGCGCT
6439	57	80	MW2_CDS_00441	MW0083	FALSE	unmapped	TTGTCTTTGCTTGGAGTCCGTTCGTCATTTTAACTGCCTTTGTTTTAGTATGGAGTGCAC
6440	57	78	MW2_CDS_10893	MW2056	FALSE	unmapped	TGCAGATTTACAAAAAGCGATAACGCGTATTAAAGAGGCAACTGCTGAAACGAATTCGCT
6441	57	76	MW2_CDS_11713	MW2220	FALSE	unmapped	AGACATATTGAAACAAAACCACAACTAGCGGAAGCTAATACGTTGACGTATGGTACGCGT
6442	57	74	MW2_CDS_05285	MW0979	FALSE	unmapped	CGCATTAACAATCCATGCACATCCAACATTAGGTGAGATGACTATGGAAGCAGCAGAAAA
6443	57	72	MW2_CDS_03010	MW0554	FALSE	unmapped	TGTTGATTGGAGGCATGTCAATATTAGCTTTAAGCATGTTGCTGACATTAGAAAACCAGA
6444	57	70	MW2_CDS_12623	MW2388	FALSE	unmapped	AGCGTTAGCTTTGAAACCAAAGTTAATCATTGCTGATGAGCCGACAACGGCTTTAGATAC
6445	57	68	MW2_CDS_06424	MW1193	FALSE	unmapped	AAAAGAAGCTAAATTTAAAACGATAATCAAGTTATATGAATATCAAAGAACATTAGAAAA
6446	57	66	MW2_CDS_01422	MW0261	FALSE	unmapped	ACGAAAGGTCAATTACTTGTTGAAAATGATCGACTCATTGATTATCAAATCGCTGATGGA
6447	57	64	MW2_CDS_05943	MW1105	FALSE	unmapped	ATTGAAGTTGATGGAGGCGTAAATACCGATACAGCGAAAGTTTGTGTTGAAAATGGTGCT
6448	57	62	MW2_CDS_03159	MW0580	FALSE	unmapped	ACTACAAACAACCACAAGTTGTTAAAGCAGTTAAAATTTTATCTCAAGAAGATTACTTCG
6449	57	60	(+)E1A_r60_a22		pos		
6450	57	58	MW2_CDS_10615	MW2003	FALSE	unmapped	AGGTTTACCAGATAAAGATGGATTATGTTTGATTTCAGAAATCAGGCAACATACTGACAT
6451	57	56	MW2_CDS_00922	MW0170	FALSE	unmapped	CTTACAGTCATGCTAATTGGTACGTCGAAACTTTCTATACGAGCATCCACTATTTGGGGT
6452	57	54	MW2_CDS_08712	MW1639	FALSE	unmapped	TCATCATTGTCAGATATGTACTCAGGTATTGTAGCAGCTGTAGGTTCTCTGAAAGGGCCA
6453	57	52	MW2_CDS_01952	MW0359	FALSE	unmapped	CCATTGAATGTACAAACACAAACAAGACGTCTAGGCGTGCCAGAAGGTATTGCCAATTTC
6454	57	50	MW2_CDS_11217	MW2119	FALSE	unmapped	ACCAGCCACTTGATGAAAGTTTAGAAAGTTTGAAACAGGCAGTGTCACAACCCTTATTCG
6455	57	48	MW2_CDS_06066	MW1128	FALSE	unmapped	TGCAGGCGGAAGCGCTACTAGAGAAAAAGTAACTGAAGCATTTAAAATCATTTTAGGTGA
6456	57	46	MW2_CDS_10307	MW1945	FALSE	unmapped	AGGCAAGTTGACTAATAATGAAGATAAAGCTAAAAAATGGATTGAAGAGTGGGACGATAA
6457	57	44	DCP_20_1		pos		
6458	57	42	MW2_CDS_09679	MW1817	FALSE	unmapped	TGATATGAAATGTAGCAGACACGAGATTCACCCTATGTATCCAGCTGACTTTGCAAGTCA
6459	57	40	MW2_CDS_07187	MW1344	FALSE	unmapped	GCAGCAATGGCACACGGAAAAGTATTTTCATTTGGTCCAACTTTCAGAGCTGAAAAATCA
6460	57	38	MW2_CDS_06336	MW1176	FALSE	unmapped	TTTGGATACTATCAAAACATATCAACAAATTGAAGCACAGATTCATCAGAACCAAACGAT
6461	57	36	(+)E1A_r60_a135		pos		
6462	57	34	MW2_CDS_11907	MW2256	FALSE	unmapped	ACGTAAAATTGAATCATACGCTGATATAAAAGTAGAACGTCGTGTAAACGAAGATGTCGC
6463	57	32	MW2_CDS_11286	MW2132	FALSE	unmapped	GAGCGCATATTGATGAAGAAACTGGTATTAAAGCGACGCATGAAGAAGGCATCTTACACC
6464	57	30	MW2_CDS_09261	MW1738	FALSE	unmapped	TCCTGATAGCACTGCTCAAGGTAAAATTGTTTTCGATGTGTCAGAAAACATAGCCAACGC
6465	57	28	MW2_CDS_06651	MW1243	FALSE	unmapped	ATTTGGTGATAACGCACCTCAAGGTGTTGCAGTTACTCAATCAGCACTTAATGAGCATTT
6466	57	26	MW2_CDS_02875	MW0529	FALSE	unmapped	ATTCATTATATAATGTTAACAATATGTATTTTAAAGTTTACATTGAGTGAGGGATATTGA
6467	57	24	MW2_CDS_07384	MW1379	FALSE	unmapped	AACGTATGGCAGAAATATGGATGTTACTCATGCTACTAGAAGAACAACACACTATGGCAA
6468	57	22	MW2_CDS_09858	MW1850	FALSE	unmapped	GGGCATGCCATGGCAGTTGTTGGGAACGCTAAATTAGATAATGGACAAGAGGTTATAATT
6469	57	20	MW2_CDS_01507	MW0276	FALSE	unmapped	AGTCAAATGTACAACGAGATTGCGAATAAGATTAGCAGTATGATACCGGTAGAGTGGGAA
6470	57	18	MW2_CDS_02225	MW0411	FALSE	unmapped	TCAGTGCAACGGGTGTGTCTTTAGGTGGATTAATGACATTAAAATTGGCGCAACACTATC
6471	57	16	MW2_CDS_12390	MW2346	FALSE	unmapped	CTCCAACATTTAACACAAGAATGTGGTGTCACTGAACAAGCGCTAAATCAAGGGATGACA
6472	57	14	MW2_CDS_07570	MW1425	FALSE	unmapped	AGAGGCAAGAGTCATAGCATGGTATGCAAAAGAACAATGGCGTTTAGATGTGTTCAACAC
6473	57	12	MW2_CDS_00117	MW0021	FALSE	unmapped	TGGGAAATTAAAGTGAAGCATGACGGTAAGGACAAAACGAATACTTACTATGTCGAAGCG
6474	57	10	MW2_CDS_00458	MW0087	FALSE	unmapped	CATTGTTGCTCGTATAATAATTAAGCCACTAGAGTTGCCTATCGGTGTCGTTACCGCTGT
6475	57	8	MW2_CDS_06385	MW1185	FALSE	unmapped	CGAGGACATGGTATTAATATTGATGAATCAACAAGAGGGCATTACGATGATATGAAACGA
6476	57	6	agr_tiling 109_R		FALSE	unmapped	CTTATGCACTTGCCTACATTTTAAATAGAATATTAAAAAGGATAAATGGTACATACCTTT
6477	57	4	MW2_CDS_06813	MW1272	FALSE	unmapped	AGAAACATTGAAAAAAGGTGGTAGTGTATCACCTGTCGAACTTGCAAACATTGCAGGTGT
6478	57	2	MW2_CDS_02220	MW0410	FALSE	unmapped	ACAGAGGCATTTAGCGGTTTGGTTTGTGACATATTTGGTTTCAGGTGTCATCATGAACAA
6479	57	163	MW2_CDS_00514	MW0096	FALSE	unmapped	ATATGGCAGGACGCCCAACACAATTTGGTATTTCTGAAGACGAAGTTGATGATGTCATTG
6480	57	161	MW2_CDS_08393	MW1580	FALSE	unmapped	GTGGGTTAAAGTTGTGGAAGATGGTTTGACAGGTCCAATTGGACGTTTCTTTGAAACAGA
6481	57	159	MW2_CDS_04394	MW0809	FALSE	unmapped	TGACAACGAAGAGAGTCAAGTTCAGTTTGTTGGTTTTGTTGGCGAGCATAGTCGATATGA
6482	57	157	MW2_CDS_07013	MW1310	FALSE	unmapped	AGCTTTAGAAAATCAAGTTAAAGCTTTCCAACAAGCGAATAAACTCGAGGTAACTGGTGA
6483	57	155	MW2_CDS_02193	MW0404	FALSE	unmapped	AACCAGATATGACCTTAAGAATGCCAGATATAAGTACTACAGTAGAAACACTTAATCTCA
6484	57	153	MW2_CDS_08245	MW1551	FALSE	unmapped	ACATATGTCGCTACACTCTAATTCTAGGATTTATACTTATGTCCTTACCTGATGTTGTTG
6485	57	151	MW2_CDS_11199	MW2115	FALSE	unmapped	CATGCAAGAGCAGTGAAATTATTCAAGGATGGCGGCTATCAAGGAGAAATTGGTGTTGTA
6486	57	149	MW2_CDS_03063	MW0563	FALSE	unmapped	TCAAGCAGTTGCAGCATTACAAGAGCTTAAGGAACAAGGGAAGATTAAAGCAATTGGTGT
6487	57	147	MW2_CDS_06002	MW1116	FALSE	unmapped	GCCAGAAGGGAATTTAACAAAAATGCGTGCCACTATTGTATGTGAGCCCTCACTTGTAAT
6488	57	145	MW2_CDS_13033	MW2466	FALSE	unmapped	AGAGCTACTAAATGTAGAGTCAGCACAAGAATTAGGTCATGTAGTTGCTGCCGTTGGTTT
6489	57	143	MW2_CDS_06708	MW1254	FALSE	unmapped	TTTATCGCCAATGACAGTTATTGCGAATTTATTACCAACAGGTACCGTTTCAGGTGCACC
6490	57	141	MW2_CDS_03232	MW0594	FALSE	unmapped	TTTCTATCGTCCATTAATGATTTCTACATTCGATCCAACGTTTAGTAGAATGAGTGGTCT
6491	57	139	MW2_CDS_07744	MW1460	FALSE	unmapped	ACACCCTATCCATACAGATTAGAAGAGACAGATGATATTTCATTGGTTGGATATGCACGA
6492	57	137	MW2_CDS_11339	MW2144	FALSE	unmapped	AAGTAACAGTTAAAGGACCTGGTCCAGGTCGTGAATCAGCTATTCGTGCATTACAATCTG
6493	57	135	MW2_CDS_03425	MW0628	FALSE	unmapped	ACAAATCATTCATATTATCATCAAAACCAGCATGCTCAATCAATAAGTAAAGTGTGGCTT
6494	57	133	MW2_CDS_09490	MW1783	FALSE	unmapped	CCAGCTGCTAGTTCTCATCATCATAACTTTGCGAGTGGCTTAAGCTATCATGTATTGACG
6495	57	131	MW2_CDS_03092	MW0568	FALSE	unmapped	AGGTTCACTTGTTGGTACAAGACAAGACTTACGTGAAGCGTTTGAATTTGCTGCTGAAAA
6496	57	129	psma_tiling_010_R		FALSE	unmapped	GCATTTTATCCATAGGGCTAGGACATGTATATGTCTTAGTCCTTTTTATGTTTGCTTTGA
6497	57	127	MW2_CDS_12686	MW2399	FALSE	unmapped	AAGAACAACAGGAGCGTATTACACTCTATCTCAAGCATAATACCAAAGAACCAAACACGA
6498	57	125	MW2_CDS_11200	MW2115	FALSE	unmapped	TTCAATGAAATTGGACCTATTGGTGATGGCCAATATTTAGTAGGTAAATTCCCTCCAGGT
6499	57	123	MW2_CDS_12979	MW2456	FALSE	unmapped	ATGCTAAAGTCATCATGCCAGTATATCCGAAGATTCCGCATCAAGATTATCAAGCGACGT
6500	57	121	MW2_CDS_09868	MW1852	FALSE	unmapped	ATGAACTTCGAAATTTAGGATATGGCGTTACGCACTATGCTGCGTTTGGTAGAGATGGTA
6501	57	119	MW2_CDS_00728	MW0135	FALSE	unmapped	AGTAAGGAATTGCACGAGATGGGTGAGCGCGCACATCAACTGTTTAAAGATAAATATACG
6502	57	117	MW2_CDS_10865	MW2051	FALSE	unmapped	AGCTGCTGGAGAAATGAAAACGAAGCCAACACAACATAGTGTTAAAGAATTACGAGGCTT
6503	57	115	MW2_CDS_05650	MW1050	FALSE	unmapped	TTCAGGCGTACCAGTGTGGAATGGTTTAACTGATGAAGATCATCCTACTCAAGTTCTTGC
6504	57	113	MW2_CDS_10404	MW1965	FALSE	unmapped	CTAATTGGATGGATGGGGTTACCGGAAATCGAATATCCTACTGATAATGAAGGATGGGCC
6505	57	111	MW2_CDS_05170	MW0956	FALSE	unmapped	TGCGTATGAAGCGGATAGTCAATCAATATTTGGTGGAATTGTTGCATTAAACCGAGCTGT
6506	57	109	MW2_CDS_07757	MW1462	FALSE	unmapped	TGAAGTTTCAAAAGATAGAATTCAAGGATTTGAAACGGTTGCATCACAATTTAATCTGGA
6507	57	107	MW2_CDS_02474	MW0457	FALSE	unmapped	AGGTAATATAGGTAAACGTTTTGAACTTACAAGACATAATATCGGCTTTGAAGTCGTTGA
6508	57	105	MW2_CDS_08123	MW1529	FALSE	unmapped	ACGAGGCAAAAGTTGCCAAAAAGATAGAGCGTTGGCAAAAAATAATTAAAGAAGCTGCTG
6509	57	103	MW2_CDS_09577	MW1799	FALSE	unmapped	ACAAGTGGTTCAAGGTATTTCATTTGACCCATTCACACCATTAATAGTGGCAGCAGCATT
6510	57	101	NC_A_040		FALSE	unmapped	GTCTCATAGTAAACGGCTACTACATTCGCATGTACTTCGTTTTACTGTCCACGCATGGTC
6511	57	99	MW2_CDS_01187	MW0218	FALSE	unmapped	GATTGTTAGGTCCACTCGGTTTACACCATATTTTTTACTTACCGTTTTGGCAGACGGCAC
6512	57	97	MW2_CDS_00867	MW0160	FALSE	unmapped	ACGGCATTTTCAGAAACATTCGAACACCTTTTCCCTAAAATGAATTACCTAGCGATTGCA
6513	57	95	MW2_CDS_01956	MW0359	FALSE	unmapped	ATTTCACTGGACAACGTGCAACTTCCACGATTGCTGTCGTGATATTTGCTTCGTTTATAG
6514	57	93	MW2_CDS_07669	MW1447	FALSE	unmapped	AACCAACTCAAGTGATAACAAGTGTATCAGATGATAGAGGACGTACAGTGGTTACGGATT
6515	57	91	MW2_CDS_00243	MW0046	FALSE	unmapped	AAAAGTAAATCCACAAAAAGATTTAGTCCCACTATGTTCTAATTGCCATAAAATGATTCA
6516	57	89	MW2_CDS_06684	MW1249	FALSE	unmapped	ACAAACATTCCTGATTCAGGGATTTTCCAAACAGGTTTGAGTTTTGGTATCCGAGGTGAA
6517	57	87	MW2_CDS_03227	MW0594	FALSE	unmapped	CGCAGTATTACCTGGTGTTGCCCTATCATTCTTATTTGGTATTCCAATGTTTGTAGGCGC
6518	57	85	MW2_CDS_05261	MW0975	FALSE	unmapped	TGGAAAAACAATCGCAGTAGTATTAGCATCTAGTGTCTTGCTTGCAGGATGTACTACGGA
6519	57	83	MW2_CDS_00631	MW0117	FALSE	unmapped	AGATGCTGCGGCTGTATTTAACGATGCACGTAATACTGTGAAAAAAGACCAACCAAATGT
6520	57	81	MW2_CDS_01743	MW0317	FALSE	unmapped	CTGCCGCTATTGCTGCAGTCGCTCCAATATTCAAATCACGTGAAAAGGATACAGCTATTA
6521	57	79	MW2_CDS_13900	MW2624	FALSE	unmapped	AGGGAACGAGATGGTTATTCACAAGAATATCTTGCTGAAAAGTTATATGTATCTAGGCAG
6522	57	77	MW2_CDS_04188	MW0766	FALSE	unmapped	TCTCATCTAACTGAACGTGAGAAGCGTGTAATTAAGCGTGAACACGTTAGAGAAGCTCAA
6523	57	75	MW2_CDS_08322	MW1565	FALSE	unmapped	ACCAATCGAAACTGATGAAGAATGGGACATGATTGAAGAAGTTGTAAATACTGAAATGGA
6524	57	73	MW2_CDS_10813	MW2042	FALSE	unmapped	TGGTGATGAGGCTGCGATTTTTGCTGGTGATTTAATGCGTATGTATTCAAAGTATGCTGA
6525	57	71	psma_tiling_051_R		FALSE	unmapped	ATACCCATGTGAAAGACCTCCTTTGTTTGTTATGAAATCTTATTTACCAGTGAATTGTTC
6526	57	69	psma_tiling_024_R		FALSE	unmapped	TGTCTCAGACCTCGAGTATCAAACATAAAACACGCCACAAAAATATAACGCGTCAGACTA
6527	57	67	MW2_CDS_12156	MW2300	FALSE	unmapped	ACAGTCTTACCAAATGATAAGGAATGCTTTAAAAACGGATTTATCACTTCATCAAGTTCA
6528	57	65	MW2_CDS_10094	MW1898	FALSE	unmapped	AAACAACTATCAGCCACAACCGAACCATCTGGACAGAAAGTAACTTATGCAGTGACTGAG
6529	57	63	MW2_CDS_00113	MW0020	FALSE	unmapped	TCGTACGACGCATGTTTTTGCACCAAGTAAACCTGAAAAGTTAAAAACATATCGCATGGT
6530	57	61	MW2_CDS_11701	MW2217	FALSE	unmapped	GATTCGCTACAATCGCAATTGCATCAGGAAATCAAGCTCATGCTTCTGAGCAAGATAACT
6531	57	59	MW2_CDS_06898	MW1287	FALSE	unmapped	AACGCTACCCGATACGTGCATTAATGATGAGCCATATGTTTGTTGAAGTAGATGGCAATG
6532	57	57	MW2_CDS_01506	MW0276	FALSE	unmapped	AGAAGAAATATTTGATGATTTATGGATGAATCTTTATTACTTGTTTATGAATTTGAGGGA
6533	57	55	MW2_CDS_12882	MW2438	FALSE	unmapped	GAGGACAAGTTTCAGAAAATGGGATGAACCGGTATTTCAAACGTCTTGGTGAAGGTGTTT
6534	57	53	MW2_CDS_04222	MW0774	FALSE	unmapped	TGAAAAAAACTGGCAAAGAATCTAAAAAAGAGTCCTATTTAAGTTTCACTGTCATTCTCT
6535	57	51	MW2_CDS_01674	MW0305	FALSE	unmapped	GGTTCAATGAAACGTGTACCGCAAATTCCATTGAATGTTGTTGATGTGAGAGACGTAGCT
6536	57	49	MW2_CDS_12731	MW2408	FALSE	unmapped	AGAAAATAAAGAAGAAAACATCTATTTTACGGATAGTATTAATTTCAAACCTACTAAATA
6537	57	47	MW2_CDS_12060	MW2284	FALSE	unmapped	AGAAAAACAGTTACCACAACATTTCATTCGCATTTCCAAATCAGAAATCGTCAACAAGTA
6538	57	45	MW2_CDS_00923	MW0170	FALSE	unmapped	AGTGGACTATCTGTGGACTATAAAAAGTTATTGAGTGAAGCAGGACTCTCAGAGACATCA
6539	57	43	MW2_CDS_12184	MW2306	FALSE	unmapped	AGAAAAGAAAGATTACGTTGTTCGAACACGTGAAGAGAAAGATGAAAGAAACCTACAAAT
6540	57	41	NC_A_078		FALSE	unmapped	GCTACTTCCCACAAACATGTTCCACGTATAATACGCTGAATTGTCTTCAAGAAAGTAGCT
6541	57	39	MW2_CDS_05338	MW0988	FALSE	unmapped	GGCGCAAGCGATTAAATTTGCTACGATAGATTCGAACATTCAGTTATCAATCGCATTTGT
6542	57	37	MW2_CDS_13576	MW2567	FALSE	unmapped	TCTTTGCCTAAAGCGGGGGAAACGATAAAAGAACATTGGTTGCCGATATCTGTAATTGTT
6543	57	35	MW2_CDS_01276	MW0234	FALSE	unmapped	TGGTGATGAGTAAATTACGACCATTGTTGCACTACGCGAGAGCGAAAGATATAGACAACT
6544	57	33	MW2_CDS_03222	MW0593	FALSE	unmapped	AACGGATTAAATTTAGAGACTGGTAACGGTTGGTTTGAAAAAGCCTTAGAACAGGCTGGT
6545	57	31	MW2_CDS_01552	MW0284	FALSE	unmapped	AGACTTTACAGATCCAAAAGAAGCTACAGCTGAATCTCGTGAAGCATTAATTGAAAAACA
6546	57	29	MW2_CDS_00419	MW0079	FALSE	unmapped	GGACGCCTGAAACGAAATCAGAAGTTACCAATACACATAAATTTGACGTTGCAGGGCTAA
6547	57	27	MW2_CDS_09535	MW1791	FALSE	unmapped	AGATAAATTCCATTCGAATAAACGACGTGTGTCTCCTACTGGACAGCGTGCAATTACACA
6548	57	25	psma_tiling_084_F		FALSE	unmapped	CATTGGCATAACTGGTGCTAAAAACAACAAGCCACTTATCAATGCAATGATAAGCGCAAT
6549	57	23	RC1		pos		
6550	57	21	psma_tiling_048_F		FALSE	unmapped	CATTGCAGGAATCATTAAATTCATTAAAGGATTAATTGAGAAATTCACTGGTAAGTAAGT
6551	57	19	MW2_CDS_02772	MW0511	FALSE	unmapped	AAGCTATTTAAACGCTATGACGATTGGATTAATAGCTTTAATGCATGTCCAGTTGTACGT
6552	57	17	MW2_CDS_11394	MW2157	FALSE	unmapped	CGTTGTGAACATGGGTGTAGGTGACGCAGTACAAAATTCTAAAGTATTAGACAATGCTGT
6553	57	15	perR_tiling_026_F		FALSE	unmapped	CGTTATTTAATTTCTTCACATACTCATCCAACAGCTGATGAAATTTATCAAGCACTTTCA
6554	57	13	MW2_CDS_13392	MW2534	FALSE	unmapped	GGTCATCACCGTTACTTATTTACTGGAGATTTTATATGTTTTGAAGGGAAGAGATGGCGT
6555	57	11	MW2_CDS_11520	MW2184	FALSE	unmapped	GCCATTCCTGTTGCTGTAATTATGCTTTTAATTGGCGTTACCTATGCGTCCATCCTAACT
6556	57	9	MW2_CDS_12768	MW2416	FALSE	unmapped	ACAAAACAACCAGTAGATAAGATTGTAGAGTTCGGTGGCGAGAAAATACCGCAAGGTCAT
6557	57	7	MW2_CDS_13663	MW2582	FALSE	unmapped	CAAGCTAAGGATGAAGGTGTAACAAGTATTGTAGCGACACCTCATCATTTGCATCCGAGA
6558	57	5	MW2_CDS_01967	MW0362	FALSE	unmapped	AAAACCATTCAATCTGTCAAAGATCCACATTACAACGAAGCACTTAAACTTTACGATACT
6559	57	3	MW2_CDS_10809	MW2041	FALSE	unmapped	AAAAGGGTTTGAACAAACACGAGCTGAATGGTTAATGTTAGATGTATTTCAATGGACGCG
6560	57	1	MW2_CDS_01261	MW0232	FALSE	unmapped	TAATAAAATACCTGAAGGCTTAACATTTGATCATGCATTTGAGTGTGTGGGTGGTCGCGG
6561	56	164	MW2_CDS_00597	MW0111	FALSE	unmapped	TCGCACTGAGCTTGATTTTACCTGCATTTGCAGTAGGTAATCACATTTCAATCTTCGTCA
6562	56	162	MW2_CDS_00995	MW0184	FALSE	unmapped	CACAACAAGATGGTGAAATTCCTACATTGGATCCAATACGTTCAATTGCGCCGTCAGTAT
6563	56	160	MW2_CDS_03313	MW0609	FALSE	unmapped	CCTCAATCACCTGAAGTAGCAGATGGCTTAACTGTTGGGGAATTAGTTTCATATGGTCGT
6564	56	158	MW2_CDS_08915	MW1674	FALSE	unmapped	ACCTGACAAAGCAGTTTACAATGCGATTGTTAAAGTCGTTGTGGCAAACATTGGTTATGA
6565	56	156	MW2_CDS_09621	MW1806	FALSE	unmapped	GTACACTTGCAGCATTTGTTGGATACTTGGAGTTATTGTTCGGGCCTTTACGTCGTTTAG
6566	56	154	MW2_CDS_10894	MW2056	FALSE	unmapped	CGAACAGAAGATTGAAGAAAAAGCGAATTATTGCGTTCAGTTTGCATACTCGGAATCGCT
6567	56	152	MW2_CDS_10265	MW1938	FALSE	unmapped	TTCGACAAATAAAAAATTTGTTACCGCTCAAGAGATTGATATCAAATTAAGAAGGTACCT
6568	56	150	MW2_CDS_11534	MW2186	FALSE	unmapped	AGCGACTACGATTTTAGAACAAATTGATTACGCGACGTCTATTGGTTTGAATGTAAAAGT
6569	56	148	MW2_CDS_12460	MW2359	FALSE	unmapped	AGGGAGTAATTGCGGATTTACAGTTAAAAAATAATGGTGATTTAGCCGGGATACTTGGCT
6570	56	146	MW2_CDS_12092	MW2289	FALSE	unmapped	TTGCCAAATTTCCAAACAGCTTTAAATGCGGCTAATAATGAAGCAAATAAATTTGGTAGT
6571	56	144	MW2_CDS_09045	MW1697	FALSE	unmapped	ACGGTACAATCACAATTAAAACGCGTCTTGCGGACGAATTCTTAGGTGAAATTCCTGAAA
6572	56	142	MW2_CDS_04680	MW0863	FALSE	unmapped	AATTAAAATCATTTATAACTGTAACTTTGGCACTGGGCATGATCGCAACGACTGGCGCTA
6573	56	140	MW2_CDS_05719	MW1064	FALSE	unmapped	AGAGATATTATGGGTTCACGTATTTCAGACTGGAATAGAGTCGGTTGGGGTGAAATCCCA
6574	56	138	MW2_CDS_09623	MW1807	FALSE	unmapped	TCATACGTTAGTAACTGAAAGTGACGGAAGAACTTGGATAACACGTGAACCGGCAATTGT
6575	56	136	MW2_CDS_07569	MW1425	FALSE	unmapped	TAAAGGCGACCCTCTCAGACAAAAGGGAAAAGTGTCCGAATTAGCTTTAGGTTATCAAGG
6576	56	134	MW2_CDS_04681	MW0864	FALSE	unmapped	GGCAGTATTGTTCACGATTTTCACAGCAATTTTTGCTGCAGTAATTAAACCGCCGAAAGA
6577	56	132	MW2_CDS_05236	MW0969	FALSE	unmapped	GCATGGATGATCATGTATGGGGTAAGTGGATTATTAATTCCAGCTTCATTATCTACTGCT
6578	56	130	MW2_CDS_12008	MW2275	FALSE	unmapped	TTGCTAAGTATATCAAGCACAATGAGCAATTTTTCAAAGACATTTTAGTTACCTATCCAA
6579	56	128	MW2_CDS_10334	MW1951	FALSE	unmapped	AGGTGTTGCGTGATTATAAGATAAACGTTCAAAATAATTGGAAAAACGAATTATATAATG
6580	56	126	MW2_CDS_00309	MW0059	FALSE	unmapped	CAATTGCAGAAGCAAGAGCACTTCTAGATGAATTTGAAGCCCAAATGGACGAAGACGTTA
6581	56	124	MW2_CDS_13523	MW2558	FALSE	unmapped	GATTGGTGACAAAATGATCTATGGTGATGGTGATGGTCGCACATTCACAAGTTTATCGGG
6582	56	122	MW2_CDS_04357	MW0803	FALSE	unmapped	CGTTTAGTGGAAAGCTTGCACGCGGTATCAACAATAGGTTTATCGAAGAAATGTCCCAAT
6583	56	120	MW2_CDS_13803	MW2605	FALSE	unmapped	TGAAGTGAAAAGCCGATTGCCTCATTCGGAAGAAAGTCATACTTTTCATGGTAGAGATGT
6584	56	118	MW2_CDS_12991	MW2458	FALSE	unmapped	TGCAGAGAAAGAAATCGAAGTGAATGGTTACGACATTGATGCGATGGGTGTCGTTAGTAA
6585	56	116	MW2_CDS_03472	MW0636	FALSE	unmapped	TTGGATGTTTTGTTTTACCGCCATTTGGAATTATTATTATACCTTTTATTTTGGTATTCA
6586	56	114	MW2_CDS_01443	MW0265	FALSE	unmapped	AAGGTATTAAAGCAGATGGTGGCAAGGTTGATCAAGCAAAACAATTAGCGGCAAAAACAG
6587	56	112	MW2_CDS_00324	MW0063	FALSE	unmapped	TTTGATTTTAATCATAGGTGGCGACAATCCGCATACCAAAGCACAACCTTTAGTCAACCA
6588	56	110	MW2_CDS_03595	MW0659	FALSE	unmapped	ATTTGAAAAATGTAACGGGATACATTCGTGGTGGGTGTTCGCCTGTTGGTATGAAAACAT
6589	56	108	MW2_CDS_03132	MW0575	FALSE	unmapped	TCACTTGGTTTGATGCATGTTATTAATTATTTATCAACATCAGAAACAGTTGGTTTTCGT
6590	56	106	MW2_CDS_12310	MW2331	FALSE	unmapped	AAAAGAATCAGCAACGACATCCTCGAAAAACGGCAAACCATTAGTTGTCATATATGGCGA
6591	56	104	MW2_CDS_11277	MW2131	FALSE	unmapped	AAAAAATGCATGTACGTATGATGCCGGCACAAGAGCCACCTTATACACGTTTAATCGATT
6592	56	102	agr_tiling 183_R		FALSE	unmapped	ATTTTATGGTAATTTAAAAGAACTGAGTCAATTAGATGATCGTTTCTTTAGATGTCATAA
6593	56	100	MW2_CDS_08550	MW1611	FALSE	unmapped	GATTTAACTTGCTTAGGAAAAGTTATCGGTGGAGGACTACCTGTAGGTGCTTTTGGTGGT
6594	56	98	MW2_CDS_03229	MW0594	FALSE	unmapped	TTCAATTGTCGGACTTTATTACAGCTATATTTACAACATTCCTAGTGGTGCGACAATCGT
6595	56	96	MW2_CDS_00699	MW0130	FALSE	unmapped	TTGCAAAAAGATGCATTTGTTGTGCTATCAGATAGTGGAACATTGTCAGAAGAGTCGTCT
6596	56	94	ETG10_195139		pos		
6597	56	92	agr_tiling 139_R		FALSE	unmapped	ATATGATCGATTTAAGTCGCAGTATTGGTATTATTCTTGATAACGCAATAGAGGCATCAA
6598	56	90	MW2_CDS_05831	MW1084	FALSE	unmapped	GCAACCAATGGAAAAAGCACCATTCGGAATTGTTGGTAGTGAAACAGCATTCCCATTATT
6599	56	88	MW2_CDS_13091	MW2478	FALSE	unmapped	GTCGTCCAGTCGTGACAGATTATCATGGTGACAATCAAACGCTACAACTACTTGCTACTG
6600	56	86	MW2_CDS_00374	MW0071	FALSE	unmapped	TTGAAAAATTATAAAGACGGAGATATTTCATATAATCCAGAGGTGCCGAGTTATTCGGCT
6601	56	84	MW2_CDS_09651	MW1811	FALSE	unmapped	TTTGGATTACTAAAGTTGGGAATGGATATTGTATTGCCAATTTGAAAGAAGACAAATGGA
6602	56	82	MW2_CDS_12181	MW2305	FALSE	unmapped	TTGACAGTTACTTGGAAGAGAAAAATCTAAAAGATAAAATTAAATCAGAAAAAACAGAGT
6603	56	80	MW2_CDS_11184	MW2113	FALSE	unmapped	TGGTGCTGTAGGTTCAGTTGTAGGTCAAATTGCTAAGATTAAAGGTTGCCGTGTAGTAGG
6604	56	78	MW2_CDS_11430	MW2166	FALSE	unmapped	AGTGGTGCTGAAGCTGACATCAAAGTTGGTAACGCATTACCATTACAAAACATTCCAGTT
6605	56	76	MW2_CDS_05025	MW0930	FALSE	unmapped	TATGATGATACACAGCATATCCTCATGCAAACGTCATCCAAACAAGGTATTGGCACTTCG
6606	56	74	MW2_CDS_12364	MW2341	FALSE	unmapped	TGAAAACAGACGTTTAGCACAACGTGAAGTTAACAAAGCACCTATGGATGTAAAAGAGCA
6607	56	72	MW2_CDS_11176	MW2111	FALSE	unmapped	AGGCGTTGCTGCAACATTAGGTTTCGGTGCATTGCAAATAAACGAAGGTTTACATTTTTT
6608	56	70	MW2_CDS_03904	MW0713	FALSE	unmapped	TGCAGGGTGTAAATTATATGCTAAAAATATCAGAAAATTCAAAGTGTTTGCGTTTGCACG
6609	56	68	MW2_CDS_02451	MW0453	FALSE	unmapped	TGACAGATGTAAGACTTAGAAAAATACAAACAGATGGACGAATGAAAGCACTCGTTTCCA
6610	56	66	MW2_CDS_11039	MW2087	FALSE	unmapped	TGCAGCTAAAGTTTCTGGTGTTAAAGCAATTGAAGCGACAACGACTGCACAAGATTTAGA
6611	56	64	MW2_CDS_10584	MW1998	FALSE	unmapped	CGAGTCGAATTGAACGTTTACAATACTTGTCGATTAAATCTAATCCAATTAGTAAAGTGC
6612	56	62	MW2_CDS_11289	MW2133	FALSE	unmapped	AGTCAATGGCGATTTGAAATTGTTGTTTTATGGCGGACTGAAAATGTTGTTTTTGGCGAT
6613	56	60	MW2_CDS_01365	MW0250	FALSE	unmapped	TCGAACGTCGACATGAAGTACCTTTTATTGATTTCTCAGTATTACGCAACCGTCCGTTCA
6614	56	58	MW2_CDS_09314	MW1750	FALSE	unmapped	ACTACGAGCATTTGTCACAGGTAATGCACCAGCTAAATTAACTCATGCGAACTTATGCAA
6615	56	56	MW2_CDS_12191	MW2307	FALSE	unmapped	TACGCTCACTATTCAAGCTACTAGAAGCGCAAAATACAAATCTGAACAACTCATTTTAGA
6616	56	54	MW2_CDS_00271	MW0052	FALSE	unmapped	AGGTGAAAAAACGTGTGGATTTCTTAAAGTTCTATAATGACAATGAACTTATAAGTACCA
6617	56	52	MW2_CDS_03752	MW0687	FALSE	unmapped	ATTGAGAGAACCAGGCTTCTTCAGACATCTTAAAGTGATGCCGTATGCACAAGAAGTTGT
6618	56	50	MW2_CDS_08755	MW1646	FALSE	unmapped	CAAGAGCAAATTATGCAAATAGCGAGCACATTTGCAAACTTCAGTTATGGTGAAGCGGAT
6619	56	48	MW2_CDS_10734	MW2028	FALSE	unmapped	AACAATATTAGACGCAAAAGCAAGTGAGCATGCAACACGTATGACTGCGATGAAAAATGC
6620	56	46	MW2_CDS_10421	MW1968	FALSE	unmapped	TTAGGTACAGTAGGAATGGTATGTCCATTTCCGTTAATTGAAGCGCAAAAGAAAATGGCA
6621	56	44	MW2_CDS_10254	MW1936	FALSE	unmapped	TCCGAAGTATGATGATATCAAAGTCGCTTCGTTTAGTGATATTAAAGTAATGGGCAAAGT
6622	56	42	perR_tiling_019_F		FALSE	unmapped	AACATATGGAGACTCATCAAGTCGATTCGACTTTAATACACATAATCATTATCATATTAT
6623	56	40	(+)E1A_r60_1		pos		
6624	56	38	MW2_CDS_11563	MW2192	FALSE	unmapped	CAAGGCCACGCCAAAATGGTCGATGTATCAGACAAACAAATTACAAAAAGAACTGCTGTC
6625	56	36	MW2_CDS_09811	MW1841	FALSE	unmapped	TGCAATCGTATTAGAAGCTATTTCTGGTGCAGATGTTAATGACTCTACAAGTGCACCAGT
6626	56	34	MW2_CDS_03765	MW0689	FALSE	unmapped	GCTTATCACCAACGGGTAATAGTGCTGCTGTTAAGTTAGCACCTAAAGCATTTAATGCCC
6627	56	32	MW2_CDS_07077	MW1322	FALSE	unmapped	TTTATTTCGTCGTCCCACCCCAACTTGCATTGTCTGTAGAAATTGGGAATCCAATTTCTC
6628	56	30	MW2_CDS_12824	MW2426	FALSE	unmapped	AGGTTGTGCGTTAAGCGATATAGATATGTTGCTAAAAGGTGAAGGTACTTTGAAGACACT
6629	56	28	MW2_CDS_01963	MW0361	FALSE	unmapped	GCGAATCCTTAAAAGCTATCCAAACATCACAAGAGGCTATCCAAGAAGCACAAGCATCTC
6630	56	26	MW2_CDS_00814	MW0151	FALSE	unmapped	CTGCTGATCATCCATGGAGAACAATGCCTAGAAATGCTATGACGGTTCACTATTCAGGTA
6631	56	24	MW2_CDS_09480	MW1781	FALSE	unmapped	ACGCCATTATCAGATAGACATTTTCTCATCTTTTTATTACTTGTATTTATGACGTATCCA
6632	56	22	agr_tiling 076_F		FALSE	unmapped	GTTGAATAAATTGGGTATATGGTTCTTTTACAAAAAGTGTGATAATGAAAAGAATTGTAC
6633	56	20	MW2_CDS_01384	MW0254	FALSE	unmapped	TGTTAGCGCTGTTCAAGTAGTACTTCATTATCGTTTAAACCAACAAGCAGCATTGCAACG
6634	56	18	MW2_CDS_10239	MW1933	FALSE	unmapped	CGATGTTATACCTACCAGAAGCTTTAATTACTTGGTCGATGACAAATCAAGTTACAACGA
6635	56	16	MW2_CDS_02511	MW0464	FALSE	unmapped	TGGGAAATCAACGCGTAATAAACTAGGATTTGATGAGTTATCGAAGCGAAAAGGTTATCA
6636	56	14	MW2_CDS_05405	MW1001	FALSE	unmapped	ACTAAACGTGAAGAAATCGTTTCAGTGTATGCTACAGGTGAGAAAGTCAATGTTAGTCCG
6637	56	12	MW2_CDS_12243	MW2317	FALSE	unmapped	TTTAAAAAATATCAAGAAAGTTTTGGATATATGGCACAACAGTTATGCTTTCCAGAAAAA
6638	56	10	MW2_CDS_04215	MW0772	FALSE	unmapped	AACTAAAGAACAAAAGTATACAATAGCTAAATTTTACAAATTATATATTGAACGTTCGAA
6639	56	8	MW2_CDS_04152	MW0760	FALSE	unmapped	TTTTTCTTCTAATCATACAGTCTTATCTAACGGCGATGTAGGTCCAGGAAACCTAAGAAA
6640	56	6	MW2_CDS_06935	MW1295	FALSE	unmapped	GGCTATTTTGGGTTTCACTCGAATGTCAGTTCGAGGAATAAATAAAGTTAAACGAGAGCT
6641	56	4	MW2_CDS_10518	MW1985	FALSE	unmapped	TAGGTGTTGAACCTTCAGGTGCAAGTAGTATGTATGAATCTGTTGTCGTAAATAATCAGG
6642	56	2	MW2_CDS_03573	MW0655	FALSE	unmapped	TGGTAACTGATTTAATCCATTTGAACCAATTTCAATTCAACTTTTACGCAGGACTAAATT
6643	56	163	MW2_CDS_00614	MW0114	FALSE	unmapped	ATACCAGATGGCGAAGACTTATTACGTGGTTTACTTGAAACCTTTGCGATAGCCGTTGTA
6644	56	161	MW2_CDS_06278	MW1165	FALSE	unmapped	AGAGCAACGTACTGGAATTAAACGTGAAATGCTAGTGCATATTGAAAATAATGAATTCGA
6645	56	159	MW2_CDS_04311	MW0794	FALSE	unmapped	GTTGTTGGCTCCCTCTTTGCAGTATTTCCAGGTTTACCAACTAATATCGTGATGTGGTTC
6646	56	157	MW2_CDS_00901	MW0166	FALSE	unmapped	TGGCGTATTTAGTGGATTTATCATTGGTGCAAGCTTCCTACCGTTAGTTATGTTAGGGCT
6647	56	155	MW2_CDS_13805	MW2606	FALSE	unmapped	ACTGGTGGCGTAATGCTAGGCAAAGATGTTAAATTCGAAGCATCAGCTGAATTCTCAATC
6648	56	153	MW2_CDS_02024	MW0374	FALSE	unmapped	TGCAATTTATGATGTGATAAGAAAGTACTGGTCAGGAACAGGTGATCGAAAATTAATGGA
6649	56	151	MW2_CDS_05382	MW0997	FALSE	unmapped	TCTTTAAACTGGGTAGATCAAATGAAAGTTGCCAATGAAGCAGTACAAGAAGCGGGCAAA
6650	56	149	MW2_CDS_07978	MW1504	FALSE	unmapped	TACAAATCAGCCTGTACCACCACCATGGTTAACAGGTGGAGACTTAGGTAGAGATGTAAT
6651	56	147	MW2_CDS_10225	MW1929	FALSE	unmapped	TCTGACTTCAAAGTAGACTTTCATCTAAACAACTTAATTGAAATGAATTTTAATTTGCGT
6652	56	145	MW2_CDS_11328	MW2142	FALSE	unmapped	CAAAAATTATTTGGTGAAATCGCAGAGCGTTACACAGAACGTCAAGGTGGTTACACTCGT
6653	56	143	MW2_CDS_03131	MW0575	FALSE	unmapped	AATTCATGTTCAACTGGCAGATTTTAAAAAAGCATTTATTGAGCTAGATGACGATGAAGA
6654	56	141	MW2_CDS_05227	MW0968	FALSE	unmapped	CCGGCGTATGAAGATGTAAATCGTTTAGCCAAGAAGCAAGGAGGAGAAATAGAAAAATGA
6655	56	139	MW2_CDS_10512	MW1984	FALSE	unmapped	TGTACAAAAAATGCAATGTTACCAATTGTTTTAGAAAAAAATGCACGTGAACATCTTGCT
6656	56	137	MW2_CDS_03945	MW0720	FALSE	unmapped	ATTTAACTTTGCGGCCACTGGGTTCGACACCATATACTTTATTGGATTACTTTGGCGATG
6657	56	135	MW2_CDS_08478	MW1594	FALSE	unmapped	AAACCCTGCACCTGACTTCAGTGAAAAAGGTGAACCAGGTGAGGAATTAGATGTATCTTT
6658	56	133	MW2_CDS_12968	MW2454	FALSE	unmapped	AGTCAGCATTCTCATCATGGATCTCTTACGCAAAAACATTTGAGTCTTCCTGAAATCTCA
6659	56	131	MW2_CDS_02471	MW0457	FALSE	unmapped	GATTTAGATTTAGAACAAGGACAAGTTCGCTTAAGACAAAAAGGAAGTGCGGGCGGTCAC
6660	56	129	MW2_CDS_04999	MW0925	FALSE	unmapped	ATTATAAAAAAGGCCTTGATGATCATGAATCTGTAGGCATTGGTGGTGCCATTGTTCGCA
6661	56	127	MW2_CDS_08000	MW1507	FALSE	unmapped	TGTGGTTTGGAATCTTATTCGCAATAGTAGGTGCGCTTCTAATTGAAAAATTAAGAACGT
6662	56	125	MW2_CDS_10741	MW2029	FALSE	unmapped	ACGTCTTGACTTAGCGTCATACAGAGAACTTGAATCATTTGCACAATTCGGTTCAGACCT
6663	56	123	MW2_CDS_04725	MW0872	FALSE	unmapped	TGCGAAAGCGCCTAATGGCAAAGATTATGCGAGTACCACGAATTCGCCTTTAAAATATAA
6664	56	121	psma_tiling_030_R		FALSE	unmapped	ATTTATTTGCAACAAACTAACAAGACTCACCTCACATCAATAAATCAACACAAAGCAAAG
6665	56	119	MW2_CDS_02832	MW0521	FALSE	unmapped	GCAGTTGGTAATGCCGATGTCACTTATGGATTAGCAATTGACGGTGATAAAGTTACACGT
6666	56	117	MW2_CDS_06062	MW1127	FALSE	unmapped	TTGAAAAAAACGCGGGTTACGGTACCAAACAACATTTACTAGCAATCGATGATATTGGCA
6667	56	115	MW2_CDS_08285	MW1558	FALSE	unmapped	AGCTGAGAAAGGTGACATTTTAAAAATAGGTGCTATAACCAAAGGTGCACGCGGTTATCT
6668	56	113	MW2_CDS_06805	MW1270	FALSE	unmapped	AGGAAAAAGTTTTGAATCAAAAGAACCGGTAACACAGATATTATTCAACTATGCACCCAT
6669	56	111	MW2_CDS_00456	MW0086	FALSE	unmapped	GCAATCAGTTTAGTAGGTAACATTGGGTTTGTCGGTTTAATCGCACCACATATCGCGAAA
6670	56	109	MW2_CDS_12151	MW2299	FALSE	unmapped	AGCAGCTTATATCTTAGCCTCAATTGAAAAAGGGTTACGCAAAGTTATTCCAACGGTGTT
6671	56	107	DCP_20_7		pos		
6672	56	105	MW2_CDS_00980	MW0182	FALSE	unmapped	TGGCAGAGTTACTAGGCGGTTCAGCAGTGACGGAACAAGTATTTAACATTAATGGTATCG
6673	56	103	MW2_CDS_07621	MW1438	FALSE	unmapped	AAATACTAATTTAAATGATGAGTATGTCGTTTCGCCTGGCTGGACTAAAGATGAACAGGC
6674	56	101	MW2_CDS_02695	MW0497	FALSE	unmapped	AAATCCATTAGCTGAGTTAACGCATAAACGTCGTCTATCAGCATTAGGACCTGGTGGTTT
6675	56	99	MW2_CDS_03583	MW0657	FALSE	unmapped	GCAGGCGGATTGAACTCGACATTCACTAGTATGGGTAATTTCATAGGTCCTTTAATCGCA
6676	56	97	MW2_CDS_11529	MW2186	FALSE	unmapped	GTTCTACATGTACACGCGCAAGGCTGTCATCAGATGGGAAGTTTTACGGATGTTTATTTG
6677	56	95	MW2_CDS_11018	MW2084	FALSE	unmapped	GTTGTCGTGGGAATCGCTGGTAAAGATGGCGAACATTTAGACTTGTTATCTAAAATTGCA
6678	56	93	MW2_CDS_02509	MW0464	FALSE	unmapped	AGTGCTAAAACATACGAAGAGTGGTTTAAACAATTTAGTAGTAAGAAAGCACAATTCAGT
6679	56	91	MW2_CDS_08833	MW1659	FALSE	unmapped	CCTAAGGCACATTTTCATGTAGATGCGGTTCAAGCATTCGGCAAAATTTCAATGGATCTC
6680	56	89	MW2_CDS_10198	MW1922	FALSE	unmapped	TGCTATAGGAATGTTGAAAGCAAATGATTTAACTAGACTCGAAGAAATACATTTAATTCA
6681	56	87	MW2_CDS_03561	MW0653	FALSE	unmapped	AAGCACCTTATTGACTATGATGCAGCATCAAATATTCATGGATGGCAATGGTCTGCTTCT
6682	56	85	NC_A_060		FALSE	unmapped	TCGCTCAAGCATTTCTAGACAAACGAAACGAATGGCATGATGTTTTCGGTACAGGAAAAT
6683	56	83	MW2_CDS_02993	MW0551	FALSE	unmapped	GGCCCAGCAGGTCCAAATTCATTTGTGGAAGTCAAACGTACATCAGGTAATGTGTTTATA
6684	56	81	MW2_CDS_05159	MW0954	FALSE	unmapped	TCATATTACTGGTGGAGGTTTTTATGAAAATATTCCACGTGCATTGCCAGCCGGATATGC
6685	56	79	MW2_CDS_01544	MW0283	FALSE	unmapped	CGTTAGCTTTTTCCGTTGTCATTGTCAATGGCTATAAGTTTAAAGGCCTCACAGATCGCA
6686	56	77	pMW2_002		FALSE	unmapped	TGTCAATTAAACTTTACAACATAAATGAGGAATACAGAGAAAAGTTTTATCAAATACCGA
6687	56	75	MW2_CDS_11612	MW2200	FALSE	unmapped	ACAGCTTTAATGACAGCGATTATCGCTATTTTAGGATTGGTACCGGTAATTCCACTACCA
6688	56	73	MW2_CDS_13641	MW2578	FALSE	unmapped	CTGCTTACAAACATTTCGAAGCTGGCCAAGGTAAAAAAGGTGCACAACATGCATTAGATT
6689	56	71	MW2_CDS_08268	MW1555	FALSE	unmapped	TAAAACTTGCCAAAGCACATAATGTTGCAGTAGGTGCACATCCTGGTTTACCTGATTTGA
6690	56	69	MW2_CDS_13883	MW2620	FALSE	unmapped	GCAGCAAGTTTTGCAGAACGTGTCATCATGCTAAAAGATGGCCAAATTCATACACAACTT
6691	56	67	MW2_CDS_06443	MW1201	FALSE	unmapped	ACATGTTGGCAGTTGGCGAGACAAGTTCTTTAAAGAGCGTGAAGGTAAATATCAGGTAGA
6692	56	65	MW2_CDS_02425	MW0448	FALSE	unmapped	ACAAGATTGCGAAAAAATAATGGTTGTTGCAAACCTGCCGTACTATATTACGACGCCAAT
6693	56	63	MW2_CDS_08336	MW1568	FALSE	unmapped	GCGCAATGGCATTATTCGGTGAAAAATATGGTGATGTTGTGCGTGTAGTAAATATGGCAC
6694	56	61	MW2_CDS_04420	MW0815	FALSE	unmapped	AGCATTGTTTATAGGTTATGGCTATTATGAACGTTGGCGTAAGAAACATCCGCCACGTTG
6695	56	59	MW2_CDS_12384	MW2344	FALSE	unmapped	ACTTCAATCCAGAATTTTTAAGCGTACTATCACACAGACAAGATGGCGCTAAAAAATCTA
6696	56	57	MW2_CDS_05246	MW0971	FALSE	unmapped	CGTCGTCCCACCCCAACTTACATTGTCTGTAGAAATTGGGAATCCAATTTCTCTTTGTTG
6697	56	55	MW2_CDS_01868	MW0341	FALSE	unmapped	ATGCTAAAAAAGCGTTAGTTGAACGTTTCAACGGCATCTTAGCTACTGAAGGTGCAGAAG
6698	56	53	MW2_CDS_03498	MW0642	FALSE	unmapped	TGAATTAGTATTTGGTGCAGGGTCAATTGGCATTATGGGTGCCATTCAAGATGGTGTATT
6699	56	51	MW2_CDS_02950	MW0544	FALSE	unmapped	TTGTGTTGAAGGCTCTGGTTCAGAACGTGCATTGATGATGCAAACATTTTATGAACATGC
6700	56	49	MW2_CDS_03622	MW0663	FALSE	unmapped	AAGCACGTCTTGCAAATGGTGCGCTTGCTGGTAGTATTTTAAAAATGAATCATGGGTTAC
6701	56	47	MW2_CDS_11311	MW2139	FALSE	unmapped	TCATTTATTCCACTACTAGTGCCACTATTCATCTCAGCTTTCCAACGCGCCGAAGAATTA
6702	56	45	pMW2_031		FALSE	unmapped	AGGAACACGTAAAATAGAACCAAAGATAATTGATGAAATTGAACGCCTTGCGCTTATGAA
6703	56	43	MW2_CDS_05474	MW1014	FALSE	unmapped	TTCATTTTAAAGAGAAAAAAGTACAACATGATGATGCAAAAGAAGTGCCTTCAAAACATC
6704	56	41	MW2_CDS_02362	MW0436	FALSE	unmapped	ACATATTGTCCCGTATCCGCCAGGGATTCCTATTATTTTCAAAGGAGAAACAATAACTGA
6705	56	39	MW2_CDS_06489	MW1211	FALSE	unmapped	ACAATAAGGAATTAGTGGAAAAGGGACTTGCTAGAGAGAAGTATTTTTCACCAAATGGCA
6706	56	37	MW2_CDS_04465	MW0824	FALSE	unmapped	TCGGAGTGCTTGCGTGTGCTGAAAATATGATAAATGAAGCATCAATGAAGCCAGATGATG
6707	56	35	MW2_CDS_06010	MW1117	FALSE	unmapped	GCATTAGGTGCTTCATTACAACATGTCATTGTAGATTCAGAAAAAGATGGACGCCAGGCT
6708	56	33	MW2_CDS_12182	MW2305	FALSE	unmapped	TGTTGCAGTAGCATTTTTCTTTGGTCTGAAAACATATCAAGGCCATAAGAATATTCAACT
6709	56	31	MW2_CDS_10686	MW2017	FALSE	unmapped	TGGTTGAAGGTGAAGTACTTGCGCATGATATTTTAGCGCAAATTGTTGGTGAATCATACG
6710	56	29	agr_tiling 188_F		FALSE	unmapped	GTTTCTCACCGATGCATAGCAGTGTTCTTTATTTTTAAAATAGACAATTCGCTCTTTCGA
6711	56	27	MW2_CDS_03592	MW0658	FALSE	unmapped	AATGTATCAACTGAAGATACTTATAAAAAGAAAATGGATATTCTCAATATTCATACTGCT
6712	56	25	ETG10_236652		pos		
6713	56	23	MW2_CDS_07474	MW1398	FALSE	unmapped	CTTTGACACACCAGCAGAAAAAGTATTTGGCAAACCAGTAGTATTTACAGATGCAGCAGT
6714	56	21	MW2_CDS_02365	MW0437	FALSE	unmapped	GGATTATATCCAGACTTGACGATTTATTTGAATGTTAGTGCTGAAGTAGGCCGCGAACGT
6715	56	19	MW2_CDS_08298	MW1561	FALSE	unmapped	AAGATCAAAAGCACTTGACTTTCGACGAGCGCCTAGAAACCAATTATGACCATCCATTTG
6716	56	17	NA		ignore		
6717	56	15	MW2_CDS_08059	MW1517	FALSE	unmapped	TGAATATAAATTCCCATTTGGTTGGGGTGAGTTATGGGGTATCGCAAGTCGTACAGACTT
6718	56	13	MW2_CDS_04806	MW0887	FALSE	unmapped	AGCAAGCGGTTGATGAGTTGAAAGTGAAACTTAAAGGCATGCGCAAACAATATGAAGTTG
6719	56	11	MW2_CDS_10567	MW1995	FALSE	unmapped	ATGATACATGGAATTGGTGTAGATTTAATCGAAATCGATCGAATAAAAGTGTTATATAGT
6720	56	9	MW2_CDS_05699	MW1061	FALSE	unmapped	TGTACAGTAATCGGTGTTTCAAATCGTATTGAGATTTGGGATAGAGAAACTTGGAATGAT
6721	56	7	MW2_CDS_09392	MW1764	FALSE	unmapped	AAGGTCAAGGATTATTGGCAGCTTAATTCATATGCGCTGCAATCGAATATTTGGCATTGA
6722	56	5	MW2_CDS_12648	MW2392	FALSE	unmapped	AGAACGGCGATGATTCAGCATATTGGGAAAATGCTAGGTATCAAAACGCCAATGATTGAT
6723	56	3	MW2_CDS_04289	MW0789	FALSE	unmapped	TTTGGTTATACACCAACGTGTGGTACTTGTAAGGTTTCAGAAAGAATGTTAGACATTGCT
6724	56	1	MW2_CDS_12025	MW2278	FALSE	unmapped	TGAAAATGTAAGGCAAGTATTAGAAGTCATCAATCATCGCATTAAAACATATAGCAATCA
6725	55	164	MW2_CDS_09019	MW1692	FALSE	unmapped	AGGTGGTGCATCTGGCGAAGCATATATGGCTGAACAAGATGGACAAAAGTTGTTTTTAAA
6726	55	162	MW2_CDS_09345	MW1755	FALSE	unmapped	TGCAGACGGAGCAAAAGTGAAAGATAGAATTTCTGTTATTGGTTATCCAAAGGGTGCACA
6727	55	160	MW2_CDS_00447	MW0085	FALSE	unmapped	TGAGCGTAATACTTACATTTCAATATCTGAAGAACAACGAGAGAAAATTGCAGAACGTGT
6728	55	158	MW2_CDS_01003	MW0186	FALSE	unmapped	TCGTTTTCACAAAAGACGTAAAAGATCCCGCGCTGAAACAAAAAATCGAAAACAATCAAT
6729	55	156	MW2_CDS_02750	MW0507	FALSE	unmapped	ACTGAATAAAAAACTAATTGTTATGGATAGTGAGTATGCACCAGCAATAGGCGCAGCAAT
6730	55	154	MW2_CDS_05306	MW0982	FALSE	unmapped	AAGCTGAAGAAGGATTATTTAAAGCAACTGTTGATTCTATGTTATTTAGAGGGGTCCACT
6731	55	152	agr_tiling 026_R		FALSE	unmapped	ATAATTATCTGTAATGATAATTAAGAAAAATACATAGCACTGAGTCCAAGGAAACTAACT
6732	55	150	MW2_CDS_08660	MW1630	FALSE	unmapped	GTGCACGTTCATGTAATGAAAGCATTATTCCTACTTCTACTGGTGCGGCGAAAGCTTTAA
6733	55	148	MW2_CDS_04774	MW0881	FALSE	unmapped	ATGTCGCTGAAAAAAGAAATGCCAAAATTAGTGAGTTGTTTAATGAGGCGCCTTGTGATT
6734	55	146	MW2_CDS_02113	MW0390	FALSE	unmapped	ACATGGCTTTTCGATAAATGAGTTGTTCTTTATTCAAAAGGAAGAAGTATCGTTGAAGGA
6735	55	144	MW2_CDS_11309	MW2139	FALSE	unmapped	AATTATTTTGGCACAAAAGTCGCGTGGTTCTGAAATAAGTTCAGGGAACATTGCAACACG
6736	55	142	MW2_CDS_12804	MW2423	FALSE	unmapped	GAGAAGGCGATATTTCAGCGTTAGGTGCACAAAAAGAATTTACGGATCAAGAGATGCCAG
6737	55	140	MW2_CDS_05054	MW0935	FALSE	unmapped	TCACAGTATGATTTGACGATGAAGATTAGCAGGGAACAATCTATAGTTTCAAGGTGGATT
6738	55	138	MW2_CDS_04349	MW0801	FALSE	unmapped	ACTTAGTCGAAGCTTACCTTTATTTTTATTAGCTATTTTTTCTTTAGTCATTCATAGTGC
6739	55	136	MW2_CDS_05480	MW1015	FALSE	unmapped	AAGCAGCTAAACAAAAGAAACATCCCAAAGTATTAATATTAATGGGTGTACCGGGTAGCT
6740	55	134	MW2_CDS_06036	MW1123	FALSE	unmapped	TTGCCAGCGATGACCATGACTGATGCTATTGTTAGACTGATTCCAGGTGTTTTAGGTAAT
6741	55	132	MW2_CDS_05189	MW0959	FALSE	unmapped	CGCACCAAGTCGTGTTGACTTTCCAACAACAAACTCACACTTATTACAATTTAAAAATGG
6742	55	130	MW2_CDS_09471	MW1779	FALSE	unmapped	ACGAAAGTGCGGAATTTGGTAGTTCAATTGGTGGTGAAATTAAGTCATTACTTGGAAACT
6743	55	128	MW2_CDS_04052	MW0738	FALSE	unmapped	ATTGCTGTTGCTACAAACGCTGGTCAAATTAAAACTGGTTCATTATCACGTACTGACCGT
6744	55	126	MW2_CDS_00081	MW0015	FALSE	unmapped	ACAACATGATATTAAAATTGATAAACGTAAAATGGATTTACCAAATGGAATTCATTCCCT
6745	55	124	MW2_CDS_08652	MW1628	FALSE	unmapped	TGTTAGCTTCTTGGTCTGAATCAGAACCAACTATATCGCAAAAGACAATGGTTGAAGAAT
6746	55	122	MW2_CDS_00818	MW0152	FALSE	unmapped	CACTAGCTAGGTTAGGGATTGTGTTGGGTGTTTTCTTAACGTCATTACAAATGGGACTGT
6747	55	120	MW2_CDS_05000	MW0925	FALSE	unmapped	TCAGCCTATTCATTGCCATGTTACTAGCATGCTTACTTATTCAAGCAGCAACTAATATGT
6748	55	118	MW2_CDS_07168	MW1340	FALSE	unmapped	AACCATATGGTTCTGCATATGGCCATGGTGTATCTGGAGTAAATATGGGTGCTAAGACAG
6749	55	116	MW2_CDS_12512	MW2368	FALSE	unmapped	TAAGTCGGGTGTTGCTTCAGGTGTGTATAAAATGGCGTCATCATTAGGAAATGCATTTGG
6750	55	114	MW2_CDS_12741	MW2410	FALSE	unmapped	TGAAAAGAATGAAACTGAAAAAGAAGCTTTGATCAGAGAAATTAGAGAAGAAATGAAATG
6751	55	112	MW2_CDS_13824	MW2609	FALSE	unmapped	AGCGTTATTTGCAGATAAAAAAGTGGTTACGTACTGTACTGGTGGAATTCGATGCGAAAA
6752	55	110	MW2_CDS_05254	MW0973	FALSE	unmapped	GTGCGTGAAAATACACAATCACTTTATGTTGAAGCTCAAACAGAAGAACAAGTACGTCGT
6753	55	108	MW2_CDS_00327	MW0063	FALSE	unmapped	TGATTACTTGTTTATTTGGAAGTAGTAGAAAAGATGGCAATTCAGCTATCGCAGTAGAGA
6754	55	106	agr_tiling 018_F		FALSE	unmapped	ATAACTGTAAAACATTCCCTTAATAATAAGTATGGTCGTGAGCCCCTCCCAAGCTCGCGG
6755	55	104	NC_A_084		FALSE	unmapped	TGGCGATTAAATTAAGGTAAATTATAAAAAATGCTGATATTTTTGACTAAACCAAATGCT
6756	55	102	MW2_CDS_11703	MW2217	FALSE	unmapped	GTACTGGTGGTTTAGGTGCAAGCTACAGCACTTCAAGCAACAATGTTCAAGTAACTACAA
6757	55	100	MW2_CDS_09821	MW1843	FALSE	unmapped	GATTTGGTGCATCGTTCAGTCCACTTGTGCTATTTGCACTTTACTGGAAAGGTTTGACAC
6758	55	98	MW2_CDS_05682	MW1058	FALSE	unmapped	GGAGATTCTTTAACATCTGACATTCTAGGTGGAATCAATGCGGGTATAGCTACTTGCTGG
6759	55	96	MW2_CDS_12973	MW2455	FALSE	unmapped	TTCTGGTGTTGCGATGAATTTACGCCATCCAATTTGGCACATTGATATCACTAAATGGGA
6760	55	94	MW2_CDS_04337	MW0798	FALSE	unmapped	GCTTGGTGAAGACTATGTGATTACAGAAGAAATGGGAGATATTGAAGCATTGCAAGGTGT
6761	55	92	MW2_CDS_06747	MW1260	FALSE	unmapped	AGATATCGTATCCCATGCGGAAGGCTTTATTTATACTGTGACGATGAATGCGACAACAGG
6762	55	90	MW2_CDS_07710	MW1454	FALSE	unmapped	TGGCAAGAGGACCTGTGTCTAAAGGATTATTAACTTCAAACAGTGTTAATGTGCTCGACA
6763	55	88	MW2_CDS_01136	MW0209	FALSE	unmapped	ATTGCCAAAATTCTTTATTCAACGAGAGCAGGCGTTGCTTATATGGCTACAGGTGGTATG
6764	55	86	MW2_CDS_12334	MW2335	FALSE	unmapped	TTAGGATTTATTTTAGTGGCTGAAATGTTTAGAAAAGCTCAAGAAGTTGCGTCTACAACA
6765	55	84	MW2_CDS_09332	MW1753	FALSE	unmapped	ATCCGGGTGATGAAGACATCTCTGTCATGAATATTGAAGAACAAGCAGTTGAACGTGGAC
6766	55	82	MW2_CDS_02812	MW0518	FALSE	unmapped	AAGTTGGCGATGGTAAAGATAATGTGGCAGCAGCGCATGACGGTAAAGATATTGAATATG
6767	55	80	MW2_CDS_08224	MW1547	FALSE	unmapped	GCTGAATTCGATATCGTTATTAATACAACACCAGCGGGTATGGCTGGAAATAACGAAAGT
6768	55	78	MW2_CDS_03497	MW0642	FALSE	unmapped	ATGATTGAGGAAGGTTTTATTGATCCTAAGTATCGTGCTCTTGCACCGTTATGCGACACT
6769	55	76	DCP_1_0		pos		
6770	55	74	MW2_CDS_04518	MW0835	FALSE	unmapped	AGCTCAGCAAACAAAACATGCTGAAATGTCTTTAGCTAGTTTAGCACGCTTAAAAGAAGA
6771	55	72	MW2_CDS_08666	MW1631	FALSE	unmapped	ATGCCGAAAGTTATTGGTCTAACAGGTGGAATCGCCTCAGGAAAATCAACAGTATCAGAA
6772	55	70	MW2_CDS_12312	MW2331	FALSE	unmapped	TGCACCTAAATCATTTTTAGATTTTCAAAAGCAATTATTTGCTGCCCAGCAAGATGAAAA
6773	55	68	NC_S_037		FALSE	unmapped	TTTTGTTTTCGGACAGCAGGGGTATTAGACGCGATTGACAATGTCTGTTTAATTAAACGT
6774	55	66	MW2_CDS_04390	MW0808	FALSE	unmapped	TGATTACATAGTTGGTGACTATGGTTACGATCAATTACGATTAAAAGGTTTTTACAAAGA
6775	55	64	MW2_CDS_11636	MW2205	FALSE	unmapped	GCAGAGATTAATGATGGGTTAGCCGGATTTAATCCAGTGTTAACTGCCATTGCGTTAACA
6776	55	62	agr_tiling 064_F		FALSE	unmapped	TGCTTTCTATATAACACCAAAAAGATGAAGGTGCATGTGCACCATGTGCATACCTTCTAA
6777	55	60	MW2_CDS_09413	MW1769	FALSE	unmapped	AAAAGGATAGGTTTGCTTATGAAATTAACTTGAAAGATTTCCCCGACATCTATAACTTGT
6778	55	58	MW2_CDS_10599	MW2001	FALSE	unmapped	GCAGTTTGATGGTTGGTAAAACACCAGAATATTTAAATATGCCAATTGGCGCCCGTGAAA
6779	55	56	MW2_CDS_10702	MW2022	FALSE	unmapped	GTTATTGGATATTCGTGTCGTCATCACGCGTCCAGCCAATGATCCAGCTTTATTTGAATC
6780	55	54	perR_tiling_087_R		FALSE	unmapped	CAAAATGTTTTTAAGTTCTTCTATTTGTGTTTTAACCTTAACCTTCTCGATAACATCTAA
6781	55	52	MW2_CDS_09321	MW1751	FALSE	unmapped	ATGACACATTGGAAAATCCAGCCTTTTTAGGCAATACATTTGATGCGGTTATTGCGAACC
6782	55	50	MW2_CDS_05753	MW1070	FALSE	unmapped	GAAACATTGCCAATTGATAGTGCCAACTATATTGAAACTAGAGGACGAGATCGTCATGGT
6783	55	48	MW2_CDS_04238	MW0779	FALSE	unmapped	TTCTTGATGTATATGGCTTGGACCATTTGGCATGATAAACCCTCAACAGATGGAGAAGCT
6784	55	46	MW2_CDS_12851	MW2432	FALSE	unmapped	AGCGAGCAAATGATTGGTTTAAAAAGTATGGCGTATGGGCTGTATTTATCTGTCGTTTCA
6785	55	44	MW2_CDS_07401	MW1383	FALSE	unmapped	TGCTTAAATTAATTTCACCAACATTCGAAGATATTAAAACATGGTATCAATTGAAAGAAT
6786	55	42	MW2_CDS_07628	MW1439	FALSE	unmapped	ACACAGAGGCAAAAGGCAAATTAGTTGCACAACCAATAACTACTATAAATAGCGCAAGAA
6787	55	40	MW2_CDS_11801	MW2237	FALSE	unmapped	TGGTTCATACCAAGGTGTGGAACTGATAGGTATTACGGCAGGTGAAACTAAAGATCCTCA
6788	55	38	MW2_CDS_08319	MW1564	FALSE	unmapped	TCACGGTTTTGTATCGGATATTGGGATTGTTAGATCGAGAAATGTAAGACAAATGGTTAA
6789	55	36	MW2_CDS_10045	MW1887	FALSE	unmapped	TGATATTCAAGTTTATACAGAGCAATTAACAGACGGTTTAAACGCTATATTAGGATTTTT
6790	55	34	MW2_CDS_07119	MW1330	FALSE	unmapped	GCAAATGGCTGTAGAAGCTGAATCGCAATTTGAAAGTTTTGAAGCTAATATTCAAACGCA
6791	55	32	MW2_CDS_09364	MW1759	FALSE	unmapped	AGTATCTCTACCATTGATACCGCTCAACTTTTTATTAACTCGATACTTTGGTGTGTTCGT
6792	55	30	MW2_CDS_08969	MW1683	FALSE	unmapped	AGCATTAGAAACGTTTGGTGGTGTTAAACGTCGTTTCAATGAAACTACAATTGCAAATCA
6793	55	28	MW2_CDS_11547	MW2189	FALSE	unmapped	TGGCTGAAAAGAAATTGGCACAAATTGGAGATGAAATAAATGAAAAATGGCCTGGAACGA
6794	55	26	MW2_CDS_08588	MW1617	FALSE	unmapped	TCCTACTTTAGTTATATGCACTAAAGAAGACAAAATTCCAAAAGGTAAAGTTCAAAAGCA
6795	55	24	MW2_CDS_04702	MW0868	FALSE	unmapped	TGGGGTTCCTGGATTAGGGGATCAATTCGTACGTTCAATTACAACAAATGATTTCTCAGT
6796	55	22	MW2_CDS_11133	MW2104	FALSE	unmapped	AGGCGCTTCGAGTGATCATTTAATGCTTGATTTAAATGGTCAAGGACACTATCAAGTTGG
6797	55	20	psma_tiling_069_R		FALSE	unmapped	ACACGTTAGGTCTCGTCTAGGCAAAGCATATTTATGAAGATGAATTGAACAGACAGAAGT
6798	55	18	MW2_CDS_05822	MW1083	FALSE	unmapped	ATTAACATCCCAATTGCGAATGCTGGTGATGGTAGTGGACAACATCCAACACAAAGTTTA
6799	55	16	MW2_CDS_08538	MW1608	FALSE	unmapped	AGATTTGCAGTATGAACATGCTTCTGATCGTATCACAGTTGATGATACTGCAACACAACT
6800	55	14	MW2_CDS_03877	MW0709	FALSE	unmapped	TGTTGCTATTACAAATGCAATTAACTTAATTGATGGACTCGATGGTTTGGCGTCGGGTGT
6801	55	12	MW2_CDS_08291	MW1559	FALSE	unmapped	ACAAATCGAAAGAGATATATCAGATGGCAACTTTAATGTTGATGACTGGGTGGTGATTGA
6802	55	10	MW2_CDS_10019	MW1881	FALSE	unmapped	AGTTGGTGCACTTACTGACAATAGTGCCAAAGCCGAATCTAAGAAAGATGATACTGATTT
6803	55	8	MW2_CDS_06577	MW1228	FALSE	unmapped	AGAAGCAAAGGAGCAAACAGCCTTAAGAAAAGCTTATCTTGAGAGTTTTAGAAAAGGGTT
6804	55	6	MW2_CDS_08789	MW1651	FALSE	unmapped	TCCGAAGATGAAATTAGCAAAATACGTAAAGCTGCTGAGTTAGCAGATAAGTGTATCGAA
6805	55	4	MW2_CDS_03328	MW0611	FALSE	unmapped	ATTGCCAAACGTATCGTTGGACCACGTCACCAGTTGTTTTTACCAATTGCCATTTTAGTA
6806	55	2	MW2_CDS_09630	MW1808	FALSE	unmapped	ACCGTATGTTACTACAGAAGCTGGAACGTTTAATCAAGCTATGATGGAATTAGGGGCATT
6807	55	163	MW2_CDS_12042	MW2281	FALSE	unmapped	TGGTGAGTGAAAAAGATTTAACAGGTAATATTGCGAGTTATCAAGCAGAGCAAGCACCGT
6808	55	161	MW2_CDS_00511	MW0095	FALSE	unmapped	AGGTGATGATCGCGGAAAAATATATCGCCATTTAAGTGCATCTCTAGCGACGTCTAAACA
6809	55	159	agr_tiling 046_R		FALSE	unmapped	AGTCGTTTTTTATTCTTAACTGTAAATTTTTTTATGTTAAAATATTAAATACAAATTACA
6810	55	157	MW2_CDS_00170	MW0032	FALSE	unmapped	ACACGACTTCTTCGGTTAGTCATATGTTAGATGGTCAACAATCATCTGTTACGAAAGACT
6811	55	155	MW2_CDS_02852	MW0525	FALSE	unmapped	TTTGGCGCGGATGTAATTACAATACTAGGTGTTGCAGAAGATGCATCAATTAAAGCAGCT
6812	55	153	MW2_CDS_10128	MW1906	FALSE	unmapped	AGCAAGAGACCGTGCCAGAGAAGAATTTCACAAAAGTTTTAGTGGAACTAAACAAGCTGG
6813	55	151	MW2_CDS_08750	MW1645	FALSE	unmapped	GGCAGGTGCACGAGTTGTTGGTACAGGACGTTCAGACTATCCTAACCAAATTAATAATGT
6814	55	149	MW2_CDS_06197	MW1151	FALSE	unmapped	CTTGGAAAAGGTGAGCGTGTTAATGTAGGGATTACTGACCCAGGCTTTGCTAAAAAGTTG
6815	55	147	MW2_CDS_10671	MW2015	FALSE	unmapped	CTCCATTATTAGCACGAGTAACTGGAGCTGGTTGTTTATTAGGAGGCGTTATTGCTGGAT
6816	55	145	psma_tiling_055_F		FALSE	unmapped	ATGAAGTTAACTCATAAGCAAAGGAGGTAATCTTAATGGGTATCATCGCTGGCATCATTA
6817	55	143	MW2_CDS_05700	MW1061	FALSE	unmapped	TGCGTATGTTCTTCTCTGGTGCTGTTGAAGTAGAACTTGATAAGCAAGGGCGTATTAACA
6818	55	141	MW2_CDS_03980	MW0726	FALSE	unmapped	CATCAGTACCAGGTATTTTTGCAGCAGGAGATGTTCGTGACAAAGGTTTACGCCAAATTG
6819	55	139	MW2_CDS_04897	MW0902	FALSE	unmapped	GTATTGCCTGAGCACTTCCCACATGGCGTATTATGGCAATCTATTTTCTGGACAGTACTA
6820	55	137	MW2_CDS_02798	MW0516	FALSE	unmapped	ACAACATTGATTTTTGGGTTAAGTGGTCATGAAGCTAAAGCGGCAGAACATACGAATGGA
6821	55	135	(+)E1A_r60_3		pos		
6822	55	133	MW2_CDS_11948	MW2265	FALSE	unmapped	ACACAGTGAAAGGTAATCCATTTGTGTCTCGCATGCGTAAATCAGATTGTATGTTTCCCG
6823	55	131	agr_tiling 199_F		FALSE	unmapped	TAGAGTGAAATAGAAATTGATAAATTATGTAGTAATAGGAATAGGTATACAAAGAAACGT
6824	55	129	MW2_CDS_03487	MW0639	FALSE	unmapped	GGCGGTCATGCTATTTTTAACAGGTTGTGGTAAAAGTCAAGAGAAAGCCACTCTGGAAAA
6825	55	127	MW2_CDS_09426	MW1771	FALSE	unmapped	TGATTGATCAGCCGATTGAAGGCTTTTTTAGTATAGCGGGCTTTAAAGAAGATGCAGAAA
6826	55	125	MW2_CDS_03355	MW0616	FALSE	unmapped	ACGTGCACTAGGTATCGTTACACCATTTTTAATTGTTTTAGTTGTATTAATCGCTGGCGT
6827	55	123	MW2_CDS_07801	MW1470	FALSE	unmapped	ATCGATGATGCTTGGTTGGCAGAAATAGAAGCGGAGCATAAAGACATCATCAATAAAGCG
6828	55	121	MW2_CDS_02676	MW0494	FALSE	unmapped	CCGTGGATTAACAGTAGCTGAAGTTACTGACTTACGTTCACAATTACGTGAAGCTGGTGT
6829	55	119	MW2_CDS_03885	MW0710	FALSE	unmapped	CTGTTAGAGACGTCATTTATGATGTCGGACGTGTCGAACTACGAGAAGCAGTACCATGTA
6830	55	117	MW2_CDS_04760	MW0878	FALSE	unmapped	AGCTTCTGGTATAGATCCAGACAAAGCAACATTGTTCATACAATCTGAAGTCCCTGCACA
6831	55	115	MW2_CDS_09210	MW1728	FALSE	unmapped	ACCCAGTACGTATTGATACGATTGTCGTATCAACACAACATGCTGAGGATGTGACACTTG
6832	55	113	MW2_CDS_09121	MW1710	FALSE	unmapped	TTGATAAGCATGATAACAGTTTTGACATTCATCTTATTCCAGAAACGAGGCGTTCAACGA
6833	55	111	MW2_CDS_12636	MW2390	FALSE	unmapped	TGCCGACTTCTGGATTAACAGGTCCAGAAAGTTACATATTGCCAGTGATCGTTATTACGA
6834	55	109	MW2_CDS_10524	MW1987	FALSE	unmapped	TCGAGATCCAAGGGACGAGTTTGAAACACCAATCCTTAAATCCGATGTGCTATCAATTGA
6835	55	107	MW2_CDS_03260	MW0599	FALSE	unmapped	AGTCATAACTTAGGACAAGTGAGACAATTTTGTACTAAGATTGCTTGGATTGAAGGCGGA
6836	55	105	MW2_CDS_08900	MW1670	FALSE	unmapped	ACTCAATGAAAATTGCTGCGACACAAGTTGAAGGTATCGGGTTTGCTATTCCAAGTAATG
6837	55	103	MW2_CDS_01639	MW0299	FALSE	unmapped	AGAAGCATACCCGTGACGCTTTACGTCAATTGGAACAGAATTATCATGACTCATCGTCTT
6838	55	101	MW2_CDS_05426	MW1005	FALSE	unmapped	GGTGAAGGTCTAACAGATTTGTTCGAATTCATGACGATGATTGAATATAACCATCAACGT
6839	55	99	MW2_CDS_01807	MW0329	FALSE	unmapped	TCCGTTTATCGTATACGCATCTATTAATCAATATCGCTTTAGGTGTGATTAATGCTGCAA
6840	55	97	MW2_CDS_10783	MW2037	FALSE	unmapped	AAAACAATTTTCCCTGGTATTCAAGGTGGACCTCTTGAGCATGTTATTGCAGCAAAAGCA
6841	55	95	MW2_CDS_01180	MW0217	FALSE	unmapped	CAACGTCGTAGAAATCCCATTAAACGACGAAGAACAAAGCAAGTTCGCACATTCAGCTAA
6842	55	93	MW2_CDS_10739	MW2028	FALSE	unmapped	TGGATATTTAGTTATCACGAGTGATAAAGGTTTAGCAGGTGCATATAGTGCAAACGTGCT
6843	55	91	NC_A_038		FALSE	unmapped	AAATTTCCTTAATTCATAAAACATTAATAACTAACCCTTTCTTACAAACCACCTAGCCCA
6844	55	89	MW2_CDS_11090	MW2096	FALSE	unmapped	TTCTTAGGTGGTGTGTCTTATACAATTGGTGCATGGTTTTATGCACAAAAGAATAGACCA
6845	55	87	perR_tiling_064_R		FALSE	unmapped	GTAGCAATTGCACCTGTACCTAAAAATAAAACTGTTTGTCCTGATAGGCGTTTACCAGTT
6846	55	85	MW2_CDS_11306	MW2138	FALSE	unmapped	ATGAACAGAGCGGCACAACAATTCATAGGTACACATGATTTTACGGGATTTTGTTCGCAA
6847	55	83	MW2_CDS_02571	MW0475	FALSE	unmapped	AGGTGCAGTACGTGAACATATTAGACATATTGAATTAAGTGGTCATGAAGGTATTGCAGT
6848	55	81	MW2_CDS_07915	MW1491	FALSE	unmapped	AAATCCATTATTAAAATAACGATAACAGTTAAAGTCGGTACAAATGTGCAGACTAAAACT
6849	55	79	MW2_CDS_01879	MW0344	FALSE	unmapped	TCCAAGCAAGATATCACGATTTGGACCAACTTCAAAAGCGATATAAAAGAAACGAAAGCT
6850	55	77	MW2_CDS_11318	MW2140	FALSE	unmapped	ACCAAAAGAGCTCTTCAAAGATAAAAAAAAATTGGCGGATTGGCATATTGGTTTGCCAGA
6851	55	75	MW2_CDS_12830	MW2427	FALSE	unmapped	TGAAGCATTTGATACGTTATTAGGTTTCGTAGAGTTAGATCATATTTATTCGTCAGCACT
6852	55	73	MW2_CDS_10880	MW2054	FALSE	unmapped	TTTTACACCTAGCAATAAATTAGCAGCCGTTATTGGTGTCGTTGGCGAAGTTGTTACGAC
6853	55	71	MW2_CDS_03024	MW0556	FALSE	unmapped	TCAATGAGTTATCAAAACATAATAGTATATTTTGCTTGGATTACAGCAATAATGGGTTTT
6854	55	69	perR_tiling_095_F		FALSE	unmapped	AAATTTTATTGAGAAACACGGATTGAATTTCGATTTATTAGTAGATGAAGATTTTAAATT
6855	55	67	NC_S_010		FALSE	unmapped	TAATCTGGCCTATCAAAGTAAACATCTATGGTTTCCTCCCCCCCATAGATCCTTAAGCCA
6856	55	65	MW2_CDS_07049	MW1316	FALSE	unmapped	GTTGAAGGTAAACTAGATGAGAAAAATACAATTCCACATACCTTTCTACATTTAATTCGT
6857	55	63	MW2_CDS_11072	MW2093	FALSE	unmapped	AAATGAAGAAATCTCACATGGCACGGCTATTATGAACTTTGGTCGTGTAATGGCTGGTTC
6858	55	61	MW2_CDS_01073	MW0198	FALSE	unmapped	CAATCACAGAACGGCCGTAGCTTAGCATCTTGTCATGATGCCTTCCAACCATTATTAAAA
6859	55	59	MW2_CDS_06405	MW1189	FALSE	unmapped	GCCCTGGTGAAACGAAGTTAGAGATGGATCGCAGACATATTCGAACTCGTATGAATGAAA
6860	55	57	MW2_CDS_12265	MW2321	FALSE	unmapped	CAGAAAGTGGCAAAATTCATGCGATTCACAATATCTGTCCACACAAACAAGGACCATTGT
6861	55	55	MW2_CDS_02102	MW0388	FALSE	unmapped	AGTGGTAAGGTTGAAAATTATAACGGTTCTAACGTTGTACGCTTTAACCAAGAAAATCAA
6862	55	53	NC_S_075		FALSE	unmapped	GTATTTTTGCGAAGTCTGCCCAAAGCACGTAGTGTTTGAAGATTTCGGTCCTATGCAATA
6863	55	51	MW2_CDS_02439	MW0451	FALSE	unmapped	AGAACGTTTGTTACCTGGCGGGTATTTATTTTTATCAGATTTGGTAGGTAATCCATCGCT
6864	55	49	MW2_CDS_11544	MW2189	FALSE	unmapped	GGTTTCTTCACCGCATCGTAAAGATGCCTATCGAGCAAATGAATATGCAATTGAGCGTAT
6865	55	47	MW2_CDS_02800	MW0516	FALSE	unmapped	ATACAAATGTTAGCGGTAGCTTTGAACAAGTCGCATTTGCGAAACGTGAAAATGCAACAA
6866	55	45	MW2_CDS_05950	MW1106	FALSE	unmapped	TGGTGCAACAGGCGGACGATTAGATCACTTTTTTGGGGCAATTCAGTTATTATTGAAAAA
6867	55	43	MW2_CDS_03828	MW0700	FALSE	unmapped	AGAGTATCCTTCATGTGGTAGTGTATTCCAAAGACCGCCTGGTCATTTTGCAGGTAAATT
6868	55	41	MW2_CDS_01441	MW0265	FALSE	unmapped	ATGGCAAAGTTTCAAGAAGAATTAGTACAACCGATTGCTGACCATCAAAAAGCAATTGAT
6869	55	39	MW2_CDS_03814	MW0697	FALSE	unmapped	TGCGTCCTGTTATTCAGATCAGATTGTAGCATTGAAAAACGGACAACTAGTTAAGTCAGA
6870	55	37	MW2_CDS_03429	MW0629	FALSE	unmapped	AGTGCTCCATTAATTTATAAGACATTAAGTGCGCTGTATCACAACTTTGATGGCTTTGGA
6871	55	35	MW2_CDS_02908	MW0536	FALSE	unmapped	TCCACTGTCTGCATATAGAGGATTCTTTGGATCAAAACCGTATTCCAAAGCGAATGCCTA
6872	55	33	MW2_CDS_05435	MW1007	FALSE	unmapped	TGTGAACAAGTAGGAGCTAAAACAATCATACGTGGTTTAAGAGCAGTCAGTGATTTTGAA
6873	55	31	MW2_CDS_06476	MW1208	FALSE	unmapped	GCAGTCGACTCAACAAATGGAACTAAAATAATCATTGAAATCTCAACAGGAGGAATAGCA
6874	55	29	MW2_CDS_08191	MW1541	FALSE	unmapped	AGGACAAAAGAATGTTGAACCACAAATTGGAGTAAACAGTGTGCATGTAAAAAATGGGAA
6875	55	27	MW2_CDS_04844	MW0893	FALSE	unmapped	AGTCAGACACCTGCCCTACAAAAAGAAGCAGAGCAAATTATTAAATTCGCACTAGCTCAA
6876	55	25	MW2_CDS_13660	MW2581	FALSE	unmapped	TGGGTATCGTAATGAAGGTGTATCAGAATCATGTCATGGCGGTATTAAATGGTATAACCT
6877	55	23	MW2_CDS_05300	MW0981	FALSE	unmapped	ACAAGAAGGAAGAACAAGTTATTTATGATGAGTATGATGAAGGTTATATATTAAATTGGT
6878	55	21	MW2_CDS_00997	MW0185	FALSE	unmapped	AGGTGCTGATGATACGAGGGAAGGTACAGTGATGGGTGGTGAGGTATTATCAATTAGAAA
6879	55	19	MW2_CDS_00706	MW0131	FALSE	unmapped	AACATGAGTATTATTAGAGAAAGTAATGTAACCGATGGGTTTAAAAAAAGATGGCCAATT
6880	55	17	MW2_CDS_08088	MW1523	FALSE	unmapped	CATTTGGTAAGACGATTCGTGCGAAAACGATGGGGCAACGTATATATGTTAATGCCATGA
6881	55	15	MW2_CDS_11665	MW2210	FALSE	unmapped	ACAAGAGCAACTTACCTATTCTGATGGTTTAGCCATGCGTTTAGTTTATGATGCATTGGA
6882	55	13	MW2_CDS_06488	MW1211	FALSE	unmapped	AGCATTTCAATTTATGAATCATACGGGTCCTTTCAAAAAGGGGACGAATCATGAAACTGT
6883	55	11	MW2_CDS_08807	MW1654	FALSE	unmapped	ACGTGACTTATCAGAAGAAGCTGAATCAGGTAAAGCACGTTCACAAATGGCTTTAGATGT
6884	55	9	pMW2_082		FALSE	unmapped	ACAAATTAAAGCAGCACAGATGATATTAGATGATTATGAATGTATTAAAAGTGGGAAGTC
6885	55	7	MW2_CDS_04691	MW0866	FALSE	unmapped	CACAAGCTCGAGGTGCCAATATTTATGCTGAGATAGTTGGCTATGGTACTACAGGTGATG
6886	55	5	MW2_CDS_01042	MW0192	FALSE	unmapped	ACGCTTATCGTAGCATCTGCAAATGCACTGTTTAGTGTGATATTTGTCACGTTAACAGCA
6887	55	3	MW2_CDS_11413	MW2162	FALSE	unmapped	ACGTCTTGGATCACATCTCGTCAAATCGAATCTGCTCGTATAGCAATGACACGTTACATG
6888	55	1	MW2_CDS_12748	MW2411	FALSE	unmapped	AATTTCAGCTCAGTTCAAAGTGCTAATCCTGAAGATCATCGCGCTTTTGATCAAGCAGTC
6889	54	164	MW2_CDS_10634	MW2007	FALSE	unmapped	CAAATGGGACGAATCAATTCATGGCTTGACCCCTATACATATAGTAGTGGCGATGGCTAT
6890	54	162	MW2_CDS_00994	MW0184	FALSE	unmapped	GTCAATGGACAAGCACGTAATACTGGAGAGCGTGTATCGGCTGAAGATGTTAAGTTTTCT
6891	54	160	perR_tiling_041_R		FALSE	unmapped	ATTCTTATTGAGAAAATTAACTAGATTGTTTTTAAAAATATCTAATAAGTCATACTTTGC
6892	54	158	(-)3xSLv1		neg		
6893	54	156	MW2_CDS_06598	MW1232	FALSE	unmapped	TTAACGATGTATTTATTCCTCTTAAGCCACTTAGACAATTGGAAATTATCTCAGGCGAAT
6894	54	154	MW2_CDS_10460	MW1975	FALSE	unmapped	AGTGCAATTAATGCCTGCGATTAGTCAGCTATTTGAGCAGAGCAAAATAGCTAAACAGCA
6895	54	152	MW2_CDS_12944	MW2449	FALSE	unmapped	CATTTAATTGTTGAAGCAAAAGCTAAAGGTTATCGTGCGCTAGTTGCAGGCATTGATGCT
6896	54	150	MW2_CDS_03403	MW0624	FALSE	unmapped	AGAGAATTATAGTATTTTGAGAAAGCTTGGATTTACACAAAAAGATATGGCAAGGGGACT
6897	54	148	MW2_CDS_08273	MW1556	FALSE	unmapped	ATTTCAACCAACACCAGGTAAAGTGACAGCGTTACATTTACCTCAAGGCTTTAATGTGCG
6898	54	146	MW2_CDS_06431	MW1197	FALSE	unmapped	ATTGATATGATTCTAAAGAGATTATATAATAGTGGTAACATAATATATAAAGTTAGGTGA
6899	54	144	MW2_CDS_04501	MW0831	FALSE	unmapped	ATTCTTTGGTGCTTTGTTAACAAAAGTTGGTGTTTATGCAATCGCTAGAACATTGAGCCT
6900	54	142	MW2_CDS_03587	MW0658	FALSE	unmapped	AGCAACAAATGAAGATGCGCTTGCTAAGGTACATAAAACAATTAATACGCTTAACGCGAT
6901	54	140	MW2_CDS_01831	MW0333	FALSE	unmapped	ACTCAATTGTCATCATGGCCCGCACCATATGCAAGAGTCTTTCACACATATTGAATTACC
6902	54	138	MW2_CDS_13152	MW2489	FALSE	unmapped	TCATCAAAATATTGTTGGTACTATAGGTTTGATTAGACTAGATAATAATATGTCTGCACT
6903	54	136	MW2_CDS_11800	MW2237	FALSE	unmapped	AGACATTGGAAGTCCGTTTGTTGCAACATTTGCTAAAATCGGTATTACATTTGCAGCTGG
6904	54	134	MW2_CDS_08903	MW1671	FALSE	unmapped	TGCTTTAGCACCAGAAGATAAAATTGATGGCGAATTTACGATTATTCGTCGCGGTAAGAA
6905	54	132	MW2_CDS_04154	MW0760	FALSE	unmapped	ACCAGAATCACACCGCTTAGAATACTCGTATAAAAATGATACATTGTATGCTGAATTTGA
6906	54	130	MW2_CDS_10125	MW1905	FALSE	unmapped	ATCGTTGTAAGTTACCAAACACAACATTTGCACGTGATTTATATGAGAACATGCGTGTAG
6907	54	128	MW2_CDS_09604	MW1804	FALSE	unmapped	TATGGTGGACGTCAAGATATTATGGAACAAGTAGCACCTCTAGGACCTGCATATCAAGCT
6908	54	126	MW2_CDS_09803	MW1840	FALSE	unmapped	TTCCCAGAGCCTGACATTGTACCTTTATATATTGATGATGCTTGGAAAGAGCGTGTTCGT
6909	54	124	MW2_CDS_01066	MW0196	FALSE	unmapped	ACTTATCTTTTTCTGTATCAGACTTGTCAGCTTAAAGATATCTATTAATCACTCAAAACA
6910	54	122	MW2_CDS_11191	MW2114	FALSE	unmapped	ACATATGGTAACGACAAGTCACTGCCACAGTTAAACAAACAAGTGAATATTGCAGGGACA
6911	54	120	MW2_CDS_09012	MW1691	FALSE	unmapped	AAAAGATCATCCTGAATTGGTTGACATGGACGGTCAACATGCAGGGAAAATGACTGAATG
6912	54	118	MW2_CDS_11614	MW2200	FALSE	unmapped	TCAGTACCAATTGTACTTCAAAACATTGGTATTTTCTTAGCAGGTGTGATTTTAGGACGT
6913	54	116	MW2_CDS_03697	MW0677	FALSE	unmapped	TGAGATACGTTTATTTTTGATAAATAGTTTACGAGAGGTTGCCGATGTCCACCTTTGCCT
6914	54	114	MW2_CDS_00676	MW0126	FALSE	unmapped	AGTAATGCGAAGTTAGTTGTTGATGATAAAAAAATTCCTAAACGAATGCCACAACAAGAT
6915	54	112	MW2_CDS_11240	MW2123	FALSE	unmapped	CTTTGAAACATTGTGATAATTGTGGTGGTGCCATTCGACCGGACATCGTATTATACGGTG
6916	54	110	MW2_CDS_06583	MW1229	FALSE	unmapped	AAGGTAAAAATGTGTGGTTTGGTGTACGTGAATTTGCTATGGGTGCTGCTGTAAATGGTA
6917	54	108	MW2_CDS_08335	MW1568	FALSE	unmapped	ACTGAAGTGGATGTACCAAATGCGAAAGCAATTCGCTCGACAATGGACGATTTTAAATCT
6918	54	106	MW2_CDS_00181	MW0034	FALSE	unmapped	ACGGCTAGGTTTTAAAAGATATGCCTATCGTCATGATAAGTATGGTTATAAGCGAGACTT
6919	54	104	MW2_CDS_12012	MW2276	FALSE	unmapped	GATGCTTGTTAATGGTATTGCACCAGTTGTTGCGCCAACAATAGGGGGCATAATTTTAAA
6920	54	102	MW2_CDS_05516	MW1022	FALSE	unmapped	ACTAATGGACAAACTCCAATTGCATTAGCTGGTGTTATGGGTGGCGATTTTTCAGAAGTT
6921	54	100	MW2_CDS_08260	MW1554	FALSE	unmapped	TTTGCGCCAGAACATCCAATGAAATTAGTCTTGCCAATCATTACGTTAGTTGGTGGAACT
6922	54	98	MW2_CDS_12325	MW2334	FALSE	unmapped	AAAGATTTGGCTAATGAAGGCATGACAATGGTCATTGTGACACATGAAATGCGTTTTGCT
6923	54	96	MW2_CDS_08554	MW1611	FALSE	unmapped	TGGGTGTCGTACCGCCGATTGAAGGTTTTTTACAGGGATTAAGAAATATTACGACTGAAT
6924	54	94	MW2_CDS_00598	MW0111	FALSE	unmapped	ATTGGTGCCTTAATTGCGATTATCGTTTTTGCGCTATATATTAAAAATGCGCAACGTCCA
6925	54	92	MW2_CDS_11999	MW2274	FALSE	unmapped	GGTATGGAAGGTTCAATGGTGCAAGCTGGTAACCCAATCGCTTATGCATACAATTTAGAT
6926	54	90	MW2_CDS_02580	MW0477	FALSE	unmapped	CTAGAGATATTATTAGAGCAAATATTTTAAAACGTTTGTTACCAGTTATAAATTATTACT
6927	54	88	MW2_CDS_01909	MW0351	FALSE	unmapped	TTGTGGACAATTAGATGTGCCGTTAACGGATACTGGCACAAAAAGTGCAGACGATTTATG
6928	54	86	MW2_CDS_01142	MW0210	FALSE	unmapped	GATGATAACGGTGAGGAAGTACCTACTGGTGAGATTGGCGAACTTGCAATTAAGGCTAAA
6929	54	84	MW2_CDS_10560	MW1994	FALSE	unmapped	TGGTCGCGTATGTATGGATCAGACAATTGTTAAAGTGCCAGATCAAGTTAAAGCTGGAGA
6930	54	82	MW2_CDS_08521	MW1605	FALSE	unmapped	AGAAGATCGAAATGTGATTATTGTAATTCGTCACTCAAATGGTATGAATTAATGCCGATT
6931	54	80	MW2_CDS_06023	MW1120	FALSE	unmapped	TGGTTTAGAGCTATTCCATCCTGAACGTATGGCATCACGTATTTTAGGTATGGGTGATGT
6932	54	78	MW2_CDS_04581	MW0845	FALSE	unmapped	AGCGAGTCTATCTCATATTAGACCTAAATATTATTTCATTGTTTTGGCATCATCAAAGTT
6933	54	76	MW2_CDS_02341	MW0432	FALSE	unmapped	ACTTTAACAGAGTTAGATTATGATAAATCTTTAAATAGTATTGAAGAAAGTTTTGATGAT
6934	54	74	MW2_CDS_00627	MW0116	FALSE	unmapped	TCTTGCAGATGAGCCAGTTGCTTCATTAGACCCATTAACTACGAAACAGGTTATGGATGA
6935	54	72	psma_tiling_046_R		FALSE	unmapped	CCCCTTCAAATAAGATGTTCATATCTATGAGATTTTTATAACTTACTTACCAGTGAATTT
6936	54	70	MW2_CDS_04777	MW0881	FALSE	unmapped	AGTAAATTGATTTTAGCACAGATGATACAGCAACAAGGATTTAAAGTAGAGATAGAGCCA
6937	54	68	MW2_CDS_09174	MW1721	FALSE	unmapped	TACAACAAATCCTAGTTTAATGGCGAAAGCGGGCGTAACAGATTACAAAGCTTTTGCTGA
6938	54	66	MW2_CDS_00134	MW0024	FALSE	unmapped	GCCTGCACAAGGACGTCTTACAACGTAGTAACTACGCACTATCATTCAGCAAAATGACAT
6939	54	64	MW2_CDS_09987	MW1873	FALSE	unmapped	ACAATTGCTTAATGCCAACTATATTACATGCATTGTTTTAACATTAATTGGAACGCTTGT
6940	54	62	MW2_CDS_05031	MW0931	FALSE	unmapped	CGGTAAATCACAAGGCAGAGATATTCATTATCAAGAAGGCGTACCATCATATGAACAAGT
6941	54	60	MW2_CDS_05479	MW1015	FALSE	unmapped	AGAGGAAGTGCCATTCGGTATTACAGCAAATGTTGATGCTGATAAGGCAATGACTCAATT
6942	54	58	MW2_CDS_07816	MW1473	FALSE	unmapped	AGGCACAATTTGTGGTGATGATACTTGTTTAATTATTTGTCGAAGCAAAGAGGCAAGTGA
6943	54	56	MW2_CDS_01325	MW0242	FALSE	unmapped	TGGTCATGGCACGATGGAACGCTTGAAAAAAGATTCGTTCTATTGGTATCAACAAGTGAT
6944	54	54	MW2_CDS_06737	MW1258	FALSE	unmapped	ATTTTGAAGCACATAAAAGACATACCTTATTTGATAGCAGGAGGCATTAACTCTGAAAAT
6945	54	52	MW2_CDS_05718	MW1064	FALSE	unmapped	AGGTATGTTTGATGGAGAAGCACCTGGTCAAATTGGATGGAGTAATGAGTTGCAACAAAA
6946	54	50	MW2_CDS_05893	MW1096	FALSE	unmapped	TGGTATGTAGATCCAGATGGAAAGAAAATTGGCAATTCAAACACACCTGTTTTTTACGCA
6947	54	48	MW2_CDS_04470	MW0825	FALSE	unmapped	CAGATTCAATGATTTTTGGTGCACTGGCAGGGGTACTCGTATTCTTTATTTCACGTGCAT
6948	54	46	MW2_CDS_08001	MW1508	FALSE	unmapped	ATTATCAGGTGGTCAACAACAACGTGTAATGATTGCTCGAGCATTGATTTCAGAACCTGC
6949	54	44	MW2_CDS_07245	MW1354	FALSE	unmapped	CGAATAGGAATGATGCTTGCAGTTGCTTCTCTACTTTCAAGCGAGCCTGTCAAAATCAAA
6950	54	42	MW2_CDS_09086	MW1704	FALSE	unmapped	CCAGAAGGACATGTTTATGGTTTCGACATTCAAGATTTAGCTTTAGAAAATACACGTGAT
6951	54	40	perR_tiling_014_R		FALSE	unmapped	ATGATGTGTTACGTCAAAGTCAGTCATATGCTGAGCTAATCTTTCAATTTCATTTAACTG
6952	54	38	MW2_CDS_04976	MW0920	FALSE	unmapped	TTTGTGTTATGTTAGGCTCAATCTTCACACTTAAACTTACAAGAGGATATGTAAGTGGTT
6953	54	36	MW2_CDS_03580	MW0656	FALSE	unmapped	TGTGATGACGTTGTATTAAAATTTTTCAATTTAACAACGAAACAATACGAAGAAAAACAT
6954	54	34	MW2_CDS_13532	MW2559	FALSE	unmapped	TGATCAAACTTTTAAAGGTGTTTCTGCAAAAGGAAACGAAGCAAGTCAATTGCAATTTGT
6955	54	32	MW2_CDS_01752	MW0319	FALSE	unmapped	AAGCGATTGAAAATAATGATATGGCCCAAGCAAAAGCGTTATATCCAAAAGTTCGTATGT
6956	54	30	perR_tiling_029_F		FALSE	unmapped	TCAATTGCATCATTGCGACAAGCAGGCGTAAGAATTACACCTCAAAGACAAGCAATATTA
6957	54	28	MW2_CDS_13867	MW2617	FALSE	unmapped	TTGGTGGAACGATTGGTACACTAGTTTCAGGTTTCTTTTTAGTGCTTATCGGTGTGTTGA
6958	54	26	MW2_CDS_01048	MW0193	FALSE	unmapped	AGAAGCAAAAGCTTGGATTGATGCAGTTGTAAATGATACTGAACCAGTTGTGAAACCGGA
6959	54	24	MW2_CDS_03978	MW0726	FALSE	unmapped	TCGGTGGTGGTGACTCAGCAGTAGAAGAGGGAACATTCTTAACTAAATTTGCTGACAAAG
6960	54	22	MW2_CDS_04661	MW0860	FALSE	unmapped	AAGTTTTGAAAAACTTTATTTACAATTACAAGATGGTTTTCCAGTGATTGTTCCTACTGA
6961	54	20	MW2_CDS_03624	MW0664	FALSE	unmapped	AGATGATTACGTGGATACAACTTATGATCGCTGGGTTGTTTCAGAAATCGATAACCACCA
6962	54	18	MW2_CDS_09912	MW1859	FALSE	unmapped	TGACACATCGCGCACTATTAGTTGTTGACTATTCATATGACTTTATCGCAGATGACGGCT
6963	54	16	MW2_CDS_09195	MW1725	FALSE	unmapped	CCGGCAAGGTTGACTAGAATTGAAAAAAGCTTGTTACAAGCGCATTTTCGTTCAGTCAAC
6964	54	14	MW2_CDS_09512	MW1787	FALSE	unmapped	ACGCAACAGACTTATTATGTGATCGTGCAAGGAATTATTTATCATCTGCAAAAGGCACAC
6965	54	12	MW2_CDS_01077	MW0198	FALSE	unmapped	CACTGCTAAAGATGGTGTTGAAGCATTATCACTAATTCAACAACATCAGCCAGAATTAGT
6966	54	10	MW2_CDS_00517	MW0096	FALSE	unmapped	TGGTCTGAAAAACATCGATTTCCACTCAAACATATCAATCTTGGTGGTGGTATAGGGGTT
6967	54	8	MW2_CDS_05667	MW1053	FALSE	unmapped	GTTTATTTTCGGAGTACCTTCTGAAATGATAAAAGATAGGCAAAGGAAAAATAACGGCGT
6968	54	6	MW2_CDS_01353	MW0247	FALSE	unmapped	ATACTTTGCGCGCGAATCAATTGCCAGAACCACAAATCGTCCATACTGAATTATCTAAGC
6969	54	4	MW2_CDS_07906	MW1489	FALSE	unmapped	TCAATTACACCATATGAAGGTGGTATCGCTTTTGCAAGTAAACCATTAATTGATGCTGAT
6970	54	2	MW2_CDS_11134	MW2104	FALSE	unmapped	TGCGATTACATTGGAGGCTGAGATTTTAGAAATTAAACCTCGAGTTAATACACAAACGCA
6971	54	163	MW2_CDS_08055	MW1517	FALSE	unmapped	ACAGTACGTGACAGAGATTCAATGGAACAAGTTCGTATGCCAATCTCAGAGTTAGAAGCT
6972	54	161	MW2_CDS_10938	MW2065	FALSE	unmapped	ATGCTTTATGGCAAGTATTTACCAAATGAAACAGGGGCATTATACTATCGTGAAGGGTTT
6973	54	159	RC8		pos		
6974	54	157	MW2_CDS_07520	MW1408	FALSE	unmapped	GCTTAGGGAAAGTGCCATGGAATACTAATTTTAAGACACGTCAATGGCAAGACGGTGATG
6975	54	155	MW2_CDS_12946	MW2449	FALSE	unmapped	ACTTATGAACCACAAACCATAGACGAACGTGTCGCATGGTTTGAAACGAAACAACGTAAG
6976	54	153	MW2_CDS_01654	MW0302	FALSE	unmapped	TTGTGGGAATTATATCGAGGCTTAGCAAATGTCAGACCGGCATTACCTGTAAGTGATGAA
6977	54	151	MW2_CDS_10990	MW2078	FALSE	unmapped	CATGTGCAACTACAGATTAGTGTTTCAAATTCATCAAGATTTAATGCGGAAACAATGGCT
6978	54	149	MW2_CDS_13178	MW2494	FALSE	unmapped	TAAAAGTGGTTGATCCAATCGGTCAGGATGTCACACCAGATAAAGTGTATGATCTTCGCC
6979	54	147	MW2_CDS_11482	MW2176	FALSE	unmapped	AGATGATATGATTAAGACGACATTGTTGGTCACTTGGATGTTCCCGGTAGGTGTTGCAAT
6980	54	145	MW2_CDS_04163	MW0762	FALSE	unmapped	TGTGTACGAAGAATTAGAAAGAACGATTGAGAACAATGGTTATGAAGCTGATTTGAATGT
6981	54	143	MW2_CDS_08468	MW1593	FALSE	unmapped	TGTAACTGATATTGTGGGTATGTTGGCACGTGTACTAGATGTTATATCAAAGTTAGAACT
6982	54	141	MW2_CDS_09742	MW1829	FALSE	unmapped	TCATTAGCTATGATTCCAGGTATTCATGATGCCTACATATTCAACTTTTTGTCTCGAACA
6983	54	139	MW2_CDS_03286	MW0604	FALSE	unmapped	CCATTATTCACTATCATTGGTGGTGCATGCCTTGTCGCTGGATTAGCACTAATTGTTCAT
6984	54	137	MW2_CDS_05432	MW1006	FALSE	unmapped	ACGAGACCAACTATGGATAAAGTTAAAGAAGGTATCTTTAATAGTTTATATGATGTGTCA
6985	54	135	MW2_CDS_13459	MW2545	FALSE	unmapped	AGATGAAGCAAAAGTCGTGTATCAAGAACAAAACATACAGCTATCTTTGACTGAATTACA
6986	54	133	perR_tiling_075_F		FALSE	unmapped	TACAACGTTGCCCGAATTTAAAATGGATTGCATGGTTTGCAACGGGTGTAAATACATTGC
6987	54	131	MW2_CDS_05117	MW0947	FALSE	unmapped	TGGTTCAATTTGCTTCTGAAGCGAGAGAAAGAGGTATAAACATTATCATTGCAGGCGCTG
6988	54	129	(-)3xSLv1		neg		
6989	54	127	MW2_CDS_01354	MW0247	FALSE	unmapped	ACAATATGATGATTGTTGCACCATATGACATGATGGCGAATATGTCGACTCGTGTCGCTG
6990	54	125	MW2_CDS_09638	MW1809	FALSE	unmapped	ATGAGAGCCGTAATTAAGCAACAAGCTTTAAAAGCAATTCAACAAGAGCATCACCCTGTT
6991	54	123	MW2_CDS_03748	MW0686	FALSE	unmapped	CTAGAGCTGTATTAACGCCAGGGGATACTATTGTTACAAGTGAAGCGACATTCGGTCAAT
6992	54	121	MW2_CDS_00757	MW0140	FALSE	unmapped	AGGCAGTGCGGAAGAAACGATTGAACGTTTTTACAATAGACAAGGCATTGAAACTATTGA
6993	54	119	MW2_CDS_05780	MW1075	FALSE	unmapped	TCGCGTTTCCGTATGTTAGTTGAAGCGCAATTAGACTTATTAAAAAACGAAGATTGGGAT
6994	54	117	MW2_CDS_07214	MW1348	FALSE	unmapped	GAAAGCTTTGGACTAACTTTACTTGAGGCTATGAAAACAGGCGTCGTTCCAATTGGTTCA
6995	54	115	MW2_CDS_13387	MW2533	FALSE	unmapped	ATTGGACAGACAATGGATTTGTATGGCACTAATAGAAGTGTAGGAAACTTATATGGCACT
6996	54	113	MW2_CDS_02670	MW0493	FALSE	unmapped	GCTACACCAGACATGATGGGTGAAGTTGGTAAATTAGGTCGTGTATTAGGACCAAAAGGT
6997	54	111	MW2_CDS_12594	MW2382	FALSE	unmapped	ATTGCATTATCAGCTTGTGGTAAAGAACAAACCAAAACATATGAAGGTGATGTTAGTGGT
6998	54	109	MW2_CDS_11694	MW2216	FALSE	unmapped	ACGAGGGATTGTTATTTATCAAAATGACACGATGATTGTAACGAAGTTCAAACATGAAGT
6999	54	107	psma_tiling_012_R		FALSE	unmapped	CCTTTTTATGTTTGCTTTGATGAAAAATGGCAAAACCATCGTACCAACTGTTAATTGAAG
7000	54	105	MW2_CDS_00488	MW0092	FALSE	unmapped	GACGAACAGTATGTTAGTTGTTGGTCAAATTATTGGCAGTCTTAGTGGCGCTGCCATTAC
7001	54	103	MW2_CDS_12864	MW2434	FALSE	unmapped	ATTTTAGCAGTTATTCAAACGGCACTTTTAGAAAAAATAGACTGGCTAAAGTGGAATCCT
7002	54	101	agr_tiling 027_F		FALSE	unmapped	TGAGTAACATTTGCTAGTAGAGTTAGTTTCCTTGGACTCAGTGCTATGTATTTTTCTTAA
7003	54	99	MW2_CDS_09380	MW1762	FALSE	unmapped	AGCGTCAAAAACATTTAAAAAGAATGTTGTCGCACCTGAACCATATAAAGTTCTGGAATT
7004	54	97	MW2_CDS_07441	MW1391	FALSE	unmapped	AGGATTGACTGAAGAAGATGTTCTGAACAAGATGAGTACTAAAACTTATACAAAAGCCTT
7005	54	95	NC_S_024		FALSE	unmapped	TTGGCAAAATTTTGACCTTGCTATTGAAATGACTAAGACTTCTTAAGGAATTCGGGCAGA
7006	54	93	MW2_CDS_06372	MW1183	FALSE	unmapped	GGAAAAGTAAATTATGCGCTTGAAGGTTCCATCTTTGTTTCGGGTTCAGCAATCCAATGG
7007	54	91	MW2_CDS_01903	MW0349	FALSE	unmapped	GGAAGTATTTACATCTTGCCAGCATTAATTGGTTCAATTATCTTAATTGCAATCGTAACG
7008	54	89	MW2_CDS_00494	MW0093	FALSE	unmapped	ACGCGAATAACGCAGTGTTTGTTGACTGTGTAGAAGATTTATATCAAACGCCGACCATTG
7009	54	87	MW2_CDS_13012	MW2462	FALSE	unmapped	AGATTGTACCGCTAACTTGGGTAGAAGACGGTGCAAACTTTTTATTAAAGACGATGGTCT
7010	54	85	MW2_CDS_06776	MW1265	FALSE	unmapped	ACTGCATTACAATATATATTTGATGCAGATGTTAAATATATAGCATTTGGTAATGACCAC
7011	54	83	MW2_CDS_01067	MW0197	FALSE	unmapped	TGATAACTGGGCACCGTTATATGTGTCAGAGCATTTACACTTTAGTAAAGGCGATGCAGT
7012	54	81	MW2_CDS_12051	MW2282	FALSE	unmapped	CGATGACGTTACCGAACAAGGAATTTCAATTATTATTTATGCTTGCAGCACGTCCTAAGC
7013	54	79	MW2_CDS_11765	MW2230	FALSE	unmapped	ACTGTTGATGGTGTTCGTTTTACAAAAGGACAGCAGACACATGTAAATGGTGATCAAGCA
7014	54	77	MW2_CDS_11594	MW2197	FALSE	unmapped	ACCAATCACATACGAAGCTGGTGCTACATCAGATAGTAAATTAGCAAAAGAGTGGATGGA
7015	54	75	(+)E1A_r60_1		pos		
7016	54	73	MW2_CDS_05936	MW1104	FALSE	unmapped	AGACATGTCGAACTATTCGAACGTCAAAACGGTTATATTGCAGACACACCTGGATTCAGT
7017	54	71	MW2_CDS_02859	MW0526	FALSE	unmapped	ACATATATTTGTAGCTGGTAAAGGACGTTCAGGATTCGTGGCGAATAGTTTTGCAATGCG
7018	54	69	MW2_CDS_08784	MW1651	FALSE	unmapped	ATGAAATGAGTTTTGATACGATGGTTTTATTTGGAGATCATGCCGCATCACCTCATGGCA
7019	54	67	DCP_20_0		pos		
7020	54	65	MW2_CDS_12152	MW2299	FALSE	unmapped	TGCTGCATTAGGTATGATACTAGTTCATCCATCGCTAATGAGCGCATACGATTTCCCAAA
7021	54	63	MW2_CDS_01862	MW0339	FALSE	unmapped	AAACCCGCTCGTAGTATTGACTTTAATGAAGAAGATCAAAAATGGGTGAATCAAGCGCAA
7022	54	61	MW2_CDS_10957	MW2068	FALSE	unmapped	AGGTGAAATTCCTAGAGAAGATGTTGCGACAGTATTAAAAGAAATTGTCACATCCAATCA
7023	54	59	MW2_CDS_11023	MW2085	FALSE	unmapped	ACACGGTTTAAAAGCGTTTTTAAGCGAATATGCTAAAGTTGACGATGGCTTAGCCGATGA
7024	54	57	MW2_CDS_01569	MW0287	FALSE	unmapped	GGTGTCGACTTAATTGGATCGATTGTCATCTTAGCGCCATTAGCTCGTCTTATTGCAGTA
7025	54	55	MW2_CDS_00690	MW0129	FALSE	unmapped	CCGAAGAGTATGGCAATACGGTTTATATTTATCGCTGGCCAAATTTATTCGGCAAGTGGT
7026	54	53	MW2_CDS_04179	MW0764	FALSE	unmapped	AACAACGCAAGATACTTCAACTGAAGCAACACCTTCAAACAATGAATCAGCTCCACAGAG
7027	54	51	MW2_CDS_01224	MW0226	FALSE	unmapped	ATCGCGTTCATTTTGAAAAAATTCTGCGTAACGAGTTGACAGTATGTGGCTCTTGGAACT
7028	54	49	MW2_CDS_03669	MW0672	FALSE	unmapped	CAGACAGCGTAGATAATCATACCGAAAAGTTGTTAGAACGCTACGAGCAGTTGGTGGATT
7029	54	47	MW2_CDS_09465	MW1778	FALSE	unmapped	AGTGGGAAACACATGAAGACATTTTAGATAACGATGCAAAACAACAAATTGCTGAACAAA
7030	54	45	MW2_CDS_08676	MW1633	FALSE	unmapped	GCTATGAATACGCCAATACAGGGCAGTGCTGCAGATATCATTAAACTGGCAATGGTTAAA
7031	54	43	MW2_CDS_09815	MW1842	FALSE	unmapped	AGATTTTGCAAAACAAAATGATAGCGCTGATACAGAAGGCGTTGAACCTACATATCACGT
7032	54	41	MW2_CDS_09344	MW1755	FALSE	unmapped	CTAAGGAACCATACAATTCAGTGGTAGCATTTGTGGGTGGTACTGGTGTAGTTGTTGGTA
7033	54	39	MW2_CDS_09079	MW1703	FALSE	unmapped	GTACTTAAAGAACCGGGTGTTGTAGGATTATCTATTGGTACGCGTCCTGACTGTCTACCA
7034	54	37	MW2_CDS_03194	MW0587	FALSE	unmapped	TGAATTTAATATTATTACTAGTTATAGGATTTTTAGTGTTTATAGGAACATATATGATTT
7035	54	35	MW2_CDS_02557	MW0473	FALSE	unmapped	GGCTTTGGCGGTATAGACGATGATGCTTTAAAACCGCATGTAGACGCTCTAATAAAATCA
7036	54	33	MW2_CDS_03826	MW0700	FALSE	unmapped	AGTGTATATGAATGCTGGCGCTTATGGTGGCGAAGTTAAAGATTGTATAGACTATGCGCT
7037	54	31	MW2_CDS_11934	MW2261	FALSE	unmapped	ACAACAGCAAATATCGTATTGGCTTGAGCGTTTTGATATTACTGAAAACCGCAAAAAACG
7038	54	29	MW2_CDS_13937	MW2631	FALSE	unmapped	AGAAATAGACCATTTTCGCTTAGGTATTAGTGTTTCTAAAAAACTAGGTAATGCAGTGTT
7039	54	27	MW2_CDS_07600	MW1432	FALSE	unmapped	AGCTACTTAGAAATAAACAAAGTCTTCTATGCATTAGATAGAGAACTTCAATACAGAGCG
7040	54	25	MW2_CDS_06307	MW1171	FALSE	unmapped	AAACAACTTCTGAAAAGTATGCAATGGGATGGCATTTAGATGGTAGAGCTAGCGCTGTTG
7041	54	23	MW2_CDS_02177	MW0401	FALSE	unmapped	TGGTGATGTCTCAATTAATGAGAATGTTCCAAGTTATGACGCAAAATTTAAAATGAGCAA
7042	54	21	MW2_CDS_12113	MW2293	FALSE	unmapped	ATTGCTGTTTCGAAAAGTTATCAAGGTCAAGGTTACGGCAGTCAAATTATGGAACATATT
7043	54	19	MW2_CDS_01357	MW0249	FALSE	unmapped	AGAAACAGTAGAATTATCATATGATGCTGTTAATCGTATTGTGTTAAAAGATGGATGGTT
7044	54	17	MW2_CDS_02847	MW0524	FALSE	unmapped	TGGTCATATTGGATTTAATGAACCTGGTACGCCGTTTGACAGCGTTACTCATATCGTTGA
7045	54	15	MW2_CDS_05436	MW1007	FALSE	unmapped	AGAGCGTATGGATTTAATTGAACAATCTGTTAAACATTTACCTAATGTCAAGGTTCATCA
7046	54	13	pMW2_015		FALSE	unmapped	GGTAAACCTATATATGTTTTTGAGATGAATAAAGCATCTACCGAATCCGCGGAAAAGTCT
7047	54	11	MW2_CDS_03918	MW0715	FALSE	unmapped	ACAAGGCAGGGCAACCAGTGCTATTAGGTACTGTTGCAGTTGAGACTTCTGAATATATTT
7048	54	9	MW2_CDS_05258	MW0974	FALSE	unmapped	TGGCAGTGGCAAATCTTATGACTATATGCTTGTGAACCCAAAAATTGTAAGTCATAGCGT
7049	54	7	MW2_CDS_08684	MW1634	FALSE	unmapped	ACAGATATTGGATTGGTTGGTTTTGTGAACGTAATTGTATGTGGTTACTTTGCGTTTTCG
7050	54	5	MW2_CDS_09993	MW1874	FALSE	unmapped	CGACTGGGATGAAAATGAAATTATCACTAGCAGTTGCATTTTCACATCATGCTGAATTGT
7051	54	3	MW2_CDS_09327	MW1752	FALSE	unmapped	TTAACATCAATAACTGGTGTCGGCACAACAGTGGTTGATGGTATTCAACAAACAGCCAAA
7052	54	1	MW2_CDS_09866	MW1851	FALSE	unmapped	AGGGAGAATGGCATCCTCAAGATTTAAATGATAGTCCTTTAAAATTTATTCTCAGTACCT
7053	53	164	MW2_CDS_10237	MW1933	FALSE	unmapped	CACCGAGAATCAGAGCCACAAGTGACAGAGTTAACATCAGCAAATAAGGTAAGTGCTCTT
7054	53	162	MW2_CDS_02506	MW0464	FALSE	unmapped	CGGGATCAAATGCCAATCGTATTGGATAAACAACAGCGCATTATTGCGGTAGGAGATTTA
7055	53	160	perR_tiling_028_R		FALSE	unmapped	TGTGAAGAAATTAAATAACGTAATATTGCTTGTCTTTGAGGTGTAATTCTTACGCCTGCT
7056	53	158	MW2_CDS_03882	MW0709	FALSE	unmapped	AGTCTTTCGAGCATTATTTTGTATGTATCGCCACCATTAGGTGTTGTATTAATGTTTGTA
7057	53	156	MW2_CDS_04835	MW0891	FALSE	unmapped	AGCGCAGTCATTACATGTGTATTCGTTCCGATTATTTTCAAAAAACTGTTTCCAGTTCCA
7058	53	154	NC_S_087		FALSE	unmapped	GTGAAACGTGTTTATGAACTAGACGTTCTAGTATAGTTACTACAGCTTTAGTCAGAAGGT
7059	53	152	MW2_CDS_03868	MW0707	FALSE	unmapped	TTAGGCATTGCAACCAATCAAGATATCATTACTATAGCCAGTGTCATGCCACTTGTCCCT
7060	53	150	MW2_CDS_07515	MW1406	FALSE	unmapped	TGCCAGAAGGAAAAACATATTTTGTAGAAATGAAGCAAGAAAAAGGAAAGTTGCATCCTT
7061	53	148	MW2_CDS_09164	MW1719	FALSE	unmapped	GGCTTGTTTTTATTTGGGCTAATTACAAGTCTATCTGGCGTACAATTTTTCGTTAGTCCT
7062	53	146	MW2_CDS_08171	MW1538	FALSE	unmapped	TGGACAGCAAATTGCTAAAACAATAGGCGTACATCCATACAGAGTAAAATTAGCGTTAGG
7063	53	144	MW2_CDS_01266	MW0233	FALSE	unmapped	TTGTTCCAGGTAAAATTGTGCAATCATTTGACGCATTAATGGACGCCTTGGACAATGAAG
7064	53	142	MW2_CDS_07231	MW1351	FALSE	unmapped	ATCGATGCACTGGCATTTGTAACATTATTCAAATATGGGATTTGGGCAGTTATTATGAAT
7065	53	140	MW2_CDS_09938	MW1863	FALSE	unmapped	TGACAAGTTATGAAGAAGAAACTGATTATCGTAACGTTCCAAGAGAATTACTAGATAACA
7066	53	138	MW2_CDS_07058	MW1318	FALSE	unmapped	GCGTGGCGAATTAACTCAAAATGGTTTTACAAGTTTAGAAACGAGCGAAGCAGTATCGGA
7067	53	136	MW2_CDS_03996	MW0729	FALSE	unmapped	ACCGACTCGTTAATTGTGAAACGGCAAATCTAAATAAAACAGTTAGTGCTGCGATGAAAC
7068	53	134	MW2_CDS_12637	MW2390	FALSE	unmapped	CCAATGATAATGGGTGGACTAGTTGTTATCGAGTATATCTTTGCATGGCCTGGACTAGGT
7069	53	132	MW2_CDS_10790	MW2038	FALSE	unmapped	TAATCCATTAACAATGGAAGAAGTTTCCGTCGTTCCAGATGTACATGCTGGAGGGAGTTT
7070	53	130	MW2_CDS_06955	MW1299	FALSE	unmapped	ACGAATCCATACACTGGTGAAGTAATCAAAGCTGTACCAGGATTTAACGTTATAGCAGCG
7071	53	128	MW2_CDS_11582	MW2195	FALSE	unmapped	AGCAGATGAAGCTATTATCGAAGTGAATGGGCAATTACTTACTGATACGGCAAAAAACGT
7072	53	126	MW2_CDS_02338	MW0432	FALSE	unmapped	CGATTGCCTCTTTATCAGTTCATCCTGAATTACGTGGACAAAAATTAGGTCGTGGCTTGG
7073	53	124	MW2_CDS_11510	MW2182	FALSE	unmapped	AGACGCACAAGCAACTTCACCATATTCAATTTTTATCAGAGGTGCTATTTATCGCTTTGA
7074	53	122	MW2_CDS_04802	MW0886	FALSE	unmapped	AGGGAATAATAATTATGGTAAGGAATTTGTTGCAACCGTTGAAGAAACATTCGACATTGA
7075	53	120	agr_tiling 187_R		FALSE	unmapped	ATAATATTGAATCTATAGATTCGAAAGAGCGAATTGTCTATTTTAAAAATAAAGAACACT
7076	53	118	MW2_CDS_08220	MW1547	FALSE	unmapped	GGCGCAGGTGGTGCAAGTAAAGGTATTGCTTATGAATTAGCAAAATTTGTAAAGCCCAAA
7077	53	116	MW2_CDS_04405	MW0811	FALSE	unmapped	ATGTACAAACAGGTGTATCTACGTTAGAAGATGTGCAAAATAAAAATGTGCCACCAACGT
7078	53	114	MW2_CDS_01597	MW0292	FALSE	unmapped	ATCTGGCTTTGATGAAATGTTAGTTCAAGCTACGATTTCTGGCGTAGATGGTGCAATTGG
7079	53	112	MW2_CDS_06347	MW1178	FALSE	unmapped	CACGTGCCAACTTGCAAAATTTTGAACCAAGTGAATTTGGTTATATGAGGAAGCAAACGT
7080	53	110	MW2_CDS_00862	MW0159	FALSE	unmapped	TCGTTCCAGACATTTATATTTTAGGTAAGGCATTGGGTGGCGGCTTATACCCTGTATCTG
7081	53	108	MW2_CDS_00022	MW0005	FALSE	unmapped	GATGCGATTGAAGCGGACCAAACATTTGAAATGTTAATGGGTGATGTTGTAGAAAACCGT
7082	53	106	MW2_CDS_06887	MW1285	FALSE	unmapped	TGCAGTTGTTGCTGGTACACCTGCAAAAGTGATTAAGCAAGCTTCTGAAGTACAAGATAC
7083	53	104	MW2_CDS_08350	MW1570	FALSE	unmapped	ACAAGCATTACAAACAGAGATTGAACAAGTTGATTGTAATTATATGATCGGTATGGCGTT
7084	53	102	MW2_CDS_10156	MW1912	FALSE	unmapped	TGTTAAAACAACGAGAAAGCCATAATAGGATTATGAGTATTCTTGATATAGGCAGAGACA
7085	53	100	MW2_CDS_10014	MW1880	FALSE	unmapped	AAGTGAAAGAGGTATCAGTGATCTTGACTTAAAATTTGCGAAACAAGCAAAATATACAGT
7086	53	98	MW2_CDS_05259	MW0974	FALSE	unmapped	TCGCCATGAGAGAGTTTTTAGTAAATAGTCAAGATGAGGAAATCGCGAAACGATATGGTT
7087	53	96	MW2_CDS_06111	MW1136	FALSE	unmapped	AGATGCTATTTTAGTTGTCAGTGGAACTGGCGAAGTTATTGCCCCAGATGATGACCTTAT
7088	53	94	MW2_CDS_02261	MW0417	FALSE	unmapped	TGATTGGTATTCCATTAGGTGTCTTATTGGTAATTACTCGAAAACAAGGCATATGGCCGA
7089	53	92	MW2_CDS_03137	MW0576	FALSE	unmapped	ACATCATCACTTATGTTGGTAAATCCAACATCTATTGAAGGTGAATTACCGGAAGAACGT
7090	53	90	MW2_CDS_04209	MW0770	FALSE	unmapped	GGATACAAATCATTAGAAGAAGGCCAAAAAGTTGAATTCGACATCGTTGAAGGCGACCGT
7091	53	88	MW2_CDS_09643	MW1810	FALSE	unmapped	TCTTATGTTTAATAGCTGCAGTAAATTTCGTATTAGCAAGGTATACGACACACGCAATTT
7092	53	86	psma_tiling_021_F		FALSE	unmapped	TTCATGATTTGGCATACGAAATCTTAATGATTTTCATAATCTATCCCAAGATATATTGGC
7093	53	84	ETG09_205211		pos		
7094	53	82	MW2_CDS_01750	MW0319	FALSE	unmapped	AACGCTCTGAACCAGTTGCAGAAGCATTTGGAGATTTAGATCCTAAAATTGATGCACGTC
7095	53	80	MW2_CDS_08016	MW1510	FALSE	unmapped	ACGTTATTGCCAGCGATTTAGCATCTCGTGGTATTGATATTGAAGGTGTTAGTCATGTCA
7096	53	78	MW2_CDS_07661	MW1446	FALSE	unmapped	ATGTTGACTGCTAAAGGTGAAGAAACAAACCGTGTTGAAGGTTTTGAATCTGGTGCAGAT
7097	53	76	MW2_CDS_12541	MW2372	FALSE	unmapped	AGGTATACGAGGACACAAAACTTTGCGTGATATGATGCAACAACATATTTATACCGTTCA
7098	53	74	MW2_CDS_09005	MW1690	FALSE	unmapped	AAAAACATTTTGAACCGGTTCCGGGTATCAAGATGCAACATAGTGGAGGTCATAGCTTTG
7099	53	72	MW2_CDS_11790	MW2235	FALSE	unmapped	AATTGAATAAGTTCAAAGGCTTTGAAACATTATATATAATAAACGAAAATCAAGTTTCCT
7100	53	70	MW2_CDS_09765	MW1834	FALSE	unmapped	GAGGTGCACATGCAGAATTCAGAGCAGTTTCAGCACCAAAAATTGACTTTTCAAGCATAC
7101	53	68	MW2_CDS_00793	MW0147	FALSE	unmapped	GAACACAGAATTACAGGGTATTCTGTAGCCGAACCATTCGGTGCACTGGGTGAAAAGTTA
7102	53	66	MW2_CDS_00970	MW0180	FALSE	unmapped	TTCAACACCGAACAAATATTTTTACATAGTGATAGAGAGGGGTTATGTACACCCTTTTCT
7103	53	64	MW2_CDS_10505	MW1983	FALSE	unmapped	CACAAGTGACATGGGGAACTAATCCTGAAATGGGTGTTAATTTCAGTGAACCATTCCCTG
7104	53	62	MW2_CDS_10855	MW2050	FALSE	unmapped	ACCAAGACCTATAGTCTACACTGAAGATTACGATAAGATTGTCCAACCACATGCGATGGC
7105	53	60	MW2_CDS_07950	MW1498	FALSE	unmapped	ATGAATGATAAACTAACATCAGTACAAAAACATTTAGAAAATAGTGGTGAAAACCTATGA
7106	53	58	MW2_CDS_13829	MW2610	FALSE	unmapped	CAGATAATGATGATTTTCAACCTATTGATCAAGCCATTCACTTAGACGGTGCGCCAGCTT
7107	53	56	MW2_CDS_00679	MW0127	FALSE	unmapped	TGAAGAAGGTGGGCCAGTTACTGTGACACATCCTGAAATGACACGTTACTTTATGACAAT
7108	53	54	MW2_CDS_01631	MW0298	FALSE	unmapped	GCTATTGTCTACATCCACGGTGGTGGATTAATGTTCGGTAAAGCTAACGATTTATCCCCA
7109	53	52	agr_tiling 096_R		FALSE	unmapped	ATACATTATTGGAATAGTGTTATCTTCAGTATATTTCTTTGACAAAATCGGAAGTATTTC
7110	53	50	MW2_CDS_00472	MW0089	FALSE	unmapped	GCACATGGGGGTTATTTAATGACTCGTATTGCAAAGGTGCAAGAACTGTTAGCCACTATT
7111	53	48	MW2_CDS_08117	MW1528	FALSE	unmapped	ATTGCATAAAGCTTTACCAGACTTGGCAGTTACGAGTGATGTAATTGTTGGTTTCCCAGG
7112	53	46	MW2_CDS_13505	MW2555	FALSE	unmapped	GCCGGTGTGGAATGGATTAACAGACGATTGGCATCCTACACAAATGTTAGCTGATTTTAT
7113	53	44	MW2_CDS_05036	MW0932	FALSE	unmapped	TGCACCCGTAACTTATATTCAAGTTGAAGCACCTACTGGTACATTTATTGCTTCCGGTGT
7114	53	42	MW2_CDS_08292	MW1559	FALSE	unmapped	ACCTGTTCAATATGGTGGTACATATGGACCAGATATTGAAGAAGTAGCAAAGCATAATCG
7115	53	40	MW2_CDS_12919	MW2445	FALSE	unmapped	GGGCACGATAGCATTGATATTATTATGCCAAACATGACTAAGGGGCAGGCATTAAAACGA
7116	53	38	MW2_CDS_03524	MW0646	FALSE	unmapped	ACACATCTAATTGCAGGTGTTTATCAGCCAACAATAGGTACTATAAGTACAAACCAGCGT
7117	53	36	MW2_CDS_12455	MW2358	FALSE	unmapped	ATTCTTGCACCATTAGCTGGTGGATTAGCTTTATCCGTAGCAACATGGCGTTCTATTTTC
7118	53	34	MW2_CDS_09701	MW1821	FALSE	unmapped	TCATCTTGTGATAATTTAATAGACTACATCGTAAAAGATGCAAATTTGAAAGAGGGGTAG
7119	53	32	MW2_CDS_04519	MW0835	FALSE	unmapped	AATGTTGATGTATTGCGCTATGAAGATTCACTTCAACAAGCAATTACAGATTTAGAAACT
7120	53	30	MW2_CDS_02783	MW0513	FALSE	unmapped	GAACGTGCAGCCAAAGTGTTAGGTAGTTGGCGTTTAGAAGGTTGCACATTATATGTAACC
7121	53	28	MW2_CDS_00174	MW0032	FALSE	unmapped	GGTGAATCGATATTAAAATGCTCTATTTTAAAATCTCAGCACATAAATAATGTGGCAGCA
7122	53	26	MW2_CDS_10664	MW2013	FALSE	unmapped	CCACACTTCTTATGGTTCGATTTAGGACGTCCTGATATTTGGATTACAATTATTGCCGGT
7123	53	24	MW2_CDS_04933	MW0909	FALSE	unmapped	TGACTGTTGCAGAAGTGGGTAACATTGTTGAGTTTATGGATGGATTAAGAGGTCGTGTTG
7124	53	22	MW2_CDS_06245	MW1160	FALSE	unmapped	AAGGATATCCAGTAACCATTATAGAACGATTACGAACTGCCGATGGAGAACCGATCGTCT
7125	53	20	MW2_CDS_09236	MW1733	FALSE	unmapped	CGTTTCATTTCGCCACTCACTCCACCAACTTGTCGTTTTTATCCAACATGTTCAGAGTAC
7126	53	18	MW2_CDS_00377	MW0072	FALSE	unmapped	AGTCTTCTGTTTTTAGTCATTAGTATCACTGCTGGTTGTGGCATGGGTAAAGAAGCGGAA
7127	53	16	(+)E1A_r60_a104		pos		
7128	53	14	MW2_CDS_01641	MW0299	FALSE	unmapped	CTTTTGTCACAGAACCTGACTTTGTGCATAAACTTGCTGAACAGCGACCACATGATATCA
7129	53	12	MW2_CDS_12405	MW2348	FALSE	unmapped	TGCCGACAGTATTCCGATTAATTTTTTGCATCCAATCAAAGGCACAAAGTTTGGAAGCAT
7130	53	10	MW2_CDS_08406	MW1582	FALSE	unmapped	AGGTTGGATAGCTGGATGGCACACAAATTTAGATATTGTCGCGGATAATACGAAGGAGAA
7131	53	8	MW2_CDS_12221	MW2313	FALSE	unmapped	ACGAGAACTAGAAATATTGCCACTTATTGCCAAAGGTTACGGGAATAAAGAAATTGCAGA
7132	53	6	MW2_CDS_10953	MW2068	FALSE	unmapped	ACACTATGTCATGGTTTCAACATATGATTCGAGACGTCAGGCTTTTGATGATAGCGGTGA
7133	53	4	MW2_CDS_04197	MW0768	FALSE	unmapped	TTTCACAGACCGTGACAAACGCGTTATTAGACGTGATCATGTTAAAGAAGCACAAAGCTT
7134	53	2	MW2_CDS_02917	MW0538	FALSE	unmapped	AGGTGCGATTACGCCAATTGGTGGCGTATTGTTCATCATTGGATGGATAATGTTAATCAT
7135	53	163	MW2_CDS_01914	MW0351	FALSE	unmapped	CAGTGCGAATCCGAAATATGAAAAATATTTCAATGATCCAAACTTTAAAGACTTTCGTCA
7136	53	161	MW2_CDS_00653	MW0123	FALSE	unmapped	ATGCATTCTTAGGCATTGCACACTCAATTGCGCATAAAATTGGTGGCGAATATGGTATTC
7137	53	159	MW2_CDS_03019	MW0555	FALSE	unmapped	AGAAAAAGAAATAGTTATATTAACATGCTGTATGATACTTCTAGGTGTTTTCGCATTGTT
7138	53	157	MW2_CDS_10392	MW1963	FALSE	unmapped	AGAAACTGCACATACACGCTTACAATTGTTGTCTAAAGATAATAGCGTTGAAACGATTGA
7139	53	155	agr_tiling 024_F		FALSE	unmapped	TTATCATTACAGATAATTATTTCTAGCATGTAAGCTATCGTAAACAACATCGATTTATCA
7140	53	153	MW2_CDS_03947	MW0721	FALSE	unmapped	GTTATCAGGTGGTGAGGCTCAACGTGTGAAACTTGCATCTGAACTTCATAAACGTTCAAC
7141	53	151	MW2_CDS_08053	MW1516	FALSE	unmapped	CAAAAGTATGAAGTAATTGGAAGAATTTCCAAAACAACAATAGCTAAGTTATTAGTAGCA
7142	53	149	MW2_CDS_08557	MW1612	FALSE	unmapped	TGGTTGGATAGATGAAGAACGTGTCGTTATGGAACAAATGGTTTCAATGAAACGTGCAGG
7143	53	147	MW2_CDS_02686	MW0496	FALSE	unmapped	AGATGTTCTTGTTCAAACTTTTTTAAAAGCGCATCCACCTGGTCCAAGTAAGCGAATTGC
7144	53	145	psma_tiling_027_R		FALSE	unmapped	CAAAGATCACGAATATTCCGTACGTCCCACCAAGAACATCCTATACAAAAAACCAAGACC
7145	53	143	MW2_CDS_01399	MW0256	FALSE	unmapped	AGTTAAAACTAGATTACGCACTTGATTTCGATCAAGATAAATACACGTATGCTGAAGCGA
7146	53	141	MW2_CDS_09209	MW1728	FALSE	unmapped	TGAAGGGCAACTTGTCGAAGCAGTTAGAAAACACTTTGACCTAAGACCTGCAGGTATTAT
7147	53	139	MW2_CDS_09499	MW1784	FALSE	unmapped	TTGCAAGCAAATATTGGTTGGTCTGAAACGCATCATGACGTAGATAGTTCAGAGGCAATG
7148	53	137	MW2_CDS_04116	MW0753	FALSE	unmapped	TGCTAGATCATACAAATGAATCTGTAAAACGTGTGTTTAAGTATAGAGATAAGCAAGAAC
7149	53	135	MW2_CDS_03395	MW0623	FALSE	unmapped	TTTGCTGACGAACCAACAGGTGCACTGGATTCTAAAAGTACTCAAGATTTATTAAAACGA
7150	53	133	MW2_CDS_03769	MW0689	FALSE	unmapped	GTTAAAAACTTCCACGGCGGATTCTTGATTGCAGCAGTTGGTATGGCATTAGGTTTAGTA
7151	53	131	MW2_CDS_08288	MW1559	FALSE	unmapped	TCCATACTTAGGCGGACTTGATGAACAACTACATACACCTAGACGTAATCAGCCAAGGTT
7152	53	129	MW2_CDS_01960	MW0361	FALSE	unmapped	TAGAAGATTTACGCCTAGAAATCCAGAAAATGCGCGAAGAACGTCACCTACTTGGTCAAA
7153	53	127	MW2_CDS_13806	MW2606	FALSE	unmapped	AGCTACTGCAACAATTATTCCAAGCTCAATTAACACTAAAAACGAAGCACGTGATAACCA
7154	53	125	MW2_CDS_12722	MW2407	FALSE	unmapped	TGTAGGTTATGTCATTATGACAAAAGCAAATGGTCAAAACGCCCAAATTAAAGACACATT
7155	53	123	MW2_CDS_07162	MW1339	FALSE	unmapped	AAAGCGACATTGCAGTTATTCACAAAAAGCCTACGCCAGTACAAATAGTTAATGTCAACT
7156	53	121	MW2_CDS_12262	MW2320	FALSE	unmapped	GTGGATGTCAATTCCTTAGTGAATGGTGGCACGTTAGCAATTTATATGGGGGTAAAACGT
7157	53	119	DCP_20_0		pos		
7158	53	117	pMW2_026		FALSE	unmapped	ACGCTCGTAGTCAGAGAAGAAAACACTTAAAACAAAATATTGCTAGTCCAAGTACCACGG
7159	53	115	MW2_CDS_11940	MW2263	FALSE	unmapped	GTTTATTTAGGCCTAACAATTGTTATGATAGTATTCCTATGCTTTGACAGTAAGCCGGCA
7160	53	113	MW2_CDS_01158	MW0212	FALSE	unmapped	TGTGTGGATACTTGTATTCATTTTAATGGGGGCAGGTTTAAAACAAGTGAATTTACTGCA
7161	53	111	MW2_CDS_07247	MW1354	FALSE	unmapped	AAAATGGGCGGTAATATCCAACTTTTCAATCAAACAACTGGTGCTGAACCTACTGCTTCT
7162	53	109	psma_tiling_054_R		FALSE	unmapped	GATTAAGCTTTTGATAACTTTAATGATGCCAGCGATGATACCCATTAAGATTACCTCCTT
7163	53	107	MW2_CDS_08665	MW1631	FALSE	unmapped	GTAGTAGATGCTGATAAAGCAGCCAGGGAAGCTGTTAAAAAGGGGAGTAAAGGTTTAGCT
7164	53	105	perR_tiling_107_R		FALSE	unmapped	TCTTGATTTTCTAATTTAAATATTGGAAATTGTTCTCCTTTTTGCAACATATAATCACCT
7165	53	103	MW2_CDS_07368	MW1376	FALSE	unmapped	AGTTAAAGCTACAAATGTTGTAGGTAGTGGCGACGGTGTAGAAGTATTCGTGCATTGTGA
7166	53	101	MW2_CDS_01770	MW0322	FALSE	unmapped	TGTCGTTCGTCATTACGGTCATCGTCGTATATGTTTCATCATTTTGGTGGATGACACCAT
7167	53	99	MW2_CDS_00469	MW0088	FALSE	unmapped	AATGGGGAAAGCTTTAGGGAAAGAAAAAGAAGCTGAAGATTTACTTAAAAAGTACGATGA
7168	53	97	MW2_CDS_03177	MW0584	FALSE	unmapped	TTTTCATTCGTTGATTAAAATTAGGTTACCAGAAACATTATCGAAAGAACTACTTCAATA
7169	53	95	MW2_CDS_06377	MW1184	FALSE	unmapped	AAAAAAGTGGTTAATGCAGCAGGTCCATGGGTTGATGATGTTAGAAGTGGTGATTATGCA
7170	53	93	MW2_CDS_08653	MW1629	FALSE	unmapped	TGTTGATCAATTGTTAGCATCGATGCAAGGGATTTTAAGCGAAAACAAACGGAGTGATGC
7171	53	91	MW2_CDS_01057	MW0195	FALSE	unmapped	TGGTTTCAGTTGTCATAACAATCCAATTTCTCCAGATCCGATAGAAGCGAAAGAAGCCGA
7172	53	89	MW2_CDS_09680	MW1817	FALSE	unmapped	TGGATTTCAGAGATGAAGATATTTGGATGTTATTTGGTACTTTGCCTGTGTTTCCATGCT
7173	53	87	MW2_CDS_07331	MW1369	FALSE	unmapped	CCGCTTCAAAACCACATGCCTCTAATAATGCAAGCCAAAACCATGATGAACATGACAATC
7174	53	85	MW2_CDS_11028	MW2086	FALSE	unmapped	ACGGTGCCAATGCATCTCCAGCAACAGTTTCTAATGGTAGTCATAGTATGCATCAAGATA
7175	53	83	MW2_CDS_07531	MW1412	FALSE	unmapped	TGCCAAAGAAAACGGTAACGATTGATGTAGATGAAAACTTATTAGTAGTAGCTAGTAATG
7176	53	81	MW2_CDS_05681	MW1058	FALSE	unmapped	ACGATTTGTGAATTACTTCAAACATCATCAAATGGAAGTTGATGGGCATCGTGCAGATGT
7177	53	79	MW2_CDS_00826	MW0153	FALSE	unmapped	TGGACCATCTGAGTCAACAGTCATCACATCGTATTGGTCACATCAATGTGGTGATTTGAT
7178	53	77	MW2_CDS_06041	MW1124	FALSE	unmapped	CGTGGTAAAGTACGTCGTGCTAAATTATATTACTTACGTAGTTTACGTGGTAAAGCTGCT
7179	53	75	MW2_CDS_01682	MW0306	FALSE	unmapped	CCAACCTACGATGCGAAAAATTACAGGGAATGACCAAGTAGCTTTAGGTCATTTTGGCTC
7180	53	73	MW2_CDS_05978	MW1111	FALSE	unmapped	GACCAAATAAGTTCTATTGAAGAACAAGAATTTATTGGTGATTTGATTCAAGTCAATCCA
7181	53	71	MW2_CDS_06465	MW1206	FALSE	unmapped	AGACAAGTTATTACAAAGTGAAAATCGCAGTATAATGTTCCAAAAAACGATGTTTCCAGA
7182	53	69	MW2_CDS_07988	MW1505	FALSE	unmapped	TGGCTTTTGAATTACCAAAATTACCATACGCATTTGATGCATTAGAACCACATTTTGACA
7183	53	67	MW2_CDS_08426	MW1585	FALSE	unmapped	TGGTACAAATGTTTTAACAATGCACAAAGATGCAATTAAACCAGGTCAACGTGTGTTAAT
7184	53	65	psma_tiling_014_R		FALSE	unmapped	GTACCAACTGTTAATTGAAGGTACAATCATTGTTTAACAGTCATAAAAATGAGTGAAGTA
7185	53	63	MW2_CDS_07279	MW1360	FALSE	unmapped	TGGTGGTATGTCTTGAAACGAGCCAACCAACTTTGCCAGTCTTTAAACAAATGTATGCAT
7186	53	61	MW2_CDS_12410	MW2349	FALSE	unmapped	TTCGCATGGTGTGAATACCTTTTTCCATGGTCATACATACACCGGGAATCAAATCGTTTG
7187	53	59	MW2_CDS_11721	MW2221	FALSE	unmapped	TGAACGACGTAACAAATCATCAACCGAATCGCAAATCCAATGATGAGAACATTATGGCGA
7188	53	57	MW2_CDS_06057	MW1127	FALSE	unmapped	TTGATAGACGCGATGACGCTTGATAATGCACTGCCTCAAGTATCTTTAATCAAGGGTGAT
7189	53	55	MW2_CDS_06586	MW1230	FALSE	unmapped	AAACCCACCAATCAACGAAGAAATGCTTCGTATGATGATGATGCAAATGGGTCAAAAACC
7190	53	53	MW2_CDS_00734	MW0136	FALSE	unmapped	GTTGCAACTGATTTAATGGATTCAACATCGTATATAACAAAGACAGGGAAGGTCATTCGT
7191	53	51	MW2_CDS_08497	MW1599	FALSE	unmapped	ACGGTTTTAGCAAGAAATCCGGATCAGTGGATGAATACAATTGTAATTGATAAGGGATCT
7192	53	49	MW2_CDS_10570	MW1996	FALSE	unmapped	ACCCATAGCGCTTGTACTTTTAATCGCATTTAATATTTTGAACTGGCTATTTTGGGAGAT
7193	53	47	NC_S_013		FALSE	unmapped	AGAGGTTCTTATGTGATTGGACAACTGTTCTCCCTACTAGACTTTTAGCATAGCTGGTTA
7194	53	45	MW2_CDS_04839	MW0892	FALSE	unmapped	CAGCTGGTCCAATCCGTACATTAAGTGCAAAAGGTGTGGGTGGTTTCAATACAATTCTTA
7195	53	43	MW2_CDS_08635	MW1626	FALSE	unmapped	ATGCGCGCCAATTACAAGATGAATTGAAATCTCAAGGCGTTCGTGTAAGTATTGATGACC
7196	53	41	ETG10_13482		pos		
7197	53	39	MW2_CDS_11912	MW2257	FALSE	unmapped	AGGTGAAGCGTTAATTGAGGTTTCTGAAATTAGAGAACCATGCTGGAAAATTCAAGCAAA
7198	53	37	MW2_CDS_04047	MW0737	FALSE	unmapped	ATTCGTAATTTTGATGCCCCAACTTATGCAACTGCCAAAGAAGGTGTAGAAGCAAGCTAT
7199	53	35	MW2_CDS_10948	MW2067	FALSE	unmapped	AGGGACTTTAGCAGAGTCTAGAGAAGAAGTTGCGAATCATGTTCAACACGGAACGATAGA
7200	53	33	MW2_CDS_03261	MW0599	FALSE	unmapped	AAATCAACGTTGAGCAATATCATTGGCGGTTCTTTGTCGCCTACTGTTGGCAAAGTGGAT
7201	53	31	MW2_CDS_12533	MW2371	FALSE	unmapped	TTCAATTGATGAAGGATGTTGAATTGCCGTTAGCATTACCGCTTATCATTGGTGGCATTC
7202	53	29	MW2_CDS_06764	MW1263	FALSE	unmapped	TGGAATTTCGTTGATTATTCAAGGATTCACTGCAGAATTTACAATTAGTTTAATTAGTGA
7203	53	27	MW2_CDS_09457	MW1776	FALSE	unmapped	TTGAAAGAATCTGCAGTCAGAAGAAGTTATCTAGATATACTTTTACCAGTTCCAAAGGGT
7204	53	25	MW2_CDS_13019	MW2463	FALSE	unmapped	TGAACAGCAAATTATCAATGATGAAGTAGATATAGGCGTGACCACTTTGCCAGTCGATCA
7205	53	23	MW2_CDS_07412	MW1385	FALSE	unmapped	TCGGTTATTTTTGATGGAACAGCAAATGGTGTGGGCTCTACATTGTACTTAAATGAGAGT
7206	53	21	MW2_CDS_07756	MW1462	FALSE	unmapped	GCATGCCATTTATTGTGATTGGTAAGCCTACATCGGATATAGATCATCAATTTACACACA
7207	53	19	MW2_CDS_11345	MW2145	FALSE	unmapped	ACGGTATCGGTACGTCAACTGCTCAAAAAATTCTTGAAGAAGCTAACGTATCAGCTGATA
7208	53	17	MW2_CDS_10261	MW1938	FALSE	unmapped	GGTGTCTCTAATAATGCCAGCGCTCAAGGTGATATAGGAATTGATAATCTCAGGAATTTT
7209	53	15	NC_A_085		FALSE	unmapped	ACAAAGAATCTCTTTAGACACACATTGAATATCGAAACATTTAATTGCGCTAAATCGTTT
7210	53	13	MW2_CDS_00284	MW0054	FALSE	unmapped	GCTTTACTTGCATTAACATTAATGTTTATTAAAGTGAAACCTAGTTCCGAAAAGTCTTCA
7211	53	11	MW2_CDS_04569	MW0843	FALSE	unmapped	AGGTATCAAATCAAGAGAAATTTATGAGGCACCTGCTGCAGAAGTTATTTTAAAAGCGCA
7212	53	9	MW2_CDS_07898	MW1488	FALSE	unmapped	GGGATTACTTACACCTCCAGGTTCATTTGGTGCAGATATTGTTGTAGGTGATACTCAGCC
7213	53	7	MW2_CDS_01303	MW0239	FALSE	unmapped	AACAAGTGGTCACACATTAGGTGTAGCACCAGCCAAAGAATTAGGACCTGTAGAAGAATC
7214	53	5	MW2_CDS_03720	MW0681	FALSE	unmapped	ACATCTGACTCTGAATTTACAATGGATAACAGTTTATACGGTTTACCGCAAGGTTCTGCC
7215	53	3	MW2_CDS_04730	MW0873	FALSE	unmapped	TGGTTACGCTAGTGAAATAAATAGTTTTGTACCATCAATGCATTGGATAGCAGCTGATCC
7216	53	1	MW2_CDS_10989	MW2078	FALSE	unmapped	TGTTTGAATTTGGTCATTATACAGTTGCTATGAAAAATGCACGCCCTGAAATCCAAGCAT
7217	52	164	MW2_CDS_01084	MW0199	FALSE	unmapped	ACGAAGAGTTGAACTACATTGAACAGTATGTTGCGATACAAAACATCCGTTTTGATGACA
7218	52	162	MW2_CDS_06720	MW1256	FALSE	unmapped	GACTGATTATGGTTTGAAACATGCGCCGAATAGTGATTTTAAAGGCGGTTCACCTGAAGA
7219	52	160	MW2_CDS_12462	MW2359	FALSE	unmapped	TCTGAATTAGACGGTAAGATGTCATATATGATTGCAGTTACCGGAGATAATAGTGCTGAT
7220	52	158	MW2_CDS_09041	MW1696	FALSE	unmapped	AGACGTATCAAAATTGCTGATTTAGAATTGGACAGCAATCTAGATTCAGGAGAATATCGT
7221	52	156	MW2_CDS_10667	MW2014	FALSE	unmapped	GTCGAAGCATGACGCGCATATACCAGTAGGTCCAGAAATGATTGCAACGTTTAAAGAAAT
7222	52	154	MW2_CDS_07335	MW1370	FALSE	unmapped	AGCAATTAGGATTCTTTCGCATGATTGGCTATTGCAAATTGGATCAATGTAGACGGAAGT
7223	52	152	MW2_CDS_01338	MW0245	FALSE	unmapped	AACTTAGCTCACCCATTAAATAAAGGTAATATTCGTACTGGTGAAACAACGCCCTACTCT
7224	52	150	MW2_CDS_01881	MW0344	FALSE	unmapped	GCAATTCAAATTTTGACACAAATTCAAGAACACCAGAAGAAGTTATGGAAACCAAAATCA
7225	52	148	MW2_CDS_08584	MW1616	FALSE	unmapped	GTGTCTTATGCTGCGGTCGAGTTGGCGAAAAAAGTATTTGGCAAATTGAAAAGTAAGCAA
7226	52	146	MW2_CDS_00024	MW0005	FALSE	unmapped	TGAGACCGTTAATTGAAGCAGGCTATGTGTATATTGCACAGCCACCGTTGTATAAACTGA
7227	52	144	MW2_CDS_13454	MW2545	FALSE	unmapped	TTGGGAATCAGAAAACTTCATAGATGATAACACATTAGCTGTTAACATGACGCGCCTGCG
7228	52	142	MW2_CDS_06940	MW1296	FALSE	unmapped	ACCCAACTTACACTACCAATAGAAACTTCTGTTAGAATTCCTCAAAATGATAATACGCGA
7229	52	140	MW2_CDS_08261	MW1554	FALSE	unmapped	GGTATTAGGTGTTGTTGTAACAGGTGTGACACTAAGTTCTGAAAATCCACCAGCGTCAGT
7230	52	138	MW2_CDS_10993	MW2079	FALSE	unmapped	GGTAAAATGCCAGGCAAGGTAGGGTATTCTGCAGAGACTGTACGACAACATATAGGTTTT
7231	52	136	MW2_CDS_09820	MW1843	FALSE	unmapped	CAAGTACTCTTCCATCCTCTTGTAGGTGGTTTCTTACTTGCTGCGATTCTAGCTGCAATT
7232	52	134	MW2_CDS_06320	MW1173	FALSE	unmapped	TTATGGCGTTCATTCTATTCACGGACGTGCATTACCTTTAGCTCAAGGTGTAAAAATGGC
7233	52	132	MW2_CDS_13934	MW2630	FALSE	unmapped	ACTCGCTCAAGTGGAAGTGAATATTGATTATCCTGAATACGATGATGTTGAAGATGCGAC
7234	52	130	MW2_CDS_02730	MW0504	FALSE	unmapped	ATTTACGGTACACATTTATGGAGTGGTTATCCTACTGGAACTATTCATTCACGTGCGGGG
7235	52	128	MW2_CDS_13394	MW2535	FALSE	unmapped	ATTTGATTCGGGTTCATATATTTTAGCGGCAGCATCTCAGAAAAAAGTGGTAGGCGAACC
7236	52	126	MW2_CDS_07788	MW1468	FALSE	unmapped	ACAGAGATTCCACATGCATGGATGATGATTGAAGTAGATGCTACAAATCTTGTGAATACG
7237	52	124	MW2_CDS_11483	MW2176	FALSE	unmapped	TCCATTTACCACATGTGGCAATCGATTTCTTTAGCATACTTTCCCATGCAAATATGCCGT
7238	52	122	MW2_CDS_08812	MW1655	FALSE	unmapped	AGAACAAGCAATAAATGCATTAAAAGATGCTGGATATGCCTTTCTAGTGGTACCAAGTAA
7239	52	120	MW2_CDS_11095	MW2097	FALSE	unmapped	AGAAGCAATCCATTTCTTTAAACAAGATAATATTGTGGCGCTTAGTGAAGAAGGGAAGTT
7240	52	118	MW2_CDS_13566	MW2565	FALSE	unmapped	CGGTATCAAAGGTGCTTTTGAAGGGAATTCTGTTCCTTTTAACACATTAGAAGCTGATGG
7241	52	116	NC_S_104		FALSE	unmapped	TGCGGATTTCCTGTAATTAGATGACAACTTATTCTTTTCAGGGGAACATTACACTTTTAT
7242	52	114	MW2_CDS_07037	MW1314	FALSE	unmapped	ATCCAGCTGAAGACTACCATCAAGATTATTACAAAAAGAACCCGGTACATTATTACCAAT
7243	52	112	RC2		pos		
7244	52	110	MW2_CDS_09310	MW1749	FALSE	unmapped	TGCTTCTGTTTTAGGGGCGACACTTCGAATCGACATTTGTGAAATACATATAGAGATTGC
7245	52	108	MW2_CDS_09323	MW1751	FALSE	unmapped	CGACAGCGGGTAAAAAAGCAGGCGAGTTCTATACACCACAACAAGTATCTAAGATACTGG
7246	52	106	MW2_CDS_06884	MW1285	FALSE	unmapped	ATCGGTGCAAATGCAGTTATTTTAGAAGGTGTACGTGTTGGTAAAGGTGCTATTGTTGCA
7247	52	104	MW2_CDS_11671	MW2211	FALSE	unmapped	GTGGCAAATCCGATTAAAATTGGTATTGGTGGTCCTGTAGGTGCAGGTAAAACACAATTA
7248	52	102	MW2_CDS_05150	MW0953	FALSE	unmapped	TTATGACGCGCCATATAGTGGCTTATGTGTAGAAAGTTTCACTGGAGATTATCCTGCAGG
7249	52	100	MW2_CDS_08885	MW1668	FALSE	unmapped	ATTTTTCGTTGGTGTTACAGAGCCGATTGAGTTTGCATTTATGTTTGTTGCGCCAATCTT
7250	52	98	MW2_CDS_07742	MW1460	FALSE	unmapped	ACACTCGCTGCAAATGATGTGATTAATGGTGCTACACGACTTGTAGATATCGCTAAAAAA
7251	52	96	NA		ignore		
7252	52	94	MW2_CDS_07393	MW1380	FALSE	unmapped	ATGGTTATAACGATCCTGGAGCAGTCGGAAACGGAACAAATGAACGTGATTTTATCCGTA
7253	52	92	MW2_CDS_03971	MW0725	FALSE	unmapped	GGTGAACTCATAATTGCTGAAAAAGTAGATTTAACTGATGTTGAGCCATATATCGGTGCG
7254	52	90	MW2_CDS_06832	MW1275	FALSE	unmapped	AATCCAAATATTTACTTGGGCGAAAATGCCTCAAGAAGAATTCCAGAATGTTGCATCGGC
7255	52	88	MW2_CDS_09711	MW1823	FALSE	unmapped	AGCCGTAATGGAATCGTATTAAAACTACTAAGTGTTGTCTTCACTGTAGTTATGGGCGTT
7256	52	86	MW2_CDS_05141	MW0951	FALSE	unmapped	AAATTTGCGGTTCTTGTTTTTCCAGGTTCGAATTGTGATAGAGACATGTTTAATGCTGCT
7257	52	84	MW2_CDS_07686	MW1450	FALSE	unmapped	ACTCCAGACTTTGAACGCATCATCAAGGCCAACTATCCAGACTATGATTATAATCAGGAA
7258	52	82	MW2_CDS_01725	MW0314	FALSE	unmapped	GCAGCCAGGTACTGAAACGATTTATCGATTTTCTTTATTAGTACCAAATCAAGCGGCACT
7259	52	80	agr_tiling 200_R		FALSE	unmapped	TCCTATTACTACATAATTTATCAATTTCTATTTCACTCTACAATCCTATGGCGCAATTTT
7260	52	78	MW2_CDS_10213	MW1926	FALSE	unmapped	AATGGATTGAAGAGAACACAGACGAAAGAGACAGGCTAATTAACTTAGTCATGAGATGGT
7261	52	76	MW2_CDS_04697	MW0867	FALSE	unmapped	TGTTGAAAAAATGGCTTGGAATGGCACTAATAACGCCAATATTAACGTTTATTATATGGC
7262	52	74	MW2_CDS_13095	MW2479	FALSE	unmapped	AGCTGTGGTCACTGCAAAAGTGCTGTTGAATCTGCATTAAATAATATTGACGGTGTCACT
7263	52	72	MW2_CDS_11964	MW2268	FALSE	unmapped	CGATGACCACTTGATTAAGCAACGTAATATCATTCGTACTGCTCAAGAAATGACAAACGA
7264	52	70	MW2_CDS_00651	MW0122	FALSE	unmapped	AGGATATCGTTGCAGATGAAATCTCAATGGAAGAATATTTAGATCCTTTCACTGGAGAGA
7265	52	68	MW2_CDS_04449	MW0821	FALSE	unmapped	AGAGTATGGTTGCCTGACACATTGTGGTATATGTTCAGCCGGGTTGTATGCTTTAGTAAA
7266	52	66	MW2_CDS_06765	MW1263	FALSE	unmapped	TGAATCGAATTGAAAAACATGCCAAAAACACTTTTATTATTCTGATGCTCATTATGTTAT
7267	52	64	MW2_CDS_04263	MW0783	FALSE	unmapped	TTCCTAATGAATTAGATAAGCAACAATGTCATTATGATGCAGTTACGAAACTAGGTGGCA
7268	52	62	MW2_CDS_12358	MW2340	FALSE	unmapped	AGGGCGTTACCATGGAAGTAGTGTGTTTATTGATGTCACAATTGTTGTAGATGCTAACCT
7269	52	60	MW2_CDS_06047	MW1125	FALSE	unmapped	CGACGCTTTGTAACACCCGTAACAATACGCATTAAAGCTTCAGATAGGATTAGATTATCA
7270	52	58	MW2_CDS_08372	MW1575	FALSE	unmapped	GAAAAAGAAGGTCAGCAAGATAAAGCGACTGGTAAAGCAAAAGAAGTTGTTGAAAATGCT
7271	52	56	(-)3xSLv1		neg		
7272	52	54	(+)E1A_r60_n11		pos		
7273	52	52	MW2_CDS_04646	MW0858	FALSE	unmapped	TGTTTCAATCGAAATTAAATGTTGTCGTGTCTTCATATATCGCGACATTCATTATGCCCA
7274	52	50	MW2_CDS_07481	MW1399	FALSE	unmapped	TGAAATAGCTGCTAGTATCTCTAAAGAGCAATATAAGCGTTTCGAGAACGTCCCAGAAGA
7275	52	48	MW2_CDS_02923	MW0539	FALSE	unmapped	CTAGTAGGTGTGTCGTTAATTGCACCTTGGCTAGGAAGAACTGCATTGACTTGGATTGTA
7276	52	46	MW2_CDS_12909	MW2443	FALSE	unmapped	AAAAAATATGAGGCACAAACGATCCCAGCTGTTGAACAAAAATTCGATGCATTCCAAGCA
7277	52	44	MW2_CDS_08051	MW1516	FALSE	unmapped	GGTTAAGGACTATATGTCTCAACCTGTTGTGCTAAGAGAGAATACAACAGTTTATGACGC
7278	52	42	MW2_CDS_03857	MW0705	FALSE	unmapped	ATGGAGAATTACAATATGAAAGCTTTAACGCTGCTGAAGCGGTTATTACATGCCACGGTG
7279	52	40	agr_tiling 025_R		FALSE	unmapped	CGATAGCTTACATGCTAGAAATAATTATCTGTAATGATAATTAAGAAAAATACATAGCAC
7280	52	38	MW2_CDS_09877	MW1853	FALSE	unmapped	ACAATTTTCAATTGCTTCAAACCGACAAGGTATCGTAGTTGGCACTGATCATTCTGCAGA
7281	52	36	MW2_CDS_10857	MW2050	FALSE	unmapped	CGATGTGGTCTTAATAAGCAACAAACCTAAAACAGATGATTTCCCTGATCATCTCGTACA
7282	52	34	MW2_CDS_08654	MW1629	FALSE	unmapped	GGTGAACACGTTATGAACTTGTTAATGCATGTTGATCAAGTTTCATATGTTAGATTTGCA
7283	52	32	MW2_CDS_10648	MW2011	FALSE	unmapped	TTGGCGTTCAAATAGCTTCTAGTGGTCCTGACGAAGAATGGGAACAGATTAAATACGGTT
7284	52	30	MW2_CDS_04300	MW0791	FALSE	unmapped	GGTCTTATTTTAGGTGTGTTATTATTCTTGTCTGCTAAAGGTAAGTCTATCGGTGCAAGG
7285	52	28	MW2_CDS_09823	MW1844	FALSE	unmapped	TCAATCACACCAGGTGAATTTATCACTCAAGCGACTGCAGAAAAGAGTCAAACAAAGCTT
7286	52	26	MW2_CDS_05845	MW1086	FALSE	unmapped	CTTAGTATTAGGCTCTGGACCAATTCGAATCGGCCAAGGTGTAGAATTTGACTATGCGAC
7287	52	24	MW2_CDS_04883	MW0899	FALSE	unmapped	CACAAGACCATTTAGATTTTCATGGCACAATGGAAGCATACGGACACGCGAAGTCTTTAT
7288	52	22	MW2_CDS_11174	MW2111	FALSE	unmapped	ATGGTGGATATCTTGGGCACCATTTGTAGGTATATTTATTGCACGTGTGTCAAAAGGACG
7289	52	20	MW2_CDS_05307	MW0983	FALSE	unmapped	AGCATGAAAGCAATTCCTAATAATTTATTGCAGGCCTCAAGTGATTTAGGTGCCAGTCCT
7290	52	18	MW2_CDS_06781	MW1266	FALSE	unmapped	ATTGCAAGTATTCGTTCTATAGAAAGAGGCTTTAATTATTATCAAAGTGAATGCGTCATT
7291	52	16	NC_A_082		FALSE	unmapped	ATCGCAATCGCAATAACTGACACAAATAAGTCACCCAATCTATTTAAGTTTGTGTTCTCT
7292	52	14	MW2_CDS_06426	MW1193	FALSE	unmapped	TGAATGAGATTGAAACTATTATAAGTGAAATAGAAAAGTTATTAACTAACAATACACCAT
7293	52	12	MW2_CDS_05710	MW1063	FALSE	unmapped	AATCAAGTGAAAACAGTGCTTTACAATCTGAAATCAAAAAGAATTCTTCTTATGAACGCA
7294	52	10	MW2_CDS_12685	MW2399	FALSE	unmapped	AATCTGTGCATTTCACAAGTTTAAAAAGAGGACCTATGGGCGATGCCGTAATTGAAGGTT
7295	52	8	agr_tiling 148_R		FALSE	unmapped	GTTTTTCTACTAAAGGTGAAGGTCGTGGTTTAGGTCTATCAACTTTAAAAGAAATTGCTG
7296	52	6	MW2_CDS_05503	MW1020	FALSE	unmapped	CAAGATAAAGTGTTGCGAGCGAGTCAAGGTAGTGTTTTCCATTTGCCAGTTATGACACAA
7297	52	4	MW2_CDS_07778	MW1466	FALSE	unmapped	ACTGAGCATTGCATTTACAATGAATTTAATGATGCCAAGTTTAGACAAACAACTAGACGA
7298	52	2	MW2_CDS_01588	MW0290	FALSE	unmapped	CCTGGGTGATGTATCAGCTCGAACACAAGGTATCATTTCAGTTTACTTAGTAAGCTTCGC
7299	52	163	MW2_CDS_06767	MW1263	FALSE	unmapped	TCCTACTTTTTTACTTTCAATACTTTTGGTCATATATCAAACTCAATCTGCACAAATCTT
7300	52	161	MW2_CDS_05035	MW0932	FALSE	unmapped	ATGAAGTGATCGGAATTCATTGGGGCGGTGTACCAAATGAATTTAATGGTGCGGTATTTA
7301	52	159	perR_tiling_024_F		FALSE	unmapped	AAATTTATCAAGCACTTTCACCTGATTTTCCAAATATAAGTGTTGCGACAATATATAATA
7302	52	157	MW2_CDS_01761	MW0320	FALSE	unmapped	TGATAAAGATGCCCATACGAGACTAGCGAAAGAAGCAAATACGTCAATTTTACGTAGAGC
7303	52	155	MW2_CDS_04913	MW0905	FALSE	unmapped	TTATTACATGATGCAATTCACCTTGCATTTGATAATGATATAACATGTGTCCACGTGCCT
7304	52	153	(+)E1A_r60_a97		pos		
7305	52	151	MW2_CDS_02015	MW0372	FALSE	unmapped	AGGTATTGTAAAAGAATTGAAACCATTGCTAAAATGGTCAGAAGTACCAGCTAACGCTGT
7306	52	149	MW2_CDS_09591	MW1801	FALSE	unmapped	TCTTCACATACTCATCCAACAGCTGATGAAATTTATCAAGCACTTTCACCTGATTTTCCA
7307	52	147	MW2_CDS_08047	MW1515	FALSE	unmapped	TGAAATTGGATGTCCTGTCATTGATGTTTCTCAAAAAGCAATCGAAGAAACAGCAAACGA
7308	52	145	MW2_CDS_01553	MW0285	FALSE	unmapped	AAGGCTCAAGGATTTACGAATGGCTATTTAGCGAACGTAGTTATTTCGCAGACGCTCATA
7309	52	143	agr_tiling 078_R		FALSE	unmapped	ATATACCCAATTTATTCAACTGGGTATTATTATACAAGCTATTACATTACTACCAATATA
7310	52	141	MW2_CDS_07543	MW1416	FALSE	unmapped	AGATTATTGGTTGAATAAACGCAAGTCAGAAAATGAACAGATTGATATTGATAGAGTGCT
7311	52	139	MW2_CDS_05211	MW0964	FALSE	unmapped	AATGCCAACGACGATTCAAGAATTGAGAGAAAGACGACAACGTGCTGAAGCAATTGTAAA
7312	52	137	MW2_CDS_09366	MW1759	FALSE	unmapped	AGGTGACCTAATTATTAATCCACATCCGGTTAATGCTATGTTGTTATTGGTGACAATATT
7313	52	135	MW2_CDS_12671	MW2396	FALSE	unmapped	ATTTATTACAGGTGAAACAATTCGTATTGACGGTGGTGTTATGGCTTACACATGGCCTGG
7314	52	133	MW2_CDS_12981	MW2456	FALSE	unmapped	TGGCACAAAAGAAGTACTGTACCCAGATGCTTTGAACTTATCGCAATTGTTGAGTGCAAA
7315	52	131	MW2_CDS_05016	MW0928	FALSE	unmapped	TGCCAAACTTATGGCCGCGCCTGAAAGAAATTAAAGTACCAACATTAATATTAGCTGGAG
7316	52	129	MW2_CDS_09760	MW1833	FALSE	unmapped	AGTGTGGTTTCAAACGAGAGCAAGCAAAATATGAAATATCAAGTTTTGATGTGGCACCGT
7317	52	127	MW2_CDS_13338	MW2523	FALSE	unmapped	GGTATGCCTATGTCAGCAATTGTTGGACGCAAAGAGATTATGAATTGTTTAGAAGCGCCA
7318	52	125	MW2_CDS_03642	MW0667	FALSE	unmapped	ACCATATGAGCAACGTATCAAACATGAAAACCGCACATTAGAAGTGAATTTCTGTAGCGA
7319	52	123	MW2_CDS_01226	MW0226	FALSE	unmapped	GTTACGATTGGTCAAATATTGACGCTACCTAAAAAAGGTGGCGAGGTGGTATTACTCGGA
7320	52	121	MW2_CDS_04015	MW0732	FALSE	unmapped	TTCACAAGCAAACCAATATCAGCAATTGCCACAGCAGAATCAATATCAATATGTGCCACC
7321	52	119	MW2_CDS_07983	MW1504	FALSE	unmapped	AAGCTTCGCAGTCAAGGTGCCAAAGATATGGATAATGCAATGATGGTTGTACAAAATCCT
7322	52	117	MW2_CDS_00621	MW0115	FALSE	unmapped	TGGATTAGTCGGCGCTGGCGGTATTGGATTGTTTTATGATCAAACACTTGGTTTATTTCA
7323	52	115	MW2_CDS_09292	MW1744	FALSE	unmapped	CGCAGGTGTTGGTGGTTTCCTTGGATCTATAGCTGCATCGAATATTGATACTAGTAAGGG
7324	52	113	MW2_CDS_05342	MW0989	FALSE	unmapped	TCACGTAGCAAAGCATGCTAGAAGAAGTGTGAATCCTCCTAAAGATACATGGGTTGCTTT
7325	52	111	MW2_CDS_02574	MW0476	FALSE	unmapped	CATGGCAAGATGCAGTTCAAGCCGGTTCAGTTATGGCGACAAAACTATTATCTAACGAAT
7326	52	109	MW2_CDS_02091	MW0386	FALSE	unmapped	ACAAACAAATCGCATGAGTGACGTCATTGACGGTAGAAATATTGAAAAAATAGAAGCCAA
7327	52	107	MW2_CDS_04513	MW0834	FALSE	unmapped	CGCTCATTCCAGCTTACTAATGCTTTAATTGCTGGTGGTGTTGGTTTGTCCGTCATTATT
7328	52	105	MW2_CDS_00491	MW0092	FALSE	unmapped	TTGGCGGTGTTACAGCTTCGATATTAGGTTTTAGTGCGTTACTGATGAGTATTGCCGTTA
7329	52	103	MW2_CDS_09239	MW1734	FALSE	unmapped	CATGCTTGATGAAGTAGTGGATGGAACAATACCTCCAATAGCCCTTGATGAAAAGGCAAC
7330	52	101	MW2_CDS_13445	MW2543	FALSE	unmapped	TCGTGGCGAAGAAAGTCAATTAGCTTTTCAACAACGAATAACAGATAGCTTAGCACTTGT
7331	52	99	MW2_CDS_02760	MW0509	FALSE	unmapped	ATAACTCGTTAGCACGATTAGAAATGCCTCAAGTAGACGAAGCAGAATTGTTAGAGGGGC
7332	52	97	MW2_CDS_02510	MW0464	FALSE	unmapped	TTCTAGACAAGCTTTTAATAACTTACCAAACTCATTAAAGATGGTTGTGTTGGATTGCCT
7333	52	95	MW2_CDS_06719	MW1255	FALSE	unmapped	TTCAGTACCATCCTGAATCATTTGCTACAGACTATGGTGTCAAAATAATTACAAATTTCA
7334	52	93	MW2_CDS_08334	MW1568	FALSE	unmapped	AATAACGTTAAAGCCGGTGATCTTATCAAACAAATGGCACCAATCGTTGGTGGTAAAGGT
7335	52	91	MW2_CDS_03435	MW0630	FALSE	unmapped	TATAAGAAGACTAATTGAAAAAGAAAGACTTAGTAAAGTTAGATCATCTAAAGATGAGCG
7336	52	89	MW2_CDS_06249	MW1160	FALSE	unmapped	CAATTGCCAGAGAATTAAATGTAAAAACCGACGATGTTTATGAAGCAATTCAGGCATTGA
7337	52	87	MW2_CDS_02556	MW0473	FALSE	unmapped	GGCAACACTGTACCTGTTCATATGCAAAACCTTATTGCAACGTTTATATCTTCCGGTGGT
7338	52	85	MW2_CDS_02890	MW0532	FALSE	unmapped	ACTAAAAATGATCAACATGTCATAACGGTTACACAAACTTTTATTAAGGCGATGAAGTAG
7339	52	83	MW2_CDS_11031	MW2086	FALSE	unmapped	GCAGGACAACTTAAGTCTGAAACTAACGTTGCATCTAACGAAGCAGATAAATCGCCAAGC
7340	52	81	MW2_CDS_07513	MW1405	FALSE	unmapped	ACTTACATGGTCCTTGGAATTATACCAACAAGCAAATGCTAGATTATACAGACAAGGACA
7341	52	79	MW2_CDS_03736	MW0684	FALSE	unmapped	ATCAACTTTTATCAGAGAGCGAGCGTGTCATTGTCATGCAAGAAGATAGCGTAGGTCAAT
7342	52	77	MW2_CDS_02295	MW0424	FALSE	unmapped	ATGCCAATACAGTGACTTATACTATTTCGATGAATTGGTCGTTAGAAATTGCGCGCGCAC
7343	52	75	MW2_CDS_03645	MW0667	FALSE	unmapped	TGGCTTCTGAAATTACGCAACAAATGAATCAAATTAAATCCGAACAACAAGAAAAAACAG
7344	52	73	MW2_CDS_00025	MW0005	FALSE	unmapped	CATTTGGTACAGGAATCGGTGGCGACTTTGATCTAGCGAAAGCAAGATATCACAAAATCG
7345	52	71	MW2_CDS_13833	MW2611	FALSE	unmapped	ATTAGTATTAAATGCCATTCATATCCCACTTCATGCTGGTAAAATTGAAGAAATGTCTCG
7346	52	69	MW2_CDS_05190	MW0959	FALSE	unmapped	ATTACAGAAGTATGTTCATTTACTCAGTGAATATGGTGTGTGGCATCCACGTGCATGGGA
7347	52	67	pMW2_041		FALSE	unmapped	TCAGCTAATGAAATTGTAGTTGAAATTCAAAAATATAAAGAAGTTAGTGATAAAACGATT
7348	52	65	MW2_CDS_06718	MW1255	FALSE	unmapped	TGATTCCTTTACATATAACCTAGTGGATATTGTTGCTCAACATACTGACGTCATTGTTCA
7349	52	63	MW2_CDS_10609	MW2002	FALSE	unmapped	TACCTGTTGAATTGAAAATGAACAAATCACCCTATCGTCCTAAAGGCAAACGTTTCGCCA
7350	52	61	MW2_CDS_06157	MW1143	FALSE	unmapped	AATGACAAAAGACTATCCTGATCCAGAGTTGTTAATTCGTACTTCAGGAGAACAAAGAAT
7351	52	59	MW2_CDS_06894	MW1286	FALSE	unmapped	ACCAACGCCATTCTTATTTGGGGAAGATTTTAGTTTTTATGGTCAACAACTAGCTCCAGC
7352	52	57	MW2_CDS_05903	MW1098	FALSE	unmapped	ACGGCGAAGTGACAAGAAGTAAAATGATAGTTGTCGAAAGTTATGACGTCAATGGGAACA
7353	52	55	MW2_CDS_12953	MW2451	FALSE	unmapped	ATCACCAGAAGCATCCGGGCACGCTATGGCATTAGCGATAAGTAATTTATTAGGTTTAGT
7354	52	53	MW2_CDS_07873	MW1483	FALSE	unmapped	TTGAGAAAGATGTAAGTAAAAACAAAGGCGATAAGAATGTTCAATCGAAATTAAATCAAA
7355	52	51	MW2_CDS_01389	MW0254	FALSE	unmapped	CCGTTTAAAAGAAACGATACAGTTATATGGTAGAGATGACTTTATAGGTGGTATTGCTGT
7356	52	49	(+)E1A_r60_a20		pos		
7357	52	47	MW2_CDS_10980	MW2074	FALSE	unmapped	AGAAAGCATTAACTTTAAAACGAAAGATAATCAAAGGATTCCACTATATATAGGTGTGCT
7358	52	45	MW2_CDS_05932	MW1103	FALSE	unmapped	GAACGTGTTGAACGTGGTGACAGTGTTGATGTTGTTATATCAAAAGGCCCTGAAAAGGTT
7359	52	43	MW2_CDS_05781	MW1075	FALSE	unmapped	TGCATGAAAATGATTTAAAGCCAGATGAAGTTGCAGCAAATGCACAAAATAATGCATCAA
7360	52	41	MW2_CDS_11009	MW2082	FALSE	unmapped	ATGATTTTTGGAAAAGGCACTGCAAAAGCAACGTCATATGGTGCTGGAATTATCCACTTC
7361	52	39	MW2_CDS_02241	MW0414	FALSE	unmapped	GGAAATATTTAGTAGAGAAGGCAATTCAAGAAGGGCGTGTGCGTGCAGGTCAAACTATTG
7362	52	37	MW2_CDS_00501	MW0094	FALSE	unmapped	TAAGTGAAGCTGCTTCACACCTGACATTAAAGCCAATGCCAGAAGCACATAAAAAAGTGA
7363	52	35	psma_tiling_056_R		FALSE	unmapped	CCCATTAAGATTACCTCCTTTGCTTATGAGTTAACTTCATTGTACATAGTTATCTTGTGC
7364	52	33	MW2_CDS_11579	MW2194	FALSE	unmapped	GGTTTCAGTAAAATGCAACGTTCAGACTGTACAACTTGTGGAGATGTACCAAGTTATCCG
7365	52	31	MW2_CDS_09771	MW1835	FALSE	unmapped	TTACCTGTTGTCGCACATAACGCGGCATTTGATATGAACGTCTTACATCAAAGCATTCAA
7366	52	29	MW2_CDS_05390	MW0998	FALSE	unmapped	TCACGCTGTTAAAAATTATCCAAATAACCGTACTGTTCATTATGGTTATACAGCTGCATT
7367	52	27	MW2_CDS_05760	MW1071	FALSE	unmapped	ATGACAAAATCGAAATTGTAGGTTTAATGACGATGGCACCATTGACAGATGATGAAGCAT
7368	52	25	MW2_CDS_05187	MW0959	FALSE	unmapped	ATGAGTTGTCTATTGGTCAAAAACGACGCCTTAGCGTAGCTACCGCACTAAGTTCTAAAG
7369	52	23	MW2_CDS_09558	MW1796	FALSE	unmapped	ATATCAACCAGAAATCCCAGCTAATACTGGTAACATTGCACGTACGTGTGCAGGTACAAA
7370	52	21	MW2_CDS_12903	MW2442	FALSE	unmapped	GCCAGCAAAAGGCATGATTGGACACTTACATTTAAAAACACATGATTTGGACGCAGCATA
7371	52	19	MW2_CDS_03805	MW0696	FALSE	unmapped	TGCGACAATTTGCTTGAGTTGGATTAGTTTATTTAGTGCGCAATGGGTAGTTGAAAATGT
7372	52	17	MW2_CDS_00964	MW0178	FALSE	unmapped	AGCACAGTCATTTAATCAAACCACGTTAGAAACATGGTTGTTAGAAAGTCAAAAAGAGGT
7373	52	15	MW2_CDS_00265	MW0051	FALSE	unmapped	TGGCACAGGAAAGGGTGATTGGTGCTAATGTTTGGGTAGATGGTATTCAAAAAGAAACAG
7374	52	13	perR_tiling_069_F		FALSE	unmapped	AACAATTATCTGAATACATTTTAGCTTTCATTTTAGATGATTATAAAAAGATGAAACTAT
7375	52	11	MW2_CDS_09320	MW1751	FALSE	unmapped	ATGGACAGCAGATTCAAAATTTGAAAATGATGAACGATTCAGTGGTTACGGCAAGCTTGC
7376	52	9	MW2_CDS_00499	MW0093	FALSE	unmapped	TGCATCAAGATGTTCTGCTCACGCGCTATGTAGAAGGTAAAGAAGATCAGGTTGAGAAAG
7377	52	7	MW2_CDS_00682	MW0127	FALSE	unmapped	CGCTTCGGAAAAAATGTTGATATCGTTCCTATTATAGCGGATGTGCAAAATAGAGCGCGT
7378	52	5	MW2_CDS_04155	MW0760	FALSE	unmapped	ACTCTCGTACTATATATGGTGGTGTTACTAAAGCAGAAAACAATAAATTAGATTCGCCAA
7379	52	3	MW2_CDS_01574	MW0288	FALSE	unmapped	TGCTGGTATGGTTAACGCAAAGAAAACGATAGAAACGAAATATACAGTTAGGCAAAACCT
7380	52	1	agr_tiling 169_R		FALSE	unmapped	CGAGTCACAGTGAACTTACCTATTTAACATTTGTCTACAAAGTTGCAGCGATGGATTTTA
7381	51	164	MW2_CDS_10275	MW1940	FALSE	unmapped	AAAAAAGAATATCCTTATCAAACACCTGTACTCGGCCGTTCTCAATCAGGGTGGGACAAA
7382	51	162	NA		ignore		
7383	51	160	MW2_CDS_10726	MW2026	FALSE	unmapped	AGCTGGTGAGATAGGTGTCATGAGTGGACATATTCCAACTGTAGCTGCTTTAAAAACAGG
7384	51	158	MW2_CDS_05838	MW1085	FALSE	unmapped	ACCGTATGTTTCGACAGGTAAGGATCTAAGTGTCGTACTTGTAGACTTTGGTAAGAAGCA
7385	51	156	NA		ignore		
7386	51	154	MW2_CDS_10362	MW1957	FALSE	unmapped	ATTGCTCAAATGCCATTTGGTGATATTCGTGAAGCTGCTGGCGAAAAAACATTTAATCCA
7387	51	152	MW2_CDS_08795	MW1652	FALSE	unmapped	AGGTGCAGTTTTAATTCCAGGTGCTAAAGCGCCAAGACTTGTAACAGAAGACATGATTAA
7388	51	150	MW2_CDS_07869	MW1483	FALSE	unmapped	GGTTTCAATTGTTGGCGCAACATTATTGTTAGCTGGATGTGGATCACAAAATTTAGCACC
7389	51	148	(+)E1A_r60_1		pos		
7390	51	146	MW2_CDS_00135	MW0024	FALSE	unmapped	TTAGAAATACAAGGAAAGATGCTATCTTCCGAAGGATTGGCCCAAGAATTGAACCAACGC
7391	51	144	MW2_CDS_00843	MW0156	FALSE	unmapped	AACAACATTAAGCATTTACGATCAAACAACATCTACCCCATTATCGTTCATGGCGGTGGC
7392	51	142	MW2_CDS_08062	MW1518	FALSE	unmapped	TGGTTTTACTGCATCATTTAATCGCTGTGCTGTGAGTGGTAATGACACACAAGCAGATTT
7393	51	140	MW2_CDS_02921	MW0538	FALSE	unmapped	TGTCGGAACAGGTGCATTTGGTGCGCATGGTTTACAAGGAAAAATAAGTGATCACTATTT
7394	51	138	MW2_CDS_09047	MW1697	FALSE	unmapped	TGGAATTATGGCCTTGGCACAACCATTATTCACAGTTTTCTATGGTTACGATCCAATTGT
7395	51	136	MW2_CDS_01826	MW0333	FALSE	unmapped	TACCATGCCACTAAGCACTTGAACAAACCATTTTTCATAGGCATTATGCCTATCGCAAGT
7396	51	134	MW2_CDS_06792	MW1268	FALSE	unmapped	TTAAGCTGCACGTATGATTCGTACCAATTTGATGGGGAAAATGTTAGTAGATTGAGTCAA
7397	51	132	MW2_CDS_02741	MW0506	FALSE	unmapped	ACATCATTTAATGGAAGCAGGTTTTGACGTTGATGTTGCGACATTATCTGGTTATCCAGT
7398	51	130	MW2_CDS_09082	MW1703	FALSE	unmapped	TGGCACGAAGGAAAATATATTGCTTATTTTCAGGCATTTACAAATACACATGCGCCAGTT
7399	51	128	MW2_CDS_05575	MW1033	FALSE	unmapped	GTGGTAAAAAGACAGTGATTTCGTCTGGATTAGAAACGGCTCGTGAAGTTAGTGCATTGC
7400	51	126	MW2_CDS_09944	MW1866	FALSE	unmapped	TTCAAAAGCTGGTCTGGCACCATCCATACATCAATGTATCAACCTGAAACATTAACTGCA
7401	51	124	MW2_CDS_00290	MW0056	FALSE	unmapped	AGATGAAGTTGAGTACGGTGGTGTAGGCACTTATATTGGTGCTACTGAAAATGCGAATCA
7402	51	122	MW2_CDS_09677	MW1817	FALSE	unmapped	GTTATGCATATCTCACATAACTGGGGAACAACTGATGAATTCGCAAATGTTGGCTTTGGC
7403	51	120	psma_tiling_058_F		FALSE	unmapped	TATGATCATAACAATTCAAGTTAGGAAAAAAATCAATTACGCACAAGATAACTATGTACA
7404	51	118	MW2_CDS_09667	MW1814	FALSE	unmapped	TGTCAGAGAATTTTACGCAACGTGTAAGCACGAACTTAGAAAAAATGAAGCAACAAAATT
7405	51	116	MW2_CDS_13546	MW2562	FALSE	unmapped	AGTTATAGCAGTAGATGCACCAGCGCAACACACGCAACTTCATGATACAGATATTACACA
7406	51	114	MW2_CDS_10985	MW2078	FALSE	unmapped	AACTTCAGATGTAACGGCATACACGAATGAAGAGGATGGCGCAGCAAAATATTTAGCAAA
7407	51	112	MW2_CDS_01346	MW0246	FALSE	unmapped	GTGCAGTGGTACTTCTGTTAATTGGTGAATTTGGATACTGGTTATATTCAGCTGCACCGC
7408	51	110	MW2_CDS_08188	MW1540	FALSE	unmapped	ACTCAAACAATCTGGTATTGAATTTAAAAAAATTCCATTTTCACCAGAATATGTTGCTAA
7409	51	108	MW2_CDS_02735	MW0505	FALSE	unmapped	CATGGTTCAGGTGTTATGGGTAAAGGCGCTGGTACGGTTAAACATTTTGGTTTACAAGAT
7410	51	106	MW2_CDS_04869	MW0897	FALSE	unmapped	AAAGCTCAATTGAGACAAATTGTTGATGTGACAAAGCGCCATTTATTGTTGTTCCCTGGT
7411	51	104	MW2_CDS_01895	MW0347	FALSE	unmapped	TTAAAATCATTAGCAGTGTTATCAATGTCAGCGGTGGTGCTTACTGCATGTGGCAATGAT
7412	51	102	MW2_CDS_03277	MW0602	FALSE	unmapped	ACCCAGCAGTAACGCACACGACAATTCAACTCGTAAAAGACTATATTATGTCTATGCAGC
7413	51	100	NC_S_067		FALSE	unmapped	TTGATGGTTATTGTTGTTGATTTGAATAATTTGTAGCGAATATTTTGTAACAGGGCTACT
7414	51	98	MW2_CDS_03230	MW0594	FALSE	unmapped	GTTTGTGGTACAGTTGGTAGTTTAATTGTATTACGTGGTCTTTCATTAATGGGAGATGCA
7415	51	96	MW2_CDS_04626	MW0853	FALSE	unmapped	ACTGGTAATTTACTTGTCCACTTGAAAGAATCCCCTACCTCAATTTTAATTGAAGCCGAA
7416	51	94	MW2_CDS_09584	MW1800	FALSE	unmapped	TCTTCAGGTTAAAGGAACACCATTGTCTGCTGGATTTGGATATACAGGATTAGTTGGCCC
7417	51	92	perR_tiling_076_R		FALSE	unmapped	GCAAACCATGCAATCCATTTTAAATTCGGGCAACGTTGTAAAAATGCCTCATTGATACCG
7418	51	90	MW2_CDS_00194	MW0037	FALSE	unmapped	ACTCAAAATATCATTATTGATGAACGTCATTTACTAAAACAAGGAGGTCAGGACCATGAA
7419	51	88	MW2_CDS_06218	MW1155	FALSE	unmapped	CTATTAAAGGCACTGTAGTGCAAGGTGAAAAAAGGGGAAGAACTATTGGCTTCCCAACAG
7420	51	86	MW2_CDS_04271	MW0785	FALSE	unmapped	ACAGGCGTAGAAATTAATAAATTGTTTAATACACACGGCGCGAAATATCGTGAGCTTGAT
7421	51	84	psma_tiling_053_R		FALSE	unmapped	TATTTACCAGTGAATTGTTCGATTAAGCTTTTGATAACTTTAATGATGCCAGCGATGATA
7422	51	82	DCP_20_3		pos		
7423	51	80	agr_tiling 130_F		FALSE	unmapped	TACCATTTAACTTAAGAGCATTCATTTGTAAATTATCTTTCATAGGTACAATATTTTTAT
7424	51	78	MW2_CDS_12436	MW2355	FALSE	unmapped	TATATGTTTTTGTATCCTGGCTAAATTTGCCAGCGGAAATTGCGCCATTTGCAGGTTTAG
7425	51	76	MW2_CDS_09347	MW1755	FALSE	unmapped	TGCAGGTAGTGGAAAAGATGAATCTGAAAAGAATTTCGGTGTTTATTTCACACCACAATT
7426	51	74	agr_tiling 095_F		FALSE	unmapped	AAAGAAATATACTGAAGATAACACTATTCCAATAATGTATATATAATCTGATTTTTTGTA
7427	51	72	MW2_CDS_13365	MW2529	FALSE	unmapped	AAGGTTTTTAAGACCTAGAACAGCTGGTAGACACTATATCATTATTACGCTGTGGGAAAA
7428	51	70	MW2_CDS_02130	MW0393	FALSE	unmapped	ACTTCAGCAACAGAAAAAAGGCTATATGCAGAAAATCTTCTCGCAAGAATTGCGATTCAA
7429	51	68	MW2_CDS_02667	MW0492	FALSE	unmapped	GATCAAGCAGGTTTAATTATTCCGGTAGAAATCAGTGTTTATGAAGATCGTTCATTTACA
7430	51	66	MW2_CDS_06682	MW1249	FALSE	unmapped	TGTACTCGGTGCAGATAAAGCACAAGGTGGACAATCAAGAACAGATTCTATCATGGTTGT
7431	51	64	MW2_CDS_02088	MW0386	FALSE	unmapped	ATAAACGCACCAAGATTTCAAATCAAGAGAGATGAAGGTGACGGTATTGCTACGTACGGT
7432	51	62	MW2_CDS_12619	MW2387	FALSE	unmapped	ACGTGAAACGCGTCAGTTGAGTTATATTTTTATCACACATGATATTCAAGCTGCCACGTA
7433	51	60	MW2_CDS_09999	MW1875	FALSE	unmapped	AATTTTAAAAAACAATAGTGATTTTCCGATTTATGAACAGATTAAGCAACAAGTAAAACA
7434	51	58	MW2_CDS_12820	MW2426	FALSE	unmapped	ATGGCAAGTTATCAAAGCGAAACATACTGCTACAACACGTCGATTCGAATGTCCAAACTG
7435	51	56	perR_tiling_026_R		FALSE	unmapped	TGAAAGTGCTTGATAAATTTCATCAGCTGTTGGATGAGTATGTGAAGAAATTAAATAACG
7436	51	54	MW2_CDS_13495	MW2553	FALSE	unmapped	TGCGGTGGTGGCGGTATTCCAGTTATAAAAAAAGAAAATACCTATGAAGGTGTTGAAGCG
7437	51	52	MW2_CDS_10527	MW1987	FALSE	unmapped	AAGCGTATGATGTGCAATTAATTGCAATTGGCAATGGTACTGCAAGTCGTGAAACAGAAC
7438	51	50	MW2_CDS_13818	MW2608	FALSE	unmapped	AGGAGATTTTAAATCTACAGGAGGCATTTTTGCAGCTACAGAAAATGGTGACAACATACA
7439	51	48	MW2_CDS_04985	MW0922	FALSE	unmapped	ATGCGCCAATTCATTAAAAGAATTGTTAAAACAATCCTTGTCGGTTATGTAATTAAATTT
7440	51	46	MW2_CDS_13916	MW2627	FALSE	unmapped	CGAGATGAGGTAGGCAAAAGTATCCAAGCGATTCAACAAACAGGACTACATGTTGAGCAT
7441	51	44	MW2_CDS_06073	MW1129	FALSE	unmapped	GGTGTGAAAACAGCGGCAACACCTTCAGAAATTGGTTCAACATTAATTGAAGCTGCTAAA
7442	51	42	MW2_CDS_07462	MW1395	FALSE	unmapped	ACAAAAGTTGGTAGTCAAGAAAGGGCTGTTTTAATTGAATGGGTAGGTCCTATGAATCGC
7443	51	40	MW2_CDS_12572	MW2378	FALSE	unmapped	ATTATGACCCGGAAGAATTGCGTCAACGAATCAGTTATTTGATGCAGCAAAGTGACTTGT
7444	51	38	MW2_CDS_00857	MW0158	FALSE	unmapped	GAATGAAAATCTAAGCGCTTATGCAATCGGAAACCATAAACACAAACCGGAAATCGAGCA
7445	51	36	MW2_CDS_09996	MW1875	FALSE	unmapped	TGGTTAAAGAATTGGTTAATGAAGCGCAAGCCATCGAAATGTCACTTGAGGAACTTCAAG
7446	51	34	psma_tiling_081_R		FALSE	unmapped	GATTAGAAATAAGGAGGTTATGCAGTGTTAAGTTTTCAATTGCTATTTTCACTGTTTGTT
7447	51	32	MW2_CDS_13557	MW2564	FALSE	unmapped	TCGTATTGCTTGTATTACAAATTGCAGGTGGTGGAGGAACATTCCCAATTCAAACTACGC
7448	51	30	MW2_CDS_09927	MW1861	FALSE	unmapped	AACGTTGCGTGAATTTTATGGTCAAAATATACAACAAAGTCCAGATTATGGCCGCATTGT
7449	51	28	MW2_CDS_03375	MW0620	FALSE	unmapped	CATCAGCAAGAGATTTAACATTAATCGCAGCAGATAATTTTGGTCGAGCAGCGGCTATCA
7450	51	26	MW2_CDS_01727	MW0315	FALSE	unmapped	ATCAACGTTTTATGGCACAGCTTGATTTTGGCGGTGTGCCATTTGAAAATGTTATGAAGA
7451	51	24	MW2_CDS_08222	MW1547	FALSE	unmapped	AGAGCGCAAGGGAAACCATATTTATAATGGCTTAGATATGTTTGTTTACCAAGGTGCGGA
7452	51	22	MW2_CDS_01698	MW0310	FALSE	unmapped	TCTGAAGAAGAAAATGAACAAATGAAAGCAAACTTAACTAAAATGTTATCTAGTTTACAA
7453	51	20	MW2_CDS_04042	MW0737	FALSE	unmapped	AGAAGGCGTTACACTTCGAGAAACTGGTCGCTTAGGTGACTTAGCACCTACATTATTAGA
7454	51	18	MW2_CDS_06280	MW1166	FALSE	unmapped	GCCGTAACTGGTTTACGTTTACTACAAATTGAACAAGGATTCGTAAGTGCAGCTGGTCAA
7455	51	16	MW2_CDS_07720	MW1456	FALSE	unmapped	TGGGGCATCGAAAGCAGGGTTTTATGCATTAATGAATGCTTTAAGACTAGAGTCACCAAA
7456	51	14	MW2_CDS_12035	MW2280	FALSE	unmapped	AAATGGTGCCTCTGGTTCTGGGAAAACAACATTGCTAACGATATTAGGCGGATTGTTAAG
7457	51	12	MW2_CDS_01110	MW0204	FALSE	unmapped	TTCGCCAAGACTTGTTAATCAAGCGCACTTGGAAAATAAAGAAGTCTATACTTGGACCAT
7458	51	10	MW2_CDS_11281	MW2131	FALSE	unmapped	AGGTGATGAGTTAACACCATATGCAACTGTAACTAAATTCGTAGCAGATACAAGCTATGA
7459	51	8	MW2_CDS_08072	MW1519	FALSE	unmapped	TGGGTCAAAGTTCAAAGAGACTGGCGAAACAAAGTTAACTTTATTCGCCAAATTGGTTAT
7460	51	6	MW2_CDS_03130	MW0575	FALSE	unmapped	AGGTACGTTGTTGGACAGAGTTAAATCTCGAGAGAAATTTATCGAAGAGCAATATGAACG
7461	51	4	MW2_CDS_01000	MW0185	FALSE	unmapped	ATATAAACGACCACTAAGTAACATGGCTCCAACGATTGTGATGTATCACGGGAAGCCAAT
7462	51	2	MW2_CDS_02932	MW0541	FALSE	unmapped	CACTTATCCCAACAGGTGACTTGGCAACTATTATCATTGCAGCAGTCATGCCTATTGTTC
7463	51	163	MW2_CDS_11827	MW2243	FALSE	unmapped	TGATAAATTCGAAACATACATCATCAACATCGCCGGTTTAAATGACCGTACTACTAGAAA
7464	51	161	MW2_CDS_05794	MW1077	FALSE	unmapped	ACTAATTCATTTAAGCGAATATGATATTCCAGTTAACGGAGGTATACAGCCTGCTTCGTT
7465	51	159	MW2_CDS_04926	MW0908	FALSE	unmapped	GCTGAATTAACTGGTCGTAACGATATTCAAGTTGGACAAGCGAAAATCTCAGGGAATGCC
7466	51	157	MW2_CDS_03795	MW0694	FALSE	unmapped	AAGGAAAAAAGCAGTTTATTCATTTATGGCGATGATGGAGCAAATACACGCGAAAAGCTA
7467	51	155	MW2_CDS_00787	MW0146	FALSE	unmapped	TGCGGAAAGTCTACTTTACTCAATATCATCGGTGGATTTATTCATCCATCATCTGGACGT
7468	51	153	MW2_CDS_13104	MW2481	FALSE	unmapped	AAAGATACAGACACTAAAATCGTGCATGATTTTGCTTATGGTGCTTTCGGTTTCGACGCT
7469	51	151	MW2_CDS_03632	MW0665	FALSE	unmapped	AGGACGAGCATTAAAGGATAATGGCGTCGATAGAGAAGATTTGTTTATAACAACGAAGTT
7470	51	149	MW2_CDS_03842	MW0702	FALSE	unmapped	AAACCATCTCATACCTAAATTTGAAGCATATTATAAGTCAGCAAAAAATTTGCCTGATGA
7471	51	147	MW2_CDS_04635	MW0856	FALSE	unmapped	GAGGCAAATGTAAATCGATTATTAGCTGACGCGGCGAAACGAAAGTCCAATGTCACATTA
7472	51	145	MW2_CDS_05979	MW1112	FALSE	unmapped	CATTAATGGATGGCGATACAGATGTTGTAGTTACCGATGGCTATACTGGGAACATGGTCC
7473	51	143	MW2_CDS_13236	MW2505	FALSE	unmapped	GTTTGAAAATATGAAACAAAATTTGGATAGTGAAATACAACGTGGAGAAGTTACACCCCA
7474	51	141	agr_tiling 085_F		FALSE	unmapped	CTTTTGGTACTTCAGCTTCGTCCAATAAAAAATCACAATTTATATACGCGGCTCTGTAAC
7475	51	139	MW2_CDS_07640	MW1442	FALSE	unmapped	CGTGATCATATACTAAATGATAATAAGTTACACAAGCGAAATCGCATTTTAATTGCCAGC
7476	51	137	MW2_CDS_03073	MW0564	FALSE	unmapped	GAAACATTACAAGATAAACGATATCCTAATTTTAAGGCACAAATGGCCGAAAAGGATTTT
7477	51	135	MW2_CDS_01045	MW0193	FALSE	unmapped	GCAGATAGTCAATTTTTACATCAAGCAGCGCAACGTGGCGACTTAGGAGACATTTACTTC
7478	51	133	NC_A_053		FALSE	unmapped	AATCAGTTAGGATGAAAAAGTGGATAATCCTTTTTTAGGCAGGTACTTCGGTACTTGCCT
7479	51	131	MW2_CDS_04656	MW0859	FALSE	unmapped	AGATATTTGTTTTGAAGATGCAACAAGGACTTCTAGAGAAAAATTGAAAGAATACATGGA
7480	51	129	psma_tiling_069_F		FALSE	unmapped	ACTTCTGTCTGTTCAATTCATCTTCATAAATATGCTTTGCCTAGACGAGACCTAACGTGT
7481	51	127	MW2_CDS_05563	MW1031	FALSE	unmapped	CTTCTCTCAACATGGTGGTAACCGCTTAGGTGCCAATTCATTGTTATCAGCGATTTATGG
7482	51	125	MW2_CDS_09304	MW1748	FALSE	unmapped	ATGTGAAAGGTTATAAAAATATAAGCTTCGCTAATTTTAAAGAAAACCCAATGGATGGTT
7483	51	123	MW2_CDS_12693	MW2401	FALSE	unmapped	ACAAAAAAGATGATTTTGTTGCCTATGCATCACCTGAAAATAACTTTCAATTTGTAGGTG
7484	51	121	MW2_CDS_06944	MW1297	FALSE	unmapped	TGCCAGTAAGTGACATGACGTTAGATCAATTGAAATCCAAAGATCGAAACATTGGGACAT
7485	51	119	MW2_CDS_12862	MW2434	FALSE	unmapped	AAAATTTTTACGCCACAGGAATCTTTCACATCTGCTTATAATGGTTTTTCATGGTTTGCA
7486	51	117	MW2_CDS_09953	MW1867	FALSE	unmapped	GCAATATTAAAGTTGTTATTGGTACGCTACAAATCGACAAGAGTCAAATTAAACAATCCA
7487	51	115	MW2_CDS_09974	MW1871	FALSE	unmapped	ACGCGTGATTTTTCACAAGGTACAATTCAACTATATATGAGTAAAGTTAAAACACGCGTT
7488	51	113	MW2_CDS_09620	MW1806	FALSE	unmapped	ACAGCAACAGATGAAGAAGTAGTTGAAGCGGCGAAAATGGCTAATGCACATGACTTTATT
7489	51	111	MW2_CDS_08888	MW1668	FALSE	unmapped	TTAATTCCTACAGGATTACATCATGCACTGAATAGTGTGTTCTGGTTTGATACGATTGGT
7490	51	109	MW2_CDS_06091	MW1132	FALSE	unmapped	AGTTATATCCGAATATCCACCACATACACCAATTGCTAAATATAGATTTCCTGAGCGCAA
7491	51	107	MW2_CDS_02182	MW0402	FALSE	unmapped	AGAACCTGAACAAATGATATCTGCAAAAGAAAGACAACTTTCAACGATAGGGTCTTCTGT
7492	51	105	MW2_CDS_09029	MW1694	FALSE	unmapped	TGCGGGTCTTTTCGGTATCAACTTGCGCTATCCAGAAGGATTTGAATTTGAAAAAGCTAT
7493	51	103	MW2_CDS_00015	MW0003	FALSE	unmapped	GTGATTATTTTGGTTCAAGAAGTTGTAGTAGAAGGAGACATTAATTTAGGTCAATTTCTA
7494	51	101	MW2_CDS_06006	MW1117	FALSE	unmapped	GTTGCAACATTTATCGTTACTGAGTGGTGGTGAGCGTGCATTAACTGCTATTGCTTTACT
7495	51	99	MW2_CDS_06455	MW1205	FALSE	unmapped	AATTCACCAATTCAAATAGCTGCAAGTGGTCCGGCTAGTGACTGGCATCAAATTGAATAT
7496	51	97	NA		ignore		
7497	51	95	MW2_CDS_10537	MW1989	FALSE	unmapped	GGCGTTTTTTCGAGAGCTGGTGCTACATATGATGATATTGAAGATGCCAAGATTGCAGTT
7498	51	93	MW2_CDS_09950	MW1867	FALSE	unmapped	AACGATCATGGTGACATTGAATTTAAAAACATGCCATCAAAAGTAGATGCAAAAGCTTCT
7499	51	91	MW2_CDS_11100	MW2098	FALSE	unmapped	ACACCAAGAGGCGTGAAATTATTTTATCCGTTACCGTTTAATGTGAAGACACCGATTCAA
7500	51	89	MW2_CDS_04309	MW0793	FALSE	unmapped	GGCAGACGAAAGTAAATTTGAACAAGCAAAAGGTAATGTTAAAGAAACAGTAGGTAATGT
7501	51	87	MW2_CDS_03071	MW0564	FALSE	unmapped	TCACCAGTGTATTGGTATAGCATTTCAGCACCATTGAAAGCATTTATCGAACATTGGTCA
7502	51	85	MW2_CDS_12498	MW2365	FALSE	unmapped	GGCTACGAATTACAAGGTTCGACACCTGTCGTCTCTAAACCTGAATTTAACCTTTGGGAT
7503	51	83	MW2_CDS_00378	MW0072	FALSE	unmapped	TGATAAGGGAACATGGATTGTAAATTCTCAAATGGCAATTCAAAATAAAGGAGAAGCTCT
7504	51	81	MW2_CDS_05761	MW1071	FALSE	unmapped	TCCATGCTTTAGATCGATTGAGCTTAGCCAAAGAAATTAACAAACGTGCAGAACATAAAA
7505	51	79	MW2_CDS_09417	MW1770	FALSE	unmapped	ATTTACGCTTTATACGATCAGTCCAGAGACATGATTACACTGACAGATGACGGCTATACT
7506	51	77	MW2_CDS_09692	MW1819	FALSE	unmapped	ACGAGGTATTCGATATTGTGCGAATTGATGGTAACGATCCAGTTGAAAATTGGCGTCAAC
7507	51	75	MW2_CDS_06821	MW1273	FALSE	unmapped	AAAGAAAGATACCGTATTAATAAGAGAAATAATTGAGCGTGATGAAGATATCGATGACTT
7508	51	73	MW2_CDS_09128	MW1711	FALSE	unmapped	AGATGAATTTATTCTCTATTATGCCCCGAAATTAATTGGCGGATCTGGAAATTATCAATT
7509	51	71	MW2_CDS_10777	MW2036	FALSE	unmapped	GCGCTAAAAATATTCGCTTCATGTGTTTAATTGCAGCACCAGAAGGCGTAGAAAAGATGC
7510	51	69	MW2_CDS_01282	MW0235	FALSE	unmapped	CACCTTATGTGACGAAATTATCGAAAGTACATGGACCTAACCATCCATATTTAGTCGAGT
7511	51	67	MW2_CDS_09723	MW1825	FALSE	unmapped	AGTGCCGATGAAAGTTGTGCATGAAATACAAGATTTTAAAGTGCCTAAAGGTATTGAAGA
7512	51	65	MW2_CDS_05161	MW0954	FALSE	unmapped	GTGCGCAAATTAATTAATGAATCAGGCATTGATTTGGCATCAAACTTCGATAATCGTCCA
7513	51	63	MW2_CDS_02737	MW0505	FALSE	unmapped	AAGCACAATCACGACCATTCTTATTCTCTACATCATTAGCACCTGGGGATACCAAAGCAA
7514	51	61	perR_tiling_109_R		FALSE	unmapped	TTTGCAACATATAATCACCTTTTTCTTCATTATAATAATTTTATGATACGATATTAGATG
7515	51	59	MW2_CDS_13635	MW2577	FALSE	unmapped	GCGAGAAAAGTAAGGCAGATGGTATCTCAGTGGTTGGTACTGTCAATTATGACGTTCCTT
7516	51	57	MW2_CDS_00727	MW0135	FALSE	unmapped	TGGCTATCTTGCAGCTAAGAAAGCGTTGGTACTCATCATGGATAAGCAATCTGATATCGT
7517	51	55	MW2_CDS_05333	MW0987	FALSE	unmapped	ATGCTTCAGACAACAATGGGTGCATTAGCAATTATTTTATTAATTTCAACACTTTATGGT
7518	51	53	MW2_CDS_10986	MW2078	FALSE	unmapped	CAGGACGTTCGCATTCTGAAATACATCAACTTGTACCTCAAGATTTTGCGGTTAATGGCA
7519	51	51	MW2_CDS_10724	MW2026	FALSE	unmapped	TGAAAGAGCTAAATTAGCCAAAGCAAGAGCAGAGTCTCACTTGGAAAATGATGACGACAA
7520	51	49	MW2_CDS_01805	MW0329	FALSE	unmapped	TCTTTGGCGAGGTACTGGTTGGTTTAGCTTCGTCATCATTTAGCATTGATCATTTTAGTT
7521	51	47	MW2_CDS_03275	MW0602	FALSE	unmapped	AGGGCAGCGAGCTTACAATTACCATGGTGAATGGAAATTGAAAAGTGCTGATGAGTTTAT
7522	51	45	MW2_CDS_06925	MW1293	FALSE	unmapped	CACGTTCTATTTATACGACAGTTAGACAGAGACCTGCATCATTTTATAAAGTTGAAGGCT
7523	51	43	(-)3xSLv1		neg		
7524	51	41	perR_tiling_056_F		FALSE	unmapped	TCACTTGAAAGCACATTACCAAATGCTGACATTATTATAAATGCTTTACCAGAAACGCAA
7525	51	39	MW2_CDS_06262	MW1162	FALSE	unmapped	ACATTGCGTGCAATGTATCAACAACATCCAATACGTGTTGATATTGCCGGTAGTGTAGAA
7526	51	37	MW2_CDS_03884	MW0710	FALSE	unmapped	GGAACTGCCGGTGTCCCAATGTTAGACATATTAAAAAAGCTCGATGTTCATAATGCGTGT
7527	51	35	MW2_CDS_03911	MW0714	FALSE	unmapped	ACCAATGGATTCAGAAGAAGCGGTATTACAAATGAATCTATTAGGTCATGACTTCTTTGT
7528	51	33	MW2_CDS_13133	MW2486	FALSE	unmapped	AGGGCAGAGTTGATTCATTGGATATCGATACTTCCAGTCATCATATTCAATAAAGGCCCT
7529	51	31	MW2_CDS_08100	MW1525	FALSE	unmapped	CAGGTGTAGCAATGAACGGTATTGAAGTGAAAGCCAAAGCTCGTATCACAGTTAGAGCTA
7530	51	29	MW2_CDS_00239	MW0045	FALSE	unmapped	CGAAGGTGCTGGAGCACAAGTTCCAATGGGACTATTCAGTGGTGATTTTATTTTTGTAGG
7531	51	27	MW2_CDS_13289	MW2515	FALSE	unmapped	GGATAGCAAGAGCAAGTCAGTACATAAGCAACAATTGAAAGAATTGCCAAAAACAGGAGT
7532	51	25	MW2_CDS_08049	MW1516	FALSE	unmapped	CAACGCTTAGACCAGATTTAGCGATATTAACAATGTCAGGTTTTTTAGAAGCGCGTCCCC
7533	51	23	MW2_CDS_02312	MW0427	FALSE	unmapped	GTGCATATGGTGTTCAAACAATGCGTTACGATGTTGACGATAAAGGACACATACGTGGTT
7534	51	21	MW2_CDS_09158	MW1718	FALSE	unmapped	TCAAGAAGGCATTCAGCTAGAAGTTGATGAGCCATTTTCTCTAGTTTCAAAAAAATGTCA
7535	51	19	MW2_CDS_12674	MW2397	FALSE	unmapped	TCCTTATCGGCTTTCATCCCGCATTCACACAAGTCATTTACCGTGTAGGAGATTCAATTA
7536	51	17	MW2_CDS_08896	MW1670	FALSE	unmapped	CTGAAGAAGAGCGCGAGCAACTTCATACTGATAGAGAAGACGGTATTTATGTCGCCAAAG
7537	51	15	MW2_CDS_07855	MW1480	FALSE	unmapped	GCAATGCCTATGCCTCAAGTACAATCAACTGATAGCAATAAAACTGAAGCTCCAAAGCCA
7538	51	13	MW2_CDS_06257	MW1162	FALSE	unmapped	GTTGCGTGATAAAAAAGGCAATTTCCAAGATGCAGAAGCATTTGAACTTTTGAAAAAGCA
7539	51	11	MW2_CDS_01205	MW0221	FALSE	unmapped	TGGGACAGCAATTAGTGCATAAAGAAAATATAATGCTCAATTTGTCGGCAACTGATAAAG
7540	51	9	MW2_CDS_08197	MW1542	FALSE	unmapped	TGTCGCAATATGCAGAAATGAGCCTAGTGTACGATCAATTGACTCAAGATCAACCATATG
7541	51	7	MW2_CDS_09528	MW1790	FALSE	unmapped	AACGGTACCACTTAAATCGGGTCAAGAACAATTCGGCATTTTAAATGTAGCGTCACCAAA
7542	51	5	MW2_CDS_01657	MW0302	FALSE	unmapped	AGGATTTGAAGCCGATAAAAGGTGACAATATCTTTGTTTGGCAAGGTGATATCACGACGT
7543	51	3	MW2_CDS_01817	MW0331	FALSE	unmapped	GACAACAACATGCACCGGGTTGGGGATTAGATGCTTTGAAGTACTTAATTGAAGAACGTC
7544	51	1	MW2_CDS_04103	MW0750	FALSE	unmapped	TGAATTGGGAAATTAAAAATTTAATGTGTGATTTAAAGATATTGAAAGAAAAGTTTGAGG
7545	50	164	MW2_CDS_13217	MW2501	FALSE	unmapped	CGACGCACAGGACATTGCCGAACTTGCAAAGTCATTAAGTGATGAACCTGTCTATATATT
7546	50	162	pMW2_065		FALSE	unmapped	ACAGTTGCTTAAAGATAATCACCTAGAAGAAGAAATTAGCGGTATAACTAATTACAAGGA
7547	50	160	MW2_CDS_03450	MW0633	FALSE	unmapped	TATAGGCTTAGTCACGATGAAAAAGGTTCGTGATCCTTTAGAGGTGACGGTAGTTGGACA
7548	50	158	MW2_CDS_01450	MW0267	FALSE	unmapped	GTCATGAATTCAGCACAAAAGTTCTTTGAAGCAGATGAACATTGGGGTACGGAATTTGCC
7549	50	156	MW2_CDS_12206	MW2310	FALSE	unmapped	TCAATACAATACCTGAATAATGATTTCTGGAGTAATTGCGAAAAATATTTAAAAGTTGCT
7550	50	154	MW2_CDS_05055	MW0935	FALSE	unmapped	GTGAATAGAAGATTTGGACAACGCACGGATATCACATCTGAACAGCTAGAACTTCTCCGT
7551	50	152	MW2_CDS_02189	MW0403	FALSE	unmapped	TTTAATCAAATTAATAATAAAAATGAATTAGAAGAATCATATGAATCTGAGAAAAAACGT
7552	50	150	(-)3xSLv1		neg		
7553	50	148	MW2_CDS_11158	MW2108	FALSE	unmapped	AAGTGGAAATAACGTTACTCAAGGTGTATCTGTTGAAGTTGGTGAAAAACAAGCTGCTGT
7554	50	146	MW2_CDS_00629	MW0116	FALSE	unmapped	CGCTCTGATGAATTATCAGGAGGTCAACAACAACGTATATCTATTGCACGTGCACTATGC
7555	50	144	MW2_CDS_06493	MW1212	FALSE	unmapped	TGCAGAAAATGCTGAATTAAGAAGTCAAATGCTGAGTTCTAATAATGATGTTGGCCACCA
7556	50	142	MW2_CDS_11488	MW2177	FALSE	unmapped	AGGTGACTTAGAAAAACGGGAATCTTTGAATTTAGATACTTCCGCACTTGTTCGTCAACT
7557	50	140	MW2_CDS_05623	MW1044	FALSE	unmapped	TAGAGTTTATAGCGAAGAAGGTGCTAACAAAAGTGGTTTAGCCTGGCCTTCAGCCTTTAA
7558	50	138	MW2_CDS_05874	MW1092	FALSE	unmapped	TCAGGACCATCTGGAGTAGGTAAAGGTACTGTTAGAAAACGAATATTTGAAGATCCAAGT
7559	50	136	MW2_CDS_03510	MW0644	FALSE	unmapped	TGCTACAAGTAAAGTTGCTTCAAAAACATCTGCAGCAATCAGTAACACAGCGAGTGATGT
7560	50	134	MW2_CDS_03695	MW0677	FALSE	unmapped	TGCTAACTTCAGAGGACGGCAAGGTCCTTGAATTTGATATTGGCAACATTGTCATTGAAG
7561	50	132	MW2_CDS_02218	MW0409	FALSE	unmapped	CAGTAAAGCCATTACGCAATGGGAAAAAGATTTCCTTGGCAGAGGTTCCTTGTCAGTTAA
7562	50	130	MW2_CDS_01593	MW0291	FALSE	unmapped	TAGTGCAGACAATTGGAAACTAAATACTGCGGCAGCTGCCATTCCAATTATTTTCCTAGG
7563	50	128	MW2_CDS_09355	MW1757	FALSE	unmapped	AAACAAATTGATTTAACTAAGGAAAATGTCTACGATGACTTTAACAAAAAGCTAGATGCT
7564	50	126	MW2_CDS_06540	MW1220	FALSE	unmapped	AAGTCAAAGCCCATTTACAATTGTATTCGATAGAGTAGGCATAGCCTTTGCAGCATCAGT
7565	50	124	MW2_CDS_12226	MW2314	FALSE	unmapped	TGCCATTTACAGCAACATATCAGTTGATTGATCAAGACAGGGGAATTCATGCATTTACGC
7566	50	122	MW2_CDS_12356	MW2340	FALSE	unmapped	ATCTATTGTTAAGTATGTCACGGGTTTTGTCTTTAACTCTGCAGCTGTAAGAGCCGACGC
7567	50	120	MW2_CDS_11849	MW2247	FALSE	unmapped	AGCGGCTGGTGTAGCTGGTATTTCACCGTTAATGTTATTCCCATACAGCATTTATCCTAT
7568	50	118	MW2_CDS_03335	MW0613	FALSE	unmapped	GCATCAGGACCACTGTATGGCTTTAGCTTTGTTAAAATGTCTGCAGTCACCAAAGATGAT
7569	50	116	MW2_CDS_11639	MW2205	FALSE	unmapped	GACGATGCCTTTTGTCATTGTGACTTGGTTTACAATTTTACTTTCAGGACAGGTTAAATT
7570	50	114	MW2_CDS_08158	MW1535	FALSE	unmapped	CAATGGGCGTTCAAACATTCAAGCCGGAGTTATTGTCTGTTTTAGGTAGAACGCACAATA
7571	50	112	perR_tiling_061_R		FALSE	unmapped	CCTGACTTGCTCAGACCAATTAAATTCATATTAAAAGCCTTTGCTAACTTCGCAGTTCTA
7572	50	110	MW2_CDS_03285	MW0603	FALSE	unmapped	CATATGACTTACTTCACTATGGTCATATCGAATTGCTTCGTCGTGCAAGAGAGATGGGCG
7573	50	108	MW2_CDS_13119	MW2483	FALSE	unmapped	AGTAAGCAACGATTAAAGCAATATGAAGTTGATATTGCTGAAGTGTACCAAAATGGTGTT
7574	50	106	MW2_CDS_05268	MW0976	FALSE	unmapped	AAAGCAATTGCTGTAGGTATTCCTGGTATCCAAGTTGATGGTATGGATGCGTTAGCTGTA
7575	50	104	psma_tiling_042_F		FALSE	unmapped	AGCAAAATTATTCAAATTCTTTAAAGATTTACTTGGTAAATTTTTAGGTAACAACTAATC
7576	50	102	MW2_CDS_05329	MW0986	FALSE	unmapped	ACAACAATGATATTTCTGAAGAACGCAATTCAAGTGAAGTTAAGGACAAAAAAGAGCAAG
7577	50	100	pMW2_094		FALSE	unmapped	TGCTATGAGCGATTTATTCGGAATCTCTTTAGAGCATTTAATTAAAGGAGATGCACGTTT
7578	50	98	MW2_CDS_00030	MW0006	FALSE	unmapped	TATCTACATATCGTGCTCAAAACCGTGGTGGTCGTGGTGTTCAAGGTATGAATACATTGG
7579	50	96	MW2_CDS_12771	MW2417	FALSE	unmapped	TCGGTATAGACCAATCTAGAATTGTTAAAAGCGTAAAAGAATTATCAAAAAAGGGTTACT
7580	50	94	MW2_CDS_11658	MW2209	FALSE	unmapped	TGAAGAAATCCAAGGCAATATTGCCAATTTGTCAAATTCAGAAAAACAAAAGCACGTCGA
7581	50	92	MW2_CDS_02163	MW0399	FALSE	unmapped	AGGTGATAAAGGGACGTGGACAATATCAACAGATTTTGCTAAAAGCAACAAACCAGGTGA
7582	50	90	MW2_CDS_09447	MW1775	FALSE	unmapped	TGGATTTGCTGATCGACATGCATACGAAGACTTTAAGCAATCTGATGCCTTTAATGACCA
7583	50	88	MW2_CDS_04772	MW0880	FALSE	unmapped	ATAATTATGAGTCATAACGTAACAGCTCAAGTTCGACGTTATTTTCCAGAGACAACTGAA
7584	50	86	MW2_CDS_13209	MW2500	FALSE	unmapped	ACAGCTGAAAATTTAGACGTACCGATTTATCTACATCCCGCGCCAGTTAACAGTGACATT
7585	50	84	MW2_CDS_07891	MW1487	FALSE	unmapped	ACTATGGGAGCAACTGGACTTAAAGAGGTTTCTGAAGCAGCGGTTCTTAATGCGAATTAT
7586	50	82	MW2_CDS_05158	MW0954	FALSE	unmapped	GCACTTATCGGTGGAGAGACTGCTGAAATGGGTGAAATGTATCACGAAGGTGAATATGAT
7587	50	80	NC_A_058		FALSE	unmapped	TGTCCGATTTATTTGAGAACCACTATAATTTCTTAATTAGTCCCATTAACACGAACTGCA
7588	50	78	MW2_CDS_06823	MW1274	FALSE	unmapped	TGTATCGCGCGTTGTTTAGCAATTGAACCTGAAGTCATTTTAATGGATGAACCGACATCA
7589	50	76	MW2_CDS_04543	MW0839	FALSE	unmapped	AAAGAAGTCCGTGGACGTGGTTTGTTTATAGGTGTGGAACTTAATGAAAGTGCTAGACCA
7590	50	74	MW2_CDS_02411	MW0446	FALSE	unmapped	ATGCTAAACAGCCTAAAGAAGTTGCTAAGCATGTGTCAATGGAGCGTTTGCTAGTTGAAA
7591	50	72	MW2_CDS_06327	MW1174	FALSE	unmapped	ATGAAAGACACATTAATGAGTATACAAATAATTCCTAAAACACCAAACAATGACAATGTT
7592	50	70	MW2_CDS_00839	MW0155	FALSE	unmapped	ACTGCATATTAGTTAAAAAATACGCTTACTTAGCAATGGGACAAGGTGCTGTTTTTGGTA
7593	50	68	MW2_CDS_13535	MW2560	FALSE	unmapped	GGTGGTAGTCAATCGTCAACAAACAACCAAAATAATCAACAACAGAACACACCACCTGCT
7594	50	66	MW2_CDS_13311	MW2519	FALSE	unmapped	ATCACAGCACTCGGTAGACAGACAGTTGCAATCATGCATAATCCTGAAATACGTACACTG
7595	50	64	MW2_CDS_07653	MW1444	FALSE	unmapped	ATCACATATTTATCAAGAAACTTAAAAGAATATCGTAAATATTACGAACCGTTGATTCAT
7596	50	62	MW2_CDS_03041	MW0559	FALSE	unmapped	TGTTTTCTGGTCAGTTATAGGAAGTTCGGTTTTGTTTGGAGTTACTTTAAGGAAATACAT
7597	50	60	agr_tiling 165_R		FALSE	unmapped	ACTTTCAACTGATATTAATGGTATCAAATTAGGCAGTGAAATTCGTAAGCATGACCCAGT
7598	50	58	MW2_CDS_05324	MW0985	FALSE	unmapped	AGAAAGAGCAAGAACGCCTTGAAGTTTATAAAGATTTAGGACCTGAAGTTTTAAGTGAAT
7599	50	56	MW2_CDS_02547	MW0471	FALSE	unmapped	GGAATGTTGTTTGAAGACAGAAGAATGTTTACACCGTATTAGAAAGGAACGATGGGGTCC
7600	50	54	MW2_CDS_03369	MW0619	FALSE	unmapped	TCTCCACATAAAGTCATCTTTGTTGCTGAAAGTGATGAACAACTCGTTGGCTTTGCCTTT
7601	50	52	MW2_CDS_03919	MW0716	FALSE	unmapped	TGGCGAACAAAAAGAAATCGGCTGGGGAAGCCAAATTAGATCATATGTTTTCCATCCATA
7602	50	50	MW2_CDS_03218	MW0592	FALSE	unmapped	TGTGCATGGAACAATTTCTTTAGCAATCGCATTAACGTTACCGTATTTTTTAGCAGGGCA
7603	50	48	MW2_CDS_00440	MW0083	FALSE	unmapped	TACTGTGAGTGATTTATCGCCTAAAGGAATTGCGTTGCGTCTCGATTTAATTGGTGCAAC
7604	50	46	MW2_CDS_11546	MW2189	FALSE	unmapped	ATTTGGGAAGATGGTTCAAAATGGCAAGGGCATCAAAAAGGGAATTATGAAGAAGCGAAG
7605	50	44	MW2_CDS_05450	MW1009	FALSE	unmapped	AGATGAACACTATCACATTATTAAAGATGGTATGGTTAATCTTCAGGATATTGTCGAGGA
7606	50	42	MW2_CDS_03062	MW0563	FALSE	unmapped	TATGGGCCAGAACGATCAGAAGAATTGGTTGGAGAAGTTGTTAAAGAATATCCGCGAGAG
7607	50	40	MW2_CDS_08640	MW1626	FALSE	unmapped	TGTTGATAAAGAGGTGAGCATGGGGTATGACCACGTTTATACACCAGTACTTGCTAATGT
7608	50	38	MW2_CDS_11257	MW2127	FALSE	unmapped	ACGTGACATCGTTGTACTCGCAAAATCAGTGAATCCAGAACGTATGGCTCAAAACTTAGA
7609	50	36	MW2_CDS_05872	MW1092	FALSE	unmapped	GCGTGAAGGTGAAGTTGATGGCGTAGATTACTTTTTTAAAACTAGGGATGCGTTTGAAGC
7610	50	34	MW2_CDS_08455	MW1591	FALSE	unmapped	ATTGGTAAAGGCGATGAGGCTAGAAGTATCCGTATCGACTTACCTCCATTCACTTTGGTA
7611	50	32	MW2_CDS_05618	MW1042	FALSE	unmapped	GGTTCAACAAAGAAAATCGGAAGAAACTGATAGAGGTTGTTTGAAAAGTGTCATCATGCT
7612	50	30	MW2_CDS_13515	MW2556	FALSE	unmapped	GAGACAAAAAGGCATTAAAGTCATTGAAATATCTGGTAGCGAGTTGGTACGTGGACGTGG
7613	50	28	MW2_CDS_01114	MW0205	FALSE	unmapped	GATGCGTTTCAAAAACGCGATATTTTAGCTGCGCACTATATTGCAAAATCCGCTATACGC
7614	50	26	MW2_CDS_12095	MW2290	FALSE	unmapped	ATTTGGCTAGGAGTTTGGGAACATAATCCTCGTGCTCAAGCATTTTATAAACGTCATGGA
7615	50	24	MW2_CDS_05344	MW0989	FALSE	unmapped	CAAAGAGCCATCAATGTGAAAAAAGGTGAATTCTTTATAGCGCGTGCAATCACACCACAA
7616	50	22	MW2_CDS_13191	MW2497	FALSE	unmapped	TGGGATGTCAGAGATGTAATAAACGACAATATTAAAGGAAATGGACAAACACCAGAACCA
7617	50	20	MW2_CDS_06422	MW1192	FALSE	unmapped	GCTGCGAACCCATATATGGCGTTAGCTGCAATTTTAGAAGCTGGTTTAGACGGTATTAAA
7618	50	18	MW2_CDS_07930	MW1494	FALSE	unmapped	CATTCCAAATATTGCTAAACAAACTGCTCACATACAATCAACAGGTTGTAATGCACAGGT
7619	50	16	MW2_CDS_09794	MW1838	FALSE	unmapped	ACAGAATGAAGTTATTATGGGCTTTTATCGTCAAAGAAGCCATGACATTATTGACATGGA
7620	50	14	MW2_CDS_11469	MW2173	FALSE	unmapped	TATTCAGGCGACGATGGCAACAACATATAAAGACCAAGCACGCCCATTAATGTCTAAAAC
7621	50	12	MW2_CDS_01145	MW0210	FALSE	unmapped	TCATCCAAGGTGGTTCACAACCATTACCAAGTATCCAAGCAGCTTTTAAACAATATGGCA
7622	50	10	MW2_CDS_03166	MW0581	FALSE	unmapped	CGGTAAATTAAAGCCTATCTATTTTACTGGCGGTATACTTGGTATGGCTTTTGTAACAGC
7623	50	8	MW2_CDS_05756	MW1071	FALSE	unmapped	GCAGTTGAAGAAGGTGCGACGTTTGTTAGAATTGGGACTAAACTTGTAGGAGAAGAGGAG
7624	50	6	agr_tiling 160_F		FALSE	unmapped	TAGCTTGCTCAAGCACCTCATAAGGATTATCAGTTGCGAGGGCAATTTCCATAGGCTTTT
7625	50	4	MW2_CDS_06635	MW1240	FALSE	unmapped	TTCTTTAGCAAGTATCGTTGCAGCAATTTGCTGTGTGATTGGCTCGCTTATCATTCAAGA
7626	50	2	MW2_CDS_10711	MW2023	FALSE	unmapped	AAGTAGTTGAATATGAAGAAGGTCAACGTTGTGTGGCTATTAAACAAGTATCAGGAAACG
7627	50	163	MW2_CDS_04123	MW0755	FALSE	unmapped	AAAACGTCAAGAACGACAAAACAAGCGAGAAGAATTACATCGAATAGAGTTTGATAAGCA
7628	50	161	MW2_CDS_03993	MW0728	FALSE	unmapped	AGGTAGAGTCATTCCATCTACAAATACAAGTGTGCAATTAAATGCTGTTATGGAAGATGG
7629	50	159	MW2_CDS_13085	MW2476	FALSE	unmapped	AACAACAACAGACAATGTAAGTATTTCGATTCCTTTTGATACAGATTATGGTTGGAACGT
7630	50	157	MW2_CDS_11622	MW2202	FALSE	unmapped	CATTGCAGTAGTTGCGCCAACATATGCTGGTGGACTTAAAAAATTAGGTGCAAACATTGT
7631	50	155	MW2_CDS_07826	MW1474	FALSE	unmapped	AGCGCAATTGCACTAGAAATGATTCATACATATTCACTTATTCATGATGACCTACCAGCG
7632	50	153	MW2_CDS_09495	MW1784	FALSE	unmapped	TTTATTCCACGATGTGCAACAATGGTTGAAATCAGCTGAAGACACGAATGAAAAATGGCG
7633	50	151	MW2_CDS_07670	MW1447	FALSE	unmapped	ACGACTGTCACTGAATTAGGAACAAAAGTAAAGCCATCAGATACGATTGAAGTTGAAGGT
7634	50	149	MW2_CDS_04753	MW0877	FALSE	unmapped	TGACAGCACAAAACATTCTTGGTACAGACTCTGGTGGTAGGGATAACTTTAGTCGTTTGT
7635	50	147	MW2_CDS_09928	MW1862	FALSE	unmapped	TGCCTCATCAGATGACCTTTTAGTTTGTGCTCATGAGCAAGGAGATTCAGTTGTAACTGT
7636	50	145	MW2_CDS_13738	MW2594	FALSE	unmapped	ACGCGCTATTGAACATTTAGGGTATGAGGTGGTTGTCTCAAATACCTCAAAAATAATCGA
7637	50	143	MW2_CDS_03381	MW0621	FALSE	unmapped	TCGTGATAATCCAATGGATCAAGTGATGAGTATGGAACTTGGCGCAGATGATTATATGCA
7638	50	141	MW2_CDS_01811	MW0330	FALSE	unmapped	GCATCAGGAATCAATGATGGTGCTGCGATGATGTTAGTCATGTCAGAAGACAAAGCTAAA
7639	50	139	MW2_CDS_03378	MW0620	FALSE	unmapped	AGGTGCGACCGCTCGCAGTATTTAAAATAGAAGAAACAGCTGACGGAATAATAACTTTAA
7640	50	137	MW2_CDS_13142	MW2487	FALSE	unmapped	TGCACAAGGTAATTATCATTACACTTGGACAGGAAATTGGAATCCAAGTCAATTAACGCA
7641	50	135	MW2_CDS_05854	MW1088	FALSE	unmapped	ACTTTCCTGAAGTAGAAGTTATTTCTGGTACTGCAACAGCTGGTATTCCACATGCAGCTT
7642	50	133	pMW2_069		FALSE	unmapped	AGTTGGAGAAAGTGGCGCTGGAAAATCTACTTTACTTAACATAATCGCTGGGTTCGAAGA
7643	50	131	MW2_CDS_01340	MW0245	FALSE	unmapped	TGATGTCTTAGCTACAGTGTTAGAAGAAATGGAAATCCAAAAAATATACTTAGCAGAAGA
7644	50	129	MW2_CDS_05772	MW1074	FALSE	unmapped	TGTGATCAAGCGGAACAGCATTATGCACCAGTATTAACGCATTTTTTAGATCCAAGAGGG
7645	50	127	MW2_CDS_13463	MW2547	FALSE	unmapped	AAAGAAAAAGACGAAAAATCCGCAAAAGTAGAAACGCAAACAAAAGCCCTACAACACGCT
7646	50	125	agr_tiling 105_F		FALSE	unmapped	AAAAAGATTGGTAGAACTATAAACACGCTGTGTGAAATTGTTATAATGTATGAAAAAATA
7647	50	123	MW2_CDS_13232	MW2504	FALSE	unmapped	ATCCGGATGCTGATCCTAGTGTTAGATTGTCACCTTATACACGTCAGCGACTAGGTAATG
7648	50	121	pMW2_078		FALSE	unmapped	ACTAGTGTCCATATGGAAAATGAAAAGCTGGTTGAAGAATTTAATGATTTAGCACAACGT
7649	50	119	MW2_CDS_07206	MW1347	FALSE	unmapped	GCTGAGGAACGATTCCAAGAAGATGCTTTACGTATGATTCGATGTTTAAGGTTCCAGTCA
7650	50	117	MW2_CDS_10039	MW1886	FALSE	unmapped	AACATGGCAACAGTATATGAAAACACACCATCGTTTGTTCCACAAATAGGTGATGTGGCT
7651	50	115	MW2_CDS_01514	MW0278	FALSE	unmapped	AAGTTTGGTGTTTTACCAGAAATGGAATACGAAATGGAAGAAGTTAAAGAAATCGAGCAA
7652	50	113	MW2_CDS_01306	MW0239	FALSE	unmapped	AGGTGGAGACATTATTTACTTCTTCTTAGAACCGGCAACAATCTGTTTTGCGATTCCGTT
7653	50	111	MW2_CDS_06316	MW1172	FALSE	unmapped	GAAGATGAAATTGCTGCTGTAACTATGGCTATTGGTGCAAATTATGGTGGAGTCAGAGCG
7654	50	109	MW2_CDS_12752	MW2413	FALSE	unmapped	TAGCATTATTACTTATCGCATTATTCTACGTTTGCTTTTATAAAATTACAAAATACCCGT
7655	50	107	MW2_CDS_01742	MW0317	FALSE	unmapped	CGCGCACTTAAACCGCTTATGACAATCATTATTACCTCAATATGCTTGTCATCACTTGCC
7656	50	105	perR_tiling_037_R		FALSE	unmapped	GTATTGCGCGCGTGTCAATATTTACATGATGATTTCATTTAATAGCCTTTTTTAGCATCA
7657	50	103	MW2_CDS_04775	MW0881	FALSE	unmapped	GTTATTGAGCTACAGTATTCGCCAATTCCTTATAAACAGATTCTTCAACGAACGGAAGGT
7658	50	101	MW2_CDS_07536	MW1414	FALSE	unmapped	GGGTTTGGCGTTTATCTCTTTTATCGCATAGCAATTATTTTTCTTAAGAGTAAAAAGACT
7659	50	99	MW2_CDS_04616	MW0851	FALSE	unmapped	AGTTGGGTATTAGCGATTATTTTATTTATCGCTACATACTTAAACATTTCAAAAAATCAA
7660	50	97	MW2_CDS_01679	MW0306	FALSE	unmapped	AACGGGCGTTCGCTTAATCTTAGCTGAAATCGTCCCAGCATTTAAAGGAATTTCTGAAAA
7661	50	95	MW2_CDS_06365	MW1182	FALSE	unmapped	TTGTCGGAGCAACAATTGTATGGTTAATGTACTTGCCACATTGGAAAGCGACAGAAGAAG
7662	50	93	MW2_CDS_00277	MW0053	FALSE	unmapped	ACAATTGATAAAAATGGCATTGAAATTAGAGATGAAATTGTTTTGACAAAATATTTGTAA
7663	50	91	MW2_CDS_08327	MW1566	FALSE	unmapped	CCTTCTATTGAGATTGTGATGTGGGATGAAAGATTAAGCACAATGGCTGCTGAACGATCA
7664	50	89	MW2_CDS_00817	MW0152	FALSE	unmapped	TATGTTTATCGTTTTAACAATTGGTGCTAGCATGCTTGTTGCTGGTGTATTTGGGGGACA
7665	50	87	agr_tiling 177_R		FALSE	unmapped	AACGATTGAATTAAAACGTGGCAGTAATTCAGTGTATGTTCAATATGATGATATTATGTT
7666	50	85	MW2_CDS_09430	MW1772	FALSE	unmapped	AACATATCCACGACTTAGAGTAACTGGTGCATCTTTTGAAGCGGTTGGACTACCTGATTG
7667	50	83	MW2_CDS_03394	MW0623	FALSE	unmapped	GCATGATCCTGTTGCAGCAAGTTATGCCAATCGAGTAGTGATGCTAAAAGATGGTCAAAT
7668	50	81	MW2_CDS_05310	MW0983	FALSE	unmapped	CAATTTTATATGCCGCTTTAATAACAATTATTACCTTGACTATCAGTTATCCAGCTGCCT
7669	50	79	MW2_CDS_13368	MW2530	FALSE	unmapped	ATCAAATGTCCAATATAGATCATGAGTTTTTAGAAATTGTAAAAAGATCACTTTCTCTGT
7670	50	77	MW2_CDS_06510	MW1215	FALSE	unmapped	TTTTATGGAAAAGGAGCAGGCAGTTTAGCAACAGGTAGTGCCGTTGTCAGTGATTTATTG
7671	50	75	MW2_CDS_02414	MW0446	FALSE	unmapped	GCAGGTGTTGATCGTATGTTTGTAGTTGGTTTTAACAAATCGACAATTGAACGCGCGATG
7672	50	73	(-)3xSLv1		neg		
7673	50	71	MW2_CDS_11861	MW2249	FALSE	unmapped	GAACAAGATGCACAAGAAGTACGCCAAGTGATTGAAGAAAGTGGTCAAAAGGCAGTGTTA
7674	50	69	MW2_CDS_08943	MW1679	FALSE	unmapped	GGCGTAAAAGCTTTTGCCAAAATGAAAGGCAATTTGCCAGATGCCATTTTATGTATCAGC
7675	50	67	MW2_CDS_03249	MW0597	FALSE	unmapped	CCACAGTGGGATGGTAGTGCACTTAAAGAACTCAGTCATGTACCTATCTTCATTTATAGT
7676	50	65	MW2_CDS_12251	MW2319	FALSE	unmapped	CGTAATGGTGTTGTAACGGCAAGAGCAGTTATTTCGCATCGTATGCCTAAAGGTACAATG
7677	50	63	MW2_CDS_03725	MW0682	FALSE	unmapped	TTGAAGACTGGACAGACGGTTAAAGTAGCTTATTTTAAGCAAACAGATGAGACCCTGGAT
7678	50	61	MW2_CDS_04341	MW0799	FALSE	unmapped	AGTCGTGGTATTTCTGAAGAAGAAGCGACAGAAATGATTGTTATGGGATTCATCGAACCA
7679	50	59	MW2_CDS_13841	MW2612	FALSE	unmapped	CAACAGGAAAAACGGCAACATTAAATGAATCTAATAACTGGACCCATACGTGGGCAGGAT
7680	50	57	MW2_CDS_13369	MW2530	FALSE	unmapped	GGCGAATTAGCGATTTGGATTAAAGAAGATGATTCATTCCCAAAACAAGAGAAGCTAACA
7681	50	55	MW2_CDS_05571	MW1032	FALSE	unmapped	AGCCAATGAATACTTTCCCAGTTATCCGTGACTTACAAGTTGATCGTTCTAGAATGTTCG
7682	50	53	(+)E1A_r60_n9		pos		
7683	50	51	MW2_CDS_12915	MW2444	FALSE	unmapped	AAACAATTGCAGAGTATTCTGTTTCTATCGCCCTACAATTAGTGCGTCGCTTCCCAGATA
7684	50	49	MW2_CDS_12655	MW2393	FALSE	unmapped	AGAAAAGTTTGAAGCGCATTACGAGCGTGTATTACAAGACGATCAATATATCGAAGCATT
7685	50	47	MW2_CDS_09678	MW1817	FALSE	unmapped	ATCAGAACAAGGAATGTTTGTATCTGCGGAAACAATGCTCAATCAAAGTACGCTACCACA
7686	50	45	MW2_CDS_07633	MW1441	FALSE	unmapped	ACTTGATACTAGATTTAATGCTAATTACGAAGCCTTCAAAACATTGTCTGAATACAATGA
7687	50	43	NA		ignore		
7688	50	41	MW2_CDS_02357	MW0436	FALSE	unmapped	CGGCGCGCACTTTGGATTGCAAGGATTTCCAGATTCTACATTAAATTATCAAGCTGACTA
7689	50	39	MW2_CDS_10547	MW1991	FALSE	unmapped	AGTTCAGCTGGTCATGAGCCTGGATATATTTATCGCGCTGAAAAAGAAGAATTCGAAGAA
7690	50	37	MW2_CDS_09482	MW1782	FALSE	unmapped	ATACGGCGGTAAAGATAAATTTGAAAAGGCCCTTCAACAGCAAGGTTTAACAGCCGATAA
7691	50	35	perR_tiling_043_R		FALSE	unmapped	TCTAATAAGTCATACTTTGCCTCATAATCATTACCAGTTATATGCGCTGTTATAGTTACA
7692	50	33	MW2_CDS_08398	MW1581	FALSE	unmapped	AGGGGATATGGCGTCTCGAAAAGAATATAACGAAGCGTTAGTGAAACACTTTGAACCAGT
7693	50	31	MW2_CDS_08992	MW1687	FALSE	unmapped	ATGGATATTTGTATTGAAAATGGTATTATGGGTATTCCAAGTTTTCTAGTATATAAAAAT
7694	50	29	MW2_CDS_05460	MW1012	FALSE	unmapped	ACTGGTTTAACTTCAGTTGATAACTTTATTAGCACAGTTGCCTTCGCAACACTTGCCCTT
7695	50	27	MW2_CDS_08470	MW1593	FALSE	unmapped	AGAGAAACGATATTTCCAGTAGACGATAAAATGCTTGACCATCGAGAATTTACATTAATT
7696	50	25	agr_tiling 065_R		FALSE	unmapped	GCACATGCACCTTCATCTTTTTGGTGTTATATAGAAAGCATTACACTTTTTATTGTGCTA
7697	50	23	MW2_CDS_07665	MW1446	FALSE	unmapped	TGATGCACATCGCGTACTTGCTGATAATCAAGAAGTTAATTTGACTCCTAAAGAGTACGA
7698	50	21	MW2_CDS_09491	MW1783	FALSE	unmapped	ACAGAACAATTTGTAGATGGTGCACCTTTATCACCGGCAGAAATACAAGAAGAGATTTCT
7699	50	19	MW2_CDS_04234	MW0778	FALSE	unmapped	AACTAAGGGGATAAACTTCGATTTATATGCATCATCAACGCAAGAACGCGCAAGTGACAC
7700	50	17	agr_tiling 077_F		FALSE	unmapped	AGCTTGTATAATAATACCCAGTTGAATAAATTGGGTATATGGTTCTTTTACAAAAAGTGT
7701	50	15	MW2_CDS_11142	MW2105	FALSE	unmapped	TAATTGATAAACCATATCATGTTAAGTTGCCCGTCGATGCACAAGCAACAAGTGCCGTTA
7702	50	13	MW2_CDS_00617	MW0114	FALSE	unmapped	CGGGACACCACTCATATTTGCCATTCAAACACGTTCTTGGGACCGTGTAGGTATTATATT
7703	50	11	agr_tiling 081_F		FALSE	unmapped	ACTAAAAGCTCAATAACTTTGTTGAGTAATTTTTTCATAATTTAGTCCTCCTTTGAATAG
7704	50	9	MW2_CDS_07062	MW1319	FALSE	unmapped	CAGAAAATCGTTAGGTGGCGTGCTGCTATGTTTATCTTTGATGAAGGTAATGCAGAGCAG
7705	50	7	MW2_CDS_02687	MW0496	FALSE	unmapped	TGATAATGCGATCGTAAAGGAAAGTGATGCTTTGTCTGCTGTGGAAGACAAAAGTTTTGA
7706	50	5	(-)3xSLv1		neg		
7707	50	3	MW2_CDS_13891	MW2621	FALSE	unmapped	GATCAAACCCTTACATCTATGGCACCAAATGAATTTAACGTGGTCGCTACTCAAGATGCT
7708	50	1	psma_tiling_001_R		FALSE	unmapped	TGAAGATCCATATCAATGGCAAATTAGACCAGCACGATAAGTTGAATGAAGTATAATCAT
7709	49	164	MW2_CDS_04594	MW0848	FALSE	unmapped	TTTGAGTAAACGAGGCAGCCAAGTGGCAGATGAAGCAACGATTTATAAATTCATCCAACA
7710	49	162	MW2_CDS_05624	MW1044	FALSE	unmapped	ACGAACGAGTTCGTGATGATTACCAATTGCATTGGACTTCAACAAATTGGAAAGGTACCA
7711	49	160	MW2_CDS_13716	MW2591	FALSE	unmapped	ACCAAATGGACCAACATGTCATACAGGCAGTCAAAGTTGTTTCAACACAGAAGTTCCATT
7712	49	158	MW2_CDS_08144	MW1533	FALSE	unmapped	TCACCAAGCTGTAGTTCAAGATGATAACCCTGATTTTGAATCTGGCGAAATCACTCAAGA
7713	49	156	MW2_CDS_12163	MW2301	FALSE	unmapped	TGAGCACTTACCAAAACCTGTCGTTTTCATTGACGATATTCACGATATTGAGATTAGCCA
7714	49	154	MW2_CDS_00065	MW0012	FALSE	unmapped	AAAAAGTTATGATGAACGTTTCACGCCGGATGAAGTAGTCGCATACCAACAACATCAAGG
7715	49	152	MW2_CDS_11984	MW2271	FALSE	unmapped	TCATGGGTGATGGTTCAGGTGGTGCACTGGCATTATCCTTTGTACAATCTCTTTTAGATA
7716	49	150	MW2_CDS_03822	MW0698	FALSE	unmapped	AAAGGGGAAGGCGGTAAGTCATTACCGAATTTCTTAGAATCATTTAAAGATGATAAATAT
7717	49	148	MW2_CDS_01776	MW0323	FALSE	unmapped	ACACTTTTATTTTAGGCATCACAGGTCCAACAAGTCTTGTCGTCATTAGCATTATCGCTT
7718	49	146	MW2_CDS_00018	MW0004	FALSE	unmapped	AGAGTCGTTAGCTAAACCGATTCATGCTGGTATCACAAATGATAAAGAAGCGTTGTCGCT
7719	49	144	MW2_CDS_09560	MW1796	FALSE	unmapped	CAAATACTGCTGCGTTGTTAATTTATGAAGCGTTACGTCAACAAGATTTTCCGGGATTGA
7720	49	142	MW2_CDS_06454	MW1204	FALSE	unmapped	GCTGAGACTTTAGAGTTATTAGAAAAAAACATTAATGCTTTTTTAAGTTCTGAAGAAGCT
7721	49	140	MW2_CDS_10393	MW1963	FALSE	unmapped	CGAAAGAGCGAATTGTCTATTTTAAAAATAAAGAACACTGCTATGCATCGGTGAGAAACG
7722	49	138	MW2_CDS_06210	MW1153	FALSE	unmapped	CCTCGAGTTGGTTTTATTACAATTACAGATGTTGTTTTAACAAATGATTTATCGCAGGCT
7723	49	136	MW2_CDS_11555	MW2190	FALSE	unmapped	AGATAATCAAAATCTTACTCAAATTATTGAAAAATCTGTTACAATTGACACCAATATCGT
7724	49	134	MW2_CDS_04987	MW0923	FALSE	unmapped	TTGGACAAGGTCTTTTTCACTTATTATTTTTCTGGACAGGTATCCCTACCATCATCTCAA
7725	49	132	MW2_CDS_08788	MW1651	FALSE	unmapped	TGAAAGCGAGCACTTAACAGTAGCACGCCAAAAACAATTAATCTCTGGTTTCAATGTCAA
7726	49	130	MW2_CDS_08865	MW1665	FALSE	unmapped	AGTCAATATTGCGAAACATCTACGACAGTGCTACACCCTATTCACGAGTTAGGAAATGCC
7727	49	128	MW2_CDS_06439	MW1201	FALSE	unmapped	CGATAATGTGTATATTGAAACCAGAAAAGGAAAAGTGCATTATTCGAAGACAGGTGCTCA
7728	49	126	MW2_CDS_08196	MW1542	FALSE	unmapped	AGTGTTGATATGTTGACTGTTGCAGCTCAAAAATCAGCAAATGTAAATTGGCTTGAAGGA
7729	49	124	MW2_CDS_02281	MW0422	FALSE	unmapped	TACTGACAATCCACATGCCATGGCACTTTATCGCCAACAAGGATATCAATATATGGGAGA
7730	49	122	MW2_CDS_06291	MW1167	FALSE	unmapped	AACAAGCACAATCATTGATTCAACCTGTTAAACAAGAAATTCTTGATCGTATTGGAGAAT
7731	49	120	MW2_CDS_05208	MW0963	FALSE	unmapped	AGACGCTTGAAGAGAGTGGCGTTGATTATGAATTAACTGAAGTTATGGGATTACCAAAAG
7732	49	118	DCP_20_3		pos		
7733	49	116	MW2_CDS_07882	MW1485	FALSE	unmapped	TTTGTCTCTAGAGGTGAAATTGATCCAGTTATACGTTTTTACACATGGAATCCTGCAACA
7734	49	114	MW2_CDS_03601	MW0660	FALSE	unmapped	TGCTAGGTGGTCAAGTTAAAGAAAATACACTTGCTACGATTGGTTCTAGTGCTATGGAGA
7735	49	112	MW2_CDS_04682	MW0864	FALSE	unmapped	TGCAAATGGTTAACTTTGTACTTAATAGCCTAGTAGGTGGAGACAGCTTAAATGTAGTGA
7736	49	110	MW2_CDS_06899	MW1287	FALSE	unmapped	ATCGGTTATGGCGATGGAATTTTAAGAACACGTGCTAAACATGAAGCACTTATCAATGGT
7737	49	108	MW2_CDS_13065	MW2473	FALSE	unmapped	AAGCGGTCCTGTTATTGTAGCAGCTGCATTAATCATGTTTAGTGTCTTCTTTGCGTTTGT
7738	49	106	MW2_CDS_00444	MW0084	FALSE	unmapped	TGGCAAAGAAGACGGCAACAAACCTGGTAAAGAAGACAACAAAAAACCTGGTAAAGAAGA
7739	49	104	MW2_CDS_04360	MW0803	FALSE	unmapped	AGCTAATAGGTACAGCAACAAGTGTTGATGAAGCTATTGCGAATGAAAAAGCGGGTATGG
7740	49	102	MW2_CDS_07889	MW1487	FALSE	unmapped	TAAAGTGCTAGAAGCACCACATACAACTGTGATTGATCGATTAGACGAAGCTACAGCTGC
7741	49	100	MW2_CDS_13009	MW2461	FALSE	unmapped	TTATTAAGATTTGGAAGATTTGAATCTTCTATCGCCAAAGGTTTAACGTATGGGAATGCG
7742	49	98	MW2_CDS_06780	MW1266	FALSE	unmapped	GAAACGCAGCATGAGGCTGAAGTAAAGGGCAGTGGCAACAAAGTATATCGTTGTTATATT
7743	49	96	MW2_CDS_00291	MW0056	FALSE	unmapped	ACGAATGCCTCTTTCCAAAATGAATATGTTTGGTTTAGGAAATATGATGATGCGCTACGT
7744	49	94	MW2_CDS_10870	MW2052	FALSE	unmapped	TGGTTGATGAAAAATCATTTATTGATATGGCTTATACATTATTGAATGATAAAGGCGAAA
7745	49	92	MW2_CDS_09340	MW1754	FALSE	unmapped	ACAAAGTGGGCGATAGAATTACTGCACATCCAAATAGTGATAAAGGTAATGGTGGTATTT
7746	49	90	MW2_CDS_10135	MW1908	FALSE	unmapped	TCAATGGCTTTAGATTGGCCACTCATTGAAGTGGGACAAAGTTTTAAGGCGTTATCACAA
7747	49	88	MW2_CDS_07304	MW1365	FALSE	unmapped	CGCGTTTAACTCAATTTGGTGCATTTATAGACATTGGCGGTGTTGATGGTTTAGTGCATG
7748	49	86	NC_A_067		FALSE	unmapped	AAAAGCAAATTGACCAAAATGGAAGTTTGAATCAAAAAACATTAAATGTACCCATGACTT
7749	49	84	DCP_1_11		pos		
7750	49	82	DCP_1_4		pos		
7751	49	80	MW2_CDS_10555	MW1992	FALSE	unmapped	AGACGAGGAGATGTTTATTTAGCAGATTTATCACCAGTACAGGGATCTGAACAAGGGGGA
7752	49	78	MW2_CDS_11064	MW2092	FALSE	unmapped	AGTTATATCAATGGCCTTTTTTGTGGAAGAAAATGCGCCAGTTATATGGAGAGGGCCAAT
7753	49	76	NC_A_026		FALSE	unmapped	AGCACTGAGTCCAAGGAAACTAACTCTACTAGCAAATGTTACTCACTTGCTAATTTTACA
7754	49	74	MW2_CDS_03553	MW0651	FALSE	unmapped	CAAACGAAGATAAACGTTTCGAACAATTAAGATTTGAACGCAAATTTATAGTTATTCCGT
7755	49	72	MW2_CDS_13703	MW2589	FALSE	unmapped	ACTTTACGAACAACACAGCGTTTCACGATACCGTGCTACACTATTATCCATTAAGTGAAA
7756	49	70	MW2_CDS_04017	MW0732	FALSE	unmapped	TATTTGCAATTTTTGCATATGTAGATCATTCGAATAAAGCTAAAGAACGTATGTTGAACG
7757	49	68	perR_tiling_054_R		FALSE	unmapped	TTAATTCAAAATGTTTTTTCTTTAGTAAATGAATCGTTTCTTGCGTTTCTGGTAAAGCAT
7758	49	66	MW2_CDS_12786	MW2420	FALSE	unmapped	CCACCTGCCAAAGAAGAACCTAAAAAGCCTTCTAAACCAGTGGAACAAGGTAAGGTAGTA
7759	49	64	pMW2_071		FALSE	unmapped	CGTAACGCATGATTTAGAGCTTGCGAAACGATTTGATGTCATAGTCAATATTTCTGAGCT
7760	49	62	MW2_CDS_01584	MW0290	FALSE	unmapped	ACAAGGAGAAAAAGTTGCATCCTTTGCAATGAGGTTGCTACTTGGTTCAACTCTAGCTTC
7761	49	60	MW2_CDS_12916	MW2444	FALSE	unmapped	AACGCCGTGTACAAGCACATGATTTTACTTGGCAAGCAGAAATCATGTCTAAACCAGTTA
7762	49	58	MW2_CDS_07167	MW1340	FALSE	unmapped	GTGGATTAACGGCTTTACACCTCAATACACTATGTCAGTGTGGATGGGCTTCAGTAAAGT
7763	49	56	MW2_CDS_00089	MW0016	FALSE	unmapped	TCTGTAGGTAAGACTGCGTTCGCACTTAATATTGCACAAAAAGTTGCAACGCATGAAGAT
7764	49	54	MW2_CDS_01393	MW0255	FALSE	unmapped	ACCTACGATTTTTTTACAACATATAGCAAATGGCGTTTTCAATATTCAACCGTTCGCAGT
7765	49	52	agr_tiling 024_R		FALSE	unmapped	TGATAAATCGATGTTGTTTACGATAGCTTACATGCTAGAAATAATTATCTGTAATGATAA
7766	49	50	MW2_CDS_11559	MW2191	FALSE	unmapped	GCAACATATGGCTATGCAGAGGTTAAAGTTATTAAGCAACCGAGTGTCGCTGTTATTGCA
7767	49	48	MW2_CDS_13200	MW2499	FALSE	unmapped	GACTAAAATTGTGTTAATCACAGGAGGCAATAAAGGGTTAGGCTATGCAAGTGCAGAGGC
7768	49	46	MW2_CDS_10749	MW2030	FALSE	unmapped	TGAATTGAGTCAAGAAGAGTTAGATAAGATTGTCAAACTAGTAACTCAACAAACGAAGTT
7769	49	44	MW2_CDS_02620	MW0483	FALSE	unmapped	ATTGGTGACTGGGTTATCGTAAAAAAAGATGGCATTCCAACGTACAATTTTGCAGTAGCT
7770	49	42	perR_tiling_055_R		FALSE	unmapped	TTTAGTAAATGAATCGTTTCTTGCGTTTCTGGTAAAGCATTTATAATAATGTCAGCATTT
7771	49	40	MW2_CDS_05113	MW0946	FALSE	unmapped	GGGAAATTATATATCGATGAACAAACTTTTGTACCTTGCACACCGCTCGGCATCATGGAA
7772	49	38	MW2_CDS_09988	MW1873	FALSE	unmapped	TGCTTGACTCAACAAAGTTCTTTTACCTATTGCAATCTTTTATAAGTCCAACAATATTGA
7773	49	36	agr_tiling 014_F		FALSE	unmapped	AGGGAAGAGTTAATCCTCATTATGAGATCCACCGTTAAAATATATGAATAAGTCTAATGT
7774	49	34	MW2_CDS_09507	MW1786	FALSE	unmapped	AGGTGAAGAAATTGCTGAAGAAGATTTACAAAAAGCGCAAGAACAAGCGCAAGCAATTGA
7775	49	32	MW2_CDS_12451	MW2357	FALSE	unmapped	AAAACAAGTTGAAAATCAAGACGGCCAAATTAACCAGCAAGTCGATAATGCTAAAGAAAA
7776	49	30	MW2_CDS_10066	MW1893	FALSE	unmapped	GGTTTAAACCGATTCGCATTCACATTATCAAACGCTGATAGTGCATACGAAACTGACGGT
7777	49	28	MW2_CDS_06219	MW1155	FALSE	unmapped	TCGAGGGGTAGCTAACATAGGTGTAAAGCCAACATTTCATGATCCTAACAAAGCAGAAGT
7778	49	26	MW2_CDS_03007	MW0553	FALSE	unmapped	TAAATATAAAAACGACTATCTGATGATTGATTTAGTAAGCACATGGTTAGTTTTGTTCTT
7779	49	24	MW2_CDS_12829	MW2427	FALSE	unmapped	ACGTACAATTGATAAAACGTAAAGATTATATTCAGCACCCTAAAGAAAATGGTTACCGCA
7780	49	22	MW2_CDS_03862	MW0706	FALSE	unmapped	CCAGGCATTATACCATTAGTACCTGGTGGTGCAGCTTATCAAGCGACTCGTTTTTTAGTA
7781	49	20	perR_tiling_013_F		FALSE	unmapped	ATTAGCTCAGCATATGACTGACTTTGACGTAACACATCATCGAATGGAAATTTATGGAGT
7782	49	18	MW2_CDS_07307	MW1365	FALSE	unmapped	AAGCAACATTACCAAACGAAGATGTTGTTGAAAGTGATCCTTCTACGACTAAGGCGTACT
7783	49	16	MW2_CDS_05694	MW1060	FALSE	unmapped	AGGTATGATTGAACAACAGCGTCGTCTAAACAAAGACTTATTAGATGAAGTGGCGGGGAA
7784	49	14	MW2_CDS_01490	MW0274	FALSE	unmapped	AGGACTAGAACCATGGACATCATGCGAATTTGATTTTACAAGAGAAGGTACATTGAATGT
7785	49	12	MW2_CDS_06362	MW1182	FALSE	unmapped	GTAAAGGTGGTTCAAATTGGTCATATGCAATCGTTCCTATCTTAGGACCAATTGCCGGTG
7786	49	10	MW2_CDS_10100	MW1900	FALSE	unmapped	AGAAAAGCAAGGGAAAAACAAAGTTTTAAAAACAATGCTTGATACTGCTAAGAGGTTGCA
7787	49	8	MW2_CDS_10325	MW1949	FALSE	unmapped	TACATGTGCTAACGAATGCGACAGTCGGTGATGAAACAGAAACGAAAGAAGTTGTAGTCA
7788	49	6	MW2_CDS_07847	MW1479	FALSE	unmapped	CTTTATGCCATCACCAGGTAAAATTGAGCAATATCTTGCACCAGGTGGATATGGTGTTCG
7789	49	4	MW2_CDS_01581	MW0289	FALSE	unmapped	ATCTAGAAGGGATTTAGCAGAAGTTGTTGCGATGAAGTGTGTTGGTGCTACTACTGTAGC
7790	49	2	NA		ignore		
7791	49	163	MW2_CDS_05440	MW1008	FALSE	unmapped	ATTAGCGATGAACGACCGTGGCAGACAATATTTAAAGCATTTAAAAACAGCGTTCCCAGA
7792	49	161	MW2_CDS_01534	MW0281	FALSE	unmapped	GGAAAAATCGATCAAAATAATGACAATAATAGGAATTGTTATTCAGGGTTTAGCAACGGT
7793	49	159	MW2_CDS_10975	MW2073	FALSE	unmapped	AGAGCTTATATACTTAAACATGATGAATTTACTCCTTATATTATGAAATGTTATCAATAG
7794	49	157	MW2_CDS_04840	MW0892	FALSE	unmapped	AGTGATTTATCAAGTGGCGTTACAGGTGAAAATATTCATGTAGATAGCGGATTCCACGCA
7795	49	155	MW2_CDS_08099	MW1524	FALSE	unmapped	TGTCGGTATTCTAATTTTTGTCATATCAGTGATCATTTCTATCATTACTACTATGCGCGA
7796	49	153	MW2_CDS_00276	MW0053	FALSE	unmapped	TCTTGTTGAGTGATAAAAATTTCGATAATAAAATGGTAGTCTCAACAGGTAGTTACATTT
7797	49	151	MW2_CDS_08126	MW1530	FALSE	unmapped	CGGATTGGGAAAATGAATGGAAAAACTATTTCCATCCATTCCGAGCGTCGAAGAAGTTCA
7798	49	149	MW2_CDS_08301	MW1561	FALSE	unmapped	GAACCGACTAAGAAATATGCTGATATAATTATTCCTGAAGGTGGGAGCAATAAAGTTGCA
7799	49	147	NA		ignore		
7800	49	145	MW2_CDS_09335	MW1753	FALSE	unmapped	TGCGAAAGATGCTAAAGTTGATGACAAAATTAAAGTTATTGGTTACCCATTACCTGCTCA
7801	49	143	MW2_CDS_09244	MW1735	FALSE	unmapped	CATGCACGTCCTGACACTGTAGGGATGCCAAGTGCCAATGTAGACGTTAAAATTAAAAAT
7802	49	141	MW2_CDS_03362	MW0617	FALSE	unmapped	TACTGGCGAAGAAGATTGGGAAAAGAGTTTTAAAAACATTTCACAAATGTCGACAGTAAA
7803	49	139	MW2_CDS_13820	MW2609	FALSE	unmapped	GGATGGCTTTTAAAAGAAGGTTTCGAAGATGTAGCACAACTTCATGGCGGTATTGCTACA
7804	49	137	MW2_CDS_05144	MW0952	FALSE	unmapped	TCAAGACCGCTATTCGTGAAGGACTATTATCACATGTTCAAACAGTTGGTAAAGGTGGCT
7805	49	135	MW2_CDS_12863	MW2434	FALSE	unmapped	TGCTTCAAACAGTTGAAAAAGGCTTTAGTAAGTCGACGAAATTAGAACTTCATGAATTGT
7806	49	133	MW2_CDS_00708	MW0132	FALSE	unmapped	ACAATTGACTGGTCATCTAATTTCGAGTGCTGGATATGGAATTATTTATTTTGGACCCTT
7807	49	131	MW2_CDS_13752	MW2597	FALSE	unmapped	AAGTGTTTCAAGTTGGTGGTGCTCAAAGTATTGCTGCATTGACTTATGGAACAGAAACGA
7808	49	129	MW2_CDS_01970	MW0363	FALSE	unmapped	TCAGCTTATGAAGAGATTGATATTACACATTTTGCTGAAGCATCTAAAGGTCCCAAAGCT
7809	49	127	MW2_CDS_00190	MW0035	FALSE	unmapped	CGACCAGTTGTTATCGACCGTGTCGAACAAGTGATGGAAATGTTAAAACCTCATAAAAAG
7810	49	125	MW2_CDS_07356	MW1374	FALSE	unmapped	AGGCGATGATATGAGTACTTTAGTTGGTACAGTGTTGAGTGGCTTTGAATATCGAGCACA
7811	49	123	MW2_CDS_06414	MW1191	FALSE	unmapped	AAGGGATTAAACAAATCATTTATGACTCACAAGAGCATTTAACAACAGATGAACAAGAGA
7812	49	121	MW2_CDS_01221	MW0224	FALSE	unmapped	AAGGCGCAACTGTTGTGGTAACTGGATTGGACAATGACAAAGTCAGATTAGATAAAGCAG
7813	49	119	MW2_CDS_00986	MW0183	FALSE	unmapped	TGCGTGCCAGTGTTTTAGAAATTAAACGCATGGAATATGTAGATGCAGCACGTATCACTG
7814	49	117	MW2_CDS_11225	MW2120	FALSE	unmapped	TGCAGATCAAGCTGATCCACATTTCTTTGATGAATTCTTAGAAAAATGGGACAGAGGCGA
7815	49	115	MW2_CDS_11074	MW2093	FALSE	unmapped	GGATTCGGGTTAATGCTATACGCATTTAGTAGTGCAGGAGATTTAGGATTTACAAGTCCA
7816	49	113	MW2_CDS_00013	MW0003	FALSE	unmapped	GGAGTGCGTGAAACACGTCGCGGTAAAAAGTTAGAACATCAAGATCGTATAGATATCCCA
7817	49	111	agr_tiling 017_R		FALSE	unmapped	TCTTTATTACAATAAAAAGGCCGCGAGCTTGGGAGGGGCTCACGACCATACTTATTATTA
7818	49	109	MW2_CDS_00812	MW0151	FALSE	unmapped	GGTCATCGTCAATCAGTAGAAGGTGAATGGAACTTGTCTCAAGTAGGTAATCATGCGCAT
7819	49	107	MW2_CDS_03646	MW0667	FALSE	unmapped	GCAGTGATATAGATGTAGGAACTACGATGACTGTAACATTACACAAATTAGACATTACGT
7820	49	105	MW2_CDS_01343	MW0246	FALSE	unmapped	TAGTCGTTATTCTAATTGGAGCGCGTATGACAGTTTGGAGTGAACGCAAAGAAGCAAGTA
7821	49	103	MW2_CDS_06915	MW1291	FALSE	unmapped	ATGCATTTTATAATAATTGTGACATGAACTATTGCGAAGATTGTGAAGAGGATTTACAAA
7822	49	101	MW2_CDS_01133	MW0208	FALSE	unmapped	AGAAATGGCTGATCGCATATTACGCACATCGCATAAGTTTGATGACAAACAAGCTTCCAT
7823	49	99	MW2_CDS_06178	MW1147	FALSE	unmapped	TTACGCCGATACAATATCCTGCCGATGATCAAAATTCAGCATGGATGACGACACATTTTG
7824	49	97	MW2_CDS_09153	MW1716	FALSE	unmapped	AACATTTTTTTGCACGAAACGACGATTTAGATGTTATAAGAGATCGCGCTGATTTCGTGA
7825	49	95	MW2_CDS_12739	MW2410	FALSE	unmapped	TTAACAACATACAAATGTACTTTAAACAAAGAGTTACCAACTTTAACTGAACATAAGAGT
7826	49	93	MW2_CDS_11601	MW2198	FALSE	unmapped	AGTGCAAGTCATATTTACCAAGAAACAGGTGGCTTACATAATGCTGCTATAAGCGATGGT
7827	49	91	MW2_CDS_12093	MW2289	FALSE	unmapped	TGAAGAACATAATGGCAACTATAAGTATGTGTTTAGTTTTAAAGACCCAAATGCAAATGG
7828	49	89	MW2_CDS_12327	MW2334	FALSE	unmapped	TTAACACATGTCAAAGATCAACGTCCACATGCATTATCAGGTGGTCAACAACAACGTGTT
7829	49	87	MW2_CDS_09483	MW1782	FALSE	unmapped	TCGAAGATAAAATCTTAAACCCTGAAAAACTTAAACAAGGTGGCGCACAAGGCGGACAAT
7830	49	85	MW2_CDS_08413	MW1583	FALSE	unmapped	TGAATGTTAGCATAAATAATGATGGTCCAGTCACTATTATTTATGAAAGTCAGGACGGCA
7831	49	83	MW2_CDS_13419	MW2539	FALSE	unmapped	CCTCGTTGCAAGTCGTCGGGCACAAACATTAAGTCAATACGTTGAACACATAATGGTTAT
7832	49	81	MW2_CDS_06236	MW1158	FALSE	unmapped	CGTATAGCTGCGGGACCTGAAATTCAATCTCGTGGGTTTGTATATGTACGTGAAAGTGAA
7833	49	79	MW2_CDS_04529	MW0837	FALSE	unmapped	TGGGTTTCAAACACTTAAAGAACGCTTACCAATCTGGATAAAACAGTCAAAGCGAGCAAT
7834	49	77	MW2_CDS_00496	MW0093	FALSE	unmapped	GATGGCATACCCGACGTATGCTTTGTCAGAGATCTTGAAGGCATTTGTCTATCTAGAACG
7835	49	75	agr_tiling 115_F		FALSE	unmapped	AAAGCGAATACTGTTTGATTGTTGATGCATCACTCGCATCAATTTGCGAATATGCAAATA
7836	49	73	MW2_CDS_12466	MW2360	FALSE	unmapped	TTACCAGTTAAACCTATCAGTCAGCTATTTCCTATCCCTATGGTCATGGGGTGTGAAGGT
7837	49	71	MW2_CDS_02653	MW0489	FALSE	unmapped	AAGAGTTGATTCGTCAGTTTAAGTATTTGAGTGTATTTGAAAAAGATGTCATGTATTTAA
7838	49	69	MW2_CDS_11478	MW2175	FALSE	unmapped	ACGACGCTAGGCGCACTCATTGTTGGATTAGGTTTACTTATTACTGGTTTCGCAAAATTC
7839	49	67	MW2_CDS_08392	MW1580	FALSE	unmapped	GCATTTAAATATGGTGCACCACCACATGGCGGTATTGCATTAGGATTAGACCGATTAGTC
7840	49	65	MW2_CDS_08057	MW1517	FALSE	unmapped	ATTGTATCGAGCCATCACTTGGTGCAGATCGTGTAACATTAGCTTTCTTATGTGATGCAT
7841	49	63	MW2_CDS_12692	MW2401	FALSE	unmapped	AAAAGTGAAAGATTAAGTGAGTTACTAAAACCAGCAAATCAATTAAAATCACCAGATGAT
7842	49	61	MW2_CDS_11661	MW2210	FALSE	unmapped	TGACAGCGCCTGGTTTAGAACTAAATCAAATGGCGCATGAGAACGTCAATGTTAGAATTT
7843	49	59	MW2_CDS_00936	MW0172	FALSE	unmapped	GCGCGAGCCATTATAAATAATCCAAAGTTTATTATTGCAGATGAGCCAACGGGTGCTTTG
7844	49	57	MW2_CDS_04726	MW0872	FALSE	unmapped	CGTTGATTCAGTGAAAAACAATGGCTCAATTCCTTCCGATACACTAACAGCCAAAGGAAT
7845	49	55	MW2_CDS_10263	MW1938	FALSE	unmapped	TGGCCAGTGTAACACTAAATACATATATGGTGGAATCACAGCTACTAACGAATATCTAGA
7846	49	53	MW2_CDS_08284	MW1558	FALSE	unmapped	ACACATTCTTCAAGGACCTCAATTCGAGGCATTTTCTGAAGAGGCTAGAGCGAAAATTGT
7847	49	51	MW2_CDS_06251	MW1161	FALSE	unmapped	TGTTGTCGGCAATGTAGAACCTGAAAGTGTTGAGAAACAAATACGTGAAAAATTTGCACT
7848	49	49	MW2_CDS_11593	MW2197	FALSE	unmapped	ACAATGGTAAGAAACAAGAGATTCAAGTTGCAGCGGCAGCAAGTTTAACAGATGTAACCA
7849	49	47	MW2_CDS_01163	MW0213	FALSE	unmapped	AGGTAAACCCAAACTTGATCATATTACTGTGACGTACCAAGAAGACGGCAATAATCGCGT
7850	49	45	MW2_CDS_10165	MW1914	FALSE	unmapped	AGAGCTTATAATCATATTGATAGTTTTATCACTTCAGAGTACCGACGAAAAATAAACGAT
7851	49	43	MW2_CDS_12114	MW2293	FALSE	unmapped	TTGGTTAATTGGTATGGGTAGAGTAATTGGCGATGGCGGAACTGCTTTTCAAATTGTTGA
7852	49	41	agr_tiling 134_R		FALSE	unmapped	GAGATTAAAGGTCTTCTAACAGCTAAAATTTTACGTGCACAAGAAATGAATATACCGATT
7853	49	39	MW2_CDS_07968	MW1501	FALSE	unmapped	AGTCGAAGCAATTATTGGTTCATGGCGGATGTTAACTGTATACTTTATTGCAGGGTTGTT
7854	49	37	MW2_CDS_08746	MW1644	FALSE	unmapped	GCAATTTCTGATGAAGGATCATTTACAGAATTCGATAAGGGAATGACCTCTGCGAATCCA
7855	49	35	MW2_CDS_03572	MW0655	FALSE	unmapped	TGGTCGTTTCTTACGCTTACATTCCGTTTATTTCTTTAATGAGCCCTTACATGTTCTAAA
7856	49	33	MW2_CDS_04260	MW0783	FALSE	unmapped	ACATAGATGACGCATTGCTATATCAAGCAATTGAGAAAGCTGCTGATGCTCCAAATCACG
7857	49	31	MW2_CDS_11358	MW2149	FALSE	unmapped	CCAGCCAGTCTAATTCAATTTGGACAAACTGCGTTCGTTGGGCAAGAAGATACATCATTA
7858	49	29	MW2_CDS_13863	MW2617	FALSE	unmapped	GTTACTCGCTCTTTCTTCAGGCGCATCACAACAAGCCATTTCGTTTATCGGAATCTTATC
7859	49	27	MW2_CDS_05502	MW1020	FALSE	unmapped	GCAATTGAACCGGCAAGATTAGATCAGCAAATTATCGCATACGCGCAAGAAGTTTTTGAA
7860	49	25	MW2_CDS_07289	MW1362	FALSE	unmapped	CCTCAAACTGGTAAAGAAATTGATATCCCAGCAAGTAAAGTTCCAGCATTCAAAGCTGGT
7861	49	23	MW2_CDS_10056	MW1890	FALSE	unmapped	TGAACTAAGAGAATCTCATAAAGAACTTAAAGATAAGCAAGATAAAGTTGTAGATGAGAA
7862	49	21	MW2_CDS_09073	MW1702	FALSE	unmapped	TAACTTTTGGAGAAATGTTTGTATGGCCAGCAGTTCCAACTATAGCCAATCAGTTAGCGC
7863	49	19	MW2_CDS_03685	MW0675	FALSE	unmapped	AATTGCTGACGGAGCGACTTTTCCAAATTGCTTAAAGATTACAGCCAAAAACGATGAAGC
7864	49	17	MW2_CDS_05861	MW1090	FALSE	unmapped	ACAGTAAAAGATACTATTGAAATGGAACGACTATTTAATGGATTAAAAGATGAAGGTGCC
7865	49	15	MW2_CDS_08296	MW1560	FALSE	unmapped	TGCACGTTCATTTGGTGACTTATCAGAGAACTCTGAGTATGATGCAGCAAAAGATGAACA
7866	49	13	MW2_CDS_08065	MW1518	FALSE	unmapped	TATGGTTTGTTTATTTACAATCAGTGGCGAGGTATGGGAACGTTAAATTCTGTAGATGTT
7867	49	11	MW2_CDS_12844	MW2431	FALSE	unmapped	TGGTACAGTATCAGGGTGGATGAACTTATGGGGTAATATAGGTGCATTAATCAGTCCGCT
7868	49	9	pMW2_003		FALSE	unmapped	TGCAAACAATTTTAACTGAATTTGAAGAAACACATGCACTTTATATGCGCCGTAAAAACA
7869	49	7	MW2_CDS_07099	MW1326	FALSE	unmapped	GGTTGGATTCATGTAGGAAATGTTGCGGGGGAACTTAAAAATCCTAAACGCGATTTACCT
7870	49	5	MW2_CDS_02369	MW0438	FALSE	unmapped	CTATTACACCTATGGGAGGCAGTGCGGATTCGTACATTCCATATCCAGTTGAAGTTGAAG
7871	49	3	MW2_CDS_01800	MW0328	FALSE	unmapped	TTTTATGCAACGAGAAAGCAAACATATATTTATTTTATAGTCGCTATCATAGCTGCGGGA
7872	49	1	agr_tiling 045_F		FALSE	unmapped	TTAACATAAAAAAATTTACAGTTAAGAATAAAAAACGACTAGTTAAGAAAAATTGGAAAA
7873	48	164	MW2_CDS_08435	MW1587	FALSE	unmapped	TGGTACACGCGTAGATTTCCAATCTAAACAAGCAATTACTCAACAAAAGGTAGAGCAAGT
7874	48	162	MW2_CDS_09055	MW1698	FALSE	unmapped	CCCGACCGAAGTTCCAATTACATCAGCTGAACCTTTCATCAAATCCAATCGTCTAAAAGG
7875	48	160	MW2_CDS_10238	MW1933	FALSE	unmapped	TGCTCGAAGAATATCCAGTGATATGGGAATGGGATGTGACTATCAAAGTCACTACCAACA
7876	48	158	MW2_CDS_08629	MW1625	FALSE	unmapped	GGTGCATACGAATATATCGTTGCAGCAAGTGGTTTAACTGGTTTTATTGCTTGGGTAGGT
7877	48	156	MW2_CDS_04191	MW0767	FALSE	unmapped	GTAGCAACAAACAATCCAGCTTCACAACAAGTTGATAAGCATTTTGTTGCTAAAGGCCCA
7878	48	154	MW2_CDS_05222	MW0966	FALSE	unmapped	AGGAATCATGGTAGAGATACCTGCAACAGCAGCATTAGCTGATGTCTTTGCTAAAGAAGT
7879	48	152	MW2_CDS_09416	MW1769	FALSE	unmapped	AACTCATATCGATGTAAATGAATTAAAAACAATAGTTGCTAGTCGAATAAATGAAAGGCA
7880	48	150	MW2_CDS_04809	MW0887	FALSE	unmapped	TGGCTGAGATTCAGATTCGTACATTAGCAATGAATTTCTGGGCAACGATTGAACATACTT
7881	48	148	MW2_CDS_04014	MW0732	FALSE	unmapped	AAAATGAGTACAACAGCGAAAGTAGTTAGCATTGCGACGGTATTGCTATTACTCGGAGGA
7882	48	146	MW2_CDS_01871	MW0342	FALSE	unmapped	CTGGTGTAGATGGTCGCTTACAATCCCGTAATTATGAAAATCAAGAAGGTCGTCGTGTGT
7883	48	144	MW2_CDS_13631	MW2576	FALSE	unmapped	GGTGATCACGAACGTAAAGATACAGTGAAAAATGCTGAAGAGACAGGTTGGTTTGTGTGG
7884	48	142	MW2_CDS_10800	MW2040	FALSE	unmapped	TTCCGAATAGTATCGCCCATGCTGATTATAATGATACTGAACAGCCAATTGCACCAGGTA
7885	48	140	MW2_CDS_07339	MW1370	FALSE	unmapped	AAAAGTAACAAAGCATTTTAAAGAAGCGGTTGTCTTAGCATTGACAGCAACTGCACCACC
7886	48	138	MW2_CDS_05007	MW0927	FALSE	unmapped	AACGGTTGTTTGGCACACCGACGGGATTGGATTTCGAGTATACAGCTAAGTTATATCAAT
7887	48	136	MW2_CDS_04497	MW0831	FALSE	unmapped	TAGTCGGCGTTGCAATGATGACAGAGTCAGGTATGATTGGGGCTATTTACTATACATTGC
7888	48	134	MW2_CDS_09957	MW1868	FALSE	unmapped	AGCTGTTGCTGCTTCATTAAGTTTAGGCATTCTATCTATTTTTGTCATCCTTATACCAGT
7889	48	132	MW2_CDS_07582	MW1427	FALSE	unmapped	GTAGAACACGTGCAGAATACATGCAAAATGTGCCTCAAAAGCCACCACATTTGTTAAGTG
7890	48	130	MW2_CDS_02378	MW0440	FALSE	unmapped	GAGGAAGTACGTGCACAATTACCTGATATTGGTGAAGCAATTGAAACGCCTGATGGTAAC
7891	48	128	MW2_CDS_04026	MW0734	FALSE	unmapped	CACAAGCTCATATTGAAGCAGGCGCTAAAAAAGTATTAATCTCAGCACCAGCTACTGGTG
7892	48	126	MW2_CDS_01812	MW0330	FALSE	unmapped	GTCGAAAAATTAAGTCGCTTAAGACCAGCTTTCAAAAAAGACGGGACAGTTACAGCAGGT
7893	48	124	MW2_CDS_06851	MW1279	FALSE	unmapped	ACACCTGTACACGACGATAATTTAAAAAACGAAGTCATTGAAGCCAAACCTTACCGCGTA
7894	48	122	MW2_CDS_11104	MW2098	FALSE	unmapped	GCAAATTATTCAGACGCCTAATTATTATATGGCAGCAATTATAATTGGGTTAGTGTCACA
7895	48	120	MW2_CDS_01342	MW0245	FALSE	unmapped	TTTCAAAAGCAATCGCGACAATTGGTCATTTTGATTTATTAACGATTAATGACGCTGGCA
7896	48	118	MW2_CDS_10896	MW2057	FALSE	unmapped	AGTTGGTGAAGCAGTTATTGATGATGATTTTGGTTATGGCTCTACGGATACAGGGAACGT
7897	48	116	MW2_CDS_06019	MW1119	FALSE	unmapped	ACGTTACGAATGAATTATTTGTTTGATTTTTATCAATCCTTATTGACGAATAAACAACGT
7898	48	114	MW2_CDS_00600	MW0111	FALSE	unmapped	ACGTTCCCATTCATAATGGAGCAAATTTATCATCTGCAACTAGACACAACATCACTGTTA
7899	48	112	MW2_CDS_01825	MW0332	FALSE	unmapped	GTGTTGGCGAAGGCTTAAGCTTTGCAACTGAAAAATTAGACGAATTAGATGCATTGCGTC
7900	48	110	MW2_CDS_12119	MW2294	FALSE	unmapped	ATCAGGTGGAGGAAATACAGCATTAGATTGGGCGCATGATATTGCCAAGATTGCTAAAAG
7901	48	108	MW2_CDS_10179	MW1919	FALSE	unmapped	TTAAATACACTTATTGATAATGAACAAATGGAGTTAGGACACCAAACAAACTTATTTGAA
7902	48	106	MW2_CDS_05172	MW0956	FALSE	unmapped	AGCACCTACTGATGAACAATGGGAAGCAATGTTATTAGGATGGAAAGTTGTACCATCAGT
7903	48	104	NC_S_112		FALSE	unmapped	ATTTTATAAACTATATCTCAACTACCTATACAAAATCATACAATTAAAAATCCATCCGTT
7904	48	102	MW2_CDS_02499	MW0462	FALSE	unmapped	CAATGATATCGATGCACAGGAGCGAAAAGCGAAAGAAGCACAGTTTCAAAAGCAACAAAA
7905	48	100	agr_tiling 111_F		FALSE	unmapped	ATAACAATAGTTATAACAGTAAGGAATTTTTTATTAAGAGAAAGGTATGTACCATTTATC
7906	48	98	MW2_CDS_06803	MW1270	FALSE	unmapped	ATTACCTGTAATCACGCTATCTTTAGGTATGTGTGCATACATCATTCGTTTAGTGCGTTC
7907	48	96	MW2_CDS_12604	MW2384	FALSE	unmapped	CCATACATTAATACATGGTGGGAATTCATTCCAGCATTGATACTAGCAAGTAGTGCGACT
7908	48	94	MW2_CDS_02448	MW0453	FALSE	unmapped	TGATGAAACAGATGAAGTAGTACCAGATAAAAACGCTACATCAGAAGATTCAGAAGAAGC
7909	48	92	MW2_CDS_06565	MW1225	FALSE	unmapped	GGTGTTGGTGTTGATTTTAATGATGAAAAACAACCTTTTTGGACAGAAAATTATACTGGT
7910	48	90	agr_tiling 082_F		FALSE	unmapped	CGATGCTGTTGAAAAAGTCAACTAAAAGCTCAATAACTTTGTTGAGTAATTTTTTCATAA
7911	48	88	MW2_CDS_12521	MW2369	FALSE	unmapped	AAACGATTAGACCCAACAACACGACATCGTAAAAATCAATCTAATCATCGGCCGCAAAGT
7912	48	86	MW2_CDS_12347	MW2337	FALSE	unmapped	TGGAGGCGTTGTTTTAGTCGCATTATTTGTATTACGTCAATATCGGCTATCAACACCATT
7913	48	84	MW2_CDS_00392	MW0074	FALSE	unmapped	AAAAAACTCGGTAAAATAGATGAAATCAAATCGAAGTTACTGCAAACGAACGGTGGCGCC
7914	48	82	MW2_CDS_03241	MW0596	FALSE	unmapped	TGAATTATGAACCTGGTGATATCGTTACAATCAAACGTGTGAGAGATAAGACCGATTTGC
7915	48	80	MW2_CDS_02850	MW0524	FALSE	unmapped	AGACAATGTATCCACGTTTAATTTAGACGAATATGTAGGTTTAACCGCATCACATCCGCA
7916	48	78	MW2_CDS_11120	MW2102	FALSE	unmapped	TTTGTTAATGCAAGCAATGACACGCAATCCGCTAGCATCACCTAAAATTTTTGGTGTCAG
7917	48	76	MW2_CDS_08110	MW1526	FALSE	unmapped	AACGATTGTAGAATGGGTGATATTAGTGAAGATTTTCAACAGAAAGATTCCGTTTTTGGA
7918	48	74	MW2_CDS_10610	MW2003	FALSE	unmapped	TGACTAAACCTTTTAATGTTGATGAGCTTCGGGCACGAATACGAGTCATCGAGAGAATCG
7919	48	72	MW2_CDS_12091	MW2289	FALSE	unmapped	ACAGGGTTACTAGCATTATCATTATTTTTAGCTGCATGTGGTCAAGATAGTGACCAACAA
7920	48	70	MW2_CDS_10683	MW2017	FALSE	unmapped	GCCTCCAAGTGGCGACCATTACATAAAACATATGTATTTCCAAGCGCATAGTCGTGAAAA
7921	48	68	MW2_CDS_05968	MW1110	FALSE	unmapped	TTATGATGCGGATCGCTTTGGATTATCAACTTTACATCAGTTACGCGGTCGTGTAGGTAG
7922	48	66	MW2_CDS_05175	MW0957	FALSE	unmapped	AACAATTGCACAACCCATTGCAAAGGCAATGCTTAATGAAGGTTATCAATTCTTCGGTGT
7923	48	64	agr_tiling 129_F		FALSE	unmapped	TTCATTTGTAAATTATCTTTCATAGGTACAATATTTTTATTGAAATAGTCTCGAAGACCG
7924	48	62	MW2_CDS_01233	MW0227	FALSE	unmapped	ACAGAACATACACAGTATCCCTGTAAGGAATGAAATGTATCAAGGCCAAACACCACAATC
7925	48	60	NC_S_022		FALSE	unmapped	AGCTTTACCATCTTGTGAAACAATCCATTAATTGTAATATTACGTTGAGCGCCTTGTTCA
7926	48	58	MW2_CDS_00076	MW0014	FALSE	unmapped	AGCATCATATGTTGTTGCGAGACGTGAAGATAATCTGATTGGTATATCTGCGCGTTCACT
7927	48	56	MW2_CDS_04145	MW0759	FALSE	unmapped	TAACGGCAATACTTTTTGGTATGATATGATGCCTGCACCAGGCGATAAGTTTGACCAATC
7928	48	54	MW2_CDS_13073	MW2474	FALSE	unmapped	AAAGAAGATTTGCGAGATATTGCAGAATTTCAAGAAGAAGACGCTGAATTTAATAAAGTA
7929	48	52	pMW2_095		FALSE	unmapped	AGTTATTTTAGAGGGAAATTATAGAGAGAGTAACAGGGTACCTTCCATAGTTGATTTTCT
7930	48	50	MW2_CDS_03449	MW0632	FALSE	unmapped	CTGAAGGTGGTTTCTATAGAGAGACAATTCGAGAAGTATTGAAAGATGGACGCAGAGCGC
7931	48	48	MW2_CDS_04455	MW0823	FALSE	unmapped	TGGTGGTGCTGGATTCACTGGTGTTGAATTCTTAGGTGAATTAACAGACAGAATTCCTGA
7932	48	46	MW2_CDS_06185	MW1148	FALSE	unmapped	CGTAGCGTCACCTGGTGCAGAACGTCCAATTAAAAAAGAACAAGATTTCCAAAATGCAAT
7933	48	44	MW2_CDS_13273	MW2512	FALSE	unmapped	CGCTTTTGAAAATTCAAAAGAAGCCATTGCATATTACGAAGAAGTATTTGGTGCAACTGA
7934	48	42	MW2_CDS_08526	MW1606	FALSE	unmapped	AGCATGTTAGGTGAACATCAGAAACAAAATGCTGCATTAGCCATAACAGCTCTTATTGAA
7935	48	40	MW2_CDS_09510	MW1787	FALSE	unmapped	CAACATATGCAAGCAAACAAGCGAATAAGCCAGTGGTTACGTTAATGCCTCAATTCGTTG
7936	48	38	MW2_CDS_05318	MW0984	FALSE	unmapped	ACCTTCTATTATAGGAGGATTCTTTATGGCTTTAACTTATTCACTAGACGATTTCACAGT
7937	48	36	MW2_CDS_04531	MW0837	FALSE	unmapped	AATTTTGTCTATAGATGATGAAGGAAAGCTTAATCTATCATTAAAGGATAATGATTACTT
7938	48	34	MW2_CDS_00221	MW0042	FALSE	unmapped	AAGCATTGGCAGAAATAAACAAAACGCAAAAAAGATTAGTTACAAAGATAGACACACTCT
7939	48	32	MW2_CDS_02633	MW0486	FALSE	unmapped	GCTAAAAACACTGATGTTCAAACATATCGTAAAAGTTCAGCGATAGAAGCAGTGATAGGT
7940	48	30	MW2_CDS_03566	MW0654	FALSE	unmapped	CCTAAATGGCAAGTGCCTCAAAACATAAAAGTTAGATTGAAATATATTTATCTCGCTACG
7941	48	28	MW2_CDS_13693	MW2587	FALSE	unmapped	TTTGTATTTTTTACAATTAGCATATTGATTCAAAAATGGCAGAGAGGAAGAGAATCGTGA
7942	48	26	MW2_CDS_04904	MW0903	FALSE	unmapped	TAAACAAAATGCAGACTCGTCTGAAACGGTGGGATATCAAAGTCAGTCAAGTGCATCTCA
7943	48	24	MW2_CDS_04362	MW0803	FALSE	unmapped	GCTATCGTTGCTCAAGGTAGTGAAGCAGGTGGACATCGTGGTTCATTTTTAAAACCTAAA
7944	48	22	MW2_CDS_03021	MW0556	FALSE	unmapped	GTGAAACCTGCTAAAAAGAATGTTTTTTGGCCAGTTGCAGGTATCTCTACTTTATTCGCA
7945	48	20	MW2_CDS_06938	MW1296	FALSE	unmapped	AGGTTTTAAAAGATATGCATACCGTAATGATAGATATAGTTTTAAACGTGACTTCAAGCT
7946	48	18	MW2_CDS_08739	MW1643	FALSE	unmapped	CTGGTAAAGCTGCGGAAGAACGTGGACAAAGTGAATCTATCGCAACAAATTTGATTGAGA
7947	48	16	MW2_CDS_12832	MW2428	FALSE	unmapped	AGAAGAGAACTTCGTACAATTCCATACAGCAACAATGGAAAAAACAGAGGTGGATAGTGA
7948	48	14	MW2_CDS_08269	MW1555	FALSE	unmapped	ACAAGTGCGAATGTTGCTTGTGGTTTTCACGCTGGTGATGAAAATGTAATGAATGAAACG
7949	48	12	NC_S_081		FALSE	unmapped	TTCTCTTGCTATTGAAATGTTAGGATGTAAATATGTCTTAGAGTATTTTGTCCAACGCAA
7950	48	10	MW2_CDS_04170	MW0763	FALSE	unmapped	CATGACTTTGCTCAAGTTGACCAGTTAATTAGAACGGCATTTGAAAATAGTGAACATGGT
7951	48	8	perR_tiling_076_F		FALSE	unmapped	CGGTATCAATGAGGCATTTTTACAACGTTGCCCGAATTTAAAATGGATTGCATGGTTTGC
7952	48	6	MW2_CDS_08451	MW1590	FALSE	unmapped	AGCTGAGTGCATAAAAGAAATGGATCAAGGTGGACGCATCATGCGTTTACATTATGAAGG
7953	48	4	MW2_CDS_10472	MW1977	FALSE	unmapped	AAGATGTTCTAGCGCGTCGCCGAGAATCTTTAACACCGTTTAAAGCGAAAGTAAAAACAG
7954	48	2	NC_A_041		FALSE	unmapped	TGCTGCTGAAAACCGGTCATTTTGATGCAACCTTCATTACATTTAAATAGTTCCCTTTAT
7955	48	163	MW2_CDS_08010	MW1509	FALSE	unmapped	TTTTGATACATGTCATACGCATGATGCTGGATATAATGTGAAAGAGGACTTTGATGGCGT
7956	48	161	MW2_CDS_12387	MW2345	FALSE	unmapped	TCTAGCCTATTATTACTAGTATTTGGCGTATTTAATCCAATTAATGTGATTATTTCTATT
7957	48	159	MW2_CDS_11627	MW2202	FALSE	unmapped	TGGGAAGAAACAACTGCTAAAGACGGTAAAGAAATTAAAAAAGCAATTGGACAAGATGCA
7958	48	157	MW2_CDS_11891	MW2254	FALSE	unmapped	AGCTACGCGTAAAGTTTATCCAACACAGTCAATCGGTGTGATTAACATTGATGCGCATTT
7959	48	155	MW2_CDS_06775	MW1265	FALSE	unmapped	ATTGAAACTTGATAAAATCAAACACATCAATAATAATGCACAAGCTATTTGCAAAGTCTT
7960	48	153	MW2_CDS_13734	MW2594	FALSE	unmapped	CAATCATATTGCCCGGTGTCGGCCATTTTAAAGATGCGATGTCAGAGATAAAGCGATTAA
7961	48	151	MW2_CDS_02906	MW0536	FALSE	unmapped	GCGTTAGACAAACACCGCATTTACAAGATTGGGCAAGAGAAGGCGTCTTGTTATTGAATA
7962	48	149	MW2_CDS_00958	MW0177	FALSE	unmapped	GCGCCACACGCTATATTTGAGATTTTAGCACTTTTAATTGCTTCAACATTCTCATTAGGT
7963	48	147	MW2_CDS_08183	MW1540	FALSE	unmapped	TTAAGGATAATCGTATTATTGCTGGTGGTTATAATGGCTCTGTAGCTGGCGAGGTGCATT
7964	48	145	MW2_CDS_05739	MW1068	FALSE	unmapped	ACAAAAGTAAATGGTGGGTTTATTGTAACTGGTGGATCTGCAAACTTACTTGGCGTAAAA
7965	48	143	MW2_CDS_04410	MW0812	FALSE	unmapped	TGCAGAGGCGGACTTTAATGCAACATATGTTTCTTTTGAAACGTTGTTAGCAGAAAGTGA
7966	48	141	MW2_CDS_02804	MW0517	FALSE	unmapped	ATAGCGGCTCAAATAACGCAACGTTATTTGGCGGATTATTCGCAGCATTAGGATCATTAT
7967	48	139	MW2_CDS_00086	MW0016	FALSE	unmapped	GAGATGGGTGCTGATCAGTTAGCCACACGTATGATTTGTAGTTCTGGAAATGTTGACTCA
7968	48	137	MW2_CDS_10503	MW1983	FALSE	unmapped	GAATGACTATTTGTAACATGGCTATCGAAGGTGGTGCCAAATACGGCATAATCCAACCTG
7969	48	135	MW2_CDS_00421	MW0080	FALSE	unmapped	AAACTACGCAAAGGTCATATTAAACGCCTTAATCGTGGTGAATGTACAACAAAAGGCGGA
7970	48	133	MW2_CDS_11490	MW2178	FALSE	unmapped	AGAGAATTGGTGGGTATTTATCGTCTTATTACTCTTAGTCGGTAATGTCGAAGTGACAGG
7971	48	131	MW2_CDS_11253	MW2125	FALSE	unmapped	AGTGAACCTTATAAGAAAACAAATGTTATAAAAAAATTTACATCGTTAACAATAGATGAA
7972	48	129	MW2_CDS_02869	MW0528	FALSE	unmapped	AGATAACGAGCAAGATAGAGCTTATTATGCAGAACATCCAAAAGAAGCATTATGGTGGGT
7973	48	127	MW2_CDS_02718	MW0502	FALSE	unmapped	TACTGTATACTCTGGAGATATCGCTGCTGCGGTAGGTCTTAAAGATACAGGTACTGGTGA
7974	48	125	MW2_CDS_12767	MW2416	FALSE	unmapped	ACAAAACAACCAGTAGATAAGATTGTAGAGTTCGGTGGCGAGAAAATACCGCAAGGTCAT
7975	48	123	MW2_CDS_09783	MW1837	FALSE	unmapped	ACGTATAAGTGGGCGTTAGGTGTCACAGCGGTTGTCGATCAAAATATCATCATCAATCTT
7976	48	121	MW2_CDS_06446	MW1202	FALSE	unmapped	TTGAGAATTGAAGATGCATATCGTAAAGATGTTATTATCACGCTTTTGAATAATGAAGAA
7977	48	119	MW2_CDS_11888	MW2253	FALSE	unmapped	AGGAATACAGTTTTATCGTTATGCGAGCGAATTAGTTCAACAATATCGATCCACGATGGA
7978	48	117	MW2_CDS_13177	MW2493	FALSE	unmapped	GTGAGCGAGACAGATGAACCTCAGGGGTTTGAACGCACGCATAATATATTAAATATTAAT
7979	48	115	MW2_CDS_12433	MW2354	FALSE	unmapped	CACGCAATATTAAAGTTCGAGTAAAGCGTTTTTTAGTGGTTTACGCTACTTTAATTACTA
7980	48	113	MW2_CDS_02541	MW0470	FALSE	unmapped	AACCCACCGATTCCGGGTCATTATGATGGAGTAGGTATCGAAATAGTGAGGGAGAATAAA
7981	48	111	MW2_CDS_09740	MW1829	FALSE	unmapped	TGCAACGTTCACGATTTTATTCTGTACAAAACTCAAATTGCAAGTTGGTACGAATGTCGC
7982	48	109	MW2_CDS_07267	MW1358	FALSE	unmapped	AGACATATTATTGGCAGCACCAATCCTTCAGAAGCTTCACCAGGATCAATTAGAGGTGAT
7983	48	107	MW2_CDS_09872	MW1852	FALSE	unmapped	GTCGTATGGTGATGCAAATTTTAACACCAAGAAAATATGAACGTAAATTGATGGATACGA
7984	48	105	MW2_CDS_07791	MW1468	FALSE	unmapped	CGCTTCAGAGCATGACATTGATTTATCACAAGTTGTAGGTAGTGGATTTGAAGGTCGTGT
7985	48	103	MW2_CDS_09168	MW1720	FALSE	unmapped	TTCATGACGTACCGGCAAATGAACAACAATTAGAGCAAGAAATACGAAATACACCATTCT
7986	48	101	MW2_CDS_00358	MW0068	FALSE	unmapped	GGACAAGCAATACCTCAAGCAGCTGTGGGAGCATTATATCGTTCAAAAAAAGTTGTAGCT
7987	48	99	MW2_CDS_09221	MW1730	FALSE	unmapped	CATTTAATGGAAGCAGCACGTCTTCACATAAAGTACCGGTTCCTTACGCTATGCAAGTTG
7988	48	97	MW2_CDS_08602	MW1619	FALSE	unmapped	AGAAGAAGCGATTACAAAAGCTACTGATAATACAACAATCGATATTCCTGAAGCAATGGT
7989	48	95	MW2_CDS_02756	MW0508	FALSE	unmapped	TGAGCGCAATGAGTTTTGATCCAGAGATGGTAAAAGAAGCAATTCAAGAATACTATCCCA
7990	48	93	agr_tiling 053_F		FALSE	unmapped	AAGATACGTGGCAAACTGGTCAATTTTATTATCAAAATAATTCAATTTTACACCACTCTC
7991	48	91	MW2_CDS_05471	MW1014	FALSE	unmapped	TGAAAATGAGCGACCTAAAGCATCAGGTACATTAAAAGTTGAAAATAGCCCTCCAACAGT
7992	48	89	DCP_1_4		pos		
7993	48	87	MW2_CDS_01277	MW0234	FALSE	unmapped	ACCGCAATGGATTAATGCTCTAGGAGACTTTATACAAGCAGTTCCAGAACGTGTAGATGC
7994	48	85	MW2_CDS_12880	MW2438	FALSE	unmapped	GGAACATATTTTTCGTGAAGGACAAAAAGGTGCGCCAACGCTAATATTGTTGCATGGTAC
7995	48	83	MW2_CDS_04413	MW0813	FALSE	unmapped	GCCACCTAATAAATATGTTGAAGCATTCAAACCATATTTATTAACACTATTGTATTTGGC
7996	48	81	MW2_CDS_13632	MW2576	FALSE	unmapped	TCGCCAGTTCATTTTGAATGTGAGTACGTTCAAACGATTCGTATTCCAACTGGAGATCCA
7997	48	79	MW2_CDS_06272	MW1164	FALSE	unmapped	ACAGACAGTCCAAAGTAAGAATAATTTAGATTTTGGAGATCCGTTTGGTGGTGGTTTTGG
7998	48	77	MW2_CDS_11463	MW2172	FALSE	unmapped	ACCAAGAGCTGGTAGAGCATTGTTCTCAGATTCTTTAGCTACGATTGTAGGATCAGTTTT
7999	48	75	MW2_CDS_04060	MW0740	FALSE	unmapped	TGGTGCTGAGCAGTTATTCGGTAAACAAAAACAACGTGGCGTCGATTTATTCTTAAATAG
8000	48	73	MW2_CDS_07586	MW1427	FALSE	unmapped	ACGTCCCTGAATCTTTTGGAACTGGTGATGTCATTATATTTTCAGGTGGTGTACTTGAAA
8001	48	71	MW2_CDS_11565	MW2192	FALSE	unmapped	CCTACCTTGAAAGCAAGTCTGGCGGTAAATCTGGAGATTTTCAACGCCAATCAAATCAAT
8002	48	69	MW2_CDS_12827	MW2427	FALSE	unmapped	ACAACCCTATACATCATATGGAGCGACGTGTGAAAGAAATGCGCAGTTTAATAGAAAAGC
8003	48	67	MW2_CDS_04253	MW0781	FALSE	unmapped	TTAAGTGTTTCAATTGATGCGACAATTAAAAATGTTATATCTCAAGAAGAAGCTGAAAAA
8004	48	65	MW2_CDS_08068	MW1519	FALSE	unmapped	AGGAATTGTCATTGGAAAAGGCGGTAAAAAGTTAAAAGAAGTAGGGAAACGTGCGAGACG
8005	48	63	MW2_CDS_03818	MW0698	FALSE	unmapped	TCCAGATGTTATTTTAGCGATGGATAGAGGTCAAGCGATAAGTGGTAAATCAACTGCGAA
8006	48	61	agr_tiling 044_F		FALSE	unmapped	GTTAAGAATAAAAAACGACTAGTTAAGAAAAATTGGAAAATAAATGCTTTTAGCATGTTT
8007	48	59	agr_tiling 173_R		FALSE	unmapped	GAATTAAGAACTCGAATTATAGATTGTTTAGAAACTGCACATACACGCTTACAATTGTTG
8008	48	57	MW2_CDS_09098	MW1706	FALSE	unmapped	GGACAAATTGAAAACTTTCAAACGTATCACGAAAGTTTGCTAGACTGGTTAAAGATAGCT
8009	48	55	MW2_CDS_02249	MW0415	FALSE	unmapped	TGCCAAACAATTGATTAAAGCAACATCGTATTACACATTAGCTGAAAGTTTAGGTGCAGT
8010	48	53	MW2_CDS_09213	MW1728	FALSE	unmapped	CGCTGCACGTTATGTGGCTAAAAATATTGTTGCAGCAGGTTTAGCAGATCAATGTGAAGT
8011	48	51	MW2_CDS_07620	MW1438	FALSE	unmapped	TAAAGCTTTTGAAGAGTACAAAAAAGGAAAAGAAGAGGAAGCAAGAGCTGGTGCTAGCGC
8012	48	49	MW2_CDS_13214	MW2501	FALSE	unmapped	TGTAGATATTCCAGGCGGTCACTTAGGTTATATTCAAAAACCTGAAGGCTTTGCTGACGT
8013	48	47	MW2_CDS_02029	MW0375	FALSE	unmapped	TCATTATTGGCAATCGTTAGAGATTTCGCAATTTAATAATGCTAATTTATTATACGAATT
8014	48	45	MW2_CDS_11032	MW2086	FALSE	unmapped	ATGCAACGCCAGCAGAAAGCACAACAAATAACAATAGTACAACTACAGCAACAAACGAGA
8015	48	43	MW2_CDS_04610	MW0850	FALSE	unmapped	CCACCAGTAACACCTCCGAATAATGTGATTGCTTTTGGTAGAAATTACAAAGATCATGCG
8016	48	41	NC_S_011		FALSE	unmapped	ACAACGCCATTCCCTACACACTCTTATAAAAGAGATTCACGCGCGTCAATAAATTGTATT
8017	48	39	MW2_CDS_12754	MW2413	FALSE	unmapped	ACGACCATTGCAGATAAACACAAGAACCAAATTGCATATATATTTACGCTATGTATCAGT
8018	48	37	MW2_CDS_05473	MW1014	FALSE	unmapped	TGAACAGCATATGGATAAAATCAATATGCATGTTAAAACGTTGGCTGAAAAGAAAAATCT
8019	48	35	agr_tiling 141_R		FALSE	unmapped	TAACGCAATAGAGGCATCAAGTGAAATTGATGATCCTATCATTCGAGTTGCATTTATTGA
8020	48	33	MW2_CDS_04095	MW0747	FALSE	unmapped	AGGTGACACACAAAAGAAAGTTGCTAGCAAACTTGATATTAGTCCACAACGTTACCAGTT
8021	48	31	MW2_CDS_02260	MW0417	FALSE	unmapped	GCGGTGGTGGTATAGGAGACTTAGCTTTAGTGTATGGTTATCAAAGATTTGATACGACGG
8022	48	29	NC_A_015		FALSE	unmapped	TGTACATATGACAGTAAGGACTAGGTACAGTCATAGTACTTCGAGCAAAATTTGTTTTGT
8023	48	27	MW2_CDS_12629	MW2389	FALSE	unmapped	GCAGAGTGGGGCATGATGCTTAACGAAGCTAGAAAAGTGATGTTTACACATCCTGAAATG
8024	48	25	MW2_CDS_10153	MW1911	FALSE	unmapped	TTGTAATGTACCGATAGATAAAGGAATTATGATAAATGAACTTAGCGAAGCATTGTGGAA
8025	48	23	MW2_CDS_06038	MW1123	FALSE	unmapped	CGATGGAAGACTTAGATGTCACAGAACAAACACGCGTTATTTTAATGTGTCCACAAGGCG
8026	48	21	MW2_CDS_07853	MW1480	FALSE	unmapped	CAGACGAAGAAGCATATGTGCAAGTTGGGGACACTGTTTCAAATGAAACAACAGTGTGTA
8027	48	19	MW2_CDS_07787	MW1468	FALSE	unmapped	GCGCGTAATAAGCAATTGACAGCTGAAGATATGCAGGGCGGTACATTTACGGTAAATAAT
8028	48	17	MW2_CDS_13108	MW2482	FALSE	unmapped	TCCAGGTGCAGGCGTTCCTATTGTCTTAACGAGTGCGAAAATAACTGTAGATGAAATGAT
8029	48	15	MW2_CDS_05308	MW0983	FALSE	unmapped	CATGCCGTTAACAAAAGAAGGTGTTATGACTGGGATTCAAGTAACCTTTATTCCATCACT
8030	48	13	MW2_CDS_04174	MW0764	FALSE	unmapped	CTCCGATTCATCAAGTGATTCCGACTCAGAAAGTGATTCAAATAGCGATTCCGAGTCAGG
8031	48	11	agr_tiling 135_R		FALSE	unmapped	AGCTAAAATTTTACGTGCACAAGAAATGAATATACCGATTAGTATAGAAATACCAGATGA
8032	48	9	MW2_CDS_12667	MW2396	FALSE	unmapped	TAGAGAACAGATTGGGCATGTTGATGTGTTATTTAATAATGCCGGTGTGGATAATGCGGC
8033	48	7	MW2_CDS_05327	MW0986	FALSE	unmapped	TCATGATGAGCGCACTGAGGAAGAACCATCAGTATTATCCAGACAGGCTAAATACAAACA
8034	48	5	psma_tiling_071_F		FALSE	unmapped	CTTTAAGCGTGCTCCCATGCACATATGTATATAAAATGTTACTTCTGTCTGTTCAATTCA
8035	48	3	MW2_CDS_11952	MW2266	FALSE	unmapped	GTTTAGGAAAAGATTATGATGCTGCAGTAATGGTAGGTGGTTTTATCGGGCATGGGCTTG
8036	48	1	MW2_CDS_06519	MW1216	FALSE	unmapped	GTACAACAATTAGACGGTGAAGCACCTGATATTTTAGCGATTCCTGTAGGTAATGCAGGT
8037	47	164	MW2_CDS_08515	MW1604	FALSE	unmapped	AAAAGCAATTACTTTAAAAGCAGCATTTGAGTTAGGGGAAAGGATGGGGAGAAGAGCTGA
8038	47	162	MW2_CDS_07926	MW1493	FALSE	unmapped	ACTTTTGACAATGACATCTAAAGGATTAAGCAATCTTAGAGTAATAGATGATGAGGCAAA
8039	47	160	MW2_CDS_08317	MW1564	FALSE	unmapped	TGCAATTCGCTTCTATATCTGATGACATTCATGTCACAACGATAGAGCGTAATGAAACGA
8040	47	158	MW2_CDS_09001	MW1689	FALSE	unmapped	TTCATTATGATTTTTATGCAGATGCATATACTGGTGAAGTCATTAACATTGTAGAGCGTT
8041	47	156	MW2_CDS_03965	MW0724	FALSE	unmapped	AGTTGCAGCTGGTACGGTTGTTTCAAAAGATATACCGGATAATGGATTTGCATATGGCAA
8042	47	154	MW2_CDS_08674	MW1632	FALSE	unmapped	TGTTGCGTCTGTAGCATCTTATCCTTCATTTTTAGAAATAGCGCCTGAACCTTTTTCAAA
8043	47	152	MW2_CDS_13739	MW2595	FALSE	unmapped	GGCACAAGGTGATATTGACGTAGATGATCACCACGTAACTGAAGATATCGGCATTGTCAT
8044	47	150	MW2_CDS_12673	MW2397	FALSE	unmapped	TCGGAGCCTTACTTTCTAGTTTAATGCCGTATTCAATCGCGCTAAGTATTGTGTGGACAG
8045	47	148	MW2_CDS_12575	MW2378	FALSE	unmapped	AGCGCATAACGATTGTTGATGGCAAAATTTCTAAGGTTGAGGAGTTGAATCAACATGAGT
8046	47	146	MW2_CDS_03008	MW0553	FALSE	unmapped	CCTGATTCTCATTTAGAAAAAAATTGCGTTATTATCATTTGTTCGGTTTTATTATTAAGT
8047	47	144	MW2_CDS_08760	MW1647	FALSE	unmapped	GATGCGCTTGTAATTGTATGTGATACTGCCAATGCTCCACGAATTGACGATGAACGTTAT
8048	47	142	MW2_CDS_08302	MW1561	FALSE	unmapped	AGCAGTAGAAGTACCGACATATGATTATGCTAGTCATACAAGAAGTGACATTACCATTGA
8049	47	140	MW2_CDS_03829	MW0700	FALSE	unmapped	ATTGGCGGCGTTGAAGTTTCAACTAAACACGCTGGTTTTATGGTAAATGTAGACAATGGA
8050	47	138	MW2_CDS_11616	MW2201	FALSE	unmapped	GGTGGTACCTTTTTACCAAAAGGAAATGTTGAAGAACCTGAGCATGATGGTTCTGCAGAA
8051	47	136	MW2_CDS_09722	MW1825	FALSE	unmapped	ACAAAGTTATGGACTTAAAAATATGCGTGAAAGAGCTTTGGAAATTGGTGCAACGTTCCA
8052	47	134	MW2_CDS_09919	MW1860	FALSE	unmapped	TGATCATAACGAATTCCAACAAAGTTCTGATACGATTGCCTCTGCTACAATTAAGCATGT
8053	47	132	MW2_CDS_02406	MW0445	FALSE	unmapped	ACGCCTTGGGTATTAGCTAAGGACGATAGCCAAAAAGATATGTTAGGCAATGTAATGGCT
8054	47	130	(+)eQC-41		pos		
8055	47	128	MW2_CDS_10041	MW1886	FALSE	unmapped	ATACGGTGATAATCGTACTAACTATAGATTCGATGTTGGACAGGCTGTATACGCGCCTGG
8056	47	126	MW2_CDS_01619	MW0296	FALSE	unmapped	TGTCTGGAAACTCATCATCATTTGGTTTTTACGCGTGGCATTGTCGCTATTAATCACCAT
8057	47	124	MW2_CDS_06339	MW1177	FALSE	unmapped	TTTGGTACTGGTACAGCTTTTGCATTTCCAGGTAGTATGATTGGAGTTTTATTGGCTAGT
8058	47	122	MW2_CDS_03122	MW0574	FALSE	unmapped	CATTGGCAGATAGCTTTACATTAGGATTGGCAAGCGGTGCTACATTTGGTTCAGGATTAG
8059	47	120	MW2_CDS_09498	MW1784	FALSE	unmapped	TGACTTAGATTTTGATCTTGATGAGCAATATCGCATTCGTGATCACTGGCAACAAGCTTT
8060	47	118	MW2_CDS_05069	MW0938	FALSE	unmapped	ACAATGGGAATGAATAATTGGAATATTGCTCAAATGCGAATCTTTTGGCAATATACAGCA
8061	47	116	MW2_CDS_04921	MW0906	FALSE	unmapped	ACTAACACCATTATTTCCAACTTATTTTTTCCCAACACATTCTGACAGACAAAATGAAAA
8062	47	114	MW2_CDS_12531	MW2371	FALSE	unmapped	TGTACTTGCTATTATGATACCGATTTTTGGTGTTGGTAAAACGCCTGCAATTGTAGCGCT
8063	47	112	MW2_CDS_04968	MW0918	FALSE	unmapped	TGAGCAGATAGATCCAACTATAGAAATCGAAAATGGAAATACAAAATTAAAATTAAATGG
8064	47	110	NA		ignore		
8065	47	108	MW2_CDS_00865	MW0160	FALSE	unmapped	CCATTATCAGACATTGGTATGGGCTGGGTTGTTCTCAGTTTGATTGGTTTCATTATCGGC
8066	47	106	MW2_CDS_08923	MW1675	FALSE	unmapped	CTGATATCGTTGTAACGGAAGCTGGATTTGGTTCAGACTTAGGCGCTGAAAAATTCATGG
8067	47	104	MW2_CDS_10378	MW1960	FALSE	unmapped	ATTCTTTTCATTATCACACTTTTTGTAAAAGAACCATATACCCAATTTATTCAACTGGGT
8068	47	102	MW2_CDS_05766	MW1072	FALSE	unmapped	ACGCCTGATAATGTGGAAGTAGCTGGAAGCATTACAGACCATATTGAAAATATGGAACAT
8069	47	100	MW2_CDS_04830	MW0891	FALSE	unmapped	GAACGACTAGGTCTGTTTGACCGAGACATAGTTGTTTGTGCCACGAATGACGATGATATT
8070	47	98	MW2_CDS_00272	MW0052	FALSE	unmapped	CGGAAACTGGAGATATACAAAAAGGATATATAAAATTTCATTCTACTAAATCAAGTTTCT
8071	47	96	MW2_CDS_03944	MW0720	FALSE	unmapped	ATGATTGATGAATCACATGTGACATTACCGCAAGTTCGAGGCATGTATAACGGAGACAGA
8072	47	94	MW2_CDS_00807	MW0150	FALSE	unmapped	ACGACAAACGCAATGAATCGATGCTCCATTATACACGCACAGAGAAGATTAAACAGATGT
8073	47	92	agr_tiling 023_F		FALSE	unmapped	TTCTAGCATGTAAGCTATCGTAAACAACATCGATTTATCATTATTTGATAAATAAAATTT
8074	47	90	MW2_CDS_13621	MW2574	FALSE	unmapped	GATTTCTTAAAGAGTGGCAATTATTTTTCAGGAGTTAAACCTGGTAAGGATACAGAACGT
8075	47	88	MW2_CDS_11829	MW2243	FALSE	unmapped	TCACACTGATATCACTTATACGTTGAATAAGTCTCATGCACATATTATATGTACGCCAGA
8076	47	86	perR_tiling_119_R		FALSE	unmapped	TGTTATGAAAGAAGGACACGGTGCATATTTATATGATGTCGATGGCAATAAATTTATTGA
8077	47	84	MW2_CDS_13331	MW2522	FALSE	unmapped	GTGAAACCAATTGGCATCGAATTACCAGCAGCATTATCAAATCCATTTGGTACGAATGGC
8078	47	82	perR_tiling_089_F		FALSE	unmapped	TGTAAGAACGACTTTTATAATAGATGAACAAGGTAAAGTATTAGATGTTATCGAGAAGGT
8079	47	80	DCP_22_7		pos		
8080	47	78	MW2_CDS_06919	MW1292	FALSE	unmapped	GCACAAGGGGATGACGCAGATATAGAGAGATTTATTCAAGGTGTAATTGAAGGTGCCTCA
8081	47	76	pMW2_102		FALSE	unmapped	ACACCTTAATTATCCCTTTGATACATCTACTAACGCTAGACAAAACGTTGATGCACAAGA
8082	47	74	MW2_CDS_03838	MW0702	FALSE	unmapped	AGTCGATGTAGATAAGTTGCCGAAAAAGGGTATAGATATAACTCACGGCGATAAAGCCTT
8083	47	72	MW2_CDS_02615	MW0483	FALSE	unmapped	TTATGCCTATTCGTGTTGCTGTAACAGGCCAAATGCATGGTCCTGAATTACCAAATACAA
8084	47	70	MW2_CDS_07235	MW1352	FALSE	unmapped	GAAACATTAGAAATTGCAGAAGTGGGAAGTCACGCTTCTGCAATTCAATTTACTAAGCGT
8085	47	68	MW2_CDS_08408	MW1582	FALSE	unmapped	GCTTTAGCAGATACGTTAGACGCTACGATTCAGAAGAAAGGTCTACTTTCTAATCGCGGT
8086	47	66	MW2_CDS_02742	MW0506	FALSE	unmapped	TGGTGTTGAACACAAAGGTGCCTATAAAGATGGTAAATGGAAAGTATTGATGATTGCTGC
8087	47	64	MW2_CDS_00296	MW0057	FALSE	unmapped	ACCCAGTCCGTTCATAGCGCTGATATGACAGGTAAAGAAGAACATGTATTAGACGTACGT
8088	47	62	MW2_CDS_13912	MW2627	FALSE	unmapped	TGCGAGAGCGGTATTATCATTGTCTGATAGTGAACAAGAAGCGTTGATTGAGCAAGTCAT
8089	47	60	MW2_CDS_10720	MW2025	FALSE	unmapped	GTAAGCAATTTTATTGTAGATTTGTTACAATACTCGACGCAGGTAAAATATTTAATAAAA
8090	47	58	MW2_CDS_10706	MW2022	FALSE	unmapped	AATCATTTAATCGAATGATGCAGTCTAAACCAAAGTTAAAGGATGAAAAATTAGAAGAGT
8091	47	56	MW2_CDS_13271	MW2512	FALSE	unmapped	CATTCTTCAATTGAAATAGAATTACCGTTTGCTGACCAATTCTGGGGTGGCAAAATGGGC
8092	47	54	MW2_CDS_01062	MW0196	FALSE	unmapped	TCGGTGTATTATTATTAACACACGCAACATATACAACTATTTTATTAGTACCGTATGCGT
8093	47	52	MW2_CDS_00973	MW0181	FALSE	unmapped	ATTGTTTGCGACGAGGCAGTGTCCGCTTTAGACGTTTCAATTCAAAAAGATATCATCGAG
8094	47	50	(+)E1A_r60_1		pos		
8095	47	48	MW2_CDS_07230	MW1351	FALSE	unmapped	AGGTTTAAACGTTCTATGATTGGAATCAGTGTAGCGATGACTTGGGTATTTTTGAATGAT
8096	47	46	MW2_CDS_12873	MW2436	FALSE	unmapped	ATGCTAATTCCTGTTAACTGTATTATAACAACTTTACAGCAAAAAAATGCAAAATCAACT
8097	47	44	MW2_CDS_07500	MW1403	FALSE	unmapped	CTAATGTCAGTTTGTTATAGCTGTCATAACAAAATTCATGCAAATGATAATGACAAAAGT
8098	47	42	MW2_CDS_00096	MW0017	FALSE	unmapped	AAAAGGTATCGGTCCAGCATATGTAGACAAAGTTCAACGTATCGGTATTCGTATGGCAGA
8099	47	40	MW2_CDS_12344	MW2337	FALSE	unmapped	TGGGTTAACTTTATTACCAGGAGCAATTGTTATGGCATTTATGTCGATGACTTCGGGTGC
8100	47	38	MW2_CDS_08787	MW1651	FALSE	unmapped	AGGTGTGACTGAACGTGAAGTAGTCAACCATATTGAGCAAACTATCAAACAATATGGCGT
8101	47	36	MW2_CDS_02573	MW0475	FALSE	unmapped	AAGGTATCGCTACAGATATTGAAGGTGTCTTTATAAGAGCGCCACATATTGAAAAAGTAG
8102	47	34	MW2_CDS_04022	MW0733	FALSE	unmapped	TGGCACAACAAGCTGGCGGTTATTATACGACGATGTATGTACCTGATAATGTCAGTGAAA
8103	47	32	MW2_CDS_12302	MW2328	FALSE	unmapped	CGAAGATAATGTTGCGAATAAAGTGACTGAAACAATTCGTAAAGAAACAGATGCGAAGCC
8104	47	30	MW2_CDS_05239	MW0970	FALSE	unmapped	TTAAATAAAATTGGAGCAGATACGGTTGTGCACCCTGAGCGTGATATGGGTAGACGTATT
8105	47	28	MW2_CDS_13342	MW2524	FALSE	unmapped	TCACATTTAAAAGCTTTATTATTGAATTTAGATTTTCTAATTCCTTCTGACAATACACCA
8106	47	26	NA		ignore		
8107	47	24	MW2_CDS_00427	MW0081	FALSE	unmapped	CGGCGACAGACCTTTAGTCGTCCCGCATCAATCACAAAATTTAGCATTTATTGGTAACTT
8108	47	22	NC_S_060		FALSE	unmapped	AAAAGACGGTGACCTTATATTTTATTTAAAAATAGCCTTCAAAATGCCGGTCAAAGCGAA
8109	47	20	MW2_CDS_13193	MW2497	FALSE	unmapped	AAAGACGCATTACGTGCGAAGAGTTGCAAGCACATTTTGAAGAATCTACCTTATCGGTTC
8110	47	18	NC_A_004		FALSE	unmapped	TGATATATTTGCAAGGGTAGAAGCAGTATCTTTCATCTCTTCACGCACATGCCGTCGGGG
8111	47	16	agr_tiling 175_R		FALSE	unmapped	ATACACGCTTACAATTGTTGTCTAAAGATAATAGCGTTGAAACGATTGAATTAAAACGTG
8112	47	14	MW2_CDS_06709	MW1254	FALSE	unmapped	AATTCGAACGATGATGATAGATGAGCAGTATATCAACGTAGAAGCTGGTTGTGGCGTTGT
8113	47	12	MW2_CDS_04334	MW0798	FALSE	unmapped	TTCCCAGCTCGTATTAAATGTGCCACATTAGCTTGGAAAGCATTGGAAAAAGGTACTGTT
8114	47	10	MW2_CDS_10638	MW2007	FALSE	unmapped	ACAGGTATTGTTGGTGCAATGACAGTCATTTTAGGTATTCTATATGCACCCGCATTAATT
8115	47	8	MW2_CDS_07002	MW1307	FALSE	unmapped	AACGCTAAACTACTTACCTAAAGAGAAAGCTGATTTTATTGGAGCAACAATTCGAGAAGA
8116	47	6	MW2_CDS_07851	MW1479	FALSE	unmapped	TCAAAGATGTTGCTAAGGCAGAAATGATCAAAGCCAATGTTCCAGTTGTTCCTGGTAGTG
8117	47	4	MW2_CDS_01203	MW0221	FALSE	unmapped	TGTGTTATTTCAAAATGGGTTCGTGAAGTCAACGTTTAAAGATGCAGTCATCGACAGAGA
8118	47	2	MW2_CDS_06440	MW1201	FALSE	unmapped	ATTGAATGAATTGTTAAGAGAAAAAATGTCAACAGGCAATCTAATATTAAGTGATGAGCT
8119	47	163	MW2_CDS_09844	MW1847	FALSE	unmapped	TGCGATTTGTATGTCTCAAACAGATGCAATTATGATTGGTGGAACTGATGACGTTACTGA
8120	47	161	MW2_CDS_04620	MW0852	FALSE	unmapped	ACTCAAGGTGCACACGCGAATTATTACCCAGGAAATTCCCCTTTACACTTAAGGGTATAT
8121	47	159	MW2_CDS_09653	MW1812	FALSE	unmapped	AGAAATTGGTAAAATTTATAAACTGACTGATGGCAGTAATCAATATTTTAAAGTAGAAAG
8122	47	157	MW2_CDS_08529	MW1606	FALSE	unmapped	TGTCATTGTTGAGGCTGGATTGGGTATAAAGAACGATTCGACAAATGTCTTTACACCGGT
8123	47	155	MW2_CDS_04065	MW0741	FALSE	unmapped	TGTTGAACAAGGTTATGATGAAATTGTTGTTGCTGGTCTATCATTAGGTGGGGATTTTGC
8124	47	153	MW2_CDS_04284	MW0788	FALSE	unmapped	TTGCGAATTGCCCCAAACAATATTTGGCGCATGTACTTTCAAAACATGGCTTTACTTGTA
8125	47	151	MW2_CDS_01821	MW0332	FALSE	unmapped	AGTTGACGAACCTGCATTACGTGAAGGCTTACCATTACGCTCTGAATATCACGAACAATA
8126	47	149	MW2_CDS_04045	MW0737	FALSE	unmapped	AAAGGTGAACGCCGTCGTTTAATTGATTCACCTAAAGTTGCAACGTATGACTTGAAACCA
8127	47	147	MW2_CDS_06237	MW1158	FALSE	unmapped	GGTATTGGGGATGTAGGAAATATCGTGTTGAGAGACCGTCATCTTTTAGCAGAAGATGGT
8128	47	145	MW2_CDS_10482	MW1979	FALSE	unmapped	GTTGCGGATCAAGTCAGCACGCTAAATCGAATTACAAGTGCTTTTGTTCGCCTACAATAT
8129	47	143	MW2_CDS_13821	MW2609	FALSE	unmapped	TGGTAAGGATTGGTTTGATGGCAAACCATGTGAACGTTATATTAATTGCGCTAACCCAGA
8130	47	141	MW2_CDS_11631	MW2203	FALSE	unmapped	TCCAACAAGAGGGGGAAGACCAAGTACACATGCTGTTAAAGCTGATGATGGGTATATTTT
8131	47	139	MW2_CDS_01699	MW0310	FALSE	unmapped	ACTCGTAGAAGCATTCACTTCGATATTTGATGAAATGGAACAAACACTCGTATCGCAGTT
8132	47	137	MW2_CDS_11487	MW2176	FALSE	unmapped	TGGTATTCAGTTTAAATATCGAACACTGCCATTTATAGGTATGACGACCAATTTGACAAT
8133	47	135	MW2_CDS_01984	MW0365	FALSE	unmapped	ATCCCAGTGCCGTTTAGATTCTCTGGATTTAGCTTTGATGTGACATCGACGTTAGTGTTC
8134	47	133	MW2_CDS_13558	MW2564	FALSE	unmapped	AGCACTCATTGTATCGGTTGGAGATTTGTTAATCCTAAAAGCAGGAGTTGAGTCACCTGT
8135	47	131	agr_tiling 053_R		FALSE	unmapped	GAGAGTGGTGTAAAATTGAATTATTTTGATAATAAAATTGACCAGTTTGCCACGTATCTT
8136	47	129	MW2_CDS_07525	MW1409	FALSE	unmapped	TGAAAACTTTACGCGAAATCATTTATGATAAATACGAAAATGAAAACTTGAGAACTTTAA
8137	47	127	MW2_CDS_09867	MW1851	FALSE	unmapped	TGGAACAATTTGAATTATTTAGTATTGATAAATTCAAATGTAATTCAGAGGCTAAGTATT
8138	47	125	MW2_CDS_05253	MW0973	FALSE	unmapped	GAGGGCGCACATTTAGATTACGAAAAAGAAAACTCAGAACACTTTAATGTGGAGATTGCT
8139	47	123	MW2_CDS_01301	MW0238	FALSE	unmapped	AGTATTATTATTTGTATTATTATGTACTGGTGCTGTTAAGTTAGGCGAAGTCGAAAAAGT
8140	47	121	MW2_CDS_11085	MW2095	FALSE	unmapped	ACCAACAGCTGTTACTTTTAAATTTCTTGAGTTTTATCTTAGCTATCGTTGTGGCAATGT
8141	47	119	MW2_CDS_02768	MW0510	FALSE	unmapped	AGGTGTAGAACAATTTTTAGCACATACCAATGCTACCTCGTTGTTCGATTTGATCATTTC
8142	47	117	MW2_CDS_08174	MW1538	FALSE	unmapped	AGAAAAGTTGATTTTATTTTTAGGCGATAGACCAACAATTAATAAGCAGGATGTTAACCA
8143	47	115	MW2_CDS_03186	MW0586	FALSE	unmapped	TGGAGCATTGGTATCATCTATTACTGCGATAATACCTATGTTTTTTGGAAAACCATTTTT
8144	47	113	MW2_CDS_12578	MW2379	FALSE	unmapped	ACAACAGATTCGGGCAAAGAAATTAGAGGTATCATCGGTTCTAAACCGCCACATGTCTTA
8145	47	111	MW2_CDS_02319	MW0428	FALSE	unmapped	AGGGCTCTGCAGCATTTGGAGCATGGTTTGTCTATAAACGTCGTAAAATGGTTAAAGAAG
8146	47	109	MW2_CDS_09906	MW1858	FALSE	unmapped	AGACATTCAAGTACCTGGTGCTTTTCCAAAATTCGGAACGACAGATGGTACGATAACGAA
8147	47	107	MW2_CDS_05994	MW1114	FALSE	unmapped	CCGTTAGCACGTTTTGGTCAAGACACAGATATTGCTAATACAGTAGCGTTCTTAGCATCA
8148	47	105	psma_tiling_064_R		FALSE	unmapped	CAAAATCTTTACAATCATTGGTTTAATAGAGGTTAAGCTCATGAATTTGACATGAAGCAG
8149	47	103	MW2_CDS_08006	MW1508	FALSE	unmapped	AGTATTAGTACTTGATGAACCAACGAATGGTATTGATGCAAAACATGTAAGTGAATTTTA
8150	47	101	MW2_CDS_02346	MW0433	FALSE	unmapped	AGGTAGCGTACATGATGAAGCGTTGGATCACTTGTTTGATGATATTGTACAAGGTGACGT
8151	47	99	MW2_CDS_09066	MW1701	FALSE	unmapped	GGACGTCGTGAAACAAATACAATGCCACAATGGGCAGGTAGTTGTTGGTATTATTTACGT
8152	47	97	MW2_CDS_03986	MW0727	FALSE	unmapped	TGAAGTATTTGAATATAATGTTTATGTGCATCATAGGGACGCACATATTGAAAGTGGCGA
8153	47	95	DCP_1_2		pos		
8154	47	93	psma_tiling_039_R		FALSE	unmapped	GTTTTGTCCTCCTGTATGTTGATTTAACATAGTGATGAGTTGTTGATCGTTAATGTTTGA
8155	47	91	MW2_CDS_01155	MW0212	FALSE	unmapped	GTCATTTAGTTTGGTCAGCGATTGTTGGTGCTGCAATAGTTATTGCGAAAGAACAGCATG
8156	47	89	MW2_CDS_12639	MW2391	FALSE	unmapped	TGATGATGAAGGTATCTTTATCCCTATTTCACACGGTAGTATGACAGTTGTTGCGCCGAA
8157	47	87	MW2_CDS_01185	MW0218	FALSE	unmapped	TTTATTACGATGATGTTCGGCTTATGTGGTGCCGCACTTGCAATTTATCACACAGCTAAA
8158	47	85	MW2_CDS_00410	MW0078	FALSE	unmapped	TTTCAAATTGAAAGTTCAAGGTAAAGGTGGTCATGGTTCATCACCCCATATGGCCAATGA
8159	47	83	MW2_CDS_06785	MW1267	FALSE	unmapped	TGTCATGCGTTCGTTATTAGCACAGCCTCGCGTTTTAATATGTGATGAGATAACTTCAAA
8160	47	81	MW2_CDS_04515	MW0834	FALSE	unmapped	AGTGTTGATACATTAGGCTACCTATTCCCAATCATTGGTATAGTGGGCAGTGTCTTCACA
8161	47	79	MW2_CDS_02475	MW0457	FALSE	unmapped	TTTTTCATTAGATAAACAAAAGTTTAAAGGTGCATATACAATTGAACGAATGAACGGCGA
8162	47	77	MW2_CDS_01028	MW0190	FALSE	unmapped	AGTGAAAAATGCACCGCAAACGTTAGAAGAAGTTGAAGCTAATGCTGCCAAACTAACTGA
8163	47	75	(+)E1A_r60_n9		pos		
8164	47	73	MW2_CDS_04599	MW0848	FALSE	unmapped	ATGATTCCGCAAACATTGGACCAAGTAAGTATTGGTACGATGGATTTGGCTAAAGTCGAT
8165	47	71	MW2_CDS_03677	MW0674	FALSE	unmapped	AGGCGCTCTAGCTTATCAAATTGGGGCTAAGCATATTATTACAGGCGTATGTGAAACAGA
8166	47	69	MW2_CDS_13935	MW2631	FALSE	unmapped	AGCAAGACAGCCAGCTAAAGATATGACGACTTTACAAATACAGAATAGTCTTGAGCACGT
8167	47	67	psma_tiling_026_F		FALSE	unmapped	GATGTTCTTGGTGGGACGTACGGAATATTCGTGATCTTTGTAGTCTGACGCGTTATATTT
8168	47	65	MW2_CDS_12177	MW2304	FALSE	unmapped	ACGGATCAGCACTTTATCAATCTATTGCAGCATTATTCGTTGCACAGATGTATGGAATGC
8169	47	63	MW2_CDS_11673	MW2212	FALSE	unmapped	AGCAATACATTCGATTGTCGTGTTGCTATTTCTCAATTGCCTACACATGGTTTTGCAGTT
8170	47	61	MW2_CDS_02148	MW0396	FALSE	unmapped	TGGACTTGTACTACATGATGATGCAAACTTCTTAGAACATGAATTAAGCTATATCGATGT
8171	47	59	MW2_CDS_10874	MW2053	FALSE	unmapped	TGGATATGGCACGAAAATAATGATGTCATTGCCGCAATATGTTCAAGGTGTATTTCCTGA
8172	47	57	MW2_CDS_06609	MW1235	FALSE	unmapped	AGAAGCCGAAGAAGAAGCAGTTGTGGAAGAAAATGTTGTGTTATTAACTGAAATCAGAGA
8173	47	55	MW2_CDS_10903	MW2058	FALSE	unmapped	ACTAAAGTGGTTGCCCCATTTATTAGATTAGCGGGAACGATGGAAGGATTAAACGGAGAT
8174	47	53	MW2_CDS_09068	MW1701	FALSE	unmapped	TCCTGTCATTCATTGGGAAGATGGAACAATGACAACTGTTCCTGAAGAAGAGCTACCATT
8175	47	51	MW2_CDS_04580	MW0845	FALSE	unmapped	CAAGCTTATGGACCTATTTTAGGTATATTGATTAGTTGGCTTGGATTAATTTCTGGAACA
8176	47	49	(+)E1A_r60_a107		pos		
8177	47	47	MW2_CDS_13525	MW2558	FALSE	unmapped	AATTAACACACGGTGTGACACAAGAGACTGCAAACTTAGAATATAAGGACCAGTCAGGCG
8178	47	45	MW2_CDS_08401	MW1581	FALSE	unmapped	AGGACAAATGAAACAAGCAGACCGTTTAGGTGCCAAGTTTACAATCGTTATTGGTGATCA
8179	47	43	NC_S_003		FALSE	unmapped	ACGCATACTTCACCATGCTAAAATAGGAGTCGCAAACAAATAAGATTCAATAAGATGTGA
8180	47	41	MW2_CDS_03003	MW0553	FALSE	unmapped	TCGGAGTAGCAATGGAAAAATTATGATTTTTCCATCATTCAAGAATCTTTGCTTTGTACT
8181	47	39	MW2_CDS_03237	MW0595	FALSE	unmapped	AATGGTGCTGGTAAATCTTCCCTTATCAAGTCTTTAATTGGTGAATTTAATGCTACCGGT
8182	47	37	MW2_CDS_02739	MW0506	FALSE	unmapped	CATGGACCAGCAGCACTACTTTCAGCAGGGCTTAACAGAGAAAAATCTACATTAGAAGGA
8183	47	35	psma_tiling_047_R		FALSE	unmapped	ATATCTATGAGATTTTTATAACTTACTTACCAGTGAATTTCTCAATTAATCCTTTAATGA
8184	47	33	MW2_CDS_11013	MW2083	FALSE	unmapped	GATGGCATTATTTCTACTGTGAATTTAGACATCGACTCCCCCTATTTAACGGTAAACCCA
8185	47	31	agr_tiling 174_R		FALSE	unmapped	AGATTGTTTAGAAACTGCACATACACGCTTACAATTGTTGTCTAAAGATAATAGCGTTGA
8186	47	29	MW2_CDS_12502	MW2366	FALSE	unmapped	CCATTTGAACGTGGCGTAAGCAATGAGAAGTTTAAAGCGCAAGGTGGTACTCTGATTTAT
8187	47	27	MW2_CDS_05470	MW1013	FALSE	unmapped	CCGGCAAAGTACATTAAGAAAAATGGTAAATTGTATGTTCAAATAACTGTCAACCACAGT
8188	47	25	MW2_CDS_00835	MW0155	FALSE	unmapped	GCACACCAGAACGTAATGCAACGAACCCACCTCAAGAGTTATTGCAACAATTAGGATTTA
8189	47	23	MW2_CDS_05970	MW1110	FALSE	unmapped	GAACGAGACTTAGAAATGCGTGGTCCTGGAGATTTCTTTGGTGTTAAACAAAGTGGGTTG
8190	47	21	MW2_CDS_08184	MW1540	FALSE	unmapped	TGGCACAAAGTCATTTGCTAGCATTACGTTCAACTTGTCAAAGATTATCTGTAGGTGCAA
8191	47	19	MW2_CDS_07005	MW1308	FALSE	unmapped	ACGGACACCTTTGCGTTAAACAAACCTGCACAAGGTTTATTTGCGAAATTTGGATTTCAT
8192	47	17	perR_tiling_061_F		FALSE	unmapped	TAGAACTGCGAAGTTAGCAAAGGCTTTTAATATGAATTTAATTGGTCTGAGCAAGTCAGG
8193	47	15	MW2_CDS_08909	MW1672	FALSE	unmapped	AGGCCCTAAAACATCAAGTCCAAATGTCATTAAAGCATTAACGTCATCTGAAGACACTTT
8194	47	13	agr_tiling 158_F		FALSE	unmapped	GGCAATTTCCATAGGCTTTTCTTCTATCATTATATAATTTTTAATAATGGTAACCATGTT
8195	47	11	agr_tiling 205_F		FALSE	unmapped	TGCTACACTGTTTTTTAAAACAAAATAAGATTCACGGGGTAGGAAATTGTAGCATTTTAT
8196	47	9	MW2_CDS_01360	MW0250	FALSE	unmapped	ATGCACCAAGTGTAGCTGCAACCGTAACATTTATCGTCAGCATTGTATTGATGATCCTTG
8197	47	7	MW2_CDS_05483	MW1016	FALSE	unmapped	TAGTGGCTGATTTATTAGGACGAGTGATACAGCCTCCTCTAGAAATTCCAGCCAATGCTA
8198	47	5	MW2_CDS_11786	MW2234	FALSE	unmapped	GCACTCACAATTGCAGCTTACATAGGACCAATTTTGTTTGGTTATTATGAAATCGATAGT
8199	47	3	MW2_CDS_04423	MW0815	FALSE	unmapped	TGGTTTCACAACAGCACTTAGCATTGTGATTACATTCCACTTTGTAACATTTGGCTTTTT
8200	47	1	MW2_CDS_10917	MW2061	FALSE	unmapped	AGCATCAGGTGGCGTACGTAATTTAGAAGATTTCAATAAAATGGTTGAAGCAGGTGCGAC
8201	46	164	MW2_CDS_08880	MW1667	FALSE	unmapped	ACATGTTTCGGATGCTACTTTATTTAGTTTGAAGGGTGCATTATGGACGTTAGCGCAAGA
8202	46	162	MW2_CDS_07644	MW1443	FALSE	unmapped	AGCGGTGAAAATATGGTGCAGGGTCTAGCTTTACCTTCTAATTATTTAGGAAGAAAAATG
8203	46	160	MW2_CDS_01398	MW0256	FALSE	unmapped	TGGCACAAAACGTCAAGATAAAGGTAAAATTACTGTCGCATTAGATAAATATAGCGACGA
8204	46	158	MW2_CDS_11528	MW2185	FALSE	unmapped	ACGTTTTATAGAAGCAGAAAGGGAGTTAAGTCAGTTAAAGCACTGGTTAAAAACAACACA
8205	46	156	MW2_CDS_07174	MW1341	FALSE	unmapped	ATTTGCCAAAAATAAGACATTAGGTTCTAGTGAAGCAAAGCCCTACTTGGATGAATACCA
8206	46	154	agr_tiling 077_R		FALSE	unmapped	ACACTTTTTGTAAAAGAACCATATACCCAATTTATTCAACTGGGTATTATTATACAAGCT
8207	46	152	MW2_CDS_01555	MW0285	FALSE	unmapped	GGCTTACTGTTAACAGGCGTTACAGGTGCATTTTTACCTGATGCAGTACCTGTCAAATTC
8208	46	150	MW2_CDS_10145	MW1909	FALSE	unmapped	AGTTTTTATAGTGACTTTGTTAAAGCAAGTTTGATTTTAGAGCGCGAAGACTTGATTTTA
8209	46	148	MW2_CDS_11773	MW2232	FALSE	unmapped	GTAAACATGGACATTGGCATGCAGTCATTTATGACATTGCTCAAGACAAAACTGCCGAAC
8210	46	146	MW2_CDS_02395	MW0443	FALSE	unmapped	TCTGAAGCATTGAAGCGTGAATATGAAATTAAAACTTATACCAGACAAAAGAAATTGCGA
8211	46	144	MW2_CDS_08344	MW1569	FALSE	unmapped	GCACAATTGATATTTGTAGGTGATGAGGACCAATTGCCTTCTGTAGGTCCTGGTCAAGTA
8212	46	142	MW2_CDS_02348	MW0434	FALSE	unmapped	AGCTGATGAGCTTACTCAAGAACGTTTAGGTAAACATACTCAAGGCTTAAACATCCCTGG
8213	46	140	MW2_CDS_06707	MW1253	FALSE	unmapped	GGTATTTCAGTAGGTGATTTTGTTAGCTTTGATCCACGTACAGTTATCACGTCATCAGGT
8214	46	138	MW2_CDS_01898	MW0347	FALSE	unmapped	ACTCCAAAAGATGAAACAAAATCAACAGAGTCAAATACTAATCAAGACACTAATACAACA
8215	46	136	MW2_CDS_10752	MW2031	FALSE	unmapped	CAGGTCCTAACTTTCATCGTGTTACTTGCGTTACTTAAAAAGTTCGCATGGGGTCCATTG
8216	46	134	MW2_CDS_00675	MW0126	FALSE	unmapped	GGTGTTACAGAAATCATTGTAACATCACATCACTTACATCCTCGATATACCACACCTATA
8217	46	132	MW2_CDS_05294	MW0980	FALSE	unmapped	TGGAATATGAGTATCCAATTGATTTAGACTGGAGTAATGAAGAGATGATTTCAGTGATAA
8218	46	130	MW2_CDS_00080	MW0015	FALSE	unmapped	ACGAATGTACCTGTTAAATTAGATAAAGAAGTTGAAGGTACAATTCGCGTACACACAGTT
8219	46	128	ETG05_66023		pos		
8220	46	126	MW2_CDS_03781	MW0691	FALSE	unmapped	GCCATTGATCATATGGTACTTAGTGATGCCGATTCATTAATGAAACTCAATCCTTTCTGG
8221	46	124	MW2_CDS_11719	MW2221	FALSE	unmapped	ATTTGGTCTATCGTTTTAGTCGTTATCACTTTAATAGGCGTTTTCCTAATTGCTACCGAT
8222	46	122	MW2_CDS_00705	MW0131	FALSE	unmapped	TTTTCTGGCGGCTTTGACTTGAAAGAAACACCGAAATATTTAAATGAAATTGATATACTT
8223	46	120	MW2_CDS_05355	MW0991	FALSE	unmapped	AGCTGTTGTTTTCTTAGTATTATTTAGTTTTGCTGTTGGTGCATCAAATGTACCAATGAT
8224	46	118	MW2_CDS_01719	MW0313	FALSE	unmapped	ATTCAAAGGTCGTCGAGGACCTGCAGGTTTCTTCTTTATGTTAGGTGTCACAGTATTTGT
8225	46	116	MW2_CDS_10942	MW2065	FALSE	unmapped	TCTGTCGTTGGAATTGGAGAAGTATCAAAGCATATTCATGAAAAACCACCAATTCCTGGT
8226	46	114	MW2_CDS_04934	MW0910	FALSE	unmapped	ATGTGGGGCGAACACCAAGAATACTGGTATTTATATACAGGTATAATGCTAATTGCTGGT
8227	46	112	MW2_CDS_09289	MW1743	FALSE	unmapped	AGTTCCAATGCAAAGTAATGCTTTTTCAATAATTATATATTCATCAATTTTTGCTGTGTT
8228	46	110	MW2_CDS_03925	MW0717	FALSE	unmapped	AGTATAGGAAGTTTATGGGGCAATGCAAATAACTGGAATTACGCAGCAAAAGTTGCAGGA
8229	46	108	MW2_CDS_02725	MW0503	FALSE	unmapped	TACTTACATTCCAACTCCAGAACGTGATTCTGACAAACCATTCATGATGCCAGTTGAGGA
8230	46	106	MW2_CDS_02855	MW0525	FALSE	unmapped	AATGCAGATGATCCAGTAGAAGCTGCAAAACAATGTCGCGCTGCAATCGAAGGTAAGTAA
8231	46	104	MW2_CDS_05346	MW0989	FALSE	unmapped	ACCACAACTCCATGAATTAGGAGAATATTTTAGTGACTTCTTTACAAGTCAAACTGGTGA
8232	46	102	MW2_CDS_07755	MW1462	FALSE	unmapped	AAAGATGTAATGACAGCAACATTCAATGATTCTTATTTAACCGAAATTGCGTCACCACCT
8233	46	100	MW2_CDS_02704	MW0499	FALSE	unmapped	AGTTGCACGCTTTAACAAACAACATTTTGTAGTTGGTCTTAAAGAAACGCTTAAAGCGTT
8234	46	98	(+)E1A_r60_a22		pos		
8235	46	96	MW2_CDS_11227	MW2120	FALSE	unmapped	TCAAAAGGACATGAAGTCATTGACGTAGGAACATACGATTTCACAAGAACACATTATCCA
8236	46	94	MW2_CDS_07998	MW1507	FALSE	unmapped	ACTGCTTACCAAGAAATTGCTATTCCAATTATAATGAGTGCTGGTATCGCCTTGAGTGCA
8237	46	92	MW2_CDS_10408	MW1966	FALSE	unmapped	CCAATGCGCGATGGAAGAGATACAACAGATGCTTAAAAAGCAAGATATGCCATATAGCGT
8238	46	90	(-)3xSLv1		neg		
8239	46	88	MW2_CDS_04689	MW0866	FALSE	unmapped	GATGCAGATGCAATGATTACTGGTGGTACAGAAGCACCAATTACTCATATGGCAATTGCT
8240	46	86	MW2_CDS_07650	MW1444	FALSE	unmapped	GAAGGTATGCAACAAGCTAGAAAAGAGTTAGATTATACTGCCAATACTGATGCAGTTTCT
8241	46	84	MW2_CDS_11789	MW2235	FALSE	unmapped	ACACTACTTAATAAACGTCCCCTCCGACAAGTCGACTATGGTAACAAAATTCAATATCTT
8242	46	82	MW2_CDS_08616	MW1622	FALSE	unmapped	AGCAGCTCGTCAACATGAAATGAGCTACTCACGTTTAATGAACGGTTTGAAAAAAGCTGG
8243	46	80	MW2_CDS_01891	MW0346	FALSE	unmapped	AAAGAAGGGAAAGAGACGCAATTAATGTATACTGCTACATTTGATGTTAAACCGCATAGA
8244	46	78	MW2_CDS_11687	MW2215	FALSE	unmapped	AGATGAAAGGCGTGTTATTGTAACAATCAAGCGAGAAAAGTTTTCTAAAGTCACTATGCT
8245	46	76	MW2_CDS_07056	MW1318	FALSE	unmapped	GCAAGACCAGCTGCAGTAGCAGTTGCAACACAAAATGAACATAGACCTACAAATACAGTT
8246	46	74	MW2_CDS_10324	MW1949	FALSE	unmapped	TATTGGTGAATGGGACGGAGGTGATGAGGGGTTAGATAAGGCAGTGAAAGATGTATCTAA
8247	46	72	MW2_CDS_12050	MW2282	FALSE	unmapped	TATAGCTAGCCATTTACAAACAGAGCACATTGATGCATACACACAACCAAGTGGTGAAGC
8248	46	70	MW2_CDS_10188	MW1921	FALSE	unmapped	AGATGATAATCAACAAGATTTATACCAACAACAAGCGCAACAAACACGTGGACAATCGCA
8249	46	68	MW2_CDS_08744	MW1644	FALSE	unmapped	GGTGGTGCACGTATGCAAGAAGGTATTATTTCCTTGATGCAAATGGGTAAAACCAGTGTA
8250	46	66	MW2_CDS_05284	MW0978	FALSE	unmapped	AAGATGTAGATGCATACTTAAATGGTGGTGCACCAACAGCTTCAAATGAATCAGCTGCTT
8251	46	64	MW2_CDS_04743	MW0875	FALSE	unmapped	TTATAAATATGCACATGAATTTTCAGGTGGACAGAGACAAAGAGTGGGAATTGCAAGAGC
8252	46	62	MW2_CDS_02057	MW0381	FALSE	unmapped	AACGTATTCCAGAAGTGGAAAATTTAGTATATGCGGCAAAGCAAAGTGGCGTTGCTCATA
8253	46	60	MW2_CDS_10935	MW2064	FALSE	unmapped	ACAGAAAGGTGATTGTATATATTTTGAATCGCAGGCGATTATTAAACTAATCACAGCACT
8254	46	58	MW2_CDS_09015	MW1691	FALSE	unmapped	AACGTATCATACGTTTTTAGCGTTGTATCAACAAATCTTAAATGATGAAGGAGATTTACA
8255	46	56	MW2_CDS_01162	MW0213	FALSE	unmapped	AGACAAGGTATTGCAGATCATATTTATCAAGGTTATGCGAAACCTGCAACGAGTCCATTT
8256	46	54	MW2_CDS_03126	MW0574	FALSE	unmapped	AGTCATTACGTCGGTATTGAGCCAAGGCTATCCAGTTAGAATCTTAATATTAAGTGGTTT
8257	46	52	MW2_CDS_04816	MW0888	FALSE	unmapped	TCAGTTGGTGGTGATGGTACATTACTACAAGCATTCCATCAGTATAGCCACATGTTATCA
8258	46	50	MW2_CDS_06814	MW1272	FALSE	unmapped	GCGATGGATTGATTTTGCACAAAATAAAGGTAAAGATACAGGCGCATTTTGTGCAAGTCC
8259	46	48	MW2_CDS_10235	MW1932	FALSE	unmapped	GAGTATTTCATCCAAGTAGAGAAAGCATGGAACAGTCCAGAAATGATTATGCAACGTGCT
8260	46	46	MW2_CDS_02217	MW0409	FALSE	unmapped	ACAAGGTATCTTAACGCCAGCAGAATATCGTGTGTGTAGTACGAATGAAGGATTACTAAA
8261	46	44	MW2_CDS_05391	MW0999	FALSE	unmapped	GTTTTCCTGGAGCAGTACCACCACTAATTGGATGGGTTGCAATTGAAGGACAAATTAGTT
8262	46	42	MW2_CDS_03565	MW0653	FALSE	unmapped	TTGGCGCGTTATGATGAAGATGAGGCAAACTATGAAGCATTTATACGTGAACTCATTTTT
8263	46	40	MW2_CDS_00057	MW0010	FALSE	unmapped	CTAGCAATATTAATTGCAGCCACAATTTCAGCAGCGTTAGGAGTGATGATGGAACGATGA
8264	46	38	MW2_CDS_13281	MW2514	FALSE	unmapped	TACGCGTATCACATCGTGAATTAGATCAAGAAAAATCCACAATTGCGCAACCTTGGCATA
8265	46	36	MW2_CDS_07064	MW1319	FALSE	unmapped	TTTATATAAGGGGCTTCGTGATAAAAGTCCTGCTGTAAGAAGAACAGCAGGGGATTGCAT
8266	46	34	MW2_CDS_09728	MW1826	FALSE	unmapped	GGAAAATAATACCATTGTTGTTAGACACATTTTAGGTAAAGTGCAGGTTATATTGCCGGT
8267	46	32	MW2_CDS_06515	MW1215	FALSE	unmapped	TGCCACCACATTTTGAAATAAAGACAGATAAAACACGGGAAATGATGGATTCAGATGCAG
8268	46	30	RC9		pos		
8269	46	28	MW2_CDS_07403	MW1384	FALSE	unmapped	ACGAAAAATGGTTGCTAGTATGCAGAAACAAGTTGTTCAAAGTACAAAGTTATCGATGCA
8270	46	26	perR_tiling_001_F		FALSE	unmapped	ACGGAAGTGGTATTAACTAATAACTAGTATCCTTTATAAATAAACATAAAAATATTCAAA
8271	46	24	MW2_CDS_11608	MW2199	FALSE	unmapped	TCAGTTTAGTTTGCCATTTGGAAAAGACTATGCAGATGCACATGAAGAAATGGTAAGGGA
8272	46	22	MW2_CDS_05659	MW1051	FALSE	unmapped	AATCCAAAAGGAAGCGTGCTTATAACATCATTAAATGAATTAGATGCTGCCTTAGAGGGT
8273	46	20	MW2_CDS_09772	MW1835	FALSE	unmapped	GGTCATCATGATGCATTGAATGATGCCAAAGCATGCGCAATGATTACTTTTAGGCTACTG
8274	46	18	MW2_CDS_06253	MW1161	FALSE	unmapped	GGACAAAGTGGATATGCTGCTTTTGTTGTATTTAACATGATGTTTGGAGGAGATCCTTCA
8275	46	16	MW2_CDS_00275	MW0053	FALSE	unmapped	TGTAGAGAACAAGGGTATTGGTAGTCATTTGCTTGATTATGCTGAAATAATTGCCTCAGA
8276	46	14	MW2_CDS_06318	MW1173	FALSE	unmapped	TGGTTTGACAAAGGGACAAACATCGCCGTCATCAGCAGTAGGATTTGTTACTAAAACAAC
8277	46	12	MW2_CDS_06472	MW1207	FALSE	unmapped	GGAATTGCCGGAAGATGTTAAACCTAAATTTTATAAAGAGTATATGTATAGTATGACGGT
8278	46	10	MW2_CDS_03962	MW0723	FALSE	unmapped	ATCGCGGCACGAATCTATTTTGTGATTTTCCAATGGCCATATTACGTGGAAAATCCAAGT
8279	46	8	MW2_CDS_07447	MW1392	FALSE	unmapped	AGCGGATACAACTTATCCAAAAGGTACTTACCAAGTGGCATGGGAAGAAAATGGTAAAGA
8280	46	6	MW2_CDS_03236	MW0595	FALSE	unmapped	AGTGTGGAACAAGTGATTTTATCAGGTTGCTACAAAGAAATTGGATGGTTTAGACGACCT
8281	46	4	MW2_CDS_13676	MW2584	FALSE	unmapped	TGCTCATGACATGCCTAAAATTATGAGTGTTGATAATGTTACGATACTTTCCTCAGCACA
8282	46	2	MW2_CDS_00416	MW0079	FALSE	unmapped	ACACCTTCTACAGATACAGCTATTTCGAATGCACCGTTAGATAAAGTTGGCGTTGCTTCA
8283	46	163	MW2_CDS_07908	MW1490	FALSE	unmapped	GAGTTCACATGTTTGCAAGAATGTATTAACACTGCAGATATAATTGCTACTGGTGGTGGT
8284	46	161	MW2_CDS_05509	MW1021	FALSE	unmapped	GGTGCTGATCGTGAAATTCGTTTACGTCCAAGTTACTTCCCATTCACTGAACCTTCTGTA
8285	46	159	MW2_CDS_12370	MW2342	FALSE	unmapped	AGATGCCCTAGTTGTTAAGATGCAAGGCTTCATCAGCTCTAGAACAACATATTCAGACTT
8286	46	157	MW2_CDS_04746	MW0876	FALSE	unmapped	ATGGGTCAATCATGTTATACATGGTGATTTAGGGGAGTCAATCAAATATAAAAGGCCGGT
8287	46	155	MW2_CDS_02326	MW0429	FALSE	unmapped	GTGTTGTGATTCAAACAGGCACAGTGGAAAATAATACGATAAGCGGGTTTGGTGCAATTG
8288	46	153	MW2_CDS_00337	MW0065	FALSE	unmapped	TGCATGCAATGCAATATCATGTTAAGTTGCCTAGTGATTACAATATGGAAATAATTAGAG
8289	46	151	MW2_CDS_00541	MW0102	FALSE	unmapped	TTTGCTTCGTCAGCAGCTGTTTATGGTGATCTTCCTGATTTGCCTAAAAGTGATCAATCA
8290	46	149	agr_tiling 016_F		FALSE	unmapped	AGCCCCTCCCAAGCTCGCGGCCTTTTTATTGTAATAAAGAAGGGAAGAGTTAATCCTCAT
8291	46	147	MW2_CDS_05879	MW1094	FALSE	unmapped	AGATAAACGCGCATTGGTTACAGCAGGACCAACTATTGAAGTTATCGATCCAGTCAGATT
8292	46	145	MW2_CDS_02493	MW0460	FALSE	unmapped	GGCGAAAGATGCTGAAGGTAAACAGCCAAGAGTTAAATTTGAAAAAGTATTTGCAGAGCA
8293	46	143	MW2_CDS_08349	MW1570	FALSE	unmapped	TGGAAAAATAGAAGAAGCGTTACAAGCATTGTTCGGAAATATCGAAGAAAATCCTACAAT
8294	46	141	MW2_CDS_02115	MW0390	FALSE	unmapped	AGAAAGTTTTGAACCAACAAATATTAGTGTTAAAAGCGAAGATTACTATGGCTCTAACGT
8295	46	139	NC_S_027		FALSE	unmapped	TGGCACAAGATATCATTTCAACAATCAGTGACTTAGTAAAATGGATTATCGACACAGTGA
8296	46	137	MW2_CDS_08894	MW1669	FALSE	unmapped	TTAGTTAAAATGTCAAAATCATTATACGTAATCGGTAAAGATAATATTCCTAAGGATAGT
8297	46	135	MW2_CDS_09603	MW1803	FALSE	unmapped	TGTTGCAAAAAGGAGAACAATTTCCAATATTTAAATTAGAAAATCAAGACGGAACTGTCA
8298	46	133	MW2_CDS_06582	MW1229	FALSE	unmapped	TGCAACGTTCATCTTCACACATGATTCAATTGCAGTAGGTGAAGATGGTCCTACTCATGA
8299	46	131	MW2_CDS_04189	MW0766	FALSE	unmapped	GTTGTTGAATTTGAAGAAACGTCTGCTTTACCTGGTAGAAAATCAGGATCACTGGTTGGT
8300	46	129	MW2_CDS_00128	MW0023	FALSE	unmapped	GCATCAGGTGGAGACGGATATAGTATGTTCGGTGGCCCTAGAGAAGAAGGTATTTCATTA
8301	46	127	MW2_CDS_05453	MW1011	FALSE	unmapped	CCAAGTGTTGAAAAAGAAAATGACGCATCTAGTGAGTCAGGTAAAGACAAAACGCCTGCT
8302	46	125	MW2_CDS_01608	MW0294	FALSE	unmapped	CAACGGATCAATCGCGTAATACCGACCATCAATTTATCAACACACAAATTGCGACACTCT
8303	46	123	MW2_CDS_04150	MW0760	FALSE	unmapped	AGGTAAAGAATACGGCACTTCTTCAAAATTTTATAGCGGTTTTGATAAGGGGAGTGTAGT
8304	46	121	RC9		pos		
8305	46	119	MW2_CDS_13283	MW2514	FALSE	unmapped	TGCATGGACGTAAAGAGTGGGAAAGTTACTACGCTAGAGAAAATCTCGAACGCCAAAAAT
8306	46	117	MW2_CDS_06222	MW1155	FALSE	unmapped	AGTGATGATTATTTGTTACCTCGTAAAGGTGTTTATGCTGTTAGTATTGAAATCGGCACT
8307	46	115	MW2_CDS_09527	MW1789	FALSE	unmapped	GGCACATTATCCGGATATTAAAGTTTTGGTATTAACAAGTTATGTTGATGATGAACATGT
8308	46	113	MW2_CDS_09281	MW1741	FALSE	unmapped	AGCACGTGCCTATTTGCCTAGAATATTAGTAGAGAAACTACTCATTAAAATTGACGATAT
8309	46	111	MW2_CDS_01191	MW0219	FALSE	unmapped	GGCATTGATTCGTGAGCCAAGAATCGCTGAGCATATTGAATCTATTACTTTGATGGGTGG
8310	46	109	MW2_CDS_06261	MW1162	FALSE	unmapped	TTGTTGTTGGCGATGTGGATCCTGAAGCAATATGTCGAATAGTAAAACAACACGAGGATG
8311	46	107	agr_tiling 010_R		FALSE	unmapped	TAACTCAGTAAGAATCCATTTCGCCCTTTGCAAATGAATGATTTTCTTAATTAAATTGAT
8312	46	105	MW2_CDS_03574	MW0655	FALSE	unmapped	TGAGCTTAGTCTATTATTACGATTATTCAAACCGAATAAAAAGTATGAATGGCCACTCTT
8313	46	103	NC_S_017		FALSE	unmapped	CCCCTTTGTTTGAAGTGAAAAATTTCTCCCATCCCCTTTGTTTAGCGTCGTGTATTCAGA
8314	46	101	MW2_CDS_05565	MW1031	FALSE	unmapped	TAAACTGCGACTAATGAGTGAATCAGCACGTGGTGAAGGTGGACGAATTTGGACATATAA
8315	46	99	MW2_CDS_02394	MW0442	FALSE	unmapped	AATGATGATGTTTTTTCGTTTTCAACGGATGCTTTGTTGTTAGGGCATTTTACAAAACCT
8316	46	97	NC_S_023		FALSE	unmapped	ACAGCGATTCGATAAAATATGTCAGTTAAAATTAATAATTGCATTATTTCTTAACAAAAA
8317	46	95	MW2_CDS_02427	MW0448	FALSE	unmapped	GGGGTCATTGACAGAACAATTGGCTAGACATGCTAAAAGAGTATTGGCATTTGAAATTGA
8318	46	93	MW2_CDS_12033	MW2279	FALSE	unmapped	TCAGTCACCTATTGTGAAAGGTTTGTCTATGTGGTTAGCTATATTATGTCTTTCCCTGTT
8319	46	91	MW2_CDS_11341	MW2144	FALSE	unmapped	GTAGCACACATCCGTTCAACATTCAACAACACTATTGTAACTATCACTGATGAGTTCGGT
8320	46	89	MW2_CDS_00987	MW0183	FALSE	unmapped	GTGTTTGCAATTCCATCATTATTGTTAGCGGTGGCAATTATTGCATCATTTGGAGCAAGT
8321	46	87	MW2_CDS_02612	MW0482	FALSE	unmapped	ACAAATTGTTGCAGATTCAAATGACAGTGTTAAACGTGAAAAGGGTAAAAGAGGCTTAGA
8322	46	85	MW2_CDS_13839	MW2612	FALSE	unmapped	CAACAGACATCAACGGTACAACAATAACGAACAAGTATACACCAGGAGAGACATCGGCAA
8323	46	83	perR_tiling_018_F		FALSE	unmapped	GTCGATTCGACTTTAATACACATAATCATTATCATATTATATGTGAACAATGTGGTAAGA
8324	46	81	MW2_CDS_03542	MW0649	FALSE	unmapped	ACCGGAATCTGTTCTACGTTTGAAAGGTTATGTGTCATTTAGAGATCAACCAAATGCAAT
8325	46	79	MW2_CDS_08216	MW1545	FALSE	unmapped	TTGTACTTTGTTATTGGGACGGATCAGTATAACCAACTAGAGAAATGGTATCAAATTGAA
8326	46	77	MW2_CDS_06101	MW1134	FALSE	unmapped	GGTTCAATTAAGACAAGATGATGCTGCTGGCACACTCTACAATATTGTCGGCTTCCAAAC
8327	46	75	MW2_CDS_01855	MW0337	FALSE	unmapped	ATGATTGAACAGGGATTTAAGATTCAAAATAAGAGTAAAAAGAGTAACAAAAAGCGCTCT
8328	46	73	MW2_CDS_12111	MW2292	FALSE	unmapped	TCTACACCTTACAGATCATTGCCTAAAATTGAAAAAATAGAGCATTATCATATATTCGGA
8329	46	71	MW2_CDS_11156	MW2108	FALSE	unmapped	ATTGCTGGTATCGCTGCACGTGAAGTTAAAGGTATCTTAGACATGAAAGGTGGCTTAACT
8330	46	69	MW2_CDS_00222	MW0042	FALSE	unmapped	TGAAGAACAATTGAAATCACTACTCGCGATAAAGAAAGTAGATGCACATATGAGTTATGA
8331	46	67	MW2_CDS_13159	MW2490	FALSE	unmapped	CGCTCGTGAATCAAATGGTCAAGTAAATGCTTACAACCCATCAGGTGCTTCAGGTTTATT
8332	46	65	MW2_CDS_01378	MW0253	FALSE	unmapped	CGGCGAAAAATGGAATCAAAGACAAATCCAAAATCACATCGGTTATGTGCCACAAGACAT
8333	46	63	MW2_CDS_00932	MW0171	FALSE	unmapped	AGGGGTTAAAACCTGGAGACAAGTTAATTAAACAACCTAAAAGTACAATGAATGATGGTG
8334	46	61	RC6		pos		
8335	46	59	MW2_CDS_07216	MW1348	FALSE	unmapped	TGGCATTGAAAAAAGTGATATTGTGACAAGTGTGAGTAAATCTTTAGCACAAGAAACACA
8336	46	57	MW2_CDS_04712	MW0870	FALSE	unmapped	TCATTGCTGATGAACCAACGACTGCATTAGACGTAACGATGCAGGCACAAATTTTAGATT
8337	46	55	MW2_CDS_11787	MW2234	FALSE	unmapped	GTTTTCACTTATTTAAAATCTGGAAGAAACCTAGGTTCAACAATTGCATTACATATAGCA
8338	46	53	MW2_CDS_13135	MW2486	FALSE	unmapped	TGGTCATCAGCTTAATCAAAATATATATGATCAGCGTCATTTAATGACAATCAATACTGA
8339	46	51	MW2_CDS_13474	MW2549	FALSE	unmapped	TTTATCAATAAATTACCTGGTATTACTATTAAATCATTACTAGAAATATTAGAAATTTCT
8340	46	49	MW2_CDS_00971	MW0180	FALSE	unmapped	TGTCGACTTTTAGATTATCTTTCAATAAGCTCTTTTATTGTGGTTTCTCTCCAAATATCT
8341	46	47	MW2_CDS_07309	MW1365	FALSE	unmapped	AGAGTCATTTTAAGCCGTAAAGCAGTTGAACAAGAAGAAAACGATGCTAAAAAAGATCAA
8342	46	45	MW2_CDS_07117	MW1329	FALSE	unmapped	TGATATGTTTGATGGTTATAAGCAAAATCGTTCTGCACCACCAGAAGAATTGATACCACA
8343	46	43	MW2_CDS_04332	MW0797	FALSE	unmapped	ACTCCATTAATTGCTCAAGCAATTGGGCTTGCAGAAGCTATTCGCTATTTAGAACGCATA
8344	46	41	psma_tiling_035_R		FALSE	unmapped	ATTCAATTCGCTTAAATTATTTTGCGAAAATGTCGATAATTGCTTTGATGATTTTAATGA
8345	46	39	MW2_CDS_09725	MW1826	FALSE	unmapped	TGCGACGGATGAGGTTATGACTTCACCATCTTTTATTAAACAAAAGTGGTTTGGTGAGCA
8346	46	37	MW2_CDS_08930	MW1676	FALSE	unmapped	ATATGATTGTTAACTATCCAACGATGGACGTCAAGCTTGGCTCAATGGGCAAACCATTAC
8347	46	35	MW2_CDS_10971	MW2071	FALSE	unmapped	AGTTGTCACTGAACCAAAAAATACAAAAGTAGAAAATGATAAAGTGACAACATCTGTTGA
8348	46	33	MW2_CDS_03044	MW0560	FALSE	unmapped	GAAGACAGCTAAAATCAATTCTTTTTGGCCAGTGGCAGGAAGTACGGTCTTATTTGGTGT
8349	46	31	MW2_CDS_10723	MW2026	FALSE	unmapped	TACTGATATTCATAGAGCCGAAAGAGCTTTAGAGAGAGCAAATAACCGTTTGCGTGTGGC
8350	46	29	MW2_CDS_09637	MW1809	FALSE	unmapped	TGTGGCAATTGCACATGTAACAAACGATAATGTCATAGACCACTCTTATATTGGCTGGGT
8351	46	27	MW2_CDS_06508	MW1214	FALSE	unmapped	ATATAGTTACATTTCCACGTGGCGGATCAGATATAACTGGCGCCATCATATCAAGTGGTG
8352	46	25	MW2_CDS_07800	MW1470	FALSE	unmapped	CCCCATGCTGTTGGTGCTGCTTTAGCTTTAAAAATGGATGGTAAGAAGAAAATTGCAACA
8353	46	23	MW2_CDS_02820	MW0519	FALSE	unmapped	TCAATTGCTCGCCTCGTTGAAAATAAACAAATTAAACATCAAGTTGAAGTGATCAAGCAA
8354	46	21	MW2_CDS_04781	MW0882	FALSE	unmapped	ACTGGTTACAGTGCAGCTCAAAGCTTAAGTCATCAAATTTTAACAGAAGGTAAGCCAGCA
8355	46	19	MW2_CDS_12938	MW2448	FALSE	unmapped	CCAGGACCAGCAACACCTGAACAATTAAATAGAGGTGTAAGCTTTGCAGAAGAAAACGAA
8356	46	17	MW2_CDS_07129	MW1331	FALSE	unmapped	GGTCGTTGAACAGGCGCAAAAAGCTGGTATTAAAAAGCCGTTTTCAATCGTATATCCAAG
8357	46	15	MW2_CDS_08732	MW1642	FALSE	unmapped	TTCAGCGTGGAGGTACATTCTTGTATTCAGCAAGATGTCCAGAGTTTAAGGAGCAAGAAG
8358	46	13	MW2_CDS_00223	MW0042	FALSE	unmapped	TCAATTGATTAGTTATGTTGCATTAGAACAGGAATATGCTTGGGCTTTTTTAAATGAACT
8359	46	11	MW2_CDS_10149	MW1910	FALSE	unmapped	TGAAGCGATGTGGTCATCCAACATGTAATGTATTGATTAATCATAATGAAAGTTATTGTG
8360	46	9	MW2_CDS_04556	MW0841	FALSE	unmapped	AGCTGATATGTTACGATTAAATAAATATGGCGTTGATGGTGTCTTTACAAATTTCGCTGA
8361	46	7	MW2_CDS_05696	MW1060	FALSE	unmapped	TTGCTTGATGATGCTTTTAGAGCAACACAACAACGTACTCAAAATCAAGGCTTGAATGCG
8362	46	5	MW2_CDS_11402	MW2159	FALSE	unmapped	ATGTACTGTTAAAAATGCAACACCAGGTGGCGTTGTTAAAAAAGGTGACGTTGTCAAAGC
8363	46	3	MW2_CDS_08837	MW1659	FALSE	unmapped	TTCAACTTCTGGTTCACCATTCGTTTTAAATATTAGTTTTCCTGGCGTAAAAGGTGAAGT
8364	46	1	MW2_CDS_11168	MW2110	FALSE	unmapped	GGCTTATTAATAGTAGTAATCGTGGGGTTCCTGTTATTCATGTATATCCAAGATGGACGT
8365	45	164	MW2_CDS_05568	MW1032	FALSE	unmapped	ATAATAAATTCGTTGGTGCGCAAGCAATCTCGCAAGTTCGTTTGTTTAATTTGCACCCAA
8366	45	162	MW2_CDS_05075	MW0939	FALSE	unmapped	CCAAAAAGCACAGGAAGTTGATTCTATTGATAAACTTGATAACGTGATTCAAATTGTAGG
8367	45	160	MW2_CDS_12601	MW2384	FALSE	unmapped	TGGGTTAGTAGCTGTATTCACTCAACAAGCCCCATGGGGTTTCTCTTTTCCTATTTCAAT
8368	45	158	MW2_CDS_05910	MW1099	FALSE	unmapped	AAACCAGGAAGACAAGTGTTTAATCAAATTCGTGGATTATCACCATGGCCAGTTGCTTAT
8369	45	156	MW2_CDS_10367	MW1957	FALSE	unmapped	GGGCTTATTTAAAAAAGATAAAAAAGCAATGACTTTTGACAATGCAATGGAAGAAAGACG
8370	45	154	MW2_CDS_04905	MW0904	FALSE	unmapped	TCATGGGTATTTTAATGTTTATAGGATCTTCGCCAAGTTCGGTTGGTGGCGGTATTCGTA
8371	45	152	MW2_CDS_07359	MW1374	FALSE	unmapped	CGAGTATTCCATTTGACAAATCAATTATTGACAGTGATAGCTCATTAAGAAGTGAGGATA
8372	45	150	MW2_CDS_01863	MW0339	FALSE	unmapped	ACTAGCGGACTTAGAATCTGTTGAGAAACGTTTGCCTAGAATTGAAAAATTAGCACGTCA
8373	45	148	MW2_CDS_03942	MW0720	FALSE	unmapped	ACTTGTGTATGTATCTGCAACGCCTGGACCATACGAAATTGAACATACGGATAAGATGGT
8374	45	146	MW2_CDS_08668	MW1631	FALSE	unmapped	GACGAAGTGTGGGTTGTATACACTTCTGAAAGTATACAAATGGATCGTTTAATGCAACGT
8375	45	144	MW2_CDS_07224	MW1350	FALSE	unmapped	AGAAAGTTGTTTCACTATCTCCTGCAAACTATGACAGACCATCAGTTGCTGGAACTGCAA
8376	45	142	MW2_CDS_08707	MW1638	FALSE	unmapped	AGTTGGTGGTATTGGTATTGCGCCAGGTGCAAACATTAATTATGAAACAGGTCATGCTAT
8377	45	140	MW2_CDS_05738	MW1068	FALSE	unmapped	AGAATTCACACGCCATCACAAATGGGAATTAGAAAACCTGAATTTTCTTCAGCAATTTCT
8378	45	138	MW2_CDS_02920	MW0538	FALSE	unmapped	ATCAGTATGGGAAAAAGCAACGACGTATCAAATGTACCATGGCTTAGCATTATTAATTAT
8379	45	136	MW2_CDS_05030	MW0931	FALSE	unmapped	TTCAAAATTAGAGAACAACAATTCGATAACTCATGGTGTGCAGGATTTAGTATGGCAGCA
8380	45	134	MW2_CDS_03202	MW0589	FALSE	unmapped	ACTCCAGGGTCTACAGTAATACGAATTTCTCAAGACTCTAAAAAGTTTTTTATTCATAGT
8381	45	132	MW2_CDS_11909	MW2257	FALSE	unmapped	TGGTTATCTTCAACTGGTTTCACTGGTGATGAACAGGCTTATAAAGATCATGGTGGACCA
8382	45	130	MW2_CDS_04039	MW0736	FALSE	unmapped	GTGCTCAAAATACGTATTTCGAAGATAATGGTGCGTTCACAGGTGAAACGTCTCCAGTTG
8383	45	128	MW2_CDS_09333	MW1753	FALSE	unmapped	TGGCGGTATTGGAAAAATTGGTTCTGAATATAATGGTGCCGTATACTTTACGCCTCAAAT
8384	45	126	MW2_CDS_06259	MW1162	FALSE	unmapped	TCAATCACCAAGACTAATGCTTGGTTTTAAAAATAAACCATTACAAGAAGCGCCTCAAAA
8385	45	124	MW2_CDS_01673	MW0305	FALSE	unmapped	AATATGTCTTGAGTGTAGCATCTCCGGTGTTTTTCGGTAAAACAGACGATGCAGAAGTGA
8386	45	122	MW2_CDS_01424	MW0262	FALSE	unmapped	ACGGAGATTTATCGAATGATAAACGTTCTGAAGAAACGAAAAAGTATAACGATAAATTGC
8387	45	120	MW2_CDS_02709	MW0500	FALSE	unmapped	ACCAATTAGTACGTAAACCAAGACAAAGCAAAATCAAAAAATCAGATTCTCCAGCTTTAA
8388	45	118	MW2_CDS_01623	MW0296	FALSE	unmapped	TTTGTCGTCGGTGTAGTAAGCGTATCAGCCATTATCTTTTTCTCAGCATTAGTGCCATGT
8389	45	116	MW2_CDS_07771	MW1465	FALSE	unmapped	ACTACGGTTGTAGGTGCACCGACGCAAATGTTAATTTCAGCTAAAATTTTTGGCAAAACG
8390	45	114	MW2_CDS_01478	MW0272	FALSE	unmapped	AGATTAGCAGCATGATACCGGTAGAGTGGGCAAAGGTATATGCAATGGCATATATCGATG
8391	45	112	MW2_CDS_03616	MW0662	FALSE	unmapped	TGCCCGTGATGGTCAAAGAAAAGGTAACTCAAATGACAGTCAAGAAAAATTAAGCCCAGG
8392	45	110	MW2_CDS_12441	MW2356	FALSE	unmapped	CGTTATTACTGGAGAAGGACGCATGGATTATCAGACCATCTTTGGTAAAACACCCGTAGG
8393	45	108	MW2_CDS_02822	MW0520	FALSE	unmapped	ATTCCTGTCGGCTATAGTGAAACAATTGATACACCAGTCCAAACATTAGATCAGCGCAGT
8394	45	106	MW2_CDS_01315	MW0241	FALSE	unmapped	TGGCGTGAATACAGTTGACTTGGAAGGTAAAGGGTTCAAGTGCTTTGTAAAGCAAAATGA
8395	45	104	MW2_CDS_13541	MW2561	FALSE	unmapped	ACAATCACATGTGCTTATTTTTCGCACAAAAGATGTTTTTCCTTGGCGACAACACGATGT
8396	45	102	MW2_CDS_09605	MW1804	FALSE	unmapped	TGTTCCAGAAAGCGTCGCACGTGAAGTCATTACTGTACCTTTCAATGATATTAACGCCTA
8397	45	100	MW2_CDS_12207	MW2311	FALSE	unmapped	TGAAGTTGCCACAACACTTCCAGCACAAAAAATAATAAATGAGGTGACTGAATTTTGGCA
8398	45	98	MW2_CDS_07964	MW1501	FALSE	unmapped	TGATGAAAAAGCATTAAAATATGTGCGTAAAGCATTAAATGCAGACCCTAAAAATGCAGA
8399	45	96	MW2_CDS_04950	MW0914	FALSE	unmapped	TGATTTTTATTATGCCATGATCAGTCAAGGCGGGTATTTATTCAAAAATTATGACGCGCT
8400	45	94	MW2_CDS_07327	MW1368	FALSE	unmapped	TGGTGAAAGTAAAACGATACACAATGATTATGTTTTTGCGATGATTGGTTATCATCCCGA
8401	45	92	MW2_CDS_06037	MW1123	FALSE	unmapped	AATTAAGCAAGGCCGACCACATCGTTTTCATATGCGGACATTATGAAGGTTACGATGAAC
8402	45	90	MW2_CDS_05020	MW0929	FALSE	unmapped	TCCTTAAAGCAGCTATGAATGCTGACACAGATGGTTTAGCTGGTTTACAACAAATGGCTG
8403	45	88	MW2_CDS_00821	MW0152	FALSE	unmapped	ACTGGTTTGCTGATTTATATTGTTGGCTATAGTGGTCTAACCTATCTTAATCAGTTTGGC
8404	45	86	MW2_CDS_00834	MW0155	FALSE	unmapped	TTGGGTATTATTCCACCTTATCATTATGCCAATCATGCATACTGTACCTGCTGTGTGGGA
8405	45	84	MW2_CDS_11870	MW2250	FALSE	unmapped	ACATGCATTAAAAGATGTACAAGCAGTATTGGGTTTTCATAATGACCCATCGCGTTCGGT
8406	45	82	MW2_CDS_07476	MW1398	FALSE	unmapped	ACAGACGTAGAAACAGCAAAAGAATTAAAAGCAAAAGGTGATACAGTCAAGTTCACTACT
8407	45	80	MW2_CDS_03817	MW0698	FALSE	unmapped	TGCTGCGACGAAACCCGAAGTAATCTTTATCTCTGGACGTACAGCTAATCAAAAGAATTT
8408	45	78	DCP_22_2		pos		
8409	45	76	MW2_CDS_13675	MW2584	FALSE	unmapped	TTTTACCGGCAATATGTCTTGTAGTAAGTGCGGCATTAACCTTTTTTGTTATGCCTGACA
8410	45	74	agr_tiling 208_R		FALSE	unmapped	CAAGATTCAACTTGTTTCCTACACTGTTTTATAAATGAATTATTTAAAATGCTTGTTCAA
8411	45	72	MW2_CDS_11037	MW2087	FALSE	unmapped	GGTTCAACAACAGAAGAAAAAGCAGCTGCGAAACAACAAGTCCAAACTGAAAAAACGACT
8412	45	70	MW2_CDS_12950	MW2451	FALSE	unmapped	CATGCTTTGTCTGGATATGAAATGATTGACGCAGTCAAAGGTGCCATTGCAACAAATGAA
8413	45	68	MW2_CDS_11693	MW2216	FALSE	unmapped	GTTTGCCAGCCGCATTGTTAAATGAGAATTCAGACGCTATACGTTTATCGTGTAAGGGTC
8414	45	66	MW2_CDS_02463	MW0455	FALSE	unmapped	CTTGTTGTACACACCCTGTTTTATCAGGACCGGCTAAAGAACGTATCGAAAATTCTGCTA
8415	45	64	MW2_CDS_08104	MW1525	FALSE	unmapped	GGTGAAGAAACAATCATCGCACGTGTTGGTGAAGGTATCGTTTCAACAATTGGTTCTAGT
8416	45	62	MW2_CDS_00055	MW0010	FALSE	unmapped	AACACATTTAAGTTTTAGACAAGGCGTGCGAGAGTGTGTCCCAACATTATTGGGTTATGC
8417	45	60	MW2_CDS_08802	MW1654	FALSE	unmapped	GGTAATGGAGCATCAATTGCAGCTATCGATGGCGGTAAATCTATTGATACATCAATGGGC
8418	45	58	MW2_CDS_00672	MW0126	FALSE	unmapped	GATGACGGTCCGACAAATGAAACAGAGATGCTGGATCTTTTAAAACAAGCGACAACACAA
8419	45	56	MW2_CDS_12421	MW2351	FALSE	unmapped	ATCTGGCGGAGAAAAGCAAAGGATTTCTATTGCTAGGGCGATATTAAAAGATGCACCAAT
8420	45	54	MW2_CDS_09663	MW1814	FALSE	unmapped	TTTACTTTGGGGATAATCAATATACGCTTGAGGGCGCAGCAAACCATTACTTTGGAACAA
8421	45	52	MW2_CDS_11748	MW2227	FALSE	unmapped	TTTGCTGTTTCATTATCAATTAGTCTAGTTGTCTTTAATATGATGTTCAGAGATAGAACA
8422	45	50	MW2_CDS_11321	MW2141	FALSE	unmapped	TAAAATACGATGTGGCATTTGGACTCGAAAATCATGCGGTTCCACATGACGAAATGCATA
8423	45	48	agr_tiling 207_F		FALSE	unmapped	ATTCATTTATAAAACAGTGTAGGAAACAAGTTGAATCTTGTGCTACACTGTTTTTTAAAA
8424	45	46	MW2_CDS_04327	MW0796	FALSE	unmapped	ATGAAAGAACATGCATCGTCTGTATTTAATGGTATCGGCTACATTAAGCATGGTGGAACT
8425	45	44	MW2_CDS_13389	MW2534	FALSE	unmapped	GTTATCTATCATTCCGGACACTTAGGTGACTCCCAACAAGACATTGCATCATTAGGTGGT
8426	45	42	MW2_CDS_07345	MW1371	FALSE	unmapped	TGAGCTATTTTTAGAAAAAATCAATGAATTTAATGCTGAAATGGAAATCATGTTGCATCC
8427	45	40	MW2_CDS_04389	MW0808	FALSE	unmapped	AGCAGAGATGAGTAAACGTTTTTCAAATATTCAAGATTACATATTTGAATATTGTAACTT
8428	45	38	MW2_CDS_10335	MW1951	FALSE	unmapped	TCAGATACTTCCCCCTAAAACTGAAAGTTCTATCGGTAAGATTTCCGTTGACCCAAATGT
8429	45	36	perR_tiling_105_F		FALSE	unmapped	TTTAAATTAGAAAATCAAGACGGAACTGTCATTACAAATGATACATTAAAAGGTAAAAAG
8430	45	34	MW2_CDS_13272	MW2512	FALSE	unmapped	ACCGATAAATACGGTGTTCGTTGGATGTTACATGGTCAAGACTATACTGCAATCCAACAA
8431	45	32	MW2_CDS_06811	MW1272	FALSE	unmapped	AATTTTTTGGAGATGCAGTAGACATGACTGAGGGTGCTGAATTAACATGGATGCGTCAAC
8432	45	30	ETG05_36762		pos		
8433	45	28	MW2_CDS_11036	MW2087	FALSE	unmapped	TGATGCAGAAGCAAATACTGAAAATGGTAAAGCAATTCAAGCCATTGCAGCAGCAACTAC
8434	45	26	MW2_CDS_01637	MW0299	FALSE	unmapped	AGAAAATCAATAGCATCATTCAGCAGTATCGCGATGCTACATTACGCGCGATTAAAGCAG
8435	45	24	MW2_CDS_10104	MW1901	FALSE	unmapped	ATGTAAAGCCAGATTATCAAGATAAATCTTATTTGCGTATCTATGGCGAGGTGGTCATTT
8436	45	22	MW2_CDS_00237	MW0045	FALSE	unmapped	TAGGTGCTATTCCAACATCTACGCTTGGCTATGAAAAACAAACGAACTGGGCTTTTTCTG
8437	45	20	MW2_CDS_04294	MW0790	FALSE	unmapped	GTCTTGCTTTGTGATGAGGCAACAAGTGCACTTGATCCGCAAACAACAGATGAAATTTTA
8438	45	18	ETG04_27747		pos		
8439	45	16	MW2_CDS_05229	MW0968	FALSE	unmapped	GCTATAGAATTTGGATGGTTCTTAACAGAGATGGGTAGACAGCCTTGGATTGTTCGTGGT
8440	45	14	MW2_CDS_11194	MW2114	FALSE	unmapped	TCGAAGTGCTAAATATTTATGGAGATTTGAAAGATGGTACACATTCAGACGGCAGAGTGT
8441	45	12	MW2_CDS_04024	MW0734	FALSE	unmapped	TATTCCTGAAATCGATGGTAAATTAGATGGTGGTGCACAACGTGTTCCTGTAGCTACAGG
8442	45	10	MW2_CDS_01314	MW0241	FALSE	unmapped	CATTCTTACAGCTGTAGGTGGTGTCGAAAACATTGTTGATGCAACGTATGACACGAAGTG
8443	45	8	MW2_CDS_04737	MW0874	FALSE	unmapped	AGCTATCCTCATCAATTATCTGGTGGTATGAGACAAAGAGTAATGATTGCAATGGCCATT
8444	45	6	MW2_CDS_02279	MW0421	FALSE	unmapped	ATTTCCCAGGTGGTAAAATAGAAGAAGGGGAATCACGAGTACAAGCGCTGTTAAGAGAAG
8445	45	4	MW2_CDS_06159	MW1144	FALSE	unmapped	GAACGCTGACAGCTATTATTGCCTTAATCGTATTCTTGCCTATCTTGTTAAAAGGCGGCC
8446	45	2	MW2_CDS_08073	MW1520	FALSE	unmapped	AGGAGATATGGTTATGATGACAGTCGCAGAGTTACTACCATTTGGATTTTCAGGAAAGGA
8447	45	163	psma_tiling_084_R		FALSE	unmapped	ATTGCGCTTATCATTGCATTGATAAGTGGCTTGTTGTTTTTAGCACCAGTTATGCCAATG
8448	45	161	MW2_CDS_02893	MW0532	FALSE	unmapped	TGTTTTAACCAACCTTATAGAAAAGAAGTACCACCATTAATGTGTGCGTCATTATGGCCA
8449	45	159	MW2_CDS_00224	MW0042	FALSE	unmapped	TTGATAGAATTGTATTTGAAGGCATTTAAAGGACAAAAGAAAACAGATTATGAGTTTGGG
8450	45	157	MW2_CDS_09693	MW1819	FALSE	unmapped	TACAAAAAAATCAATTTCCATGGGTCGTAGCTGCTTTTCCATCTAAAGCTTGGGCGAAGA
8451	45	155	perR_tiling_049_F		FALSE	unmapped	CATAGTTAAAGAAGCGCTCTTAATAGAAGTATTAAAAAGTAAAGTTATTCGACATGCATA
8452	45	153	MW2_CDS_08475	MW1594	FALSE	unmapped	AGCTGCGTACGAGCAACGTTTAGAAGATAGACCTCAAATCGTAGTAGCTAACAAGATGGA
8453	45	151	MW2_CDS_11209	MW2117	FALSE	unmapped	AGCTCAAGCTGGAGATTTTGCAAAAGCAGATGCATTGATTGAAGAAGGAAACAATTGCAT
8454	45	149	MW2_CDS_03513	MW0644	FALSE	unmapped	ACGTGAACTTAAAAAGTTTGCTAGAGAACATGATCCTGCCTATATTGAGAAAAAAGGCGA
8455	45	147	MW2_CDS_13733	MW2594	FALSE	unmapped	TTCGTACATTCTTATCAAGCGCCGATGTCAGAAAATGTAATTGCATATGCGCAGTATGGG
8456	45	145	MW2_CDS_12753	MW2413	FALSE	unmapped	AGTGCAGTATTTTTGATGTCTTCAATTCTAAGCTTTGAATATGATTTTATTGCATTAGCA
8457	45	143	NA		ignore		
8458	45	141	MW2_CDS_03179	MW0585	FALSE	unmapped	ACGTCAACGACTGACAATGGTCATTTTAAATGGAGTCATCGGATTTGTTGTGACCTTATT
8459	45	139	MW2_CDS_01211	MW0223	FALSE	unmapped	TAAACGTTTTGGCGAACGTGAAATTTATATTGGATTGGATGCGGCTGTAGCATTAGGTCA
8460	45	137	MW2_CDS_01832	MW0334	FALSE	unmapped	ACTCATTGCAGACATCAAATACGCATTAAAGGAGGCATTCAATGAGTCAATTCCTCACAC
8461	45	135	MW2_CDS_00729	MW0135	FALSE	unmapped	GCCTCAAACGTTAACAATACTTTGTGGTCATGGTAAGAAATTTGCAGATGTCAAAACGGC
8462	45	133	agr_tiling 072_F		FALSE	unmapped	CTTTTTTGCTTTACAAGCCTCGCTGGGATAGGCTTCTTCTTAGTGGCTGCAGGTGCATAT
8463	45	131	MW2_CDS_10376	MW1960	FALSE	unmapped	AGAAGGTATGCACATGGTGCACATGCACCTTCATCTTTTTGGTGTTATATAGAAAGCATT
8464	45	129	MW2_CDS_02373	MW0439	FALSE	unmapped	AAACCTGAGCAAATTTTAGACACAATCCATTCAAGGTGTCAGCATGTATATTTCAAGCCT
8465	45	127	MW2_CDS_07443	MW1391	FALSE	unmapped	TCGTAAAACAGGAAAAACAGAGAGCTATACAAAAGAAGATGTAACAATGGGCGAAGCAGA
8466	45	125	MW2_CDS_11123	MW2102	FALSE	unmapped	TGGACGTCAACTAACGATAATGGAACTAGGCGATGACATTGCTAAGGGATTAGGTCAAAA
8467	45	123	MW2_CDS_08373	MW1575	FALSE	unmapped	GGCAGACGAAAGTAAGTTCGATCAATTTAAAGGAAATGTTAAAGAAACAGTAGGTAACGT
8468	45	121	(+)E1A_r60_a22		pos		
8469	45	119	DCP_20_5		pos		
8470	45	117	MW2_CDS_05325	MW0986	FALSE	unmapped	GGAAAAATCAACCTAGCGCAGTTAGTCAACGTCGAATGAATTTTGAAGAGCGACGTCAAA
8471	45	115	MW2_CDS_01837	MW0334	FALSE	unmapped	CAACCGTAGATACTACCAAGCTCGAACAAATCGAGGGTGCCATTCAATCAAACACAAAAT
8472	45	113	agr_tiling 058_F		FALSE	unmapped	TAGTATACATAACAATTAATTTACCTATATTTTTAGCTAAGACCTGCATCCCTAATCGTA
8473	45	111	MW2_CDS_03746	MW0686	FALSE	unmapped	GGATTAGCGGGTTTACGTGTAGGATATGTGGTAGCAAGTGAACATGCGATTGAAAAATGG
8474	45	109	MW2_CDS_10251	MW1936	FALSE	unmapped	AAACTCTGAACGTTGGTGAAGCGTGGCTTATGGGGTATGATGTAGATTCTTATCGAGTTC
8475	45	107	MW2_CDS_10733	MW2027	FALSE	unmapped	AATGAGTGACAGTGGTGTAATTAAGAAAACAGCCATGGTATTCGGGCAAATGAATGAGCC
8476	45	105	MW2_CDS_05064	MW0937	FALSE	unmapped	TAGAACGAGTAGCTGTGATGAAATCACATCGTGGACAAGGAATGGGTAGAATGCTTATGC
8477	45	103	MW2_CDS_12423	MW2351	FALSE	unmapped	ACAGCAATAATTGGACCTTCAGGAAGTGGGAAATCTACATTATGTCACTTACTCTTGCGC
8478	45	101	MW2_CDS_01748	MW0318	FALSE	unmapped	TGTGGCATTTGGTATGAAGGAACGCTAGTTGGTGTCATCGGTTTACATGAAATTAATCGC
8479	45	99	DCP_22_7		pos		
8480	45	97	MW2_CDS_01332	MW0244	FALSE	unmapped	AACAGGCCAAGCCTTTATCACTGTGAATGCAGAAGGACAAAACACCATCTATGTTTATGG
8481	45	95	NC_S_048		FALSE	unmapped	ACCTTTTTTTGTTTTTCTATAAATACAATAAGGTATGTCAATTTGATAATTTATTAATTT
8482	45	93	agr_tiling 039_R		FALSE	unmapped	TGCCATTGAAATCACTCCTTCCTTAATTAAGATAAAAATTCTTAAAATTAAACAACTCAT
8483	45	91	MW2_CDS_11330	MW2142	FALSE	unmapped	AGTGAACGTATTGAAACTACAGAAGCTCGTGCAAAAGAAGTTCGCAGTGTTGTTGAGAAA
8484	45	89	MW2_CDS_04361	MW0803	FALSE	unmapped	GGAACAATATCTTTAGTGCCACAAATTGTAGATGTCGTTTCAATTCCGGTCATTGCCGCT
8485	45	87	MW2_CDS_07376	MW1378	FALSE	unmapped	TCCAGAGGTAACTTCAATCCAGAATTTATTGGTGTCCTATCTCGAAAACAAAACGCTGCA
8486	45	85	MW2_CDS_05486	MW1016	FALSE	unmapped	ACAGGTTTATTAGCAGTATTTTTAGCAAGTGCAACTGTTGCGATTGTTGGACAACTAGCC
8487	45	83	MW2_CDS_03298	MW0606	FALSE	unmapped	AGATGTTAATAAATTGCTTCAAGCTTTTGTCTATTTTAAATCATTTGAGAAGTTACGACA
8488	45	81	MW2_CDS_03914	MW0715	FALSE	unmapped	ATCAAGAGCTGTAGAATCAGCACAAAAACGTGTAGAAGGTAATAACTTCGACGCGCGTAA
8489	45	79	MW2_CDS_09222	MW1731	FALSE	unmapped	TGCTACATGATAAATATCCACATGCATTTATCCACATGGTTGGTTTTTCGCGAGGTGGTT
8490	45	77	MW2_CDS_09192	MW1724	FALSE	unmapped	ACTTCAAAGTTACCTATCGCAACATTGATAGTAAATCTAGTTGGTAGTTTTTTAATTGGA
8491	45	75	MW2_CDS_05745	MW1069	FALSE	unmapped	TGACAAATCTACGCCAATGATGGAAGCATTTAAAGAAGCTGATAACGTGTTACGCCAAGG
8492	45	73	MW2_CDS_01744	MW0317	FALSE	unmapped	TGCGTTTCCGTTCATCAGAATCATCTAGCAATGGTCGAATAAGCATTCCATACTTTTTAA
8493	45	71	agr_tiling 007_F		FALSE	unmapped	TCTACTATAAAAAAATAAACATAGACTTATGAAAAATCTCTCATAAATCTATGTTTAGTC
8494	45	69	MW2_CDS_12275	MW2323	FALSE	unmapped	AGCATCAGGATTTAGAGACGGTAATGACGACGTTGATTCAAAGTGGGGTTGACCATTTTA
8495	45	67	MW2_CDS_08304	MW1562	FALSE	unmapped	AGATGTACATTAAGTAATCATATGACTGCAAGGGATTCCAACAGAGGCGGTTGCTGTCAA
8496	45	65	ETG02_36680		pos		
8497	45	63	MW2_CDS_11045	MW2088	FALSE	unmapped	TGGTGCAAATGGTTCAACATCATCATTAGCGCCATTCTTATTTGGTGATTTAGAAGCAGA
8498	45	61	MW2_CDS_09672	MW1815	FALSE	unmapped	TGATGTACCAACATTTGCCATTTGTCATGGGCCACAAATACTAATAGATACAGACGATTT
8499	45	59	MW2_CDS_07466	MW1396	FALSE	unmapped	AACTGAATATCTACCACAAACAAATCACTTAGTTAAAATTGACAGTGCATTATATTCCGA
8500	45	57	MW2_CDS_08255	MW1553	FALSE	unmapped	TGTGGTGATTTGACGGAATTTATTGACACAATGCTTGAGCTATTGATAGCAGGACAAGAA
8501	45	55	MW2_CDS_13226	MW2503	FALSE	unmapped	ACGTCAAATGTTGCTGCAAATGTGGCAAAATATACAAATGTTTATCGTTCAAGCGCTACC
8502	45	53	MW2_CDS_13196	MW2498	FALSE	unmapped	AGCGATGACGACACTTACACGAAGTTCAAAACAGATATGCTGTTGCAATCATTATCAACT
8503	45	51	MW2_CDS_04001	MW0730	FALSE	unmapped	AACAATTTGTATCGGTATGGCTGCATCAATGGGATCATTCTTATTAGCAGCTGGTGCAAA
8504	45	49	MW2_CDS_08487	MW1597	FALSE	unmapped	AGGTGGAAAACAAATCAAAGTAGAAGAAGGTCAAGAAATCTTCGTTGAAAAATTAGACGT
8505	45	47	MW2_CDS_01063	MW0196	FALSE	unmapped	AGGTGGTATTTGGACATTAAAATTATTCATTTTACCTAACCATCCTATTATTAAATCTGG
8506	45	45	MW2_CDS_08125	MW1529	FALSE	unmapped	TTCTTATTGCATATGAAGAGGAAGCAAAAGATGGTGAGTTAAGCAATTTCAAGCAAACTT
8507	45	43	MW2_CDS_01993	MW0367	FALSE	unmapped	TAGATCACGTCAACCGCGTAGTCTATGACATTACATCAAAACCACCAAGCACAATTGAGT
8508	45	41	agr_tiling 061_R		FALSE	unmapped	TTGCCTATATTTTAAACATTTTTATCTTCACTTTAATTACTAATATATCGTTTTATCTAA
8509	45	39	MW2_CDS_05164	MW0955	FALSE	unmapped	TTGTGGTATGGATACGGGAGAAATTATTGAACAGAGACAATGTGATATTAGACCGGACGA
8510	45	37	MW2_CDS_06549	MW1221	FALSE	unmapped	CAAATATGAGAGATGCACAAAATAACTGGGATTTCTGGACGGGTCTTCCAGAAGCATTGC
8511	45	35	MW2_CDS_10087	MW1897	FALSE	unmapped	ATTACAGGATTTACAAAAACAGGAAAGCCGCAATATCAAAAGTATTTAGCGAAGCCGATT
8512	45	33	MW2_CDS_04823	MW0889	FALSE	unmapped	ACCAAACAATCAAAATTGTACACCTTCGAGAGAACATCCTCATGAAAGTTTAATCGAACA
8513	45	31	MW2_CDS_00816	MW0152	FALSE	unmapped	TTTGGTTACCTCAAGACCGAAATCAAGTAAAGCAAAGTGATGACAAGAGGCATGCAAGTC
8514	45	29	MW2_CDS_00529	MW0099	FALSE	unmapped	AGGGAACGCAAATCAAGCATCACATAAAGACACGTGTAAAAAGGAACTTGATAGTCAAGA
8515	45	27	MW2_CDS_06532	MW1218	FALSE	unmapped	AGCATCTGGTAGACCTACTGAAGGTATGATTCCAACTGCTAGAGATTTAAAATTACCTGA
8516	45	25	MW2_CDS_01256	MW0231	FALSE	unmapped	AACGATGACGATGTCATTGTGACACATGATGCAGTTAGACCATTTTTAACGCATCGTATT
8517	45	23	agr_tiling 018_R		FALSE	unmapped	CCGCGAGCTTGGGAGGGGCTCACGACCATACTTATTATTAAGGGAATGTTTTACAGTTAT
8518	45	21	MW2_CDS_08689	MW1635	FALSE	unmapped	AAAGAAAAGCAGCCGGTAAGTGTTACTGTACTATTCTATGTTTTATGCTTCTTCGGTCAA
8519	45	19	MW2_CDS_02525	MW0467	FALSE	unmapped	ACGATTAAAGCAGCAGGAGGATTTATCATTCAAGTTATGCCAGGTGCCAAAGATGAAACA
8520	45	17	MW2_CDS_10031	MW1884	FALSE	unmapped	TCTATACTTGCGGGAACTTTAGCAATCGTTTTAGCATCACCACTAGTAACTAATCTAGAT
8521	45	15	MW2_CDS_02460	MW0455	FALSE	unmapped	CCATGGCGGTGTTACACGTGCACGTAAATTAGCTGACATTTTAAAAACTCCAATTGCAAT
8522	45	13	MW2_CDS_03031	MW0557	FALSE	unmapped	TGGAGACATTGCTTTGCGAATCTAAAGTTATTAATAAAAACCCTAAATATCGAATAATCA
8523	45	11	MW2_CDS_06033	MW1122	FALSE	unmapped	ACTGTTAAGTCACATAGAGTGCATAAAGGGCTTCATATGCTTACATTTGAAGGTATTAAT
8524	45	9	MW2_CDS_03124	MW0574	FALSE	unmapped	AAACCTCGCAAATTAAATACAATTGCCAATTATTTGTTTGGTGGCTTTGGTGATGCAGAA
8525	45	7	MW2_CDS_02854	MW0525	FALSE	unmapped	ACAATTAAAGAAATTGTCGCTGAAAGTCCTGATCTTGTTATTGTTGGTGGCGGAATCGCA
8526	45	5	MW2_CDS_11847	MW2246	FALSE	unmapped	CCAGAGTTAGTATACGAAGCTTGGACAAAGAAAGATTTGTTGAAACAATGGTTTATGACA
8527	45	3	MW2_CDS_11652	MW2208	FALSE	unmapped	CGCAGATTCACGTATTCGTAAAGAAACGATTGCAGCAGAAGATGTTCTGCAAGATATGGG
8528	45	1	MW2_CDS_05947	MW1105	FALSE	unmapped	AAGCTGGTGTAGTAATTAATCCTGGTACACCAATATCACAAATTGAACCTATTTTAGACA
8529	44	164	MW2_CDS_01463	MW0269	FALSE	unmapped	ATGACTTTCGAAGAAAAACTAAGTCAAATGTATAACGAGATTGCGAATAAGATTAGCAGT
8530	44	162	psma_tiling_050_F		FALSE	unmapped	AGATTTCATAACAAACAAAGGAGGTCTTTCACATGGGTATCATTGCAGGAATCATTAAAT
8531	44	160	MW2_CDS_05935	MW1103	FALSE	unmapped	TGAACATAAGTCGAATCAACCTAAACGTGAAACGACGCAAGTACCTATTGTAAATGGGCC
8532	44	158	MW2_CDS_05714	MW1064	FALSE	unmapped	CGGAGACTTAACTATGCCTGACATGTCAGGATGGACGAAAGAAGATGTCATTGCTTTTGA
8533	44	156	MW2_CDS_11051	MW2089	FALSE	unmapped	ACGCTTGAAAACAAAGTAACTAAAAAGATGACAGTTCAACCTGATGTAAGTCAGAGTGAT
8534	44	154	MW2_CDS_11187	MW2113	FALSE	unmapped	TGGTGGAACAGTTGGCGATGAAGTATTTAAGCATTTAAATCGTTTTGCACGTGTACCAGT
8535	44	152	MW2_CDS_03659	MW0670	FALSE	unmapped	GCAGTTGGTGCTGTTGCCTCTGTATTAACTTTAGGCGCTTGTGGTAATTCTAATTCACAA
8536	44	150	(+)eQC-39		pos		
8537	44	148	MW2_CDS_04048	MW0738	FALSE	unmapped	TGGTTACACAGCAGTAGTTTCTCACCGTTCAGGTGAAACAGAAGATACAACAATTGCTGA
8538	44	146	MW2_CDS_12205	MW2310	FALSE	unmapped	ACAATTAATTCTATGAAAAGCTTAATTGCACATGAAGTAAATCATAATATGCGCTATCAA
8539	44	144	MW2_CDS_10722	MW2025	FALSE	unmapped	TGCAGTTATCCATTTAGTGTTACATGTTGTATGTATTTGTATTGCCTATTGGGCTTTACA
8540	44	142	MW2_CDS_04606	MW0850	FALSE	unmapped	AAGTTTAACTGGCGGTTGCCCAATGGGTCCTTATATCGTTACTAAAGACGAACTACCATT
8541	44	140	ETG10_234183		pos		
8542	44	138	MW2_CDS_04020	MW0733	FALSE	unmapped	ATATAATGTATTCTTCGTACCAGCCAGAGGTGGACTAGGCGAAAATGTTGTCTTTCAGGC
8543	44	136	MW2_CDS_03415	MW0626	FALSE	unmapped	GCAGCAATCGCATCTGAAGGCTCATTTGGAGTGTTACATTACCAAGGTTTCACAAAAATT
8544	44	134	MW2_CDS_03997	MW0729	FALSE	unmapped	ACGGCATTTTTACGCATGAAATTGATCATTCAATGATTCAAGATGATGAAATGAGACGCA
8545	44	132	MW2_CDS_08639	MW1626	FALSE	unmapped	CGATGCATAGATATGAAGCAAGTGGTGCTGTATCAGGATTACAACGTGTTCGTGGTATGA
8546	44	130	MW2_CDS_02973	MW0547	FALSE	unmapped	AGATGATTCAAATGGTCATAAATATGGATTAGGTTCAAGTGCAGCAGTACTTGTGTCAGT
8547	44	128	MW2_CDS_06364	MW1182	FALSE	unmapped	CACATTTAAACCCAGCGGTGTCTTTAGCTCTTGCATTAGACGGAAGTTTTGATTGGTCAT
8548	44	126	MW2_CDS_03938	MW0719	FALSE	unmapped	GGGTCGGTACTATTCTGACATTAATTTTAATTGGTGCCTCAATCTATAAAGAGTATTTCC
8549	44	124	(+)E1A_r60_a97		pos		
8550	44	122	MW2_CDS_07958	MW1499	FALSE	unmapped	TTGGCGTAGGTATTGGTGTACCAGGTCCTGTTGACTTTGAAAAAGGTACAGTAAATGGAG
8551	44	120	MW2_CDS_09741	MW1829	FALSE	unmapped	TTGACAGCAATTATTGGACTCGTGACATCAGGTTTAATTAACTTCATGGTGTTTCCACCT
8552	44	118	MW2_CDS_02874	MW0528	FALSE	unmapped	TGGCATCATTTGGTTGGAGAATCCCATTCTTACTCGGTTTATTCCTAGGATTATTCGGCT
8553	44	116	MW2_CDS_02398	MW0444	FALSE	unmapped	TGATGATGTAACACAATTACAAGCATTGATTCAGCAAGGCGATGTACCATTGAAAGGCGA
8554	44	114	RC4		pos		
8555	44	112	agr_tiling 088_R		FALSE	unmapped	AATTAACTCAATTACACGAATAACTATAAGAGAAAGTGTGATAGTAAGTGGAAGCATTAA
8556	44	110	MW2_CDS_11116	MW2101	FALSE	unmapped	GCAATAGGCGCAATATGTACGGCGATTGTGCAGTTCTTATTAATCAGAAATCCACTGGAA
8557	44	108	MW2_CDS_13472	MW2549	FALSE	unmapped	ACAAGGATCACATGCAACACTTCAAAAATTAAAAGAGCAAGGTCTCATTATTGAAAAAGT
8558	44	106	perR_tiling_097_F		FALSE	unmapped	CAGTATATGGTATAAGCGGTGATTCAAAGAAAAAACACCAAAATTTTATTGAGAAACACG
8559	44	104	MW2_CDS_01757	MW0320	FALSE	unmapped	TTGTTAAGGTACGTTGGGCGCAATCTGGTTTTATCTCTGCTAAAGGTAAGGAAACACCTA
8560	44	102	MW2_CDS_06363	MW1182	FALSE	unmapped	GTTTGTGCCAATGTCAATTTAAAGAGAAGTGCTGCGAATGGTGCTGATTGGATTGTCATC
8561	44	100	MW2_CDS_11434	MW2167	FALSE	unmapped	AACCTAAGAAAAAACGTATGGGCCGTTACCAAGGCTATACAAACAAAAGAAGAAAAGCGA
8562	44	98	MW2_CDS_12649	MW2392	FALSE	unmapped	TACCGCAATCCTCATTGATCCATTTTCACAGCCAGACGAAAACGGACATTACTTTGATTT
8563	44	96	RC9		pos		
8564	44	94	MW2_CDS_12810	MW2424	FALSE	unmapped	CGAGTGAAGTCGAAACTGCGAAACGTCTCGGTGTTGATCCTTATGATGTCTTAACTCAAA
8565	44	92	MW2_CDS_01998	MW0367	FALSE	unmapped	TTGGGGATCAACTAACATGTATCTTTGTAGACCATGGCTTACTTCGTAAAGGTGAAGGCG
8566	44	90	MW2_CDS_00503	MW0094	FALSE	unmapped	AACAATATGGTTCTGAAGCTTGGACAAAGCAATTTTTAGCTGTAGCGATTCGTCCAATGA
8567	44	88	MW2_CDS_08840	MW1660	FALSE	unmapped	TGTATCGTCGATTACTTGCTTCTAACTTAACAAGCGTTCCTGAAAGGTTTATCATCATGA
8568	44	86	MW2_CDS_04445	MW0820	FALSE	unmapped	CAACATATCGTAACGTCTATGTAGTTGGTGATTGTGCTGATTTACCACATGCGCCAAGTG
8569	44	84	DCP_1_2		pos		
8570	44	82	MW2_CDS_07495	MW1401	FALSE	unmapped	TGCCACAGGCTTCAGACAGTGATAAGTTGGATGGTTTAAATACACATATGGGCATTTTTG
8571	44	80	MW2_CDS_07917	MW1491	FALSE	unmapped	GTTGTAAATGACAGAGGAAATATAACAATGATTAATAATGTTACAGCATTTACTGCAAAT
8572	44	78	MW2_CDS_02371	MW0438	FALSE	unmapped	AGTCAGGAACTTGCAGATCAACTTGTTAAAAATAACTTTAGAGCAACAAAATTGGCAACA
8573	44	76	MW2_CDS_10223	MW1929	FALSE	unmapped	TTCCACATCCTTTCAAAAAGTTAATAAGATGGTCTAATGGCATTGCAGCAGGTGCTGACA
8574	44	74	MW2_CDS_05806	MW1080	FALSE	unmapped	TAGTTCACGGGAATATTCCTCATGATTACGGTACAATCGATGCGCCAATTGGTAGAAACA
8575	44	72	MW2_CDS_12134	MW2296	FALSE	unmapped	TCAAGTTTAGTTTCAGCTATTGTTAGAAAACATAGCACAAAACGTACTGAAGTGCCGTCA
8576	44	70	MW2_CDS_07770	MW1465	FALSE	unmapped	ACGCCAAAAGAGGGTGTTAGTGCTATTAATATTGCGGCGAAAGCAATTAGTCGAATGAAA
8577	44	68	MW2_CDS_11149	MW2106	FALSE	unmapped	AGCTGTATCATTTCATTCATTCATCATTAATATTTGTCGTTCAATAGGGCCTGCCATTGC
8578	44	66	MW2_CDS_02216	MW0409	FALSE	unmapped	AAACGAACACGTTCTGAATTAGTTGAATCCGGTGAGCAAGATTTGAATGATATCATTTTT
8579	44	64	MW2_CDS_11175	MW2111	FALSE	unmapped	GCATTCCGTCAGGCGGTCAAAAATTCCAATGGTTACAAAATTGGACAATCTTTTACTGGG
8580	44	62	MW2_CDS_08902	MW1671	FALSE	unmapped	TGAATTAATGCGTCGTATGTATGGTCAAACAGACGCATACGGTTTAACTATTCCGCTTGT
8581	44	60	NC_A_021		FALSE	unmapped	TCTGCCCGAATTCCTTAAGAAGTCTTAGTCATTTCAATAGCAAGGTCAAAATTTTGCCAA
8582	44	58	MW2_CDS_09391	MW1763	FALSE	unmapped	ATTCAATATTCTAAAAATAGCTGGGTAGTCCCACAAGAAAGTCAATTTTTAGAGTCTGAT
8583	44	56	MW2_CDS_05989	MW1113	FALSE	unmapped	AATTGAACCAGCAAACATTAATTGCCCAGGTCAAATTGTTGTTTCAGGTCACAAAGCTTT
8584	44	54	MW2_CDS_01304	MW0239	FALSE	unmapped	TTTATCAATGTTACCTCAAGCAGCAACTACAGCGATTGCGTTACCAGTATCAGCTGGTAT
8585	44	52	MW2_CDS_10872	MW2053	FALSE	unmapped	TCTAGTAGTAGATGCGGAAAATGACAATGCTTGGAACCTTTACGAACGTGCTGGATTCAT
8586	44	50	MW2_CDS_07241	MW1353	FALSE	unmapped	AGAGTTAATGTATACAACTGGATGTTTGGAAATAGAACACGGCGATGCTAATGAAGGTGT
8587	44	48	agr_tiling 059_R		FALSE	unmapped	TTAGCTAAAAATATAGGTAAATTAATTGTTATGTATACTATTGCCTATATTTTAAACATT
8588	44	46	MW2_CDS_09497	MW1784	FALSE	unmapped	GGTCGTTTAAATGATGCGAAAGGGCGTCATGATGAATTACAATCGACAGTTGAGAACGTT
8589	44	44	MW2_CDS_01164	MW0213	FALSE	unmapped	TGATACAGATGCTAAATCAGATGTTAATCAAACTCCTGTTGGTACAGGCCCTTACCAAAT
8590	44	42	MW2_CDS_02081	MW0385	FALSE	unmapped	AACTAAAGTAGAAGCACCGCAATCAAAACCAAACGCGACAACACCATCTTCAACTAAAGT
8591	44	40	MW2_CDS_02951	MW0544	FALSE	unmapped	GGTAAGAAATTTGCAGGCATATCGCAACGAAGAGTTAGAGGCGGTATTGCTGTACAAATT
8592	44	38	MW2_CDS_02135	MW0394	FALSE	unmapped	AGCAAGTTTAGCACTAGGGATTTTAACAACAGGGATGATTACAACTACTGCTCAGCCAGT
8593	44	36	MW2_CDS_08332	MW1567	FALSE	unmapped	TGTTTATCGAACATTAGATGAACGAGGATATAATGCCGTAAACCAAATTGTAGGTTATTT
8594	44	34	(+)E1A_r60_a20		pos		
8595	44	32	MW2_CDS_03819	MW0698	FALSE	unmapped	TGGACCTAAAGGTCGTTTTGGTGGATTAGTTTACGATACATTAGGATTCAATGCAGTTGA
8596	44	30	MW2_CDS_10805	MW2041	FALSE	unmapped	TGAAAAAGATATGGTTACGATGTCTCCAACGGTTACGAGATTCGAACCACATCAGGCATT
8597	44	28	MW2_CDS_12034	MW2279	FALSE	unmapped	CATCAACAATTTGTATCATGAAGCAGTTAAAATTGTTTGTGTAACAAGTCAGTTTCATGT
8598	44	26	MW2_CDS_06982	MW1304	FALSE	unmapped	TCAAGGTCATTTAAATTTGATTCAGCGATGGGGAAAAAAAGACCCAGCAGTATTAGAAGA
8599	44	24	MW2_CDS_09567	MW1797	FALSE	unmapped	CTATGGTAGATACGGGTGTATTATCAGATAGGGCAGTAGCAGAACGTGCAGGTTTAGGAT
8600	44	22	MW2_CDS_06374	MW1184	FALSE	unmapped	ACTGAAGAAGTTGAGCAAGCAATTAAAGAAGCGCAACATGGAAATAATCAACCAGCAGTT
8601	44	20	MW2_CDS_01075	MW0198	FALSE	unmapped	TTTGTGATGATGAACGAATTATTCGAGAAGGTTTAAAGCAAATCATTCCTTGGGGAGACT
8602	44	18	MW2_CDS_03700	MW0677	FALSE	unmapped	TGGACATATCCCTAGACTTACTTATCATACTAATCGCATAAAATGTTCTTCTGAGCGATT
8603	44	16	MW2_CDS_10583	MW1998	FALSE	unmapped	TGAGTGTAGCTGTGTATGTCATTTTTTATTTTATATGGTTAAGATTTGAATGGCCACATT
8604	44	14	MW2_CDS_02560	MW0473	FALSE	unmapped	TCCGAGTTTAGATATTTCGGCAAACCCATTCCAGCAATTCAAGGTCTATATTCAAGAGGA
8605	44	12	MW2_CDS_12633	MW2390	FALSE	unmapped	GCGGTGTGAAATCTATCACATTAATGTTGCATGTGTTGCGTAATGCTTTACAAGTTGCGG
8606	44	10	MW2_CDS_09231	MW1732	FALSE	unmapped	TGCTGAAGCAGTTACCCGTGAATTATATGAAGAAACAGGCGCCAAAGTTAAAAATATTCA
8607	44	8	MW2_CDS_03486	MW0639	FALSE	unmapped	AATCACAAAAAGCCTACATCAGCAGATAAAGATCAAAAAGCTAATGACAAACACCAATCA
8608	44	6	MW2_CDS_03315	MW0609	FALSE	unmapped	TTGATTGGGCAATGGAAGTTACAGGAACTGATACATTCCGACACCGTTCAATCAATGATT
8609	44	4	MW2_CDS_04527	MW0836	FALSE	unmapped	TGGCGCATTATCAATGGCTAACTCAGGACCTAATACTAATGGTTCACAATTTTTCATTGT
8610	44	2	MW2_CDS_12480	MW2362	FALSE	unmapped	GAACTTATAGGTGTAACTGCTGGTGAAACGAAAGATCCTGAAAAAACCTTACCGAAAGCA
8611	44	163	MW2_CDS_06867	MW1282	FALSE	unmapped	GCCAATCCAAACTGCTCTACGATTCAGTCTGTTGTGCCATTAAAAGTATTGCAAGATGCT
8612	44	161	MW2_CDS_08473	MW1594	FALSE	unmapped	GCTCGTCAAATGCGTTCGATGGGTATTGATGATGCACTTAGAGAACGTGGTTGTAAAAAT
8613	44	159	MW2_CDS_02755	MW0508	FALSE	unmapped	AGCTGCAAGAACTTATAATTTGCACTTTTTCACACCAAGTTCAATTGGTGCATTTGGAGA
8614	44	157	MW2_CDS_03705	MW0679	FALSE	unmapped	TTCATTCCAGCTGGTTCTGTAGTACTTGAAGGGAAAAAATGCGGTATTGTAACTACGGAT
8615	44	155	MW2_CDS_06861	MW1281	FALSE	unmapped	CGACCGCTGTGGCACTTGCTGTTAGTAATCAAATACCTTGTGAAATTTATACCGACGTTG
8616	44	153	MW2_CDS_01246	MW0229	FALSE	unmapped	ATTTATACGGTTCGCTTTAGACCATCACAAGAAATTATTCAAGTGTGGCATGCCGTTGGT
8617	44	151	MW2_CDS_02577	MW0476	FALSE	unmapped	ACGTTTATACACATTAACAGCTTCAGCAATGTCGACTGTTTCTGCTTCAATTATCGGTGC
8618	44	149	MW2_CDS_09036	MW1695	FALSE	unmapped	ACAAATCCGAAAGAATATGCTAATAGATTAAAAAATAATCCAAAAGCATTTTTCGAAGAA
8619	44	147	MW2_CDS_01051	MW0194	FALSE	unmapped	TACTAGTTATATGACATTTGCCAATCGAGCAAGCATGCAGTTTGAATGTTCGTGGTCTGC
8620	44	145	MW2_CDS_04998	MW0925	FALSE	unmapped	GCCTGTTAAAGTTATCAGACGTTTCAAGAAGAATGATACACCGCCTACAATGATGCCAGC
8621	44	143	MW2_CDS_13889	MW2621	FALSE	unmapped	AGTGCAAATAACAAGTTAACAGGCAACAATGCCATCATTACAAATACAAAATCGCTGCCT
8622	44	141	MW2_CDS_00372	MW0071	FALSE	unmapped	TCACTGCTGGTTGTGGCATAGGTAAAGAAGCGGAAGTTAAGAAAAGCTTTGAAAAAACAT
8623	44	139	MW2_CDS_03800	MW0695	FALSE	unmapped	CCGCTTCTAGGAATTATGATGGGTGGGATTGTTGCAAGTTTCACAACCTTCATCTCATTG
8624	44	137	MW2_CDS_00151	MW0028	FALSE	unmapped	ACAGATTTGATAATCAAGAATTTGATTTCGAACGTGAATTGACACAAGATCCATATTCAA
8625	44	135	MW2_CDS_05729	MW1066	FALSE	unmapped	CCAAAGCAACAAACACGCTAGCAACACAGTTTGCCTTAAATTCATTTAATCAACCAATCA
8626	44	133	MW2_CDS_05995	MW1114	FALSE	unmapped	AGTAACAGGTGCATCAAGAGGAATTGGACGTAGTATTGCGTTACAATTAGCAGAAGAAGG
8627	44	131	agr_tiling 214_F		FALSE	unmapped	TAAATTTAACTCAGTTATTTGAAAATGAAGGTGAGGAAATTTTAGCGTTTAGCAATCGCG
8628	44	129	MW2_CDS_02004	MW0368	FALSE	unmapped	AGCCTTCGACACTGTTCTATTTAGATAAAGATTTATATTTTGAGAAAGTTAATGATGAGT
8629	44	127	MW2_CDS_09051	MW1698	FALSE	unmapped	ATTTAAGGTGAACGGGACATTACCTATAGATAAGGCATTTGTCACAGGTGGTGGTGTGTC
8630	44	125	MW2_CDS_00062	MW0012	FALSE	unmapped	GCCTGATAATGTTGGGCATGATGGATTCCTACTAAACTTTAGTACCTGGGCACCTAACTT
8631	44	123	MW2_CDS_08244	MW1551	FALSE	unmapped	AAACATCAAGAAAATTATATTCGATGCATTTATTATCATCGTCTTTATCTTCTTTTTACT
8632	44	121	MW2_CDS_07502	MW1403	FALSE	unmapped	AGCATGGTCGTAAGTCATATCAATACGATTGGTTCTATCATTCAAAAGCATGGAAGAAGT
8633	44	119	MW2_CDS_04090	MW0746	FALSE	unmapped	TCACTTTAGCGTTAAATGTTGATGTTGCAGATTTATTTAAAAATGTCTTTAACGAACTGA
8634	44	117	MW2_CDS_04054	MW0739	FALSE	unmapped	AGCTGCACACGGTGCGTACTTAACATTGCCAATTTTAATCGTTATTATAGGTTCGGTTGC
8635	44	115	MW2_CDS_07440	MW1391	FALSE	unmapped	CAATGGTGAAGATGAAGAAGATTCAGAAACTGAACCAGAAGAGATGGGAAAGACAGAAGA
8636	44	113	MW2_CDS_02924	MW0539	FALSE	unmapped	ACTGGTTGGTTATCAACAAGTCATCAAAGTTTAAATGGGCAGTTGTGGTTAACAGGTGCT
8637	44	111	MW2_CDS_00543	MW0102	FALSE	unmapped	ACGCTTAATTATGGAACACAAAGATGCAATTGGACACGGTTATAACATTGGTACAGGCAC
8638	44	109	MW2_CDS_06881	MW1284	FALSE	unmapped	GAATCAACGCGTTGCTAGATTAGCAGAAGAAAAAGGACATGAAATCGTTGGGGTCATTGA
8639	44	107	MW2_CDS_12879	MW2437	FALSE	unmapped	AAACACGTCGATCTACCTACATTAAAATTAGCGACACAAATGTCTCCGTCAATTGGTATT
8640	44	105	RC5		pos		
8641	44	103	MW2_CDS_04908	MW0904	FALSE	unmapped	TGGGGTATTAGCCATTCTATTATTTGAACATAACCATGCGTTCAAAGGATTAAGTTGGCA
8642	44	101	MW2_CDS_03723	MW0682	FALSE	unmapped	TCGGTGGTACAGTGATTACCGTAAGCCATGATCGCTACTTTTTAAATAAAGTTGCACAGT
8643	44	99	MW2_CDS_07426	MW1388	FALSE	unmapped	AGACGGCAAGCAAATTAAGCAAATTTCTTGTTTTGCTAAGTCGGTTCAGTCTGAAACAAT
8644	44	97	(-)3xSLv1		neg		
8645	44	95	MW2_CDS_13238	MW2505	FALSE	unmapped	TCAAAAGTATATGTTTGACTATTCTGCATGTAAATATCCGATTGGTGTTGTAGAAGATGA
8646	44	93	MW2_CDS_10170	MW1916	FALSE	unmapped	ATATATTATGATGACGGCTAATGATGATGTAGAGGCGCCGAGTGATTACGTCTTTCGAGC
8647	44	91	MW2_CDS_05424	MW1005	FALSE	unmapped	TCATTTCCAAGCATTTTATATCATGATTAACGCTATTAAATATCCATATCCAGATTCAAA
8648	44	89	MW2_CDS_09412	MW1768	FALSE	unmapped	AGTGGCTTTAATCCATCGTTTATCACTACACTATCACATGAAAAAGGTTCAAGTGATACG
8649	44	87	MW2_CDS_13812	MW2607	FALSE	unmapped	AGTTGCAGTTGGAGCACTTTTGACAAATAGAATAAGGGATAAAAAAGATAAAAGGCTAGA
8650	44	85	MW2_CDS_10313	MW1946	FALSE	unmapped	AGTGATCCAATTGTCATTATTACAATCTCAATACTCATAATATTTGGAGGTATTGGACAT
8651	44	83	MW2_CDS_12019	MW2277	FALSE	unmapped	ACCATTTCAGCTTCAGGTAAAGCGAAAGATAAAACATTTACAACACAGACGAAGACGATT
8652	44	81	MW2_CDS_04674	MW0862	FALSE	unmapped	AAAAGCAGATTTATCAAGAACAAAGGGTGACTATGTACAAGGTAAAAATAGCTTTACTAG
8653	44	79	MW2_CDS_12809	MW2424	FALSE	unmapped	TTGCAAAGCGTGTTAAACCAGGTGCAGATGGTTTAATATTCCATCCCTATTTAGCTGGAG
8654	44	77	MW2_CDS_07727	MW1457	FALSE	unmapped	ATGGCAGGTATTCCGATTGATTATATTAAACAACAATTAGAATGCCAAAATCCAGTTGCT
8655	44	75	MW2_CDS_03990	MW0728	FALSE	unmapped	ACAGATGGTTATAGCGTGAAAGATCATATCGATGCGATTCATAGACAAGCTGGACAACCG
8656	44	73	MW2_CDS_12956	MW2452	FALSE	unmapped	ATCAAAGTGCTTTCGATATTATCGGACCAGTTATGATGGGCCCTTCAAGTTCTCATACGG
8657	44	71	MW2_CDS_11917	MW2258	FALSE	unmapped	AGGTCGATACAGATATGCCTCATGTTGTGTTCTTTACTTTTAACCAGCCTGATGAGTGGG
8658	44	69	agr_tiling 182_R		FALSE	unmapped	TTAGATAACCGTCAAATTGAATTTTATGGTAATTTAAAAGAACTGAGTCAATTAGATGAT
8659	44	67	MW2_CDS_01603	MW0293	FALSE	unmapped	TATGACGCTTGGTACAGGCATTGGGGGTGCGTACAAGAATAATCAAGGTCATATTGATAA
8660	44	65	MW2_CDS_09197	MW1726	FALSE	unmapped	CCCAAGTTGTTTTAAGATGGAATGTGCAGCATGGTGTGGTTACAATCCCTAAATCGGTAA
8661	44	63	pMW2_039		FALSE	unmapped	TTAAATAACAAAGAAATTGAAGAATTGCGAGATATTTTAAATGATATTAGTAAAAAGTAA
8662	44	61	MW2_CDS_00330	MW0064	FALSE	unmapped	TGGTATGGAACTAACGGAAGAAGGCTTAGCATACGTTAAATACGCTAAAGTGATTTTAGA
8663	44	59	MW2_CDS_09486	MW1782	FALSE	unmapped	AGCTGATAAACCAACAGACTTTAACAGTGAAAAACAAAGCCTGAAAGAAAAATTAGTCGA
8664	44	57	MW2_CDS_10879	MW2054	FALSE	unmapped	TATTTTTGCAAATGTTGGTACCGGTACGTCACTACATTATTTCGACGGCCAATCACAACG
8665	44	55	MW2_CDS_01425	MW0262	FALSE	unmapped	TTGGATGGAATTAGGACAAGGACATCTTGATGAAGCGATTAATATTGCCACTTATTTAGA
8666	44	53	MW2_CDS_00845	MW0156	FALSE	unmapped	CGATTGGTTTCAATAACCATGATGGAGAATTTTACAATATTAATGCTGACACGCTTGCCT
8667	44	51	MW2_CDS_07712	MW1454	FALSE	unmapped	ACGATAAAGGTATAAATGAATCAGTTGTTGGTAAGGCACTTCTTAAATATCAACAACGCG
8668	44	49	MW2_CDS_00045	MW0008	FALSE	unmapped	AGGTGTAAGTGAATTAGCAAACGTATCGGAACGTCGTTTAGAGCGACTAGTAAATCCTCA
8669	44	47	MW2_CDS_01475	MW0271	FALSE	unmapped	CTGCTGTGATGTATTCTGAAAAAATAGTAGTATTGCCTATAATCATCTATGCCATTGTGT
8670	44	45	MW2_CDS_12383	MW2344	FALSE	unmapped	TGGTGGTGACATTAGTATCTCTAATGGTTTATCTGGTGGACTTAATGGAAATACAGCTTT
8671	44	43	MW2_CDS_09825	MW1844	FALSE	unmapped	TGGTAACCAACCACGTGCTTTAATTAGTAAGACAAAAGATGACAAAGAACCGCAAGTTCA
8672	44	41	RC2		pos		
8673	44	39	MW2_CDS_10908	MW2059	FALSE	unmapped	AGACCATCTCAATGCTTGAAAAATACAATCAATCTATTCTTGCTAGCTGTATTCCCAGCT
8674	44	37	MW2_CDS_11729	MW2224	FALSE	unmapped	TGTTGCTAATGCTGCAATTAGTGCCGTTCAAGGTGAGAAACCACAATTTGTCGTTAACTA
8675	44	35	MW2_CDS_06416	MW1191	FALSE	unmapped	AACGGATTTAACGCCAAGGCAAATACGTTACTATGAAACACATGAACTCATCAAACCTGA
8676	44	33	MW2_CDS_13732	MW2593	FALSE	unmapped	ATCTGTTGATGCCTATGGAGAAGATATTAAAGTGAACGGATGGGAAGAGGACACAGAGTT
8677	44	31	MW2_CDS_12826	MW2427	FALSE	unmapped	TAGCGCAGAAACTGCCAAAGAACATATACTGGATATTGCCGGAATTCGCGTAGTATGTAA
8678	44	29	MW2_CDS_06798	MW1269	FALSE	unmapped	TCATTCTATATATAAGTTCACTATCATTTATTGGGTTAGGTGCACAACCGCCAACACCAG
8679	44	27	agr_tiling 063_R		FALSE	unmapped	TAATATATCGTTTTATCTAATTAGAAGGTATGCACATGGTGCACATGCACCTTCATCTTT
8680	44	25	(+)E1A_r60_a97		pos		
8681	44	23	MW2_CDS_13003	MW2460	FALSE	unmapped	AATTCCGGTCGTTCATTCATTACCTGCTAAGACAATCTTACCGGATGACCATCCATACAG
8682	44	21	MW2_CDS_03096	MW0568	FALSE	unmapped	ACGTTATGGGGGCTAAAATTGTTGCCTTCGACATTAATGATGATAAATTAGCATTCGCGA
8683	44	19	MW2_CDS_07767	MW1464	FALSE	unmapped	AGCGCGTAAATGCTTCTAAAGAATTAAATGGTCCAAAAGCATCATTTGATGGTGACAAGA
8684	44	17	NA		ignore		
8685	44	15	MW2_CDS_11530	MW2186	FALSE	unmapped	ATGCTGGGCTGCGCAGAATTAATGTCAGTTTGGATGCTATTGATGATACGCTATTTCAAT
8686	44	13	MW2_CDS_13503	MW2554	FALSE	unmapped	ACACTTTTAAAACAGGCTTTTTCGGTATGACGTCAGAGGGTGTATTGCCATTTAGTTGGG
8687	44	11	NA		ignore		
8688	44	9	MW2_CDS_07682	MW1449	FALSE	unmapped	TGAGCCAATTGAACAAGTAGTCACTCACTTTTTAGCTATTTTAGAGATGTCAAAAGCAGG
8689	44	7	MW2_CDS_06258	MW1162	FALSE	unmapped	CAATTTGTACTAGAGCCGACTTATAGTTTTTCAATCGTGACAAGCGCTACTGAAGAACCA
8690	44	5	MW2_CDS_02051	MW0379	FALSE	unmapped	TTTTCCCTATCATTACAACAAAAAGGTGTTGATATGAAAATAGGTTTAGACATAGCTTCA
8691	44	3	MW2_CDS_09721	MW1825	FALSE	unmapped	ACACAGGAAGCAATTTCGAATACATTGCGTCATTCAAACGGTACAAAAGTGACAGTAGAA
8692	44	1	MW2_CDS_10036	MW1885	FALSE	unmapped	AGAAACGAAGTCTTTCCCTATAACAGAAAAAGGTTTTGTTGTCCCAGATTTATCAGAGCA
8693	43	164	MW2_CDS_13620	MW2574	FALSE	unmapped	AACGTTTCCGCAACAAATATGAAATCTTATTTATCTTGGAAAGTTAACCCTGCAGGCAGT
8694	43	162	MW2_CDS_04955	MW0915	FALSE	unmapped	ACGGAGTATAGTTATGCCAAAGTGCCAAAAGGTACGCAACAATATGTTAATATTACGGCT
8695	43	160	MW2_CDS_13072	MW2474	FALSE	unmapped	ATGCATAACGATATCAAAAATAATAGAGACCGTATCGATATTGACAGCGACATCCCAGAT
8696	43	158	MW2_CDS_10342	MW1953	FALSE	unmapped	CAAATTGCTGAAAATGCAGGATTAGAAGGCTCTGTCATCGTTGAACGCTTGAAAAATGCA
8697	43	156	MW2_CDS_10446	MW1973	FALSE	unmapped	TTTAAATTATCCAGGTGGTCCACAAGTTGATCGGTTGGCTGCTGAAGGTGAAGATACTTA
8698	43	154	MW2_CDS_08771	MW1648	FALSE	unmapped	ACAAGTCGAGAGATGATTAATACAAAGGACGACGACGAAATAGATAAAGTGATGACGCGA
8699	43	152	MW2_CDS_06597	MW1232	FALSE	unmapped	GTTCAGAAAGGTGTTTTTGATATATTTGATTATGTCATGCTAGGTCACTTGCATCATCCA
8700	43	150	MW2_CDS_07813	MW1472	FALSE	unmapped	GCAGCGTCGTATAGTCGCTAGGGAGTTAAGAGACCACATTGTATCGGAAATTCAAAACTT
8701	43	148	MW2_CDS_08374	MW1576	FALSE	unmapped	CAACATTGAAATATTTAGCGGAATATGTAGATACAAGCGAAGATTTAGACGGATACATGT
8702	43	146	MW2_CDS_03596	MW0659	FALSE	unmapped	AGCTTTGAGGTACCAGAAGAACATTTATCTGGTCAAGAAGTCGCAGAACTCATACAAGCA
8703	43	144	MW2_CDS_08576	MW1615	FALSE	unmapped	AGTTATGTCTTCTTTGCCTTAGCTTTTGTCAATGCATTACTGTATATCATGCAATACCGT
8704	43	142	MW2_CDS_05286	MW0979	FALSE	unmapped	AAGCAATTGATGGTCAAGCTGCTGAAGTTGATTACATTGGTATGCCAGCAGTATGCTTTA
8705	43	140	MW2_CDS_07394	MW1381	FALSE	unmapped	GAAAAGCAACAGGGCAAGCGCCAATTAAAGAAGTAATGACACCTACGAATATGAACGACA
8706	43	138	MW2_CDS_07965	MW1501	FALSE	unmapped	TCTAAGTCCGAAGGTATGACAGAATGGGAGCGAGGACTTAGAATGTTTCCTAAATCAGGT
8707	43	136	MW2_CDS_04121	MW0754	FALSE	unmapped	ACATCAATATACGATGGTATCAAGCAAGCGATGAAAGATATACCACAAACGTTTAGGCGT
8708	43	134	MW2_CDS_12468	MW2360	FALSE	unmapped	ACGGCACTGGTAAATCCTTAGAAGATCTTAAAGGTATTATCGATCAAGGTCAACCTGTGT
8709	43	132	MW2_CDS_09402	MW1767	FALSE	unmapped	TGGGGCGGTAAGTATAATGTTTCGGTTAGTTCAGAATCAAATGATGCTGTAAATGTTGTT
8710	43	130	MW2_CDS_08083	MW1522	FALSE	unmapped	AGAAGAAGATGAGCCAGAGATTGATTTTAGTGGTCTTGATATACCACGTGTTTTAGGGGA
8711	43	128	MW2_CDS_04545	MW0839	FALSE	unmapped	AGGTAAAGCACTAGGTGGTGGTGTCTTCCCAATTTCTGTTGTATTAGCAGATAAAGAAGT
8712	43	126	MW2_CDS_03588	MW0658	FALSE	unmapped	TCAAATTCTTTTAACGAACAAGAGTGCCAAGTTATTGCTGATCGTTATGCAGATAAGCAT
8713	43	124	agr_tiling 172_F		FALSE	unmapped	GTGCAGTTTCTAAACAATCTATAATTCGAGTTCTTAATTCTGCTGGATCATCTTTAAAAA
8714	43	122	MW2_CDS_05962	MW1109	FALSE	unmapped	TCTATTCCTCAAGGTATAAGCGCACTATTCCAATGTGATGTGGACGCAACACTTGAAGAA
8715	43	120	MW2_CDS_01833	MW0334	FALSE	unmapped	AGAAGTGAGACAAGAACGTGGTATCACTTTCGGTCTATTCCGATTAAGTGTTGGTCTCGA
8716	43	118	MW2_CDS_03306	MW0608	FALSE	unmapped	CGAGAATTGCAACGAAATACCTCGATGTAAGCACGCCATATGCTTTGCTTTTCTTCGATA
8717	43	116	MW2_CDS_01907	MW0350	FALSE	unmapped	ACTCGCTTTTTTATTTCCAAAATTTCCTCATATTAATTTATTACTTTTTAATCCTATCTT
8718	43	114	MW2_CDS_13361	MW2528	FALSE	unmapped	TGATTATGACTTAACGCATTTACATAGTGCCGTTTCTGCAGGTGAGCCACTAAATCGAGA
8719	43	112	MW2_CDS_04561	MW0842	FALSE	unmapped	CGATGGTTCACTTATCACGCTTTGCAGAGGAAATTATTTTCTGGTCCACAGACGAAGCTA
8720	43	110	MW2_CDS_11078	MW2094	FALSE	unmapped	ATGGCAGTTATATAATCTTTGGGTACTTCATCATATTTGCAGTCGAGCATTTAATGGATT
8721	43	108	MW2_CDS_13477	MW2550	FALSE	unmapped	CACAAGGGGATAAATTTGCCAAAGCTGTACCATTATCTGCTGTGTTTGAAGCGCAAAATT
8722	43	106	MW2_CDS_12022	MW2277	FALSE	unmapped	AAATCTGGTGGTAAGAAAAAGACGGTTATAGCTGAAGCAAATAAAGTGACGCCAATAGGT
8723	43	104	MW2_CDS_08145	MW1533	FALSE	unmapped	AGCACAACGTGTGTTAACAGATATTTTACCAGCAATAGACAATATAGAACGTGCACTTCA
8724	43	102	MW2_CDS_00137	MW0025	FALSE	unmapped	TCCAGGCTCTCAACACGGTCATGGCTATGATTTAGTAGCTTTTGATCCAACAAATACAGA
8725	43	100	NA		ignore		
8726	43	98	MW2_CDS_12247	MW2318	FALSE	unmapped	CTAATATTTTCACTGCAGGAGATACAGAGCCAGTAAAAGGAGCCCTACAACGTATGGCAA
8727	43	96	MW2_CDS_09423	MW1771	FALSE	unmapped	ATAAAGAAACCCAGCGTTTAATGAATGCATTAGAGGGGAACTTGCGAATCGTGGAAGATG
8728	43	94	MW2_CDS_09111	MW1709	FALSE	unmapped	AAAATGTACGCTTACATTCTGCGTGCCTTACAGGCGATATTTTCCATAGTCAACGTTGTG
8729	43	92	MW2_CDS_10470	MW1977	FALSE	unmapped	TCTATTGTTGGTCGCGGCTTAGGTAAAGATGTTGCATTAATTACTGATGGGCGTTTTTCC
8730	43	90	MW2_CDS_06536	MW1219	FALSE	unmapped	CAAGCATTAGAAGAAAAGAACGGACAATTATTAAAGAGAACTTTAAGGGAATATCCCGGT
8731	43	88	MW2_CDS_01330	MW0243	FALSE	unmapped	ATGTGCACAACATCTATTTATCTAGCTCATACATATGGCTGTCACATTCAAGGCGTTGAT
8732	43	86	MW2_CDS_01669	MW0304	FALSE	unmapped	GGATAAAGTGTTAAAGCCTAATCGCAAAAAGATTGCATCGAAAGGGATTAAATCTGTGCG
8733	43	84	MW2_CDS_02244	MW0415	FALSE	unmapped	AGTACCTGCATTGATGACACATGCATCCATTCCAGCAGATATTCGAGCTAAAGAAGGTAT
8734	43	82	MW2_CDS_06759	MW1262	FALSE	unmapped	TGAAAGTGATGAGTTCAATCTTTTCCTAGATTTATATCGTGAAACTGAAGAGCGTGCTGG
8735	43	80	MW2_CDS_07297	MW1363	FALSE	unmapped	TGGCTTTACCTACTAAAGCAATGCGAGAAGTTGCTTCTCAAATTAATGATAAGCTGACCT
8736	43	78	MW2_CDS_10185	MW1920	FALSE	unmapped	ACGAAAACGGCGGAAGTAGATGAAAACCTTGAGAAAGACAGAGAAGCTTTTATTAAGCGT
8737	43	76	MW2_CDS_02438	MW0451	FALSE	unmapped	AAATTAGATGCTGTTGTTACCATTGCGACAAAAGGTATTTCATTGGCAAATGCGGTTGCT
8738	43	74	MW2_CDS_03013	MW0554	FALSE	unmapped	TGCTTCGTTGTATTTCTATGTATTTTAATCTTTTTTGTGCTTCTGAATCGAAAATTAAAA
8739	43	72	MW2_CDS_07974	MW1502	FALSE	unmapped	TGAACAAGCCTTAATGGATCATAAACGTATTTTTGTACCGAAAATGGATTATTTAAATCA
8740	43	70	MW2_CDS_08937	MW1678	FALSE	unmapped	ATCGGCTATGGACACACTGTAAATGTCCCACTTGAACCGTATACAGAAGATGCATCATTT
8741	43	68	MW2_CDS_11858	MW2248	FALSE	unmapped	ACAAATACGTCGCATACTTTTTATCCTTTGTCTCAGGGTTACTTTACATTGGATTTGTAA
8742	43	66	MW2_CDS_05675	MW1054	FALSE	unmapped	TCAATAGCTTAATAACGCCTATTTGGATTTTATGCCTTGTGGGAATTATGACGCATATGA
8743	43	64	MW2_CDS_13610	MW2572	FALSE	unmapped	CCACCCTGGTGATATGAAACCACCACTAAACGTATATTTTAGTGGTTATCGAACAGCGGA
8744	43	62	MW2_CDS_00218	MW0041	FALSE	unmapped	ATGATCAACGTGAAGTAGGACGTCGTTTTGCTTACTGGATTAAGTACACGCCAGGATTAC
8745	43	60	MW2_CDS_03397	MW0623	FALSE	unmapped	ACTGCATACATTGACTGTTAAAGAAAACATAATGTTACCACTAACGGTTCAGAAGTTAGA
8746	43	58	MW2_CDS_12374	MW2343	FALSE	unmapped	CATTAGGATACAATATCGGTGGTAATTTCCAATCAGCCCCATCACTCGGTGGTAATGGAT
8747	43	56	agr_tiling 106_F		FALSE	unmapped	AAATTGATACATACACTACCAAAAAGATTGGTAGAACTATAAACACGCTGTGTGAAATTG
8748	43	54	MW2_CDS_09070	MW1701	FALSE	unmapped	CGCAATTGGATTGGACGTTCTGAAGGGGCCAAAGTTTCATTTGATGTAGATAATACGGAA
8749	43	52	MW2_CDS_02099	MW0388	FALSE	unmapped	CATTGGCATTAGGCTTATTAACTACTGGTGTGATTACATCAGAAGGCCAAGCAGTGCAAG
8750	43	50	agr_tiling 035_F		FALSE	unmapped	CAGTGACTTAGTAAAATGGATTATCGACACAGTGAACAAATTCACTAAAAAATAAGATGA
8751	43	48	MW2_CDS_08402	MW1581	FALSE	unmapped	TCCAAGTGAAACAGGTATTGGTTTTGCGCTAAGTATAGAACGATTATTGCTTGCACTTGA
8752	43	46	MW2_CDS_11105	MW2099	FALSE	unmapped	TCGGCTCAACGTTTGGTAAAACGAATCGCGTTATTATCGATACTGAAGACCACGAATACA
8753	43	44	MW2_CDS_04352	MW0802	FALSE	unmapped	GCAATTGCTGGACATGAAGGTGCTTTAAATGAAATTGAGACGAGTAGGTTGGAAGGTGTC
8754	43	42	MW2_CDS_11924	MW2259	FALSE	unmapped	TTTATATTAGCTGGCTTATGTGAAATAGGTGGGGGATACCTGATTTGGCTGTGGCTTAGG
8755	43	40	MW2_CDS_03913	MW0715	FALSE	unmapped	ACAACAGAGTTTGGTGAAGCGAAGCACGTTTCAGCTGAAGATGGTAAAGAAAAAGTGAAA
8756	43	38	MW2_CDS_12889	MW2439	FALSE	unmapped	GCAGGTACAGACATGACGTTCTTTGATTTTCCAAATATTACAAAAGGGCAGGCAGGAACA
8757	43	36	MW2_CDS_03065	MW0563	FALSE	unmapped	GACCAGCTATCGATGTGATTATTCCTGGTGCAAAACGTGCAGAACAAGTCGTTGAAAATA
8758	43	34	agr_tiling 143_R		FALSE	unmapped	ATTCGAGTTGCATTTATTGAAAGCGAAAATTCAGTAACGTTTATTGTTATGAATAAATGT
8759	43	32	MW2_CDS_03398	MW0624	FALSE	unmapped	TCCCTAATACTGATTTGAAACGTGGACAAGCTGATTTGTTTGTAGCGGAAGGTTCTATCA
8760	43	30	pMW2_042		FALSE	unmapped	TGGCCAATAAGCAAGTTGAAATATCTATGGCTGAATGGGATGTTATGAATATAATATGGG
8761	43	28	MW2_CDS_13552	MW2563	FALSE	unmapped	GGCGAACTAGGTAAAACAGAATGTTGGTATATTTTAGATGCAGCCCCAGGTGCTGAAATT
8762	43	26	MW2_CDS_00808	MW0150	FALSE	unmapped	TACGTGGGTAAAGGACCCAATAGTATTCGAGTGTCGTTTAAAGATAATTGGGCGATTGCA
8763	43	24	perR_tiling_037_F		FALSE	unmapped	TGATGCTAAAAAAGGCTATTAAATGAAATCATCATGTAAATATTGACACGCGCGCAATAC
8764	43	22	MW2_CDS_08087	MW1522	FALSE	unmapped	ACAAGAAATTAATCGAACATATAGAGATAAAGATAAAGTTACAGATGTAATCTCATTTGC
8765	43	20	MW2_CDS_12231	MW2315	FALSE	unmapped	TCTCCAATAAAATGGCACTATGTTTCAGGTAATAAAAATAATCGATTTAAATTGATTATT
8766	43	18	MW2_CDS_00093	MW0017	FALSE	unmapped	ACATCACGTGTTGGTGATGGTCCATTCCCTACTGAATTATTCGATGAAGATGGACATCAT
8767	43	16	MW2_CDS_00644	MW0119	FALSE	unmapped	GAAAAATGATGAAGTTAGTGTGAGCGCAGACTTCCTTGGACCCAAACCACAACACTTTAA
8768	43	14	MW2_CDS_02321	MW0428	FALSE	unmapped	GGATTAAATAAAGTCGTTCACGATTCGATAAAAATGTTGGTCGTTGGACCCGTAGCGCTT
8769	43	12	MW2_CDS_04808	MW0887	FALSE	unmapped	GTGAACAAGCGTCGCCAATAGAATTTGTTACTGGTCGTGTTAAACCAATCGCTAGTATTA
8770	43	10	MW2_CDS_01118	MW0206	FALSE	unmapped	ACAAGGTGAAATCGTTCAAGGTCCAGATTTCCCAACAATGGAACAAAACAGACCATCTTT
8771	43	8	MW2_CDS_03418	MW0627	FALSE	unmapped	AATTAGCACATATTGGTCAGACGCTAAGTATTGGGCTGGTAACGCAGCTAATGATGGTTA
8772	43	6	MW2_CDS_03340	MW0613	FALSE	unmapped	ACGAAAGGTAGAGCTGCATATTTTGGAGAAGAATCAAAAGGTTATATTGATCCAGGTGCT
8773	43	4	MW2_CDS_13021	MW2464	FALSE	unmapped	TCCATGTCCTGAAAGCATCTCAGTACCTGTAATTAAACGGGCACTATCAGTTTTCAACCA
8774	43	2	MW2_CDS_07000	MW1307	FALSE	unmapped	ACGGACACAGTAATAAGTAGAGCAGGATCAAATGCGATTTATGAGTTCTTAACATTACGT
8775	43	163	MW2_CDS_07910	MW1490	FALSE	unmapped	CGCATTCAAGAAATTTGATAGTCATTTGCTATCAATTTCAGAAATATATTATGAATTGCT
8776	43	161	MW2_CDS_10661	MW2013	FALSE	unmapped	TCAAGAAAAAGTGAAACGTGCGCGTACACAAGAAGAAAAAATGGCTGCAAACCAAGAATT
8777	43	159	MW2_CDS_13494	MW2553	FALSE	unmapped	ATCGATGATATTGATGTAGCAACACTGAAAAAATACGCGGCACAAGGTAAGTTTGCGGAA
8778	43	157	MW2_CDS_06818	MW1273	FALSE	unmapped	AGACAGCGATATCAGGAGCAACTTGATGATTTAATAAAGGAATTACGTCGGTTAGGTGCA
8779	43	155	MW2_CDS_04612	MW0851	FALSE	unmapped	ACAATGGTATTAGGTGTCATTCTACCGTTAGGGCCTATATCAAAATTATTCGGTATTGGC
8780	43	153	MW2_CDS_11193	MW2114	FALSE	unmapped	AGTTGATAAAGATGGTAAACCAAGTCGAATGAATCAACCTTATCAGCAATTACGCGTGCT
8781	43	151	MW2_CDS_07361	MW1375	FALSE	unmapped	GCGATGATCATGGCATTGTATTTAATGCAAGTTTGCCCTTGTACAAAGATGCCATCCATC
8782	43	149	MW2_CDS_08218	MW1546	FALSE	unmapped	TGATACGTTAGAAAACAGAGAATTGATTAAAGTACATGTACTACAAAATAACTTTGATGA
8783	43	147	MW2_CDS_13219	MW2502	FALSE	unmapped	TGCAATCACCAGCCAAATGTACTAAAGCAGAGTTTATAAAACGTTTAGCATGCCTTCCGT
8784	43	145	MW2_CDS_04827	MW0890	FALSE	unmapped	GCAGACGACCAAGAAGATGTTGCTCAAGTTATGAGAGACTATGATTTCATGGCTGTACCT
8785	43	143	MW2_CDS_12890	MW2439	FALSE	unmapped	TACGGTATGACAACTATTGCGCATGAAGATAATGTCGCATTACTTGAAGTTGGCGAAGGA
8786	43	141	MW2_CDS_01046	MW0193	FALSE	unmapped	GTTCAACATTCCATAAATTAAATAAACAGCATCATGCGGCAAACGCTTGGGGTTCATGGA
8787	43	139	MW2_CDS_10435	MW1971	FALSE	unmapped	GCGCACCAAGAAGAACAGTCAGTTAACGTACAAGCACATGAAAAGTCTATGGAACAATCG
8788	43	137	psma_tiling_049_R		FALSE	unmapped	CTCAATTAATCCTTTAATGAATTTAATGATTCCTGCAATGATACCCATGTGAAAGACCTC
8789	43	135	MW2_CDS_12216	MW2313	FALSE	unmapped	AGTCATTGCCGATGATCACGCTGTTGTCCGTACGGGGTTCTCTATGATTTTAAATTATCA
8790	43	133	MW2_CDS_08039	MW1514	FALSE	unmapped	AGATGATGAGTATGGCGGTTATGATGAGTATGGCGGTTATATTGAACCTGAGCCAATTGG
8791	43	131	MW2_CDS_10458	MW1975	FALSE	unmapped	ATGCGATTATTGTTGCTGAAGGTCCTGGTTCATATACTGGCTTACGTATCGGTGTTACTG
8792	43	129	MW2_CDS_05519	MW1023	FALSE	unmapped	TAAAGGTGCCGGTGCTAAAGTCGATGTAATCGCCGCCAAAATTATAAAAAAATACGGTCT
8793	43	127	MW2_CDS_02563	MW0474	FALSE	unmapped	GAGGCGATGGGTGTTGACTATATTGATGAATCAGAAGTGTTAACACCAGCAGATGAGGAA
8794	43	125	MW2_CDS_13246	MW2507	FALSE	unmapped	GAAAGTACAACAGTAAGTGGAAATAATAATGCTCATAGTGTGATAGATGATTTGATGAGT
8795	43	123	MW2_CDS_07342	MW1371	FALSE	unmapped	AGGGCCATGTTACTTACATTATTATTTGCAAGGCTATGATGAACCAATGTATACGAGACA
8796	43	121	MW2_CDS_12474	MW2361	FALSE	unmapped	ACCTGTGAAATTTGTTCCTGGAAACCATGATTTATGGGAAGTTGAAAGTATGACTACGCA
8797	43	119	MW2_CDS_13611	MW2573	FALSE	unmapped	AGTGCAATTAGCGCTGGGATTCCACAAATTAATGGTCAACAAACAGATTACGTCTCTGAT
8798	43	117	MW2_CDS_00182	MW0034	FALSE	unmapped	GCTTTCAGAACCAGAAACAAAAAATATCTACAGTCAAAGAAAAATTGATGTGGAACCTGT
8799	43	115	MW2_CDS_10113	MW1903	FALSE	unmapped	TGGAAAAAGGCCAGTATTTAAAGTCAGGTAAACGTGTTGAAATGACAGTAAAACGTGCTG
8800	43	113	NC_A_011		FALSE	unmapped	AATACAATTTATTGACGCGCGTGAATCTCTTTTATAAGAGTGTGTAGGGAATGGCGTTGT
8801	43	111	(+)E1A_r60_3		pos		
8802	43	109	MW2_CDS_05316	MW0984	FALSE	unmapped	AATGCTGCAAGAGATTTAGGAGCGACTGAACCACAATTATTAAGCAACATTATTATTCCT
8803	43	107	MW2_CDS_06269	MW1164	FALSE	unmapped	TAAGTTGATTGGCATTAGAGGTATGCCACGAGTTGGTAAAACTGAATCAATTGTTGCGGG
8804	43	105	(-)3xSLv1		neg		
8805	43	103	MW2_CDS_09139	MW1714	FALSE	unmapped	ACACGTCTTAACACAAAAAGATGTTAAGATTTCTTGGGGCACATACTTTAAAACCGGTAT
8806	43	101	MW2_CDS_05257	MW0974	FALSE	unmapped	AACAATGAAAGACATCATTAGAGATGGTCATCCAACTTTGCGTCAAAAAGCAGCTGAGTT
8807	43	99	MW2_CDS_05987	MW1113	FALSE	unmapped	TGAATGGCGTGATGCTAAGTTTCCTGTAGTTCAAAATGTAAATGCGCAAGGTGAAACTGA
8808	43	97	agr_tiling 179_F		FALSE	unmapped	ATGGGCAATGAGTCTGTGAGATTTTGTTGATGATTCAAAAAACATAATATCATCATATTG
8809	43	95	MW2_CDS_02292	MW0423	FALSE	unmapped	ATTTTTGGCGTACCGATTTATGTCGTCACATTCTTTTTCTGCATTATTATTGGCGCTTGT
8810	43	93	MW2_CDS_09574	MW1798	FALSE	unmapped	ATCAATCTTGAAATCAATCAAGGGGAAGTAGTAGCAATAATAGGTCCATCTGGTAGTGGT
8811	43	91	MW2_CDS_00783	MW0146	FALSE	unmapped	CATGACATTGATGAAGCTATTTATCTTTCCGACCGCATTGTTCTGTTAGGTGAAGGGTGC
8812	43	89	MW2_CDS_12283	MW2324	FALSE	unmapped	ACAACTCATGCATGAAGCATTTACGCCTCTAAGAGAACTAGGTATTGATTGGCCTTCAGT
8813	43	87	MW2_CDS_04899	MW0903	FALSE	unmapped	AGAACGGTGTTGTTGTAGATCAAGTTGACAACAATGGTTTAGCAGATCAATCTGGTCTGA
8814	43	85	MW2_CDS_12029	MW2279	FALSE	unmapped	ACAAGGACCAGACGAACCAATTTCTGAAGCTTTAGCTATGCAACGTTATTTGATTGCACA
8815	43	83	MW2_CDS_04485	MW0828	FALSE	unmapped	TGCAATGTCATTACTATTTGGTACGTTTTTATATTTTATTGCTACTCAAGGTTTTGTAAA
8816	43	81	MW2_CDS_02837	MW0522	FALSE	unmapped	TCCTGATGATGAAACCTTCTCATCTGCAGGCACATTAGCAAGTTATATCCAAAAAGGCAT
8817	43	79	MW2_CDS_01287	MW0236	FALSE	unmapped	GCAGAAGGATTGGCAAATATTTTTAGTAGCCAAATTGAACTTGGTGAAGCCGAAACGCAA
8818	43	77	MW2_CDS_11691	MW2215	FALSE	unmapped	AGTTGTGACTATGTATCGTATTTATTGTCGTCACAAGAATTATTTCGAAATCTAAAGTGT
8819	43	75	MW2_CDS_08994	MW1687	FALSE	unmapped	GTGCTACAGTATTTGAATTCACTGCAGGCTGGTGTCCAGATTGTAGAGTGATAGAACCAG
8820	43	73	MW2_CDS_09745	MW1829	FALSE	unmapped	ATCATTTACTTACCTAAAAATACTCGTGTTAACTTTTCAGGTGACGAAAAAATGGCATTG
8821	43	71	agr_tiling 057_R		FALSE	unmapped	TCATATTCAATTTTTGCAAGTACGATTAGGGATGCAGGTCTTAGCTAAAAATATAGGTAA
8822	43	69	MW2_CDS_13308	MW2518	FALSE	unmapped	TCCAGTCATTGGTATTGGTGCAGGAAAAGGTACAGATGGTCAAGTATTGGTTTATCACGA
8823	43	67	MW2_CDS_03628	MW0664	FALSE	unmapped	GGCTGATGAATGGTTCTGCACGTGTTATTATTAGAATGTTTGGTGTAAATCCTGATGCCC
8824	43	65	MW2_CDS_08651	MW1628	FALSE	unmapped	GTGAATCCAAAGCCACAAAGTGATGAATGGTTTGAGTTACTTGAACAAACGAGTCCAATT
8825	43	63	(+)E1A_r60_n9		pos		
8826	43	61	MW2_CDS_06637	MW1240	FALSE	unmapped	TGGCTTATTCGCTATACTTGGACACGTTTATCCTGTTTATTTAAAATTCCAAGGTGGCAA
8827	43	59	MW2_CDS_06118	MW1137	FALSE	unmapped	GTTTATAGGTGCTGGAGCTTTCCATGTATCTAAGCCGAGTGACTTGATACCAGAATTGCA
8828	43	57	MW2_CDS_13310	MW2519	FALSE	unmapped	TCGGGAGACACGCCAAAACAATAACATATTATACTGTACCACATGCACCTGCACAAGATA
8829	43	55	MW2_CDS_01694	MW0309	FALSE	unmapped	CCACATATTGCACTTATTCACGCTGGTACTGATTATGTACAGAATGGTGTAGGTTTCGCA
8830	43	53	MW2_CDS_08819	MW1656	FALSE	unmapped	ACAGTGTTAGATAATGACTTAAATCAAGTAACATTAGCAGATTATGCTGGTAAAAAGAAA
8831	43	51	MW2_CDS_11826	MW2243	FALSE	unmapped	ACTAGAAATATCGACATTCTATCTGCCAATTATAGATCGTCATCTATGAGCAAAGCTCGT
8832	43	49	MW2_CDS_08089	MW1523	FALSE	unmapped	GCAACTCCGTAAAGGTGCTGTTAAACGTATTGTATTAACAAGACCTGCTGTTGAAGCAGG
8833	43	47	MW2_CDS_03053	MW0561	FALSE	unmapped	ACCTGGTTAACTTTATTTCTTCCTATGATTAATTGGTTAATTCCAAAAAAATATGTCAAA
8834	43	45	MW2_CDS_13439	MW2542	FALSE	unmapped	ACAAGTTAAAACAGGCTAGTGATGATATTCCAATAGACTTCATTGGTAATGAAGGCGCGA
8835	43	43	MW2_CDS_00815	MW0151	FALSE	unmapped	ACAATTGGTATTTTTGGATTTGGTCGAATTGGACAACTTGTTGCTGAAAGATTAGCGCCA
8836	43	41	MW2_CDS_08542	MW1609	FALSE	unmapped	CAGGAGGGGTTAATCAGATAGTTTTAGTTGCATTAGCTACTGGTGCCGATGTTGCTATGA
8837	43	39	MW2_CDS_08919	MW1675	FALSE	unmapped	AGGTGCAATCATGACTATGCCTGGTTTACCTAAAAAACCAGCAGCATTAAACATGGATGT
8838	43	37	MW2_CDS_08386	MW1578	FALSE	unmapped	AGAGTGTCTTGACCGAGGGATTAAAGTGATTTCCAGTATGGGTGCTGCAAATAAAACAGA
8839	43	35	MW2_CDS_00230	MW0043	FALSE	unmapped	ATGCAAGAGATTTAAAAGTAGCAATTCGCGAAGCACTGGTTAATACATTAATGCATGCGT
8840	43	33	MW2_CDS_03837	MW0701	FALSE	unmapped	TCATAAATATAATAAGAAAGTTATGATGGCGAAGTTTAACAATTTTCATGAACTAAAACA
8841	43	31	MW2_CDS_06924	MW1293	FALSE	unmapped	TTTGGTTGATGCATATACACGTCTAGCAAAAATGCCCAAAAAATCAATTAATGAACAGCA
8842	43	29	MW2_CDS_00251	MW0047	FALSE	unmapped	AGACAAAATTCCTATGAATATAGCTGATGATATTAAATTTCATGTTGTGATTTACAGTGA
8843	43	27	MW2_CDS_09336	MW1754	FALSE	unmapped	CCAGGTAAAGAAGATGTATCAGTCATTCAAGTTGAAGAGCGTGCAATAGAACGTGGACCA
8844	43	25	MW2_CDS_12899	MW2441	FALSE	unmapped	TGATCATACAGGCGTATCTGATGAACTCGGTGGTCAAGGTGTTGGCAAAAAACTAGTTAA
8845	43	23	MW2_CDS_12592	MW2382	FALSE	unmapped	AGACGAAGCCAAAAAGTTATTCGCCAAATCTGAAAGTATTTTCAAAGACCTTAAAGGCGT
8846	43	21	MW2_CDS_04180	MW0765	FALSE	unmapped	ACAAAGTGAGGAGTTCTTAAAAGAAATTGAAGATATAAAAAAAGATAACCCTGAATTGAA
8847	43	19	MW2_CDS_13155	MW2489	FALSE	unmapped	ATGTTTGTTGATAAAGGTTATAGGAATTTAAAAATAGGTAAAAAACTTTTAGATAAAGTT
8848	43	17	MW2_CDS_10190	MW1921	FALSE	unmapped	AAACAAGCAGAGAACGTTAATAAATACCTATCTAAAGGATCGTTGGCGGGCGTAGATGGT
8849	43	15	MW2_CDS_04574	MW0844	FALSE	unmapped	AGTGCCAACTACACAACTGATTTACATTCTTTAGGTCAATATGTACAAGAAGGCCGTCGT
8850	43	13	MW2_CDS_01014	MW0188	FALSE	unmapped	AGTCAAAGCAGGTGATATTATTGCATATTCAGGCAATACAGGTAAACAAACGACAGGCGC
8851	43	11	MW2_CDS_13683	MW2585	FALSE	unmapped	TTCGACATCGAAGAAAGGTATATTAGAATGTACGTTCAATTATCTAATACGCCTGAGGAA
8852	43	9	MW2_CDS_13326	MW2521	FALSE	unmapped	AGAGTGTTATGGATAGTGGCTTTGATGGATATTTCTTAATCGCGGCAAACCCTGTAGACA
8853	43	7	MW2_CDS_05065	MW0937	FALSE	unmapped	GAATCTGAATCTATTCACCTCATTGGATATGATAATGGACAGCCAGTTGCCACTGCTCGA
8854	43	5	MW2_CDS_07038	MW1315	FALSE	unmapped	GGTACACTAGATGATGGTCGCTTAGAGCTTGTGCACAATGCGAGAACTCAAAATTCTAGT
8855	43	3	MW2_CDS_04943	MW0912	FALSE	unmapped	ATTTAACTTTAGCACTTGGATTATCAACAGCAGCTTATGCATCTACAGAATACGCAGAAG
8856	43	1	MW2_CDS_09645	MW1810	FALSE	unmapped	AGGTATGTAACAGAACGTTTAAAACAAAGTTGGAAAAGTTTTCTAATCGTATTAGCTGCA
8857	42	164	MW2_CDS_01626	MW0297	FALSE	unmapped	GTCCAATCAACCATTTGTTAATGTTACGAATGATGAACCTGCCACACGCAGAGGTATCTG
8858	42	162	MW2_CDS_00406	MW0077	FALSE	unmapped	CACAGATGAAACGATTACTGATATTGCATTGCAAAATGGCTTTTCAAGTGCAGCGAGCTT
8859	42	160	MW2_CDS_13700	MW2588	FALSE	unmapped	ACTAAAAGAAATGTATAAAACTGGGTTATGGGAATTTGAAACACATACCCACGATTTGCA
8860	42	158	MW2_CDS_13318	MW2520	FALSE	unmapped	ATTCGTGGTGCCATTGTTGGATTTTTTACACCAGAATTATTTCATGGCGTAGGATCTGCT
8861	42	156	MW2_CDS_12532	MW2371	FALSE	unmapped	CTGATGATTGTAACTGCAACGGTACTCGTTACTGCACTAGCATTAGGTGTTGATGCCTTA
8862	42	154	MW2_CDS_08168	MW1537	FALSE	unmapped	AGACAAAGCTGCTCAAAGTAATTTAATACATTCAAACAAAGCTGACCGTATTAAATCACA
8863	42	152	MW2_CDS_05657	MW1051	FALSE	unmapped	TTTGCTGAATGTGGCGCAATGAGTCAAGCTTACATCGGCTATCAATTACAAGAAAGCTTA
8864	42	150	MW2_CDS_13140	MW2487	FALSE	unmapped	GTGCTGGTGTGGTTACGTCTCGTACAATTTCAGCAAACCAAGCAGGTTCATATAATTTCA
8865	42	148	MW2_CDS_13167	MW2491	FALSE	unmapped	CGGTGCAGCGCAGTTTAAAAATGGTGCTTGGATGATTACGGGTATTGGTGATTTAATTAA
8866	42	146	MW2_CDS_10969	MW2071	FALSE	unmapped	TGCAGATAGTACACACCTGATTGGTATTGCTATTACAACTCAAAGCATCATAATCATTGT
8867	42	144	MW2_CDS_13225	MW2503	FALSE	unmapped	CAATGATTCGAAAAGACGGCATGCTCTTGTTTAATTTGCATCAGGGCGCCTTATTACAAG
8868	42	142	MW2_CDS_11711	MW2219	FALSE	unmapped	GGCTGTGTTTGGCGATAAAATGTCACCATTATCAGATACAACTAATTTAGCGGCGCTTGT
8869	42	140	MW2_CDS_04221	MW0773	FALSE	unmapped	ATCTACCAAGCTTATAAATTTGGTGTAAGTGAAAAATCAGTTAAAAGTTATGGATTACAT
8870	42	138	MW2_CDS_09376	MW1761	FALSE	unmapped	TCAAGCTGGAACTTCATTAGCCACACCTAAAGTTTCGGGAGCACTAGCTTTAATCATTGA
8871	42	136	MW2_CDS_06567	MW1226	FALSE	unmapped	TGGAGCCAATTTACCTAGACAATGTTGCTGTAATTGGGAAAGTAATTGGTTTGTACCGCG
8872	42	134	NC_A_107		FALSE	unmapped	TCCTATTAAGGTTGAATCGCGTTAACAGCATATAGGAAATGCTGTTAGGCGATGCAGAGT
8873	42	132	MW2_CDS_05074	MW0939	FALSE	unmapped	TCTAACGAGAACAATGATTCAACTAATAACAGTGATTCCAGCAATCAACAACAACCTGCT
8874	42	130	MW2_CDS_12110	MW2292	FALSE	unmapped	ACGGTTTATTAATGGCACTATTTTCAATAGGTTTAATTGTAGGTTCATTAATCACACCTT
8875	42	128	MW2_CDS_11862	MW2249	FALSE	unmapped	TGCTATTAGCGTCAGAAGAATCAAGTTATACAACTGGACAAGTGTTCGGTGTTAGCGGTG
8876	42	126	(+)E1A_r60_n11		pos		
8877	42	124	MW2_CDS_08496	MW1599	FALSE	unmapped	CGGCTTAGCTAAAGAAGTTAGGGTTAAGACTGGTGCAGACTTAACAGATTTGAGTCATGT
8878	42	122	MW2_CDS_13885	MW2620	FALSE	unmapped	TCTGTTCAAAAAATGTCGAAGGCAACAATGGAAGAAAATTACAAAGCGATCACGACAGCA
8879	42	120	MW2_CDS_09478	MW1781	FALSE	unmapped	ACCTACGTCAATCAACCTGTACACAAATTTTATTTTTGCATTAACTTAATATTGCCGTTA
8880	42	118	MW2_CDS_10438	MW1971	FALSE	unmapped	GCTAATCAACAAAAAGCGCTTAATGGCGATATTACTTTCGGCGCAAATTTACAAATTGGT
8881	42	116	NC_S_006		FALSE	unmapped	CCCCGACGGCATGTGCGTGAAGAGATGAAAGATACTGCTTCTACCCTTGCAAATATATCA
8882	42	114	MW2_CDS_05581	MW1034	FALSE	unmapped	AGAAGCTGCTGCAAAAGCATTGAATAAAACAGTCATAGCTGATGACAGTGGACTAGAAGT
8883	42	112	perR_tiling_112_F		FALSE	unmapped	TTGTAAACGTTCACTTTCACTAAAATTCATTTATATCAACCTCTTTTAATTTAATATTTT
8884	42	110	MW2_CDS_08897	MW1670	FALSE	unmapped	GTATCATTTCAGCAAGCGAACGTACTATTGACGCTGAGACAACTGGTGGCAATACAAAAG
8885	42	108	MW2_CDS_05243	MW0970	FALSE	unmapped	AACTTTGATCATGTCATTGTGGCAATTGGTGAAAATATTCAATCAAGTACGTTGACGACT
8886	42	106	MW2_CDS_11361	MW2149	FALSE	unmapped	ACCACAATCAATTCAGATTGGTGGTACAAGTTTACTTATCGTTATTGGTGTAGCGATTGA
8887	42	104	MW2_CDS_05357	MW0992	FALSE	unmapped	TTGGCGGTCGTCGTAATGGTGCATTAATTTCAATGGATCAAGGTTCTGCAAGTACTTATG
8888	42	102	MW2_CDS_04966	MW0917	FALSE	unmapped	GACTAGAACTTATAATATTATTGGTATCCTTTCTTGTCTTATATCTTTTATTATTATGGC
8889	42	100	MW2_CDS_08835	MW1659	FALSE	unmapped	ACGACGAGTGCTTGTTCATCTAAACGTAATAAATTAAATGAAGTATTGGCTGCAATGGGA
8890	42	98	MW2_CDS_08136	MW1531	FALSE	unmapped	TGGAAGTGGTCAAGAATTTGAAGAAGCTTGTCCAACATGTCACGGAAAAGGTACTGAAAA
8891	42	96	MW2_CDS_05721	MW1065	FALSE	unmapped	TCGGATTTACAATGTATGCCATCATGAGCTTTGTGTTAGGAGAAACGGCAATTGGTATTT
8892	42	94	MW2_CDS_12876	MW2437	FALSE	unmapped	TGCTTGGCGGTGTTACCCCATTTTTAATTGCGATTGTCATTATGATTGCGGTCTACTATT
8893	42	92	MW2_CDS_12555	MW2375	FALSE	unmapped	TGAGCCATACTTCCATAAAGTCGTTCTACTAAGTGGCGCACTACGATTAGACACCCTTAA
8894	42	90	MW2_CDS_08061	MW1518	FALSE	unmapped	CATGGTGCAAAAGTACCACTTATGGCTAGGCGTGCTAAAAAAGTTAAGACGGGTTTACAA
8895	42	88	MW2_CDS_12901	MW2442	FALSE	unmapped	GCGGCTAACACTTGGCAATCCAATCAAGCAAGACAAAACAATGCACAAAGTTATGGATTA
8896	42	86	MW2_CDS_05188	MW0959	FALSE	unmapped	TCTAGGTGAGTGGATTACAATTACAGGGGCAAATGGTAGTGGTAAAACAACCTTGCTTGA
8897	42	84	NC_S_031		FALSE	unmapped	AGGCGTCAATTTAGACGCAGAGAGGAGGTGTATAAGGTGATGCTTATTTTCGTTCACATC
8898	42	82	MW2_CDS_07783	MW1467	FALSE	unmapped	TGCGCCTTCAAGTCCGTCATTTGCATTAGTAAAAGATGGAAAGATTACAGAAATGATTGA
8899	42	80	DCP_1_1		pos		
8900	42	78	MW2_CDS_01257	MW0231	FALSE	unmapped	CGCGACGCCACAACAATGGATGACGCATACGAAAGATACACTTAGAAAATTCAAAATTTC
8901	42	76	MW2_CDS_06134	MW1139	FALSE	unmapped	ACAAGCACAAGAATCAGTTAAATCTGAAGCAGAACGTGCTGGTCAATTCTACATTAACCA
8902	42	74	agr_tiling 086_R		FALSE	unmapped	AATTGTGATTTTTTATTGGACGAAGCTGAAGTACCAAAAGAATTAACTCAATTACACGAA
8903	42	72	MW2_CDS_04281	MW0787	FALSE	unmapped	ACTTGGTGGTTATCCATATTTTGACCAAATAGATCCAAGAACGAACGATCAAGAACTGAA
8904	42	70	MW2_CDS_06742	MW1259	FALSE	unmapped	AGGTCCAGACCCGTTCCCAACGATTGTTAGAGATTTTCAGAGTGTGATTGGTAAAGAAAT
8905	42	68	MW2_CDS_12211	MW2312	FALSE	unmapped	TGGTCATACGAAAGCATATCAATCATTTATTAGACGTAAAGACAGCTTACAATCGCAGGA
8906	42	66	MW2_CDS_02240	MW0414	FALSE	unmapped	TACATTTACAGGTACCGCACGTTATTTAAAGCAACATCACGTGCAATGTTATGCCGTTGA
8907	42	64	MW2_CDS_00100	MW0018	FALSE	unmapped	TATCATGTTACCTGGTCGTGATGGTATGGAAGTATGTCGTGAAGTGCGCAAAAAATACGA
8908	42	62	MW2_CDS_08231	MW1548	FALSE	unmapped	CAATTGCGAATATTCGAGAAAATGAAGATGTGTATATTGTAGGGACAACGAATGTTGGGA
8909	42	60	MW2_CDS_07736	MW1459	FALSE	unmapped	AATGGTCCATTAGAAAGTGATTTACTACTTGCTCGTGATGGTAACCATTGGTGGGACGAT
8910	42	58	MW2_CDS_08979	MW1685	FALSE	unmapped	TGGACAGAAAGTTGTTGTTGCTAAAGTAGGTGCAGTGATGCCTAGCGGTATGGTAATTAA
8911	42	56	MW2_CDS_00112	MW0020	FALSE	unmapped	ACCATCGTTCGTAGTTCAAAGAGTGGTGTTACAACCTACAACAATAATACAGGTGTCGCA
8912	42	54	RC10		pos		
8913	42	52	MW2_CDS_07407	MW1385	FALSE	unmapped	GTTTGGCAGTCCTTTTGGAGGAGGAAAGATTTCATTGAATCCCTCAAATCTTCCAGATGG
8914	42	50	MW2_CDS_13712	MW2590	FALSE	unmapped	CAGAAGGTACACCTAGTTGGACATAGTATGGGCGGTCAAACGATACGTCAACTAGAAGAA
8915	42	48	MW2_CDS_06853	MW1279	FALSE	unmapped	TCAGAACGTAAAGCTGAACCAAGATTAGGTGAATCTGTTCAAGTTAGAATTATCGGGCAT
8916	42	46	MW2_CDS_04441	MW0819	FALSE	unmapped	TATATGTGCAAGTTGCGTTAATGCGCCAACATCGAAAGATATTTATGACTGGCTACAGCC
8917	42	44	MW2_CDS_04510	MW0833	FALSE	unmapped	TTTCGTCGGCGGATTATTATTCGCAAGTTCACTTGTTATCATTACGATTGCATTTGATAT
8918	42	42	MW2_CDS_04509	MW0833	FALSE	unmapped	AGAAACAATGCGTAAAATTTTCCCATTAGATTTTAAAATCTTGATAGGTATCGGATTAGT
8919	42	40	MW2_CDS_05777	MW1074	FALSE	unmapped	TCTAATGAGAATTGGAAAAATGAAAGTGCAACAGTTAGTTCTTTAAGGTTAGATGTTGTT
8920	42	38	MW2_CDS_08768	MW1648	FALSE	unmapped	CAGATTATAAGCGTATGGCGAATCGAACTGGCCATACAAGATTTCCGGTAGTCAATGAGT
8921	42	36	MW2_CDS_03755	MW0687	FALSE	unmapped	TGCTACAGCAGCAATGGATGTACCAACATCATTTAGTGATAAATATGAATGGTTACTAGA
8922	42	34	pMW2_063		FALSE	unmapped	CGTATCTGTTTTTTCTTTTGATCGCACAACTAATTTGAAATTTGGGTATCTAGATTCTCC
8923	42	32	MW2_CDS_00390	MW0074	FALSE	unmapped	ACCCAGAAAAGGTAAGTGCATTAGATAACGGTGGTGTCAATGAAAGTAAACTTGCTACCG
8924	42	30	MW2_CDS_05636	MW1047	FALSE	unmapped	ACACACAGCCTCATTTTTCATTTTCAAATAAATGGCTATATCAATATGATAATGGAAACA
8925	42	28	MW2_CDS_04765	MW0879	FALSE	unmapped	ACCATTACAAGACTTATATTCAATCATTCAAGATAATCCTGGCTTATTACGTCGTCCAAT
8926	42	26	MW2_CDS_09071	MW1702	FALSE	unmapped	GGACAGTACCAAGGTTTTGTGAATTCAGCTGCTACAGTAGGAAAAGCATTTGGTCCATTT
8927	42	24	(-)3xSLv1		neg		
8928	42	22	MW2_CDS_06129	MW1139	FALSE	unmapped	GCAGTAATTTCAATGAAACAATTACTAGAAGCGGGTGTTCACTTCGGTCACCAAACACGT
8929	42	20	MW2_CDS_02123	MW0392	FALSE	unmapped	GCGCCAAAGTCCAAAGCAGACTTTGCCTTTATTCAACACATGGTACATTACTTAGACGAT
8930	42	18	NA		ignore		
8931	42	16	MW2_CDS_09415	MW1769	FALSE	unmapped	GGGAACATAGAAAAAGATAGGTTTTCAATTTCAATCATTTTCAAAGATACCTATCACACC
8932	42	14	MW2_CDS_01124	MW0207	FALSE	unmapped	TATATCACGTACGAATGTGAATGGTGGCGCTATTGCTTTAGGTCATCCATTAGGTGCTAC
8933	42	12	MW2_CDS_10587	MW1999	FALSE	unmapped	CTGATGCTCGTCATATATCTACTTCAAGAGTGGCCGACTTGATTCAACATCGTAAGCAGC
8934	42	10	MW2_CDS_07042	MW1315	FALSE	unmapped	TCTTCAGGATTAAGTGGTACATATAACACTGCTTACCAAGCAAGTCAAATGGTAGATGCT
8935	42	8	MW2_CDS_01194	MW0219	FALSE	unmapped	TAATTAAACCAGCTGCCTTTGCTTCTGAAATACATGGGGAATCTGGATTAGATGGTCCGA
8936	42	6	(+)E1A_r60_a104		pos		
8937	42	4	MW2_CDS_03181	MW0585	FALSE	unmapped	GCGTCAACTATTTCCTAAAATGAATCTAGTCATGACGATAGCGGCTCTATCTATGGCTGG
8938	42	2	MW2_CDS_08873	MW1666	FALSE	unmapped	GAGGTAGAACTATCAAACGATAGCGATTCCGTTAAAGTTGGCGCTTCTGTCTTTACAGGT
8939	42	163	MW2_CDS_12622	MW2388	FALSE	unmapped	TGTTGTTGTGATGAAAAATGGTCAGCTTATTGAACAAGGGACACGTGAATCAGTCTTGCA
8940	42	161	MW2_CDS_07482	MW1399	FALSE	unmapped	TCATGGGTTATGACTGTAGGTAATGCAGAAGAATTAAGAAAGACAGCGGATTTACTTGAA
8941	42	159	MW2_CDS_04613	MW0851	FALSE	unmapped	TCGATTGCTAAAAGAAAGAGACATGAACAAAGTCACAAAATGTTTTGGATAACAATGGCA
8942	42	157	MW2_CDS_02174	MW0401	FALSE	unmapped	AGGTGAAAAAAGCGATTTGTCAGTAATAGATTCATTAAATTTCCAGCCGGCGAAGGTGGA
8943	42	155	MW2_CDS_02256	MW0417	FALSE	unmapped	GTACCATTCACAAAATTAGTAGTAGGTACTTCAATTGGTACGACTGCTGCCATCGTGCCT
8944	42	153	MW2_CDS_04428	MW0816	FALSE	unmapped	TGGAATTTAGAGAACAAGTATTAAATTTATTAGCAGAAGTAGCAGAAAATGATATTGTAA
8945	42	151	MW2_CDS_06423	MW1192	FALSE	unmapped	CGCAACATTTATGCCTAAACCATTATTTGGTGTGAATGGTAGCGGTATGCACTTTAACGT
8946	42	149	pMW2_034		FALSE	unmapped	GCAGCACGTGCTAGAGGCCGATATGGAGGCAGACCAGAAAAATTAAATCAAAAAGATTTA
8947	42	147	MW2_CDS_03444	MW0631	FALSE	unmapped	GGGTGTATCTGGATCAGTTGCTTATATGTTTGATCATGTGGCAACATTTGGTATTGAAGG
8948	42	145	MW2_CDS_02393	MW0442	FALSE	unmapped	AAAGAGAATCAGCAACACCAACATCAAAAAGAAGCACATAAGATAGCGAGACATGAGATT
8949	42	143	MW2_CDS_12250	MW2318	FALSE	unmapped	TATTTACCACGTTTATGTGAACATTGCTTGAATCCAAGTTGCGTTGCATCGTGTCCTTCA
8950	42	141	MW2_CDS_05882	MW1094	FALSE	unmapped	GAAAAATGGGTTATGCAATAGCTGAAGCATTGCGAAATCGAGGAGCTATCGTGACGTTAG
8951	42	139	MW2_CDS_09940	MW1865	FALSE	unmapped	AAAAAAGATTTTGAAGATATTGAAAGAAAAACTAAAGAAATTATTTCTGATATTGAAAGT
8952	42	137	NA		ignore		
8953	42	135	MW2_CDS_00180	MW0034	FALSE	unmapped	TCAAGAGACCTACGGTCATTTACCTGAATATATTGTAGCTGATGCAGGTTATGGTAGTGA
8954	42	133	MW2_CDS_02662	MW0492	FALSE	unmapped	CAAAATGCAAGACTTAAACGCTGCTGACGAAGAAGCAGCTATGCGTATTATCGAAGGTAC
8955	42	131	MW2_CDS_09559	MW1796	FALSE	unmapped	TTTGGAAAAGAGACGACAGGATTACCAGACTGGGTGAAAGAGAAATATCAAGACACAGCA
8956	42	129	MW2_CDS_10241	MW1933	FALSE	unmapped	ACGTTCAAACCTATACGATATAAAGATAAAAACTACTCCATTCCATTTACTTTAGGACCT
8957	42	127	MW2_CDS_11990	MW2272	FALSE	unmapped	TGGGTAATATCAATGATTTACAACAAGGAATCGATCGCTTAATTTTAGTCTTTAACGGTT
8958	42	125	MW2_CDS_05808	MW1080	FALSE	unmapped	TGATCGTCAATCTATGGCTGTTGTTGATGATGGTAAGGAAGCAGTGACACATTTTAACGT
8959	42	123	MW2_CDS_03414	MW0626	FALSE	unmapped	TACTTGGTTTTACGGAATTCCAAGTTCGTCTTCACATGCACTTATAGGTTCAATTGCGGG
8960	42	121	MW2_CDS_02864	MW0527	FALSE	unmapped	ACACGAAAAAATGTGGTGAAGTAGCAACACAAAGTGCATTTAAAGCATGTGGCTTAACGG
8961	42	119	MW2_CDS_10705	MW2022	FALSE	unmapped	ACGTCAACAGTATGCTGAAAGTTTATTAGAACAACTTATTGATGATGGATTATCTGGTGA
8962	42	117	MW2_CDS_06801	MW1270	FALSE	unmapped	TGCCGATTATCCCATTACTAGGGATTTCACTTGGCAGTCTAATAGGTGGTACTGTAGTGA
8963	42	115	MW2_CDS_02375	MW0439	FALSE	unmapped	GCATTAAGGAAATCAGTTATACGTTGGTGTGAATTGTTGCTTACTAATAAGCCAATGGCA
8964	42	113	MW2_CDS_10507	MW1984	FALSE	unmapped	GTGGTTTCGGTCCATTTGCTTTTGATGAATGGCGGTACTTACCTGATGGTTCAGATAATC
8965	42	111	(+)E1A_r60_1		pos		
8966	42	109	ETG05_36762		pos		
8967	42	107	MW2_CDS_00921	MW0169	FALSE	unmapped	GGATTCACTGGTACGCCACGTTTTCCAGAAAATAGTAGTCAAGATGGTAGAACAACTGCA
8968	42	105	MW2_CDS_09635	MW1809	FALSE	unmapped	CCAACCCATTTCATGTATGGATGTGGGCTCAGCTCGCAGTATTTTTACATGTCTTTGTAG
8969	42	103	MW2_CDS_00781	MW0145	FALSE	unmapped	AACAGAAGCAGATATTAGTATTCAATTAGTCAAAGAAGTACGCTTAGTTGGTAAAGATTT
8970	42	101	MW2_CDS_09083	MW1704	FALSE	unmapped	ATTGTTGTAGACGCAACTTGCGGTAACGGCAATGACACTTTATTTTTAGCCGAACAAGTA
8971	42	99	MW2_CDS_13764	MW2599	FALSE	unmapped	CAGCAGTTGAGAGACAACGTGCATTTTGTTGTATTGGGACATTATCAATTGCTTGATGCC
8972	42	97	MW2_CDS_12131	MW2296	FALSE	unmapped	AGTCAATGCCGCGGACATCAATGGTTTGACGAATCCAGTAAAAGTGGATAATGAAAAACT
8973	42	95	perR_tiling_008_R		FALSE	unmapped	AACTTCTTAAATATTACGCTTACTTATATGAAGTAAGCTAACGCCTTTTTAATTTGTCAT
8974	42	93	MW2_CDS_04952	MW0914	FALSE	unmapped	ATCATCTTGATGGGGAAATCAGTGGAATAACCAATTATAAAGATAGCGTGATGGAAATGT
8975	42	91	MW2_CDS_08713	MW1639	FALSE	unmapped	TGAAAGAGCAATGCGTATACAGGCTAAAGTAGCATCATTAGTTACAGCGTTTGCTCGAGT
8976	42	89	MW2_CDS_08977	MW1684	FALSE	unmapped	CGTATAGAAGCGCCTATTCCAGGAACTAGTCGTGTTGGTATTGAAGTTCCGAACCAAAAT
8977	42	87	MW2_CDS_07673	MW1448	FALSE	unmapped	AGAAGATTTGCCGACAACTGAAGAAGACGATGAAGAAATGGATGCTTTCTTCAGTAATCT
8978	42	85	MW2_CDS_06570	MW1226	FALSE	unmapped	CGATTCATGTGCCAGTTATTGGTAAAGTCACAGCAGGTGTTCCTATTACCGCAGTAGAAA
8979	42	83	MW2_CDS_02041	MW0378	FALSE	unmapped	AGCTATTCACGCATGTCCAGAATTACTTGGTGGATTATTAATTCCTAGAGAACCTGCAGA
8980	42	81	agr_tiling 162_R		FALSE	unmapped	TGAGGTGCTTGAGCAAGCTAAAAATATGAATGACATAGGCTGTTACTTTTTAGATATTCA
8981	42	79	MW2_CDS_05850	MW1087	FALSE	unmapped	ACAACAGAAGACATGTTACGACACGAACAAAATATACAAACATCGATTGAAGAGGCCGTT
8982	42	77	MW2_CDS_06929	MW1294	FALSE	unmapped	TAGAAAATGAAAAGCTACCACAATTGCAACAGCAAGCGCAGCAATCCACTAATCAAATGG
8983	42	75	MW2_CDS_05270	MW0976	FALSE	unmapped	ATTCTCAAGAGGTCACTTCAAAGGAAATCAATTCCCTGAAGGCGTTAATGCATTAAGCCC
8984	42	73	MW2_CDS_11501	MW2180	FALSE	unmapped	ATGAACTTCATGCCGAAATTGCTAAATGGCAGCAGAAGATGGAAACATCTGAAAAGCAAG
8985	42	71	MW2_CDS_01222	MW0225	FALSE	unmapped	TGGAACATTTACTCGTAAGTAATTCCATTGTCATTGCAGGTTATTTTGCGACAGGTATTT
8986	42	69	MW2_CDS_10017	MW1880	FALSE	unmapped	AGATAAAGCTAAAGCAAATGTTCAAGTGCCATATACAATCACAGTGAACGGCACAAGCCA
8987	42	67	MW2_CDS_04112	MW0752	FALSE	unmapped	ACAAAGGTAACGGCGCATATACCAGTGGCAACCATAAGAATATTATATTTTGGGTGGGTT
8988	42	65	perR_tiling_081_F		FALSE	unmapped	AACAACGCTTTTCAGATTTAGATTTTAAATTTTATAAAAAAGCATCAGAAATACCTGAGA
8989	42	63	MW2_CDS_03354	MW0616	FALSE	unmapped	AGTGTCAGGTGCAGGCGCGATGTATGGTGGTATTATCTATACTGTATTACTAGCATTGAT
8990	42	61	MW2_CDS_00149	MW0027	FALSE	unmapped	ACCTGACTGTCATTGTACATCGAAATATCTGAATAACCTCATTGAGCAAGATCACCGTCA
8991	42	59	MW2_CDS_11390	MW2156	FALSE	unmapped	AAAAAAAACAAAAATATGCAGTTCGTGAATACACTCGTTGTGAACGTTGTGGCCGTCCAC
8992	42	57	MW2_CDS_05422	MW1004	FALSE	unmapped	ATGAAACATGAACGACAAATCCGAAAATATGGACATATCGTTCATTCAAATAGAGATCGT
8993	42	55	MW2_CDS_10613	MW2003	FALSE	unmapped	AGGACGCAAAAGATATTATTAAAACACATCCACGCATTGGTTATCAAATGTTGCAGTGGA
8994	42	53	MW2_CDS_12766	MW2416	FALSE	unmapped	TAAGAATCCAGACACAGGAAAAGTGATCGAAGAGCCAGTGGATGATGTGATTAAACACGG
8995	42	51	MW2_CDS_09184	MW1723	FALSE	unmapped	AACACTGATAGCCAATTTGACTGGTGCCTTTGTAATGGGATTGCTAACAGCCTTAACAAT
8996	42	49	MW2_CDS_10177	MW1918	FALSE	unmapped	AGCGTTTTACTTTACTCCACCTGAATCATGGTCGAAGAAAAAGAAAGCTCAAGCGATTGG
8997	42	47	MW2_CDS_03506	MW0643	FALSE	unmapped	TCCTCCACATGTATCAACATTATATGTTGATGATGGACCAGATGCAGTTGATTACAAAAT
8998	42	45	MW2_CDS_12599	MW2383	FALSE	unmapped	TGCTGAAGATTTGATTCGTTTCGTCGATCAGTTGCAGCAATTAGGTCAAAAACCAGTAGG
8999	42	43	MW2_CDS_12962	MW2453	FALSE	unmapped	TGGTGGACCGTCAAAAGCATTTGCAGTTTGTATTGAGCCATTGACGCAAATTGATTTAAT
9000	42	41	MW2_CDS_01036	MW0191	FALSE	unmapped	CCCTGTCGTCAAAGGTAAGAAATTTATCCGTACTGTGTTAATCCTACCTTGGGCTGTACC
9001	42	39	MW2_CDS_08469	MW1593	FALSE	unmapped	ACGATTCATCAAAGTATTCCAATGGAAGAAAAAGCAACAATAACATTATCACTGAATGCT
9002	42	37	MW2_CDS_12066	MW2285	FALSE	unmapped	ACTCATAGGCGTCGTCTTTTTCCTTGGAGATTTTATCTTTAAATACACAGATTGGAGCAT
9003	42	35	MW2_CDS_11001	MW2080	FALSE	unmapped	AAAACCATTGTTCGTTTATATTTCTCAATCAGGTGAAACTGCAGATAGCCGCGCCGTATT
9004	42	33	MW2_CDS_04650	MW0858	FALSE	unmapped	TGTATTGATTGCTCCCAATAAAGAGAATAATCATCTTCTAACTGAGGCATCTTTATTTGA
9005	42	31	RC5		pos		
9006	42	29	MW2_CDS_00766	MW0142	FALSE	unmapped	AAATTATCATTTACGGGCTCAACTGATGTAGGTTATCAAGTTGCCGAAGCTGCAGCAAAA
9007	42	27	MW2_CDS_04399	MW0810	FALSE	unmapped	TTTTGTAGACAAAGATAAACTAACTCAGAAATTAGCCTATTTACAAGCATTAACTGATGA
9008	42	25	MW2_CDS_03871	MW0708	FALSE	unmapped	CGATCCAAAATCACAGCGTAAAGTGTTTAAAGATGCAGACGATATGGTGCATGTAGCCAA
9009	42	23	MW2_CDS_10114	MW1904	FALSE	unmapped	AAGCAATCGAAGATGCAAAAGTGAATGTTTTGCAAGAATTGAAACTATGGATGGCGCGAA
9010	42	21	psma_tiling_059_F		FALSE	unmapped	TAAAATAAAAAATTCGCAGTTATGATCATAACAATTCAAGTTAGGAAAAAAATCAATTAC
9011	42	19	MW2_CDS_06547	MW1221	FALSE	unmapped	AAGCTGCTGAAATTATAGCTACAGATCGTGATTCATCTCAACGCGATTTATTCGAAGCCA
9012	42	17	MW2_CDS_07590	MW1428	FALSE	unmapped	ACAATTTACGTGTGTTAAACACTGAACTATCAACAGTAGATTCATCAATTGTACAAGAGA
9013	42	15	MW2_CDS_04328	MW0797	FALSE	unmapped	ATGCTTATGAGCAAATGTCTGCAATTGAAGGAATTGAAATTTATGGCCCGCCAAAGGATC
9014	42	13	MW2_CDS_07680	MW1449	FALSE	unmapped	ACCGACAGATTTATCTCATTTGGAAACGGATGAATCTTGGGATCCAAATCATACGATTGA
9015	42	11	MW2_CDS_10981	MW2074	FALSE	unmapped	TCGCCTAAAGATACAACAAGATTCGAGACAAAACCTGATCATCAAGCACAGTTTGACTGG
9016	42	9	MW2_CDS_11381	MW2154	FALSE	unmapped	TGAAGGTATTTCAAAAGAACAAGTTGGAGCATTAGCATCTAACATCCGTTCAGTAAGACC
9017	42	7	MW2_CDS_06256	MW1161	FALSE	unmapped	TGTTTTGAGTGGGGTTTCAAGTGATAAGTACGAAACTGCAAAAGACACTATTATAAGTGA
9018	42	5	MW2_CDS_12921	MW2445	FALSE	unmapped	AATCGTGAGACGCATCCAAATGTTGACGAAGAAGTAGCAACGCAATTCAGCAATGATATT
9019	42	3	MW2_CDS_04797	MW0885	FALSE	unmapped	ACAGTTTGGTGTAAAGGATACAACTTTATCAATACTTGGTGCATTAACGACATATCGCCA
9020	42	1	perR_tiling_060_F		FALSE	unmapped	AGGCTTTTAATATGAATTTAATTGGTCTGAGCAAGTCAGGTCAGAACAAAGATGAGTTTG
9021	41	164	agr_tiling 001_R		FALSE	unmapped	ACTGTAGATTTAAACTTAAATGAAGTAGAACAGCAACGCGAAAATATACCTATATTTAAA
9022	41	162	MW2_CDS_06686	MW1249	FALSE	unmapped	TCCAGGATATGGAAAACACAAAATTAATTCAGCATACGCTTTAGGTGGTCCAGAGCTACT
9023	41	160	MW2_CDS_03776	MW0691	FALSE	unmapped	ACCTATGAACCAATGAGTCAGATGCAAATACTTTATCTATTAGGGGCTGGCTTAGCTGCC
9024	41	158	MW2_CDS_04818	MW0889	FALSE	unmapped	TACGGGACGTACACATCAAATTCGTGTACATTTTCAACATATTGGGCATCCAATTGTGGG
9025	41	156	MW2_CDS_05492	MW1017	FALSE	unmapped	AAATCATAATACTATTTTATACGGGCACCATGTCGGTGATAATACGATGTTTGATGTGTT
9026	41	154	MW2_CDS_07350	MW1373	FALSE	unmapped	CTACTTATTTAGTATGGGCGATCCAGTTGGACCATTTGCTAACTTTTTAGCAGGCGCAAG
9027	41	152	MW2_CDS_13743	MW2595	FALSE	unmapped	ACGAAACACAGCTGAAACACAACTAAATATTTCAATATCAGATGACCAGTCACCATCGCA
9028	41	150	MW2_CDS_01058	MW0195	FALSE	unmapped	TGCGATTCGCATATTAGGCCAAGCAAATGCAATTCATCACTTCCATGCTAAAGATACGTA
9029	41	148	agr_tiling 163_F		FALSE	unmapped	CATTAATATCAGTTGAAAGTTGAATATCTAAAAAGTAACAGCCTATGTCATTCATATTTT
9030	41	146	MW2_CDS_04387	MW0808	FALSE	unmapped	TCCGTCTGATGTGATAGATGACGACAATAAACTTCAAGATGTGAAGATTAAGCCAACCAT
9031	41	144	MW2_CDS_03891	MW0711	FALSE	unmapped	AGCAGGGGAAATGGTTGAAGGTGTTAATGTACATGCATTTGATAGTAAGCTTGCAGCAAT
9032	41	142	MW2_CDS_10901	MW2058	FALSE	unmapped	CTGCTTGTAATGAAGTACAATGTGGCTGGGCAGCAAGTCATTCATTAGAAGGTGCTAAAA
9033	41	140	MW2_CDS_08851	MW1662	FALSE	unmapped	ACTGAAAGACAATTCCGTAACACATTTGACATCGCTGGTAAAAAATTCGGTGTACACGGT
9034	41	138	MW2_CDS_08472	MW1593	FALSE	unmapped	AGAAACTTCAGTAGAAGATGTTATTGGTGCTTTGAGAAATTTAGATTATGTATCAAAAGT
9035	41	136	MW2_CDS_09110	MW1708	FALSE	unmapped	GTTGCAATCGTAGTTAGTCGATTTAATGATTTTATCACTGGAAGATTACTTGAAGGTGCA
9036	41	134	MW2_CDS_05014	MW0928	FALSE	unmapped	AACGATTGTCCCAATCGCCACATAAAATGGCCAAAGCATTAAGAGATTATGGTACAGGTC
9037	41	132	MW2_CDS_09230	MW1732	FALSE	unmapped	TCGAAGTTGAATCATTGGTAAGCAAGAACGATTATTTAGAAACAGCAGGGCCAGTGTTGT
9038	41	130	MW2_CDS_00572	MW0107	FALSE	unmapped	CTAATTCTGAAGAAAAAGGTGGCGTAATAGATGACATCAAAGCGCAGTGGGGCACTTTAG
9039	41	128	MW2_CDS_05911	MW1099	FALSE	unmapped	ACGATGCTGAACTCGTTGAGACTAATAAGATAAACGAGCCTGGAACCATTATAGAAACGA
9040	41	126	MW2_CDS_06809	MW1271	FALSE	unmapped	TGCCTAATTATTTATGGATCACAACATTAATAATGATTTTATTAACAATATTCTGTTGCT
9041	41	124	MW2_CDS_00059	MW0011	FALSE	unmapped	TGGTGAGGGGTATACATTAAACATCCCTTACATTATCGCGCTCATTCCGACGGTTATTTT
9042	41	122	MW2_CDS_09775	MW1835	FALSE	unmapped	TCAACTTGCTAAAAGAACCGTTGATTCGTATCGATACGGTTTAAAACATATGATGGAGTT
9043	41	120	MW2_CDS_13341	MW2524	FALSE	unmapped	TTGGTAGCCTCATTTATTTTGTATTTGTGTTACTGTTTCATACTTCTAAAAGGCTTTACT
9044	41	118	MW2_CDS_05160	MW0954	FALSE	unmapped	AGGTATCGATGCAGTCGCAATGTGTGTTAATGATATTTTAACGACAGGTGCAGAACCATT
9045	41	116	MW2_CDS_09387	MW1763	FALSE	unmapped	TGTTATGGCAATACGGGTGTAATGACGACGTTGTTTTTAATCGGCCAAGCATTACAAGAT
9046	41	114	MW2_CDS_05215	MW0964	FALSE	unmapped	TATTGGTAAAAGAATTTCAAGTGCATTTTTAAAAATAGTTATTAGAGATGTAGCTAAACG
9047	41	112	MW2_CDS_03139	MW0577	FALSE	unmapped	TAGGCTTAGTGAACACTAGTGCCGAAGCAGCAAGTGGCAACTCTATTGATACTGTTAAAC
9048	41	110	MW2_CDS_07840	MW1477	FALSE	unmapped	TCCCGAGTGCAAGCTTTTCAAACTTTATTTCAATTAGAAATGAAGGACAGTGATTTAACG
9049	41	108	agr_tiling 058_R		FALSE	unmapped	TACGATTAGGGATGCAGGTCTTAGCTAAAAATATAGGTAAATTAATTGTTATGTATACTA
9050	41	106	MW2_CDS_13453	MW2544	FALSE	unmapped	AAATGATGTAGAGAGCTACTTTTTAACATGGGTACATCAAATGAAAACACCCATTACTGC
9051	41	104	MW2_CDS_02307	MW0426	FALSE	unmapped	GTGAATAGCAAAGCGGCTAGTATTGATGTTGAAAAACTGTTATGTCCTTTCGATGGGCCA
9052	41	102	DCP_22_2		pos		
9053	41	100	MW2_CDS_04186	MW0766	FALSE	unmapped	TGCACCAAAACAATTGGCTGGATTAAATGGTGAAAGTCATGATTTCACAACAACGCATCA
9054	41	98	MW2_CDS_01932	MW0355	FALSE	unmapped	ACAACCAATTATGCAGTTATTTATAGATAATGCTATCCTTAACAACGTTCAAAACGACGC
9055	41	96	MW2_CDS_10175	MW1918	FALSE	unmapped	AAGACGATAACCAAATTACAGAAATAACTAGCTCAAAGCGTTATGGAATTGAGCCCAAAA
9056	41	94	MW2_CDS_05913	MW1100	FALSE	unmapped	CGTATTAGATGCATGTAGTGCACCTGGCGGTAAAGCTTGTCACATTGCTGAAGTTTTAAT
9057	41	92	MW2_CDS_01152	MW0211	FALSE	unmapped	AGAGTCATTATTTACCAGCCTTGTCTGGAGAAGAACGAATTGATGGAATACCTGAACCCG
9058	41	90	MW2_CDS_06897	MW1287	FALSE	unmapped	AATAGTGCGAGTTTTTATCGGGAAGGACAAATATTACTACCCCACCATACACATGCACGT
9059	41	88	MW2_CDS_13195	MW2498	FALSE	unmapped	AGAGAATAGGCAACGAATTGAAGAAATAGCGCACAAACTTTTTGATGAAGAAGGCGTTGA
9060	41	86	MW2_CDS_13834	MW2611	FALSE	unmapped	CACGAAAACTAACTGAAGATGATTTAGCAATTGAATTGAAACAACCAATTGTTGGTTGTA
9061	41	84	MW2_CDS_06888	MW1285	FALSE	unmapped	TATTAGCAGGTGTGATTGAACCCCCTAGTGCATCACCGGTTATAATCGAGGATGATGTAT
9062	41	82	MW2_CDS_10860	MW2051	FALSE	unmapped	GCTTGTCAATTCCACCCAGAATTCTTATCTAGACCAAATCGTCCGCACCCGATTTTTAAA
9063	41	80	MW2_CDS_03095	MW0568	FALSE	unmapped	GAAACACTTTGCCGTAGTGTGAAAAATGCTGGTTATACAGTAGATGGTGCAATGGCTGAA
9064	41	78	MW2_CDS_12394	MW2346	FALSE	unmapped	AGAACAGACGGTACAAAGGTTTTATAATAAAGGTTTTTTTCATGAAAATGGGCAACCGGA
9065	41	76	MW2_CDS_06168	MW1145	FALSE	unmapped	ACCAGTTAATAAAAAAGCGGAAACAACGATTATTGCTATTGGTGCCATTTTCATGGTCGT
9066	41	74	MW2_CDS_13624	MW2575	FALSE	unmapped	GCACATCCGAATCACTGAGTACATCTATGTCTGGTTCACAAAGCATTTCTGACTCGACAT
9067	41	72	MW2_CDS_10589	MW1999	FALSE	unmapped	TCCCGTTAGCTATCACGTTAATTGGTCAAATATTTTTTTATCAACAAGCAAACGGCAGTT
9068	41	70	MW2_CDS_12612	MW2386	FALSE	unmapped	GATCGCGTCATTTGTAGTGGCATTTGGTCCGCAAGTAGGTGCAATTATTTTCTATGGTAG
9069	41	68	MW2_CDS_08869	MW1665	FALSE	unmapped	TTCGTCACAAGCTGACAATTCTACACCGTTCACACCAAATGTGTCTTTATTTAGAGGTGT
9070	41	66	MW2_CDS_10219	MW1928	FALSE	unmapped	TGCATCTGATGAGACTATCAAGGACAGATTACTATTTCATCCTAGATTTGAAAAAGAACT
9071	41	64	NA		ignore		
9072	41	62	MW2_CDS_08560	MW1612	FALSE	unmapped	AGGTACTGGTGCATACATTCACGATGGTGTTATTCAACAGGCAACACGTATTGCTAAAAA
9073	41	60	MW2_CDS_06621	MW1237	FALSE	unmapped	ATGGTTTACGTGTTATGGGTAAATTCGGTGATTCTGTGACAACTGACCACATCTCTCCAG
9074	41	58	MW2_CDS_04604	MW0849	FALSE	unmapped	AGTATCAACGCTTTACTATAGATGGAGATGGCACTGGACGTCGAATTGATTTGTCGCAAA
9075	41	56	MW2_CDS_06950	MW1298	FALSE	unmapped	TGCGTCAGCAAGTATGCATGATAAAATGGCTGAAACGAAGAAAGGTGTAGTGTTATTCCA
9076	41	54	MW2_CDS_02559	MW0473	FALSE	unmapped	AAAAAGATTGAAACCTTACAAAGAGCAGCTTGATATTCAAGGTGCTGAAACGGGTATGCA
9077	41	52	MW2_CDS_13288	MW2515	FALSE	unmapped	TAGATGGCACGAAAGATCCAGATGTTATCAAGCAGTTGAAAGATGATAATGAGGTGCCGA
9078	41	50	MW2_CDS_06468	MW1207	FALSE	unmapped	GGTGTTGCAATGAGTGCAGTTCAATGGTTAGAGTCAGGAATATTTTTATGGTTAGGTGCG
9079	41	48	MW2_CDS_10877	MW2054	FALSE	unmapped	ATTATGCTTAACTGGAGGTAATGCAGGTGTCATTGCTGAAAACATCAACATTCCTGCACA
9080	41	46	MW2_CDS_06075	MW1130	FALSE	unmapped	AGTTCCAAAGTTTAGATCAAAACTGGAATAATGGTGGATGGCGTAAAGCAGAGGTTGCAC
9081	41	44	MW2_CDS_13448	MW2544	FALSE	unmapped	AGCACAACTGTTACTTGAAAGAGATGAGCCTAATGTTGTGAATCGTGTTCGTCAAGAGGT
9082	41	42	MW2_CDS_06380	MW1185	FALSE	unmapped	CGGTGATGCCTTTGAAGTAGCGCAAACAGTGAGAGGCAATGTTGATAAACCATACATTAT
9083	41	40	MW2_CDS_10216	MW1927	FALSE	unmapped	GTCTTAGCAATTGTACTTATGCCGTTTCTATACTTCACTACTGCATGGTCGATTGCGGGA
9084	41	38	MW2_CDS_12850	MW2432	FALSE	unmapped	GACGCACGTTGAGCGATAGCTTTGGTATGTTGATGACTGGTCTTCATACATATTCACGTA
9085	41	36	MW2_CDS_02298	MW0424	FALSE	unmapped	CGCTTGCTGGCCGAAACATCGGCCAAGATATTATGGGAACAATGACTAACATCTTATTAT
9086	41	34	MW2_CDS_01418	MW0260	FALSE	unmapped	ACAAGCAGGAGAAAAAAATATTCCCGTACATTTTGATGTCTGTAGGGGCTTTTTTGACTT
9087	41	32	MW2_CDS_06731	MW1257	FALSE	unmapped	AACGCAATTGAGAAAGAACCAAAGCTAGCAATTATTGCAGAAATTAAATCGAAGAGTCCT
9088	41	30	NC_S_080		FALSE	unmapped	AGAGAACACAAACTTAAATAGATTGGGTGACTTATTTGTGTCAGTTATTGCGATTGCGAT
9089	41	28	MW2_CDS_05587	MW1035	FALSE	unmapped	TGAAATGCACCCAGATGCAGATGTATATTTACATTTAGGAGATTCAGAATTCGCGTATGA
9090	41	26	MW2_CDS_11632	MW2203	FALSE	unmapped	GCGCCAAATGGTTGGATATTGCATATACCAAGCTGTTATTTAGGTATAGCACAAGCTGCT
9091	41	24	MW2_CDS_02811	MW0518	FALSE	unmapped	TGACTCTGGTGGTGGCGACGGTACTGTTAAACCTGAAGAAAAGTTATACAAAATTGGTGA
9092	41	22	MW2_CDS_06212	MW1154	FALSE	unmapped	AGTACAACGACTGAAGATCAAACGGGTGATACATTGGAAACAAAAGGTGTACACTCAGCA
9093	41	20	MW2_CDS_04011	MW0731	FALSE	unmapped	TGATAAGAAAATTTCATATGTCAACTGGGCTAAATCTGGGTGGGAACACAAAGTTCCTCA
9094	41	18	MW2_CDS_10242	MW1933	FALSE	unmapped	CACAAAGTTTCCCATTTCTGTTATTGACGTTGAATTTGATATTAAAAATAAAGTAAATGA
9095	41	16	MW2_CDS_02069	MW0383	FALSE	unmapped	AGCAACAGGTGTAAACACTACAACGGAAAAACCAGTTCATGCCGAAAAGAAACCTATTGT
9096	41	14	agr_tiling 094_R		FALSE	unmapped	CATTTATTAGTGGAATAAGATACAAAAAATCAGATTATATATACATTATTGGAATAGTGT
9097	41	12	MW2_CDS_05767	MW1072	FALSE	unmapped	GTAATAGATGATGAAGAGGAAGTAGAAGTACCTGACAAACAACAACAGGTCAATGAAGCG
9098	41	10	MW2_CDS_03924	MW0716	FALSE	unmapped	CCTGGGGATGAAGCAGGGATTAAAAGTGTAACATTGCTCATCAAAGGGCATAATGCTTAT
9099	41	8	psma_tiling_074_R		FALSE	unmapped	AGAACAATGCAACAAGGTATATCAACGTACCGTGATGCAGTGTCTAGTTAAACTGAAACC
9100	41	6	MW2_CDS_08553	MW1611	FALSE	unmapped	ACGGCGCATTGCTAATTTTCGATGAAGTAATGACTGGTTTCAGAGTCGGTTATCATTGTG
9101	41	4	MW2_CDS_08510	MW1603	FALSE	unmapped	GGCGTTAGCAGGTGTGATCGTTACGAAACAAGCTTTTCCTTTATTAAGTGTAGCAATCGG
9102	41	2	MW2_CDS_00131	MW0023	FALSE	unmapped	TCAAAGGAGAAAGAGATGACGTTAGAACGCGTGAAACAAATTTAGGAAACGCGATTGCAG
9103	41	163	MW2_CDS_03047	MW0560	FALSE	unmapped	GTGCTCACTATATGACAATAAAGTTCATGTATTATTTAAATCAAATGGAATTGAAAAGTT
9104	41	161	psma_tiling_039_F		FALSE	unmapped	TCAAACATTAACGATCAACAACTCATCACTATGTTAAATCAACATACAGGAGGACAAAAC
9105	41	159	MW2_CDS_04990	MW0924	FALSE	unmapped	ACAATTGCGACATTTGAAGCATATAGAGGTAGAGGCATCGCGACAAAGTTATTAACGTCA
9106	41	157	MW2_CDS_01992	MW0366	FALSE	unmapped	AGGTGTGGATGTCTTAGTTATCGATACAGCACATGGTCACTCTAAAGGCGTTATCGATCA
9107	41	155	MW2_CDS_11958	MW2267	FALSE	unmapped	AGTTTAGCACTTGGTGCAAAGGCAACTGGTATGTCTCGTCCGTTTTTAAATCAAGTTGAA
9108	41	153	NC_A_086		FALSE	unmapped	ACATTCGATTTCCTTTTCACAATAGCCACCTCGCTTGTTCAAAACATAAACAACTATTGC
9109	41	151	MW2_CDS_10756	MW2031	FALSE	unmapped	ACAGAGATATCGATGACGCAGAACAAGCTAAGTTAAATGCACAGAAACTTGAAGAAGAAA
9110	41	149	MW2_CDS_00894	MW0165	FALSE	unmapped	ATCAGGTATCTGAGCATGATGTGAAAGTTGCGACAGTTATGGGTATGTGTGGCATTTCTA
9111	41	147	MW2_CDS_06499	MW1213	FALSE	unmapped	TTGGGATGTGGATTATATTAAACCGGAGATTGTTCTAATGTATGATCTAATGCAACACCA
9112	41	145	MW2_CDS_03626	MW0664	FALSE	unmapped	TGGTGGAACGGCAGGTATTTTAACGATGGAAGATATTTTAGAAGAAATCGTTGGAGAAAT
9113	41	143	MW2_CDS_00611	MW0113	FALSE	unmapped	ATCGCACGTCCATATGTTGGTGAACCAGGAAACTTTACACGTACATCTAATCGACATGAC
9114	41	141	MW2_CDS_08692	MW1635	FALSE	unmapped	CATTACACGTTGTAAAGCGTGGACAAGCTATTATTTGTTAGCATTTTCTTTAATGTTAAT
9115	41	139	MW2_CDS_03754	MW0687	FALSE	unmapped	TCGCGATTGATATGGATGAAGTATTGGCAGATACATTAGGAGAAATCATTGATGCTGTCA
9116	41	137	MW2_CDS_13795	MW2604	FALSE	unmapped	GCTGGGCACTTATTGCACCAACATTAGATATTTTGATTTATAACGAACCGGCTAACAAGG
9117	41	135	MW2_CDS_12178	MW2304	FALSE	unmapped	TCAAGTTCGGAAGCTGTACTTCCTGTAATGATGAAGAAAATGGAAAACTTCGGTTCTCCA
9118	41	133	MW2_CDS_12354	MW2339	FALSE	unmapped	TGATGCTAGAAAAGAATTTGGAGAAGAACAAGTACATATTTGGCGTCGTTCTTATGATGT
9119	41	131	MW2_CDS_07388	MW1380	FALSE	unmapped	GTGGACAACGTCGTTATATTGCTACAGGAGAGGTAGACAAGGCAGGTAATAGAATAAGCA
9120	41	129	MW2_CDS_07815	MW1472	FALSE	unmapped	AGCTTAGCGCTTAATAACGCACATATGACATTAACGGATGAAAATGCTATCACTGATCGT
9121	41	127	MW2_CDS_06114	MW1136	FALSE	unmapped	AGTAACGCTTGGTCAACAAGTCATCATGAAACAAACGGCAAGAAAAGTGCGACGTTTATA
9122	41	125	MW2_CDS_05732	MW1067	FALSE	unmapped	AAGGCGTTATCTGAAATGACACCTGAAGTTAGACGATATATTGCCGAAGTGACATACGCC
9123	41	123	MW2_CDS_11160	MW2108	FALSE	unmapped	TGGTGAATCAGCACCTAAAATCTTCCGTAAAGTAACTGAATTAGTAAAAGAACAAGTTAA
9124	41	121	NC_A_014		FALSE	unmapped	TATAAACAACACAAAGGAGATAACTTCTCTATTGAAGAAGTTAAAAACATTATAGCAGAC
9125	41	119	MW2_CDS_10222	MW1929	FALSE	unmapped	GGCTGAAGCCATCAATTCGACCTATCCAATAAATGAGCAAAGTACCTACAAGAGACACGA
9126	41	117	MW2_CDS_03167	MW0581	FALSE	unmapped	GGGCATATTGATAGATCACTTTGGATTATTTGGTTCACCTAAAATAGCAATGACATCCAG
9127	41	115	MW2_CDS_12700	MW2402	FALSE	unmapped	AAGAACAACAGGAGCGTATTACACTTTATCTCAAGCATAATACTAAAGAACCAAACACGA
9128	41	113	MW2_CDS_12351	MW2339	FALSE	unmapped	TGTCGTCATGGACAAAGCGAGTGGAATGCTAAAAACTTATTTACTGGATGGGAAGATGTT
9129	41	111	MW2_CDS_00582	MW0108	FALSE	unmapped	AATCATGGTGGTAGTGAAATGGTGCAAAATAAAACAGGTCATATGAGTCAACAAGGCCAT
9130	41	109	MW2_CDS_01818	MW0331	FALSE	unmapped	TGTGCAACGTTGGAATATTGTAACGCAATATGGTACTCACATTGATGCACCAATTCACTT
9131	41	107	MW2_CDS_05205	MW0963	FALSE	unmapped	AAATATGCTGCACGACATGGACATAGTTATGACACGATCGTGATTGATCCACCTAGCTTT
9132	41	105	MW2_CDS_04542	MW0839	FALSE	unmapped	TGACGAAATCCAAGCAGGATTAGGTCGTTCGGGTAAATTATTTGCTACGGATTGGGATAA
9133	41	103	MW2_CDS_04172	MW0763	FALSE	unmapped	CCAGACGAAGCGTTTTTAATTAAAGAATTAAAAGTGAACAGTTTAGCGGGAAAAACAGGT
9134	41	101	MW2_CDS_13032	MW2466	FALSE	unmapped	CGAATGGAACGTGCTTCTGTATTGGCACAAGTAGATATTCATCGTGCAGCAACACATAAT
9135	41	99	MW2_CDS_13568	MW2565	FALSE	unmapped	TGGAATAATCGAGCTCAATACCGTGATTATCAAGTAAGTCATACACCAAAACGTCATGCT
9136	41	97	MW2_CDS_05986	MW1113	FALSE	unmapped	GAAAACACGCAACCAGCTTTATTGACGCATAGTTCGGCATTATTAGCAGCGCTAAAAAAT
9137	41	95	MW2_CDS_05183	MW0958	FALSE	unmapped	AGCTTCGCAGATCTTTAAAAATGCGCTATCAGATGATAGACGCAGCAAATTATAGAGGGT
9138	41	93	MW2_CDS_10639	MW2007	FALSE	unmapped	TCATACTGACTTTATCTTTTCAGTGATTGGAGAGGAACTAGGTTTTATCGGTTCTGTCAT
9139	41	91	MW2_CDS_12993	MW2459	FALSE	unmapped	GCACCAGGTATCGGTCAAATCATTCCATTATCAGAAGTACCTGATCAAGTATTCGCTGGT
9140	41	89	MW2_CDS_09129	MW1712	FALSE	unmapped	GCGCATAAAGTATCTCAATTATATGATGCTTTAGAATCGAATGAGCAACAACAGCGCAGT
9141	41	87	(+)E1A_r60_a20		pos		
9142	41	85	MW2_CDS_07486	MW1400	FALSE	unmapped	AGTGGCAAGCGAGAATTTAACAAGAGAAAGAGTAGCTAACGTTTTTCAATTGCCCTCAAT
9143	41	83	MW2_CDS_04450	MW0821	FALSE	unmapped	TGGCAAAAGGTGGAGATTATGTTTTTAATCAACTGGAAAATGACCCAGATGTCGATGTGT
9144	41	81	MW2_CDS_10566	MW1995	FALSE	unmapped	AGCAGCCAAAATTGGTTGAGCGGATTTTAACTAAAAATGAACAGCACAAATTCAACAATT
9145	41	79	MW2_CDS_00804	MW0149	FALSE	unmapped	TTGCAGCATTGACACCAACATTAAGACATTTAGGTAAACTTGAAGCAGAGTTGAAGGGGT
9146	41	77	MW2_CDS_02771	MW0511	FALSE	unmapped	TGAGGTCATTGATCGTATTATTGAACGTGGTCGCGAAATGGAAATTAATACAGACCCTGA
9147	41	75	MW2_CDS_06172	MW1146	FALSE	unmapped	TGGGTTGTTACGGTATTGGAATTTCTAGAACGCTGAGTGCGATTGTTGAACAAAATCACG
9148	41	73	NA		ignore		
9149	41	71	MW2_CDS_05039	MW0932	FALSE	unmapped	CCAAATGGTGGTTTCACTGCTGAACAAATCACTAAATATTCAGGCGAAGGTGATTTAGCA
9150	41	69	MW2_CDS_12278	MW2323	FALSE	unmapped	ACGACGGAAGGCTTGTTAACAAAGTGAAGCAGCAAATGAATGACATGGTTATTAATACAG
9151	41	67	MW2_CDS_02818	MW0519	FALSE	unmapped	ATGGGCCATCAGAACTGATTCAAGATGGATTTAATGGCTATTTAGTACCTCAAGGTGACA
9152	41	65	(+)E1A_r60_a135		pos		
9153	41	63	MW2_CDS_09686	MW1818	FALSE	unmapped	TGTTGCGTTAGATGATGAAGGCAAACCTAAACATGTACCTGGTGTATATCCAGAAGATGA
9154	41	61	MW2_CDS_08348	MW1570	FALSE	unmapped	GAAGCTGTGACTATCGACCCTAAACACTTATTAAGTCAGCATGCGCTGAAAACATTCACT
9155	41	59	MW2_CDS_07729	MW1458	FALSE	unmapped	GAGGTGAGTCCAAACAGGGTCCAGTTGTAGCAATTTTTGGTGATACAAAACCATGTTCTA
9156	41	57	MW2_CDS_12320	MW2333	FALSE	unmapped	ACGCAAACTTTTTTCGACTTATTCCATATGGCTGAGGAAAAGCATGGTTTCAAATTCCGT
9157	41	55	MW2_CDS_12822	MW2426	FALSE	unmapped	GAAACCACAAGGATTTACAGAAGGAAAGCGTCGTGTGTATACAGAACAACAGCGACAAAC
9158	41	53	MW2_CDS_01683	MW0307	FALSE	unmapped	TTTTAGATAAAGCTGAATTACAACAAAAGCTCTCAGAAAAATTACAACAACTTAACATGA
9159	41	51	MW2_CDS_05988	MW1113	FALSE	unmapped	TTGTTAGAAAACGTGGTCAATTAATGGCGCAAGCATTTCCTACTGGTGTAGGAAGTATGG
9160	41	49	MW2_CDS_01498	MW0275	FALSE	unmapped	TCTTTTGATTATATTGATTGGGTGAATTCAGAATTTGGACCAATGGGAAGAGAACATTAT
9161	41	47	MW2_CDS_04852	MW0894	FALSE	unmapped	ACTGATGGTACGGTTAATGCGAATGGCACACCGCATTTAATTAAAGATGGCGGTATTTAT
9162	41	45	MW2_CDS_07730	MW1458	FALSE	unmapped	TGCTGATGTGATGGTACATGAAGCGACCTATATAGATGGTGAAAAGCATTTAGCCAACAA
9163	41	43	MW2_CDS_02907	MW0536	FALSE	unmapped	AGCACATGGATTAGCATTTTCAGTGCAACCTAACGCAAAATTCCCTCCATCTTTACGTAA
9164	41	41	MW2_CDS_01258	MW0231	FALSE	unmapped	TCAAGCTGCTTTAGAGTACGGTGCAGTAGATACAGTGATTGATGCTATAGATACGATTGT
9165	41	39	MW2_CDS_01878	MW0344	FALSE	unmapped	CTATCAAAATCCACCCGCATGGGTTTGCATTGAATTCATGCAACTAGGTCAATTCGTTTC
9166	41	37	MW2_CDS_05145	MW0952	FALSE	unmapped	ATTCAACGAAAGGTATGGCAGAAGCATGCGACATTCTTAAGACACCAGTAGTTTCTGGTA
9167	41	35	psma_tiling_061_R		FALSE	unmapped	ACTGCGAATTTTTTATTTTAAAAGGACGGGAAATACTGCCTAACTGTACAGGTGCATTTA
9168	41	33	MW2_CDS_03906	MW0713	FALSE	unmapped	ACGGAATTAGATTTAAATGGCAAGGAAATATTACTCGTTGACGATATTTATACAACTGGA
9169	41	31	MW2_CDS_08630	MW1625	FALSE	unmapped	TGCAGTCATTTTAACGTCTGTGTTATCAGCAGGTAACTCAGGTATGTATGCTTCAACTCG
9170	41	29	MW2_CDS_13244	MW2506	FALSE	unmapped	TCACAGCGAAACATAAGCAAATGGATGACTTATATGATGAAAAGCGAGAGGTTAAAGCAT
9171	41	27	MW2_CDS_11276	MW2130	FALSE	unmapped	TGTTACTGCCACTTTAGCATTGGGATTATTATCAACAGTAGGTGCAGCTTTACCGAGTCA
9172	41	25	psma_tiling_005_R		FALSE	unmapped	GTTTGCAATTTATGACAATTAATAAAAAGTTAAGATGTTCTTAGGATCTTTTTGTTTTCA
9173	41	23	MW2_CDS_00258	MW0049	FALSE	unmapped	TTGTCCTTATGATAACGCAGTTGCGGAAGCAACGATGAAAGCAATGAGATCTGAATTTGT
9174	41	21	MW2_CDS_11869	MW2250	FALSE	unmapped	GGGCAATTACATCAGCAGTAGATCGTTTTGAGTTTCATATTAAAGGCGTGGGTGGTCATG
9175	41	19	MW2_CDS_13051	MW2469	FALSE	unmapped	AAAGCAATCGATGTGTTAGATATTACAGCAGCACATTTATCTGCGCAAAGTCCAGCTGTC
9176	41	17	MW2_CDS_02030	MW0375	FALSE	unmapped	TGGTCGCAAGCATCTATCACTTTCATTTCAATTACATAGATAATGCCTATGATTTAGCAT
9177	41	15	NA		ignore		
9178	41	13	MW2_CDS_00909	MW0167	FALSE	unmapped	AGAGCAACGAATACGATGCGATTTGTAGCTACTAATATTATGGATGCGCAAATTGATGCA
9179	41	11	MW2_CDS_11038	MW2087	FALSE	unmapped	CGACTACTGAAGAACAACAAGCAGCGAAAGAAAAAGTTGATCAAGCTGTTCTGTCTGCAA
9180	41	9	MW2_CDS_06497	MW1212	FALSE	unmapped	TCCGTATCAATTAGCAGCAAATAATGCGAAAGCATTAAAGGATCATATTGAACAAAACTT
9181	41	7	MW2_CDS_00601	MW0112	FALSE	unmapped	AGCATCAGGTGGCGTACGTAATTTAGAAGATTTCAATAAAATGGTTGAAGCAGGTGCGAC
9182	41	5	MW2_CDS_04929	MW0908	FALSE	unmapped	TCCACAATTTCCAAAAATTCACTGAACCAATTGTTCAAGCATTACAATCTTTAGGCGTCA
9183	41	3	MW2_CDS_06304	MW1170	FALSE	unmapped	TGCATATCGTTTAGCAGAGAGATATTCAACAATTGCAACAAATTGTTATGATACTGCAGA
9184	41	1	MW2_CDS_08318	MW1564	FALSE	unmapped	AGCGCAATCAAAGAAATTTTTTGAAATATATACACCACTTTTAAAGCACCAAGGTCTCGT
9185	40	164	MW2_CDS_12080	MW2287	FALSE	unmapped	GAAGAAATTGAACCTGCAAAAGCACATTCTGCAAAAGCAGTATTACATGCATGGAGTCCA
9186	40	162	MW2_CDS_11269	MW2129	FALSE	unmapped	ATAGCGATGTGAAACACTACCGTGATAACTTCTGGGCGACAGCTGATATGAAACGTTTAG
9187	40	160	MW2_CDS_08791	MW1652	FALSE	unmapped	GGGTAAAGTAACTATTATCGGTGGTGGTCAAGCAGGAACAAATGCAGCTAAAATTGCACT
9188	40	158	NC_S_108		FALSE	unmapped	GATGCGAAACCTTTCGATAAACTACACACGTAGAAAGATGTGTATCAGGACCTCTGGACG
9189	40	156	agr_tiling 126_F		FALSE	unmapped	GTCATGTCATCTTCACGAATGTATTCTGAAAGAGTCGTCAAGATATTGACATAATCATGA
9190	40	154	MW2_CDS_05088	MW0941	FALSE	unmapped	ACATACTGTAGGATTTATCGCATCTATCGTATTAACGCTTTTAGCAGTATACGTAACACT
9191	40	152	MW2_CDS_04914	MW0905	FALSE	unmapped	AGTCGGTCAAGATCATGAAACGTATTATGTTCAGGCTGGTCAAGATGCAAAAGAGCTTGT
9192	40	150	MW2_CDS_03482	MW0638	FALSE	unmapped	TGGGGACATTTTAGTAATGAAAAAAGTATGGTTAACATTGAACTGCTATATGTTGAACCA
9193	40	148	MW2_CDS_13295	MW2516	FALSE	unmapped	GCGGTAGACATCTTGCCAAATGAAAAAGTAGCCATCGTGAATAATAATAATGGTGCACGT
9194	40	146	perR_tiling_011_R		FALSE	unmapped	ACTACCAAAGTTAAATTATTTATCTTGGCATTCTTTACAAACTCCATAAATTTCCATTCG
9195	40	144	MW2_CDS_02747	MW0507	FALSE	unmapped	TGATGGGAACAAGCACATGCCATCTTATGTTAAATGAAAAGCAACATCAAGTGCCAGGTA
9196	40	142	MW2_CDS_08914	MW1674	FALSE	unmapped	AAGGTTGCTGATACAGATGTAGCTGAAAATAGCAGCACTGCAACAAATCCTAAAGATGCG
9197	40	140	MW2_CDS_11485	MW2176	FALSE	unmapped	GGCCTAAAACGGGACTTATTTATTTTGTTATGGCTGATATAGGTGGTGCCTTTGTGATGT
9198	40	138	MW2_CDS_10669	MW2014	FALSE	unmapped	ACAGCATCTCTGTCATCAATATGATGTGCCTTTTATCGTTAATGATGATGTATCCTTGGC
9199	40	136	MW2_CDS_10260	MW1937	FALSE	unmapped	AGAAGTAACTGCTCAAGAGATTGATATTAAGTTACGAAAATACCTACAAAACGAATACAA
9200	40	134	MW2_CDS_03512	MW0644	FALSE	unmapped	ATCGAAAAGCGTCATAAAGAAGAGCAAAAAGCCCGCGAAAAGAATGAAATACAACGTATT
9201	40	132	MW2_CDS_02549	MW0471	FALSE	unmapped	CAAGCATACTTAGGATTAGGTAGTAATATTGGTGATAGAGAAAGCCAGTTAAACGATGCT
9202	40	130	MW2_CDS_11380	MW2154	FALSE	unmapped	ACAAACCATGGTACAACTCGTGCTTTATTAAACAATATGGTACAAGGTGTTTCTCAAGGA
9203	40	128	MW2_CDS_11335	MW2143	FALSE	unmapped	TGACTGAACACTTGAATATCTTCGTTGGTCTTACTGATGAAGCGCAAAACGCTGAAATCA
9204	40	126	MW2_CDS_08535	MW1607	FALSE	unmapped	AATTCCGGCTTGGTATCATAAAGAAACAGGCGAAATATATGTTGGAGAAGAAGCGCCAAC
9205	40	124	MW2_CDS_10044	MW1887	FALSE	unmapped	ACTGGTGTGATTCAAGACCCGACTACTAAAGGTATAGGTGATAGCCACCAAGCTTTAGAA
9206	40	122	MW2_CDS_04752	MW0877	FALSE	unmapped	TATGTTGAGTGATGCTCAAGAAGGGGATGTTATAAGTGGTAAACCGTGGATATGGATGCC
9207	40	120	MW2_CDS_02502	MW0463	FALSE	unmapped	AATTAACTTCAATCAAACGTCAAACAGAATCTAGACGCGGTGGCAAAGGTTCAAGACGTT
9208	40	118	MW2_CDS_09105	MW1707	FALSE	unmapped	AGCCTGCAACAAATTGTTCAAGTTTTAGATCGATTAAAAGGCGAATTTAGAAATGTTGGT
9209	40	116	MW2_CDS_05640	MW1048	FALSE	unmapped	ACAGGTGCAGACAATAACTACACAATAGATTTAAGTAAAAGGTTGCCATCAACTGATGCA
9210	40	114	MW2_CDS_08211	MW1545	FALSE	unmapped	GGTCAGAGTTATACCTATGACACGATCAAGGCATTCAAGGAGCAACACAAAGACAGTGAG
9211	40	112	MW2_CDS_06585	MW1230	FALSE	unmapped	ATCAAATGATGACGATGATGAATAAAAATATGGATCAAAATATGAAGAGTGCGAAAAAGT
9212	40	110	pMW2_040		FALSE	unmapped	AGAACATTAATCACAAGACTATATAAAAAAGAGATTATAAAACGATACAAATCAGAAAAT
9213	40	108	MW2_CDS_07971	MW1502	FALSE	unmapped	ATGGTTAAGAAATCAATTTTTTGCAACTGAAGAATACAAAGAAGCAAACGCAATTGCGCT
9214	40	106	MW2_CDS_08054	MW1516	FALSE	unmapped	AGTTGGATATTATTATTCAGGTAAATCAAAAGGTAAGTTTTTTAATGAAAAACTTCGACA
9215	40	104	MW2_CDS_07262	MW1356	FALSE	unmapped	TGGTGTAGGTAGTTATGTACATTATGATCGTAAATTAGATGGAAGAATAGCACAGGGTGT
9216	40	102	MW2_CDS_09570	MW1798	FALSE	unmapped	AAAGATGTAAGTGACAAAGTCATATTTATGGCAGATGGCGTTGTCGTAGAGTCAGGCACA
9217	40	100	MW2_CDS_13216	MW2501	FALSE	unmapped	AATATCGCACCAATTGATGCAAAAATGATGTCTCAACCTGCTGATACTGAAGAAGGACGT
9218	40	98	MW2_CDS_04424	MW0815	FALSE	unmapped	AACACATATGCAATCATGCCGTTACAATTAGACTTACATGGCTTTGTCAATTTGTGGTTA
9219	40	96	MW2_CDS_11418	MW2163	FALSE	unmapped	GTTTCTCACGTAGAGATTGAACGTGCTGCAAACCGTATCAACATTGCAATTCATACTGGT
9220	40	94	NC_S_107		FALSE	unmapped	CGAGCTCATTAAGCGTGTCGGAGGGTTGTCTTCGTCATCAACACACACAGTTTATAATAA
9221	40	92	MW2_CDS_04912	MW0905	FALSE	unmapped	TGAACGGAGAGAAGGGGTTGAGTGGACAGATTCGAAATGAAGATTTGTATCATGCATACC
9222	40	90	MW2_CDS_00383	MW0073	FALSE	unmapped	ACCGACGAATAAAGCGCCAAAGTTATTGTTAAAAGGGTCAGGGAACTTAAAAGGTTCATC
9223	40	88	MW2_CDS_04229	MW0777	FALSE	unmapped	GTGAAATGTTGTTAGATGGTGTACCAAATGAACTTATCAACACTTGGTTAGATAAAGACA
9224	40	86	MW2_CDS_07517	MW1408	FALSE	unmapped	AAGAGATGAAACTGGTGGAAGACGTTTTTGGCCAATGACTGTAAATCCAGAGAGAGTTGA
9225	40	84	(+)E1A_r60_a104		pos		
9226	40	82	MW2_CDS_03987	MW0727	FALSE	unmapped	TCACCTAAAGAATTAAAAGAACGCATTCGTCGATACTATGAAGATGAAGAGTTTGAAACT
9227	40	80	MW2_CDS_07140	MW1333	FALSE	unmapped	TCTTGCAAACTGGAAAGGTGATACACCTTTAATTGATCCATTTTGCGGTTCGGGTACAAT
9228	40	78	MW2_CDS_03066	MW0563	FALSE	unmapped	ACGAAAGGGTCTCATGAATTTGATGAAAATCAAGAAGTACATCAGAACAATCAACCGGAA
9229	40	76	MW2_CDS_06186	MW1148	FALSE	unmapped	AGGTGGCGTAGATTTAAATGATTGTACGCTAGCTTCTGAAAAAATAAGTGAAGCTATGGA
9230	40	74	MW2_CDS_04800	MW0885	FALSE	unmapped	ACTCGTTTTAGATAAAAGTGAGTATTTCGATACTACGGATTATGAGTTAGAGTTCGAAGT
9231	40	72	MW2_CDS_08382	MW1577	FALSE	unmapped	AAATTCAGCAATGAGTGCCATTGATAGTGCATTGTCCGATATTAGAAACGGTCATGTGGG
9232	40	70	NC_A_017		FALSE	unmapped	TCTGAATACACGACGCTAAACAAAGGGGATGGGAGAAATTTTTCACTTCAAACAAAGGGG
9233	40	68	MW2_CDS_13075	MW2475	FALSE	unmapped	CAAGGTGGCGGCACTGATGATTCAAAAGGTTACTTTGTAGAACCAACAATCATTTCAGGA
9234	40	66	MW2_CDS_02129	MW0393	FALSE	unmapped	ACCCCAACTATATTTGAAGAGCAGCAAAAAATAGGCGAATTCATCAGCAAACTTGACCGA
9235	40	64	agr_tiling 128_F		FALSE	unmapped	CATAGGTACAATATTTTTATTGAAATAGTCTCGAAGACCGGTCATGTCATCTTCACGAAT
9236	40	62	MW2_CDS_00034	MW0007	FALSE	unmapped	TCCTATTGAGGAACAGACATATGAGCGTAATCGTGAAGCAGTTGATCGTTTAGGTGCAAC
9237	40	60	MW2_CDS_03034	MW0558	FALSE	unmapped	GCCCAAAAAATACGCAAAAATTAGCGAAAATGAATTTGAAAGGTTAAATATAGTCGAGCC
9238	40	58	MW2_CDS_07956	MW1499	FALSE	unmapped	TTTAAATGTAATTGTGGTCGTTCTGGATGTATTGAAACAGTTGCTTCAGCGACAGGCGTT
9239	40	56	MW2_CDS_05304	MW0982	FALSE	unmapped	TCAACAATTTGGCACACCAACAGATATATATGACGAACCAGTGAATCGATTTGTAGCTGA
9240	40	54	MW2_CDS_02954	MW0544	FALSE	unmapped	TGGTTATAATGCCATTGTTAGAAATTCTGGTGGCTTAGGTGTCGTTCTAGATCAAGGTGT
9241	40	52	MW2_CDS_10174	MW1917	FALSE	unmapped	TGGCGAGAAAAGCAAGGATTGTAACAATAAATGATAAACCTTATAGGTTCAGTAAATTTG
9242	40	50	MW2_CDS_01996	MW0367	FALSE	unmapped	TTGAATTAGGTATTCCAGAACATTTAGTGTGGAGACAACCATTCCCAGGACCTGGTCTTG
9243	40	48	MW2_CDS_10663	MW2013	FALSE	unmapped	CCCGATTAAGAGTATGTTGGGTTGTTTACCAATGCTAATCCAATTGCCAATCATCATGGG
9244	40	46	MW2_CDS_06418	MW1192	FALSE	unmapped	AGTTGCCCCTGGTCAACATGAAATTGACTTTAAATATGCAGATGCTGTTACAGCATGTGA
9245	40	44	MW2_CDS_13786	MW2602	FALSE	unmapped	AAAGGTATCAAACGCATTGTGTTACCTTTAATATTTTCTAGTATCGAAAGAATTGACACT
9246	40	42	MW2_CDS_04893	MW0902	FALSE	unmapped	TTGGTATTCACTTTGGTGGTATGGACTTAGGTCAGTTCGTAGTCATGTTCCTAGGTGGAA
9247	40	40	MW2_CDS_05293	MW0980	FALSE	unmapped	TTTCTTTAATCATGTAGAGAAGTATTATGAATCCGGCGTGACGGCAGGCGACTTTATGGG
9248	40	38	MW2_CDS_04750	MW0876	FALSE	unmapped	TTGCTTTAGGAATAACGTCAGGTAGATATTCTTACAGTTTGACTGATTATACTGTGCAAA
9249	40	36	MW2_CDS_10681	MW2016	FALSE	unmapped	ACGGCAGAACTTGCAAAAGGTAGACGATTATTTGAGGCTGTACACAAGGCTAAAAAGTTT
9250	40	34	MW2_CDS_12294	MW2327	FALSE	unmapped	ATTGACTCATTTGCGACACCTCAAGGTGCAAAAGATACAAAAATGCCAAGCATGAAAATT
9251	40	32	MW2_CDS_01652	MW0301	FALSE	unmapped	TGACACCTGAATTGCAAGATGATATTGGGACAGTAGGTTATGTTGAATTCGTAAGTCCAG
9252	40	30	MW2_CDS_02646	MW0488	FALSE	unmapped	TTGTGTTTTCGATGCTTATGACCAATCGGGTGTTGAAAGAGAATACATGTATCATGGCGT
9253	40	28	(+)eQC-40		pos		
9254	40	26	MW2_CDS_10538	MW1989	FALSE	unmapped	TTTACGCGAAGGTGGCCTAGGTTTATTTTTAATCGAATCTTTAATGGATGAAGTGACAGT
9255	40	24	MW2_CDS_04213	MW0772	FALSE	unmapped	ACTGCCAAATTTTAATTCAAAACAAATACTTAACTGGTGAAGTTTTGGACGATAACATTT
9256	40	22	MW2_CDS_10797	MW2039	FALSE	unmapped	TGAATCAAGAGGTATATTCGCTGTGAACAATCAAGGTGTTTCGAATTATGTTGAAGACTT
9257	40	20	MW2_CDS_12116	MW2293	FALSE	unmapped	AAAGTGACATATGATATTCCGACTTGCGAGGATTATTGCGCATTAAGGATTAACGCAGGT
9258	40	18	MW2_CDS_12463	MW2359	FALSE	unmapped	AGGATGGTGATACTACAAGTGAAAAATATATTACAGAAATTTGGATGCCTGTTAAAGGGT
9259	40	16	MW2_CDS_03231	MW0594	FALSE	unmapped	ACTACGACAGATTTGTACCATATTCTGTTTGGTAATTTACTGGCAATCACAAATAGTGCA
9260	40	14	(+)E1A_r60_a20		pos		
9261	40	12	MW2_CDS_02269	MW0419	FALSE	unmapped	CCGGGTCAAAAATTGAAAGTAACTGGTAATGCATCTACGAACTCAGGATCTGCAACAACG
9262	40	10	MW2_CDS_06501	MW1213	FALSE	unmapped	AGATCAAGCAATAGCTAAAGAAGATTTATCACTTTCAAAAATTGCAAAAGTTTATGTGCA
9263	40	8	MW2_CDS_03100	MW0570	FALSE	unmapped	TTTGCATTTTGTTGAAGGACAAACGACAACAACTTTTTACGATATATCGGCTGGACGAAT
9264	40	6	MW2_CDS_09243	MW1735	FALSE	unmapped	GTGACGCAGTATGTGTAGGGCATCCTGATGATACTTGGGGACAAGTGCCTAAATTATATT
9265	40	4	MW2_CDS_10689	MW2019	FALSE	unmapped	TGTCCCAGCCTGTATAATGACATATATTTGCGAAATAAAAAAACCGGAACATATCGAGAA
9266	40	2	MW2_CDS_05147	MW0952	FALSE	unmapped	ATACGATAATTAAGCCAGGACTTCAAGCATCGGTAGTACGTGTGGAAGGCACAAATAAGG
9267	40	163	MW2_CDS_04956	MW0915	FALSE	unmapped	GGATTAATCGTATCCATTACTATTGCTTTTACAATCATACATCATCCTATACTTGATCGT
9268	40	161	MW2_CDS_10998	MW2080	FALSE	unmapped	GCAGAAGGTTTTGCTGGTGGAGAACTTAAACATGGTACAATTGCCTTAATCGAAGAAGGT
9269	40	159	RC12		pos		
9270	40	157	MW2_CDS_00551	MW0103	FALSE	unmapped	TGGAACTATATATATCAATTAGAACATTGATGGTTGTTATTACAGGGGAAGGCTCAAGGT
9271	40	155	MW2_CDS_02616	MW0483	FALSE	unmapped	AGAAATGCCAGCTCTTGGTGAAGAAGAACAACAAGTGATTAATGGAGAGCAAGTACCAGA
9272	40	153	MW2_CDS_13145	MW2488	FALSE	unmapped	CTGAAAAGCGCTCTAATGTACATCTAGTCGATTGGTATAAAGCTTCTGCAGGTCATCCGG
9273	40	151	psma_tiling_034_F		FALSE	unmapped	ATTATCGACATTTTCGCAAAATAATTTAAGCGAATTGAATACTTAAAATTCTCAGGCCAC
9274	40	149	MW2_CDS_13713	MW2590	FALSE	unmapped	TATGGTGCAGCACATGCAGCAAAATATGGACATGAACGTTATGGAAAAACATACGAAGGA
9275	40	147	MW2_CDS_12821	MW2426	FALSE	unmapped	AAAAATAAATGGCCGTTTCTAATTGCGTTGCCGTTTATGATTGGATACGGCATTGGTGTT
9276	40	145	MW2_CDS_00426	MW0081	FALSE	unmapped	TTTGATCTTCGCGTCTTAATGGATGCCATATACGAACTGAATGACCATCAAGATTTGCGC
9277	40	143	NA		ignore		
9278	40	141	MW2_CDS_08711	MW1638	FALSE	unmapped	TAAGACCGGTACGTTGGTTTAAAGGAGTACCATCACCTGTTAAACGTCCACAAGATGTTG
9279	40	139	MW2_CDS_05934	MW1103	FALSE	unmapped	TGCTCATCATCAGCAATTCCAAAAGCCAGAAGGTACGGTTTACGAACCAAAACCTAAAAA
9280	40	137	MW2_CDS_05220	MW0966	FALSE	unmapped	TATTGAAGCGTCACATAAAGAAGGTAAATGGACAGGTATGTGTGGTGAAATGGCTGGAGA
9281	40	135	agr_tiling 023_R		FALSE	unmapped	AAATTTTATTTATCAAATAATGATAAATCGATGTTGTTTACGATAGCTTACATGCTAGAA
9282	40	133	MW2_CDS_02958	MW0545	FALSE	unmapped	ATATTACAGAGCCGCTAGCAGTAACGATCCAAACGAATTTACCACCATCACGTGGATTAG
9283	40	131	MW2_CDS_01524	MW0279	FALSE	unmapped	ACCATGGACATCATGTGAATTTGATTTTACAAGAGAGGGTAATTTGAAAGTATCGTTTGA
9284	40	129	MW2_CDS_09779	MW1836	FALSE	unmapped	TCCATGATATTTTGATGACATTGGATATTGGAGATTTTCCAGGCGTAGGTAAAGCTTCCA
9285	40	127	MW2_CDS_09523	MW1789	FALSE	unmapped	TTCAGCAATCAATAAAGGTGCTGATGGTTATGAAATGAAAGACGTTGAGCCTCAGCAATT
9286	40	125	MW2_CDS_12624	MW2388	FALSE	unmapped	AACAAGGTAGTCGTGCCTTTGACCCATCAACTACTGTCGGTAAACAAATGTTTGAGACTA
9287	40	123	MW2_CDS_03689	MW0676	FALSE	unmapped	TAACGTTATCATAAGCAAACCGATGAAAGGGACAATGCCTAGAGGTAAAACGGAAGCTGA
9288	40	121	MW2_CDS_05705	MW1062	FALSE	unmapped	CAGTTATCACCATGACGCAACATTAGACATGCGTATGGACCAAACACAAGAACTAACAGC
9289	40	119	MW2_CDS_08205	MW1544	FALSE	unmapped	GAGTTATGGTAGTGAAATATTGCATGGCCCTGTGTGTGCAGCAATCATGGAACATGAATA
9290	40	117	MW2_CDS_09059	MW1699	FALSE	unmapped	TGCTGTTCAAGTTGACGTAGTAAAAAAACAAGCAGCGCGAGATAAAATCACTGCTGAAGT
9291	40	115	MW2_CDS_01466	MW0270	FALSE	unmapped	AAACGCTGGGGGGGTAAAACTAAAACACATTTCGGTTTATTATTAACTGCGTTGAGCTCA
9292	40	113	MW2_CDS_01341	MW0245	FALSE	unmapped	TGCCAATTCCAAATGATCATCGTCGTATCGACCTAGCTGTAACTAAAAACTTACCACGCT
9293	40	111	MW2_CDS_11003	MW2081	FALSE	unmapped	ACTGTCACATTGATGACACTTTATTTAATTTTGTCACATTTATTTTGACAAAGTTGATTT
9294	40	109	MW2_CDS_10521	MW1986	FALSE	unmapped	ACTGCACGAATTATGTCATTATCACTTGCATATTGCTGGTAAAGGTTATCAACATAAAGA
9295	40	107	MW2_CDS_05446	MW1009	FALSE	unmapped	GCTTGCTAAACAGCAAGAACAAGATGATTCAGAATCACGACAAGTTGATCCAAGGCTTCA
9296	40	105	MW2_CDS_12472	MW2361	FALSE	unmapped	ACATGTTGTGACGCACCCTGATTTCATTGTTCCTATGCCGCATCGTATATTCGATTTTTA
9297	40	103	MW2_CDS_09836	MW1846	FALSE	unmapped	ACAAAGTGATGCATAAAGCCTGGGGAGAAGGCATGGTGAGTAATGTAAACGAGAAAAATG
9298	40	101	MW2_CDS_06876	MW1283	FALSE	unmapped	AGCCTAGAAGATACAGATACTAAAGTGCTTCGTGAAGCATATGACACATTTAAAGCGGGT
9299	40	99	MW2_CDS_03899	MW0712	FALSE	unmapped	TTGCCAGCTCGCTTTCATAAAAAATCACTTCCAGTTCCTAAATATCGTTATTTCAAACTT
9300	40	97	MW2_CDS_07505	MW1404	FALSE	unmapped	ACGAAACCTTGAAGAAATGGTCGAAGCAGTTGAGAGTGAATACTTAAAGTTGCCTGAAGA
9301	40	95	MW2_CDS_05933	MW1103	FALSE	unmapped	TGCACTTGTTTCTTTTGTGGCAATGGCAATGTTTGGTAATAAATACGAAGAGACACCTGA
9302	40	93	MW2_CDS_00398	MW0075	FALSE	unmapped	TGATCTTGAAAATGCATATGAAATAGAGTTGAAACGTATTGAAAGGGAGATACAAAATCT
9303	40	91	MW2_CDS_04562	MW0842	FALSE	unmapped	TTAAGTGGTACCACATACCCTATCGATAGACACGAGACAACAGCATTGTTGAACTTTGGC
9304	40	89	MW2_CDS_00391	MW0074	FALSE	unmapped	GTGGCATTTTCGGTAGCTGAAGGACTAAGTAAAATGGTTGACCAAGAACTTCAGCAGTTG
9305	40	87	MW2_CDS_08571	MW1614	FALSE	unmapped	TGATGCGATTATTTTAGCTGCAGCTGGTTTAAGAAGAATGGGCTGGTCAGATGATATTGT
9306	40	85	MW2_CDS_05549	MW1029	FALSE	unmapped	GCGCTAGTGCAGAAATTGTACCACTGAAGAAAAATAGCCAGGCATTTTATTTGTTGCACC
9307	40	83	MW2_CDS_07078	MW1323	FALSE	unmapped	TTAAATGGATACCGAGAGAACAAAACAAAGAAGCGAATCAACACGCTCAACAGGCATTGT
9308	40	81	MW2_CDS_03295	MW0605	FALSE	unmapped	TGGCCTTGAAAGTGTCTATAATATCCCGTTATCTAAGTGGCGACGCAAAATTGGATATGT
9309	40	79	MW2_CDS_07233	MW1352	FALSE	unmapped	AGTCGCGTATTGCAGTTTGGGTGCTTAACTATATAAAAGTGAATGAGGCGAAATTGGCAA
9310	40	77	MW2_CDS_02994	MW0551	FALSE	unmapped	GCAGTTGGAGCTGGATTAGCGACTTTTGTTTTAGGAAGTAATCCAGTAGGATGGGTGATT
9311	40	75	MW2_CDS_13211	MW2500	FALSE	unmapped	CCCATTCTTCTTAGAACGTATGGATGAAGCTTTATTCGCTGAACATTTGAACCACCCTGT
9312	40	73	DCP_20_5		pos		
9313	40	71	MW2_CDS_11005	MW2082	FALSE	unmapped	TAATATAAATCATGTTATTTTTGCCTGCGATGCGGGTATGGGTTCTAGTGCAATGGGTGC
9314	40	69	MW2_CDS_02782	MW0513	FALSE	unmapped	AAGAGTCGTCTATGGCGCAGATGATCCTAAAGGTGGTTGTAGTGGCAGTTTAATGAATTT
9315	40	67	MW2_CDS_00526	MW0098	FALSE	unmapped	ACCAACCATCTTTACTGCGATTTATATGGAAAGTTACTCTGTAATCGGAGGTGCACTTTT
9316	40	65	MW2_CDS_10122	MW1905	FALSE	unmapped	GCAACATCAATCAATGTTCGTTTGGTTTTATGCTTGACGATAAAGGCGATGAAGTGCGTT
9317	40	63	MW2_CDS_04464	MW0824	FALSE	unmapped	TCAATATCAGCCTAGTGTGATTATGGACTTTGCTACATTAACGGGTGCAGCAATTGTTGC
9318	40	61	MW2_CDS_07996	MW1507	FALSE	unmapped	TAGCTGATGGGTTCAATCAAGAAATTGTTGGATTGCTATTTGGCTCAATAAGCGCAGTGA
9319	40	59	NA		ignore		
9320	40	57	MW2_CDS_08821	MW1657	FALSE	unmapped	AGCAATCGGTCTACCACCATCTGTGGCTTTAGGTACAAATAAATTGGCAAGTTCATTTGG
9321	40	55	MW2_CDS_04704	MW0869	FALSE	unmapped	TATTGGTTTGGTACTGATCAGTTGGGTCGAGATTTATGGACAAGAACATGGAAAGGTGCT
9322	40	53	MW2_CDS_08931	MW1677	FALSE	unmapped	GCAGCGGTTAATGGCAACTGGTGGACTTGAAATATTCGCTACAGATGATCCAGAAATAAC
9323	40	51	MW2_CDS_13354	MW2526	FALSE	unmapped	TTCAAACAAGTAACTGACTATGTATTCATCGGTGCTGGCGGTGGAGCGATTCCATTATTA
9324	40	49	MW2_CDS_00163	MW0031	FALSE	unmapped	ATGGCTAGCTACAATGCCAAAATCTCAGGTAAAGTGTATGATGAGCTATATGAGAACGGT
9325	40	47	MW2_CDS_12058	MW2283	FALSE	unmapped	TCGATCAACTCATTAAAGATATCATTCGACATGAACAATTTGCTGCTGATGAAAAGTCGT
9326	40	45	MW2_CDS_07667	MW1447	FALSE	unmapped	TGAAAGCCCTAGAAAAAGGTATTGAATTAGAAGATGGTATGACGCAACCGGCTGAAGTGA
9327	40	43	MW2_CDS_02944	MW0543	FALSE	unmapped	AGCTTTTCAACAAAAGGGTCTGCTAAATCAGACGACGTGACAAAAGTTCAAGAAGCTGTC
9328	40	41	MW2_CDS_07165	MW1339	FALSE	unmapped	TGCATATCAACAAAAAGGTATTGTGTTTTTAATGATTCGTTTTAAAACGCTAGATGAAGT
9329	40	39	MW2_CDS_12140	MW2297	FALSE	unmapped	GGAACGCACGAGTCAATTAGAATTGAAAATCAACGAACATATTAAAAATAATATGCAACG
9330	40	37	MW2_CDS_13438	MW2542	FALSE	unmapped	AGTCTAAGGTCGGTCTTAATAATGAAGTCTTTAAAGTGAAACAACTTGACGCACATGCGT
9331	40	35	MW2_CDS_10004	MW1878	FALSE	unmapped	CGCTATGAAGTCACTAAGGAAGTTGTCTATGCTGATCAATATCATTCACATTGGCAAGCC
9332	40	33	MW2_CDS_01227	MW0226	FALSE	unmapped	TCGCGGAATATGTCAAATTGCCAGCGCAAAATGTTTTAAAGGTTCCAGACAATGTTGATT
9333	40	31	MW2_CDS_01983	MW0365	FALSE	unmapped	AATTCATTTCCGTATACAGCCTATTCGCAAAATGTAGGACTTGTTTCTTTATCCGGCGCT
9334	40	29	MW2_CDS_08586	MW1617	FALSE	unmapped	TGCAGTAAAAGAAGAACAATATCCAAAAACAGAATTGTCTGAAGTTGCACTGAGCGGTCG
9335	40	27	MW2_CDS_07365	MW1375	FALSE	unmapped	AGCGACACTGTTTAGTACAAAGAAAAATTTTACTAATGACAATACAGAAGATGATGTAAT
9336	40	25	MW2_CDS_12174	MW2304	FALSE	unmapped	GCACCACTTGGAGTGTTTGCATTCATTTGTACTACAATTATTACATTTGGTGCATCCGCA
9337	40	23	MW2_CDS_13553	MW2563	FALSE	unmapped	TGGTCCATACAAGGATATGACCCTAGATCAACTTTGGTCACAACATCGTGAATTATTCGA
9338	40	21	MW2_CDS_07399	MW1382	FALSE	unmapped	TGTTTGGATTTACCAAACGACACGAACAAGATTGGCGTTTAACGCGATTAGAAGAAAATG
9339	40	19	MW2_CDS_04705	MW0869	FALSE	unmapped	TCGGTGGACGTGTCGATACGATTATGCAACGTATACTTGAAGTCATAGCATCTATTCCGA
9340	40	17	MW2_CDS_13665	MW2582	FALSE	unmapped	TGGTTGCAAATGGGGCATTGAGTCAATTAACATCGAGTTCTTTAGTTGGTGGATTTGGTA
9341	40	15	MW2_CDS_13322	MW2521	FALSE	unmapped	TAAAGATGCAGATTTAGTTGTTATTACAGCTGGTGCACCTCAAAAGCCAGGTGAAACACG
9342	40	13	MW2_CDS_13093	MW2478	FALSE	unmapped	TTGTCATTGCTTGTCCATGCGCATTAGGACTTGCTACACCAACTTCTATTATGGTAGGTA
9343	40	11	MW2_CDS_13538	MW2560	FALSE	unmapped	AATCGGAGCACTTGGGTTCGCAATTTATGCTGCAATAAATCATTCTACATCATCAAGTAA
9344	40	9	MW2_CDS_03917	MW0715	FALSE	unmapped	ATCCGTCATGATGTGTTAAATGCGAAAAATCATGAACGTGAAGCTGAAATTGTTGCAGGC
9345	40	7	MW2_CDS_04572	MW0844	FALSE	unmapped	ACTTGCTTGTGCAATGAGTGGATACCAATTAGGTGTAAATCCATTTAACCAACCTGGTGT
9346	40	5	perR_tiling_005_R		FALSE	unmapped	CTATTTAAATATTTTTCAGAATAAGCATAAAAAAGAAGTTAAACAACTTTCATGTCGTTT
9347	40	3	MW2_CDS_02650	MW0489	FALSE	unmapped	ACGATTTGACAACTCAAGACAGTACAATCAAACGTAACAATGCAATAAATGATAAAGACT
9348	40	1	MW2_CDS_05115	MW0946	FALSE	unmapped	AGCGAACAGAAAATATTAGAAGCAATCAATCCTGAAAAAGATGTGGACGGATTTCATCCA
9349	39	164	MW2_CDS_08280	MW1557	FALSE	unmapped	ACTTCACTGACTCGAATCATTTGGCTGCACACAGTAATCAATCAAATCAAAGTATGAACA
9350	39	162	MW2_CDS_05596	MW1038	FALSE	unmapped	CACTCGCCCATTAGAAGAACATAGAAAAAATATTCCAGTGGTTAAAAACGGCGAAATCGA
9351	39	160	MW2_CDS_09901	MW1857	FALSE	unmapped	TGTGCATACATGTTACCAGTAGGGACACCACCGAATGCAATTATCTTTGGTTCAGGTAAA
9352	39	158	(-)3xSLv1		neg		
9353	39	156	MW2_CDS_10627	MW2005	FALSE	unmapped	ATCGGTGTTGCTACTGATAATGCATTAGTTTGTTCTGTTGATGATAGAGATACTACAGGT
9354	39	154	MW2_CDS_03478	MW0637	FALSE	unmapped	ACAACTGCAGTGTTTTAACAATTCAAATTGGATATGGATATTCACCTATTTAGCAATCAT
9355	39	152	MW2_CDS_02857	MW0526	FALSE	unmapped	AACAGGCACATGTTGTTGGAGAATCAACGACACCTGCGATTAAGTCGAATGATGTATTTG
9356	39	150	MW2_CDS_02422	MW0448	FALSE	unmapped	AGTGGGCGAACGCTTAAATGCTGAAGTAGGTTCAAAAGCATATGGTTCGTTATCAATTGT
9357	39	148	MW2_CDS_12828	MW2427	FALSE	unmapped	TGCAGAGACGGAAAAGTATCGAGATTTACTGAAAGAATGTGCGACAGAGATTACTGAAGT
9358	39	146	MW2_CDS_10597	MW2000	FALSE	unmapped	GCTCATTGCGTTAACAGTATGTTTAATACCAACGACAATCGGTGGTTTGTTATCGGCGAT
9359	39	144	MW2_CDS_11992	MW2272	FALSE	unmapped	CGTTAGCCTAGTCATAACAATACTGACAATTGTATTTAATCGCACAGTTCTAAAAGTAGT
9360	39	142	perR_tiling_048_R		FALSE	unmapped	CATTTTCAAACACATCTAAATATGCATGTCGAATAACTTTACTTTTTAATACTTCTATTA
9361	39	140	MW2_CDS_13461	MW2546	FALSE	unmapped	TTTAGAGGAGCGTAAACGTACGAAGAAAAAGCAACTCGAGAAAGAAAAAGCAAATACACT
9362	39	138	MW2_CDS_07709	MW1454	FALSE	unmapped	TATCAACTTCATGGCGGAACCATTGATGACCCATTAGACGAAACAATAAGCGCATTTGAT
9363	39	136	MW2_CDS_03185	MW0586	FALSE	unmapped	TTTTATTCTCAGTTGTTGGTGTTATTGTCACAGTGATGTTGTCGCTTAGCGGAGGTCGAT
9364	39	134	MW2_CDS_05371	MW0995	FALSE	unmapped	ACCTTCATGCCCATTATATGAAGAAGTACTAGATACACAAATGTTTGGACTTCAAAAAGA
9365	39	132	MW2_CDS_12546	MW2373	FALSE	unmapped	AGAGCGTTAATCTTTAATGAAACAGAATTAGAGGAAGCGTATAAATGGATGCATCCTTGT
9366	39	130	MW2_CDS_04722	MW0872	FALSE	unmapped	AAGAAATGTTCCTAGGAGATGCACCGGTAGCACCAATTTATCAAAAAGGTGTTGCACATT
9367	39	128	MW2_CDS_06626	MW1238	FALSE	unmapped	TGAGATTTTTAATGAAAAAGGTGAACTTGCAACTACAGGTTCCACAGAATTGATTTGCAT
9368	39	126	MW2_CDS_13817	MW2608	FALSE	unmapped	GGGCGGAGGATCTATGCTTTATACAGTTAATGGCTTTGCAAAAGGTCATCAAAGTTTTCA
9369	39	124	MW2_CDS_11851	MW2247	FALSE	unmapped	GCGAGTTTGGTAAGTGTCGCAGATATTGCCACGGCAAACAACACCATCTCTATTATTATG
9370	39	122	MW2_CDS_10072	MW1894	FALSE	unmapped	TGGATGGAGATGAATGGATTAGGTTCATTCAATACGGAGATTCTACCGAAACCGAAAGGC
9371	39	120	MW2_CDS_02255	MW0416	FALSE	unmapped	ATTGAGTGATAAAAAAGACCAATTTCCTGAAGAATTATCTGGTGGGCAGAAGCAAAGGGT
9372	39	118	MW2_CDS_02154	MW0397	FALSE	unmapped	TCAAGTGCAGATAATGTACCAAGTTTCGATGCAGAATATCAAATAAGTAATACGGATAAA
9373	39	116	(-)3xSLv1		neg		
9374	39	114	MW2_CDS_01697	MW0309	FALSE	unmapped	GCCGTTAGCAAGCATATTAGTCCAATTGAACAAGATGCTGCTATTCGCTTCAACGAAGAT
9375	39	112	MW2_CDS_08657	MW1629	FALSE	unmapped	GCATGCCGATGAATTAAATGCCATTCGAAGACGAAGAGAATGTGAAAATTGTGGAACACG
9376	39	110	MW2_CDS_10758	MW2032	FALSE	unmapped	ACGTCAACCAGAAGCACGTGGTCAATTAATGGGTATCATGTTCATTGGTGTAGGTTTAGT
9377	39	108	MW2_CDS_07415	MW1386	FALSE	unmapped	TTCAAATCGATGATTTTCCATTACCAAGAGAATGGCGTGATGCAGGTTGGTTCTTGGAAG
9378	39	106	MW2_CDS_06842	MW1277	FALSE	unmapped	TGCTGATACAAATGCTATCGTTTCTTCTGTAACGAAAAACAAAGAGGGAATCGGATACTT
9379	39	104	MW2_CDS_10575	MW1997	FALSE	unmapped	AGCGCATCACATTATAGGATTTGACACTTGGCAACATACATTACTTAAACGCAACAATTT
9380	39	102	MW2_CDS_04807	MW0887	FALSE	unmapped	GGATGAAATTCAACATCGTTTGGAAAGAGCGGCAGAAGCAGCGTATTTACTTGATGAAGA
9381	39	100	(+)E1A_r60_a135		pos		
9382	39	98	MW2_CDS_09353	MW1757	FALSE	unmapped	AGTTGTTAAAACGGCTAAAGCAGAAGAAAAAATGACAGATGGTCAATTATGGAAAAAAGT
9383	39	96	MW2_CDS_04257	MW0782	FALSE	unmapped	TGAAAATGTCACAGTTGATCAAGTGGCAGAAATGATTACAAAGCTGAAGGTTATGCAAGA
9384	39	94	agr_tiling 095_R		FALSE	unmapped	TACAAAAAATCAGATTATATATACATTATTGGAATAGTGTTATCTTCAGTATATTTCTTT
9385	39	92	MW2_CDS_02018	MW0371	FALSE	unmapped	AAGGTGAAACAGACGTTAATAAAACGGCAGTCAAGACTAGTGAACCAATAGCTTTTGTGA
9386	39	90	MW2_CDS_05157	MW0954	FALSE	unmapped	CATGGGTATTGGCTATACGGTTATCGTTGATGAAAAAGATGCATCACGCGCTTTGAAGAT
9387	39	88	MW2_CDS_00105	MW0019	FALSE	unmapped	TGCGATGAAATATTCTAGAGGCGATAAACGTGTCGAGTTCCACGTGAAACAAAATCCACT
9388	39	86	MW2_CDS_07215	MW1348	FALSE	unmapped	AAGGTGTTATACAACAAACTTCAGAAAAACATGCTAGCAGATATTGCTGAACGTTTTGGA
9389	39	84	MW2_CDS_01911	MW0351	FALSE	unmapped	TTTTTCACAAAAAGCGCCTGAAGGAGAAAGTTATGAAGATGTATATCAACGCGTCGAACA
9390	39	82	MW2_CDS_04181	MW0765	FALSE	unmapped	AAATGGAAATACTGATAATTTAGATTATCTAGGATTATCTCATGAAAGATATGAAAGTGT
9391	39	80	MW2_CDS_05315	MW0984	FALSE	unmapped	TCTTCGTTACTGGTAATGGCTTTAGTGTGTTATCAGTTGAAGTTTATGCTATGGCGAGAA
9392	39	78	MW2_CDS_03017	MW0555	FALSE	unmapped	TTATTTGGTGGATTGTCAACAATGGCTCTGAGTATGTTAGTAACTTCATCCCCTCAAAAT
9393	39	76	MW2_CDS_00187	MW0035	FALSE	unmapped	TTGATGAAAGCGATTAGTGAAAGTGACACAGTGATTCTTGCTTATGGTGCCTATGCGAAG
9394	39	74	MW2_CDS_10186	MW1920	FALSE	unmapped	ACGGCATCACTTAAAATCGCTAAAGACAGAAACAAAGTTACTTGGGGATATGCTAAAAGC
9395	39	72	MW2_CDS_06254	MW1161	FALSE	unmapped	TGTTTCTGTTGCTGAAAAAGCATTTTTAGATACAATCTATGTGTTGACAAAAGGAGGGGA
9396	39	70	MW2_CDS_04739	MW0874	FALSE	unmapped	TGCAGGTCAAATTGTAGAATTTGGAGGCATAAAAGAAATACTACACAATCCGAAACATCC
9397	39	68	MW2_CDS_10270	MW1939	FALSE	unmapped	AAGCCGGAAAACCTACGAAGTCAGAACAAGAAAAATTCATCTCGGTAACTGAATATGAAA
9398	39	66	MW2_CDS_11347	MW2146	FALSE	unmapped	AACGTAAAGGTAAAGTAATGGTAATTTGTGAAAATCCAAAACACAAACAAAGACAAGGTT
9399	39	64	MW2_CDS_11739	MW2225	FALSE	unmapped	AGGTGCTGGACAAGCAATGGAAGATGCTATCGTATTAGTAAATTGTTTTAACACATACGA
9400	39	62	MW2_CDS_06878	MW1284	FALSE	unmapped	ATTTTTGCGAATGGTGCAATACAAGCAGCAGAACGCTTAGTTAATAAACCAAACGGCTTT
9401	39	60	MW2_CDS_07317	MW1367	FALSE	unmapped	GATCGTGTGCAATTCCATCATATGCCATATCGCCAACAAGCATTGGAAAATGTCAATGAC
9402	39	58	MW2_CDS_00122	MW0022	FALSE	unmapped	ATGGAAGACGAAACAACGTATTTTAGGCGATATGGGACATGTATCTAATGAGGATGCGGG
9403	39	56	MW2_CDS_01368	MW0251	FALSE	unmapped	CGAGGTTATAGTTCATATGGATCAACACACAAAGCGGGCGCGATGAATATTACGCAAAAT
9404	39	54	MW2_CDS_05501	MW1020	FALSE	unmapped	TTGCTGAATCTTTATCAGGTACAGTGACACCACAAGGGTTTTTCGCAATCATTGAGAAGC
9405	39	52	MW2_CDS_10116	MW1904	FALSE	unmapped	GATGCGATTGTTTTATTTGACCGCTCTCAATACCAAGCATCATGGACTGACTACATGCAT
9406	39	50	MW2_CDS_12677	MW2397	FALSE	unmapped	TTTAAGAAATGCTAAAACAGGCAGCTTACTAGACGATGCGCCATTAATTAACGGTGTCGG
9407	39	48	NC_S_065		FALSE	unmapped	TCGTACTAATTTTCAGCGTTTGATGACAAAAGTGTATGTCCAAACTTAAATAATGGCGAT
9408	39	46	MW2_CDS_05210	MW0964	FALSE	unmapped	TACTGCTGCAAAACAAACAAAATGGTTTCCTGTTGTAGGACAAGCTGTGTCTGCATCTAT
9409	39	44	(+)E1A_r60_a22		pos		
9410	39	42	MW2_CDS_04019	MW0733	FALSE	unmapped	CCTGAAAAGGTCATTGAACAACTTCAACATCATCAAGCTGTCGGAGAGGCATTTGGTTAT
9411	39	40	MW2_CDS_02488	MW0460	FALSE	unmapped	AGGTTGTCCATGGGATAAAGTGCAAACGCATGAAACGCTTAAGCGTTATTTACTTGAAGA
9412	39	38	MW2_CDS_11125	MW2102	FALSE	unmapped	ACATATCCTTATGAATCACCAGTAGGGATTGTTACATCATTCGTAGGTGCACTTTACTTC
9413	39	36	MW2_CDS_04108	MW0751	FALSE	unmapped	AGAAAGAACAAAAATGGAAGAAAAGTGGATTGAAGGAGGAAAACGAGGGCGAAAGCCTAC
9414	39	34	psma_tiling_015_R		FALSE	unmapped	GTACAATCATTGTTTAACAGTCATAAAAATGAGTGAAGTAAATGCAGCTATCAATGTACT
9415	39	32	MW2_CDS_11376	MW2153	FALSE	unmapped	AAGGCGTAACATTAGCTCAAGCTTCTTCAAAAGACAGCGACATTGCTACTACAGCAACTA
9416	39	30	MW2_CDS_01982	MW0365	FALSE	unmapped	AAATATCATACCGCTACCTGTGTTAGGTGGTGCGATGATAGCTATGTTTGGCATGGTAAT
9417	39	28	MW2_CDS_01140	MW0209	FALSE	unmapped	GCTTTACGTGCCACATTAGATTATGTCACTGAGCGTAAGCAATTCGGCAAACCAATTAGT
9418	39	26	MW2_CDS_03330	MW0612	FALSE	unmapped	ATGTTCAAACTGTTATTGTTCGTGACGACATTGCTGTGACAAACGAAGTACAACGTCGTG
9419	39	24	MW2_CDS_12308	MW2330	FALSE	unmapped	ACGCTCGACAGAATTTAAAGGCACTTATGACAAAAGTAAATGATGATAGTGATATGGTAA
9420	39	22	MW2_CDS_09200	MW1726	FALSE	unmapped	CAGCAATTTTGAACCTGAACATTTGGAAGCTTTGTTGGCACAAGTGTCAATTAAACCTGT
9421	39	20	MW2_CDS_05957	MW1108	FALSE	unmapped	ACGGTGTGAAAATATCTGAAGTTGCCAATAATGTACAATCAACAGTGAAATATACTTTGG
9422	39	18	MW2_CDS_00048	MW0009	FALSE	unmapped	GAAATGATGGTACCACAGCTTGTGAACGCAGATACAATGTATGGTACAGGTCAATTACCT
9423	39	16	MW2_CDS_11796	MW2236	FALSE	unmapped	AGCAACTCACAATTCGAACGACAGTGTTATTCTTATTACTAACAATGGTACGCAAAGTGA
9424	39	14	MW2_CDS_07544	MW1416	FALSE	unmapped	TGAAATCATCGACCAACGTGATGCATTGCTAGAAGAAAAGTGTTTAAACGACGACTGGTG
9425	39	12	MW2_CDS_07797	MW1469	FALSE	unmapped	AGTGCCAGAAGAATATTACACTGTACCTTTAGGAAAAGCAGATGTTAAACGTGAAGGTGA
9426	39	10	MW2_CDS_05521	MW1023	FALSE	unmapped	GTCATGTTTCAAGGTAATCATGCAGAAGCTGTGTCTAAAGAACTTCTACCGCAGCATTCT
9427	39	8	MW2_CDS_10233	MW1932	FALSE	unmapped	CAATCACACATTCGGACGGTCACACATCAATTAGTAAGACGCCAAAAGTAACAGGCAAAG
9428	39	6	agr_tiling 041_F		FALSE	unmapped	TAATATAACTAGATCACAGAGATGTGATGGAAAATAGTTGATGAGTTGTTTAATTTTAAG
9429	39	4	MW2_CDS_12615	MW2387	FALSE	unmapped	GGCGCAACGTGTTGCGATTGCGCGTGCAATATGTATTAACCCTAAATATATTTTGTTTGA
9430	39	2	MW2_CDS_10026	MW1883	FALSE	unmapped	ACTCATTTTCTAACTCTAAACACCTCATTTTTTAATAATTCAGCATCGGATTTCTGTTTT
9431	39	163	MW2_CDS_07436	MW1390	FALSE	unmapped	GTTGGACTGGAGATATGTATTCAAGAGCCCACGATCGTTTTGATGCAATTTCAAGTTCGG
9432	39	161	perR_tiling_099_F		FALSE	unmapped	TTTAGAGACAATTTAGAAATGTTCAATGATTTAGATGTTGCAGTATATGGTATAAGCGGT
9433	39	159	MW2_CDS_07806	MW1471	FALSE	unmapped	AAGCAATTGGTAAAGCAGTGATTGATAGCCATGACACAAACGAAGGGTATAGCGAAATGG
9434	39	157	MW2_CDS_03648	MW0668	FALSE	unmapped	TTGTGACTGTAAATGGTCACGAAGTCCCTATGCGTATTAAGGAATTTGAGTTATTGTGGT
9435	39	155	MW2_CDS_08881	MW1667	FALSE	unmapped	AGAAGCGCATCATGCCGACTATGTTATTAATCATTTAGGTGAACTTAGAGGTGTACTAGA
9436	39	153	MW2_CDS_08985	MW1686	FALSE	unmapped	GTCAAGGCGAAATGCTCGTAGCAGTGCCACACCAAGATGTGTTAATTATTGCAGATATAC
9437	39	151	MW2_CDS_10364	MW1957	FALSE	unmapped	TGGGATAACACAAAAGCAATTTTAAAAGAAGTCATGGGAGAGAATCGTGATTTCGAGCCA
9438	39	149	MW2_CDS_02352	MW0435	FALSE	unmapped	TATCAAAGTGACGAGATTAGCACAAGGGTTATCGGTAGGTGGCGATTTAGAGTATGCTGA
9439	39	147	MW2_CDS_10282	MW1941	FALSE	unmapped	TGACAACAACAATACAAATGTGACTGACTTTGCACCAAAAAATCAGGATGAATCAAGAGA
9440	39	145	MW2_CDS_04741	MW0875	FALSE	unmapped	AGTAATCCGCCGCAAGGTTGTCCTTTTCATACAAGATGTCCGATTGCAAAAGATAAATGT
9441	39	143	MW2_CDS_03844	MW0703	FALSE	unmapped	GGTTTGGAATCGAGACCACGGTGATATCAATGTGTCGTCATTAGCACAAGCAGAAGAATA
9442	39	141	MW2_CDS_01260	MW0232	FALSE	unmapped	ATGATCGATTACATTTCACCAGAAGGAAGCATTGCACTGTTAGGTGTAAGTGAGTTCCCA
9443	39	139	MW2_CDS_04041	MW0736	FALSE	unmapped	GCACCAGCAATTCAATTAGATGCATTAACTACTGCAGTTAAAGAAGGAAAAGCACAAGGT
9444	39	137	MW2_CDS_13174	MW2493	FALSE	unmapped	AGACACACGATGTCATTCGACAATGCTCATTTCTTTGCTCAGTTACGTCATCCTGTCTTA
9445	39	135	MW2_CDS_07091	MW1325	FALSE	unmapped	GGTTTAGGACTAGGGATATATGCTACACCATCAACAGATACAGCAATTGCAAATGCACCG
9446	39	133	MW2_CDS_08433	MW1586	FALSE	unmapped	TGCGAATTGTTGATGACTGACGACGAAGAAGAAGCTGCATTTTTAGCAGAACAAGTTGAA
9447	39	131	MW2_CDS_12564	MW2376	FALSE	unmapped	TCTGTTCAAGCTATCACGTATACGAGTGCCATCATTGGCGCATTAGGATTAATCGTTGTT
9448	39	129	MW2_CDS_02674	MW0494	FALSE	unmapped	ATCAGTATTACAAGCTCCTGTACGCAACTTCGCTTATGCGGTTAAAGCTATTGGAGAACA
9449	39	127	MW2_CDS_12479	MW2362	FALSE	unmapped	TGCTAACTGCCGCGGCCTCTGCTACAAATAGTGGTATCTATTCGAATAGTCGTATCTTAT
9450	39	125	perR_tiling_003_F		FALSE	unmapped	TCTGAAAAATATTTAAATAGAAGAAAAGAACATTCTAACTACGGAAGTGGTATTAACTAA
9451	39	123	MW2_CDS_01339	MW0245	FALSE	unmapped	TGCAACAAATTAAACAATTGATTTCATCGGAAATCGAAATCATTTTCATTCCTCACGAAG
9452	39	121	MW2_CDS_04632	MW0854	FALSE	unmapped	TGGAAGAGGCATTGAAAGATAGTATCTTAGGTGCATTAGAAATGGTAATTGACCCTGAAT
9453	39	119	MW2_CDS_06578	MW1228	FALSE	unmapped	TTCTGATTTGAATATCGAAAGAATTAACGAGTTAGCTAAAAAGAAAAAAGAAGTAGGATT
9454	39	117	MW2_CDS_04004	MW0730	FALSE	unmapped	TGACAACGTAGCAAATTCAATCGTATCACAGTTATTATTCTTACAAGCGCAAGACTCAGA
9455	39	115	MW2_CDS_09602	MW1803	FALSE	unmapped	ACACCTACTTGTACCACAGAAGCTTGTGACTTTAGAGACAATTTAGAAATGTTCAATGAT
9456	39	113	MW2_CDS_00772	MW0143	FALSE	unmapped	TCCGCAACCAATTGAAAGTGGCATTATGTTTATGATTGCTAGTATTGGTTTACTCGTTAA
9457	39	111	MW2_CDS_00740	MW0137	FALSE	unmapped	TGTATGAAATACGTCGCCAATCACATCGTAAAACGGTATTGATCAACATGCCTTCAGTGT
9458	39	109	MW2_CDS_02608	MW0481	FALSE	unmapped	CAATCCGAGACGAATGGCAACAGGGATTGATCATAATCGATTAAGTTTGTTGATGGCTGT
9459	39	107	MW2_CDS_05642	MW1048	FALSE	unmapped	GGTACAGCATCTACACAATTTCCTAATACACCTATCAATTCTTCATCTGAAGCGAAAGCT
9460	39	105	MW2_CDS_05433	MW1007	FALSE	unmapped	TGGAACATACAATAGCGGTCATTCCGGGTAGTTTTGACCCCATTACTTATGGTCATTTAG
9461	39	103	MW2_CDS_10317	MW1947	FALSE	unmapped	GTGGTATGTGTAAAATGATGTTTTACGAAAAAAATGCAGAGTATATGAGAATCCTTGCGT
9462	39	101	MW2_CDS_06354	MW1179	FALSE	unmapped	CAGATATTGTCAACAGAATGGCAATGAGCCATCCGGACATTCGAATAGCACTCATTTCAG
9463	39	99	MW2_CDS_09797	MW1839	FALSE	unmapped	CAATGGCAGGATTTGAAAAATTAGTGCCGGACGCTAAGTTAGATGACGGCTATTTTACGT
9464	39	97	MW2_CDS_02578	MW0476	FALSE	unmapped	GCAATGCAAGCACTTGGTAAACTTAGTGATTTATCTGAACACGCAAAAGGTGTTACATCT
9465	39	95	MW2_CDS_10218	MW1928	FALSE	unmapped	AAGAGCGCAAGGAATTGTGCATTACCCTGATGAGAATTTTAATCGCTGGAGATTTAACGC
9466	39	93	NA		ignore		
9467	39	91	MW2_CDS_10904	MW2058	FALSE	unmapped	TCACAAATACGACATTCGTTTCAAACAACCAAACAAAGAACATATGGATATGCCCGGACT
9468	39	89	MW2_CDS_05938	MW1104	FALSE	unmapped	ACTTAGTGGTCAATCAGGTGTCGGTAAGTCCACTTTCTTAAATCATTATCGTCCAGAACT
9469	39	87	MW2_CDS_02330	MW0430	FALSE	unmapped	GAGAGACCGTGCGTAAGGCATTAGATTTGTTGGCATTAGACGGCATGATTCAAAAGATTC
9470	39	85	MW2_CDS_10018	MW1881	FALSE	unmapped	GAAGTTAGTTAGTCATAACGTTTATATGTTATCGACCGTTTTGTATCCAAACTGGAGACT
9471	39	83	MW2_CDS_00749	MW0139	FALSE	unmapped	GACAGATTCTGGTGGTATTCAAGAGGAGGCTCCTACATTTGGAAAACCTGTGTTGGTATT
9472	39	81	MW2_CDS_03282	MW0603	FALSE	unmapped	TGATGTAGATGTTTTTGTTATGGGACATGACTGGGAAGGTGAATTCGACTTCTTAAAGGA
9473	39	79	MW2_CDS_05153	MW0953	FALSE	unmapped	CCAATTCATCGCTATCAGCTGCGAGTGGTTATGCTGAAGAAATAGGTTTGCCATATGAAA
9474	39	77	MW2_CDS_02835	MW0522	FALSE	unmapped	TCATTTTATCCTGGATATGCAGTACATCCTGATCACGAAGCAACAGCAGACGCTGTAATT
9475	39	75	MW2_CDS_09438	MW1773	FALSE	unmapped	CGGAAGAGGAACATAAAGACACGGTATTAGTTGTTTCGGCACATAGTTTGCCAAAAGGTT
9476	39	73	MW2_CDS_13717	MW2591	FALSE	unmapped	GGTCGAAACAACGTCTATGGACAAAAGGTGAAACATCTGGTCATACGCAACGTGTTAAAG
9477	39	71	MW2_CDS_02553	MW0472	FALSE	unmapped	CAATGGGGAAACGATTGATTTAGAATCTGCTTGGACTCGTTTGCATATTGTTGATGCTGT
9478	39	69	MW2_CDS_01012	MW0187	FALSE	unmapped	GGTGTGCCATCATATGAAACAATCATTATTGAAGGACACAATGCTGAACCTCATAAGACT
9479	39	67	MW2_CDS_02139	MW0394	FALSE	unmapped	TGACTTCTAAGAGTAACGGTCAAAATACTGCTTCTGTGACTTCAGAATACTATAGCATCA
9480	39	65	MW2_CDS_09063	MW1700	FALSE	unmapped	TAAAGTTGTAGAATATTTAGAGGCAAATGGCATTGATGCCGTAAATGTCGAAGGCGGCAT
9481	39	63	MW2_CDS_09952	MW1867	FALSE	unmapped	ACAGAACTTCGTATAAAACGGGGGAATCAATTTAGAGTTAAATATGATGGTGACAATGAT
9482	39	61	MW2_CDS_11424	MW2164	FALSE	unmapped	TGGAAGCAAAAGCGGTTGCTAGAACAATAAGAATCGCACCTCGTAAAGTAAGACTAGTTC
9483	39	59	(-)3xSLv1		neg		
9484	39	57	NA		ignore		
9485	39	55	NC_A_063		FALSE	unmapped	TTAGTACTCAAGACCATAAAAAATAACCTTCTATTCGCTTTGACCGGCATTTTGAAGGCT
9486	39	53	MW2_CDS_04304	MW0792	FALSE	unmapped	ACCAAAAGGTGCAACAGTCTATGTGTCTAATAATCCAGCTGAACAAGGACGTTTCTTAAA
9487	39	51	MW2_CDS_12200	MW2309	FALSE	unmapped	GTATTGACTACATATATATTTTATTATGATTGTGAAAAAGTGAACATAAGGATTTTCCCT
9488	39	49	MW2_CDS_07949	MW1497	FALSE	unmapped	TGGATTACCAATTATTACAAGTAAGGTAACTCCTGAAAAGTTAAACGAAGGTAGCACAGA
9489	39	47	perR_tiling_117_F		FALSE	unmapped	CGTGTCCTTCTTTCATAACAACAGGTGCACCGCCTCCTACAGCTTTATAAGAACGAGAAG
9490	39	45	MW2_CDS_03107	MW0571	FALSE	unmapped	AAACAAGCGAAAGAGCAAGGTATTGAAGTGACTGCTGCGAATGATTTTACAACAATTACT
9491	39	43	MW2_CDS_04165	MW0762	FALSE	unmapped	AAGTCATTCAGAAAAAATACGTGAATATTTTACCTAGTAAAGAAGGGTACATGTTACCAA
9492	39	41	MW2_CDS_08717	MW1639	FALSE	unmapped	TCCTAGAGCGAAATATTTAAGAGAAATGAGCCGTCAAATTACGAAAGACGCTGGTCGTGA
9493	39	39	MW2_CDS_01687	MW0308	FALSE	unmapped	AATTTAGCAACCGTACTGGGCGATAACCAAACAGTCCAGCAACTATTAACTGCAACAAAT
9494	39	37	NC_S_030		FALSE	unmapped	CGCAATACAAAATAGGTGACATATAGCCGCACCAATAAAAATCCCCTCACTACCGCAAAT
9495	39	35	MW2_CDS_13117	MW2483	FALSE	unmapped	TGGACGAAGTGAGACAGGCTAACTATACATTACATGAACGTGTTTTTGTGGATAAGCGGA
9496	39	33	MW2_CDS_11516	MW2183	FALSE	unmapped	AGTTGAAAACAGTTTAGAGGATAAACGACAAAAGTTTTTAACTTTAACACCTAAAGGGCA
9497	39	31	MW2_CDS_06826	MW1274	FALSE	unmapped	AGGTCCATCTGGTTGTGGCAAATCAACATATATTAAAACTTTGAATCGAATGGTTGAGTT
9498	39	29	MW2_CDS_04810	MW0887	FALSE	unmapped	ACGATATCGCTGGTTTAAGAATGATGTGCCAATTTGTTGAAGATATTGATGTTGTCGTCA
9499	39	27	MW2_CDS_05491	MW1017	FALSE	unmapped	TGGTTACAAAATTGTTCAAACATATATTGAAGACAAGCAAGAACGCGCAAATTATGAGAA
9500	39	25	MW2_CDS_04242	MW0779	FALSE	unmapped	ACTCGCAATTTTAGGAGAAATGGTTGGATCAATTGATAAAACCGGAAAATTATTAACAAT
9501	39	23	NA		ignore		
9502	39	21	MW2_CDS_10029	MW1884	FALSE	unmapped	GATGAACTAAATGTTAATGAATTAGCTACTGGAAGTTTAAACACTTATTATAAGCGAACT
9503	39	19	MW2_CDS_13501	MW2554	FALSE	unmapped	AGTATGGCACAGGTGCTTGCAACTATTGTAGGTGGTTGGGGATCTACACTTGTAAATATT
9504	39	17	MW2_CDS_12281	MW2324	FALSE	unmapped	GTGTGAAAAGTATTTCGGGCTATCCTTTTGTCTGGTGGTTTGCGACAAATCCTGAGTATG
9505	39	15	MW2_CDS_04870	MW0897	FALSE	unmapped	AGTGCACCCAACACGCTTTGCCTTCATGATGTCTTTAGTCGTTTTAATTGCATGGATATT
9506	39	13	NA		ignore		
9507	39	11	MW2_CDS_09502	MW1785	FALSE	unmapped	AGGTAGACATTTTAATGAGCAAGGTGAAAAAGGTTGCTTATTAATCGAGGGTGACCACTT
9508	39	9	MW2_CDS_08876	MW1666	FALSE	unmapped	CTATCGATGTGTTTGAACATGAACCTGCAACTGACTCGCCTCTTGTTGCACATGATAAAA
9509	39	7	MW2_CDS_13513	MW2556	FALSE	unmapped	AAAGATGCGAATATTCCAATCTGGTTAGATCGAGATTGCCCATTCAATATTGAAGGCGGC
9510	39	5	MW2_CDS_02971	MW0547	FALSE	unmapped	GGTGTGCAAAAGATGGTGCGTCAGAATCGTACAATTATTCAACGTATGGATAAAGAAGCT
9511	39	3	MW2_CDS_06574	MW1227	FALSE	unmapped	CAGCCTTTGCAATATTCTTGTTAAGTGCGAACATTAGTGCTCACTCGGAACAAGTGTACG
9512	39	1	MW2_CDS_10640	MW2008	FALSE	unmapped	ACTAAATCTCGTTTAGACATTATTAATACTTTGCCAGCATCTAATAAAGTAAGTCACGAA
9513	38	164	agr_tiling 162_F		FALSE	unmapped	TGAATATCTAAAAAGTAACAGCCTATGTCATTCATATTTTTAGCTTGCTCAAGCACCTCA
9514	38	162	MW2_CDS_03519	MW0645	FALSE	unmapped	AGTGGGTATGGTTCCAGCAGGTATTTTAGGCTTACTATTTGATGATTTCATCGAAGAACA
9515	38	160	MW2_CDS_00092	MW0017	FALSE	unmapped	AATACGGTACAACAACAGGACGTCCACGTCGTGTAGGTTGGTTTGATTCAGTTGTATTAC
9516	38	158	MW2_CDS_09932	MW1862	FALSE	unmapped	AAACAGGTAAAATTACGCTATGTGATAACACTCGTGTAGCATCTGAAGGTGTATGTGTCA
9517	38	156	MW2_CDS_02311	MW0427	FALSE	unmapped	ACCTGAAAGATTTTGGCCTGCTGACCTTGTATTATTATCAATCGGCTTCGAAGGTACAGA
9518	38	154	agr_tiling 112_F		FALSE	unmapped	ACAAAGAGAATGTTATTACTATAACAATAGTTATAACAGTAAGGAATTTTTTATTAAGAG
9519	38	152	MW2_CDS_12691	MW2400	FALSE	unmapped	ACATGTTTTTGTAATTATTGGTGTCATTTTATGTATATGTATAGTTGTTACGGCCATACA
9520	38	150	MW2_CDS_08170	MW1537	FALSE	unmapped	TGAAAAAGCTGAAGCACGCAACATTTCACAAAAGAGTGCAATGCGTACAGCAGTTAAAAA
9521	38	148	MW2_CDS_04801	MW0885	FALSE	unmapped	TGCATCAATCTATAATAAATTGCAAGAGAAATATTTTAAAGACAGTGTGCTTTTTAAGCA
9522	38	146	MW2_CDS_04171	MW0763	FALSE	unmapped	TTCATCATCAAAATAAAGGTATTGGGAAGCGATTGATTCAAGCATTAGAACGAGAAGCAA
9523	38	144	MW2_CDS_02167	MW0399	FALSE	unmapped	AGAACAACTTATGATGAATTGGGTAAGATGACACGCGAAAAAAATTATCGTGTTGAACTT
9524	38	142	MW2_CDS_05678	MW1056	FALSE	unmapped	TTAATAATGATGGCGCAAAATTAGGCACAAGCATTGTGAGCATCGTTGAAAATGGCGTAG
9525	38	140	psma_tiling_059_R		FALSE	unmapped	GTAATTGATTTTTTTCCTAACTTGAATTGTTATGATCATAACTGCGAATTTTTTATTTTA
9526	38	138	MW2_CDS_09183	MW1723	FALSE	unmapped	ATCGGTGGTGCTTTAGGCGCTTTATTACGTTACCTCATTTCTTTTCTGAATACTGACGGA
9527	38	136	MW2_CDS_01604	MW0293	FALSE	unmapped	GAAGCACACATGTGCCAGTATTGTTTGAAGCAGCTGAAGAAGGTGATGATATTGCAAAAC
9528	38	134	MW2_CDS_07330	MW1369	FALSE	unmapped	AGGTGGCATGGCCAAAGTATTGTTACCATTAATTGCAGCTGTACTAATTATCGGTGCATT
9529	38	132	(+)E1A_r60_a107		pos		
9530	38	130	MW2_CDS_09399	MW1765	FALSE	unmapped	ATGGAAAAAGTTCTTGATTTAGACGTGCAAGTTAAAGCAAACAATAACTCAAATGATTCA
9531	38	128	MW2_CDS_09461	MW1777	FALSE	unmapped	ACGAAGGTGAAGTCGTTGCATTTGGAGATTTAGAAGCATTGAGACAACAAACTGGCTTAC
9532	38	126	MW2_CDS_00561	MW0105	FALSE	unmapped	ATTAAGCGACCTTGATGCCTTACCGTCATTAGATCGAATGGCGTCTATTTTTGAAGAGGG
9533	38	124	MW2_CDS_12642	MW2391	FALSE	unmapped	AGCTGGTTGGAAGAAAGGTAAAGACAGCGATGTTCGTCAAAAAGATGGTAAAAACCTTGA
9534	38	122	MW2_CDS_04964	MW0917	FALSE	unmapped	ATTGTTGTTATCTTTAGTCATTGTTTTTTGCTATATTAAAACGAAAAATCAATTACATTT
9535	38	120	MW2_CDS_02769	MW0511	FALSE	unmapped	CATTATAACCATTGCAGGTACAGTTGGTGTTGGAAAATCAACACTAACGCAAGCACTTGC
9536	38	118	MW2_CDS_07146	MW1335	FALSE	unmapped	ACGATGGCTCGTGGCTATAGAAGAGAAGAAGTAGATGCATTTTTAGATGACATTATTGCT
9537	38	116	MW2_CDS_05317	MW0984	FALSE	unmapped	ACTGGTCTTGGTTTAGGATTTTGGACAGTTCTAATATCTCATATTGCATTTTGCATACCT
9538	38	114	MW2_CDS_03376	MW0620	FALSE	unmapped	ACAAGCACCAATGCAAAAAATGATGATTCATGGCTTTGAAGTTGACTGCCGGATTAAAGA
9539	38	112	MW2_CDS_05791	MW1077	FALSE	unmapped	AAGACCCGGAAGGAAACGGTTTTAAATTTTATGTTGATAAAGACGAAGCGCAATGGACGA
9540	38	110	MW2_CDS_01493	MW0274	FALSE	unmapped	AATACGGAGTTTGATCAATTAGGCCGTGAAAATTATTATATGTACAAAAAATTTGGGGTT
9541	38	108	MW2_CDS_12489	MW2364	FALSE	unmapped	AGCCAAGTATGGCCGATACTTATTTTCTTGCCGTTCGTGGTGATTTTCTTCTTGAAAATT
9542	38	106	MW2_CDS_13504	MW2554	FALSE	unmapped	GCAACACATTACCAAGTATTATTGTCGCCTCGTTACTACTCTGGGGTGTCCATTTCTTGA
9543	38	104	MW2_CDS_12952	MW2451	FALSE	unmapped	ACAGAAGAGCAAATGATTGATTTCTTATTCACTTCAGCATTGTTTGGGCGTGTCGTAGCA
9544	38	102	MW2_CDS_11965	MW2268	FALSE	unmapped	TCATTTTGAAGACCGCCATGTAGATGATCGCTTTAATAAAATGGTCATGGATAGTGTCTT
9545	38	100	MW2_CDS_07827	MW1475	FALSE	unmapped	GAATGACTTAATAAAAGAAGAAGCTGAGGATGTAAAAAATGACGAATCTACCGATGAATA
9546	38	98	MW2_CDS_03094	MW0568	FALSE	unmapped	ACTGCAGACTATGCTGTGAAAGTACCTGAAAAATTAGATCCAGCAGCAGCGTCTTCTATT
9547	38	96	MW2_CDS_09425	MW1771	FALSE	unmapped	GATGGCTTCGAAACATTTACAGCGTTGCAAGATCGGATGCAAGATTACATGACACGATAG
9548	38	94	MW2_CDS_12501	MW2366	FALSE	unmapped	TGCCCAAAGTATTGCCTTTATGTATGAACCTGGCGAAGGATTAGCAAATGAGGAAACTTC
9549	38	92	MW2_CDS_01677	MW0306	FALSE	unmapped	TGCAACAACATTCTCAGATACAGACTTTTTAACTGTCGGTATCGTGTTCGGTAACGCAGT
9550	38	90	MW2_CDS_08034	MW1513	FALSE	unmapped	AGTCATTTAGGAGACTTTATTGAGGATCAGGAAGCACAAAGTCCTTCAGATCATGCTGCT
9551	38	88	MW2_CDS_09479	MW1781	FALSE	unmapped	TTTTTCTTACCATATAGAAAATCGTTTAAAGTTCATAAGTTGACTAAAAGAAAATGGCTT
9552	38	86	(+)E1A_r60_a107		pos		
9553	38	84	MW2_CDS_01889	MW0345	FALSE	unmapped	AGTTGTCACTTTAAAGGAATTGGATCATATCATAAGATTTGCTCATATTTCTTATGGCTT
9554	38	82	MW2_CDS_01592	MW0291	FALSE	unmapped	TACACAGCGAGTCAAGACGTCGTGCAGCGTTATCAAGCTTCTGATAGTTTAAAAGAAACA
9555	38	80	MW2_CDS_11683	MW2214	FALSE	unmapped	AGTTATAATGAAATAGAGAAGATAGATTATGATGGTCAAACTATAATGTTCAAATTTAAT
9556	38	78	perR_tiling_112_R		FALSE	unmapped	AAAATATTAAATTAAAAGAGGTTGATATAAATGAATTTTAGTGAAAGTGAACGTTTACAA
9557	38	76	NC_S_042		FALSE	unmapped	AGTATAAATTGCCATGAGAGTAGAAGCTTCAGTTTATGAAGACTTCGAAATCATGGTTTT
9558	38	74	MW2_CDS_00168	MW0031	FALSE	unmapped	ACCGAAGATAAAAAAGAACCTCTGCTCAACAAGTTCCAGATTACAACTTCACCAGGTTCA
9559	38	72	MW2_CDS_08540	MW1608	FALSE	unmapped	ACAACATGCTGGGCTATCTTGGTTAACTATTTTAAAAAAGAAAGAAGCCTATGAAGAAGC
9560	38	70	MW2_CDS_04176	MW0764	FALSE	unmapped	GACTCAGACAATGACTCGGATTCAGATAGCGATTCTGACTCAGACAGTGACTCAGATTCC
9561	38	68	MW2_CDS_09608	MW1804	FALSE	unmapped	ACCCTAGTGATTTATGATGAAGTAATTACTGCATTCCGTTTCCATTACGGTGCCGCTCAA
9562	38	66	MW2_CDS_07098	MW1326	FALSE	unmapped	ACGCTACATTCTTATTAACGTTGCCAATAGAACTACTTGCTGGTAATTTAAATGCGGCTT
9563	38	64	MW2_CDS_12875	MW2437	FALSE	unmapped	TTGGATTAATGTATGCATTTGCGTCACGTTTCAGCGTTCCATTTAGCAGACGTTACTTCA
9564	38	62	pMW2_089		FALSE	unmapped	TGCGATGTGTAATAAATTAAAAGAGCAAGATACTAATACATTACGTTTGTCTTTTGATGA
9565	38	60	MW2_CDS_03273	MW0601	FALSE	unmapped	AGTGAGAGGCCTGAATCAATTTTACAAAGCAATACCGGATAGCTACAAAGTGTATACTGA
9566	38	58	MW2_CDS_11130	MW2103	FALSE	unmapped	ACCAGTTAGAGAAAAAATTGGGGATTATACTTCTGTAGGTACACGTAAACAGCCAAACTT
9567	38	56	MW2_CDS_00467	MW0088	FALSE	unmapped	AGTTAAAAACAACCAAGTATCTGATGATTTAGATGAAATCACTTGGAACTTAGCTGGCGG
9568	38	54	MW2_CDS_06325	MW1174	FALSE	unmapped	ACGACAGTACAAGGAAATATGAATGAATGTTTAATTTTAATACAATCATTAAATGAACGA
9569	38	52	perR_tiling_118_F		FALSE	unmapped	GACATCATATAAATATGCACCGTGTCCTTCTTTCATAACAACAGGTGCACCGCCTCCTAC
9570	38	50	MW2_CDS_02038	MW0377	FALSE	unmapped	CCAATACACATTTGGGAATGAACCTGATGATATAGAGGTATTGGATTTTATTCATCATCA
9571	38	48	MW2_CDS_13388	MW2534	FALSE	unmapped	TAATCGTGTAATGTTGGATAAGGATTTAGAAGTTATTCCCGCGCCTGGACATACACCAGG
9572	38	46	MW2_CDS_02282	MW0422	FALSE	unmapped	GTGGAAAAGGGGTCGCACCATTTAGCGATAACCAAGATGCAGTATTTTTCAGGTCATTTA
9573	38	44	MW2_CDS_13277	MW2513	FALSE	unmapped	AGACAAAGTTGACTTAATAAGGCATTTTAATACGATTGTCAATCAAGGGCCAGCAACGAT
9574	38	42	MW2_CDS_11350	MW2148	FALSE	unmapped	TGAACCGTCTTACAGGTCGTCGAATCTGTGAGTCATGTGGTACAACGTATCATCTTGTAT
9575	38	40	MW2_CDS_02280	MW0421	FALSE	unmapped	TGTCTGTTTAGTTGAAGAAACAGCTGATAAAATATTACTTGTTCAAGTAAGGAATCGCGA
9576	38	38	MW2_CDS_10820	MW2043	FALSE	unmapped	AACCGGCGATTGATGATCGATATCATAAAGAAAAAGTGGTCTCTCATAATGGTAATGCCA
9577	38	36	NA		ignore		
9578	38	34	MW2_CDS_11797	MW2236	FALSE	unmapped	GAAAATGAGATGCATATGGGAGCAACAACTTCATTATTTGCTCAAATGTTCACTATTGAT
9579	38	32	NA		ignore		
9580	38	30	MW2_CDS_08143	MW1532	FALSE	unmapped	CAGATTCATTAATTAGAAGAACAATGGAACCTACACGCCAAGCAATGAAAGACGCTGGCT
9581	38	28	MW2_CDS_11040	MW2088	FALSE	unmapped	AGATGCTGAAAGATTTGCACAACAAATAGCTGATGTGGTTCAAGATAAAATGGGATTAGA
9582	38	26	MW2_CDS_10658	MW2012	FALSE	unmapped	TGCAACAATCAGACGTCATTAGTGCTGCCAAAAAATATATGGAATCTATTCATCAAAATG
9583	38	24	MW2_CDS_11901	MW2255	FALSE	unmapped	AGCGACTAAAGGACGTACAATTTATATTGCAACGACATTCCATGCTTCAATGACATTCGG
9584	38	22	MW2_CDS_10603	MW2001	FALSE	unmapped	TGTTGTTCTTATTTGGTCGCATGTTAAGTAGACATGGTAAACGAGTACATCGTCATGCGT
9585	38	20	MW2_CDS_08996	MW1688	FALSE	unmapped	TTGTACCTCACACGCCATTCACACAGTTATCTGAACATCGATATAGTGCTAAAGCATGGG
9586	38	18	MW2_CDS_04822	MW0889	FALSE	unmapped	AACCCACATATTGTTACGCGTCTAGATCGTAATACAACTGGTATTGTGATATTCGCTAAA
9587	38	16	MW2_CDS_13699	MW2588	FALSE	unmapped	AAAGTCGCAGAAAACTATAGCCTATCCTTATGGCTTGATGAATGACGATAAATTACCGGT
9588	38	14	MW2_CDS_12258	MW2320	FALSE	unmapped	GCCGTATGCAAAACATATTCAGCAAGAAAAAATAAATGACTGTATCGTGGAAGCAGCGCG
9589	38	12	MW2_CDS_06389	MW1186	FALSE	unmapped	AACGAATAGAGGTAAAGTTCCAATCATAGCAGGTGGAACAGGCTTATATATTCAATCATT
9590	38	10	MW2_CDS_11981	MW2271	FALSE	unmapped	TTGGTGTCAATGAGATTATGAAAAAATGGGCGAATGGCCTACCATTAACAGATAAGCGCA
9591	38	8	MW2_CDS_11433	MW2166	FALSE	unmapped	CACCTGAAAAGTCATTATTAAAACCGCTACCGAAAAAAGCGGGACGTAACAACCAAGGTA
9592	38	6	MW2_CDS_04219	MW0773	FALSE	unmapped	TCGTTGTCGTATCCCCAATAAACTCACCAAAAACAATTGCAGATAATAAGTATTCAGAAA
9593	38	4	MW2_CDS_04319	MW0795	FALSE	unmapped	AGACATGGCACAACGTTATTTAAATGAAGGTTTCTCAGGTGGAGAGAAGAAACGTAACGA
9594	38	2	MW2_CDS_07326	MW1368	FALSE	unmapped	GAAACAAATATCGAAAATTGCTACATTGCAGGTGTGATTGCTGCAGGGAATGATGCGAAT
9595	38	163	MW2_CDS_13851	MW2615	FALSE	unmapped	AGCCCATTCAGCTATTAGCGATTGTCGTAGCAGGCTATGTCATTACATTAAATTGGGGTA
9596	38	161	MW2_CDS_02486	MW0459	FALSE	unmapped	GCCATTCGATGTTGCCATAACTGAAAAAGGAGTCTATGACCGTGGTGCATCATTTATTCA
9597	38	159	MW2_CDS_01790	MW0327	FALSE	unmapped	TTTCAAGAGGGATGCGAATGAAGATAGCTTTAACGATTGCGCTTTCTCATGATGTGAAGC
9598	38	157	MW2_CDS_06359	MW1180	FALSE	unmapped	ACAACATATTGCCTGCCATAAGAAACATTAAAGATTTAGAGAAACTGATTAAAACAGATT
9599	38	155	MW2_CDS_07086	MW1324	FALSE	unmapped	TTGCCAAACATAAATCATGCACAACAACAAGCATTAACTGATGCTATAAATGCAGCGCCT
9600	38	153	MW2_CDS_10900	MW2057	FALSE	unmapped	GGAAAAAGTGCTCATGCCTCTGAAAATGCAGATGAAGCGTTAAATGCATTAGACGCTATG
9601	38	151	MW2_CDS_04316	MW0795	FALSE	unmapped	ACAAATGCTGATTTCATGCGTTCAGCAATCAATGCGAAACGTGAAGAAGGACAAGAAATC
9602	38	149	MW2_CDS_02337	MW0432	FALSE	unmapped	AGAGCGTGCCAAAGCACAAGAGTATAGTACGGTTGTTGTAGACCATTGTTTTGACTACTT
9603	38	147	MW2_CDS_08688	MW1635	FALSE	unmapped	TAGCTGTACATGTAAGCTGGTTACGTTGGCTTTCATATGGTCTCATTAGTATGGGCATCA
9604	38	145	agr_tiling 163_R		FALSE	unmapped	AAAATATGAATGACATAGGCTGTTACTTTTTAGATATTCAACTTTCAACTGATATTAATG
9605	38	143	MW2_CDS_00525	MW0098	FALSE	unmapped	GGCTGATTGGTGGTATTTTGCTGATTTGGAATAAATACTCAAAAGATGAATCGACAGACG
9606	38	141	(+)E1A_r60_a135		pos		
9607	38	139	MW2_CDS_07063	MW1319	FALSE	unmapped	CTCGTATTGAAAACGGAGATGAGGCACTTGGTTCAGTATGGAAACAAATGGCAAACAGAA
9608	38	137	MW2_CDS_08488	MW1598	FALSE	unmapped	AATGATGGTAGTGTATCGTGGCTTTGGCGTATCATTATTGCTCAGCATATTTTTAGGCGT
9609	38	135	MW2_CDS_04471	MW0825	FALSE	unmapped	AGTGGCTTTGCAAAGGCGAATCACCCAATTGAGTTTAATATGATTTGGAAAGCAATGCTT
9610	38	133	MW2_CDS_10933	MW2064	FALSE	unmapped	AATGTGGAAAACAACATGGCACCAACCAAATGATTATGAAAAATCGTTCTTTTTAGATGA
9611	38	131	MW2_CDS_11054	MW2090	FALSE	unmapped	TACCTAACACACCTTTACATGATGGTGCAATGATTATTCAAGGCACGAAGATTGCAGCAG
9612	38	129	MW2_CDS_01711	MW0312	FALSE	unmapped	AGGGAATTATTGGTAGAAAAAGGTATCTTAACTACATTTGAACATAAAGGTAAGATGGCT
9613	38	127	MW2_CDS_07349	MW1373	FALSE	unmapped	TTTAGTGATGTACCGTCACTACTAGCTACATTTACGTTTGGACCAGTTGCCGGTATCGTA
9614	38	125	MW2_CDS_10209	MW1924	FALSE	unmapped	ACAATCAGAATTGAAGCGCATTGAAGACAATAACAGCGCAAGTAATGAGAACAAAATCCA
9615	38	123	MW2_CDS_03617	MW0663	FALSE	unmapped	ATGCGTGCAAAAGGTATGCCTGAAGGAGAATATGATTTGGGTGGACAAAAAGTAACTGTT
9616	38	121	MW2_CDS_10215	MW1926	FALSE	unmapped	ACGGATTCGATTTTAAATTAGCAGTTAAGAAACAAGATTACAGCATTCTAGTGAATGTCT
9617	38	119	MW2_CDS_00595	MW0111	FALSE	unmapped	GCGATTGCTGCGGCTCTAATCGATTTTAAAGCATTAAATTTCCCAGGCAATGATGCATTA
9618	38	117	ETG10_13482		pos		
9619	38	115	DCP_22_9		pos		
9620	38	113	MW2_CDS_08113	MW1527	FALSE	unmapped	ACAGTAGTACGTAAAAATGAATCACTTGAAGATGCGTTACGTAGATTTAAACGTTCAGTT
9621	38	111	MW2_CDS_00910	MW0167	FALSE	unmapped	TCAAGAGCTAAAGATTGCGATATCTCGATACTTACCCGAAGATATTGCAACCAATCCACA
9622	38	109	MW2_CDS_07519	MW1408	FALSE	unmapped	GAATAGAACAACTACCAAAAAAGCATTGACTGCTGGAATTGCTCGAGTAATGGAGCCTGG
9623	38	107	MW2_CDS_12617	MW2387	FALSE	unmapped	CGACGATTGCGATTATCGGAGAAAGTGGTAGCGGTAAATCGACATTGAGTCGTATGATAT
9624	38	105	MW2_CDS_01149	MW0211	FALSE	unmapped	TGGTATGAATTACAATGCAGATGTGCGCATGCCTCATGATCGAGCATGGGATTTTATTTA
9625	38	103	MW2_CDS_04400	MW0810	FALSE	unmapped	AGATATTAAGATTATCATGCCAATGTTTGATGACGCATTACCTTATTACAAACAATTTAT
9626	38	101	MW2_CDS_02446	MW0452	FALSE	unmapped	CATTGAATGTTGATGGGGAAATCGTAAGCGCTGATGTTCAAGCACAGACAAAACAAGTTT
9627	38	99	MW2_CDS_03909	MW0714	FALSE	unmapped	TGAGGAAAAAATTGGTAAGTTGGAACGTTATTTTAATGACGTACCAAATGCAGTGGCGCA
9628	38	97	NC_A_093		FALSE	unmapped	ACAGGTATTTTATTCTTAGCTTGTGTTTTTTATACATTTCCAACAAATTTAATCGCTGAT
9629	38	95	MW2_CDS_04220	MW0773	FALSE	unmapped	TCACCCTATGCAATTAAAGATAATTTTATAGATCCATACAAACTAAGGCTTGTTAAAGCT
9630	38	93	MW2_CDS_07880	MW1485	FALSE	unmapped	TGAATCGCATCCGAATATGCCTTCTACAGTTACAGAAGCGTACAGAGTGATTTCACAAGG
9631	38	91	MW2_CDS_08331	MW1567	FALSE	unmapped	AGGTGACCCTGCGTATATTCCACGCCAAAATGAAGCAAGAAATCAAATTCGTCATATTGA
9632	38	89	MW2_CDS_03106	MW0571	FALSE	unmapped	AGCGATTGAATTGTTGAAAAAAGTAGCTGACTTTGAGCCTACAATTGAAAGTGCTGCAGA
9633	38	87	(-)3xSLv1		neg		
9634	38	85	MW2_CDS_00805	MW0149	FALSE	unmapped	TGGTGCGATTTCGAAACATGAATCATCAGATGAATTTGTCATGTTCATTCTACGTGCCAA
9635	38	83	MW2_CDS_10794	MW2039	FALSE	unmapped	TCACATTGCATGAATATGTAAAAGAAGCAGGAGAAGTTATAGATCCATACGGTGGAACAA
9636	38	81	MW2_CDS_08414	MW1583	FALSE	unmapped	AGTTGTACAAAGAGTTAAAGAAGCATCGGTGACGAATGATACATTAAATAATCAAATCAA
9637	38	79	MW2_CDS_13010	MW2462	FALSE	unmapped	TCGCAGTCATTATCATAGGAACATGTATCGTTGCATTATCTTCAGGTTATATTGCTGAAA
9638	38	77	MW2_CDS_12517	MW2368	FALSE	unmapped	TGGTTCTTGGGGTGGTAGTGGTATTTGTACGTTGTTTGGTGGCTTAATGGCTACATATAT
9639	38	75	(+)E1A_r60_a97		pos		
9640	38	73	MW2_CDS_04794	MW0884	FALSE	unmapped	ACCCTTGTAGAAAAAGATGAACGACTTAATCACCTGTTTCCAGGAGATTTTGCAGAAACA
9641	38	71	MW2_CDS_03290	MW0604	FALSE	unmapped	CACATTTCGTCAATCCAACGGGTGCTGAAAATTCAAGATTACGTTCATTTGCACCAACAA
9642	38	69	MW2_CDS_12679	MW2398	FALSE	unmapped	TGAAGAACAAATTATTGATCTTGTCTTTGTTGTAAACCAAATTAACGGTTGGAACAGGCT
9643	38	67	psma_tiling_019_R		FALSE	unmapped	GAGTGTTTCAGTCTAAACGTGCAACGCAATTCTGCACGTGGCCAATATATCTTGGGATAG
9644	38	65	MW2_CDS_10456	MW1974	FALSE	unmapped	TGTGATGTGATGAGTTTAGAAGTAAGAGTTAATAATAAAGTGGCACAACATGTATATGAA
9645	38	63	NC_A_013		FALSE	unmapped	ACCAGCTATGCTAAAAGTCTAGTAGGGAGAACAGTTGTCCAATCACATAAGAACCTCTAA
9646	38	61	MW2_CDS_08193	MW1541	FALSE	unmapped	AATAATACTAAAGTAAATTTAAATACCGCATCTGTATCAGAATTGATGTCTGTTCCTGGA
9647	38	59	MW2_CDS_09235	MW1733	FALSE	unmapped	ACCACGGTGCTTTCAAAGGCCTTTATTTAGGTATCCGTCGTATTTTAAAATGTCATCCGC
9648	38	57	MW2_CDS_03636	MW0666	FALSE	unmapped	TTGGAAAAGAAGCAGCTATGATTGCAGGTTACCAGCATAGTACTGAATTTGATGCAGTCA
9649	38	55	NA		ignore		
9650	38	53	MW2_CDS_13411	MW2537	FALSE	unmapped	GCCAATGGGTTGTCGTTCATTTTTACCAAGTTGGAAAGATGCGGAAGGTCATTTTGAAAA
9651	38	51	MW2_CDS_01426	MW0262	FALSE	unmapped	GCATAATGAGCGCATTGAAAAAGGATACCAAGCATTTGTAAAGGATGATTATACGCAAGT
9652	38	49	MW2_CDS_11581	MW2195	FALSE	unmapped	TGCAGTTCGTGGTCCATCTGGCATTGGTAAAACTACTGTTTTAAATATGATTGCCGGATT
9653	38	47	MW2_CDS_06746	MW1260	FALSE	unmapped	AATGGTGCAGATATAATTGAAATTGGAGTACCTTTCTCTGATCCGGTTGCTGATGGTCCA
9654	38	45	MW2_CDS_05052	MW0935	FALSE	unmapped	TGCACGTTGCGAATTGATTGAAGCAAGATGTCAATGTTTATCGGAAGTCGAATTAGACAA
9655	38	43	MW2_CDS_02851	MW0525	FALSE	unmapped	CGGTACGCCAATCATTTACAACGAAGGTTTACCAGCAGTTAAACATATGGCAGACAACAT
9656	38	41	MW2_CDS_03520	MW0645	FALSE	unmapped	TTTAGGCTTTTTAGCTGCATTTACTGTTGGACTAATTGCAATCAAAACATTCTTGCATCT
9657	38	39	MW2_CDS_00974	MW0181	FALSE	unmapped	AATGATATTTTATTAAAATTCGATCGCGTGAGCGTGGATTACACATCACCGAGTGGCAGC
9658	38	37	MW2_CDS_01865	MW0340	FALSE	unmapped	CCTGAATGGCTTTATTGTGCAAAGGCTAATCTTGTTTTAGAGCCTGCTTATACTGGCGAA
9659	38	35	MW2_CDS_04462	MW0824	FALSE	unmapped	CTGCGAATGTCGTTGGTATCATTGAAGCGGCTAGTCGTTTACAACTGCCTGTAAATATTG
9660	38	33	(-)3xSLv1		neg		
9661	38	31	MW2_CDS_08005	MW1508	FALSE	unmapped	TCAAAAATTTATGGACATCCTGTACGTTTTGTCGATCATCAGCATAATCGAGAATGTTGT
9662	38	29	MW2_CDS_01405	MW0257	FALSE	unmapped	GCCAAACAACAATCATCAAAACCAGTCACGTACAAACGACAATCATCAACACGCAAATCA
9663	38	27	MW2_CDS_00116	MW0021	FALSE	unmapped	AGGGCGATCAAAAGACTTTAGTTCTAAAGCTAAAGGCGATTCGGATTTGACCACATCAGA
9664	38	25	ETG08_142674		pos		
9665	38	23	MW2_CDS_13044	MW2468	FALSE	unmapped	AGAGTTGGAGAATATCGATATGTCAAAGCTTTATGTACCAAAACATAGCACGAAGCCGTA
9666	38	21	MW2_CDS_11986	MW2271	FALSE	unmapped	AGATGCAACACTATCTAATAAAGATATTTCGGACGCCTTAATCGAACAAGATGCGGTTCT
9667	38	19	MW2_CDS_10193	MW1922	FALSE	unmapped	ATTTTGAAAGTCATCGCTTATGCACGATTAAGGCAAAGCAAGAGCTGCGAATAGGTACAT
9668	38	17	(+)E1A_r60_3		pos		
9669	38	15	MW2_CDS_02283	MW0422	FALSE	unmapped	CTGATAATGAAAGGTATCCCATCGTTGTAATGGATGGCAGGCAATGTGTGGCCTTTTTTA
9670	38	13	MW2_CDS_02934	MW0541	FALSE	unmapped	GACACATGTTGATGTTCACAACGAAATCATTAGAAGCATTGGTTACTGCGTTTGGCATCG
9671	38	11	MW2_CDS_04796	MW0885	FALSE	unmapped	ACACCCGATTTCAAATTAAAGGAACATCGCTCTGCACTACGCATAAGAGTTAAAGACAAT
9672	38	9	MW2_CDS_08476	MW1594	FALSE	unmapped	CGTAGTTTTGTTATGGCAGATTTACCAGGTTTAATTGAAGGTGCATCTGATGGCGTTGGA
9673	38	7	MW2_CDS_02715	MW0502	FALSE	unmapped	ATTCGAAAACGCTATCGTTGGTGGTGTAGTTCCTCGTGAATACATTCCATCAGTAGAAGC
9674	38	5	MW2_CDS_10196	MW1922	FALSE	unmapped	ACGGCAGTGTACACAGCGCATTAGCAAATAGAATTATGGAGTCTCATTTTAGCTTAGAAC
9675	38	3	(-)3xSLv1		neg		
9676	38	1	MW2_CDS_10388	MW1962	FALSE	unmapped	ACACATTAAAGATTGAAGCAATTAATAATGAAATGCGCAAGTTCCGTCATGATTATGTCA
9677	37	164	MW2_CDS_02137	MW0394	FALSE	unmapped	TGGACCACAACTTAATGTAGTTACTTTACTTGGCACAGACAAAGAAAGGTTTAAGGACGA
9678	37	162	MW2_CDS_12757	MW2414	FALSE	unmapped	AGAATTTTAATCAATGCTATTAAGGTGGGAATTGAAATGAAATATAAAATTAGTTTGGCT
9679	37	160	MW2_CDS_05331	MW0987	FALSE	unmapped	GATGATTATGTTGATTTCTAAAAAAGAATCAAAAGAAACTACACATAAGGACGATGAGTA
9680	37	158	MW2_CDS_13496	MW2553	FALSE	unmapped	GCCAGACTCAGTCTTTAAAGAAGATGCAGGACGTGGTTATAGAAAAGTAGTTGCGTCACC
9681	37	156	MW2_CDS_13905	MW2625	FALSE	unmapped	TGTGCATGTAAGTCGTGGCGCAGTGTTTGGTATGACAGGGGTATTAGTTTGTATTTTAGT
9682	37	154	MW2_CDS_06576	MW1228	FALSE	unmapped	TGATCCAGAAGGTAATGATGTAACACCTGAAAAAATTAAAGAGATACAACAAAAAAGAGA
9683	37	152	MW2_CDS_11597	MW2197	FALSE	unmapped	AAGATGTAAAACAAGTATTAAATTATGTTGAAAAGGGTAATGCGAAACAAGGTTTTGTGT
9684	37	150	MW2_CDS_06649	MW1242	FALSE	unmapped	CGTGCTGACAAAAAAGTCGATGGTATCGTTGAAGTACGTGATGAAACTGATAGAACTGGT
9685	37	148	MW2_CDS_00659	MW0124	FALSE	unmapped	AGTGTGGATAACGTATCAATTTTATCTAAAGCAGACGGTACAGCAGTTAAAGTCGCACCA
9686	37	146	MW2_CDS_06893	MW1286	FALSE	unmapped	GCAGAAGGTTATCCCCCTACAATCAATAGTCCGAAATTACGTACTCAAATAGAGGACGCC
9687	37	144	MW2_CDS_13339	MW2524	FALSE	unmapped	TGCGCAACGTCCAATTTTTCAATTTAGTGTGACAGAATTAATCGGTTGGATTATTACACA
9688	37	142	MW2_CDS_10491	MW1981	FALSE	unmapped	TGGTGTAAGCACGACTGAACTTCCATTAGGAAAATTATCTGGTAAACACGCCTTCTCAGA
9689	37	140	MW2_CDS_01816	MW0331	FALSE	unmapped	TGTTGAAGCTGTTGGTCATGAAACATTCGATACCGATGCATCTGTGGACGTTGTAAAAAA
9690	37	138	MW2_CDS_03983	MW0727	FALSE	unmapped	AGGAAACGCGTCGTGCACATCCTTTGATGGAACAAGGTAAAAGATCCTTAATTAATGCAA
9691	37	136	MW2_CDS_07652	MW1444	FALSE	unmapped	ACAGTAGATGATGTGATTGAATTGAGTAATAAATTAAAAGAAAAACCCAATATGCCTCAA
9692	37	134	MW2_CDS_06599	MW1233	FALSE	unmapped	TGATGAAGGATTCGGTACATTAGATCAAGAAACGCTTGAAACAGCGTTAGACACTTTATT
9693	37	132	MW2_CDS_08035	MW1513	FALSE	unmapped	AGCCAAACGTATTGAACAAGGTGATGAAGTAGCAAAATCAAGACTAGCAGAAGCGAACTT
9694	37	130	MW2_CDS_02841	MW0523	FALSE	unmapped	AATGGTGGTTGGGTTTATGTACAAGGTCTAACGCATTTTGAGGTCAATGAACATGATGAA
9695	37	128	MW2_CDS_02833	MW0521	FALSE	unmapped	GTGTACCCTGTACTTGTTGACCAGTATCAAACAGCTGGCACATTTAGTTTTTCAACAAGT
9696	37	126	MW2_CDS_06334	MW1176	FALSE	unmapped	TGCCCATAGTTGAACAGTTTCAAACTTCACAATATGAAGCGAATCAATTATTGAAAATGT
9697	37	124	MW2_CDS_05122	MW0947	FALSE	unmapped	ATAGATTCTTTATTATCAATTGTTCAAATGCCAGGAGGTATTCCGGTTGCAACGACTGCA
9698	37	122	MW2_CDS_04483	MW0828	FALSE	unmapped	AAAACGCCTTATACTAAAAAGACTAAAGTCGATGAAATTTCAGAAGACTTAAAAGACACA
9699	37	120	MW2_CDS_00084	MW0015	FALSE	unmapped	ACAAGATGTTAAAGGTAAAGGTAAAAAAGGTGAAGTTAAAGAAGTACCAGTAGGTTATGC
9700	37	118	(+)E1A_r60_n9		pos		
9701	37	116	MW2_CDS_04436	MW0818	FALSE	unmapped	GGCGACTGCTCATTGATTGACGTGGAAGACGGTATTGTTAAATTACAATTACATGGTGCA
9702	37	114	MW2_CDS_10930	MW2063	FALSE	unmapped	TGCTTAGAGCAATCAATTGTTAAAGAAGCTGCGAAAGGTTACTCTGCAGAACAAATGGTT
9703	37	112	MW2_CDS_09863	MW1851	FALSE	unmapped	ATGAACACAGAAGCTTTGGGAACTTCTCCTAGAATGACTTTCATTAAGCAAAAGTCATAA
9704	37	110	MW2_CDS_02419	MW0447	FALSE	unmapped	AGCAGTTATTGAAAAAGTTAAATGCATTTGGTTATACCGAAGCGGATGTAAGGCAAGCTT
9705	37	108	MW2_CDS_05475	MW1014	FALSE	unmapped	TGAAAAAGAAAAAGCGTTACCAGCTTTTAATAGAGATGATGATAGCAAGAATAGTAGTCA
9706	37	106	MW2_CDS_10333	MW1951	FALSE	unmapped	AACCATTGTAATGAAAAAACTATCAATGTGGATACAAACCATTATGTCACGTACCAGCAT
9707	37	104	MW2_CDS_11808	MW2238	FALSE	unmapped	AACAAATACTGCTACGTGCTACAAAAATATCGGTACTCTTTGCTGTAGCATTTTTCATCA
9708	37	102	agr_tiling 156_R		FALSE	unmapped	GAAAATTTTCATTTGCGAAGACGATCCAAAACAAAGAGAAAACATGGTTACCATTATTAA
9709	37	100	MW2_CDS_09403	MW1767	FALSE	unmapped	ACCCAACATATGGTAATGAACTGTTTTTAGGTGGTAGACAAAGTAGTTCAAATGCTGGTC
9710	37	98	MW2_CDS_03615	MW0662	FALSE	unmapped	CCAAAAAGCTCAGAGTACAATGCGTTTGCAGAGCAGCTATGGAACATTGGTAGTAAAAGT
9711	37	96	MW2_CDS_12098	MW2290	FALSE	unmapped	TGGCTGGGATAATCAAAGAAATTTCAAAACAAAATGCTAGTGAATTAGTTGAATTAGCAA
9712	37	94	MW2_CDS_06724	MW1256	FALSE	unmapped	ATATCTTGAATGGTAAAGATCAGTCAAGTCGACGTGATGTTGTCTTACTAAATGCGGGTT
9713	37	92	MW2_CDS_03953	MW0722	FALSE	unmapped	CCTGTAAGACCTGGTAGAAATGTTGCGGTAATTATTGAGGTCGCTGCAATGAACTATCGA
9714	37	90	MW2_CDS_10539	MW1989	FALSE	unmapped	TGACTAAGTATATAAAAAAAGAGCAGGTGCGAAATAATGGCGAAAGAGTCGAAATCAGCT
9715	37	88	MW2_CDS_05723	MW1065	FALSE	unmapped	AAAAGAATAACCAAGGTTTAACAAGTAAACAGAAGTTTTTGGCGCAAATTGGTATTGCGA
9716	37	86	MW2_CDS_05206	MW0963	FALSE	unmapped	AAAGACAGCGAATATAGTGGTGGTTTTGTTGAAGGAGATGCACCTGAGTTTCCAATTGTT
9717	37	84	MW2_CDS_09219	MW1729	FALSE	unmapped	ACTAATCGGTGATGATGAACACGGCTGGAATAAAAACGGGGTCTTTAATATCGAAGGTGG
9718	37	82	MW2_CDS_01798	MW0328	FALSE	unmapped	ACTTTGCAGTATTTAATCCGTTGATGAGTTCGGCAATGGCTGGGGTTATGTTAATCACAC
9719	37	80	MW2_CDS_11027	MW2085	FALSE	unmapped	ACTGGCCCTCTTGGTAACAATATTCATTTTGCTAACTCAGCAGTTGATAGAATTGTACCA
9720	37	78	MW2_CDS_13317	MW2520	FALSE	unmapped	ATTTAAACATATGCATGTACGAATGATGCCTGCTCAGCAACCGCCATATACACGTTTGAT
9721	37	76	MW2_CDS_06331	MW1175	FALSE	unmapped	AGAGGGTGGTAATATCGTTCCTCATATCCACTTGCCAGTTCAATCTGGAAATAATGCAGT
9722	37	74	MW2_CDS_12920	MW2445	FALSE	unmapped	GTTAGATAAATGGGGAATGTCTTCTTCAGAGCTCATGGCCTTCGGAGATGCGAATAATGA
9723	37	72	MW2_CDS_01958	MW0361	FALSE	unmapped	ACAGTAAAGATTCGAAGGTTGCTGGAGTGAATACGTCAACAGACGCTAAGACGGATACTA
9724	37	70	MW2_CDS_06789	MW1268	FALSE	unmapped	ATTAATGCCTTGATTGGAGAGAGCGGCGCTGGAAAAAGTTTGATTGCTAAAGCTTTACTT
9725	37	68	MW2_CDS_10890	MW2056	FALSE	unmapped	GGCATTCAATATCTTGGTGCGGCAACGCAATTAACGGATAAGTACGGATTTTATAACGGA
9726	37	66	MW2_CDS_08311	MW1563	FALSE	unmapped	TGTGGAAATTGAGGTGCAAGTTCAAGGAATGACTTGTATGTTCCAATCAAAGCGTATGCT
9727	37	64	MW2_CDS_08069	MW1519	FALSE	unmapped	TCCAGATGATCAAATTTCAGACCATCCTGAACAATTTGTAGTGGGTGAAATCATTCGTGA
9728	37	62	MW2_CDS_02657	MW0491	FALSE	unmapped	GTCTGAAGAAGTTGGCGCAAAGCGTTGGTATGCAGTGCATACATATTCTGGATATGAAAA
9729	37	60	MW2_CDS_05702	MW1061	FALSE	unmapped	TGTTCATGGGAGAATACGATCATCAATTAGATACAAAAGGACGTATGATTATACCGTCCA
9730	37	58	MW2_CDS_05023	MW0929	FALSE	unmapped	CAGAAGAAACGTGGACATGGTGGTTATGTAGGTGAAGACCAAATCCCTCGCTTAAATGTA
9731	37	56	MW2_CDS_11305	MW2138	FALSE	unmapped	AGACATGTGAGAATCCATCCTTCAAGTAGGACTGATAGAGGTGTACATGCGATACAGCAA
9732	37	54	MW2_CDS_01712	MW0312	FALSE	unmapped	TCAAAAGAGGCATTTGCAGATTACTTAATGATTATAGTTATTGATGAAGAATTAAGCGGT
9733	37	52	MW2_CDS_08859	MW1663	FALSE	unmapped	GCATTAGTGACCAGAAAATTTGTTGATAAAGCACATCATCATCAATTACAGGTTATGCCA
9734	37	50	MW2_CDS_10328	MW1949	FALSE	unmapped	GAACTGATAGAGGTACCAATAAAACCTAGTGATCGTTTAAAAGCTCGTGAAATGTTGGGT
9735	37	48	MW2_CDS_05469	MW1013	FALSE	unmapped	ACAAAGGATCTGATGGAACGACTACTGGTCAAAGTGAATCTAATAGTTCGAATAAAGACA
9736	37	46	MW2_CDS_10245	MW1934	FALSE	unmapped	TGGAACAAATCACGTTAACCAAAGAAGAGTGTGTCGAACAATGCATCAATAAAGACTTAA
9737	37	44	MW2_CDS_06865	MW1281	FALSE	unmapped	ACGTCATTGATGATTTTAATGGGCAACAAGCGGTGGAAAAACTATATGACGCATTTAACA
9738	37	42	MW2_CDS_05238	MW0969	FALSE	unmapped	TCCGTTTGTAAAAATTACAGATGCATATGTTAATCCAGAAATGGGCTGGACATTAGTGAT
9739	37	40	MW2_CDS_01219	MW0224	FALSE	unmapped	GGGACGAGGCGTATCAACATTTAAAATCTGGCGAAGGTATTAAAGCATTACTTAAGCCGC
9740	37	38	MW2_CDS_13830	MW2610	FALSE	unmapped	GCCATTGAAGCTATTTCTAATGATGAGGATTTACACCTAGCCCTGGGCACAACGGAATAG
9741	37	36	MW2_CDS_08555	MW1612	FALSE	unmapped	AAGTATGCATCAAGTTTCTTTGGACCTTTTAGAGATGCAGCAGATTCAGCGCCATCATTT
9742	37	34	MW2_CDS_05085	MW0941	FALSE	unmapped	TTTGCTCTTGTAATTACACTTTGTTTCGTTGTCGGAACATATTGGGTTATGCAAGGCGGT
9743	37	32	MW2_CDS_06606	MW1234	FALSE	unmapped	CCCCAGAATGACCATTCTTTAGCAAAATCAACTGATCCGAAAATTTTACCAATTAATGGC
9744	37	30	MW2_CDS_09977	MW1871	FALSE	unmapped	AAAAGTCCTTTAACATATTTAGCGATACTAGTCGTATCTAGTTTGATTGCAACTCAAAGT
9745	37	28	MW2_CDS_08731	MW1642	FALSE	unmapped	TAAACGTGGTAAGAAACACTCAATCGTTCTTGTAGCAGAAGGTTGTATGACTGCGCAAGA
9746	37	26	MW2_CDS_08275	MW1556	FALSE	unmapped	TGTAACGATGCTGTTAAAGTTGCACGTGCAGCAAATTATAGAAGTGCAGGTACGATTGAA
9747	37	24	MW2_CDS_05334	MW0987	FALSE	unmapped	GCATCACAACGTGAAGAATTAGCGAAGCAATTATCTCAGAACGGTGGCAAGGTTTCTTTA
9748	37	22	MW2_CDS_11659	MW2209	FALSE	unmapped	ACGCAGATGACCATAATATGATTATTGTGGATGTTAATTCAGAAGATCTTTTAGTGATTC
9749	37	20	MW2_CDS_00637	MW0118	FALSE	unmapped	CCCACCAGGTTACAGTACTTTGCCAACAGTTAAAGCAGATGAAAACGGAAATGTCACAAT
9750	37	18	MW2_CDS_12153	MW2300	FALSE	unmapped	TCGACACCCAAACTTTATTAGATTTTTTAGCAGAACTTGCTAATAAATATGATGTTCAAT
9751	37	16	MW2_CDS_06835	MW1276	FALSE	unmapped	TTCAATCGTTCTCGCGATTTCAAGAGCAATTGGAGAAACGATGATTGTATCATTAGCGGC
9752	37	14	MW2_CDS_02284	MW0422	FALSE	unmapped	TGACACCATCATGTTACGACATTATGTCCCACAAGATTATTCGATGTTAGAAGCTTTTCA
9753	37	12	MW2_CDS_09995	MW1874	FALSE	unmapped	ACTTATTTATGAAGAACATAAGCGTACGGGATTTATAGGATTAACAGAACATGCGCAAGT
9754	37	10	MW2_CDS_02183	MW0402	FALSE	unmapped	TTTAAAAATGGTAAAGGTCATGAAATGGAAGGCTTTCTGACCGAAGAAGAACAAAAAGCT
9755	37	8	MW2_CDS_10522	MW1986	FALSE	unmapped	AGGTTACGTACAACAGGCGGACGTTATCTTTTAAAGTCCCATGATATTGAAATTAATCCA
9756	37	6	MW2_CDS_10396	MW1964	FALSE	unmapped	GAAAATGAAGGTGAGGAAATTTTAGCGTTTAGCAATCGCGTTGCTGCAATAGTGACAACG
9757	37	4	MW2_CDS_07411	MW1385	FALSE	unmapped	TCGACCGAACGGTACAAATAAAGTGTTTGTTAAAAGAAAAGAAGCGGGTTCATGGTCTGA
9758	37	2	MW2_CDS_11207	MW2117	FALSE	unmapped	ACAGTGTAACGATGATGCATGGTCAAGACCATTTAATGACAACAATTTTACTGAAAGATT
9759	37	163	MW2_CDS_07542	MW1415	FALSE	unmapped	ACCTAAACTACATTCAGTTTATTTTGTTCATGTAATGCATACGCTAACAGAACAATTTGT
9760	37	161	MW2_CDS_03379	MW0620	FALSE	unmapped	ACGAACAGGTTGTTGCAGCAATGAATCAAATAGATATTGCTGTATTCTTTATCGACCCAA
9761	37	159	MW2_CDS_12018	MW2277	FALSE	unmapped	AGTTCACCACAAATTATAGATGCTGAAAAACATGGTGATAAGATTACCGCAACCGTAAGA
9762	37	157	MW2_CDS_01763	MW0321	FALSE	unmapped	GTTGCGTGAAGGTGTTGAGGTTATCATTTTCTATATGGGGATGATAGGTGAGCTAGCGAC
9763	37	155	MW2_CDS_10602	MW2001	FALSE	unmapped	ATGTGGAGTGAGTATCGTGGTAATCCAATACTAGCGAATTTAGGCATTTATGGACCGAAT
9764	37	153	psma_tiling_021_R		FALSE	unmapped	GCCAATATATCTTGGGATAGATTATGAAAATCATTAAGATTTCGTATGCCAAATCATGAA
9765	37	151	agr_tiling 063_F		FALSE	unmapped	AAAGATGAAGGTGCATGTGCACCATGTGCATACCTTCTAATTAGATAAAACGATATATTA
9766	37	149	MW2_CDS_04784	MW0882	FALSE	unmapped	GGGTCGATGTCTATGAGAATAAAGGTAAACGTTCAGGTGGCTATTCATCAGGTGCACATT
9767	37	147	MW2_CDS_05476	MW1014	FALSE	unmapped	AGGTTGAAAATAATCACAAAGAGCAACCGAAACATAAAGATGAAAAATCAAAAAAGGAAA
9768	37	145	MW2_CDS_13831	MW2611	FALSE	unmapped	AGGGCGAAGTACCGAGTATTGGAACGATTTTAGAAGGTCTTCAAACATTACCTGAACGTG
9769	37	143	MW2_CDS_09571	MW1798	FALSE	unmapped	CGAATCAATTATCAGGTGGTCAAAAGCAAAGGGTAGCAATTGCAAGAGCTTTAGCAATGC
9770	37	141	MW2_CDS_03516	MW0645	FALSE	unmapped	AGCAGCATCGGACTTCACATTTATTATGGCTGTTCCAATTATGTTAGCAGCTAGTGGTTT
9771	37	139	MW2_CDS_12369	MW2342	FALSE	unmapped	TTAGTCAGAAATTAGGCTATAATATCGGCGGAAACTTCCAATCAGCGCCATCAATCGGAG
9772	37	137	MW2_CDS_01401	MW0256	FALSE	unmapped	AGGTTAATGGTGAAAAGTACAAAGTTAGACCTGTCACGTTAACACTTAGCAGAGCTGACA
9773	37	135	MW2_CDS_08491	MW1598	FALSE	unmapped	TCCGTTGATTATAAAGTTCCTTAAAAAAACAAACAATGACATTGACATGAAACGTCGTCA
9774	37	133	MW2_CDS_04625	MW0853	FALSE	unmapped	ATCGACGCTGGGGCGCACCATTCCCTGTCATTGAAATTGTAAAACTTGGTATTAATAAAG
9775	37	131	(-)3xSLv1		neg		
9776	37	129	MW2_CDS_09951	MW1867	FALSE	unmapped	TGCAATTGATATGAATCCTTTTCATGAGAATAAGAAAACGTTAACGATTGAAATGCCTGA
9777	37	127	MW2_CDS_11405	MW2160	FALSE	unmapped	ATACAAAACTCATGATGAAAACAATTCAGCTAAATTAGGAGACATTGTTAAAATTCAAGA
9778	37	125	MW2_CDS_12240	MW2317	FALSE	unmapped	TCTGATTATCTACCGTTGATGCTTCAATTTTTGCAAGTGGCAGAATGGCGAAATGATCCA
9779	37	123	MW2_CDS_10463	MW1975	FALSE	unmapped	ACTCCTAAATACCATAAATTAGCTGAGGCGGAACGAAATTGGATCAACAGTCAAAAGAAC
9780	37	121	MW2_CDS_09135	MW1713	FALSE	unmapped	CAAAGGTTCATACCTCTAACCAACGATGTATTTGTCATAACCTTAAGACTGGTGAATGCT
9781	37	119	MW2_CDS_12036	MW2280	FALSE	unmapped	GTGGTACAGTGCTTTACAATGATGCGCCATTGTTTGATAAACAGCATCGTCCTAGTGATT
9782	37	117	MW2_CDS_01487	MW0273	FALSE	unmapped	ACCTGGAAGTGAAGAATTGAATTATTATTCAGATATTCCTAAAGATTGCAATGTCTCAAA
9783	37	115	MW2_CDS_00508	MW0095	FALSE	unmapped	TGCGAGAGGTATTATTGTGCCACACGTTAAAGATCGTGAGACAGTTGAGCATATTGTGAA
9784	37	113	MW2_CDS_08418	MW1584	FALSE	unmapped	GCCATATGGTGCTGTGCCGATTGATTTTGCTTATGCGATTCACAGTGAAGTAGGTAATAA
9785	37	111	MW2_CDS_02022	MW0374	FALSE	unmapped	AAAGGTAATGCAATAATCCCTGCTGGATCTTTAGGTAACATCATGTTACTTGACTCTGGT
9786	37	109	MW2_CDS_03618	MW0663	FALSE	unmapped	TATTTTTTCAATTGGTCATACAGTGGCAACATACGAAGAAGCAGTCGAAGCTGTTGAGCG
9787	37	107	MW2_CDS_02870	MW0528	FALSE	unmapped	TCGATATTTGGTGGTACGACGCCATTAGTTGCAACATGGTTAGTTACGAAAACTGGAGAT
9788	37	105	psma_tiling_014_F		FALSE	unmapped	TACTTCACTCATTTTTATGACTGTTAAACAATGATTGTACCTTCAATTAACAGTTGGTAC
9789	37	103	MW2_CDS_07028	MW1313	FALSE	unmapped	TGATGGACCTAAAGAAAGTGGCGGCTTAAGATACTGTATCAATTCCGCTGCAATTCAATT
9790	37	101	MW2_CDS_10516	MW1985	FALSE	unmapped	ACAATTTCTGGACAAGGTACGCTTGCTAAAGAAATGCTAGAACAATCAAAGACTGACAAT
9791	37	99	NC_S_052		FALSE	unmapped	AAGCACCCCGTAAACTATTATACGGGAATGCTAAAGTCATATATACTACGGGGGAGTAGT
9792	37	97	MW2_CDS_11588	MW2196	FALSE	unmapped	GTGCAAGGCTTCAGAGGTATAGACACGAAAATGATTAATACAGCTAGAACGATGGGAGCA
9793	37	95	MW2_CDS_00713	MW0133	FALSE	unmapped	AACATACAATTGTAGGGGCTGGGTCGGTTGTAACAAAAAGTTTTCCAGAAGGTAACGTTG
9794	37	93	MW2_CDS_01295	MW0237	FALSE	unmapped	CGAAACAACAGAGCCATTGAATCGTTATGAAAAACGATTGAATCCCGCTTATTTCATACG
9795	37	91	MW2_CDS_11060	MW2091	FALSE	unmapped	AACAGATTTCCTCTAGTTCTTGGTGGAGATCATTCTATTGCGGTAGGTTCAGTATCAGCA
9796	37	89	MW2_CDS_09369	MW1760	FALSE	unmapped	AGCCGGTAAAACGACACTTATGAAAATTATATGTGGCATACTTCAACAAGATTCAGGGGA
9797	37	87	MW2_CDS_06725	MW1256	FALSE	unmapped	ACCTTGTGGGTCCATTAATTAATCCATATCACTTAACGTATCAAATGGTAGGCGTCTTTG
9798	37	85	MW2_CDS_09278	MW1741	FALSE	unmapped	TAGACGCTACATACTCGCAAGCCGTAGCATACCTTTTAAATAAATATGGCGCTGTAACCG
9799	37	83	MW2_CDS_06393	MW1187	FALSE	unmapped	AACTGTATTCTTTCTAAACGGTTTCCAAATGAAAGGTGTTATTGAAGAATACGACAAGTA
9800	37	81	MW2_CDS_09428	MW1771	FALSE	unmapped	TGTACGCAAAAAGGATACATATTTTGTAACACATGGTTTAGGTTCAATCACAGCTTTAAA
9801	37	79	MW2_CDS_13083	MW2476	FALSE	unmapped	GGTGACGATTGGAGAAGGCAGTGTGATTGGTGCTGGTAGTGTTGTCACTAAAGATATTCC
9802	37	77	MW2_CDS_06189	MW1149	FALSE	unmapped	AAGCTGTTGTTGAAGAGCTAGGTGGCGAAAAAATCGACATCGTTCAATGGAATGAAGATC
9803	37	75	MW2_CDS_09514	MW1787	FALSE	unmapped	TGTCATTAGGTTTCATTTTAGGTGGTATTATTGGATTTTTCCAAGGTTTGGTTGCAATCT
9804	37	73	MW2_CDS_12453	MW2358	FALSE	unmapped	TCCATTTACCACTTTGGGTCTTACTCATCGCATTCTTCTTAAATGTGTGTCCTGTGACGT
9805	37	71	MW2_CDS_04235	MW0778	FALSE	unmapped	ACGTTATATTTAATGCGCCACGGACAAACTTTGTTTAATTTTAAGGGACTAATTCAGGGA
9806	37	69	MW2_CDS_12790	MW2420	FALSE	unmapped	GCGTTGCATTCTACTCTAATAACGCTCAAGGCGACGGTAAAGATAAGCCAAATGATCCTA
9807	37	67	MW2_CDS_09000	MW1688	FALSE	unmapped	GATATAGGTGCTCAAAATGAAGATGAGGTGCGTGAGCGCGGAATAGATATAGGAGATACA
9808	37	65	MW2_CDS_02545	MW0471	FALSE	unmapped	CCCATTAAATGATATAGCAGCAAATGTCGTAGAACCACGTTCGAAATTGAAAGTGAAAGA
9809	37	63	MW2_CDS_10821	MW2043	FALSE	unmapped	ACCATTCCGGTTGGATAGAATGTATTACAGGTAGTATGTTTAGCGGTAAATCCGAAGAAC
9810	37	61	MW2_CDS_13224	MW2503	FALSE	unmapped	TAGTTCAACTTTTACAGCGTGCTCGGTCACAATGACGATGCTTTTGAAACATTTAGGTGG
9811	37	59	MW2_CDS_08198	MW1542	FALSE	unmapped	ATTGGATGCGGTACTGGTAGTTTAACAGTTCAATTAGAAGCTTTAGGTAATGTTACTGGT
9812	37	57	perR_tiling_069_R		FALSE	unmapped	ATAGTTTCATCTTTTTATAATCATCTAAAATGAAAGCTAAAATGTATTCAGATAATTGTT
9813	37	55	MW2_CDS_01086	MW0200	FALSE	unmapped	AACGATTAGTTGCAGAGTTCGATGCCAAGTCAATTCGAAAGGATGTTAGTGAACAAAGCG
9814	37	53	MW2_CDS_01005	MW0186	FALSE	unmapped	AGAATCCTCTTATTCAGTTGTTGGATCAGATGAGCTTTTAAAAGAAGACCGTATGTTGTT
9815	37	51	MW2_CDS_01288	MW0236	FALSE	unmapped	TAGAGCAGCTATCGTGATACCACTTGAGATGCATGGTTCTATCGTCGGTACATTGAAGAT
9816	37	49	MW2_CDS_05224	MW0966	FALSE	unmapped	GCTTGCTGCAAATATTGGTACACCTAATGATTTGCCAGGTGTTATTGAAAATGGTGCACA
9817	37	47	MW2_CDS_11603	MW2198	FALSE	unmapped	ACGGCAGTAGGATTTATTCGAAATGGTGGCTTTAATATATATAGTCATCCAGAACGTATC
9818	37	45	MW2_CDS_09308	MW1749	FALSE	unmapped	ATGAGGATTTTTGAAATGGGTTATGATGCAAAATTACATGGTGAATTTGATATGTGGGTT
9819	37	43	MW2_CDS_02112	MW0390	FALSE	unmapped	AAAGGTGGCATATATAGCGTTGGCGGTATAACAAAGAAAAATGTGAGATCAGTGTTTGGA
9820	37	41	MW2_CDS_05653	MW1050	FALSE	unmapped	GATGGTCGTAATAACGTTGCAAATGCATTAATGCAAGGTGCTGCCATTATGGGTATGAAC
9821	37	39	MW2_CDS_07568	MW1424	FALSE	unmapped	TGCAACATCAAGCTTATATCAATGCTTCTGTTGACATTAGAATTCCTACAGAAGTCGAAA
9822	37	37	MW2_CDS_04559	MW0842	FALSE	unmapped	ACCTCTAGCATATAACAAAGATATGCAGGAAGATAAAGAAGGTTTATTCGATGCTGTCCA
9823	37	35	MW2_CDS_08238	MW1550	FALSE	unmapped	TCAGACTTAGCAAATGGAGAAGCGGAAATGAGCTTCGAAGCATTTTTAGAAAAAGCAGCT
9824	37	33	MW2_CDS_11726	MW2223	FALSE	unmapped	ACAGTGCCTAAGTTATATCACCTCCATCAAAAGTACGCGCTTACATCATTGATACACAAG
9825	37	31	MW2_CDS_04031	MW0735	FALSE	unmapped	AAATGATGCTTTTGGTACTGCGCATCGTGAGCATGCATCTAATGTTGGTATTTCTACACA
9826	37	29	MW2_CDS_00768	MW0143	FALSE	unmapped	GTCATCGTTGCAGTTGTATTGATTTACTTTACAGGATGGCGCATCATCGACCCAATCATT
9827	37	27	MW2_CDS_02138	MW0394	FALSE	unmapped	TGAAGATTATGAAGGACTTGATGTATTTGTTGTAAGAGAAGGGTCAGGTAAACACGCAGA
9828	37	25	MW2_CDS_06016	MW1118	FALSE	unmapped	TGCTACAACTGGTCAGAATGCGTTGTCACAAGCTAGAAACTTTAAAGAAGTAACAAATGT
9829	37	23	MW2_CDS_00953	MW0176	FALSE	unmapped	ACCTTCGTATTTATCTCCACATTTCAATCATCAACATTACAGTGAATTAGAGTCTTTTGA
9830	37	21	MW2_CDS_13390	MW2534	FALSE	unmapped	AGGAGGTTCTAATCAAGTTGAAGCCCCTTACTTTATACATGAAAATGATGTGGCTGCACT
9831	37	19	ETG10_195139		pos		
9832	37	17	MW2_CDS_03348	MW0615	FALSE	unmapped	TGGCGAGTTTGATTTAGTACGACAATTGATGTCCGAAACAGATTTTATGGAATTTGAAGA
9833	37	15	MW2_CDS_05603	MW1039	FALSE	unmapped	TTGACGTGTCTAATTTGAATTTAGTAATTCTACCAACGTTAATCATTAGCTGGGTCACAA
9834	37	13	MW2_CDS_06632	MW1239	FALSE	unmapped	TGCAGCAGTAACTTGGTTTAAAAATGAACTTGAGTTGCCTGAAAATAATAAAGTGCTCGT
9835	37	11	(+)eQC-41		pos		
9836	37	9	MW2_CDS_05347	MW0989	FALSE	unmapped	TGCAACAAACAAAAGAGGCTATAAAATGTTACCTCATTTCCAAATTGGTATGTTTGAAGA
9837	37	7	MW2_CDS_11731	MW2224	FALSE	unmapped	ACCTAAAGCATCAACAAACGCGACTGCCGATTTAACAATTGGATTAGTACTTGCAGTAGC
9838	37	5	MW2_CDS_05416	MW1003	FALSE	unmapped	TTTTAATAAAATTGCACAAGGATCCGTCGCAATTGGTGCTAGCCAACAGGAAGTTACAGA
9839	37	3	MW2_CDS_03347	MW0615	FALSE	unmapped	GAAGGTGCTTTGGATTCTGCTTATTATCATGCAGACGCTTCCATAAAACTTACTGACGGC
9840	37	1	MW2_CDS_06444	MW1202	FALSE	unmapped	ACAGACTGATTTTGCTGTTTATTCGTTTGATGAAACTGAGATAAAAAGTATTAGATTATT
9841	36	164	MW2_CDS_06163	MW1144	FALSE	unmapped	TGGATGCTGCATTTTGCTTAATGTCTGTGGCTTATGTAGGCATTGGTTTTATGTTCTTTT
9842	36	162	MW2_CDS_13847	MW2613	FALSE	unmapped	CAATGGCCGGTAACCCCCTTGCACAAAATTTAGCATCTAGCACATCTAATGTTCACATTA
9843	36	160	MW2_CDS_13450	MW2544	FALSE	unmapped	ACTCACACAAACCATCCTGTTTCAGTCGTATCTAAACAAAATGAGGGTACAACATTTACG
9844	36	158	MW2_CDS_08814	MW1656	FALSE	unmapped	GGTACCATCAATTGATACAGGTGTTTGTGATCAGCAGACTCGCAAATTCAACTCTGATGC
9845	36	156	MW2_CDS_06265	MW1163	FALSE	unmapped	TTATTCGACGATGAAAAGTGCACAATTAGGTTTCGTTAAGGCGCTTAGTCAAGAGCTTGC
9846	36	154	perR_tiling_009_R		FALSE	unmapped	TACTTATATGAAGTAAGCTAACGCCTTTTTAATTTGTCATACTACCAAAGTTAAATTATT
9847	36	152	MW2_CDS_06084	MW1131	FALSE	unmapped	TGGCTGAAGAAAAACATGGTTTTCATTTCATGAATGAAGATTATTTTAAACGAATGCAAG
9848	36	150	MW2_CDS_06103	MW1134	FALSE	unmapped	GACTGAGGATGAATTTAATCGCTTTTATGATGCAGTATTAGAAGCTGAAGTTGCGCCTGT
9849	36	148	MW2_CDS_12908	MW2443	FALSE	unmapped	GATACAGCGAGCCATTTTGTGCTAATTTTTGCGCGTAAAAATGTAACGTCAAGATCACCG
9850	36	146	MW2_CDS_09826	MW1844	FALSE	unmapped	TCGATTACTATGGACAAGCTGAAACAATTGGTATTACACAGTACGTTACTGAACAAGCGA
9851	36	144	MW2_CDS_11724	MW2222	FALSE	unmapped	TATGATAAAGTAGGCGGAGAAATCGGTTCTACTTGGGGAAATGCTAATAATTGGGCTGCT
9852	36	142	MW2_CDS_09248	MW1735	FALSE	unmapped	CGTTTCGTAATCATTATGCCAGTGCAATCGGATGTAAAGAGAGCTTGGGATTTGATCGTG
9853	36	140	MW2_CDS_12641	MW2391	FALSE	unmapped	TGCAGCATTTAAAGCGAAAAATGGTTATGAAAGTGCAACATCAGGCATTGAGAACAAAGA
9854	36	138	MW2_CDS_09662	MW1814	FALSE	unmapped	TCAACGATTAGCGACAGAGATGTGCAAGGTGGTAGTACCATTACACAACAAGTTGTCAAA
9855	36	136	MW2_CDS_06142	MW1141	FALSE	unmapped	ATTTTTGCTGCAGGTATTGGAAACCCATACTTCTCTACAGATACTACAGCGGCATTACGT
9856	36	134	MW2_CDS_09891	MW1855	FALSE	unmapped	GGCGTACGTAACTTTATTGATGATTACCGTTACAATTTACTAGAAAAAGTTGCAGATGCG
9857	36	132	MW2_CDS_03976	MW0726	FALSE	unmapped	TTCTGTGACATTAACGTCTACAAAAGATGGTTCAGAAGAAACACACGAGGCTGATGGTGT
9858	36	130	MW2_CDS_05143	MW0951	FALSE	unmapped	ACGGCATTTACAAATCTTTATGAACAAGGTGAAAAAGTTATATATCCTGTAGCTCACGGT
9859	36	128	MW2_CDS_01274	MW0234	FALSE	unmapped	TTGGCGAAGGACATTATGATGTCAGACTTAAATTACATTCACGAAACAAGAAGCACACAA
9860	36	126	MW2_CDS_13169	MW2492	FALSE	unmapped	AGCTATCCGGAGCATCAACGAGATATCATTGTAAATAGTGCGAGTTTTTTAGCAGCTGGT
9861	36	124	MW2_CDS_13068	MW2474	FALSE	unmapped	GCCAGAGACATTAGCGATCGCCTTAACCACCCATTTCAAACGATTAGCGATACAATTAAC
9862	36	122	MW2_CDS_00735	MW0136	FALSE	unmapped	AGCGATTATTCGATGTAGTGAGTTCAATATATGGTTTAGTAGTTTTAAGTCCGATTCTGT
9863	36	120	MW2_CDS_00683	MW0128	FALSE	unmapped	CAAGCTCAACGGTAGGGGATCTTGCGACCGCATTATTAGAATTGTTTGAAGCTGATAATG
9864	36	118	MW2_CDS_10363	MW1957	FALSE	unmapped	CAAATGCCATGCATCAATTTGCAATTTGGACTGCATTAGCTACTAAAGGCATAGGTGCTT
9865	36	116	MW2_CDS_04984	MW0921	FALSE	unmapped	CTGAAGTCACAAAAGACAAAACTACGCATGTTGGTGAACGCAAGGGTGGTCCTTATATAT
9866	36	114	MW2_CDS_10786	MW2037	FALSE	unmapped	AGTTCGTAAATTAGCGTTAGAGCATAAGCCTAAGCTTATTGTGGCAGGAGCATCAGCATA
9867	36	112	MW2_CDS_01414	MW0259	FALSE	unmapped	TTGAATCATAACCTTGATGGTCGCTTATCGAAAGATGCATTAAGCCAGCAATTGAGTGCA
9868	36	110	MW2_CDS_02693	MW0497	FALSE	unmapped	AAAATGGATTATATGGATGTATCGCCGAAGCAAGTTGTTTCAGCAGCGACAGCATGTATT
9869	36	108	MW2_CDS_09841	MW1847	FALSE	unmapped	AACATCTAACAGAAACGCAACTTTTTTATGGTGGCGGTATTTCCTCAGAACAACAAGCGA
9870	36	106	MW2_CDS_01876	MW0343	FALSE	unmapped	AAACGTTTTATCTCAGAACGCGGTAAAATTTTACCACGTCGTGTAACTGGTACTTCAGCT
9871	36	104	MW2_CDS_05513	MW1022	FALSE	unmapped	ATTAATGTCTGTGTCGGTAGGTTACATTAATTACCAGCCAATTCCGAGATTCCCAGGCAT
9872	36	102	MW2_CDS_03235	MW0595	FALSE	unmapped	GGCTATGAGTGTCACTCGCTTAAACGAAACATTTATGAGTAGCACTGACTGTAGTGACCC
9873	36	100	MW2_CDS_11179	MW2112	FALSE	unmapped	TCTGTCTTAATCATTAATGGTGCCGGTGGTGTAGGCAGTATAGCCACTCAAATTGCTAAA
9874	36	98	MW2_CDS_06593	MW1232	FALSE	unmapped	ATAGTGGCTCCTTATTGCAGTATTCATTTTCGGAAGCGGGTCAAGCTAAAGGGTATAGAC
9875	36	96	MW2_CDS_03287	MW0604	FALSE	unmapped	TAGAATTAATCAAGTTATCATGGGTGCGGGAGACTATAAAAACCTTGGTGGCGAGAAGCA
9876	36	94	MW2_CDS_04435	MW0818	FALSE	unmapped	TCACTCTTAAAGCTGGTATTGAGCGTGCATTACACGAAGAAGTGCCTGGTGTAATAGAAG
9877	36	92	MW2_CDS_12228	MW2315	FALSE	unmapped	TTTGGTCAAAGAGATGGTCGTCCTTTACCAAAAATATTTGATAATGATGATATTCAACGT
9878	36	90	MW2_CDS_06828	MW1275	FALSE	unmapped	ATTGAAGCCTTGAAAATGGGTAACAGTATATTGGCAGCAGCGCTAACAATGACCTTACTG
9879	36	88	MW2_CDS_13066	MW2473	FALSE	unmapped	TGCAAGATGGTTTTATGAAAGGTCTGTTTGGTATTGAAACGACAGGACCAATGCTAGCAT
9880	36	86	MW2_CDS_00920	MW0169	FALSE	unmapped	CAGCATGGTTGAAGCAATTGATACGGAAGAAGTATGGTTAGCGGATAAACGTGTGGAATT
9881	36	84	(+)E1A_r60_a135		pos		
9882	36	82	MW2_CDS_03753	MW0687	FALSE	unmapped	TGACAATCCTAGACAGCTTGAAATTTTTACTGGTACACCGATTATGTTTACAGCAGTGCA
9883	36	80	MW2_CDS_04526	MW0836	FALSE	unmapped	TCAAATGAAAGAAGTACCTCAAAATATGTTAAGTCAACTTGCAGATGGTGGCTGGCCTCA
9884	36	78	pMW2_079		FALSE	unmapped	AGGTGGATGGTTTCATAAAGAGAAGCAAGAAACAGGCAATATTGTAATTACTAAAACTGA
9885	36	76	MW2_CDS_09730	MW1827	FALSE	unmapped	ACTGAAAAAATAGCAACAGAAAAAACATCGTATCTAATAAATTATATGAACGCTGTGGCA
9886	36	74	MW2_CDS_12507	MW2367	FALSE	unmapped	AGTTGCAACATTGGGTAAACAACGTCATATTGAAGCGCCAGTCAATCGCTTTATTACTGA
9887	36	72	MW2_CDS_07453	MW1393	FALSE	unmapped	AAAAGTATTCGTTGGATACACGGACAGTGAAGATCATTCAGAGGATTCTGCAGGTTCGTT
9888	36	70	MW2_CDS_11022	MW2085	FALSE	unmapped	AGACGCTGTAAAAGATAGTTCAATTGAAGCTGGCTTACGCCGTGTTTTAGCTGAAACAAG
9889	36	68	MW2_CDS_09020	MW1692	FALSE	unmapped	GGTTGTTACAGCACAACATTGGAAAAATGGCCGTGAACTATCTTCAAACGAAATGAAGCA
9890	36	66	MW2_CDS_08587	MW1617	FALSE	unmapped	TGGATGTTCCAGGGTATGGATATGCTAAAGTAAGTAAAACACAACGTGAAAAATTTGGGA
9891	36	64	MW2_CDS_09237	MW1734	FALSE	unmapped	TGAAAAGTCATGGTGTAAAAGTGGTTATTGGCGGCATGTACGAATATGGTTTAAGCCGTT
9892	36	62	MW2_CDS_12315	MW2332	FALSE	unmapped	ACGTGTATCATATAAGCAAGATTTTGATTCGAGACGATATTATCAACAACATGATGCGGA
9893	36	60	MW2_CDS_08307	MW1562	FALSE	unmapped	CGCGCCATCCATTACAAATCGTTCAAATTAAAGTGGATCGCCCGATATATCCAAACAACA
9894	36	58	MW2_CDS_09172	MW1720	FALSE	unmapped	TTTTTTTACGATGATTTATCGGTTACACGAGGAAATTATTTTTTAACTTTAATGGCAGCA
9895	36	56	MW2_CDS_12392	MW2346	FALSE	unmapped	TGGTAAACGTTTAGATTCATTTGGACAAAGGGGGATTAGGGCAACACATTTTTCGTTTGA
9896	36	54	MW2_CDS_09795	MW1839	FALSE	unmapped	TTTAGCTGCAGGCGGACAATTGACGCAAGTCTCTTATGAAACACCGAGTAAATTGAAATC
9897	36	52	agr_tiling 144_R		FALSE	unmapped	AAGCGAAAATTCAGTAACGTTTATTGTTATGAATAAATGTGCAGATGATATACCACGTAT
9898	36	50	MW2_CDS_05819	MW1082	FALSE	unmapped	TGGTGTTTCTACAATGTTTGCCAGTATTATTGGTGGACCACCAAGTACAACATACGGTGA
9899	36	48	MW2_CDS_11758	MW2229	FALSE	unmapped	TCGTCCTGGTACTGGTGCGTATCCATTACGTGGACATAATAATGTTCAAGGATGTAGTGA
9900	36	46	MW2_CDS_08816	MW1656	FALSE	unmapped	ATCATTTGGTGAAAACTATGGCGTTGTTATGGAAGAACTTCGCTTATTAGCTCGTGCAGT
9901	36	44	MW2_CDS_08934	MW1677	FALSE	unmapped	GAAGGTCCTTTAACATACGAAGATTTGAAATCGCTTACTTTCGATGCGCATTTAACCGCA
9902	36	42	MW2_CDS_09852	MW1849	FALSE	unmapped	AGCATACGACAAAGTACAACCAAAAGCGATGATATCTTGGGAAACGAAAACACCTTTCCG
9903	36	40	agr_tiling 197_F		FALSE	unmapped	ATAGGTATACAAAGAAACGTTACATCATTTTTTAATTCACGCGTCATATTTAATTTTGTT
9904	36	38	psma_tiling_061_F		FALSE	unmapped	TAAATGCACCTGTACAGTTAGGCAGTATTTCCCGTCCTTTTAAAATAAAAAATTCGCAGT
9905	36	36	MW2_CDS_02872	MW0528	FALSE	unmapped	TGGTAAGTTAGCGGATAAAATAGGTGAAAAGAAAGTATTTCTAATTGGTACTGGTGGGCT
9906	36	34	MW2_CDS_11918	MW2258	FALSE	unmapped	TTTTTACATCACAACATGCGCAATTAAGCCAACAAATGACACGTTTTGGTGGTCTCGATC
9907	36	32	MW2_CDS_02713	MW0501	FALSE	unmapped	AAACGTGGAACAGCACAAAGAATTCTTTATTCAGCATTCGACCTAGTTGAACAACGCAGT
9908	36	30	MW2_CDS_03158	MW0580	FALSE	unmapped	AAAAAACGTAATGAGCATGATGAAAGAACTGTATTAATTCTTGTTAATGCACAACAACGT
9909	36	28	MW2_CDS_13511	MW2556	FALSE	unmapped	TGGTGCTAGAGAGCAATGGAATGATGGCTCAAATACATTATGTATAAGACCAGGCGTTGT
9910	36	26	agr_tiling 184_R		FALSE	unmapped	AACTGAGTCAATTAGATGATCGTTTCTTTAGATGTCATAATAGCTTTGTCGTCAATCGCC
9911	36	24	MW2_CDS_11550	MW2190	FALSE	unmapped	AAGCGGGGGCAGATCAAAGTATTGTACAAGGTTTTCAATATCAGCAAACTGTAACACGTG
9912	36	22	MW2_CDS_11570	MW2193	FALSE	unmapped	ACTAGAGACTTTGATACAGATAAAGGTGGTCAATGCGTGCGCCAACTATTACAAGCAGAT
9913	36	20	MW2_CDS_05944	MW1105	FALSE	unmapped	TGCAGAACATGGTGCCGATATGATTTCAATTCATGTCGAATCAACGCCTCATATTCATCG
9914	36	18	MW2_CDS_10444	MW1972	FALSE	unmapped	TGATGGCATAGTATTCTCTGAGTTAACACATCCACTCATAGCAGATGCAGTAGCCAATGA
9915	36	16	MW2_CDS_10131	MW1906	FALSE	unmapped	ATTTAACGTTCAGAAAGACATCCGAAATAGAATTGAAATCAGACGCAAGAGGTCGACTGT
9916	36	14	MW2_CDS_05847	MW1087	FALSE	unmapped	GTTCGACGCATATTGTAGTCGGTAGACCGATTACACAAAGTGACAATCCAGTCGAAAGTT
9917	36	12	MW2_CDS_02335	MW0431	FALSE	unmapped	TGTGGGAAGTAGCTTTTTTATATGTGAAGTTTGATTCAAGTGAAATCGATGTGCAGTTTG
9918	36	10	MW2_CDS_08467	MW1593	FALSE	unmapped	TTGCCTGAATCCGTGGTTAAAACATTGAAGATTAAAGATGCCTTAAAAAGTGATCCGACA
9919	36	8	MW2_CDS_00344	MW0066	FALSE	unmapped	AGGAAAAGGAAAGGCTTTATTACCTATGACTTTTGAGAATAAAAGAGATATAGTACAGGA
9920	36	6	MW2_CDS_00531	MW0099	FALSE	unmapped	TCGTACCTGTCATCGTATTGGCATCTGACTTATTTAAAGAAAGGATTTCAAAAGGTGTCA
9921	36	4	MW2_CDS_01733	MW0316	FALSE	unmapped	GTCAATGCGTTTCGTGACAAGGTAATAGGACTTGTAGCGACAGCAGGTTCTAGTAAACAT
9922	36	2	MW2_CDS_02442	MW0451	FALSE	unmapped	GTGAAATTATCTGATGTAGATGAATATAATCAAGAGTTTAACGTAGAACCTGGCAACAGT
9923	36	163	MW2_CDS_08141	MW1532	FALSE	unmapped	GGAGCTGCAATCCAAGGTGGCGTTATCACAGGTGACGTTAAAGACGTAGTATTATTAGAC
9924	36	161	MW2_CDS_08483	MW1596	FALSE	unmapped	TGACGACAATGGTGGTCATTTTCATATAAGAAGCGTTGATACAAATAACGATGAAGCGCA
9925	36	159	MW2_CDS_06315	MW1172	FALSE	unmapped	ACGGCTAGTGCTGGTCCAGGTTTATCTTTAATGATGGAAGCAATTGGATTATCTGGTATG
9926	36	157	MW2_CDS_00685	MW0128	FALSE	unmapped	TGAACAAACGCTGATTTGTGGTACAAGATACGGTAATGTGATGGCTTCAAGAGGATCAGT
9927	36	155	MW2_CDS_10221	MW1928	FALSE	unmapped	TGCCACATATTTTAAACGTAACAGTTCCAATACCTGAAACACATGTACTTATCACAAAAG
9928	36	153	MW2_CDS_10051	MW1889	FALSE	unmapped	AAAGTGCCGATCAATTTATGGCTAGACGGTAAACAAAATACAGTACCTTTGGAAACGGTT
9929	36	151	MW2_CDS_11304	MW2138	FALSE	unmapped	GCACAACACCGCGATCCATTTCAAAGTGGTTTGAAAACATTTATTCCTGAAACGTTGGAT
9930	36	149	MW2_CDS_10226	MW1929	FALSE	unmapped	TCATTGATAGTTGCTATAGTTTGTTTATTAAGTTTTTTATCGACCTATTGTTCACATTCT
9931	36	147	MW2_CDS_06631	MW1239	FALSE	unmapped	GGCGAATTCCAACTCAAGCAAGGATTTAGTCCTGCTTTTACAGTTGAACCAAAGGAAGAT
9932	36	145	MW2_CDS_11971	MW2269	FALSE	unmapped	ACCAACTATCACTTGGCCTGAACAATTAGGACATAAAATAGCAATTCCACACAAAGGAGC
9933	36	143	MW2_CDS_12361	MW2341	FALSE	unmapped	ACGTACTATAAATACAAAGGTGCGATTGACAAAGCTGTATTAACTTTACTTGGCGATGGT
9934	36	141	MW2_CDS_07716	MW1456	FALSE	unmapped	ACGTTGTTGGTGCGTGATGTTGATAAAGCAACTAGAATCTTTGAACAGGAATTGGGGAAA
9935	36	139	NA		ignore		
9936	36	137	MW2_CDS_02288	MW0423	FALSE	unmapped	ATCCAACGCTTACGCAATACGAATTATTCCAATCTGGCATGCGTGTTGGTAGAGAAATTT
9937	36	135	MW2_CDS_06049	MW1125	FALSE	unmapped	GGCGTTGGGTGTATATCTTAGCACTATCATCAAGCGCTCTTTGCGGATTGTTTATTCAAC
9938	36	133	MW2_CDS_06309	MW1171	FALSE	unmapped	AGGGGATATCGTAGGTAAAATTGGACGAGACGCAATTGAAACGTACATACCTCAACTGAA
9939	36	131	NC_S_106		FALSE	unmapped	ACTCTGCATCGCCTAACAGCATTTCCTATATGCTGTTAACGCGATTCAACCTTAATAGGA
9940	36	129	MW2_CDS_06435	MW1198	FALSE	unmapped	ATGTATTTTGCACAGTTAGATGGTGAAATAACTAATAAACAGTCACAAGAATTATTGGAT
9941	36	127	MW2_CDS_10200	MW1923	FALSE	unmapped	AAAGGCGATACATTCAAGCAAGAAATGGGAGAAACAGGACGTATCAAAGCGATTAAGCAC
9942	36	125	NA		ignore		
9943	36	123	MW2_CDS_00424	MW0080	FALSE	unmapped	CAAAACGTGCGGCGCTTGTACACGTCATCTTTAACTTAATCGGGGTAATTATCTTCACAA
9944	36	121	MW2_CDS_10167	MW1914	FALSE	unmapped	TTTGAAGAACAGTTTAGTCAAAAGTTTAAAATAAACAGAACTTCGATAAAAGAAAGAATT
9945	36	119	MW2_CDS_08891	MW1669	FALSE	unmapped	TGCATTTCCTGTAGATCGTGAAAATCCAGGACCTAGTACTTTAAAACGCCCAATCAATTT
9946	36	117	MW2_CDS_03704	MW0679	FALSE	unmapped	TGTGCCATCAGAATCAGACATGATGATTGTCTATGACGCAAGGGATATGATTAAACACCA
9947	36	115	MW2_CDS_10624	MW2005	FALSE	unmapped	TGCGACGATTGCCATTGCGGTTGGTCATGAATTAGGTTTGACATATAACACAATCTATCA
9948	36	113	MW2_CDS_05730	MW1066	FALSE	unmapped	AGCAGCTGTGCTTGCTTGTATTTTAGCTGGTGTACCTATTAAAGCAATTATTGATAGTTT
9949	36	111	MW2_CDS_13397	MW2535	FALSE	unmapped	ACACATGGTACAGAGGCAACCATTATTGAAGTGGTGCATCATTTACCATTCCCATCATTG
9950	36	109	MW2_CDS_06958	MW1299	FALSE	unmapped	GCCAGTTGAACGTGCAATTAAACGTACAATTATTGATAAATTGGAAGATGAACGTGAACA
9951	36	107	MW2_CDS_10332	MW1951	FALSE	unmapped	ATCTCTACGCACTCATTCAGATACACACATTGCGCATTGCTCATAGAATCAGGTGTACAC
9952	36	105	MW2_CDS_06526	MW1217	FALSE	unmapped	TGGGGAATTGGTTCGCTCTTTAAATAGTCAGGTAGTATCATGCCATTCTGAATTGGTCGA
9953	36	103	MW2_CDS_12682	MW2398	FALSE	unmapped	TGAGCCAAGGTGAAAAGTTTATTCATCAATCACCCGTTAATGATGAACTTAGTGCATTGA
9954	36	101	NC_S_083		FALSE	unmapped	AACGATTTAGCGCAATTAAATGTTTCGATATTCAATGTGTGTCTAAAGAGATTCTTTGTT
9955	36	99	pMW2_033		FALSE	unmapped	AGTGTTATTAAAGCGATGCCTAAGTCTGTTATTGATTTCTCTCATCAGGGTGAAAAATAC
9956	36	97	MW2_CDS_13007	MW2461	FALSE	unmapped	ACTGGCGTCATGCTGAATTTCATGTTAGTGTTCTTAACACTTAAAGCATTTGGCTATTCT
9957	36	95	NA		ignore		
9958	36	93	MW2_CDS_09549	MW1793	FALSE	unmapped	ATCAATTAAAGCTTTTCCATTGGCAATTGGGGCATTATATTTACCTGTTATTTTCAAAGT
9959	36	91	psma_tiling_054_F		FALSE	unmapped	AAGGAGGTAATCTTAATGGGTATCATCGCTGGCATCATTAAAGTTATCAAAAGCTTAATC
9960	36	89	MW2_CDS_11978	MW2270	FALSE	unmapped	GGGCAATACTTTATCATCACACATATCAATACACTTATTGGTGATTTTCACTCAGAAGCT
9961	36	87	MW2_CDS_04711	MW0870	FALSE	unmapped	GGGTTGTTGCGAATATTGCTGATAGAGTGGCAGTTATGTATGGTGGTCAAATGGTTGAAA
9962	36	85	MW2_CDS_06696	MW1252	FALSE	unmapped	TAGTTTCAAAAACCCTACTGACCGAGAACGCGGTATGCAAGCATTGAGTGATTTTGATTG
9963	36	83	MW2_CDS_01536	MW0282	FALSE	unmapped	ATTGCCATGCAAATTGACGATGTACTCGCAAAAATGTTTGTCATGATGTTCGGTGTTACC
9964	36	81	MW2_CDS_07671	MW1447	FALSE	unmapped	AGCGGTTATACTTCAAGACGTAAGGCAGAAACTTTAATTTCTGAAGGAAAAGTGAAAGTG
9965	36	79	DCP_1_7		pos		
9966	36	77	MW2_CDS_03437	MW0630	FALSE	unmapped	AGTTGTCGCTAAATGATTTAGCAGTCTTAGATTTAACGATGAAGCATTGCAAAGATGAAA
9967	36	75	MW2_CDS_02190	MW0404	FALSE	unmapped	TTTTAAAGCTAATTTTAAAGGCGCGGCTCAAGGAGATTGGGTTAAAAGTGCCATGTCTGA
9968	36	73	MW2_CDS_10330	MW1950	FALSE	unmapped	TGTTCAGAACAATCTGTAATATTATGGTATGAAACCATATTAGATAAAATTGTGGGGGTG
9969	36	71	MW2_CDS_01562	MW0286	FALSE	unmapped	ACATGATGAACGACTTAAAGCATATTGTGATCGTTCATATCATATGAAAGATGGCGTCCT
9970	36	69	MW2_CDS_03184	MW0586	FALSE	unmapped	TTTCGGATTCTATGTCTTCTTCGCAGGTCATAATAATCCTGGTGGTGGGTTTATTGGTGG
9971	36	67	MW2_CDS_02396	MW0443	FALSE	unmapped	ACCGAGGTCAAGGAGCCAAATATACGAAAGTAAGACGTCCGGTGCATTTAGTTTATCAAG
9972	36	65	MW2_CDS_11417	MW2163	FALSE	unmapped	TGACATCGATTATGCACACGCTGAAGCTGACACTACTTACGGTAAATTAGGCGTTAAAGT
9973	36	63	MW2_CDS_00326	MW0063	FALSE	unmapped	TCAAAGCAACATTGAAAAGGTTACAGATAATCGTCATAGCAAAGGTGCCAACTTTCATAA
9974	36	61	MW2_CDS_06740	MW1259	FALSE	unmapped	CAATTGAAAGTGCACATGCACTGAGTTATGTTGAAAGACTAGCGCCTACGATGTCGAAAG
9975	36	59	MW2_CDS_04493	MW0830	FALSE	unmapped	ACCAGGATTCTTTGTTTATCACACAGATTTAAAAAAAGATTGGCAAATTGTCTTGCTGTC
9976	36	57	MW2_CDS_00594	MW0110	FALSE	unmapped	TAGAAAAAGCAGTTGGAACAGCACGTGACAAAGGTGTACGTCATCATGTAGGTAATGTGT
9977	36	55	MW2_CDS_00751	MW0139	FALSE	unmapped	ACGTATGAGTCAAGCGAATAATCCATATGGTGATGGACAAGCATCACGACGTATTTGTGA
9978	36	53	MW2_CDS_04963	MW0917	FALSE	unmapped	TTACTAATCGTATTAAATATTATTATATTGCTTTTTTTCAGTTTGCCGTTGTTACTTTCA
9979	36	51	MW2_CDS_13938	MW2631	FALSE	unmapped	TGCAGATTTTCAGAGAATATATAAAAAAGGTCATTCTGTAGCCAACAGACAATTTGTTGT
9980	36	49	MW2_CDS_13144	MW2488	FALSE	unmapped	TGCAGGTAGTAAAGCGCTGACTGATTTGATTGTAAAAACGATGGAAACACATGCTACAAA
9981	36	47	MW2_CDS_01345	MW0246	FALSE	unmapped	GGGTGTCTTTGCATTAGGAAATTGGCCAGGCATTGGTCATAAAATCATTGGATTTACAGC
9982	36	45	MW2_CDS_07584	MW1427	FALSE	unmapped	TGGTTGGAAGCTTGTAGAAGGTCGTTCACGAAGAATGATAACTGATACAAAAGCAATGCT
9983	36	43	MW2_CDS_06286	MW1167	FALSE	unmapped	CGCCTTTGGCGGGAAGTCATGAAGTATATATTAGATTGACTGCAAATGCCGACTCAAAAG
9984	36	41	MW2_CDS_00118	MW0021	FALSE	unmapped	TGAACTGGAAACTGACAAAGACACTTTTCATTTTCGTGTTTATTCTTGTCAACATCGTGT
9985	36	39	perR_tiling_091_F		FALSE	unmapped	ATCAGTTAAAAAAATCATTTGGCAAAGAAAGTATGGGCATTGTAAGAACGACTTTTATAA
9986	36	37	MW2_CDS_00082	MW0015	FALSE	unmapped	AACTGGTGAAGGTGGTAAATTGTTTGGGTCAGTAAGTACAAAACAAATTGCCGAAGCACT
9987	36	35	MW2_CDS_03189	MW0586	FALSE	unmapped	TGAAACAACTTGGATACTTCCAATTTTAGGACAAATTCATGTAAGTACAATAACACTTTT
9988	36	33	MW2_CDS_07504	MW1404	FALSE	unmapped	TAAGGCTCAAGTATTGGAATAAAGAAAAGAAGTTAAAGATGGAACAGATAGGACATGAAT
9989	36	31	MW2_CDS_01410	MW0258	FALSE	unmapped	AGAGCAAAATCGCAATCTTACGGGCAAGGTTCAGACCAAATCCGTCAAATTTTATCTGAT
9990	36	29	MW2_CDS_01848	MW0336	FALSE	unmapped	ACCGAATCCGTATCAGCCCCGAAAAACTTTCGATGAAAATCATTTAAATGATTTGGCAGA
9991	36	27	agr_tiling 004_F		FALSE	unmapped	ATGACATGTGTTAATTATTATTTCGGGCGCTTCTTATTTATACAAATCTAATTTAATACT
9992	36	25	MW2_CDS_00382	MW0072	FALSE	unmapped	AGAGAATAAAAATGAAAATATTTACTTTACTGATAGTCTACATCTTAAACCGAGCGAGGA
9993	36	23	MW2_CDS_13784	MW2602	FALSE	unmapped	TCAGCGTACAGAGTTAATCAATGGTATTGGTCGATTTACGCTAACATCACAGGAATTATT
9994	36	21	MW2_CDS_10887	MW2055	FALSE	unmapped	AAACTGGCGTGGTTGGTACAATTGTTTCAGCGCAAAAATTGTCTAATGAACTTACATTTT
9995	36	19	MW2_CDS_13589	MW2569	FALSE	unmapped	TGTCGACAATTTGAGCAATATCAAGGTTATCGCCCACGTGTTTATACTATTCCTGTGGGA
9996	36	17	(+)E1A_r60_n9		pos		
9997	36	15	MW2_CDS_11014	MW2083	FALSE	unmapped	TAGTCGTTTGCAGCAGTGGTATGGGAACTAGTCGTCTATTATCAACTCGTCTAGAGCAAG
9998	36	13	MW2_CDS_11526	MW2185	FALSE	unmapped	CCGTAAAATCTATAAAAAAGAGCTTATTTCTAAATTGCGTTCTGAAACGGATGAAAGACA
9999	36	11	MW2_CDS_11776	MW2232	FALSE	unmapped	TGACACTCCCAATGCTGTTTTCCGACATTTTAATTTATTGTACAGAACGAAATGTGATGT
10000	36	9	MW2_CDS_06275	MW1165	FALSE	unmapped	AAAGACTTAGATTATAAGAGTAAATCAAAAGAGCCAATACAATTATTAGTAATCATGGGT
10001	36	7	MW2_CDS_11704	MW2218	FALSE	unmapped	ATTCGATTTTTTTCATAGAAATTAAAAAAGCCAACAAGGCTCTTGAAACCTTGTTGGCGT
10002	36	5	MW2_CDS_11080	MW2094	FALSE	unmapped	GGTTGTTCTCTTTATTTTTGTACTTTCTGGTGCGATTTTTTTAACATTTCTAGGGTTTGG
10003	36	3	MW2_CDS_13413	MW2538	FALSE	unmapped	CAAACAGCAGGGCAATTTGGTGTACCGTCTGTATCAACAGCTTATTCAATGGTTATAGGG
10004	36	1	MW2_CDS_09748	MW1831	FALSE	unmapped	TTTGCACTTTTTGATAGTGACATGGACAATTTGAAACATATGGATTACGACAATCCTGTT
10005	35	164	MW2_CDS_00577	MW0108	FALSE	unmapped	CCAGCTGCTGGTGAAAGTATGACATCAAGTATTCTTACTGCAAGTATTGCCGCACTACTA
10006	35	162	MW2_CDS_03173	MW0584	FALSE	unmapped	AGAGGACAGGAGTCTTTCGAATGAAGACGTTCTTTTTCAATCACTACGAACAAATCAAGT
10007	35	160	MW2_CDS_09334	MW1753	FALSE	unmapped	ACTGCCCATCCAGACGGTGACAAAGGAAATGGTGGTATATATAAAATTAAAAGCATTTCT
10008	35	158	MW2_CDS_01778	MW0324	FALSE	unmapped	CGTTACGTCATCTGTGAAAAGTACGATTCCTGTTGCTCAAAAATCAAATCAATCTATCGT
10009	35	156	MW2_CDS_07398	MW1382	FALSE	unmapped	GAACGCAAGAAAAAATTTATGACAAGTTAGATAGAAATTTCGAAGAACTAAGGCGTGACA
10010	35	154	MW2_CDS_13452	MW2544	FALSE	unmapped	GCAATCCAATCAATTATACGTAAAAGATAATGGTATCGGTATTAGTGAAGCGGACTTGCC
10011	35	152	MW2_CDS_13122	MW2484	FALSE	unmapped	TTGGTATGAATGTATTTTCTACCTTAGACGACGGTCGGACTAACCAGCATGCATTTGGAC
10012	35	150	(-)3xSLv1		neg		
10013	35	148	RC8		pos		
10014	35	146	agr_tiling 108_R		FALSE	unmapped	GGTAGTGT