#ID = Probe name
#SEQUENCE = Probe sequence
ID	SEQUENCE
T7_00001_G01	CCAAAAAAAACCAACCCGTCAAAACCCCACAACCCC
T7_00002_G01	CAAAAAACCCCAAACCCGTCCAAAAACCCCAAACCC
T7_00003_G01	AACCCCACCCCAAAACCGTCCACCCCAAAAAAAAAC
T7_00004_G01	AAACCCCACCCAAAACCGTCCACCCCAAAACCAAAA
T7_00005_G01	AAACCCAAAAAAAAACCGTCCCAACCACCCAACCCC
T7_00006_G01	CCAACCCCAACCCAAAAGTCACCCACAAAAAAACCC
T7_00007_G01	CCCACCCCAAAAAAAAAGTCACCCACCACCCCAAAA
T7_00008_G01	ACCCACCCCAAACCAAAGTCAAAAACCCAAACCACC
T7_00009_G01	CAAAAAACCAAAACCCCGTCAACCCCAACCCCAAAC
T7_00010_G01	CACCCAAAACCCCAAAAGTCAACCCCACAACCCAAA
T7_00011_G01	CCAAAAAAAAAACCCCAGTCAACCCCAACCCAACCC
T7_00012_G01	ACAAAAAACCCACCCAAGTCAAACACCCCAAACCCC
T7_00013_G01	CCACCCAAAAAAAAACCGTCACCCCAAACCAAACCC
T7_00014_G01	CCCAAAAAAAAACCACCGTCCCAACCCAAACCCCAA
T7_00015_G01	AAAAAAAAACACCCCAAGTCCACCCAAACCCCACCC
T7_00016_G01	AAAACCCCAAAACCCAAGTCCCCAAACCACCCAAAC
T7_00017_G01	AACCAACACCCAAAAACGTCCCAACCAACCCACCAA
T7_00018_G01	ACCCCACCAAAAAAACCGTCAAAAAACCCCAACCCC
T7_00019_G01	CCAACCCACCAAAAAACGTCCAAAACCCACCCCAAA
T7_00020_G01	CAACCCAACCCCAAAAAGTCAAAACCCAACCAACCC
T7_00021_G01	CCCAAACCCCAAAAAAAGTCAACCAAACCACCACCC
T7_00022_G01	CCAAAAACCCCAAAAAAGTCAACCCCACCAAACCCC
T7_00023_G01	AAAAAACCAAAACCCACGTCCCCACCCCAAAAACCC
T7_00024_G01	ACCCCACCCCAAAAAAAGTCACCCCAAAAAAACCCC
T7_00025_G01	CCAAACCAAAAAAAACCGTCCACCCCAAAACACCCC
T7_00026_G01	AAACACCACCCAAAAACGTCCCAAAACCCACCCCAA
T7_00027_G01	AAAACCAAAAACCACCCGTCAAACCCCACCCCAAAC
T7_00028_G01	CCCACAAAACAAAAACCGTCCCAAAACAACCCCACC
T7_00029_G01	AAAACCCCAACAAAACCGTCCCACCCCAAAACCCAA
T7_00030_G01	CCAAAAAACCCCAACCCGTCAAAACCCAAACCAACC
T7_00031_G01	CCCAAACCCCAAACCCCGTCAACCCAAAAAAACCAA
T7_00032_G01	AAAAAAACCCCAAAACAGTCACCCCACCCCAAACCC
T7_00033_G01	CCCACCCAAAACCAAAAGTCAAACCCCAAAAACCCC
T7_00034_G01	ACCCACCCACCCCAAAAGTCAACCCAAAAAAAACCC
T7_00035_G01	AAACCCCAAAAAAACCCGTCCAACCCCAAAAACCCC
T7_00036_G01	AAAACCCCACCAACCCCGTCAAAACCCAAAAACCAC
T7_00037_G01	AAAAACCCCACCACCCAGTCAACCCAAAACCCCAAA
T7_00038_G01	AACCAACCCAAAAACCCGTCCAAAAAAACCCACCCC
T7_00039_G01	CCACCCCAAACCCCAAAGTCAAAAAACCACCCCAAA
T7_00040_G01	CCCAAACCCAAACCCCAGTCAACCAAACCCCAAAAA
T7_00041_G01	ACCCCAAAACCCCAAAAGTCAAACCAAACCACCACC
T7_00042_G01	AAAACCCCACCCCAACAGTCAACCCAAAAAAACCCC
T7_00043_G01	AACCCCAAACAAACCCCGTCAAACCCAAACCCAAAC
T7_00044_G01	AAAACCACCCACCCCAAGTCAACCCACCAAAAACCA
T7_00045_G01	CAAAAAAAAAACCCCACGTCCCCAAAAACCCACCCC
T7_00046_G01	CCCAAAAAAAAACCCCAGTCAAACCCCACCAAACCC
T7_00047_G01	AACCCCACCACCCAAAAGTCAAAAAAACCACCCACC
T7_00048_G01	AAAACCCCACCCCAAACGTCCCACCCCAAAAACAAA
T7_00049_G01	AAAACCCACCCCAACCCGTCAAAACCCCAAAAACCA
T7_00050_G01	CCCAAAAAAAAACACCCGTCCAACCCCAACCCAACA
T7_00051_G01	CCCAAAACCCCACCCCAGTCACCCAAAAAAAAAACC
T7_00052_G01	CCCAAAAAAAAAACCCCGTCACCCAAAACCACCCCA
T7_00053_G01	AACCAAAACCCAAAAAAGTCCCCAAAACCCCACCCC
T7_00054_G01	CCCACCCACCAAAAACCGTCCCAAAAAAACCCCAAA
T7_00055_G01	CACCCCACCCCAAAACCGTCCAAAAAAAAAAACCCC
T7_00056_G01	AACCCCACAACCAACCCGTCCAAAAACAAAAACCCC
T7_00057_G01	AAAAAAAACCCAACACCGTCCCAAAACCCCAACCCC
T7_00058_G01	CCCAAAAACCCCAAAAAGTCAAACCCCACCCAAACC
T7_00059_G01	CACCACCCAACCCCAAAGTCCCCAAAACAAAAAACC
T7_00060_G01	AAAACCCCAAAACCCCAGTCAAAACCCCAAACCCCA
T7_00061_G01	CCCAACCCACCCCAAAAGTCCCACCCAAAAAAAACA
T7_00062_G01	AAAAAAACACCCAACCCGTCCAAAAACCCCAACCCC
T7_00063_G01	AAAACCCCAACCCCAACGTCCCCAAAACCCAAAAAC
T7_00064_G01	ACCCCACAAACCCAAACGTCCCCACCCCAAAAAAAA
T7_00065_G01	CCAAAAAACCCCACCCAGTCAAAAAAACCCCACCCA
T7_00066_G01	AACCCAAACCAAAAAACGTCCCAACCCCAAAACCCC
T7_00067_G01	CCCACCCCAAAAAAAAAGTCACCCCAAACCAAACCC
T7_00068_G01	CCAAAAAAACCCCACCCGTCAAAAAAAACCCACCCC
T7_00069_G01	AACCCAAACCCCAAAAAGTCAAAAACCCCACACCCC
T7_00070_G01	CCCAAACAAACCAAAACGTCCCAAAACCCCAAACCC
T7_00071_G01	CCCAAAAAACCCCACCCGTCCAAAAAAACCAAACCC
T7_00072_G01	AAAAAAACCCACCCACCGTCAAACACCCAAACCCCA
T7_00073_G01	CCACCCAACCCACCAAAGTCAAACAAACCAAAACCC
T7_00074_G01	CCCAACCCCAAAAAAAAGTCCCCAACCCAAAAACCC
T7_00075_G01	AACCCAAAAAACCCCAAGTCCAAAAAACCCCACCCC
T7_00076_G01	CCCAACCCCAACCCAAAGTCACCCCAAAAAAAACCA
T7_00077_G01	AAAAACCCACCCCAAACGTCCCAAAACCAAAACCCC
T7_00078_G01	CCCAAACCCAAACCAACGTCCCCAAACCCCAAAAAA
T7_00079_G01	ACCCCAAACAAAAACCCGTCCAAAAAACCCAACCCC
T7_00080_G01	AAACCCCAAAAAACCCCGTCAAAAACCCCAACCCCA
T7_00081_G01	CAACCAAACCCCAAACAGTCAAACCCCACCCCAAAA
T7_00082_G01	ACCCAACCCAAACCCCAGTCAAACCCAAAAAAACCC
T7_00083_G01	CCAAACCAAAAACCCACGTCCCACCCCACCAAAAAA
T7_00084_G01	CCAAAAACCACCCCAAAGTCAAAAACCCCAAACCCC
T7_00085_G01	AAAAAAAAAAACCCCACGTCCCACCAAACCCACCCC
T7_00086_G01	AAAACCAAAAAACCCACGTCCCCAACCCCAAAACCC
T7_00087_G01	CCAAAAACCCAAAACCCGTCACCCCAAAAAAACCCC
T7_00088_G01	CCCAAAAAAAACCCCACGTCCAAACCCAAAAACCCC
T7_00089_G01	AACCCAAACCCAAAACCGTCCAACACCCCAAAAACC
T7_00090_G01	ACCCCAAAAAAAACCCCGTCAAACCCCAACCAAACC
T7_00091_G01	ACCCAAAAACCCACCCCGTCAAAAAAAACCAACCCC
T7_00092_G01	AAAAACCCCACCCCAAAGTCCCCAAAAACCCACCAA
T7_00093_G01	AAAAACCAACCACCCCAGTCCCCACCAAAAAAACCC
T7_00094_G01	AAAAACCCCAAAAACCCGTCACCCCACCCCACAAAA
T7_00095_G01	AAAAACCCAAAAACCCAGTCCCACCACCCAAACCCA
T7_00096_G01	AAAAACCCAAAAAAACCGTCCCACCCAACCCAACCC
T7_00097_G01	CCCAACCCCAAAAAACCGTCCAACCCAAACAAAACC
T7_00098_G01	CCAAAACCCCACCCCAAGTCAACCAAAAAAAACCCC
T7_00099_G01	AACCCAAACCCCAAAACGTCCCACCAAAAAAACCCC
T7_00100_G01	CCCAAAAAAAACCCACAGTCACCCAACCACCCCAAA
T7_00101_G01	CCCACCCCAAAAAAAAAGTCAACCCAACCCAAACCC
T7_00102_G01	CCCAAAAAAACCAACCCGTCCAACCCAAAAAACCCC
T7_00103_G01	CAAAAAAACCCACCCCAGTCAACCCCAAAAAACCCC
T7_00104_G01	AAAAACCCCAAACCCAAGTCCCCACCCCAAAACAAC
T7_00105_G01	CCACCCCAAAAAACCCCGTCAAAACCCCAAAAACCA
T7_00106_G01	AAACCCACCCAAACCAAGTCACCCCAAAAACCCCAA
T7_00107_G01	CCAAACCCCACCAAAAAGTCAAACCCCAAAAACCCC
T7_00108_G01	AAAAAAAACCCACCCAAGTCACCCCAAAACCCACCC
T7_00109_G01	CCAAAAAACCCCAAAAAGTCAACCCCACCCCAAACC
T7_00110_G01	AACCCCAACCCCAAAAAGTCAAAACCCCAAAACCCC
T7_00111_G01	ACCCCACCCCACCCCAAGTCACCCCAAAAAAAAAAA
T7_00112_G01	CCCAAAAAAAAACCCCAGTCACCCAAACCCCACCAA
T7_00113_G01	CCCAAAAAACCACCCCAGTCAAAACCCCAAAAACCC
T7_00114_G01	AAACCCCAACCCCAAAAGTCAAACCCCAACCCCAAA
T7_00115_G01	ACCCCAAACCCCAAAAAGTCAAAAACCCCAACACCC
T7_00116_G01	AAAAAACCCACCCAAAAGTCCCAAACACCACCACCC
T7_00117_G01	ACCCAAACCCCAAAAACGTCAAACCCCAAAAACCCC
T7_00118_G01	CCACAAAAACCAAAACCGTCCCAAAAACCCCAACCC
T7_00119_G01	CCCAAAAAAAACCAAACGTCCCCACCCAAAAACCCC
T7_00120_G01	CCCACCCAAACCAAAAAGTCAAACCCCAAAACCCCA
T7_00121_G01	CCCACCCAAAAAAAAACGTCCAAACCCCAAAACCCC
T7_00122_G01	CCCAAAACCCAACCCCAGTCAAACCCCAAAAAAACC
T7_00123_G01	CCCAAAAAAAACCAACCGTCCCAAAACCCAAACCCC
T7_00124_G01	ACCCAAAACAAAAACCCGTCCAAAAAACCCCACCCC
T7_00125_G01	CCCAACCCAAAAAAAAAGTCAAAACCCCACCCACCC
T7_00126_G01	ACAAAACCCCAACAAAAGTCAACCAACCCCAACCCC
T7_00127_G01	CCAAAAAAACCCCAAACGTCCCCACCCAAACCCAAA
T7_00128_G01	CCCAAACCCACCCAAACGTCCCCAAAAAAAAAACCC
T7_00129_G01	AACCCACCCACCCCAAAGTCAACAAACCCAAAAACC
T7_00130_G01	ACCCAAAACCCCAACAAGTCAACCCAACCAAACCCA
T7_00131_G01	AACCCCACCCCAAAAAAGTCCCACCCAAAACCCAAA
T7_00132_G01	ACCCCAAAAAAAAAAACGTCCCCAAAACCCCACCCC
T7_00133_G01	CCAAAAACAAACCCCAAGTCAACCCCACCCAAACCA
T7_00134_G01	CCCAACCCAACCCCAAAGTCAAAACCCAAAAAACCC
T7_00135_G01	AAACCCCAAAAAAAACAGTCACCCACCACCCAACCC
T7_00136_G01	CCCAAAAACCCCACAAAGTCAACCAACCCCAAACCA
T7_00137_G01	AAACCCCAAACCCCAACGTCCCACCCCAAAAACAAA
T7_00138_G01	CCAAACCCCAAAAAAAAGTCACCACAACCCAACCCC
T7_00139_G01	CCCAAACCAAAAACCCAGTCAAAACAACCCAACCCC
T7_00140_G01	ACCCCACCCAAAACCCCGTCAAAACCAAAAAACCCA
T7_00141_G01	ACCCCAAAAAAAAACCCGTCCAACCCCAAAAACCCC
T7_00142_G01	CAAAAACCCAACCCAACGTCCCAACCAAAAAACCCC
T7_00143_G01	CCCAAACCCACCCCAAAGTCAAAAAAAACCAACCCC
T7_00144_G01	AACCCAAACCCAACCAAGTCAAAACCCCAAAACCCC
T7_00145_G01	AACCCCAAAAACCCCAAGTCAACCCCAAACCCCAAA
T7_00146_G01	CCCAACCCCAACCCAAAGTCAAACAAACAAAACCCC
T7_00147_G01	CCCAAAAAAAAACCCACGTCCCAACCCAAAAACCCC
T7_00148_G01	CCAAAAAACCCCAAACCGTCCACCCCAAACCCAAAA
T7_00149_G01	ACCCACCAAACCACCCAGTCACCAAAAAAACCCCAA
T7_00150_G01	CCCACCAAACCACCAAAGTCAAAACCCAAAACCCCA
T7_00151_G01	CCACCAACCCAAAAAACGTCCAAACCCAAAAACCCC
T7_00152_G01	CCCAAAAACCCCAACAAGTCAACCCCACCACAACAA
T7_00153_G01	CCACCCAAAAAAAAAAAGTCCACCCCACCAAACCCC
T7_00154_G01	AAAAAAACCCCACCCCAGTCCCCAAAAACCCCAAAC
T7_00155_G01	AAAAAAAAACCCCAAACGTCCCCAAACCCCAACCCC
T7_00156_G01	CCCAAAAAAACCCCAAAGTCAAACCCAAACCACCCC
T7_00157_G01	ACCCCAAAACCCCACCCGTCAAAAAACCCCAAAAAC
T7_00158_G01	AAAAAAACCCACCCCAAGTCAACCAAACCCCAACCC
T7_00159_G01	CCACCCAAAACCAAAAAGTCAAAACCCCACCCAACC
T7_00160_G01	ACCCCAACCCAAAAACCGTCCCACAAAAAACCCCAA
T7_00161_G01	CCCAAACAAAAAAAAACGTCCCCAACCCCACCCCAA
T7_00162_G01	ACCCAAACCCCAAAAACGTCCCAAAAAAACCCCACC
T7_00163_G01	CAACCAACCCAAAAAAAGTCAACCCCACCAAACCCC
T7_00164_G01	AACCCCAACCCCAACAAGTCAAAAACCCAAAACCCC
T7_00165_G01	CCAAAAACCCCAAAAACGTCCCCAAAAAACCCACCC
T7_00166_G01	CAAAAAACAACCCCACCGTCCAACCCAAAAAACCCC
T7_00167_G01	CAAAAAACCCCAAACCCGTCAAAAACCCCAAACCCC
T7_00168_G01	CCCAACCCCAAAAAACCGTCCCAAACCCAAAAAACC
T7_00169_G01	CCCAAACCCCACAAAAAGTCAACCCCAAAAAACCCC
T7_00170_G01	CCACCAAAAAAACACCCGTCCAAAACCCAAACCCCA
T7_00171_G01	CCCACCCAAAAAAAAAAGTCAACCCAAACCCCACCC
T7_00172_G01	CCCACAACCCCAAACCCGTCCAAAAAAAAAAACCCC
T7_00173_G01	AAACCACCCAAACCCAAGTCACCCCAAAACCCCAAA
T7_00174_G01	CCACAAAAAAACCCCAAGTCACCCCAACCCACCAAA
T7_00175_G01	ACCCCAAAAAAAAACCAGTCAAACCCCAACCACCCC
T7_00176_G01	CAACCCCAAAAAAAAAAGTCACCCCACCCAAACCCC
T7_00177_G01	CCCACCAACCCCACACCGTCCAAAAAAAAAAAACCC
T7_00178_G01	AAAAAACCAAAACCCCAGTCACCCCAACCAAACCCC
T7_00179_G01	AAAAAAAACCCAAACCCGTCCACCCAAAACCCACCC
T7_00180_G01	ACCCCAACCAAAAAACCGTCCCAAACCCACCCAAAA
T7_00181_G01	CAACCCAAAAAAAACCAGTCAACCCAACCCCAACCC
T7_00182_G01	CCACCCCAAAAACCAAAGTCACCCCAAAAAAACCCC
T7_00183_G01	CCAAAAAAAAACCCCAAGTCCCAAACCCCAAACCCC
T7_00184_G01	AAACCCCAAAACCCCAAGTCACCCACCCAAAACCAA
T7_00185_G01	CCACCCCAAAAAAAACCGTCAAAAACCCCAAACCCC
T7_00186_G01	CCCAAAAAAAAACCCCAGTCAAACCAACCCACCCCA
T7_00187_G01	AAAAAAACCCCACCACCGTCCACCCCAAAAACCCAA
T7_00188_G01	CCCACAAAACCCCAAAAGTCAAAACCCCAAACCCCA
T7_00189_G01	AAAAACCACCCAACCCCGTCAAACCCCAAAACCCAA
T7_00190_G01	AAAAAAAACCACCCAAAGTCACCCACCCCAAACCCC
T7_00191_G01	CCCAACCCCACCCCAAAGTCAAACCCCAAAAACAAA
T7_00192_G01	AAACCCCAAAAACCCAAGTCAAAACCCAACCCACCC
T7_00193_G01	AAAAACCAAAAAAACCCGTCCAACCCAACCCCACCC
T7_00194_G01	CCACCAAAAACCCCAAAGTCAAACCCCAAAAACCCC
T7_00195_G01	CCCAAAAAAAAACAACCGTCCCAACCCACCCAAACC
T7_00196_G01	CAAAAACCCAACCCCAAGTCAACCCCAAAAAACCCC
T7_00197_G01	CACCCCAACCCAAAACCGTCCCAAAAAAAAAACCCC
T7_00198_G01	CCAAAAAAAAACCCACCGTCCCACCCCAAAAAACCC
T7_00199_G01	ACCCAAAAAAACCAACCGTCCCAAAACCCCAAACCC
T7_00200_G01	AACCCACAAAAAAAACCGTCCCAAAACCCCAACCCC
T7_00201_G01	AAAAAAACCCCACCCCAGTCAACCCCAAAAACCCCA
T7_00202_G01	ACCCCAACAAAACCCCAGTCAAAACCCAAAAACCCC
T7_00203_G01	AAAAAAACCCAAACCAAGTCCCCACCCCAAAACCCC
T7_00204_G01	CCAACCCCAACCCCAAAGTCAAAAAAAACCCAACCC
T7_00205_G01	AAACCACACAACCCAAAGTCAAAACCCAACCCACCC
T7_00206_G01	CCCAACCCACCAACCCCGTCAACCACCAAAAAAAAA
T7_00207_G01	CCAAACCCAACCCAAACGTCACAAAACCCCACCAAA
T7_00208_G01	CCCAACAAACCCCAAACGTCCCAAACAAAAAACCCC
T7_00209_G01	CCAAAAAACCCAACCCCGTCACCCCAAAAAAACCCA
T7_00210_G01	CAACCAAAACCCCAACCGTCCAAACCCCAAAAAACC
T7_00211_G01	AAAACCCCAAAAAAAAAGTCACCCCACCCACCCACC
T7_00212_G01	CCAACACAAAACCCCAAGTCCCACCCAAAACCCAAA
T7_00213_G01	CAAACCCCAACCCAACCGTCCCAAAAAAAAAACCCC
T7_00214_G01	CCAAACCCCACCCCAAAGTCAAACCAACCCCAAAAA
T7_00215_G01	AAAAAAACCCCAAAAACGTCCAAACCCCACCCACCC
T7_00216_G01	ACCCCACCCCAAAAAACGTCCCCAAAAACCAAAACC
T7_00217_G01	CCCAACCCAAAAAAAAAGTCAACCCACCCAACCCCA
T7_00218_G01	CACCAAACAAACCCCAAGTCAACCAAAACCCAACCC
T7_00219_G01	CCCAAAAAAAAAACCCCGTCAACAACCCCAACCCCA
T7_00220_G01	ACCCCAAAACCCAAACCGTCCCAAAAACCCCAAAAC
T7_00221_G01	CCAAACAAAAACCCAAAGTCCCCAACCCAAAACCCC
T7_00222_G01	CCCAAAAAAAACACACCGTCCCAAACCCAAAACCCC
T7_00223_G01	AAAAAAACCCCAAAAAAGTCACCCCACCCCACCCCA
T7_00224_G01	AAAAACCCAACCCCAACGTCCCCAAAACCAAAACCC
T7_00225_G01	AACCAAAAACCCCAAACGTCCCCAAACCAAAACCCC
T7_00226_G01	CCCAAAAAAACCCAAACGTCCCACCCCAAAAAACCC
T7_00227_G01	CAACCCCAACCAAAAAAGTCCACCAAACCAAACCCC
T7_00228_G01	CCCACCCCAAAAAAAAAGTCACCAACCCCACCCAAA
T7_00229_G01	CCCAACCACCCCAAACCGTCCAAAAAAAAAAACCCC
T7_00230_G01	CCCAAACCCCAAAAACCGTCCCAAAAAAAACACCCC
T7_00231_G01	ACCCAAAAAAAAAAACCGTCCCACAACCCCAACCCC
T7_00232_G01	CAAAAAAAAAACAACCCGTCACCCAACCCCAACCCC
T7_00233_G01	CCCACCCAACCCCAAAAGTCAAAACCCCAAAAAACC
T7_00234_G01	AACCCCACCCCAAACCCGTCCACAAAAAAAAAACCC
T7_00235_G01	AAAAACCAACCCCACCCGTCAAAAAACCAACCCACC
T7_00236_G01	AAAACCCCACCCCAACCGTCCCAAAACCAAAAAACC
T7_00237_G01	CCCAACCCCAAAAAACCGTCCCAACCCAAAAACCAA
T7_00238_G01	ACCCAACCAAACCAAACGTCAAACCCAACCCCAAAC
T7_00239_G01	AAACCCACCCCAAAAAAGTCAAAACCACCCCAACCC
T7_00240_G01	CCCACCCACCCAAAAAAGTCAACCCAACCAAACCAA
T7_00241_G01	CCCAACCAAACCCCAAAGTCAACCCAAAAAAACCCC
T7_00242_G01	CCCACCCAACCCAAAAAGTCCAAACCCACAACCAAA
T7_00243_G01	CCCAAAAAAACCCAACCGTCACCCCAAAACCCAAAC
T7_00244_G01	CAACCCACCCCAAAAACGTCCCCAAACCCCAAAAAA
T7_00245_G01	AAAAAAAAAACCCCAACGTCCCCAAACCCACCCCAC
T7_00246_G01	ACCCCAAAAAAAAAAACGTCCCCAACCCCAAACCCC
T7_00247_G01	CCAAAACCCCACCCCAAGTCAAAACCCCAAAAAACC
T7_00248_G01	ACCAAACCCCACCCCAAGTCCCAAAAAAAAACCCCA
T7_00249_G01	CAAAAAAAAACCCAACCGTCCACCCCAACCCACCAA
T7_00250_G01	ACCCCAAACCCAAAAAAGTCCCAAAAAACCCCACCC
T7_00251_G01	AAAAAAACCCCAACCCCGTCAAAACCCCACCCCAAA
T7_00252_G01	ACCCACCCAAAACCCAAGTCACAAAACCCCAACCAA
T7_00253_G01	CAAACCCCAACCCCAAAGTCACCCAAAAAAAACCCC
T7_00254_G01	AAAAACCCCAAAACCCCGTCAAAACAACCCCAACCC
T7_00255_G01	CCAAAAAAAAAAACCCCGTCAACCCACCAACCACCC
T7_00256_G01	CCAAACCCAAACCCCAAGTCAAAAACCCAAAACCCC
T7_00257_G01	AAACCAAAAAAACACCCGTCCAACCCCACCCCAAAC
T7_00258_G01	CCAAAAAAAACCCAAAAGTCCCCACCCAAACCCACC
T7_00259_G01	AACCAAAACCCCAAACCGTCCAACCCCAAAAAACCC
T7_00260_G01	CCCAAAACCAAAACCAAGTCAAACCCCACCAAACCC
T7_00261_G01	CCCAAAAAAAAACCCCAGTCAAACCCACCAAACCCC
T7_00262_G01	ACCCCACCAAAAAACCCGTCAAAAACCCCAAAACCC
T7_00263_G01	CAAACCCCAACCCAAAAGTCAACCCCAAAAAACCCC
T7_00264_G01	CCCACCCCAAACCAAAAGTCAACCCAAAAAAACCCC
T7_00265_G01	AAAACCCCACCAAAACCGTCCCAACCCCACCAAAAA
T7_00266_G01	AAAACCCAAAACCCCAAGTCAACCCAAACCCCAACC
T7_00267_G01	CCAAACCCAAAACCCACGTCAAAAAAAACCCCACCC
T7_00268_G01	CCAAAAAACCCCAAACCGTCAAACCCAACCCAAACC
T7_00269_G01	CCCAAAAAAACCCCAAAGTCAACCCAAACCAACCCC
T7_00270_G01	AACCCCAAAAAACCCAAGTCACCCCACAAAAACCCC
T7_00271_G01	CCAAAACCCCACCCAACGTCCCCACCAAAAAACAAA
T7_00272_G01	CCCAACCAACCCAAAACGTCCCCAAAAAACCAAACC
T7_00273_G01	CCCAAAAAACAAAACCCGTCCAACCCAAAACCACCC
T7_00274_G01	CAAAAAAACCCACCCAAGTCAACCCAAAACCACCCC
T7_00275_G01	CCCACCAAACCCAACACGTCCCAAAAAAACCCCAAA
T7_00276_G01	AAACCCAAAACCCACCCGTCCAAAAAACCAAACCCC
T7_00277_G01	CCCAAAAAAAAACCCCAGTCCCCAAAACCAAACCCC
T7_00278_G01	ACCAACCCCACCCACCCGTCAAACCCCAAAAAAAAA
T7_00279_G01	ACCCCAACAAACAAAAAGTCACCCCACCCAAAACCC
T7_00280_G01	ACCCAAACCCAAAAACCGTCCAAAACCCCAAAACCC
T7_00281_G01	CCAAAACCCCAAAAACCGTCCACCCAAAACCCAAAC
T7_00282_G01	CAACCCCAACCCCAAAAGTCACCCCAAAAAAAACCC
T7_00283_G01	CCACAACCAAAAACCAAGTCACCACCCAAAAACCCC
T7_00284_G01	CCCAAAAACCCAACCCCGTCACCAAAAAAAAACCCC
T7_00285_G01	CCCAACCCAAAAAACCCGTCAAAAACCCAAAACCCC
T7_00286_G01	CCAAACCAAACCCCAAAGTCAAAACCCCACCCCAAA
T7_00287_G01	CACCCACCCCAACCCCAGTCAAAAACCCACAAAAAA
T7_00288_G01	CCCAAAAAAAACCCAAAGTCAACCCACCCCAAACCC
T7_00289_G01	CAAAAACCAAAACCCAAGTCCCCAAAAACCCCACCC
T7_00290_G01	CCCAAAAACCCAACCCAGTCAAAAACCCAAAACCCC
T7_00291_G01	ACCCCACCCAAAACCCCGTCAAAAAAAAAACCACCC
T7_00292_G01	CCACCCCAAAACCCAAAGTCCCCAAAAACCAAAACC
T7_00293_G01	ACCCCAAACCCCAAAAAGTCACCCCAAAAAAACCCC
T7_00294_G01	CCACCCCAAAAAAACCCGTCAAAACCCCAAAACCCA
T7_00295_G01	CAAACCCCACCCCAACCGTCCACCAACCAAAAAAAA
T7_00296_G01	CCCAAAACCAAAACCCAGTCACCCAACCCAAAAACC
T7_00297_G01	CCCAAACCCAAAACCCCGTCACCCCAACAACAAAAA
T7_00298_G01	CACCCCAAAACCCCAAAGTCCCCAAAAAAAAACCCC
T7_00299_G01	CCCAAAACCCCACCCCAGTCCAAACAAAAAAAACCC
T7_00300_G01	AAAAACCCCAAACCCCAGTCAACCCCAAAACCCCAA
T7_00301_G01	ACCCCAAAAAAAAACCAGTCAACCACCCCAAACCCC
T7_00302_G01	CCAAAAAACCAAACCCCGTCACCCCACCAAAAAACC
T7_00303_G01	CCAAAAAAAACCCCACCGTCCACCAAAAAACACCCC
T7_00304_G01	CCAAACCCAAAAAACCAGTCACCCCACCAAAAACCC
T7_00305_G01	AAACCCCACCCCAACCCGTCCAAAAACCCCAAAAAA
T7_00306_G01	ACCCAACCCACCCAAAAGTCAAAAAAACCCACACCC
T7_00307_G01	CCCAAAACCCAAAACCAGTCAACCCCAAAAAACCCC
T7_00308_G01	ACCCCAAACCCCAAAAAGTCAACCCCAAAAAACCCC
T7_00309_G01	CCAACCCAAAAAAAAAAGTCACCCCAACCACCCCAC
T7_00310_G01	AAACCCAAACCCCAACCGTCCCAAAAAAACAACCCC
T7_00311_G01	AAAAACCCCACCCCAACGTCCCCAAAAAAAAACCCC
T7_00312_G01	ACCCCAAAAAACCCCAAGTCACCCCAACCAAACCAA
T7_00313_G01	CCCAAACCCCAACCAAAGTCCCCACCCCAAAAAAAA
T7_00314_G01	CCACCCACCCCAAAAAAGTCACCCAAAAAAAACCCC
T7_00315_G01	AAACCCCAAACAAAAACGTCCCAAAACCCCAACCCC
T7_00316_G01	AAAACCCCACCCCACCCGTCCACCCCAAAAAAAAAA
T7_00317_G01	CCAAAAACCAAACCCCAGTCAAACCCAACCAAACCC
T7_00318_G01	AACCCCACCAACCCCAAGTCACAAAAACCCCAACAA
T7_00319_G01	ACCCCACCCAAAAACCCGTCCACCCAAAAAAAACCA
T7_00320_G01	ACCCCAAAAACAAACCCGTCACCCACAAAAAACCCC
T7_00321_G01	CCCACCCAAAAACCCAAGTCAAACAAAACCACCCCA
T7_00322_G01	AACCCCAACCAAACCCCGTCAAACCCACAAAAAACC
T7_00323_G01	CCCAAAAAAAAACCCACGTCCCAAACCCAAAACCCC
T7_00324_G01	CCCAAAAAAAAAACCCCGTCAAACCCACACCCAACC
T7_00325_G01	AAAAACCCCACCCACCCGTCAAAAACCAAAACCCCA
T7_00326_G01	AAAAACCAAAAACCCCAGTCAACCCACCCAAACCCC
T7_00327_G01	CAAAACCCAACCCCAAAGTCCAACCCCAAACCCAAA
T7_00328_G01	CCCAAAAACCACCCAAAGTCACCACCCCAAAAAACC
T7_00329_G01	CAACCAAAAAACCCAAAGTCAACCACCCACCCCAAC
T7_00330_G01	CCCAAACCCCAAACCCCGTCAAAAAAACAAAACCCC
T7_00331_G01	CCCAAACCCAAAAACCCGTCCAAAAAAAACCCCACC
T7_00332_G01	CAAAAACCCACCCCAAAGTCAAAAAACCCCAACCCC
T7_00333_G01	ACCCCAAAACCCCAACAGTCAAAACCCCAAAAACCC
T7_00334_G01	ACCCCAAAAAAAAACCCGTCCAACCCAAAACACCCC
T7_00335_G01	AAAACCCACCCAACCCAGTCACCCAAAAAAAACCCC
T7_00336_G01	CCCAAAAAAAACCCCAAGTCACCCCAAACCCCAAAC
T7_00337_G01	AAAAACCACCCCAAACCGTCCACCAACAAAAACCCC
T7_00338_G01	ACCCACCCCAAAAACCCGTCACCAAAAAAACCCCAA
T7_00339_G01	CCAAAAAACCCCAACCCGTCCACAACAACCAAAACC
T7_00340_G01	CCCAACAAAACCCCAACGTCCCACCCAAACCAAAAA
T7_00341_G01	CAAAACCCCACCCAACCGTCCCAAACCCCAAAAAAA
T7_00342_G01	ACAACCCCACCCCAACCGTCCAAAAAAAAAAACCCC
T7_00343_G01	CAAAAAACCCAACCCCAGTCAACCCCAAAAAACCCC
T7_00344_G01	ACCCACCCCAACCCCAAGTCAAAAAAAACCCCAAAC
T7_00345_G01	CCAAAAAAACCCCAAAAGTCACCCAAACCCCAACCC
T7_00346_G01	CCCACCCCAACCCCAAAGTCAAAAACAAAAAACCCC
T7_00347_G01	CCAAAACCAAACCCCAAGTCAAAACCCCAAAACCCC
T7_00348_G01	CCCAACCCCAAAAACCAGTCACCAAAAAACCAACCC
T7_00349_G01	AAAACCCACCCAACCCCGTCAAAACCCCAAAACCAA
T7_00350_G01	AAACCCCAAAAACCCCAGTCCCCAAACCAAAAACCC
T7_00351_G01	ACAAAAAAAAAACCCCAGTCAAACCCACCCCACCCC
T7_00352_G01	CCACCCCAACCCAAAAAGTCAAACAAAACCCCAACC
T7_00353_G01	ACCCCAAACCCCAAAAAGTCAAAAACCCAACCACCC
T7_00354_G01	CCAAAAAAAACCCAAACGTCCCCAAAAACCCCACCC
T7_00355_G01	CCCACCCAAAACACCAAGTCACCCAAAAAAAACCCC
T7_00356_G01	AAAAAAACCCCACCCAAGTCACCCAACCCAACCCAA
T7_00357_G01	CCAAAAAAACACCCAAAGTCACCCCACCCCAAAACC
T7_00358_G01	CAAAAAACCCCAAAAACGTCCCCAAAACCCCAACCC
T7_00359_G01	CCCAAAACCCCAAAACCGTCAAACCCAAAAAACCCC
T7_00360_G01	CAAAAACCCCAAACCAAGTCAAACCCCACCCCAAAC
T7_00361_G01	CACCAACCCAAAAAAACGTCCACCCCAAAACCCCAA
T7_00362_G01	CCCAAAAACCCCAAAAAGTCCCCAAAACCAAACCCC
T7_00363_G01	CCCACCCCAAAAAAAAAGTCACAAACCACCAACCCC
T7_00364_G01	CCAAAACCCCAAACCAAGTCAAAAAAACCCCACCCC
T7_00365_G01	ACCCACCCCAAAAAAAAGTCACCCCACAAAAACCCC
T7_00366_G01	CCCAACCCCACCCAAACGTCCAAAAAAAAAAACCCC
T7_00367_G01	CCCAAAAAACACCACCCGTCCAAACCCAAAAAACCC
T7_00368_G01	AAAAAACCCCAAACCCCGTCACCCCAAAAAAACCCC
T7_00369_G01	CAACCAAACCCCACCACGTCCCAAACCCCAAAAAAA
T7_00370_G01	AAAAAACCCCACCCCAAGTCACCCCAAAACCCAAAC
T7_00371_G01	CCCAAAAAACCCAACCCGTCAAAACCCAAAAACCCC
T7_00372_G01	CCCAAAACCCCAAACCCGTCCACCAAAAAAAAACCC
T7_00373_G01	AAAACCCAACCACCCCAGTCAAACCCCACCCAAAAA
T7_00374_G01	CCCAAACCAACCCCAAAGTCAAAACCCCAACCCAAA
T7_00375_G01	CCCACCCCACCAAAAAAGTCAAAAAACCCAAACCCC
T7_00376_G01	CAACACCACCCACCACCGTCCCAAAAAAAAAAACCC
T7_00377_G01	AAAAAAACCACCCCACCGTCCCAAACCCAAAACCCA
T7_00378_G01	CCCAAAAAAACACCCCAGTCACCCAAAACCCAAACC
T7_00379_G01	CCCAAACCACCCAAAAAGTCACCAAAAAACCCCACC
T7_00380_G01	CCCAAAAACCCAAAAAAGTCCCAACCCCAAAACCCC
T7_00381_G01	CCCACCCCAAACCCAAAGTCAAAAACCCCAAAAACC
T7_00382_G01	AAACCCAACCAAACCCCGTCACAAACCAAAAACCCC
T7_00383_G01	AACCCAAAACCCAAAACGTCCCCAACCCAAACCCAA
T7_00384_G01	CAAAACCCCAAAAAAACGTCCACCCCAAACAACCCC
T7_00385_G01	AAAACCCCAAAAACCCAGTCACCACCCCAACCCAAA
T7_00386_G01	CCAAACCCCACAAAACCGTCCCAACAAAAAAACCCC
T7_00387_G01	CACCAAAACCAAAAAAAGTCCCAACACCCCAACCCC
T7_00388_G01	CCAAAAAACCCACCCCAGTCAAAAAAAACCCCACCC
T7_00389_G01	CCAAAAAAACCAACCACGTCCCCACCAAAAAACCCC
T7_00390_G01	CCAAACCCCAACCCCAAGTCAAAAAAAAACCACCCC
T7_00391_G01	ACCCCAAACCACACCAAGTCAAAACCCAAAAACCCC
T7_00392_G01	CCCAAACCCCAAAAAAAGTCCCAAACCCACCCCAAA
T7_00393_G01	CCACCCCAAAACCCCAAGTCAAACCAAAACCCCAAA
T7_00394_G01	ACCCCACACAAAAACCCGTCAAAAACCAACACCCCA
T7_00395_G01	CCCAACCCCAAAAAAAAGTCCACCCCAAAAAACCCC
T7_00396_G01	AAACCAAACCCCACCCCGTCAAACCAAAAAAACCCC
T7_00397_G01	AACCCCACCAACCCAAAGTCAAACCCAAAAAACCCC
T7_00398_G01	CCCAAAAAACCCAAAAAGTCACCCACCCAAAACCCC
T7_00399_G01	CCAAACCACCAAACCACGTCCCCAAAAAACCCCAAA
T7_00400_G01	CCCACCCCAAAACCAACGTCCCCAAAAAAAAAACCC
T7_00401_G01	AAAACCAAACACAACCCGTCCAAAACCCCAAACCCC
T7_00402_G01	ACCCCAAAAAAACCCACGTCACCAAACCCCAACCAA
T7_00403_G01	ACCCAAAAACCACCCCAGTCCCAAACAAACCAAACC
T7_00404_G01	CCAAAAAAAAAAAACCCGTCCAACCCCACACACCCC
T7_00405_G01	CAAACAACAACCCAAAAGTCCCCAACCCCAACCCAA
T7_00406_G01	CAAAAACAAAACCCCAAGTCAACCAAACCCCACCCC
T7_00407_G01	ACCCAAAACAAAACCCAGTCCCCAAACCCAACAACC
T7_00408_G01	CCCAAAACACCACCAACGTCCAAAAAAACCCAACCC
T7_00409_G01	CCCACCACCCAAAAAACGTCCAACCCAAAACAAACC
T7_00410_G01	CACAACACAAAAAAACCGTCCCAACCCCAACAACCC
T7_00411_G01	ACAAACCCAAACAACCCGTCAAACCCACAAAACCCC
T7_00412_G01	CACCACACCCAACCAACGTCCAAAAAACCCCAAAAC
T7_00413_G01	CCAAAACAACCCAAAACGTCCAAAAAACCCCACCCC
T7_00414_G01	AACCAAAAAACACCCCAGTCAACCCAACACAACCCC
T7_00415_G01	CCACCACAAAAACCCCAGTCCCACAAAAACACCAAC
T7_00416_G01	CCAAAAACCACCCCAAAGTCACCCCAAACAACCCAA
T7_00417_G01	CCCAAAAAACAACCCAAGTCCCCAAACCCAAAACCC
T7_00418_G01	CCAAACAAAAAACCACCGTCCCAAACCCAACCCCAA
T7_00419_G01	CCACCACCCAACCAAAAGTCAAAAAACCACAACCCC
T7_00420_G01	AAACCACCCAAAACCCAGTCCACCCCAAAAAAACCC
T7_00421_G01	CCCAAAACCCAACCCCAGTCAAAAAAAAACCCCACC
T7_00422_G01	AACCACCAACCACCCAAGTCAACCACCACCAAACAA
T7_00423_G01	CCCACCCACCCCAAAAAGTCAACAAAAACCAACCCA
T7_00424_G01	AAAAACCACCACCAAACGTCCACCCAAACCCACCAA
T7_00425_G01	CCCAACACACAAAAAACGTCCCCACCCCAAAAAACC
T7_00426_G01	ACCCAAACAACCAACCCGTCCACCCAAAAAAAACCC
T7_00427_G01	CCCACCAACCAAACCCAGTCACAAACAACAAACACC
T7_00428_G01	AAAACAAACACCAACCAGTCACCAACCCACACCACC
T7_00429_G01	CCCAAACCACCCAAACAGTCAAACCCACAAAAACCC
T7_00430_G01	CCAAACCAACAAAAAACGTCAAACCACCCACCACCC
T7_00431_G01	CAAAAAAAAACAACAACGTCCCCACCACCCCAACCC
T7_00432_G01	ACCCCAAAAAACCCAACGTCCCACCAAACCAAAACC
T7_00433_G01	CCCAACAAAACCACCCAGTCAAAAAACCACCCAACC
T7_00434_G01	CACCCCAAACAAAAACCGTCAAACCAACCCCACCAA
T7_00435_G01	ACCCACCCAACAAAAAAGTCCCCAACCCAAAAACCC
T7_00436_G01	CCCAAAAACCACCAACAGTCAAAACCACCCAAACCC
T7_00437_G01	AACCCAACCCACAAAAAGTCAACCCAAAACCCACCC
T7_00438_G01	CACCACCCACAAACCACGTCACACCAAAAAACCAAC
T7_00439_G01	AAAAACCCAAAACCCACGTCCAACCCCACCAAAACC
T7_00440_G01	CAAAAAAACCACCCCAAGTCAAACACCCAACCCCAC
T7_00441_G01	CAACCCAAACAAAAAACGTCCAACCCCAACCCACCA
T7_00442_G01	CCAAAAACCCAAAACCCGTCCAACCACCCAACAACA
T7_00443_G01	AAAAAAAACAAAACCCCGTCACCACCCCACCACACC
T7_00444_G01	CCAAACCCAAACAAAAAGTCACCCAACCCCAAACCC
T7_00445_G01	CCAACAAAACACCCACCGTCCACCAAAAAAAACCCC
T7_00446_G01	AACCAAACCCAAACCCCGTCACCCCAAAAAACCCAA
T7_00447_G01	CCCAAACCCAAAACCCAGTCCAACCCCAAACCAAAA
T7_00448_G01	AAAAAACCCCAAAAACCGTCCCAACCCCAAACCCCA
T7_00449_G01	CCAACCCCACAAACAAAGTCCCCAACCAAACAAACC
T7_00450_G01	CCCACCCAAACCAAAAAGTCAAACAAACCCCAACCC
T7_00451_G01	AACCAAAACCCCAAAAAGTCCCACCCAACAAACCCC
T7_00452_G01	CAAAAACAACCCACCAAGTCACCCCAAAACAACCCC
T7_00453_G01	AAACCCCACCCCAACCCGTCAAAAACAACCCAAACA
T7_00454_G01	AACCCAAACCCCACCCCGTCAACAAAACCAAAAACC
T7_00455_G01	AACCCCACAAAAAAACAGTCCCCACCCAAAACCCCA
T7_00456_G01	AACCCACAACCCAAAAAGTCAACCCACCACCAAACC
T7_00457_G01	CCCAAAAAAACCCCACCGTCACAAACAAAACCCCAC
T7_00458_G01	ACCCCAAAACCCAAAAAGTCAAAACCCCAACACCCC
T7_00459_G01	CCAAAAACCCCAACCCAGTCCCAAACAAAAAACCCC
T7_00460_G01	CCCAAACCCACCAAACCGTCCAACCCAAAACAAAAC
T7_00461_G01	CAAACCCACCAACCCCAGTCAACCAACACAAAACCA
T7_00462_G01	ACCCCACCCCACCCCAAGTCAAAAAAAAAACCCAAC
T7_00463_G01	CAAACCCCAAACCCAAAGTCCCCAAAAACCACCCAA
T7_00464_G01	AAACCACCCAAAAAAACGTCAAACCCACCCCAACCC
T7_00465_G01	ACCCAACAAACCAACCAGTCCCCAAACACAAACCCA
T7_00466_G01	AACCAAAAAAAACCCCAGTCCAAACCCCAACCCACC
T7_00467_G01	CCCAAAAAAAAAAACCCGTCAACCACCCACCCACCA
T7_00468_G01	CCCAACCCAAACCACCCGTCCAAAACCACACAAAAA
T7_00469_G01	CAAAACCCCAACCAACCGTCACCAAAACCCAAAACC
T7_00470_G01	ACACCCCACCCCAAAAAGTCAACCCAAAAAAACCCC
T7_00471_G01	CCACAAAACAACCAACCGTCAAAAACCCCAACACCC
T7_00472_G01	AAACAACCAAACCCCAAGTCCAAAACCCCACAACCC
T7_00473_G01	ACCCAAACCCCAACCCCGTCAAAAAACAACCCCAAA
T7_00474_G01	AAACCCCAAACCAAAACGTCCAACCAACCAAACCCC
T7_00475_G01	AAAAAACCCCAACCCCAGTCACCCCAAACAAACCCA
T7_00476_G01	CACCCCACCCACCCAAAGTCACAAAAACCCCAAAAA
T7_00477_G01	ACCAAAACCCACCAACCGTCCCAACAAAACAACCAC
T7_00478_G01	CCCAACCCACCCCAAAAGTCAAACCAAAAAACCACC
T7_00479_G01	AACCCAAACCCCAAAAAGTCAACAACCCACCAACCC
T7_00480_G01	AAAAACCCAAAACCAAAGTCACCCAAACCCCACCCC
T7_00481_G01	CCCAAAAACCCCAAAAAGTCCCCACAAACAACCCCA
T7_00482_G01	CCCACCCCAAAAAAAACGTCACAACCCAAACCCCAA
T7_00483_G01	AAACCCCACCCAACCACGTCCCCAAAAAAAACCCAA
T7_00484_G01	CCCACACCCCAAAAAAAGTCCAAAACCAAACCCACC
T7_00485_G01	AACCCACCCACCAACCCGTCAAAAAAAAAACACCCC
T7_00486_G01	CAAACCCAACCACAACCGTCAAAAAACCCCACCCAA
T7_00487_G01	AAAAAAAACCCCACCACGTCACACCAAACCAACCCC
T7_00488_G01	AAACCACCCACCCCAAAGTCAACCCCAAAACCCAAA
T7_00489_G01	CACACCCAAACCCAAAAGTCCACCACCAACAACAAC
T7_00490_G01	ACCCACCACCACCCAAAGTCCCCACAAAACCAAAAA
T7_00491_G01	CCAACACCAAACCAACAGTCACCCACCCCAAAAAAC
T7_00492_G01	CCCACCCCAAAAAACACGTCCCAAACCACAAACCAA
T7_00493_G01	ACCAAAAACCCAAACCAGTCACCCCAACCAAAACCC
T7_00494_G01	ACCCCAAAAACCCAAAAGTCAACAAACCCCAACCCC
T7_00495_G01	CAACCAAAACCCAAAACGTCCACCCAAAAACCACCC
T7_00496_G01	CCAAACCCAAAAACCCAGTCACCACAAACACCCAAC
T7_00497_G01	CCAAAACCCCACCAACAGTCAACCCAAAACCCCAAA
T7_00498_G01	AACCAACCCCAAACAACGTCCCCAAAACCACCAAAC
T7_00499_G01	CACCCAAAAAACCAAAAGTCCACCCACCCCAAAACC
T7_00500_G01	AAACAAACAACCAACAAGTCACCCACCCCAAACCCC
T7_00501_G01	CCAAAAACCCAAACAACGTCCCAAAAACACCACCCC
T7_00502_G01	AACCACCACACCCCAAAGTCCCCAACACAACCAAAA
T7_00503_G01	ACCAAACCAAACCCCACGTCCAACCAAAAACCAACC
T7_00504_G01	CAACCCACCCAACCACCGTCCCAAAAACCCAAAAAA
T7_00505_G01	CCCAAAAAACCCACCAAGTCAAAACCAACCCCAACC
T7_00506_G01	AACCCAAAAAACCCACCGTCCCACAAACCCAAAACC
T7_00507_G01	CACAACCCAAAAACCAAGTCCCAACCCAACCAACCA
T7_00508_G01	CCAACCCCAAAAAACCCGTCCACAACCACCAACAAA
T7_00509_G01	CCCAAACCAAACCCAACGTCAAAACCCAAAACCCCA
T7_00510_G01	CCCACCAAAACCCCAAAGTCACCAAACCCAAACACA
T7_00511_G01	AAACCCCAACACCCCACGTCCCCAAAAAACCACAAA
T7_00512_G01	ACCCCAAACCACCAACAGTCCCCACAAAAAACCCAA
T7_00513_G01	CAAAACCCCAAACCACCGTCCCAAACCCCAAAAAAC
T7_00514_G01	ACCCCACCAAAAAAACCGTCCACCCAAAAAAACCCC
T7_00515_G01	ACAACCCCAAACCCAACGTCCCCAAAACCCAAACAA
T7_00516_G01	CCCAACAAACCCACCCAGTCAAAACCCCAAAACACA
T7_00517_G01	ACCACAAAAACCCCACCGTCCCAAAAAAACCCCACA
T7_00518_G01	ACCCAAACCCCAACCAAGTCCCACCAAAAAAAACCC
T7_00519_G01	CCAACCCACCCAAAACCGTCCCAAACAAAACACACA
T7_00520_G01	CCAAAAAAAACCCACAAGTCCCCACAAACACCCACC
T7_00521_G01	ACACCCCAAAAAAACCAGTCCCACCACCACAACCAA
T7_00522_G01	CCACCCAAAAAAAACCCGTCACCACCACCACAAAAC
T7_00523_G01	CACCACCCCAACCCCAAGTCAACACCAAAAAACCAA
T7_00524_G01	CCCAAAAACCCCAACCCGTCAACCCAAAAAAAACCC
T7_00525_G01	AAAAAAACCCCACCCCAGTCACCCCAAACCAACCAA
T7_00526_G01	AAAACACACCCACCCAAGTCAAACCCACAAACACCC
T7_00527_G01	ACAAACCCCAACCCAAAGTCACCCAAACCCCAAAAC
T7_00528_G01	CACCCCACCCAACACCAGTCAAAAAACCCCACAAAA
T7_00529_G01	AACAAACCCAACCCACCGTCCCACAAAAAAACCACC
T7_00530_G01	ACAACCCAAAAACCCAAGTCAACCAACCCCAAACCC
T7_00531_G01	ACCCAACAACCAACCCAGTCACCCCAAAACAAAACC
T7_00532_G01	CCAACCCCAAAACCACCGTCCCAAAACCCAAAAAAC
T7_00533_G01	CCCAACCCCACCCCAAAGTCCCACAAAAAACCAAAA
T7_00534_G01	CACAAAACCCAAACCCAGTCCAAAACCAACAACCCC
T7_00535_G01	CCCAAAAACCCAAAACAGTCACCCAACCAAACCCCA
T7_00536_G01	AAACCACCAACACCCCAGTCAAACCCCACCCAAAAA
T7_00537_G01	AAAAACCCACCAACAAAGTCACCCCAACCCAAACCC
T7_00538_G01	CCCAACCCACAACAACCGTCACCCAAAAAACCAACA
T7_00539_G01	AAAAAACCCCAACCCACGTCAACAAACCAACCCCAC
T7_00540_G01	CCACCCCAAACCCCACAGTCAAACCAAAAAAACCCA
T7_00541_G01	CCCAAAAAACCCCAAAAGTCCCCACCAACCCCAAAA
T7_00542_G01	AAAACCCCAACCCAAACGTCCCAAACACCCAAAACC
T7_00543_G01	ACCCAAAAAACACCCCAGTCCACCAACCAACCAAAC
T7_00544_G01	AAACCCCACAACCCAACGTCCCCAAAAAAACCCCAA
T7_00545_G01	ACCCAACCCAAAAAACCGTCCCAAAAAACCCCAACC
T7_00546_G01	CCCAAACCACCCAAAAAGTCAAAACCCCACAACCCA
T7_00547_G01	ACAACCCCACAACCACAGTCAACCCCAAAAAACACC
T7_00548_G01	CCAACCAAAAAAACCAAGTCACCCAAAACCCACCCC
T7_00549_G01	ACCCCAACAACCCCAAAGTCAAACCACACAAACCCA
T7_00550_G01	CCAACCCCACCAAAAACGTCCAAAACACCAAAACCC
T7_00551_G01	CAAAACCCCAAAAAAAAGTCACCCAACCCACCCACC
T7_00552_G01	CCAAAAAAACCCCAACCGTCAAACCCACCCCACAAA
T7_00553_G01	ACCCCAAAAAACCCACCGTCCCAAAAACCCAAAACC
T7_00554_G01	ACCCAACCCCAAAAAAAGTCCCCACAACAAAACCCC
T7_00555_G01	CAACACCAACCAAACCCGTCCAAAAACCCACCCAAA
T7_00556_G01	AAAACCCAACCACCAAAGTCAAACACACCCCAACCC
T7_00557_G01	CACCCCACCAACCCAAAGTCAAAAAAAACCAACCCC
T7_00558_G01	CCCAAACCCCAAAACACGTCCCCAAACAACCCAAAA
T7_00559_G01	AACCAACCCACCCCAAAGTCAAACCCCAAAACCCAA
T7_00560_G01	AAACAACCCACCCAAAAGTCACACCACCCAAACCCA
T7_00561_G01	CAAACCCCACAAACCCAGTCAAAAAACCCAAACCCC
T7_00562_G01	CCCAAACCAAAAAACAAGTCCCAAACCCCACCAACC
T7_00563_G01	AACCCCACCCAAAACCCGTCACCAACAAAACCCAAA
T7_00564_G01	CCCAAAAACCCACACCCGTCACCCCAAACAAAACAA
T7_00565_G01	CACCCCACACCCACCCAGTCACCAACACAAAAAAAA
T7_00566_G01	CCAAACAAACCCCAAAAGTCACCAACCACACAACCC
T7_00567_G01	CACCCCACCAAACCAACGTCAACCCCAAAAAAAACC
T7_00568_G01	AAACCCCAAAACAACCAGTCAAACACCCACCAACCC
T7_00569_G01	CACAAACCCAAAAAAAAGTCCCAACCCCACCCCAAC
T7_00570_G01	CCAAACCCCAAACACACGTCAAAACCCAAAAACCCC
T7_00571_G01	AACCCCAAAAACACCCAGTCACACAAAAACCCCACC
T7_00572_G01	ACCCAAACACCCAAACCGTCAAAACCCAAAACCACC
T7_00573_G01	CAAAAAAACCAACCAACGTCACCCAACCCCACCCAA
T7_00574_G01	ACCCAAAAAAAACCCCAGTCAACCCAAACCCACCCA
T7_00575_G01	AAAAAACCCACCCCAACGTCCCAAAACCCAAAACCC
T7_00576_G01	CCCACCCCAAAACCAAAGTCAACCAACCCACAAAAC
T7_00577_G01	CCAAAAAAACCCAAACCGTCCAAACCCACCACCCAA
T7_00578_G01	CACAAAAAACCCCAACCGTCCCACCCCAAACCAAAA
T7_00579_G01	CCCAAAAAAAACCACCAGTCCCCAAACCCAAAACCC
T7_00580_G01	AACCCAAAAAAACCCAAGTCACCCAAACACCCACCC
T7_00581_G01	AAACCCCAAACAAAACCGTCAAACCAACCCCACCCA
T7_00582_G01	AACCAAACAAACCCAACGTCCCCAAACAAACCACCC
T7_00583_G01	CCCAACCCACCACCCCAGTCAAAAAACCAAAAAACC
T7_00584_G01	CCACACCCCAAAAAACAGTCCCCACCCCAAAAAAAC
T7_00585_G01	AACCAAAAACCCCACACGTCCCAACCCAAAACCCAA
T7_00586_G01	AAAAAACCCAACCCCACGTCACCCCAAAACCCCAAA
T7_00587_G01	AACCAAAAAAAAAACCCGTCAAACCCACCCCACCCC
T7_00588_G01	ACCACCAAAAAACAACCGTCCCAACACCCCACCAAA
T7_00589_G01	CCCAAAAAAAAAACACCGTCCCACCACCCCACCAAA
T7_00590_G01	CCACAACCCCAAAAAAAGTCAACACAAACCCCACCC
T7_00591_G01	CCAAACAAAACAACAACGTCAACCCCACCCAAACCC
T7_00592_G01	CCCAAAAACCCAAAAAAGTCACCCCAAACCCAACCC
T7_00593_G01	AACCCCAAAAAACCAAAGTCCCACCCCAAACCACAC
T7_00594_G01	CCCAAAACAAAACCACCGTCAAACCAACCCAAACCC
T7_00595_G01	AAAACCACCCCAAAAACGTCCCCAAACCCAAACCAC
T7_00596_G01	CCACCAAAAAAAACAACGTCCCAAACCCCAACCCCA
T7_00597_G01	CAACAAACCCCACAACCGTCCAAAACACAACCCCAA
T7_00598_G01	CCCACCCCAACCAACCCGTCCAAAAAAAAACAAACC
T7_00599_G01	AAACCACCCCACAAAAAGTCAACCAAACCCCAACCC
T7_00600_G01	CCCAAAACCCCAAAAAAGTCAACCCACCCACCACAA
T7_00601_G01	CCAAAAAACCAAACCCCGTCAAAAACCCCAAACCCC
T7_00602_G01	AACCAACCCCACACCAAGTCAAAAAAAACCCCACCC
T7_00603_G01	CACACAACAAAACAAACGTCACCCCACACAACCACC
T7_00604_G01	AAAAAACCACCCCACCCGTCCAAACCCAAACCAAAC
T7_00605_G01	CCACCCCAAAAAAACCAGTCCCAACACCAAACAACC
T7_00606_G01	CCCAACAAACCCAAACCGTCACCCAAAACCCCAAAA
T7_00607_G01	ACCAACCACCCAACCCAGTCAAACAACCAAACACCA
T7_00608_G01	CAAAAAAAAAACAACCCGTCAACCACCCACCCACCC
T7_00609_G01	ACCACCCCAAACACCCAGTCAACAAACCCCAAAAAC
T7_00610_G01	AAAAAAACCCAAAACACGTCCCACCCCAAACCCCAC
T7_00611_G01	CCCAAACAACCAAACCAGTCAAAAACCACCAACCCC
T7_00612_G01	AAACCACCCACCCCAAAGTCACAAAAACCACAACCC
T7_00613_G01	ACCCCAAAAAAAACACAGTCACCCCACACCCCAACA
T7_00614_G01	AACCACCACCACCCAAAGTCCCCAAACCCCAAAAAA
T7_00615_G01	ACCCACCCCAACCCAACGTCAAAACAAAACCCAAAC
T7_00616_G01	ACCAACCCACACAACCCGTCAAAAACCAAAAACCCC
T7_00617_G01	CCCAAAACCAACCCACCGTCCCAAACCCCAAAAAAA
T7_00618_G01	CAAAAAACCAAACCCCAGTCAACCCAACCACCCCAA
T7_00619_G01	AACCCCAAAACCAACCCGTCACCCAAAAAAAACCCC
T7_00620_G01	CCACCAAACCCACACCCGTCAAAAACCCCAAAAAAC
T7_00621_G01	ACAACCACCCAAACACCGTCCAACCACCCAAAAAAC
T7_00622_G01	AACACAACCCCAACCCCGTCAAAAAACCCCAAACCA
T7_00623_G01	AAAAAAAACCCCAAACCGTCCCAACCCCAACCCCAA
T7_00624_G01	CACCCAAACAAACCCCAGTCAAAAACCCAAAACCCC
T7_00625_G01	CCCACCACAAAAAACCAGTCCAAAAACCCAAACCCC
T7_00626_G01	CCAAAAAAACCACCAACGTCCCCACACCACCAAACA
T7_00627_G01	AAAACCCAAAACACAAAGTCCCCAAACCCACCCACC
T7_00628_G01	CCCAAAAAAAACCCACCGTCCCAAAACACCCCAAAC
T7_00629_G01	AAAACCACCCACAAACCGTCACCAAACCCCACCAAA
T7_00630_G01	ACCCCACACCCCAAAAAGTCAAACCCAAACCCAAAC
T7_00631_G01	CAAACCCCACCCACCAAGTCAAACCAAAAACCAACC
T7_00632_G01	AAAAAACCCCACCCAAAGTCACCCCAACCACAACCA
T7_00633_G01	ACCCAAAACACAAACCCGTCAAAAACCCCAAACCCC
T7_00634_G01	ACCCCACCACCAAAAACGTCCAAAAAAAACCCCACC
T7_00635_G01	ACCCCAAACCCCAAAACGTCCAAACCAAACACCCAA
T7_00636_G01	CCAAAACCCCAACCAACGTCCCAAACCAACAACACA
T7_00637_G01	CAACCCACAAAACCCACGTCCAAACCAACCCCAAAA
T7_00638_G01	ACCCAAAACCAAAAACCGTCCAAACCCACACCCCAA
T7_00639_G01	CCCAAAACCAAAACCCAGTCCAACCCAACACACCAA
T7_00640_G01	ACAACACCAAAAACAACGTCAACCCCACCCACCAAC
T7_00641_G01	CCCAAACAAAAACCCCAGTCACCACCACCACAACAA
T7_00642_G01	CAAAAAAACCACCAAACGTCAACCCCACCAAACCCC
T7_00643_G01	CCACCCCACAAAAAAAAGTCCCCACCCACCCAAAAA
T7_00644_G01	CACCAACCCACAAAACCGTCCCAAACCAACCCAAAA
T7_00645_G01	AAAACCCCACCAAACCAGTCACCCACCCCAAAAAAC
T7_00646_G01	ACCCCAAAACCCACCCAGTCAAAAACAACCCCAAAC
T7_00647_G01	AACAACCCACCCCACCAGTCACCAACAAAAAAACCC
T7_00648_G01	CCCAAACCCCACCCACAGTCCACCAAACCAAAAAAA
T7_00649_G01	CAACACACCCAAAAAAAGTCAACCCCAAACCCCACC
T7_00650_G01	CCACCAAAAAAAAAACCGTCCCACCCACAAAACCCC
T7_00651_G01	CCACCACCCCAACCAAAGTCAACACCAAAAAACCCA
T7_00652_G01	CCACCCCAAAAACCCACGTCCAACAAAAACCCAAAC
T7_00653_G01	CCCACCAAACCCCAACCGTCAAAAAAACCCCAAAAC
T7_00654_G01	AACCCCAACCCACCCAAGTCCCCAAACCCAAAAAAA
T7_00655_G01	CCAAAAAACACCCACCAGTCAAAACCACAACCACCC
T7_00656_G01	AACCCCAAACCAACCCCGTCACCCCAAAAAAACCAA
T7_00657_G01	CCAAAACAAAAACCAACGTCCCCAAACACCCAACCC
T7_00658_G01	CCCAAAAAACCCAACCCGTCAAAAACCCCAAACCAC
T7_00659_G01	CCAAACCCAACACCCCAGTCAAAAAACCCCAAACCA
T7_00660_G01	CCACCCCAAAAAAAACCGTCACAACCAACCAAACCC
T7_00661_G01	ACCCCAACCAACCACCCGTCCAAAACACACCAAAAA
T7_00662_G01	ACCCAAAAACCCAAACAGTCAACCACCAACACCCAC
T7_00663_G01	ACCAACACCCACCAAAAGTCAACCCCAAACCCCAAA
T7_00664_G01	CACCAAAACACCCCAAAGTCAAACCCCACCACCAAA
T7_00665_G01	AAAAAACCCACAACCCCGTCACCCAACCCCAAAAAC
T7_00666_G01	AAACCCCAAACCACCAAGTCCAACCCCAAAAAACCC
T7_00667_G01	AAACCCACACCCACCCCGTCACAAAAAACCAACAAC
T7_00668_G01	AAAACAACCCCACAAAAGTCAAAACCCCACCCCACC
T7_00669_G01	AAACCAAAAACCCCAAAGTCAAAACCACCCCACCCC
T7_00670_G01	CAACCCACACCCAAAACGTCCACAACCAAAAAACCC
T7_00671_G01	ACCCAAAAAAAAACCCCGTCAACCCCAAACCCCACA
T7_00672_G01	CCAAACCCCAAAACCCCGTCAAAAACACCAAACCCA
T7_00673_G01	CCCAAACCAAACCACCCGTCCACAAAACCACCAAAA
T7_00674_G01	CCACCCCACCCCAAAAAGTCAAAAAACCCAAACCCA
T7_00675_G01	ACAACCCAAAAACACACGTCCCACACCCCAAAACAC
T7_00676_G01	CCACAAAAAACCCCAAAGTCCAACCCAAACCAACCC
T7_00677_G01	CCCACCAAAACCACCACGTCCCCAAAAAAACCACAA
T7_00678_G01	ACCACACAAAAAAAAAAGTCCCCAACCCACCACCCC
T7_00679_G01	CCCAAAAACCAAACCCCGTCAAAAAAACCCACCCCA
T7_00680_G01	CAACCCCAACCACAACAGTCAAAAAACCCACCACCA
T7_00681_G01	CCCACCAACCAACCAAAGTCAACCCCAAACCACAAA
T7_00682_G01	CACAACCCCACCACCCAGTCAACCCACAAAAAAAAC
T7_00683_G01	CACCCAAAACCAACCCCGTCAAACCAAAACAAACCC
T7_00684_G01	CCCACCCAAAACCACCCGTCACCCCAAAAAACAAAA
T7_00685_G01	CCCAACCAAAAACAAACGTCCCCACAAAACCACACC
T7_00686_G01	CAAACCAAAACCAAAACGTCCCACCAACAACCCACC
T7_00687_G01	CCCAAAACCCCAAAAAAGTCACCCCACCCCAAAAAC
T7_00688_G01	AAACCCACAACCAACCCGTCACCCACAACCCAAAAA
T7_00689_G01	CCCACCAAAACCCAACAGTCAACCAAAAACCCAACC
T7_00690_G01	CCAAAACCCCACCCACCGTCACAAACCAACAACAAA
T7_00691_G01	ACCCCAAACCCCACCCCGTCAACCCCAAAAAAAAAA
T7_00692_G01	CAACCAACCCAAACACAGTCCACAAAAACCAACCCC
T7_00693_G01	ACAACCCACCACCCCAAGTCACAAAAACCCCAAAAC
T7_00694_G01	CACCCCAACAAACCCAAGTCAAAACCACCCACCAAA
T7_00695_G01	AAAAACCCCACCAAAACGTCCCAAACCCCAAAACCC
T7_00696_G01	CCCAAAAAACCAACAACGTCCCACACCCCAAACAAC
T7_00697_G01	CAACAAAACAACCCACAGTCACCCCAAAACCCAACC
T7_00698_G01	CCACCCAAAAAAACCCCGTCCAACACCCAACCAAAA
T7_00699_G01	CAAACCCAAAACCCCAAGTCCCCACCAAAAAAACCC
T7_00700_G01	AACAAAAACCCCAAAAAGTCACCACCCCAACCACCC
T7_00701_G01	CAACCCACAAAACACCAGTCACCACAACCCCAAAAC
T7_00702_G01	CAACACCACCCACAAAAGTCAAACCAACCACCAACC
T7_00703_G01	CCACCACACCCCAAAAAGTCCAAAAAACCCAAACCC
T7_00704_G01	ACCCACCACCACCCAAAGTCAAAAACCCCACCAAAA
T7_00705_G01	CCACCCACCAAAAAAAAGTCACACCCCACCACCAAA
T7_00706_G01	CCAAAAAACCCAACAAAGTCAAAACCCCACCCACCC
T7_00707_G01	CCACCAACAAAACCCCAGTCCCCAACCCCAAAAAAA
T7_00708_G01	ACCAACCACAAAACCAAGTCACCCCACACCCCAAAA
T7_00709_G01	CCAACCCAAACCCAACCGTCCAAAAACCCAAACCAA
T7_00710_G01	CCCAAACCAACCAAAAAGTCACCCAACCAAACCACC
T7_00711_G01	CCAAACAAAACCCCAACGTCCCACCCACACCAAAAA
T7_00712_G01	ACAACAACCAAAACCCCGTCAAAACCCCAACCCCAA
T7_00713_G01	CAAAAAAACCCACCCCAGTCCCACCCAAAAAACCAC
T7_00714_G01	CCAACCACCAAAAAACCGTCCAAAACCCAACCCAAC
T7_00715_G01	ACCACCACCCAAAACCAGTCACCCAAAAAAAACCCC
T7_00716_G01	ACCCAACCCCAAAAACCGTCCCAAACACCCAAAAAC
T7_00717_G01	CCCAACACCCAAACAACGTCCAAAACCAACAAACCC
T7_00718_G01	ACACCACCCCAAACACAGTCAACAACCCAACCCAAA
T7_00719_G01	CCAAACCCCAAAAACCCGTCAAACCCCAAACCCAAA
T7_00720_G01	CCAACCCCAACCCACCCGTCAAAACCAAAAAAACCA
T7_00721_G01	CCAAAAACACAAACCCCGTCACCCCAACCCAACAAA
T7_00722_G01	AAAAAACACCCCACCCAGTCACACCCCAACCCAAAA
T7_00723_G01	CAAACAAACCCCACACCGTCCAACCACAAAAAACCC
T7_00724_G01	CACCCAACAAAAAACCCGTCCACAAACCAACAACCC
T7_00725_G01	CCCAACCCACCCCACAAGTCACCAAAAAAACCCAAA
T7_00726_G01	AACAAACCCCAAACCACGTCCAACCAAAAACACCCC
T7_00727_G01	AACCCCAAAACAACCCCGTCAAAAAACCCAAACCCC
T7_00728_G01	CCCACAACCCCAACCAAGTCAAAACACCAAACAACC
T7_00729_G01	CACAAACCAAAACCCCAGTCCCAAACCCAACCAACA
T7_00730_G01	ACCCCAACCCCACAAACGTCCAAACCCAAAACCAAA
T7_00731_G01	ACCAACCAACACCCAAAGTCAAAAACACCCAACCCC
T7_00732_G01	CCACACCCCAAAAACCCGTCAACCAAAAAACCCACA
T7_00733_G01	AAAAAACCAAAACCCAAGTCACCCAACCCCAACCCC
T7_00734_G01	CACCCAACACAACACAAGTCAACCCAACCCCAAAAC
T7_00735_G01	AAACCAAAACAACCCCAGTCAAAAACCCACCACCCC
T7_00736_G01	AACCCAACCCAAAAACCGTCCACAACACAAACCACC
T7_00737_G01	CCCAAACCAAACCCCAAGTCAAAAAAACCACCCCAC
T7_00738_G01	CCCACCCCAAAACCCACGTCCAAAAAAAAACCCAAC
T7_00739_G01	ACCCAACACACCAACCAGTCAACAACAAAACCCCAC
T7_00740_G01	CCACCCAAAAAACCCAAGTCCAAACCCACCACCAAA
T7_00741_G01	AACCCACAAAAAAAACCGTCCCAACCCCAAAACCCC
T7_00742_G01	AAAACAACCCCAACCCCGTCAACCCCAAAAAACCCA
T7_00743_G01	CCAACCCCAAAAACCCAGTCCCCAAAAACAACCCAA
T7_00744_G01	CCCAAAAACAAAAACCCGTCACACCCCAACCCAAAC
T7_00745_G01	CACCCCAAAACCAAAAAGTCACCCCACCAACCCAAA
T7_00746_G01	CCCAACCCCAACAAAACGTCCAAAAAACCAAACCCC
T7_00747_G01	CAAACCCCAAAAAAAAAGTCCCAACCAACCCCACCC
T7_00748_G01	CACCCCAAAAAACAAAAGTCCCCACCCAAAACCCCA
T7_00749_G01	CACCCACCCAACCCCAAGTCCAAACCAAAACACAAA
T7_00750_G01	CCAAACCAACCCAACCAGTCACCCACAAAAACCCAA
T7_00751_G01	CCCAAAAAAAACCCCAAGTCAACACACCACAACCCC
T7_00752_G01	AACAAAAAAAACCCCAAGTCCACACCCACCCCACCA
T7_00753_G01	ACCCAAAACCCCACAACGTCCCAAAAACCAAAACCC
T7_00754_G01	CCCAAAACCCACAAAAAGTCAAACCCACACCACCCA
T7_00755_G01	AACCCAACCACACAACAGTCAACAAAACCCCACCCA
T7_00756_G01	CACAACCCAAACCAAAAGTCAACCCAACCACAACCC
T7_00757_G01	CACCAAAACCCAAAACCGTCACCACCACCAAAAACC
T7_00758_G01	ACCCAACCAACCAAAACGTCCCAAAAAACCAACCCC
T7_00759_G01	ACACCCAAAAACCCCACGTCAAAACCAACACCCAAC
T7_00760_G01	CCCAAAAAAAACACACCGTCACCCAAAAACCCCACC
T7_00761_G01	CCAAACCCAAACCAAACGTCCAAAACAACCCCAACC
T7_00762_G01	CAAACCACCAAAAAAACGTCCCAACCCCAAAACCCC
T7_00763_G01	CACCACCCCAACAAAAAGTCAAAAAACCCCAACCCC
T7_00764_G01	CCCAAAAACAACCCCACGTCAACCAAACCACCCAAA
T7_00765_G01	CCACCCACCCCAAAAAAGTCAAAAAAACCCCAACCC
T7_00766_G01	CCCAAACACACAACCACGTCCACCAACCAAAAAACC
T7_00767_G01	AAAAACAACCACCAACCGTCCACCCAACCAAACCCA
T7_00768_G01	AACCCCACCCAAAAAAAGTCCCCAAACCCACCCAAA
T7_00769_G01	CCCAAAACCCCAAAAACGTCAAAACCCAAACCACCC
T7_00770_G01	CCAACCCCAAAAAAAACGTCCCCAAACCCAAACCCA
T7_00771_G01	CAAAAAACCAAAAACCCGTCACCCAACCCCACCACA
T7_00772_G01	ACCAAACCAAACCCAAAGTCACCCACACCACACAAC
T7_00773_G01	CCACCCCAAAAAAAACCGTCCCAACCACAACCCAAA
T7_00774_G01	ACCAACCCCAACCACCAGTCAAAAAACACCCCAAAC
T7_00775_G01	ACCACCCCACCCAAAAAGTCACCCACACAAAAAACC
T7_00776_G01	CCACCAAAACCCACCCAGTCACCAAAACCCAAAACA
T7_00777_G01	CCAACCCCAAAAACCCAGTCAACACCCACACAAACA
T7_00778_G01	AACCACCCAAACCCAAAGTCAACCCCACCACCAAAA
T7_00779_G01	AACCCCAAAAAACCCAAGTCACAACCAAACCACCCC
T7_00780_G01	CACAAAACCAAAACCAAGTCACCCAAACCCCAACCC
T7_00781_G01	CAAAAACACCCCACCAAGTCACCCAAAAACCCACCA
T7_00782_G01	AACCCCACCAAAAAAAAGTCAAACCCCAACCCACCC
T7_00783_G01	CCAAACAACCCCAAACCGTCAAAACAAAACCACCCC
T7_00784_G01	AAACCAACCCCAAAAACGTCCCAACCCCAAAACCCA
T7_00785_G01	CAAAAAAAAACCAACCCGTCCAAAACCCCACCCACC
T7_00786_G01	AACCAAAACAAAACAACGTCCCCAAAACCCCACCCC
T7_00787_G01	AACCCCAAAACCCAACAGTCACCACCAAACACCAAC
T7_00788_G01	CCCACCCCAAAAACCAAGTCAAAAACCCCAAACCAC
T7_00789_G01	ACAAACCCACCACAAAAGTCCCAAACCAAACACCCC
T7_00790_G01	CCAAAACCCACCCAACAGTCACCCCAAAACCAACAA
T7_00791_G01	ACAAACCCAAAACCCAAGTCAACCCCACAACCAACC
T7_00792_G01	CCAAACAAACAAAACCCGTCCAAACCCAACCCACCA
T7_00793_G01	AAACACCACCACCCCAAGTCAAACCCCAAAAAACCC
T7_00794_G01	AACAAACCCCACAAAACGTCCCACCCAAAACCCAAC
T7_00795_G01	ACCCACCCCAAAACCAAGTCAAAAACCCAACCCCAA
T7_00796_G01	CCCAAAAACAAACCCCAGTCCAAACCAACCCAAACC
T7_00797_G01	CCCAAAAACAACCACCCGTCCAAAAACCCCACCAAA
T7_00798_G01	ACCCAAAAAAAACCCCAGTCAAACCCAACCAACCCC
T7_00799_G01	CAAAAACCCCACAACCCGTCAAAAAAACCACCACCC
T7_00800_G01	ACAAAAAACCCAACCCAGTCAAACCCCAACCCCAAC
T7_00801_G01	CACCCCAACCACCCAAAGTCAAAACCACCCCAAAAA
T7_00802_G01	CCCAAACCAAAACCCACGTCCCCAAAAAAAACCCAC
T7_00803_G01	CCACCCAACAAAAAAACGTCCAAACCCCAAACACCC
T7_00804_G01	AAACCCCAAAACCCACCGTCCCACCCAACCAAAAAA
T7_00805_G01	CCCACCAACCCCACAAAGTCAAAACCAAAACAACCC
T7_00806_G01	AACAAAACACCAAACCCGTCACAAACCCCAACCCCA
T7_00807_G01	AAAAACCAAACAAACCCGTCAACCCAAACCCCACCC
T7_00808_G01	AAAACAAACCAAAACCAGTCCAACCCCACCCACCCA
T7_00809_G01	CCCAACCAAACCCCAAAGTCCCAAAAAAAACCACCC
T7_00810_G01	ACCACCACCAACCACCCGTCAACAAAAAAAACACCC
T7_00811_G01	AACAACCCAACCCACAAGTCACCCCAAAAACAACCC
T7_00812_G01	AACCACCCACACCACCAGTCACCCACCAAAACAAAA
T7_00813_G01	AAACCCAACACCAAACCGTCACCAACCAAAAACCCC
T7_00814_G01	CCAAAAAACCCCAAACCGTCCACCCAACCCAAAACA
T7_00815_G01	AACAACCCAAACCCAAAGTCCCCAAACCAACAACCC
T7_00816_G01	CAACAACCCAAAAAAACGTCCCAAACCCCACCCCAA
T7_00817_G01	CCAACCCCACCAAAAAAGTCACCCACAACCAACAAC
T7_00818_G01	CAACCCCACAAAAAACCGTCCAACACCACCCAAAAC
T7_00819_G01	CACCCACCAACCCCAAAGTCAACAACCACAAAAACC
T7_00820_G01	AACCAACAAACCCCACCGTCCAAACCCAAAACCAAC
T7_00821_G01	AAAACCCAACCCCACCAGTCAAAAACCACCCAAACC
T7_00822_G01	ACACAACACCCCAACACGTCACACAACCAAACAACC
T7_00823_G01	CCACAAAACCAAAACCCGTCCACACACCCCAAACAA
T7_00824_G01	ACAAAACAAAACAACACGTCCAACCACCCACCACCC
T7_00825_G01	CCCAAAAAAACCCCACCGTCCCAACCCAAACAACAA
T7_00826_G01	CCCAACAACCCAACCAAGTCAAAACCCCAACAACCA
T7_00827_G01	ACCCCAAACCACCACAAGTCCAAAACCAAACAACCC
T7_00828_G01	AACAACCCCAAAAAAACGTCCCCACCAAACCCCACA
T7_00829_G01	AAAAAAACCCCAAAACAGTCCCCAACCCACCCCAAC
T7_00830_G01	CCAAAAAAACCCCAACCGTCAACAACCACACAACCC
T7_00831_G01	AAAAACCCAAAACACCCGTCACCCCACAACCCCAAA
T7_00832_G01	CAACCACCCCAAAAACAGTCACCACCAACAAACCAC
T7_00833_G01	CCACACACACACACCCAGTCAACAACCCACCAAAAA
T7_00834_G01	AAAACAAAACCCAACCCGTCAACCAAAACCCACCCC
T7_00835_G01	AAACCCAAAAACCAACCGTCCACAACCCACAACCCA
T7_00836_G01	AACCCACAACCCCACCCGTCAAAACCAAAACCAACA
T7_00837_G01	ACCAAAAAACCCCAACCGTCCCACCAAAACCCAAAC
T7_00838_G01	CACCCAAACCACCAAACGTCCCACCCAAAAAACAAC
T7_00839_G01	CCACAAACAAACCACCCGTCCAAACCCCAACAAAAC
T7_00840_G01	AAAACCCCAAAACAAAAGTCAACCCCACCCAACCCC
T7_00841_G01	AAACCCCAACCCCACCCGTCACAAAAAACACCCAAA
T7_00842_G01	CACCCCACCCCAAAAAAGTCACAAACCCCACACAAA
T7_00843_G01	AAAAAAACCCCAACCAAGTCCCCAAACCACCCCACA
T7_00844_G01	AAACCACCCAACCCACAGTCACCCACAAACCCAAAA
T7_00845_G01	ACAACCCCAACCACACCGTCAAAAAACCACCCAACA
T7_00846_G01	ACCCACAAAAAACACCCGTCCAAAAACCCCAACCCA
T7_00847_G01	CCCAACAAAAACCCCAAGTCACACCCACCCAAAACA
T7_00848_G01	CCCAACCCCAACCACACGTCAACAAAAAACCCCAAA
T7_00849_G01	CACCCAACACCAACCAAGTCAACCCCAAAACACCAA
T7_00850_G01	AAACCCAAAACCCCAACGTCCAAACCCAAAACCACC
T7_00851_G01	ACAAAAACCCCAACCCAGTCACCCCAACACAAAACC
T7_00852_G01	AAAAAACCCCACCAACCGTCCACACCAAAACCCCAA
T7_00853_G01	CCCAACCCACACACACAGTCCACACCCAAAAAAAAC
T7_00854_G01	CCAACCAAAAACCCACCGTCCCAAACCACAAACCAA
T7_00855_G01	ACAACCCCAACCAACCCGTCACCAAAAAACCCCAAA
T7_00856_G01	CCCAAAACCCCAACCCAGTCAACAACAAAAACCACC
T7_00857_G01	CCAAACCACCCAACCCCGTCAACAACAAAAAAACCC
T7_00858_G01	CACCCAAACAAACCCCAGTCAACACCCCACACAAAA
T7_00859_G01	CCCACCCAACCAAAACAGTCCCCAAACCCCAAAAAA
T7_00860_G01	CCCACAACCCCAAAACCGTCAAAAACCAAAACCCCA
T7_00861_G01	CCCAAAACCACCCCAACGTCCCAAAAAAAACCCCAA
T7_00862_G01	AACAACCCCAAAACCAAGTCACCCCACAACCCCAAA
T7_00863_G01	AACCACCAACCCAAAAAGTCAAAACCCACACCCACC
T7_00864_G01	CAAAACCCACAAAACCCGTCAACCAAACACACCCCA
T7_00865_G01	CAAAAACCCACCCACAAGTCACCCAACCCAACCAAA
T7_00866_G01	AAAACACCCCACCAAAAGTCAACCCCAAACCCCAAC
T7_00867_G01	AACCCAAAAACCAAAAAGTCCCCACCCAACCCCAAC
T7_00868_G01	CCACCCACCAAACAAAAGTCCCAACCCCAAACAAAC
T7_00869_G01	CAAAAAACAAACCACAAGTCCAACCCCACCCCACCA
T7_00870_G01	CCCAACAACAACAAACCGTCCAAAACCACCAACCCA
T7_00871_G01	CACACAAAAAACCAAAAGTCACCACCACCACCACCC
T7_00872_G01	ACACACAACAACCCAAAGTCACCCCAAACCCAACCA
T7_00873_G01	AAAACAAAAACCCCAAAGTCCCAACCACACCCCACC
T7_00874_G01	CCAAACCACAAACCCAAGTCACCCACAAAAACCCCA
T7_00875_G01	CACACCCCAAAACAAACGTCCCAAACCCAACACCAA
T7_00876_G01	CAAAAAAACCCCACCAAGTCAACCCCAACAAACCCC
T7_00877_G01	ACACAACCCCAACCCCAGTCAAAAACCCCAAACCAA
T7_00878_G01	CACACAAAAAACACCCAGTCACCACAAACACCCCAC
T7_00879_G01	CCAAACACACCCAAACCGTCACACCCCAAAACAAAC
T7_00880_G01	AAAACCCACACAAAACCGTCCCACAACCCCAAAACC
T7_00881_G01	AACAACCCCAACCCAAAGTCCAAAAACAACCACCCC
T7_00882_G01	AAAAAACCACCCACACCGTCAACCCCACAAAACCCA
T7_00883_G01	AAAAAACCCACCCACCCGTCACCCCAAAAAACCCAA
T7_00884_G01	CCCAAAAAACCACCAAAGTCAACCCACCACACACCA
T7_00885_G01	CCCAACCAACCCCAAAAGTCCAAAAAACCAACCCCA
T7_00886_G01	CCAAAACAACAAACAACGTCACCCCACACCCCAAAC
T7_00887_G01	CCACCCCAACACCCAAAGTCAAAAACCAAACACCCA
T7_00888_G01	AACCCACCCCACACAACGTCCAAACAAAAAACCCCA
T7_00889_G01	AACCCCACCCCAAAAACGTCAAAACAAACCAACCCC
T7_00890_G01	AACCCCAAACAACCCAAGTCCCACCAACCAAAACAC
T7_00891_G01	CACCCCACCAAAACCAAGTCCACACAAAACCAAACC
T7_00892_G01	ACCAAAACCCAAACCACGTCCCCACAAACCCCAAAA
T7_00893_G01	CAAACCCAAAACCCAACGTCACCACAAAACACACCC
T7_00894_G01	CCAAACCAAACCAAACAGTCAACCAAACCCCACCAC
T7_00895_G01	CACACCCAAAACCAAACGTCCCCACAAACCACAAAC
T7_00896_G01	ACCAAACCACCCACCAAGTCACCACAAAAAAACCCC
T7_00897_G01	CAAACAACCCAAAACAAGTCACCCAACCACCCACCA
T7_00898_G01	AACCCCAACCCAAACCCGTCACCCCAAAAACCAAAA
T7_00899_G01	AAACCACAACCACCCACGTCAAACCAAAAACACCCC
T7_00900_G01	CAAAACAAAACCCAACAGTCCCCACCCACACCAACA
T7_00901_G01	AACCAACCACCAAAACCGTCAACCAAAAACCCACCC
T7_00902_G01	ACCCACAAACCAACAACGTCCCACAAAAACAACCCC
T7_00903_G01	CCAACCACAAACAACAAGTCCCAACCCAAACCACAC
T7_00904_G01	CAAACAAACCCAACAAAGTCAAACCCCAACCACCCC
T7_00905_G01	CCCAAAACCCAAAAACAGTCCACCAAACCCCACCAA
T7_00906_G01	CAAAACCCCACACCAAAGTCACCCCAACAAACCCAA
T7_00907_G01	AACCCAACCCAAAAAACGTCACCACAACCACCCAAC
T7_00908_G01	ACCCCACAAACAAACCCGTCAAACCCAAACCAAACC
T7_00909_G01	ACCCCAAACCAACCCAAGTCACACCAACAACCACAA
T7_00910_G01	AAACCCCACCCACCCCAGTCAAACACCCCAAAAAAA
T7_00911_G01	CAAACCCAACCAAAAAAGTCCCAACCCCAAAACCCC
T7_00912_G01	AAACCCAAAACCACCAAGTCAACCCAAAACCCACCC
T7_00913_G01	AACCACCCCAAAAACCCGTCAACCCAAACCACCAAA
T7_00914_G01	AAAAAACCAACCCACCCGTCAACACCCAACCCAACA
T7_00915_G01	AAAAAACCCAAAAAAACGTCCCCAACCACCCCACCC
T7_00916_G01	CCCACCCCACAACAAAAGTCCAACACAAACCAACAC
T7_00917_G01	AAACCCCAACCCCAAACGTCCCACAACCACAACAAA
T7_00918_G01	CCAAAAACACCAACAAAGTCACACCACCCCAACCCA
T7_00919_G01	CACCAAAAACACCCCAAGTCCAACCAACCCCAACAA
T7_00920_G01	CCAACCAAAACCCCAAAGTCCCCAACAACCAAACAC
T7_00921_G01	AACACCACACCCAAACCGTCAACCCAAAACCCCAAA
T7_00922_G01	CAACCCCAAAAAAACCCGTCAAACCACCCCACAACA
T7_00923_G01	AAAACAACCCCACACCCGTCAAAACCCAACCCCAAA
T7_00924_G01	CACCAACAAAAACAACCGTCCCACCCAAACCAAACC
T7_00925_G01	ACCCAACCAAAAAACCCGTCACAACCAACCAAACCC
T7_00926_G01	AAAACACCACCACAACCGTCCACAAAAACCCACCAC
T7_00927_G01	AAAACAACCCACAACAAGTCCCAAACCCACCCACCA
T7_00928_G01	AACCACCCCAACACCCAGTCAAACACCAAACAAACC
T7_00929_G01	ACAACCCACCACCACCCGTCCAAAAACCAACCAAAA
T7_00930_G01	ACCAAACACCCCACACCGTCCAAAAAAAAACCCCAC
T7_00931_G01	AAAAAAACCCAAACCCAGTCACCAACCCAACCACCC
T7_00932_G01	CCAAAACAAACCCCAACGTCCCAACCCCAACCAAAA
T7_00933_G01	AAACCAACCAAAAAAACGTCACCCCACCCCACACCA
T7_00934_G01	ACCCAAAACCACCCCACGTCCCAAAACCCCAAAAAA
T7_00935_G01	CCCACCCCACAAACCCCGTCAACACAAAAACACAAA
T7_00936_G01	CCACCAAAAACCACCACGTCAAACCCAACCCAAACA
T7_00937_G01	CCACCCCAAACCACCAAGTCAAAACCAACAAAACCC
T7_00938_G01	CACAACCCCAACCCCAAGTCCCAAAAAAAAAACCCC
T7_00939_G01	AAAAAAACCCCAAAACCGTCACCCACCCCAACCCAA
T7_00940_G01	CAAAAAACCAAAACCCCGTCACCCCAACCCAAAACC
T7_00941_G01	ACACACCCAACCAACCCGTCAAAAAAACCCACCCAA
T7_00942_G01	ACAAAACCACCCCAAACGTCAACCCAAACCCAACAC
T7_00943_G01	CAACCACCACCCAAAAAGTCACCAAACAAACACCCC
T7_00944_G01	CCAACCCACCAAACCCCGTCACAAACAAAAACACAC
T7_00945_G01	CCAACACCCCAAACAAAGTCCACCCCAAAAACACCA
T7_00946_G01	ACAACAACAACCCAACCGTCAAACCCCAACCAAACC
T7_00947_G01	CAAAACCACCCAACCCAGTCAAACCCACCAAACACA
T7_00948_G01	CAAAACACCCCAACACCGTCCAAAAAAAACCCACCC
T7_00949_G01	CCAACAAACCCCAAAACGTCAAAACCCACCCAACCA
T7_00950_G01	ACCCAAAAAAACAAACCGTCCACCACCAAACCACCC
T7_00951_G01	AAAAACACACCCAACCCGTCAAACCACACACCCCAA
T7_00952_G01	AACCCCAAAAAACCACCGTCCAAAAACACACACCCC
T7_00953_G01	CCAACCAACCAAACCCAGTCACAACACAAAAACCCC
T7_00954_G01	AACCACCCCACCCCAAAGTCAAAAACAAACCCCAAC
T7_00955_G01	ACACCAAACCCCAACAAGTCAAAACCAAACCCCACC
T7_00956_G01	CACCCAAACCAACAAAAGTCAAACCCCACAAACCCC
T7_00957_G01	CCCACACACCCCACAAAGTCAAACACCCAAACCAAA
T7_00958_G01	ACAAAAACCAAAAACCCGTCCACCCAAACACCCACC
T7_00959_G01	AACACAAACCCCAACCCGTCAAACCCAAAAACCCAC
T7_00960_G01	CAAAACCCAACACCAACGTCCCACCACAAAAACCCA
T7_00961_G01	AACAAACCAACCCCAAAGTCAAACCCACAACCCACC
T7_00962_G01	AACAAAAAAAACCCCACGTCCCAACCAACCCCAACC
T7_00963_G01	ACCCAAACACCCACCAAGTCCACCACAACCCAAAAA
T7_00964_G01	CACAACAACCCACAAAAGTCACACCAACCACCCCAA
T7_00965_G01	AAACACCCACACAAACCGTCCAAACCCCAACCACAA
T7_00966_G01	CCAAAAACCCCAAACACGTCAAAACCCCACCAAACC
T7_00967_G01	ACAACAACCACACCCACGTCCCAACCAAACACAACA
T7_00968_G01	AACCACCACCCACCCCAGTCAAACAACCAAAACCAA
T7_00969_G01	ACCCCAAAAACCACAACGTCCAAACAACCACCCCAA
T7_00970_G01	AAACCAACACCCACCACGTCCAAAACCCAACCAAAC
T7_00971_G01	AACCACCCCAAACCACAGTCACAAACCAAAACCCAC
T7_00972_G01	AACCCCACCACCCAAAAGTCAAAAAAACCACCCCAC
T7_00973_G01	AACAAACCCCACCACCCGTCCACAAAAACCACAAAC
T7_00974_G01	CCCAAAACACCAACACCGTCAACAAACCCACCAAAC
T7_00975_G01	ACCACCACCCCACCCAAGTCCAAAAAAACACCAAAC
T7_00976_G01	CCCAAACAAAAAAACACGTCCACAACCAACCCACCC
T7_00977_G01	CACCAAAACCAACCCAAGTCCACACCCCAACAAAAC
T7_00978_G01	CAACCAACCAACACAAAGTCCAAACCCCAAAACCCC
T7_00979_G01	AACCCAAAAACAAACCCGTCCACCACCACAACCAAC
T7_00980_G01	CCACCAACCAACCACACGTCAAAACAAAAACACCCC
T7_00981_G01	AAACCAACCCCAACCCCGTCAAACCCCAAACAAAAC
T7_00982_G01	CACAAACCCAAAAACCCGTCCACCCCAAAAACCCAA
T7_00983_G01	AAAACCACCCCAAAAAAGTCCCCAACCACCAACCCA
T7_00984_G01	CCCACACCAACACAAAAGTCACCCAACACCCAAACA
T7_00985_G01	AACCAACCCACCAACAAGTCAAACCACACCCCAAAC
T7_00986_G01	CCAAACCCCACCCCAACGTCACAAAAACCCCAAAAA
T7_00987_G01	CCCAAAAAACCAACCAAGTCACCCAACCAAAACCCC
T7_00988_G01	CCAACCACCAAACCAACGTCCCACCCAACCAAAAAA
T7_00989_G01	CAAACACCCAAAACCACGTCCACACCAAACCCCAAA
T7_00990_G01	CCACCCCAAAACCACACGTCCCCAACAAAAACCAAA
T7_00991_G01	CAAAAAAAACACCACCAGTCCACCCCAACAACACCC
T7_00992_G01	AACCAAAACACCCCACAGTCAACCACCCCACAAAAC
T7_00993_G01	AACCCAAACCACCACAAGTCACCACACAAAAACCCC
T7_00994_G01	CCAAAACACCAAACAAAGTCAACCCCACACCACACC
T7_00995_G01	CCCAACCCCACCCAACAGTCAAACAAAACAAAACCC
T7_00996_G01	CAACCCCAAAAAACCACGTCAAACACCCAAAACCCC
T7_00997_G01	AACCAAAACACACAACCGTCAACCAACCCAAACCCC
T7_00998_G01	AAAACCACCCCAAACAAGTCCCACCCAAAACCCCAA
T7_00999_G01	CCCACAAAACCCCAAACGTCCCAACCCAAACCAAAA
T7_01000_G01	ACCCAACAACAACCACCGTCAAAAAACCCCAACCCA
T7_01001_G01	AAACCCAACCACAACCCGTCAAACCCCAAACACCAA
T7_01002_G01	AACCCAAAAACCCCACAGTCACCAAAACCCCACCAA
T7_01003_G01	ACCAACAACCACCACAAGTCAACAACACCCACCCAA
T7_01004_G01	CCCAAAAAAAACCACAAGTCAACCCCACCACCCAAC
T7_01005_G01	CCAAAACCACCCACCCCGTCACAAACAAACAACCAA
T7_01006_G01	CCAAACCAAAACACCCCGTCACAACCAAAAACCACC
T7_01007_G01	ACCCACCCAACCCCAAAGTCCCCACCAAAAAACAAA
T7_01008_G01	CCAAAACCCCAAAAACCGTCACAACCCAACCCCAAA
T7_01009_G01	AAAACCACAAACAACCCGTCCAACCACCAAAACCCC
T7_01010_G01	ACCCCAAAAACACAACCGTCACAACCAACCACAACC
T7_01011_G01	ACACCCAAACAAACACAGTCCCAACAAACACCACCC
T7_01012_G01	ACACCCCAAAAAACCACGTCAACACCCACCCAAAAC
T7_01013_G01	AACCAACCACCAAAAACGTCCAACCAAAACCCACCC
T7_01014_G01	CAACCCCACCCAAACACGTCCCAAAAAACCAACCAA
T7_01015_G01	AAAACCCCAACCACCACGTCCAAAACCCAACCCAAA
T7_01016_G01	CAAAAAAAAACCACCACGTCACCCCAACCAACCCAC
T7_01017_G01	CCAAACCCACAACCCACGTCCCAAAAAACCCAAACA
T7_01018_G01	CCCAAAAAACACAACCCGTCAAACCCCAAAAACCCC
T7_01019_G01	ACAAACCACCACCAACCGTCCAACCAAAAAAACCCC
T7_01020_G01	CCAAAAACAACCCCAAAGTCCACAAACCCACACACC
T7_01021_G01	CACACCCCAAAAACCACGTCAAAAAACCCAACCCCA
T7_01022_G01	AAACCCACCCAAAAAAAGTCCCCAACCAACCCAACC
T7_01023_G01	CACCAAACACCCAAAACGTCCCAAAAACACCCAACC
T7_01024_G01	CACACCAAAAACCCCAAGTCCCAACCAAACCAACCA
T7_01025_G01	AAAACCACCACAACCCCGTCAAACCAAAACCACACC
T7_01026_G01	CACCCCAACCCAAAAAAGTCACCCACCCAAAAAACC
T7_01027_G01	ACCAAACAACAAAACCAGTCCCCAACACCCCAAACC
T7_01028_G01	CCACCAAACAACCCAAAGTCACACCCACCAAAAACC
T7_01029_G01	AACACCAACACAACCAAGTCACCCACAACAAACCCC
T7_01030_G01	AACACAAACCAACCCCAGTCACCCAAACCCACCAAA
T7_01031_G01	AAAAACCCCACCACCCCGTCACAAACACCAACCAAA
T7_01032_G01	CCAACCCCAACCAAAAAGTCACCCAAACCAACACCA
T7_01033_G01	CAAAAACCACCCAAACAGTCACACAAAACCCACCCC
T7_01034_G01	CACAACCAAAACACCCCGTCAAACAAACACCAACCC
T7_01035_G01	CCACACAACCACCAAAAGTCACAACCACCCCAAAAC
T7_01036_G01	CAAACCAAACCCCAAAAGTCACACCCACAACACCCA
T7_01037_G01	CCAAAAAACAACCCCAAGTCCCACCCCAAACCACAA
T7_01038_G01	ACCAAACCCCAAACCAAGTCCCCAAAACAACCCCAA
T7_01039_G01	CCAAAACCCCAAACACCGTCCAACACCAAACCAAAC
T7_01040_G01	CCCAACCCCAAAAAACCGTCACCCAACACCAACAAA
T7_01041_G01	ACCCACACCCACCCCAAGTCAAAACCAAACAAACCA
T7_01042_G01	CCAAACCAAACCCACACGTCCCCAACAAACCCAAAA
T7_01043_G01	ACCACCACCAACCAAACGTCAAACCCAACCAAACAC
T7_01044_G01	AACCACCCAACCCAAACGTCCACCACACCCAAAAAA
T7_01045_G01	AACCAACAAAAACCACCGTCACAAACACCCCACACC
T7_01046_G01	AACCCAAAAAACAACCAGTCCCCACCCAAACCCCAA
T7_01047_G01	AACAACCCAAAAAACCAGTCCACCAACCACCCAACC
T7_01048_G01	AAACCCAACAACCACAAGTCCACCACCCCACCAAAA
T7_01049_G01	AACCACCAACCCCACCAGTCAAAAAACCAAAACCCC
T7_01050_G01	CAAACCAAACAAAACCCGTCCACCCCACAAAAACCC
T7_01051_G01	CCCAAAAACCCAACCACGTCCCCAACAAAAACCAAC
T7_01052_G01	CCAACCCAAACCCAAAAGTCAAAAACCCAACCCCAC
T7_01053_G01	CCCAAAAACAACACCCAGTCACCCCACCCCAAAAAA
T7_01054_G01	CCAACCCCAAACAAACAGTCACCACAACCAACCCAA
T7_01055_G01	CACCCCACACCAACCACGTCCAAAAAAACCCCAAAA
T7_01056_G01	CCAAAACACACCCACCCGTCAACCAAAACCCCAAAA
T7_01057_G01	AACCCCAAAAAACCAAAGTCAACCCACCAACCCCAC
T7_01058_G01	CCAAACACCCCAAACCCGTCAAAACCAACAACCCAA
T7_01059_G01	CACCAAAAAACCCCACCGTCCAACCACCCACAAAAA
T7_01060_G01	CCCAAAAAAAACAACCCGTCACCAAAACCACCCACC
T7_01061_G01	AAAACCACCAAACCCCAGTCCCCAACCAAAACCACA
T7_01062_G01	CCCACAACACCCCAACCGTCCCACAAAAAACCAAAA
T7_01063_G01	CAAAAAACCAACCCACAGTCACCCCACCCAACCAAA
T7_01064_G01	AACCCAAAAACACCCCAGTCACCACCCCAAAAAACC
T7_01065_G01	AAAACCACCCACCAACCGTCCAAACCAACCAAAACC
T7_01066_G01	ACCAACCACCCACACAAGTCAAAACACCCCAAACCA
T7_01067_G01	AAACAACAAACCCCAAAGTCCCCAACCAAACCCCAC
T7_01068_G01	CCCAAAAACCACAAACCGTCCCAAAAAACCACCCCA
T7_01069_G01	CCCAAAACCCAAAAAACGTCACCAACCCACAAACCC
T7_01070_G01	CCCACCAACCAAAAACCGTCCCAAAAAACCACACAC
T7_01071_G01	AAAAACCCAACCCAAACGTCCCCAACCCCAAACACA
T7_01072_G01	AAAAACCCACACCCCAAGTCACCAAAAACCCCAACC
T7_01073_G01	AAAAACCCCACACCAAAGTCCACCCCAAAAACCCAC
T7_01074_G01	ACACACCCACCACCAAAGTCAACACACAAACACCAC
T7_01075_G01	ACCAAACAAAACACCCAGTCCCACCACCCAAACCAA
T7_01076_G01	ACAAACCCAAACCACAAGTCAACCAAAACCCCACCC
T7_01077_G01	AAAAAAACCACCCACAAGTCCCAACCCCAAAACCCC
T7_01078_G01	CCCACCAAAAACCACCCGTCAACACCAAAAAAACCC
T7_01079_G01	AACAACCCCAACCCACCGTCCAAAACCCCAAAAAAC
T7_01080_G01	ACACCCCACAAACAACAGTCAACCCAAACCCAACAC
T7_01081_G01	ACAAACCACCCCACACAGTCCCAAAACCAAAAACCC
T7_01082_G01	AACAACCAACCACCAAAGTCCCAAACCCACCCCAAA
T7_01083_G01	CCAACCACCACACCCAAGTCCAACACCAAAACAAAC
T7_01084_G01	AACCCAAACCCCAAAAAGTCACCCCACCACAACCAA
T7_01085_G01	CCCACCAAACCCCAACCGTCAAACAAAAAAAACCCC
T7_01086_G01	AACACCAACCCCAAACAGTCAAACACCCAAACCACC
T7_01087_G01	CACCCCACCCAAAAAAAGTCCAAAAAACACCCACCC
T7_01088_G01	ACCCACAACCAAAACAAGTCAAAACCCCACCAACCC
T7_01089_G01	AACCAAAACCAACCAACGTCCAACCAACCCAAACCC
T7_01090_G01	AAACCCACCCAAAACACGTCCAAACCCCAAAAACCC
T7_01091_G01	AACAAACAACCCCAACCGTCAAAAACCCCAAACCCC
T7_01092_G01	AAAACACCCAAACCCCAGTCACCCAAAACCCCAAAC
T7_01093_G01	CAACCCAACCAAACCCCGTCAACCACCAAAAAACCA
T7_01094_G01	AACCACCCACCCAAAACGTCAAAAACCACCAAACCC
T7_01095_G01	AAACCACCCACCACAAAGTCACACCAAAAACACCCC
T7_01096_G01	ACCCCACAACAAAACCCGTCACCCCAACCAAAAAAC
T7_01097_G01	CACCACCCCAAACCACCGTCCCAAAAACAAAACCAA
T7_01098_G01	AACCCAAAAAACACCCCGTCAAAAACCCCACCCCAA
T7_01099_G01	AAAAACCCACCACCACAGTCCAACAAAACCCACCAC
T7_01100_G01	CCACCCAAACAACACCAGTCCCAACAACCCAAAACA
T7_01101_G01	CACCAAAACCCCACAAAGTCACCCAAACACACCCAA
T7_01102_G01	CACACAAAAAACCCCACGTCCCCAAACAAACCACCA
T7_01103_G01	CAACCCACAAAAAAACCGTCCCAAACCCAAAACCCC
T7_01104_G01	ACCCCAAAAACAAACCAGTCACCCAACACACCCCAA
T7_01105_G01	CCCACCCAACACAACCAGTCCAAACCACCACAAAAA
T7_01106_G01	ACCCACACCCAACAACCGTCCAAAACCAAAAACCAC
T7_01107_G01	AAAAACCACCAACACCCGTCCAAAACCACCCCAACA
T7_01108_G01	AACAACCAACCCCAACCGTCCAAAAACCACCCCAAA
T7_01109_G01	CCCACCCCAAAAAAAAAGTCACCCAACCCACCAAAC
T7_01110_G01	AACCCCAACAAACCCCAGTCACCAACCCAAAACCAA
T7_01111_G01	ACCCACCCCAACCAAAAGTCAAACACCCCAAAAACC
T7_01112_G01	AAAAAACCAACCCACCCGTCCACCCCACCAAACAAA
T7_01113_G01	CACCCAAAAAACCCAAAGTCAACCCACCACCCAACA
T7_01114_G01	CCCAACCCCACCAAACCGTCCCAAAAAAACCAAAAC
T7_01115_G01	CAAAAACCCCAAACAACGTCCCCAAACCCAAAACCC
T7_01116_G01	CCCAAACCCACAAACCCGTCCAAAACCACACCAAAA
T7_01117_G01	CCACAACCCAAAACACAGTCACAAACCCCACAAACC
T7_01118_G01	CCCACCAAAAACCCAAAGTCCAAAAACCCACCAACC
T7_01119_G01	AAACCACCCAAAAACCCGTCACCAACCACACCAAAC
T7_01120_G01	CAACCCAAAACACCACCGTCCCAACCACAACAAAAC
T7_01121_G01	ACAAAACCCCACCAAAAGTCCAAAAACCCACCCCAC
T7_01122_G01	CCAACACAAAACACCCCGTCAAACCAAACACCCCAA
T7_01123_G01	CAACCCAAAAAAACAAAGTCCCCAACCCCACAACCC
T7_01124_G01	AACACCCCACCCACAACGTCAAACCCCAAAAACCAA
T7_01125_G01	AAACCCACCCAAAAAAAGTCCCCAACCACCCACCAA
T7_01126_G01	CCACAACCAACAAAAAAGTCCCCAACCCCACAAACC
T7_01127_G01	CAAACCACACAACCCAAGTCAACAACCCCAACACCA
T7_01128_G01	CCAAAAACAAAACCCACGTCAAAACCCACCAACCCC
T7_01129_G01	ACCCCAAAAACAACACCGTCCCAAAACCCACAACCA
T7_01130_G01	AAAACAACACCACAACCGTCCAACCCAAACACACCC
T7_01131_G01	ACCCACCCACAAAAAACGTCCAACCCAACCCACAAA
T7_01132_G01	AAAAACCAAAACCCCAAGTCCCACCCAAACCCCAAC
T7_01133_G01	AACCCCACCCCACCCACGTCAAAAAAACCCCAAAAA
T7_01134_G01	ACCAACCAACCCCACCCGTCACAAAACCAAACCAAA
T7_01135_G01	AAAAAAACCCCACCACAGTCCCAAACCAACAACCCC
T7_01136_G01	ACCCCACAAACCCAACCGTCCCAAACCCAAAAAACA
T7_01137_G01	AACACAAAACCCCACCCGTCCAAACCAACAAACCCA
T7_01138_G01	CCAAACCCACCCCACCCGTCCAAAAAACCAAAACAA
T7_01139_G01	CCAAAAAAACCACCCAAGTCAACACCCCACCAAACC
T7_01140_G01	CACCCCAAAAACCACAAGTCAAACAACCCAAACCCC
T7_01141_G01	AACCAAACCCAAAAAACGTCACCCACCAAACCCCAC
T7_01142_G01	CAAACACCACCCCAACAGTCCAACACAACCCAACAA
T7_01143_G01	AACCCCAAAAAACACACGTCAAACACCCACCCCACA
T7_01144_G01	CCAAACCCCACCCCAACGTCCCCAAAAACAAAAACA
T7_01145_G01	CCAAAAAAAACACCCAAGTCCCAAACCCAACACCCC
T7_01146_G01	ACAAAACCCAACAAAACGTCCACCACCCACACCACA
T7_01147_G01	CAAACCACCAACCCACAGTCACACCCAAAACCCAAA
T7_01148_G01	ACCCAACCCCACACCAAGTCAAAACCCAACCCAAAA
T7_01149_G01	CCAAACCCAAACCCAAAGTCACAAACCCCACACCAA
T7_01150_G01	CCAAAAAAAACCCACCCGTCCAACAACCACAAACCC
T7_01151_G01	ACCCAAACCCAAAACCCGTCAAAACCACCCAAAACC
T7_01152_G01	CCCACACCCCAAAACCCGTCAAACAAAACCCCAAAA
T7_01153_G01	CCCAACCCACCAAAAAAGTCAAACCCAAACCCACAC
T7_01154_G01	CACCCAAAAACAAAACCGTCCAAACCCAAACACCCC
T7_01155_G01	AAAACCCCACACAAACAGTCACCAAAACCCACCCCA
T7_01156_G01	CCAACCAAAAAAAACCCGTCACCCAACCAAAACCCC
T7_01157_G01	AAAAAACCCCAAAACCCGTCCAACCCAACAAACCCC
T7_01158_G01	CAACCAACAACCCAAAAGTCCAACCAACAACCACCC
T7_01159_G01	AAAACCCACACCCACACGTCCACCACCCAAAAAAAC
T7_01160_G01	CAAACCCACACCACAACGTCCCCACCCAAAAACAAA
T7_01161_G01	CCACCCACCCACAAACCGTCCAAACCAAAAAAAACC
T7_01162_G01	ACCCAAACAAACAAAAAGTCACCACCCCAACACCCC
T7_01163_G01	AAAACCCACACCCAAAAGTCCAACACACCCCAAACC
T7_01164_G01	AAAAAAACCCCAACCAAGTCCCACCCCAAACCAACC
T7_01165_G01	AAACAACAAAACCCAACGTCACCACCCCAACCCACA
T7_01166_G01	ACCAACCAAACCAAACCGTCCCAAAAAAACCACCCC
T7_01167_G01	CCACAACAAAACACACCGTCCAACCCAAAAAACCCC
T7_01168_G01	CCCAAAACCCACCCAAAGTCCCAAACAAACCCAACA
T7_01169_G01	CCCACCACCACAAACCCGTCCAAAACCAAACCAAAA
T7_01170_G01	ACAACCAAACCCACCCAGTCACAAACAAACACCCAC
T7_01171_G01	CACCACCCACAAAAACCGTCCCACCCCAAAAAAAAC
T7_01172_G01	ACCCCAAAACAAACCCCGTCACCCCAAAAAACCCAA
T7_01173_G01	AACACCCCACCCAAACAGTCAACCCCAAAAACCCAA
T7_01174_G01	CACAACACCCAAAAAAAGTCACCCAACACCCCAACC
T7_01175_G01	CAAAAAAACCCCACCCAGTCACCACCAACCACAACA
T7_01176_G01	CACAACAACCAAAAACAGTCCCCACCAACCCCAAAC
T7_01177_G01	CACCCAAAAAAAACCACGTCAAACCCACCCCAAACC
T7_01178_G01	AACCACAACAACCCAACGTCCACAAACCCAACCCAA
T7_01179_G01	CCCAACACACCCACAAAGTCCACCCAACACAAAACA
T7_01180_G01	CACCAACCAAACCACACGTCCCAAAAACCAAACCCA
T7_01181_G01	CCAAAACAAACCCAACAGTCACCACCCCACCCAAAA
T7_01182_G01	AACCAAAAACCACACCCGTCCAAAACAACCCCAACC
T7_01183_G01	AACAAAAAACCACCAAAGTCCCACCCCAACCCAACC
T7_01184_G01	CAACACCAACCCAAAACGTCAAACCCCACACAAACC
T7_01185_G01	AAACCCAAACCAAAAAAGTCCCCAAACCACCCACCC
T7_01186_G01	CCACAACCCAAACCCCAGTCAAACACACCAAACCAA
T7_01187_G01	CCACAACCAAAAACCCAGTCACCAAAAAACCACCCC
T7_01188_G01	ACACCCAACCAAACCCCGTCAAAAAAACCACAACCC
T7_01189_G01	CCAACAAACCAAACCCAGTCAACCACCCCAAAAACC
T7_01190_G01	AAAACACCCACCCCAAAGTCAAACCCCACCACACAA
T7_01191_G01	AAACAACACCAACCACCGTCAAAACCCCAACCAACC
T7_01192_G01	ACACCAACAAACACCCAGTCACCCCAAAAAAACCCC
T7_01193_G01	CCAACCCAAACCCCAAAGTCCCCAAACCCCAAAAAA
T7_01194_G01	CCAACCCAAAAACCCAAGTCACCCAAAACCCCAACA
T7_01195_G01	AACAAACCACCAAACCCGTCAACCCCACCCACAAAA
T7_01196_G01	AAAAACCCACCCACCAAGTCAACAACCCCACAACCA
T7_01197_G01	CCACCCAACCACCACCAGTCACACAACAAAACCAAA
T7_01198_G01	AAAAACCCCACCCCACCGTCCAAAAAAACCCCAAAC
T7_01199_G01	AACCAAAACCACCCAACGTCCCCAAACCCAAAACCA
T7_01200_G01	ACCCCAAAACCAAAACAGTCACCCCAACACCCAAAC
T7_01201_G01	CAAAAAAACCCCAAACCGTCCAACCACCCCAACCAA
T7_01202_G01	CCACAAAACCACCCAAAGTCACAACCCAACAAACCC
T7_01203_G01	ACAAACCCAACCAACCCGTCACCAAAACAACCACCA
T7_01204_G01	AACCCAACCCAACAAAAGTCAACCCACCACACCAAC
T7_01205_G01	CCCACCAAAAACAAAACGTCCACCAACCAAACCCCA
T7_01206_G01	CCACCAAACACCCACACGTCCCCAAAACACCAAAAA
T7_01207_G01	ACACCCAAACCAAAACCGTCCCAAAAAACCCAACCC
T7_01208_G01	ACCACAAACACCACACAGTCCAAACCCCAACCAAAC
T7_01209_G01	AACAAAAACAACACACCGTCAAAACCCCACCCCACC
T7_01210_G01	AAACACCACCCACACCCGTCCAAACACAAAACACCA
T7_01211_G01	AAAAACCCACCACAAAAGTCCCACCCCAACAAACCC
T7_01212_G01	CACACCACACAAACAAAGTCCCAACAAACCACCCAC
T7_01213_G01	CCACAAACCCACCCACCGTCACCAACAAAAACAAAC
T7_01214_G01	CAACCCAACCCCACCAAGTCACAAAACAAACACCAC
T7_01215_G01	AACAACAAAACCAACACGTCCAACACCACCACCACC
T7_01216_G01	AAAAAACCAACCCCAAAGTCACCAACCACCCACCCA
T7_01217_G01	CAACCCAAAAACACAAAGTCCCACAACACCCACCCA
T7_01218_G01	ACACCCACCCAAACCACGTCACCCCAAAAAAACAAC
T7_01219_G01	ACCACCCAAAACCCACCGTCCAAACAAAACCCAAAC
T7_01220_G01	CCACAACACCCACCCCAGTCCCAAAAAAACCACAAA
T7_01221_G01	CAAAACACCAAACCACCGTCACAACCCACAAACCCA
T7_01222_G01	AACCAACCCCACCAAACGTCCCAAACAAACCAACAC
T7_01223_G01	CCAAACACCACCACCCCGTCAACAACCAAAAAACCA
T7_01224_G01	AACCCCAAAACCAACCCGTCCAACCAAAAAAACCCC
T7_01225_G01	ACAAAACCCCACAAACCGTCAAACACAAACCCACCC
T7_01226_G01	AACAAAAAACCCACCCAGTCCCCAACCAACAACCCA
T7_01227_G01	CACACCCCACAAAAAACGTCCCCAACAACCACCAAA
T7_01228_G01	CCCAACCCCAAACAAAAGTCCACCAAAACCCACAAC
T7_01229_G01	ACCACCCCAAACCCCACGTCCCCAAAAAAAAACAAC
T7_01230_G01	ACCCCAAACCAAAAACCGTCCCACCAAACCAACAAC
T7_01231_G01	ACCCAAAAAACCACACAGTCCCCAACACAAAACCCC
T7_01232_G01	AACCCACCAAACAACACGTCCACACCAACACACAAC
T7_01233_G01	AAAACCCCAAAAACCAAGTCACCACCACCAACACCC
T7_01234_G01	ACACCAACCAACAACCCGTCCAACAACACAAAACCC
T7_01235_G01	AACAAAACCCACCACAAGTCCCACAAACAACCACCC
T7_01236_G01	CAACCCAAAACCCCAAAGTCACCCAAACCAACAACC
T7_01237_G01	CCCACCCCAAAACCAACGTCCAAACAAACCCCAAAA
T7_01238_G01	ACCCAAAACCCCACAAAGTCAACACCAAAACACCCC
T7_01239_G01	CCCACCCAAAAACCACCGTCAAAAACAACAAACCCC
T7_01240_G01	AAAAAAACCCACACCACGTCCAAACACCCCAACCCA
T7_01241_G01	CAAACACCCACCCCAAAGTCCCACCCACCAAAAAAA
T7_01242_G01	ACCACCCCAAAACAAAAGTCAACCACACCAACCCCA
T7_01243_G01	AAACCACCCCACCAACCGTCAACACAAAAACACCAC
T7_01244_G01	CCACCCCACCCAAAAAAGTCAACACAACCCCAAAAC
T7_01245_G01	CAAACAAACACACACCAGTCCAAAACCCCACCCAAC
T7_01246_G01	AACCCCACAACCACAACGTCACCCCAAAAACCAAAC
T7_01247_G01	CAAACCACCAACCCCAAGTCACAACAACAACCCCAA
T7_01248_G01	CCAACCACCAAAAACCCGTCAACCAAACCACACACA
T7_01249_G01	ACCCAAAAAACCCAAACGTCACACCCCACACAACCA
T7_01250_G01	CAACACCCACAAACCAAGTCAACCACCAAAACCCCA
T7_01251_G01	CAAACCCACCAAACCCAGTCCAACACCAACAAACAC
T7_01252_G01	CAACAAACACCACACCCGTCAAAACAACCAACCACC
T7_01253_G01	CCCAAACCCCACCCACAGTCAAAAAAACCCCAAAAC
T7_01254_G01	CCCAAAACACCAACACAGTCCACCCCAAACCCAAAA
T7_01255_G01	CCCACCCAAAACCAAAAGTCAAAACCAACCCACACC
T7_01256_G01	AACCCAACCACAAACACGTCCCCAACAACCAAAACC
T7_01257_G01	CACACCAAAAACCAAAAGTCAACCCCACCAACACCC
T7_01258_G01	ACACAAAACCCAAAACAGTCACCCCACCCCAACCAA
T7_01259_G01	CCACAACACCCCAAACAGTCAAAACACCCAAACACC
T7_01260_G01	CACCCCAAAAACCCAAAGTCCCAAAAACCCCACACA
T7_01261_G01	AAAACAAACCACCCAAAGTCCACCCCAAAACCCACC
T7_01262_G01	CAAAACCCACACAAACAGTCCAAACCCACCCAACAC
T7_01263_G01	CCAACCACAAACACCCCGTCAAAACCCACAAAAACC
T7_01264_G01	ACCCACACAAACCCCACGTCCAAACAACCCCAAAAA
T7_01265_G01	CAAACCCACCACCCACCGTCAAAACACACCAAACAA
T7_01266_G01	ACCACAACCCAACAAAAGTCAACACCCACCCCAAAC
T7_01267_G01	CCCAAAAACAAAACCCAGTCACCAAAACACCCACCC
T7_01268_G01	CACCCACCCCAACACCAGTCACAAAAAAACAACCAC
T7_01269_G01	AAACCCACAACCCACAAGTCACCACCCCAACAAAAC
T7_01270_G01	CCCAAAAACCCCAACCCGTCAAAACACAACACCAAC
T7_01271_G01	ACCACACACCCACCAACGTCAACACAACCCAAAAAC
T7_01272_G01	CCAACAACCCACCCCAAGTCCCCACCAAACAAAAAA
T7_01273_G01	CAAACCCAAAACCACCCGTCAAACCCCACCACAAAA
T7_01274_G01	CCAAACCAAACAAAACAGTCACACCCACCCAACCAC
T7_01275_G01	ACCAACCCCAAAAAAAAGTCCCCAAAACCCAACCCC
T7_01276_G01	CCCACACCACACAAACCGTCAAAAAAAACACACCCC
T7_01277_G01	CCAACCCCAAACCACAAGTCAAACCAAAACCCCACA
T7_01278_G01	CCCACACCCAAAAAAAAGTCACCCCAACCCAACAAC
T7_01279_G01	CAAAACCCACCAACAACGTCCACAACAACAACCCCA
T7_01280_G01	ACACCACAAACCCCACCGTCACACCACACAAAACAA
T7_01281_G01	CCCACACCAAACCCCAAGTCCCCAAAAAACAACCAA
T7_01282_G01	CAAACCACCCACAAAAAGTCCCACCCCAAACAACCA
T7_01283_G01	CCAAAACCCAACCCCAAGTCCCACAAACAACAAACC
T7_01284_G01	CAAACAAACACCACCACGTCAAAAACCCCAACCCAC
T7_01285_G01	CAACAAACAACCAAAACGTCCCCAAACCCCACACCA
T7_01286_G01	AAAACCCACCCCAAACCGTCCCACAACAAAAAACCC
T7_01287_G01	AAAACCCCACCACACCCGTCAACACAAAAACACCCA
T7_01288_G01	CCAAAACCCAAAAAAACGTCCAAACCCCAACCCCAC
T7_01289_G01	ACACAAAAAAACCCACCGTCACACAACCACAACCCC
T7_01290_G01	ACCACACACAAAACCACGTCACCACCAAACCACCAA
T7_01291_G01	CCCAAACACAAAACCACGTCAACCCCACCCCAAAAA
T7_01292_G01	CCAACACACCCAAACCCGTCAAAAACACCCAAAACC
T7_01293_G01	ACCCAAAAACACCCACAGTCAACCACCAAACAACCC
T7_01294_G01	CAACACAAAAAACACCAGTCACCCCACCCCACACAA
T7_01295_G01	ACCAACAAAAAACCAACGTCCCAAACACCCCACCAC
T7_01296_G01	CCAAAAAAACCACCACCGTCCCAAAAACCACACCAC
T7_01297_G01	ACCCCAAAACCACCCAAGTCCACCCAACAAAAACCA
T7_01298_G01	AAAAACCCACAACCAAAGTCCCCAAACCACCAACCC
T7_01299_G01	AACCAAACCCAAACCCAGTCCACACAAACCCCACAA
T7_01300_G01	AAAACCAACCACCCAACGTCCACAACACCCAAAACC
T7_01301_G01	ACCCACAAAACACCAACGTCCAAAACCCCAAAACCC
T7_01302_G01	ACCAAAACCCCAAACCAGTCACAACCCACAAAACCC
T7_01303_G01	CACAAAAAACCCCAACCGTCCCACCCCAACACAAAA
T7_01304_G01	AAACCACCCAAACCACCGTCAAAACCCAAACCACCA
T7_01305_G01	CCAACCCAAACCAACCCGTCAAACCAACAACAACAC
T7_01306_G01	AACACCCAAAACCCACCGTCCCAACCACCAACAAAA
T7_01307_G01	ACCCAACCAACACCACCGTCACAACACAAACAACAC
T7_01308_G01	ACCCCACAAAACCCAACGTCCCAAAACACCCAAAAC
T7_01309_G01	ACAAAACCCCACCAAACGTCCACACACAAAACCCCA
T7_01310_G01	ACAAACCCAAAAAAAACGTCCCACCAACCACCCACC
T7_01311_G01	AAAAAAACAAACCAACCGTCACCAACCCACCACCCC
T7_01312_G01	AACCCAACAACACCCCAGTCCCAACCCACAAACAAA
T7_01313_G01	ACCCACAAAACCCACACGTCAACCAAAAACCACCCA
T7_01314_G01	ACCAAAACACCACCCACGTCAAACCCCACCAAAACA
T7_01315_G01	ACAACCCCAACCCAAACGTCCACCCCAAAAAAAACC
T7_01316_G01	ACCCCACAACAAAAACCGTCCACCAAACCCACCAAA
T7_01317_G01	ACACCAAACCCAAACCCGTCAAAACCAACAAACCCC
T7_01318_G01	CCAAAAAAACCAAACAAGTCACCCCACCACCCCACA
T7_01319_G01	CAAAACCCAAAACCCCAGTCACCCAACACCCAACAA
T7_01320_G01	AACAACCCCACACCACAGTCCCAAAAAAACACCCAC
T7_01321_G01	CCCAACCAAACCACCCAGTCCCAAAAAAAAACACCC
T7_01322_G01	CCCACCCAAAACCAAAAGTCCAACCCCACCAACAAA
T7_01323_G01	AAACCCACCACCCAAAAGTCAAACCCAACCCACAAC
T7_01324_G01	CCCAACCACCCAAAAACGTCCCAAACCCAAAAAACC
T7_01325_G01	ACAAAACAAACCAACCAGTCCACCAACCAACCCACC
T7_01326_G01	AAAAAAAACCCCACCCCGTCAAACAACCAACCCCAC
T7_01327_G01	CAAACAAACCACCAAACGTCCAAACCAAACCACCCC
T7_01328_G01	CCACCCAACAACCAAAAGTCCCACCAAAACCCAAAC
T7_01329_G01	AACAAAAAACAACCACCGTCCCAACCCACACCCCAA
T7_01330_G01	CAAAAAACCCCAAAACCGTCCCACCACCCAAAAACC
T7_01331_G01	AACCAACACACAACAAAGTCACCAACCCAACCACCC
T7_01332_G01	CCCAAAAACAAACCCACGTCACAACCCCAACCCAAA
T7_01333_G01	CAAACCAACCCCACCCAGTCCACAAAAACCCAACAA
T7_01334_G01	AAACACACCCCACACAAGTCACCAAAACCACCCCAA
T7_01335_G01	CAAAAACCACCCAAACAGTCACCCCACCAAACCCAA
T7_01336_G01	AAACCCCACCCAAACAAGTCCAAAACCCCACCCAAA
T7_01337_G01	CCACCCAAAAAAAACCCGTCCACCAACCAAACCCAA
T7_01338_G01	AAACCCCAAAACCCAACGTCACAACCCCAACCCAAA
T7_01339_G01	AACACCACCACCACCACGTCCAAAACCCAACCAAAA
T7_01340_G01	ACCCCAAAACACCCCACGTCCCAAAAAACCCCAAAA
T7_01341_G01	CACACCAAAACCCCACAGTCAAACCACCCCAAAAAC
T7_01342_G01	CAACCAAACAACAACACGTCCAACACCAAACACCCC
T7_01343_G01	AAAAAACCCAACCCACCGTCCCACCCCAACAAAAAC
T7_01344_G01	CACCACAAACACCCCAAGTCCACCAAAAACCAAACC
T7_01345_G01	ACCCCACCAACCCAAAAGTCCCCAAAAACCCACAAA
T7_01346_G01	ACCCACAAAAACCAACAGTCAACCACCCACAACACC
T7_01347_G01	CAAACCCACCCCACCAAGTCACAAAAAAACCAACCC
T7_01348_G01	CCAAAAAACCACCAAAAGTCACCAAACCCCACCCAC
T7_01349_G01	AACCAAAACCAAAACCCGTCACCCCAACAACCCAAC
T7_01350_G01	ACCCAACCACACCAAAAGTCAAAACCACCACAACCC
T7_01351_G01	CAAAACCCAACAAACCCGTCAAAACACCACCCCAAC
T7_01352_G01	CACAAAACACCACCCCAGTCCACAACAAAAACACCC
T7_01353_G01	CCCAAAAACCACAACAAGTCCACACCCAACAACCAC
T7_01354_G01	CAACAAAACCAACACCAGTCCAACCCACCACCACAA
T7_01355_G01	AACCCCACCCAAAAAACGTCCACCACCAAAAACCAC
T7_01356_G01	ACCAAACCACAACCAAAGTCCCCAACACCAACACAC
T7_01357_G01	CCCAACACCCACAAACCGTCAAAAACCAACCACCAA
T7_01358_G01	AAACCCACACAAAAAAAGTCCCCACCCCAACCCCAA
T7_01359_G01	AACACCACCCACACCAAGTCAAACCAAAAACCCACC
T7_01360_G01	CAAACAACCCCAACAAAGTCCCACCCACCACAAAAC
T7_01361_G01	ACCACCCACACCCCAAAGTCCAAAACCCAAACAAAC
T7_01362_G01	CCACCAAACCCACCACCGTCCAAAAAAACACAACCA
T7_01363_G01	ACCACCCCACCAACAAAGTCACCAAAAACCCCAAAC
T7_01364_G01	CAACACCCCAAAAACCAGTCAACCAAACCAACACCC
T7_01365_G01	AAACCACAACCCAAACCGTCCCAAAAACCACACCCA
T7_01366_G01	CACCAAAACCCAAACCCGTCAAAAAAACACCCACCC
T7_01367_G01	AACCACACCAAACCCACGTCCCCAAACACCCAAAAA
T7_01368_G01	AAACCCAACCCCAAAACGTCCCCACAAACACACCAA
T7_01369_G01	CCCAACACACACCCACCGTCAAACCCCAAAAAAAAC
T7_01370_G01	CCAACCACACCCACCACGTCCAAAAAAAACAACCCA
T7_01371_G01	AAAACCAAACCCAAACCGTCCCAACAACCACCCCAA
T7_01372_G01	AACCCCACCAACAACAAGTCAAACCCCAAAAACCCC
T7_01373_G01	CCAACAAAAAACAACACGTCCCAACCCCAACACCCA
T7_01374_G01	CCCAAAAAACACCCAAAGTCACACACAAACCACCCC
T7_01375_G01	AACCCCAACCCAACACCGTCCCAACACACAAACAAA
T7_01376_G01	ACCAAAAAACCACCCAAGTCCCACACACAAACCCCA
T7_01377_G01	AACCCACCCAACAACAAGTCAAACCACCCAAACCCA
T7_01378_G01	CAACCCCACCAAAACCCGTCCAAAACCAACCAAACA
T7_01379_G01	ACCAACACCACCCACAAGTCCAAACCAAACCAAACC
T7_01380_G01	ACACCCCACAACCAACCGTCAAAACCCAAACAAACC
T7_01381_G01	ACCACCAACCCACAACCGTCCCCAAAAACAAAACAC
T7_01382_G01	CCACCCAACCAAACCCAGTCAAACACCCAAAAACCA
T7_01383_G01	CCAACAACAACCCCAAAGTCACAACACAACACACCC
T7_01384_G01	CACCAAACAAACCCACCGTCAAAACACCAACCACCA
T7_01385_G01	CCCACCCACCCAAAAAAGTCCAAACACAAACCCACA
T7_01386_G01	CCCAACCACAAACAAAAGTCAACACCCCAAAACCCC
T7_01387_G01	AAACCCACCCCAACAACGTCAACAAAACCCCACCAA
T7_01388_G01	AACACCACCCAAAAACCGTCACCCCAACAAAACCCA
T7_01389_G01	CAACAACAAAAAACCCAGTCAACCCACAACCCACCC
T7_01390_G01	CCACAAAACCACAAAAAGTCCCCAAACCCCAACCCA
T7_01391_G01	CCAAAACCCACAACCCCGTCAACAACCCAAAACCAA
T7_01392_G01	CAACCACCAAAAACACAGTCAACCCAACCCAAACCC
T7_01393_G01	CCCACAAAAAAAACCACGTCCAACCCACAACCAACC
T7_01394_G01	CCAAACCCCACCCCACCGTCAAAAACCACACAAAAA
T7_01395_G01	AAACCCCACCCCACAAAGTCAAACAACAACCCACAC
T7_01396_G01	AAACACACACCAAAAACGTCCCAAACCCCAAACCCC
T7_01397_G01	CCCACAACAAACAAACCGTCACCACCCACCAAAACA
T7_01398_G01	CCCACACCCCAACCAACGTCAAACAAAACACCCAAA
T7_01399_G01	ACCCACCAAACCCCAAAGTCAACCCACCCCAAAAAA
T7_01400_G01	CCAACCCACACCCACAAGTCCCACAACCACAAAAAA
T7_01401_G01	AAAAACACCACCCACCCGTCAAAACCAACCACCCAA
T7_01402_G01	CAAAAAACCCAAAACCAGTCAACACAACCCCACCCC
T7_01403_G01	CCCAAACCCCAACCAAAGTCCCCAACCCCAAAAAAA
T7_01404_G01	CAAAAAACCAACCAACCGTCCCACCAAAACCACACC
T7_01405_G01	CAAACCCAACCCCAAAAGTCCCAACCCAACAACAAC
T7_01406_G01	CCCAAACAAACAACCACGTCACCCCAACCCAAACAA
T7_01407_G01	ACCCAACACCAAACAAAGTCCAAACCCACCCCAAAC
T7_01408_G01	AACCAACACACACAACCGTCCACCCCAAAACCAACA
T7_01409_G01	AAAAACCACCACCAACCGTCCCAAACCCCAAACCAA
T7_01410_G01	AAAACCCAAAACCAACCGTCCCAAACAAACCACCCC
T7_01411_G01	CCACAAAACACACAACAGTCAAAACCACCCCACACC
T7_01412_G01	AAACAACCACCACCAAAGTCACCACAACCCACCCAA
T7_01413_G01	CCACACCCAAAAAACACGTCCCCAACAACCCCAAAA
T7_01414_G01	CAACCCACCCACCCCACGTCAAAAAAAACCCAACAA
T7_01415_G01	AACACCCAACAAACCAAGTCACCCCACAACAACCCA
T7_01416_G01	AAACAAACACACCCAAAGTCAACAACCCCACCACCC
T7_01417_G01	CCAACAACAACCCCAACGTCACCCCACCAAACAAAA
T7_01418_G01	CAAACAAACACCCAACCGTCAAACCACCAAAACCCC
T7_01419_G01	AAACCCAAACCCACCCAGTCAAACCACACCAAACAC
T7_01420_G01	ACACCCCACAACAAACCGTCCAAACCAAACACCAAC
T7_01421_G01	CAAACCCCAAAACCCAAGTCACCAACAACCCACAAC
T7_01422_G01	ACCAAACCACCCCACAAGTCAAACCCCAAACAAACC
T7_01423_G01	CAAAACCACAAACCCCAGTCAACCCCAAACCCCAAA
T7_01424_G01	AACCCACCCCAAACCCAGTCCCACAAAAAAAACCAC
T7_01425_G01	ACACACCCCAACCCCACGTCCAACCAAACAAAACAA
T7_01426_G01	ACACCACCCAACACACAGTCCCCAAAACAAACCCAA
T7_01427_G01	CCCAAACCCCAACCCCAGTCCAAAACCAAACCAAAA
T7_01428_G01	CCAACACAAAACAACCAGTCCACCCAAAACCACCCA
T7_01429_G01	CAACCACCAAACAACCAGTCCACAAACCAAACCCCA
T7_01430_G01	CACCCCACCACCCAAAAGTCAAAAAACACCCAAACC
T7_01431_G01	ACCCCACACCAAAACACGTCCCAAAACAAAAACCCC
T7_01432_G01	ACCACCCAAAAAAACCAGTCACCAACACCCACCAAC
T7_01433_G01	ACCCCAACCCCAAACCAGTCACAAACAAACCACCAA
T7_01434_G01	CACCCCAACCAACCCAAGTCACAAACCAAACCAACA
T7_01435_G01	AAAAAACAAACCCCACCGTCAAAACCACCCCAACCC
T7_01436_G01	ACAAAACAACCCCAAACGTCCCCAAAACAACCCACC
T7_01437_G01	CAAACCAAAACCCACCCGTCAACCCCAAAACCCAAA
T7_01438_G01	AACCCCAAACACCACCCGTCAACAAACACCAAACCA
T7_01439_G01	CCCAAACACCCCACAAAGTCCCAAAACCAAACACCA
T7_01440_G01	CCCAAACCCACAAAACAGTCAAACCAACCCAACCCA
T7_01441_G01	CACAACCAACAACACCAGTCAACCCCAAAAACCCCA
T7_01442_G01	AACAACCAACCACCAAAGTCAACCACACACAACCCC
T7_01443_G01	ACACCACCAAAAACCCCGTCACCAAACCCCACAAAA
T7_01444_G01	AAACCCCACAAAAAAACGTCCACCCCACACAACACC
T7_01445_G01	CACAACCAACCCAAAACGTCCCCAACCAAAACAACC
T7_01446_G01	AAACCACCCAACAACAAGTCAACCAAACCCCACCCA
T7_01447_G01	AAAAAACACCCCAACCAGTCAACAACCCAACCACCC
T7_01448_G01	ACCACCAAACACCCAACGTCAACCAAACCCCAACAA
T7_01449_G01	CCAAACCACCAAAAACCGTCCCACACCAACAAAACC
T7_01450_G01	CCCACCAAACCCAAAACGTCACAAAACCCAACCAAC
T7_01451_G01	ACCACAAAAAAAACCACGTCCCCACCAACCCACACA
T7_01452_G01	AAACCACCACCCCACACGTCCCCAACAACAAAAAAC
T7_01453_G01	AACACCCAAAACCACCAGTCACCCACCAAAAAACCC
T7_01454_G01	AACCAAACCCCAAACCAGTCCCACCCCAACAAAACA
T7_01455_G01	CAAACCCCAAAACCAACGTCCACCCAAACAACCCAA
T7_01456_G01	AACCCAAACCCCAAAACGTCCACCAACCAAACCAAC
T7_01457_G01	CCACCAAACCCCAAACCGTCCAACCCAAAAAACCAA
T7_01458_G01	CCACCACAACCAAAACAGTCAAACCCCACACACACA
T7_01459_G01	AAACCACAAAACAAACCGTCACCCCACCCCAAACCA
T7_01460_G01	CCCAACAAACCCACAAAGTCACCCACAACACAACCA
T7_01461_G01	AACCCACCCCACCAAACGTCAAAACAACCCCAAAAC
T7_01462_G01	ACCCCAAACACAAACAAGTCCAACCCCACACCCAAA
T7_01463_G01	CCCACAACAAAAACCCAGTCACCCAACCACACAACA
T7_01464_G01	AAACCCAACCACACCCAGTCAACACAACCAACCCAA
T7_01465_G01	ACAAAACAACCCACCAAGTCCACACCCACCCAAAAC
T7_01466_G01	ACCAAAAACCCAAACCAGTCACAAACCCCAACACCC
T7_01467_G01	CCACACAACAAAAACCCGTCACAAAAAACCCACCCC
T7_01468_G01	CAACAAAACCAAACCACGTCAACCACCCCAACAACC
T7_01469_G01	CCAAACCCAAACAACCAGTCAAAACACACCCCAACC
T7_01470_G01	CACCCCAACAACCCAAAGTCCCAACCCACAAACAAA
T7_01471_G01	AACACACAAAAACCCAAGTCCCCACACCCAAAACCC
T7_01472_G01	AACCCACCACCACCACCGTCCAAAACCAACACAAAA
T7_01473_G01	AAACACCCCAACAAAACGTCCAAACACACCCACCCA
T7_01474_G01	AACCCCAAACCACAACAGTCAAAAAACCCACCCCAC
T7_01475_G01	CAAAAACAACCCAAAAAGTCACCCAACCCCAACCCC
T7_01476_G01	AAAAAACCCCAACCCCAGTCACCAACACCACACCAA
T7_01477_G01	AACCCAACCAAAACCCAGTCACCCCAAAAAACACCC
T7_01478_G01	AAAACCCCAACCAAAAAGTCAACACCACCCCACCAC
T7_01479_G01	ACACCCAACCCAAAAAAGTCACCACCCAACCCAAAC
T7_01480_G01	ACCACAACCACACAACCGTCCAAAACCCAACCCAAA
T7_01481_G01	ACCCCAAACCCAAAACCGTCAAAACCCCAACCCAAA
T7_01482_G01	CAACCACCCACAACCCCGTCACACCAAAAAAACCAA
T7_01483_G01	ACAAAACCACAAACCCCGTCAAAACCCCAAACCCAC
T7_01484_G01	ACCACAACAAAACCCCAGTCCCCAACCAACCAAAAC
T7_01485_G01	CAACCCAACCCACCAACGTCCAACAACCAACCAAAA
T7_01486_G01	AACCAACAAAACACCCCGTCCCACACCACCAAAAAC
T7_01487_G01	AAAACCCCAACCAACCCGTCAACCCCAAAAAACCCA
T7_01488_G01	ACCACACCAACAAAACCGTCCAAAACACCAACCACC
T7_01489_G01	CACCCAACCAACCCCAAGTCAAACCACAAAACCAAC
T7_01490_G01	CCAAACCAACAAACCCCGTCAAAACCAACCCCAACA
T7_01491_G01	AACCCAAAAACCAAAAAGTCACCCCACCCCACCACA
T7_01492_G01	ACACCACCCAAAAACCAGTCCCAAAAACACAACCCC
T7_01493_G01	ACACCCAAACAACCACCGTCAACAACACCCACCAAA
T7_01494_G01	ACCCAAACACACAACCAGTCAACCCAAAACCACACC
T7_01495_G01	ACACACCACCAAAACCAGTCACACCAACCCACAAAC
T7_01496_G01	CACCCACACCCCACAAAGTCCAAAAAAAAACCCACC
T7_01497_G01	AAACCCACCCCAACCCAGTCACACAAAAAACCCAAC
T7_01498_G01	AAACACACACAAAACACGTCACCAACCCACAACCCC
T7_01499_G01	AAAAACCCACCAAACACGTCCCACCAACACCACACA
T7_01500_G01	ACACAAAACACCAAACCGTCCACCAAACCCACCACA
T7_01501_G01	ACCCAAACCCCAAAAAAGTCCAACCCCAAACCCAAC
T7_01502_G01	CCAAACAACCAACACCAGTCCACACCAACCACCAAA
T7_01503_G01	ACCCCAAACAACAACCCGTCCAACACACAAACCACA
T7_01504_G01	ACCAAACACCACCACACGTCAAAACCAAAACCCCAC
T7_01505_G01	AAAAACAACCCACCCCAGTCACCCCACCACCAAAAA
T7_01506_G01	ACCCACACAACAACCCAGTCAACAACCACAAACCCA
T7_01507_G01	CACACACCCCACCAACAGTCAAAACAAAAACCACCC
T7_01508_G01	CCCAAAAACCCCAAAACGTCCCACAAAAAACACCCC
T7_01509_G01	ACCAAAAAACAACCACAGTCCAACCCACAACCCACC
T7_01510_G01	ACCCAAACACACCAACAGTCCCCAACCACCAAAAAC
T7_01511_G01	AAACCAAAAAACCCACCGTCCCCAAACAAACACCCC
T7_01512_G01	AAAACAACCCCACCAAAGTCACAAACCCACACACCC
T7_01513_G01	CAAAAACCCAAAACCACGTCACACCACCACCCCAAA
T7_01514_G01	CCAAAACAAACCAAAACGTCCACACAACCCAACCCC
T7_01515_G01	CCACACCCACAACCACCGTCCACAACCAACAAAAAA
T7_01516_G01	ACAACCCCACCAACCCAGTCACCAAAACAAAACACC
T7_01517_G01	AAAAAACCCACACCCAAGTCAACCCCACCACACAAC
T7_01518_G01	CCCACCAAAACAACCACGTCAACCAAAAAACCACCC
T7_01519_G01	AAACCCACCAACCACCAGTCACAAACCACAACCCAA
T7_01520_G01	ACACCACACAACCAAAAGTCACCAAACCCAAACCCC
T7_01521_G01	CCACAAAACCAAACACAGTCCCCAAAAAACCCACCC
T7_01522_G01	CACAACAACCAACCCCAGTCACCCACCAACAAAAAC
T7_01523_G01	AAAACCCAAACACCACCGTCCCACCAAAAACCCCAA
T7_01524_G01	CACCACCAACCAACCCAGTCAAAAACCCCAACACAA
T7_01525_G01	CCCAACCACACCAAACAGTCACCCCACAAAAACCAA
T7_01526_G01	AACCCCAACAACCCACCGTCCCAAAAAAAAAACCCC
T7_01527_G01	AACACACCCCACCCCAAGTCACAACCACAAACCAAA
T7_01528_G01	AAAACCACCCCAAAAACGTCCACAAACCCCAACCCA
T7_01529_G01	ACAACACCACACCCAACGTCCCACCAAACAAACAAC
T7_01530_G01	AACCCCACAACCCCACCGTCCACAACAAAACACAAA
T7_01531_G01	AAAACCACAACCCCAACGTCAAACCCCAAAACCCAC
T7_01532_G01	CCCAAACCCAACAACCCGTCAAACACAACACCAAAC
T7_01533_G01	AAAAAACCACCCACCCAGTCCCAAAACCAAACCCCA
T7_01534_G01	AACCACCCCAACCACACGTCACAAAACCCCAAAAAC
T7_01535_G01	CAACCCCAAAAAACACCGTCAAAACCCCACCAAACC
T7_01536_G01	AAACCAAACACACACCAGTCACACACCCACCAAACC
T7_01537_G01	ACCACAACAAAAAAAACGTCCCACACACCACCCACC
T7_01538_G01	AACACAAACCCAAACCCGTCAACCCACCAACCACAA
T7_01539_G01	ACCCCAAAAACAAAAACGTCCCAACACCCACCCCAA
T7_01540_G01	ACAACCCACCAACCCCAGTCAAAAAACAACCCCAAC
T7_01541_G01	CCACAAAAAAACCCACCGTCCACCCAACAACCACAA
T7_01542_G01	CCAACACCCACAAACAAGTCCCAACCCAAAAAACCC
T7_01543_G01	ACCCCAAACCCCACCCAGTCCAACAAAAAACCCAAA
T7_01544_G01	CACCAACACCCCAAAACGTCAAACCCAAAACCCACA
T7_01545_G01	CCCAAACCAACCCAAACGTCACCCAAAAACCAACCA
T7_01546_G01	CCCAAAAAACAAAACCAGTCCCACCAACCACAACCC
T7_01547_G01	CCCAAACACAAAAAACCGTCCAAAACCCCACCAACC
T7_01548_G01	CCAACACAACCAACCACGTCCACACCAAACCCAAAA
T7_01549_G01	AAACCAAAAAAACACCCGTCACCCCACCCACAAACC
T7_01550_G01	ACCAAACCACACAAAAAGTCCACCCCAACAACCCCA
T7_01551_G01	CCCACCCAAAAACCCCAGTCCAAAAAACCCACAAAC
T7_01552_G01	CCAAAAAAAACCAACCCGTCCACCCAAACCAACCCA
T7_01553_G01	AACCCAACCCAAAAACAGTCCCACACCCACAACACA
T7_01554_G01	AACCCACCACCCACCAAGTCCCCAACAAAAAACCAA
T7_01555_G01	AAACCAAAAACACCCCAGTCCCCAAAACCACCCAAC
T7_01556_G01	CCCAAACCCAAACCACAGTCCCCACCAAAACCAAAA
T7_01557_G01	AAACCCAAACCACCCACGTCACAACCCCAACCAAAA
T7_01558_G01	CCCAAACAAAACACCCAGTCCCACCAAAAAAACCCC
T7_01559_G01	CCAACAAAACACCAAACGTCCAACCCAAACCAACCC
T7_01560_G01	AAAAACCCAAAACACCCGTCACCCCAACCCCAACAA
T7_01561_G01	ACCCACCCCAACAAACCGTCAAACAAACCCAAAACC
T7_01562_G01	CCCACCACCCAAACAACGTCAAACCAACACCAAAAC
T7_01563_G01	ACCACCACACCCAAACAGTCAACAAAACACCCCAAC
T7_01564_G01	AAAAACCCCAACACCCAGTCACCAAACAACCCACAC
T7_01565_G01	CCCACCAACCAAAACAAGTCCCAAAACAACACCCAC
T7_01566_G01	CAAACACAACCAACAAAGTCAACCCCAAACCCCACC
T7_01567_G01	CCAACACCACCCCAAAAGTCCACAACCCACCAAAAA
T7_01568_G01	CACCCACACCAAAAAACGTCACCCCACAACAACACA
T7_01569_G01	CAACACACCCACAACCAGTCACACAAAAAACCCCAC
T7_01570_G01	CACCAACACCAAACCCCGTCAAAACACAACACCCAA
T7_01571_G01	ACCCCACAACAAAACAAGTCCCAACACACCACACCA
T7_01572_G01	CACACAAACACAAACACGTCCAACACCAAACCCCAC
T7_01573_G01	AACAACAAACACCAACCGTCCCAACACCAACACCCA
T7_01574_G01	ACCCCAACCAACAACCCGTCCAAAACACCAACAAAC
T7_01575_G01	ACCACAAAAACCCAACAGTCCACCCACCAAAACCCA
T7_01576_G01	CCAACACCCAAACACCAGTCACAACCCAAAACCAAC
T7_01577_G01	CCAACCACAAACCCAAAGTCCCCAACAAACCCCAAA
T7_01578_G01	CACACCCCAAAAAAACCGTCCACCAAAAAACCACCC
T7_01579_G01	ACCCACCCAAACCCCACGTCAACCACAAAACAAACA
T7_01580_G01	CCCAACCAAACCAACCAGTCACAAACCCACAAACCA
T7_01581_G01	CCCAAACAAACCCAACAGTCAAACCACACAAACCCC
T7_01582_G01	CAAACCACCCCAACACCGTCCAACCCACACAAAAAA
T7_01583_G01	CCAACCCAAAAAACCCAGTCAAAAACCCACACACCC
T7_01584_G01	CAAAACAAACCACACCCGTCACCCCAACAAAACACC
T7_01585_G01	CCAAAAACCCACCCCAAGTCAAACACCCAAACCACA
T7_01586_G01	CAAACCCCACAAAACCCGTCACCCAAACACACAACA
T7_01587_G01	CCCAAAAAAAAAACCAAGTCCACCCACCACAACCCC
T7_01588_G01	ACAACCCAAACACACAAGTCCCCACCAACAACCAAC
T7_01589_G01	ACACCCCACCACCCAAAGTCAAAAACCACCAACAAC
T7_01590_G01	AAACCCACCAACCCCAAGTCACAACCAAACAAACCC
T7_01591_G01	CAACACCCCACCAAAACGTCCAACCAAACCAACACA
T7_01592_G01	CACCCAAACCAACAACCGTCAAAAACAACCCCACCA
T7_01593_G01	CAACCACCAACCACCAAGTCCAACAAAAAACCCCAC
T7_01594_G01	ACACCCAAACCCACCCAGTCAAAACAACCCAACCAA
T7_01595_G01	AAAAACCAAAAAAACACGTCACCCACCCACCCCACC
T7_01596_G01	CCACAACCCACCCAAAAGTCAAAACCACACACACCA
T7_01597_G01	AAACCCCAAACCAAACCGTCAACCCCAACAAACCCA
T7_01598_G01	CAAAACCCAAACCCCACGTCAACCAAACAAAACCCC
T7_01599_G01	AACAACCAAAACCACACGTCACCAACCACACAACCC
T7_01600_G01	CAACAACCCCAAACACCGTCACCAACCAAACAACCA
T7_01601_G01	CACCACACAAACACACAGTCCACAACCAACCACCAA
T7_01602_G01	ACACCAACCAAACCAACGTCAAAACACCCAACCACC
T7_01603_G01	AACCCACACCCCACCACGTCACAACCACCAAAAAAA
T7_01604_G01	CAACACCAAAACCACACGTCCCACCCCAAACAAAAC
T7_01605_G01	ACAAACACACCCACAACGTCACACCACACACCACAA
T7_01606_G01	CCAACCCACACACACAAGTCACCCCAAAAAAAACCC
T7_01607_G01	ACAACCCAAACCCAAAAGTCCAAAACACCACCACCC
T7_01608_G01	AACCCAACAACCACACAGTCCCCACACCAAAACACA
T7_01609_G01	CCACCCAACCCAACCACGTCCACCAAAACAAAAAAC
T7_01610_G01	CCCACAACCCAAACCACGTCAACCCCAAAAAACAAC
T7_01611_G01	CAACACCCAAAACCAAAGTCCAACCAAACCAACCCC
T7_01612_G01	AACCCCAAACCAACCCCGTCAACAAACCCAAAAACC
T7_01613_G01	CCAAACCCAAACCCCAAGTCACCACAAACAAACCAC
T7_01614_G01	CACAACAACCCACAAAAGTCCAACCACCCCAAAACC
T7_01615_G01	ACACCACCCCACCAACCGTCCAAAACCCCAAAAAAA
T7_01616_G01	ACAACACCACAACCCAAGTCACCACAACCACAACCA
T7_01617_G01	ACCCACCCAAAACCCAAGTCCCAACCCCACAAAAAA
T7_01618_G01	CAAACCCCAACACCAAAGTCCACAACCAACAACCAC
T7_01619_G01	CACAAAAACCAAACACCGTCCACACACCCAAAACCC
T7_01620_G01	AAAAACACCACACAAACGTCCACACAACACCCCACC
T7_01621_G01	CCAAAACCAACCACACAGTCACCACCCAAAAAACCC
T7_01622_G01	ACCAAAACACACCCACAGTCCACAAACCAAACCCAC
T7_01623_G01	AACAACCCACCACCAAAGTCCCCAACAAAAAACCCC
T7_01624_G01	AAACACAACCCCACACAGTCACACCCCACCAAAAAC
T7_01625_G01	CAAAACACCACCAACAAGTCCACACCCACCAAACCA
T7_01626_G01	ACCAAACAAAAAACCCCGTCACACACAACCACCACC
T7_01627_G01	AAACACCCAACCACCCAGTCACAAAAACACCCCAAC
T7_01628_G01	CCACACACACCAAAAACGTCACAACACACCAAACCC
T7_01629_G01	CCACAACCCAAAACAACGTCCAACACCCCAAAACCA
T7_01630_G01	AAACCACACCCCAAAACGTCACAAACACACCCAACC
T7_01631_G01	CCACAACCCAAACCAACGTCACAACAACCCCACAAA
T7_01632_G01	AAACAACCCACCACCCCGTCCCAACAACAACACAAA
T7_01633_G01	ACCCACCCAACACACAAGTCACACACACCCAAAAAC
T7_01634_G01	AACCACCCACCCAAAAAGTCAACCCAACCCCAACAA
T7_01635_G01	CCCAACCCCACCCAAAAGTCACAACAACAACACCAA
T7_01636_G01	AAACAAACCCAACACCCGTCACCCCAAACAACACCA
T7_01637_G01	ACCAACACCAAAAACCCGTCCAACCAACCACCAAAC
T7_01638_G01	CAACACAAACCCAACCCGTCACCACACACAAACCAA
T7_01639_G01	CCAACACCCCAAAACAAGTCCCCACAAAACACCACA
T7_01640_G01	ACCAAACACAAAAACCAGTCACCCACCCACCACCAA
T7_01641_G01	CCAAACACCACCACCCCGTCAAACCAAAAAACCAAC
T7_01642_G01	ACCCAACCCCACCCAACGTCACAAAAAACACCAAAC
T7_01643_G01	ACAACCCCAACAAAAACGTCCCCACACAACCAAACC
T7_01644_G01	CACAACACAACCCACAAGTCACCACAAAACAACCCC
T7_01645_G01	CCAAAACAACAAAAACCGTCAACACCCAACCCCACC
T7_01646_G01	CCCAACAAAACAAAAACGTCAACCCACACCACCCAC
T7_01647_G01	CCCACAAACCAAAACCCGTCCACCAACCCAAAAACA
T7_01648_G01	CCAACCCACACAAAAAAGTCAACCCACAAACCACCC
T7_01649_G01	CCCAACAACAAACCCAAGTCACCCAAAACAACACCC
T7_01650_G01	CCAAAAAAACCCCACCCGTCCCAAACAACAAACACC
T7_01651_G01	CAAACACCCCAACCACAGTCCCCACACACCAAAAAA
T7_01652_G01	ACCCCACACCAAACCACGTCAACCCAACAAAAACCA
T7_01653_G01	CCACACAAACCCAAACAGTCCACAAACACCCAAACC
T7_01654_G01	ACCAACCAACCAACCAAGTCCACACACCAAACACCA
T7_01655_G01	ACAACAAACCCACAAACGTCCCCACACCACAAAACC
T7_01656_G01	CCAACCCAACACACCACGTCAACCACAAAAACCACA
T7_01657_G01	AACACAAACCACCAACAGTCACCACACACAACCCCA
T7_01658_G01	ACCAACACACCCCAAACGTCACAAAAACCAACCCAC
T7_01659_G01	CCACAACCCCAAAAAACGTCACCAAACCCAACAACC
T7_01660_G01	AACACCCAAACCACCCCGTCCAAACAACAAACAACC
T7_01661_G01	AAACCCCAACAACAAAAGTCCCAAACCCCACCCCAA
T7_01662_G01	CAACCAACCAAAAACCAGTCCACCCCAAAAACCCAC
T7_01663_G01	ACCACCCACAAAAAAACGTCAACAAACCCCACCACC
T7_01664_G01	CCAACAACCCACAAACAGTCCACCCCAAAAACACCA
T7_01665_G01	CCAAACAACAAAACCCCGTCAAACAACACCCCACAC
T7_01666_G01	ACACACCCCAAACCACAGTCACCAAACAAAACCCCA
T7_01667_G01	CCACCAAACCACCAAAAGTCCCCAACAAAACAACCC
T7_01668_G01	CCACAACAACAAAAACAGTCCCAACACCACACCCCA
T7_01669_G01	ACCCACAAACAAAACAAGTCCACCAAACCACCCACC
T7_01670_G01	ACCAAAACCCCAAACACGTCCAACCCACAAAACCCA
T7_01671_G01	ACACAACACACAACACCGTCCAACCAAACCAACCAC
T7_01672_G01	ACCACCACCCAAAACCCGTCAACACAAACCCAACAA
T7_01673_G01	AAACCAAACCCAAACCCGTCACCAACCAAACCCCAA
T7_01674_G01	CCCACAAACCAAACCCCGTCAAAACCCCAACAAAAC
T7_01675_G01	CCCAAACCCAACACACAGTCCAACAAACCCACCAAA
T7_01676_G01	ACAACACCACAACACCCGTCACACAAAACCCCAACA
T7_01677_G01	CAACCCACCCCACAAACGTCCCCAAAACCAAAACAA
T7_01678_G01	ACCCCAAAAACACACCCGTCCACAACCCCAAAAACA
T7_01679_G01	CCCACAAACCACAAAACGTCCCCAAAACAACAACCC
T7_01680_G01	CAACAACACCACAACCCGTCACCAAAAAACACCCAC
T7_01681_G01	CCACCCCACACACACAAGTCAAAACAACCCCAAACA
T7_01682_G01	ACACAAAACCAACACAAGTCCCCACCACACCACACA
T7_01683_G01	CCCACCAAACCCAACAAGTCCACACAAAAAAACCCC
T7_01684_G01	ACCCAAACCCAAAAACCGTCCACAACACCAAACCCA
T7_01685_G01	AACCCACCAACAACAACGTCCCAACAACCAACCCAA
T7_01686_G01	CCCAACCACCCAAAACAGTCCAAACCCACCAAACAA
T7_01687_G01	AAAAAACAACCACCCCAGTCCCCACCAAAACCCCAA
T7_01688_G01	AACAACCAACCCAAACCGTCAACACACCACCCCAAA
T7_01689_G01	CAAAACCACCACCAACCGTCCACACCCAACAACAAA
T7_01690_G01	CACAAAACCCCAACAAAGTCACCCCAAAACCCACCA
T7_01691_G01	ACAAACCCAACAACCACGTCACCACACCAAAACACC
T7_01692_G01	ACAACCCCACACCACCAGTCAACAAAAAAACACCCC
T7_01693_G01	AAAAAAACCCAAACCCCGTCAACCCACAACCCAACC
T7_01694_G01	CCACCAAAAACCAACCCGTCCAACAAACAACACCCA
T7_01695_G01	CCCACCCAAAACAAACCGTCCCCACAAACAACAACA
T7_01696_G01	CCCACACAAAAACACCAGTCAACAACCCACCAACAC
T7_01697_G01	CACCAACCACCAACCAAGTCACCAACAAACAAACCC
T7_01698_G01	ACCAAACCAACAACCAAGTCAAACCCAAACCACCCC
T7_01699_G01	ACCCACCACACAACCAAGTCAACAAACCACCCAAAC
T7_01700_G01	CCACACACCAACAAAACGTCCCCAAAACAACCACCA
T7_01701_G01	AACCACCAACCAACCAAGTCCAACCCACCAAAAACC
T7_01702_G01	CAACAAACCCAAACCAAGTCCCACAACACCACACCA
T7_01703_G01	CACAACCCCAACCCAAAGTCCACAACCCCAAAACAA
T7_01704_G01	AACACCACAAACCACAAGTCCACCACAACCAACCAC
T7_01705_G01	CACACAAAACAAACAAAGTCCACCCACCACCCAACC
T7_01706_G01	CCCAACACCAACAACCAGTCAAACACACACCAAACC
T7_01707_G01	ACCCCAACACACACAACGTCAAACAACCACCCAACA
T7_01708_G01	AAACACCCCACACCACCGTCCACAAAAAACACAACC
T7_01709_G01	CACCCCAACCCACAAAAGTCACACAAACAACCCAAC
T7_01710_G01	AACCCCAACACCAACACGTCCAAAAAACCCCACAAC
T7_01711_G01	ACAACAACCCACCCAAAGTCACACCAAACACACCCA
T7_01712_G01	CACCACCAACACACCCAGTCCACAAAACCACAACAA
T7_01713_G01	CAACCCAAAAACAAACCGTCACCACCAAAACCCCAC
T7_01714_G01	AACCACCACCCAAAAACGTCCAACCAACACACCACA
T7_01715_G01	ACCCAAAAACACCCCAAGTCAAAAACACCCACCCCA
T7_01716_G01	CCCAAAAACACACACCCGTCAAAAAACACCACCCCA
T7_01717_G01	CCAACCACCCACCCCAAGTCAACAAAAAAACCCAAC
T7_01718_G01	ACACAACCAAAACCCCAGTCCACCAAACCAACCCAA
T7_01719_G01	CCCAAACCACCACCCAAGTCACCAAAAAAAACCCCA
T7_01720_G01	ACAAAACCCCAACAACCGTCCACAAACCAACCAACC
T7_01721_G01	CCCAAACCAAAAAACACGTCCAACCCAACCCCAAAC
T7_01722_G01	ACACACAACCAAACACCGTCCACCAAACCAAACACC
T7_01723_G01	AAAAAACCACACAACCCGTCCACCAACCCAACCCAA
T7_01724_G01	CCCACCCAAACCCAAAAGTCCAACACCCCACAAAAA
T7_01725_G01	CCCAACAAACCAAAAACGTCCCAACACACCCAACCA
T7_01726_G01	ACCACAACCCACCCACAGTCAACCCCAAAAACAAAC
T7_01727_G01	CACCACCCACACCCAACGTCACAAAACAACCAAAAC
T7_01728_G01	CCACCAAAACACCAAAAGTCACCACCCAACACCACA
T7_01729_G01	AACCCAAAAAACACCACGTCACCCAACACCAACCCA
T7_01730_G01	CCACAACCACACCAAAAGTCAACCACAAACCACCCA
T7_01731_G01	CCACAACCCAAACCAAAGTCAAAACACCACCAACCC
T7_01732_G01	ACACCACACCAAAACCAGTCCAACCCACAACACAAC
T7_01733_G01	ACCAAACACCCAAAACAGTCACACCCACCCAACCAA
T7_01734_G01	CCACCAAAACAACACCAGTCCAAACCACACAACACC
T7_01735_G01	AAACACCACACCCACCAGTCAAAACCCCACCCAAAA
T7_01736_G01	ACCCAAACACAACCAAAGTCACCCCAAACAAACCCC
T7_01737_G01	CCCACAACAACCCCAAAGTCCAAACCCACCAAAAAC
T7_01738_G01	CACCAAAACCACCCAAAGTCAACACAACCACCCCAA
T7_01739_G01	AACCAAAACACACCCACGTCACCAAACCCAAACCCA
T7_01740_G01	ACAACACACCACAACAAGTCCCAAACCAACCACACC
T7_01741_G01	CAAAACACCCACACAACGTCAAACCCCACCAACCAA
T7_01742_G01	CCACCACACAACACACCGTCAAAAAAACACCACACC
T7_01743_G01	CCCAACCCCAAAAACAAGTCACACCAACAAACACCC
T7_01744_G01	CACCAAACACAACACAAGTCCACCACACAAACCCAC
T7_01745_G01	ACACACCCACAAAAAACGTCACCCCAACCCAAACCA
T7_01746_G01	CACCCCAACAACACAAAGTCAACCCCAAAAACACCC
T7_01747_G01	CAACAACAAAAAACCCAGTCCCACCAAACACCACCC
T7_01748_G01	CCCAAAAAAAAACCCACGTCAAACACACACCACCCC
T7_01749_G01	CAAACACAACCACACCAGTCCACACCCAACAAAACC
T7_01750_G01	CAACAACACAAACACACGTCCCCACCACACAAAACC
T7_01751_G01	ACCCAAACACAACACCAGTCACACACACACCAACAC
T7_01752_G01	CACCAACCAACACCCAAGTCAACCAAACCACCCAAA
T7_01753_G01	CCCAACCCAAAACCCAAGTCAAACAAACCCCAACCA
T7_01754_G01	CCACCCCAAACCACAACGTCCCAACAAAACACACAA
T7_01755_G01	ACAAAAAACCCCAAACAGTCCAAACCCCACCCCACA
T7_01756_G01	CCAAACAACCACAAAAAGTCAACCCACCACCCAACC
T7_01757_G01	AAAAAACCCAACCCACAGTCAACACAACACCCCACC
T7_01758_G01	CAACCAAAACCACAACAGTCAAAACACCCACCCCAC
T7_01759_G01	CACACACAAACCCACCAGTCAAACACACCACCAACA
T7_01760_G01	CAAAAACACAACCCCAAGTCCCACACCCACCAACAA
T7_01761_G01	AACCCAAAAAACAACCCGTCAAACCCACCCCACAAC
T7_01762_G01	CCAAAAAACCACCCACAGTCCCAACCAACCCCAAAA
T7_01763_G01	CACCAACCCACCCACACGTCAAAAACCAACCAAAAC
T7_01764_G01	ACCAAACCAACCCACCAGTCCAAAACCCCAAAACAC
T7_01765_G01	AACACCCCAACCACAACGTCCCAACAAACCACCAAA
T7_01766_G01	CCACAAACCACAAAACAGTCACCCACCACAACCCAA
T7_01767_G01	CCACAAAAAAAACACAAGTCCCCACCCCACAACACC
T7_01768_G01	CAACAACCCCACCAACCGTCACACAAACACAAACCA
T7_01769_G01	AACACCCAACCAACCAAGTCAAACCACACACACCAC
T7_01770_G01	ACAAAAACCACACCCAAGTCCAAAACCACCCCACCA
T7_01771_G01	CCCAACCAAAACAACCAGTCACCCCAAACACCCAAA
T7_01772_G01	CCCACCAAACACCCAAAGTCAAACAAACCACAACCC
T7_01773_G01	ACACCAACAAACCCAAAGTCACCACACACCCAACAC
T7_01774_G01	ACCCACAAACACACCAAGTCCAAAACCCACAAACCC
T7_01775_G01	ACACCACAACCCACCCCGTCAAACAAAACACCCAAA
T7_01776_G01	AAACAACACCCCAAAAAGTCAACCCCACACACCACC
T7_01777_G01	ACACACAAAACCACACCGTCAAACCCACCACACACA
T7_01778_G01	CAACACCACACAAACACGTCCACCCACCCACAAAAA
T7_01779_G01	CCCAAACCAACACCCACGTCAACCACAACAACAACA
T7_01780_G01	CCAACCAACACCACAAAGTCCCCAAAAAACACACCC
T7_01781_G01	ACCCACACCCAAAACACGTCCACACAACAAAACCCA
T7_01782_G01	CACCAAACAACAACACCGTCACACCAAACCCAACCA
T7_01783_G01	CCCACCCCACACCCCAAGTCACAAAAAAAAACCCAA
T7_01784_G01	CACAAAACAACACCCACGTCCACCAACCAACAACCA
T7_01785_G01	CCCAACCCACCCAAACCGTCAAACACAAAACAACAC
T7_01786_G01	ACAACCCAAAAACCCCAGTCACACCCAAACCACCAA
T7_01787_G01	AACAACACACCCACAAAGTCCAACCAAAACCCCACC
T7_01788_G01	ACCAACAAACCCCACCAGTCAAACAAACCCACACCA
T7_01789_G01	CACCACAACCCCAAAAAGTCAACACCAAACCCAACC
T7_01790_G01	ACCCAACCCCAACCAAAGTCCAAAAACCCACCCAAA
T7_01791_G01	AACACCAAACCCACAACGTCCACCAAAACCACACAC
T7_01792_G01	ACAAACAAACCCAACCCGTCAACCCCACACAACACA
T7_01793_G01	CACCAAACAAAACCAACGTCCACAAACCCACCCCAA
T7_01794_G01	CCACAAACCAACAACCAGTCACCCCAAACCCACAAA
T7_01795_G01	ACCCAAACAACACCAAAGTCCCACCAAACCCACCAA
T7_01796_G01	CCCACCAAACCACAAACGTCCCAAACCCAAAACCAA
T7_01797_G01	CAACCCCACCACAACAAGTCAAACCAACACCACACA
T7_01798_G01	AACCACCAAAACAACCCGTCACCAACCACAAAACCC
T7_01799_G01	AAAACACACCACAAACCGTCAACCAACCAACACCCC
T7_01800_G01	CACCACAACACCCACCAGTCACCAAAAACCCCAAAA
T7_01801_G01	AAAACAAACACCACAACGTCACACCACCAACCCCAC
T7_01802_G01	AAACCAACCAACCCACCGTCAAACAACAAACCACCC
T7_01803_G01	AACCAAACCCCAAAACCGTCAAACCACAACCACACC
T7_01804_G01	ACCACAAAACACCAACAGTCCAACCCACCCAAAACC
T7_01805_G01	AAACAACCACCCCACACGTCAACCAACACAACCCAA
T7_01806_G01	AAAAAACAAACCACCCAGTCACCCCACACCCCACAA
T7_01807_G01	ACCCAACAACAACAACAGTCACCCAAAACCACCCAC
T7_01808_G01	CAACCCAACCACACCACGTCACCAAAAACACAACCA
T7_01809_G01	ACACCAACCCCAAACCCGTCACAAAAAAACCCCAAC
T7_01810_G01	AAAAAAAAACCCCAACCGTCACCCCAACAACCCACC
T7_01811_G01	CCCACCACACCCAACACGTCCACAAAAACAAAAACC
T7_01812_G01	AACCCACCCCACCACCAGTCAACACCAACCAAAAAA
T7_01813_G01	ACCACCAACAACAAACCGTCAACAACCCACCACACA
T7_01814_G01	ACCCCACAACACCACAAGTCCAACAACCACCCAAAA
T7_01815_G01	CCCACAACCCCAACACAGTCAAAACAACCAACCACA
T7_01816_G01	ACCAAACCCCAAAAACCGTCCACCCACCACAAACAA
T7_01817_G01	AACCAAACACCCACCCAGTCCACCCCAAAACAAAAC
T7_01818_G01	AACACACCAAACACCCAGTCCACCAACCCAAAACCA
T7_01819_G01	ACACACACCCAAAACCAGTCACAAAACCCCACCACA
T7_01820_G01	ACAACAACCCCAACCCAGTCCACAAACCCACAAACA
T7_01821_G01	AAAACACCACCAAACCCGTCCAACCACCCAAACCAA
T7_01822_G01	CCCACACCAAAAAAACCGTCAACCACACACACACCA
T7_01823_G01	AACCACCCCACACCAAAGTCCACCAAAAAAAACCCC
T7_01824_G01	CCCACCACCAAAACCCAGTCCAAAAACCCCAAAACA
T7_01825_G01	ACACCCACCACAAACCAGTCAAAAACCCAAAACCCC
T7_01826_G01	AAAACCCACCCCACACCGTCACCACAACACCAAAAA
T7_01827_G01	CACCACCCAACCAACACGTCCACCACAAACAACAAA
T7_01828_G01	CAAAACCCAAAACCCCAGTCAACCACACCCAACACA
T7_01829_G01	ACACCCACAAAACCCCAGTCCACCCACAAAACACAA
T7_01830_G01	ACCAAACCACCCAAAACGTCCACAAACCACACACAC
T7_01831_G01	CCACCAAACAACCCACAGTCACCCAACCAAAACACA
T7_01832_G01	ACACCCACCCCACACAAGTCACACACCAAAACACAA
T7_01833_G01	AACACCAAAAACCAAAAGTCCCACCCACCACCCCAA
T7_01834_G01	CCCACCCACAAAAAAACGTCACCCCAACACACCAAA
T7_01835_G01	CAAAACCACCCCAAACAGTCCACCACCACAAAACCA
T7_01836_G01	CAACCAAACCCAACCAAGTCAACACAAACCAACCCC
T7_01837_G01	ACACCACAAACAAAAACGTCCAACACACCACCCCAC
T7_01838_G01	AACAACAACCCCAAACCGTCAACAACACCACCACCA
T7_01839_G01	AACCAAAAACCCAAACAGTCAACCACCCACCAACCC
T7_01840_G01	CCCAACAAAACAAACACGTCAACAACCCCAACACCC
T7_01841_G01	CACCCCAAAACCACCAAGTCACACCAACCAAACACA
T7_01842_G01	ACCCCACCCCAAAACAAGTCAACAAAACACCCACAC
T7_01843_G01	CAACACACCAAACCACCGTCAACCCCACCAAACAAA
T7_01844_G01	CACACCAACACCAACCAGTCACCAAACAAACCAACC
T7_01845_G01	CACAACACAAACCCCAAGTCACAAACACCCCACACA
T7_01846_G01	CACCCAACCAACCAAACGTCAACACAAAACCCACCA
T7_01847_G01	CACAAAAACAACCCACCGTCCACCACAAAACCCCAA
T7_01848_G01	ACAACAACAACCCACCAGTCAAACACACCCCACCAA
T7_01849_G01	CAAACCCCAAAAACAACGTCCCACCCAACCCCAAAA
T7_01850_G01	ACCCACAAACCCAAAAAGTCCCAACCACCCACACAA
T7_01851_G01	AAACCCAACCCACAAACGTCAAAACCACCACCCCAA
T7_01852_G01	CAACACCCAAACAAACCGTCCACCAACACCAAACCA
T7_01853_G01	CCACACACAAAACCACCGTCCACAAAAAACACCCAC
T7_01854_G01	AAACCAACCCCACCCCAGTCCAAAACAAACCCAACA
T7_01855_G01	CAACACAACACCCAACAGTCCAAACCAACACCAACC
T7_01856_G01	ACCAAACCCCAAAAACCGTCAAACAACCACCCCACA
T7_01857_G01	ACCAAACACCACAAAAAGTCCCAAAACCACCCACCC
T7_01858_G01	ACCCCACCACAACAACAGTCCCCACAAACCAAACAA
T7_01859_G01	CAAAAACCCAACCAAAAGTCCCCAAACCACAACCCC
T7_01860_G01	CAAACACCAACCAACCAGTCCCCAAAAACCCACAAC
T7_01861_G01	ACAACCCACCCAACCAAGTCAACCACCAAACACCAA
T7_01862_G01	CCCAAAACCCCACACAAGTCACCAACCAAACAAACC
T7_01863_G01	AAACCAACACCACCCAAGTCACAACCCAAAACACCC
T7_01864_G01	AACACCCCAAACAAACAGTCACAACACCCCACAACC
T7_01865_G01	CAAACCCCAAAACAACCGTCCCACCAAACAACCCAA
T7_01866_G01	CACAACCCAACCCACAAGTCCCAAAACCACCAACAA
T7_01867_G01	AACCCCAAACAAAACACGTCCCAACCCCAAAAACCC
T7_01868_G01	CCAACCACACAACAAACGTCCACCAAACACCCAAAC
T7_01869_G01	AAAACCCCAACCAACAAGTCACCACCCACACAACCA
T7_01870_G01	CAACACACCCCACAACAGTCCAAAACCAAAACCCAC
T7_01871_G01	ACCAACACAACCCACAAGTCCAACCAAACCCAAACC
T7_01872_G01	CCACCACCAACCACCACGTCCAAACCACCAAAAAAA
T7_01873_G01	CCAACCCCAAAAACACCGTCAAAACCCACAACCCAA
T7_01874_G01	AAAACCCCACCCCACCAGTCAAAACCCAAAAACACC
T7_01875_G01	CCAAACCACCCACCAACGTCCACCCACAACAAAAAA
T7_01876_G01	ACAAAACCACCCAAACCGTCCAACACCACCAAACAC
T7_01877_G01	CACCCACACCAAACAACGTCAAACCCAACCAAAACC
T7_01878_G01	AAACACCCCACACACCCGTCCAACAAAAACCAAACC
T7_01879_G01	CAACAACAACACCCCACGTCAAACCCCAAACACACA
T7_01880_G01	AACAACCCCACCAACCCGTCCAAACAAAAAACCCAC
T7_01881_G01	CACCAACACAAACCAAAGTCCACACCAAACCCCACA
T7_01882_G01	CCAAAACACAACCAAACGTCCCCAAAACAACACCCC
T7_01883_G01	AAAACAACACAACCCCAGTCACCAAACCCCAAACCC
T7_01884_G01	AAACCAAACCACCCCAAGTCACACCAACCACAACCA
T7_01885_G01	CCAACACCCAACACAACGTCAAAACACCCCACAAAC
T7_01886_G01	CACCAACCAAAACACACGTCCAACCCAAAAAACCCC
T7_01887_G01	CCAACAACCCACACAACGTCAACCCAAAACACACCA
T7_01888_G01	CCCAACCACCACAAACAGTCACAACAAACAACACCC
T7_01889_G01	CACCACCACAAACACAAGTCCACCCCAACACCAAAA
T7_01890_G01	CCACAAAACCAAAAACAGTCACCCCAACCAACCCAC
T7_01891_G01	ACCACACCACAACACAAGTCCCACACAAAAACCACC
T7_01892_G01	CACCCAAAACCCCAAAAGTCACAACCCAACCACAAC
T7_01893_G01	CCAACAAACAACCCACAGTCAACCCCAAAAACCACC
T7_01894_G01	CAAAAACAACACCCACAGTCACCACCACCACAAACC
T7_01895_G01	CACCCCACCCACAAACAGTCCAAAAACCAAAACCAC
T7_01896_G01	CACCACCACACCACCCAGTCCAACACCAAAACAAAA
T7_01897_G01	CAAAACCACCACAAACCGTCACCACAAAACACACCC
T7_01898_G01	CCACCCACCAAACCAAAGTCCACCACAAAAAAACCC
T7_01899_G01	CAACCCACCCCAAACACGTCACAAACCACAAACAAC
T7_01900_G01	CCACCCCACCAAAAACAGTCCCCACAACAAAACCAA
T7_01901_G01	AACAACACCCAAAAACCGTCAACACACCCCACCCAA
T7_01902_G01	CCAAACCCCAAACAACCGTCCAACACAACCCACAAA
T7_01903_G01	CACAAACAACAAAAAACGTCCACCACCACCCAACCC
T7_01904_G01	ACACAAACACCCCAACCGTCACAAACACCCACAAAC
T7_01905_G01	AACAAACACCAAACCCCGTCACAACCCCACACAAAC
T7_01906_G01	AAACAAAAAACCCCACCGTCCCCAAACACCCAAACC
T7_01907_G01	CAACCACCCAAACCACCGTCACAAACACACAAACCA
T7_01908_G01	CAAACCCACCCAACAACGTCACAAACAACCAAACCC
T7_01909_G01	ACAAAAAAACCCACACAGTCCCAACACCCACACACC
T7_01910_G01	CAAACACCCCAACACCCGTCACAACAAAACCAACCA
T7_01911_G01	CACCCACACAAAACAAAGTCACCAACCCAACAACCC
T7_01912_G01	AACCAACCCAAACCACAGTCCAAAAACCAACCCACC
T7_01913_G01	ACCACACACAAAAAACCGTCACCAAACACCACCCCA
T7_01914_G01	CCAACACCAACCCCAAAGTCAACCACAAAAACCCCA
T7_01915_G01	CAAAACACCACCCCAAAGTCACAAACCCCACCACAA
T7_01916_G01	ACCCAAAAAAACCCCACGTCCACCACCAACCCAAAA
T7_01917_G01	CACAAAAAAAACAACACGTCACCCCACACACCCACC
T7_01918_G01	AAAACCCCAAACCCCAAGTCACACCCAAAACACCAC
T7_01919_G01	CCACCCAACAAAAACAAGTCACCAAACCACACCCCA
T7_01920_G01	CAAAAAAACCCCACCAAGTCCAACCACACCCAACAC
T7_01921_G01	ACCCCACAAACACACCAGTCACCACAAAACCCCAAA
T7_01922_G01	CACAACCAAAAACCCAAGTCCACCCCAAAAAACCCC
T7_01923_G01	CACCAAAACCAACAACAGTCCCACCAAACACCACCA
T7_01924_G01	ACCACCAAAACAAAACAGTCCCCACACCCCACAAAC
T7_01925_G01	CACCCACACCAAAAAAAGTCAACCCCAACACACCCA
T7_01926_G01	AAACCCCAACACACCCAGTCCACAAAACCAACCACA
T7_01927_G01	CACACCACCCAACCACCGTCCAAAAAACCAAACCAA
T7_01928_G01	CCACACAAACACACCAAGTCAAACCACACCACCAAC
T7_01929_G01	CACAAAACACCCAAACCGTCCACAACAACAACACCC
T7_01930_G01	CCACAAAACCACCCCACGTCCACACAAACCCAAAAA
T7_01931_G01	ACAACAAAACCAACCCCGTCACCAAACCCCAAAACC
T7_01932_G01	ACACCACACCAAACACCGTCAAAACCAACCCAAACC
T7_01933_G01	CCAACAACAAACCACCAGTCCAAAACCCAAACCCCA
T7_01934_G01	ACCAACACCCACAACCAGTCCCAAACACAAACCACA
T7_01935_G01	ACCCAACAAAAAACCCAGTCCCCAACCAACCACAAC
T7_01936_G01	CACACCCAACAAAACCAGTCCAACCCAACACCAACA
T7_01937_G01	ACCCACCCAACACAAACGTCCAAAAACAACCACACC
T7_01938_G01	CACACCACCAACAAAAAGTCAACACCCCAAACCACC
T7_01939_G01	CCCAACCAAAACACAACGTCCCCACAAAACCACACA
T7_01940_G01	AACCCCAACAAACCCAAGTCAACAAAACACCACCCC
T7_01941_G01	CACCCCAACAACCCAAAGTCAACACAAAAACCACCC
T7_01942_G01	CAACCCCAACAAACAACGTCCACCAAACCAAACCCA
T7_01943_G01	AAAAACACCACCCCAACGTCCCCAAAAACAACCCCA
T7_01944_G01	ACCACACAACCCACAAAGTCCCCACAACCAAACCAA
T7_01945_G01	CCCAAACCAACCAACCAGTCCAAACCCCAAACAACA
T7_01946_G01	CCCACAACACAACCCCAGTCAACCACACAAACCAAA
T7_01947_G01	CCACAACACCACCACCCGTCACAACAAAAACAAACC
T7_01948_G01	CCAAAACAACAAAAACCGTCCACACACCCCAACACC
T7_01949_G01	ACAACCCACCCAAACAAGTCCCACCAAAACACAACC
T7_01950_G01	CCAAACAAAAACACACAGTCCACCCAACCAACCCCA
T7_01951_G01	ACACCACAAACCCCAAAGTCCCAAAACACCCACAAC
T7_01952_G01	ACCACCAAAAAAACCCAGTCCACCAACCCAACCACA
T7_01953_G01	CACCCCAACAACCACCAGTCCAAAAACAAACAACCC
T7_01954_G01	ACCAAACCACCACAACCGTCAAACCCAACACCAACA
T7_01955_G01	CAAAAAACCACCCACCCGTCAACACACAAACCCAAC
T7_01956_G01	CACCCAAAACCCCAAACGTCCCAAAAACCCCAAACA
T7_01957_G01	AAACACAACCCCACCAAGTCCCACAAAAACAACCCC
T7_01958_G01	AACACCCCAAACCACCAGTCACCAAACCCCAAAACA
T7_01959_G01	ACAAACCACCCCAAACAGTCACCCCAAAACCCAACA
T7_01960_G01	CACCACCCAACAAAACCGTCACAAAACCCCAAACAC
T7_01961_G01	ACAACCAACCACAAACCGTCAAACACACAACCCACC
T7_01962_G01	ACCAAAACAAACACCCAGTCCCACCCCAAACAAACC
T7_01963_G01	AAAAACACACAACCCAAGTCCACCCACCCACAACAC
T7_01964_G01	ACCAAAACCCACAACCCGTCACCCAAAACACACAAC
T7_01965_G01	ACCCAAAACCCAACAACGTCCAAACCCCAAAAACCC
T7_01966_G01	CCCAAAACACCCCACAAGTCACCAAAACCACCCAAA
T7_01967_G01	AAAACACAAACCCACCCGTCCAACAAACACCCCACA
T7_01968_G01	CCCAAAACAACAAAACAGTCCAACCCCAACACCACC
T7_01969_G01	CCCAAAAACCCACAACAGTCAACACCCCAACCCAAA
T7_01970_G01	CAACCAAAACCCAAACAGTCAAACCCCAACCCCAAC
T7_01971_G01	CACAACAACCAAACCCCGTCAAAAACACCACACACC
T7_01972_G01	CACAAACCAACAACCCAGTCCCAACCAACCCAAAAC
T7_01973_G01	AACCCAACCACCAAAAAGTCACCACCAAAACACCCC
T7_01974_G01	AACCAAAACCACACCACGTCACCCCAAAAACCAACC
T7_01975_G01	CAAAAAACCAAACCCCAGTCCCACACACAACCAACC
T7_01976_G01	ACCCACACCACAAAAACGTCCACCACAACCCAAACA
T7_01977_G01	CCAAAACCAACCCCAACGTCACCAAAACACACACCA
T7_01978_G01	ACAACCCCAACACCACCGTCAACCCCAAAAAAACCA
T7_01979_G01	AAACCCAAACACCAAAAGTCCCCAACAACCACACCC
T7_01980_G01	CCAACACACACCACAAAGTCACCCAACCAACAACCA
T7_01981_G01	ACACACACAAACACCCAGTCCACAAACCCACCAACA
T7_01982_G01	ACACCAACCACACCACAGTCCCAAAACCAACCACAA
T7_01983_G01	AAAACACAAAAACCCCAGTCCACCCCACACCAAACC
T7_01984_G01	ACACCAAACCCCACAACGTCACAAACCCAACCAACA
T7_01985_G01	AAACACCCACCCAAAACGTCACCACAAACACCCACA
T7_01986_G01	CCCAAACAACACACACCGTCAAACACAACACCCAAC
T7_01987_G01	AAACACCCACCCACCAAGTCAAACCCAACAACCAAC
T7_01988_G01	CACCACCAAACAAACAAGTCCACCCCAAACACACAC
T7_01989_G01	ACAACAAACCCAAACACGTCCCAACAACCCCAAACC
T7_01990_G01	CCCACCCCAAACCCAAAGTCACAACAAAAAACCCCA
T7_01991_G01	AACCACACCACCACCCCGTCAAAAAACAAACACACC
T7_01992_G01	ACCCAACACCCACAAACGTCCCAACAACAAACCAAC
T7_01993_G01	AAAACCCACAACCAACAGTCAACCCACCCAACCCAA
T7_01994_G01	CCCAAACAACACCCACCGTCCAACCAAAACAACCAA
T7_01995_G01	CCAAACCACCCAACCCAGTCACCCAAAAAAACACAC
T7_01996_G01	ACACAACAACCAAACCAGTCCCACCCAAAACCACCA
T7_01997_G01	AACCCACCAAAAACCCCGTCACCACCACAAAACCAA
T7_01998_G01	CACAAACCCCAAACACAGTCCAACACCAACAACCCA
T7_01999_G01	CCCAACAAACCCCACACGTCAACACACAACAAAACC
T7_02000_G01	AACCAACAACAACACCAGTCCAACACCCAAAACCCC
T7_02001_G02	GAAAAAGAAAGGGAAAAGTCAGGGGAAAGGGGAGGG
T7_02002_G02	GGGGAGGAAGGGAAGGGGTCAAAAAAAAAGGGGAAA
T7_02003_G02	AAAAAGAAGGGAGGGGAGTCAAGGGGAAAGGGGAAA
T7_02004_G02	AGGGGAGAAAAAAAAAAGTCAAGAGGGAGGGGAGGG
T7_02005_G02	AAAGGAAAGGGAAAAAAGTCGGGGAAGGGGAAAGGG
T7_02006_G02	GGGGAAGGGAAAAAAAGGTCGGGAAAGGGGAAAAAG
T7_02007_G02	GGGGAAGGAAAAAAGGGGTCAAAAGGGGAAAAAGGG
T7_02008_G02	GGGGAAAGGAAAAAAAGGTCGAAGGAGGGAGGGAAA
T7_02009_G02	GAAAAAAGGGGAGGGGAGTCAGGGAAAAAAGGGGAA
T7_02010_G02	GGGGAAAAAAGGGGAAGGTCGGGAGGGAAAAAAAAG
T7_02011_G02	AAGGGGAGAGAAAAGGGGTCAAAGGGGAAAAAAGGG
T7_02012_G02	GGGGAAAAAAAGGGAAAGTCGGGGAAAGGAAAGGGA
T7_02013_G02	GGGAAAAAAGGGAAGAAGTCGGAGGGGAAAGGGAAA
T7_02014_G02	GGGGAAAGGGGAAAGAAGTCAAAAGGGGAAAAAGGG
T7_02015_G02	GAAGGGAAAAGGAAGGGGTCAAGGGAAGGGGAAAAA
T7_02016_G02	AAAAAAGGGGAAAGGGAGTCAAAGGGGAAGGAAGGG
T7_02017_G02	AAAAGGGAAGGAAAAAAGTCAAGGGGAAGGGGAGGG
T7_02018_G02	AAGAAGGAAGGGGAAGGGTCGGAAAAGGGAAAAAGG
T7_02019_G02	GGGAGGGGAAAAGGGGAGTCAAAAAAAGGGAGAAAG
T7_02020_G02	AGGGAGGGGAAAGGGGAGTCAAGGAAAAAAGGGAAA
T7_02021_G02	GAAAGGGAAAAAAAAGGGTCGGAAGGGGAAGGGGAA
T7_02022_G02	GGGAAGGGGAGGAGAAGGTCGGAAAAAAAAAAAGGG
T7_02023_G02	GGGGAGGGAAGGGGAAGGTCAAAAAAAAAAAGGGGA
T7_02024_G02	GGGGAAAAGGAAGGGGAGTCAAAAAAAAAGGGAGGG
T7_02025_G02	GGGGAAGGGGAAGGGGAGTCAGAAAAAAAAAAAGGG
T7_02026_G02	GGGGAAAAAGGGAGGAGGTCGAAAAAAGGGGAAAAG
T7_02027_G02	GAAGGAAAAGGGAAGGGGTCGAAAAAGGGGAAAAGG
T7_02028_G02	GGGGAAAAAGGGGAAAGGTCGGGAAGGGGAAAAAAA
T7_02029_G02	GGAAAAAGGGAAAAGGGGTCGAGGGGAAAAAAGAGG
T7_02030_G02	AAAAAAGGGAAGGGAGGGTCGGAAGGGGAAAAAAGG
T7_02031_G02	GGGGAAGAAAGGGAAGGGTCAAAGAAAAGGGGAAAG
T7_02032_G02	AAAAAAGGGGAAGGGAGGTCGGAAAAGGGGAAAAGG
T7_02033_G02	GGAAAAAAAAGGGAAAGGTCGGGAAAAAGGGGAGGG
T7_02034_G02	AAAGGAGGGGAAGGGGAGTCAAAAAAGGGGAAAAGG
T7_02035_G02	GGGAAAAAAGGGGAAAGGTCGGGAGAAAGGGAAAAG
T7_02036_G02	GGGGAAAAAAAAGAAAAGTCAAAGGGGAGGGGAGGG
T7_02037_G02	GAAGGGAAAAAAAAGGGGTCGAAGGAAAGAGGGGAG
T7_02038_G02	GGGAAAAAGGGAAAAAAGTCAGGGGAGGGAAAAGGG
T7_02039_G02	AAAAGGGGAAAGGGGAGGTCGGAAAGGAAAAAAGGG
T7_02040_G02	GGGGAGGGAAAAAAAGGGTCGAAAAAGGGAAAAGGG
T7_02041_G02	GGGGAAAAAGGGGAAAAGTCAAAGGGGAGGAAAAGG
T7_02042_G02	GGGGAAAAAAGGGAAGGGTCGGAAAGAAAAAGGGAG
T7_02043_G02	GGGGAAAAAGGAGGAAGGTCAAAAGGGAAAGGGGAA
T7_02044_G02	GGGAAGGGGAAGGGGAAGTCAAAGGGAAAAAAAAGG
T7_02045_G02	GGGAGGGGAAAAAAAAAGTCAGGGAGGGGAAAAAGG
T7_02046_G02	AAAAAGGGAGGGGAAGGGTCGGAGGGGAAAAAAAAG
T7_02047_G02	GGAAAGGAAAGGGGAAAGTCAGGGAAAGGAAAAGGG
T7_02048_G02	GGAAAGGGAGAGGGGAAGTCAAAAGGGAAAAGGGAA
T7_02049_G02	AAGAAGGGAAAGAAGGGGTCGAAAAGGGGAAAAGGG
T7_02050_G02	GGGAAAGGGGAAGGGAAGTCAAAGGGAAAAAAGAGG
T7_02051_G02	GGGGAAAAAAGGGAAAGGTCGGAGGGGAAAAAAAGG
T7_02052_G02	GGAGGGAGGGGAAAAAGGTCGGGAAAAAAAAAAGGG
T7_02053_G02	GGGGAAGAAAGGGGAGGGTCGAAAAAAAAGGGGAAA
T7_02054_G02	AAAAAAAAGGGAAAGGGGTCGAGGGAAAAGGGAGGG
T7_02055_G02	GGGGAGGAAGGAAAGGGGTCAAGGGAAAAAAAAAGG
T7_02056_G02	GGGGAAAGGGGAGGGGAGTCAAAAAAAAAAAGGAGG
T7_02057_G02	AAAAAAGGGGAAAAGGAGTCAGGGGAGGGAAAGAGG
T7_02058_G02	GGGGAAAAAAAAAGGGAGTCAGGGGAGGGAAAAAGG
T7_02059_G02	AAAAAGGGGAAAAAGGGGTCGAAGGGAAGGAAAGGG
T7_02060_G02	GGGGAGGGGAAAAAAAAGTCAGGGAGGGGAAAAAAG
T7_02061_G02	GAAAGGGGAAGGGGAAAGTCAAAAGGGAAGGGGAAA
T7_02062_G02	GGGGAAAGGGGAGAAAAGTCAAGGGAAAAAAGGGGA
T7_02063_G02	AAAGGGAGAGGGGAGGGGTCAAAAAAAAGGAAAGGG
T7_02064_G02	GGAAGGGGAAAAAAAAAGTCAAGGGAAGGGGAGGGA
T7_02065_G02	GGGAAGGGAGGGAAAAAGTCAAAAAGGGAAGGGGAA
T7_02066_G02	GGGGAAAAAAGGGGAAAGTCAAAAAGGGGAAGGGGA
T7_02067_G02	GGAAAAGGGAGAAAAAAGTCAGGGGAGGGAAAAGGG
T7_02068_G02	AAGGGGAAAGGGGAGGAGTCAAAGGGGAAAAAAAGG
T7_02069_G02	GGGGAAGGGAAAAAGGGGTCAGGGGAAGAAAAAAAG
T7_02070_G02	GGGGAGGGAAAAAAAAAGTCAGGGAGGGGAAAAGAG
T7_02071_G02	GGGGAAGGGGAAGGGGAGTCAAAAAAAGGGGAAAAA
T7_02072_G02	AGGAGGGGAAAAAAGGAGTCGGGGAGGGAAAAAAAG
T7_02073_G02	GGGGAAAGGAAAAAGGGGTCGAAGGGAAAGGGAAAA
T7_02074_G02	AGGGGAAAAAAAAAAAAGTCGGGGAGGGGAGGGAAG
T7_02075_G02	AAAGGGGAAAGGGGAAGGTCGGGAAAAAAAAGGGGA
T7_02076_G02	GGGAAGGAGGAAAAAAAGTCGGGAGGGGAGGAAAAA
T7_02077_G02	GGGAGGGGAAGGAAAAAGTCAAAAGGGGAAAAAGGG
T7_02078_G02	AAAAGGGGAAAAAGGGAGTCAAAAGGGAAGGGAGGG
T7_02079_G02	AGGGAGGGGAAGGGGAAGTCAAAAAAAAGGGGAAAG
T7_02080_G02	GGGGAAAAGGGAAAAAAGTCGGAAAGGGGAAGGGAA
T7_02081_G02	GGAAAAGGGGAAAAAAAGTCAGGGGAAAGGGGAAGG
T7_02082_G02	GGAAAAAAGGGGAAGGGGTCGAGAAGAAGGAAAAGG
T7_02083_G02	GGGGAAAAAAGGGGAAAGTCAAGGGGAAAAAGGAGG
T7_02084_G02	GGAGGAAAAAGGGGAAAGTCAGGGGAAAGGGGAAAA
T7_02085_G02	GGGGAAAAGGGGAAGGGGTCAGGAAGGGAAAAAAAA
T7_02086_G02	AAAGGGGAAAGGGAGGGGTCGAAAGGGAGAAGAAAA
T7_02087_G02	GGGGAAAGGGAAAAAAAGTCAAAGGGGAGGGAGAAG
T7_02088_G02	GGAGGAAAAAGGGAGGGGTCAAAAAGGGGAAGGAAA
T7_02089_G02	GGGAGGGGAAGGAGGGAGTCAAGGAAAAAGGAAAAA
T7_02090_G02	GGGGAAAAAGGGAAAAGGTCGGAAAAGGAAGGAAGG
T7_02091_G02	GGAAAAGGGGAGGGAAGGTCGGGAGGAAAAAAGAAA
T7_02092_G02	AAAGGGGAGGGGAAGGGGTCGAAAAAGGGGAAAAAA
T7_02093_G02	AAAGGAGGGAAAGGGAAGTCAGGGGAAAAGGGGAAA
T7_02094_G02	GAAAGGGGAGAGGGGAAGTCAAAAAGGGAAAAAGGG
T7_02095_G02	GGGAAAAGGAGGGAAAAGTCAAAAGGGAAGGGAAGG
T7_02096_G02	AAGAAAGGGAGGAGGGAGTCGGGGAAAAAAAAGAGG
T7_02097_G02	GGGGAAAAAAGGGAAAAGTCGAGGGGAAAAGGGGAA
T7_02098_G02	GGAAGAAAGGGGAAAGGGTCGGAGGAAAGGGAAAAA
T7_02099_G02	GGGGAAAGGGAAAAAAGGTCGAAGGGGAAAAGGGAA
T7_02100_G02	GGGAGGGAAGGGAGGGAGTCAAAAAAAAAAGGGGAA
T7_02101_G02	AAAAGGGGAAAAAAGGGGTCAGGGGAAGGGGAAAAG
T7_02102_G02	GGGGAAAAAAAAAAAAAGTCGGGGAAGGGGAGAGGG
T7_02103_G02	GGGGAAAAGGGGAAAAAGTCAAGGGGAAAAAGGAGG
T7_02104_G02	AAGGGGAAGGGAGAAGGGTCAAAGGGGAAGGAAAAA
T7_02105_G02	GGAAAAAGGGAAAAAAAGTCAGGGGAGGGGAAGGGA
T7_02106_G02	GGGAAAAAAAAGGGAGGGTCAAAAGGGGAAGGGAAG
T7_02107_G02	AAAAAGGGGAAAGGGAGGTCGAAAAAGGGAAGGGGA
T7_02108_G02	GGGGAAGGGGAAAAAAAGTCAAGGAAGGGGAAAGGA
T7_02109_G02	GAGGGAAAAAAGGGGAAGTCAGGGGAAAAAAGGGGA
T7_02110_G02	GGGGAGGGAAAGGGAAAGTCAAAAAAGGGAAGGAAG
T7_02111_G02	GGAAAAAGGGGAAAAAGGTCGGGAAAAAAGGGAGGG
T7_02112_G02	GAAAAAAAAGGGGAAGGGTCGGAAAAGGGGAAAGGG
T7_02113_G02	GGGGAAAAAGGGAAAAAGTCAAGGGAAAGGGGAAGG
T7_02114_G02	AAGGAAAAGGAGGGGAAGTCAGGAAAAAAGGGAGGG
T7_02115_G02	GGGGAAAGGAAAAAAAGGTCGGAAGGGGAGGGAAAA
T7_02116_G02	GGGGAGGGAAAAGGGAAGTCAAGGGAAGGGAAAAAA
T7_02117_G02	GGGGAAGGGGAGGGGAAGTCAAGGGGAAAAAAAAAA
T7_02118_G02	GAAGGGAAAAAGGAAAGGTCGGAAAAAGGGGAAGGG
T7_02119_G02	GGGGAAAAGGGAAAAGGGTCGAAAGGGAAAAAAGGG
T7_02120_G02	GGGGAAGGAAAAGGGAAGTCGGGGAAAAAAAAAGGG
T7_02121_G02	GAAGAGGAGGGAGGAGGGTCGGAAAAAAAAAAAGGG
T7_02122_G02	AGGGGAGAAGGGAAGGGGTCGAAAAAGGGGAAAAAA
T7_02123_G02	GGAAAAAAGGGAAAGGGGTCAGGGGAAGGAAAAAGG
T7_02124_G02	GGGGAAAAAAGGGGAAGGTCGGGAAAAAAGGGAAAG
T7_02125_G02	GGGAAGGGAAAGGGGAAGTCAAAAGGAAGGGGAAAA
T7_02126_G02	GGGGAAGGGGAAAAGGGGTCGAAAGGGGAAAAAAAA
T7_02127_G02	GGGGAGGGGAAAAAAGGGTCGGAAGGGGAAAAAAAA
T7_02128_G02	AGAAGGGGAAAAGGGAAGTCAAAGGGAAGGGAAAGG
T7_02129_G02	AGAGGGAAAAAGAAAGGGTCGGAAAAAAGGGGAGGG
T7_02130_G02	AAAAAGGGAAGGGAAAGGTCGGGAGGGAAAAGGGAA
T7_02131_G02	GGGAGGGGAAAGGGAAAGTCAAAAAAAAAGGGAGGG
T7_02132_G02	AGGGGAGGGAAAAAGGGGTCGAGGGAAAAAAAAGGA
T7_02133_G02	GGGGAAAAGGGGAAAAAGTCAGGGGAAAGGGGAAAA
T7_02134_G02	GGGGAGGGAAAAAAAAAGTCAAGGGAAAGGAGGGGA
T7_02135_G02	GGGAAAAGGGAAAAGGAGTCAGGGGAAAAAAGGAGG
T7_02136_G02	GGGAAAAAAAAAGGGGAGTCAGGGGAAAAGGAAGGG
T7_02137_G02	GGGGAAAAAAAAAAGGGGTCAAGGAGGGGAAGGAAG
T7_02138_G02	GGAAAAAGGAAGGGGAGGTCGGGAAAAAGAAAAGGG
T7_02139_G02	AAGGGGAGGGAAAGGGAGTCAAAAAAAGGGGAAAGG
T7_02140_G02	GGGGAGGGGAAGGAAAAGTCAAAGGGGAAAAAAAGG
T7_02141_G02	GGGAAAGAGGGGAGGGAGTCAAAAGAAAAAAGGGGA
T7_02142_G02	GGAGGAAAAAAAGAGGGGTCGAAAAGGGAAAGGGGA
T7_02143_G02	GGGGAAGGGGAAAAGGAGTCAAGGGGAAAAAAAAGG
T7_02144_G02	GGGAGGGGAAGGGGAAAGTCAAAAGGAAAAGGGAAA
T7_02145_G02	GGGGAAAGGAAGGGGAAGTCAGGGAAAAAAAAGGGA
T7_02146_G02	GGGGAGGGAAAAAAAAGGTCGGAAAAGGGAAAAGGG
T7_02147_G02	AAGGGGAAAGGAAAAAGGTCGGAAGGAGGAGGGAAA
T7_02148_G02	AAAAAGGGGAGGGAAAAGTCGGGGAGGGGAAAAAAG
T7_02149_G02	GGGAAGGAGGGGAGGGAGTCAAAAAAAAAAAGGGGA
T7_02150_G02	AAAGGGAAAAAAGGGGAGTCAAAGAAGGGGAGGGGA
T7_02151_G02	AAGGGAAAGAGGGGAGGGTCAGGGGAAAAAAAAAGG
T7_02152_G02	GGGGAAAAGGGGAAAAAGTCAAGGAAAAGGGAGGGA
T7_02153_G02	GGGAAGGGAGGGGAAAAGTCAGGGAAAAAAAAAGGG
T7_02154_G02	GAAGGGGAAGGGGAAAAGTCAGGGGAAAAAAAAGGG
T7_02155_G02	AGGGAGGGAGGGGAAAAGTCAAGGGAAAAAAAAGGG
T7_02156_G02	GGGGAGAAAAGGGAAAGGTCGAAAAAAAGGGAAGGG
T7_02157_G02	GGGGAAGGGGAGGGGAAGTCAAAAAAAAGGGGAAAA
T7_02158_G02	AGGGGAGGGAAAAAAGGGTCGAAAGGGAAAAAAGGG
T7_02159_G02	AAGGGGAGGAGGGAAAAGTCAAGGGAAAAGGGGAAA
T7_02160_G02	AAAAGGGGAAAAGGGGAGTCGGGAGGGAAAAAAAGG
T7_02161_G02	GGAAAAAAGGGGAAAAAGTCAAGGGGAGGGGAAAGG
T7_02162_G02	AAAGGGGAAGGGGAAAAGTCAAAGGGGAAGGGGAAA
T7_02163_G02	AAAAGGGAAGGGGAAAAGTCAAGGAAAGGGGAAGGG
T7_02164_G02	GGGAAAGGGGAGGAAAGGTCGGGAAAAAAGGGAAAA
T7_02165_G02	GGAAAAGAGAGGGGAAAGTCAAAGGAAAGGGAAGGG
T7_02166_G02	GGGAGGAAAAAAAAAAAGTCAGGGGAGGAGGAAGGG
T7_02167_G02	AAAGGGGAGGGGAGGGAGTCGGGGAAAAAAAAAAAG
T7_02168_G02	GGGAGGGAAAGGGGAAAGTCGGGGAGGAAAAAAAAA
T7_02169_G02	GGGGAAAAAAAAGGGGAGTCAAAAAGGGGAAGGGGA
T7_02170_G02	AAAAAAGGGGAAAAAGGGTCAGGGGAAAGGAGGGGA
T7_02171_G02	AGGGAGGGGAAAAAGGGGTCAGGAAAAAAAGGGGAA
T7_02172_G02	AGGGAGGGAAAAAAGGAGTCGGGGAGGGGAAAAAAA
T7_02173_G02	GGGGAAGAGGGAGGGGAGTCAAAAAAAGGGGAAAAA
T7_02174_G02	GGGGAAAAAAAAAGGGAGTCAAGAGGGAAAGGGGAG
T7_02175_G02	GGGAAAAAAAAGGGAGAGTCAGGGAAGGAGGGGAAA
T7_02176_G02	GGGGAGGGAAAAAAAGGGTCGGAAAAGGAAAAAGGG
T7_02177_G02	GAAAGAAAGGGGAAAGGGTCGAAAAGGGGAAAAGGG
T7_02178_G02	GGGAAAAAAAAAGGGGAGTCAGGGAGGGAAGGAAAG
T7_02179_G02	GGGGAGGGAGGGGAAAAGTCAAGAAAAAAGGGGAAA
T7_02180_G02	GGGAAAAAAAAAGGGGAGTCAAAAGGGAGAGGGGAG
T7_02181_G02	GGGGAAAAAAAGGAGGAGTCAAGGGAGAGAAAAGGG
T7_02182_G02	GGAAAAGGGGAAGGGAGGTCGGAGGGGAAAAAAAAA
T7_02183_G02	AAAAAAGAAAAAGGGGAGTCAGGGAAGGGAGGGAGG
T7_02184_G02	GGGGAGGGGAAAAGAGGGTCAGGGAAAAAAAAAAGG
T7_02185_G02	GAAAAAAGGGGAAAAAGGTCGGGAAAAGGGGAAGGG
T7_02186_G02	GGAGAAAAAAGGGGAAAGTCAAGGGAGGGAAAAGGG
T7_02187_G02	AAAGGGAGGGGAAAGGGGTCGAAAAAAAAGGAGAGG
T7_02188_G02	GGGGAAAAAAGGGGAAAGTCAAAGGGGAAAGGGAGA
T7_02189_G02	GGGGAAAAAAAAAGAAGGTCGGGAAGGGGAAAAGGG
T7_02190_G02	GGGAAAAAGGGGAAGGAGTCAGGGAAAAGGGGAAAA
T7_02191_G02	GGGGAAGGGGAGGAAAAGTCAGGAAAAAAAGGGGAA
T7_02192_G02	GGGGAAAGGGAGGGGAAGTCAGGAAAAAAAAGGGAA
T7_02193_G02	GAAGGGGAAAAAAAAGGGTCGGAAAGGGGAAAAGGG
T7_02194_G02	GGGAAAGGGAAAAAAAGGTCGGGAGGGAAAAAAGGG
T7_02195_G02	AAAAAGGGGAGGGGAAAGTCGGGAAAAAGGGAGGAA
T7_02196_G02	GGAGGAAAGGGAGGGGAGTCAAAAAAAAGGGGAAAG
T7_02197_G02	GGGGAAGAAAGGGGAGGGTCGGAGGGAAAAAAAAAA
T7_02198_G02	AAGGGAAAAGGAGGGAAGTCAAGGAGGGGAAAAAGG
T7_02199_G02	GGGGAGGAAAAAAAAAAGTCGGGGAAAAAGGGGAGG
T7_02200_G02	GAGGGGAAGGGGAAAAAGTCAAAAAAAGGGGAAGGG
T7_02201_G02	GGAGGGGAGGAAAAAAAGTCAAGGGGAAAAGGGGAA
T7_02202_G02	GGGGAAAGGGAAAAAAAGTCGGGGAAAGAGGGGAAA
T7_02203_G02	GGAAAAAAAAGGGGAAAGTCGGGGAGGAAGGAGGAA
T7_02204_G02	AGGGAGGGGAGGGGAAGGTCGGGAAAAAAAGAAAAA
T7_02205_G02	GAAGGAAAAAAAAAAGGGTCGGAGGAGGGGAAAGGG
T7_02206_G02	GGAAGGGAAAAGGGGAAGTCAAAGGGGAAGAAAAGG
T7_02207_G02	GAAGGGAAAGGGGAAAGGTCGAGGGAAAAAAAAGGG
T7_02208_G02	AAAAAAAAAGGGGAGGAGTCAGGGAAAGGGGAAGGG
T7_02209_G02	GGGGAAAGGGGAAGGGAGTCAAAGAGGGAAAAAAAG
T7_02210_G02	GGGGAGGGAAAAAAAAAGTCAGGGAGGAAAGGGGAA
T7_02211_G02	GGGGAAAGGGGAAAGGGGTCAAAAGGAAAAAAAGGG
T7_02212_G02	AGGGGAAAAAAGGGGAAGTCGGGGAAAAAGGGGAAA
T7_02213_G02	GGGAAAAGGGGAGGAAAGTCAAGGGGAGGGAAAAAA
T7_02214_G02	GGGGAGGGAAAGGAAGAGTCAAAAAGGGGAGGAAAA
T7_02215_G02	AAGGGGAAAAGGGAGAAGTCGGGGAAAAGGGGAAAA
T7_02216_G02	AAGGAAGGAAAGGGGAAGTCAAAAAGAAGGGGAGGG
T7_02217_G02	GGGGAGGGGAAAAAAAAGTCGAAAAAGGGGAAAGGG
T7_02218_G02	GGAGGGAAAGGGAAGGGGTCGAAGGGGAAAAAAAAA
T7_02219_G02	GAGGGAAAAAAAAGAAAGTCGGGAAAGGGAGGGGAG
T7_02220_G02	GGGAGGGGAAAAGGGGAGTCGGGGAAAAAAAAAAAG
T7_02221_G02	AAAGGGAAAAAGGGAGAGTCGGGAAAAGGGAAAGGG
T7_02222_G02	GGGGAAAAAAGGGAGGGGTCAAAAAAAGGGAAAGGG
T7_02223_G02	GGGAAGGGAAGGGAGGGGTCAAAAAAGGAAAAAGGA
T7_02224_G02	AAAAAGGAAGGAGGGGAGTCGGGAGGAAAAAAAGGG
T7_02225_G02	GGAAAGGGGAAAGGAAAGTCAAAAAGGGAGGGGAGA
T7_02226_G02	GGGGAGGGGAGGGGAAAGTCAAAAAAAAAAGGGGAA
T7_02227_G02	GGGAAAAAAAAGGAGGGGTCAAAAAAGAGGGGAGGG
T7_02228_G02	AAAAGGAAAAGGAAGGGGTCGAAAGGGGAAAGGGGA
T7_02229_G02	GGGGAGGGAAGGAAAAGGTCGGAAGAAAAAAAAGGG
T7_02230_G02	AAAGGGGAAAAGAAAGGGTCGGAAAGGGGAAAAGGG
T7_02231_G02	AAGGGAAAGGAAAAGGGGTCAAAAAGGGGAGGGAAG
T7_02232_G02	GGGAGGGAAAGGGAAAAGTCAAGGGGAAAGGAAAAG
T7_02233_G02	AGGGGAGGGGAAAAAAAGTCGAGGGAAAAAGGAAGG
T7_02234_G02	AAAGAGAGGGGAAAAGGGTCGGAAAAAAAGGGGAGG
T7_02235_G02	GGGAGGGGAAAGGAAAGGTCGGAGGAAAAGGAAAAA
T7_02236_G02	GGGGAGAAGGGGAAAAAGTCGGGGAAAAGGGAAAAA
T7_02237_G02	AAGGGGAGGAAGGGGAGGTCGGAAAAAAAAAAAGGG
T7_02238_G02	AAGGGGAAAGGGGAAGGGTCAGGGAAAAAAAAAGGG
T7_02239_G02	GGAAGGGAAAAAAAAAGGTCGGGAGGGAGGGGAAAA
T7_02240_G02	AAAAGGGGAAAAAAGGAGTCGAAAGGGGAAGGGGAG
T7_02241_G02	AAAAGGGGAAAGGGGAAGTCGGGGAAAAGGGGAAAA
T7_02242_G02	GGGGAAGGGGAAAAAAGGTCGGAAAAAAGGGGAAAG
T7_02243_G02	AGGGAAGGGGAGGAAAAGTCGAAAAAAAAGGGGAGG
T7_02244_G02	AGGGGAAAAAAGGGGAAGTCAAAAGGGGAAAGGGGA
T7_02245_G02	GGGGAAGGAAAAGGGGAGTCAGGGAAGGGAAAAAAA
T7_02246_G02	AAAAAAAGGGGAGGGGAGTCAAGGGGAAAAAGGGGA
T7_02247_G02	GGGGAAAAGGGAAAAAAGTCGGGAAGGGGAAAAAGG
T7_02248_G02	GGAAAAAGAGGGGAAAGGTCAAAAGGGGAGGGGAAA
T7_02249_G02	AAGGGGAAAAGAAAGGGGTCAGAAAGGGGAAAGGGA
T7_02250_G02	GGGAGGAAGGGGAAAAAGTCAAAAGGGAGGAAAAGG
T7_02251_G02	GGGGAAAGAAAAAAGGGGTCAGGGGAAAAAAGGGGA
T7_02252_G02	GGGAAAAAAAGAGGAAGGTCGGGAAAAGGGGAAAGG
T7_02253_G02	GGGAAAAAAAAAGGGGAGTCAAAAAGGAGGGGAGGG
T7_02254_G02	GGGGAGAAGAGGGAAAAGTCAGGGAAAAAGGGGAAA
T7_02255_G02	GGAGGGGAAAGGGGAAAGTCAAAAAAGGAGGGGAAA
T7_02256_G02	AGGGGAAGGGGAGGGAAGTCAAGGGGAGAAAAAAAA
T7_02257_G02	GGGAAAGGGGAAAAGGGGTCAAAGGGGAAAAAAAGG
T7_02258_G02	GGAAAAAAAGGAAGGGAGTCAAGGGAAAGGGAAGGG
T7_02259_G02	GGGGAAAAGGGAAAAAAGTCAAGGGGAAAGGAAGGG
T7_02260_G02	GGGGAAAGGGAAAAAGGGTCAAGGAAAAGGGAAAGG
T7_02261_G02	GGAAAGAAAAAGGGGAAGTCAGGGAGGGGAAGGAAA
T7_02262_G02	GGAAAAGGGGAGGAAGGGTCGAAAAAAAAGGGAAGG
T7_02263_G02	AAAAAGAAAGGGGAAAGGTCGGAGGAAAGGGAAGGG
T7_02264_G02	GGGAGGGGAAGGGGAAAGTCGGGAAAAAAAAAAAGG
T7_02265_G02	GAAGGGAAGGGGAAAAAGTCGGAAAGGGAAAAAGGG
T7_02266_G02	GGGGAAGGGAAGGGAAAGTCGGAAAAAAAAGGGAAG
T7_02267_G02	AAAGGGGAAAGGGGAAAGTCAGGGGAAAAAAGGGGA
T7_02268_G02	GGGGAAGGAAAAAGGGAGTCAAAAAAAAGGGGAGGG
T7_02269_G02	GGGGAAAGGGGAAAAAAGTCAGGGGAAAAAGGGGAA
T7_02270_G02	GGGGAAAAAAAGAAGGGGTCGAAAAAAAGGGGAGGG
T7_02271_G02	GGGGAAAAAAAGGGAAAGTCGGGAGGGAAAGGGAAA
T7_02272_G02	GAAGGGGAAAAAAAAGGGTCGAGGAAAAGGGGAAGG
T7_02273_G02	GGAAAGGGGAAAGGGGAGTCGGAAAAAAAGGGGAAA
T7_02274_G02	GGGGAAGGGGAAGGAAAGTCAAAAAAAGGGAGGGAA
T7_02275_G02	AGGGGAAAAAAAGGGAGGTCGGGAGGGAAAAAAAGG
T7_02276_G02	AGGGGAGAGGGAAAAAAGTCGGGGAAGGGAAAAAAG
T7_02277_G02	GAAAAAAAAAAAGGGGAGTCGGGGAGGGGAAAAGGG
T7_02278_G02	GGGAAGGGGAAAAAAAGGTCGGGAGGGAAAAAAAGG
T7_02279_G02	AAAAAGGAAGGGGAAAGGTCGGAAAAGGGGAAAGGG
T7_02280_G02	GGGAGAAAGAAGAGGGAGTCGGAAAAGGGGAAGAAA
T7_02281_G02	GGGGAAAAAAAAGGGAAGTCAAAGGGGAAAGGAGGG
T7_02282_G02	GGGGAAAAGGGAAGGAAGTCAAAGGGAGGGGAAAAA
T7_02283_G02	GGGAAGGAAAGGGGAAAGTCAAGGGGAAAGGGAAAA
T7_02284_G02	GGGGAAAAAAAAAAAAGGTCGGGAGGGGAAGGGGAA
T7_02285_G02	AAAAGGGGAAAAAAAAAGTCAGGGGAGGGAGGGAGG
T7_02286_G02	AAAAGGAAAAGGGGAAAGTCGGGGAAGGGAAGGGAA
T7_02287_G02	AGGGAAGGGAGGGAAGGGTCGGAAGAAAAAAAAAGG
T7_02288_G02	GAGGGGAAAAGAGGGGAGTCGGAGAAAAAGGAAGAA
T7_02289_G02	GGGGAAAAGGAAAAGGGGTCGAAAAAAGGAGGGGAA
T7_02290_G02	GGGAAAAAAAAAAAAAGGTCGGAGGGGAGGGGAAGG
T7_02291_G02	AGGGGAAAAAAGGGGAAGTCAAAGGGAGGGAAAAGG
T7_02292_G02	GGAAGGGGAAGGGAAAAGTCAAGGGGAAAAAAAGGG
T7_02293_G02	AAAAAAGGGGAAGGGAAGTCAGGGGAAAAGGGAAGG
T7_02294_G02	AAAGGGAAAAAAGGGAGGTCGGAAGAGAAGGAAGGG
T7_02295_G02	GAAAAGAAAAAGGGGAAGTCAGGGGAAGGGGAAAGG
T7_02296_G02	AAAAGGGAAAAAAAGGGGTCGAGGGGAAAGAGAGGG
T7_02297_G02	AAGAAGGGAAGGGGAAAGTCAAAAAAGGGGAGGGGA
T7_02298_G02	GGGGAGGGAGGGGAAAAGTCAGAGGGGAAAAAAAAA
T7_02299_G02	GGGGAAGGGGAAAAAGGGTCGGAAAGAAAAAAAGGG
T7_02300_G02	AGGGAAAAAAAAGAGGGGTCGAGGGGAAGGGGAAAA
T7_02301_G02	GGGGAAGGAAAAGGAAAGTCAAAGGGAAAAGGGGAG
T7_02302_G02	GGGGAAAAGGGGAAAAAGTCAAAAGGGGAAAGAGGG
T7_02303_G02	GGAAAAAAAGGGGAAAGGTCGGGAGGGAAAGGGAAA
T7_02304_G02	GGGAAGGGGAAGAAAAAGTCAAGGGAAAGGGAAAGG
T7_02305_G02	GGGGAAAAAAGGGAGGGGTCAGGGAAAAGAAAAAGG
T7_02306_G02	GAAAAAGGGGAGGGAAGGTCGGGAAGGGAAAAAAAG
T7_02307_G02	GGGAGGAGGGGAGGGGAGTCAAAAAAAAAAAAGAGG
T7_02308_G02	AAAAGGAGGGGAAAGGGGTCGAGGGAAAAAAAGGGA
T7_02309_G02	GGGGAAAAGGGAAAGGGGTCGAAAAAAAAGGGAAGG
T7_02310_G02	GGGAAAAAAGGGGAGGGGTCAAAGGAAGGGGAAAAA
T7_02311_G02	AAAAAGGGGAAGGAAAAGTCAGGGGAAGGGAGGGAA
T7_02312_G02	GGAAGGGGAAGAAAAAAGTCAGGGGAGGGAGGAAAA
T7_02313_G02	GGAAAAGGAAGGAAAAAGTCAGGGAGAAAGGGGAGG
T7_02314_G02	GGGGAAAAAAAAGGGGAGTCAAAGGGAGGGGAAGAA
T7_02315_G02	GGGGAAAAAAAAGGGGAGTCAGGAGGGAAAAAAGGG
T7_02316_G02	AGGGGAAAAAAAAAGGGGTCGAAAAGGGGAAGGAGG
T7_02317_G02	GGGAAAAGGGGAAAGGAGTCGGAAAAAAAGGAAGGG
T7_02318_G02	GGAGGAAGGAGGGGAAGGTCGGAAAAAAAAAAAGGG
T7_02319_G02	AGGGAAAAAAAAGAAAAGTCAGGGGAGGGGAGAGGG
T7_02320_G02	GGGAAAGGGGAAAAAAAGTCAAGGGGAGGGAAAAGG
T7_02321_G02	GGGGAGGAAGAAAAAAAGTCAAGGGGAAAAGGAGGG
T7_02322_G02	GGGGAAGGGGAAAAAGGGTCGGAAAAAAAAAGGGAG
T7_02323_G02	AGGGGAAAAAAAAAAGGGTCGGAAAGGGGAGGGGAA
T7_02324_G02	GGAAAAGGAAAGGGAAAGTCGGGAAGGGAAAAGGGA
T7_02325_G02	GGGGAGGAAAAAGGGGAGTCAAAGGAAAGGGAAGAA
T7_02326_G02	GGGGAAGGGGAAAAGGAGTCGGAGGGGAAAAAAAAA
T7_02327_G02	AAGGAAGAGGGAAAAAGGTCGGAAGGAAGGGAGGAA
T7_02328_G02	AAAGGGGAGGGAAAAAGGTCAAGAAAGGGAGGGGAA
T7_02329_G02	GGGGAAAAAAAGAAAGGGTCGAGAAAAGGGGAAGGG
T7_02330_G02	GGAAAAGGAGGAAAAAAGTCGGGGAGGGAAAAAGGG
T7_02331_G02	GAGAAAAGGAGGGAAAGGTCGAAGGGAAAAAGGGAG
T7_02332_G02	GGGAAAAGGGGAAAAGAGTCGGGGAAGGGGAAAAAA
T7_02333_G02	AAGGGGAGGGGAAAGGGGTCGAGAAAAAAAAAAGGG
T7_02334_G02	GGGGAGGGGAAAAAAAAGTCGAAAAAAGGGGAAGGG
T7_02335_G02	GGGGAAGGGGAAAAAAAGTCGGGGAAAAGGGGAAAA
T7_02336_G02	GGGAGGGAAAAGGGAAAGTCGGGGAAAAGAAAAAGG
T7_02337_G02	GGGAAAAAGGGGAGGGAGTCAAAAGGGAAAAAAGGG
T7_02338_G02	GGGAAGGGAAAAAAAGGGTCGGAAGGAGGGGAAAAA
T7_02339_G02	GGGAAAGGGAAAAAGGGGTCGAAAAAAAAGGGGAGG
T7_02340_G02	GGGAAAGGAAAAGGAAAGTCGGGGAGGGAAAAAAGG
T7_02341_G02	GGGAGGGGAGGGGAAAAGTCGGAAGGGAAAAAAAAA
T7_02342_G02	GGAGGAAAAAAGGAAAAGTCAAAGGGGAGGGAAGGG
T7_02343_G02	AGGGGAAGGGAGGAAGGGTCGAAAAAAAAGGGAAAG
T7_02344_G02	GGGGAAAAAAGGAAAAAGTCGAGGGAAAGGGAGAGG
T7_02345_G02	GGGAAAAAGAAAAAGGGGTCAAAGGGGAAGGGGAAG
T7_02346_G02	GGGAAAAAGGGGAAGAAGTCAAGGGGAGGAGAAGAA
T7_02347_G02	AGGGAAAAAGGGAAGGGGTCAAAAGGGAAAGGAAGG
T7_02348_G02	AAAAAGGGAGGGGAGGGGTCGAAGGGAAAAAGGAAA
T7_02349_G02	GGGAAAAGGGAAGGGGAGTCAAAGGAAAAAGGAAGG
T7_02350_G02	GGGAAGGAAGGGAAAAGGTCGGGAAAAAAGGAAAGG
T7_02351_G02	GGGAAGGGAAGGGAAGGGTCGAAGGAAAAGGAAAAA
T7_02352_G02	GGGGAAAAAAAAGGAAAGTCAAGGGGAGGGGAAGGA
T7_02353_G02	GGGGAAGGAGGGAAAAGGTCAGGAAAGGGGAAAAAA
T7_02354_G02	GGGGAGGGAAAGGGAAAGTCAAAAAGGGAAAAAGGG
T7_02355_G02	AAGGGGAAAAAGGGGAAGTCAAGGGGAAAGGGGAAA
T7_02356_G02	GGGGAAGGGGAAAAAAGGTCGGAAGAAAAAGGGGAA
T7_02357_G02	AGGGGAGGGGAAAAGGGGTCGAAGGAGGAAAAAAAA
T7_02358_G02	AAAAAAAGGGGAAGGAAGTCAGGGGAAGGGGAAAGG
T7_02359_G02	GGGAAAAGGGAGGGAAAGTCAAAGGGAAAGGGGAAA
T7_02360_G02	GGGGAAAGGAAAGGGGAGTCAAAAAAAAGGGGAAGG
T7_02361_G02	GGGGAAAAAAAAGGGGAGTCAGGGGAAAAAGGGGAA
T7_02362_G02	AAGGGAGGGGAGGGGAAGTCGGGGAAAAAAAAGAAA
T7_02363_G02	GGGGAAAAAAAGGGGAAGTCAAGGGAAAGGGGAAAG
T7_02364_G02	GGGAGGAGGGGAGGAAAGTCGAAAAGGGGAAAAAAA
T7_02365_G02	GGGAAAGGGGAAGGGGAGTCGGGAGGAAAAAAAAAA
T7_02366_G02	GGGGAAAAGGGAAGAAAGTCAAAAGGGAGGGGAAAG
T7_02367_G02	GGGAAAAAGGAGGGGAAGTCAAAAGGAAAAGGAGGG
T7_02368_G02	GGGGAGGAAAAAAAAGGGTCGGAAAAAAGGGGAAGG
T7_02369_G02	GGGGAAAAGGGGAGAAAGTCAAAGGGAAAGGGGAAA
T7_02370_G02	GGGGAAAAAAGGGGAAAGTCGGGGAAAAAAGGGAAG
T7_02371_G02	GGGGAAAAAGGGGAAAAGTCAAAAGGGGAGGGGAAA
T7_02372_G02	GGGGAAAAGGGAAAAAGGTCGAAAGGGGAGGGAAAA
T7_02373_G02	AGGGGAAGGGAAAAAGGGTCGGAGAAAAAAGGGGAA
T7_02374_G02	AAGGGGAAAAGGGGAAAGTCAAGGGAAAAAGGAGGG
T7_02375_G02	GGGGAGGGGAAAAGAAAGTCAAAGGGAAAAAGGAGG
T7_02376_G02	GGGAGGGAAAAAGGGGAGTCAAAAAGGGAAAAGGGA
T7_02377_G02	GGGGAAAAAGAGGGAAGGTCGAAAAAAAAGGGGAGG
T7_02378_G02	AAAAGGAGAAAAAAGGGGTCAAAGGGAAGGGGAGGG
T7_02379_G02	GGGGAAAAAGGGAAAAAGTCAAAGGGAGGGGAAAGG
T7_02380_G02	GGGGAGGGGAGGGAAAAGTCAAAAAAAAGGAAAGGG
T7_02381_G02	GGGAAGGGGAAAAAAAAGTCAAAGGGAAAGGGAGGG
T7_02382_G02	GGAGGGAGGGGAAAAAAGTCAAAAGGGGAAAAAGGG
T7_02383_G02	GGGGAGGGGAAAAAAAAGTCGGAAAGGGGAAGGAAA
T7_02384_G02	GGGGAAGGAAAAGGAAAGTCAGGGAAAAAGGGAAGG
T7_02385_G02	GGAAAAAGGGGAAAAGGGTCGGAAAGGAAAAGGGGA
T7_02386_G02	GGAGGGGAAGGGAAAAAGTCAAAGAAAAGGGGAAGG
T7_02387_G02	AAGGGAGGGAAGGGGAAGTCAAAAGGGAAAGGGAAA
T7_02388_G02	GGGGAAGGAAGGGGAGGGTCGGAAAAAAAAAGGAAA
T7_02389_G02	AGGGGAAAAGGGGAGGGGTCAAAAAAGGGGAAAAAG
T7_02390_G02	GGGAAAAAAAAGGGGAGGTCGGAAAGGGGAAAAAGG
T7_02391_G02	AAAAAAGGGGAAGGGAAGTCAAGGGGAGGGAAAAGG
T7_02392_G02	GGGAAGGGGAGGGAAAAGTCAGGGGAAAAAAAAAGG
T7_02393_G02	AAGGGGAGGGAAAAGGGGTCGAAAGGAGGGAAAAAA
T7_02394_G02	GGGGAAAGGGGAAAGGAGTCAAGGGAAAAAAAAGGG
T7_02395_G02	GAAAGGAAAGGGGAGGGGTCAAAAAAGGGGAAAAGG
T7_02396_G02	GGGGAAAGGAAAAAGGGGTCAAAAAAAAGGGGAGGG
T7_02397_G02	GGGAAGGGAGGGGAAAAGTCAAAAGAAAGAGGGAAG
T7_02398_G02	GGGGAAGAAAAAAGGGAGTCAAAGGGGAAGGGGAAA
T7_02399_G02	GGAAGGGGAGGGGAAAAGTCAGGGAAAAAGGGAAAA
T7_02400_G02	GGAGGGAAAGGGGAAAGGTCGGAAGAAAAAGGGAAA
T7_02401_G02	GGGGAGGGGAAAAAAAGGTCGGAAAAAAGGAAGGAG
T7_02402_G02	AGAAAAAAGGGAAAAGGGTCGGAAAGGAGGAGGGGA
T7_02403_G02	GGGGAAGAAAAAGAGGGGTCGAAAAAGGAGGGGAAA
T7_02404_G02	GAAGGGGAGAGAAAAGGGTCAGGGAAGGGGAAAAAA
T7_02405_G02	AAAGGGGAAAAGGAGGGGTCAAGGGAGGGAAAAGAA
T7_02406_G02	GGAAAGGGGAAGAAAGGGTCAAGGAAAGAAAGGGAG
T7_02407_G02	AGGGGAAAAAAAAAGGGGTCAAAGGAGGAGAGGGGA
T7_02408_G02	AGGAAAAGGGAGGGGAGGTCAAGAAGAAAGAGGGAA
T7_02409_G02	GAAAAAAGGGGAAAGGGGTCGAAGGGAAGGGGAAAA
T7_02410_G02	AAAAGAAAAGGGAAGGGGTCAAGGGAAGAAGGGAGG
T7_02411_G02	GGGGAAGGGGAAAAAAAGTCAAGGGGAGGAAAAGGA
T7_02412_G02	AAAGGAGAGGGAAAGGGGTCAAAGGGGAAAAAAGGG
T7_02413_G02	GAAAAAAAGGAAAAAGGGTCGGAAAGGAGGGGAGGG
T7_02414_G02	GAAAGGGGAAAAAAAAAGTCGGAAGGAAGGGGAGGG
T7_02415_G02	AAGGAAAGGGGAAAAAAGTCGGAGGAAGGGAGGAGA
T7_02416_G02	AAAAAAGAAGGAAGGAGGTCAAGGGGAGGGGAAAGG
T7_02417_G02	GGAAAAAAGGAGGAAAGGTCAGAAGAGGAAGGGGAG
T7_02418_G02	GGGAAAAAAGGGGAAAAGTCGGGAGGAAGGGGAAAA
T7_02419_G02	GGGAAAAGGAGGAAAAAGTCGGGGAAAGGAAAAGGG
T7_02420_G02	GGGAAGGGGAAGGGGAAGTCAAAAAGGAAAAAAGGG
T7_02421_G02	AGGGGAGAGAAAAAGGGGTCGAAAGAAAGGGGAAAG
T7_02422_G02	GGAAAGGGGAAGGGAAAGTCAAAGGAAGAAAGGAGG
T7_02423_G02	AGGGAAGGAAAGAAGGAGTCAAGGGAAAAAGGAGGG
T7_02424_G02	AAGGGGAAAAGGGAGAGGTCGAGAAAGAAGGAGGAA
T7_02425_G02	GGAAGGGGAAAAAAAAGGTCGGGAAAGGGAAAGGGA
T7_02426_G02	AGGGGAAAGAAAGGGAGGTCGAAAGAAGGGAAGAGA
T7_02427_G02	GGGGAAAAAAAAAAGGGGTCAAAGGAGGGGAGGAAG
T7_02428_G02	GGGGAAGGGAAAGAAAGGTCGGGAAAAGAAAGAAGG
T7_02429_G02	AGAAAGGGGAAAAAAAAGTCGGGAAGAGGGAGGGGA
T7_02430_G02	AAAGAAGAAGGAAAGGGGTCGAAGGGAAGGGGAAAG
T7_02431_G02	AAGGAAGGGGAGGGGAAGTCAAGGGGAGAAAAAAAG
T7_02432_G02	GGGGAAAGGGGAGGAAAGTCAAGAGGAAGGGAAAAA
T7_02433_G02	GGGAAAGGGAAGGGAAAGTCGAAGAAAAAGGAAGGG
T7_02434_G02	GAAAGAAAAGGGGAGGGGTCGAGGGGAAAAGGAAAA
T7_02435_G02	AAGGGGAAAAGGGAGAAGTCAGGGGAAAGGGGAAAA
T7_02436_G02	GGGGAAAGAGGAAAAGGGTCGGAAGAGGGAAAAAAG
T7_02437_G02	AGGAAGGAAAAAAAAGGGTCGAGGGGAAAGGGGAGA
T7_02438_G02	GGGAGGGAAAGGAAAAAGTCAAAGAAAGGGGAAGGG
T7_02439_G02	AAAAAAGGGGAAGGAGGGTCAAAGAGAAAGGGGAGG
T7_02440_G02	AGGAGGGAAAAAAAAGAGTCGGGGAAAGGGAGAAGG
T7_02441_G02	AAGAAGGGGAAAAAGGAGTCGGAAAAGGAAGGGAGG
T7_02442_G02	AAGAGGGAGAAAGAGGAGTCGGAAAAGGGAAAAGGG
T7_02443_G02	GAAAGGAAAAAGGGAAGGTCGGGAAAAAGGGGAAGG
T7_02444_G02	GGGAAGGAAAAAGAAAGGTCGGGAGAAAAGGAGAGG
T7_02445_G02	GAGGGGAAAAGGGAAGGGTCGAAGAGAAAAAAAGGG
T7_02446_G02	AAGGGGAAAGGAAGAAAGTCGGGGAAAGGAAAAGGG
T7_02447_G02	GGGAAAAAGGGGAAAAGGTCGGAAGGGGAAAAAAGG
T7_02448_G02	GGAAAAGGGGAGGAAGAGTCAAGGGAAAAGGGGAAA
T7_02449_G02	AAAGGGAGGAAGGGGAAGTCAAAAGGGAAAGGAAGG
T7_02450_G02	GGGGAGGGGAAAGGGGAGTCAAAAAGGAAGGAAAAA
T7_02451_G02	AAAGGAGGAGGGGAAGAGTCAAAAGGGAAAAGGGAG
T7_02452_G02	AGAGAAAAGGGGAAGAGGTCAAAAGGGGAAAGGGAG
T7_02453_G02	GAAAAGGGAAAGGAAAAGTCAAGGGGAGGGGAGGAA
T7_02454_G02	GGAGGAAGGGAAAAAAAGTCAAAGGAGGAAGGGAGG
T7_02455_G02	AGGAAAGGGAAGAAAAGGTCGGAGGGAGGAAGGAAA
T7_02456_G02	GAGGGGAGGGAAAGAAAGTCAAAAGGAAGGGAAGGA
T7_02457_G02	AGGGAGGGAAGGAGAGGGTCAGAAAAGAAGGAAAGA
T7_02458_G02	GGGAAGAGGGAAAAGAAGTCAAAGGGAGGGGAGAAA
T7_02459_G02	AAGAAGGAAAAAGGGAAGTCAGAAGGAGGGGAGGGA
T7_02460_G02	AGGAAAAAAGGGGAGGGGTCGAGGGGAAAAGAAGAA
T7_02461_G02	AGGGAAAGGGGAAAGGGGTCAAAGGAAAAAGGGAAG
T7_02462_G02	GGGGAGAAGGAAAGGAAGTCAAGGGGAAAAAAAGGG
T7_02463_G02	GGGAAAAGGGGAGGGGAGTCAAGGAAAAAAGGGAAA
T7_02464_G02	GAAGGGAAGAAGGAGGAGTCGGGAAAGGGAAAAAGA
T7_02465_G02	GAGGGAAAAGAGGAAAAGTCAAGGAGGAAAGGAGGG
T7_02466_G02	GGGAGGAAGGGGAAGGAGTCAAGGAAAAAAAGGAAG
T7_02467_G02	GAGGGGAGGGGAAAAAAGTCAAAAGGGGAAAGAAGG
T7_02468_G02	GGAGGGAAAGGAGGGAAGTCAGGAAGGAAAAAAAGG
T7_02469_G02	GGAGAGGAGGAAAAAAAGTCGGGGAAAAGGGGAAAG
T7_02470_G02	GGGAAGGGGAGGGGAAAGTCGGAGAAAAAAGGAAAA
T7_02471_G02	GGGGAAGGAAGGGGAGGGTCGGAAAAAAAAAAAGGA
T7_02472_G02	GAAAAGGGGAAAGGAGGGTCGGAAAGGGGAAAAAAG
T7_02473_G02	GGGAAAAAAAAAGAAGGGTCAAGAGGAGGAGGAGGG
T7_02474_G02	GGAAAGGGGAAAAGAAGGTCGGAGGGAAAAAGAGAG
T7_02475_G02	GGGAAAAAAAAAGGAAGGTCGGGAAAGGGGAAGGAG
T7_02476_G02	GGGAGGGGAAAAAAAAAGTCAGGAGAAGGGAAAGGG
T7_02477_G02	GGGGAAAAGAAGAAAAAGTCAAGGGGAGGGGAAAGG
T7_02478_G02	GGGAAAGGAGGGGAAAGGTCGGGAAAGAAAAGGAAA
T7_02479_G02	GAAAAGGAGGGGAGGAAGTCAAGGGAAAAAGGGGAA
T7_02480_G02	GAAGGGAAAAAGGGAAAGTCGGAAGGGAGAAAGGAG
T7_02481_G02	AGGGAGGGAAGGGGAAGGTCGGAAAAAAAAAGAAGG
T7_02482_G02	GGAAAAGGGGAGGAAGAGTCAGGGAGAAAGGAAAAG
T7_02483_G02	GGGGAAAGGGAGAGAGAGTCAGAGAAAAAAAGGGGA
T7_02484_G02	GGGAGGGAGGGGAAAAAGTCAGGGAAGGGAAAAAAA
T7_02485_G02	GGAAAAGGGGAAGGAAAGTCAGGAGGGAAAAGGGAA
T7_02486_G02	GGAAGGAAAAGGAAGAAGTCAAAAGGGGAGGGAGGA
T7_02487_G02	GAAAAAAAAGGGGAGGGGTCGAAAAAAGGGAGGGAG
T7_02488_G02	GGGGAAAAGAAAAGGAAGTCGGGAAGGGGAAAAAGG
T7_02489_G02	GAGGGGAAGGAGAAAGAGTCAAAAAAAAGGGGAGGG
T7_02490_G02	GGGGAAAGGAAAAAAAGGTCGGGAGAAAAAGGAGGG
T7_02491_G02	AAGGGGAGGGGAAAAGGGTCGAGAGGGAAAAAAAAG
T7_02492_G02	AGGGAAAGGGAAGAGGGGTCAAGGAAGGAAAAAGGA
T7_02493_G02	GGAAAAAAGGGAAGAAGGTCGGGAAAAAGGAGGGGA
T7_02494_G02	AGGAGGGGAAAAAAGGGGTCGAAAGAAAGGAAAGGG
T7_02495_G02	AAAGGGAGGGGAAAAAGGTCAAAGAGGGAAGGGGAA
T7_02496_G02	AAGAAAAGGGAAAAGGAGTCGGGGAGGGGAAAAGGA
T7_02497_G02	AAGGGAAAAGGAGAAGAGTCAGAGGGGAAAAGGGGA
T7_02498_G02	AAGGAAAGGGGAAAAAGGTCGAGGAAAGGGGAAAGG
T7_02499_G02	GGAGGGAAAAGAAAGGGGTCGAGAAGGGGAGAAAAA
T7_02500_G02	AAGGGAGGGGAAAAAGGGTCGGAAGAAAAAAGGGGA
T7_02501_G02	GGGAAAGGGAAAAGGAGGTCGGAAGGGGAAAAAAAG
T7_02502_G02	AAAAGGAAGAAGGGGAGGTCAGGAAAGGGAAGGGAA
T7_02503_G02	GGGAAGGGGAGAGAAAAGTCAAAAGGGAGAAAGGAG
T7_02504_G02	AGGGGAAGGAAGGAGGGGTCGAAAAGAGAGGAAAAA
T7_02505_G02	GGGGAAGGAAAAAAAGAGTCAGGAGGGAAGGAGAAG
T7_02506_G02	AGAAAGAAAAAAGGGGAGTCAAGGGGAGGGAGGAAG
T7_02507_G02	GGGGAGAAAGAGAAAAAGTCGGAAGGGAGGAAAAGG
T7_02508_G02	GAGAGGGAGGAAAGGAAGTCAGGAGAGGAGAGAAAA
T7_02509_G02	GGGAAAAAGGGGAAGGAGTCAAAAGGGAAAGGGGAA
T7_02510_G02	AAAAAAAAGGGAGAGGGGTCAGGAAGAAGAGGAGGG
T7_02511_G02	AGGAAAAAAAAAAGGGAGTCGGGGAAAGGGGAAGGG
T7_02512_G02	GGGAAAAGGGAGGGGAAGTCGGGAAAAGGAAAAAAG
T7_02513_G02	GAAGGAGAAAGGGAAGGGTCAAAAGGAGGAGAAAGG
T7_02514_G02	AAAGGAGGGAGGGAAAGGTCGGAGAGGAAAAAAAGG
T7_02515_G02	AAGAGGAGAAGGGAGAGGTCGGGAAAAAAGAAAGGG
T7_02516_G02	AGGGGAGGAAGGAGGGAGTCGAAGAAAAAGAGGAAA
T7_02517_G02	AAAAAGGGAAGGAAAAGGTCGGAAGGGAGGGAAGGA
T7_02518_G02	GGGGAAAAAGGGGAAAGGTCAGGGGAAAAAAGAGGA
T7_02519_G02	GAAAAGGGAAGGGAGAAGTCAAAAGGGGAGAGAAGG
T7_02520_G02	GGAGAGGAAAGGAAAGGGTCAGGGGAGGAAAAAAAG
T7_02521_G02	GGGAAAGGGGAAGGAGAGTCGGGAAGGGAAAAAAAA
T7_02522_G02	GAAGAAGGAGAGGGAAAGTCAAAAGAGAAGGGGAGG
T7_02523_G02	AGGGAAGGGGAAAAAGGGTCGGAAAGAGGGAAAAAG
T7_02524_G02	GGGAAAGGAAGGAAAAAGTCAGGGAAGGAAAGGAGG
T7_02525_G02	GAAAAGGGGAAAGGGAGGTCAGGAAAAAGGAAGGGA
T7_02526_G02	AAAAGGGGAAAGGGGAAGTCGGGGAAAAGAAAAGGG
T7_02527_G02	GGAAAAAAGGGGAAGGGGTCGAAAGGGAAAAAGGGA
T7_02528_G02	AGGGAGGGGAAGGGAAGGTCAAAAGAAAAGGGAAAG
T7_02529_G02	AAGGGAAAAGGGGAAAGGTCGGAAGGGAAAGAGAAG
T7_02530_G02	GGGGAGAAGAAAGGGAGGTCGAAGGAAAGGGAAAAA
T7_02531_G02	GAGGAGGAGGAAGGAAAGTCAGGGAAAAGGAAGAAG
T7_02532_G02	AGGAAGGAAGGGGAAGGGTCAGGAAGGGAAAAGAAA
T7_02533_G02	GGGAAGAGGGAAGGGGAGTCGAAAAAAGAAAGAAGG
T7_02534_G02	GGGGAAAAGAGAAAAGGGTCAAAAGGAGGAAGGGGA
T7_02535_G02	AAAAGGGAAAAAGGAAGGTCGGGAGGAAGGGAGGAA
T7_02536_G02	GAGAAAGGGAAAAAAAAGTCGGAAGGGGAGGGGAAG
T7_02537_G02	AAAGGGGAGAAGGAAAAGTCGGGGAAGGAAAAAGGG
T7_02538_G02	GGGGAGGGGAGAAAGGGGTCAAAAAAAGGGGAAAAA
T7_02539_G02	GGAAGGGGAAAAAGGGAGTCGGGAAAAAGAAGGGAA
T7_02540_G02	GGAGAAAAAAGGGGAAAGTCAGGGGAAGGGGAAAGA
T7_02541_G02	AAAAGGGGAGGAAAAAGGTCGGGAAAGGGAAAGGGA
T7_02542_G02	GAGGAGGGGAAGGGGAAGTCAAGAGGAAAAAAGGAA
T7_02543_G02	GAGAAAGGGAGGGGAAAGTCAGAAAAGGGAAGAAGG
T7_02544_G02	GGGGAAAGGAAAAGAAGGTCAGGGGAAAAAAGGGGA
T7_02545_G02	GGGAGGGGAAAAAAAGGGTCGGAAAAAAAGGAAGGG
T7_02546_G02	AAAAAAGGAGAGGAAGGGTCGGAAAGAGGGAAGGAG
T7_02547_G02	AAAGGAAGGAGAAGAAGGTCGAAGGGAAAAGGGAGG
T7_02548_G02	AAGGAGGGAAGAAAAAAGTCGAGGGGAAAGGGAGGA
T7_02549_G02	GGGGAAAGGGAGGAAAGGTCGGGAAAAGGAAAAAGA
T7_02550_G02	GGGGAAGGGAGGGAAAAGTCAGGAAAGGGAGAAAAA
T7_02551_G02	AGAAAGGGGAAAAAGGGGTCAGGGGAAAAAGGGAGA
T7_02552_G02	GGGGAGAAGAAAAAGAAGTCAGAGGGGAAGAAGGAG
T7_02553_G02	GGGAAAAAGGAGGAAGAGTCAAAAGGAGGGAAAGGG
T7_02554_G02	GGAAAAGGGGAAGGGGAGTCGGGAAAGGAAAAGAAA
T7_02555_G02	AGGAGGAAAAAAAAAGGGTCGGAGGGGAGGGAAAAG
T7_02556_G02	AGGGAAGAGAGGAAGGAGTCAAGAAGAAAAGGGGAG
T7_02557_G02	GGGGAAAGGAAAAAAGGGTCGAGGAAAGGAAGGGAA
T7_02558_G02	GGAAAGGGGAGGGAAAGGTCGGAAAAAAAAAGAGGG
T7_02559_G02	GGGAAGAAGGGGAAGAAGTCGGAGGGGAAGAAAAAA
T7_02560_G02	GGGGAAGAGGGAAAAGGGTCAGGAAAAGGGAAAGAA
T7_02561_G02	GGGGAAAAAAAAAAAAGGTCAGGGGAGGGGAAAGGG
T7_02562_G02	AGGAAGGAAAGGAGGAAGTCAGGGAGAAAAGGGGAA
T7_02563_G02	GAAAGGGAGGAGGAGAAGTCAAAAAAGGGGAGGAGA
T7_02564_G02	GGGAAAGAGGAAAAGGGGTCAGGAAGAAGGAAGGAA
T7_02565_G02	GGGAAAAGGGGAAAAAAGTCAAGGGAGGGAGGAGAA
T7_02566_G02	GAAAAAAAGGGGAGGGAGTCAGGGAAAAAGGAGGAG
T7_02567_G02	GAAAAGGGAAAGGAGGAGTCAGGGAAAAAGGAGGAG
T7_02568_G02	GGAAAGGAAGGAAAGGGGTCGAAGGAAAAAGGGGAA
T7_02569_G02	AAAAGAGGAAAAGGGAGGTCGGAGGAAAAGGGGAGA
T7_02570_G02	AAGGGGAGAAAGGGAAAGTCGGGGAAAGGGGAAAAA
T7_02571_G02	GAGGGGAAAAAGGAAGGGTCGGAGGAAAGAGAAAAG
T7_02572_G02	AAGAAGGGGAAAAAGGGGTCGAAAAGGAAGGGGAGA
T7_02573_G02	GGAGGGGAAGGGAGAGGGTCGAAAAAAAAAGGGAAA
T7_02574_G02	AAAGGGAGGGAAAAAGGGTCAAGGGAGGGAGAAAAG
T7_02575_G02	GGGGAAAGGGGAAAGGGGTCGAAAGGAAAAGGAAAA
T7_02576_G02	AGGAGAGGGAAAAAAGGGTCAAGGGGAAAAAGGGGA
T7_02577_G02	GGGAGGAAAGAAAAAGAGTCGGGAAGGAGAAGGGAA
T7_02578_G02	GGGGAAAAAAAAGGGAAGTCAAAAAGGGGAGGAGGG
T7_02579_G02	GGGAAGGGAAAAAAAAAGTCAGGAGGGGAAGGGGAA
T7_02580_G02	GGGAAAGGGAAAAAAAAGTCGGGGAAGGGAAAAGGG
T7_02581_G02	GGAAAAAAAGAGGGGAAGTCAAAGGGGAAGGAAGGG
T7_02582_G02	GGGGAAGAAGAAAGAAAGTCGGGAAGAGGAAGGGAA
T7_02583_G02	GGGGAGGAGGGAAAAGGGTCGAAGAAAAGGAAAAAG
T7_02584_G02	GGGGAGGAAAAGGGGAAGTCAAAAAAGGAAGGGGAA
T7_02585_G02	GAGAGGGAAAGGGAAAAGTCGAGGAGGAAGAAGAAG
T7_02586_G02	GAAAAAAAGGGGAGAAAGTCAGGGAGGGGAGGAAAG
T7_02587_G02	AGAAGGGAGGAAAAAAAGTCGGGAAGGGAAGGAAGG
T7_02588_G02	GGGAAAGGGGAGGGGAGGTCGGGAAAAAAAAAAAGA
T7_02589_G02	AAAAGGGAGGAAAAGGGGTCGAAAGGGGAGGAAAAG
T7_02590_G02	GAAAGGGGAAAGGGAAAGTCGGGAAAAAGGAGGGAA
T7_02591_G02	AAAGGGAAAGGAAAGAGGTCGGGAAAGGGAAAGGAG
T7_02592_G02	GGAAGGGAGAAAAGGAAGTCAAAGGGGAAGGGGAAA
T7_02593_G02	GAAGAAGGGGAGGGGAAGTCAAAAAGAGAAAGGGAG
T7_02594_G02	GAAGAGGAAGGGGAGGAGTCAAAAAAAAGGGGAAGG
T7_02595_G02	AAGGAAGGGGAAAAAGGGTCGAAAAGGGAAGGGGAA
T7_02596_G02	AAGGGAGGGAAAAAAAAGTCGGAAAGAAGGGGAGGG
T7_02597_G02	AGGAGGGAAGAAAAGGGGTCGAAGGGGAAAAAAAGG
T7_02598_G02	GGGGAGAAAGGGGAAAGGTCGAAAAAAAGAGGGGAA
T7_02599_G02	AAAAAGGAAGGGGAAGAGTCAGGGAAGGAAGGGGAA
T7_02600_G02	GGGGAGGAAGGGAAAGAGTCGAGGAAAAAGGGAAAA
T7_02601_G02	AAAAAAGGGGAGGGAAAGTCAGGGGAAGGAGAAGGA
T7_02602_G02	AAGAGGAGGGAAAAAAGGTCGGGAGGGAAAAGGAAG
T7_02603_G02	AGGGGAAAGGAAAAAAGGTCGGGAGAAAAGGGGAAG
T7_02604_G02	AGAAGGGAGGAGGGGAAGTCAGAAAAAGGGGAAAAG
T7_02605_G02	GGGAAAGGAAAAAGGAAGTCGAAAGAGGAGAGGGGA
T7_02606_G02	AAGGAAAGGAGGGGAGGGTCAAAAAAAGGGGAAAGG
T7_02607_G02	GGGAAGAGGGAGAAAAAGTCAAGGGAGGGAAAAAGG
T7_02608_G02	AAAGGAAGGGAAAAGGGGTCGAGGAAAGAAAGGGGA
T7_02609_G02	AGAAGGGGAGAAGAAAAGTCGGGGAAAAGGAAAGGG
T7_02610_G02	GGGGAGGAGGAAAAAAAGTCGGAAAGAAGGAGGGAA
T7_02611_G02	AAAAAGGGGAGAGGAAAGTCAAGGAAAGGGAGGAGG
T7_02612_G02	GAGGGAGAAAAGGGAGGGTCGAAAAAAGAAAGGAGG
T7_02613_G02	AAGGGGAGAAAGAGAAGGTCAGGAGGAAAGGAAAGG
T7_02614_G02	AGAAAGAAAGGGAAGGGGTCAAAGGAAGGAGGGAAG
T7_02615_G02	AGGGAAGGAAGGAAAAAGTCAAAAGGGAGGAGGGGA
T7_02616_G02	GGGGAGGAGGAGGGAAAGTCAAAAAGGGGAAAAAGA
T7_02617_G02	AAAAGGGAAGGGGAAGGGTCGGAGGGAGAAAAAAAG
T7_02618_G02	GGAGAAGGGGAAAAAAAGTCAAGAGAAAGGGGAGGG
T7_02619_G02	GGGAAAGAAAAAAAGGGGTCGAGGGAGGAAAAAGGG
T7_02620_G02	AAGAGGGAAGAAGAGGGGTCAAAAAGGGAAGGAAGG
T7_02621_G02	AGAGGGAAAAAGGGGAGGTCAAAAGGAAGAGGGAAG
T7_02622_G02	GAAAAAAGGGAGGAGAGGTCGGGAAGGGAAGAAAAG
T7_02623_G02	AAGAAGGGAAAGAAAGGGTCGGAAAGGGGAGGGAAA
T7_02624_G02	GGAAAAGAGGGGAAAAAGTCAGGGAGAAGGAAAGGG
T7_02625_G02	AGGAAGGGAAAAAAAAAGTCGGGAAAGGGGAGGGGA
T7_02626_G02	AGGAAGGGAAGAGGGGAGTCAAGGAAGGAAAGGAAA
T7_02627_G02	GGGAGGAGAAAGGGAAGGTCGAAAAGAAGGGAGAAA
T7_02628_G02	GAAAGGAGAAGGGGAGAGTCAGGGAAAAGGGGAAAA
T7_02629_G02	GGGAGGGGAAAAAAAAGGTCAGAAGGGAAAGGGGAA
T7_02630_G02	GGAAGAAGGGGAAAAAGGTCGAGGGGAAAAAAAGGG
T7_02631_G02	GGAAAGGGAAGGGAAGGGTCAAAAGGGAAAGGAAAG
T7_02632_G02	GGAAAGGGAAGAGGGGAGTCAAAAAAGGGGAAAGGA
T7_02633_G02	GGGAGGAGAAAAAAAGGGTCGAGAAGGGGAAAAAGG
T7_02634_G02	GAAAGGGGAAAGGGAGAGTCAGGGAAAGGGGAAAAA
T7_02635_G02	GAGAAAGGGGAGGGGAAGTCGGAAAAAGGAAGAAAG
T7_02636_G02	GAAGAAAAAAGGAAGGGGTCGAAAGGAAGGGAGGGA
T7_02637_G02	GGGAAGGAAAGGAAAAGGTCGGAAAAGAGGAAGGGA
T7_02638_G02	AAGAAAAAGGAAGGGAGGTCGGGAGAAGGGAAAAGG
T7_02639_G02	AAAAAGAAAGGGGAGGAGTCAGGGAGGGAAAGGGAA
T7_02640_G02	AGGAGGGGAGGGGAAGGGTCGAAAAAAGGGAAAAAA
T7_02641_G02	GGGGAAGGAAGGAAAAAGTCAGAAGGGAGGGAAAAG
T7_02642_G02	GGGGAAAGGGAAGGAAGGTCAAAAAGGGGAAAAAGG
T7_02643_G02	GGGAAAAAAGAAAAGGGGTCGAAAGGGGAAAGGGGA
T7_02644_G02	AGAAAAAGGGGAAGGGAGTCGGAAGAAGGAAAAGGG
T7_02645_G02	AGGGGAGGGGAGGGGAAGTCAAAAAAAAAAGGGAAG
T7_02646_G02	AAAGGGAAGAGAGGGAGGTCGGGAAAAGAGAAAAGG
T7_02647_G02	AGAGAAGAAGGGAAGGGGTCGAGGGAAAAAGGAAGA
T7_02648_G02	GGGAAGAGAGAAGGAAAGTCAAGGGGAAGAAGGGAA
T7_02649_G02	AAGAAAAAAGGGGAAAGGTCGGGAAAGAAGGGAGGG
T7_02650_G02	AAGAGGGGAAGGGGAAAGTCAAAGGAAAGGGAAGGA
T7_02651_G02	AAAGGGGAAGGAAGGAAGTCAAGGGAAGGAGGGAAA
T7_02652_G02	GAAAGAGAGGGGAGGGAGTCGGGGAAAAAAAAAAGG
T7_02653_G02	GGGAAAAAAAGGAAGAAGTCAAGGGAGGGAGGGGAA
T7_02654_G02	AAGGAAGGAGGGAAAAAGTCAAAAAGGGAGGGGAGG
T7_02655_G02	GGGGAAGGAAAAAAAAGGTCGGAGGAGAAGGGGAAA
T7_02656_G02	GGGGAGGAAAGGGGAGGGTCGGAAGAAAGAAAAAAA
T7_02657_G02	AGGGGAAGGGAGGGGAAGTCAAAAGGGAAAAAAAGG
T7_02658_G02	GGGAGAAAAAAAAGGGAGTCAAGGAAGGGAGGGGAA
T7_02659_G02	GGGGAAGAAGAAAAGGGGTCAGAAAGGGAAAAAGGG
T7_02660_G02	AGAAGAAAGAGGGAGGGGTCGAGAAAAGGAAGGGAA
T7_02661_G02	GGGAAAAAAAAAAGGAGGTCAGAAGAGGAGGGAGGG
T7_02662_G02	AAGAAGGGAAAGGGAAAGTCAGGGGAGGGGAAAAAG
T7_02663_G02	AAGGGAGGAGAGGAAAAGTCGAAGGAAAGAGAAGGG
T7_02664_G02	AGGGGAAGGGAAGAGGAGTCGGGAAAAAAAAGGAAG
T7_02665_G02	GAGGAAGGGAGGGAAGGGTCAAAAAGGAAAAAAGGG
T7_02666_G02	AGGGGAAAAGGGAGGGAGTCAGGGAAGGAAAAAAAG
T7_02667_G02	GGAAGGAAAAGGGGAAAGTCAGGAAAGGGAAAGAGG
T7_02668_G02	GGGAAAAGGGGAAAAAAGTCAAAGGAAAGGGGAGGG
T7_02669_G02	AAGGGAGGGAAAGAAGGGTCAAAAGGGGAAAAGAGG
T7_02670_G02	GGGGAGAAAGAGGGAAGGTCGAAAAAGGGAAAAAGG
T7_02671_G02	GGGAGGGAGGAAGGAAAGTCAAAAGAAAGGAGGAAG
T7_02672_G02	AGGGGAAAAAGGGGAGGGTCGAGGAAGAAGAAAAAG
T7_02673_G02	AAGGGAGGGAAAGGGGAGTCAGGAAAGGAAAAAAGG
T7_02674_G02	AAAGGGAAAAGGGAAGGGTCGAGAAAAAAGGGGAGG
T7_02675_G02	GGAAAGAGAAGGGAAAAGTCAAAAGAGAGGGGAGGG
T7_02676_G02	GAAAAAGGAGAAAGAGGGTCGGAGGGGAAAGAAAGG
T7_02677_G02	AAGAGGGGAGGAAAAGAGTCAGGGAAAGGGGAAAGA
T7_02678_G02	AAGGAGGAAGAAAGAGGGTCAAGGGAAGAAGGGGAA
T7_02679_G02	AAAGAGGAGGAAAAAGGGTCGAAGGGAGGGAAAAGG
T7_02680_G02	AAAAAAGGGAAAAAAGAGTCGGGAGGAGGGGAAGGG
T7_02681_G02	GGAGGGGAAGGGGAAAGGTCGAAAAAAGGGAAAGAA
T7_02682_G02	AGGAGAAGGGGAAAGAGGTCGAAAGAAAGAAGGGGA
T7_02683_G02	GGGAAAGGGAAAAAGAAGTCGGAAGAGGGGAAAGAG
T7_02684_G02	AGGAGGGGAAAAAAAAAGTCAAGGGGAGGAGGGAAG
T7_02685_G02	GAAAAGGGGAAAAAAGGGTCGAGGGGAGAAAGGGAA
T7_02686_G02	GGGAAAAAGAAAGGGGAGTCGAAAGGAAGGGAAAGG
T7_02687_G02	GGGGAAAAGGGAAAAAGGTCGGGAAAAGGGGAAGAA
T7_02688_G02	GGAAAGGGGAGAAAAAGGTCGAGAGGGGAAGGAAAA
T7_02689_G02	AGGAAAAAAAGGGGAAAGTCAGGGAAGGAAGGAGGG
T7_02690_G02	GGGAAAAAGGGAGGAAGGTCGAAAGGGGAAAAAAGG
T7_02691_G02	AGGAAGGAAAAAGGAGGGTCGAAGGGGAGAGGAAAA
T7_02692_G02	AGAAGAAGGGAGGAAAAGTCAAGGGGAGAGGAGGAA
T7_02693_G02	AAGAAAAAAGGAAGGGAGTCGGAAGGAGGGGAGAGA
T7_02694_G02	GGAGGAAGGAAAGGGGAGTCAAAAGAAGAAGGGGAA
T7_02695_G02	GGAGGAAAAAAGGGGAAGTCGAAGGGGAAAGAAAGG
T7_02696_G02	GAAGGGGAAAAAAGGGAGTCAAGAAGGGAAGGGGAA
T7_02697_G02	AAAGGGAAGAAGAGGAAGTCGGGGAGAGGGGAAAAA
T7_02698_G02	GGAAAAGGGGAAGAAGAGTCAAGAGGAGGGGAAGAA
T7_02699_G02	GGAAAGGAGGGGAAAAGGTCGAAGGAGGAAAAAAGG
T7_02700_G02	GGGGAAGGAGGGAAAAAGTCAAGGAGGGGAAAAGAA
T7_02701_G02	GAAAAGGGAGGAGGGAAGTCAGGAAAAAAGGGGAAG
T7_02702_G02	GGGGAAGAAAGGGGAAAGTCGAGGAAGAAAAAGGGA
T7_02703_G02	GAAGGGGAAGGAAGAAAGTCAGGGAGGGGAGAAAAA
T7_02704_G02	GGGAAGAGGGAAAAAGAGTCAAAGGGGAAGAAAGGG
T7_02705_G02	GGGGAGGGGAAAAAAAAGTCGAAAGGAGAAAGGGGA
T7_02706_G02	GGGAAAGAAGGAAAAAAGTCGGGAGGAAAAGGAGGG
T7_02707_G02	GAGGGGAAAGGGAAAGGGTCGAAAAGAAAGGGAGAA
T7_02708_G02	AAAAAGGGGAAAGGGAAGTCAAGGGGAAAGGGGAAG
T7_02709_G02	AGGGGAGGGAGGAAAAAGTCGGGAAGGAAAGGAAAA
T7_02710_G02	GGGGAAAAAAGGGGAAGGTCGAAAGGAAGAAAGGGA
T7_02711_G02	GAAAAGGAAAAGGGAGGGTCAAGGAAGAAGGGGAAG
T7_02712_G02	GGAAAGGGGAAGGGAGAGTCAAGGGAAAGGAAAGAA
T7_02713_G02	GGGGAAAAAAGGGAAGGGTCGAAAAGGGAAAAGGAG
T7_02714_G02	AAAAGAGGGAAAAAAAAGTCGGGAAGGGGAGGGGAG
T7_02715_G02	GGGGAAAAAAAAGGAGAGTCAGGGGAAGGAAAGAGG
T7_02716_G02	AAGGGAAGGGGAAAAGAGTCGGGAAGGGAAAAAAGG
T7_02717_G02	AGGGGAAAGGGAAAAGGGTCGGAGGGGAAGAAAAAA
T7_02718_G02	AAGAAAAGGAGGGAAAGGTCGGAGAGGGAAAAAGGG
T7_02719_G02	GGAAAAAAAAGGGAAAGGTCGGGAGGGAGGGGAAAA
T7_02720_G02	GGGAAAAAAAGGGAGAAGTCAAGGAGGAAGGAAGGG
T7_02721_G02	AAGAAAAGAGGGGAGGAGTCGGGAGGAAAAGGGAAA
T7_02722_G02	GAGGAGGGAGAAAGGAGGTCAGAGGAAAAAAGGAAG
T7_02723_G02	GGGAAAGGAGGGAAAGAGTCAAAGGGAGAAAAAGGG
T7_02724_G02	GAGAAGAAGAGGGAGGGGTCGAAAGAGGGGAAAAAA
T7_02725_G02	GGAAAAAAGAAAAGGGAGTCAAGGGGAGGGGAAAGG
T7_02726_G02	GGGAAAAAAAAAGAGGGGTCGAAAGAGGAAGGGAGG
T7_02727_G02	GAAGGGGAAAAAAAAAGGTCGGGAAGGGGAAGAGGA
T7_02728_G02	AGGGGAAAAAGGAAAAGGTCAAGAGAGGGGAAAGGG
T7_02729_G02	GGGGAAAAAAGGGGAGGGTCAAAAAAGGAGAGGGAA
T7_02730_G02	AAAGGGGAAGGGGAAAAGTCGAAGGAGAAGAGGAAG
T7_02731_G02	GGAGGGAAAAAAGGGAAGTCGAAAGGGGAAAGAAGG
T7_02732_G02	GGGGAAGGGGAGAAAAAGTCAAAAAAAGGGGAAGGG
T7_02733_G02	AAGGGAAAGGGAGAAAAGTCAGGGAGAAGAGGGGAA
T7_02734_G02	GGGGAAAGAAGAGGGGAGTCAAGAGGGAAAGAAAAG
T7_02735_G02	GGAAGGGAGGAAAGGAAGTCAAAGGGAAAAAGAGGG
T7_02736_G02	AAAGGGGAAGGGAAAAAGTCAAGGGGAGGGAAGAAG
T7_02737_G02	AGGGAAAAAGGGAAGGGGTCAAAAGAAAGAGGGAGG
T7_02738_G02	AAAAGGGAGGGGAAGGGGTCGAAAGAGAAAAAAGGG
T7_02739_G02	AGGGGAAAGAAGGGAGGGTCGAAAAAAGAAGGGAAG
T7_02740_G02	AGGGGAGAAAGGAAGGGGTCAGGAAAGGAAAGGAAA
T7_02741_G02	GGGAAGGAAAAAGGAGGGTCGAAAAAGGGGAAGGAA
T7_02742_G02	GGAAAAAAGGGAGGAAGGTCGGAAAAGGAGGGGAAA
T7_02743_G02	GAAGGAAAGGGGAAAGGGTCGAAAAAGAAAGGGAGG
T7_02744_G02	AAAAGAAGAAGAAGGGAGTCAGGGGAGGAAAGGGAG
T7_02745_G02	AGGGAAAAAGAAAAGGGGTCGAGGGGAAGAGGGAAA
T7_02746_G02	GGGGAGGGGAAAGAAAAGTCAAGGGAGGGGAAAAAA
T7_02747_G02	AAAGGGGAAGGGAAGGGGTCAAAAAAAGAGAGGAGG
T7_02748_G02	AGGGGAAGGAAAGGGAGGTCGAGGGGAAGAAAAAAA
T7_02749_G02	AGAAGAGGAAAGGGAAAGTCAGGGGAAGGGGAAGAA
T7_02750_G02	AAAAAAAAAGGGGAAGGGTCGGAGAAGAGGGAAGGG
T7_02751_G02	GAAAAAGGAAGGAAGGGGTCGAAAAAAGGGGAAGGG
T7_02752_G02	GAAGAGGGGAGGAAAAAGTCGGGGAGGAAAGGAAAA
T7_02753_G02	GGGGAGAGAAAAGGAAGGTCGAAAAGGAAAAGGGGA
T7_02754_G02	AAGGAGGAGGAGGGAAAGTCGGGAAAGGGGAAAAAA
T7_02755_G02	GGAAAGGGGAAAAGGAAGTCAAAGGGAGGAAGGAAG
T7_02756_G02	AGGGGAGGGAGGAAAGAGTCAAAGGGAAAAAAAGGG
T7_02757_G02	GGAAAAGGAAAGGGAAGGTCGAAGGAAAGAAGGAGG
T7_02758_G02	AAAGAAAGAGAGGAGGGGTCGAGAGGGAGGAAGAAA
T7_02759_G02	GAGGGAAAAAAGGAAAAGTCGAGGGAGGGGAAAAGG
T7_02760_G02	GAAGGGGAAAGGGGAAGGTCAAAAAAAAAGGGAGGG
T7_02761_G02	GAAAGGAGGGAAGAGGGGTCAAAAAGAAAAGGAGGG
T7_02762_G02	GAGGGGAAAGGAAAAGGGTCAAGGGAGGAAAAGGAA
T7_02763_G02	AGGGGAAAAGGAGAAAAGTCGGAGGGGAAAAAAGGG
T7_02764_G02	GGAGAAGGGAAAAAAGGGTCAGGGAAAAAAGGGGAG
T7_02765_G02	AAGGGGAAAAAGGGGAGGTCGGGAAAAAAGGGGAAA
T7_02766_G02	GAAGGGAGGGAAAGGGAGTCAAAGGGAGGAAAAAGA
T7_02767_G02	AAAAAAAGGAGAGGAGGGTCAAAGAGGGGAGGAAGG
T7_02768_G02	GGGAAAGGGAGGAAGAAGTCAAAGGGAAAAAGGGGA
T7_02769_G02	GAGGAAAAAGGGAAGAGGTCGGGAGAAAAGGAAAGG
T7_02770_G02	GGGAAGGGGAAAAAAAAGTCAGGGGAAAGGAAAGGG
T7_02771_G02	GGGAAAGGGAAAAGAAAGTCAGGGGAAGGAAAAGGG
T7_02772_G02	GGGGAAAAAAGGAGAAGGTCGGGAAAGGAAAGGGAA
T7_02773_G02	AGGGGAAAGGAAAAAAGGTCGGAGGAAGGGAAAAGG
T7_02774_G02	GGAGGGAAAGGGGAAAAGTCAGGAAAGGAAAAAGGG
T7_02775_G02	GAAAAAGGGGAGAAAAGGTCGGGAGGAAGGAAAAGG
T7_02776_G02	AGAGGGGAAGGGGAAAAGTCAAAAAAGGAGGGAAGG
T7_02777_G02	AGAAAGAAAAAAGGGAAGTCGAAGGGAGGGAGGGGA
T7_02778_G02	AAAAGGGGAAGGGAAAAGTCAGGAAGGGAGAGGAAG
T7_02779_G02	AGGGGAGAAAAAGGGGAGTCGGGAAAAAAGGGGAAA
T7_02780_G02	AAAAAAAAAGGGAGGAGGTCGAGGGGAAAAGGGAGG
T7_02781_G02	AGGGAAGAAGGGGAAAGGTCAAGGAGGGAGGAAAAA
T7_02782_G02	AAAAAGAAGGAGGAAGGGTCGAGGGAAGGAAAGGGA
T7_02783_G02	GGAAGAGAAAAGGGAAGGTCAAGAGGAGGGGAAGAA
T7_02784_G02	GGGGAGGGAAAAAAAAGGTCGAGGGAGAAAAGGGAA
T7_02785_G02	AGGAAGGGAGAGGGAAGGTCGGGAGAAGAAAAAGAA
T7_02786_G02	AAAGGGAGAAAGAAGGGGTCGAAAAAGGGGAGGAGA
T7_02787_G02	AGGAAAGGAGGGGAAAGGTCAAAAGGAGGGGAGAAA
T7_02788_G02	AAAAGGGGAAGAAAGAGGTCGAAGGAAGGGAGGGAA
T7_02789_G02	AAGGAAGGGAAGGGAGGGTCAAAGGGGAAAAAAAGG
T7_02790_G02	GGAGGGAGAAAAAAGAGGTCGAAAGAGGGAAAGGGA
T7_02791_G02	GGAAAGGAGGAGGGAAGGTCGGGAGGAAAAGAAAAA
T7_02792_G02	GAGGGAGGGAGGGAAAAGTCGAAAAAGAGAGGGAAA
T7_02793_G02	AAAAAGGGAAAAAAGGGGTCGAGAAGGGGAAGGGAG
T7_02794_G02	AGGGAAAGAAGGAAGGGGTCGAGGGAAAAAAAAGGG
T7_02795_G02	AGGGGAGAGGGGAGGAAGTCGAAAAGGGGAAAAAAA
T7_02796_G02	AAAAAGGAAGGGAAAGGGTCAAAGGGAAGGAGGAGG
T7_02797_G02	GGGGAAAAAAGGAGAAAGTCGAGGAAAAAGGGGAGG
T7_02798_G02	GGGAAAAAGGGAAAAAGGTCGAAAGGAGGAGGGAAG
T7_02799_G02	GGGAAGGGAAAAAAAAAGTCGGGGAAGAAGAGGGAG
T7_02800_G02	AGGGAAGGGAAGGGAGAGTCAAAAAGGGAAAGAAGG
T7_02801_G02	GGGAAAAAGGAGAAAGGGTCGGAAAAAAGGAGGGGA
T7_02802_G02	AGGGAGAGAGAAAAAAGGTCGGGAGGGAAAGGGAAA
T7_02803_G02	GGGGAAAAAGGGAAAGGGTCGAGGAAAAAAGGGGAA
T7_02804_G02	GGGAGGGGAAGAAAGGAGTCAAAAAGGAGGGGAAAA
T7_02805_G02	GGAGAAAAGAAGGAGGAGTCGGGGAAGAAAAGAGAG
T7_02806_G02	AGGAGGAGGAAAAAGGGGTCGAAGGGAAGAAAAAGG
T7_02807_G02	AGGGGAGAAAGGGAAGGGTCGGAAAGGGAAAAAAGA
T7_02808_G02	GAAGGGGAAAAGGAGGGGTCAGAAGGGAAAAAAAGG
T7_02809_G02	GGAAGAGGGGAGAAGAAGTCAAAGAGAAGGGAAAGG
T7_02810_G02	AGAAAAGAAAAGAAGAGGTCGAAGGAGGGAGGAGGG
T7_02811_G02	GGGAGGAAAAAGGGAAAGTCGAAAAAGGGAGGAAGG
T7_02812_G02	AAGAAGGGGAAGAGAGGGTCAAAAAAGAAGGGAGGG
T7_02813_G02	GAAGGAAAGAAGGGGAAGTCAGAAGGAAAGGAGGAG
T7_02814_G02	GAAAAAAAGGGGAGGGAGTCAGGAGGAAGGAGAAGA
T7_02815_G02	GGAAAAAAAGGAAAAGAGTCGGGAGAGGGGAAGGGA
T7_02816_G02	GAGGGAAAGAAAGGGGAGTCAAGAGGGGAGAGAAAA
T7_02817_G02	AAAGAAGAAAAGGGAAGGTCAGGAGGGGAAGGGAGA
T7_02818_G02	AAAAAGGAGGAGGGAAAGTCGGGGAAAAAGAGGGGA
T7_02819_G02	AAAAGAGGGGAAGGGAGGTCAGGAAGGAAAGGGAAA
T7_02820_G02	AAGGGAAAAAGGAAAAAGTCGGGAGGGAAGGGGAAG
T7_02821_G02	AGGGGAAGGAGGAAAAAGTCGGGGAGAAGAAAAGGA
T7_02822_G02	AAAAAGGAGGAGAAAGGGTCAGAAGGGGAAGGAGGA
T7_02823_G02	AAGGAAAAAGGAGAGGGGTCGAAAAGAAGGGGAAGG
T7_02824_G02	AGAGGGGAAGGGGAGGGGTCAAAAAAGGAAAAAAGG
T7_02825_G02	AGGGAAGAGGAGGAAAAGTCGGGAAAAAGAAGGAGG
T7_02826_G02	GGAAAGGGAAGGGGAAAGTCGGGAGAGAAAAAAAGG
T7_02827_G02	GGAAAAAAAAGGGAGGGGTCGAAGAAGGAGAAAGGG
T7_02828_G02	GGAGGGGAGGAGAGAAAGTCAGAGGGAGAAAAGAAA
T7_02829_G02	AAGGAGGGGAAGAGGGAGTCAAAGAGGAAAGAAAGG
T7_02830_G02	AGAAGGGAAGGGAGGAGGTCAGGAAGGGAAAAAAGA
T7_02831_G02	GGGAAAAAGGGAAAGAGGTCAGGGGAAGGGGAAAAA
T7_02832_G02	GAAAAGGGGAGAGGGGAGTCGAAAAGAAGGGGAAAA
T7_02833_G02	GAAAAGGAGGGAAGAAAGTCGGGGAAAGAAGGAGGA
T7_02834_G02	AAAAGGAGGGGAAAAAAGTCGGGAAGGAGGAAGGGA
T7_02835_G02	GGAGGGGAAAGGAGGAAGTCAAAAGGAAGAAAAGGG
T7_02836_G02	GAGAAAAGGAGAAGAGAGTCAAGAGGAGGGGAAGGA
T7_02837_G02	GGAGAAGGAAGAAAAAAGTCGGGAAGGGGAGAAAGG
T7_02838_G02	GGAAAAAAGGGGAAAGGGTCGAGGGAAGGGAAAAGA
T7_02839_G02	AGGGAGAAGGAAAAGAAGTCAAAAGGGGAGGAAGGG
T7_02840_G02	AGAAAGGGAAAGGAGAAGTCAAGGAAAAGGGGAGGG
T7_02841_G02	GGAAAAAAAGGAGGGAAGTCAAGAGGGGAGGAAAGG
T7_02842_G02	AAGGGGAAGGGAAAGGGGTCAGGGGAAAAAGGAAAA
T7_02843_G02	GGGAGGGAAAAGGAAGGGTCGGAAAGGAAAAAGGAA
T7_02844_G02	GGGGAGAAGGGAAAAAAGTCAAAGGAAGGAAGAGGG
T7_02845_G02	GGGGAGGGAAGGAAAAAGTCAGAAGGAGGAGAGAAA
T7_02846_G02	GGGAAGGAAAAGGAAGGGTCAAAGGGAAAAGGAGGA
T7_02847_G02	GAGAGAAAAAAGGAAAAGTCAGGAGGAGGAGGAGGG
T7_02848_G02	AAGGGGAGGGAGAAAGGGTCGAGAAAAAAAAGGGGA
T7_02849_G02	AAGAGGAAGGGGAAAGAGTCAAAGAGGGAAAGGAGG
T7_02850_G02	GGGAAAAAGGGAAAAGGGTCGAGGGGAGGAAAAAAG
T7_02851_G02	AAGAAGGAAGGAGGAAAGTCGGAAAGGGAGGGGAAA
T7_02852_G02	AAGAAAGGAGGAAAGGGGTCAAGGGGAGGGAGAAAA
T7_02853_G02	GGGAGAAGGAAAGGAAAGTCAAAGAAAGGGGAGGAG
T7_02854_G02	GGGGAAAAAGGAGAAAGGTCAAGAGAGAAAGGGAGG
T7_02855_G02	AGGAAAGAAAGGGGAAGGTCGAAAAGGAGAAGGGGA
T7_02856_G02	AAAGGGGAAAGAAAAAAGTCGGGGAAAGGAGGGGAG
T7_02857_G02	GGAGAGGAAAAAGGAGAGTCAAAGGAGGAGAAAGGG
T7_02858_G02	GAAAAAAGGGAGGGAAAGTCAGAAGGGAGGGGAGAA
T7_02859_G02	GGGAGGAGGAGGAAAAAGTCAAGGGAAAAGAGGGAA
T7_02860_G02	GAGGGAAGAAGGGGAAAGTCGGAGGAAGAAAAGGAA
T7_02861_G02	AGGGAAGGAGAAGAGAGGTCAAGAGGGAAAGGGAAA
T7_02862_G02	AGGGGAAGGGAAAGGAAGTCGGAAGAAGAGGAAAAG
T7_02863_G02	GGGAGAAGGGAAGGAAAGTCAAGAGGGAAAAAGGGA
T7_02864_G02	GGGAAAAGGGAAAAAGAGTCGAGGAAAGGGGAGGAA
T7_02865_G02	AGAAAGAGGGAGGGGAAGTCAAAAGAAAGAGGAGGG
T7_02866_G02	GGAAGGGGAAAGAAAGAGTCAGGAGAAGGAAGGGAA
T7_02867_G02	GGGAAAGGGAAAGGGAAGTCGGAAAAAGGAAGGAGA
T7_02868_G02	GGAAGGGAGAGGGAGGAGTCAAGGAGGAAAAAAAAG
T7_02869_G02	AAGAAGGGGAAGGGAGGGTCGAAAAGGGGAAAAAAG
T7_02870_G02	AAAAGGGGAAGGAGGAGGTCGAAAAGGGAAGGGAAA
T7_02871_G02	AAAAAAGGGGAAGGGAGGTCGGGAGGGGAAAAAGAA
T7_02872_G02	GGAGAAAAGGAAAGGAAGTCGGGAAAGGGGAGGAAA
T7_02873_G02	AAGAAGGGGAGGAAAAGGTCGAAAGGAAAGGGGAGA
T7_02874_G02	GGAGGAGAAAAGAGGAAGTCAGAAGGGAGAGGAAGA
T7_02875_G02	AGAAGGGGAAGGAAGGGGTCAGGAAAAAAGGGGAAA
T7_02876_G02	GAAGGAAAGGGGAAGAAGTCAGGGAAAAAAGGGGAG
T7_02877_G02	GGAAAGGGAAGAGGGGAGTCGAAAAGAAGGGAAAAG
T7_02878_G02	AAGGGAGGAGGGGAGGAGTCAAAAAAGAGGAAAGAG
T7_02879_G02	GAAGAAGGGAAAGAAAAGTCAGGGAGGGGAGGAGAA
T7_02880_G02	AGGAAGGGAGGGAGGAAGTCAAGGGAAGGAGAAAAA
T7_02881_G02	GGGAGAGAAAGGAAAAGGTCGGGAAAAAGGAAGGAG
T7_02882_G02	AGGGGAAAAAGAAAGGAGTCAGGGAAGAGAGGGGAA
T7_02883_G02	GGGGAGGGAGGGAAAAAGTCGAGGGGAAAAAAGAAA
T7_02884_G02	AAGGGGAAAGAAGGGAAGTCGGAGGAAGGAAAAGAG
T7_02885_G02	GGAGGGAAGGAGGAGGAGTCAGAGAAGAAAAGGAAA
T7_02886_G02	AGGGAGAGGGAAGAAGGGTCGAAAAGGAAAAAGGAG
T7_02887_G02	GAGGAGGGAGGGGAAAAGTCAGAAAAAGGGAAAAGG
T7_02888_G02	AGGGGAAAAAGGAGAAGGTCGAAAGAAGGAGGGGAA
T7_02889_G02	AAGGAAGGAGGAAAAGGGTCAAGGAAAAAGGGAGGG
T7_02890_G02	GAAAAAAAAGAGGAGGAGTCGAGGGGAAGAAGAGGG
T7_02891_G02	AAGAGAGAAAGGAAAAGGTCGAAGGGAAGGGAAGGG
T7_02892_G02	GGGGAAGAAGGGGAGAAGTCAAAGGAAGGAAAGGAA
T7_02893_G02	GAGGAAAAGGGGAGAAAGTCAGGGAAAGAGAGGGAA
T7_02894_G02	AAGGAAAGGGAAAAAAGGTCAGGGAGGAAAGGGGAG
T7_02895_G02	AGGGGAAAAGAAGGAAAGTCGAGAGGAAAAGGGAGG
T7_02896_G02	GGGAGAGAGGGGAGAAAGTCAAAGAGGGAAAGGAAA
T7_02897_G02	GGAAAGAGAGGGAAAGGGTCAGAGGGGAAAAGAAAG
T7_02898_G02	AAGGGGAGGAGGGAAAAGTCAAAAAAAGGAGGGGAG
T7_02899_G02	GGGAGGGGAGAAGAAAAGTCGAAGAGAAAGGAAGAG
T7_02900_G02	AAAAGGAAGGGGAGGAAGTCAAGGGGAGAAGAAGGA
T7_02901_G02	AAAAGAAGGGGAGAGGGGTCAAAAGGGAAGGGGAAA
T7_02902_G02	AAGGGGAAGAAAGGGGAGTCAGGAAGGGAAAAGGAA
T7_02903_G02	GGAAAAAGAGGAAGAAAGTCAGAGGAGGGGAAGGGA
T7_02904_G02	GGAGGAAGAGGGGAAAAGTCAAAAGGGGAAGGGAAA
T7_02905_G02	GGAGGAAAGAAAAGGGAGTCAAAGGGAAGAAGAGGG
T7_02906_G02	GAGAAAGGGGAAGAAAAGTCGGGGAAAGAAGGGAGA
T7_02907_G02	GGGAGGAAAAAGGAGGGGTCAAGAGGAAAAAAAGGG
T7_02908_G02	AGGGAAAGGGAAAAAGGGTCGGAAAGGGAAAGAAGG
T7_02909_G02	AGGGGAGAAGAAAAGGGGTCAGGGGAAGGAAAAAAG
T7_02910_G02	AAGAAAAGGGAGAAAGGGTCAGAAAAGGGAGGGGAG
T7_02911_G02	GGAGGGAGGAAAGAAAAGTCGGAAGGGGAAAGAAAG
T7_02912_G02	GGAAAGGAAAGGGAGAGGTCGGGAAGAAAGGGAAAA
T7_02913_G02	AAAAAGGGAGGGAGGAAGTCAAGAAGGGGAGAAGGA
T7_02914_G02	AAGAAAGGGGAGGAGGGGTCGAGAAAAAGGAGAAAG
T7_02915_G02	GGGAGAAAGAAGGAAAAGTCAAAGGAGGGAGGAGGA
T7_02916_G02	GGGAGAGGAAGAGGGAAGTCAGGGAAGGAAAAAAAG
T7_02917_G02	GAGGAGAGAAAAAGGGAGTCGGGAGAGAGGAAAAAG
T7_02918_G02	AGGGAAGGAAAAAAGGGGTCAGAAGGAAGGAAAGGG
T7_02919_G02	AGGAAAAGGGAAAGGAGGTCGGGAGAAAGGGGAAAA
T7_02920_G02	AGGGGAAAAAAAAAAGAGTCGGAAGGGGAGGGAAGG
T7_02921_G02	AAAAAAAAAAAGGGGAGGTCGGGAAAGGGGAGGGGA
T7_02922_G02	AGAAAAAGGGGAAGGGAGTCAGGGGAAGAGAAAAGG
T7_02923_G02	GGGAAAAGGGAGGGAAAGTCGGAAAGAAAGGGAAGA
T7_02924_G02	AAGGAAGGGAGGAAGAAGTCAAAGGAGAGGGGAAAG
T7_02925_G02	GGGAGAAGAGGGGAAGGGTCGGAGAAAAAAGGAAAA
T7_02926_G02	AAGGGAGAAGGGGAGGGGTCAAAAGGAAAAGGAAGA
T7_02927_G02	GGGAGGGAAAAAGGAAGGTCGGAAAAAAAAGGAGGG
T7_02928_G02	AAAGAAGGGGAGAAGGGGTCGAAAAGGGAAAAGGGA
T7_02929_G02	AGGGAAAGAGGGAGGAAGTCGAGGAGAAGGGAAAAA
T7_02930_G02	GAAAAAGGGAGGAAGAAGTCGGGAAGAAGGGAGGAA
T7_02931_G02	GAGAAGAAGGAAAAAGAGTCGGGAGGAAGGGGAAAG
T7_02932_G02	GGGGAAGGGAGGAAAAAGTCAAGGAAAAAGGGAAGG
T7_02933_G02	GAAGGGGAAAGAGGAAAGTCGGGGAAAGGAAAAGGA
T7_02934_G02	GGGAAGGGGAAGGAGAGGTCAAGAAAAAAGGGGAAA
T7_02935_G02	AGGGAGAGGGAGGGGAAGTCAAAAGGAAAGAAAGGA
T7_02936_G02	GGAGGAAAAGAAAAGAGGTCAAAAGGGGAGAGGAGG
T7_02937_G02	GAGAAGGGGAGAGGAAAGTCGAAAAAGGGAGAAAGG
T7_02938_G02	GGGGAAAGAAAAAAAGGGTCGAGAAGAGGAGAGGAG
T7_02939_G02	GAAGAGGGAAGGAAGGGGTCGAAAAAAGGGAGGAAA
T7_02940_G02	GGGAAAAGAAAAAAAGGGTCGGAAGGGGAAGGAGGA
T7_02941_G02	AAGGGGAAAAGGGGAAAGTCAAAAGGAGGAGGAGGA
T7_02942_G02	GAAAAAAAAGAGGGAGGGTCGGAGGGAAAAGGGAGA
T7_02943_G02	GAGGAAAAGGAAAAAGGGTCGAAGGGGAAAGGAGGA
T7_02944_G02	AAAAAGGAAAGGGGAAAGTCAAGAGAGGAGGGAGGG
T7_02945_G02	GGAAGAGGGAAGGAAGGGTCGGAAAGAGAGGAAAAA
T7_02946_G02	GGAAGAAAAGGGAAGGGGTCGAAGGAAAAGGAAGGA
T7_02947_G02	AAGGGGAAAAGGGAGAAGTCAAGAGAAGGAAGGAGG
T7_02948_G02	AGAAAGGGGAGGGAGGAGTCGGAAAAAGGGAGAAAA
T7_02949_G02	AGGGAGGAAAAGAAAGGGTCGGAGGAAAAAAGGGAG
T7_02950_G02	AAAAGGGGAGGAAAGAAGTCGGGGAAAGGAGGGAAA
T7_02951_G02	GAGAGAGGAGGAAAAAAGTCGGGAAAGAAGGGAGAG
T7_02952_G02	AAAGGAAGAGGGAGGAGGTCGAAAAGGGAAGGAAAG
T7_02953_G02	AGGGGAAAAAAAAAGGGGTCGAAGGAAAGGGGAGAG
T7_02954_G02	AGAAAAAGGAAAAAGGGGTCGAGGGAAAGAGGGAGG
T7_02955_G02	AAAAGGGAGGGGAAGGGGTCAAAGGAAGAAGAAAGG
T7_02956_G02	GGGGAGGGAAAAAGAAGGTCGGAGGGAGGAAAAAAA
T7_02957_G02	GAAAAGGGGAAAGGGAGGTCGAGGGAAAAAGAAAGG
T7_02958_G02	AAAAGAAGGGAGGAAGGGTCGAAAGGAAAAGGGGAG
T7_02959_G02	GGGGAAGGGAAAAAGGGGTCGAGAAAAAAAAGAGGG
T7_02960_G02	GAAAGGGAGGAAGGAAGGTCGGAAAAGGGAAGAGAA
T7_02961_G02	AAAAGAGGGGAGGAAAAGTCAAGGGGAAAGGGGAAG
T7_02962_G02	GAAAGGAAAGAAAAGGGGTCGAGGGGAGAAAAAGGG
T7_02963_G02	GAAGGAAGAAAGGGAAGGTCAAGGGGAAGGGGAAAA
T7_02964_G02	GGAGAAAGGAAAGGGGAGTCAGGGAAGGAAAGAGAA
T7_02965_G02	AAAAGGGAGAGAAAAGGGTCGGAGAAGGGGAAAAGG
T7_02966_G02	GGGGAAAAAGGGAGGAGGTCGGGAGAAAAAAAGAGA
T7_02967_G02	GGGGAAAGAGGGAGAGGGTCGGAAAAAAGGAAAAAG
T7_02968_G02	GGGGAGGAGAAAGGGAAGTCGAGGAAAAAAGGGAAA
T7_02969_G02	AGGAAGGGAAAAAAGGAGTCAAGAGAAGGGGAGGAG
T7_02970_G02	AGGGGAGAGAGGAGAAAGTCAAAAGGAAAGGAGGGA
T7_02971_G02	GGAAGGAAGGGGAAGGAGTCAAGGGAAAAGAAGAGA
T7_02972_G02	GGGGAAGAGAAAAAGAAGTCGGAGGAGGGAAAAGGA
T7_02973_G02	GAGAGGGAAAGGAGGGAGTCAGAGAAGGAAGGAAAA
T7_02974_G02	AAAAAAGGGGAGGAAGGGTCGAGAGGAAAAGGGGAA
T7_02975_G02	GGAAGGGAAAAAGGGAAGTCAGGGAAAAGGGGAAGA
T7_02976_G02	GAAAGGGAAAAGGGAAGGTCAGGAGAAAAGAGAGGG
T7_02977_G02	AAAAAAAGGGAAAGGGAGTCAGGAAGGGAAGGAGGG
T7_02978_G02	GAAAAGGAAAGAGGGAAGTCGGGAGAAAGGGGAAGA
T7_02979_G02	AGGAGGGGAGGGAAAGGGTCGGAAAAAAAGGAAGAA
T7_02980_G02	AAGAAGGAAGGGGAAGGGTCGAAAAAGGAGGGGAAA
T7_02981_G02	GAAGGGAAGAAAAAAAGGTCGGAAGAGGGAAGGGAG
T7_02982_G02	AAAGAAGAGGAAGGAGGGTCAAAAGGGGAAGGAAGG
T7_02983_G02	AAAAAAAGAAAGGAGAAGTCGGGGAGGGGAAGGGAG
T7_02984_G02	GGGGAGAAAGAAAAAAAGTCGGGAAGGGGAAGGGAA
T7_02985_G02	GGGGAGAGGGAGGGAGAGTCAAAAAAAAAAAGGAGG
T7_02986_G02	GGAAAAGGGGAGAAAAGGTCGGAGGGGAAAAAAAGG
T7_02987_G02	AAAAAGGGGAGGGGAGGGTCGAAAAAAAGGGGAAAG
T7_02988_G02	GGGAAGAAGAAGAAAGGGTCGAAAAGGAGGAAGGGA
T7_02989_G02	AGGGAAAAGAGAAAGGAGTCGAGAAGGGAAGAGGGA
T7_02990_G02	AGGGGAAGGAAAAGGAGGTCAAAGAAAGGGGAAAGG
T7_02991_G02	GGAAAAGGGAAAGGAAGGTCAGGAAGAGAGGGGAAA
T7_02992_G02	GAAAGGAAAAGGGAAAAGTCGGAGGAGAGGAAAGGG
T7_02993_G02	AAGAGGGAGAAAAGAAGGTCGGAAGGAAGGAGGAAG
T7_02994_G02	AAAAAGAGAGGGAAGGGGTCAAAGGAGAGAGGGGAA
T7_02995_G02	AGGAAGGAGGGGAGAGAGTCAAGAAAAGGGGAAGAA
T7_02996_G02	AAGGGAGGGAAAAAAAAGTCGGAAAGGAAGGGGAGG
T7_02997_G02	AGAGGGGAAAAAAAAAGGTCGAGGGAGGAGGGGAAA
T7_02998_G02	AGGAAAAGGAGGAAAGGGTCGGAGGGGAGGAAAAAA
T7_02999_G02	GAGGAGGAAAAAAGGGAGTCGGGAAAAGGAAAGGGA
T7_03000_G02	AGGGAGGGAAGGGGAAAGTCGGGAGGAAAAAAGAAA
T7_03001_G02	GGAGGGGAGGAGGAAAGGTCAAAAAAAAAAGGGGAG
T7_03002_G02	AAGGAAGGAAGGAGGAGGTCGAAGGGGAAGAAAAAG
T7_03003_G02	AAGAAAGGAGGGGAGAGGTCAAGAAAAAGGGAGGGA
T7_03004_G02	GGGAAAAAAAGAGAGGAGTCAAGGGAGAGGGGAGAA
T7_03005_G02	GAAAGGAAAGGGGAAAAGTCAGAGGGAGAAGAGGGA
T7_03006_G02	AAGAGAGAGAAGGGAGAGTCAAAGGGAAAGGGAAGG
T7_03007_G02	AAAAAGGAGGAAGAGGGGTCGAAAAGGAGGGGAAGA
T7_03008_G02	GGAAGAGAAAAGGGAGAGTCGAAAAGGGGAAGGGAA
T7_03009_G02	GGAAAAGGGGAAAGAGGGTCGAAGAGGAAAGGAAAG
T7_03010_G02	GGAAGAGGAAAAGGGAGGTCAGGGAGGGGAAAAAAA
T7_03011_G02	AAGAAAAGAGGAGAGGGGTCGAAGGAAGGGAAGAGA
T7_03012_G02	AGGAAGGGGAAAAGGAAGTCAAAAGAAGAGGGAGGG
T7_03013_G02	AAAGGGAAGGAAAAGGGGTCAGGGGAGAAGGAAGAA
T7_03014_G02	GAAAAAGAGGGGAAAAGGTCGGGAAAGGGGAAAGAG
T7_03015_G02	AAGGAAAGAGGGGAAAAGTCGAGAGGAAAGAGGAGG
T7_03016_G02	GGGGAGGGAGAAGGGGAGTCAAGAAAGGGAAAAAAA
T7_03017_G02	GAAAAAGGGGAAAGAAGGTCGGGAAAGGGAAAAGGG
T7_03018_G02	AAAAAAAGGGGAAAAGAGTCGGGAAGGGAGGGGAAG
T7_03019_G02	AGAAAGGAGAAAAGGAAGTCGGGGAAGGAGGGGAAA
T7_03020_G02	GGAGGAAGAGAAGGGAAGTCGGAGGGAAGGAAAAAA
T7_03021_G02	GGGAAAGGAAAGGGAAGGTCGGAAGGGGAAAAAGAA
T7_03022_G02	AAAAAGGGAGGAGGAGAGTCGAAGAAAAGGGAGGAG
T7_03023_G02	GGGGAGGAGGGAAAAAGGTCGGAAAAAAGAAGGGAA
T7_03024_G02	AAGGAGGGAGGGAAAAGGTCAAAAAGGAGGAAAGGG
T7_03025_G02	AGGGGAAAAAGAGAAGGGTCAGAAGGAAGGAGAAGG
T7_03026_G02	AGGAAAGAAAAGAGGGAGTCGGAGGAGGGAAAGGAA
T7_03027_G02	GGGAAGGGGAGGAAAGGGTCGGAAAAAAAGGAAAAG
T7_03028_G02	GAAAGAGGAAAAAAAGAGTCGGGAAGGGAGGGGAGA
T7_03029_G02	GAAAAAAAGGGAAGAAGGTCGAAGAGAAGGGGAGGG
T7_03030_G02	GAGGGAAAAGGGGAAAAGTCAAGGGGAGGGGAAAAA
T7_03031_G02	AGAGAGGGAGGAGGAAAGTCAAGAGAGAAAGAGGAG
T7_03032_G02	AGGAGGAAAAAGGAGGGGTCAAGAGGAAAAGGGAGA
T7_03033_G02	GAGGGAGAGGAGGAAGAGTCAAAAGGAGGAGGAAAA
T7_03034_G02	GAAGAGGAAGGGAAAAGGTCAAAGGGGAGAGAAAGG
T7_03035_G02	GGGGAGAAAGGGAAAAAGTCAGGGGAGGGAAAAAAG
T7_03036_G02	GAAGAAGGGAAAAAAAGGTCGGAAAGGGGAGGGGAA
T7_03037_G02	GGGGAAAGAGGGAGGAAGTCAGGAAAAGAAAGGGAA
T7_03038_G02	GAGGAAAAAGAGGGGAAGTCGAAGGAAGGGGAAGAA
T7_03039_G02	GGAGGGGAAAAGGAGAGGTCGGGAAGAAAAAGGAAA
T7_03040_G02	GGGAGAAGGGGAAGAAAGTCAGGGGAAGGGAAAAAA
T7_03041_G02	GGGAAGGAAAGGGGAAAGTCGGAAAAAAAAGGAGGG
T7_03042_G02	AAAGAGGGAGAGAAAGGGTCGAAAGGGGAAGGAGAA
T7_03043_G02	AGAGAGGAGGAAAGGGAGTCAGGGGAAAAAAAAGGG
T7_03044_G02	GAAGAAGGAGAAAGGGAGTCGGGGAAAGAAAAAGGG
T7_03045_G02	GAAAAGGGAAGAGGAAGGTCGGAGGAGAAAAAGGGA
T7_03046_G02	AAGGGGAGGGGAAAAAAGTCGGGAAAAGAAGGGGAA
T7_03047_G02	GGGAGAAGAGGGAAAAAGTCAAGGGAGGGGAAAAAG
T7_03048_G02	AAAAGAAGGGAGAAGAAGTCGGAAAGGGAGGGAGGA
T7_03049_G02	AAAAGGGAGAGGGAAAAGTCGAAGAGAGGGGAAAGG
T7_03050_G02	AAAAAGGAAGGGGAAAGGTCGAGAAAAGGGGAAGGG
T7_03051_G02	AAGGAGGGGAGAGAGGGGTCAAGGGAGAAAAAGAAA
T7_03052_G02	GAAGGAAGAAGGGAAAAGTCGAAGGAAGAAGGAGGG
T7_03053_G02	AAAGGGGAAGGGGAAAGGTCGGAGAAGGAGAAGAAA
T7_03054_G02	GAAAGAGGAGGGGAAGAGTCGAAGAGAAGGGAAGAA
T7_03055_G02	AGGGGAGAGGGGAGAAAGTCAAGGGGAAGAAGAAAA
T7_03056_G02	AAAGGGAAGAAAGAGGAGTCAGGGGAAAGGAGAAGG
T7_03057_G02	GGAAAAAAAAAAGGGGAGTCGGAGAGAAGGGGAAGG
T7_03058_G02	AAGAAGGGGAAAAAAAGGTCGGGAGGAAAGGGGAGA
T7_03059_G02	GAAAAGAAAAGGGAAGAGTCGGGAGGGAGAGGAAGA
T7_03060_G02	GAAAAGAGGGGAAGAGGGTCGAAAAAAAAGGGAGGG
T7_03061_G02	AAAGGGAAAAAGGAAGGGTCGAGAAGGGAGAAGGGA
T7_03062_G02	GAGGAAGAAAAAGAAGGGTCGGAGGGAAAGGAAAGG
T7_03063_G02	GGGAGGGAAGGAAAAGAGTCGGGAAAGGGGAAAAAA
T7_03064_G02	GGAGGAAAAAAGGGGAAGTCAAGGAAAGAGGGGAAG
T7_03065_G02	AAGGGAAAAAGAAAGGGGTCGAGGAGGAGAAGGAAG
T7_03066_G02	GGAAGGAAAAAGGGAGGGTCGGAAAGGAGAAAGGAA
T7_03067_G02	AAAAAGAGGGAAAAGGAGTCGGGAGAAAGGGGAAGG
T7_03068_G02	GGAAAAGAAAGAAAGGGGTCGAAAGGGGAGGGGAAA
T7_03069_G02	GGAGGGAGGGAGAAAGGGTCGAAAGGAAAAAAAAGG
T7_03070_G02	GGAGGAAAGAAGGGAAAGTCAGAGGGAGGAAAAAGG
T7_03071_G02	GAGAGGGGAAAGAAAAAGTCGGAAAAGGGGAAAGGG
T7_03072_G02	GAGGGAGGAAGGAAAAGGTCAAGGGGAAAGGGAAAA
T7_03073_G02	GAAAAGAAAGAGGGAGGGTCGAGGAGGAAAAAAGGG
T7_03074_G02	GAAAAAAGAAAGGAGAAGTCGAAGGGGAGGGGAGGA
T7_03075_G02	GGAAAGGGAGGGAAAAAGTCAGGGGAAGAAAAGAGG
T7_03076_G02	GAAAAAAGGAGGGAAAAGTCAGGGGAGGAAAGGAGG
T7_03077_G02	AAGAGAAAGGGGAAGGGGTCAAAGGGAAAAAGGGAG
T7_03078_G02	GGGGAGGAGGAGAAGGAGTCAGGAAAGAGAAAGAAA
T7_03079_G02	GGGGAGAAAGGGGAAGAGTCAAAGAGGAAAGGAAAG
T7_03080_G02	GGAGGGAAAAAAAAAAGGTCGGAAGAGAGGAGAGGG
T7_03081_G02	GAGAAAGGGAAAAAGGGGTCGAGGGGAAAAAGGGAA
T7_03082_G02	AAAGGGGAGGAGGGGAGGTCGGAAAAAAAAAGAGAG
T7_03083_G02	GGGGAGAGGAAGGGAAAGTCGGAAAAAAAGAAGAGG
T7_03084_G02	GGGGAAAGAGAAGGGAAGTCAGAGGAAAAAGAAGGG
T7_03085_G02	AAGGAAAAGGAGGGAAGGTCGGGAAAGGGAAAAGGA
T7_03086_G02	AAAAAGGAAAAGGGGAAGTCGGAGGGAAAGGGGAAG
T7_03087_G02	AAAGGAAGGAAAAAAAGGTCAGGGGAGGGGAGAGGA
T7_03088_G02	AAGGGGAGGGAGAAAAGGTCGGAAGGAGGAAGAAAA
T7_03089_G02	AAGGAGGGGAAAGGAGAGTCAGAAAGGAAAAGGGAG
T7_03090_G02	GGGGAAAGGAGGAAAAAGTCAGGGGAAGAAAGAGGA
T7_03091_G02	AAAAAGGAGGGAAGAGGGTCGAGGAGGAGAAAAGGA
T7_03092_G02	AAGGAAAAGAGGGGAGAGTCAAGGAGGGGAGAAAAG
T7_03093_G02	GGGGAAAAAAAGAGGAAGTCAGAGGGAGGAGGGAAA
T7_03094_G02	GGGAAAAGAGGAAGAGGGTCAAGAAAGGGAGGAAAG
T7_03095_G02	AAAAAGAGGAGGAGGGAGTCGGGAAAGGGAAAAGAG
T7_03096_G02	AAGAAAGGAAGGGGAAAGTCAAAGGGAGAAGGGAGG
T7_03097_G02	AGGGAAGGGAAAAGAGGGTCGGAAAGAAAGGAAGGA
T7_03098_G02	AAAAAGGAGGAGGGAGAGTCAAAGGAGGAGAAAGGG
T7_03099_G02	GGGAGAGGGAAGGGAGGGTCAGAAGAGGAAAAAAAA
T7_03100_G02	AAAGAAAAAAGGGAGGAGTCGAAGGAGGAGGAGGGA
T7_03101_G02	GGGAAAGAAAAAGAGGGGTCGAGAGGGGAAAAGGAA
T7_03102_G02	AGAGAAGGGGAAGGGGAGTCAAAAAGGGGAAAGGAA
T7_03103_G02	GGAAAGGGAGAAGGGAGGTCGGAAAAAAGGGAAAGA
T7_03104_G02	GGGAAAAAAAAGAAGGGGTCAGGAAAAGGAGGGAGG
T7_03105_G02	GGGAAAGAGGGAAAGGGGTCGAAAAGGAAGGGAAAA
T7_03106_G02	AAAAGGAAGAAAAGAGGGTCGGAAGGGGAAGGGAAG
T7_03107_G02	GGAGGGAAGAAGGGAAAGTCGGGGAAGGGAAAAAAA
T7_03108_G02	GGGAAGGAAGGAAAGGGGTCAAAAGAAAAGGGAGGA
T7_03109_G02	GGGAGGGAGGGAAAAGAGTCAGAAAAAAGGAAGGGA
T7_03110_G02	GGAAAGGGGAGGGGAAGGTCAGAAAAAGGGGAAAAA
T7_03111_G02	AAAAAAGGGAGGGAGGGGTCAGGGGAAAAAAGGGAA
T7_03112_G02	GGAAGGAGGAGAGGGAAGTCGAAGAGGAAAAGAAAG
T7_03113_G02	AGAAAAGGGGAGGAAAAGTCGAAAAAGGGAGGGGAG
T7_03114_G02	GAGAAAAGAAGGGAGGGGTCAGAAGAAAAGGGGAAG
T7_03115_G02	AAGAGGAGAGGGAAAGGGTCAAGGGAAAAGGGGAAA
T7_03116_G02	AAAGGGGAGGGAGGGGAGTCAAAGAGGGGAAAAAAA
T7_03117_G02	AAGAAAAGAGGAAAGGGGTCAGAAAGGGGAAGGGGA
T7_03118_G02	AGAGAAGAGGGGAAGAGGTCAGAGAAGGAAAGAAGG
T7_03119_G02	GGGGAAAAGGAGGGAGGGTCAAGAGGGAAAAAAAAG
T7_03120_G02	AAAGAAGGGAAAAAAAGGTCGGGAGAGGGGAGGGAA
T7_03121_G02	GGGGAAAAGGGAAAAAGGTCAAAAGGGAGAGGGAGA
T7_03122_G02	GGGAAAGAAGAAAAAGGGTCGGAAAAGGGGAAGGAG
T7_03123_G02	GGAAAAGGGGAAAAGGGGTCAAGGGGAAAAAAGGAG
T7_03124_G02	AGGGAGAAAAAAGAGGGGTCGAAAAAGGGGAAGGGA
T7_03125_G02	AAAGGGAGGGAAAAGAGGTCGAAAGGGGAAAAAGGG
T7_03126_G02	GGAAAGGAGAGAGGGAAGTCGGAAAGAAGGGGAAAA
T7_03127_G02	GGGGAAAAAAAAAGAAGGTCGGGAAGGGAAGGAAGG
T7_03128_G02	GGAAGAGGGGAAAGAAAGTCGAGGGGAAAAAGAGGA
T7_03129_G02	AAGGAAGGAAAGGGAGAGTCAGGGAAGAAAGAGGGA
T7_03130_G02	AGAAAAGGGAAGAAAAGGTCGAGGAGGGAGAGGAGA
T7_03131_G02	GGGAAAGGGGAAGAGAAGTCGAGGGAAGAAAGGAAA
T7_03132_G02	AGGGAGGGGAAGGAAAAGTCAAAGAGGGGAAAAAGG
T7_03133_G02	AGAAAGAAGGGAAGAGGGTCGAGGGAAAAGAAGAGG
T7_03134_G02	GAAAGAAAGGGAGAAAGGTCGGGAGAAAAAGGGAGG
T7_03135_G02	GAGGAAAAAAGGGGAGGGTCGAAGGAGGGAGAAAAA
T7_03136_G02	GGGAAAAAAGGGGAAAGGTCGAAGGGAGAGGAAGAA
T7_03137_G02	AAGGGAAAAAGAGGGGAGTCAGGAGGGGAAAAAAGG
T7_03138_G02	GGAGAAAGAAAGGAGGGGTCGAAAGGGGAAGAAAAG
T7_03139_G02	GAAGGGGAAGAGAAAAAGTCGGGAAGGGAGGGAAAA
T7_03140_G02	GGGGAAAAAGAAAGGGAGTCGAAAAAAGGGAGGGAG
T7_03141_G02	AGGAAGGAGGGGAAGGGGTCAAGAAGGGAAAAAAAG
T7_03142_G02	GAGGGAAAGGAGGAAAGGTCGGAGGGAAAAAAGAAG
T7_03143_G02	GGAAAGAGGGGAAAGGGGTCAAAAGGAAGAAGGGAA
T7_03144_G02	AAGGAGGAAAGAAAAAAGTCGGAGAGGGGAGGGAGA
T7_03145_G02	AAAGAGAAAAAGAAAGGGTCGGAGGAGAGGAGGGGA
T7_03146_G02	AAGGAAAAGGGGAAAGGGTCGAAAAGGGAAGGAGGA
T7_03147_G02	GGAAGGAAAAGGGGAGGGTCGGAAAGGGGAAAAAAA
T7_03148_G02	GAAAGAAGGGAAAAGAAGTCAGGGAAGGAGGGAGGA
T7_03149_G02	GGGAAGGGAGGGGAAAAGTCAGAAAAGAAAAGGAGG
T7_03150_G02	GGAGGAAAAAGGAGGAGGTCAAAGGGAAGGGAAAGA
T7_03151_G02	AAAGGGAGGGAAGAAGAGTCGGAGAAAAAAGGGGAG
T7_03152_G02	AAAAGAGGGGAAAGGAAGTCAGGGAGGGAGGAAAGA
T7_03153_G02	AAAGGGAAGAAGGAGAAGTCGAGGAGGGGAGGAAAA
T7_03154_G02	GGGGAGGAAAGAAAGAAGTCGGAAGGAAAAGAGAGG
T7_03155_G02	AGGGAGAAAAAGGGGAAGTCGAGGGAAGAAAAAGGG
T7_03156_G02	AAGGAAGAGGGAGGAAAGTCAAAAGGGAAGGAGGAG
T7_03157_G02	GGAAAAAGGGGAAAGAGGTCAAAAGGGGAGGAAAGG
T7_03158_G02	AGGGGAGGGAAAGAAAAGTCGGGAAAGGAAGGGAAA
T7_03159_G02	GGAGAGGAAGGGAAGGGGTCAAAAGGAAGGGAAAAA
T7_03160_G02	GGGGAAGGAAAAGGGGAGTCGGAAAAAAGGAAGAAG
T7_03161_G02	GAAGGGGAGAAAAAAGGGTCGAAGAGGAGGGAAAAG
T7_03162_G02	AGGGGAAAAGGAAAAGAGTCAGGGGAAGAGGGAAAG
T7_03163_G02	GGGGAGAGAAGGGGAAAGTCAGGGAGAAGAAAAAAG
T7_03164_G02	GAAGGAAAAAAGGGAAGGTCGGAAAGGGAGGGGAAA
T7_03165_G02	GAGGGGAGGAAAAGGAAGTCGAGAGAAAAGGAAAGG
T7_03166_G02	GAAGGGAGGAAGAAGAGGTCGGAGGAAGAAAAAGGA
T7_03167_G02	GGAAGAAAGGGAGAAAAGTCAAGGGAGGAAGGAAGG
T7_03168_G02	AGGAAAAAAAAGGAGGAGTCGGGAGGAAAGAGAGGG
T7_03169_G02	AAGAGAAAGGAGGGAGGGTCGGAGAAAAAGGAGGAA
T7_03170_G02	GAAAAGGGGAGAGGAAAGTCAGGGGAAGAAAGGGAA
T7_03171_G02	AGGAGAAAGGAAAAAAAGTCGGAGAGGAGGGAAGGG
T7_03172_G02	AAAGGGGAAGGGGAGGGGTCAGAAAAAAGAGGGAAA
T7_03173_G02	GAGAGGGGAAAAAGGAGGTCAAAAAAGGGAAGGGGA
T7_03174_G02	AGGGAAAAAAAGAAAGGGTCGAGGAGGAAAGGAGGG
T7_03175_G02	GGGGAGAAGGGAAAAAGGTCAAGGAAAGGGAAAAGG
T7_03176_G02	GAGGGGAAAAAAAAAGAGTCGGAGGGAAAGGAAGGG
T7_03177_G02	AGGGAAAGGGAAAAGGGGTCAAAAGGAGGGAAAAGG
T7_03178_G02	GGAAGGGGAAAAAAAGGGTCAAAAGGAGGGAGGGAA
T7_03179_G02	GGGAAAAAGAGGGAAGAGTCAAGGGAGGAAGAAAGG
T7_03180_G02	AGGGAGAAGGAAAAGAAGTCGGGGAGAGAAGAGGAA
T7_03181_G02	AAAAAGGGGAGGAAAAGGTCGGGAGGAGGAAGAAGA
T7_03182_G02	GAAAGGGAGGAAGGGAAGTCGGAAAAAAAGGGGAAG
T7_03183_G02	AGGAAGAGGAAGGAGGAGTCAGGAAAAGGGAAAAGG
T7_03184_G02	AAAAAAAAGGAAGGGAAGTCAGGGGAAGGGAGGGGA
T7_03185_G02	GGGAAGGGAGGAAAAAAGTCAAAGGGAAAGGGAGAG
T7_03186_G02	GGGAAAAAAAAGGGAAGGTCGAGAGGGAAAGGAAGG
T7_03187_G02	GGAGGGGAAAAGGAAAAGTCAAGAGGGGAAAGAAGG
T7_03188_G02	GGGGAAAGGGAAGAAAAGTCAAGGAAGAGGGAGAAG
T7_03189_G02	GAAAAGGAGGGAAGGGAGTCAAAGGGAGGAAAGAGA
T7_03190_G02	GGAAAGGAGAAAGGGAAGTCAGGGAGAAAAAGGGGA
T7_03191_G02	GAAAAGGGGAAAGAGAGGTCAGAAAGGAAGGGGAAG
T7_03192_G02	AAGGAAGAGGGAGGAAGGTCAAAGGGGAAAAAAGGG
T7_03193_G02	GGAGAAAGGGGAGGGAGGTCGAAAAAGGAAAAAGGA
T7_03194_G02	GAGGAGGGGAAAAAAGGGTCAAAGAAGGAGAAGGGA
T7_03195_G02	GGGAAAAGGGAAGAAAGGTCGAAGGAAGGAGGAAGA
T7_03196_G02	GGAGGAGGAAAGGAAAAGTCGGGAAGGGGAAAAGAA
T7_03197_G02	AGAAGGAAAAAAGGGGAGTCAAAGGGAAAGGGGAGG
T7_03198_G02	GAAAGGAGAGAAGGGAAGTCAAGAAGGGGAAGAGGA
T7_03199_G02	AGGAGGAGGAAGGAGGGGTCAAGAAAAAAAAGAGGG
T7_03200_G02	GGGAAGAAAGGAAGGGAGTCAGGGAGAAGAAGGAAA
T7_03201_G02	GGAAAAGGGAAAAAAAGGTCGAAAGGGGAAGGGGAG
T7_03202_G02	GGGAAAAAGAAAAAGGGGTCGAGGGGAGAAGGAAAG
T7_03203_G02	AGAAAGGGGAAAAGGGAGTCGAAGAGGAAAGGAGGA
T7_03204_G02	AAAGGAGGAGGGGAGAGGTCGGGAAGAAGAAAAAAG
T7_03205_G02	AGGAAAGGGGAAAAAAAGTCGGGGAGGAAAAGGAGG
T7_03206_G02	GAAGAGGGAAAGAGAAGGTCGAAGAGGGGAGAGAAA
T7_03207_G02	GAGAGGGGAAGAGAGAGGTCGGAAAAGGAGAAAGAA
T7_03208_G02	GGGAAGGGAAGGGAAAGGTCAGAAAAAAAGGGGAGA
T7_03209_G02	GGGAAAAGGAAAGAAGGGTCGAAAGGGAAGGAAAGG
T7_03210_G02	AAGGGAAGAAGAGGGGAGTCGGAAGGGAGAAAGAAA
T7_03211_G02	AGGAAAGAGGAGGAGAGGTCAAAAGGAAAAGGGGAG
T7_03212_G02	GGAGAAAAGGAGAAAAAGTCGGGAAAGGGGAAGGGA
T7_03213_G02	AAAGGAGGAGGAAAAGAGTCGGAGAGGGAAAAAGGG
T7_03214_G02	GGGGAAAAAGGGAAAAAGTCAGAGGGGAAGGAAGAG
T7_03215_G02	GGAGGGAAAAAAAAGGGGTCGAGGAAGGAAAGGGAA
T7_03216_G02	GGGAGGGAAAAAGGGGAGTCGAAAAAAGGGAGAAAG
T7_03217_G02	GGAGGGGAGGGGAAAAGGTCGGGAAGGAAAAAAAAA
T7_03218_G02	AGGAAAGGAGGGGAGAAGTCAAAGGGGAAAGAAAGG
T7_03219_G02	AAAGGAAGAAGAGGAAGGTCGAGAAGGGAGAAGGGA
T7_03220_G02	GGGGAGAAAAAGAGAGGGTCGAGGGAAAAGAAGGAA
T7_03221_G02	AAGGAAAAGGAAAAGGGGTCAGGGGAAGAAGGGAAG
T7_03222_G02	AAAGGGGAAAAAGAGGAGTCGGAAAGAGGGGAAAGG
T7_03223_G02	GGAAGAAAAGAGGAAAGGTCGAAGGGAAAGGAAGGG
T7_03224_G02	AGAAGGAGAAGAGAAAAGTCGGGAGGAAAGGGGAGA
T7_03225_G02	AGGGAAAGAGAGAAGGAGTCAAGGGAAAAGGAGAGG
T7_03226_G02	AAGAAGGGAGGAGGGGAGTCAAGGAAAGGGAGAAAA
T7_03227_G02	GAAAGGAGGAAGGGGAAGTCAGAAGAAGAAGGGGAA
T7_03228_G02	GGGGAAAAGAAGGAAGGGTCGGAAAGGGGAGAAAAA
T7_03229_G02	GGAAAAGAGAGAGGGGAGTCAAAAGGGAGGAAAGGA
T7_03230_G02	AGAGGAAGGGAGAGGGAGTCGAAGAGAAAAAGAAGG
T7_03231_G02	GGAAAGGGAGAAAGAAAGTCGGGGAAGAGGAAAAGG
T7_03232_G02	AGGGGAGGAAGGGAAAAGTCGGGAAAAAGGGAGAAA
T7_03233_G02	GGAAAAGGAAGGGAGAGGTCGGGAAAAGGAAAAAGG
T7_03234_G02	GGGGAAGGGGAAAGGAAGTCAAAGGAGGGGAAAAAA
T7_03235_G02	AAAGGAAAAGGAGGAAGGTCGGGAAGGAAAGGAGAG
T7_03236_G02	AGAAGGGAGGAAGGGGAGTCAAAAAAGAAGGGGAAG
T7_03237_G02	AGGGGAAAAGAGGGGAGGTCGGAAAAAAGGGGAAAA
T7_03238_G02	AAAAAGGAAAGGAGAAAGTCAGAGGGGAGGAGGAGG
T7_03239_G02	AGGGAGGGAGGGGAAAAGTCAGGAAGAAAGGAAAGA
T7_03240_G02	GGGAGAGGGGAGGAAAAGTCGGGGAAGGAAAAAAAA
T7_03241_G02	GGGAAAAGGGGAGGGGAGTCGAAAAGAGAAGGAAAA
T7_03242_G02	GGAAAAGGAAAGGAGGAGTCAAAAGAAGGGGAGGGA
T7_03243_G02	AGGGGAAAAAAGGGAGGGTCGGAGGGAGAAAAAAGA
T7_03244_G02	GGAAGAGAGGAAAAAGAGTCGGGAGGGAAGAAAGAG
T7_03245_G02	AGGGAGAGAAAGGGGAGGTCGAAAGAAGGGGAAAAA
T7_03246_G02	AAGAAGAAAGAGGAAGGGTCGGAAGAGGAAGAGGGA
T7_03247_G02	GAGGAAAGAGAAAAGAGGTCGAAAGGGAAGGAAGGG
T7_03248_G02	GGGGAAAAGAAAGGGGAGTCGAAAAAAGGGGAAAGG
T7_03249_G02	GGGAAAGGGAAAGGAGAGTCGGGAGGAAAAGGAAAA
T7_03250_G02	GGAAAGAAAGAAGGAAGGTCGAGAAGGGGAAGGGAA
T7_03251_G02	AGAAGAAGAGAAGGGAAGTCGGGGAAAAGGAGAAGG
T7_03252_G02	AGGGAGGGGAGGAGGGAGTCAGGAAAGAAAAAAGAA
T7_03253_G02	GGGGAGAAAAGGAAGAGGTCGAGGAAGAAAAAAGGG
T7_03254_G02	AAAAAAGAGGGAGGGAAGTCAAAGGGGAAGAGGGGA
T7_03255_G02	AAGGAAAGGGGAAAGGAGTCGGAGGGGAAGAAAAGA
T7_03256_G02	GAAAGGAGGGGAAGAGGGTCGAAGGGAGAGAAAAAA
T7_03257_G02	AGGAGAAAAGGGAGGAGGTCGGAGAGAAAAAAAGGG
T7_03258_G02	AAGGGAGGAAAGAAAGAGTCGGGAGGAAAAGAGAGG
T7_03259_G02	GGAAAAGAGGGGAAAAAGTCGGGAAAAGGGAGGGAA
T7_03260_G02	AGGGAAAAAGAGGGAGAGTCAAGGAGGAAAGAAGGG
T7_03261_G02	AGGGAAAGGAAGGGAAAGTCAAGGGAGGAAAGGGAA
T7_03262_G02	AAGAAAGGAAAAGGGAAGTCGGAAGGGAGGGGAAGA
T7_03263_G02	AGGAAAGGAGAAAAAGGGTCAGGAAGGGAAGAAGGG
T7_03264_G02	GGGGAAAAAAGGGGAAAGTCAAGAAGGGGAGGGAAA
T7_03265_G02	GGGGAAAGGGGAAAAGAGTCAAGAAAAAGGAGGGGA
T7_03266_G02	AAGGAAGGAGGAAGAAAGTCAAAGAGGAGGGGAGGA
T7_03267_G02	AAGGGAAGGAAAAGGGAGTCAGGGGAAAAAAGAGGG
T7_03268_G02	GGAAAAAGGGAGGGGAAGTCAAAGAGGGAAAGGAGA
T7_03269_G02	AAAAGGGAGGGGAAAGGGTCGGAGAAGAAAAAAGGG
T7_03270_G02	AAGGAGAAGAGGAAGGGGTCAGGAAAGAGGAAAAGG
T7_03271_G02	AAGGGAAGGGAGAAAGGGTCGAAAGAGGAAGGGAAA
T7_03272_G02	GGAGAAAAGGAAAGAGAGTCGGGAAAAAAGGGAGGG
T7_03273_G02	AAGGAAGAGAGAGAAGGGTCGAGGGGAAAAGGAAGA
T7_03274_G02	GGGGAAAAGGAGGGGAGGTCGAAGGGAAAAAAAAGA
T7_03275_G02	AAAGGGGAAAAAAAGGGGTCGAGGAGAAAAGGGGAG
T7_03276_G02	GAAAGGGGAAAAGGGAAGTCAGGAAGAAGGGAGAAG
T7_03277_G02	AAGGAAGAGGAAAGAGGGTCGGAAGAAAAGGAGGGA
T7_03278_G02	GAGGAAGAGGGGAAAAGGTCAAAGGGAAAAGGGAGA
T7_03279_G02	AAAGGGGAAAGGAAAGGGTCAAGGGGAAGAAAGGGA
T7_03280_G02	GGGAAGAGGAAAGGAAAGTCGGGAAGGGAAAAGAAG
T7_03281_G02	AGGAAGGGAGGGGAGAAGTCGAAAAAAAAGGGAGGA
T7_03282_G02	GGGGAAGAGAGGGGAAAGTCGGAGAAAAAAAGGAAG
T7_03283_G02	AAGGAAAGGGAAAGGGAGTCGAGAGAAAGGGGAGAA
T7_03284_G02	AAGGAGGGAGAGGAGGAGTCAGGAAGGGAAAAAAAG
T7_03285_G02	GAAGGAGGAAAGAAGGAGTCGAGAAAGGAAAGGGGA
T7_03286_G02	GGAAAAAAGAGAGGGAAGTCGGGGAGAGAAAAGGGA
T7_03287_G02	AAAGGAGAAGGGAAAGGGTCGGAAAAAGGAGAGGGA
T7_03288_G02	AGGGGAAAGAGAAAGAAGTCGAAGGGGAGAGGGAAA
T7_03289_G02	GAGAAAAGGGAAAAGGGGTCAAGAGGAGGGAAAGGA
T7_03290_G02	GAAAAAAGGGGAAAAGGGTCGGAGGAGGGAAAAAGG
T7_03291_G02	AAAAAGGGAAAAGAGGGGTCAGGGGAAGGGGAAGAA
T7_03292_G02	GAAAAAAGGGGAGGGGAGTCAAAAGAAGGAGGAAGG
T7_03293_G02	AGAGGGAAAGGAAAAGGGTCGGAAAAAAGGGAAGGG
T7_03294_G02	GAGGGAAAGGAAGAAGGGTCAGAGAAAGGAAGAAGG
T7_03295_G02	AGGAGAAGGGAAGAAAAGTCAAGAGGGAGGGGAAAG
T7_03296_G02	GAGGAAAGAAAGGGAGGGTCAAAAGAGGAAGGAGGA
T7_03297_G02	GGGGAAGGAAGGGAAAAGTCAGGAGAGGAAAAAGGA
T7_03298_G02	GAAAGGAAGGGGAGGGAGTCGAGAAAAAGGGAAGAA
T7_03299_G02	AAGGAGGGGAAAGGAGAGTCAGGAAAAAGGGGAAAG
T7_03300_G02	AGGGAAGGAGAGGAAAAGTCAAAAGGAGGAGAAGGG
T7_03301_G02	GGGGAAAGGGAGGGGAAGTCGGGAAAAAGAAGAAAA
T7_03302_G02	GGAAGGGAGAGGGAGAAGTCGGAGAAGGAGAAAAAA
T7_03303_G02	AGAGAAAAAGAAGAGGAGTCGAGGGAAGAAGGAGGG
T7_03304_G02	AGAGGGGAGAAGAAAGGGTCGAAAGGAAAGAGGAAG
T7_03305_G02	GAAGAAGAAAAAAGGGAGTCAAGGGAGAAGGGAGGG
T7_03306_G02	AAAAAAGGGGAAGGGGAGTCAGGAAGAGGAGAGGAA
T7_03307_G02	GGAAGAGGGAGAAAGAAGTCGGAAGGGAAAAAAGGG
T7_03308_G02	GAAGGAAAGAAAGGGAGGTCGGGAAAAAGAAGAGGG
T7_03309_G02	AAAGGGGAGGGAAAGAAGTCGAAAAGGGGAGGGAAA
T7_03310_G02	GAGAGGGGAAAAAGGAGGTCGGAAAAAGGGAAGGAA
T7_03311_G02	GGGGAAAAAAAAGGAAAGTCGGGGAAAGGAAGGGGA
T7_03312_G02	AAAAAAGAGGGGAAGGAGTCAAGAAGGGAAGGAGGG
T7_03313_G02	GAGGGAAGGAAGGGGAAGTCAAAGGAGAAAAGGAAG
T7_03314_G02	GAAAAGGGAAGAAAGGGGTCAAAAGAGGAGGGGAAG
T7_03315_G02	AGGGAAAAGGAGGAAAAGTCGAAGGGGAAGGAAGGA
T7_03316_G02	AGAGGAAGGAAGAAGGGGTCGAAGAAGAGAAAAGGG
T7_03317_G02	AAAAGAAGGGAGAGGAAGTCGAGGAGGGAAGGAAAG
T7_03318_G02	AAAGGAAGAGAGAGAGAGTCGGGAAGGAAAGGGGAA
T7_03319_G02	GAAGGGAAAAGGGGAAAGTCAGGGAAAGGAAGAAGG
T7_03320_G02	AAGGGAAAAAGGGGAGGGTCGAGGAGAGAAGGAAAA
T7_03321_G02	AAAGAGAAGAGGGAAAAGTCGGGGAAGGGAAGGGAA
T7_03322_G02	AGGAAAGGAGAAGGGGAGTCGAAAGAAAAGGGAAGG
T7_03323_G02	AAAGGGGAGAAAAAAAGGTCGAGGGGAGAGAAGAGG
T7_03324_G02	AGGGGAAGGAAGAAGGGGTCGAAAAGAGGAAGAAAG
T7_03325_G02	GGGAAAGAAAGAAGGAGGTCAGGGGAAGGGAAAGAA
T7_03326_G02	GGGGAAAGAAAAAAGGGGTCAAAAGGAAGGGAGAGG
T7_03327_G02	GGGAAAGAGAAAAAAGGGTCGAAAAGGGGAGGAAGG
T7_03328_G02	GAAGGGGAAAGGAAAGGGTCGGAGGGAAGAAAGAAA
T7_03329_G02	AGAAGAGAAGGGAAGAGGTCGAGGAGAGGGAAAGAA
T7_03330_G02	AGGGAAAGGGAAGGAAGGTCGAAGGGAGAAGGAAAA
T7_03331_G02	GGGAAAGAGAAAAGGAGGTCAAGGGGAGGGGAAAAA
T7_03332_G02	AGGGGAGAGAGGGGAAAGTCAGAAGGGAAAAGAAAG
T7_03333_G02	GGGAAGGAGAGGAAAGAGTCAGGGGAGAAAAAGGAA
T7_03334_G02	GGGGAAAGGGAGAAAAGGTCGGAAGGAAAAAGAAGG
T7_03335_G02	AGAGGAAGGGAGGAGGAGTCAAAAGGGGAAAAGAAG
T7_03336_G02	GAGGGAGAAGGGAAAGAGTCGGGAGAAGAAAAGGAA
T7_03337_G02	GGGAAAAGGAGGAAAGAGTCGAGGGGAGAGGAAAAA
T7_03338_G02	AAGGGAAAGGGGAAAAGGTCGAGGAAGGAAAGGAAG
T7_03339_G02	GAGGAAGGAAAGGGAAGGTCGAAAGGGAAAAAAGGG
T7_03340_G02	GAGGAGGAGAGGAGGGAGTCGAAAGAGGAAAGAAAA
T7_03341_G02	GGGGAAAGAAGAAAGAGGTCGGGAAAGGGGAAGAAA
T7_03342_G02	AGGAAAGGAGGAAGAGGGTCGAAAGGGAGAAAAAGG
T7_03343_G02	AAAAGGGAAAGAGGAGGGTCGGAGGAAAAAGGGGAA
T7_03344_G02	AAAAGGGGAAGGAAGGGGTCAAGGGGAAAAAAGGGA
T7_03345_G02	GAGGAGGGAAAAAAAAGGTCGGAAAAGAAGGGGAGG
T7_03346_G02	AAGAAAAAGAAGAGAGGGTCAAAAGGGGAGGGGAGG
T7_03347_G02	GGAAAGAAAAGGGAAGGGTCGGAAAAGAGGAGAAGG
T7_03348_G02	AGGGAAAAAAGGAGAGGGTCGGAAAGAGGAGGGAAA
T7_03349_G02	AAAGAGGGGAAGAAAAGGTCGAAAGAGAGGGAGGGA
T7_03350_G02	AAAGGGAAAGGAGGGAGGTCAGAAGGGGAAGGAAAA
T7_03351_G02	AGGGAGGGAAGGAGGGAGTCAAAAAAAGGGAGAAGA
T7_03352_G02	AAAGGGAGGGGAAGGGAGTCAGAGAAAAAAGGGAAG
T7_03353_G02	GAAGGAGGAAAAAGAGAGTCAAGGGAAGGGAAAGGG
T7_03354_G02	GGGAGGGAAAAGGAAAAGTCAAAAGGAAGGGAGAGG
T7_03355_G02	GGGGAAGAGAAAGGGAGGTCAGGAGAAGGAAGAAAA
T7_03356_G02	GAAGGGAAGGGGAGGAAGTCAGAAAAGAAAGAGGAG
T7_03357_G02	GGAGGAAAGGGGAAAGGGTCGAAGGGAAAAAAGGAA
T7_03358_G02	AAGGGAGGAGAAAAAGGGTCGAAGAAGGAAGAGAGG
T7_03359_G02	AGGAGAAAAAAGGGAGGGTCAGGGGAGGGAAGAAAA
T7_03360_G02	GGGGAAAAAGAGGAGGGGTCGAAGAAAGGAAAGAGA
T7_03361_G02	GAGGAAGGAGGGAGGAAGTCAGAAAGGAAGGAAGAA
T7_03362_G02	AAAGGGAGGGGAAGAAGGTCAAGAAAAGGGGAGGAA
T7_03363_G02	GAAGAGGGGAAAAAGGAGTCAAGGAAAGGAAGAGGG
T7_03364_G02	GGGGAGGAAAAAAGAGGGTCAAGAAAGGGGAAAGAG
T7_03365_G02	AGGGAAGAGGGAGGAAAGTCAAAAAGGAGGGAAGGA
T7_03366_G02	AAGGGGAAGGAGGGGAGGTCGAAAGAAAGGGAAAAA
T7_03367_G02	AAAAGGGGAGGAGAGGGGTCAAGAGAAAAAGAGGGA
T7_03368_G02	GGAGAAGGGAGGGAAAAGTCAAAAGGAGAGAGAGGA
T7_03369_G02	AGAGGGAAGGGAAAAAAGTCAGGAGGGAAGGGAAAG
T7_03370_G02	GAAAGAGAGAGAGGGAAGTCGGAAGGAAAAGGGAGA
T7_03371_G02	GGAAGAAAAAGGAAGGAGTCGAAAAGGAGGGGAAGG
T7_03372_G02	GGAAAAAAAGGAAAGAAGTCAGGGGAGGAGGGGAGA
T7_03373_G02	AGGGAGAAAGGAGGGGAGTCGGAAAAAAAAGGGAAG
T7_03374_G02	AGAGGAAAGGAAAGAAGGTCGGAGGGAAAGAAGGAG
T7_03375_G02	AGAAAAGGAGGAGGAGAGTCGAAAGAGGAAGGAAGG
T7_03376_G02	AGGAGGGAAAAAAAGGAGTCAGGAAGAGGGAGGAAG
T7_03377_G02	GGAGGAAAGAGGGAGAGGTCGGGAAAAGAGGAAAAA
T7_03378_G02	GAAGGGGAGGAGAAAAAGTCGAGAGAAGGAGAAGAG
T7_03379_G02	GGGAGGAAGGAAAGGAGGTCAAGGGGAAAGAAAAAG
T7_03380_G02	GGGAAGGGGAAAAAGAGGTCGGGGAGGGAAAAAAAA
T7_03381_G02	GAAAGAGAAGGAAGAAAGTCAAGGGGAAAGGGGAGG
T7_03382_G02	AGGGGAAAAAAGGGAAAGTCGGGGAGGAAAAGAGGA
T7_03383_G02	GAGGAGGAAGGAAGGGAGTCAAAAAGGGGAAGAGAA
T7_03384_G02	GAAAGGAGGAAGAGGAAGTCAGAGGGAGAAAAGAGG
T7_03385_G02	AAGAGAGGGGAGGGGAAGTCAGAAGGAGAAAGGAAA
T7_03386_G02	GGGGAAGAAAGGGGAAGGTCAAAAGGAAAGAGAAGG
T7_03387_G02	GAAAAGGGAGAGAAAGAGTCGAAAGGGAGGGAAGAG
T7_03388_G02	AAAGGAGGGAAAGGAGGGTCAAAAGGGAAAGGAGGA
T7_03389_G02	GAAGAAGAAGAAAGAGGGTCAGGGGAAGAGAAGGGA
T7_03390_G02	GGGGAGAGGAAGGAAAAGTCGGAAGGAAGGGAAAAA
T7_03391_G02	GGGGAAGGGAGAAAAGGGTCAAGGGAGAGAAAGAAA
T7_03392_G02	GAAAGGAAGGAAAAAAGGTCAGGAAGGAGGAGGAGG
T7_03393_G02	GGGAGAAGGGGAAAGGAGTCAGAAAAGGAAAAAGGG
T7_03394_G02	GGAGAGGGGAAGGAAAAGTCAGAAGAGAGGAGAAAG
T7_03395_G02	GGAGGGAAAGAGAAGAGGTCAAAAGAGGAGAGGGAA
T7_03396_G02	GGAAGGGAAAAAAGGAAGTCGGGAGGAGAAGGAAGA
T7_03397_G02	AAGGAAGGGGAAGGAGAGTCAGAAAAAGGAGGAGGA
T7_03398_G02	GGAAAAAGGAGGGAGAGGTCGAAGGGAAGAAAAAGG
T7_03399_G02	AGGGGAGAGGGAAAAGAGTCAGAAAGGGGAAGAAGA
T7_03400_G02	GGAAAGGAAGGAGGGGAGTCGAAAAAGGGGAGAAAA
T7_03401_G02	AGGGAAAGGGGAAAAAAGTCGAAGGGGAAAGGGAAG
T7_03402_G02	GGAAGGGAAAAAAGGAAGTCAGGGAGGAAAAGAGGG
T7_03403_G02	GGAAGAAAAAGGGGAAAGTCGGGGAGAAAAGAAGGG
T7_03404_G02	AAAAAAGGGAGGGAAGAGTCAAGGGGAGGAGAGGAA
T7_03405_G02	GGGGAAAAGAAGGGAAGGTCGGGAGAAGAAAAAAGG
T7_03406_G02	AGGAGGAAAGGAGAAAAGTCAAGGAGGAGAAGAGGG
T7_03407_G02	AGGGGAGAAGAAAAAGGGTCGAGGAAAGGGAGGAAA
T7_03408_G02	GGAGGGGAAAAGAAAGGGTCGAAAGAGGGAAAAAGG
T7_03409_G02	AAGGGAGGAAGGGGAAAGTCAAGGGAGGGGAAAAAA
T7_03410_G02	AAAGGGAAAGGGAGGGAGTCAAAGGAGAGGAAAGAG
T7_03411_G02	GGGGAAAAAAAAAGGGAGTCAGGGGAAGGAAAGGAG
T7_03412_G02	GGGAAAGGGAAGGAAAAGTCAAGAAGGAGAAGGGGA
T7_03413_G02	GGGAAAGGGGAGGGAGAGTCAAAAAAAGGGGAAAAG
T7_03414_G02	GGGAAGAAAGAAAGAGGGTCAAAGGGAGAAGGAGAG
T7_03415_G02	AAGGGGAGAAAGGGAAGGTCGGGAAAAAGGAGGAAA
T7_03416_G02	AGAAAAGGGGAGAAAGGGTCAAAGAGAAAGGGAGGG
T7_03417_G02	GGGAAGGAAAGGGAAAGGTCGGAAAAAAGGGAAGGA
T7_03418_G02	AGGAAAAAGGAAAAGAAGTCAGGAGGGGAGGGAGGA
T7_03419_G02	AAAAAAGAAAGGGGAGGGTCAAAAGGAGGGGAAGGG
T7_03420_G02	GAAAAAGGAGGGAAGAAGTCGGGAAGAAAAGGAGGG
T7_03421_G02	AGGGAGAGGAAGGAAAAGTCGGGGAAAGGAAAAGAG
T7_03422_G02	AAGGAGGGAGGGGAAAAGTCAGAAAGAAAGGAGAGG
T7_03423_G02	GGAGAAAAGAGAGAAGAGTCAAAAGGAGGGGAGAGG
T7_03424_G02	AGGAGGGAGAGGAGGAGGTCGAAAGGAAAGGAAAAA
T7_03425_G02	GAGAGGAAAAAGGAAAAGTCAAGGGGAGGAAGAGGG
T7_03426_G02	GGAGAAGAAGAGGGGAAGTCAAGGAGGAAGAGAAAG
T7_03427_G02	AGGAAGAAAAGGAGAAAGTCGGAGGAGGGAAAGGGA
T7_03428_G02	AAAAGGGAAGGAGGAAAGTCAGAAAGGGAGGAAGGG
T7_03429_G02	GGAAGAAGAAGGGGAAGGTCAGGGGAGGAAAGAAAA
T7_03430_G02	AAAAGAAAGGGAGGAGGGTCGAGGGGAGGAAAAAAG
T7_03431_G02	AAGGGAAAGGAAAAAGGGTCAGGGGAGGAGGAAGAA
T7_03432_G02	GGAAAGGGAGGAGGGGAGTCAGAAGAAAAAAGGAGA
T7_03433_G02	AGGAAAAAAGAAGGAGAGTCGAAGGGAGAAGGGAGG
T7_03434_G02	AGAGAAAAGAGGAAAGGGTCGAGGAAAGGGAGGAGA
T7_03435_G02	AAAAAAAAAGGAGGGAAGTCGGGGAGGGGAGGAGAA
T7_03436_G02	GAGGAGGGGAAAAAAAAGTCAGGGAGGGAGGGAAAA
T7_03437_G02	AGGGAGGGGAAGGGAAGGTCAAAAAAAAGGGAAGGA
T7_03438_G02	GGAGAAAAAAAGGGAGGGTCGAGGGAAGAAGGAGAA
T7_03439_G02	AGAAGGAAAGGGAGAGGGTCAAGGAAAGGGAAAGGA
T7_03440_G02	AGGGGAGAGGGAAGGAAGTCAGGGGAAAAAGAAAAG
T7_03441_G02	AAAGGGAGGAGAAGAAGGTCGAAGAGGAAAAGAGGG
T7_03442_G02	GGAGGGAAAGGGAAAAAGTCAAAAGGGGAGGAAGGA
T7_03443_G02	GGGAAGGAAAAAGGGAAGTCAGAGGAAAGGGGAAGA
T7_03444_G02	AAAAGGGGAAAAAGGAAGTCAGGAGGAGGAAGAGGG
T7_03445_G02	AGGGGAAGAAGAAGGAGGTCGAAGGGGAAAAAGAAG
T7_03446_G02	GGAAGAGGGGAGAAGAGGTCGGAAAGGGGAAAAAAA
T7_03447_G02	AAGGGGAAAAGGGGAGGGTCGAAAGAAAAAGAGAGG
T7_03448_G02	AAGAAAAAAGAAGGAGGGTCGGAAGGGAGAGGGGAA
T7_03449_G02	AGAAAAGAGGAGAAGGAGTCGGGAGGAGGGGAAAAA
T7_03450_G02	AGGAGAAGAAAAGGGGAGTCGGGAAGGAAGGAAAAG
T7_03451_G02	GAAAAGAAAAGGAGGAGGTCGGGAGAGAGAAAAGGG
T7_03452_G02	GGAAAAAGGGAAAGGAAGTCGGGAGAGAGAAAGGGA
T7_03453_G02	AGGAAAGAAGGGAAAGGGTCGGAAGGAGGGGAAAAA
T7_03454_G02	GGGAAAGGGGAAAGGGAGTCGGGAAAAGGAAAAAAG
T7_03455_G02	AGGAGAGAGAAAAGGAGGTCAGGAGGAAAGGAGGAA
T7_03456_G02	GAGAGGAGAGAAAGAAAGTCGGAAGAAAGGAGGGAG
T7_03457_G02	AGAGAGGAGGAGAAGGGGTCAAAGAAAGGAGAAAGG
T7_03458_G02	AGGAGGAAAGAGGGAAGGTCAAGGAAAGGGGAAGAA
T7_03459_G02	GGGGAAAAGAAGAAAAAGTCAGGGGAGGGAGGGAAA
T7_03460_G02	AGAAAAAAGGAGGAGAAGTCGGGGAAAGGGAGGAAG
T7_03461_G02	AGAAGGGGAAGGGAAAGGTCGAGGGGAAAAAAAAGG
T7_03462_G02	AGGAGGGGAAAGGGGAGGTCGGGAAAAAAAAAGAAG
T7_03463_G02	GGAAAAAAAAAAGGGGAGTCAAGAGGGAAGGGGAGG
T7_03464_G02	AAGAAGGGGAAGGAAGAGTCAAGGAAGGAAAGAGGG
T7_03465_G02	GGAGAAAAGGAGGGAAAGTCAGAAGGGAAGAAAGGG
T7_03466_G02	AAAGGAGGGGAGAAGAGGTCGGGGAAAAAGGGAAAA
T7_03467_G02	AAAAAAGGAAGGGGAAAGTCAGGAAGGAGGGAGGGA
T7_03468_G02	GAAAGAAAGAGAGAGGAGTCGAAAAGGGGAGGGAAG
T7_03469_G02	AGGGGAGAAAAGGGAAGGTCGGAAAAGAGGGAAAAG
T7_03470_G02	AGAAAAGGGGAGGAAAGGTCGAGAGAGAAAAGGGGA
T7_03471_G02	GGGGAAAAGGGAAAAGAGTCGGAAGAGGAAGAGGAA
T7_03472_G02	GGAAAGGGAAAAAGGGAGTCAAGGGGAAGAAGGGAA
T7_03473_G02	GAGAAAAAAGGGGAGGAGTCAGAAAAGGAGGGGAAG
T7_03474_G02	GGGAGGGAGAAAAGAGGGTCAAAAGGGAGAAGAAAG
T7_03475_G02	AAGGAAGAAAGGGGAAGGTCGAGAAAAAAGGGGAGG
T7_03476_G02	AAAAGAGAGGGGAAAGAGTCAGAGAAGGGAGAAGGG
T7_03477_G02	AAAAAGGGAAGGAGGAAGTCAAGGAAGAGGGAAGGG
T7_03478_G02	GAAGAGGGGAGGAAAAGGTCGAAGGAAAGGAAGAGA
T7_03479_G02	GGAAAGGAAAGAGGAAAGTCAGGAAGAGAGGGAGAG
T7_03480_G02	AAGGAGGGGAAGAAGGAGTCGGGAAAAGGAAAGGAA
T7_03481_G02	GGGAAAGGGAGAAAAGAGTCAAAGGAAGGGAAGGGA
T7_03482_G02	GAGAAGGAAGGGAAAAGGTCGGGAAGGAAAAGAAGG
T7_03483_G02	AGAAAAAAGAGGAGGAGGTCGGAAAGGAGGGAAGGA
T7_03484_G02	AAAAAGAGGAGGGAGGGGTCAAAAGGAAGGAGGGAA
T7_03485_G02	AAAAGGGAAAGAGGGGAGTCGAAGAAGGGGAAGAGA
T7_03486_G02	GGGGAAAGGAGAGAGGAGTCAAGGGGAGGAAAAAAA
T7_03487_G02	GGAGAGGAAGAAAAAGAGTCGGGGAGGAAGGAAAAG
T7_03488_G02	AAAGGAGGGGAGGAAGGGTCAAGAGAAAAAGAGGAG
T7_03489_G02	GAGAAAAAGGAGGAAGAGTCGAAGGGAAGGGGAGAA
T7_03490_G02	GGGAGGGGAAAAGGAAGGTCGAAAGAAAGGGGAAAA
T7_03491_G02	AAGGGAGAAGGGAGAAAGTCAGGAAGGAAGGAAAGG
T7_03492_G02	GAGGGAAAAGGGAGGAAGTCGGGAAGGGAAAAGAAA
T7_03493_G02	AGGGAAAGGAAAAAGAGGTCGGAGGGAAGGAAGGAA
T7_03494_G02	AAGGGGAGAAGGAGAAGGTCAGGGGAAAAAGGAAAG
T7_03495_G02	GAGAGGGAGGGAGGAAAGTCGGGAAAGGAAAAGAAA
T7_03496_G02	GAAAAAAAGGGGAAAGGGTCGAAGGAGGGGAAGGAA
T7_03497_G02	GGAGAGGAAGAGGGAAAGTCAAAGGAAGAGAGGAAG
T7_03498_G02	GGGAGGAAAGGGAAAAGGTCAGAAAAGGGAAGGAAG
T7_03499_G02	AGGGAAAAAGGGAAAGGGTCAAAGGGAAGGGAGAAG
T7_03500_G02	AAGAAAGGGGAAAAGAGGTCGGGAAGAGAGGAAAGG
T7_03501_G02	AGGGAAGAGAGGAAAAAGTCGGAGAGGGAGAAAGAG
T7_03502_G02	GAAAGGAAAAGGGAGGGGTCAAGGGGAAAAGGGAAA
T7_03503_G02	GGGGAGAGGAGGGAGGAGTCAAAAAAAAAGGAAGAG
T7_03504_G02	GAAGGGGAAAAAAAAGGGTCGGAAAGGGAGAAAGGG
T7_03505_G02	GGAAGAGAAGGAAGGAGGTCGAGAGGAAAGGGAAAA
T7_03506_G02	AAAGGGAGGAGGGAAAAGTCAAAGGGAAGGGAGAAG
T7_03507_G02	GAGAAGGGAGGGAGGGAGTCAAGGAGAAGAAAGAAA
T7_03508_G02	AAAGAGGAGGAAGGGAAGTCAGGAGAAAGGAGGAGA
T7_03509_G02	AAAGAGAAAGGGAAGGAGTCGGGGAAGGGGAGAAAA
T7_03510_G02	AAGGGAGAGAAGGAGAGGTCAAGGAGGGAAAGGAAA
T7_03511_G02	GGGAAAAGGGAGGAGAGGTCGGGAAGAAAAAAAAGG
T7_03512_G02	GGAGAAGGAAAAAGAAAGTCAGGGGAAGGGGAAAGG
T7_03513_G02	GAGAAAAAAGGGGAAGGGTCGGAGGGGAAGAGAAAA
T7_03514_G02	AAGAGGAGGGAAAAAGGGTCAGGGGAAGAAAAGGGA
T7_03515_G02	AGGGGAAGGGAAGGAAAGTCAGGGGAAGGAAAAAGA
T7_03516_G02	AAGAGGAGGGAGAGGAAGTCAAAGGAAAAAGGGAGG
T7_03517_G02	AGGAGGGAGAGGGGAAAGTCGAAAAGGGAAAGAAAG
T7_03518_G02	AAAGAAAAGGAAGGAGGGTCGGGAAGGAGGGAAAAG
T7_03519_G02	AAGGAAGGAGGGAAGGAGTCAGAGGGAAAGAAAGGA
T7_03520_G02	AAGAGGGAAAAGGGAGGGTCGGAAGGAGGAAGAAAA
T7_03521_G02	GGGGAAAAGAGGGGAAAGTCAGGAAAAAAGGGGAGA
T7_03522_G02	AGGAGGAGAAAGGAAGGGTCGAAAAAGGGAGAGAAG
T7_03523_G02	GGGAAAAGAGGAAAGAAGTCGAAAAGGAGGAGGGAG
T7_03524_G02	GGGAAGGAAAGGAAGGAGTCAGAAAGGGAGAAAGGA
T7_03525_G02	AAGAAAAGAGGAGGGAAGTCAGGGGAGGGAGAAGAA
T7_03526_G02	GGGGAAAAAGGAAGAAGGTCAAGGAGGAGAGAGAGA
T7_03527_G02	GGGGAGGGGAGGAAAAAGTCGAGAAAAGGAGAGAAA
T7_03528_G02	AGGGGAAAAGGGGAAGGGTCAAAAGGAAAGAGAGAG
T7_03529_G02	GGGGAGAAAGAGGGGAGGTCGAAAAAGGAAAGGAAA
T7_03530_G02	GAGAGAGGGGAGGAAGAGTCAAAAGAAAAAGGAGGG
T7_03531_G02	AAAAGGGGAGGGAGGAGGTCGGGAAAAAAAAAAGGG
T7_03532_G02	AAGAGGGAAAAGGAGGAGTCAGGGAGGAAAAAAGGG
T7_03533_G02	AGGAGAAAAAGGAGAGGGTCGAAGAGGAGAAGAGAG
T7_03534_G02	GGAGAAAGGGAGGGAGGGTCAGGAAGAAAAAGAAAG
T7_03535_G02	AGAAGAGGAGAGGGAAGGTCGGAGGAAAGAAAGAAG
T7_03536_G02	GAAAGGGAAAAGGAGGGGTCAAAGGGGAGGAGAAAA
T7_03537_G02	GGGGAGAAGGAAAGAGAGTCAAGGGGAAGAAAAAGG
T7_03538_G02	GGAGAAGAGGAGGAAAAGTCAAGGAAGAGAAGGGGA
T7_03539_G02	GAAAAAGGGAAAAGGAGGTCAGAGGAGGAGGGGAAA
T7_03540_G02	AGAGGGAAAGGGAGGGAGTCAAAAGAAGGGAAGGAA
T7_03541_G02	GGAAAAAAGGAGGAAAAGTCAGGAAAGGGGAGGGAG
T7_03542_G02	GGGAAAGGGAAGAAGGGGTCAAAGAGAAGAGGAAAG
T7_03543_G02	GGGGAGGGGAAAGAAAAGTCGAAAAGAGGAAAAGGG
T7_03544_G02	GGAGGGGAAAAGGGAGAGTCGGAAGAAAGGAAGAAA
T7_03545_G02	AGGGGAAAGGGAAAAGGGTCAAAAGGGGAAGGGAAA
T7_03546_G02	AGGGAGAAGGAAGGAGGGTCAAAGGAGAGAAAGAAG
T7_03547_G02	AGGGAAAGGGGAAAGAGGTCAAAGAAGGGAGGGAAA
T7_03548_G02	GAAGAAAGAAGGAAAAGGTCGGGAAAGGGGAGAGGA
T7_03549_G02	AAAGGGAGGGGAAAAGGGTCAAAAGGGAGAGGGAAA
T7_03550_G02	GGGAAGGGAGGAAAGGAGTCAGAGAAAAAGAAAGGG
T7_03551_G02	GAAAAAAAGGAAAAGGGGTCGAGAGAGGGGAGGGAA
T7_03552_G02	GGAAGGGGAAGGGAAGAGTCAGGAAGAAAAAAGGGA
T7_03553_G02	GGGGAAAGAGGGGAGAAGTCAAGAAAGAAGGAAGAG
T7_03554_G02	GGGAAAAAGAAAGGGAGGTCAGAAGGGGAAGGGAAA
T7_03555_G02	GGGAAAAAAGAAAAGGAGTCGGAGGAAGGAGAAGGG
T7_03556_G02	GAGAAGAAGGAAGGGGAGTCAGGGAGGAAGAAAAAG
T7_03557_G02	AGAAAGGAAGGAAAGAGGTCGAAAGAAGGGGAAGGG
T7_03558_G02	GGGGAAAGGAGAAAAAGGTCGAGAAGGGGAAGGAAA
T7_03559_G02	GGGAGAAAAAAAAGGAGGTCGAAGGGAGAAGGAAGG
T7_03560_G02	GAAGAAGGGGAAAGAGGGTCAGGAAGGAAAGAAGGA
T7_03561_G02	GGGGAGAAGGGAAAAAGGTCGAAGAGGGAAAAGAAG
T7_03562_G02	AGAAAAAGGGAAGGGGAGTCGGGAAAAGAGGGGAAA
T7_03563_G02	GAGAAGAGGGGAAAAGAGTCGGAAGAAAAAGGAGGG
T7_03564_G02	GGAAGGAAAAGGAAGAGGTCGGAGAAAGGGGAAGAA
T7_03565_G02	AAAAAGGGAGAAGGAGAGTCAGAGGAAGGAGGAAGG
T7_03566_G02	AGGAAAGGAGAAGGAAAGTCGGGAAGAGGAAGAGAG
T7_03567_G02	AAAAGGAAAGGGAAAGAGTCAGGGGAGAGGGAAAGG
T7_03568_G02	GAGGGGAGGAAAGAAAAGTCGGGAAAAAGAAGGAGG
T7_03569_G02	GGAGGGGAGGGAAAAAAGTCAAGAGAAGGGGAAAAG
T7_03570_G02	AGGGGAAAGGAAAAAGGGTCGGAGGAAAGGAAGAAG
T7_03571_G02	GGAGAGGGAGAAGGAGGGTCGAGAAGGAAGAAAAAA
T7_03572_G02	AGGAAAAAGGGAAAGGAGTCAGAAAGGGGAAGAGGG
T7_03573_G02	AAAGAAAAGGGAAGGAGGTCAGGGGAAAGAAGGGAG
T7_03574_G02	AAGAGAAAGGGAAAGGGGTCAAGGGAGGAAGGAGAA
T7_03575_G02	AGAGAGGAGGAAAAGGAGTCAGAGGAAGGGAGAAAG
T7_03576_G02	GAAAGGGGAAGGAAAAGGTCAGAAGAGGGAAAGGAG
T7_03577_G02	AAGAAAAGGGGAAGAGGGTCAAGAAAGGGGAAGGGA
T7_03578_G02	GGGGAGAAAAGAAAAGGGTCGGAAAGAAGAGAGGGA
T7_03579_G02	GAGAGGGGAAAGGGAAGGTCGAAGAAGAAGAAGGAA
T7_03580_G02	GAGAGGGAAGGAGAAAAGTCGAAGGAAAAAGGGGAG
T7_03581_G02	AAAGAAAGAGAGGGAAAGTCAAGAAGGGGAGGAGGG
T7_03582_G02	GGGGAGGAGAAGGGGAAGTCAAAGGAGAGAAAAAGA
T7_03583_G02	AAGGAAAAGGGAAGGGAGTCAAGAAAGGGGAGAGGA
T7_03584_G02	GGGAAGGAGGGAAAAAGGTCGGAAAGGGAAAAAAGG
T7_03585_G02	GAGAAAGAAAAGGAGAAGTCAAGGAGGAGGGGAAGG
T7_03586_G02	GGGAGGAAGGAGGAAAGGTCGGAGAAAGAAAGAAGA
T7_03587_G02	AGAAAAAAGGGGAAAAGGTCGAGAGAAAGGGGAGGG
T7_03588_G02	GGAAGAGAGGGAAAGGGGTCAAAAAGAGGGAAAAGG
T7_03589_G02	AGAGGGGAGAAGGAAGGGTCAAAAGGGAAAGAAAGG
T7_03590_G02	GGGAGAAGAAAGAAAGGGTCAGGAGGGAGGAAAAGA
T7_03591_G02	GGGGAGGGAAGAAGGAGGTCAGAAAGAGAAAGAAAG
T7_03592_G02	AAAGGGGAAAAGGGGAAGTCAAGAAAAGGGGAGGGA
T7_03593_G02	GGGAGGAAGGAAAAGAAGTCGGAAAAGAAGAGGGAG
T7_03594_G02	GAAGGAAAAGGGGAGGGGTCGAGAAAAGAAAAGGGA
T7_03595_G02	GAAGGGGAAAGGAGGGAGTCAGAAGGAAAGGAAAGA
T7_03596_G02	AAAGAGGAGGGAGAGGGGTCGAAAGAGAAAAGAGGA
T7_03597_G02	GAAAAGGAGAAAGGGGAGTCAAGGGGAAAGGGGAAA
T7_03598_G02	GGGGAGGGAGAGAAGAAGTCAAGAAAGAGAAGGGAA
T7_03599_G02	GGAAAAGGGAAAGGGAGGTCGAAAAAGAGGAAAGGG
T7_03600_G02	AGAGGAGGAAGAAGAGGGTCAGAGGAAAGGAAGAAG
T7_03601_G02	GAAAGGGGAAAAGAAGGGTCGGAGGAAAGAAGGGAA
T7_03602_G02	AGGGAGAAGGAAGAGGGGTCAGGGAAAAAAGAAGAG
T7_03603_G02	GGGAAAAAGGAAGGGAAGTCAAAAAGGGAGGGAAGG
T7_03604_G02	GAAAAGGAAGAGGGAAGGTCGAGGAAAAGGAGAGAG
T7_03605_G02	GAGGAAAGAAAAGGAAGGTCGAGAAAGGGAGGGGAA
T7_03606_G02	GGAAAGGGAAAGGGGAAGTCAGGAGAAAGAAAGGAG
T7_03607_G02	AAGGAGAAAAGGGGAGGGTCGAAAGGAGAGAAAAGG
T7_03608_G02	GGAAAGGAGGGAGGAAGGTCGAGGGAGAAGAAAAAA
T7_03609_G02	GAGAGAAAGAGAAAGGGGTCAAGAGGAAGGGGAAGA
T7_03610_G02	AAGAAAGGGAGGAGAGGGTCGAGAGGGAAGGAAAAA
T7_03611_G02	GGAAGAAAGAAAGAGAAGTCGGAGGAGAAGGAGGGA
T7_03612_G02	AAGAGGAGAAAGGAGAAGTCGAGGAGAAGGAAGGAG
T7_03613_G02	GGGAAGGGGAGGGAAAAGTCAGAAGAAGAAGAGGAA
T7_03614_G02	AGGGAAGAAGGGAGAAAGTCAGAGAAGAAGGAGGAG
T7_03615_G02	GAAAAGGAAGAGAAGAGGTCGGAAAGAGGAGAGAGG
T7_03616_G02	GGGAGAAAGAAAAAAGGGTCGGAAAGGGAAGGAAGG
T7_03617_G02	AGGAAAGGAGGAGAAGGGTCAAAGGGAAGAGGAAGA
T7_03618_G02	AGAGGAGAAAGAAAAAGGTCGAAGAGAGGAGGGGAG
T7_03619_G02	AAGGGAGAGGGGAGGAGGTCAGAAGGAGGAAAAAAA
T7_03620_G02	AAAGAGGAGAGGGGAGGGTCAAAGAAGAAGGGAAAG
T7_03621_G02	GGGAGGAAGGGAGAAAGGTCGGAAGAGAAAAGGAAA
T7_03622_G02	GGAAAGGAAGGAGGAAGGTCAGAAAAGAGAGGAGGA
T7_03623_G02	AAAAAGAGAGAAGGGAAGTCGAGGGAGGGAGAAGAG
T7_03624_G02	GAGGGAAAAAGGAGGGAGTCAAAGGGGAGAAAAGGA
T7_03625_G02	GAGAAAAAGAAGGGAGGGTCGAGGAGAAAAGGGGAA
T7_03626_G02	GAGGAGAGAGGGGAGAGGTCAAGAGAAAAAGAGAAG
T7_03627_G02	AGAGAGGGAGGGAGGGAGTCAGAAAAGAAGAAAAGG
T7_03628_G02	GAGAGAGGAAAGAAAAGGTCGAAGGGAGGAGAAGAG
T7_03629_G02	AGAAGAGGAGAAGAGGGGTCAGAGAAAAGGGGAAGA
T7_03630_G02	AAGGAAAGAGGGAGGGAGTCGAGGGGAAAAGAAAAG
T7_03631_G02	AGGGAGAGGGAGAAGAGGTCAAGGGAAGGAGAAAAA
T7_03632_G02	AGGGAAGAAAGAAGGAAGTCAGGGAAGGGGAGAGAA
T7_03633_G02	AAGAGAAAGGAGGAAGAGTCAGGAGAGAGAAGGGGA
T7_03634_G02	GGGAGGGAAAAGAAAGGGTCGGGAGAAAGAAGAAGA
T7_03635_G02	AGAGAAAGGAAAAGGGAGTCGGGAAAAGGGAGAGGA
T7_03636_G02	GGGAAAAAGGAAGAGGAGTCAAAGAGAGGGAGGAAG
T7_03637_G02	GGAGAAGAGGAGGAGGGGTCAGAAGAAAAAGAAAGG
T7_03638_G02	AAAAGAAAGAGGGGAAAGTCAGGGAGGAAGGGAAGG
T7_03639_G02	AGAGAGAAAAGGAGAGGGTCAAAGGGAGGAGAGAGA
T7_03640_G02	AGAGAGGGAAAAAGGGAGTCGGAAAGGAGGAAGGAA
T7_03641_G02	AAGGAAAAAGGGAAAGGGTCGGAGGAGAGGAAGAGA
T7_03642_G02	AGAGGAAGGGGAAAGGGGTCAGAAAAAAAGGGGAAG
T7_03643_G02	GGAGAGAGAGGAAAAAGGTCAGAAGAGAGGAAAGGG
T7_03644_G02	GAAAGAGGGGAAGGAGAGTCGGGAGAGAGGAAAAAA
T7_03645_G02	GAGAGAAGGAGGAGAGGGTCGAAGAGAGGAAGAAAA
T7_03646_G02	AAAGGGGAAGGGAAAGGGTCGGGAAGGAAAGAAAAG
T7_03647_G02	GGAAAAGGAAGGGGAAGGTCAGGAAAAGAGAGAGGA
T7_03648_G02	AGGGGAAAAGAAAAGGGGTCAAGAGAGGAGGAGGAA
T7_03649_G02	GAGAAAGGGGAAAGAGAGTCGAAGAGGAAGAAGGGA
T7_03650_G02	GGGGAAAAGAAAGGAGAGTCGGAAAGAAAGGAAGGG
T7_03651_G02	AAAAGAAAAGGGGAAAGGTCGAAGGAGAGGGAAGGG
T7_03652_G02	AGGAAAGGAAGGGAGGAGTCGAAAAGGGGAAAAGAG
T7_03653_G02	AGAAAGAAGGGAAAGAAGTCGGGAGGGGAAAAGGAG
T7_03654_G02	GGAGGGAGGGAAGAAAAGTCGAAAAGAAGGGAAGGA
T7_03655_G02	GGGAGGAAAGGAGAAAGGTCGGAAAGGGAAAAGGAA
T7_03656_G02	GAAGGAAAAGGGAAAGAGTCAAAGGGGAAGGGGAAG
T7_03657_G02	AGAGGAGAAGAAGGAGGGTCAAAAGGGAGGAAAGGA
T7_03658_G02	AAGGGAGGGGAGGGGAGGTCGGGAAAAAAAAGAAAA
T7_03659_G02	AGGGGAAGAAAAGAAGAGTCAGGGAAAGAGGGAGGA
T7_03660_G02	AGGGGAGAAAGAGAGGAGTCAGGAGAAAAGGGGAAA
T7_03661_G02	GAGGGGAAAAGGAGGAAGTCAGAGGAAGGAAAGAGA
T7_03662_G02	GGAGAAGGGAAAAGAAGGTCGAAGAGGGGAAAAGGA
T7_03663_G02	GAAGGGAGGGGAAAGAGGTCAGAAAGGAGAAAGAAG
T7_03664_G02	AGAGAAGAAGGAAAGGAGTCGGAGGGAAAAGGAGGA
T7_03665_G02	AGAAGAGAGAAAGAGGAGTCAAGGGAAGGAGAGAGG
T7_03666_G02	GAAGGGAGAAAAAAAGGGTCAGAGGAAAGGGAGGAG
T7_03667_G02	AAGGAAGAGGAAGGGAAGTCAAGGGAGAAAAGGAGG
T7_03668_G02	GGAGAGAAAGGGAAAGAGTCGAGAAAGAGGGAAAGG
T7_03669_G02	AAAGAGGGAGGGAGGAAGTCAAAGGGAAGAAGGAAG
T7_03670_G02	GAGGGAGAGGAAAGAAGGTCAAAGGGAAGGAAAAGG
T7_03671_G02	GAGAAGGGAAGGGAGAAGTCGGAAAAGGAGGAAGAA
T7_03672_G02	AGGGAAGAAAAAAGGGAGTCGGGAAGGAAGGAGAAG
T7_03673_G02	AAAAGAGAGAGGGAGAAGTCGGAAGAGGGAAGAGAG
T7_03674_G02	GGGAAAGGGGAGGAGGAGTCAAAAAGAGGGAAAAAG
T7_03675_G02	GAAAAGAGGAGGAAGAAGTCGAGAGGGAGGAAAGGA
T7_03676_G02	GGGAGGGAAGGGAGAAAGTCAGAAAGAGAAAAGGAG
T7_03677_G02	AAAAAGAGAAAGGGAGAGTCAAGGGAGGAGAGGGAG
T7_03678_G02	GAGGGGAGGGAGAAAGAGTCGAAAAAGGAAAAGGAG
T7_03679_G02	GAAAGGGGAGGGAGAAAGTCGGAAAAGAGGAGAAAG
T7_03680_G02	AAGGGGAAGAGGAAGAGGTCGAAAAAAGGGGAGAAG
T7_03681_G02	GGGAAAGGAAGGAAGGAGTCGAAAGGGGAAAGAAGA
T7_03682_G02	GAGGAAGAAGAGGAGAAGTCAAAGGAAGAGGGGAGA
T7_03683_G02	AGAGAGGGGAAGGAAAGGTCAAAAGGGAAAGAGGAG
T7_03684_G02	AAAGAGAAAGAGAAAGGGTCGGAGAGAGAGAGGAGG
T7_03685_G02	AAGAAGGGGAAAGAAAGGTCGGAAAGAAGGGAGAGG
T7_03686_G02	GGAGGGGAAGAAGAGGGGTCGAAAGAAAGAGAGAAA
T7_03687_G02	GGGAAAAGAGGGGAGAAGTCAGGAAAAGGAGGGAAA
T7_03688_G02	GAAGAGAAGAGGGAAGAGTCGAAAGGAAGAGGAAGG
T7_03689_G02	AAAGGGAAAGAAGAAGGGTCAGGAAAGGGAAGAGGG
T7_03690_G02	AAGAGAGAAAGAGAAGAGTCGGAAGGGAAAGGGAGG
T7_03691_G02	AGAAAAAAAGGGAGAGAGTCGGAAGAGGGAGAGAGG
T7_03692_G02	AGGAAAGAGGGAAAAGAGTCAGAGGGAGGGAAGGAA
T7_03693_G02	GAAGAGAAAGGGAAGGGGTCAGGAGAGAGAAAGGAA
T7_03694_G02	GAGGGGAAAAAAGAGAAGTCGGAGGGAAGGAGAAAG
T7_03695_G02	GAAGGGAGGAAGGAAGGGTCGAAAAGGGAAAGAAGA
T7_03696_G02	GAAAGGGGAAGAGGAAAGTCGAGAAGGAAGAAGGAG
T7_03697_G02	GGAGAGAAGAGAAAAGGGTCGGAAAAGGAAGGGAAG
T7_03698_G02	AGAAGAGGAGAAGGGAAGTCAGGAGAAGGAGAAGGA
T7_03699_G02	AGAGGGAGAAAAGGGGAGTCGAGGGAGAAAAGAGAA
T7_03700_G02	AGGAGGAGGAAAAAGGGGTCAAAAGAAGGGAAGAGG
T7_03701_G02	AGGGGAGAAAAAGAAAAGTCGAAGGGGAAGGGGAAG
T7_03702_G02	AGAAGAGAAGGGAAGGAGTCGAAGGAAAAGAGGGGA
T7_03703_G02	AAAGGAAGGGAGGGAGAGTCAAAGGGAAAGGGAAAG
T7_03704_G02	GGGAGAAGAGAAGGGGAGTCAAGGAGAGAAAGGAAA
T7_03705_G02	AAGGGAAGAGAAGGGAAGTCGGGGAAGAGGAGAAAA
T7_03706_G02	GAAGGAAAAAGGGAGGAGTCAAAAAGGAGGAGAGGG
T7_03707_G02	GGAAAGAAAAAGAGAGAGTCGAGGGAAGGAAGGGGA
T7_03708_G02	GGGAGGAAAGGAAGAGAGTCAAAGAGGGAGAGAGAA
T7_03709_G02	GAGAAAAAAAAGAAGAGGTCAGGGGAGAGAGGGAGG
T7_03710_G02	GGAGAAAGGAAGAAGGAGTCAGGGGAAAGGGAGAAA
T7_03711_G02	AAAGAGGGGAGAGGAGGGTCGAGAAAAAAGAGAAGG
T7_03712_G02	AAAAGGAGGAGAAAGGGGTCAAGGAGAAGAAGAGGG
T7_03713_G02	GAGGGAGAAAAAAAAAAGTCGGGGAAGGGAAGGGAG
T7_03714_G02	GGGAGGGAGAAAAAAAGGTCAGGGGAAGAGAGGAAA
T7_03715_G02	AAGGAGGAGGAAAAAGAGTCGAGAAAGGGAAGGGGA
T7_03716_G02	GGGGAGAAAAAAGAAGAGTCGAGAAGGGGAGGAGAA
T7_03717_G02	GGAAGAAGGGAGAAAGAGTCGAGGGGAAAAAGAGGA
T7_03718_G02	GAAGGAAAAAGAAAGAGGTCGAAGGGAGGAAGAGGG
T7_03719_G02	AGAAGAGAGGAGAAGAAGTCGGAAAGGAAGGAGAGG
T7_03720_G02	GGAGAAGAAAGAGGGGAGTCAAAGAGGGAAAGGAAG
T7_03721_G02	AGGGAGGGAAAAGGGAAGTCGGAAGGGGAGAAAAAA
T7_03722_G02	GAGGAGGAAAGAAAGAAGTCGAGGGGAAAGAGAGAG
T7_03723_G02	AAGAGGGGAAGGAGAAGGTCGGAAGAAAGGAGGAAA
T7_03724_G02	GGGGAAGAAAAGAGGGAGTCGAAGGGAAAAAGGGAA
T7_03725_G02	AAGGAAGGGGAAAGGAAGTCAAGGGAGAAGGGGAAA
T7_03726_G02	GGGAAGGAAGGGAGGGAGTCAGAGAAGGAGAAAAAA
T7_03727_G02	AAGAAGAGGAGAGGAGAGTCGAAAAAGGGAGGGGAA
T7_03728_G02	AAAAAGGAGGGAAGGGAGTCAGAAGAAGAGGGAGAG
T7_03729_G02	GAAGAAGGGGAAAGGGAGTCGGGAAAGAAGAGAGAA
T7_03730_G02	AGGGGAGGAGAAGAAGAGTCGGGAGAAAGGAAAGAA
T7_03731_G02	AAAAGAGAGGAGGAGGAGTCAGGAAGAGAGGAAAGG
T7_03732_G02	GAGGAAGGGGAAAGAAGGTCGAAAAGGAGGAAAAGG
T7_03733_G02	AGAGGGAGGAGAAAAAAGTCAGGGGAGAAGAGAAGG
T7_03734_G02	GGAAGGAGAAAAGGAAAGTCAAGGGAGAAAGGGAGG
T7_03735_G02	GGAGAGAGAAGAAAGGGGTCAGGAAGGAAAAGAGAG
T7_03736_G02	GGGAAAAAGAGAGAGGGGTCAAAAAAGAGGAGGGGA
T7_03737_G02	AAGGAGAGAAGAGAGAGGTCAGAGAGGAAGGGAGAA
T7_03738_G02	AAGAGGGAAGGGGAGGGGTCGAAAGAAGGAAAAAAG
T7_03739_G02	AGGAGGAAAAAAAGGGAGTCGAGGAAGGGAAGGAGA
T7_03740_G02	GAGGAAGAGAGGAAAGGGTCGGAGAAAGGAAAAGAG
T7_03741_G02	GGGGAGAAAGGAAAAGAGTCAGAGAGGGAAAGGAAG
T7_03742_G02	GAGGGAAGGAAGGAAAGGTCAAGAGAAAAGGGAGGA
T7_03743_G02	GAGGGGAAGAAGAGAAAGTCAAGGGGAAAAAGAGGG
T7_03744_G02	AGAGGGGAAGGAAGAAAGTCGGGGAGGGAAAAGAAA
T7_03745_G02	AAGGGAGGAAGAAGAAGGTCGGAAGAAGGAAGGGAA
T7_03746_G02	AAAAAGAGGAGGGGAAGGTCGGGAAAAAGAAGGGGA
T7_03747_G02	AAAGGGGAAAAAGGAAAGTCGGGAAGGGAAGGGGAA
T7_03748_G02	AAGGGAGGAGGGGAAAAGTCGAAAAAGGAGAGAGAG
T7_03749_G02	GAAAGAAAGGGAAAGAAGTCGAGGGGAGAAAGAGGG
T7_03750_G02	GAAAAGGAGGAGAAAGGGTCAGGAGAAAAGAGAGGG
T7_03751_G02	AGGGAAAAAAAGGGGAGGTCGAGGAGGAAGGGAAAA
T7_03752_G02	GGAGGAAAGAGGGAGGAGTCGAAAAGAGAAAGAGGA
T7_03753_G02	AAAAAGGGAGGGAAGGGGTCAGGGAAAAGAGAGAAG
T7_03754_G02	GGAGAGAGGAAGAAAAGGTCGGGAAAAGAAGGAGGA
T7_03755_G02	GGGAAGAGGAGAAGAAAGTCGAGGGAGGAAAAGAGA
T7_03756_G02	AAAGGAAAGGGGAAAGGGTCAGAAGAGGGGAGAAAG
T7_03757_G02	GAGGAGGGAGAGGGAAGGTCAGAAAAGAAGGAAAAG
T7_03758_G02	AAGAGGGGAAAGAAAGAGTCAGAAGAGGGGAGAAGG
T7_03759_G02	GGGAGGGAAAAAGGGGAGTCAAAGGGAAAAGAAGGA
T7_03760_G02	AGAGAGAGAAAGAGGGAGTCGAGAAAGGGAGGAAGA
T7_03761_G02	GAAGAAGAAGAGGGGAGGTCAAAGGGGAAAGAGAGA
T7_03762_G02	GAAGAAGAGAAAGAGAGGTCGGGAGGAGAGAAAAGG
T7_03763_G02	GGAGAAAGGAGAAAAGAGTCAGGGAGGAGAAGGGAA
T7_03764_G02	GGAGGGGAGAGAGAGAAGTCAAAAGAAGGGGAAAGA
T7_03765_G02	AAAGGGAAAGAGGAAAAGTCGGGAAGAAGGAGAGGG
T7_03766_G02	GGAGAAGGGAAAGGAAGGTCAGAAGAAGGGGAGAAA
T7_03767_G02	GAAGAGGAGGAGAAAGAGTCAGAAGGGGAGAAGGAA
T7_03768_G02	GGAAAAAAGGAGGGAGAGTCGGAAGGAAGGGGAAAA
T7_03769_G02	AGAGAAAAGGAAGAGAAGTCGGGAGGAGAGGAGAGA
T7_03770_G02	GGAGAGAGAAAAGGAGGGTCGAGAAAAAAGAGGGAG
T7_03771_G02	AGAGAAGAAGAAGAAGAGTCGGGGAGGAGAAAGGAG
T7_03772_G02	GAAGAGGGAAAGAAAGGGTCGAGGAAGAGGAAAGGA
T7_03773_G02	AGGAAAGAGGGAAAGGGGTCAGGGAAAAAGGGGAAA
T7_03774_G02	GGAGGAAAAGAAGAGGAGTCGAAAGGAGAGAAGAGG
T7_03775_G02	GGAAAGAGGAGAGAGAAGTCAGGGGAAAAGAGGGAA
T7_03776_G02	GAAAGAGGGGAAGAGGGGTCAGAAGAAAAGGAAGGA
T7_03777_G02	GGGAAAAAAGAGGAAGAGTCGAAGAGGAGGAGGGAA
T7_03778_G02	AAGAAAGGGAGGAAAAAGTCAGGGGAGGAAGGGGAA
T7_03779_G02	AGAAAAGAAGAGGAGGAGTCGAGGGAGGGGAAGAAA
T7_03780_G02	GAAGAGGAGAGAAAGAGGTCGAGGGAGGGAGAAAAA
T7_03781_G02	AAGGGGAGGAAGGGAAAGTCGAAGAGGGGAAAGAAA
T7_03782_G02	GAGAAAGAGGGGAGGAGGTCGAAAAAAGAAAGGAGG
T7_03783_G02	GGAGGGGAGGAAAAAGAGTCGGGAGAAGAAAAGGAA
T7_03784_G02	GGAAGAAGGGAGAGAAGGTCAAGGGAAAAGAGAGGA
T7_03785_G02	AAGGAGGAGGGGAGAAAGTCAAAGAAGGGGAAGAAG
T7_03786_G02	GGGAGAAGAAGGGGAAAGTCGAAAGGGAGGAAAAAG
T7_03787_G02	AGAAGGGAAGAAAAAGAGTCGGAGGAGAAGGGAGAG
T7_03788_G02	AGGGAAGGGGAGGGAAGGTCAGAAAAAAGAGGAAAG
T7_03789_G02	GAGGAAGGGAGGGAGAGGTCAAAAAGGAAGGAAAAG
T7_03790_G02	GGGAAAAGAAGAAGAAGGTCGGGGAAAAGGAAAGGG
T7_03791_G02	GGGGAGAGAGGGAGGAAGTCAAAAAGGGGAAAGAAA
T7_03792_G02	AGAAAAAGGGAGGGAAAGTCAGGGAAGGGAGAAGAG
T7_03793_G02	GAAGAAGGGGAGGAAGGGTCAGAGAAAGAGAAAGGA
T7_03794_G02	AGGAAAGAAGAAAAAAGGTCGGAGGGGAGGGAAGGA
T7_03795_G02	GGGAAGAGAGGAAGAGAGTCAAGGAAAAGAGGGGAA
T7_03796_G02	GGGAGGAGGGGAAGAGAGTCAGAAAAAGAGAGGAAA
T7_03797_G02	AGGGGAGGAAGGGAGGAGTCGAAGAAGAAAAAGAAG
T7_03798_G02	GAGGGAGGGAAGAAAGGGTCGAGAAAGGAGAAAAAG
T7_03799_G02	AGAAGAAAAAGGGAAGGGTCGAGAAGGGGAGAAGGA
T7_03800_G02	AAAAGGAAAGAGGAGGAGTCGGGGAAGAGAGAAGGA
T7_03801_G02	AGAAAGGGAAAGGGGAAGTCAGGAGAAGGGAAAAGG
T7_03802_G02	GGAAGAGGGGAAAAGAAGTCGGGAGAAAAGAGGAGA
T7_03803_G02	GGGAAAGAAGGGGAGGGGTCGAAAGGAAAGAAGAAA
T7_03804_G02	GAAGAGAGAAGAAAAGGGTCAGAAGAAGGGAGGGGA
T7_03805_G02	GGAAGGGAAAAGAAAAGGTCAAGGAGGGAGAGAGAG
T7_03806_G02	AAAAGGAAGGAAGAAAGGTCGAGGAGAGAGGGAGGA
T7_03807_G02	GAAAAGGGGAAAGAGGGGTCGAGAAGAGGAAGAGAA
T7_03808_G02	AGGAGAAGAAAAAAAGGGTCGGAAGGGGAGGGAAAG
T7_03809_G02	GGGAGGGGAAAGGGGAAGTCAAAAAAAGAGGAGAGA
T7_03810_G02	GGAGGAGGAAAAAAAGAGTCGGGGAGGAAAGAAGAG
T7_03811_G02	AGAGGAGAGGAAAGAGGGTCAAAAGGAAGGGAAAGG
T7_03812_G02	GGAAAAAAAGAGGGAAGGTCGAAGGAGGGAAGAGGA
T7_03813_G02	GGGAAGAAAAGAAAGAGGTCAAGAAGGGGAAGAGGG
T7_03814_G02	AGAGGAGAGGGAAAAAAGTCAGGGAAAGGGAAGGAG
T7_03815_G02	AGGAAAAGAAAGAGGGAGTCGGAGGGGAAAGAAAGG
T7_03816_G02	GAAGGGAAGAAAGAAAGGTCGAGGAGAAGAGAGGAG
T7_03817_G02	AAAAGAGGAGGAAAGGGGTCGAAGGAGGGAAAGGAA
T7_03818_G02	GAAAGAGGGGAGGAAGAGTCAAAAGGAAAGGGGAGA
T7_03819_G02	GGAAAGGAGGGAAGGGAGTCAGGGAAAAAAAGAGAG
T7_03820_G02	AGGAGGAAAGGGGAGAAGTCAGAAGGAAAGAAGGAG
T7_03821_G02	GAGAGGGGAGAAGGAAGGTCGAAAAGGGAAAGAAAG
T7_03822_G02	GGGAAAGGAAGAGGGAGGTCAAGGAGAAGAAGAAGA
T7_03823_G02	GGAAGAAAGGGGAGAAAGTCAAAAAGAGGAGGGGAG
T7_03824_G02	AGAAAGGGGAGAAAAAGGTCAGAGGGGAAGGAGAGA
T7_03825_G02	GGAAGAGAGAGGAGAAAGTCAGGGAAGGAAGAAGGA
T7_03826_G02	AGAAAGAAGAAGGGAGGGTCGAGGAGGAGAGAAAAG
T7_03827_G02	AGGGGAGAGAGAAAGAAGTCAAAAGGGGAGGAAGAG
T7_03828_G02	GGAGGGAGGAAAGGAAAGTCGAGGAGAAAAAAAGGG
T7_03829_G02	AAAAGGGAGGGGAGAGGGTCAGGAGAAGAGGAAAAA
T7_03830_G02	GAGAGAAGGAGGGAGGAGTCGGAAGGAGAAAAAAAG
T7_03831_G02	GAGAGGAGGAGAAAAAAGTCAAAGGAGGGAGAAGGG
T7_03832_G02	AGGGAAAGAAAGAAGGGGTCAAAAGGGAGAGGAAGG
T7_03833_G02	AGAGGGAGGGGAGAGAAGTCAGAGAGGAAAAGAGAA
T7_03834_G02	AGAAAGAGGGAAGAAGGGTCGAGAGAAGAGAGAGAG
T7_03835_G02	AAGGGAGAGAAGAAGGGGTCGAGGGAAAAAAGGGAA
T7_03836_G02	GGGAGGAAAGAGGGAAAGTCAAAGAAAGGAGAAGGG
T7_03837_G02	AGAAGGGAAAGGGAAAAGTCGAAAAGAGGAGGAGGG
T7_03838_G02	AGAAAGGAGGGGAAAGAGTCAGGGGAAAAGGGAAGA
T7_03839_G02	GAAGAGAGGAAAGGAGGGTCAAGGGGAGGAAAGAAA
T7_03840_G02	GAAGGAAAAGGGGAAGAGTCGAAGGAAAAGAGGGAG
T7_03841_G02	AAGAGAGGAAAGAGGGAGTCGAGGAAGGGAAAAGGA
T7_03842_G02	GAGAAAAAGAGGAGGGAGTCAGGGAAAAGGAGGGAA
T7_03843_G02	GGAAAGGGGAAAGAAGGGTCGAAGAGAAGGGAGAAA
T7_03844_G02	AGGAAAGAGGAGAAAAAGTCGGAAAAGGAGGGAGGG
T7_03845_G02	AAAGGAAGAGGAGGGAAGTCAGAAGGGAAAAGAGGG
T7_03846_G02	GGAGAAAAAAAAGAGAAGTCGGGAGGGGAGAAGAGG
T7_03847_G02	GGGAAAGGGAAGAGAGAGTCGAAGAAAGGGAGGAAA
T7_03848_G02	GAAGGGAAGGGAGGAAGGTCAAAGAAAGGGAGGAAA
T7_03849_G02	AGGGAGGGAAGAGAAAGGTCGAAAAAGAAGGAGAGG
T7_03850_G02	AAGGAGAAGGAGGGAGGGTCAGAGAGGAAGAAAAGA
T7_03851_G02	GAAGAGGGGAAGGAGGAGTCAAAGAGAAAGGAAAGG
T7_03852_G02	AAGGGAGGGGAGGAGGAGTCAAGAGGAAGGAAAAAA
T7_03853_G02	GAGAAAGAGGAGAAAAGGTCGAGAAGGGGAAGAGGA
T7_03854_G02	GAAAAGGAGAAGAGGAGGTCAAGGAAGGAGAAAGGG
T7_03855_G02	GGGGAAAGAAGGAAAAAGTCGAAAGGGAGGAAAGGG
T7_03856_G02	AGAAAGGGAAGAAGGAGGTCAGGAGAGGAAAAGAGG
T7_03857_G02	GGAGAAGGAAAAAGAGAGTCGAAAAGGGAGGGGAAG
T7_03858_G02	AAGAAGAGGAGGAGGGAGTCGAGAAAAAGGAAGGGA
T7_03859_G02	GAAGGGAAGAGGGAAGGGTCAAGGAGAGGGAAAAAA
T7_03860_G02	GAAGGGGAAGGAAAGAAGTCGAAAAGGAAAGGAGGG
T7_03861_G02	GAGAAGGGAAAGAGAGAGTCAAAAAAGGGAGGAGGG
T7_03862_G02	GAAGAAGAGGAGAAGGGGTCAGGAAAAAAGAGGGAG
T7_03863_G02	GGAAAGAGAAGAAAAAGGTCGGGGAGAGGGAGAAGA
T7_03864_G02	AAAGGGGAAGAAGAAAAGTCGGAAAGGGGAGGGGAA
T7_03865_G02	GAGAAGGGAGGAAGAGAGTCAGGAAGGAGAAAGAGA
T7_03866_G02	GGAAAGAGAGAAAGAGGGTCAAAGGGAGGAGAGAGA
T7_03867_G02	GGGGAAAAAAGGGAGGAGTCGAAGGAAGGAGAAAAG
T7_03868_G02	AAGGGAGAAAAGAAAGAGTCAAAGGGGAGAGGGAGG
T7_03869_G02	AGGGAGGAGAGAAGGAAGTCAAGAAAGGAGGGAAAG
T7_03870_G02	GGGAAGAGGGAGGGAAAGTCAGAAAGGAAAAAAGGG
T7_03871_G02	GGAGAAGGGAAGGAGGGGTCAAAAGAAAAGAAGGAG
T7_03872_G02	GAGGAAGGAGGAAGGAAGTCAGGAAGAAAGAAAGGG
T7_03873_G02	GGAGGAGAGAAGAGAGGGTCAAAAAAAGAGGAGAGG
T7_03874_G02	GAGAAGAAGGAAAGGGAGTCAAGAAAGGGGAGAGGA
T7_03875_G02	AGGGAAGAGGGAGAAAGGTCGGAAGAAGAAAGGAAG
T7_03876_G02	GGGAAGAAAAGAAAAAGGTCAAGGGAGAGGAGGGAG
T7_03877_G02	AAAGAAGGAGGGGAGAGGTCAAGGAAGAGAAGGGAA
T7_03878_G02	AAAAGAAGGAGAGAGGAGTCAAGAGGAGAGGAGAGG
T7_03879_G02	AGAAGGGAGGGAAGGAAGTCAAGGAGGAAAGAGGAA
T7_03880_G02	AAGGAGGAAAAGGGAAGGTCAGGGGAGAAAAAGGAG
T7_03881_G02	GAAGAGGGAGGAGAAGAGTCAAGAGGAAGAAAGGAG
T7_03882_G02	GAAGAGGAAAAGGAGAGGTCGGAGGGGAAAGAAAAG
T7_03883_G02	AAAGGGGAAGAGAGGGAGTCGAGAAAAGGAAGGAGA
T7_03884_G02	AGGAAGAGAGGGGAAAGGTCAGAAAAAGGAAGGGAG
T7_03885_G02	AGAGGAGAAAGGGGAAAGTCGGAAAAGAGGGAGAAG
T7_03886_G02	AAGGGGAGGAAAAGGAAGTCAGGGGAAAGAAGAAGG
T7_03887_G02	AAAGGGAGAAAGGGGAGGTCGGGAAGGGAAAAAAAG
T7_03888_G02	AAAAGAGAAAAAGGGGAGTCGAGGGGAGAGGAAAGG
T7_03889_G02	GGAGAAAAGGAAAAAGAGTCAGGGGAAGGAAGGGAG
T7_03890_G02	AGGGAGGAAGAAAAAAGGTCAGAGGGGAGAAGGAGA
T7_03891_G02	AGGGAGAAAGAAAAGAAGTCGAGGAAAGGAGGGAGG
T7_03892_G02	GAGGAGGAGGAGAAAAGGTCGGAAAGGGGAAAGAAA
T7_03893_G02	GGAGGAGGAGAGAAGAAGTCAGAAGGAAGAGAGGAA
T7_03894_G02	GAAGAAGAAAAAAGGGAGTCGGAGGAAAGAGGAGGG
T7_03895_G02	GGGAGAAGGGAAAGGAGGTCAAGGGGAAAAAAGAAG
T7_03896_G02	AAGGAGGAGGGAAAAAGGTCGAAGGAAGAGAGGAGA
T7_03897_G02	GGAGGGAGGGAAAGAGAGTCAAAGGAGAGGAGAAAA
T7_03898_G02	GGAGAGGAGAAGAAAAAGTCAGGGGAAAGGAAAGGG
T7_03899_G02	GGAAAAAAAGGGGAGGGGTCGGAAAGAAGAAAGAGG
T7_03900_G02	GAAGGAGGAGGAAAGAAGTCAGGAAAGGAAGAAGGG
T7_03901_G02	AGGGAAAAAGGGGAAAAGTCAGGGGAAAAAGGAGGG
T7_03902_G02	GAGAGAGAAAGGGAGGAGTCAAAGAGAGGAGGAAGA
T7_03903_G02	AGGGAGAAGGGAAAAGGGTCAAGAAAAAAGGGGAGG
T7_03904_G02	AAGAAGAGAGGGAGAAAGTCGAAGGAAAAGGGGAGG
T7_03905_G02	AGGAGGGAGGGAGGAGAGTCAGGAAAAAGGGAAAAA
T7_03906_G02	GGAGAGAAAAAAGAGAGGTCGGAAAGAAAGGGAGGG
T7_03907_G02	GGGAGGGAAAAAAGAGGGTCAGGAAGGGAAGGAAAA
T7_03908_G02	GGGAGAAGGGGAAAGGAGTCAAAAGGGGAAGGAAAA
T7_03909_G02	GAAAAAAGGAAAGGGGAGTCGGAGAGAGAAGGAAGG
T7_03910_G02	AAAAAGAAGGGGAAGAGGTCGGAGGGAAGAGAGGAA
T7_03911_G02	AAGAAGAGGGAAAAAGGGTCAAGAGAGGGGAGGGAA
T7_03912_G02	AAAGGGAAGGGAGAAAGGTCAAAAGGAGGAGGGGAA
T7_03913_G02	AAGAAGGAAGGGAAAGGGTCAAGAGAGGAGGGGAAA
T7_03914_G02	GGGAAAGGAAAAAAGAGGTCGAAGGGAAGGGGAAAG
T7_03915_G02	AGGGAGAAAGAGAGGAAGTCGAAAAGGGAGAAAGGG
T7_03916_G02	GGAGGAAGGAAAAGGAAGTCAGAGGGGAGAAAAGGA
T7_03917_G02	GGAAGAGAGGAGAAGGAGTCGAAAAAAAGGGGAGAG
T7_03918_G02	AGAGGAAGGAAAGGAAGGTCAAAAGAGGGAAGGAGG
T7_03919_G02	AGGAGGAGAAAAAGAGGGTCGGAAGGGAAGAGAGAA
T7_03920_G02	AGAGGAGAGAAGGGGAGGTCAAAAGGAGAGAAAAGG
T7_03921_G02	AGAGAAAGAGGGGAAGGGTCAGAAAGAGGGAGAAAG
T7_03922_G02	GGGAGGGAAGAAAAGAGGTCAAAGAGGGGAAGAAAG
T7_03923_G02	AAGGGAAAAAAGAAGGGGTCAAAGGGAGGGGAGAAG
T7_03924_G02	AGAAGAGAGGGAAAGGAGTCGGAGGAAAGGGAAAGA
T7_03925_G02	AGGAAAGGGGAAAAAGGGTCGAGGGAGGAGAAAGAA
T7_03926_G02	GGAGGAAGGAAGGGAAAGTCGGGAAAGAAAGAAGGA
T7_03927_G02	AGAAAGGAAGGAGAGAGGTCGGGGAAAGAGAAAGAG
T7_03928_G02	AGGGGAGAAGGGAAAGGGTCAAAAAGGGAAAGGGAA
T7_03929_G02	GGGAGGGAAAAAAGGAGGTCGGAGAAAAGGAAGAAG
T7_03930_G02	AAGGAGGAAGAGGGAAAGTCGGAAAAGGGAGGAGAA
T7_03931_G02	GGGGAGAGGAAAAAAGGGTCGAGAGAGAAGAGAGAA
T7_03932_G02	GAGAAAGAGAAAAGGGAGTCGGGGAGGAAGAAGAAG
T7_03933_G02	AAGAGGGAAAGGAGGAAGTCAGAGAAGGAAGAGAGG
T7_03934_G02	AGGGAGGAGAAAAAGGGGTCGGAAGAAAGAGAAGGA
T7_03935_G02	AAAAAAAAAGGGGAAGGGTCAGGGGAAGAAGGGAGG
T7_03936_G02	GGGAGGGGAAAGGGAAAGTCAGAAGAAAAAAGGGGA
T7_03937_G02	GGAGGAAAAGAGGAAAAGTCAGGAGGGAAGAGGAGA
T7_03938_G02	GGGAGGGGAGGAAAGAGGTCGAAGGAAAAAGGAAAA
T7_03939_G02	GGGAGGAGGAAAAGGGAGTCGAAAAAGGGGAAAAGA
T7_03940_G02	GAGAAAAGAGGGAAAGGGTCGAGAAGAAGAAGAGGG
T7_03941_G02	GAGGAAAGAAGAAGAGGGTCAGAGGAAAGGGAAGGA
T7_03942_G02	AGAGAGGGGAAAGGAGAGTCAGGAAAGAAAAGGGGA
T7_03943_G02	AAAGGGGAAGAGAAAGAGTCAAGAGGGGAGAGGGAA
T7_03944_G02	GAAGGAGGGAAAGGAGGGTCAGAAAGAGAGAAAGGA
T7_03945_G02	GGGAAGAAAGGGGAAAAGTCGGGGAGAAAAAGGAAG
T7_03946_G02	AGGAAAGGGGAAAAAGGGTCAAAGAAGGAGGGGAGA
T7_03947_G02	AAGGGAAGAGAGGAGGGGTCGAGAAAAAAAGGAAGG
T7_03948_G02	GAGGAAAAGGAGGGAAAGTCAAGAGAAGGAGGGGAA
T7_03949_G02	AGGGAAAGAAGAGGAAAGTCGGAGGAAAGGGAGGAA
T7_03950_G02	AGGGGAAAAAGAGAGGGGTCGAGAAGGGGAAAAAGA
T7_03951_G02	GAAAAGGGAAAAGGGGAGTCAAGGAGAGGGAAGAGA
T7_03952_G02	GAGGGAAAAGGGGAAAAGTCAGAAGGGAAGGAGAAG
T7_03953_G02	GAGAAGGGGAAGGGAAAGTCGAGAAGGGGAAAAGAA
T7_03954_G02	AGAGAAAGGAAAAGAGGGTCAAAGAGGGGAGGGAGA
T7_03955_G02	GGGAGAAGGGGAAAAGGGTCGAAAGGGGAAGAAAAA
T7_03956_G02	GAGAGGAAAAGAGGAAAGTCGAGGGAGGAAAGGAAG
T7_03957_G02	AGGGAAGGGAAAGAAAAGTCGAGAGGAAGGGAGGAA
T7_03958_G02	GAGGGAAGAAAGGAAGGGTCGAAGAAGAGAGGAAAG
T7_03959_G02	AAGAGAGGAGAAGAAGGGTCGGAGGAGGAAAAGAGA
T7_03960_G02	GAGGAAGGAGGAAGAAAGTCAGAAGGGAAAGGGGAA
T7_03961_G02	AAGAAGGGGAAAGGGAAGTCAAAAGGAGGGAAAGGG
T7_03962_G02	GAGAAGGGAAGGAAAGAGTCGGAGGAAAAGGGAAGA
T7_03963_G02	AGGAGGGGAAAGGAAAAGTCGGAGGAAGAAGAAGGA
T7_03964_G02	GGGAGAAGGGGAAGAGAGTCAAAAGAAGGAAGGAGA
T7_03965_G02	GAAAAGAAGAGGGAGGAGTCAGAAGGAGAAGGAGAG
T7_03966_G02	AAAAGAAGAGAGGAAAGGTCAGGAGGGGAGAGAAGG
T7_03967_G02	AGAAAAAAGGGGAAAGAGTCGAAAGGGGAGGGGAGA
T7_03968_G02	AAGGAGGGAAGGGGAAAGTCGAGGAGGAGAAAGAAA
T7_03969_G02	GAGGAAAAGGGGAAAGAGTCAGGGAGGGAAAAAGGA
T7_03970_G02	GAGGGAAGGAGAAGAAGGTCAAAGGGAAAAGGAAGG
T7_03971_G02	GAGGAGGGGAAGAGAGGGTCAAAAAAGAAGGGAAAG
T7_03972_G02	AAGGGAAAAAGAGAAGAGTCGGAGAGGAGGAGAGGA
T7_03973_G02	AGGGAGAAGGGAAGAAAGTCAAAGGGAGAGGAAGAG
T7_03974_G02	GAAAAAGGAGAAGAGAGGTCGAAGGAAAGAGGAGGG
T7_03975_G02	GGAAAAGGGGAGAAGAAGTCGGAAAAGGGAGGAAGA
T7_03976_G02	GAAAAAGAAGAGGGAGAGTCAGGAGGAGGAGAAAGG
T7_03977_G02	GGAAGAGGGAAGAGAAGGTCAAAAGAGGGGAGAAAG
T7_03978_G02	GAAAAAAAAGGAAGGGAGTCGAGGGGAGAGGAAAGG
T7_03979_G02	GGGAAGAAGAAAGGGAAGTCAGGGAAAAGAAGAGGG
T7_03980_G02	AAAGGAAGGGGAGGGGAGTCGAAAAGAAAGGGAAGA
T7_03981_G02	GGGAGGGAAAGGGAAAAGTCGAAGAGGGGAGAAAAA
T7_03982_G02	AAAGGAAGGAAGGGAGGGTCAAAGAAGAAAGGAGGG
T7_03983_G02	AGGAAAAGAGAGGGAGAGTCGAGAAAGGAAAGGGAG
T7_03984_G02	GGAGGAAAGGAGGAAAAGTCGGGAAGAAAAGAAGGG
T7_03985_G02	AAGGAGAAGGAAGGGAGGTCGAAGGGAAGGAAAAGA
T7_03986_G02	GGGAGAAAGGAAAAGGGGTCGAGGAAGGGAAAAAGA
T7_03987_G02	AAAGGAGAAGGGAGGAAGTCGGAAAAAGAGAGGAGG
T7_03988_G02	GAAGGGGAAAGGGGAAAGTCAAAGAGGAAAAGGAGG
T7_03989_G02	AAGGAAAAGAGAGGGAGGTCAGGAAAGGGAAAGGGA
T7_03990_G02	AGAAGGGAAAAAGGGGAGTCAGAGGGAAAGGAGGAA
T7_03991_G02	AGGGAGAAGGAAGAAGAGTCGAGAGAGAGAGGGAAA
T7_03992_G02	GGGAGAGAAAAAGGGAGGTCGGGAGAAGAAAAGAGA
T7_03993_G02	GGGAGAAAGAGAAGGAGGTCAAAGGAAGGAAGGGAA
T7_03994_G02	AGGAGGAGGAAAAAGGAGTCGGAAGAGGGAGAAAGA
T7_03995_G02	AAGGGGAGGGAGGGGAAGTCGAGAAAGGAAAAAGAA
T7_03996_G02	AAAAAAGGAGAGAAGGGGTCGAGGAAGGGAAGGGAA
T7_03997_G02	AAGGGAGGAGGGGAAGAGTCAAAGAAAAGGAAGGAG
T7_03998_G02	AAGGGAAGGAAAGGAAAGTCAAGGGAGGGAGAAGAG
T7_03999_G02	AGAAAGAAAGGGAAGGGGTCAAGGGGAGAGAAGAGA
T7_04000_G02	GAAAAGAGGAGGGGAAAGTCAGAAAGGGGAGGAGAA
T7_04001_G03	CCTTTTTTTTCCTTCCCGTCTTTTCCCCTCTTCCCC
T7_04002_G03	CTTTTTTCCCCTTTCCCGTCCTTTTTCCCCTTTCCC
T7_04003_G03	TTCCCCTCCCCTTTTCCGTCCTCCCCTTTTTTTTTC
T7_04004_G03	TTTCCCCTCCCTTTTCCGTCCTCCCCTTTTCCTTTT
T7_04005_G03	TTTCCCTTTTTTTTTCCGTCCCTTCCTCCCTTCCCC
T7_04006_G03	CCTTCCCCTTCCCTTTTGTCTCCCTCTTTTTTTCCC
T7_04007_G03	CCCTCCCCTTTTTTTTTGTCTCCCTCCTCCCCTTTT
T7_04008_G03	TCCCTCCCCTTTCCTTTGTCTTTTTCCCTTTCCTCC
T7_04009_G03	CTTTTTTCCTTTTCCCCGTCTTCCCCTTCCCCTTTC
T7_04010_G03	CTCCCTTTTCCCCTTTTGTCTTCCCCTCTTCCCTTT
T7_04011_G03	CCTTTTTTTTTTCCCCTGTCTTCCCCTTCCCTTCCC
T7_04012_G03	TCTTTTTTCCCTCCCTTGTCTTTCTCCCCTTTCCCC
T7_04013_G03	CCTCCCTTTTTTTTTCCGTCTCCCCTTTCCTTTCCC
T7_04014_G03	CCCTTTTTTTTTCCTCCGTCCCTTCCCTTTCCCCTT
T7_04015_G03	TTTTTTTTTCTCCCCTTGTCCTCCCTTTCCCCTCCC
T7_04016_G03	TTTTCCCCTTTTCCCTTGTCCCCTTTCCTCCCTTTC
T7_04017_G03	TTCCTTCTCCCTTTTTCGTCCCTTCCTTCCCTCCTT
T7_04018_G03	TCCCCTCCTTTTTTTCCGTCTTTTTTCCCCTTCCCC
T7_04019_G03	CCTTCCCTCCTTTTTTCGTCCTTTTCCCTCCCCTTT
T7_04020_G03	CTTCCCTTCCCCTTTTTGTCTTTTCCCTTCCTTCCC
T7_04021_G03	CCCTTTCCCCTTTTTTTGTCTTCCTTTCCTCCTCCC
T7_04022_G03	CCTTTTTCCCCTTTTTTGTCTTCCCCTCCTTTCCCC
T7_04023_G03	TTTTTTCCTTTTCCCTCGTCCCCTCCCCTTTTTCCC
T7_04024_G03	TCCCCTCCCCTTTTTTTGTCTCCCCTTTTTTTCCCC
T7_04025_G03	CCTTTCCTTTTTTTTCCGTCCTCCCCTTTTCTCCCC
T7_04026_G03	TTTCTCCTCCCTTTTTCGTCCCTTTTCCCTCCCCTT
T7_04027_G03	TTTTCCTTTTTCCTCCCGTCTTTCCCCTCCCCTTTC
T7_04028_G03	CCCTCTTTTCTTTTTCCGTCCCTTTTCTTCCCCTCC
T7_04029_G03	TTTTCCCCTTCTTTTCCGTCCCTCCCCTTTTCCCTT
T7_04030_G03	CCTTTTTTCCCCTTCCCGTCTTTTCCCTTTCCTTCC
T7_04031_G03	CCCTTTCCCCTTTCCCCGTCTTCCCTTTTTTTCCTT
T7_04032_G03	TTTTTTTCCCCTTTTCTGTCTCCCCTCCCCTTTCCC
T7_04033_G03	CCCTCCCTTTTCCTTTTGTCTTTCCCCTTTTTCCCC
T7_04034_G03	TCCCTCCCTCCCCTTTTGTCTTCCCTTTTTTTTCCC
T7_04035_G03	TTTCCCCTTTTTTTCCCGTCCTTCCCCTTTTTCCCC
T7_04036_G03	TTTTCCCCTCCTTCCCCGTCTTTTCCCTTTTTCCTC
T7_04037_G03	TTTTTCCCCTCCTCCCTGTCTTCCCTTTTCCCCTTT
T7_04038_G03	TTCCTTCCCTTTTTCCCGTCCTTTTTTTCCCTCCCC
T7_04039_G03	CCTCCCCTTTCCCCTTTGTCTTTTTTCCTCCCCTTT
T7_04040_G03	CCCTTTCCCTTTCCCCTGTCTTCCTTTCCCCTTTTT
T7_04041_G03	TCCCCTTTTCCCCTTTTGTCTTTCCTTTCCTCCTCC
T7_04042_G03	TTTTCCCCTCCCCTTCTGTCTTCCCTTTTTTTCCCC
T7_04043_G03	TTCCCCTTTCTTTCCCCGTCTTTCCCTTTCCCTTTC
T7_04044_G03	TTTTCCTCCCTCCCCTTGTCTTCCCTCCTTTTTCCT
T7_04045_G03	CTTTTTTTTTTCCCCTCGTCCCCTTTTTCCCTCCCC
T7_04046_G03	CCCTTTTTTTTTCCCCTGTCTTTCCCCTCCTTTCCC
T7_04047_G03	TTCCCCTCCTCCCTTTTGTCTTTTTTTCCTCCCTCC
T7_04048_G03	TTTTCCCCTCCCCTTTCGTCCCTCCCCTTTTTCTTT
T7_04049_G03	TTTTCCCTCCCCTTCCCGTCTTTTCCCCTTTTTCCT
T7_04050_G03	CCCTTTTTTTTTCTCCCGTCCTTCCCCTTCCCTTCT
T7_04051_G03	CCCTTTTCCCCTCCCCTGTCTCCCTTTTTTTTTTCC
T7_04052_G03	CCCTTTTTTTTTTCCCCGTCTCCCTTTTCCTCCCCT
T7_04053_G03	TTCCTTTTCCCTTTTTTGTCCCCTTTTCCCCTCCCC
T7_04054_G03	CCCTCCCTCCTTTTTCCGTCCCTTTTTTTCCCCTTT
T7_04055_G03	CTCCCCTCCCCTTTTCCGTCCTTTTTTTTTTTCCCC
T7_04056_G03	TTCCCCTCTTCCTTCCCGTCCTTTTTCTTTTTCCCC
T7_04057_G03	TTTTTTTTCCCTTCTCCGTCCCTTTTCCCCTTCCCC
T7_04058_G03	CCCTTTTTCCCCTTTTTGTCTTTCCCCTCCCTTTCC
T7_04059_G03	CTCCTCCCTTCCCCTTTGTCCCCTTTTCTTTTTTCC
T7_04060_G03	TTTTCCCCTTTTCCCCTGTCTTTTCCCCTTTCCCCT
T7_04061_G03	CCCTTCCCTCCCCTTTTGTCCCTCCCTTTTTTTTCT
T7_04062_G03	TTTTTTTCTCCCTTCCCGTCCTTTTTCCCCTTCCCC
T7_04063_G03	TTTTCCCCTTCCCCTTCGTCCCCTTTTCCCTTTTTC
T7_04064_G03	TCCCCTCTTTCCCTTTCGTCCCCTCCCCTTTTTTTT
T7_04065_G03	CCTTTTTTCCCCTCCCTGTCTTTTTTTCCCCTCCCT
T7_04066_G03	TTCCCTTTCCTTTTTTCGTCCCTTCCCCTTTTCCCC
T7_04067_G03	CCCTCCCCTTTTTTTTTGTCTCCCCTTTCCTTTCCC
T7_04068_G03	CCTTTTTTTCCCCTCCCGTCTTTTTTTTCCCTCCCC
T7_04069_G03	TTCCCTTTCCCCTTTTTGTCTTTTTCCCCTCTCCCC
T7_04070_G03	CCCTTTCTTTCCTTTTCGTCCCTTTTCCCCTTTCCC
T7_04071_G03	CCCTTTTTTCCCCTCCCGTCCTTTTTTTCCTTTCCC
T7_04072_G03	TTTTTTTCCCTCCCTCCGTCTTTCTCCCTTTCCCCT
T7_04073_G03	CCTCCCTTCCCTCCTTTGTCTTTCTTTCCTTTTCCC
T7_04074_G03	CCCTTCCCCTTTTTTTTGTCCCCTTCCCTTTTTCCC
T7_04075_G03	TTCCCTTTTTTCCCCTTGTCCTTTTTTCCCCTCCCC
T7_04076_G03	CCCTTCCCCTTCCCTTTGTCTCCCCTTTTTTTTCCT
T7_04077_G03	TTTTTCCCTCCCCTTTCGTCCCTTTTCCTTTTCCCC
T7_04078_G03	CCCTTTCCCTTTCCTTCGTCCCCTTTCCCCTTTTTT
T7_04079_G03	TCCCCTTTCTTTTTCCCGTCCTTTTTTCCCTTCCCC
T7_04080_G03	TTTCCCCTTTTTTCCCCGTCTTTTTCCCCTTCCCCT
T7_04081_G03	CTTCCTTTCCCCTTTCTGTCTTTCCCCTCCCCTTTT
T7_04082_G03	TCCCTTCCCTTTCCCCTGTCTTTCCCTTTTTTTCCC
T7_04083_G03	CCTTTCCTTTTTCCCTCGTCCCTCCCCTCCTTTTTT
T7_04084_G03	CCTTTTTCCTCCCCTTTGTCTTTTTCCCCTTTCCCC
T7_04085_G03	TTTTTTTTTTTCCCCTCGTCCCTCCTTTCCCTCCCC
T7_04086_G03	TTTTCCTTTTTTCCCTCGTCCCCTTCCCCTTTTCCC
T7_04087_G03	CCTTTTTCCCTTTTCCCGTCTCCCCTTTTTTTCCCC
T7_04088_G03	CCCTTTTTTTTCCCCTCGTCCTTTCCCTTTTTCCCC
T7_04089_G03	TTCCCTTTCCCTTTTCCGTCCTTCTCCCCTTTTTCC
T7_04090_G03	TCCCCTTTTTTTTCCCCGTCTTTCCCCTTCCTTTCC
T7_04091_G03	TCCCTTTTTCCCTCCCCGTCTTTTTTTTCCTTCCCC
T7_04092_G03	TTTTTCCCCTCCCCTTTGTCCCCTTTTTCCCTCCTT
T7_04093_G03	TTTTTCCTTCCTCCCCTGTCCCCTCCTTTTTTTCCC
T7_04094_G03	TTTTTCCCCTTTTTCCCGTCTCCCCTCCCCTCTTTT
T7_04095_G03	TTTTTCCCTTTTTCCCTGTCCCTCCTCCCTTTCCCT
T7_04096_G03	TTTTTCCCTTTTTTTCCGTCCCTCCCTTCCCTTCCC
T7_04097_G03	CCCTTCCCCTTTTTTCCGTCCTTCCCTTTCTTTTCC
T7_04098_G03	CCTTTTCCCCTCCCCTTGTCTTCCTTTTTTTTCCCC
T7_04099_G03	TTCCCTTTCCCCTTTTCGTCCCTCCTTTTTTTCCCC
T7_04100_G03	CCCTTTTTTTTCCCTCTGTCTCCCTTCCTCCCCTTT
T7_04101_G03	CCCTCCCCTTTTTTTTTGTCTTCCCTTCCCTTTCCC
T7_04102_G03	CCCTTTTTTTCCTTCCCGTCCTTCCCTTTTTTCCCC
T7_04103_G03	CTTTTTTTCCCTCCCCTGTCTTCCCCTTTTTTCCCC
T7_04104_G03	TTTTTCCCCTTTCCCTTGTCCCCTCCCCTTTTCTTC
T7_04105_G03	CCTCCCCTTTTTTCCCCGTCTTTTCCCCTTTTTCCT
T7_04106_G03	TTTCCCTCCCTTTCCTTGTCTCCCCTTTTTCCCCTT
T7_04107_G03	CCTTTCCCCTCCTTTTTGTCTTTCCCCTTTTTCCCC
T7_04108_G03	TTTTTTTTCCCTCCCTTGTCTCCCCTTTTCCCTCCC
T7_04109_G03	CCTTTTTTCCCCTTTTTGTCTTCCCCTCCCCTTTCC
T7_04110_G03	TTCCCCTTCCCCTTTTTGTCTTTTCCCCTTTTCCCC
T7_04111_G03	TCCCCTCCCCTCCCCTTGTCTCCCCTTTTTTTTTTT
T7_04112_G03	CCCTTTTTTTTTCCCCTGTCTCCCTTTCCCCTCCTT
T7_04113_G03	CCCTTTTTTCCTCCCCTGTCTTTTCCCCTTTTTCCC
T7_04114_G03	TTTCCCCTTCCCCTTTTGTCTTTCCCCTTCCCCTTT
T7_04115_G03	TCCCCTTTCCCCTTTTTGTCTTTTTCCCCTTCTCCC
T7_04116_G03	TTTTTTCCCTCCCTTTTGTCCCTTTCTCCTCCTCCC
T7_04117_G03	TCCCTTTCCCCTTTTTCGTCTTTCCCCTTTTTCCCC
T7_04118_G03	CCTCTTTTTCCTTTTCCGTCCCTTTTTCCCCTTCCC
T7_04119_G03	CCCTTTTTTTTCCTTTCGTCCCCTCCCTTTTTCCCC
T7_04120_G03	CCCTCCCTTTCCTTTTTGTCTTTCCCCTTTTCCCCT
T7_04121_G03	CCCTCCCTTTTTTTTTCGTCCTTTCCCCTTTTCCCC
T7_04122_G03	CCCTTTTCCCTTCCCCTGTCTTTCCCCTTTTTTTCC
T7_04123_G03	CCCTTTTTTTTCCTTCCGTCCCTTTTCCCTTTCCCC
T7_04124_G03	TCCCTTTTCTTTTTCCCGTCCTTTTTTCCCCTCCCC
T7_04125_G03	CCCTTCCCTTTTTTTTTGTCTTTTCCCCTCCCTCCC
T7_04126_G03	TCTTTTCCCCTTCTTTTGTCTTCCTTCCCCTTCCCC
T7_04127_G03	CCTTTTTTTCCCCTTTCGTCCCCTCCCTTTCCCTTT
T7_04128_G03	CCCTTTCCCTCCCTTTCGTCCCCTTTTTTTTTTCCC
T7_04129_G03	TTCCCTCCCTCCCCTTTGTCTTCTTTCCCTTTTTCC
T7_04130_G03	TCCCTTTTCCCCTTCTTGTCTTCCCTTCCTTTCCCT
T7_04131_G03	TTCCCCTCCCCTTTTTTGTCCCTCCCTTTTCCCTTT
T7_04132_G03	TCCCCTTTTTTTTTTTCGTCCCCTTTTCCCCTCCCC
T7_04133_G03	CCTTTTTCTTTCCCCTTGTCTTCCCCTCCCTTTCCT
T7_04134_G03	CCCTTCCCTTCCCCTTTGTCTTTTCCCTTTTTTCCC
T7_04135_G03	TTTCCCCTTTTTTTTCTGTCTCCCTCCTCCCTTCCC
T7_04136_G03	CCCTTTTTCCCCTCTTTGTCTTCCTTCCCCTTTCCT
T7_04137_G03	TTTCCCCTTTCCCCTTCGTCCCTCCCCTTTTTCTTT
T7_04138_G03	CCTTTCCCCTTTTTTTTGTCTCCTCTTCCCTTCCCC
T7_04139_G03	CCCTTTCCTTTTTCCCTGTCTTTTCTTCCCTTCCCC
T7_04140_G03	TCCCCTCCCTTTTCCCCGTCTTTTCCTTTTTTCCCT
T7_04141_G03	TCCCCTTTTTTTTTCCCGTCCTTCCCCTTTTTCCCC
T7_04142_G03	CTTTTTCCCTTCCCTTCGTCCCTTCCTTTTTTCCCC
T7_04143_G03	CCCTTTCCCTCCCCTTTGTCTTTTTTTTCCTTCCCC
T7_04144_G03	TTCCCTTTCCCTTCCTTGTCTTTTCCCCTTTTCCCC
T7_04145_G03	TTCCCCTTTTTCCCCTTGTCTTCCCCTTTCCCCTTT
T7_04146_G03	CCCTTCCCCTTCCCTTTGTCTTTCTTTCTTTTCCCC
T7_04147_G03	CCCTTTTTTTTTCCCTCGTCCCTTCCCTTTTTCCCC
T7_04148_G03	CCTTTTTTCCCCTTTCCGTCCTCCCCTTTCCCTTTT
T7_04149_G03	TCCCTCCTTTCCTCCCTGTCTCCTTTTTTTCCCCTT
T7_04150_G03	CCCTCCTTTCCTCCTTTGTCTTTTCCCTTTTCCCCT
T7_04151_G03	CCTCCTTCCCTTTTTTCGTCCTTTCCCTTTTTCCCC
T7_04152_G03	CCCTTTTTCCCCTTCTTGTCTTCCCCTCCTCTTCTT
T7_04153_G03	CCTCCCTTTTTTTTTTTGTCCTCCCCTCCTTTCCCC
T7_04154_G03	TTTTTTTCCCCTCCCCTGTCCCCTTTTTCCCCTTTC
T7_04155_G03	TTTTTTTTTCCCCTTTCGTCCCCTTTCCCCTTCCCC
T7_04156_G03	CCCTTTTTTTCCCCTTTGTCTTTCCCTTTCCTCCCC
T7_04157_G03	TCCCCTTTTCCCCTCCCGTCTTTTTTCCCCTTTTTC
T7_04158_G03	TTTTTTTCCCTCCCCTTGTCTTCCTTTCCCCTTCCC
T7_04159_G03	CCTCCCTTTTCCTTTTTGTCTTTTCCCCTCCCTTCC
T7_04160_G03	TCCCCTTCCCTTTTTCCGTCCCTCTTTTTTCCCCTT
T7_04161_G03	CCCTTTCTTTTTTTTTCGTCCCCTTCCCCTCCCCTT
T7_04162_G03	TCCCTTTCCCCTTTTTCGTCCCTTTTTTTCCCCTCC
T7_04163_G03	CTTCCTTCCCTTTTTTTGTCTTCCCCTCCTTTCCCC
T7_04164_G03	TTCCCCTTCCCCTTCTTGTCTTTTTCCCTTTTCCCC
T7_04165_G03	CCTTTTTCCCCTTTTTCGTCCCCTTTTTTCCCTCCC
T7_04166_G03	CTTTTTTCTTCCCCTCCGTCCTTCCCTTTTTTCCCC
T7_04167_G03	CTTTTTTCCCCTTTCCCGTCTTTTTCCCCTTTCCCC
T7_04168_G03	CCCTTCCCCTTTTTTCCGTCCCTTTCCCTTTTTTCC
T7_04169_G03	CCCTTTCCCCTCTTTTTGTCTTCCCCTTTTTTCCCC
T7_04170_G03	CCTCCTTTTTTTCTCCCGTCCTTTTCCCTTTCCCCT
T7_04171_G03	CCCTCCCTTTTTTTTTTGTCTTCCCTTTCCCCTCCC
T7_04172_G03	CCCTCTTCCCCTTTCCCGTCCTTTTTTTTTTTCCCC
T7_04173_G03	TTTCCTCCCTTTCCCTTGTCTCCCCTTTTCCCCTTT
T7_04174_G03	CCTCTTTTTTTCCCCTTGTCTCCCCTTCCCTCCTTT
T7_04175_G03	TCCCCTTTTTTTTTCCTGTCTTTCCCCTTCCTCCCC
T7_04176_G03	CTTCCCCTTTTTTTTTTGTCTCCCCTCCCTTTCCCC
T7_04177_G03	CCCTCCTTCCCCTCTCCGTCCTTTTTTTTTTTTCCC
T7_04178_G03	TTTTTTCCTTTTCCCCTGTCTCCCCTTCCTTTCCCC
T7_04179_G03	TTTTTTTTCCCTTTCCCGTCCTCCCTTTTCCCTCCC
T7_04180_G03	TCCCCTTCCTTTTTTCCGTCCCTTTCCCTCCCTTTT
T7_04181_G03	CTTCCCTTTTTTTTCCTGTCTTCCCTTCCCCTTCCC
T7_04182_G03	CCTCCCCTTTTTCCTTTGTCTCCCCTTTTTTTCCCC
T7_04183_G03	CCTTTTTTTTTCCCCTTGTCCCTTTCCCCTTTCCCC
T7_04184_G03	TTTCCCCTTTTCCCCTTGTCTCCCTCCCTTTTCCTT
T7_04185_G03	CCTCCCCTTTTTTTTCCGTCTTTTTCCCCTTTCCCC
T7_04186_G03	CCCTTTTTTTTTCCCCTGTCTTTCCTTCCCTCCCCT
T7_04187_G03	TTTTTTTCCCCTCCTCCGTCCTCCCCTTTTTCCCTT
T7_04188_G03	CCCTCTTTTCCCCTTTTGTCTTTTCCCCTTTCCCCT
T7_04189_G03	TTTTTCCTCCCTTCCCCGTCTTTCCCCTTTTCCCTT
T7_04190_G03	TTTTTTTTCCTCCCTTTGTCTCCCTCCCCTTTCCCC
T7_04191_G03	CCCTTCCCCTCCCCTTTGTCTTTCCCCTTTTTCTTT
T7_04192_G03	TTTCCCCTTTTTCCCTTGTCTTTTCCCTTCCCTCCC
T7_04193_G03	TTTTTCCTTTTTTTCCCGTCCTTCCCTTCCCCTCCC
T7_04194_G03	CCTCCTTTTTCCCCTTTGTCTTTCCCCTTTTTCCCC
T7_04195_G03	CCCTTTTTTTTTCTTCCGTCCCTTCCCTCCCTTTCC
T7_04196_G03	CTTTTTCCCTTCCCCTTGTCTTCCCCTTTTTTCCCC
T7_04197_G03	CTCCCCTTCCCTTTTCCGTCCCTTTTTTTTTTCCCC
T7_04198_G03	CCTTTTTTTTTCCCTCCGTCCCTCCCCTTTTTTCCC
T7_04199_G03	TCCCTTTTTTTCCTTCCGTCCCTTTTCCCCTTTCCC
T7_04200_G03	TTCCCTCTTTTTTTTCCGTCCCTTTTCCCCTTCCCC
T7_04201_G03	TTTTTTTCCCCTCCCCTGTCTTCCCCTTTTTCCCCT
T7_04202_G03	TCCCCTTCTTTTCCCCTGTCTTTTCCCTTTTTCCCC
T7_04203_G03	TTTTTTTCCCTTTCCTTGTCCCCTCCCCTTTTCCCC
T7_04204_G03	CCTTCCCCTTCCCCTTTGTCTTTTTTTTCCCTTCCC
T7_04205_G03	TTTCCTCTCTTCCCTTTGTCTTTTCCCTTCCCTCCC
T7_04206_G03	CCCTTCCCTCCTTCCCCGTCTTCCTCCTTTTTTTTT
T7_04207_G03	CCTTTCCCTTCCCTTTCGTCTCTTTTCCCCTCCTTT
T7_04208_G03	CCCTTCTTTCCCCTTTCGTCCCTTTCTTTTTTCCCC
T7_04209_G03	CCTTTTTTCCCTTCCCCGTCTCCCCTTTTTTTCCCT
T7_04210_G03	CTTCCTTTTCCCCTTCCGTCCTTTCCCCTTTTTTCC
T7_04211_G03	TTTTCCCCTTTTTTTTTGTCTCCCCTCCCTCCCTCC
T7_04212_G03	CCTTCTCTTTTCCCCTTGTCCCTCCCTTTTCCCTTT
T7_04213_G03	CTTTCCCCTTCCCTTCCGTCCCTTTTTTTTTTCCCC
T7_04214_G03	CCTTTCCCCTCCCCTTTGTCTTTCCTTCCCCTTTTT
T7_04215_G03	TTTTTTTCCCCTTTTTCGTCCTTTCCCCTCCCTCCC
T7_04216_G03	TCCCCTCCCCTTTTTTCGTCCCCTTTTTCCTTTTCC
T7_04217_G03	CCCTTCCCTTTTTTTTTGTCTTCCCTCCCTTCCCCT
T7_04218_G03	CTCCTTTCTTTCCCCTTGTCTTCCTTTTCCCTTCCC
T7_04219_G03	CCCTTTTTTTTTTCCCCGTCTTCTTCCCCTTCCCCT
T7_04220_G03	TCCCCTTTTCCCTTTCCGTCCCTTTTTCCCCTTTTC
T7_04221_G03	CCTTTCTTTTTCCCTTTGTCCCCTTCCCTTTTCCCC
T7_04222_G03	CCCTTTTTTTTCTCTCCGTCCCTTTCCCTTTTCCCC
T7_04223_G03	TTTTTTTCCCCTTTTTTGTCTCCCCTCCCCTCCCCT
T7_04224_G03	TTTTTCCCTTCCCCTTCGTCCCCTTTTCCTTTTCCC
T7_04225_G03	TTCCTTTTTCCCCTTTCGTCCCCTTTCCTTTTCCCC
T7_04226_G03	CCCTTTTTTTCCCTTTCGTCCCTCCCCTTTTTTCCC
T7_04227_G03	CTTCCCCTTCCTTTTTTGTCCTCCTTTCCTTTCCCC
T7_04228_G03	CCCTCCCCTTTTTTTTTGTCTCCTTCCCCTCCCTTT
T7_04229_G03	CCCTTCCTCCCCTTTCCGTCCTTTTTTTTTTTCCCC
T7_04230_G03	CCCTTTCCCCTTTTTCCGTCCCTTTTTTTTCTCCCC
T7_04231_G03	TCCCTTTTTTTTTTTCCGTCCCTCTTCCCCTTCCCC
T7_04232_G03	CTTTTTTTTTTCTTCCCGTCTCCCTTCCCCTTCCCC
T7_04233_G03	CCCTCCCTTCCCCTTTTGTCTTTTCCCCTTTTTTCC
T7_04234_G03	TTCCCCTCCCCTTTCCCGTCCTCTTTTTTTTTTCCC
T7_04235_G03	TTTTTCCTTCCCCTCCCGTCTTTTTTCCTTCCCTCC
T7_04236_G03	TTTTCCCCTCCCCTTCCGTCCCTTTTCCTTTTTTCC
T7_04237_G03	CCCTTCCCCTTTTTTCCGTCCCTTCCCTTTTTCCTT
T7_04238_G03	TCCCTTCCTTTCCTTTCGTCTTTCCCTTCCCCTTTC
T7_04239_G03	TTTCCCTCCCCTTTTTTGTCTTTTCCTCCCCTTCCC
T7_04240_G03	CCCTCCCTCCCTTTTTTGTCTTCCCTTCCTTTCCTT
T7_04241_G03	CCCTTCCTTTCCCCTTTGTCTTCCCTTTTTTTCCCC
T7_04242_G03	CCCTCCCTTCCCTTTTTGTCCTTTCCCTCTTCCTTT
T7_04243_G03	CCCTTTTTTTCCCTTCCGTCTCCCCTTTTCCCTTTC
T7_04244_G03	CTTCCCTCCCCTTTTTCGTCCCCTTTCCCCTTTTTT
T7_04245_G03	TTTTTTTTTTCCCCTTCGTCCCCTTTCCCTCCCCTC
T7_04246_G03	TCCCCTTTTTTTTTTTCGTCCCCTTCCCCTTTCCCC
T7_04247_G03	CCTTTTCCCCTCCCCTTGTCTTTTCCCCTTTTTTCC
T7_04248_G03	TCCTTTCCCCTCCCCTTGTCCCTTTTTTTTTCCCCT
T7_04249_G03	CTTTTTTTTTCCCTTCCGTCCTCCCCTTCCCTCCTT
T7_04250_G03	TCCCCTTTCCCTTTTTTGTCCCTTTTTTCCCCTCCC
T7_04251_G03	TTTTTTTCCCCTTCCCCGTCTTTTCCCCTCCCCTTT
T7_04252_G03	TCCCTCCCTTTTCCCTTGTCTCTTTTCCCCTTCCTT
T7_04253_G03	CTTTCCCCTTCCCCTTTGTCTCCCTTTTTTTTCCCC
T7_04254_G03	TTTTTCCCCTTTTCCCCGTCTTTTCTTCCCCTTCCC
T7_04255_G03	CCTTTTTTTTTTTCCCCGTCTTCCCTCCTTCCTCCC
T7_04256_G03	CCTTTCCCTTTCCCCTTGTCTTTTTCCCTTTTCCCC
T7_04257_G03	TTTCCTTTTTTTCTCCCGTCCTTCCCCTCCCCTTTC
T7_04258_G03	CCTTTTTTTTCCCTTTTGTCCCCTCCCTTTCCCTCC
T7_04259_G03	TTCCTTTTCCCCTTTCCGTCCTTCCCCTTTTTTCCC
T7_04260_G03	CCCTTTTCCTTTTCCTTGTCTTTCCCCTCCTTTCCC
T7_04261_G03	CCCTTTTTTTTTCCCCTGTCTTTCCCTCCTTTCCCC
T7_04262_G03	TCCCCTCCTTTTTTCCCGTCTTTTTCCCCTTTTCCC
T7_04263_G03	CTTTCCCCTTCCCTTTTGTCTTCCCCTTTTTTCCCC
T7_04264_G03	CCCTCCCCTTTCCTTTTGTCTTCCCTTTTTTTCCCC
T7_04265_G03	TTTTCCCCTCCTTTTCCGTCCCTTCCCCTCCTTTTT
T7_04266_G03	TTTTCCCTTTTCCCCTTGTCTTCCCTTTCCCCTTCC
T7_04267_G03	CCTTTCCCTTTTCCCTCGTCTTTTTTTTCCCCTCCC
T7_04268_G03	CCTTTTTTCCCCTTTCCGTCTTTCCCTTCCCTTTCC
T7_04269_G03	CCCTTTTTTTCCCCTTTGTCTTCCCTTTCCTTCCCC
T7_04270_G03	TTCCCCTTTTTTCCCTTGTCTCCCCTCTTTTTCCCC
T7_04271_G03	CCTTTTCCCCTCCCTTCGTCCCCTCCTTTTTTCTTT
T7_04272_G03	CCCTTCCTTCCCTTTTCGTCCCCTTTTTTCCTTTCC
T7_04273_G03	CCCTTTTTTCTTTTCCCGTCCTTCCCTTTTCCTCCC
T7_04274_G03	CTTTTTTTCCCTCCCTTGTCTTCCCTTTTCCTCCCC
T7_04275_G03	CCCTCCTTTCCCTTCTCGTCCCTTTTTTTCCCCTTT
T7_04276_G03	TTTCCCTTTTCCCTCCCGTCCTTTTTTCCTTTCCCC
T7_04277_G03	CCCTTTTTTTTTCCCCTGTCCCCTTTTCCTTTCCCC
T7_04278_G03	TCCTTCCCCTCCCTCCCGTCTTTCCCCTTTTTTTTT
T7_04279_G03	TCCCCTTCTTTCTTTTTGTCTCCCCTCCCTTTTCCC
T7_04280_G03	TCCCTTTCCCTTTTTCCGTCCTTTTCCCCTTTTCCC
T7_04281_G03	CCTTTTCCCCTTTTTCCGTCCTCCCTTTTCCCTTTC
T7_04282_G03	CTTCCCCTTCCCCTTTTGTCTCCCCTTTTTTTTCCC
T7_04283_G03	CCTCTTCCTTTTTCCTTGTCTCCTCCCTTTTTCCCC
T7_04284_G03	CCCTTTTTCCCTTCCCCGTCTCCTTTTTTTTTCCCC
T7_04285_G03	CCCTTCCCTTTTTTCCCGTCTTTTTCCCTTTTCCCC
T7_04286_G03	CCTTTCCTTTCCCCTTTGTCTTTTCCCCTCCCCTTT
T7_04287_G03	CTCCCTCCCCTTCCCCTGTCTTTTTCCCTCTTTTTT
T7_04288_G03	CCCTTTTTTTTCCCTTTGTCTTCCCTCCCCTTTCCC
T7_04289_G03	CTTTTTCCTTTTCCCTTGTCCCCTTTTTCCCCTCCC
T7_04290_G03	CCCTTTTTCCCTTCCCTGTCTTTTTCCCTTTTCCCC
T7_04291_G03	TCCCCTCCCTTTTCCCCGTCTTTTTTTTTTCCTCCC
T7_04292_G03	CCTCCCCTTTTCCCTTTGTCCCCTTTTTCCTTTTCC
T7_04293_G03	TCCCCTTTCCCCTTTTTGTCTCCCCTTTTTTTCCCC
T7_04294_G03	CCTCCCCTTTTTTTCCCGTCTTTTCCCCTTTTCCCT
T7_04295_G03	CTTTCCCCTCCCCTTCCGTCCTCCTTCCTTTTTTTT
T7_04296_G03	CCCTTTTCCTTTTCCCTGTCTCCCTTCCCTTTTTCC
T7_04297_G03	CCCTTTCCCTTTTCCCCGTCTCCCCTTCTTCTTTTT
T7_04298_G03	CTCCCCTTTTCCCCTTTGTCCCCTTTTTTTTTCCCC
T7_04299_G03	CCCTTTTCCCCTCCCCTGTCCTTTCTTTTTTTTCCC
T7_04300_G03	TTTTTCCCCTTTCCCCTGTCTTCCCCTTTTCCCCTT
T7_04301_G03	TCCCCTTTTTTTTTCCTGTCTTCCTCCCCTTTCCCC
T7_04302_G03	CCTTTTTTCCTTTCCCCGTCTCCCCTCCTTTTTTCC
T7_04303_G03	CCTTTTTTTTCCCCTCCGTCCTCCTTTTTTCTCCCC
T7_04304_G03	CCTTTCCCTTTTTTCCTGTCTCCCCTCCTTTTTCCC
T7_04305_G03	TTTCCCCTCCCCTTCCCGTCCTTTTTCCCCTTTTTT
T7_04306_G03	TCCCTTCCCTCCCTTTTGTCTTTTTTTCCCTCTCCC
T7_04307_G03	CCCTTTTCCCTTTTCCTGTCTTCCCCTTTTTTCCCC
T7_04308_G03	TCCCCTTTCCCCTTTTTGTCTTCCCCTTTTTTCCCC
T7_04309_G03	CCTTCCCTTTTTTTTTTGTCTCCCCTTCCTCCCCTC
T7_04310_G03	TTTCCCTTTCCCCTTCCGTCCCTTTTTTTCTTCCCC
T7_04311_G03	TTTTTCCCCTCCCCTTCGTCCCCTTTTTTTTTCCCC
T7_04312_G03	TCCCCTTTTTTCCCCTTGTCTCCCCTTCCTTTCCTT
T7_04313_G03	CCCTTTCCCCTTCCTTTGTCCCCTCCCCTTTTTTTT
T7_04314_G03	CCTCCCTCCCCTTTTTTGTCTCCCTTTTTTTTCCCC
T7_04315_G03	TTTCCCCTTTCTTTTTCGTCCCTTTTCCCCTTCCCC
T7_04316_G03	TTTTCCCCTCCCCTCCCGTCCTCCCCTTTTTTTTTT
T7_04317_G03	CCTTTTTCCTTTCCCCTGTCTTTCCCTTCCTTTCCC
T7_04318_G03	TTCCCCTCCTTCCCCTTGTCTCTTTTTCCCCTTCTT
T7_04319_G03	TCCCCTCCCTTTTTCCCGTCCTCCCTTTTTTTTCCT
T7_04320_G03	TCCCCTTTTTCTTTCCCGTCTCCCTCTTTTTTCCCC
T7_04321_G03	CCCTCCCTTTTTCCCTTGTCTTTCTTTTCCTCCCCT
T7_04322_G03	TTCCCCTTCCTTTCCCCGTCTTTCCCTCTTTTTTCC
T7_04323_G03	CCCTTTTTTTTTCCCTCGTCCCTTTCCCTTTTCCCC
T7_04324_G03	CCCTTTTTTTTTTCCCCGTCTTTCCCTCTCCCTTCC
T7_04325_G03	TTTTTCCCCTCCCTCCCGTCTTTTTCCTTTTCCCCT
T7_04326_G03	TTTTTCCTTTTTCCCCTGTCTTCCCTCCCTTTCCCC
T7_04327_G03	CTTTTCCCTTCCCCTTTGTCCTTCCCCTTTCCCTTT
T7_04328_G03	CCCTTTTTCCTCCCTTTGTCTCCTCCCCTTTTTTCC
T7_04329_G03	CTTCCTTTTTTCCCTTTGTCTTCCTCCCTCCCCTTC
T7_04330_G03	CCCTTTCCCCTTTCCCCGTCTTTTTTTCTTTTCCCC
T7_04331_G03	CCCTTTCCCTTTTTCCCGTCCTTTTTTTTCCCCTCC
T7_04332_G03	CTTTTTCCCTCCCCTTTGTCTTTTTTCCCCTTCCCC
T7_04333_G03	TCCCCTTTTCCCCTTCTGTCTTTTCCCCTTTTTCCC
T7_04334_G03	TCCCCTTTTTTTTTCCCGTCCTTCCCTTTTCTCCCC
T7_04335_G03	TTTTCCCTCCCTTCCCTGTCTCCCTTTTTTTTCCCC
T7_04336_G03	CCCTTTTTTTTCCCCTTGTCTCCCCTTTCCCCTTTC
T7_04337_G03	TTTTTCCTCCCCTTTCCGTCCTCCTTCTTTTTCCCC
T7_04338_G03	TCCCTCCCCTTTTTCCCGTCTCCTTTTTTTCCCCTT
T7_04339_G03	CCTTTTTTCCCCTTCCCGTCCTCTTCTTCCTTTTCC
T7_04340_G03	CCCTTCTTTTCCCCTTCGTCCCTCCCTTTCCTTTTT
T7_04341_G03	CTTTTCCCCTCCCTTCCGTCCCTTTCCCCTTTTTTT
T7_04342_G03	TCTTCCCCTCCCCTTCCGTCCTTTTTTTTTTTCCCC
T7_04343_G03	CTTTTTTCCCTTCCCCTGTCTTCCCCTTTTTTCCCC
T7_04344_G03	TCCCTCCCCTTCCCCTTGTCTTTTTTTTCCCCTTTC
T7_04345_G03	CCTTTTTTTCCCCTTTTGTCTCCCTTTCCCCTTCCC
T7_04346_G03	CCCTCCCCTTCCCCTTTGTCTTTTTCTTTTTTCCCC
T7_04347_G03	CCTTTTCCTTTCCCCTTGTCTTTTCCCCTTTTCCCC
T7_04348_G03	CCCTTCCCCTTTTTCCTGTCTCCTTTTTTCCTTCCC
T7_04349_G03	TTTTCCCTCCCTTCCCCGTCTTTTCCCCTTTTCCTT
T7_04350_G03	TTTCCCCTTTTTCCCCTGTCCCCTTTCCTTTTTCCC
T7_04351_G03	TCTTTTTTTTTTCCCCTGTCTTTCCCTCCCCTCCCC
T7_04352_G03	CCTCCCCTTCCCTTTTTGTCTTTCTTTTCCCCTTCC
T7_04353_G03	TCCCCTTTCCCCTTTTTGTCTTTTTCCCTTCCTCCC
T7_04354_G03	CCTTTTTTTTCCCTTTCGTCCCCTTTTTCCCCTCCC
T7_04355_G03	CCCTCCCTTTTCTCCTTGTCTCCCTTTTTTTTCCCC
T7_04356_G03	TTTTTTTCCCCTCCCTTGTCTCCCTTCCCTTCCCTT
T7_04357_G03	CCTTTTTTTCTCCCTTTGTCTCCCCTCCCCTTTTCC
T7_04358_G03	CTTTTTTCCCCTTTTTCGTCCCCTTTTCCCCTTCCC
T7_04359_G03	CCCTTTTCCCCTTTTCCGTCTTTCCCTTTTTTCCCC
T7_04360_G03	CTTTTTCCCCTTTCCTTGTCTTTCCCCTCCCCTTTC
T7_04361_G03	CTCCTTCCCTTTTTTTCGTCCTCCCCTTTTCCCCTT
T7_04362_G03	CCCTTTTTCCCCTTTTTGTCCCCTTTTCCTTTCCCC
T7_04363_G03	CCCTCCCCTTTTTTTTTGTCTCTTTCCTCCTTCCCC
T7_04364_G03	CCTTTTCCCCTTTCCTTGTCTTTTTTTCCCCTCCCC
T7_04365_G03	TCCCTCCCCTTTTTTTTGTCTCCCCTCTTTTTCCCC
T7_04366_G03	CCCTTCCCCTCCCTTTCGTCCTTTTTTTTTTTCCCC
T7_04367_G03	CCCTTTTTTCTCCTCCCGTCCTTTCCCTTTTTTCCC
T7_04368_G03	TTTTTTCCCCTTTCCCCGTCTCCCCTTTTTTTCCCC
T7_04369_G03	CTTCCTTTCCCCTCCTCGTCCCTTTCCCCTTTTTTT
T7_04370_G03	TTTTTTCCCCTCCCCTTGTCTCCCCTTTTCCCTTTC
T7_04371_G03	CCCTTTTTTCCCTTCCCGTCTTTTCCCTTTTTCCCC
T7_04372_G03	CCCTTTTCCCCTTTCCCGTCCTCCTTTTTTTTTCCC
T7_04373_G03	TTTTCCCTTCCTCCCCTGTCTTTCCCCTCCCTTTTT
T7_04374_G03	CCCTTTCCTTCCCCTTTGTCTTTTCCCCTTCCCTTT
T7_04375_G03	CCCTCCCCTCCTTTTTTGTCTTTTTTCCCTTTCCCC
T7_04376_G03	CTTCTCCTCCCTCCTCCGTCCCTTTTTTTTTTTCCC
T7_04377_G03	TTTTTTTCCTCCCCTCCGTCCCTTTCCCTTTTCCCT
T7_04378_G03	CCCTTTTTTTCTCCCCTGTCTCCCTTTTCCCTTTCC
T7_04379_G03	CCCTTTCCTCCCTTTTTGTCTCCTTTTTTCCCCTCC
T7_04380_G03	CCCTTTTTCCCTTTTTTGTCCCTTCCCCTTTTCCCC
T7_04381_G03	CCCTCCCCTTTCCCTTTGTCTTTTTCCCCTTTTTCC
T7_04382_G03	TTTCCCTTCCTTTCCCCGTCTCTTTCCTTTTTCCCC
T7_04383_G03	TTCCCTTTTCCCTTTTCGTCCCCTTCCCTTTCCCTT
T7_04384_G03	CTTTTCCCCTTTTTTTCGTCCTCCCCTTTCTTCCCC
T7_04385_G03	TTTTCCCCTTTTTCCCTGTCTCCTCCCCTTCCCTTT
T7_04386_G03	CCTTTCCCCTCTTTTCCGTCCCTTCTTTTTTTCCCC
T7_04387_G03	CTCCTTTTCCTTTTTTTGTCCCTTCTCCCCTTCCCC
T7_04388_G03	CCTTTTTTCCCTCCCCTGTCTTTTTTTTCCCCTCCC
T7_04389_G03	CCTTTTTTTCCTTCCTCGTCCCCTCCTTTTTTCCCC
T7_04390_G03	CCTTTCCCCTTCCCCTTGTCTTTTTTTTTCCTCCCC
T7_04391_G03	TCCCCTTTCCTCTCCTTGTCTTTTCCCTTTTTCCCC
T7_04392_G03	CCCTTTCCCCTTTTTTTGTCCCTTTCCCTCCCCTTT
T7_04393_G03	CCTCCCCTTTTCCCCTTGTCTTTCCTTTTCCCCTTT
T7_04394_G03	TCCCCTCTCTTTTTCCCGTCTTTTTCCTTCTCCCCT
T7_04395_G03	CCCTTCCCCTTTTTTTTGTCCTCCCCTTTTTTCCCC
T7_04396_G03	TTTCCTTTCCCCTCCCCGTCTTTCCTTTTTTTCCCC
T7_04397_G03	TTCCCCTCCTTCCCTTTGTCTTTCCCTTTTTTCCCC
T7_04398_G03	CCCTTTTTTCCCTTTTTGTCTCCCTCCCTTTTCCCC
T7_04399_G03	CCTTTCCTCCTTTCCTCGTCCCCTTTTTTCCCCTTT
T7_04400_G03	CCCTCCCCTTTTCCTTCGTCCCCTTTTTTTTTTCCC
T7_04401_G03	TTTTCCTTTCTCTTCCCGTCCTTTTCCCCTTTCCCC
T7_04402_G03	TCCCCTTTTTTTCCCTCGTCTCCTTTCCCCTTCCTT
T7_04403_G03	TCCCTTTTTCCTCCCCTGTCCCTTTCTTTCCTTTCC
T7_04404_G03	CCTTTTTTTTTTTTCCCGTCCTTCCCCTCTCTCCCC
T7_04405_G03	CTTTCTTCTTCCCTTTTGTCCCCTTCCCCTTCCCTT
T7_04406_G03	CTTTTTCTTTTCCCCTTGTCTTCCTTTCCCCTCCCC
T7_04407_G03	TCCCTTTTCTTTTCCCTGTCCCCTTTCCCTTCTTCC
T7_04408_G03	CCCTTTTCTCCTCCTTCGTCCTTTTTTTCCCTTCCC
T7_04409_G03	CCCTCCTCCCTTTTTTCGTCCTTCCCTTTTCTTTCC
T7_04410_G03	CTCTTCTCTTTTTTTCCGTCCCTTCCCCTTCTTCCC
T7_04411_G03	TCTTTCCCTTTCTTCCCGTCTTTCCCTCTTTTCCCC
T7_04412_G03	CTCCTCTCCCTTCCTTCGTCCTTTTTTCCCCTTTTC
T7_04413_G03	CCTTTTCTTCCCTTTTCGTCCTTTTTTCCCCTCCCC
T7_04414_G03	TTCCTTTTTTCTCCCCTGTCTTCCCTTCTCTTCCCC
T7_04415_G03	CCTCCTCTTTTTCCCCTGTCCCTCTTTTTCTCCTTC
T7_04416_G03	CCTTTTTCCTCCCCTTTGTCTCCCCTTTCTTCCCTT
T7_04417_G03	CCCTTTTTTCTTCCCTTGTCCCCTTTCCCTTTTCCC
T7_04418_G03	CCTTTCTTTTTTCCTCCGTCCCTTTCCCTTCCCCTT
T7_04419_G03	CCTCCTCCCTTCCTTTTGTCTTTTTTCCTCTTCCCC
T7_04420_G03	TTTCCTCCCTTTTCCCTGTCCTCCCCTTTTTTTCCC
T7_04421_G03	CCCTTTTCCCTTCCCCTGTCTTTTTTTTTCCCCTCC
T7_04422_G03	TTCCTCCTTCCTCCCTTGTCTTCCTCCTCCTTTCTT
T7_04423_G03	CCCTCCCTCCCCTTTTTGTCTTCTTTTTCCTTCCCT
T7_04424_G03	TTTTTCCTCCTCCTTTCGTCCTCCCTTTCCCTCCTT
T7_04425_G03	CCCTTCTCTCTTTTTTCGTCCCCTCCCCTTTTTTCC
T7_04426_G03	TCCCTTTCTTCCTTCCCGTCCTCCCTTTTTTTTCCC
T7_04427_G03	CCCTCCTTCCTTTCCCTGTCTCTTTCTTCTTTCTCC
T7_04428_G03	TTTTCTTTCTCCTTCCTGTCTCCTTCCCTCTCCTCC
T7_04429_G03	CCCTTTCCTCCCTTTCTGTCTTTCCCTCTTTTTCCC
T7_04430_G03	CCTTTCCTTCTTTTTTCGTCTTTCCTCCCTCCTCCC
T7_04431_G03	CTTTTTTTTTCTTCTTCGTCCCCTCCTCCCCTTCCC
T7_04432_G03	TCCCCTTTTTTCCCTTCGTCCCTCCTTTCCTTTTCC
T7_04433_G03	CCCTTCTTTTCCTCCCTGTCTTTTTTCCTCCCTTCC
T7_04434_G03	CTCCCCTTTCTTTTTCCGTCTTTCCTTCCCCTCCTT
T7_04435_G03	TCCCTCCCTTCTTTTTTGTCCCCTTCCCTTTTTCCC
T7_04436_G03	CCCTTTTTCCTCCTTCTGTCTTTTCCTCCCTTTCCC
T7_04437_G03	TTCCCTTCCCTCTTTTTGTCTTCCCTTTTCCCTCCC
T7_04438_G03	CTCCTCCCTCTTTCCTCGTCTCTCCTTTTTTCCTTC
T7_04439_G03	TTTTTCCCTTTTCCCTCGTCCTTCCCCTCCTTTTCC
T7_04440_G03	CTTTTTTTCCTCCCCTTGTCTTTCTCCCTTCCCCTC
T7_04441_G03	CTTCCCTTTCTTTTTTCGTCCTTCCCCTTCCCTCCT
T7_04442_G03	CCTTTTTCCCTTTTCCCGTCCTTCCTCCCTTCTTCT
T7_04443_G03	TTTTTTTTCTTTTCCCCGTCTCCTCCCCTCCTCTCC
T7_04444_G03	CCTTTCCCTTTCTTTTTGTCTCCCTTCCCCTTTCCC
T7_04445_G03	CCTTCTTTTCTCCCTCCGTCCTCCTTTTTTTTCCCC
T7_04446_G03	TTCCTTTCCCTTTCCCCGTCTCCCCTTTTTTCCCTT
T7_04447_G03	CCCTTTCCCTTTTCCCTGTCCTTCCCCTTTCCTTTT
T7_04448_G03	TTTTTTCCCCTTTTTCCGTCCCTTCCCCTTTCCCCT
T7_04449_G03	CCTTCCCCTCTTTCTTTGTCCCCTTCCTTTCTTTCC
T7_04450_G03	CCCTCCCTTTCCTTTTTGTCTTTCTTTCCCCTTCCC
T7_04451_G03	TTCCTTTTCCCCTTTTTGTCCCTCCCTTCTTTCCCC
T7_04452_G03	CTTTTTCTTCCCTCCTTGTCTCCCCTTTTCTTCCCC
T7_04453_G03	TTTCCCCTCCCCTTCCCGTCTTTTTCTTCCCTTTCT
T7_04454_G03	TTCCCTTTCCCCTCCCCGTCTTCTTTTCCTTTTTCC
T7_04455_G03	TTCCCCTCTTTTTTTCTGTCCCCTCCCTTTTCCCCT
T7_04456_G03	TTCCCTCTTCCCTTTTTGTCTTCCCTCCTCCTTTCC
T7_04457_G03	CCCTTTTTTTCCCCTCCGTCTCTTTCTTTTCCCCTC
T7_04458_G03	TCCCCTTTTCCCTTTTTGTCTTTTCCCCTTCTCCCC
T7_04459_G03	CCTTTTTCCCCTTCCCTGTCCCTTTCTTTTTTCCCC
T7_04460_G03	CCCTTTCCCTCCTTTCCGTCCTTCCCTTTTCTTTTC
T7_04461_G03	CTTTCCCTCCTTCCCCTGTCTTCCTTCTCTTTTCCT
T7_04462_G03	TCCCCTCCCCTCCCCTTGTCTTTTTTTTTTCCCTTC
T7_04463_G03	CTTTCCCCTTTCCCTTTGTCCCCTTTTTCCTCCCTT
T7_04464_G03	TTTCCTCCCTTTTTTTCGTCTTTCCCTCCCCTTCCC
T7_04465_G03	TCCCTTCTTTCCTTCCTGTCCCCTTTCTCTTTCCCT
T7_04466_G03	TTCCTTTTTTTTCCCCTGTCCTTTCCCCTTCCCTCC
T7_04467_G03	CCCTTTTTTTTTTTCCCGTCTTCCTCCCTCCCTCCT
T7_04468_G03	CCCTTCCCTTTCCTCCCGTCCTTTTCCTCTCTTTTT
T7_04469_G03	CTTTTCCCCTTCCTTCCGTCTCCTTTTCCCTTTTCC
T7_04470_G03	TCTCCCCTCCCCTTTTTGTCTTCCCTTTTTTTCCCC
T7_04471_G03	CCTCTTTTCTTCCTTCCGTCTTTTTCCCCTTCTCCC
T7_04472_G03	TTTCTTCCTTTCCCCTTGTCCTTTTCCCCTCTTCCC
T7_04473_G03	TCCCTTTCCCCTTCCCCGTCTTTTTTCTTCCCCTTT
T7_04474_G03	TTTCCCCTTTCCTTTTCGTCCTTCCTTCCTTTCCCC
T7_04475_G03	TTTTTTCCCCTTCCCCTGTCTCCCCTTTCTTTCCCT
T7_04476_G03	CTCCCCTCCCTCCCTTTGTCTCTTTTTCCCCTTTTT
T7_04477_G03	TCCTTTTCCCTCCTTCCGTCCCTTCTTTTCTTCCTC
T7_04478_G03	CCCTTCCCTCCCCTTTTGTCTTTCCTTTTTTCCTCC
T7_04479_G03	TTCCCTTTCCCCTTTTTGTCTTCTTCCCTCCTTCCC
T7_04480_G03	TTTTTCCCTTTTCCTTTGTCTCCCTTTCCCCTCCCC
T7_04481_G03	CCCTTTTTCCCCTTTTTGTCCCCTCTTTCTTCCCCT
T7_04482_G03	CCCTCCCCTTTTTTTTCGTCTCTTCCCTTTCCCCTT
T7_04483_G03	TTTCCCCTCCCTTCCTCGTCCCCTTTTTTTTCCCTT
T7_04484_G03	CCCTCTCCCCTTTTTTTGTCCTTTTCCTTTCCCTCC
T7_04485_G03	TTCCCTCCCTCCTTCCCGTCTTTTTTTTTTCTCCCC
T7_04486_G03	CTTTCCCTTCCTCTTCCGTCTTTTTTCCCCTCCCTT
T7_04487_G03	TTTTTTTTCCCCTCCTCGTCTCTCCTTTCCTTCCCC
T7_04488_G03	TTTCCTCCCTCCCCTTTGTCTTCCCCTTTTCCCTTT
T7_04489_G03	CTCTCCCTTTCCCTTTTGTCCTCCTCCTTCTTCTTC
T7_04490_G03	TCCCTCCTCCTCCCTTTGTCCCCTCTTTTCCTTTTT
T7_04491_G03	CCTTCTCCTTTCCTTCTGTCTCCCTCCCCTTTTTTC
T7_04492_G03	CCCTCCCCTTTTTTCTCGTCCCTTTCCTCTTTCCTT
T7_04493_G03	TCCTTTTTCCCTTTCCTGTCTCCCCTTCCTTTTCCC
T7_04494_G03	TCCCCTTTTTCCCTTTTGTCTTCTTTCCCCTTCCCC
T7_04495_G03	CTTCCTTTTCCCTTTTCGTCCTCCCTTTTTCCTCCC
T7_04496_G03	CCTTTCCCTTTTTCCCTGTCTCCTCTTTCTCCCTTC
T7_04497_G03	CCTTTTCCCCTCCTTCTGTCTTCCCTTTTCCCCTTT
T7_04498_G03	TTCCTTCCCCTTTCTTCGTCCCCTTTTCCTCCTTTC
T7_04499_G03	CTCCCTTTTTTCCTTTTGTCCTCCCTCCCCTTTTCC
T7_04500_G03	TTTCTTTCTTCCTTCTTGTCTCCCTCCCCTTTCCCC
T7_04501_G03	CCTTTTTCCCTTTCTTCGTCCCTTTTTCTCCTCCCC
T7_04502_G03	TTCCTCCTCTCCCCTTTGTCCCCTTCTCTTCCTTTT
T7_04503_G03	TCCTTTCCTTTCCCCTCGTCCTTCCTTTTTCCTTCC
T7_04504_G03	CTTCCCTCCCTTCCTCCGTCCCTTTTTCCCTTTTTT
T7_04505_G03	CCCTTTTTTCCCTCCTTGTCTTTTCCTTCCCCTTCC
T7_04506_G03	TTCCCTTTTTTCCCTCCGTCCCTCTTTCCCTTTTCC
T7_04507_G03	CTCTTCCCTTTTTCCTTGTCCCTTCCCTTCCTTCCT
T7_04508_G03	CCTTCCCCTTTTTTCCCGTCCTCTTCCTCCTTCTTT
T7_04509_G03	CCCTTTCCTTTCCCTTCGTCTTTTCCCTTTTCCCCT
T7_04510_G03	CCCTCCTTTTCCCCTTTGTCTCCTTTCCCTTTCTCT
T7_04511_G03	TTTCCCCTTCTCCCCTCGTCCCCTTTTTTCCTCTTT
T7_04512_G03	TCCCCTTTCCTCCTTCTGTCCCCTCTTTTTTCCCTT
T7_04513_G03	CTTTTCCCCTTTCCTCCGTCCCTTTCCCCTTTTTTC
T7_04514_G03	TCCCCTCCTTTTTTTCCGTCCTCCCTTTTTTTCCCC
T7_04515_G03	TCTTCCCCTTTCCCTTCGTCCCCTTTTCCCTTTCTT
T7_04516_G03	CCCTTCTTTCCCTCCCTGTCTTTTCCCCTTTTCTCT
T7_04517_G03	TCCTCTTTTTCCCCTCCGTCCCTTTTTTTCCCCTCT
T7_04518_G03	TCCCTTTCCCCTTCCTTGTCCCTCCTTTTTTTTCCC
T7_04519_G03	CCTTCCCTCCCTTTTCCGTCCCTTTCTTTTCTCTCT
T7_04520_G03	CCTTTTTTTTCCCTCTTGTCCCCTCTTTCTCCCTCC
T7_04521_G03	TCTCCCCTTTTTTTCCTGTCCCTCCTCCTCTTCCTT
T7_04522_G03	CCTCCCTTTTTTTTCCCGTCTCCTCCTCCTCTTTTC
T7_04523_G03	CTCCTCCCCTTCCCCTTGTCTTCTCCTTTTTTCCTT
T7_04524_G03	CCCTTTTTCCCCTTCCCGTCTTCCCTTTTTTTTCCC
T7_04525_G03	TTTTTTTCCCCTCCCCTGTCTCCCCTTTCCTTCCTT
T7_04526_G03	TTTTCTCTCCCTCCCTTGTCTTTCCCTCTTTCTCCC
T7_04527_G03	TCTTTCCCCTTCCCTTTGTCTCCCTTTCCCCTTTTC
T7_04528_G03	CTCCCCTCCCTTCTCCTGTCTTTTTTCCCCTCTTTT
T7_04529_G03	TTCTTTCCCTTCCCTCCGTCCCTCTTTTTTTCCTCC
T7_04530_G03	TCTTCCCTTTTTCCCTTGTCTTCCTTCCCCTTTCCC
T7_04531_G03	TCCCTTCTTCCTTCCCTGTCTCCCCTTTTCTTTTCC
T7_04532_G03	CCTTCCCCTTTTCCTCCGTCCCTTTTCCCTTTTTTC
T7_04533_G03	CCCTTCCCCTCCCCTTTGTCCCTCTTTTTTCCTTTT
T7_04534_G03	CTCTTTTCCCTTTCCCTGTCCTTTTCCTTCTTCCCC
T7_04535_G03	CCCTTTTTCCCTTTTCTGTCTCCCTTCCTTTCCCCT
T7_04536_G03	TTTCCTCCTTCTCCCCTGTCTTTCCCCTCCCTTTTT
T7_04537_G03	TTTTTCCCTCCTTCTTTGTCTCCCCTTCCCTTTCCC
T7_04538_G03	CCCTTCCCTCTTCTTCCGTCTCCCTTTTTTCCTTCT
T7_04539_G03	TTTTTTCCCCTTCCCTCGTCTTCTTTCCTTCCCCTC
T7_04540_G03	CCTCCCCTTTCCCCTCTGTCTTTCCTTTTTTTCCCT
T7_04541_G03	CCCTTTTTTCCCCTTTTGTCCCCTCCTTCCCCTTTT
T7_04542_G03	TTTTCCCCTTCCCTTTCGTCCCTTTCTCCCTTTTCC
T7_04543_G03	TCCCTTTTTTCTCCCCTGTCCTCCTTCCTTCCTTTC
T7_04544_G03	TTTCCCCTCTTCCCTTCGTCCCCTTTTTTTCCCCTT
T7_04545_G03	TCCCTTCCCTTTTTTCCGTCCCTTTTTTCCCCTTCC
T7_04546_G03	CCCTTTCCTCCCTTTTTGTCTTTTCCCCTCTTCCCT
T7_04547_G03	TCTTCCCCTCTTCCTCTGTCTTCCCCTTTTTTCTCC
T7_04548_G03	CCTTCCTTTTTTTCCTTGTCTCCCTTTTCCCTCCCC
T7_04549_G03	TCCCCTTCTTCCCCTTTGTCTTTCCTCTCTTTCCCT
T7_04550_G03	CCTTCCCCTCCTTTTTCGTCCTTTTCTCCTTTTCCC
T7_04551_G03	CTTTTCCCCTTTTTTTTGTCTCCCTTCCCTCCCTCC
T7_04552_G03	CCTTTTTTTCCCCTTCCGTCTTTCCCTCCCCTCTTT
T7_04553_G03	TCCCCTTTTTTCCCTCCGTCCCTTTTTCCCTTTTCC
T7_04554_G03	TCCCTTCCCCTTTTTTTGTCCCCTCTTCTTTTCCCC
T7_04555_G03	CTTCTCCTTCCTTTCCCGTCCTTTTTCCCTCCCTTT
T7_04556_G03	TTTTCCCTTCCTCCTTTGTCTTTCTCTCCCCTTCCC
T7_04557_G03	CTCCCCTCCTTCCCTTTGTCTTTTTTTTCCTTCCCC
T7_04558_G03	CCCTTTCCCCTTTTCTCGTCCCCTTTCTTCCCTTTT
T7_04559_G03	TTCCTTCCCTCCCCTTTGTCTTTCCCCTTTTCCCTT
T7_04560_G03	TTTCTTCCCTCCCTTTTGTCTCTCCTCCCTTTCCCT
T7_04561_G03	CTTTCCCCTCTTTCCCTGTCTTTTTTCCCTTTCCCC
T7_04562_G03	CCCTTTCCTTTTTTCTTGTCCCTTTCCCCTCCTTCC
T7_04563_G03	TTCCCCTCCCTTTTCCCGTCTCCTTCTTTTCCCTTT
T7_04564_G03	CCCTTTTTCCCTCTCCCGTCTCCCCTTTCTTTTCTT
T7_04565_G03	CTCCCCTCTCCCTCCCTGTCTCCTTCTCTTTTTTTT
T7_04566_G03	CCTTTCTTTCCCCTTTTGTCTCCTTCCTCTCTTCCC
T7_04567_G03	CTCCCCTCCTTTCCTTCGTCTTCCCCTTTTTTTTCC
T7_04568_G03	TTTCCCCTTTTCTTCCTGTCTTTCTCCCTCCTTCCC
T7_04569_G03	CTCTTTCCCTTTTTTTTGTCCCTTCCCCTCCCCTTC
T7_04570_G03	CCTTTCCCCTTTCTCTCGTCTTTTCCCTTTTTCCCC
T7_04571_G03	TTCCCCTTTTTCTCCCTGTCTCTCTTTTTCCCCTCC
T7_04572_G03	TCCCTTTCTCCCTTTCCGTCTTTTCCCTTTTCCTCC
T7_04573_G03	CTTTTTTTCCTTCCTTCGTCTCCCTTCCCCTCCCTT
T7_04574_G03	TCCCTTTTTTTTCCCCTGTCTTCCCTTTCCCTCCCT
T7_04575_G03	TTTTTTCCCTCCCCTTCGTCCCTTTTCCCTTTTCCC
T7_04576_G03	CCCTCCCCTTTTCCTTTGTCTTCCTTCCCTCTTTTC
T7_04577_G03	CCTTTTTTTCCCTTTCCGTCCTTTCCCTCCTCCCTT
T7_04578_G03	CTCTTTTTTCCCCTTCCGTCCCTCCCCTTTCCTTTT
T7_04579_G03	CCCTTTTTTTTCCTCCTGTCCCCTTTCCCTTTTCCC
T7_04580_G03	TTCCCTTTTTTTCCCTTGTCTCCCTTTCTCCCTCCC
T7_04581_G03	TTTCCCCTTTCTTTTCCGTCTTTCCTTCCCCTCCCT
T7_04582_G03	TTCCTTTCTTTCCCTTCGTCCCCTTTCTTTCCTCCC
T7_04583_G03	CCCTTCCCTCCTCCCCTGTCTTTTTTCCTTTTTTCC
T7_04584_G03	CCTCTCCCCTTTTTTCTGTCCCCTCCCCTTTTTTTC
T7_04585_G03	TTCCTTTTTCCCCTCTCGTCCCTTCCCTTTTCCCTT
T7_04586_G03	TTTTTTCCCTTCCCCTCGTCTCCCCTTTTCCCCTTT
T7_04587_G03	TTCCTTTTTTTTTTCCCGTCTTTCCCTCCCCTCCCC
T7_04588_G03	TCCTCCTTTTTTCTTCCGTCCCTTCTCCCCTCCTTT
T7_04589_G03	CCCTTTTTTTTTTCTCCGTCCCTCCTCCCCTCCTTT
T7_04590_G03	CCTCTTCCCCTTTTTTTGTCTTCTCTTTCCCCTCCC
T7_04591_G03	CCTTTCTTTTCTTCTTCGTCTTCCCCTCCCTTTCCC
T7_04592_G03	CCCTTTTTCCCTTTTTTGTCTCCCCTTTCCCTTCCC
T7_04593_G03	TTCCCCTTTTTTCCTTTGTCCCTCCCCTTTCCTCTC
T7_04594_G03	CCCTTTTCTTTTCCTCCGTCTTTCCTTCCCTTTCCC
T7_04595_G03	TTTTCCTCCCCTTTTTCGTCCCCTTTCCCTTTCCTC
T7_04596_G03	CCTCCTTTTTTTTCTTCGTCCCTTTCCCCTTCCCCT
T7_04597_G03	CTTCTTTCCCCTCTTCCGTCCTTTTCTCTTCCCCTT
T7_04598_G03	CCCTCCCCTTCCTTCCCGTCCTTTTTTTTTCTTTCC
T7_04599_G03	TTTCCTCCCCTCTTTTTGTCTTCCTTTCCCCTTCCC
T7_04600_G03	CCCTTTTCCCCTTTTTTGTCTTCCCTCCCTCCTCTT
T7_04601_G03	CCTTTTTTCCTTTCCCCGTCTTTTTCCCCTTTCCCC
T7_04602_G03	TTCCTTCCCCTCTCCTTGTCTTTTTTTTCCCCTCCC
T7_04603_G03	CTCTCTTCTTTTCTTTCGTCTCCCCTCTCTTCCTCC
T7_04604_G03	TTTTTTCCTCCCCTCCCGTCCTTTCCCTTTCCTTTC
T7_04605_G03	CCTCCCCTTTTTTTCCTGTCCCTTCTCCTTTCTTCC
T7_04606_G03	CCCTTCTTTCCCTTTCCGTCTCCCTTTTCCCCTTTT
T7_04607_G03	TCCTTCCTCCCTTCCCTGTCTTTCTTCCTTTCTCCT
T7_04608_G03	CTTTTTTTTTTCTTCCCGTCTTCCTCCCTCCCTCCC
T7_04609_G03	TCCTCCCCTTTCTCCCTGTCTTCTTTCCCCTTTTTC
T7_04610_G03	TTTTTTTCCCTTTTCTCGTCCCTCCCCTTTCCCCTC
T7_04611_G03	CCCTTTCTTCCTTTCCTGTCTTTTTCCTCCTTCCCC
T7_04612_G03	TTTCCTCCCTCCCCTTTGTCTCTTTTTCCTCTTCCC
T7_04613_G03	TCCCCTTTTTTTTCTCTGTCTCCCCTCTCCCCTTCT
T7_04614_G03	TTCCTCCTCCTCCCTTTGTCCCCTTTCCCCTTTTTT
T7_04615_G03	TCCCTCCCCTTCCCTTCGTCTTTTCTTTTCCCTTTC
T7_04616_G03	TCCTTCCCTCTCTTCCCGTCTTTTTCCTTTTTCCCC
T7_04617_G03	CCCTTTTCCTTCCCTCCGTCCCTTTCCCCTTTTTTT
T7_04618_G03	CTTTTTTCCTTTCCCCTGTCTTCCCTTCCTCCCCTT
T7_04619_G03	TTCCCCTTTTCCTTCCCGTCTCCCTTTTTTTTCCCC
T7_04620_G03	CCTCCTTTCCCTCTCCCGTCTTTTTCCCCTTTTTTC
T7_04621_G03	TCTTCCTCCCTTTCTCCGTCCTTCCTCCCTTTTTTC
T7_04622_G03	TTCTCTTCCCCTTCCCCGTCTTTTTTCCCCTTTCCT
T7_04623_G03	TTTTTTTTCCCCTTTCCGTCCCTTCCCCTTCCCCTT
T7_04624_G03	CTCCCTTTCTTTCCCCTGTCTTTTTCCCTTTTCCCC
T7_04625_G03	CCCTCCTCTTTTTTCCTGTCCTTTTTCCCTTTCCCC
T7_04626_G03	CCTTTTTTTCCTCCTTCGTCCCCTCTCCTCCTTTCT
T7_04627_G03	TTTTCCCTTTTCTCTTTGTCCCCTTTCCCTCCCTCC
T7_04628_G03	CCCTTTTTTTTCCCTCCGTCCCTTTTCTCCCCTTTC
T7_04629_G03	TTTTCCTCCCTCTTTCCGTCTCCTTTCCCCTCCTTT
T7_04630_G03	TCCCCTCTCCCCTTTTTGTCTTTCCCTTTCCCTTTC
T7_04631_G03	CTTTCCCCTCCCTCCTTGTCTTTCCTTTTTCCTTCC
T7_04632_G03	TTTTTTCCCCTCCCTTTGTCTCCCCTTCCTCTTCCT
T7_04633_G03	TCCCTTTTCTCTTTCCCGTCTTTTTCCCCTTTCCCC
T7_04634_G03	TCCCCTCCTCCTTTTTCGTCCTTTTTTTTCCCCTCC
T7_04635_G03	TCCCCTTTCCCCTTTTCGTCCTTTCCTTTCTCCCTT
T7_04636_G03	CCTTTTCCCCTTCCTTCGTCCCTTTCCTTCTTCTCT
T7_04637_G03	CTTCCCTCTTTTCCCTCGTCCTTTCCTTCCCCTTTT
T7_04638_G03	TCCCTTTTCCTTTTTCCGTCCTTTCCCTCTCCCCTT
T7_04639_G03	CCCTTTTCCTTTTCCCTGTCCTTCCCTTCTCTCCTT
T7_04640_G03	TCTTCTCCTTTTTCTTCGTCTTCCCCTCCCTCCTTC
T7_04641_G03	CCCTTTCTTTTTCCCCTGTCTCCTCCTCCTCTTCTT
T7_04642_G03	CTTTTTTTCCTCCTTTCGTCTTCCCCTCCTTTCCCC
T7_04643_G03	CCTCCCCTCTTTTTTTTGTCCCCTCCCTCCCTTTTT
T7_04644_G03	CTCCTTCCCTCTTTTCCGTCCCTTTCCTTCCCTTTT
T7_04645_G03	TTTTCCCCTCCTTTCCTGTCTCCCTCCCCTTTTTTC
T7_04646_G03	TCCCCTTTTCCCTCCCTGTCTTTTTCTTCCCCTTTC
T7_04647_G03	TTCTTCCCTCCCCTCCTGTCTCCTTCTTTTTTTCCC
T7_04648_G03	CCCTTTCCCCTCCCTCTGTCCTCCTTTCCTTTTTTT
T7_04649_G03	CTTCTCTCCCTTTTTTTGTCTTCCCCTTTCCCCTCC
T7_04650_G03	CCTCCTTTTTTTTTTCCGTCCCTCCCTCTTTTCCCC
T7_04651_G03	CCTCCTCCCCTTCCTTTGTCTTCTCCTTTTTTCCCT
T7_04652_G03	CCTCCCCTTTTTCCCTCGTCCTTCTTTTTCCCTTTC
T7_04653_G03	CCCTCCTTTCCCCTTCCGTCTTTTTTTCCCCTTTTC
T7_04654_G03	TTCCCCTTCCCTCCCTTGTCCCCTTTCCCTTTTTTT
T7_04655_G03	CCTTTTTTCTCCCTCCTGTCTTTTCCTCTTCCTCCC
T7_04656_G03	TTCCCCTTTCCTTCCCCGTCTCCCCTTTTTTTCCTT
T7_04657_G03	CCTTTTCTTTTTCCTTCGTCCCCTTTCTCCCTTCCC
T7_04658_G03	CCCTTTTTTCCCTTCCCGTCTTTTTCCCCTTTCCTC
T7_04659_G03	CCTTTCCCTTCTCCCCTGTCTTTTTTCCCCTTTCCT
T7_04660_G03	CCTCCCCTTTTTTTTCCGTCTCTTCCTTCCTTTCCC
T7_04661_G03	TCCCCTTCCTTCCTCCCGTCCTTTTCTCTCCTTTTT
T7_04662_G03	TCCCTTTTTCCCTTTCTGTCTTCCTCCTTCTCCCTC
T7_04663_G03	TCCTTCTCCCTCCTTTTGTCTTCCCCTTTCCCCTTT
T7_04664_G03	CTCCTTTTCTCCCCTTTGTCTTTCCCCTCCTCCTTT
T7_04665_G03	TTTTTTCCCTCTTCCCCGTCTCCCTTCCCCTTTTTC
T7_04666_G03	TTTCCCCTTTCCTCCTTGTCCTTCCCCTTTTTTCCC
T7_04667_G03	TTTCCCTCTCCCTCCCCGTCTCTTTTTTCCTTCTTC
T7_04668_G03	TTTTCTTCCCCTCTTTTGTCTTTTCCCCTCCCCTCC
T7_04669_G03	TTTCCTTTTTCCCCTTTGTCTTTTCCTCCCCTCCCC
T7_04670_G03	CTTCCCTCTCCCTTTTCGTCCTCTTCCTTTTTTCCC
T7_04671_G03	TCCCTTTTTTTTTCCCCGTCTTCCCCTTTCCCCTCT
T7_04672_G03	CCTTTCCCCTTTTCCCCGTCTTTTTCTCCTTTCCCT
T7_04673_G03	CCCTTTCCTTTCCTCCCGTCCTCTTTTCCTCCTTTT
T7_04674_G03	CCTCCCCTCCCCTTTTTGTCTTTTTTCCCTTTCCCT
T7_04675_G03	TCTTCCCTTTTTCTCTCGTCCCTCTCCCCTTTTCTC
T7_04676_G03	CCTCTTTTTTCCCCTTTGTCCTTCCCTTTCCTTCCC
T7_04677_G03	CCCTCCTTTTCCTCCTCGTCCCCTTTTTTTCCTCTT
T7_04678_G03	TCCTCTCTTTTTTTTTTGTCCCCTTCCCTCCTCCCC
T7_04679_G03	CCCTTTTTCCTTTCCCCGTCTTTTTTTCCCTCCCCT
T7_04680_G03	CTTCCCCTTCCTCTTCTGTCTTTTTTCCCTCCTCCT
T7_04681_G03	CCCTCCTTCCTTCCTTTGTCTTCCCCTTTCCTCTTT
T7_04682_G03	CTCTTCCCCTCCTCCCTGTCTTCCCTCTTTTTTTTC
T7_04683_G03	CTCCCTTTTCCTTCCCCGTCTTTCCTTTTCTTTCCC
T7_04684_G03	CCCTCCCTTTTCCTCCCGTCTCCCCTTTTTTCTTTT
T7_04685_G03	CCCTTCCTTTTTCTTTCGTCCCCTCTTTTCCTCTCC
T7_04686_G03	CTTTCCTTTTCCTTTTCGTCCCTCCTTCTTCCCTCC
T7_04687_G03	CCCTTTTCCCCTTTTTTGTCTCCCCTCCCCTTTTTC
T7_04688_G03	TTTCCCTCTTCCTTCCCGTCTCCCTCTTCCCTTTTT
T7_04689_G03	CCCTCCTTTTCCCTTCTGTCTTCCTTTTTCCCTTCC
T7_04690_G03	CCTTTTCCCCTCCCTCCGTCTCTTTCCTTCTTCTTT
T7_04691_G03	TCCCCTTTCCCCTCCCCGTCTTCCCCTTTTTTTTTT
T7_04692_G03	CTTCCTTCCCTTTCTCTGTCCTCTTTTTCCTTCCCC
T7_04693_G03	TCTTCCCTCCTCCCCTTGTCTCTTTTTCCCCTTTTC
T7_04694_G03	CTCCCCTTCTTTCCCTTGTCTTTTCCTCCCTCCTTT
T7_04695_G03	TTTTTCCCCTCCTTTTCGTCCCTTTCCCCTTTTCCC
T7_04696_G03	CCCTTTTTTCCTTCTTCGTCCCTCTCCCCTTTCTTC
T7_04697_G03	CTTCTTTTCTTCCCTCTGTCTCCCCTTTTCCCTTCC
T7_04698_G03	CCTCCCTTTTTTTCCCCGTCCTTCTCCCTTCCTTTT
T7_04699_G03	CTTTCCCTTTTCCCCTTGTCCCCTCCTTTTTTTCCC
T7_04700_G03	TTCTTTTTCCCCTTTTTGTCTCCTCCCCTTCCTCCC
T7_04701_G03	CTTCCCTCTTTTCTCCTGTCTCCTCTTCCCCTTTTC
T7_04702_G03	CTTCTCCTCCCTCTTTTGTCTTTCCTTCCTCCTTCC
T7_04703_G03	CCTCCTCTCCCCTTTTTGTCCTTTTTTCCCTTTCCC
T7_04704_G03	TCCCTCCTCCTCCCTTTGTCTTTTTCCCCTCCTTTT
T7_04705_G03	CCTCCCTCCTTTTTTTTGTCTCTCCCCTCCTCCTTT
T7_04706_G03	CCTTTTTTCCCTTCTTTGTCTTTTCCCCTCCCTCCC
T7_04707_G03	CCTCCTTCTTTTCCCCTGTCCCCTTCCCCTTTTTTT
T7_04708_G03	TCCTTCCTCTTTTCCTTGTCTCCCCTCTCCCCTTTT
T7_04709_G03	CCTTCCCTTTCCCTTCCGTCCTTTTTCCCTTTCCTT
T7_04710_G03	CCCTTTCCTTCCTTTTTGTCTCCCTTCCTTTCCTCC
T7_04711_G03	CCTTTCTTTTCCCCTTCGTCCCTCCCTCTCCTTTTT
T7_04712_G03	TCTTCTTCCTTTTCCCCGTCTTTTCCCCTTCCCCTT
T7_04713_G03	CTTTTTTTCCCTCCCCTGTCCCTCCCTTTTTTCCTC
T7_04714_G03	CCTTCCTCCTTTTTTCCGTCCTTTTCCCTTCCCTTC
T7_04715_G03	TCCTCCTCCCTTTTCCTGTCTCCCTTTTTTTTCCCC
T7_04716_G03	TCCCTTCCCCTTTTTCCGTCCCTTTCTCCCTTTTTC
T7_04717_G03	CCCTTCTCCCTTTCTTCGTCCTTTTCCTTCTTTCCC
T7_04718_G03	TCTCCTCCCCTTTCTCTGTCTTCTTCCCTTCCCTTT
T7_04719_G03	CCTTTCCCCTTTTTCCCGTCTTTCCCCTTTCCCTTT
T7_04720_G03	CCTTCCCCTTCCCTCCCGTCTTTTCCTTTTTTTCCT
T7_04721_G03	CCTTTTTCTCTTTCCCCGTCTCCCCTTCCCTTCTTT
T7_04722_G03	TTTTTTCTCCCCTCCCTGTCTCTCCCCTTCCCTTTT
T7_04723_G03	CTTTCTTTCCCCTCTCCGTCCTTCCTCTTTTTTCCC
T7_04724_G03	CTCCCTTCTTTTTTCCCGTCCTCTTTCCTTCTTCCC
T7_04725_G03	CCCTTCCCTCCCCTCTTGTCTCCTTTTTTTCCCTTT
T7_04726_G03	TTCTTTCCCCTTTCCTCGTCCTTCCTTTTTCTCCCC
T7_04727_G03	TTCCCCTTTTCTTCCCCGTCTTTTTTCCCTTTCCCC
T7_04728_G03	CCCTCTTCCCCTTCCTTGTCTTTTCTCCTTTCTTCC
T7_04729_G03	CTCTTTCCTTTTCCCCTGTCCCTTTCCCTTCCTTCT
T7_04730_G03	TCCCCTTCCCCTCTTTCGTCCTTTCCCTTTTCCTTT
T7_04731_G03	TCCTTCCTTCTCCCTTTGTCTTTTTCTCCCTTCCCC
T7_04732_G03	CCTCTCCCCTTTTTCCCGTCTTCCTTTTTTCCCTCT
T7_04733_G03	TTTTTTCCTTTTCCCTTGTCTCCCTTCCCCTTCCCC
T7_04734_G03	CTCCCTTCTCTTCTCTTGTCTTCCCTTCCCCTTTTC
T7_04735_G03	TTTCCTTTTCTTCCCCTGTCTTTTTCCCTCCTCCCC
T7_04736_G03	TTCCCTTCCCTTTTTCCGTCCTCTTCTCTTTCCTCC
T7_04737_G03	CCCTTTCCTTTCCCCTTGTCTTTTTTTCCTCCCCTC
T7_04738_G03	CCCTCCCCTTTTCCCTCGTCCTTTTTTTTTCCCTTC
T7_04739_G03	TCCCTTCTCTCCTTCCTGTCTTCTTCTTTTCCCCTC
T7_04740_G03	CCTCCCTTTTTTCCCTTGTCCTTTCCCTCCTCCTTT
T7_04741_G03	TTCCCTCTTTTTTTTCCGTCCCTTCCCCTTTTCCCC
T7_04742_G03	TTTTCTTCCCCTTCCCCGTCTTCCCCTTTTTTCCCT
T7_04743_G03	CCTTCCCCTTTTTCCCTGTCCCCTTTTTCTTCCCTT
T7_04744_G03	CCCTTTTTCTTTTTCCCGTCTCTCCCCTTCCCTTTC
T7_04745_G03	CTCCCCTTTTCCTTTTTGTCTCCCCTCCTTCCCTTT
T7_04746_G03	CCCTTCCCCTTCTTTTCGTCCTTTTTTCCTTTCCCC
T7_04747_G03	CTTTCCCCTTTTTTTTTGTCCCTTCCTTCCCCTCCC
T7_04748_G03	CTCCCCTTTTTTCTTTTGTCCCCTCCCTTTTCCCCT
T7_04749_G03	CTCCCTCCCTTCCCCTTGTCCTTTCCTTTTCTCTTT
T7_04750_G03	CCTTTCCTTCCCTTCCTGTCTCCCTCTTTTTCCCTT
T7_04751_G03	CCCTTTTTTTTCCCCTTGTCTTCTCTCCTCTTCCCC
T7_04752_G03	TTCTTTTTTTTCCCCTTGTCCTCTCCCTCCCCTCCT
T7_04753_G03	TCCCTTTTCCCCTCTTCGTCCCTTTTTCCTTTTCCC
T7_04754_G03	CCCTTTTCCCTCTTTTTGTCTTTCCCTCTCCTCCCT
T7_04755_G03	TTCCCTTCCTCTCTTCTGTCTTCTTTTCCCCTCCCT
T7_04756_G03	CTCTTCCCTTTCCTTTTGTCTTCCCTTCCTCTTCCC
T7_04757_G03	CTCCTTTTCCCTTTTCCGTCTCCTCCTCCTTTTTCC
T7_04758_G03	TCCCTTCCTTCCTTTTCGTCCCTTTTTTCCTTCCCC
T7_04759_G03	TCTCCCTTTTTCCCCTCGTCTTTTCCTTCTCCCTTC
T7_04760_G03	CCCTTTTTTTTCTCTCCGTCTCCCTTTTTCCCCTCC
T7_04761_G03	CCTTTCCCTTTCCTTTCGTCCTTTTCTTCCCCTTCC
T7_04762_G03	CTTTCCTCCTTTTTTTCGTCCCTTCCCCTTTTCCCC
T7_04763_G03	CTCCTCCCCTTCTTTTTGTCTTTTTTCCCCTTCCCC
T7_04764_G03	CCCTTTTTCTTCCCCTCGTCTTCCTTTCCTCCCTTT
T7_04765_G03	CCTCCCTCCCCTTTTTTGTCTTTTTTTCCCCTTCCC
T7_04766_G03	CCCTTTCTCTCTTCCTCGTCCTCCTTCCTTTTTTCC
T7_04767_G03	TTTTTCTTCCTCCTTCCGTCCTCCCTTCCTTTCCCT
T7_04768_G03	TTCCCCTCCCTTTTTTTGTCCCCTTTCCCTCCCTTT
T7_04769_G03	CCCTTTTCCCCTTTTTCGTCTTTTCCCTTTCCTCCC
T7_04770_G03	CCTTCCCCTTTTTTTTCGTCCCCTTTCCCTTTCCCT
T7_04771_G03	CTTTTTTCCTTTTTCCCGTCTCCCTTCCCCTCCTCT
T7_04772_G03	TCCTTTCCTTTCCCTTTGTCTCCCTCTCCTCTCTTC
T7_04773_G03	CCTCCCCTTTTTTTTCCGTCCCTTCCTCTTCCCTTT
T7_04774_G03	TCCTTCCCCTTCCTCCTGTCTTTTTTCTCCCCTTTC
T7_04775_G03	TCCTCCCCTCCCTTTTTGTCTCCCTCTCTTTTTTCC
T7_04776_G03	CCTCCTTTTCCCTCCCTGTCTCCTTTTCCCTTTTCT
T7_04777_G03	CCTTCCCCTTTTTCCCTGTCTTCTCCCTCTCTTTCT
T7_04778_G03	TTCCTCCCTTTCCCTTTGTCTTCCCCTCCTCCTTTT
T7_04779_G03	TTCCCCTTTTTTCCCTTGTCTCTTCCTTTCCTCCCC
T7_04780_G03	CTCTTTTCCTTTTCCTTGTCTCCCTTTCCCCTTCCC
T7_04781_G03	CTTTTTCTCCCCTCCTTGTCTCCCTTTTTCCCTCCT
T7_04782_G03	TTCCCCTCCTTTTTTTTGTCTTTCCCCTTCCCTCCC
T7_04783_G03	CCTTTCTTCCCCTTTCCGTCTTTTCTTTTCCTCCCC
T7_04784_G03	TTTCCTTCCCCTTTTTCGTCCCTTCCCCTTTTCCCT
T7_04785_G03	CTTTTTTTTTCCTTCCCGTCCTTTTCCCCTCCCTCC
T7_04786_G03	TTCCTTTTCTTTTCTTCGTCCCCTTTTCCCCTCCCC
T7_04787_G03	TTCCCCTTTTCCCTTCTGTCTCCTCCTTTCTCCTTC
T7_04788_G03	CCCTCCCCTTTTTCCTTGTCTTTTTCCCCTTTCCTC
T7_04789_G03	TCTTTCCCTCCTCTTTTGTCCCTTTCCTTTCTCCCC
T7_04790_G03	CCTTTTCCCTCCCTTCTGTCTCCCCTTTTCCTTCTT
T7_04791_G03	TCTTTCCCTTTTCCCTTGTCTTCCCCTCTTCCTTCC
T7_04792_G03	CCTTTCTTTCTTTTCCCGTCCTTTCCCTTCCCTCCT
T7_04793_G03	TTTCTCCTCCTCCCCTTGTCTTTCCCCTTTTTTCCC
T7_04794_G03	TTCTTTCCCCTCTTTTCGTCCCTCCCTTTTCCCTTC
T7_04795_G03	TCCCTCCCCTTTTCCTTGTCTTTTTCCCTTCCCCTT
T7_04796_G03	CCCTTTTTCTTTCCCCTGTCCTTTCCTTCCCTTTCC
T7_04797_G03	CCCTTTTTCTTCCTCCCGTCCTTTTTCCCCTCCTTT
T7_04798_G03	TCCCTTTTTTTTCCCCTGTCTTTCCCTTCCTTCCCC
T7_04799_G03	CTTTTTCCCCTCTTCCCGTCTTTTTTTCCTCCTCCC
T7_04800_G03	TCTTTTTTCCCTTCCCTGTCTTTCCCCTTCCCCTTC
T7_04801_G03	CTCCCCTTCCTCCCTTTGTCTTTTCCTCCCCTTTTT
T7_04802_G03	CCCTTTCCTTTTCCCTCGTCCCCTTTTTTTTCCCTC
T7_04803_G03	CCTCCCTTCTTTTTTTCGTCCTTTCCCCTTTCTCCC
T7_04804_G03	TTTCCCCTTTTCCCTCCGTCCCTCCCTTCCTTTTTT
T7_04805_G03	CCCTCCTTCCCCTCTTTGTCTTTTCCTTTTCTTCCC
T7_04806_G03	TTCTTTTCTCCTTTCCCGTCTCTTTCCCCTTCCCCT
T7_04807_G03	TTTTTCCTTTCTTTCCCGTCTTCCCTTTCCCCTCCC
T7_04808_G03	TTTTCTTTCCTTTTCCTGTCCTTCCCCTCCCTCCCT
T7_04809_G03	CCCTTCCTTTCCCCTTTGTCCCTTTTTTTTCCTCCC
T7_04810_G03	TCCTCCTCCTTCCTCCCGTCTTCTTTTTTTTCTCCC
T7_04811_G03	TTCTTCCCTTCCCTCTTGTCTCCCCTTTTTCTTCCC
T7_04812_G03	TTCCTCCCTCTCCTCCTGTCTCCCTCCTTTTCTTTT
T7_04813_G03	TTTCCCTTCTCCTTTCCGTCTCCTTCCTTTTTCCCC
T7_04814_G03	CCTTTTTTCCCCTTTCCGTCCTCCCTTCCCTTTTCT
T7_04815_G03	TTCTTCCCTTTCCCTTTGTCCCCTTTCCTTCTTCCC
T7_04816_G03	CTTCTTCCCTTTTTTTCGTCCCTTTCCCCTCCCCTT
T7_04817_G03	CCTTCCCCTCCTTTTTTGTCTCCCTCTTCCTTCTTC
T7_04818_G03	CTTCCCCTCTTTTTTCCGTCCTTCTCCTCCCTTTTC
T7_04819_G03	CTCCCTCCTTCCCCTTTGTCTTCTTCCTCTTTTTCC
T7_04820_G03	TTCCTTCTTTCCCCTCCGTCCTTTCCCTTTTCCTTC
T7_04821_G03	TTTTCCCTTCCCCTCCTGTCTTTTTCCTCCCTTTCC
T7_04822_G03	TCTCTTCTCCCCTTCTCGTCTCTCTTCCTTTCTTCC
T7_04823_G03	CCTCTTTTCCTTTTCCCGTCCTCTCTCCCCTTTCTT
T7_04824_G03	TCTTTTCTTTTCTTCTCGTCCTTCCTCCCTCCTCCC
T7_04825_G03	CCCTTTTTTTCCCCTCCGTCCCTTCCCTTTCTTCTT
T7_04826_G03	CCCTTCTTCCCTTCCTTGTCTTTTCCCCTTCTTCCT
T7_04827_G03	TCCCCTTTCCTCCTCTTGTCCTTTTCCTTTCTTCCC
T7_04828_G03	TTCTTCCCCTTTTTTTCGTCCCCTCCTTTCCCCTCT
T7_04829_G03	TTTTTTTCCCCTTTTCTGTCCCCTTCCCTCCCCTTC
T7_04830_G03	CCTTTTTTTCCCCTTCCGTCTTCTTCCTCTCTTCCC
T7_04831_G03	TTTTTCCCTTTTCTCCCGTCTCCCCTCTTCCCCTTT
T7_04832_G03	CTTCCTCCCCTTTTTCTGTCTCCTCCTTCTTTCCTC
T7_04833_G03	CCTCTCTCTCTCTCCCTGTCTTCTTCCCTCCTTTTT
T7_04834_G03	TTTTCTTTTCCCTTCCCGTCTTCCTTTTCCCTCCCC
T7_04835_G03	TTTCCCTTTTTCCTTCCGTCCTCTTCCCTCTTCCCT
T7_04836_G03	TTCCCTCTTCCCCTCCCGTCTTTTCCTTTTCCTTCT
T7_04837_G03	TCCTTTTTTCCCCTTCCGTCCCTCCTTTTCCCTTTC
T7_04838_G03	CTCCCTTTCCTCCTTTCGTCCCTCCCTTTTTTCTTC
T7_04839_G03	CCTCTTTCTTTCCTCCCGTCCTTTCCCCTTCTTTTC
T7_04840_G03	TTTTCCCCTTTTCTTTTGTCTTCCCCTCCCTTCCCC
T7_04841_G03	TTTCCCCTTCCCCTCCCGTCTCTTTTTTCTCCCTTT
T7_04842_G03	CTCCCCTCCCCTTTTTTGTCTCTTTCCCCTCTCTTT
T7_04843_G03	TTTTTTTCCCCTTCCTTGTCCCCTTTCCTCCCCTCT
T7_04844_G03	TTTCCTCCCTTCCCTCTGTCTCCCTCTTTCCCTTTT
T7_04845_G03	TCTTCCCCTTCCTCTCCGTCTTTTTTCCTCCCTTCT
T7_04846_G03	TCCCTCTTTTTTCTCCCGTCCTTTTTCCCCTTCCCT
T7_04847_G03	CCCTTCTTTTTCCCCTTGTCTCTCCCTCCCTTTTCT
T7_04848_G03	CCCTTCCCCTTCCTCTCGTCTTCTTTTTTCCCCTTT
T7_04849_G03	CTCCCTTCTCCTTCCTTGTCTTCCCCTTTTCTCCTT
T7_04850_G03	TTTCCCTTTTCCCCTTCGTCCTTTCCCTTTTCCTCC
T7_04851_G03	TCTTTTTCCCCTTCCCTGTCTCCCCTTCTCTTTTCC
T7_04852_G03	TTTTTTCCCCTCCTTCCGTCCTCTCCTTTTCCCCTT
T7_04853_G03	CCCTTCCCTCTCTCTCTGTCCTCTCCCTTTTTTTTC
T7_04854_G03	CCTTCCTTTTTCCCTCCGTCCCTTTCCTCTTTCCTT
T7_04855_G03	TCTTCCCCTTCCTTCCCGTCTCCTTTTTTCCCCTTT
T7_04856_G03	CCCTTTTCCCCTTCCCTGTCTTCTTCTTTTTCCTCC
T7_04857_G03	CCTTTCCTCCCTTCCCCGTCTTCTTCTTTTTTTCCC
T7_04858_G03	CTCCCTTTCTTTCCCCTGTCTTCTCCCCTCTCTTTT
T7_04859_G03	CCCTCCCTTCCTTTTCTGTCCCCTTTCCCCTTTTTT
T7_04860_G03	CCCTCTTCCCCTTTTCCGTCTTTTTCCTTTTCCCCT
T7_04861_G03	CCCTTTTCCTCCCCTTCGTCCCTTTTTTTTCCCCTT
T7_04862_G03	TTCTTCCCCTTTTCCTTGTCTCCCCTCTTCCCCTTT
T7_04863_G03	TTCCTCCTTCCCTTTTTGTCTTTTCCCTCTCCCTCC
T7_04864_G03	CTTTTCCCTCTTTTCCCGTCTTCCTTTCTCTCCCCT
T7_04865_G03	CTTTTTCCCTCCCTCTTGTCTCCCTTCCCTTCCTTT
T7_04866_G03	TTTTCTCCCCTCCTTTTGTCTTCCCCTTTCCCCTTC
T7_04867_G03	TTCCCTTTTTCCTTTTTGTCCCCTCCCTTCCCCTTC
T7_04868_G03	CCTCCCTCCTTTCTTTTGTCCCTTCCCCTTTCTTTC
T7_04869_G03	CTTTTTTCTTTCCTCTTGTCCTTCCCCTCCCCTCCT
T7_04870_G03	CCCTTCTTCTTCTTTCCGTCCTTTTCCTCCTTCCCT
T7_04871_G03	CTCTCTTTTTTCCTTTTGTCTCCTCCTCCTCCTCCC
T7_04872_G03	TCTCTCTTCTTCCCTTTGTCTCCCCTTTCCCTTCCT
T7_04873_G03	TTTTCTTTTTCCCCTTTGTCCCTTCCTCTCCCCTCC
T7_04874_G03	CCTTTCCTCTTTCCCTTGTCTCCCTCTTTTTCCCCT
T7_04875_G03	CTCTCCCCTTTTCTTTCGTCCCTTTCCCTTCTCCTT
T7_04876_G03	CTTTTTTTCCCCTCCTTGTCTTCCCCTTCTTTCCCC
T7_04877_G03	TCTCTTCCCCTTCCCCTGTCTTTTTCCCCTTTCCTT
T7_04878_G03	CTCTCTTTTTTCTCCCTGTCTCCTCTTTCTCCCCTC
T7_04879_G03	CCTTTCTCTCCCTTTCCGTCTCTCCCCTTTTCTTTC
T7_04880_G03	TTTTCCCTCTCTTTTCCGTCCCTCTTCCCCTTTTCC
T7_04881_G03	TTCTTCCCCTTCCCTTTGTCCTTTTTCTTCCTCCCC
T7_04882_G03	TTTTTTCCTCCCTCTCCGTCTTCCCCTCTTTTCCCT
T7_04883_G03	TTTTTTCCCTCCCTCCCGTCTCCCCTTTTTTCCCTT
T7_04884_G03	CCCTTTTTTCCTCCTTTGTCTTCCCTCCTCTCTCCT
T7_04885_G03	CCCTTCCTTCCCCTTTTGTCCTTTTTTCCTTCCCCT
T7_04886_G03	CCTTTTCTTCTTTCTTCGTCTCCCCTCTCCCCTTTC
T7_04887_G03	CCTCCCCTTCTCCCTTTGTCTTTTTCCTTTCTCCCT
T7_04888_G03	TTCCCTCCCCTCTCTTCGTCCTTTCTTTTTTCCCCT
T7_04889_G03	TTCCCCTCCCCTTTTTCGTCTTTTCTTTCCTTCCCC
T7_04890_G03	TTCCCCTTTCTTCCCTTGTCCCTCCTTCCTTTTCTC
T7_04891_G03	CTCCCCTCCTTTTCCTTGTCCTCTCTTTTCCTTTCC
T7_04892_G03	TCCTTTTCCCTTTCCTCGTCCCCTCTTTCCCCTTTT
T7_04893_G03	CTTTCCCTTTTCCCTTCGTCTCCTCTTTTCTCTCCC
T7_04894_G03	CCTTTCCTTTCCTTTCTGTCTTCCTTTCCCCTCCTC
T7_04895_G03	CTCTCCCTTTTCCTTTCGTCCCCTCTTTCCTCTTTC
T7_04896_G03	TCCTTTCCTCCCTCCTTGTCTCCTCTTTTTTTCCCC
T7_04897_G03	CTTTCTTCCCTTTTCTTGTCTCCCTTCCTCCCTCCT
T7_04898_G03	TTCCCCTTCCCTTTCCCGTCTCCCCTTTTTCCTTTT
T7_04899_G03	TTTCCTCTTCCTCCCTCGTCTTTCCTTTTTCTCCCC
T7_04900_G03	CTTTTCTTTTCCCTTCTGTCCCCTCCCTCTCCTTCT
T7_04901_G03	TTCCTTCCTCCTTTTCCGTCTTCCTTTTTCCCTCCC
T7_04902_G03	TCCCTCTTTCCTTCTTCGTCCCTCTTTTTCTTCCCC
T7_04903_G03	CCTTCCTCTTTCTTCTTGTCCCTTCCCTTTCCTCTC
T7_04904_G03	CTTTCTTTCCCTTCTTTGTCTTTCCCCTTCCTCCCC
T7_04905_G03	CCCTTTTCCCTTTTTCTGTCCTCCTTTCCCCTCCTT
T7_04906_G03	CTTTTCCCCTCTCCTTTGTCTCCCCTTCTTTCCCTT
T7_04907_G03	TTCCCTTCCCTTTTTTCGTCTCCTCTTCCTCCCTTC
T7_04908_G03	TCCCCTCTTTCTTTCCCGTCTTTCCCTTTCCTTTCC
T7_04909_G03	TCCCCTTTCCTTCCCTTGTCTCTCCTTCTTCCTCTT
T7_04910_G03	TTTCCCCTCCCTCCCCTGTCTTTCTCCCCTTTTTTT
T7_04911_G03	CTTTCCCTTCCTTTTTTGTCCCTTCCCCTTTTCCCC
T7_04912_G03	TTTCCCTTTTCCTCCTTGTCTTCCCTTTTCCCTCCC
T7_04913_G03	TTCCTCCCCTTTTTCCCGTCTTCCCTTTCCTCCTTT
T7_04914_G03	TTTTTTCCTTCCCTCCCGTCTTCTCCCTTCCCTTCT
T7_04915_G03	TTTTTTCCCTTTTTTTCGTCCCCTTCCTCCCCTCCC
T7_04916_G03	CCCTCCCCTCTTCTTTTGTCCTTCTCTTTCCTTCTC
T7_04917_G03	TTTCCCCTTCCCCTTTCGTCCCTCTTCCTCTTCTTT
T7_04918_G03	CCTTTTTCTCCTTCTTTGTCTCTCCTCCCCTTCCCT
T7_04919_G03	CTCCTTTTTCTCCCCTTGTCCTTCCTTCCCCTTCTT
T7_04920_G03	CCTTCCTTTTCCCCTTTGTCCCCTTCTTCCTTTCTC
T7_04921_G03	TTCTCCTCTCCCTTTCCGTCTTCCCTTTTCCCCTTT
T7_04922_G03	CTTCCCCTTTTTTTCCCGTCTTTCCTCCCCTCTTCT
T7_04923_G03	TTTTCTTCCCCTCTCCCGTCTTTTCCCTTCCCCTTT
T7_04924_G03	CTCCTTCTTTTTCTTCCGTCCCTCCCTTTCCTTTCC
T7_04925_G03	TCCCTTCCTTTTTTCCCGTCTCTTCCTTCCTTTCCC
T7_04926_G03	TTTTCTCCTCCTCTTCCGTCCTCTTTTTCCCTCCTC
T7_04927_G03	TTTTCTTCCCTCTTCTTGTCCCTTTCCCTCCCTCCT
T7_04928_G03	TTCCTCCCCTTCTCCCTGTCTTTCTCCTTTCTTTCC
T7_04929_G03	TCTTCCCTCCTCCTCCCGTCCTTTTTCCTTCCTTTT
T7_04930_G03	TCCTTTCTCCCCTCTCCGTCCTTTTTTTTTCCCCTC
T7_04931_G03	TTTTTTTCCCTTTCCCTGTCTCCTTCCCTTCCTCCC
T7_04932_G03	CCTTTTCTTTCCCCTTCGTCCCTTCCCCTTCCTTTT
T7_04933_G03	TTTCCTTCCTTTTTTTCGTCTCCCCTCCCCTCTCCT
T7_04934_G03	TCCCTTTTCCTCCCCTCGTCCCTTTTCCCCTTTTTT
T7_04935_G03	CCCTCCCCTCTTTCCCCGTCTTCTCTTTTTCTCTTT
T7_04936_G03	CCTCCTTTTTCCTCCTCGTCTTTCCCTTCCCTTTCT
T7_04937_G03	CCTCCCCTTTCCTCCTTGTCTTTTCCTTCTTTTCCC
T7_04938_G03	CTCTTCCCCTTCCCCTTGTCCCTTTTTTTTTTCCCC
T7_04939_G03	TTTTTTTCCCCTTTTCCGTCTCCCTCCCCTTCCCTT
T7_04940_G03	CTTTTTTCCTTTTCCCCGTCTCCCCTTCCCTTTTCC
T7_04941_G03	TCTCTCCCTTCCTTCCCGTCTTTTTTTCCCTCCCTT
T7_04942_G03	TCTTTTCCTCCCCTTTCGTCTTCCCTTTCCCTTCTC
T7_04943_G03	CTTCCTCCTCCCTTTTTGTCTCCTTTCTTTCTCCCC
T7_04944_G03	CCTTCCCTCCTTTCCCCGTCTCTTTCTTTTTCTCTC
T7_04945_G03	CCTTCTCCCCTTTCTTTGTCCTCCCCTTTTTCTCCT
T7_04946_G03	TCTTCTTCTTCCCTTCCGTCTTTCCCCTTCCTTTCC
T7_04947_G03	CTTTTCCTCCCTTCCCTGTCTTTCCCTCCTTTCTCT
T7_04948_G03	CTTTTCTCCCCTTCTCCGTCCTTTTTTTTCCCTCCC
T7_04949_G03	CCTTCTTTCCCCTTTTCGTCTTTTCCCTCCCTTCCT
T7_04950_G03	TCCCTTTTTTTCTTTCCGTCCTCCTCCTTTCCTCCC
T7_04951_G03	TTTTTCTCTCCCTTCCCGTCTTTCCTCTCTCCCCTT
T7_04952_G03	TTCCCCTTTTTTCCTCCGTCCTTTTTCTCTCTCCCC
T7_04953_G03	CCTTCCTTCCTTTCCCTGTCTCTTCTCTTTTTCCCC
T7_04954_G03	TTCCTCCCCTCCCCTTTGTCTTTTTCTTTCCCCTTC
T7_04955_G03	TCTCCTTTCCCCTTCTTGTCTTTTCCTTTCCCCTCC
T7_04956_G03	CTCCCTTTCCTTCTTTTGTCTTTCCCCTCTTTCCCC
T7_04957_G03	CCCTCTCTCCCCTCTTTGTCTTTCTCCCTTTCCTTT
T7_04958_G03	TCTTTTTCCTTTTTCCCGTCCTCCCTTTCTCCCTCC
T7_04959_G03	TTCTCTTTCCCCTTCCCGTCTTTCCCTTTTTCCCTC
T7_04960_G03	CTTTTCCCTTCTCCTTCGTCCCTCCTCTTTTTCCCT
T7_04961_G03	TTCTTTCCTTCCCCTTTGTCTTTCCCTCTTCCCTCC
T7_04962_G03	TTCTTTTTTTTCCCCTCGTCCCTTCCTTCCCCTTCC
T7_04963_G03	TCCCTTTCTCCCTCCTTGTCCTCCTCTTCCCTTTTT
T7_04964_G03	CTCTTCTTCCCTCTTTTGTCTCTCCTTCCTCCCCTT
T7_04965_G03	TTTCTCCCTCTCTTTCCGTCCTTTCCCCTTCCTCTT
T7_04966_G03	CCTTTTTCCCCTTTCTCGTCTTTTCCCCTCCTTTCC
T7_04967_G03	TCTTCTTCCTCTCCCTCGTCCCTTCCTTTCTCTTCT
T7_04968_G03	TTCCTCCTCCCTCCCCTGTCTTTCTTCCTTTTCCTT
T7_04969_G03	TCCCCTTTTTCCTCTTCGTCCTTTCTTCCTCCCCTT
T7_04970_G03	TTTCCTTCTCCCTCCTCGTCCTTTTCCCTTCCTTTC
T7_04971_G03	TTCCTCCCCTTTCCTCTGTCTCTTTCCTTTTCCCTC
T7_04972_G03	TTCCCCTCCTCCCTTTTGTCTTTTTTTCCTCCCCTC
T7_04973_G03	TTCTTTCCCCTCCTCCCGTCCTCTTTTTCCTCTTTC
T7_04974_G03	CCCTTTTCTCCTTCTCCGTCTTCTTTCCCTCCTTTC
T7_04975_G03	TCCTCCTCCCCTCCCTTGTCCTTTTTTTCTCCTTTC
T7_04976_G03	CCCTTTCTTTTTTTCTCGTCCTCTTCCTTCCCTCCC
T7_04977_G03	CTCCTTTTCCTTCCCTTGTCCTCTCCCCTTCTTTTC
T7_04978_G03	CTTCCTTCCTTCTCTTTGTCCTTTCCCCTTTTCCCC
T7_04979_G03	TTCCCTTTTTCTTTCCCGTCCTCCTCCTCTTCCTTC
T7_04980_G03	CCTCCTTCCTTCCTCTCGTCTTTTCTTTTTCTCCCC
T7_04981_G03	TTTCCTTCCCCTTCCCCGTCTTTCCCCTTTCTTTTC
T7_04982_G03	CTCTTTCCCTTTTTCCCGTCCTCCCCTTTTTCCCTT
T7_04983_G03	TTTTCCTCCCCTTTTTTGTCCCCTTCCTCCTTCCCT
T7_04984_G03	CCCTCTCCTTCTCTTTTGTCTCCCTTCTCCCTTTCT
T7_04985_G03	TTCCTTCCCTCCTTCTTGTCTTTCCTCTCCCCTTTC
T7_04986_G03	CCTTTCCCCTCCCCTTCGTCTCTTTTTCCCCTTTTT
T7_04987_G03	CCCTTTTTTCCTTCCTTGTCTCCCTTCCTTTTCCCC
T7_04988_G03	CCTTCCTCCTTTCCTTCGTCCCTCCCTTCCTTTTTT
T7_04989_G03	CTTTCTCCCTTTTCCTCGTCCTCTCCTTTCCCCTTT
T7_04990_G03	CCTCCCCTTTTCCTCTCGTCCCCTTCTTTTTCCTTT
T7_04991_G03	CTTTTTTTTCTCCTCCTGTCCTCCCCTTCTTCTCCC
T7_04992_G03	TTCCTTTTCTCCCCTCTGTCTTCCTCCCCTCTTTTC
T7_04993_G03	TTCCCTTTCCTCCTCTTGTCTCCTCTCTTTTTCCCC
T7_04994_G03	CCTTTTCTCCTTTCTTTGTCTTCCCCTCTCCTCTCC
T7_04995_G03	CCCTTCCCCTCCCTTCTGTCTTTCTTTTCTTTTCCC
T7_04996_G03	CTTCCCCTTTTTTCCTCGTCTTTCTCCCTTTTCCCC
T7_04997_G03	TTCCTTTTCTCTCTTCCGTCTTCCTTCCCTTTCCCC
T7_04998_G03	TTTTCCTCCCCTTTCTTGTCCCTCCCTTTTCCCCTT
T7_04999_G03	CCCTCTTTTCCCCTTTCGTCCCTTCCCTTTCCTTTT
T7_05000_G03	TCCCTTCTTCTTCCTCCGTCTTTTTTCCCCTTCCCT
T7_05001_G03	TTTCCCTTCCTCTTCCCGTCTTTCCCCTTTCTCCTT
T7_05002_G03	TTCCCTTTTTCCCCTCTGTCTCCTTTTCCCCTCCTT
T7_05003_G03	TCCTTCTTCCTCCTCTTGTCTTCTTCTCCCTCCCTT
T7_05004_G03	CCCTTTTTTTTCCTCTTGTCTTCCCCTCCTCCCTTC
T7_05005_G03	CCTTTTCCTCCCTCCCCGTCTCTTTCTTTCTTCCTT
T7_05006_G03	CCTTTCCTTTTCTCCCCGTCTCTTCCTTTTTCCTCC
T7_05007_G03	TCCCTCCCTTCCCCTTTGTCCCCTCCTTTTTTCTTT
T7_05008_G03	CCTTTTCCCCTTTTTCCGTCTCTTCCCTTCCCCTTT
T7_05009_G03	TTTTCCTCTTTCTTCCCGTCCTTCCTCCTTTTCCCC
T7_05010_G03	TCCCCTTTTTCTCTTCCGTCTCTTCCTTCCTCTTCC
T7_05011_G03	TCTCCCTTTCTTTCTCTGTCCCTTCTTTCTCCTCCC
T7_05012_G03	TCTCCCCTTTTTTCCTCGTCTTCTCCCTCCCTTTTC
T7_05013_G03	TTCCTTCCTCCTTTTTCGTCCTTCCTTTTCCCTCCC
T7_05014_G03	CTTCCCCTCCCTTTCTCGTCCCTTTTTTCCTTCCTT
T7_05015_G03	TTTTCCCCTTCCTCCTCGTCCTTTTCCCTTCCCTTT
T7_05016_G03	CTTTTTTTTTCCTCCTCGTCTCCCCTTCCTTCCCTC
T7_05017_G03	CCTTTCCCTCTTCCCTCGTCCCTTTTTTCCCTTTCT
T7_05018_G03	CCCTTTTTTCTCTTCCCGTCTTTCCCCTTTTTCCCC
T7_05019_G03	TCTTTCCTCCTCCTTCCGTCCTTCCTTTTTTTCCCC
T7_05020_G03	CCTTTTTCTTCCCCTTTGTCCTCTTTCCCTCTCTCC
T7_05021_G03	CTCTCCCCTTTTTCCTCGTCTTTTTTCCCTTCCCCT
T7_05022_G03	TTTCCCTCCCTTTTTTTGTCCCCTTCCTTCCCTTCC
T7_05023_G03	CTCCTTTCTCCCTTTTCGTCCCTTTTTCTCCCTTCC
T7_05024_G03	CTCTCCTTTTTCCCCTTGTCCCTTCCTTTCCTTCCT
T7_05025_G03	TTTTCCTCCTCTTCCCCGTCTTTCCTTTTCCTCTCC
T7_05026_G03	CTCCCCTTCCCTTTTTTGTCTCCCTCCCTTTTTTCC
T7_05027_G03	TCCTTTCTTCTTTTCCTGTCCCCTTCTCCCCTTTCC
T7_05028_G03	CCTCCTTTCTTCCCTTTGTCTCTCCCTCCTTTTTCC
T7_05029_G03	TTCTCCTTCTCTTCCTTGTCTCCCTCTTCTTTCCCC
T7_05030_G03	TTCTCTTTCCTTCCCCTGTCTCCCTTTCCCTCCTTT
T7_05031_G03	TTTTTCCCCTCCTCCCCGTCTCTTTCTCCTTCCTTT
T7_05032_G03	CCTTCCCCTTCCTTTTTGTCTCCCTTTCCTTCTCCT
T7_05033_G03	CTTTTTCCTCCCTTTCTGTCTCTCTTTTCCCTCCCC
T7_05034_G03	CTCTTCCTTTTCTCCCCGTCTTTCTTTCTCCTTCCC
T7_05035_G03	CCTCTCTTCCTCCTTTTGTCTCTTCCTCCCCTTTTC
T7_05036_G03	CTTTCCTTTCCCCTTTTGTCTCTCCCTCTTCTCCCT
T7_05037_G03	CCTTTTTTCTTCCCCTTGTCCCTCCCCTTTCCTCTT
T7_05038_G03	TCCTTTCCCCTTTCCTTGTCCCCTTTTCTTCCCCTT
T7_05039_G03	CCTTTTCCCCTTTCTCCGTCCTTCTCCTTTCCTTTC
T7_05040_G03	CCCTTCCCCTTTTTTCCGTCTCCCTTCTCCTTCTTT
T7_05041_G03	TCCCTCTCCCTCCCCTTGTCTTTTCCTTTCTTTCCT
T7_05042_G03	CCTTTCCTTTCCCTCTCGTCCCCTTCTTTCCCTTTT
T7_05043_G03	TCCTCCTCCTTCCTTTCGTCTTTCCCTTCCTTTCTC
T7_05044_G03	TTCCTCCCTTCCCTTTCGTCCTCCTCTCCCTTTTTT
T7_05045_G03	TTCCTTCTTTTTCCTCCGTCTCTTTCTCCCCTCTCC
T7_05046_G03	TTCCCTTTTTTCTTCCTGTCCCCTCCCTTTCCCCTT
T7_05047_G03	TTCTTCCCTTTTTTCCTGTCCTCCTTCCTCCCTTCC
T7_05048_G03	TTTCCCTTCTTCCTCTTGTCCTCCTCCCCTCCTTTT
T7_05049_G03	TTCCTCCTTCCCCTCCTGTCTTTTTTCCTTTTCCCC
T7_05050_G03	CTTTCCTTTCTTTTCCCGTCCTCCCCTCTTTTTCCC
T7_05051_G03	CCCTTTTTCCCTTCCTCGTCCCCTTCTTTTTCCTTC
T7_05052_G03	CCTTCCCTTTCCCTTTTGTCTTTTTCCCTTCCCCTC
T7_05053_G03	CCCTTTTTCTTCTCCCTGTCTCCCCTCCCCTTTTTT
T7_05054_G03	CCTTCCCCTTTCTTTCTGTCTCCTCTTCCTTCCCTT
T7_05055_G03	CTCCCCTCTCCTTCCTCGTCCTTTTTTTCCCCTTTT
T7_05056_G03	CCTTTTCTCTCCCTCCCGTCTTCCTTTTCCCCTTTT
T7_05057_G03	TTCCCCTTTTTTCCTTTGTCTTCCCTCCTTCCCCTC
T7_05058_G03	CCTTTCTCCCCTTTCCCGTCTTTTCCTTCTTCCCTT
T7_05059_G03	CTCCTTTTTTCCCCTCCGTCCTTCCTCCCTCTTTTT
T7_05060_G03	CCCTTTTTTTTCTTCCCGTCTCCTTTTCCTCCCTCC
T7_05061_G03	TTTTCCTCCTTTCCCCTGTCCCCTTCCTTTTCCTCT
T7_05062_G03	CCCTCTTCTCCCCTTCCGTCCCTCTTTTTTCCTTTT
T7_05063_G03	CTTTTTTCCTTCCCTCTGTCTCCCCTCCCTTCCTTT
T7_05064_G03	TTCCCTTTTTCTCCCCTGTCTCCTCCCCTTTTTTCC
T7_05065_G03	TTTTCCTCCCTCCTTCCGTCCTTTCCTTCCTTTTCC
T7_05066_G03	TCCTTCCTCCCTCTCTTGTCTTTTCTCCCCTTTCCT
T7_05067_G03	TTTCTTCTTTCCCCTTTGTCCCCTTCCTTTCCCCTC
T7_05068_G03	CCCTTTTTCCTCTTTCCGTCCCTTTTTTCCTCCCCT
T7_05069_G03	CCCTTTTCCCTTTTTTCGTCTCCTTCCCTCTTTCCC
T7_05070_G03	CCCTCCTTCCTTTTTCCGTCCCTTTTTTCCTCTCTC
T7_05071_G03	TTTTTCCCTTCCCTTTCGTCCCCTTCCCCTTTCTCT
T7_05072_G03	TTTTTCCCTCTCCCCTTGTCTCCTTTTTCCCCTTCC
T7_05073_G03	TTTTTCCCCTCTCCTTTGTCCTCCCCTTTTTCCCTC
T7_05074_G03	TCTCTCCCTCCTCCTTTGTCTTCTCTCTTTCTCCTC
T7_05075_G03	TCCTTTCTTTTCTCCCTGTCCCTCCTCCCTTTCCTT
T7_05076_G03	TCTTTCCCTTTCCTCTTGTCTTCCTTTTCCCCTCCC
T7_05077_G03	TTTTTTTCCTCCCTCTTGTCCCTTCCCCTTTTCCCC
T7_05078_G03	CCCTCCTTTTTCCTCCCGTCTTCTCCTTTTTTTCCC
T7_05079_G03	TTCTTCCCCTTCCCTCCGTCCTTTTCCCCTTTTTTC
T7_05080_G03	TCTCCCCTCTTTCTTCTGTCTTCCCTTTCCCTTCTC
T7_05081_G03	TCTTTCCTCCCCTCTCTGTCCCTTTTCCTTTTTCCC
T7_05082_G03	TTCTTCCTTCCTCCTTTGTCCCTTTCCCTCCCCTTT
T7_05083_G03	CCTTCCTCCTCTCCCTTGTCCTTCTCCTTTTCTTTC
T7_05084_G03	TTCCCTTTCCCCTTTTTGTCTCCCCTCCTCTTCCTT
T7_05085_G03	CCCTCCTTTCCCCTTCCGTCTTTCTTTTTTTTCCCC
T7_05086_G03	TTCTCCTTCCCCTTTCTGTCTTTCTCCCTTTCCTCC
T7_05087_G03	CTCCCCTCCCTTTTTTTGTCCTTTTTTCTCCCTCCC
T7_05088_G03	TCCCTCTTCCTTTTCTTGTCTTTTCCCCTCCTTCCC
T7_05089_G03	TTCCTTTTCCTTCCTTCGTCCTTCCTTCCCTTTCCC
T7_05090_G03	TTTCCCTCCCTTTTCTCGTCCTTTCCCCTTTTTCCC
T7_05091_G03	TTCTTTCTTCCCCTTCCGTCTTTTTCCCCTTTCCCC
T7_05092_G03	TTTTCTCCCTTTCCCCTGTCTCCCTTTTCCCCTTTC
T7_05093_G03	CTTCCCTTCCTTTCCCCGTCTTCCTCCTTTTTTCCT
T7_05094_G03	TTCCTCCCTCCCTTTTCGTCTTTTTCCTCCTTTCCC
T7_05095_G03	TTTCCTCCCTCCTCTTTGTCTCTCCTTTTTCTCCCC
T7_05096_G03	TCCCCTCTTCTTTTCCCGTCTCCCCTTCCTTTTTTC
T7_05097_G03	CTCCTCCCCTTTCCTCCGTCCCTTTTTCTTTTCCTT
T7_05098_G03	TTCCCTTTTTTCTCCCCGTCTTTTTCCCCTCCCCTT
T7_05099_G03	TTTTTCCCTCCTCCTCTGTCCTTCTTTTCCCTCCTC
T7_05100_G03	CCTCCCTTTCTTCTCCTGTCCCTTCTTCCCTTTTCT
T7_05101_G03	CTCCTTTTCCCCTCTTTGTCTCCCTTTCTCTCCCTT
T7_05102_G03	CTCTCTTTTTTCCCCTCGTCCCCTTTCTTTCCTCCT
T7_05103_G03	CTTCCCTCTTTTTTTCCGTCCCTTTCCCTTTTCCCC
T7_05104_G03	TCCCCTTTTTCTTTCCTGTCTCCCTTCTCTCCCCTT
T7_05105_G03	CCCTCCCTTCTCTTCCTGTCCTTTCCTCCTCTTTTT
T7_05106_G03	TCCCTCTCCCTTCTTCCGTCCTTTTCCTTTTTCCTC
T7_05107_G03	TTTTTCCTCCTTCTCCCGTCCTTTTCCTCCCCTTCT
T7_05108_G03	TTCTTCCTTCCCCTTCCGTCCTTTTTCCTCCCCTTT
T7_05109_G03	CCCTCCCCTTTTTTTTTGTCTCCCTTCCCTCCTTTC
T7_05110_G03	TTCCCCTTCTTTCCCCTGTCTCCTTCCCTTTTCCTT
T7_05111_G03	TCCCTCCCCTTCCTTTTGTCTTTCTCCCCTTTTTCC
T7_05112_G03	TTTTTTCCTTCCCTCCCGTCCTCCCCTCCTTTCTTT
T7_05113_G03	CTCCCTTTTTTCCCTTTGTCTTCCCTCCTCCCTTCT
T7_05114_G03	CCCTTCCCCTCCTTTCCGTCCCTTTTTTTCCTTTTC
T7_05115_G03	CTTTTTCCCCTTTCTTCGTCCCCTTTCCCTTTTCCC
T7_05116_G03	CCCTTTCCCTCTTTCCCGTCCTTTTCCTCTCCTTTT
T7_05117_G03	CCTCTTCCCTTTTCTCTGTCTCTTTCCCCTCTTTCC
T7_05118_G03	CCCTCCTTTTTCCCTTTGTCCTTTTTCCCTCCTTCC
T7_05119_G03	TTTCCTCCCTTTTTCCCGTCTCCTTCCTCTCCTTTC
T7_05120_G03	CTTCCCTTTTCTCCTCCGTCCCTTCCTCTTCTTTTC
T7_05121_G03	TCTTTTCCCCTCCTTTTGTCCTTTTTCCCTCCCCTC
T7_05122_G03	CCTTCTCTTTTCTCCCCGTCTTTCCTTTCTCCCCTT
T7_05123_G03	CTTCCCTTTTTTTCTTTGTCCCCTTCCCCTCTTCCC
T7_05124_G03	TTCTCCCCTCCCTCTTCGTCTTTCCCCTTTTTCCTT
T7_05125_G03	TTTCCCTCCCTTTTTTTGTCCCCTTCCTCCCTCCTT
T7_05126_G03	CCTCTTCCTTCTTTTTTGTCCCCTTCCCCTCTTTCC
T7_05127_G03	CTTTCCTCTCTTCCCTTGTCTTCTTCCCCTTCTCCT
T7_05128_G03	CCTTTTTCTTTTCCCTCGTCTTTTCCCTCCTTCCCC
T7_05129_G03	TCCCCTTTTTCTTCTCCGTCCCTTTTCCCTCTTCCT
T7_05130_G03	TTTTCTTCTCCTCTTCCGTCCTTCCCTTTCTCTCCC
T7_05131_G03	TCCCTCCCTCTTTTTTCGTCCTTCCCTTCCCTCTTT
T7_05132_G03	TTTTTCCTTTTCCCCTTGTCCCTCCCTTTCCCCTTC
T7_05133_G03	TTCCCCTCCCCTCCCTCGTCTTTTTTTCCCCTTTTT
T7_05134_G03	TCCTTCCTTCCCCTCCCGTCTCTTTTCCTTTCCTTT
T7_05135_G03	TTTTTTTCCCCTCCTCTGTCCCTTTCCTTCTTCCCC
T7_05136_G03	TCCCCTCTTTCCCTTCCGTCCCTTTCCCTTTTTTCT
T7_05137_G03	TTCTCTTTTCCCCTCCCGTCCTTTCCTTCTTTCCCT
T7_05138_G03	CCTTTCCCTCCCCTCCCGTCCTTTTTTCCTTTTCTT
T7_05139_G03	CCTTTTTTTCCTCCCTTGTCTTCTCCCCTCCTTTCC
T7_05140_G03	CTCCCCTTTTTCCTCTTGTCTTTCTTCCCTTTCCCC
T7_05141_G03	TTCCTTTCCCTTTTTTCGTCTCCCTCCTTTCCCCTC
T7_05142_G03	CTTTCTCCTCCCCTTCTGTCCTTCTCTTCCCTTCTT
T7_05143_G03	TTCCCCTTTTTTCTCTCGTCTTTCTCCCTCCCCTCT
T7_05144_G03	CCTTTCCCCTCCCCTTCGTCCCCTTTTTCTTTTTCT
T7_05145_G03	CCTTTTTTTTCTCCCTTGTCCCTTTCCCTTCTCCCC
T7_05146_G03	TCTTTTCCCTTCTTTTCGTCCTCCTCCCTCTCCTCT
T7_05147_G03	CTTTCCTCCTTCCCTCTGTCTCTCCCTTTTCCCTTT
T7_05148_G03	TCCCTTCCCCTCTCCTTGTCTTTTCCCTTCCCTTTT
T7_05149_G03	CCTTTCCCTTTCCCTTTGTCTCTTTCCCCTCTCCTT
T7_05150_G03	CCTTTTTTTTCCCTCCCGTCCTTCTTCCTCTTTCCC
T7_05151_G03	TCCCTTTCCCTTTTCCCGTCTTTTCCTCCCTTTTCC
T7_05152_G03	CCCTCTCCCCTTTTCCCGTCTTTCTTTTCCCCTTTT
T7_05153_G03	CCCTTCCCTCCTTTTTTGTCTTTCCCTTTCCCTCTC
T7_05154_G03	CTCCCTTTTTCTTTTCCGTCCTTTCCCTTTCTCCCC
T7_05155_G03	TTTTCCCCTCTCTTTCTGTCTCCTTTTCCCTCCCCT
T7_05156_G03	CCTTCCTTTTTTTTCCCGTCTCCCTTCCTTTTCCCC
T7_05157_G03	TTTTTTCCCCTTTTCCCGTCCTTCCCTTCTTTCCCC
T7_05158_G03	CTTCCTTCTTCCCTTTTGTCCTTCCTTCTTCCTCCC
T7_05159_G03	TTTTCCCTCTCCCTCTCGTCCTCCTCCCTTTTTTTC
T7_05160_G03	CTTTCCCTCTCCTCTTCGTCCCCTCCCTTTTTCTTT
T7_05161_G03	CCTCCCTCCCTCTTTCCGTCCTTTCCTTTTTTTTCC
T7_05162_G03	TCCCTTTCTTTCTTTTTGTCTCCTCCCCTTCTCCCC
T7_05163_G03	TTTTCCCTCTCCCTTTTGTCCTTCTCTCCCCTTTCC
T7_05164_G03	TTTTTTTCCCCTTCCTTGTCCCTCCCCTTTCCTTCC
T7_05165_G03	TTTCTTCTTTTCCCTTCGTCTCCTCCCCTTCCCTCT
T7_05166_G03	TCCTTCCTTTCCTTTCCGTCCCTTTTTTTCCTCCCC
T7_05167_G03	CCTCTTCTTTTCTCTCCGTCCTTCCCTTTTTTCCCC
T7_05168_G03	CCCTTTTCCCTCCCTTTGTCCCTTTCTTTCCCTTCT
T7_05169_G03	CCCTCCTCCTCTTTCCCGTCCTTTTCCTTTCCTTTT
T7_05170_G03	TCTTCCTTTCCCTCCCTGTCTCTTTCTTTCTCCCTC
T7_05171_G03	CTCCTCCCTCTTTTTCCGTCCCTCCCCTTTTTTTTC
T7_05172_G03	TCCCCTTTTCTTTCCCCGTCTCCCCTTTTTTCCCTT
T7_05173_G03	TTCTCCCCTCCCTTTCTGTCTTCCCCTTTTTCCCTT
T7_05174_G03	CTCTTCTCCCTTTTTTTGTCTCCCTTCTCCCCTTCC
T7_05175_G03	CTTTTTTTCCCCTCCCTGTCTCCTCCTTCCTCTTCT
T7_05176_G03	CTCTTCTTCCTTTTTCTGTCCCCTCCTTCCCCTTTC
T7_05177_G03	CTCCCTTTTTTTTCCTCGTCTTTCCCTCCCCTTTCC
T7_05178_G03	TTCCTCTTCTTCCCTTCGTCCTCTTTCCCTTCCCTT
T7_05179_G03	CCCTTCTCTCCCTCTTTGTCCTCCCTTCTCTTTTCT
T7_05180_G03	CTCCTTCCTTTCCTCTCGTCCCTTTTTCCTTTCCCT
T7_05181_G03	CCTTTTCTTTCCCTTCTGTCTCCTCCCCTCCCTTTT
T7_05182_G03	TTCCTTTTTCCTCTCCCGTCCTTTTCTTCCCCTTCC
T7_05183_G03	TTCTTTTTTCCTCCTTTGTCCCTCCCCTTCCCTTCC
T7_05184_G03	CTTCTCCTTCCCTTTTCGTCTTTCCCCTCTCTTTCC
T7_05185_G03	TTTCCCTTTCCTTTTTTGTCCCCTTTCCTCCCTCCC
T7_05186_G03	CCTCTTCCCTTTCCCCTGTCTTTCTCTCCTTTCCTT
T7_05187_G03	CCTCTTCCTTTTTCCCTGTCTCCTTTTTTCCTCCCC
T7_05188_G03	TCTCCCTTCCTTTCCCCGTCTTTTTTTCCTCTTCCC
T7_05189_G03	CCTTCTTTCCTTTCCCTGTCTTCCTCCCCTTTTTCC
T7_05190_G03	TTTTCTCCCTCCCCTTTGTCTTTCCCCTCCTCTCTT
T7_05191_G03	TTTCTTCTCCTTCCTCCGTCTTTTCCCCTTCCTTCC
T7_05192_G03	TCTCCTTCTTTCTCCCTGTCTCCCCTTTTTTTCCCC
T7_05193_G03	CCTTCCCTTTCCCCTTTGTCCCCTTTCCCCTTTTTT
T7_05194_G03	CCTTCCCTTTTTCCCTTGTCTCCCTTTTCCCCTTCT
T7_05195_G03	TTCTTTCCTCCTTTCCCGTCTTCCCCTCCCTCTTTT
T7_05196_G03	TTTTTCCCTCCCTCCTTGTCTTCTTCCCCTCTTCCT
T7_05197_G03	CCTCCCTTCCTCCTCCTGTCTCTCTTCTTTTCCTTT
T7_05198_G03	TTTTTCCCCTCCCCTCCGTCCTTTTTTTCCCCTTTC
T7_05199_G03	TTCCTTTTCCTCCCTTCGTCCCCTTTCCCTTTTCCT
T7_05200_G03	TCCCCTTTTCCTTTTCTGTCTCCCCTTCTCCCTTTC
T7_05201_G03	CTTTTTTTCCCCTTTCCGTCCTTCCTCCCCTTCCTT
T7_05202_G03	CCTCTTTTCCTCCCTTTGTCTCTTCCCTTCTTTCCC
T7_05203_G03	TCTTTCCCTTCCTTCCCGTCTCCTTTTCTTCCTCCT
T7_05204_G03	TTCCCTTCCCTTCTTTTGTCTTCCCTCCTCTCCTTC
T7_05205_G03	CCCTCCTTTTTCTTTTCGTCCTCCTTCCTTTCCCCT
T7_05206_G03	CCTCCTTTCTCCCTCTCGTCCCCTTTTCTCCTTTTT
T7_05207_G03	TCTCCCTTTCCTTTTCCGTCCCTTTTTTCCCTTCCC
T7_05208_G03	TCCTCTTTCTCCTCTCTGTCCTTTCCCCTTCCTTTC
T7_05209_G03	TTCTTTTTCTTCTCTCCGTCTTTTCCCCTCCCCTCC
T7_05210_G03	TTTCTCCTCCCTCTCCCGTCCTTTCTCTTTTCTCCT
T7_05211_G03	TTTTTCCCTCCTCTTTTGTCCCTCCCCTTCTTTCCC
T7_05212_G03	CTCTCCTCTCTTTCTTTGTCCCTTCTTTCCTCCCTC
T7_05213_G03	CCTCTTTCCCTCCCTCCGTCTCCTTCTTTTTCTTTC
T7_05214_G03	CTTCCCTTCCCCTCCTTGTCTCTTTTCTTTCTCCTC
T7_05215_G03	TTCTTCTTTTCCTTCTCGTCCTTCTCCTCCTCCTCC
T7_05216_G03	TTTTTTCCTTCCCCTTTGTCTCCTTCCTCCCTCCCT
T7_05217_G03	CTTCCCTTTTTCTCTTTGTCCCTCTTCTCCCTCCCT
T7_05218_G03	TCTCCCTCCCTTTCCTCGTCTCCCCTTTTTTTCTTC
T7_05219_G03	TCCTCCCTTTTCCCTCCGTCCTTTCTTTTCCCTTTC
T7_05220_G03	CCTCTTCTCCCTCCCCTGTCCCTTTTTTTCCTCTTT
T7_05221_G03	CTTTTCTCCTTTCCTCCGTCTCTTCCCTCTTTCCCT
T7_05222_G03	TTCCTTCCCCTCCTTTCGTCCCTTTCTTTCCTTCTC
T7_05223_G03	CCTTTCTCCTCCTCCCCGTCTTCTTCCTTTTTTCCT
T7_05224_G03	TTCCCCTTTTCCTTCCCGTCCTTCCTTTTTTTCCCC
T7_05225_G03	TCTTTTCCCCTCTTTCCGTCTTTCTCTTTCCCTCCC
T7_05226_G03	TTCTTTTTTCCCTCCCTGTCCCCTTCCTTCTTCCCT
T7_05227_G03	CTCTCCCCTCTTTTTTCGTCCCCTTCTTCCTCCTTT
T7_05228_G03	CCCTTCCCCTTTCTTTTGTCCTCCTTTTCCCTCTTC
T7_05229_G03	TCCTCCCCTTTCCCCTCGTCCCCTTTTTTTTTCTTC
T7_05230_G03	TCCCCTTTCCTTTTTCCGTCCCTCCTTTCCTTCTTC
T7_05231_G03	TCCCTTTTTTCCTCTCTGTCCCCTTCTCTTTTCCCC
T7_05232_G03	TTCCCTCCTTTCTTCTCGTCCTCTCCTTCTCTCTTC
T7_05233_G03	TTTTCCCCTTTTTCCTTGTCTCCTCCTCCTTCTCCC
T7_05234_G03	TCTCCTTCCTTCTTCCCGTCCTTCTTCTCTTTTCCC
T7_05235_G03	TTCTTTTCCCTCCTCTTGTCCCTCTTTCTTCCTCCC
T7_05236_G03	CTTCCCTTTTCCCCTTTGTCTCCCTTTCCTTCTTCC
T7_05237_G03	CCCTCCCCTTTTCCTTCGTCCTTTCTTTCCCCTTTT
T7_05238_G03	TCCCTTTTCCCCTCTTTGTCTTCTCCTTTTCTCCCC
T7_05239_G03	CCCTCCCTTTTTCCTCCGTCTTTTTCTTCTTTCCCC
T7_05240_G03	TTTTTTTCCCTCTCCTCGTCCTTTCTCCCCTTCCCT
T7_05241_G03	CTTTCTCCCTCCCCTTTGTCCCTCCCTCCTTTTTTT
T7_05242_G03	TCCTCCCCTTTTCTTTTGTCTTCCTCTCCTTCCCCT
T7_05243_G03	TTTCCTCCCCTCCTTCCGTCTTCTCTTTTTCTCCTC
T7_05244_G03	CCTCCCCTCCCTTTTTTGTCTTCTCTTCCCCTTTTC
T7_05245_G03	CTTTCTTTCTCTCTCCTGTCCTTTTCCCCTCCCTTC
T7_05246_G03	TTCCCCTCTTCCTCTTCGTCTCCCCTTTTTCCTTTC
T7_05247_G03	CTTTCCTCCTTCCCCTTGTCTCTTCTTCTTCCCCTT
T7_05248_G03	CCTTCCTCCTTTTTCCCGTCTTCCTTTCCTCTCTCT
T7_05249_G03	TCCCTTTTTTCCCTTTCGTCTCTCCCCTCTCTTCCT
T7_05250_G03	CTTCTCCCTCTTTCCTTGTCTTCCTCCTTTTCCCCT
T7_05251_G03	CTTTCCCTCCTTTCCCTGTCCTTCTCCTTCTTTCTC
T7_05252_G03	CTTCTTTCTCCTCTCCCGTCTTTTCTTCCTTCCTCC
T7_05253_G03	CCCTTTCCCCTCCCTCTGTCTTTTTTTCCCCTTTTC
T7_05254_G03	CCCTTTTCTCCTTCTCTGTCCTCCCCTTTCCCTTTT
T7_05255_G03	CCCTCCCTTTTCCTTTTGTCTTTTCCTTCCCTCTCC
T7_05256_G03	TTCCCTTCCTCTTTCTCGTCCCCTTCTTCCTTTTCC
T7_05257_G03	CTCTCCTTTTTCCTTTTGTCTTCCCCTCCTTCTCCC
T7_05258_G03	TCTCTTTTCCCTTTTCTGTCTCCCCTCCCCTTCCTT
T7_05259_G03	CCTCTTCTCCCCTTTCTGTCTTTTCTCCCTTTCTCC
T7_05260_G03	CTCCCCTTTTTCCCTTTGTCCCTTTTTCCCCTCTCT
T7_05261_G03	TTTTCTTTCCTCCCTTTGTCCTCCCCTTTTCCCTCC
T7_05262_G03	CTTTTCCCTCTCTTTCTGTCCTTTCCCTCCCTTCTC
T7_05263_G03	CCTTCCTCTTTCTCCCCGTCTTTTCCCTCTTTTTCC
T7_05264_G03	TCCCTCTCTTTCCCCTCGTCCTTTCTTCCCCTTTTT
T7_05265_G03	CTTTCCCTCCTCCCTCCGTCTTTTCTCTCCTTTCTT
T7_05266_G03	TCCTCTTCCCTTCTTTTGTCTTCTCCCTCCCCTTTC
T7_05267_G03	CCCTTTTTCTTTTCCCTGTCTCCTTTTCTCCCTCCC
T7_05268_G03	CTCCCTCCCCTTCTCCTGTCTCTTTTTTTCTTCCTC
T7_05269_G03	TTTCCCTCTTCCCTCTTGTCTCCTCCCCTTCTTTTC
T7_05270_G03	CCCTTTTTCCCCTTCCCGTCTTTTCTCTTCTCCTTC
T7_05271_G03	TCCTCTCTCCCTCCTTCGTCTTCTCTTCCCTTTTTC
T7_05272_G03	CCTTCTTCCCTCCCCTTGTCCCCTCCTTTCTTTTTT
T7_05273_G03	CTTTCCCTTTTCCTCCCGTCTTTCCCCTCCTCTTTT
T7_05274_G03	CCTTTCCTTTCTTTTCTGTCTCTCCCTCCCTTCCTC
T7_05275_G03	TCCTTCCCCTTTTTTTTGTCCCCTTTTCCCTTCCCC
T7_05276_G03	CCCTCTCCTCTCTTTCCGTCTTTTTTTTCTCTCCCC
T7_05277_G03	CCTTCCCCTTTCCTCTTGTCTTTCCTTTTCCCCTCT
T7_05278_G03	CCCTCTCCCTTTTTTTTGTCTCCCCTTCCCTTCTTC
T7_05279_G03	CTTTTCCCTCCTTCTTCGTCCTCTTCTTCTTCCCCT
T7_05280_G03	TCTCCTCTTTCCCCTCCGTCTCTCCTCTCTTTTCTT
T7_05281_G03	CCCTCTCCTTTCCCCTTGTCCCCTTTTTTCTTCCTT
T7_05282_G03	CTTTCCTCCCTCTTTTTGTCCCTCCCCTTTCTTCCT
T7_05283_G03	CCTTTTCCCTTCCCCTTGTCCCTCTTTCTTCTTTCC
T7_05284_G03	CTTTCTTTCTCCTCCTCGTCTTTTTCCCCTTCCCTC
T7_05285_G03	CTTCTTTCTTCCTTTTCGTCCCCTTTCCCCTCTCCT
T7_05286_G03	TTTTCCCTCCCCTTTCCGTCCCTCTTCTTTTTTCCC
T7_05287_G03	TTTTCCCCTCCTCTCCCGTCTTCTCTTTTTCTCCCT
T7_05288_G03	CCTTTTCCCTTTTTTTCGTCCTTTCCCCTTCCCCTC
T7_05289_G03	TCTCTTTTTTTCCCTCCGTCTCTCTTCCTCTTCCCC
T7_05290_G03	TCCTCTCTCTTTTCCTCGTCTCCTCCTTTCCTCCTT
T7_05291_G03	CCCTTTCTCTTTTCCTCGTCTTCCCCTCCCCTTTTT
T7_05292_G03	CCTTCTCTCCCTTTCCCGTCTTTTTCTCCCTTTTCC
T7_05293_G03	TCCCTTTTTCTCCCTCTGTCTTCCTCCTTTCTTCCC
T7_05294_G03	CTTCTCTTTTTTCTCCTGTCTCCCCTCCCCTCTCTT
T7_05295_G03	TCCTTCTTTTTTCCTTCGTCCCTTTCTCCCCTCCTC
T7_05296_G03	CCTTTTTTTCCTCCTCCGTCCCTTTTTCCTCTCCTC
T7_05297_G03	TCCCCTTTTCCTCCCTTGTCCTCCCTTCTTTTTCCT
T7_05298_G03	TTTTTCCCTCTTCCTTTGTCCCCTTTCCTCCTTCCC
T7_05299_G03	TTCCTTTCCCTTTCCCTGTCCTCTCTTTCCCCTCTT
T7_05300_G03	TTTTCCTTCCTCCCTTCGTCCTCTTCTCCCTTTTCC
T7_05301_G03	TCCCTCTTTTCTCCTTCGTCCTTTTCCCCTTTTCCC
T7_05302_G03	TCCTTTTCCCCTTTCCTGTCTCTTCCCTCTTTTCCC
T7_05303_G03	CTCTTTTTTCCCCTTCCGTCCCTCCCCTTCTCTTTT
T7_05304_G03	TTTCCTCCCTTTCCTCCGTCTTTTCCCTTTCCTCCT
T7_05305_G03	CCTTCCCTTTCCTTCCCGTCTTTCCTTCTTCTTCTC
T7_05306_G03	TTCTCCCTTTTCCCTCCGTCCCTTCCTCCTTCTTTT
T7_05307_G03	TCCCTTCCTTCTCCTCCGTCTCTTCTCTTTCTTCTC
T7_05308_G03	TCCCCTCTTTTCCCTTCGTCCCTTTTCTCCCTTTTC
T7_05309_G03	TCTTTTCCCCTCCTTTCGTCCTCTCTCTTTTCCCCT
T7_05310_G03	TCTTTCCCTTTTTTTTCGTCCCTCCTTCCTCCCTCC
T7_05311_G03	TTTTTTTCTTTCCTTCCGTCTCCTTCCCTCCTCCCC
T7_05312_G03	TTCCCTTCTTCTCCCCTGTCCCTTCCCTCTTTCTTT
T7_05313_G03	TCCCTCTTTTCCCTCTCGTCTTCCTTTTTCCTCCCT
T7_05314_G03	TCCTTTTCTCCTCCCTCGTCTTTCCCCTCCTTTTCT
T7_05315_G03	TCTTCCCCTTCCCTTTCGTCCTCCCCTTTTTTTTCC
T7_05316_G03	TCCCCTCTTCTTTTTCCGTCCTCCTTTCCCTCCTTT
T7_05317_G03	TCTCCTTTCCCTTTCCCGTCTTTTCCTTCTTTCCCC
T7_05318_G03	CCTTTTTTTCCTTTCTTGTCTCCCCTCCTCCCCTCT
T7_05319_G03	CTTTTCCCTTTTCCCCTGTCTCCCTTCTCCCTTCTT
T7_05320_G03	TTCTTCCCCTCTCCTCTGTCCCTTTTTTTCTCCCTC
T7_05321_G03	CCCTTCCTTTCCTCCCTGTCCCTTTTTTTTTCTCCC
T7_05322_G03	CCCTCCCTTTTCCTTTTGTCCTTCCCCTCCTTCTTT
T7_05323_G03	TTTCCCTCCTCCCTTTTGTCTTTCCCTTCCCTCTTC
T7_05324_G03	CCCTTCCTCCCTTTTTCGTCCCTTTCCCTTTTTTCC
T7_05325_G03	TCTTTTCTTTCCTTCCTGTCCTCCTTCCTTCCCTCC
T7_05326_G03	TTTTTTTTCCCCTCCCCGTCTTTCTTCCTTCCCCTC
T7_05327_G03	CTTTCTTTCCTCCTTTCGTCCTTTCCTTTCCTCCCC
T7_05328_G03	CCTCCCTTCTTCCTTTTGTCCCTCCTTTTCCCTTTC
T7_05329_G03	TTCTTTTTTCTTCCTCCGTCCCTTCCCTCTCCCCTT
T7_05330_G03	CTTTTTTCCCCTTTTCCGTCCCTCCTCCCTTTTTCC
T7_05331_G03	TTCCTTCTCTCTTCTTTGTCTCCTTCCCTTCCTCCC
T7_05332_G03	CCCTTTTTCTTTCCCTCGTCTCTTCCCCTTCCCTTT
T7_05333_G03	CTTTCCTTCCCCTCCCTGTCCTCTTTTTCCCTTCTT
T7_05334_G03	TTTCTCTCCCCTCTCTTGTCTCCTTTTCCTCCCCTT
T7_05335_G03	CTTTTTCCTCCCTTTCTGTCTCCCCTCCTTTCCCTT
T7_05336_G03	TTTCCCCTCCCTTTCTTGTCCTTTTCCCCTCCCTTT
T7_05337_G03	CCTCCCTTTTTTTTCCCGTCCTCCTTCCTTTCCCTT
T7_05338_G03	TTTCCCCTTTTCCCTTCGTCTCTTCCCCTTCCCTTT
T7_05339_G03	TTCTCCTCCTCCTCCTCGTCCTTTTCCCTTCCTTTT
T7_05340_G03	TCCCCTTTTCTCCCCTCGTCCCTTTTTTCCCCTTTT
T7_05341_G03	CTCTCCTTTTCCCCTCTGTCTTTCCTCCCCTTTTTC
T7_05342_G03	CTTCCTTTCTTCTTCTCGTCCTTCTCCTTTCTCCCC
T7_05343_G03	TTTTTTCCCTTCCCTCCGTCCCTCCCCTTCTTTTTC
T7_05344_G03	CTCCTCTTTCTCCCCTTGTCCTCCTTTTTCCTTTCC
T7_05345_G03	TCCCCTCCTTCCCTTTTGTCCCCTTTTTCCCTCTTT
T7_05346_G03	TCCCTCTTTTTCCTTCTGTCTTCCTCCCTCTTCTCC
T7_05347_G03	CTTTCCCTCCCCTCCTTGTCTCTTTTTTTCCTTCCC
T7_05348_G03	CCTTTTTTCCTCCTTTTGTCTCCTTTCCCCTCCCTC
T7_05349_G03	TTCCTTTTCCTTTTCCCGTCTCCCCTTCTTCCCTTC
T7_05350_G03	TCCCTTCCTCTCCTTTTGTCTTTTCCTCCTCTTCCC
T7_05351_G03	CTTTTCCCTTCTTTCCCGTCTTTTCTCCTCCCCTTC
T7_05352_G03	CTCTTTTCTCCTCCCCTGTCCTCTTCTTTTTCTCCC
T7_05353_G03	CCCTTTTTCCTCTTCTTGTCCTCTCCCTTCTTCCTC
T7_05354_G03	CTTCTTTTCCTTCTCCTGTCCTTCCCTCCTCCTCTT
T7_05355_G03	TTCCCCTCCCTTTTTTCGTCCTCCTCCTTTTTCCTC
T7_05356_G03	TCCTTTCCTCTTCCTTTGTCCCCTTCTCCTTCTCTC
T7_05357_G03	CCCTTCTCCCTCTTTCCGTCTTTTTCCTTCCTCCTT
T7_05358_G03	TTTCCCTCTCTTTTTTTGTCCCCTCCCCTTCCCCTT
T7_05359_G03	TTCTCCTCCCTCTCCTTGTCTTTCCTTTTTCCCTCC
T7_05360_G03	CTTTCTTCCCCTTCTTTGTCCCTCCCTCCTCTTTTC
T7_05361_G03	TCCTCCCTCTCCCCTTTGTCCTTTTCCCTTTCTTTC
T7_05362_G03	CCTCCTTTCCCTCCTCCGTCCTTTTTTTCTCTTCCT
T7_05363_G03	TCCTCCCCTCCTTCTTTGTCTCCTTTTTCCCCTTTC
T7_05364_G03	CTTCTCCCCTTTTTCCTGTCTTCCTTTCCTTCTCCC
T7_05365_G03	TTTCCTCTTCCCTTTCCGTCCCTTTTTCCTCTCCCT
T7_05366_G03	CTCCTTTTCCCTTTCCCGTCTTTTTTTCTCCCTCCC
T7_05367_G03	TTCCTCTCCTTTCCCTCGTCCCCTTTCTCCCTTTTT
T7_05368_G03	TTTCCCTTCCCCTTTTCGTCCCCTCTTTCTCTCCTT
T7_05369_G03	CCCTTCTCTCTCCCTCCGTCTTTCCCCTTTTTTTTC
T7_05370_G03	CCTTCCTCTCCCTCCTCGTCCTTTTTTTTCTTCCCT
T7_05371_G03	TTTTCCTTTCCCTTTCCGTCCCTTCTTCCTCCCCTT
T7_05372_G03	TTCCCCTCCTTCTTCTTGTCTTTCCCCTTTTTCCCC
T7_05373_G03	CCTTCTTTTTTCTTCTCGTCCCTTCCCCTTCTCCCT
T7_05374_G03	CCCTTTTTTCTCCCTTTGTCTCTCTCTTTCCTCCCC
T7_05375_G03	TTCCCCTTCCCTTCTCCGTCCCTTCTCTCTTTCTTT
T7_05376_G03	TCCTTTTTTCCTCCCTTGTCCCTCTCTCTTTCCCCT
T7_05377_G03	TTCCCTCCCTTCTTCTTGTCTTTCCTCCCTTTCCCT
T7_05378_G03	CTTCCCCTCCTTTTCCCGTCCTTTTCCTTCCTTTCT
T7_05379_G03	TCCTTCTCCTCCCTCTTGTCCTTTCCTTTCCTTTCC
T7_05380_G03	TCTCCCCTCTTCCTTCCGTCTTTTCCCTTTCTTTCC
T7_05381_G03	TCCTCCTTCCCTCTTCCGTCCCCTTTTTCTTTTCTC
T7_05382_G03	CCTCCCTTCCTTTCCCTGTCTTTCTCCCTTTTTCCT
T7_05383_G03	CCTTCTTCTTCCCCTTTGTCTCTTCTCTTCTCTCCC
T7_05384_G03	CTCCTTTCTTTCCCTCCGTCTTTTCTCCTTCCTCCT
T7_05385_G03	CCCTCCCTCCCTTTTTTGTCCTTTCTCTTTCCCTCT
T7_05386_G03	CCCTTCCTCTTTCTTTTGTCTTCTCCCCTTTTCCCC
T7_05387_G03	TTTCCCTCCCCTTCTTCGTCTTCTTTTCCCCTCCTT
T7_05388_G03	TTCTCCTCCCTTTTTCCGTCTCCCCTTCTTTTCCCT
T7_05389_G03	CTTCTTCTTTTTTCCCTGTCTTCCCTCTTCCCTCCC
T7_05390_G03	CCTCTTTTCCTCTTTTTGTCCCCTTTCCCCTTCCCT
T7_05391_G03	CCTTTTCCCTCTTCCCCGTCTTCTTCCCTTTTCCTT
T7_05392_G03	CTTCCTCCTTTTTCTCTGTCTTCCCTTCCCTTTCCC
T7_05393_G03	CCCTCTTTTTTTTCCTCGTCCTTCCCTCTTCCTTCC
T7_05394_G03	CCTTTCCCCTCCCCTCCGTCTTTTTCCTCTCTTTTT
T7_05395_G03	TTTCCCCTCCCCTCTTTGTCTTTCTTCTTCCCTCTC
T7_05396_G03	TTTCTCTCTCCTTTTTCGTCCCTTTCCCCTTTCCCC
T7_05397_G03	CCCTCTTCTTTCTTTCCGTCTCCTCCCTCCTTTTCT
T7_05398_G03	CCCTCTCCCCTTCCTTCGTCTTTCTTTTCTCCCTTT
T7_05399_G03	TCCCTCCTTTCCCCTTTGTCTTCCCTCCCCTTTTTT
T7_05400_G03	CCTTCCCTCTCCCTCTTGTCCCTCTTCCTCTTTTTT
T7_05401_G03	TTTTTCTCCTCCCTCCCGTCTTTTCCTTCCTCCCTT
T7_05402_G03	CTTTTTTCCCTTTTCCTGTCTTCTCTTCCCCTCCCC
T7_05403_G03	CCCTTTCCCCTTCCTTTGTCCCCTTCCCCTTTTTTT
T7_05404_G03	CTTTTTTCCTTCCTTCCGTCCCTCCTTTTCCTCTCC
T7_05405_G03	CTTTCCCTTCCCCTTTTGTCCCTTCCCTTCTTCTTC
T7_05406_G03	CCCTTTCTTTCTTCCTCGTCTCCCCTTCCCTTTCTT
T7_05407_G03	TCCCTTCTCCTTTCTTTGTCCTTTCCCTCCCCTTTC
T7_05408_G03	TTCCTTCTCTCTCTTCCGTCCTCCCCTTTTCCTTCT
T7_05409_G03	TTTTTCCTCCTCCTTCCGTCCCTTTCCCCTTTCCTT
T7_05410_G03	TTTTCCCTTTTCCTTCCGTCCCTTTCTTTCCTCCCC
T7_05411_G03	CCTCTTTTCTCTCTTCTGTCTTTTCCTCCCCTCTCC
T7_05412_G03	TTTCTTCCTCCTCCTTTGTCTCCTCTTCCCTCCCTT
T7_05413_G03	CCTCTCCCTTTTTTCTCGTCCCCTTCTTCCCCTTTT
T7_05414_G03	CTTCCCTCCCTCCCCTCGTCTTTTTTTTCCCTTCTT
T7_05415_G03	TTCTCCCTTCTTTCCTTGTCTCCCCTCTTCTTCCCT
T7_05416_G03	TTTCTTTCTCTCCCTTTGTCTTCTTCCCCTCCTCCC
T7_05417_G03	CCTTCTTCTTCCCCTTCGTCTCCCCTCCTTTCTTTT
T7_05418_G03	CTTTCTTTCTCCCTTCCGTCTTTCCTCCTTTTCCCC
T7_05419_G03	TTTCCCTTTCCCTCCCTGTCTTTCCTCTCCTTTCTC
T7_05420_G03	TCTCCCCTCTTCTTTCCGTCCTTTCCTTTCTCCTTC
T7_05421_G03	CTTTCCCCTTTTCCCTTGTCTCCTTCTTCCCTCTTC
T7_05422_G03	TCCTTTCCTCCCCTCTTGTCTTTCCCCTTTCTTTCC
T7_05423_G03	CTTTTCCTCTTTCCCCTGTCTTCCCCTTTCCCCTTT
T7_05424_G03	TTCCCTCCCCTTTCCCTGTCCCTCTTTTTTTTCCTC
T7_05425_G03	TCTCTCCCCTTCCCCTCGTCCTTCCTTTCTTTTCTT
T7_05426_G03	TCTCCTCCCTTCTCTCTGTCCCCTTTTCTTTCCCTT
T7_05427_G03	CCCTTTCCCCTTCCCCTGTCCTTTTCCTTTCCTTTT
T7_05428_G03	CCTTCTCTTTTCTTCCTGTCCTCCCTTTTCCTCCCT
T7_05429_G03	CTTCCTCCTTTCTTCCTGTCCTCTTTCCTTTCCCCT
T7_05430_G03	CTCCCCTCCTCCCTTTTGTCTTTTTTCTCCCTTTCC
T7_05431_G03	TCCCCTCTCCTTTTCTCGTCCCTTTTCTTTTTCCCC
T7_05432_G03	TCCTCCCTTTTTTTCCTGTCTCCTTCTCCCTCCTTC
T7_05433_G03	TCCCCTTCCCCTTTCCTGTCTCTTTCTTTCCTCCTT
T7_05434_G03	CTCCCCTTCCTTCCCTTGTCTCTTTCCTTTCCTTCT
T7_05435_G03	TTTTTTCTTTCCCCTCCGTCTTTTCCTCCCCTTCCC
T7_05436_G03	TCTTTTCTTCCCCTTTCGTCCCCTTTTCTTCCCTCC
T7_05437_G03	CTTTCCTTTTCCCTCCCGTCTTCCCCTTTTCCCTTT
T7_05438_G03	TTCCCCTTTCTCCTCCCGTCTTCTTTCTCCTTTCCT
T7_05439_G03	CCCTTTCTCCCCTCTTTGTCCCTTTTCCTTTCTCCT
T7_05440_G03	CCCTTTCCCTCTTTTCTGTCTTTCCTTCCCTTCCCT
T7_05441_G03	CTCTTCCTTCTTCTCCTGTCTTCCCCTTTTTCCCCT
T7_05442_G03	TTCTTCCTTCCTCCTTTGTCTTCCTCTCTCTTCCCC
T7_05443_G03	TCTCCTCCTTTTTCCCCGTCTCCTTTCCCCTCTTTT
T7_05444_G03	TTTCCCCTCTTTTTTTCGTCCTCCCCTCTCTTCTCC
T7_05445_G03	CTCTTCCTTCCCTTTTCGTCCCCTTCCTTTTCTTCC
T7_05446_G03	TTTCCTCCCTTCTTCTTGTCTTCCTTTCCCCTCCCT
T7_05447_G03	TTTTTTCTCCCCTTCCTGTCTTCTTCCCTTCCTCCC
T7_05448_G03	TCCTCCTTTCTCCCTTCGTCTTCCTTTCCCCTTCTT
T7_05449_G03	CCTTTCCTCCTTTTTCCGTCCCTCTCCTTCTTTTCC
T7_05450_G03	CCCTCCTTTCCCTTTTCGTCTCTTTTCCCTTCCTTC
T7_05451_G03	TCCTCTTTTTTTTCCTCGTCCCCTCCTTCCCTCTCT
T7_05452_G03	TTTCCTCCTCCCCTCTCGTCCCCTTCTTCTTTTTTC
T7_05453_G03	TTCTCCCTTTTCCTCCTGTCTCCCTCCTTTTTTCCC
T7_05454_G03	TTCCTTTCCCCTTTCCTGTCCCTCCCCTTCTTTTCT
T7_05455_G03	CTTTCCCCTTTTCCTTCGTCCTCCCTTTCTTCCCTT
T7_05456_G03	TTCCCTTTCCCCTTTTCGTCCTCCTTCCTTTCCTTC
T7_05457_G03	CCTCCTTTCCCCTTTCCGTCCTTCCCTTTTTTCCTT
T7_05458_G03	CCTCCTCTTCCTTTTCTGTCTTTCCCCTCTCTCTCT
T7_05459_G03	TTTCCTCTTTTCTTTCCGTCTCCCCTCCCCTTTCCT
T7_05460_G03	CCCTTCTTTCCCTCTTTGTCTCCCTCTTCTCTTCCT
T7_05461_G03	TTCCCTCCCCTCCTTTCGTCTTTTCTTCCCCTTTTC
T7_05462_G03	TCCCCTTTCTCTTTCTTGTCCTTCCCCTCTCCCTTT
T7_05463_G03	CCCTCTTCTTTTTCCCTGTCTCCCTTCCTCTCTTCT
T7_05464_G03	TTTCCCTTCCTCTCCCTGTCTTCTCTTCCTTCCCTT
T7_05465_G03	TCTTTTCTTCCCTCCTTGTCCTCTCCCTCCCTTTTC
T7_05466_G03	TCCTTTTTCCCTTTCCTGTCTCTTTCCCCTTCTCCC
T7_05467_G03	CCTCTCTTCTTTTTCCCGTCTCTTTTTTCCCTCCCC
T7_05468_G03	CTTCTTTTCCTTTCCTCGTCTTCCTCCCCTTCTTCC
T7_05469_G03	CCTTTCCCTTTCTTCCTGTCTTTTCTCTCCCCTTCC
T7_05470_G03	CTCCCCTTCTTCCCTTTGTCCCTTCCCTCTTTCTTT
T7_05471_G03	TTCTCTCTTTTTCCCTTGTCCCCTCTCCCTTTTCCC
T7_05472_G03	TTCCCTCCTCCTCCTCCGTCCTTTTCCTTCTCTTTT
T7_05473_G03	TTTCTCCCCTTCTTTTCGTCCTTTCTCTCCCTCCCT
T7_05474_G03	TTCCCCTTTCCTCTTCTGTCTTTTTTCCCTCCCCTC
T7_05475_G03	CTTTTTCTTCCCTTTTTGTCTCCCTTCCCCTTCCCC
T7_05476_G03	TTTTTTCCCCTTCCCCTGTCTCCTTCTCCTCTCCTT
T7_05477_G03	TTCCCTTCCTTTTCCCTGTCTCCCCTTTTTTCTCCC
T7_05478_G03	TTTTCCCCTTCCTTTTTGTCTTCTCCTCCCCTCCTC
T7_05479_G03	TCTCCCTTCCCTTTTTTGTCTCCTCCCTTCCCTTTC
T7_05480_G03	TCCTCTTCCTCTCTTCCGTCCTTTTCCCTTCCCTTT
T7_05481_G03	TCCCCTTTCCCTTTTCCGTCTTTTCCCCTTCCCTTT
T7_05482_G03	CTTCCTCCCTCTTCCCCGTCTCTCCTTTTTTTCCTT
T7_05483_G03	TCTTTTCCTCTTTCCCCGTCTTTTCCCCTTTCCCTC
T7_05484_G03	TCCTCTTCTTTTCCCCTGTCCCCTTCCTTCCTTTTC
T7_05485_G03	CTTCCCTTCCCTCCTTCGTCCTTCTTCCTTCCTTTT
T7_05486_G03	TTCCTTCTTTTCTCCCCGTCCCTCTCCTCCTTTTTC
T7_05487_G03	TTTTCCCCTTCCTTCCCGTCTTCCCCTTTTTTCCCT
T7_05488_G03	TCCTCTCCTTCTTTTCCGTCCTTTTCTCCTTCCTCC
T7_05489_G03	CTCCCTTCCTTCCCCTTGTCTTTCCTCTTTTCCTTC
T7_05490_G03	CCTTTCCTTCTTTCCCCGTCTTTTCCTTCCCCTTCT
T7_05491_G03	TTCCCTTTTTCCTTTTTGTCTCCCCTCCCCTCCTCT
T7_05492_G03	TCTCCTCCCTTTTTCCTGTCCCTTTTTCTCTTCCCC
T7_05493_G03	TCTCCCTTTCTTCCTCCGTCTTCTTCTCCCTCCTTT
T7_05494_G03	TCCCTTTCTCTCTTCCTGTCTTCCCTTTTCCTCTCC
T7_05495_G03	TCTCTCCTCCTTTTCCTGTCTCTCCTTCCCTCTTTC
T7_05496_G03	CTCCCTCTCCCCTCTTTGTCCTTTTTTTTTCCCTCC
T7_05497_G03	TTTCCCTCCCCTTCCCTGTCTCTCTTTTTTCCCTTC
T7_05498_G03	TTTCTCTCTCTTTTCTCGTCTCCTTCCCTCTTCCCC
T7_05499_G03	TTTTTCCCTCCTTTCTCGTCCCTCCTTCTCCTCTCT
T7_05500_G03	TCTCTTTTCTCCTTTCCGTCCTCCTTTCCCTCCTCT
T7_05501_G03	TCCCTTTCCCCTTTTTTGTCCTTCCCCTTTCCCTTC
T7_05502_G03	CCTTTCTTCCTTCTCCTGTCCTCTCCTTCCTCCTTT
T7_05503_G03	TCCCCTTTCTTCTTCCCGTCCTTCTCTCTTTCCTCT
T7_05504_G03	TCCTTTCTCCTCCTCTCGTCTTTTCCTTTTCCCCTC
T7_05505_G03	TTTTTCTTCCCTCCCCTGTCTCCCCTCCTCCTTTTT
T7_05506_G03	TCCCTCTCTTCTTCCCTGTCTTCTTCCTCTTTCCCT
T7_05507_G03	CTCTCTCCCCTCCTTCTGTCTTTTCTTTTTCCTCCC
T7_05508_G03	CCCTTTTTCCCCTTTTCGTCCCTCTTTTTTCTCCCC
T7_05509_G03	TCCTTTTTTCTTCCTCTGTCCTTCCCTCTTCCCTCC
T7_05510_G03	TCCCTTTCTCTCCTTCTGTCCCCTTCCTCCTTTTTC
T7_05511_G03	TTTCCTTTTTTCCCTCCGTCCCCTTTCTTTCTCCCC
T7_05512_G03	TTTTCTTCCCCTCCTTTGTCTCTTTCCCTCTCTCCC
T7_05513_G03	CTTTTTCCCTTTTCCTCGTCTCTCCTCCTCCCCTTT
T7_05514_G03	CCTTTTCTTTCCTTTTCGTCCTCTCTTCCCTTCCCC
T7_05515_G03	CCTCTCCCTCTTCCTCCGTCCTCTTCCTTCTTTTTT
T7_05516_G03	TCTTCCCCTCCTTCCCTGTCTCCTTTTCTTTTCTCC
T7_05517_G03	TTTTTTCCCTCTCCCTTGTCTTCCCCTCCTCTCTTC
T7_05518_G03	CCCTCCTTTTCTTCCTCGTCTTCCTTTTTTCCTCCC
T7_05519_G03	TTTCCCTCCTTCCTCCTGTCTCTTTCCTCTTCCCTT
T7_05520_G03	TCTCCTCTCTTCCTTTTGTCTCCTTTCCCTTTCCCC
T7_05521_G03	CCTCTTTTCCTTTCTCTGTCCCCTTTTTTCCCTCCC
T7_05522_G03	CTCTTCTTCCTTCCCCTGTCTCCCTCCTTCTTTTTC
T7_05523_G03	TTTTCCCTTTCTCCTCCGTCCCTCCTTTTTCCCCTT
T7_05524_G03	CTCCTCCTTCCTTCCCTGTCTTTTTCCCCTTCTCTT
T7_05525_G03	CCCTTCCTCTCCTTTCTGTCTCCCCTCTTTTTCCTT
T7_05526_G03	TTCCCCTTCTTCCCTCCGTCCCTTTTTTTTTTCCCC
T7_05527_G03	TTCTCTCCCCTCCCCTTGTCTCTTCCTCTTTCCTTT
T7_05528_G03	TTTTCCTCCCCTTTTTCGTCCTCTTTCCCCTTCCCT
T7_05529_G03	TCTTCTCCTCTCCCTTCGTCCCTCCTTTCTTTCTTC
T7_05530_G03	TTCCCCTCTTCCCCTCCGTCCTCTTCTTTTCTCTTT
T7_05531_G03	TTTTCCTCTTCCCCTTCGTCTTTCCCCTTTTCCCTC
T7_05532_G03	CCCTTTCCCTTCTTCCCGTCTTTCTCTTCTCCTTTC
T7_05533_G03	TTTTTTCCTCCCTCCCTGTCCCTTTTCCTTTCCCCT
T7_05534_G03	TTCCTCCCCTTCCTCTCGTCTCTTTTCCCCTTTTTC
T7_05535_G03	CTTCCCCTTTTTTCTCCGTCTTTTCCCCTCCTTTCC
T7_05536_G03	TTTCCTTTCTCTCTCCTGTCTCTCTCCCTCCTTTCC
T7_05537_G03	TCCTCTTCTTTTTTTTCGTCCCTCTCTCCTCCCTCC
T7_05538_G03	TTCTCTTTCCCTTTCCCGTCTTCCCTCCTTCCTCTT
T7_05539_G03	TCCCCTTTTTCTTTTTCGTCCCTTCTCCCTCCCCTT
T7_05540_G03	TCTTCCCTCCTTCCCCTGTCTTTTTTCTTCCCCTTC
T7_05541_G03	CCTCTTTTTTTCCCTCCGTCCTCCCTTCTTCCTCTT
T7_05542_G03	CCTTCTCCCTCTTTCTTGTCCCTTCCCTTTTTTCCC
T7_05543_G03	TCCCCTTTCCCCTCCCTGTCCTTCTTTTTTCCCTTT
T7_05544_G03	CTCCTTCTCCCCTTTTCGTCTTTCCCTTTTCCCTCT
T7_05545_G03	CCCTTTCCTTCCCTTTCGTCTCCCTTTTTCCTTCCT
T7_05546_G03	CCCTTTTTTCTTTTCCTGTCCCTCCTTCCTCTTCCC
T7_05547_G03	CCCTTTCTCTTTTTTCCGTCCTTTTCCCCTCCTTCC
T7_05548_G03	CCTTCTCTTCCTTCCTCGTCCTCTCCTTTCCCTTTT
T7_05549_G03	TTTCCTTTTTTTCTCCCGTCTCCCCTCCCTCTTTCC
T7_05550_G03	TCCTTTCCTCTCTTTTTGTCCTCCCCTTCTTCCCCT
T7_05551_G03	CCCTCCCTTTTTCCCCTGTCCTTTTTTCCCTCTTTC
T7_05552_G03	CCTTTTTTTTCCTTCCCGTCCTCCCTTTCCTTCCCT
T7_05553_G03	TTCCCTTCCCTTTTTCTGTCCCTCTCCCTCTTCTCT
T7_05554_G03	TTCCCTCCTCCCTCCTTGTCCCCTTCTTTTTTCCTT
T7_05555_G03	TTTCCTTTTTCTCCCCTGTCCCCTTTTCCTCCCTTC
T7_05556_G03	CCCTTTCCCTTTCCTCTGTCCCCTCCTTTTCCTTTT
T7_05557_G03	TTTCCCTTTCCTCCCTCGTCTCTTCCCCTTCCTTTT
T7_05558_G03	CCCTTTCTTTTCTCCCTGTCCCTCCTTTTTTTCCCC
T7_05559_G03	CCTTCTTTTCTCCTTTCGTCCTTCCCTTTCCTTCCC
T7_05560_G03	TTTTTCCCTTTTCTCCCGTCTCCCCTTCCCCTTCTT
T7_05561_G03	TCCCTCCCCTTCTTTCCGTCTTTCTTTCCCTTTTCC
T7_05562_G03	CCCTCCTCCCTTTCTTCGTCTTTCCTTCTCCTTTTC
T7_05563_G03	TCCTCCTCTCCCTTTCTGTCTTCTTTTCTCCCCTTC
T7_05564_G03	TTTTTCCCCTTCTCCCTGTCTCCTTTCTTCCCTCTC
T7_05565_G03	CCCTCCTTCCTTTTCTTGTCCCTTTTCTTCTCCCTC
T7_05566_G03	CTTTCTCTTCCTTCTTTGTCTTCCCCTTTCCCCTCC
T7_05567_G03	CCTTCTCCTCCCCTTTTGTCCTCTTCCCTCCTTTTT
T7_05568_G03	CTCCCTCTCCTTTTTTCGTCTCCCCTCTTCTTCTCT
T7_05569_G03	CTTCTCTCCCTCTTCCTGTCTCTCTTTTTTCCCCTC
T7_05570_G03	CTCCTTCTCCTTTCCCCGTCTTTTCTCTTCTCCCTT
T7_05571_G03	TCCCCTCTTCTTTTCTTGTCCCTTCTCTCCTCTCCT
T7_05572_G03	CTCTCTTTCTCTTTCTCGTCCTTCTCCTTTCCCCTC
T7_05573_G03	TTCTTCTTTCTCCTTCCGTCCCTTCTCCTTCTCCCT
T7_05574_G03	TCCCCTTCCTTCTTCCCGTCCTTTTCTCCTTCTTTC
T7_05575_G03	TCCTCTTTTTCCCTTCTGTCCTCCCTCCTTTTCCCT
T7_05576_G03	CCTTCTCCCTTTCTCCTGTCTCTTCCCTTTTCCTTC
T7_05577_G03	CCTTCCTCTTTCCCTTTGTCCCCTTCTTTCCCCTTT
T7_05578_G03	CTCTCCCCTTTTTTTCCGTCCTCCTTTTTTCCTCCC
T7_05579_G03	TCCCTCCCTTTCCCCTCGTCTTCCTCTTTTCTTTCT
T7_05580_G03	CCCTTCCTTTCCTTCCTGTCTCTTTCCCTCTTTCCT
T7_05581_G03	CCCTTTCTTTCCCTTCTGTCTTTCCTCTCTTTCCCC
T7_05582_G03	CTTTCCTCCCCTTCTCCGTCCTTCCCTCTCTTTTTT
T7_05583_G03	CCTTCCCTTTTTTCCCTGTCTTTTTCCCTCTCTCCC
T7_05584_G03	CTTTTCTTTCCTCTCCCGTCTCCCCTTCTTTTCTCC
T7_05585_G03	CCTTTTTCCCTCCCCTTGTCTTTCTCCCTTTCCTCT
T7_05586_G03	CTTTCCCCTCTTTTCCCGTCTCCCTTTCTCTCTTCT
T7_05587_G03	CCCTTTTTTTTTTCCTTGTCCTCCCTCCTCTTCCCC
T7_05588_G03	TCTTCCCTTTCTCTCTTGTCCCCTCCTTCTTCCTTC
T7_05589_G03	TCTCCCCTCCTCCCTTTGTCTTTTTCCTCCTTCTTC
T7_05590_G03	TTTCCCTCCTTCCCCTTGTCTCTTCCTTTCTTTCCC
T7_05591_G03	CTTCTCCCCTCCTTTTCGTCCTTCCTTTCCTTCTCT
T7_05592_G03	CTCCCTTTCCTTCTTCCGTCTTTTTCTTCCCCTCCT
T7_05593_G03	CTTCCTCCTTCCTCCTTGTCCTTCTTTTTTCCCCTC
T7_05594_G03	TCTCCCTTTCCCTCCCTGTCTTTTCTTCCCTTCCTT
T7_05595_G03	TTTTTCCTTTTTTTCTCGTCTCCCTCCCTCCCCTCC
T7_05596_G03	CCTCTTCCCTCCCTTTTGTCTTTTCCTCTCTCTCCT
T7_05597_G03	TTTCCCCTTTCCTTTCCGTCTTCCCCTTCTTTCCCT
T7_05598_G03	CTTTTCCCTTTCCCCTCGTCTTCCTTTCTTTTCCCC
T7_05599_G03	TTCTTCCTTTTCCTCTCGTCTCCTTCCTCTCTTCCC
T7_05600_G03	CTTCTTCCCCTTTCTCCGTCTCCTTCCTTTCTTCCT
T7_05601_G03	CTCCTCTCTTTCTCTCTGTCCTCTTCCTTCCTCCTT
T7_05602_G03	TCTCCTTCCTTTCCTTCGTCTTTTCTCCCTTCCTCC
T7_05603_G03	TTCCCTCTCCCCTCCTCGTCTCTTCCTCCTTTTTTT
T7_05604_G03	CTTCTCCTTTTCCTCTCGTCCCTCCCCTTTCTTTTC
T7_05605_G03	TCTTTCTCTCCCTCTTCGTCTCTCCTCTCTCCTCTT
T7_05606_G03	CCTTCCCTCTCTCTCTTGTCTCCCCTTTTTTTTCCC
T7_05607_G03	TCTTCCCTTTCCCTTTTGTCCTTTTCTCCTCCTCCC
T7_05608_G03	TTCCCTTCTTCCTCTCTGTCCCCTCTCCTTTTCTCT
T7_05609_G03	CCTCCCTTCCCTTCCTCGTCCTCCTTTTCTTTTTTC
T7_05610_G03	CCCTCTTCCCTTTCCTCGTCTTCCCCTTTTTTCTTC
T7_05611_G03	CTTCTCCCTTTTCCTTTGTCCTTCCTTTCCTTCCCC
T7_05612_G03	TTCCCCTTTCCTTCCCCGTCTTCTTTCCCTTTTTCC
T7_05613_G03	CCTTTCCCTTTCCCCTTGTCTCCTCTTTCTTTCCTC
T7_05614_G03	CTCTTCTTCCCTCTTTTGTCCTTCCTCCCCTTTTCC
T7_05615_G03	TCTCCTCCCCTCCTTCCGTCCTTTTCCCCTTTTTTT
T7_05616_G03	TCTTCTCCTCTTCCCTTGTCTCCTCTTCCTCTTCCT
T7_05617_G03	TCCCTCCCTTTTCCCTTGTCCCTTCCCCTCTTTTTT
T7_05618_G03	CTTTCCCCTTCTCCTTTGTCCTCTTCCTTCTTCCTC
T7_05619_G03	CTCTTTTTCCTTTCTCCGTCCTCTCTCCCTTTTCCC
T7_05620_G03	TTTTTCTCCTCTCTTTCGTCCTCTCTTCTCCCCTCC
T7_05621_G03	CCTTTTCCTTCCTCTCTGTCTCCTCCCTTTTTTCCC
T7_05622_G03	TCCTTTTCTCTCCCTCTGTCCTCTTTCCTTTCCCTC
T7_05623_G03	TTCTTCCCTCCTCCTTTGTCCCCTTCTTTTTTCCCC
T7_05624_G03	TTTCTCTTCCCCTCTCTGTCTCTCCCCTCCTTTTTC
T7_05625_G03	CTTTTCTCCTCCTTCTTGTCCTCTCCCTCCTTTCCT
T7_05626_G03	TCCTTTCTTTTTTCCCCGTCTCTCTCTTCCTCCTCC
T7_05627_G03	TTTCTCCCTTCCTCCCTGTCTCTTTTTCTCCCCTTC
T7_05628_G03	CCTCTCTCTCCTTTTTCGTCTCTTCTCTCCTTTCCC
T7_05629_G03	CCTCTTCCCTTTTCTTCGTCCTTCTCCCCTTTTCCT
T7_05630_G03	TTTCCTCTCCCCTTTTCGTCTCTTTCTCTCCCTTCC
T7_05631_G03	CCTCTTCCCTTTCCTTCGTCTCTTCTTCCCCTCTTT
T7_05632_G03	TTTCTTCCCTCCTCCCCGTCCCTTCTTCTTCTCTTT
T7_05633_G03	TCCCTCCCTTCTCTCTTGTCTCTCTCTCCCTTTTTC
T7_05634_G03	TTCCTCCCTCCCTTTTTGTCTTCCCTTCCCCTTCTT
T7_05635_G03	CCCTTCCCCTCCCTTTTGTCTCTTCTTCTTCTCCTT
T7_05636_G03	TTTCTTTCCCTTCTCCCGTCTCCCCTTTCTTCTCCT
T7_05637_G03	TCCTTCTCCTTTTTCCCGTCCTTCCTTCCTCCTTTC
T7_05638_G03	CTTCTCTTTCCCTTCCCGTCTCCTCTCTCTTTCCTT
T7_05639_G03	CCTTCTCCCCTTTTCTTGTCCCCTCTTTTCTCCTCT
T7_05640_G03	TCCTTTCTCTTTTTCCTGTCTCCCTCCCTCCTCCTT
T7_05641_G03	CCTTTCTCCTCCTCCCCGTCTTTCCTTTTTTCCTTC
T7_05642_G03	TCCCTTCCCCTCCCTTCGTCTCTTTTTTCTCCTTTC
T7_05643_G03	TCTTCCCCTTCTTTTTCGTCCCCTCTCTTCCTTTCC
T7_05644_G03	CTCTTCTCTTCCCTCTTGTCTCCTCTTTTCTTCCCC
T7_05645_G03	CCTTTTCTTCTTTTTCCGTCTTCTCCCTTCCCCTCC
T7_05646_G03	CCCTTCTTTTCTTTTTCGTCTTCCCTCTCCTCCCTC
T7_05647_G03	CCCTCTTTCCTTTTCCCGTCCTCCTTCCCTTTTTCT
T7_05648_G03	CCTTCCCTCTCTTTTTTGTCTTCCCTCTTTCCTCCC
T7_05649_G03	CCCTTCTTCTTTCCCTTGTCTCCCTTTTCTTCTCCC
T7_05650_G03	CCTTTTTTTCCCCTCCCGTCCCTTTCTTCTTTCTCC
T7_05651_G03	CTTTCTCCCCTTCCTCTGTCCCCTCTCTCCTTTTTT
T7_05652_G03	TCCCCTCTCCTTTCCTCGTCTTCCCTTCTTTTTCCT
T7_05653_G03	CCTCTCTTTCCCTTTCTGTCCTCTTTCTCCCTTTCC
T7_05654_G03	TCCTTCCTTCCTTCCTTGTCCTCTCTCCTTTCTCCT
T7_05655_G03	TCTTCTTTCCCTCTTTCGTCCCCTCTCCTCTTTTCC
T7_05656_G03	CCTTCCCTTCTCTCCTCGTCTTCCTCTTTTTCCTCT
T7_05657_G03	TTCTCTTTCCTCCTTCTGTCTCCTCTCTCTTCCCCT
T7_05658_G03	TCCTTCTCTCCCCTTTCGTCTCTTTTTCCTTCCCTC
T7_05659_G03	CCTCTTCCCCTTTTTTCGTCTCCTTTCCCTTCTTCC
T7_05660_G03	TTCTCCCTTTCCTCCCCGTCCTTTCTTCTTTCTTCC
T7_05661_G03	TTTCCCCTTCTTCTTTTGTCCCTTTCCCCTCCCCTT
T7_05662_G03	CTTCCTTCCTTTTTCCTGTCCTCCCCTTTTTCCCTC
T7_05663_G03	TCCTCCCTCTTTTTTTCGTCTTCTTTCCCCTCCTCC
T7_05664_G03	CCTTCTTCCCTCTTTCTGTCCTCCCCTTTTTCTCCT
T7_05665_G03	CCTTTCTTCTTTTCCCCGTCTTTCTTCTCCCCTCTC
T7_05666_G03	TCTCTCCCCTTTCCTCTGTCTCCTTTCTTTTCCCCT
T7_05667_G03	CCTCCTTTCCTCCTTTTGTCCCCTTCTTTTCTTCCC
T7_05668_G03	CCTCTTCTTCTTTTTCTGTCCCTTCTCCTCTCCCCT
T7_05669_G03	TCCCTCTTTCTTTTCTTGTCCTCCTTTCCTCCCTCC
T7_05670_G03	TCCTTTTCCCCTTTCTCGTCCTTCCCTCTTTTCCCT
T7_05671_G03	TCTCTTCTCTCTTCTCCGTCCTTCCTTTCCTTCCTC
T7_05672_G03	TCCTCCTCCCTTTTCCCGTCTTCTCTTTCCCTTCTT
T7_05673_G03	TTTCCTTTCCCTTTCCCGTCTCCTTCCTTTCCCCTT
T7_05674_G03	CCCTCTTTCCTTTCCCCGTCTTTTCCCCTTCTTTTC
T7_05675_G03	CCCTTTCCCTTCTCTCTGTCCTTCTTTCCCTCCTTT
T7_05676_G03	TCTTCTCCTCTTCTCCCGTCTCTCTTTTCCCCTTCT
T7_05677_G03	CTTCCCTCCCCTCTTTCGTCCCCTTTTCCTTTTCTT
T7_05678_G03	TCCCCTTTTTCTCTCCCGTCCTCTTCCCCTTTTTCT
T7_05679_G03	CCCTCTTTCCTCTTTTCGTCCCCTTTTCTTCTTCCC
T7_05680_G03	CTTCTTCTCCTCTTCCCGTCTCCTTTTTTCTCCCTC
T7_05681_G03	CCTCCCCTCTCTCTCTTGTCTTTTCTTCCCCTTTCT
T7_05682_G03	TCTCTTTTCCTTCTCTTGTCCCCTCCTCTCCTCTCT
T7_05683_G03	CCCTCCTTTCCCTTCTTGTCCTCTCTTTTTTTCCCC
T7_05684_G03	TCCCTTTCCCTTTTTCCGTCCTCTTCTCCTTTCCCT
T7_05685_G03	TTCCCTCCTTCTTCTTCGTCCCTTCTTCCTTCCCTT
T7_05686_G03	CCCTTCCTCCCTTTTCTGTCCTTTCCCTCCTTTCTT
T7_05687_G03	TTTTTTCTTCCTCCCCTGTCCCCTCCTTTTCCCCTT
T7_05688_G03	TTCTTCCTTCCCTTTCCGTCTTCTCTCCTCCCCTTT
T7_05689_G03	CTTTTCCTCCTCCTTCCGTCCTCTCCCTTCTTCTTT
T7_05690_G03	CTCTTTTCCCCTTCTTTGTCTCCCCTTTTCCCTCCT
T7_05691_G03	TCTTTCCCTTCTTCCTCGTCTCCTCTCCTTTTCTCC
T7_05692_G03	TCTTCCCCTCTCCTCCTGTCTTCTTTTTTTCTCCCC
T7_05693_G03	TTTTTTTCCCTTTCCCCGTCTTCCCTCTTCCCTTCC
T7_05694_G03	CCTCCTTTTTCCTTCCCGTCCTTCTTTCTTCTCCCT
T7_05695_G03	CCCTCCCTTTTCTTTCCGTCCCCTCTTTCTTCTTCT
T7_05696_G03	CCCTCTCTTTTTCTCCTGTCTTCTTCCCTCCTTCTC
T7_05697_G03	CTCCTTCCTCCTTCCTTGTCTCCTTCTTTCTTTCCC
T7_05698_G03	TCCTTTCCTTCTTCCTTGTCTTTCCCTTTCCTCCCC
T7_05699_G03	TCCCTCCTCTCTTCCTTGTCTTCTTTCCTCCCTTTC
T7_05700_G03	CCTCTCTCCTTCTTTTCGTCCCCTTTTCTTCCTCCT
T7_05701_G03	TTCCTCCTTCCTTCCTTGTCCTTCCCTCCTTTTTCC
T7_05702_G03	CTTCTTTCCCTTTCCTTGTCCCTCTTCTCCTCTCCT
T7_05703_G03	CTCTTCCCCTTCCCTTTGTCCTCTTCCCCTTTTCTT
T7_05704_G03	TTCTCCTCTTTCCTCTTGTCCTCCTCTTCCTTCCTC
T7_05705_G03	CTCTCTTTTCTTTCTTTGTCCTCCCTCCTCCCTTCC
T7_05706_G03	CCCTTCTCCTTCTTCCTGTCTTTCTCTCTCCTTTCC
T7_05707_G03	TCCCCTTCTCTCTCTTCGTCTTTCTTCCTCCCTTCT
T7_05708_G03	TTTCTCCCCTCTCCTCCGTCCTCTTTTTTCTCTTCC
T7_05709_G03	CTCCCCTTCCCTCTTTTGTCTCTCTTTCTTCCCTTC
T7_05710_G03	TTCCCCTTCTCCTTCTCGTCCTTTTTTCCCCTCTTC
T7_05711_G03	TCTTCTTCCCTCCCTTTGTCTCTCCTTTCTCTCCCT
T7_05712_G03	CTCCTCCTTCTCTCCCTGTCCTCTTTTCCTCTTCTT
T7_05713_G03	CTTCCCTTTTTCTTTCCGTCTCCTCCTTTTCCCCTC
T7_05714_G03	TTCCTCCTCCCTTTTTCGTCCTTCCTTCTCTCCTCT
T7_05715_G03	TCCCTTTTTCTCCCCTTGTCTTTTTCTCCCTCCCCT
T7_05716_G03	CCCTTTTTCTCTCTCCCGTCTTTTTTCTCCTCCCCT
T7_05717_G03	CCTTCCTCCCTCCCCTTGTCTTCTTTTTTTCCCTTC
T7_05718_G03	TCTCTTCCTTTTCCCCTGTCCTCCTTTCCTTCCCTT
T7_05719_G03	CCCTTTCCTCCTCCCTTGTCTCCTTTTTTTTCCCCT
T7_05720_G03	TCTTTTCCCCTTCTTCCGTCCTCTTTCCTTCCTTCC
T7_05721_G03	CCCTTTCCTTTTTTCTCGTCCTTCCCTTCCCCTTTC
T7_05722_G03	TCTCTCTTCCTTTCTCCGTCCTCCTTTCCTTTCTCC
T7_05723_G03	TTTTTTCCTCTCTTCCCGTCCTCCTTCCCTTCCCTT
T7_05724_G03	CCCTCCCTTTCCCTTTTGTCCTTCTCCCCTCTTTTT
T7_05725_G03	CCCTTCTTTCCTTTTTCGTCCCTTCTCTCCCTTCCT
T7_05726_G03	TCCTCTTCCCTCCCTCTGTCTTCCCCTTTTTCTTTC
T7_05727_G03	CTCCTCCCTCTCCCTTCGTCTCTTTTCTTCCTTTTC
T7_05728_G03	CCTCCTTTTCTCCTTTTGTCTCCTCCCTTCTCCTCT
T7_05729_G03	TTCCCTTTTTTCTCCTCGTCTCCCTTCTCCTTCCCT
T7_05730_G03	CCTCTTCCTCTCCTTTTGTCTTCCTCTTTCCTCCCT
T7_05731_G03	CCTCTTCCCTTTCCTTTGTCTTTTCTCCTCCTTCCC
T7_05732_G03	TCTCCTCTCCTTTTCCTGTCCTTCCCTCTTCTCTTC
T7_05733_G03	TCCTTTCTCCCTTTTCTGTCTCTCCCTCCCTTCCTT
T7_05734_G03	CCTCCTTTTCTTCTCCTGTCCTTTCCTCTCTTCTCC
T7_05735_G03	TTTCTCCTCTCCCTCCTGTCTTTTCCCCTCCCTTTT
T7_05736_G03	TCCCTTTCTCTTCCTTTGTCTCCCCTTTCTTTCCCC
T7_05737_G03	CCCTCTTCTTCCCCTTTGTCCTTTCCCTCCTTTTTC
T7_05738_G03	CTCCTTTTCCTCCCTTTGTCTTCTCTTCCTCCCCTT
T7_05739_G03	TTCCTTTTCTCTCCCTCGTCTCCTTTCCCTTTCCCT
T7_05740_G03	TCTTCTCTCCTCTTCTTGTCCCTTTCCTTCCTCTCC
T7_05741_G03	CTTTTCTCCCTCTCTTCGTCTTTCCCCTCCTTCCTT
T7_05742_G03	CCTCCTCTCTTCTCTCCGTCTTTTTTTCTCCTCTCC
T7_05743_G03	CCCTTCCCCTTTTTCTTGTCTCTCCTTCTTTCTCCC
T7_05744_G03	CTCCTTTCTCTTCTCTTGTCCTCCTCTCTTTCCCTC
T7_05745_G03	TCTCTCCCTCTTTTTTCGTCTCCCCTTCCCTTTCCT
T7_05746_G03	CTCCCCTTCTTCTCTTTGTCTTCCCCTTTTTCTCCC
T7_05747_G03	CTTCTTCTTTTTTCCCTGTCCCTCCTTTCTCCTCCC
T7_05748_G03	CCCTTTTTTTTTCCCTCGTCTTTCTCTCTCCTCCCC
T7_05749_G03	CTTTCTCTTCCTCTCCTGTCCTCTCCCTTCTTTTCC
T7_05750_G03	CTTCTTCTCTTTCTCTCGTCCCCTCCTCTCTTTTCC
T7_05751_G03	TCCCTTTCTCTTCTCCTGTCTCTCTCTCTCCTTCTC
T7_05752_G03	CTCCTTCCTTCTCCCTTGTCTTCCTTTCCTCCCTTT
T7_05753_G03	CCCTTCCCTTTTCCCTTGTCTTTCTTTCCCCTTCCT
T7_05754_G03	CCTCCCCTTTCCTCTTCGTCCCTTCTTTTCTCTCTT
T7_05755_G03	TCTTTTTTCCCCTTTCTGTCCTTTCCCCTCCCCTCT
T7_05756_G03	CCTTTCTTCCTCTTTTTGTCTTCCCTCCTCCCTTCC
T7_05757_G03	TTTTTTCCCTTCCCTCTGTCTTCTCTTCTCCCCTCC
T7_05758_G03	CTTCCTTTTCCTCTTCTGTCTTTTCTCCCTCCCCTC
T7_05759_G03	CTCTCTCTTTCCCTCCTGTCTTTCTCTCCTCCTTCT
T7_05760_G03	CTTTTTCTCTTCCCCTTGTCCCTCTCCCTCCTTCTT
T7_05761_G03	TTCCCTTTTTTCTTCCCGTCTTTCCCTCCCCTCTTC
T7_05762_G03	CCTTTTTTCCTCCCTCTGTCCCTTCCTTCCCCTTTT
T7_05763_G03	CTCCTTCCCTCCCTCTCGTCTTTTTCCTTCCTTTTC
T7_05764_G03	TCCTTTCCTTCCCTCCTGTCCTTTTCCCCTTTTCTC
T7_05765_G03	TTCTCCCCTTCCTCTTCGTCCCTTCTTTCCTCCTTT
T7_05766_G03	CCTCTTTCCTCTTTTCTGTCTCCCTCCTCTTCCCTT
T7_05767_G03	CCTCTTTTTTTTCTCTTGTCCCCTCCCCTCTTCTCC
T7_05768_G03	CTTCTTCCCCTCCTTCCGTCTCTCTTTCTCTTTCCT
T7_05769_G03	TTCTCCCTTCCTTCCTTGTCTTTCCTCTCTCTCCTC
T7_05770_G03	TCTTTTTCCTCTCCCTTGTCCTTTTCCTCCCCTCCT
T7_05771_G03	CCCTTCCTTTTCTTCCTGTCTCCCCTTTCTCCCTTT
T7_05772_G03	CCCTCCTTTCTCCCTTTGTCTTTCTTTCCTCTTCCC
T7_05773_G03	TCTCCTTCTTTCCCTTTGTCTCCTCTCTCCCTTCTC
T7_05774_G03	TCCCTCTTTCTCTCCTTGTCCTTTTCCCTCTTTCCC
T7_05775_G03	TCTCCTCTTCCCTCCCCGTCTTTCTTTTCTCCCTTT
T7_05776_G03	TTTCTTCTCCCCTTTTTGTCTTCCCCTCTCTCCTCC
T7_05777_G03	TCTCTCTTTTCCTCTCCGTCTTTCCCTCCTCTCTCT
T7_05778_G03	CTTCTCCTCTCTTTCTCGTCCTCCCTCCCTCTTTTT
T7_05779_G03	CCCTTTCCTTCTCCCTCGTCTTCCTCTTCTTCTTCT
T7_05780_G03	CCTTCCTTCTCCTCTTTGTCCCCTTTTTTCTCTCCC
T7_05781_G03	TCCCTCTCCCTTTTCTCGTCCTCTCTTCTTTTCCCT
T7_05782_G03	CTCCTTTCTTCTTCTCCGTCTCTCCTTTCCCTTCCT
T7_05783_G03	CCCTCCCCTCTCCCCTTGTCTCTTTTTTTTTCCCTT
T7_05784_G03	CTCTTTTCTTCTCCCTCGTCCTCCTTCCTTCTTCCT
T7_05785_G03	CCCTTCCCTCCCTTTCCGTCTTTCTCTTTTCTTCTC
T7_05786_G03	TCTTCCCTTTTTCCCCTGTCTCTCCCTTTCCTCCTT
T7_05787_G03	TTCTTCTCTCCCTCTTTGTCCTTCCTTTTCCCCTCC
T7_05788_G03	TCCTTCTTTCCCCTCCTGTCTTTCTTTCCCTCTCCT
T7_05789_G03	CTCCTCTTCCCCTTTTTGTCTTCTCCTTTCCCTTCC
T7_05790_G03	TCCCTTCCCCTTCCTTTGTCCTTTTTCCCTCCCTTT
T7_05791_G03	TTCTCCTTTCCCTCTTCGTCCTCCTTTTCCTCTCTC
T7_05792_G03	TCTTTCTTTCCCTTCCCGTCTTCCCCTCTCTTCTCT
T7_05793_G03	CTCCTTTCTTTTCCTTCGTCCTCTTTCCCTCCCCTT
T7_05794_G03	CCTCTTTCCTTCTTCCTGTCTCCCCTTTCCCTCTTT
T7_05795_G03	TCCCTTTCTTCTCCTTTGTCCCTCCTTTCCCTCCTT
T7_05796_G03	CCCTCCTTTCCTCTTTCGTCCCTTTCCCTTTTCCTT
T7_05797_G03	CTTCCCCTCCTCTTCTTGTCTTTCCTTCTCCTCTCT
T7_05798_G03	TTCCTCCTTTTCTTCCCGTCTCCTTCCTCTTTTCCC
T7_05799_G03	TTTTCTCTCCTCTTTCCGTCTTCCTTCCTTCTCCCC
T7_05800_G03	CTCCTCTTCTCCCTCCTGTCTCCTTTTTCCCCTTTT
T7_05801_G03	TTTTCTTTCTCCTCTTCGTCTCTCCTCCTTCCCCTC
T7_05802_G03	TTTCCTTCCTTCCCTCCGTCTTTCTTCTTTCCTCCC
T7_05803_G03	TTCCTTTCCCCTTTTCCGTCTTTCCTCTTCCTCTCC
T7_05804_G03	TCCTCTTTTCTCCTTCTGTCCTTCCCTCCCTTTTCC
T7_05805_G03	TTTCTTCCTCCCCTCTCGTCTTCCTTCTCTTCCCTT
T7_05806_G03	TTTTTTCTTTCCTCCCTGTCTCCCCTCTCCCCTCTT
T7_05807_G03	TCCCTTCTTCTTCTTCTGTCTCCCTTTTCCTCCCTC
T7_05808_G03	CTTCCCTTCCTCTCCTCGTCTCCTTTTTCTCTTCCT
T7_05809_G03	TCTCCTTCCCCTTTCCCGTCTCTTTTTTTCCCCTTC
T7_05810_G03	TTTTTTTTTCCCCTTCCGTCTCCCCTTCTTCCCTCC
T7_05811_G03	CCCTCCTCTCCCTTCTCGTCCTCTTTTTCTTTTTCC
T7_05812_G03	TTCCCTCCCCTCCTCCTGTCTTCTCCTTCCTTTTTT
T7_05813_G03	TCCTCCTTCTTCTTTCCGTCTTCTTCCCTCCTCTCT
T7_05814_G03	TCCCCTCTTCTCCTCTTGTCCTTCTTCCTCCCTTTT
T7_05815_G03	CCCTCTTCCCCTTCTCTGTCTTTTCTTCCTTCCTCT
T7_05816_G03	TCCTTTCCCCTTTTTCCGTCCTCCCTCCTCTTTCTT
T7_05817_G03	TTCCTTTCTCCCTCCCTGTCCTCCCCTTTTCTTTTC
T7_05818_G03	TTCTCTCCTTTCTCCCTGTCCTCCTTCCCTTTTCCT
T7_05819_G03	TCTCTCTCCCTTTTCCTGTCTCTTTTCCCCTCCTCT
T7_05820_G03	TCTTCTTCCCCTTCCCTGTCCTCTTTCCCTCTTTCT
T7_05821_G03	TTTTCTCCTCCTTTCCCGTCCTTCCTCCCTTTCCTT
T7_05822_G03	CCCTCTCCTTTTTTTCCGTCTTCCTCTCTCTCTCCT
T7_05823_G03	TTCCTCCCCTCTCCTTTGTCCTCCTTTTTTTTCCCC
T7_05824_G03	CCCTCCTCCTTTTCCCTGTCCTTTTTCCCCTTTTCT
T7_05825_G03	TCTCCCTCCTCTTTCCTGTCTTTTTCCCTTTTCCCC
T7_05826_G03	TTTTCCCTCCCCTCTCCGTCTCCTCTTCTCCTTTTT
T7_05827_G03	CTCCTCCCTTCCTTCTCGTCCTCCTCTTTCTTCTTT
T7_05828_G03	CTTTTCCCTTTTCCCCTGTCTTCCTCTCCCTTCTCT
T7_05829_G03	TCTCCCTCTTTTCCCCTGTCCTCCCTCTTTTCTCTT
T7_05830_G03	TCCTTTCCTCCCTTTTCGTCCTCTTTCCTCTCTCTC
T7_05831_G03	CCTCCTTTCTTCCCTCTGTCTCCCTTCCTTTTCTCT
T7_05832_G03	TCTCCCTCCCCTCTCTTGTCTCTCTCCTTTTCTCTT
T7_05833_G03	TTCTCCTTTTTCCTTTTGTCCCTCCCTCCTCCCCTT
T7_05834_G03	CCCTCCCTCTTTTTTTCGTCTCCCCTTCTCTCCTTT
T7_05835_G03	CTTTTCCTCCCCTTTCTGTCCTCCTCCTCTTTTCCT
T7_05836_G03	CTTCCTTTCCCTTCCTTGTCTTCTCTTTCCTTCCCC
T7_05837_G03	TCTCCTCTTTCTTTTTCGTCCTTCTCTCCTCCCCTC
T7_05838_G03	TTCTTCTTCCCCTTTCCGTCTTCTTCTCCTCCTCCT
T7_05839_G03	TTCCTTTTTCCCTTTCTGTCTTCCTCCCTCCTTCCC
T7_05840_G03	CCCTTCTTTTCTTTCTCGTCTTCTTCCCCTTCTCCC
T7_05841_G03	CTCCCCTTTTCCTCCTTGTCTCTCCTTCCTTTCTCT
T7_05842_G03	TCCCCTCCCCTTTTCTTGTCTTCTTTTCTCCCTCTC
T7_05843_G03	CTTCTCTCCTTTCCTCCGTCTTCCCCTCCTTTCTTT
T7_05844_G03	CTCTCCTTCTCCTTCCTGTCTCCTTTCTTTCCTTCC
T7_05845_G03	CTCTTCTCTTTCCCCTTGTCTCTTTCTCCCCTCTCT
T7_05846_G03	CTCCCTTCCTTCCTTTCGTCTTCTCTTTTCCCTCCT
T7_05847_G03	CTCTTTTTCTTCCCTCCGTCCTCCTCTTTTCCCCTT
T7_05848_G03	TCTTCTTCTTCCCTCCTGTCTTTCTCTCCCCTCCTT
T7_05849_G03	CTTTCCCCTTTTTCTTCGTCCCTCCCTTCCCCTTTT
T7_05850_G03	TCCCTCTTTCCCTTTTTGTCCCTTCCTCCCTCTCTT
T7_05851_G03	TTTCCCTTCCCTCTTTCGTCTTTTCCTCCTCCCCTT
T7_05852_G03	CTTCTCCCTTTCTTTCCGTCCTCCTTCTCCTTTCCT
T7_05853_G03	CCTCTCTCTTTTCCTCCGTCCTCTTTTTTCTCCCTC
T7_05854_G03	TTTCCTTCCCCTCCCCTGTCCTTTTCTTTCCCTTCT
T7_05855_G03	CTTCTCTTCTCCCTTCTGTCCTTTCCTTCTCCTTCC
T7_05856_G03	TCCTTTCCCCTTTTTCCGTCTTTCTTCCTCCCCTCT
T7_05857_G03	TCCTTTCTCCTCTTTTTGTCCCTTTTCCTCCCTCCC
T7_05858_G03	TCCCCTCCTCTTCTTCTGTCCCCTCTTTCCTTTCTT
T7_05859_G03	CTTTTTCCCTTCCTTTTGTCCCCTTTCCTCTTCCCC
T7_05860_G03	CTTTCTCCTTCCTTCCTGTCCCCTTTTTCCCTCTTC
T7_05861_G03	TCTTCCCTCCCTTCCTTGTCTTCCTCCTTTCTCCTT
T7_05862_G03	CCCTTTTCCCCTCTCTTGTCTCCTTCCTTTCTTTCC
T7_05863_G03	TTTCCTTCTCCTCCCTTGTCTCTTCCCTTTTCTCCC
T7_05864_G03	TTCTCCCCTTTCTTTCTGTCTCTTCTCCCCTCTTCC
T7_05865_G03	CTTTCCCCTTTTCTTCCGTCCCTCCTTTCTTCCCTT
T7_05866_G03	CTCTTCCCTTCCCTCTTGTCCCTTTTCCTCCTTCTT
T7_05867_G03	TTCCCCTTTCTTTTCTCGTCCCTTCCCCTTTTTCCC
T7_05868_G03	CCTTCCTCTCTTCTTTCGTCCTCCTTTCTCCCTTTC
T7_05869_G03	TTTTCCCCTTCCTTCTTGTCTCCTCCCTCTCTTCCT
T7_05870_G03	CTTCTCTCCCCTCTTCTGTCCTTTTCCTTTTCCCTC
T7_05871_G03	TCCTTCTCTTCCCTCTTGTCCTTCCTTTCCCTTTCC
T7_05872_G03	CCTCCTCCTTCCTCCTCGTCCTTTCCTCCTTTTTTT
T7_05873_G03	CCTTCCCCTTTTTCTCCGTCTTTTCCCTCTTCCCTT
T7_05874_G03	TTTTCCCCTCCCCTCCTGTCTTTTCCCTTTTTCTCC
T7_05875_G03	CCTTTCCTCCCTCCTTCGTCCTCCCTCTTCTTTTTT
T7_05876_G03	TCTTTTCCTCCCTTTCCGTCCTTCTCCTCCTTTCTC
T7_05877_G03	CTCCCTCTCCTTTCTTCGTCTTTCCCTTCCTTTTCC
T7_05878_G03	TTTCTCCCCTCTCTCCCGTCCTTCTTTTTCCTTTCC
T7_05879_G03	CTTCTTCTTCTCCCCTCGTCTTTCCCCTTTCTCTCT
T7_05880_G03	TTCTTCCCCTCCTTCCCGTCCTTTCTTTTTTCCCTC
T7_05881_G03	CTCCTTCTCTTTCCTTTGTCCTCTCCTTTCCCCTCT
T7_05882_G03	CCTTTTCTCTTCCTTTCGTCCCCTTTTCTTCTCCCC
T7_05883_G03	TTTTCTTCTCTTCCCCTGTCTCCTTTCCCCTTTCCC
T7_05884_G03	TTTCCTTTCCTCCCCTTGTCTCTCCTTCCTCTTCCT
T7_05885_G03	CCTTCTCCCTTCTCTTCGTCTTTTCTCCCCTCTTTC
T7_05886_G03	CTCCTTCCTTTTCTCTCGTCCTTCCCTTTTTTCCCC
T7_05887_G03	CCTTCTTCCCTCTCTTCGTCTTCCCTTTTCTCTCCT
T7_05888_G03	CCCTTCCTCCTCTTTCTGTCTCTTCTTTCTTCTCCC
T7_05889_G03	CTCCTCCTCTTTCTCTTGTCCTCCCCTTCTCCTTTT
T7_05890_G03	CCTCTTTTCCTTTTTCTGTCTCCCCTTCCTTCCCTC
T7_05891_G03	TCCTCTCCTCTTCTCTTGTCCCTCTCTTTTTCCTCC
T7_05892_G03	CTCCCTTTTCCCCTTTTGTCTCTTCCCTTCCTCTTC
T7_05893_G03	CCTTCTTTCTTCCCTCTGTCTTCCCCTTTTTCCTCC
T7_05894_G03	CTTTTTCTTCTCCCTCTGTCTCCTCCTCCTCTTTCC
T7_05895_G03	CTCCCCTCCCTCTTTCTGTCCTTTTTCCTTTTCCTC
T7_05896_G03	CTCCTCCTCTCCTCCCTGTCCTTCTCCTTTTCTTTT
T7_05897_G03	CTTTTCCTCCTCTTTCCGTCTCCTCTTTTCTCTCCC
T7_05898_G03	CCTCCCTCCTTTCCTTTGTCCTCCTCTTTTTTTCCC
T7_05899_G03	CTTCCCTCCCCTTTCTCGTCTCTTTCCTCTTTCTTC
T7_05900_G03	CCTCCCCTCCTTTTTCTGTCCCCTCTTCTTTTCCTT
T7_05901_G03	TTCTTCTCCCTTTTTCCGTCTTCTCTCCCCTCCCTT
T7_05902_G03	CCTTTCCCCTTTCTTCCGTCCTTCTCTTCCCTCTTT
T7_05903_G03	CTCTTTCTTCTTTTTTCGTCCTCCTCCTCCCTTCCC
T7_05904_G03	TCTCTTTCTCCCCTTCCGTCTCTTTCTCCCTCTTTC
T7_05905_G03	TTCTTTCTCCTTTCCCCGTCTCTTCCCCTCTCTTTC
T7_05906_G03	TTTCTTTTTTCCCCTCCGTCCCCTTTCTCCCTTTCC
T7_05907_G03	CTTCCTCCCTTTCCTCCGTCTCTTTCTCTCTTTCCT
T7_05908_G03	CTTTCCCTCCCTTCTTCGTCTCTTTCTTCCTTTCCC
T7_05909_G03	TCTTTTTTTCCCTCTCTGTCCCTTCTCCCTCTCTCC
T7_05910_G03	CTTTCTCCCCTTCTCCCGTCTCTTCTTTTCCTTCCT
T7_05911_G03	CTCCCTCTCTTTTCTTTGTCTCCTTCCCTTCTTCCC
T7_05912_G03	TTCCTTCCCTTTCCTCTGTCCTTTTTCCTTCCCTCC
T7_05913_G03	TCCTCTCTCTTTTTTCCGTCTCCTTTCTCCTCCCCT
T7_05914_G03	CCTTCTCCTTCCCCTTTGTCTTCCTCTTTTTCCCCT
T7_05915_G03	CTTTTCTCCTCCCCTTTGTCTCTTTCCCCTCCTCTT
T7_05916_G03	TCCCTTTTTTTCCCCTCGTCCTCCTCCTTCCCTTTT
T7_05917_G03	CTCTTTTTTTTCTTCTCGTCTCCCCTCTCTCCCTCC
T7_05918_G03	TTTTCCCCTTTCCCCTTGTCTCTCCCTTTTCTCCTC
T7_05919_G03	CCTCCCTTCTTTTTCTTGTCTCCTTTCCTCTCCCCT
T7_05920_G03	CTTTTTTTCCCCTCCTTGTCCTTCCTCTCCCTTCTC
T7_05921_G03	TCCCCTCTTTCTCTCCTGTCTCCTCTTTTCCCCTTT
T7_05922_G03	CTCTTCCTTTTTCCCTTGTCCTCCCCTTTTTTCCCC
T7_05923_G03	CTCCTTTTCCTTCTTCTGTCCCTCCTTTCTCCTCCT
T7_05924_G03	TCCTCCTTTTCTTTTCTGTCCCCTCTCCCCTCTTTC
T7_05925_G03	CTCCCTCTCCTTTTTTTGTCTTCCCCTTCTCTCCCT
T7_05926_G03	TTTCCCCTTCTCTCCCTGTCCTCTTTTCCTTCCTCT
T7_05927_G03	CTCTCCTCCCTTCCTCCGTCCTTTTTTCCTTTCCTT
T7_05928_G03	CCTCTCTTTCTCTCCTTGTCTTTCCTCTCCTCCTTC
T7_05929_G03	CTCTTTTCTCCCTTTCCGTCCTCTTCTTCTTCTCCC
T7_05930_G03	CCTCTTTTCCTCCCCTCGTCCTCTCTTTCCCTTTTT
T7_05931_G03	TCTTCTTTTCCTTCCCCGTCTCCTTTCCCCTTTTCC
T7_05932_G03	TCTCCTCTCCTTTCTCCGTCTTTTCCTTCCCTTTCC
T7_05933_G03	CCTTCTTCTTTCCTCCTGTCCTTTTCCCTTTCCCCT
T7_05934_G03	TCCTTCTCCCTCTTCCTGTCCCTTTCTCTTTCCTCT
T7_05935_G03	TCCCTTCTTTTTTCCCTGTCCCCTTCCTTCCTCTTC
T7_05936_G03	CTCTCCCTTCTTTTCCTGTCCTTCCCTTCTCCTTCT
T7_05937_G03	TCCCTCCCTTCTCTTTCGTCCTTTTTCTTCCTCTCC
T7_05938_G03	CTCTCCTCCTTCTTTTTGTCTTCTCCCCTTTCCTCC
T7_05939_G03	CCCTTCCTTTTCTCTTCGTCCCCTCTTTTCCTCTCT
T7_05940_G03	TTCCCCTTCTTTCCCTTGTCTTCTTTTCTCCTCCCC
T7_05941_G03	CTCCCCTTCTTCCCTTTGTCTTCTCTTTTTCCTCCC
T7_05942_G03	CTTCCCCTTCTTTCTTCGTCCTCCTTTCCTTTCCCT
T7_05943_G03	TTTTTCTCCTCCCCTTCGTCCCCTTTTTCTTCCCCT
T7_05944_G03	TCCTCTCTTCCCTCTTTGTCCCCTCTTCCTTTCCTT
T7_05945_G03	CCCTTTCCTTCCTTCCTGTCCTTTCCCCTTTCTTCT
T7_05946_G03	CCCTCTTCTCTTCCCCTGTCTTCCTCTCTTTCCTTT
T7_05947_G03	CCTCTTCTCCTCCTCCCGTCTCTTCTTTTTCTTTCC
T7_05948_G03	CCTTTTCTTCTTTTTCCGTCCTCTCTCCCCTTCTCC
T7_05949_G03	TCTTCCCTCCCTTTCTTGTCCCTCCTTTTCTCTTCC
T7_05950_G03	CCTTTCTTTTTCTCTCTGTCCTCCCTTCCTTCCCCT
T7_05951_G03	TCTCCTCTTTCCCCTTTGTCCCTTTTCTCCCTCTTC
T7_05952_G03	TCCTCCTTTTTTTCCCTGTCCTCCTTCCCTTCCTCT
T7_05953_G03	CTCCCCTTCTTCCTCCTGTCCTTTTTCTTTCTTCCC
T7_05954_G03	TCCTTTCCTCCTCTTCCGTCTTTCCCTTCTCCTTCT
T7_05955_G03	CTTTTTTCCTCCCTCCCGTCTTCTCTCTTTCCCTTC
T7_05956_G03	CTCCCTTTTCCCCTTTCGTCCCTTTTTCCCCTTTCT
T7_05957_G03	TTTCTCTTCCCCTCCTTGTCCCTCTTTTTCTTCCCC
T7_05958_G03	TTCTCCCCTTTCCTCCTGTCTCCTTTCCCCTTTTCT
T7_05959_G03	TCTTTCCTCCCCTTTCTGTCTCCCCTTTTCCCTTCT
T7_05960_G03	CTCCTCCCTTCTTTTCCGTCTCTTTTCCCCTTTCTC
T7_05961_G03	TCTTCCTTCCTCTTTCCGTCTTTCTCTCTTCCCTCC
T7_05962_G03	TCCTTTTCTTTCTCCCTGTCCCTCCCCTTTCTTTCC
T7_05963_G03	TTTTTCTCTCTTCCCTTGTCCTCCCTCCCTCTTCTC
T7_05964_G03	TCCTTTTCCCTCTTCCCGTCTCCCTTTTCTCTCTTC
T7_05965_G03	TCCCTTTTCCCTTCTTCGTCCTTTCCCCTTTTTCCC
T7_05966_G03	CCCTTTTCTCCCCTCTTGTCTCCTTTTCCTCCCTTT
T7_05967_G03	TTTTCTCTTTCCCTCCCGTCCTTCTTTCTCCCCTCT
T7_05968_G03	CCCTTTTCTTCTTTTCTGTCCTTCCCCTTCTCCTCC
T7_05969_G03	CCCTTTTTCCCTCTTCTGTCTTCTCCCCTTCCCTTT
T7_05970_G03	CTTCCTTTTCCCTTTCTGTCTTTCCCCTTCCCCTTC
T7_05971_G03	CTCTTCTTCCTTTCCCCGTCTTTTTCTCCTCTCTCC
T7_05972_G03	CTCTTTCCTTCTTCCCTGTCCCTTCCTTCCCTTTTC
T7_05973_G03	TTCCCTTCCTCCTTTTTGTCTCCTCCTTTTCTCCCC
T7_05974_G03	TTCCTTTTCCTCTCCTCGTCTCCCCTTTTTCCTTCC
T7_05975_G03	CTTTTTTCCTTTCCCCTGTCCCTCTCTCTTCCTTCC
T7_05976_G03	TCCCTCTCCTCTTTTTCGTCCTCCTCTTCCCTTTCT
T7_05977_G03	CCTTTTCCTTCCCCTTCGTCTCCTTTTCTCTCTCCT
T7_05978_G03	TCTTCCCCTTCTCCTCCGTCTTCCCCTTTTTTTCCT
T7_05979_G03	TTTCCCTTTCTCCTTTTGTCCCCTTCTTCCTCTCCC
T7_05980_G03	CCTTCTCTCTCCTCTTTGTCTCCCTTCCTTCTTCCT
T7_05981_G03	TCTCTCTCTTTCTCCCTGTCCTCTTTCCCTCCTTCT
T7_05982_G03	TCTCCTTCCTCTCCTCTGTCCCTTTTCCTTCCTCTT
T7_05983_G03	TTTTCTCTTTTTCCCCTGTCCTCCCCTCTCCTTTCC
T7_05984_G03	TCTCCTTTCCCCTCTTCGTCTCTTTCCCTTCCTTCT
T7_05985_G03	TTTCTCCCTCCCTTTTCGTCTCCTCTTTCTCCCTCT
T7_05986_G03	CCCTTTCTTCTCTCTCCGTCTTTCTCTTCTCCCTTC
T7_05987_G03	TTTCTCCCTCCCTCCTTGTCTTTCCCTTCTTCCTTC
T7_05988_G03	CTCCTCCTTTCTTTCTTGTCCTCCCCTTTCTCTCTC
T7_05989_G03	TCTTCTTTCCCTTTCTCGTCCCTTCTTCCCCTTTCC
T7_05990_G03	CCCTCCCCTTTCCCTTTGTCTCTTCTTTTTTCCCCT
T7_05991_G03	TTCCTCTCCTCCTCCCCGTCTTTTTTCTTTCTCTCC
T7_05992_G03	TCCCTTCTCCCTCTTTCGTCCCTTCTTCTTTCCTTC
T7_05993_G03	TTTTCCCTCTTCCTTCTGTCTTCCCTCCCTTCCCTT
T7_05994_G03	CCCTTTCTTCTCCCTCCGTCCTTCCTTTTCTTCCTT
T7_05995_G03	CCTTTCCTCCCTTCCCTGTCTCCCTTTTTTTCTCTC
T7_05996_G03	TCTCTTCTTCCTTTCCTGTCCCTCCCTTTTCCTCCT
T7_05997_G03	TTCCCTCCTTTTTCCCCGTCTCCTCCTCTTTTCCTT
T7_05998_G03	CTCTTTCCCCTTTCTCTGTCCTTCTCCTTCTTCCCT
T7_05999_G03	CCCTTCTTTCCCCTCTCGTCTTCTCTCTTCTTTTCC
T7_06000_G03	TTCCTTCTTCTTCTCCTGTCCTTCTCCCTTTTCCCC
T7_06001_G04	GTTTTTGTTTGGGTTTTGTCTGGGGTTTGGGGTGGG
T7_06002_G04	GGGGTGGTTGGGTTGGGGTCTTTTTTTTTGGGGTTT
T7_06003_G04	TTTTTGTTGGGTGGGGTGTCTTGGGGTTTGGGGTTT
T7_06004_G04	TGGGGTGTTTTTTTTTTGTCTTGTGGGTGGGGTGGG
T7_06005_G04	TTTGGTTTGGGTTTTTTGTCGGGGTTGGGGTTTGGG
T7_06006_G04	GGGGTTGGGTTTTTTTGGTCGGGTTTGGGGTTTTTG
T7_06007_G04	GGGGTTGGTTTTTTGGGGTCTTTTGGGGTTTTTGGG
T7_06008_G04	GGGGTTTGGTTTTTTTGGTCGTTGGTGGGTGGGTTT
T7_06009_G04	GTTTTTTGGGGTGGGGTGTCTGGGTTTTTTGGGGTT
T7_06010_G04	GGGGTTTTTTGGGGTTGGTCGGGTGGGTTTTTTTTG
T7_06011_G04	TTGGGGTGTGTTTTGGGGTCTTTGGGGTTTTTTGGG
T7_06012_G04	GGGGTTTTTTTGGGTTTGTCGGGGTTTGGTTTGGGT
T7_06013_G04	GGGTTTTTTGGGTTGTTGTCGGTGGGGTTTGGGTTT
T7_06014_G04	GGGGTTTGGGGTTTGTTGTCTTTTGGGGTTTTTGGG
T7_06015_G04	GTTGGGTTTTGGTTGGGGTCTTGGGTTGGGGTTTTT
T7_06016_G04	TTTTTTGGGGTTTGGGTGTCTTTGGGGTTGGTTGGG
T7_06017_G04	TTTTGGGTTGGTTTTTTGTCTTGGGGTTGGGGTGGG
T7_06018_G04	TTGTTGGTTGGGGTTGGGTCGGTTTTGGGTTTTTGG
T7_06019_G04	GGGTGGGGTTTTGGGGTGTCTTTTTTTGGGTGTTTG
T7_06020_G04	TGGGTGGGGTTTGGGGTGTCTTGGTTTTTTGGGTTT
T7_06021_G04	GTTTGGGTTTTTTTTGGGTCGGTTGGGGTTGGGGTT
T7_06022_G04	GGGTTGGGGTGGTGTTGGTCGGTTTTTTTTTTTGGG
T7_06023_G04	GGGGTGGGTTGGGGTTGGTCTTTTTTTTTTTGGGGT
T7_06024_G04	GGGGTTTTGGTTGGGGTGTCTTTTTTTTTGGGTGGG
T7_06025_G04	GGGGTTGGGGTTGGGGTGTCTGTTTTTTTTTTTGGG
T7_06026_G04	GGGGTTTTTGGGTGGTGGTCGTTTTTTGGGGTTTTG
T7_06027_G04	GTTGGTTTTGGGTTGGGGTCGTTTTTGGGGTTTTGG
T7_06028_G04	GGGGTTTTTGGGGTTTGGTCGGGTTGGGGTTTTTTT
T7_06029_G04	GGTTTTTGGGTTTTGGGGTCGTGGGGTTTTTTGTGG
T7_06030_G04	TTTTTTGGGTTGGGTGGGTCGGTTGGGGTTTTTTGG
T7_06031_G04	GGGGTTGTTTGGGTTGGGTCTTTGTTTTGGGGTTTG
T7_06032_G04	TTTTTTGGGGTTGGGTGGTCGGTTTTGGGGTTTTGG
T7_06033_G04	GGTTTTTTTTGGGTTTGGTCGGGTTTTTGGGGTGGG
T7_06034_G04	TTTGGTGGGGTTGGGGTGTCTTTTTTGGGGTTTTGG
T7_06035_G04	GGGTTTTTTGGGGTTTGGTCGGGTGTTTGGGTTTTG
T7_06036_G04	GGGGTTTTTTTTGTTTTGTCTTTGGGGTGGGGTGGG
T7_06037_G04	GTTGGGTTTTTTTTGGGGTCGTTGGTTTGTGGGGTG
T7_06038_G04	GGGTTTTTGGGTTTTTTGTCTGGGGTGGGTTTTGGG
T7_06039_G04	TTTTGGGGTTTGGGGTGGTCGGTTTGGTTTTTTGGG
T7_06040_G04	GGGGTGGGTTTTTTTGGGTCGTTTTTGGGTTTTGGG
T7_06041_G04	GGGGTTTTTGGGGTTTTGTCTTTGGGGTGGTTTTGG
T7_06042_G04	GGGGTTTTTTGGGTTGGGTCGGTTTGTTTTTGGGTG
T7_06043_G04	GGGGTTTTTGGTGGTTGGTCTTTTGGGTTTGGGGTT
T7_06044_G04	GGGTTGGGGTTGGGGTTGTCTTTGGGTTTTTTTTGG
T7_06045_G04	GGGTGGGGTTTTTTTTTGTCTGGGTGGGGTTTTTGG
T7_06046_G04	TTTTTGGGTGGGGTTGGGTCGGTGGGGTTTTTTTTG
T7_06047_G04	GGTTTGGTTTGGGGTTTGTCTGGGTTTGGTTTTGGG
T7_06048_G04	GGTTTGGGTGTGGGGTTGTCTTTTGGGTTTTGGGTT
T7_06049_G04	TTGTTGGGTTTGTTGGGGTCGTTTTGGGGTTTTGGG
T7_06050_G04	GGGTTTGGGGTTGGGTTGTCTTTGGGTTTTTTGTGG
T7_06051_G04	GGGGTTTTTTGGGTTTGGTCGGTGGGGTTTTTTTGG
T7_06052_G04	GGTGGGTGGGGTTTTTGGTCGGGTTTTTTTTTTGGG
T7_06053_G04	GGGGTTGTTTGGGGTGGGTCGTTTTTTTTGGGGTTT
T7_06054_G04	TTTTTTTTGGGTTTGGGGTCGTGGGTTTTGGGTGGG
T7_06055_G04	GGGGTGGTTGGTTTGGGGTCTTGGGTTTTTTTTTGG
T7_06056_G04	GGGGTTTGGGGTGGGGTGTCTTTTTTTTTTTGGTGG
T7_06057_G04	TTTTTTGGGGTTTTGGTGTCTGGGGTGGGTTTGTGG
T7_06058_G04	GGGGTTTTTTTTTGGGTGTCTGGGGTGGGTTTTTGG
T7_06059_G04	TTTTTGGGGTTTTTGGGGTCGTTGGGTTGGTTTGGG
T7_06060_G04	GGGGTGGGGTTTTTTTTGTCTGGGTGGGGTTTTTTG
T7_06061_G04	GTTTGGGGTTGGGGTTTGTCTTTTGGGTTGGGGTTT
T7_06062_G04	GGGGTTTGGGGTGTTTTGTCTTGGGTTTTTTGGGGT
T7_06063_G04	TTTGGGTGTGGGGTGGGGTCTTTTTTTTGGTTTGGG
T7_06064_G04	GGTTGGGGTTTTTTTTTGTCTTGGGTTGGGGTGGGT
T7_06065_G04	GGGTTGGGTGGGTTTTTGTCTTTTTGGGTTGGGGTT
T7_06066_G04	GGGGTTTTTTGGGGTTTGTCTTTTTGGGGTTGGGGT
T7_06067_G04	GGTTTTGGGTGTTTTTTGTCTGGGGTGGGTTTTGGG
T7_06068_G04	TTGGGGTTTGGGGTGGTGTCTTTGGGGTTTTTTTGG
T7_06069_G04	GGGGTTGGGTTTTTGGGGTCTGGGGTTGTTTTTTTG
T7_06070_G04	GGGGTGGGTTTTTTTTTGTCTGGGTGGGGTTTTGTG
T7_06071_G04	GGGGTTGGGGTTGGGGTGTCTTTTTTTGGGGTTTTT
T7_06072_G04	TGGTGGGGTTTTTTGGTGTCGGGGTGGGTTTTTTTG
T7_06073_G04	GGGGTTTGGTTTTTGGGGTCGTTGGGTTTGGGTTTT
T7_06074_G04	TGGGGTTTTTTTTTTTTGTCGGGGTGGGGTGGGTTG
T7_06075_G04	TTTGGGGTTTGGGGTTGGTCGGGTTTTTTTTGGGGT
T7_06076_G04	GGGTTGGTGGTTTTTTTGTCGGGTGGGGTGGTTTTT
T7_06077_G04	GGGTGGGGTTGGTTTTTGTCTTTTGGGGTTTTTGGG
T7_06078_G04	TTTTGGGGTTTTTGGGTGTCTTTTGGGTTGGGTGGG
T7_06079_G04	TGGGTGGGGTTGGGGTTGTCTTTTTTTTGGGGTTTG
T7_06080_G04	GGGGTTTTGGGTTTTTTGTCGGTTTGGGGTTGGGTT
T7_06081_G04	GGTTTTGGGGTTTTTTTGTCTGGGGTTTGGGGTTGG
T7_06082_G04	GGTTTTTTGGGGTTGGGGTCGTGTTGTTGGTTTTGG
T7_06083_G04	GGGGTTTTTTGGGGTTTGTCTTGGGGTTTTTGGTGG
T7_06084_G04	GGTGGTTTTTGGGGTTTGTCTGGGGTTTGGGGTTTT
T7_06085_G04	GGGGTTTTGGGGTTGGGGTCTGGTTGGGTTTTTTTT
T7_06086_G04	TTTGGGGTTTGGGTGGGGTCGTTTGGGTGTTGTTTT
T7_06087_G04	GGGGTTTGGGTTTTTTTGTCTTTGGGGTGGGTGTTG
T7_06088_G04	GGTGGTTTTTGGGTGGGGTCTTTTTGGGGTTGGTTT
T7_06089_G04	GGGTGGGGTTGGTGGGTGTCTTGGTTTTTGGTTTTT
T7_06090_G04	GGGGTTTTTGGGTTTTGGTCGGTTTTGGTTGGTTGG
T7_06091_G04	GGTTTTGGGGTGGGTTGGTCGGGTGGTTTTTTGTTT
T7_06092_G04	TTTGGGGTGGGGTTGGGGTCGTTTTTGGGGTTTTTT
T7_06093_G04	TTTGGTGGGTTTGGGTTGTCTGGGGTTTTGGGGTTT
T7_06094_G04	GTTTGGGGTGTGGGGTTGTCTTTTTGGGTTTTTGGG
T7_06095_G04	GGGTTTTGGTGGGTTTTGTCTTTTGGGTTGGGTTGG
T7_06096_G04	TTGTTTGGGTGGTGGGTGTCGGGGTTTTTTTTGTGG
T7_06097_G04	GGGGTTTTTTGGGTTTTGTCGTGGGGTTTTGGGGTT
T7_06098_G04	GGTTGTTTGGGGTTTGGGTCGGTGGTTTGGGTTTTT
T7_06099_G04	GGGGTTTGGGTTTTTTGGTCGTTGGGGTTTTGGGTT
T7_06100_G04	GGGTGGGTTGGGTGGGTGTCTTTTTTTTTTGGGGTT
T7_06101_G04	TTTTGGGGTTTTTTGGGGTCTGGGGTTGGGGTTTTG
T7_06102_G04	GGGGTTTTTTTTTTTTTGTCGGGGTTGGGGTGTGGG
T7_06103_G04	GGGGTTTTGGGGTTTTTGTCTTGGGGTTTTTGGTGG
T7_06104_G04	TTGGGGTTGGGTGTTGGGTCTTTGGGGTTGGTTTTT
T7_06105_G04	GGTTTTTGGGTTTTTTTGTCTGGGGTGGGGTTGGGT
T7_06106_G04	GGGTTTTTTTTGGGTGGGTCTTTTGGGGTTGGGTTG
T7_06107_G04	TTTTTGGGGTTTGGGTGGTCGTTTTTGGGTTGGGGT
T7_06108_G04	GGGGTTGGGGTTTTTTTGTCTTGGTTGGGGTTTGGT
T7_06109_G04	GTGGGTTTTTTGGGGTTGTCTGGGGTTTTTTGGGGT
T7_06110_G04	GGGGTGGGTTTGGGTTTGTCTTTTTTGGGTTGGTTG
T7_06111_G04	GGTTTTTGGGGTTTTTGGTCGGGTTTTTTGGGTGGG
T7_06112_G04	GTTTTTTTTGGGGTTGGGTCGGTTTTGGGGTTTGGG
T7_06113_G04	GGGGTTTTTGGGTTTTTGTCTTGGGTTTGGGGTTGG
T7_06114_G04	TTGGTTTTGGTGGGGTTGTCTGGTTTTTTGGGTGGG
T7_06115_G04	GGGGTTTGGTTTTTTTGGTCGGTTGGGGTGGGTTTT
T7_06116_G04	GGGGTGGGTTTTGGGTTGTCTTGGGTTGGGTTTTTT
T7_06117_G04	GGGGTTGGGGTGGGGTTGTCTTGGGGTTTTTTTTTT
T7_06118_G04	GTTGGGTTTTTGGTTTGGTCGGTTTTTGGGGTTGGG
T7_06119_G04	GGGGTTTTGGGTTTTGGGTCGTTTGGGTTTTTTGGG
T7_06120_G04	GGGGTTGGTTTTGGGTTGTCGGGGTTTTTTTTTGGG
T7_06121_G04	GTTGTGGTGGGTGGTGGGTCGGTTTTTTTTTTTGGG
T7_06122_G04	TGGGGTGTTGGGTTGGGGTCGTTTTTGGGGTTTTTT
T7_06123_G04	GGTTTTTTGGGTTTGGGGTCTGGGGTTGGTTTTTGG
T7_06124_G04	GGGGTTTTTTGGGGTTGGTCGGGTTTTTTGGGTTTG
T7_06125_G04	GGGTTGGGTTTGGGGTTGTCTTTTGGTTGGGGTTTT
T7_06126_G04	GGGGTTGGGGTTTTGGGGTCGTTTGGGGTTTTTTTT
T7_06127_G04	GGGGTGGGGTTTTTTGGGTCGGTTGGGGTTTTTTTT
T7_06128_G04	TGTTGGGGTTTTGGGTTGTCTTTGGGTTGGGTTTGG
T7_06129_G04	TGTGGGTTTTTGTTTGGGTCGGTTTTTTGGGGTGGG
T7_06130_G04	TTTTTGGGTTGGGTTTGGTCGGGTGGGTTTTGGGTT
T7_06131_G04	GGGTGGGGTTTGGGTTTGTCTTTTTTTTTGGGTGGG
T7_06132_G04	TGGGGTGGGTTTTTGGGGTCGTGGGTTTTTTTTGGT
T7_06133_G04	GGGGTTTTGGGGTTTTTGTCTGGGGTTTGGGGTTTT
T7_06134_G04	GGGGTGGGTTTTTTTTTGTCTTGGGTTTGGTGGGGT
T7_06135_G04	GGGTTTTGGGTTTTGGTGTCTGGGGTTTTTTGGTGG
T7_06136_G04	GGGTTTTTTTTTGGGGTGTCTGGGGTTTTGGTTGGG
T7_06137_G04	GGGGTTTTTTTTTTGGGGTCTTGGTGGGGTTGGTTG
T7_06138_G04	GGTTTTTGGTTGGGGTGGTCGGGTTTTTGTTTTGGG
T7_06139_G04	TTGGGGTGGGTTTGGGTGTCTTTTTTTGGGGTTTGG
T7_06140_G04	GGGGTGGGGTTGGTTTTGTCTTTGGGGTTTTTTTGG
T7_06141_G04	GGGTTTGTGGGGTGGGTGTCTTTTGTTTTTTGGGGT
T7_06142_G04	GGTGGTTTTTTTGTGGGGTCGTTTTGGGTTTGGGGT
T7_06143_G04	GGGGTTGGGGTTTTGGTGTCTTGGGGTTTTTTTTGG
T7_06144_G04	GGGTGGGGTTGGGGTTTGTCTTTTGGTTTTGGGTTT
T7_06145_G04	GGGGTTTGGTTGGGGTTGTCTGGGTTTTTTTTGGGT
T7_06146_G04	GGGGTGGGTTTTTTTTGGTCGGTTTTGGGTTTTGGG
T7_06147_G04	TTGGGGTTTGGTTTTTGGTCGGTTGGTGGTGGGTTT
T7_06148_G04	TTTTTGGGGTGGGTTTTGTCGGGGTGGGGTTTTTTG
T7_06149_G04	GGGTTGGTGGGGTGGGTGTCTTTTTTTTTTTGGGGT
T7_06150_G04	TTTGGGTTTTTTGGGGTGTCTTTGTTGGGGTGGGGT
T7_06151_G04	TTGGGTTTGTGGGGTGGGTCTGGGGTTTTTTTTTGG
T7_06152_G04	GGGGTTTTGGGGTTTTTGTCTTGGTTTTGGGTGGGT
T7_06153_G04	GGGTTGGGTGGGGTTTTGTCTGGGTTTTTTTTTGGG
T7_06154_G04	GTTGGGGTTGGGGTTTTGTCTGGGGTTTTTTTTGGG
T7_06155_G04	TGGGTGGGTGGGGTTTTGTCTTGGGTTTTTTTTGGG
T7_06156_G04	GGGGTGTTTTGGGTTTGGTCGTTTTTTTGGGTTGGG
T7_06157_G04	GGGGTTGGGGTGGGGTTGTCTTTTTTTTGGGGTTTT
T7_06158_G04	TGGGGTGGGTTTTTTGGGTCGTTTGGGTTTTTTGGG
T7_06159_G04	TTGGGGTGGTGGGTTTTGTCTTGGGTTTTGGGGTTT
T7_06160_G04	TTTTGGGGTTTTGGGGTGTCGGGTGGGTTTTTTTGG
T7_06161_G04	GGTTTTTTGGGGTTTTTGTCTTGGGGTGGGGTTTGG
T7_06162_G04	TTTGGGGTTGGGGTTTTGTCTTTGGGGTTGGGGTTT
T7_06163_G04	TTTTGGGTTGGGGTTTTGTCTTGGTTTGGGGTTGGG
T7_06164_G04	GGGTTTGGGGTGGTTTGGTCGGGTTTTTTGGGTTTT
T7_06165_G04	GGTTTTGTGTGGGGTTTGTCTTTGGTTTGGGTTGGG
T7_06166_G04	GGGTGGTTTTTTTTTTTGTCTGGGGTGGTGGTTGGG
T7_06167_G04	TTTGGGGTGGGGTGGGTGTCGGGGTTTTTTTTTTTG
T7_06168_G04	GGGTGGGTTTGGGGTTTGTCGGGGTGGTTTTTTTTT
T7_06169_G04	GGGGTTTTTTTTGGGGTGTCTTTTTGGGGTTGGGGT
T7_06170_G04	TTTTTTGGGGTTTTTGGGTCTGGGGTTTGGTGGGGT
T7_06171_G04	TGGGTGGGGTTTTTGGGGTCTGGTTTTTTTGGGGTT
T7_06172_G04	TGGGTGGGTTTTTTGGTGTCGGGGTGGGGTTTTTTT
T7_06173_G04	GGGGTTGTGGGTGGGGTGTCTTTTTTTGGGGTTTTT
T7_06174_G04	GGGGTTTTTTTTTGGGTGTCTTGTGGGTTTGGGGTG
T7_06175_G04	GGGTTTTTTTTGGGTGTGTCTGGGTTGGTGGGGTTT
T7_06176_G04	GGGGTGGGTTTTTTTGGGTCGGTTTTGGTTTTTGGG
T7_06177_G04	GTTTGTTTGGGGTTTGGGTCGTTTTGGGGTTTTGGG
T7_06178_G04	GGGTTTTTTTTTGGGGTGTCTGGGTGGGTTGGTTTG
T7_06179_G04	GGGGTGGGTGGGGTTTTGTCTTGTTTTTTGGGGTTT
T7_06180_G04	GGGTTTTTTTTTGGGGTGTCTTTTGGGTGTGGGGTG
T7_06181_G04	GGGGTTTTTTTGGTGGTGTCTTGGGTGTGTTTTGGG
T7_06182_G04	GGTTTTGGGGTTGGGTGGTCGGTGGGGTTTTTTTTT
T7_06183_G04	TTTTTTGTTTTTGGGGTGTCTGGGTTGGGTGGGTGG
T7_06184_G04	GGGGTGGGGTTTTGTGGGTCTGGGTTTTTTTTTTGG
T7_06185_G04	GTTTTTTGGGGTTTTTGGTCGGGTTTTGGGGTTGGG
T7_06186_G04	GGTGTTTTTTGGGGTTTGTCTTGGGTGGGTTTTGGG
T7_06187_G04	TTTGGGTGGGGTTTGGGGTCGTTTTTTTTGGTGTGG
T7_06188_G04	GGGGTTTTTTGGGGTTTGTCTTTGGGGTTTGGGTGT
T7_06189_G04	GGGGTTTTTTTTTGTTGGTCGGGTTGGGGTTTTGGG
T7_06190_G04	GGGTTTTTGGGGTTGGTGTCTGGGTTTTGGGGTTTT
T7_06191_G04	GGGGTTGGGGTGGTTTTGTCTGGTTTTTTTGGGGTT
T7_06192_G04	GGGGTTTGGGTGGGGTTGTCTGGTTTTTTTTGGGTT
T7_06193_G04	GTTGGGGTTTTTTTTGGGTCGGTTTGGGGTTTTGGG
T7_06194_G04	GGGTTTGGGTTTTTTTGGTCGGGTGGGTTTTTTGGG
T7_06195_G04	TTTTTGGGGTGGGGTTTGTCGGGTTTTTGGGTGGTT
T7_06196_G04	GGTGGTTTGGGTGGGGTGTCTTTTTTTTGGGGTTTG
T7_06197_G04	GGGGTTGTTTGGGGTGGGTCGGTGGGTTTTTTTTTT
T7_06198_G04	TTGGGTTTTGGTGGGTTGTCTTGGTGGGGTTTTTGG
T7_06199_G04	GGGGTGGTTTTTTTTTTGTCGGGGTTTTTGGGGTGG
T7_06200_G04	GTGGGGTTGGGGTTTTTGTCTTTTTTTGGGGTTGGG
T7_06201_G04	GGTGGGGTGGTTTTTTTGTCTTGGGGTTTTGGGGTT
T7_06202_G04	GGGGTTTGGGTTTTTTTGTCGGGGTTTGTGGGGTTT
T7_06203_G04	GGTTTTTTTTGGGGTTTGTCGGGGTGGTTGGTGGTT
T7_06204_G04	TGGGTGGGGTGGGGTTGGTCGGGTTTTTTTGTTTTT
T7_06205_G04	GTTGGTTTTTTTTTTGGGTCGGTGGTGGGGTTTGGG
T7_06206_G04	GGTTGGGTTTTGGGGTTGTCTTTGGGGTTGTTTTGG
T7_06207_G04	GTTGGGTTTGGGGTTTGGTCGTGGGTTTTTTTTGGG
T7_06208_G04	TTTTTTTTTGGGGTGGTGTCTGGGTTTGGGGTTGGG
T7_06209_G04	GGGGTTTGGGGTTGGGTGTCTTTGTGGGTTTTTTTG
T7_06210_G04	GGGGTGGGTTTTTTTTTGTCTGGGTGGTTTGGGGTT
T7_06211_G04	GGGGTTTGGGGTTTGGGGTCTTTTGGTTTTTTTGGG
T7_06212_G04	TGGGGTTTTTTGGGGTTGTCGGGGTTTTTGGGGTTT
T7_06213_G04	GGGTTTTGGGGTGGTTTGTCTTGGGGTGGGTTTTTT
T7_06214_G04	GGGGTGGGTTTGGTTGTGTCTTTTTGGGGTGGTTTT
T7_06215_G04	TTGGGGTTTTGGGTGTTGTCGGGGTTTTGGGGTTTT
T7_06216_G04	TTGGTTGGTTTGGGGTTGTCTTTTTGTTGGGGTGGG
T7_06217_G04	GGGGTGGGGTTTTTTTTGTCGTTTTTGGGGTTTGGG
T7_06218_G04	GGTGGGTTTGGGTTGGGGTCGTTGGGGTTTTTTTTT
T7_06219_G04	GTGGGTTTTTTTTGTTTGTCGGGTTTGGGTGGGGTG
T7_06220_G04	GGGTGGGGTTTTGGGGTGTCGGGGTTTTTTTTTTTG
T7_06221_G04	TTTGGGTTTTTGGGTGTGTCGGGTTTTGGGTTTGGG
T7_06222_G04	GGGGTTTTTTGGGTGGGGTCTTTTTTTGGGTTTGGG
T7_06223_G04	GGGTTGGGTTGGGTGGGGTCTTTTTTGGTTTTTGGT
T7_06224_G04	TTTTTGGTTGGTGGGGTGTCGGGTGGTTTTTTTGGG
T7_06225_G04	GGTTTGGGGTTTGGTTTGTCTTTTTGGGTGGGGTGT
T7_06226_G04	GGGGTGGGGTGGGGTTTGTCTTTTTTTTTTGGGGTT
T7_06227_G04	GGGTTTTTTTTGGTGGGGTCTTTTTTGTGGGGTGGG
T7_06228_G04	TTTTGGTTTTGGTTGGGGTCGTTTGGGGTTTGGGGT
T7_06229_G04	GGGGTGGGTTGGTTTTGGTCGGTTGTTTTTTTTGGG
T7_06230_G04	TTTGGGGTTTTGTTTGGGTCGGTTTGGGGTTTTGGG
T7_06231_G04	TTGGGTTTGGTTTTGGGGTCTTTTTGGGGTGGGTTG
T7_06232_G04	GGGTGGGTTTGGGTTTTGTCTTGGGGTTTGGTTTTG
T7_06233_G04	TGGGGTGGGGTTTTTTTGTCGTGGGTTTTTGGTTGG
T7_06234_G04	TTTGTGTGGGGTTTTGGGTCGGTTTTTTTGGGGTGG
T7_06235_G04	GGGTGGGGTTTGGTTTGGTCGGTGGTTTTGGTTTTT
T7_06236_G04	GGGGTGTTGGGGTTTTTGTCGGGGTTTTGGGTTTTT
T7_06237_G04	TTGGGGTGGTTGGGGTGGTCGGTTTTTTTTTTTGGG
T7_06238_G04	TTGGGGTTTGGGGTTGGGTCTGGGTTTTTTTTTGGG
T7_06239_G04	GGTTGGGTTTTTTTTTGGTCGGGTGGGTGGGGTTTT
T7_06240_G04	TTTTGGGGTTTTTTGGTGTCGTTTGGGGTTGGGGTG
T7_06241_G04	TTTTGGGGTTTGGGGTTGTCGGGGTTTTGGGGTTTT
T7_06242_G04	GGGGTTGGGGTTTTTTGGTCGGTTTTTTGGGGTTTG
T7_06243_G04	TGGGTTGGGGTGGTTTTGTCGTTTTTTTTGGGGTGG
T7_06244_G04	TGGGGTTTTTTGGGGTTGTCTTTTGGGGTTTGGGGT
T7_06245_G04	GGGGTTGGTTTTGGGGTGTCTGGGTTGGGTTTTTTT
T7_06246_G04	TTTTTTTGGGGTGGGGTGTCTTGGGGTTTTTGGGGT
T7_06247_G04	GGGGTTTTGGGTTTTTTGTCGGGTTGGGGTTTTTGG
T7_06248_G04	GGTTTTTGTGGGGTTTGGTCTTTTGGGGTGGGGTTT
T7_06249_G04	TTGGGGTTTTGTTTGGGGTCTGTTTGGGGTTTGGGT
T7_06250_G04	GGGTGGTTGGGGTTTTTGTCTTTTGGGTGGTTTTGG
T7_06251_G04	GGGGTTTGTTTTTTGGGGTCTGGGGTTTTTTGGGGT
T7_06252_G04	GGGTTTTTTTGTGGTTGGTCGGGTTTTGGGGTTTGG
T7_06253_G04	GGGTTTTTTTTTGGGGTGTCTTTTTGGTGGGGTGGG
T7_06254_G04	GGGGTGTTGTGGGTTTTGTCTGGGTTTTTGGGGTTT
T7_06255_G04	GGTGGGGTTTGGGGTTTGTCTTTTTTGGTGGGGTTT
T7_06256_G04	TGGGGTTGGGGTGGGTTGTCTTGGGGTGTTTTTTTT
T7_06257_G04	GGGTTTGGGGTTTTGGGGTCTTTGGGGTTTTTTTGG
T7_06258_G04	GGTTTTTTTGGTTGGGTGTCTTGGGTTTGGGTTGGG
T7_06259_G04	GGGGTTTTGGGTTTTTTGTCTTGGGGTTTGGTTGGG
T7_06260_G04	GGGGTTTGGGTTTTTGGGTCTTGGTTTTGGGTTTGG
T7_06261_G04	GGTTTGTTTTTGGGGTTGTCTGGGTGGGGTTGGTTT
T7_06262_G04	GGTTTTGGGGTGGTTGGGTCGTTTTTTTTGGGTTGG
T7_06263_G04	TTTTTGTTTGGGGTTTGGTCGGTGGTTTGGGTTGGG
T7_06264_G04	GGGTGGGGTTGGGGTTTGTCGGGTTTTTTTTTTTGG
T7_06265_G04	GTTGGGTTGGGGTTTTTGTCGGTTTGGGTTTTTGGG
T7_06266_G04	GGGGTTGGGTTGGGTTTGTCGGTTTTTTTTGGGTTG
T7_06267_G04	TTTGGGGTTTGGGGTTTGTCTGGGGTTTTTTGGGGT
T7_06268_G04	GGGGTTGGTTTTTGGGTGTCTTTTTTTTGGGGTGGG
T7_06269_G04	GGGGTTTGGGGTTTTTTGTCTGGGGTTTTTGGGGTT
T7_06270_G04	GGGGTTTTTTTGTTGGGGTCGTTTTTTTGGGGTGGG
T7_06271_G04	GGGGTTTTTTTGGGTTTGTCGGGTGGGTTTGGGTTT
T7_06272_G04	GTTGGGGTTTTTTTTGGGTCGTGGTTTTGGGGTTGG
T7_06273_G04	GGTTTGGGGTTTGGGGTGTCGGTTTTTTTGGGGTTT
T7_06274_G04	GGGGTTGGGGTTGGTTTGTCTTTTTTTGGGTGGGTT
T7_06275_G04	TGGGGTTTTTTTGGGTGGTCGGGTGGGTTTTTTTGG
T7_06276_G04	TGGGGTGTGGGTTTTTTGTCGGGGTTGGGTTTTTTG
T7_06277_G04	GTTTTTTTTTTTGGGGTGTCGGGGTGGGGTTTTGGG
T7_06278_G04	GGGTTGGGGTTTTTTTGGTCGGGTGGGTTTTTTTGG
T7_06279_G04	TTTTTGGTTGGGGTTTGGTCGGTTTTGGGGTTTGGG
T7_06280_G04	GGGTGTTTGTTGTGGGTGTCGGTTTTGGGGTTGTTT
T7_06281_G04	GGGGTTTTTTTTGGGTTGTCTTTGGGGTTTGGTGGG
T7_06282_G04	GGGGTTTTGGGTTGGTTGTCTTTGGGTGGGGTTTTT
T7_06283_G04	GGGTTGGTTTGGGGTTTGTCTTGGGGTTTGGGTTTT
T7_06284_G04	GGGGTTTTTTTTTTTTGGTCGGGTGGGGTTGGGGTT
T7_06285_G04	TTTTGGGGTTTTTTTTTGTCTGGGGTGGGTGGGTGG
T7_06286_G04	TTTTGGTTTTGGGGTTTGTCGGGGTTGGGTTGGGTT
T7_06287_G04	TGGGTTGGGTGGGTTGGGTCGGTTGTTTTTTTTTGG
T7_06288_G04	GTGGGGTTTTGTGGGGTGTCGGTGTTTTTGGTTGTT
T7_06289_G04	GGGGTTTTGGTTTTGGGGTCGTTTTTTGGTGGGGTT
T7_06290_G04	GGGTTTTTTTTTTTTTGGTCGGTGGGGTGGGGTTGG
T7_06291_G04	TGGGGTTTTTTGGGGTTGTCTTTGGGTGGGTTTTGG
T7_06292_G04	GGTTGGGGTTGGGTTTTGTCTTGGGGTTTTTTTGGG
T7_06293_G04	TTTTTTGGGGTTGGGTTGTCTGGGGTTTTGGGTTGG
T7_06294_G04	TTTGGGTTTTTTGGGTGGTCGGTTGTGTTGGTTGGG
T7_06295_G04	GTTTTGTTTTTGGGGTTGTCTGGGGTTGGGGTTTGG
T7_06296_G04	TTTTGGGTTTTTTTGGGGTCGTGGGGTTTGTGTGGG
T7_06297_G04	TTGTTGGGTTGGGGTTTGTCTTTTTTGGGGTGGGGT
T7_06298_G04	GGGGTGGGTGGGGTTTTGTCTGTGGGGTTTTTTTTT
T7_06299_G04	GGGGTTGGGGTTTTTGGGTCGGTTTGTTTTTTTGGG
T7_06300_G04	TGGGTTTTTTTTGTGGGGTCGTGGGGTTGGGGTTTT
T7_06301_G04	GGGGTTGGTTTTGGTTTGTCTTTGGGTTTTGGGGTG
T7_06302_G04	GGGGTTTTGGGGTTTTTGTCTTTTGGGGTTTGTGGG
T7_06303_G04	GGTTTTTTTGGGGTTTGGTCGGGTGGGTTTGGGTTT
T7_06304_G04	GGGTTGGGGTTGTTTTTGTCTTGGGTTTGGGTTTGG
T7_06305_G04	GGGGTTTTTTGGGTGGGGTCTGGGTTTTGTTTTTGG
T7_06306_G04	GTTTTTGGGGTGGGTTGGTCGGGTTGGGTTTTTTTG
T7_06307_G04	GGGTGGTGGGGTGGGGTGTCTTTTTTTTTTTTGTGG
T7_06308_G04	TTTTGGTGGGGTTTGGGGTCGTGGGTTTTTTTGGGT
T7_06309_G04	GGGGTTTTGGGTTTGGGGTCGTTTTTTTTGGGTTGG
T7_06310_G04	GGGTTTTTTGGGGTGGGGTCTTTGGTTGGGGTTTTT
T7_06311_G04	TTTTTGGGGTTGGTTTTGTCTGGGGTTGGGTGGGTT
T7_06312_G04	GGTTGGGGTTGTTTTTTGTCTGGGGTGGGTGGTTTT
T7_06313_G04	GGTTTTGGTTGGTTTTTGTCTGGGTGTTTGGGGTGG
T7_06314_G04	GGGGTTTTTTTTGGGGTGTCTTTGGGTGGGGTTGTT
T7_06315_G04	GGGGTTTTTTTTGGGGTGTCTGGTGGGTTTTTTGGG
T7_06316_G04	TGGGGTTTTTTTTTGGGGTCGTTTTGGGGTTGGTGG
T7_06317_G04	GGGTTTTGGGGTTTGGTGTCGGTTTTTTTGGTTGGG
T7_06318_G04	GGTGGTTGGTGGGGTTGGTCGGTTTTTTTTTTTGGG
T7_06319_G04	TGGGTTTTTTTTGTTTTGTCTGGGGTGGGGTGTGGG
T7_06320_G04	GGGTTTGGGGTTTTTTTGTCTTGGGGTGGGTTTTGG
T7_06321_G04	GGGGTGGTTGTTTTTTTGTCTTGGGGTTTTGGTGGG
T7_06322_G04	GGGGTTGGGGTTTTTGGGTCGGTTTTTTTTTGGGTG
T7_06323_G04	TGGGGTTTTTTTTTTGGGTCGGTTTGGGGTGGGGTT
T7_06324_G04	GGTTTTGGTTTGGGTTTGTCGGGTTGGGTTTTGGGT
T7_06325_G04	GGGGTGGTTTTTGGGGTGTCTTTGGTTTGGGTTGTT
T7_06326_G04	GGGGTTGGGGTTTTGGTGTCGGTGGGGTTTTTTTTT
T7_06327_G04	TTGGTTGTGGGTTTTTGGTCGGTTGGTTGGGTGGTT
T7_06328_G04	TTTGGGGTGGGTTTTTGGTCTTGTTTGGGTGGGGTT
T7_06329_G04	GGGGTTTTTTTGTTTGGGTCGTGTTTTGGGGTTGGG
T7_06330_G04	GGTTTTGGTGGTTTTTTGTCGGGGTGGGTTTTTGGG
T7_06331_G04	GTGTTTTGGTGGGTTTGGTCGTTGGGTTTTTGGGTG
T7_06332_G04	GGGTTTTGGGGTTTTGTGTCGGGGTTGGGGTTTTTT
T7_06333_G04	TTGGGGTGGGGTTTGGGGTCGTGTTTTTTTTTTGGG
T7_06334_G04	GGGGTGGGGTTTTTTTTGTCGTTTTTTGGGGTTGGG
T7_06335_G04	GGGGTTGGGGTTTTTTTGTCGGGGTTTTGGGGTTTT
T7_06336_G04	GGGTGGGTTTTGGGTTTGTCGGGGTTTTGTTTTTGG
T7_06337_G04	GGGTTTTTGGGGTGGGTGTCTTTTGGGTTTTTTGGG
T7_06338_G04	GGGTTGGGTTTTTTTGGGTCGGTTGGTGGGGTTTTT
T7_06339_G04	GGGTTTGGGTTTTTGGGGTCGTTTTTTTTGGGGTGG
T7_06340_G04	GGGTTTGGTTTTGGTTTGTCGGGGTGGGTTTTTTGG
T7_06341_G04	GGGTGGGGTGGGGTTTTGTCGGTTGGGTTTTTTTTT
T7_06342_G04	GGTGGTTTTTTGGTTTTGTCTTTGGGGTGGGTTGGG
T7_06343_G04	TGGGGTTGGGTGGTTGGGTCGTTTTTTTTGGGTTTG
T7_06344_G04	GGGGTTTTTTGGTTTTTGTCGTGGGTTTGGGTGTGG
T7_06345_G04	GGGTTTTTGTTTTTGGGGTCTTTGGGGTTGGGGTTG
T7_06346_G04	GGGTTTTTGGGGTTGTTGTCTTGGGGTGGTGTTGTT
T7_06347_G04	TGGGTTTTTGGGTTGGGGTCTTTTGGGTTTGGTTGG
T7_06348_G04	TTTTTGGGTGGGGTGGGGTCGTTGGGTTTTTGGTTT
T7_06349_G04	GGGTTTTGGGTTGGGGTGTCTTTGGTTTTTGGTTGG
T7_06350_G04	GGGTTGGTTGGGTTTTGGTCGGGTTTTTTGGTTTGG
T7_06351_G04	GGGTTGGGTTGGGTTGGGTCGTTGGTTTTGGTTTTT
T7_06352_G04	GGGGTTTTTTTTGGTTTGTCTTGGGGTGGGGTTGGT
T7_06353_G04	GGGGTTGGTGGGTTTTGGTCTGGTTTGGGGTTTTTT
T7_06354_G04	GGGGTGGGTTTGGGTTTGTCTTTTTGGGTTTTTGGG
T7_06355_G04	TTGGGGTTTTTGGGGTTGTCTTGGGGTTTGGGGTTT
T7_06356_G04	GGGGTTGGGGTTTTTTGGTCGGTTGTTTTTGGGGTT
T7_06357_G04	TGGGGTGGGGTTTTGGGGTCGTTGGTGGTTTTTTTT
T7_06358_G04	TTTTTTTGGGGTTGGTTGTCTGGGGTTGGGGTTTGG
T7_06359_G04	GGGTTTTGGGTGGGTTTGTCTTTGGGTTTGGGGTTT
T7_06360_G04	GGGGTTTGGTTTGGGGTGTCTTTTTTTTGGGGTTGG
T7_06361_G04	GGGGTTTTTTTTGGGGTGTCTGGGGTTTTTGGGGTT
T7_06362_G04	TTGGGTGGGGTGGGGTTGTCGGGGTTTTTTTTGTTT
T7_06363_G04	GGGGTTTTTTTGGGGTTGTCTTGGGTTTGGGGTTTG
T7_06364_G04	GGGTGGTGGGGTGGTTTGTCGTTTTGGGGTTTTTTT
T7_06365_G04	GGGTTTGGGGTTGGGGTGTCGGGTGGTTTTTTTTTT
T7_06366_G04	GGGGTTTTGGGTTGTTTGTCTTTTGGGTGGGGTTTG
T7_06367_G04	GGGTTTTTGGTGGGGTTGTCTTTTGGTTTTGGTGGG
T7_06368_G04	GGGGTGGTTTTTTTTGGGTCGGTTTTTTGGGGTTGG
T7_06369_G04	GGGGTTTTGGGGTGTTTGTCTTTGGGTTTGGGGTTT
T7_06370_G04	GGGGTTTTTTGGGGTTTGTCGGGGTTTTTTGGGTTG
T7_06371_G04	GGGGTTTTTGGGGTTTTGTCTTTTGGGGTGGGGTTT
T7_06372_G04	GGGGTTTTGGGTTTTTGGTCGTTTGGGGTGGGTTTT
T7_06373_G04	TGGGGTTGGGTTTTTGGGTCGGTGTTTTTTGGGGTT
T7_06374_G04	TTGGGGTTTTGGGGTTTGTCTTGGGTTTTTGGTGGG
T7_06375_G04	GGGGTGGGGTTTTGTTTGTCTTTGGGTTTTTGGTGG
T7_06376_G04	GGGTGGGTTTTTGGGGTGTCTTTTTGGGTTTTGGGT
T7_06377_G04	GGGGTTTTTGTGGGTTGGTCGTTTTTTTTGGGGTGG
T7_06378_G04	TTTTGGTGTTTTTTGGGGTCTTTGGGTTGGGGTGGG
T7_06379_G04	GGGGTTTTTGGGTTTTTGTCTTTGGGTGGGGTTTGG
T7_06380_G04	GGGGTGGGGTGGGTTTTGTCTTTTTTTTGGTTTGGG
T7_06381_G04	GGGTTGGGGTTTTTTTTGTCTTTGGGTTTGGGTGGG
T7_06382_G04	GGTGGGTGGGGTTTTTTGTCTTTTGGGGTTTTTGGG
T7_06383_G04	GGGGTGGGGTTTTTTTTGTCGGTTTGGGGTTGGTTT
T7_06384_G04	GGGGTTGGTTTTGGTTTGTCTGGGTTTTTGGGTTGG
T7_06385_G04	GGTTTTTGGGGTTTTGGGTCGGTTTGGTTTTGGGGT
T7_06386_G04	GGTGGGGTTGGGTTTTTGTCTTTGTTTTGGGGTTGG
T7_06387_G04	TTGGGTGGGTTGGGGTTGTCTTTTGGGTTTGGGTTT
T7_06388_G04	GGGGTTGGTTGGGGTGGGTCGGTTTTTTTTTGGTTT
T7_06389_G04	TGGGGTTTTGGGGTGGGGTCTTTTTTGGGGTTTTTG
T7_06390_G04	GGGTTTTTTTTGGGGTGGTCGGTTTGGGGTTTTTGG
T7_06391_G04	TTTTTTGGGGTTGGGTTGTCTTGGGGTGGGTTTTGG
T7_06392_G04	GGGTTGGGGTGGGTTTTGTCTGGGGTTTTTTTTTGG
T7_06393_G04	TTGGGGTGGGTTTTGGGGTCGTTTGGTGGGTTTTTT
T7_06394_G04	GGGGTTTGGGGTTTGGTGTCTTGGGTTTTTTTTGGG
T7_06395_G04	GTTTGGTTTGGGGTGGGGTCTTTTTTGGGGTTTTGG
T7_06396_G04	GGGGTTTGGTTTTTGGGGTCTTTTTTTTGGGGTGGG
T7_06397_G04	GGGTTGGGTGGGGTTTTGTCTTTTGTTTGTGGGTTG
T7_06398_G04	GGGGTTGTTTTTTGGGTGTCTTTGGGGTTGGGGTTT
T7_06399_G04	GGTTGGGGTGGGGTTTTGTCTGGGTTTTTGGGTTTT
T7_06400_G04	GGTGGGTTTGGGGTTTGGTCGGTTGTTTTTGGGTTT
T7_06401_G04	GGGGTGGGGTTTTTTTGGTCGGTTTTTTGGTTGGTG
T7_06402_G04	TGTTTTTTGGGTTTTGGGTCGGTTTGGTGGTGGGGT
T7_06403_G04	GGGGTTGTTTTTGTGGGGTCGTTTTTGGTGGGGTTT
T7_06404_G04	GTTGGGGTGTGTTTTGGGTCTGGGTTGGGGTTTTTT
T7_06405_G04	TTTGGGGTTTTGGTGGGGTCTTGGGTGGGTTTTGTT
T7_06406_G04	GGTTTGGGGTTGTTTGGGTCTTGGTTTGTTTGGGTG
T7_06407_G04	TGGGGTTTTTTTTTGGGGTCTTTGGTGGTGTGGGGT
T7_06408_G04	TGGTTTTGGGTGGGGTGGTCTTGTTGTTTGTGGGTT
T7_06409_G04	GTTTTTTGGGGTTTGGGGTCGTTGGGTTGGGGTTTT
T7_06410_G04	TTTTGTTTTGGGTTGGGGTCTTGGGTTGTTGGGTGG
T7_06411_G04	GGGGTTGGGGTTTTTTTGTCTTGGGGTGGTTTTGGT
T7_06412_G04	TTTGGTGTGGGTTTGGGGTCTTTGGGGTTTTTTGGG
T7_06413_G04	GTTTTTTTGGTTTTTGGGTCGGTTTGGTGGGGTGGG
T7_06414_G04	GTTTGGGGTTTTTTTTTGTCGGTTGGTTGGGGTGGG
T7_06415_G04	TTGGTTTGGGGTTTTTTGTCGGTGGTTGGGTGGTGT
T7_06416_G04	TTTTTTGTTGGTTGGTGGTCTTGGGGTGGGGTTTGG
T7_06417_G04	GGTTTTTTGGTGGTTTGGTCTGTTGTGGTTGGGGTG
T7_06418_G04	GGGTTTTTTGGGGTTTTGTCGGGTGGTTGGGGTTTT
T7_06419_G04	GGGTTTTGGTGGTTTTTGTCGGGGTTTGGTTTTGGG
T7_06420_G04	GGGTTGGGGTTGGGGTTGTCTTTTTGGTTTTTTGGG
T7_06421_G04	TGGGGTGTGTTTTTGGGGTCGTTTGTTTGGGGTTTG
T7_06422_G04	GGTTTGGGGTTGGGTTTGTCTTTGGTTGTTTGGTGG
T7_06423_G04	TGGGTTGGTTTGTTGGTGTCTTGGGTTTTTGGTGGG
T7_06424_G04	TTGGGGTTTTGGGTGTGGTCGTGTTTGTTGGTGGTT
T7_06425_G04	GGTTGGGGTTTTTTTTGGTCGGGTTTGGGTTTGGGT
T7_06426_G04	TGGGGTTTGTTTGGGTGGTCGTTTGTTGGGTTGTGT
T7_06427_G04	GGGGTTTTTTTTTTGGGGTCTTTGGTGGGGTGGTTG
T7_06428_G04	GGGGTTGGGTTTGTTTGGTCGGGTTTTGTTTGTTGG
T7_06429_G04	TGTTTGGGGTTTTTTTTGTCGGGTTGTGGGTGGGGT
T7_06430_G04	TTTGTTGTTGGTTTGGGGTCGTTGGGTTGGGGTTTG
T7_06431_G04	TTGGTTGGGGTGGGGTTGTCTTGGGGTGTTTTTTTG
T7_06432_G04	GGGGTTTGGGGTGGTTTGTCTTGTGGTTGGGTTTTT
T7_06433_G04	GGGTTTGGGTTGGGTTTGTCGTTGTTTTTGGTTGGG
T7_06434_G04	GTTTGTTTTGGGGTGGGGTCGTGGGGTTTTGGTTTT
T7_06435_G04	TTGGGGTTTTGGGTGTTGTCTGGGGTTTGGGGTTTT
T7_06436_G04	GGGGTTTGTGGTTTTGGGTCGGTTGTGGGTTTTTTG
T7_06437_G04	TGGTTGGTTTTTTTTGGGTCGTGGGGTTTGGGGTGT
T7_06438_G04	GGGTGGGTTTGGTTTTTGTCTTTGTTTGGGGTTGGG
T7_06439_G04	TTTTTTGGGGTTGGTGGGTCTTTGTGTTTGGGGTGG
T7_06440_G04	TGGTGGGTTTTTTTTGTGTCGGGGTTTGGGTGTTGG
T7_06441_G04	TTGTTGGGGTTTTTGGTGTCGGTTTTGGTTGGGTGG
T7_06442_G04	TTGTGGGTGTTTGTGGTGTCGGTTTTGGGTTTTGGG
T7_06443_G04	GTTTGGTTTTTGGGTTGGTCGGGTTTTTGGGGTTGG
T7_06444_G04	GGGTTGGTTTTTGTTTGGTCGGGTGTTTTGGTGTGG
T7_06445_G04	GTGGGGTTTTGGGTTGGGTCGTTGTGTTTTTTTGGG
T7_06446_G04	TTGGGGTTTGGTTGTTTGTCGGGGTTTGGTTTTGGG
T7_06447_G04	GGGTTTTTGGGGTTTTGGTCGGTTGGGGTTTTTTGG
T7_06448_G04	GGTTTTGGGGTGGTTGTGTCTTGGGTTTTGGGGTTT
T7_06449_G04	TTTGGGTGGTTGGGGTTGTCTTTTGGGTTTGGTTGG
T7_06450_G04	GGGGTGGGGTTTGGGGTGTCTTTTTGGTTGGTTTTT
T7_06451_G04	TTTGGTGGTGGGGTTGTGTCTTTTGGGTTTTGGGTG
T7_06452_G04	TGTGTTTTGGGGTTGTGGTCTTTTGGGGTTTGGGTG
T7_06453_G04	GTTTTGGGTTTGGTTTTGTCTTGGGGTGGGGTGGTT
T7_06454_G04	GGTGGTTGGGTTTTTTTGTCTTTGGTGGTTGGGTGG
T7_06455_G04	TGGTTTGGGTTGTTTTGGTCGGTGGGTGGTTGGTTT
T7_06456_G04	GTGGGGTGGGTTTGTTTGTCTTTTGGTTGGGTTGGT
T7_06457_G04	TGGGTGGGTTGGTGTGGGTCTGTTTTGTTGGTTTGT
T7_06458_G04	GGGTTGTGGGTTTTGTTGTCTTTGGGTGGGGTGTTT
T7_06459_G04	TTGTTGGTTTTTGGGTTGTCTGTTGGTGGGGTGGGT
T7_06460_G04	TGGTTTTTTGGGGTGGGGTCGTGGGGTTTTGTTGTT
T7_06461_G04	TGGGTTTGGGGTTTGGGGTCTTTGGTTTTTGGGTTG
T7_06462_G04	GGGGTGTTGGTTTGGTTGTCTTGGGGTTTTTTTGGG
T7_06463_G04	GGGTTTTGGGGTGGGGTGTCTTGGTTTTTTGGGTTT
T7_06464_G04	GTTGGGTTGTTGGTGGTGTCGGGTTTGGGTTTTTGT
T7_06465_G04	GTGGGTTTTGTGGTTTTGTCTTGGTGGTTTGGTGGG
T7_06466_G04	GGGTGGTTGGGGTTGGTGTCTTGGTTTTTTTGGTTG
T7_06467_G04	GTGGGGTGGGGTTTTTTGTCTTTTGGGGTTTGTTGG
T7_06468_G04	GGTGGGTTTGGTGGGTTGTCTGGTTGGTTTTTTTGG
T7_06469_G04	GGTGTGGTGGTTTTTTTGTCGGGGTTTTGGGGTTTG
T7_06470_G04	GGGTTGGGGTGGGGTTTGTCGGTGTTTTTTGGTTTT
T7_06471_G04	GGGGTTGGTTGGGGTGGGTCGGTTTTTTTTTTTGGT
T7_06472_G04	GTTTTGGGGTTTGGTGGGTCGGTTTGGGGTTTTTTG
T7_06473_G04	GGGTTTTTTTTTGTTGGGTCTTGTGGTGGTGGTGGG
T7_06474_G04	GGTTTGGGGTTTTGTTGGTCGGTGGGTTTTTGTGTG
T7_06475_G04	GGGTTTTTTTTTGGTTGGTCGGGTTTGGGGTTGGTG
T7_06476_G04	GGGTGGGGTTTTTTTTTGTCTGGTGTTGGGTTTGGG
T7_06477_G04	GGGGTTTTGTTGTTTTTGTCTTGGGGTGGGGTTTGG
T7_06478_G04	GGGTTTGGTGGGGTTTGGTCGGGTTTGTTTTGGTTT
T7_06479_G04	GTTTTGGTGGGGTGGTTGTCTTGGGTTTTTGGGGTT
T7_06480_G04	GTTGGGTTTTTGGGTTTGTCGGTTGGGTGTTTGGTG
T7_06481_G04	TGGGTGGGTTGGGGTTGGTCGGTTTTTTTTTGTTGG
T7_06482_G04	GGTTTTGGGGTGGTTGTGTCTGGGTGTTTGGTTTTG
T7_06483_G04	GGGGTTTGGGTGTGTGTGTCTGTGTTTTTTTGGGGT
T7_06484_G04	GGGTGGGTGGGGTTTTTGTCTGGGTTGGGTTTTTTT
T7_06485_G04	GGTTTTGGGGTTGGTTTGTCTGGTGGGTTTTGGGTT
T7_06486_G04	GGTTGGTTTTGGTTGTTGTCTTTTGGGGTGGGTGGT
T7_06487_G04	GTTTTTTTTGGGGTGGGGTCGTTTTTTGGGTGGGTG
T7_06488_G04	GGGGTTTTGTTTTGGTTGTCGGGTTGGGGTTTTTGG
T7_06489_G04	GTGGGGTTGGTGTTTGTGTCTTTTTTTTGGGGTGGG
T7_06490_G04	GGGGTTTGGTTTTTTTGGTCGGGTGTTTTTGGTGGG
T7_06491_G04	TTGGGGTGGGGTTTTGGGTCGTGTGGGTTTTTTTTG
T7_06492_G04	TGGGTTTGGGTTGTGGGGTCTTGGTTGGTTTTTGGT
T7_06493_G04	GGTTTTTTGGGTTGTTGGTCGGGTTTTTGGTGGGGT
T7_06494_G04	TGGTGGGGTTTTTTGGGGTCGTTTGTTTGGTTTGGG
T7_06495_G04	TTTGGGTGGGGTTTTTGGTCTTTGTGGGTTGGGGTT
T7_06496_G04	TTGTTTTGGGTTTTGGTGTCGGGGTGGGGTTTTGGT
T7_06497_G04	TTGGGTTTTGGTGTTGTGTCTGTGGGGTTTTGGGGT
T7_06498_G04	TTGGTTTGGGGTTTTTGGTCGTGGTTTGGGGTTTGG
T7_06499_G04	GGTGGGTTTTGTTTGGGGTCGTGTTGGGGTGTTTTT
T7_06500_G04	TTGGGTGGGGTTTTTGGGTCGGTTGTTTTTTGGGGT
T7_06501_G04	GGGTTTGGGTTTTGGTGGTCGGTTGGGGTTTTTTTG
T7_06502_G04	TTTTGGTTGTTGGGGTGGTCTGGTTTGGGTTGGGTT
T7_06503_G04	GGGTTGGGGTGTGTTTTGTCTTTTGGGTGTTTGGTG
T7_06504_G04	TGGGGTTGGTTGGTGGGGTCGTTTTGTGTGGTTTTT
T7_06505_G04	GGGGTTGGTTTTTTTGTGTCTGGTGGGTTGGTGTTG
T7_06506_G04	TGTTTGTTTTTTGGGGTGTCTTGGGGTGGGTGGTTG
T7_06507_G04	GGGGTGTTTGTGTTTTTGTCGGTTGGGTGGTTTTGG
T7_06508_G04	GTGTGGGTGGTTTGGTTGTCTGGTGTGGTGTGTTTT
T7_06509_G04	GGGTTTTTGGGGTTGGTGTCTTTTGGGTTTGGGGTT
T7_06510_G04	TTTTTTTTGGGTGTGGGGTCTGGTTGTTGTGGTGGG
T7_06511_G04	TGGTTTTTTTTTTGGGTGTCGGGGTTTGGGGTTGGG
T7_06512_G04	GGGTTTTGGGTGGGGTTGTCGGGTTTTGGTTTTTTG
T7_06513_G04	GTTGGTGTTTGGGTTGGGTCTTTTGGTGGTGTTTGG
T7_06514_G04	TTTGGTGGGTGGGTTTGGTCGGTGTGGTTTTTTTGG
T7_06515_G04	TTGTGGTGTTGGGTGTGGTCGGGTTTTTTGTTTGGG
T7_06516_G04	TGGGGTGGTTGGTGGGTGTCGTTGTTTTTGTGGTTT
T7_06517_G04	TTTTTGGGTTGGTTTTGGTCGGTTGGGTGGGTTGGT
T7_06518_G04	GGGGTTTTTGGGGTTTGGTCTGGGGTTTTTTGTGGT
T7_06519_G04	GTTTTGGGTTGGGTGTTGTCTTTTGGGGTGTGTTGG
T7_06520_G04	GGTGTGGTTTGGTTTGGGTCTGGGGTGGTTTTTTTG
T7_06521_G04	GGGTTTGGGGTTGGTGTGTCGGGTTGGGTTTTTTTT
T7_06522_G04	GTTGTTGGTGTGGGTTTGTCTTTTGTGTTGGGGTGG
T7_06523_G04	TGGGTTGGGGTTTTTGGGTCGGTTTGTGGGTTTTTG
T7_06524_G04	GGGTTTGGTTGGTTTTTGTCTGGGTTGGTTTGGTGG
T7_06525_G04	GTTTTGGGGTTTGGGTGGTCTGGTTTTTGGTTGGGT
T7_06526_G04	TTTTGGGGTTTGGGGTTGTCGGGGTTTTGTTTTGGG
T7_06527_G04	GGTTTTTTGGGGTTGGGGTCGTTTGGGTTTTTGGGT
T7_06528_G04	TGGGTGGGGTTGGGTTGGTCTTTTGTTTTGGGTTTG
T7_06529_G04	TTGGGTTTTGGGGTTTGGTCGGTTGGGTTTGTGTTG
T7_06530_G04	GGGGTGTTGTTTGGGTGGTCGTTGGTTTGGGTTTTT
T7_06531_G04	GTGGTGGTGGTTGGTTTGTCTGGGTTTTGGTTGTTG
T7_06532_G04	TGGTTGGTTGGGGTTGGGTCTGGTTGGGTTTTGTTT
T7_06533_G04	GGGTTGTGGGTTGGGGTGTCGTTTTTTGTTTGTTGG
T7_06534_G04	GGGGTTTTGTGTTTTGGGTCTTTTGGTGGTTGGGGT
T7_06535_G04	TTTTGGGTTTTTGGTTGGTCGGGTGGTTGGGTGGTT
T7_06536_G04	GTGTTTGGGTTTTTTTTGTCGGTTGGGGTGGGGTTG
T7_06537_G04	TTTGGGGTGTTGGTTTTGTCGGGGTTGGTTTTTGGG
T7_06538_G04	GGGGTGGGGTGTTTGGGGTCTTTTTTTGGGGTTTTT
T7_06539_G04	GGTTGGGGTTTTTGGGTGTCGGGTTTTTGTTGGGTT
T7_06540_G04	GGTGTTTTTTGGGGTTTGTCTGGGGTTGGGGTTTGT
T7_06541_G04	TTTTGGGGTGGTTTTTGGTCGGGTTTGGGTTTGGGT
T7_06542_G04	GTGGTGGGGTTGGGGTTGTCTTGTGGTTTTTTGGTT
T7_06543_G04	GTGTTTGGGTGGGGTTTGTCTGTTTTGGGTTGTTGG
T7_06544_G04	GGGGTTTGGTTTTGTTGGTCTGGGGTTTTTTGGGGT
T7_06545_G04	GGGTGGGGTTTTTTTGGGTCGGTTTTTTTGGTTGGG
T7_06546_G04	TTTTTTGGTGTGGTTGGGTCGGTTTGTGGGTTGGTG
T7_06547_G04	TTTGGTTGGTGTTGTTGGTCGTTGGGTTTTGGGTGG
T7_06548_G04	TTGGTGGGTTGTTTTTTGTCGTGGGGTTTGGGTGGT
T7_06549_G04	GGGGTTTGGGTGGTTTGGTCGGGTTTTGGTTTTTGT
T7_06550_G04	GGGGTTGGGTGGGTTTTGTCTGGTTTGGGTGTTTTT
T7_06551_G04	TGTTTGGGGTTTTTGGGGTCTGGGGTTTTTGGGTGT
T7_06552_G04	GGGGTGTTGTTTTTGTTGTCTGTGGGGTTGTTGGTG
T7_06553_G04	GGGTTTTTGGTGGTTGTGTCTTTTGGTGGGTTTGGG
T7_06554_G04	GGTTTTGGGGTTGGGGTGTCGGGTTTGGTTTTGTTT
T7_06555_G04	TGGTGGTTTTTTTTTGGGTCGGTGGGGTGGGTTTTG
T7_06556_G04	TGGGTTGTGTGGTTGGTGTCTTGTTGTTTTGGGGTG
T7_06557_G04	GGGGTTTGGTTTTTTGGGTCGTGGTTTGGTTGGGTT
T7_06558_G04	GGTTTGGGGTGGGTTTGGTCGGTTTTTTTTTGTGGG
T7_06559_G04	GGGTTGTTGGGGTTGTTGTCGGTGGGGTTGTTTTTT
T7_06560_G04	GGGGTTGTGGGTTTTGGGTCTGGTTTTGGGTTTGTT
T7_06561_G04	GGGGTTTTTTTTTTTTGGTCTGGGGTGGGGTTTGGG
T7_06562_G04	TGGTTGGTTTGGTGGTTGTCTGGGTGTTTTGGGGTT
T7_06563_G04	GTTTGGGTGGTGGTGTTGTCTTTTTTGGGGTGGTGT
T7_06564_G04	GGGTTTGTGGTTTTGGGGTCTGGTTGTTGGTTGGTT
T7_06565_G04	GGGTTTTGGGGTTTTTTGTCTTGGGTGGGTGGTGTT
T7_06566_G04	GTTTTTTTGGGGTGGGTGTCTGGGTTTTTGGTGGTG
T7_06567_G04	GTTTTGGGTTTGGTGGTGTCTGGGTTTTTGGTGGTG
T7_06568_G04	GGTTTGGTTGGTTTGGGGTCGTTGGTTTTTGGGGTT
T7_06569_G04	TTTTGTGGTTTTGGGTGGTCGGTGGTTTTGGGGTGT
T7_06570_G04	TTGGGGTGTTTGGGTTTGTCGGGGTTTGGGGTTTTT
T7_06571_G04	GTGGGGTTTTTGGTTGGGTCGGTGGTTTGTGTTTTG
T7_06572_G04	TTGTTGGGGTTTTTGGGGTCGTTTTGGTTGGGGTGT
T7_06573_G04	GGTGGGGTTGGGTGTGGGTCGTTTTTTTTTGGGTTT
T7_06574_G04	TTTGGGTGGGTTTTTGGGTCTTGGGTGGGTGTTTTG
T7_06575_G04	GGGGTTTGGGGTTTGGGGTCGTTTGGTTTTGGTTTT
T7_06576_G04	TGGTGTGGGTTTTTTGGGTCTTGGGGTTTTTGGGGT
T7_06577_G04	GGGTGGTTTGTTTTTGTGTCGGGTTGGTGTTGGGTT
T7_06578_G04	GGGGTTTTTTTTGGGTTGTCTTTTTGGGGTGGTGGG
T7_06579_G04	GGGTTGGGTTTTTTTTTGTCTGGTGGGGTTGGGGTT
T7_06580_G04	GGGTTTGGGTTTTTTTTGTCGGGGTTGGGTTTTGGG
T7_06581_G04	GGTTTTTTTGTGGGGTTGTCTTTGGGGTTGGTTGGG
T7_06582_G04	GGGGTTGTTGTTTGTTTGTCGGGTTGTGGTTGGGTT
T7_06583_G04	GGGGTGGTGGGTTTTGGGTCGTTGTTTTGGTTTTTG
T7_06584_G04	GGGGTGGTTTTGGGGTTGTCTTTTTTGGTTGGGGTT
T7_06585_G04	GTGTGGGTTTGGGTTTTGTCGTGGTGGTTGTTGTTG
T7_06586_G04	GTTTTTTTGGGGTGTTTGTCTGGGTGGGGTGGTTTG
T7_06587_G04	TGTTGGGTGGTTTTTTTGTCGGGTTGGGTTGGTTGG
T7_06588_G04	GGGTTTGGGGTGGGGTGGTCGGGTTTTTTTTTTTGT
T7_06589_G04	TTTTGGGTGGTTTTGGGGTCGTTTGGGGTGGTTTTG
T7_06590_G04	GTTTGGGGTTTGGGTTTGTCGGGTTTTTGGTGGGTT
T7_06591_G04	TTTGGGTTTGGTTTGTGGTCGGGTTTGGGTTTGGTG
T7_06592_G04	GGTTGGGTGTTTTGGTTGTCTTTGGGGTTGGGGTTT
T7_06593_G04	GTTGTTGGGGTGGGGTTGTCTTTTTGTGTTTGGGTG
T7_06594_G04	GTTGTGGTTGGGGTGGTGTCTTTTTTTTGGGGTTGG
T7_06595_G04	TTGGTTGGGGTTTTTGGGTCGTTTTGGGTTGGGGTT
T7_06596_G04	TTGGGTGGGTTTTTTTTGTCGGTTTGTTGGGGTGGG
T7_06597_G04	TGGTGGGTTGTTTTGGGGTCGTTGGGGTTTTTTTGG
T7_06598_G04	GGGGTGTTTGGGGTTTGGTCGTTTTTTTGTGGGGTT
T7_06599_G04	TTTTTGGTTGGGGTTGTGTCTGGGTTGGTTGGGGTT
T7_06600_G04	GGGGTGGTTGGGTTTGTGTCGTGGTTTTTGGGTTTT
T7_06601_G04	TTTTTTGGGGTGGGTTTGTCTGGGGTTGGTGTTGGT
T7_06602_G04	TTGTGGTGGGTTTTTTGGTCGGGTGGGTTTTGGTTG
T7_06603_G04	TGGGGTTTGGTTTTTTGGTCGGGTGTTTTGGGGTTG
T7_06604_G04	TGTTGGGTGGTGGGGTTGTCTGTTTTTGGGGTTTTG
T7_06605_G04	GGGTTTGGTTTTTGGTTGTCGTTTGTGGTGTGGGGT
T7_06606_G04	TTGGTTTGGTGGGGTGGGTCTTTTTTTGGGGTTTGG
T7_06607_G04	GGGTTGTGGGTGTTTTTGTCTTGGGTGGGTTTTTGG
T7_06608_G04	TTTGGTTGGGTTTTGGGGTCGTGGTTTGTTTGGGGT
T7_06609_G04	TGTTGGGGTGTTGTTTTGTCGGGGTTTTGGTTTGGG
T7_06610_G04	GGGGTGGTGGTTTTTTTGTCGGTTTGTTGGTGGGTT
T7_06611_G04	TTTTTGGGGTGTGGTTTGTCTTGGTTTGGGTGGTGG
T7_06612_G04	GTGGGTGTTTTGGGTGGGTCGTTTTTTGTTTGGTGG
T7_06613_G04	TTGGGGTGTTTGTGTTGGTCTGGTGGTTTGGTTTGG
T7_06614_G04	TGTTTGTTTGGGTTGGGGTCTTTGGTTGGTGGGTTG
T7_06615_G04	TGGGTTGGTTGGTTTTTGTCTTTTGGGTGGTGGGGT
T7_06616_G04	GGGGTGGTGGTGGGTTTGTCTTTTTGGGGTTTTTGT
T7_06617_G04	TTTTGGGTTGGGGTTGGGTCGGTGGGTGTTTTTTTG
T7_06618_G04	GGTGTTGGGGTTTTTTTGTCTTGTGTTTGGGGTGGG
T7_06619_G04	GGGTTTGTTTTTTTGGGGTCGTGGGTGGTTTTTGGG
T7_06620_G04	TTGTGGGTTGTTGTGGGGTCTTTTTGGGTTGGTTGG
T7_06621_G04	TGTGGGTTTTTGGGGTGGTCTTTTGGTTGTGGGTTG
T7_06622_G04	GTTTTTTGGGTGGTGTGGTCGGGTTGGGTTGTTTTG
T7_06623_G04	TTGTTGGGTTTGTTTGGGTCGGTTTGGGGTGGGTTT
T7_06624_G04	GGTTTTGTGGGGTTTTTGTCTGGGTGTTGGTTTGGG
T7_06625_G04	TGGTTGGGTTTTTTTTTGTCGGGTTTGGGGTGGGGT
T7_06626_G04	TGGTTGGGTTGTGGGGTGTCTTGGTTGGTTTGGTTT
T7_06627_G04	GGGTGGTGTTTGGGTTGGTCGTTTTGTTGGGTGTTT
T7_06628_G04	GTTTGGTGTTGGGGTGTGTCTGGGTTTTGGGGTTTT
T7_06629_G04	GGGTGGGGTTTTTTTTGGTCTGTTGGGTTTGGGGTT
T7_06630_G04	GGTTGTTGGGGTTTTTGGTCGTGGGGTTTTTTTGGG
T7_06631_G04	GGTTTGGGTTGGGTTGGGTCTTTTGGGTTTGGTTTG
T7_06632_G04	GGTTTGGGTTGTGGGGTGTCTTTTTTGGGGTTTGGT
T7_06633_G04	GGGTGGTGTTTTTTTGGGTCGTGTTGGGGTTTTTGG
T7_06634_G04	GTTTGGGGTTTGGGTGTGTCTGGGTTTGGGGTTTTT
T7_06635_G04	GTGTTTGGGGTGGGGTTGTCGGTTTTTGGTTGTTTG
T7_06636_G04	GTTGTTTTTTGGTTGGGGTCGTTTGGTTGGGTGGGT
T7_06637_G04	GGGTTGGTTTGGTTTTGGTCGGTTTTGTGGTTGGGT
T7_06638_G04	TTGTTTTTGGTTGGGTGGTCGGGTGTTGGGTTTTGG
T7_06639_G04	TTTTTGTTTGGGGTGGTGTCTGGGTGGGTTTGGGTT
T7_06640_G04	TGGTGGGGTGGGGTTGGGTCGTTTTTTGGGTTTTTT
T7_06641_G04	GGGGTTGGTTGGTTTTTGTCTGTTGGGTGGGTTTTG
T7_06642_G04	GGGGTTTGGGTTGGTTGGTCTTTTTGGGGTTTTTGG
T7_06643_G04	GGGTTTTTTGTTTTGGGGTCGTTTGGGGTTTGGGGT
T7_06644_G04	TGTTTTTGGGGTTGGGTGTCGGTTGTTGGTTTTGGG
T7_06645_G04	TGGGGTGGGGTGGGGTTGTCTTTTTTTTTTGGGTTG
T7_06646_G04	TTTGGGTTGTGTGGGTGGTCGGGTTTTGTGTTTTGG
T7_06647_G04	TGTGTTGTTGGGTTGGGGTCGTGGGTTTTTGGTTGT
T7_06648_G04	GGGTTGTGTGTTGGTTTGTCTTGGGGTTGTTGGGTT
T7_06649_G04	TTGTTTTTTGGGGTTTGGTCGGGTTTGTTGGGTGGG
T7_06650_G04	TTGTGGGGTTGGGGTTTGTCTTTGGTTTGGGTTGGT
T7_06651_G04	TTTGGGGTTGGTTGGTTGTCTTGGGTTGGTGGGTTT
T7_06652_G04	GTTTGTGTGGGGTGGGTGTCGGGGTTTTTTTTTTGG
T7_06653_G04	GGGTTTTTTTGGTTGTTGTCTTGGGTGGGTGGGGTT
T7_06654_G04	TTGGTTGGTGGGTTTTTGTCTTTTTGGGTGGGGTGG
T7_06655_G04	GGGGTTGGTTTTTTTTGGTCGGTGGTGTTGGGGTTT
T7_06656_G04	GGGGTGGTTTGGGGTGGGTCGGTTGTTTGTTTTTTT
T7_06657_G04	TGGGGTTGGGTGGGGTTGTCTTTTGGGTTTTTTTGG
T7_06658_G04	GGGTGTTTTTTTTGGGTGTCTTGGTTGGGTGGGGTT
T7_06659_G04	GGGGTTGTTGTTTTGGGGTCTGTTTGGGTTTTTGGG
T7_06660_G04	TGTTGTTTGTGGGTGGGGTCGTGTTTTGGTTGGGTT
T7_06661_G04	GGGTTTTTTTTTTGGTGGTCTGTTGTGGTGGGTGGG
T7_06662_G04	TTGTTGGGTTTGGGTTTGTCTGGGGTGGGGTTTTTG
T7_06663_G04	TTGGGTGGTGTGGTTTTGTCGTTGGTTTGTGTTGGG
T7_06664_G04	TGGGGTTGGGTTGTGGTGTCGGGTTTTTTTTGGTTG
T7_06665_G04	GTGGTTGGGTGGGTTGGGTCTTTTTGGTTTTTTGGG
T7_06666_G04	TGGGGTTTTGGGTGGGTGTCTGGGTTGGTTTTTTTG
T7_06667_G04	GGTTGGTTTTGGGGTTTGTCTGGTTTGGGTTTGTGG
T7_06668_G04	GGGTTTTGGGGTTTTTTGTCTTTGGTTTGGGGTGGG
T7_06669_G04	TTGGGTGGGTTTGTTGGGTCTTTTGGGGTTTTGTGG
T7_06670_G04	GGGGTGTTTGTGGGTTGGTCGTTTTTGGGTTTTTGG
T7_06671_G04	GGGTGGGTGGTTGGTTTGTCTTTTGTTTGGTGGTTG
T7_06672_G04	TGGGGTTTTTGGGGTGGGTCGTGGTTGTTGTTTTTG
T7_06673_G04	TTGGGTGGGTTTGGGGTGTCTGGTTTGGTTTTTTGG
T7_06674_G04	TTTGGGTTTTGGGTTGGGTCGTGTTTTTTGGGGTGG
T7_06675_G04	GGTTTGTGTTGGGTTTTGTCTTTTGTGTGGGGTGGG
T7_06676_G04	GTTTTTGGTGTTTGTGGGTCGGTGGGGTTTGTTTGG
T7_06677_G04	TTGTGGGGTGGTTTTGTGTCTGGGTTTGGGGTTTGT
T7_06678_G04	TTGGTGGTTGTTTGTGGGTCTTGGGTTGTTGGGGTT
T7_06679_G04	TTTGTGGTGGTTTTTGGGTCGTTGGGTGGGTTTTGG
T7_06680_G04	TTTTTTGGGTTTTTTGTGTCGGGTGGTGGGGTTGGG
T7_06681_G04	GGTGGGGTTGGGGTTTGGTCGTTTTTTGGGTTTGTT
T7_06682_G04	TGGTGTTGGGGTTTGTGGTCGTTTGTTTGTTGGGGT
T7_06683_G04	GGGTTTGGGTTTTTGTTGTCGGTTGTGGGGTTTGTG
T7_06684_G04	TGGTGGGGTTTTTTTTTGTCTTGGGGTGGTGGGTTG
T7_06685_G04	GTTTTGGGGTTTTTTGGGTCGTGGGGTGTTTGGGTT
T7_06686_G04	GGGTTTTTGTTTGGGGTGTCGTTTGGTTGGGTTTGG
T7_06687_G04	GGGGTTTTGGGTTTTTGGTCGGGTTTTGGGGTTGTT
T7_06688_G04	GGTTTGGGGTGTTTTTGGTCGTGTGGGGTTGGTTTT
T7_06689_G04	TGGTTTTTTTGGGGTTTGTCTGGGTTGGTTGGTGGG
T7_06690_G04	GGGTTTTTGGGTGGTTGGTCGTTTGGGGTTTTTTGG
T7_06691_G04	TGGTTGGTTTTTGGTGGGTCGTTGGGGTGTGGTTTT
T7_06692_G04	TGTTGTTGGGTGGTTTTGTCTTGGGGTGTGGTGGTT
T7_06693_G04	TTGTTTTTTGGTTGGGTGTCGGTTGGTGGGGTGTGT
T7_06694_G04	GGTGGTTGGTTTGGGGTGTCTTTTGTTGTTGGGGTT
T7_06695_G04	GGTGGTTTTTTGGGGTTGTCGTTGGGGTTTGTTTGG
T7_06696_G04	GTTGGGGTTTTTTGGGTGTCTTGTTGGGTTGGGGTT
T7_06697_G04	TTTGGGTTGTTGTGGTTGTCGGGGTGTGGGGTTTTT
T7_06698_G04	GGTTTTGGGGTTGTTGTGTCTTGTGGTGGGGTTGTT
T7_06699_G04	GGTTTGGTGGGGTTTTGGTCGTTGGTGGTTTTTTGG
T7_06700_G04	GGGGTTGGTGGGTTTTTGTCTTGGTGGGGTTTTGTT
T7_06701_G04	GTTTTGGGTGGTGGGTTGTCTGGTTTTTTGGGGTTG
T7_06702_G04	GGGGTTGTTTGGGGTTTGTCGTGGTTGTTTTTGGGT
T7_06703_G04	GTTGGGGTTGGTTGTTTGTCTGGGTGGGGTGTTTTT
T7_06704_G04	GGGTTGTGGGTTTTTGTGTCTTTGGGGTTGTTTGGG
T7_06705_G04	GGGGTGGGGTTTTTTTTGTCGTTTGGTGTTTGGGGT
T7_06706_G04	GGGTTTGTTGGTTTTTTGTCGGGTGGTTTTGGTGGG
T7_06707_G04	GTGGGGTTTGGGTTTGGGTCGTTTTGTTTGGGTGTT
T7_06708_G04	TTTTTGGGGTTTGGGTTGTCTTGGGGTTTGGGGTTG
T7_06709_G04	TGGGGTGGGTGGTTTTTGTCGGGTTGGTTTGGTTTT
T7_06710_G04	GGGGTTTTTTGGGGTTGGTCGTTTGGTTGTTTGGGT
T7_06711_G04	GTTTTGGTTTTGGGTGGGTCTTGGTTGTTGGGGTTG
T7_06712_G04	GGTTTGGGGTTGGGTGTGTCTTGGGTTTGGTTTGTT
T7_06713_G04	GGGGTTTTTTGGGTTGGGTCGTTTTGGGTTTTGGTG
T7_06714_G04	TTTTGTGGGTTTTTTTTGTCGGGTTGGGGTGGGGTG
T7_06715_G04	GGGGTTTTTTTTGGTGTGTCTGGGGTTGGTTTGTGG
T7_06716_G04	TTGGGTTGGGGTTTTGTGTCGGGTTGGGTTTTTTGG
T7_06717_G04	TGGGGTTTGGGTTTTGGGTCGGTGGGGTTGTTTTTT
T7_06718_G04	TTGTTTTGGTGGGTTTGGTCGGTGTGGGTTTTTGGG
T7_06719_G04	GGTTTTTTTTGGGTTTGGTCGGGTGGGTGGGGTTTT
T7_06720_G04	GGGTTTTTTTGGGTGTTGTCTTGGTGGTTGGTTGGG
T7_06721_G04	TTGTTTTGTGGGGTGGTGTCGGGTGGTTTTGGGTTT
T7_06722_G04	GTGGTGGGTGTTTGGTGGTCTGTGGTTTTTTGGTTG
T7_06723_G04	GGGTTTGGTGGGTTTGTGTCTTTGGGTGTTTTTGGG
T7_06724_G04	GTGTTGTTGTGGGTGGGGTCGTTTGTGGGGTTTTTT
T7_06725_G04	GGTTTTTTGTTTTGGGTGTCTTGGGGTGGGGTTTGG
T7_06726_G04	GGGTTTTTTTTTGTGGGGTCGTTTGTGGTTGGGTGG
T7_06727_G04	GTTGGGGTTTTTTTTTGGTCGGGTTGGGGTTGTGGT
T7_06728_G04	TGGGGTTTTTGGTTTTGGTCTTGTGTGGGGTTTGGG
T7_06729_G04	GGGGTTTTTTGGGGTGGGTCTTTTTTGGTGTGGGTT
T7_06730_G04	TTTGGGGTTGGGGTTTTGTCGTTGGTGTTGTGGTTG
T7_06731_G04	GGTGGGTTTTTTGGGTTGTCGTTTGGGGTTTGTTGG
T7_06732_G04	GGGGTTGGGGTGTTTTTGTCTTTTTTTGGGGTTGGG
T7_06733_G04	TTGGGTTTGGGTGTTTTGTCTGGGTGTTGTGGGGTT
T7_06734_G04	GGGGTTTGTTGTGGGGTGTCTTGTGGGTTTGTTTTG
T7_06735_G04	GGTTGGGTGGTTTGGTTGTCTTTGGGTTTTTGTGGG
T7_06736_G04	TTTGGGGTTGGGTTTTTGTCTTGGGGTGGGTTGTTG
T7_06737_G04	TGGGTTTTTGGGTTGGGGTCTTTTGTTTGTGGGTGG
T7_06738_G04	TTTTGGGTGGGGTTGGGGTCGTTTGTGTTTTTTGGG
T7_06739_G04	TGGGGTTTGTTGGGTGGGTCGTTTTTTGTTGGGTTG
T7_06740_G04	TGGGGTGTTTGGTTGGGGTCTGGTTTGGTTTGGTTT
T7_06741_G04	GGGTTGGTTTTTGGTGGGTCGTTTTTGGGGTTGGTT
T7_06742_G04	GGTTTTTTGGGTGGTTGGTCGGTTTTGGTGGGGTTT
T7_06743_G04	GTTGGTTTGGGGTTTGGGTCGTTTTTGTTTGGGTGG
T7_06744_G04	TTTTGTTGTTGTTGGGTGTCTGGGGTGGTTTGGGTG
T7_06745_G04	TGGGTTTTTGTTTTGGGGTCGTGGGGTTGTGGGTTT
T7_06746_G04	GGGGTGGGGTTTGTTTTGTCTTGGGTGGGGTTTTTT
T7_06747_G04	TTTGGGGTTGGGTTGGGGTCTTTTTTTGTGTGGTGG
T7_06748_G04	TGGGGTTGGTTTGGGTGGTCGTGGGGTTGTTTTTTT
T7_06749_G04	TGTTGTGGTTTGGGTTTGTCTGGGGTTGGGGTTGTT
T7_06750_G04	TTTTTTTTTGGGGTTGGGTCGGTGTTGTGGGTTGGG
T7_06751_G04	GTTTTTGGTTGGTTGGGGTCGTTTTTTGGGGTTGGG
T7_06752_G04	GTTGTGGGGTGGTTTTTGTCGGGGTGGTTTGGTTTT
T7_06753_G04	GGGGTGTGTTTTGGTTGGTCGTTTTGGTTTTGGGGT
T7_06754_G04	TTGGTGGTGGTGGGTTTGTCGGGTTTGGGGTTTTTT
T7_06755_G04	GGTTTGGGGTTTTGGTTGTCTTTGGGTGGTTGGTTG
T7_06756_G04	TGGGGTGGGTGGTTTGTGTCTTTGGGTTTTTTTGGG
T7_06757_G04	GGTTTTGGTTTGGGTTGGTCGTTGGTTTGTTGGTGG
T7_06758_G04	TTTGTTTGTGTGGTGGGGTCGTGTGGGTGGTTGTTT
T7_06759_G04	GTGGGTTTTTTGGTTTTGTCGTGGGTGGGGTTTTGG
T7_06760_G04	GTTGGGGTTTGGGGTTGGTCTTTTTTTTTGGGTGGG
T7_06761_G04	GTTTGGTGGGTTGTGGGGTCTTTTTGTTTTGGTGGG
T7_06762_G04	GTGGGGTTTGGTTTTGGGTCTTGGGTGGTTTTGGTT
T7_06763_G04	TGGGGTTTTGGTGTTTTGTCGGTGGGGTTTTTTGGG
T7_06764_G04	GGTGTTGGGTTTTTTGGGTCTGGGTTTTTTGGGGTG
T7_06765_G04	TTGGGGTTTTTGGGGTGGTCGGGTTTTTTGGGGTTT
T7_06766_G04	GTTGGGTGGGTTTGGGTGTCTTTGGGTGGTTTTTGT
T7_06767_G04	TTTTTTTGGTGTGGTGGGTCTTTGTGGGGTGGTTGG
T7_06768_G04	GGGTTTGGGTGGTTGTTGTCTTTGGGTTTTTGGGGT
T7_06769_G04	GTGGTTTTTGGGTTGTGGTCGGGTGTTTTGGTTTGG
T7_06770_G04	GGGTTGGGGTTTTTTTTGTCTGGGGTTTGGTTTGGG
T7_06771_G04	GGGTTTGGGTTTTGTTTGTCTGGGGTTGGTTTTGGG
T7_06772_G04	GGGGTTTTTTGGTGTTGGTCGGGTTTGGTTTGGGTT
T7_06773_G04	TGGGGTTTGGTTTTTTGGTCGGTGGTTGGGTTTTGG
T7_06774_G04	GGTGGGTTTGGGGTTTTGTCTGGTTTGGTTTTTGGG
T7_06775_G04	GTTTTTGGGGTGTTTTGGTCGGGTGGTTGGTTTTGG
T7_06776_G04	TGTGGGGTTGGGGTTTTGTCTTTTTTGGTGGGTTGG
T7_06777_G04	TGTTTGTTTTTTGGGTTGTCGTTGGGTGGGTGGGGT
T7_06778_G04	TTTTGGGGTTGGGTTTTGTCTGGTTGGGTGTGGTTG
T7_06779_G04	TGGGGTGTTTTTGGGGTGTCGGGTTTTTTGGGGTTT
T7_06780_G04	TTTTTTTTTGGGTGGTGGTCGTGGGGTTTTGGGTGG
T7_06781_G04	TGGGTTGTTGGGGTTTGGTCTTGGTGGGTGGTTTTT
T7_06782_G04	TTTTTGTTGGTGGTTGGGTCGTGGGTTGGTTTGGGT
T7_06783_G04	GGTTGTGTTTTGGGTTGGTCTTGTGGTGGGGTTGTT
T7_06784_G04	GGGGTGGGTTTTTTTTGGTCGTGGGTGTTTTGGGTT
T7_06785_G04	TGGTTGGGTGTGGGTTGGTCGGGTGTTGTTTTTGTT
T7_06786_G04	TTTGGGTGTTTGTTGGGGTCGTTTTTGGGGTGGTGT
T7_06787_G04	TGGTTTGGTGGGGTTTGGTCTTTTGGTGGGGTGTTT
T7_06788_G04	TTTTGGGGTTGTTTGTGGTCGTTGGTTGGGTGGGTT
T7_06789_G04	TTGGTTGGGTTGGGTGGGTCTTTGGGGTTTTTTTGG
T7_06790_G04	GGTGGGTGTTTTTTGTGGTCGTTTGTGGGTTTGGGT
T7_06791_G04	GGTTTGGTGGTGGGTTGGTCGGGTGGTTTTGTTTTT
T7_06792_G04	GTGGGTGGGTGGGTTTTGTCGTTTTTGTGTGGGTTT
T7_06793_G04	TTTTTGGGTTTTTTGGGGTCGTGTTGGGGTTGGGTG
T7_06794_G04	TGGGTTTGTTGGTTGGGGTCGTGGGTTTTTTTTGGG
T7_06795_G04	TGGGGTGTGGGGTGGTTGTCGTTTTGGGGTTTTTTT
T7_06796_G04	TTTTTGGTTGGGTTTGGGTCTTTGGGTTGGTGGTGG
T7_06797_G04	GGGGTTTTTTGGTGTTTGTCGTGGTTTTTGGGGTGG
T7_06798_G04	GGGTTTTTGGGTTTTTGGTCGTTTGGTGGTGGGTTG
T7_06799_G04	GGGTTGGGTTTTTTTTTGTCGGGGTTGTTGTGGGTG
T7_06800_G04	TGGGTTGGGTTGGGTGTGTCTTTTTGGGTTTGTTGG
T7_06801_G04	GGGTTTTTGGTGTTTGGGTCGGTTTTTTGGTGGGGT
T7_06802_G04	TGGGTGTGTGTTTTTTGGTCGGGTGGGTTTGGGTTT
T7_06803_G04	GGGGTTTTTGGGTTTGGGTCGTGGTTTTTTGGGGTT
T7_06804_G04	GGGTGGGGTTGTTTGGTGTCTTTTTGGTGGGGTTTT
T7_06805_G04	GGTGTTTTGTTGGTGGTGTCGGGGTTGTTTTGTGTG
T7_06806_G04	TGGTGGTGGTTTTTGGGGTCGTTGGGTTGTTTTTGG
T7_06807_G04	TGGGGTGTTTGGGTTGGGTCGGTTTGGGTTTTTTGT
T7_06808_G04	GTTGGGGTTTTGGTGGGGTCTGTTGGGTTTTTTTGG
T7_06809_G04	GGTTGTGGGGTGTTGTTGTCTTTGTGTTGGGTTTGG
T7_06810_G04	TGTTTTGTTTTGTTGTGGTCGTTGGTGGGTGGTGGG
T7_06811_G04	GGGTGGTTTTTGGGTTTGTCGTTTTTGGGTGGTTGG
T7_06812_G04	TTGTTGGGGTTGTGTGGGTCTTTTTTGTTGGGTGGG
T7_06813_G04	GTTGGTTTGTTGGGGTTGTCTGTTGGTTTGGTGGTG
T7_06814_G04	GTTTTTTTGGGGTGGGTGTCTGGTGGTTGGTGTTGT
T7_06815_G04	GGTTTTTTTGGTTTTGTGTCGGGTGTGGGGTTGGGT
T7_06816_G04	GTGGGTTTGTTTGGGGTGTCTTGTGGGGTGTGTTTT
T7_06817_G04	TTTGTTGTTTTGGGTTGGTCTGGTGGGGTTGGGTGT
T7_06818_G04	TTTTTGGTGGTGGGTTTGTCGGGGTTTTTGTGGGGT
T7_06819_G04	TTTTGTGGGGTTGGGTGGTCTGGTTGGTTTGGGTTT
T7_06820_G04	TTGGGTTTTTGGTTTTTGTCGGGTGGGTTGGGGTTG
T7_06821_G04	TGGGGTTGGTGGTTTTTGTCGGGGTGTTGTTTTGGT
T7_06822_G04	TTTTTGGTGGTGTTTGGGTCTGTTGGGGTTGGTGGT
T7_06823_G04	TTGGTTTTTGGTGTGGGGTCGTTTTGTTGGGGTTGG
T7_06824_G04	TGTGGGGTTGGGGTGGGGTCTTTTTTGGTTTTTTGG
T7_06825_G04	TGGGTTGTGGTGGTTTTGTCGGGTTTTTGTTGGTGG
T7_06826_G04	GGTTTGGGTTGGGGTTTGTCGGGTGTGTTTTTTTGG
T7_06827_G04	GGTTTTTTTTGGGTGGGGTCGTTGTTGGTGTTTGGG
T7_06828_G04	GGTGGGGTGGTGTGTTTGTCTGTGGGTGTTTTGTTT
T7_06829_G04	TTGGTGGGGTTGTGGGTGTCTTTGTGGTTTGTTTGG
T7_06830_G04	TGTTGGGTTGGGTGGTGGTCTGGTTGGGTTTTTTGT
T7_06831_G04	GGGTTTTTGGGTTTGTGGTCTGGGGTTGGGGTTTTT
T7_06832_G04	GTTTTGGGGTGTGGGGTGTCGTTTTGTTGGGGTTTT
T7_06833_G04	GTTTTGGTGGGTTGTTTGTCGGGGTTTGTTGGTGGT
T7_06834_G04	TTTTGGTGGGGTTTTTTGTCGGGTTGGTGGTTGGGT
T7_06835_G04	GGTGGGGTTTGGTGGTTGTCTTTTGGTTGTTTTGGG
T7_06836_G04	GTGTTTTGGTGTTGTGTGTCTTGTGGTGGGGTTGGT
T7_06837_G04	GGTGTTGGTTGTTTTTTGTCGGGTTGGGGTGTTTGG
T7_06838_G04	GGTTTTTTGGGGTTTGGGTCGTGGGTTGGGTTTTGT
T7_06839_G04	TGGGTGTTGGTTTTGTTGTCTTTTGGGGTGGTTGGG
T7_06840_G04	TGTTTGGGTTTGGTGTTGTCTTGGTTTTGGGGTGGG
T7_06841_G04	GGTTTTTTTGGTGGGTTGTCTTGTGGGGTGGTTTGG
T7_06842_G04	TTGGGGTTGGGTTTGGGGTCTGGGGTTTTTGGTTTT
T7_06843_G04	GGGTGGGTTTTGGTTGGGTCGGTTTGGTTTTTGGTT
T7_06844_G04	GGGGTGTTGGGTTTTTTGTCTTTGGTTGGTTGTGGG
T7_06845_G04	GGGGTGGGTTGGTTTTTGTCTGTTGGTGGTGTGTTT
T7_06846_G04	GGGTTGGTTTTGGTTGGGTCTTTGGGTTTTGGTGGT
T7_06847_G04	GTGTGTTTTTTGGTTTTGTCTGGTGGTGGTGGTGGG
T7_06848_G04	TTGGGGTGGGTGTTTGGGTCGTGTTTTTTTTGGGGT
T7_06849_G04	TTGTGGTTGGGGTTTGTGTCTTTGTGGGTTTGGTGG
T7_06850_G04	GGGTTTTTGGGTTTTGGGTCGTGGGGTGGTTTTTTG
T7_06851_G04	TTGTTGGTTGGTGGTTTGTCGGTTTGGGTGGGGTTT
T7_06852_G04	TTGTTTGGTGGTTTGGGGTCTTGGGGTGGGTGTTTT
T7_06853_G04	GGGTGTTGGTTTGGTTTGTCTTTGTTTGGGGTGGTG
T7_06854_G04	GGGGTTTTTGGTGTTTGGTCTTGTGTGTTTGGGTGG
T7_06855_G04	TGGTTTGTTTGGGGTTGGTCGTTTTGGTGTTGGGGT
T7_06856_G04	TTTGGGGTTTGTTTTTTGTCGGGGTTTGGTGGGGTG
T7_06857_G04	GGTGTGGTTTTTGGTGTGTCTTTGGTGGTGTTTGGG
T7_06858_G04	GTTTTTTGGGTGGGTTTGTCTGTTGGGTGGGGTGTT
T7_06859_G04	GGGTGGTGGTGGTTTTTGTCTTGGGTTTTGTGGGTT
T7_06860_G04	GTGGGTTGTTGGGGTTTGTCGGTGGTTGTTTTGGTT
T7_06861_G04	TGGGTTGGTGTTGTGTGGTCTTGTGGGTTTGGGTTT
T7_06862_G04	TGGGGTTGGGTTTGGTTGTCGGTTGTTGTGGTTTTG
T7_06863_G04	GGGTGTTGGGTTGGTTTGTCTTGTGGGTTTTTGGGT
T7_06864_G04	GGGTTTTGGGTTTTTGTGTCGTGGTTTGGGGTGGTT
T7_06865_G04	TGTTTGTGGGTGGGGTTGTCTTTTGTTTGTGGTGGG
T7_06866_G04	GGTTGGGGTTTGTTTGTGTCTGGTGTTGGTTGGGTT
T7_06867_G04	GGGTTTGGGTTTGGGTTGTCGGTTTTTGGTTGGTGT
T7_06868_G04	GGTTGGGTGTGGGTGGTGTCTTGGTGGTTTTTTTTG
T7_06869_G04	TTGTTGGGGTTGGGTGGGTCGTTTTGGGGTTTTTTG
T7_06870_G04	TTTTGGGGTTGGTGGTGGTCGTTTTGGGTTGGGTTT
T7_06871_G04	TTTTTTGGGGTTGGGTGGTCGGGTGGGGTTTTTGTT
T7_06872_G04	GGTGTTTTGGTTTGGTTGTCGGGTTTGGGGTGGTTT
T7_06873_G04	TTGTTGGGGTGGTTTTGGTCGTTTGGTTTGGGGTGT
T7_06874_G04	GGTGGTGTTTTGTGGTTGTCTGTTGGGTGTGGTTGT
T7_06875_G04	TGTTGGGGTTGGTTGGGGTCTGGTTTTTTGGGGTTT
T7_06876_G04	GTTGGTTTGGGGTTGTTGTCTGGGTTTTTTGGGGTG
T7_06877_G04	GGTTTGGGTTGTGGGGTGTCGTTTTGTTGGGTTTTG
T7_06878_G04	TTGGGTGGTGGGGTGGTGTCTTTTTTGTGGTTTGTG
T7_06879_G04	GTTGTTGGGTTTGTTTTGTCTGGGTGGGGTGGTGTT
T7_06880_G04	TGGTTGGGTGGGTGGTTGTCTTGGGTTGGTGTTTTT
T7_06881_G04	GGGTGTGTTTGGTTTTGGTCGGGTTTTTGGTTGGTG
T7_06882_G04	TGGGGTTTTTGTTTGGTGTCTGGGTTGTGTGGGGTT
T7_06883_G04	GGGGTGGGTGGGTTTTTGTCGTGGGGTTTTTTGTTT
T7_06884_G04	TTGGGGTTTGTTGGGTTGTCGGTGGTTGGTTTTGTG
T7_06885_G04	GGTGGGTTGGTGGTGGTGTCTGTGTTGTTTTGGTTT
T7_06886_G04	TGGGTGTGGGTTGTTGGGTCGTTTTGGTTTTTGGTG
T7_06887_G04	GTGGTGGGTGGGGTTTTGTCTGTTTTTGGGTTTTGG
T7_06888_G04	TGGGGTTTTTGGTGTTGGTCGTTTGTTGGTGGGGTT
T7_06889_G04	TTGGTTGGTGGTTTTGGGTCTTGGTTTTTGGGTGGG
T7_06890_G04	GTTTTTTTTGTGGTGGTGTCGTGGGGTTGTTGTGGG
T7_06891_G04	TTGTGTGTTTGGTTTTGGTCGTTGGGTTGGGTTGGG
T7_06892_G04	GGGGTTGTTGGGGTGTTGTCTTTGGTTGGTTTGGTT
T7_06893_G04	GTGGTTTTGGGGTGTTTGTCTGGGTTTGTGTGGGTT
T7_06894_G04	TTGGTTTGGGTTTTTTGGTCTGGGTGGTTTGGGGTG
T7_06895_G04	TGGGGTTTTGTTGGTTTGTCGTGTGGTTTTGGGTGG
T7_06896_G04	GGGTGTGTGGGGTGTTTGTCTTTGTGGGTTTGGTTT
T7_06897_G04	GGTTTGTGTGGGTTTGGGTCTGTGGGGTTTTGTTTG
T7_06898_G04	TTGGGGTGGTGGGTTTTGTCTTTTTTTGGTGGGGTG
T7_06899_G04	GGGTGGGGTGTTGTTTTGTCGTTGTGTTTGGTTGTG
T7_06900_G04	TTTTGGTTGGGGTGGTTGTCTTGGGGTGTTGTTGGT
T7_06901_G04	TTTTGTTGGGGTGTGGGGTCTTTTGGGTTGGGGTTT
T7_06902_G04	TTGGGGTTGTTTGGGGTGTCTGGTTGGGTTTTGGTT
T7_06903_G04	GGTTTTTGTGGTTGTTTGTCTGTGGTGGGGTTGGGT
T7_06904_G04	GGTGGTTGTGGGGTTTTGTCTTTTGGGGTTGGGTTT
T7_06905_G04	GGTGGTTTGTTTTGGGTGTCTTTGGGTTGTTGTGGG
T7_06906_G04	GTGTTTGGGGTTGTTTTGTCGGGGTTTGTTGGGTGT
T7_06907_G04	GGGTGGTTTTTGGTGGGGTCTTGTGGTTTTTTTGGG
T7_06908_G04	TGGGTTTGGGTTTTTGGGTCGGTTTGGGTTTGTTGG
T7_06909_G04	TGGGGTGTTGTTTTGGGGTCTGGGGTTGGTTTTTTG
T7_06910_G04	TTGTTTTGGGTGTTTGGGTCTGTTTTGGGTGGGGTG
T7_06911_G04	GGTGGGTGGTTTGTTTTGTCGGTTGGGGTTTGTTTG
T7_06912_G04	GGTTTGGTTTGGGTGTGGTCGGGTTGTTTGGGTTTT
T7_06913_G04	TTTTTGGGTGGGTGGTTGTCTTGTTGGGGTGTTGGT
T7_06914_G04	TTGTTTGGGGTGGTGGGGTCGTGTTTTTGGTGTTTG
T7_06915_G04	GGGTGTTTGTTGGTTTTGTCTTTGGTGGGTGGTGGT
T7_06916_G04	GGGTGTGGTTGTGGGTTGTCTGGGTTGGTTTTTTTG
T7_06917_G04	GTGGTGTGTTTTTGGGTGTCGGGTGTGTGGTTTTTG
T7_06918_G04	TGGGTTGGTTTTTTGGGGTCTGTTGGTTGGTTTGGG
T7_06919_G04	TGGTTTTGGGTTTGGTGGTCGGGTGTTTGGGGTTTT
T7_06920_G04	TGGGGTTTTTTTTTTGTGTCGGTTGGGGTGGGTTGG
T7_06921_G04	TTTTTTTTTTTGGGGTGGTCGGGTTTGGGGTGGGGT
T7_06922_G04	TGTTTTTGGGGTTGGGTGTCTGGGGTTGTGTTTTGG
T7_06923_G04	GGGTTTTGGGTGGGTTTGTCGGTTTGTTTGGGTTGT
T7_06924_G04	TTGGTTGGGTGGTTGTTGTCTTTGGTGTGGGGTTTG
T7_06925_G04	GGGTGTTGTGGGGTTGGGTCGGTGTTTTTTGGTTTT
T7_06926_G04	TTGGGTGTTGGGGTGGGGTCTTTTGGTTTTGGTTGT
T7_06927_G04	GGGTGGGTTTTTGGTTGGTCGGTTTTTTTTGGTGGG
T7_06928_G04	TTTGTTGGGGTGTTGGGGTCGTTTTGGGTTTTGGGT
T7_06929_G04	TGGGTTTGTGGGTGGTTGTCGTGGTGTTGGGTTTTT
T7_06930_G04	GTTTTTGGGTGGTTGTTGTCGGGTTGTTGGGTGGTT
T7_06931_G04	GTGTTGTTGGTTTTTGTGTCGGGTGGTTGGGGTTTG
T7_06932_G04	GGGGTTGGGTGGTTTTTGTCTTGGTTTTTGGGTTGG
T7_06933_G04	GTTGGGGTTTGTGGTTTGTCGGGGTTTGGTTTTGGT
T7_06934_G04	GGGTTGGGGTTGGTGTGGTCTTGTTTTTTGGGGTTT
T7_06935_G04	TGGGTGTGGGTGGGGTTGTCTTTTGGTTTGTTTGGT
T7_06936_G04	GGTGGTTTTGTTTTGTGGTCTTTTGGGGTGTGGTGG
T7_06937_G04	GTGTTGGGGTGTGGTTTGTCGTTTTTGGGTGTTTGG
T7_06938_G04	GGGGTTTGTTTTTTTGGGTCGTGTTGTGGTGTGGTG
T7_06939_G04	GTTGTGGGTTGGTTGGGGTCGTTTTTTGGGTGGTTT
T7_06940_G04	GGGTTTTGTTTTTTTGGGTCGGTTGGGGTTGGTGGT
T7_06941_G04	TTGGGGTTTTGGGGTTTGTCTTTTGGTGGTGGTGGT
T7_06942_G04	GTTTTTTTTGTGGGTGGGTCGGTGGGTTTTGGGTGT
T7_06943_G04	GTGGTTTTGGTTTTTGGGTCGTTGGGGTTTGGTGGT
T7_06944_G04	TTTTTGGTTTGGGGTTTGTCTTGTGTGGTGGGTGGG
T7_06945_G04	GGTTGTGGGTTGGTTGGGTCGGTTTGTGTGGTTTTT
T7_06946_G04	GGTTGTTTTGGGTTGGGGTCGTTGGTTTTGGTTGGT
T7_06947_G04	TTGGGGTTTTGGGTGTTGTCTTGTGTTGGTTGGTGG
T7_06948_G04	TGTTTGGGGTGGGTGGTGTCGGTTTTTGGGTGTTTT
T7_06949_G04	TGGGTGGTTTTGTTTGGGTCGGTGGTTTTTTGGGTG
T7_06950_G04	TTTTGGGGTGGTTTGTTGTCGGGGTTTGGTGGGTTT
T7_06951_G04	GTGTGTGGTGGTTTTTTGTCGGGTTTGTTGGGTGTG
T7_06952_G04	TTTGGTTGTGGGTGGTGGTCGTTTTGGGTTGGTTTG
T7_06953_G04	TGGGGTTTTTTTTTGGGGTCGTTGGTTTGGGGTGTG
T7_06954_G04	TGTTTTTGGTTTTTGGGGTCGTGGGTTTGTGGGTGG
T7_06955_G04	TTTTGGGTGGGGTTGGGGTCTTTGGTTGTTGTTTGG
T7_06956_G04	GGGGTGGGTTTTTGTTGGTCGGTGGGTGGTTTTTTT
T7_06957_G04	GTTTTGGGGTTTGGGTGGTCGTGGGTTTTTGTTTGG
T7_06958_G04	TTTTGTTGGGTGGTTGGGTCGTTTGGTTTTGGGGTG
T7_06959_G04	GGGGTTGGGTTTTTGGGGTCGTGTTTTTTTTGTGGG
T7_06960_G04	GTTTGGGTGGTTGGTTGGTCGGTTTTGGGTTGTGTT
T7_06961_G04	TTTTGTGGGGTGGTTTTGTCTTGGGGTTTGGGGTTG
T7_06962_G04	GTTTGGTTTGTTTTGGGGTCGTGGGGTGTTTTTGGG
T7_06963_G04	GTTGGTTGTTTGGGTTGGTCTTGGGGTTGGGGTTTT
T7_06964_G04	GGTGTTTGGTTTGGGGTGTCTGGGTTGGTTTGTGTT
T7_06965_G04	TTTTGGGTGTGTTTTGGGTCGGTGTTGGGGTTTTGG
T7_06966_G04	GGGGTTTTTGGGTGGTGGTCGGGTGTTTTTTTGTGT
T7_06967_G04	GGGGTTTGTGGGTGTGGGTCGGTTTTTTGGTTTTTG
T7_06968_G04	GGGGTGGTGTTTGGGTTGTCGTGGTTTTTTGGGTTT
T7_06969_G04	TGGTTGGGTTTTTTGGTGTCTTGTGTTGGGGTGGTG
T7_06970_G04	TGGGGTGTGTGGTGTTTGTCTTTTGGTTTGGTGGGT
T7_06971_G04	GGTTGGTTGGGGTTGGTGTCTTGGGTTTTGTTGTGT
T7_06972_G04	GGGGTTGTGTTTTTGTTGTCGGTGGTGGGTTTTGGT
T7_06973_G04	GTGTGGGTTTGGTGGGTGTCTGTGTTGGTTGGTTTT
T7_06974_G04	TTTTTTGGGGTGGTTGGGTCGTGTGGTTTTGGGGTT
T7_06975_G04	GGTTGGGTTTTTGGGTTGTCTGGGTTTTGGGGTTGT
T7_06976_G04	GTTTGGGTTTTGGGTTGGTCTGGTGTTTTGTGTGGG
T7_06977_G04	TTTTTTTGGGTTTGGGTGTCTGGTTGGGTTGGTGGG
T7_06978_G04	GTTTTGGTTTGTGGGTTGTCGGGTGTTTGGGGTTGT
T7_06979_G04	TGGTGGGGTGGGTTTGGGTCGGTTTTTTTGGTTGTT
T7_06980_G04	TTGTTGGTTGGGGTTGGGTCGTTTTTGGTGGGGTTT
T7_06981_G04	GTTGGGTTGTTTTTTTGGTCGGTTGTGGGTTGGGTG
T7_06982_G04	TTTGTTGTGGTTGGTGGGTCTTTTGGGGTTGGTTGG
T7_06983_G04	TTTTTTTGTTTGGTGTTGTCGGGGTGGGGTTGGGTG
T7_06984_G04	GGGGTGTTTGTTTTTTTGTCGGGTTGGGGTTGGGTT
T7_06985_G04	GGGGTGTGGGTGGGTGTGTCTTTTTTTTTTTGGTGG
T7_06986_G04	GGTTTTGGGGTGTTTTGGTCGGTGGGGTTTTTTTGG
T7_06987_G04	TTTTTGGGGTGGGGTGGGTCGTTTTTTTGGGGTTTG
T7_06988_G04	GGGTTGTTGTTGTTTGGGTCGTTTTGGTGGTTGGGT
T7_06989_G04	TGGGTTTTGTGTTTGGTGTCGTGTTGGGTTGTGGGT
T7_06990_G04	TGGGGTTGGTTTTGGTGGTCTTTGTTTGGGGTTTGG
T7_06991_G04	GGTTTTGGGTTTGGTTGGTCTGGTTGTGTGGGGTTT
T7_06992_G04	GTTTGGTTTTGGGTTTTGTCGGTGGTGTGGTTTGGG
T7_06993_G04	TTGTGGGTGTTTTGTTGGTCGGTTGGTTGGTGGTTG
T7_06994_G04	TTTTTGTGTGGGTTGGGGTCTTTGGTGTGTGGGGTT
T7_06995_G04	TGGTTGGTGGGGTGTGTGTCTTGTTTTGGGGTTGTT
T7_06996_G04	TTGGGTGGGTTTTTTTTGTCGGTTTGGTTGGGGTGG
T7_06997_G04	TGTGGGGTTTTTTTTTGGTCGTGGGTGGTGGGGTTT
T7_06998_G04	TGGTTTTGGTGGTTTGGGTCGGTGGGGTGGTTTTTT
T7_06999_G04	GTGGTGGTTTTTTGGGTGTCGGGTTTTGGTTTGGGT
T7_07000_G04	TGGGTGGGTTGGGGTTTGTCGGGTGGTTTTTTGTTT
T7_07001_G04	GGTGGGGTGGTGGTTTGGTCTTTTTTTTTTGGGGTG
T7_07002_G04	TTGGTTGGTTGGTGGTGGTCGTTGGGGTTGTTTTTG
T7_07003_G04	TTGTTTGGTGGGGTGTGGTCTTGTTTTTGGGTGGGT
T7_07004_G04	GGGTTTTTTTGTGTGGTGTCTTGGGTGTGGGGTGTT
T7_07005_G04	GTTTGGTTTGGGGTTTTGTCTGTGGGTGTTGTGGGT
T7_07006_G04	TTGTGTGTGTTGGGTGTGTCTTTGGGTTTGGGTTGG
T7_07007_G04	TTTTTGGTGGTTGTGGGGTCGTTTTGGTGGGGTTGT
T7_07008_G04	GGTTGTGTTTTGGGTGTGTCGTTTTGGGGTTGGGTT
T7_07009_G04	GGTTTTGGGGTTTGTGGGTCGTTGTGGTTTGGTTTG
T7_07010_G04	GGTTGTGGTTTTGGGTGGTCTGGGTGGGGTTTTTTT
T7_07011_G04	TTGTTTTGTGGTGTGGGGTCGTTGGTTGGGTTGTGT
T7_07012_G04	TGGTTGGGGTTTTGGTTGTCTTTTGTTGTGGGTGGG
T7_07013_G04	TTTGGGTTGGTTTTGGGGTCTGGGGTGTTGGTTGTT
T7_07014_G04	GTTTTTGTGGGGTTTTGGTCGGGTTTGGGGTTTGTG
T7_07015_G04	TTGGTTTGTGGGGTTTTGTCGTGTGGTTTGTGGTGG
T7_07016_G04	GGGGTGGGTGTTGGGGTGTCTTGTTTGGGTTTTTTT
T7_07017_G04	GTTTTTGGGGTTTGTTGGTCGGGTTTGGGTTTTGGG
T7_07018_G04	TTTTTTTGGGGTTTTGTGTCGGGTTGGGTGGGGTTG
T7_07019_G04	TGTTTGGTGTTTTGGTTGTCGGGGTTGGTGGGGTTT
T7_07020_G04	GGTGGTTGTGTTGGGTTGTCGGTGGGTTGGTTTTTT
T7_07021_G04	GGGTTTGGTTTGGGTTGGTCGGTTGGGGTTTTTGTT
T7_07022_G04	TTTTTGGGTGGTGGTGTGTCGTTGTTTTGGGTGGTG
T7_07023_G04	GGGGTGGTGGGTTTTTGGTCGGTTTTTTGTTGGGTT
T7_07024_G04	TTGGTGGGTGGGTTTTGGTCTTTTTGGTGGTTTGGG
T7_07025_G04	TGGGGTTTTTGTGTTGGGTCTGTTGGTTGGTGTTGG
T7_07026_G04	TGGTTTGTTTTGTGGGTGTCGGTGGTGGGTTTGGTT
T7_07027_G04	GGGTTGGGGTGGTTTGGGTCGGTTTTTTTGGTTTTG
T7_07028_G04	GTTTGTGGTTTTTTTGTGTCGGGTTGGGTGGGGTGT
T7_07029_G04	GTTTTTTTGGGTTGTTGGTCGTTGTGTTGGGGTGGG
T7_07030_G04	GTGGGTTTTGGGGTTTTGTCTTGGGGTGGGGTTTTT
T7_07031_G04	TGTGTGGGTGGTGGTTTGTCTTGTGTGTTTGTGGTG
T7_07032_G04	TGGTGGTTTTTGGTGGGGTCTTGTGGTTTTGGGTGT
T7_07033_G04	GTGGGTGTGGTGGTTGTGTCTTTTGGTGGTGGTTTT
T7_07034_G04	GTTGTGGTTGGGTTTTGGTCTTTGGGGTGTGTTTGG
T7_07035_G04	GGGGTGTTTGGGTTTTTGTCTGGGGTGGGTTTTTTG
T7_07036_G04	GTTGTTGGGTTTTTTTGGTCGGTTTGGGGTGGGGTT
T7_07037_G04	GGGGTTTGTGGGTGGTTGTCTGGTTTTGTTTGGGTT
T7_07038_G04	GTGGTTTTTGTGGGGTTGTCGTTGGTTGGGGTTGTT
T7_07039_G04	GGTGGGGTTTTGGTGTGGTCGGGTTGTTTTTGGTTT
T7_07040_G04	GGGTGTTGGGGTTGTTTGTCTGGGGTTGGGTTTTTT
T7_07041_G04	GGGTTGGTTTGGGGTTTGTCGGTTTTTTTTGGTGGG
T7_07042_G04	TTTGTGGGTGTGTTTGGGTCGTTTGGGGTTGGTGTT
T7_07043_G04	TGTGTGGTGGTTTGGGTGTCTGGGGTTTTTTTTGGG
T7_07044_G04	GTTGTTGGTGTTTGGGTGTCGGGGTTTGTTTTTGGG
T7_07045_G04	GTTTTGGGTTGTGGTTGGTCGGTGGTGTTTTTGGGT
T7_07046_G04	TTGGGGTGGGGTTTTTTGTCGGGTTTTGTTGGGGTT
T7_07047_G04	GGGTGTTGTGGGTTTTTGTCTTGGGTGGGGTTTTTG
T7_07048_G04	TTTTGTTGGGTGTTGTTGTCGGTTTGGGTGGGTGGT
T7_07049_G04	TTTTGGGTGTGGGTTTTGTCGTTGTGTGGGGTTTGG
T7_07050_G04	TTTTTGGTTGGGGTTTGGTCGTGTTTTGGGGTTGGG
T7_07051_G04	TTGGTGGGGTGTGTGGGGTCTTGGGTGTTTTTGTTT
T7_07052_G04	GTTGGTTGTTGGGTTTTGTCGTTGGTTGTTGGTGGG
T7_07053_G04	TTTGGGGTTGGGGTTTGGTCGGTGTTGGTGTTGTTT
T7_07054_G04	GTTTGTGGTGGGGTTGTGTCGTTGTGTTGGGTTGTT
T7_07055_G04	TGGGGTGTGGGGTGTTTGTCTTGGGGTTGTTGTTTT
T7_07056_G04	TTTGGGTTGTTTGTGGTGTCTGGGGTTTGGTGTTGG
T7_07057_G04	GGTTTTTTTTTTGGGGTGTCGGTGTGTTGGGGTTGG
T7_07058_G04	TTGTTGGGGTTTTTTTGGTCGGGTGGTTTGGGGTGT
T7_07059_G04	GTTTTGTTTTGGGTTGTGTCGGGTGGGTGTGGTTGT
T7_07060_G04	GTTTTGTGGGGTTGTGGGTCGTTTTTTTTGGGTGGG
T7_07061_G04	TTTGGGTTTTTGGTTGGGTCGTGTTGGGTGTTGGGT
T7_07062_G04	GTGGTTGTTTTTGTTGGGTCGGTGGGTTTGGTTTGG
T7_07063_G04	GGGTGGGTTGGTTTTGTGTCGGGTTTGGGGTTTTTT
T7_07064_G04	GGTGGTTTTTTGGGGTTGTCTTGGTTTGTGGGGTTG
T7_07065_G04	TTGGGTTTTTGTTTGGGGTCGTGGTGGTGTTGGTTG
T7_07066_G04	GGTTGGTTTTTGGGTGGGTCGGTTTGGTGTTTGGTT
T7_07067_G04	TTTTTGTGGGTTTTGGTGTCGGGTGTTTGGGGTTGG
T7_07068_G04	GGTTTTGTTTGTTTGGGGTCGTTTGGGGTGGGGTTT
T7_07069_G04	GGTGGGTGGGTGTTTGGGTCGTTTGGTTTTTTTTGG
T7_07070_G04	GGTGGTTTGTTGGGTTTGTCTGTGGGTGGTTTTTGG
T7_07071_G04	GTGTGGGGTTTGTTTTTGTCGGTTTTGGGGTTTGGG
T7_07072_G04	GTGGGTGGTTGGTTTTGGTCTTGGGGTTTGGGTTTT
T7_07073_G04	GTTTTGTTTGTGGGTGGGTCGTGGTGGTTTTTTGGG
T7_07074_G04	GTTTTTTGTTTGGTGTTGTCGTTGGGGTGGGGTGGT
T7_07075_G04	GGTTTGGGTGGGTTTTTGTCTGGGGTTGTTTTGTGG
T7_07076_G04	GTTTTTTGGTGGGTTTTGTCTGGGGTGGTTTGGTGG
T7_07077_G04	TTGTGTTTGGGGTTGGGGTCTTTGGGTTTTTGGGTG
T7_07078_G04	GGGGTGGTGGTGTTGGTGTCTGGTTTGTGTTTGTTT
T7_07079_G04	GGGGTGTTTGGGGTTGTGTCTTTGTGGTTTGGTTTG
T7_07080_G04	GGTGGGTTTTTTTTTTGGTCGGTTGTGTGGTGTGGG
T7_07081_G04	GTGTTTGGGTTTTTGGGGTCGTGGGGTTTTTGGGTT
T7_07082_G04	TTTGGGGTGGTGGGGTGGTCGGTTTTTTTTTGTGTG
T7_07083_G04	GGGGTGTGGTTGGGTTTGTCGGTTTTTTTGTTGTGG
T7_07084_G04	GGGGTTTGTGTTGGGTTGTCTGTGGTTTTTGTTGGG
T7_07085_G04	TTGGTTTTGGTGGGTTGGTCGGGTTTGGGTTTTGGT
T7_07086_G04	TTTTTGGTTTTGGGGTTGTCGGTGGGTTTGGGGTTG
T7_07087_G04	TTTGGTTGGTTTTTTTGGTCTGGGGTGGGGTGTGGT
T7_07088_G04	TTGGGGTGGGTGTTTTGGTCGGTTGGTGGTTGTTTT
T7_07089_G04	TTGGTGGGGTTTGGTGTGTCTGTTTGGTTTTGGGTG
T7_07090_G04	GGGGTTTGGTGGTTTTTGTCTGGGGTTGTTTGTGGT
T7_07091_G04	TTTTTGGTGGGTTGTGGGTCGTGGTGGTGTTTTGGT
T7_07092_G04	TTGGTTTTGTGGGGTGTGTCTTGGTGGGGTGTTTTG
T7_07093_G04	GGGGTTTTTTTGTGGTTGTCTGTGGGTGGTGGGTTT
T7_07094_G04	GGGTTTTGTGGTTGTGGGTCTTGTTTGGGTGGTTTG
T7_07095_G04	TTTTTGTGGTGGTGGGTGTCGGGTTTGGGTTTTGTG
T7_07096_G04	TTGTTTGGTTGGGGTTTGTCTTTGGGTGTTGGGTGG
T7_07097_G04	TGGGTTGGGTTTTGTGGGTCGGTTTGTTTGGTTGGT
T7_07098_G04	TTTTTGGTGGTGGGTGTGTCTTTGGTGGTGTTTGGG
T7_07099_G04	GGGTGTGGGTTGGGTGGGTCTGTTGTGGTTTTTTTT
T7_07100_G04	TTTGTTTTTTGGGTGGTGTCGTTGGTGGTGGTGGGT
T7_07101_G04	GGGTTTGTTTTTGTGGGGTCGTGTGGGGTTTTGGTT
T7_07102_G04	TGTGTTGGGGTTGGGGTGTCTTTTTGGGGTTTGGTT
T7_07103_G04	GGTTTGGGTGTTGGGTGGTCGGTTTTTTGGGTTTGT
T7_07104_G04	GGGTTTTTTTTGTTGGGGTCTGGTTTTGGTGGGTGG
T7_07105_G04	GGGTTTGTGGGTTTGGGGTCGTTTTGGTTGGGTTTT
T7_07106_G04	TTTTGGTTGTTTTGTGGGTCGGTTGGGGTTGGGTTG
T7_07107_G04	GGTGGGTTGTTGGGTTTGTCGGGGTTGGGTTTTTTT
T7_07108_G04	GGGTTGGTTGGTTTGGGGTCTTTTGTTTTGGGTGGT
T7_07109_G04	GGGTGGGTGGGTTTTGTGTCTGTTTTTTGGTTGGGT
T7_07110_G04	GGTTTGGGGTGGGGTTGGTCTGTTTTTGGGGTTTTT
T7_07111_G04	TTTTTTGGGTGGGTGGGGTCTGGGGTTTTTTGGGTT
T7_07112_G04	GGTTGGTGGTGTGGGTTGTCGTTGTGGTTTTGTTTG
T7_07113_G04	TGTTTTGGGGTGGTTTTGTCGTTTTTGGGTGGGGTG
T7_07114_G04	GTGTTTTGTTGGGTGGGGTCTGTTGTTTTGGGGTTG
T7_07115_G04	TTGTGGTGTGGGTTTGGGTCTTGGGTTTTGGGGTTT
T7_07116_G04	TTTGGGGTGGGTGGGGTGTCTTTGTGGGGTTTTTTT
T7_07117_G04	TTGTTTTGTGGTTTGGGGTCTGTTTGGGGTTGGGGT
T7_07118_G04	TGTGTTGTGGGGTTGTGGTCTGTGTTGGTTTGTTGG
T7_07119_G04	GGGGTTTTGGTGGGTGGGTCTTGTGGGTTTTTTTTG
T7_07120_G04	TTTGTTGGGTTTTTTTGGTCGGGTGTGGGGTGGGTT
T7_07121_G04	GGGGTTTTGGGTTTTTGGTCTTTTGGGTGTGGGTGT
T7_07122_G04	GGGTTTGTTGTTTTTGGGTCGGTTTTGGGGTTGGTG
T7_07123_G04	GGTTTTGGGGTTTTGGGGTCTTGGGGTTTTTTGGTG
T7_07124_G04	TGGGTGTTTTTTGTGGGGTCGTTTTTGGGGTTGGGT
T7_07125_G04	TTTGGGTGGGTTTTGTGGTCGTTTGGGGTTTTTGGG
T7_07126_G04	GGTTTGGTGTGTGGGTTGTCGGTTTGTTGGGGTTTT
T7_07127_G04	GGGGTTTTTTTTTGTTGGTCGGGTTGGGTTGGTTGG
T7_07128_G04	GGTTGTGGGGTTTGTTTGTCGTGGGGTTTTTGTGGT
T7_07129_G04	TTGGTTGGTTTGGGTGTGTCTGGGTTGTTTGTGGGT
T7_07130_G04	TGTTTTGGGTTGTTTTGGTCGTGGTGGGTGTGGTGT
T7_07131_G04	GGGTTTGGGGTTGTGTTGTCGTGGGTTGTTTGGTTT
T7_07132_G04	TGGGTGGGGTTGGTTTTGTCTTTGTGGGGTTTTTGG
T7_07133_G04	TGTTTGTTGGGTTGTGGGTCGTGGGTTTTGTTGTGG
T7_07134_G04	GTTTGTTTGGGTGTTTGGTCGGGTGTTTTTGGGTGG
T7_07135_G04	GTGGTTTTTTGGGGTGGGTCGTTGGTGGGTGTTTTT
T7_07136_G04	GGGTTTTTTGGGGTTTGGTCGTTGGGTGTGGTTGTT
T7_07137_G04	TTGGGTTTTTGTGGGGTGTCTGGTGGGGTTTTTTGG
T7_07138_G04	GGTGTTTGTTTGGTGGGGTCGTTTGGGGTTGTTTTG
T7_07139_G04	GTTGGGGTTGTGTTTTTGTCGGGTTGGGTGGGTTTT
T7_07140_G04	GGGGTTTTTGTTTGGGTGTCGTTTTTTGGGTGGGTG
T7_07141_G04	TGGTTGGTGGGGTTGGGGTCTTGTTGGGTTTTTTTG
T7_07142_G04	GTGGGTTTGGTGGTTTGGTCGGTGGGTTTTTTGTTG
T7_07143_G04	GGTTTGTGGGGTTTGGGGTCTTTTGGTTGTTGGGTT
T7_07144_G04	TTGGTGGTTTGTTTTTTGTCGGTGTGGGGTGGGTGT
T7_07145_G04	TTTGTGTTTTTGTTTGGGTCGGTGGTGTGGTGGGGT
T7_07146_G04	TTGGTTTTGGGGTTTGGGTCGTTTTGGGTTGGTGGT
T7_07147_G04	GGTTGGTTTTGGGGTGGGTCGGTTTGGGGTTTTTTT
T7_07148_G04	GTTTGTTGGGTTTTGTTGTCTGGGTTGGTGGGTGGT
T7_07149_G04	GGGTTGGGTGGGGTTTTGTCTGTTTTGTTTTGGTGG
T7_07150_G04	GGTGGTTTTTGGTGGTGGTCTTTGGGTTGGGTTTGT
T7_07151_G04	TTTGGGTGGGTTGTTGTGTCGGTGTTTTTTGGGGTG
T7_07152_G04	TTTTGTGGGGTTTGGTTGTCTGGGTGGGTGGTTTGT
T7_07153_G04	TTTGGGTTGTTGGTGTTGTCGTGGTGGGGTGGTTTT
T7_07154_G04	GGGGTGGTTTGTTTGTTGTCGGTTGGTTTTGTGTGG
T7_07155_G04	TGGGTGTTTTTGGGGTTGTCGTGGGTTGTTTTTGGG
T7_07156_G04	TTGGTTGTGGGTGGTTTGTCTTTTGGGTTGGTGGTG
T7_07157_G04	GGTTTTTGGGGTTTGTGGTCTTTTGGGGTGGTTTGG
T7_07158_G04	TGGGGTGGGTTTGTTTTGTCGGGTTTGGTTGGGTTT
T7_07159_G04	GGTGTGGTTGGGTTGGGGTCTTTTGGTTGGGTTTTT
T7_07160_G04	GGGGTTGGTTTTGGGGTGTCGGTTTTTTGGTTGTTG
T7_07161_G04	GTTGGGGTGTTTTTTGGGTCGTTGTGGTGGGTTTTG
T7_07162_G04	TGGGGTTTTGGTTTTGTGTCTGGGGTTGTGGGTTTG
T7_07163_G04	GGGGTGTGTTGGGGTTTGTCTGGGTGTTGTTTTTTG
T7_07164_G04	GTTGGTTTTTTGGGTTGGTCGGTTTGGGTGGGGTTT
T7_07165_G04	GTGGGGTGGTTTTGGTTGTCGTGTGTTTTGGTTTGG
T7_07166_G04	GTTGGGTGGTTGTTGTGGTCGGTGGTTGTTTTTGGT
T7_07167_G04	GGTTGTTTGGGTGTTTTGTCTTGGGTGGTTGGTTGG
T7_07168_G04	TGGTTTTTTTTGGTGGTGTCGGGTGGTTTGTGTGGG
T7_07169_G04	TTGTGTTTGGTGGGTGGGTCGGTGTTTTTGGTGGTT
T7_07170_G04	GTTTTGGGGTGTGGTTTGTCTGGGGTTGTTTGGGTT
T7_07171_G04	TGGTGTTTGGTTTTTTTGTCGGTGTGGTGGGTTGGG
T7_07172_G04	TTTGGGGTTGGGGTGGGGTCTGTTTTTTGTGGGTTT
T7_07173_G04	GTGTGGGGTTTTTGGTGGTCTTTTTTGGGTTGGGGT
T7_07174_G04	TGGGTTTTTTTGTTTGGGTCGTGGTGGTTTGGTGGG
T7_07175_G04	GGGGTGTTGGGTTTTTGGTCTTGGTTTGGGTTTTGG
T7_07176_G04	GTGGGGTTTTTTTTTGTGTCGGTGGGTTTGGTTGGG
T7_07177_G04	TGGGTTTGGGTTTTGGGGTCTTTTGGTGGGTTTTGG
T7_07178_G04	GGTTGGGGTTTTTTTGGGTCTTTTGGTGGGTGGGTT
T7_07179_G04	GGGTTTTTGTGGGTTGTGTCTTGGGTGGTTGTTTGG
T7_07180_G04	TGGGTGTTGGTTTTGTTGTCGGGGTGTGTTGTGGTT
T7_07181_G04	TTTTTGGGGTGGTTTTGGTCGGGTGGTGGTTGTTGT
T7_07182_G04	GTTTGGGTGGTTGGGTTGTCGGTTTTTTTGGGGTTG
T7_07183_G04	TGGTTGTGGTTGGTGGTGTCTGGTTTTGGGTTTTGG
T7_07184_G04	TTTTTTTTGGTTGGGTTGTCTGGGGTTGGGTGGGGT
T7_07185_G04	GGGTTGGGTGGTTTTTTGTCTTTGGGTTTGGGTGTG
T7_07186_G04	GGGTTTTTTTTGGGTTGGTCGTGTGGGTTTGGTTGG
T7_07187_G04	GGTGGGGTTTTGGTTTTGTCTTGTGGGGTTTGTTGG
T7_07188_G04	GGGGTTTGGGTTGTTTTGTCTTGGTTGTGGGTGTTG
T7_07189_G04	GTTTTGGTGGGTTGGGTGTCTTTGGGTGGTTTGTGT
T7_07190_G04	GGTTTGGTGTTTGGGTTGTCTGGGTGTTTTTGGGGT
T7_07191_G04	GTTTTGGGGTTTGTGTGGTCTGTTTGGTTGGGGTTG
T7_07192_G04	TTGGTTGTGGGTGGTTGGTCTTTGGGGTTTTTTGGG
T7_07193_G04	GGTGTTTGGGGTGGGTGGTCGTTTTTGGTTTTTGGT
T7_07194_G04	GTGGTGGGGTTTTTTGGGTCTTTGTTGGTGTTGGGT
T7_07195_G04	GGGTTTTGGGTTGTTTGGTCGTTGGTTGGTGGTTGT
T7_07196_G04	GGTGGTGGTTTGGTTTTGTCGGGTTGGGGTTTTGTT
T7_07197_G04	TGTTGGTTTTTTGGGGTGTCTTTGGGTTTGGGGTGG
T7_07198_G04	GTTTGGTGTGTTGGGTTGTCTTGTTGGGGTTGTGGT
T7_07199_G04	TGGTGGTGGTTGGTGGGGTCTTGTTTTTTTTGTGGG
T7_07200_G04	GGGTTGTTTGGTTGGGTGTCTGGGTGTTGTTGGTTT
T7_07201_G04	GGTTTTGGGTTTTTTTGGTCGTTTGGGGTTGGGGTG
T7_07202_G04	GGGTTTTTGTTTTTGGGGTCGTGGGGTGTTGGTTTG
T7_07203_G04	TGTTTGGGGTTTTGGGTGTCGTTGTGGTTTGGTGGT
T7_07204_G04	TTTGGTGGTGGGGTGTGGTCGGGTTGTTGTTTTTTG
T7_07205_G04	TGGTTTGGGGTTTTTTTGTCGGGGTGGTTTTGGTGG
T7_07206_G04	GTTGTGGGTTTGTGTTGGTCGTTGTGGGGTGTGTTT
T7_07207_G04	GTGTGGGGTTGTGTGTGGTCGGTTTTGGTGTTTGTT
T7_07208_G04	GGGTTGGGTTGGGTTTGGTCTGTTTTTTTGGGGTGT
T7_07209_G04	GGGTTTTGGTTTGTTGGGTCGTTTGGGTTGGTTTGG
T7_07210_G04	TTGGGTTGTTGTGGGGTGTCGGTTGGGTGTTTGTTT
T7_07211_G04	TGGTTTGTGGTGGTGTGGTCTTTTGGTTTTGGGGTG
T7_07212_G04	GGTGTTTTGGTGTTTTTGTCGGGTTTGGGGTTGGGT
T7_07213_G04	TTTGGTGGTGGTTTTGTGTCGGTGTGGGTTTTTGGG
T7_07214_G04	GGGGTTTTTGGGTTTTTGTCTGTGGGGTTGGTTGTG
T7_07215_G04	GGTGGGTTTTTTTTGGGGTCGTGGTTGGTTTGGGTT
T7_07216_G04	GGGTGGGTTTTTGGGGTGTCGTTTTTTGGGTGTTTG
T7_07217_G04	GGTGGGGTGGGGTTTTGGTCGGGTTGGTTTTTTTTT
T7_07218_G04	TGGTTTGGTGGGGTGTTGTCTTTGGGGTTTGTTTGG
T7_07219_G04	TTTGGTTGTTGTGGTTGGTCGTGTTGGGTGTTGGGT
T7_07220_G04	GGGGTGTTTTTGTGTGGGTCGTGGGTTTTGTTGGTT
T7_07221_G04	TTGGTTTTGGTTTTGGGGTCTGGGGTTGTTGGGTTG
T7_07222_G04	TTTGGGGTTTTTGTGGTGTCGGTTTGTGGGGTTTGG
T7_07223_G04	GGTTGTTTTGTGGTTTGGTCGTTGGGTTTGGTTGGG
T7_07224_G04	TGTTGGTGTTGTGTTTTGTCGGGTGGTTTGGGGTGT
T7_07225_G04	TGGGTTTGTGTGTTGGTGTCTTGGGTTTTGGTGTGG
T7_07226_G04	TTGTTGGGTGGTGGGGTGTCTTGGTTTGGGTGTTTT
T7_07227_G04	GTTTGGTGGTTGGGGTTGTCTGTTGTTGTTGGGGTT
T7_07228_G04	GGGGTTTTGTTGGTTGGGTCGGTTTGGGGTGTTTTT
T7_07229_G04	GGTTTTGTGTGTGGGGTGTCTTTTGGGTGGTTTGGT
T7_07230_G04	TGTGGTTGGGTGTGGGTGTCGTTGTGTTTTTGTTGG
T7_07231_G04	GGTTTGGGTGTTTGTTTGTCGGGGTTGTGGTTTTGG
T7_07232_G04	TGGGGTGGTTGGGTTTTGTCGGGTTTTTGGGTGTTT
T7_07233_G04	GGTTTTGGTTGGGTGTGGTCGGGTTTTGGTTTTTGG
T7_07234_G04	GGGGTTGGGGTTTGGTTGTCTTTGGTGGGGTTTTTT
T7_07235_G04	TTTGGTTTTGGTGGTTGGTCGGGTTGGTTTGGTGTG
T7_07236_G04	TGTTGGGTGGTTGGGGTGTCTTTTTTGTTGGGGTTG
T7_07237_G04	TGGGGTTTTGTGGGGTGGTCGGTTTTTTGGGGTTTT
T7_07238_G04	TTTTTGGTTTGGTGTTTGTCTGTGGGGTGGTGGTGG
T7_07239_G04	TGGGTGGGTGGGGTTTTGTCTGGTTGTTTGGTTTGT
T7_07240_G04	GGGTGTGGGGTGGTTTTGTCGGGGTTGGTTTTTTTT
T7_07241_G04	GGGTTTTGGGGTGGGGTGTCGTTTTGTGTTGGTTTT
T7_07242_G04	GGTTTTGGTTTGGTGGTGTCTTTTGTTGGGGTGGGT
T7_07243_G04	TGGGGTTTTTTGGGTGGGTCGGTGGGTGTTTTTTGT
T7_07244_G04	GGTTGTGTGGTTTTTGTGTCGGGTGGGTTGTTTGTG
T7_07245_G04	TGGGTGTGTTTGGGGTGGTCGTTTGTTGGGGTTTTT
T7_07246_G04	TTGTTGTTTGTGGTTGGGTCGGTTGTGGTTGTGGGT
T7_07247_G04	GTGGTTTGTGTTTTGTGGTCGTTTGGGTTGGTTGGG
T7_07248_G04	GGGGTTTTGTTTGGGGTGTCGTTTTTTGGGGTTTGG
T7_07249_G04	GGGTTTGGGTTTGGTGTGTCGGGTGGTTTTGGTTTT
T7_07250_G04	GGTTTGTTTGTTGGTTGGTCGTGTTGGGGTTGGGTT
T7_07251_G04	TGTTGTTGTGTTGGGTTGTCGGGGTTTTGGTGTTGG
T7_07252_G04	TGGGTGGGGTGGTGGGTGTCTGGTTTGTTTTTTGTT
T7_07253_G04	GGGGTGTTTTGGTTGTGGTCGTGGTTGTTTTTTGGG
T7_07254_G04	TTTTTTGTGGGTGGGTTGTCTTTGGGGTTGTGGGGT
T7_07255_G04	TTGGTTTGGGGTTTGGTGTCGGTGGGGTTGTTTTGT
T7_07256_G04	GTTTGGTGGGGTTGTGGGTCGTTGGGTGTGTTTTTT
T7_07257_G04	TGGTGTTTTGGGTGGTGGTCGGTGTGTTTTTTTGGG
T7_07258_G04	TTGGGTGGTTTGTTTGTGTCGGGTGGTTTTGTGTGG
T7_07259_G04	GGTTTTGTGGGGTTTTTGTCGGGTTTTGGGTGGGTT
T7_07260_G04	TGGGTTTTTGTGGGTGTGTCTTGGTGGTTTGTTGGG
T7_07261_G04	TGGGTTTGGTTGGGTTTGTCTTGGGTGGTTTGGGTT
T7_07262_G04	TTGTTTGGTTTTGGGTTGTCGGTTGGGTGGGGTTGT
T7_07263_G04	TGGTTTGGTGTTTTTGGGTCTGGTTGGGTTGTTGGG
T7_07264_G04	GGGGTTTTTTGGGGTTTGTCTTGTTGGGGTGGGTTT
T7_07265_G04	GGGGTTTGGGGTTTTGTGTCTTGTTTTTGGTGGGGT
T7_07266_G04	TTGGTTGGTGGTTGTTTGTCTTTGTGGTGGGGTGGT
T7_07267_G04	TTGGGTTGGTTTTGGGTGTCTGGGGTTTTTTGTGGG
T7_07268_G04	GGTTTTTGGGTGGGGTTGTCTTTGTGGGTTTGGTGT
T7_07269_G04	TTTTGGGTGGGGTTTGGGTCGGTGTTGTTTTTTGGG
T7_07270_G04	TTGGTGTTGTGGTTGGGGTCTGGTTTGTGGTTTTGG
T7_07271_G04	TTGGGTTGGGTGTTTGGGTCGTTTGTGGTTGGGTTT
T7_07272_G04	GGTGTTTTGGTTTGTGTGTCGGGTTTTTTGGGTGGG
T7_07273_G04	TTGGTTGTGTGTGTTGGGTCGTGGGGTTTTGGTTGT
T7_07274_G04	GGGGTTTTGGTGGGGTGGTCGTTGGGTTTTTTTTGT
T7_07275_G04	TTTGGGGTTTTTTTGGGGTCGTGGTGTTTTGGGGTG
T7_07276_G04	GTTTGGGGTTTTGGGTTGTCTGGTTGTTGGGTGTTG
T7_07277_G04	TTGGTTGTGGTTTGTGGGTCGGTTGTTTTGGTGGGT
T7_07278_G04	GTGGTTGTGGGGTTTTGGTCTTTGGGTTTTGGGTGT
T7_07279_G04	TTTGGGGTTTGGTTTGGGTCTTGGGGTTGTTTGGGT
T7_07280_G04	GGGTTGTGGTTTGGTTTGTCGGGTTGGGTTTTGTTG
T7_07281_G04	TGGTTGGGTGGGGTGTTGTCGTTTTTTTTGGGTGGT
T7_07282_G04	GGGGTTGTGTGGGGTTTGTCGGTGTTTTTTTGGTTG
T7_07283_G04	TTGGTTTGGGTTTGGGTGTCGTGTGTTTGGGGTGTT
T7_07284_G04	TTGGTGGGTGTGGTGGTGTCTGGTTGGGTTTTTTTG
T7_07285_G04	GTTGGTGGTTTGTTGGTGTCGTGTTTGGTTTGGGGT
T7_07286_G04	GGTTTTTTGTGTGGGTTGTCGGGGTGTGTTTTGGGT
T7_07287_G04	TTTGGTGTTGGGTTTGGGTCGGTTTTTGGTGTGGGT
T7_07288_G04	TGGGGTTTGTGTTTGTTGTCGTTGGGGTGTGGGTTT
T7_07289_G04	GTGTTTTGGGTTTTGGGGTCTTGTGGTGGGTTTGGT
T7_07290_G04	GTTTTTTGGGGTTTTGGGTCGGTGGTGGGTTTTTGG
T7_07291_G04	TTTTTGGGTTTTGTGGGGTCTGGGGTTGGGGTTGTT
T7_07292_G04	GTTTTTTGGGGTGGGGTGTCTTTTGTTGGTGGTTGG
T7_07293_G04	TGTGGGTTTGGTTTTGGGTCGGTTTTTTGGGTTGGG
T7_07294_G04	GTGGGTTTGGTTGTTGGGTCTGTGTTTGGTTGTTGG
T7_07295_G04	TGGTGTTGGGTTGTTTTGTCTTGTGGGTGGGGTTTG
T7_07296_G04	GTGGTTTGTTTGGGTGGGTCTTTTGTGGTTGGTGGT
T7_07297_G04	GGGGTTGGTTGGGTTTTGTCTGGTGTGGTTTTTGGT
T7_07298_G04	GTTTGGTTGGGGTGGGTGTCGTGTTTTTGGGTTGTT
T7_07299_G04	TTGGTGGGGTTTGGTGTGTCTGGTTTTTGGGGTTTG
T7_07300_G04	TGGGTTGGTGTGGTTTTGTCTTTTGGTGGTGTTGGG
T7_07301_G04	GGGGTTTGGGTGGGGTTGTCGGGTTTTTGTTGTTTT
T7_07302_G04	GGTTGGGTGTGGGTGTTGTCGGTGTTGGTGTTTTTT
T7_07303_G04	TGTGTTTTTGTTGTGGTGTCGTGGGTTGTTGGTGGG
T7_07304_G04	TGTGGGGTGTTGTTTGGGTCGTTTGGTTTGTGGTTG
T7_07305_G04	GTTGTTGTTTTTTGGGTGTCTTGGGTGTTGGGTGGG
T7_07306_G04	TTTTTTGGGGTTGGGGTGTCTGGTTGTGGTGTGGTT
T7_07307_G04	GGTTGTGGGTGTTTGTTGTCGGTTGGGTTTTTTGGG
T7_07308_G04	GTTGGTTTGTTTGGGTGGTCGGGTTTTTGTTGTGGG
T7_07309_G04	TTTGGGGTGGGTTTGTTGTCGTTTTGGGGTGGGTTT
T7_07310_G04	GTGTGGGGTTTTTGGTGGTCGGTTTTTGGGTTGGTT
T7_07311_G04	GGGGTTTTTTTTGGTTTGTCGGGGTTTGGTTGGGGT
T7_07312_G04	TTTTTTGTGGGGTTGGTGTCTTGTTGGGTTGGTGGG
T7_07313_G04	GTGGGTTGGTTGGGGTTGTCTTTGGTGTTTTGGTTG
T7_07314_G04	GTTTTGGGTTGTTTGGGGTCTTTTGTGGTGGGGTTG
T7_07315_G04	TGGGTTTTGGTGGTTTTGTCGTTGGGGTTGGTTGGT
T7_07316_G04	TGTGGTTGGTTGTTGGGGTCGTTGTTGTGTTTTGGG
T7_07317_G04	TTTTGTTGGGTGTGGTTGTCGTGGTGGGTTGGTTTG
T7_07318_G04	TTTGGTTGTGTGTGTGTGTCGGGTTGGTTTGGGGTT
T7_07319_G04	GTTGGGTTTTGGGGTTTGTCTGGGTTTGGTTGTTGG
T7_07320_G04	TTGGGTTTTTGGGGTGGGTCGTGGTGTGTTGGTTTT
T7_07321_G04	TTTGTGTTGTGGGTTTTGTCGGGGTTGGGTTGGGTT
T7_07322_G04	TGGTTTGGTGTTGGGGTGTCGTTTGTTTTGGGTTGG
T7_07323_G04	TTTGGGGTGTTTTTTTGGTCGTGGGGTGTGTTGTGG
T7_07324_G04	TGGGGTTGGTTGTTGGGGTCGTTTTGTGGTTGTTTG
T7_07325_G04	GGGTTTGTTTGTTGGTGGTCTGGGGTTGGGTTTGTT
T7_07326_G04	GGGGTTTGTTTTTTGGGGTCTTTTGGTTGGGTGTGG
T7_07327_G04	GGGTTTGTGTTTTTTGGGTCGTTTTGGGGTGGTTGG
T7_07328_G04	GTTGGGGTTTGGTTTGGGTCGGTGGGTTGTTTGTTT
T7_07329_G04	TGTTGTGTTGGGTTGTGGTCGTGGTGTGGGTTTGTT
T7_07330_G04	TGGGTTTGGGTTGGTTGGTCGTTGGGTGTTGGTTTT
T7_07331_G04	GGGTTTGTGTTTTGGTGGTCTTGGGGTGGGGTTTTT
T7_07332_G04	TGGGGTGTGTGGGGTTTGTCTGTTGGGTTTTGTTTG
T7_07333_G04	GGGTTGGTGTGGTTTGTGTCTGGGGTGTTTTTGGTT
T7_07334_G04	GGGGTTTGGGTGTTTTGGTCGGTTGGTTTTTGTTGG
T7_07335_G04	TGTGGTTGGGTGGTGGTGTCTTTTGGGGTTTTGTTG
T7_07336_G04	GTGGGTGTTGGGTTTGTGTCGGGTGTTGTTTTGGTT
T7_07337_G04	GGGTTTTGGTGGTTTGTGTCGTGGGGTGTGGTTTTT
T7_07338_G04	TTGGGTTTGGGGTTTTGGTCGTGGTTGGTTTGGTTG
T7_07339_G04	GTGGTTGGTTTGGGTTGGTCGTTTGGGTTTTTTGGG
T7_07340_G04	GTGGTGGTGTGGTGGGTGTCGTTTGTGGTTTGTTTT
T7_07341_G04	GGGGTTTGTTGTTTGTGGTCGGGTTTGGGGTTGTTT
T7_07342_G04	TGGTTTGGTGGTTGTGGGTCGTTTGGGTGTTTTTGG
T7_07343_G04	TTTTGGGTTTGTGGTGGGTCGGTGGTTTTTGGGGTT
T7_07344_G04	TTTTGGGGTTGGTTGGGGTCTTGGGGTTTTTTGGGT
T7_07345_G04	GTGGTGGGTTTTTTTTGGTCGGTTTTGTTGGGGTGG
T7_07346_G04	TTGTTTTTGTTGTGTGGGTCTTTTGGGGTGGGGTGG
T7_07347_G04	GGTTTGTTTTGGGTTGGGTCGGTTTTGTGGTGTTGG
T7_07348_G04	TGGGTTTTTTGGTGTGGGTCGGTTTGTGGTGGGTTT
T7_07349_G04	TTTGTGGGGTTGTTTTGGTCGTTTGTGTGGGTGGGT
T7_07350_G04	TTTGGGTTTGGTGGGTGGTCTGTTGGGGTTGGTTTT
T7_07351_G04	TGGGTGGGTTGGTGGGTGTCTTTTTTTGGGTGTTGT
T7_07352_G04	TTTGGGTGGGGTTGGGTGTCTGTGTTTTTTGGGTTG
T7_07353_G04	GTTGGTGGTTTTTGTGTGTCTTGGGTTGGGTTTGGG
T7_07354_G04	GGGTGGGTTTTGGTTTTGTCTTTTGGTTGGGTGTGG
T7_07355_G04	GGGGTTGTGTTTGGGTGGTCTGGTGTTGGTTGTTTT
T7_07356_G04	GTTGGGTTGGGGTGGTTGTCTGTTTTGTTTGTGGTG
T7_07357_G04	GGTGGTTTGGGGTTTGGGTCGTTGGGTTTTTTGGTT
T7_07358_G04	TTGGGTGGTGTTTTTGGGTCGTTGTTGGTTGTGTGG
T7_07359_G04	TGGTGTTTTTTGGGTGGGTCTGGGGTGGGTTGTTTT
T7_07360_G04	GGGGTTTTTGTGGTGGGGTCGTTGTTTGGTTTGTGT
T7_07361_G04	GTGGTTGGTGGGTGGTTGTCTGTTTGGTTGGTTGTT
T7_07362_G04	TTTGGGTGGGGTTGTTGGTCTTGTTTTGGGGTGGTT
T7_07363_G04	GTTGTGGGGTTTTTGGTGTCTTGGTTTGGTTGTGGG
T7_07364_G04	GGGGTGGTTTTTTGTGGGTCTTGTTTGGGGTTTGTG
T7_07365_G04	TGGGTTGTGGGTGGTTTGTCTTTTTGGTGGGTTGGT
T7_07366_G04	TTGGGGTTGGTGGGGTGGTCGTTTGTTTGGGTTTTT
T7_07367_G04	TTTTGGGGTGGTGTGGGGTCTTGTGTTTTTGTGGGT
T7_07368_G04	GGTGTTGGGTGGGTTTTGTCTTTTGGTGTGTGTGGT
T7_07369_G04	TGTGGGTTGGGTTTTTTGTCTGGTGGGTTGGGTTTG
T7_07370_G04	GTTTGTGTGTGTGGGTTGTCGGTTGGTTTTGGGTGT
T7_07371_G04	GGTTGTTTTTGGTTGGTGTCGTTTTGGTGGGGTTGG
T7_07372_G04	GGTTTTTTTGGTTTGTTGTCTGGGGTGGTGGGGTGT
T7_07373_G04	TGGGTGTTTGGTGGGGTGTCGGTTTTTTTTGGGTTG
T7_07374_G04	TGTGGTTTGGTTTGTTGGTCGGTGGGTTTGTTGGTG
T7_07375_G04	TGTTTTGGTGGTGGTGTGTCGTTTGTGGTTGGTTGG
T7_07376_G04	TGGTGGGTTTTTTTGGTGTCTGGTTGTGGGTGGTTG
T7_07377_G04	GGTGGTTTGTGGGTGTGGTCGGGTTTTGTGGTTTTT
T7_07378_G04	GTTGGGGTGGTGTTTTTGTCGTGTGTTGGTGTTGTG
T7_07379_G04	GGGTGGTTGGTTTGGTGGTCTTGGGGTTTGTTTTTG
T7_07380_G04	GGGTTGGGGTTTTTGTGGTCGGGGTGGGTTTTTTTT
T7_07381_G04	GTTTGTGTTGGTTGTTTGTCTTGGGGTTTGGGGTGG
T7_07382_G04	TGGGGTTTTTTGGGTTTGTCGGGGTGGTTTTGTGGT
T7_07383_G04	GTGGTGGTTGGTTGGGTGTCTTTTTGGGGTTGTGTT
T7_07384_G04	GTTTGGTGGTTGTGGTTGTCTGTGGGTGTTTTGTGG
T7_07385_G04	TTGTGTGGGGTGGGGTTGTCTGTTGGTGTTTGGTTT
T7_07386_G04	GGGGTTGTTTGGGGTTGGTCTTTTGGTTTGTGTTGG
T7_07387_G04	GTTTTGGGTGTGTTTGTGTCGTTTGGGTGGGTTGTG
T7_07388_G04	TTTGGTGGGTTTGGTGGGTCTTTTGGGTTTGGTGGT
T7_07389_G04	GTTGTTGTTGTTTGTGGGTCTGGGGTTGTGTTGGGT
T7_07390_G04	GGGGTGTGGTTGGTTTTGTCGGTTGGTTGGGTTTTT
T7_07391_G04	GGGGTTGGGTGTTTTGGGTCTTGGGTGTGTTTGTTT
T7_07392_G04	GTTTGGTTGGTTTTTTGGTCTGGTTGGTGGTGGTGG
T7_07393_G04	GGGTGTTGGGGTTTGGTGTCTGTTTTGGTTTTTGGG
T7_07394_G04	GGTGTGGGGTTGGTTTTGTCTGTTGTGTGGTGTTTG
T7_07395_G04	GGTGGGTTTGTGTTGTGGTCTTTTGTGGTGTGGGTT
T7_07396_G04	GGTTGGGTTTTTTGGTTGTCGGGTGGTGTTGGTTGT
T7_07397_G04	TTGGTTGGGGTTGGTGTGTCTGTTTTTGGTGGTGGT
T7_07398_G04	GGTTTTTGGTGGGTGTGGTCGTTGGGTTGTTTTTGG
T7_07399_G04	TGGGGTGTGGGTTTTGTGTCTGTTTGGGGTTGTTGT
T7_07400_G04	GGTTTGGTTGGTGGGGTGTCGTTTTTGGGGTGTTTT
T7_07401_G04	TGGGTTTGGGGTTTTTTGTCGTTGGGGTTTGGGTTG
T7_07402_G04	GGTTGGGTTTTTTGGTTGTCTGGGTGGTTTTGTGGG
T7_07403_G04	GGTTGTTTTTGGGGTTTGTCGGGGTGTTTTGTTGGG
T7_07404_G04	TTTTTTGGGTGGGTTGTGTCTTGGGGTGGTGTGGTT
T7_07405_G04	GGGGTTTTGTTGGGTTGGTCGGGTGTTGTTTTTTGG
T7_07406_G04	TGGTGGTTTGGTGTTTTGTCTTGGTGGTGTTGTGGG
T7_07407_G04	TGGGGTGTTGTTTTTGGGTCGTGGTTTGGGTGGTTT
T7_07408_G04	GGTGGGGTTTTGTTTGGGTCGTTTGTGGGTTTTTGG
T7_07409_G04	TTGGGTGGTTGGGGTTTGTCTTGGGTGGGGTTTTTT
T7_07410_G04	TTTGGGTTTGGGTGGGTGTCTTTGGTGTGGTTTGTG
T7_07411_G04	GGGGTTTTTTTTTGGGTGTCTGGGGTTGGTTTGGTG
T7_07412_G04	GGGTTTGGGTTGGTTTTGTCTTGTTGGTGTTGGGGT
T7_07413_G04	GGGTTTGGGGTGGGTGTGTCTTTTTTTGGGGTTTTG
T7_07414_G04	GGGTTGTTTGTTTGTGGGTCTTTGGGTGTTGGTGTG
T7_07415_G04	TTGGGGTGTTTGGGTTGGTCGGGTTTTTGGTGGTTT
T7_07416_G04	TGTTTTGGGGTGTTTGGGTCTTTGTGTTTGGGTGGG
T7_07417_G04	GGGTTGGTTTGGGTTTGGTCGGTTTTTTGGGTTGGT
T7_07418_G04	TGGTTTTTGGTTTTGTTGTCTGGTGGGGTGGGTGGT
T7_07419_G04	TTTTTTGTTTGGGGTGGGTCTTTTGGTGGGGTTGGG
T7_07420_G04	GTTTTTGGTGGGTTGTTGTCGGGTTGTTTTGGTGGG
T7_07421_G04	TGGGTGTGGTTGGTTTTGTCGGGGTTTGGTTTTGTG
T7_07422_G04	TTGGTGGGTGGGGTTTTGTCTGTTTGTTTGGTGTGG
T7_07423_G04	GGTGTTTTGTGTGTTGTGTCTTTTGGTGGGGTGTGG
T7_07424_G04	TGGTGGGTGTGGTGGTGGTCGTTTGGTTTGGTTTTT
T7_07425_G04	GTGTGGTTTTTGGTTTTGTCTTGGGGTGGTTGTGGG
T7_07426_G04	GGTGTTGTTGTGGGGTTGTCTTGGTGGTTGTGTTTG
T7_07427_G04	TGGTTGTTTTGGTGTTTGTCGGTGGTGGGTTTGGGT
T7_07428_G04	TTTTGGGTTGGTGGTTTGTCTGTTTGGGTGGTTGGG
T7_07429_G04	GGTTGTTGTTGGGGTTGGTCTGGGGTGGTTTGTTTT
T7_07430_G04	TTTTGTTTGGGTGGTGGGTCGTGGGGTGGTTTTTTG
T7_07431_G04	TTGGGTTTGGTTTTTGGGTCTGGGGTGGTGGTTGTT
T7_07432_G04	GGTTTGGGTGGTGGGGTGTCTGTTGTTTTTTGGTGT
T7_07433_G04	TGGTTTTTTGTTGGTGTGTCGTTGGGTGTTGGGTGG
T7_07434_G04	TGTGTTTTGTGGTTTGGGTCGTGGTTTGGGTGGTGT
T7_07435_G04	TTTTTTTTTGGTGGGTTGTCGGGGTGGGGTGGTGTT
T7_07436_G04	GTGGTGGGGTTTTTTTTGTCTGGGTGGGTGGGTTTT
T7_07437_G04	TGGGTGGGGTTGGGTTGGTCTTTTTTTTGGGTTGGT
T7_07438_G04	GGTGTTTTTTTGGGTGGGTCGTGGGTTGTTGGTGTT
T7_07439_G04	TGTTGGTTTGGGTGTGGGTCTTGGTTTGGGTTTGGT
T7_07440_G04	TGGGGTGTGGGTTGGTTGTCTGGGGTTTTTGTTTTG
T7_07441_G04	TTTGGGTGGTGTTGTTGGTCGTTGTGGTTTTGTGGG
T7_07442_G04	GGTGGGTTTGGGTTTTTGTCTTTTGGGGTGGTTGGT
T7_07443_G04	GGGTTGGTTTTTGGGTTGTCTGTGGTTTGGGGTTGT
T7_07444_G04	TTTTGGGGTTTTTGGTTGTCTGGTGGTGGTTGTGGG
T7_07445_G04	TGGGGTTGTTGTTGGTGGTCGTTGGGGTTTTTGTTG
T7_07446_G04	GGTTGTGGGGTGTTGTGGTCGGTTTGGGGTTTTTTT
T7_07447_G04	TTGGGGTTTTGGGGTGGGTCGTTTGTTTTTGTGTGG
T7_07448_G04	TTGTTTTTTGTTGGTGGGTCGGTTGGGTGTGGGGTT
T7_07449_G04	TGTTTTGTGGTGTTGGTGTCGGGTGGTGGGGTTTTT
T7_07450_G04	TGGTGTTGTTTTGGGGTGTCGGGTTGGTTGGTTTTG
T7_07451_G04	GTTTTGTTTTGGTGGTGGTCGGGTGTGTGTTTTGGG
T7_07452_G04	GGTTTTTGGGTTTGGTTGTCGGGTGTGTGTTTGGGT
T7_07453_G04	TGGTTTGTTGGGTTTGGGTCGGTTGGTGGGGTTTTT
T7_07454_G04	GGGTTTGGGGTTTGGGTGTCGGGTTTTGGTTTTTTG
T7_07455_G04	TGGTGTGTGTTTTGGTGGTCTGGTGGTTTGGTGGTT
T7_07456_G04	GTGTGGTGTGTTTGTTTGTCGGTTGTTTGGTGGGTG
T7_07457_G04	TGTGTGGTGGTGTTGGGGTCTTTGTTTGGTGTTTGG
T7_07458_G04	TGGTGGTTTGTGGGTTGGTCTTGGTTTGGGGTTGTT
T7_07459_G04	GGGGTTTTGTTGTTTTTGTCTGGGGTGGGTGGGTTT
T7_07460_G04	TGTTTTTTGGTGGTGTTGTCGGGGTTTGGGTGGTTG
T7_07461_G04	TGTTGGGGTTGGGTTTGGTCGTGGGGTTTTTTTTGG
T7_07462_G04	TGGTGGGGTTTGGGGTGGTCGGGTTTTTTTTTGTTG
T7_07463_G04	GGTTTTTTTTTTGGGGTGTCTTGTGGGTTGGGGTGG
T7_07464_G04	TTGTTGGGGTTGGTTGTGTCTTGGTTGGTTTGTGGG
T7_07465_G04	GGTGTTTTGGTGGGTTTGTCTGTTGGGTTGTTTGGG
T7_07466_G04	TTTGGTGGGGTGTTGTGGTCGGGGTTTTTGGGTTTT
T7_07467_G04	TTTTTTGGTTGGGGTTTGTCTGGTTGGTGGGTGGGT
T7_07468_G04	GTTTGTTTGTGTGTGGTGTCGTTTTGGGGTGGGTTG
T7_07469_G04	TGGGGTGTTTTGGGTTGGTCGGTTTTGTGGGTTTTG
T7_07470_G04	TGTTTTGGGGTGGTTTGGTCGTGTGTGTTTTGGGGT
T7_07471_G04	GGGGTTTTGGGTTTTGTGTCGGTTGTGGTTGTGGTT
T7_07472_G04	GGTTTGGGTTTTTGGGTGTCTTGGGGTTGTTGGGTT
T7_07473_G04	GTGTTTTTTGGGGTGGTGTCTGTTTTGGTGGGGTTG
T7_07474_G04	GGGTGGGTGTTTTGTGGGTCTTTTGGGTGTTGTTTG
T7_07475_G04	TTGGTTGTTTGGGGTTGGTCGTGTTTTTTGGGGTGG
T7_07476_G04	TTTTGTGTGGGGTTTGTGTCTGTGTTGGGTGTTGGG
T7_07477_G04	TTTTTGGGTTGGTGGTTGTCTTGGTTGTGGGTTGGG
T7_07478_G04	GTTGTGGGGTGGTTTTGGTCGTTGGTTTGGTTGTGT
T7_07479_G04	GGTTTGGTTTGTGGTTTGTCTGGTTGTGTGGGTGTG
T7_07480_G04	TTGGTGGGGTTGTTGGTGTCGGGTTTTGGTTTGGTT
T7_07481_G04	GGGTTTGGGTGTTTTGTGTCTTTGGTTGGGTTGGGT
T7_07482_G04	GTGTTGGTTGGGTTTTGGTCGGGTTGGTTTTGTTGG
T7_07483_G04	TGTTTTTTGTGGTGGTGGTCGGTTTGGTGGGTTGGT
T7_07484_G04	TTTTTGTGGTGGGTGGGGTCTTTTGGTTGGTGGGTT
T7_07485_G04	TTTTGGGTTTGTGGGGTGTCGTTGTTGGGGTTGTGT
T7_07486_G04	GGGGTTTGGTGTGTGGTGTCTTGGGGTGGTTTTTTT
T7_07487_G04	GGTGTGGTTGTTTTTGTGTCGGGGTGGTTGGTTTTG
T7_07488_G04	TTTGGTGGGGTGGTTGGGTCTTGTGTTTTTGTGGTG
T7_07489_G04	GTGTTTTTGGTGGTTGTGTCGTTGGGTTGGGGTGTT
T7_07490_G04	GGGTGGGGTTTTGGTTGGTCGTTTGTTTGGGGTTTT
T7_07491_G04	TTGGGTGTTGGGTGTTTGTCTGGTTGGTTGGTTTGG
T7_07492_G04	GTGGGTTTTGGGTGGTTGTCGGGTTGGGTTTTGTTT
T7_07493_G04	TGGGTTTGGTTTTTGTGGTCGGTGGGTTGGTTGGTT
T7_07494_G04	TTGGGGTGTTGGTGTTGGTCTGGGGTTTTTGGTTTG
T7_07495_G04	GTGTGGGTGGGTGGTTTGTCGGGTTTGGTTTTGTTT
T7_07496_G04	GTTTTTTTGGGGTTTGGGTCGTTGGTGGGGTTGGTT
T7_07497_G04	GGTGTGGTTGTGGGTTTGTCTTTGGTTGTGTGGTTG
T7_07498_G04	GGGTGGTTTGGGTTTTGGTCTGTTTTGGGTTGGTTG
T7_07499_G04	TGGGTTTTTGGGTTTGGGTCTTTGGGTTGGGTGTTG
T7_07500_G04	TTGTTTGGGGTTTTGTGGTCGGGTTGTGTGGTTTGG
T7_07501_G04	TGGGTTGTGTGGTTTTTGTCGGTGTGGGTGTTTGTG
T7_07502_G04	GTTTGGTTTTGGGTGGGGTCTTGGGGTTTTGGGTTT
T7_07503_G04	GGGGTGTGGTGGGTGGTGTCTTTTTTTTTGGTTGTG
T7_07504_G04	GTTGGGGTTTTTTTTGGGTCGGTTTGGGTGTTTGGG
T7_07505_G04	GGTTGTGTTGGTTGGTGGTCGTGTGGTTTGGGTTTT
T7_07506_G04	TTTGGGTGGTGGGTTTTGTCTTTGGGTTGGGTGTTG
T7_07507_G04	GTGTTGGGTGGGTGGGTGTCTTGGTGTTGTTTGTTT
T7_07508_G04	TTTGTGGTGGTTGGGTTGTCTGGTGTTTGGTGGTGT
T7_07509_G04	TTTGTGTTTGGGTTGGTGTCGGGGTTGGGGTGTTTT
T7_07510_G04	TTGGGTGTGTTGGTGTGGTCTTGGTGGGTTTGGTTT
T7_07511_G04	GGGTTTTGGGTGGTGTGGTCGGGTTGTTTTTTTTGG
T7_07512_G04	GGTGTTGGTTTTTGTTTGTCTGGGGTTGGGGTTTGG
T7_07513_G04	GTGTTTTTTGGGGTTGGGTCGGTGGGGTTGTGTTTT
T7_07514_G04	TTGTGGTGGGTTTTTGGGTCTGGGGTTGTTTTGGGT
T7_07515_G04	TGGGGTTGGGTTGGTTTGTCTGGGGTTGGTTTTTGT
T7_07516_G04	TTGTGGTGGGTGTGGTTGTCTTTGGTTTTTGGGTGG
T7_07517_G04	TGGTGGGTGTGGGGTTTGTCGTTTTGGGTTTGTTTG
T7_07518_G04	TTTGTTTTGGTTGGTGGGTCGGGTTGGTGGGTTTTG
T7_07519_G04	TTGGTTGGTGGGTTGGTGTCTGTGGGTTTGTTTGGT
T7_07520_G04	TTGTGGGTTTTGGGTGGGTCGGTTGGTGGTTGTTTT
T7_07521_G04	GGGGTTTTGTGGGGTTTGTCTGGTTTTTTGGGGTGT
T7_07522_G04	TGGTGGTGTTTGGTTGGGTCGTTTTTGGGTGTGTTG
T7_07523_G04	GGGTTTTGTGGTTTGTTGTCGTTTTGGTGGTGGGTG
T7_07524_G04	GGGTTGGTTTGGTTGGTGTCTGTTTGGGTGTTTGGT
T7_07525_G04	TTGTTTTGTGGTGGGTTGTCTGGGGTGGGTGTTGTT
T7_07526_G04	GGGGTTTTTGGTTGTTGGTCTTGGTGGTGTGTGTGT
T7_07527_G04	GGGGTGGGGTGGTTTTTGTCGTGTTTTGGTGTGTTT
T7_07528_G04	TGGGGTTTTGGGGTTGGGTCTTTTGGTTTGTGTGTG
T7_07529_G04	GGGGTGTTTGTGGGGTGGTCGTTTTTGGTTTGGTTT
T7_07530_G04	GTGTGTGGGGTGGTTGTGTCTTTTGTTTTTGGTGGG
T7_07531_G04	TTTTGGGGTGGGTGGTGGTCGGGTTTTTTTTTTGGG
T7_07532_G04	TTGTGGGTTTTGGTGGTGTCTGGGTGGTTTTTTGGG
T7_07533_G04	TGGTGTTTTTGGTGTGGGTCGTTGTGGTGTTGTGTG
T7_07534_G04	GGTGTTTGGGTGGGTGGGTCTGGTTGTTTTTGTTTG
T7_07535_G04	TGTTGTGGTGTGGGTTGGTCGGTGGTTTGTTTGTTG
T7_07536_G04	GTTTGGGTTTTGGTGGGGTCTTTGGGGTGGTGTTTT
T7_07537_G04	GGGGTGTTGGTTTGTGTGTCTTGGGGTTGTTTTTGG
T7_07538_G04	GGTGTTGTGGTGGTTTTGTCTTGGTTGTGTTGGGGT
T7_07539_G04	GTTTTTGGGTTTTGGTGGTCTGTGGTGGTGGGGTTT
T7_07540_G04	TGTGGGTTTGGGTGGGTGTCTTTTGTTGGGTTGGTT
T7_07541_G04	GGTTTTTTGGTGGTTTTGTCTGGTTTGGGGTGGGTG
T7_07542_G04	GGGTTTGGGTTGTTGGGGTCTTTGTGTTGTGGTTTG
T7_07543_G04	GGGGTGGGGTTTGTTTTGTCGTTTTGTGGTTTTGGG
T7_07544_G04	GGTGGGGTTTTGGGTGTGTCGGTTGTTTGGTTGTTT
T7_07545_G04	TGGGGTTTGGGTTTTGGGTCTTTTGGGGTTGGGTTT
T7_07546_G04	TGGGTGTTGGTTGGTGGGTCTTTGGTGTGTTTGTTG
T7_07547_G04	TGGGTTTGGGGTTTGTGGTCTTTGTTGGGTGGGTTT
T7_07548_G04	GTTGTTTGTTGGTTTTGGTCGGGTTTGGGGTGTGGT
T7_07549_G04	TTTGGGTGGGGTTTTGGGTCTTTTGGGTGTGGGTTT
T7_07550_G04	GGGTTGGGTGGTTTGGTGTCTGTGTTTTTGTTTGGG
T7_07551_G04	GTTTTTTTGGTTTTGGGGTCGTGTGTGGGGTGGGTT
T7_07552_G04	GGTTGGGGTTGGGTTGTGTCTGGTTGTTTTTTGGGT
T7_07553_G04	GGGGTTTGTGGGGTGTTGTCTTGTTTGTTGGTTGTG
T7_07554_G04	GGGTTTTTGTTTGGGTGGTCTGTTGGGGTTGGGTTT
T7_07555_G04	GGGTTTTTTGTTTTGGTGTCGGTGGTTGGTGTTGGG
T7_07556_G04	GTGTTGTTGGTTGGGGTGTCTGGGTGGTTGTTTTTG
T7_07557_G04	TGTTTGGTTGGTTTGTGGTCGTTTGTTGGGGTTGGG
T7_07558_G04	GGGGTTTGGTGTTTTTGGTCGTGTTGGGGTTGGTTT
T7_07559_G04	GGGTGTTTTTTTTGGTGGTCGTTGGGTGTTGGTTGG
T7_07560_G04	GTTGTTGGGGTTTGTGGGTCTGGTTGGTTTGTTGGT
T7_07561_G04	GGGGTGTTGGGTTTTTGGTCGTTGTGGGTTTTGTTG
T7_07562_G04	TGTTTTTGGGTTGGGGTGTCGGGTTTTGTGGGGTTT
T7_07563_G04	GTGTTGTGGGGTTTTGTGTCGGTTGTTTTTGGTGGG
T7_07564_G04	GGTTGGTTTTGGTTGTGGTCGGTGTTTGGGGTTGTT
T7_07565_G04	TTTTTGGGTGTTGGTGTGTCTGTGGTTGGTGGTTGG
T7_07566_G04	TGGTTTGGTGTTGGTTTGTCGGGTTGTGGTTGTGTG
T7_07567_G04	TTTTGGTTTGGGTTTGTGTCTGGGGTGTGGGTTTGG
T7_07568_G04	GTGGGGTGGTTTGTTTTGTCGGGTTTTTGTTGGTGG
T7_07569_G04	GGTGGGGTGGGTTTTTTGTCTTGTGTTGGGGTTTTG
T7_07570_G04	TGGGGTTTGGTTTTTGGGTCGGTGGTTTGGTTGTTG
T7_07571_G04	GGTGTGGGTGTTGGTGGGTCGTGTTGGTTGTTTTTT
T7_07572_G04	TGGTTTTTGGGTTTGGTGTCTGTTTGGGGTTGTGGG
T7_07573_G04	TTTGTTTTGGGTTGGTGGTCTGGGGTTTGTTGGGTG
T7_07574_G04	TTGTGTTTGGGTTTGGGGTCTTGGGTGGTTGGTGTT
T7_07575_G04	TGTGTGGTGGTTTTGGTGTCTGTGGTTGGGTGTTTG
T7_07576_G04	GTTTGGGGTTGGTTTTGGTCTGTTGTGGGTTTGGTG
T7_07577_G04	TTGTTTTGGGGTTGTGGGTCTTGTTTGGGGTTGGGT
T7_07578_G04	GGGGTGTTTTGTTTTGGGTCGGTTTGTTGTGTGGGT
T7_07579_G04	GTGTGGGGTTTGGGTTGGTCGTTGTTGTTGTTGGTT
T7_07580_G04	GTGTGGGTTGGTGTTTTGTCGTTGGTTTTTGGGGTG
T7_07581_G04	TTTGTTTGTGTGGGTTTGTCTTGTTGGGGTGGTGGG
T7_07582_G04	GGGGTGGTGTTGGGGTTGTCTTTGGTGTGTTTTTGT
T7_07583_G04	TTGGTTTTGGGTTGGGTGTCTTGTTTGGGGTGTGGT
T7_07584_G04	GGGTTGGTGGGTTTTTGGTCGGTTTGGGTTTTTTGG
T7_07585_G04	GTGTTTGTTTTGGTGTTGTCTTGGTGGTGGGGTTGG
T7_07586_G04	GGGTGGTTGGTGGTTTGGTCGGTGTTTGTTTGTTGT
T7_07587_G04	TGTTTTTTGGGGTTTTGGTCGTGTGTTTGGGGTGGG
T7_07588_G04	GGTTGTGTGGGTTTGGGGTCTTTTTGTGGGTTTTGG
T7_07589_G04	TGTGGGGTGTTGGTTGGGTCTTTTGGGTTTGTTTGG
T7_07590_G04	GGGTGTTGTTTGTTTGGGTCTGGTGGGTGGTTTTGT
T7_07591_G04	GGGGTGGGTTGTTGGTGGTCTGTTTGTGTTTGTTTG
T7_07592_G04	TTTGGGGTTTTGGGGTTGTCTTGTTTTGGGGTGGGT
T7_07593_G04	GGGTGGTTGGTTTTGTTGTCGGTTTTGTTGTGGGTG
T7_07594_G04	GTTGGTTTTGGGGTGGGGTCGTGTTTTGTTTTGGGT
T7_07595_G04	GTTGGGGTTTGGTGGGTGTCTGTTGGTTTGGTTTGT
T7_07596_G04	TTTGTGGTGGGTGTGGGGTCGTTTGTGTTTTGTGGT
T7_07597_G04	GTTTTGGTGTTTGGGGTGTCTTGGGGTTTGGGGTTT
T7_07598_G04	GGGGTGGGTGTGTTGTTGTCTTGTTTGTGTTGGGTT
T7_07599_G04	GGTTTTGGGTTTGGGTGGTCGTTTTTGTGGTTTGGG
T7_07600_G04	TGTGGTGGTTGTTGTGGGTCTGTGGTTTGGTTGTTG
T7_07601_G04	GTTTGGGGTTTTGTTGGGTCGGTGGTTTGTTGGGTT
T7_07602_G04	TGGGTGTTGGTTGTGGGGTCTGGGTTTTTTGTTGTG
T7_07603_G04	GGGTTTTTGGTTGGGTTGTCTTTTTGGGTGGGTTGG
T7_07604_G04	GTTTTGGTTGTGGGTTGGTCGTGGTTTTGGTGTGTG
T7_07605_G04	GTGGTTTGTTTTGGTTGGTCGTGTTTGGGTGGGGTT
T7_07606_G04	GGTTTGGGTTTGGGGTTGTCTGGTGTTTGTTTGGTG
T7_07607_G04	TTGGTGTTTTGGGGTGGGTCGTTTGGTGTGTTTTGG
T7_07608_G04	GGTTTGGTGGGTGGTTGGTCGTGGGTGTTGTTTTTT
T7_07609_G04	GTGTGTTTGTGTTTGGGGTCTTGTGGTTGGGGTTGT
T7_07610_G04	TTGTTTGGGTGGTGTGGGTCGTGTGGGTTGGTTTTT
T7_07611_G04	GGTTGTTTGTTTGTGTTGTCGGTGGTGTTGGTGGGT
T7_07612_G04	TTGTGGTGTTTGGTGTTGTCGTGGTGTTGGTTGGTG
T7_07613_G04	GGGTTGGGGTGGGTTTTGTCTGTTGTTGTTGTGGTT
T7_07614_G04	TGGGTTGTTGGGTGTTTGTCTGTGTTGTTGGTGGTG
T7_07615_G04	GTTTTGGTTGTGTTGTGGTCGGTTTGTGGTGTGTGG
T7_07616_G04	GGGTGTTTGTTTTTTGGGTCGGTTTGGGTTGGTTGG
T7_07617_G04	TGGTTTGGTGGTGTTGGGTCTTTGGGTTGTGGTTGT
T7_07618_G04	TGTGGTGTTTGTTTTTGGTCGTTGTGTGGTGGGGTG
T7_07619_G04	TTGGGTGTGGGGTGGTGGTCTGTTGGTGGTTTTTTT
T7_07620_G04	TTTGTGGTGTGGGGTGGGTCTTTGTTGTTGGGTTTG
T7_07621_G04	GGGTGGTTGGGTGTTTGGTCGGTTGTGTTTTGGTTT
T7_07622_G04	GGTTTGGTTGGTGGTTGGTCTGTTTTGTGTGGTGGT
T7_07623_G04	TTTTTGTGTGTTGGGTTGTCGTGGGTGGGTGTTGTG
T7_07624_G04	GTGGGTTTTTGGTGGGTGTCTTTGGGGTGTTTTGGT
T7_07625_G04	GTGTTTTTGTTGGGTGGGTCGTGGTGTTTTGGGGTT
T7_07626_G04	GTGGTGTGTGGGGTGTGGTCTTGTGTTTTTGTGTTG
T7_07627_G04	TGTGTGGGTGGGTGGGTGTCTGTTTTGTTGTTTTGG
T7_07628_G04	GTGTGTGGTTTGTTTTGGTCGTTGGGTGGTGTTGTG
T7_07629_G04	TGTTGTGGTGTTGTGGGGTCTGTGTTTTGGGGTTGT
T7_07630_G04	TTGGTTTGTGGGTGGGTGTCGTGGGGTTTTGTTTTG
T7_07631_G04	TGGGTGTGGGTGTTGTGGTCTTGGGTTGGTGTTTTT
T7_07632_G04	TGGGTTGTTTGTTGGTTGTCTGGGTTGGGGTGTGTT
T7_07633_G04	TTGTGTTTGGTGGTTGTGTCTGGTGTGTGTTGGGGT
T7_07634_G04	GGGTGGGTTTTGTTTGGGTCGGGTGTTTGTTGTTGT
T7_07635_G04	TGTGTTTGGTTTTGGGTGTCGGGTTTTGGGTGTGGT
T7_07636_G04	GGGTTTTTGGTTGTGGTGTCTTTGTGTGGGTGGTTG
T7_07637_G04	GGTGTTGTGGTGGTGGGGTCTGTTGTTTTTGTTTGG
T7_07638_G04	TTTTGTTTGTGGGGTTTGTCTGGGTGGTTGGGTTGG
T7_07639_G04	TGTGTGTTTTGGTGTGGGTCTTTGGGTGGTGTGTGT
T7_07640_G04	TGTGTGGGTTTTTGGGTGTCGGTTTGGTGGTTGGTT
T7_07641_G04	TTGGTTTTTGGGTTTGGGTCGGTGGTGTGGTTGTGT
T7_07642_G04	TGTGGTTGGGGTTTGGGGTCTGTTTTTTTGGGGTTG
T7_07643_G04	GGTGTGTGTGGTTTTTGGTCTGTTGTGTGGTTTGGG
T7_07644_G04	GTTTGTGGGGTTGGTGTGTCGGGTGTGTGGTTTTTT
T7_07645_G04	GTGTGTTGGTGGTGTGGGTCGTTGTGTGGTTGTTTT
T7_07646_G04	TTTGGGGTTGGGTTTGGGTCGGGTTGGTTTGTTTTG
T7_07647_G04	GGTTTTGGTTGGGGTTGGTCTGGTTTTGTGTGTGGT
T7_07648_G04	TGGGGTTTTGTTTTGGGGTCTTGTGTGGTGGTGGTT
T7_07649_G04	GTGTTTGGGGTTTGTGTGTCGTTGTGGTTGTTGGGT
T7_07650_G04	GGGGTTTTGTTTGGTGTGTCGGTTTGTTTGGTTGGG
T7_07651_G04	TTTTGTTTTGGGGTTTGGTCGTTGGTGTGGGTTGGG
T7_07652_G04	TGGTTTGGTTGGGTGGTGTCGTTTTGGGGTTTTGTG
T7_07653_G04	TGTTTGTTGGGTTTGTTGTCGGGTGGGGTTTTGGTG
T7_07654_G04	GGTGGGTGGGTTGTTTTGTCGTTTTGTTGGGTTGGT
T7_07655_G04	GGGTGGTTTGGTGTTTGGTCGGTTTGGGTTTTGGTT
T7_07656_G04	GTTGGTTTTGGGTTTGTGTCTTTGGGGTTGGGGTTG
T7_07657_G04	TGTGGTGTTGTTGGTGGGTCTTTTGGGTGGTTTGGT
T7_07658_G04	TTGGGTGGGGTGGGGTGGTCGGGTTTTTTTTGTTTT
T7_07659_G04	TGGGGTTGTTTTGTTGTGTCTGGGTTTGTGGGTGGT
T7_07660_G04	TGGGGTGTTTGTGTGGTGTCTGGTGTTTTGGGGTTT
T7_07661_G04	GTGGGGTTTTGGTGGTTGTCTGTGGTTGGTTTGTGT
T7_07662_G04	GGTGTTGGGTTTTGTTGGTCGTTGTGGGGTTTTGGT
T7_07663_G04	GTTGGGTGGGGTTTGTGGTCTGTTTGGTGTTTGTTG
T7_07664_G04	TGTGTTGTTGGTTTGGTGTCGGTGGGTTTTGGTGGT
T7_07665_G04	TGTTGTGTGTTTGTGGTGTCTTGGGTTGGTGTGTGG
T7_07666_G04	GTTGGGTGTTTTTTTGGGTCTGTGGTTTGGGTGGTG
T7_07667_G04	TTGGTTGTGGTTGGGTTGTCTTGGGTGTTTTGGTGG
T7_07668_G04	GGTGTGTTTGGGTTTGTGTCGTGTTTGTGGGTTTGG
T7_07669_G04	TTTGTGGGTGGGTGGTTGTCTTTGGGTTGTTGGTTG
T7_07670_G04	GTGGGTGTGGTTTGTTGGTCTTTGGGTTGGTTTTGG
T7_07671_G04	GTGTTGGGTTGGGTGTTGTCGGTTTTGGTGGTTGTT
T7_07672_G04	TGGGTTGTTTTTTGGGTGTCGGGTTGGTTGGTGTTG
T7_07673_G04	TTTTGTGTGTGGGTGTTGTCGGTTGTGGGTTGTGTG
T7_07674_G04	GGGTTTGGGGTGGTGGTGTCTTTTTGTGGGTTTTTG
T7_07675_G04	GTTTTGTGGTGGTTGTTGTCGTGTGGGTGGTTTGGT
T7_07676_G04	GGGTGGGTTGGGTGTTTGTCTGTTTGTGTTTTGGTG
T7_07677_G04	TTTTTGTGTTTGGGTGTGTCTTGGGTGGTGTGGGTG
T7_07678_G04	GTGGGGTGGGTGTTTGTGTCGTTTTTGGTTTTGGTG
T7_07679_G04	GTTTGGGGTGGGTGTTTGTCGGTTTTGTGGTGTTTG
T7_07680_G04	TTGGGGTTGTGGTTGTGGTCGTTTTTTGGGGTGTTG
T7_07681_G04	GGGTTTGGTTGGTTGGTGTCGTTTGGGGTTTGTTGT
T7_07682_G04	GTGGTTGTTGTGGTGTTGTCTTTGGTTGTGGGGTGT
T7_07683_G04	TGTGTGGGGTTGGTTTGGTCTTTTGGGTTTGTGGTG
T7_07684_G04	TTTGTGTTTGTGTTTGGGTCGGTGTGTGTGTGGTGG
T7_07685_G04	TTGTTGGGGTTTGTTTGGTCGGTTTGTTGGGTGTGG
T7_07686_G04	GGTGGGGTTGTTGTGGGGTCGTTTGTTTGTGTGTTT
T7_07687_G04	GGGTTTTGTGGGGTGTTGTCTGGTTTTGGTGGGTTT
T7_07688_G04	GTTGTGTTGTGGGTTGTGTCGTTTGGTTGTGGTTGG
T7_07689_G04	TTTGGGTTTGTTGTTGGGTCTGGTTTGGGTTGTGGG
T7_07690_G04	TTGTGTGTTTGTGTTGTGTCGGTTGGGTTTGGGTGG
T7_07691_G04	TGTTTTTTTGGGTGTGTGTCGGTTGTGGGTGTGTGG
T7_07692_G04	TGGTTTGTGGGTTTTGTGTCTGTGGGTGGGTTGGTT
T7_07693_G04	GTTGTGTTTGGGTTGGGGTCTGGTGTGTGTTTGGTT
T7_07694_G04	GTGGGGTTTTTTGTGTTGTCGGTGGGTTGGTGTTTG
T7_07695_G04	GTTGGGTGGTTGGTTGGGTCGTTTTGGGTTTGTTGT
T7_07696_G04	GTTTGGGGTTGTGGTTTGTCGTGTTGGTTGTTGGTG
T7_07697_G04	GGTGTGTTGTGTTTTGGGTCGGTTTTGGTTGGGTTG
T7_07698_G04	TGTTGTGGTGTTGGGTTGTCTGGTGTTGGTGTTGGT
T7_07699_G04	TGTGGGTGTTTTGGGGTGTCGTGGGTGTTTTGTGTT
T7_07700_G04	TGGTGGTGGTTTTTGGGGTCTTTTGTTGGGTTGTGG
T7_07701_G04	TGGGGTGTTTTTGTTTTGTCGTTGGGGTTGGGGTTG
T7_07702_G04	TGTTGTGTTGGGTTGGTGTCGTTGGTTTTGTGGGGT
T7_07703_G04	TTTGGTTGGGTGGGTGTGTCTTTGGGTTTGGGTTTG
T7_07704_G04	GGGTGTTGTGTTGGGGTGTCTTGGTGTGTTTGGTTT
T7_07705_G04	TTGGGTTGTGTTGGGTTGTCGGGGTTGTGGTGTTTT
T7_07706_G04	GTTGGTTTTTGGGTGGTGTCTTTTTGGTGGTGTGGG
T7_07707_G04	GGTTTGTTTTTGTGTGTGTCGTGGGTTGGTTGGGGT
T7_07708_G04	GGGTGGTTTGGTTGTGTGTCTTTGTGGGTGTGTGTT
T7_07709_G04	GTGTTTTTTTTGTTGTGGTCTGGGGTGTGTGGGTGG
T7_07710_G04	GGTGTTTGGTTGTTGGTGTCTGGGGTTTGGGTGTTT
T7_07711_G04	TTTGTGGGGTGTGGTGGGTCGTGTTTTTTGTGTTGG
T7_07712_G04	TTTTGGTGGTGTTTGGGGTCTTGGTGTTGTTGTGGG
T7_07713_G04	GTGGGTGTTTTTTTTTTGTCGGGGTTGGGTTGGGTG
T7_07714_G04	GGGTGGGTGTTTTTTTGGTCTGGGGTTGTGTGGTTT
T7_07715_G04	TTGGTGGTGGTTTTTGTGTCGTGTTTGGGTTGGGGT
T7_07716_G04	GGGGTGTTTTTTGTTGTGTCGTGTTGGGGTGGTGTT
T7_07717_G04	GGTTGTTGGGTGTTTGTGTCGTGGGGTTTTTGTGGT
T7_07718_G04	GTTGGTTTTTGTTTGTGGTCGTTGGGTGGTTGTGGG
T7_07719_G04	TGTTGTGTGGTGTTGTTGTCGGTTTGGTTGGTGTGG
T7_07720_G04	GGTGTTGTTTGTGGGGTGTCTTTGTGGGTTTGGTTG
T7_07721_G04	TGGGTGGGTTTTGGGTTGTCGGTTGGGGTGTTTTTT
T7_07722_G04	GTGGTGGTTTGTTTGTTGTCGTGGGGTTTGTGTGTG
T7_07723_G04	TTGTGGGGTTGGTGTTGGTCGGTTGTTTGGTGGTTT
T7_07724_G04	GGGGTTGTTTTGTGGGTGTCGTTGGGTTTTTGGGTT
T7_07725_G04	TTGGTTGGGGTTTGGTTGTCTTGGGTGTTGGGGTTT
T7_07726_G04	GGGTTGGTTGGGTGGGTGTCTGTGTTGGTGTTTTTT
T7_07727_G04	TTGTTGTGGTGTGGTGTGTCGTTTTTGGGTGGGGTT
T7_07728_G04	TTTTTGGTGGGTTGGGTGTCTGTTGTTGTGGGTGTG
T7_07729_G04	GTTGTTGGGGTTTGGGTGTCGGGTTTGTTGTGTGTT
T7_07730_G04	TGGGGTGGTGTTGTTGTGTCGGGTGTTTGGTTTGTT
T7_07731_G04	TTTTGTGTGGTGGTGGTGTCTGGTTGTGTGGTTTGG
T7_07732_G04	GTGGTTGGGGTTTGTTGGTCGTTTTGGTGGTTTTGG
T7_07733_G04	TGTGGGTGGTGTTTTTTGTCTGGGGTGTTGTGTTGG
T7_07734_G04	GGTTGGTGTTTTGGTTTGTCTTGGGTGTTTGGGTGG
T7_07735_G04	GGTGTGTGTTGTTTGGGGTCTGGTTGGTTTTGTGTG
T7_07736_G04	GGGTTTTTGTGTGTGGGGTCTTTTTTGTGGTGGGGT
T7_07737_G04	TTGGTGTGTTGTGTGTGGTCTGTGTGGTTGGGTGTT
T7_07738_G04	TTGTGGGTTGGGGTGGGGTCGTTTGTTGGTTTTTTG
T7_07739_G04	TGGTGGTTTTTTTGGGTGTCGTGGTTGGGTTGGTGT
T7_07740_G04	GTGGTTGTGTGGTTTGGGTCGGTGTTTGGTTTTGTG
T7_07741_G04	GGGGTGTTTGGTTTTGTGTCTGTGTGGGTTTGGTTG
T7_07742_G04	GTGGGTTGGTTGGTTTGGTCTTGTGTTTTGGGTGGT
T7_07743_G04	GTGGGGTTGTTGTGTTTGTCTTGGGGTTTTTGTGGG
T7_07744_G04	TGTGGGGTTGGTTGTTTGTCGGGGTGGGTTTTGTTT
T7_07745_G04	TTGGGTGGTTGTTGTTGGTCGGTTGTTGGTTGGGTT
T7_07746_G04	TTTTTGTGGTGGGGTTGGTCGGGTTTTTGTTGGGGT
T7_07747_G04	TTTGGGGTTTTTGGTTTGTCGGGTTGGGTTGGGGTT
T7_07748_G04	TTGGGTGGTGGGGTTTTGTCGTTTTTGGTGTGTGTG
T7_07749_G04	GTTTGTTTGGGTTTGTTGTCGTGGGGTGTTTGTGGG
T7_07750_G04	GTTTTGGTGGTGTTTGGGTCTGGTGTTTTGTGTGGG
T7_07751_G04	TGGGTTTTTTTGGGGTGGTCGTGGTGGTTGGGTTTT
T7_07752_G04	GGTGGTTTGTGGGTGGTGTCGTTTTGTGTTTGTGGT
T7_07753_G04	TTTTTGGGTGGGTTGGGGTCTGGGTTTTGTGTGTTG
T7_07754_G04	GGTGTGTGGTTGTTTTGGTCGGGTTTTGTTGGTGGT
T7_07755_G04	GGGTTGTGGTGTTGTTTGTCGTGGGTGGTTTTGTGT
T7_07756_G04	TTTGGTTTGGGGTTTGGGTCTGTTGTGGGGTGTTTG
T7_07757_G04	GTGGTGGGTGTGGGTTGGTCTGTTTTGTTGGTTTTG
T7_07758_G04	TTGTGGGGTTTGTTTGTGTCTGTTGTGGGGTGTTGG
T7_07759_G04	GGGTGGGTTTTTGGGGTGTCTTTGGGTTTTGTTGGT
T7_07760_G04	TGTGTGTGTTTGTGGGTGTCGTGTTTGGGTGGTTGT
T7_07761_G04	GTTGTTGTTGTGGGGTGGTCTTTGGGGTTTGTGTGT
T7_07762_G04	GTTGTTGTGTTTGTGTGGTCGGGTGGTGTGTTTTGG
T7_07763_G04	GGTGTTTGGTGTTTTGTGTCTGGGTGGTGTTGGGTT
T7_07764_G04	GGTGGGGTGTGTGTGTTGTCTTTTGTTGGGGTTTGT
T7_07765_G04	TTTGGGTTTGTGGTTTTGTCGGGTTGTTGGTGTGGG
T7_07766_G04	GGTGTTGGGTTTGGTTGGTCTGTTGTTGGGGTGTTT
T7_07767_G04	GTTGTGGTGGTGTTTGTGTCTGTTGGGGTGTTGGTT
T7_07768_G04	GGTTTTTTGGTGGGTGTGTCGGTTGGTTGGGGTTTT
T7_07769_G04	TGTGTTTTGGTTGTGTTGTCGGGTGGTGTGGTGTGT
T7_07770_G04	GGTGTGTGTTTTGGTGGGTCGTGTTTTTTGTGGGTG
T7_07771_G04	TGTGTTGTTGTTGTTGTGTCGGGGTGGTGTTTGGTG
T7_07772_G04	GTTGTGGGTTTGTTTGGGTCGTGGTTGTGGTTTGGT
T7_07773_G04	TGGTTTGTGGGTTTGGGGTCTGGGTTTTTGGGGTTT
T7_07774_G04	GGTGGTTTTGTTGTGGTGTCGTTTGGTGTGTTGTGG
T7_07775_G04	GGTTTGTGGTGTGTGTTGTCTGGGGTTTTGTGGGTT
T7_07776_G04	GTTTGTGGGGTTGTGGGGTCTGTTGTTTTGGTTGGT
T7_07777_G04	GGGTTTTTTGTGGTTGTGTCGTTGTGGTGGTGGGTT
T7_07778_G04	TTGTTTGGGTGGTTTTTGTCTGGGGTGGTTGGGGTT
T7_07779_G04	TGTTTTGTTGTGGTGGTGTCGTGGGTGGGGTTGTTT
T7_07780_G04	GTTGTGGTGTGTTTGTGGTCGTGGGTGGGTGTTTTT
T7_07781_G04	TTGGGGTGGTTGGGTTTGTCGTTGTGGGGTTTGTTT
T7_07782_G04	GTGTTTGTGGGGTGGTGGTCGTTTTTTGTTTGGTGG
T7_07783_G04	GGTGGGGTGGTTTTTGTGTCGGGTGTTGTTTTGGTT
T7_07784_G04	GGTTGTTGGGTGTGTTGGTCTTGGGTTTTGTGTGGT
T7_07785_G04	TTGGTGGTGGGGTGTTTGTCTTTGTTGGGGTTGTTG
T7_07786_G04	GGGTGTTGTTGGGGTTTGTCGTTTGGGTGGTTTTTG
T7_07787_G04	TGTTGGGTTGTTTTTGTGTCGGTGGTGTTGGGTGTG
T7_07788_G04	TGGGTTGGGGTGGGTTGGTCTGTTTTTTGTGGTTTG
T7_07789_G04	GTGGTTGGGTGGGTGTGGTCTTTTTGGTTGGTTTTG
T7_07790_G04	GGGTTTTGTTGTTGTTGGTCGGGGTTTTGGTTTGGG
T7_07791_G04	GGGGTGTGTGGGTGGTTGTCTTTTTGGGGTTTGTTT
T7_07792_G04	TGTTTTTGGGTGGGTTTGTCTGGGTTGGGTGTTGTG
T7_07793_G04	GTTGTTGGGGTGGTTGGGTCTGTGTTTGTGTTTGGT
T7_07794_G04	TGGTTTGTTGTTTTTTGGTCGGTGGGGTGGGTTGGT
T7_07795_G04	GGGTTGTGTGGTTGTGTGTCTTGGTTTTGTGGGGTT
T7_07796_G04	GGGTGGTGGGGTTGTGTGTCTGTTTTTGTGTGGTTT
T7_07797_G04	TGGGGTGGTTGGGTGGTGTCGTTGTTGTTTTTGTTG
T7_07798_G04	GTGGGTGGGTTGTTTGGGTCGTGTTTGGTGTTTTTG
T7_07799_G04	TGTTGTTTTTGGGTTGGGTCGTGTTGGGGTGTTGGT
T7_07800_G04	TTTTGGTTTGTGGTGGTGTCGGGGTTGTGTGTTGGT
T7_07801_G04	TGTTTGGGTTTGGGGTTGTCTGGTGTTGGGTTTTGG
T7_07802_G04	GGTTGTGGGGTTTTGTTGTCGGGTGTTTTGTGGTGT
T7_07803_G04	GGGTTTGTTGGGGTGGGGTCGTTTGGTTTGTTGTTT
T7_07804_G04	GTTGTGTGTTGTTTTGGGTCTGTTGTTGGGTGGGGT
T7_07805_G04	GGTTGGGTTTTGTTTTGGTCTTGGTGGGTGTGTGTG
T7_07806_G04	TTTTGGTTGGTTGTTTGGTCGTGGTGTGTGGGTGGT
T7_07807_G04	GTTTTGGGGTTTGTGGGGTCGTGTTGTGGTTGTGTT
T7_07808_G04	TGGTGTTGTTTTTTTGGGTCGGTTGGGGTGGGTTTG
T7_07809_G04	GGGTGGGGTTTGGGGTTGTCTTTTTTTGTGGTGTGT
T7_07810_G04	GGTGGTGGTTTTTTTGTGTCGGGGTGGTTTGTTGTG
T7_07811_G04	TGTGGTGTGGTTTGTGGGTCTTTTGGTTGGGTTTGG
T7_07812_G04	GGTTTTTTTGTGGGTTGGTCGTTGGTGGGTTGTGGT
T7_07813_G04	GGGTTGTTTTGTTTGTGGTCTTGTTGGGGTTGTGGG
T7_07814_G04	TGTGGTGTGGGTTTTTTGTCTGGGTTTGGGTTGGTG
T7_07815_G04	TGGTTTTGTTTGTGGGTGTCGGTGGGGTTTGTTTGG
T7_07816_G04	GTTGGGTTGTTTGTTTGGTCGTGGTGTTGTGTGGTG
T7_07817_G04	TTTTGTGGTGGTTTGGGGTCGTTGGTGGGTTTGGTT
T7_07818_G04	GTTTGTGGGGTGGTTGTGTCTTTTGGTTTGGGGTGT
T7_07819_G04	GGTTTGGTGGGTTGGGTGTCTGGGTTTTTTTGTGTG
T7_07820_G04	TGGTGGTTTGGGGTGTTGTCTGTTGGTTTGTTGGTG
T7_07821_G04	GTGTGGGGTGTTGGTTGGTCGTTTTGGGTTTGTTTG
T7_07822_G04	GGGTTTGGTTGTGGGTGGTCTTGGTGTTGTTGTTGT
T7_07823_G04	GGTTGTTTGGGGTGTTTGTCTTTTTGTGGTGGGGTG
T7_07824_G04	TGTTTGGGGTGTTTTTGGTCTGTGGGGTTGGTGTGT
T7_07825_G04	GGTTGTGTGTGGTGTTTGTCTGGGTTGGTTGTTGGT
T7_07826_G04	TGTTTGTTGTTGGGTGGGTCGTGGTGGTGTGTTTTG
T7_07827_G04	TGGGGTGTGTGTTTGTTGTCTTTTGGGGTGGTTGTG
T7_07828_G04	GGTGGGTGGTTTGGTTTGTCGTGGTGTTTTTTTGGG
T7_07829_G04	TTTTGGGTGGGGTGTGGGTCTGGTGTTGTGGTTTTT
T7_07830_G04	GTGTGTTGGTGGGTGGTGTCGGTTGGTGTTTTTTTG
T7_07831_G04	GTGTGGTGGTGTTTTTTGTCTTTGGTGGGTGTTGGG
T7_07832_G04	TGGGTTTGTTTGTTGGGGTCTTTTGGGTGTGGTTGG
T7_07833_G04	TGTGGGTGGGGTGTGTTGTCTGTGTGGTTTTGTGTT
T7_07834_G04	TGTTTGTGGGTTGTTGGGTCGTGTGTTGTGTGTGTG
T7_07835_G04	TTGGGTGTGTTGTTGGGGTCGTGGGTTTTTTGGGTT
T7_07836_G04	GGGTGGTTTGTGGGTTTGTCTTTGTTTGGTGTTGGG
T7_07837_G04	TGTTGGGTTTGGGTTTTGTCGTTTTGTGGTGGTGGG
T7_07838_G04	TGTTTGGTGGGGTTTGTGTCTGGGGTTTTGGGTTGT
T7_07839_G04	GTTGTGTGGTTTGGTGGGTCTTGGGGTGGTTTGTTT
T7_07840_G04	GTTGGTTTTGGGGTTGTGTCGTTGGTTTTGTGGGTG
T7_07841_G04	TTGTGTGGTTTGTGGGTGTCGTGGTTGGGTTTTGGT
T7_07842_G04	GTGTTTTTGTGGTGGGTGTCTGGGTTTTGGTGGGTT
T7_07843_G04	GGTTTGGGGTTTGTTGGGTCGTTGTGTTGGGTGTTT
T7_07844_G04	TGGTTTGTGGTGTTTTTGTCGGTTTTGGTGGGTGGG
T7_07845_G04	TTTGGTTGTGGTGGGTTGTCTGTTGGGTTTTGTGGG
T7_07846_G04	GGTGTTTTTTTTGTGTTGTCGGGTGGGGTGTTGTGG
T7_07847_G04	GGGTTTGGGTTGTGTGTGTCGTTGTTTGGGTGGTTT
T7_07848_G04	GTTGGGTTGGGTGGTTGGTCTTTGTTTGGGTGGTTT
T7_07849_G04	TGGGTGGGTTGTGTTTGGTCGTTTTTGTTGGTGTGG
T7_07850_G04	TTGGTGTTGGTGGGTGGGTCTGTGTGGTTGTTTTGT
T7_07851_G04	GTTGTGGGGTTGGTGGTGTCTTTGTGTTTGGTTTGG
T7_07852_G04	TTGGGTGGGGTGGTGGTGTCTTGTGGTTGGTTTTTT
T7_07853_G04	GTGTTTGTGGTGTTTTGGTCGTGTTGGGGTTGTGGT
T7_07854_G04	GTTTTGGTGTTGTGGTGGTCTTGGTTGGTGTTTGGG
T7_07855_G04	GGGGTTTGTTGGTTTTTGTCGTTTGGGTGGTTTGGG
T7_07856_G04	TGTTTGGGTTGTTGGTGGTCTGGTGTGGTTTTGTGG
T7_07857_G04	GGTGTTGGTTTTTGTGTGTCGTTTTGGGTGGGGTTG
T7_07858_G04	TTGTTGTGGTGGTGGGTGTCGTGTTTTTGGTTGGGT
T7_07859_G04	GTTGGGTTGTGGGTTGGGTCTTGGTGTGGGTTTTTT
T7_07860_G04	GTTGGGGTTGGTTTGTTGTCGTTTTGGTTTGGTGGG
T7_07861_G04	GTGTTGGGTTTGTGTGTGTCTTTTTTGGGTGGTGGG
T7_07862_G04	GTTGTTGTGGTGTTGGGGTCTGGTTTTTTGTGGGTG
T7_07863_G04	GGTTTGTGTTGTTTTTGGTCGGGGTGTGGGTGTTGT
T7_07864_G04	TTTGGGGTTGTTGTTTTGTCGGTTTGGGGTGGGGTT
T7_07865_G04	GTGTTGGGTGGTTGTGTGTCTGGTTGGTGTTTGTGT
T7_07866_G04	GGTTTGTGTGTTTGTGGGTCTTTGGGTGGTGTGTGT
T7_07867_G04	GGGGTTTTTTGGGTGGTGTCGTTGGTTGGTGTTTTG
T7_07868_G04	TTGGGTGTTTTGTTTGTGTCTTTGGGGTGTGGGTGG
T7_07869_G04	TGGGTGGTGTGTTGGTTGTCTTGTTTGGTGGGTTTG
T7_07870_G04	GGGTTGTGGGTGGGTTTGTCTGTTTGGTTTTTTGGG
T7_07871_G04	GGTGTTGGGTTGGTGGGGTCTTTTGTTTTGTTGGTG
T7_07872_G04	GTGGTTGGTGGTTGGTTGTCTGGTTGTTTGTTTGGG
T7_07873_G04	GGTGGTGTGTTGTGTGGGTCTTTTTTTGTGGTGTGG
T7_07874_G04	GTGTTGTTGGTTTGGGTGTCTTGTTTGGGGTGTGGT
T7_07875_G04	TGGGTTGTGGGTGTTTGGTCGGTTGTTGTTTGGTTG
T7_07876_G04	GGGTTGTTTTGTTTTTGGTCTTGGGTGTGGTGGGTG
T7_07877_G04	TTTGTTGGTGGGGTGTGGTCTTGGTTGTGTTGGGTT
T7_07878_G04	TTTTGTTGGTGTGTGGTGTCTTGTGGTGTGGTGTGG
T7_07879_G04	TGTTGGGTGGGTTGGTTGTCTTGGTGGTTTGTGGTT
T7_07880_G04	TTGGTGGTTTTGGGTTGGTCTGGGGTGTTTTTGGTG
T7_07881_G04	GTTGTGGGTGGTGTTGTGTCTTGTGGTTGTTTGGTG
T7_07882_G04	GTTGTGGTTTTGGTGTGGTCGGTGGGGTTTGTTTTG
T7_07883_G04	TTTGGGGTTGTGTGGGTGTCGTGTTTTGGTTGGTGT
T7_07884_G04	TGGTTGTGTGGGGTTTGGTCTGTTTTTGGTTGGGTG
T7_07885_G04	TGTGGTGTTTGGGGTTTGTCGGTTTTGTGGGTGTTG
T7_07886_G04	TTGGGGTGGTTTTGGTTGTCTGGGGTTTGTTGTTGG
T7_07887_G04	TTTGGGTGTTTGGGGTGGTCGGGTTGGGTTTTTTTG
T7_07888_G04	TTTTGTGTTTTTGGGGTGTCGTGGGGTGTGGTTTGG
T7_07889_G04	GGTGTTTTGGTTTTTGTGTCTGGGGTTGGTTGGGTG
T7_07890_G04	TGGGTGGTTGTTTTTTGGTCTGTGGGGTGTTGGTGT
T7_07891_G04	TGGGTGTTTGTTTTGTTGTCGTGGTTTGGTGGGTGG
T7_07892_G04	GTGGTGGTGGTGTTTTGGTCGGTTTGGGGTTTGTTT
T7_07893_G04	GGTGGTGGTGTGTTGTTGTCTGTTGGTTGTGTGGTT
T7_07894_G04	GTTGTTGTTTTTTGGGTGTCGGTGGTTTGTGGTGGG
T7_07895_G04	GGGTGTTGGGTTTGGTGGTCTTGGGGTTTTTTGTTG
T7_07896_G04	TTGGTGGTGGGTTTTTGGTCGTTGGTTGTGTGGTGT
T7_07897_G04	GGTGGGTGGGTTTGTGTGTCTTTGGTGTGGTGTTTT
T7_07898_G04	GGTGTGGTGTTGTTTTTGTCTGGGGTTTGGTTTGGG
T7_07899_G04	GGTTTTTTTGGGGTGGGGTCGGTTTGTTGTTTGTGG
T7_07900_G04	GTTGGTGGTGGTTTGTTGTCTGGTTTGGTTGTTGGG
T7_07901_G04	TGGGTTTTTGGGGTTTTGTCTGGGGTTTTTGGTGGG
T7_07902_G04	GTGTGTGTTTGGGTGGTGTCTTTGTGTGGTGGTTGT
T7_07903_G04	TGGGTGTTGGGTTTTGGGTCTTGTTTTTTGGGGTGG
T7_07904_G04	TTGTTGTGTGGGTGTTTGTCGTTGGTTTTGGGGTGG
T7_07905_G04	TGGTGGGTGGGTGGTGTGTCTGGTTTTTGGGTTTTT
T7_07906_G04	GGTGTGTTTTTTGTGTGGTCGGTTTGTTTGGGTGGG
T7_07907_G04	GGGTGGGTTTTTTGTGGGTCTGGTTGGGTTGGTTTT
T7_07908_G04	GGGTGTTGGGGTTTGGTGTCTTTTGGGGTTGGTTTT
T7_07909_G04	GTTTTTTGGTTTGGGGTGTCGGTGTGTGTTGGTTGG
T7_07910_G04	TTTTTGTTGGGGTTGTGGTCGGTGGGTTGTGTGGTT
T7_07911_G04	TTGTTGTGGGTTTTTGGGTCTTGTGTGGGGTGGGTT
T7_07912_G04	TTTGGGTTGGGTGTTTGGTCTTTTGGTGGTGGGGTT
T7_07913_G04	TTGTTGGTTGGGTTTGGGTCTTGTGTGGTGGGGTTT
T7_07914_G04	GGGTTTGGTTTTTTGTGGTCGTTGGGTTGGGGTTTG
T7_07915_G04	TGGGTGTTTGTGTGGTTGTCGTTTTGGGTGTTTGGG
T7_07916_G04	GGTGGTTGGTTTTGGTTGTCTGTGGGGTGTTTTGGT
T7_07917_G04	GGTTGTGTGGTGTTGGTGTCGTTTTTTTGGGGTGTG
T7_07918_G04	TGTGGTTGGTTTGGTTGGTCTTTTGTGGGTTGGTGG
T7_07919_G04	TGGTGGTGTTTTTGTGGGTCGGTTGGGTTGTGTGTT
T7_07920_G04	TGTGGTGTGTTGGGGTGGTCTTTTGGTGTGTTTTGG
T7_07921_G04	TGTGTTTGTGGGGTTGGGTCTGTTTGTGGGTGTTTG
T7_07922_G04	GGGTGGGTTGTTTTGTGGTCTTTGTGGGGTTGTTTG
T7_07923_G04	TTGGGTTTTTTGTTGGGGTCTTTGGGTGGGGTGTTG
T7_07924_G04	TGTTGTGTGGGTTTGGTGTCGGTGGTTTGGGTTTGT
T7_07925_G04	TGGTTTGGGGTTTTTGGGTCGTGGGTGGTGTTTGTT
T7_07926_G04	GGTGGTTGGTTGGGTTTGTCGGGTTTGTTTGTTGGT
T7_07927_G04	TGTTTGGTTGGTGTGTGGTCGGGGTTTGTGTTTGTG
T7_07928_G04	TGGGGTGTTGGGTTTGGGTCTTTTTGGGTTTGGGTT
T7_07929_G04	GGGTGGGTTTTTTGGTGGTCGGTGTTTTGGTTGTTG
T7_07930_G04	TTGGTGGTTGTGGGTTTGTCGGTTTTGGGTGGTGTT
T7_07931_G04	GGGGTGTGGTTTTTTGGGTCGTGTGTGTTGTGTGTT
T7_07932_G04	GTGTTTGTGTTTTGGGTGTCGGGGTGGTTGTTGTTG
T7_07933_G04	TTGTGGGTTTGGTGGTTGTCTGTGTTGGTTGTGTGG
T7_07934_G04	TGGGTGGTGTTTTTGGGGTCGGTTGTTTGTGTTGGT
T7_07935_G04	TTTTTTTTTGGGGTTGGGTCTGGGGTTGTTGGGTGG
T7_07936_G04	GGGTGGGGTTTGGGTTTGTCTGTTGTTTTTTGGGGT
T7_07937_G04	GGTGGTTTTGTGGTTTTGTCTGGTGGGTTGTGGTGT
T7_07938_G04	GGGTGGGGTGGTTTGTGGTCGTTGGTTTTTGGTTTT
T7_07939_G04	GGGTGGTGGTTTTGGGTGTCGTTTTTGGGGTTTTGT
T7_07940_G04	GTGTTTTGTGGGTTTGGGTCGTGTTGTTGTTGTGGG
T7_07941_G04	GTGGTTTGTTGTTGTGGGTCTGTGGTTTGGGTTGGT
T7_07942_G04	TGTGTGGGGTTTGGTGTGTCTGGTTTGTTTTGGGGT
T7_07943_G04	TTTGGGGTTGTGTTTGTGTCTTGTGGGGTGTGGGTT
T7_07944_G04	GTTGGTGGGTTTGGTGGGTCTGTTTGTGTGTTTGGT
T7_07945_G04	GGGTTGTTTGGGGTTTTGTCGGGGTGTTTTTGGTTG
T7_07946_G04	TGGTTTGGGGTTTTTGGGTCTTTGTTGGTGGGGTGT
T7_07947_G04	TTGGGTTGTGTGGTGGGGTCGTGTTTTTTTGGTTGG
T7_07948_G04	GTGGTTTTGGTGGGTTTGTCTTGTGTTGGTGGGGTT
T7_07949_G04	TGGGTTTGTTGTGGTTTGTCGGTGGTTTGGGTGGTT
T7_07950_G04	TGGGGTTTTTGTGTGGGGTCGTGTTGGGGTTTTTGT
T7_07951_G04	GTTTTGGGTTTTGGGGTGTCTTGGTGTGGGTTGTGT
T7_07952_G04	GTGGGTTTTGGGGTTTTGTCTGTTGGGTTGGTGTTG
T7_07953_G04	GTGTTGGGGTTGGGTTTGTCGTGTTGGGGTTTTGTT
T7_07954_G04	TGTGTTTGGTTTTGTGGGTCTTTGTGGGGTGGGTGT
T7_07955_G04	GGGTGTTGGGGTTTTGGGTCGTTTGGGGTTGTTTTT
T7_07956_G04	GTGTGGTTTTGTGGTTTGTCGTGGGTGGTTTGGTTG
T7_07957_G04	TGGGTTGGGTTTGTTTTGTCGTGTGGTTGGGTGGTT
T7_07958_G04	GTGGGTTGTTTGGTTGGGTCGTTGTTGTGTGGTTTG
T7_07959_G04	TTGTGTGGTGTTGTTGGGTCGGTGGTGGTTTTGTGT
T7_07960_G04	GTGGTTGGTGGTTGTTTGTCTGTTGGGTTTGGGGTT
T7_07961_G04	TTGTTGGGGTTTGGGTTGTCTTTTGGTGGGTTTGGG
T7_07962_G04	GTGTTGGGTTGGTTTGTGTCGGTGGTTTTGGGTTGT
T7_07963_G04	TGGTGGGGTTTGGTTTTGTCGGTGGTTGTTGTTGGT
T7_07964_G04	GGGTGTTGGGGTTGTGTGTCTTTTGTTGGTTGGTGT
T7_07965_G04	GTTTTGTTGTGGGTGGTGTCTGTTGGTGTTGGTGTG
T7_07966_G04	TTTTGTTGTGTGGTTTGGTCTGGTGGGGTGTGTTGG
T7_07967_G04	TGTTTTTTGGGGTTTGTGTCGTTTGGGGTGGGGTGT
T7_07968_G04	TTGGTGGGTTGGGGTTTGTCGTGGTGGTGTTTGTTT
T7_07969_G04	GTGGTTTTGGGGTTTGTGTCTGGGTGGGTTTTTGGT
T7_07970_G04	GTGGGTTGGTGTTGTTGGTCTTTGGGTTTTGGTTGG
T7_07971_G04	GTGGTGGGGTTGTGTGGGTCTTTTTTGTTGGGTTTG
T7_07972_G04	TTGGGTTTTTGTGTTGTGTCGGTGTGGTGGTGTGGT
T7_07973_G04	TGGGTGTTGGGTTGTTTGTCTTTGGGTGTGGTTGTG
T7_07974_G04	GTTTTTGGTGTTGTGTGGTCGTTGGTTTGTGGTGGG
T7_07975_G04	GGTTTTGGGGTGTTGTTGTCGGTTTTGGGTGGTTGT
T7_07976_G04	GTTTTTGTTGTGGGTGTGTCTGGTGGTGGTGTTTGG
T7_07977_G04	GGTTGTGGGTTGTGTTGGTCTTTTGTGGGGTGTTTG
T7_07978_G04	GTTTTTTTTGGTTGGGTGTCGTGGGGTGTGGTTTGG
T7_07979_G04	GGGTTGTTGTTTGGGTTGTCTGGGTTTTGTTGTGGG
T7_07980_G04	TTTGGTTGGGGTGGGGTGTCGTTTTGTTTGGGTTGT
T7_07981_G04	GGGTGGGTTTGGGTTTTGTCGTTGTGGGGTGTTTTT
T7_07982_G04	TTTGGTTGGTTGGGTGGGTCTTTGTTGTTTGGTGGG
T7_07983_G04	TGGTTTTGTGTGGGTGTGTCGTGTTTGGTTTGGGTG
T7_07984_G04	GGTGGTTTGGTGGTTTTGTCGGGTTGTTTTGTTGGG
T7_07985_G04	TTGGTGTTGGTTGGGTGGTCGTTGGGTTGGTTTTGT
T7_07986_G04	GGGTGTTTGGTTTTGGGGTCGTGGTTGGGTTTTTGT
T7_07987_G04	TTTGGTGTTGGGTGGTTGTCGGTTTTTGTGTGGTGG
T7_07988_G04	GTTGGGGTTTGGGGTTTGTCTTTGTGGTTTTGGTGG
T7_07989_G04	TTGGTTTTGTGTGGGTGGTCTGGTTTGGGTTTGGGT
T7_07990_G04	TGTTGGGTTTTTGGGGTGTCTGTGGGTTTGGTGGTT
T7_07991_G04	TGGGTGTTGGTTGTTGTGTCGTGTGTGTGTGGGTTT
T7_07992_G04	GGGTGTGTTTTTGGGTGGTCGGGTGTTGTTTTGTGT
T7_07993_G04	GGGTGTTTGTGTTGGTGGTCTTTGGTTGGTTGGGTT
T7_07994_G04	TGGTGGTGGTTTTTGGTGTCGGTTGTGGGTGTTTGT
T7_07995_G04	TTGGGGTGGGTGGGGTTGTCGTGTTTGGTTTTTGTT
T7_07996_G04	TTTTTTGGTGTGTTGGGGTCGTGGTTGGGTTGGGTT
T7_07997_G04	TTGGGTGGTGGGGTTGTGTCTTTGTTTTGGTTGGTG
T7_07998_G04	TTGGGTTGGTTTGGTTTGTCTTGGGTGGGTGTTGTG
T7_07999_G04	TGTTTGTTTGGGTTGGGGTCTTGGGGTGTGTTGTGT
T7_08000_G04	GTTTTGTGGTGGGGTTTGTCTGTTTGGGGTGGTGTT
T7_08001_G05	CACACACACACACAACAGTCACACACACACACCACA
T7_08002_G05	ACACACACACAACACACGTCACACAAACCCACACAC
T7_08003_G05	AACACACAACACACAACGTCCCCACACACACACACA
T7_08004_G05	ACACACACACACACAACGTCACAACACACACACACC
T7_08005_G05	AACACAACACCACAACAGTCCACACACACCACACAC
T7_08006_G05	AAACACACACACACCACGTCACACACACACCACACA
T7_08007_G05	ACACACACACACACACAGTCCCCAACACACACAACA
T7_08008_G05	CCACACACCACAACACAGTCCACCACAAACACACAA
T7_08009_G05	CACACACACACACAAACGTCACAACACACACACACC
T7_08010_G05	ACACACACAAACACACAGTCCACACACACACACACC
T7_08011_G05	ACACACACCACACAACCGTCACACACACACACAACA
T7_08012_G05	CACACACACAACACCACGTCACACACACACACACAA
T7_08013_G05	CACACACACACAACACAGTCACACACCCAACACACA
T7_08014_G05	CACACACACACACACACGTCAACACCACACACAACA
T7_08015_G05	ACAACACAACACACACAGTCCCACCACACACAACAC
T7_08016_G05	ACACACAACACACACACGTCACAACACACACCCACA
T7_08017_G05	CACACACCCACAACACAGTCAACACACACAACACAC
T7_08018_G05	ACACAACACACCACACAGTCCACACACACACCACAA
T7_08019_G05	CACACACACCACAACACGTCACACACACAACACACA
T7_08020_G05	AAACACACACACCACACGTCACACACAACCACACAC
T7_08021_G05	CACACAACACCAACCACGTCACAACACACACACACA
T7_08022_G05	ACACACACACACAACAAGTCCCACACACAACACACC
T7_08023_G05	CACACAACACCACACACGTCACCAAACACACAACAC
T7_08024_G05	AACAACACCAAACCACAGTCCACACACACCACACAC
T7_08025_G05	CCACACACAAACACAAAGTCCACACACAACCAACCC
T7_08026_G05	ACACACACAACCACACAGTCCACACACAACACACAC
T7_08027_G05	ACACACACACAACACACGTCAACACACACACACACC
T7_08028_G05	ACCACAACACAACCAACGTCACACACACACACACAC
T7_08029_G05	ACACACACCAACACACAGTCCACACACACACACAAC
T7_08030_G05	ACACACACAACACCAACGTCACACACACACACACCA
T7_08031_G05	CACACAACACACAACCAGTCAACACACACACCAACC
T7_08032_G05	CAACCACACACACACACGTCCAACACACAACACACA
T7_08033_G05	CCAACACCAAACACACCGTCACACACACACACAACA
T7_08034_G05	CACACACACACACCAACGTCACACACACACACAAAC
T7_08035_G05	CACCACACACACACACAGTCCACACACAACAACACA
T7_08036_G05	ACACACAACACACACCAGTCACACACACACACCACA
T7_08037_G05	ACACCACACACACACACGTCACACACACACACAACA
T7_08038_G05	CACACACACACCACACAGTCCACACAACACACAACA
T7_08039_G05	CACAACACACAACACAAGTCCACCACACACACACCA
T7_08040_G05	CACCACACAACACACACGTCACACAACAACCACACA
T7_08041_G05	ACACACAACACCACACAGTCCACACACACCAACACA
T7_08042_G05	ACAACACACACACACCAGTCCAACACACACACACAC
T7_08043_G05	CACACAACACACACACAGTCCACACACACACCACAA
T7_08044_G05	ACACACACACACACACAGTCCACACACAACACAACC
T7_08045_G05	ACACACAACCACACACAGTCCACACCACAACACACA
T7_08046_G05	CACAACACACCACACACGTCACACACACAACAACAC
T7_08047_G05	ACACCACACAAACACACGTCACACACAACACACCAC
T7_08048_G05	ACACACACCACAACACAGTCAAACCACCACACACCA
T7_08049_G05	AACCACACACAACAACAGTCCACCACACACACACCA
T7_08050_G05	CAACACACACACACAACGTCACACACACCACACACA
T7_08051_G05	CAACACACACACACACCGTCACACAACACACACACA
T7_08052_G05	ACACCAACCACACACACGTCACAACACACACACAAC
T7_08053_G05	ACAAACACACACACCACGTCACACACACACACACAC
T7_08054_G05	ACACACACACACACAACGTCACACCAACACACACAC
T7_08055_G05	ACACAACACACCACACAGTCCACACACACAACACAC
T7_08056_G05	AACACCACACAACAACCGTCACACACACACACACAC
T7_08057_G05	ACAACACACCACACACAGTCCACAACACACACACCA
T7_08058_G05	ACACACACACACACACAGTCCACCACACACACACAA
T7_08059_G05	ACACACACCACACAAACGTCCACAACACACACCAAC
T7_08060_G05	ACCACACAACACACACAGTCACCACACACACACAAC
T7_08061_G05	ACAACACACACACACACGTCACACACACACACACCA
T7_08062_G05	ACACACACCACACACAAGTCCCACACACACAACACA
T7_08063_G05	CAAACCACACACACCACGTCACACACCACAACACAA
T7_08064_G05	ACAACACACACACACACGTCACCACACACCACACAA
T7_08065_G05	ACACACACAACACACACGTCACAACCCACACACACA
T7_08066_G05	ACAACACACCACACACAGTCCACACACACAACACAC
T7_08067_G05	ACACACACAACACACACGTCACCACAACCACACACA
T7_08068_G05	CACCAACAAACACACACGTCACACACACACACACCA
T7_08069_G05	CACACAACACCAACACAGTCCACCACACACAACACA
T7_08070_G05	CACACACACACAACACCGTCAACACAACACACACCA
T7_08071_G05	ACACACACACACACACCGTCAACACACAACACACCA
T7_08072_G05	CACACAACACACACACCGTCACACACACAACCAACA
T7_08073_G05	ACACACACACACAACACGTCACACACACACAACACC
T7_08074_G05	ACACACACCACACAACAGTCCAACACCACACACAAC
T7_08075_G05	CACACACCACACACACAGTCACACACAACACACACA
T7_08076_G05	CACACAACACACAACACGTCACACACACACACACAC
T7_08077_G05	ACACACACACACACACAGTCCACACACACAACACCA
T7_08078_G05	ACACAACAACACACACAGTCCACCACAACACACCAC
T7_08079_G05	CACACACACACACCAACGTCACACAACACCACAAAC
T7_08080_G05	CAACACACACAACACACGTCACCACACCACACACAA
T7_08081_G05	ACACACACACACACACAGTCACACACACCACACACA
T7_08082_G05	CCACACACACACACACAGTCCACAACAACACACACA
T7_08083_G05	ACACACACACACACCACGTCACACACACAAACCACA
T7_08084_G05	AACAAACACACCACACCGTCACACACACACACCACA
T7_08085_G05	CCACACACACAACACAAGTCCACACACACACACACA
T7_08086_G05	ACACACACCACACACACGTCACCACACAACAAACAC
T7_08087_G05	CACACACACACCACACCGTCAAAACACACAACACAC
T7_08088_G05	CACAACACACCACACAAGTCACACACACCACACACA
T7_08089_G05	ACAACACACACAACACCGTCACCAACACACACACAC
T7_08090_G05	CCACACCACACAACACAGTCCACAACACAACACACA
T7_08091_G05	CACACACCCACACCAACGTCAACACACAACACAACA
T7_08092_G05	CACACAACACACACCACGTCAAACACACAACACACC
T7_08093_G05	CAACACCAACACACACAGTCCAACACACACCACACA
T7_08094_G05	CACACCACACACACACAGTCACACACACACAACACA
T7_08095_G05	AACACACAAACACACCAGTCCACACACACACACACC
T7_08096_G05	CACCACACACACACAACGTCACAAACCACAACACAC
T7_08097_G05	ACACACACACCACACACGTCACACACCACAACAACA
T7_08098_G05	CACAACACACACACACAGTCACACACACACCAACAC
T7_08099_G05	CACACACAACACACCCAGTCCACACACACACACAAA
T7_08100_G05	CCACAACCCACCACAACGTCACACACAACACACAAA
T7_08101_G05	ACACACACACACCACACGTCACAACACACACAACAC
T7_08102_G05	CAACACACACACACACAGTCCACACACCACACAACA
T7_08103_G05	ACACAACACACACACCCGTCACACAACACACACACA
T7_08104_G05	CACACACACACACACACGTCACACACACAAAACACC
T7_08105_G05	ACACACACACCACACACGTCACACAACACACACACA
T7_08106_G05	ACACACACACACACACCGTCACACAACACCACAACA
T7_08107_G05	AACAACACACCACACACGTCACACACACACACACAC
T7_08108_G05	AACACACACACACCACAGTCCACACACACACACAAC
T7_08109_G05	CACAAACACACACCACAGTCCACACACACCACACAA
T7_08110_G05	CACACAACACACAAACAGTCCACACACCACACACAC
T7_08111_G05	AACAACACCACACACACGTCACACACACACACACAC
T7_08112_G05	CACACACACACAACACAGTCCACACACACAACACAC
T7_08113_G05	ACACACACACCACACACGTCACACACAAACACACAC
T7_08114_G05	ACAACACACACACACCAGTCCAACACACACAACACC
T7_08115_G05	ACACACACACACACACAGTCCCAACACACACACACA
T7_08116_G05	CACACACACACACACACGTCACACAAACACACCACA
T7_08117_G05	ACCACAACCAACACACAGTCCCACACACAACACACA
T7_08118_G05	ACACACACAACACACCAGTCCACACACACACCACAA
T7_08119_G05	AAACACACACACAACACGTCACACACCACCACACAC
T7_08120_G05	CACACACACACAACACAGTCCACACACAACACACAC
T7_08121_G05	ACCACACACACAACCACGTCACACAACACAACACCA
T7_08122_G05	CACACACACACACACACGTCACAACACACACACCAA
T7_08123_G05	ACACACACACACACACCGTCACACACAACAACACAC
T7_08124_G05	ACACACACACACACAACGTCACACCACACACAACCA
T7_08125_G05	CACACCACACCACAACAGTCCACAACACACAACAAC
T7_08126_G05	ACACACACACACACCACGTCACACACACACAACACA
T7_08127_G05	ACACAACACCACACACAGTCCACAACCACACAACAC
T7_08128_G05	ACACAACAACACACACCGTCACACACAACACACCAC
T7_08129_G05	ACAACCACACACAACACGTCACACACACACCACACA
T7_08130_G05	CACACAACACAACACACGTCAACACACACACACCAC
T7_08131_G05	AACACACCACAACACCAGTCCACACACACACAACAC
T7_08132_G05	CAACACACACACAACACGTCACACACACACACACAC
T7_08133_G05	CACACACCACAACACAAGTCCACACACACACACACA
T7_08134_G05	CACACACCACAACACACGTCAACACACACACAACAC
T7_08135_G05	ACACACACACACAACACGTCCACACACACACACACA
T7_08136_G05	CCACACAACACACACACGTCAACACACACAACACAC
T7_08137_G05	CACACACACACACCCACGTCACACACACAAAACACA
T7_08138_G05	ACACCACACACAACACAGTCCAACAACCACACACAC
T7_08139_G05	ACACACACACAACCACAGTCCACACAACACACACAC
T7_08140_G05	AAACACACACACCACACGTCACACACACACACACAC
T7_08141_G05	ACACACACCACAACACAGTCCACACACACACAACAC
T7_08142_G05	CACACACCACACACACAGTCCACAAACACACACAAC
T7_08143_G05	ACACACACACACACACAGTCCAACACCACACACAAC
T7_08144_G05	CACACACAACAACACACGTCACACCACACACACACA
T7_08145_G05	CACACACCACACACACAGTCCAACACACACAACACA
T7_08146_G05	ACCACAACACACACACAGTCCACACACACACACAAC
T7_08147_G05	ACACCACACACACACAAGTCCACACACACACACAAC
T7_08148_G05	CACCACCACACACAAAAGTCCACACACACACACCAA
T7_08149_G05	ACAACACACACACACAAGTCCACACACCACACACAC
T7_08150_G05	CACACACACACACCACAGTCCACACAAACACACACA
T7_08151_G05	AACAACACACACCCACAGTCCACACACCACACAACA
T7_08152_G05	CACCACACACACAACACGTCACACAACACACAACAC
T7_08153_G05	ACCAAACCACACACAACGTCACACACACACACACAC
T7_08154_G05	ACACACACACACAACACGTCACACAACCCACACACA
T7_08155_G05	CACACACACAACACACAGTCCACCACAACAACACAC
T7_08156_G05	CACACACACACACAAACGTCACAACCCACAACACAC
T7_08157_G05	ACACCACACACACACACGTCACAACACCACAACACA
T7_08158_G05	ACACACCACACACACAAGTCCACACACACACACAAC
T7_08159_G05	ACACACACACCACACACGTCACACACAACACACACA
T7_08160_G05	ACACACACACACACACAGTCCAACACACCACAACAC
T7_08161_G05	CACACACACACCACACAGTCACACACACACACAACA
T7_08162_G05	CACAACACACACACACAGTCCACACACACAACACAC
T7_08163_G05	CCACACAACACACACACGTCAACACACAACACACAC
T7_08164_G05	ACACACACACACACACAGTCCACCACACACAACACA
T7_08165_G05	ACACACACACACCAACAGTCCAACACACACCACACA
T7_08166_G05	CACACACACACACACAAGTCCCACACACACAAACAC
T7_08167_G05	ACACACACACACACACAGTCCCACACACAACCAACA
T7_08168_G05	ACACACAACACACACACGTCACAACACACACCACAC
T7_08169_G05	CACAAACACCACACACAGTCCACACACACACAACAC
T7_08170_G05	ACACCACACAACACACAGTCCACACACACACAACAC
T7_08171_G05	ACACACACACACACACAGTCCACACACCACAACACA
T7_08172_G05	ACACACACACACACAACGTCCCACACACAACACACA
T7_08173_G05	CACACACCACACACAACGTCACACACACAACACACA
T7_08174_G05	ACACAACACCACACACAGTCCAACACACACCAACCA
T7_08175_G05	ACACACACACACACACAGTCCACAACCACACAACAC
T7_08176_G05	CACACACACACACACACGTCACACACACAAACACCA
T7_08177_G05	CCAACCACACACACAACGTCAAACACACACCACACA
T7_08178_G05	ACACACACACACACACAGTCAACACACACCACACAC
T7_08179_G05	CACACACCACACAACACGTCACAACACACACAACAC
T7_08180_G05	ACACAACACACACACACGTCCACAACCCACACAACA
T7_08181_G05	CACACACACACACACCAGTCCACACACACAAACACA
T7_08182_G05	ACCAACACACAACACACGTCACCACAACACACACAC
T7_08183_G05	ACACACACACACAACACGTCACAACACACACCACAC
T7_08184_G05	CACACACACACAACAACGTCACACACACACACCCAA
T7_08185_G05	ACACACACCACACACACGTCACACACACAACACACA
T7_08186_G05	CACACCAAACACACACAGTCCACACACACACAACCA
T7_08187_G05	CAACCACACCACACAACGTCACCACACCAAACAACA
T7_08188_G05	CACACACACACACAACAGTCCACAACACACCACACA
T7_08189_G05	ACCACACAACACACACAGTCCACACACACAACACAC
T7_08190_G05	ACACACACACACACACAGTCACACCACAACACACAC
T7_08191_G05	CCAACAACACACACACAGTCCACACACACACACCAA
T7_08192_G05	ACACACACAACACACACGTCACCACACACAACCACA
T7_08193_G05	CACACACACACACACACGTCACACACACCAACAACA
T7_08194_G05	ACCACAAACACACACACGTCACACACACACAACACC
T7_08195_G05	CACAACAAACACACCACGTCACACACACACACACAC
T7_08196_G05	ACCAACACCACCACACAGTCCACAAACAACCACACA
T7_08197_G05	ACACCAACACACAACCAGTCCCACACACACACACAA
T7_08198_G05	ACCACACACACACACAAGTCCACCACAACACAACAC
T7_08199_G05	ACCACACACACAACCAAGTCCACACACACACAACAC
T7_08200_G05	ACACACACAACACACACGTCAACACACACACACCAC
T7_08201_G05	ACACACACACACACACAGTCCCACACAACACACACA
T7_08202_G05	ACACACACACCACACACGTCACAAACACACACACAC
T7_08203_G05	ACACACCACACACACAAGTCCACACACACACACACA
T7_08204_G05	CACACACACACAACACAGTCCACACACACAACCACA
T7_08205_G05	CACACCACACACACACAGTCACAACACACACAACAC
T7_08206_G05	AACACACACACACACAAGTCCCACACCACACACACA
T7_08207_G05	ACACCACACAAACACACGTCCACACAACCACAACCA
T7_08208_G05	ACACACACCACACAACAGTCCACACACAACACACAC
T7_08209_G05	CACACACACACCACACAGTCCACAACACAACACACA
T7_08210_G05	AACACACCACCACAACAGTCCACAACACACCACACA
T7_08211_G05	ACCACACACACACACACGTCACAACACCACACAACA
T7_08212_G05	CACCACACACACACAACGTCAACACACAACACACAC
T7_08213_G05	ACAACACCACACACACAGTCACACACACACACACAC
T7_08214_G05	CACACACACACACACAAGTCCCACACACACACAAAC
T7_08215_G05	ACACACACAACACAACAGTCACACACCACACACCAC
T7_08216_G05	CACACACACACACACACGTCAACACACACACAACAC
T7_08217_G05	ACACACAAACACACACAGTCCACACACACCACACAC
T7_08218_G05	CACACACACAACACACAGTCCAACACACACACCACA
T7_08219_G05	ACACACAAACACACACAGTCCCACCACACACACACA
T7_08220_G05	ACACAACCCACACACACGTCAACACACACACAACAC
T7_08221_G05	CAACACACACAACACACGTCACACACACACACCAAC
T7_08222_G05	CACACACAACACACACAGTCACACCACACACAACAC
T7_08223_G05	CACCACACACACACACAGTCCACAACCAACAACACA
T7_08224_G05	ACACACACACACACAACGTCACAACACCACAACCAC
T7_08225_G05	CACACAACACAACACACGTCACCACACACAACACCA
T7_08226_G05	ACAACACACACACACACGTCACACACACACACACAC
T7_08227_G05	ACACCACACACACACACGTCACACACAACACCAACA
T7_08228_G05	CACACACCACACAACACGTCACAACACACACACAAC
T7_08229_G05	CACAACACCACACACACGTCACAACACACACACACA
T7_08230_G05	ACAACACCCACACCACAGTCCACAACACAACACACA
T7_08231_G05	CACCCACACACACAAACGTCACACACACAACAACAC
T7_08232_G05	ACACCACACACACACAAGTCCACACACCAACACACA
T7_08233_G05	ACACACACACAACCACAGTCCACACACACACAACAC
T7_08234_G05	ACACACACACACACAACGTCACACACCACACACACA
T7_08235_G05	AACACACACACACACACGTCACACAACACACACCAC
T7_08236_G05	CACACACCAACACAACAGTCAACACCACACACACCA
T7_08237_G05	CAAACAACCACACACACGTCACACACACACACACAC
T7_08238_G05	ACACAACCACACACACAGTCCAACACACCACACAAC
T7_08239_G05	ACAACACACACACCAACGTCCACACACACACACAAC
T7_08240_G05	ACACACACACAACACACGTCACCACACACACACACA
T7_08241_G05	CACACACAACCACACAAGTCCACACACACACCAACA
T7_08242_G05	CACACACACACAAAACCGTCACACACCACACACACA
T7_08243_G05	CCACACACACAACACACGTCAACACACACACACACA
T7_08244_G05	CACACACACAACACACAGTCCACACACAACACACAC
T7_08245_G05	ACACACAAACACACACCGTCAACACACCACACACAC
T7_08246_G05	ACACACAAACCCACACAGTCCACAACACACACACAC
T7_08247_G05	ACACACACACCACACACGTCAACACACCACAACACA
T7_08248_G05	ACACACACACACCACAAGTCCACAACACACACACAC
T7_08249_G05	AACACACACACACAACAGTCCAACACACACCACCAC
T7_08250_G05	CACACACACACACACACGTCACAACAACACACCACA
T7_08251_G05	CCACACACACAACAACAGTCCACACACACACACACA
T7_08252_G05	ACACACACACACACACCGTCCACAACACACAACACA
T7_08253_G05	ACCACACACACAACACAGTCCACACACACACACACA
T7_08254_G05	ACACAACACCACACAAAGTCCACCACACACACACAC
T7_08255_G05	ACACCAACACACCAACAGTCCACACACACACACACA
T7_08256_G05	AACACACCACACCACACGTCACACACACACACAACA
T7_08257_G05	ACACACACACACACACAGTCCACAACACAACACACC
T7_08258_G05	ACCACACACACACACACGTCACACACACAACAACAC
T7_08259_G05	ACACACACACCACACACGTCAACACCACACACACAA
T7_08260_G05	CACACACAAACACACACGTCAACACACACACACCAC
T7_08261_G05	ACACAACACACACACCAGTCCACCACAACACACACA
T7_08262_G05	ACAACAACAACCACACAGTCCCACAACACACACCAC
T7_08263_G05	CAAACACACACCCACACGTCACCACACACACAAACA
T7_08264_G05	CCAACACACACACACACGTCACACACACAACACACA
T7_08265_G05	CACACACACACACACAAGTCCAACAACCACACACAC
T7_08266_G05	CACCACAACACACACACGTCACACACACACACACAA
T7_08267_G05	CACACACACAACACACAGTCCACCACCAAACACAAC
T7_08268_G05	ACACAACACACACACACGTCCACACAACACACACAC
T7_08269_G05	ACACACAACACCCAACAGTCCACACACAACCACACA
T7_08270_G05	AAACACACCACAACACAGTCCACACACACACACCCA
T7_08271_G05	CACAACACACACACACCGTCACACACAACACACACA
T7_08272_G05	CACAACCCACACACAACGTCACACAACACCACACAA
T7_08273_G05	ACACCACAACACACCACGTCACAACACACACAACAC
T7_08274_G05	CACCACACACACAAACAGTCCACACACACAACACAC
T7_08275_G05	CACACACACAACACACAGTCCACAACACCACACACA
T7_08276_G05	AACACCACACACCACACGTCAACAACACACACCACA
T7_08277_G05	CCACACACACACAACAAGTCCACACACACAACACCA
T7_08278_G05	CACACACAACACACACAGTCCACACACACACACACA
T7_08279_G05	CACACACACACACACACGTCACACACAACACCACAA
T7_08280_G05	CACACACACAACACACCGTCACACAACACACACACA
T7_08281_G05	ACACACACAACACACACGTCACACCAACCACACACA
T7_08282_G05	ACACACACACCACACACGTCACACCAACACACACAA
T7_08283_G05	ACACACACCACAACAAAGTCCACACACACACACCAC
T7_08284_G05	AACACACACACACACACGTCACACACACACAACACC
T7_08285_G05	AACACACACAACACCACGTCACACACACACACACAC
T7_08286_G05	CACACACACACACAACAGTCCAACACACACACACAC
T7_08287_G05	CAACACACCACACACACGTCACACACACACAACACA
T7_08288_G05	ACACACACCACCAAACAGTCCACACAACACACACAC
T7_08289_G05	AACACACCACACACACAGTCCACACACACAACACAC
T7_08290_G05	ACACCACAACAACACAAGTCCAACACACACACCACC
T7_08291_G05	CACAACACACACCACACGTCACACACAACACACACA
T7_08292_G05	CCACACACACACACACAGTCACAACAACACACAACC
T7_08293_G05	CACACACACACACACACGTCAACACACACACACAAC
T7_08294_G05	ACACACACAACACACCAGTCCACACCACACAAACAC
T7_08295_G05	CACACACACACACAACAGTCCAACACACACACCACA
T7_08296_G05	ACACACACAACACACCAGTCCACACACACAACACAC
T7_08297_G05	CCACACACACAACAAACGTCACCACACAACACACCA
T7_08298_G05	ACACAACACCACACCACGTCACAACACACAACACAC
T7_08299_G05	CCACACACACACACACAGTCCACACACACAACAACA
T7_08300_G05	CAACACACACACACAACGTCACACCAACACACACAC
T7_08301_G05	CACAACACACAACAACAGTCCACACCACACACACAC
T7_08302_G05	ACACACACACAACACAAGTCCACACCCAACACACCA
T7_08303_G05	ACCACACACACACACACGTCCACACACACACAAACA
T7_08304_G05	CAACACAACACACCCAAGTCCACACACACACAACAC
T7_08305_G05	ACACACCACCACACACAGTCCAACAACACACACACA
T7_08306_G05	ACACACCACACAACACAGTCACACACACACACACAC
T7_08307_G05	ACACACACACACCACACGTCAACAACCACACACACA
T7_08308_G05	CACACACACCAACACACGTCACAACACACACACAAC
T7_08309_G05	CACCAACACACACACACGTCACACACACACAACAAC
T7_08310_G05	ACACCACACACACACACGTCAACAACACACCACACA
T7_08311_G05	CAACACACACACACCACGTCACAACACACACAACAC
T7_08312_G05	ACACAACACACACACACGTCAACACACACACACACC
T7_08313_G05	CACACACACACACACAAGTCCCACACAACACACACA
T7_08314_G05	ACAACACACCACACCACGTCAACACACACACACACA
T7_08315_G05	CACACACACACACACAAGTCCACACACACAACACCA
T7_08316_G05	CAACACACACACACACAGTCCACCACACACACAACA
T7_08317_G05	ACACACCACACACACACGTCACAACACACACACACA
T7_08318_G05	CACACACAACACACACAGTCCAACCACCACAACACA
T7_08319_G05	CACCACACACACACCAAGTCAACACACACACACACA
T7_08320_G05	ACACCAAACACACACACGTCACACACCACACACACA
T7_08321_G05	ACACACACACACCACAAGTCCCACACACACAACAAC
T7_08322_G05	CACACAAACACACACACGTCACCACACACAACACAC
T7_08323_G05	ACCAACACACCACACACGTCACACACAACACACAAC
T7_08324_G05	AACACACACACACACCAGTCCACACACACACAACCA
T7_08325_G05	CAAACCAAACACACAAAGTCCACACCACACACCCAC
T7_08326_G05	ACACACACAACACACACGTCCACCAACACACCACAA
T7_08327_G05	ACACAACACCACACAACGTCACACACCACACACACA
T7_08328_G05	CACAACACAAACCACACGTCACCACCACACACACAA
T7_08329_G05	ACAACACACACACACACGTCACCACAACAACACACC
T7_08330_G05	ACACACACCACAACACCGTCACACACACAACCACAA
T7_08331_G05	CACACACAACACACACAGTCACACAACACCACACAC
T7_08332_G05	ACAACACCACACACCACGTCACACACAAACACACAC
T7_08333_G05	CACACCACCACACACAAGTCCACAACAACACACACA
T7_08334_G05	ACACAACACACACACACGTCAAACACCCACACACCA
T7_08335_G05	ACACAACCACCACACACGTCACCACACACACAAACA
T7_08336_G05	ACACACACACAACACACGTCACACCACACACACACA
T7_08337_G05	CACACACACACAACACAGTCCAACACCCACACAACA
T7_08338_G05	ACACACCACACACACACGTCACACACACACAACACA
T7_08339_G05	CAACACACACACACACAGTCCACCACAACAACACAC
T7_08340_G05	AACACACACACACACAAGTCCACACACACACACACC
T7_08341_G05	AACCACAACACACACACGTCACACACACACACACAC
T7_08342_G05	ACAACACACACACACAAGTCCAACAACCCACACCAC
T7_08343_G05	ACAACACACACACACACGTCACAACACCACACACAC
T7_08344_G05	ACACACACACACACAACGTCACACACCACACACAAC
T7_08345_G05	ACAACACACACACAACAGTCCACACCAACCACACAC
T7_08346_G05	CACACCACAACACACACGTCACCACACCAAAAACAC
T7_08347_G05	CAACAACACACACCACAGTCCACACACACACACACA
T7_08348_G05	ACACAACACACACACACGTCACACACACACAACACC
T7_08349_G05	ACCACAACAACAACACCGTCACACACACACACACAC
T7_08350_G05	CACACACACACACACACGTCACAACACACACACAAC
T7_08351_G05	AACCACACACACACACAGTCCACACACACAACACAC
T7_08352_G05	CACCAACACACAACACAGTCCACAACACACACACAC
T7_08353_G05	AACACAACACACACACAGTCCACACACCACACACAC
T7_08354_G05	CACACACAACAACACACGTCACACACCACACACACA
T7_08355_G05	ACACCCACACACACAACGTCACACAAACACACCACA
T7_08356_G05	ACACCCACAAACACACAGTCCACACACACACAACAC
T7_08357_G05	ACACAACCACACCACAAGTCCACACACACAACCACA
T7_08358_G05	CACACACCAACAACACAGTCCAACACACACCACACA
T7_08359_G05	CACCACAACACACAAACGTCCACACACAACACACAC
T7_08360_G05	ACACACACACACCCACAGTCCACAACACACAACACA
T7_08361_G05	ACCAACACACACAACCAGTCCACAACACACACACAC
T7_08362_G05	CACACACACACACACAAGTCCAACACACACACACAC
T7_08363_G05	ACACACCACAACACACAGTCCAACACACAACACACC
T7_08364_G05	CACACACACAACACAACGTCACACACACACCACACA
T7_08365_G05	ACACACACAACACACACGTCCAACACACACACACAC
T7_08366_G05	ACCACACACACACACCAGTCCAACACACACAACACA
T7_08367_G05	AACACACAACACACACAGTCCACACCACACACACAC
T7_08368_G05	ACACACACACACACACAGTCCAACACACCCAACAAC
T7_08369_G05	ACACACACACACACCACGTCACACACACACACAACA
T7_08370_G05	ACCACACACACAAACACGTCACACACACACACACAC
T7_08371_G05	ACACCAACCCAAACACAGTCCAACAAACACCACCAC
T7_08372_G05	ACACACACACACAACACGTCACACACACACACACCA
T7_08373_G05	ACACACACACACAAACAGTCCACACACCACACCACA
T7_08374_G05	CACACACACAACACACAGTCCCAAACACACACACAC
T7_08375_G05	CACACACCACAACACACGTCACACAAACACCACACA
T7_08376_G05	AACACACACACACACCAGTCCAACAACACACCACCA
T7_08377_G05	ACACACACACAACACACGTCACACACACCACACACA
T7_08378_G05	CACACACACCAACACAAGTCCACACACACACACACA
T7_08379_G05	CACCAACACCAACCACAGTCCACACACACAAACAAC
T7_08380_G05	CACACACAACAACACACGTCAACACACACACCACAC
T7_08381_G05	ACACACCACACACACACGTCCACACACACACAACAA
T7_08382_G05	CACAACAACAACACACAGTCCACCACACACACACAC
T7_08383_G05	ACACACCCACACACACAGTCCACAACAACACACACA
T7_08384_G05	CACACACACACACACAAGTCCACACACACACACAAC
T7_08385_G05	CACCACACACAAAACACGTCACCACACACACACACA
T7_08386_G05	ACACACAACAAACACCAGTCCAACACCACCACACAC
T7_08387_G05	ACACCAACACACACACAGTCCACACACAACACACAC
T7_08388_G05	CCACACACAACACACACGTCACACCACACACAACAA
T7_08389_G05	ACACAACACAACACAACGTCCACACACCACACACAC
T7_08390_G05	CACACACACACACCAACGTCACACAACACACAACAC
T7_08391_G05	ACACAACACACACACACGTCACACCAACACACACAC
T7_08392_G05	CACACAACACAACCACAGTCCACACACACACACACA
T7_08393_G05	CAACACACACACACACCGTCACACACACACAACACA
T7_08394_G05	ACACAACCACAAACACAGTCCACACACACCACACAC
T7_08395_G05	CACACACACACACACACGTCACCAACACACACACAA
T7_08396_G05	CACACAACACAACACACGTCCCACACCACACAAACA
T7_08397_G05	CAACACACACACACACCGTCCAACACACAACACACA
T7_08398_G05	ACCACAACACACCACACGTCACACACACACAACACA
T7_08399_G05	ACACACAACCAACACACGTCACACACCACAACACAC
T7_08400_G05	ACACAACACACAAACCAGTCCACCACCACACACACA
T7_08401_G05	CACACACACCACAACCAGTCCCACAACAAAACACAC
T7_08402_G05	ACACCACCAAAAACACAGTCCACCCAAACACACACC
T7_08403_G05	CCACACACAACCAACCCGTCACCAACAAACACAACA
T7_08404_G05	AAACACCACACCACAACGTCCACACACACACACAAC
T7_08405_G05	CACACAACACACACAACGTCACCAACACCAACACAC
T7_08406_G05	ACAACCACAACACCCACGTCAAACCCACCAACAACA
T7_08407_G05	ACACCACCACACACAACGTCAACAACACACCAACAC
T7_08408_G05	AACAAACCACACAACACGTCACACACACACACACCC
T7_08409_G05	CCAACACACAAACACCAGTCACACACCACAACACAC
T7_08410_G05	ACAACACCAAACAACACGTCACACCACAACCACCAC
T7_08411_G05	AACACACCCACACACAAGTCCAACAACACACACCCA
T7_08412_G05	ACACACACACAACCAACGTCACAACACCACCACACA
T7_08413_G05	ACCACAAACCACACCAAGTCACACACAACACACCAC
T7_08414_G05	CAACACAACACAAAAAAGTCCACCACCCCACCACCA
T7_08415_G05	CAACAACAACCCCACAAGTCCCACAAACACCAACAC
T7_08416_G05	ACAACACACAACCCACAGTCCCAACACACACAACAC
T7_08417_G05	AACAACACACCACCACAGTCCACACCACAAAACCAC
T7_08418_G05	AACCACCACCACCAACAGTCACAACCACACACACAA
T7_08419_G05	CAACCACAAACACACCAGTCCACAACAACAACCCAC
T7_08420_G05	ACCACACACACACCCAAGTCCAACACAACAAACCAC
T7_08421_G05	ACACAACACAACACCCAGTCCAACACCACACACAAC
T7_08422_G05	ACACCCAACAACCAACAGTCCACACACACACAACAC
T7_08423_G05	AACACACCAACAACACAGTCACACAACCACAACCCC
T7_08424_G05	CACAACAACCACCCAACGTCACCACACCCAAAAAAC
T7_08425_G05	CAAACCAACACACAAACGTCACACCACACCACACCA
T7_08426_G05	CACACACCACAACAACAGTCAACCACCACACAACAC
T7_08427_G05	CACACACAACACACCACGTCCCACACAACACAAACA
T7_08428_G05	AACACCACAACCACAAAGTCCACACACCCAAACCAC
T7_08429_G05	ACACACACACACACACAGTCACCAACACCAACCACA
T7_08430_G05	ACACACACACACACACCGTCCAACACACAACACAAC
T7_08431_G05	CCACACAACACACACAAGTCCAACCCACACAACACA
T7_08432_G05	ACACCAAACCCACACAAGTCCAACACACACACACAC
T7_08433_G05	AACACCCACCACACAACGTCACAACAACACACCAAC
T7_08434_G05	ACCACACCAACAACCCAGTCCACACAACAAACACAC
T7_08435_G05	CCAACACCACACACACCGTCACAAACAACCACAACA
T7_08436_G05	AACACAAACCACACACCGTCCACAACACACACACCA
T7_08437_G05	CACAACCACACACAACAGTCACCAACAACACCACCA
T7_08438_G05	CAACACACACACAACACGTCAACACAACCCCACAAC
T7_08439_G05	ACAAACCACCACAACACGTCCACACCACACACAACA
T7_08440_G05	ACACCACCACAAACAACGTCACACCACCACAACACA
T7_08441_G05	ACAACCAAACACCACACGTCCACACACCACACAAAC
T7_08442_G05	ACACAACACAAACCCACGTCACCACACCAAACCACA
T7_08443_G05	AACAACAACCCACACAAGTCCACACACACACACCCA
T7_08444_G05	ACAAACCCACACCCAACGTCAACACACCAACCAAAC
T7_08445_G05	AACACACACACCACACAGTCCACACCAAACACACAC
T7_08446_G05	CACACACACACACAACAGTCCCAACAACACCACACA
T7_08447_G05	CCAACCACACACACCAAGTCACACACACACACAACA
T7_08448_G05	CACCAACACACCACACAGTCACACACACAACACACA
T7_08449_G05	ACACAAACACACACCACGTCCACACACAACACACAC
T7_08450_G05	ACAACACACCAACACCCGTCCACACAACACAACACA
T7_08451_G05	CAAAACCACACCCAACCGTCAACACCAACACACACA
T7_08452_G05	CCAACACAAACACAACAGTCACCAACACACACCCAC
T7_08453_G05	CCAACCACACCAACAACGTCCAAACACAACCAACAC
T7_08454_G05	CCACACAACCACCAAAAGTCCAAAACCCACACCACA
T7_08455_G05	ACCACCACACACACACCGTCAACAACACCAAAACCA
T7_08456_G05	CACAACAAACACCCACAGTCCACACAACACCCACAA
T7_08457_G05	ACAAACACCACACCACAGTCCACACAACACACACCA
T7_08458_G05	AACACAACACAAACCACGTCCCCAACACCAACCACA
T7_08459_G05	ACACCACACAACCACAAGTCCAAACACACCCAACCA
T7_08460_G05	CAAACACACACACACACGTCAACACACACACCCACA
T7_08461_G05	AACAACACCACACACAAGTCCACCCAACCACAACAC
T7_08462_G05	ACCAACCAACACCACCAGTCAACACAACCACAACAC
T7_08463_G05	CACCCACAACACCAACCGTCAACACAACAAACACCA
T7_08464_G05	CCAACACCACACACAACGTCACACACAAACACACCA
T7_08465_G05	AACAAAACACCACACACGTCAACCACACCACCACAC
T7_08466_G05	CACAACACAACACAACCGTCACCAACACCACACAAC
T7_08467_G05	ACACACCACACCAACACGTCACCACCACACAACAAA
T7_08468_G05	ACAACCCACACACACCCGTCACCACAAACAACAACA
T7_08469_G05	ACACCACACCACACAACGTCACAACACACACAACAC
T7_08470_G05	ACACACCACCACACACCGTCACCAAACAACAACACA
T7_08471_G05	CACCACACACAACACCAGTCCAAACACCAACACACA
T7_08472_G05	AACAAACACAACCCACCGTCACCACACAACACACAC
T7_08473_G05	CACCAACACACAACACAGTCCACCACAAACAACACC
T7_08474_G05	AACACCCACCACACACAGTCCCACAACAAAAACCAC
T7_08475_G05	AAACACAAAACCCACACGTCACACCCACACACCCAA
T7_08476_G05	AACACAAACACAACACAGTCCACCCACACCACACAC
T7_08477_G05	ACACCACACACCAACCCGTCAAACCAACACACAACA
T7_08478_G05	CACAAACCAACCAACACGTCACACCCAACAACCACA
T7_08479_G05	CACACAACACACACACCGTCACACACACAACACAAC
T7_08480_G05	AACACCCACACACACACGTCCAACAAACCAACACAC
T7_08481_G05	ACACAAACCACCCACAAGTCACCACACACAACACAC
T7_08482_G05	CACACCCCACAAAACACGTCACAACACACAACACCA
T7_08483_G05	ACACACAACCACACAACGTCCAACCCACACAACACA
T7_08484_G05	CACAACACACACACCACGTCACACACACACAAACAC
T7_08485_G05	ACCACCACCACACAAAAGTCCACACACACAAACACC
T7_08486_G05	CACAACACACACCACAAGTCACACACAACACCACAC
T7_08487_G05	AACAAACACACACACCAGTCCCACCACACCACAACA
T7_08488_G05	CACACAACACCACCAACGTCACACACAACACACACA
T7_08489_G05	AACACACACACACAAACGTCACACAACCCACCAACC
T7_08490_G05	AACAACACACACAACACGTCCAACACAACACCCCAC
T7_08491_G05	ACACACAACACACCACAGTCAACACCCCAACAAACC
T7_08492_G05	CACCACACACACAACACGTCACACAACACACACACA
T7_08493_G05	ACACACACACACAACCAGTCCCACAACAACCACACA
T7_08494_G05	ACACACAACCACCCAACGTCCAAACACACAACCACA
T7_08495_G05	AAACACAACCACACCACGTCAACACACACACCCACA
T7_08496_G05	AACACACACCACAACCAGTCCACCAACACACAACAC
T7_08497_G05	CACCAAACACACCCACAGTCAACAACCACAACAACC
T7_08498_G05	CACAACACACACCCAACGTCACACCACAACAACACA
T7_08499_G05	ACAAAACACACCACACAGTCCCAACCACACACACCA
T7_08500_G05	CAAACACACACCCCACAGTCCCAACAAACACAACAC
T7_08501_G05	ACCCACACAACAACACAGTCCCCACACACACAAACA
T7_08502_G05	CACACAACACACACAACGTCACACACACACCAACAC
T7_08503_G05	CACCACACCAAAAACACGTCAAACCACAAACCCACC
T7_08504_G05	AACACAACCAACCACACGTCACACACACACACCACA
T7_08505_G05	ACCACACAAACACCACCGTCAAAACACACAACCACC
T7_08506_G05	ACCAACCAACACAACCAGTCCACACCACCAACAAAC
T7_08507_G05	AACCAACCACACAACAAGTCCACACACCACACACAC
T7_08508_G05	CACAAACACACCACACCGTCAACCACCAACCAAAAC
T7_08509_G05	CAACACAACACCAAACAGTCACAACACCACACCCAC
T7_08510_G05	CACCAACAAAACACACAGTCCCCACAACCACACAAC
T7_08511_G05	CCACACACCACACAACAGTCAACACACACCACACAA
T7_08512_G05	AACAACACAAAACCACAGTCCACACACCACACCCCA
T7_08513_G05	AACACACACCAAACACCGTCAACCACACACACACAC
T7_08514_G05	CACACAAAACAACCACAGTCACACACACACCCCAAC
T7_08515_G05	ACACAAAACACACACAAGTCCACACCACACCCACCA
T7_08516_G05	AACACCCAACACACACCGTCACAACACACACACACA
T7_08517_G05	ACACACAAACACCCCACGTCACACAACACACAACAC
T7_08518_G05	ACCACACACACACCCAAGTCCAACAACACCCAACAA
T7_08519_G05	ACACAACAAACCAAACCGTCACACACACACCCCACA
T7_08520_G05	ACACCACACCAAACCACGTCAACACAACACCACACA
T7_08521_G05	ACCACAAACACCACAACGTCACACACACACACCCAA
T7_08522_G05	AACCAACACACAACAACGTCACCACACACACACACC
T7_08523_G05	ACAAAACACACACACCCGTCACACACACACACAACC
T7_08524_G05	CCAACACAACAACCACAGTCCAACACACACACCACA
T7_08525_G05	CACACACACAACAAACAGTCCACACACACACACACC
T7_08526_G05	CACACCCCACACACAACGTCACAACAAACACACACA
T7_08527_G05	CAAACACACACCACACAGTCCACACACACACACAAC
T7_08528_G05	CACACAACACACAACAAGTCCACACAAACACCCCAC
T7_08529_G05	ACCAACACACACACCACGTCCCAAACAACACACACA
T7_08530_G05	ACACCAACAAAACACCCGTCACCCCAAACAACACAC
T7_08531_G05	ACACACACCAACCCACAGTCACCACAACACACACAA
T7_08532_G05	ACACACAAACACCACAAGTCACCCCACACAACACAC
T7_08533_G05	ACACACAACAACCACACGTCAACACACAACCCACAC
T7_08534_G05	CACACAACACACACCACGTCACCACCAACCACAAAA
T7_08535_G05	CAACACAACAACCAACAGTCCACCACCACAACACAC
T7_08536_G05	CAACACAAAAACAACCAGTCCCACCACCACACCACA
T7_08537_G05	ACACACAACACACACAAGTCCCACACACACACCACA
T7_08538_G05	CACACCACCACACACCAGTCCACACACACACAAAAA
T7_08539_G05	CCACAAACACACAAACAGTCACCACACCACACACAC
T7_08540_G05	CAAACACACCACACCAAGTCCACCACACAACACAAC
T7_08541_G05	CACCAACACCCACCAAAGTCCACACACACAACAAAC
T7_08542_G05	CACAACACCACAACACCGTCACAACACACACAACCA
T7_08543_G05	CACACACACACACCACAGTCAAACAACACACACCCA
T7_08544_G05	AACACACAACCACACACGTCACCCCACACAAACACA
T7_08545_G05	ACACACACACACACACCGTCAACAAACCAACCACAC
T7_08546_G05	AACCAAAACACCAACACGTCACACCCACACCCAACA
T7_08547_G05	AACCACAACAACACAACGTCCACACCACCACACACA
T7_08548_G05	CACAACAACAAAACACAGTCCACACACCACCACACC
T7_08549_G05	CCAACCACACCACCACAGTCAACAACAACAACACAC
T7_08550_G05	ACCACCACACACAAACCGTCACAACACAACCACACA
T7_08551_G05	CAACACCACAAACACACGTCACAACACACACACCAC
T7_08552_G05	ACACACACAAACCACCAGTCACACACCACAACACCA
T7_08553_G05	ACCAAACACCACACAAAGTCCACCACCACACAACAC
T7_08554_G05	ACAACACCACACAACACGTCACACACACAAACCCAC
T7_08555_G05	ACACACACAACACACACGTCACAACAACCACCACCA
T7_08556_G05	ACACACACAACACAAACGTCACCACACACCACCACA
T7_08557_G05	ACCAAACCACCACAACAGTCCCAACAACACACACAC
T7_08558_G05	ACCACAACAACACCAACGTCACACCAACACACACCA
T7_08559_G05	AACCACACACACCACAAGTCCACAACAACCACACCA
T7_08560_G05	ACAAACACACCACACACGTCCACACCACACAACACA
T7_08561_G05	ACCAAACACACAACACAGTCACACACCCACACACAC
T7_08562_G05	AAACACACCACAACACCGTCAACACCACACACACAC
T7_08563_G05	ACCCACACAAACACCACGTCCCAAAACACACACAAC
T7_08564_G05	CCAAAAAACACCACCCAGTCACACAAACAACCACCC
T7_08565_G05	ACACCACAAACACAACAGTCACACACCCCACACACA
T7_08566_G05	AACCACACACAACAACAGTCCACACCCACACACACA
T7_08567_G05	ACAACAAACCCACACACGTCACCACACACACACACA
T7_08568_G05	CACAACACCACACCACAGTCACACACACAAACACAC
T7_08569_G05	CACAACACACACACAACGTCACACCACACAAACACC
T7_08570_G05	AACAACCCAACACCACAGTCCACACACCACACAAAC
T7_08571_G05	CACACACACACACAAACGTCACACACACAACCACAC
T7_08572_G05	CACACACACACACACCAGTCACCCAACAACACAACA
T7_08573_G05	ACAACCACACACCCAACGTCACCACCACAAACACAA
T7_08574_G05	AAACACACCACCACAACGTCAACACACCAACCACAC
T7_08575_G05	ACCACACAAACCACAAAGTCCACAACACCACCACAC
T7_08576_G05	AACACACACCAACACACGTCCACACAAACCCACAAC
T7_08577_G05	AACACACACAAACACACGTCACACACCACACACCAC
T7_08578_G05	CACACACAACACACCCAGTCCAACCACAAAACCACA
T7_08579_G05	ACACCCCACAAACACACGTCAACCACCACAAACACA
T7_08580_G05	ACCACCCCACAACACACGTCACCAACAACAACAACA
T7_08581_G05	ACACACAACACACACCCGTCACAACACCAACCACAA
T7_08582_G05	AAACAACACCACACACAGTCCACACACACCACACAC
T7_08583_G05	CACACCCAAAACACAACGTCACAACACCCAAACACC
T7_08584_G05	CACACACCACCCAACCCGTCAACAACAAACACAACA
T7_08585_G05	ACACCACAAACCACCACGTCACACACACACACACAA
T7_08586_G05	CACACACAAACACAACAGTCCCACACAACACACACC
T7_08587_G05	CAACACAAACACCACCAGTCCACAACACACACACAC
T7_08588_G05	CACACACAACAACAACCGTCCACACAACACCCACAA
T7_08589_G05	ACCCACACACACAAACAGTCCAACACACACCACACA
T7_08590_G05	CAACACAAACCACCACAGTCCACACACAACACAACC
T7_08591_G05	AACACCACCCAACCCACGTCACAACACAACACACAA
T7_08592_G05	ACAACACAAAACCAAACGTCCCACACCCACACACAC
T7_08593_G05	AACACAAAACACCCACCGTCACACAACACACACCCA
T7_08594_G05	ACACACACAACACACACGTCCCAACAACCACACACA
T7_08595_G05	CCACACAACACACACACGTCACAAACACACCACACA
T7_08596_G05	ACACCACACAACAAACAGTCCACAACCACACCACAC
T7_08597_G05	ACACACCACACACACAAGTCCCACACAACACCAACA
T7_08598_G05	CACAAACACACCACCCAGTCACAACACACCAACACA
T7_08599_G05	AACAACACCCACACACCGTCCACAACCCACACAAAA
T7_08600_G05	CACACAACACCACACCAGTCCACACAAAAACCACAC
T7_08601_G05	CACACCACAACAAACAAGTCACCACCCAAACCACAC
T7_08602_G05	CCACACACAAACACAACGTCCAAACACACCAACACC
T7_08603_G05	AACACACACAACACCCAGTCCACACAACACACACAC
T7_08604_G05	CACAACCCACACAACAAGTCACACCAACACACCACA
T7_08605_G05	CACAACACAAACCCCACGTCAAACCCACACCAAACA
T7_08606_G05	ACACACACACACAACACGTCACCAACCCACACACAA
T7_08607_G05	ACACACACAAACAACCCGTCACACACCACACAACCA
T7_08608_G05	CACAAACACACACACAAGTCCCACCAACACCACACA
T7_08609_G05	ACACAACCACAAACACCGTCACAACACCCACAACCA
T7_08610_G05	CACAACCACAACAACACGTCACACACAACCACCAAC
T7_08611_G05	CAAACACACACCCCAACGTCAACCACCACAACACAA
T7_08612_G05	ACAACCACCACACACAAGTCCCAACCACACACAACA
T7_08613_G05	CCACCAACACAAACACAGTCCACACAACACACACAC
T7_08614_G05	AACACCCACAACACAACGTCCACACAAACCCAACAC
T7_08615_G05	CACAAAACCCAAACACAGTCCACACACACACCCACA
T7_08616_G05	CCAAACCCAACACAACAGTCCACACACACACACACA
T7_08617_G05	CACACACCACAACACCAGTCCACAACACAACACACA
T7_08618_G05	ACACAACACACACACCAGTCCAACACACAACACACC
T7_08619_G05	CACACACAACAACACAAGTCCCCACACACACACAAC
T7_08620_G05	ACACCCACACAACAAACGTCCCACAACACCACAACA
T7_08621_G05	CACAAACAACAACAAACGTCAACAACCCACCCACCC
T7_08622_G05	CCACACCACACACAAACGTCACACCACAACACAACA
T7_08623_G05	CACACCCACAAACACAAGTCCACAACACCCAAACAC
T7_08624_G05	ACACACAACACAACCAAGTCCCACACCAACACACCA
T7_08625_G05	ACACAACAACACACCAAGTCCACACACCACAACACC
T7_08626_G05	CACACCAAAAAACCAACGTCCCAACAACCCACACAC
T7_08627_G05	AACAAACACCCAACACAGTCCACCCAACCAACAACC
T7_08628_G05	ACACCAACCCAAAAACCGTCACACACCACACCACAA
T7_08629_G05	ACAACACACACAACAACGTCCACCCACACACAACAC
T7_08630_G05	CAACACACAAACACCACGTCACACACACAACAACCC
T7_08631_G05	CACAAAACCACAACCCCGTCACACACACAAACCACA
T7_08632_G05	CCAACACAAACCACACAGTCCAACACACACACAACC
T7_08633_G05	ACCACCCAACACACAACGTCAACCACAACACACACA
T7_08634_G05	CAACACACCCACCACACGTCCAACACAACAAACCAA
T7_08635_G05	AACAACAACACCACACAGTCCACCACACACCAACAC
T7_08636_G05	CAACACAACACACACCAGTCCAACACAACCACACAC
T7_08637_G05	ACACACCCACACAACCAGTCCAAAACCCCAAAACCA
T7_08638_G05	ACCACACACACACACCAGTCCACAACACACACACAA
T7_08639_G05	ACAAACACACACACCAAGTCCACACACCACCCACAA
T7_08640_G05	ACAACCACACAACACAAGTCACACCCAAACCCACCA
T7_08641_G05	CAACACAACCACAACCAGTCCCACACACACCAACAA
T7_08642_G05	ACACACACACACACACAGTCCACCACACACCAACAA
T7_08643_G05	ACACAACCAACAACACAGTCCACCCAACACCCACAA
T7_08644_G05	AAACACACAACCACACAGTCCAACACCACACCAACC
T7_08645_G05	ACACCCAACAACACAACGTCACACCACACAACCACA
T7_08646_G05	ACAACCACCAACACCAAGTCCACAACACCACACCAA
T7_08647_G05	ACACCACACAACACCACGTCAACAACCACACACAAC
T7_08648_G05	CCCAAACAACCAACAACGTCCACAACAACCACCACA
T7_08649_G05	ACACACCACACAACACAGTCCCAACAACCCAAACAC
T7_08650_G05	CACACCCACACCACACAGTCCAACACAAACACACAA
T7_08651_G05	ACACACACACAACCACAGTCCACACCACAACACAAC
T7_08652_G05	CAACACAACACACACACGTCAACACACACACACACC
T7_08653_G05	CCACAACCCACACCAACGTCACAAACACACAACCAA
T7_08654_G05	CAACAACACACACAACCGTCCACACACCACACAACA
T7_08655_G05	ACACACACACCACACACGTCAAACACAACCACACAC
T7_08656_G05	ACACAACACCCACCAACGTCCACACACAAAACACAC
T7_08657_G05	ACACACCACAAAACACAGTCCACCACACACCCACAA
T7_08658_G05	CCACACAACACACAACAGTCACACAACACCACACAC
T7_08659_G05	ACACACACCAACACACCGTCACAACACACACACACA
T7_08660_G05	CCACACACAACACAAACGTCACCACACCACACAACA
T7_08661_G05	ACACAACACCCCAAACAGTCCACACAACACACAACC
T7_08662_G05	ACACCACAAAACACACCGTCCACACAACCCCACAAA
T7_08663_G05	ACCCACACACACACACAGTCACACACAAACACCACA
T7_08664_G05	CAACACACACACACCACGTCACACACAACACACACA
T7_08665_G05	ACACCAACACACCAACCGTCACACAACCACACACAA
T7_08666_G05	CAACCACACACAACACCGTCAACCACCAACAACACA
T7_08667_G05	AACCAACCAACAACAACGTCCCACCACCACACACAA
T7_08668_G05	CACACACACCACACAACGTCCACAACCACAACAACA
T7_08669_G05	CAACACCACACACACACGTCACACAACAAACCACCA
T7_08670_G05	CACAACACACACACACAGTCCAAACAACAACACCCC
T7_08671_G05	CCACAAAACACACCAACGTCACACCAACCACAAACC
T7_08672_G05	CCAAACACACACACACAGTCCCACACAACACACAAC
T7_08673_G05	CACACAAACACACACCAGTCCCACCACACAAAACCA
T7_08674_G05	ACACACACACCACACACGTCACACAACACACACAAC
T7_08675_G05	ACCACACACACACCAAAGTCCCACACCCAAACAACA
T7_08676_G05	ACCAAACCCACACCACAGTCACACCAAACACCAACA
T7_08677_G05	ACAACAAACCCAAACCAGTCCACACAACACACCCAC
T7_08678_G05	AACAACCAACACCACCAGTCCAACACACACAACACC
T7_08679_G05	CCACACACACCACAAACGTCAACCACACAACAACCA
T7_08680_G05	ACACACAACACACAACAGTCCACACAAACACCCCAC
T7_08681_G05	ACACACAACACACACACGTCACACACCCACACACAA
T7_08682_G05	ACAACACACACCACCACGTCCAACAACAAACACCAC
T7_08683_G05	ACACACACAACACACACGTCACACACACACACACAC
T7_08684_G05	CACAACACACCACACAAGTCCCAACACACCACACAA
T7_08685_G05	ACAACCACACACACCCCGTCACACAAACACAACACA
T7_08686_G05	CACACAACCAACACCACGTCACAACACCAAACACAC
T7_08687_G05	ACCACAACACAACACACGTCAAACACACACACACCC
T7_08688_G05	ACACACACACAACACACGTCACCAACACACCAACAC
T7_08689_G05	CAACAACACCCACACAAGTCCACACAACCACAACCA
T7_08690_G05	ACACCAACACACACACAGTCCCAACACCACACCAAA
T7_08691_G05	ACACACCCACCCAAACAGTCCAAACACACAACACCA
T7_08692_G05	AACACAACACAACCCACGTCACAACACACACACCAC
T7_08693_G05	CCAACACACACACAACAGTCACAACACACCACACAC
T7_08694_G05	ACCACCACAAAACACCAGTCCACACACACAACACCA
T7_08695_G05	CACCACACACAAAACACGTCACAACCACCACAACAC
T7_08696_G05	CACACACACACACACCCGTCAACAAAACACCACACA
T7_08697_G05	ACACACAACAACACAACGTCCAACCCACACACACAC
T7_08698_G05	ACACACCCACACACCAAGTCCACACAAACCACACAA
T7_08699_G05	CACACAACACACACAAAGTCCACCCACCACACACAA
T7_08700_G05	ACACACACCACACCACAGTCACACAAACACAACCAC
T7_08701_G05	CACAAACCACCCACAAAGTCCACCACCAACAACAAC
T7_08702_G05	AACACACCCAACACCACGTCACACACACACAACACA
T7_08703_G05	CACACCCACACAACAAAGTCCACAACCACACACACA
T7_08704_G05	ACACACAACACACACAAGTCCCCACCACACAACACA
T7_08705_G05	CACCAACACCAACACACGTCAACACCACACACCAAA
T7_08706_G05	ACACCAACCACACAAACGTCACACACACAACACCCA
T7_08707_G05	ACACACCACACACCAACGTCACAACAACACACCACA
T7_08708_G05	CACAACCACACACAACAGTCAACACCCAACACCACA
T7_08709_G05	ACACACACACACACACAGTCACACAACACACACCAC
T7_08710_G05	CAACAACCACAACCAAAGTCCCACAAACACCACCCA
T7_08711_G05	CCACCACACACACACAAGTCACAACAACACCACACA
T7_08712_G05	CCACACCACACAAACACGTCACCCAACACAACAACA
T7_08713_G05	ACAACACCAACACAACAGTCCCAACCACCACCACAA
T7_08714_G05	ACACCACAACCACACCCGTCAACACAACAACACACA
T7_08715_G05	CCCACACACACACAAACGTCACACACCACAAAACAC
T7_08716_G05	CAACACACACACAACACGTCCACAACCAACACACAC
T7_08717_G05	AACACACACCCAACCACGTCCCACACCAACAACAAA
T7_08718_G05	AACACACACCACACACAGTCCACAACCCACAACACA
T7_08719_G05	AACACAACACACAAAAAGTCCACCCACACCACACCC
T7_08720_G05	CACAACAAACAAACACAGTCACACCCACCACACCAC
T7_08721_G05	AACACCAAACACACACAGTCACACACACCACCCACA
T7_08722_G05	CCAACACACACACCACAGTCCACAACACACACACAA
T7_08723_G05	ACACACCAACACACACAGTCAACACCCAAACCACCA
T7_08724_G05	ACACAACACACCAACACGTCCAACCCAACACACACA
T7_08725_G05	CAACCACACACACAACAGTCCCACAACAACACACAC
T7_08726_G05	CAACACCACAACACACAGTCAACACACACAACCACC
T7_08727_G05	ACAACCACACCACACCAGTCCAACACAAACAACACC
T7_08728_G05	ACACAACACACCACCACGTCACACAACAACACACCA
T7_08729_G05	CACACACCACCACACACGTCAACACAAACCAACACA
T7_08730_G05	ACACAAACACAACCACAGTCCCACCAACACACACCA
T7_08731_G05	AAACACACAAACCCCACGTCCACCAAACACACACAC
T7_08732_G05	CCACACAAACAAACACAGTCCCACCAACACACACAC
T7_08733_G05	ACACCACCAACCAACCCGTCACACACACAAACAACA
T7_08734_G05	ACACACACCACACAACAGTCCAACACCCAACCAACA
T7_08735_G05	CACACACACACACACAAGTCCACACAACACCACAAC
T7_08736_G05	CACCAACAAACACACACGTCACACACCACAACAACC
T7_08737_G05	ACACCAACACACAACACGTCAACCACACACACCAAC
T7_08738_G05	AAACCACACAAACACACGTCCAACCCACACACACAC
T7_08739_G05	ACACACCACACACAACCGTCAACAACACACACACAC
T7_08740_G05	CACACACACACAACACAGTCCAACCACAACCCACAA
T7_08741_G05	ACACCAACACAAACACAGTCCACACCACCAACACAC
T7_08742_G05	CACACACAACACCACACGTCACACAAACACACCACA
T7_08743_G05	ACACACAACACCACAACGTCACCCAACAACACACAC
T7_08744_G05	AACAACACCCACAACACGTCACACACACACAACACC
T7_08745_G05	AACACCACACAACACACGTCACCCAACCACAACACA
T7_08746_G05	ACACAACCAACACAACAGTCCACCACACACACACAC
T7_08747_G05	ACAACACACACACCAAAGTCCCACAACACACCACAC
T7_08748_G05	ACCCACACACCACACACGTCACAAACACAAACCACA
T7_08749_G05	CACACACCACAACACACGTCACACACACACAACCAA
T7_08750_G05	ACCACAACACCACACACGTCACACCAACAACACACA
T7_08751_G05	CACACCACAACACCACAGTCCAACCACAAACACACA
T7_08752_G05	ACAACCACAACACACACGTCCCACACACAAACAACC
T7_08753_G05	CCACACACAACAACACCGTCACAACCACACACACAA
T7_08754_G05	CACAACACCACACAACAGTCCACAACCACAACACAC
T7_08755_G05	ACCCAACAACACACCACGTCCACCACAACACACAAA
T7_08756_G05	AACAAACACCACCACACGTCACACCCACAACACCAA
T7_08757_G05	CCACAACAAACAACCACGTCACCACAAAACCACACC
T7_08758_G05	CAAACCACAACACCACCGTCACAAACCACACACCAA
T7_08759_G05	ACCACACACCAACAAAAGTCCAACAACCACCCCACA
T7_08760_G05	CAACACCACACAACCACGTCCAAACAAAACACCCAC
T7_08761_G05	AACACACCCACACAACCGTCACACACACACACACAA
T7_08762_G05	ACCACACACACAACACCGTCAACAACAACCACCACA
T7_08763_G05	CCACAAACACAAACCCAGTCCCACAACACAACACAC
T7_08764_G05	CACAACCACACACACAAGTCACAACCCACACAACCA
T7_08765_G05	ACCACAAACACACACCAGTCCCCAACAACAACCACA
T7_08766_G05	ACCACAACACCCACACAGTCACACACCAACAACACA
T7_08767_G05	ACACACACACACCAACAGTCCACAAAACAACCCCAC
T7_08768_G05	CAAACACACACCCACACGTCAACACACACAACACAC
T7_08769_G05	ACACAACACAACACACCGTCACCAACCCAACCAACA
T7_08770_G05	ACCACACACACAACACAGTCCACAAACCAACACCAC
T7_08771_G05	ACACACACACCACACACGTCCCAAAACACACCAACA
T7_08772_G05	CACACACCCCACACAACGTCAACACAAACCACACAA
T7_08773_G05	CAACACACAACAACAACGTCAACCCACACCCACAAC
T7_08774_G05	CAAACAACCACAACCACGTCACCACACACACACACA
T7_08775_G05	CACACACACACAACAAAGTCCCAACCAACCACAACC
T7_08776_G05	CACAAAAACACCACACAGTCAACACCACCCCACACA
T7_08777_G05	ACCACAAACCACACAAAGTCCAACCCACAACAACCC
T7_08778_G05	CAACAACAAACCACACAGTCCACCAACACCAACACC
T7_08779_G05	CACACCAACACACACAAGTCCACAAACCACACACCA
T7_08780_G05	ACCACACAACCAAAAACGTCACCAACACACCCACAC
T7_08781_G05	CAACACACCCACAACACGTCACCAAACAACACACAC
T7_08782_G05	CACAACACACCACACACGTCACAAACAACCCACACA
T7_08783_G05	AAACACACACCAACAAAGTCCACCCACACCACCCAA
T7_08784_G05	CAACACAACACACACACGTCAACACCACACACCACA
T7_08785_G05	ACAACACAACACACCCAGTCCACACAACACACCACA
T7_08786_G05	AAACACCACACACACACGTCCAACACCACCAACACA
T7_08787_G05	CACCAACAACACAAACCGTCCACACACAACCAAACC
T7_08788_G05	ACACACCAACACCACACGTCACCACAACACAACACA
T7_08789_G05	CACAACACACACCACACGTCACCCAACAAAACACAC
T7_08790_G05	ACCACACACACAACACAGTCACCACACAACACACAC
T7_08791_G05	CAACACACACCAACACAGTCAACACACAACCACCAC
T7_08792_G05	ACACACACCACAAACACGTCCAACCAACACACACCA
T7_08793_G05	CCACAACCACAACACACGTCACACAACACCACAAAC
T7_08794_G05	CAACACACACACACCACGTCAACCAAACCACCCAAA
T7_08795_G05	CCACACACACACACACCGTCCACAAACACAACACAA
T7_08796_G05	ACCAACACACACAACACGTCCCAACACACACACAAC
T7_08797_G05	CACAAAACACACAACACGTCACACCCAACACACCCA
T7_08798_G05	CACCACAAACACACACAGTCCACACCACAAACACAC
T7_08799_G05	CACACACAAACACACCAGTCCAACCCCAACACACAA
T7_08800_G05	ACACACAACACACCCACGTCACCACAAACACCAACA
T7_08801_G05	ACACAAAACACAACCCCGTCAACACAACCACACCCA
T7_08802_G05	AACACACCCAACCACCCGTCACACCAAACCAAAAAC
T7_08803_G05	CAACCAACACACACAACGTCCCAACACCCACAACAA
T7_08804_G05	ACACACAACACACAACAGTCACCACACCAACACACC
T7_08805_G05	CACACCACAACACACACGTCCCACACAAACACAACA
T7_08806_G05	ACACAACACACACCACAGTCCACACCAACAACACCA
T7_08807_G05	AACCACACCCAAACCACGTCAAACACAAACCAACCC
T7_08808_G05	CAACAAACACAACCACAGTCCACCACACACACCACA
T7_08809_G05	CCACCCAAACACAAAACGTCACCCAAACAAACCCAC
T7_08810_G05	CACACACCAACACCAAAGTCCAACACACACCCACAA
T7_08811_G05	CACCACAACAACACCAAGTCCACCAACACCCAACAA
T7_08812_G05	CAAACCACAACACAACCGTCCCACAAACACACACCA
T7_08813_G05	CCCACAACACAAACACAGTCACACACCACACCACAA
T7_08814_G05	CACACCACCACCAACACGTCACACACACACAACAAA
T7_08815_G05	AACAACAACACAAACACGTCACCAACCCACCACCAC
T7_08816_G05	CAAAAACCACACAACACGTCACCACCACCAACACCA
T7_08817_G05	CACACACCCCAACACCAGTCACACCAAAACACAACA
T7_08818_G05	AACCACAACCAACACAAGTCCCACAACACCACACAC
T7_08819_G05	ACACAAAACCCCACAAAGTCCAACCCACACCCAACA
T7_08820_G05	ACCACCCAACACAACAAGTCCACACACACAACACAC
T7_08821_G05	ACCACCACCAACCAAAAGTCCAACACCACACAACAC
T7_08822_G05	AACACAAACACCACCCCGTCACACAAACACACACAC
T7_08823_G05	ACCCCACACAAACACCAGTCACACCACACAACAACA
T7_08824_G05	ACACCAACAACCCACACGTCACACCAAACACACACA
T7_08825_G05	ACCACAAACCCACAACAGTCCACCCACAACAACAAC
T7_08826_G05	ACCACCAAACACAAAACGTCCACACCAACCACACAC
T7_08827_G05	ACACACACACCACCCACGTCACAACAACACCACAAA
T7_08828_G05	CACCCACACACACACACGTCCACAACAAACACAACA
T7_08829_G05	AACCACACACAACCAACGTCCACACAAACACCCACA
T7_08830_G05	ACAAACACAACCCACCAGTCCCACACAAACCACAAC
T7_08831_G05	ACCAACACAACAACACCGTCACACCACCCAAAACCA
T7_08832_G05	CCACCACCCACACACAAGTCCAAACACACAACACAA
T7_08833_G05	AACCACCACACACACACGTCCACAACACAAACACAC
T7_08834_G05	AACCACACACCAACACAGTCCACACACAAACCACAC
T7_08835_G05	ACACCAAAACCCCACCCGTCAACCAAACACAACCAA
T7_08836_G05	CACACAACACCCACAACGTCACCAACCACACAAACA
T7_08837_G05	CCAACACAAACACACACGTCACAAACACACACCCCA
T7_08838_G05	CAAAACCACACCACACAGTCCAACCAACACCACAAC
T7_08839_G05	AACCACACCCAACACACGTCACAAAACCAACCACAC
T7_08840_G05	CACACACAACAAAAACAGTCCCCACACACCCACACA
T7_08841_G05	CACACACACCCACCAAAGTCCACACCACAAAACCAA
T7_08842_G05	ACAACAAACACCCACACGTCACAACACACACCCAAC
T7_08843_G05	ACCCACAACCACAACAAGTCCAACAAACCACACCAC
T7_08844_G05	ACACAACCACACCACCAGTCCAACACACAACACACA
T7_08845_G05	CACACCACACCACCACCGTCCACAACACAAAAAAAC
T7_08846_G05	CCCACACACACACCACAGTCCAACACCAAAACAACA
T7_08847_G05	AACAACACACCAACCCAGTCCCACACACACAACACA
T7_08848_G05	ACCACACACAACCCACAGTCAACACACAAACACACC
T7_08849_G05	ACAACACACACACCAAAGTCAACACACCACCACACC
T7_08850_G05	CACCCACCAACACCAACGTCACACACAACAACACAA
T7_08851_G05	ACACACAACCACAACCAGTCCACCACACAACACACA
T7_08852_G05	ACCAACACCACACACAAGTCACACCAACAACACCAC
T7_08853_G05	ACACACCACACAACAACGTCCCACAAACAACAACCC
T7_08854_G05	CAACACCCACACAAACAGTCCACAAACCACACCACA
T7_08855_G05	CAACACAACACACCCAAGTCCACACACACACCACAA
T7_08856_G05	CCACCACCCACACCAAAGTCCACAACAACACAAACA
T7_08857_G05	ACCACAAACCACACCCAGTCACCCACACAAACAAAC
T7_08858_G05	CCACACACAACAAACACGTCCCACACCAACACAAAC
T7_08859_G05	AAACAACCCACCCCACCGTCACAACACCACACAAAA
T7_08860_G05	CCACAACACAACACCACGTCCACACCACCAAACAAA
T7_08861_G05	ACCACAAACCAACCCCAGTCCACAAACACACAACCA
T7_08862_G05	ACCACACCAAACACCACGTCACACCCACAAACAACA
T7_08863_G05	CCACACACCAACAACAAGTCCAACCACACACAACCA
T7_08864_G05	ACACACACAACACCACAGTCCACCACCACCACAAAA
T7_08865_G05	ACACCCACCAAACCACAGTCCACACCAAACAACCAA
T7_08866_G05	CACCCACCACCACACACGTCAAAAACCACACAACAA
T7_08867_G05	ACACCACACACACCAACGTCCACAACAACACACACA
T7_08868_G05	AACAACACACACACCAAGTCCCCAACCACACACACA
T7_08869_G05	ACAAACCAACACACCCAGTCACACACCACACCAAAC
T7_08870_G05	ACCACCAACCACCAACAGTCCAACACACAACACACA
T7_08871_G05	ACACACCACCAACAAACGTCACACCACCACACAACA
T7_08872_G05	CCACACAAACCACAACAGTCCCAACCACCAAAACCA
T7_08873_G05	CCACCAAACAACCCACAGTCACAACCACCAAACACA
T7_08874_G05	CACCACACCAAAACACCGTCACACACCACCAAAACA
T7_08875_G05	ACACACAACACACAACAGTCCACAAACACCCACACC
T7_08876_G05	CACACAACCACAACCACGTCAAAACCACCAACACAC
T7_08877_G05	CAAAAACACCACACACCGTCCACACACCACACACAA
T7_08878_G05	ACCCACCACCACAACACGTCAACACACACCAAAACA
T7_08879_G05	CACACAAACCAACACAAGTCAACACCCCACAACACC
T7_08880_G05	CCACCAACAAACACACAGTCCAAAACACACACACCC
T7_08881_G05	AACACACACCCCAACCAGTCACACCACAACACACAA
T7_08882_G05	ACACCACAACACACAACGTCACACCACAACACACCA
T7_08883_G05	AACACCACAACAACAACGTCACACCCACAACCCAAC
T7_08884_G05	CCAACACCACAAACCAAGTCCACACACACAACACAC
T7_08885_G05	AACACACAACACACACAGTCCCAACACACCCCACAA
T7_08886_G05	CACAACCACAAACAACCGTCACAACACCAACACCAC
T7_08887_G05	ACCACAAAAACCCCACAGTCACCCACCCAACAAACA
T7_08888_G05	AAACAACAACACCACACGTCAACACACACCCACCCA
T7_08889_G05	CACCCAAACACACACCAGTCACACACAACCAACACA
T7_08890_G05	ACACACCACACAACACAGTCACAAACCACACCCACA
T7_08891_G05	CACACACCACAACACAAGTCACACACACCCACCAAA
T7_08892_G05	AACAACACCACACACAAGTCCACCACAACCACACAC
T7_08893_G05	ACCCCACCACACCACAAGTCACACACAACACAAAAC
T7_08894_G05	ACACACACACACACACAGTCCACAAACACCCAACCA
T7_08895_G05	ACCACCACAAACACACAGTCACCAACACCCACAACA
T7_08896_G05	CCACAAAACCCAACACAGTCACACAAACACCCAACC
T7_08897_G05	CACCAACCAAACCCACAGTCCACACACCAAAACCAA
T7_08898_G05	ACACAACCCACACACCAGTCCCAAACCACACAAACA
T7_08899_G05	CACAACAACACACAACCGTCCCAAACACCCACAACA
T7_08900_G05	CCAAACACAACACAACCGTCCCAACCACCACAAACA
T7_08901_G05	AACCCACACCAACACAAGTCCCACACACCAACAAAC
T7_08902_G05	ACACACACACAACACAAGTCCCCACAACAACACCAC
T7_08903_G05	CAAAACACACCACCACCGTCAACAACACCACAAACC
T7_08904_G05	ACAACAACCACACACCCGTCAACACAACACACACAC
T7_08905_G05	ACAACCACACAACAACAGTCCAACCACCACACACAC
T7_08906_G05	CACACCACAACACACCAGTCACAACAACCACACACA
T7_08907_G05	CACAACAACACACCCACGTCCACACACAAAAACACC
T7_08908_G05	CAACACACAACACCACAGTCAACACACACACACCAC
T7_08909_G05	AACACCACACCACACCAGTCCAAACCCAACCAACAA
T7_08910_G05	CACCCAAACAACACCCAGTCACACAACAACCCAAAC
T7_08911_G05	ACACCCACCAAACCCACGTCACCAACCAACACAAAA
T7_08912_G05	ACCAACACACACCACAAGTCACACACAACCAACCAC
T7_08913_G05	ACAAACACAAACACACAGTCCACACAACCACCCACC
T7_08914_G05	CCACCACACAAACAACAGTCCCACACAAAACACCAC
T7_08915_G05	CCAACCCCAAACACACCGTCACACAACAACACAACA
T7_08916_G05	ACACACCAACCACACACGTCAACAACACCACCAACA
T7_08917_G05	CACACCCACAAACAACCGTCAACCCAAACAAACCAC
T7_08918_G05	CCACAAACAACCACCAAGTCCAACAACAACACACCC
T7_08919_G05	CACACCACAACCCCACAGTCAAACACAACACAACCA
T7_08920_G05	CACAAACCACACCCAACGTCCCAACAACACAACACA
T7_08921_G05	CACACACACACAAACAAGTCCCACACAACCACCACA
T7_08922_G05	AACAACCCAAAAACACCGTCACCACACACCACCACA
T7_08923_G05	CAAACACCAACAAACACGTCCAACCCACACAAACCC
T7_08924_G05	ACCACAAAAACCCAAACGTCAACCAACCACCCCAAC
T7_08925_G05	ACACAACAACACACAACGTCACACACACACCACCAC
T7_08926_G05	ACAACAACCCAAACAACGTCACCCACCCACCAAACA
T7_08927_G05	ACCAACACAAACAACACGTCACACCCAACCCACAAC
T7_08928_G05	ACCCCACAACCAAACACGTCCAAAAACCAACCACCA
T7_08929_G05	CAACAACACACAACACCGTCACCAACCCAACACCAA
T7_08930_G05	CAAAACCAACAACCCAAGTCCCACACCAACCACACA
T7_08931_G05	ACAACACAAAACACACAGTCCCCAACACCACACACC
T7_08932_G05	CCACCCAACCACAACAAGTCCAAACCCCAACACAAA
T7_08933_G05	CCAACCACACAACACACGTCACCAACAACACCAACA
T7_08934_G05	ACAACCCACAAACACACGTCCACAACCCAACACAAC
T7_08935_G05	CACAACCAACACCACCAGTCCACCAAACACACAAAC
T7_08936_G05	ACAAACCAACACCAACAGTCCACCACCACCACACAA
T7_08937_G05	ACAACAACAACCACCACGTCCAAACCACAAAACCCC
T7_08938_G05	AACCACCAAACCACCAAGTCCACAACACCAACACAC
T7_08939_G05	CACAAACAAACAAACACGTCCAACCCCAACCACCAC
T7_08940_G05	CACACAACACACACAAAGTCCCACACACAAACCCAC
T7_08941_G05	ACCACAAACCACAAAAAGTCCAACCCCACACCACAC
T7_08942_G05	AAAAAACACCACCAACCGTCACCACACACCCACAAC
T7_08943_G05	CACCCAACCCAAACAACGTCAACCACCAAACCAACA
T7_08944_G05	CACCACAACACACCCCAGTCAAACAACACAACACAC
T7_08945_G05	CAACCAACCACCAAACAGTCCCAACCAACCACACAA
T7_08946_G05	ACACACCACACCACAACGTCACCACACAACAACACA
T7_08947_G05	ACCCACACAAACACAACGTCAACCACCCACAACAAC
T7_08948_G05	AAACACACCACCACACAGTCCACACAACAAACCACC
T7_08949_G05	ACAAAACCACACACCACGTCCACACACACAACCAAC
T7_08950_G05	ACCACACCACACACCACGTCAACCACACACACAAAA
T7_08951_G05	ACAACAACCACAAACCAGTCCACCACAACCACACAC
T7_08952_G05	CACAAACCAAACACCACGTCCCAAAACCCCAAACAC
T7_08953_G05	AACCCAAACCAAAACACGTCCCAACCAAACACCACC
T7_08954_G05	CCAACACCACCCAAAAAGTCAACCAACACCCAACAC
T7_08955_G05	AAAACACCACACCCACAGTCCAACACACAACCACAC
T7_08956_G05	ACAACACACACACACCCGTCACAACCAACCCAAACA
T7_08957_G05	ACCACACACAACACCCAGTCCACCAACACCAAAACA
T7_08958_G05	CACCAACACCCCACAAAGTCCACACAAACAACCAAC
T7_08959_G05	CAAACAAAACAACACCCGTCCACCACAACCACACCA
T7_08960_G05	CACCCAAAACAAACCACGTCAACCCCACACACACAA
T7_08961_G05	CAAACCACCACACACAAGTCCCACACCAAACAACAC
T7_08962_G05	ACACACCCCACAACACCGTCAAAACACAAAACCCAC
T7_08963_G05	CAACACCCACACACAAAGTCCACACACACACCAAAC
T7_08964_G05	CAAACCAACCACACCACGTCACAACACCCCAACAAA
T7_08965_G05	CCACACAAACACACCCCGTCACAACACAAAAACACC
T7_08966_G05	ACACACCAACCAACACAGTCCCACCCAACAACACAA
T7_08967_G05	ACAACCCACCAAACCAAGTCCACACCCAACACAACA
T7_08968_G05	CAAACACACCACCAACCGTCAACAACACACCACAAC
T7_08969_G05	AACACACACACAACACAGTCCCCACACAAACACCAC
T7_08970_G05	ACACACAACACAACCACGTCACACACCACAACCCAA
T7_08971_G05	CACAACCAACACAAACAGTCCAACACCACACACACC
T7_08972_G05	ACCAAAAACACACAACAGTCCACACACCACACACCC
T7_08973_G05	AAACACACAAACACAACGTCACCCACCACACACCAC
T7_08974_G05	ACAAAACAACCCACAACGTCACCCACACACACACAC
T7_08975_G05	CACACCACCCACACCAAGTCACAAACACAAACACCA
T7_08976_G05	ACCAACACACCACACCAGTCACACACACACACAACA
T7_08977_G05	ACACAAACCACACCACCGTCAACAACACCACAACAC
T7_08978_G05	CCCACAACCACACACAAGTCCAAACACAACCCACAA
T7_08979_G05	ACCAAACCACAACACACGTCACACCCACAAAACACC
T7_08980_G05	CACCCCAAAAAAACAAAGTCCACACCCCACACACAC
T7_08981_G05	CACACACACAACACACAGTCCAACACACACACACCA
T7_08982_G05	ACAACAAAACCACCCAAGTCCAACACACCCACCAAC
T7_08983_G05	CACACACCAACACACACGTCCACCAAACACACAACA
T7_08984_G05	AACACACCACAACAACAGTCCACAACACACCCACCA
T7_08985_G05	CACACACCAACAAACACGTCCCACAACACACACACA
T7_08986_G05	ACACAACCACAACAACAGTCACCACAAAACCCACCC
T7_08987_G05	CCACAACAACCACACACGTCAACCCCACAAAACACA
T7_08988_G05	CACACCAACACAACACAGTCCACACCAACCAACACA
T7_08989_G05	CCAACACACACACACACGTCAACACACACCCAAAAC
T7_08990_G05	ACACACACACACACACAGTCACACCAACCACACAAC
T7_08991_G05	CCACACAACCACAAAACGTCCAACACCACAACACAC
T7_08992_G05	AACACCACAAAACACACGTCCACACCAACCCCACAA
T7_08993_G05	ACACACAACACCACCCAGTCCAAAACCACCAAACAC
T7_08994_G05	ACACCACACACAACACCGTCAACACACACCAACACA
T7_08995_G05	ACAACACACACACAACAGTCACCACCACACACACAC
T7_08996_G05	AACACACCCACAACAACGTCCCACACACACCACAAA
T7_08997_G05	ACACACCACCCAACCACGTCCACACAAACACAAAAC
T7_08998_G05	CAACCCACCACAACAACGTCAACAACCACAACCCAA
T7_08999_G05	AACAACCCACCACACACGTCCACACAACACACACAA
T7_09000_G05	ACACACAAAACAACACAGTCCACCACAACCACCCAC
T7_09001_G05	ACCACACCCACACAACAGTCCAACACCACCAAACAA
T7_09002_G05	AACAACACAACCCACACGTCCAAACCACCCACACAA
T7_09003_G05	AAACACACACACACAACGTCAACCCACCACACCCAA
T7_09004_G05	CACACACACAACACAAAGTCCACCCCAACACACAAC
T7_09005_G05	CACAACCACAAACAACAGTCCACACACACCACCAAC
T7_09006_G05	ACAACACCAACACCACCGTCCACACACAACAACCAA
T7_09007_G05	ACCACACCCACACAACAGTCCACACACAACAACACA
T7_09008_G05	ACAACAAACCCAACCACGTCCACCACAACACCAACA
T7_09009_G05	CACCAACCACACACCACGTCAAAACCACAAACACCA
T7_09010_G05	ACACACAAAACACACACGTCCACACACAACCACCAC
T7_09011_G05	CACCACAAAAACCAACAGTCCACACCACACCACCAA
T7_09012_G05	CACACACAACCCACAACGTCACACACACACACAAAC
T7_09013_G05	CACACACCACAACACACGTCCAACAACAACACACAC
T7_09014_G05	CACCACCACCACCACAAGTCAACAACCACAAACCAA
T7_09015_G05	CCACACCCACACACACAGTCACACACAACAACACAA
T7_09016_G05	AAACACCACAACCACACGTCACAACCACACACACAC
T7_09017_G05	CAACAACCCACCAACACGTCCCACAAACAACAACAC
T7_09018_G05	CCAACACCACAACAACCGTCACACACAACACAAACC
T7_09019_G05	CCCAAACACAACACAAAGTCACCACAAACACACCCC
T7_09020_G05	CAACACAACAACCAACAGTCCAACCACACACCACAC
T7_09021_G05	AAAACACACACACACACGTCAACCAACCCCACACAC
T7_09022_G05	ACAACACCACAACCACAGTCCACCAACAACCACAAC
T7_09023_G05	CACAAAACAAACACACCGTCAACACAACCCACACCC
T7_09024_G05	AACCACACAACACACCAGTCACAACACCACCCCAAA
T7_09025_G05	AACAACCACACCACACCGTCAACAAACCACACACAC
T7_09026_G05	ACCACAACCAACCAACAGTCACCACACACACACAAC
T7_09027_G05	ACACACCACCACAAACAGTCCCAAACAACACACACC
T7_09028_G05	CACACAACAACAACCCAGTCCACAACCACACACACA
T7_09029_G05	ACCACAACACACACACAGTCCCACACACAACAACAC
T7_09030_G05	ACAACCAAACACAACCAGTCCACCAACAACACCCCA
T7_09031_G05	CCCAACACCCAAACAACGTCCACACAAAAACCACAC
T7_09032_G05	CCACACACACAAACACCGTCACACAACCAACAACAC
T7_09033_G05	ACACAAACACCAACACCGTCACCAACACACACCACA
T7_09034_G05	AACACAACCACAAACCCGTCACACACACACACCACA
T7_09035_G05	CACACCAAACACCACACGTCACCAACACAACAACCA
T7_09036_G05	ACAACACACAACCACCAGTCAAACCACACACCCAAC
T7_09037_G05	ACCCAACAACAACCAACGTCAACCACCAAACACCCA
T7_09038_G05	AACACCCACACCACAACGTCACAAAACACAACCACC
T7_09039_G05	CAACCCCAAAAACACACGTCCAACACACCCAACACA
T7_09040_G05	CACACCACACCACACACGTCAAAACACCACAACACA
T7_09041_G05	AAACACCAACACCACACGTCCCACAACCCAACACAA
T7_09042_G05	CACCACCAACACACCACGTCCCAAACACAAACAACA
T7_09043_G05	AACACACACACACAACAGTCCCCAAACCACACCACA
T7_09044_G05	CCCACAACCACAACAAAGTCACAACACACCCACACA
T7_09045_G05	ACACACACCACCACAAAGTCCAACACAAACACCCAC
T7_09046_G05	CACCCCAACACACAAACGTCCACCACACAAAACAAC
T7_09047_G05	ACAACACACCACAACCAGTCAACACCCAAACCAACC
T7_09048_G05	CACCAACCACCAACACAGTCCACAACCACAACAACA
T7_09049_G05	ACACCCAAACCCACAACGTCACAACAAACACACACC
T7_09050_G05	CACACCACACACACAACGTCCACACAACAACACCAA
T7_09051_G05	ACAACACAAACCCACCAGTCACACACACCAAACCCA
T7_09052_G05	ACAACACACCACCCAACGTCACACAACCAACACACA
T7_09053_G05	ACACACAACCACCACAAGTCACACCCAAACCACAAC
T7_09054_G05	CACCCAAACACAACACCGTCAACACACCACAAACAC
T7_09055_G05	CAAAACCCCACCACAACGTCCCCAAAACAACACAAC
T7_09056_G05	ACAAACACCCAAACACCGTCACCACACCCAACAAAC
T7_09057_G05	AACACAACCAACCACAAGTCCACACACACCACACAC
T7_09058_G05	CAACCACACACCCACACGTCACACAAACAAACCCAA
T7_09059_G05	ACAAAACCACACAAACAGTCCCCACCAACACCCAAC
T7_09060_G05	ACAAACACAACACAACCGTCAACCAACACCACCACC
T7_09061_G05	CCAACCAACACCAACACGTCACCAACCAACACACAA
T7_09062_G05	AACACACCAACAACCACGTCACCCACCAACAACCAA
T7_09063_G05	CCAAACACCACACCAAAGTCCACCCAAACACACAAC
T7_09064_G05	ACACAAAACACAACCCAGTCCACCACCACCAAACCA
T7_09065_G05	ACCCACACACAAACCAAGTCACAACACCACAACCCA
T7_09066_G05	ACACACCCAAACACACAGTCACACACACACCACACA
T7_09067_G05	ACACACACACACCACAAGTCACCCACCACAACACAA
T7_09068_G05	CCACAACAACCACAACAGTCACCACCACACAAACCA
T7_09069_G05	ACCAAAAAAACACAACAGTCACCACCACACCCCACC
T7_09070_G05	CACACAACACACACAACGTCACACAACACCACACCA
T7_09071_G05	AACCACAAAACCAACAAGTCACACACCACCCCACAC
T7_09072_G05	AACACACACCACCACCAGTCCAACAACCCACACAAA
T7_09073_G05	CCACACAAACCACCACAGTCCACACACAACAAACAC
T7_09074_G05	CCACCACACCACACAACGTCAACCACAACAACACAA
T7_09075_G05	ACAACAAACCCACCCACGTCACACCAAAACCCACAA
T7_09076_G05	AACCACCAAAACAACCCGTCACACACAACCACACCA
T7_09077_G05	ACCCAACACACAAAAACGTCACAACACCCACACCAC
T7_09078_G05	ACACCCACCAACACACAGTCAACACACACCACACAA
T7_09079_G05	ACACCCACACACAACCAGTCCAAACACAACACACAC
T7_09080_G05	AACACACACAACACACCGTCAACAACCACACCCCAA
T7_09081_G05	ACACAACAAACCACCCAGTCCACACACACACAACAC
T7_09082_G05	ACAACACCACAACACCAGTCCAAACACACCACCACA
T7_09083_G05	CACACACACACCACACAGTCCAACACAACACACAAC
T7_09084_G05	CAAACCAAAAACACACCGTCCACCACAACACACCAC
T7_09085_G05	ACACAACACACCCACAAGTCAACAAACCACAACCCC
T7_09086_G05	CACAACCACAAACAAAAGTCACCACACACCCACACC
T7_09087_G05	CAACACAAACCAACACAGTCACCCACACCCAAACCA
T7_09088_G05	CACAACACACACACAACGTCCCCAACAAAACCACAC
T7_09089_G05	CCCAACCACACACACACGTCACCAACCCAAAAAAAC
T7_09090_G05	CACACAAACAACCACACGTCACACCACCCAAACACA
T7_09091_G05	AACAACCCACACACACCGTCAAACAACAACACCCAC
T7_09092_G05	CACAAACACACCACCACGTCCACACAAAACCACACA
T7_09093_G05	ACACACACACACCACCCGTCAAAAAACAACACACCC
T7_09094_G05	ACAACACACAAACCACAGTCAACACCACACCACCAC
T7_09095_G05	CACAACCAACACACACAGTCCACAACACCCACACAA
T7_09096_G05	CCACCACCACACAACACGTCACACACACACAAAACA
T7_09097_G05	AACACAACACACCAAACGTCACACACACCAACACCC
T7_09098_G05	CAACACCCCAACAAACAGTCCACACACAAACCACAC
T7_09099_G05	CCAACAACCACCACAAAGTCACACACAACCCACAAC
T7_09100_G05	ACACACCACACCCAAACGTCCACAACAACACCAAAC
T7_09101_G05	ACACACCACACACACAAGTCCAACACACACACCACA
T7_09102_G05	ACCCACAACAACAACACGTCAACCCACCCAACACAA
T7_09103_G05	AACACAACAAACCACAAGTCCCACCCCAACCACAAC
T7_09104_G05	CACCAAACCACACACCAGTCCAACCAACAACACACA
T7_09105_G05	CCAACCACACACAACAAGTCCAACACACACACACAC
T7_09106_G05	AACAACCACAACAACCAGTCCACCCACACAACACAC
T7_09107_G05	CACCAACCACACACAACGTCCCACACAAACACAAAC
T7_09108_G05	CACACAAACAACACCAAGTCCACAACACCAACCCAC
T7_09109_G05	CAAACACCACACAACCAGTCCCAAACCCCAACCAAA
T7_09110_G05	ACAACACACACACACACGTCACCAAACACACCACAC
T7_09111_G05	ACACACCACCACACACAGTCCCACACCAACAAAACA
T7_09112_G05	CAAAACCCACACACAACGTCACAACAACCACCACCA
T7_09113_G05	CCACACCACACACACACGTCACACACAAACACAACA
T7_09114_G05	ACCAACAAACAAAAACAGTCACACCCACCACCACCC
T7_09115_G05	AACACACCACCCACCACGTCAAAACACCACCAACAA
T7_09116_G05	CAACACACACCAACACCGTCACACAACACACAACAC
T7_09117_G05	CACACAACACACAACCAGTCCACCCAACACACACAA
T7_09118_G05	CACACACCACAAACCAAGTCCACACCAAACACAACC
T7_09119_G05	CACCACACCCCACAAACGTCACACACAAACACAACA
T7_09120_G05	ACAACACACCACACACCGTCACACAACACCAAACCA
T7_09121_G05	ACACAACACCACACAAAGTCCACCACCACACAACCA
T7_09122_G05	CACACACAAACACACACGTCACACACACACACACCA
T7_09123_G05	AACCAACACCCACCAACGTCACAACAACACACACCA
T7_09124_G05	CACAAAAACCCCAACAAGTCACCCCACACCAAACCA
T7_09125_G05	AACACCAACAACACCCCGTCACACACAACACACACA
T7_09126_G05	CCCACACAACAACAAACGTCACACACACCCAACACA
T7_09127_G05	CCAAAAACACACACCAAGTCCCACAAAACCCACACC
T7_09128_G05	AAACACACACCACAACCGTCCACCACACCAAACCAA
T7_09129_G05	AACACCACACACCCCACGTCAAACACAACAACCAAC
T7_09130_G05	AACCAACACCACACCAAGTCCACACCACAACACACA
T7_09131_G05	ACAACACAACACACACAGTCCCACACCACCCAAACA
T7_09132_G05	CACCCAACAACAAACCAGTCCACAACCACACAACAC
T7_09133_G05	ACACCAACACACCAACAGTCCACACACAACCACACA
T7_09134_G05	CAAACCAAAAACACACAGTCACACACCCACACCCAC
T7_09135_G05	CACAACACAACCCACAAGTCACACCACACACCAAAC
T7_09136_G05	CACACACAACCACACCAGTCCAACCAACAACACACA
T7_09137_G05	ACACCAACACACAACACGTCACAACCACACACCACA
T7_09138_G05	ACACACACACCCACACAGTCCAACCACACCAAACAA
T7_09139_G05	ACCACCACACACACACAGTCCCAACAACACAACAAC
T7_09140_G05	CACAAACCACAACACACGTCCACCCAACAAACACAC
T7_09141_G05	CCAAACACCAAAACACAGTCCCACACACCACACACA
T7_09142_G05	ACACCAACCAAAACAACGTCACACACACACACCCAC
T7_09143_G05	CAAACCAACACAAAACAGTCCACCACCAACCCACAC
T7_09144_G05	ACCAACAACCACAACACGTCCAAACACCCACAACAC
T7_09145_G05	CACACCCAACACACACAGTCAACACAACCACCACAA
T7_09146_G05	CCACAAACACACCACCAGTCCAACACAACCCACAAA
T7_09147_G05	ACCACCACACCCAAAAAGTCACACACAACACCCACA
T7_09148_G05	CCAACACACACCAACCAGTCCCACCAACAAACCAAA
T7_09149_G05	CACCACACACCAAAAACGTCAAACCCACCCACAAAC
T7_09150_G05	ACACAAACCACAACACAGTCCACACACCACACACAC
T7_09151_G05	ACCACACACACACCAAAGTCCACCACACACACAACA
T7_09152_G05	AAACACACCACCACACAGTCCAACCCCACAAACAAC
T7_09153_G05	ACCCCAAACAAACACACGTCACAACAACACACCACC
T7_09154_G05	CACCAACCCACACACAAGTCCAAACACACAACACAC
T7_09155_G05	AAACCACAACAACCCACGTCCACAACACACCAACAC
T7_09156_G05	CACAACCAACACCAACCGTCACCAACACAACAACCA
T7_09157_G05	CACCCACAACACAACAAGTCCAACAAACCCACCACA
T7_09158_G05	ACCACCCACCCACCAACGTCAACACACAACAAACAA
T7_09159_G05	CACCACAAACACCAAAAGTCACACAACCCACCCACA
T7_09160_G05	CCAACCACACCAAAAACGTCAACACACACCCAACAC
T7_09161_G05	CCACAACCACAACACACGTCACAAACACACCCAACA
T7_09162_G05	CCAACACAACACCAACAGTCCAACAACCACACACAC
T7_09163_G05	CACCCACACACCACCACGTCAAACAAACACAACAAC
T7_09164_G05	CAAAACACCAACACACAGTCCCCACAAAACACCACC
T7_09165_G05	ACACACACCCAACACACGTCAAACCAACCACCAAAC
T7_09166_G05	CCACACACAAACCACAAGTCCACCAAACACACCACA
T7_09167_G05	CAACACACAACAACACAGTCACCACACACACCACAC
T7_09168_G05	ACCACACCCCACACAAAGTCAACAAAAACCACCCCA
T7_09169_G05	CACACACCACACAACCAGTCCCACACAACACACAAA
T7_09170_G05	CACAACACCAACCACAAGTCCACACACAACCCACAA
T7_09171_G05	ACACAACACCACCCACAGTCCAACCCACCACAAAAA
T7_09172_G05	AAAACACCCCACACAACGTCCCACACACAACCACAA
T7_09173_G05	ACACAACACCCACACCAGTCAACACCAACACAACCA
T7_09174_G05	ACACACACCACCAACACGTCACACAACACCAACAAC
T7_09175_G05	CAAACAAACAACCACACGTCACCACCCCAACACACA
T7_09176_G05	ACACACAACAACAAACCGTCACACCACCACCCACAA
T7_09177_G05	CACACACCACACCAACAGTCCACAAACCACAACACA
T7_09178_G05	ACCCAACACCAACAAACGTCCCACCAAAACACCAAC
T7_09179_G05	ACACCACACAAACACACGTCCACACACCCAACACAA
T7_09180_G05	CCACACACCAAACACCAGTCACACACAACACAACCA
T7_09181_G05	ACAACAAACCAAACACCGTCACACCACACCAACCAC
T7_09182_G05	AACACAAACCAACCACAGTCCACACACACACACCAC
T7_09183_G05	CCAACACACACAACACAGTCACACACACAACCAACC
T7_09184_G05	CCACCAACCACACACAAGTCACACACCAACCACAAA
T7_09185_G05	ACACACACCCAAAAACAGTCCAACACACCACACACC
T7_09186_G05	CAACACACCACACACCAGTCAACCAAAACCCCACAA
T7_09187_G05	CCAACACACACAACACAGTCCACCACACCACCAAAA
T7_09188_G05	CACCAACACACAAACCAGTCCACAACAACCCAACAC
T7_09189_G05	ACCACACACACACCACCGTCAAACCAACAAACACAC
T7_09190_G05	CCCACAACAACCCAAAAGTCCACCACACCAAACAAC
T7_09191_G05	CCACAAAACCCCACCACGTCACCAACCACAAACAAA
T7_09192_G05	CAAAACCCACAACAACAGTCCACACACCACACACCA
T7_09193_G05	AACACCAACCACAAAACGTCACCAACACCCACAACC
T7_09194_G05	CAACACCCAAACCAAACGTCCACAAACACACCACAC
T7_09195_G05	CCACACAACAACACACAGTCCACACACCAACCAAAC
T7_09196_G05	CACCCACAACCAAACACGTCACACAACACAACCAAC
T7_09197_G05	ACACCAACCACAACCCAGTCACAACCACACAACAAC
T7_09198_G05	ACACAAAACACACACAAGTCCCCACACACACACCAC
T7_09199_G05	CAACACACCCACACACAGTCACCAACAACAAACACC
T7_09200_G05	AACCACACCACAACAACGTCCAACACCACACAACAC
T7_09201_G05	ACCAACCCACACACAAAGTCCCCACAAACAACCACA
T7_09202_G05	CCAACACCAACACACACGTCAACACAACCCCAAACA
T7_09203_G05	AACACACACCAAACCCCGTCACACCACACAACAACA
T7_09204_G05	CACACACACCAACCCACGTCCACCAAAACACACAAA
T7_09205_G05	ACACCCCAAACACAAACGTCACACAACAACCCAACC
T7_09206_G05	ACAAACACACACACCACGTCACCACACAACAACACC
T7_09207_G05	AAACCAAACCACACAACGTCACAAACCCCACAACCC
T7_09208_G05	CAAAACAACCAAACCCAGTCCCCACCAACCCACAAA
T7_09209_G05	CCAAACAACACACACAAGTCCAACAACACCCACCAC
T7_09210_G05	AACACACACCAACCCAAGTCCCACAACAACCACCAA
T7_09211_G05	ACCAACACAACCCACCAGTCCACCAAACACAAACAC
T7_09212_G05	ACACACAAACACAACCCGTCCACAACCCACACACAA
T7_09213_G05	ACACCCAAACAAAAACCGTCCACACCAACACCCAAC
T7_09214_G05	ACACACACCACACAAACGTCACACACACACAACCCA
T7_09215_G05	CACCACAACACCAACCAGTCCACACACCCAACAAAA
T7_09216_G05	CAACACCCAAACACACCGTCACACAAACACCACCAA
T7_09217_G05	CCCAACAACCCCACCACGTCAACACAACAACAACAA
T7_09218_G05	AAACACCACCAACACCCGTCAACACACAACAACACC
T7_09219_G05	ACCACACCACACACAAAGTCCAACCACAAACCCAAC
T7_09220_G05	CACACCCAACAACCACAGTCCAAACAACCAAACACC
T7_09221_G05	CCAAAACACCAACCCACGTCAACACCAACACACACA
T7_09222_G05	ACACACCAACCAACAACGTCAACAACACAACCCCAC
T7_09223_G05	ACCCAACACACAACACCGTCCAACCCAACAAACACA
T7_09224_G05	CCCACCCCAAAACACCCGTCAACAAACAAACAACCA
T7_09225_G05	ACAACCACACAACAACCGTCACACACACACCACCAA
T7_09226_G05	AACCACACCACACACAAGTCCCCAACACCCAAACAA
T7_09227_G05	AACAAACCAACCCACCAGTCAACCAACACCACACCA
T7_09228_G05	AACCACACCAACCAAAAGTCCACCACCACCACAACA
T7_09229_G05	ACACAAACCAACCCACCGTCCACAACACAACACCAA
T7_09230_G05	CACCAACACAAACCAACGTCCACAACCAACACACAC
T7_09231_G05	AAACACACACCCACCACGTCAACCAACAACACAACC
T7_09232_G05	ACAACCCAAACACCAAAGTCCAAACACACCACCCAC
T7_09233_G05	AAACACACACACACACAGTCCAACAACACACCCCAC
T7_09234_G05	AACAACCAACAACCACCGTCCAAACACAACCCCACA
T7_09235_G05	CACCACCACAAACAACAGTCCAACAACCACACAACC
T7_09236_G05	CAAACACACACCACACAGTCCACACAACACAACCCA
T7_09237_G05	CAACAAACCACACACACGTCCACCAACCAACACACA
T7_09238_G05	CCAAAACAACCACAAAAGTCCACCACACCACACACC
T7_09239_G05	CACACAACAAACCCACCGTCCACACAACAAAACCAC
T7_09240_G05	CCCAACACACACAAACAGTCCCACAAACCCACACAA
T7_09241_G05	ACCCAACACACCACCACGTCACAAAACCCAACAACA
T7_09242_G05	AAACAACACCACCCAACGTCACACAACACACACCAC
T7_09243_G05	ACAACCACCCCAAACACGTCACCCAAAACACAACAC
T7_09244_G05	CACCCCAACCAACAAAAGTCACCAACAAACCACCAC
T7_09245_G05	ACACAAAACCAACAACAGTCCCCACACCACCAACCA
T7_09246_G05	AACCCACAACCCCAACCGTCACAAACCAACAACACA
T7_09247_G05	CCCACACCAAAACAACCGTCCACAACAACAACCACA
T7_09248_G05	ACCACCAACAACACAACGTCAAACCCCACCCAACAA
T7_09249_G05	CACACACACACACCAAAGTCCACACACACAACACCA
T7_09250_G05	CAACAACCAACACAAAAGTCCAAAACCACCCACCCC
T7_09251_G05	ACCCACAACCCAACAACGTCCACAACAAACACCAAC
T7_09252_G05	ACCACAACCACCCACACGTCAAAACAACAACACACC
T7_09253_G05	CAACACACCACACAAAAGTCCACACCACACACACAC
T7_09254_G05	CCCAAACCCAACACCAAGTCACAACAACAACCACAC
T7_09255_G05	CACCACACCACAACAAAGTCCACACCAACACAACAC
T7_09256_G05	CCACCAACAACAAAAAAGTCCCCAACACACACCCAC
T7_09257_G05	ACCCCACCACACACACAGTCCAACCCCAAAAAAAAC
T7_09258_G05	AACCACCCCAACACACAGTCACAACCACACAACAAC
T7_09259_G05	ACACACCCACCACAACAGTCCACAACACAAACCAAC
T7_09260_G05	AACCCACCAACACACAAGTCCCAACAACACAACCAC
T7_09261_G05	CCAAACACAAAACCACAGTCCCACCCCACACACAAA
T7_09262_G05	AAACCACACCCACACAAGTCCCAACACCCCAAAACA
T7_09263_G05	ACCAACCAAAACCAAACGTCACACACCACACACCCA
T7_09264_G05	CACAACAAAAACACCCAGTCACAACACACCCACACC
T7_09265_G05	AAAACACAACCACCACAGTCCACAACACCCACAACC
T7_09266_G05	AACACACCCCACAACACGTCAAACACACAACCCACA
T7_09267_G05	ACAACAACCACAACACCGTCACCACACCAACAACAC
T7_09268_G05	CCACAACCACACACCCAGTCACACCAACAACAAAAC
T7_09269_G05	AAAACCCCACCAACCAAGTCCACAACCACACCCAAA
T7_09270_G05	CCAACACCCCACACACAGTCCACACAACACACAAAA
T7_09271_G05	CCACCCCAACACACACAGTCAAAACCACCACAAAAC
T7_09272_G05	ACCCACAACCACACACAGTCACAACCAACAACCAAC
T7_09273_G05	ACACACAAACAACCCACGTCCCCACAACCACAAACA
T7_09274_G05	CCCACCACCACAAACACGTCAACACAACACAAACAC
T7_09275_G05	AAACACCACACACAACCGTCACCACACACCCAACAA
T7_09276_G05	ACCCACCACCCCACCACGTCAAACAACACACAAAAA
T7_09277_G05	CACACACCACCCCACAAGTCCACAAAACAACCAACA
T7_09278_G05	ACACCAACACAACAAACGTCACACCACCCAACACCA
T7_09279_G05	CACACAACACCACACAAGTCCAAACACCCACCACAA
T7_09280_G05	ACAACCACCAACACAAAGTCACACCACCACCACACA
T7_09281_G05	ACCACAAACACAACCACGTCCAAACACCCACACCAA
T7_09282_G05	AACACACACAACACACAGTCACCACCCACAACCCAA
T7_09283_G05	ACAAACCAACCACACAAGTCCCAACAACCAAACCCC
T7_09284_G05	CAACCACCCACACACACGTCCCAACAAAAAACAACC
T7_09285_G05	CAAACCACAACACCCAAGTCCAACACACAACACCAC
T7_09286_G05	AAACCACCCACAACCCAGTCCAACCAAAAACACCAC
T7_09287_G05	ACAAACACAACAAACCAGTCCCAACCACCACAACCC
T7_09288_G05	CACACCCACACAACACAGTCAACCCACAAACACACA
T7_09289_G05	ACCACACACAAACCAACGTCCACACCACAAACACCA
T7_09290_G05	ACAAACACAACACAAACGTCACACACCACCACCCAC
T7_09291_G05	ACCACAAACCACAACACGTCCAACCACCAACACACA
T7_09292_G05	AACCAAACCCAACCACAGTCCAAAACAAACCCCACC
T7_09293_G05	ACCAAAAACCCCAACACGTCACACACCAACCACAAC
T7_09294_G05	ACACACACACACACCCAGTCACCAACACACAAACAC
T7_09295_G05	ACACACACAACCCAACAGTCAACACAACCCACACAC
T7_09296_G05	CCACACCAACAACAACAGTCCACACCACCAACACAA
T7_09297_G05	ACACCAAAACACCACACGTCCAAACACACACACCAC
T7_09298_G05	ACAAACACAACAACAACGTCAACCCACCACACCACC
T7_09299_G05	CCAACACACACAACCCAGTCAACACAACAACCACAC
T7_09300_G05	ACAAACCCCAACCAAACGTCACACCCAACAACCACA
T7_09301_G05	ACACACCAAAACAAACAGTCCACACCACAACACCCC
T7_09302_G05	ACCACACCACAAACACAGTCACACAACACCACACAC
T7_09303_G05	AACACAAACCCAAACCAGTCCAACACACCAACACCC
T7_09304_G05	CAACCAAACACCCAACAGTCCACAACAAACCACCAC
T7_09305_G05	CCCAACCAACAACACCAGTCACCCAAAACCACAACA
T7_09306_G05	ACACACACCACAACAACGTCCAAAACCAACCACCAC
T7_09307_G05	ACACAACACACCACACAGTCCACCACAACAACCACA
T7_09308_G05	AACACACCCAACCACAAGTCACCAACAAACCACCCA
T7_09309_G05	CCCAACACACACACCAAGTCCACACAACACCAAACA
T7_09310_G05	AACCCAACCAAACAACAGTCCCACACACACCCAAAC
T7_09311_G05	CCAACCACAACAACCCAGTCCAACACACACACACAA
T7_09312_G05	CCCAACACAAACAACCCGTCACCCACAAAAACCACA
T7_09313_G05	AACCCACACAAACACCCGTCACCAACAAACAAACCC
T7_09314_G05	AAACCCACAACACACACGTCACACCAAAACACCACC
T7_09315_G05	CACCACCCAACACAACAGTCCAAACCAACACCAACA
T7_09316_G05	CACACAACACAACACACGTCACAACCCACACACACA
T7_09317_G05	ACCAAACAACAACACACGTCCCCACACACCACAACA
T7_09318_G05	ACACACAAAAAAACCCAGTCCCCACCCCACAACACA
T7_09319_G05	ACAACCACAACCCACCCGTCCACACACAAACAACAA
T7_09320_G05	ACAACACACAACCACCCGTCAACACACACAACCCAA
T7_09321_G05	CCACACACAACCACACAGTCCACAACACACAACACA
T7_09322_G05	AAAACACCCCACACACAGTCACACCAAACACCCAAC
T7_09323_G05	CACACCAACAACACCACGTCCCCAAAAACACACACA
T7_09324_G05	CAACACAAACACAACACGTCACACACACACCCAACC
T7_09325_G05	ACCACACACAAAACAACGTCCACCCCACAACCACAA
T7_09326_G05	ACACAACAACACACACCGTCAAACACCACCACACAC
T7_09327_G05	CACACAAACCCAAACACGTCACACAACCACACCACA
T7_09328_G05	CCAAAACACACAACACAGTCCACACACACCAACACC
T7_09329_G05	CAACACACAACACAACAGTCCACACACCCAAACACC
T7_09330_G05	CACAACACCACCAAACAGTCACACACCCAACACAAC
T7_09331_G05	AACCACCACCAACACACGTCAACACACAACACACCA
T7_09332_G05	CAACACAACACAACACCGTCACAACACACAACCACC
T7_09333_G05	CCCAAACAACCACCACAGTCAACAACACCCAACACA
T7_09334_G05	CACACAAACACCAAACCGTCACAACCACAAACCCCA
T7_09335_G05	CACACAACACACCCACAGTCACCACACAAACACACA
T7_09336_G05	CCAAACCCACAACCACAGTCACACCAACCACAAACA
T7_09337_G05	AAACACCCACCAACACCGTCACCACACCAACACAAA
T7_09338_G05	CAACCCACACAAAAACCGTCAACCAAACACCACCAC
T7_09339_G05	CAACACACAACACACACGTCACACACACACACCACA
T7_09340_G05	CAAACACACACCCACACGTCCCAAACACACACACAA
T7_09341_G05	CACCCACCACACACCAAGTCCAACAAACCACACAAA
T7_09342_G05	CAACAACACACCAACACGTCACCAACACACCCAACA
T7_09343_G05	CACCACACAACACAACCGTCACACCACCAAAACAAC
T7_09344_G05	ACAACCACACACCACACGTCCCACACACACAAAACA
T7_09345_G05	AACACAACAACACCACAGTCCACCACCAAACCACAC
T7_09346_G05	ACAAACACCACCAACACGTCACCAACACACCACCAA
T7_09347_G05	ACCACACAAAAACACCAGTCCACCACCCACAACAAC
T7_09348_G05	CAAAACAAACACACCCCGTCACCAACACACCCACAA
T7_09349_G05	CAACAACAACCCACAACGTCACACCACACAACCACA
T7_09350_G05	ACAACACCAACACAACAGTCCAACCACCACACCCAA
T7_09351_G05	ACAAACCACAACCAACAGTCCACCACACCCAACCAA
T7_09352_G05	CAACCACACCAAACACCGTCAACCCAAACACAACCA
T7_09353_G05	CAACACACAACCAACCAGTCCACCAAAAACCAACCC
T7_09354_G05	CCACACACCACCACACCGTCAACACACAACAAAACA
T7_09355_G05	ACCAACACCCCACAAACGTCACACCACAAACAACAC
T7_09356_G05	CACAACAAACCCACCAAGTCCACCACCACCAAAACA
T7_09357_G05	CAACACCAACAAAAAACGTCACCACACACCCCACAC
T7_09358_G05	ACCCACACACCCAACCAGTCAAACACAACAACACCA
T7_09359_G05	CCCAACACAAACACACAGTCCACAACCACCAACAAC
T7_09360_G05	AAACAAACCCACAACACGTCACCAACCCAAACACCC
T7_09361_G05	ACCACAACCAACACCAAGTCAAAACACCACCCACAC
T7_09362_G05	ACACCCAACAACAACAAGTCCACCACACACCCAAAC
T7_09363_G05	ACCACACACACACAACAGTCCACACACCCACACAAA
T7_09364_G05	CAACAAAACACACAACAGTCCACCACCCCAACCACA
T7_09365_G05	CAAACCCACAAAACACCGTCACCCAAACACACCACA
T7_09366_G05	CCACAACACACACCCAAGTCCAACAAACCCAAACCA
T7_09367_G05	AACACACAACAACACACGTCCAACCCACACAACCCA
T7_09368_G05	AACCACAACACAACACCGTCCCAAACCCACAAACAC
T7_09369_G05	ACACAAACCCAACAACAGTCCAACACACCACCCACA
T7_09370_G05	CACACCACACACCACAAGTCCACACACACAACCAAA
T7_09371_G05	CACCAACACACACACACGTCACCACAACACAAACAC
T7_09372_G05	CCACAACCCCAACCACCGTCAACACCAAACAAAAAC
T7_09373_G05	CCCAACCCAACACCCAAGTCCACACACAAACAACAA
T7_09374_G05	CACCCACCACACACAACGTCCACAAACAAACCAAAC
T7_09375_G05	ACCCCAACACAACCACAGTCAAACCCACACAACACA
T7_09376_G05	CCAAAACCCACCACACAGTCCCAAAAACACCAACAC
T7_09377_G05	ACACCAAAAACACCCACGTCACACCACCAACAACAC
T7_09378_G05	ACACAACACACCACCAAGTCCCACCACACAACAACA
T7_09379_G05	CACACCAACACAAAACCGTCAACCCCACAAACCACA
T7_09380_G05	ACCACACAACAACCAACGTCCAAAACACCCACCAAC
T7_09381_G05	AAACCACAAACACCCACGTCCAACACAACCACAACC
T7_09382_G05	ACACCCACACCAACCAAGTCCAACCCACAAAACACA
T7_09383_G05	CAAACCAACACCACCAAGTCCAACCCACACAAACCA
T7_09384_G05	CACCACCACACAACACCGTCACAACACCACACAAAA
T7_09385_G05	ACAACAAAAACCCACCAGTCCACACACAACCACCAC
T7_09386_G05	CCAACACACACCCAAACGTCCAAACACACCCAACAA
T7_09387_G05	CCACACACAACACACCAGTCCAACACCAACACAAAC
T7_09388_G05	AACAACACACACCACACGTCAACAAACCCACCACAC
T7_09389_G05	CACACACCCAACCACACGTCAAAACCAAACCACAAC
T7_09390_G05	ACAACCCACCACAAACAGTCACCACCAAACCAAACC
T7_09391_G05	AAAACAACAACACCCCAGTCCCACCACACAACAACC
T7_09392_G05	CCACACAAACACCACACGTCAACCACCACCAAACAA
T7_09393_G05	CCCAACAACACCACCACGTCAACCCAAACCAAAACA
T7_09394_G05	CCAACAAACCACACCACGTCCACACAAAAACACACC
T7_09395_G05	CACAAAACCAAACACAAGTCCCACACACCCCACAAC
T7_09396_G05	CACCCACCAAACACACAGTCCACAACACACACCAAA
T7_09397_G05	ACCAACCAAACAACACAGTCCCAAACCACACCACAC
T7_09398_G05	CCAACACAACCAACACAGTCCACACACACACACCAA
T7_09399_G05	AACCACACCAAAACAAAGTCCACACCCACCCAAACC
T7_09400_G05	CCCAACACACACCACAAGTCCACCACACCAAAAACA
T7_09401_G05	AACACACACACCAACACGTCAAAACCACCCACAACC
T7_09402_G05	CCACAACACACAACAACGTCCAACCACAAACACCAC
T7_09403_G05	CCACAAACCAAACCACCGTCACCAAAACACACCCAA
T7_09404_G05	CACACCCACAAACACACGTCAAACAACCACACACAC
T7_09405_G05	CACCACAACAACCACCAGTCAACACACCACCACAAA
T7_09406_G05	AAAACCCACCAAAACACGTCAAACACACCACCCACC
T7_09407_G05	AACACAACCACAACCAAGTCCCCACACACACACCAA
T7_09408_G05	ACCCCACACACACCACAGTCCACAAAACACACAACA
T7_09409_G05	CCAACACAAACACCACAGTCCACACACCCAACAACA
T7_09410_G05	AACCAACACCACACAACGTCCAAACAACCACCACCA
T7_09411_G05	CACCCACACACCACACAGTCAAACACACACAACACA
T7_09412_G05	ACCACAACCACCAACAAGTCACACCCACCAAACACA
T7_09413_G05	ACAACACCCAACCCACAGTCACACACAACACAACCA
T7_09414_G05	CCCACAACCAACAAAAAGTCACCACCAAAACCCCAC
T7_09415_G05	CCCACACAACACCACAAGTCCAACACCACACAAAAC
T7_09416_G05	AAACCACAAACCACCACGTCACAAACACCAAACCCC
T7_09417_G05	CAAAACCACAAAAACCCGTCAAACCCACACCCCACA
T7_09418_G05	ACACACACACCACCACAGTCACCAACACCAACAACA
T7_09419_G05	CACAAACCACAACACACGTCACACCACAAACACCAC
T7_09420_G05	ACCACAAACACACACACGTCACACCACACAACACAC
T7_09421_G05	AAACACCAACACACACAGTCAACCCAACCACCCACA
T7_09422_G05	AACCCAAACCCACCACAGTCCACACACAAACAACCA
T7_09423_G05	ACAAAAAAAACACAACCGTCACCCACCCACCACACC
T7_09424_G05	AACCAAACAACCACCAAGTCACCACCCAAACACACC
T7_09425_G05	AACACAACACAAACCCCGTCACAAACACCACACCCA
T7_09426_G05	ACACACCAACACAAAACGTCACCCACCCAACACACA
T7_09427_G05	ACCACACACACAACCCAGTCCCAAAACCAACCACAA
T7_09428_G05	CAACCAACAACCCACACGTCACACACACCCAAAAAC
T7_09429_G05	CACACCAAACACACACAGTCCAAACCCACACACAAC
T7_09430_G05	ACACACCACCAACAAAAGTCACAACCACCAACACCC
T7_09431_G05	ACACACCAACACACCAAGTCCCACAAACCACAACCA
T7_09432_G05	ACAACCCACCAAACACCGTCACACAAAACAACCCAC
T7_09433_G05	CACCACAAACACACAACGTCACACACCACACAACAC
T7_09434_G05	CCACCACAACACACACAGTCACAACCAAACCACACA
T7_09435_G05	CACACCACCACCAACCAGTCACCAACAACACACAAA
T7_09436_G05	ACAAACACACCAAACACGTCAACCCACCCACACACA
T7_09437_G05	CACAACAACAACACCCAGTCAACACCACCAAACCAC
T7_09438_G05	AACCACCACCCACCACAGTCAACCACCAAAACAACA
T7_09439_G05	AAACACAACCCACCACAGTCACCCACACAACCAACA
T7_09440_G05	ACACCAACACCACACACGTCACAAAACACCACACAC
T7_09441_G05	CACCACAACACACACCAGTCACAAAACAACCCACAC
T7_09442_G05	CAACAAAACCACCAACCGTCACAAAACCCCAACACC
T7_09443_G05	ACCAACAACCACAACCAGTCCCAACCAACCACACAA
T7_09444_G05	AACCAACACCACACAAAGTCCCAAACACCCACACCA
T7_09445_G05	CCCAACACACAAACACCGTCCAACAAACAACACCCA
T7_09446_G05	ACCCAACACAAACCAACGTCCAACCACACCAACCAA
T7_09447_G05	CCCAACCAAACAAAACAGTCCACCCACACACACACA
T7_09448_G05	AACAAACAACACCCAACGTCACACACACACCACACC
T7_09449_G05	AACACAACCACAACACAGTCCCACAACACACACCAC
T7_09450_G05	CAAACACACAAACCACCGTCCACAACACCACACAAC
T7_09451_G05	CAACCACACAACACCACGTCACACAACACACCAACA
T7_09452_G05	AAAACACACACCCCACAGTCAAAACCCACCACCACA
T7_09453_G05	CAAAACCACACCAAAAAGTCCCACAACCCCAAACCC
T7_09454_G05	AACACAACAACCCACCAGTCAACCACCAACCACACA
T7_09455_G05	CAACAACACAACACACCGTCCACCACACAACACACA
T7_09456_G05	CACACAACCAACCAACAGTCACACACACACACCACA
T7_09457_G05	CACACCACCACAACACCGTCAACACAAACCACAACA
T7_09458_G05	CCCACCACACCCAAACCGTCAAACCACAAAACAACA
T7_09459_G05	CCAACAAAACACCACCAGTCACAAAACACACACCCC
T7_09460_G05	ACCACAAACACAAACACGTCACAACCCACACCCACA
T7_09461_G05	ACACCACCAAACCAACCGTCAACAACACCAACCAAC
T7_09462_G05	CACCAAAAACACCCACCGTCAACACCCAACAACACA
T7_09463_G05	ACACCCCAAAAAACCACGTCACACACACCACACACA
T7_09464_G05	CAAACACACACACACCAGTCCCAACCAAAACCCAAC
T7_09465_G05	AAACACACACACAAACCGTCCACAACCCACACACAC
T7_09466_G05	CACACACAACAACCCCAGTCCAAAACCACAAACCAC
T7_09467_G05	CACAAACACACACCACAGTCAACACACAACAACCCC
T7_09468_G05	CACAACCACAACACAACGTCACACCCACAAACACCA
T7_09469_G05	ACCCCAAACACAACACAGTCACACACAACACCACAC
T7_09470_G05	CAACCCACACCAACACAGTCCAACACACACACAAAC
T7_09471_G05	CAACACACAACACAACAGTCCCCACCAAACCACACA
T7_09472_G05	ACAAACCCACCAAAAACGTCACCACACCCCAACACA
T7_09473_G05	ACACACACACCACCCAAGTCCAACAACCACAAACCA
T7_09474_G05	CACCCAAACACACACACGTCAACAACACCACACAAC
T7_09475_G05	ACCAACAACCACCACCAGTCAACAAAAACCACACCC
T7_09476_G05	AACCACCACACAACCACGTCACCACAAAACCAACAC
T7_09477_G05	CACACAACCACAAACAAGTCCCAACCAACACACCAC
T7_09478_G05	AAACACCACACACACACGTCACACCAACACACACCA
T7_09479_G05	CACAACCACAACACAAAGTCACCCCACACACCAACA
T7_09480_G05	AAACCACACAACACCACGTCACAACCCACAAACACC
T7_09481_G05	CACAACCAAAACCAACAGTCACAACCACACACCACC
T7_09482_G05	AACACCCCAAACCCACAGTCCCACAACAACACAACA
T7_09483_G05	AAACACCCACCCACCAAGTCCACACAAACCCAAACA
T7_09484_G05	CCACACACACAACACAAGTCCACAACCACACAACAC
T7_09485_G05	AACCACCAAACCACCACGTCAACCCCAAAACACACA
T7_09486_G05	CACAACCCAACAACACCGTCACCCAACCAAAACAAC
T7_09487_G05	AAACCACCACACACAACGTCACCAAACAACACACCC
T7_09488_G05	CCACACCCAACAACACAGTCAACCACACAAACCAAC
T7_09489_G05	ACCACCAACAACACCACGTCCCAAAAACCAACCACA
T7_09490_G05	CCACAACACACACAACAGTCCAACAAACACACCCAC
T7_09491_G05	CAAAACCCACACACCACGTCCAACACCAAACCAACA
T7_09492_G05	ACACACCACACCAACACGTCCCACAAAACACACCAA
T7_09493_G05	AACCCAACAACACCAAAGTCCCACCACCACAACACA
T7_09494_G05	AACACACACAACACACCGTCAACAACCAACACCCCA
T7_09495_G05	ACACACAAACAACACCCGTCACAACAACCCACCAAC
T7_09496_G05	ACAACCACCCAAACCACGTCCAACAACCAAACCACA
T7_09497_G05	ACCCAACAACACACCCAGTCAACCACACACACACAA
T7_09498_G05	AACCACAAACCACACCCGTCAAACCCAAAACACCAC
T7_09499_G05	ACACAACAACCCACCACGTCAACCACCAAACCAACA
T7_09500_G05	ACAAACCACCCAACACCGTCACCACACAACAACACA
T7_09501_G05	AACAACCCACCACACACGTCCAACAAACCACAACAC
T7_09502_G05	CCAAACACCAACAAACAGTCCACACCACCCAAACCA
T7_09503_G05	CCACCACAACACCCACAGTCCCACCAAACAAAACAA
T7_09504_G05	ACAACAAACACCACCACGTCACACAAACACACACCC
T7_09505_G05	CAACCACCCACAAACCAGTCACAAAACACACCCCAA
T7_09506_G05	CACAAAACACAACCACAGTCCACCCACACAACAACC
T7_09507_G05	CAACACACACAACACACGTCCACCCACAACACCAAA
T7_09508_G05	CACACACAACAACCACAGTCACCACACCACACCAAA
T7_09509_G05	ACAACACCAACACAACCGTCACACCAACCACACACA
T7_09510_G05	CCAAAACAACACCCAACGTCCCAACACAACCCAACA
T7_09511_G05	ACACACCACACACCCACGTCACAACCCCAAAAAACA
T7_09512_G05	CCACAACCAACAACCAAGTCAACACCACAACCACAC
T7_09513_G05	CACACCAACCAACCACCGTCAAACCCAAACAACCAA
T7_09514_G05	CCACAACCCAACACAAAGTCAACACACACACACCAC
T7_09515_G05	ACCCCACAAACAACCCAGTCAAACCACACACCAACA
T7_09516_G05	CCCAAACACACAACACAGTCACAACACCACACCACA
T7_09517_G05	AACCAACCACACACCAAGTCCAACACACCCAACAAC
T7_09518_G05	AAAAACACAAACACACAGTCACACCACCCACCCACC
T7_09519_G05	CAACAACCCCAAACACAGTCCAACACCCACACACAA
T7_09520_G05	AACCACACACACACACAGTCCACCACACAAACACAC
T7_09521_G05	ACAAACCAAACACACACGTCAACAACCCCACCCCAA
T7_09522_G05	ACAAAAACCACACCCAAGTCACCCACCACACACCAA
T7_09523_G05	ACCACAACAAAAACCCAGTCCACACCCACCCACAAA
T7_09524_G05	AAACAACACCCACACAAGTCCACCAACCACAACACC
T7_09525_G05	CACACCCCACCAAACAAGTCCACAAACACACCAACA
T7_09526_G05	CACCAAACACCACAAACGTCCAACCACCACACACAA
T7_09527_G05	CAAAACACCACCACACAGTCCAACCACCCAAAACCA
T7_09528_G05	AAACACCACACACAACCGTCCCACACCAAACCACAA
T7_09529_G05	ACCCAACCAAACAAACAGTCCAACCCACACACACAC
T7_09530_G05	ACCCAAAAACCACACCAGTCCACACAACCAAACACC
T7_09531_G05	CACAACACAACCACCAAGTCCACACACACACAACAC
T7_09532_G05	CAAAAACACCACCACAAGTCCAAACCACAACCCCAC
T7_09533_G05	ACACAACAAACACCCACGTCACACAACAACCCCACA
T7_09534_G05	ACAACACCCAACAACACGTCAACACACCACCACCAA
T7_09535_G05	ACACAACCCAAACACCCGTCACACACCAACAAACAC
T7_09536_G05	AAAACACACCCAACACAGTCCCACCAAACCACACAC
T7_09537_G05	AAACAACACCACCAACCGTCAACAAAACCCCACACC
T7_09538_G05	ACAAACCCACACAAACCGTCACACAACACACACACC
T7_09539_G05	CACCAACCAACACCAAAGTCACAAACCACACACCCA
T7_09540_G05	CACACCACAAACCCACCGTCACACCAACAAAACAAC
T7_09541_G05	CCACCACCAAACAACCAGTCACAACACCCACAAACA
T7_09542_G05	ACACACACCACACCACCGTCCCAAACACAAAAACCA
T7_09543_G05	ACAAACACAACCACAACGTCCCCACCAACCACACAA
T7_09544_G05	ACCCAACCACACAACACGTCCAAACAAACCAACACC
T7_09545_G05	ACAAACACAACCAACCAGTCCACACAACCACCACAC
T7_09546_G05	CAACACACAAACACCAAGTCCCACAACCACAACCAC
T7_09547_G05	AAACAACCACACCCCACGTCAACAAACACACCCAAC
T7_09548_G05	CACAACCCCACAAAACAGTCCAACAACACACCACAC
T7_09549_G05	ACACACCACAACCCACAGTCAACAACCCACACACAA
T7_09550_G05	ACACCCACCAAACCCCAGTCCAACAAACACACAACA
T7_09551_G05	ACACACCCACCCAACACGTCCAAACAACAACACACA
T7_09552_G05	AAACCAACCACACAAACGTCAACACCACCCACACAC
T7_09553_G05	CCACACCCAACACACAAGTCACAACAACACACCAAC
T7_09554_G05	CAACACAACCACACACAGTCCACCCACCAAAACCAA
T7_09555_G05	ACACCCACACAAACACCGTCAAAACACCACAACACC
T7_09556_G05	CACCACAACACACACACGTCACCACACACAAAAACC
T7_09557_G05	AAACACAACACACCCACGTCCACCACAACAACACAC
T7_09558_G05	AAACCACACAACCACCCGTCAACCAACACCAACACA
T7_09559_G05	CAACAACACCAAACCAAGTCACACCACACCCACCAA
T7_09560_G05	CAACCACACAACCCACAGTCACACCAACAAAACCAC
T7_09561_G05	CCAAACACCCCACACCAGTCACAAAACACCCACAAA
T7_09562_G05	CAAACACCACAAACACAGTCACAACACACACCCACC
T7_09563_G05	AACACCAACACCACAACGTCAACCCCAACACCACAA
T7_09564_G05	CACCAAACACCAAACCAGTCAACCCACCACAACAAC
T7_09565_G05	CCAACACAACAACAACAGTCACCAACCACACACCAC
T7_09566_G05	CCCAAAAAAACAACACCGTCCAACACACACCACACC
T7_09567_G05	ACACAACAAAACAACCAGTCCCCAAACCCACCCCAA
T7_09568_G05	CCACAAACCACAACCAAGTCACCAACACCACACACA
T7_09569_G05	ACCCACACCACAAACACGTCAACAACACACACCAAC
T7_09570_G05	CACACCCAAACACAAAAGTCCACAACAACCACCACC
T7_09571_G05	AAACCACACCAAAACCCGTCCAAAACACACACCACC
T7_09572_G05	AACACCACACCACAACAGTCACACAAACCACCACCA
T7_09573_G05	AACAACCAACCACCAACGTCAACACCCACCACACAA
T7_09574_G05	ACACCACCAACCACCACGTCAACAACAAAAAACCCC
T7_09575_G05	CCAACCAAACAAAAACCGTCCACCCAAACACCCAAC
T7_09576_G05	ACAACCCAAAACCAACAGTCCCACACAACCCAACAC
T7_09577_G05	ACACCCACACAAACCACGTCACCACCAACACCAAAA
T7_09578_G05	ACACAACACACCACAACGTCCACACAACACACCAAC
T7_09579_G05	AAAACCAACACACACACGTCACACCACCCACAACAC
T7_09580_G05	CCAAACCCAAAACACAAGTCCACCACACCACACACA
T7_09581_G05	ACCACCCACACACACAAGTCAACCACACACACAACA
T7_09582_G05	ACCACCACACACCACACGTCACAACACAACACACAA
T7_09583_G05	AAACACCAACACACACAGTCACCACCACACACACCA
T7_09584_G05	ACACCCACAACCCACAAGTCAAACACCACCAACACA
T7_09585_G05	ACCACCAACAAAACACCGTCACCAACAACCAACACC
T7_09586_G05	ACAACAACACAACCACAGTCCACCCAACCCAAACAC
T7_09587_G05	CACACACACCACCACACGTCAACACCACAACAAACA
T7_09588_G05	ACCAACACCACAACCACGTCAAACACACACCACACA
T7_09589_G05	ACACACCACACCACACCGTCACAACAAAACCACAAC
T7_09590_G05	ACACAAAACCCACAAACGTCACCACACAACCACCAC
T7_09591_G05	CCCACAAAACACAACCAGTCAACACACCACCAACAC
T7_09592_G05	CCAACAAACCACACACCGTCAACACAACACCAACAC
T7_09593_G05	CACCCACACAACAACCCGTCAACACAACACAACCAA
T7_09594_G05	ACACACACACCCACACCGTCACAAAACCAACACAAC
T7_09595_G05	AAACACAAACACACCAAGTCACACCCAAACCCACCC
T7_09596_G05	CAACCACACACCACAAAGTCACCACAAACACCACCA
T7_09597_G05	ACACACACACACCCAAAGTCCACAACCACACAACCA
T7_09598_G05	ACACCCCAAACAACACAGTCCCACCACCAACACAAA
T7_09599_G05	CAAACCAAACACACCACGTCAACACACACACCACCA
T7_09600_G05	ACCACCCCACAACCACAGTCCAAAACACCCCAAAAA
T7_09601_G05	CACCCCAACCAACAACAGTCCAAAACACAACACCAC
T7_09602_G05	CCAAACACACAAACCCCGTCAACCAACACCCACAAA
T7_09603_G05	AACAAACCAACACCCACGTCACCACAACAACCACCA
T7_09604_G05	ACACACCACCCAAAACAGTCCCAAAAACAACACCCC
T7_09605_G05	AACCCACAAACAACCCAGTCCACACAAACAACCCAC
T7_09606_G05	ACCAAACAACCCAAAAAGTCCACACCCACACCCACA
T7_09607_G05	CACCACACACCAAACACGTCAAAACAACCCACACCA
T7_09608_G05	CACAACACACCAACAACGTCACACACACCCCACAAA
T7_09609_G05	CACCACCACCCCAAACAGTCCCCAAAAAAACCAACA
T7_09610_G05	CAAACACAACCAACACAGTCCACACCACACACACAC
T7_09611_G05	ACCACAAAACACCACCCGTCCAACAAAACACACCCA
T7_09612_G05	CAAACCCACCCCAAACAGTCAACAAACACACAACCC
T7_09613_G05	CCCAACAAACACCCACCGTCACACACCAACAAAAAC
T7_09614_G05	ACAACAACACACAAACCGTCCCAAACCAACCAACCC
T7_09615_G05	CACCACCACAACAAACCGTCAAAAAACCACCACACC
T7_09616_G05	CCAACACAAACCAACACGTCACCCAAACACCACACA
T7_09617_G05	ACCCCACCACCACACACGTCACAACAACACAAAACA
T7_09618_G05	CCCACAACAACACAAACGTCACACCACAAACCACAC
T7_09619_G05	CAACCAAAACCACCACAGTCAACACACACCACCACA
T7_09620_G05	ACACCCCAACACACCAAGTCAAAAAACCCACACCCA
T7_09621_G05	AACCAACAACCACCCCAGTCCACCAAAACAACCACA
T7_09622_G05	CAACCCAAACACCCCAAGTCACAACAACACACACAC
T7_09623_G05	AACCACCAAACAACCACGTCCAACACCACCCCAAAA
T7_09624_G05	CCCACACCAAACAAACAGTCCCCACACCAAAACACA
T7_09625_G05	CAAACACAAACCAACACGTCACACCCACCCAACACA
T7_09626_G05	ACCAACCACACAAAACCGTCCCACAACACCCACAAA
T7_09627_G05	CACACCAACAACAACCCGTCCACCACACAACAAAAC
T7_09628_G05	ACCACAAACCACCAAAAGTCCCACCCAAACACCAAC
T7_09629_G05	CAACCAAAACAAACCCAGTCCAACCCACCAAACCCA
T7_09630_G05	ACACACACACCAACCACGTCCACAACACACCAAAAC
T7_09631_G05	CAACAACAACACCCACAGTCAAACACCACACCCCAA
T7_09632_G05	ACCCACCCAAACCAAAAGTCCAACAAACACAACCCC
T7_09633_G05	ACAACCAACCCAACCACGTCAAACACACACACCCAA
T7_09634_G05	AAAAACCAAACACCACCGTCCCCACACACAACCACA
T7_09635_G05	AACACACAACAAACACAGTCACCCCACAACACACCC
T7_09636_G05	AAACACCCCACAAACCAGTCACCACACCACCACAAA
T7_09637_G05	AACACCCAACACACCACGTCACCAAACACCCACAAA
T7_09638_G05	CCCAACACCCACACAAAGTCCACCACAAACCAACAA
T7_09639_G05	CAACAAACACCACAACCGTCACCACCCAAAAACCAC
T7_09640_G05	AACCACCACCACAACCCGTCCAACAAACACACAACA
T7_09641_G05	CAAACCCCACCCACCCAGTCAACAAAACACACACAA
T7_09642_G05	ACCCACAACACCAAACAGTCACCCACAAACACAACC
T7_09643_G05	CCACCACAAACCAACAAGTCACCCCACCCACAAAAA
T7_09644_G05	CAACCCAAACACAACCCGTCACACAAACAACACCAC
T7_09645_G05	CACACACCCACCCAAAAGTCACACCAACCCAAAAAC
T7_09646_G05	CCCACACCAACAAACCCGTCCAACCAAAAAAACCCA
T7_09647_G05	AACCCAAAACCCAACACGTCCAACAACCCCAACACA
T7_09648_G05	CACCCACAACCACACCAGTCAACAACACAACACAAC
T7_09649_G05	CCAAACCCACAACACCAGTCACACCAAACAACACCA
T7_09650_G05	CCCAACACACAAAAACCGTCAAACACCCACACCACA
T7_09651_G05	CCCAAACAACCCCAAACGTCAAAACCCAACCAAACC
T7_09652_G05	CAACAAACAACACCAACGTCACCCCACCAACCAACA
T7_09653_G05	AAAACCAAAACAACCCAGTCCACCAACCACCAACCC
T7_09654_G05	AAACAAACCAAACCACAGTCCACAAACCCCACACCC
T7_09655_G05	AAAACCAACAACACCACGTCAACCCCAAACCCACCA
T7_09656_G05	CAACCCACCCAAACACCGTCACACACAACACAACAA
T7_09657_G05	AACCACCAACCCACAAAGTCAAACACCCCACACCAA
T7_09658_G05	CCCAAACCCAAACCACAGTCCACCCAAAACCCAAAA
T7_09659_G05	CAAAACCCACAACCCACGTCACACAACACACAAACC
T7_09660_G05	ACAAACCCAAACACCACGTCCCACCCACAACCAAAA
T7_09661_G05	CAAACCACACACCCAAAGTCCCAACCAAAAACCCAC
T7_09662_G05	ACCACACCCCAAACAAAGTCAAAACACCACACACCC
T7_09663_G05	AAACCCACACACAACAAGTCACACACCAACCACCCA
T7_09664_G05	CAACAACACACAACCCAGTCACCACAAACCACACCA
T7_09665_G05	AACCAACCACACAACACGTCAAAACCCCACACCACA
T7_09666_G05	CCAACAACAACCACCACGTCACACCACCCAAAAAAC
T7_09667_G05	ACCCACCACACAAAACAGTCCCAAAACCACCAACCA
T7_09668_G05	ACCCACCACAAACCAAAGTCACAACCCAACACCCAA
T7_09669_G05	ACACCCACCAAACCAAAGTCAACACACACCCACCAA
T7_09670_G05	CACCCAACCAACAACACGTCACACACCAAAACACCA
T7_09671_G05	CCACAACCAAACAAACAGTCCCCACCCAAAAACCAC
T7_09672_G05	ACCACCCCAACACACACGTCAACAACACAAAAACCC
T7_09673_G05	AACAACACACAACAAACGTCACCCAACCACACCCCA
T7_09674_G05	CAACCCACAACAACAAAGTCCACCAACCACCACCAA
T7_09675_G05	ACAACCAACAAACCCAAGTCCAAAAAACCCCACCCC
T7_09676_G05	CCACAACCCCAAAAAACGTCAACCACCAACACAACC
T7_09677_G05	CAACCACCACACCACAAGTCAAAAACACCACAACCC
T7_09678_G05	CACACAACAAAACACAAGTCCAAACCCCACCACCCA
T7_09679_G05	CCAAAACCACACCCACAGTCCAAACAACAACCACAC
T7_09680_G05	AACCAACACCACAAACCGTCACCCACCCACAAAAAC
T7_09681_G05	AACACCAAAACCCACACGTCCCACACCAACCAAAAC
T7_09682_G05	ACCCAAAACCACACCACGTCCAACAAACCAAACCAC
T7_09683_G05	ACCACCACCACCACCAAGTCAAACCAACCAAACCAA
T7_09684_G05	CCCAAACACAAACAAACGTCCACCAACACACACCAC
T7_09685_G05	ACAACACAAACAAACCAGTCCCACACCACACCCACA
T7_09686_G05	AAACACACCAACAAAACGTCCACCACCCACACAACC
T7_09687_G05	CCAACCACAAACACACAGTCAACCCACCAACCAACA
T7_09688_G05	AACCACACAACAACCCAGTCCACCACCAAACACCAA
T7_09689_G05	CACACACCACAACAAACGTCCCAACACAAACACCCA
T7_09690_G05	CACACCCAACACACCAAGTCCACACCAAACCAACAA
T7_09691_G05	ACAAAACACCAACACCCGTCACACAACCAACCCACA
T7_09692_G05	ACAACCAACCACAACCAGTCAAACAACAACCCACCC
T7_09693_G05	AAAACACACCCACACACGTCACAACCCAAAACCCCA
T7_09694_G05	CAAAAAACAACACCCCAGTCACCAAACCAACCACCC
T7_09695_G05	CCCAACCCAACCAACAAGTCACAAAACACCAACACC
T7_09696_G05	ACAACAACCCACAAAACGTCAACACCACACACACCC
T7_09697_G05	AACAACCCCACAACCAAGTCACCACCAAAAACCCAC
T7_09698_G05	CAACCCACCCAAACAACGTCCAAACCACCACAACAA
T7_09699_G05	ACACACCACACCCAACAGTCCAACACACAACAACAC
T7_09700_G05	AACCACCCAAACAAACCGTCCCAACACAACAACCCA
T7_09701_G05	ACAAACACCCAACAACCGTCCCACACCAACACCAAA
T7_09702_G05	CAACACAACAACAACAAGTCCCACCAACACCACCCA
T7_09703_G05	CACCCAAACCAACCAACGTCAAACCCAAACCCAACA
T7_09704_G05	CCCACACAAAAAAAACCGTCACACCACCACCAACAC
T7_09705_G05	AACACCACACAAACAAAGTCCAACACCACCCCAACC
T7_09706_G05	ACCACACACCACACACAGTCCAAAACACCAAACCAC
T7_09707_G05	ACCAAACAACAACCCACGTCCACCACACACAAACAC
T7_09708_G05	CACAACACACCACCCAAGTCCACAAACCACAACAAC
T7_09709_G05	AACACCCCACCACACACGTCACCCCACAAAAACAAA
T7_09710_G05	CAACCAAACAAACCACAGTCACACCAACACCCACAC
T7_09711_G05	ACACCCACAACCACACAGTCCAAACCCAAAACAACC
T7_09712_G05	AAACCACACACAAACACGTCACCCACCAACCAACCA
T7_09713_G05	AACACCAACAACAAACAGTCCAACCCCACCCCAACA
T7_09714_G05	AACACACACCACAAAAAGTCACACAACCCACCCACC
T7_09715_G05	CAACACCCCAAAAACCCGTCCACCCACAAAACCAAA
T7_09716_G05	CCCAACCAAAAACCCACGTCAAACCACACAACCACA
T7_09717_G05	CAAACCACCAACACAACGTCCCACCACAACAAAACC
T7_09718_G05	CAAACACACCCACCCACGTCAACAAAAAACCCACAC
T7_09719_G05	AACCCACCAACCCACCAGTCCAACACCACCAAAAAA
T7_09720_G05	CACAACAACCAACACCCGTCACCCAAAAACCACACA
T7_09721_G05	ACAAAACAAACCAACCCGTCCAAACCCACAACCCCA
T7_09722_G05	CAACCCCAACAACACCAGTCAACCCACAAACAACAC
T7_09723_G05	ACCACCACCCAAAAACAGTCCAAACCACACCAACCA
T7_09724_G05	AAACCCACACCCAAACCGTCACACACCACCAAAAAC
T7_09725_G05	CCACAAACACACAACACGTCCAACCCACAACACAAC
T7_09726_G05	CAACCACAAAAAACCAAGTCCCAACACCCCACCCAA
T7_09727_G05	CACAAAACACACACAACGTCCAACCACCAACAACCC
T7_09728_G05	AACCAAACACCAAACCAGTCACCACCCAACACAACC
T7_09729_G05	ACCCAAACAACCCAACAGTCCCCAACAACAAACCAC
T7_09730_G05	ACCCAAACAAAAAACCCGTCAAAACACCCCACCACC
T7_09731_G05	ACAACAACCCCACACACGTCACAAACCACCAACCAA
T7_09732_G05	AACAACAACCCACAAACGTCAAACACCACCCCAACC
T7_09733_G05	AAACACCACCCACCAAAGTCAACCCCACAACCAACA
T7_09734_G05	ACACACACCCCACACAAGTCACAACCACAACCACAA
T7_09735_G05	CACACAACCACAACAACGTCCAAACACCACAACCCA
T7_09736_G05	CCAAAACACCCAACACCGTCCACCACCCAAAACAAA
T7_09737_G05	CACCCAACCCCACAACAGTCCACACAACAACAACAA
T7_09738_G05	CCCACCACAACCACCAAGTCAACACACACCAACAAA
T7_09739_G05	CAAACCACCCAAAAACAGTCCCCACACACCCAAACA
T7_09740_G05	CAAACACCCCAAAACACGTCCACAACACACACCAAC
T7_09741_G05	CACCAACACAAAAAACCGTCACACCCCAACACACCA
T7_09742_G05	AACACAACACACCACACGTCACCACACCACCAACAA
T7_09743_G05	CAACACCAAAACAAACAGTCCCACCCAACCACCCAA
T7_09744_G05	AACAAACACAAACACAAGTCCCCACCCACCACCAAC
T7_09745_G05	CAAACACCCAAACCACCGTCCCAACACACCAAAACA
T7_09746_G05	CCAACCACACCACACCAGTCACCACACAAAAACACA
T7_09747_G05	ACCCAAACACACACACAGTCACACCAAAACACCCAC
T7_09748_G05	ACCCACAACAAAACAACGTCCAACCCAACCCACAAC
T7_09749_G05	ACACCACACAAAACCACGTCAAACACACACACCACC
T7_09750_G05	AACCACCCAACACCACCGTCAAACAACACACCACAA
T7_09751_G05	ACAACCCCAAAACACCCGTCCAACAAAACCACCCAA
T7_09752_G05	CCCAACCCAAACAACAAGTCCAAAACCCAACACACC
T7_09753_G05	CACCCAAAACCACCCACGTCAAACAAAAAACACCCC
T7_09754_G05	AACAAACCAACACACCAGTCAACACCACAACCCCAC
T7_09755_G05	AAACCACCAAACACACAGTCACCACCACACACCCAA
T7_09756_G05	ACCAACAAAACAAACAAGTCCACCCCACACACCCCA
T7_09757_G05	CACACCCAACCCAACCAGTCCCAACAAAAACCACAA
T7_09758_G05	CCAACACACAAAACAACGTCCACCCCACACAAAACC
T7_09759_G05	ACCCCAACAAAACAACCGTCACAACAACCACACACC
T7_09760_G05	ACAACCAAACACCACACGTCACCCACCAACAAACAC
T7_09761_G05	CACCACAACCAAACACCGTCAACACCCCAACAAAAC
T7_09762_G05	AACCAACAACCAAAACAGTCACCACCAACCCCAACC
T7_09763_G05	ACCAAACAACCAACACCGTCAACCACCACCAAAACC
T7_09764_G05	ACAACCACACAACACCCGTCACCACCAACAACAAAC
T7_09765_G05	CACAACCACCACCCAACGTCACCCACAAAACACAAA
T7_09766_G05	CACAAACCACCAAAACCGTCACAACACACACCACAC
T7_09767_G05	ACAAACCCACACACACCGTCAACAACAACACCCCAA
T7_09768_G05	CACCAACAAACACAACCGTCACCACACACAACACAC
T7_09769_G05	ACACAAAAAACCAACACGTCCCAACACAACCCCACC
T7_09770_G05	AACCCAACCCCAAACCCGTCCACACAAAACCACAAA
T7_09771_G05	AAACAAAACCAACCCCAGTCCACCCAAACACCCACA
T7_09772_G05	ACCACACCACACAAACAGTCCAACCCCACAACACAA
T7_09773_G05	CCAACACAACCCACACCGTCCACACAACAAACAAAC
T7_09774_G05	AACCACCACAAACACCCGTCCCAAAACCCACAAACA
T7_09775_G05	ACCACCCCACAACCCAAGTCCAAAAACCAACAACCA
T7_09776_G05	CCACCCAACAAAAACACGTCACCACACACAAACACC
T7_09777_G05	ACACACAAAACACCCACGTCCAACAACACCACACAC
T7_09778_G05	AAACCACCAACCACCACGTCCACCAAAACAACCACA
T7_09779_G05	ACCCCACAACAAACCCAGTCCACAACACCCAAACAA
T7_09780_G05	CAACAACCCCACACCAAGTCCACCACCAAAAAACCA
T7_09781_G05	CACAACCAAACACAAACGTCAACCACAAACCACCCC
T7_09782_G05	CCAACAAACACACACACGTCCACAAAACACACCACC
T7_09783_G05	CAAAAACACACACCACCGTCACACACCCAACAACCA
T7_09784_G05	CCACACAACACCCACAAGTCAAACCACACCACCAAA
T7_09785_G05	ACCCCACCAACCAAACAGTCACCCAAAACCCAAACA
T7_09786_G05	CACCAAAACACAACCAAGTCCAACCAACACAACCCC
T7_09787_G05	ACACAACCACCACCAAAGTCCAACCACACACAAACC
T7_09788_G05	ACACCACAACAAACCACGTCAACCAAACCACACCAC
T7_09789_G05	AACACCACCCAACACACGTCAACCAAACACAACCCA
T7_09790_G05	ACCCAAACCACAAAAACGTCCCCACCCACACACAAA
T7_09791_G05	CAACCCCAAACCAAACCGTCAACCAAACCACACACA
T7_09792_G05	AAACCACACAAACCAAAGTCCACCCAACCCCACACA
T7_09793_G05	CACACACCACCAAACACGTCCCAAAAACACACCAAC
T7_09794_G05	CAACACACCCACCCAAAGTCCAAACCCAACAACAAC
T7_09795_G05	CACAACAACCACAACCAGTCCCACACCAAACAACCA
T7_09796_G05	CACCCAACACAACCACAGTCCACACACCCAAAACAA
T7_09797_G05	ACACCACCCACCAACCAGTCAACACAACACAACACA
T7_09798_G05	CACACACACAAACACCAGTCAACCCAACACAACCAC
T7_09799_G05	ACAAACCCACCCCAACAGTCACACCAAACCACACAA
T7_09800_G05	CACACCAACAAACCAACGTCCAACCCACAACCACAA
T7_09801_G05	ACACCAACCACCACAACGTCCAACCACCACACAAAA
T7_09802_G05	ACACAACAACACACACCGTCCACCAACACACACACA
T7_09803_G05	AACACACCCAACAACCAGTCCCCACACAAACACAAC
T7_09804_G05	AACACACAACCCACACCGTCCACCCAAACAAACCAA
T7_09805_G05	CAAACAAACCCCACAAAGTCAAACCCCAACCACCAC
T7_09806_G05	AACCCAACACCCAACAAGTCAAACCACAACCACACC
T7_09807_G05	CACCACACCAACAAACAGTCCACACAAACACACACC
T7_09808_G05	ACACACACCACCACACCGTCACCCAACAAAAACACA
T7_09809_G05	CACACCCCAAACACAAAGTCAACCCAAACACCCAAC
T7_09810_G05	CCACCAAAACACAACCAGTCACAACCCCAAACAACC
T7_09811_G05	AACACCACACAACACACGTCAAACCCAAAACACCCC
T7_09812_G05	CAACCAAACCAAACCCCGTCAACACCCAACCAACAA
T7_09813_G05	CCCACACAAACAAAACCGTCCAACAACAACCACCAC
T7_09814_G05	CCACAACACCACCCAAAGTCACCAAAAACCCAAACC
T7_09815_G05	ACAACACACAACAACACGTCCACACACCCACAACCA
T7_09816_G05	AACCCCAAACACAACAAGTCACACAACCCACAACCC
T7_09817_G05	CCAAAACCACACACAAAGTCACCCACACACCAACCA
T7_09818_G05	ACAACCCAAAACCACCAGTCACCACACCCCAAACAA
T7_09819_G05	CCCAACCACACACACCCGTCAAAACAAACAAACCCA
T7_09820_G05	CAACACACAAAAACACCGTCCAACCACCACCCACAA
T7_09821_G05	CACAAAACCACACACCCGTCAACCACAAAACCACAC
T7_09822_G05	AACCCCACCCACAACACGTCAAACCAAACACCAACA
T7_09823_G05	CCCACAAAACACCAACAGTCAACACCCAAACACACC
T7_09824_G05	AAAAACCACCACAACACGTCAAACCACCCACACCCA
T7_09825_G05	CAAACCCCACAAACCACGTCCAACAACCCACAACAA
T7_09826_G05	AACACACAAACACACCAGTCAACACCCAACCACCAC
T7_09827_G05	CACCAAACAAACACCCAGTCAAACCCAAACCACCCA
T7_09828_G05	CCAAACAACCAAACCACGTCCAAACCCAAACACACC
T7_09829_G05	AAACCAACCAACCCACCGTCAACCCCAACAACACAA
T7_09830_G05	CACCACACACAACACCCGTCAAACACAACAACACCA
T7_09831_G05	CAACCAACACACCACAAGTCCACAACCACACCAACA
T7_09832_G05	ACACACACACAAACAAAGTCAACCAACCACCACCCC
T7_09833_G05	AACACCAACCAACACAAGTCAAACACACACCCCACC
T7_09834_G05	CCAACCAACAAAACCAAGTCCACCCCACACACAAAC
T7_09835_G05	AACACCAAACAACAAACGTCACCCCAAAACCCACCC
T7_09836_G05	AAACACACCACCCCACCGTCAACCCAAAACAAACAC
T7_09837_G05	CACCCAACCCCAACAACGTCACAAACAACAAACCAC
T7_09838_G05	CCCACACAAAACACCCCGTCACACAAACCCCAAAAA
T7_09839_G05	ACCCACCACACCAACAAGTCCAAAAACACCACCAAC
T7_09840_G05	ACACAAAACACCCAACAGTCCACCACACACACACCA
T7_09841_G05	CAACAACCACAACACACGTCACCACACCAACCCAAA
T7_09842_G05	ACAACAACCAACAACACGTCCACCAACCAAACCCAC
T7_09843_G05	CACCCACCACAAAAAACGTCACACCCAACCCAAAAC
T7_09844_G05	ACACAAACCAACACACCGTCCCACAACCCAACACAA
T7_09845_G05	CACCACAACAACACACAGTCCACACAACAACCAACC
T7_09846_G05	ACAACAAAAAAACCCACGTCCACCAACCACACACCC
T7_09847_G05	ACCCCAACCCCACCCAAGTCAAAAAACACACCCAAA
T7_09848_G05	AACACAACCAACCCCAAGTCCAACACAACACCCACA
T7_09849_G05	ACCAACAAAACAAACACGTCAACCCACCACCCAACC
T7_09850_G05	CACCAACCACACAACACGTCAAAACAACCACCCAAC
T7_09851_G05	CACACACACACCACCCCGTCAACCACAAAACAAAAC
T7_09852_G05	CACCAACCAACAACAAAGTCAACAAACCCCACCACC
T7_09853_G05	CCACACCAACCACAAAAGTCCAAACCCCACAACAAC
T7_09854_G05	CACACAACCAACCCAACGTCAAAAACACCACCAACC
T7_09855_G05	CAACACACAACCCCACAGTCCCAACCAACAAACAAC
T7_09856_G05	ACAACCACCCAACAACAGTCACCCAACCAAACCAAC
T7_09857_G05	CACCACACAACACACCAGTCAACAAACCAACCAACC
T7_09858_G05	ACACAACACCCACACCAGTCACCACAAAACCCACAA
T7_09859_G05	ACACACACAAACCACAAGTCACCCCACACCAACCAA
T7_09860_G05	CACAAACAAACCACACCGTCCAACACACAACCCCAA
T7_09861_G05	CCACACCAACACCACAAGTCAACAACACACCAACCA
T7_09862_G05	ACACACCACCCCAAAACGTCAACAAACACCACCACA
T7_09863_G05	CAAAACACCACCAACACGTCCCCACCACAAACACAA
T7_09864_G05	CACACACAACCAAACACGTCAACACACACCACCCAA
T7_09865_G05	AACAACCAACCACACCCGTCAACCACAAAAACACCC
T7_09866_G05	ACCAAAACCCACAAACAGTCCACACCAAACACCACC
T7_09867_G05	CACCCACCAACACAACCGTCCCAAAAAAAACCACCA
T7_09868_G05	AACAACCCAAACCACCAGTCACACCCACACAAAACC
T7_09869_G05	CCAAAACAAAACCAACCGTCCACCCAAACCCCAAAC
T7_09870_G05	ACCACCACACCCAACCAGTCCACACAACCAAAACAA
T7_09871_G05	AAACACCCACAACAAAAGTCCACCACACCACCACAC
T7_09872_G05	AACCAAACCACACCAACGTCACCACCCAAAACAACC
T7_09873_G05	CCACCACAAAACACAACGTCCCAAACAACACAACCC
T7_09874_G05	ACAACCCACCAAACACCGTCAACACACAACCCACAA
T7_09875_G05	ACCAACCCACCCAAACCGTCCACCAAAAACACAAAC
T7_09876_G05	CACCCACACACAAACCAGTCACAACCCCACAAAACA
T7_09877_G05	AAACCCACCCCAACAAAGTCACAACCCAACCCAACA
T7_09878_G05	CCAACACCCAACCACCAGTCCACAACACCCAAAAAA
T7_09879_G05	AACAACACCACCAACACGTCCCCAAACACCAAACCA
T7_09880_G05	AACAACCAACAACCCACGTCCCCACAACCAAACAAC
T7_09881_G05	CCAACCAACACACACAAGTCCCCACAAACCACACAA
T7_09882_G05	CACACAACACAACCAACGTCAACAACAACCCACACC
T7_09883_G05	CCACACCAAACACACACGTCACCAAACACCCAACAA
T7_09884_G05	CCACACAACAAACCACCGTCACAACAACCCACACAA
T7_09885_G05	CAAACAAACACCCCAACGTCCCAACAACACAAACCC
T7_09886_G05	CCCACACCAACACCACAGTCCCAAAACAAAACAACC
T7_09887_G05	CCAACCAAACCCAACCCGTCACAAACCACACAACAA
T7_09888_G05	AACCCACAAACCACAACGTCACCACAAACAACACCC
T7_09889_G05	CACCCAACACAACCACAGTCCAAAACCACCCAAACA
T7_09890_G05	CAACCCCACAAAACACAGTCCACACCAAACCCAACA
T7_09891_G05	CACAACCAACCCACAACGTCCAAAAACCCACACCAA
T7_09892_G05	ACCACAAACCACACACCGTCAACAAACAACCCACCA
T7_09893_G05	AACCAAAACCACACACAGTCCACACCAAACACCCCA
T7_09894_G05	ACACACCCCAAACCACAGTCAACACAAACACAACCC
T7_09895_G05	ACCAACAACCAAACCACGTCACAAACACACCCCACA
T7_09896_G05	AACCACAACACCCCACAGTCAACACCACACACAAAC
T7_09897_G05	ACCACACCACCAACACAGTCCCCACACACAAAAACA
T7_09898_G05	ACACCACCCAACCCACCGTCCAACAAACCACAAAAA
T7_09899_G05	CCACCCAAAAAAAACACGTCCCCACACACAACACAC
T7_09900_G05	AAACAACACAAACAACAGTCCACCACACCCCACCCA
T7_09901_G05	CCCACAACCACCACCCAGTCAACACACAAAACAACA
T7_09902_G05	ACACCACACACCAACAAGTCCACAACACAAACCACC
T7_09903_G05	AACAACACACCAAACACGTCACCACACCAACCCAAC
T7_09904_G05	AAACCACCACACACAAAGTCACCACCACCAAAACCC
T7_09905_G05	ACCACACCACACAAAACGTCACCCAAAAACACCACC
T7_09906_G05	CACAACCACACACCAACGTCCACACAACAAACAACC
T7_09907_G05	CCAAAAACAAACCAACAGTCCCCACAACACACACCC
T7_09908_G05	AACACACACCAACAAACGTCACCACAACACACCCCA
T7_09909_G05	ACCAACAACACACAACAGTCCAACCACACCACACCA
T7_09910_G05	CCAACAACACACAACAAGTCCCAAACACCCACCACA
T7_09911_G05	AACCCAACACCCACCCCGTCCAAAACAACAAACAAC
T7_09912_G05	AACACCCAACACAACCAGTCCAAAACCAACCAACCC
T7_09913_G05	CACACACAACAACAACAGTCCACCCAACCAAACCAC
T7_09914_G05	AAACCACACAAACCACCGTCACACACCAAAACCCAC
T7_09915_G05	CAAACACACACCCACCCGTCACCAAAAAAAACCCCA
T7_09916_G05	CAACAAACCCCACAACAGTCCACACCAACCACAAAC
T7_09917_G05	CCAAACCAACACAACCCGTCCCCAACAAACCAAAAC
T7_09918_G05	CACACCAAAACACCAAAGTCCAAACAACCCACCACC
T7_09919_G05	CACCAACCCCAAAACCAGTCCACAACAACACACACA
T7_09920_G05	AAACAAACCCAACCAACGTCCCACACCCACAACAAC
T7_09921_G05	CCCACAAAAACCCAACCGTCAACCAAACCCACACAA
T7_09922_G05	ACCAAACAACACCACACGTCCCACCAAACCAACAAC
T7_09923_G05	CAAACCACAACCAACCCGTCAACACCACACAAACAC
T7_09924_G05	CCAAACCCAACAACACCGTCCAAACAACCAACACAC
T7_09925_G05	CCACCAAACACAACCCAGTCAACCCACACCCAAAAA
T7_09926_G05	CACACACAACACACAACGTCCCAACCCCACACAAAA
T7_09927_G05	CACCCACCACACAACACGTCAAACCCCAAACAACAA
T7_09928_G05	AAACCCACACACCAACCGTCCACACAACAACCACAA
T7_09929_G05	CAACCCACCACACCAACGTCCACACAAACAAAACCA
T7_09930_G05	AACCACCCAACCAAAACGTCACAACACCCACAACAC
T7_09931_G05	AAACACCCACACACACAGTCAAACCAAACCCACCAC
T7_09932_G05	AACCCACAAACCAACCAGTCAACCCAACCCAACCAA
T7_09933_G05	AACACCCCACACAACACGTCAACACACACACAACAC
T7_09934_G05	ACCAACACAAAACACAAGTCCAACCCAACCCACACC
T7_09935_G05	AACAACCCACCAACCCCGTCAACAAAACCACAACAC
T7_09936_G05	CAAACCACAAACCACACGTCACACCACCAACCAAAC
T7_09937_G05	CACACACACCACACACCGTCACAAAACCCAAAACAC
T7_09938_G05	ACCCACACAAACAAAAAGTCACACAACCACCCACCC
T7_09939_G05	CAAAAACAACCACCCCAGTCACAACCACAACACCAC
T7_09940_G05	CACACAACCAAACACCCGTCACCCACCACAACAAAA
T7_09941_G05	ACACCAAACACACAAAAGTCCACCCAACACACCCCA
T7_09942_G05	CACAACAACAAACCACCGTCACCACCAACACCAACA
T7_09943_G05	CACCACACACACAAACAGTCACAACCCACAAACCCA
T7_09944_G05	CACAACAACACCCAAAAGTCACCACCACACCCAAAC
T7_09945_G05	CCAAAACAACACACAACGTCCACACAAACCCCACCA
T7_09946_G05	CCAAACAACAACACAACGTCCCACACCAAAACCACC
T7_09947_G05	AACAACCACAAACCAACGTCCCCACAACACCACAAC
T7_09948_G05	CCACCCACACAAACAAAGTCCCAAACACCAACACCA
T7_09949_G05	CCAACCAACCACACACAGTCCCAAACAACACCCAAA
T7_09950_G05	ACACACCCACCCAACCAGTCACACAAACAAAACCCA
T7_09951_G05	CACACCAACACACCACCGTCAAAAACCCAAAACACC
T7_09952_G05	CACCCCACAAAAACCCCGTCACAAAAACACAAACCC
T7_09953_G05	AACAAACACCACACCCAGTCACACCCACAAAACACC
T7_09954_G05	CACCAACCACCACAAACGTCCAAACAACACCACCAA
T7_09955_G05	CCACAACCAACCCACCAGTCCAACCAACAACCAAAA
T7_09956_G05	AACAAACCACACCCCAAGTCCACACACACCAAACCA
T7_09957_G05	CAAAACACCACACCCACGTCAACACCCCACACAAAA
T7_09958_G05	ACAAACACACACACCAAGTCCACAAACCCCACACCA
T7_09959_G05	ACCACCAAAACCACCCAGTCAACACCAACACACCAA
T7_09960_G05	AACCCACCAACAACAAAGTCCCACCCACCCAAAACA
T7_09961_G05	CACAACCACCCAACCAAGTCCCACAACAAAACCACA
T7_09962_G05	CACAAAACAACCACCCCGTCACACACACACACAAAC
T7_09963_G05	AACCACCAAACACAAAAGTCCACACCCACCCACACA
T7_09964_G05	ACACCACAAACACCACCGTCAAACACAACACCAACC
T7_09965_G05	CACACAACCACACCACAGTCACACACACCAACACAA
T7_09966_G05	CACACCCAAACAACAAAGTCCCACAACCCAAACACC
T7_09967_G05	CCACACCAAAACAAACCGTCACCACAACACACCACA
T7_09968_G05	AACACCCAAACCACCCCGTCAAAACCACACACAACA
T7_09969_G05	CCCACCACAAACAACCAGTCCAAAACACACCCCAAA
T7_09970_G05	ACACACCCACCAAAACCGTCAACCAACCAACACACA
T7_09971_G05	AACCACCAACACAAACAGTCCACACACCACCACACA
T7_09972_G05	CACCCAACACCCAAAACGTCCAACAACCACAAACCA
T7_09973_G05	ACCACACACAAAACAACGTCCCAAACCACACACACC
T7_09974_G05	ACAAAAACCCAACCACAGTCCCAACACCCACCAAAC
T7_09975_G05	CCACCACACAAAAACCCGTCAAAACCACACACCCAA
T7_09976_G05	CACACAACAACAACACAGTCCAAACACACCCCACAC
T7_09977_G05	CAACACCACAAAACAACGTCAACCCAACCACAACCC
T7_09978_G05	AAACCCAAACAACCACAGTCCACCACACAAACCACC
T7_09979_G05	CAACCCCACACACACCCGTCCAACACAAAAACACAA
T7_09980_G05	ACCCACACCAACACCAAGTCCCACCCCAAAAAAAAC
T7_09981_G05	CACCCCACCAAACACAAGTCACCAAAACCAAACCAC
T7_09982_G05	AACCAACAACCACCAACGTCCACCACAAACACAACC
T7_09983_G05	CAACACACACACACACCGTCACCACAAACACACAAC
T7_09984_G05	CACAACACCCAACCACAGTCCACAAACACAACACAC
T7_09985_G05	CAACAACACCCACACAAGTCCCACCAACAACCACAA
T7_09986_G05	ACCAAACCACACAAAAAGTCCCAACACACACCACCC
T7_09987_G05	CAAACCCACCAAAAACAGTCCAACACACACAACCCC
T7_09988_G05	CCACCAAAAAACACCCAGTCACCACAAACCCAACCA
T7_09989_G05	ACACACCCCACAAAACAGTCCAAACAACCACACCCA
T7_09990_G05	AACAAAACCCAACCACAGTCCCCAACCAAAACCACC
T7_09991_G05	CACACACACAACACACCGTCACACAAAACCACACCA
T7_09992_G05	CAACCACAAACCAAACCGTCCAACCCAACACCAAAC
T7_09993_G05	AAACACACCACACACACGTCAACCAACCCAACACCA
T7_09994_G05	AAACCCCAACCCCAACAGTCCAACACAAAACCCCAA
T7_09995_G05	CACACACCACCACACACGTCCAAAAAACACCACACA
T7_09996_G05	AACCAACAACACACACCGTCAACAACACAACCACCC
T7_09997_G05	CACCCCAACAAACACCAGTCCACCAACACCAAAACA
T7_09998_G05	CCAACCACAACCACAACGTCCACCAACCCAAACAAA
T7_09999_G05	ACAAAAACCACACAACAGTCAACCCCACCAACACCC
T7_10000_G05	CAAACCAACAACCACACGTCACCCAAACCACCAAAC
T7_10001_G06	GAAGAGAGAGAGAGAGGGTCAGAGAGAGAAGAGAGA
T7_10002_G06	GAGAAGAAAGAGAGAGAGTCGGAGAGGAAGAGAGAG
T7_10003_G06	GAGAGAGAGAGAGAGAAGTCGGAGAGAGAGAGAGAA
T7_10004_G06	GAGAGAGGAGAAGAGAGGTCAAGGAGAGAAGAGAGA
T7_10005_G06	GGAAGAGAGAGAGAGAAGTCGAGAGAGAAGAGAGAG
T7_10006_G06	AGAGAGAGAGAGAGAGAGTCAGAGAGAGAGAAGAGG
T7_10007_G06	AGAGAGAGAGAGAGAGAGTCGAGAGAGAGGAGGAAA
T7_10008_G06	AGAGAGAGAGGAGAGGAGTCGAAAGAGGAAGAGAGA
T7_10009_G06	GGAGAGAGAAGAGAGAGGTCAGAGAGAAGAGAGAGA
T7_10010_G06	GAGAGAGAAGAGAGAGAGTCGAGAGAGAAGAAGAGG
T7_10011_G06	GAAGAGGAGAGAAGAGAGTCGAGGAGAGAGAGAAGA
T7_10012_G06	AGAGAGAGAGAGAGAGAGTCGAGAAGGAGAGAGAGA
T7_10013_G06	AGGAGAAAGAGAAAGAAGTCGAGGAGGAGAGGAGGA
T7_10014_G06	AAAGGAGAGAGAGAGAGGTCAGAGAGAGAGGAGAGA
T7_10015_G06	AGGAGAAGAAGAGGAGAGTCGGAAGAGAGAGAGAGA
T7_10016_G06	GGAGAGAGAGAGAGAGAGTCAGAAGAAGAGAGAAGG
T7_10017_G06	GAGAAGAGAGAGGAGAAGTCAGAGAGGAGAGAGAGA
T7_10018_G06	AGAAGAAGAGAGAGAGAGTCGAGAGGAGGAGAGAGA
T7_10019_G06	AGAGGAGAGAGAGAGAAGTCGAGAGAGAGAGAGAGA
T7_10020_G06	AGAGAGAGAGAGAGAGGGTCAGAGAAGAGGAGAAGA
T7_10021_G06	AGAGAAGAGAAGAGAGAGTCGGAAGGAGAGGAGAGA
T7_10022_G06	AGAGAGAGAAAGGAGAAGTCGAGAGGAGAGAGAGAG
T7_10023_G06	GAGAGGAGAGAAGAGAGGTCAGAGAGAGAAGAGAGA
T7_10024_G06	AGAGAGAGAGAGAAGAGGTCAGAGAGAAGGGAGAAG
T7_10025_G06	GAAGAGAAAAGAGAGAGGTCAGAGGAGGAGGAGAGA
T7_10026_G06	GAGAGAGAAGAGAAGGAGTCGAGAAGAGAGAGGAGA
T7_10027_G06	AGAGAGGAGAGAGAAGAGTCGAAAGGAGAGAGAGAG
T7_10028_G06	AGAGAGGAAGAGAAGAGGTCAGAGAGAGAGGAGAGA
T7_10029_G06	AGAGAGAGGAGAGAGAGGTCAGAGAGAAGAGAGAGA
T7_10030_G06	AGAAGAGAGGAGAGAGAGTCGAGGAGAGAAGAGAGA
T7_10031_G06	AGAGAGAGAGAAGAGAGGTCAAGAGAGGAGGAGAGA
T7_10032_G06	AGAGAGAGGAGGAGAGAGTCAGGAAGAAAGAGGAGA
T7_10033_G06	AAGAGGAAGAGAGGGAGGTCAGAGAAGAGAGAGAGA
T7_10034_G06	AGGAGAGAGAGAGAGAGGTCAGAGAGAGAAGAAGAG
T7_10035_G06	GAGAAGAGAAGGAAGAGGTCAGGAAGGAGAGAGAGA
T7_10036_G06	AAGAGAGAGAGAGGAAGGTCAGAGAGAGAGAGAGAG
T7_10037_G06	AGAGAAAGAGAGGAGAGGTCAGAGAGGAGAGAGAAG
T7_10038_G06	AGAGAGAGAAGAGAGGAGTCGAGAGGAGAGAAAGAG
T7_10039_G06	GAGAGGAGGAAGAGAGGGTCAGAAAGAGAGAAGAGA
T7_10040_G06	AGAGAGGAGAGAGAGAAGTCGAAGAGAGGAGAAGAG
T7_10041_G06	AGAGAGAGGAAGAGAGAGTCGGAAGAGAGAGAGAGA
T7_10042_G06	AAGAGAGAGAGGAGAGGGTCAGAGAGAGAAGAGAGA
T7_10043_G06	AGAAGAGAGAGAGAGAGGTCAGGAGAAGAAGAGAGG
T7_10044_G06	GAGAGAGAAGAGAGAGAGTCGAGAAGAGAGGAGAGA
T7_10045_G06	GAGAGAGAGAGAGAGAAGTCAGAGAGAGAGAAGAGG
T7_10046_G06	GAGAGAGAAGAGAGAGAGTCGAGAAGAGAGAGAGAG
T7_10047_G06	AGAGAGAGAAGAGAGAGGTCGAAGAGAGAGAGAGAG
T7_10048_G06	AGAGGAGAGAGAGAGAGGTCAGAGAGAGAGAGAAGA
T7_10049_G06	GAAGGAGAGAAGAGGAGGTCAGAAGAGAGAGAGAGA
T7_10050_G06	GAAGAGAGAAGGAGAGAGTCGAGAGAGAGAGAGAGA
T7_10051_G06	AGAGAAGGAGAGAGAAGGTCAGAGAAGAGGAGAGAG
T7_10052_G06	AAGAGAGAGAGAGAGGAGTCGAGAGAGAGAGAGAAG
T7_10053_G06	AAGAAGAGAGAGAGAGGGTCAGAGAGAGGAGAGAGA
T7_10054_G06	AGAGAGAGAGAAGAGAGGTCAGAGAGAGGAGAAGAG
T7_10055_G06	GAGAGAGAGAGAGAAGAGTCGAAAGAGAGAGGGAGA
T7_10056_G06	GAGAGAGAGAGAGAGAGGTCAGAGAAGAGAAGAGAG
T7_10057_G06	GAGAGGAGAGAGAGAGAGTCAGAAGAGAGAGAAGAG
T7_10058_G06	AGAGAGAGGGAGAGAGAGTCGAGAGAGAGAAAGAGA
T7_10059_G06	AGAAGAGAAGAGAAGAGGTCGGAGAGAGGAGAGAGA
T7_10060_G06	AGAGAGAGAGAGGAAGAGTCGAGAAGAGAGAGAGAG
T7_10061_G06	AAGAGAAGAGGAGAGAGGTCAGAAGAGAGGAGAGAG
T7_10062_G06	AAGAGAGAGAAGGAGAGGTCAGAGAAGGAGAGAGAG
T7_10063_G06	AGAAGAGAAGAGAGAGAGTCGAGAGAGAGAGAGGAG
T7_10064_G06	GAGAGAGAGAGAGGAGAGTCGAGAGAGAAGAAGAGA
T7_10065_G06	AGAAGAGAAGAGAGAGGGTCAGAGAGAGAGAAGAGG
T7_10066_G06	GAGAGGAGAGAGGAGAGGTCAAGAAGAGAGAAGAGA
T7_10067_G06	AGAGAGAGAGAGAGAGAGTCAGAGAGAGAGAGAAGG
T7_10068_G06	AGAGAGGAGAGAGAAGAGTCGAGAGGAGAGAGAAGA
T7_10069_G06	AAGAGAGAGAGAGAGAGGTCAGAGAGAGGAGAGAGA
T7_10070_G06	GAGAGAGAGAGAGAGAGGTCAAGAGGAGAGAGAAGA
T7_10071_G06	AAGAAGAGAGAGAGAGAGTCGAGAGAGAGAGAGAGG
T7_10072_G06	GAGAGAGAGAAGAGAGAGTCGGAGGAGAAGAAGAGA
T7_10073_G06	AAGAGAAAGGAGGAGAGGTCAGAGAGGAGAGAGAGA
T7_10074_G06	GAAGAGGAGAGAGAGAGGTCAGAAGAGAAGAGAGAG
T7_10075_G06	GAGAGAGAGAGAGAAGAGTCAGAGAGAGAGGAGAGA
T7_10076_G06	GAGAGAGAGAGAAGAGAGTCGAGGGAAGAGAGAAGA
T7_10077_G06	AGAGAGAGAGAAGAGGAGTCGAAGAGAGGAGAGAGA
T7_10078_G06	GAGAGAGAGAGAAGAGAGTCGAGAGAGAGAGAAGAG
T7_10079_G06	GAGAAGAGGAGAGAGAGGTCAGAAGAAGAGAGGAGA
T7_10080_G06	GAGAGAGAGAGAGAGAGGTCAGAAGAGGAGAGAGAA
T7_10081_G06	GAGAGAGAGAGAAAGGAGTCGAGGAGAGAGAGAAGA
T7_10082_G06	GAGAGAGAAGAGAGGAAGTCAGAGAGGAGAGAGAGA
T7_10083_G06	AGGAGAGAGAGAGAAGAGTCGAAGAGAGAGGAGAAG
T7_10084_G06	AGGAAGAGAGAGAGGAGGTCAGAGAGAGAGAGAGAA
T7_10085_G06	GAGAGAAGAGGAGAGGAGTCGAGAGAGAAAGAGAAG
T7_10086_G06	AAAGAGAGGAGAAGAGAGTCGAGAGAGAGAGAGGGA
T7_10087_G06	GAGAGAGAGAAGGAGAGGTCAGAGAGAGAGAGAGAA
T7_10088_G06	AAGAGAGGAGAGGGAAAGTCGAGAGAGGAAGAGAAG
T7_10089_G06	AGAGAGAGAGGAAGAGAGTCAGAGAGAGAGGAGAGA
T7_10090_G06	GAGAAGGAGAAGAGAGAGTCGAGGAGAGAGAAGAGA
T7_10091_G06	GAAGAGAGAGAGAGAGAGTCGAGAGAGGAGAGAAGA
T7_10092_G06	AGAGAGAGAGAGAGAGAGTCGAGAGAGGAGAGAGAA
T7_10093_G06	AGAGAGAGAGAGGAGAGGTCAGAGAGAGAGAAGAGA
T7_10094_G06	GAGAAAGGAGAGAGAAGGTCAGGAGAGAGAAGAGAG
T7_10095_G06	GAGAGAGAGAGAGAAAGGTCAGAGAGAGAGAGAGAG
T7_10096_G06	GAGGAGAAGGAGAAGAGGTCAGAGAGAAGAGAAGAG
T7_10097_G06	GAAGAGAGAGAGAGAGGGTCAGAGAGAAGAAGAGAG
T7_10098_G06	AGAGAGAGAGGAGAGAGGTCAGAAGAGAAGAGAGAG
T7_10099_G06	AGAGAAGAAGAGAGGAGGTCAGAGGAGAGAGAGAGA
T7_10100_G06	GAGAGAGAGAGAGAGGAGTCGAGAAAAGAGAGAGGA
T7_10101_G06	AGAGAGAGGAGAGAGAAGTCGAGAAGGAGAGAGAGA
T7_10102_G06	GAGAGAGAGGAGAAGAGGTCAGAGAGAGAGAGAAGA
T7_10103_G06	AAGAGAGAGAAGGAGAGGTCAGAGAGAGAGAGAGAG
T7_10104_G06	AGAGAAGGAGAGAGAGAGTCGAGAGAGAGAGAGAGA
T7_10105_G06	GAGAAGAAGAGAGAGAAGTCAGGAGAGAGAGGAGAG
T7_10106_G06	AGAGAGAGGAAGAAAGAGTCGAGGAGAGGAGAGAAG
T7_10107_G06	AGAAGAAGAGAGAGAGAGTCGAGAGAGGGAGAGAGA
T7_10108_G06	AGAGAGGAGAGAGAGAGGTCGAGAAAGAGAGAGAGA
T7_10109_G06	GAGAGAGAAGAGAGAGAGTCGAGAGAGAAGAGAGGA
T7_10110_G06	AAGAGAGGAGGAGAAGAGTCGAGAAGAGAGGAGAGA
T7_10111_G06	GAGAGAGAGAGAGAGAAGTCGAGAGAGAGAGGAAGA
T7_10112_G06	GAAGAGAGAGGAGAGAGGTCAAGAGAGAGAGAGAGA
T7_10113_G06	AGGAGAGAGAGAGAGAGGTCAGAAGAGAAAGGAGAG
T7_10114_G06	AGAGAGAGAGAGAAGAGGTCAGGAGAGAGAGAGAGA
T7_10115_G06	GAGAGAGGAGAGAGAAGGTCGAGAGAGAAGAGAGAA
T7_10116_G06	GAGGAGAGAGAGAGAGAGTCGAGAAGAAGAAGAGAG
T7_10117_G06	AGAGAGGAGAAGAGGAGGTCAGAGAGAAGAGAGAGA
T7_10118_G06	GAGAGAGAGAGAGAGGAGTCGAGAAAGAGAGAAGAG
T7_10119_G06	AGAGGAAGAGAGAAGGAGTCGGAGAGAGAGAGAGAA
T7_10120_G06	AGAGAAAGAGAGAGAGAGTCGAGGAGAGAGAGAGAG
T7_10121_G06	AAGGAGAGAGAGAAAGAGTCGAGAGAGGAGAGAGAG
T7_10122_G06	GAGAGAGAAGAGAGAGAGTCGAGAGAGGAAAGGAGA
T7_10123_G06	GAGAAGAAGAGAGGAGAGTCGAGAGAGAGAGAGAGA
T7_10124_G06	AGAGAAGAGAGAAGAGAGTCGAGAGAAGAGGGAGAG
T7_10125_G06	GAGAGAGAGAGAGAAGGGTCAGAGAGAGAAGAGAGA
T7_10126_G06	GAGAGAAGAGAGAGAGAGTCGGAGAGAGAAGAGAGA
T7_10127_G06	AGAGGAAGAGAGAGAGAGTCGGAAGAGAGAGAGAGA
T7_10128_G06	GAAGAGAGAGAGAGAGAGTCGAGGAGAAGAAGAGAG
T7_10129_G06	GAGAGAGAGAGAAAGGAGTCGAAGAGAGAGAGAGAG
T7_10130_G06	GAGAGAGAGAGAGAGGAGTCGAGAGAAAGAGAGAGA
T7_10131_G06	AGAGGAGAGGAGAGAGAGTCAAGAGAGAGAGAGAGA
T7_10132_G06	GAGAGAGGAGAAGAGAGGTCAGAGAAAGAGGAGAGA
T7_10133_G06	AGAGAGAGAGAGAGAGAGTCGAGAGAGAGAGAAGAG
T7_10134_G06	GAGAGAGGAGAGAAGAAGTCGAGAGGAGAGAGAGAA
T7_10135_G06	AGAGAGAGAAGGAGAAGGTCAGGAGAGAAGAGAGAG
T7_10136_G06	GAGAGAGAGAAGAGAGAGTCGAAAGAGGAGAGAGGA
T7_10137_G06	AGAGAGAGGAGAAGAGAGTCGAGAGAGAAGAGAGAG
T7_10138_G06	AGAGGAGAGGAGAGAGAGTCGAGAGAGAAAAGAGAG
T7_10139_G06	AGAGAGAGAGGAGAGAGGTCAGAGAGGAGAAGAAGA
T7_10140_G06	AGAGAGAGGAGAGAGAGGTCAGAAGAAGAGAGAGAG
T7_10141_G06	GAGAGAAAGAGAGAGAGGTCAGAGAGAGAGGAGAGA
T7_10142_G06	GAGGAGAAGAGAGAGAGGTCAGAGAGAGAGAGAAGA
T7_10143_G06	GAGAGGAGAAGAGAGAGGTCAGAGAGAGAAAGAGAG
T7_10144_G06	AGAAGAGAGAGAGGAGAGTCGAGAGAGAGAGAAGAG
T7_10145_G06	AGGAAGAAGAGAGAGAGGTCGGAGAGAGAAGAGAGA
T7_10146_G06	AGAGAGAGAGAGAGAGAGTCGGGAGAAGAGAGAAGA
T7_10147_G06	AGAGAGAGAGAGAAGAGGTCAGAAGAGAGAGGAGAG
T7_10148_G06	GGAGAAGAGAGAGAGAGGTCAGAAGAAGAGAGAGAG
T7_10149_G06	GAGGAAGAGAAGAGAGAGTCGAGAGAGAGAGAGAGA
T7_10150_G06	AAGAGAGAGAGAGAGAGGTCAGAAGAGAGGAGAGAG
T7_10151_G06	AGAGAGAGAGAGAGAGAGTCGGAGAGAAGAGAGAGA
T7_10152_G06	AGGAGAGAGAGAGAGAGGTCAAGAGAGAAGAGGAGA
T7_10153_G06	GAGAGAGAGAGAGAGAGGTCAAAGAGAGAGAGGAGA
T7_10154_G06	GAGAGAGGAGAGAAGAGGTCAGAGAGAGAGAAGAAG
T7_10155_G06	AAGAGAGAGAAGAGAGAGTCGAGAGGAGGAGAGAAG
T7_10156_G06	GAGAGAGAGAGAGAGAGGTCAAGAGAGAGGAGAGAA
T7_10157_G06	AGAGAGAGAGAGAAGGGGTCAGGAGAAAGAGAGAGA
T7_10158_G06	AGAGAGAGAGAGAGAGAGTCGAGAGAGAGGAGAAGA
T7_10159_G06	GAGAGAGAGAGAGAGAGGTCAGAGAGAAGGAGAAGA
T7_10160_G06	AAGAGAGGAGAGAGAGAGTCGAGAAGGAGAAGAGGA
T7_10161_G06	GAGAGAGAGAGAGAGAAGTCGAGAGAGAGAGAAGAG
T7_10162_G06	AGAGAGAGAGAGAAGAGGTCAGAGAGAGAGAGGAGA
T7_10163_G06	GAGAGAAGAGAGAGAGAGTCGAGAGGAGAAGAGAGA
T7_10164_G06	GAGAGAGAGAGAGAGAAGTCGAAGAGAGAGAGAGGA
T7_10165_G06	AGAAGAGGAAGGAGAGGGTCAGAGAGAGAAGAAGGA
T7_10166_G06	AGAGAGAGAGAGAGGAGGTCAGAGAGAGAGAGAAGA
T7_10167_G06	GAAGAGAGGAGGGAGAAGTCGAGAGAAGAGAGAAAG
T7_10168_G06	GAGAGAGGAGAGAGAAGGTCAGAGAGAGAGAAGAGA
T7_10169_G06	GAGGAGAGAAGAGAGAGGTCAGAGAAGAGAGAGAGA
T7_10170_G06	AGAGAGAGAGGAGGAGAGTCGAGAAGAGAGAGAAGA
T7_10171_G06	AGAGAGAGAGAGAGAGAGTCAGAGGAGAGAGAGAGA
T7_10172_G06	GAAGAGAGAGAGAGAGAGTCAGAGAGAGAGAGAAGG
T7_10173_G06	AGGAGGAGAGAGAGAAAGTCGAGAGGAGAGAAGAGA
T7_10174_G06	GAGAGAAGGAGAGAGAGGTCAGAGAGAGAGAGAAGA
T7_10175_G06	AGGAGGAGAGAAGAAGAGTCGAGAGAGAGAGAGAGA
T7_10176_G06	AGAGAAGAAGAGAAGGAGTCGGAGAGAGAGAGAGAG
T7_10177_G06	AGAGAGAGGAAGAGAGGGTCAGAAAGAGAGAGAGAG
T7_10178_G06	GAGAAGAGAGGAAGAGAGTCGAGGAAGAGAGAGAAG
T7_10179_G06	AGAGAGAGAGAGAGAGGGTCAAGAGAGAAGAGAGGA
T7_10180_G06	GAGAGAAGGAGAAGAGAGTCGAGAGAGGAGAAGAGA
T7_10181_G06	GAGAGAGGAGAAGAGAGGTCAGAGAGAGAGAAGAAG
T7_10182_G06	AGAGAGAGAGAGAGAGAGTCGAGAAGAGAAGGAGAG
T7_10183_G06	AAGAGAGAGAGAGGAGAGTCGAGAGAGGAGAAGAGA
T7_10184_G06	GAGAGAGAAGAGAGAGAGTCGAGGAGGAAGAGAGAA
T7_10185_G06	AGAAGAGAGAGAGAAGAGTCGAGAGGAAGGAGAGAG
T7_10186_G06	GAGGAGAGAGAGAAAAGGTCAGAGAGAGAGAGAGAG
T7_10187_G06	GAGAGAGAGAGAAAGAGGTCAGAAGAGAGAGAGGAG
T7_10188_G06	AAGAAGAGAGAGAGGAGGTCAAGGAGAAGGAGAGAG
T7_10189_G06	GGAGAGAGAAGAGAGAGGTCAGAGAGAGAAGAGAGA
T7_10190_G06	AAGAGAGAGAGAGAGGAGTCGAAGAAGAGAGGAGGA
T7_10191_G06	AGAGAGAGAAGGAAGAGGTCAGAGAGAGAGAGAGAG
T7_10192_G06	GAGAGAGAAAGAGAGAGGTCAGGAGAGAGAGAGAGA
T7_10193_G06	AGGAGAGGAAGAGAGAGGTCAGAGGAGAGAGAGAAA
T7_10194_G06	GAGAGAGAGAAAGAAGAGTCGGAGAGAGAGAGAGAG
T7_10195_G06	GAGAAAGAGGAGAAGAGGTCAGAGAGAGAAGGAGAG
T7_10196_G06	AGAGAGAGGAGAGAGGAGTCGAGAGAAAGAGAGAGA
T7_10197_G06	AGGAGAGAAGAGAAGAGGTCAGAGAGAGAGGAGAGA
T7_10198_G06	AGGAAAGAGAAGGAGGAGTCGAGAAGAGAGAGAGAG
T7_10199_G06	GGAGAGAGAAAGAGAAAGTCGAGAGAGAAGGAAGGG
T7_10200_G06	AAGAGGAGAGGAGAGAGGTCAGAGAGAGAGAAGAGA
T7_10201_G06	GAGAGAGAGAGAAAGAGGTCAGAGGAGAGGAGAAGA
T7_10202_G06	GAAGAGAGAAGAAGAGAGTCGGAGAGAGAGAGGAAG
T7_10203_G06	AGAGAAGGAGAGAGAGAGTCGAAGAGAGGAGAGAAG
T7_10204_G06	AGAGGAGAAGAGAGAAGGTCAGGAAGAGAGAGAGAG
T7_10205_G06	GAAGGAGAGAGAGAGAGGTCGAAGAGAGAAGAGAGA
T7_10206_G06	AGAAGAAGAGAGAAGAGGTCGAGAGAGGAGGAGAGA
T7_10207_G06	AGAGAGAAGAGAAGAGAGTCGAGAGAGAGAGAGAGG
T7_10208_G06	AGAGAGAGAGAGAGAGAGTCAGAGAGAAGAGAGGAG
T7_10209_G06	AGAGAGGAGAGAAGAGAGTCGAGAGAGAGAGAAGAG
T7_10210_G06	GAGAGAGAGAGAAAGAGGTCAGGAGAAGAGAGAGAG
T7_10211_G06	GGAAGAGAGAGAGAGAAGTCGAGAGAGAGAGAGAGA
T7_10212_G06	AGGAGAGAGAGAGAGAGGTCAAGAGAGAGAGAGAGA
T7_10213_G06	AGAGAGAGAGAAAGAGAGTCGGAGAGAGAGAGAGAG
T7_10214_G06	GAAGAAGAGAGAGGAGAGTCGAGAGAGAGAGAGAGA
T7_10215_G06	AGAGGAAAGAGGGAGAGGTCAGAGAAGAGAGAAGAG
T7_10216_G06	GAGAAGAGAGAGAGAGAGTCGAAGAGAGAGGAAGAG
T7_10217_G06	GAGAGAGGAGAGAAAGAGTCGGAGAGAGAGAAGAGA
T7_10218_G06	AGAGAGAGAGAGAGAGAGTCGGAGAGAAAGAGAGAG
T7_10219_G06	GAAAGAGAGAGGAGGAGGTCAGAGAGAGGAAGAAGA
T7_10220_G06	GAGAGAGAGAGAAGAGAGTCGAGAGAGAGGAGAGAA
T7_10221_G06	GAAAAGAGAGAGAGGGAGTCGAGAGAGAGAGAGAGA
T7_10222_G06	GAGAGAGAGAGGAGAGAGTCAGAGAAGGAAAGAGAG
T7_10223_G06	AAGAGAGAAGAGAGAGAGTCGAGAGAGAGAGAGGAG
T7_10224_G06	AGAGAGAAGAAGAGAGAGTCGAGGAGAGAGAGAGAG
T7_10225_G06	AAGAGAGGAGAGAGAGAGTCGAGAGAGAGAAGAGAG
T7_10226_G06	AGAGAGAGAGAAGAGGAGTCGAGAGAGAGGAGAAGA
T7_10227_G06	GAGGAGAGAGAAAGAGAGTCGAGAGAGAGAGAGAGA
T7_10228_G06	AGAGAGAGAGAGAGAGGGTCAAGAGAGAGAGAGAGA
T7_10229_G06	AGAAGAGAGGAGAGAGAGTCGAGAAGGAGAGAGAGA
T7_10230_G06	AGAAGGGAGAGAGAGAGGTCAGAGAGAGAAAGAGAG
T7_10231_G06	AGAGAAGAGAGGAAGAGGTCAGAGAGGAGAGAGAAG
T7_10232_G06	AGAGGAGAGAAGAGAGAGTCGAGAAGAGAGAGAGAG
T7_10233_G06	GAGAGAGAAAGAGAAGAGTCGAGAGAGGAGAGAGAG
T7_10234_G06	GAGAGAGAAGAGAGAGAGTCGAGAGAAGAGAGAGAG
T7_10235_G06	GAGAGAGAGAGAGGAAGGTCAGAGAAGAGAGAAGAG
T7_10236_G06	AGAGAAGAAGAGAGAGAGTCGAGAGAGGAGAGAGAG
T7_10237_G06	AGAGAGGAAGAGAAGAGGTCGAGAGAGGAGAGAAGA
T7_10238_G06	GAGAGAGAGAGAGAGAAGTCGGAGAGAGAGAGAAAG
T7_10239_G06	GGAGAGAGAGAGAGAAGGTCAGAAGAGAGAGAGAGA
T7_10240_G06	GAGGAGAGAAGAGAGAGGTCAGAGAGAGAGAGAAGA
T7_10241_G06	GGGAGAGAGAGAGAAGAGTCAGAGAAGAAGAGAGAG
T7_10242_G06	GAGAGAAGAGAGAAGGAGTCGAAGAGAGAGAGAGAG
T7_10243_G06	GAGAGAGAAGGAAGAGAGTCGAGAGAGAGAAAGGAG
T7_10244_G06	AGAGAAGAAGAGGAGGAGTCAGGAGAGAGAGAAGAG
T7_10245_G06	AGAAGAGGAGAGAGAGAGTCAGAGAGAGGAGAGAGA
T7_10246_G06	GAGAGGAGAAGAAGAGAGTCGAGAGAGAGAGAAGAG
T7_10247_G06	AGAAGAGAGAAGAGAGAGTCGGAGAGAGAGAGAGAG
T7_10248_G06	GAGGAGAGAGAGAGAGAGTCGAAGAGAAGAGAGAGA
T7_10249_G06	AGAGAGAGAGAAAGGAGGTCAGAGAGAGAGAGAGAG
T7_10250_G06	AGAGAGAAGAGAGAGAGGTCAGGAGAGAGAGAGAGA
T7_10251_G06	AGAAGAGGAAGAGAGAGGTCAGAGAGAGAGAGAGAG
T7_10252_G06	AGAGAGAGAGAGAAAGAGTCGAGAGAGAGGAGAGAG
T7_10253_G06	GAGAGAGAGGAGAAGAGGTCAGAGAGAGAAGAGAGA
T7_10254_G06	AGAAGAGAGAGAGAGAGGTCAAGAGAGAGAGAGGAG
T7_10255_G06	GAGAGAGAGAAGAGAGAGTCAGAGAGAGAGAGGGAA
T7_10256_G06	AGGAGAGAGAGAGAGGAGTCGAGAAGAGAAGAGAGA
T7_10257_G06	AGGAAGAGAGAGAGAAGGTCAGAGAGAGAGAGAGGA
T7_10258_G06	GAGAGAAGAGAGAGAGAGTCGAGGAGAGAGGAGAAA
T7_10259_G06	AGAGAGAGAGAGAAGAGGTCAGAGAGGGAGAAGAAG
T7_10260_G06	GAGAGGAGAGAGAAGAGGTCAGAGGAAAGAAGAGGA
T7_10261_G06	AGAGAGAGAGAGAGAGAGTCAGGAGAGAGAGAGGAA
T7_10262_G06	GAGAGAAGAGGAAAGAGGTCAGAGAGAGGAGAGAGA
T7_10263_G06	AGGAGAGGAAGAGAGAGGTCAGAGAGAAGAAGAGGA
T7_10264_G06	AGAGAGAGAGAAGAGAGGTCAAGAGAGGAAGGAGAG
T7_10265_G06	AGAAGAGAGAGAGAGGAGTCGAAGAGAGAGAAGAGG
T7_10266_G06	GAAAGAGAGAGAGAGAGGTCAGGAAGAGAGGAGAGA
T7_10267_G06	GAGAGAGAGAGAGAGAAGTCGAGAGAAGAGAGAAGG
T7_10268_G06	AGAGGAGAGAGAGAGAGGTCAGAGAAGGAGAAGAGA
T7_10269_G06	AGAAGAGAGAGGGAGAGGTCAGAGAGAGAGAGAAGA
T7_10270_G06	AGAAGAGAGAGAGAGAGGTCAGAGAGAAGAGAGGGA
T7_10271_G06	AGGAAGAGAGGAGAAGAGTCGAGAGAGAGAGAAGAG
T7_10272_G06	AGAGGAGAGAGGAAAAGGTCAAGGAGAGAGAGAGAG
T7_10273_G06	AGAGGAGAGGGAGAGAAGTCAGAGAGAGAGAAGAGA
T7_10274_G06	AGAGAGAGGAGAGAGAGGTCAGAGAGAGAAGAGAGA
T7_10275_G06	AAGAGGAGAGAGAGAGAGTCGAGAGAGAGAGAGAAG
T7_10276_G06	GAAGAGAGGAGAGAGAGGTCAGAAGAGAGAGAGAGA
T7_10277_G06	AGGAGAGAGAGAGAGAGGTCAGAGGAAGAGAGAGAA
T7_10278_G06	GAAGAGAGAAGAGAGAGGTCAGAGAAGAGGAGAGAG
T7_10279_G06	AGAAGAGAGGAGAGAAGGTCAGAGAGAGAGAGAGAG
T7_10280_G06	AGAAGAAGAGAGAGAGGGTCAGGAGAGAGAAGAGAG
T7_10281_G06	AAGAGAAGAGAGAGAGAGTCGAGAGAGAGGAGAGAG
T7_10282_G06	GAGAGAGAGAGAAGAGAGTCGAGAGAGAGAGAGAGA
T7_10283_G06	GAAAAGAGAGGAGGAGAGTCGGAGAAGAGAGAGAGA
T7_10284_G06	GAGAGAGGAGAAGAAGAGTCGAGGAGAGAAGAGAGA
T7_10285_G06	GAGAGAGAGAGAGAGAGGTCAGAGAGAAGAGAGAAG
T7_10286_G06	AGAGAGAAAGAGAGAGGGTCAGAGAGAGAGAGAGAG
T7_10287_G06	AGGAGAGAAGAGAGAGAGTCGAGAGAGAGAGAGAGA
T7_10288_G06	GAGAGAAGAGGAAGGAGGTCAGAAGAGAGAGAGAGA
T7_10289_G06	GAGAGAAGAGAGAGAGAGTCAGGAGAGAGAAGAGAG
T7_10290_G06	AAGAAGAGGAGAGAGAGGTCAGAGAGAGAGGAGAGA
T7_10291_G06	AGAGAGAGAGAAGAAAGGTCAGAGAGAGAGAGAGGG
T7_10292_G06	AGAAGGAGGGAAGAGAGGTCAAGAGAGAGAGAGAGA
T7_10293_G06	GAGAGAGAGAGAAGAGAGTCGAGAGAGAAGAGAAGG
T7_10294_G06	AGAAGAGAGAAGAGAGAGTCGAGAGGAGAGGAGAGA
T7_10295_G06	AGAGAGAAAGAGAGGAGGTCAGAGAGAGAGAGAGAG
T7_10296_G06	GAAAGAGAGAGGGAGAGGTCAGGAGAGAGAGAAAGA
T7_10297_G06	GAGAAGAGAGAGAGAGAGTCGAGAGAGAAGGAGAGA
T7_10298_G06	AGGAGAGAGAGAGAGAGGTCGAGAGAGAGAGAAAGA
T7_10299_G06	AAGAGAGAGAGAGAGAAGTCGGAAGGAGAGAGAGAG
T7_10300_G06	GAGAAGAGAGAAGAGAGGTCGAGAGAGAGAGAGAGA
T7_10301_G06	GAAGGAGAGAGAGAGAGGTCAAGAAGAGAGAGGAGA
T7_10302_G06	AAGGAGAGAGAGAGAGAGTCGAAGAGAGAGAGAGAG
T7_10303_G06	AGAAGGAGAGAGAGAGAGTCAGAGAGAGGAGAGAGA
T7_10304_G06	AGAGAGAGAGAGAAGAGGTCAGAGAGAGAGAAGAGG
T7_10305_G06	AGGAAGAGAGAGAGAGAGTCGGAAAGAGGAAGAGAG
T7_10306_G06	GGAGAGAGAGAGAGAGAGTCGAAGAGAGAAGAGAGA
T7_10307_G06	GAGAGAAGAAAGAGAGAGTCGGAGGAGAGAAGAGAG
T7_10308_G06	AGAGAAGAGAGAGAGAGGTCAGAGGAAGAGAGAGAG
T7_10309_G06	AGAGAGAGAAGAGGGAGGTCAGAGAGAGAGAAGAGA
T7_10310_G06	AGAGAGAGAGGAAGAAGGTCAGAGGAGAGAGAGAGA
T7_10311_G06	AGAGAGAGAGAGGGAGAGTCGAGAAGAGAGAAGAGA
T7_10312_G06	GAGAGAGAGAGAGAAGAGTCGAAGAGGAAGAGAGGA
T7_10313_G06	AGAGAGAGAGAGGGAGAGTCAGAAAGAGAGAGAGAG
T7_10314_G06	AGAAGAGAGAGAAGAGGGTCAGGAGAGAGAGAGAGA
T7_10315_G06	AGAGAGAGAGAGAGAGAGTCGGAAAGAGAAGAGGGA
T7_10316_G06	GAAGAGAGAGAGAAGAGGTCAGAGGAGAGAGAGAGA
T7_10317_G06	GAGAGAGAGAAGAGAGAGTCGAGGAGAAGAAGAGAG
T7_10318_G06	AGAGAGAGAGAGAGAGAGTCGAGAGAAGAGGAAGAG
T7_10319_G06	AGAGAGAGAGGAGAGAGGTCAAGAGGAGAGAGAGAA
T7_10320_G06	AAGAGAGAGAGAGAGGAGTCAGAGAGAAGGAGAGAG
T7_10321_G06	AGAGAGAGGAGAGAAGAGTCAGAAGAGAGAGGAGAG
T7_10322_G06	AGGAGAGAGAGAGAGAGGTCAGAAGAGAGGAGAGAA
T7_10323_G06	AAGGAGAGGAGAGAAGAGTCGAGAGAGAGAGAGAGA
T7_10324_G06	AGAGAGGAAGAGAGAGAGTCGGAAGAGAGAGAGAAG
T7_10325_G06	AGAGAGAGAGAGAGAGGGTCAGAGAGAGAAAGAGAG
T7_10326_G06	GAGAGAGAGAGAGAGAGGTCAAGAGAGAGAGAAGAG
T7_10327_G06	AGAGGAGAGGAGAGAAAGTCGAAGAGAGGAGAGAGA
T7_10328_G06	GAAGAAGAAGAGAGGGAGTCGAGAGAGAGAGAGAGA
T7_10329_G06	GAGAAGGAGAGAGAGAGGTCAAGAGAGAGAGAGAGA
T7_10330_G06	GAGAAGAAGGAGAGAGAGTCGAGAGAAGAGAGAGAG
T7_10331_G06	GAAGAGAGAGAAGAGAGGTCAGGAGAGGAGAGAGAA
T7_10332_G06	GAAGAGAGAGAAGAGAGGTCAGAGAGAGAGAGAGGA
T7_10333_G06	AGAGAGAGAGGAGAGAAGTCGGAGAGAGAAGAAGAG
T7_10334_G06	AAGAGGAGAGAGAGAGAGTCGAGAAGAGAGAGAGAG
T7_10335_G06	AAGAGAGAGAGAAGAGAGTCGAGAGAGAGGAGAGGA
T7_10336_G06	AGGAGAGAGAAGAGAGAGTCGAGAGAGGAAGAAGAG
T7_10337_G06	AGAGAGAGAGAAGAGAGGTCGAGAGAGAGAGAGAGA
T7_10338_G06	GAGAGAGAGAGGAGAGAGTCGAGAGAGAGAGAAAGA
T7_10339_G06	AGAGGAGAGAGAAGAGAGTCAGAGAGGAGAGAGAGA
T7_10340_G06	AGAGAAGAGAGAGAGGAGTCGAGAGGAGAGAGAGAA
T7_10341_G06	GAGGAAGAGAAGAGAAGGTCAGAGAGAGAGAGGAGA
T7_10342_G06	AAAGAGAGAAGGAGAGAGTCGAAGAGAGGGAGAGAG
T7_10343_G06	AGAGAGAGGAGAGAGAGGTCAAGAGAGAGAGAGAAG
T7_10344_G06	AGAGAGAGAGAGAAGAAGTCAGAGAGGAGGAAGGGA
T7_10345_G06	AGAGGGAGAGAGAGAGAGTCGAGAGAGAAGAGAAGA
T7_10346_G06	GAGAAGAGAGAGAGAGAGTCGAAGAGAGAGGAGAGA
T7_10347_G06	AAGAGAGAGAGAGAGAGGTCAGAAGAGAGGAAGGAG
T7_10348_G06	GAAGAGAGAGAGAGAGAGTCGAAAGAGAGGAGAGAG
T7_10349_G06	AGGGAGAGAGAGAGAGAGTCGAAGAGAGAGAGAAGA
T7_10350_G06	AAAGGAGAGAGAGGAGAGTCGAGAGAGAGAGAGAGA
T7_10351_G06	AGAGAGAAGAGAGGAGAGTCGAGAGAGAGAGAGAGA
T7_10352_G06	GAGAGAGAAGAGAAGAGGTCAGAGAGGGAGAAGAGA
T7_10353_G06	GGAGAGAGAGAGAGAGAGTCGAGAGAGAGAGAAGAA
T7_10354_G06	AGGAGGAGAGAGAGAGGGTCAGAAAGAGAAGAGAAG
T7_10355_G06	AGAAAGAGAGAGGAGAGGTCAGAGAGGAGAGAGAGA
T7_10356_G06	AGGAGAGAGAGGAAGAGGTCAGAGAGAGAGAGAGAA
T7_10357_G06	GAAGGAGAGAGAAGAAGGTCGAGAGAGAAGAGAGAG
T7_10358_G06	AAGAGAGAGAGAAGAGAGTCGAGAGAGAGAGAGGGA
T7_10359_G06	GAGAGAGAGAAGAGAAGGTCGAGAGAGAGAGAGAGA
T7_10360_G06	AGAGAGAGAGAGAGAGGGTCAGAGAGAGAGAAGAGA
T7_10361_G06	GAGAGAGAGAGAGAAGAGTCGAGAAGAGGAGAGGAA
T7_10362_G06	AGGAGAGAGGAGAGAGAGTCGAAAGAGAGAGAGAGA
T7_10363_G06	AGAGAAGAGAGAGAGAGGTCAGAGAGGAGAGAAAGG
T7_10364_G06	AGAGAGAGGAGAGAGAGGTCAAGAGAGAGAGAGAGA
T7_10365_G06	GAAGAGAGAGAGAGAAGGTCGAGAGAGAGAGAGAGA
T7_10366_G06	GAAGAGAGAGAAGAGAGGTCGGAGAGGAGAAGAAGA
T7_10367_G06	AGGAGAGAGAGAGAGGAGTCGAGAGAGAAAGAGAGA
T7_10368_G06	AGAGAGAAGAGAGAGAGGTCGAGAGAGAGAAGAGAG
T7_10369_G06	AGGAGAGGGAGAGAGAAGTCGAGAAAGAAGAGAGAG
T7_10370_G06	AGAGAGGAGGAAGGAGAGTCGAGAGAGAAAGAGAGA
T7_10371_G06	GAGAGGAGAAGAGAGAGGTCAGGAGAGGAAAAAGAG
T7_10372_G06	GAGAGAAGAGAGAGAGAGTCGAGAAGAGGAGAAGAG
T7_10373_G06	GAGAAAGAGGAGAGGAGGTCAGAGAGAAGAGAGAGA
T7_10374_G06	AAAAAGAGGAGAGAAGGGTCAGGAGGAGAGAGAGAG
T7_10375_G06	AGAGAGAGAGAAGGAGAGTCGAAGAGAGAGAGAGAG
T7_10376_G06	GAGAGAGAAGAGAGAGGGTCAGAGAAGAGAGAGAGA
T7_10377_G06	GAGAGAAGAGAGAGAGAGTCAGAGAGAGAGAGGAGA
T7_10378_G06	AGAAGAGAGGAGGAGAGGTCAAGAGAAGAGAGAGAG
T7_10379_G06	GAGAGAGAGAGAAAAGAGTCGAGAGAGAGAGGAGAG
T7_10380_G06	AGAGAGGAGAAGAGAGAGTCGAGAGAGAGAAGAGGA
T7_10381_G06	AGGAGAGAGAGGAGAAGGTCAGAGAGAAGAGAAGAG
T7_10382_G06	AGAGAGAGAGAGAGAGAGTCGAGGGGAGAAAAGAGA
T7_10383_G06	GAGAGAGAGAGAAGAGAGTCGAAGAGAGGAGAAGAG
T7_10384_G06	GAGAAGAGAGAGAGAGAGTCGAAGAGGAGAGAAGAG
T7_10385_G06	AGAGAGAAAGAGAGAAGGTCAGAGAGAGAGGAGGAG
T7_10386_G06	AAGAGAGAGAGAGAGAGGTCAGAGAGAGAGAGAGAG
T7_10387_G06	AGAGAGAGAGAGAGGAGGTCAGAGAGAAGAGAGAGA
T7_10388_G06	AGAGGAAGAGAGGAAGAGTCGAGAGAGAGAGAGAGA
T7_10389_G06	GAGAGAGAGAGAGAAAAGTCGAGGAGAGAGAGAGAG
T7_10390_G06	AGAGAGAAAGAGAGAGGGTCAAGAGAGGAGAGAGAG
T7_10391_G06	GAGAGAGGAGAGAGGAAGTCGAGAGAAGAAGAGAGA
T7_10392_G06	GAGAGAGAGAAGAGAGGGTCAGAGAGAGAGAGAAGA
T7_10393_G06	AGAGAGGAAGAGAGGAGGTCAGAGAGAGAGAAAGAG
T7_10394_G06	AGAGAAGAGGAGAGAGAGTCGAGAGAGAGAGAGGAA
T7_10395_G06	GAGAAGAGAGAGAGAGAGTCGAGAGAGAGGAAGAGA
T7_10396_G06	AGGAGAAGAGAGAGAGAGTCGAGAGAGAGAGAGAGA
T7_10397_G06	GAGAGAGAGAGAAGGAGGTCGAAGAAGAAGGAGAAG
T7_10398_G06	AGAAGAGAGAGAGGAGAGTCGAGAGAAGAGAGAGAG
T7_10399_G06	AGAGAGAGAGAGGAAGAGTCGGGAGAGAGAGAAAAG
T7_10400_G06	AAGGAGAGGAGAGAAGAGTCGAAGAGAGAGAGAGGA
T7_10401_G06	AGAGAGAGAGAGAGAGGGTCAAGAAGAGAAGGAGAG
T7_10402_G06	GGAGAGAAGGAGGAAGAGTCGGAGAGAGAAAGGAAA
T7_10403_G06	AGAGAGAGGAAGAGAGGGTCAGAAGAAGAGGAGAGA
T7_10404_G06	AGAGAGAGAGAGAGAGGGTCAAGAAGGAGAGAGAAG
T7_10405_G06	AGAGAAGAGAGAAGAGAGTCGGAGAGAGAGAGAGAG
T7_10406_G06	GAGGAAGAAAGAAGAGGGTCAGAGAGAGAGGAAAGG
T7_10407_G06	GAGAAGAGGAAGAGAAGGTCAGAGGGAGAAGGAAGA
T7_10408_G06	GGAAAAGAGGAGAGGGAGTCGAAAAGAGGAGAGGAA
T7_10409_G06	AGAAAAGAGAAGAGGGAGTCGAGAAGGGAAGGAGAG
T7_10410_G06	GAGAAAGGGAAGGAGAGGTCAGGAGAGAGAGAGAAA
T7_10411_G06	GAGAGAAAGAGAAGAGGGTCAGAGGAGAGAGAGAGA
T7_10412_G06	AGAGAGAAGAGAGAGAGGTCGAGGAGAAGAAGAAGG
T7_10413_G06	AGAGGAAAAAGGAAGAGGTCAGAGAGGAGGAAGGGA
T7_10414_G06	AGAGAGAGGAAAAGAGAGTCAGAGAGAGAGGGAGAG
T7_10415_G06	AGAAGAGGGAGAGAGGGGTCAGAGGAAGAAAAGAAG
T7_10416_G06	AAGAAAGAGGAGGAGAAGTCGAGAGAGAGAGAGAGG
T7_10417_G06	AGAAGGGGAGAAGAAGAGTCGGGAAAGAAGGAAGAG
T7_10418_G06	AGAAGAGAGGAGGAAGAGTCGGAAAGGGAGGAGAAA
T7_10419_G06	GGAGAGGAGAAAGAAAGGTCAAGAAGGAGAGAGAGG
T7_10420_G06	GGAGAAGAGAAAGAAGAGTCGAGAGAGAGGGAGAGA
T7_10421_G06	AGGAAGAGGGAAGGAAAGTCGGAGAGGAAAGGAAGA
T7_10422_G06	AGAGAGAGAAGGAGAAAGTCGAGGGGAAGGAAAGAG
T7_10423_G06	GAGAAGAGAGGAGAGAAGTCGGAAGAGAGGAGAGAA
T7_10424_G06	GAGAAGAGAGAGAGAAGGTCAGAGAGAGGGAGAGAA
T7_10425_G06	AGAAGAGAGAGGAGAGAGTCAGGAGAGAAGAGAGGA
T7_10426_G06	AGAGAGGAGAGAGAAGGGTCAAGAAGAGAGAGAGAG
T7_10427_G06	GGAGAAAGGAGAAAGAGGTCGGAGAAGGGAGAGAAA
T7_10428_G06	AAGAGGAGAAGGAGAAAGTCGAGAGAGGGAAAGGAG
T7_10429_G06	AAAAGGAGAGAGAGAAAGTCGGGAGAGGAGAGGAAG
T7_10430_G06	GAGAAGGAGAGAGGAAAGTCGGAAAAGAGAGAGAGG
T7_10431_G06	GAAGAGAGAGGAAAAGAGTCGAGGAGAAGAGGAGAG
T7_10432_G06	GAGAGGAGAGAAGAGAGGTCAGAGAAAGAGGAGAGA
T7_10433_G06	AGAAGAAAGAGAGGAGAGTCAGGAGGAGGGAGAAGA
T7_10434_G06	AGAGAGAGGAGAGGAGAGTCAAGAGAAGAGAAGAGG
T7_10435_G06	GAGAAGAAGGAGAGAGGGTCAAGGAGAAGAGAGAGA
T7_10436_G06	AAGGAGAAGGAGAGGAGGTCAGAGGAGAAAAGAGAG
T7_10437_G06	AGAGAGAGAGAAGAGAGGTCAGAGGAGAGGGAGAAA
T7_10438_G06	AGGAAGGGGAAGAGAGAGTCAGAGAGAGAAGAGAGA
T7_10439_G06	GAGAGAGAGAGGAGAGAGTCAGAAAGGGGAAGAAGA
T7_10440_G06	AGAGAGAGGAGGAGAAGGTCAAGAAGGAGAGAGAGA
T7_10441_G06	GAGAGAGAAAGGAGAGAGTCGAGGGAGAGGAGAAAA
T7_10442_G06	GAAGGAAGAGAGGAGAGGTCAAAGAGAAGGAGAGGA
T7_10443_G06	AAGAGAAAGGAGAGAGGGTCGAGAAGAGAGAGAGGA
T7_10444_G06	GAGAGAAAGAAGAGGAGGTCAAGGAAGAGAGAGGAG
T7_10445_G06	GAAGAGAGAGAGGAGAGGTCAGAAAGAGAGAGGAGA
T7_10446_G06	AGAAGAGAGAGGAGGAGGTCGAAGAAGAAAGAGGAG
T7_10447_G06	AGAGAGAAAAGGGAGAAGTCGAGAGAGAGAGAGGAG
T7_10448_G06	AGAAGAGGGAGAAGGAGGTCGAGGAGAAGAAGAGAA
T7_10449_G06	AGAGAGAGGAGAGAGAGGTCAAGAGAGAAGAGAGAG
T7_10450_G06	GAGAGGAAGAGGAGAAGGTCAAGAAGGAGAAGGAAG
T7_10451_G06	GAGAGAGAAAGAAGGAAGTCGAGAAGAGAGGGAGAG
T7_10452_G06	GAGAAAGAGAGAAGGGAGTCGAAGGGAAGAGAGAGA
T7_10453_G06	AAGAGAGAGAAGAGAGAGTCGAGAGGAGAGAAGGAG
T7_10454_G06	AGGAAAGAGGAGAGAGAGTCAGAAGGAGAGAGGGAA
T7_10455_G06	GGAGAAGAGAGAGAGAGGTCAGAGAGAGAAGAAGAG
T7_10456_G06	AGAGGAGAGAAGAGGAGGTCAAGAAGGAGAGAGAAG
T7_10457_G06	AGGAGAGAGAGAGAGAGGTCAGAAGAGGAGAAAGAG
T7_10458_G06	AAGAGGAGAGAGGGAGAGTCGAGAAGAGAAGGAAGA
T7_10459_G06	GAAAGGAGAGAGAGGAGGTCAGAGAAGAGAGAGAGA
T7_10460_G06	AAAGGAGGAGAGAAGAAGTCGGAGAGGAGAGAGAGA
T7_10461_G06	AAGAGAGGAAGAGAGGAGTCGAGGAGAAGAGAGAGA
T7_10462_G06	AGAGAGAGAGAGAGAGAGTCAGAGAAGAGAGAGGAG
T7_10463_G06	GAGAAGAGAGGAAGAGAGTCAGGAGGAGAGAGAGAA
T7_10464_G06	AAGAAGGAAGAGGAGGAGTCGAAGAGAGAGAAGAGG
T7_10465_G06	GAGAGAAAGGGAGAGAAGTCAAGGGAGAGAAGGAGA
T7_10466_G06	GAGAGGAGAAGAGGAGAGTCGAAGGAGAAAGAGAGA
T7_10467_G06	AGAGAGAAAGGGAGGGAGTCGGAGAAGAAGAGAAGA
T7_10468_G06	GGAGAAGAGAGAAGGAAGTCAGGAGAGAGAGAAGAG
T7_10469_G06	GGGAGAAAAAGAAGAAGGTCAAGGAGGGAAGAGGAG
T7_10470_G06	AGAGGAAGGAGGAAGAAGTCGGAAGAGAGAGAAGAG
T7_10471_G06	GAGAGAGAGAGAAGAGGGTCGAGGAGAGAGAAAAAG
T7_10472_G06	GAAGAGAGAAGAGAGGAGTCAGAAGAGAGGAGGAGA
T7_10473_G06	AGAGAGAGAGAGAAGAGGTCGAAGGAGAGAGAGGAA
T7_10474_G06	AGGAGAGAGGGGAAGAGGTCAGAAGAAGAAAGAGAG
T7_10475_G06	AGAGAAAGAGAGGAAGAGTCAGAGAGGGAGGAGAAG
T7_10476_G06	AAGAGAAGGAGAAGAGAGTCGAGAGGGAGGAGAAGA
T7_10477_G06	AAGGAGGGAGAGAGAGAGTCGAGAGAAGGAAAGAAG
T7_10478_G06	GAGAGAAGAGAGAGAAGGTCGAGAGGAAGAGAGAAG
T7_10479_G06	AGAGAGAGAAGAGAAGAGTCGAGAGAGAGAGGAGAG
T7_10480_G06	GAGGAGAGAGAGAGAGAGTCGAGAAAGAAGAGAGAG
T7_10481_G06	GGAAAAGAGGAGGAGAGGTCAGAGGGAAGAAAGAGA
T7_10482_G06	AAGAGAGAGGAGAAGAAGTCGGAGGAAGAGAGAGGA
T7_10483_G06	GAGAGAGGAGGAGGGAAGTCAGGAGAAAGAAGGAAA
T7_10484_G06	AGGGAGAGAAGAGAGAGGTCGGAAAGAGGAGGAAAA
T7_10485_G06	AGGAAGAGAGAGAGGAGGTCGGAAAGAAGAGAGAGA
T7_10486_G06	GAGAGAAGAGAGGAAGGGTCAAAGAAAGGAGAGGGA
T7_10487_G06	GGAAGAGGAGGAGAAAGGTCAGAAGAAAGAGGGAAG
T7_10488_G06	GGAGAAGGAAGGAAAAGGTCAGAGAGAAGGAAGAGG
T7_10489_G06	GAGAAGAAGAAGAGGGAGTCGAGAGAAAGAGAGGAG
T7_10490_G06	AGAGAGAAGAGAGAGAGGTCAAGAGAGAAGAGGAGG
T7_10491_G06	GGAGAGAGAAAGAAGAGGTCAGAGAGAGAGAGAGAG
T7_10492_G06	AAGAGAAGAGGAGAGAGGTCAAGAGGAGAGAGGAGA
T7_10493_G06	AGAGAGGGAGAAAGAGAGTCGAGAAGGAGAGAGAGA
T7_10494_G06	GAGAAGGAGAGAGAGAGGTCGAGAAGAAAGAGAGAG
T7_10495_G06	GAGGAAGAGAAGAGGAGGTCAAGAGAAGAGAGAAGG
T7_10496_G06	AGAGAGAGAAGAGAGAGGTCAGAGAGAGAGAGAGAG
T7_10497_G06	AGAAGGGAGAGAGGAGAGTCAAAGGAGAAGAGAGAG
T7_10498_G06	AGAGAGGAGGAGAGAGAGTCGAGAAAGAGGAAGAGA
T7_10499_G06	AGGAAGAGGAGAAGGGAGTCGAAGAAGAGAAGAGGA
T7_10500_G06	AGAGAAGGGGAGAAGGAGTCGAAGAGGAGAAAGAGA
T7_10501_G06	AGAGAGAAGAGAGAGAGGTCAGAGAGGGAGAGAGAA
T7_10502_G06	GAGAGAAGAGAGAAGAAGTCGAGAGAAAGAGGGGAG
T7_10503_G06	AGAGAGAGAGAGGAGAAGTCGAAAGGGAGAGAGAGA
T7_10504_G06	AGAAAGAGAGGAGGAGAGTCAGAGGAGAGAGAGAGA
T7_10505_G06	AGAGAAGAGGAAGAGGAGTCGAGAGAGGAGAAGAGA
T7_10506_G06	GGAGAGAGAGAGAGAGGGTCAGGAAAAGAAGAGAAG
T7_10507_G06	GAGAGAGAGAAAGAGAGGTCAGAGGAAGAGAGGGAA
T7_10508_G06	GAGAAGAGAGGGAAGAAGTCGAGAGAGAGAAGAGAG
T7_10509_G06	AGAGAGAGAGAGAGAGGGTCGAGAGAGGAAGAAGAA
T7_10510_G06	AGGAGAGAGAGGGAAGAGTCGAGAAGAGAGAAGAGA
T7_10511_G06	GAGAAAGAGGAAAGAGAGTCGGAGAAGAGGAGGAGA
T7_10512_G06	GAGAAGGAGAAGAAGAGGTCAGGAGAGAGAGAAGAG
T7_10513_G06	AGGAGAGAGAGGGAGAGGTCAAAGAGAGAAGAGAAG
T7_10514_G06	GAGAGAGGAGAGAGAGAGTCAGAGAGAAAGGGAAAG
T7_10515_G06	AGGGAAGAAGAGGGAGAGTCAAGAAGAGGAGAGAAG
T7_10516_G06	GAGAGAGAGAGAGAGAGGTCGAGAAGGAAGAGAAGA
T7_10517_G06	AAGAGAGAGAGAGAAAGGTCAGAGAAGGGAGGAAGG
T7_10518_G06	GAGAGGGAGAAGAGAGAGTCAGAAAGGAGAGGAAGA
T7_10519_G06	GAGGAGAAAGAAAGAGAGTCGAGGAAGGGAGAGAGA
T7_10520_G06	AAGAAGAAGGAGAGAGGGTCAGAGAAAGAGGGGAAG
T7_10521_G06	AGAAGAAGAGGAGGAAGGTCAAGGGAAAAGAGGGGA
T7_10522_G06	GAGAGAGAGGAGAAAAGGTCAGGAGAGAGAGAGAGA
T7_10523_G06	GAGAGGAGAAGGAGAGAGTCGAGAGGAAGAAGAGAA
T7_10524_G06	AAGAGAAGAGAGAGGAGGTCAGAGAAGAAGGGGAGA
T7_10525_G06	GAGAGAGAGAGGAAGAAGTCAGGAGGAGAGAGAAGA
T7_10526_G06	AGGAGAGGAGGAGAGAGGTCAGAGAGAGAAAAGAGA
T7_10527_G06	GAAAGAGAGAGGAGAAGGTCAGAAGAGAGAGGAGGA
T7_10528_G06	GAGAGAGAGAGAGAAGAGTCGGGGAAGAAAAGAGAG
T7_10529_G06	AGAGAAGAAAGAGAGAGGTCAAAGAGAGGGAGGGGA
T7_10530_G06	AGGAGAGAGAGAAGAGAGTCGGGGAGAAAGAAGAAG
T7_10531_G06	GAGAGAGAGAGAGAGAGGTCAAGAAGAAGAAGGGAG
T7_10532_G06	GGAAAGAGAGAGAGAGAGTCAGGAAGAGGAGAAAGG
T7_10533_G06	GAGAGAGAGGAAGAGGAGTCGAGAAAGAGGAAGAGA
T7_10534_G06	GAGAAGAGAGAGAGGGAGTCAGAGAAGAGAGAAGAG
T7_10535_G06	AGGAGAGGGAGAAGAAAGTCAGGAGAGAGAGAGAGA
T7_10536_G06	GGGGAGAAAAAAGAGAGGTCAGAGGAGAGAGAGAGA
T7_10537_G06	AAGAGAAGAGGGAGAAGGTCGAGGAAGAGAGAAGAG
T7_10538_G06	AGAGGAGGAAGAGAAGGGTCAGAGAGAGAAAAGAGG
T7_10539_G06	GGAAGAGAGAGAGAAGGGTCAGAGGAGAGAGGAAAA
T7_10540_G06	AGGAGAGAAGGAGAGAAGTCGAGAGAGGAGAGAAGA
T7_10541_G06	GAAGAGGAGAAGAGAGAGTCAAGAGAGAGAAGGAGG
T7_10542_G06	GAGAGAAGAAGAGAGAAGTCGAGAGAGAGGAAGGGA
T7_10543_G06	AGGAGAAAAGAGGAGAGGTCAGAGAGAGGAGGAAGA
T7_10544_G06	AAGAAGGGAAGAGGAGAGTCGAGAGAGGAGAGAAAG
T7_10545_G06	GAAGAAAGAGAGAGGGAGTCGAGAGAGAAGAGGAGA
T7_10546_G06	AAGAAGGAAAGGGGAGAGTCGAAGGAGAGGAGAGAA
T7_10547_G06	AGAGAGAGAGAGAGAGAGTCGAAAGAGAGGGAAGAG
T7_10548_G06	AGAGGGGAAAAGAGAGAGTCGAGAGAAGAGAGAAGG
T7_10549_G06	GGAGAAGAGAGAAAGAGGTCAAGAGAGGAGAGAGAG
T7_10550_G06	GAGGAGAGAGAAGAGGAGTCGAAAGAGGAAGAGAGA
T7_10551_G06	AGAGGAGAGAGAGGAGAGTCGAGAGAGAAGAAGAGA
T7_10552_G06	GAGGAGAGAGAAAGAAGGTCAGAGGAGAGAGAGAGA
T7_10553_G06	AAAGAGAGGAGAGAAGAGTCGAAGAGAGAGGAGAGG
T7_10554_G06	AAAGAGAGAGAGAGAGAGTCAGAGAGAGAGAGAGGG
T7_10555_G06	GAGAGAGAGAAAAGAGGGTCGAGAGAGAGAGAAGAG
T7_10556_G06	AGAAGGAGAGGAGAAGAGTCGAAGAAGGGAAGGAGA
T7_10557_G06	AGAGAGGAGAGAGAGAGGTCAGAGAAAGGGAGAAGA
T7_10558_G06	GAGAAGAGGGAAAGGAGGTCGAAAGAGAAAGGAAGG
T7_10559_G06	AGAAGAGAGAAGAGAGAGTCGGAGAGAGAGAGAGGA
T7_10560_G06	GAGAGGGAGAGAGAGAGGTCAGGAAGAAAAGAGAAG
T7_10561_G06	AGGAGGAGGGAGAAAGAGTCGAAGAGAGGAAAGGAA
T7_10562_G06	AAGGAGAAAGAGGGAAGGTCAGGAGGAGAAGAGAGA
T7_10563_G06	AGGAGAAGAAGAGGAGAGTCGAGAGAGGGAAGAAAG
T7_10564_G06	AGAGGAAGAGAGAGGGAGTCGGAGAGAAAAGGAAGA
T7_10565_G06	GAGAGAGAGAGGGAGAAGTCAAGAAGAGAGGAGAGA
T7_10566_G06	GAGAAGAGAGAGGAGAGGTCGAAGGAAAGAGAAGAG
T7_10567_G06	GAGAGAAGAGAGGAGAGGTCAGAGAAGAGAGAGAAG
T7_10568_G06	GGAAAGAGGAAGAGAGAGTCGAGAGAAGAGAGAGAG
T7_10569_G06	AGGAGAAGAGAGAGAGGGTCGAGAGAAGAAAGAGAG
T7_10570_G06	GAGGAAGGAGAGAAGAAGTCGAAGAGAGAGGAGAAG
T7_10571_G06	AGGGAGAGAGGGAGGAAGTCGAAGAGAAGAAAGAGA
T7_10572_G06	GGAGAGGAGAAGAGAGAGTCGAGAAGAGAGAGAAGA
T7_10573_G06	AGGAGAGAGAGAAGAGAGTCGAGAGAGAGAGAGAGA
T7_10574_G06	GAGAAGGGAGAGAGAAAGTCGAGGAAGGAGAGAGAA
T7_10575_G06	GAGAGGAGGGAGAGAGAGTCGAAGAAGAGGAAAAGA
T7_10576_G06	AGAAGGAAGAAGAAGGAGTCGAGAGAGAGGAGAAGG
T7_10577_G06	GAGAGAGAGAGAAGAAAGTCGGAAGGAAGGAGAAGG
T7_10578_G06	GAAGAGAGAGAAGGAGAGTCAGAGAGGAGAAAGGGA
T7_10579_G06	AGAGGAGAGGGAGAAGAGTCGAAAAGAAGGAGAGAG
T7_10580_G06	AGAAGAGAGAGAAGAGAGTCGAGAGGAAGAGAGAGG
T7_10581_G06	AAGAGGAGGAAAGAGAGGTCGGAGAGGAGAAGGAAA
T7_10582_G06	GAGAAAGGAGAGAGGAGGTCGAGAAGGAGAAAGGAA
T7_10583_G06	AAGAGAGGGAGAGAGGAGTCGAGAAGAGAGAGAAGA
T7_10584_G06	GAAGAAGAGAGAGAAGGGTCGAGAGAGGAGAGAAGA
T7_10585_G06	AAAAGGAGAGAGAGAGAGTCGAGGAGAGAGAGAGAG
T7_10586_G06	AGAGAGAAAGAGGAGAGGTCAGAGAAGGGAGAAGAG
T7_10587_G06	AAGAGAAGAGAGAAAAAGTCGAGGGAGAGGAGAGGG
T7_10588_G06	AGAGAGAAGAGAGAAGAGTCGAGAGAAAGAGGGGAG
T7_10589_G06	GAGAAGAAGAAGAAGAGGTCAGGAGGAGAGAGAGGA
T7_10590_G06	GAGAGAGAGAGAAGAAAGTCAGAGGAGGAGAGAGGA
T7_10591_G06	AAGAGAGAGGGAAGAGAGTCGAGAAAGGAAGGAAGG
T7_10592_G06	AGAGAGAGGAAGAGAAGGTCAGAGAAAGGAGGAGAG
T7_10593_G06	GAGAGGAGAAGAAGAGAGTCGGAAGAGAGAGAGAGA
T7_10594_G06	AGAGAGGAAGAGAGAGGGTCAAGAGAAGGGAGAAGA
T7_10595_G06	AAAAGAGAGGAGGAAGGGTCGAGAGAGGGAAGAGAA
T7_10596_G06	GAGAGAGAGAGGAGAGGGTCAAGAAAGAAGAAGGAG
T7_10597_G06	AGAGAGAGAGGGAGAAGGTCAAGAGAAGAGAGAGAG
T7_10598_G06	AGGGAGAAAAGAAAGGAGTCGGGAGAGAAGAAGGGA
T7_10599_G06	GAGAGGAGAGGAAGAGAGTCGAAAGAGAAGAGAGAG
T7_10600_G06	AAAGGAGAGAGAGAGAGGTCGAGAGGAAAGAGAGGA
T7_10601_G06	AAGAGAGAGGAGAGAGAGTCGAGAAGGGAGAAGAGA
T7_10602_G06	GAAGAAGAAAGGAGAGAGTCGAGGAAGAGGAAGAGG
T7_10603_G06	GAGGAGAGAGAGAGAGAGTCGAAAGAGAGAGAGAAG
T7_10604_G06	GGGAGAGAAGAGAAGAGGTCAGGGAAGAGAGAAAGA
T7_10605_G06	AGAGAGAGAAGAGGAAGGTCAGGAGAGAAGGAAGAG
T7_10606_G06	AGGGAAGAAGGGAGAAGGTCAGGAGGGAAAAGAAAG
T7_10607_G06	GAGGAGAGAGAAAGGAGGTCAGAGAAAGAGAAGAGG
T7_10608_G06	AAAGGGGAGAAGAAGAGGTCAGAGAGAAGGAGAGGA
T7_10609_G06	AGAAAGAGAGGAAAGAGGTCAGGGAAAGGAGAGAGG
T7_10610_G06	GAAGGGAGAGGAGAGAGGTCAGAAGAAGAAAGAGAG
T7_10611_G06	AGGAGAAGGAGAGAGAGGTCAGAGAAGAGAGAGAGA
T7_10612_G06	GAAGGAGAAGAGGAAGAGTCGAAGAGAGAGAGAGAG
T7_10613_G06	GAGAGAGAGAGGAGAAGGTCAAGAGAGGAGAGAAGA
T7_10614_G06	GGGAAAGGAGAGAAGAAGTCGAGAGAGAAGGAGAGA
T7_10615_G06	AAGAAAGAGGAGAGGAGGTCAGAGAGGGGAAGAAGA
T7_10616_G06	GGAGAGAGAAGAGAAGAGTCGAGAAAGGGAAGAGAG
T7_10617_G06	GGAGAGGAGAGAGAGAGGTCAGAAGAAGAAGAGAAG
T7_10618_G06	GAAGAAAAAGAAAGGGAGTCGAGAGAGGGAGGAGAG
T7_10619_G06	GAGAGGGAAAGGGAGGAGTCAGAGAAGAGAAAGAAG
T7_10620_G06	AAGAAAGAGAGAGAGAGGTCGAAAGGAGAGGGGAGA
T7_10621_G06	GAAGAGAGAGAGAAGAGGTCAAGAGAAGGGGAGAAG
T7_10622_G06	GAGAGAGAAGGAGGAAGGTCGGAAAAGAAGGAAGAG
T7_10623_G06	GAGGAGAAAAAGAGGAGGTCAAGAGAGAGAGAGAGG
T7_10624_G06	AGGAGAAGAGGAGGAGAGTCGAAGAGAGAGAGAAGA
T7_10625_G06	GGAGAAGGAGAAGAGAGGTCAGAGAAGAGGAGAAAG
T7_10626_G06	AAAGGAGAAGGAGGAAGGTCAGAGAGAGAAAGGAGG
T7_10627_G06	GAAGAGAGGAGAGAAGAGTCGAAGGGAGAGGAAAAG
T7_10628_G06	GAGAAAGAGAGAAAAGGGTCAGAGGGAAGAGAGAGG
T7_10629_G06	AAGAGAGAGAGAGAAGAGTCGAGGAGAGAGGAGAGA
T7_10630_G06	GAGAGAGGGAAAAAGAGGTCAGAAAGAGGAGGAGGA
T7_10631_G06	GAGAGAAGAGAGAGGGAGTCAAGAGAGGAGAAAGAG
T7_10632_G06	AGAAAAGAGGGGAAGAGGTCAGGAGAAGGAGAGAAG
T7_10633_G06	GAGGGGAGAAAGAGAGAGTCGAGAGAGAAGAGAAGA
T7_10634_G06	AGAAGAGAAGGGGAAAGGTCGAGGAGAAGAGAAGAG
T7_10635_G06	GGAGAGAGAGAAGAGAGGTCAGAGGAGAGAAAGAAG
T7_10636_G06	AGGAAGAGAAGGAGAGGGTCGGAAAGAGAGAAAGAG
T7_10637_G06	AGAGAGGGAAGGAGAAGGTCAGAGAGAAGAGAGGAA
T7_10638_G06	GGAAAGAGGAAAGGAGAGTCAGAGGAGAAGAGGAAG
T7_10639_G06	GAGAGAAGAGGAGAGAGGTCAAGAAGAGAGAAGGAG
T7_10640_G06	AGAAGGAGGAGAAGAGAGTCGAAGAGGAGAGAGAGA
T7_10641_G06	AGAGAAGGAGAGAGAAAGTCGGAGAGAGAGAGAGAG
T7_10642_G06	AGGAGAAGAGAGAGAGAGTCGAAAGGAGGAAGAGAG
T7_10643_G06	AGAAGAGAAGGGGAGAGGTCGAAAGAAGAAGGGAAG
T7_10644_G06	AGAGAAGGAAGAGAAGAGTCGAGGAGAGAGAGAGAG
T7_10645_G06	GAGAGAGAAAAGAGGGAGTCGAGGAGAGAGAGAGAA
T7_10646_G06	GAGAGAGAGGAAGAAGAGTCGAGAAGAGAGAGAGAG
T7_10647_G06	AGAGGAGAAAGAGAAGAGTCGAGAGAGAGGGAAGGA
T7_10648_G06	AGGAAGAGAGGAGAGGAGTCGAGAGGAGAGAAGAAA
T7_10649_G06	AAGAAGAGAGAGAAGAAGTCGAGGGGAGAGAAGGAG
T7_10650_G06	AGGAGAGAGAGAGAGGAGTCGGAAGAAGAGAGAAAG
T7_10651_G06	GAAGAGGAAGGAGGGAGGTCAGAGAAAGAAGAGAGA
T7_10652_G06	AAGAAAGGAGGAGGGAAGTCGGAGGAGAAAGAGAGA
T7_10653_G06	AGAGAAGAGAGAGAGAGGTCAGAGAGAGAAGGGAGA
T7_10654_G06	GAAGAGGAGGAAGAGAGGTCAGAGAGGAGAGAGAAA
T7_10655_G06	AGAAAGAGGAGGAGAAGGTCAGAGAGAGAAGGAGAG
T7_10656_G06	GAGAGAGAGAGAGAGAGGTCAGAGAGAGGAGAAGAA
T7_10657_G06	AGAAAAAGGGAGAAGAGGTCGAGGGAGAGAGAGAGA
T7_10658_G06	GAGAGAGAGAGAGAGGAGTCAAGAGAGAAGGAGAGA
T7_10659_G06	GAGAAGAGAGAAGGAGAGTCGAGAAGGAGAGAGAGA
T7_10660_G06	AGAGAGAGAAGAGAAGAGTCAGAGAAGAGAGGGAGG
T7_10661_G06	GAGAAAAGAGGAGGGAAGTCGAGGAGAGAGAGAGAA
T7_10662_G06	AGAGAGGAGGGAAGAGAGTCGAGGAGAAAGAAAGAG
T7_10663_G06	AGGAGAAGGAAAGGGAGGTCAGAGGAGAGAAGAAGA
T7_10664_G06	GAGGAAAGAGAAAGAGAGTCGGAGAGAAGGAGAGAG
T7_10665_G06	AGGAGAGGAGAAGAAAGGTCGGAGAAGAGAGAAAGG
T7_10666_G06	GAGAGGAGAGAGGAGAGGTCAGAAAGAAGAGGAAGA
T7_10667_G06	AGGAGAGAGAAGAGAGGGTCAGGAGAGAGAGGAAAA
T7_10668_G06	GGAGAAGAGAGAAGAGAGTCAGGAAGAGAGAGAGAG
T7_10669_G06	AGAGAGAGAGAGAAGAAGTCGAGAAGGAGAGGAGAG
T7_10670_G06	GAGAGAGAAGAGAGAGAGTCGGGAAGAGAGAAGAAG
T7_10671_G06	GGAGGAGAAGAGAGAGAGTCGGAAGAGAGAAGAAGA
T7_10672_G06	GAGAGAGAGAGGAAGAGGTCAAGGGAGAAGAAGAGA
T7_10673_G06	AGAGAGAGAAAGAGGAGGTCAAGAGAGAGAGAGGAG
T7_10674_G06	GGAGAGAAGAGGAGAAGGTCAGAGAAGAGAGAGAAG
T7_10675_G06	GAAGGGAAGAGAAGGAGGTCAGAAGAGAGAGGAGAA
T7_10676_G06	GAGAGAGAGAGAGAGAAGTCGAGAGAAGAGGAGAAG
T7_10677_G06	AGGAGAGGGAGAAGAAAGTCGAGAGAAGAGAGAGAG
T7_10678_G06	GAAGAAGAGGGAAGAGAGTCGAGAAGAGGAGAGGAA
T7_10679_G06	GGAAGAGAGAGGAGAGAGTCGAGAGAAGAGGAGAAA
T7_10680_G06	GAAAGAGAGAGAGGAAGGTCAGAGAGAGAGAGGAGA
T7_10681_G06	AGAAGAAGAGAGAAGGGGTCAAGAGGAGAGGGAGAA
T7_10682_G06	AAAGAGAGGAGAGGGAGGTCAAGAGGAGAGAAGAGA
T7_10683_G06	AGAGAGAGAGAAGAAGAGTCGAGGAGGGAAGAGAGA
T7_10684_G06	GGAGGAGAAGAGAGAAGGTCAGAGGGAAGAGAAAGA
T7_10685_G06	AGAGAGAGAAGGAGAGAGTCAGAGGGAGAGAAGGAA
T7_10686_G06	GAGGAAGAGGGAGGAAAGTCGAGAGAGAGAAGAAAG
T7_10687_G06	AGGAAAAGAGGAGGGAGGTCAGGAGAAGAGAAGAGA
T7_10688_G06	GAGAGGAAGGAGAAAAGGTCAGGGAAGAAGAGAGAG
T7_10689_G06	AGGAAGAGAGAGAAGAGGTCAGAGAGAGGAGAGAGA
T7_10690_G06	AGAGGAGAGAGGAAAGAGTCAGAAGAGGAGAGAGAG
T7_10691_G06	AGAGAAGAAGAAGGGAAGTCGAGAGAGGAGGAGAGA
T7_10692_G06	GGAGAAGAGAGAGAGAAGTCGAAGAGGAAGAGGAAG
T7_10693_G06	GAAAGGAGAGAGAGAAGGTCGAGAGAGAGAGAAGAG
T7_10694_G06	GAGAAGGAGAGAGAAGAGTCAGGAAGAAGAGGAGGA
T7_10695_G06	AGAGAAGAGGGGAGGAAGTCGAGAAGGAAGAAGAAG
T7_10696_G06	AGAGGAGGGAAGAGAGAGTCGAGAGGAAAGAGAAAG
T7_10697_G06	GGAAAGAGAAGAGAGGGGTCAGAAGAAAGGAGGAGA
T7_10698_G06	GAAGGGAAGAGAGAAGAGTCGAGAGAAGAGAGAGAG
T7_10699_G06	GGAAGAGAAGAGAGAGAGTCAGAGAGAGAGAGAGAG
T7_10700_G06	AAAGAGGAAGAGAAAAGGTCAGGGAGAGGGAGGAGA
T7_10701_G06	GAGAGAGAGGAGAAGGAGTCGGGGAGAAAGAAGAAA
T7_10702_G06	AGGAGAGAGAGGAGGAAGTCGAGAAAGAGAAGAGAG
T7_10703_G06	AGAGAAGGGAGAGAGGGGTCAAGAAGAGAGAGAAGA
T7_10704_G06	AGGGAAGAGAGAAGGAGGTCAGAGGAAAGAAGAGAG
T7_10705_G06	GAGGAGAGGAAGAGAAGGTCAGAGAGGAAGAAGGAA
T7_10706_G06	AGGAGGAGAGGAGAGAGGTCAAAGAAAAGAGAGGAG
T7_10707_G06	GAAGAGGAGAGAAGAGAGTCGGAAGAAAAGGAGGAG
T7_10708_G06	AGAGGAAAGAGGAGAGAGTCGAAGAAGAGAGGAGAG
T7_10709_G06	GAAGGAAGAGGAGGAAAGTCAGAGAGAGAGAGAGGA
T7_10710_G06	AGAAGAAGGAAGAGAGAGTCGAGGAAGAGAGAGAGG
T7_10711_G06	AGAGAGAAGGAGAAGAGGTCAAGAGGGAGAAAGAGG
T7_10712_G06	AGGAGAGAGGAAGGAAGGTCAAAAGAGAGAGGAGGA
T7_10713_G06	AAAGAGAGGAGGAGAAGGTCAAGAGAGGAAGGAGAG
T7_10714_G06	AGAGGGAGAGGAAAAGAGTCGAGAGAAGGAGAGAGA
T7_10715_G06	GAGAGAAGAGAGAGAGAGTCAGAGAGAGAAGAGGAG
T7_10716_G06	AAGAGAGAGAAGAGAGAGTCAGAGAGGAGAGAGGGA
T7_10717_G06	AAAGGAGAGAAGAGAGAGTCGAGGAAGAGGAGAGAG
T7_10718_G06	AGAGAGAGAAAAGAGAGGTCGAGAGAGAGGAGAGGA
T7_10719_G06	GGAGAGGAAGAAAAGGAGTCGAGAGAAGAAGGAGAG
T7_10720_G06	AGAGAGAAGAGAGAGAAGTCGAGAGGAGGGAGAGAA
T7_10721_G06	AGAAGGAGGAGAGAAGAGTCAGAGGAGAAAGGAGAG
T7_10722_G06	GAGGGAGAGAGAAGGAAGTCGAGAAGAAGAAGAGAG
T7_10723_G06	GGAGAAGAGAGAGAGAGGTCAGAAGAGGAGAAGAGA
T7_10724_G06	GGAAGAGGAAGAGAGAGGTCGAGAAGAAGAAAGAGG
T7_10725_G06	GAGGAAGAAGAAGAGAAGTCGAGAGGGAAGAAGAGG
T7_10726_G06	GAGAGGAGAGAGGAGGAGTCAGAGAGAAAGAAAGAG
T7_10727_G06	GAGAAGAGAGAGAGAGAGTCAGAGAGAAGGAGAGAG
T7_10728_G06	GGAAGAGAGGAGGAAAAGTCGGAGAGAGAGAAGGAA
T7_10729_G06	GAGAAAAGAAGAGAGGAGTCGAGAGAGAGAGAGAGG
T7_10730_G06	AGAGAAGGAGAGGAGAGGTCAGAAAGAGAGAGGAGA
T7_10731_G06	GAGGAAAGAGAGGGAGAGTCAAGAAGGAGAAGAAGG
T7_10732_G06	AGGGAGAGAGGAAAAGAGTCGGAGAGAGGGAAGAAA
T7_10733_G06	AGAAGAGAAGGAGAGAAGTCGAGAAGGAGAGAGAGG
T7_10734_G06	GAGAGAGAGAAGAGAAGGTCGAGGAGAGAGAGAAGA
T7_10735_G06	GGAAAGAGAGAGGGAAGGTCAGAGAGAGAGAAGAAG
T7_10736_G06	GAAGAGAAGGAAGGAAAGTCGAAGGAGAGAGAGAGG
T7_10737_G06	AAGAGGAGAAAGGAGGAGTCAGGAGAGAGGAGAAGA
T7_10738_G06	GAGAGAGAGAAGGAGAAGTCAAGGAGAGAAGAGGGA
T7_10739_G06	GAAAGAGGGAAGAGGAGGTCAGAGAGAGAGGAAAGA
T7_10740_G06	GGGAGAAGAGAGAGAAGGTCAGAGAAGAGAGAAGAG
T7_10741_G06	AGAGAGAGAGAAAGAGGGTCAGGAGAAGGAGAAGAG
T7_10742_G06	GAGAGAAGAAGAGAAGGGTCGAGAGAGAGGGAGAAA
T7_10743_G06	GAGAAGAGGAGAGGAGAGTCGAAAGAGAGAGAGAGA
T7_10744_G06	AAAGGAAGGAGAGAAGGGTCAGAAGAGGAAGAGGAG
T7_10745_G06	GAAGGAGAGGGAGAAGAGTCGAAGAGAGAAGAGGAA
T7_10746_G06	GAAGGAGAAGAAGAGAGGTCAGAGGAGGGAAAAGAG
T7_10747_G06	GAGGAGGAGAAGAGAAGGTCAGAAGGAAAGAGGGAA
T7_10748_G06	GAGAGAGAAGAGAAGGAGTCGAGGAAGAGAGAAGGA
T7_10749_G06	GAAGAGAGAGAGGAAAGGTCAAGAGAGAGAGAGAGG
T7_10750_G06	AGGAGAGAGGAGAGGAGGTCAGAAAAGAGAGAAGAG
T7_10751_G06	GGAGAGAGAAAAGAAGAGTCGAGGAGAGAAGGAGGA
T7_10752_G06	AGAGAGGAGAGAAGAAGGTCAAGAGGAGAGAGAGAG
T7_10753_G06	AGAAGAGGAAGGAAGAGGTCAAGAGGAAGAGGAAGG
T7_10754_G06	GGAGAAGAGGAAGAGAGGTCAGAGAAAGGAGAGAGA
T7_10755_G06	GAGGGGAAGAAGAGAGAGTCGAGAGAAAGAGAAGAG
T7_10756_G06	GAGAGAAGAGAGAAGAGGTCAGAGGAGAAGAGAGAG
T7_10757_G06	AGAAGAGAGGAGAGGAGGTCGAGAAAGAAGAAGGGA
T7_10758_G06	AGAGGAGAGAGAGAAAGGTCAGAGAGGAGAAGGAAG
T7_10759_G06	GGAGAGGAAGAGAGAGGGTCGAGAAAAGAAAAGGAG
T7_10760_G06	AGGGAGAAAGAAAGAGGGTCAGAGAGGAGAGAGAAG
T7_10761_G06	GAGAGAGGAAGAGAGAAGTCGAGAAGAGAAGGGGAA
T7_10762_G06	GAGAGAAGAAAGAAGAGGTCGAGGAAGAGGAGGGAA
T7_10763_G06	AGAGGAGAGAGAGAGGAGTCGAGAGAGAAGGAAGAA
T7_10764_G06	GAGAGAGGAGAAGAGGAGTCGAGAAGAGAAGAGAGA
T7_10765_G06	GAGAAGAGAGGAGAGAGGTCAGAAAAGAGGAGAGAG
T7_10766_G06	GAGAGAAGGAAAGAGAAGTCGAGAGAGAAGAGAGGG
T7_10767_G06	AGGAAAGGGAGAGGAGAGTCAGAGGAAAGAGGAAGA
T7_10768_G06	GAAGAAGGAAAAGAAGAGTCGGGAAGGGAGGAGAGA
T7_10769_G06	GGAAAAGAGAGAGAGAGGTCAGGAGGAAGGGAAAGA
T7_10770_G06	GGAGAAAGAGAGAGAGAGTCGGAGAAGGAGAAGAAG
T7_10771_G06	AGAAGGAGGAAGGAGGAGTCGAAGAAGGAGAGAGAA
T7_10772_G06	GAGGAAAGAGAGAGAGAGTCGAGAGAAGGAAGAGAG
T7_10773_G06	AAGAGGGGAGGAGGAAAGTCAGAGAAGGAAGAGAGA
T7_10774_G06	GAGAAGAAGGAGGGAAGGTCAGGAGAGGGAAAAAAG
T7_10775_G06	GAGAGGGAGAAAGAGAAGTCGAGAGAAAGAGGAGAG
T7_10776_G06	GGAGAGAGGAGGAAGAGGTCGAGAAAAAAGAGAAGG
T7_10777_G06	GGAGAGAGAGAAGGAAGGTCAAGAGGAGAGAGAAGA
T7_10778_G06	GAAGAGGAGAGAAGAGAGTCGAGAAGAGAGAGAAGG
T7_10779_G06	GAAGGAGAAGGAGGAGAGTCGAGAGGAAGAGAGAAA
T7_10780_G06	AGAGAGAGAGGAGAGAGGTCAGAGAAGAGAGAGAAG
T7_10781_G06	AGGAGGAAGAGAGAAGAGTCGAGGAAGGAGAAAGGA
T7_10782_G06	AAGGGAGAGAAGAGGAGGTCAAGAAGAGAGAGGAGA
T7_10783_G06	GAGGAGAGAAAGAAAAGGTCGAGAGAGAGGGAGAAG
T7_10784_G06	GAAGAGAGAGAAGAAGAGTCGAGAGAGGGAGAGAGA
T7_10785_G06	AAGAGAGAGAGGAGAAGGTCAGAAGAAGAGGGAGAG
T7_10786_G06	AGAGAAGAAGAGAGGAAGTCGAGAGAGGAGAAGAGG
T7_10787_G06	AGGGAGAAGAGAGAGAGGTCAAGAGGAGAGAGAGAA
T7_10788_G06	GAAAGAGAGAGAGAGAAGTCAGAGAAGAGGGAGAGG
T7_10789_G06	GAGAAGGAGAGAGAGAAGTCGAGAAGAGAGGAAGAG
T7_10790_G06	GAAAAAAGGAGAAGAGAGTCAGGAAGAGGGGAGAGG
T7_10791_G06	GAAGAGAGAAAGAGGGAGTCAGAGAGAGAGAGGAGA
T7_10792_G06	GAAGAGGAGAGGGAGGAGTCAAAGAGGAGAGAAAGA
T7_10793_G06	AGAAGAGAAGAGAGAGAGTCGAAAGGAGAGGGAGAG
T7_10794_G06	GGGAGAGAGGAGGGAAAGTCGAGAAGGGAAAAGAAA
T7_10795_G06	AGAGAAGAGGAGAGAAGGTCGAGAGAGGAAGAGAGA
T7_10796_G06	AGAGAAGAAGAGAGAGAGTCGAGAGAAGGGGAGAAG
T7_10797_G06	GAAGAGGAGGAGAAGAGGTCAGAAGAGAGAGAAGGA
T7_10798_G06	GAGAGGAAGGAGAGAGAGTCGAAGAAGAAAGGAGAG
T7_10799_G06	AAGAGAGAGAGAGAGAGGTCGAGAGGAGAGAAAGAG
T7_10800_G06	AGAGAAAGAGAGAGAGAGTCGAGAAGAGGAGAGGGA
T7_10801_G06	AGAGAGAGAGAAGAAAAGTCGGAGAGAGGGAGAGAG
T7_10802_G06	AGAGAGGAGGAGAAAGAGTCGGAAAGAAGAGAGAGG
T7_10803_G06	AGAGAAAAGAGAAGGGAGTCGAGGAGGAGGAAAGGA
T7_10804_G06	GAAGGAGGAAAGAAGAGGTCGAGAGAAGGAAAGAGG
T7_10805_G06	AAGAAGGAGGAGGAAGAGTCAGGAGGGAAAGGAGAA
T7_10806_G06	AAGAAGGGAAAAAGAGGGTCAGGAGAGAGGAGGAGA
T7_10807_G06	AAGAGGAAGGAGAGGAAGTCGAAAGGAGAGAGGAGA
T7_10808_G06	GAGAGGAGAGGAAAGAAGTCAGGAAGAAGAGGGAAG
T7_10809_G06	GAAGAGAGGGAGAGAGAGTCAGGAAGAAGAAAGAGG
T7_10810_G06	GAGAAGGAAGAGAGAGAGTCGAGAAGAGGGAGAGAA
T7_10811_G06	GGAAGAGAGGAGAGGAGGTCAGAGAAGAAAGAAGAG
T7_10812_G06	AGGAGAGGAGAGAGGAGGTCAAGGAGAGAGAGAAAA
T7_10813_G06	AAGAAAGAGGAGGGAGGGTCAAAAGGAAGAGGAGAG
T7_10814_G06	GAGAGGGGAAGAGAAGAGTCGAAGAGAGAAGAGAGA
T7_10815_G06	AGAAGAGAAAGGGAGGAGTCAGAGAGAGGAAAGGGA
T7_10816_G06	AGGGAAGGGGAAGAGGGGTCAGAAGAGAGAAAAAAG
T7_10817_G06	GGAAAGAGAGAGAGAAGGTCGAGGAAGAGAGAGGAA
T7_10818_G06	GAGGGAGAAAGAGAGAGGTCAGAGAAAGAGAGAAGG
T7_10819_G06	GGAAGAAAGAGAAGAGGGTCAGAGGAGAGAAGGAAG
T7_10820_G06	GGAGAAAGAGAGGAGGAGTCAGAAAGGAGGAAGAGA
T7_10821_G06	AGAAGGAGGAAAGGAAGGTCAAGAAGAGGGAGAAGG
T7_10822_G06	GAGAAAGAGAGGAGGAGGTCGAGAGAAAAGGAGAGA
T7_10823_G06	AAGAGGAAGGAGAAAAGGTCAGGAAGAGGGAGAAGG
T7_10824_G06	GGAGGGAAGAAAGAAGAGTCAAGGAGAAGAGGGAAG
T7_10825_G06	GGAGAAAGAGAGGAGGAGTCGAAGAGAAGGGAGAAA
T7_10826_G06	AAAGAGAGAGGAGAAGGGTCGAGGAGAGGAAAGGAA
T7_10827_G06	GAAAGAGAGAGAGGAAAGTCAGGAGAGAGAAGGAGG
T7_10828_G06	GGGAGAGAAAGAGAGAGGTCAGAAAAGGGAGAGAGA
T7_10829_G06	GAGAAGGAGAGGGAGAAGTCGGAAAGAGGAGAAAGA
T7_10830_G06	GAGGAAAGAGAGAGAAGGTCAAGAGAAGAAGGGGAG
T7_10831_G06	GAGAGAAGAGAGAAGGAGTCAGAGGAGAGGAAGAAG
T7_10832_G06	GAAAAGAGAGGAGGAGGGTCAAGAAGAGGAGAAAGG
T7_10833_G06	AGGAAGAGGAGAGAGAAGTCAGAGGAAGAAGAGGAG
T7_10834_G06	AGGAGGAGGAAGGAAAAGTCGAAGAGGAGAGAAGAG
T7_10835_G06	AGAGAGGAGAGGAAAAGGTCAAGGAGAGAGAGAGAG
T7_10836_G06	GAGAGAAAGAGAGAGAGGTCGAAGGGAGAAGAGAAG
T7_10837_G06	GAGGAGAAAGAAGGAGAGTCGGAGAGGAAGAAGAAG
T7_10838_G06	AAAGAAGAGGAGAGGGAGTCGAGAGGAAGAGAAGAG
T7_10839_G06	AGAGAAGAGGAGAAGGGGTCGAGAAGAGAGAGAAGA
T7_10840_G06	AGAGAAGAGGAAAAGAGGTCGAGGGAGAGAAGAGAG
T7_10841_G06	AAGAGAGAGAAGGAGAAGTCGGAGAGGGGAGAAGAA
T7_10842_G06	AGAGGAGAGAGAAGAGGGTCAAGAGAGAGGAAGAGA
T7_10843_G06	GAAAAGGAAGAAGGGAAGTCGGAGAGGAAGGAGAGA
T7_10844_G06	GAGAGGAGAGAGAGAAGGTCGAGAGAAGAAGAGGAA
T7_10845_G06	GAGAGAAAGAGAAGAGAGTCAGGAGAGAGAGGAAGG
T7_10846_G06	AGAAGAAGGAGAGAGGAGTCGAGAGAGAGAGAGGAA
T7_10847_G06	AAGAGAAAGGAGGAAAGGTCAGAGGAGGAAGAGAGG
T7_10848_G06	AGAAAAGGAGAGGGAAGGTCAGAGGGAGAGAAAGAG
T7_10849_G06	AGGGGAGAGAGGAGGAGGTCAAAAGAAAGAAGAGAG
T7_10850_G06	AAGAAGGAGGAGAGAGAGTCAAAAGGAGAGAGGGGA
T7_10851_G06	AGGGAGAGAAAGAGAAGGTCAGAGAGAAGAGAGGAG
T7_10852_G06	AAGGAGAGAGAAGGAAGGTCGAGAGAAAGAGGGAGA
T7_10853_G06	AGAGAAAGGAGAGAGGGGTCAAGAGGAGAGAGAGAA
T7_10854_G06	GAGAGAGGAGGAAAGAGGTCAGAGAGAAGGAGAGAA
T7_10855_G06	GGGGAAAGGAGGAGAGAGTCAAGAAGAAAGAGGGAA
T7_10856_G06	AAGGAGGAAAAGAAGGGGTCAGAGAGAAGGAGAGGA
T7_10857_G06	AAGAGGAGAGGAGAAAGGTCAGGAGAGAGAAAAGGG
T7_10858_G06	AGAAAGAGGGAAAGAGGGTCAGGAGAGGGAAGAAAG
T7_10859_G06	AGGAGGAGAGAGAGAGAGTCGGAAGAAGAGAAGAAG
T7_10860_G06	GAGGGAGGAGGGAGGAAGTCAGAGAAGAAAGAAAGA
T7_10861_G06	AGGAGAAAGGAGAGGGAGTCAGGGAGAGAAAGAAAG
T7_10862_G06	AGAGAGAGAGAAGAGAAGTCGGGAGAAGAAGAGGAG
T7_10863_G06	GAGAAGGAAGAGGAAGGGTCAGGAAGAGAAGAAGGA
T7_10864_G06	AGAGAAGAGGAGAGAAAGTCGAGGAGGAGAGAAGGA
T7_10865_G06	AAGAGAGAGAGAGGAGAGTCGAGAGAGAAGGAAGAG
T7_10866_G06	AGAGAGAGGAGAAGAGAGTCGAAGAGGAAGGGAGAA
T7_10867_G06	AGGAGAAAGGAAGGGGAGTCGAGAAAGAGAGAAGGA
T7_10868_G06	GGAGGAAAGAAGGGAGAGTCAGAAGGAGGAAAGAGA
T7_10869_G06	AGAGAAGAGGAGAGAGGGTCGAGAGAAGAAGAGAGA
T7_10870_G06	GAGAGAAGAGAAGGAGGGTCAGAAGAGAGAGAGAGA
T7_10871_G06	AAGAAGGAGAAGAAGGAGTCGAGGGAGAGAAGAGAG
T7_10872_G06	AGAAAGAGAGAAGAGGAGTCAGGAAGGAGAGGAAGG
T7_10873_G06	GAAAGAAAGAAGGAGAGGTCAGGAGGGGAAGAGAGA
T7_10874_G06	AGGAAGAGAAGAAGAGGGTCAGAGGAGGGAAAAGGA
T7_10875_G06	AGAGAGGAGAGAAGAGAGTCAGAAAGGAGAGGGAGA
T7_10876_G06	AAGGAAGAGAGAGGGGAGTCGGAAGAAAAGAGAGAG
T7_10877_G06	AGAGAAAAGGGGAGAAAGTCGAAGGGAGAGGGAAGA
T7_10878_G06	GAAAGAGGGAGAAGAGAGTCAGAGAGGAGGAGAAAG
T7_10879_G06	GGAAGAGGAGGGAAAAAGTCAAGGAAGAGGGAAGAG
T7_10880_G06	AGAGAGAAGAAGGAAGGGTCAGAGAGAAGAAGAGGG
T7_10881_G06	AGAGAGAAAGGGAGAGGGTCAGGGAAGAAGAGAGAA
T7_10882_G06	AGAAGAAAGGAAAGAGGGTCAGAGGAGAGGAAGGAG
T7_10883_G06	GAGAGGAAGAGGAAAGAGTCGGAGGAGAAGGAGAAA
T7_10884_G06	AAGGAGGAGGAGAGGGAGTCGAGAAAAGAGAGAAAG
T7_10885_G06	GGAGGAAAAGAGAAGGAGTCAGAGAGAGAGAGAGAG
T7_10886_G06	AGGGAGAAGAGGAAGGAGTCAAGAGGAGAGAAGAGA
T7_10887_G06	AAGGAGAAGGAAGAGAAGTCGGAGAAGAGGAGAGAG
T7_10888_G06	GGAGAGAGGAGAAGAAGGTCGAAAGGAGAGAAGAAG
T7_10889_G06	GAAGAAGAGAGGAGAGGGTCAAAAGAGGGAGGAAGA
T7_10890_G06	AAGAGGAGAGGAGAGGAGTCGAAAGGGAAGGAAGAA
T7_10891_G06	AAGAGGAGAGAGGGGAGGTCAAAGAGAAGAAGGAAG
T7_10892_G06	GGAGAGAGAAGAAAGAGGTCGGAGAGGAAGAGAAAG
T7_10893_G06	GAGAGGAGGAAAAGGGAGTCAGGAGGGAAGAAAAAG
T7_10894_G06	GAGAGGGGAGAGAGAAAGTCGAGAAAGGAGGAAAGA
T7_10895_G06	GAAAGGAAAAAGAGAGGGTCGAGGAGAAGAGAGGAG
T7_10896_G06	AGGAAGGAGAGAGAAGAGTCAGGAAAAGGGAAGGGA
T7_10897_G06	AGAAGAGGAGAAGGAGAGTCGAGGAAGAAGGAGAAG
T7_10898_G06	GAGAGGAAAGAGGAGAGGTCAGGAAGAGAAGAAGGA
T7_10899_G06	GAGAAGAGAGAAGAGGAGTCAAGAGAGAAGGAGAGG
T7_10900_G06	GAGAGAGAGAGAGAGGAGTCGGAAGAGAGAAGAAGA
T7_10901_G06	GAGGGAAGAAGAAAGGAGTCGAGAAGGAGAGAAGAG
T7_10902_G06	GAGGAAGAAGAAGGAGGGTCAGGAGAAGAAGGAAGA
T7_10903_G06	AGAGAAGAGAAGGAGGGGTCAGGGAAAAAAAGAGGG
T7_10904_G06	AGAGAAAAGAGAGAGAAGTCGGGAGAGAGAGAGGAG
T7_10905_G06	GGAGAAGAAGGAGAAGAGTCAGGAGGAGAGAAAGGA
T7_10906_G06	GAGAGGAGGAGGAAGAGGTCAGAGAGAGAGAAGAAA
T7_10907_G06	AAAGGAGGGAAGAGAAGGTCAGGGAGAGAAGAGAGA
T7_10908_G06	AGAAAAGGAGGGAGAGAGTCAAGAAGAGAGAGGGGA
T7_10909_G06	AAGAGAGAGAGGAGAGAGTCGGGAAGAAAGGGAGAA
T7_10910_G06	GAGGGAGAGGGAAGAAAGTCGGAGAGAGAGAAAGAA
T7_10911_G06	AGGAGGAGAGGGAAAAAGTCAGAGAGAAGAGGGAGA
T7_10912_G06	GAGAGAGGAGAGGAAGAGTCGAGAAAGGAGAAGAGA
T7_10913_G06	GAGAGGAAAAAGAGAAGGTCGAGAGAAGGAGGAGGA
T7_10914_G06	GAAGAGAGAGGAAGAGGGTCAGAGAAGAGAGAAGAG
T7_10915_G06	AGGAGGGAAGGGAAGAAGTCGAAGAAAAGAGAGGGA
T7_10916_G06	AGAGAGAGAGAGAAGAAGTCGAGGAGAGGGAAGAGA
T7_10917_G06	AAGAGAGAGAGAAGAGAGTCGGGAGAGAAAGAGGAG
T7_10918_G06	GAGAAGGAGAAAGAAGGGTCAGAAGAGGAAGAGGAG
T7_10919_G06	GAAAGGAAAAAGAGAGAGTCAGAGAGGGAGAGGGAG
T7_10920_G06	GGAGAAAAGGGGAGGAGGTCAGGAAGGAGAAAGAAA
T7_10921_G06	AAGAGAGAGGGAGAGAAGTCAGAAGGGAGAGAGAGA
T7_10922_G06	AGAGAGAGGAGAGAGGGGTCGAGGAAAGGAAAAAGA
T7_10923_G06	AAGAGAGGGAGAAGAAGGTCGGAGAGAGAGGAGAAA
T7_10924_G06	AAGAGAAGGAGAGAAGAGTCAGAGGAGGGGAGAAAG
T7_10925_G06	AAGAAGAGAGAGAGGAAGTCGGGAAGGAGAGAGAGA
T7_10926_G06	GGGGAGGGAGAAAGAGAGTCGGAAGAGAAAAGAAGA
T7_10927_G06	AGGGGAAAGAAAGAGAGGTCAGAAGAAGAGAGGAGG
T7_10928_G06	GAAGGAGAGGAAAAGAGGTCAGAGAGAGAGAGGGAA
T7_10929_G06	GAGAGAAGGAGAAGGAGGTCAAAAGGAGGAAGAGAG
T7_10930_G06	GAGGGAGAGAGAGGAGAGTCAAGAGAGAAGGAAGAA
T7_10931_G06	AGGAAAAGAGAAGAAGGGTCAGGAAGAGGAAGGGAG
T7_10932_G06	AGAGAAGAGAGAGGAAGGTCAGAGAGAGAAGAAGGG
T7_10933_G06	AGAGAGGGAAAGAGAGAGTCAGAGAGAGAGGAGAGA
T7_10934_G06	GAGAGAGAAAGAGAGGAGTCGAGGAAGAGGAGAGAA
T7_10935_G06	GGGAAAAAGGAAAGAGAGTCGAGGAGGAAGGAGAGA
T7_10936_G06	GGGAAAGAAGAGAGAAAGTCGAGGGGAAAAGAGGGA
T7_10937_G06	GAAGAGAGAGAGGGAAGGTCAGAGGGAAAAAGAAGG
T7_10938_G06	AAAGAAGGAGGGAGAAGGTCAAAGAGGAGAGAGAGG
T7_10939_G06	GAAAGAAAGAAGGGAGGGTCAAGGGAGAGAGAGAAG
T7_10940_G06	AGAGGAGAGAAAGAGAGGTCGAGAGAGGGAAGAGAA
T7_10941_G06	GAGAAGAGAAGAAAGAGGTCAAGAGGAGAGGAGGAG
T7_10942_G06	GAGAAGGAGAGAGGGGAGTCGAAGAGGAAAAGAAAG
T7_10943_G06	AAGAAGGGAGGAGAGAGGTCGAGAGAAGAGAGAGAA
T7_10944_G06	AGAAAGAGAAAGAGAGAGTCGAGAGAAGGAGGGAGG
T7_10945_G06	AAGGGAGAAGAGGAGAGGTCAAGAAAGAGAGGAGGA
T7_10946_G06	GGGAGAAGGAGAAGAAAGTCAGAAGAGAGGGAGAGA
T7_10947_G06	GAGAAAAGAGAGAAAGAGTCGGGGAGGAAAGGAGAG
T7_10948_G06	GAGGGAAGAGAGAGGAGGTCAGAAGAGAGAGAAAGA
T7_10949_G06	GAGAAGGGGAAGAAGAAGTCGGAAGAGAGAGGAAGA
T7_10950_G06	GAGAAGGAGAAGAGAGGGTCGGAGAAAGAGAAAGAG
T7_10951_G06	GAAAAGAGGAGAAAGGGGTCAGAGGAGAGGAGAAGA
T7_10952_G06	GAAGAAGAGAGAAGAGGGTCAGGAAGGGAAGAGGAA
T7_10953_G06	AGAAAAAGAGAGGAAGAGTCGAAGAAGAGGGGAGGG
T7_10954_G06	AGGGAGGAGGAGGAGAAGTCAGAAGAGAGAGAAGAA
T7_10955_G06	GAGAGAGAAGAAGAAGAGTCGAGGAGGAGAGAAGAG
T7_10956_G06	GGAAGGGAGAGAGAGAAGTCAGAGAAAGAGAAAGGG
T7_10957_G06	GAGGGAAAGAAGAGGGAGTCAGAGAAGAAGGGAAAG
T7_10958_G06	AGAGGGAGGAAGAGAGAGTCAAGAGAGAGGAGAGAA
T7_10959_G06	AGAGAGGAGGAAGGGGAGTCAGAAAGAGGAGAGAAA
T7_10960_G06	AGAGAAGAGAAAGAAGAGTCGGGAGGGGAGAAGAAG
T7_10961_G06	GGAGGAAGAAGGGAAGAGTCGAGGAGAAGAAAGAAG
T7_10962_G06	AGAGAGAGAAGAGGAGAGTCGAGGAGGAGGAGAAAA
T7_10963_G06	AAAAGAGAGGAGGGAAGGTCGAGAAGAGAGGAAGGA
T7_10964_G06	GAGAAAGGAGAGAAAGAGTCAGGGGAGAGGGAAAGA
T7_10965_G06	GGAGGAAGAAAGAGAGAGTCGAAAAGAGAGAGAGGG
T7_10966_G06	AGAAGAAGGAGAGAGGGGTCAAGAGAAGAGAGAGAG
T7_10967_G06	AAGAGGGAGAAGAGAAGGTCGAGAAGGAAGAGGAGA
T7_10968_G06	AGAGAGAGAGAGAAAGGGTCAGAGGAGAGGAGAAGA
T7_10969_G06	AGGGGAGAAGGAAAGAGGTCGAAAAAGGAAGGAGGA
T7_10970_G06	AGAGAGAGAGAAAGGAGGTCAAGAAGGAGGAGAGAG
T7_10971_G06	GAAAAAGGAGAGAAGAGGTCAGGAGGAGGAAGAGGA
T7_10972_G06	AGGAAGAAGGAGAAGAGGTCGAAAGAGGGAGAAGAG
T7_10973_G06	AAGGAGAGAGGAAGAGAGTCGAGAGAGAAAGGAGAG
T7_10974_G06	AAAGAGAGGAGGAGAGAGTCGAGAGAAGAAAGGAGG
T7_10975_G06	GGGAGAGAGAAAGAGAAGTCGGGAAGGAAAGAAGAG
T7_10976_G06	AAAGAGAGGAGGAGAGAGTCGAAGGGGAGAAAGAAG
T7_10977_G06	AGAGAGAGGGAGGAAGAGTCAGGAGAAGAAAAGAGG
T7_10978_G06	AAGAAGAGAGGAAGGGAGTCGGAGAGAGAGAAGAGA
T7_10979_G06	AAGGAGAAGGAGGAGAGGTCAGAAGAGAGAGAGAGA
T7_10980_G06	GGGAGAGAGGAGAAGAAGTCGAAAAGGAGAAGAGAG
T7_10981_G06	AGAAGAGGGAGAGAGAGGTCGAAGAGAGAAGAGAGA
T7_10982_G06	GAAGGAAGAGAGAGAAGGTCGGAAGAGGGAGAAGAA
T7_10983_G06	GGGAAGAAGAAAAAGAGGTCGGAGGAGAGAAGAGGA
T7_10984_G06	AGGAAGAGAGAGAAGGAGTCGAAGGAAAGAGAGGAG
T7_10985_G06	AGAGAGAGAGAGAGAGAGTCAGAGGAAGGAGAGAAG
T7_10986_G06	GAGAAGAAGAGAGGAGGGTCAGAGGAAAGAGAGAGA
T7_10987_G06	GGAAGGAGAGGAAGAAGGTCAGAGGAGGAAGAAGAA
T7_10988_G06	GAGAAGAGGAAAGAAAGGTCGGAGAGGGAAGAGAAG
T7_10989_G06	AGAGAGAGGAGAGGAGAGTCAAGAGAGAGAGGAAGA
T7_10990_G06	AGGAGAGAGAGAGGAGAGTCAGAAGAGAAGGAGAAG
T7_10991_G06	AAGAGAGAAGGAGAAGAGTCGGGGAGGAAGAAAGAG
T7_10992_G06	GGGAAGAGAAAGAAAAAGTCGAGGAGAGGAGAGAGG
T7_10993_G06	AGAGAGAGAGAGAGAGAGTCAAGGGGAAAGGGGAAA
T7_10994_G06	GGGAAGAGGGAGAAGAGGTCAAAGAAGGAGAGAAGA
T7_10995_G06	GAGAGAGAAGGAGAGAGGTCGAAAGGAGAGAAGAGA
T7_10996_G06	GAAAGAAGAGAGGAGAAGTCGAAGGAGAGAGGGAAG
T7_10997_G06	AGGAAGAGAGAGGAGAAGTCAGAGAGAAGGAAGGAG
T7_10998_G06	GAGAAGAGGAAGGAGAAGTCGAGAGAGAAGGGAGAA
T7_10999_G06	AGGAGAAAGGGAGAAGAGTCGAGGGAGAAGAAGAAG
T7_11000_G06	AGAGAGAGAGGGGAGAAGTCGGAGAAAGAAGAAGAG
T7_11001_G06	AGAAGGAAAGAGAAGGAGTCGAGGAAGAAGAGGGGA
T7_11002_G06	GGAAGAAAAGAGGGAGGGTCAAGAGAGAGAGAAGAG
T7_11003_G06	AGGAGAAGAAGAGAGAGGTCAGAGGAGAGAAGAAGG
T7_11004_G06	AAGGAGAAGAGGGAGGAGTCAAGGGGAAAAAGAGGA
T7_11005_G06	AGGGAAGAAGAAGGAAGGTCAAGGAGGAAAGAGGGA
T7_11006_G06	GAAGAGGAAGAGGAGAGGTCAGAGGAGAGAAAGAGA
T7_11007_G06	GGAGAAGAGGGAAGAAAGTCGGAAAAGAGAGAGAGG
T7_11008_G06	AGAAGAAGAGGAGAGGAGTCGGGGAAGAGAAGAGAA
T7_11009_G06	GAGAGAGGGAGAGGAAGGTCAAGAAGAAGGAAAAGG
T7_11010_G06	GGGAGGAGGGAAAGAAAGTCAAGAGGAAAGGAGAGA
T7_11011_G06	AGGAGAGAGAAGAGAGAGTCGAAGAAGGGGAGAAAG
T7_11012_G06	AAGAGAGGAAGAAGGAGGTCAGGGAGGAAGAAGGAA
T7_11013_G06	GAAGAGAGGAGAGAGGAGTCAAGGAAAAGGGGAGAA
T7_11014_G06	AGAGAGGGGAAGAAAAAGTCGAGAGGAGGAGAGGAA
T7_11015_G06	GAAGAAAGAGAAGAGGAGTCGAAGAGAGGGAAGAGG
T7_11016_G06	AGAAGGAGGGGAGAGGAGTCAGAAAGAAGAAAGGGA
T7_11017_G06	GAAGAAGGGAGGAAGAGGTCGGAGAAAGAAGAAGAG
T7_11018_G06	AGAAGAAAGGGAGGGAGGTCAGAGGAAAAGGGAGAA
T7_11019_G06	GGAAAGAGAAGAGAGAGGTCAGGAGAAGGAGAGAAG
T7_11020_G06	AGAGGAAAGAGGAGGAGGTCAAGAAAGAGAGGAGAG
T7_11021_G06	AGAGAGGAGGAAGAAAGGTCAGAGGAGGAGAGAAGA
T7_11022_G06	AAGAGAGAAAAAGGAAGGTCAGAGGGGAGAGAGGGA
T7_11023_G06	AGAGAGGAGAGAAAAAGGTCAGGAGAGAGAGAGAGG
T7_11024_G06	AAGGGAGGGAGGAGAAAGTCGAGAGAAAGAGAGAGA
T7_11025_G06	GAGAAGGAAGAGAAAGAGTCGAAGAGGAGAGAGAGG
T7_11026_G06	AAAAAGAGGGAGGGAAGGTCAGGAAAGAGGAAGAGG
T7_11027_G06	AGAGAGAGGAGGAGAAAGTCGAAGAGAAAGAGGGAG
T7_11028_G06	GGGAGAGAGAGAGGAGAGTCGAAGAGGAAAAGAAGA
T7_11029_G06	GAAAAGGGAGAGAGAAGGTCAGAAGAAGGAGGAGGA
T7_11030_G06	GGAGAGAGAGAAAGAGGGTCAGAGAAGGAAGAAGAG
T7_11031_G06	GAGAAAGAGAGAGAGAAGTCGGGGAGAGAAGAGAAG
T7_11032_G06	AAGGGAGAGGAGAGAGAGTCAGAGAAGAAGAGAGAG
T7_11033_G06	AGGAAAGAAAAGAGGAAGTCGGAGGAGAGAGGAAGG
T7_11034_G06	GAAGAGGAAGAGAGAAGGTCAGAGGAAGAGAAGGGA
T7_11035_G06	GAGAGAGAGGAGAGAGGGTCGAGAAGAGAGAGAAAA
T7_11036_G06	GGAGAAGAAGGAGAGAGGTCAAGGGGAGAAAAGAGA
T7_11037_G06	GAAGGAAGAAGAAGAGAGTCGAAGGAAGAGAGAGGG
T7_11038_G06	AGGAGAAGGAAGAGAAGGTCAAGGGAAGAAGGAGGA
T7_11039_G06	GAAGAGAAAGGAAGAGAGTCAGGGAGAGGGAAAGGA
T7_11040_G06	GAGAGAGAGAGAAAGAAGTCGGAGAGAAGGAGGAGA
T7_11041_G06	GGAAGGAAAGAGAGAGAGTCAAGGAGAGGAGAGAGA
T7_11042_G06	GGAAGAGAGAAAAAGGGGTCAAGGAAGAAGGAGAGG
T7_11043_G06	AAGAGAAGGAGAAAGGGGTCAGAGAGAGAGAGGAGA
T7_11044_G06	GAGGGAGAAGAGAAGAAGTCGAAGAAAGGGAGGAGA
T7_11045_G06	AGGAGGAGAAAAAAGAAGTCGAGAGAGGAGGAAGGG
T7_11046_G06	GAGGAAGAAAGAGGGAGGTCAGAGGAGAAAAGAGAG
T7_11047_G06	GGGGAGAGAGAGAAGGAGTCGAAGAAAAAGAGGAAG
T7_11048_G06	AAAAGGGAGAGAAGAGAGTCAAGAGGAGAGGAGAGG
T7_11049_G06	GAGGAGAAAGAAGAGGAGTCAGAAGAGAGAGAGGAG
T7_11050_G06	GGAAAAAGAGAGAGGAAGTCGGAGAAAAGGGAGAGG
T7_11051_G06	GAGAGAAGGAAAAAGGAGTCGGAAGAGAGAAGGGAG
T7_11052_G06	AGAGGAGGGAGAGAAGAGTCGGAAGAAGGGAAGAAA
T7_11053_G06	AGAGGAGAGGAGAGAGAGTCGAGAGAGAAGAGAAGA
T7_11054_G06	AAGAAAAGGGGAAAGGAGTCGGGAGAGAGGAAGAAG
T7_11055_G06	GGGAGAGAAAAAGGAGAGTCAGAAGAGAGAGAGAGG
T7_11056_G06	GGAAGAGAGAGAAGAGAGTCAGAGAGAGAAGGAAGG
T7_11057_G06	GGAAAGAGGAGAGGAAAGTCGAGGGAAAGAGAGAAG
T7_11058_G06	GAGAGAGGAGGGAGAGAGTCGGAAAAAGAGAGAGAA
T7_11059_G06	AGGAGGAAGAAGGAGAAGTCAGAGAGGAGAAAGAGG
T7_11060_G06	AGAAGAGAGGAAAAGAGGTCAGAAAGGGGAGGAGAG
T7_11061_G06	AGGAGAAGGAGGGAGAAGTCGGAAGGAAGAAAGAGA
T7_11062_G06	AGGAAAAAAAGAGAAGAGTCAGGAGGAGAGGGGAGG
T7_11063_G06	AAGAAGGAGGAGAAGAGGTCAGAAAGAGAGAGGAGG
T7_11064_G06	GAAAGAAAAGAAGAGGGGTCGAGGAGAAGGAGAGGA
T7_11065_G06	AAGGAAGAGGAGAAAGGGTCAGGAAAGAAGGGAAGG
T7_11066_G06	GAAGAGAGAAGGAAGAGGTCAGAGGAAGAGAGGAAG
T7_11067_G06	GGAGAAGGAGAAGAGAAGTCGAAGAGAGGAAGAGAG
T7_11068_G06	GGAAGGAGAGAGAAGAAGTCGAAGAGAGAGAGAGAG
T7_11069_G06	GGAGAAGAGAAGAGGAGGTCGAGAGGAGGAAAGAAA
T7_11070_G06	AGGAAGAGAAAGAAGAGGTCAGAGGGAAGGGAGAAG
T7_11071_G06	GAGAGAGAGAGGAGAGAGTCGAAGAGAAGAGAGAAG
T7_11072_G06	GAAAGGGAAAAAGGAGGGTCAGGGAAGGGAGAAAAG
T7_11073_G06	GGAGAGAGGGAAAAGAGGTCAAAGGAGAGGAAAGAG
T7_11074_G06	AAGAAGGAGAAGGGAGAGTCGGGGAAAGAAGAGAAG
T7_11075_G06	GAGGGAGAAAGGGAGAGGTCAAGAGAGAGAGAAAAG
T7_11076_G06	AGAGGAGGGAGAGAGAGGTCAAAAGAAAGAGGAGGA
T7_11077_G06	GAAGGGAGAAGAAGAGAGTCAGAAGAGGAGAGAGAG
T7_11078_G06	AGAGGAGAGAGAAGAGAGTCAGGGAAAGAAGGAGAG
T7_11079_G06	AGAGGAGAGAGAGGAAGGTCGAGAAGAAGAGAGAGA
T7_11080_G06	AGAGAGGGAAGAGGAAAGTCGAAGGAAGAGAAGGAG
T7_11081_G06	GAGAAAGAGAAAGAGGAGTCAAGGGAGGAGGAAGAG
T7_11082_G06	AGAAAGAAAAGAGGGGAGTCGGAAGAGGGAGAAGAG
T7_11083_G06	AGAGGAGAGAGAGAAGAGTCGAGAGGAGGAGAAAGA
T7_11084_G06	AGAGAAAGGAGAGGAGGGTCAAGAAGAGGAGAAGAG
T7_11085_G06	AGGGAGAGAAAAGGGAAGTCGAGAGAGAGAGAGAGA
T7_11086_G06	AAGAAGAGGGAGAAGGGGTCAGAGAGAGAGAGAAGA
T7_11087_G06	GAAGAGAGAAGAAGGGAGTCGAGAAGAGGAGAAGGA
T7_11088_G06	AGAAGAGAGAGAGAGAGGTCAGGAAGAGAGAGGAGA
T7_11089_G06	GAGAGAGAAAAGGGGAGGTCAAGGGAGGGAAAAAAG
T7_11090_G06	AAAGAGAGAGAGAGGAGGTCAGAGGAGAGGAGAAGA
T7_11091_G06	AAGGGAAAGAAGGGGAAGTCGAGGGGAAAGGAAGAA
T7_11092_G06	GGAGAGAAGAGAGAGGAGTCAAGAAGGGGAAAGAGA
T7_11093_G06	AGGAGAGAGGAGAGAAGGTCAAGGGAAGAGAAAAGG
T7_11094_G06	AGAGGGAGGAAAGGAGAGTCGAGAGGAAAGAAGGAA
T7_11095_G06	GGGAGAGAAAAGAGAGGGTCAGAAGAGAGAGAAGGA
T7_11096_G06	GAGGAGAGGAAAAGGAGGTCGAAAGAGAGAGGAGAA
T7_11097_G06	AAAGGAGAAGGAAGAGAGTCGGAGAGAAGAGAAGGG
T7_11098_G06	GAGGAGAAAGAGGAAAAGTCAGAGAAGGGAGGGAGA
T7_11099_G06	GAAGGAGGAGAGGGAAGGTCAAGAGAAAGGAGAGAA
T7_11100_G06	GGGAAAGGAGAGAAGGAGTCGGAAGAGAAAAAGAGG
T7_11101_G06	AAAAGAGGAGAGGGAGAGTCGAAGAGAGAAGGAGAG
T7_11102_G06	AGGAAAGAGAGGAGAGAGTCAGGGGAAGAAGGAAGA
T7_11103_G06	GGAAGGAGAGGAAAAAGGTCAAGAGAGAGGGAAGAG
T7_11104_G06	AGAAGAAGGGAAAGAAGGTCAGGGAGGGAGGAAAGA
T7_11105_G06	GAGGAAGAGAAGAGAAAGTCGAGGGAGGAGAGAGAA
T7_11106_G06	GAGAGAGAGAAGAGAGAGTCGAAGAGAGAGAGAGGA
T7_11107_G06	AGAGGAGAGAGAGGAGAGTCGGGAGAAAGGAGAAAA
T7_11108_G06	GAGAAGAGGAGGAGAGGGTCGAGAAAGAAGAAGAGA
T7_11109_G06	AAGAGAAGAAAGGAGAAGTCGGAGGGGAAGGAGAAG
T7_11110_G06	AGGAAAAGAGAGAGAGAGTCAGAGAGAGGAGAGGGA
T7_11111_G06	GAGAAAGGAGAAGAGAGGTCGAGGGAAGAAAGAGAG
T7_11112_G06	GGGAGAGAAGAAGAAAGGTCAGAGAGAGGGAAGAGA
T7_11113_G06	AGAAAAGAAAAGAGAGAGTCGAGGAGAGGGGAGGAG
T7_11114_G06	AGAGGAGAAGAGAGAAGGTCAGAGGAGAAGAGAGGA
T7_11115_G06	GAAGGAAGGAGGAAAGAGTCGGAAGGAAGGAGAGAA
T7_11116_G06	GGAGAGAAGAAGAGAGAGTCGAGAGAGGAAGGAAAG
T7_11117_G06	AAGAGAAGAGAGGAAAGGTCAGAGAGAGGAAGAGGG
T7_11118_G06	AGAGAGAGAAGAGAGAGGTCAGAAGGAAAGAGAGGG
T7_11119_G06	GAGAGAGAGAGAGAGAAGTCGGAAGAGAGAGAGAGA
T7_11120_G06	GAGAGGAAAGGAAGAGAGTCGGAGAGAGAAAGGAAG
T7_11121_G06	AAGAGAAGAGAAGAGGGGTCAGGAGAAGGAGAAGGA
T7_11122_G06	GAGAGAAAGAAGGAGAGGTCAGAGGAGGGAAAGAGA
T7_11123_G06	GAAGAGGAGAGGAAAAGGTCGGGAGAAGGAAGAGAA
T7_11124_G06	GGGAGAGAAGAGAAGAAGTCGAGAAAGGAAGGAGGA
T7_11125_G06	GAAGAGAGAGAGAAGAGGTCGAAAAGGAGGAGAGAG
T7_11126_G06	AGAGAGGAGAGAGAGAAGTCGAAGAGAGAGAGGAGA
T7_11127_G06	AGAGGGAGAGAGAAGGAGTCGAAAGAGAAGAGAGAG
T7_11128_G06	AAGGGAAAGGAAAAGAGGTCGGAAGGAAAGAGGAGG
T7_11129_G06	GGAAGAGAAGAGAAGAGGTCAGAGAGAGAGAAGAGG
T7_11130_G06	GGAGAGAAGGAGGAGAAGTCGGAAGAGAGAGAGAAA
T7_11131_G06	AAAGAGGGGAGAGAAGAGTCGAGGAAGAGGAGAGAA
T7_11132_G06	AGGAAGAAGGGAGAGAGGTCAGGGAAGGAGAAAAGA
T7_11133_G06	AGAGAGAGAGAAGGAAGGTCAAGAGAGGAGAGAGAG
T7_11134_G06	GAGGAGAAGAGGGGAAAGTCGAGGGAAGAAAAGAAG
T7_11135_G06	GAAGAGGGAGAGAGAAAGTCGAGAGAGAGAGGAAAG
T7_11136_G06	AGAGAAGAGAGGGAGAAGTCAGAGGAGAGAAAGGGA
T7_11137_G06	GAGAGAGAAGAGGAGAAGTCGAGAGGAGGAAAGAAG
T7_11138_G06	AGAGGAAGAGAGGAAGAGTCGAGAGAGAAGGAGAGA
T7_11139_G06	GGGAAAGAGAAAAGAAGGTCGGAGAGAGAGAGAGGA
T7_11140_G06	AGGAGAAAGAGAAAAGGGTCGAGAGAGAAGAGAGGG
T7_11141_G06	GAGAAGAAGAGAGGGAGGTCGAGAGAGAAAAAGAGG
T7_11142_G06	AAGAGAGAAGAGAGAGAGTCGAGAAGGAAAGGAGGG
T7_11143_G06	GGGAGAAGAAGGGAAAAGTCGAGGAGAGGAAAGAAG
T7_11144_G06	GAGGAAGGAGAGAGAAGGTCGGAGAGAAAGAGAAAG
T7_11145_G06	GAGGAGGAGGAGGAGAAGTCAAGAAGGAGAAAGGAA
T7_11146_G06	AAGAGAGGAAGAGGAGAGTCAAGGGAAGAAAGAGGG
T7_11147_G06	AGGAGAGGAAAGAGGAGGTCAGAGGGAGAAAGAAGA
T7_11148_G06	GAAGGAGGAAGAGGAGAGTCAGAGAAAAGGGGAGAA
T7_11149_G06	AGAGGGAAGAGGAGAGGGTCAGAAGAGAGAAAGAGA
T7_11150_G06	AGAAAAAGAGGAGGGAAGTCGAGAGAAGAGGAAGGG
T7_11151_G06	AAGAAGAGGAGAGAGAAGTCGAGGAGAAGGAGAGAG
T7_11152_G06	GAGGGAGGAAGAGGAAGGTCAGAGAGAAGAAGAGAA
T7_11153_G06	AAGGGAGAGGAAGAGAAGTCGGAGAGAGGAAGAAAG
T7_11154_G06	AGAAAGGAAGAGGAAGAGTCGAGGAGGAGGAGAGAA
T7_11155_G06	AGGAAGAAGAGAGAGAGGTCGAAAAGAGGGAAGGAG
T7_11156_G06	AGAGAAAGGAGAAGAGAGTCGAGAGAGGAGAGAGAG
T7_11157_G06	GGAGAGGAGAGAAAAGAGTCAGAGGGAGAGGAGAAA
T7_11158_G06	AGAGAGGAGGGAGAAAGGTCAGAGAGAAGGAGAAGA
T7_11159_G06	AAGGAAGAGGAGAGGAAGTCGAGAGGAGAAGAGAGA
T7_11160_G06	GGGAAGGAGAGAGAGAGGTCAGGAAGGGAAAAAAAG
T7_11161_G06	AGAGAGAGGGAAGAGAGGTCAAAGGAAGGAGGAAAG
T7_11162_G06	GGGAGAAGAGAAAGAGAGTCAGAGAGGAGAGGAGAA
T7_11163_G06	AGAAGAGAGGAGGGAAGGTCAGAGAAGGAAGAGAGA
T7_11164_G06	AGAGAAGGGAAGAAGAGGTCAGGGAGAAAGAGAGAG
T7_11165_G06	GGGAAGAGGAGAGAAAGGTCAGAAGAGGGAGAGAAA
T7_11166_G06	AAGAGAAGGAAGAGAGAGTCGAGAGAGGAGAGGAAG
T7_11167_G06	GAGAGGAGAAGAGAGGAGTCAGAAGAAGGAGAGAGA
T7_11168_G06	GGGAGAAGAAGAGAGGAGTCGAAAGGAGAGAGAAAG
T7_11169_G06	AGGAGAGGGAGAGAAGAGTCGAAGAGGAGGAAAGAA
T7_11170_G06	GAGAAAGGAGAGGGAAGGTCGGAAGAAGAGAAGAGA
T7_11171_G06	GAAAGGAAGGGAAGAGGGTCGAGAGAGGAGAAGAAA
T7_11172_G06	AGAGAAGAAAGGAGGGAGTCGAGAGAGAGAGAAGAG
T7_11173_G06	GAGGAAAGAAGAGGAAAGTCGAGAGAGGAGGGAAGA
T7_11174_G06	GAGAGAGGAGAGAAGGAGTCGGAGAGAAGAGAGAAA
T7_11175_G06	AGGAGAAAAAGGGGAGAGTCAGGGAGGGAAGAAAGA
T7_11176_G06	AAGAGGAGAAGAGAGAGGTCGAGGGAGAGAGAAAAG
T7_11177_G06	GAGGAAGGGAGAGAGAAGTCGAAAGAGAGAAGAGAG
T7_11178_G06	AAGGAGAAAGAGGAAGAGTCGAGAGGAGAAGAAGGG
T7_11179_G06	GAAGAGAGAGAGGAGGAGTCAAAGAAAGGAAGGGGA
T7_11180_G06	AGAAAGAAGAGAGAAGGGTCAGAGAGGGAGAGAGGA
T7_11181_G06	AAAGAGGAAGAGGAGAGGTCGGAGAAGGGAAGAGAA
T7_11182_G06	AAAGGAGAAGAAGGGAGGTCGAGAAGAGAGGAAGAG
T7_11183_G06	AAGAGGAAGGGAGAGAGGTCAGAGGAAGGAGAAGAA
T7_11184_G06	AGAGGAAGAGAAGGAGAGTCAGGAGAGAAGAGGAGA
T7_11185_G06	AGAGAGAGAGAGGAGAAGTCAGGGAGGAGAAGAGAA
T7_11186_G06	GGAGAGAGAAAGGAGAAGTCGAGGAAAGAGAGGAGA
T7_11187_G06	GAGGGAGAGAGAGAGAGGTCGAGAAGAAAGAGAAGA
T7_11188_G06	GGAAGGAGAAGAAGAAGGTCAGAGGAAAGGGAGAAG
T7_11189_G06	AAGAGAGAGAGAGAAGAGTCGGGAAAGGAGAGGAGA
T7_11190_G06	GAGAGAAAGAAGAGGAAGTCGAGAAGAGGAAGGGAG
T7_11191_G06	AGGGAGAGAAAGAGAAGGTCAAGGAGGGAGAAGAAG
T7_11192_G06	GAAAGGAGAAGAGAAGGGTCGGAGAAAGAGAGAGGA
T7_11193_G06	GAAAGAGAGAAGAGAGGGTCAGAGAGAGAAGGAGAG
T7_11194_G06	AAAAGAGAAGGAGAGGGGTCAAGGGAAAGAGGAGAG
T7_11195_G06	GAAGAAGAGGAGAGGAGGTCGAGGAAGAAAGAGAGA
T7_11196_G06	GGAGAAGAAGGAGAAAAGTCGAGGAGAGAGGGAGAA
T7_11197_G06	AAAGAGGAGAGAAGGGAGTCGAGGAAGAGAAGAGAG
T7_11198_G06	AAGAGAGAGGGGAAGGAGTCAGAGGAGAAGAGAGAA
T7_11199_G06	AAGAGGGAGAGGAGAAGGTCAGAAAAGAGAAGGAGG
T7_11200_G06	GAGAAGGAAGAGGAGGAGTCGAGGAAAGAGAGAAAG
T7_11201_G06	GAGAAAGAAGGAAGAAGGTCGGAGGGGAAAAGGAGA
T7_11202_G06	GAGAAGGGGAGAAAAGAGTCGAAGAAGAGAGGAGAG
T7_11203_G06	GAGGAGAAGAAGGAGGAGTCAAGAGAGGAGGAGAAA
T7_11204_G06	GAGGGAAAAGAGAGAGAGTCGAGAGAAGAAGAGAGG
T7_11205_G06	GGAAAAGAAGAGGGAAGGTCGGAAGAGAAGGGAAGA
T7_11206_G06	AAGAGAAAGGGAAAGGAGTCGAAGAGAGGAAGAGGG
T7_11207_G06	GAGGAGGAGAAAGAAGAGTCGAAGAAGGAGAGAAGG
T7_11208_G06	GAAGGAAGAAGGGAGAGGTCAGAGAGAGGGAAAAAG
T7_11209_G06	GAGGAGAAGAGAGAAGAGTCGAGGGAGAGAAGAAGA
T7_11210_G06	AGGAGGAGGAGAGAAAGGTCAGGAAAAGAAGGAGAG
T7_11211_G06	GGAAGAGAAGGAAGAGAGTCGAGAGAGAGAGAGGAA
T7_11212_G06	AGGAAGGAAAGAAGAGAGTCGGAAAGGAGAGGAGAG
T7_11213_G06	GAAGAGGAAAGAGAGAAGTCGAGGGAGAGGAAGAGA
T7_11214_G06	AGAAAGGGGAAGGAAAGGTCAGAGGGAAGAAGGAGA
T7_11215_G06	AGAGAGAGAGGAGGAGAGTCAGGAAGAGGAAGAAGA
T7_11216_G06	AAGAGGGGAAAGGGAGAGTCGGAGAAGAAGAGAAGA
T7_11217_G06	AGAGAAGAAAAGAAGGAGTCGGGAAAGGGAGGGGAA
T7_11218_G06	GAGAGAGAAGAAGGGGAGTCGAAAAGGAGAAAGGAG
T7_11219_G06	GGGAGAGAAGGGAAAAAGTCGGAAGAGAAGAGGAAG
T7_11220_G06	AGAGAAGAAAGAGGGAGGTCAGAGAAGAAGGGGAGA
T7_11221_G06	GAAAGAGAGAGAGGAAGGTCAGAAGGAAGAAGGAGG
T7_11222_G06	AGAGAAAGGAGAGGAGGGTCAGAGGAGAAAGAGAGA
T7_11223_G06	AAGAGAGAGGAGAAGGGGTCAAGAAAGAGAGGGAGA
T7_11224_G06	AAGAGGAGAGGAGAAGAGTCAGAGAAAGGAGGAGGA
T7_11225_G06	GAAGGAGGAAAAGAGGAGTCGAAAAGGGGAAGAGGA
T7_11226_G06	AAGAGGAGAAGGGAGAAGTCGGAAGAGAAGAGGGAA
T7_11227_G06	AAGAGAGAAGAAGAGAGGTCGAAGGGAGAGAAGGGA
T7_11228_G06	GAGAGGAGAAGGAGGAGGTCAGAGAGAAAAAGAGAG
T7_11229_G06	AGGAGGAAAGAAAAAGAGTCGGGGAAAGGAGAGGAG
T7_11230_G06	GGAAAGAGAAGAAGAGAGTCGGAGAGGAGAGGAGAA
T7_11231_G06	AGAAGAAGGAGAAGAGGGTCAGGAGAGGAAGAAGAG
T7_11232_G06	GGGGAAGAGGAGGAGAAGTCGGAGAAGAAAAAAGGA
T7_11233_G06	AAGGAAGGAGAAGAGAAGTCGAGGGAGAGAGAGGAA
T7_11234_G06	GGGAAGAGAAAGAAGGGGTCAGGGAGAAAAAGGAGA
T7_11235_G06	AGGAGAGGAGAAAGAGAGTCAGAGAAGAGGAGAGAG
T7_11236_G06	AAAAGAAAGGAAAGAGAGTCGAGGAGGGGAGAGGAG
T7_11237_G06	GAAGGGGAGAAAAGGGAGTCAAAGGGGAAGAAAGGA
T7_11238_G06	GGAGAAGAAGGAGGAGAGTCAAGGAGAAAAGGAGGA
T7_11239_G06	AAAAGGAAAGAAGAGAGGTCAGGAGAGGGAGGAGGA
T7_11240_G06	AGAGAGGAGAAGGGAGAGTCAAGAAGGGAGAGAGAA
T7_11241_G06	GGAAAGAGGGGAGAGGAGTCAGAAAAGAGGGAGAAA
T7_11242_G06	GGGGAGAGAAGAAGAAGGTCAAGGGAGAAAGGAAAG
T7_11243_G06	AGAGAGAGAGGGAGAGAGTCGAGAAGAAGAGAAAGG
T7_11244_G06	GAAAGAGAGAGGGAGAGGTCGGAAAGAGAGAGAGAA
T7_11245_G06	AAGGAAAGAAGGAAGAGGTCGAGGGGAAGAAAGGGA
T7_11246_G06	GAGAGGAAGAGAGAAAGGTCGAAGGGAAGGAAGAAG
T7_11247_G06	GAAAAAGAGAGGGGAGAGTCAGAGAGGAGAAGAGAG
T7_11248_G06	GAAAGAGAGAGAAAAGAGTCGGAGAGGGAGAGAAGG
T7_11249_G06	AGAGAGAGAGAGGGAAAGTCGAGAAGGAGAGAAGGA
T7_11250_G06	GGGAAGAGAGGAAAGAGGTCAGAGAGAGAGGAAGAA
T7_11251_G06	AGGAGAGAAGGAGAAAGGTCAGAGAGAGGAGAGAGA
T7_11252_G06	GAGAGAAGAAAGGAAGAGTCGAAGAAGGGGAGAAGG
T7_11253_G06	GAGAAGGAGAAGAGAAAGTCAGGGGAGAGAGGAAGA
T7_11254_G06	GAGAAGGAGGGGAGAGAGTCAAGAAGAGAGAGAAAG
T7_11255_G06	GGGAAGGAAAGAAAAGAGTCGAGGGAGAGAGAGAGA
T7_11256_G06	GAGAGAGGAGAAAGGAGGTCGAAAGGAAAGAGAGAG
T7_11257_G06	GGGAAGGGAAGAGGGAAGTCGAGAGAGAAAGAAGAA
T7_11258_G06	AGAGAAGAAGGGAGGGAGTCGAGGAAAGAGGGAAAA
T7_11259_G06	GAGGAGAGAAGAGAAGGGTCAGAGGAGGAAAAGAAG
T7_11260_G06	GAAAAGGAGAGGAAAAAGTCGGAGAAGGGGAAAGGG
T7_11261_G06	AGAAAGAGGGAAAGAAGGTCGAGAGGGGAAGAGAAG
T7_11262_G06	AGAGGAAGAAGAAGAGGGTCGAAGAGGAGGAGAGAA
T7_11263_G06	GAAAAAGGGAGAAAGAGGTCAAAGAGGGAGGGAGAG
T7_11264_G06	GGAGAGAGAAGAGAGGAGTCGAAGAGGAAGAGAAAG
T7_11265_G06	GGAAAGGAGAAGAGAAGGTCGAGAAGAGAAGAAGGG
T7_11266_G06	AGAGAAGGAGAGGAGAAGTCGGGAGGAAGGAGAAAA
T7_11267_G06	GAGAGGAGAGAAGAAAAGTCAGGGAAGAAGAGGGAG
T7_11268_G06	AAAAAGAGAAAGAGAGAGTCAGAGGAGGGAGGGAGG
T7_11269_G06	GGGGAGGAAGAAGAGGAGTCGAGAGGAGAAAAAGAA
T7_11270_G06	AGAGGGAGAAGAGGGAGGTCGAGAGAGAAAGAGAAA
T7_11271_G06	AAAGGAGAGGGAGAGAAGTCGGAAGAGGGGAAAAGA
T7_11272_G06	GAGAGGAGAGAAAAGGAGTCGGGGAGAAAGAAAGGA
T7_11273_G06	AGAGAGGGAAAGGAGAGGTCGAAAGGAGAAGAGAGA
T7_11274_G06	GAGAGGGAGAAAGAGAGGTCAAAGAAGGAGAGAGAG
T7_11275_G06	AAGAGGAGGAAAAAGAAGTCGAGGAGAGAGAGGGAG
T7_11276_G06	AAAGAGAGAGAGAAAGGGTCGGAGGGAGAGAGAGAA
T7_11277_G06	GAGGAGAAGAGAGAGGAGTCAGAAAAGAAGGGAGAG
T7_11278_G06	GAAAGGAAAGAGAGGAGGTCAAGAGAGAGAGGAGGA
T7_11279_G06	GAGGAGGGGAAGAGGAGGTCAGAAGAAGAAAGAGAA
T7_11280_G06	GGAGAAGGGAAAGAGGAGTCAAGGAGGAAGAGAGAA
T7_11281_G06	AGAGGAGAGGAGGGAGAGTCGGAAAAGGAAGAGAAA
T7_11282_G06	GAGAAGAGGGGAAGGGAGTCGAAAAAGAAGAGAAGG
T7_11283_G06	GAGAAGAGAAGGAGAGAGTCAGAGGAAAGGAGGAAG
T7_11284_G06	AGAAAGAAGGGAGGAGAGTCGGGAGGAAGAAAGAGA
T7_11285_G06	AGGGAAGAGAGGAGGAGGTCAGAAAAGGGAAGAAGA
T7_11286_G06	GGGAGAAAGAGAGAAGAGTCGAAGGGGAGAAGAAGA
T7_11287_G06	GAAAGAAGGAGAAGAGAGTCGAGAAGGGAAGGAGAG
T7_11288_G06	AAAGAGAAGGGAGGAGAGTCAGGGAGAGAAGGAAGA
T7_11289_G06	GAGAAGAGAAAGGGAGGGTCGAAGAGAAAGAGGAAG
T7_11290_G06	GAAGAGGAGAAAAGAGAGTCGAAGAAGGAGAGGAGG
T7_11291_G06	GAAAAAAAGAGGGAGGGGTCGAAGGAGAGAAGAAGG
T7_11292_G06	AGGGAAAAAGGAGAGGAGTCGAGAGAAGGAAAGAGG
T7_11293_G06	AGAGGAAGAGAGAGGAGGTCAGAAGAGGAAGAGAGA
T7_11294_G06	GGGAAAAAAAGAAGAGGGTCGAAGAGAGAGGAGAGG
T7_11295_G06	GAGAAAGAAAAGAGGAGGTCGGAGAAGAGGAGGAGA
T7_11296_G06	GAGAGAGAGAGGGAGAAGTCGAAGAGAAAGAGGGAA
T7_11297_G06	GAGGGAAAAAAAGAGGGGTCAAGAGAGAAGGGGAGA
T7_11298_G06	GGAAGAGGGGAGAGAGAGTCGAGAGAGAAAGAAGAA
T7_11299_G06	AGAAGGGAAAAGGAAGAGTCGGAGAGAAGGGAAGAG
T7_11300_G06	GAGAAGAGAGAGGGAAAGTCGAGAGAGAAGGGGAAA
T7_11301_G06	GGGGAGGAAAAGAAGGAGTCAGAAGAAGAAGAGGAG
T7_11302_G06	AGAGAAGAGGAAAGAGGGTCGGAGGAAGAGGAAAGA
T7_11303_G06	AGAGAAGAGAAGAGAGAGTCGAGAGAGAGAGGAAGG
T7_11304_G06	AGAGGAGAGAGAAGAGAGTCGGAAGGAGAAGAGGAA
T7_11305_G06	AGAGAGAAAGGAAGAGGGTCGAAGAAGGGAGAGGAA
T7_11306_G06	AGGGAGGAGGAAAGGGAGTCGAAAAAGAGGAAAGGA
T7_11307_G06	GAAGGAAGAAAGAAGGGGTCGAAAGAGGGGAGAAGA
T7_11308_G06	GAAGAGAAGAAGGGAAGGTCAGAGAGAGAGGGAGAA
T7_11309_G06	GAGAGGAAGGAGGAAGGGTCAAGAAGAGGAGAAGAA
T7_11310_G06	GGGAAAAAAAGGAGGGAGTCGGGGAAGAAGGAAGAA
T7_11311_G06	GAGGAAAGAGGAAAGGAGTCAAGGGAGGAGAAGAAG
T7_11312_G06	GAAAGAGGAGAAAGAGAGTCAGAAGAGAGAGGGAGG
T7_11313_G06	GGAAGAGGGGAGAGAGAGTCGAGAGAAGAGAGAAAA
T7_11314_G06	GGAAAAGAGGGAAAAGAGTCGAGAGAAGAGAGGAGG
T7_11315_G06	AGAGGAGAAGAGAAGGAGTCGGAGAAGAGAAGGAAG
T7_11316_G06	GAAGAAGAGAGAGAGGGGTCGAGAGGAAGAGAGAAA
T7_11317_G06	GGAAGGGGAGAGGAAAGGTCGAGGAAAGAAGGAAAA
T7_11318_G06	AGAAGGAGAGGAGAGAGGTCAAAGGAGAGAGAGAAG
T7_11319_G06	GAAAGAGGGAGAAGGAAGTCGAAAGAGGAAGAGGGA
T7_11320_G06	AAAAGGAGGAGAAAAGGGTCGAGAAAGAGGAGAGGG
T7_11321_G06	GGAGAGGAAGGAGAAGAGTCAGAAAAAAGGGAGGAG
T7_11322_G06	GAAGAAAAGGAGGAAGGGTCAGAAAAGGGGAAGAGG
T7_11323_G06	AGGAGAGAAAAAGAGGAGTCGAGGAGGGAGAAGAAG
T7_11324_G06	AGGGAGGGAAAAGAGAAGTCGGAGAAAGGGAGAGAA
T7_11325_G06	GGAAAGAGAGAAGGAGAGTCGAAAAGGAGGAGGAGA
T7_11326_G06	AGAAAGAGAGGAGAAAAGTCAGAGGGGAGAGAGGAG
T7_11327_G06	AAAGAGAGAGAGAGGAGGTCAGGGAAGAAAGGGAGA
T7_11328_G06	GGAAGAGAAGAAGAAGAGTCAGGAAGGAGAGAGGAG
T7_11329_G06	AGAAGAGGGGAGAAGGAGTCAAGAGAGAGAAGAAGG
T7_11330_G06	GAAAGAAGAGAGGGAAAGTCAGGGAGAGAGGAGAGA
T7_11331_G06	AAGGAAAAGAGAGAGAGGTCAGAGGAAGAGGGAGGA
T7_11332_G06	AGGAGAGAGAAAGAGGGGTCAGGAAGAAGAGAGAGA
T7_11333_G06	GAAAGGGAAGGGAAAGAGTCGAGGAGAAGAGAGGAA
T7_11334_G06	AGGGAAGAGAAAGGAAGGTCGAAGGAGAGGAAGGAA
T7_11335_G06	GGAAGAGAGAGGGAAAGGTCGAAAGAGAGGGAAGAA
T7_11336_G06	AGAGGAAGGAGAAGAGGGTCAAAGGAGGGGAAGAAA
T7_11337_G06	GAAGAAAAGAGAGAAGAGTCGAGGAGGGGAAGGAGA
T7_11338_G06	GGAAAGAGGGAAGAGGAGTCAGAGAAAAGAGAGGAG
T7_11339_G06	GGAGAAAGGAGAAGGAAGTCAGGAAGAGGAGAGAGA
T7_11340_G06	GAGAGAAAGAAAGGAGAGTCGGGAAGGAGAGGAAGA
T7_11341_G06	GAAGGGAAAGGGGAAGAGTCGAAAAGGAGAGAAGAG
T7_11342_G06	GAGAAAAGGAAGAGGAAGTCGGAGGGAAGAAGGAGA
T7_11343_G06	GAAGAGGGAAAGAGAGGGTCAGAGAAAGAGGAGGAA
T7_11344_G06	GAAGAGAAAGAGAAGAGGTCAGAGAGAGAGGGAAGG
T7_11345_G06	AAAGGAGGAGAGAGAAGGTCAGGAAAGAAGAGAGGG
T7_11346_G06	GAAGAAAAGGAGGGGAAGTCGGAAGGAAAGAGAGGA
T7_11347_G06	GGAGAAGGAAGAAGGAAGTCAAGAGGAGAAGGAGAG
T7_11348_G06	AGGAAGGGAGAGAGAAAGTCGGGAGAAAGAAGGAGA
T7_11349_G06	AAAGGAAAGAGAAGGAGGTCAGAAGAGAGGGAGGAG
T7_11350_G06	GGAGAAGGAAGAGAAGAGTCAGAGAAGAGGAGAGAG
T7_11351_G06	AAGGGGAGAGGAAGGAGGTCAAAGGAGAGAGAAAGA
T7_11352_G06	GAGAAAGGAGAAGAGAGGTCAGAGGAGAAAGAGGAG
T7_11353_G06	AGAGAGAGGGAAGAGGAGTCAGAAAGAGAAGGGAAG
T7_11354_G06	GGGAAAGAGGAGAGAGGGTCGAGGAAGAGAAAAGAA
T7_11355_G06	GAGGGAAAGAGAGAGAGGTCAAGAAGAGGAGAGAAG
T7_11356_G06	AGAAGGGGAGAGAAAGAGTCGAAGAGGAGGGGAAAA
T7_11357_G06	GAGGGAAGGAGAAGAAGGTCAGAGAGAGAGAAAGGA
T7_11358_G06	AGAAGAAGAGGAGAGAGGTCAGAGGGAGGAAAAGAG
T7_11359_G06	AGAGAGGAAGAGAGGAAGTCGGAGAAAGGAGAAGGA
T7_11360_G06	AGGGGAGGAGAGAGAGAGTCGAAGGGGAAAAAAAAG
T7_11361_G06	GAAAGGAGAAGAGAGAGGTCAGAGAGGAAGAGGAGA
T7_11362_G06	GAAGAAGGAGAAAGAAAGTCAGGGAGGGAAGGAGGA
T7_11363_G06	AGAAGAAGGGAAGGGAAGTCGAGAAAGAAAGGGGAG
T7_11364_G06	GGAGAGAGAAGGAGAGAGTCGAGAAGAGAGAAGAGA
T7_11365_G06	AGAAGAGAGAGGAGGAGGTCAAGGAAGAAAGGAGAG
T7_11366_G06	GGGAGAAGGAAGAAAAAGTCAGGAGGAAAAGGGGAG
T7_11367_G06	GAGAGAAGAGGAGAGAAGTCGAAAGAGGGAGGAGAA
T7_11368_G06	GGGAAGGAAGGAGGAAGGTCAGAAGAAGGAGAGAAA
T7_11369_G06	AGAGAAGAGAGGAGAAGGTCGAGAGAAGAGAGGAAG
T7_11370_G06	GGAAAGGGAAGAGAAGAGTCAAGAGAAGGGAAAGGG
T7_11371_G06	AGGAAGGAGAGAGAAGAGTCGAAAGGAAGGGAAGAG
T7_11372_G06	AAGAAAGAGAGAGAGGAGTCGAGAGAGAAGGGAAGG
T7_11373_G06	GAGAAGAGAAGGAGGAAGTCGAGAGAGAGAGAAGAG
T7_11374_G06	AGAAGAAGGAAGAGGGAGTCGAGAGAAGAGGAGAGA
T7_11375_G06	GAAAAGAAGGAAAGGGAGTCGGGAGGAAGGGAGAAA
T7_11376_G06	AAAGAAGAGGAGGGAAGGTCAGAGAAGAGAGAGGAG
T7_11377_G06	AGGAGGAAGAAGAGAAGGTCAAAGGGGAGGGAAGAA
T7_11378_G06	AGGAAGGGAGAAGAAAAGTCAAGAGAGGGAGGAAGG
T7_11379_G06	AAGAGGAGAAGAAGGGAGTCGAGAGGAAGAGGAAGA
T7_11380_G06	GAGAGAGAGAAAGGAAAGTCGGAGAGAGGAGAAGGA
T7_11381_G06	GGGAAGAGAAGGAAGGAGTCAAAAGGAGAGGAGGAA
T7_11382_G06	GAGGAGAAGAGAGAGAGGTCAGGAGAGAGAAAAAGG
T7_11383_G06	GAAGAGAGAGAAGAGAGGTCGAGGGAGAAGAGGAAA
T7_11384_G06	AAGAGAGAGGAGGAAGGGTCAAGAAGGAGGGAAGAA
T7_11385_G06	AGAGGGAAAGAAGGAAGGTCGGGAGGGAGAAAAGAA
T7_11386_G06	AGGAAGAAGAGAGGAGAGTCAGAGAGAAGAGAGAGG
T7_11387_G06	AGAAGGGAGGAAAGAGGGTCAGAGAAAAGAAGGGAG
T7_11388_G06	AAAGGAGAGAAGGAGGGGTCAAGGAAGAGGAAGAGA
T7_11389_G06	AGAGGGAAGGGGAGAGAGTCGAAGAAAAAGAGGAAG
T7_11390_G06	AGAGGGAGAGAAAGAGGGTCAAAAGAGGAGAAGAGG
T7_11391_G06	AGAGAGAGAGGGAGAGGGTCAGAAAAGGAAGAGAAG
T7_11392_G06	GAGAGGAAGGAAGGAGGGTCAAAGGGAAAGAAGGAA
T7_11393_G06	AAGAGAAGAAGGGAGGAGTCAAGGAGGAAGGAGAGA
T7_11394_G06	AAGAGGAAGAGGAGAAGGTCAAGGGGAAGAGGAGAA
T7_11395_G06	AGAAAGAGAAGAAAGGAGTCGGAAGGAGGAGAAGGG
T7_11396_G06	AGGGGAAAAGAAGAAGAGTCGGAAGGAGAGAAAGGG
T7_11397_G06	AGAGAAGAAAGAGGAAGGTCAGGAGAAGGGAGAGAG
T7_11398_G06	GAGGAGAAAGAGAGGAGGTCGGAGAGGGAGAAAAAA
T7_11399_G06	AGGGAGGGGAGAGAGAAGTCGAGAGAAGAAAGAGAA
T7_11400_G06	AAAGGAGGGAGAAGGGAGTCGAAGGAAAAAGAGGAG
T7_11401_G06	AAGGAGGGGAAGAGAGAGTCAGAAGGAGAGAAGAAG
T7_11402_G06	GGAGAGAGAAGAGGAGAGTCAAGAAGAGGAAGAGAG
T7_11403_G06	GGGAGGAAAGAAAGAGAGTCAAGAAGAGAGGGAGAG
T7_11404_G06	AGAAAGAGGAGGAAGAGGTCAGGAAGAGAGGAGGAA
T7_11405_G06	AGAAGGAGGGAAAGGAGGTCGAAGAAGGAAAGGAGA
T7_11406_G06	GGAGAAGAGAGAAGAAGGTCAGGAGAAGAAGAGGAG
T7_11407_G06	AAAGAGAGGGGAGAAGAGTCGGGAAAAGGGAGAAAG
T7_11408_G06	GAGGGAGGAGAAAGGAGGTCAGAGGAAGAGAAAAAG
T7_11409_G06	AAAGAGAGAGAGAAAGGGTCGAGAAGGGAGAGAGAG
T7_11410_G06	GAAGAGGAGAGAGGGGAGTCAGGAAGAGGAAAGAAA
T7_11411_G06	AGGAAGAAGGAGGAGGAGTCAAGAAAAAGGAGAGGG
T7_11412_G06	AGAAGGAGAGAGGAGAGGTCGGAGAGAGAGAAAAGA
T7_11413_G06	AAGAGAGAGAAGAGAGGGTCAAGAAGGAAGAGGGGA
T7_11414_G06	GGGAGAGGAAAAGAAGGGTCGAGAAGAAGAAGGAGA
T7_11415_G06	AGAGAAAAGGAAGAAGAGTCGGGAGAGGAGGAAGGA
T7_11416_G06	GAGAGGAGGAAAAGAGAGTCGAAGAGAGAGAGGAGA
T7_11417_G06	AGAAGAGGAGAGAAGAGGTCAGAGAGAGAAAGGAGG
T7_11418_G06	AGAGAAGAGAAGGAGGAGTCAAGGAAAGAGAGAGGG
T7_11419_G06	AGAAGAAAAAGGGAGGAGTCGAGAGAGAAGGAGGAG
T7_11420_G06	GAGAGGAGAGAGAGAGAGTCAGAGAGAGGGAAAAGA
T7_11421_G06	AGGAGAGAAGAGGAAGGGTCGGAAAAAGAGAGAAGG
T7_11422_G06	GAAGAGGAGGAAAGAGAGTCGAGAAAGGAGGAAGAG
T7_11423_G06	GAAGAAGAAGGGAGAAGGTCAGAGGAGAGAAGGAGA
T7_11424_G06	AAAAAGGAAGGGGAGAAGTCGGGGAGGAGAGAGAAA
T7_11425_G06	AGAGAGAAAGAAGGGAGGTCGGGAGAAGGAGAAAGA
T7_11426_G06	AAGGAAGAGGAGAGGAAGTCAGGAAGAAGAGGGGAA
T7_11427_G06	GGAGAGAGAGGAAGGAAGTCAGGAAAGAAGAGGAGA
T7_11428_G06	GGAAAAGAGGAAGGGAGGTCAAGAGGAAGAGAGAGA
T7_11429_G06	AGAGAGAAAGAAGAGGGGTCAGAAGAAGGGAGGAAG
T7_11430_G06	AGAGAGGAGAAGGAGAAGTCGGAGAGAGAGGAGAAA
T7_11431_G06	GAGGAGAAAGAGAGGAGGTCAAGAGAAAGGGAAGGA
T7_11432_G06	GAGGGGAAGGAAGAAAAGTCAGGAAGAAAGGAGGAG
T7_11433_G06	AGAAGGAAGGAGAGAAGGTCAGGAGGAAAGGAAGGA
T7_11434_G06	AAGAAAGGAGGAAAGAAGTCAGAAGAGGAGGGAGGG
T7_11435_G06	GAGAGGGAAGAAGAAAAGTCGAGGGAAAGAGAGAGG
T7_11436_G06	AGAAGGAGAAGGGAGGGGTCGAGAGAGAAAGAAGAA
T7_11437_G06	AAAGAGGAGGAAGAGGGGTCAAGAGAGAAGAAGAGG
T7_11438_G06	GGAGAAGGGGAAGGAGGGTCAAGAGGAAAGAAAAAG
T7_11439_G06	AGAAAGAGGGGAGGAAGGTCAGAGGAGAGAAGAGAA
T7_11440_G06	AGGAGAGAGGAGAAGGAGTCGAGAGAAGAGGAAAGA
T7_11441_G06	AAAGGAAAGGAGGGAAAGTCAGAGGAGAGGAGAAGG
T7_11442_G06	AGAGAAGAGGGAAGAAAGTCGAAGAGAGGAGGAGGA
T7_11443_G06	GGGAGAGAGAGAAGGAGGTCAAGAAAAAGGGAGGAA
T7_11444_G06	AGAGGAAGGAAGGAGAAGTCGAAGGAAGAAGGGAGA
T7_11445_G06	AAAAGAGGGAAGAGGAAGTCGGAAGGAAAGGAGAGG
T7_11446_G06	GGAAAGAGGAGAAAGAGGTCAGAGAAAGGGGAGGAA
T7_11447_G06	AAAAGAGAGGAGAAGGGGTCAGAGAGAGAGGGAAGA
T7_11448_G06	GGAAAGGGAAAAGAGAAGTCGAGGAGAGGAGAGAGA
T7_11449_G06	AGAGAAGAGAGGAGAGAGTCGAGGAGAAGAAGGAGA
T7_11450_G06	AGAAAGAGAGAAGGAAAGTCGAGGGAGGAAAGGGAG
T7_11451_G06	GGGAAGAGAGAGAGGAAGTCGAGAGAAGAGGAAAGA
T7_11452_G06	GGGAAGAGAGAGAAAGGGTCAAGAGAGAGGAGAGAA
T7_11453_G06	GAGGAAAAGAAGGAGAGGTCAGAGAAGAGGAGAGGA
T7_11454_G06	AGGAGAAGGAGGAAGAAGTCAGAGGGAGGAAAGAGA
T7_11455_G06	GAAGAGAGAAGGAAGGAGTCGAGGAAAAAGGAAGGG
T7_11456_G06	GGAGAAGAGAGAAGAAGGTCGAAGGAGAAAGAGGAG
T7_11457_G06	AAGAAAGGAAGGGAGGAGTCAAGGAAGAGGAGAGGA
T7_11458_G06	GAGGAAGGAAGGAAGAGGTCGAAGGAAGAAGAGAAG
T7_11459_G06	AGGAGAGAGAAAAGAAGGTCGAGGGGAGAAGGAGAA
T7_11460_G06	GAAGGAGAGAGAGAAGAGTCAAAGAGAGGGGAAAGG
T7_11461_G06	GAGAAAAAGGGGAGGAAGTCGGAAGGAAAAGGAGGA
T7_11462_G06	GAGGGAGAAAGGAGAGGGTCAAAAAAGGAGGAAGGA
T7_11463_G06	GGAAAAAAGAAGAGGAGGTCAGGAGGAAGAGGAGAG
T7_11464_G06	AGGGAAGAGAGAAGAGGGTCGAAGGGAAGAAAGAGA
T7_11465_G06	AGAAAGAGAAGAGAAAGGTCAGAGAGGAGGAGGGAG
T7_11466_G06	GAGAGAGAGAGAGGAAAGTCGAGAGAGAGAAGAGGA
T7_11467_G06	GAAGGAAGAGAGAGAAGGTCGAGAGGAGAAAGAGAG
T7_11468_G06	AAAAGAGGGGAGAGAGAGTCAGAGGAAAGAGGGAAG
T7_11469_G06	AGAGAGAAGAGGGAGAGGTCGGGAGAGAAAAGAGAA
T7_11470_G06	AAAGGGGAGGGAAAAGGGTCAGAAAGAGAGAGAGAG
T7_11471_G06	GGGAAGAAGAAAGAAGAGTCGAGGGAAAGGGGAAGA
T7_11472_G06	AAGGAGAAGGGGAGAGAGTCGAGAAGAAGAGAGGAA
T7_11473_G06	AAGGAGGAAAGGAGGAGGTCAAGGGGAAAAGAGAGA
T7_11474_G06	AGGGAGAAGGGAAGAAGGTCGAGAAGAAAGAGGAAG
T7_11475_G06	AAAGAAGAGAAGGAGGAGTCGAAGAGGGAAGAGGGA
T7_11476_G06	AAGAGAGAGGAAGGGAAGTCGGAGAAGAAGGAGGAA
T7_11477_G06	AAAGGGAGGAAAAGAGGGTCAAGGGAGAGAAGGAAG
T7_11478_G06	GGAGAAGAGAGAGGGAAGTCGAAGAAAGGGAAAGGA
T7_11479_G06	GAGAGGAGGAGGAAGGAGTCAGGAAGAAGAGAGAAA
T7_11480_G06	GAGGAAGAGAAGGAGGAGTCAAGGAAGGAGGAAGAA
T7_11481_G06	AAAGAGGGAGAGAGAAGGTCGGAGAGAGAAGAGGAA
T7_11482_G06	AGAGAGAGAAGAAAGAGGTCAAGGGGAGGAGAGGAA
T7_11483_G06	GGAAGAGGGAGAAGAGAGTCGAAGAGGAAAGAGAGA
T7_11484_G06	AGAAAGAGGAGGGGAGAGTCGAAAAGAGGAAGAAGG
T7_11485_G06	GAGAGAAAAGGGAGAAAGTCAAGAGGAGGAAGGAGG
T7_11486_G06	GAGAAAAAGGGAAGGAAGTCAGGGGAGAAGAGAGGA
T7_11487_G06	GAAGAGAGGAGAGAGAGGTCAGAAGGAGAAAGGGAA
T7_11488_G06	GAGAGAGAGGAGGAGAGGTCAAGAGGAGAAGAAAGA
T7_11489_G06	AGAAGAAGGGAGAAGGAGTCGAGGGAGAAAGAAGAG
T7_11490_G06	AGGAAGAGGAAAGAGAGGTCGAAGGGGAGAGAGAAA
T7_11491_G06	GAAGAGAGAAGAGAAGAGTCGGGAGGAAAGGAGAGA
T7_11492_G06	GAGAGAGGAGGAGAGAGGTCGGAAGAAAAAGAAGAG
T7_11493_G06	GGAAAAAGAAAGAGGAGGTCAGAGGAGAGAAGAGGG
T7_11494_G06	AGGGGAAGAGAAGGAGAGTCAAAGGGAGAGAAGAGA
T7_11495_G06	AGGGAAAGGGAGAAAGAGTCGGGAGAAAAGAGAGGA
T7_11496_G06	AGAGGAGAGAGGAAGAGGTCAGGAAGAGAGGAGAAA
T7_11497_G06	GAGAAGAAGAAAGGGAAGTCGGAAGAGAGAGAGAGG
T7_11498_G06	GAAGGGAGAGAAAAAGGGTCAAGGAAAGAGGAGGAG
T7_11499_G06	AAGAGAAGAGAGGAGAAGTCGGGGAGAGAAGAAAGG
T7_11500_G06	GAGAGAGGAGAAGAAGAGTCAGAGAGAGAGGGAGAA
T7_11501_G06	GGAAGAAGAGGGGAAGGGTCAGGAGAAAAGAGAAAG
T7_11502_G06	GGGAAGAGAGAAAGAGGGTCGAAGAAAGAAGAGGGA
T7_11503_G06	AAAGAGGAGAGAGAGAGGTCAGAGGAAGAGAGAGGA
T7_11504_G06	AGAAAGAGAAGGAAGGAGTCGAGAGAAGGAGGAGAG
T7_11505_G06	AGAGGAGAAGAAGAGGGGTCGAAAGAAAAGGAGAGG
T7_11506_G06	AGAGAGGAAGAGAGGGAGTCAAAGAAGAGAGGAGAG
T7_11507_G06	GGAGAGAGGAGGAGAGGGTCAAGAGAGAAGAAAAGA
T7_11508_G06	GAGAGGGAAGAAGGAGAGTCGAAAGAAGGAAAGAGG
T7_11509_G06	GAGGAGGGGAGAAGAGAGTCGAGAGGAGAAGAAAAA
T7_11510_G06	AAGGAGGGGAGAAGGAAGTCGAAAGAGGAGAGAAAG
T7_11511_G06	AAAGAGGAGAGAGAAGGGTCAGGAGAGAGGGAAGAA
T7_11512_G06	AGAGAGAGGAGAGGAGGGTCGGAAAGAGAAAAAGGA
T7_11513_G06	AGAGAGGGAAAAAGGGAGTCAGGAGGAGAGAAAGAG
T7_11514_G06	GAAGAGAAGAGAAGAGGGTCAGAAGAGAGAAGGAGG
T7_11515_G06	AGAGAGAAGAGGAAGAAGTCAAAGAGAGAGGGAGGG
T7_11516_G06	GAGAGAGGAGGGGAGAAGTCGAGAAAAGAAGGAAGA
T7_11517_G06	GAGAAGAGGAAAGAGGAGTCGGGAAGGAAAGAGAGA
T7_11518_G06	GAAGAGAGAGAAGGGGAGTCAGAGGAGAGAAGGAAA
T7_11519_G06	GAAGAGAGAAAGAGGAAGTCGGAGAAGGAGAAGGAG
T7_11520_G06	GAAGAGAGAAGAGAAGAGTCGGAGAGAAGAGAGGAG
T7_11521_G06	GAGAGGGAGGAGAAGGAGTCGAGAAAGAAAGAAGAG
T7_11522_G06	GAGGAAGGAAGAGGAAAGTCAGAAAGGAGAGAGGGA
T7_11523_G06	GAGAGGGAGAGGAGAGAGTCAAGAAGAGGAGAAAAG
T7_11524_G06	GAGGAGAAAGAGAGAAGGTCAGAGAGGAGAGAAGAG
T7_11525_G06	AAGAGAGAGAAGAGAGAGTCAGGAGGGAGAAGGGAA
T7_11526_G06	AGAGAAGAAGAGAGAGGGTCAAAGAGGAGGAGAGAG
T7_11527_G06	AGAAAGAGAAAGGGGAGGTCGAGAGAAGAAGAGGGA
T7_11528_G06	AGAGAAGAGAGGAGGAAGTCGGAGGAGAGAAGAAGA
T7_11529_G06	GAAAGAGAGAGAGAGGAGTCGGAAGGAAAAGGGAAG
T7_11530_G06	GGAAGGGAGAGGGAGAAGTCAAAGAGAAAGAGGAGA
T7_11531_G06	GGAAGGGAAGAGGAGGAGTCGAAGAGAAAGAGAGAA
T7_11532_G06	GAGAAAAGAGGAAGAGAGTCGGGAAGGAGAGAAGAG
T7_11533_G06	AAGAGAGGGGAGAAGAGGTCAAAGAGAGAAGGGAGA
T7_11534_G06	GAGAGAGGAAAAGAAGGGTCAAGAAGAGAGGAAGGG
T7_11535_G06	GAGAGAAGGAGAAAGAAGTCAGAGAGAGGAGAGAGG
T7_11536_G06	AGAGGAGGAAAGGAAGGGTCAAGAAGAGGAAGGAAG
T7_11537_G06	GGAAAAGAGAGAAGAGAGTCGAGAGAGAGGAAGAGG
T7_11538_G06	AGGGAAGAGGAGAAAAAGTCGAAGGAGAGGAGAGAG
T7_11539_G06	GAGGGAGAGAAGAAGGGGTCAAGAGAAGAGAAGGAA
T7_11540_G06	AGGGAGAGGGGAGGAGAGTCAAAAAGGAAAAGGAGA
T7_11541_G06	AAGAAGGGAAAAGGAGAGTCGAGAGGAAGGAAGAGG
T7_11542_G06	GGAGAGGGAAGAGAGAAGTCAGAAGAAGAGAGGAAG
T7_11543_G06	GAGAGAGAGGAAGGGAGGTCGAGGAAAAGAGAGAAA
T7_11544_G06	GAGGAGAGAAGGAAGGGGTCAAGAGAAGAGAAGAGA
T7_11545_G06	AGAAAGGGAGGAAAAAGGTCAGGAGAGGGGAAGAGA
T7_11546_G06	GGGAGAGGAGAAGAAGGGTCAGAGAAAGAAGAGAGA
T7_11547_G06	AGAGGGAAAGAAAAAGGGTCGAGAGGAAGAGGGAAG
T7_11548_G06	AGGGGAAAGGAAGGAGAGTCAGAAGAGAAGGGAAGA
T7_11549_G06	GGGAGGGAAAGAGAAAGGTCAAAAAGAGGGAGGGAA
T7_11550_G06	GGAGAAAGGAGAGAGAAGTCAAGAGAGGAAAGGGGA
T7_11551_G06	AAGAGAGAGAGAGAAAAGTCAGAGAGAGGGAGGAGG
T7_11552_G06	GAGAAGAGGGGAGAGAGGTCGGAGAAAAGGAGAAAA
T7_11553_G06	GGGAGGAGGAGAAAGAGGTCAAGAGAAGAGAAAGAG
T7_11554_G06	AGAAGGGAGGAGAAAGAGTCAGGAGGAAAGGAAAGG
T7_11555_G06	GAGAGGAGGAGAAGAGGGTCAAGAGAAAGGAGAAGA
T7_11556_G06	AAGAAGGAAGAAGGAGGGTCGAAAGAGAAGGGGAGA
T7_11557_G06	AGGAAAGAAAGAGGAAAGTCGAAGGAGAAGGGAGGG
T7_11558_G06	GGAAAAGAGAAAGGGAAGTCAGAGGAGGAGAGAGGA
T7_11559_G06	GAGAGGAGAGAAAGAGAGTCGAGAAGAAGAGGGAAG
T7_11560_G06	AGAGAGGAGGAAGAAAAGTCAGAAGGAGGAAGAGGG
T7_11561_G06	GGAAAGGGAGAAGGAGAGTCAGAGGAAGGAGAAAGA
T7_11562_G06	AGGAAGAAGGAGAAGGAGTCGGAAGGAAGGAGAGAA
T7_11563_G06	GAAGGAGGGAGAAAGGAGTCAGAAAAGAGAGGGGAA
T7_11564_G06	AGAAGAAGGGAAGGAGAGTCGAGAGGGAAAGAGGAA
T7_11565_G06	AGAGGAAGAGGGAGAGAGTCGAGAAGAGGAAGGAAA
T7_11566_G06	AGAAGAAAGAGAAAAAGGTCGGAGAGGGAGAGGGAG
T7_11567_G06	GAGAGGAGAGAGGAGAAGTCGAGAGAGAGAAGGAAA
T7_11568_G06	GAGAAAGGAGAGAGAAGGTCGAAGAAGGAAGGAGGA
T7_11569_G06	GAGAGAGAAAAGGAGAGGTCGGGAAGGAAGAGAAGA
T7_11570_G06	GGAGGAGAGAAAAAGAGGTCAAGAAAGGAGAGGGGA
T7_11571_G06	AGGGAAGAAGAGAGGGAGTCAAGGAGAGAGAGAGAA
T7_11572_G06	GAAGGAAGAGGAGAGAGGTCGAGAAGAGAAAGGAAG
T7_11573_G06	GAAGAGAGGGAAGGAAAGTCAAGAGAGGAAGGAGAG
T7_11574_G06	AGGGAGAAGGAAGAGGAGTCAAGAGAGAAGAAGGGA
T7_11575_G06	AGAGAGGAGAGGAGAGGGTCAGAAGAAAAGGAGAAG
T7_11576_G06	AAAAGAGAAGGAGGAGAGTCGAGAAGAGGGAGAAGG
T7_11577_G06	GGGAAAGAAAGAGAGGAGTCAGAGAAGAGAGGAGAG
T7_11578_G06	AAGAGAAGGAGAAGGAAGTCGGGAGAGAGAGAGGAA
T7_11579_G06	AGGAAGGGGAGGAGGAGGTCGAAAAGAAGAGAAGAA
T7_11580_G06	GAAGGAAAAGGAGAGGAGTCAGAGAAGGAGAGAGAG
T7_11581_G06	AGAGAAGGGGAAGAGAGGTCAAGAGGAGGAAGAAGA
T7_11582_G06	AGAGGAAAAAGAGGGAGGTCAGAGGAGGAAGAAGAG
T7_11583_G06	GAAGAGGAGAGAGAGGAGTCAGAGAGAGAGAGAAGA
T7_11584_G06	GGGGAGAAGAAAGAAGGGTCAAAGAAGGAGAGAGAG
T7_11585_G06	GAGAAAAGAGAAGGAGAGTCGAGGGAGAGAAGAAGG
T7_11586_G06	AGAAAGAGGGGAGGAGAGTCGGAGAGAAAGAAAGAG
T7_11587_G06	GAGAGGAAGAAAGAGAGGTCAGGGAAAAGAAGAGGG
T7_11588_G06	AGAAGGAGGGGAAAGAGGTCAGGGAAAAGAGAAGAG
T7_11589_G06	GAGAAAGGAAGGGAGAAGTCGGAAAGAGAGGAGAGA
T7_11590_G06	GAGAAGGAGAAGAGAAGGTCAGAGGGAGAAAGAGGA
T7_11591_G06	AGGAGGAAGGGAGAGAGGTCAGAAGAGAAAGAGAAG
T7_11592_G06	AGAGAGGAGAGAAGGAGGTCGAGAAGAGAGAGGAAA
T7_11593_G06	AAGAGAGGGAAGGAGAAGTCAGGAAGAAAGGAGGGA
T7_11594_G06	AGAGAAGAAGAGAAAGGGTCGGAAGAAGGAGAAGGG
T7_11595_G06	AGAGGGAGAAGAAAGAAGTCGAAGGAGGAAGGGAAG
T7_11596_G06	AGGAAGAGGAGAAGGAGGTCAAAGAGAGAGGAGAGA
T7_11597_G06	AGGGGAAAGAGAAGAGAGTCAGAGAGAAGAGGAGAG
T7_11598_G06	AGAGGAAGAGGAGAGAGGTCAGAAAAGAGGAGAGAG
T7_11599_G06	GGAAAGAGAAAAGGAGGGTCGAGAGGGAGAAGAGAA
T7_11600_G06	GAGAGAAAAGAGAAGAGGTCGAGAGAGGGAAGGAAG
T7_11601_G06	AGAAGAGGGAGAGAGAAGTCGGAGGAAGAAGAGAGA
T7_11602_G06	AGAGAGAAGAGAAGAAGGTCAGGGAGGAGGAGAAAG
T7_11603_G06	AGGAGAGGAAGGAGAAGGTCGAAAAGAAGAGAAGGG
T7_11604_G06	AGAGGGAGGAAAGGAAAGTCAAGAGAGAGGGAGGAA
T7_11605_G06	AGAGAGAGAGAAAGGAGGTCAAGGAAGGAAGGGAGA
T7_11606_G06	GAGGGAAGAGAAGGAGAGTCGAGAGAGGGAAAAGAA
T7_11607_G06	AGAGAGAAGAAAGGAGGGTCAAGAGAGAGGAGAGGA
T7_11608_G06	GAAGGGGAGAGAGAGGGGTCGAAGAGAAAAAGAGAA
T7_11609_G06	AGAAAAGAGGGAGGGGAGTCGGAGAAGAGAAGGAAA
T7_11610_G06	AGAGGAGGAAAGGGGAAGTCGGAAAAGAAAGAGAGG
T7_11611_G06	GAAAGAAAGAGGGGAAGGTCGGAAGAAGAGAAAGGG
T7_11612_G06	AGGGAGGAGAAAGGAAAGTCAGAAGGGAAGAGGGAA
T7_11613_G06	GAAAGGAGAAAGGAGAGGTCAGAGGAGGAAGGAAAG
T7_11614_G06	AAGGAAGAGAAGAGGAGGTCAAGGGAGAAGGAAGGA
T7_11615_G06	AGGAAAGAAGGAAGAGGGTCAAGGAGGAGGAAAAGG
T7_11616_G06	AGGAAGAGAAAGAGGGAGTCGAGGGGAAAGGAAGAA
T7_11617_G06	GGAGGAAAAAAAGAAGGGTCGAAGAGGGAGAGAGGA
T7_11618_G06	GAGAGAGGAGGAAAGAGGTCGGAAAAAGAGAGGAAG
T7_11619_G06	AAGAGAGGAAAGGGGAGGTCAGAAAGGAGAGAGAGA
T7_11620_G06	GAGGAGGAGAAGAAAGGGTCAAAAAAGGAGGAGAGG
T7_11621_G06	AAAAAGGAGAGGAGGAGGTCGGAAAGAGGAGAGAGA
T7_11622_G06	AGAGAAGAGGAGAGGGAGTCAGAAGAAGGAGAAGAG
T7_11623_G06	GAGGGAGAGAGAAAGGAGTCAGAAGGGGAGAAAAGA
T7_11624_G06	GAAGGAAAGAAAGGAGAGTCAGAGGAAGAGGGAGAG
T7_11625_G06	AGAGGAGGAGGGAAAGAGTCAGGGAGAAGGAGAAAA
T7_11626_G06	GGGGAGAAGAGAGGAAGGTCAAGGGGAAGAAGAAAA
T7_11627_G06	GGAGAGAAGGGAGAAGGGTCGAGAAGGAAAAAGAGA
T7_11628_G06	GGAGAAAGAGAGAAGAGGTCGAAGGGAGAAGAGAAG
T7_11629_G06	GAAGAAGAAGGGGAAGGGTCGAGAAGAAGAGAAGAG
T7_11630_G06	GGGAGAGAAAGAAAAGGGTCGAAGAAGAAGGAGGAG
T7_11631_G06	GAGAGGGAAGAAGAGAAGTCGGGGAAGGAGAAAAAG
T7_11632_G06	GAAGAAGGGAAGGGAAAGTCGAAAAGGGAGAGAGAG
T7_11633_G06	GAAAAAGAGAGAGGAGGGTCAGAGAGGGAAGAAGGA
T7_11634_G06	GAAGGAGAAAGGAAAGGGTCGAAGGGAAGAGGAAAG
T7_11635_G06	GGAAGAAGAGGAAGAGGGTCGAGAGAGGAAAAGAGA
T7_11636_G06	GGGGAGAAAAGAAAGAAGTCGAGAGAAAGGAGGAGG
T7_11637_G06	AGAAGAGAAGAGAGGGAGTCGGAAGGAGGAAGAGAA
T7_11638_G06	AGAGAGAGGAGGAGAGGGTCAGGGAAGAAAAAGAGA
T7_11639_G06	GGAGAGAGAGAGAAAAGGTCAGAAGGAAGGAAGAGG
T7_11640_G06	GAAGAAAGAAGAGGAAGGTCAGGGGAGGAAGGAAGA
T7_11641_G06	GAAAGAGAGAGGGAGGGGTCAGGAAAAAAAAGGGGA
T7_11642_G06	AGGAGGAAGGGAAGAGAGTCAGAAAAGGAGAGAAGG
T7_11643_G06	GGGAAAGGAGGGGAAGGGTCGGAAAAAAGAGAGAAA
T7_11644_G06	AGGAAGAAGGAAAGGAGGTCAGAAAGAGAGGGGAGA
T7_11645_G06	AAAGGAGGAAAGAGAGAGTCAGGAGGAGAGAGGGAA
T7_11646_G06	AAGGAAAAGGAGAGAGAGTCGAGAGGAAAGAGGGGA
T7_11647_G06	AGAGGGAGAAGGAGAGAGTCGAAAGGGAAAAGAAGG
T7_11648_G06	GAAGGAGAAAAAAGGAAGTCGGAAGAGGGGAGGGAA
T7_11649_G06	GAAGAAGAAGAGGGAGAGTCAAAGAGGAGAGGGGAA
T7_11650_G06	GAAGGAAAGAGAAAGAGGTCGGAAAGGGAGAGAGAG
T7_11651_G06	AGAAAAAGGAGAGAAGAGTCAAGGGGAGGAAGAGGG
T7_11652_G06	GAGAAGAAGAGGGAAAAGTCAGGAGGAGAGGGAAAG
T7_11653_G06	AGGAAAGAAGAGGAGAGGTCGGAGGAAAGGAAGAAG
T7_11654_G06	GGGAAGAGAGGAAAGAGGTCGGGAAAAGAAGAAGAG
T7_11655_G06	AGAAGGAAGGAGAAGGAGTCAAAGAAGAAGGGAGGG
T7_11656_G06	GAGAGAAGAGAAGGAAGGTCAAGAAGAAGGGAGAGG
T7_11657_G06	GGAAGAGAAGGGAGAGGGTCGAGAGAAGAAAGAAAG
T7_11658_G06	GAAGAAGAGAAGAAAGAGTCGAGGGGAAGAGGGAAG
T7_11659_G06	AAGGAGGGAAGGAAAAGGTCAGAAGAGGGAGAAGAG
T7_11660_G06	AAAGGGAGGGGAAGAAAGTCAGAAGGGAAGGGAAGA
T7_11661_G06	AAAGAGGGAGAGAGAGAGTCAAAGGAAAGGGAGGAG
T7_11662_G06	GAAGGGAGGGAAAGAAGGTCGAAAGGAGGAGAAGAA
T7_11663_G06	AAGAAAGGAGAGGGGAAGTCGAGAGAGAGGAAAGGA
T7_11664_G06	GAAGAAGGAGAAGAGAGGTCAGGAGAGGAAGGGAAA
T7_11665_G06	GGAGAGAGAGGAAGAGAGTCGGAGAGAAGAAGAAAG
T7_11666_G06	AGAAGAGAAAAAGGAAGGTCAGAGGAGAGGGAGGGA
T7_11667_G06	GAAGAGAAGAAAGGGGAGTCGAAAAGAGAAGGGGAG
T7_11668_G06	GAAGGGGAAAGGAAAGGGTCAAGGAAAGGAGAGAGA
T7_11669_G06	AGAGAAGAAGAGAAGGAGTCAAGGAAGGGGAGAGAG
T7_11670_G06	GGGAGAGGAAGAAAGGGGTCGAAGGAAAAAAAGGGA
T7_11671_G06	AGGGAGAGGGGAGAAGGGTCAGAAAAGAGAGAGAAA
T7_11672_G06	GAGGAGAGAAAAGGGAGGTCGAAGAGAGGAAGAGAA
T7_11673_G06	AGAAAGGGAGAGAGAGGGTCAAGAAGAAGAGGGGAA
T7_11674_G06	AGAGAGGAGGGGAAAAGGTCAAGAAAGAGGAGGAGA
T7_11675_G06	GAGAAGAGAGGAGGGAAGTCGAGAAAGGAGAAGAAG
T7_11676_G06	GGAAAAGAAAAGGAAGGGTCGAGGGAAAGGGGAAAG
T7_11677_G06	GGGGAAGAGAGGAAAAGGTCAAGAGGAGAGAGGAAA
T7_11678_G06	GGAGAGAGAAGGGAGAAGTCGGAGAGAGAAGGAAAA
T7_11679_G06	AGAAAGAGGAGAGGAGAGTCAGGAGGAAGGGAAAAG
T7_11680_G06	GAGAAGGAGAGAGGAAGGTCGAGAGAAGAAAGAAGG
T7_11681_G06	AAAGGGAAAGAAGGAGAGTCGAGGAGAGAAAGGAGG
T7_11682_G06	AGAAAGAGAAAGGAAGGGTCAGAGGGAGAAGGAAGG
T7_11683_G06	AAAGAGAGGAAGAAAAGGTCGAGGAGGGAGAGAAGG
T7_11684_G06	AAGGAGGAGAAAGAGGGGTCGGAAAAGGGAGAAAGA
T7_11685_G06	AGAAAGGGAGGGGAAGAGTCAGAGGAAAGGAGAGAA
T7_11686_G06	GGAAAGAAGGAAAGGAGGTCGAAAGGGAAAGAGAGG
T7_11687_G06	GGGAGAGGAAGGAGAAAGTCAAGAAGGAGGAAAGGA
T7_11688_G06	AAGGAGGAAGAGGAAAGGTCGGGGAGAAAGAGAGAA
T7_11689_G06	AAGGAGGAAGAGAAAGAGTCGAGAGAGGAGGAGAGA
T7_11690_G06	AAGAGAGGAGAAGGGGAGTCAGAGGAAGAAAAGGGA
T7_11691_G06	GGAAAGAAAGGAGGAGAGTCGGAAAGGAAGGAGGAA
T7_11692_G06	AAAAAGAGGGAGGAGGGGTCAAAAGAGAGAGGAGGA
T7_11693_G06	GAGGAAGGAGGAGAAAGGTCGAAAGAAGAGGAGGAA
T7_11694_G06	GAAAGAAGAGAGAGAAGGTCAGAGGAGAGGGAAGAG
T7_11695_G06	GAGGAGGGGAGAAAAGAGTCAAGAGAGGAGAGAAGA
T7_11696_G06	GGAGGAAGGGAGGGAAAGTCAAGAAAGGGAAAGAAG
T7_11697_G06	GAGGGGAAGAAAGAGGAGTCGAGGAAGAGGAAAAGA
T7_11698_G06	GGAGAAGGAGGAGAGAAGTCAGGGAAAAGAAGGAAG
T7_11699_G06	GAGAGGAAGAAGAAGGGGTCGAGGAGAGAAGAAAAG
T7_11700_G06	GAAAGGAAGAGAAAAAGGTCGGGAGGAGAAAGGGAG
T7_11701_G06	GAGGGAAGGGGAGAAGAGTCGAGAGAAGAAGAAGAA
T7_11702_G06	AGGAAAAAGGGAGAAAAGTCGAGGGGAAAAGGGAGG
T7_11703_G06	AAGAGGAAAAGGGAGAGGTCGGAGAGGAAGGAAAAG
T7_11704_G06	GAAAGGAGGGAGGAGAGGTCAAAAAAGGGGAAGAGA
T7_11705_G06	GAAAGGAAAGAGGGAGAGTCAGGAAGGGAGGAAAGA
T7_11706_G06	AAGGAGGAGAGGAGAGAGTCGAAAAAGAGAGGAAGG
T7_11707_G06	GGAGAAGGAAGAGGAGGGTCAAAAGAAGGAAAGGGA
T7_11708_G06	AAGAGGAGAGAAAGAAAGTCGAAGAGGAGGGGAAGG
T7_11709_G06	GAAGAAAGGAGAAGAGGGTCAGGGAAGGAGGAAGAA
T7_11710_G06	AGGGAGAGAGAGAAGAGGTCAAAGAGGGGAGAAAAG
T7_11711_G06	GAAAGGAGAGGAGAAAAGTCGGGAAGAGGGAAAGGA
T7_11712_G06	GGAGAGGAAAGAAGAGAGTCAGAAGGAGAGGGAAGA
T7_11713_G06	GGAAAAGAGAAGAAGGGGTCGAAGAAGGAGAGAGGA
T7_11714_G06	AAGGAAGGGGAAGAGAGGTCAAGAAAGAGAGAGGAG
T7_11715_G06	GGAGAGGAGAAGGAAGAGTCGAGAAAGGAGAGAGAA
T7_11716_G06	GGAGGAGAAAAGAGAAGGTCGGAAAGAAGAGAAGGG
T7_11717_G06	AAGGAGAGAAGAAGGGAGTCGAGGAGGAAAGAGGAA
T7_11718_G06	GAGGAAAAGAGGGAGGAGTCGAAGAAAGGGAGAAAG
T7_11719_G06	GGGAGGAGAAGGAGGAAGTCAAGAGAGAGGAAGAAA
T7_11720_G06	AGGAGAAAGAAAAGAGGGTCGAAGGGAAGAGGAGAG
T7_11721_G06	AGAAGAAGAGAGGAGGGGTCAAGAAGAAGGAAGGAG
T7_11722_G06	GAGAAAAGAGAGAGAAGGTCGAAGGAGGAAGAAGGG
T7_11723_G06	AAGGGAAGGAAAGGGGAGTCAAGGGAAGAAAGAGGA
T7_11724_G06	AGAGGAAGAGGAGAGAAGTCAGGAGAAGAAGGGGAA
T7_11725_G06	AGAGGAAGAGAGAGGAGGTCGAGAAGAAGAGAGAGA
T7_11726_G06	AAGAGGGAAGAGAAGGAGTCGAAAAGGAAGGAAGGG
T7_11727_G06	GAGGGGAGAAAAGGAGAGTCAGAGGAGGAGAAAAGA
T7_11728_G06	AAGGAGGGAAAAGAGAGGTCGAAAAAGAGGGAGAGG
T7_11729_G06	AGAAAGGAGAGAAAGAGGTCAGGGAGGGGAGGAAAA
T7_11730_G06	AAGAAGGAGAGGAAGGAGTCGAGGAGAGGAAAGAGA
T7_11731_G06	AAAAGAAGGAGAGGAGAGTCGAGGGGAAAGGGAGAA
T7_11732_G06	GAAGGAGGGAAGGAGAAGTCGGGAGGAAGAAAGAAA
T7_11733_G06	GAAAGAAAAGAGGAAGAGTCGAGGAAGGGAAGGAGG
T7_11734_G06	AGAAGAAGAGAGAAAGGGTCGGAAAGGAAGGAAGGG
T7_11735_G06	AGGGAAGGAGGGAAAAAGTCAAAGGGAGGGAAAGAG
T7_11736_G06	AAGAAAGGAAGAGGGAGGTCAGGAGAAGAAGGAGGA
T7_11737_G06	GGAGAGAGGGAAAGGAGGTCGAGAAAAAGAGGGAAA
T7_11738_G06	GGAGGGAAGAAAAAGAGGTCAGGAGAGAGAAAGAGG
T7_11739_G06	AGAGGAGGGAAGAAGAAGTCGGGAAAGAGAGGAAAG
T7_11740_G06	GGAAAGGGGAGAGGAGAGTCAGAAGAGGAAGAAAGA
T7_11741_G06	GGGAAGAGAGAAAAAGGGTCAAAGAGGGAGAGGAGA
T7_11742_G06	AAAGGAAGGAAGGGAGGGTCAAGGGGAAGAAGAGAA
T7_11743_G06	GAGGGAAAGGAAAAAGAGTCAAGGAAGGGAGAGGAG
T7_11744_G06	AAGAAAGAGAGGGAAGGGTCGAAAGAAGGGAGAAGG
T7_11745_G06	AAGGGAAAAGGGAAGAGGTCGAAGAAGGGGAAGAGA
T7_11746_G06	GAGAAAGGAGAGGGAGGGTCAAGAAGAAGAAGGGAA
T7_11747_G06	AGAAGGAGGGGAAAAGGGTCGGAGAAGAAGGAAGAA
T7_11748_G06	AAGAGGAAGGAAGAGAAGTCAAAGAGAGAGGGGAGG
T7_11749_G06	AAGGGAAGAAGAGAAAAGTCGGGGAGAAGGGGAGAA
T7_11750_G06	AGGGAAGGGAAAAGGAGGTCGAAAGAGGGAGAAAAG
T7_11751_G06	AGAAGAGAAAGAAAGGAGTCGGAGAGGAGAGGGAGA
T7_11752_G06	GAGAAGAGGGAAGGAGAGTCGAGAAAGAGAAGAGAG
T7_11753_G06	AGAGAAGGAAGAAGAAGGTCGGGGAAGAGAGAGAAG
T7_11754_G06	AGAAAGGGAGGAAAGAGGTCGGAAAGGAAGAAGAGG
T7_11755_G06	GAGAAAGAAGAGGAAGAGTCAGAGAAGGGAGGGGAA
T7_11756_G06	AGGGAGAGAAAGAAAAAGTCAGAGAAGGAGGGAGGG
T7_11757_G06	AAGGAAAGAGGAAAGGAGTCAGGAGGGAAGAGAAGG
T7_11758_G06	GAGAGGGAAGAGAGGAAGTCGAGAGGAAAGGAAGAA
T7_11759_G06	GAAGGAGAGGAAGAGGAGTCAGAGAAGAGGAAGAGA
T7_11760_G06	GAAAGGAGAGAGGAGGAGTCGAGGAAAGGAGAAAGA
T7_11761_G06	GGGAAAAAAAGGGAGAGGTCAAGGAGGAAGAGGAAG
T7_11762_G06	AAAGAGAGGGAAGGAGAGTCGGAAGAGGGAAGGAAA
T7_11763_G06	GGGGAAAGAAAAAAAGAGTCGGGAGAGAGGAGGAGA
T7_11764_G06	GGAGGAAAAAGAGGAAGGTCAAAGGGAGGAAGGGAA
T7_11765_G06	GAGAAGGGAGGAGAGGAGTCAAAGGAGGAAAAAAGG
T7_11766_G06	AGAGAGAGGGGAGAGAAGTCAGAAGGAGAAGGAGAA
T7_11767_G06	GAGGAGAGGAAAAGGAAGTCGAAGGGAGGAGAAGAA
T7_11768_G06	AGAGAGGGGAAAGGAGAGTCAAGAGAAAGAGAAGGG
T7_11769_G06	AAAAGGAAAGGGAAGGAGTCAGAGAGAAGAGGGAGG
T7_11770_G06	GAGGGGAAGGAAAGAGAGTCAGAGGAAGAAGAAGGA
T7_11771_G06	GAGGAAGGAAGAAGAAAGTCAAGAAAGGGGAGGAGG
T7_11772_G06	GGAGGAGGGAAGAGAAAGTCAGAAGAGAGGAAAGAG
T7_11773_G06	GGAGAGAAAAGAGAAGAGTCGAGAGAGGGAGGAGAA
T7_11774_G06	AAAAGAAAGGGGAGGGAGTCGAAAGGAAGAGGGGAA
T7_11775_G06	GGAAGAAAGGGGAGGGAGTCAGAGAGAAGAAGGAAA
T7_11776_G06	AAAGAGGAAAAGGAGGGGTCAGGAAAAGGGGAAGGA
T7_11777_G06	AGAGAGGAGAGGGAAGAGTCGAAGAGAGAAGAAGAG
T7_11778_G06	AAGGAGAAGGGGAAGGAGTCGAAGAAAGAGAAGGAG
T7_11779_G06	AGAAGGAAGGGAAGGAGGTCAAAGAGAGAGAGGGAA
T7_11780_G06	AGGAAAGGAGAGAAAAAGTCGGAAGAGAGAGGAGGG
T7_11781_G06	AGAAAGAGGAAGGGAGGGTCAAAGAGGGGAAGAAGA
T7_11782_G06	AGAGAGAGAAAGGAGGGGTCAAAAGGGGAAGAGAAG
T7_11783_G06	AAAGGGAGAGGGAAAGGGTCAGAGAGGAGGAAAAAG
T7_11784_G06	GAAGAAGAAGGGGAGAAGTCGGAAGAAGGAAGAGGA
T7_11785_G06	GGAGGAGGGAGAGGGAAGTCAAAAAAGGAAAGAGAG
T7_11786_G06	AGAGAGGGAGAAGGAGGGTCAAAAGAAGGAAGGGAA
T7_11787_G06	AAGAAAGGGAGAGAGAGGTCGAAGGAAGGGAAGGAA
T7_11788_G06	AAGGGGAAAGAGAAGAAGTCAGAGAAGGGAGAAGGG
T7_11789_G06	AGAGAAAGGAAGAGAGGGTCGGAGAAGGGAAGAGAA
T7_11790_G06	GAGAAGAGAGAGGGAAGGTCGGAAAAGGAAGAGAGA
T7_11791_G06	GGGAGGAGGGAAGGAAAGTCGAGAAAAGAAGAAGGA
T7_11792_G06	GAGAGAAGGAGAAGAAGGTCGAAAGAGGAGAAGGGA
T7_11793_G06	AAAGAAGAGGGAGAGAGGTCGGAAGAGGAGAAGGAA
T7_11794_G06	AAAAGGAAGAAGAGGAGGTCAAGGGGAAAGGGAGGA
T7_11795_G06	GAAGAGGAAAAGAAAGAGTCGGAGGGAAGGAGGGAA
T7_11796_G06	GAAAGAGAGGGAGGGAGGTCAAGAAAAAAGGGAGAG
T7_11797_G06	AGAGGAAGGAGAGGAAGGTCGAGGAAAGAGAGAAAG
T7_11798_G06	AGAAGGAAGGAAGAAGGGTCAGAGAGGGGAAGAAAG
T7_11799_G06	AAAGAGGAGGGAGGAAAGTCAAGGGGAGAAGGAAGA
T7_11800_G06	GAAGAAAAGGGGAAGAAGTCGAGAGAAGGGAGAGAG
T7_11801_G06	AGAGAGAAGGGAAAAAGGTCAGGGAGGGAAGAAAGG
T7_11802_G06	GAAGAAAAGGAAAAAGGGTCGAGAGGGAAGGGGAGA
T7_11803_G06	AGGAAGGGAGGGAAAGGGTCGAGGAAAAAGAGAAAG
T7_11804_G06	GAAGGGGAAGAAGAGGAGTCAAGGGAGAAAGAAGAG
T7_11805_G06	AGGAGAGGAAGAGAGAGGTCAGGAAAAGAGAGAAGG
T7_11806_G06	GGGAGGGAAAAAGGAAGGTCAGGAGAAAGAGAGGAA
T7_11807_G06	AGGGGAGAAGAAAGGGAGTCGAGAAGAGGGAAAGAA
T7_11808_G06	AGAGAAAAGAAGGGAGGGTCGGAAAGAGAGGAGAGA
T7_11809_G06	GAGAAAAGGAAAGAGAGGTCGAGGGAGGAGAGAAGA
T7_11810_G06	GAGAGAGAAAGAGAGGAGTCAGGAGGGAGAAAGGAA
T7_11811_G06	AGAGAAGAGGGAGGAAAGTCGAAAAGGAGGAGGAAG
T7_11812_G06	AAGAAGAGGAGGAAGAGGTCGGGAAAGAGGAAAGGA
T7_11813_G06	GGGAGAAGGAAGAAGGGGTCAAGAGAGAAAAGGAAG
T7_11814_G06	GGGAGGGAAAGAAGAAGGTCAAGAGAAGAAGGAGAG
T7_11815_G06	GAGGAAGGGGAAAAGGAGTCGAGAAGAAGAGAGAGA
T7_11816_G06	AGGAAAGGAGAGGAGGAGTCGGAAAGGAGAAGGAAA
T7_11817_G06	AGAGAGAAGAGAAGAAGGTCGAGAGAAAGGGGAGGA
T7_11818_G06	GAGAGAGAAAGAAGGGAGTCAGGAAAAGGAGAGGAG
T7_11819_G06	GAGGAGAAGAAAGAGAGGTCAAAAGAAGGGGAGGAG
T7_11820_G06	AAGAGAGAAAGAGAGGAGTCAAGAGGGAAGGAGGAG
T7_11821_G06	AGAAAGAGAAGGGGAGGGTCGAGAGGGAGAAAAGAA
T7_11822_G06	GAGGAAGAAAGGAGGAGGTCAAGAGAAGGGAAGAGA
T7_11823_G06	AAGAAAGGAGGAGAGGGGTCAAGAAAGAGGAAGGAG
T7_11824_G06	GAGGAAAGAAAGAGGGAGTCAAAGGGAAAGGAGGGA
T7_11825_G06	AAAAAGGAAAGAGGAGGGTCGGGAGAGAGAAGGAGA
T7_11826_G06	AGGGAAGGGAGAGAAGAGTCGGGAAGGAAGAGAAAA
T7_11827_G06	GAGGAAGGGAAAAGGAGGTCAGAAGAGAGAAAGAGG
T7_11828_G06	AAGGAAAAGGGGAGAAAGTCGAAAGGAGAGGAGAGG
T7_11829_G06	AGGGAGGAGAGGAAGAAGTCGAAAAAGAGGAGGAAG
T7_11830_G06	AGGGAGGAAAGAGGGAAGTCGAGAAGAAGAAGGAAG
T7_11831_G06	GGAGGAAAAGAGAAGGAGTCAGAAGGGGAAAGAAGG
T7_11832_G06	GGAGAGGAAAAGAAAGGGTCAGGAGAAGAGAGGAGA
T7_11833_G06	AGGGAAGAAAGAAGAGAGTCAGGAGAGGGAAGAGGA
T7_11834_G06	GAAGGGGAGAAAAGAGAGTCGAGAGGAAAGGGAAGA
T7_11835_G06	AGGAGAGGGGAAAGAGAGTCAAGAGAGGAGAGAGAA
T7_11836_G06	AAAAGGAAAAGAAGGGAGTCGAGGAAGGAGGAAGGG
T7_11837_G06	AGGGAAAGGAGAAAAAGGTCGGGAGGGAGAGAGAAA
T7_11838_G06	GAAAAAGAAGGAGGGGAGTCAGAAGGAGAAGAGGAG
T7_11839_G06	GGGAAAGAGAAAGAAAGGTCGAGGAAGAGAGAGGAG
T7_11840_G06	GAGAGAGAGGAGAGAGGGTCAGAAAAGGGAAAAGAG
T7_11841_G06	GGAGAAGAGGAGGGAAAGTCAGGAAAAAGGGAAAGG
T7_11842_G06	AAGAAGAAGGAGAAGAGGTCAGGGAGGGAGAAGAGA
T7_11843_G06	AAGAGGAAAAAGGGAGAGTCAGGGGAGAAAGAAGGG
T7_11844_G06	AGAGGAAAGAGAGAAAAGTCGAGGGAAGAGAGGGGA
T7_11845_G06	AGGGAAAGAAGGGAAGAGTCGGGAAGAAGAAAGGAG
T7_11846_G06	GAGAGGAAGGAAAAAGGGTCAGAAGGAGGAAGAGGA
T7_11847_G06	AAGGGAGGAAGGGAGGAGTCGAAGAGGAGGAAAAAA
T7_11848_G06	AGAGAGAAAAGAGGGAGGTCGAAGAAGAGGAGAGAG
T7_11849_G06	AGAAGAGAGGAGAGAAAGTCGAGGGAGGAAGAGAGA
T7_11850_G06	GGAGGAGAAAGGAAAGGGTCGGAAGAAGAAAAGAGG
T7_11851_G06	AGGAGAGAGAAAAGAAGGTCGGAAAGGAGAGAGAGG
T7_11852_G06	GAAGAGGAAGAGAGAAAGTCAGAGGGAAGGGAGAGA
T7_11853_G06	GGAAAAGAAGGGAGGAAGTCGGAGAGGAAGGAAAGA
T7_11854_G06	GGAGGGAAAAAAAAGAGGTCGGGAGAGAGAAGAGAG
T7_11855_G06	AGAAAAGGGAGAAAGGAGTCGAAGGGGAAGGGAGAA
T7_11856_G06	GAAGAAGGGAAGAAGAGGTCGAAGAAAGAAGGGAGG
T7_11857_G06	AGAGAAGAGGGAGAGGAGTCAGGAGAAAAGGGAGAA
T7_11858_G06	AGAGAGAGGGAAAAAGAGTCAGGAGAGGGAAGAGAG
T7_11859_G06	GAGAAGAAGGGGAGAAGGTCAGAAGGAGAGAAGAAG
T7_11860_G06	GGGGAAGAGGAGAAAAGGTCGAAAGGAAAAGAGGAG
T7_11861_G06	GGAAGAGGAGGAAGGAGGTCGAAAAGGGAAAGAAGA
T7_11862_G06	GGAAAAGGAGAGGGAGAGTCGGAGGAAAAAGGAGAA
T7_11863_G06	AAAGAAAAGGAAGGGGAGTCGAGGGAAAGAGGGAGA
T7_11864_G06	AGGGGAGAGAGGAAAAAGTCAGGAAGAAGGAAGAGG
T7_11865_G06	GAAGAGAAAGAGAAGGGGTCAGAGAGAGAGAGAGAG
T7_11866_G06	AAAGAGAGGAGAGAGAGGTCAAGGAAGGGAAGAGGA
T7_11867_G06	GAAGGAAGGAAAGAAGAGTCAAGGGAGGGAGAGGAA
T7_11868_G06	GAAGAGGAGGAGAAAAAGTCGAAAGAGGGAAGGGAG
T7_11869_G06	AGGGGAGGAAGGAAAGAGTCAGGGAAAAGGGAAAGA
T7_11870_G06	GGGGAAGAAGGAAGGAGGTCGAGAAGAAGAAAGGAA
T7_11871_G06	AGAGAGAGAGGAAGGAGGTCGAGAAGAGAGGAAAAG
T7_11872_G06	GAAGAAAGAGGAGAAGGGTCAGGAGGGAAAAAGGAG
T7_11873_G06	GGGAGAGAGGGAAGAGAGTCGGGAGAAAAAAGAAAG
T7_11874_G06	AGGAGGGGAGAAGGGAAGTCGAAAAAGGAAGAAGGA
T7_11875_G06	AAAGGAGGAGAGAGAAAGTCAGGAGGAGGAAAAGGG
T7_11876_G06	GAAGGGAAAGGGAAAGGGTCAGGAAAAGGAAGGGAA
T7_11877_G06	GGGAAGAAGAAGGAGAGGTCAAAAGGGAGAAGGAGA
T7_11878_G06	AAGGGAGAAAAAGGAAGGTCAAAAGAGGGAGGGGAG
T7_11879_G06	AGAGGGAGGAAAGGGGAGTCGAAAAAAAGGAGGGAA
T7_11880_G06	AGAAGAAAAAAAGGGAGGTCGAGGAAGGAGAGAGGG
T7_11881_G06	GAAGAGAGAAGGGGAGAGTCGGAAGGAAGAAAGAAG
T7_11882_G06	GGAGAGGAAGAAGAGAGGTCAGAAAGGAAGGGAGAA
T7_11883_G06	GGAAGAAGAAGGAGGAGGTCAGAGGAGGGAAAAAAG
T7_11884_G06	GGGAGGAAGAGAGAAGAGTCAAAGGAGAAAAGAGGG
T7_11885_G06	AAAGAGGAGGGGAGAAGGTCAAAGAAAGAGGGGAAG
T7_11886_G06	AAAGAGGGGAGAAAGGAGTCAGGAGAGGAGGAGAAA
T7_11887_G06	GAAGAAGGGGAGAGGAAGTCGAGGAGGAAAAAAGGA
T7_11888_G06	AAAGAAAGAGAGAGGGAGTCAAGGAAGAGGAGGGAG
T7_11889_G06	AAAGGGAGAGAGAAGAAGTCAGAGAGGAAGGAGGGA
T7_11890_G06	GGAGAGAGGAGGGAGAAGTCGAGGAAAGGGAAAAAA
T7_11891_G06	AGGAAAAGGGAGAAAGAGTCGAGAGGAAAGAGGAGG
T7_11892_G06	AGAAGGAGAGAAGAGGGGTCAGGAGGAAGAAGAAAG
T7_11893_G06	AAGAGAAAAGGGGAGAAGTCGAAAAGAGGGAGGGAG
T7_11894_G06	GGAGGGAGGAGAAGAAGGTCAAGAAGAAGAGGAGAA
T7_11895_G06	GAAGAGAGGGGAGAAGAGTCAGAGAAGAAAGGGAAG
T7_11896_G06	AGAGGGAGAAGGAGGAAGTCGGAAGGAAAAGGAGAA
T7_11897_G06	GGAGGAGAGGAAGAAAGGTCAAGGAGGGAAAGGAAA
T7_11898_G06	GGAGAGAAAGGAGGGGAGTCAAAAGGAAGGAGGAAA
T7_11899_G06	GAGAGGAAAAAGAGAGGGTCGGAGAAGAGAGGGAAA
T7_11900_G06	AGAAAAGAGGGGAGAAAGTCGGAGAGGAAAGAGGAG
T7_11901_G06	AAAAGGGGAAAGGGAGGGTCAGAAAGGAGAAAGAGG
T7_11902_G06	GAAGGGAGGAGAGGAAGGTCGAGAGAAAGAAAAGGA
T7_11903_G06	AGAAGAAGGGGAGAGAGGTCAGAAAGGAGGAAGGAA
T7_11904_G06	GGAAAAGGAGAGAGAAAGTCAGGGAGAGAGGAAGGA
T7_11905_G06	GGGGAGGAAGGGAGAAGGTCAGAAGAAGAAGAAAAG
T7_11906_G06	AAGAGGAAGGAGAGAGAGTCGGGGAGGAAAAAGAGA
T7_11907_G06	GAGGAGGAAGGAGAGAAGTCGAAGGAGAAGAAAGAG
T7_11908_G06	AGAAGAAGAGGGAAGGAGTCGGGAGGAAAAGGAGAA
T7_11909_G06	GAAAGGGAGAGGAAGAGGTCAGGAAAGGAGGAAAGA
T7_11910_G06	AAAGGGAGAGAGGAAGGGTCGAGAGAAGAAGGAGAA
T7_11911_G06	GAGAAGAAGGGGAGAGGGTCAAAGAGGGAAAAGAAG
T7_11912_G06	AAGAGAAGAAGAAAGGGGTCGAGAAAGGGGAGAGAG
T7_11913_G06	GAGGGAGGAAGAGAAGGGTCGGAAAAAAAAGGAGGA
T7_11914_G06	GAAGGGAAAGAAGAGAAGTCAAGGGAAGAGGAGGGA
T7_11915_G06	GGAAAAAGGGAGAGAAGGTCAGAAGGGAGAAGAAGG
T7_11916_G06	GGAAAGAGGGGAGGAGGGTCAAAGAAGAAGGAGAAA
T7_11917_G06	GAGAAAGAGAGAGGAGGGTCGGAAGAGAGAGAGAAA
T7_11918_G06	AAGAAAGAGGAAAGAGAGTCGAGGAGGAAGAGGGAG
T7_11919_G06	GGAGGGAGAGAAAGAAAGTCGGAAAGAGGAAGAGGA
T7_11920_G06	GGAAAGGAAGAGAAGGGGTCGGGAAGAAAGGAAAAG
T7_11921_G06	AGGAGGGAAGAGAGAGAGTCAGAAGAAGGGAAAGGA
T7_11922_G06	GAGGGAGGAGAAAAAAGGTCAGAGGGAAGGGAAAAG
T7_11923_G06	AGGAAAGAAGAAGGGAGGTCGAGGAGAGAGAAAGAG
T7_11924_G06	AGGGAGAGGAAGAGGAAGTCGGAGGGGAAAAAAAAG
T7_11925_G06	GAGAGGGGAAAGAGAAAGTCAAGGGAAAGAGGGAAG
T7_11926_G06	GGAAGGAAGAGAGAGAAGTCGGGAGAAAGGAGAGAA
T7_11927_G06	AGAAGGAGGGGAAAAGGGTCGAGAGAAGGAAGAGAA
T7_11928_G06	GAAAGAGGAGAGAGGAGGTCAAGAAGAGGAGGGAAA
T7_11929_G06	GAAGGAAAAGGAGGAGAGTCAAGAGAGAGGAGGAGA
T7_11930_G06	GAGAGAAGAAAAGAGAAGTCGAAAGGGGAGGAGGGA
T7_11931_G06	AGGAAGAAAAGAAAGAGGTCAAGGGAGGAGGGAAGG
T7_11932_G06	AGAGAAAAAAGGAAGAGGTCGGAAGAGAAGGGGAGG
T7_11933_G06	GGAAAGGGAAAAGAAAAGTCGGGGAAGAGGAAGGAG
T7_11934_G06	AAGGGAAGGGGAAAGGGGTCGAGAGAAAAGGAGAAA
T7_11935_G06	GAGAAGGAAGAAGGAAGGTCGAGAGAGAAAGGGAAG
T7_11936_G06	AGAAAAAGAGAGGGAAGGTCGGGAAAAGAGGAGGGA
T7_11937_G06	GAAGAGAGGGAAGAAAAGTCGGAAAAGGAAGGAGGG
T7_11938_G06	GAGGGAAGGGGAAGAAGGTCAGAAAGAAGAAAGGAG
T7_11939_G06	GAGGGAAAGGAAGGAAGGTCAAAGGGAAAGGGAAGA
T7_11940_G06	AAAGAGGGAAGAAAGGAGTCAGGGAAAGGGGAGGAA
T7_11941_G06	GAAGGAAAAGAAAGGGAGTCGAAGGGAGGAAAGGGA
T7_11942_G06	GAAAGAGGAGAGAGGAGGTCGAGAGAAGAAGAAAGG
T7_11943_G06	GGGGAAAGAGGGGAAAAGTCAGAGAAGAGGAAGGAA
T7_11944_G06	AGAAAAAGGAGAGAGAAGTCGAGAGGAGGAGAGGAG
T7_11945_G06	GAAGAAGAGGGAGAGAAGTCGGAGGAAGAAGGAGAA
T7_11946_G06	AAGGGAGAAGGAAAGAAGTCGAGAAGAAGGAGGAGG
T7_11947_G06	GAAGGGGAAGGGAAGAAGTCGAAAGAAAGGAGAAGG
T7_11948_G06	GAAAGAGAGAAAGGAGGGTCGGAAGGGAAAAGGAAG
T7_11949_G06	AGGAAGGAGAGAAAAGGGTCGGAGAAGAGGGAGAAA
T7_11950_G06	GGGAAGAGGGAGAGAAAGTCGAGGAGAAAGGAAGAA
T7_11951_G06	AGGAGGAGAGGGAAGGAGTCGAGAGAAGGAAAAGAA
T7_11952_G06	GAAGAGAGAGGAGAGGAGTCAAAAGAAGAGGGGAGA
T7_11953_G06	GAAAGAGGAGGGAGAGAGTCGGGAAAGAGAAAAGGA
T7_11954_G06	AAGAGAAAGAAAGAAGGGTCGAGGGAGGAAAGGGGA
T7_11955_G06	GAGGAGGGAGGAAGAAGGTCAGAAGAAAGAAGAGAG
T7_11956_G06	AAAGGAAGGAGGAAAGGGTCAAGAGGGAAAGAAGGG
T7_11957_G06	AAAAGGGGAGGAAGGAAGTCGGAGAGAAGAGAGAAG
T7_11958_G06	AGGAAAGAAAGGGAAAGGTCGAGGAGGGAGGAAAGA
T7_11959_G06	GGAAGAGAGAAAAGAAGGTCGAGGGGAGAGAAAAGG
T7_11960_G06	GAGAGAGAAGGAAAGAGGTCAAGAGAGAGGAGGGAA
T7_11961_G06	AAAAAGGGAGGGAGAGAGTCGGAGAAGAGAGAGGAA
T7_11962_G06	AAGGAGAGGGAGAAGGAGTCGAGAGAAAGAAGGAGA
T7_11963_G06	GAGGAAAAAAGGAAAGAGTCGAAGGGGAGGGGAGAA
T7_11964_G06	GGGAGGAGAAAGAAGGAGTCGAAAAGAGAGGGGAAA
T7_11965_G06	GAAAGGGGAGGGAGGGAGTCAAGAAAAGAGAGAGAA
T7_11966_G06	GAAGAGAGGAGGAGAAAGTCAGGAAAAGGAGGGAGA
T7_11967_G06	GAGAGAGGGAGGGAAAAGTCAGAGGAAGGGAAAAAG
T7_11968_G06	GGAGAGAGAAAAGAGAAGTCGGGAAAGAAGGAGGGA
T7_11969_G06	GGGGAGGAGAGAGAGAAGTCAGAAAAGGGAAGAGAA
T7_11970_G06	AGAGAGGGAGGGAAAAGGTCAGGAAAAAGAGGGAGA
T7_11971_G06	AAGAAGAGAGGAAAGAGGTCAGGAGAGGAAGGGAAG
T7_11972_G06	AGGAAAGGGAGGAGGAGGTCAGGAGAGAAAGAAAAG
T7_11973_G06	GGAGAAGGGGAAAAAAGGTCAAGGAGGAAGAGAAGG
T7_11974_G06	GAGGGAAGAGAAGGAGAGTCGAAAAGGAGGGAAAGA
T7_11975_G06	AAGGGGAGAGAAAAGAAGTCGGAGGGAGAAGAGAAG
T7_11976_G06	GAAGAAGGGAAGAAGAGGTCAGAAGAAAGGGAGGGA
T7_11977_G06	GAAGAAGAAGGAAAGAAGTCGAGAGAGGGAGAGGGA
T7_11978_G06	GAGGAAGGGAGAGGAAAGTCAAGAAGAGAGAGAAGG
T7_11979_G06	GAAAAGGGAAGAGAGGGGTCAAAGGGGAAAAGAGGA
T7_11980_G06	AGGGAGGAGAGAAAAGAGTCGGAAAAGGAGGAAGGA
T7_11981_G06	AGAGAAAGAGGGAGAGGGTCAGAAGAGAGGGAAAGA
T7_11982_G06	AAAAGAGAAGAGGAAGAGTCGGGGAGGAGGGAAGAA
T7_11983_G06	GAAGGGAAAGAGAAGGGGTCAGAGAAAGAAGAGGAG
T7_11984_G06	AAGGAGAGAGGGAAAGGGTCAGAGGAAAAGAGGAGA
T7_11985_G06	AGAGAGGGAGGAAAAGGGTCAAGGAAGGAAGAGAGA
T7_11986_G06	AAAAGAGAGGGAGAGAGGTCAGAAGGGAAAAGGGGA
T7_11987_G06	AAGGGAAAGGGAGGGAGGTCGGGAGAAAGGAAAAAA
T7_11988_G06	AAAGGAGGAAGGAAGGAGTCGGAAAGAAGAGAGGGA
T7_11989_G06	GAGAGGAAAAGAGGGAGGTCAAGGAAAAGGAAGGAG
T7_11990_G06	AAGGGAGGGAAAGAGAGGTCGAGGAGGAAGGAAAAA
T7_11991_G06	AAGGGGAGAGAGAAGGAGTCAAGAGAAAGGGAAAGG
T7_11992_G06	GAAAAAAGAGAGAAGGAGTCAGGAGGGGAAGAAGGG
T7_11993_G06	GAGAGAAAGAGGAGGAGGTCGGAAAAAGAAGGAAGG
T7_11994_G06	GAAAAGGGAGAAGGGAGGTCAGAGAAGAGAGAAAGG
T7_11995_G06	GGGGAGGAAAGGAAGAGGTCGAGGAAAAAAAGGAAG
T7_11996_G06	AGGAGAGGGAGAAAGAGGTCAAGGGAAAGAAAGGGA
T7_11997_G06	GAAGGGAAAGAGGGGAAGTCAGAAGAAGAGAGAGAG
T7_11998_G06	GGAGAGGAAGGAGAAAAGTCGAAAGGGGAGAAGAAG
T7_11999_G06	GGGAAGAGAAGGGAGAGGTCAGAGAAGGAGGAAAAA
T7_12000_G06	AAGGGAGAAGAGGAGAAGTCAGAGAAAGGAAGGGGA
T7_12001_G07	CTCTCTCTCTCTCTTCTGTCTCTCTCTCTCTCCTCT
T7_12002_G07	TCTCTCTCTCTTCTCTCGTCTCTCTTTCCCTCTCTC
T7_12003_G07	TTCTCTCTTCTCTCTTCGTCCCCTCTCTCTCTCTCT
T7_12004_G07	TCTCTCTCTCTCTCTTCGTCTCTTCTCTCTCTCTCC
T7_12005_G07	TTCTCTTCTCCTCTTCTGTCCTCTCTCTCCTCTCTC
T7_12006_G07	TTTCTCTCTCTCTCCTCGTCTCTCTCTCTCCTCTCT
T7_12007_G07	TCTCTCTCTCTCTCTCTGTCCCCTTCTCTCTCTTCT
T7_12008_G07	CCTCTCTCCTCTTCTCTGTCCTCCTCTTTCTCTCTT
T7_12009_G07	CTCTCTCTCTCTCTTTCGTCTCTTCTCTCTCTCTCC
T7_12010_G07	TCTCTCTCTTTCTCTCTGTCCTCTCTCTCTCTCTCC
T7_12011_G07	TCTCTCTCCTCTCTTCCGTCTCTCTCTCTCTCTTCT
T7_12012_G07	CTCTCTCTCTTCTCCTCGTCTCTCTCTCTCTCTCTT
T7_12013_G07	CTCTCTCTCTCTTCTCTGTCTCTCTCCCTTCTCTCT
T7_12014_G07	CTCTCTCTCTCTCTCTCGTCTTCTCCTCTCTCTTCT
T7_12015_G07	TCTTCTCTTCTCTCTCTGTCCCTCCTCTCTCTTCTC
T7_12016_G07	TCTCTCTTCTCTCTCTCGTCTCTTCTCTCTCCCTCT
T7_12017_G07	CTCTCTCCCTCTTCTCTGTCTTCTCTCTCTTCTCTC
T7_12018_G07	TCTCTTCTCTCCTCTCTGTCCTCTCTCTCTCCTCTT
T7_12019_G07	CTCTCTCTCCTCTTCTCGTCTCTCTCTCTTCTCTCT
T7_12020_G07	TTTCTCTCTCTCCTCTCGTCTCTCTCTTCCTCTCTC
T7_12021_G07	CTCTCTTCTCCTTCCTCGTCTCTTCTCTCTCTCTCT
T7_12022_G07	TCTCTCTCTCTCTTCTTGTCCCTCTCTCTTCTCTCC
T7_12023_G07	CTCTCTTCTCCTCTCTCGTCTCCTTTCTCTCTTCTC
T7_12024_G07	TTCTTCTCCTTTCCTCTGTCCTCTCTCTCCTCTCTC
T7_12025_G07	CCTCTCTCTTTCTCTTTGTCCTCTCTCTTCCTTCCC
T7_12026_G07	TCTCTCTCTTCCTCTCTGTCCTCTCTCTTCTCTCTC
T7_12027_G07	TCTCTCTCTCTTCTCTCGTCTTCTCTCTCTCTCTCC
T7_12028_G07	TCCTCTTCTCTTCCTTCGTCTCTCTCTCTCTCTCTC
T7_12029_G07	TCTCTCTCCTTCTCTCTGTCCTCTCTCTCTCTCTTC
T7_12030_G07	TCTCTCTCTTCTCCTTCGTCTCTCTCTCTCTCTCCT
T7_12031_G07	CTCTCTTCTCTCTTCCTGTCTTCTCTCTCTCCTTCC
T7_12032_G07	CTTCCTCTCTCTCTCTCGTCCTTCTCTCTTCTCTCT
T7_12033_G07	CCTTCTCCTTTCTCTCCGTCTCTCTCTCTCTCTTCT
T7_12034_G07	CTCTCTCTCTCTCCTTCGTCTCTCTCTCTCTCTTTC
T7_12035_G07	CTCCTCTCTCTCTCTCTGTCCTCTCTCTTCTTCTCT
T7_12036_G07	TCTCTCTTCTCTCTCCTGTCTCTCTCTCTCTCCTCT
T7_12037_G07	TCTCCTCTCTCTCTCTCGTCTCTCTCTCTCTCTTCT
T7_12038_G07	CTCTCTCTCTCCTCTCTGTCCTCTCTTCTCTCTTCT
T7_12039_G07	CTCTTCTCTCTTCTCTTGTCCTCCTCTCTCTCTCCT
T7_12040_G07	CTCCTCTCTTCTCTCTCGTCTCTCTTCTTCCTCTCT
T7_12041_G07	TCTCTCTTCTCCTCTCTGTCCTCTCTCTCCTTCTCT
T7_12042_G07	TCTTCTCTCTCTCTCCTGTCCTTCTCTCTCTCTCTC
T7_12043_G07	CTCTCTTCTCTCTCTCTGTCCTCTCTCTCTCCTCTT
T7_12044_G07	TCTCTCTCTCTCTCTCTGTCCTCTCTCTTCTCTTCC
T7_12045_G07	TCTCTCTTCCTCTCTCTGTCCTCTCCTCTTCTCTCT
T7_12046_G07	CTCTTCTCTCCTCTCTCGTCTCTCTCTCTTCTTCTC
T7_12047_G07	TCTCCTCTCTTTCTCTCGTCTCTCTCTTCTCTCCTC
T7_12048_G07	TCTCTCTCCTCTTCTCTGTCTTTCCTCCTCTCTCCT
T7_12049_G07	TTCCTCTCTCTTCTTCTGTCCTCCTCTCTCTCTCCT
T7_12050_G07	CTTCTCTCTCTCTCTTCGTCTCTCTCTCCTCTCTCT
T7_12051_G07	CTTCTCTCTCTCTCTCCGTCTCTCTTCTCTCTCTCT
T7_12052_G07	TCTCCTTCCTCTCTCTCGTCTCTTCTCTCTCTCTTC
T7_12053_G07	TCTTTCTCTCTCTCCTCGTCTCTCTCTCTCTCTCTC
T7_12054_G07	TCTCTCTCTCTCTCTTCGTCTCTCCTTCTCTCTCTC
T7_12055_G07	TCTCTTCTCTCCTCTCTGTCCTCTCTCTCTTCTCTC
T7_12056_G07	TTCTCCTCTCTTCTTCCGTCTCTCTCTCTCTCTCTC
T7_12057_G07	TCTTCTCTCCTCTCTCTGTCCTCTTCTCTCTCTCCT
T7_12058_G07	TCTCTCTCTCTCTCTCTGTCCTCCTCTCTCTCTCTT
T7_12059_G07	TCTCTCTCCTCTCTTTCGTCCTCTTCTCTCTCCTTC
T7_12060_G07	TCCTCTCTTCTCTCTCTGTCTCCTCTCTCTCTCTTC
T7_12061_G07	TCTTCTCTCTCTCTCTCGTCTCTCTCTCTCTCTCCT
T7_12062_G07	TCTCTCTCCTCTCTCTTGTCCCTCTCTCTCTTCTCT
T7_12063_G07	CTTTCCTCTCTCTCCTCGTCTCTCTCCTCTTCTCTT
T7_12064_G07	TCTTCTCTCTCTCTCTCGTCTCCTCTCTCCTCTCTT
T7_12065_G07	TCTCTCTCTTCTCTCTCGTCTCTTCCCTCTCTCTCT
T7_12066_G07	TCTTCTCTCCTCTCTCTGTCCTCTCTCTCTTCTCTC
T7_12067_G07	TCTCTCTCTTCTCTCTCGTCTCCTCTTCCTCTCTCT
T7_12068_G07	CTCCTTCTTTCTCTCTCGTCTCTCTCTCTCTCTCCT
T7_12069_G07	CTCTCTTCTCCTTCTCTGTCCTCCTCTCTCTTCTCT
T7_12070_G07	CTCTCTCTCTCTTCTCCGTCTTCTCTTCTCTCTCCT
T7_12071_G07	TCTCTCTCTCTCTCTCCGTCTTCTCTCTTCTCTCCT
T7_12072_G07	CTCTCTTCTCTCTCTCCGTCTCTCTCTCTTCCTTCT
T7_12073_G07	TCTCTCTCTCTCTTCTCGTCTCTCTCTCTCTTCTCC
T7_12074_G07	TCTCTCTCCTCTCTTCTGTCCTTCTCCTCTCTCTTC
T7_12075_G07	CTCTCTCCTCTCTCTCTGTCTCTCTCTTCTCTCTCT
T7_12076_G07	CTCTCTTCTCTCTTCTCGTCTCTCTCTCTCTCTCTC
T7_12077_G07	TCTCTCTCTCTCTCTCTGTCCTCTCTCTCTTCTCCT
T7_12078_G07	TCTCTTCTTCTCTCTCTGTCCTCCTCTTCTCTCCTC
T7_12079_G07	CTCTCTCTCTCTCCTTCGTCTCTCTTCTCCTCTTTC
T7_12080_G07	CTTCTCTCTCTTCTCTCGTCTCCTCTCCTCTCTCTT
T7_12081_G07	TCTCTCTCTCTCTCTCTGTCTCTCTCTCCTCTCTCT
T7_12082_G07	CCTCTCTCTCTCTCTCTGTCCTCTTCTTCTCTCTCT
T7_12083_G07	TCTCTCTCTCTCTCCTCGTCTCTCTCTCTTTCCTCT
T7_12084_G07	TTCTTTCTCTCCTCTCCGTCTCTCTCTCTCTCCTCT
T7_12085_G07	CCTCTCTCTCTTCTCTTGTCCTCTCTCTCTCTCTCT
T7_12086_G07	TCTCTCTCCTCTCTCTCGTCTCCTCTCTTCTTTCTC
T7_12087_G07	CTCTCTCTCTCCTCTCCGTCTTTTCTCTCTTCTCTC
T7_12088_G07	CTCTTCTCTCCTCTCTTGTCTCTCTCTCCTCTCTCT
T7_12089_G07	TCTTCTCTCTCTTCTCCGTCTCCTTCTCTCTCTCTC
T7_12090_G07	CCTCTCCTCTCTTCTCTGTCCTCTTCTCTTCTCTCT
T7_12091_G07	CTCTCTCCCTCTCCTTCGTCTTCTCTCTTCTCTTCT
T7_12092_G07	CTCTCTTCTCTCTCCTCGTCTTTCTCTCTTCTCTCC
T7_12093_G07	CTTCTCCTTCTCTCTCTGTCCTTCTCTCTCCTCTCT
T7_12094_G07	CTCTCCTCTCTCTCTCTGTCTCTCTCTCTCTTCTCT
T7_12095_G07	TTCTCTCTTTCTCTCCTGTCCTCTCTCTCTCTCTCC
T7_12096_G07	CTCCTCTCTCTCTCTTCGTCTCTTTCCTCTTCTCTC
T7_12097_G07	TCTCTCTCTCCTCTCTCGTCTCTCTCCTCTTCTTCT
T7_12098_G07	CTCTTCTCTCTCTCTCTGTCTCTCTCTCTCCTTCTC
T7_12099_G07	CTCTCTCTTCTCTCCCTGTCCTCTCTCTCTCTCTTT
T7_12100_G07	CCTCTTCCCTCCTCTTCGTCTCTCTCTTCTCTCTTT
T7_12101_G07	TCTCTCTCTCTCCTCTCGTCTCTTCTCTCTCTTCTC
T7_12102_G07	CTTCTCTCTCTCTCTCTGTCCTCTCTCCTCTCTTCT
T7_12103_G07	TCTCTTCTCTCTCTCCCGTCTCTCTTCTCTCTCTCT
T7_12104_G07	CTCTCTCTCTCTCTCTCGTCTCTCTCTCTTTTCTCC
T7_12105_G07	TCTCTCTCTCCTCTCTCGTCTCTCTTCTCTCTCTCT
T7_12106_G07	TCTCTCTCTCTCTCTCCGTCTCTCTTCTCCTCTTCT
T7_12107_G07	TTCTTCTCTCCTCTCTCGTCTCTCTCTCTCTCTCTC
T7_12108_G07	TTCTCTCTCTCTCCTCTGTCCTCTCTCTCTCTCTTC
T7_12109_G07	CTCTTTCTCTCTCCTCTGTCCTCTCTCTCCTCTCTT
T7_12110_G07	CTCTCTTCTCTCTTTCTGTCCTCTCTCCTCTCTCTC
T7_12111_G07	TTCTTCTCCTCTCTCTCGTCTCTCTCTCTCTCTCTC
T7_12112_G07	CTCTCTCTCTCTTCTCTGTCCTCTCTCTCTTCTCTC
T7_12113_G07	TCTCTCTCTCCTCTCTCGTCTCTCTCTTTCTCTCTC
T7_12114_G07	TCTTCTCTCTCTCTCCTGTCCTTCTCTCTCTTCTCC
T7_12115_G07	TCTCTCTCTCTCTCTCTGTCCCTTCTCTCTCTCTCT
T7_12116_G07	CTCTCTCTCTCTCTCTCGTCTCTCTTTCTCTCCTCT
T7_12117_G07	TCCTCTTCCTTCTCTCTGTCCCTCTCTCTTCTCTCT
T7_12118_G07	TCTCTCTCTTCTCTCCTGTCCTCTCTCTCTCCTCTT
T7_12119_G07	TTTCTCTCTCTCTTCTCGTCTCTCTCCTCCTCTCTC
T7_12120_G07	CTCTCTCTCTCTTCTCTGTCCTCTCTCTTCTCTCTC
T7_12121_G07	TCCTCTCTCTCTTCCTCGTCTCTCTTCTCTTCTCCT
T7_12122_G07	CTCTCTCTCTCTCTCTCGTCTCTTCTCTCTCTCCTT
T7_12123_G07	TCTCTCTCTCTCTCTCCGTCTCTCTCTTCTTCTCTC
T7_12124_G07	TCTCTCTCTCTCTCTTCGTCTCTCCTCTCTCTTCCT
T7_12125_G07	CTCTCCTCTCCTCTTCTGTCCTCTTCTCTCTTCTTC
T7_12126_G07	TCTCTCTCTCTCTCCTCGTCTCTCTCTCTCTTCTCT
T7_12127_G07	TCTCTTCTCCTCTCTCTGTCCTCTTCCTCTCTTCTC
T7_12128_G07	TCTCTTCTTCTCTCTCCGTCTCTCTCTTCTCTCCTC
T7_12129_G07	TCTTCCTCTCTCTTCTCGTCTCTCTCTCTCCTCTCT
T7_12130_G07	CTCTCTTCTCTTCTCTCGTCTTCTCTCTCTCTCCTC
T7_12131_G07	TTCTCTCCTCTTCTCCTGTCCTCTCTCTCTCTTCTC
T7_12132_G07	CTTCTCTCTCTCTTCTCGTCTCTCTCTCTCTCTCTC
T7_12133_G07	CTCTCTCCTCTTCTCTTGTCCTCTCTCTCTCTCTCT
T7_12134_G07	CTCTCTCCTCTTCTCTCGTCTTCTCTCTCTCTTCTC
T7_12135_G07	TCTCTCTCTCTCTTCTCGTCCTCTCTCTCTCTCTCT
T7_12136_G07	CCTCTCTTCTCTCTCTCGTCTTCTCTCTCTTCTCTC
T7_12137_G07	CTCTCTCTCTCTCCCTCGTCTCTCTCTCTTTTCTCT
T7_12138_G07	TCTCCTCTCTCTTCTCTGTCCTTCTTCCTCTCTCTC
T7_12139_G07	TCTCTCTCTCTTCCTCTGTCCTCTCTTCTCTCTCTC
T7_12140_G07	TTTCTCTCTCTCCTCTCGTCTCTCTCTCTCTCTCTC
T7_12141_G07	TCTCTCTCCTCTTCTCTGTCCTCTCTCTCTCTTCTC
T7_12142_G07	CTCTCTCCTCTCTCTCTGTCCTCTTTCTCTCTCTTC
T7_12143_G07	TCTCTCTCTCTCTCTCTGTCCTTCTCCTCTCTCTTC
T7_12144_G07	CTCTCTCTTCTTCTCTCGTCTCTCCTCTCTCTCTCT
T7_12145_G07	CTCTCTCCTCTCTCTCTGTCCTTCTCTCTCTTCTCT
T7_12146_G07	TCCTCTTCTCTCTCTCTGTCCTCTCTCTCTCTCTTC
T7_12147_G07	TCTCCTCTCTCTCTCTTGTCCTCTCTCTCTCTCTTC
T7_12148_G07	CTCCTCCTCTCTCTTTTGTCCTCTCTCTCTCTCCTT
T7_12149_G07	TCTTCTCTCTCTCTCTTGTCCTCTCTCCTCTCTCTC
T7_12150_G07	CTCTCTCTCTCTCCTCTGTCCTCTCTTTCTCTCTCT
T7_12151_G07	TTCTTCTCTCTCCCTCTGTCCTCTCTCCTCTCTTCT
T7_12152_G07	CTCCTCTCTCTCTTCTCGTCTCTCTTCTCTCTTCTC
T7_12153_G07	TCCTTTCCTCTCTCTTCGTCTCTCTCTCTCTCTCTC
T7_12154_G07	TCTCTCTCTCTCTTCTCGTCTCTCTTCCCTCTCTCT
T7_12155_G07	CTCTCTCTCTTCTCTCTGTCCTCCTCTTCTTCTCTC
T7_12156_G07	CTCTCTCTCTCTCTTTCGTCTCTTCCCTCTTCTCTC
T7_12157_G07	TCTCCTCTCTCTCTCTCGTCTCTTCTCCTCTTCTCT
T7_12158_G07	TCTCTCCTCTCTCTCTTGTCCTCTCTCTCTCTCTTC
T7_12159_G07	TCTCTCTCTCCTCTCTCGTCTCTCTCTTCTCTCTCT
T7_12160_G07	TCTCTCTCTCTCTCTCTGTCCTTCTCTCCTCTTCTC
T7_12161_G07	CTCTCTCTCTCCTCTCTGTCTCTCTCTCTCTCTTCT
T7_12162_G07	CTCTTCTCTCTCTCTCTGTCCTCTCTCTCTTCTCTC
T7_12163_G07	CCTCTCTTCTCTCTCTCGTCTTCTCTCTTCTCTCTC
T7_12164_G07	TCTCTCTCTCTCTCTCTGTCCTCCTCTCTCTTCTCT
T7_12165_G07	TCTCTCTCTCTCCTTCTGTCCTTCTCTCTCCTCTCT
T7_12166_G07	CTCTCTCTCTCTCTCTTGTCCCTCTCTCTCTTTCTC
T7_12167_G07	TCTCTCTCTCTCTCTCTGTCCCTCTCTCTTCCTTCT
T7_12168_G07	TCTCTCTTCTCTCTCTCGTCTCTTCTCTCTCCTCTC
T7_12169_G07	CTCTTTCTCCTCTCTCTGTCCTCTCTCTCTCTTCTC
T7_12170_G07	TCTCCTCTCTTCTCTCTGTCCTCTCTCTCTCTTCTC
T7_12171_G07	TCTCTCTCTCTCTCTCTGTCCTCTCTCCTCTTCTCT
T7_12172_G07	TCTCTCTCTCTCTCTTCGTCCCTCTCTCTTCTCTCT
T7_12173_G07	CTCTCTCCTCTCTCTTCGTCTCTCTCTCTTCTCTCT
T7_12174_G07	TCTCTTCTCCTCTCTCTGTCCTTCTCTCTCCTTCCT
T7_12175_G07	TCTCTCTCTCTCTCTCTGTCCTCTTCCTCTCTTCTC
T7_12176_G07	CTCTCTCTCTCTCTCTCGTCTCTCTCTCTTTCTCCT
T7_12177_G07	CCTTCCTCTCTCTCTTCGTCTTTCTCTCTCCTCTCT
T7_12178_G07	TCTCTCTCTCTCTCTCTGTCTTCTCTCTCCTCTCTC
T7_12179_G07	CTCTCTCCTCTCTTCTCGTCTCTTCTCTCTCTTCTC
T7_12180_G07	TCTCTTCTCTCTCTCTCGTCCTCTTCCCTCTCTTCT
T7_12181_G07	CTCTCTCTCTCTCTCCTGTCCTCTCTCTCTTTCTCT
T7_12182_G07	TCCTTCTCTCTTCTCTCGTCTCCTCTTCTCTCTCTC
T7_12183_G07	TCTCTCTCTCTCTTCTCGTCTCTTCTCTCTCCTCTC
T7_12184_G07	CTCTCTCTCTCTTCTTCGTCTCTCTCTCTCTCCCTT
T7_12185_G07	TCTCTCTCCTCTCTCTCGTCTCTCTCTCTTCTCTCT
T7_12186_G07	CTCTCCTTTCTCTCTCTGTCCTCTCTCTCTCTTCCT
T7_12187_G07	CTTCCTCTCCTCTCTTCGTCTCCTCTCCTTTCTTCT
T7_12188_G07	CTCTCTCTCTCTCTTCTGTCCTCTTCTCTCCTCTCT
T7_12189_G07	TCCTCTCTTCTCTCTCTGTCCTCTCTCTCTTCTCTC
T7_12190_G07	TCTCTCTCTCTCTCTCTGTCTCTCCTCTTCTCTCTC
T7_12191_G07	CCTTCTTCTCTCTCTCTGTCCTCTCTCTCTCTCCTT
T7_12192_G07	TCTCTCTCTTCTCTCTCGTCTCCTCTCTCTTCCTCT
T7_12193_G07	CTCTCTCTCTCTCTCTCGTCTCTCTCTCCTTCTTCT
T7_12194_G07	TCCTCTTTCTCTCTCTCGTCTCTCTCTCTCTTCTCC
T7_12195_G07	CTCTTCTTTCTCTCCTCGTCTCTCTCTCTCTCTCTC
T7_12196_G07	TCCTTCTCCTCCTCTCTGTCCTCTTTCTTCCTCTCT
T7_12197_G07	TCTCCTTCTCTCTTCCTGTCCCTCTCTCTCTCTCTT
T7_12198_G07	TCCTCTCTCTCTCTCTTGTCCTCCTCTTCTCTTCTC
T7_12199_G07	TCCTCTCTCTCTTCCTTGTCCTCTCTCTCTCTTCTC
T7_12200_G07	TCTCTCTCTTCTCTCTCGTCTTCTCTCTCTCTCCTC
T7_12201_G07	TCTCTCTCTCTCTCTCTGTCCCTCTCTTCTCTCTCT
T7_12202_G07	TCTCTCTCTCCTCTCTCGTCTCTTTCTCTCTCTCTC
T7_12203_G07	TCTCTCCTCTCTCTCTTGTCCTCTCTCTCTCTCTCT
T7_12204_G07	CTCTCTCTCTCTTCTCTGTCCTCTCTCTCTTCCTCT
T7_12205_G07	CTCTCCTCTCTCTCTCTGTCTCTTCTCTCTCTTCTC
T7_12206_G07	TTCTCTCTCTCTCTCTTGTCCCTCTCCTCTCTCTCT
T7_12207_G07	TCTCCTCTCTTTCTCTCGTCCTCTCTTCCTCTTCCT
T7_12208_G07	TCTCTCTCCTCTCTTCTGTCCTCTCTCTTCTCTCTC
T7_12209_G07	CTCTCTCTCTCCTCTCTGTCCTCTTCTCTTCTCTCT
T7_12210_G07	TTCTCTCCTCCTCTTCTGTCCTCTTCTCTCCTCTCT
T7_12211_G07	TCCTCTCTCTCTCTCTCGTCTCTTCTCCTCTCTTCT
T7_12212_G07	CTCCTCTCTCTCTCTTCGTCTTCTCTCTTCTCTCTC
T7_12213_G07	TCTTCTCCTCTCTCTCTGTCTCTCTCTCTCTCTCTC
T7_12214_G07	CTCTCTCTCTCTCTCTTGTCCCTCTCTCTCTCTTTC
T7_12215_G07	TCTCTCTCTTCTCTTCTGTCTCTCTCCTCTCTCCTC
T7_12216_G07	CTCTCTCTCTCTCTCTCGTCTTCTCTCTCTCTTCTC
T7_12217_G07	TCTCTCTTTCTCTCTCTGTCCTCTCTCTCCTCTCTC
T7_12218_G07	CTCTCTCTCTTCTCTCTGTCCTTCTCTCTCTCCTCT
T7_12219_G07	TCTCTCTTTCTCTCTCTGTCCCTCCTCTCTCTCTCT
T7_12220_G07	TCTCTTCCCTCTCTCTCGTCTTCTCTCTCTCTTCTC
T7_12221_G07	CTTCTCTCTCTTCTCTCGTCTCTCTCTCTCTCCTTC
T7_12222_G07	CTCTCTCTTCTCTCTCTGTCTCTCCTCTCTCTTCTC
T7_12223_G07	CTCCTCTCTCTCTCTCTGTCCTCTTCCTTCTTCTCT
T7_12224_G07	TCTCTCTCTCTCTCTTCGTCTCTTCTCCTCTTCCTC
T7_12225_G07	CTCTCTTCTCTTCTCTCGTCTCCTCTCTCTTCTCCT
T7_12226_G07	TCTTCTCTCTCTCTCTCGTCTCTCTCTCTCTCTCTC
T7_12227_G07	TCTCCTCTCTCTCTCTCGTCTCTCTCTTCTCCTTCT
T7_12228_G07	CTCTCTCCTCTCTTCTCGTCTCTTCTCTCTCTCTTC
T7_12229_G07	CTCTTCTCCTCTCTCTCGTCTCTTCTCTCTCTCTCT
T7_12230_G07	TCTTCTCCCTCTCCTCTGTCCTCTTCTCTTCTCTCT
T7_12231_G07	CTCCCTCTCTCTCTTTCGTCTCTCTCTCTTCTTCTC
T7_12232_G07	TCTCCTCTCTCTCTCTTGTCCTCTCTCCTTCTCTCT
T7_12233_G07	TCTCTCTCTCTTCCTCTGTCCTCTCTCTCTCTTCTC
T7_12234_G07	TCTCTCTCTCTCTCTTCGTCTCTCTCCTCTCTCTCT
T7_12235_G07	TTCTCTCTCTCTCTCTCGTCTCTCTTCTCTCTCCTC
T7_12236_G07	CTCTCTCCTTCTCTTCTGTCTTCTCCTCTCTCTCCT
T7_12237_G07	CTTTCTTCCTCTCTCTCGTCTCTCTCTCTCTCTCTC
T7_12238_G07	TCTCTTCCTCTCTCTCTGTCCTTCTCTCCTCTCTTC
T7_12239_G07	TCTTCTCTCTCTCCTTCGTCCTCTCTCTCTCTCTTC
T7_12240_G07	TCTCTCTCTCTTCTCTCGTCTCCTCTCTCTCTCTCT
T7_12241_G07	CTCTCTCTTCCTCTCTTGTCCTCTCTCTCTCCTTCT
T7_12242_G07	CTCTCTCTCTCTTTTCCGTCTCTCTCCTCTCTCTCT
T7_12243_G07	CCTCTCTCTCTTCTCTCGTCTTCTCTCTCTCTCTCT
T7_12244_G07	CTCTCTCTCTTCTCTCTGTCCTCTCTCTTCTCTCTC
T7_12245_G07	TCTCTCTTTCTCTCTCCGTCTTCTCTCCTCTCTCTC
T7_12246_G07	TCTCTCTTTCCCTCTCTGTCCTCTTCTCTCTCTCTC
T7_12247_G07	TCTCTCTCTCCTCTCTCGTCTTCTCTCCTCTTCTCT
T7_12248_G07	TCTCTCTCTCTCCTCTTGTCCTCTTCTCTCTCTCTC
T7_12249_G07	TTCTCTCTCTCTCTTCTGTCCTTCTCTCTCCTCCTC
T7_12250_G07	CTCTCTCTCTCTCTCTCGTCTCTTCTTCTCTCCTCT
T7_12251_G07	CCTCTCTCTCTTCTTCTGTCCTCTCTCTCTCTCTCT
T7_12252_G07	TCTCTCTCTCTCTCTCCGTCCTCTTCTCTCTTCTCT
T7_12253_G07	TCCTCTCTCTCTTCTCTGTCCTCTCTCTCTCTCTCT
T7_12254_G07	TCTCTTCTCCTCTCTTTGTCCTCCTCTCTCTCTCTC
T7_12255_G07	TCTCCTTCTCTCCTTCTGTCCTCTCTCTCTCTCTCT
T7_12256_G07	TTCTCTCCTCTCCTCTCGTCTCTCTCTCTCTCTTCT
T7_12257_G07	TCTCTCTCTCTCTCTCTGTCCTCTTCTCTTCTCTCC
T7_12258_G07	TCCTCTCTCTCTCTCTCGTCTCTCTCTCTTCTTCTC
T7_12259_G07	TCTCTCTCTCCTCTCTCGTCTTCTCCTCTCTCTCTT
T7_12260_G07	CTCTCTCTTTCTCTCTCGTCTTCTCTCTCTCTCCTC
T7_12261_G07	TCTCTTCTCTCTCTCCTGTCCTCCTCTTCTCTCTCT
T7_12262_G07	TCTTCTTCTTCCTCTCTGTCCCTCTTCTCTCTCCTC
T7_12263_G07	CTTTCTCTCTCCCTCTCGTCTCCTCTCTCTCTTTCT
T7_12264_G07	CCTTCTCTCTCTCTCTCGTCTCTCTCTCTTCTCTCT
T7_12265_G07	CTCTCTCTCTCTCTCTTGTCCTTCTTCCTCTCTCTC
T7_12266_G07	CTCCTCTTCTCTCTCTCGTCTCTCTCTCTCTCTCTT
T7_12267_G07	CTCTCTCTCTTCTCTCTGTCCTCCTCCTTTCTCTTC
T7_12268_G07	TCTCTTCTCTCTCTCTCGTCCTCTCTTCTCTCTCTC
T7_12269_G07	TCTCTCTTCTCCCTTCTGTCCTCTCTCTTCCTCTCT
T7_12270_G07	TTTCTCTCCTCTTCTCTGTCCTCTCTCTCTCTCCCT
T7_12271_G07	CTCTTCTCTCTCTCTCCGTCTCTCTCTTCTCTCTCT
T7_12272_G07	CTCTTCCCTCTCTCTTCGTCTCTCTTCTCCTCTCTT
T7_12273_G07	TCTCCTCTTCTCTCCTCGTCTCTTCTCTCTCTTCTC
T7_12274_G07	CTCCTCTCTCTCTTTCTGTCCTCTCTCTCTTCTCTC
T7_12275_G07	CTCTCTCTCTTCTCTCTGTCCTCTTCTCCTCTCTCT
T7_12276_G07	TTCTCCTCTCTCCTCTCGTCTTCTTCTCTCTCCTCT
T7_12277_G07	CCTCTCTCTCTCTTCTTGTCCTCTCTCTCTTCTCCT
T7_12278_G07	CTCTCTCTTCTCTCTCTGTCCTCTCTCTCTCTCTCT
T7_12279_G07	CTCTCTCTCTCTCTCTCGTCTCTCTCTTCTCCTCTT
T7_12280_G07	CTCTCTCTCTTCTCTCCGTCTCTCTTCTCTCTCTCT
T7_12281_G07	TCTCTCTCTTCTCTCTCGTCTCTCCTTCCTCTCTCT
T7_12282_G07	TCTCTCTCTCCTCTCTCGTCTCTCCTTCTCTCTCTT
T7_12283_G07	TCTCTCTCCTCTTCTTTGTCCTCTCTCTCTCTCCTC
T7_12284_G07	TTCTCTCTCTCTCTCTCGTCTCTCTCTCTCTTCTCC
T7_12285_G07	TTCTCTCTCTTCTCCTCGTCTCTCTCTCTCTCTCTC
T7_12286_G07	CTCTCTCTCTCTCTTCTGTCCTTCTCTCTCTCTCTC
T7_12287_G07	CTTCTCTCCTCTCTCTCGTCTCTCTCTCTCTTCTCT
T7_12288_G07	TCTCTCTCCTCCTTTCTGTCCTCTCTTCTCTCTCTC
T7_12289_G07	TTCTCTCCTCTCTCTCTGTCCTCTCTCTCTTCTCTC
T7_12290_G07	TCTCCTCTTCTTCTCTTGTCCTTCTCTCTCTCCTCC
T7_12291_G07	CTCTTCTCTCTCCTCTCGTCTCTCTCTTCTCTCTCT
T7_12292_G07	CCTCTCTCTCTCTCTCTGTCTCTTCTTCTCTCTTCC
T7_12293_G07	CTCTCTCTCTCTCTCTCGTCTTCTCTCTCTCTCTTC
T7_12294_G07	TCTCTCTCTTCTCTCCTGTCCTCTCCTCTCTTTCTC
T7_12295_G07	CTCTCTCTCTCTCTTCTGTCCTTCTCTCTCTCCTCT
T7_12296_G07	TCTCTCTCTTCTCTCCTGTCCTCTCTCTCTTCTCTC
T7_12297_G07	CCTCTCTCTCTTCTTTCGTCTCCTCTCTTCTCTCCT
T7_12298_G07	TCTCTTCTCCTCTCCTCGTCTCTTCTCTCTTCTCTC
T7_12299_G07	CCTCTCTCTCTCTCTCTGTCCTCTCTCTCTTCTTCT
T7_12300_G07	CTTCTCTCTCTCTCTTCGTCTCTCCTTCTCTCTCTC
T7_12301_G07	CTCTTCTCTCTTCTTCTGTCCTCTCCTCTCTCTCTC
T7_12302_G07	TCTCTCTCTCTTCTCTTGTCCTCTCCCTTCTCTCCT
T7_12303_G07	TCCTCTCTCTCTCTCTCGTCCTCTCTCTCTCTTTCT
T7_12304_G07	CTTCTCTTCTCTCCCTTGTCCTCTCTCTCTCTTCTC
T7_12305_G07	TCTCTCCTCCTCTCTCTGTCCTTCTTCTCTCTCTCT
T7_12306_G07	TCTCTCCTCTCTTCTCTGTCTCTCTCTCTCTCTCTC
T7_12307_G07	TCTCTCTCTCTCCTCTCGTCTTCTTCCTCTCTCTCT
T7_12308_G07	CTCTCTCTCCTTCTCTCGTCTCTTCTCTCTCTCTTC
T7_12309_G07	CTCCTTCTCTCTCTCTCGTCTCTCTCTCTCTTCTTC
T7_12310_G07	TCTCCTCTCTCTCTCTCGTCTTCTTCTCTCCTCTCT
T7_12311_G07	CTTCTCTCTCTCTCCTCGTCTCTTCTCTCTCTTCTC
T7_12312_G07	TCTCTTCTCTCTCTCTCGTCTTCTCTCTCTCTCTCC
T7_12313_G07	CTCTCTCTCTCTCTCTTGTCCCTCTCTTCTCTCTCT
T7_12314_G07	TCTTCTCTCCTCTCCTCGTCTTCTCTCTCTCTCTCT
T7_12315_G07	CTCTCTCTCTCTCTCTTGTCCTCTCTCTCTTCTCCT
T7_12316_G07	CTTCTCTCTCTCTCTCTGTCCTCCTCTCTCTCTTCT
T7_12317_G07	TCTCTCCTCTCTCTCTCGTCTCTTCTCTCTCTCTCT
T7_12318_G07	CTCTCTCTTCTCTCTCTGTCCTTCCTCCTCTTCTCT
T7_12319_G07	CTCCTCTCTCTCTCCTTGTCTTCTCTCTCTCTCTCT
T7_12320_G07	TCTCCTTTCTCTCTCTCGTCTCTCTCCTCTCTCTCT
T7_12321_G07	TCTCTCTCTCTCCTCTTGTCCCTCTCTCTCTTCTTC
T7_12322_G07	CTCTCTTTCTCTCTCTCGTCTCCTCTCTCTTCTCTC
T7_12323_G07	TCCTTCTCTCCTCTCTCGTCTCTCTCTTCTCTCTTC
T7_12324_G07	TTCTCTCTCTCTCTCCTGTCCTCTCTCTCTCTTCCT
T7_12325_G07	CTTTCCTTTCTCTCTTTGTCCTCTCCTCTCTCCCTC
T7_12326_G07	TCTCTCTCTTCTCTCTCGTCCTCCTTCTCTCCTCTT
T7_12327_G07	TCTCTTCTCCTCTCTTCGTCTCTCTCCTCTCTCTCT
T7_12328_G07	CTCTTCTCTTTCCTCTCGTCTCCTCCTCTCTCTCTT
T7_12329_G07	TCTTCTCTCTCTCTCTCGTCTCCTCTTCTTCTCTCC
T7_12330_G07	TCTCTCTCCTCTTCTCCGTCTCTCTCTCTTCCTCTT
T7_12331_G07	CTCTCTCTTCTCTCTCTGTCTCTCTTCTCCTCTCTC
T7_12332_G07	TCTTCTCCTCTCTCCTCGTCTCTCTCTTTCTCTCTC
T7_12333_G07	CTCTCCTCCTCTCTCTTGTCCTCTTCTTCTCTCTCT
T7_12334_G07	TCTCTTCTCTCTCTCTCGTCTTTCTCCCTCTCTCCT
T7_12335_G07	TCTCTTCCTCCTCTCTCGTCTCCTCTCTCTCTTTCT
T7_12336_G07	TCTCTCTCTCTTCTCTCGTCTCTCCTCTCTCTCTCT
T7_12337_G07	CTCTCTCTCTCTTCTCTGTCCTTCTCCCTCTCTTCT
T7_12338_G07	TCTCTCCTCTCTCTCTCGTCTCTCTCTCTCTTCTCT
T7_12339_G07	CTTCTCTCTCTCTCTCTGTCCTCCTCTTCTTCTCTC
T7_12340_G07	TTCTCTCTCTCTCTCTTGTCCTCTCTCTCTCTCTCC
T7_12341_G07	TTCCTCTTCTCTCTCTCGTCTCTCTCTCTCTCTCTC
T7_12342_G07	TCTTCTCTCTCTCTCTTGTCCTTCTTCCCTCTCCTC
T7_12343_G07	TCTTCTCTCTCTCTCTCGTCTCTTCTCCTCTCTCTC
T7_12344_G07	TCTCTCTCTCTCTCTTCGTCTCTCTCCTCTCTCTTC
T7_12345_G07	TCTTCTCTCTCTCTTCTGTCCTCTCCTTCCTCTCTC
T7_12346_G07	CTCTCCTCTTCTCTCTCGTCTCCTCTCCTTTTTCTC
T7_12347_G07	CTTCTTCTCTCTCCTCTGTCCTCTCTCTCTCTCTCT
T7_12348_G07	TCTCTTCTCTCTCTCTCGTCTCTCTCTCTCTTCTCC
T7_12349_G07	TCCTCTTCTTCTTCTCCGTCTCTCTCTCTCTCTCTC
T7_12350_G07	CTCTCTCTCTCTCTCTCGTCTCTTCTCTCTCTCTTC
T7_12351_G07	TTCCTCTCTCTCTCTCTGTCCTCTCTCTCTTCTCTC
T7_12352_G07	CTCCTTCTCTCTTCTCTGTCCTCTTCTCTCTCTCTC
T7_12353_G07	TTCTCTTCTCTCTCTCTGTCCTCTCTCCTCTCTCTC
T7_12354_G07	CTCTCTCTTCTTCTCTCGTCTCTCTCCTCTCTCTCT
T7_12355_G07	TCTCCCTCTCTCTCTTCGTCTCTCTTTCTCTCCTCT
T7_12356_G07	TCTCCCTCTTTCTCTCTGTCCTCTCTCTCTCTTCTC
T7_12357_G07	TCTCTTCCTCTCCTCTTGTCCTCTCTCTCTTCCTCT
T7_12358_G07	CTCTCTCCTTCTTCTCTGTCCTTCTCTCTCCTCTCT
T7_12359_G07	CTCCTCTTCTCTCTTTCGTCCTCTCTCTTCTCTCTC
T7_12360_G07	TCTCTCTCTCTCCCTCTGTCCTCTTCTCTCTTCTCT
T7_12361_G07	TCCTTCTCTCTCTTCCTGTCCTCTTCTCTCTCTCTC
T7_12362_G07	CTCTCTCTCTCTCTCTTGTCCTTCTCTCTCTCTCTC
T7_12363_G07	TCTCTCCTCTTCTCTCTGTCCTTCTCTCTTCTCTCC
T7_12364_G07	CTCTCTCTCTTCTCTTCGTCTCTCTCTCTCCTCTCT
T7_12365_G07	TCTCTCTCTTCTCTCTCGTCCTTCTCTCTCTCTCTC
T7_12366_G07	TCCTCTCTCTCTCTCCTGTCCTTCTCTCTCTTCTCT
T7_12367_G07	TTCTCTCTTCTCTCTCTGTCCTCTCCTCTCTCTCTC
T7_12368_G07	TCTCTCTCTCTCTCTCTGTCCTTCTCTCCCTTCTTC
T7_12369_G07	TCTCTCTCTCTCTCCTCGTCTCTCTCTCTCTCTTCT
T7_12370_G07	TCCTCTCTCTCTTTCTCGTCTCTCTCTCTCTCTCTC
T7_12371_G07	TCTCCTTCCCTTTCTCTGTCCTTCTTTCTCCTCCTC
T7_12372_G07	TCTCTCTCTCTCTTCTCGTCTCTCTCTCTCTCTCCT
T7_12373_G07	TCTCTCTCTCTCTTTCTGTCCTCTCTCCTCTCCTCT
T7_12374_G07	CTCTCTCTCTTCTCTCTGTCCCTTTCTCTCTCTCTC
T7_12375_G07	CTCTCTCCTCTTCTCTCGTCTCTCTTTCTCCTCTCT
T7_12376_G07	TTCTCTCTCTCTCTCCTGTCCTTCTTCTCTCCTCCT
T7_12377_G07	TCTCTCTCTCTTCTCTCGTCTCTCTCTCCTCTCTCT
T7_12378_G07	CTCTCTCTCCTTCTCTTGTCCTCTCTCTCTCTCTCT
T7_12379_G07	CTCCTTCTCCTTCCTCTGTCCTCTCTCTCTTTCTTC
T7_12380_G07	CTCTCTCTTCTTCTCTCGTCTTCTCTCTCTCCTCTC
T7_12381_G07	TCTCTCCTCTCTCTCTCGTCCTCTCTCTCTCTTCTT
T7_12382_G07	CTCTTCTTCTTCTCTCTGTCCTCCTCTCTCTCTCTC
T7_12383_G07	TCTCTCCCTCTCTCTCTGTCCTCTTCTTCTCTCTCT
T7_12384_G07	CTCTCTCTCTCTCTCTTGTCCTCTCTCTCTCTCTTC
T7_12385_G07	CTCCTCTCTCTTTTCTCGTCTCCTCTCTCTCTCTCT
T7_12386_G07	TCTCTCTTCTTTCTCCTGTCCTTCTCCTCCTCTCTC
T7_12387_G07	TCTCCTTCTCTCTCTCTGTCCTCTCTCTTCTCTCTC
T7_12388_G07	CCTCTCTCTTCTCTCTCGTCTCTCCTCTCTCTTCTT
T7_12389_G07	TCTCTTCTCTTCTCTTCGTCCTCTCTCCTCTCTCTC
T7_12390_G07	CTCTCTCTCTCTCCTTCGTCTCTCTTCTCTCTTCTC
T7_12391_G07	TCTCTTCTCTCTCTCTCGTCTCTCCTTCTCTCTCTC
T7_12392_G07	CTCTCTTCTCTTCCTCTGTCCTCTCTCTCTCTCTCT
T7_12393_G07	CTTCTCTCTCTCTCTCCGTCTCTCTCTCTCTTCTCT
T7_12394_G07	TCTCTTCCTCTTTCTCTGTCCTCTCTCTCCTCTCTC
T7_12395_G07	CTCTCTCTCTCTCTCTCGTCTCCTTCTCTCTCTCTT
T7_12396_G07	CTCTCTTCTCTTCTCTCGTCCCTCTCCTCTCTTTCT
T7_12397_G07	CTTCTCTCTCTCTCTCCGTCCTTCTCTCTTCTCTCT
T7_12398_G07	TCCTCTTCTCTCCTCTCGTCTCTCTCTCTCTTCTCT
T7_12399_G07	TCTCTCTTCCTTCTCTCGTCTCTCTCCTCTTCTCTC
T7_12400_G07	TCTCTTCTCTCTTTCCTGTCCTCCTCCTCTCTCTCT
T7_12401_G07	CTCTCTCTCCTCTTCCTGTCCCTCTTCTTTTCTCTC
T7_12402_G07	TCTCCTCCTTTTTCTCTGTCCTCCCTTTCTCTCTCC
T7_12403_G07	CCTCTCTCTTCCTTCCCGTCTCCTTCTTTCTCTTCT
T7_12404_G07	TTTCTCCTCTCCTCTTCGTCCTCTCTCTCTCTCTTC
T7_12405_G07	CTCTCTTCTCTCTCTTCGTCTCCTTCTCCTTCTCTC
T7_12406_G07	TCTTCCTCTTCTCCCTCGTCTTTCCCTCCTTCTTCT
T7_12407_G07	TCTCCTCCTCTCTCTTCGTCTTCTTCTCTCCTTCTC
T7_12408_G07	TTCTTTCCTCTCTTCTCGTCTCTCTCTCTCTCTCCC
T7_12409_G07	CCTTCTCTCTTTCTCCTGTCTCTCTCCTCTTCTCTC
T7_12410_G07	TCTTCTCCTTTCTTCTCGTCTCTCCTCTTCCTCCTC
T7_12411_G07	TTCTCTCCCTCTCTCTTGTCCTTCTTCTCTCTCCCT
T7_12412_G07	TCTCTCTCTCTTCCTTCGTCTCTTCTCCTCCTCTCT
T7_12413_G07	TCCTCTTTCCTCTCCTTGTCTCTCTCTTCTCTCCTC
T7_12414_G07	CTTCTCTTCTCTTTTTTGTCCTCCTCCCCTCCTCCT
T7_12415_G07	CTTCTTCTTCCCCTCTTGTCCCTCTTTCTCCTTCTC
T7_12416_G07	TCTTCTCTCTTCCCTCTGTCCCTTCTCTCTCTTCTC
T7_12417_G07	TTCTTCTCTCCTCCTCTGTCCTCTCCTCTTTTCCTC
T7_12418_G07	TTCCTCCTCCTCCTTCTGTCTCTTCCTCTCTCTCTT
T7_12419_G07	CTTCCTCTTTCTCTCCTGTCCTCTTCTTCTTCCCTC
T7_12420_G07	TCCTCTCTCTCTCCCTTGTCCTTCTCTTCTTTCCTC
T7_12421_G07	TCTCTTCTCTTCTCCCTGTCCTTCTCCTCTCTCTTC
T7_12422_G07	TCTCCCTTCTTCCTTCTGTCCTCTCTCTCTCTTCTC
T7_12423_G07	TTCTCTCCTTCTTCTCTGTCTCTCTTCCTCTTCCCC
T7_12424_G07	CTCTTCTTCCTCCCTTCGTCTCCTCTCCCTTTTTTC
T7_12425_G07	CTTTCCTTCTCTCTTTCGTCTCTCCTCTCCTCTCCT
T7_12426_G07	CTCTCTCCTCTTCTTCTGTCTTCCTCCTCTCTTCTC
T7_12427_G07	CTCTCTCTTCTCTCCTCGTCCCTCTCTTCTCTTTCT
T7_12428_G07	TTCTCCTCTTCCTCTTTGTCCTCTCTCCCTTTCCTC
T7_12429_G07	TCTCTCTCTCTCTCTCTGTCTCCTTCTCCTTCCTCT
T7_12430_G07	TCTCTCTCTCTCTCTCCGTCCTTCTCTCTTCTCTTC
T7_12431_G07	CCTCTCTTCTCTCTCTTGTCCTTCCCTCTCTTCTCT
T7_12432_G07	TCTCCTTTCCCTCTCTTGTCCTTCTCTCTCTCTCTC
T7_12433_G07	TTCTCCCTCCTCTCTTCGTCTCTTCTTCTCTCCTTC
T7_12434_G07	TCCTCTCCTTCTTCCCTGTCCTCTCTTCTTTCTCTC
T7_12435_G07	CCTTCTCCTCTCTCTCCGTCTCTTTCTTCCTCTTCT
T7_12436_G07	TTCTCTTTCCTCTCTCCGTCCTCTTCTCTCTCTCCT
T7_12437_G07	CTCTTCCTCTCTCTTCTGTCTCCTTCTTCTCCTCCT
T7_12438_G07	CTTCTCTCTCTCTTCTCGTCTTCTCTTCCCCTCTTC
T7_12439_G07	TCTTTCCTCCTCTTCTCGTCCTCTCCTCTCTCTTCT
T7_12440_G07	TCTCCTCCTCTTTCTTCGTCTCTCCTCCTCTTCTCT
T7_12441_G07	TCTTCCTTTCTCCTCTCGTCCTCTCTCCTCTCTTTC
T7_12442_G07	TCTCTTCTCTTTCCCTCGTCTCCTCTCCTTTCCTCT
T7_12443_G07	TTCTTCTTCCCTCTCTTGTCCTCTCTCTCTCTCCCT
T7_12444_G07	TCTTTCCCTCTCCCTTCGTCTTCTCTCCTTCCTTTC
T7_12445_G07	TTCTCTCTCTCCTCTCTGTCCTCTCCTTTCTCTCTC
T7_12446_G07	CTCTCTCTCTCTCTTCTGTCCCTTCTTCTCCTCTCT
T7_12447_G07	CCTTCCTCTCTCTCCTTGTCTCTCTCTCTCTCTTCT
T7_12448_G07	CTCCTTCTCTCCTCTCTGTCTCTCTCTCTTCTCTCT
T7_12449_G07	TCTCTTTCTCTCTCCTCGTCCTCTCTCTTCTCTCTC
T7_12450_G07	TCTTCTCTCCTTCTCCCGTCCTCTCTTCTCTTCTCT
T7_12451_G07	CTTTTCCTCTCCCTTCCGTCTTCTCCTTCTCTCTCT
T7_12452_G07	CCTTCTCTTTCTCTTCTGTCTCCTTCTCTCTCCCTC
T7_12453_G07	CCTTCCTCTCCTTCTTCGTCCTTTCTCTTCCTTCTC
T7_12454_G07	CCTCTCTTCCTCCTTTTGTCCTTTTCCCTCTCCTCT
T7_12455_G07	TCCTCCTCTCTCTCTCCGTCTTCTTCTCCTTTTCCT
T7_12456_G07	CTCTTCTTTCTCCCTCTGTCCTCTCTTCTCCCTCTT
T7_12457_G07	TCTTTCTCCTCTCCTCTGTCCTCTCTTCTCTCTCCT
T7_12458_G07	TTCTCTTCTCTTTCCTCGTCCCCTTCTCCTTCCTCT
T7_12459_G07	TCTCCTCTCTTCCTCTTGTCCTTTCTCTCCCTTCCT
T7_12460_G07	CTTTCTCTCTCTCTCTCGTCTTCTCTCTCTCCCTCT
T7_12461_G07	TTCTTCTCCTCTCTCTTGTCCTCCCTTCCTCTTCTC
T7_12462_G07	TCCTTCCTTCTCCTCCTGTCTTCTCTTCCTCTTCTC
T7_12463_G07	CTCCCTCTTCTCCTTCCGTCTTCTCTTCTTTCTCCT
T7_12464_G07	CCTTCTCCTCTCTCTTCGTCTCTCTCTTTCTCTCCT
T7_12465_G07	TTCTTTTCTCCTCTCTCGTCTTCCTCTCCTCCTCTC
T7_12466_G07	CTCTTCTCTTCTCTTCCGTCTCCTTCTCCTCTCTTC
T7_12467_G07	TCTCTCCTCTCCTTCTCGTCTCCTCCTCTCTTCTTT
T7_12468_G07	TCTTCCCTCTCTCTCCCGTCTCCTCTTTCTTCTTCT
T7_12469_G07	TCTCCTCTCCTCTCTTCGTCTCTTCTCTCTCTTCTC
T7_12470_G07	TCTCTCCTCCTCTCTCCGTCTCCTTTCTTCTTCTCT
T7_12471_G07	CTCCTCTCTCTTCTCCTGTCCTTTCTCCTTCTCTCT
T7_12472_G07	TTCTTTCTCTTCCCTCCGTCTCCTCTCTTCTCTCTC
T7_12473_G07	CTCCTTCTCTCTTCTCTGTCCTCCTCTTTCTTCTCC
T7_12474_G07	TTCTCCCTCCTCTCTCTGTCCCTCTTCTTTTTCCTC
T7_12475_G07	TTTCTCTTTTCCCTCTCGTCTCTCCCTCTCTCCCTT
T7_12476_G07	TTCTCTTTCTCTTCTCTGTCCTCCCTCTCCTCTCTC
T7_12477_G07	TCTCCTCTCTCCTTCCCGTCTTTCCTTCTCTCTTCT
T7_12478_G07	CTCTTTCCTTCCTTCTCGTCTCTCCCTTCTTCCTCT
T7_12479_G07	CTCTCTTCTCTCTCTCCGTCTCTCTCTCTTCTCTTC
T7_12480_G07	TTCTCCCTCTCTCTCTCGTCCTTCTTTCCTTCTCTC
T7_12481_G07	TCTCTTTCCTCCCTCTTGTCTCCTCTCTCTTCTCTC
T7_12482_G07	CTCTCCCCTCTTTTCTCGTCTCTTCTCTCTTCTCCT
T7_12483_G07	TCTCTCTTCCTCTCTTCGTCCTTCCCTCTCTTCTCT
T7_12484_G07	CTCTTCTCTCTCTCCTCGTCTCTCTCTCTCTTTCTC
T7_12485_G07	TCCTCCTCCTCTCTTTTGTCCTCTCTCTCTTTCTCC
T7_12486_G07	CTCTTCTCTCTCCTCTTGTCTCTCTCTTCTCCTCTC
T7_12487_G07	TTCTTTCTCTCTCTCCTGTCCCTCCTCTCCTCTTCT
T7_12488_G07	CTCTCTTCTCCTCCTTCGTCTCTCTCTTCTCTCTCT
T7_12489_G07	TTCTCTCTCTCTCTTTCGTCTCTCTTCCCTCCTTCC
T7_12490_G07	TTCTTCTCTCTCTTCTCGTCCTTCTCTTCTCCCCTC
T7_12491_G07	TCTCTCTTCTCTCCTCTGTCTTCTCCCCTTCTTTCC
T7_12492_G07	CTCCTCTCTCTCTTCTCGTCTCTCTTCTCTCTCTCT
T7_12493_G07	TCTCTCTCTCTCTTCCTGTCCCTCTTCTTCCTCTCT
T7_12494_G07	TCTCTCTTCCTCCCTTCGTCCTTTCTCTCTTCCTCT
T7_12495_G07	TTTCTCTTCCTCTCCTCGTCTTCTCTCTCTCCCTCT
T7_12496_G07	TTCTCTCTCCTCTTCCTGTCCTCCTTCTCTCTTCTC
T7_12497_G07	CTCCTTTCTCTCCCTCTGTCTTCTTCCTCTTCTTCC
T7_12498_G07	CTCTTCTCTCTCCCTTCGTCTCTCCTCTTCTTCTCT
T7_12499_G07	TCTTTTCTCTCCTCTCTGTCCCTTCCTCTCTCTCCT
T7_12500_G07	CTTTCTCTCTCCCCTCTGTCCCTTCTTTCTCTTCTC
T7_12501_G07	TCCCTCTCTTCTTCTCTGTCCCCTCTCTCTCTTTCT
T7_12502_G07	CTCTCTTCTCTCTCTTCGTCTCTCTCTCTCCTTCTC
T7_12503_G07	CTCCTCTCCTTTTTCTCGTCTTTCCTCTTTCCCTCC
T7_12504_G07	TTCTCTTCCTTCCTCTCGTCTCTCTCTCTCTCCTCT
T7_12505_G07	TCCTCTCTTTCTCCTCCGTCTTTTCTCTCTTCCTCC
T7_12506_G07	TCCTTCCTTCTCTTCCTGTCCTCTCCTCCTTCTTTC
T7_12507_G07	TTCCTTCCTCTCTTCTTGTCCTCTCTCCTCTCTCTC
T7_12508_G07	CTCTTTCTCTCCTCTCCGTCTTCCTCCTTCCTTTTC
T7_12509_G07	CTTCTCTTCTCCTTTCTGTCTCTTCTCCTCTCCCTC
T7_12510_G07	CTCCTTCTTTTCTCTCTGTCCCCTCTTCCTCTCTTC
T7_12511_G07	CCTCTCTCCTCTCTTCTGTCTTCTCTCTCCTCTCTT
T7_12512_G07	TTCTTCTCTTTTCCTCTGTCCTCTCTCCTCTCCCCT
T7_12513_G07	TTCTCTCTCCTTTCTCCGTCTTCCTCTCTCTCTCTC
T7_12514_G07	CTCTCTTTTCTTCCTCTGTCTCTCTCTCTCCCCTTC
T7_12515_G07	TCTCTTTTCTCTCTCTTGTCCTCTCCTCTCCCTCCT
T7_12516_G07	TTCTCCCTTCTCTCTCCGTCTCTTCTCTCTCTCTCT
T7_12517_G07	TCTCTCTTTCTCCCCTCGTCTCTCTTCTCTCTTCTC
T7_12518_G07	TCCTCTCTCTCTCCCTTGTCCTTCTTCTCCCTTCTT
T7_12519_G07	TCTCTTCTTTCCTTTCCGTCTCTCTCTCTCCCCTCT
T7_12520_G07	TCTCCTCTCCTTTCCTCGTCTTCTCTTCTCCTCTCT
T7_12521_G07	TCCTCTTTCTCCTCTTCGTCTCTCTCTCTCTCCCTT
T7_12522_G07	TTCCTTCTCTCTTCTTCGTCTCCTCTCTCTCTCTCC
T7_12523_G07	TCTTTTCTCTCTCTCCCGTCTCTCTCTCTCTCTTCC
T7_12524_G07	CCTTCTCTTCTTCCTCTGTCCTTCTCTCTCTCCTCT
T7_12525_G07	CTCTCTCTCTTCTTTCTGTCCTCTCTCTCTCTCTCC
T7_12526_G07	CTCTCCCCTCTCTCTTCGTCTCTTCTTTCTCTCTCT
T7_12527_G07	CTTTCTCTCTCCTCTCTGTCCTCTCTCTCTCTCTTC
T7_12528_G07	CTCTCTTCTCTCTTCTTGTCCTCTCTTTCTCCCCTC
T7_12529_G07	TCCTTCTCTCTCTCCTCGTCCCTTTCTTCTCTCTCT
T7_12530_G07	TCTCCTTCTTTTCTCCCGTCTCCCCTTTCTTCTCTC
T7_12531_G07	TCTCTCTCCTTCCCTCTGTCTCCTCTTCTCTCTCTT
T7_12532_G07	TCTCTCTTTCTCCTCTTGTCTCCCCTCTCTTCTCTC
T7_12533_G07	TCTCTCTTCTTCCTCTCGTCTTCTCTCTTCCCTCTC
T7_12534_G07	CTCTCTTCTCTCTCCTCGTCTCCTCCTTCCTCTTTT
T7_12535_G07	CTTCTCTTCTTCCTTCTGTCCTCCTCCTCTTCTCTC
T7_12536_G07	CTTCTCTTTTTCTTCCTGTCCCTCCTCCTCTCCTCT
T7_12537_G07	TCTCTCTTCTCTCTCTTGTCCCTCTCTCTCTCCTCT
T7_12538_G07	CTCTCCTCCTCTCTCCTGTCCTCTCTCTCTCTTTTT
T7_12539_G07	CCTCTTTCTCTCTTTCTGTCTCCTCTCCTCTCTCTC
T7_12540_G07	CTTTCTCTCCTCTCCTTGTCCTCCTCTCTTCTCTTC
T7_12541_G07	CTCCTTCTCCCTCCTTTGTCCTCTCTCTCTTCTTTC
T7_12542_G07	CTCTTCTCCTCTTCTCCGTCTCTTCTCTCTCTTCCT
T7_12543_G07	CTCTCTCTCTCTCCTCTGTCTTTCTTCTCTCTCCCT
T7_12544_G07	TTCTCTCTTCCTCTCTCGTCTCCCCTCTCTTTCTCT
T7_12545_G07	TCTCTCTCTCTCTCTCCGTCTTCTTTCCTTCCTCTC
T7_12546_G07	TTCCTTTTCTCCTTCTCGTCTCTCCCTCTCCCTTCT
T7_12547_G07	TTCCTCTTCTTCTCTTCGTCCTCTCCTCCTCTCTCT
T7_12548_G07	CTCTTCTTCTTTTCTCTGTCCTCTCTCCTCCTCTCC
T7_12549_G07	CCTTCCTCTCCTCCTCTGTCTTCTTCTTCTTCTCTC
T7_12550_G07	TCCTCCTCTCTCTTTCCGTCTCTTCTCTTCCTCTCT
T7_12551_G07	CTTCTCCTCTTTCTCTCGTCTCTTCTCTCTCTCCTC
T7_12552_G07	TCTCTCTCTTTCCTCCTGTCTCTCTCCTCTTCTCCT
T7_12553_G07	TCCTTTCTCCTCTCTTTGTCCTCCTCCTCTCTTCTC
T7_12554_G07	TCTTCTCCTCTCTTCTCGTCTCTCTCTCTTTCCCTC
T7_12555_G07	TCTCTCTCTTCTCTCTCGTCTCTTCTTCCTCCTCCT
T7_12556_G07	TCTCTCTCTTCTCTTTCGTCTCCTCTCTCCTCCTCT
T7_12557_G07	TCCTTTCCTCCTCTTCTGTCCCTTCTTCTCTCTCTC
T7_12558_G07	TCCTCTTCTTCTCCTTCGTCTCTCCTTCTCTCTCCT
T7_12559_G07	TTCCTCTCTCTCCTCTTGTCCTCTTCTTCCTCTCCT
T7_12560_G07	TCTTTCTCTCCTCTCTCGTCCTCTCCTCTCTTCTCT
T7_12561_G07	TCCTTTCTCTCTTCTCTGTCTCTCTCCCTCTCTCTC
T7_12562_G07	TTTCTCTCCTCTTCTCCGTCTTCTCCTCTCTCTCTC
T7_12563_G07	TCCCTCTCTTTCTCCTCGTCCCTTTTCTCTCTCTTC
T7_12564_G07	CCTTTTTTCTCCTCCCTGTCTCTCTTTCTTCCTCCC
T7_12565_G07	TCTCCTCTTTCTCTTCTGTCTCTCTCCCCTCTCTCT
T7_12566_G07	TTCCTCTCTCTTCTTCTGTCCTCTCCCTCTCTCTCT
T7_12567_G07	TCTTCTTTCCCTCTCTCGTCTCCTCTCTCTCTCTCT
T7_12568_G07	CTCTTCTCCTCTCCTCTGTCTCTCTCTCTTTCTCTC
T7_12569_G07	CTCTTCTCTCTCTCTTCGTCTCTCCTCTCTTTCTCC
T7_12570_G07	TTCTTCCCTTCTCCTCTGTCCTCTCTCCTCTCTTTC
T7_12571_G07	CTCTCTCTCTCTCTTTCGTCTCTCTCTCTTCCTCTC
T7_12572_G07	CTCTCTCTCTCTCTCCTGTCTCCCTTCTTCTCTTCT
T7_12573_G07	TCTTCCTCTCTCCCTTCGTCTCCTCCTCTTTCTCTT
T7_12574_G07	TTTCTCTCCTCCTCTTCGTCTTCTCTCCTTCCTCTC
T7_12575_G07	TCCTCTCTTTCCTCTTTGTCCTCTTCTCCTCCTCTC
T7_12576_G07	TTCTCTCTCCTTCTCTCGTCCTCTCTTTCCCTCTTC
T7_12577_G07	TTCTCTCTCTTTCTCTCGTCTCTCTCCTCTCTCCTC
T7_12578_G07	CTCTCTCTTCTCTCCCTGTCCTTCCTCTTTTCCTCT
T7_12579_G07	TCTCCCCTCTTTCTCTCGTCTTCCTCCTCTTTCTCT
T7_12580_G07	TCCTCCCCTCTTCTCTCGTCTCCTTCTTCTTCTTCT
T7_12581_G07	TCTCTCTTCTCTCTCCCGTCTCTTCTCCTTCCTCTT
T7_12582_G07	TTTCTTCTCCTCTCTCTGTCCTCTCTCTCCTCTCTC
T7_12583_G07	CTCTCCCTTTTCTCTTCGTCTCTTCTCCCTTTCTCC
T7_12584_G07	CTCTCTCCTCCCTTCCCGTCTTCTTCTTTCTCTTCT
T7_12585_G07	TCTCCTCTTTCCTCCTCGTCTCTCTCTCTCTCTCTT
T7_12586_G07	CTCTCTCTTTCTCTTCTGTCCCTCTCTTCTCTCTCC
T7_12587_G07	CTTCTCTTTCTCCTCCTGTCCTCTTCTCTCTCTCTC
T7_12588_G07	CTCTCTCTTCTTCTTCCGTCCTCTCTTCTCCCTCTT
T7_12589_G07	TCCCTCTCTCTCTTTCTGTCCTTCTCTCTCCTCTCT
T7_12590_G07	CTTCTCTTTCCTCCTCTGTCCTCTCTCTTCTCTTCC
T7_12591_G07	TTCTCCTCCCTTCCCTCGTCTCTTCTCTTCTCTCTT
T7_12592_G07	TCTTCTCTTTTCCTTTCGTCCCTCTCCCTCTCTCTC
T7_12593_G07	TTCTCTTTTCTCCCTCCGTCTCTCTTCTCTCTCCCT
T7_12594_G07	TCTCTCTCTTCTCTCTCGTCCCTTCTTCCTCTCTCT
T7_12595_G07	CCTCTCTTCTCTCTCTCGTCTCTTTCTCTCCTCTCT
T7_12596_G07	TCTCCTCTCTTCTTTCTGTCCTCTTCCTCTCCTCTC
T7_12597_G07	TCTCTCCTCTCTCTCTTGTCCCTCTCTTCTCCTTCT
T7_12598_G07	CTCTTTCTCTCCTCCCTGTCTCTTCTCTCCTTCTCT
T7_12599_G07	TTCTTCTCCCTCTCTCCGTCCTCTTCCCTCTCTTTT
T7_12600_G07	CTCTCTTCTCCTCTCCTGTCCTCTCTTTTTCCTCTC
T7_12601_G07	CTCTCCTCTTCTTTCTTGTCTCCTCCCTTTCCTCTC
T7_12602_G07	CCTCTCTCTTTCTCTTCGTCCTTTCTCTCCTTCTCC
T7_12603_G07	TTCTCTCTCTTCTCCCTGTCCTCTCTTCTCTCTCTC
T7_12604_G07	CTCTTCCCTCTCTTCTTGTCTCTCCTTCTCTCCTCT
T7_12605_G07	CTCTTCTCTTTCCCCTCGTCTTTCCCTCTCCTTTCT
T7_12606_G07	TCTCTCTCTCTCTTCTCGTCTCCTTCCCTCTCTCTT
T7_12607_G07	TCTCTCTCTTTCTTCCCGTCTCTCTCCTCTCTTCCT
T7_12608_G07	CTCTTTCTCTCTCTCTTGTCCCTCCTTCTCCTCTCT
T7_12609_G07	TCTCTTCCTCTTTCTCCGTCTCTTCTCCCTCTTCCT
T7_12610_G07	CTCTTCCTCTTCTTCTCGTCTCTCTCTTCCTCCTTC
T7_12611_G07	CTTTCTCTCTCCCCTTCGTCTTCCTCCTCTTCTCTT
T7_12612_G07	TCTTCCTCCTCTCTCTTGTCCCTTCCTCTCTCTTCT
T7_12613_G07	CCTCCTTCTCTTTCTCTGTCCTCTCTTCTCTCTCTC
T7_12614_G07	TTCTCCCTCTTCTCTTCGTCCTCTCTTTCCCTTCTC
T7_12615_G07	CTCTTTTCCCTTTCTCTGTCCTCTCTCTCTCCCTCT
T7_12616_G07	CCTTTCCCTTCTCTTCTGTCCTCTCTCTCTCTCTCT
T7_12617_G07	CTCTCTCCTCTTCTCCTGTCCTCTTCTCTTCTCTCT
T7_12618_G07	TCTCTTCTCTCTCTCCTGTCCTTCTCTCTTCTCTCC
T7_12619_G07	CTCTCTCTTCTTCTCTTGTCCCCTCTCTCTCTCTTC
T7_12620_G07	TCTCCCTCTCTTCTTTCGTCCCTCTTCTCCTCTTCT
T7_12621_G07	CTCTTTCTTCTTCTTTCGTCTTCTTCCCTCCCTCCC
T7_12622_G07	CCTCTCCTCTCTCTTTCGTCTCTCCTCTTCTCTTCT
T7_12623_G07	CTCTCCCTCTTTCTCTTGTCCTCTTCTCCCTTTCTC
T7_12624_G07	TCTCTCTTCTCTTCCTTGTCCCTCTCCTTCTCTCCT
T7_12625_G07	TCTCTTCTTCTCTCCTTGTCCTCTCTCCTCTTCTCC
T7_12626_G07	CTCTCCTTTTTTCCTTCGTCCCTTCTTCCCTCTCTC
T7_12627_G07	TTCTTTCTCCCTTCTCTGTCCTCCCTTCCTTCTTCC
T7_12628_G07	TCTCCTTCCCTTTTTCCGTCTCTCTCCTCTCCTCTT
T7_12629_G07	TCTTCTCTCTCTTCTTCGTCCTCCCTCTCTCTTCTC
T7_12630_G07	CTTCTCTCTTTCTCCTCGTCTCTCTCTCTTCTTCCC
T7_12631_G07	CTCTTTTCCTCTTCCCCGTCTCTCTCTCTTTCCTCT
T7_12632_G07	CCTTCTCTTTCCTCTCTGTCCTTCTCTCTCTCTTCC
T7_12633_G07	TCCTCCCTTCTCTCTTCGTCTTCCTCTTCTCTCTCT
T7_12634_G07	CTTCTCTCCCTCCTCTCGTCCTTCTCTTCTTTCCTT
T7_12635_G07	TTCTTCTTCTCCTCTCTGTCCTCCTCTCTCCTTCTC
T7_12636_G07	CTTCTCTTCTCTCTCCTGTCCTTCTCTTCCTCTCTC
T7_12637_G07	TCTCTCCCTCTCTTCCTGTCCTTTTCCCCTTTTCCT
T7_12638_G07	TCCTCTCTCTCTCTCCTGTCCTCTTCTCTCTCTCTT
T7_12639_G07	TCTTTCTCTCTCTCCTTGTCCTCTCTCCTCCCTCTT
T7_12640_G07	TCTTCCTCTCTTCTCTTGTCTCTCCCTTTCCCTCCT
T7_12641_G07	CTTCTCTTCCTCTTCCTGTCCCTCTCTCTCCTTCTT
T7_12642_G07	TCTCTCTCTCTCTCTCTGTCCTCCTCTCTCCTTCTT
T7_12643_G07	TCTCTTCCTTCTTCTCTGTCCTCCCTTCTCCCTCTT
T7_12644_G07	TTTCTCTCTTCCTCTCTGTCCTTCTCCTCTCCTTCC
T7_12645_G07	TCTCCCTTCTTCTCTTCGTCTCTCCTCTCTTCCTCT
T7_12646_G07	TCTTCCTCCTTCTCCTTGTCCTCTTCTCCTCTCCTT
T7_12647_G07	TCTCCTCTCTTCTCCTCGTCTTCTTCCTCTCTCTTC
T7_12648_G07	CCCTTTCTTCCTTCTTCGTCCTCTTCTTCCTCCTCT
T7_12649_G07	TCTCTCCTCTCTTCTCTGTCCCTTCTTCCCTTTCTC
T7_12650_G07	CTCTCCCTCTCCTCTCTGTCCTTCTCTTTCTCTCTT
T7_12651_G07	TCTCTCTCTCTTCCTCTGTCCTCTCCTCTTCTCTTC
T7_12652_G07	CTTCTCTTCTCTCTCTCGTCTTCTCTCTCTCTCTCC
T7_12653_G07	CCTCTTCCCTCTCCTTCGTCTCTTTCTCTCTTCCTT
T7_12654_G07	CTTCTTCTCTCTCTTCCGTCCTCTCTCCTCTCTTCT
T7_12655_G07	TCTCTCTCTCCTCTCTCGTCTTTCTCTTCCTCTCTC
T7_12656_G07	TCTCTTCTCCCTCCTTCGTCCTCTCTCTTTTCTCTC
T7_12657_G07	TCTCTCCTCTTTTCTCTGTCCTCCTCTCTCCCTCTT
T7_12658_G07	CCTCTCTTCTCTCTTCTGTCTCTCTTCTCCTCTCTC
T7_12659_G07	TCTCTCTCCTTCTCTCCGTCTCTTCTCTCTCTCTCT
T7_12660_G07	CCTCTCTCTTCTCTTTCGTCTCCTCTCCTCTCTTCT
T7_12661_G07	TCTCTTCTCCCCTTTCTGTCCTCTCTTCTCTCTTCC
T7_12662_G07	TCTCCTCTTTTCTCTCCGTCCTCTCTTCCCCTCTTT
T7_12663_G07	TCCCTCTCTCTCTCTCTGTCTCTCTCTTTCTCCTCT
T7_12664_G07	CTTCTCTCTCTCTCCTCGTCTCTCTCTTCTCTCTCT
T7_12665_G07	TCTCCTTCTCTCCTTCCGTCTCTCTTCCTCTCTCTT
T7_12666_G07	CTTCCTCTCTCTTCTCCGTCTTCCTCCTTCTTCTCT
T7_12667_G07	TTCCTTCCTTCTTCTTCGTCCCTCCTCCTCTCTCTT
T7_12668_G07	CTCTCTCTCCTCTCTTCGTCCTCTTCCTCTTCTTCT
T7_12669_G07	CTTCTCCTCTCTCTCTCGTCTCTCTTCTTTCCTCCT
T7_12670_G07	CTCTTCTCTCTCTCTCTGTCCTTTCTTCTTCTCCCC
T7_12671_G07	CCTCTTTTCTCTCCTTCGTCTCTCCTTCCTCTTTCC
T7_12672_G07	CCTTTCTCTCTCTCTCTGTCCCTCTCTTCTCTCTTC
T7_12673_G07	CTCTCTTTCTCTCTCCTGTCCCTCCTCTCTTTTCCT
T7_12674_G07	TCTCTCTCTCCTCTCTCGTCTCTCTTCTCTCTCTTC
T7_12675_G07	TCCTCTCTCTCTCCTTTGTCCCTCTCCCTTTCTTCT
T7_12676_G07	TCCTTTCCCTCTCCTCTGTCTCTCCTTTCTCCTTCT
T7_12677_G07	TCTTCTTTCCCTTTCCTGTCCTCTCTTCTCTCCCTC
T7_12678_G07	TTCTTCCTTCTCCTCCTGTCCTTCTCTCTCTTCTCC
T7_12679_G07	CCTCTCTCTCCTCTTTCGTCTTCCTCTCTTCTTCCT
T7_12680_G07	TCTCTCTTCTCTCTTCTGTCCTCTCTTTCTCCCCTC
T7_12681_G07	TCTCTCTTCTCTCTCTCGTCTCTCTCCCTCTCTCTT
T7_12682_G07	TCTTCTCTCTCCTCCTCGTCCTTCTTCTTTCTCCTC
T7_12683_G07	TCTCTCTCTTCTCTCTCGTCTCTCTCTCTCTCTCTC
T7_12684_G07	CTCTTCTCTCCTCTCTTGTCCCTTCTCTCCTCTCTT
T7_12685_G07	TCTTCCTCTCTCTCCCCGTCTCTCTTTCTCTTCTCT
T7_12686_G07	CTCTCTTCCTTCTCCTCGTCTCTTCTCCTTTCTCTC
T7_12687_G07	TCCTCTTCTCTTCTCTCGTCTTTCTCTCTCTCTCCC
T7_12688_G07	TCTCTCTCTCTTCTCTCGTCTCCTTCTCTCCTTCTC
T7_12689_G07	CTTCTTCTCCCTCTCTTGTCCTCTCTTCCTCTTCCT
T7_12690_G07	TCTCCTTCTCTCTCTCTGTCCCTTCTCCTCTCCTTT
T7_12691_G07	TCTCTCCCTCCCTTTCTGTCCTTTCTCTCTTCTCCT
T7_12692_G07	TTCTCTTCTCTTCCCTCGTCTCTTCTCTCTCTCCTC
T7_12693_G07	CCTTCTCTCTCTCTTCTGTCTCTTCTCTCCTCTCTC
T7_12694_G07	TCCTCCTCTTTTCTCCTGTCCTCTCTCTCTTCTCCT
T7_12695_G07	CTCCTCTCTCTTTTCTCGTCTCTTCCTCCTCTTCTC
T7_12696_G07	CTCTCTCTCTCTCTCCCGTCTTCTTTTCTCCTCTCT
T7_12697_G07	TCTCTCTTCTTCTCTTCGTCCTTCCCTCTCTCTCTC
T7_12698_G07	TCTCTCCCTCTCTCCTTGTCCTCTCTTTCCTCTCTT
T7_12699_G07	CTCTCTTCTCTCTCTTTGTCCTCCCTCCTCTCTCTT
T7_12700_G07	TCTCTCTCCTCTCCTCTGTCTCTCTTTCTCTTCCTC
T7_12701_G07	CTCTTTCCTCCCTCTTTGTCCTCCTCCTTCTTCTTC
T7_12702_G07	TTCTCTCCCTTCTCCTCGTCTCTCTCTCTCTTCTCT
T7_12703_G07	CTCTCCCTCTCTTCTTTGTCCTCTTCCTCTCTCTCT
T7_12704_G07	TCTCTCTTCTCTCTCTTGTCCCCTCCTCTCTTCTCT
T7_12705_G07	CTCCTTCTCCTTCTCTCGTCTTCTCCTCTCTCCTTT
T7_12706_G07	TCTCCTTCCTCTCTTTCGTCTCTCTCTCTTCTCCCT
T7_12707_G07	TCTCTCCTCTCTCCTTCGTCTCTTCTTCTCTCCTCT
T7_12708_G07	CTCTTCCTCTCTCTTCTGTCTTCTCCCTTCTCCTCT
T7_12709_G07	TCTCTCTCTCTCTCTCTGTCTCTCTTCTCTCTCCTC
T7_12710_G07	CTTCTTCCTCTTCCTTTGTCCCTCTTTCTCCTCCCT
T7_12711_G07	CCTCCTCTCTCTCTCTTGTCTCTTCTTCTCCTCTCT
T7_12712_G07	CCTCTCCTCTCTTTCTCGTCTCCCTTCTCTTCTTCT
T7_12713_G07	TCTTCTCCTTCTCTTCTGTCCCTTCCTCCTCCTCTT
T7_12714_G07	TCTCCTCTTCCTCTCCCGTCTTCTCTTCTTCTCTCT
T7_12715_G07	CCCTCTCTCTCTCTTTCGTCTCTCTCCTCTTTTCTC
T7_12716_G07	CTTCTCTCTCTCTTCTCGTCCTCTTCCTTCTCTCTC
T7_12717_G07	TTCTCTCTCCCTTCCTCGTCCCTCTCCTTCTTCTTT
T7_12718_G07	TTCTCTCTCCTCTCTCTGTCCTCTTCCCTCTTCTCT
T7_12719_G07	TTCTCTTCTCTCTTTTTGTCCTCCCTCTCCTCTCCC
T7_12720_G07	CTCTTCTTTCTTTCTCTGTCTCTCCCTCCTCTCCTC
T7_12721_G07	TTCTCCTTTCTCTCTCTGTCTCTCTCTCCTCCCTCT
T7_12722_G07	CCTTCTCTCTCTCCTCTGTCCTCTTCTCTCTCTCTT
T7_12723_G07	TCTCTCCTTCTCTCTCTGTCTTCTCCCTTTCCTCCT
T7_12724_G07	TCTCTTCTCTCCTTCTCGTCCTTCCCTTCTCTCTCT
T7_12725_G07	CTTCCTCTCTCTCTTCTGTCCCTCTTCTTCTCTCTC
T7_12726_G07	CTTCTCCTCTTCTCTCTGTCTTCTCTCTCTTCCTCC
T7_12727_G07	TCTTCCTCTCCTCTCCTGTCCTTCTCTTTCTTCTCC
T7_12728_G07	TCTCTTCTCTCCTCCTCGTCTCTCTTCTTCTCTCCT
T7_12729_G07	CTCTCTCCTCCTCTCTCGTCTTCTCTTTCCTTCTCT
T7_12730_G07	TCTCTTTCTCTTCCTCTGTCCCTCCTTCTCTCTCCT
T7_12731_G07	TTTCTCTCTTTCCCCTCGTCCTCCTTTCTCTCTCTC
T7_12732_G07	CCTCTCTTTCTTTCTCTGTCCCTCCTTCTCTCTCTC
T7_12733_G07	TCTCCTCCTTCCTTCCCGTCTCTCTCTCTTTCTTCT
T7_12734_G07	TCTCTCTCCTCTCTTCTGTCCTTCTCCCTTCCTTCT
T7_12735_G07	CTCTCTCTCTCTCTCTTGTCCTCTCTTCTCCTCTTC
T7_12736_G07	CTCCTTCTTTCTCTCTCGTCTCTCTCCTCTTCTTCC
T7_12737_G07	TCTCCTTCTCTCTTCTCGTCTTCCTCTCTCTCCTTC
T7_12738_G07	TTTCCTCTCTTTCTCTCGTCCTTCCCTCTCTCTCTC
T7_12739_G07	TCTCTCCTCTCTCTTCCGTCTTCTTCTCTCTCTCTC
T7_12740_G07	CTCTCTCTCTCTTCTCTGTCCTTCCTCTTCCCTCTT
T7_12741_G07	TCTCCTTCTCTTTCTCTGTCCTCTCCTCCTTCTCTC
T7_12742_G07	CTCTCTCTTCTCCTCTCGTCTCTCTTTCTCTCCTCT
T7_12743_G07	TCTCTCTTCTCCTCTTCGTCTCCCTTCTTCTCTCTC
T7_12744_G07	TTCTTCTCCCTCTTCTCGTCTCTCTCTCTCTTCTCC
T7_12745_G07	TTCTCCTCTCTTCTCTCGTCTCCCTTCCTCTTCTCT
T7_12746_G07	TCTCTTCCTTCTCTTCTGTCCTCCTCTCTCTCTCTC
T7_12747_G07	TCTTCTCTCTCTCCTTTGTCCCTCTTCTCTCCTCTC
T7_12748_G07	TCCCTCTCTCCTCTCTCGTCTCTTTCTCTTTCCTCT
T7_12749_G07	CTCTCTCCTCTTCTCTCGTCTCTCTCTCTCTTCCTT
T7_12750_G07	TCCTCTTCTCCTCTCTCGTCTCTCCTTCTTCTCTCT
T7_12751_G07	CTCTCCTCTTCTCCTCTGTCCTTCCTCTTTCTCTCT
T7_12752_G07	TCTTCCTCTTCTCTCTCGTCCCTCTCTCTTTCTTCC
T7_12753_G07	CCTCTCTCTTCTTCTCCGTCTCTTCCTCTCTCTCTT
T7_12754_G07	CTCTTCTCCTCTCTTCTGTCCTCTTCCTCTTCTCTC
T7_12755_G07	TCCCTTCTTCTCTCCTCGTCCTCCTCTTCTCTCTTT
T7_12756_G07	TTCTTTCTCCTCCTCTCGTCTCTCCCTCTTCTCCTT
T7_12757_G07	CCTCTTCTTTCTTCCTCGTCTCCTCTTTTCCTCTCC
T7_12758_G07	CTTTCCTCTTCTCCTCCGTCTCTTTCCTCTCTCCTT
T7_12759_G07	TCCTCTCTCCTTCTTTTGTCCTTCTTCCTCCCCTCT
T7_12760_G07	CTTCTCCTCTCTTCCTCGTCCTTTCTTTTCTCCCTC
T7_12761_G07	TTCTCTCCCTCTCTTCCGTCTCTCTCTCTCTCTCTT
T7_12762_G07	TCCTCTCTCTCTTCTCCGTCTTCTTCTTCCTCCTCT
T7_12763_G07	CCTCTTTCTCTTTCCCTGTCCCTCTTCTCTTCTCTC
T7_12764_G07	CTCTTCCTCTCTCTCTTGTCTCTTCCCTCTCTTCCT
T7_12765_G07	TCCTCTTTCTCTCTCCTGTCCCCTTCTTCTTCCTCT
T7_12766_G07	TCCTCTTCTCCCTCTCTGTCTCTCTCCTTCTTCTCT
T7_12767_G07	TCTCTCTCTCTCCTTCTGTCCTCTTTTCTTCCCCTC
T7_12768_G07	CTTTCTCTCTCCCTCTCGTCTTCTCTCTCTTCTCTC
T7_12769_G07	TCTCTTCTCTTCTCTCCGTCTCCTTCCCTTCCTTCT
T7_12770_G07	TCCTCTCTCTCTTCTCTGTCCTCTTTCCTTCTCCTC
T7_12771_G07	TCTCTCTCTCCTCTCTCGTCCCTTTTCTCTCCTTCT
T7_12772_G07	CTCTCTCCCCTCTCTTCGTCTTCTCTTTCCTCTCTT
T7_12773_G07	CTTCTCTCTTCTTCTTCGTCTTCCCTCTCCCTCTTC
T7_12774_G07	CTTTCTTCCTCTTCCTCGTCTCCTCTCTCTCTCTCT
T7_12775_G07	CTCTCTCTCTCTTCTTTGTCCCTTCCTTCCTCTTCC
T7_12776_G07	CTCTTTTTCTCCTCTCTGTCTTCTCCTCCCCTCTCT
T7_12777_G07	TCCTCTTTCCTCTCTTTGTCCTTCCCTCTTCTTCCC
T7_12778_G07	CTTCTTCTTTCCTCTCTGTCCTCCTTCTCCTTCTCC
T7_12779_G07	CTCTCCTTCTCTCTCTTGTCCTCTTTCCTCTCTCCT
T7_12780_G07	TCCTCTCTTCCTTTTTCGTCTCCTTCTCTCCCTCTC
T7_12781_G07	CTTCTCTCCCTCTTCTCGTCTCCTTTCTTCTCTCTC
T7_12782_G07	CTCTTCTCTCCTCTCTCGTCTCTTTCTTCCCTCTCT
T7_12783_G07	TTTCTCTCTCCTTCTTTGTCCTCCCTCTCCTCCCTT
T7_12784_G07	CTTCTCTTCTCTCTCTCGTCTTCTCCTCTCTCCTCT
T7_12785_G07	TCTTCTCTTCTCTCCCTGTCCTCTCTTCTCTCCTCT
T7_12786_G07	TTTCTCCTCTCTCTCTCGTCCTTCTCCTCCTTCTCT
T7_12787_G07	CTCCTTCTTCTCTTTCCGTCCTCTCTCTTCCTTTCC
T7_12788_G07	TCTCTCCTTCTCCTCTCGTCTCCTCTTCTCTTCTCT
T7_12789_G07	CTCTTCTCTCTCCTCTCGTCTCCCTTCTTTTCTCTC
T7_12790_G07	TCCTCTCTCTCTTCTCTGTCTCCTCTCTTCTCTCTC
T7_12791_G07	CTTCTCTCTCCTTCTCTGTCTTCTCTCTTCCTCCTC
T7_12792_G07	TCTCTCTCCTCTTTCTCGTCCTTCCTTCTCTCTCCT
T7_12793_G07	CCTCTTCCTCTTCTCTCGTCTCTCTTCTCCTCTTTC
T7_12794_G07	CTTCTCTCTCTCTCCTCGTCTTCCTTTCCTCCCTTT
T7_12795_G07	CCTCTCTCTCTCTCTCCGTCCTCTTTCTCTTCTCTT
T7_12796_G07	TCCTTCTCTCTCTTCTCGTCCCTTCTCTCTCTCTTC
T7_12797_G07	CTCTTTTCTCTCTTCTCGTCTCTCCCTTCTCTCCCT
T7_12798_G07	CTCCTCTTTCTCTCTCTGTCCTCTCCTCTTTCTCTC
T7_12799_G07	CTCTCTCTTTCTCTCCTGTCCTTCCCCTTCTCTCTT
T7_12800_G07	TCTCTCTTCTCTCCCTCGTCTCCTCTTTCTCCTTCT
T7_12801_G07	TCTCTTTTCTCTTCCCCGTCTTCTCTTCCTCTCCCT
T7_12802_G07	TTCTCTCCCTTCCTCCCGTCTCTCCTTTCCTTTTTC
T7_12803_G07	CTTCCTTCTCTCTCTTCGTCCCTTCTCCCTCTTCTT
T7_12804_G07	TCTCTCTTCTCTCTTCTGTCTCCTCTCCTTCTCTCC
T7_12805_G07	CTCTCCTCTTCTCTCTCGTCCCTCTCTTTCTCTTCT
T7_12806_G07	TCTCTTCTCTCTCCTCTGTCCTCTCCTTCTTCTCCT
T7_12807_G07	TTCCTCTCCCTTTCCTCGTCTTTCTCTTTCCTTCCC
T7_12808_G07	CTTCTTTCTCTTCCTCTGTCCTCCTCTCTCTCCTCT
T7_12809_G07	CCTCCCTTTCTCTTTTCGTCTCCCTTTCTTTCCCTC
T7_12810_G07	CTCTCTCCTTCTCCTTTGTCCTTCTCTCTCCCTCTT
T7_12811_G07	CTCCTCTTCTTCTCCTTGTCCTCCTTCTCCCTTCTT
T7_12812_G07	CTTTCCTCTTCTCTTCCGTCCCTCTTTCTCTCTCCT
T7_12813_G07	CCCTCTTCTCTTTCTCTGTCTCTCTCCTCTCCTCTT
T7_12814_G07	CTCTCCTCCTCCTTCTCGTCTCTCTCTCTCTTCTTT
T7_12815_G07	TTCTTCTTCTCTTTCTCGTCTCCTTCCCTCCTCCTC
T7_12816_G07	CTTTTTCCTCTCTTCTCGTCTCCTCCTCCTTCTCCT
T7_12817_G07	CTCTCTCCCCTTCTCCTGTCTCTCCTTTTCTCTTCT
T7_12818_G07	TTCCTCTTCCTTCTCTTGTCCCTCTTCTCCTCTCTC
T7_12819_G07	TCTCTTTTCCCCTCTTTGTCCTTCCCTCTCCCTTCT
T7_12820_G07	TCCTCCCTTCTCTTCTTGTCCTCTCTCTCTTCTCTC
T7_12821_G07	TCCTCCTCCTTCCTTTTGTCCTTCTCCTCTCTTCTC
T7_12822_G07	TTCTCTTTCTCCTCCCCGTCTCTCTTTCTCTCTCTC
T7_12823_G07	TCCCCTCTCTTTCTCCTGTCTCTCCTCTCTTCTTCT
T7_12824_G07	TCTCCTTCTTCCCTCTCGTCTCTCCTTTCTCTCTCT
T7_12825_G07	TCCTCTTTCCCTCTTCTGTCCTCCCTCTTCTTCTTC
T7_12826_G07	TCCTCCTTTCTCTTTTCGTCCTCTCCTTCCTCTCTC
T7_12827_G07	TCTCTCTCTCCTCCCTCGTCTCTTCTTCTCCTCTTT
T7_12828_G07	CTCCCTCTCTCTCTCTCGTCCTCTTCTTTCTCTTCT
T7_12829_G07	TTCCTCTCTCTTCCTTCGTCCTCTCTTTCTCCCTCT
T7_12830_G07	TCTTTCTCTTCCCTCCTGTCCCTCTCTTTCCTCTTC
T7_12831_G07	TCCTTCTCTTCTTCTCCGTCTCTCCTCCCTTTTCCT
T7_12832_G07	CCTCCTCCCTCTCTCTTGTCCTTTCTCTCTTCTCTT
T7_12833_G07	TTCCTCCTCTCTCTCTCGTCCTCTTCTCTTTCTCTC
T7_12834_G07	TTCCTCTCTCCTTCTCTGTCCTCTCTCTTTCCTCTC
T7_12835_G07	TCTCCTTTTCCCCTCCCGTCTTCCTTTCTCTTCCTT
T7_12836_G07	CTCTCTTCTCCCTCTTCGTCTCCTTCCTCTCTTTCT
T7_12837_G07	CCTTCTCTTTCTCTCTCGTCTCTTTCTCTCTCCCCT
T7_12838_G07	CTTTTCCTCTCCTCTCTGTCCTTCCTTCTCCTCTTC
T7_12839_G07	TTCCTCTCCCTTCTCTCGTCTCTTTTCCTTCCTCTC
T7_12840_G07	CTCTCTCTTCTTTTTCTGTCCCCTCTCTCCCTCTCT
T7_12841_G07	CTCTCTCTCCCTCCTTTGTCCTCTCCTCTTTTCCTT
T7_12842_G07	TCTTCTTTCTCCCTCTCGTCTCTTCTCTCTCCCTTC
T7_12843_G07	TCCCTCTTCCTCTTCTTGTCCTTCTTTCCTCTCCTC
T7_12844_G07	TCTCTTCCTCTCCTCCTGTCCTTCTCTCTTCTCTCT
T7_12845_G07	CTCTCCTCTCCTCCTCCGTCCTCTTCTCTTTTTTTC
T7_12846_G07	CCCTCTCTCTCTCCTCTGTCCTTCTCCTTTTCTTCT
T7_12847_G07	TTCTTCTCTCCTTCCCTGTCCCTCTCTCTCTTCTCT
T7_12848_G07	TCCTCTCTCTTCCCTCTGTCTTCTCTCTTTCTCTCC
T7_12849_G07	TCTTCTCTCTCTCCTTTGTCTTCTCTCCTCCTCTCC
T7_12850_G07	CTCCCTCCTTCTCCTTCGTCTCTCTCTTCTTCTCTT
T7_12851_G07	TCTCTCTTCCTCTTCCTGTCCTCCTCTCTTCTCTCT
T7_12852_G07	TCCTTCTCCTCTCTCTTGTCTCTCCTTCTTCTCCTC
T7_12853_G07	TCTCTCCTCTCTTCTTCGTCCCTCTTTCTTCTTCCC
T7_12854_G07	CTTCTCCCTCTCTTTCTGTCCTCTTTCCTCTCCTCT
T7_12855_G07	CTTCTCTTCTCTCCCTTGTCCTCTCTCTCTCCTCTT
T7_12856_G07	CCTCCTCCCTCTCCTTTGTCCTCTTCTTCTCTTTCT
T7_12857_G07	TCCTCTTTCCTCTCCCTGTCTCCCTCTCTTTCTTTC
T7_12858_G07	CCTCTCTCTTCTTTCTCGTCCCTCTCCTTCTCTTTC
T7_12859_G07	TTTCTTCCCTCCCCTCCGTCTCTTCTCCTCTCTTTT
T7_12860_G07	CCTCTTCTCTTCTCCTCGTCCTCTCCTCCTTTCTTT
T7_12861_G07	TCCTCTTTCCTTCCCCTGTCCTCTTTCTCTCTTCCT
T7_12862_G07	TCCTCTCCTTTCTCCTCGTCTCTCCCTCTTTCTTCT
T7_12863_G07	CCTCTCTCCTTCTTCTTGTCCTTCCTCTCTCTTCCT
T7_12864_G07	TCTCTCTCTTCTCCTCTGTCCTCCTCCTCCTCTTTT
T7_12865_G07	TCTCCCTCCTTTCCTCTGTCCTCTCCTTTCTTCCTT
T7_12866_G07	CTCCCTCCTCCTCTCTCGTCTTTTTCCTCTCTTCTT
T7_12867_G07	TCTCCTCTCTCTCCTTCGTCCTCTTCTTCTCTCTCT
T7_12868_G07	TTCTTCTCTCTCTCCTTGTCCCCTTCCTCTCTCTCT
T7_12869_G07	TCTTTCCTTCTCTCCCTGTCTCTCTCCTCTCCTTTC
T7_12870_G07	TCCTCCTTCCTCCTTCTGTCCTTCTCTCTTCTCTCT
T7_12871_G07	TCTCTCCTCCTTCTTTCGTCTCTCCTCCTCTCTTCT
T7_12872_G07	CCTCTCTTTCCTCTTCTGTCCCTTCCTCCTTTTCCT
T7_12873_G07	CCTCCTTTCTTCCCTCTGTCTCTTCCTCCTTTCTCT
T7_12874_G07	CTCCTCTCCTTTTCTCCGTCTCTCTCCTCCTTTTCT
T7_12875_G07	TCTCTCTTCTCTCTTCTGTCCTCTTTCTCCCTCTCC
T7_12876_G07	CTCTCTTCCTCTTCCTCGTCTTTTCCTCCTTCTCTC
T7_12877_G07	CTTTTTCTCCTCTCTCCGTCCTCTCTCCTCTCTCTT
T7_12878_G07	TCCCTCCTCCTCTTCTCGTCTTCTCTCTCCTTTTCT
T7_12879_G07	CTCTCTTTCCTTCTCTTGTCTTCTCCCCTCTTCTCC
T7_12880_G07	CCTCCTTCTTTCTCTCTGTCCTTTTCTCTCTCTCCC
T7_12881_G07	TTCTCTCTCCCCTTCCTGTCTCTCCTCTTCTCTCTT
T7_12882_G07	TCTCCTCTTCTCTCTTCGTCTCTCCTCTTCTCTCCT
T7_12883_G07	TTCTCCTCTTCTTCTTCGTCTCTCCCTCTTCCCTTC
T7_12884_G07	CCTTCTCCTCTTTCCTTGTCCTCTCTCTCTTCTCTC
T7_12885_G07	TTCTCTCTTCTCTCTCTGTCCCTTCTCTCCCCTCTT
T7_12886_G07	CTCTTCCTCTTTCTTCCGTCTCTTCTCCTTCTCCTC
T7_12887_G07	TCCTCTTTTTCCCCTCTGTCTCCCTCCCTTCTTTCT
T7_12888_G07	TTTCTTCTTCTCCTCTCGTCTTCTCTCTCCCTCCCT
T7_12889_G07	CTCCCTTTCTCTCTCCTGTCTCTCTCTTCCTTCTCT
T7_12890_G07	TCTCTCCTCTCTTCTCTGTCTCTTTCCTCTCCCTCT
T7_12891_G07	CTCTCTCCTCTTCTCTTGTCTCTCTCTCCCTCCTTT
T7_12892_G07	TTCTTCTCCTCTCTCTTGTCCTCCTCTTCCTCTCTC
T7_12893_G07	TCCCCTCCTCTCCTCTTGTCTCTCTCTTCTCTTTTC
T7_12894_G07	TCTCTCTCTCTCTCTCTGTCCTCTTTCTCCCTTCCT
T7_12895_G07	TCCTCCTCTTTCTCTCTGTCTCCTTCTCCCTCTTCT
T7_12896_G07	CCTCTTTTCCCTTCTCTGTCTCTCTTTCTCCCTTCC
T7_12897_G07	CTCCTTCCTTTCCCTCTGTCCTCTCTCCTTTTCCTT
T7_12898_G07	TCTCTTCCCTCTCTCCTGTCCCTTTCCTCTCTTTCT
T7_12899_G07	CTCTTCTTCTCTCTTCCGTCCCTTTCTCCCTCTTCT
T7_12900_G07	CCTTTCTCTTCTCTTCCGTCCCTTCCTCCTCTTTCT
T7_12901_G07	TTCCCTCTCCTTCTCTTGTCCCTCTCTCCTTCTTTC
T7_12902_G07	TCTCTCTCTCTTCTCTTGTCCCCTCTTCTTCTCCTC
T7_12903_G07	CTTTTCTCTCCTCCTCCGTCTTCTTCTCCTCTTTCC
T7_12904_G07	TCTTCTTCCTCTCTCCCGTCTTCTCTTCTCTCTCTC
T7_12905_G07	TCTTCCTCTCTTCTTCTGTCCTTCCTCCTCTCTCTC
T7_12906_G07	CTCTCCTCTTCTCTCCTGTCTCTTCTTCCTCTCTCT
T7_12907_G07	CTCTTCTTCTCTCCCTCGTCCTCTCTCTTTTTCTCC
T7_12908_G07	CTTCTCTCTTCTCCTCTGTCTTCTCTCTCTCTCCTC
T7_12909_G07	TTCTCCTCTCCTCTCCTGTCCTTTCCCTTCCTTCTT
T7_12910_G07	CTCCCTTTCTTCTCCCTGTCTCTCTTCTTCCCTTTC
T7_12911_G07	TCTCCCTCCTTTCCCTCGTCTCCTTCCTTCTCTTTT
T7_12912_G07	TCCTTCTCTCTCCTCTTGTCTCTCTCTTCCTTCCTC
T7_12913_G07	TCTTTCTCTTTCTCTCTGTCCTCTCTTCCTCCCTCC
T7_12914_G07	CCTCCTCTCTTTCTTCTGTCCCTCTCTTTTCTCCTC
T7_12915_G07	CCTTCCCCTTTCTCTCCGTCTCTCTTCTTCTCTTCT
T7_12916_G07	TCTCTCCTTCCTCTCTCGTCTTCTTCTCCTCCTTCT
T7_12917_G07	CTCTCCCTCTTTCTTCCGTCTTCCCTTTCTTTCCTC
T7_12918_G07	CCTCTTTCTTCCTCCTTGTCCTTCTTCTTCTCTCCC
T7_12919_G07	CTCTCCTCTTCCCCTCTGTCTTTCTCTTCTCTTCCT
T7_12920_G07	CTCTTTCCTCTCCCTTCGTCCCTTCTTCTCTTCTCT
T7_12921_G07	CTCTCTCTCTCTTTCTTGTCCCTCTCTTCCTCCTCT
T7_12922_G07	TTCTTCCCTTTTTCTCCGTCTCCTCTCTCCTCCTCT
T7_12923_G07	CTTTCTCCTTCTTTCTCGTCCTTCCCTCTCTTTCCC
T7_12924_G07	TCCTCTTTTTCCCTTTCGTCTTCCTTCCTCCCCTTC
T7_12925_G07	TCTCTTCTTCTCTCTTCGTCTCTCTCTCTCCTCCTC
T7_12926_G07	TCTTCTTCCCTTTCTTCGTCTCCCTCCCTCCTTTCT
T7_12927_G07	TCCTTCTCTTTCTTCTCGTCTCTCCCTTCCCTCTTC
T7_12928_G07	TCCCCTCTTCCTTTCTCGTCCTTTTTCCTTCCTCCT
T7_12929_G07	CTTCTTCTCTCTTCTCCGTCTCCTTCCCTTCTCCTT
T7_12930_G07	CTTTTCCTTCTTCCCTTGTCCCTCTCCTTCCTCTCT
T7_12931_G07	TCTTCTCTTTTCTCTCTGTCCCCTTCTCCTCTCTCC
T7_12932_G07	CCTCCCTTCCTCTTCTTGTCCTTTCCCCTTCTCTTT
T7_12933_G07	CCTTCCTCTCTTCTCTCGTCTCCTTCTTCTCCTTCT
T7_12934_G07	TCTTCCCTCTTTCTCTCGTCCTCTTCCCTTCTCTTC
T7_12935_G07	CTCTTCCTTCTCCTCCTGTCCTCCTTTCTCTCTTTC
T7_12936_G07	TCTTTCCTTCTCCTTCTGTCCTCCTCCTCCTCTCTT
T7_12937_G07	TCTTCTTCTTCCTCCTCGTCCTTTCCTCTTTTCCCC
T7_12938_G07	TTCCTCCTTTCCTCCTTGTCCTCTTCTCCTTCTCTC
T7_12939_G07	CTCTTTCTTTCTTTCTCGTCCTTCCCCTTCCTCCTC
T7_12940_G07	CTCTCTTCTCTCTCTTTGTCCCTCTCTCTTTCCCTC
T7_12941_G07	TCCTCTTTCCTCTTTTTGTCCTTCCCCTCTCCTCTC
T7_12942_G07	TTTTTTCTCCTCCTTCCGTCTCCTCTCTCCCTCTTC
T7_12943_G07	CTCCCTTCCCTTTCTTCGTCTTCCTCCTTTCCTTCT
T7_12944_G07	CTCCTCTTCTCTCCCCTGTCTTTCTTCTCTTCTCTC
T7_12945_G07	CTTCCTTCCTCCTTTCTGTCCCTTCCTTCCTCTCTT
T7_12946_G07	TCTCTCCTCTCCTCTTCGTCTCCTCTCTTCTTCTCT
T7_12947_G07	TCCCTCTCTTTCTCTTCGTCTTCCTCCCTCTTCTTC
T7_12948_G07	TTTCTCTCCTCCTCTCTGTCCTCTCTTCTTTCCTCC
T7_12949_G07	TCTTTTCCTCTCTCCTCGTCCTCTCTCTCTTCCTTC
T7_12950_G07	TCCTCTCCTCTCTCCTCGTCTTCCTCTCTCTCTTTT
T7_12951_G07	TCTTCTTCCTCTTTCCTGTCCTCCTCTTCCTCTCTC
T7_12952_G07	CTCTTTCCTTTCTCCTCGTCCCTTTTCCCCTTTCTC
T7_12953_G07	TTCCCTTTCCTTTTCTCGTCCCTTCCTTTCTCCTCC
T7_12954_G07	CCTTCTCCTCCCTTTTTGTCTTCCTTCTCCCTTCTC
T7_12955_G07	TTTTCTCCTCTCCCTCTGTCCTTCTCTCTTCCTCTC
T7_12956_G07	TCTTCTCTCTCTCTCCCGTCTCTTCCTTCCCTTTCT
T7_12957_G07	TCCTCTCTCTTCTCCCTGTCCTCCTTCTCCTTTTCT
T7_12958_G07	CTCCTTCTCCCCTCTTTGTCCTCTCTTTCTTCCTTC
T7_12959_G07	CTTTCTTTTCTTCTCCCGTCCTCCTCTTCCTCTCCT
T7_12960_G07	CTCCCTTTTCTTTCCTCGTCTTCCCCTCTCTCTCTT
T7_12961_G07	CTTTCCTCCTCTCTCTTGTCCCTCTCCTTTCTTCTC
T7_12962_G07	TCTCTCCCCTCTTCTCCGTCTTTTCTCTTTTCCCTC
T7_12963_G07	CTTCTCCCTCTCTCTTTGTCCTCTCTCTCTCCTTTC
T7_12964_G07	CTTTCCTTCCTCTCCTCGTCTCTTCTCCCCTTCTTT
T7_12965_G07	CCTCTCTTTCTCTCCCCGTCTCTTCTCTTTTTCTCC
T7_12966_G07	TCTCTCCTTCCTTCTCTGTCCCTCCCTTCTTCTCTT
T7_12967_G07	TCTTCCCTCCTTTCCTTGTCCTCTCCCTTCTCTTCT
T7_12968_G07	CTTTCTCTCCTCCTTCCGTCTTCTTCTCTCCTCTTC
T7_12969_G07	TTCTCTCTCTCTTCTCTGTCCCCTCTCTTTCTCCTC
T7_12970_G07	TCTCTCTTCTCTTCCTCGTCTCTCTCCTCTTCCCTT
T7_12971_G07	CTCTTCCTTCTCTTTCTGTCCTTCTCCTCTCTCTCC
T7_12972_G07	TCCTTTTTCTCTCTTCTGTCCTCTCTCCTCTCTCCC
T7_12973_G07	TTTCTCTCTTTCTCTTCGTCTCCCTCCTCTCTCCTC
T7_12974_G07	TCTTTTCTTCCCTCTTCGTCTCCCTCTCTCTCTCTC
T7_12975_G07	CTCTCCTCCCTCTCCTTGTCTCTTTCTCTTTCTCCT
T7_12976_G07	TCCTTCTCTCCTCTCCTGTCTCTCTCTCTCTCTTCT
T7_12977_G07	TCTCTTTCCTCTCCTCCGTCTTCTTCTCCTCTTCTC
T7_12978_G07	CCCTCTTCCTCTCTCTTGTCCTTTCTCTTCCCTCTT
T7_12979_G07	TCCTTTCCTCTTCTCTCGTCTCTCCCTCTTTTCTCC
T7_12980_G07	CTCCCCTTTTTTTCTTTGTCCTCTCCCCTCTCTCTC
T7_12981_G07	CTCTCTCTCTTCTCTCTGTCCTTCTCTCTCTCTCCT
T7_12982_G07	TCTTCTTTTCCTCCCTTGTCCTTCTCTCCCTCCTTC
T7_12983_G07	CTCTCTCCTTCTCTCTCGTCCTCCTTTCTCTCTTCT
T7_12984_G07	TTCTCTCCTCTTCTTCTGTCCTCTTCTCTCCCTCCT
T7_12985_G07	CTCTCTCCTTCTTTCTCGTCCCTCTTCTCTCTCTCT
T7_12986_G07	TCTCTTCCTCTTCTTCTGTCTCCTCTTTTCCCTCCC
T7_12987_G07	CCTCTTCTTCCTCTCTCGTCTTCCCCTCTTTTCTCT
T7_12988_G07	CTCTCCTTCTCTTCTCTGTCCTCTCCTTCCTTCTCT
T7_12989_G07	CCTTCTCTCTCTCTCTCGTCTTCTCTCTCCCTTTTC
T7_12990_G07	TCTCTCTCTCTCTCTCTGTCTCTCCTTCCTCTCTTC
T7_12991_G07	CCTCTCTTCCTCTTTTCGTCCTTCTCCTCTTCTCTC
T7_12992_G07	TTCTCCTCTTTTCTCTCGTCCTCTCCTTCCCCTCTT
T7_12993_G07	TCTCTCTTCTCCTCCCTGTCCTTTTCCTCCTTTCTC
T7_12994_G07	TCTCCTCTCTCTTCTCCGTCTTCTCTCTCCTTCTCT
T7_12995_G07	TCTTCTCTCTCTCTTCTGTCTCCTCCTCTCTCTCTC
T7_12996_G07	TTCTCTCCCTCTTCTTCGTCCCTCTCTCTCCTCTTT
T7_12997_G07	TCTCTCCTCCCTTCCTCGTCCTCTCTTTCTCTTTTC
T7_12998_G07	CTTCCCTCCTCTTCTTCGTCTTCTTCCTCTTCCCTT
T7_12999_G07	TTCTTCCCTCCTCTCTCGTCCTCTCTTCTCTCTCTT
T7_13000_G07	TCTCTCTTTTCTTCTCTGTCCTCCTCTTCCTCCCTC
T7_13001_G07	TCCTCTCCCTCTCTTCTGTCCTTCTCCTCCTTTCTT
T7_13002_G07	TTCTTCTCTTCCCTCTCGTCCTTTCCTCCCTCTCTT
T7_13003_G07	TTTCTCTCTCTCTCTTCGTCTTCCCTCCTCTCCCTT
T7_13004_G07	CTCTCTCTCTTCTCTTTGTCCTCCCCTTCTCTCTTC
T7_13005_G07	CTCTTCCTCTTTCTTCTGTCCTCTCTCTCCTCCTTC
T7_13006_G07	TCTTCTCCTTCTCCTCCGTCCTCTCTCTTCTTCCTT
T7_13007_G07	TCCTCTCCCTCTCTTCTGTCCTCTCTCTTCTTCTCT
T7_13008_G07	TCTTCTTTCCCTTCCTCGTCCTCCTCTTCTCCTTCT
T7_13009_G07	CTCCTTCCTCTCTCCTCGTCTTTTCCTCTTTCTCCT
T7_13010_G07	TCTCTCTTTTCTCTCTCGTCCTCTCTCTTCCTCCTC
T7_13011_G07	CTCCTCTTTTTCCTTCTGTCCTCTCCTCTCCTCCTT
T7_13012_G07	CTCTCTCTTCCCTCTTCGTCTCTCTCTCTCTCTTTC
T7_13013_G07	CTCTCTCCTCTTCTCTCGTCCTTCTTCTTCTCTCTC
T7_13014_G07	CTCCTCCTCCTCCTCTTGTCTTCTTCCTCTTTCCTT
T7_13015_G07	CCTCTCCCTCTCTCTCTGTCTCTCTCTTCTTCTCTT
T7_13016_G07	TTTCTCCTCTTCCTCTCGTCTCTTCCTCTCTCTCTC
T7_13017_G07	CTTCTTCCCTCCTTCTCGTCCCTCTTTCTTCTTCTC
T7_13018_G07	CCTTCTCCTCTTCTTCCGTCTCTCTCTTCTCTTTCC
T7_13019_G07	CCCTTTCTCTTCTCTTTGTCTCCTCTTTCTCTCCCC
T7_13020_G07	CTTCTCTTCTTCCTTCTGTCCTTCCTCTCTCCTCTC
T7_13021_G07	TTTTCTCTCTCTCTCTCGTCTTCCTTCCCCTCTCTC
T7_13022_G07	TCTTCTCCTCTTCCTCTGTCCTCCTTCTTCCTCTTC
T7_13023_G07	CTCTTTTCTTTCTCTCCGTCTTCTCTTCCCTCTCCC
T7_13024_G07	TTCCTCTCTTCTCTCCTGTCTCTTCTCCTCCCCTTT
T7_13025_G07	TTCTTCCTCTCCTCTCCGTCTTCTTTCCTCTCTCTC
T7_13026_G07	TCCTCTTCCTTCCTTCTGTCTCCTCTCTCTCTCTTC
T7_13027_G07	TCTCTCCTCCTCTTTCTGTCCCTTTCTTCTCTCTCC
T7_13028_G07	CTCTCTTCTTCTTCCCTGTCCTCTTCCTCTCTCTCT
T7_13029_G07	TCCTCTTCTCTCTCTCTGTCCCTCTCTCTTCTTCTC
T7_13030_G07	TCTTCCTTTCTCTTCCTGTCCTCCTTCTTCTCCCCT
T7_13031_G07	CCCTTCTCCCTTTCTTCGTCCTCTCTTTTTCCTCTC
T7_13032_G07	CCTCTCTCTCTTTCTCCGTCTCTCTTCCTTCTTCTC
T7_13033_G07	TCTCTTTCTCCTTCTCCGTCTCCTTCTCTCTCCTCT
T7_13034_G07	TTCTCTTCCTCTTTCCCGTCTCTCTCTCTCTCCTCT
T7_13035_G07	CTCTCCTTTCTCCTCTCGTCTCCTTCTCTTCTTCCT
T7_13036_G07	TCTTCTCTCTTCCTCCTGTCTTTCCTCTCTCCCTTC
T7_13037_G07	TCCCTTCTTCTTCCTTCGTCTTCCTCCTTTCTCCCT
T7_13038_G07	TTCTCCCTCTCCTCTTCGTCTCTTTTCTCTTCCTCC
T7_13039_G07	CTTCCCCTTTTTCTCTCGTCCTTCTCTCCCTTCTCT
T7_13040_G07	CTCTCCTCTCCTCTCTCGTCTTTTCTCCTCTTCTCT
T7_13041_G07	TTTCTCCTTCTCCTCTCGTCCCTCTTCCCTTCTCTT
T7_13042_G07	CTCCTCCTTCTCTCCTCGTCCCTTTCTCTTTCTTCT
T7_13043_G07	TTCTCTCTCTCTCTTCTGTCCCCTTTCCTCTCCTCT
T7_13044_G07	CCCTCTTCCTCTTCTTTGTCTCTTCTCTCCCTCTCT
T7_13045_G07	TCTCTCTCCTCCTCTTTGTCCTTCTCTTTCTCCCTC
T7_13046_G07	CTCCCCTTCTCTCTTTCGTCCTCCTCTCTTTTCTTC
T7_13047_G07	TCTTCTCTCCTCTTCCTGTCTTCTCCCTTTCCTTCC
T7_13048_G07	CTCCTTCCTCCTTCTCTGTCCTCTTCCTCTTCTTCT
T7_13049_G07	TCTCCCTTTCCCTCTTCGTCTCTTCTTTCTCTCTCC
T7_13050_G07	CTCTCCTCTCTCTCTTCGTCCTCTCTTCTTCTCCTT
T7_13051_G07	TCTTCTCTTTCCCTCCTGTCTCTCTCTCCTTTCCCT
T7_13052_G07	TCTTCTCTCCTCCCTTCGTCTCTCTTCCTTCTCTCT
T7_13053_G07	TCTCTCTTCCTCCTCTTGTCTCTCCCTTTCCTCTTC
T7_13054_G07	CTCCCTTTCTCTTCTCCGTCTTCTCTCCTCTTTCTC
T7_13055_G07	CTTTTCCCCTCCTCTTCGTCCCCTTTTCTTCTCTTC
T7_13056_G07	TCTTTCTCCCTTTCTCCGTCTCCTCTCCCTTCTTTC
T7_13057_G07	TTCTCTTCCTTCCTCTTGTCCTCTCTCTCCTCTCTC
T7_13058_G07	CTTCCTCTCTCCCTCTCGTCTCTCTTTCTTTCCCTT
T7_13059_G07	TCTTTTCCTCTCTTTCTGTCCCCTCCTTCTCCCTTC
T7_13060_G07	TCTTTCTCTTCTCTTCCGTCTTCCTTCTCCTCCTCC
T7_13061_G07	CCTTCCTTCTCCTTCTCGTCTCCTTCCTTCTCTCTT
T7_13062_G07	TTCTCTCCTTCTTCCTCGTCTCCCTCCTTCTTCCTT
T7_13063_G07	CCTTTCTCCTCTCCTTTGTCCTCCCTTTCTCTCTTC
T7_13064_G07	TCTCTTTTCTCTTCCCTGTCCTCCTCCTCCTTTCCT
T7_13065_G07	TCCCTCTCTCTTTCCTTGTCTCTTCTCCTCTTCCCT
T7_13066_G07	TCTCTCCCTTTCTCTCTGTCTCTCTCTCTCCTCTCT
T7_13067_G07	TCTCTCTCTCTCCTCTTGTCTCCCTCCTCTTCTCTT
T7_13068_G07	CCTCTTCTTCCTCTTCTGTCTCCTCCTCTCTTTCCT
T7_13069_G07	TCCTTTTTTTCTCTTCTGTCTCCTCCTCTCCCCTCC
T7_13070_G07	CTCTCTTCTCTCTCTTCGTCTCTCTTCTCCTCTCCT
T7_13071_G07	TTCCTCTTTTCCTTCTTGTCTCTCTCCTCCCCTCTC
T7_13072_G07	TTCTCTCTCCTCCTCCTGTCCTTCTTCCCTCTCTTT
T7_13073_G07	CCTCTCTTTCCTCCTCTGTCCTCTCTCTTCTTTCTC
T7_13074_G07	CCTCCTCTCCTCTCTTCGTCTTCCTCTTCTTCTCTT
T7_13075_G07	TCTTCTTTCCCTCCCTCGTCTCTCCTTTTCCCTCTT
T7_13076_G07	TTCCTCCTTTTCTTCCCGTCTCTCTCTTCCTCTCCT
T7_13077_G07	TCCCTTCTCTCTTTTTCGTCTCTTCTCCCTCTCCTC
T7_13078_G07	TCTCCCTCCTTCTCTCTGTCTTCTCTCTCCTCTCTT
T7_13079_G07	TCTCCCTCTCTCTTCCTGTCCTTTCTCTTCTCTCTC
T7_13080_G07	TTCTCTCTCTTCTCTCCGTCTTCTTCCTCTCCCCTT
T7_13081_G07	TCTCTTCTTTCCTCCCTGTCCTCTCTCTCTCTTCTC
T7_13082_G07	TCTTCTCCTCTTCTCCTGTCCTTTCTCTCCTCCTCT
T7_13083_G07	CTCTCTCTCTCCTCTCTGTCCTTCTCTTCTCTCTTC
T7_13084_G07	CTTTCCTTTTTCTCTCCGTCCTCCTCTTCTCTCCTC
T7_13085_G07	TCTCTTCTCTCCCTCTTGTCTTCTTTCCTCTTCCCC
T7_13086_G07	CTCTTCCTCTTTCTTTTGTCTCCTCTCTCCCTCTCC
T7_13087_G07	CTTCTCTTTCCTTCTCTGTCTCCCTCTCCCTTTCCT
T7_13088_G07	CTCTTCTCTCTCTCTTCGTCCCCTTCTTTTCCTCTC
T7_13089_G07	CCCTTCCTCTCTCTCTCGTCTCCTTCCCTTTTTTTC
T7_13090_G07	CTCTCTTTCTTCCTCTCGTCTCTCCTCCCTTTCTCT
T7_13091_G07	TTCTTCCCTCTCTCTCCGTCTTTCTTCTTCTCCCTC
T7_13092_G07	CTCTTTCTCTCCTCCTCGTCCTCTCTTTTCCTCTCT
T7_13093_G07	TCTCTCTCTCTCCTCCCGTCTTTTTTCTTCTCTCCC
T7_13094_G07	TCTTCTCTCTTTCCTCTGTCTTCTCCTCTCCTCCTC
T7_13095_G07	CTCTTCCTTCTCTCTCTGTCCTCTTCTCCCTCTCTT
T7_13096_G07	CCTCCTCCTCTCTTCTCGTCTCTCTCTCTCTTTTCT
T7_13097_G07	TTCTCTTCTCTCCTTTCGTCTCTCTCTCCTTCTCCC
T7_13098_G07	CTTCTCCCCTTCTTTCTGTCCTCTCTCTTTCCTCTC
T7_13099_G07	CCTTCTTCCTCCTCTTTGTCTCTCTCTTCCCTCTTC
T7_13100_G07	TCTCTCCTCTCCCTTTCGTCCTCTTCTTCTCCTTTC
T7_13101_G07	TCTCTCCTCTCTCTCTTGTCCTTCTCTCTCTCCTCT
T7_13102_G07	TCCCTCTTCTTCTTCTCGTCTTCCCTCCCTTCTCTT
T7_13103_G07	TTCTCTTCTTTCCTCTTGTCCCTCCCCTTCCTCTTC
T7_13104_G07	CTCCTTTCCTCTCTCCTGTCCTTCCTTCTTCTCTCT
T7_13105_G07	CCTTCCTCTCTCTTCTTGTCCTTCTCTCTCTCTCTC
T7_13106_G07	TTCTTCCTCTTCTTCCTGTCCTCCCTCTCTTCTCTC
T7_13107_G07	CTCCTTCCTCTCTCTTCGTCCCTCTCTTTCTCTTTC
T7_13108_G07	CTCTCTTTCTTCTCCTTGTCCTCTTCTCCTTCCCTC
T7_13109_G07	CTTTCTCCTCTCTTCCTGTCCCTTTCCCCTTCCTTT
T7_13110_G07	TCTTCTCTCTCTCTCTCGTCTCCTTTCTCTCCTCTC
T7_13111_G07	TCTCTCCTCCTCTCTCTGTCCCTCTCCTTCTTTTCT
T7_13112_G07	CTTTTCCCTCTCTCTTCGTCTCTTCTTCCTCCTCCT
T7_13113_G07	CCTCTCCTCTCTCTCTCGTCTCTCTCTTTCTCTTCT
T7_13114_G07	TCCTTCTTTCTTTTTCTGTCTCTCCCTCCTCCTCCC
T7_13115_G07	TTCTCTCCTCCCTCCTCGTCTTTTCTCCTCCTTCTT
T7_13116_G07	CTTCTCTCTCCTTCTCCGTCTCTCTTCTCTCTTCTC
T7_13117_G07	CTCTCTTCTCTCTTCCTGTCCTCCCTTCTCTCTCTT
T7_13118_G07	CTCTCTCCTCTTTCCTTGTCCTCTCCTTTCTCTTCC
T7_13119_G07	CTCCTCTCCCCTCTTTCGTCTCTCTCTTTCTCTTCT
T7_13120_G07	TCTTCTCTCCTCTCTCCGTCTCTCTTCTCCTTTCCT
T7_13121_G07	TCTCTTCTCCTCTCTTTGTCCTCCTCCTCTCTTCCT
T7_13122_G07	CTCTCTCTTTCTCTCTCGTCTCTCTCTCTCTCTCCT
T7_13123_G07	TTCCTTCTCCCTCCTTCGTCTCTTCTTCTCTCTCCT
T7_13124_G07	CTCTTTTTCCCCTTCTTGTCTCCCCTCTCCTTTCCT
T7_13125_G07	TTCTCCTTCTTCTCCCCGTCTCTCTCTTCTCTCTCT
T7_13126_G07	CCCTCTCTTCTTCTTTCGTCTCTCTCTCCCTTCTCT
T7_13127_G07	CCTTTTTCTCTCTCCTTGTCCCTCTTTTCCCTCTCC
T7_13128_G07	TTTCTCTCTCCTCTTCCGTCCTCCTCTCCTTTCCTT
T7_13129_G07	TTCTCCTCTCTCCCCTCGTCTTTCTCTTCTTCCTTC
T7_13130_G07	TTCCTTCTCCTCTCCTTGTCCTCTCCTCTTCTCTCT
T7_13131_G07	TCTTCTCTTCTCTCTCTGTCCCTCTCCTCCCTTTCT
T7_13132_G07	CTCCCTTCTTCTTTCCTGTCCTCTTCCTCTCTTCTC
T7_13133_G07	TCTCCTTCTCTCCTTCTGTCCTCTCTCTTCCTCTCT
T7_13134_G07	CTTTCCTTTTTCTCTCTGTCTCTCTCCCTCTCCCTC
T7_13135_G07	CTCTTCTCTTCCCTCTTGTCTCTCCTCTCTCCTTTC
T7_13136_G07	CTCTCTCTTCCTCTCCTGTCCTTCCTTCTTCTCTCT
T7_13137_G07	TCTCCTTCTCTCTTCTCGTCTCTTCCTCTCTCCTCT
T7_13138_G07	TCTCTCTCTCCCTCTCTGTCCTTCCTCTCCTTTCTT
T7_13139_G07	TCCTCCTCTCTCTCTCTGTCCCTTCTTCTCTTCTTC
T7_13140_G07	CTCTTTCCTCTTCTCTCGTCCTCCCTTCTTTCTCTC
T7_13141_G07	CCTTTCTCCTTTTCTCTGTCCCTCTCTCCTCTCTCT
T7_13142_G07	TCTCCTTCCTTTTCTTCGTCTCTCTCTCTCTCCCTC
T7_13143_G07	CTTTCCTTCTCTTTTCTGTCCTCCTCCTTCCCTCTC
T7_13144_G07	TCCTTCTTCCTCTTCTCGTCCTTTCTCCCTCTTCTC
T7_13145_G07	CTCTCCCTTCTCTCTCTGTCTTCTCTTCCTCCTCTT
T7_13146_G07	CCTCTTTCTCTCCTCCTGTCCTTCTCTTCCCTCTTT
T7_13147_G07	TCCTCCTCTCCCTTTTTGTCTCTCTCTTCTCCCTCT
T7_13148_G07	CCTTCTCTCTCCTTCCTGTCCCTCCTTCTTTCCTTT
T7_13149_G07	CTCCTCTCTCCTTTTTCGTCTTTCCCTCCCTCTTTC
T7_13150_G07	TCTCTTTCCTCTTCTCTGTCCTCTCTCCTCTCTCTC
T7_13151_G07	TCCTCTCTCTCTCCTTTGTCCTCCTCTCTCTCTTCT
T7_13152_G07	TTTCTCTCCTCCTCTCTGTCCTTCCCCTCTTTCTTC
T7_13153_G07	TCCCCTTTCTTTCTCTCGTCTCTTCTTCTCTCCTCC
T7_13154_G07	CTCCTTCCCTCTCTCTTGTCCTTTCTCTCTTCTCTC
T7_13155_G07	TTTCCTCTTCTTCCCTCGTCCTCTTCTCTCCTTCTC
T7_13156_G07	CTCTTCCTTCTCCTTCCGTCTCCTTCTCTTCTTCCT
T7_13157_G07	CTCCCTCTTCTCTTCTTGTCCTTCTTTCCCTCCTCT
T7_13158_G07	TCCTCCCTCCCTCCTTCGTCTTCTCTCTTCTTTCTT
T7_13159_G07	CTCCTCTTTCTCCTTTTGTCTCTCTTCCCTCCCTCT
T7_13160_G07	CCTTCCTCTCCTTTTTCGTCTTCTCTCTCCCTTCTC
T7_13161_G07	CCTCTTCCTCTTCTCTCGTCTCTTTCTCTCCCTTCT
T7_13162_G07	CCTTCTCTTCTCCTTCTGTCCTTCTTCCTCTCTCTC
T7_13163_G07	CTCCCTCTCTCCTCCTCGTCTTTCTTTCTCTTCTTC
T7_13164_G07	CTTTTCTCCTTCTCTCTGTCCCCTCTTTTCTCCTCC
T7_13165_G07	TCTCTCTCCCTTCTCTCGTCTTTCCTTCCTCCTTTC
T7_13166_G07	CCTCTCTCTTTCCTCTTGTCCTCCTTTCTCTCCTCT
T7_13167_G07	CTTCTCTCTTCTTCTCTGTCTCCTCTCTCTCCTCTC
T7_13168_G07	TCCTCTCCCCTCTCTTTGTCTTCTTTTTCCTCCCCT
T7_13169_G07	CTCTCTCCTCTCTTCCTGTCCCTCTCTTCTCTCTTT
T7_13170_G07	CTCTTCTCCTTCCTCTTGTCCTCTCTCTTCCCTCTT
T7_13171_G07	TCTCTTCTCCTCCCTCTGTCCTTCCCTCCTCTTTTT
T7_13172_G07	TTTTCTCCCCTCTCTTCGTCCCTCTCTCTTCCTCTT
T7_13173_G07	TCTCTTCTCCCTCTCCTGTCTTCTCCTTCTCTTCCT
T7_13174_G07	TCTCTCTCCTCCTTCTCGTCTCTCTTCTCCTTCTTC
T7_13175_G07	CTTTCTTTCTTCCTCTCGTCTCCTCCCCTTCTCTCT
T7_13176_G07	TCTCTCTTCTTCTTTCCGTCTCTCCTCCTCCCTCTT
T7_13177_G07	CTCTCTCCTCTCCTTCTGTCCTCTTTCCTCTTCTCT
T7_13178_G07	TCCCTTCTCCTTCTTTCGTCCCTCCTTTTCTCCTTC
T7_13179_G07	TCTCCTCTCTTTCTCTCGTCCTCTCTCCCTTCTCTT
T7_13180_G07	CCTCTCTCCTTTCTCCTGTCTCTCTCTTCTCTTCCT
T7_13181_G07	TCTTCTTTCCTTTCTCCGTCTCTCCTCTCCTTCCTC
T7_13182_G07	TTCTCTTTCCTTCCTCTGTCCTCTCTCTCTCTCCTC
T7_13183_G07	CCTTCTCTCTCTTCTCTGTCTCTCTCTCTTCCTTCC
T7_13184_G07	CCTCCTTCCTCTCTCTTGTCTCTCTCCTTCCTCTTT
T7_13185_G07	TCTCTCTCCCTTTTTCTGTCCTTCTCTCCTCTCTCC
T7_13186_G07	CTTCTCTCCTCTCTCCTGTCTTCCTTTTCCCCTCTT
T7_13187_G07	CCTTCTCTCTCTTCTCTGTCCTCCTCTCCTCCTTTT
T7_13188_G07	CTCCTTCTCTCTTTCCTGTCCTCTTCTTCCCTTCTC
T7_13189_G07	TCCTCTCTCTCTCCTCCGTCTTTCCTTCTTTCTCTC
T7_13190_G07	CCCTCTTCTTCCCTTTTGTCCTCCTCTCCTTTCTTC
T7_13191_G07	CCTCTTTTCCCCTCCTCGTCTCCTTCCTCTTTCTTT
T7_13192_G07	CTTTTCCCTCTTCTTCTGTCCTCTCTCCTCTCTCCT
T7_13193_G07	TTCTCCTTCCTCTTTTCGTCTCCTTCTCCCTCTTCC
T7_13194_G07	CTTCTCCCTTTCCTTTCGTCCTCTTTCTCTCCTCTC
T7_13195_G07	CCTCTCTTCTTCTCTCTGTCCTCTCTCCTTCCTTTC
T7_13196_G07	CTCCCTCTTCCTTTCTCGTCTCTCTTCTCTTCCTTC
T7_13197_G07	TCTCCTTCCTCTTCCCTGTCTCTTCCTCTCTTCTTC
T7_13198_G07	TCTCTTTTCTCTCTCTTGTCCCCTCTCTCTCTCCTC
T7_13199_G07	CTTCTCTCCCTCTCTCTGTCTCCTTCTTCTTTCTCC
T7_13200_G07	TTCCTCTCCTCTTCTTCGTCCTTCTCCTCTCTTCTC
T7_13201_G07	TCCTTCCCTCTCTCTTTGTCCCCTCTTTCTTCCTCT
T7_13202_G07	CCTTCTCCTTCTCTCTCGTCTTCTCTTCCCCTTTCT
T7_13203_G07	TTCTCTCTCCTTTCCCCGTCTCTCCTCTCTTCTTCT
T7_13204_G07	CTCTCTCTCCTTCCCTCGTCCTCCTTTTCTCTCTTT
T7_13205_G07	TCTCCCCTTTCTCTTTCGTCTCTCTTCTTCCCTTCC
T7_13206_G07	TCTTTCTCTCTCTCCTCGTCTCCTCTCTTCTTCTCC
T7_13207_G07	TTTCCTTTCCTCTCTTCGTCTCTTTCCCCTCTTCCC
T7_13208_G07	CTTTTCTTCCTTTCCCTGTCCCCTCCTTCCCTCTTT
T7_13209_G07	CCTTTCTTCTCTCTCTTGTCCTTCTTCTCCCTCCTC
T7_13210_G07	TTCTCTCTCCTTCCCTTGTCCCTCTTCTTCCTCCTT
T7_13211_G07	TCCTTCTCTTCCCTCCTGTCCTCCTTTCTCTTTCTC
T7_13212_G07	TCTCTCTTTCTCTTCCCGTCCTCTTCCCTCTCTCTT
T7_13213_G07	TCTCCCTTTCTTTTTCCGTCCTCTCCTTCTCCCTTC
T7_13214_G07	TCTCTCTCCTCTCTTTCGTCTCTCTCTCTCTTCCCT
T7_13215_G07	CTCCTCTTCTCCTTCCTGTCCTCTCTCCCTTCTTTT
T7_13216_G07	CTTCTCCCTTTCTCTCCGTCTCTCTTTCTCCTCCTT
T7_13217_G07	CCCTTCTTCCCCTCCTCGTCTTCTCTTCTTCTTCTT
T7_13218_G07	TTTCTCCTCCTTCTCCCGTCTTCTCTCTTCTTCTCC
T7_13219_G07	TCCTCTCCTCTCTCTTTGTCCTTCCTCTTTCCCTTC
T7_13220_G07	CTCTCCCTTCTTCCTCTGTCCTTTCTTCCTTTCTCC
T7_13221_G07	CCTTTTCTCCTTCCCTCGTCTTCTCCTTCTCTCTCT
T7_13222_G07	TCTCTCCTTCCTTCTTCGTCTTCTTCTCTTCCCCTC
T7_13223_G07	TCCCTTCTCTCTTCTCCGTCCTTCCCTTCTTTCTCT
T7_13224_G07	CCCTCCCCTTTTCTCCCGTCTTCTTTCTTTCTTCCT
T7_13225_G07	TCTTCCTCTCTTCTTCCGTCTCTCTCTCTCCTCCTT
T7_13226_G07	TTCCTCTCCTCTCTCTTGTCCCCTTCTCCCTTTCTT
T7_13227_G07	TTCTTTCCTTCCCTCCTGTCTTCCTTCTCCTCTCCT
T7_13228_G07	TTCCTCTCCTTCCTTTTGTCCTCCTCCTCCTCTTCT
T7_13229_G07	TCTCTTTCCTTCCCTCCGTCCTCTTCTCTTCTCCTT
T7_13230_G07	CTCCTTCTCTTTCCTTCGTCCTCTTCCTTCTCTCTC
T7_13231_G07	TTTCTCTCTCCCTCCTCGTCTTCCTTCTTCTCTTCC
T7_13232_G07	TCTTCCCTTTCTCCTTTGTCCTTTCTCTCCTCCCTC
T7_13233_G07	TTTCTCTCTCTCTCTCTGTCCTTCTTCTCTCCCCTC
T7_13234_G07	TTCTTCCTTCTTCCTCCGTCCTTTCTCTTCCCCTCT
T7_13235_G07	CTCCTCCTCTTTCTTCTGTCCTTCTTCCTCTCTTCC
T7_13236_G07	CTTTCTCTCTCCTCTCTGTCCTCTCTTCTCTTCCCT
T7_13237_G07	CTTCTTTCCTCTCTCTCGTCCTCCTTCCTTCTCTCT
T7_13238_G07	CCTTTTCTTCCTCTTTTGTCCTCCTCTCCTCTCTCC
T7_13239_G07	CTCTCTTCTTTCCCTCCGTCCTCTCTTCTTTTCCTC
T7_13240_G07	CCCTTCTCTCTCTTTCTGTCCCTCTTTCCCTCTCTT
T7_13241_G07	TCCCTTCTCTCCTCCTCGTCTCTTTTCCCTTCTTCT
T7_13242_G07	TTTCTTCTCCTCCCTTCGTCTCTCTTCTCTCTCCTC
T7_13243_G07	TCTTCCTCCCCTTTCTCGTCTCCCTTTTCTCTTCTC
T7_13244_G07	CTCCCCTTCCTTCTTTTGTCTCCTTCTTTCCTCCTC
T7_13245_G07	TCTCTTTTCCTTCTTCTGTCCCCTCTCCTCCTTCCT
T7_13246_G07	TTCCCTCTTCCCCTTCCGTCTCTTTCCTTCTTCTCT
T7_13247_G07	CCCTCTCCTTTTCTTCCGTCCTCTTCTTCTTCCTCT
T7_13248_G07	TCCTCCTTCTTCTCTTCGTCTTTCCCCTCCCTTCTT
T7_13249_G07	CTCTCTCTCTCTCCTTTGTCCTCTCTCTCTTCTCCT
T7_13250_G07	CTTCTTCCTTCTCTTTTGTCCTTTTCCTCCCTCCCC
T7_13251_G07	TCCCTCTTCCCTTCTTCGTCCTCTTCTTTCTCCTTC
T7_13252_G07	TCCTCTTCCTCCCTCTCGTCTTTTCTTCTTCTCTCC
T7_13253_G07	CTTCTCTCCTCTCTTTTGTCCTCTCCTCTCTCTCTC
T7_13254_G07	CCCTTTCCCTTCTCCTTGTCTCTTCTTCTTCCTCTC
T7_13255_G07	CTCCTCTCCTCTTCTTTGTCCTCTCCTTCTCTTCTC
T7_13256_G07	CCTCCTTCTTCTTTTTTGTCCCCTTCTCTCTCCCTC
T7_13257_G07	TCCCCTCCTCTCTCTCTGTCCTTCCCCTTTTTTTTC
T7_13258_G07	TTCCTCCCCTTCTCTCTGTCTCTTCCTCTCTTCTTC
T7_13259_G07	TCTCTCCCTCCTCTTCTGTCCTCTTCTCTTTCCTTC
T7_13260_G07	TTCCCTCCTTCTCTCTTGTCCCTTCTTCTCTTCCTC
T7_13261_G07	CCTTTCTCTTTTCCTCTGTCCCTCCCCTCTCTCTTT
T7_13262_G07	TTTCCTCTCCCTCTCTTGTCCCTTCTCCCCTTTTCT
T7_13263_G07	TCCTTCCTTTTCCTTTCGTCTCTCTCCTCTCTCCCT
T7_13264_G07	CTCTTCTTTTTCTCCCTGTCTCTTCTCTCCCTCTCC
T7_13265_G07	TTTTCTCTTCCTCCTCTGTCCTCTTCTCCCTCTTCC
T7_13266_G07	TTCTCTCCCCTCTTCTCGTCTTTCTCTCTTCCCTCT
T7_13267_G07	TCTTCTTCCTCTTCTCCGTCTCCTCTCCTTCTTCTC
T7_13268_G07	CCTCTTCCTCTCTCCCTGTCTCTCCTTCTTCTTTTC
T7_13269_G07	TTTTCCCCTCCTTCCTTGTCCTCTTCCTCTCCCTTT
T7_13270_G07	CCTTCTCCCCTCTCTCTGTCCTCTCTTCTCTCTTTT
T7_13271_G07	CCTCCCCTTCTCTCTCTGTCTTTTCCTCCTCTTTTC
T7_13272_G07	TCCCTCTTCCTCTCTCTGTCTCTTCCTTCTTCCTTC
T7_13273_G07	TCTCTCTTTCTTCCCTCGTCCCCTCTTCCTCTTTCT
T7_13274_G07	CCCTCCTCCTCTTTCTCGTCTTCTCTTCTCTTTCTC
T7_13275_G07	TTTCTCCTCTCTCTTCCGTCTCCTCTCTCCCTTCTT
T7_13276_G07	TCCCTCCTCCCCTCCTCGTCTTTCTTCTCTCTTTTT
T7_13277_G07	CTCTCTCCTCCCCTCTTGTCCTCTTTTCTTCCTTCT
T7_13278_G07	TCTCCTTCTCTTCTTTCGTCTCTCCTCCCTTCTCCT
T7_13279_G07	CTCTCTTCTCCTCTCTTGTCCTTTCTCCCTCCTCTT
T7_13280_G07	TCTTCCTCCTTCTCTTTGTCTCTCCTCCTCCTCTCT
T7_13281_G07	TCCTCTTTCTCTTCCTCGTCCTTTCTCCCTCTCCTT
T7_13282_G07	TTCTCTCTCTTCTCTCTGTCTCCTCCCTCTTCCCTT
T7_13283_G07	TCTTTCCTTCCTCTCTTGTCCCTTCTTCCTTTCCCC
T7_13284_G07	CTTCCTCCCTCTCTCTCGTCCCTTCTTTTTTCTTCC
T7_13285_G07	CTTTCCTCTTCTCCCTTGTCCTTCTCTCTTCTCCTC
T7_13286_G07	TTTCCTCCCTCTTCCCTGTCCTTCCTTTTTCTCCTC
T7_13287_G07	TCTTTCTCTTCTTTCCTGTCCCTTCCTCCTCTTCCC
T7_13288_G07	CTCTCCCTCTCTTCTCTGTCTTCCCTCTTTCTCTCT
T7_13289_G07	TCCTCTCTCTTTCCTTCGTCCTCTCCTCTTTCTCCT
T7_13290_G07	TCTTTCTCTTCTCTTTCGTCTCTCTCCTCCTCCCTC
T7_13291_G07	TCCTCTTTCCTCTTCTCGTCCTTCCTCCTTCTCTCT
T7_13292_G07	TTCCTTTCCCTTCCTCTGTCCTTTTCTTTCCCCTCC
T7_13293_G07	TCCTTTTTCCCCTTCTCGTCTCTCTCCTTCCTCTTC
T7_13294_G07	TCTCTCTCTCTCTCCCTGTCTCCTTCTCTCTTTCTC
T7_13295_G07	TCTCTCTCTTCCCTTCTGTCTTCTCTTCCCTCTCTC
T7_13296_G07	CCTCTCCTTCTTCTTCTGTCCTCTCCTCCTTCTCTT
T7_13297_G07	TCTCCTTTTCTCCTCTCGTCCTTTCTCTCTCTCCTC
T7_13298_G07	TCTTTCTCTTCTTCTTCGTCTTCCCTCCTCTCCTCC
T7_13299_G07	CCTTCTCTCTCTTCCCTGTCTTCTCTTCTTCCTCTC
T7_13300_G07	TCTTTCCCCTTCCTTTCGTCTCTCCCTTCTTCCTCT
T7_13301_G07	TCTCTCCTTTTCTTTCTGTCCTCTCCTCTTCTCCCC
T7_13302_G07	TCCTCTCCTCTTTCTCTGTCTCTCTTCTCCTCTCTC
T7_13303_G07	TTCTCTTTCCCTTTCCTGTCCTTCTCTCCTTCTCCC
T7_13304_G07	CTTCCTTTCTCCCTTCTGTCCTCTTCTTTCCTCCTC
T7_13305_G07	CCCTTCCTTCTTCTCCTGTCTCCCTTTTCCTCTTCT
T7_13306_G07	TCTCTCTCCTCTTCTTCGTCCTTTTCCTTCCTCCTC
T7_13307_G07	TCTCTTCTCTCCTCTCTGTCCTCCTCTTCTTCCTCT
T7_13308_G07	TTCTCTCCCTTCCTCTTGTCTCCTTCTTTCCTCCCT
T7_13309_G07	CCCTTCTCTCTCTCCTTGTCCTCTCTTCTCCTTTCT
T7_13310_G07	TTCCCTTCCTTTCTTCTGTCCCTCTCTCTCCCTTTC
T7_13311_G07	CCTTCCTCTTCTTCCCTGTCCTTCTCTCTCTCTCTT
T7_13312_G07	CCCTTCTCTTTCTTCCCGTCTCCCTCTTTTTCCTCT
T7_13313_G07	TTCCCTCTCTTTCTCCCGTCTCCTTCTTTCTTTCCC
T7_13314_G07	TTTCCCTCTTCTCTCTCGTCTCTCCTTTTCTCCTCC
T7_13315_G07	CTCCTCCCTTCTCTTCTGTCCTTTCCTTCTCCTTCT
T7_13316_G07	CTCTCTTCTCTTCTCTCGTCTCTTCCCTCTCTCTCT
T7_13317_G07	TCCTTTCTTCTTCTCTCGTCCCCTCTCTCCTCTTCT
T7_13318_G07	TCTCTCTTTTTTTCCCTGTCCCCTCCCCTCTTCTCT
T7_13319_G07	TCTTCCTCTTCCCTCCCGTCCTCTCTCTTTCTTCTT
T7_13320_G07	TCTTCTCTCTTCCTCCCGTCTTCTCTCTCTTCCCTT
T7_13321_G07	CCTCTCTCTTCCTCTCTGTCCTCTTCTCTCTTCTCT
T7_13322_G07	TTTTCTCCCCTCTCTCTGTCTCTCCTTTCTCCCTTC
T7_13323_G07	CTCTCCTTCTTCTCCTCGTCCCCTTTTTCTCTCTCT
T7_13324_G07	CTTCTCTTTCTCTTCTCGTCTCTCTCTCTCCCTTCC
T7_13325_G07	TCCTCTCTCTTTTCTTCGTCCTCCCCTCTTCCTCTT
T7_13326_G07	TCTCTTCTTCTCTCTCCGTCTTTCTCCTCCTCTCTC
T7_13327_G07	CTCTCTTTCCCTTTCTCGTCTCTCTTCCTCTCCTCT
T7_13328_G07	CCTTTTCTCTCTTCTCTGTCCTCTCTCTCCTTCTCC
T7_13329_G07	CTTCTCTCTTCTCTTCTGTCCTCTCTCCCTTTCTCC
T7_13330_G07	CTCTTCTCCTCCTTTCTGTCTCTCTCCCTTCTCTTC
T7_13331_G07	TTCCTCCTCCTTCTCTCGTCTTCTCTCTTCTCTCCT
T7_13332_G07	CTTCTCTTCTCTTCTCCGTCTCTTCTCTCTTCCTCC
T7_13333_G07	CCCTTTCTTCCTCCTCTGTCTTCTTCTCCCTTCTCT
T7_13334_G07	CTCTCTTTCTCCTTTCCGTCTCTTCCTCTTTCCCCT
T7_13335_G07	CTCTCTTCTCTCCCTCTGTCTCCTCTCTTTCTCTCT
T7_13336_G07	CCTTTCCCTCTTCCTCTGTCTCTCCTTCCTCTTTCT
T7_13337_G07	TTTCTCCCTCCTTCTCCGTCTCCTCTCCTTCTCTTT
T7_13338_G07	CTTCCCTCTCTTTTTCCGTCTTCCTTTCTCCTCCTC
T7_13339_G07	CTTCTCTCTTCTCTCTCGTCTCTCTCTCTCTCCTCT
T7_13340_G07	CTTTCTCTCTCCCTCTCGTCCCTTTCTCTCTCTCTT
T7_13341_G07	CTCCCTCCTCTCTCCTTGTCCTTCTTTCCTCTCTTT
T7_13342_G07	CTTCTTCTCTCCTTCTCGTCTCCTTCTCTCCCTTCT
T7_13343_G07	CTCCTCTCTTCTCTTCCGTCTCTCCTCCTTTTCTTC
T7_13344_G07	TCTTCCTCTCTCCTCTCGTCCCTCTCTCTCTTTTCT
T7_13345_G07	TTCTCTTCTTCTCCTCTGTCCTCCTCCTTTCCTCTC
T7_13346_G07	TCTTTCTCCTCCTTCTCGTCTCCTTCTCTCCTCCTT
T7_13347_G07	TCCTCTCTTTTTCTCCTGTCCTCCTCCCTCTTCTTC
T7_13348_G07	CTTTTCTTTCTCTCCCCGTCTCCTTCTCTCCCTCTT
T7_13349_G07	CTTCTTCTTCCCTCTTCGTCTCTCCTCTCTTCCTCT
T7_13350_G07	TCTTCTCCTTCTCTTCTGTCCTTCCTCCTCTCCCTT
T7_13351_G07	TCTTTCCTCTTCCTTCTGTCCTCCTCTCCCTTCCTT
T7_13352_G07	CTTCCTCTCCTTTCTCCGTCTTCCCTTTCTCTTCCT
T7_13353_G07	CTTCTCTCTTCCTTCCTGTCCTCCTTTTTCCTTCCC
T7_13354_G07	CCTCTCTCCTCCTCTCCGTCTTCTCTCTTCTTTTCT
T7_13355_G07	TCCTTCTCCCCTCTTTCGTCTCTCCTCTTTCTTCTC
T7_13356_G07	CTCTTCTTTCCCTCCTTGTCCTCCTCCTCCTTTTCT
T7_13357_G07	CTTCTCCTTCTTTTTTCGTCTCCTCTCTCCCCTCTC
T7_13358_G07	TCCCTCTCTCCCTTCCTGTCTTTCTCTTCTTCTCCT
T7_13359_G07	CCCTTCTCTTTCTCTCTGTCCTCTTCCTCCTTCTTC
T7_13360_G07	TTTCTTTCCCTCTTCTCGTCTCCTTCCCTTTCTCCC
T7_13361_G07	TCCTCTTCCTTCTCCTTGTCTTTTCTCCTCCCTCTC
T7_13362_G07	TCTCCCTTCTTCTTCTTGTCCTCCTCTCTCCCTTTC
T7_13363_G07	TCCTCTCTCTCTCTTCTGTCCTCTCTCCCTCTCTTT
T7_13364_G07	CTTCTTTTCTCTCTTCTGTCCTCCTCCCCTTCCTCT
T7_13365_G07	CTTTCCCTCTTTTCTCCGTCTCCCTTTCTCTCCTCT
T7_13366_G07	CCTCTTCTCTCTCCCTTGTCCTTCTTTCCCTTTCCT
T7_13367_G07	TTCTCTCTTCTTCTCTCGTCCTTCCCTCTCTTCCCT
T7_13368_G07	TTCCTCTTCTCTTCTCCGTCCCTTTCCCTCTTTCTC
T7_13369_G07	TCTCTTTCCCTTCTTCTGTCCTTCTCTCCTCCCTCT
T7_13370_G07	CTCTCCTCTCTCCTCTTGTCCTCTCTCTCTTCCTTT
T7_13371_G07	CTCCTTCTCTCTCTCTCGTCTCCTCTTCTCTTTCTC
T7_13372_G07	CCTCTTCCCCTTCCTCCGTCTTCTCCTTTCTTTTTC
T7_13373_G07	CCCTTCCCTTCTCCCTTGTCCTCTCTCTTTCTTCTT
T7_13374_G07	CTCCCTCCTCTCTCTTCGTCCTCTTTCTTTCCTTTC
T7_13375_G07	TCCCCTTCTCTTCCTCTGTCTTTCCCTCTCTTCTCT
T7_13376_G07	CCTTTTCCCTCCTCTCTGTCCCTTTTTCTCCTTCTC
T7_13377_G07	TCTCCTTTTTCTCCCTCGTCTCTCCTCCTTCTTCTC
T7_13378_G07	TCTCTTCTCTCCTCCTTGTCCCTCCTCTCTTCTTCT
T7_13379_G07	CTCTCCTTCTCTTTTCCGTCTTCCCCTCTTTCCTCT
T7_13380_G07	TCCTCTCTTCTTCCTTCGTCCTTTTCTCCCTCCTTC
T7_13381_G07	TTTCCTCTTTCTCCCTCGTCCTTCTCTTCCTCTTCC
T7_13382_G07	TCTCCCTCTCCTTCCTTGTCCTTCCCTCTTTTCTCT
T7_13383_G07	CTTTCCTTCTCCTCCTTGTCCTTCCCTCTCTTTCCT
T7_13384_G07	CTCCTCCTCTCTTCTCCGTCTCTTCTCCTCTCTTTT
T7_13385_G07	TCTTCTTTTTCCCTCCTGTCCTCTCTCTTCCTCCTC
T7_13386_G07	CCTTCTCTCTCCCTTTCGTCCTTTCTCTCCCTTCTT
T7_13387_G07	CCTCTCTCTTCTCTCCTGTCCTTCTCCTTCTCTTTC
T7_13388_G07	TTCTTCTCTCTCCTCTCGTCTTCTTTCCCTCCTCTC
T7_13389_G07	CTCTCTCCCTTCCTCTCGTCTTTTCCTTTCCTCTTC
T7_13390_G07	TCTTCCCTCCTCTTTCTGTCTCCTCCTTTCCTTTCC
T7_13391_G07	TTTTCTTCTTCTCCCCTGTCCCTCCTCTCTTCTTCC
T7_13392_G07	CCTCTCTTTCTCCTCTCGTCTTCCTCCTCCTTTCTT
T7_13393_G07	CCCTTCTTCTCCTCCTCGTCTTCCCTTTCCTTTTCT
T7_13394_G07	CCTTCTTTCCTCTCCTCGTCCTCTCTTTTTCTCTCC
T7_13395_G07	CTCTTTTCCTTTCTCTTGTCCCTCTCTCCCCTCTTC
T7_13396_G07	CTCCCTCCTTTCTCTCTGTCCTCTTCTCTCTCCTTT
T7_13397_G07	TCCTTCCTTTCTTCTCTGTCCCTTTCCTCTCCTCTC
T7_13398_G07	CCTTCTCTTCCTTCTCTGTCCTCTCTCTCTCTCCTT
T7_13399_G07	TTCCTCTCCTTTTCTTTGTCCTCTCCCTCCCTTTCC
T7_13400_G07	CCCTTCTCTCTCCTCTTGTCCTCCTCTCCTTTTTCT
T7_13401_G07	TTCTCTCTCTCCTTCTCGTCTTTTCCTCCCTCTTCC
T7_13402_G07	CCTCTTCTCTCTTCTTCGTCCTTCCTCTTTCTCCTC
T7_13403_G07	CCTCTTTCCTTTCCTCCGTCTCCTTTTCTCTCCCTT
T7_13404_G07	CTCTCCCTCTTTCTCTCGTCTTTCTTCCTCTCTCTC
T7_13405_G07	CTCCTCTTCTTCCTCCTGTCTTCTCTCCTCCTCTTT
T7_13406_G07	TTTTCCCTCCTTTTCTCGTCTTTCTCTCCTCCCTCC
T7_13407_G07	TTCTCTTCCTCTTCCTTGTCCCCTCTCTCTCTCCTT
T7_13408_G07	TCCCCTCTCTCTCCTCTGTCCTCTTTTCTCTCTTCT
T7_13409_G07	CCTTCTCTTTCTCCTCTGTCCTCTCTCCCTTCTTCT
T7_13410_G07	TTCCTTCTCCTCTCTTCGTCCTTTCTTCCTCCTCCT
T7_13411_G07	CTCCCTCTCTCCTCTCTGTCTTTCTCTCTCTTCTCT
T7_13412_G07	TCCTCTTCCTCCTTCTTGTCTCTCCCTCCTTTCTCT
T7_13413_G07	TCTTCTCCCTTCCCTCTGTCTCTCTCTTCTCTTCCT
T7_13414_G07	CCCTCTTCCTTCTTTTTGTCTCCTCCTTTTCCCCTC
T7_13415_G07	CCCTCTCTTCTCCTCTTGTCCTTCTCCTCTCTTTTC
T7_13416_G07	TTTCCTCTTTCCTCCTCGTCTCTTTCTCCTTTCCCC
T7_13417_G07	CTTTTCCTCTTTTTCCCGTCTTTCCCTCTCCCCTCT
T7_13418_G07	TCTCTCTCTCCTCCTCTGTCTCCTTCTCCTTCTTCT
T7_13419_G07	CTCTTTCCTCTTCTCTCGTCTCTCCTCTTTCTCCTC
T7_13420_G07	TCCTCTTTCTCTCTCTCGTCTCTCCTCTCTTCTCTC
T7_13421_G07	TTTCTCCTTCTCTCTCTGTCTTCCCTTCCTCCCTCT
T7_13422_G07	TTCCCTTTCCCTCCTCTGTCCTCTCTCTTTCTTCCT
T7_13423_G07	TCTTTTTTTTCTCTTCCGTCTCCCTCCCTCCTCTCC
T7_13424_G07	TTCCTTTCTTCCTCCTTGTCTCCTCCCTTTCTCTCC
T7_13425_G07	TTCTCTTCTCTTTCCCCGTCTCTTTCTCCTCTCCCT
T7_13426_G07	TCTCTCCTTCTCTTTTCGTCTCCCTCCCTTCTCTCT
T7_13427_G07	TCCTCTCTCTCTTCCCTGTCCCTTTTCCTTCCTCTT
T7_13428_G07	CTTCCTTCTTCCCTCTCGTCTCTCTCTCCCTTTTTC
T7_13429_G07	CTCTCCTTTCTCTCTCTGTCCTTTCCCTCTCTCTTC
T7_13430_G07	TCTCTCCTCCTTCTTTTGTCTCTTCCTCCTTCTCCC
T7_13431_G07	TCTCTCCTTCTCTCCTTGTCCCTCTTTCCTCTTCCT
T7_13432_G07	TCTTCCCTCCTTTCTCCGTCTCTCTTTTCTTCCCTC
T7_13433_G07	CTCCTCTTTCTCTCTTCGTCTCTCTCCTCTCTTCTC
T7_13434_G07	CCTCCTCTTCTCTCTCTGTCTCTTCCTTTCCTCTCT
T7_13435_G07	CTCTCCTCCTCCTTCCTGTCTCCTTCTTCTCTCTTT
T7_13436_G07	TCTTTCTCTCCTTTCTCGTCTTCCCTCCCTCTCTCT
T7_13437_G07	CTCTTCTTCTTCTCCCTGTCTTCTCCTCCTTTCCTC
T7_13438_G07	TTCCTCCTCCCTCCTCTGTCTTCCTCCTTTTCTTCT
T7_13439_G07	TTTCTCTTCCCTCCTCTGTCTCCCTCTCTTCCTTCT
T7_13440_G07	TCTCCTTCTCCTCTCTCGTCTCTTTTCTCCTCTCTC
T7_13441_G07	CTCCTCTTCTCTCTCCTGTCTCTTTTCTTCCCTCTC
T7_13442_G07	CTTCTTTTCCTCCTTCCGTCTCTTTTCCCCTTCTCC
T7_13443_G07	TCCTTCTTCCTCTTCCTGTCCCTTCCTTCCTCTCTT
T7_13444_G07	TTCCTTCTCCTCTCTTTGTCCCTTTCTCCCTCTCCT
T7_13445_G07	CCCTTCTCTCTTTCTCCGTCCTTCTTTCTTCTCCCT
T7_13446_G07	TCCCTTCTCTTTCCTTCGTCCTTCCTCTCCTTCCTT
T7_13447_G07	CCCTTCCTTTCTTTTCTGTCCTCCCTCTCTCTCTCT
T7_13448_G07	TTCTTTCTTCTCCCTTCGTCTCTCTCTCTCCTCTCC
T7_13449_G07	TTCTCTTCCTCTTCTCTGTCCCTCTTCTCTCTCCTC
T7_13450_G07	CTTTCTCTCTTTCCTCCGTCCTCTTCTCCTCTCTTC
T7_13451_G07	CTTCCTCTCTTCTCCTCGTCTCTCTTCTCTCCTTCT
T7_13452_G07	TTTTCTCTCTCCCCTCTGTCTTTTCCCTCCTCCTCT
T7_13453_G07	CTTTTCCTCTCCTTTTTGTCCCTCTTCCCCTTTCCC
T7_13454_G07	TTCTCTTCTTCCCTCCTGTCTTCCTCCTTCCTCTCT
T7_13455_G07	CTTCTTCTCTTCTCTCCGTCCTCCTCTCTTCTCTCT
T7_13456_G07	CTCTCTTCCTTCCTTCTGTCTCTCTCTCTCTCCTCT
T7_13457_G07	CTCTCCTCCTCTTCTCCGTCTTCTCTTTCCTCTTCT
T7_13458_G07	CCCTCCTCTCCCTTTCCGTCTTTCCTCTTTTCTTCT
T7_13459_G07	CCTTCTTTTCTCCTCCTGTCTCTTTTCTCTCTCCCC
T7_13460_G07	TCCTCTTTCTCTTTCTCGTCTCTTCCCTCTCCCTCT
T7_13461_G07	TCTCCTCCTTTCCTTCCGTCTTCTTCTCCTTCCTTC
T7_13462_G07	CTCCTTTTTCTCCCTCCGTCTTCTCCCTTCTTCTCT
T7_13463_G07	TCTCCCCTTTTTTCCTCGTCTCTCTCTCCTCTCTCT
T7_13464_G07	CTTTCTCTCTCTCTCCTGTCCCTTCCTTTTCCCTTC
T7_13465_G07	TTTCTCTCTCTCTTTCCGTCCTCTTCCCTCTCTCTC
T7_13466_G07	CTCTCTCTTCTTCCCCTGTCCTTTTCCTCTTTCCTC
T7_13467_G07	CTCTTTCTCTCTCCTCTGTCTTCTCTCTTCTTCCCC
T7_13468_G07	CTCTTCCTCTTCTCTTCGTCTCTCCCTCTTTCTCCT
T7_13469_G07	TCCCCTTTCTCTTCTCTGTCTCTCTCTTCTCCTCTC
T7_13470_G07	CTTCCCTCTCCTTCTCTGTCCTTCTCTCTCTCTTTC
T7_13471_G07	CTTCTCTCTTCTCTTCTGTCCCCTCCTTTCCTCTCT
T7_13472_G07	TCTTTCCCTCCTTTTTCGTCTCCTCTCCCCTTCTCT
T7_13473_G07	TCTCTCTCTCCTCCCTTGTCCTTCTTCCTCTTTCCT
T7_13474_G07	CTCCCTTTCTCTCTCTCGTCTTCTTCTCCTCTCTTC
T7_13475_G07	TCCTTCTTCCTCCTCCTGTCTTCTTTTTCCTCTCCC
T7_13476_G07	TTCCTCCTCTCTTCCTCGTCTCCTCTTTTCCTTCTC
T7_13477_G07	CTCTCTTCCTCTTTCTTGTCCCTTCCTTCTCTCCTC
T7_13478_G07	TTTCTCCTCTCTCTCTCGTCTCTCCTTCTCTCTCCT
T7_13479_G07	CTCTTCCTCTTCTCTTTGTCTCCCCTCTCTCCTTCT
T7_13480_G07	TTTCCTCTCTTCTCCTCGTCTCTTCCCTCTTTCTCC
T7_13481_G07	CTCTTCCTTTTCCTTCTGTCTCTTCCTCTCTCCTCC
T7_13482_G07	TTCTCCCCTTTCCCTCTGTCCCTCTTCTTCTCTTCT
T7_13483_G07	TTTCTCCCTCCCTCCTTGTCCTCTCTTTCCCTTTCT
T7_13484_G07	CCTCTCTCTCTTCTCTTGTCCTCTTCCTCTCTTCTC
T7_13485_G07	TTCCTCCTTTCCTCCTCGTCTTCCCCTTTTCTCTCT
T7_13486_G07	CTCTTCCCTTCTTCTCCGTCTCCCTTCCTTTTCTTC
T7_13487_G07	TTTCCTCCTCTCTCTTCGTCTCCTTTCTTCTCTCCC
T7_13488_G07	CCTCTCCCTTCTTCTCTGTCTTCCTCTCTTTCCTTC
T7_13489_G07	TCCTCCTTCTTCTCCTCGTCCCTTTTTCCTTCCTCT
T7_13490_G07	CCTCTTCTCTCTCTTCTGTCCTTCTTTCTCTCCCTC
T7_13491_G07	CTTTTCCCTCTCTCCTCGTCCTTCTCCTTTCCTTCT
T7_13492_G07	TCTCTCCTCTCCTTCTCGTCCCTCTTTTCTCTCCTT
T7_13493_G07	TTCCCTTCTTCTCCTTTGTCCCTCCTCCTCTTCTCT
T7_13494_G07	TTCTCTCTCTTCTCTCCGTCTTCTTCCTTCTCCCCT
T7_13495_G07	TCTCTCTTTCTTCTCCCGTCTCTTCTTCCCTCCTTC
T7_13496_G07	TCTTCCTCCCTTTCCTCGTCCTTCTTCCTTTCCTCT
T7_13497_G07	TCCCTTCTTCTCTCCCTGTCTTCCTCTCTCTCTCTT
T7_13498_G07	TTCCTCTTTCCTCTCCCGTCTTTCCCTTTTCTCCTC
T7_13499_G07	TCTCTTCTTCCCTCCTCGTCTTCCTCCTTTCCTTCT
T7_13500_G07	TCTTTCCTCCCTTCTCCGTCTCCTCTCTTCTTCTCT
T7_13501_G07	TTCTTCCCTCCTCTCTCGTCCTTCTTTCCTCTTCTC
T7_13502_G07	CCTTTCTCCTTCTTTCTGTCCTCTCCTCCCTTTCCT
T7_13503_G07	CCTCCTCTTCTCCCTCTGTCCCTCCTTTCTTTTCTT
T7_13504_G07	TCTTCTTTCTCCTCCTCGTCTCTCTTTCTCTCTCCC
T7_13505_G07	CTTCCTCCCTCTTTCCTGTCTCTTTTCTCTCCCCTT
T7_13506_G07	CTCTTTTCTCTTCCTCTGTCCTCCCTCTCTTCTTCC
T7_13507_G07	CTTCTCTCTCTTCTCTCGTCCTCCCTCTTCTCCTTT
T7_13508_G07	CTCTCTCTTCTTCCTCTGTCTCCTCTCCTCTCCTTT
T7_13509_G07	TCTTCTCCTTCTCTTCCGTCTCTCCTTCCTCTCTCT
T7_13510_G07	CCTTTTCTTCTCCCTTCGTCCCTTCTCTTCCCTTCT
T7_13511_G07	TCTCTCCTCTCTCCCTCGTCTCTTCCCCTTTTTTCT
T7_13512_G07	CCTCTTCCTTCTTCCTTGTCTTCTCCTCTTCCTCTC
T7_13513_G07	CTCTCCTTCCTTCCTCCGTCTTTCCCTTTCTTCCTT
T7_13514_G07	CCTCTTCCCTTCTCTTTGTCTTCTCTCTCTCTCCTC
T7_13515_G07	TCCCCTCTTTCTTCCCTGTCTTTCCTCTCTCCTTCT
T7_13516_G07	CCCTTTCTCTCTTCTCTGTCTCTTCTCCTCTCCTCT
T7_13517_G07	TTCCTTCCTCTCTCCTTGTCCTTCTCTCCCTTCTTC
T7_13518_G07	TTTTTCTCTTTCTCTCTGTCTCTCCTCCCTCCCTCC
T7_13519_G07	CTTCTTCCCCTTTCTCTGTCCTTCTCCCTCTCTCTT
T7_13520_G07	TTCCTCTCTCTCTCTCTGTCCTCCTCTCTTTCTCTC
T7_13521_G07	TCTTTCCTTTCTCTCTCGTCTTCTTCCCCTCCCCTT
T7_13522_G07	TCTTTTTCCTCTCCCTTGTCTCCCTCCTCTCTCCTT
T7_13523_G07	TCCTCTTCTTTTTCCCTGTCCTCTCCCTCCCTCTTT
T7_13524_G07	TTTCTTCTCCCTCTCTTGTCCTCCTTCCTCTTCTCC
T7_13525_G07	CTCTCCCCTCCTTTCTTGTCCTCTTTCTCTCCTTCT
T7_13526_G07	CTCCTTTCTCCTCTTTCGTCCTTCCTCCTCTCTCTT
T7_13527_G07	CTTTTCTCCTCCTCTCTGTCCTTCCTCCCTTTTCCT
T7_13528_G07	TTTCTCCTCTCTCTTCCGTCCCTCTCCTTTCCTCTT
T7_13529_G07	TCCCTTCCTTTCTTTCTGTCCTTCCCTCTCTCTCTC
T7_13530_G07	TCCCTTTTTCCTCTCCTGTCCTCTCTTCCTTTCTCC
T7_13531_G07	CTCTTCTCTTCCTCCTTGTCCTCTCTCTCTCTTCTC
T7_13532_G07	CTTTTTCTCCTCCTCTTGTCCTTTCCTCTTCCCCTC
T7_13533_G07	TCTCTTCTTTCTCCCTCGTCTCTCTTCTTCCCCTCT
T7_13534_G07	TCTTCTCCCTTCTTCTCGTCTTCTCTCCTCCTCCTT
T7_13535_G07	TCTCTTCCCTTTCTCCCGTCTCTCTCCTTCTTTCTC
T7_13536_G07	TTTTCTCTCCCTTCTCTGTCCCTCCTTTCCTCTCTC
T7_13537_G07	TTTCTTCTCCTCCTTCCGTCTTCTTTTCCCCTCTCC
T7_13538_G07	TCTTTCCCTCTCTTTCCGTCTCTCTTCTCTCTCTCC
T7_13539_G07	CTCCTTCCTTCTCCTTTGTCTCTTTCCTCTCTCCCT
T7_13540_G07	CTCTCCTCTTTCCCTCCGTCTCTCCTTCTTTTCTTC
T7_13541_G07	CCTCCTCCTTTCTTCCTGTCTCTTCTCCCTCTTTCT
T7_13542_G07	TCTCTCTCCTCTCCTCCGTCCCTTTCTCTTTTTCCT
T7_13543_G07	TCTTTCTCTTCCTCTTCGTCCCCTCCTTCCTCTCTT
T7_13544_G07	TCCCTTCCTCTCTTCTCGTCCTTTCTTTCCTTCTCC
T7_13545_G07	TCTTTCTCTTCCTTCCTGTCCTCTCTTCCTCCTCTC
T7_13546_G07	CTTCTCTCTTTCTCCTTGTCCCTCTTCCTCTTCCTC
T7_13547_G07	TTTCTTCCTCTCCCCTCGTCTTCTTTCTCTCCCTTC
T7_13548_G07	CTCTTCCCCTCTTTTCTGTCCTTCTTCTCTCCTCTC
T7_13549_G07	TCTCTCCTCTTCCCTCTGTCTTCTTCCCTCTCTCTT
T7_13550_G07	TCTCCCTCCTTTCCCCTGTCCTTCTTTCTCTCTTCT
T7_13551_G07	TCTCTCCCTCCCTTCTCGTCCTTTCTTCTTCTCTCT
T7_13552_G07	TTTCCTTCCTCTCTTTCGTCTTCTCCTCCCTCTCTC
T7_13553_G07	CCTCTCCCTTCTCTCTTGTCTCTTCTTCTCTCCTTC
T7_13554_G07	CTTCTCTTCCTCTCTCTGTCCTCCCTCCTTTTCCTT
T7_13555_G07	TCTCCCTCTCTTTCTCCGTCTTTTCTCCTCTTCTCC
T7_13556_G07	CTCCTCTTCTCTCTCTCGTCTCCTCTCTCTTTTTCC
T7_13557_G07	TTTCTCTTCTCTCCCTCGTCCTCCTCTTCTTCTCTC
T7_13558_G07	TTTCCTCTCTTCCTCCCGTCTTCCTTCTCCTTCTCT
T7_13559_G07	CTTCTTCTCCTTTCCTTGTCTCTCCTCTCCCTCCTT
T7_13560_G07	CTTCCTCTCTTCCCTCTGTCTCTCCTTCTTTTCCTC
T7_13561_G07	CCTTTCTCCCCTCTCCTGTCTCTTTTCTCCCTCTTT
T7_13562_G07	CTTTCTCCTCTTTCTCTGTCTCTTCTCTCTCCCTCC
T7_13563_G07	TTCTCCTTCTCCTCTTCGTCTTCCCCTTCTCCTCTT
T7_13564_G07	CTCCTTTCTCCTTTCCTGTCTTCCCTCCTCTTCTTC
T7_13565_G07	CCTTCTCTTCTTCTTCTGTCTCCTTCCTCTCTCCTC
T7_13566_G07	CCCTTTTTTTCTTCTCCGTCCTTCTCTCTCCTCTCC
T7_13567_G07	TCTCTTCTTTTCTTCCTGTCCCCTTTCCCTCCCCTT
T7_13568_G07	CCTCTTTCCTCTTCCTTGTCTCCTTCTCCTCTCTCT
T7_13569_G07	TCCCTCTCCTCTTTCTCGTCTTCTTCTCTCTCCTTC
T7_13570_G07	CTCTCCCTTTCTCTTTTGTCCTCTTCTTCCTCCTCC
T7_13571_G07	TTTCCTCTCCTTTTCCCGTCCTTTTCTCTCTCCTCC
T7_13572_G07	TTCTCCTCTCCTCTTCTGTCTCTCTTTCCTCCTCCT
T7_13573_G07	TTCTTCCTTCCTCCTTCGTCTTCTCCCTCCTCTCTT
T7_13574_G07	TCTCCTCCTTCCTCCTCGTCTTCTTCTTTTTTCCCC
T7_13575_G07	CCTTCCTTTCTTTTTCCGTCCTCCCTTTCTCCCTTC
T7_13576_G07	TCTTCCCTTTTCCTTCTGTCCCTCTCTTCCCTTCTC
T7_13577_G07	TCTCCCTCTCTTTCCTCGTCTCCTCCTTCTCCTTTT
T7_13578_G07	TCTCTTCTCTCCTCTTCGTCCTCTCTTCTCTCCTTC
T7_13579_G07	TTTTCCTTCTCTCTCTCGTCTCTCCTCCCTCTTCTC
T7_13580_G07	CCTTTCCCTTTTCTCTTGTCCTCCTCTCCTCTCTCT
T7_13581_G07	TCCTCCCTCTCTCTCTTGTCTTCCTCTCTCTCTTCT
T7_13582_G07	TCCTCCTCTCTCCTCTCGTCTCTTCTCTTCTCTCTT
T7_13583_G07	TTTCTCCTTCTCTCTCTGTCTCCTCCTCTCTCTCCT
T7_13584_G07	TCTCCCTCTTCCCTCTTGTCTTTCTCCTCCTTCTCT
T7_13585_G07	TCCTCCTTCTTTTCTCCGTCTCCTTCTTCCTTCTCC
T7_13586_G07	TCTTCTTCTCTTCCTCTGTCCTCCCTTCCCTTTCTC
T7_13587_G07	CTCTCTCTCCTCCTCTCGTCTTCTCCTCTTCTTTCT
T7_13588_G07	TCCTTCTCCTCTTCCTCGTCTTTCTCTCTCCTCTCT
T7_13589_G07	TCTCTCCTCTCCTCTCCGTCTCTTCTTTTCCTCTTC
T7_13590_G07	TCTCTTTTCCCTCTTTCGTCTCCTCTCTTCCTCCTC
T7_13591_G07	CCCTCTTTTCTCTTCCTGTCTTCTCTCCTCCTTCTC
T7_13592_G07	CCTTCTTTCCTCTCTCCGTCTTCTCTTCTCCTTCTC
T7_13593_G07	CTCCCTCTCTTCTTCCCGTCTTCTCTTCTCTTCCTT
T7_13594_G07	TCTCTCTCTCCCTCTCCGTCTCTTTTCCTTCTCTTC
T7_13595_G07	TTTCTCTTTCTCTCCTTGTCTCTCCCTTTCCCTCCC
T7_13596_G07	CTTCCTCTCTCCTCTTTGTCTCCTCTTTCTCCTCCT
T7_13597_G07	TCTCTCTCTCTCCCTTTGTCCTCTTCCTCTCTTCCT
T7_13598_G07	TCTCCCCTTTCTTCTCTGTCCCTCCTCCTTCTCTTT
T7_13599_G07	CTTTCCTTTCTCTCCTCGTCTTCTCTCTCTCCTCCT
T7_13600_G07	TCCTCCCCTCTTCCTCTGTCCTTTTCTCCCCTTTTT
T7_13601_G07	CTCCCCTTCCTTCTTCTGTCCTTTTCTCTTCTCCTC
T7_13602_G07	CCTTTCTCTCTTTCCCCGTCTTCCTTCTCCCTCTTT
T7_13603_G07	TTCTTTCCTTCTCCCTCGTCTCCTCTTCTTCCTCCT
T7_13604_G07	TCTCTCCTCCCTTTTCTGTCCCTTTTTCTTCTCCCC
T7_13605_G07	TTCCCTCTTTCTTCCCTGTCCTCTCTTTCTTCCCTC
T7_13606_G07	TCCTTTCTTCCCTTTTTGTCCTCTCCCTCTCCCTCT
T7_13607_G07	CTCCTCTCTCCTTTCTCGTCTTTTCTTCCCTCTCCT
T7_13608_G07	CTCTTCTCTCCTTCTTCGTCTCTCTCTCCCCTCTTT
T7_13609_G07	CTCCTCCTCCCCTTTCTGTCCCCTTTTTTTCCTTCT
T7_13610_G07	CTTTCTCTTCCTTCTCTGTCCTCTCCTCTCTCTCTC
T7_13611_G07	TCCTCTTTTCTCCTCCCGTCCTTCTTTTCTCTCCCT
T7_13612_G07	CTTTCCCTCCCCTTTCTGTCTTCTTTCTCTCTTCCC
T7_13613_G07	CCCTTCTTTCTCCCTCCGTCTCTCTCCTTCTTTTTC
T7_13614_G07	TCTTCTTCTCTCTTTCCGTCCCTTTCCTTCCTTCCC
T7_13615_G07	CTCCTCCTCTTCTTTCCGTCTTTTTTCCTCCTCTCC
T7_13616_G07	CCTTCTCTTTCCTTCTCGTCTCCCTTTCTCCTCTCT
T7_13617_G07	TCCCCTCCTCCTCTCTCGTCTCTTCTTCTCTTTTCT
T7_13618_G07	CCCTCTTCTTCTCTTTCGTCTCTCCTCTTTCCTCTC
T7_13619_G07	CTTCCTTTTCCTCCTCTGTCTTCTCTCTCCTCCTCT
T7_13620_G07	TCTCCCCTTCTCTCCTTGTCTTTTTTCCCTCTCCCT
T7_13621_G07	TTCCTTCTTCCTCCCCTGTCCTCCTTTTCTTCCTCT
T7_13622_G07	CTTCCCTTTCTCCCCTTGTCTCTTCTTCTCTCTCTC
T7_13623_G07	TTCCTCCTTTCTTCCTCGTCCTTCTCCTCCCCTTTT
T7_13624_G07	CCCTCTCCTTTCTTTCTGTCCCCTCTCCTTTTCTCT
T7_13625_G07	CTTTCTCTTTCCTTCTCGTCTCTCCCTCCCTTCTCT
T7_13626_G07	TCCTTCCTCTCTTTTCCGTCCCTCTTCTCCCTCTTT
T7_13627_G07	CTCTCCTTCTTCTTCCCGTCCTCCTCTCTTCTTTTC
T7_13628_G07	TCCTCTTTCCTCCTTTTGTCCCTCCCTTTCTCCTTC
T7_13629_G07	CTTCCTTTTCTTTCCCTGTCCTTCCCTCCTTTCCCT
T7_13630_G07	TCTCTCTCTCCTTCCTCGTCCTCTTCTCTCCTTTTC
T7_13631_G07	CTTCTTCTTCTCCCTCTGTCTTTCTCCTCTCCCCTT
T7_13632_G07	TCCCTCCCTTTCCTTTTGTCCTTCTTTCTCTTCCCC
T7_13633_G07	TCTTCCTTCCCTTCCTCGTCTTTCTCTCTCTCCCTT
T7_13634_G07	TTTTTCCTTTCTCCTCCGTCCCCTCTCTCTTCCTCT
T7_13635_G07	TTCTCTCTTCTTTCTCTGTCTCCCCTCTTCTCTCCC
T7_13636_G07	TTTCTCCCCTCTTTCCTGTCTCCTCTCCTCCTCTTT
T7_13637_G07	TTCTCCCTTCTCTCCTCGTCTCCTTTCTCCCTCTTT
T7_13638_G07	CCCTTCTCCCTCTCTTTGTCCTCCTCTTTCCTTCTT
T7_13639_G07	CTTCTTTCTCCTCTTCCGTCTCCTCCCTTTTTCCTC
T7_13640_G07	TTCCTCCTCCTCTTCCCGTCCTTCTTTCTCTCTTCT
T7_13641_G07	CTTTCCCCTCCCTCCCTGTCTTCTTTTCTCTCTCTT
T7_13642_G07	TCCCTCTTCTCCTTTCTGTCTCCCTCTTTCTCTTCC
T7_13643_G07	CCTCCTCTTTCCTTCTTGTCTCCCCTCCCTCTTTTT
T7_13644_G07	CTTCCCTTTCTCTTCCCGTCTCTCTTTCTTCTCCTC
T7_13645_G07	CTCTCTCCCTCCCTTTTGTCTCTCCTTCCCTTTTTC
T7_13646_G07	CCCTCTCCTTCTTTCCCGTCCTTCCTTTTTTTCCCT
T7_13647_G07	TTCCCTTTTCCCTTCTCGTCCTTCTTCCCCTTCTCT
T7_13648_G07	CTCCCTCTTCCTCTCCTGTCTTCTTCTCTTCTCTTC
T7_13649_G07	CCTTTCCCTCTTCTCCTGTCTCTCCTTTCTTCTCCT
T7_13650_G07	CCCTTCTCTCTTTTTCCGTCTTTCTCCCTCTCCTCT
T7_13651_G07	CCCTTTCTTCCCCTTTCGTCTTTTCCCTTCCTTTCC
T7_13652_G07	CTTCTTTCTTCTCCTTCGTCTCCCCTCCTTCCTTCT
T7_13653_G07	TTTTCCTTTTCTTCCCTGTCCTCCTTCCTCCTTCCC
T7_13654_G07	TTTCTTTCCTTTCCTCTGTCCTCTTTCCCCTCTCCC
T7_13655_G07	TTTTCCTTCTTCTCCTCGTCTTCCCCTTTCCCTCCT
T7_13656_G07	CTTCCCTCCCTTTCTCCGTCTCTCTCTTCTCTTCTT
T7_13657_G07	TTCCTCCTTCCCTCTTTGTCTTTCTCCCCTCTCCTT
T7_13658_G07	CCCTTTCCCTTTCCTCTGTCCTCCCTTTTCCCTTTT
T7_13659_G07	CTTTTCCCTCTTCCCTCGTCTCTCTTCTCTCTTTCC
T7_13660_G07	TCTTTCCCTTTCTCCTCGTCCCTCCCTCTTCCTTTT
T7_13661_G07	CTTTCCTCTCTCCCTTTGTCCCTTCCTTTTTCCCTC
T7_13662_G07	TCCTCTCCCCTTTCTTTGTCTTTTCTCCTCTCTCCC
T7_13663_G07	TTTCCCTCTCTCTTCTTGTCTCTCTCCTTCCTCCCT
T7_13664_G07	CTTCTTCTCTCTTCCCTGTCTCCTCTTTCCTCTCCT
T7_13665_G07	TTCCTTCCTCTCTTCTCGTCTTTTCCCCTCTCCTCT
T7_13666_G07	CCTTCTTCTTCCTCCTCGTCTCTCCTCCCTTTTTTC
T7_13667_G07	TCCCTCCTCTCTTTTCTGTCCCTTTTCCTCCTTCCT
T7_13668_G07	TCCCTCCTCTTTCCTTTGTCTCTTCCCTTCTCCCTT
T7_13669_G07	TCTCCCTCCTTTCCTTTGTCTTCTCTCTCCCTCCTT
T7_13670_G07	CTCCCTTCCTTCTTCTCGTCTCTCTCCTTTTCTCCT
T7_13671_G07	CCTCTTCCTTTCTTTCTGTCCCCTCCCTTTTTCCTC
T7_13672_G07	TCCTCCCCTTCTCTCTCGTCTTCTTCTCTTTTTCCC
T7_13673_G07	TTCTTCTCTCTTCTTTCGTCTCCCTTCCTCTCCCCT
T7_13674_G07	CTTCCCTCTTCTTCTTTGTCCTCCTTCCTCCTCCTT
T7_13675_G07	TCTTCCTTCTTTCCCTTGTCCTTTTTTCCCCTCCCC
T7_13676_G07	CCTCTTCCCCTTTTTTCGTCTTCCTCCTTCTCTTCC
T7_13677_G07	CTTCCTCCTCTCCTCTTGTCTTTTTCTCCTCTTCCC
T7_13678_G07	CTCTCTTCTTTTCTCTTGTCCTTTCCCCTCCTCCCT
T7_13679_G07	CCTTTTCCTCTCCCTCTGTCCTTTCTTCTTCCTCTC
T7_13680_G07	TTCCTTCTCCTCTTTCCGTCTCCCTCCCTCTTTTTC
T7_13681_G07	TTCTCCTTTTCCCTCTCGTCCCTCTCCTTCCTTTTC
T7_13682_G07	TCCCTTTTCCTCTCCTCGTCCTTCTTTCCTTTCCTC
T7_13683_G07	TCCTCCTCCTCCTCCTTGTCTTTCCTTCCTTTCCTT
T7_13684_G07	CCCTTTCTCTTTCTTTCGTCCTCCTTCTCTCTCCTC
T7_13685_G07	TCTTCTCTTTCTTTCCTGTCCCTCTCCTCTCCCTCT
T7_13686_G07	TTTCTCTCCTTCTTTTCGTCCTCCTCCCTCTCTTCC
T7_13687_G07	CCTTCCTCTTTCTCTCTGTCTTCCCTCCTTCCTTCT
T7_13688_G07	TTCCTCTCTTCTTCCCTGTCCTCCTCCTTTCTCCTT
T7_13689_G07	CTCTCTCCTCTTCTTTCGTCCCTTCTCTTTCTCCCT
T7_13690_G07	CTCTCCCTTCTCTCCTTGTCCTCTCCTTTCCTTCTT
T7_13691_G07	TCTTTTCTCCTTCTCCCGTCTCTCTTCCTTCCCTCT
T7_13692_G07	TCTTCCTTCCTCTTCCTGTCTTTCTTCTTCCCTCCC
T7_13693_G07	TTTTCTCTCCCTCTCTCGTCTCTTCCCTTTTCCCCT
T7_13694_G07	CTTTTTTCTTCTCCCCTGTCTCCTTTCCTTCCTCCC
T7_13695_G07	CCCTTCCCTTCCTTCTTGTCTCTTTTCTCCTTCTCC
T7_13696_G07	TCTTCTTCCCTCTTTTCGTCTTCTCCTCTCTCTCCC
T7_13697_G07	TTCTTCCCCTCTTCCTTGTCTCCTCCTTTTTCCCTC
T7_13698_G07	CTTCCCTCCCTTTCTTCGTCCTTTCCTCCTCTTCTT
T7_13699_G07	TCTCTCCTCTCCCTTCTGTCCTTCTCTCTTCTTCTC
T7_13700_G07	TTCCTCCCTTTCTTTCCGTCCCTTCTCTTCTTCCCT
T7_13701_G07	TCTTTCTCCCTTCTTCCGTCCCTCTCCTTCTCCTTT
T7_13702_G07	CTTCTCTTCTTCTTCTTGTCCCTCCTTCTCCTCCCT
T7_13703_G07	CTCCCTTTCCTTCCTTCGTCTTTCCCTTTCCCTTCT
T7_13704_G07	CCCTCTCTTTTTTTTCCGTCTCTCCTCCTCCTTCTC
T7_13705_G07	TTCTCCTCTCTTTCTTTGTCCTTCTCCTCCCCTTCC
T7_13706_G07	TCCTCTCTCCTCTCTCTGTCCTTTTCTCCTTTCCTC
T7_13707_G07	TCCTTTCTTCTTCCCTCGTCCTCCTCTCTCTTTCTC
T7_13708_G07	CTCTTCTCTCCTCCCTTGTCCTCTTTCCTCTTCTTC
T7_13709_G07	TTCTCCCCTCCTCTCTCGTCTCCCCTCTTTTTCTTT
T7_13710_G07	CTTCCTTTCTTTCCTCTGTCTCTCCTTCTCCCTCTC
T7_13711_G07	TCTCCCTCTTCCTCTCTGTCCTTTCCCTTTTCTTCC
T7_13712_G07	TTTCCTCTCTCTTTCTCGTCTCCCTCCTTCCTTCCT
T7_13713_G07	TTCTCCTTCTTCTTTCTGTCCTTCCCCTCCCCTTCT
T7_13714_G07	TTCTCTCTCCTCTTTTTGTCTCTCTTCCCTCCCTCC
T7_13715_G07	CTTCTCCCCTTTTTCCCGTCCTCCCTCTTTTCCTTT
T7_13716_G07	CCCTTCCTTTTTCCCTCGTCTTTCCTCTCTTCCTCT
T7_13717_G07	CTTTCCTCCTTCTCTTCGTCCCTCCTCTTCTTTTCC
T7_13718_G07	CTTTCTCTCCCTCCCTCGTCTTCTTTTTTCCCTCTC
T7_13719_G07	TTCCCTCCTTCCCTCCTGTCCTTCTCCTCCTTTTTT
T7_13720_G07	CTCTTCTTCCTTCTCCCGTCTCCCTTTTTCCTCTCT
T7_13721_G07	TCTTTTCTTTCCTTCCCGTCCTTTCCCTCTTCCCCT
T7_13722_G07	CTTCCCCTTCTTCTCCTGTCTTCCCTCTTTCTTCTC
T7_13723_G07	TCCTCCTCCCTTTTTCTGTCCTTTCCTCTCCTTCCT
T7_13724_G07	TTTCCCTCTCCCTTTCCGTCTCTCTCCTCCTTTTTC
T7_13725_G07	CCTCTTTCTCTCTTCTCGTCCTTCCCTCTTCTCTTC
T7_13726_G07	CTTCCTCTTTTTTCCTTGTCCCTTCTCCCCTCCCTT
T7_13727_G07	CTCTTTTCTCTCTCTTCGTCCTTCCTCCTTCTTCCC
T7_13728_G07	TTCCTTTCTCCTTTCCTGTCTCCTCCCTTCTCTTCC
T7_13729_G07	TCCCTTTCTTCCCTTCTGTCCCCTTCTTCTTTCCTC
T7_13730_G07	TCCCTTTCTTTTTTCCCGTCTTTTCTCCCCTCCTCC
T7_13731_G07	TCTTCTTCCCCTCTCTCGTCTCTTTCCTCCTTCCTT
T7_13732_G07	TTCTTCTTCCCTCTTTCGTCTTTCTCCTCCCCTTCC
T7_13733_G07	TTTCTCCTCCCTCCTTTGTCTTCCCCTCTTCCTTCT
T7_13734_G07	TCTCTCTCCCCTCTCTTGTCTCTTCCTCTTCCTCTT
T7_13735_G07	CTCTCTTCCTCTTCTTCGTCCTTTCTCCTCTTCCCT
T7_13736_G07	CCTTTTCTCCCTTCTCCGTCCTCCTCCCTTTTCTTT
T7_13737_G07	CTCCCTTCCCCTCTTCTGTCCTCTCTTCTTCTTCTT
T7_13738_G07	CCCTCCTCTTCCTCCTTGTCTTCTCTCTCCTTCTTT
T7_13739_G07	CTTTCCTCCCTTTTTCTGTCCCCTCTCTCCCTTTCT
T7_13740_G07	CTTTCTCCCCTTTTCTCGTCCTCTTCTCTCTCCTTC
T7_13741_G07	CTCCTTCTCTTTTTTCCGTCTCTCCCCTTCTCTCCT
T7_13742_G07	TTCTCTTCTCTCCTCTCGTCTCCTCTCCTCCTTCTT
T7_13743_G07	CTTCTCCTTTTCTTTCTGTCCCTCCCTTCCTCCCTT
T7_13744_G07	TTCTTTCTCTTTCTCTTGTCCCCTCCCTCCTCCTTC
T7_13745_G07	CTTTCTCCCTTTCCTCCGTCCCTTCTCTCCTTTTCT
T7_13746_G07	CCTTCCTCTCCTCTCCTGTCTCCTCTCTTTTTCTCT
T7_13747_G07	TCCCTTTCTCTCTCTCTGTCTCTCCTTTTCTCCCTC
T7_13748_G07	TCCCTCTTCTTTTCTTCGTCCTTCCCTTCCCTCTTC
T7_13749_G07	TCTCCTCTCTTTTCCTCGTCTTTCTCTCTCTCCTCC
T7_13750_G07	TTCCTCCCTTCTCCTCCGTCTTTCTTCTCTCCTCTT
T7_13751_G07	TCTTCCCCTTTTCTCCCGTCCTTCTTTTCCTCCCTT
T7_13752_G07	CCCTTCCCTTTCTTCTTGTCCTTTTCCCTTCTCTCC
T7_13753_G07	CTCCCTTTTCCTCCCTCGTCTTTCTTTTTTCTCCCC
T7_13754_G07	TTCTTTCCTTCTCTCCTGTCTTCTCCTCTTCCCCTC
T7_13755_G07	TTTCCTCCTTTCTCTCTGTCTCCTCCTCTCTCCCTT
T7_13756_G07	TCCTTCTTTTCTTTCTTGTCCTCCCCTCTCTCCCCT
T7_13757_G07	CTCTCCCTTCCCTTCCTGTCCCTTCTTTTTCCTCTT
T7_13758_G07	CCTTCTCTCTTTTCTTCGTCCTCCCCTCTCTTTTCC
T7_13759_G07	TCCCCTTCTTTTCTTCCGTCTCTTCTTCCTCTCTCC
T7_13760_G07	TCTTCCTTTCTCCTCTCGTCTCCCTCCTTCTTTCTC
T7_13761_G07	CTCCTCTTCCTTTCTCCGTCTTCTCCCCTTCTTTTC
T7_13762_G07	TTCCTTCTTCCTTTTCTGTCTCCTCCTTCCCCTTCC
T7_13763_G07	TCCTTTCTTCCTTCTCCGTCTTCCTCCTCCTTTTCC
T7_13764_G07	TCTTCCTCTCTTCTCCCGTCTCCTCCTTCTTCTTTC
T7_13765_G07	CTCTTCCTCCTCCCTTCGTCTCCCTCTTTTCTCTTT
T7_13766_G07	CTCTTTCCTCCTTTTCCGTCTCTTCTCTCTCCTCTC
T7_13767_G07	TCTTTCCCTCTCTCTCCGTCTTCTTCTTCTCCCCTT
T7_13768_G07	CTCCTTCTTTCTCTTCCGTCTCCTCTCTCTTCTCTC
T7_13769_G07	TCTCTTTTTTCCTTCTCGTCCCTTCTCTTCCCCTCC
T7_13770_G07	TTCCCTTCCCCTTTCCCGTCCTCTCTTTTCCTCTTT
T7_13771_G07	TTTCTTTTCCTTCCCCTGTCCTCCCTTTCTCCCTCT
T7_13772_G07	TCCTCTCCTCTCTTTCTGTCCTTCCCCTCTTCTCTT
T7_13773_G07	CCTTCTCTTCCCTCTCCGTCCTCTCTTCTTTCTTTC
T7_13774_G07	TTCCTCCTCTTTCTCCCGTCCCTTTTCCCTCTTTCT
T7_13775_G07	TCCTCCCCTCTTCCCTTGTCCTTTTTCCTTCTTCCT
T7_13776_G07	CCTCCCTTCTTTTTCTCGTCTCCTCTCTCTTTCTCC
T7_13777_G07	TCTCTCTTTTCTCCCTCGTCCTTCTTCTCCTCTCTC
T7_13778_G07	TTTCCTCCTTCCTCCTCGTCCTCCTTTTCTTCCTCT
T7_13779_G07	TCCCCTCTTCTTTCCCTGTCCTCTTCTCCCTTTCTT
T7_13780_G07	CTTCTTCCCCTCTCCTTGTCCTCCTCCTTTTTTCCT
T7_13781_G07	CTCTTCCTTTCTCTTTCGTCTTCCTCTTTCCTCCCC
T7_13782_G07	CCTTCTTTCTCTCTCTCGTCCTCTTTTCTCTCCTCC
T7_13783_G07	CTTTTTCTCTCTCCTCCGTCTCTCTCCCTTCTTCCT
T7_13784_G07	CCTCTCTTCTCCCTCTTGTCTTTCCTCTCCTCCTTT
T7_13785_G07	TCCCCTCCTTCCTTTCTGTCTCCCTTTTCCCTTTCT
T7_13786_G07	CTCCTTTTCTCTTCCTTGTCCTTCCTTCTCTTCCCC
T7_13787_G07	TCTCTTCCTCCTCCTTTGTCCTTCCTCTCTCTTTCC
T7_13788_G07	TCTCCTCTTCTTTCCTCGTCTTCCTTTCCTCTCCTC
T7_13789_G07	TTCTCCTCCCTTCTCTCGTCTTCCTTTCTCTTCCCT
T7_13790_G07	TCCCTTTCCTCTTTTTCGTCCCCTCCCTCTCTCTTT
T7_13791_G07	CTTCCCCTTTCCTTTCCGTCTTCCTTTCCTCTCTCT
T7_13792_G07	TTTCCTCTCTTTCCTTTGTCCTCCCTTCCCCTCTCT
T7_13793_G07	CTCTCTCCTCCTTTCTCGTCCCTTTTTCTCTCCTTC
T7_13794_G07	CTTCTCTCCCTCCCTTTGTCCTTTCCCTTCTTCTTC
T7_13795_G07	CTCTTCTTCCTCTTCCTGTCCCTCTCCTTTCTTCCT
T7_13796_G07	CTCCCTTCTCTTCCTCTGTCCTCTCTCCCTTTTCTT
T7_13797_G07	TCTCCTCCCTCCTTCCTGTCTTCTCTTCTCTTCTCT
T7_13798_G07	CTCTCTCTCTTTCTCCTGTCTTCCCTTCTCTTCCTC
T7_13799_G07	TCTTTCCCTCCCCTTCTGTCTCTCCTTTCCTCTCTT
T7_13800_G07	CTCTCCTTCTTTCCTTCGTCCTTCCCTCTTCCTCTT
T7_13801_G07	TCTCCTTCCTCCTCTTCGTCCTTCCTCCTCTCTTTT
T7_13802_G07	TCTCTTCTTCTCTCTCCGTCCTCCTTCTCTCTCTCT
T7_13803_G07	TTCTCTCCCTTCTTCCTGTCCCCTCTCTTTCTCTTC
T7_13804_G07	TTCTCTCTTCCCTCTCCGTCCTCCCTTTCTTTCCTT
T7_13805_G07	CTTTCTTTCCCCTCTTTGTCTTTCCCCTTCCTCCTC
T7_13806_G07	TTCCCTTCTCCCTTCTTGTCTTTCCTCTTCCTCTCC
T7_13807_G07	CTCCTCTCCTTCTTTCTGTCCTCTCTTTCTCTCTCC
T7_13808_G07	TCTCTCTCCTCCTCTCCGTCTCCCTTCTTTTTCTCT
T7_13809_G07	CTCTCCCCTTTCTCTTTGTCTTCCCTTTCTCCCTTC
T7_13810_G07	CCTCCTTTTCTCTTCCTGTCTCTTCCCCTTTCTTCC
T7_13811_G07	TTCTCCTCTCTTCTCTCGTCTTTCCCTTTTCTCCCC
T7_13812_G07	CTTCCTTTCCTTTCCCCGTCTTCTCCCTTCCTTCTT
T7_13813_G07	CCCTCTCTTTCTTTTCCGTCCTTCTTCTTCCTCCTC
T7_13814_G07	CCTCTTCTCCTCCCTTTGTCTCCTTTTTCCCTTTCC
T7_13815_G07	TCTTCTCTCTTCTTCTCGTCCTCTCTCCCTCTTCCT
T7_13816_G07	TTCCCCTTTCTCTTCTTGTCTCTCTTCCCTCTTCCC
T7_13817_G07	CCTTTTCCTCTCTCTTTGTCTCCCTCTCTCCTTCCT
T7_13818_G07	TCTTCCCTTTTCCTCCTGTCTCCTCTCCCCTTTCTT
T7_13819_G07	CCCTTCCTCTCTCTCCCGTCTTTTCTTTCTTTCCCT
T7_13820_G07	CTTCTCTCTTTTTCTCCGTCCTTCCTCCTCCCTCTT
T7_13821_G07	CTCTTTTCCTCTCTCCCGTCTTCCTCTTTTCCTCTC
T7_13822_G07	TTCCCCTCCCTCTTCTCGTCTTTCCTTTCTCCTTCT
T7_13823_G07	CCCTCTTTTCTCCTTCTGTCTTCTCCCTTTCTCTCC
T7_13824_G07	TTTTTCCTCCTCTTCTCGTCTTTCCTCCCTCTCCCT
T7_13825_G07	CTTTCCCCTCTTTCCTCGTCCTTCTTCCCTCTTCTT
T7_13826_G07	TTCTCTCTTTCTCTCCTGTCTTCTCCCTTCCTCCTC
T7_13827_G07	CTCCTTTCTTTCTCCCTGTCTTTCCCTTTCCTCCCT
T7_13828_G07	CCTTTCTTCCTTTCCTCGTCCTTTCCCTTTCTCTCC
T7_13829_G07	TTTCCTTCCTTCCCTCCGTCTTCCCCTTCTTCTCTT
T7_13830_G07	CTCCTCTCTCTTCTCCCGTCTTTCTCTTCTTCTCCT
T7_13831_G07	CTTCCTTCTCTCCTCTTGTCCTCTTCCTCTCCTTCT
T7_13832_G07	TCTCTCTCTCTTTCTTTGTCTTCCTTCCTCCTCCCC
T7_13833_G07	TTCTCCTTCCTTCTCTTGTCTTTCTCTCTCCCCTCC
T7_13834_G07	CCTTCCTTCTTTTCCTTGTCCTCCCCTCTCTCTTTC
T7_13835_G07	TTCTCCTTTCTTCTTTCGTCTCCCCTTTTCCCTCCC
T7_13836_G07	TTTCTCTCCTCCCCTCCGTCTTCCCTTTTCTTTCTC
T7_13837_G07	CTCCCTTCCCCTTCTTCGTCTCTTTCTTCTTTCCTC
T7_13838_G07	CCCTCTCTTTTCTCCCCGTCTCTCTTTCCCCTTTTT
T7_13839_G07	TCCCTCCTCTCCTTCTTGTCCTTTTTCTCCTCCTTC
T7_13840_G07	TCTCTTTTCTCCCTTCTGTCCTCCTCTCTCTCTCCT
T7_13841_G07	CTTCTTCCTCTTCTCTCGTCTCCTCTCCTTCCCTTT
T7_13842_G07	TCTTCTTCCTTCTTCTCGTCCTCCTTCCTTTCCCTC
T7_13843_G07	CTCCCTCCTCTTTTTTCGTCTCTCCCTTCCCTTTTC
T7_13844_G07	TCTCTTTCCTTCTCTCCGTCCCTCTTCCCTTCTCTT
T7_13845_G07	CTCCTCTTCTTCTCTCTGTCCTCTCTTCTTCCTTCC
T7_13846_G07	TCTTCTTTTTTTCCCTCGTCCTCCTTCCTCTCTCCC
T7_13847_G07	TCCCCTTCCCCTCCCTTGTCTTTTTTCTCTCCCTTT
T7_13848_G07	TTCTCTTCCTTCCCCTTGTCCTTCTCTTCTCCCTCT
T7_13849_G07	TCCTTCTTTTCTTTCTCGTCTTCCCTCCTCCCTTCC
T7_13850_G07	CTCCTTCCTCTCTTCTCGTCTTTTCTTCCTCCCTTC
T7_13851_G07	CTCTCTCTCTCCTCCCCGTCTTCCTCTTTTCTTTTC
T7_13852_G07	CTCCTTCCTTCTTCTTTGTCTTCTTTCCCCTCCTCC
T7_13853_G07	CCTCTCCTTCCTCTTTTGTCCTTTCCCCTCTTCTTC
T7_13854_G07	CTCTCTTCCTTCCCTTCGTCTTTTTCTCCTCCTTCC
T7_13855_G07	CTTCTCTCTTCCCCTCTGTCCCTTCCTTCTTTCTTC
T7_13856_G07	TCTTCCTCCCTTCTTCTGTCTCCCTTCCTTTCCTTC
T7_13857_G07	CTCCTCTCTTCTCTCCTGTCTTCTTTCCTTCCTTCC
T7_13858_G07	TCTCTTCTCCCTCTCCTGTCTCCTCTTTTCCCTCTT
T7_13859_G07	TCTCTCTCTTTCCTCTTGTCTCCCCTCTCCTTCCTT
T7_13860_G07	CTCTTTCTTTCCTCTCCGTCCTTCTCTCTTCCCCTT
T7_13861_G07	CCTCTCCTTCTCCTCTTGTCTTCTTCTCTCCTTCCT
T7_13862_G07	TCTCTCCTCCCCTTTTCGTCTTCTTTCTCCTCCTCT
T7_13863_G07	CTTTTCTCCTCCTTCTCGTCCCCTCCTCTTTCTCTT
T7_13864_G07	CTCTCTCTTCCTTTCTCGTCTTCTCTCTCCTCCCTT
T7_13865_G07	TTCTTCCTTCCTCTCCCGTCTTCCTCTTTTTCTCCC
T7_13866_G07	TCCTTTTCCCTCTTTCTGTCCTCTCCTTTCTCCTCC
T7_13867_G07	CTCCCTCCTTCTCTTCCGTCCCTTTTTTTTCCTCCT
T7_13868_G07	TTCTTCCCTTTCCTCCTGTCTCTCCCTCTCTTTTCC
T7_13869_G07	CCTTTTCTTTTCCTTCCGTCCTCCCTTTCCCCTTTC
T7_13870_G07	TCCTCCTCTCCCTTCCTGTCCTCTCTTCCTTTTCTT
T7_13871_G07	TTTCTCCCTCTTCTTTTGTCCTCCTCTCCTCCTCTC
T7_13872_G07	TTCCTTTCCTCTCCTTCGTCTCCTCCCTTTTCTTCC
T7_13873_G07	CCTCCTCTTTTCTCTTCGTCCCTTTCTTCTCTTCCC
T7_13874_G07	TCTTCCCTCCTTTCTCCGTCTTCTCTCTTCCCTCTT
T7_13875_G07	TCCTTCCCTCCCTTTCCGTCCTCCTTTTTCTCTTTC
T7_13876_G07	CTCCCTCTCTCTTTCCTGTCTCTTCCCCTCTTTTCT
T7_13877_G07	TTTCCCTCCCCTTCTTTGTCTCTTCCCTTCCCTTCT
T7_13878_G07	CCTTCTCCCTTCCTCCTGTCCTCTTCTCCCTTTTTT
T7_13879_G07	TTCTTCTCCTCCTTCTCGTCCCCTTTCTCCTTTCCT
T7_13880_G07	TTCTTCCTTCTTCCCTCGTCCCCTCTTCCTTTCTTC
T7_13881_G07	CCTTCCTTCTCTCTCTTGTCCCCTCTTTCCTCTCTT
T7_13882_G07	CTCTCTTCTCTTCCTTCGTCTTCTTCTTCCCTCTCC
T7_13883_G07	CCTCTCCTTTCTCTCTCGTCTCCTTTCTCCCTTCTT
T7_13884_G07	CCTCTCTTCTTTCCTCCGTCTCTTCTTCCCTCTCTT
T7_13885_G07	CTTTCTTTCTCCCCTTCGTCCCTTCTTCTCTTTCCC
T7_13886_G07	CCCTCTCCTTCTCCTCTGTCCCTTTTCTTTTCTTCC
T7_13887_G07	CCTTCCTTTCCCTTCCCGTCTCTTTCCTCTCTTCTT
T7_13888_G07	TTCCCTCTTTCCTCTTCGTCTCCTCTTTCTTCTCCC
T7_13889_G07	CTCCCTTCTCTTCCTCTGTCCTTTTCCTCCCTTTCT
T7_13890_G07	CTTCCCCTCTTTTCTCTGTCCTCTCCTTTCCCTTCT
T7_13891_G07	CTCTTCCTTCCCTCTTCGTCCTTTTTCCCTCTCCTT
T7_13892_G07	TCCTCTTTCCTCTCTCCGTCTTCTTTCTTCCCTCCT
T7_13893_G07	TTCCTTTTCCTCTCTCTGTCCTCTCCTTTCTCCCCT
T7_13894_G07	TCTCTCCCCTTTCCTCTGTCTTCTCTTTCTCTTCCC
T7_13895_G07	TCCTTCTTCCTTTCCTCGTCTCTTTCTCTCCCCTCT
T7_13896_G07	TTCCTCTTCTCCCCTCTGTCTTCTCCTCTCTCTTTC
T7_13897_G07	TCCTCTCCTCCTTCTCTGTCCCCTCTCTCTTTTTCT
T7_13898_G07	TCTCCTCCCTTCCCTCCGTCCTTCTTTCCTCTTTTT
T7_13899_G07	CCTCCCTTTTTTTTCTCGTCCCCTCTCTCTTCTCTC
T7_13900_G07	TTTCTTCTCTTTCTTCTGTCCTCCTCTCCCCTCCCT
T7_13901_G07	CCCTCTTCCTCCTCCCTGTCTTCTCTCTTTTCTTCT
T7_13902_G07	TCTCCTCTCTCCTTCTTGTCCTCTTCTCTTTCCTCC
T7_13903_G07	TTCTTCTCTCCTTTCTCGTCTCCTCTCCTTCCCTTC
T7_13904_G07	TTTCCTCCTCTCTCTTTGTCTCCTCCTCCTTTTCCC
T7_13905_G07	TCCTCTCCTCTCTTTTCGTCTCCCTTTTTCTCCTCC
T7_13906_G07	CTCTTCCTCTCTCCTTCGTCCTCTCTTCTTTCTTCC
T7_13907_G07	CCTTTTTCTTTCCTTCTGTCCCCTCTTCTCTCTCCC
T7_13908_G07	TTCTCTCTCCTTCTTTCGTCTCCTCTTCTCTCCCCT
T7_13909_G07	TCCTTCTTCTCTCTTCTGTCCTTCCTCTCCTCTCCT
T7_13910_G07	CCTTCTTCTCTCTTCTTGTCCCTTTCTCCCTCCTCT
T7_13911_G07	TTCCCTTCTCCCTCCCCGTCCTTTTCTTCTTTCTTC
T7_13912_G07	TTCTCCCTTCTCTTCCTGTCCTTTTCCTTCCTTCCC
T7_13913_G07	CTCTCTCTTCTTCTTCTGTCCTCCCTTCCTTTCCTC
T7_13914_G07	TTTCCTCTCTTTCCTCCGTCTCTCTCCTTTTCCCTC
T7_13915_G07	CTTTCTCTCTCCCTCCCGTCTCCTTTTTTTTCCCCT
T7_13916_G07	CTTCTTTCCCCTCTTCTGTCCTCTCCTTCCTCTTTC
T7_13917_G07	CCTTTCCTTCTCTTCCCGTCCCCTTCTTTCCTTTTC
T7_13918_G07	CTCTCCTTTTCTCCTTTGTCCTTTCTTCCCTCCTCC
T7_13919_G07	CTCCTTCCCCTTTTCCTGTCCTCTTCTTCTCTCTCT
T7_13920_G07	TTTCTTTCCCTTCCTTCGTCCCTCTCCCTCTTCTTC
T7_13921_G07	CCCTCTTTTTCCCTTCCGTCTTCCTTTCCCTCTCTT
T7_13922_G07	TCCTTTCTTCTCCTCTCGTCCCTCCTTTCCTTCTTC
T7_13923_G07	CTTTCCTCTTCCTTCCCGTCTTCTCCTCTCTTTCTC
T7_13924_G07	CCTTTCCCTTCTTCTCCGTCCTTTCTTCCTTCTCTC
T7_13925_G07	CCTCCTTTCTCTTCCCTGTCTTCCCTCTCCCTTTTT
T7_13926_G07	CTCTCTCTTCTCTCTTCGTCCCTTCCCCTCTCTTTT
T7_13927_G07	CTCCCTCCTCTCTTCTCGTCTTTCCCCTTTCTTCTT
T7_13928_G07	TTTCCCTCTCTCCTTCCGTCCTCTCTTCTTCCTCTT
T7_13929_G07	CTTCCCTCCTCTCCTTCGTCCTCTCTTTCTTTTCCT
T7_13930_G07	TTCCTCCCTTCCTTTTCGTCTCTTCTCCCTCTTCTC
T7_13931_G07	TTTCTCCCTCTCTCTCTGTCTTTCCTTTCCCTCCTC
T7_13932_G07	TTCCCTCTTTCCTTCCTGTCTTCCCTTCCCTTCCTT
T7_13933_G07	TTCTCCCCTCTCTTCTCGTCTTCTCTCTCTCTTCTC
T7_13934_G07	TCCTTCTCTTTTCTCTTGTCCTTCCCTTCCCTCTCC
T7_13935_G07	TTCTTCCCTCCTTCCCCGTCTTCTTTTCCTCTTCTC
T7_13936_G07	CTTTCCTCTTTCCTCTCGTCTCTCCTCCTTCCTTTC
T7_13937_G07	CTCTCTCTCCTCTCTCCGTCTCTTTTCCCTTTTCTC
T7_13938_G07	TCCCTCTCTTTCTTTTTGTCTCTCTTCCTCCCTCCC
T7_13939_G07	CTTTTTCTTCCTCCCCTGTCTCTTCCTCTTCTCCTC
T7_13940_G07	CTCTCTTCCTTTCTCCCGTCTCCCTCCTCTTCTTTT
T7_13941_G07	TCTCCTTTCTCTCTTTTGTCCTCCCTTCTCTCCCCT
T7_13942_G07	CTCTTCTTCTTTCCTCCGTCTCCTCCTTCTCCTTCT
T7_13943_G07	CTCCTCTCTCTCTTTCTGTCTCTTCCCTCTTTCCCT
T7_13944_G07	CTCTTCTTCTCCCTTTTGTCTCCTCCTCTCCCTTTC
T7_13945_G07	CCTTTTCTTCTCTCTTCGTCCTCTCTTTCCCCTCCT
T7_13946_G07	CCTTTCTTCTTCTCTTCGTCCCTCTCCTTTTCCTCC
T7_13947_G07	TTCTTCCTCTTTCCTTCGTCCCCTCTTCTCCTCTTC
T7_13948_G07	CCTCCCTCTCTTTCTTTGTCCCTTTCTCCTTCTCCT
T7_13949_G07	CCTTCCTTCCTCTCTCTGTCCCTTTCTTCTCCCTTT
T7_13950_G07	TCTCTCCCTCCCTTCCTGTCTCTCTTTCTTTTCCCT
T7_13951_G07	CTCTCCTTCTCTCCTCCGTCTTTTTCCCTTTTCTCC
T7_13952_G07	CTCCCCTCTTTTTCCCCGTCTCTTTTTCTCTTTCCC
T7_13953_G07	TTCTTTCTCCTCTCCCTGTCTCTCCCTCTTTTCTCC
T7_13954_G07	CTCCTTCCTCCTCTTTCGTCCTTTCTTCTCCTCCTT
T7_13955_G07	CCTCTTCCTTCCCTCCTGTCCTTCCTTCTTCCTTTT
T7_13956_G07	TTCTTTCCTCTCCCCTTGTCCTCTCTCTCCTTTCCT
T7_13957_G07	CTTTTCTCCTCTCCCTCGTCTTCTCCCCTCTCTTTT
T7_13958_G07	TCTTTCTCTCTCTCCTTGTCCTCTTTCCCCTCTCCT
T7_13959_G07	TCCTCCTTTTCCTCCCTGTCTTCTCCTTCTCTCCTT
T7_13960_G07	TTCCCTCCTTCTTCTTTGTCCCTCCCTCCCTTTTCT
T7_13961_G07	CTCTTCCTCCCTTCCTTGTCCCTCTTCTTTTCCTCT
T7_13962_G07	CTCTTTTCTTCCTCCCCGTCTCTCTCTCTCTCTTTC
T7_13963_G07	TTCCTCCTTTCTCTTTTGTCCTCTCCCTCCCTCTCT
T7_13964_G07	TCTCCTCTTTCTCCTCCGTCTTTCTCTTCTCCTTCC
T7_13965_G07	CTCTCTTCCTCTCCTCTGTCTCTCTCTCCTTCTCTT
T7_13966_G07	CTCTCCCTTTCTTCTTTGTCCCTCTTCCCTTTCTCC
T7_13967_G07	CCTCTCCTTTTCTTTCCGTCTCCTCTTCTCTCCTCT
T7_13968_G07	TTCTCCCTTTCCTCCCCGTCTTTTCCTCTCTCTTCT
T7_13969_G07	CCCTCCTCTTTCTTCCTGTCCTTTTCTCTCCCCTTT
T7_13970_G07	TCTCTCCCTCCTTTTCCGTCTTCCTTCCTTCTCTCT
T7_13971_G07	TTCCTCCTTCTCTTTCTGTCCTCTCTCCTCCTCTCT
T7_13972_G07	CTCCCTTCTCCCTTTTCGTCCTTCTTCCTCTTTCCT
T7_13973_G07	TCCTCTCTCTTTTCTTCGTCCCTTTCCTCTCTCTCC
T7_13974_G07	TCTTTTTCCCTTCCTCTGTCCCTTCTCCCTCCTTTC
T7_13975_G07	CCTCCTCTCTTTTTCCCGTCTTTTCCTCTCTCCCTT
T7_13976_G07	CTCTCTTCTTCTTCTCTGTCCTTTCTCTCCCCTCTC
T7_13977_G07	CTTCTCCTCTTTTCTTCGTCTTCCCTTCCTCTTCCC
T7_13978_G07	TTTCCCTTTCTTCCTCTGTCCTCCTCTCTTTCCTCC
T7_13979_G07	CTTCCCCTCTCTCTCCCGTCCTTCTCTTTTTCTCTT
T7_13980_G07	TCCCTCTCCTTCTCCTTGTCCCTCCCCTTTTTTTTC
T7_13981_G07	CTCCCCTCCTTTCTCTTGTCTCCTTTTCCTTTCCTC
T7_13982_G07	TTCCTTCTTCCTCCTTCGTCCTCCTCTTTCTCTTCC
T7_13983_G07	CTTCTCTCTCTCTCTCCGTCTCCTCTTTCTCTCTTC
T7_13984_G07	CTCTTCTCCCTTCCTCTGTCCTCTTTCTCTTCTCTC
T7_13985_G07	CTTCTTCTCCCTCTCTTGTCCCTCCTTCTTCCTCTT
T7_13986_G07	TCCTTTCCTCTCTTTTTGTCCCTTCTCTCTCCTCCC
T7_13987_G07	CTTTCCCTCCTTTTTCTGTCCTTCTCTCTCTTCCCC
T7_13988_G07	CCTCCTTTTTTCTCCCTGTCTCCTCTTTCCCTTCCT
T7_13989_G07	TCTCTCCCCTCTTTTCTGTCCTTTCTTCCTCTCCCT
T7_13990_G07	TTCTTTTCCCTTCCTCTGTCCCCTTCCTTTTCCTCC
T7_13991_G07	CTCTCTCTCTTCTCTCCGTCTCTCTTTTCCTCTCCT
T7_13992_G07	CTTCCTCTTTCCTTTCCGTCCTTCCCTTCTCCTTTC
T7_13993_G07	TTTCTCTCCTCTCTCTCGTCTTCCTTCCCTTCTCCT
T7_13994_G07	TTTCCCCTTCCCCTTCTGTCCTTCTCTTTTCCCCTT
T7_13995_G07	CTCTCTCCTCCTCTCTCGTCCTTTTTTCTCCTCTCT
T7_13996_G07	TTCCTTCTTCTCTCTCCGTCTTCTTCTCTTCCTCCC
T7_13997_G07	CTCCCCTTCTTTCTCCTGTCCTCCTTCTCCTTTTCT
T7_13998_G07	CCTTCCTCTTCCTCTTCGTCCTCCTTCCCTTTCTTT
T7_13999_G07	TCTTTTTCCTCTCTTCTGTCTTCCCCTCCTTCTCCC
T7_14000_G07	CTTTCCTTCTTCCTCTCGTCTCCCTTTCCTCCTTTC
T7_14001_G08	GTTGTGTGTGTGTGTGGGTCTGTGTGTGTTGTGTGT
T7_14002_G08	GTGTTGTTTGTGTGTGTGTCGGTGTGGTTGTGTGTG
T7_14003_G08	GTGTGTGTGTGTGTGTTGTCGGTGTGTGTGTGTGTT
T7_14004_G08	GTGTGTGGTGTTGTGTGGTCTTGGTGTGTTGTGTGT
T7_14005_G08	GGTTGTGTGTGTGTGTTGTCGTGTGTGTTGTGTGTG
T7_14006_G08	TGTGTGTGTGTGTGTGTGTCTGTGTGTGTGTTGTGG
T7_14007_G08	TGTGTGTGTGTGTGTGTGTCGTGTGTGTGGTGGTTT
T7_14008_G08	TGTGTGTGTGGTGTGGTGTCGTTTGTGGTTGTGTGT
T7_14009_G08	GGTGTGTGTTGTGTGTGGTCTGTGTGTTGTGTGTGT
T7_14010_G08	GTGTGTGTTGTGTGTGTGTCGTGTGTGTTGTTGTGG
T7_14011_G08	GTTGTGGTGTGTTGTGTGTCGTGGTGTGTGTGTTGT
T7_14012_G08	TGTGTGTGTGTGTGTGTGTCGTGTTGGTGTGTGTGT
T7_14013_G08	TGGTGTTTGTGTTTGTTGTCGTGGTGGTGTGGTGGT
T7_14014_G08	TTTGGTGTGTGTGTGTGGTCTGTGTGTGTGGTGTGT
T7_14015_G08	TGGTGTTGTTGTGGTGTGTCGGTTGTGTGTGTGTGT
T7_14016_G08	GGTGTGTGTGTGTGTGTGTCTGTTGTTGTGTGTTGG
T7_14017_G08	GTGTTGTGTGTGGTGTTGTCTGTGTGGTGTGTGTGT
T7_14018_G08	TGTTGTTGTGTGTGTGTGTCGTGTGGTGGTGTGTGT
T7_14019_G08	TGTGGTGTGTGTGTGTTGTCGTGTGTGTGTGTGTGT
T7_14020_G08	TGTGTGTGTGTGTGTGGGTCTGTGTTGTGGTGTTGT
T7_14021_G08	TGTGTTGTGTTGTGTGTGTCGGTTGGTGTGGTGTGT
T7_14022_G08	TGTGTGTGTTTGGTGTTGTCGTGTGGTGTGTGTGTG
T7_14023_G08	GTGTGGTGTGTTGTGTGGTCTGTGTGTGTTGTGTGT
T7_14024_G08	TGTGTGTGTGTGTTGTGGTCTGTGTGTTGGGTGTTG
T7_14025_G08	GTTGTGTTTTGTGTGTGGTCTGTGGTGGTGGTGTGT
T7_14026_G08	GTGTGTGTTGTGTTGGTGTCGTGTTGTGTGTGGTGT
T7_14027_G08	TGTGTGGTGTGTGTTGTGTCGTTTGGTGTGTGTGTG
T7_14028_G08	TGTGTGGTTGTGTTGTGGTCTGTGTGTGTGGTGTGT
T7_14029_G08	TGTGTGTGGTGTGTGTGGTCTGTGTGTTGTGTGTGT
T7_14030_G08	TGTTGTGTGGTGTGTGTGTCGTGGTGTGTTGTGTGT
T7_14031_G08	TGTGTGTGTGTTGTGTGGTCTTGTGTGGTGGTGTGT
T7_14032_G08	TGTGTGTGGTGGTGTGTGTCTGGTTGTTTGTGGTGT
T7_14033_G08	TTGTGGTTGTGTGGGTGGTCTGTGTTGTGTGTGTGT
T7_14034_G08	TGGTGTGTGTGTGTGTGGTCTGTGTGTGTTGTTGTG
T7_14035_G08	GTGTTGTGTTGGTTGTGGTCTGGTTGGTGTGTGTGT
T7_14036_G08	TTGTGTGTGTGTGGTTGGTCTGTGTGTGTGTGTGTG
T7_14037_G08	TGTGTTTGTGTGGTGTGGTCTGTGTGGTGTGTGTTG
T7_14038_G08	TGTGTGTGTTGTGTGGTGTCGTGTGGTGTGTTTGTG
T7_14039_G08	GTGTGGTGGTTGTGTGGGTCTGTTTGTGTGTTGTGT
T7_14040_G08	TGTGTGGTGTGTGTGTTGTCGTTGTGTGGTGTTGTG
T7_14041_G08	TGTGTGTGGTTGTGTGTGTCGGTTGTGTGTGTGTGT
T7_14042_G08	TTGTGTGTGTGGTGTGGGTCTGTGTGTGTTGTGTGT
T7_14043_G08	TGTTGTGTGTGTGTGTGGTCTGGTGTTGTTGTGTGG
T7_14044_G08	GTGTGTGTTGTGTGTGTGTCGTGTTGTGTGGTGTGT
T7_14045_G08	GTGTGTGTGTGTGTGTTGTCTGTGTGTGTGTTGTGG
T7_14046_G08	GTGTGTGTTGTGTGTGTGTCGTGTTGTGTGTGTGTG
T7_14047_G08	TGTGTGTGTTGTGTGTGGTCGTTGTGTGTGTGTGTG
T7_14048_G08	TGTGGTGTGTGTGTGTGGTCTGTGTGTGTGTGTTGT
T7_14049_G08	GTTGGTGTGTTGTGGTGGTCTGTTGTGTGTGTGTGT
T7_14050_G08	GTTGTGTGTTGGTGTGTGTCGTGTGTGTGTGTGTGT
T7_14051_G08	TGTGTTGGTGTGTGTTGGTCTGTGTTGTGGTGTGTG
T7_14052_G08	TTGTGTGTGTGTGTGGTGTCGTGTGTGTGTGTGTTG
T7_14053_G08	TTGTTGTGTGTGTGTGGGTCTGTGTGTGGTGTGTGT
T7_14054_G08	TGTGTGTGTGTTGTGTGGTCTGTGTGTGGTGTTGTG
T7_14055_G08	GTGTGTGTGTGTGTTGTGTCGTTTGTGTGTGGGTGT
T7_14056_G08	GTGTGTGTGTGTGTGTGGTCTGTGTTGTGTTGTGTG
T7_14057_G08	GTGTGGTGTGTGTGTGTGTCTGTTGTGTGTGTTGTG
T7_14058_G08	TGTGTGTGGGTGTGTGTGTCGTGTGTGTGTTTGTGT
T7_14059_G08	TGTTGTGTTGTGTTGTGGTCGGTGTGTGGTGTGTGT
T7_14060_G08	TGTGTGTGTGTGGTTGTGTCGTGTTGTGTGTGTGTG
T7_14061_G08	TTGTGTTGTGGTGTGTGGTCTGTTGTGTGGTGTGTG
T7_14062_G08	TTGTGTGTGTTGGTGTGGTCTGTGTTGGTGTGTGTG
T7_14063_G08	TGTTGTGTTGTGTGTGTGTCGTGTGTGTGTGTGGTG
T7_14064_G08	GTGTGTGTGTGTGGTGTGTCGTGTGTGTTGTTGTGT
T7_14065_G08	TGTTGTGTTGTGTGTGGGTCTGTGTGTGTGTTGTGG
T7_14066_G08	GTGTGGTGTGTGGTGTGGTCTTGTTGTGTGTTGTGT
T7_14067_G08	TGTGTGTGTGTGTGTGTGTCTGTGTGTGTGTGTTGG
T7_14068_G08	TGTGTGGTGTGTGTTGTGTCGTGTGGTGTGTGTTGT
T7_14069_G08	TTGTGTGTGTGTGTGTGGTCTGTGTGTGGTGTGTGT
T7_14070_G08	GTGTGTGTGTGTGTGTGGTCTTGTGGTGTGTGTTGT
T7_14071_G08	TTGTTGTGTGTGTGTGTGTCGTGTGTGTGTGTGTGG
T7_14072_G08	GTGTGTGTGTTGTGTGTGTCGGTGGTGTTGTTGTGT
T7_14073_G08	TTGTGTTTGGTGGTGTGGTCTGTGTGGTGTGTGTGT
T7_14074_G08	GTTGTGGTGTGTGTGTGGTCTGTTGTGTTGTGTGTG
T7_14075_G08	GTGTGTGTGTGTGTTGTGTCTGTGTGTGTGGTGTGT
T7_14076_G08	GTGTGTGTGTGTTGTGTGTCGTGGGTTGTGTGTTGT
T7_14077_G08	TGTGTGTGTGTTGTGGTGTCGTTGTGTGGTGTGTGT
T7_14078_G08	GTGTGTGTGTGTTGTGTGTCGTGTGTGTGTGTTGTG
T7_14079_G08	GTGTTGTGGTGTGTGTGGTCTGTTGTTGTGTGGTGT
T7_14080_G08	GTGTGTGTGTGTGTGTGGTCTGTTGTGGTGTGTGTT
T7_14081_G08	GTGTGTGTGTGTTTGGTGTCGTGGTGTGTGTGTTGT
T7_14082_G08	GTGTGTGTTGTGTGGTTGTCTGTGTGGTGTGTGTGT
T7_14083_G08	TGGTGTGTGTGTGTTGTGTCGTTGTGTGTGGTGTTG
T7_14084_G08	TGGTTGTGTGTGTGGTGGTCTGTGTGTGTGTGTGTT
T7_14085_G08	GTGTGTTGTGGTGTGGTGTCGTGTGTGTTTGTGTTG
T7_14086_G08	TTTGTGTGGTGTTGTGTGTCGTGTGTGTGTGTGGGT
T7_14087_G08	GTGTGTGTGTTGGTGTGGTCTGTGTGTGTGTGTGTT
T7_14088_G08	TTGTGTGGTGTGGGTTTGTCGTGTGTGGTTGTGTTG
T7_14089_G08	TGTGTGTGTGGTTGTGTGTCTGTGTGTGTGGTGTGT
T7_14090_G08	GTGTTGGTGTTGTGTGTGTCGTGGTGTGTGTTGTGT
T7_14091_G08	GTTGTGTGTGTGTGTGTGTCGTGTGTGGTGTGTTGT
T7_14092_G08	TGTGTGTGTGTGTGTGTGTCGTGTGTGGTGTGTGTT
T7_14093_G08	TGTGTGTGTGTGGTGTGGTCTGTGTGTGTGTTGTGT
T7_14094_G08	GTGTTTGGTGTGTGTTGGTCTGGTGTGTGTTGTGTG
T7_14095_G08	GTGTGTGTGTGTGTTTGGTCTGTGTGTGTGTGTGTG
T7_14096_G08	GTGGTGTTGGTGTTGTGGTCTGTGTGTTGTGTTGTG
T7_14097_G08	GTTGTGTGTGTGTGTGGGTCTGTGTGTTGTTGTGTG
T7_14098_G08	TGTGTGTGTGGTGTGTGGTCTGTTGTGTTGTGTGTG
T7_14099_G08	TGTGTTGTTGTGTGGTGGTCTGTGGTGTGTGTGTGT
T7_14100_G08	GTGTGTGTGTGTGTGGTGTCGTGTTTTGTGTGTGGT
T7_14101_G08	TGTGTGTGGTGTGTGTTGTCGTGTTGGTGTGTGTGT
T7_14102_G08	GTGTGTGTGGTGTTGTGGTCTGTGTGTGTGTGTTGT
T7_14103_G08	TTGTGTGTGTTGGTGTGGTCTGTGTGTGTGTGTGTG
T7_14104_G08	TGTGTTGGTGTGTGTGTGTCGTGTGTGTGTGTGTGT
T7_14105_G08	GTGTTGTTGTGTGTGTTGTCTGGTGTGTGTGGTGTG
T7_14106_G08	TGTGTGTGGTTGTTTGTGTCGTGGTGTGGTGTGTTG
T7_14107_G08	TGTTGTTGTGTGTGTGTGTCGTGTGTGGGTGTGTGT
T7_14108_G08	TGTGTGGTGTGTGTGTGGTCGTGTTTGTGTGTGTGT
T7_14109_G08	GTGTGTGTTGTGTGTGTGTCGTGTGTGTTGTGTGGT
T7_14110_G08	TTGTGTGGTGGTGTTGTGTCGTGTTGTGTGGTGTGT
T7_14111_G08	GTGTGTGTGTGTGTGTTGTCGTGTGTGTGTGGTTGT
T7_14112_G08	GTTGTGTGTGGTGTGTGGTCTTGTGTGTGTGTGTGT
T7_14113_G08	TGGTGTGTGTGTGTGTGGTCTGTTGTGTTTGGTGTG
T7_14114_G08	TGTGTGTGTGTGTTGTGGTCTGGTGTGTGTGTGTGT
T7_14115_G08	GTGTGTGGTGTGTGTTGGTCGTGTGTGTTGTGTGTT
T7_14116_G08	GTGGTGTGTGTGTGTGTGTCGTGTTGTTGTTGTGTG
T7_14117_G08	TGTGTGGTGTTGTGGTGGTCTGTGTGTTGTGTGTGT
T7_14118_G08	GTGTGTGTGTGTGTGGTGTCGTGTTTGTGTGTTGTG
T7_14119_G08	TGTGGTTGTGTGTTGGTGTCGGTGTGTGTGTGTGTT
T7_14120_G08	TGTGTTTGTGTGTGTGTGTCGTGGTGTGTGTGTGTG
T7_14121_G08	TTGGTGTGTGTGTTTGTGTCGTGTGTGGTGTGTGTG
T7_14122_G08	GTGTGTGTTGTGTGTGTGTCGTGTGTGGTTTGGTGT
T7_14123_G08	GTGTTGTTGTGTGGTGTGTCGTGTGTGTGTGTGTGT
T7_14124_G08	TGTGTTGTGTGTTGTGTGTCGTGTGTTGTGGGTGTG
T7_14125_G08	GTGTGTGTGTGTGTTGGGTCTGTGTGTGTTGTGTGT
T7_14126_G08	GTGTGTTGTGTGTGTGTGTCGGTGTGTGTTGTGTGT
T7_14127_G08	TGTGGTTGTGTGTGTGTGTCGGTTGTGTGTGTGTGT
T7_14128_G08	GTTGTGTGTGTGTGTGTGTCGTGGTGTTGTTGTGTG
T7_14129_G08	GTGTGTGTGTGTTTGGTGTCGTTGTGTGTGTGTGTG
T7_14130_G08	GTGTGTGTGTGTGTGGTGTCGTGTGTTTGTGTGTGT
T7_14131_G08	TGTGGTGTGGTGTGTGTGTCTTGTGTGTGTGTGTGT
T7_14132_G08	GTGTGTGGTGTTGTGTGGTCTGTGTTTGTGGTGTGT
T7_14133_G08	TGTGTGTGTGTGTGTGTGTCGTGTGTGTGTGTTGTG
T7_14134_G08	GTGTGTGGTGTGTTGTTGTCGTGTGGTGTGTGTGTT
T7_14135_G08	TGTGTGTGTTGGTGTTGGTCTGGTGTGTTGTGTGTG
T7_14136_G08	GTGTGTGTGTTGTGTGTGTCGTTTGTGGTGTGTGGT
T7_14137_G08	TGTGTGTGGTGTTGTGTGTCGTGTGTGTTGTGTGTG
T7_14138_G08	TGTGGTGTGGTGTGTGTGTCGTGTGTGTTTTGTGTG
T7_14139_G08	TGTGTGTGTGGTGTGTGGTCTGTGTGGTGTTGTTGT
T7_14140_G08	TGTGTGTGGTGTGTGTGGTCTGTTGTTGTGTGTGTG
T7_14141_G08	GTGTGTTTGTGTGTGTGGTCTGTGTGTGTGGTGTGT
T7_14142_G08	GTGGTGTTGTGTGTGTGGTCTGTGTGTGTGTGTTGT
T7_14143_G08	GTGTGGTGTTGTGTGTGGTCTGTGTGTGTTTGTGTG
T7_14144_G08	TGTTGTGTGTGTGGTGTGTCGTGTGTGTGTGTTGTG
T7_14145_G08	TGGTTGTTGTGTGTGTGGTCGGTGTGTGTTGTGTGT
T7_14146_G08	TGTGTGTGTGTGTGTGTGTCGGGTGTTGTGTGTTGT
T7_14147_G08	TGTGTGTGTGTGTTGTGGTCTGTTGTGTGTGGTGTG
T7_14148_G08	GGTGTTGTGTGTGTGTGGTCTGTTGTTGTGTGTGTG
T7_14149_G08	GTGGTTGTGTTGTGTGTGTCGTGTGTGTGTGTGTGT
T7_14150_G08	TTGTGTGTGTGTGTGTGGTCTGTTGTGTGGTGTGTG
T7_14151_G08	TGTGTGTGTGTGTGTGTGTCGGTGTGTTGTGTGTGT
T7_14152_G08	TGGTGTGTGTGTGTGTGGTCTTGTGTGTTGTGGTGT
T7_14153_G08	GTGTGTGTGTGTGTGTGGTCTTTGTGTGTGTGGTGT
T7_14154_G08	GTGTGTGGTGTGTTGTGGTCTGTGTGTGTGTTGTTG
T7_14155_G08	TTGTGTGTGTTGTGTGTGTCGTGTGGTGGTGTGTTG
T7_14156_G08	GTGTGTGTGTGTGTGTGGTCTTGTGTGTGGTGTGTT
T7_14157_G08	TGTGTGTGTGTGTTGGGGTCTGGTGTTTGTGTGTGT
T7_14158_G08	TGTGTGTGTGTGTGTGTGTCGTGTGTGTGGTGTTGT
T7_14159_G08	GTGTGTGTGTGTGTGTGGTCTGTGTGTTGGTGTTGT
T7_14160_G08	TTGTGTGGTGTGTGTGTGTCGTGTTGGTGTTGTGGT
T7_14161_G08	GTGTGTGTGTGTGTGTTGTCGTGTGTGTGTGTTGTG
T7_14162_G08	TGTGTGTGTGTGTTGTGGTCTGTGTGTGTGTGGTGT
T7_14163_G08	GTGTGTTGTGTGTGTGTGTCGTGTGGTGTTGTGTGT
T7_14164_G08	GTGTGTGTGTGTGTGTTGTCGTTGTGTGTGTGTGGT
T7_14165_G08	TGTTGTGGTTGGTGTGGGTCTGTGTGTGTTGTTGGT
T7_14166_G08	TGTGTGTGTGTGTGGTGGTCTGTGTGTGTGTGTTGT
T7_14167_G08	GTTGTGTGGTGGGTGTTGTCGTGTGTTGTGTGTTTG
T7_14168_G08	GTGTGTGGTGTGTGTTGGTCTGTGTGTGTGTTGTGT
T7_14169_G08	GTGGTGTGTTGTGTGTGGTCTGTGTTGTGTGTGTGT
T7_14170_G08	TGTGTGTGTGGTGGTGTGTCGTGTTGTGTGTGTTGT
T7_14171_G08	TGTGTGTGTGTGTGTGTGTCTGTGGTGTGTGTGTGT
T7_14172_G08	GTTGTGTGTGTGTGTGTGTCTGTGTGTGTGTGTTGG
T7_14173_G08	TGGTGGTGTGTGTGTTTGTCGTGTGGTGTGTTGTGT
T7_14174_G08	GTGTGTTGGTGTGTGTGGTCTGTGTGTGTGTGTTGT
T7_14175_G08	TGGTGGTGTGTTGTTGTGTCGTGTGTGTGTGTGTGT
T7_14176_G08	TGTGTTGTTGTGTTGGTGTCGGTGTGTGTGTGTGTG
T7_14177_G08	TGTGTGTGGTTGTGTGGGTCTGTTTGTGTGTGTGTG
T7_14178_G08	GTGTTGTGTGGTTGTGTGTCGTGGTTGTGTGTGTTG
T7_14179_G08	TGTGTGTGTGTGTGTGGGTCTTGTGTGTTGTGTGGT
T7_14180_G08	GTGTGTTGGTGTTGTGTGTCGTGTGTGGTGTTGTGT
T7_14181_G08	GTGTGTGGTGTTGTGTGGTCTGTGTGTGTGTTGTTG
T7_14182_G08	TGTGTGTGTGTGTGTGTGTCGTGTTGTGTTGGTGTG
T7_14183_G08	TTGTGTGTGTGTGGTGTGTCGTGTGTGGTGTTGTGT
T7_14184_G08	GTGTGTGTTGTGTGTGTGTCGTGGTGGTTGTGTGTT
T7_14185_G08	TGTTGTGTGTGTGTTGTGTCGTGTGGTTGGTGTGTG
T7_14186_G08	GTGGTGTGTGTGTTTTGGTCTGTGTGTGTGTGTGTG
T7_14187_G08	GTGTGTGTGTGTTTGTGGTCTGTTGTGTGTGTGGTG
T7_14188_G08	TTGTTGTGTGTGTGGTGGTCTTGGTGTTGGTGTGTG
T7_14189_G08	GGTGTGTGTTGTGTGTGGTCTGTGTGTGTTGTGTGT
T7_14190_G08	TTGTGTGTGTGTGTGGTGTCGTTGTTGTGTGGTGGT
T7_14191_G08	TGTGTGTGTTGGTTGTGGTCTGTGTGTGTGTGTGTG
T7_14192_G08	GTGTGTGTTTGTGTGTGGTCTGGTGTGTGTGTGTGT
T7_14193_G08	TGGTGTGGTTGTGTGTGGTCTGTGGTGTGTGTGTTT
T7_14194_G08	GTGTGTGTGTTTGTTGTGTCGGTGTGTGTGTGTGTG
T7_14195_G08	GTGTTTGTGGTGTTGTGGTCTGTGTGTGTTGGTGTG
T7_14196_G08	TGTGTGTGGTGTGTGGTGTCGTGTGTTTGTGTGTGT
T7_14197_G08	TGGTGTGTTGTGTTGTGGTCTGTGTGTGTGGTGTGT
T7_14198_G08	TGGTTTGTGTTGGTGGTGTCGTGTTGTGTGTGTGTG
T7_14199_G08	GGTGTGTGTTTGTGTTTGTCGTGTGTGTTGGTTGGG
T7_14200_G08	TTGTGGTGTGGTGTGTGGTCTGTGTGTGTGTTGTGT
T7_14201_G08	GTGTGTGTGTGTTTGTGGTCTGTGGTGTGGTGTTGT
T7_14202_G08	GTTGTGTGTTGTTGTGTGTCGGTGTGTGTGTGGTTG
T7_14203_G08	TGTGTTGGTGTGTGTGTGTCGTTGTGTGGTGTGTTG
T7_14204_G08	TGTGGTGTTGTGTGTTGGTCTGGTTGTGTGTGTGTG
T7_14205_G08	GTTGGTGTGTGTGTGTGGTCGTTGTGTGTTGTGTGT
T7_14206_G08	TGTTGTTGTGTGTTGTGGTCGTGTGTGGTGGTGTGT
T7_14207_G08	TGTGTGTTGTGTTGTGTGTCGTGTGTGTGTGTGTGG
T7_14208_G08	TGTGTGTGTGTGTGTGTGTCTGTGTGTTGTGTGGTG
T7_14209_G08	TGTGTGGTGTGTTGTGTGTCGTGTGTGTGTGTTGTG
T7_14210_G08	GTGTGTGTGTGTTTGTGGTCTGGTGTTGTGTGTGTG
T7_14211_G08	GGTTGTGTGTGTGTGTTGTCGTGTGTGTGTGTGTGT
T7_14212_G08	TGGTGTGTGTGTGTGTGGTCTTGTGTGTGTGTGTGT
T7_14213_G08	TGTGTGTGTGTTTGTGTGTCGGTGTGTGTGTGTGTG
T7_14214_G08	GTTGTTGTGTGTGGTGTGTCGTGTGTGTGTGTGTGT
T7_14215_G08	TGTGGTTTGTGGGTGTGGTCTGTGTTGTGTGTTGTG
T7_14216_G08	GTGTTGTGTGTGTGTGTGTCGTTGTGTGTGGTTGTG
T7_14217_G08	GTGTGTGGTGTGTTTGTGTCGGTGTGTGTGTTGTGT
T7_14218_G08	TGTGTGTGTGTGTGTGTGTCGGTGTGTTTGTGTGTG
T7_14219_G08	GTTTGTGTGTGGTGGTGGTCTGTGTGTGGTTGTTGT
T7_14220_G08	GTGTGTGTGTGTTGTGTGTCGTGTGTGTGGTGTGTT
T7_14221_G08	GTTTTGTGTGTGTGGGTGTCGTGTGTGTGTGTGTGT
T7_14222_G08	GTGTGTGTGTGGTGTGTGTCTGTGTTGGTTTGTGTG
T7_14223_G08	TTGTGTGTTGTGTGTGTGTCGTGTGTGTGTGTGGTG
T7_14224_G08	TGTGTGTTGTTGTGTGTGTCGTGGTGTGTGTGTGTG
T7_14225_G08	TTGTGTGGTGTGTGTGTGTCGTGTGTGTGTTGTGTG
T7_14226_G08	TGTGTGTGTGTTGTGGTGTCGTGTGTGTGGTGTTGT
T7_14227_G08	GTGGTGTGTGTTTGTGTGTCGTGTGTGTGTGTGTGT
T7_14228_G08	TGTGTGTGTGTGTGTGGGTCTTGTGTGTGTGTGTGT
T7_14229_G08	TGTTGTGTGGTGTGTGTGTCGTGTTGGTGTGTGTGT
T7_14230_G08	TGTTGGGTGTGTGTGTGGTCTGTGTGTGTTTGTGTG
T7_14231_G08	TGTGTTGTGTGGTTGTGGTCTGTGTGGTGTGTGTTG
T7_14232_G08	TGTGGTGTGTTGTGTGTGTCGTGTTGTGTGTGTGTG
T7_14233_G08	GTGTGTGTTTGTGTTGTGTCGTGTGTGGTGTGTGTG
T7_14234_G08	GTGTGTGTTGTGTGTGTGTCGTGTGTTGTGTGTGTG
T7_14235_G08	GTGTGTGTGTGTGGTTGGTCTGTGTTGTGTGTTGTG
T7_14236_G08	TGTGTTGTTGTGTGTGTGTCGTGTGTGGTGTGTGTG
T7_14237_G08	TGTGTGGTTGTGTTGTGGTCGTGTGTGGTGTGTTGT
T7_14238_G08	GTGTGTGTGTGTGTGTTGTCGGTGTGTGTGTGTTTG
T7_14239_G08	GGTGTGTGTGTGTGTTGGTCTGTTGTGTGTGTGTGT
T7_14240_G08	GTGGTGTGTTGTGTGTGGTCTGTGTGTGTGTGTTGT
T7_14241_G08	GGGTGTGTGTGTGTTGTGTCTGTGTTGTTGTGTGTG
T7_14242_G08	GTGTGTTGTGTGTTGGTGTCGTTGTGTGTGTGTGTG
T7_14243_G08	GTGTGTGTTGGTTGTGTGTCGTGTGTGTGTTTGGTG
T7_14244_G08	TGTGTTGTTGTGGTGGTGTCTGGTGTGTGTGTTGTG
T7_14245_G08	TGTTGTGGTGTGTGTGTGTCTGTGTGTGGTGTGTGT
T7_14246_G08	GTGTGGTGTTGTTGTGTGTCGTGTGTGTGTGTTGTG
T7_14247_G08	TGTTGTGTGTTGTGTGTGTCGGTGTGTGTGTGTGTG
T7_14248_G08	GTGGTGTGTGTGTGTGTGTCGTTGTGTTGTGTGTGT
T7_14249_G08	TGTGTGTGTGTTTGGTGGTCTGTGTGTGTGTGTGTG
T7_14250_G08	TGTGTGTTGTGTGTGTGGTCTGGTGTGTGTGTGTGT
T7_14251_G08	TGTTGTGGTTGTGTGTGGTCTGTGTGTGTGTGTGTG
T7_14252_G08	TGTGTGTGTGTGTTTGTGTCGTGTGTGTGGTGTGTG
T7_14253_G08	GTGTGTGTGGTGTTGTGGTCTGTGTGTGTTGTGTGT
T7_14254_G08	TGTTGTGTGTGTGTGTGGTCTTGTGTGTGTGTGGTG
T7_14255_G08	GTGTGTGTGTTGTGTGTGTCTGTGTGTGTGTGGGTT
T7_14256_G08	TGGTGTGTGTGTGTGGTGTCGTGTTGTGTTGTGTGT
T7_14257_G08	TGGTTGTGTGTGTGTTGGTCTGTGTGTGTGTGTGGT
T7_14258_G08	GTGTGTTGTGTGTGTGTGTCGTGGTGTGTGGTGTTT
T7_14259_G08	TGTGTGTGTGTGTTGTGGTCTGTGTGGGTGTTGTTG
T7_14260_G08	GTGTGGTGTGTGTTGTGGTCTGTGGTTTGTTGTGGT
T7_14261_G08	TGTGTGTGTGTGTGTGTGTCTGGTGTGTGTGTGGTT
T7_14262_G08	GTGTGTTGTGGTTTGTGGTCTGTGTGTGGTGTGTGT
T7_14263_G08	TGGTGTGGTTGTGTGTGGTCTGTGTGTTGTTGTGGT
T7_14264_G08	TGTGTGTGTGTTGTGTGGTCTTGTGTGGTTGGTGTG
T7_14265_G08	TGTTGTGTGTGTGTGGTGTCGTTGTGTGTGTTGTGG
T7_14266_G08	GTTTGTGTGTGTGTGTGGTCTGGTTGTGTGGTGTGT
T7_14267_G08	GTGTGTGTGTGTGTGTTGTCGTGTGTTGTGTGTTGG
T7_14268_G08	TGTGGTGTGTGTGTGTGGTCTGTGTTGGTGTTGTGT
T7_14269_G08	TGTTGTGTGTGGGTGTGGTCTGTGTGTGTGTGTTGT
T7_14270_G08	TGTTGTGTGTGTGTGTGGTCTGTGTGTTGTGTGGGT
T7_14271_G08	TGGTTGTGTGGTGTTGTGTCGTGTGTGTGTGTTGTG
T7_14272_G08	TGTGGTGTGTGGTTTTGGTCTTGGTGTGTGTGTGTG
T7_14273_G08	TGTGGTGTGGGTGTGTTGTCTGTGTGTGTGTTGTGT
T7_14274_G08	TGTGTGTGGTGTGTGTGGTCTGTGTGTGTTGTGTGT
T7_14275_G08	TTGTGGTGTGTGTGTGTGTCGTGTGTGTGTGTGTTG
T7_14276_G08	GTTGTGTGGTGTGTGTGGTCTGTTGTGTGTGTGTGT
T7_14277_G08	TGGTGTGTGTGTGTGTGGTCTGTGGTTGTGTGTGTT
T7_14278_G08	GTTGTGTGTTGTGTGTGGTCTGTGTTGTGGTGTGTG
T7_14279_G08	TGTTGTGTGGTGTGTTGGTCTGTGTGTGTGTGTGTG
T7_14280_G08	TGTTGTTGTGTGTGTGGGTCTGGTGTGTGTTGTGTG
T7_14281_G08	TTGTGTTGTGTGTGTGTGTCGTGTGTGTGGTGTGTG
T7_14282_G08	GTGTGTGTGTGTTGTGTGTCGTGTGTGTGTGTGTGT
T7_14283_G08	GTTTTGTGTGGTGGTGTGTCGGTGTTGTGTGTGTGT
T7_14284_G08	GTGTGTGGTGTTGTTGTGTCGTGGTGTGTTGTGTGT
T7_14285_G08	GTGTGTGTGTGTGTGTGGTCTGTGTGTTGTGTGTTG
T7_14286_G08	TGTGTGTTTGTGTGTGGGTCTGTGTGTGTGTGTGTG
T7_14287_G08	TGGTGTGTTGTGTGTGTGTCGTGTGTGTGTGTGTGT
T7_14288_G08	GTGTGTTGTGGTTGGTGGTCTGTTGTGTGTGTGTGT
T7_14289_G08	GTGTGTTGTGTGTGTGTGTCTGGTGTGTGTTGTGTG
T7_14290_G08	TTGTTGTGGTGTGTGTGGTCTGTGTGTGTGGTGTGT
T7_14291_G08	TGTGTGTGTGTTGTTTGGTCTGTGTGTGTGTGTGGG
T7_14292_G08	TGTTGGTGGGTTGTGTGGTCTTGTGTGTGTGTGTGT
T7_14293_G08	GTGTGTGTGTGTTGTGTGTCGTGTGTGTTGTGTTGG
T7_14294_G08	TGTTGTGTGTTGTGTGTGTCGTGTGGTGTGGTGTGT
T7_14295_G08	TGTGTGTTTGTGTGGTGGTCTGTGTGTGTGTGTGTG
T7_14296_G08	GTTTGTGTGTGGGTGTGGTCTGGTGTGTGTGTTTGT
T7_14297_G08	GTGTTGTGTGTGTGTGTGTCGTGTGTGTTGGTGTGT
T7_14298_G08	TGGTGTGTGTGTGTGTGGTCGTGTGTGTGTGTTTGT
T7_14299_G08	TTGTGTGTGTGTGTGTTGTCGGTTGGTGTGTGTGTG
T7_14300_G08	GTGTTGTGTGTTGTGTGGTCGTGTGTGTGTGTGTGT
T7_14301_G08	GTTGGTGTGTGTGTGTGGTCTTGTTGTGTGTGGTGT
T7_14302_G08	TTGGTGTGTGTGTGTGTGTCGTTGTGTGTGTGTGTG
T7_14303_G08	TGTTGGTGTGTGTGTGTGTCTGTGTGTGGTGTGTGT
T7_14304_G08	TGTGTGTGTGTGTTGTGGTCTGTGTGTGTGTTGTGG
T7_14305_G08	TGGTTGTGTGTGTGTGTGTCGGTTTGTGGTTGTGTG
T7_14306_G08	GGTGTGTGTGTGTGTGTGTCGTTGTGTGTTGTGTGT
T7_14307_G08	GTGTGTTGTTTGTGTGTGTCGGTGGTGTGTTGTGTG
T7_14308_G08	TGTGTTGTGTGTGTGTGGTCTGTGGTTGTGTGTGTG
T7_14309_G08	TGTGTGTGTTGTGGGTGGTCTGTGTGTGTGTTGTGT
T7_14310_G08	TGTGTGTGTGGTTGTTGGTCTGTGGTGTGTGTGTGT
T7_14311_G08	TGTGTGTGTGTGGGTGTGTCGTGTTGTGTGTTGTGT
T7_14312_G08	GTGTGTGTGTGTGTTGTGTCGTTGTGGTTGTGTGGT
T7_14313_G08	TGTGTGTGTGTGGGTGTGTCTGTTTGTGTGTGTGTG
T7_14314_G08	TGTTGTGTGTGTTGTGGGTCTGGTGTGTGTGTGTGT
T7_14315_G08	TGTGTGTGTGTGTGTGTGTCGGTTTGTGTTGTGGGT
T7_14316_G08	GTTGTGTGTGTGTTGTGGTCTGTGGTGTGTGTGTGT
T7_14317_G08	GTGTGTGTGTTGTGTGTGTCGTGGTGTTGTTGTGTG
T7_14318_G08	TGTGTGTGTGTGTGTGTGTCGTGTGTTGTGGTTGTG
T7_14319_G08	TGTGTGTGTGGTGTGTGGTCTTGTGGTGTGTGTGTT
T7_14320_G08	TTGTGTGTGTGTGTGGTGTCTGTGTGTTGGTGTGTG
T7_14321_G08	TGTGTGTGGTGTGTTGTGTCTGTTGTGTGTGGTGTG
T7_14322_G08	TGGTGTGTGTGTGTGTGGTCTGTTGTGTGGTGTGTT
T7_14323_G08	TTGGTGTGGTGTGTTGTGTCGTGTGTGTGTGTGTGT
T7_14324_G08	TGTGTGGTTGTGTGTGTGTCGGTTGTGTGTGTGTTG
T7_14325_G08	TGTGTGTGTGTGTGTGGGTCTGTGTGTGTTTGTGTG
T7_14326_G08	GTGTGTGTGTGTGTGTGGTCTTGTGTGTGTGTTGTG
T7_14327_G08	TGTGGTGTGGTGTGTTTGTCGTTGTGTGGTGTGTGT
T7_14328_G08	GTTGTTGTTGTGTGGGTGTCGTGTGTGTGTGTGTGT
T7_14329_G08	GTGTTGGTGTGTGTGTGGTCTTGTGTGTGTGTGTGT
T7_14330_G08	GTGTTGTTGGTGTGTGTGTCGTGTGTTGTGTGTGTG
T7_14331_G08	GTTGTGTGTGTTGTGTGGTCTGGTGTGGTGTGTGTT
T7_14332_G08	GTTGTGTGTGTTGTGTGGTCTGTGTGTGTGTGTGGT
T7_14333_G08	TGTGTGTGTGGTGTGTTGTCGGTGTGTGTTGTTGTG
T7_14334_G08	TTGTGGTGTGTGTGTGTGTCGTGTTGTGTGTGTGTG
T7_14335_G08	TTGTGTGTGTGTTGTGTGTCGTGTGTGTGGTGTGGT
T7_14336_G08	TGGTGTGTGTTGTGTGTGTCGTGTGTGGTTGTTGTG
T7_14337_G08	TGTGTGTGTGTTGTGTGGTCGTGTGTGTGTGTGTGT
T7_14338_G08	GTGTGTGTGTGGTGTGTGTCGTGTGTGTGTGTTTGT
T7_14339_G08	TGTGGTGTGTGTTGTGTGTCTGTGTGGTGTGTGTGT
T7_14340_G08	TGTGTTGTGTGTGTGGTGTCGTGTGGTGTGTGTGTT
T7_14341_G08	GTGGTTGTGTTGTGTTGGTCTGTGTGTGTGTGGTGT
T7_14342_G08	TTTGTGTGTTGGTGTGTGTCGTTGTGTGGGTGTGTG
T7_14343_G08	TGTGTGTGGTGTGTGTGGTCTTGTGTGTGTGTGTTG
T7_14344_G08	TGTGTGTGTGTGTTGTTGTCTGTGTGGTGGTTGGGT
T7_14345_G08	TGTGGGTGTGTGTGTGTGTCGTGTGTGTTGTGTTGT
T7_14346_G08	GTGTTGTGTGTGTGTGTGTCGTTGTGTGTGGTGTGT
T7_14347_G08	TTGTGTGTGTGTGTGTGGTCTGTTGTGTGGTTGGTG
T7_14348_G08	GTTGTGTGTGTGTGTGTGTCGTTTGTGTGGTGTGTG
T7_14349_G08	TGGGTGTGTGTGTGTGTGTCGTTGTGTGTGTGTTGT
T7_14350_G08	TTTGGTGTGTGTGGTGTGTCGTGTGTGTGTGTGTGT
T7_14351_G08	TGTGTGTTGTGTGGTGTGTCGTGTGTGTGTGTGTGT
T7_14352_G08	GTGTGTGTTGTGTTGTGGTCTGTGTGGGTGTTGTGT
T7_14353_G08	GGTGTGTGTGTGTGTGTGTCGTGTGTGTGTGTTGTT
T7_14354_G08	TGGTGGTGTGTGTGTGGGTCTGTTTGTGTTGTGTTG
T7_14355_G08	TGTTTGTGTGTGGTGTGGTCTGTGTGGTGTGTGTGT
T7_14356_G08	TGGTGTGTGTGGTTGTGGTCTGTGTGTGTGTGTGTT
T7_14357_G08	GTTGGTGTGTGTTGTTGGTCGTGTGTGTTGTGTGTG
T7_14358_G08	TTGTGTGTGTGTTGTGTGTCGTGTGTGTGTGTGGGT
T7_14359_G08	GTGTGTGTGTTGTGTTGGTCGTGTGTGTGTGTGTGT
T7_14360_G08	TGTGTGTGTGTGTGTGGGTCTGTGTGTGTGTTGTGT
T7_14361_G08	GTGTGTGTGTGTGTTGTGTCGTGTTGTGGTGTGGTT
T7_14362_G08	TGGTGTGTGGTGTGTGTGTCGTTTGTGTGTGTGTGT
T7_14363_G08	TGTGTTGTGTGTGTGTGGTCTGTGTGGTGTGTTTGG
T7_14364_G08	TGTGTGTGGTGTGTGTGGTCTTGTGTGTGTGTGTGT
T7_14365_G08	GTTGTGTGTGTGTGTTGGTCGTGTGTGTGTGTGTGT
T7_14366_G08	GTTGTGTGTGTTGTGTGGTCGGTGTGGTGTTGTTGT
T7_14367_G08	TGGTGTGTGTGTGTGGTGTCGTGTGTGTTTGTGTGT
T7_14368_G08	TGTGTGTTGTGTGTGTGGTCGTGTGTGTGTTGTGTG
T7_14369_G08	TGGTGTGGGTGTGTGTTGTCGTGTTTGTTGTGTGTG
T7_14370_G08	TGTGTGGTGGTTGGTGTGTCGTGTGTGTTTGTGTGT
T7_14371_G08	GTGTGGTGTTGTGTGTGGTCTGGTGTGGTTTTTGTG
T7_14372_G08	GTGTGTTGTGTGTGTGTGTCGTGTTGTGGTGTTGTG
T7_14373_G08	GTGTTTGTGGTGTGGTGGTCTGTGTGTTGTGTGTGT
T7_14374_G08	TTTTTGTGGTGTGTTGGGTCTGGTGGTGTGTGTGTG
T7_14375_G08	TGTGTGTGTGTTGGTGTGTCGTTGTGTGTGTGTGTG
T7_14376_G08	GTGTGTGTTGTGTGTGGGTCTGTGTTGTGTGTGTGT
T7_14377_G08	GTGTGTTGTGTGTGTGTGTCTGTGTGTGTGTGGTGT
T7_14378_G08	TGTTGTGTGGTGGTGTGGTCTTGTGTTGTGTGTGTG
T7_14379_G08	GTGTGTGTGTGTTTTGTGTCGTGTGTGTGTGGTGTG
T7_14380_G08	TGTGTGGTGTTGTGTGTGTCGTGTGTGTGTTGTGGT
T7_14381_G08	TGGTGTGTGTGGTGTTGGTCTGTGTGTTGTGTTGTG
T7_14382_G08	TGTGTGTGTGTGTGTGTGTCGTGGGGTGTTTTGTGT
T7_14383_G08	GTGTGTGTGTGTTGTGTGTCGTTGTGTGGTGTTGTG
T7_14384_G08	GTGTTGTGTGTGTGTGTGTCGTTGTGGTGTGTTGTG
T7_14385_G08	TGTGTGTTTGTGTGTTGGTCTGTGTGTGTGGTGGTG
T7_14386_G08	TTGTGTGTGTGTGTGTGGTCTGTGTGTGTGTGTGTG
T7_14387_G08	TGTGTGTGTGTGTGGTGGTCTGTGTGTTGTGTGTGT
T7_14388_G08	TGTGGTTGTGTGGTTGTGTCGTGTGTGTGTGTGTGT
T7_14389_G08	GTGTGTGTGTGTGTTTTGTCGTGGTGTGTGTGTGTG
T7_14390_G08	TGTGTGTTTGTGTGTGGGTCTTGTGTGGTGTGTGTG
T7_14391_G08	GTGTGTGGTGTGTGGTTGTCGTGTGTTGTTGTGTGT
T7_14392_G08	GTGTGTGTGTTGTGTGGGTCTGTGTGTGTGTGTTGT
T7_14393_G08	TGTGTGGTTGTGTGGTGGTCTGTGTGTGTGTTTGTG
T7_14394_G08	TGTGTTGTGGTGTGTGTGTCGTGTGTGTGTGTGGTT
T7_14395_G08	GTGTTGTGTGTGTGTGTGTCGTGTGTGTGGTTGTGT
T7_14396_G08	TGGTGTTGTGTGTGTGTGTCGTGTGTGTGTGTGTGT
T7_14397_G08	GTGTGTGTGTGTTGGTGGTCGTTGTTGTTGGTGTTG
T7_14398_G08	TGTTGTGTGTGTGGTGTGTCGTGTGTTGTGTGTGTG
T7_14399_G08	TGTGTGTGTGTGGTTGTGTCGGGTGTGTGTGTTTTG
T7_14400_G08	TTGGTGTGGTGTGTTGTGTCGTTGTGTGTGTGTGGT
T7_14401_G08	TGTGTGTGTGTGTGTGGGTCTTGTTGTGTTGGTGTG
T7_14402_G08	GGTGTGTTGGTGGTTGTGTCGGTGTGTGTTTGGTTT
T7_14403_G08	TGTGTGTGGTTGTGTGGGTCTGTTGTTGTGGTGTGT
T7_14404_G08	TGTGTGTGTGTGTGTGGGTCTTGTTGGTGTGTGTTG
T7_14405_G08	TGTGTTGTGTGTTGTGTGTCGGTGTGTGTGTGTGTG
T7_14406_G08	GTGGTTGTTTGTTGTGGGTCTGTGTGTGTGGTTTGG
T7_14407_G08	GTGTTGTGGTTGTGTTGGTCTGTGGGTGTTGGTTGT
T7_14408_G08	GGTTTTGTGGTGTGGGTGTCGTTTTGTGGTGTGGTT
T7_14409_G08	TGTTTTGTGTTGTGGGTGTCGTGTTGGGTTGGTGTG
T7_14410_G08	GTGTTTGGGTTGGTGTGGTCTGGTGTGTGTGTGTTT
T7_14411_G08	GTGTGTTTGTGTTGTGGGTCTGTGGTGTGTGTGTGT
T7_14412_G08	TGTGTGTTGTGTGTGTGGTCGTGGTGTTGTTGTTGG
T7_14413_G08	TGTGGTTTTTGGTTGTGGTCTGTGTGGTGGTTGGGT
T7_14414_G08	TGTGTGTGGTTTTGTGTGTCTGTGTGTGTGGGTGTG
T7_14415_G08	TGTTGTGGGTGTGTGGGGTCTGTGGTTGTTTTGTTG
T7_14416_G08	TTGTTTGTGGTGGTGTTGTCGTGTGTGTGTGTGTGG
T7_14417_G08	TGTTGGGGTGTTGTTGTGTCGGGTTTGTTGGTTGTG
T7_14418_G08	TGTTGTGTGGTGGTTGTGTCGGTTTGGGTGGTGTTT
T7_14419_G08	GGTGTGGTGTTTGTTTGGTCTTGTTGGTGTGTGTGG
T7_14420_G08	GGTGTTGTGTTTGTTGTGTCGTGTGTGTGGGTGTGT
T7_14421_G08	TGGTTGTGGGTTGGTTTGTCGGTGTGGTTTGGTTGT
T7_14422_G08	TGTGTGTGTTGGTGTTTGTCGTGGGGTTGGTTTGTG
T7_14423_G08	GTGTTGTGTGGTGTGTTGTCGGTTGTGTGGTGTGTT
T7_14424_G08	GTGTTGTGTGTGTGTTGGTCTGTGTGTGGGTGTGTT
T7_14425_G08	TGTTGTGTGTGGTGTGTGTCTGGTGTGTTGTGTGGT
T7_14426_G08	TGTGTGGTGTGTGTTGGGTCTTGTTGTGTGTGTGTG
T7_14427_G08	GGTGTTTGGTGTTTGTGGTCGGTGTTGGGTGTGTTT
T7_14428_G08	TTGTGGTGTTGGTGTTTGTCGTGTGTGGGTTTGGTG
T7_14429_G08	TTTTGGTGTGTGTGTTTGTCGGGTGTGGTGTGGTTG
T7_14430_G08	GTGTTGGTGTGTGGTTTGTCGGTTTTGTGTGTGTGG
T7_14431_G08	GTTGTGTGTGGTTTTGTGTCGTGGTGTTGTGGTGTG
T7_14432_G08	GTGTGGTGTGTTGTGTGGTCTGTGTTTGTGGTGTGT
T7_14433_G08	TGTTGTTTGTGTGGTGTGTCTGGTGGTGGGTGTTGT
T7_14434_G08	TGTGTGTGGTGTGGTGTGTCTTGTGTTGTGTTGTGG
T7_14435_G08	GTGTTGTTGGTGTGTGGGTCTTGGTGTTGTGTGTGT
T7_14436_G08	TTGGTGTTGGTGTGGTGGTCTGTGGTGTTTTGTGTG
T7_14437_G08	TGTGTGTGTGTTGTGTGGTCTGTGGTGTGGGTGTTT
T7_14438_G08	TGGTTGGGGTTGTGTGTGTCTGTGTGTGTTGTGTGT
T7_14439_G08	GTGTGTGTGTGGTGTGTGTCTGTTTGGGGTTGTTGT
T7_14440_G08	TGTGTGTGGTGGTGTTGGTCTTGTTGGTGTGTGTGT
T7_14441_G08	GTGTGTGTTTGGTGTGTGTCGTGGGTGTGGTGTTTT
T7_14442_G08	GTTGGTTGTGTGGTGTGGTCTTTGTGTTGGTGTGGT
T7_14443_G08	TTGTGTTTGGTGTGTGGGTCGTGTTGTGTGTGTGGT
T7_14444_G08	GTGTGTTTGTTGTGGTGGTCTTGGTTGTGTGTGGTG
T7_14445_G08	GTTGTGTGTGTGGTGTGGTCTGTTTGTGTGTGGTGT
T7_14446_G08	TGTTGTGTGTGGTGGTGGTCGTTGTTGTTTGTGGTG
T7_14447_G08	TGTGTGTTTTGGGTGTTGTCGTGTGTGTGTGTGGTG
T7_14448_G08	TGTTGTGGGTGTTGGTGGTCGTGGTGTTGTTGTGTT
T7_14449_G08	TGTGTGTGGTGTGTGTGGTCTTGTGTGTTGTGTGTG
T7_14450_G08	GTGTGGTTGTGGTGTTGGTCTTGTTGGTGTTGGTTG
T7_14451_G08	GTGTGTGTTTGTTGGTTGTCGTGTTGTGTGGGTGTG
T7_14452_G08	GTGTTTGTGTGTTGGGTGTCGTTGGGTTGTGTGTGT
T7_14453_G08	TTGTGTGTGTTGTGTGTGTCGTGTGGTGTGTTGGTG
T7_14454_G08	TGGTTTGTGGTGTGTGTGTCTGTTGGTGTGTGGGTT
T7_14455_G08	GGTGTTGTGTGTGTGTGGTCTGTGTGTGTTGTTGTG
T7_14456_G08	TGTGGTGTGTTGTGGTGGTCTTGTTGGTGTGTGTTG
T7_14457_G08	TGGTGTGTGTGTGTGTGGTCTGTTGTGGTGTTTGTG
T7_14458_G08	TTGTGGTGTGTGGGTGTGTCGTGTTGTGTTGGTTGT
T7_14459_G08	GTTTGGTGTGTGTGGTGGTCTGTGTTGTGTGTGTGT
T7_14460_G08	TTTGGTGGTGTGTTGTTGTCGGTGTGGTGTGTGTGT
T7_14461_G08	TTGTGTGGTTGTGTGGTGTCGTGGTGTTGTGTGTGT
T7_14462_G08	TGTGTGTGTGTGTGTGTGTCTGTGTTGTGTGTGGTG
T7_14463_G08	GTGTTGTGTGGTTGTGTGTCTGGTGGTGTGTGTGTT
T7_14464_G08	TTGTTGGTTGTGGTGGTGTCGTTGTGTGTGTTGTGG
T7_14465_G08	GTGTGTTTGGGTGTGTTGTCTTGGGTGTGTTGGTGT
T7_14466_G08	GTGTGGTGTTGTGGTGTGTCGTTGGTGTTTGTGTGT
T7_14467_G08	TGTGTGTTTGGGTGGGTGTCGGTGTTGTTGTGTTGT
T7_14468_G08	GGTGTTGTGTGTTGGTTGTCTGGTGTGTGTGTTGTG
T7_14469_G08	GGGTGTTTTTGTTGTTGGTCTTGGTGGGTTGTGGTG
T7_14470_G08	TGTGGTTGGTGGTTGTTGTCGGTTGTGTGTGTTGTG
T7_14471_G08	GTGTGTGTGTGTTGTGGGTCGTGGTGTGTGTTTTTG
T7_14472_G08	GTTGTGTGTTGTGTGGTGTCTGTTGTGTGGTGGTGT
T7_14473_G08	TGTGTGTGTGTGTTGTGGTCGTTGGTGTGTGTGGTT
T7_14474_G08	TGGTGTGTGGGGTTGTGGTCTGTTGTTGTTTGTGTG
T7_14475_G08	TGTGTTTGTGTGGTTGTGTCTGTGTGGGTGGTGTTG
T7_14476_G08	TTGTGTTGGTGTTGTGTGTCGTGTGGGTGGTGTTGT
T7_14477_G08	TTGGTGGGTGTGTGTGTGTCGTGTGTTGGTTTGTTG
T7_14478_G08	GTGTGTTGTGTGTGTTGGTCGTGTGGTTGTGTGTTG
T7_14479_G08	TGTGTGTGTTGTGTTGTGTCGTGTGTGTGTGGTGTG
T7_14480_G08	GTGGTGTGTGTGTGTGTGTCGTGTTTGTTGTGTGTG
T7_14481_G08	GGTTTTGTGGTGGTGTGGTCTGTGGGTTGTTTGTGT
T7_14482_G08	TTGTGTGTGGTGTTGTTGTCGGTGGTTGTGTGTGGT
T7_14483_G08	GTGTGTGGTGGTGGGTTGTCTGGTGTTTGTTGGTTT
T7_14484_G08	TGGGTGTGTTGTGTGTGGTCGGTTTGTGGTGGTTTT
T7_14485_G08	TGGTTGTGTGTGTGGTGGTCGGTTTGTTGTGTGTGT
T7_14486_G08	GTGTGTTGTGTGGTTGGGTCTTTGTTTGGTGTGGGT
T7_14487_G08	GGTTGTGGTGGTGTTTGGTCTGTTGTTTGTGGGTTG
T7_14488_G08	GGTGTTGGTTGGTTTTGGTCTGTGTGTTGGTTGTGG
T7_14489_G08	GTGTTGTTGTTGTGGGTGTCGTGTGTTTGTGTGGTG
T7_14490_G08	TGTGTGTTGTGTGTGTGGTCTTGTGTGTTGTGGTGG
T7_14491_G08	GGTGTGTGTTTGTTGTGGTCTGTGTGTGTGTGTGTG
T7_14492_G08	TTGTGTTGTGGTGTGTGGTCTTGTGGTGTGTGGTGT
T7_14493_G08	TGTGTGGGTGTTTGTGTGTCGTGTTGGTGTGTGTGT
T7_14494_G08	GTGTTGGTGTGTGTGTGGTCGTGTTGTTTGTGTGTG
T7_14495_G08	GTGGTTGTGTTGTGGTGGTCTTGTGTTGTGTGTTGG
T7_14496_G08	TGTGTGTGTTGTGTGTGGTCTGTGTGTGTGTGTGTG
T7_14497_G08	TGTTGGGTGTGTGGTGTGTCTTTGGTGTTGTGTGTG
T7_14498_G08	TGTGTGGTGGTGTGTGTGTCGTGTTTGTGGTTGTGT
T7_14499_G08	TGGTTGTGGTGTTGGGTGTCGTTGTTGTGTTGTGGT
T7_14500_G08	TGTGTTGGGGTGTTGGTGTCGTTGTGGTGTTTGTGT
T7_14501_G08	TGTGTGTTGTGTGTGTGGTCTGTGTGGGTGTGTGTT
T7_14502_G08	GTGTGTTGTGTGTTGTTGTCGTGTGTTTGTGGGGTG
T7_14503_G08	TGTGTGTGTGTGGTGTTGTCGTTTGGGTGTGTGTGT
T7_14504_G08	TGTTTGTGTGGTGGTGTGTCTGTGGTGTGTGTGTGT
T7_14505_G08	TGTGTTGTGGTTGTGGTGTCGTGTGTGGTGTTGTGT
T7_14506_G08	GGTGTGTGTGTGTGTGGGTCTGGTTTTGTTGTGTTG
T7_14507_G08	GTGTGTGTGTTTGTGTGGTCTGTGGTTGTGTGGGTT
T7_14508_G08	GTGTTGTGTGGGTTGTTGTCGTGTGTGTGTTGTGTG
T7_14509_G08	TGTGTGTGTGTGTGTGGGTCGTGTGTGGTTGTTGTT
T7_14510_G08	TGGTGTGTGTGGGTTGTGTCGTGTTGTGTGTTGTGT
T7_14511_G08	GTGTTTGTGGTTTGTGTGTCGGTGTTGTGGTGGTGT
T7_14512_G08	GTGTTGGTGTTGTTGTGGTCTGGTGTGTGTGTTGTG
T7_14513_G08	TGGTGTGTGTGGGTGTGGTCTTTGTGTGTTGTGTTG
T7_14514_G08	GTGTGTGGTGTGTGTGTGTCTGTGTGTTTGGGTTTG
T7_14515_G08	TGGGTTGTTGTGGGTGTGTCTTGTTGTGGTGTGTTG
T7_14516_G08	GTGTGTGTGTGTGTGTGGTCGTGTTGGTTGTGTTGT
T7_14517_G08	TTGTGTGTGTGTGTTTGGTCTGTGTTGGGTGGTTGG
T7_14518_G08	GTGTGGGTGTTGTGTGTGTCTGTTTGGTGTGGTTGT
T7_14519_G08	GTGGTGTTTGTTTGTGTGTCGTGGTTGGGTGTGTGT
T7_14520_G08	TTGTTGTTGGTGTGTGGGTCTGTGTTTGTGGGGTTG
T7_14521_G08	TGTTGTTGTGGTGGTTGGTCTTGGGTTTTGTGGGGT
T7_14522_G08	GTGTGTGTGGTGTTTTGGTCTGGTGTGTGTGTGTGT
T7_14523_G08	GTGTGGTGTTGGTGTGTGTCGTGTGGTTGTTGTGTT
T7_14524_G08	TTGTGTTGTGTGTGGTGGTCTGTGTTGTTGGGGTGT
T7_14525_G08	GTGTGTGTGTGGTTGTTGTCTGGTGGTGTGTGTTGT
T7_14526_G08	TGGTGTGGTGGTGTGTGGTCTGTGTGTGTTTTGTGT
T7_14527_G08	GTTTGTGTGTGGTGTTGGTCTGTTGTGTGTGGTGGT
T7_14528_G08	GTGTGTGTGTGTGTTGTGTCGGGGTTGTTTTGTGTG
T7_14529_G08	TGTGTTGTTTGTGTGTGGTCTTTGTGTGGGTGGGGT
T7_14530_G08	TGGTGTGTGTGTTGTGTGTCGGGGTGTTTGTTGTTG
T7_14531_G08	GTGTGTGTGTGTGTGTGGTCTTGTTGTTGTTGGGTG
T7_14532_G08	GGTTTGTGTGTGTGTGTGTCTGGTTGTGGTGTTTGG
T7_14533_G08	GTGTGTGTGGTTGTGGTGTCGTGTTTGTGGTTGTGT
T7_14534_G08	GTGTTGTGTGTGTGGGTGTCTGTGTTGTGTGTTGTG
T7_14535_G08	TGGTGTGGGTGTTGTTTGTCTGGTGTGTGTGTGTGT
T7_14536_G08	GGGGTGTTTTTTGTGTGGTCTGTGGTGTGTGTGTGT
T7_14537_G08	TTGTGTTGTGGGTGTTGGTCGTGGTTGTGTGTTGTG
T7_14538_G08	TGTGGTGGTTGTGTTGGGTCTGTGTGTGTTTTGTGG
T7_14539_G08	GGTTGTGTGTGTGTTGGGTCTGTGGTGTGTGGTTTT
T7_14540_G08	TGGTGTGTTGGTGTGTTGTCGTGTGTGGTGTGTTGT
T7_14541_G08	GTTGTGGTGTTGTGTGTGTCTTGTGTGTGTTGGTGG
T7_14542_G08	GTGTGTTGTTGTGTGTTGTCGTGTGTGTGGTTGGGT
T7_14543_G08	TGGTGTTTTGTGGTGTGGTCTGTGTGTGGTGGTTGT
T7_14544_G08	TTGTTGGGTTGTGGTGTGTCGTGTGTGGTGTGTTTG
T7_14545_G08	GTTGTTTGTGTGTGGGTGTCGTGTGTGTTGTGGTGT
T7_14546_G08	TTGTTGGTTTGGGGTGTGTCGTTGGTGTGGTGTGTT
T7_14547_G08	TGTGTGTGTGTGTGTGTGTCGTTTGTGTGGGTTGTG
T7_14548_G08	TGTGGGGTTTTGTGTGTGTCGTGTGTTGTGTGTTGG
T7_14549_G08	GGTGTTGTGTGTTTGTGGTCTTGTGTGGTGTGTGTG
T7_14550_G08	GTGGTGTGTGTTGTGGTGTCGTTTGTGGTTGTGTGT
T7_14551_G08	TGTGGTGTGTGTGGTGTGTCGTGTGTGTTGTTGTGT
T7_14552_G08	GTGGTGTGTGTTTGTTGGTCTGTGGTGTGTGTGTGT
T7_14553_G08	TTTGTGTGGTGTGTTGTGTCGTTGTGTGTGGTGTGG
T7_14554_G08	TTTGTGTGTGTGTGTGTGTCTGTGTGTGTGTGTGGG
T7_14555_G08	GTGTGTGTGTTTTGTGGGTCGTGTGTGTGTGTTGTG
T7_14556_G08	TGTTGGTGTGGTGTTGTGTCGTTGTTGGGTTGGTGT
T7_14557_G08	TGTGTGGTGTGTGTGTGGTCTGTGTTTGGGTGTTGT
T7_14558_G08	GTGTTGTGGGTTTGGTGGTCGTTTGTGTTTGGTTGG
T7_14559_G08	TGTTGTGTGTTGTGTGTGTCGGTGTGTGTGTGTGGT
T7_14560_G08	GTGTGGGTGTGTGTGTGGTCTGGTTGTTTTGTGTTG
T7_14561_G08	TGGTGGTGGGTGTTTGTGTCGTTGTGTGGTTTGGTT
T7_14562_G08	TTGGTGTTTGTGGGTTGGTCTGGTGGTGTTGTGTGT
T7_14563_G08	TGGTGTTGTTGTGGTGTGTCGTGTGTGGGTTGTTTG
T7_14564_G08	TGTGGTTGTGTGTGGGTGTCGGTGTGTTTTGGTTGT
T7_14565_G08	GTGTGTGTGTGGGTGTTGTCTTGTTGTGTGGTGTGT
T7_14566_G08	GTGTTGTGTGTGGTGTGGTCGTTGGTTTGTGTTGTG
T7_14567_G08	GTGTGTTGTGTGGTGTGGTCTGTGTTGTGTGTGTTG
T7_14568_G08	GGTTTGTGGTTGTGTGTGTCGTGTGTTGTGTGTGTG
T7_14569_G08	TGGTGTTGTGTGTGTGGGTCGTGTGTTGTTTGTGTG
T7_14570_G08	GTGGTTGGTGTGTTGTTGTCGTTGTGTGTGGTGTTG
T7_14571_G08	TGGGTGTGTGGGTGGTTGTCGTTGTGTTGTTTGTGT
T7_14572_G08	GGTGTGGTGTTGTGTGTGTCGTGTTGTGTGTGTTGT
T7_14573_G08	TGGTGTGTGTGTTGTGTGTCGTGTGTGTGTGTGTGT
T7_14574_G08	GTGTTGGGTGTGTGTTTGTCGTGGTTGGTGTGTGTT
T7_14575_G08	GTGTGGTGGGTGTGTGTGTCGTTGTTGTGGTTTTGT
T7_14576_G08	TGTTGGTTGTTGTTGGTGTCGTGTGTGTGGTGTTGG
T7_14577_G08	GTGTGTGTGTGTTGTTTGTCGGTTGGTTGGTGTTGG
T7_14578_G08	GTTGTGTGTGTTGGTGTGTCTGTGTGGTGTTTGGGT
T7_14579_G08	TGTGGTGTGGGTGTTGTGTCGTTTTGTTGGTGTGTG
T7_14580_G08	TGTTGTGTGTGTTGTGTGTCGTGTGGTTGTGTGTGG
T7_14581_G08	TTGTGGTGGTTTGTGTGGTCGGTGTGGTGTTGGTTT
T7_14582_G08	GTGTTTGGTGTGTGGTGGTCGTGTTGGTGTTTGGTT
T7_14583_G08	TTGTGTGGGTGTGTGGTGTCGTGTTGTGTGTGTTGT
T7_14584_G08	GTTGTTGTGTGTGTTGGGTCGTGTGTGGTGTGTTGT
T7_14585_G08	TTTTGGTGTGTGTGTGTGTCGTGGTGTGTGTGTGTG
T7_14586_G08	TGTGTGTTTGTGGTGTGGTCTGTGTTGGGTGTTGTG
T7_14587_G08	TTGTGTTGTGTGTTTTTGTCGTGGGTGTGGTGTGGG
T7_14588_G08	TGTGTGTTGTGTGTTGTGTCGTGTGTTTGTGGGGTG
T7_14589_G08	GTGTTGTTGTTGTTGTGGTCTGGTGGTGTGTGTGGT
T7_14590_G08	GTGTGTGTGTGTTGTTTGTCTGTGGTGGTGTGTGGT
T7_14591_G08	TTGTGTGTGGGTTGTGTGTCGTGTTTGGTTGGTTGG
T7_14592_G08	TGTGTGTGGTTGTGTTGGTCTGTGTTTGGTGGTGTG
T7_14593_G08	GTGTGGTGTTGTTGTGTGTCGGTTGTGTGTGTGTGT
T7_14594_G08	TGTGTGGTTGTGTGTGGGTCTTGTGTTGGGTGTTGT
T7_14595_G08	TTTTGTGTGGTGGTTGGGTCGTGTGTGGGTTGTGTT
T7_14596_G08	GTGTGTGTGTGGTGTGGGTCTTGTTTGTTGTTGGTG
T7_14597_G08	TGTGTGTGTGGGTGTTGGTCTTGTGTTGTGTGTGTG
T7_14598_G08	TGGGTGTTTTGTTTGGTGTCGGGTGTGTTGTTGGGT
T7_14599_G08	GTGTGGTGTGGTTGTGTGTCGTTTGTGTTGTGTGTG
T7_14600_G08	TTTGGTGTGTGTGTGTGGTCGTGTGGTTTGTGTGGT
T7_14601_G08	TTGTGTGTGGTGTGTGTGTCGTGTTGGGTGTTGTGT
T7_14602_G08	GTTGTTGTTTGGTGTGTGTCGTGGTTGTGGTTGTGG
T7_14603_G08	GTGGTGTGTGTGTGTGTGTCGTTTGTGTGTGTGTTG
T7_14604_G08	GGGTGTGTTGTGTTGTGGTCTGGGTTGTGTGTTTGT
T7_14605_G08	TGTGTGTGTTGTGGTTGGTCTGGTGTGTTGGTTGTG
T7_14606_G08	TGGGTTGTTGGGTGTTGGTCTGGTGGGTTTTGTTTG
T7_14607_G08	GTGGTGTGTGTTTGGTGGTCTGTGTTTGTGTTGTGG
T7_14608_G08	TTTGGGGTGTTGTTGTGGTCTGTGTGTTGGTGTGGT
T7_14609_G08	TGTTTGTGTGGTTTGTGGTCTGGGTTTGGTGTGTGG
T7_14610_G08	GTTGGGTGTGGTGTGTGGTCTGTTGTTGTTTGTGTG
T7_14611_G08	TGGTGTTGGTGTGTGTGGTCTGTGTTGTGTGTGTGT
T7_14612_G08	GTTGGTGTTGTGGTTGTGTCGTTGTGTGTGTGTGTG
T7_14613_G08	GTGTGTGTGTGGTGTTGGTCTTGTGTGGTGTGTTGT
T7_14614_G08	GGGTTTGGTGTGTTGTTGTCGTGTGTGTTGGTGTGT
T7_14615_G08	TTGTTTGTGGTGTGGTGGTCTGTGTGGGGTTGTTGT
T7_14616_G08	GGTGTGTGTTGTGTTGTGTCGTGTTTGGGTTGTGTG
T7_14617_G08	GGTGTGGTGTGTGTGTGGTCTGTTGTTGTTGTGTTG
T7_14618_G08	GTTGTTTTTGTTTGGGTGTCGTGTGTGGGTGGTGTG
T7_14619_G08	GTGTGGGTTTGGGTGGTGTCTGTGTTGTGTTTGTTG
T7_14620_G08	TTGTTTGTGTGTGTGTGGTCGTTTGGTGTGGGGTGT
T7_14621_G08	GTTGTGTGTGTGTTGTGGTCTTGTGTTGGGGTGTTG
T7_14622_G08	GTGTGTGTTGGTGGTTGGTCGGTTTTGTTGGTTGTG
T7_14623_G08	GTGGTGTTTTTGTGGTGGTCTTGTGTGTGTGTGTGG
T7_14624_G08	TGGTGTTGTGGTGGTGTGTCGTTGTGTGTGTGTTGT
T7_14625_G08	GGTGTTGGTGTTGTGTGGTCTGTGTTGTGGTGTTTG
T7_14626_G08	TTTGGTGTTGGTGGTTGGTCTGTGTGTGTTTGGTGG
T7_14627_G08	GTTGTGTGGTGTGTTGTGTCGTTGGGTGTGGTTTTG
T7_14628_G08	GTGTTTGTGTGTTTTGGGTCTGTGGGTTGTGTGTGG
T7_14629_G08	TTGTGTGTGTGTGTTGTGTCGTGGTGTGTGGTGTGT
T7_14630_G08	GTGTGTGGGTTTTTGTGGTCTGTTTGTGGTGGTGGT
T7_14631_G08	GTGTGTTGTGTGTGGGTGTCTTGTGTGGTGTTTGTG
T7_14632_G08	TGTTTTGTGGGGTTGTGGTCTGGTGTTGGTGTGTTG
T7_14633_G08	GTGGGGTGTTTGTGTGTGTCGTGTGTGTTGTGTTGT
T7_14634_G08	TGTTGTGTTGGGGTTTGGTCGTGGTGTTGTGTTGTG
T7_14635_G08	GGTGTGTGTGTTGTGTGGTCTGTGGTGTGTTTGTTG
T7_14636_G08	TGGTTGTGTTGGTGTGGGTCGGTTTGTGTGTTTGTG
T7_14637_G08	TGTGTGGGTTGGTGTTGGTCTGTGTGTTGTGTGGTT
T7_14638_G08	GGTTTGTGGTTTGGTGTGTCTGTGGTGTTGTGGTTG
T7_14639_G08	GTGTGTTGTGGTGTGTGGTCTTGTTGTGTGTTGGTG
T7_14640_G08	TGTTGGTGGTGTTGTGTGTCGTTGTGGTGTGTGTGT
T7_14641_G08	TGTGTTGGTGTGTGTTTGTCGGTGTGTGTGTGTGTG
T7_14642_G08	TGGTGTTGTGTGTGTGTGTCGTTTGGTGGTTGTGTG
T7_14643_G08	TGTTGTGTTGGGGTGTGGTCGTTTGTTGTTGGGTTG
T7_14644_G08	TGTGTTGGTTGTGTTGTGTCGTGGTGTGTGTGTGTG
T7_14645_G08	GTGTGTGTTTTGTGGGTGTCGTGGTGTGTGTGTGTT
T7_14646_G08	GTGTGTGTGGTTGTTGTGTCGTGTTGTGTGTGTGTG
T7_14647_G08	TGTGGTGTTTGTGTTGTGTCGTGTGTGTGGGTTGGT
T7_14648_G08	TGGTTGTGTGGTGTGGTGTCGTGTGGTGTGTTGTTT
T7_14649_G08	TTGTTGTGTGTGTTGTTGTCGTGGGGTGTGTTGGTG
T7_14650_G08	TGGTGTGTGTGTGTGGTGTCGGTTGTTGTGTGTTTG
T7_14651_G08	GTTGTGGTTGGTGGGTGGTCTGTGTTTGTTGTGTGT
T7_14652_G08	TTGTTTGGTGGTGGGTTGTCGGTGGTGTTTGTGTGT
T7_14653_G08	TGTGTTGTGTGTGTGTGGTCTGTGTGTGTTGGGTGT
T7_14654_G08	GTTGTGGTGGTTGTGTGGTCTGTGTGGTGTGTGTTT
T7_14655_G08	TGTTTGTGGTGGTGTTGGTCTGTGTGTGTTGGTGTG
T7_14656_G08	GTGTGTGTGTGTGTGTGGTCTGTGTGTGGTGTTGTT
T7_14657_G08	TGTTTTTGGGTGTTGTGGTCGTGGGTGTGTGTGTGT
T7_14658_G08	GTGTGTGTGTGTGTGGTGTCTTGTGTGTTGGTGTGT
T7_14659_G08	GTGTTGTGTGTTGGTGTGTCGTGTTGGTGTGTGTGT
T7_14660_G08	TGTGTGTGTTGTGTTGTGTCTGTGTTGTGTGGGTGG
T7_14661_G08	GTGTTTTGTGGTGGGTTGTCGTGGTGTGTGTGTGTT
T7_14662_G08	TGTGTGGTGGGTTGTGTGTCGTGGTGTTTGTTTGTG
T7_14663_G08	TGGTGTTGGTTTGGGTGGTCTGTGGTGTGTTGTTGT
T7_14664_G08	GTGGTTTGTGTTTGTGTGTCGGTGTGTTGGTGTGTG
T7_14665_G08	TGGTGTGGTGTTGTTTGGTCGGTGTTGTGTGTTTGG
T7_14666_G08	GTGTGGTGTGTGGTGTGGTCTGTTTGTTGTGGTTGT
T7_14667_G08	TGGTGTGTGTTGTGTGGGTCTGGTGTGTGTGGTTTT
T7_14668_G08	GGTGTTGTGTGTTGTGTGTCTGGTTGTGTGTGTGTG
T7_14669_G08	TGTGTGTGTGTGTTGTTGTCGTGTTGGTGTGGTGTG
T7_14670_G08	GTGTGTGTTGTGTGTGTGTCGGGTTGTGTGTTGTTG
T7_14671_G08	GGTGGTGTTGTGTGTGTGTCGGTTGTGTGTTGTTGT
T7_14672_G08	GTGTGTGTGTGGTTGTGGTCTTGGGTGTTGTTGTGT
T7_14673_G08	TGTGTGTGTTTGTGGTGGTCTTGTGTGTGTGTGGTG
T7_14674_G08	GGTGTGTTGTGGTGTTGGTCTGTGTTGTGTGTGTTG
T7_14675_G08	GTTGGGTTGTGTTGGTGGTCTGTTGTGTGTGGTGTT
T7_14676_G08	GTGTGTGTGTGTGTGTTGTCGTGTGTTGTGGTGTTG
T7_14677_G08	TGGTGTGGGTGTTGTTTGTCGTGTGTTGTGTGTGTG
T7_14678_G08	GTTGTTGTGGGTTGTGTGTCGTGTTGTGGTGTGGTT
T7_14679_G08	GGTTGTGTGTGGTGTGTGTCGTGTGTTGTGGTGTTT
T7_14680_G08	GTTTGTGTGTGTGGTTGGTCTGTGTGTGTGTGGTGT
T7_14681_G08	TGTTGTTGTGTGTTGGGGTCTTGTGGTGTGGGTGTT
T7_14682_G08	TTTGTGTGGTGTGGGTGGTCTTGTGGTGTGTTGTGT
T7_14683_G08	TGTGTGTGTGTTGTTGTGTCGTGGTGGGTTGTGTGT
T7_14684_G08	GGTGGTGTTGTGTGTTGGTCTGTGGGTTGTGTTTGT
T7_14685_G08	TGTGTGTGTTGGTGTGTGTCTGTGGGTGTGTTGGTT
T7_14686_G08	GTGGTTGTGGGTGGTTTGTCGTGTGTGTGTTGTTTG
T7_14687_G08	TGGTTTTGTGGTGGGTGGTCTGGTGTTGTGTTGTGT
T7_14688_G08	GTGTGGTTGGTGTTTTGGTCTGGGTTGTTGTGTGTG
T7_14689_G08	TGGTTGTGTGTGTTGTGGTCTGTGTGTGGTGTGTGT
T7_14690_G08	TGTGGTGTGTGGTTTGTGTCTGTTGTGGTGTGTGTG
T7_14691_G08	TGTGTTGTTGTTGGGTTGTCGTGTGTGGTGGTGTGT
T7_14692_G08	GGTGTTGTGTGTGTGTTGTCGTTGTGGTTGTGGTTG
T7_14693_G08	GTTTGGTGTGTGTGTTGGTCGTGTGTGTGTGTTGTG
T7_14694_G08	GTGTTGGTGTGTGTTGTGTCTGGTTGTTGTGGTGGT
T7_14695_G08	TGTGTTGTGGGGTGGTTGTCGTGTTGGTTGTTGTTG
T7_14696_G08	TGTGGTGGGTTGTGTGTGTCGTGTGGTTTGTGTTTG
T7_14697_G08	GGTTTGTGTTGTGTGGGGTCTGTTGTTTGGTGGTGT
T7_14698_G08	GTTGGGTTGTGTGTTGTGTCGTGTGTTGTGTGTGTG
T7_14699_G08	GGTTGTGTTGTGTGTGTGTCTGTGTGTGTGTGTGTG
T7_14700_G08	TTTGTGGTTGTGTTTTGGTCTGGGTGTGGGTGGTGT
T7_14701_G08	GTGTGTGTGGTGTTGGTGTCGGGGTGTTTGTTGTTT
T7_14702_G08	TGGTGTGTGTGGTGGTTGTCGTGTTTGTGTTGTGTG
T7_14703_G08	TGTGTTGGGTGTGTGGGGTCTTGTTGTGTGTGTTGT
T7_14704_G08	TGGGTTGTGTGTTGGTGGTCTGTGGTTTGTTGTGTG
T7_14705_G08	GTGGTGTGGTTGTGTTGGTCTGTGTGGTTGTTGGTT
T7_14706_G08	TGGTGGTGTGGTGTGTGGTCTTTGTTTTGTGTGGTG
T7_14707_G08	GTTGTGGTGTGTTGTGTGTCGGTTGTTTTGGTGGTG
T7_14708_G08	TGTGGTTTGTGGTGTGTGTCGTTGTTGTGTGGTGTG
T7_14709_G08	GTTGGTTGTGGTGGTTTGTCTGTGTGTGTGTGTGGT
T7_14710_G08	TGTTGTTGGTTGTGTGTGTCGTGGTTGTGTGTGTGG
T7_14711_G08	TGTGTGTTGGTGTTGTGGTCTTGTGGGTGTTTGTGG
T7_14712_G08	TGGTGTGTGGTTGGTTGGTCTTTTGTGTGTGGTGGT
T7_14713_G08	TTTGTGTGGTGGTGTTGGTCTTGTGTGGTTGGTGTG
T7_14714_G08	TGTGGGTGTGGTTTTGTGTCGTGTGTTGGTGTGTGT
T7_14715_G08	GTGTGTTGTGTGTGTGTGTCTGTGTGTGTTGTGGTG
T7_14716_G08	TTGTGTGTGTTGTGTGTGTCTGTGTGGTGTGTGGGT
T7_14717_G08	TTTGGTGTGTTGTGTGTGTCGTGGTTGTGGTGTGTG
T7_14718_G08	TGTGTGTGTTTTGTGTGGTCGTGTGTGTGGTGTGGT
T7_14719_G08	GGTGTGGTTGTTTTGGTGTCGTGTGTTGTTGGTGTG
T7_14720_G08	TGTGTGTTGTGTGTGTTGTCGTGTGGTGGGTGTGTT
T7_14721_G08	TGTTGGTGGTGTGTTGTGTCTGTGGTGTTTGGTGTG
T7_14722_G08	GTGGGTGTGTGTTGGTTGTCGTGTTGTTGTTGTGTG
T7_14723_G08	GGTGTTGTGTGTGTGTGGTCTGTTGTGGTGTTGTGT
T7_14724_G08	GGTTGTGGTTGTGTGTGGTCGTGTTGTTGTTTGTGG
T7_14725_G08	GTGGTTGTTGTTGTGTTGTCGTGTGGGTTGTTGTGG
T7_14726_G08	GTGTGGTGTGTGGTGGTGTCTGTGTGTTTGTTTGTG
T7_14727_G08	GTGTTGTGTGTGTGTGTGTCTGTGTGTTGGTGTGTG
T7_14728_G08	GGTTGTGTGGTGGTTTTGTCGGTGTGTGTGTTGGTT
T7_14729_G08	GTGTTTTGTTGTGTGGTGTCGTGTGTGTGTGTGTGG
T7_14730_G08	TGTGTTGGTGTGGTGTGGTCTGTTTGTGTGTGGTGT
T7_14731_G08	GTGGTTTGTGTGGGTGTGTCTTGTTGGTGTTGTTGG
T7_14732_G08	TGGGTGTGTGGTTTTGTGTCGGTGTGTGGGTTGTTT
T7_14733_G08	TGTTGTGTTGGTGTGTTGTCGTGTTGGTGTGTGTGG
T7_14734_G08	GTGTGTGTGTTGTGTTGGTCGTGGTGTGTGTGTTGT
T7_14735_G08	GGTTTGTGTGTGGGTTGGTCTGTGTGTGTGTTGTTG
T7_14736_G08	GTTGTGTTGGTTGGTTTGTCGTTGGTGTGTGTGTGG
T7_14737_G08	TTGTGGTGTTTGGTGGTGTCTGGTGTGTGGTGTTGT
T7_14738_G08	GTGTGTGTGTTGGTGTTGTCTTGGTGTGTTGTGGGT
T7_14739_G08	GTTTGTGGGTTGTGGTGGTCTGTGTGTGTGGTTTGT
T7_14740_G08	GGGTGTTGTGTGTGTTGGTCTGTGTTGTGTGTTGTG
T7_14741_G08	TGTGTGTGTGTTTGTGGGTCTGGTGTTGGTGTTGTG
T7_14742_G08	GTGTGTTGTTGTGTTGGGTCGTGTGTGTGGGTGTTT
T7_14743_G08	GTGTTGTGGTGTGGTGTGTCGTTTGTGTGTGTGTGT
T7_14744_G08	TTTGGTTGGTGTGTTGGGTCTGTTGTGGTTGTGGTG
T7_14745_G08	GTTGGTGTGGGTGTTGTGTCGTTGTGTGTTGTGGTT
T7_14746_G08	GTTGGTGTTGTTGTGTGGTCTGTGGTGGGTTTTGTG
T7_14747_G08	GTGGTGGTGTTGTGTTGGTCTGTTGGTTTGTGGGTT
T7_14748_G08	GTGTGTGTTGTGTTGGTGTCGTGGTTGTGTGTTGGT
T7_14749_G08	GTTGTGTGTGTGGTTTGGTCTTGTGTGTGTGTGTGG
T7_14750_G08	TGGTGTGTGGTGTGGTGGTCTGTTTTGTGTGTTGTG
T7_14751_G08	GGTGTGTGTTTTGTTGTGTCGTGGTGTGTTGGTGGT
T7_14752_G08	TGTGTGGTGTGTTGTTGGTCTTGTGGTGTGTGTGTG
T7_14753_G08	TGTTGTGGTTGGTTGTGGTCTTGTGGTTGTGGTTGG
T7_14754_G08	GGTGTTGTGGTTGTGTGGTCTGTGTTTGGTGTGTGT
T7_14755_G08	GTGGGGTTGTTGTGTGTGTCGTGTGTTTGTGTTGTG
T7_14756_G08	GTGTGTTGTGTGTTGTGGTCTGTGGTGTTGTGTGTG
T7_14757_G08	TGTTGTGTGGTGTGGTGGTCGTGTTTGTTGTTGGGT
T7_14758_G08	TGTGGTGTGTGTGTTTGGTCTGTGTGGTGTTGGTTG
T7_14759_G08	GGTGTGGTTGTGTGTGGGTCGTGTTTTGTTTTGGTG
T7_14760_G08	TGGGTGTTTGTTTGTGGGTCTGTGTGGTGTGTGTTG
T7_14761_G08	GTGTGTGGTTGTGTGTTGTCGTGTTGTGTTGGGGTT
T7_14762_G08	GTGTGTTGTTTGTTGTGGTCGTGGTTGTGGTGGGTT
T7_14763_G08	TGTGGTGTGTGTGTGGTGTCGTGTGTGTTGGTTGTT
T7_14764_G08	GTGTGTGGTGTTGTGGTGTCGTGTTGTGTTGTGTGT
T7_14765_G08	GTGTTGTGTGGTGTGTGGTCTGTTTTGTGGTGTGTG
T7_14766_G08	GTGTGTTGGTTTGTGTTGTCGTGTGTGTTGTGTGGG
T7_14767_G08	TGGTTTGGGTGTGGTGTGTCTGTGGTTTGTGGTTGT
T7_14768_G08	GTTGTTGGTTTTGTTGTGTCGGGTTGGGTGGTGTGT
T7_14769_G08	GGTTTTGTGTGTGTGTGGTCTGGTGGTTGGGTTTGT
T7_14770_G08	GGTGTTTGTGTGTGTGTGTCGGTGTTGGTGTTGTTG
T7_14771_G08	TGTTGGTGGTTGGTGGTGTCGTTGTTGGTGTGTGTT
T7_14772_G08	GTGGTTTGTGTGTGTGTGTCGTGTGTTGGTTGTGTG
T7_14773_G08	TTGTGGGGTGGTGGTTTGTCTGTGTTGGTTGTGTGT
T7_14774_G08	GTGTTGTTGGTGGGTTGGTCTGGTGTGGGTTTTTTG
T7_14775_G08	GTGTGGGTGTTTGTGTTGTCGTGTGTTTGTGGTGTG
T7_14776_G08	GGTGTGTGGTGGTTGTGGTCGTGTTTTTTGTGTTGG
T7_14777_G08	GGTGTGTGTGTTGGTTGGTCTTGTGGTGTGTGTTGT
T7_14778_G08	GTTGTGGTGTGTTGTGTGTCGTGTTGTGTGTGTTGG
T7_14779_G08	GTTGGTGTTGGTGGTGTGTCGTGTGGTTGTGTGTTT
T7_14780_G08	TGTGTGTGTGGTGTGTGGTCTGTGTTGTGTGTGTTG
T7_14781_G08	TGGTGGTTGTGTGTTGTGTCGTGGTTGGTGTTTGGT
T7_14782_G08	TTGGGTGTGTTGTGGTGGTCTTGTTGTGTGTGGTGT
T7_14783_G08	GTGGTGTGTTTGTTTTGGTCGTGTGTGTGGGTGTTG
T7_14784_G08	GTTGTGTGTGTTGTTGTGTCGTGTGTGGGTGTGTGT
T7_14785_G08	TTGTGTGTGTGGTGTTGGTCTGTTGTTGTGGGTGTG
T7_14786_G08	TGTGTTGTTGTGTGGTTGTCGTGTGTGGTGTTGTGG
T7_14787_G08	TGGGTGTTGTGTGTGTGGTCTTGTGGTGTGTGTGTT
T7_14788_G08	GTTTGTGTGTGTGTGTTGTCTGTGTTGTGGGTGTGG
T7_14789_G08	GTGTTGGTGTGTGTGTTGTCGTGTTGTGTGGTTGTG
T7_14790_G08	GTTTTTTGGTGTTGTGTGTCTGGTTGTGGGGTGTGG
T7_14791_G08	GTTGTGTGTTTGTGGGTGTCTGTGTGTGTGTGGTGT
T7_14792_G08	GTTGTGGTGTGGGTGGTGTCTTTGTGGTGTGTTTGT
T7_14793_G08	TGTTGTGTTGTGTGTGTGTCGTTTGGTGTGGGTGTG
T7_14794_G08	GGGTGTGTGGTGGGTTTGTCGTGTTGGGTTTTGTTT
T7_14795_G08	TGTGTTGTGGTGTGTTGGTCGTGTGTGGTTGTGTGT
T7_14796_G08	TGTGTTGTTGTGTGTGTGTCGTGTGTTGGGGTGTTG
T7_14797_G08	GTTGTGGTGGTGTTGTGGTCTGTTGTGTGTGTTGGT
T7_14798_G08	GTGTGGTTGGTGTGTGTGTCGTTGTTGTTTGGTGTG
T7_14799_G08	TTGTGTGTGTGTGTGTGGTCGTGTGGTGTGTTTGTG
T7_14800_G08	TGTGTTTGTGTGTGTGTGTCGTGTTGTGGTGTGGGT
T7_14801_G08	TGTGTGTGTGTTGTTTTGTCGGTGTGTGGGTGTGTG
T7_14802_G08	TGTGTGGTGGTGTTTGTGTCGGTTTGTTGTGTGTGG
T7_14803_G08	TGTGTTTTGTGTTGGGTGTCGTGGTGGTGGTTTGGT
T7_14804_G08	GTTGGTGGTTTGTTGTGGTCGTGTGTTGGTTTGTGG
T7_14805_G08	TTGTTGGTGGTGGTTGTGTCTGGTGGGTTTGGTGTT
T7_14806_G08	TTGTTGGGTTTTTGTGGGTCTGGTGTGTGGTGGTGT
T7_14807_G08	TTGTGGTTGGTGTGGTTGTCGTTTGGTGTGTGGTGT
T7_14808_G08	GTGTGGTGTGGTTTGTTGTCTGGTTGTTGTGGGTTG
T7_14809_G08	GTTGTGTGGGTGTGTGTGTCTGGTTGTTGTTTGTGG
T7_14810_G08	GTGTTGGTTGTGTGTGTGTCGTGTTGTGGGTGTGTT
T7_14811_G08	GGTTGTGTGGTGTGGTGGTCTGTGTTGTTTGTTGTG
T7_14812_G08	TGGTGTGGTGTGTGGTGGTCTTGGTGTGTGTGTTTT
T7_14813_G08	TTGTTTGTGGTGGGTGGGTCTTTTGGTTGTGGTGTG
T7_14814_G08	GTGTGGGGTTGTGTTGTGTCGTTGTGTGTTGTGTGT
T7_14815_G08	TGTTGTGTTTGGGTGGTGTCTGTGTGTGGTTTGGGT
T7_14816_G08	TGGGTTGGGGTTGTGGGGTCTGTTGTGTGTTTTTTG
T7_14817_G08	GGTTTGTGTGTGTGTTGGTCGTGGTTGTGTGTGGTT
T7_14818_G08	GTGGGTGTTTGTGTGTGGTCTGTGTTTGTGTGTTGG
T7_14819_G08	GGTTGTTTGTGTTGTGGGTCTGTGGTGTGTTGGTTG
T7_14820_G08	GGTGTTTGTGTGGTGGTGTCTGTTTGGTGGTTGTGT
T7_14821_G08	TGTTGGTGGTTTGGTTGGTCTTGTTGTGGGTGTTGG
T7_14822_G08	GTGTTTGTGTGGTGGTGGTCGTGTGTTTTGGTGTGT
T7_14823_G08	TTGTGGTTGGTGTTTTGGTCTGGTTGTGGGTGTTGG
T7_14824_G08	GGTGGGTTGTTTGTTGTGTCTTGGTGTTGTGGGTTG
T7_14825_G08	GGTGTTTGTGTGGTGGTGTCGTTGTGTTGGGTGTTT
T7_14826_G08	TTTGTGTGTGGTGTTGGGTCGTGGTGTGGTTTGGTT
T7_14827_G08	GTTTGTGTGTGTGGTTTGTCTGGTGTGTGTTGGTGG
T7_14828_G08	GGGTGTGTTTGTGTGTGGTCTGTTTTGGGTGTGTGT
T7_14829_G08	GTGTTGGTGTGGGTGTTGTCGGTTTGTGGTGTTTGT
T7_14830_G08	GTGGTTTGTGTGTGTTGGTCTTGTGTTGTTGGGGTG
T7_14831_G08	GTGTGTTGTGTGTTGGTGTCTGTGGTGTGGTTGTTG
T7_14832_G08	GTTTTGTGTGGTGGTGGGTCTTGTTGTGGTGTTTGG
T7_14833_G08	TGGTTGTGGTGTGTGTTGTCTGTGGTTGTTGTGGTG
T7_14834_G08	TGGTGGTGGTTGGTTTTGTCGTTGTGGTGTGTTGTG
T7_14835_G08	TGTGTGGTGTGGTTTTGGTCTTGGTGTGTGTGTGTG
T7_14836_G08	GTGTGTTTGTGTGTGTGGTCGTTGGGTGTTGTGTTG
T7_14837_G08	GTGGTGTTTGTTGGTGTGTCGGTGTGGTTGTTGTTG
T7_14838_G08	TTTGTTGTGGTGTGGGTGTCGTGTGGTTGTGTTGTG
T7_14839_G08	TGTGTTGTGGTGTTGGGGTCGTGTTGTGTGTGTTGT
T7_14840_G08	TGTGTTGTGGTTTTGTGGTCGTGGGTGTGTTGTGTG
T7_14841_G08	TTGTGTGTGTTGGTGTTGTCGGTGTGGGGTGTTGTT
T7_14842_G08	TGTGGTGTGTGTTGTGGGTCTTGTGTGTGGTTGTGT
T7_14843_G08	GTTTTGGTTGTTGGGTTGTCGGTGTGGTTGGTGTGT
T7_14844_G08	GTGTGGTGTGTGTGTTGGTCGTGTGTTGTTGTGGTT
T7_14845_G08	GTGTGTTTGTGTTGTGTGTCTGGTGTGTGTGGTTGG
T7_14846_G08	TGTTGTTGGTGTGTGGTGTCGTGTGTGTGTGTGGTT
T7_14847_G08	TTGTGTTTGGTGGTTTGGTCTGTGGTGGTTGTGTGG
T7_14848_G08	TGTTTTGGTGTGGGTTGGTCTGTGGGTGTGTTTGTG
T7_14849_G08	TGGGGTGTGTGGTGGTGGTCTTTTGTTTGTTGTGTG
T7_14850_G08	TTGTTGGTGGTGTGTGTGTCTTTTGGTGTGTGGGGT
T7_14851_G08	TGGGTGTGTTTGTGTTGGTCTGTGTGTTGTGTGGTG
T7_14852_G08	TTGGTGTGTGTTGGTTGGTCGTGTGTTTGTGGGTGT
T7_14853_G08	TGTGTTTGGTGTGTGGGGTCTTGTGGTGTGTGTGTT
T7_14854_G08	GTGTGTGGTGGTTTGTGGTCTGTGTGTTGGTGTGTT
T7_14855_G08	GGGGTTTGGTGGTGTGTGTCTTGTTGTTTGTGGGTT
T7_14856_G08	TTGGTGGTTTTGTTGGGGTCTGTGTGTTGGTGTGGT
T7_14857_G08	TTGTGGTGTGGTGTTTGGTCTGGTGTGTGTTTTGGG
T7_14858_G08	TGTTTGTGGGTTTGTGGGTCTGGTGTGGGTTGTTTG
T7_14859_G08	TGGTGGTGTGTGTGTGTGTCGGTTGTTGTGTTGTTG
T7_14860_G08	GTGGGTGGTGGGTGGTTGTCTGTGTTGTTTGTTTGT
T7_14861_G08	TGGTGTTTGGTGTGGGTGTCTGGGTGTGTTTGTTTG
T7_14862_G08	TGTGTGTGTGTTGTGTTGTCGGGTGTTGTTGTGGTG
T7_14863_G08	GTGTTGGTTGTGGTTGGGTCTGGTTGTGTTGTTGGT
T7_14864_G08	TGTGTTGTGGTGTGTTTGTCGTGGTGGTGTGTTGGT
T7_14865_G08	TTGTGTGTGTGTGGTGTGTCGTGTGTGTTGGTTGTG
T7_14866_G08	TGTGTGTGGTGTTGTGTGTCGTTGTGGTTGGGTGTT
T7_14867_G08	TGGTGTTTGGTTGGGGTGTCGTGTTTGTGTGTTGGT
T7_14868_G08	GGTGGTTTGTTGGGTGTGTCTGTTGGTGGTTTGTGT
T7_14869_G08	TGTGTTGTGGTGTGTGGGTCGTGTGTTGTTGTGTGT
T7_14870_G08	GTGTGTTGTGTTGGTGGGTCTGTTGTGTGTGTGTGT
T7_14871_G08	TTGTTGGTGTTGTTGGTGTCGTGGGTGTGTTGTGTG
T7_14872_G08	TGTTTGTGTGTTGTGGTGTCTGGTTGGTGTGGTTGG
T7_14873_G08	GTTTGTTTGTTGGTGTGGTCTGGTGGGGTTGTGTGT
T7_14874_G08	TGGTTGTGTTGTTGTGGGTCTGTGGTGGGTTTTGGT
T7_14875_G08	TGTGTGGTGTGTTGTGTGTCTGTTTGGTGTGGGTGT
T7_14876_G08	TTGGTTGTGTGTGGGGTGTCGGTTGTTTTGTGTGTG
T7_14877_G08	TGTGTTTTGGGGTGTTTGTCGTTGGGTGTGGGTTGT
T7_14878_G08	GTTTGTGGGTGTTGTGTGTCTGTGTGGTGGTGTTTG
T7_14879_G08	GGTTGTGGTGGGTTTTTGTCTTGGTTGTGGGTTGTG
T7_14880_G08	TGTGTGTTGTTGGTTGGGTCTGTGTGTTGTTGTGGG
T7_14881_G08	TGTGTGTTTGGGTGTGGGTCTGGGTTGTTGTGTGTT
T7_14882_G08	TGTTGTTTGGTTTGTGGGTCTGTGGTGTGGTTGGTG
T7_14883_G08	GTGTGGTTGTGGTTTGTGTCGGTGGTGTTGGTGTTT
T7_14884_G08	TTGGTGGTGGTGTGGGTGTCGTGTTTTGTGTGTTTG
T7_14885_G08	GGTGGTTTTGTGTTGGTGTCTGTGTGTGTGTGTGTG
T7_14886_G08	TGGGTGTTGTGGTTGGTGTCTTGTGGTGTGTTGTGT
T7_14887_G08	TTGGTGTTGGTTGTGTTGTCGGTGTTGTGGTGTGTG
T7_14888_G08	GGTGTGTGGTGTTGTTGGTCGTTTGGTGTGTTGTTG
T7_14889_G08	GTTGTTGTGTGGTGTGGGTCTTTTGTGGGTGGTTGT
T7_14890_G08	TTGTGGTGTGGTGTGGTGTCGTTTGGGTTGGTTGTT
T7_14891_G08	TTGTGGTGTGTGGGGTGGTCTTTGTGTTGTTGGTTG
T7_14892_G08	GGTGTGTGTTGTTTGTGGTCGGTGTGGTTGTGTTTG
T7_14893_G08	GTGTGGTGGTTTTGGGTGTCTGGTGGGTTGTTTTTG
T7_14894_G08	GTGTGGGGTGTGTGTTTGTCGTGTTTGGTGGTTTGT
T7_14895_G08	GTTTGGTTTTTGTGTGGGTCGTGGTGTTGTGTGGTG
T7_14896_G08	TGGTTGGTGTGTGTTGTGTCTGGTTTTGGGTTGGGT
T7_14897_G08	TGTTGTGGTGTTGGTGTGTCGTGGTTGTTGGTGTTG
T7_14898_G08	GTGTGGTTTGTGGTGTGGTCTGGTTGTGTTGTTGGT
T7_14899_G08	GTGTTGTGTGTTGTGGTGTCTTGTGTGTTGGTGTGG
T7_14900_G08	GTGTGTGTGTGTGTGGTGTCGGTTGTGTGTTGTTGT
T7_14901_G08	GTGGGTTGTTGTTTGGTGTCGTGTTGGTGTGTTGTG
T7_14902_G08	GTGGTTGTTGTTGGTGGGTCTGGTGTTGTTGGTTGT
T7_14903_G08	TGTGTTGTGTTGGTGGGGTCTGGGTTTTTTTGTGGG
T7_14904_G08	TGTGTTTTGTGTGTGTTGTCGGGTGTGTGTGTGGTG
T7_14905_G08	GGTGTTGTTGGTGTTGTGTCTGGTGGTGTGTTTGGT
T7_14906_G08	GTGTGGTGGTGGTTGTGGTCTGTGTGTGTGTTGTTT
T7_14907_G08	TTTGGTGGGTTGTGTTGGTCTGGGTGTGTTGTGTGT
T7_14908_G08	TGTTTTGGTGGGTGTGTGTCTTGTTGTGTGTGGGGT
T7_14909_G08	TTGTGTGTGTGGTGTGTGTCGGGTTGTTTGGGTGTT
T7_14910_G08	GTGGGTGTGGGTTGTTTGTCGGTGTGTGTGTTTGTT
T7_14911_G08	TGGTGGTGTGGGTTTTTGTCTGTGTGTTGTGGGTGT
T7_14912_G08	GTGTGTGGTGTGGTTGTGTCGTGTTTGGTGTTGTGT
T7_14913_G08	GTGTGGTTTTTGTGTTGGTCGTGTGTTGGTGGTGGT
T7_14914_G08	GTTGTGTGTGGTTGTGGGTCTGTGTTGTGTGTTGTG
T7_14915_G08	TGGTGGGTTGGGTTGTTGTCGTTGTTTTGTGTGGGT
T7_14916_G08	TGTGTGTGTGTGTTGTTGTCGTGGTGTGGGTTGTGT
T7_14917_G08	TTGTGTGTGTGTTGTGTGTCGGGTGTGTTTGTGGTG
T7_14918_G08	GTGTTGGTGTTTGTTGGGTCTGTTGTGGTTGTGGTG
T7_14919_G08	GTTTGGTTTTTGTGTGTGTCTGTGTGGGTGTGGGTG
T7_14920_G08	GGTGTTTTGGGGTGGTGGTCTGGTTGGTGTTTGTTT
T7_14921_G08	TTGTGTGTGGGTGTGTTGTCTGTTGGGTGTGTGTGT
T7_14922_G08	TGTGTGTGGTGTGTGGGGTCGTGGTTTGGTTTTTGT
T7_14923_G08	TTGTGTGGGTGTTGTTGGTCGGTGTGTGTGGTGTTT
T7_14924_G08	TTGTGTTGGTGTGTTGTGTCTGTGGTGGGGTGTTTG
T7_14925_G08	TTGTTGTGTGTGTGGTTGTCGGGTTGGTGTGTGTGT
T7_14926_G08	GGGGTGGGTGTTTGTGTGTCGGTTGTGTTTTGTTGT
T7_14927_G08	TGGGGTTTGTTTGTGTGGTCTGTTGTTGTGTGGTGG
T7_14928_G08	GTTGGTGTGGTTTTGTGGTCTGTGTGTGTGTGGGTT
T7_14929_G08	GTGTGTTGGTGTTGGTGGTCTTTTGGTGGTTGTGTG
T7_14930_G08	GTGGGTGTGTGTGGTGTGTCTTGTGTGTTGGTTGTT
T7_14931_G08	TGGTTTTGTGTTGTTGGGTCTGGTTGTGGTTGGGTG
T7_14932_G08	TGTGTTGTGTGTGGTTGGTCTGTGTGTGTTGTTGGG
T7_14933_G08	TGTGTGGGTTTGTGTGTGTCTGTGTGTGTGGTGTGT
T7_14934_G08	GTGTGTGTTTGTGTGGTGTCGTGGTTGTGGTGTGTT
T7_14935_G08	GGGTTTTTGGTTTGTGTGTCGTGGTGGTTGGTGTGT
T7_14936_G08	GGGTTTGTTGTGTGTTTGTCGTGGGGTTTTGTGGGT
T7_14937_G08	GTTGTGTGTGTGGGTTGGTCTGTGGGTTTTTGTTGG
T7_14938_G08	TTTGTTGGTGGGTGTTGGTCTTTGTGGTGTGTGTGG
T7_14939_G08	GTTTGTTTGTTGGGTGGGTCTTGGGTGTGTGTGTTG
T7_14940_G08	TGTGGTGTGTTTGTGTGGTCGTGTGTGGGTTGTGTT
T7_14941_G08	GTGTTGTGTTGTTTGTGGTCTTGTGGTGTGGTGGTG
T7_14942_G08	GTGTTGGTGTGTGGGGTGTCGTTGTGGTTTTGTTTG
T7_14943_G08	TTGTTGGGTGGTGTGTGGTCGTGTGTTGTGTGTGTT
T7_14944_G08	TGTTTGTGTTTGTGTGTGTCGTGTGTTGGTGGGTGG
T7_14945_G08	TTGGGTGTTGTGGTGTGGTCTTGTTTGTGTGGTGGT
T7_14946_G08	GGGTGTTGGTGTTGTTTGTCTGTTGTGTGGGTGTGT
T7_14947_G08	GTGTTTTGTGTGTTTGTGTCGGGGTGGTTTGGTGTG
T7_14948_G08	GTGGGTTGTGTGTGGTGGTCTGTTGTGTGTGTTTGT
T7_14949_G08	GTGTTGGGGTTGTTGTTGTCGGTTGTGTGTGGTTGT
T7_14950_G08	GTGTTGGTGTTGTGTGGGTCGGTGTTTGTGTTTGTG
T7_14951_G08	GTTTTGTGGTGTTTGGGGTCTGTGGTGTGGTGTTGT
T7_14952_G08	GTTGTTGTGTGTTGTGGGTCTGGTTGGGTTGTGGTT
T7_14953_G08	TGTTTTTGTGTGGTTGTGTCGTTGTTGTGGGGTGGG
T7_14954_G08	TGGGTGGTGGTGGTGTTGTCTGTTGTGTGTGTTGTT
T7_14955_G08	GTGTGTGTTGTTGTTGTGTCGTGGTGGTGTGTTGTG
T7_14956_G08	GGTTGGGTGTGTGTGTTGTCTGTGTTTGTGTTTGGG
T7_14957_G08	GTGGGTTTGTTGTGGGTGTCTGTGTTGTTGGGTTTG
T7_14958_G08	TGTGGGTGGTTGTGTGTGTCTTGTGTGTGGTGTGTT
T7_14959_G08	TGTGTGGTGGTTGGGGTGTCTGTTTGTGGTGTGTTT
T7_14960_G08	TGTGTTGTGTTTGTTGTGTCGGGTGGGGTGTTGTTG
T7_14961_G08	GGTGGTTGTTGGGTTGTGTCGTGGTGTTGTTTGTTG
T7_14962_G08	TGTGTGTGTTGTGGTGTGTCGTGGTGGTGGTGTTTT
T7_14963_G08	TTTTGTGTGGTGGGTTGGTCGTGTTGTGTGGTTGGT
T7_14964_G08	GTGTTTGGTGTGTTTGTGTCTGGGGTGTGGGTTTGT
T7_14965_G08	GGTGGTTGTTTGTGTGTGTCGTTTTGTGTGTGTGGG
T7_14966_G08	TGTTGTTGGTGTGTGGGGTCTTGTGTTGTGTGTGTG
T7_14967_G08	TTGTGGGTGTTGTGTTGGTCGTGTTGGTTGTGGTGT
T7_14968_G08	TGTGTGTGTGTGTTTGGGTCTGTGGTGTGGTGTTGT
T7_14969_G08	TGGGGTGTTGGTTTGTGGTCGTTTTTGGTTGGTGGT
T7_14970_G08	TGTGTGTGTGTTTGGTGGTCTTGTTGGTGGTGTGTG
T7_14971_G08	GTTTTTGGTGTGTTGTGGTCTGGTGGTGGTTGTGGT
T7_14972_G08	TGGTTGTTGGTGTTGTGGTCGTTTGTGGGTGTTGTG
T7_14973_G08	TTGGTGTGTGGTTGTGTGTCGTGTGTGTTTGGTGTG
T7_14974_G08	TTTGTGTGGTGGTGTGTGTCGTGTGTTGTTTGGTGG
T7_14975_G08	GGGTGTGTGTTTGTGTTGTCGGGTTGGTTTGTTGTG
T7_14976_G08	TTTGTGTGGTGGTGTGTGTCGTTGGGGTGTTTGTTG
T7_14977_G08	TGTGTGTGGGTGGTTGTGTCTGGTGTTGTTTTGTGG
T7_14978_G08	TTGTTGTGTGGTTGGGTGTCGGTGTGTGTGTTGTGT
T7_14979_G08	TTGGTGTTGGTGGTGTGGTCTGTTGTGTGTGTGTGT
T7_14980_G08	GGGTGTGTGGTGTTGTTGTCGTTTTGGTGTTGTGTG
T7_14981_G08	TGTTGTGGGTGTGTGTGGTCGTTGTGTGTTGTGTGT
T7_14982_G08	GTTGGTTGTGTGTGTTGGTCGGTTGTGGGTGTTGTT
T7_14983_G08	GGGTTGTTGTTTTTGTGGTCGGTGGTGTGTTGTGGT
T7_14984_G08	TGGTTGTGTGTGTTGGTGTCGTTGGTTTGTGTGGTG
T7_14985_G08	TGTGTGTGTGTGTGTGTGTCTGTGGTTGGTGTGTTG
T7_14986_G08	GTGTTGTTGTGTGGTGGGTCTGTGGTTTGTGTGTGT
T7_14987_G08	GGTTGGTGTGGTTGTTGGTCTGTGGTGGTTGTTGTT
T7_14988_G08	GTGTTGTGGTTTGTTTGGTCGGTGTGGGTTGTGTTG
T7_14989_G08	TGTGTGTGGTGTGGTGTGTCTTGTGTGTGTGGTTGT
T7_14990_G08	TGGTGTGTGTGTGGTGTGTCTGTTGTGTTGGTGTTG
T7_14991_G08	TTGTGTGTTGGTGTTGTGTCGGGGTGGTTGTTTGTG
T7_14992_G08	GGGTTGTGTTTGTTTTTGTCGTGGTGTGGTGTGTGG
T7_14993_G08	TGTGTGTGTGTGTGTGTGTCTTGGGGTTTGGGGTTT
T7_14994_G08	GGGTTGTGGGTGTTGTGGTCTTTGTTGGTGTGTTGT
T7_14995_G08	GTGTGTGTTGGTGTGTGGTCGTTTGGTGTGTTGTGT
T7_14996_G08	GTTTGTTGTGTGGTGTTGTCGTTGGTGTGTGGGTTG
T7_14997_G08	TGGTTGTGTGTGGTGTTGTCTGTGTGTTGGTTGGTG
T7_14998_G08	GTGTTGTGGTTGGTGTTGTCGTGTGTGTTGGGTGTT
T7_14999_G08	TGGTGTTTGGGTGTTGTGTCGTGGGTGTTGTTGTTG
T7_15000_G08	TGTGTGTGTGGGGTGTTGTCGGTGTTTGTTGTTGTG
T7_15001_G08	TGTTGGTTTGTGTTGGTGTCGTGGTTGTTGTGGGGT
T7_15002_G08	GGTTGTTTTGTGGGTGGGTCTTGTGTGTGTGTTGTG
T7_15003_G08	TGGTGTTGTTGTGTGTGGTCTGTGGTGTGTTGTTGG
T7_15004_G08	TTGGTGTTGTGGGTGGTGTCTTGGGGTTTTTGTGGT
T7_15005_G08	TGGGTTGTTGTTGGTTGGTCTTGGTGGTTTGTGGGT
T7_15006_G08	GTTGTGGTTGTGGTGTGGTCTGTGGTGTGTTTGTGT
T7_15007_G08	GGTGTTGTGGGTTGTTTGTCGGTTTTGTGTGTGTGG
T7_15008_G08	TGTTGTTGTGGTGTGGTGTCGGGGTTGTGTTGTGTT
T7_15009_G08	GTGTGTGGGTGTGGTTGGTCTTGTTGTTGGTTTTGG
T7_15010_G08	GGGTGGTGGGTTTGTTTGTCTTGTGGTTTGGTGTGT
T7_15011_G08	TGGTGTGTGTTGTGTGTGTCGTTGTTGGGGTGTTTG
T7_15012_G08	TTGTGTGGTTGTTGGTGGTCTGGGTGGTTGTTGGTT
T7_15013_G08	GTTGTGTGGTGTGTGGTGTCTTGGTTTTGGGGTGTT
T7_15014_G08	TGTGTGGGGTTGTTTTTGTCGTGTGGTGGTGTGGTT
T7_15015_G08	GTTGTTTGTGTTGTGGTGTCGTTGTGTGGGTTGTGG
T7_15016_G08	TGTTGGTGGGGTGTGGTGTCTGTTTGTTGTTTGGGT
T7_15017_G08	GTTGTTGGGTGGTTGTGGTCGGTGTTTGTTGTTGTG
T7_15018_G08	TGTTGTTTGGGTGGGTGGTCTGTGGTTTTGGGTGTT
T7_15019_G08	GGTTTGTGTTGTGTGTGGTCTGGTGTTGGTGTGTTG
T7_15020_G08	TGTGGTTTGTGGTGGTGGTCTTGTTTGTGTGGTGTG
T7_15021_G08	TGTGTGGTGGTTGTTTGGTCTGTGGTGGTGTGTTGT
T7_15022_G08	TTGTGTGTTTTTGGTTGGTCTGTGGGGTGTGTGGGT
T7_15023_G08	TGTGTGGTGTGTTTTTGGTCTGGTGTGTGTGTGTGG
T7_15024_G08	TTGGGTGGGTGGTGTTTGTCGTGTGTTTGTGTGTGT
T7_15025_G08	GTGTTGGTTGTGTTTGTGTCGTTGTGGTGTGTGTGG
T7_15026_G08	TTTTTGTGGGTGGGTTGGTCTGGTTTGTGGTTGTGG
T7_15027_G08	TGTGTGTGGTGGTGTTTGTCGTTGTGTTTGTGGGTG
T7_15028_G08	GGGTGTGTGTGTGGTGTGTCGTTGTGGTTTTGTTGT
T7_15029_G08	GTTTTGGGTGTGTGTTGGTCTGTTGTTGGTGGTGGT
T7_15030_G08	GGTGTGTGTGTTTGTGGGTCTGTGTTGGTTGTTGTG
T7_15031_G08	GTGTTTGTGTGTGTGTTGTCGGGGTGTGTTGTGTTG
T7_15032_G08	TTGGGTGTGGTGTGTGTGTCTGTGTTGTTGTGTGTG
T7_15033_G08	TGGTTTGTTTTGTGGTTGTCGGTGGTGTGTGGTTGG
T7_15034_G08	GTTGTGGTTGTGTGTTGGTCTGTGGTTGTGTTGGGT
T7_15035_G08	GTGTGTGTGGTGTGTGGGTCGTGTTGTGTGTGTTTT
T7_15036_G08	GGTGTTGTTGGTGTGTGGTCTTGGGGTGTTTTGTGT
T7_15037_G08	GTTGGTTGTTGTTGTGTGTCGTTGGTTGTGTGTGGG
T7_15038_G08	TGGTGTTGGTTGTGTTGGTCTTGGGTTGTTGGTGGT
T7_15039_G08	GTTGTGTTTGGTTGTGTGTCTGGGTGTGGGTTTGGT
T7_15040_G08	GTGTGTGTGTGTTTGTTGTCGGTGTGTTGGTGGTGT
T7_15041_G08	GGTTGGTTTGTGTGTGTGTCTTGGTGTGGTGTGTGT
T7_15042_G08	GGTTGTGTGTTTTTGGGGTCTTGGTTGTTGGTGTGG
T7_15043_G08	TTGTGTTGGTGTTTGGGGTCTGTGTGTGTGTGGTGT
T7_15044_G08	GTGGGTGTTGTGTTGTTGTCGTTGTTTGGGTGGTGT
T7_15045_G08	TGGTGGTGTTTTTTGTTGTCGTGTGTGGTGGTTGGG
T7_15046_G08	GTGGTTGTTTGTGGGTGGTCTGTGGTGTTTTGTGTG
T7_15047_G08	GGGGTGTGTGTGTTGGTGTCGTTGTTTTTGTGGTTG
T7_15048_G08	TTTTGGGTGTGTTGTGTGTCTTGTGGTGTGGTGTGG
T7_15049_G08	GTGGTGTTTGTTGTGGTGTCTGTTGTGTGTGTGGTG
T7_15050_G08	GGTTTTTGTGTGTGGTTGTCGGTGTTTTGGGTGTGG
T7_15051_G08	GTGTGTTGGTTTTTGGTGTCGGTTGTGTGTTGGGTG
T7_15052_G08	TGTGGTGGGTGTGTTGTGTCGGTTGTTGGGTTGTTT
T7_15053_G08	TGTGGTGTGGTGTGTGTGTCGTGTGTGTTGTGTTGT
T7_15054_G08	TTGTTTTGGGGTTTGGTGTCGGGTGTGTGGTTGTTG
T7_15055_G08	GGGTGTGTTTTTGGTGTGTCTGTTGTGTGTGTGTGG
T7_15056_G08	GGTTGTGTGTGTTGTGTGTCTGTGTGTGTTGGTTGG
T7_15057_G08	GGTTTGTGGTGTGGTTTGTCGTGGGTTTGTGTGTTG
T7_15058_G08	GTGTGTGGTGGGTGTGTGTCGGTTTTTGTGTGTGTT
T7_15059_G08	TGGTGGTTGTTGGTGTTGTCTGTGTGGTGTTTGTGG
T7_15060_G08	TGTTGTGTGGTTTTGTGGTCTGTTTGGGGTGGTGTG
T7_15061_G08	TGGTGTTGGTGGGTGTTGTCGGTTGGTTGTTTGTGT
T7_15062_G08	TGGTTTTTTTGTGTTGTGTCTGGTGGTGTGGGGTGG
T7_15063_G08	TTGTTGGTGGTGTTGTGGTCTGTTTGTGTGTGGTGG
T7_15064_G08	GTTTGTTTTGTTGTGGGGTCGTGGTGTTGGTGTGGT
T7_15065_G08	TTGGTTGTGGTGTTTGGGTCTGGTTTGTTGGGTTGG
T7_15066_G08	GTTGTGTGTTGGTTGTGGTCTGTGGTTGTGTGGTTG
T7_15067_G08	GGTGTTGGTGTTGTGTTGTCGTTGTGTGGTTGTGTG
T7_15068_G08	GGTTGGTGTGTGTTGTTGTCGTTGTGTGTGTGTGTG
T7_15069_G08	GGTGTTGTGTTGTGGTGGTCGTGTGGTGGTTTGTTT
T7_15070_G08	TGGTTGTGTTTGTTGTGGTCTGTGGGTTGGGTGTTG
T7_15071_G08	GTGTGTGTGTGGTGTGTGTCGTTGTGTTGTGTGTTG
T7_15072_G08	GTTTGGGTTTTTGGTGGGTCTGGGTTGGGTGTTTTG
T7_15073_G08	GGTGTGTGGGTTTTGTGGTCTTTGGTGTGGTTTGTG
T7_15074_G08	TTGTTGGTGTTGGGTGTGTCGGGGTTTGTTGTGTTG
T7_15075_G08	GTGGGTGTTTGGGTGTGGTCTTGTGTGTGTGTTTTG
T7_15076_G08	TGTGGTGGGTGTGTGTGGTCTTTTGTTTGTGGTGGT
T7_15077_G08	GTTGGGTGTTGTTGTGTGTCTGTTGTGGTGTGTGTG
T7_15078_G08	TGTGGTGTGTGTTGTGTGTCTGGGTTTGTTGGTGTG
T7_15079_G08	TGTGGTGTGTGTGGTTGGTCGTGTTGTTGTGTGTGT
T7_15080_G08	TGTGTGGGTTGTGGTTTGTCGTTGGTTGTGTTGGTG
T7_15081_G08	GTGTTTGTGTTTGTGGTGTCTTGGGTGGTGGTTGTG
T7_15082_G08	TGTTTGTTTTGTGGGGTGTCGGTTGTGGGTGTTGTG
T7_15083_G08	TGTGGTGTGTGTGTTGTGTCGTGTGGTGGTGTTTGT
T7_15084_G08	TGTGTTTGGTGTGGTGGGTCTTGTTGTGGTGTTGTG
T7_15085_G08	TGGGTGTGTTTTGGGTTGTCGTGTGTGTGTGTGTGT
T7_15086_G08	TTGTTGTGGGTGTTGGGGTCTGTGTGTGTGTGTTGT
T7_15087_G08	GTTGTGTGTTGTTGGGTGTCGTGTTGTGGTGTTGGT
T7_15088_G08	TGTTGTGTGTGTGTGTGGTCTGGTTGTGTGTGGTGT
T7_15089_G08	GTGTGTGTTTTGGGGTGGTCTTGGGTGGGTTTTTTG
T7_15090_G08	TTTGTGTGTGTGTGGTGGTCTGTGGTGTGGTGTTGT
T7_15091_G08	TTGGGTTTGTTGGGGTTGTCGTGGGGTTTGGTTGTT
T7_15092_G08	GGTGTGTTGTGTGTGGTGTCTTGTTGGGGTTTGTGT
T7_15093_G08	TGGTGTGTGGTGTGTTGGTCTTGGGTTGTGTTTTGG
T7_15094_G08	TGTGGGTGGTTTGGTGTGTCGTGTGGTTTGTTGGTT
T7_15095_G08	GGGTGTGTTTTGTGTGGGTCTGTTGTGTGTGTTGGT
T7_15096_G08	GTGGTGTGGTTTTGGTGGTCGTTTGTGTGTGGTGTT
T7_15097_G08	TTTGGTGTTGGTTGTGTGTCGGTGTGTTGTGTTGGG
T7_15098_G08	GTGGTGTTTGTGGTTTTGTCTGTGTTGGGTGGGTGT
T7_15099_G08	GTTGGTGGTGTGGGTTGGTCTTGTGTTTGGTGTGTT
T7_15100_G08	GGGTTTGGTGTGTTGGTGTCGGTTGTGTTTTTGTGG
T7_15101_G08	TTTTGTGGTGTGGGTGTGTCGTTGTGTGTTGGTGTG
T7_15102_G08	TGGTTTGTGTGGTGTGTGTCTGGGGTTGTTGGTTGT
T7_15103_G08	GGTTGGTGTGGTTTTTGGTCTTGTGTGTGGGTTGTG
T7_15104_G08	TGTTGTTGGGTTTGTTGGTCTGGGTGGGTGGTTTGT
T7_15105_G08	GTGGTTGTGTTGTGTTTGTCGTGGGTGGTGTGTGTT
T7_15106_G08	GTGTGTGTGTTGTGTGTGTCGTTGTGTGTGTGTGGT
T7_15107_G08	TGTGGTGTGTGTGGTGTGTCGGGTGTTTGGTGTTTT
T7_15108_G08	GTGTTGTGGTGGTGTGGGTCGTGTTTGTTGTTGTGT
T7_15109_G08	TTGTGTTGTTTGGTGTTGTCGGTGGGGTTGGTGTTG
T7_15110_G08	TGGTTTTGTGTGTGTGTGTCTGTGTGTGGTGTGGGT
T7_15111_G08	GTGTTTGGTGTTGTGTGGTCGTGGGTTGTTTGTGTG
T7_15112_G08	GGGTGTGTTGTTGTTTGGTCTGTGTGTGGGTTGTGT
T7_15113_G08	TGTTTTGTTTTGTGTGTGTCGTGGTGTGGGGTGGTG
T7_15114_G08	TGTGGTGTTGTGTGTTGGTCTGTGGTGTTGTGTGGT
T7_15115_G08	GTTGGTTGGTGGTTTGTGTCGGTTGGTTGGTGTGTT
T7_15116_G08	GGTGTGTTGTTGTGTGTGTCGTGTGTGGTTGGTTTG
T7_15117_G08	TTGTGTTGTGTGGTTTGGTCTGTGTGTGGTTGTGGG
T7_15118_G08	TGTGTGTGTTGTGTGTGGTCTGTTGGTTTGTGTGGG
T7_15119_G08	GTGTGTGTGTGTGTGTTGTCGGTTGTGTGTGTGTGT
T7_15120_G08	GTGTGGTTTGGTTGTGTGTCGGTGTGTGTTTGGTTG
T7_15121_G08	TTGTGTTGTGTTGTGGGGTCTGGTGTTGGTGTTGGT
T7_15122_G08	GTGTGTTTGTTGGTGTGGTCTGTGGTGGGTTTGTGT
T7_15123_G08	GTTGTGGTGTGGTTTTGGTCGGGTGTTGGTTGTGTT
T7_15124_G08	GGGTGTGTTGTGTTGTTGTCGTGTTTGGTTGGTGGT
T7_15125_G08	GTTGTGTGTGTGTTGTGGTCGTTTTGGTGGTGTGTG
T7_15126_G08	TGTGTGGTGTGTGTGTTGTCGTTGTGTGTGTGGTGT
T7_15127_G08	TGTGGGTGTGTGTTGGTGTCGTTTGTGTTGTGTGTG
T7_15128_G08	TTGGGTTTGGTTTTGTGGTCGGTTGGTTTGTGGTGG
T7_15129_G08	GGTTGTGTTGTGTTGTGGTCTGTGTGTGTGTTGTGG
T7_15130_G08	GGTGTGTTGGTGGTGTTGTCGGTTGTGTGTGTGTTT
T7_15131_G08	TTTGTGGGGTGTGTTGTGTCGTGGTTGTGGTGTGTT
T7_15132_G08	TGGTTGTTGGGTGTGTGGTCTGGGTTGGTGTTTTGT
T7_15133_G08	TGTGTGTGTGTTGGTTGGTCTTGTGTGGTGTGTGTG
T7_15134_G08	GTGGTGTTGTGGGGTTTGTCGTGGGTTGTTTTGTTG
T7_15135_G08	GTTGTGGGTGTGTGTTTGTCGTGTGTGTGTGGTTTG
T7_15136_G08	TGTGTTGTGTGGGTGTTGTCTGTGGTGTGTTTGGGT
T7_15137_G08	GTGTGTGTTGTGGTGTTGTCGTGTGGTGGTTTGTTG
T7_15138_G08	TGTGGTTGTGTGGTTGTGTCGTGTGTGTTGGTGTGT
T7_15139_G08	GGGTTTGTGTTTTGTTGGTCGGTGTGTGTGTGTGGT
T7_15140_G08	TGGTGTTTGTGTTTTGGGTCGTGTGTGTTGTGTGGG
T7_15141_G08	GTGTTGTTGTGTGGGTGGTCGTGTGTGTTTTTGTGG
T7_15142_G08	TTGTGTGTTGTGTGTGTGTCGTGTTGGTTTGGTGGG
T7_15143_G08	GGGTGTTGTTGGGTTTTGTCGTGGTGTGGTTTGTTG
T7_15144_G08	GTGGTTGGTGTGTGTTGGTCGGTGTGTTTGTGTTTG
T7_15145_G08	GTGGTGGTGGTGGTGTTGTCTTGTTGGTGTTTGGTT
T7_15146_G08	TTGTGTGGTTGTGGTGTGTCTTGGGTTGTTTGTGGG
T7_15147_G08	TGGTGTGGTTTGTGGTGGTCTGTGGGTGTTTGTTGT
T7_15148_G08	GTTGGTGGTTGTGGTGTGTCTGTGTTTTGGGGTGTT
T7_15149_G08	TGTGGGTTGTGGTGTGGGTCTGTTGTGTGTTTGTGT
T7_15150_G08	TGTTTTTGTGGTGGGTTGTCGTGTGTTGTGGTTGGG
T7_15151_G08	TTGTTGTGGTGTGTGTTGTCGTGGTGTTGGTGTGTG
T7_15152_G08	GTGGGTGGTTGTGGTTGGTCTGTGTGTTGTTGTGTT
T7_15153_G08	TTGGGTGTGGTTGTGTTGTCGGTGTGTGGTTGTTTG
T7_15154_G08	TGTTTGGTTGTGGTTGTGTCGTGGTGGTGGTGTGTT
T7_15155_G08	TGGTTGTTGTGTGTGTGGTCGTTTTGTGGGTTGGTG
T7_15156_G08	TGTGTTTGGTGTTGTGTGTCGTGTGTGGTGTGTGTG
T7_15157_G08	GGTGTGGTGTGTTTTGTGTCTGTGGGTGTGGTGTTT
T7_15158_G08	TGTGTGGTGGGTGTTTGGTCTGTGTGTTGGTGTTGT
T7_15159_G08	TTGGTTGTGGTGTGGTTGTCGTGTGGTGTTGTGTGT
T7_15160_G08	GGGTTGGTGTGTGTGTGGTCTGGTTGGGTTTTTTTG
T7_15161_G08	TGTGTGTGGGTTGTGTGGTCTTTGGTTGGTGGTTTG
T7_15162_G08	GGGTGTTGTGTTTGTGTGTCTGTGTGGTGTGGTGTT
T7_15163_G08	TGTTGTGTGGTGGGTTGGTCTGTGTTGGTTGTGTGT
T7_15164_G08	TGTGTTGGGTTGTTGTGGTCTGGGTGTTTGTGTGTG
T7_15165_G08	GGGTTGTGGTGTGTTTGGTCTGTTGTGGGTGTGTTT
T7_15166_G08	TTGTGTTGGTTGTGTGTGTCGTGTGTGGTGTGGTTG
T7_15167_G08	GTGTGGTGTTGTGTGGTGTCTGTTGTTGGTGTGTGT
T7_15168_G08	GGGTGTTGTTGTGTGGTGTCGTTTGGTGTGTGTTTG
T7_15169_G08	TGGTGTGGGTGTGTTGTGTCGTTGTGGTGGTTTGTT
T7_15170_G08	GTGTTTGGTGTGGGTTGGTCGGTTGTTGTGTTGTGT
T7_15171_G08	GTTTGGTTGGGTTGTGGGTCGTGTGTGGTGTTGTTT
T7_15172_G08	TGTGTTGTTTGGTGGGTGTCGTGTGTGTGTGTTGTG
T7_15173_G08	GTGGTTTGTTGTGGTTTGTCGTGTGTGGTGGGTTGT
T7_15174_G08	GTGTGTGGTGTGTTGGTGTCGGTGTGTTGTGTGTTT
T7_15175_G08	TGGTGTTTTTGGGGTGTGTCTGGGTGGGTTGTTTGT
T7_15176_G08	TTGTGGTGTTGTGTGTGGTCGTGGGTGTGTGTTTTG
T7_15177_G08	GTGGTTGGGTGTGTGTTGTCGTTTGTGTGTTGTGTG
T7_15178_G08	TTGGTGTTTGTGGTTGTGTCGTGTGGTGTTGTTGGG
T7_15179_G08	GTTGTGTGTGTGGTGGTGTCTTTGTTTGGTTGGGGT
T7_15180_G08	TGTTTGTTGTGTGTTGGGTCTGTGTGGGTGTGTGGT
T7_15181_G08	TTTGTGGTTGTGGTGTGGTCGGTGTTGGGTTGTGTT
T7_15182_G08	TTTGGTGTTGTTGGGTGGTCGTGTTGTGTGGTTGTG
T7_15183_G08	TTGTGGTTGGGTGTGTGGTCTGTGGTTGGTGTTGTT
T7_15184_G08	TGTGGTTGTGTTGGTGTGTCTGGTGTGTTGTGGTGT
T7_15185_G08	TGTGTGTGTGTGGTGTTGTCTGGGTGGTGTTGTGTT
T7_15186_G08	GGTGTGTGTTTGGTGTTGTCGTGGTTTGTGTGGTGT
T7_15187_G08	GTGGGTGTGTGTGTGTGGTCGTGTTGTTTGTGTTGT
T7_15188_G08	GGTTGGTGTTGTTGTTGGTCTGTGGTTTGGGTGTTG
T7_15189_G08	TTGTGTGTGTGTGTTGTGTCGGGTTTGGTGTGGTGT
T7_15190_G08	GTGTGTTTGTTGTGGTTGTCGTGTTGTGGTTGGGTG
T7_15191_G08	TGGGTGTGTTTGTGTTGGTCTTGGTGGGTGTTGTTG
T7_15192_G08	GTTTGGTGTTGTGTTGGGTCGGTGTTTGTGTGTGGT
T7_15193_G08	GTTTGTGTGTTGTGTGGGTCTGTGTGTGTTGGTGTG
T7_15194_G08	TTTTGTGTTGGTGTGGGGTCTTGGGTTTGTGGTGTG
T7_15195_G08	GTTGTTGTGGTGTGGTGGTCGTGGTTGTTTGTGTGT
T7_15196_G08	GGTGTTGTTGGTGTTTTGTCGTGGTGTGTGGGTGTT
T7_15197_G08	TTTGTGGTGTGTTGGGTGTCGTGGTTGTGTTGTGTG
T7_15198_G08	TTGTGTGTGGGGTTGGTGTCTGTGGTGTTGTGTGTT
T7_15199_G08	TTGTGGGTGTGGTGTTGGTCTGTTTTGTGTTGGTGG
T7_15200_G08	GTGTTGGTTGTGGTGGTGTCGTGGTTTGTGTGTTTG
T7_15201_G08	GTGTTTGTTGGTTGTTGGTCGGTGGGGTTTTGGTGT
T7_15202_G08	GTGTTGGGGTGTTTTGTGTCGTTGTTGTGTGGTGTG
T7_15203_G08	GTGGTGTTGTTGGTGGTGTCTTGTGTGGTGGTGTTT
T7_15204_G08	GTGGGTTTTGTGTGTGTGTCGTGTGTTGTTGTGTGG
T7_15205_G08	GGTTTTGTTGTGGGTTGGTCGGTTGTGTTGGGTTGT
T7_15206_G08	TTGTGTTTGGGTTTGGTGTCGTTGTGTGGTTGTGGG
T7_15207_G08	GTGGTGGTGTTTGTTGTGTCGTTGTTGGTGTGTTGG
T7_15208_G08	GTTGGTTGTTGGGTGTGGTCTGTGTGTGGGTTTTTG
T7_15209_G08	GTGGTGTTGTGTGTTGTGTCGTGGGTGTGTTGTTGT
T7_15210_G08	TGGTGGTGGTGTGTTTGGTCTGGTTTTGTTGGTGTG
T7_15211_G08	GGTTGTGTTGGTTGTGTGTCGTGTGTGTGTGTGGTT
T7_15212_G08	TGGTTGGTTTGTTGTGTGTCGGTTTGGTGTGGTGTG
T7_15213_G08	GTTGTGGTTTGTGTGTTGTCGTGGGTGTGGTTGTGT
T7_15214_G08	TGTTTGGGGTTGGTTTGGTCTGTGGGTTGTTGGTGT
T7_15215_G08	TGTGTGTGTGGTGGTGTGTCTGGTTGTGGTTGTTGT
T7_15216_G08	TTGTGGGGTTTGGGTGTGTCGGTGTTGTTGTGTTGT
T7_15217_G08	TGTGTTGTTTTGTTGGTGTCGGGTTTGGGTGGGGTT
T7_15218_G08	GTGTGTGTTGTTGGGGTGTCGTTTTGGTGTTTGGTG
T7_15219_G08	GGGTGTGTTGGGTTTTTGTCGGTTGTGTTGTGGTTG
T7_15220_G08	TGTGTTGTTTGTGGGTGGTCTGTGTTGTTGGGGTGT
T7_15221_G08	GTTTGTGTGTGTGGTTGGTCTGTTGGTTGTTGGTGG
T7_15222_G08	TGTGTTTGGTGTGGTGGGTCTGTGGTGTTTGTGTGT
T7_15223_G08	TTGTGTGTGGTGTTGGGGTCTTGTTTGTGTGGGTGT
T7_15224_G08	TTGTGGTGTGGTGTTGTGTCTGTGTTTGGTGGTGGT
T7_15225_G08	GTTGGTGGTTTTGTGGTGTCGTTTTGGGGTTGTGGT
T7_15226_G08	TTGTGGTGTTGGGTGTTGTCGGTTGTGTTGTGGGTT
T7_15227_G08	TTGTGTGTTGTTGTGTGGTCGTTGGGTGTGTTGGGT
T7_15228_G08	GTGTGGTGTTGGTGGTGGTCTGTGTGTTTTTGTGTG
T7_15229_G08	TGGTGGTTTGTTTTTGTGTCGGGGTTTGGTGTGGTG
T7_15230_G08	GGTTTGTGTTGTTGTGTGTCGGTGTGGTGTGGTGTT
T7_15231_G08	TGTTGTTGGTGTTGTGGGTCTGGTGTGGTTGTTGTG
T7_15232_G08	GGGGTTGTGGTGGTGTTGTCGGTGTTGTTTTTTGGT
T7_15233_G08	TTGGTTGGTGTTGTGTTGTCGTGGGTGTGTGTGGTT
T7_15234_G08	GGGTTGTGTTTGTTGGGGTCTGGGTGTTTTTGGTGT
T7_15235_G08	TGGTGTGGTGTTTGTGTGTCTGTGTTGTGGTGTGTG
T7_15236_G08	TTTTGTTTGGTTTGTGTGTCGTGGTGGGGTGTGGTG
T7_15237_G08	GTTGGGGTGTTTTGGGTGTCTTTGGGGTTGTTTGGT
T7_15238_G08	GGTGTTGTTGGTGGTGTGTCTTGGTGTTTTGGTGGT
T7_15239_G08	TTTTGGTTTGTTGTGTGGTCTGGTGTGGGTGGTGGT
T7_15240_G08	TGTGTGGTGTTGGGTGTGTCTTGTTGGGTGTGTGTT
T7_15241_G08	GGTTTGTGGGGTGTGGTGTCTGTTTTGTGGGTGTTT
T7_15242_G08	GGGGTGTGTTGTTGTTGGTCTTGGGTGTTTGGTTTG
T7_15243_G08	TGTGTGTGTGGGTGTGTGTCGTGTTGTTGTGTTTGG
T7_15244_G08	GTTTGTGTGTGGGTGTGGTCGGTTTGTGTGTGTGTT
T7_15245_G08	TTGGTTTGTTGGTTGTGGTCGTGGGGTTGTTTGGGT
T7_15246_G08	GTGTGGTTGTGTGTTTGGTCGTTGGGTTGGTTGTTG
T7_15247_G08	GTTTTTGTGTGGGGTGTGTCTGTGTGGTGTTGTGTG
T7_15248_G08	GTTTGTGTGTGTTTTGTGTCGGTGTGGGTGTGTTGG
T7_15249_G08	TGTGTGTGTGTGGGTTTGTCGTGTTGGTGTGTTGGT
T7_15250_G08	GGGTTGTGTGGTTTGTGGTCTGTGTGTGTGGTTGTT
T7_15251_G08	TGGTGTGTTGGTGTTTGGTCTGTGTGTGGTGTGTGT
T7_15252_G08	GTGTGTTGTTTGGTTGTGTCGTTGTTGGGGTGTTGG
T7_15253_G08	GTGTTGGTGTTGTGTTTGTCTGGGGTGTGTGGTTGT
T7_15254_G08	GTGTTGGTGGGGTGTGTGTCTTGTTGTGTGTGTTTG
T7_15255_G08	GGGTTGGTTTGTTTTGTGTCGTGGGTGTGTGTGTGT
T7_15256_G08	GTGTGTGGTGTTTGGTGGTCGTTTGGTTTGTGTGTG
T7_15257_G08	GGGTTGGGTTGTGGGTTGTCGTGTGTGTTTGTTGTT
T7_15258_G08	TGTGTTGTTGGGTGGGTGTCGTGGTTTGTGGGTTTT
T7_15259_G08	GTGGTGTGTTGTGTTGGGTCTGTGGTGGTTTTGTTG
T7_15260_G08	GTTTTGGTGTGGTTTTTGTCGGTGTTGGGGTTTGGG
T7_15261_G08	TGTTTGTGGGTTTGTTGGTCGTGTGGGGTTGTGTTG
T7_15262_G08	TGTGGTTGTTGTTGTGGGTCGTTGTGGTGGTGTGTT
T7_15263_G08	GTTTTTGGGTGTTTGTGGTCTTTGTGGGTGGGTGTG
T7_15264_G08	GGTGTGTGTTGTGTGGTGTCGTTGTGGTTGTGTTTG
T7_15265_G08	GGTTTGGTGTTGTGTTGGTCGTGTTGTGTTGTTGGG
T7_15266_G08	TGTGTTGGTGTGGTGTTGTCGGGTGGTTGGTGTTTT
T7_15267_G08	GTGTGGTGTGTTGTTTTGTCTGGGTTGTTGTGGGTG
T7_15268_G08	TTTTTGTGTTTGTGTGTGTCTGTGGTGGGTGGGTGG
T7_15269_G08	GGGGTGGTTGTTGTGGTGTCGTGTGGTGTTTTTGTT
T7_15270_G08	TGTGGGTGTTGTGGGTGGTCGTGTGTGTTTGTGTTT
T7_15271_G08	TTTGGTGTGGGTGTGTTGTCGGTTGTGGGGTTTTGT
T7_15272_G08	GTGTGGTGTGTTTTGGTGTCGGGGTGTTTGTTTGGT
T7_15273_G08	TGTGTGGGTTTGGTGTGGTCGTTTGGTGTTGTGTGT
T7_15274_G08	GTGTGGGTGTTTGTGTGGTCTTTGTTGGTGTGTGTG
T7_15275_G08	TTGTGGTGGTTTTTGTTGTCGTGGTGTGTGTGGGTG
T7_15276_G08	TTTGTGTGTGTGTTTGGGTCGGTGGGTGTGTGTGTT
T7_15277_G08	GTGGTGTTGTGTGTGGTGTCTGTTTTGTTGGGTGTG
T7_15278_G08	GTTTGGTTTGTGTGGTGGTCTTGTGTGTGTGGTGGT
T7_15279_G08	GTGGTGGGGTTGTGGTGGTCTGTTGTTGTTTGTGTT
T7_15280_G08	GGTGTTGGGTTTGTGGTGTCTTGGTGGTTGTGTGTT
T7_15281_G08	TGTGGTGTGGTGGGTGTGTCGGTTTTGGTTGTGTTT
T7_15282_G08	GTGTTGTGGGGTTGGGTGTCGTTTTTGTTGTGTTGG
T7_15283_G08	GTGTTGTGTTGGTGTGTGTCTGTGGTTTGGTGGTTG
T7_15284_G08	TGTTTGTTGGGTGGTGTGTCGGGTGGTTGTTTGTGT
T7_15285_G08	TGGGTTGTGTGGTGGTGGTCTGTTTTGGGTTGTTGT
T7_15286_G08	GGGTGTTTGTGTGTTGTGTCGTTGGGGTGTTGTTGT
T7_15287_G08	GTTTGTTGGTGTTGTGTGTCGTGTTGGGTTGGTGTG
T7_15288_G08	TTTGTGTTGGGTGGTGTGTCTGGGTGTGTTGGTTGT
T7_15289_G08	GTGTTGTGTTTGGGTGGGTCGTTGTGTTTGTGGTTG
T7_15290_G08	GTTGTGGTGTTTTGTGTGTCGTTGTTGGTGTGGTGG
T7_15291_G08	GTTTTTTTGTGGGTGGGGTCGTTGGTGTGTTGTTGG
T7_15292_G08	TGGGTTTTTGGTGTGGTGTCGTGTGTTGGTTTGTGG
T7_15293_G08	TGTGGTTGTGTGTGGTGGTCTGTTGTGGTTGTGTGT
T7_15294_G08	GGGTTTTTTTGTTGTGGGTCGTTGTGTGTGGTGTGG
T7_15295_G08	GTGTTTGTTTTGTGGTGGTCGGTGTTGTGGTGGTGT
T7_15296_G08	GTGTGTGTGTGGGTGTTGTCGTTGTGTTTGTGGGTT
T7_15297_G08	GTGGGTTTTTTTGTGGGGTCTTGTGTGTTGGGGTGT
T7_15298_G08	GGTTGTGGGGTGTGTGTGTCGTGTGTGTTTGTTGTT
T7_15299_G08	TGTTGGGTTTTGGTTGTGTCGGTGTGTTGGGTTGTG
T7_15300_G08	GTGTTGTGTGTGGGTTTGTCGTGTGTGTTGGGGTTT
T7_15301_G08	GGGGTGGTTTTGTTGGTGTCTGTTGTTGTTGTGGTG
T7_15302_G08	TGTGTTGTGGTTTGTGGGTCGGTGGTTGTGGTTTGT
T7_15303_G08	TGTGTTGTGTTGTGTGTGTCGTGTGTGTGTGGTTGG
T7_15304_G08	TGTGGTGTGTGTTGTGTGTCGGTTGGTGTTGTGGTT
T7_15305_G08	TGTGTGTTTGGTTGTGGGTCGTTGTTGGGTGTGGTT
T7_15306_G08	TGGGTGGTGGTTTGGGTGTCGTTTTTGTGGTTTGGT
T7_15307_G08	GTTGGTTGTTTGTTGGGGTCGTTTGTGGGGTGTTGT
T7_15308_G08	GTTGTGTTGTTGGGTTGGTCTGTGTGTGTGGGTGTT
T7_15309_G08	GTGTGGTTGGTGGTTGGGTCTTGTTGTGGTGTTGTT
T7_15310_G08	GGGTTTTTTTGGTGGGTGTCGGGGTTGTTGGTTGTT
T7_15311_G08	GTGGTTTGTGGTTTGGTGTCTTGGGTGGTGTTGTTG
T7_15312_G08	GTTTGTGGTGTTTGTGTGTCTGTTGTGTGTGGGTGG
T7_15313_G08	GGTTGTGGGGTGTGTGTGTCGTGTGTTGTGTGTTTT
T7_15314_G08	GGTTTTGTGGGTTTTGTGTCGTGTGTTGTGTGGTGG
T7_15315_G08	TGTGGTGTTGTGTTGGTGTCGGTGTTGTGTTGGTTG
T7_15316_G08	GTTGTTGTGTGTGTGGGGTCGTGTGGTTGTGTGTTT
T7_15317_G08	GGTTGGGGTGTGGTTTGGTCGTGGTTTGTTGGTTTT
T7_15318_G08	TGTTGGTGTGGTGTGTGGTCTTTGGTGTGTGTGTTG
T7_15319_G08	GTTTGTGGGTGTTGGTTGTCGTTTGTGGTTGTGGGT
T7_15320_G08	TTTTGGTGGTGTTTTGGGTCGTGTTTGTGGTGTGGG
T7_15321_G08	GGTGTGGTTGGTGTTGTGTCTGTTTTTTGGGTGGTG
T7_15322_G08	GTTGTTTTGGTGGTTGGGTCTGTTTTGGGGTTGTGG
T7_15323_G08	TGGTGTGTTTTTGTGGTGTCGTGGTGGGTGTTGTTG
T7_15324_G08	TGGGTGGGTTTTGTGTTGTCGGTGTTTGGGTGTGTT
T7_15325_G08	GGTTTGTGTGTTGGTGTGTCGTTTTGGTGGTGGTGT
T7_15326_G08	TGTTTGTGTGGTGTTTTGTCTGTGGGGTGTGTGGTG
T7_15327_G08	TTTGTGTGTGTGTGGTGGTCTGGGTTGTTTGGGTGT
T7_15328_G08	GGTTGTGTTGTTGTTGTGTCTGGTTGGTGTGTGGTG
T7_15329_G08	TGTTGTGGGGTGTTGGTGTCTTGTGTGTGTTGTTGG
T7_15330_G08	GTTTGTTGTGTGGGTTTGTCTGGGTGTGTGGTGTGT
T7_15331_G08	TTGGTTTTGTGTGTGTGGTCTGTGGTTGTGGGTGGT
T7_15332_G08	TGGTGTGTGTTTGTGGGGTCTGGTTGTTGTGTGTGT
T7_15333_G08	GTTTGGGTTGGGTTTGTGTCGTGGTGTTGTGTGGTT
T7_15334_G08	TGGGTTGTGTTTGGTTGGTCGTTGGTGTGGTTGGTT
T7_15335_G08	GGTTGTGTGTGGGTTTGGTCGTTTGTGTGGGTTGTT
T7_15336_G08	TGTGGTTGGTGTTGTGGGTCTTTGGTGGGGTTGTTT
T7_15337_G08	GTTGTTTTGTGTGTTGTGTCGTGGTGGGGTTGGTGT
T7_15338_G08	GGTTTGTGGGTTGTGGTGTCTGTGTTTTGTGTGGTG
T7_15339_G08	GGTGTTTGGTGTTGGTTGTCTGGTTGTGGTGTGTGT
T7_15340_G08	GTGTGTTTGTTTGGTGTGTCGGGTTGGTGTGGTTGT
T7_15341_G08	GTTGGGTTTGGGGTTGTGTCGTTTTGGTGTGTTGTG
T7_15342_G08	GTGTTTTGGTTGTGGTTGTCGGTGGGTTGTTGGTGT
T7_15343_G08	GTTGTGGGTTTGTGTGGGTCTGTGTTTGTGGTGGTT
T7_15344_G08	GTTGTGTTTGTGTTGTGGTCTGTGTGTGTGGGTTGG
T7_15345_G08	TTTGGTGGTGTGTGTTGGTCTGGTTTGTTGTGTGGG
T7_15346_G08	GTTGTTTTGGTGGGGTTGTCGGTTGGTTTGTGTGGT
T7_15347_G08	GGTGTTGGTTGTTGGTTGTCTTGTGGTGTTGGTGTG
T7_15348_G08	TGGTTGGGTGTGTGTTTGTCGGGTGTTTGTTGGTGT
T7_15349_G08	TTTGGTTTGTGTTGGTGGTCTGTTGTGTGGGTGGTG
T7_15350_G08	GGTGTTGGTTGTGTTGTGTCTGTGTTGTGGTGTGTG
T7_15351_G08	TTGGGGTGTGGTTGGTGGTCTTTGGTGTGTGTTTGT
T7_15352_G08	GTGTTTGGTGTTGTGTGGTCTGTGGTGTTTGTGGTG
T7_15353_G08	TGTGTGTGGGTTGTGGTGTCTGTTTGTGTTGGGTTG
T7_15354_G08	GGGTTTGTGGTGTGTGGGTCGTGGTTGTGTTTTGTT
T7_15355_G08	GTGGGTTTGTGTGTGTGGTCTTGTTGTGGTGTGTTG
T7_15356_G08	TGTTGGGGTGTGTTTGTGTCGTTGTGGTGGGGTTTT
T7_15357_G08	GTGGGTTGGTGTTGTTGGTCTGTGTGTGTGTTTGGT
T7_15358_G08	TGTTGTTGTGGTGTGTGGTCTGTGGGTGGTTTTGTG
T7_15359_G08	TGTGTGGTTGTGTGGTTGTCGGTGTTTGGTGTTGGT
T7_15360_G08	TGGGGTGGTGTGTGTGTGTCGTTGGGGTTTTTTTTG
T7_15361_G08	GTTTGGTGTTGTGTGTGGTCTGTGTGGTTGTGGTGT
T7_15362_G08	GTTGTTGGTGTTTGTTTGTCTGGGTGGGTTGGTGGT
T7_15363_G08	TGTTGTTGGGTTGGGTTGTCGTGTTTGTTTGGGGTG
T7_15364_G08	GGTGTGTGTTGGTGTGTGTCGTGTTGTGTGTTGTGT
T7_15365_G08	TGTTGTGTGTGGTGGTGGTCTTGGTTGTTTGGTGTG
T7_15366_G08	GGGTGTTGGTTGTTTTTGTCTGGTGGTTTTGGGGTG
T7_15367_G08	GTGTGTTGTGGTGTGTTGTCGTTTGTGGGTGGTGTT
T7_15368_G08	GGGTTGGTTGGTGGTTGGTCTGTTGTTGGTGTGTTT
T7_15369_G08	TGTGTTGTGTGGTGTTGGTCGTGTGTTGTGTGGTTG
T7_15370_G08	GGTTTGGGTTGTGTTGTGTCTTGTGTTGGGTTTGGG
T7_15371_G08	TGGTTGGTGTGTGTTGTGTCGTTTGGTTGGGTTGTG
T7_15372_G08	TTGTTTGTGTGTGTGGTGTCGTGTGTGTTGGGTTGG
T7_15373_G08	GTGTTGTGTTGGTGGTTGTCGTGTGTGTGTGTTGTG
T7_15374_G08	TGTTGTTGGTTGTGGGTGTCGTGTGTTGTGGTGTGT
T7_15375_G08	GTTTTGTTGGTTTGGGTGTCGGGTGGTTGGGTGTTT
T7_15376_G08	TTTGTTGTGGTGGGTTGGTCTGTGTTGTGTGTGGTG
T7_15377_G08	TGGTGGTTGTTGTGTTGGTCTTTGGGGTGGGTTGTT
T7_15378_G08	TGGTTGGGTGTTGTTTTGTCTTGTGTGGGTGGTTGG
T7_15379_G08	TTGTGGTGTTGTTGGGTGTCGTGTGGTTGTGGTTGT
T7_15380_G08	GTGTGTGTGTTTGGTTTGTCGGTGTGTGGTGTTGGT
T7_15381_G08	GGGTTGTGTTGGTTGGTGTCTTTTGGTGTGGTGGTT
T7_15382_G08	GTGGTGTTGTGTGTGTGGTCTGGTGTGTGTTTTTGG
T7_15383_G08	GTTGTGTGTGTTGTGTGGTCGTGGGTGTTGTGGTTT
T7_15384_G08	TTGTGTGTGGTGGTTGGGTCTTGTTGGTGGGTTGTT
T7_15385_G08	TGTGGGTTTGTTGGTTGGTCGGGTGGGTGTTTTGTT
T7_15386_G08	TGGTTGTTGTGTGGTGTGTCTGTGTGTTGTGTGTGG
T7_15387_G08	TGTTGGGTGGTTTGTGGGTCTGTGTTTTGTTGGGTG
T7_15388_G08	TTTGGTGTGTTGGTGGGGTCTTGGTTGTGGTTGTGT
T7_15389_G08	TGTGGGTTGGGGTGTGTGTCGTTGTTTTTGTGGTTG
T7_15390_G08	TGTGGGTGTGTTTGTGGGTCTTTTGTGGTGTTGTGG
T7_15391_G08	TGTGTGTGTGGGTGTGGGTCTGTTTTGGTTGTGTTG
T7_15392_G08	GTGTGGTTGGTTGGTGGGTCTTTGGGTTTGTTGGTT
T7_15393_G08	TTGTGTTGTTGGGTGGTGTCTTGGTGGTTGGTGTGT
T7_15394_G08	TTGTGGTTGTGGTGTTGGTCTTGGGGTTGTGGTGTT
T7_15395_G08	TGTTTGTGTTGTTTGGTGTCGGTTGGTGGTGTTGGG
T7_15396_G08	TGGGGTTTTGTTGTTGTGTCGGTTGGTGTGTTTGGG
T7_15397_G08	TGTGTTGTTTGTGGTTGGTCTGGTGTTGGGTGTGTG
T7_15398_G08	GTGGTGTTTGTGTGGTGGTCGGTGTGGGTGTTTTTT
T7_15399_G08	TGGGTGGGGTGTGTGTTGTCGTGTGTTGTTTGTGTT
T7_15400_G08	TTTGGTGGGTGTTGGGTGTCGTTGGTTTTTGTGGTG
T7_15401_G08	TTGGTGGGGTTGTGTGTGTCTGTTGGTGTGTTGTTG
T7_15402_G08	GGTGTGTGTTGTGGTGTGTCTTGTTGTGGTTGTGTG
T7_15403_G08	GGGTGGTTTGTTTGTGTGTCTTGTTGTGTGGGTGTG
T7_15404_G08	TGTTTGTGGTGGTTGTGGTCTGGTTGTGTGGTGGTT
T7_15405_G08	TGTTGGTGGGTTTGGTGGTCGTTGTTGGTTTGGTGT
T7_15406_G08	GGTGTTGTGTGTTGTTGGTCTGGTGTTGTTGTGGTG
T7_15407_G08	TTTGTGTGGGGTGTTGTGTCGGGTTTTGGGTGTTTG
T7_15408_G08	GTGGGTGGTGTTTGGTGGTCTGTGGTTGTGTTTTTG
T7_15409_G08	TTTGTGTGTGTGTTTGGGTCGTGTTGGGTGTGTGTG
T7_15410_G08	GTTGTGGTGTGTGGGGTGTCTGGTTGTGGTTTGTTT
T7_15411_G08	TGGTTGTTGGTGGTGGTGTCTTGTTTTTGGTGTGGG
T7_15412_G08	TGTTGGTGTGTGGTGTGGTCGGTGTGTGTGTTTTGT
T7_15413_G08	TTGTGTGTGTTGTGTGGGTCTTGTTGGTTGTGGGGT
T7_15414_G08	GGGTGTGGTTTTGTTGGGTCGTGTTGTTGTTGGTGT
T7_15415_G08	TGTGTTTTGGTTGTTGTGTCGGGTGTGGTGGTTGGT
T7_15416_G08	GTGTGGTGGTTTTGTGTGTCGTTGTGTGTGTGGTGT
T7_15417_G08	TGTTGTGGTGTGTTGTGGTCTGTGTGTGTTTGGTGG
T7_15418_G08	TGTGTTGTGTTGGTGGTGTCTTGGTTTGTGTGTGGG
T7_15419_G08	TGTTGTTTTTGGGTGGTGTCGTGTGTGTTGGTGGTG
T7_15420_G08	GTGTGGTGTGTGTGTGTGTCTGTGTGTGGGTTTTGT
T7_15421_G08	TGGTGTGTTGTGGTTGGGTCGGTTTTTGTGTGTTGG
T7_15422_G08	GTTGTGGTGGTTTGTGTGTCGTGTTTGGTGGTTGTG
T7_15423_G08	GTTGTTGTTGGGTGTTGGTCTGTGGTGTGTTGGTGT
T7_15424_G08	TTTTTGGTTGGGGTGTTGTCGGGGTGGTGTGTGTTT
T7_15425_G08	TGTGTGTTTGTTGGGTGGTCGGGTGTTGGTGTTTGT
T7_15426_G08	TTGGTTGTGGTGTGGTTGTCTGGTTGTTGTGGGGTT
T7_15427_G08	GGTGTGTGTGGTTGGTTGTCTGGTTTGTTGTGGTGT
T7_15428_G08	GGTTTTGTGGTTGGGTGGTCTTGTGGTTGTGTGTGT
T7_15429_G08	TGTGTGTTTGTTGTGGGGTCTGTTGTTGGGTGGTTG
T7_15430_G08	TGTGTGGTGTTGGTGTTGTCGGTGTGTGTGGTGTTT
T7_15431_G08	GTGGTGTTTGTGTGGTGGTCTTGTGTTTGGGTTGGT
T7_15432_G08	GTGGGGTTGGTTGTTTTGTCTGGTTGTTTGGTGGTG
T7_15433_G08	TGTTGGTTGGTGTGTTGGTCTGGTGGTTTGGTTGGT
T7_15434_G08	TTGTTTGGTGGTTTGTTGTCTGTTGTGGTGGGTGGG
T7_15435_G08	GTGTGGGTTGTTGTTTTGTCGTGGGTTTGTGTGTGG
T7_15436_G08	TGTTGGTGTTGGGTGGGGTCGTGTGTGTTTGTTGTT
T7_15437_G08	TTTGTGGTGGTTGTGGGGTCTTGTGTGTTGTTGTGG
T7_15438_G08	GGTGTTGGGGTTGGTGGGTCTTGTGGTTTGTTTTTG
T7_15439_G08	TGTTTGTGGGGTGGTTGGTCTGTGGTGTGTTGTGTT
T7_15440_G08	TGGTGTGTGGTGTTGGTGTCGTGTGTTGTGGTTTGT
T7_15441_G08	TTTGGTTTGGTGGGTTTGTCTGTGGTGTGGTGTTGG
T7_15442_G08	TGTGTTGTGGGTTGTTTGTCGTTGTGTGGTGGTGGT
T7_15443_G08	GGGTGTGTGTGTTGGTGGTCTTGTTTTTGGGTGGTT
T7_15444_G08	TGTGGTTGGTTGGTGTTGTCGTTGGTTGTTGGGTGT
T7_15445_G08	TTTTGTGGGTTGTGGTTGTCGGTTGGTTTGGTGTGG
T7_15446_G08	GGTTTGTGGTGTTTGTGGTCTGTGTTTGGGGTGGTT
T7_15447_G08	TTTTGTGTGGTGTTGGGGTCTGTGTGTGTGGGTTGT
T7_15448_G08	GGTTTGGGTTTTGTGTTGTCGTGGTGTGGTGTGTGT
T7_15449_G08	TGTGTTGTGTGGTGTGTGTCGTGGTGTTGTTGGTGT
T7_15450_G08	TGTTTGTGTGTTGGTTTGTCGTGGGTGGTTTGGGTG
T7_15451_G08	GGGTTGTGTGTGTGGTTGTCGTGTGTTGTGGTTTGT
T7_15452_G08	GGGTTGTGTGTGTTTGGGTCTTGTGTGTGGTGTGTT
T7_15453_G08	GTGGTTTTGTTGGTGTGGTCTGTGTTGTGGTGTGGT
T7_15454_G08	TGGTGTTGGTGGTTGTTGTCTGTGGGTGGTTTGTGT
T7_15455_G08	GTTGTGTGTTGGTTGGTGTCGTGGTTTTTGGTTGGG
T7_15456_G08	GGTGTTGTGTGTTGTTGGTCGTTGGTGTTTGTGGTG
T7_15457_G08	TTGTTTGGTTGGGTGGTGTCTTGGTTGTGGTGTGGT
T7_15458_G08	GTGGTTGGTTGGTTGTGGTCGTTGGTTGTTGTGTTG
T7_15459_G08	TGGTGTGTGTTTTGTTGGTCGTGGGGTGTTGGTGTT
T7_15460_G08	GTTGGTGTGTGTGTTGTGTCTTTGTGTGGGGTTTGG
T7_15461_G08	GTGTTTTTGGGGTGGTTGTCGGTTGGTTTTGGTGGT
T7_15462_G08	GTGGGTGTTTGGTGTGGGTCTTTTTTGGTGGTTGGT
T7_15463_G08	GGTTTTTTGTTGTGGTGGTCTGGTGGTTGTGGTGTG
T7_15464_G08	TGGGTTGTGTGTTGTGGGTCGTTGGGTTGTTTGTGT
T7_15465_G08	TGTTTGTGTTGTGTTTGGTCTGTGTGGTGGTGGGTG
T7_15466_G08	GTGTGTGTGTGTGGTTTGTCGTGTGTGTGTTGTGGT
T7_15467_G08	GTTGGTTGTGTGTGTTGGTCGTGTGGTGTTTGTGTG
T7_15468_G08	TTTTGTGGGGTGTGTGTGTCTGTGGTTTGTGGGTTG
T7_15469_G08	TGTGTGTTGTGGGTGTGGTCGGGTGTGTTTTGTGTT
T7_15470_G08	TTTGGGGTGGGTTTTGGGTCTGTTTGTGTGTGTGTG
T7_15471_G08	GGGTTGTTGTTTGTTGTGTCGTGGGTTTGGGGTTGT
T7_15472_G08	TTGGTGTTGGGGTGTGTGTCGTGTTGTTGTGTGGTT
T7_15473_G08	TTGGTGGTTTGGTGGTGGTCTTGGGGTTTTGTGTGT
T7_15474_G08	TGGGTGTTGGGTTGTTGGTCGTGTTGTTTGTGGTTG
T7_15475_G08	TTTGTTGTGTTGGTGGTGTCGTTGTGGGTTGTGGGT
T7_15476_G08	TTGTGTGTGGTTGGGTTGTCGGTGTTGTTGGTGGTT
T7_15477_G08	TTTGGGTGGTTTTGTGGGTCTTGGGTGTGTTGGTTG
T7_15478_G08	GGTGTTGTGTGTGGGTTGTCGTTGTTTGGGTTTGGT
T7_15479_G08	GTGTGGTGGTGGTTGGTGTCTGGTTGTTGTGTGTTT
T7_15480_G08	GTGGTTGTGTTGGTGGTGTCTTGGTTGGTGGTTGTT
T7_15481_G08	TTTGTGGGTGTGTGTTGGTCGGTGTGTGTTGTGGTT
T7_15482_G08	TGTGTGTGTTGTTTGTGGTCTTGGGGTGGTGTGGTT
T7_15483_G08	GGTTGTGGGTGTTGTGTGTCGTTGTGGTTTGTGTGT
T7_15484_G08	TGTTTGTGGTGGGGTGTGTCGTTTTGTGGTTGTTGG
T7_15485_G08	GTGTGTTTTGGGTGTTTGTCTTGTGGTGGTTGGTGG
T7_15486_G08	GTGTTTTTGGGTTGGTTGTCTGGGGTGTTGTGTGGT
T7_15487_G08	GTTGTGTGGTGTGTGTGGTCTGTTGGTGTTTGGGTT
T7_15488_G08	GTGTGTGTGGTGGTGTGGTCTTGTGGTGTTGTTTGT
T7_15489_G08	TGTTGTTGGGTGTTGGTGTCGTGGGTGTTTGTTGTG
T7_15490_G08	TGGTTGTGGTTTGTGTGGTCGTTGGGGTGTGTGTTT
T7_15491_G08	GTTGTGTGTTGTGTTGTGTCGGGTGGTTTGGTGTGT
T7_15492_G08	GTGTGTGGTGGTGTGTGGTCGGTTGTTTTTGTTGTG
T7_15493_G08	GGTTTTTGTTTGTGGTGGTCTGTGGTGTGTTGTGGG
T7_15494_G08	TGGGGTTGTGTTGGTGTGTCTTTGGGTGTGTTGTGT
T7_15495_G08	TGGGTTTGGGTGTTTGTGTCGGGTGTTTTGTGTGGT
T7_15496_G08	TGTGGTGTGTGGTTGTGGTCTGGTTGTGTGGTGTTT
T7_15497_G08	GTGTTGTTGTTTGGGTTGTCGGTTGTGTGTGTGTGG
T7_15498_G08	GTTGGGTGTGTTTTTGGGTCTTGGTTTGTGGTGGTG
T7_15499_G08	TTGTGTTGTGTGGTGTTGTCGGGGTGTGTTGTTTGG
T7_15500_G08	GTGTGTGGTGTTGTTGTGTCTGTGTGTGTGGGTGTT
T7_15501_G08	GGTTGTTGTGGGGTTGGGTCTGGTGTTTTGTGTTTG
T7_15502_G08	GGGTTGTGTGTTTGTGGGTCGTTGTTTGTTGTGGGT
T7_15503_G08	TTTGTGGTGTGTGTGTGGTCTGTGGTTGTGTGTGGT
T7_15504_G08	TGTTTGTGTTGGTTGGTGTCGTGTGTTGGTGGTGTG
T7_15505_G08	TGTGGTGTTGTTGTGGGGTCGTTTGTTTTGGTGTGG
T7_15506_G08	TGTGTGGTTGTGTGGGTGTCTTTGTTGTGTGGTGTG
T7_15507_G08	GGTGTGTGGTGGTGTGGGTCTTGTGTGTTGTTTTGT
T7_15508_G08	GTGTGGGTTGTTGGTGTGTCGTTTGTTGGTTTGTGG
T7_15509_G08	GTGGTGGGGTGTTGTGTGTCGTGTGGTGTTGTTTTT
T7_15510_G08	TTGGTGGGGTGTTGGTTGTCGTTTGTGGTGTGTTTG
T7_15511_G08	TTTGTGGTGTGTGTTGGGTCTGGTGTGTGGGTTGTT
T7_15512_G08	TGTGTGTGGTGTGGTGGGTCGGTTTGTGTTTTTGGT
T7_15513_G08	TGTGTGGGTTTTTGGGTGTCTGGTGGTGTGTTTGTG
T7_15514_G08	GTTGTGTTGTGTTGTGGGTCTGTTGTGTGTTGGTGG
T7_15515_G08	TGTGTGTTGTGGTTGTTGTCTTTGTGTGTGGGTGGG
T7_15516_G08	GTGTGTGGTGGGGTGTTGTCGTGTTTTGTTGGTTGT
T7_15517_G08	GTGTTGTGGTTTGTGGTGTCGGGTTGGTTTGTGTGT
T7_15518_G08	GTTGTGTGTGTTGGGGTGTCTGTGGTGTGTTGGTTT
T7_15519_G08	GTTGTGTGTTTGTGGTTGTCGGTGTTGGTGTTGGTG
T7_15520_G08	GTTGTGTGTTGTGTTGTGTCGGTGTGTTGTGTGGTG
T7_15521_G08	GTGTGGGTGGTGTTGGTGTCGTGTTTGTTTGTTGTG
T7_15522_G08	GTGGTTGGTTGTGGTTTGTCTGTTTGGTGTGTGGGT
T7_15523_G08	GTGTGGGTGTGGTGTGTGTCTTGTTGTGGTGTTTTG
T7_15524_G08	GTGGTGTTTGTGTGTTGGTCTGTGTGGTGTGTTGTG
T7_15525_G08	TTGTGTGTGTTGTGTGTGTCTGGTGGGTGTTGGGTT
T7_15526_G08	TGTGTTGTTGTGTGTGGGTCTTTGTGGTGGTGTGTG
T7_15527_G08	TGTTTGTGTTTGGGGTGGTCGTGTGTTGTTGTGGGT
T7_15528_G08	TGTGTTGTGTGGTGGTTGTCGGTGGTGTGTTGTTGT
T7_15529_G08	GTTTGTGTGTGTGTGGTGTCGGTTGGTTTTGGGTTG
T7_15530_G08	GGTTGGGTGTGGGTGTTGTCTTTGTGTTTGTGGTGT
T7_15531_G08	GGTTGGGTTGTGGTGGTGTCGTTGTGTTTGTGTGTT
T7_15532_G08	GTGTTTTGTGGTTGTGTGTCGGGTTGGTGTGTTGTG
T7_15533_G08	TTGTGTGGGGTGTTGTGGTCTTTGTGTGTTGGGTGT
T7_15534_G08	GTGTGTGGTTTTGTTGGGTCTTGTTGTGTGGTTGGG
T7_15535_G08	GTGTGTTGGTGTTTGTTGTCTGTGTGTGGTGTGTGG
T7_15536_G08	TGTGGTGGTTTGGTTGGGTCTTGTTGTGGTTGGTTG
T7_15537_G08	GGTTTTGTGTGTTGTGTGTCGTGTGTGTGGTTGTGG
T7_15538_G08	TGGGTTGTGGTGTTTTTGTCGTTGGTGTGGTGTGTG
T7_15539_G08	GTGGGTGTGTTGTTGGGGTCTTGTGTTGTGTTGGTT
T7_15540_G08	TGGGTGTGGGGTGGTGTGTCTTTTTGGTTTTGGTGT
T7_15541_G08	TTGTTGGGTTTTGGTGTGTCGTGTGGTTGGTTGTGG
T7_15542_G08	GGTGTGGGTTGTGTGTTGTCTGTTGTTGTGTGGTTG
T7_15543_G08	GTGTGTGTGGTTGGGTGGTCGTGGTTTTGTGTGTTT
T7_15544_G08	GTGGTGTGTTGGTTGGGGTCTTGTGTTGTGTTGTGT
T7_15545_G08	TGTTTGGGTGGTTTTTGGTCTGGTGTGGGGTTGTGT
T7_15546_G08	GGGTGTGGTGTTGTTGGGTCTGTGTTTGTTGTGTGT
T7_15547_G08	TGTGGGTTTGTTTTTGGGTCGTGTGGTTGTGGGTTG
T7_15548_G08	TGGGGTTTGGTTGGTGTGTCTGTTGTGTTGGGTTGT
T7_15549_G08	GGGTGGGTTTGTGTTTGGTCTTTTTGTGGGTGGGTT
T7_15550_G08	GGTGTTTGGTGTGTGTTGTCTTGTGTGGTTTGGGGT
T7_15551_G08	TTGTGTGTGTGTGTTTTGTCTGTGTGTGGGTGGTGG
T7_15552_G08	GTGTTGTGGGGTGTGTGGTCGGTGTTTTGGTGTTTT
T7_15553_G08	GGGTGGTGGTGTTTGTGGTCTTGTGTTGTGTTTGTG
T7_15554_G08	TGTTGGGTGGTGTTTGTGTCTGGTGGTTTGGTTTGG
T7_15555_G08	GTGTGGTGGTGTTGTGGGTCTTGTGTTTGGTGTTGT
T7_15556_G08	TTGTTGGTTGTTGGTGGGTCGTTTGTGTTGGGGTGT
T7_15557_G08	TGGTTTGTTTGTGGTTTGTCGTTGGTGTTGGGTGGG
T7_15558_G08	GGTTTTGTGTTTGGGTTGTCTGTGGTGGTGTGTGGT
T7_15559_G08	GTGTGGTGTGTTTGTGTGTCGTGTTGTTGTGGGTTG
T7_15560_G08	TGTGTGGTGGTTGTTTTGTCTGTTGGTGGTTGTGGG
T7_15561_G08	GGTTTGGGTGTTGGTGTGTCTGTGGTTGGTGTTTGT
T7_15562_G08	TGGTTGTTGGTGTTGGTGTCGGTTGGTTGGTGTGTT
T7_15563_G08	GTTGGTGGGTGTTTGGTGTCTGTTTTGTGTGGGGTT
T7_15564_G08	TGTTGTTGGGTTGGTGTGTCGTGTGGGTTTGTGGTT
T7_15565_G08	TGTGGTTGTGGGTGTGTGTCGTGTTGTGGTTGGTTT
T7_15566_G08	TGTTGTTTGTGTTTTTGGTCGGTGTGGGTGTGGGTG
T7_15567_G08	GTGTGGTGTGTGGTGTTGTCGTGTGTGTGTTGGTTT
T7_15568_G08	GTGTTTGGTGTGTGTTGGTCGTTGTTGGTTGGTGGT
T7_15569_G08	GTGTGTGTTTTGGTGTGGTCGGGTTGGTTGTGTTGT
T7_15570_G08	GGTGGTGTGTTTTTGTGGTCTTGTTTGGTGTGGGGT
T7_15571_G08	TGGGTTGTTGTGTGGGTGTCTTGGTGTGTGTGTGTT
T7_15572_G08	GTTGGTTGTGGTGTGTGGTCGTGTTGTGTTTGGTTG
T7_15573_G08	GTTGTGTGGGTTGGTTTGTCTTGTGTGGTTGGTGTG
T7_15574_G08	TGGGTGTTGGTTGTGGTGTCTTGTGTGTTGTTGGGT
T7_15575_G08	TGTGTGGTGTGGTGTGGGTCTGTTGTTTTGGTGTTG
T7_15576_G08	TTTTGTGTTGGTGGTGTGTCGTGTTGTGGGTGTTGG
T7_15577_G08	GGGTTTGTTTGTGTGGTGTCTGTGTTGTGTGGTGTG
T7_15578_G08	TTGTGTTGGTGTTGGTTGTCGGGTGTGTGTGTGGTT
T7_15579_G08	TGGTTGGGGTGGTGGTGGTCGTTTTGTTGTGTTGTT
T7_15580_G08	GTTGGTTTTGGTGTGGTGTCTGTGTTGGTGTGTGTG
T7_15581_G08	TGTGTTGGGGTTGTGTGGTCTTGTGGTGGTTGTTGT
T7_15582_G08	TGTGGTTTTTGTGGGTGGTCTGTGGTGGTTGTTGTG
T7_15583_G08	GTTGTGGTGTGTGTGGTGTCTGTGTGTGTGTGTTGT
T7_15584_G08	GGGGTGTTGTTTGTTGGGTCTTTGTTGGTGTGTGTG
T7_15585_G08	GTGTTTTGTGTTGGTGTGTCGTGGGTGTGTTGTTGG
T7_15586_G08	TGTTTGTGGGGTGGTGTGTCGGTGTGTTTGTTTGTG
T7_15587_G08	GTGTGGTTGTTTGTGTGGTCTGGGTTTTGTTGTGGG
T7_15588_G08	TGTTGGTGGGGTTTGTGGTCTGGGTTTTGTGTTGTG
T7_15589_G08	GTGTTTGGTTGGGTGTTGTCGGTTTGTGTGGTGTGT
T7_15590_G08	GTGTTGGTGTTGTGTTGGTCTGTGGGTGTTTGTGGT
T7_15591_G08	TGGTGGTTGGGTGTGTGGTCTGTTGTGTTTGTGTTG
T7_15592_G08	TGTGTGGTGTGTTGGTGGTCGTGTTGTGTGTGGTTT
T7_15593_G08	TTGTGTGGGTTGGTGTTGTCTGGTTGTTTGGTGGGT
T7_15594_G08	TGTGTTGTTGTGTTTGGGTCGGTTGTTGGTGTTGGG
T7_15595_G08	TGTGGGTGTTGTTTGTTGTCGTTGGTGGTTGGGTTG
T7_15596_G08	TGGTTGTGGTGTTGGTGGTCTTTGTGTGTGGTGTGT
T7_15597_G08	TGGGGTTTGTGTTGTGTGTCTGTGTGTTGTGGTGTG
T7_15598_G08	TGTGGTTGTGGTGTGTGGTCTGTTTTGTGGTGTGTG
T7_15599_G08	GGTTTGTGTTTTGGTGGGTCGTGTGGGTGTTGTGTT
T7_15600_G08	GTGTGTTTTGTGTTGTGGTCGTGTGTGGGTTGGTTG
T7_15601_G08	TGTTGTGGGTGTGTGTTGTCGGTGGTTGTTGTGTGT
T7_15602_G08	TGTGTGTTGTGTTGTTGGTCTGGGTGGTGGTGTTTG
T7_15603_G08	TGGTGTGGTTGGTGTTGGTCGTTTTGTTGTGTTGGG
T7_15604_G08	TGTGGGTGGTTTGGTTTGTCTTGTGTGTGGGTGGTT
T7_15605_G08	TGTGTGTGTGTTTGGTGGTCTTGGTTGGTTGGGTGT
T7_15606_G08	GTGGGTTGTGTTGGTGTGTCGTGTGTGGGTTTTGTT
T7_15607_G08	TGTGTGTTGTTTGGTGGGTCTTGTGTGTGGTGTGGT
T7_15608_G08	GTTGGGGTGTGTGTGGGGTCGTTGTGTTTTTGTGTT
T7_15609_G08	TGTTTTGTGGGTGGGGTGTCGGTGTTGTGTTGGTTT
T7_15610_G08	TGTGGTGGTTTGGGGTTGTCGGTTTTGTTTGTGTGG
T7_15611_G08	GTTTGTTTGTGGGGTTGGTCGGTTGTTGTGTTTGGG
T7_15612_G08	TGGGTGGTGTTTGGTTTGTCTGTTGGGTTGTGGGTT
T7_15613_G08	GTTTGGTGTTTGGTGTGGTCTGTGGTGGTTGGTTTG
T7_15614_G08	TTGGTTGTGTTGTGGTGGTCTTGGGTGTTGGTTGGT
T7_15615_G08	TGGTTTGTTGGTTGTGGGTCTTGGTGGTGGTTTTGG
T7_15616_G08	TGGTTGTGTTTGTGGGTGTCGTGGGGTTTGGTTGTT
T7_15617_G08	GGTGGTTTTTTTGTTGGGTCGTTGTGGGTGTGTGGT
T7_15618_G08	GTGTGTGGTGGTTTGTGGTCGGTTTTTGTGTGGTTG
T7_15619_G08	TTGTGTGGTTTGGGGTGGTCTGTTTGGTGTGTGTGT
T7_15620_G08	GTGGTGGTGTTGTTTGGGTCTTTTTTGGTGGTGTGG
T7_15621_G08	TTTTTGGTGTGGTGGTGGTCGGTTTGTGGTGTGTGT
T7_15622_G08	TGTGTTGTGGTGTGGGTGTCTGTTGTTGGTGTTGTG
T7_15623_G08	GTGGGTGTGTGTTTGGTGTCTGTTGGGGTGTTTTGT
T7_15624_G08	GTTGGTTTGTTTGGTGTGTCTGTGGTTGTGGGTGTG
T7_15625_G08	TGTGGTGGTGGGTTTGTGTCTGGGTGTTGGTGTTTT
T7_15626_G08	GGGGTGTTGTGTGGTTGGTCTTGGGGTTGTTGTTTT
T7_15627_G08	GGTGTGTTGGGTGTTGGGTCGTGTTGGTTTTTGTGT
T7_15628_G08	GGTGTTTGTGTGTTGTGGTCGTTGGGTGTTGTGTTG
T7_15629_G08	GTTGTTGTTGGGGTTGGGTCGTGTTGTTGTGTTGTG
T7_15630_G08	GGGTGTGTTTGTTTTGGGTCGTTGTTGTTGGTGGTG
T7_15631_G08	GTGTGGGTTGTTGTGTTGTCGGGGTTGGTGTTTTTG
T7_15632_G08	GTTGTTGGGTTGGGTTTGTCGTTTTGGGTGTGTGTG
T7_15633_G08	GTTTTTGTGTGTGGTGGGTCTGTGTGGGTTGTTGGT
T7_15634_G08	GTTGGTGTTTGGTTTGGGTCGTTGGGTTGTGGTTTG
T7_15635_G08	GGTTGTTGTGGTTGTGGGTCGTGTGTGGTTTTGTGT
T7_15636_G08	GGGGTGTTTTGTTTGTTGTCGTGTGTTTGGTGGTGG
T7_15637_G08	TGTTGTGTTGTGTGGGTGTCGGTTGGTGGTTGTGTT
T7_15638_G08	TGTGTGTGGTGGTGTGGGTCTGGGTTGTTTTTGTGT
T7_15639_G08	GGTGTGTGTGTGTTTTGGTCTGTTGGTTGGTTGTGG
T7_15640_G08	GTTGTTTGTTGTGGTTGGTCTGGGGTGGTTGGTTGT
T7_15641_G08	GTTTGTGTGTGGGTGGGGTCTGGTTTTTTTTGGGGT
T7_15642_G08	TGGTGGTTGGGTTGTGTGTCTGTTTTGGTGTGTTGG
T7_15643_G08	GGGTTTGGTGGGGTTGGGTCGGTTTTTTGTGTGTTT
T7_15644_G08	TGGTTGTTGGTTTGGTGGTCTGTTTGTGTGGGGTGT
T7_15645_G08	TTTGGTGGTTTGTGTGTGTCTGGTGGTGTGTGGGTT
T7_15646_G08	TTGGTTTTGGTGTGTGTGTCGTGTGGTTTGTGGGGT
T7_15647_G08	TGTGGGTGTTGGTGTGTGTCGTTTGGGTTTTGTTGG
T7_15648_G08	GTTGGTGTTTTTTGGTTGTCGGTTGTGGGGTGGGTT
T7_15649_G08	GTTGTTGTTGTGGGTGTGTCTTTGTGGTGTGGGGTT
T7_15650_G08	GTTGGTTTGTGTTTGTGGTCGGTTTGGGTGTGTGTG
T7_15651_G08	TGTTTTTGGTGTGTTGTGTCTTGGGGTGGTTGTGGG
T7_15652_G08	GTGTTGTTGTGGGTTTTGTCTGGTGGTGTGGGTTTG
T7_15653_G08	TGGTTTGTTGTGGTGTGGTCGGTGGTTTGGTTGTTG
T7_15654_G08	GGGTTGTGTGGTTTGTGGTCGGGTTTTGTTGTTGTG
T7_15655_G08	TGTTGGTTGGTGTTGGTGTCTTTGTTGTTGGGTGGG
T7_15656_G08	GTGTGTTGTGTTGGTTGGTCTTGTTGTTGGGTGTGG
T7_15657_G08	GGTTGTGTTGGGTGTGGGTCGTGTGTTGTTTGTTTG
T7_15658_G08	GTTGTTGTGTTGTTTGTGTCGTGGGGTTGTGGGTTG
T7_15659_G08	TTGGTGGGTTGGTTTTGGTCTGTTGTGGGTGTTGTG
T7_15660_G08	TTTGGGTGGGGTTGTTTGTCTGTTGGGTTGGGTTGT
T7_15661_G08	TTTGTGGGTGTGTGTGTGTCTTTGGTTTGGGTGGTG
T7_15662_G08	GTTGGGTGGGTTTGTTGGTCGTTTGGTGGTGTTGTT
T7_15663_G08	TTGTTTGGTGTGGGGTTGTCGTGTGTGTGGTTTGGT
T7_15664_G08	GTTGTTGGTGTTGTGTGGTCTGGTGTGGTTGGGTTT
T7_15665_G08	GGTGTGTGTGGTTGTGTGTCGGTGTGTTGTTGTTTG
T7_15666_G08	TGTTGTGTTTTTGGTTGGTCTGTGGTGTGGGTGGGT
T7_15667_G08	GTTGTGTTGTTTGGGGTGTCGTTTTGTGTTGGGGTG
T7_15668_G08	GTTGGGGTTTGGTTTGGGTCTTGGTTTGGTGTGTGT
T7_15669_G08	TGTGTTGTTGTGTTGGTGTCTTGGTTGGGGTGTGTG
T7_15670_G08	GGGTGTGGTTGTTTGGGGTCGTTGGTTTTTTTGGGT
T7_15671_G08	TGGGTGTGGGGTGTTGGGTCTGTTTTGTGTGTGTTT
T7_15672_G08	GTGGTGTGTTTTGGGTGGTCGTTGTGTGGTTGTGTT
T7_15673_G08	TGTTTGGGTGTGTGTGGGTCTTGTTGTTGTGGGGTT
T7_15674_G08	TGTGTGGTGGGGTTTTGGTCTTGTTTGTGGTGGTGT
T7_15675_G08	GTGTTGTGTGGTGGGTTGTCGTGTTTGGTGTTGTTG
T7_15676_G08	GGTTTTGTTTTGGTTGGGTCGTGGGTTTGGGGTTTG
T7_15677_G08	GGGGTTGTGTGGTTTTGGTCTTGTGGTGTGTGGTTT
T7_15678_G08	GGTGTGTGTTGGGTGTTGTCGGTGTGTGTTGGTTTT
T7_15679_G08	TGTTTGTGGTGTGGTGTGTCTGGTGGTTGGGTTTTG
T7_15680_G08	GTGTTGGTGTGTGGTTGGTCGTGTGTTGTTTGTTGG
T7_15681_G08	TTTGGGTTTGTTGGTGTGTCGTGGTGTGTTTGGTGG
T7_15682_G08	TGTTTGTGTTTGGTTGGGTCTGTGGGTGTTGGTTGG
T7_15683_G08	TTTGTGTGGTTGTTTTGGTCGTGGTGGGTGTGTTGG
T7_15684_G08	TTGGTGGTGTTTGTGGGGTCGGTTTTGGGTGTTTGT
T7_15685_G08	TGTTTGGGTGGGGTTGTGTCTGTGGTTTGGTGTGTT
T7_15686_G08	GGTTTGTTGGTTTGGTGGTCGTTTGGGTTTGTGTGG
T7_15687_G08	GGGTGTGGTTGGTGTTTGTCTTGTTGGTGGTTTGGT
T7_15688_G08	TTGGTGGTTGTGGTTTGGTCGGGGTGTTTGTGTGTT
T7_15689_G08	TTGGTGGTTGTGTTTGTGTCGTGTGTGGTGGTGTGT
T7_15690_G08	TTGTGTGGTGTTGGGGTGTCTGTGGTTGTTTTGGGT
T7_15691_G08	GGTTTGTTTGGTGGTGTGTCGGTTTGGTTGGTGGTT
T7_15692_G08	TTTTTGTGGGTGGTGGGGTCTTTTGTGTGTGGTGGT
T7_15693_G08	GTGGTTGGTGGTGTTTGGTCGTTTGTTGTGGTGGTT
T7_15694_G08	GTTTGTTGTGTGTGTTGGTCTGTGGTGTGGGTTGTG
T7_15695_G08	GTGGTGGGGTGTTTTGTGTCTTGTGTGGTGTGTTGT
T7_15696_G08	GGTGGTTGGGTGGGTTTGTCTTGTTTGGGTTTGTTG
T7_15697_G08	GTGGGGTTGTTTGTGGTGTCGTGGTTGTGGTTTTGT
T7_15698_G08	GGTGTTGGTGGTGTGTTGTCTGGGTTTTGTTGGTTG
T7_15699_G08	GTGTGGTTGTTGTTGGGGTCGTGGTGTGTTGTTTTG
T7_15700_G08	GTTTGGTTGTGTTTTTGGTCGGGTGGTGTTTGGGTG
T7_15701_G08	GTGGGTTGGGGTGTTGTGTCGTGTGTTGTTGTTGTT
T7_15702_G08	TGGTTTTTGGGTGTTTTGTCGTGGGGTTTTGGGTGG
T7_15703_G08	TTGTGGTTTTGGGTGTGGTCGGTGTGGTTGGTTTTG
T7_15704_G08	GTTTGGTGGGTGGTGTGGTCTTTTTTGGGGTTGTGT
T7_15705_G08	GTTTGGTTTGTGGGTGTGTCTGGTTGGGTGGTTTGT
T7_15706_G08	TTGGTGGTGTGGTGTGTGTCGTTTTTGTGTGGTTGG
T7_15707_G08	GGTGTTGGTTGTGGTGGGTCTTTTGTTGGTTTGGGT
T7_15708_G08	TTGTGGTGTGTTTGTTTGTCGTTGTGGTGGGGTTGG
T7_15709_G08	GTTGTTTGGTGTTGTGGGTCTGGGTTGGTGGTTGTT
T7_15710_G08	TGGGTGTGTGTGTTGTGGTCTTTGTGGGGTGTTTTG
T7_15711_G08	GTTTGGTGTGGTGTTTTGTCGGGTTGTGGGTTTGGT
T7_15712_G08	GGTGTGGTTTGTTGTGTGTCTGTTGGTGTGGGTTGT
T7_15713_G08	GGTTTTGTGTTGTTGGGGTCGTTGTTGGTGTGTGGT
T7_15714_G08	TTGGTTGGGGTTGTGTGGTCTTGTTTGTGTGTGGTG
T7_15715_G08	GGTGTGGTGTTGGTTGTGTCGTGTTTGGTGTGTGTT
T7_15716_G08	GGTGGTGTTTTGTGTTGGTCGGTTTGTTGTGTTGGG
T7_15717_G08	TTGGTGTGTTGTTGGGTGTCGTGGTGGTTTGTGGTT
T7_15718_G08	GTGGTTTTGTGGGTGGTGTCGTTGTTTGGGTGTTTG
T7_15719_G08	GGGTGGTGTTGGTGGTTGTCTTGTGTGTGGTTGTTT
T7_15720_G08	TGGTGTTTGTTTTGTGGGTCGTTGGGTTGTGGTGTG
T7_15721_G08	TGTTGTTGTGTGGTGGGGTCTTGTTGTTGGTTGGTG
T7_15722_G08	GTGTTTTGTGTGTGTTGGTCGTTGGTGGTTGTTGGG
T7_15723_G08	TTGGGTTGGTTTGGGGTGTCTTGGGTTGTTTGTGGT
T7_15724_G08	TGTGGTTGTGGTGTGTTGTCTGGTGTTGTTGGGGTT
T7_15725_G08	TGTGGTTGTGTGTGGTGGTCGTGTTGTTGTGTGTGT
T7_15726_G08	TTGTGGGTTGTGTTGGTGTCGTTTTGGTTGGTTGGG
T7_15727_G08	GTGGGGTGTTTTGGTGTGTCTGTGGTGGTGTTTTGT
T7_15728_G08	TTGGTGGGTTTTGTGTGGTCGTTTTTGTGGGTGTGG
T7_15729_G08	TGTTTGGTGTGTTTGTGGTCTGGGTGGGGTGGTTTT
T7_15730_G08	TTGTTGGTGTGGTTGGTGTCGTGGTGTGGTTTGTGT
T7_15731_G08	TTTTGTTGGTGTGGTGTGTCGTGGGGTTTGGGTGTT
T7_15732_G08	GTTGGTGGGTTGGTGTTGTCGGGTGGTTGTTTGTTT
T7_15733_G08	GTTTGTTTTGTGGTTGTGTCGTGGTTGGGTTGGTGG
T7_15734_G08	TGTTGTTGTGTGTTTGGGTCGGTTTGGTTGGTTGGG
T7_15735_G08	TGGGTTGGTGGGTTTTTGTCTTTGGGTGGGTTTGTG
T7_15736_G08	TTGTTTGGTTGTGGGTGGTCTGGTGTTGTTGGTGGT
T7_15737_G08	GGTGTGTGGGTTTGGTGGTCGTGTTTTTGTGGGTTT
T7_15738_G08	GGTGGGTTGTTTTTGTGGTCTGGTGTGTGTTTGTGG
T7_15739_G08	TGTGGTGGGTTGTTGTTGTCGGGTTTGTGTGGTTTG
T7_15740_G08	GGTTTGGGGTGTGGTGTGTCTGTTGTGGTTGTTTGT
T7_15741_G08	GGGTTGTGTGTTTTTGGGTCTTTGTGGGTGTGGTGT
T7_15742_G08	TTTGGTTGGTTGGGTGGGTCTTGGGGTTGTTGTGTT
T7_15743_G08	GTGGGTTTGGTTTTTGTGTCTTGGTTGGGTGTGGTG
T7_15744_G08	TTGTTTGTGTGGGTTGGGTCGTTTGTTGGGTGTTGG
T7_15745_G08	TTGGGTTTTGGGTTGTGGTCGTTGTTGGGGTTGTGT
T7_15746_G08	GTGTTTGGTGTGGGTGGGTCTTGTTGTTGTTGGGTT
T7_15747_G08	TGTTGGTGGGGTTTTGGGTCGGTGTTGTTGGTTGTT
T7_15748_G08	TTGTGGTTGGTTGTGTTGTCTTTGTGTGTGGGGTGG
T7_15749_G08	TTGGGTTGTTGTGTTTTGTCGGGGTGTTGGGGTGTT
T7_15750_G08	TGGGTTGGGTTTTGGTGGTCGTTTGTGGGTGTTTTG
T7_15751_G08	TGTTGTGTTTGTTTGGTGTCGGTGTGGTGTGGGTGT
T7_15752_G08	GTGTTGTGGGTTGGTGTGTCGTGTTTGTGTTGTGTG
T7_15753_G08	TGTGTTGGTTGTTGTTGGTCGGGGTTGTGTGTGTTG
T7_15754_G08	TGTTTGGGTGGTTTGTGGTCGGTTTGGTTGTTGTGG
T7_15755_G08	GTGTTTGTTGTGGTTGTGTCTGTGTTGGGTGGGGTT
T7_15756_G08	TGGGTGTGTTTGTTTTTGTCTGTGTTGGTGGGTGGG
T7_15757_G08	TTGGTTTGTGGTTTGGTGTCTGGTGGGTTGTGTTGG
T7_15758_G08	GTGTGGGTTGTGTGGTTGTCGTGTGGTTTGGTTGTT
T7_15759_G08	GTTGGTGTGGTTGTGGTGTCTGTGTTGTGGTTGTGT
T7_15760_G08	GTTTGGTGTGTGGTGGTGTCGTGGTTTGGTGTTTGT
T7_15761_G08	GGGTTTTTTTGGGTGTGGTCTTGGTGGTTGTGGTTG
T7_15762_G08	TTTGTGTGGGTTGGTGTGTCGGTTGTGGGTTGGTTT
T7_15763_G08	GGGGTTTGTTTTTTTGTGTCGGGTGTGTGGTGGTGT
T7_15764_G08	GGTGGTTTTTGTGGTTGGTCTTTGGGTGGTTGGGTT
T7_15765_G08	GTGTTGGGTGGTGTGGTGTCTTTGGTGGTTTTTTGG
T7_15766_G08	TGTGTGTGGGGTGTGTTGTCTGTTGGTGTTGGTGTT
T7_15767_G08	GTGGTGTGGTTTTGGTTGTCGTTGGGTGGTGTTGTT
T7_15768_G08	TGTGTGGGGTTTGGTGTGTCTTGTGTTTGTGTTGGG
T7_15769_G08	TTTTGGTTTGGGTTGGTGTCTGTGTGTTGTGGGTGG
T7_15770_G08	GTGGGGTTGGTTTGTGTGTCTGTGGTTGTTGTTGGT
T7_15771_G08	GTGGTTGGTTGTTGTTTGTCTTGTTTGGGGTGGTGG
T7_15772_G08	GGTGGTGGGTTGTGTTTGTCTGTTGTGTGGTTTGTG
T7_15773_G08	GGTGTGTTTTGTGTTGTGTCGTGTGTGGGTGGTGTT
T7_15774_G08	TTTTGTTTGGGGTGGGTGTCGTTTGGTTGTGGGGTT
T7_15775_G08	GGTTGTTTGGGGTGGGTGTCTGTGTGTTGTTGGTTT
T7_15776_G08	TTTGTGGTTTTGGTGGGGTCTGGTTTTGGGGTTGGT
T7_15777_G08	TGTGTGGTGTGGGTTGTGTCGTTGTGTGTTGTTGTG
T7_15778_G08	TTGGTGTTGGGGTTGGTGTCGTTGTTTGTGTTGGTG
T7_15779_G08	TGTTGGTTGGGTTGGTGGTCTTTGTGTGTGTGGGTT
T7_15780_G08	TGGTTTGGTGTGTTTTTGTCGGTTGTGTGTGGTGGG
T7_15781_G08	TGTTTGTGGTTGGGTGGGTCTTTGTGGGGTTGTTGT
T7_15782_G08	TGTGTGTGTTTGGTGGGGTCTTTTGGGGTTGTGTTG
T7_15783_G08	TTTGGGTGTGGGTTTGGGTCTGTGTGGTGGTTTTTG
T7_15784_G08	GTTGTTGTTGGGGTGTTGTCGGTTGTTGGTTGTGGT
T7_15785_G08	GGTGGTGGGTGTGGGTTGTCTTTTTTGGTTTGTGTG
T7_15786_G08	TGTGTGGGTGTTGGTGGGTCTTTTGTTGGTTGGGTT
T7_15787_G08	TTGTTTGGGTGTGTGTGGTCGTTGGTTGGGTTGGTT
T7_15788_G08	TTGGGGTTTGTGTTGTTGTCTGTGTTGGGTGTTGGG
T7_15789_G08	TGTGTTTGGTTGTGTGGGTCGGTGTTGGGTTGTGTT
T7_15790_G08	GTGTTGTGTGTGGGTTGGTCGGTTTTGGTTGTGTGT
T7_15791_G08	GGGTGGTGGGTTGGTTTGTCGTGTTTTGTTGTTGGT
T7_15792_G08	GTGTGTTGGTGTTGTTGGTCGTTTGTGGTGTTGGGT
T7_15793_G08	TTTGTTGTGGGTGTGTGGTCGGTTGTGGTGTTGGTT
T7_15794_G08	TTTTGGTTGTTGTGGTGGTCTTGGGGTTTGGGTGGT
T7_15795_G08	GTTGTGGTTTTGTTTGTGTCGGTGGGTTGGTGGGTT
T7_15796_G08	GTTTGTGTGGGTGGGTGGTCTTGTTTTTTGGGTGTG
T7_15797_G08	TGTGGTTGGTGTGGTTGGTCGTGGTTTGTGTGTTTG
T7_15798_G08	TGTTGGTTGGTTGTTGGGTCTGTGTGGGGTTGTTTG
T7_15799_G08	TTTGTGGTGGGTGGTTTGTCTTGGGGTGTTGGTTGT
T7_15800_G08	GTTGTTTTGGGGTTGTTGTCGTGTGTTGGGTGTGTG
T7_15801_G08	TGTGTGTTGGGTTTTTGGTCTGGGTGGGTTGTTTGG
T7_15802_G08	GTTGTTTTGGTTTTTGGGTCGTGTGGGTTGGGGTGT
T7_15803_G08	TGGTTGGGTGGGTTTGGGTCGTGGTTTTTGTGTTTG
T7_15804_G08	GTTGGGGTTGTTGTGGTGTCTTGGGTGTTTGTTGTG
T7_15805_G08	TGGTGTGGTTGTGTGTGGTCTGGTTTTGTGTGTTGG
T7_15806_G08	GGGTGGGTTTTTGGTTGGTCTGGTGTTTGTGTGGTT
T7_15807_G08	TGGGGTGTTGTTTGGGTGTCGTGTTGTGGGTTTGTT
T7_15808_G08	TGTGTTTTGTTGGGTGGGTCGGTTTGTGTGGTGTGT
T7_15809_G08	GTGTTTTGGTTTGTGTGGTCGTGGGTGGTGTGTTGT
T7_15810_G08	GTGTGTGTTTGTGTGGTGTCTGGTGGGTGTTTGGTT
T7_15811_G08	TGTGTTGTGGGTGGTTTGTCGTTTTGGTGGTGGTTG
T7_15812_G08	TTGTTGTGGTGGTTGTGGTCGGGTTTGTGGTTTGGT
T7_15813_G08	GGGTGTTGGTTGTTGGGGTCTTGTGTGTTTTGGTTG
T7_15814_G08	GGGTGGGTTTGTTGTTGGTCTTGTGTTGTTGGTGTG
T7_15815_G08	GTGGTTGGGGTTTTGGTGTCGTGTTGTTGTGTGTGT
T7_15816_G08	TGGTTTGGTGTGGTGGTGTCGGTTTGGTGTTGGTTT
T7_15817_G08	TGTGTGTTGTGTTGTTGGTCGTGTGTTTGGGGTGGT
T7_15818_G08	GTGTGTGTTTGTTGGGTGTCTGGTTTTGGTGTGGTG
T7_15819_G08	GTGGTGTTGTTTGTGTGGTCTTTTGTTGGGGTGGTG
T7_15820_G08	TTGTGTGTTTGTGTGGTGTCTTGTGGGTTGGTGGTG
T7_15821_G08	TGTTTGTGTTGGGGTGGGTCGTGTGGGTGTTTTGTT
T7_15822_G08	GTGGTTGTTTGGTGGTGGTCTTGTGTTGGGTTGTGT
T7_15823_G08	TTGTTTGGTGGTGTGGGGTCTTGTTTGTGGTTGGTG
T7_15824_G08	GTGGTTTGTTTGTGGGTGTCTTTGGGTTTGGTGGGT
T7_15825_G08	TTTTTGGTTTGTGGTGGGTCGGGTGTGTGTTGGTGT
T7_15826_G08	TGGGTTGGGTGTGTTGTGTCGGGTTGGTTGTGTTTT
T7_15827_G08	GTGGTTGGGTTTTGGTGGTCTGTTGTGTGTTTGTGG
T7_15828_G08	TTGGTTTTGGGGTGTTTGTCGTTTGGTGTGGTGTGG
T7_15829_G08	TGGGTGGTGTGGTTGTTGTCGTTTTTGTGGTGGTTG
T7_15830_G08	TGGGTGGTTTGTGGGTTGTCGTGTTGTTGTTGGTTG
T7_15831_G08	GGTGGTTTTGTGTTGGTGTCTGTTGGGGTTTGTTGG
T7_15832_G08	GGTGTGGTTTTGTTTGGGTCTGGTGTTGTGTGGTGT
T7_15833_G08	TGGGTTGTTTGTTGTGTGTCTGGTGTGGGTTGTGGT
T7_15834_G08	GTTGGGGTGTTTTGTGTGTCGTGTGGTTTGGGTTGT
T7_15835_G08	TGGTGTGGGGTTTGTGTGTCTTGTGTGGTGTGTGTT
T7_15836_G08	TTTTGGTTTTGTTGGGTGTCGTGGTTGGTGGTTGGG
T7_15837_G08	TGGGTTTGGTGTTTTTGGTCGGGTGGGTGTGTGTTT
T7_15838_G08	GTTTTTGTTGGTGGGGTGTCTGTTGGTGTTGTGGTG
T7_15839_G08	GGGTTTGTGTTTGTTTGGTCGTGGTTGTGTGTGGTG
T7_15840_G08	GTGTGTGTGGTGTGTGGGTCTGTTTTGGGTTTTGTG
T7_15841_G08	GGTGTTGTGGTGGGTTTGTCTGGTTTTTGGGTTTGG
T7_15842_G08	TTGTTGTTGGTGTTGTGGTCTGGGTGGGTGTTGTGT
T7_15843_G08	TTGTGGTTTTTGGGTGTGTCTGGGGTGTTTGTTGGG
T7_15844_G08	TGTGGTTTGTGTGTTTTGTCGTGGGTTGTGTGGGGT
T7_15845_G08	TGGGTTTGTTGGGTTGTGTCGGGTTGTTGTTTGGTG
T7_15846_G08	GTGTGGTTGGTTTTTGGGTCTGTTGGTGGTTGTGGT
T7_15847_G08	TTGGGTGGTTGGGTGGTGTCGTTGTGGTGGTTTTTT
T7_15848_G08	TGTGTGTTTTGTGGGTGGTCGTTGTTGTGGTGTGTG
T7_15849_G08	TGTTGTGTGGTGTGTTTGTCGTGGGTGGTTGTGTGT
T7_15850_G08	GGTGGTGTTTGGTTTGGGTCGGTTGTTGTTTTGTGG
T7_15851_G08	TGGTGTGTGTTTTGTTGGTCGGTTTGGTGTGTGTGG
T7_15852_G08	GTTGTGGTTGTGTGTTTGTCTGTGGGTTGGGTGTGT
T7_15853_G08	GGTTTTGTTGGGTGGTTGTCGGTGTGGTTGGTTTGT
T7_15854_G08	GGTGGGTTTTTTTTGTGGTCGGGTGTGTGTTGTGTG
T7_15855_G08	TGTTTTGGGTGTTTGGTGTCGTTGGGGTTGGGTGTT
T7_15856_G08	GTTGTTGGGTTGTTGTGGTCGTTGTTTGTTGGGTGG
T7_15857_G08	TGTGTTGTGGGTGTGGTGTCTGGTGTTTTGGGTGTT
T7_15858_G08	TGTGTGTGGGTTTTTGTGTCTGGTGTGGGTTGTGTG
T7_15859_G08	GTGTTGTTGGGGTGTTGGTCTGTTGGTGTGTTGTTG
T7_15860_G08	GGGGTTGTGGTGTTTTGGTCGTTTGGTTTTGTGGTG
T7_15861_G08	GGTTGTGGTGGTTGGTGGTCGTTTTGGGTTTGTTGT
T7_15862_G08	GGTTTTGGTGTGGGTGTGTCGGTGGTTTTTGGTGTT
T7_15863_G08	TTTGTTTTGGTTGGGGTGTCGTGGGTTTGTGGGTGT
T7_15864_G08	TGGGGTGTGTGGTTTTTGTCTGGTTGTTGGTTGTGG
T7_15865_G08	GTTGTGTTTGTGTTGGGGTCTGTGTGTGTGTGTGTG
T7_15866_G08	TTTGTGTGGTGTGTGTGGTCTTGGTTGGGTTGTGGT
T7_15867_G08	GTTGGTTGGTTTGTTGTGTCTTGGGTGGGTGTGGTT
T7_15868_G08	GTTGTGGTGGTGTTTTTGTCGTTTGTGGGTTGGGTG
T7_15869_G08	TGGGGTGGTTGGTTTGTGTCTGGGTTTTGGGTTTGT
T7_15870_G08	GGGGTTGTTGGTTGGTGGTCGTGTTGTTGTTTGGTT
T7_15871_G08	TGTGTGTGTGGTTGGTGGTCGTGTTGTGTGGTTTTG
T7_15872_G08	GTTGTTTGTGGTGTTGGGTCTGGTGGGTTTTTGGTG
T7_15873_G08	GGGTGTGTGGGTTGTGTGTCGGGTGTTTTTTGTTTG
T7_15874_G08	TGGTGGGGTGTTGGGTTGTCGTTTTTGGTTGTTGGT
T7_15875_G08	TTTGGTGGTGTGTGTTTGTCTGGTGGTGGTTTTGGG
T7_15876_G08	GTTGGGTTTGGGTTTGGGTCTGGTTTTGGTTGGGTT
T7_15877_G08	GGGTTGTTGTTGGTGTGGTCTTTTGGGTGTTGGTGT
T7_15878_G08	TTGGGTGTTTTTGGTTGGTCTTTTGTGGGTGGGGTG
T7_15879_G08	TGTGGGTGGTTTGGGGTGTCGTTTTTTTGGTGGGTT
T7_15880_G08	TGTTGTTTTTTTGGGTGGTCGTGGTTGGTGTGTGGG
T7_15881_G08	GTTGTGTGTTGGGGTGTGTCGGTTGGTTGTTTGTTG
T7_15882_G08	GGTGTGGTTGTTGTGTGGTCTGTTTGGTTGGGTGTT
T7_15883_G08	GGTTGTTGTTGGTGGTGGTCTGTGGTGGGTTTTTTG
T7_15884_G08	GGGTGGTTGTGTGTTGTGTCTTTGGTGTTTTGTGGG
T7_15885_G08	TTTGTGGTGGGGTGTTGGTCTTTGTTTGTGGGGTTG
T7_15886_G08	TTTGTGGGGTGTTTGGTGTCTGGTGTGGTGGTGTTT
T7_15887_G08	GTTGTTGGGGTGTGGTTGTCGTGGTGGTTTTTTGGT
T7_15888_G08	TTTGTTTGTGTGTGGGTGTCTTGGTTGTGGTGGGTG
T7_15889_G08	TTTGGGTGTGTGTTGTTGTCTGTGTGGTTGGTGGGT
T7_15890_G08	GGTGTGTGGTGGGTGTTGTCGTGGTTTGGGTTTTTT
T7_15891_G08	TGGTTTTGGGTGTTTGTGTCGTGTGGTTTGTGGTGG
T7_15892_G08	TGTTGGTGTGTTGTGGGGTCTGGTGGTTGTTGTTTG
T7_15893_G08	TTGTGTTTTGGGGTGTTGTCGTTTTGTGGGTGGGTG
T7_15894_G08	GGTGGGTGGTGTTGTTGGTCTTGTTGTTGTGGTGTT
T7_15895_G08	GTTGTGTGGGGTGTTGTGTCTGTGTTGTTTGGGTTG
T7_15896_G08	TGTGGGTGTTGGTGGTTGTCGGTTGGTTTTGGTGTT
T7_15897_G08	GGTGGTGTGGTTGTTTGGTCTTGGTGGGTTTGGTTT
T7_15898_G08	GGTGTGTTTGGTGGGGTGTCTTTTGGTTGGTGGTTT
T7_15899_G08	GTGTGGTTTTTGTGTGGGTCGGTGTTGTGTGGGTTT
T7_15900_G08	TGTTTTGTGGGGTGTTTGTCGGTGTGGTTTGTGGTG
T7_15901_G08	TTTTGGGGTTTGGGTGGGTCTGTTTGGTGTTTGTGG
T7_15902_G08	GTTGGGTGGTGTGGTTGGTCGTGTGTTTGTTTTGGT
T7_15903_G08	TGTTGTTGGGGTGTGTGGTCTGTTTGGTGGTTGGTT
T7_15904_G08	GGTTTTGGTGTGTGTTTGTCTGGGTGTGTGGTTGGT
T7_15905_G08	GGGGTGGTTGGGTGTTGGTCTGTTGTTGTTGTTTTG
T7_15906_G08	TTGTGGTTGGTGTGTGTGTCGGGGTGGTTTTTGTGT
T7_15907_G08	GTGGTGGTTGGTGTGTTGTCGTTGGTGTTGTTTGTG
T7_15908_G08	TGTTGTTGTGGGTTGGTGTCGGGTGGTTTTGGTGTT
T7_15909_G08	GTTTGGGTGTGGTTGTGGTCTGGTTTGGTGGTTTGT
T7_15910_G08	TTTGGGTGTGTGGTTGGGTCGTGTGTTGTTGGTGTT
T7_15911_G08	GTGTTGTTGGGGTGTGGGTCTTTGTGGGTTTTGTTG
T7_15912_G08	TTGTGTTGTTGTTTGGGGTCGTGTTTGGGGTGTGTG
T7_15913_G08	GTGGGTGGTTGTGTTGGGTCGGTTTTTTTTGGTGGT
T7_15914_G08	GTTGGGTTTGTTGTGTTGTCTTGGGTTGTGGTGGGT
T7_15915_G08	GGTTTTTGGGTGTGTTGGTCTGTTGGGTGTTGTTGG
T7_15916_G08	GGTTTGTGGGGTGGTGGGTCTTTGTTGTTGGTGTTT
T7_15917_G08	GTGTTTGTGTGTGGTGGGTCGGTTGTGTGTGTGTTT
T7_15918_G08	TTGTTTGTGGTTTGTGTGTCGTGGTGGTTGTGGGTG
T7_15919_G08	GGTGGGTGTGTTTGTTTGTCGGTTTGTGGTTGTGGT
T7_15920_G08	GGTTTGGTTGTGTTGGGGTCGGGTTGTTTGGTTTTG
T7_15921_G08	TGGTGGGTTGTGTGTGTGTCTGTTGTTGGGTTTGGT
T7_15922_G08	GTGGGTGGTGTTTTTTGGTCTGTGGGTTGGGTTTTG
T7_15923_G08	TGGTTTGTTGTTGGGTGGTCGTGGTGTGTGTTTGTG
T7_15924_G08	TGGGTGTGGTTGTGGTTGTCGGTGGGGTTTTTTTTG
T7_15925_G08	GTGTGGGGTTTGTGTTTGTCTTGGGTTTGTGGGTTG
T7_15926_G08	GGTTGGTTGTGTGTGTTGTCGGGTGTTTGGTGTGTT
T7_15927_G08	TGTTGGTGGGGTTTTGGGTCGTGTGTTGGTTGTGTT
T7_15928_G08	GTTTGTGGTGTGTGGTGGTCTTGTTGTGGTGGGTTT
T7_15929_G08	GTTGGTTTTGGTGGTGTGTCTTGTGTGTGGTGGTGT
T7_15930_G08	GTGTGTTGTTTTGTGTTGTCGTTTGGGGTGGTGGGT
T7_15931_G08	TGGTTGTTTTGTTTGTGGTCTTGGGTGGTGGGTTGG
T7_15932_G08	TGTGTTTTTTGGTTGTGGTCGGTTGTGTTGGGGTGG
T7_15933_G08	GGTTTGGGTTTTGTTTTGTCGGGGTTGTGGTTGGTG
T7_15934_G08	TTGGGTTGGGGTTTGGGGTCGTGTGTTTTGGTGTTT
T7_15935_G08	GTGTTGGTTGTTGGTTGGTCGTGTGTGTTTGGGTTG
T7_15936_G08	TGTTTTTGTGTGGGTTGGTCGGGTTTTGTGGTGGGT
T7_15937_G08	GTTGTGTGGGTTGTTTTGTCGGTTTTGGTTGGTGGG
T7_15938_G08	GTGGGTTGGGGTTGTTGGTCTGTTTGTTGTTTGGTG
T7_15939_G08	GTGGGTTTGGTTGGTTGGTCTTTGGGTTTGGGTTGT
T7_15940_G08	TTTGTGGGTTGTTTGGTGTCTGGGTTTGGGGTGGTT
T7_15941_G08	GTTGGTTTTGTTTGGGTGTCGTTGGGTGGTTTGGGT
T7_15942_G08	GTTTGTGGTGTGTGGTGGTCGTGTGTTGTTGTTTGG
T7_15943_G08	GGGGTTTGTGGGGTTTTGTCTGTGTTGTGGTTGGTT
T7_15944_G08	TGTTTTTGGTGTGTGTTGTCGTGTGGTGGTGTGGTG
T7_15945_G08	GTTGTTGTGGGTGTGTTGTCGGTGGTTGTTGGTGTT
T7_15946_G08	TTGGGTGTTGGTTTGTTGTCGTGTTGTTGGTGGTGG
T7_15947_G08	GTTGGGGTTGGGTTGTTGTCGTTTGTTTGGTGTTGG
T7_15948_G08	GTTTGTGTGTTTGGTGGGTCGGTTGGGTTTTGGTTG
T7_15949_G08	TGGTTGGTGTGTTTTGGGTCGGTGTTGTGGGTGTTT
T7_15950_G08	GGGTTGTGGGTGTGTTTGTCGTGGTGTTTGGTTGTT
T7_15951_G08	TGGTGGTGTGGGTTGGTGTCGTGTGTTGGTTTTGTT
T7_15952_G08	GTTGTGTGTGGTGTGGTGTCTTTTGTTGTGGGGTGT
T7_15953_G08	GTTTGTGGTGGGTGTGTGTCGGGTTTGTGTTTTGGT
T7_15954_G08	TTGTGTTTGTTTGTTGGGTCGTGGGTGGTTTGGGGT
T7_15955_G08	GTGGTGGGTGGTTGTTGGTCTGTTGTTTGTTGTGTG
T7_15956_G08	TTTGGTTGGTGGTTTGGGTCTTGTGGGTTTGTTGGG
T7_15957_G08	TTTTGGGGTGGTTGGTTGTCGGTGTGTTGTGTGTTG
T7_15958_G08	TGGTTTGTTTGGGTTTGGTCGTGGTGGGTGGTTTGT
T7_15959_G08	GGTTGTGTGTTTTGTTGGTCGTGGGGTGTGTTTTGG
T7_15960_G08	GTGTGTGTTGGTTTGTGGTCTTGTGTGTGGTGGGTT
T7_15961_G08	TTTTTGGGTGGGTGTGTGTCGGTGTTGTGTGTGGTT
T7_15962_G08	TTGGTGTGGGTGTTGGTGTCGTGTGTTTGTTGGTGT
T7_15963_G08	GTGGTTTTTTGGTTTGTGTCGTTGGGGTGGGGTGTT
T7_15964_G08	GGGTGGTGTTTGTTGGTGTCGTTTTGTGTGGGGTTT
T7_15965_G08	GTTTGGGGTGGGTGGGTGTCTTGTTTTGTGTGTGTT
T7_15966_G08	GTTGTGTGGTGGTGTTTGTCTGGTTTTGGTGGGTGT
T7_15967_G08	GTGTGTGGGTGGGTTTTGTCTGTGGTTGGGTTTTTG
T7_15968_G08	GGTGTGTGTTTTGTGTTGTCGGGTTTGTTGGTGGGT
T7_15969_G08	GGGGTGGTGTGTGTGTTGTCTGTTTTGGGTTGTGTT
T7_15970_G08	TGTGTGGGTGGGTTTTGGTCTGGTTTTTGTGGGTGT
T7_15971_G08	TTGTTGTGTGGTTTGTGGTCTGGTGTGGTTGGGTTG
T7_15972_G08	TGGTTTGGGTGGTGGTGGTCTGGTGTGTTTGTTTTG
T7_15973_G08	GGTGTTGGGGTTTTTTGGTCTTGGTGGTTGTGTTGG
T7_15974_G08	GTGGGTTGTGTTGGTGTGTCGTTTTGGTGGGTTTGT
T7_15975_G08	TTGGGGTGTGTTTTGTTGTCGGTGGGTGTTGTGTTG
T7_15976_G08	GTTGTTGGGTTGTTGTGGTCTGTTGTTTGGGTGGGT
T7_15977_G08	GTTGTTGTTGGTTTGTTGTCGTGTGTGGGTGTGGGT
T7_15978_G08	GTGGTTGGGTGTGGTTTGTCTTGTTGTGTGTGTTGG
T7_15979_G08	GTTTTGGGTTGTGTGGGGTCTTTGGGGTTTTGTGGT
T7_15980_G08	TGGGTGGTGTGTTTTGTGTCGGTTTTGGTGGTTGGT
T7_15981_G08	TGTGTTTGTGGGTGTGGGTCTGTTGTGTGGGTTTGT
T7_15982_G08	TTTTGTGTTGTGGTTGTGTCGGGGTGGTGGGTTGTT
T7_15983_G08	GTTGGGTTTGTGTTGGGGTCTGTGTTTGTTGTGGTG
T7_15984_G08	TTGGTGTGTGGGTTTGGGTCTGTGGTTTTGTGGTGT
T7_15985_G08	TGTGTGGGTGGTTTTGGGTCTTGGTTGGTTGTGTGT
T7_15986_G08	TTTTGTGTGGGTGTGTGGTCTGTTGGGTTTTGGGGT
T7_15987_G08	TTGGGTTTGGGTGGGTGGTCGGGTGTTTGGTTTTTT
T7_15988_G08	TTTGGTGGTTGGTTGGTGTCGGTTTGTTGTGTGGGT
T7_15989_G08	GTGTGGTTTTGTGGGTGGTCTTGGTTTTGGTTGGTG
T7_15990_G08	TTGGGTGGGTTTGTGTGGTCGTGGTGGTTGGTTTTT
T7_15991_G08	TTGGGGTGTGTGTTGGTGTCTTGTGTTTGGGTTTGG
T7_15992_G08	GTTTTTTGTGTGTTGGTGTCTGGTGGGGTTGTTGGG
T7_15993_G08	GTGTGTTTGTGGTGGTGGTCGGTTTTTGTTGGTTGG
T7_15994_G08	GTTTTGGGTGTTGGGTGGTCTGTGTTGTGTGTTTGG
T7_15995_G08	GGGGTGGTTTGGTTGTGGTCGTGGTTTTTTTGGTTG
T7_15996_G08	TGGTGTGGGTGTTTGTGGTCTTGGGTTTGTTTGGGT
T7_15997_G08	GTTGGGTTTGTGGGGTTGTCTGTTGTTGTGTGTGTG
T7_15998_G08	GGTGTGGTTGGTGTTTTGTCGTTTGGGGTGTTGTTG
T7_15999_G08	GGGTTGTGTTGGGTGTGGTCTGTGTTGGTGGTTTTT
T7_16000_G08	TTGGGTGTTGTGGTGTTGTCTGTGTTTGGTTGGGGT
T7_16001_G09	GCGGCCGCAGGAGGACGGTCACGAGAAACACCACCA
T7_16002_G09	CAGCAGCAGCAGCAGCAGTCGCAGCAGCAGCAGGAC
T7_16003_G09	ACACCACGACGACGACGGTCACGGCGACGACGAGGA
T7_16004_G09	AAAACCGCCGCCGGAGGGTCAGCAGCAGCAGCAGCA
T7_16005_G09	GCCGCGACGCCGCAGCAGTCGCAGCAGAAGAAGAAC
T7_16006_G09	ACACAAGAAGAAGAAGCGTCCGCCGCCGGCGGCAGC
T7_16007_G09	AGCAGCAGCAGCAAGAAGTCGAAGCACCGCGGCCGC
T7_16008_G09	GACGACGACCAGCAGCCGTCACCACGGAGGAAGCAG
T7_16009_G09	AACAAGAAGCGGCACGAGTCGGCGACGACGACCGCC
T7_16010_G09	GAAGAAGCAGCAGCAACGTCACCAGAGGCCGCCGGC
T7_16011_G09	AGCAGCAGGAGAGGAGCGTCAACCACCGCCGCAGCA
T7_16012_G09	GACGACGACGACAACCAGTCACAACACGGCGGGCGG
T7_16013_G09	CGGCGGCGGCGCCGACAGTCACAACAACAACGAGGA
T7_16014_G09	GCCGCCGCCAGCAGCAGGTCCAGCAGGAGAGAAACA
T7_16015_G09	ACCACCAGACGACGACGGTCACGACGACGACGGAGG
T7_16016_G09	ACAACACCACCACCGCAGTCGCGGGGACGAGGAGGA
T7_16017_G09	CCGCGGCGGCGGCCGCCGTCACAACAAAAAAGAGGA
T7_16018_G09	ACGAGCAACAACAGCAGGTCCCGCGGCGGCGACGAA
T7_16019_G09	GGAGGAGGAGCAGCAGCGTCAGCAGCAACCACCACC
T7_16020_G09	CACAACAGCAGCCGCGGGTCCGGCAGCAGCAAGAAG
T7_16021_G09	AGACGACAACGACGGCGGTCACGCAGCAGCAGCAGC
T7_16022_G09	GCACGACGGCGCCGACAGTCACACGACGAGAAGACG
T7_16023_G09	ACCGACGAAGAAGGCGGGTCCCGCCGCCGACAAAAG
T7_16024_G09	GAGGAAGAAGAAGCACCGTCACCACCGCCGACGCGG
T7_16025_G09	ACAACGACGGCGGCAACGTCAGCAGCAGCAGCAGCG
T7_16026_G09	AGAAGAAGACGACAACGGTCCCGCCCGCGGCAGCAG
T7_16027_G09	GAGGAAGACGACGACACGTCCACCACGACGACGGCG
T7_16028_G09	AGAAGAAGAAGGCAGCAGTCGAAGCGCCGCCGCCCC
T7_16029_G09	GAAGAGGAGGAGGACGAGTCCGCCCGCCACCACAAC
T7_16030_G09	ACAACGACGACGACGACGTCGAGGACGACGACGCCG
T7_16031_G09	GCGGCCGCCGCAGAAGAGTCAGAACAACACCGACGG
T7_16032_G09	CGCCGCAGCAGCGGCGGGTCCAGACAACGACAAGAA
T7_16033_G09	ACCACGACGCCACGACGGTCAAGAAGGACGAGCGGC
T7_16034_G09	CGACGCCGCAGCAGCAGGTCCAGCAAGAAGACGGCA
T7_16035_G09	GAGGAGGAGGCCGCACCGTCACCAGCAGCAGCAACA
T7_16036_G09	GACGAACGGCGGCGGCGGTCCAGCAACCACCAAGAA
T7_16037_G09	ACGACGACGACGACGGCGTCGGCAGACGACGACCAA
T7_16038_G09	ACGACGAGGAGGAGGACGTCGACGACGACCACCACC
T7_16039_G09	ACAACAAGAAGAACGAGGTCGCGGCAGCGCCGCCGC
T7_16040_G09	GCAGCAGCAGCAGGAGCGTCACCAACGACGACGACG
T7_16041_G09	AACAAGGAGGACGACGGGTCCGACGACGCCGCCACA
T7_16042_G09	AACGCAGCAGCAGCAGAGTCCGACGGAGCAGCCGAC
T7_16043_G09	GGCGCCGGCCGCCACAAGTCCAACAAGAAGACGAGG
T7_16044_G09	GACGACGAGGAGGAAGAGTCAAGCCGCCGCCACCAC
T7_16045_G09	CAACAGCAGCAGCAGCAGTCGCAGCAGCAGCAGCGG
T7_16046_G09	CAACACCAACAACGGCCGTCGCGGAGGAGGACGACG
T7_16047_G09	GCCCGCCCCACAGAAGAGTCGGAGCAGCAGCAAGAG
T7_16048_G09	CGACCACGAGGAGCAGCGTCAGGAGCAACCACGACG
T7_16049_G09	CCGCACCACAACAACAGGTCCAGCAGGAGGAGGCGG
T7_16050_G09	AGGAGGACGACGACGACGTCGACGACACGACGCCAC
T7_16051_G09	CAACAAAGACGACCACCGTCGGCGGCAGCAGCAGGG
T7_16052_G09	CAACAACAACGAAGAGGGTCCGGCGGCGCCAGCAGC
T7_16053_G09	AGACGGCGCCGCAACAAGTCGAAGAAGCGGCAGCCC
T7_16054_G09	GGAGCACCAACAACAGAGTCCGACGGCGGCGACGAC
T7_16055_G09	GCGACGACAGCAGCAGGGTCAGGCCGACGACAACAC
T7_16056_G09	CAACGACGACGACCACCGTCAGCAGCAGCAGGAGGG
T7_16057_G09	AGAAGAACAAGAACGACGTCGACGCCGCCGCCGCGG
T7_16058_G09	CAGCGGCAGCAGCAGCAGTCGCAGCAGAAGACGACC
T7_16059_G09	GAAGCAGAAAACACAACGTCGGCGGCGCCGCCGCAG
T7_16060_G09	GACAACAGCACCACGACGTCGACGACGACGGCGGAG
T7_16061_G09	GCCACCACAACCACAGGGTCAGGAGGAGCAGCAGCG
T7_16062_G09	GCAACAACGAAAACAGCGTCAGACGGCGGCGGCCGC
T7_16063_G09	CCGACGAAGAAGAAGCAGTCGCAGCCGGCGACGACC
T7_16064_G09	AACAGCAGCAGCACCGCGTCAGCAGCGACGACGAGG
T7_16065_G09	CAGCCGCCGCCCACCACGTCGAGGAGGAGGAGAAAA
T7_16066_G09	GCGGCAGCAGCACCACCGTCACCAGAAGACGGAGGA
T7_16067_G09	AGAACAACAACGACGACGTCACCGCGGCGGCGGCGA
T7_16068_G09	CAGCAGCAGCAGCAGCCGTCGCAGCAGCAGCAGAAG
T7_16069_G09	CGGCGGCGGAGCAGCAGGTCCAGCAGCACCAACAAA
T7_16070_G09	GAAGAAGAAGAAGCAGCGTCAGCAGCCGCCGCCGCC
T7_16071_G09	ACCACCACCGACGACGAGTCCGACCAGGAGGAGGGA
T7_16072_G09	CCACCCACGACGGAGGAGTCGGAGGAGGCAACACCA
T7_16073_G09	GCCGCCGACGACAACCAGTCCCACAGAGGAGGAGGA
T7_16074_G09	CGAAGAAGAAAGACGGCGTCCGCCGCCGACGACGAC
T7_16075_G09	CGCCGACAACAGGAGGAGTCCGACGACGACGACGAC
T7_16076_G09	AGGAGGAGCACCACCACGTCGACGACGACGACGACG
T7_16077_G09	ACCACGACGACGACGACGTCGACGACGACGAGGACG
T7_16078_G09	CAGCAACGACAACAAGAGTCAGACGCCGGCGGCGGC
T7_16079_G09	GACGACGACGACGACGAGTCCGACCAGCAGCAGCAG
T7_16080_G09	GGCGGCGGCGGCGGCAGGTCCAACAACAACAACAAC
T7_16081_G09	GACGAGCAGCACGACGAGTCCAGCAGCAGCAGCAGC
T7_16082_G09	GGACGACGACGACGACAGTCACACGACGACGACCGG
T7_16083_G09	ACCACCAAGAAGCAGCAGTCCCAGCAGGAGGCGGCG
T7_16084_G09	GGAGGAGGAAGAACAACGTCACCACCACCGCCGGCG
T7_16085_G09	CCACGACGACGACGACGGTCACGACGACGAGGAGCA
T7_16086_G09	AGCAACAACGACGACGAGTCCGACGGCGGCGGCACA
T7_16087_G09	AACAACACGACGGCACGGTCCCGCCACGAGGAGGAG
T7_16088_G09	GGCGGCAGCACCAGCAGGTCAAGCAGCAGCAGCAAC
T7_16089_G09	CGCCGCAGCAGCCGCCGGTCCAGCAGAAGAAGAAGA
T7_16090_G09	CCACCACAGCAGCAGGAGTCGGACGCAGCAGCAGGA
T7_16091_G09	CACCACAAGGAAGAAGAGTCCCGCCAGCGGCGGCAG
T7_16092_G09	CCGCCGCAGAAGAAGAAGTCGAAGCCGCAGCAGCCG
T7_16093_G09	AGCCGCCGCAAGCAGCAGTCGCAACACGACGGGAAG
T7_16094_G09	CGCCGCCACGACGACGAGTCGCAACAACAGGAGGAG
T7_16095_G09	GGCCGCCGCGCCGCAGCGTCAACAACGAAGAAGAAG
T7_16096_G09	GACGACAAGAACCAACAGTCACAGCCGCGGCGGCGG
T7_16097_G09	CCGCCGACAACAACAGCGTCCGACGAGGAGGACGAG
T7_16098_G09	ACCAGCAGCAGCAGCAGGTCCAGCAGCAGCAGGAGC
T7_16099_G09	GAGGAGGAGCAGCAGCAGTCGCAGCACCAACACCGC
T7_16100_G09	GCAACACCACCAGCAGGGTCAAGACGACGACGGCGG
T7_16101_G09	GGCGGCGGCGACGACCGGTCCCGACGACAAAAAACA
T7_16102_G09	GGCGGGCGGCAGCAGCAGTCGCAGCACAACAACAAC
T7_16103_G09	AGAAGCAGCAGCAGCGGGTCCGGCAACCAGCAGCAC
T7_16104_G09	AGCAGCACGACCACGACGTCGACGAGGAGCAGCAGC
T7_16105_G09	GGCGGCGCCGCCCCGCGGTCACGAAGAAACAAGAAA
T7_16106_G09	CAGCAGGAGGAGACAACGTCAACGACGGCCGCCACG
T7_16107_G09	CGCCGCCGAAGACGACGGTCACGACGACGACGAAGA
T7_16108_G09	CCGCAGAAAAAAAAGACGTCGAGGCGGCGCCGCCGC
T7_16109_G09	CAGGAGGGAGCAGCAGAGTCGGCAGCACCACCACCA
T7_16110_G09	CACCCGCGCCGGCGACGGTCAAGAAGAAGAAGACGC
T7_16111_G09	ACGAAGACGACGACGACGTCGACGACGACGACGCCG
T7_16112_G09	ACGACGCAGCACCAGCAGTCGCAGCAGCAGGAGGAC
T7_16113_G09	GCCGCCGCACAACACCAGTCACAGGAGGAGCAGGGA
T7_16114_G09	AGCAGCAGCAGCAGCAGGTCCAGCAGCAGGACGACC
T7_16115_G09	GGCGACGACGACGACAAGTCCGACGACGACGACGAC
T7_16116_G09	CCACCACAAGACCACCGGTCCCGAGGAGGAGGAGGA
T7_16117_G09	AGCAGCGGCGGCGGCGAGTCCAACAACGACGACAAC
T7_16118_G09	ACAACCACCGCCGCCGCGTCGGCGGAGAAGAAGAAG
T7_16119_G09	ACGACGACGACGAACAGGTCCAGCAGCGGCAGCAGC
T7_16120_G09	ACAACGACCACGACGACGTCGACGACGACGCGGAGG
T7_16121_G09	GGCAGCAGCAGCAGCAGGTCCAGCAGCAGCAGCAAC
T7_16122_G09	ACGGCGGCAGAACAACAGTCACAACCGACGGCGGCG
T7_16123_G09	CAACAGGAGGCAGCAGCGTCCGACCAGCAGCAGCAG
T7_16124_G09	AAAAGAAGAACCGCCGCGTCCGGCGACGACGGCAGC
T7_16125_G09	CGACGACGACAACAGGAGTCGGAGCAGCCGCAGCCA
T7_16126_G09	CACCACGCCCACCACGAGTCCGAAGAGGAGGAGGAG
T7_16127_G09	CGACGACAACCACCAACGTCGACGACGAGGAGGGGC
T7_16128_G09	GCCGCCCCGGAAGAAGCGTCAACAACGAGGAGGACC
T7_16129_G09	ACCACCAGCAGCAGCCGGTCCCGCAGGAGGAAGAAG
T7_16130_G09	AACAGCAGGAGGCGGCGGTCGCCGCAGAACAACCAC
T7_16131_G09	CGACCACCAAGAAGCGGGTCCGGCAAGACGACGGCA
T7_16132_G09	GCACCACCACCACCAGCGTCAGCAGGAGGAGGAGGA
T7_16133_G09	CAACGACGACGACGACGGTCACGACGACGACGGACG
T7_16134_G09	GCCGACGACGACGAGGAGTCGAACAACGACGACGCC
T7_16135_G09	CGGAGCGCCGCCGCAGAGTCACAACAGCAGCAGAAG
T7_16136_G09	GGCAACAACAACGACGAGTCCGGCGGCGCAGCAGCA
T7_16137_G09	CGCCGCCGCCGCAGCGGGTCAGGACAACAAAGAAGA
T7_16138_G09	GAGCAGCCGCCGGCAGAGTCAGACGACGAAGACACC
T7_16139_G09	CAACAACACCAACAGCGGTCGCAGGAGCAGCGGCGG
T7_16140_G09	CAGCAGGAAGGAGGAGCGTCAGCAGCACCACCACCG
T7_16141_G09	AGAGGCGACGGCGACGAGTCCCACGACGACGACCAA
T7_16142_G09	ACGACGACGACGACGACGTCGACCACCAGCAGGAGG
T7_16143_G09	CGACGACGAAGACGACCGTCACGACGACGACGACGG
T7_16144_G09	GAAGCAACAGCAGCCGCGTCAGCAGCAGCAGCAGCG
T7_16145_G09	GAAGCAGCAGCAGGACCGTCACGACGCAGCAGCAGC
T7_16146_G09	AGAAGGAGCAGCAGCAGGTCCAGCAGGACCACCCGC
T7_16147_G09	CGCAGGACACAGCAGCAGTCGCAGCAGCAGCAGCAG
T7_16148_G09	ACGCCGCCACCGCCGCCGTCGAAGAAAAGAAGGAGG
T7_16149_G09	CAACAACAAGCGACGGAGTCGGCCGCCGCAGCAGGA
T7_16150_G09	CGCGACGACGACGACGAGTCAGACGACGACGACGAC
T7_16151_G09	GAAGGAGGAAGAAAAGCGTCGGCGCCCCGCCACCAC
T7_16152_G09	GCCGCGACGACGAGGAGGTCGAGCAACCACCAGCAA
T7_16153_G09	ACGACGGCGCCGACGACGTCGACAACAACGAGGAGC
T7_16154_G09	CGACGACGACGACGACGGTCAGGAGCACCACCAGGA
T7_16155_G09	GCCGCCGCCGACGACGAGTCCGGCGAAGAAGAACAA
T7_16156_G09	GAAGGAGGAGGAGGGCCGTCGCACCACCAACCACCA
T7_16157_G09	ACAACAACCACGACGACGTCGACGAGGACGGCGGCG
T7_16158_G09	GGACGACGACGCAGCACGTCCAACGAAGAAGGCCGC
T7_16159_G09	AGAAGAAGAAGCCGCCGGTCCAGCCGCAGCACGACG
T7_16160_G09	AGGAGGAGGAACACCACGTCCAGCAGCCGCCGACGA
T7_16161_G09	GGACGACCACCACCACCGTCACCAGGAGGAGGAGGA
T7_16162_G09	GCGGCGACGACGACCCCGTCGCCGCAAAGAAGAAGA
T7_16163_G09	AGCAACAACCGCCGACCGTCACCGGCGGAGGAGAAG
T7_16164_G09	GACGACGCCGCAGCAAAGTCAAACGACGAGGCGCCG
T7_16165_G09	ACCACGACCAGGAGGACGTCGACGACGACGACGACG
T7_16166_G09	CCGCCGGCGGCGCAGCAGTCGAAAAAACAGCAGCAG
T7_16167_G09	GCGGCGACCGACGACACGTCAAAAGCAGCAGCGGCA
T7_16168_G09	GACGCCACCACCGACGAGTCCGACGAGGAGCAGAAG
T7_16169_G09	GCGACGACGACGGCGGCGTCAGCAGCAACAACAGCA
T7_16170_G09	GAGGAGGACCGCCGACAGTCACAACACGACGACGGC
T7_16171_G09	CGGCGGCGGCGACGACGGTCACGACGAACAACAACA
T7_16172_G09	CAGCAGCGACGACGACGGTCACGACGACGACGACGA
T7_16173_G09	GCACACAACGACGACGCGTCCGCAGCAGCAGGAGGA
T7_16174_G09	GCAGCACCACAACACGCGTCCGCAGGAGCAGGAGGA
T7_16175_G09	CGACGACGACACCACCAGTCGCAGCAGAGGACGAGG
T7_16176_G09	CGCCGCCGCCGCCGCGAGTCAGAAGAAGAAGAAGCA
T7_16177_G09	AGAACACCAACGGCCGCGTCCGCAGGAGGAGCAGCA
T7_16178_G09	GAAGAACAGCCGCCCACGTCCACCACGGAGGAGGAG
T7_16179_G09	CACCAGAAGAAGACGACGTCGGCGGCGGCACCAGCA
T7_16180_G09	CGACGACGACGGCGACGGTCACGACGACGACAAGCA
T7_16181_G09	AAGAAGAAGACGCAGCCGTCGGCGGCGGCACCACCA
T7_16182_G09	GGAGCAGCAGCAGCAGCGTCAGCACGACGCGACAAC
T7_16183_G09	GAGAAGACGAGGAAGCAGTCGCACCGCCGCAGCACC
T7_16184_G09	GCGACAGCAGCAGCAGAGTCAGAAGACGACGCCGCC
T7_16185_G09	GAGGAAGCAGCAGCCCCGTCCCAGCAAAGCAGCAGG
T7_16186_G09	AGAGGAGCAGCCGACGAGTCCGACGACGACCACGAC
T7_16187_G09	GAGGAGGAGGCAGCAGCGTCAGCACCACCGCAACAC
T7_16188_G09	AACGACCACCGCCGCGGGTCCGGCCGAAGAAGAAGA
T7_16189_G09	AACACCACCACCAGCGGGTCGGCGGCGAAGAAGGAC
T7_16190_G09	GGCCGCCGAGCAGCAACGTCACGGCGGCAACAAAGA
T7_16191_G09	CACCGCCGCCGCCGGCGGTCACGAAGAAGAAGAAGA
T7_16192_G09	CGGCGGCGACGACAACAGTCGCCGCAGCAGAAGAAC
T7_16193_G09	GAAGCAGCAGCAGCAGCGTCGACGACGACCACGACG
T7_16194_G09	AAGCAACAGCAGCAGCAGTCGCAGCAGCACCGCGGG
T7_16195_G09	CAGCAGCAGCAGACGACGTCGACGACGACGACGACG
T7_16196_G09	CGACAACAACAACAACAGTCGCGGCGGCGGCGGCGA
T7_16197_G09	AGCAGGGCGGCGGCCACGTCCACCACGACAAGAAGA
T7_16198_G09	AGCAGCAACGACGACGAGTCAGAAGACGCCGCCGCG
T7_16199_G09	AGCAGCCAACGACGACGGTCACGAGGAGCAGCCGCA
T7_16200_G09	GCACAGCGGCGGCGACGGTCACGACGACAACCAAGA
T7_16201_G09	CAACACGACGACGACGAGTCCGAAGACGACGGCGGC
T7_16202_G09	AGAGGAGGAGCAGCAGCGTCCGCCGCACCACCAAGA
T7_16203_G09	AACACCACCGACGACGAGTCCGGCGGAGCAGCAGGA
T7_16204_G09	GCCGCCGCCGCCGGGAAGTCGAAGAAGAACAACGAC
T7_16205_G09	GGAGGAGGAGACGACGAGTCCAACCACCACCCGACG
T7_16206_G09	CCACCGCAGAGAAGAAGGTCCAGCAGCAGCAGCGGC
T7_16207_G09	CGCGGCGGCGACAACAAGTCCAACACCAGGAGGACG
T7_16208_G09	CAAGAAGCACCGCCGCCGTCGCCACGAGGAGGAGAA
T7_16209_G09	GCGGCGGAGCAACAACAGTCACAGCAGCAGCAGCCG
T7_16210_G09	GAACCAGCCGGCGACGAGTCCAGCAGCAGCAGCAGA
T7_16211_G09	CACCACCAGAAGAAGAAGTCGAGCCGACGGCGGCGC
T7_16212_G09	GCCACACGACGCCGGCGGTCACGACGACGAAGAAGA
T7_16213_G09	AGGCGGCAGCAGCAGCAGTCGCAGCAGCAGCAACCA
T7_16214_G09	AGCAGCAGCAACAACGAGTCCGACGACGACGGCGGC
T7_16215_G09	AGAGAAGAAGACGACGGGTCCGGCGGCACCACCACC
T7_16216_G09	AGGAGGCGCAGGAAGACGTCCACCACCACCAGCAGG
T7_16217_G09	CCAACAGCCGCGGCAGCGTCAGAAGAGGACGACGAC
T7_16218_G09	AAGAAGGCGGCGACCACGTCCACGACGACGACGACG
T7_16219_G09	GCCGCAGCACCACCACCGTCACGAGGAGGAGAAGAG
T7_16220_G09	CGCCGCCGCCGCAGCAGGTCCGGAAGAAGAAGAAAC
T7_16221_G09	GGAGGACGACGACGACGGTCACCAACGACCACCAGG
T7_16222_G09	GCAGGAGCAGCAGCACCGTCAGCAGCAGCAGCAGCA
T7_16223_G09	GGAGCAGCAGCAGCACCGTCAGCCGGCAGCAGAACA
T7_16224_G09	AGAAGAAGACGAGCAGCGTCAGCAGCACCGCCGCCG
T7_16225_G09	CACCAGCCGCAGCAACAGTCCCAGCAGGAGGAGGAG
T7_16226_G09	GAGGAGGCCGCCGCAGCGTCAGCAGCAACAACAACG
T7_16227_G09	GACGACCAGCAGCAGCAGTCGCAGCAGCAGCAGCAG
T7_16228_G09	CACCCCGCGGCAACAAGGTCAACAGCAGGAGGAGGC
T7_16229_G09	AAGGACGACGACGACCGGTCCCGACGAGCAGCAGCA
T7_16230_G09	GACGACGACGACGACGAGTCCGACGACGCAGCAGCA
T7_16231_G09	GCAGCCGCGGCAGCAGCGTCAACAAAAAGACGGCCG
T7_16232_G09	GGCGGCCGCCGCGGCCGGTCCAACAAAACAAGAAGA
T7_16233_G09	GGCAGCCGGCCGACGCCGTCAAAAGAAGCAGCAGCA
T7_16234_G09	GCGACGACGACGACGACGTCGACGACGACAGCAGCA
T7_16235_G09	AAGAAGACGACGGCGGCGTCGGCGGCAACACCACCA
T7_16236_G09	CCGCAGCACAAGCAGCAGTCGCAGCAGCAGAAGCGG
T7_16237_G09	CACAACGACGACGACGGGTCAGGAAGACGCCGCCGA
T7_16238_G09	CAGCAGCCACCACCAGGGTCAGGAGGAGCAGCAGCA
T7_16239_G09	ACGACGACGACGCGACGGTCACGACGACGACGACGA
T7_16240_G09	GACGACGCGAGGCGGCGGTCCCGCCGCAACAAAAAA
T7_16241_G09	CCGCCGCAGCGGCGGCGGTCGAGAAGCAAAACAACA
T7_16242_G09	AGGAGGAGGCGACGACGGTCACGACACAACGCACCC
T7_16243_G09	GCCGCCAACCACCAGCAGTCGCAGCAGAGGAGGAGA
T7_16244_G09	CAGCCGCCGCGACGACGGTCACGACGAAGAAGACGA
T7_16245_G09	GACGACAGCAGCACCGAGTCCCAGCAGCAGCAGGAG
T7_16246_G09	GAGCACCGCGCCGCAGAGTCAGCAGCAGAAGCAGCA
T7_16247_G09	CCAACGGCGACAACAACGTCGGCGGCAGCAGCAGAG
T7_16248_G09	ACGACGGCGGCGGCGACGTCAAGAAGACGACCACCA
T7_16249_G09	ACGAAGAGGAGGAGGCCGTCAACAACAGCCGCCGCC
T7_16250_G09	GGACGGCGACGACGACGGTCCGGCAGAAACAACACC
T7_16251_G09	GCAGCAGCACCACCACGGTCAGGAGGAGCAGCAGCA
T7_16252_G09	ACGACGACGACGAAGCAGTCGCGCAGCAGCAGCAGC
T7_16253_G09	AGCACAACAACAGCACGGTCGCAGCAGCAGGCGGCG
T7_16254_G09	GGCGACCACCAACAAGAGTCGGAGGAGCCGACGACC
T7_16255_G09	CGCCGCCGACGAAGAACGTCAAGGACGACGACGACG
T7_16256_G09	CGACGCGGAGGAGGAGAGTCAGCAGCACCACCACCA
T7_16257_G09	GCGGGGCCGACGACGACGTCAACAAGCAGACGACCA
T7_16258_G09	CAGCAGCAGCACCACCAGTCCGAAGGAGGAGGCGAC
T7_16259_G09	GGCGGGCGGCGACGACAGTCCAACAACAACAGCAGC
T7_16260_G09	ACGACGACGACCACCAGGTCGAGGAGGACGACGACC
T7_16261_G09	AGCAGCGGCGGCGGCACGTCCAGCAGCACCAGAAAA
T7_16262_G09	CCACCACGAAGAGGAGGGTCAGGCCACCAGCAGCAG
T7_16263_G09	CAGCAGAAGACGGCAGAGTCAGAAGACGCCGCCGCC
T7_16264_G09	CGACGACCGGCGGGAGGGTCCAGCAGCAACAACAAC
T7_16265_G09	CGGCGGCGACGACGACGGTCACAACAGCGGCAACAA
T7_16266_G09	CCGCGCCGCCGACGAAGGTCAAAACAACGACGGAGG
T7_16267_G09	AGCACCAACAGAAGGAGGTCCAGCAGCAGCCGCCGG
T7_16268_G09	AGGAGAAGAAGAACCACGTCCACCACCGGCGGCGGC
T7_16269_G09	CGAGGAGAAGAGGAGGAGTCCAACAACCCCGCCGCC
T7_16270_G09	CGACGACGACGAAAAACGTCGACGACGACGGCGCCG
T7_16271_G09	AAGACGACGCCGCCACGGTCAGGAGGACGACACGAC
T7_16272_G09	CAGCACCACCGCGGCGGGTCCGACGAAGAAGAAGAC
T7_16273_G09	GCAGCAGGAGGAGGAACGTCCACCACCAGCAGCAGC
T7_16274_G09	GGCGACAACAACAACAAGTCCGACGACGCGGCGGCG
T7_16275_G09	GACGACCGCCGCCAGCAGTCGCAGCAGCAGAAGAAG
T7_16276_G09	CACGCCGACGACGACGAGTCCGACGAAGCAGGAGCA
T7_16277_G09	GAAGCAGCAGCAGCAGCGTCAGCACGCCGACGACGA
T7_16278_G09	GGCGGCGGAGACGACAGGTCCAGCACCAGCAACAAC
T7_16279_G09	CGCGGCGGCAGCAGCAGGTCCAGCAGCAGCAACAAA
T7_16280_G09	CGGCGGGGCCGCCGAGCGTCAACAACAACAAGAAGC
T7_16281_G09	GGCAGCCGCCGCCGAAGGTCAAGAAGCACCAGCAGA
T7_16282_G09	GGCGACGACGGCAGCAGGTCCAGCAGCAGCACCAAA
T7_16283_G09	CCGCCGCCGCCACCAGAGTCGGAAGAAGAAGGACGA
T7_16284_G09	CACCACCACCACGGGAAGTCGAAGAAGCAGCGGCGG
T7_16285_G09	CGACGACGACGACAAGGGTCAGGGACGACACCACCG
T7_16286_G09	CAACACCAACAACAGCGGTCGCGGCGAAGCAGGCGG
T7_16287_G09	GACGACGAAGAACACCGGTCCCGCCGACGAAGGAGC
T7_16288_G09	AGCAGCACCACGACGAAGTCGGACGCCGAGCAGCAG
T7_16289_G09	ACCACGACCACCACAACGTCGGCGGCGGAGGAGAAG
T7_16290_G09	GACGAGGAGGAGCAGAGGTCAGCAGCCACCACCACC
T7_16291_G09	CGACGACGACGAGGACGGTCACGACGACCAGCAGCA
T7_16292_G09	CGGCGGGCGACAACAACGTCAACAGCGACGACGACG
T7_16293_G09	GGGAACCAACAGCAGCAGTCGCAGCAGCAGCAGCCG
T7_16294_G09	CCACCAAGAGGACGACCGTCACGACGACGAGGAGGC
T7_16295_G09	CCGCCGCCGCAGCAGCAGTCGAAGAAGAAGAGCAGC
T7_16296_G09	AGAAGACCGACGACGGAGTCGGACCACCACCCGGAG
T7_16297_G09	GAAGCAGGAGGACGACCGTCACCACCGCCGACGAAG
T7_16298_G09	GGCCGCCGCGGCGGAGGGTCACGACAAACAACAACA
T7_16299_G09	AAACGACGACGACGAAAGTCCGGCGGCGCCGACGAC
T7_16300_G09	AGGAGCAGCAGCAGCAGGTCCAGCAGGACGACCACC
T7_16301_G09	GGCAGCAGCAGCAGCAGGTCCAGCACCACCAAGAGG
T7_16302_G09	CCCACCACCAGGAACAAGTCAAGAAGGCGGCGGCGG
T7_16303_G09	ACAACACGGCGGCGGCGGTCGCGGCAGAACAACAAC
T7_16304_G09	AAGAACAACAACCGCCGGTCCCGCCGGAGCAGGAGG
T7_16305_G09	CGGCAGCAGCACCAGCAGTCGCAGCAGCAGCAGAGA
T7_16306_G09	ACCAGCAGCAGCAGCAGGTCGAGCAACAGCAGCGGC
T7_16307_G09	ACCACCACCAGCAGCAGGTCCGAGGAGGAGGACGAC
T7_16308_G09	CGCGGCGAACAACAGCAGTCGCAGCAGCAGCGGCAA
T7_16309_G09	GACGAGCAGCAGAGGAGGTCGCAGCACCACCACGAC
T7_16310_G09	CAGCACCGGCGGCCAACGTCAACAACCAGGAGGAGG
T7_16311_G09	ACGAAGACGACCAGGAGGTCCAGCCCGCGACGACGA
T7_16312_G09	GCAGCAGCAGCAGCAGCGTCAGGAGACCACCAGCAG
T7_16313_G09	AGCACCGCCGACGACGAGTCCGAAGGACGACGACGA
T7_16314_G09	GAGGACGACGACGACGAGTCCGAAGCAGCAGCCCAC
T7_16315_G09	GACGCCGCGGCGACAACGTCAAGAACGACGACGACG
T7_16316_G09	AAGGAAGCGGCGGCGGAGTCGCACCACCACAACACG
T7_16317_G09	CGAGAAGACGACGGCGAGTCCCACCACGACGACGAG
T7_16318_G09	GACAACAGCGGGCGCCGGTCGCAGCAGCAGAACAAC
T7_16319_G09	CCACCGCCGCCGGCGACGTCGAGGAGAACAGAAGAA
T7_16320_G09	CAACAACGACGACGAAGGTCAAGAGGCGGCCGCCGC
T7_16321_G09	GCAGCGGCGGCAGCAGCGTCAGAAGAAGCACCACCA
T7_16322_G09	GGCGACGACGACCGCCAGTCGAAGAAGCAGCAGCAC
T7_16323_G09	CAAAAAACGGCGGCGGAGTCGCAGCAGCCGCAGCAC
T7_16324_G09	GACCACCACCGCCGAGGGTCAGGAGAAGCACAACGG
T7_16325_G09	ACGACGACGAAGGAGCCGTCGCCAGCAGCAGCAGCA
T7_16326_G09	ACGACGACGACGGCGGCGTCGACAGCAGCAGCAACA
T7_16327_G09	CGGCCGCAGCAGCAGCAGTCACAGCAGCAGCAGAAG
T7_16328_G09	CCGCCGACGACGACGACGTCGACAACAAGAAGGCGG
T7_16329_G09	CCCACCACAGCAGCAGCGTCAGCAGGAGGAGGACGA
T7_16330_G09	GGCGGGCGGCCGCCGCCGTCCGACGAAAAAAAAACA
T7_16331_G09	GGCGGCACAACAACGCAGTCGCAGCAGCAGCAGCAG
T7_16332_G09	CGCCGCCGCAGAAGAAGGTCAAGCAGCAGCAGCAGC
T7_16333_G09	AGGAGGAAAACCACCACGTCCACCGCAGGACGGCGG
T7_16334_G09	AGCAGCGGCGGCGGCAGGTCCAGCAACAACAACGAC
T7_16335_G09	AGCAGCAGCAGCAGACGGTCACGACGACGCCGACGA
T7_16336_G09	GCGGCGGCCGAGCAACAGTCACAAGAAGAAGCCGCC
T7_16337_G09	CACCACCGACGACGACGGTCACGAGGAGGAGCAGCA
T7_16338_G09	ACCACGACGCCGGCCGAGTCGGACGACGACGAAGAA
T7_16339_G09	CGGCGACGACAAGACGAGTCCGACGACGACGACGAC
T7_16340_G09	GCAGAAGCAGCGGCGGCGTCGACGACAACAACAGCC
T7_16341_G09	GACCAAAAAAGGAGACGGTCACGGCGCCGCGACGCC
T7_16342_G09	GCAGGAGCAGCAGAAGAGTCCGACGACGACCACCCG
T7_16343_G09	CCACCACACGACCAGCAGTCGAGGAGCAGCAGGAGG
T7_16344_G09	CAACAACGACGACGACCGTCGGCGGCAGAGGCAGCA
T7_16345_G09	GGGAGCAGCCGCCACCAGTCCAAGGAGCAACGACGA
T7_16346_G09	GAAGAAGCAGCCGCCGAGTCCGACGACGACGACGAC
T7_16347_G09	GACGACACGACGACGACGTCGACGACGACGACGCAG
T7_16348_G09	GAGGAGGAGGACGCCACGTCCACCAACGACGACGAC
T7_16349_G09	CCAGCAGCAGCGGCGACGTCGACGACACAACGAGGA
T7_16350_G09	GAAGAAGACGACAACCAGTCCCACGGCGGCGGCGAC
T7_16351_G09	GCAGCAGCAGCAGCAGGGTCAGGAGGACCACCACCA
T7_16352_G09	CAGGAGGAGCAGCAGCAGTCACAGCAGCAGCCCGAC
T7_16353_G09	CGACGACAACCACCACCGTCGGCGACGAAGGAGGAG
T7_16354_G09	CCACCAGCAGGAGGCGCGTCAGGAGCAACAACGAGC
T7_16355_G09	AGCAGCAGCAGCAGCAAGTCCAGCAGCAGGCCGACG
T7_16356_G09	GCAACAACGACGAGGAGGTCGACGACGACGGCCACC
T7_16357_G09	GGGCGCAGCACGACCAGGTCCAGCAGGACGACAACA
T7_16358_G09	GCAGCACCAGAAGAACAGTCACAGCCGGCGGCGACG
T7_16359_G09	CCACCACCACCAGCAGCGTCAGCAGAGGAGGAGGAG
T7_16360_G09	AGCAACAACACAACAGCGTCGGCCGCCGCGAGGAGG
T7_16361_G09	AACACCACCACGACGCGGTCGCGGAGAGGAGCAGCA
T7_16362_G09	CGAAGGAAGACCAGCCGGTCCAGCACCAGCAGCAGG
T7_16363_G09	GCGGCGGCCGCCGCCGCGTCAGCAAAAGAAAAAGAC
T7_16364_G09	GGGCGGAAGGAGGAGCAGTCCCACCGCCAACAACAC
T7_16365_G09	GACCACCGAAGAAGACCGTCAGCAGCCGCGGCGGAA
T7_16366_G09	CAGCAGCAGGAGCAGCAGTCGCGGACGCCGCAACAA
T7_16367_G09	CAGCAGGAGGCGGCGGAGTCGCAGCCACCACAACAA
T7_16368_G09	GACGACGACGACGAAGAGTCCGACGCCGCAGCAGCA
T7_16369_G09	CGCCCACACCGCCGACGGTCACGGGGAAGAAGAAGA
T7_16370_G09	CACCACAGCAGCGAGGAGTCGGACGACGACGACGAC
T7_16371_G09	GCGGGCGGCGACAACCAGTCCGACGACGACGAACAA
T7_16372_G09	ACGACGACGACGAGGAGGTCCAGGACGACGACCACC
T7_16373_G09	AGAAGAAGCAACAACCGGTCCCGCCGACGACGGCGG
T7_16374_G09	CAGCAGGAGGAGGAGGCGTCGGCACCACCACCAACA
T7_16375_G09	CACCACCCACAGCAGGGGTCAGCAGCAGCAGGAGGA
T7_16376_G09	AAGCAGCAGCCGCCACAGTCACAAGCAGGAGGCGGC
T7_16377_G09	ACCACGACGACAACCCCGTCGGCGCAGAAGAGGAGG
T7_16378_G09	AGAACGACGACGACGAGGTCCAAGACGACGCCGCCG
T7_16379_G09	CCACCACGGCGGCAGCAGTCGCAGCAGCAGAAGAAG
T7_16380_G09	GCGACGACGACGACGACGTCAACGACGACGACGACG
T7_16381_G09	AAGAAGACGACCACCACGTCCACCGCGGAGGAGGCG
T7_16382_G09	AGCACAGCAGCAGCCGAGTCCGACGACGACGACGAG
T7_16383_G09	CAACGACGACGCCGCAGGTCCAGCAGCAGCAGGAAG
T7_16384_G09	CACCGGCGGCGACGACGGTCACGACGACAGCAGAAA
T7_16385_G09	CGACAACACCACGACGAGTCCGACGACGCGGGAGGA
T7_16386_G09	ACGACGACGACGACGACGTCGAAGCAGCCGACGACG
T7_16387_G09	CACGCCACCAGCAGCAGGTCCAGGAGGAAGACGGCA
T7_16388_G09	CACGACGACGACGAGGCGTCGGCGCAGCAGAACAAC
T7_16389_G09	GAGCCGAACGACAGCAGGTCCAGCAGCAGCAGCAGC
T7_16390_G09	GCCGCCACCACAAAGAAGTCGAAGAAGGCGGCGGCC
T7_16391_G09	CGACGCCGCCGCCGACGGTCAGAAGAAGAAGCAGCA
T7_16392_G09	CGACGACGACGACGACGGTCACGACGCCGCAGAAGA
T7_16393_G09	CGCGGCGACGACCACAAGTCCAAGAAGGAGGCCGAC
T7_16394_G09	CGACGACGGCGAAGAAGGTCCAGCAGCAGCCGCCAA
T7_16395_G09	GCGCACCACCAGAAGCAGTCGGAGGCAGCAGCAGCA
T7_16396_G09	GGCGGAGCAGCGGCAACGTCAACAGCAGCAACCACG
T7_16397_G09	CCCACCAGCAGCAGCAGGTCCAGGCGACGAGAAGAG
T7_16398_G09	CGGCGGCGGCGGCAGCAGTCGCAGCAACAACACAAA
T7_16399_G09	GACGACGACGACGACGAGTCCGACAACAGCAGCGGC
T7_16400_G09	GGCGGCAGCAGCCGCCGGTCCCGCCGAAGAAAAAAA
T7_16401_G09	CCGCCGACCAAAGGAGAGTCCGACGGACGACCAGAG
T7_16402_G09	CCGGCGGCAAAAAGGACGTCGACGACGACAACCGGC
T7_16403_G09	GGGCCACACGACGACGAGTCCCACGAGAACACGAGG
T7_16404_G09	AGCACCGCGGACGACGGGTCAGCAACCAGGACGACA
T7_16405_G09	GCCGGAGAAGAGGAGGAGTCGAACACCACCACCGCC
T7_16406_G09	GCCCGCCGAACACGACGGTCAAGGAAGCGACGACGA
T7_16407_G09	ACAAGGAGGACGACGACGTCGACAAGCCGCCGCGCA
T7_16408_G09	GCCGCGACGCAGACGACGTCGAACGACAAGACGACG
T7_16409_G09	CAGCCGGAGCAGAGCAGGTCCAGCAGCGCAAGAACC
T7_16410_G09	GCCCGGAGCCCGCCCACGTCGAAGAAGAAGAAAGCG
T7_16411_G09	AGCAGCACCACCACGGGGTCAGCGACGACGACGGAA
T7_16412_G09	CCAGCGAAAAAGAACGGGTCCGGCCGCAGCAGCAGC
T7_16413_G09	CGGGGACAGGAGGAGACGTCCGCAGCACCACCACAA
T7_16414_G09	CGGCCGCGACAACAAGAGTCAGAGGAGACGCCACCG
T7_16415_G09	GAGGAGACCACCAGCAAGTCGCACGACGACGACGGC
T7_16416_G09	CAGCAGCACAAACCACCGTCAACGAGGGCGAGGCGG
T7_16417_G09	CGGCGGAAGAACCGGCGGTCACGAAGCACCACCAAG
T7_16418_G09	GCAGCAGAACGCGGAAGGTCACACAGCAGCAGCCGC
T7_16419_G09	CACAAGGAGCAGCGCCGGTCCAGGACGAACACGCAG
T7_16420_G09	AAAGGGCAGGAAGGCACGTCCCAGACGAGCACCCGC
T7_16421_G09	CGGCCCGCCACCCCGAAGTCGCGAGGAAGAAAAGAG
T7_16422_G09	AGCAGAACAGCACGACGGTCAAGCACGCAGCGGCCG
T7_16423_G09	AGGCCGGCGAGCAGCAAGTCCAACGACGACCGGAAC
T7_16424_G09	AGGACGACGAGGCGGCCGTCGCAGCAACAAGACACC
T7_16425_G09	GGCAAAACAACACCACCGTCAAGCGGCGGCGGGACG
T7_16426_G09	CCAACAAGACCGCGGCGGTCGACAGGCGGAGAAACC
T7_16427_G09	GCCCCGCAGGAACCGACGTCGACAGCAGAAGAGGAC
T7_16428_G09	CAGCAGCACGACGACCAGTCCGAGGAGGCCACAGGA
T7_16429_G09	AACAACGACGGCGGCGGGTCGAGCCACGACAACACG
T7_16430_G09	CAAGGCGCCACCACCAGGTCAGGAGAGGGGCACAAC
T7_16431_G09	CAGCCCAACGACGAAGAGTCACGCGACGGGGACGAC
T7_16432_G09	CCAACCAACGAACCGGCGTCGGCGGAGAGACGCAAG
T7_16433_G09	GCGGAGACGCGCCCACAGTCCAAACCGAGAGCAAGG
T7_16434_G09	GAGGACCACCAACAGCAGTCGAAGCCGCAGCGGCGA
T7_16435_G09	AGGCGGAGGACCACGAAGTCGACGACGAACCACGCC
T7_16436_G09	AGCGGCCAACAAGGAGCGTCAGCCGGAGCAACCACG
T7_16437_G09	GAGCAGCAAAAACAGCAGTCGCGACGCGGCGCCGCA
T7_16438_G09	GCGCGCAGGCGGCGACAGTCACAACAGGACAACACG
T7_16439_G09	AAACCACGAGCACCACGGTCAGGAGGCCGCGAGGAC
T7_16440_G09	GAGAAGAGGAGGACGCCGTCACCACCGGGACCACCA
T7_16441_G09	CCGCAGACGGCAGGAACGTCAACAGCACGAGGCCGA
T7_16442_G09	ACAACGACGCGAAGAACGTCAGGCGCCGCACGGCAG
T7_16443_G09	CCAGCGGGGAAGACGACGTCCAGAGAACACAGCCGC
T7_16444_G09	CAGAAAGACCACCAGGCGTCGGGAGGACCACCACGG
T7_16445_G09	CGGGGACCCGCCCAGCGGTCAGAACGAAGAAGAACC
T7_16446_G09	GGAGGCGCCGCAGCAGCGTCAGCACGCCAGCAAAAA
T7_16447_G09	AACCAGCAGGCAAGCAGGTCCAGAAGGCAGCCGCCG
T7_16448_G09	GACGAGCAGCAGCCCCAGTCGGAGACGGCACCAGAA
T7_16449_G09	GACGGAGCAGCCAAAGAGTCCGAGGCCGCACCACGA
T7_16450_G09	AAGAGGACCGAAGACGAGTCCCAGCCGCCGCGGCAA
T7_16451_G09	GACCGGCAAAAAAGACCGTCGAAGCGGGCACCGCCG
T7_16452_G09	CGAAGGAGGACACCGCAGTCCCGGCGACGACGACAA
T7_16453_G09	ACCACCACAAAGAAGGCGTCCGCCGCAGCGGAGGAG
T7_16454_G09	GCAGCACGCCGACGAAGGTCAAGGAAGCAGCAGCCC
T7_16455_G09	AAGCGGAGCAGGACACCGTCACCACCCGCGGAGGAA
T7_16456_G09	ACGCAAAAGGAGACGACGTCGCAGCCAACCGCGGCG
T7_16457_G09	CACGCCGCCGCGGCAAGGTCAGGGGCCGACAAAAAA
T7_16458_G09	CAGCACACCACCGAGAGGTCAAAGAAGCGGGCCGCG
T7_16459_G09	ACAACGGCGCCACGGGAGTCGCGGCAACAAGCACGA
T7_16460_G09	CGGCGGCCGGCAGCAGAGTCAAAGAGGACCACCACA
T7_16461_G09	AGGACCACCGCGCCGAAGTCGACAGCCAGACGAGGA
T7_16462_G09	GGGCGCCAAAAAGAAGCGTCAGCGGCGCCGACACCA
T7_16463_G09	AAAACCACCGAGGCAGCGTCAGCAACGACGGCGGCG
T7_16464_G09	GGAGGCGGAGAAACAGCGTCACCACCGCCGACGACA
T7_16465_G09	AAGAAGGAGCCGCCGACGTCCACCAGCAGAAGCGGC
T7_16466_G09	GGCCACCACCGGCAGAAGTCGAGCACCAGCAGGAAG
T7_16467_G09	GCACCAGGCGCCACAAAGTCAGAAGGCGGCGACGAC
T7_16468_G09	GAAGAAGAAGACAACCCGTCCCGCACCGAGGCGCGG
T7_16469_G09	GGCGGCGAAGAGCAGCAGTCACGACAACCACGACGC
T7_16470_G09	CGGACGACGACGCCAAGGTCGCGGCGGAACAACAAC
T7_16471_G09	CAACGACAGACAACCGCGTCCGGCGCCGGGAAGAAG
T7_16472_G09	ACCGGCGGACGAAGACGGTCGACCAACAACAGGGCC
T7_16473_G09	AGCAAGACGAGAGGGGCGTCCGCCGCAGCAACAACC
T7_16474_G09	AAAAAACAAGGACCGGCGTCGACGGGCAGCGCGCCC
T7_16475_G09	AAGCGCCGCCGGCGACGGTCAACGAACAAACGCAGG
T7_16476_G09	GCACAACAACAGCAGCCGTCGACGAGCGACGGGGAC
T7_16477_G09	CACCGCAGCGGACGACAGTCAGGAGGGAGCACAACC
T7_16478_G09	GGCCAAAAAACCAACGAGTCGGAGGGCCAGCCGCCG
T7_16479_G09	CCAGGGCGCGGCAGGACGTCGAAGACCACCAGACAA
T7_16480_G09	ACCACCACCACCGAGGAGTCGCAGCGAAGAAGCGGG
T7_16481_G09	GAGAGGCACACCAAGCAGTCCCGCCAAGAGCAGCGG
T7_16482_G09	GGGCAAAGCACGCAAGCGTCCAGCACCACCAGAGGG
T7_16483_G09	AGGAAGCACCACCAGCAGTCGGAGCAGCCACGGGCA
T7_16484_G09	CGGAGCAGGGCAGCAGAGTCAGCAGAACACCCCGAC
T7_16485_G09	GGAGGAGCCGCGCCCAAGTCCAAACGGCAACAGCAG
T7_16486_G09	AGAAGAAGACGCCGGGCGTCAGCACCGCCAACAGCG
T7_16487_G09	ACGACGGAGCGCAGCCGGTCCCACAACAAGAGGACG
T7_16488_G09	GGCGAGAAGAAAACCACGTCCCGCAGCAGGAGCGCC
T7_16489_G09	CCGCGGACAGCGGCGGCGTCAGAAGACGACAACAAC
T7_16490_G09	AGAGCCCACCAACACGAGTCCGGCGGAGGAAGCAGC
T7_16491_G09	CAGAACACCGCAGCAGGGTCCGCCGCCAAGAGAGGA
T7_16492_G09	AACAAGACGCCGAAGAAGTCGACGCAGCCGCCGGCG
T7_16493_G09	GGGAAACCAACCGACGAGTCCGACGGCGACACGACG
T7_16494_G09	CCACGAGGAACCAACAAGTCGACGGCAGCCAGCGGG
T7_16495_G09	CCCACGACGCACGACGAGTCGAAGGCGCGGCAAGAA
T7_16496_G09	CGGGGAAGAAAAACAGCGTCCACGACGCCGCAGCCG
T7_16497_G09	CAGCGGAGACCACCCAGGTCCAACAGGCAGGAAGGC
T7_16498_G09	AGGAGCCGACGCCACCCGTCGGCGACCAGAGAAGAA
T7_16499_G09	CGCGGACGACACCGCGAGTCGGCAAAAACAACGCGG
T7_16500_G09	GAAGAAGAACCACCACCGTCGCGACGGAGGGCCGAC
T7_16501_G09	GCGACGACCACCCCGCAGTCGGAAGAAGAAAGGGCC
T7_16502_G09	CAAGGAGGGAGGGCGGCGTCCACCACAACGAACCAC
T7_16503_G09	GCGGCGAAGGACCGGAAGTCAAACAGCCCCGCCGAA
T7_16504_G09	GGCAGACGAGCAGCAGCGTCAGGACAGCAGAACCCC
T7_16505_G09	GGACGACGCAGCGCCACGTCGAGCAAGAACGACGAC
T7_16506_G09	GAGCAGAGCACCAGCAGGTCCAACGCCGCAACGAGG
T7_16507_G09	ACCAACCAGAGGCCAGCGTCCGCACGAGGCAGAGGA
T7_16508_G09	GCGCCGACCAGAGGCAGGTCCACCAGACGACGAAGA
T7_16509_G09	AGAAGGAACGGCGACCAGTCCCACAAAGGGCGCGCC
T7_16510_G09	GCGGAAGACAACGCCGGGTCCAGCACGAGACAGCCA
T7_16511_G09	GCGACAACGAAGCAGAGGTCAGCCGCCACAGCCGGA
T7_16512_G09	GGCAGAACCCACGACCCGTCGAGAACGGGGCGACAA
T7_16513_G09	GGCCGCCACCACCACAAGTCGAACAGGAGAGGCGGA
T7_16514_G09	CAGGAGGGCGACAGCACGTCCGCAGCAGCAGAACCA
T7_16515_G09	GACGACGCAGCAGCAACGTCAACGCCCGGCGAAGAG
T7_16516_G09	ACCCCGCCAGCGCAGCAGTCGCGAGGAAGAGCAGAA
T7_16517_G09	GAAGAACGAGGAGCGGCGTCCGACCCACGGAACCAC
T7_16518_G09	CCCGGCGCCAACAACGAGTCGAAGACGGAGCAGCAG
T7_16519_G09	ACGGCCGACAAAGCGGCGTCCCAACCAAGGAGGCAG
T7_16520_G09	ACAACGCCGACGACGAGGTCGAAGGGGCGCACCACA
T7_16521_G09	GGCAGGGAGGAGACCACGTCGACCCACGACGACAAC
T7_16522_G09	GGGCGCCAGAACAACGGGTCCGGAGCAACCACAAGC
T7_16523_G09	AGAAGACGACACCCACAGTCACGGGGCGGACCCGAG
T7_16524_G09	CGCCGCCGAAAAGACCCGTCACCGCAGGAGGAGGAA
T7_16525_G09	GCACGCCGAAGGCAGCAGTCGCAGCAGAAGAACCGC
T7_16526_G09	ACCGCGGCGGCGGCGAGGTCGAACAAAACAAGCACC
T7_16527_G09	GAAGAACCCAGCACCCAGTCGCAGAGGCGGCGCAGA
T7_16528_G09	GGCAAAGACGCCGGCGGGTCCAAACCACGCCGAAGA
T7_16529_G09	GGCGCCGCACCACAACAGTCAGGAGCCGGAGACGAA
T7_16530_G09	GACAGCACCACCGCGCCGTCGCCGGAAGGAGAAGAA
T7_16531_G09	ACCACGAACGGCGGGACGTCGACCAGCAGGGACAAC
T7_16532_G09	CAGCCGCCAAACAGCACGTCCACGGCGGAGAGGAAG
T7_16533_G09	CGCCGAAGAGGGCGGACGTCAACAACCACCGAAGCG
T7_16534_G09	CAAGAAAAAACCGCAGCGTCCACCCGCGGGAGGCGG
T7_16535_G09	GCAGCGGGCAAGACCCCGTCACGGGGACAAAGACCA
T7_16536_G09	CGAGGAGGAACGACGACGTCGACCACAGCACCGACG
T7_16537_G09	GCCGGCGCGCCCAACAAGTCGAAAAGGAGCCGCAGA
T7_16538_G09	AGAGGACGAACAACCCCGTCCCCGGCAGAAGGGGAC
T7_16539_G09	AGCAGAAGAAAACCAGCGTCGAGGACGCCGGCCGCC
T7_16540_G09	GGGACGACGACGACGCCGTCGCCAAGAACAACGACG
T7_16541_G09	CACGAGGACGACGCGGCGTCACAAGAAGAAGCCGCC
T7_16542_G09	CAACAACAACACCACCGGTCCGGAGGGAGGCGACGG
T7_16543_G09	GAAACCCGGCCGCCGCCGTCGCGAAGAACAAGAAGG
T7_16544_G09	CGGAGGACAGCAGACCAGTCCCACCACCGGAGGAAG
T7_16545_G09	ACGGCGGACGCCAACAAGTCGGAGGGAACCACGCCA
T7_16546_G09	ACCGCCGCCGCGGGAGCGTCAGCGGCCAAGAAAAAA
T7_16547_G09	AAAGCGCCGACGCCGCCGTCGGCAGAAGACGCAAGA
T7_16548_G09	CAACAACGCAAGAGCCGGTCCGACGAAGAGCGGCCG
T7_16549_G09	AACAGGAGCACCACGACGTCGGCCGCCGGCGAGAAA
T7_16550_G09	AACGCGGCAGCCGGACGGTCACGACGAACAAGCAGC
T7_16551_G09	ACCAGAAGCAGAGGAAGGTCAAGCGCCCGCAGCGCC
T7_16552_G09	CCCAGCAGAGGAGCGAAGTCCAACCACCAGAGGGGC
T7_16553_G09	GAAGGAAGCAACCCGCCGTCGCAGAAGAAGCGGCCC
T7_16554_G09	GGGGCCGCAGCAGCCCAGTCGCAACAAGAACCAAGG
T7_16555_G09	CAACAGCAACGACAGGCGTCGGCCGCGGAAGCCGAA
T7_16556_G09	CAACGACGACGGCGGCGGTCCGAGCAGCAACAACAG
T7_16557_G09	ACAGCACCGACCGGCGCGTCCGACGAGGGAAGAACA
T7_16558_G09	CGGCGGAGAGCACGACGGTCAAGAAGAGCCCACCAC
T7_16559_G09	GACCGCCGGGAGGACGCGTCGAACAACCAAACGACG
T7_16560_G09	CGCGGAGGAGGAAGACGGTCACCGAGCACCACCAAC
T7_16561_G09	CGACCCGCCGCGCCACAGTCAAGAAGCAGGAGGAGA
T7_16562_G09	GGGGAGCGACGACGACGGTCGCACCACCACGAACAA
T7_16563_G09	ACCAGAAGAAACCGCCGGTCGCGAGGACAACGGCGC
T7_16564_G09	AGGGGAACAAGAGGCAGGTCCAGCAGCACCACCGCC
T7_16565_G09	AGGAGCCACCCGACGACGTCGAAAACGACGACGCGG
T7_16566_G09	ACAACAGCAGCGAAGAAGTCGGACGCCGCCGCGGCA
T7_16567_G09	AGAGGCGGCAGCAGCACGTCCGGCAGAACAGCACAC
T7_16568_G09	CAGCAGGCAGCAGCGACGTCGAAACAGCGCCGCAAG
T7_16569_G09	GAGCAGCAGAGGCCACCGTCACGACGAGGCCACAAG
T7_16570_G09	AGCGGCGACGACGCCACGTCCAGCAGAGGAACAACG
T7_16571_G09	AAGACGCACGCAGCGACGTCAAGAGGCGGCGCCACA
T7_16572_G09	CCGGCGACGACGACGACGTCAAAAGCAGCAGCAGCG
T7_16573_G09	GACGGGCAGAGCAGCGCGTCCACGAGGACAACAACC
T7_16574_G09	CAAAGAGGGGCCGCCCAGTCCGACCACAGAGAGCAG
T7_16575_G09	GAAGCAGCACCCACCGCGTCGACGAGAGGAGCAGAC
T7_16576_G09	GCCCGCCGACGCACCGCGTCGGCGGAGAGAAAAAAA
T7_16577_G09	CGCCAGAAGAAGGCACCGTCAGCAAACCGGCGGGAC
T7_16578_G09	ACCAGCGAGCAGCGGCGGTCAAGAGGACGACCCAAC
T7_16579_G09	CAGCCACGGCAGGCCGAGTCAGGAAGAACCACGACG
T7_16580_G09	CCCGCCGCAGCAGAAAAGTCCAACGGAAGACGGCGG
T7_16581_G09	AAGGAGGAAGACCGGCAGTCGCAGCCACCAGCACCG
T7_16582_G09	GAGGGCGACCACCAGCAGTCACGCCAGCAGGACGAA
T7_16583_G09	GGGGCCCAACACAACAAGTCGGCGGCGGCGACAACA
T7_16584_G09	CCACCAAGAGGAGCGGAGTCGGAGCAACCAACGCCG
T7_16585_G09	GACAACAAGGAGGAGGAGTCGCCGACCCACGCAGCC
T7_16586_G09	CCGCGCCCAACAGAAGAGTCAGGACAGCAGCGGCGA
T7_16587_G09	CAAAGCCACCGGCAGGGGTCCGAACGAGCAGCAGCA
T7_16588_G09	AGCAAGCAGCGACGACGGTCAAGAGCGACGCCGCCA
T7_16589_G09	CAGAGGCGGAACAAGCCGTCCCGCGGCGACCAGAAA
T7_16590_G09	CACCGAGGAAGCCGCGGGTCCGCAAGGACGACAACA
T7_16591_G09	GAGCAGGCGGCGGCAACGTCCACCACGAAGACAACG
T7_16592_G09	CAACGGCGGGGCAGCACGTCAACAACAGCGCCGAGA
T7_16593_G09	AAGAGGGCGGCGACGAAGTCGAACACGCCGCACCCA
T7_16594_G09	AAACAACAGCACACAGCGTCGGCGGCCGACGGGACG
T7_16595_G09	AACCAGAACAACACCAGGTCGAGGCGCCGGAGGCCG
T7_16596_G09	CACCGGCAGCAGCAGGAGTCGAACACCAAGGCCGGA
T7_16597_G09	GGAGACGACGAAGCCGGGTCCGAAGCCAGACCACCA
T7_16598_G09	GCAGCGGCGCCGCCGACGTCCACGAAGAGAAACAAG
T7_16599_G09	CCGCAACAGCAGCAGGAGTCCGGAGAAAGCAGCCGC
T7_16600_G09	AGGAGCAGAGGACCAACGTCAAACCGGACGCCCGGC
T7_16601_G09	GGCGGAGGGAAGCAACCGTCCGCCACCAACGACGAA
T7_16602_G09	AGAGGAGGAAGCCGCGGGTCACGACCACGAACACCC
T7_16603_G09	GCGGAAAGAAGAGCAGCGTCCCCACGCCACAACGGG
T7_16604_G09	GGAGCAGCAAGACGAGAGTCGGCCGCCACCCAGCAA
T7_16605_G09	GCCGCAACAACCCGAGGGTCAGGAGCAGCAGCCAAG
T7_16606_G09	CACGACGGCGACAACAGGTCCAGGAAGCGGAGCCAC
T7_16607_G09	ACGGCGGCGGAGGCAACGTCCAACAACAACAGCGGC
T7_16608_G09	CGCAGAAACACCGCGAAGTCCGGCAGCAGGAGCAGC
T7_16609_G09	AAGGCGGCGGCGACAGCGTCAACAACAACGACGCCG
T7_16610_G09	CGCCAGCCGCGCGGCGGGTCACCACAAGAAGAAAAG
T7_16611_G09	GAGGGGAGCAGACGCGCGTCCGCCAAAGCAACAACC
T7_16612_G09	GACGACGCAGCCGACACGTCGACGAGAAAACCGGGC
T7_16613_G09	CACCCACGACGAAGGAGGTCCAACAGCGGCAGGACG
T7_16614_G09	ACAGAACACCACCCAAGGTCAGGCGCAGGACGGCGG
T7_16615_G09	GCAGCGCCCCAGCAGGAGTCGGAAGCCGACGAAAAC
T7_16616_G09	CCAAACACCGGCCAACGGTCACGGGGAGGAGCAGCA
T7_16617_G09	GACGACAACAGCAGAAGGTCACGCGGCACACCGGGC
T7_16618_G09	CGCCAGGGGAAGAAAAAGTCAACGCCGCAGCCGCGC
T7_16619_G09	CAGAAGGAGACCACAAAGTCACCCCGGAGGGGCCGC
T7_16620_G09	GCCACCGCCGAGAACAGGTCACGACGAAGAGGACGC
T7_16621_G09	CCGGCGGCGGAGCAGCAGTCCCACAACAAGAGGAAC
T7_16622_G09	GCCGCCAGGCGGGCAAGGTCAACAGAAGCCAGCAAC
T7_16623_G09	AGAAGAAGAAGCGACCCGTCCGCCCACGAGGCGACG
T7_16624_G09	ACAACAACAGAAGGCCGGTCACGAGGACGCCGCCGG
T7_16625_G09	CGGCAAACACAACAGAAGTCGAAGGGCCCCGGGGCC
T7_16626_G09	GAGCAGGCGCCGCGGCGGTCACGACGACAACAACAA
T7_16627_G09	GCCGCCGACAAAACGACGTCGGCACGAAGAGGCAGC
T7_16628_G09	AGACCGGGAAGACGAAGGTCCACCAACCGCCAGCGG
T7_16629_G09	ACCAGAAAGAAGGAGGCGTCCACCGCCACCGGGACG
T7_16630_G09	CGGCCACCACGGGAGGCGTCGAACAAAACACGGGAC
T7_16631_G09	GAAACGGCGACCACACCGTCGCAGGACGACGAGCGA
T7_16632_G09	CAACCCGAGGAGAACAAGTCCAAAGCGGCCGCGCGG
T7_16633_G09	AGCACCGACCGCCGCAGGTCAACAAGAGGCGGAGAC
T7_16634_G09	CACAGCAACACAAAACGGTCGCGGCGGGGCAGCGAC
T7_16635_G09	ACAAGAAACCACAGCAGGTCGCGGCGGCCGGACAGC
T7_16636_G09	CGCCCCGCAGGAGGACGGTCAACAAGAGCAGCACAG
T7_16637_G09	ACAAGACGGCGGCCGGCGTCGGACGACCGCAACAAA
T7_16638_G09	GAAGGCCCGCAGCACAGGTCACAGCAGCAGAGGACC
T7_16639_G09	AAGACCGGAACACGGGAGTCCGAGGCCCCAGCAGAC
T7_16640_G09	AGCACCAGCGGAGGCGCGTCCACAACAACGGCAAGG
T7_16641_G09	GACGCCACCAGCCGACGGTCAGGAGGACGACAACAG
T7_16642_G09	CCGGCAGGACCACAACGGTCACGAAGACGCAAGGCG
T7_16643_G09	AAGAACCAGCCAGCCGGGTCAGGAGAACAGGCCGCC
T7_16644_G09	ACCGACGGCAGCGACGAGTCCGCAGCAGCAGAAGCA
T7_16645_G09	ACCGGCGAGCAGCGGAGGTCCAGAAGAAGCCCCACA
T7_16646_G09	CAACAGAGGAGGAGGCGGTCGCCCAACCAGCCACGA
T7_16647_G09	GAACCAGACGCGCGCAGGTCCACAACAGCAGGGAGC
T7_16648_G09	CACCGCCGCGAGGAGGAGTCGAAGCAGCACAACGAC
T7_16649_G09	GCAGCACCACAGAGCAGGTCAAGACGAGACCGGCGC
T7_16650_G09	GAGGGGCCGCCCAGGAGGTCGAACAAGACCACAACC
T7_16651_G09	GCCGCCGCCGACAACAAGTCAGCGGAAGACGGCAGA
T7_16652_G09	GAGGACGACGACACAAGGTCCAGCACCGCCGGCAAG
T7_16653_G09	CCGCGAGAAGACGGGCGGTCACAACAGCAGGACCAC
T7_16654_G09	CAACAACACAAAACGGCGTCGGCACCGCGGCGGGAG
T7_16655_G09	CGACCAGCAGGAGGAAGGTCAAGGCGGCCCACACCA
T7_16656_G09	GCAGGAGCCACCCACGGGTCAGGAGGAGCACAACCA
T7_16657_G09	ACACCACCGCGGCGAAGGTCGCGACGAAGGAACAGC
T7_16658_G09	GGAGCAAGACGACGGCAGTCGCACCGCAGAACCACG
T7_16659_G09	GGACCACCAACAAGGAGGTCGAGCAACGACGCCGCG
T7_16660_G09	AACCACGAGCGGCAACAGTCCCAGCAGCGGCGGGAA
T7_16661_G09	GGGCAGCAGCAAAACAGGTCCACGCCAGGAGCAGCC
T7_16662_G09	GGAAGAAGAACCGCAACGTCGACCGCCCAGCGCGAG
T7_16663_G09	GACGCCGCCGAGCAACAGTCGCAGGACCAACAAGGG
T7_16664_G09	GGACGACGAAGAACCGCGTCCGCCGACGGACAACAG
T7_16665_G09	CGGACGAAGGACCACCGGTCACACCCCAGGAGGGAA
T7_16666_G09	CCGCAAAACGGCGGAGGGTCCGGCAGCAGCACCAAA
T7_16667_G09	GGCGAGGAAAGCACCAGGTCAAGACCCCGCCAGACG
T7_16668_G09	GGGGAGGGCCACAAGGCGTCGACCAGCCCACAACAA
T7_16669_G09	CCCGCGGCGGAGGCGACGTCAAGGAACCACCAAAAG
T7_16670_G09	AGCAGCCGACGACCGGCGTCGGCGACAAGAAAACCG
T7_16671_G09	GACGCGGAACAACGGCGGTCGCAGGCAGCAACACCA
T7_16672_G09	ACGGGCCGCAACGAACAGTCAGAGGCACCGCAGCAG
T7_16673_G09	GCCGCACCAAGAAGCGAGTCCGAGCGCAGAAGACCG
T7_16674_G09	GGACGCCGGCGAAGAACGTCCACAGCCACCGAAGAG
T7_16675_G09	GACGGCCGCCAGCAGGAGTCCGCGGAGAACAACAAC
T7_16676_G09	GCCCCGGCCGAAGAACAGTCGGAAAGAGCACCAGCG
T7_16677_G09	ACGAGGAGGGCGCAACAGTCACAGCACGGCGCACCA
T7_16678_G09	GAAGCAGCGCGGCAGCGGTCAAGACCAAAACGCCGC
T7_16679_G09	ACAACAGCCGCCGCCGGGTCAGGCGGAACAAGACGA
T7_16680_G09	CGGCGGCCGACAGCCGCGTCGGCCAACAAGAAGAAA
T7_16681_G09	CACAACAGCCGCCGAAGGTCACGAGGGAGGGCACCA
T7_16682_G09	GCACCGAGGCGGCGGCAGTCGGCAGACAACAAACCA
T7_16683_G09	GCCCCACGAAGAGAAGCGTCAGCAACAGGAGCGCCG
T7_16684_G09	GAGAGAAGACACCACGCGTCCCGAAGCAACGGCGGC
T7_16685_G09	GGAGCAGCCGCGGCGACGTCAACAACAACCAGACGG
T7_16686_G09	GCAGCAGCAAAACCACCGTCGGCGAAGCAGCAGCGG
T7_16687_G09	GCAGACGGAGGAGGAAGGTCACAACGCCACCGCACC
T7_16688_G09	GCCGCCGGGGCGAGGAGGTCCAAAACAACACCACGA
T7_16689_G09	CCCACCGACAAAGGCGGGTCAGGAGAACAGCGACGC
T7_16690_G09	CGACGGCGACGACAGGAGTCAGCGACGACGACACCA
T7_16691_G09	CAACACCAGCAGCAGCCGTCCGCGAAGCGGAGGAGA
T7_16692_G09	GCCGCCACGCAAAAAAAGTCAAGCGGCGGCCGGCAG
T7_16693_G09	ACAACAGGGAGGAAGCCGTCCCACCGGCGGCAGAAC
T7_16694_G09	CCAGCCGCCCGCAGCAGGTCGAGCAGAAGACAAGAG
T7_16695_G09	CCGGCGGACGACGAAAAGTCAAAGACGCCGCGGCAC
T7_16696_G09	CACCCAAGACAACACCGGTCGCGAAGGGCGGCGAAG
T7_16697_G09	CGAAGGACGCCCCAGCAGTCGAGGAGCACAGGACCA
T7_16698_G09	CGGGGCGGCGCAGGCCAGTCCAACGAAAAAACCCGA
T7_16699_G09	GCAGCCGACAAGGCGGCGTCGACGACCAGACAAGAC
T7_16700_G09	ACAAAAAACCAGAGGGCGTCGGAGCAGCCGCCGCCG
T7_16701_G09	CCGACGCACCACGAGCAGTCGAAGAAGGACGACGCG
T7_16702_G09	CGGGGCGGCGACGAAGAGTCCACCACAACAACGACG
T7_16703_G09	CAGCGACGAGGCGGCAGGTCCCCACCACAAAAGGAG
T7_16704_G09	CGGCAGGACCACGGAGCGTCAACCACCAAGAGGAGC
T7_16705_G09	GGCAGCAGCAGCAGCGAGTCCGCACAAACAACGGCG
T7_16706_G09	ACCGACGCCGGAGGGACGTCGGCGACAACAGCACAA
T7_16707_G09	GGGCGGGAAGAGCACGCGTCGACAACAAGCCACCAC
T7_16708_G09	AGGCAGGGCGCCGAACAGTCACGGACGAACACGACC
T7_16709_G09	GAACGAGGAGCAGCAGGGTCCGGCCGCCACAACACA
T7_16710_G09	AACAAAGACGGACGCCCGTCGGACAACGGCGGAGCC
T7_16711_G09	GAAAGCAGCAACACGACGTCGGCGGACGGCCACAGC
T7_16712_G09	CGACGACAAGACGACGCGTCGACGACGACCAGGCGA
T7_16713_G09	AAAGGCGGACGACGACAGTCCGCAACGGCGACGACC
T7_16714_G09	GGAAGACCCGCAACGACGTCCACCGCAGGAAAGGCG
T7_16715_G09	CGCAGGAAACCGCGAGGGTCGGACCACAACAGCAGC
T7_16716_G09	ACGACCCCACCACGACGGTCGCGGAGGACGAAGAAG
T7_16717_G09	CAACAAGAAGCAGGAAGGTCCCGCCGCCGCGGAGCA
T7_16718_G09	GGGGAGGGGCCGCCGGAGTCAACAAAACCACACCAC
T7_16719_G09	CCGCCCCGCGGCGAAGGGTCAAGAGCACCAGAAGAA
T7_16720_G09	CCGCGGACCGACGACGAGTCCGACGCCGAAGAAGAA
T7_16721_G09	GCCGCCGCAGCAGACGAGTCCGAAGAACAAGCAGGC
T7_16722_G09	GGCGGCACCCCGGGGAAGTCAAAAAACAGCGCCGAC
T7_16723_G09	CAAGCAGACCAGGAGAAGTCGCGCGAGCCACCAGGC
T7_16724_G09	CACCGGCGAGGCAGAAGGTCACCAACGAGCGCAGCA
T7_16725_G09	ACGAAGGAAGACGGCGAGTCCGACGCACCCCGACGA
T7_16726_G09	GCAGCACCAACGAGCAGGTCACGGAGGGCCAGCAAC
T7_16727_G09	CGACACGGCAACGGAGGGTCAAGACCACCGCAGCAG
T7_16728_G09	CCCACCAAGAAGGGGCAGTCACACGAGAGGCGGACC
T7_16729_G09	CGAGCCGCCAGGAAGGAGTCGAAGCACGGCCACCAA
T7_16730_G09	AGCAGACAGCCGGCGACGTCGCCGGAGAAGAACCAC
T7_16731_G09	GCGGCGGAAGACGCACAGTCCAACCAGGCGCCAAGA
T7_16732_G09	CAGCACGCCGAAGAAAGGTCGCGGACGAACCGCAGC
T7_16733_G09	CGGCAGCCGAGCAGGGAGTCACAAACAACGCAGCGC
T7_16734_G09	CAACAGCGCCGGCACCGGTCCAGCGGGAGCAGAAAA
T7_16735_G09	CAGACAACAAGACGCGGGTCCGACGACCGACCAGGG
T7_16736_G09	CGCGGCGGAAGAAACGCGTCCGCCGAACACAAGCGA
T7_16737_G09	CCACAAAGAACCCGCGAGTCGGAGGAGCAGCCGCAG
T7_16738_G09	GCCGACGGAGGAGGAGGGTCACAACACCACCACCAG
T7_16739_G09	GAGAAGAACGAGGACGGGTCCACCGCACCCACGACG
T7_16740_G09	GCAAAAAGAACAGGCGAGTCGCCGCGCGCCAGCACG
T7_16741_G09	AACAACAGCACCCAGGAGTCCGGAGCGGGCGCCGAA
T7_16742_G09	GGAACGGCAGGCCAACAGTCCCACACCACGAGGAGG
T7_16743_G09	GACGACAACAGCCCACGGTCAGCCGAAGACGGAGGC
T7_16744_G09	ACGCCAGAAGACGGGCCGTCGAAGAACAGCGACGCC
T7_16745_G09	GAAAACAACAGCGGCGGGTCCGGCAGCAGCAGCACC
T7_16746_G09	CCACCGGCGAAGAAGGCGTCCCACCAGCAGGAAGGA
T7_16747_G09	GCAGGAAGCGAACCAGCGTCAGAAGAAGCCCCGCCG
T7_16748_G09	AACAACAACAGCGAGGGGTCCGCCACCCGACGGAGG
T7_16749_G09	GCAGCAGGAGGGGACCCGTCCCCAGCAACAGCAGAA
T7_16750_G09	CGGAGGAGCAACAAAGAGTCGGCCCCGCCGCGACAA
T7_16751_G09	GCGGAGGAGCACCCGCGGTCCCGCAGCAGCAAAAAA
T7_16752_G09	GCCACGACGGAACAAGAGTCCCAGCAGGCCGACGAG
T7_16753_G09	CGACGAGGGCGAGGAAGGTCAACCAGCCGACACCCA
T7_16754_G09	GAGAACCAGCACCACCGGTCACGACGGCAGGAGACG
T7_16755_G09	CCGACGCCGGACCGCCAGTCGCAGCAGGAAAGAGAA
T7_16756_G09	AGCAGCACGACGCCCAGGTCAAGGAGCAGCAGCCGA
T7_16757_G09	GGAAAAAAGGAGCGCCGGTCCCGCAGCAGCACCACG
T7_16758_G09	GGCGCGAAGCCGCCGCAGTCAACAACCGACGAGGAA
T7_16759_G09	CCGCAGGAAAAAACCGCGTCCGCGGCAGACGACAGG
T7_16760_G09	ACGACGCAGCAGCGGCGGTCACAAGCAGCAACGACG
T7_16761_G09	GAGGAAGCCACCACGAAGTCACGGCAGCACCGGCAG
T7_16762_G09	CAGAACAGCAGGCAGCCGTCGCGCCGCCAGAAGAAG
T7_16763_G09	GCCAGCCGACGACAACAGTCACCAGGAGGACGAGGC
T7_16764_G09	ACGAAGACACCACGCCGGTCGCACCAAGGGAACGGG
T7_16765_G09	CGAGAGGAGGCGACGCAGTCCCAACGACGCCCAAGA
T7_16766_G09	ACAAGAAGGAGGCGACGGTCCCGCCGACACCCAGGA
T7_16767_G09	GAGGAACACACCCCGCCGTCGCCGAAGCAGAAGGAG
T7_16768_G09	ACCGCCGGGCAAGAGCAGTCAAGACGGGCGACAACC
T7_16769_G09	AAGAGCCGCCGCCGCCGGTCGCCACGGAGAAGAAAA
T7_16770_G09	AGCAGCACAAAAAAGCCGTCGCGGCGGCGCCAGGCA
T7_16771_G09	CCGCGAAGAAGAACGGCGTCCGCCGACGACGAAGAC
T7_16772_G09	ACACGACGAACAGCCGCGTCGAGCAGCAGCCGGGAA
T7_16773_G09	CGGGGCCGCCACCGACGGTCACGACGAGAACAAAAG
T7_16774_G09	CCAGCGGCAGGCAGCCAGTCGCACAAAGCAGGAGCA
T7_16775_G09	AACCACCACGAAAACGAGTCCGCGGCGGAGAGCGGC
T7_16776_G09	ACGACGAGGAGGGAGAAGTCCGCCAGCAGCACCACC
T7_16777_G09	ACCACCAGCGACACCAAGTCCGACGAGGAGGAGGCG
T7_16778_G09	CGCCGACCAGCACGACCGTCCGAGGAGAAGAAGAGC
T7_16779_G09	CAGCAGGAGAACCCAAAGTCGACGGCGCGGACGCCA
T7_16780_G09	CGGAGAGCGGCAAGCCGGTCCACCCAAAGAAGGACC
T7_16781_G09	CCGGCACCACGACAAGAGTCAGAACGAGGGGACGCC
T7_16782_G09	AACCGGAGCACCCAGACGTCGACAGCGGCGGCAGAA
T7_16783_G09	GCACGAGGAGCAGCACAGTCACGCCGACGACGACGA
T7_16784_G09	CACACCAAGAGAAGCCGGTCCGCAGGAGCCGCGGAA
T7_16785_G09	GCAACAAGGAGCAGAAGGTCCCCACGGCGGCGCAAC
T7_16786_G09	AGAAAAAAAAGGCCCGGGTCCCGCCCGGGCGCAGCA
T7_16787_G09	CAACGACGAAGGACCGAGTCCGACGCCCGCAGAGGA
T7_16788_G09	CGCCAGAAGACCACCAGGTCCACCAGGAGGCAGGAG
T7_16789_G09	CGCCGGCCACCAAGCAGGTCAGGAGGACGAACAACG
T7_16790_G09	AAGAAGACGGCGGAAAGGTCCCGCCCGCACCCGAAG
T7_16791_G09	AGGCCGCCGGCCGCAGAGTCCAGCGACAAAAAGGCA
T7_16792_G09	AGCGGCGGCAGGAGCACGTCCCAGCAGCAACAACGA
T7_16793_G09	GCAGCGACAACGACCACGTCCGCGGCGAGAAGCAGA
T7_16794_G09	CGGGACGACGACGACCGGTCGCAGACCAAGACACGA
T7_16795_G09	AAAAACCGCCGCCGCCAGTCCGGGGAAGACAGGACG
T7_16796_G09	GGAGGCAGCACCAACAGGTCCGCCAAGACCAGCAGG
T7_16797_G09	CAAGACGGCAGGCCACCGTCGGGGACAGCAAGAACC
T7_16798_G09	CCAAGAAGGGCCGGCAAGTCAGCACGCCACGAGGAC
T7_16799_G09	ACAGCGGCGCGAAACGCGTCCGGAGGCCAGCAACAA
T7_16800_G09	CAACCCAACGACGGAGAGTCACGAGGAAGGCGCCGC
T7_16801_G09	AGCGACCACCAGAAGCAGTCGCGGCGAAAACCGGCG
T7_16802_G09	CCGCGACCCAAAAGCCAGTCAACAGGCGGCGAGGGA
T7_16803_G09	CAAGCCAAAAGGGCCGCGTCCACGGCCACGAAGAGG
T7_16804_G09	GGGACAAGACCCCGCCCGTCGAAGGCGGCAACGAAA
T7_16805_G09	CAAGGCAGCCCGCACGGGTCAAGCAGGAGAGCACCA
T7_16806_G09	GAAGAGCAACGCCGACAGTCGCCCCGAGAGAGGACC
T7_16807_G09	GAGAGGCCCGCCGGACGGTCAAGGAGAACAACCACC
T7_16808_G09	ACGAAGACGACCGACAGGTCGCAAGGCACACGCGGC
T7_16809_G09	GGAGGAGGAACAGAGACGTCGACAACACCGCCGCCC
T7_16810_G09	AAGAAGCGACGACACAAGTCGCGGGGCGACCACCGC
T7_16811_G09	ACCACGACCGGCAAAAGGTCAGGCGGCAGACCGCAG
T7_16812_G09	CGAGCAGGAACACCCAGGTCGAACCGGAGAGCCGCA
T7_16813_G09	ACCGGCGGCACAAGCAAGTCGAAGAGGCCGCACCAG
T7_16814_G09	AACGAAGAAGAACGCCCGTCACGACCGGCGGCGCAG
T7_16815_G09	ACAACAAGACGACGGCGGTCCACGACGGCCGGCAGA
T7_16816_G09	AGGAGACGCCCCACCGCGTCGGCGCAGAAAAGCAGA
T7_16817_G09	CAGCGGCGGCCCGAAGAGTCAAACCCAGGGCCAAGA
T7_16818_G09	GAAGCAGCGAAGCACCAGTCACAACGGGGCGCCGAC
T7_16819_G09	CGGCGAACGACACCCGGGTCAGAACAACAACGCGGG
T7_16820_G09	CCAGCCACAGGGGAGGAGTCGGGCCCACCACGAAAA
T7_16821_G09	CAACCGCGGAGCAGCCCGTCAAGGACCGGAGAAAGC
T7_16822_G09	GACCAACGCCGCCGAAAGTCAAAGCCGGACGGCAGG
T7_16823_G09	AACCGCCGCCAACAGCGGTCAGGAGAACAGGGACGC
T7_16824_G09	CGCAAGAGGAAGAGCGAGTCCGACCACCACCAGCGG
T7_16825_G09	ACAGAGGGCAACCGGGAGTCGCCGGCAACAGACCAC
T7_16826_G09	CAGCAGGAGCAGGAGACGTCACCCACCCAACGGGGA
T7_16827_G09	ACCCGAAGGAGGAGGCAGTCCCAGAAGAGCACCCGC
T7_16828_G09	CGCAGCGCGACACGCAGGTCCCGGCGAGAGAAACAA
T7_16829_G09	GAGCACGAGCAGCAGGCGTCAGCAGCGCCAGAACCA
T7_16830_G09	GGAGGAAGACGAACCCCGTCACAACCCGGGAACGGC
T7_16831_G09	CGGAGGAAGCGAACGGCGTCAACAACCGCCGAAGCC
T7_16832_G09	GGCGCGCGCAGCAGAGAGTCCCAAGGACACACCAAG
T7_16833_G09	ACAACGGCAGCACGACCGTCCAGCAACGAGGGCGGA
T7_16834_G09	AGAAAAACCCGCGGCCGGTCAGACCGGCGGAACAGC
T7_16835_G09	CCCAGGCGGCGGAGCGAGTCCAGCCGAAAAGCAACA
T7_16836_G09	GAAGCGACGACCCGGAGGTCAGGGCACACACCACGA
T7_16837_G09	AAAACGCCACCACGGCAGTCGGGAGCGGACGCCAGA
T7_16838_G09	GACACAAACACAACGGCGTCGGCGCGAGACGGCCGA
T7_16839_G09	ACGAACAGGCGGCGCAGGTCAACAGAGGCCCCGAAC
T7_16840_G09	CAACACAGGCGGGGACCGTCGCGACGACAACAGCGA
T7_16841_G09	AACAACAAAACGCGGCAGTCCGCAGCGGCGGGAGCC
T7_16842_G09	CGACAGCAGACCAAGAGGTCAGCGCCGCGCAGAGAC
T7_16843_G09	CCAAAAGAAAAGAAGGCGTCCGCGGGCGGCGCCCCA
T7_16844_G09	AAGGAGACCGACGAGGGGTCACGCCGACCACACGAC
T7_16845_G09	GCAGAAGAACGGCCACAGTCACAAGCAGCCGGCCGG
T7_16846_G09	AGCACAGGAGCGCGACGGTCGCCGCGACAAACAAGC
T7_16847_G09	AAAGGAGCAACGAACCAGTCACGGCCGCCAGCGGCG
T7_16848_G09	AGAGCACCACGGCGGCGGTCGGCCAAACAGCGACAA
T7_16849_G09	CGCGGCAAACGCAGAAGGTCGCCAGGAAACCGCCGA
T7_16850_G09	GGGGACAAGACCGCCAAGTCGCCAAGCAGCGACGAC
T7_16851_G09	CCAAAACAACGAAGCAGGTCCGCAGCCGCGGGGCAG
T7_16852_G09	CCACAACCAAGAGCGGGGTCGAGGGAGCAACGCCCA
T7_16853_G09	CCAAGGCCGCCGAGAAGGTCAAGGAAAAGCCCGGCC
T7_16854_G09	CAGGACGCCCGCAGCAAGTCCAAAGAAGGAGGCCGC
T7_16855_G09	CGCCGCCGCCCACCGGAGTCAGGAGGAGGAAAAAAC
T7_16856_G09	CCCGAACACCGCCCGGGGTCGAAGACAAAGAGACGG
T7_16857_G09	GCACAACAACAGCACCCGTCGCGCGAGGAACGGAGG
T7_16858_G09	AGGCCGCAGCAGCACGCGTCCGGAACCAAAGAGGAC
T7_16859_G09	ACAGAGAGAACCACGAGGTCCGGCAGCCGCCGAGCA
T7_16860_G09	AGGAGGCGACGGCGCACGTCCACCAGCCGCAAAGAA
T7_16861_G09	CAGGCCCACCCCACAGGGTCAAAGGAGGGCCAGAAG
T7_16862_G09	CAACAGCGGACGGCAGCGTCACCGCGAGACGAAAGC
T7_16863_G09	CAGACAGGGCCCGCAGAGTCAGGGAAAAACCCCGCG
T7_16864_G09	CACGAAGCGACGGGCGAGTCAACCCGGAAGGACCAC
T7_16865_G09	GCGCCGGCGGGAACCCAGTCCAAAAAGAAGCAGCCG
T7_16866_G09	GCCCGACGACGCCCAAGGTCGACGACACAAGAAGGG
T7_16867_G09	GACCAGCACGCCGAGGAGTCGCCAGACGAGACGACA
T7_16868_G09	GGCCGACGACGCGACGAGTCCAAGGAACGACGAACC
T7_16869_G09	AAGGACGCAGCCCAACAGTCAGGGGCAGCACGACGC
T7_16870_G09	AAGAACCCACCAGGAGGGTCAGAAGGCCGCCGACCG
T7_16871_G09	AGCAAAAACAGCCGCCCGTCAAGAGGAGGGGCCGCC
T7_16872_G09	GGGGACAACACCAGCAGGTCGAGCCGGGCAACCCAA
T7_16873_G09	AGCCGCGGAGACGAAGAGTCCAACAACACCGCGGGC
T7_16874_G09	AACGCAACCGACGAGCAGTCGCGGCGGGCAGCAACA
T7_16875_G09	GAACGGCAGCACGCCGAGTCAGGACGCACGCCAGAA
T7_16876_G09	ACCAACAGAGGAGAGCGGTCACGACGACCGCCGCGA
T7_16877_G09	GGACGCCAAGAAGAAGAGTCCGAGCCGCGCCCACGA
T7_16878_G09	CGACGCCCACCGCGGACGTCGACGAGAAGCAGAAGA
T7_16879_G09	CAGAGCCAAGAGGCCGGGTCAGACCACCAGCAGCGA
T7_16880_G09	AGCGCACCACAAGAGGGGTCGACAGACCAGGCGACC
T7_16881_G09	ACAGGACGAGGAGGCCCGTCCCCACAAGAAAGCGGC
T7_16882_G09	CAGCCGAGCGACAAAAAGTCCGGCGGCGCACCGAAG
T7_16883_G09	GAGGCGCCCACAGAAAAGTCAGGAGACGACCGCCCG
T7_16884_G09	GCCGCACAGCAACGCCAGTCGAGCAGAAAGACGGCG
T7_16885_G09	ACCAAACCGCCCGACCGGTCCAGAAGGGAGGAGCGA
T7_16886_G09	AACGAACACGAGGCCGCGTCAGCAAGAGGCCGCGAC
T7_16887_G09	CAACAGAGGCCGACCACGTCGACGACAGGCGGGCAA
T7_16888_G09	AGCGACAAAGGGGCCAAGTCCACGGCCCAGGCCAAG
T7_16889_G09	AGGACGACACAACAGCGGTCCCGGCGACGACGACGA
T7_16890_G09	AAACAGCCCCAGCAAGAGTCAGGCGGCGCGGCGACA
T7_16891_G09	GGCCGGAGGAGCAACACGTCCGCAGAAGCACCACAG
T7_16892_G09	GAGCGGCCACCGACAAAGTCGGAGGAGCAACCAGCC
T7_16893_G09	CAGCACGAGGGGAGCACGTCAACGCCACCAGCAGGA
T7_16894_G09	CCGCGACAAGGGACAACGTCAACACGAGCGGCGCAG
T7_16895_G09	AAGAGGGCGACAGCAGCGTCACCACCACCAAGGCGG
T7_16896_G09	CAACAGAAGCAGCAGCCGTCGGCGAAGACGGACGCC
T7_16897_G09	GGCGGCGCACCCCAACGGTCAAACCGCGAGAAGAAG
T7_16898_G09	AAGGAGGAAAGCACCGAGTCCCCACCACAGGCGGGC
T7_16899_G09	GAGGACAGCGGGGACCGGTCCACCAGAACAACCGCA
T7_16900_G09	GCCACCGACACGACGGCGTCACAAGGAAGAGCGACG
T7_16901_G09	AGCGGAACGAGCAGAACGTCACGGCGCCGACCACGA
T7_16902_G09	GAGCAGCGGAAGCCGACGTCCGGAAGAACAACCGCC
T7_16903_G09	ACAGGAGGGAGGACGCCGTCCCCACAAGAACACGGC
T7_16904_G09	CCAAAAGCAACGAGACGGTCACGACGGCGACGGCGC
T7_16905_G09	CGCAGCGAAGAGAACAGGTCGACGCACCAACGGCGC
T7_16906_G09	CGGGACCACAACGGAGAGTCCGACACCCCAGAGGAG
T7_16907_G09	GGCACCAGCCGGGAACAGTCAGCAACAACAGGGCGC
T7_16908_G09	GGCCGACGACACCACAGGTCCACGACAGGGAGGAAC
T7_16909_G09	GCACCACCAAGGAGCAAGTCCGCCGGAGACGCGGAA
T7_16910_G09	CGCACACCGCAGCAGGCGTCGACACACGAAAGGAGG
T7_16911_G09	AAGAAACGCCGCCCACGGTCGACGACAAGAGGCGGC
T7_16912_G09	GGCGGCGGAAGAACCGCGTCCAACACCCAGCAAAGG
T7_16913_G09	ACACAACGGCGGAACGAGTCGGAGCGGCGCCACCAA
T7_16914_G09	GACGAAGGACACCACCAGTCAAGGCCACGGCGGACG
T7_16915_G09	GGAACAGGCGGGCAACCGTCAAACGGCCGACCAGAC
T7_16916_G09	GCAGGGCACAACCCAAAGTCGGACAGGCGAAGCGCC
T7_16917_G09	AACGAGCGGGAGCAGCCGTCACGGCGGAACAACCAC
T7_16918_G09	GAGGGACAGCCACAACAGTCAGAGGCGCCGCCGAAC
T7_16919_G09	CGGGAGCACCAAGACGAGTCCGACGGCACAAAGGCC
T7_16920_G09	CCAGGAAGACCAACGGAGTCCGCCGGAAGCAGCAGC
T7_16921_G09	GAAGAAGGGCGACCCAAGTCCGGGAGCACCACGCCA
T7_16922_G09	CCGGGGAGGACGGCGCCGTCGCCCACAAAAAAGAAC
T7_16923_G09	AGGGGCGCCGCAGACGAGTCCCGCCGACAAAGACAA
T7_16924_G09	CAGCAAGAAGGGCAGCGGTCCCGCCACCAAGACGAG
T7_16925_G09	CCGAGGACACAAAAACGGTCCGAGGGCGCGCGCAAC
T7_16926_G09	CAAGAGGCGGACGAGGCGTCAAGCAGCACCAACGCC
T7_16927_G09	CGGCAGCGGAGAACACCGTCCGACGGAACGACAACG
T7_16928_G09	AACAGCGCCAGGGACGCGTCCCCGGAGAAGCAACGA
T7_16929_G09	CCAGCAGGAAGGAGAGCGTCCACCGCGACCACGAGA
T7_16930_G09	CACGCCGGCGGAGCGCAGTCGAAGACGGCAAACAAC
T7_16931_G09	CGACCGAGACCAACGAGGTCGAGCAGCAGCACGACG
T7_16932_G09	ACACCCGCGGAGAGAGAGTCACCGCAGAAGCGGCCA
T7_16933_G09	GCAGCACCACGGCGCCCGTCACAACGAGAGGGAAGA
T7_16934_G09	CCGCGGCAGAGGAAGCAGTCGCCCCAAGGCAACAAG
T7_16935_G09	CGGAGGGCCGAACCAGAGTCACAAACCAGCCGCGGA
T7_16936_G09	ACGGCGGGACCGCAAAGGTCGCCCCACGAAGGAACA
T7_16937_G09	GGCGCGAACAACCGGCAGTCCGGACACCAGAAGACG
T7_16938_G09	CACGCAGCAAAACAGCCGTCACCGGCGACGGAGAGG
T7_16939_G09	AACGAAGACCACCGCAGGTCACGAGAGCCGGCCAGG
T7_16940_G09	GCAGGACGCAGGGCACCGTCAGACCACAAAGGCAGC
T7_16941_G09	CCGCGGGACGACGGGGAGTCACACCACACCGAAAGA
T7_16942_G09	ACCGACCGGCGGGCAGCGTCAGAACGCAGGAAACAC
T7_16943_G09	AGCCCAGAAAGAAGACGGTCACGCCGCCGGCAGGAC
T7_16944_G09	AACAAACGAGGCCGCCAGTCGCGGCCACGAAGAGGC
T7_16945_G09	AGGAAAAGGACGCACCAGTCGAGGAGCACCCGCCCG
T7_16946_G09	ACACCAACGAAGGAACCGTCGCCCCAGAGGGCGGGA
T7_16947_G09	CCAACGACGGGAAGAAGGTCCGGAAGCCGACGCCAC
T7_16948_G09	AACAGCACAACGACGCCGTCACAACGGGAGCGCGGG
T7_16949_G09	CGACGAGGCGACGACGAGTCCGACGCCAACAAGGAC
T7_16950_G09	AACGCCGAAGACGGCACGTCCGGCGGCGAAGACCAA
T7_16951_G09	AGAGAGGACGAAACCGCGTCGAGCAGCGACACCCCG
T7_16952_G09	GGACGACCAAGAGGCCAGTCAGCGCCAACGGACGAC
T7_16953_G09	AAAGACGCCGAACGACAGTCACGAGGCGGCGACCCG
T7_16954_G09	AGACGAACCGCCGACGAGTCGCCCCACAGGAGGAAG
T7_16955_G09	CAAGAAGCAGACGCCCGGTCAAGCGCGGCGACGAAC
T7_16956_G09	GGGCAGCACCACCGGGCGTCCAGAGAAGAAGACCAC
T7_16957_G09	CAGCGACCGCGGCGAAGGTCCCGCCGGAAAAAAGCA
T7_16958_G09	GAACCAACAACAAGCGCGTCCGGCCGAGGCGAGAGC
T7_16959_G09	CGGGCCGGCACCAAGAAGTCGACCAAGGACACGGCA
T7_16960_G09	GAGCCGACAGCCGACAAGTCCGAAGAGCAGCAGCCG
T7_16961_G09	ACAACACCGCAGCCCGCGTCGAACAGCAGAGGGGAG
T7_16962_G09	GGGCCCCGCAGCAGAAGGTCGAGCGGCACCAACAAA
T7_16963_G09	AGACGAACACGAGCGGAGTCGGGAACGCCGCCCACA
T7_16964_G09	ACGCACGGGGCAAAAAAGTCAGACGCGGCCCCGAGC
T7_16965_G09	CAACGAGGCAAGACGAGGTCGAGCACCGGCAACGCC
T7_16966_G09	AGCAGGACACCGACGGCGTCGCAGAAGAGCGCAACC
T7_16967_G09	ACCGACAGACGCCCACGGTCACGGAGGAGAAGCGCA
T7_16968_G09	CCACAAGGAGGAGGCGAGTCAACCGCCGGAACCGCA
T7_16969_G09	GCGGCCGGCCAGAACGCGTCACGAAGCAACAGCAGA
T7_16970_G09	CAGCAGCAACAAGAAGAGTCGCAGCGGCGCCGCAGC
T7_16971_G09	AGCGGAAGACGCCGCAGGTCAACCCCACAGAGGCGA
T7_16972_G09	CGGGCGGCCGCAACAAGGTCAACAGCAGCAGCGCAA
T7_16973_G09	ACCACGGCGGCCGCGCAGTCGACAGCAGCAGAGAAA
T7_16974_G09	GGAGCCGCCCAACAACAGTCAAACGGGGAGCAGCGC
T7_16975_G09	GCACAAAACGGAAGACGGTCAGGCGGCACGACCCGC
T7_16976_G09	GGAAAGGAGCACAGCCCGTCGCCAACAACGCGACGG
T7_16977_G09	CCGGCCGCAACAGCACAGTCGCCGCGGAGAGAAAAG
T7_16978_G09	GCACCAGAAGCAGGAGAGTCCCAACCGCGGGCAGCA
T7_16979_G09	ACGAGGAGGAGGACCGCGTCAACAACCCGCAAGCGC
T7_16980_G09	GCGCCAAGAAGACCCACGTCGGAGGGAGACAACGCC
T7_16981_G09	CGCCGCGGCAACAGCGCGTCCGACGAAAGCAGAAGA
T7_16982_G09	AACGCCGCAAAGAGGAGGTCCGCAGCACCAGCAGCG
T7_16983_G09	AGAAGCAACAACGCCGGGTCCGGACAACCGCAGGCG
T7_16984_G09	CGGAAAGCCGCAGAGGAGTCCGACGAAAACCGCCGC
T7_16985_G09	CGGGCGCACGAGCGAGGGTCCCACCAGAAAAACGAC
T7_16986_G09	CCCAGCAACGGAGGCAAGTCGCCAACGCGGAAGACG
T7_16987_G09	GGGGACAGCACCACAACGTCACCAGCAAAGCGGCGG
T7_16988_G09	GACGCAGCAGCACAACGGTCACGGCCACGACGAGAG
T7_16989_G09	AACCCAGAAACGCGAGCGTCCGCAGGGGCAGCAGCA
T7_16990_G09	AGCAGGACGCCGAGCCGGTCACACGAAGAGACGACC
T7_16991_G09	CAGAAGCACCACGAACCGTCAGCGAAGCCGCGGGAG
T7_16992_G09	CCCGAGGAAGGAGCAGCGTCAAGACCACGCCAAGGC
T7_16993_G09	ACCGACGCCGGACGACAGTCAAAAGGAGGCGGCCAC
T7_16994_G09	GGAGAACCAGGGGCCCGGTCAGCACCACGGAACAAC
T7_16995_G09	CCGCAGGCGCAGGACCGGTCCCGAACGAGAACAAGA
T7_16996_G09	ACAACAAGACAGGCGACGTCGGCGCCACCAGGCAGG
T7_16997_G09	ACGACCGCAAAGACGGCGTCAGGCAGGCAACGCGCA
T7_16998_G09	CAGCCACCAGCCACGGGGTCCCAAAGGAGGAGGAAC
T7_16999_G09	GCCACGACAAGGAAGCCGTCGAGGCCGCAACAGCAG
T7_17000_G09	CCGCAGCCGAACCACCAGTCACAGGAGGAGGAGACG
T7_17001_G09	GAACAGGCGGGCGCGAGGTCCCGCCAAAAACAACGC
T7_17002_G09	AAACACAGAACAGAGGGGTCCGGCCGCAGCGGCCCA
T7_17003_G09	CGGACCCACCACGAAGAGTCGGCAGGGGACGACACA
T7_17004_G09	AGGCCGCACCGGGCGGCGTCGAAACAACAACCAGAG
T7_17005_G09	GGCGGGAACACCAAGAAGTCCGAAAGGACCCCGCCG
T7_17006_G09	GAGGGAACCAAGAGGACGTCGACAACCCGACGCCGC
T7_17007_G09	CAGCAACCGGCCGCAAGGTCAGGAGCAGCAGCAAGC
T7_17008_G09	GCACACCGACGAGGGCAGTCGCAAGGAAGAACCGCC
T7_17009_G09	GAGAACAACACGGCGACGTCCGAGGCGCAAAGCCCG
T7_17010_G09	CGAGCAACAAGAGAGGGGTCCCGCCGCAGCACAGAC
T7_17011_G09	CAAGAGCCGGAGAAGCAGTCGCAGACACGACGCCGC
T7_17012_G09	CCCAGAGGCAAAGGAAGGTCGAAGCGGCGCCCAACC
T7_17013_G09	GACGACGACAAGAAGCCGTCGAGCAGCACGCCGCGA
T7_17014_G09	AGCAAGGCGGGAACCAGGTCCGGGGCAACCAACCCA
T7_17015_G09	CCGCCAGAAGCAGCCACGTCGAGGGCGAAAAGCGCA
T7_17016_G09	AGCAGCAACGGCCGCCGGTCCCGAGCGGCGAAAAAA
T7_17017_G09	CGAAGCGCGGACGACACGTCAGCCGCCAGGAAGAAC
T7_17018_G09	GAACGACGCCCGACAGGGTCAGACGACGACAGCAGC
T7_17019_G09	AGGAGGAGCCGAACGAGGTCCGGCCAACCAGACCCA
T7_17020_G09	GGGGCAGGCCACAAACAGTCGCCCACGCGACGAAGA
T7_17021_G09	CGCACAAAAAGAGGAGGGTCGGACAGCCGCCCCGCA
T7_17022_G09	CGGCACAACAAGGCGAAGTCCCAGAGGACGACCGGC
T7_17023_G09	AGAAGACGAGAACACCCGTCGGCCACCGGCGAGGAC
T7_17024_G09	CGCACCACAACGAGAGCGTCGGAGAGGCGACGACAC
T7_17025_G09	GCCACCAGCCAGAGGCCGTCAAGAGCGAGGAACCGA
T7_17026_G09	CCCGCCGCACAACGGACGTCGACGAAAGGAGACGGA
T7_17027_G09	GCAGGAAGCGGCGCAACGTCAACAACGACGGCAGCC
T7_17028_G09	GACGCCCCAGGGCGCACGTCAGACAGGCACGAAGAA
T7_17029_G09	CCCGAGAAACAAGCAGCGTCCGCCCGGCGGAAGAAG
T7_17030_G09	GCACAGCCAGCCGGCAGGTCCACCAAGAGAGAACGG
T7_17031_G09	GGCACCAAGAGCAGACGGTCACAGGCGACGAGCCAC
T7_17032_G09	CCGACGAGAGGCGCCCAGTCGAAGCGAACCGACGAA
T7_17033_G09	GCGCGGGGCAGAAGACGGTCCGAACCAACAACACGC
T7_17034_G09	GAGGCGGACGCAGAGCAGTCGACAACCGCCACCAGA
T7_17035_G09	GCAGCAACGAGGGCAGCGTCGCCGCAACACCGAAGA
T7_17036_G09	AAAACGACAGGCGGCGCGTCAAGCCACGGCCACGGA
T7_17037_G09	AAGAGGAACGAGACCGCGTCCGCCCGCAAGCACGGA
T7_17038_G09	AACGCACACGAGGCAACGTCCACACGCCGAGGAGGG
T7_17039_G09	GCAGCGCAGCCGGCCAGGTCAACGACACGAAAAGCG
T7_17040_G09	CGACGACGGCGCAACCAGTCCAGCAGGACGGCGAAA
T7_17041_G09	GGGGAGGACCAGACAACGTCACCGCCGACAACGACG
T7_17042_G09	CAGCACCACCCGAGCGGGTCCGGCAAGAGAAAGCAG
T7_17043_G09	ACGCCGGGCGAACAACGGTCCACGACGACGAAGAGC
T7_17044_G09	CCAGCCAGAAGGCAGCCGTCGAAGAAGGACCGCCGA
T7_17045_G09	GCCGGGGAGGAGCCGACGTCGACAGCCACAACAAAC
T7_17046_G09	CGCCGCAACACAAGCAGGTCCAAGGAGACGGCGACG
T7_17047_G09	CCACACGAGGCCACGGCGTCGAGACGACGACGAAAG
T7_17048_G09	GACGAGACAGCGGAGGGGTCAGGCACCACCACCAAC
T7_17049_G09	GGGCGAAAGAAGAAACAGTCGCCCCGCGGCCAGCAC
T7_17050_G09	GAGCACAAGAACCACCGGTCGCCGCGAGGAAGCCGA
T7_17051_G09	CAGCCGCCAAACGGAGAGTCGACGAGGGAGCCCCAA
T7_17052_G09	ACAGGCCGCCAGAAGCAGTCACGCGGCGGGACAACA
T7_17053_G09	CGGCACCAAGAAGAGCAGTCGCCGCGGCGACAGACA
T7_17054_G09	GCAACAAGACGCGCCACGTCAGGAACAGCGACGCGG
T7_17055_G09	GCACCCAAGAAGAGGGCGTCCACAAGGGGCGCCCAA
T7_17056_G09	AAGACGACGCCGGCGGGGTCAAGCCCACACCAGAAG
T7_17057_G09	AACGACGGGGAGCCCCAGTCCCGCCGCAAGGAAGAA
T7_17058_G09	AGCAACACCACCGCCGGGTCCAGAAGCAGCGGGGAA
T7_17059_G09	GCAAGGCGGGCACCAACGTCAACAACAGGGCGCCGA
T7_17060_G09	GGAGCCGAAGAAGGCACGTCCAAGACGCACCCGACG
T7_17061_G09	AGAAGACGGCGGCGGCGGTCCACACCCCAGCAAGAA
T7_17062_G09	AGAAAGAGGAGGACACAGTCGCACCGCCGCCGCAGC
T7_17063_G09	GAGGACCCGACAAGGACGTCGACGACGGCGACCAAC
T7_17064_G09	CCACGAAGAAAAAGGCGGTCACGAGCGCGCACGCCG
T7_17065_G09	AGGCAGCGCGGCACGAGGTCAGGACCCACCACAAGA
T7_17066_G09	AGGGCAGCACACCGCGGGTCACAACGACGACAAGGC
T7_17067_G09	CCGGAGAACAAGCACGAGTCGGAGCAGAACCGCCCG
T7_17068_G09	GAAGGCGCCAGCCCCGGGTCCGAGGCAACAAACGAA
T7_17069_G09	GCAGCGGCGCCGGACCAGTCCGAGAAGACAACGAAC
T7_17070_G09	CAGCAGCGGGCGCCACCGTCAGCAGGAGAAGACCAA
T7_17071_G09	GACGCGGCGCCGGGCCGGTCCACGAACAACAGAAAA
T7_17072_G09	GGCGGACGCACCGACACGTCACAACACGAAGGAGGC
T7_17073_G09	AAGCCACCAGCCGGCGGGTCCACCAAGAAGGAAGGC
T7_17074_G09	GAAGACCAGGCCACCCAGTCGCGAAGCAACGGACGG
T7_17075_G09	AAGAACCCACCACAGCGGTCGAGCAGACGACGGCGG
T7_17076_G09	GACAAGACAAAGCAGGCGTCCCCACAGCGGGGCGCA
T7_17077_G09	AGGACGAGGAGCAGAAGGTCAGCCGCCCACCACAGC
T7_17078_G09	CAACAACACCGGAGAGGGTCCGGGGCAACAGCCAGC
T7_17079_G09	AAGCCAACCGGCGGGACGTCACCAGGACAGCGCAAG
T7_17080_G09	AGAACACACGACGAGGGGTCGCCCAACCCCGGAGGA
T7_17081_G09	GCAAAAAACGCGGCAGAGTCCCGCCAGCGGACGGCA
T7_17082_G09	CGCCGAGCAACAAAAACGTCACAGGAGGCGGGCCGC
T7_17083_G09	GAAAACAAACGGCCGGAGTCGGGCAGCAGCCGACCC
T7_17084_G09	GGGAAGAAGGAAACCCCGTCGCCGCAACGACCAGCG
T7_17085_G09	CAAGGCGGCAACGAAAAGTCGCGACCCCGACGAGGC
T7_17086_G09	CGGAAAGCAACGCCACGGTCACGGCCACCGAGAGGA
T7_17087_G09	CAGCCAGCAGGCAGCCGGTCCGAAAGGAGGCAACCA
T7_17088_G09	CCCACCGACGACGACCGGTCAAGCCGAGAAGAGGAG
T7_17089_G09	CAGCACAGCACGGCGGGGTCCAGAAGAGACCGACCA
T7_17090_G09	GACCCGGCCCGAGACCGGTCGAGAAGGAAGCAAACC
T7_17091_G09	CAAGCAGCGGCCGAGACGTCCGAAGGAAGACCGACC
T7_17092_G09	GACCGACCACCAGAAGCGTCGGCGAAGACCGCAGGA
T7_17093_G09	GCAGCAGCCGGAGGCAGGTCCCACGAGCAACACAAG
T7_17094_G09	AGGAGGCGCAGCACCGCGTCCGACGAGGCAAAACCA
T7_17095_G09	GCAGCCGGCGAAGCCGAGTCCAAAAGAGGCCACGAC
T7_17096_G09	GACGCCGACCAACGAAGGTCGACACCAGCAGGAGGC
T7_17097_G09	GCGAAAGAAAGACGGCCGTCCCGAACCGGACCACGG
T7_17098_G09	CAGCAGCAAGAGCACCAGTCCGACGAACGCGGCGGA
T7_17099_G09	GCGGAGCACCGGCGGAGGTCAACAACCAAGAGCACC
T7_17100_G09	GCGCCGCCAACGACGGAGTCAGCGCAGCACGAAGAA
T7_17101_G09	AGAGCAGACGAGCCGCGGTCCCACGAAGGCGCAAAC
T7_17102_G09	GAGCGACGCAGCGACAAGTCCAAGACGGCGGACCCA
T7_17103_G09	AGAGAAGAGGCAAGCAGGTCCACCCAGCCGGCCGAC
T7_17104_G09	AGGAGGCGCCCCAACGGGTCGCGCAAAAACAGCAGC
T7_17105_G09	AGCGGCACGACGGAAGGGTCAGCCCCAACGCCGAAA
T7_17106_G09	ACACCCCGCAGCAGCAGGTCGACGACGACGAGGAAG
T7_17107_G09	ACCGCGCAGCGGCGAGAGTCAGCGGCGAACACAACA
T7_17108_G09	CCCGCCGAGCAGCAGAGGTCGCGGAAGCCACAAAAG
T7_17109_G09	GCCGCCGGCCGCAACCCGTCCGAGAAAAAAGAAGGG
T7_17110_G09	CGCAGCCAGCCCACCAGGTCAGGAGAACAGAGGGCA
T7_17111_G09	GCGACGCCCAGAAGAGGGTCACGGCGCAACGAAACC
T7_17112_G09	GCGCGGCAGGCGCCGCAGTCGCGAACAAGAAAAACC
T7_17113_G09	GAGGAGACGGAAACCGCGTCCGCAACGACCGGCCAA
T7_17114_G09	GAAGAACACCCCACAACGTCAGGGACCACGGGCGGG
T7_17115_G09	ACCACCACAAAGGCGGCGTCGAGAAGCGACCGACGG
T7_17116_G09	CAAAGCGGCCACGACCAGTCCACGACGGAGGGAAGC
T7_17117_G09	AGAACAAGGAGGCAACAGTCGCACCGCCGGCGCAGC
T7_17118_G09	GCCGCAGCAGCCACGGCGTCGCGAAAAAGAACGCAG
T7_17119_G09	GGACAGGACAGCACCGCGTCAAGACGGCGACCAGCA
T7_17120_G09	AGCAGAAAGAAGACGGAGTCGCACCGCCCCGGCAGC
T7_17121_G09	CGCGCGGCAAACCCCGAGTCCGGCAGAGGAAGAAAC
T7_17122_G09	AAGGAGGGCGCAAAGCAGTCCCACCCCGAAGCGGCA
T7_17123_G09	GCCCCAGCGAAGGAAGGGTCCAGCACCGCCAAAAGG
T7_17124_G09	CGGCGGCGAAGAACAAGGTCACGACGACAGCCGACC
T7_17125_G09	CAGCGCCGAGGAAACCAGTCCCGACGGCGGCAAGAA
T7_17126_G09	GAGGACGCCGCGAAAACGTCGCGGGGACCAACCAAC
T7_17127_G09	ACGAGGCGCGCCGCGACGTCGGAAGAAGACCACAAC
T7_17128_G09	AGAAGGAGGAAGCGGCCGTCCAACCACCACGGGCCA
T7_17129_G09	CGACGCGGAGGACGAACGTCCCACGACGAGGACCAA
T7_17130_G09	CGACCACCAGCAGAACAGTCAGGAGGGGCACGAGCC
T7_17131_G09	GCGGCCAACAGCGACACGTCCCGACGACAAGGAGGA
T7_17132_G09	CACCAAGAACGCAGAAGGTCCGGCAACCAGCGGGCG
T7_17133_G09	GCCGCAAGCACGACAACGTCAGAACACCGGCGAGGG
T7_17134_G09	CCAGCCCGCCACCAAAAGTCACCGGAGGAGGGAGGA
T7_17135_G09	ACAAACAACAAGGCGGCGTCGCGACGCGGCAGCAGC
T7_17136_G09	AAGAGCAACGCCGGACGGTCCCGGAAGCAGACGCCA
T7_17137_G09	CACCGCCGGCAGCCAAAGTCGGCAGACGAGAGCAAG
T7_17138_G09	GCAGAAGCGGAAGGCGCGTCCCAACAAGCCGCCGAA
T7_17139_G09	CCGGCACAAGAAGAGGAGTCCGACGAGGCGCCCAAC
T7_17140_G09	CGCGCAACAAAGGACAGGTCGAAACCGCCGGCAGGC
T7_17141_G09	GCAACGAAGAACAGAAGGTCGCGCACCAGCGCCGCG
T7_17142_G09	GCAGAAGAGGGGACACCGTCACCACACGGAGCGCAC
T7_17143_G09	CGACAGAAGAAGAGCCAGTCGGCCACCAGGACGCCG
T7_17144_G09	CGACCAGAAGGCGGGGCGTCGCAACACAAGCAACGC
T7_17145_G09	AGGGGAGGCGACCACGCGTCCCGACGACGACAACAA
T7_17146_G09	GGGCCGAGCAGCAGCAGGTCCAGCAAACCACGGAAC
T7_17147_G09	CAAGACCAGCAGCCGACGTCGAGGAGGCAGCGACCA
T7_17148_G09	CCGGCCAACAAGACGCCGTCACGACGGGGCGAAAGA
T7_17149_G09	GACCCAGGAAGAGACGAGTCAGCAGCCGGCACACCG
T7_17150_G09	GCGAACAGCGAAGCAGCGTCAGCGGCACCAACACGG
T7_17151_G09	GAGCCGCCCCGAGGAGGGTCAGCCAAGCAACAAAGC
T7_17152_G09	GAAGAAGAAAACGCCGCGTCAACGCCGCGACCGCGG
T7_17153_G09	GGAAAGCAGCCAGCAAGGTCACCGCAGCAGACGGCC
T7_17154_G09	AGGGGCAAAACGACCACGTCCGCAGGGAACACCGCG
T7_17155_G09	CAGCAGAAGGAAGGAGAGTCCAGCACCACCCGGCCG
T7_17156_G09	GAGGCAGGGAGGACGACGTCACCCGCCGACCAACAA
T7_17157_G09	CGGACGGACGAAGAGGAGTCCCACCACCACACAGGG
T7_17158_G09	CCGAGCGGAGCCGCACAGTCAGAACAAGACGACGCG
T7_17159_G09	CAACAAAAACGGCAGAAGTCGGCCGCCGGGGCCACG
T7_17160_G09	AACAGAAGCAGGGAAGCGTCCACCACCGGCGGCGCA
T7_17161_G09	CGCGCAGAGAAGAACAGGTCGACCACGGCAGACGCC
T7_17162_G09	GAAGCAACACCGGCAGAGTCAACGACCGGAGCCGCG
T7_17163_G09	CACCAGACGAGGGGAGCGTCGCCACCACGAAACGAG
T7_17164_G09	GCCAGCGAGCAGAACGAGTCGAAACGCAGCCCCAGG
T7_17165_G09	GCGCCGACGCGCCGAAAGTCGAAAAGCGCAGAAGCC
T7_17166_G09	CGGCCGCGAAGAACGAGGTCAAAAACCGCCGAGCCG
T7_17167_G09	CGCGACAGGAGAACGAAGTCGAGCACCCAGCCGCGA
T7_17168_G09	GGACAACGGCAGCGCAAGTCAGGCCGACAAGCACGC
T7_17169_G09	GGAGGGAGGCGGCCCACGTCCAACCACAACAGCAAG
T7_17170_G09	ACCAGCAGCAGCACCAGGTCCACCGGAGGAGAGGCA
T7_17171_G09	ACACAACGCGAAGGGCCGTCCCGAGCGGAGACAACG
T7_17172_G09	CAACAACACCACCGGAGGTCGGAGGGGAGCCGCCAA
T7_17173_G09	CCACCGCAGCCGCGGGAGTCGACGGAACAAAGACAG
T7_17174_G09	GCAGCAGCCGAGAGCCAGTCCCAACAACGCAGGGAG
T7_17175_G09	GCGGCGGAACAAGAGCCGTCAGGCCGCCAACAAGAC
T7_17176_G09	CCGCGCGGAGGAAACAAGTCAGCGCGCAGAAACCGC
T7_17177_G09	AGCAGGCCACAGCCGCGGTCCAAAAGACAACGGGGC
T7_17178_G09	CAGAACAGAAGACGCAGGTCCGGCCGCCGACCAGGA
T7_17179_G09	CACAGCGCCGAGAAGACGTCAAGAACCCGGCGCGGA
T7_17180_G09	GAGGAAGCAGCCGCGCCGTCCCCAAGAACACAGAGG
T7_17181_G09	CCGCGACGGGCGACAGAGTCAGCAACAAGAACGCCG
T7_17182_G09	ACCGGACCAACAGAAGAGTCGGCCGCCGCAGAGGAC
T7_17183_G09	ACCACCCCAGCAGGCGGGTCCAGGAGGAGCAAAGCA
T7_17184_G09	GACCACCAGGCGGCGCAGTCGCAGCAGGAGAAACCA
T7_17185_G09	AGGGAGGAGCACCCCACGTCGAGAGGCCCACAGAAC
T7_17186_G09	CCAAAGGCAAGGCGCCAGTCCAAGAGCAGGAGCCGC
T7_17187_G09	AGCGAGCAACGAAGCACGTCGGCGCCAACAACCGGG
T7_17188_G09	CGCCCACGAAGGAAGAAGTCCGCCAAGCGGAGGACC
T7_17189_G09	AACGAACGCGCGGCGCGGTCGGCAAGCCACAACAAG
T7_17190_G09	CGACCAGGACCACCAGAGTCCGGGAGACGGCAAGAC
T7_17191_G09	GGGAGCAGCACAAGCAGGTCCCAACCCAGCAGCGGA
T7_17192_G09	GCCGCGCCCAACAAAGAGTCAGGAGCAGCGGCGACA
T7_17193_G09	AAGGAGCGACGGCACCCGTCCACAGAGACCAAGGGC
T7_17194_G09	CCAGAGCGCGCGCGGAGGTCGACCAAGAAACGAACC
T7_17195_G09	GGGCGCCGGAGCACGGCGTCGACAACAACACAAGAC
T7_17196_G09	CCACCGAACCCGAGGCGGTCGGGAACAGGAAGAACC
T7_17197_G09	GCGGGAGCGACGACACCGTCACCAACAACACGAGGG
T7_17198_G09	GCAGCCAACGACGAGCGGTCGCGAGCAGCAGCACAA
T7_17199_G09	GAAGAAGACCGCCGCACGTCGAGAAGCGCACCGACG
T7_17200_G09	GGCCACCACGGAAGGAGGTCCCCACCAGCAGAAGGA
T7_17201_G09	CGAACAACCCAGGCAGGGTCAGAGCCGCACCGGGAA
T7_17202_G09	AACAAAGCCGCACCGGAGTCGGACCACCGGAGGGAC
T7_17203_G09	CAACCGAGCAAGCGACAGTCGAAGGACGCCGCAGGC
T7_17204_G09	CCAGGCCACGAAGACGAGTCCGGCCAGAAGCCGAAG
T7_17205_G09	CGGCCGGACACAACAGAGTCAGGCCCGAAGAGCCGA
T7_17206_G09	AAAAAGACAAGGCCGGAGTCCGCGCCCCGCAGCAGG
T7_17207_G09	AGCCCAGCGAGCGGGAAGTCCAACAAGCCGACGGAC
T7_17208_G09	GACGAGCAGAGGAGACGGTCGCAACCGCCCAACCAG
T7_17209_G09	GGCGCCACCAGAGGAGGGTCGCCACAACGACCAGAA
T7_17210_G09	GGCGAGGAGCCAGGAGCGTCAACACGCCGCCACAAA
T7_17211_G09	CGACGACGAGCAGCCGCGTCGGAAAAGCGCCAAGAC
T7_17212_G09	CCCGAACAGGAGCAAGCGTCCAAGAACGGGCCGCGA
T7_17213_G09	CCCAGAACGACAACGAGGTCCGCAACCGGAGGGCGA
T7_17214_G09	CAGGCAGAGGACGACGAGTCCACGCCGGCACAACGA
T7_17215_G09	GCGGAAACCAAGACACCGTCAGCGGGGCCGCCAGAA
T7_17216_G09	AAGAGCACAAACCGCGGGTCGCAGCCGCACCAGGAG
T7_17217_G09	AGCCGAAGGAACGACGGGTCCGCCACCGAGAGCCAA
T7_17218_G09	AGGAGGCACGGCCGACGGTCCCAAGACCCAAAGACG
T7_17219_G09	GAGAAACCGGAAACCCAGTCCGCACGGAAGCGGCCG
T7_17220_G09	AGCCACCGAGGGCAAGAGTCGGAAAACGGACCCCGC
T7_17221_G09	AGGCCAGAAACAGCCCGGTCGGCCAACAAGCGGACG
T7_17222_G09	GAGCACCCACAGCCGAGGTCGCCACAGGGAAGAGCA
T7_17223_G09	GCAGGGCGAAGAAGCACGTCCGCAGCAGAACACCCG
T7_17224_G09	CGCCGCCCAGAAGGAAAGTCAACCACGAGGAGCCGG
T7_17225_G09	GGAAACGGCAGCACAGGGTCAGGCGCAGACAACCCC
T7_17226_G09	AAAAGCAGCAACCCGCAGTCGCAACGGGCGGCAGGC
T7_17227_G09	AGCAACAGAGCACAGCCGTCCGCGAACCGAGCGGAG
T7_17228_G09	GCGGGAGCAGCGGGACAGTCGCACCCGCACAAAACA
T7_17229_G09	GGAGACCACACACCGGCGTCCGACGAGCGAAGCAAG
T7_17230_G09	CAGGACGACGCAGCGCCGTCCACGACAGCAGGAGAA
T7_17231_G09	CGGGCGAAAGAACCCAGGTCGACCGGCCGAAACCAG
T7_17232_G09	CCGGACGACAGGAACGCGTCCAAGAAGCAGCAGCCG
T7_17233_G09	CCGGCCGGCAGAGGCAGGTCAGACAAGCAAACCGCA
T7_17234_G09	AAGGACAACGACAGCAAGTCCCCAACGGCGGCGCGG
T7_17235_G09	AGGACAACGGAGGCCGAGTCCGCCGCAAGAAGACCC
T7_17236_G09	GAGACCACACGGCGCGGGTCCGGCACAAGCAACGAA
T7_17237_G09	AAAAGAGCCGCGAAACAGTCAGCCGCGCCGGCGGAC
T7_17238_G09	GACGGAGCCGCGCAGAAGTCCCGGCCGAAAAGCACA
T7_17239_G09	GCAAAAGACGCCCGCAAGTCCAGCAGGCGGCGGAAC
T7_17240_G09	ACCGCAACCGGCGGCAGGTCACGACGAAGACGAGCA
T7_17241_G09	CAACAAAAGCGACAGCAGTCACCCGCGGACGGCGGG
T7_17242_G09	GCGGAAAAGGGCAACCGGTCACGGAGCCACCAGCAC
T7_17243_G09	ACGAGCCGACGCAGCGGGTCGAGACCCGACAAAGCA
T7_17244_G09	GCGAAAGAAAGGGCGCCGTCGCAGCGCGAACACCAC
T7_17245_G09	CAGGAGCGCAGGAGACCGTCACCGAGCCGAAGACAC
T7_17246_G09	CAACAGCAGGAGACGGCGTCGGAGAACGACCACGCC
T7_17247_G09	GGCCACGAGCAGGAGACGTCGGACCGCCAAAGCCAA
T7_17248_G09	ACAAGCGGCGGGCGGCAGTCGCAGCACCACAACGAA
T7_17249_G09	CGAGAGGACAACAGAGGGTCACGACGCGGACCCACC
T7_17250_G09	AGACGACGACACAGGGCGTCAAAGGGCGCACACGCC
T7_17251_G09	GACGCAGCAAGCAGCCGGTCCCGGGGAAACAAGACC
T7_17252_G09	AGAAGGAAACCGACGCCGTCACCGGCGGACGCCAAG
T7_17253_G09	CCGCCAGCAGAACGACAGTCAGAGGGAACCCGAGCG
T7_17254_G09	CAGCACCAGGGCAGCACGTCCACGGGGACGAACAAG
T7_17255_G09	CAGAGAAAAAAGGCCGCGTCGCCAGCCAGGCGGCCA
T7_17256_G09	ACGGGAACAACCACCCAGTCGGCAGAAGAGGCGCGC
T7_17257_G09	AAGCGCCAAAACAAACGGTCGAGGCCGCCGGCGGCA
T7_17258_G09	AAACGCACAGGACAGAGGTCCACGCGGCCCAGGACG
T7_17259_G09	CGGGCGGACCAACCAACGTCAACAGGGGAGACCAGC
T7_17260_G09	CACCACGGAGCGAGACGGTCCCACAAACACGGGAGG
T7_17261_G09	CGCAGGCAGAAGACGAAGTCAAGCAGCAGCCGCCGC
T7_17262_G09	AAGAGGCCAGGCGGGAGGTCCGACCCCGACAACAAC
T7_17263_G09	AACGACGAGGGCACGAGGTCAGAGGAGCCCCACCCA
T7_17264_G09	GCCCGACAGCCAAGGAGGTCCAGCAGAGCAGAGCAC
T7_17265_G09	GCACGCCGGCAAAACGGGTCCCGAGACACCGGAGAA
T7_17266_G09	CGAACCCCGGGGAGGACGTCAGCACACGGGAAAACC
T7_17267_G09	ACGACAACGCCGCGGGAGTCCGGCGAACACAGACAG
T7_17268_G09	CAAAACCAGGCGAGCGAGTCCGACGAGCCAGGGCCA
T7_17269_G09	CCAAGGAGGCCAGACACGTCGGCAGCCGCAGCAAAG
T7_17270_G09	AGCGCCGCCGGACCACAGTCACCACAGAAGGAGGAG
T7_17271_G09	ACGGCACAGGAGCCAGGGTCACAGGACCACGCGCAA
T7_17272_G09	AACGGCGGCCCGCACGGGTCGAGAACAGCAACCAAG
T7_17273_G09	GCCGACCAGAAAGAGGAGTCAGCCGCGCGGACCAAC
T7_17274_G09	GCAGGACACGAGGACCAGTCGCCGCAGCAGCAACAG
T7_17275_G09	GGGACCCCAACAGCGACGTCAACGGCAGACGAAGGC
T7_17276_G09	CGCCAACGGGCGAACACGTCCGGGAGAAACAACGGC
T7_17277_G09	GAGGCAACAAGCCGCGCGTCGAGACGCGGACACAAC
T7_17278_G09	AGGCGGCGCCGCCAGCGGTCAGCAGAGAAAACACAC
T7_17279_G09	CGAAGACGGAGCAGCCAGTCCCGGAGAGCCCAAGCA
T7_17280_G09	AGCCCAGCAGCGAGGACGTCGAGCCAAAAGAGCCGC
T7_17281_G09	GGAGAACCGCCACACCGGTCGCGCCAGGAAGAACAG
T7_17282_G09	GAACCCAGCACACAACAGTCACAGGAGGCGCGGGCG
T7_17283_G09	CGGCGCAGCCGAAAAGCGTCAGACCAGACAGCGACG
T7_17284_G09	CGCGCAACGACACCAGAGTCGGCGCAAGAACCAGGG
T7_17285_G09	CCGCGCCAAGCAGCAAGGTCCCGGACGAAAAGCAGG
T7_17286_G09	GGAGGAAACCACCACCGGTCGCGCAGGGAACCAGAC
T7_17287_G09	AAGGGCCGCCGGCAACGGTCACGGGCAAAACCGCAA
T7_17288_G09	CGCCAGAACAACCCGGGGTCAGGCAACGACGACAGG
T7_17289_G09	AAGCAGACGCAGGAACCGTCCAAGACGACGCCGGGC
T7_17290_G09	CGGCAGCCCAACGAGGCGTCGGGGCACAACGAACAA
T7_17291_G09	AAGGAGGACGAAGAGGCGTCGGCACCCACGCCAACC
T7_17292_G09	CAGAAAGACCGGCAGACGTCGGCGACAACCGGCGAC
T7_17293_G09	CGGAGAGACCGAGCGGCGTCACCACGGCAAACACGA
T7_17294_G09	GGAAAGCCACCGACGCCGTCGCACAGCAGGGACGAA
T7_17295_G09	CGACGCGCCGAGACGCCGTCGAGAAAGAGGCACCAA
T7_17296_G09	CGGCCGCAGAAGCGCACGTCAGACGCGAAGAAGACC
T7_17297_G09	GCCAGCAAGGAGCCGCGGTCGAACCAGCAACGACGA
T7_17298_G09	CGGACGACGACACCGAGGTCAAGCCAGAAGCGACGC
T7_17299_G09	CAAGCCAGGAGCACCCGGTCAAGAAGCCACGACGGG
T7_17300_G09	CGGCAGCCGCCAACCAGGTCAAAAGAGGAGCGGCAC
T7_17301_G09	GGGAGCACAACAGGAGCGTCCGCACACCGAAGCAGC
T7_17302_G09	GAGGACCCGCAAAACAAGTCACGCGCCCGGAGACGG
T7_17303_G09	CAGAGACACGGCACCAGGTCCAACGGCACGGCGAGA
T7_17304_G09	GCCAGCCGGAGGAAAACGTCAACGACCAACGGGGCC
T7_17305_G09	AGCCAGAAGAAGACGGCGTCGGAGACGCCACCAGCC
T7_17306_G09	CGCCAACACGAGCCACCGTCGGCAAGACGAGAAGGG
T7_17307_G09	GAAAAGAAGCGGAGGGAGTCGGCGCCCCACCACACC
T7_17308_G09	CAGGAGGCCGAGCCAGCGTCAGACCGAAGAAGACCC
T7_17309_G09	CAACCGGCGAAAGACAGGTCCGACCCGCCGGAAGAG
T7_17310_G09	CACACCCAGCCGGCAAAGTCCGAGCAGAAGCGAGGG
T7_17311_G09	AGCAAAGCAAAGACGACGTCGCGCCGCGGGCCGAAC
T7_17312_G09	GCAGCCAGGCGCCGACGGTCACGGAAGCGACAACAA
T7_17313_G09	GCAACACCGGGGCAGCGGTCCAAACAACCCGAGGGA
T7_17314_G09	GAACGGAGGCGCGGCAAGTCGAGCCACAACACCGAC
T7_17315_G09	ACGACGAAACGACACCAGTCCCGCGGCAGGAGGAGC
T7_17316_G09	CAACCCAAAAAGGCGAGGTCACGCGACGCCAGGGGC
T7_17317_G09	AGAAGAAGGCAACCAGAGTCAGCCGCGCCGACCGCG
T7_17318_G09	GCACGAGGAGGCCACCGGTCCAAAGCAGACCACAGG
T7_17319_G09	CAAAACAGCCGACAGCCGTCCACCGAGGAAGGCGGG
T7_17320_G09	AAAGACGCGGCGGCAGAGTCCAACACCGAAGCCGGC
T7_17321_G09	GACGAAAAAAGAGCCGCGTCGCCAACGCGGGCAGCC
T7_17322_G09	GGGCAGCACCCCGCGGAGTCGAGCCGCAACGAAAAA
T7_17323_G09	GCCGACGCGGAGAAGCAGTCACACAGGCGGCAACCA
T7_17324_G09	ACGCGGCCGGCCCAACGGTCGCAAGCAAAGGACAAG
T7_17325_G09	ACGAGGCACCAGGACGAGTCGCCAACGACACGCAGG
T7_17326_G09	AAGAGGGGCGACGACAAGTCCAACCGCCGACGAGCC
T7_17327_G09	AACGAGCACGGCGCCAAGTCCAAGCGGGGAGAACCC
T7_17328_G09	GCGAAGGAGGCCACAACGTCACCGGCGAACGACGAC
T7_17329_G09	AGAGCCACCGCCGGCCGGTCCACGAGCGAGAAAGAA
T7_17330_G09	ACACAAAGCAACGACGGGTCGACCACGCGAGGGCGC
T7_17331_G09	GCACGACGACGACGCCGGTCACCAGCAGAGGAGAAC
T7_17332_G09	ACGCCAGACAGGAGGACGTCAAACCACAGCCGGGGC
T7_17333_G09	AGGAACACCGGCACGCAGTCGAGACCACCGGCAAGG
T7_17334_G09	GGCCCCAGCCGGCCCCAGTCAGAGAAGAAAAGACGG
T7_17335_G09	AAGACCGGCAAGCGACGGTCACGACCGCGGACAACG
T7_17336_G09	GCGGCAAACGAAACCCCGTCGCGAAGCAAGGAGGCC
T7_17337_G09	GGGGCCGAAGGCACCACGTCCACAAACGGCGACAAG
T7_17338_G09	AGAAACAGCGCCCCACGGTCGCAGCGAAGCAGCAGG
T7_17339_G09	GCGCGGCGACAAAAGCCGTCGAAGAGCAGCGACCAC
T7_17340_G09	CGACCGGCGAGGCAAGAGTCAGCAAGAGCCAGCCAC
T7_17341_G09	CGGCGAACAACAGACCAGTCACAAGCGAGGCGCGCG
T7_17342_G09	ACACCAACGGAAAGGAGGTCGCGCGCGCCAACGAGC
T7_17343_G09	GCCCCGCAGCAAGCAAAGTCGGACCGGGGCCAAAGA
T7_17344_G09	CAGGCCGCCGACGACGAGTCCGAGCCAACGAAAGGA
T7_17345_G09	CCAGGAAGCAAGGAGAAGTCGACCGCCAGCCGCACG
T7_17346_G09	GCCGAAGAAAAGAGACCGTCCGACCCGGCAGCAGGC
T7_17347_G09	CGACGGAAGAGCACAAAGTCGGCAGCAGCAGCCCGC
T7_17348_G09	AAGCCAGGAGAGGGCAAGTCCGCCCAGCAGAACGCC
T7_17349_G09	CGCCACAGACAAGCGAGGTCGGGAAGGCAACGCCAC
T7_17350_G09	GCCCAACCGGAGGAGGAGTCAGGAACAAGGCCCACC
T7_17351_G09	AGCAGGCGAACCACGCCGTCCAGACGCCAAGAAGGG
T7_17352_G09	GAGGAGCGGCCAACGGAGTCCGCCGACACGACCAAA
T7_17353_G09	CCAAGGCGCAGCAGAAGGTCCCGGCCAACGCAGAAG
T7_17354_G09	GCGCACAGCAGCCACCGGTCCGGGCAAACAGGAGAA
T7_17355_G09	CCGCGAGCGCGGCAAGAGTCGCACAACACAGGAGAC
T7_17356_G09	GAAACGGGAGCCAACCGGTCGCAGGCCAGCAACCAG
T7_17357_G09	AAACGCGGCAGCGCCGGGTCGACAAAGAACACGGCC
T7_17358_G09	CGAGACGCCGACCACCCGTCGGCAGGAAGGAAAGCA
T7_17359_G09	CACCCACAAAAGCCACGGTCGGGCCGGCAAGAGGGA
T7_17360_G09	GCCGAGGAGACCCCAAAGTCAGGAACGCAGCGCGCA
T7_17361_G09	CAGCAAGAGGGCAGCAAGTCAGGAGCCACACCCGGC
T7_17362_G09	GCGGGAGGCACAGACAAGTCGACGAAGCCCGCCACA
T7_17363_G09	AGCGACGCACGCGCGACGTCGCACAAAGAAGGACGC
T7_17364_G09	CCCAGAGCCGACCCCGGGTCAACGAGAGAGGAGAAC
T7_17365_G09	ACGCCACCAGAGGAGAGGTCGAAGACGCCACCAGGC
T7_17366_G09	AGGACGACGGACAGGACGTCACGCACAGGACCGCAC
T7_17367_G09	GAGCCCAGGCAAGAACAGTCAGCAGCGGCCGCAGCA
T7_17368_G09	ACGGAGAGCAGCGCCGAGTCAGCAACGACGGCCCAA
T7_17369_G09	GAACCAGCAGGGGCCAAGTCACACAGGCGACACCGG
T7_17370_G09	AGAGGAGCCCGGGCCAAGTCGGCAACAAGCAACCCG
T7_17371_G09	CGAAGGCACAGCAAAGAGTCAGCCACCCGGCGGCAG
T7_17372_G09	AGCAGCGCCACAGCAGGGTCCGAAGACGACGACCGA
T7_17373_G09	GCGGCAACAACAACGCCGTCGCCGAGGAGAAGCGAC
T7_17374_G09	AGCGAGAGGGCCCACCAGTCAACAGCGGAAGCCCAG
T7_17375_G09	CCACCAACCACAACCGGGTCAGAGAGCAGGGGCAGG
T7_17376_G09	AGACGCAACCGGCCCACGTCGAGAAGCAACCGGGGA
T7_17377_G09	GAAGACCGGGGCGGGACGTCGACGCAACCCACAACA
T7_17378_G09	GAACAACCGAGGAGGCGGTCAAGACCCGACGCGACC
T7_17379_G09	CAGCGAAGACAGCCAGAGTCACACCGGACGGGGCAC
T7_17380_G09	GAACGACGGAACAGAAGGTCACGCGAACCCGCCCGG
T7_17381_G09	GAGCACCGCCAACACGCGTCCACGGGAAGAACAGGG
T7_17382_G09	GGGGCAGAAACAGCACAGTCGCCGGGCAGAACCCCA
T7_17383_G09	CAGAGAAGAGGAGGACCGTCGCGCCACACAGCCGAC
T7_17384_G09	GACGACAGAGAAGAACAGTCCAGCGGCCCGCAGCCG
T7_17385_G09	CGAGGAGAGGGCGGCCCGTCAGCCACAACAACGCAA
T7_17386_G09	GAGCGGAGGAGGACGACGTCGACCACACGACCCAAC
T7_17387_G09	GACACAACACCGGCGGAGTCACGCCGACGCGAGAAG
T7_17388_G09	ACAAGGCGCCCGGCAGAGTCCAAAACCAACGGGGCG
T7_17389_G09	AACCAAGGCCGAAGGGCGTCGCAGACCACGCAAGCG
T7_17390_G09	CCAAGCAACAACAGAGAGTCGGCCGGACGGCGAGCC
T7_17391_G09	CCCAGCGCCGGGAACAAGTCGCCGAGGAACAGGACA
T7_17392_G09	GCCACCAAGCAGGAGAGGTCCCGCGACAGCAGAAGC
T7_17393_G09	ACCACAGGGGCCCAGGAGTCGACGAGGCAACCACAG
T7_17394_G09	GGACGCAGGAGGCGAAGGTCAGCAAACCCAACGCCC
T7_17395_G09	GGAGAGCAAGAACAGGAGTCCCCACCGACCGGCCGA
T7_17396_G09	CGGCGAAGCCACCCCGAGTCAGGAGGAAGAAGCCCA
T7_17397_G09	CCAGAACAACCCGGAGGGTCCGAAAGCCGACGGGAC
T7_17398_G09	CCGCAACAGGGAGCGAAGTCCCAGACAGACACGGCG
T7_17399_G09	CACAAGGGCGCCAGACGGTCAGCAGAAGCACCGCAG
T7_17400_G09	AAAGGGGCGCACACACCGTCACGACCGCGGAGACGA
T7_17401_G09	GACGGAACAAAGCCGCAGTCCCCGGCAGGAGCAGAC
T7_17402_G09	CAAGAAAAGACCCAAGGGTCCCGCCCGGCGGAGGAC
T7_17403_G09	AACAGCGAGCCACGAAGGTCCACCGCGAGGACGCAG
T7_17404_G09	CCACAGGGGAGCCACAAGTCGAAGCGCAGCCAGACG
T7_17405_G09	ACCGGCGGCGAAACGGCGTCCGGCAGAAGAACACCA
T7_17406_G09	CGCCCCGAGGAACCAGGGTCGACAAAGAAGCGACCG
T7_17407_G09	CAGGCGCAACAGGGGCGGTCACCCACCAACGAGAAG
T7_17408_G09	GCGAACCGAAGGACAGCGTCAACGCCGCCGGAAGCA
T7_17409_G09	AGGCCCGAGCCGCGGGAGTCGACGCAAGAACCAACA
T7_17410_G09	GGCAGCAAGGAGCAAGAGTCCGACCCGCACAAGCGC
T7_17411_G09	AGCAGCAAAGGCCCACAGTCCCAGGCGAAGACCGGG
T7_17412_G09	GGCGGCCAGCAAGCCCCGTCGCCACAAAAAGAAGGG
T7_17413_G09	AAACGGGGCAAGACCAGGTCCCCGCCGCAGACGAAG
T7_17414_G09	CGGCAGACCCAAGAAGCGTCAGGGCGCACCGCAAGA
T7_17415_G09	GCAACCAACGACAGCAGGTCCAAGGGGACGACGGCC
T7_17416_G09	AGCACCACCCAGGGAGAGTCGGACCAGGCAGAAGCC
T7_17417_G09	GAGGCCGCGAACGGCGAGTCAAGGAAGCAACACCCC
T7_17418_G09	AAGGACGCCCGAAGAGCGTCACACGACGGCAGCAGC
T7_17419_G09	AGACCACAACGCGACCGGTCGCAGCAACAGGCGGGA
T7_17420_G09	AACACGGACGAGCCGCGGTCACAGGAGCACCGACGA
T7_17421_G09	GAGCAAGAAGACGCCGCGTCACCCAGGAGGACACCG
T7_17422_G09	ACACGGCCGCCGCGGACGTCGGCAAAGAACAACGAG
T7_17423_G09	CGACGCAAGGGGCCCCGGTCGAAGCGAAACGAAACC
T7_17424_G09	ACGGAAACAAAGCCGAGGTCGACAACCCCGCGGCGG
T7_17425_G09	CAACCGCCGACGCAGGGGTCCGGCGAACAGACAAGA
T7_17426_G09	CGGCGACGGGCAACGCCGTCCAAGACAAAACGGCAG
T7_17427_G09	CAGGAGGAGCCAAGCCCGTCAGCCACAACGGCGGAA
T7_17428_G09	GCACAACAACACCCGCCGTCGGCGGGAGCAGGAGAA
T7_17429_G09	AGAAGGCCGACGACCGAGTCCGACGCAAAACGCCGG
T7_17430_G09	GGGGAGCAACGCAAGCAGTCAACACGACCGCGGCAC
T7_17431_G09	GCAAAGCAACGGAGGCGGTCCCGGCGGCAACACACA
T7_17432_G09	CAACGCGAACAAGAGACGTCAAGGGCGCCGGCGACC
T7_17433_G09	CGGCAAACCGGCGCAGCGTCCCAGGAAGAACGGAAC
T7_17434_G09	GACACCACCACCGGAGCGTCAGGAAGCAGAAGCCGG
T7_17435_G09	GGACGAGACCCAGAAGAGTCGGAGACCACGACCCCG
T7_17436_G09	CCGCAAGACAGCCGCCGGTCCCGAAACAGAAGGAGG
T7_17437_G09	GGCGCGAGCGACGCCGAGTCGACCGAAAGAAACCCA
T7_17438_G09	GAGACCGGAACAACGCCGTCGCCGACGACAACGGAG
T7_17439_G09	AAAGAAAAAGGCCCCGCGTCCCGCCAGAGGGCGACG
T7_17440_G09	ACGGCCCCAGCCGAAAGGTCACGCCGAAGAGAGGAC
T7_17441_G09	GGAGAGAAGAGGACCCGGTCAACCCCAACGACCGGC
T7_17442_G09	CAGCCAGAGGCGCGACAGTCAGACGCAGACCACGGA
T7_17443_G09	GCCGCAGCAGCAAAAGCGTCCGAAGCAGCACCAGGG
T7_17444_G09	ACCGGCCGGGACAAGACGTCACCCGAGAACGCAGGA
T7_17445_G09	GACGAAAGGCGCGCGGGGTCCAAGCCACCGCACAAA
T7_17446_G09	ACCAGCGGAAGAAAGCCGTCCCCAGGAAGGACCGCG
T7_17447_G09	CAGCACGCAAACCGGGCGTCAGCAGGACGAGCACAG
T7_17448_G09	GGCGCAAAAAAGAACCCGTCCGGGAAGACCGCCCGG
T7_17449_G09	GCCAGCACCGCAACCAGGTCCACGGAGAAAGGCGGA
T7_17450_G09	GCAAAAGGCGCGGAGGGGTCCGCAACCAAACCCGAC
T7_17451_G09	CACCGGGCAGCCCGAAGGTCCAACAACAAGGCGGAG
T7_17452_G09	CGCAGAACCGGAACGAGGTCAAGACAGCGCCGACGC
T7_17453_G09	AGAACGGGCGCGGGAGAGTCCAAACGAGCACCCCAC
T7_17454_G09	GCGAACGGCGACAAACCGTCGGCACGAAGGCAGCCA
T7_17455_G09	AACCCCGGAAAGCAGGCGTCGGGGCAGCAACGACCA
T7_17456_G09	AACCAGCGAAGACAAGCGTCCGCAAGGAGGGCGCCC
T7_17457_G09	AGACGGGCCCCACGGCGGTCCCCAACGAGAAGAAGA
T7_17458_G09	AGAGGCACGGCGACCCGGTCACCCGGAGAAACGACA
T7_17459_G09	GGAGGAACAAGCCAGCGGTCCCACAGCAGGAACCCG
T7_17460_G09	AGGCACGAGGAAGACGGGTCACACAACCCACGCGCG
T7_17461_G09	CGCGACGAGCAGCGAGAGTCAAACCAGCAGACGGCC
T7_17462_G09	GCAGCACACCAAGGAAAGTCCGGGACGACGGGCCCA
T7_17463_G09	AAGCAACCCAGGAGCAGGTCCCAGCCAGCAGCAGGG
T7_17464_G09	AGGCCGCCACAGAGGAGGTCAGGAAGCAGCCACCCA
T7_17465_G09	GGCACGAAAAAAAGGAGGTCGGGCCACGCCCCACCG
T7_17466_G09	AGACGAAGAGCACGGCAGTCGGACGAGCGCCCCAAC
T7_17467_G09	CGGACGAGCCAACGACAGTCCACAGCAGGAGCGACG
T7_17468_G09	CGGCAAGACAGGAGAACGTCACCGACCCGACGGCAG
T7_17469_G09	CAAAAAGACCGCCGCGAGTCGGAGGCGGCCACAGCA
T7_17470_G09	CACCACGACGAGAGAAGGTCGACCCACAGCGACGGG
T7_17471_G09	CGGACGCCGCCACAAAGGTCCAACAGCGGGGCAGAA
T7_17472_G09	GCGGCGGCAACCGCAGCGTCAACCGACAACAAGGGA
T7_17473_G09	AACCGCGGAAACGCCGAGTCCCACCGACAGAGGAGG
T7_17474_G09	ACACGCGGGCCGAACGCGTCGAGCCCGAAGACAGAA
T7_17475_G09	CCCACGGCAGAGGCGGCGTCGGCCAAAAAACGGACA
T7_17476_G09	ACGCCAGCCGACGAGAGGTCGCGGCAGAAGAACCAC
T7_17477_G09	GACCGGAACGACAAACCGTCAACGCCGACAGGGGCG
T7_17478_G09	GAAGCGGCAACCGCCAGGTCCAGGAAGACGGACACC
T7_17479_G09	CGAAAGAGAGAGACGCCGTCGACGCCCAGCACGGCA
T7_17480_G09	CACGCGGAGAACCACAAGTCCGACCCACGGAGGGGA
T7_17481_G09	AGAACAGCAGAGCCGCAGTCGCAGCGGAGGCACCAC
T7_17482_G09	CCCGGCAGAGGAGGAGGGTCAAAACCGCCGCACAAC
T7_17483_G09	GAGCGGCCACAAGACGAGTCGAACCGCCGCAGACGA
T7_17484_G09	CCGCCGGACGGAACAGAGTCAGCACACGCGACAAGG
T7_17485_G09	AGCAGACAACACCCAAGGTCACGCGAGGAGGCCGCG
T7_17486_G09	GACGCAGAGCCGACCCCGTCCGAAGCAACAGAGGAG
T7_17487_G09	ACCGGACCCACCGCAGCGTCAAGCAAAGAAGGCGGG
T7_17488_G09	ACCGACGAACCAACGACGTCGACGGACCGACGGGGA
T7_17489_G09	GCAAGAAGAACGGCAGCGTCCGCGCCACAAGGACCG
T7_17490_G09	CACCGGCAGAACGGGGAGTCAGCAGCAAAGACCCCG
T7_17491_G09	CGACAGCGGCAGAAAAGGTCCACAGCACCGCAGGCG
T7_17492_G09	GAGCAGGGCGCAGCACCGTCCGCACGAACACGAAGA
T7_17493_G09	AGGGGCGCCAGCACAACGTCCAGCAGCAACAGGACG
T7_17494_G09	CACCACGCGGCGGCGACGTCAGACGAGGACAAGACA
T7_17495_G09	AAGACGAGCGGCAAACAGTCACACCGGGGCCCGCGA
T7_17496_G09	GGAGACCAGAAACCGACGTCAAGAACGCCGCGGCCG
T7_17497_G09	CCGCGAGCACCACACGAGTCGACAACAGCGGGGAAG
T7_17498_G09	ACACGCCGCCAGAAAGGGTCCGGGGCGACGACACAA
T7_17499_G09	GGACAGGACGGCACCCAGTCAAGCACCAACGGCGGA
T7_17500_G09	AACAAGGCCGCAAACCAGTCCCCAGGGCGGGGAACG
T7_17501_G09	AGACGAGACGAAAGCGAGTCAGCGACGCCGACCGCC
T7_17502_G09	GCAGAGCACAGGACGACGTCACCGCAAGCAGCAGCG
T7_17503_G09	CCCGACGAAGGAGCCGAGTCCGACAGAACGGACGAC
T7_17504_G09	CAACAGAGAAACCGCACGTCCACGGGACGCGGCGGA
T7_17505_G09	AAGGCGACGACAGCAGAGTCACCGGCCGGCCGACAA
T7_17506_G09	GGAAACAAAAACCACCGGTCCGGGGCCCACGGCGGA
T7_17507_G09	GCGCAGGAGCAGGCCGAGTCCCACGACGCACGAAAA
T7_17508_G09	AACGGAACGCAACGGCAGTCGGACACGCCGCCGGAA
T7_17509_G09	CGGCCGCAAGAAAACCGGTCCGCGCAGGGGACAACA
T7_17510_G09	AACCGACCCCAGCAGGGGTCGCGAAAAGGGCAGCAC
T7_17511_G09	GCGGACGACACCCAGAAGTCCAAGACGCAGGCCGGA
T7_17512_G09	GGCAAGAGACGAGACGCGTCACACGCACAAGGCGCC
T7_17513_G09	CCACAGGGAGCCCCAGCGTCAGGAGGAAAGACCGCA
T7_17514_G09	GAAAGCAGCACGGGCGCGTCCGAAGGAAGACCACCC
T7_17515_G09	CACGCCGAAGGACGGACGTCGAAAGGAGCGCCCAAC
T7_17516_G09	GGGGCGAAGCAACACGCGTCCGCCAACAGCCAAGGA
T7_17517_G09	GACAACGACAGCAACGAGTCCGGACGGGCGACGACC
T7_17518_G09	CAACACAGCAGCAGGCCGTCGCCAGGGGACAGGCAA
T7_17519_G09	GAGACCAGCCGCGACGAGTCCGAAGCAGCCGCAGAA
T7_17520_G09	CACCGGGCGCGACCGGAGTCACAACGAAGAGCCGAA
T7_17521_G09	GGAAACGGAGGACCCAAGTCGCGGACACAGCAGCCC
T7_17522_G09	AGGCGCCACGCAGCCACGTCCCAAGAGGGAAGAAGC
T7_17523_G09	CCACACGGAACAGCAGCGTCAGCGACGCAGACGAGG
T7_17524_G09	ACAGCGAGCAACCCGCCGTCGAGAAGACGAGACGCG
T7_17525_G09	ACAAAGACCGACCAAGAGTCCCGACGCAGCGGGGCG
T7_17526_G09	CAAGGCGAGGCACAACAGTCCAGCAACGCCGAGCGG
T7_17527_G09	CGCAGCCCAAGCGGAGGGTCAGGCACACAGAACGAC
T7_17528_G09	GCGAAGACACAAGGAGAGTCAGACACCGGCCCCGGC
T7_17529_G09	CAGCAGCCGGAGGCGGCGTCGCAACAAAAAAGCCGC
T7_17530_G09	CACGGCCCGAGGCGGACGTCAAACAAGGCGCAGAAC
T7_17531_G09	GCAACCCCAAGACCGGAGTCGGCCGACAGCGAGAAG
T7_17532_G09	CGACACGGCCAACAGCAGTCGCAGAGGCGGACGACA
T7_17533_G09	CCCACCGGAGCAGGGAGGTCGACAAGCAAGCACACG
T7_17534_G09	GCAGCAAGACGACCACCGTCAAAGGCCAGGCGGACG
T7_17535_G09	CGCGCAGCAGCGACCGAGTCAGGCGGCGACAACAAA
T7_17536_G09	GGCCCGCAGGAGAACGCGTCAAGAGCCGAAGCACCA
T7_17537_G09	ACCAGCCAACCAGGCGGGTCCGGCGGAGGAAAACAC
T7_17538_G09	CACCAGAGCAGAAGGGAGTCCCACGAGAGCAGCCGC
T7_17539_G09	GGAAGCACACCCACCGCGTCAGCGCCGAAGAAGAGG
T7_17540_G09	AGAGCGCCAGCCACGACGTCGACAAGGGCAGGACAC
T7_17541_G09	GGACGAGAGGACGCCCAGTCCAACGGAGAACGCCCA
T7_17542_G09	CGCGGCGGAAGACCCCAGTCCGACGACGAAACAAGG
T7_17543_G09	AGCAGGAAGCGGCCGAAGTCCGAAACACCCCGCAGG
T7_17544_G09	GAAGCAAGAGCAAGAGGGTCAGACCCCACGCCGCGC
T7_17545_G09	GCAGCGACGCCGCAGCAGTCAACAAGAAACGCGGCG
T7_17546_G09	GAGCAGCGGCGACAACAGTCCGACGACGAAACCGCG
T7_17547_G09	CCCGGCGAAGCCGGAAAGTCCAGGCGACGAACAGCA
T7_17548_G09	GGGCCGAGCAAGAAAGGGTCCGCGCACCCACAACAG
T7_17549_G09	CGGACCACCACAACGGAGTCCCGAGAAGGAGGGCAC
T7_17550_G09	CGCGCCAAGCAGACGACGTCAGCACGAAGAACGGCG
T7_17551_G09	CAGGAGGGGAGCAACGGGTCAAACACCCGGACCCCA
T7_17552_G09	GGAGCGACAACAAGCACGTCCACACCAGGACGGGGC
T7_17553_G09	GCCGCCAGCACAAACGGGTCCAGGAGGACGCCAGAA
T7_17554_G09	GAGCAGAAGCGGAACCAGTCCCACAAGCGGCCGCAG
T7_17555_G09	CGGAGCCGACAGCGCGGGTCAAAAAAAAGCCGCCCG
T7_17556_G09	AAGCAAGAGACGGCGACGTCCGGCAGAGGACCACCC
T7_17557_G09	GCCCAGAAACAAGGGAAGTCAGGCCGCCCCAGGACG
T7_17558_G09	ACGACGACCAGCCGGAAGTCAGGAGACGACCGCACG
T7_17559_G09	GGAAACCAGAAAACGCGGTCCAGACCCCAGGCGCGG
T7_17560_G09	CGGCGACCAAGACGACCGTCAGGCGGAGGCCAAACA
T7_17561_G09	AAGCCAGCGGGGCACACGTCCAAGAACACCGAGGCG
T7_17562_G09	ACGGCAGGCCCAGACCAGTCCGAAACAGCGGACGAG
T7_17563_G09	AACCACGGCCGCCAACAGTCGAAGACGGGGCAGCGA
T7_17564_G09	GCAGCCCAAGCCCGACGGTCAGAGGACCACGGAGAA
T7_17565_G09	GAGGCAGGCGACGCAAAGTCACGACGGCCGACCAAC
T7_17566_G09	AGACCGGCGAGCGCGGCGTCCGCAACAACAACGAGA
T7_17567_G09	GGGGCGGAAAAAAAGCCGTCCGGACCCCAACCGCAG
T7_17568_G09	AACGACGACGACCACCGGTCGCAGACGAAGGAGGCC
T7_17569_G09	AAGCCGCGACAGCAACGGTCCAGGGCCGAAAGCCAG
T7_17570_G09	AAAGAACGGCCGACCACGTCCGACGCCGGCGAGAAG
T7_17571_G09	GCGAGACAAAGAGGAGAGTCGACCACCGCCGCCGAC
T7_17572_G09	CGGCAACACGCGCCAGAGTCGCCGCGGGAAGAAAAC
T7_17573_G09	CAGCACCGGCAGCACAGGTCCAAGAGGAAGGAGCCC
T7_17574_G09	GAGGAGGACGACCGGCCGTCACAACGAGGCAACCAC
T7_17575_G09	GACAGCGCCCGACGAGGGTCGCAGACAGCAGCACAA
T7_17576_G09	GCCGCAGAAGACCAAGCGTCGCAGACCAGCAGAGCG
T7_17577_G09	ACCGGCGCGGCAAGAGCGTCCGCGCAAAAGAGCAAC
T7_17578_G09	GAGACGAGACAAGGCAGGTCGACCGCCCACCACAGG
T7_17579_G09	GGCGAAGCAGCCGCGGGGTCAAGACAGCACACCAAC
T7_17580_G09	GCGGACCGGACGACGCGGTCGCAACAAGAAACCCGA
T7_17581_G09	ACAAACAGCGACCGAAGGTCGCGCCGAAGCGGACGC
T7_17582_G09	ACGACAGGAGAGGGGCGGTCACGAACAACGCCCACC
T7_17583_G09	CGCCCCGCAACAAGAAAGTCGGAGGAGCGGACGACC
T7_17584_G09	GGCGGACGACACAAAGGGTCGACACCGCGACCCGAA
T7_17585_G09	GACCGGAAGACGCCCCGGTCGAAACAGCAGGAAGCC
T7_17586_G09	GCAGCACCGAAGAGCGGGTCACCAACGCCAACGAGG
T7_17587_G09	CGCACAGCAGACAACACGTCGGCCGCGGGAGGACAA
T7_17588_G09	AGGAGGCGGACGACACGGTCGCAACGACACCGCCAA
T7_17589_G09	CAACACGAGAACGGCCAGTCCGGCGACGAAGACGCG
T7_17590_G09	CGGGCGCGGACCCGAGAGTCAGACAACCCGCAAAGA
T7_17591_G09	GCCGACGACGAGGGAGGGTCGCCAGAACACAAACCC
T7_17592_G09	GAGGAACGCCAACAAGGGTCCGGCGAACGCACCGAC
T7_17593_G09	GCACCGCCACAGCACAGGTCCAAGAACGAGGGAGCG
T7_17594_G09	GACCACACAGGCGCGACGTCGAAGACGGCGCAGAAC
T7_17595_G09	CGGAACACGCAGGCCGAGTCAAAGCAACCGCAGGGC
T7_17596_G09	CAAAGGAGGCGCACCAGGTCGAGAACCCCGGCCGAA
T7_17597_G09	ACAGGCCGGCAGCACAGGTCAAGCCACAGAGGACCG
T7_17598_G09	CGCCACACCAAGCGCGCGTCAGAGCAGAAGGGAGCA
T7_17599_G09	ACCACGCGGGGAAAACGGTCGCGGACAAAGGCCCCA
T7_17600_G09	ACAGGGCGGCGCGGGGCGTCAAACACACCACCAGAA
T7_17601_G09	ACGGACAGCACACAGCGGTCCAGCGGACAACGCGGA
T7_17602_G09	GAGACCGCCCAGAACCGGTCAAGCAAGCCGGAGGCA
T7_17603_G09	AGCCGGACAGCACCACGGTCAACCGAGCGGACGGAA
T7_17604_G09	ACGGGACAAGAGGACGCGTCGGAGCACCACACCACG
T7_17605_G09	ACGCAGCAAAAACGGCGGTCCCGGGCACACAGCAGG
T7_17606_G09	GGGACGCACCGAGACGAGTCAGCAACAAGCACCGCG
T7_17607_G09	AGACGGAAGACAGAGGGGTCCCACCGGCACCCAGAC
T7_17608_G09	ACCCCACAAGAAAAGCCGTCGGCACGCGGGGAGGAC
T7_17609_G09	GCCGCAGCGAGCGGAGCGTCGCAGAACAACCAGAAC
T7_17610_G09	GGAGGCAACGCCAGCAGGTCCACAGCGAGAACCGCA
T7_17611_G09	CAGCGACGAAACAAACAGTCAGGCCGGAGCGGCCGC
T7_17612_G09	AGCACCCAAGACCAGAAGTCGGGCCGACGGCAGCAG
T7_17613_G09	GAGGGAGAAACAACCGCGTCAGACCGGGACGCCCCA
T7_17614_G09	AGGGCCGGACAGCCACAGTCGAGCCCAAACGGCAAG
T7_17615_G09	AGCGGGCGACAACAGACGTCGGCGCCACCAAGACAG
T7_17616_G09	AGGAGAGACCAGAAGACGTCACCAGCCGACGCCGCG
T7_17617_G09	GAGCCAGGACGGCAAAGGTCCCGCAAAGACGCCGAC
T7_17618_G09	GCGGGCGAAGCAACGCAGTCCGACAACCACGAGGAC
T7_17619_G09	CAGCCAGCGGACAGCAGGTCAAAACCACCGGAGGGC
T7_17620_G09	CACCCAGGGCGAACGCAGTCCCGAGGAAGAGCGCAA
T7_17621_G09	GAACCCACCAAGGACGGGTCGCGGCAAGGAGCACAC
T7_17622_G09	GAAGAAACCACGAGGAGGTCCGGCAGCCGCCCCAGA
T7_17623_G09	GGAAGGACGACCAGCCGGTCAGGCCCAACGCAAGAC
T7_17624_G09	GAAGAACAGCAGACGAGGTCGCCGGCCCCGAAACGC
T7_17625_G09	GCGGGCGACGGGAGACCGTCCCCACAAACAGAGACA
T7_17626_G09	CCAAGACACCAAGAGCCGTCGCGGACACGAGACGGG
T7_17627_G09	GACGAGCCCAGACAGGAGTCCGGCAAAGCAGCCCAG
T7_17628_G09	GAACCGGGACACCCAGCGTCAACAAACCAGGGGCGG
T7_17629_G09	GCCAGAAGAGGCACAGCGTCACCGCGCAACGGGACA
T7_17630_G09	GGACAACGCAGCACCGAGTCCAGACGACGACCGAGG
T7_17631_G09	CCACAGCACCAAGCGGCGTCGCAGGAAGCACGGGAA
T7_17632_G09	GCACCAAACGGCAGCCGGTCACGAGCGCCAAGAGGA
T7_17633_G09	GAGGAAGCACCAACCCGGTCGGAACGCCAAGCGCGA
T7_17634_G09	AGGGAACCGCCCGACGAGTCCAGACGACGACGAGCA
T7_17635_G09	GGCGCCACAGGCCAGAAGTCGGGAAGACACCCCGAA
T7_17636_G09	GCCGAAGAACGCCGCCAGTCAAGGCACAAGGCGCAG
T7_17637_G09	GCGGCAACGCAGAACACGTCGAGGGCAAGCAACCGC
T7_17638_G09	GACAGGGAAGAACCGCAGTCGCCAGGCCACCAACGG
T7_17639_G09	CAGCCGGAGACCGGCAAGTCCCGCAAGAAGCAGCGA
T7_17640_G09	GCGACGAAGGGAGAACGGTCCACGGCCACGCAACAC
T7_17641_G09	GGCGGGAAGCCACAGCCGTCACCCAGAAGGACGACA
T7_17642_G09	CGGACGGAAGCACGACGGTCGCACCACCCAAGAGAG
T7_17643_G09	AACGCCGCCGGCAAGCCGTCGAGGAAACGAAACGGC
T7_17644_G09	GAGAGGAGCAACCCACAGTCAGACGCGCGAACCGGC
T7_17645_G09	CCACACCGAGAAGGAGCGTCCCGCAAGGCAAGAGCG
T7_17646_G09	AAACACCCCACCCGGGAGTCGCGAAGAAGCGGGAGC
T7_17647_G09	GGCGGAACGGCAGACAGGTCAACCACCACGCACGAG
T7_17648_G09	GCCGGACCGACGGCGAAGTCCACGGACAAAGAGCAC
T7_17649_G09	GAAGAGCGGCAACCGCCGTCACGGGAAGCCCACAAG
T7_17650_G09	GGCGGACCACAAGGAAGGTCGCCCAAACCAAGCGGC
T7_17651_G09	ACGGCCACCAGAGGCCAGTCGGGAGAGGCACCCAAA
T7_17652_G09	CCAAAGGGCCCGGAAGAGTCGCGCAACCACACAGGG
T7_17653_G09	GCGCGCCCAACGACGAAGTCGACAAAGCAACGCGGG
T7_17654_G09	AAAACCGACCCACCAGCGTCGGAAGGGCCGGGGACA
T7_17655_G09	CCACGGGGCAACCCGAGGTCAAACGCAAACGCGGAG
T7_17656_G09	GCGGACAAGCAGCACAGGTCCCACGACGGACCGAAG
T7_17657_G09	GCACAACACAGAGACCCGTCAAGCGCGGGCACAGGG
T7_17658_G09	AACGGCCAAAAGGACGCGTCCACACAGCGAGGCGCG
T7_17659_G09	GGGACCACACCAGGGCAGTCGGAGCCCCAAGGAACA
T7_17660_G09	CAGGCAAACGCGCCCACGTCACAAGGGAGCAGCAGG
T7_17661_G09	CAAACCAGGCGGCGCAGGTCCGCAAGCACAACAGGG
T7_17662_G09	AAGCCGCCAGGCAGAAGGTCACACGCGGCGACAAGC
T7_17663_G09	CAGCAGCCACGCGAGAAGTCACGCACGGCAGGCAGA
T7_17664_G09	ACGACCACGACCAACGGGTCCGGCCGAACGGGAAGA
T7_17665_G09	CAACCCAAGGGCCAGCAGTCACGAAGGGGAGCCGCA
T7_17666_G09	CGGCAACGGAGGAGGAAGTCGCCGACACCCGAACAC
T7_17667_G09	AGCGCACAACACCCGCCGTCAAGCGAGGGCGGAGAA
T7_17668_G09	GCAGGCCGGCCCCAGAGGTCACCAGAAGCCAGAAAG
T7_17669_G09	CCACACAGGAGGGGACAGTCCGAACGACACACCGGG
T7_17670_G09	GCACCACCAACGGAAAAGTCAGACGCGCCGGCGAGG
T7_17671_G09	CAACCACCGCCGCCGGCGTCACGGAAGGGAAGAAGA
T7_17672_G09	CGGGAACCACGAACGACGTCGGCCCGGAGCAGCAAA
T7_17673_G09	ACCAAACACAAGGCGCGGTCCCGACGCGCAGGGAAG
T7_17674_G09	CGGCGGACAGCACGGAAGTCAGCCGACGACCAAGAC
T7_17675_G09	GACGCCCCGGAACGGAAGTCGGGGCCACCAACAAGA
T7_17676_G09	GAGGGCGAAAGGGACACGTCGCCGACCGCACCCAAA
T7_17677_G09	AGGCGGGCCACGAACACGTCGGCCAGCAAACAGGAC
T7_17678_G09	AGCCAGCGACGGCCGCGGTCAGAACACAAGGCACAG
T7_17679_G09	GGGACGAGAAGCACGCCGTCACAACAGACGACGGCC
T7_17680_G09	GCCGGGAGCGAAACAACGTCCCACGCAGCGAAGAGC
T7_17681_G09	GGCCAGCACAAGGACGCGTCAGACCCACGAAGCAGG
T7_17682_G09	CGCAAGGCCCGAAAAGGGTCGCAACAAAGGCGGCCC
T7_17683_G09	GGGGCAACCAACGACGAGTCCCGAAAGCCGCCGAAG
T7_17684_G09	AAAAACCCCGCGGGGACGTCAAGCGAGCCGCGCAGA
T7_17685_G09	CGCAAAGGGACCCACAGGTCCAAGAGCGGAGCCGAC
T7_17686_G09	GAAAACGCGCCGCGAACGTCCAAAGGGCGGCGAACC
T7_17687_G09	GCAGGCAACCAAAGCCCGTCACACGAGGGGCAGACG
T7_17688_G09	CAAGGCGCCCCAAGCCAGTCAGACGGCGAACGAGGA
T7_17689_G09	AGCAGACCACGCCGGGAGTCGCAGAAGGACCAGCAC
T7_17690_G09	CACCAAGGACCACGGAAGTCGAAGCGCGGCACCAGG
T7_17691_G09	AAGGAACAACGCGCCGGGTCCGCAGCACGCAGACAG
T7_17692_G09	GAGAAACCGGAGCAGGGGTCCACAGCACCACCGGCA
T7_17693_G09	GCGCGACGAGAAGCAGCGTCAGCCGACACAAAGCCG
T7_17694_G09	CACCGAAACGACGGACAGTCAAGCCCGGCGCAGGGA
T7_17695_G09	ACACAAGCCGACGAGGGGTCAGAGCGCACCCCAGGA
T7_17696_G09	CCGGCAAGCCGAAGAGGGTCGAGCCAGCCGAACAAC
T7_17697_G09	GGGAAGAACCGCCGCCAGTCCAAACGCGGAGAAGCC
T7_17698_G09	AAGCCGGGACCACACGCGTCCAAGAGGACGCAGCGA
T7_17699_G09	CCAAAGGGAAACCCACGGTCGGAGGACACCCGAGGC
T7_17700_G09	ACCACCCGAAGAGACGGGTCCGCAGCGAGGACAAGC
T7_17701_G09	AGCGAACCGGCAGGCCGGTCACAAAAACGCCGCGAG
T7_17702_G09	CGAGGAACGCCGAAGAGGTCCGCACGACGACGCACA
T7_17703_G09	GAGCGAAAAGAACCAACGTCCCGCGGCCGAGACGCG
T7_17704_G09	AGAGAGGAGCCGGCCCAGTCCACAGGACCCCGAAAG
T7_17705_G09	AGACGGCCACCAGGCCCGTCCAGAACGACAGGAGAG
T7_17706_G09	CCACGGGAACAGCGAAGGTCGCGACACCAACGAGCG
T7_17707_G09	ACCGAGGCCGACGGCGAGTCCCAAGGCGACAAACGA
T7_17708_G09	CCCGAAGGAGGCGAACAGTCACGCAGAACGGACGCC
T7_17709_G09	ACGAAAAAAAGGGCCGCGTCCCGCCACCGAGAGCGG
T7_17710_G09	GGAAAGAACAAGCCGCGGTCACCGCGCAGACGACCG
T7_17711_G09	AGCGGGCCAGCAAGACAGTCGCCGACAAGCAGCCAG
T7_17712_G09	AACAAGCGACCGCAGGAGTCACACGGCCGGCCGGAA
T7_17713_G09	AACGGACGCAGCGCGCCGTCCGGGAAAGGAAAACCC
T7_17714_G09	GGGCGACCCCGAGGACGGTCACCAAAAGGACCAGCA
T7_17715_G09	CGGGGCGGGACCCAAGGGTCCCAACCAAAAACGACG
T7_17716_G09	GGGCGACAAAGACCCGCGTCAAAGCCGGGACCACGA
T7_17717_G09	GACGACACCGGCGCAGGGTCAGGCAGAACCGACCAA
T7_17718_G09	CGCAGAGAGCCCCAACGGTCACAGAAGCCGCAGAGG
T7_17719_G09	GGCCGCGAACCCAGAAGGTCCGCCAGAGGGAAACAC
T7_17720_G09	ACACCGGGCGCGACCACGTCGGCGACAAAACGGGAA
T7_17721_G09	AGAGAGGGGACAAAGCCGTCACCGCGGCACCAACGC
T7_17722_G09	GCCGCCGGACAGCAAAAGTCGCGGCGGGACAACCAA
T7_17723_G09	ACCAGGCCGCAGAACCGGTCGACACAAGAGACGGCG
T7_17724_G09	CGCAGAAGCGAACGGCGGTCCCGGAGGCACCACAAA
T7_17725_G09	CACCGACGCCGAAGCAAGTCAGGAGGAGACCAGCGC
T7_17726_G09	CAGGCCAGAACCCGAGCGTCACGCACCGAGGAGGAA
T7_17727_G09	GACACAAACAGGCCCAGGTCGACGGAGGACGCCCGA
T7_17728_G09	ACAAAAACGGGGCGGGAGTCCACGCCGCGCCGAAAC
T7_17729_G09	ACAGCGCCGGAAAGAGAGTCAGGCCAACGAGCGCCC
T7_17730_G09	CGGAAGACCCGGCAACAGTCGCCAGGACCGGAGCAA
T7_17731_G09	GCAAAGCGGGGAACAGCGTCAGACACACCCAGGCGC
T7_17732_G09	CCACGGCACGACAACAAGTCAACGAGGCCCGGGGAG
T7_17733_G09	ACCCAGCAAACAAGCGCGTCCCCAGGAGACGGAGGG
T7_17734_G09	CACCGGCCGGCGGAACGGTCGAGAAACAACGCAGAC
T7_17735_G09	GGAACCCACCGGCACAGGTCCAGCAGCGACAAGGAG
T7_17736_G09	AAGCGGCGCAGAGGACCGTCCAGACGGCAAGCAACC
T7_17737_G09	CAGCAGCCCAAAACCGCGTCAAGGGCCGGGGAGACA
T7_17738_G09	CACGACGGGCCAAGGAGGTCAGAGCCACGCCACAGA
T7_17739_G09	CACCGGCACAGACGGCAGTCGGAGCAACGGCAGACA
T7_17740_G09	GACGAGCCGGCCAGAAGGTCGACAAGAGAGCCCCAC
T7_17741_G09	AACGCAAGCGCCGCACGGTCGGACGGCGACACGAAA
T7_17742_G09	CCGAGGAACCCACCCGGGTCCGAAGAACGAAGCAGG
T7_17743_G09	ACGAGCACCCAGAGCAGGTCAACCGAGCGGACGGCA
T7_17744_G09	AGAACCGCCCCACACCAGTCGGCGGAAGGAGGAGAC
T7_17745_G09	GAGAGGCGGCCGCCGACGTCAAACCACAGCACAGGA
T7_17746_G09	AGCCGCCGGCGCAGACGGTCACGCACGCAAGAGAAA
T7_17747_G09	AGGACGAGACGCCAAGAGTCCACACGAGGGCCCAGC
T7_17748_G09	AGAAAGCACGCGACCCCGTCGCGGAAAAGAGGCCGC
T7_17749_G09	CGAAGAAAACCGCGCAAGTCAGAGGCCGCAGGGCCC
T7_17750_G09	AAGACCACAAGCAGCACGTCAGCGGGAGAGCGCGCC
T7_17751_G09	AGCACAGGACACCGACAGTCGCAGGCAGGACCGAGC
T7_17752_G09	GCCACGACGAGCCAGGAGTCGAACCGAGCAACGAGC
T7_17753_G09	CAGAGACGGAGGAAACAGTCAGCACCGAGCGGCCCC
T7_17754_G09	AGCCGCAGCGACCACGAGTCAACGCAAGGGCGACGA
T7_17755_G09	AGAGCCAGCAAAGACGAGTCGACCGCGGGCGCAACC
T7_17756_G09	CGACGCCCGGGAAACAGGTCCAGGAAACAACGCCGG
T7_17757_G09	CACAGCCAGGCCGGACAGTCAGGAGCCCCAAGGAAG
T7_17758_G09	GCACGGGAAGGCGACACGTCAACAGACCCCGGGACA
T7_17759_G09	CGAGGACAAGACCCGCGGTCCGCGCGACACGAAGAA
T7_17760_G09	CGCCGCCGGGACGCGGGGTCAAAACAAAAACCCAGG
T7_17761_G09	CGACCGACAAAACGGAAGTCCAACCCGGCGGACGGG
T7_17762_G09	GAACAGGAGAGGGACAGGTCCCCGACGGCACCCACA
T7_17763_G09	GGGGCGACGCGCACGCAGTCACACCCCGAAGAGAAA
T7_17764_G09	GACGAGCGGCAACCCGGGTCAAAACGCCAAGGCCGA
T7_17765_G09	GGCAGCCACACCACCAGGTCGAGGACACGGAGAGCA
T7_17766_G09	AAGACGCCGGCCAGCCGGTCAAGCGAGAAGCCAGAC
T7_17767_G09	CGCAAGAAGACACGCGCGTCGCAAAAGCACGCGGGC
T7_17768_G09	GGAACCACCACCCCAAGGTCAAGAGCGGACGGCGGA
T7_17769_G09	CCCAGAGAGACCCGCGAGTCAACACACGAGGGGACG
T7_17770_G09	GGGAAGACAGGACCGCCGTCAGACCCAAGCGCGCAA
T7_17771_G09	CAGAGCAAAGAGAACCCGTCCACCCGCGGAGCGAGG
T7_17772_G09	GAGGGGCACGAAGCGCAGTCCCAAGAACGACCAGCC
T7_17773_G09	GCACAGGGCCGGCGACCGTCAAACAAGACGACGCAG
T7_17774_G09	AACGACCCCGGGGAAACGTCGGCACGCCACAGGAGA
T7_17775_G09	GACCAGCAGCGACCGGGGTCACCGAACCAAGACGGA
T7_17776_G09	AGGCGACCAGAACGCACGTCGCGGAAGAAGCCCCAG
T7_17777_G09	ACGCGCGCGGACGAGCAGTCACGCAGACGACAACAG
T7_17778_G09	CCCGGAGGACACACCCCGTCGAGGAAGCCAAAGGAG
T7_17779_G09	GAGGGCCGCGGCGGGAAGTCCACCACCCGAAAAACA
T7_17780_G09	AACGAACCCGCGACGGAGTCACAGCCAGGGAGGCAC
T7_17781_G09	CGACAGCAGGAACCACCGTCACGACAAGGCGGACGG
T7_17782_G09	CCACGAGCGCACAACCGGTCCAAGAAGGACAGGGCG
T7_17783_G09	CACGGCAGGCAGACCGCGTCGCAGGACCAAGACGAA
T7_17784_G09	GCGAGCAAGCGAAACGCGTCCCACCAAGAAGCCGGG
T7_17785_G09	ACCAACGAGAGGCCCGGGTCCAGACCGAACAGGACG
T7_17786_G09	CAGGCGACACCAGAGGAGTCGGGAAACCCACCCGAG
T7_17787_G09	AGAAACAAAGCCGCCAGGTCCAACGCGGGGCCGGCA
T7_17788_G09	AGCCAAAGACAGCCGAGGTCCAGACCGCCAGGGAGC
T7_17789_G09	GACGCCGACACGAGAGCGTCGAGCAAGCGACCCAAG
T7_17790_G09	GAGGGCCGCCAGGGACGGTCAACGACCACACCAGAA
T7_17791_G09	ACAGCAAAGGGCCCCGGGTCCGCCGGCAAGAAGCAA
T7_17792_G09	AGAAGGGGCACCACCACGTCGACCGAACGGACACGG
T7_17793_G09	GCAGAGGCAGCACCCACGTCCCAAGGGACAAAGCGG
T7_17794_G09	AACAACCAGGGCCCAAAGTCCACCGCGCGAGGGAGG
T7_17795_G09	CAGCAGCGCGACCAGCCGTCACAGAACGAACGGGAG
T7_17796_G09	ACGAACGAAGGAGACAAGTCGCGACCCACCCGGGCG
T7_17797_G09	GGCACCGGCAACGAAACGTCAAGGACCGAAGGGCCC
T7_17798_G09	GGGCAACCAGGCCCACCGTCAGCAGAGAGCAGACGA
T7_17799_G09	GCCAGAGAAAGAGAACCGTCCGGCCGCGACCGAGCA
T7_17800_G09	GCGCCCAGCACAACACGGTCGGAGGCCGAGAAACAG
T7_17801_G09	GGCCGCACGACAGCACCGTCCGCGGACAAAAAGGAG
T7_17802_G09	AAGGCCGACCCGGGCGGGTCAGCGCACCAACAAGAA
T7_17803_G09	GACAAACCGCCCCGCGGGTCCGGGACAGGAACAAAG
T7_17804_G09	CAAAGGGCGAAAGCACGGTCAACCAGGACCCCGCGG
T7_17805_G09	GCAGGCAGAGGAGGCCGGTCACGACACCACCCAAAG
T7_17806_G09	CGCCAACAGGCGGAGAGGTCCGAAGAGACACCCCGA
T7_17807_G09	CGGACAGACGAGGCCAGGTCCGCCCGAACAAGACGA
T7_17808_G09	CGAGAAAGACACGGCGGGTCCCAGCAGAACGCCGAC
T7_17809_G09	ACCAAGAAGCCGGACGCGTCCAGGCGAGGAAACGCC
T7_17810_G09	AACACCAACGCAAAAGGGTCCGGCCGCGGACAGCGG
T7_17811_G09	ACGGCAGCAGAAGGAAAGTCACGACCGCGAGCGCCC
T7_17812_G09	CACACAGAGGGAACCGAGTCGCGCCGGCAGCACGAA
T7_17813_G09	GCAGCCGGAGCAGCCAGGTCACAACACGCGGGACAA
T7_17814_G09	ACCCGCAGCGCCGAGCGGTCGGGACGACAAAACAGA
T7_17815_G09	GAACCAGCACAACGCGGGTCCGCGCAAGGAACAGCG
T7_17816_G09	ACGGGGAGAACACCCCGGTCAGAGACAACCGCCGAG
T7_17817_G09	GCCCAGGAGGAGCGCAGGTCCAGGAACCACAACCAG
T7_17818_G09	CCCAGCGGCCAGAAGGAGTCACGACGACAACAGCGG
T7_17819_G09	CGGCGGCAGAAGCAAGAGTCCGACGACGCAGACACC
T7_17820_G09	GCGAGAGACAGCAAAGCGTCGGCAGCCGACCAAGCC
T7_17821_G09	AAACCAGAAGGGGACCGGTCCCGCCGAGGCACAACG
T7_17822_G09	AAGGGAAGACCGGCCAAGTCCAGGCCAACACGGCCG
T7_17823_G09	GCCGGGCAACGACCGACGTCGAGAAAGACCCCGAGA
T7_17824_G09	AAACAAGGCAGACCCACGTCGCCGGAGCGGCGGACA
T7_17825_G09	GCAGCCAGCAAGACCAGGTCGAAGGCCAGACAGCGC
T7_17826_G09	GAGCGCCACAGCGGGCGGTCGCGACACGAACAACAA
T7_17827_G09	CAACAGGCAACAAAGGGGTCCCCGCCAGGGGACAGC
T7_17828_G09	GACGGAGGCCACCGAAGGTCCACGAAAACCGACGCG
T7_17829_G09	CCAACGGCGGCCACAACGTCACAGAAGGAGGCGGCA
T7_17830_G09	CGAAAACGGGCCGGAGGGTCAAAACCCGCCGCAGCA
T7_17831_G09	CACAAGAAGCCCGAGAAGTCAGGCCAGCCCGCAGGG
T7_17832_G09	AAGGGACCACGAAGAAGGTCGGCCCGCACGACACGC
T7_17833_G09	CAGGCGGCGCACCAAGAGTCACGCGACCAGACAAGG
T7_17834_G09	AAGGGCCCCGGAAGAACGTCCAGCCCGACACAAGGG
T7_17835_G09	GCGGACGAGCAACGCCCGTCACCAGGACCAGGGAAA
T7_17836_G09	GCCCCGGAGCAAGGCGCGTCCGAGGCAAACAGCAAA
T7_17837_G09	CCGACCCAGAGGAGGGCGTCCGACGCAACCGAAGAA
T7_17838_G09	CAGAGCGCACCGCGAGAGTCGGGCCAAACGACAGCA
T7_17839_G09	AACCGCGACCCCAGCCGGTCAAGAAGCAGGGCAGGA
T7_17840_G09	AGAACGACGAGAAACCCGTCACGGGCCGCCCGGGAA
T7_17841_G09	CAGGGGCCAAGGAAGCAGTCAGCACCCCGCACAGGA
T7_17842_G09	GGCGCACCCAGGCCACGGTCACAAGGAAGGACACGA
T7_17843_G09	CACAACCCCACGCAAGCGTCCAGGGGAAGGAAGCGG
T7_17844_G09	GCCGGAAAACCACAGCGGTCGGGCACCACAGCGGAA
T7_17845_G09	CGGAAGGCAACGGGCACGTCAACAGGAACCGACGCC
T7_17846_G09	GCCGAACAACGGCGAACGTCGAGGAGCGAGACCACC
T7_17847_G09	GGCGCGACCAGGAGAAGGTCAGCCCAACCCGAACAG
T7_17848_G09	GCGAGACCCGCCGCAAGGTCAAGCAGCAGGAGACAC
T7_17849_G09	AAAGACACGCGGCCGGCGTCAGAAGAGGGCCACCCA
T7_17850_G09	CCGCGCGGGCAGAACCAGTCCAAGCAGACAAAGGCG
T7_17851_G09	GCAGACGAAGGAAGCACGTCCAGGCCGAACCCGACG
T7_17852_G09	AAACCGACGGCGGAAACGTCGACAGGGCGACCCAGC
T7_17853_G09	ACCACAAGAAAGGGCGCGTCGCAACCAGAGCCGGGC
T7_17854_G09	CCGCCACAACAGACACCGTCGACGCGGGAGGGGAAA
T7_17855_G09	AAGGACGGCACAGCGACGTCCGAGCACAACGGCACG
T7_17856_G09	AAAGCCGCAACGGACGGGTCCAGCAGGACAACGCCG
T7_17857_G09	CCACGACCACCGGGGAAGTCGAGAAAGCAGCCAGGC
T7_17858_G09	AGGCAACGCGACCGAGCGTCAACAGGAGACCCGCAG
T7_17859_G09	CAGCGCAGCAGCCAAACGTCAAGGACCACGGAGCGG
T7_17860_G09	AAGGGGCACACACCAGCGTCCCAGCGAGGCGACGAA
T7_17861_G09	CCACCCACAGGAAGGCGGTCGGGACAAAACCCGGGA
T7_17862_G09	CAAGGCGCACCGCAGAAGTCCGGAGGCGCCCGAAAA
T7_17863_G09	ACGACAGGACCACACGAGTCACGGGGCAGCGACCAG
T7_17864_G09	ACGGCCGAAGAGCCAGCGTCCGAAGGAAGCACCCGA
T7_17865_G09	GACGGACCAACGGGGCAGTCCCACAACCACAGGAGG
T7_17866_G09	CGGAGCAGCCGGCGGGCGTCACAAAAGAAACGACCC
T7_17867_G09	GCACAGCAGCCCGGGAAGTCCAACGGCGAAGGCCAA
T7_17868_G09	CCGCAAGAAGCAGCGGAGTCCGCGCCCAGAGAAACG
T7_17869_G09	AGCCGCGACCACACAGGGTCCCAAGAGGAGCAGCAG
T7_17870_G09	AAGGAACCCCGCCCGGAGTCAGGAGGACGAACCGAC
T7_17871_G09	GGGGCCACAGCGAGCGAGTCCCGAACGACACAGCAA
T7_17872_G09	CGACACCAGAGGGACGAGTCAAAGCAACGGCCGCCG
T7_17873_G09	GGAGGACAAACGCAACAGTCGCGAGCACAGGCCCCG
T7_17874_G09	GCAGCCAGCAACGCGGAGTCCAAGCAAACCCGGGAG
T7_17875_G09	CAGGCGAGACGGGACGAGTCGCACGAAGCCCACAAC
T7_17876_G09	GAAAGGCGCAACAGCACGTCGCGGCAAAGACGCGCC
T7_17877_G09	GACGCCAGGGACAACCGGTCGCACGCCAGAAACAGG
T7_17878_G09	AAAACCCGGCGGCAGCAGTCAACGGAGACGCGCCGA
T7_17879_G09	GCCGACCCAAAGCAGACGTCCGCGGAGGCACAGAGA
T7_17880_G09	CAGCACGCGCCGAACAAGTCCGAGGACAGCGAGGCA
T7_17881_G09	GAAGCCCACAACGAGGAGTCACGCGCCAGGGACGAC
T7_17882_G09	CCAGACGGCGGGCACGAGTCGCAACAGCGAGAACCA
T7_17883_G09	ACACGGGAGGAGGAACCGTCCAAGCGGAACCGCACC
T7_17884_G09	AAGGCAGCACGCCGGAAGTCACACGAACGCGGCCAG
T7_17885_G09	AACAGAGGAGGGAGGCCGTCCAACCCGACGCCAGCA
T7_17886_G09	GCGGACGGGCGCCCGGAGTCAGCCAACAAAGCACAA
T7_17887_G09	CCAGGGAAACAACGACGGTCGCCGCAGGACACGGCA
T7_17888_G09	GCGGACGGGCCGGAACCGTCACAAACAAGCGAGCCA
T7_17889_G09	CGACGGACACAACAGCGGTCAAGCGAGCCGCAGAGC
T7_17890_G09	ACGCGCGGAGGAGCAGAGTCAGCCCACGACCAAAGC
T7_17891_G09	GCCAAACGCAAGGGCGAGTCACGCACGAACCGCAGG
T7_17892_G09	AGACAGCAGCCACGCGGGTCAGCCGACGGAACAGAC
T7_17893_G09	ACAGCCAAGCGGGGACAGTCGACGAACAGCGCCGCA
T7_17894_G09	CCAGACACGCGGAGGCGGTCAAACCAGAGCGAGCAC
T7_17895_G09	CGCGACGCGACACACGGGTCGAGACACCAACAAGGG
T7_17896_G09	AGGGACGGCCGAACGCCGTCACCCAAGGAGCCAAGA
T7_17897_G09	CCGGCAAAGCAGACGCGGTCCGACAGCGCAGAGACA
T7_17898_G09	GCAGGCAGCAGCCCAGCGTCGGAAACCAACGGAAGC
T7_17899_G09	ACCAGAGGGCCAGCGCGGTCCCGCAGAAAACGGAAC
T7_17900_G09	GGAAGCGCCGCAAGCGCGTCCAAACAACAGGGCGCA
T7_17901_G09	AGGGCAGCACAACGCAGGTCCGCAACGGCCGAACAG
T7_17902_G09	CACCAGCGGAAGGAGACGTCGACCAACGCGGCAACG
T7_17903_G09	ACGGCAACCCCGAGGCCGTCCGGAGCACAAGAGGAA
T7_17904_G09	GGAAACGGAGGACCGGAGTCCCAACCGCCAAACGCG
T7_17905_G09	AAAACACCGCCGGGCGCGTCAGCCGACGCAGAAGAG
T7_17906_G09	ACGCGCCGACAAGGCGGGTCCGAACCGCAGAAAACG
T7_17907_G09	AACGGCCAGGAAGCGAAGTCGAGGCAGGACCCCACC
T7_17908_G09	CACCCACGAAGGAGAGCGTCGGCAGCCGCAAAGAGC
T7_17909_G09	CACCGCCCGAGAAGCGAGTCCCGAGGAAGAGGACCA
T7_17910_G09	GCGAAAGCGGACCAGAAGTCGCGACCCGCGAGAACC
T7_17911_G09	AGGCGCCACGAAACCACGTCAGGGCACAAACGGGGC
T7_17912_G09	GCAACGAGACGCGCGGAGTCCAACCGGACGACACAG
T7_17913_G09	CCACAAGGCGGCGGCGAGTCCCACAGCAACGAGGAA
T7_17914_G09	ACGACAGCGGAACGACCGTCGCAAAACGGACCGCGG
T7_17915_G09	GCGCGAGACGGCAACAGGTCGAACAACGACGCGCCA
T7_17916_G09	GGAAACGCGACCCCAGGGTCCGCCAAGGGCAGCAAA
T7_17917_G09	ACAAGAACAAGGAGAAGGTCCCCGCCCCGGGAGCCG
T7_17918_G09	GGAGCCGACCGCGGAGAGTCGCAAAGCGAAAACCCC
T7_17919_G09	AGCGAAAAACCGGCGGCGTCCAGGACAGCCCGCAGA
T7_17920_G09	AGAACAGGAAGCCGGCGGTCCCGCACCCACAGAGAG
T7_17921_G09	CGGGCGGACCGAGAGACGTCAACACGCAACGAAGCC
T7_17922_G09	CAAGCCGCAGCACGGAAGTCAACGAAGACCCGGGGC
T7_17923_G09	CCGGGGCCAAACCGGAAGTCACAAGGACCAGACGGC
T7_17924_G09	CAAACGGGACGCGGCCAGTCGCCGAGAGACAGACCA
T7_17925_G09	CCCGACAAGAGCAGAGAGTCCGACAGCGACGACCGG
T7_17926_G09	CCCAGGAAACCGCAGCAGTCGCACAAGGACGAGGCG
T7_17927_G09	CGACCGCAGGCACAGGAGTCCGCAGAGGCACGACAA
T7_17928_G09	GGGGACACCCGGCAGCAGTCAACGGCACAAGACCAG
T7_17929_G09	AAGCGGGGCAGGACCAAGTCAGCACGCGGCACCCAA
T7_17930_G09	GAAAGAAGCGGAGAGCGGTCCCAACGCCGCGCCAAC
T7_17931_G09	CGAGAGGAACCCGGCAAGTCGCCAACGAGCAGGCAC
T7_17932_G09	CCCACGGACGGAGGAGAGTCCCAACAGCAGAGAGCC
T7_17933_G09	GCAAGCACGAGCAGCCGGTCCCGCCAAACGAGGAAG
T7_17934_G09	GCCGCAAAAGCAGAACAGTCACCGGGACGCCGGCGA
T7_17935_G09	ACACGCGACAACCCGAGGTCGGGGAGAGCCAAGACC
T7_17936_G09	CGCACGAAGGAGCGACAGTCAAGCCCGCCAGCGGAA
T7_17937_G09	AGGGAGCAGGGGCGACGGTCACCGAACACCACAACC
T7_17938_G09	AGAAAGCCCCGGCCAGGGTCCAGGACACGGGACAAC
T7_17939_G09	CCAAAGGACGACGAAGGGTCAAGGCGCCCAGGCACC
T7_17940_G09	CGAGACACCCGACGCAGGTCAGAAACGGCAGGGCAC
T7_17941_G09	ACACAGGAGAGGACCCGGTCGACCCAACGGCAGACG
T7_17942_G09	AGACCAAGGACCCCGACGTCAAACAGGGGCGCGCAG
T7_17943_G09	CCGCAAGAACGGCCACCGTCGCAGAGGGCAGACGAA
T7_17944_G09	ACACAAGGAGCGGAGAGGTCGACACACCGCGAGCCC
T7_17945_G09	AGGACCAGGCGGGCGACGTCAGACGCACCCAAACGA
T7_17946_G09	GAAGCCACGACAGAGAAGTCAGCCCGCCACAGCGGG
T7_17947_G09	CCGACAGCGGCCAGAGCGTCACAAACACACGGAGGG
T7_17948_G09	GAGCAACAACAGCGCGCGTCAACGGGACGAGGACCC
T7_17949_G09	AGCCCGACCCGCGGGCAGTCCAAGAACAAAAGGCGG
T7_17950_G09	GAGGCAAGCAGCAGGCGGTCCAGAACAGCCCCAAGC
T7_17951_G09	GCAACAGCAGCCGGGCAGTCGGGACGAGCACAACAC
T7_17952_G09	AGCAAGCCGAAGAAGCGGTCGAGCACCCGCGCCAAG
T7_17953_G09	GCGCCGGCAGCACAGGAGTCACACGAGACCGAGAAC
T7_17954_G09	CGACACACACAGAGCAGGTCCCGCCAGAAGGGCGGA
T7_17955_G09	CAGAGCGCACCAACCACGTCGGGCGAGCGCAGGAAA
T7_17956_G09	ACAGCGCAACAGGCGGAGTCACACAGGCAACCGGCG
T7_17957_G09	GGACACGGAGAAGCGAAGTCCGACGACCAGACCCGC
T7_17958_G09	CAGCCGCCGGACACGACGTCGAAGAACCAGAAGGCG
T7_17959_G09	CGACCAACAGGCACGGCGTCAGAAGGCCCACAGGGA
T7_17960_G09	GCGGCGACAACGAGGCCGTCAACCGCGACAAAGACG
T7_17961_G09	AGGCGCACCAGCAGGCCGTCACCAACAAAGGCGAGG
T7_17962_G09	CAGGCGACAAACAAAACGTCCGCACAGGGCGGGGCC
T7_17963_G09	CAGCCGCCGCGAAACACGTCAAACGAGCGGGGCAGA
T7_17964_G09	CACGGAAACCCACCGGAGTCGCACCAGGAGAAGCGG
T7_17965_G09	AGCAGCAGAGCAAACCCGTCGGAGCGGGAAACCCGC
T7_17966_G09	GGCACGGCAAAACAGGAGTCCGCCGCCCACAAGGAG
T7_17967_G09	AAGGAACCGACGCAGAGGTCACAGCAACCCGGCGCG
T7_17968_G09	GGCAGAGGCGCACAACGGTCGAGGAGCACACAACCC
T7_17969_G09	AAGACGCAGAGCAGCCGGTCGCAGCCAGCCAACGGA
T7_17970_G09	ACAACAGCCGCAAACACGTCGAGGGGCCGCGCAGAG
T7_17971_G09	GGGAAACACCGAAAAGCGTCAACGGCCCGCGCAGGC
T7_17972_G09	GCACCGACGGACGGAGAGTCGCACGCCGCAAAACAG
T7_17973_G09	AGCAGAAAGCGGCCACAGTCCGGCGCGCCAGAACGA
T7_17974_G09	GGAGAGCAACCAAACAGGTCGAACACGGGCCGCCCG
T7_17975_G09	CCAACAGAAGGCGCACGGTCGCCGCGGAACGAGCAA
T7_17976_G09	GCCCGGACAAGCACGAGGTCGAGCGCCAAGAACACG
T7_17977_G09	CAGGAACAGCGCCAGAAGTCGGGCCAACAACGGCGC
T7_17978_G09	ACGAGGAGACCAAGAGCGTCCGCGACGACAACGGCC
T7_17979_G09	GAGAAACGGAGCAACCAGTCGCGCAGGGCAACCCCG
T7_17980_G09	AGGGAGCAGGGCGACAAGTCCCGAACCCCACGACGA
T7_17981_G09	GGCCCGAAAGAACCCGGGTCAAACGACCCCGAAGGG
T7_17982_G09	GCACGACGCCGGACCGAGTCGAGGCAACCGAGAACA
T7_17983_G09	GACCGGCCAGCACAGCCGTCGAGAAGCAAAGCAGGC
T7_17984_G09	AGCAAGCGAACCCAGGAGTCGGCCCGAAAGGCACGC
T7_17985_G09	GGAACCGCCGCAGGAACGTCGAGACGCAACCGACGA
T7_17986_G09	AGAGGCCACCACAAAGAGTCGCCGGCCGGCAGCAAG
T7_17987_G09	AGGGAAAGGCCAACCGAGTCACGGCCAGCCCGCAGA
T7_17988_G09	ACCCGAGCGAGAGCAGGGTCAAACGCACAAGGGCCC
T7_17989_G09	AGCCCAGAAGGACCGAGGTCGGGCAACAACGCACGC
T7_17990_G09	CAGGAGAGCACCCGGACGTCACAGGAGCCAGCCAAG
T7_17991_G09	AGCGAGCCCCGGCCAAAGTCCCAGCAAAGGGCGAAG
T7_17992_G09	GAAGAGCGAGGCCACGAGTCACGCAGCAAGCACCCG
T7_17993_G09	CGAGCAACGAGACGAAAGTCCAGACCGGGGCCGACC
T7_17994_G09	GGGCGGCAACACGAAAAGTCGCCCGCGGCCACAAAG
T7_17995_G09	CCGCCGCGAAGGCGGCGGTCAAAACAAACACGGCGA
T7_17996_G09	ACCCGACGGCAAGGAAAGTCCGAGAGCCGACGACGC
T7_17997_G09	CCGGACCGCGGAAAGACGTCCAAAACGGGCCCGAGA
T7_17998_G09	ACGACGGGAAGGAGCCCGTCAGGCAACAGAACCCCG
T7_17999_G09	AGGCCGAAAACGACGGAGTCACGCCGGACCCAAGGC
T7_18000_G09	GGGAAGCACCAACACAAGTCGCCGCAAGGCCAGGCG
T7_18001_G10	ACAACCACTAATAATCAGTCTCATATTTCTCCTCCT
T7_18002_G10	CTACTACTACTACTACTGTCACTACTACTACTAATC
T7_18003_G10	TCTCCTCATCATCATCAGTCTCAACATCATCATAAT
T7_18004_G10	TTTTCCACCACCAATAAGTCTACTACTACTACTACT
T7_18005_G10	ACCACATCACCACTACTGTCACTACTATTATTATTC
T7_18006_G10	TCTCTTATTATTATTACGTCCACCACCAACAACTAC
T7_18007_G10	TACTACTACTACTTATTGTCATTACTCCACAACCAC
T7_18008_G10	ATCATCATCCTACTACCGTCTCCTCAATAATTACTA
T7_18009_G10	TTCTTATTACAACTCATGTCAACATCATCATCCACC
T7_18010_G10	ATTATTACTACTACTTCGTCTCCTATAACCACCAAC
T7_18011_G10	TACTACTAATATAATACGTCTTCCTCCACCACTACT
T7_18012_G10	ATCATCATCATCTTCCTGTCTCTTCTCAACAAACAA
T7_18013_G10	CAACAACAACACCATCTGTCTCTTCTTCTTCATAAT
T7_18014_G10	ACCACCACCTACTACTAGTCCTACTAATATATTTCT
T7_18015_G10	TCCTCCTATCATCATCAGTCTCATCATCATCAATAA
T7_18016_G10	TCTTCTCCTCCTCCACTGTCACAAAATCATAATAAT
T7_18017_G10	CCACAACAACAACCACCGTCTCTTCTTTTTTATAAT
T7_18018_G10	TCATACTTCTTCTACTAGTCCCACAACAACATCATT
T7_18019_G10	AATAATAATACTACTACGTCTACTACTTCCTCCTCC
T7_18020_G10	CTCTTCTACTACCACAAGTCCAACTACTACTTATTA
T7_18021_G10	TATCATCTTCATCAACAGTCTCACTACTACTACTAC
T7_18022_G10	ACTCATCAACACCATCTGTCTCTCATCATATTATCA
T7_18023_G10	TCCATCATTATTAACAAGTCCCACCACCATCTTTTA
T7_18024_G10	ATAATTATTATTACTCCGTCTCCTCCACCATCACAA
T7_18025_G10	TCTTCATCAACAACTTCGTCTACTACTACTACTACA
T7_18026_G10	TATTATTATCATCTTCAGTCCCACCCACAACTACTA
T7_18027_G10	ATAATTATCATCATCTCGTCCTCCTCATCATCAACA
T7_18028_G10	TATTATTATTAACTACTGTCATTACACCACCACCCC
T7_18029_G10	ATTATAATAATAATCATGTCCACCCACCTCCTCTTC
T7_18030_G10	TCTTCATCATCATCATCGTCATAATCATCATCACCA
T7_18031_G10	ACAACCACCACTATTATGTCTATTCTTCTCCATCAA
T7_18032_G10	CACCACTACTACAACAAGTCCTATCTTCATCTTATT
T7_18033_G10	TCCTCATCACCTCATCAGTCTTATTAATCATACAAC
T7_18034_G10	CATCACCACTACTACTAGTCCTACTTATTATCAACT
T7_18035_G10	ATAATAATAACCACTCCGTCTCCTACTACTACTTCT
T7_18036_G10	ATCATTCAACAACAACAGTCCTACTTCCTCCTTATT
T7_18037_G10	TCATCATCATCATCAACGTCAACTATCATCATCCTT
T7_18038_G10	TCATCATAATAATAATCGTCATCATCATCCTCCTCC
T7_18039_G10	TCTTCTTATTATTCATAGTCACAACTACACCACCAC
T7_18040_G10	ACTACTACTACTAATACGTCTCCTTCATCATCATCA
T7_18041_G10	TTCTTAATAATCATCAAGTCCATCATCACCACCTCT
T7_18042_G10	TTCACTACTACTACTATGTCCATCAATACTACCATC
T7_18043_G10	AACACCAACCACCTCTTGTCCTTCTTATTATCATAA
T7_18044_G10	ATCATCATAATAATTATGTCTTACCACCACCTCCTC
T7_18045_G10	CTTCTACTACTACTACTGTCACTACTACTACTACAA
T7_18046_G10	CTTCTCCTTCTTCAACCGTCACAATAATAATCATCA
T7_18047_G10	ACCCACCCCTCTATTATGTCAATACTACTACTTATA
T7_18048_G10	CATCCTCATAATACTACGTCTAATACTTCCTCATCA
T7_18049_G10	CCACTCCTCTTCTTCTAGTCCTACTAATAATAACAA
T7_18050_G10	TAATAATCATCATCATCGTCATCATCTCATCACCTC
T7_18051_G10	CTTCTTTATCATCCTCCGTCAACAACTACTACTAAA
T7_18052_G10	CTTCTTCTTCATTATAAGTCCAACAACACCTACTAC
T7_18053_G10	TATCAACACCACTTCTTGTCATTATTACAACTACCC
T7_18054_G10	AATACTCCTTCTTCTATGTCCATCAACAACATCATC
T7_18055_G10	ACATCATCTACTACTAAGTCTAACCATCATCTTCTC
T7_18056_G10	CTTCATCATCATCCTCCGTCTACTACTACTAATAAA
T7_18057_G10	TATTATTCTTATTCATCGTCATCACCACCACCACAA
T7_18058_G10	CTACAACTACTACTACTGTCACTACTATTATCATCC
T7_18059_G10	ATTACTATTTTCTCTTCGTCAACAACACCACCACTA
T7_18060_G10	ATCTTCTACTCCTCATCGTCATCATCATCAACAATA
T7_18061_G10	ACCTCCTCTTCCTCTAAGTCTAATAATACTACTACA
T7_18062_G10	ACTTCTTCATTTTCTACGTCTATCAACAACAACCAC
T7_18063_G10	CCATCATTATTATTACTGTCACTACCAACATCATCC
T7_18064_G10	TTCTACTACTACTCCACGTCTACTACATCATCATAA
T7_18065_G10	CTACCACCACCCTCCTCGTCATAATAATAATATTTT
T7_18066_G10	ACAACTACTACTCCTCCGTCTCCTATTATCAATAAT
T7_18067_G10	TATTCTTCTTCATCATCGTCTCCACAACAACAACAT
T7_18068_G10	CTACTACTACTACTACCGTCACTACTACTACTATTA
T7_18069_G10	CAACAACAATACTACTAGTCCTACTACTCCTTCTTT
T7_18070_G10	ATTATTATTATTACTACGTCTACTACCACCACCACC
T7_18071_G10	TCCTCCTCCATCATCATGTCCATCCTAATAATAAAT
T7_18072_G10	CCTCCCTCATCAATAATGTCAATAATAACTTCTCCT
T7_18073_G10	ACCACCATCATCTTCCTGTCCCTCTATAATAATAAT
T7_18074_G10	CATTATTATTTATCAACGTCCACCACCATCATCATC
T7_18075_G10	CACCATCTTCTAATAATGTCCATCATCATCATCATC
T7_18076_G10	TAATAATACTCCTCCTCGTCATCATCATCATCATCA
T7_18077_G10	TCCTCATCATCATCATCGTCATCATCATCATAATCA
T7_18078_G10	CTACTTCATCTTCTTATGTCTATCACCAACAACAAC
T7_18079_G10	ATCATCATCATCATCATGTCCATCCTACTACTACTA
T7_18080_G10	AACAACAACAACAACTAGTCCTTCTTCTTCTTCTTC
T7_18081_G10	ATCATACTACTCATCATGTCCTACTACTACTACTAC
T7_18082_G10	AATCATCATCATCATCTGTCTCTCATCATCATCCAA
T7_18083_G10	TCCTCCTTATTACTACTGTCCCTACTAATAACAACA
T7_18084_G10	AATAATAATTATTCTTCGTCTCCTCCTCCACCAACA
T7_18085_G10	CCTCATCATCATCATCAGTCTCATCATCATAATACT
T7_18086_G10	TACTTCTTCATCATCATGTCCATCAACAACAACTCT
T7_18087_G10	TTCTTCTCATCAACTCAGTCCCACCTCATAATAATA
T7_18088_G10	AACAACTACTCCTACTAGTCTTACTACTACTACTTC
T7_18089_G10	CACCACTACTACCACCAGTCCTACTATTATTATTAT
T7_18090_G10	CCTCCTCTACTACTAATGTCAATCACTACTACTAAT
T7_18091_G10	CTCCTCTTAATTATTATGTCCCACCTACAACAACTA
T7_18092_G10	CCACCACTATTATTATTGTCATTACCACTACTACCA
T7_18093_G10	TACCACCACTTACTACTGTCACTTCTCATCAAATTA
T7_18094_G10	CACCACCTCATCATCATGTCACTTCTTCTAATAATA
T7_18095_G10	AACCACCACACCACTACGTCTTCTTCATTATTATTA
T7_18096_G10	ATCATCTTATTCCTTCTGTCTCTACCACAACAACAA
T7_18097_G10	CCACCATCTTCTTCTACGTCCATCATAATAATCATA
T7_18098_G10	TCCTACTACTACTACTAGTCCTACTACTACTAATAC
T7_18099_G10	ATAATAATACTACTACTGTCACTACTCCTTCTCCAC
T7_18100_G10	ACTTCTCCTCCTACTAAGTCTTATCATCATCAACAA
T7_18101_G10	AACAACAACATCATCCAGTCCCATCATCTTTTTTCT
T7_18102_G10	AACAAACAACTACTACTGTCACTACTCTTCTTCTTC
T7_18103_G10	TATTACTACTACTACAAGTCCAACTTCCTACTACTC
T7_18104_G10	TACTACTCATCCTCATCGTCATCATAATACTACTAC
T7_18105_G10	AACAACACCACCCCACAGTCTCATTATTTCTTATTT
T7_18106_G10	CTACTAATAATATCTTCGTCTTCATCAACCACCTCA
T7_18107_G10	CACCACCATTATCATCAGTCTCATCATCATCATTAT
T7_18108_G10	CCACTATTTTTTTTATCGTCATAACAACACCACCAC
T7_18109_G10	CTAATAAATACTACTATGTCAACTACTCCTCCTCCT
T7_18110_G10	CTCCCACACCAACATCAGTCTTATTATTATTATCAC
T7_18111_G10	TCATTATCATCATCATCGTCATCATCATCATCACCA
T7_18112_G10	TCATCACTACTCCTACTGTCACTACTACTAATAATC
T7_18113_G10	ACCACCACTCTTCTCCTGTCTCTAATAATACTAAAT
T7_18114_G10	TACTACTACTACTACTAGTCCTACTACTAATCATCC
T7_18115_G10	AACATCATCATCATCTTGTCCATCATCATCATCATC
T7_18116_G10	CCTCCTCTTATCCTCCAGTCCCATAATAATAATAAT
T7_18117_G10	TACTACAACAACAACATGTCCTTCTTCATCATCTTC
T7_18118_G10	TCTTCCTCCACCACCACGTCAACAATATTATTATTA
T7_18119_G10	TCATCATCATCATTCTAGTCCTACTACAACTACTAC
T7_18120_G10	TCTTCATCCTCATCATCGTCATCATCATCACAATAA
T7_18121_G10	AACTACTACTACTACTAGTCCTACTACTACTACTTC
T7_18122_G10	TCAACAACTATTCTTCTGTCTCTTCCATCAACAACA
T7_18123_G10	CTTCTAATAACTACTACGTCCATCCTACTACTACTA
T7_18124_G10	TTTTATTATTCCACCACGTCCAACATCATCAACTAC
T7_18125_G10	CATCATCATCTTCTAATGTCAATACTACCACTACCT
T7_18126_G10	CTCCTCACCCTCCTCATGTCCATTATAATAATAATA
T7_18127_G10	CATCATCTTCCTCCTTCGTCATCATCATAATAAAAC
T7_18128_G10	ACCACCCCAATTATTACGTCTTCTTCATAATAATCC
T7_18129_G10	TCCTCCTACTACTACCAGTCCCACTAATAATTATTA
T7_18130_G10	TTCTACTAATAACAACAGTCACCACTATTCTTCCTC
T7_18131_G10	CATCCTCCTTATTACAAGTCCAACTTATCATCAACT
T7_18132_G10	ACTCCTCCTCCTCCTACGTCTACTAATAATAATAAT
T7_18133_G10	CTTCATCATCATCATCAGTCTCATCATCATCAATCA
T7_18134_G10	ACCATCATCATCATAATGTCATTCTTCATCATCACC
T7_18135_G10	CAATACACCACCACTATGTCTCTTCTACTACTATTA
T7_18136_G10	AACTTCTTCTTCATCATGTCCAACAACACTACTACT
T7_18137_G10	CACCACCACCACTACAAGTCTAATCTTCTTTATTAT
T7_18138_G10	ATACTACCACCAACTATGTCTATCATCATTATCTCC
T7_18139_G10	CTTCTTCTCCTTCTACAGTCACTAATACTACAACAA
T7_18140_G10	CTACTAATTAATAATACGTCTACTACTCCTCCTCCA
T7_18141_G10	TATAACATCAACATCATGTCCCTCATCATCATCCTT
T7_18142_G10	TCATCATCATCATCATCGTCATCCTCCTACTAATAA
T7_18143_G10	CATCATCATTATCATCCGTCTCATCATCATCATCAA
T7_18144_G10	ATTACTTCTACTACCACGTCTACTACTACTACTACA
T7_18145_G10	ATTACTACTACTAATCCGTCTCATCACTACTACTAC
T7_18146_G10	TATTAATACTACTACTAGTCCTACTAATCCTCCCAC
T7_18147_G10	CACTAATCTCTACTACTGTCACTACTACTACTACTA
T7_18148_G10	TCACCACCTCCACCACCGTCATTATTTTATTAATAA
T7_18149_G10	CTTCTTCTTACATCAATGTCAACCACCACTACTAAT
T7_18150_G10	CACATCATCATCATCATGTCTATCATCATCATCATC
T7_18151_G10	ATTAATAATTATTTTACGTCAACACCCCACCTCCTC
T7_18152_G10	ACCACATCATCATAATAGTCATACTTCCTCCTACTT
T7_18153_G10	TCATCAACACCATCATCGTCATCTTCTTCATAATAC
T7_18154_G10	CATCATCATCATCATCAGTCTAATACTCCTCCTAAT
T7_18155_G10	ACCACCACCATCATCATGTCCAACATTATTATTCTT
T7_18156_G10	ATTAATAATAATAAACCGTCACTCCTCCTTCCTCCT
T7_18157_G10	TCTTCTTCCTCATCATCGTCATCATAATCAACAACA
T7_18158_G10	AATCATCATCACTACTCGTCCTTCATTATTAACCAC
T7_18159_G10	TATTATTATTACCACCAGTCCTACCACTACTCATCA
T7_18160_G10	TAATAATAATTCTCCTCGTCCTACTACCACCATCAT
T7_18161_G10	AATCATCCTCCTCCTCCGTCTCCTAATAATAATAAT
T7_18162_G10	ACAACATCATCATCCCCGTCACCACTTTATTATTAT
T7_18163_G10	TACTTCTTCCACCATCCGTCTCCAACAATAATATTA
T7_18164_G10	ATCATCACCACTACTTTGTCTTTCATCATAACACCA
T7_18165_G10	TCCTCATCCTAATAATCGTCATCATCATCATCATCA
T7_18166_G10	CCACCAACAACACTACTGTCATTTTTTCTACTACTA
T7_18167_G10	ACAACATCCATCATCTCGTCTTTTACTACTACAACT
T7_18168_G10	ATCACCTCCTCCATCATGTCCATCATAATACTATTA
T7_18169_G10	ACATCATCATCAACAACGTCTACTACTTCTTCTACT
T7_18170_G10	ATAATAATCCACCATCTGTCTCTTCTCATCATCAAC
T7_18171_G10	CAACAACAACATCATCAGTCTCATCATTCTTCTTCT
T7_18172_G10	CTACTACATCATCATCAGTCTCATCATCATCATCAT
T7_18173_G10	ACTCTCTTCATCATCACGTCCACTACTACTAATAAT
T7_18174_G10	ACTACTCCTCTTCTCACGTCCACTAATACTAATAAT
T7_18175_G10	CATCATCATCTCCTCCTGTCACTACTATAATCATAA
T7_18176_G10	CACCACCACCACCACATGTCTATTATTATTATTACT
T7_18177_G10	TATTCTCCTTCAACCACGTCCACTAATAATACTACT
T7_18178_G10	ATTATTCTACCACCCTCGTCCTCCTCAATAATAATA
T7_18179_G10	CTCCTATTATTATCATCGTCAACAACAACTCCTACT
T7_18180_G10	CATCATCATCAACATCAGTCTCATCATCATCTTACT
T7_18181_G10	TTATTATTATCACTACCGTCAACAACAACTCCTCCT
T7_18182_G10	AATACTACTACTACTACGTCTACTCATCACATCTTC
T7_18183_G10	ATATTATCATAATTACTGTCACTCCACCACTACTCC
T7_18184_G10	ACATCTACTACTACTATGTCTATTATCATCACCACC
T7_18185_G10	ATAATTACTACTACCCCGTCCCTACTTTACTACTAA
T7_18186_G10	TATAATACTACCATCATGTCCATCATCATCCTCATC
T7_18187_G10	ATAATAATAACTACTACGTCTACTCCTCCACTTCTC
T7_18188_G10	TTCATCCTCCACCACAAGTCCAACCATTATTATTAT
T7_18189_G10	TTCTCCTCCTCCTACAAGTCAACAACATTATTAATC
T7_18190_G10	AACCACCATACTACTTCGTCTCAACAACTTCTTTAT
T7_18191_G10	CTCCACCACCACCAACAGTCTCATTATTATTATTAT
T7_18192_G10	CAACAACATCATCTTCTGTCACCACTACTATTATTC
T7_18193_G10	ATTACTACTACTACTACGTCATCATCATCCTCATCA
T7_18194_G10	TTACTTCTACTACTACTGTCACTACTACTCCACAAA
T7_18195_G10	CTACTACTACTATCATCGTCATCATCATCATCATCA
T7_18196_G10	CATCTTCTTCTTCTTCTGTCACAACAACAACAACAT
T7_18197_G10	TACTAAACAACAACCTCGTCCTCCTCATCTTATTAT
T7_18198_G10	TACTACTTCATCATCATGTCTATTATCACCACCACA
T7_18199_G10	TACTACCTTCATCATCAGTCTCATAATACTACCACT
T7_18200_G10	ACTCTACAACAACATCAGTCTCATCATCTTCCTTAT
T7_18201_G10	CTTCTCATCATCATCATGTCCATTATCATCAACAAC
T7_18202_G10	TATAATAATACTACTACGTCCACCACTCCTCCTTAT
T7_18203_G10	TTCTCCTCCATCATCATGTCCAACAATACTACTAAT
T7_18204_G10	ACCACCACCACCAAATTGTCATTATTATTCTTCATC
T7_18205_G10	AATAATAATATCATCATGTCCTTCCTCCTCCCATCA
T7_18206_G10	CCTCCACTATATTATTAGTCCTACTACTACTACAAC
T7_18207_G10	CACAACAACATCTTCTTGTCCTTCTCCTAATAATCA
T7_18208_G10	CTTATTACTCCACCACCGTCACCTCATAATAATATT
T7_18209_G10	ACAACAATACTTCTTCTGTCTCTACTACTACTACCA
T7_18210_G10	ATTCCTACCAACATCATGTCCTACTACTACTACTAT
T7_18211_G10	CTCCTCCTATTATTATTGTCATACCATCAACAACAC
T7_18212_G10	ACCTCTCATCACCAACAGTCTCATCATCATTATTAT
T7_18213_G10	TAACAACTACTACTACTGTCACTACTACTACTTCCT
T7_18214_G10	TACTACTACTTCTTCATGTCCATCATCATCAACAAC
T7_18215_G10	TATATTATTATCATCAAGTCCAACAACTCCTCCTCC
T7_18216_G10	TAATAACACTAATTATCGTCCTCCTCCTCCTACTAA
T7_18217_G10	CCTTCTACCACAACTACGTCTATTATAATCATCATC
T7_18218_G10	TTATTAACAACATCCTCGTCCTCATCATCATCATCA
T7_18219_G10	ACCACTACTCCTCCTCCGTCTCATAATAATATTATA
T7_18220_G10	CACCACCACCACTACTAGTCCAATTATTATTATTTC
T7_18221_G10	AATAATCATCATCATCAGTCTCCTTCATCCTCCTAA
T7_18222_G10	ACTAATACTACTACTCCGTCTACTACTACTACTACT
T7_18223_G10	AATACTACTACTACTCCGTCTACCAACTACTATTCT
T7_18224_G10	TATTATTATCATACTACGTCTACTACTCCACCACCA
T7_18225_G10	CTCCTACCACTACTTCTGTCCCTACTAATAATAATA
T7_18226_G10	ATAATAACCACCACTACGTCTACTACTTCTTCTTCA
T7_18227_G10	ATCATCCTACTACTACTGTCACTACTACTACTACTA
T7_18228_G10	CTCCCCACAACTTCTTAGTCTTCTACTAATAATAAC
T7_18229_G10	TTAATCATCATCATCCAGTCCCATCATACTACTACT
T7_18230_G10	ATCATCATCATCATCATGTCCATCATCACTACTACT
T7_18231_G10	ACTACCACAACTACTACGTCTTCTTTTTATCAACCA
T7_18232_G10	AACAACCACCACAACCAGTCCTTCTTTTCTTATTAT
T7_18233_G10	AACTACCAACCATCACCGTCTTTTATTACTACTACT
T7_18234_G10	ACATCATCATCATCATCGTCATCATCATCTACTACT
T7_18235_G10	TTATTATCATCAACAACGTCAACAACTTCTCCTCCT
T7_18236_G10	CCACTACTCTTACTACTGTCACTACTACTATTACAA
T7_18237_G10	CTCTTCATCATCATCAAGTCTAATTATCACCACCAT
T7_18238_G10	CTACTACCTCCTCCTAAGTCTAATAATACTACTACT
T7_18239_G10	TCATCATCATCACATCAGTCTCATCATCATCATCAT
T7_18240_G10	ATCATCACATAACAACAGTCCCACCACTTCTTTTTT
T7_18241_G10	CCACCACTACAACAACAGTCATATTACTTTTCTTCT
T7_18242_G10	TAATAATAACATCATCAGTCTCATCTCTTCACTCCC
T7_18243_G10	ACCACCTTCCTCCTACTGTCACTACTATAATAATAT
T7_18244_G10	CTACCACCACATCATCAGTCTCATCATTATTATCAT
T7_18245_G10	ATCATCTACTACTCCATGTCCCTACTACTACTAATA
T7_18246_G10	ATACTCCACACCACTATGTCTACTACTATTACTACT
T7_18247_G10	CCTTCAACATCTTCTTCGTCAACAACTACTACTATA
T7_18248_G10	TCATCAACAACAACATCGTCTTATTATCATCCTCCT
T7_18249_G10	TCATTATAATAATAACCGTCTTCTTCTACCACCACC
T7_18250_G10	AATCAACATCATCATCAGTCCAACTATTTCTTCTCC
T7_18251_G10	ACTACTACTCCTCCTCAGTCTAATAATACTACTACT
T7_18252_G10	TCATCATCATCATTACTGTCACACTACTACTACTAC
T7_18253_G10	TACTCTTCTTCTACTCAGTCACTACTACTAACAACA
T7_18254_G10	AACATCCTCCTTCTTATGTCAATAATACCATCATCC
T7_18255_G10	CACCACCATCATTATTCGTCTTAATCATCATCATCA
T7_18256_G10	CATCACAATAATAATATGTCTACTACTCCTCCTCCT
T7_18257_G10	ACAAAACCATCATCATCGTCTTCTTACTATCATCCT
T7_18258_G10	CTACTACTACTCCTCCTGTCCATTAATAATAACATC
T7_18259_G10	AACAAACAACATCATCTGTCCTTCTTCTTCTACTAC
T7_18260_G10	TCATCATCATCCTCCTAGTCATAATAATCATCATCC
T7_18261_G10	TACTACAACAACAACTCGTCCTACTACTCCTATTTT
T7_18262_G10	CCTCCTCATTATAATAAGTCTAACCTCCTACTACTA
T7_18263_G10	CTACTATTATCAACTATGTCTATTATCACCACCACC
T7_18264_G10	CATCATCCAACAAATAAGTCCTACTACTTCTTCTTC
T7_18265_G10	CAACAACATCATCATCAGTCTCTTCTACAACTTCTT
T7_18266_G10	CCACACCACCATCATTAGTCTTTTCTTCATCAATAA
T7_18267_G10	TACTCCTTCTATTAATAGTCCTACTACTACCACCAA
T7_18268_G10	TAATATTATTATTCCTCGTCCTCCTCCAACAACAAC
T7_18269_G10	CATAATATTATAATAATGTCCTTCTTCCCCACCACC
T7_18270_G10	CATCATCATCATTTTTCGTCATCATCATCAACACCA
T7_18271_G10	TTATCATCACCACCTCAGTCTAATAATCATCTCATC
T7_18272_G10	CTACTCCTCCACAACAAGTCCATCATTATTATTATC
T7_18273_G10	ACTACTAATAATAATTCGTCCTCCTCCTACTACTAC
T7_18274_G10	AACATCTTCTTCTTCTTGTCCATCATCACAACAACA
T7_18275_G10	ATCATCCACCACCTACTGTCACTACTACTATTATTA
T7_18276_G10	CTCACCATCATCATCATGTCCATCATTACTAATACT
T7_18277_G10	ATTACTACTACTACTACGTCTACTCACCATCATCAT
T7_18278_G10	AACAACAATATCATCTAGTCCTACTCCTACTTCTTC
T7_18279_G10	CACAACAACTACTACTAGTCCTACTACTACTTCTTT
T7_18280_G10	CAACAAAACCACCATACGTCTTCTTCTTCTTATTAC
T7_18281_G10	AACTACCACCACCATTAGTCTTATTACTCCTACTAT
T7_18282_G10	AACATCATCAACTACTAGTCCTACTACTACTCCTTT
T7_18283_G10	CCACCACCACCTCCTATGTCAATTATTATTAATCAT
T7_18284_G10	CTCCTCCTCCTCAAATTGTCATTATTACTACAACAA
T7_18285_G10	CATCATCATCATCTTAAGTCTAAATCATCTCCTCCA
T7_18286_G10	CTTCTCCTTCTTCTACAGTCACAACATTACTAACAA
T7_18287_G10	ATCATCATTATTCTCCAGTCCCACCATCATTAATAC
T7_18288_G10	TACTACTCCTCATCATTGTCAATCACCATACTACTA
T7_18289_G10	TCCTCATCCTCCTCTTCGTCAACAACAATAATATTA
T7_18290_G10	ATCATAATAATACTATAGTCTACTACCTCCTCCTCC
T7_18291_G10	CATCATCATCATAATCAGTCTCATCATCCTACTACT
T7_18292_G10	CAACAAACATCTTCTTCGTCTTCTACATCATCATCA
T7_18293_G10	AAATTCCTTCTACTACTGTCACTACTACTACTACCA
T7_18294_G10	CCTCCTTATAATCATCCGTCTCATCATCATAATAAC
T7_18295_G10	CCACCACCACTACTACTGTCATTATTATTATACTAC
T7_18296_G10	TATTATCCATCATCAATGTCAATCCTCCTCCCAATA
T7_18297_G10	ATTACTAATAATCATCCGTCTCCTCCACCATCATTA
T7_18298_G10	AACCACCACAACAATAAGTCTCATCTTTCTTCTTCT
T7_18299_G10	TTTCATCATCATCATTTGTCCAACAACACCATCATC
T7_18300_G10	TAATACTACTACTACTAGTCCTACTAATCATCCTCC
T7_18301_G10	AACTACTACTACTACTAGTCCTACTCCTCCTTATAA
T7_18302_G10	CCCTCCTCCTAATTCTTGTCTTATTAACAACAACAA
T7_18303_G10	TCTTCTCAACAACAACAGTCACAACTATTCTTCTTC
T7_18304_G10	TTATTCTTCTTCCACCAGTCCCACCAATACTAATAA
T7_18305_G10	CAACTACTACTCCTACTGTCACTACTACTACTATAT
T7_18306_G10	TCCTACTACTACTACTAGTCATACTTCTACTACAAC
T7_18307_G10	TCCTCCTCCTACTACTAGTCCATAATAATAATCATC
T7_18308_G10	CACAACATTCTTCTACTGTCACTACTACTACAACTT
T7_18309_G10	ATCATACTACTATAATAGTCACTACTCCTCCTCATC
T7_18310_G10	CTACTCCAACAACCTTCGTCTTCTTCCTAATAATAA
T7_18311_G10	TCATTATCATCCTAATAGTCCTACCCACATCATCAT
T7_18312_G10	ACTACTACTACTACTACGTCTAATATCCTCCTACTA
T7_18313_G10	TACTCCACCATCATCATGTCCATTAATCATCATCAT
T7_18314_G10	ATAATCATCATCATCATGTCCATTACTACTACCCTC
T7_18315_G10	ATCACCACAACATCTTCGTCTTATTCATCATCATCA
T7_18316_G10	TTAATTACAACAACAATGTCACTCCTCCTCTTCTCA
T7_18317_G10	CATATTATCATCAACATGTCCCTCCTCATCATCATA
T7_18318_G10	ATCTTCTACAAACACCAGTCACTACTACTATTCTTC
T7_18319_G10	CCTCCACCACCAACATCGTCATAATATTCTATTATT
T7_18320_G10	CTTCTTCATCATCATTAGTCTTATAACAACCACCAC
T7_18321_G10	ACTACAACAACTACTACGTCTATTATTACTCCTCCT
T7_18322_G10	AACATCATCATCCACCTGTCATTATTACTACTACTC
T7_18323_G10	CTTTTTTCAACAACAATGTCACTACTACCACTACTC
T7_18324_G10	ATCCTCCTCCACCATAAGTCTAATATTACTCTTCAA
T7_18325_G10	TCATCATCATTAATACCGTCACCTACTACTACTACT
T7_18326_G10	TCATCATCATCAACAACGTCATCTACTACTACTTCT
T7_18327_G10	CAACCACTACTACTACTGTCTCTACTACTACTATTA
T7_18328_G10	CCACCATCATCATCATCGTCATCTTCTTATTAACAA
T7_18329_G10	CCCTCCTCTACTACTACGTCTACTAATAATAATCAT
T7_18330_G10	AACAAACAACCACCACCGTCCATCATTTTTTTTTCT
T7_18331_G10	AACAACTCTTCTTCACTGTCACTACTACTACTACTA
T7_18332_G10	CACCACCACTATTATTAGTCTTACTACTACTACTAC
T7_18333_G10	TAATAATTTTCCTCCTCGTCCTCCACTAATCAACAA
T7_18334_G10	TACTACAACAACAACTAGTCCTACTTCTTCTTCATC
T7_18335_G10	TACTACTACTACTATCAGTCTCATCATCACCATCAT
T7_18336_G10	ACAACAACCATACTTCTGTCTCTTATTATTACCACC
T7_18337_G10	CTCCTCCATCATCATCAGTCTCATAATAATACTACT
T7_18338_G10	TCCTCATCACCAACCATGTCAATCATCATCATTATT
T7_18339_G10	CAACATCATCTTATCATGTCCATCATCATCATCATC
T7_18340_G10	ACTATTACTACAACAACGTCATCATCTTCTTCTACC
T7_18341_G10	ATCCTTTTTTAATATCAGTCTCAACACCACATCACC
T7_18342_G10	ACTAATACTACTATTATGTCCATCATCATCCTCCCA
T7_18343_G10	CCTCCTCTCATCCTACTGTCATAATACTACTAATAA
T7_18344_G10	CTTCTTCATCATCATCCGTCAACAACTATAACTACT
T7_18345_G10	AAATACTACCACCTCCTGTCCTTAATACTTCATCAT
T7_18346_G10	ATTATTACTACCACCATGTCCATCATCATCATCATC
T7_18347_G10	ATCATCTCATCATCATCGTCATCATCATCATCACTA
T7_18348_G10	ATAATAATAATCACCTCGTCCTCCTTCATCATCATC
T7_18349_G10	CCTACTACTACAACATCGTCATCATCTCTTCATAAT
T7_18350_G10	ATTATTATCATCTTCCTGTCCCTCAACAACAACATC
T7_18351_G10	ACTACTACTACTACTAAGTCTAATAATCCTCCTCCT
T7_18352_G10	CTAATAATACTACTACTGTCTCTACTACTACCCATC
T7_18353_G10	CATCATCTTCCTCCTCCGTCAACATCATTAATAATA
T7_18354_G10	CCTCCTACTAATAACACGTCTAATACTTCTTCATAC
T7_18355_G10	TACTACTACTACTACTTGTCCTACTACTAACCATCA
T7_18356_G10	ACTTCTTCATCATAATAGTCATCATCATCAACCTCC
T7_18357_G10	AAACACTACTCATCCTAGTCCTACTAATCATCTTCT
T7_18358_G10	ACTACTCCTATTATTCTGTCTCTACCAACAACATCA
T7_18359_G10	CCTCCTCCTCCTACTACGTCTACTATAATAATAATA
T7_18360_G10	TACTTCTTCTCTTCTACGTCAACCACCACATAATAA
T7_18361_G10	TTCTCCTCCTCATCACAGTCACAATATAATACTACT
T7_18362_G10	CATTAATTATCCTACCAGTCCTACTCCTACTACTAA
T7_18363_G10	ACAACAACCACCACCACGTCTACTTTTATTTTTATC
T7_18364_G10	AAACAATTAATAATACTGTCCCTCCACCTTCTTCTC
T7_18365_G10	ATCCTCCATTATTATCCGTCTACTACCACAACAATT
T7_18366_G10	CTACTACTAATACTACTGTCACAATCACCACTTCTT
T7_18367_G10	CTACTAATAACAACAATGTCACTACCTCCTCTTCTT
T7_18368_G10	ATCATCATCATCATTATGTCCATCACCACTACTACT
T7_18369_G10	CACCCTCTCCACCATCAGTCTCAAAATTATTATTAT
T7_18370_G10	CTCCTCTACTACATAATGTCAATCATCATCATCATC
T7_18371_G10	ACAAACAACATCTTCCTGTCCATCATCATCATTCTT
T7_18372_G10	TCATCATCATCATAATAGTCCTAATCATCATCCTCC
T7_18373_G10	TATTATTACTTCTTCCAGTCCCACCATCATCAACAA
T7_18374_G10	CTACTAATAATAATAACGTCAACTCCTCCTCCTTCT
T7_18375_G10	CTCCTCCCTCTACTAAAGTCTACTACTACTAATAAT
T7_18376_G10	TTACTACTACCACCTCTGTCTCTTACTAATAACAAC
T7_18377_G10	TCCTCATCATCTTCCCCGTCAACACTATTATAATAA
T7_18378_G10	TATTCATCATCATCATAGTCCTTATCATCACCACCA
T7_18379_G10	CCTCCTCAACAACTACTGTCACTACTACTATTATTA
T7_18380_G10	ACATCATCATCATCATCGTCTTCATCATCATCATCA
T7_18381_G10	TTATTATCATCCTCCTCGTCCTCCACAATAATAACA
T7_18382_G10	TACTCTACTACTACCATGTCCATCATCATCATCATA
T7_18383_G10	CTTCATCATCACCACTAGTCCTACTACTACTAATTA
T7_18384_G10	CTCCAACAACATCATCAGTCTCATCATCTACTATTT
T7_18385_G10	CATCTTCTCCTCATCATGTCCATCATCACAAATAAT
T7_18386_G10	TCATCATCATCATCATCGTCATTACTACCATCATCA
T7_18387_G10	CTCACCTCCTACTACTAGTCCTAATAATTATCAACT
T7_18388_G10	CTCATCATCATCATAACGTCAACACTACTATTCTTC
T7_18389_G10	ATACCATTCATCTACTAGTCCTACTACTACTACTAC
T7_18390_G10	ACCACCTCCTCTTTATTGTCATTATTAACAACAACC
T7_18391_G10	CATCACCACCACCATCAGTCTATTATTATTACTACT
T7_18392_G10	CATCATCATCATCATCAGTCTCATCACCACTATTAT
T7_18393_G10	CACAACATCATCCTCTTGTCCTTATTAATAACCATC
T7_18394_G10	CATCATCAACATTATTAGTCCTACTACTACCACCTT
T7_18395_G10	ACACTCCTCCTATTACTGTCAATAACTACTACTACT
T7_18396_G10	AACAATACTACAACTTCGTCTTCTACTACTTCCTCA
T7_18397_G10	CCCTCCTACTACTACTAGTCCTAACATCATATTATA
T7_18398_G10	CAACAACAACAACTACTGTCACTACTTCTTCTCTTT
T7_18399_G10	ATCATCATCATCATCATGTCCATCTTCTACTACAAC
T7_18400_G10	AACAACTACTACCACCAGTCCCACCATTATTTTTTT
T7_18401_G10	CCACCATCCTTTAATATGTCCATCAATCATCCTATA
T7_18402_G10	CCAACAACTTTTTAATCGTCATCATCATCTTCCAAC
T7_18403_G10	AAACCTCTCATCATCATGTCCCTCATATTCTCATAA
T7_18404_G10	TACTCCACAATCATCAAGTCTACTTCCTAATCATCT
T7_18405_G10	ACCAATATTATAATAATGTCATTCTCCTCCTCCACC
T7_18406_G10	ACCCACCATTCTCATCAGTCTTAATTACATCATCAT
T7_18407_G10	TCTTAATAATCATCATCGTCATCTTACCACCACACT
T7_18408_G10	ACCACATCACTATCATCGTCATTCATCTTATCATCA
T7_18409_G10	CTACCAATACTATACTAGTCCTACTACACTTATTCC
T7_18410_G10	ACCCAATACCCACCCTCGTCATTATTATTATTTACA
T7_18411_G10	TACTACTCCTCCTCAAAGTCTACATCATCATCAATT
T7_18412_G10	CCTACATTTTTATTCAAGTCCAACCACTACTACTAC
T7_18413_G10	CAAAATCTAATAATATCGTCCACTACTCCTCCTCTT
T7_18414_G10	CAACCACATCTTCTTATGTCTATAATATCACCTCCA
T7_18415_G10	ATAATATCCTCCTACTTGTCACTCATCATCATCAAC
T7_18416_G10	CTACTACTCTTTCCTCCGTCTTCATAAACATAACAA
T7_18417_G10	CAACAATTATTCCAACAGTCTCATTACTCCTCCTTA
T7_18418_G10	ACTACTATTCACAATTAGTCTCTCTACTACTACCAC
T7_18419_G10	CTCTTAATACTACACCAGTCCTAATCATTCTCACTA
T7_18420_G10	TTTAAACTAATTAACTCGTCCCTATCATACTCCCAC
T7_18421_G10	CAACCCACCTCCCCATTGTCACATAATTATTTTATA
T7_18422_G10	TACTATTCTACTCATCAGTCTTACTCACTACAACCA
T7_18423_G10	TAACCAACATACTACTTGTCCTTCATCATCCAATTC
T7_18424_G10	TAATCATCATAACAACCGTCACTACTTCTTATCTCC
T7_18425_G10	AACTTTTCTTCTCCTCCGTCTTACAACAACAAATCA
T7_18426_G10	CCTTCTTATCCACAACAGTCATCTAACAATATTTCC
T7_18427_G10	ACCCCACTAATTCCATCGTCATCTACTATTATAATC
T7_18428_G10	CTACTACTCATCATCCTGTCCATAATAACCTCTAAT
T7_18429_G10	TTCTTCATCAACAACAAGTCATACCTCATCTTCTCA
T7_18430_G10	CTTAACACCTCCTCCTAGTCTAATATAAAACTCTTC
T7_18431_G10	CTACCCTTCATCATTATGTCTCACATCAAAATCATC
T7_18432_G10	CCTTCCTTCATTCCAACGTCAACAATATATCACTTA
T7_18433_G10	ACAATATCACACCCTCTGTCCTTTCCATATACTTAA
T7_18434_G10	ATAATCCTCCTTCTACTGTCATTACCACTACAACAT
T7_18435_G10	TAACAATAATCCTCATTGTCATCATCATTCCTCACC
T7_18436_G10	TACAACCTTCTTAATACGTCTACCAATACTTCCTCA
T7_18437_G10	ATACTACTTTTTCTACTGTCACATCACAACACCACT
T7_18438_G10	ACACACTAACAACATCTGTCTCTTCTAATCTTCTCA
T7_18439_G10	TTTCCTCATACTCCTCAGTCTAATAACCACATAATC
T7_18440_G10	ATATTATAATAATCACCGTCTCCTCCAAATCCTCCT
T7_18441_G10	CCACTATCAACTAATTCGTCTTCTACTCATAACCAT
T7_18442_G10	TCTTCATCACATTATTCGTCTAACACCACTCAACTA
T7_18443_G10	CCTACAAAATTATCATCGTCCTATATTCTCTACCAC
T7_18444_G10	CTATTTATCCTCCTAACGTCAAATAATCCTCCTCAA
T7_18445_G10	CAAAATCCCACCCTACAGTCTATTCATTATTATTCC
T7_18446_G10	AATAACACCACTACTACGTCTACTCACCTACTTTTT
T7_18447_G10	TTCCTACTAACTTACTAGTCCTATTAACTACCACCA
T7_18448_G10	ATCATACTACTACCCCTGTCAATATCAACTCCTATT
T7_18449_G10	ATCAATACTACCTTTATGTCCATAACCACTCCTCAT
T7_18450_G10	TTATAATCCATTATCATGTCCCTACCACCACAACTT
T7_18451_G10	ATCCAACTTTTTTATCCGTCATTACAAACTCCACCA
T7_18452_G10	CATTAATAATCTCCACTGTCCCAACATCATCATCTT
T7_18453_G10	TCCTCCTCTTTATTAACGTCCACCACTACAATAATA
T7_18454_G10	ACTACTCACCATCATTAGTCTTAATTACTACTACCC
T7_18455_G10	TTACAATACTAATCTCCGTCTCCTCCCACAATAATT
T7_18456_G10	TCACTTTTAATATCATCGTCACTACCTTCCACAACA
T7_18457_G10	CTCACCACCACAACTTAGTCTAAAACCATCTTTTTT
T7_18458_G10	CTACTCTCCTCCATATAGTCTTTATTACAAACCACA
T7_18459_G10	TCTTCAACACCTCAAATGTCACAACTTCTTACTCAT
T7_18460_G10	CAACAACCAACTACTATGTCTTTATAATCCTCCTCT
T7_18461_G10	TAATCCTCCACACCATTGTCATCTACCTATCATAAT
T7_18462_G10	AAACACCTTTTTATTACGTCTACAACACCATCTCCT
T7_18463_G10	TTTTCCTCCATAACTACGTCTACTTCATCAACAACA
T7_18464_G10	AATAACAATATTTCTACGTCTCCTCCACCATCATCT
T7_18465_G10	TTATTAATACCACCATCGTCCTCCTACTATTACAAC
T7_18466_G10	AACCTCCTCCAACTATTGTCATACTCCTACTAATTA
T7_18467_G10	ACTCCTAACACCTCTTTGTCTATTAACAACATCATC
T7_18468_G10	ATTATTATTATCTTCCCGTCCCACTCCATAACACAA
T7_18469_G10	AACAACATTATACTACTGTCTCATCTTCCTCATCAC
T7_18470_G10	CAATCATCATCACCTTAGTCACAACAATTCTTCTTC
T7_18471_G10	CTTCATCTATCTTCCACGTCCAACACCAAATTATTA
T7_18472_G10	TCCAACAATCATTATCAGTCATCCTTCTTCTAAACC
T7_18473_G10	TACTTATCATATAAAACGTCCACCACTACTTCTTCC
T7_18474_G10	TTTTTTCTTAATCCAACGTCATCAAACTACACACCC
T7_18475_G10	TTACACCACCAACATCAGTCTTCATTCTTTCACTAA
T7_18476_G10	ACTCTTCTTCTACTACCGTCATCATACATCAAAATC
T7_18477_G10	CTCCACTACAATCATCTGTCTAATAAATACTCTTCC
T7_18478_G10	AACCTTTTTTCCTTCATGTCAATAAACCTACCACCA
T7_18479_G10	CCTAAACACAACTAATCGTCATTATCCTCCTATCTT
T7_18480_G10	TCCTCCTCCTCCATAATGTCACTACATTATTACAAA
T7_18481_G10	ATATAACTCTCCTTACTGTCCCACCTTATACTACAA
T7_18482_G10	AAACTTTACTCACTTACGTCCTACTCCTCCTATAAA
T7_18483_G10	TAATTACTCCTCCTACTGTCAATACTACCTCAAACT
T7_18484_G10	CAATACTAAACTACTATGTCTACTATTCTCCCCATC
T7_18485_G10	AATAATACCACACCCTTGTCCTTTCAACTTCTACTA
T7_18486_G10	TATTATTATCACCAAACGTCTACTCCACCTTCTACA
T7_18487_G10	TCATCAATACACTACCAGTCCCTCTTCTTATAATCA
T7_18488_G10	AACATATTATTTTCCTCGTCCCACTACTAATACACC
T7_18489_G10	CCACAATCTACAACAACGTCTATTATCATCTTCTTC
T7_18490_G10	TATACCCTCCTTCTCATGTCCAACAATAATTACTAC
T7_18491_G10	CTATTCTCCACTACTAAGTCCACCACCTTATATAAT
T7_18492_G10	TTCTTATCACCATTATTGTCATCACTACCACCAACA
T7_18493_G10	AAATTTCCTTCCATCATGTCCATCAACATCTCATCA
T7_18494_G10	CCTCATAATTCCTTCTTGTCATCAACTACCTACAAA
T7_18495_G10	CCCTCATCACTCATCATGTCATTAACACAACTTATT
T7_18496_G10	CAAAATTATTTTTCTACGTCCTCATCACCACTACCA
T7_18497_G10	CTACAATATCCTCCCTAGTCCTTCTAACTAATTAAC
T7_18498_G10	TAATACCATCACCTCCCGTCAACATCCTATATTATT
T7_18499_G10	CACAATCATCTCCACATGTCAACTTTTTCTTCACAA
T7_18500_G10	ATTATTATTCCTCCTCCGTCACATCAATAAACCATC
T7_18501_G10	ACATCATCCTCCCCACTGTCAATTATTATTTAAACC
T7_18502_G10	CTTAATAAATAAACAACGTCCTCCTCTTCATTCCTC
T7_18503_G10	ACAACATTAATCCAATTGTCTTTCTACCCCACCATT
T7_18504_G10	AACTATCATACTACTACGTCTAATCTACTATTCCCC
T7_18505_G10	AATCATCACTACACCTCGTCATACTTATTCATCATC
T7_18506_G10	ATACTATACTCCTACTAGTCCTTCACCACTTCATAA
T7_18507_G10	TCCTTCCTATAACCTACGTCCACTCATAACTATAAT
T7_18508_G10	ACACCATCCTATAACTAGTCCTCCTATCATCATTAT
T7_18509_G10	TATTAATTCAACATCCTGTCCCTCTTTAAACACACC
T7_18510_G10	ACAATTATCTTCACCAAGTCCTACTCATATCTACCT
T7_18511_G10	ACATCTTCATTACTATAGTCTACCACCTCTACCAAT
T7_18512_G10	AACTATTCCCTCATCCCGTCATATTCAAAACATCTT
T7_18513_G10	AACCACCTCCTCCTCTTGTCATTCTAATATAACAAT
T7_18514_G10	CTAATAAACATCTACTCGTCCACTACTACTATTCCT
T7_18515_G10	ATCATCACTACTACTTCGTCTTCACCCAACATTATA
T7_18516_G10	TCCCCACCTACACTACTGTCACATAATTATACTATT
T7_18517_G10	ATTATTCATAATACAACGTCCATCCCTCAATTCCTC
T7_18518_G10	CCCAACACCTTCTTCATGTCATTATCAATACTACTA
T7_18519_G10	TCAACCATCTTTACAACGTCCCTTCCTTAATAACTA
T7_18520_G10	TCTTCACCATCATCATAGTCATTAAAACACTCCTCT
T7_18521_G10	AACTAAATAATATCCTCGTCATCCCTCATCATCTTC
T7_18522_G10	AAACACCTATTCTTCAAGTCCAATACTTCCTCTTAC
T7_18523_G10	TATTATCATCTCCCTCTGTCTCAAAACAATCCCATA
T7_18524_G10	CACCACCATTTTATCCCGTCTCCACTAATAATAATT
T7_18525_G10	ACTCACCATTAACTACTGTCACTACTATTATTCCAC
T7_18526_G10	TCCACAACAACAACATAGTCATTCTTTTCTTACTCC
T7_18527_G10	ATTATTCCCTACTCCCTGTCACTATAACAACACTAT
T7_18528_G10	AACTTTATCACCAACAAGTCCTTTCCTCACCATTAT
T7_18529_G10	AACACCACTCCTCTTCTGTCTAATACCAATATCATT
T7_18530_G10	ATCTACTCCTCCACACCGTCACCAATTAATATTATT
T7_18531_G10	TCCTCATTCAACAAATCGTCATCCTACTAAATCTTC
T7_18532_G10	CTACCACCTTTCTACTCGTCCTCAACAATATAATTA
T7_18533_G10	CACCATTATAAACAATCGTCTTCTTCCTCCATTACA
T7_18534_G10	CTTATTTTTTCCACTACGTCCTCCCACAAATAACAA
T7_18535_G10	ACTACAAACTTATCCCCGTCTCAAAATCTTTATCCT
T7_18536_G10	CATAATAATTCATCATCGTCATCCTCTACTCCATCA
T7_18537_G10	ACCAACACACCCTTCTTGTCATTTTAATACCACTAT
T7_18538_G10	TATAATCATTCTTCCCCGTCCCCAACTATTAAAATC
T7_18539_G10	TACTATTATTTTCCTACGTCATAATCACCAACCACC
T7_18540_G10	AAATCATCATCATCACCGTCACCTTATTCTTCATCA
T7_18541_G10	CTCATAATCATCACAACGTCTCTTATTATTACCACC
T7_18542_G10	CTTCTTCTTCTCCTCCAGTCCAATAAATAACATCAA
T7_18543_G10	ATTTCCCAACCACCACCGTCACATTATTCTTATTAA
T7_18544_G10	CAATAATCTACTATCCTGTCCCTCCTCCAATAATTA
T7_18545_G10	TCAACAATCACCTTCTTGTCAATAAATTCCTCACCT
T7_18546_G10	TCCACCACCACAAATACGTCTACAACCTTATTTTTT
T7_18547_G10	TTTACACCATCACCACCGTCAACTATTATCACTTAT
T7_18548_G10	CTTCTTCACTTATACCAGTCCATCATTATACAACCA
T7_18549_G10	TTCTAATACTCCTCATCGTCAACCACCAACATATTT
T7_18550_G10	TTCACAACTACCAATCAGTCTCATCATTCTTACTAC
T7_18551_G10	TCCTATTACTATAATTAGTCTTACACCCACTACACC
T7_18552_G10	CCCTACTATAATACATTGTCCTTCCTCCTATAAAAC
T7_18553_G10	ATTAATTACTTCCCACCGTCACTATTATTACAACCC
T7_18554_G10	AAAACCACTACTACCCTGTCACTTCTTATTCCTTAA
T7_18555_G10	CTTCTACTTCATCTAACGTCAACCACAATTACCATT
T7_18556_G10	CTTCATCATCAACAACAGTCCATACTACTTCTTCTA
T7_18557_G10	TCTACTCCATCCAACACGTCCATCATAAATTATTCT
T7_18558_G10	CAACAATATACTCATCAGTCTTATTATACCCTCCTC
T7_18559_G10	ATCCACCAAATAATCACGTCATTCTTCCTTTCATCA
T7_18560_G10	CACAATAATAATTATCAGTCTCCATACTCCTCCTTC
T7_18561_G10	CATCCCACCACACCTCTGTCTTATTACTAATAATAT
T7_18562_G10	AAAATACATCATCATCAGTCACTCCTCCTCATTCTT
T7_18563_G10	TCCTATTATTTCCACCAGTCACATAATCTTCAACAC
T7_18564_G10	TAAAATTCTTATAACTAGTCCTACTACTCCTCCACC
T7_18565_G10	TAATACCTCCCATCATCGTCATTTTCATCATCACAA
T7_18566_G10	TCTTCTACTACATTATTGTCAATCACCACCACAACT
T7_18567_G10	TATAACAACTACTACTCGTCCAACTATTCTACTCTC
T7_18568_G10	CTACTAACTACTACATCGTCATTTCTACACCACTTA
T7_18569_G10	ATACTACTATAACCTCCGTCTCATCATAACCTCTTA
T7_18570_G10	TACAACATCATCACCTCGTCCTACTATAATTCTTCA
T7_18571_G10	TTATCACTCACTACATCGTCTTATAACAACACCTCT
T7_18572_G10	CCAACATCATCATCATCGTCTTTTACTACTACTACA
T7_18573_G10	ATCAAACTATACTACACGTCCTCATAATCTTCTTCC
T7_18574_G10	CTTTATAAAACCACCCTGTCCATCCTCTATATACTA
T7_18575_G10	ATTACTACTCCCTCCACGTCATCATATAATACTATC
T7_18576_G10	ACCCACCATCACTCCACGTCAACAATATATTTTTTT
T7_18577_G10	CACCTATTATTAACTCCGTCTACTTTCCAACAAATC
T7_18578_G10	TCCTACATACTACAACAGTCTTATAATCATCCCTTC
T7_18579_G10	CTACCTCAACTAACCATGTCTAATTATTCCTCATCA
T7_18580_G10	CCCACCACTACTATTTTGTCCTTCAATTATCAACAA
T7_18581_G10	TTAATAATTATCCAACTGTCACTACCTCCTACTCCA
T7_18582_G10	ATAAACATCCTCCTACTGTCTCACCTACTAATCATT
T7_18583_G10	AAAACCCTTCTCTTCTTGTCAACAACAACATCTTCT
T7_18584_G10	CCTCCTTATAATACAATGTCAATACTTCCTTCACCA
T7_18585_G10	ATCTTCTTAATAATAATGTCACCATCCCTCACTACC
T7_18586_G10	CCACACCCTTCTATTATGTCTAATCTACTACAACAT
T7_18587_G10	CTTTACCTCCAACTAAAGTCCATTCATACTACTACT
T7_18588_G10	TACTTACTACATCATCAGTCTTATACATCACCACCT
T7_18589_G10	CTATAACAATTCTTACCGTCCCACAACATCCTATTT
T7_18590_G10	CTCCATAATTACCACAAGTCCACTTAATCATCTTCT
T7_18591_G10	ATACTAACAACAACTTCGTCCTCCTCATTATCTTCA
T7_18592_G10	CTTCAACAAAACTACTCGTCTTCTTCTACACCATAT
T7_18593_G10	TTATAAACAACATCATTGTCATTCTCACCACTCCCT
T7_18594_G10	TTTCTTCTACTCTCTACGTCAACAACCATCAAATCA
T7_18595_G10	TTCCTATTCTTCTCCTAGTCATAACACCAATAACCA
T7_18596_G10	CTCCAACTACTACTAATGTCATTCTCCTTAACCAAT
T7_18597_G10	AATATCATCATTACCAAGTCCATTACCTATCCTCCT
T7_18598_G10	ACTACAACACCACCATCGTCCTCATTATATTTCTTA
T7_18599_G10	CCACTTCTACTACTAATGTCCAATATTTACTACCAC
T7_18600_G10	TAATACTATAATCCTTCGTCTTTCCAATCACCCAAC
T7_18601_G10	AACAATAAATTACTTCCGTCCACCTCCTTCATCATT
T7_18602_G10	TATAATAATTACCACAAGTCTCATCCTCATTCTCCC
T7_18603_G10	ACAATTTATTATACTACGTCCCCTCACCTCTTCAAA
T7_18604_G10	AATACTACTTATCATATGTCAACCACCTCCCTACTT
T7_18605_G10	ACCACTTCTTCCCATAAGTCTAATACTACTACCTTA
T7_18606_G10	CTCATCAACATCTTCTAGTCCTAATTACAATACCTC
T7_18607_G10	TCAACAACAATAACTTCGTCCTTCTTCTTCTACAAC
T7_18608_G10	CACTATTTCTCCACATTGTCCAACTACTAATACTAC
T7_18609_G10	TTAACAACAACATCTACGTCTTCTTCTTCATCACCA
T7_18610_G10	CACCTACCACACAACAAGTCTCCTCTTATTATTTTA
T7_18611_G10	ATAAAATACTATCACACGTCCACCTTTACTTCTTCC
T7_18612_G10	ATCATCACTACCATCTCGTCATCATATTTTCCAAAC
T7_18613_G10	CTCCCTCATCATTAATAGTCCTTCTACAACTAATCA
T7_18614_G10	TCTATTCTCCTCCCTTAGTCTAACACTAATCAACAA
T7_18615_G10	ACTACACCCCTACTAATGTCAATTACCATCATTTTC
T7_18616_G10	CCTTTCTCCAACCTTCAGTCTCAAAATAATACTACT
T7_18617_G10	ATCATCTTCTACTATTAGTCTCACAACTCTCCAAAC
T7_18618_G10	CACCTAAAATTATTTTTGTCTTCACCACTACCACAC
T7_18619_G10	CTATTAATATCCTCTTTGTCTCCCCAATAAAACCAC
T7_18620_G10	ACCTCCACCATATTCTAGTCTCATCATTATAATCAC
T7_18621_G10	CCAACAACAATACTACTGTCCCTCTTCTTATAATTC
T7_18622_G10	ACCACCTAACAAACTTAGTCTTCTATTACCTACTTC
T7_18623_G10	TATTATTATTACATCCCGTCCACCCTCATAACATCA
T7_18624_G10	TCTTCTTCTATTAACCAGTCTCATAATCACCACCAA
T7_18625_G10	CAACTTTCTCTTCTATTGTCATTAAACCCCAAAACC
T7_18626_G10	ATACTAACACCACAACAGTCTCATCATCTTCTTCTT
T7_18627_G10	ACCACCATCTTTTCATCGTCAACTCATTATAACTAC
T7_18628_G10	TATCCAAATTATCATTAGTCCTCCTTCCACCTACAA
T7_18629_G10	TCCTATTTATTAATAACGTCCTCCACCTCCAAATCA
T7_18630_G10	CAACCTCCTCAAATAACGTCATTCTTTTCTCAAATC
T7_18631_G10	ATTTCAACATCCTCTCCGTCACTAATCATCATACAT
T7_18632_G10	CTTCCCATAATATTCTTGTCCTTTACAACCACACAA
T7_18633_G10	TACTCCATCCACCACTAGTCTTCTTATAACAATATC
T7_18634_G10	CTCTACTTCTCTTTTCAGTCACAACAAAACTACATC
T7_18635_G10	TCTTATTTCCTCTACTAGTCACAACAACCAATCTAC
T7_18636_G10	CACCCCACTAATAATCAGTCTTCTTATACTACTCTA
T7_18637_G10	TCTTATCAACAACCAACGTCAATCATCCACTTCTTT
T7_18638_G10	ATTAACCCACTACTCTAGTCTCTACTACTATAATCC
T7_18639_G10	TTATCCAATTCTCAAATGTCCATAACCCCTACTATC
T7_18640_G10	TACTCCTACAATAACACGTCCTCTTCTTCAACTTAA
T7_18641_G10	ATCACCTCCTACCATCAGTCTAATAATCATCTTCTA
T7_18642_G10	CCAACTAATCCTCTTCAGTCTCATTATCACTTAACA
T7_18643_G10	TTATTCCTACCTACCAAGTCTAATATTCTAACCACC
T7_18644_G10	TCCATCAACTACATCATGTCCACTACTACTATTACT
T7_18645_G10	TCCAACATACTACAATAGTCCTATTATTACCCCTCT
T7_18646_G10	CTTCTATAATAATAACAGTCACCCTTCCTACCTCAT
T7_18647_G10	ATTCCTATCACACACTAGTCCTCTTCTACTAAATAC
T7_18648_G10	CTCCACCACATAATAATGTCATTACTACTCTTCATC
T7_18649_G10	ACTACTCCTCTATACTAGTCTTATCATATCCAACAC
T7_18650_G10	ATAAAACCACCCTAATAGTCATTCTTATCCTCTTCC
T7_18651_G10	ACCACCACCATCTTCTTGTCTACAATTATCAACTAT
T7_18652_G10	ATAATCATCATCTCTTAGTCCTACTCCACCAACTTA
T7_18653_G10	CCACATATTATCAAACAGTCTCTTCTACTAATCCTC
T7_18654_G10	CTTCTTCTCTTTTCAACGTCAACTCCACAACAAATA
T7_18655_G10	CATCCTACTAATAATTAGTCTTAACAACCCTCTCCT
T7_18656_G10	ACTAATACCTCCCTCAAGTCTAATAATACTCTTCCT
T7_18657_G10	TCTCCTCCACAACATTAGTCACATCATTAATTCTAC
T7_18658_G10	AATACTTATCATCAACTGTCACTCCACTATTCCTCA
T7_18659_G10	AATCCTCCTTCTTAATAGTCATACTTCATCACCACA
T7_18660_G10	TTCCTCATACAACTTCTGTCCCTACTACAACAAATT
T7_18661_G10	AAACTACTACTTTTCTAGTCCTCACCTAATACTACC
T7_18662_G10	AATTATTATTCCACTTCGTCATCCACCCTACACATA
T7_18663_G10	ATCACCACCATACTTCTGTCACTAATCCTTCTTAAA
T7_18664_G10	AATCATCATTATTCCACGTCCACCATCAATCTTCTA
T7_18665_G10	CAATCATTAATCCTCCAGTCTCTCCCCTAATAAATT
T7_18666_G10	CCACTTTTCAACAATAAGTCCAACTACTACTCCTTT
T7_18667_G10	AACATAATTTACTCCTAGTCTTATCCCCACCTATCA
T7_18668_G10	AAAATAAACCTCTTAACGTCATCCTACCCTCTTCTT
T7_18669_G10	CCCACAACAATAACATCGTCTTAATTCCTCCTTTTA
T7_18670_G10	TACTACCATCATCCAACGTCAACATCTTATTTTCCA
T7_18671_G10	ATCACAATTCTTCAACAGTCACTAACTACTTCTCCT
T7_18672_G10	TCAAACCACTTCATTCTGTCTATAACTCCACTACTA
T7_18673_G10	ACCACTCCTTATTACATGTCCATACACTATTATCCA
T7_18674_G10	AATCACCAACATTATTCGTCCTCTACCTCCATTATA
T7_18675_G10	ATCAACCACCTACTAATGTCCACAATATTCTTCTTC
T7_18676_G10	ACCCCAACCATTATTCTGTCAATTTATACTCCTACA
T7_18677_G10	TCATAATAAACACTTCTGTCTCTACTCAACACTCCT
T7_18678_G10	ATTACTACACAACTACAGTCTTATCCTTTTCACCAC
T7_18679_G10	TCTTCTACCACCACCAAGTCTAACAATTCTTATCAT
T7_18680_G10	CAACAACCATCTACCACGTCAACCTTCTTATTATTT
T7_18681_G10	CTCTTCTACCACCATTAGTCTCATAAATAAACTCCT
T7_18682_G10	ACTCCATAACAACAACTGTCAACTATCTTCTTTCCT
T7_18683_G10	ACCCCTCATTATATTACGTCTACTTCTAATACACCA
T7_18684_G10	ATATATTATCTCCTCACGTCCCATTACTTCAACAAC
T7_18685_G10	AATACTACCACAACATCGTCTTCTTCTTCCTATCAA
T7_18686_G10	ACTACTACTTTTCCTCCGTCAACATTACTACTACAA
T7_18687_G10	ACTATCAATAATAATTAGTCTCTTCACCTCCACTCC
T7_18688_G10	ACCACCAAAACATAATAGTCCTTTTCTTCTCCTCAT
T7_18689_G10	CCCTCCATCTTTAACAAGTCTAATATTCTACATCAC
T7_18690_G10	CATCAACATCATCTAATGTCTACATCATCATCTCCT
T7_18691_G10	CTTCTCCTACTACTACCGTCCACATTACAATAATAT
T7_18692_G10	ACCACCTCACTTTTTTTGTCTTACAACAACCAACTA
T7_18693_G10	TCTTCTAAATAATTACCGTCCCTCCAACAACTATTC
T7_18694_G10	CCTACCACCCACTACTAGTCATACTATTATCTTATA
T7_18695_G10	CCAACAATCATCATTTTGTCTTTATCACCACAACTC
T7_18696_G10	CTCCCTTATCTTCTCCAGTCACATTAAACAACATTA
T7_18697_G10	CATTAATCACCCCTACTGTCATAATACTCTAATCCT
T7_18698_G10	CAAAACAACACTAACCTGTCCTTCATTTTTTCCCAT
T7_18699_G10	ACTACCATCTTAACAACGTCATCATCCTATCTTATC
T7_18700_G10	TCTTTTTTCCTATAAACGTCAATACTACCACCACCA
T7_18701_G10	CCATCACTCCTCATACTGTCATTATTAATCATCACA
T7_18702_G10	CAAAACAACATCATTATGTCCTCCTCTTCTTCATCA
T7_18703_G10	CTACATCATAACAACTAGTCCCCTCCTCTTTTAATA
T7_18704_G10	CAACTAATCCTCAATACGTCTTCCTCCTTATAATAC
T7_18705_G10	AACTACTACTACTACATGTCCACTCTTTCTTCAACA
T7_18706_G10	TCCATCACCAATAAATCGTCAACATCTTCTACTCTT
T7_18707_G10	AAACAAATTATACTCACGTCATCTTCTTACCTCCTC
T7_18708_G10	TAACTAAACACCATTCTGTCTCAATCATTCTCATCC
T7_18709_G10	ATTCATAATACTACTAAGTCCAACCACCTCTTCTCT
T7_18710_G10	TTCTTTATCAATCACCCGTCAATCTTCAACAATACC
T7_18711_G10	ATTTACTACTTCTCATCGTCAACAATCAACCTCTAC
T7_18712_G10	CATCATCTTATCATCACGTCATCATCATCCTAACAT
T7_18713_G10	TTTAACAATCATCATCTGTCCACTTCAACATCATCC
T7_18714_G10	AATTATCCCACTTCATCGTCCTCCACTAATTTAACA
T7_18715_G10	CACTAATTTCCACATAAGTCAATCCTCTTCTACTAC
T7_18716_G10	TCATCCCCTCCTCATCAGTCACAATAATCATTATTA
T7_18717_G10	CTTCTTATTACTAATTAGTCCCACCACCACAATACT
T7_18718_G10	AAAATAAAACCACCAATGTCTTCTTTTCCTCTCCTC
T7_18719_G10	CCACCCCACAACATTAAGTCTTATACTCCTATTATT
T7_18720_G10	CCACAATCCATCATCATGTCCATCACCATTATTATT
T7_18721_G10	ACCACCACTACTATCATGTCCATTATTCTTACTAAC
T7_18722_G10	AACAACTCCCCAAAATTGTCTTTTTTCTACACCATC
T7_18723_G10	CTTACTATCCTAATATTGTCACACATACCTCCTAAC
T7_18724_G10	CTCCAACATAACTATTAGTCTCCTTCATACACTACT
T7_18725_G10	TCATTAATTATCAACATGTCCATCACTCCCCATCAT
T7_18726_G10	ACTACTCCTTCATACTAGTCTCAATAAACCTACTTC
T7_18727_G10	CATCTCAACTTCAATAAGTCTTATCCTCCACTACTA
T7_18728_G10	CCCTCCTTATTAAAACTGTCTCTCATATAACAATCC
T7_18729_G10	CATACCACCTAATTAATGTCATTACTCAACCTCCTT
T7_18730_G10	TACTATCTACCAACATCGTCACCAATATTATTCCTC
T7_18731_G10	ACAACAATTATCACTCTGTCCTTCCTAACACCTTAT
T7_18732_G10	CTACTCACCATTATTTAGTCACAATCATTCCACTAC
T7_18733_G10	CAACTACCATACTAAATGTCTCTTTCTTCACTACAC
T7_18734_G10	CTTCTACACCAACTCCAGTCCTACAAATACTATTTT
T7_18735_G10	CTATCTTCTTATCACAAGTCCATCATCCATCCTAAA
T7_18736_G10	CACAACAATTATTTCACGTCCACCATTCTCTTACAT
T7_18737_G10	CCTCTTTATTCCCACATGTCAATAATACTACCACTA
T7_18738_G10	ACCATCAATAATAATAAGTCTCTTCTCCTCCTCCTA
T7_18739_G10	ATATTATTCATAATCAAGTCCTCCACTCCCTCATCA
T7_18740_G10	ACTTTTTATTCTAACATGTCACCACACACCTACTCA
T7_18741_G10	TTCTTCTACTCCCTAATGTCCAATACAAACACCATT
T7_18742_G10	AATTCAACTAACCTTCTGTCCCTCTCCTCATAATAA
T7_18743_G10	ATCATCTTCTACCCTCAGTCTACCATTATCAATAAC
T7_18744_G10	TCACCTATTATCAAACCGTCATTATTCTACATCACC
T7_18745_G10	ATTTTCTTCTACAACAAGTCCAACTACTACTACTCC
T7_18746_G10	CCTCCAACATTATTAACGTCCCTCCTACTAATTAAT
T7_18747_G10	ACTAATTACATTCCTACGTCTATTATTACCCCACCA
T7_18748_G10	TTCTTCTTCTACATAAAGTCCACCTCCCATCAATAA
T7_18749_G10	ACTACTAATAAAATCCCGTCCCCTACTTCTACTATT
T7_18750_G10	CAATAATACTTCTTTATGTCAACCCCACCACATCTT
T7_18751_G10	ACAATAATACTCCCACAGTCCCACTACTACTTTTTT
T7_18752_G10	ACCTCATCAATTCTTATGTCCCTACTAACCATCATA
T7_18753_G10	CATCATAAACATAATTAGTCTTCCTACCATCTCCCT
T7_18754_G10	ATATTCCTACTCCTCCAGTCTCATCAACTAATATCA
T7_18755_G10	CCATCACCAATCCACCTGTCACTACTAATTTATATT
T7_18756_G10	TACTACTCATCACCCTAGTCTTAATACTACTACCAT
T7_18757_G10	AATTTTTTAATACACCAGTCCCACTACTACTCCTCA
T7_18758_G10	AACACATTACCACCACTGTCTTCTTCCATCATAATT
T7_18759_G10	CCACTAATTTTTTCCACGTCCACAACTATCATCTAA
T7_18760_G10	TCATCACTACTACAACAGTCTCTTACTACTTCATCA
T7_18761_G10	ATAATTACCTCCTCATTGTCTCAACTACTCCAACTA
T7_18762_G10	CTATTCTACTAACTACCGTCACACCACCTATTATTA
T7_18763_G10	ACCTACCATCATCTTCTGTCTCCTAATAATCATAAC
T7_18764_G10	TCATTATCTCCTCACCAGTCACTCCTTAAATTCAAA
T7_18765_G10	CATATAATAACATCACTGTCCCTTCATCACCCTTAT
T7_18766_G10	TCTTATTAATAACATCAGTCCCACCATCTCCCTAAT
T7_18767_G10	ATAATTCTCTCCCCACCGTCACCATTACTATTAATA
T7_18768_G10	TCCACCAAACTTATACTGTCTTATCAAACATCTTCC
T7_18769_G10	TTATACCACCACCACCAGTCACCTCAATATTATTTT
T7_18770_G10	TACTACTCTTTTTTACCGTCACAACAACACCTAACT
T7_18771_G10	CCACATTATTATTCAACGTCCACCATCATCATTATC
T7_18772_G10	TCTCATCATTCTACCACGTCATACTACTACCAAATT
T7_18773_G10	CAAAACCACCTCCATCAGTCTCATCATATTCTTTTA
T7_18774_G10	CCTACAACTAACTACCTGTCACTCTTTACTAATACT
T7_18775_G10	TTCCTCCTCATTTTCATGTCCACAACAATATACAAC
T7_18776_G10	TCATCATAATAAATATTGTCCACCTACTACTCCTCC
T7_18777_G10	TCCTCCTACATCTCCTTGTCCATCATAATAATAACA
T7_18778_G10	CACCATCCTACTCATCCGTCCATAATATTATTATAC
T7_18779_G10	CTACTAATATTCCCTTTGTCATCAACACAATCACCT
T7_18780_G10	CAATATACAACTTACCAGTCCTCCCTTTATTAATCC
T7_18781_G10	CCAACTCCTCATCTTATGTCTATTCATAAAATCACC
T7_18782_G10	TTCCAATACTCCCTATCGTCATCTACAACAACTATT
T7_18783_G10	ACTCATAATACTACTCTGTCTCACCATCATCATCAT
T7_18784_G10	CTCTCCTTATATTACCAGTCCACTAATACCACAATT
T7_18785_G10	ACTTCTTAATACTATTAGTCCCCTCAACAACACTTC
T7_18786_G10	TATTTTTTTTAACCCAAGTCCCACCCAAACACTACT
T7_18787_G10	CTTCATCATTAATCCATGTCCATCACCCACTATAAT
T7_18788_G10	CACCTATTATCCTCCTAGTCCTCCTAATAACTAATA
T7_18789_G10	CACCAACCTCCTTACTAGTCTAATAATCATTCTTCA
T7_18790_G10	TTATTATCAACAATTTAGTCCCACCCACTCCCATTA
T7_18791_G10	TAACCACCAACCACTATGTCCTACATCTTTTTAACT
T7_18792_G10	TACAACAACTAATACTCGTCCCTACTACTTCTTCAT
T7_18793_G10	ACTACATCTTCATCCTCGTCCACAACATATTACTAT
T7_18794_G10	CAAATCATCATCATCCAGTCACTATCCTTATCTCAT
T7_18795_G10	TTTTTCCACCACCACCTGTCCAAAATTATCTAATCA
T7_18796_G10	AATAACTACTCCTTCTAGTCCACCTTATCCTACTAA
T7_18797_G10	CTTATCAACTAACCTCCGTCAAAATCTACTTATTCC
T7_18798_G10	CCTTATTAAACCAACTTGTCTACTCACCTCATAATC
T7_18799_G10	TCTACAACACATTTCACGTCCAATAACCTACTTCTT
T7_18800_G10	CTTCCCTTCATCAATATGTCTCATAATTAACACCAC
T7_18801_G10	TACATCCTCCTATTACTGTCACAACATTTTCCAACA
T7_18802_G10	CCACATCCCTTTTACCTGTCTTCTAACAACATAAAT
T7_18803_G10	CTTACCTTTTAAACCACGTCCTCAACCTCATTATAA
T7_18804_G10	AAATCTTATCCCCACCCGTCATTAACAACTTCATTT
T7_18805_G10	CTTAACTACCCACTCAAGTCTTACTAATATACTCCT
T7_18806_G10	ATTATACTTCACCATCTGTCACCCCATATATAATCC
T7_18807_G10	ATATAACCCACCAATCAGTCTTAATATTCTTCCTCC
T7_18808_G10	TCATTATCATCCATCTAGTCACTTAACTCTCACAAC
T7_18809_G10	AATAATAATTCTATATCGTCATCTTCTCCACCACCC
T7_18810_G10	TTATTACATCATCTCTTGTCACAAAACATCCTCCAC
T7_18811_G10	TCCTCATCCAACTTTTAGTCTAACAACTATCCACTA
T7_18812_G10	CATACTAATTCTCCCTAGTCATTCCAATATACCACT
T7_18813_G10	TCCAACAACTCTTACTTGTCATTATAACCACTCCTA
T7_18814_G10	TTCATTATTATTCACCCGTCTCATCCAACAACACTA
T7_18815_G10	TCTTCTTATCATCAACAGTCCTCATCAACCAACTAT
T7_18816_G10	TAATATCACCCCTCCACGTCAACACTATTTTACTAT
T7_18817_G10	CTACAACAACCCATTATGTCTTTCCCTAAACCTTAT
T7_18818_G10	ATTACTACATTACTCCTGTCTCTTCAAAACACCATC
T7_18819_G10	CAACATTCATCTCCCAAGTCTATTCTTCTTCACAAA
T7_18820_G10	CCTACCTCTAAAATAATGTCAAACCCTCCTCATTTT
T7_18821_G10	CTTCCACAATACTACCCGTCTTAATCCAATATTTAC
T7_18822_G10	ATCCTTCACCACCATTTGTCTTTACCAATCAACTAA
T7_18823_G10	TTCCACCACCTTCTACAGTCTAATATTCTAAATCAC
T7_18824_G10	CACTTATAATTATACATGTCCATCCTCCTCCTACAA
T7_18825_G10	TCTATAAACTTCCAAATGTCACCAACTTCTATCCTC
T7_18826_G10	CTACTAATACTAATATCGTCTCCCTCCCTTCAAAAT
T7_18827_G10	TCCCATTAATAATAACTGTCCCTATTATACTCCCAC
T7_18828_G10	CACTACACATCTCACTAGTCCCAACATATATTTCTT
T7_18829_G10	ATACTCATACTACTAACGTCTACTACACCTATTCCT
T7_18830_G10	AATAATTATCATTCCCCGTCTCTTCCCAAATTCAAC
T7_18831_G10	CAATAATTACATTCAACGTCTTCTTCCACCATTACC
T7_18832_G10	AACACACACTACTATATGTCCCTTAATCTCTCCTTA
T7_18833_G10	TCTTCAACTACTCATCCGTCCTACTTCATAAACAAT
T7_18834_G10	TATTTTTCCCACAACCAGTCTATCCAACAATTCTAC
T7_18835_G10	CCCTAACAACAATACATGTCCTACCATTTTACTTCT
T7_18836_G10	ATTACATCATCCCAATAGTCTAAACTCTCTCCTCAT
T7_18837_G10	TTTTCACCTCCTCAACTGTCAAATACAATCACCTAT
T7_18838_G10	ATCTCTTTCTCTTCAACGTCAACACATATCAACCAT
T7_18839_G10	TCATTCTAACAACACTAGTCTTCTATAACCCCATTC
T7_18840_G10	CTTCTCTAACAAAATCCGTCACATCATCTTCTACAT
T7_18841_G10	TTCTTCTTTTCACAACTGTCCACTACAACAAATACC
T7_18842_G10	CATCTACTATCCTTATAGTCTACACCACACTATATC
T7_18843_G10	CCTTTTATTTTATTAACGTCCACAAACAACACCCCT
T7_18844_G10	TTAATATCCATCATAAAGTCTCACCATCCTCTCATC
T7_18845_G10	ACTATTATTCAACCTCTGTCTCTTACTACCAACCAA
T7_18846_G10	TACTCTAATACACATCAGTCACCACATCTTTCTTAC
T7_18847_G10	TTTAATACTTCATTCCTGTCTCAACCACCTACAACA
T7_18848_G10	TATACTCCTCAACAACAGTCAACCTTTCTACATCTT
T7_18849_G10	CACAACTTTCACTATTAGTCACCTAATTTCCACCAT
T7_18850_G10	AAAATCTTATCCACCTTGTCACCTTACTACATCATC
T7_18851_G10	CCTTTTCTTCATTACTAGTCCACTACCACAAAACTA
T7_18852_G10	CCTCTTCCTTATACAAAGTCATAAATACTTCACCCT
T7_18853_G10	CCTTAACCACCATATTAGTCTTAATTTTACCCAACC
T7_18854_G10	CTAATCACCCACTACTTGTCCTTTATTAATAACCAC
T7_18855_G10	CACCACCACCCTCCAATGTCTAATAATAATTTTTTC
T7_18856_G10	CCCATTCTCCACCCAAAGTCATTATCTTTATATCAA
T7_18857_G10	ACTCTTCTTCTACTCCCGTCACACATAATTCAATAA
T7_18858_G10	TAACCACTACTACTCACGTCCAATTCCTTTATAATC
T7_18859_G10	TCTATATATTCCTCATAGTCCAACTACCACCATACT
T7_18860_G10	TAATAACATCAACACTCGTCCTCCTACCACTTTATT
T7_18861_G10	CTAACCCTCCCCTCTAAGTCTTTAATAAACCTATTA
T7_18862_G10	CTTCTACAATCAACTACGTCTCCACATATCATTTAC
T7_18863_G10	CTATCTAAACCCACTATGTCTAAATTTTTCCCCACA
T7_18864_G10	CTCATTACATCAAACATGTCTTCCCAATTAATCCTC
T7_18865_G10	ACACCAACAAATTCCCTGTCCTTTTTATTACTACCA
T7_18866_G10	ACCCATCATCACCCTTAGTCATCATCTCTTATTAAA
T7_18867_G10	ATCCTACTCACCATAATGTCACCTATCATATCATCT
T7_18868_G10	AACCATCATCACATCATGTCCTTAATTCATCATTCC
T7_18869_G10	TTAATCACTACCCTTCTGTCTAAAACTACTCATCAC
T7_18870_G10	TTATTCCCTCCTAATAAGTCTATTAACCACCATCCA
T7_18871_G10	TACTTTTTCTACCACCCGTCTTATAATAAAACCACC
T7_18872_G10	AAAATCTTCTCCTACTAGTCATACCAAACTTCCCTT
T7_18873_G10	TACCACAATATCATTATGTCCTTCTTCTCCACAAAC
T7_18874_G10	TTCACTTCCATCATACTGTCACAACAAACTACTTCT
T7_18875_G10	ATTCAACTACTCACCATGTCTAATCACTCACCTATT
T7_18876_G10	TCCTTCTATAATATACAGTCTCATCATCCACCACAT
T7_18877_G10	AATCACCTTATTATTATGTCCATACCACACCCTCAT
T7_18878_G10	CATCACCCTCCACAATCGTCATCATATTACTATTAT
T7_18879_G10	CTATACCTTATAACCAAGTCTATCCTCCTACTACAT
T7_18880_G10	TACACTCCTCTTATAAAGTCATCTATCCTAACATCC
T7_18881_G10	TCTAATCATAATAACCCGTCCCCTCTTATTTACAAC
T7_18882_G10	CTACCATACATCTTTTTGTCCAACAACACTCCATTA
T7_18883_G10	ATAACACCCTCTATTTTGTCTAATATCATCCACCCA
T7_18884_G10	ACCACTCTACTTCACCTGTCATACTATTTATCAACA
T7_18885_G10	TCCTTTCCACCCATCCAGTCCTATTAAATAATACAT
T7_18886_G10	TTCATTCTCATAACCACGTCTACTTATAACCACATC
T7_18887_G10	CTTCTATAACCATCCTCGTCATCATCTAACAAACTT
T7_18888_G10	TACATCTTTAAAACCTTGTCCTCAACCCTAACCTTA
T7_18889_G10	TAATCATCTCTTCTACAGTCCCAACATCATCATCAT
T7_18890_G10	TTTCTACCCCTACTTATGTCTAACAACACAACATCT
T7_18891_G10	AACCAATAATACTTCTCGTCCACTATTACTCCTCTA
T7_18892_G10	ATACAACCTCCATCTTTGTCAATAATACTTCCTACC
T7_18893_G10	CTACTCATAAAATACTCGTCTTCACCTCCTACTAAT
T7_18894_G10	CCACATCTTAAATCTTCGTCTTCTCATACAACACTA
T7_18895_G10	TTATAAACATCTACTACGTCTCCTCCTCCTTAACAA
T7_18896_G10	CTTCTATTACTACTACCGTCAACATTATCAATCACC
T7_18897_G10	AACAACACTCCCCTTCAGTCTTTCCACATATTATTA
T7_18898_G10	TTAATAATTTACTCCATGTCCCCTCCTCTAACAAAC
T7_18899_G10	ATAATCTACAAAATCCAGTCCTCCTATTCTTCCACT
T7_18900_G10	ACCTCCATCTCATCAACGTCTCTTAATTATACATCA
T7_18901_G10	TACAATTCATACTATTCGTCTCAACACCATCCTCAT
T7_18902_G10	ATACTACAATTACCATCGTCCAATTATTCTTCCACC
T7_18903_G10	TCTAATAAATAATCACCGTCCCCTCTTATTCTCAAC
T7_18904_G10	CCTTTTACTTCATATCAGTCTCATCAACATCAACAC
T7_18905_G10	CACTACATTATATTCTAGTCATCACTCCTTCAACAC
T7_18906_G10	CAAATCCTCTTCAATATGTCCATCTCCCCTATAATA
T7_18907_G10	AACTCCTACCAAATTCTGTCTACTTCTTCTAAACAC
T7_18908_G10	AACCATCATCTCCTCTAGTCCTCATCTAAATAATTC
T7_18909_G10	ACTCCTCCTTAATACTTGTCCACCAATATCACAATT
T7_18910_G10	CACTCTCCACTACTAACGTCATCTCTCATTTAATAA
T7_18911_G10	TTATTTCACCACCCTCAGTCATCATCTTATAACAAC
T7_18912_G10	AACAACAATTATTCCACGTCCTTCTCCCTACTTTAA
T7_18913_G10	TCTCTTCAACAATTCATGTCAATACAACACCTCCTT
T7_18914_G10	ATCATTAATCTCCTCCTGTCTTAACCTCAACAATCA
T7_18915_G10	AATTCTAACAAACTTCCGTCTTTCAACCATCCTATC
T7_18916_G10	ACTAAACTCTTCCCTTTGTCAATCTAACATTACACC
T7_18917_G10	TTCATACAAATACTACCGTCTCAACAATTCTTCCTC
T7_18918_G10	ATAAATCTACCTCTTCTGTCTATAACACCACCATTC
T7_18919_G10	CAAATACTCCTTATCATGTCCATCAACTCTTTAACC
T7_18920_G10	CCTAATTATCCTTCAATGTCCACCAATTACTACTAC
T7_18921_G10	ATTATTAAACATCCCTTGTCCAAATACTCCTCACCT
T7_18922_G10	CCAAAATAATCAACACCGTCACCCTCTTTTTTATTC
T7_18923_G10	TAAAACACCACTATCATGTCCCACCATCTTTATCTT
T7_18924_G10	CTACTTATTAAACTACAGTCCCACCTCCTTATCATA
T7_18925_G10	CCATAATCTCTTTTTCAGTCCATAAACACACACTTC
T7_18926_G10	CTTATAACAATCATAACGTCTTACTACTCCTTCACC
T7_18927_G10	CAACTACAATATTCTCCGTCCATCAATTCATCTTCA
T7_18928_G10	TTCTACACCTAAATCACGTCCCCAATATTACTTCAT
T7_18929_G10	CCTACTAATTAATATACGTCCTCCACATCCTCATAT
T7_18930_G10	CTCACCAACAATACACTGTCATTATCAACTTTCTTC
T7_18931_G10	CATCCATATCCTTCATAGTCATACTACTACTCATCA
T7_18932_G10	TCTCCCACAATATATATGTCTCCACTATTACAACCT
T7_18933_G10	ACTACTCCTCAACACCCGTCTCTTCATATAAATTAT
T7_18934_G10	CCACAACTATAATTACTGTCACCCCTTAACTTCTTA
T7_18935_G10	CAATAAACCATTCCTATGTCTCTTTCCTACCACAAT
T7_18936_G10	TCAACAAATCCACTTTAGTCACCCCTCATTAATTCT
T7_18937_G10	AACACATTCTTCCAACTGTCCAATCTCCTATTATCA
T7_18938_G10	CTCACTACTTTTCTACCGTCTCCAACATCAATATAA
T7_18939_G10	TTCATTATCCTCCACTAGTCTCATATACCAACCTAA
T7_18940_G10	ACTAATCACTAAACTCCGTCTATCCTCTTTAACTAC
T7_18941_G10	CCACAAATCATCAAAATGTCTCTCCTCTCCATTTAT
T7_18942_G10	TCCATCCAACAAACTACGTCTATTCACTAATTTCTC
T7_18943_G10	TACCCTATTTATTATCAGTCTCACCACCAACTAATC
T7_18944_G10	TTCTTTCATAACCACCTGTCACAACCTCATTATAAC
T7_18945_G10	TAATTTTAATCACTCCTGTCATAATACTCCCACCCA
T7_18946_G10	TCTCCTTCATTAATTCCGTCACCCCTATAAACAAAT
T7_18947_G10	CCTTCATCAAATTATTAGTCCAATTACCATCACCTC
T7_18948_G10	TTCTACTCTTCATCACCGTCTCTTCAAATACACAAA
T7_18949_G10	CATCATAACATCATCATGTCCATCACCTTCTTAATC
T7_18950_G10	TTCACCATTATCAACTCGTCCAACAACATTATCCTT
T7_18951_G10	TATATAATCATTTCCACGTCATACTACATCTCCCCA
T7_18952_G10	AATCATCCTTATAACCTGTCTACACCTTCAATCATC
T7_18953_G10	TTTATCACCATTCATCTGTCTCATAACAACATCCCA
T7_18954_G10	TATCATTCCACCATCATGTCACCCCTCTAATAATTA
T7_18955_G10	CTTATTACTATCACCCAGTCTTACACAACATCATTC
T7_18956_G10	AAACTACTCCTCCAAACGTCCTATATTATTATCCTC
T7_18957_G10	CTACATCCACAACATTAGTCCCACCAATTTTTTACT
T7_18958_G10	ATTCCTTCTTCTTACACGTCCAACCATAACATATAC
T7_18959_G10	CAAACCAACTCCTTATTGTCATCCTTAATCTCAACT
T7_18960_G10	ATACCATCTACCATCTTGTCCATTATACTACTACCA
T7_18961_G10	TCTTCTCCACTACCCACGTCATTCTACTATAAAATA
T7_18962_G10	AAACCCCACTACTATTAGTCATACAACTCCTTCTTT
T7_18963_G10	TATCATTCTCATACAATGTCAAATTCACCACCCTCT
T7_18964_G10	TCACTCAAAACTTTTTTGTCTATCACAACCCCATAC
T7_18965_G10	CTTCATAACTTATCATAGTCATACTCCAACTTCACC
T7_18966_G10	TACTAATCTCCATCAACGTCACTATTATACACTTCC
T7_18967_G10	TCCATCTATCACCCTCAGTCTCAATAATATTACACT
T7_18968_G10	CCTCTTAATAATAACATGTCTTCCACCAATTCCACT
T7_18969_G10	ACAACCAACCTATTCACGTCTCATTACTTCTACTAT
T7_18970_G10	CTACTACTTCTTATTATGTCACTACAACACCACTAC
T7_18971_G10	TACAATTATCACCACTAGTCTTCCCCTCTATAACAT
T7_18972_G10	CAAACAACCACTTCTTAGTCTTCTACTACTACACTT
T7_18973_G10	TCCTCAACAACCACACTGTCATCTACTACTATATTT
T7_18974_G10	AATACCACCCTTCTTCTGTCTTTCAAAATACTACAC
T7_18975_G10	ACTCTTTTCAATTATCAGTCTAACAACTCATCCCAC
T7_18976_G10	AATTTAATACTCTACCCGTCACCTTCTTCACATCAA
T7_18977_G10	CCAACCACTTCTACTCTGTCACCACAATATATTTTA
T7_18978_G10	ACTCCTATTACTAATATGTCCCTTCCACAAACTACT
T7_18979_G10	TCATAATAATAATCCACGTCTTCTTCCCACTTACAC
T7_18980_G10	ACACCTTATTATCCCTCGTCAATAAATATCTTCACC
T7_18981_G10	CACCACAACTTCTACACGTCCATCATTTACTATTAT
T7_18982_G10	TTCACCACTTTATAATAGTCCACTACTCCTACTACA
T7_18983_G10	TATTACTTCTTCACCAAGTCCAATCTTCCACTAACA
T7_18984_G10	CAATTTACCACTATAATGTCCATCATTTTCCACCAC
T7_18985_G10	CAAACACTCATACATAAGTCCCTCCTATTTTTCATC
T7_18986_G10	CCCTACTTCAATAACTTGTCACCTTCACAATTATCA
T7_18987_G10	AAAATCTACTCCTCTTCGTCTCCTACTTTACAACAA
T7_18988_G10	ATCACTACTACTCTTCAGTCTCAACCTCATCATATA
T7_18989_G10	TTCCCTATTTCACATACGTCCACTAAAACTACTACT
T7_18990_G10	TACTAATCACCATACCAGTCTCTCATTATATCATCC
T7_18991_G10	CTATTACTCCTCATTCCGTCTACATTACCACAAATA
T7_18992_G10	CCCATAATTAATACTACGTCTTATCCTCACCTTAAC
T7_18993_G10	TCCATCACCAATCATCTGTCTTTTAATAACAACCTC
T7_18994_G10	AATATTCCTAAAACCCAGTCTACTCCTCAATTCTTC
T7_18995_G10	CCACTAACACTAATCCAGTCCCATTCATATTCTTAT
T7_18996_G10	TCTTCTTATCTAACATCGTCAACACCTCCTAACTAA
T7_18997_G10	TCATCCACTTTATCAACGTCTAACTAACTTCACACT
T7_18998_G10	CTACCTCCTACCTCAAAGTCCCTTTAATAATAATTC
T7_18999_G10	ACCTCATCTTAATTACCGTCATAACCACTTCTACTA
T7_19000_G10	CCACTACCATTCCTCCTGTCTCTAATAATAATATCA
T7_19001_G10	ATTCTAACAAACACATAGTCCCACCTTTTTCTTCAC
T7_19002_G10	TTTCTCTATTCTATAAAGTCCAACCACTACAACCCT
T7_19003_G10	CAATCCCTCCTCATTATGTCAACTAAAATCATCTCT
T7_19004_G10	TAACCACTCCAAACAACGTCATTTCTTCTTCCTATA
T7_19005_G10	AACAAATTCTCCTTATTGTCCATTTAATCCCCACCA
T7_19006_G10	ATAAATTCCTTATAATCGTCATCTTCCCATCACCAC
T7_19007_G10	CTACTTCCAACCACTTAGTCTAATACTACTACTTAC
T7_19008_G10	ACTCTCCATCATAAACTGTCACTTAATTATTCCACC
T7_19009_G10	ATATTCTTCTCAACATCGTCCATAACACTTTACCCA
T7_19010_G10	CATACTTCTTATATAAAGTCCCACCACTACTCTATC
T7_19011_G10	CTTATACCAATATTACTGTCACTATCTCATCACCAC
T7_19012_G10	CCCTATAACTTTAATTAGTCATTACAACACCCTTCC
T7_19013_G10	ATCATCATCTTATTACCGTCATACTACTCACCACAT
T7_19014_G10	TACTTAACAAATTCCTAGTCCAAAACTTCCTTCCCT
T7_19015_G10	CCACCTATTACTACCTCGTCATAAACATTTTACACT
T7_19016_G10	TACTACTTCAACCACCAGTCCCATACAACATTTTTT
T7_19017_G10	CATTACACAATCATCTCGTCTACCACCTAATTATTC
T7_19018_G10	ATTCATCACCCATCTAAGTCTATCATCATCTACTAC
T7_19019_G10	TAATAATACCATTCATAGTCCAACCTTCCTATCCCT
T7_19020_G10	AAAACTAACCTCTTTCTGTCACCCTCACATCATTAT
T7_19021_G10	CACTCTTTTTATAATAAGTCAATCTACCACCCCACT
T7_19022_G10	CAACTCTTCTTAACATTGTCCCTATAATCATCCAAC
T7_19023_G10	TATTATCATATTCTCCCGTCAACCTCCAACATAATC
T7_19024_G10	CACTCCTCTTCATATACGTCAATATAACATCATCTC
T7_19025_G10	ACCTCCTACCTATAACCGTCTTATACATAATTCCAT
T7_19026_G10	CCCACCACTCTTCAATCGTCATCATTTAATATCAAT
T7_19027_G10	ACTAATTACAACACTTCGTCTTCTTCATCAACTACC
T7_19028_G10	ATCACCCCTAAACACTCGTCTATCTAACTCATTATT
T7_19029_G10	CCCATATTTCTTACTACGTCCACCCAACAATTATTA
T7_19030_G10	ACTCTACCTACCAACTAGTCCTCCTTATATATTCAA
T7_19031_G10	AACTCCTTATACTATCAGTCTCTAACATCATACCTC
T7_19032_G10	CCATCATATAACACCCTGTCATTACATTCCATCATT
T7_19033_G10	ACACAAAACTATTATCAGTCCATTCCTTCTTCTCAC
T7_19034_G10	ATAACAATCACTATACTGTCATCTTCCACCTCCTAT
T7_19035_G10	ACTACTTCATAAACTACGTCACCACTTCTCCATTAT
T7_19036_G10	TTTTCATCTAACAACACGTCTTACCTCAACCTCAAT
T7_19037_G10	TTATAATTCATATCCACGTCCACCCACTTACTCAAT
T7_19038_G10	TTCACTCTCATAACTTCGTCCTCTCACCATAATAAA
T7_19039_G10	ACTACACTACCAACCTAGTCTTCATCTCATTTTACA
T7_19040_G10	CATCATCAACACTTCCTGTCCTACTAATCAACATTT
T7_19041_G10	AAAATAATCCTATCTTCGTCTCCACCATCTTCATCA
T7_19042_G10	CTACTCCTCCCATACAAGTCCAACTTATATTTACTA
T7_19043_G10	TCACCAAACATTCTTCAGTCCTCATCATCATTATAC
T7_19044_G10	CCTACCTATTAACTACCGTCATTATTAATCCACCAT
T7_19045_G10	ACCAAAATAATACCATCGTCATCTACCTCTTCTTTC
T7_19046_G10	CACCACTTCTCTTACTAGTCCTTAATATCAACATCA
T7_19047_G10	CCTCTCATAACCTCAACGTCATATCATCATCATTTA
T7_19048_G10	ATCATATCTACAATAAAGTCTAACTCCTCCTCCTTC
T7_19049_G10	AAACATTTATTATTTCTGTCACCCCACAACCTACTC
T7_19050_G10	ATACTCTTATTCCTCCAGTCACCACATAATTACCAT
T7_19051_G10	CTACCACCTTTCAATATGTCATCATAAATACCCCTT
T7_19052_G10	TCTAACCACCTATTACTGTCTCACAACAAATCTTCT
T7_19053_G10	CAACTCCTTATTATACTGTCACCACAACATCTATCT
T7_19054_G10	ACTTCTTATCACACCTCGTCTAATTCTACATCACAA
T7_19055_G10	ACTCCCTTATTATAAACGTCCTCTTAAAACACCCTT
T7_19056_G10	TTATCATCACCAACAAAGTCTTACCCTCTCCTATTA
T7_19057_G10	TTCATCAAAATACCCCTGTCCCACCACTTAATTATT
T7_19058_G10	TACTTCTCCTCCACCAAGTCCTATTACTACAAAATT
T7_19059_G10	ACTTAACAAACTCCTTCGTCTTCTTCTAAACACCAT
T7_19060_G10	AATACCATTATTAACTCGTCCTTATCACTCCCATCA
T7_19061_G10	TATTATCAACAACAACAGTCCTCTCCCCTACTTATT
T7_19062_G10	TATTTATAATAATCTCTGTCACTCCACCACCACTAC
T7_19063_G10	ATAATCCCATCTTAATCGTCATCATCAACATCCTTC
T7_19064_G10	CCTCATTATTTTTAACAGTCTCATACACACTCACCA
T7_19065_G10	TAACTACACAACTCATAGTCTAATCCCTCCTCTTAT
T7_19066_G10	TAAACTACTCTCCACAAGTCTCTTCATCATCTTAAC
T7_19067_G10	CCAATATTCTTACTCATGTCAATACTATTCCACCCA
T7_19068_G10	ATTAACACCTACCCCAAGTCCATAACTTCTTTCATT
T7_19069_G10	ACTACAACACCAATCCTGTCCATATTATCTTCATTC
T7_19070_G10	CTACTACAAACACCTCCGTCTACTAATATTATCCTT
T7_19071_G10	ATCACAACACCAAACCAGTCCTCATTCTTCTATTTT
T7_19072_G10	AACAATCACTCCATCTCGTCTCTTCTCATTAATAAC
T7_19073_G10	TTACCTCCTACCAACAAGTCCTCCTTATTAATTAAC
T7_19074_G10	ATTATCCTAACCTCCCTGTCACATTACTTCAATCAA
T7_19075_G10	TTATTCCCTCCTCTACAGTCATACTATCATCAACAA
T7_19076_G10	ATCTTATCTTTACTAACGTCCCCTCTACAAAACACT
T7_19077_G10	TAATCATAATACTATTAGTCTACCACCCTCCTCTAC
T7_19078_G10	CTTCTTCTCCAATATAAGTCCAAAACTTCTACCTAC
T7_19079_G10	TTACCTTCCAACAAATCGTCTCCTAATCTACACTTA
T7_19080_G10	TATTCTCTCATCATAAAGTCACCCTTCCCCAATAAT
T7_19081_G10	ACTTTTTTCACAACTATGTCCCACCTACAATCAACT
T7_19082_G10	CACCATACTTCTTTTTCGTCTCTAATAACAAACCAC
T7_19083_G10	ATTTTCTTTCAACCAATGTCAAACTACTACCATCCC
T7_19084_G10	AAATTATTAATTTCCCCGTCACCACTTCATCCTACA
T7_19085_G10	CTTAACAACTTCATTTTGTCACATCCCCATCATAAC
T7_19086_G10	CAATTTACTTCACCTCAGTCTCAACCTCCATATAAT
T7_19087_G10	CTACCTACTAACTACCAGTCCATTTAATAACTTCCT
T7_19088_G10	CCCTCCATCATCATCCAGTCTTACCATATTATAATA
T7_19089_G10	CTACTCTACTCAACAAAGTCCTATTATATCCATCCT
T7_19090_G10	ATCCCAACCCATATCCAGTCATATTAATTACTTTCC
T7_19091_G10	CTTACTACAACCATATCGTCCATTAATTATCCATCC
T7_19092_G10	ATCCATCCTCCTATTACGTCAACATTATCCACTAAT
T7_19093_G10	ACTACTACCAATAACTAGTCCCTCATACTTCTCTTA
T7_19094_G10	TAATAACACTACTCCACGTCCATCATAACTTTTCCT
T7_19095_G10	ACTACCAACATTACCATGTCCTTTTATAACCTCATC
T7_19096_G10	ATCACCATCCTTCATTAGTCATCTCCTACTAATAAC
T7_19097_G10	ACATTTATTTATCAACCGTCCCATTCCAATCCTCAA
T7_19098_G10	CTACTACTTATACTCCTGTCCATCATTCACAACAAT
T7_19099_G10	ACAATACTCCAACAATAGTCTTCTTCCTTATACTCC
T7_19100_G10	ACACCACCTTCATCAATGTCTACACTACTCATTATT
T7_19101_G10	TATACTATCATACCACAGTCCCTCATTAACACTTTC
T7_19102_G10	ATACATCACTACATCTTGTCCTTATCAACAATCCCT
T7_19103_G10	TATATTATAACTTACTAGTCCTCCCTACCAACCATC
T7_19104_G10	TAATAACACCCCTTCAAGTCACACTTTTTCTACTAC
T7_19105_G10	TACAACTCATCAATTAAGTCTACCCCTTCACCATTT
T7_19106_G10	TCTCCCCACTACTACTAGTCATCATCATCATAATTA
T7_19107_G10	TCCACACTACAACATATGTCTACAACATTCTCTTCT
T7_19108_G10	CCCACCATACTACTATAGTCACAATTACCTCTTTTA
T7_19109_G10	ACCACCAACCACTTCCCGTCCATATTTTTTATTAAA
T7_19110_G10	CACTACCTACCCTCCTAGTCTAATATTCTATAAACT
T7_19111_G10	ACATCACCCTATTATAAGTCTCAACACTTCATTTCC
T7_19112_G10	ACACAACTAACACCACTGTCACATTCTTATTTTTCC
T7_19113_G10	ATAATATCAATTTCCACGTCCACTTCATCCAACCTT
T7_19114_G10	ATTATTCTCCCCTCTTCGTCTAAATCCTCAAACAAA
T7_19115_G10	TCCTCCTCTTTAACAACGTCATATTACATCCATCAA
T7_19116_G10	CTTTACAACCTCATCCTGTCCTCATCAATAAATTAC
T7_19117_G10	TATTCTTAATAACTTCTGTCACTCCACCAACACTAC
T7_19118_G10	ACCACTACTACCTCAACGTCACATTTTTATTCACTA
T7_19119_G10	AATCTAATCTACTCCACGTCTTATCAACATCCTACT
T7_19120_G10	TACTATTTATTATCAATGTCACTCCACCCCAACTAC
T7_19121_G10	CACACAACTTTCCCCATGTCCAACTATAATTATTTC
T7_19122_G10	TTAATAAACACTTTACTGTCCCTCCCCATTACAACT
T7_19123_G10	ACCCCTACATTAATTAAGTCCTACTCCACCTTTTAA
T7_19124_G10	CAACAACATTATTCTTAGTCTCATCATCTACCATCC
T7_19125_G10	CTACACCATAATTTCCTGTCCCATCAACAACTTATT
T7_19126_G10	ATAATCACCACATTTTCGTCACAAAATCCTTCCTTC
T7_19127_G10	TCATAACACACCACATCGTCAATTATTATCCTCTTC
T7_19128_G10	TATTAATAATTACAACCGTCCTTCCTCCTCAAACCT
T7_19129_G10	CATCACAATAATCATTCGTCCCTCATCATAATCCTT
T7_19130_G10	CATCCTCCTACTATTCTGTCTAATAAAACTCATACC
T7_19131_G10	ACAACCTTCTACATCTCGTCCCATCATCTTAATAAT
T7_19132_G10	CTCCTTATTCACTATTAGTCCAACTTCCTACAAACA
T7_19133_G10	ACCACTTACTCATCTTCGTCTATTCTCCAACATAAA
T7_19134_G10	CCTACCCACCTCCTTTTGTCTCCAATAATAAATAAT
T7_19135_G10	TCTTTCTTCTTAACAACGTCACATCACAACTACTAC
T7_19136_G10	TTATACTTCACCAATCAGTCCCAATTACTATCACCT
T7_19137_G10	CTCCACCAACTACCTTTGTCAACTATCATATACTTA
T7_19138_G10	ACTATTACAATTAACACGTCCCTTCTTACCACCATT
T7_19139_G10	CCAACTCTTATTATAATGTCCATCATAACACCCTTC
T7_19140_G10	CACACTTCTTTAATCTAGTCATTTCCACCAACTAAC
T7_19141_G10	ACTTCATTATTCTATTAGTCACACTCCTACACCACA
T7_19142_G10	ACTATTATAAAATCTCCGTCTCCTCTCAATACACTC
T7_19143_G10	CATCTATTATTATACCTGTCAACCTCCTAATCACCA
T7_19144_G10	CATCCTATTAACAAAACGTCACTTCTCTTACTTCAC
T7_19145_G10	TAAAATAACATCCTCACGTCCCATCATCATCTTCTT
T7_19146_G10	AAACCATACTACTACTAGTCCTACTTTCCTCAATTC
T7_19147_G10	CTTATCCTACTACCATCGTCATAATAACTACATCCT
T7_19148_G10	CCAACCTTCTTATCACCGTCTCATCAAAACATTTAT
T7_19149_G10	ATCCCTAATTATATCATGTCTACTACCAACTCTCCA
T7_19150_G10	ACATTCTACATTACTACGTCTACAACTCCTTCTCAA
T7_19151_G10	ATACCACCCCATAATAAGTCTACCTTACTTCTTTAC
T7_19152_G10	ATTATTATTTTCACCACGTCTTCACCACATCCACAA
T7_19153_G10	AATTTACTACCTACTTAGTCTCCACTACTATCAACC
T7_19154_G10	TAAAACTTTTCATCCTCGTCCACTAAATTCTCCACA
T7_19155_G10	CTACTATTAATTAATATGTCCTACTCCTCCCAACCA
T7_19156_G10	ATAACTAAATAATCATCGTCTCCCACCATCCTTCTT
T7_19157_G10	CAATCAATCATTATAATGTCCCTCCTCCTCTCTAAA
T7_19158_G10	CCATACAATACCACTCTGTCTATTCTTATCATCACA
T7_19159_G10	CTTCTTTTTCAACTATTGTCAACCACCAAAACCTCA
T7_19160_G10	TTCTATTACTAAATTACGTCCTCCTCCAACAACACT
T7_19161_G10	CACACTATATTATTCTAGTCATCCTCAACTATCACC
T7_19162_G10	ATTACTTCTCCAACTATGTCTTCATCCAATACCACA
T7_19163_G10	CTCCTATCATAAAATACGTCACCTCCTCATTTCATA
T7_19164_G10	ACCTACATACTATTCATGTCATTTCACTACCCCTAA
T7_19165_G10	ACACCATCACACCATTTGTCATTTTACACTATTACC
T7_19166_G10	CAACCACATTATTCATAGTCTTTTTCCACCATACCA
T7_19167_G10	CACATCTAATATTCATTGTCATACTCCCTACCACAT
T7_19168_G10	AATCTTCAACTACACTTGTCTAACCATCTTACTCAC
T7_19169_G10	AATAAATAACAACCCTCGTCCTTCCTCTTCTACTTA
T7_19170_G10	TCCTACTACTACTCCTAGTCCTCCAATAATATAACT
T7_19171_G10	TCTCTTCACATTAAACCGTCCCATACAATATCTTCA
T7_19172_G10	CTTCTTCTCCTCCAATAGTCAATAAAATACCACCTT
T7_19173_G10	CCTCCACTACCACAAATGTCATCAATTCTTTATCTA
T7_19174_G10	ACTACTACCATATACCTGTCCCTTCTTCACTAAATA
T7_19175_G10	ACAACAATTCTTATACCGTCTAACCACCTTCTTATC
T7_19176_G10	CCACACAATAATTTCTTGTCTACACACTATTTCCAC
T7_19177_G10	TACTAACCTCTACCACAGTCCTTTTATCTTCAAAAC
T7_19178_G10	CTATTCTATTATCACTAGTCCAACCACCATCCTAAT
T7_19179_G10	CTCTACACCATATTATCGTCTTATTCCCAACACAAT
T7_19180_G10	ATAATTACTACCACACCGTCCCCTTATTCTCTATAA
T7_19181_G10	CCACATCAAACATCTATGTCTACTTCTTATTCACCA
T7_19182_G10	TCCAATCCTTCTATTATGTCAACCACCACTATAATC
T7_19183_G10	TCCTCCCCTACTAACAAGTCCTAATAATACTTTACT
T7_19184_G10	ATCCTCCTAACAACACTGTCACTACTAATATTTCCT
T7_19185_G10	TAAATAATACTCCCCTCGTCATATAACCCTCTATTC
T7_19186_G10	CCTTTAACTTAACACCTGTCCTTATACTAATACCAC
T7_19187_G10	TACATACTTCATTACTCGTCAACACCTTCTTCCAAA
T7_19188_G10	CACCCTCATTAATTATTGTCCACCTTACAATAATCC
T7_19189_G10	TTCATTCACACAACACAGTCAACTTACCTCTTCTTA
T7_19190_G10	CATCCTAATCCTCCTATGTCCAAATATCAACTTATC
T7_19191_G10	AAATACTACTCTTACTAGTCCCTTCCCTACTACAAT
T7_19192_G10	ACCACACCCTTCTTTATGTCTAATACTACAACATCT
T7_19193_G10	TTAATACATCAACTCCCGTCCTCTATATCCTTAAAC
T7_19194_G10	CCTATACACACACAATAGTCATCCTTATTTCATTCC
T7_19195_G10	AAACACCAATACTCAACGTCATCTTCTTCTCTTATC
T7_19196_G10	CCTCCATTCCCATAACAGTCAAATTCTAATTATTCC
T7_19197_G10	ACAAATACATCATCTCCGTCTCCTTCTTCTCATAAA
T7_19198_G10	ACTACCTTCATCATACAGTCACATACTACTACTCTT
T7_19199_G10	ATTATTATCCACCACTCGTCATATTACACTCCATCA
T7_19200_G10	AACCTCCTCAATTAATAGTCCCCTCCTACTATTAAT
T7_19201_G10	CATTCTTCCCTAACTAAGTCTATACCACTCCAAATT
T7_19202_G10	TTCTTTACCACTCCAATGTCAATCCTCCAATAAATC
T7_19203_G10	CTTCCATACTTACATCTGTCATTAATCACCACTAAC
T7_19204_G10	CCTAACCTCATTATCATGTCCAACCTATTACCATTA
T7_19205_G10	CAACCAATCTCTTCTATGTCTAACCCATTATACCAT
T7_19206_G10	TTTTTATCTTAACCAATGTCCACACCCCACTACTAA
T7_19207_G10	TACCCTACATACAAATTGTCCTTCTTACCATCAATC
T7_19208_G10	ATCATACTATAATATCAGTCACTTCCACCCTTCCTA
T7_19209_G10	AACACCTCCTATAATAAGTCACCTCTTCATCCTATT
T7_19210_G10	AACATAATACCTAATACGTCTTCTCACCACCTCTTT
T7_19211_G10	CATCATCATACTACCACGTCAATTTTACACCTTATC
T7_19212_G10	CCCATTCTAATACTTACGTCCTTATTCAAACCACAT
T7_19213_G10	CCCTATTCATCTTCATAGTCCACTTCCAATAAACAT
T7_19214_G10	CTAACTATAATCATCATGTCCTCACCAACTCTTCAT
T7_19215_G10	ACAATTTCCTTATCTCCGTCTACAAAACCACCTATT
T7_19216_G10	TTATACTCTTTCCACAAGTCACTACCACTCCTAATA
T7_19217_G10	TACCATTAATTCATCAAGTCCACCTCCATATACCTT
T7_19218_G10	TAATAACTCAACCATCAGTCCCTTATCCCTTTATCA
T7_19219_G10	ATATTTCCAATTTCCCTGTCCACTCAATTACAACCA
T7_19220_G10	TACCTCCATAAACTTATGTCAATTTTCAATCCCCAC
T7_19221_G10	TAACCTATTTCTACCCAGTCAACCTTCTTACAATCA
T7_19222_G10	ATACTCCCTCTACCATAGTCACCTCTAAATTATACT
T7_19223_G10	ACTAAACATTATTACTCGTCCACTACTATTCTCCCA
T7_19224_G10	CACCACCCTATTAATTTGTCTTCCTCATAATACCAA
T7_19225_G10	AATTTCAACTACTCTAAGTCTAACACTATCTTCCCC
T7_19226_G10	TTTTACTACTTCCCACTGTCACTTCAAACAACTAAC
T7_19227_G10	TACTTCTATACTCTACCGTCCACATTCCATACAATA
T7_19228_G10	ACAAATACTACAAATCTGTCACTCCCACTCTTTTCT
T7_19229_G10	AATATCCTCTCTCCAACGTCCATCATACATTACTTA
T7_19230_G10	CTAATCATCACTACACCGTCCTCATCTACTAATATT
T7_19231_G10	CAAACATTTATTCCCTAGTCATCCAACCATTTCCTA
T7_19232_G10	CCAATCATCTAATTCACGTCCTTATTACTACTACCA
T7_19233_G10	CCAACCAACTATAACTAGTCTATCTTACTTTCCACT
T7_19234_G10	TTAATCTTCATCTACTTGTCCCCTTCAACAACACAA
T7_19235_G10	TAATCTTCAATAACCATGTCCACCACTTATTATCCC
T7_19236_G10	ATATCCTCTCAACACAAGTCCAACTCTTACTTCATT
T7_19237_G10	TTTTATACCACATTTCTGTCTACCACACCAACAATC
T7_19238_G10	ATCAATACCACACTATTGTCCCAACCATTTTACTCT
T7_19239_G10	ACTTTTATCACCCACTTGTCCTACTAACAACAATTC
T7_19240_G10	TCCACTTCCAACAACTAGTCTCATCATTATCATACT
T7_19241_G10	CTTCTTTTACATCTACTGTCTCCCACAATCAACAAA
T7_19242_G10	ACAATTTTAAACTTCCAGTCTCAATACCTCCTACTC
T7_19243_G10	TCATACCATCACTACAAGTCATATCCCATCTTTACT
T7_19244_G10	ACATTTATTTAAACACCGTCACTACACATTCTCCTC
T7_19245_G10	CTAATACACTAATATCCGTCTCCATACCATTATCTC
T7_19246_G10	CTTCTACTAATATCAACGTCAATATTCATCCTCACC
T7_19247_G10	AACCTCATACTAATATCGTCAATCCACCTTTACCTT
T7_19248_G10	TCTTACAACAAACAACTGTCACTACTCCTCTTCATT
T7_19249_G10	CATATAATCTTCTATAAGTCTCATCACAATCCCTCC
T7_19250_G10	TATCATCATCTCTAAACGTCTTTAAACACTCTCACC
T7_19251_G10	ATCACTACTTACTACCAGTCCCAAAATTTCTTATCC
T7_19252_G10	TATTAATTTCCATCACCGTCTCCAACAATCACCTTA
T7_19253_G10	CCACCTACTATTCATCTGTCTATAAATTCCCATACA
T7_19254_G10	CTACTCCTAAACTACTCGTCCTCAAAATCATTCTTA
T7_19255_G10	CTATATTTTTTAACCACGTCACCTACCTAACAACCT
T7_19256_G10	TCAAATTCTTCCTCCCTGTCAACTATTATAACACAC
T7_19257_G10	TTACACCTTTTCTTTCAGTCATAACCACCAACAACT
T7_19258_G10	TTTCACTCTAATCTATAGTCCTCACAACCCTAATCA
T7_19259_G10	CAAACAATCCTTCCTTCGTCTTCTAAAATATCCTAC
T7_19260_G10	CTCCTCAATACATATCAGTCCCTCTTTCTCAAATAA
T7_19261_G10	CACTAACTATTATCATTGTCTTACTACTACCACCAC
T7_19262_G10	TTATAACCTAACAAATAGTCCATCCCCATCTTCTTC
T7_19263_G10	TTCATCATAAACTCATAGTCTATAATACCCCTCCCT
T7_19264_G10	ACCCATCTACCTTAATAGTCCTACTATACTATACTC
T7_19265_G10	ACTCACCAACTTTTCAAGTCCCATATCTCCAATATT
T7_19266_G10	CATTCCCCAAAATAATCGTCTACTCTCAAATTTTCC
T7_19267_G10	TCATCTTCACCACAAATGTCCAACATTCTCTATCTA
T7_19268_G10	CTTTTCCTAACATACATGTCCATCATACCTAAACCT
T7_19269_G10	CCTTAATAACCTATCTCGTCAACTACCACTACTTTA
T7_19270_G10	TACACCACCAATCCTCTGTCTCCTCTATTAATAATA
T7_19271_G10	TCAACTCTAATACCTAAGTCTCTAATCCTCACACTT
T7_19272_G10	TTCAACAACCCACTCAAGTCATATTCTACTTCCTTA
T7_19273_G10	ACCATCCTATTTATAATGTCTACCACACAATCCTTC
T7_19274_G10	ACTAATCTCATAATCCTGTCACCACTACTACTTCTA
T7_19275_G10	AAATCCCCTTCTACATCGTCTTCAACTATCATTAAC
T7_19276_G10	CACCTTCAAACATTCTCGTCCAAATATTTCTTCAAC
T7_19277_G10	ATAACTTCTTACCACACGTCATATCACAATCTCTTC
T7_19278_G10	TAACAACACCACCTACAGTCTACTATATTTTCTCTC
T7_19279_G10	CATTATCAATACTACCTGTCCCAATATACCCTTACT
T7_19280_G10	TACCCTACTACATAATCGTCATACCTTTTATACCAC
T7_19281_G10	AATATTCCACCTCTCCAGTCACACCTAATTATTCTA
T7_19282_G10	ATTCCCTACTCTCTTCTGTCTCTAATAACACAAACA
T7_19283_G10	CAACACTACCATTTTACGTCTATCCTATCTACATCA
T7_19284_G10	CACACTTCATCTCCTATGTCAACACTTATTCCTAAA
T7_19285_G10	CCACACCTTACTACTTAGTCCCAATCATTTTACTAA
T7_19286_G10	AATAATTTCCTCCTCCAGTCACACTAAATTCCTATC
T7_19287_G10	TTAAACCACCAACTTCAGTCTCAAACTTTTCCACTT
T7_19288_G10	CACCTATTCTTCCCAAAGTCTAACTTCATCATCTAA
T7_19289_G10	TTACTATCACTAATTCCGTCCTTATCATCACCAAAC
T7_19290_G10	CAACTACCCTTCATAACGTCAAAACTCTTCATTCTT
T7_19291_G10	TTAATAATCATTATAACGTCAACTCCCTCACCTTCC
T7_19292_G10	CTATTTATCCAACTATCGTCAACATCTTCCAACATC
T7_19293_G10	CAATATATCCATACAACGTCTCCTCAACTTTCTCAT
T7_19294_G10	AATTTACCTCCATCACCGTCACTCTACTAAATCATT
T7_19295_G10	CATCACACCATATCACCGTCATATTTATAACTCCTT
T7_19296_G10	CAACCACTATTACACTCGTCTATCACATTATTATCC
T7_19297_G10	ACCTACTTAATACCACAGTCATTCCTACTTCATCAT
T7_19298_G10	CAATCATCATCTCCATAGTCTTACCTATTACATCAC
T7_19299_G10	CTTACCTAATACTCCCAGTCTTATTACCTCATCAAA
T7_19300_G10	CAACTACCACCTTCCTAGTCTTTTATAATACAACTC
T7_19301_G10	AAATACTCTTCTAATACGTCCACTCTCCATTACTAC
T7_19302_G10	ATAATCCCACTTTTCTTGTCTCACACCCAATATCAA
T7_19303_G10	CTATATCTCAACTCCTAGTCCTTCAACTCAACATAT
T7_19304_G10	ACCTACCAATAATTTTCGTCTTCATCCTTCAAAACC
T7_19305_G10	TACCTATTATTATCAACGTCAATATCACCTCCTACC
T7_19306_G10	CACCTTCTCATACCTCCGTCAACTTATCATATTAAA
T7_19307_G10	ATTTTATTACAATAAATGTCAACACCCCTCCTCTCC
T7_19308_G10	CTAATAACCATACCTACGTCTATCCATTATTATCCC
T7_19309_G10	CTTCCAACATTTATCTAGTCCATCCCACCAATTATA
T7_19310_G10	CTCTCCCTACCAACTTTGTCCATACTATTACATAAA
T7_19311_G10	TACTTTACTTTATCATCGTCACACCACAAACCATTC
T7_19312_G10	ACTACCTAACACCATCAGTCTCAATTACATCTTCTT
T7_19313_G10	ACTTCTCCAAAACTACAGTCCTTTCTTCCCATAAAT
T7_19314_G10	ATTCAATAACACAACTTGTCATACCTCTTCTCCATC
T7_19315_G10	TCATCATTTCATCTCCTGTCCCACAACTAATAATAC
T7_19316_G10	CTTCCCTTTTTAACATAGTCTCACATCACCTAAAAC
T7_19317_G10	TATTATTAACTTCCTATGTCTACCACACCATCCACA
T7_19318_G10	ACTCATAATAACCTCCAGTCCTTTACTATCCTCTAA
T7_19319_G10	CTTTTCTACCATCTACCGTCCTCCATAATTAACAAA
T7_19320_G10	TTTATCACAACAACTATGTCCTTCTCCATTACCAAC
T7_19321_G10	ATCATTTTTTATACCACGTCACCTTCACAAACTACC
T7_19322_G10	AAACTACTCCCCACAATGTCATACCACTTCATTTTT
T7_19323_G10	ACCATCACAATATTACTGTCTCTCTAACAACTTCCT
T7_19324_G10	TCACAACCAACCCTTCAGTCACTTACTTTAATCTTA
T7_19325_G10	TCATAACTCCTAATCATGTCACCTTCATCTCACTAA
T7_19326_G10	TTATAAAACATCATCTTGTCCTTCCACCATCATACC
T7_19327_G10	TTCATACTCAACACCTTGTCCTTACAAAATATTCCC
T7_19328_G10	ACATTAATAACCTCTTCGTCTCCAACATTCATCATC
T7_19329_G10	TATACCTCCACCAACCAGTCCTCATACATATTTATT
T7_19330_G10	TCTCTTTACTTCATCAAGTCATCCTCACATAAACAC
T7_19331_G10	ACTCATCATCATCACCAGTCTCCTACTATAATATTC
T7_19332_G10	TCACCTATCTAATAATCGTCTTTCCTCTACCAAAAC
T7_19333_G10	TAATTCTCCAACTCACTGTCATATCCTCCAACTTAA
T7_19334_G10	AACCCCTACCAACCCCTGTCTATATTATTTTATCAA
T7_19335_G10	TTATCCAACTTACATCAGTCTCATCCACAATCTTCA
T7_19336_G10	ACAACTTTCATTTCCCCGTCACATTACTTAATAACC
T7_19337_G10	AAAACCATTAACTCCTCGTCCTCTTTCAACATCTTA
T7_19338_G10	TATTTCTACACCCCTCAGTCACTACATTACTACTAA
T7_19339_G10	ACACAACATCTTTTACCGTCATTATACTACATCCTC
T7_19340_G10	CATCCAACATAACTTATGTCTACTTATACCTACCTC
T7_19341_G10	CAACATTCTTCTATCCTGTCTCTTACATAACACACA
T7_19342_G10	TCTCCTTCAATTTAATAGTCACACACACCTTCATAC
T7_19343_G10	ACCCCACTACTTACTTTGTCAATCCAAAACCTTTAT
T7_19344_G10	CTAACCACCATCATCATGTCCATACCTTCATTTAAT
T7_19345_G10	CCTAATTACTTAATATTGTCATCCACCTACCACTCA
T7_19346_G10	ACCATTATTTTATATCCGTCCATCCCAACTACTAAC
T7_19347_G10	CATCAATTATACTCTTTGTCAACTACTACTACCCAC
T7_19348_G10	TTACCTAATATAAACTTGTCCACCCTACTATTCACC
T7_19349_G10	CACCTCTATCTTACATAGTCAAATTAACTTCACCTC
T7_19350_G10	ACCCTTCCAATAATAATGTCTAATTCTTAACCCTCC
T7_19351_G10	TACTAACATTCCTCACCGTCCTATCACCTTATTAAA
T7_19352_G10	ATAATACAACCTTCAATGTCCACCATCTCATCCTTT
T7_19353_G10	CCTTAACACTACTATTAGTCCCAACCTTCACTATTA
T7_19354_G10	ACACTCTACTACCTCCAGTCCAAACTTTCTAATATT
T7_19355_G10	CCACATACACAACTTATGTCACTCTTCTCTAATATC
T7_19356_G10	ATTTCAAATACCTTCCAGTCACTAACCTACTTCCTA
T7_19357_G10	TTTCACAACTACACCAAGTCATCTTTATTCTCAACC
T7_19358_G10	CATATCACCATCCTCCCGTCAACTAATTAATTTACT
T7_19359_G10	CTCCCTCTTTTACCTCAGTCAAACCAACTTATAAAT
T7_19360_G10	ACCATAATATCCCCTTTGTCTAATTCACTACACACT
T7_19361_G10	CTACTTATAAACTACTTGTCTAATACCTCTCCCAAC
T7_19362_G10	ACAAATAACTCTATCTTGTCATCATTACCCACCTCT
T7_19363_G10	TACATCACTCACACATCGTCACTCTTTATTAATCAC
T7_19364_G10	CCCTATACCATCCCCAAGTCTTCATATATAATATTC
T7_19365_G10	TCACCTCCTATAATATAGTCATTATCACCTCCTAAC
T7_19366_G10	TAATCATCAATCTAATCGTCTCACTCTAATCCACTC
T7_19367_G10	ATACCCTAACTTATTCTGTCTACTACAACCACTACT
T7_19368_G10	TCAATATACTACACCATGTCTACTTCATCAACCCTT
T7_19369_G10	ATTCCTACTAAAACCTTGTCTCTCTAACATCTCCAA
T7_19370_G10	TATAATACCCAAACCTTGTCAACTTCTTACTTCCCA
T7_19371_G10	CATTAACTCTACTTTATGTCTACCTCCCAACAACTA
T7_19372_G10	TACTACACCTCTACTAAGTCCATTATCATCATCCAT
T7_19373_G10	ACAACTTCTTCTTCACCGTCACCATAATATTACATC
T7_19374_G10	TACATATAAACCCTCCTGTCTTCTACAATTACCCTA
T7_19375_G10	CCTCCTTCCTCTTCCAAGTCTATATACTAAAACTAA
T7_19376_G10	TATCACTTCCAACCCTCGTCATATTACTTCCAAAAT
T7_19377_G10	ATTATCCAAAACAAATCGTCATCACTTCCCTCTTCT
T7_19378_G10	ATTCTTCCATAATAACAGTCTTATCCCATCACATCC
T7_19379_G10	CTACATTATCTACCTATGTCTCTCCAATCAAAACTC
T7_19380_G10	ATTCATCAATTCTATTAGTCTCACATTCCCACCCAA
T7_19381_G10	ATACTCCACCTTCTCACGTCCTCAAATTATTCTAAA
T7_19382_G10	AAAACTATTTCTACTCTGTCACCAAACTATTCCCCT
T7_19383_G10	CTATATTATAATAATCCGTCACACCTCTCTACCATC
T7_19384_G10	ATCATCTATATTATTCTGTCCTACAACCCACTACCA
T7_19385_G10	CATAATATAAACAACCCGTCTACCTCTTCTTCACTT
T7_19386_G10	ATACAATAATAATCATCGTCATCCTCTCATCCCTTC
T7_19387_G10	ATCTCTTCTCCAACAATGTCTCACCATCACATATTA
T7_19388_G10	TCTTAACACCCAACTATGTCCTTTTCCTTCAAAACA
T7_19389_G10	TTCCTTAACCATTAAACGTCACTATCCTCACTTACA
T7_19390_G10	CCTTACTTCTTCTATATGTCAACCAATCAACATACC
T7_19391_G10	CCCTACACCAAATTCTTGTCACCATAATTCTAATCT
T7_19392_G10	ACCTCCTTACTAATATAGTCCCACATCTACTATTAC
T7_19393_G10	TCCTCTAAAACCCTAATGTCATCATAACTTCCTCTA
T7_19394_G10	AATCACTAATAACATTAGTCTACTTTCCCTTCACCC
T7_19395_G10	AATATACTTATTCTAATGTCCCCTCCATCCAACCAT
T7_19396_G10	CAACATTACCTCCCCATGTCTAATAATTATTACCCT
T7_19397_G10	CCTATTCTTCCCAATAAGTCCATTTACCATCAAATC
T7_19398_G10	CCACTTCTAAATACATTGTCCCTATCTATCTCAACA
T7_19399_G10	CTCTTAAACACCTATCAGTCTACTATTACTCCACTA
T7_19400_G10	TTTAAAACACTCTCTCCGTCTCATCCACAATATCAT
T7_19401_G10	ATCAATTCTTTACCACTGTCCCCAACTAATACTATC
T7_19402_G10	CTTATTTTATCCCTTAAGTCCCACCCAACAATAATC
T7_19403_G10	TTCTACATACCTCATTAGTCCTCCACATAATCACTA
T7_19404_G10	CCTCTAAAATACCTCTTGTCATTACACTACCTATCA
T7_19405_G10	TCCAACAACATTTCAACGTCCAACTATTATTCTCCT
T7_19406_G10	CACCCCATAATTCCTAAGTCATCTTTATTACATCCA
T7_19407_G10	CTAACACTTCTAAAACAGTCTCCCTCCTTCATATTA
T7_19408_G10	ACATTCCATTAATCTACGTCTTCACCACCAATTACT
T7_19409_G10	TAACCCATACCACAAATGTCATCACTTATTCCTTCT
T7_19410_G10	AACTACTTAATACTTATGTCCATCCCACTCTTACAC
T7_19411_G10	TACTACTTTAACCCTCTGTCCCTAACATTATCCAAA
T7_19412_G10	AACAACCTACTTACCCCGTCACCTCTTTTTATTAAA
T7_19413_G10	TTTCAAAACTTATCCTAGTCCCCACCACTATCATTA
T7_19414_G10	CAACTATCCCTTATTACGTCTAAACACTCCACTTAT
T7_19415_G10	ACTTCCTTCATCTACTAGTCCTTAAAATCATCAACC
T7_19416_G10	TACTCCTCCCTAAATATGTCAATCCTAACTATTACC
T7_19417_G10	ATAACCACATTCAACATGTCTTAATTACTTCTCCCC
T7_19418_G10	TTAATCACCCATTATACGTCTCTCATCAACTACTAC
T7_19419_G10	TATCCTCTTCACATCCAGTCACTACTTCTAACAAAT
T7_19420_G10	TTCTCAATCATACCACAGTCTCTAATACTCCATCAT
T7_19421_G10	ATACTTATTATCACCACGTCTCCCTAATAATCTCCA
T7_19422_G10	TCTCAACCACCACAATCGTCAACTTTATTCTTCATA
T7_19423_G10	CATCACTTAAAACCCCAGTCATTACATTTCATTTCC
T7_19424_G10	TCAATTTCTTTACCATAGTCATCTTCCCCACAACAA
T7_19425_G10	CTTCCACCATCACTAAAGTCCAACATTCTATCTTAT
T7_19426_G10	CAACATCAAACTTCACCGTCCTTATCTTTTCAACTA
T7_19427_G10	CTAATAATACCTTACCCGTCTACCTCTTCAACAATT
T7_19428_G10	ACTCTTCTTCTCCCACCGTCAACAAATACTAATATT
T7_19429_G10	TATTAACCATCATCCATGTCCATCACTTTTCACCAA
T7_19430_G10	AAAATACTTCACTTACTGTCTTCTCATCCACAACTC
T7_19431_G10	ACTTTACTTCAATAACAGTCCCAACAACTTCTCTCT
T7_19432_G10	CTTCACATTCTTATATCGTCTTAAACACCAACATCC
T7_19433_G10	CAACTTTCCAACACTACGTCCCTAATTATTCAATTC
T7_19434_G10	ATCTCCTCCTCCAATACGTCTAATTACTATTACCAA
T7_19435_G10	AATCATATCCCTATTATGTCAATATCCTCATCCCCA
T7_19436_G10	CCACTTATCTACCACCAGTCCCATTTCTATTAATAA
T7_19437_G10	AACACATACATCACCATGTCATCCATTTATTTCCCT
T7_19438_G10	ATATCCAATTCTTCACCGTCACCATCATCTTCAATA
T7_19439_G10	TTTATTTTTAACCCCACGTCCCACCTATAAACATCA
T7_19440_G10	TCAACCCCTACCATTTAGTCTCACCATTATATAATC
T7_19441_G10	AATATATTATAATCCCAGTCTTCCCCTTCATCCAAC
T7_19442_G10	CTACCTATAACACATCTGTCTATCACTATCCTCAAT
T7_19443_G10	ACCACTACTACTTTTACGTCCATTACTACTCCTAAA
T7_19444_G10	TCCAACCAAATCTTATCGTCTCCCATATTCACTAAT
T7_19445_G10	ATCATTTAACACACAAAGTCCTTACCTCCACTCTTT
T7_19446_G10	TCCTACAATTATTTACCGTCCCCTAATTAATCCACA
T7_19447_G10	CTACTCACTTTCCAAACGTCTACTAATCATACTCTA
T7_19448_G10	AACACTTTTTTATTCCCGTCCAAATTATCCACCCAA
T7_19449_G10	ACCTACTCCACTTCCTAGTCCTCAATATTTAACAAT
T7_19450_G10	ACTTTTAACACAATAAAGTCCACTTCCTTTCCCATC
T7_19451_G10	CTCCAAACTACCCATTAGTCCTTCTTCTTAACAATA
T7_19452_G10	CACTATTCCAATTCATAGTCTTATCTACACCATCAC
T7_19453_G10	TATTCAAACACAAATATGTCCTTTCATACTCCCCTC
T7_19454_G10	ACATTCAACATCTTTCCGTCAACTCATTAACTACCT
T7_19455_G10	TTCCCCAATTTACTAACGTCAAAACTACTTCATCCT
T7_19456_G10	TTCCTACATTATCTTACGTCCACTTAATAAACACCC
T7_19457_G10	TATCAAACCCCTCAACAGTCCCCTTCATATTATTAT
T7_19458_G10	TATAACTCAACATCCCAGTCTCCCAATATTTCATCT
T7_19459_G10	AATAATTCTTACCTACAGTCCCTCTACTAATTCCCA
T7_19460_G10	TAACTCATAATTATCAAGTCTCTCTTCCCTCACACA
T7_19461_G10	CACATCATACTACATATGTCTTTCCTACTATCAACC
T7_19462_G10	ACTACTCTCCTTAATTTGTCCAAATCATCAAACCCT
T7_19463_G10	TTACTTCCCTAATACTAGTCCCTACCTACTACTAAA
T7_19464_G10	TAACCACCTCTATAATAGTCTAATTACTACCTCCCT
T7_19465_G10	AACTCATTTTTTTAATAGTCAAACCTCACCCCTCCA
T7_19466_G10	TATCATTATACTCAACTGTCAATCATACACCCCTTC
T7_19467_G10	CAATCATACCTTCATCTGTCCTCTACTAATACATCA
T7_19468_G10	CAACTTATCTAATATTCGTCTCCATCCCATCAACTA
T7_19469_G10	CTTTTTATCCACCACATGTCAATAACAACCTCTACT
T7_19470_G10	CTCCTCATCATATATTAGTCATCCCTCTACATCAAA
T7_19471_G10	CAATCACCACCTCTTTAGTCCTTCTACAAAACTATT
T7_19472_G10	ACAACAACTTCCACTACGTCTTCCATCTTCTTAAAT
T7_19473_G10	TTCCACAATTTCACCATGTCCCTCCATCTATAATAA
T7_19474_G10	TCTCACAAACCATTCACGTCATACCCATTATCTATT
T7_19475_G10	CCCTCAACTATAACAACGTCAACCTTTTTTCAATCT
T7_19476_G10	TCACCTACCATCATATAGTCACAACTATTATTCCTC
T7_19477_G10	ATCCAATTCATCTTTCCGTCTTCACCATCTAAAACA
T7_19478_G10	ATTACAACTTCCACCTAGTCCTAATTATCAATCTCC
T7_19479_G10	CATTTATATATATCACCGTCATCACCCTACTCAACT
T7_19480_G10	CTCACAATATTCCTCTTGTCCATCCCTCAATAAAAT
T7_19481_G10	TATTCTACTATACCACTGTCACTACAATAACTCCTC
T7_19482_G10	CCCAACTATAATAATAAGTCTTTTCCACCACTCTTC
T7_19483_G10	ATACAACCTCTTATCATGTCATTCCACCACTATCAT
T7_19484_G10	CCACCAATCAATTCTATGTCTACTCTCACATCTTAA
T7_19485_G10	TACTATCTTCTCCCTTAGTCTCACATAATAACCACA
T7_19486_G10	ATCACTATACCATCCCCGTCCATTACTTCTATAATA
T7_19487_G10	TCCAATCCCTCCACTACGTCTTACTTTATTAACAAA
T7_19488_G10	TCCATCATTCCTTCATCGTCATCAATCCATCAAAAT
T7_19489_G10	ACTTATTATTCAACTACGTCCACACCTCTTAATCCA
T7_19490_G10	CTCCAACTATTCAAAATGTCTACTACTTTATCCCCA
T7_19491_G10	CATCTACAACTATTTTAGTCCTCTACTCCACTAACA
T7_19492_G10	ATACTAAACACTACTCCGTCCACTCATTCTCATTAT
T7_19493_G10	TAAAACACCTACTCTTCGTCCTACTACTTCTAATCA
T7_19494_G10	CTCCTCACAACAACATCGTCTATCATAATCTTATCT
T7_19495_G10	TTATCATACAACTTTCTGTCTCTCCAAAACCCACAT
T7_19496_G10	AATATCCTATTTCCATCGTCTTATTCACCACAACCA
T7_19497_G10	CCACATACTCCTCTCATGTCATCTTCTACAAAATTA
T7_19498_G10	TCTCACCACCTATTTAAGTCCAAAACATCATCTCTT
T7_19499_G10	AATCTAATCAACTCCCTGTCTTACTCCTTCAACAAT
T7_19500_G10	TTCTTAACCACTTTCCTGTCCCCTAAACAAAATTCA
T7_19501_G10	TATCATATCATTTACATGTCTACATCACCATCCACC
T7_19502_G10	ACTATACTCTAATCATCGTCTCCACTTACTACTACA
T7_19503_G10	CCCATCATTAATACCATGTCCATCTATTCAATCATC
T7_19504_G10	CTTCTATATTTCCACTCGTCCTCAAATCACAACAAT
T7_19505_G10	TTAACATCATCTACTATGTCTCCAACCAACCATCTT
T7_19506_G10	AATTTCTTTTTCCTCCAGTCCAAAACCCTCAACAAT
T7_19507_G10	ACACTAATACTAACCATGTCCCTCATCACTCATTTT
T7_19508_G10	TTCAATTCACTTCAACTGTCAATCTCACCACCAATT
T7_19509_G10	CAACCACTTATTTTCCAGTCCACACTAAAATCTTCT
T7_19510_G10	TTCCATCCCCTACTAAAGTCACATTTTAAACTACTC
T7_19511_G10	ACAATCATCTCCCTATTGTCCTTATCACTAACCAAT
T7_19512_G10	AACTTATATCATATCACGTCTCTCACTCTTAACACC
T7_19513_G10	CCTCTAAATACCCCTACGTCTAATAATTTATCCACT
T7_19514_G10	ATTTACTACTCAAACACGTCCATTAATTATCCTCCC
T7_19515_G10	CTCACCATTAATCAATCGTCATTTAATACACCCTTC
T7_19516_G10	AAAACATTACTTCTCACGTCCACCTTCTACCTTAAT
T7_19517_G10	ATCTTCATCTACTTCATGTCCAATCAAACATCATCC
T7_19518_G10	CTTCTCTACTACTAACCGTCACCTAAAATCTAACTT
T7_19519_G10	ATATCCTACCACATCATGTCCATTACTACCACTATT
T7_19520_G10	CTCCAAACACATCCAATGTCTCTTCATTATACCATT
T7_19521_G10	AATTTCAATAATCCCTTGTCACAATCTCTACTACCC
T7_19522_G10	TAACACCTCACTACCTCGTCCCTTATAAATTATTAC
T7_19523_G10	CCTCTCAATTCTACTACGTCTACATCACTATCATAA
T7_19524_G10	TCTACATACTTCCCACCGTCATATTATCATATCACA
T7_19525_G10	TCTTTATCCATCCTTATGTCCCATCACTACAAAACA
T7_19526_G10	CTTAACATAACTCTTCTGTCCTACTTCACCATACAA
T7_19527_G10	CACTACCCTTACAATAAGTCTAACTCTCTATTCATC
T7_19528_G10	ACATTATCTCTTAATATGTCTATCTCCAACCCCAAC
T7_19529_G10	CTACTACCAATAACAACGTCACTTCTTTTTTACCAC
T7_19530_G10	CTCAACCCATAACAATCGTCTTTCTTAACACTATTC
T7_19531_G10	ACTTCCCCTTATCCAATGTCAACCATCTACATATTA
T7_19532_G10	CATCTCAACCTTCTACTGTCACTATAACAATCATCT
T7_19533_G10	CCCTCCAATACTAAATAGTCATCTTACTTACTCTCA
T7_19534_G10	ACTACTTATCATCCTCCGTCTTTAACCTAACAATCA
T7_19535_G10	CACACTACTACATCCATGTCTAACAACATCTTCTTT
T7_19536_G10	AACCCACTAATATTCACGTCTTATACCATTACTCCT
T7_19537_G10	TCCTACCTTCCTAACAAGTCCAACAATAATTTTCTC
T7_19538_G10	CTCCTATACTATTAAATGTCCCTCATATACTACCAC
T7_19539_G10	AATTACTCTCCCTCCACGTCTACACCATTATTATAA
T7_19540_G10	TATACACCTACCTCATCGTCATCTTAAACTAATCTC
T7_19541_G10	AATCATATAATCACCCTGTCCTTCAATATTCACCCT
T7_19542_G10	CACAACAATTATCCCCTGTCCATCATCATTTCTTAA
T7_19543_G10	TACTAATTACAACCATTGTCCATTTCTCCCCACTAA
T7_19544_G10	ATTACTTATACTTATAAGTCTATCCCCTCACCACAC
T7_19545_G10	ACTACATCACCACTACTGTCTTCTTATTTCACAACA
T7_19546_G10	ATACTACAACATCTTCTGTCCATCATCATTTCCACA
T7_19547_G10	CCCAACATTACCAATTTGTCCTAACATCATTCTACT
T7_19548_G10	AAACCATACTTATTTAAGTCCACACTCCCTCTTCTA
T7_19549_G10	CAATCCTCCTCTTCAATGTCCCATATTAATAAACTC
T7_19550_G10	CACACCTTACTATCATCGTCTACTCATTATTCAACA
T7_19551_G10	CTAATAAAATACTTCAAGTCTTTCTCCCAATCCCCT
T7_19552_G10	AATACATCTTCTTACTCGTCCTCTCCTAATCAAAAC
T7_19553_G10	ACCACCTACTCTTTCAAGTCCTAATAATCACCTATT
T7_19554_G10	ATACTATTACAATTCCTGTCCCTCTTACAACCACTA
T7_19555_G10	CAATACCATCTACACAAGTCTTTTTTTTACCACCCA
T7_19556_G10	TTACTTATATCAACATCGTCCAACTATAATCCTCCC
T7_19557_G10	ACCCTATTTCTTAAATTGTCTAACCACCCCTAATCA
T7_19558_G10	TCATCATCCTACCAATTGTCTAATATCATCCACTCA
T7_19559_G10	AATTTCCTATTTTCACAGTCCTATCCCCTAACACAA
T7_19560_G10	CAACATCCTTATCATCCGTCTAACAATAACCTTTCT
T7_19561_G10	TTACCTACAAAACTCTCGTCCTTATTCTCCATAACA
T7_19562_G10	TCAACTAACCCTATCCTGTCCATTTCTACAATCATA
T7_19563_G10	TTCCTCAACCACCTTCTGTCATTATCAAAACTACAT
T7_19564_G10	ACTACCCTTACCCATCAGTCTATAATCCTCAATATT
T7_19565_G10	ATAACTAACATCACTTTGTCTCATCAACCATCCTTC
T7_19566_G10	TATCCAACATACACAACGTCCACTTCTTCTTCATAT
T7_19567_G10	AAAACAATTTTTTTACCGTCCAATCCCCTTCCACTA
T7_19568_G10	TTCATCATCATCCTCCAGTCACTATCATTAATAACC
T7_19569_G10	TTACCACATCTACTTCAGTCCTAAACCATTTACCTA
T7_19570_G10	TTTATTCAACCATCCTCGTCCATCACCAACATATTA
T7_19571_G10	ACATATCTTTATAATATGTCATCCTCCACCACCATC
T7_19572_G10	CAACTTCTCACACCTATGTCACCACAAATTATTTTC
T7_19573_G10	CTACTCCAACTACTCTAGTCCTTATAATTAATACCC
T7_19574_G10	ATAATAATCATCCAACCGTCTCTTCATAACTTCCTC
T7_19575_G10	ATCTACACCCATCATAAGTCACTATCTACTACTCTT
T7_19576_G10	ACCACTATTATCCTTACGTCACTATCCTACTATACA
T7_19577_G10	TCCAACACAACTTATACGTCCACACTTTTATACTTC
T7_19578_G10	ATATCATATCTTAACTAGTCATCCACCCTCCTCTAA
T7_19579_G10	AACATTACTACCACAAAGTCTTATCTACTCTCCTTC
T7_19580_G10	ACAATCCAATCATCACAGTCACTTCTTATTTCCCAT
T7_19581_G10	TCTTTCTACATCCATTAGTCACACCATTACAATCAC
T7_19582_G10	TCATCTAATATAAAACAGTCTCATTCTTCACCCTCC
T7_19583_G10	CACCCCACTTCTTATTTGTCAATAATACAATCATCC
T7_19584_G10	AACAATCATCTCTTTAAGTCATCTCCACATCCCATT
T7_19585_G10	ATCCAATTATCACCCCAGTCATTTCTACTAATTACC
T7_19586_G10	ACTACTCCATTATACAAGTCTCCTTCACCTTCATAA
T7_19587_G10	CACTCTACTATCTTCTCGTCAACCACAAATAATCTT
T7_19588_G10	TAATAACAATCATCTCAGTCACTTCATCTCCACCTT
T7_19589_G10	CTTCTCATATTCAACCTGTCCAACATCATTATCACA
T7_19590_G10	CAAACACAATCCCATATGTCTATCTTCCCACTTTAT
T7_19591_G10	ACCATCATCATAAATAAGTCACCTATTCTCTTTCCC
T7_19592_G10	ATAATTCACCTTCTTAAGTCCAACATTCACTCCATC
T7_19593_G10	ACTCCACCTCTACTCTAGTCCTTATTCATAAATACA
T7_19594_G10	ATCCTCTCTAACACATCGTCATTATCAACACTATTC
T7_19595_G10	CAATTCTCACTAACCATGTCTTTACTTCCACTAAAC
T7_19596_G10	CTTTAATAACACTCCTAGTCATATTCCCCAACCATT
T7_19597_G10	TCTAACCAACTACTCTAGTCTTACCTCTATAATCCA
T7_19598_G10	CACCTCTCCTTACACACGTCTATACTATTAAATACT
T7_19599_G10	TCCTCACAAAATTTTCAGTCACAATCTTTAACCCCT
T7_19600_G10	TCTAAACAACACAAAACGTCTTTCTCTCCTCCTATT
T7_19601_G10	TCAATCTACTCTCTACAGTCCTACAATCTTCACAAT
T7_19602_G10	ATATCCACCCTATTCCAGTCTTACTTACCAATAACT
T7_19603_G10	TACCAATCTACTCCTCAGTCTTCCATACAATCAATT
T7_19604_G10	TCAAATCTTATAATCACGTCAATACTCCTCTCCTCA
T7_19605_G10	TCACTACTTTTTCAACAGTCCCAAACTCTCTACTAA
T7_19606_G10	AAATCACTCCATATCATGTCTACTTCTTACTCCACA
T7_19607_G10	TATCAATTATCTATAAAGTCCCTCCAACTCCCTATC
T7_19608_G10	TCCCCTCTTATTTTACCGTCAACTCACAAAATAATC
T7_19609_G10	ACCACTACATACAATACGTCACTATTCTTCCTATTC
T7_19610_G10	AATAACTTCACCTACTAGTCCTCTACATATTCCACT
T7_19611_G10	CTACATCATTTCTTTCTGTCTAACCAATACAACCAC
T7_19612_G10	TACTCCCTTATCCTATTGTCAAACCATCAACTACTA
T7_19613_G10	ATAAATATTTCTTCCACGTCTATCCAAATCACCCCT
T7_19614_G10	TAAACCAATCTACCTCTGTCATACCCTTTCAACTTA
T7_19615_G10	TACAAACATCTTCTATCGTCAACACCTCCTTATCTA
T7_19616_G10	TAATATATCCTATTATCGTCTCCTACCATCACCACA
T7_19617_G10	ATACCTAATCAACTTTAGTCCCACTTTATCACCATC
T7_19618_G10	ACAAACATTACTTCACTGTCCATCTTCCTCATAATC
T7_19619_G10	CTACCTACAATCTACTAGTCTTTTCCTCCAATAAAC
T7_19620_G10	CTCCCTAAACATTCACTGTCCCATAATTATACACTT
T7_19621_G10	ATTCCCTCCTTAATCAAGTCACAACTTAATACTCTC
T7_19622_G10	ATTATTTCCTCATAATAGTCCAACTACCACCCCTAT
T7_19623_G10	AATTAATCATCCTACCAGTCTAACCCTTCACTTATC
T7_19624_G10	ATTATTCTACTATCATAGTCACCAACCCCATTTCAC
T7_19625_G10	ACAAACATCAAATATCCGTCCCCTCTTTCTATATCT
T7_19626_G10	CCTTATCTCCTTATACCGTCACAATCTCATATCAAA
T7_19627_G10	ATCATACCCTATCTAATGTCCAACTTTACTACCCTA
T7_19628_G10	ATTCCAAATCTCCCTACGTCTTCTTTCCTAAAACAA
T7_19629_G10	ACCTATTATAACTCTACGTCTCCACACTTCAAATCT
T7_19630_G10	AATCTTCACTACTCCATGTCCTATCATCATCCATAA
T7_19631_G10	CCTCTACTCCTTACAACGTCACTAATTACTCAAATT
T7_19632_G10	ACTCCTTTCAACTACCAGTCTCATACACCTTATAAT
T7_19633_G10	ATAATTACTCCTTCCCAGTCAATTCACCTTACACAT
T7_19634_G10	TAAATTCCACCCATCATGTCCTATCATCATCATACT
T7_19635_G10	AACACCTCTAACCTATTGTCAAATTATCTCCCCATT
T7_19636_G10	ACCATTATTCACCACCTGTCTTAACTCTTAACACTA
T7_19637_G10	ACAACTTCACTATTCTCGTCATAAACTTACTTCCAC
T7_19638_G10	ATCTAAATTATTCCACTGTCACCTAACCTCCTTCAA
T7_19639_G10	CTACCAATATCCAACTTGTCCCACTTATTACTACAT
T7_19640_G10	ACATCATTAAATATTCAGTCCTCAACCTCACTTCTC
T7_19641_G10	AACAAATTACCTCTACCGTCTCCCTATTAATCATCT
T7_19642_G10	CAATCAATTACTCATCAGTCACTCCTCCCTTATATA
T7_19643_G10	TTCACCACCAACTTACCGTCATAATTTCATTTCAAC
T7_19644_G10	ATATAATACTTCCCTCTGTCTATCACACATTCCAAC
T7_19645_G10	CCTCTCCATATTAATACGTCCCACTTAACTTATACA
T7_19646_G10	TTTCTCCCCTCCCAAATGTCACATTATTACAAATAC
T7_19647_G10	AACAATTCAACTATCTAGTCTTCCTCCTCACTCATA
T7_19648_G10	ACCAATCCATCAACATTGTCCTCAATCTTTATACTC
T7_19649_G10	ATTATACAACTTCCACCGTCTCAAATTACCCTCTTA
T7_19650_G10	AACAATCCTCTTAATTAGTCACCCTTTCCTTACAAC
T7_19651_G10	TCAACCTCCTATAACCTGTCAAATATAACTCCCTTT
T7_19652_G10	CCTTTAAACCCAATTATGTCACACTTCCTCTCTAAA
T7_19653_G10	ACACACCCTTCATCATTGTCATCTTTACTTCACAAA
T7_19654_G10	TTTTCCATCCCTCCTACGTCAATTAAACCAAAATCT
T7_19655_G10	CCTCAAAACTTCCCATAGTCTTTCACTTTCACAATA
T7_19656_G10	ACAATCTTACTACTCTAGTCCCTCATCAATCCATTA
T7_19657_G10	ACTCTTCTCTATATCCCGTCTTACACAAACTCTAAA
T7_19658_G10	TTCAACCTTTTAATCACGTCCTCTCTACATAACACA
T7_19659_G10	AAATCCTCTCCTAAACTGTCAATACCCCTTAATTCT
T7_19660_G10	CTAACTTTCACACCCTCGTCTCTTAAATACTACTAA
T7_19661_G10	CTTTCCTAACAACACTAGTCCACTTACTCTTCTAAA
T7_19662_G10	TTACCACCTAACTATTAGTCTCTCACAACATCTTAC
T7_19663_G10	CTACTACCTCACATATTGTCTCACTCAACTAACTAT
T7_19664_G10	TCATCCTCATCCTTCAAGTCCAACCATTCAAATTAT
T7_19665_G10	CTTCCCTTAAACCTACTGTCTCATTAAAATACCACT
T7_19666_G10	CAACTTCAATAATAATTGTCACCATCTCCCATTCTC
T7_19667_G10	TACACTCTTCTCCCACCGTCTTACATAAACAATATT
T7_19668_G10	ACTAACCAACCCCTATAGTCTCCTATTACCTATTTA
T7_19669_G10	CCTCTCTAATAAAATCTGTCCATTCATCTCTCCAAA
T7_19670_G10	ACTCCTCCTTCAATTTTGTCTATCACACCAACATAA
T7_19671_G10	CTTCCTCCACCACCAACGTCTCAATTAAATTATTAT
T7_19672_G10	CAAATTCCTCATTCATCGTCAACCCAATACTACTTT
T7_19673_G10	TCCTTTCTCTTAACACAGTCCCATCACACTAAATTA
T7_19674_G10	CAACAATCTACTCAATTGTCTACCATCATCCTTATC
T7_19675_G10	ATCACCCCAATTCAATTGTCAAAACCTCCTTCTTAT
T7_19676_G10	ATAAACATTTAAATCTCGTCACCATCCACTCCCTTT
T7_19677_G10	TAACAAACCTCATTCTCGTCAACCTACTTTCTAATC
T7_19678_G10	TACCTACATCAACCACAGTCTATTCTCTTAACTCTA
T7_19679_G10	AAATCATATTACTCACCGTCTCTTCTATCATCAACC
T7_19680_G10	ACCAAATACATTTCTTCGTCCCTCACTACATTATAC
T7_19681_G10	AACCTACTCTTAATCACGTCTATCCCTCATTACTAA
T7_19682_G10	CACTTAACCCATTTTAAGTCACTTCTTTAACAACCC
T7_19683_G10	AAAACTTCCTTCATCATGTCCCATTTACCACCATTA
T7_19684_G10	TTTTTCCCCACAAAATCGTCTTACATACCACACTAT
T7_19685_G10	CACTTTAAATCCCTCTAGTCCTTATACAATACCATC
T7_19686_G10	ATTTTCACACCACATTCGTCCTTTAAACAACATTCC
T7_19687_G10	ACTAACTTCCTTTACCCGTCTCTCATAAAACTATCA
T7_19688_G10	CTTAACACCCCTTACCTGTCTATCAACATTCATAAT
T7_19689_G10	TACTATCCTCACCAAATGTCACTATTAATCCTACTC
T7_19690_G10	CTCCTTAATCCTCAATTGTCATTACACAACTCCTAA
T7_19691_G10	TTAATTCTTCACACCAAGTCCACTACTCACTATCTA
T7_19692_G10	ATATTTCCAATACTAAAGTCCTCTACTCCTCCAACT
T7_19693_G10	ACACATCATATTACTACGTCTACCATCTCTTTACCA
T7_19694_G10	CTCCATTTCATCAATCTGTCTTACCCAACACTAAAT
T7_19695_G10	TCTCTTACCATCATAAAGTCTATACACTCCCCTAAT
T7_19696_G10	CCAACTTACCATTATAAGTCATACCTACCATTCTTC
T7_19697_G10	AAATTATTCCACCACCTGTCCTTTCACAATATTACC
T7_19698_G10	TTACCAAATCCTCTCACGTCCTTATAATCACTACAT
T7_19699_G10	CCTTTAAATTTCCCTCAGTCAATAATCTCCCATAAC
T7_19700_G10	TCCTCCCATTATATCAAGTCCACTACATAATCTTAC
T7_19701_G10	TACATTCCAACTAACCAGTCTCTTTTTCACCACATA
T7_19702_G10	CATAATTCACCATTATAGTCCACTCATCATCACTCT
T7_19703_G10	ATACATTTTATTCCTTCGTCCCACAACCATATCACA
T7_19704_G10	TATATAATACCAACCCTGTCCTCTAATCCCCATTTA
T7_19705_G10	TATCAACCTCCTAACCCGTCCTATTCATCTAATATA
T7_19706_G10	CCTCAAATTCTACATTAGTCACATCTCCTTCATACA
T7_19707_G10	TCCATAACCATCAACATGTCCCTTAACATCTTTCAT
T7_19708_G10	CCCATTAATAACATTCTGTCTCACTATTCAATCACC
T7_19709_G10	TCATTTTTTTAAACCACGTCCCACCTCCATATACAA
T7_19710_G10	AATTTATTCTTACCACAGTCTCCACACTATCATCCA
T7_19711_G10	TACAAACCTACTTATCTGTCACCATCTTACTACCTA
T7_19712_G10	TTCTTACATCCACTAATGTCTCTCAACCAACCAATT
T7_19713_G10	TTCAATCACTACACACCGTCCAAATTTAATTTTCCC
T7_19714_G10	AAACATCCCCATAATCAGTCTCCTTTTAATCCTACT
T7_19715_G10	CAAAACAAATCCCTTAAGTCCCTTCCTTTTTCATCA
T7_19716_G10	AAACATCTTTATCCCACGTCTTTACCAAATCCTCAT
T7_19717_G10	ATCATCTCCAACACTAAGTCTAACTATTCCATCCTT
T7_19718_G10	CACTATATACCCCTTCAGTCTCTATTACCACTATAA
T7_19719_G10	AACCACATTCCCTATTAGTCCACCTATAAATTTCTC
T7_19720_G10	TCTCCAAACACATCCTCGTCAACATCTTTTCAAATT
T7_19721_G10	TATATAAAATCTTTACCGTCTCCACAACTCCTTCAC
T7_19722_G10	ACCACCAATCTACTTTTGTCACAACAAATCTTCCTT
T7_19723_G10	TCCTAACCACTATTCCAGTCATCTCTTATATCAACA
T7_19724_G10	CACTATTACATTCAACAGTCCCAATAACTCCTCTTT
T7_19725_G10	CTCCATCACCATTACTTGTCTAATAATATCCTACAC
T7_19726_G10	CTAACCTATTCCCATACGTCTCACTCCATAATAATT
T7_19727_G10	ATCTCTTTCTAACCCTAGTCATCAATAATCACCCAT
T7_19728_G10	TCTTTTTCAAAACAAATGTCCTCACCACACCATTTC
T7_19729_G10	TCTACACCAATTTATATGTCTAACCTTCATACACCC
T7_19730_G10	CAATTATCCCAACTTCTGTCACCTAATCCAATACTT
T7_19731_G10	ACTTTACAAAATTCTACGTCTATCTCTCCCTAACAC
T7_19732_G10	CCTCAACTCATCTTCTTGTCTTCATAACCCAAAATA
T7_19733_G10	TCCCTACTTTCTTACACGTCCCCTAATATCAATAAA
T7_19734_G10	CTCCAACCAACAATTCAGTCATATTTCTTCACTATC
T7_19735_G10	AATTCCCTCCAACTCTAGTCCTACTACATCTTAATA
T7_19736_G10	TTACAACACTATAATCCGTCCTATCAACTTACTTCC
T7_19737_G10	CTACTACCCTTTTCCACGTCTTAAACCAAAATATCT
T7_19738_G10	CTCATCAAACCTTAATAGTCTATACCTCACCTCTAT
T7_19739_G10	CTCCAACTCTATCAACTGTCAATACTTCAACTATCT
T7_19740_G10	ATCATACCAACCTATTAGTCATCTTATATACCCCTC
T7_19741_G10	TTCACTTACACCACTCAGTCAATCAACATCTCATTT
T7_19742_G10	CCATAATTCCCTCCCAAGTCCATTATTCATTACTAA
T7_19743_G10	TCATACTCCCTATACTAGTCTTCCATACAATCAACT
T7_19744_G10	TATTCCACCCCTCTCCTGTCAACAATTAATAATATC
T7_19745_G10	ATATAACAACCACCATCGTCTTTCCTCTACTCTAAT
T7_19746_G10	TACCACCAACACTATCAGTCTCACTCACTTATATTT
T7_19747_G10	TAATCATATCACCTTATGTCCTCTCATAAACCCTAC
T7_19748_G10	TATTTACTCACATCCCCGTCACAATTTTATAACCAC
T7_19749_G10	CATTATTTTCCACACTTGTCTATAACCACTAAACCC
T7_19750_G10	TTATCCTCTTACTACTCGTCTACAAATATACACACC
T7_19751_G10	TACTCTAATCTCCATCTGTCACTAACTAATCCATAC
T7_19752_G10	ACCTCATCATACCTAATGTCATTCCATACTTCATAC
T7_19753_G10	CTATATCAATAATTTCTGTCTACTCCATACAACCCC
T7_19754_G10	TACCACTACATCCTCATGTCTTCACTTAAACATCAT
T7_19755_G10	TATACCTACTTTATCATGTCATCCACAAACACTTCC
T7_19756_G10	CATCACCCAAATTTCTAGTCCTAATTTCTTCACCAA
T7_19757_G10	CTCTACCTAACCAATCTGTCTAATACCCCTTAATTA
T7_19758_G10	ACTCAAATTAACATCTCGTCTTCTATCCCCAAATCT
T7_19759_G10	CATAATCTTATCCCACAGTCCACACATCTCATTATT
T7_19760_G10	CACCACCAAATCACAAAGTCTTTTCTTTTTCCCTAA
T7_19761_G10	CATCCATCTTTTCAATTGTCCTTCCCAACAATCAAA
T7_19762_G10	ATTCTAATATAAATCTAGTCCCCATCAACTCCCTCT
T7_19763_G10	AAAACATCACACTCACTGTCTCTCCCCATTATATTT
T7_19764_G10	ATCATACAACTTCCCAAGTCTTTTCACCTTAACCAT
T7_19765_G10	AACTACCTCTCCTCCTAGTCATAATCTCAATATACT
T7_19766_G10	TTATCACCAACCTACCAGTCTTACATATTACCTATC
T7_19767_G10	CACTTATTATCTCACACGTCACTTTTACTCACAAAC
T7_19768_G10	AATTCCTCCTCCCCTTAGTCTTATACAATCAACAAT
T7_19769_G10	CCCTATATATCCCACATGTCTTCTCTCATAAAATCA
T7_19770_G10	AAATTATCTAATCCACCGTCTATCCCTTACACACTT
T7_19771_G10	CTATACTTTATATTCCCGTCCTCCCACAATACATAA
T7_19772_G10	ATAAAACTCATTACACTGTCCCTTATTCATCCTACC
T7_19773_G10	ACTCTAAACCAACATCCGTCTTTCTTATCATCACTA
T7_19774_G10	TTCATCCCCAAAATTTCGTCAACTCACCTCTAATAT
T7_19775_G10	ATCCTACTACATCCAAAGTCTCCATTCCTTATCAAT
T7_19776_G10	TAACATCCTATTCACTCGTCACAATTATTACCCCTA
T7_19777_G10	TCACACACAATCATACTGTCTCACTATCATCTTCTA
T7_19778_G10	CCCAATAATCTCTCCCCGTCATAATTACCTTTAATA
T7_19779_G10	ATAAACCACAACAAATTGTCCTCCTCCCATTTTTCT
T7_19780_G10	TTCATTCCCACATCAATGTCTCTACCTAAATAACTC
T7_19781_G10	CATCTACTAATTCCTCCGTCTCATCTTAACAATCAA
T7_19782_G10	CCTCATACACTCTTCCAGTCCTTATTAATCTAAACA
T7_19783_G10	CTCAACTAACTATCCACGTCACTAATCCTTATCATT
T7_19784_G10	ACATACTTACATTTCACGTCCCTCCTTATTACCAAA
T7_19785_G10	TCCTTCATATAACCCAAGTCCTATCCATTCTAATCA
T7_19786_G10	CTAACATCTCCTATAATGTCAAATTTCCCTCCCATA
T7_19787_G10	TATTTCTTTACCACCTAGTCCTTCACAAAACCAACT
T7_19788_G10	TACCTTTATCTACCATAGTCCTATCCACCTAAATAC
T7_19789_G10	ATCACCATCTCATATACGTCATACTTACATCCCTTA
T7_19790_G10	ATAAACCACCTAAATCAGTCTTCATCCTCTCCTATT
T7_19791_G10	TCTACTTTAAACCCCAAGTCCACCAACTTATTACTT
T7_19792_G10	TATTAAAACTCCTCCTCGTCATCCATTCAATCTCAA
T7_19793_G10	ACTATAACTACTCCCTCGTCCCTTAAATCTTTACAA
T7_19794_G10	TTCTTCCTAAACCCTTTGTCCTCCACACATAAATAA
T7_19795_G10	CTACTACACATCCTACCGTCTCTATTCATTCAAATA
T7_19796_G10	TCATTCATTAATATCTTGTCACATCCCTCCCAAACA
T7_19797_G10	AACTCCAACTTCATTTCGTCTTAATCCATTAAACCC
T7_19798_G10	AAACTTCCTAACCCTCCGTCTACTATATACTATCAT
T7_19799_G10	ACCTATATTTATATTCCGTCCAACCACATCCATACT
T7_19800_G10	ACACCCTACTCTTCTCAGTCAATAACCATATTTCTA
T7_19801_G10	AACCACTCATCTACTCCGTCCACAATCTTTTTAATA
T7_19802_G10	TTAACCATCCCAAACAAGTCTACACTCCTTCTTATT
T7_19803_G10	ATCTTTCCACCCCACAAGTCCAAATCTAATTCTTTA
T7_19804_G10	CTTTAAACATTTACTCAGTCTTCCTAATCCCCACAA
T7_19805_G10	ACTAACTATAATAACCAGTCTCATCTCCTCCCTTTA
T7_19806_G10	CACCTTCTAACAATATAGTCCATTATATCTCCCCAT
T7_19807_G10	CAATCTATCATAACCTAGTCCACCCATTCTTATCAT
T7_19808_G10	CATATTTATCTCAACAAGTCCCTACTATTCACCATC
T7_19809_G10	TCCTTATTACCAATCACGTCCTAACATAATTTCACC
T7_19810_G10	TTCTCCTTCACTTTTAAGTCCAACCACAATCTACAA
T7_19811_G10	TCAACTACTATTAATTTGTCTCATCCACATACACCC
T7_19812_G10	CTCTCTATAAATTCCATGTCACACCAACTACTCATT
T7_19813_G10	ACTACCAATACTACCTAGTCTCTTCTCACAAATCTT
T7_19814_G10	TCCCACTACACCATACAGTCAAATCATCTTTTCTAT
T7_19815_G10	ATTCCTACTCTTCACAAGTCCACACTTAATTCTACA
T7_19816_G10	TCAAAATATTCTCCCCAGTCTATATCTTCCACCATA
T7_19817_G10	ACCCTAATAATACACTAGTCCTAATTCCTCTTCCTA
T7_19818_G10	CCCTACAACCTATTAATGTCTCATCATCTTCTACAA
T7_19819_G10	CAACAACTATTACTTATGTCCATCATCACTATCTCC
T7_19820_G10	ACATATATCTACTTTACGTCAACTACCATCCTTACC
T7_19821_G10	TTTCCTATTAAAATCCAGTCCCACCATAACTCTTCA
T7_19822_G10	TTAAATTATCCAACCTTGTCCTAACCTTCTCAACCA
T7_19823_G10	ACCAAACTTCATCCATCGTCATATTTATCCCCATAT
T7_19824_G10	TTTCTTAACTATCCCTCGTCACCAATACAACAATCT
T7_19825_G10	ACTACCTACTTATCCTAGTCATTAACCTATCTACAC
T7_19826_G10	ATACACCTCTACAAACAGTCACATCTCATTCTTCTT
T7_19827_G10	CTTCTAACTTCTTTAAAGTCCCCACCTAAAATCTAC
T7_19828_G10	ATCAATAACCTCCATTAGTCCTCATTTTCCATCACA
T7_19829_G10	CCTTCAACAACCTCTTCGTCTCTATTAATAACAACT
T7_19830_G10	CATTTTCAAACCAATAAGTCTTTTCCCACCACTACT
T7_19831_G10	CTCTTATTACCCATATTGTCTAACCTACCCACTAAA
T7_19832_G10	TTAAATCCTCATTATTAGTCAACCCACTCATCTCAC
T7_19833_G10	CTAACAACACTCCTTATGTCTCACATCCTATCTTAA
T7_19834_G10	TTAAACCCCAATTATTCGTCCTACCCATCTCTTAAA
T7_19835_G10	ACAATCATACTTCACCCGTCTCCTAATCCTAAATTT
T7_19836_G10	ACCCCAATACTTAACACGTCCATAACTTTCTACTTT
T7_19837_G10	CCATCCCTATAATAAACGTCCATCACTTCCATTATT
T7_19838_G10	CTATACACTCCACATATGTCAAACCTTTCATCTACT
T7_19839_G10	TTCCACATCCCCTACCAGTCTTATTACTAAACTAAT
T7_19840_G10	TATTCATCATATTTCCCGTCTCAAACCACCCAAATT
T7_19841_G10	CTAAAACCTTAATTACTGTCTACTCCCCACTCTAAT
T7_19842_G10	AACACTCCCTAACCTCAGTCTCTTAATTAATCTCAT
T7_19843_G10	CTCTTCCCCTCACTTACGTCCTAAAATTAATTACAA
T7_19844_G10	ACCAATTTTCCTCTACAGTCAAACTCCTCTACAATT
T7_19845_G10	CAATTAACTTCAAACTCGTCTTCTAATTCCATCACC
T7_19846_G10	ACCATTCTTCAACATTCGTCATAATACATATCCTCC
T7_19847_G10	AACACATCCTAATATTAGTCTACCCTTCCCATTCTA
T7_19848_G10	ACATATCCCACCACTTAGTCTTACTACTAATATCTC
T7_19849_G10	TTTATCTCACAACCAACGTCTATTATAAACCTCCCT
T7_19850_G10	CCACACAAACTATTCCTGTCCTTACTATCTTTAACA
T7_19851_G10	ACTATCATTAATTACTCGTCCTAACCATTCCCATCA
T7_19852_G10	TTTCCATCAACAATTTCGTCATCTAAACATCCCTAC
T7_19853_G10	TCCTCTTATTTAAACACGTCACTTCCTATACCAAAC
T7_19854_G10	CCACCTCTTCTATCTCCGTCATCACAAATAAAATTT
T7_19855_G10	TTAATCAACTCTACATCGTCCATACTCTTCAACTCA
T7_19856_G10	TTTACCACTTCAATCAAGTCCTACTAATCTTCACCA
T7_19857_G10	CCTCATCCTCCAAAATTGTCATATTTACTACCTAAC
T7_19858_G10	TAACTTCACATCCATACGTCTTCTAATATCCCACTA
T7_19859_G10	CTACACTACTACCTTTCGTCTTAATCCTCAATACAA
T7_19860_G10	TTAAAACTCTCTCCTACGTCCCTACATAACATCATT
T7_19861_G10	CCTCCCTCTAATTAACAGTCAAATCTTTTCCCAAAT
T7_19862_G10	CTTAACACTCCACTATTGTCCAATAACACCCATTTT
T7_19863_G10	TCATCTAATCCTCTCATGTCTCAAAACTACATCCTA
T7_19864_G10	TCAACCATTATACCTACGTCCATTAATTACTCCCAT
T7_19865_G10	ATCAATCCTTCAAAACTGTCCCTCTTCCTCTAATAA
T7_19866_G10	CAATACTACCAACAAACGTCTCTTTTATTTCATCCC
T7_19867_G10	ACTCTACTACCCAAATTGTCCTTCAACATTAACCTT
T7_19868_G10	CCACTTATTACTACAATGTCCACACCCTATATTTCA
T7_19869_G10	TACCACATCCTCTCTAAGTCCCTTATAATACTACTA
T7_19870_G10	TTAATTCCCCACCCAATGTCTAATAATCATTCCATC
T7_19871_G10	AAAACCTCTACATACATGTCCCATTCATCTCTACTT
T7_19872_G10	CATCTCCTATAAATCATGTCTTTACTTCAACCACCA
T7_19873_G10	AATAATCTTTCACTTCTGTCACATACTCTAACCCCA
T7_19874_G10	ACTACCTACTTCACAATGTCCTTACTTTCCCAAATA
T7_19875_G10	CTAACATATCAAATCATGTCACTCATTACCCTCTTC
T7_19876_G10	ATTTAACACTTCTACTCGTCACAACTTTATCACACC
T7_19877_G10	ATCACCTAAATCTTCCAGTCACTCACCTATTTCTAA
T7_19878_G10	TTTTCCCAACAACTACTGTCTTCAATATCACACCAT
T7_19879_G10	ACCATCCCTTTACTATCGTCCACAATAACTCTATAT
T7_19880_G10	CTACTCACACCATTCTTGTCCATAATCTACATAACT
T7_19881_G10	ATTACCCTCTTCATAATGTCTCACACCTAAATCATC
T7_19882_G10	CCTATCAACAAACTCATGTCACTTCTACATATTCCT
T7_19883_G10	TCTCAAATAATAATTCCGTCCTTACAATTCCACTCC
T7_19884_G10	TTAACTACTCACCAATTGTCTCTCATTCACAACCTA
T7_19885_G10	TTCTATAATAAATAACCGTCCTTCCCATCACCTACT
T7_19886_G10	ACAATCAAACACCCAATGTCTACCTTCTTTACTCTT
T7_19887_G10	CCTAAATTTCTTCATCAGTCACCACTAATCTCAACT
T7_19888_G10	ACAATCAAACCAATTCCGTCTCTTTCTTACATACCT
T7_19889_G10	CATCAATCTCTTCTACAGTCTTACATACCACTATAC
T7_19890_G10	TCACACAATAATACTATGTCTACCCTCATCCTTTAC
T7_19891_G10	ACCTTTCACTTAAACATGTCTCACTCATTCCACTAA
T7_19892_G10	TATCTACTACCTCACAAGTCTACCATCAATTCTATC
T7_19893_G10	TCTACCTTACAAAATCTGTCATCATTCTACACCACT
T7_19894_G10	CCTATCTCACAATAACAGTCTTTCCTATACATACTC
T7_19895_G10	CACATCACATCTCTCAAGTCATATCTCCTTCTTAAA
T7_19896_G10	TAAATCAACCATTCACCGTCTCCCTTAATACCTTAT
T7_19897_G10	CCAACTTTACTATCACAGTCCATCTACACTATATCT
T7_19898_G10	ACTAACTACTACCCTACGTCAATTTCCTTCAATTAC
T7_19899_G10	TCCTATAAACCTACACAGTCCCACTATTTTCAATTC
T7_19900_G10	AATTACACCACTTACACGTCCTTTCTTCTAAACACT
T7_19901_G10	TAAACTACTCTTCACTAGTCCACTTCAACCATTCTA
T7_19902_G10	CTCCTACAATTAATATCGTCATCCTTCACAACTTCA
T7_19903_G10	TCAACTTCCCCATAACCGTCCAATACTCTTATAATT
T7_19904_G10	AATTTCAATAATCCAATGTCCCTTCCACCTTTCACA
T7_19905_G10	TTTTCTCCACCAAACACGTCTACCATCACTATTATA
T7_19906_G10	TCACACCATCTTAACAAGTCCATTCCACTATTTTCA
T7_19907_G10	TTCAACCTAATTACATTGTCATAACTAATCCCCTCC
T7_19908_G10	CTCCCTCATTAATATACGTCAACTACCACTTTATAC
T7_19909_G10	CTCCACCCATATTACATGTCCCATAATTATAATCCT
T7_19910_G10	ACATTTACAATCCTATTGTCACATCCCACATATTCC
T7_19911_G10	TAACACCTCATTTCCTCGTCTAAACTCTTTCAAAAC
T7_19912_G10	ACTTCATATCACACAATGTCCTTCCAATCATCTCTA
T7_19913_G10	CCTCTTAACAACAACATGTCCCTCTACTTCATAATT
T7_19914_G10	TCATCTACAATTCATCCGTCACTTTTCAATCCACAA
T7_19915_G10	ACACATATCAACTTCTAGTCATTCTTCATCACACCT
T7_19916_G10	AATTTCACATCCCCTAAGTCCACCTTAAACTACTTT
T7_19917_G10	TCTTATTCTTAATATTAGTCCCCACCCCAAATACCA
T7_19918_G10	AATACCATCCACAATATGTCACTTTACATTTTCCCC
T7_19919_G10	TACATTTTTCCAACAACGTCCTAATCTACCCACTAT
T7_19920_G10	TATTCTAATTACCAACAGTCCCACTCCCTCTATATA
T7_19921_G10	CAAACAATCCATATATCGTCTTCTCACTTCATTACC
T7_19922_G10	CTTACCACTACTCAATTGTCTTCATTATCCCAAAAC
T7_19923_G10	CCAAAACCTTTCCAATTGTCTCTTAATCCTATCAAC
T7_19924_G10	CTTTCAAATCACAACCTGTCACCATATATCTATCCT
T7_19925_G10	CCCATCTTATACTATATGTCCATCTACATCATCCAA
T7_19926_G10	CCCTAATTTCCACTACTGTCACTCTTAATCATAACA
T7_19927_G10	CATCCACTAACTCTAATGTCCACTATAACTCATCTT
T7_19928_G10	AAAATCTCCCAACTACTGTCTTCAACTCTTATCCTA
T7_19929_G10	TTACAAAACTAATCCTTGTCTACTCACAACTCCCTT
T7_19930_G10	ATTTATTACAATATACAGTCCCTTCACCACACCTTC
T7_19931_G10	CATATAATTCCCAACTTGTCACCTTCATACTAACTC
T7_19932_G10	CCCTCAATCAATAATATGTCCCTTCTACTATATACC
T7_19933_G10	ACTTACTCATACTACCAGTCCCACCTTTCATAATTA
T7_19934_G10	ACCACTTTTACTATTCTGTCTCCAAATCACCAACAT
T7_19935_G10	TCTCACATCTTCCCATAGTCAAAATATACCTTATCC
T7_19936_G10	CACTCATTAATACATCTGTCTTACCCACCTACAATT
T7_19937_G10	TAAATACTAAAACATCAGTCTCCATTCTCCTCTTCC
T7_19938_G10	TATTTACCCCAACCTAAGTCCTAATCTCAAATCTTC
T7_19939_G10	CCTTTAATCATCATTAAGTCTTAACACCCTAACTCC
T7_19940_G10	CATATCTCCCATCACTAGTCTATTTCAACTAAACTC
T7_19941_G10	TCTCTAATATAATCCCAGTCATCCCTTCAACTATCA
T7_19942_G10	TATCCTTAATCCCCATCGTCTTTCTAAAACACACTA
T7_19943_G10	CCACTTATTCAACCTCCGTCACTATAAACTATCATT
T7_19944_G10	TCTCTTAATACAATATAGTCATCTCTCCACATACCC
T7_19945_G10	TAATCCTAACAAACATCGTCTATCACTCCCTTTCAT
T7_19946_G10	ATTACCTCATCTATATTGTCTACCCACCTCTACAAA
T7_19947_G10	CCATCTACAACCTATACGTCTCTTTCTCTCAATAAA
T7_19948_G10	ATACTTCTTCTACACACGTCTTCAAATCATAATCCC
T7_19949_G10	TACCCATCCCACAAACTGTCCTTATTCTTTTAACAA
T7_19950_G10	ATAACTTACTACTAACAGTCCTATTCTACCCCTTAC
T7_19951_G10	ACTTCTACTACCAAACTGTCAAATCATACTCTTCTC
T7_19952_G10	TACTTACCATTATTACAGTCATACTCCCACACCTTA
T7_19953_G10	ACACCAACTACTCTAATGTCTCTCATATCCATATTC
T7_19954_G10	CATCTCTCTCTATACTAGTCCCACCTATTAAACAAT
T7_19955_G10	CTATACACTCCTTCCTCGTCAAACATACACTAATTT
T7_19956_G10	TCTACACTTCTAACAATGTCTCTCTAACTTCCAACA
T7_19957_G10	AATCTCAATATTACATTGTCCATCATCCTATCCCAC
T7_19958_G10	CTACCACCAATCTCATCGTCATTATTCCTATTAACA
T7_19959_G10	CATCCTTCTAACTCAACGTCTATTAACCCTCTAAAT
T7_19960_G10	ACAACATCTTCATAACCGTCTTCCACATCTTTATCA
T7_19961_G10	TAACACTCCTACTAACCGTCTCCTTCTTTAACATAA
T7_19962_G10	CTAACATCTTTCTTTTCGTCCACTCTAAACAAAACC
T7_19963_G10	CTACCACCACATTTCTCGTCTTTCATACAAAACTAT
T7_19964_G10	CTCAATTTCCCTCCAATGTCACTCCTAATATTACAA
T7_19965_G10	TACTACTATACTTTCCCGTCAATACAAATTTCCCAC
T7_19966_G10	AACTCAACTTTTCTAATGTCCACCACCCTCTTAATA
T7_19967_G10	TTAATTCCATCACTATAGTCTCTACTTCCCAACACA
T7_19968_G10	AACTATAACACTCTTCAGTCATAATACTCTCTTCCC
T7_19969_G10	TTATCACTATACTACCAGTCACTACCTACCTTCAAT
T7_19970_G10	TCTTCTACCACTTTCTCGTCATAAAACCACACTATA
T7_19971_G10	AAATTTCTCCATTTTACGTCTTCAACCCACACTAAC
T7_19972_G10	ACTCCATCAATCAATATGTCACTCACCACTTTTCTA
T7_19973_G10	TACTATTTACAACCTCTGTCCAACACACCTATTCAT
T7_19974_G10	AATATACTTCCTTTCTAGTCATTCTCAAACCACCCA
T7_19975_G10	CCTTCTATTAACACTCAGTCACCACAATTCATACTT
T7_19976_G10	ACCCAATCTTACTCATAGTCATACACCTTATTCTCA
T7_19977_G10	CTAATTCTACACCTATTGTCAAACCTTCTTCAACAC
T7_19978_G10	TCATAATATCCTTATACGTCCACATCATCTTCAACC
T7_19979_G10	ATATTTCAATACTTCCTGTCACACTAAACTTCCCCA
T7_19980_G10	TAAATACTAAACATCTTGTCCCATTCCCCTCATCAT
T7_19981_G10	AACCCATTTATTCCCAAGTCTTTCATCCCCATTAAA
T7_19982_G10	ACTCATCACCAATCCATGTCATAACTTCCATATTCT
T7_19983_G10	ATCCAACCTACTCTACCGTCATATTACTTTACTAAC
T7_19984_G10	TACTTACATTCCCTAATGTCAACCCATTTAACTCAC
T7_19985_G10	AATTCCACCACTAATTCGTCATATCACTTCCATCAT
T7_19986_G10	TATAACCTCCTCTTTATGTCACCAACCAACTACTTA
T7_19987_G10	TAAATTTAACCTTCCATGTCTCAACCTACCCACTAT
T7_19988_G10	TCCCATACATATACTAAGTCTTTCACTCTTAAACCC
T7_19989_G10	TACCCTATTAATCCATAGTCAAACTTCTTCACTCAC
T7_19990_G10	CTAATATACTCCCAATCGTCTCTAATACCTACCTTA
T7_19991_G10	TACATACCCCAACCTTTGTCCCTACTTTAAACATTA
T7_19992_G10	ATTATACATAACCTCATGTCTCACTACTTACTCCCA
T7_19993_G10	CATACTTCATATCATTTGTCCTATCCAAAACCATCC
T7_19994_G10	AAACAACTTCTCATTTTGTCACCCACAACCTCTTTA
T7_19995_G10	CCACCACATTAACAACAGTCTTTTCTTTCTCAACAT
T7_19996_G10	TCCCATCAACTTAATTTGTCCATATACCATCATCAC
T7_19997_G10	CCAATCCACAATTTATCGTCCTTTTCAAACCCATAT
T7_19998_G10	TCATCAAATTAATACCCGTCTAACTTCTATTCCCCA
T7_19999_G10	TAACCATTTTCATCAATGTCTCACCAATCCCTTAAC
T7_20000_G10	AAATTACTCCTTCTCTTGTCACCACTTAACCTAACA
T7_20001_G11	AGAAGGAGTAATAATGAGTCTGATATTTGTGGTGGT
T7_20002_G11	GTAGTAGTAGTAGTAGTGTCAGTAGTAGTAGTAATG
T7_20003_G11	TGTGGTGATGATGATGAGTCTGAAGATGATGATAAT
T7_20004_G11	TTTTGGAGGAGGAATAAGTCTAGTAGTAGTAGTAGT
T7_20005_G11	AGGAGATGAGGAGTAGTGTCAGTAGTATTATTATTG
T7_20006_G11	TGTGTTATTATTATTAGGTCGAGGAGGAAGAAGTAG
T7_20007_G11	TAGTAGTAGTAGTTATTGTCATTAGTGGAGAAGGAG
T7_20008_G11	ATGATGATGGTAGTAGGGTCTGGTGAATAATTAGTA
T7_20009_G11	TTGTTATTAGAAGTGATGTCAAGATGATGATGGAGG
T7_20010_G11	ATTATTAGTAGTAGTTGGTCTGGTATAAGGAGGAAG
T7_20011_G11	TAGTAGTAATATAATAGGTCTTGGTGGAGGAGTAGT
T7_20012_G11	ATGATGATGATGTTGGTGTCTGTTGTGAAGAAAGAA
T7_20013_G11	GAAGAAGAAGAGGATGTGTCTGTTGTTGTTGATAAT
T7_20014_G11	AGGAGGAGGTAGTAGTAGTCGTAGTAATATATTTGT
T7_20015_G11	TGGTGGTATGATGATGAGTCTGATGATGATGAATAA
T7_20016_G11	TGTTGTGGTGGTGGAGTGTCAGAAAATGATAATAAT
T7_20017_G11	GGAGAAGAAGAAGGAGGGTCTGTTGTTTTTTATAAT
T7_20018_G11	TGATAGTTGTTGTAGTAGTCGGAGAAGAAGATGATT
T7_20019_G11	AATAATAATAGTAGTAGGTCTAGTAGTTGGTGGTGG
T7_20020_G11	GTGTTGTAGTAGGAGAAGTCGAAGTAGTAGTTATTA
T7_20021_G11	TATGATGTTGATGAAGAGTCTGAGTAGTAGTAGTAG
T7_20022_G11	AGTGATGAAGAGGATGTGTCTGTGATGATATTATGA
T7_20023_G11	TGGATGATTATTAAGAAGTCGGAGGAGGATGTTTTA
T7_20024_G11	ATAATTATTATTAGTGGGTCTGGTGGAGGATGAGAA
T7_20025_G11	TGTTGATGAAGAAGTTGGTCTAGTAGTAGTAGTAGA
T7_20026_G11	TATTATTATGATGTTGAGTCGGAGGGAGAAGTAGTA
T7_20027_G11	ATAATTATGATGATGTGGTCGTGGTGATGATGAAGA
T7_20028_G11	TATTATTATTAAGTAGTGTCATTAGAGGAGGAGGGG
T7_20029_G11	ATTATAATAATAATGATGTCGAGGGAGGTGGTGTTG
T7_20030_G11	TGTTGATGATGATGATGGTCATAATGATGATGAGGA
T7_20031_G11	AGAAGGAGGAGTATTATGTCTATTGTTGTGGATGAA
T7_20032_G11	GAGGAGTAGTAGAAGAAGTCGTATGTTGATGTTATT
T7_20033_G11	TGGTGATGAGGTGATGAGTCTTATTAATGATAGAAG
T7_20034_G11	GATGAGGAGTAGTAGTAGTCGTAGTTATTATGAAGT
T7_20035_G11	ATAATAATAAGGAGTGGGTCTGGTAGTAGTAGTTGT
T7_20036_G11	ATGATTGAAGAAGAAGAGTCGTAGTTGGTGGTTATT
T7_20037_G11	TGATGATGATGATGAAGGTCAAGTATGATGATGGTT
T7_20038_G11	TGATGATAATAATAATGGTCATGATGATGGTGGTGG
T7_20039_G11	TGTTGTTATTATTGATAGTCAGAAGTAGAGGAGGAG
T7_20040_G11	AGTAGTAGTAGTAATAGGTCTGGTTGATGATGATGA
T7_20041_G11	TTGTTAATAATGATGAAGTCGATGATGAGGAGGTGT
T7_20042_G11	TTGAGTAGTAGTAGTATGTCGATGAATAGTAGGATG
T7_20043_G11	AAGAGGAAGGAGGTGTTGTCGTTGTTATTATGATAA
T7_20044_G11	ATGATGATAATAATTATGTCTTAGGAGGAGGTGGTG
T7_20045_G11	GTTGTAGTAGTAGTAGTGTCAGTAGTAGTAGTAGAA
T7_20046_G11	GTTGTGGTTGTTGAAGGGTCAGAATAATAATGATGA
T7_20047_G11	AGGGAGGGGTGTATTATGTCAATAGTAGTAGTTATA
T7_20048_G11	GATGGTGATAATAGTAGGTCTAATAGTTGGTGATGA
T7_20049_G11	GGAGTGGTGTTGTTGTAGTCGTAGTAATAATAAGAA
T7_20050_G11	TAATAATGATGATGATGGTCATGATGTGATGAGGTG
T7_20051_G11	GTTGTTTATGATGGTGGGTCAAGAAGTAGTAGTAAA
T7_20052_G11	GTTGTTGTTGATTATAAGTCGAAGAAGAGGTAGTAG
T7_20053_G11	TATGAAGAGGAGTTGTTGTCATTATTAGAAGTAGGG
T7_20054_G11	AATAGTGGTTGTTGTATGTCGATGAAGAAGATGATG
T7_20055_G11	AGATGATGTAGTAGTAAGTCTAAGGATGATGTTGTG
T7_20056_G11	GTTGATGATGATGGTGGGTCTAGTAGTAGTAATAAA
T7_20057_G11	TATTATTGTTATTGATGGTCATGAGGAGGAGGAGAA
T7_20058_G11	GTAGAAGTAGTAGTAGTGTCAGTAGTATTATGATGG
T7_20059_G11	ATTAGTATTTTGTGTTGGTCAAGAAGAGGAGGAGTA
T7_20060_G11	ATGTTGTAGTGGTGATGGTCATGATGATGAAGAATA
T7_20061_G11	AGGTGGTGTTGGTGTAAGTCTAATAATAGTAGTAGA
T7_20062_G11	AGTTGTTGATTTTGTAGGTCTATGAAGAAGAAGGAG
T7_20063_G11	GGATGATTATTATTAGTGTCAGTAGGAAGATGATGG
T7_20064_G11	TTGTAGTAGTAGTGGAGGTCTAGTAGATGATGATAA
T7_20065_G11	GTAGGAGGAGGGTGGTGGTCATAATAATAATATTTT
T7_20066_G11	AGAAGTAGTAGTGGTGGGTCTGGTATTATGAATAAT
T7_20067_G11	TATTGTTGTTGATGATGGTCTGGAGAAGAAGAAGAT
T7_20068_G11	GTAGTAGTAGTAGTAGGGTCAGTAGTAGTAGTATTA
T7_20069_G11	GAAGAAGAATAGTAGTAGTCGTAGTAGTGGTTGTTT
T7_20070_G11	ATTATTATTATTAGTAGGTCTAGTAGGAGGAGGAGG
T7_20071_G11	TGGTGGTGGATGATGATGTCGATGGTAATAATAAAT
T7_20072_G11	GGTGGGTGATGAATAATGTCAATAATAAGTTGTGGT
T7_20073_G11	AGGAGGATGATGTTGGTGTCGGTGTATAATAATAAT
T7_20074_G11	GATTATTATTTATGAAGGTCGAGGAGGATGATGATG
T7_20075_G11	GAGGATGTTGTAATAATGTCGATGATGATGATGATG
T7_20076_G11	TAATAATAGTGGTGGTGGTCATGATGATGATGATGA
T7_20077_G11	TGGTGATGATGATGATGGTCATGATGATGATAATGA
T7_20078_G11	GTAGTTGATGTTGTTATGTCTATGAGGAAGAAGAAG
T7_20079_G11	ATGATGATGATGATGATGTCGATGGTAGTAGTAGTA
T7_20080_G11	AAGAAGAAGAAGAAGTAGTCGTTGTTGTTGTTGTTG
T7_20081_G11	ATGATAGTAGTGATGATGTCGTAGTAGTAGTAGTAG
T7_20082_G11	AATGATGATGATGATGTGTCTGTGATGATGATGGAA
T7_20083_G11	TGGTGGTTATTAGTAGTGTCGGTAGTAATAAGAAGA
T7_20084_G11	AATAATAATTATTGTTGGTCTGGTGGTGGAGGAAGA
T7_20085_G11	GGTGATGATGATGATGAGTCTGATGATGATAATAGT
T7_20086_G11	TAGTTGTTGATGATGATGTCGATGAAGAAGAAGTGT
T7_20087_G11	TTGTTGTGATGAAGTGAGTCGGAGGTGATAATAATA
T7_20088_G11	AAGAAGTAGTGGTAGTAGTCTTAGTAGTAGTAGTTG
T7_20089_G11	GAGGAGTAGTAGGAGGAGTCGTAGTATTATTATTAT
T7_20090_G11	GGTGGTGTAGTAGTAATGTCAATGAGTAGTAGTAAT
T7_20091_G11	GTGGTGTTAATTATTATGTCGGAGGTAGAAGAAGTA
T7_20092_G11	GGAGGAGTATTATTATTGTCATTAGGAGTAGTAGGA
T7_20093_G11	TAGGAGGAGTTAGTAGTGTCAGTTGTGATGAAATTA
T7_20094_G11	GAGGAGGTGATGATGATGTCAGTTGTTGTAATAATA
T7_20095_G11	AAGGAGGAGAGGAGTAGGTCTTGTTGATTATTATTA
T7_20096_G11	ATGATGTTATTGGTTGTGTCTGTAGGAGAAGAAGAA
T7_20097_G11	GGAGGATGTTGTTGTAGGTCGATGATAATAATGATA
T7_20098_G11	TGGTAGTAGTAGTAGTAGTCGTAGTAGTAGTAATAG
T7_20099_G11	ATAATAATAGTAGTAGTGTCAGTAGTGGTTGTGGAG
T7_20100_G11	AGTTGTGGTGGTAGTAAGTCTTATGATGATGAAGAA
T7_20101_G11	AAGAAGAAGATGATGGAGTCGGATGATGTTTTTTGT
T7_20102_G11	AAGAAAGAAGTAGTAGTGTCAGTAGTGTTGTTGTTG
T7_20103_G11	TATTAGTAGTAGTAGAAGTCGAAGTTGGTAGTAGTG
T7_20104_G11	TAGTAGTGATGGTGATGGTCATGATAATAGTAGTAG
T7_20105_G11	AAGAAGAGGAGGGGAGAGTCTGATTATTTGTTATTT
T7_20106_G11	GTAGTAATAATATGTTGGTCTTGATGAAGGAGGTGA
T7_20107_G11	GAGGAGGATTATGATGAGTCTGATGATGATGATTAT
T7_20108_G11	GGAGTATTTTTTTTATGGTCATAAGAAGAGGAGGAG
T7_20109_G11	GTAATAAATAGTAGTATGTCAAGTAGTGGTGGTGGT
T7_20110_G11	GTGGGAGAGGAAGATGAGTCTTATTATTATTATGAG
T7_20111_G11	TGATTATGATGATGATGGTCATGATGATGATGAGGA
T7_20112_G11	TGATGAGTAGTGGTAGTGTCAGTAGTAGTAATAATG
T7_20113_G11	AGGAGGAGTGTTGTGGTGTCTGTAATAATAGTAAAT
T7_20114_G11	TAGTAGTAGTAGTAGTAGTCGTAGTAGTAATGATGG
T7_20115_G11	AAGATGATGATGATGTTGTCGATGATGATGATGATG
T7_20116_G11	GGTGGTGTTATGGTGGAGTCGGATAATAATAATAAT
T7_20117_G11	TAGTAGAAGAAGAAGATGTCGTTGTTGATGATGTTG
T7_20118_G11	TGTTGGTGGAGGAGGAGGTCAAGAATATTATTATTA
T7_20119_G11	TGATGATGATGATTGTAGTCGTAGTAGAAGTAGTAG
T7_20120_G11	TGTTGATGGTGATGATGGTCATGATGATGAGAATAA
T7_20121_G11	AAGTAGTAGTAGTAGTAGTCGTAGTAGTAGTAGTTG
T7_20122_G11	TGAAGAAGTATTGTTGTGTCTGTTGGATGAAGAAGA
T7_20123_G11	GTTGTAATAAGTAGTAGGTCGATGGTAGTAGTAGTA
T7_20124_G11	TTTTATTATTGGAGGAGGTCGAAGATGATGAAGTAG
T7_20125_G11	GATGATGATGTTGTAATGTCAATAGTAGGAGTAGGT
T7_20126_G11	GTGGTGAGGGTGGTGATGTCGATTATAATAATAATA
T7_20127_G11	GATGATGTTGGTGGTTGGTCATGATGATAATAAAAG
T7_20128_G11	AGGAGGGGAATTATTAGGTCTTGTTGATAATAATGG
T7_20129_G11	TGGTGGTAGTAGTAGGAGTCGGAGTAATAATTATTA
T7_20130_G11	TTGTAGTAATAAGAAGAGTCAGGAGTATTGTTGGTG
T7_20131_G11	GATGGTGGTTATTAGAAGTCGAAGTTATGATGAAGT
T7_20132_G11	AGTGGTGGTGGTGGTAGGTCTAGTAATAATAATAAT
T7_20133_G11	GTTGATGATGATGATGAGTCTGATGATGATGAATGA
T7_20134_G11	AGGATGATGATGATAATGTCATTGTTGATGATGAGG
T7_20135_G11	GAATAGAGGAGGAGTATGTCTGTTGTAGTAGTATTA
T7_20136_G11	AAGTTGTTGTTGATGATGTCGAAGAAGAGTAGTAGT
T7_20137_G11	GAGGAGGAGGAGTAGAAGTCTAATGTTGTTTATTAT
T7_20138_G11	ATAGTAGGAGGAAGTATGTCTATGATGATTATGTGG
T7_20139_G11	GTTGTTGTGGTTGTAGAGTCAGTAATAGTAGAAGAA
T7_20140_G11	GTAGTAATTAATAATAGGTCTAGTAGTGGTGGTGGA
T7_20141_G11	TATAAGATGAAGATGATGTCGGTGATGATGATGGTT
T7_20142_G11	TGATGATGATGATGATGGTCATGGTGGTAGTAATAA
T7_20143_G11	GATGATGATTATGATGGGTCTGATGATGATGATGAA
T7_20144_G11	ATTAGTTGTAGTAGGAGGTCTAGTAGTAGTAGTAGA
T7_20145_G11	ATTAGTAGTAGTAATGGGTCTGATGAGTAGTAGTAG
T7_20146_G11	TATTAATAGTAGTAGTAGTCGTAGTAATGGTGGGAG
T7_20147_G11	GAGTAATGTGTAGTAGTGTCAGTAGTAGTAGTAGTA
T7_20148_G11	TGAGGAGGTGGAGGAGGGTCATTATTTTATTAATAA
T7_20149_G11	GTTGTTGTTAGATGAATGTCAAGGAGGAGTAGTAAT
T7_20150_G11	GAGATGATGATGATGATGTCTATGATGATGATGATG
T7_20151_G11	ATTAATAATTATTTTAGGTCAAGAGGGGAGGTGGTG
T7_20152_G11	AGGAGATGATGATAATAGTCATAGTTGGTGGTAGTT
T7_20153_G11	TGATGAAGAGGATGATGGTCATGTTGTTGATAATAG
T7_20154_G11	GATGATGATGATGATGAGTCTAATAGTGGTGGTAAT
T7_20155_G11	AGGAGGAGGATGATGATGTCGAAGATTATTATTGTT
T7_20156_G11	ATTAATAATAATAAAGGGTCAGTGGTGGTTGGTGGT
T7_20157_G11	TGTTGTTGGTGATGATGGTCATGATAATGAAGAAGA
T7_20158_G11	AATGATGATGAGTAGTGGTCGTTGATTATTAAGGAG
T7_20159_G11	TATTATTATTAGGAGGAGTCGTAGGAGTAGTGATGA
T7_20160_G11	TAATAATAATTGTGGTGGTCGTAGTAGGAGGATGAT
T7_20161_G11	AATGATGGTGGTGGTGGGTCTGGTAATAATAATAAT
T7_20162_G11	AGAAGATGATGATGGGGGTCAGGAGTTTATTATTAT
T7_20163_G11	TAGTTGTTGGAGGATGGGTCTGGAAGAATAATATTA
T7_20164_G11	ATGATGAGGAGTAGTTTGTCTTTGATGATAAGAGGA
T7_20165_G11	TGGTGATGGTAATAATGGTCATGATGATGATGATGA
T7_20166_G11	GGAGGAAGAAGAGTAGTGTCATTTTTTGTAGTAGTA
T7_20167_G11	AGAAGATGGATGATGTGGTCTTTTAGTAGTAGAAGT
T7_20168_G11	ATGAGGTGGTGGATGATGTCGATGATAATAGTATTA
T7_20169_G11	AGATGATGATGAAGAAGGTCTAGTAGTTGTTGTAGT
T7_20170_G11	ATAATAATGGAGGATGTGTCTGTTGTGATGATGAAG
T7_20171_G11	GAAGAAGAAGATGATGAGTCTGATGATTGTTGTTGT
T7_20172_G11	GTAGTAGATGATGATGAGTCTGATGATGATGATGAT
T7_20173_G11	AGTGTGTTGATGATGAGGTCGAGTAGTAGTAATAAT
T7_20174_G11	AGTAGTGGTGTTGTGAGGTCGAGTAATAGTAATAAT
T7_20175_G11	GATGATGATGTGGTGGTGTCAGTAGTATAATGATAA
T7_20176_G11	GAGGAGGAGGAGGAGATGTCTATTATTATTATTAGT
T7_20177_G11	TATTGTGGTTGAAGGAGGTCGAGTAATAATAGTAGT
T7_20178_G11	ATTATTGTAGGAGGGTGGTCGTGGTGAATAATAATA
T7_20179_G11	GTGGTATTATTATGATGGTCAAGAAGAAGTGGTAGT
T7_20180_G11	GATGATGATGAAGATGAGTCTGATGATGATGTTAGT
T7_20181_G11	TTATTATTATGAGTAGGGTCAAGAAGAAGTGGTGGT
T7_20182_G11	AATAGTAGTAGTAGTAGGTCTAGTGATGAGATGTTG
T7_20183_G11	ATATTATGATAATTAGTGTCAGTGGAGGAGTAGTGG
T7_20184_G11	AGATGTAGTAGTAGTATGTCTATTATGATGAGGAGG
T7_20185_G11	ATAATTAGTAGTAGGGGGTCGGTAGTTTAGTAGTAA
T7_20186_G11	TATAATAGTAGGATGATGTCGATGATGATGGTGATG
T7_20187_G11	ATAATAATAAGTAGTAGGTCTAGTGGTGGAGTTGTG
T7_20188_G11	TTGATGGTGGAGGAGAAGTCGAAGGATTATTATTAT
T7_20189_G11	TTGTGGTGGTGGTAGAAGTCAAGAAGATTATTAATG
T7_20190_G11	AAGGAGGATAGTAGTTGGTCTGAAGAAGTTGTTTAT
T7_20191_G11	GTGGAGGAGGAGGAAGAGTCTGATTATTATTATTAT
T7_20192_G11	GAAGAAGATGATGTTGTGTCAGGAGTAGTATTATTG
T7_20193_G11	ATTAGTAGTAGTAGTAGGTCATGATGATGGTGATGA
T7_20194_G11	TTAGTTGTAGTAGTAGTGTCAGTAGTAGTGGAGAAA
T7_20195_G11	GTAGTAGTAGTATGATGGTCATGATGATGATGATGA
T7_20196_G11	GATGTTGTTGTTGTTGTGTCAGAAGAAGAAGAAGAT
T7_20197_G11	TAGTAAAGAAGAAGGTGGTCGTGGTGATGTTATTAT
T7_20198_G11	TAGTAGTTGATGATGATGTCTATTATGAGGAGGAGA
T7_20199_G11	TAGTAGGTTGATGATGAGTCTGATAATAGTAGGAGT
T7_20200_G11	AGTGTAGAAGAAGATGAGTCTGATGATGTTGGTTAT
T7_20201_G11	GTTGTGATGATGATGATGTCGATTATGATGAAGAAG
T7_20202_G11	TATAATAATAGTAGTAGGTCGAGGAGTGGTGGTTAT
T7_20203_G11	TTGTGGTGGATGATGATGTCGAAGAATAGTAGTAAT
T7_20204_G11	AGGAGGAGGAGGAAATTGTCATTATTATTGTTGATG
T7_20205_G11	AATAATAATATGATGATGTCGTTGGTGGTGGGATGA
T7_20206_G11	GGTGGAGTATATTATTAGTCGTAGTAGTAGTAGAAG
T7_20207_G11	GAGAAGAAGATGTTGTTGTCGTTGTGGTAATAATGA
T7_20208_G11	GTTATTAGTGGAGGAGGGTCAGGTGATAATAATATT
T7_20209_G11	AGAAGAATAGTTGTTGTGTCTGTAGTAGTAGTAGGA
T7_20210_G11	ATTGGTAGGAAGATGATGTCGTAGTAGTAGTAGTAT
T7_20211_G11	GTGGTGGTATTATTATTGTCATAGGATGAAGAAGAG
T7_20212_G11	AGGTGTGATGAGGAAGAGTCTGATGATGATTATTAT
T7_20213_G11	TAAGAAGTAGTAGTAGTGTCAGTAGTAGTAGTTGGT
T7_20214_G11	TAGTAGTAGTTGTTGATGTCGATGATGATGAAGAAG
T7_20215_G11	TATATTATTATGATGAAGTCGAAGAAGTGGTGGTGG
T7_20216_G11	TAATAAGAGTAATTATGGTCGTGGTGGTGGTAGTAA
T7_20217_G11	GGTTGTAGGAGAAGTAGGTCTATTATAATGATGATG
T7_20218_G11	TTATTAAGAAGATGGTGGTCGTGATGATGATGATGA
T7_20219_G11	AGGAGTAGTGGTGGTGGGTCTGATAATAATATTATA
T7_20220_G11	GAGGAGGAGGAGTAGTAGTCGAATTATTATTATTTG
T7_20221_G11	AATAATGATGATGATGAGTCTGGTTGATGGTGGTAA
T7_20222_G11	AGTAATAGTAGTAGTGGGTCTAGTAGTAGTAGTAGT
T7_20223_G11	AATAGTAGTAGTAGTGGGTCTAGGAAGTAGTATTGT
T7_20224_G11	TATTATTATGATAGTAGGTCTAGTAGTGGAGGAGGA
T7_20225_G11	GTGGTAGGAGTAGTTGTGTCGGTAGTAATAATAATA
T7_20226_G11	ATAATAAGGAGGAGTAGGTCTAGTAGTTGTTGTTGA
T7_20227_G11	ATGATGGTAGTAGTAGTGTCAGTAGTAGTAGTAGTA
T7_20228_G11	GTGGGGAGAAGTTGTTAGTCTTGTAGTAATAATAAG
T7_20229_G11	TTAATGATGATGATGGAGTCGGATGATAGTAGTAGT
T7_20230_G11	ATGATGATGATGATGATGTCGATGATGAGTAGTAGT
T7_20231_G11	AGTAGGAGAAGTAGTAGGTCTTGTTTTTATGAAGGA
T7_20232_G11	AAGAAGGAGGAGAAGGAGTCGTTGTTTTGTTATTAT
T7_20233_G11	AAGTAGGAAGGATGAGGGTCTTTTATTAGTAGTAGT
T7_20234_G11	AGATGATGATGATGATGGTCATGATGATGTAGTAGT
T7_20235_G11	TTATTATGATGAAGAAGGTCAAGAAGTTGTGGTGGT
T7_20236_G11	GGAGTAGTGTTAGTAGTGTCAGTAGTAGTATTAGAA
T7_20237_G11	GTGTTGATGATGATGAAGTCTAATTATGAGGAGGAT
T7_20238_G11	GTAGTAGGTGGTGGTAAGTCTAATAATAGTAGTAGT
T7_20239_G11	TGATGATGATGAGATGAGTCTGATGATGATGATGAT
T7_20240_G11	ATGATGAGATAAGAAGAGTCGGAGGAGTTGTTTTTT
T7_20241_G11	GGAGGAGTAGAAGAAGAGTCATATTAGTTTTGTTGT
T7_20242_G11	TAATAATAAGATGATGAGTCTGATGTGTTGAGTGGG
T7_20243_G11	AGGAGGTTGGTGGTAGTGTCAGTAGTATAATAATAT
T7_20244_G11	GTAGGAGGAGATGATGAGTCTGATGATTATTATGAT
T7_20245_G11	ATGATGTAGTAGTGGATGTCGGTAGTAGTAGTAATA
T7_20246_G11	ATAGTGGAGAGGAGTATGTCTAGTAGTATTAGTAGT
T7_20247_G11	GGTTGAAGATGTTGTTGGTCAAGAAGTAGTAGTATA
T7_20248_G11	TGATGAAGAAGAAGATGGTCTTATTATGATGGTGGT
T7_20249_G11	TGATTATAATAATAAGGGTCTTGTTGTAGGAGGAGG
T7_20250_G11	AATGAAGATGATGATGAGTCGAAGTATTTGTTGTGG
T7_20251_G11	AGTAGTAGTGGTGGTGAGTCTAATAATAGTAGTAGT
T7_20252_G11	TGATGATGATGATTAGTGTCAGAGTAGTAGTAGTAG
T7_20253_G11	TAGTGTTGTTGTAGTGAGTCAGTAGTAGTAAGAAGA
T7_20254_G11	AAGATGGTGGTTGTTATGTCAATAATAGGATGATGG
T7_20255_G11	GAGGAGGATGATTATTGGTCTTAATGATGATGATGA
T7_20256_G11	GATGAGAATAATAATATGTCTAGTAGTGGTGGTGGT
T7_20257_G11	AGAAAAGGATGATGATGGTCTTGTTAGTATGATGGT
T7_20258_G11	GTAGTAGTAGTGGTGGTGTCGATTAATAATAAGATG
T7_20259_G11	AAGAAAGAAGATGATGTGTCGTTGTTGTTGTAGTAG
T7_20260_G11	TGATGATGATGGTGGTAGTCATAATAATGATGATGG
T7_20261_G11	TAGTAGAAGAAGAAGTGGTCGTAGTAGTGGTATTTT
T7_20262_G11	GGTGGTGATTATAATAAGTCTAAGGTGGTAGTAGTA
T7_20263_G11	GTAGTATTATGAAGTATGTCTATTATGAGGAGGAGG
T7_20264_G11	GATGATGGAAGAAATAAGTCGTAGTAGTTGTTGTTG
T7_20265_G11	GAAGAAGATGATGATGAGTCTGTTGTAGAAGTTGTT
T7_20266_G11	GGAGAGGAGGATGATTAGTCTTTTGTTGATGAATAA
T7_20267_G11	TAGTGGTTGTATTAATAGTCGTAGTAGTAGGAGGAA
T7_20268_G11	TAATATTATTATTGGTGGTCGTGGTGGAAGAAGAAG
T7_20269_G11	GATAATATTATAATAATGTCGTTGTTGGGGAGGAGG
T7_20270_G11	GATGATGATGATTTTTGGTCATGATGATGAAGAGGA
T7_20271_G11	TTATGATGAGGAGGTGAGTCTAATAATGATGTGATG
T7_20272_G11	GTAGTGGTGGAGAAGAAGTCGATGATTATTATTATG
T7_20273_G11	AGTAGTAATAATAATTGGTCGTGGTGGTAGTAGTAG
T7_20274_G11	AAGATGTTGTTGTTGTTGTCGATGATGAGAAGAAGA
T7_20275_G11	ATGATGGAGGAGGTAGTGTCAGTAGTAGTATTATTA
T7_20276_G11	GTGAGGATGATGATGATGTCGATGATTAGTAATAGT
T7_20277_G11	ATTAGTAGTAGTAGTAGGTCTAGTGAGGATGATGAT
T7_20278_G11	AAGAAGAATATGATGTAGTCGTAGTGGTAGTTGTTG
T7_20279_G11	GAGAAGAAGTAGTAGTAGTCGTAGTAGTAGTTGTTT
T7_20280_G11	GAAGAAAAGGAGGATAGGTCTTGTTGTTGTTATTAG
T7_20281_G11	AAGTAGGAGGAGGATTAGTCTTATTAGTGGTAGTAT
T7_20282_G11	AAGATGATGAAGTAGTAGTCGTAGTAGTAGTGGTTT
T7_20283_G11	GGAGGAGGAGGTGGTATGTCAATTATTATTAATGAT
T7_20284_G11	GTGGTGGTGGTGAAATTGTCATTATTAGTAGAAGAA
T7_20285_G11	GATGATGATGATGTTAAGTCTAAATGATGTGGTGGA
T7_20286_G11	GTTGTGGTTGTTGTAGAGTCAGAAGATTAGTAAGAA
T7_20287_G11	ATGATGATTATTGTGGAGTCGGAGGATGATTAATAG
T7_20288_G11	TAGTAGTGGTGATGATTGTCAATGAGGATAGTAGTA
T7_20289_G11	TGGTGATGGTGGTGTTGGTCAAGAAGAATAATATTA
T7_20290_G11	ATGATAATAATAGTATAGTCTAGTAGGTGGTGGTGG
T7_20291_G11	GATGATGATGATAATGAGTCTGATGATGGTAGTAGT
T7_20292_G11	GAAGAAAGATGTTGTTGGTCTTGTAGATGATGATGA
T7_20293_G11	AAATTGGTTGTAGTAGTGTCAGTAGTAGTAGTAGGA
T7_20294_G11	GGTGGTTATAATGATGGGTCTGATGATGATAATAAG
T7_20295_G11	GGAGGAGGAGTAGTAGTGTCATTATTATTATAGTAG
T7_20296_G11	TATTATGGATGATGAATGTCAATGGTGGTGGGAATA
T7_20297_G11	ATTAGTAATAATGATGGGTCTGGTGGAGGATGATTA
T7_20298_G11	AAGGAGGAGAAGAATAAGTCTGATGTTTGTTGTTGT
T7_20299_G11	TTTGATGATGATGATTTGTCGAAGAAGAGGATGATG
T7_20300_G11	TAATAGTAGTAGTAGTAGTCGTAGTAATGATGGTGG
T7_20301_G11	AAGTAGTAGTAGTAGTAGTCGTAGTGGTGGTTATAA
T7_20302_G11	GGGTGGTGGTAATTGTTGTCTTATTAAGAAGAAGAA
T7_20303_G11	TGTTGTGAAGAAGAAGAGTCAGAAGTATTGTTGTTG
T7_20304_G11	TTATTGTTGTTGGAGGAGTCGGAGGAATAGTAATAA
T7_20305_G11	GAAGTAGTAGTGGTAGTGTCAGTAGTAGTAGTATAT
T7_20306_G11	TGGTAGTAGTAGTAGTAGTCATAGTTGTAGTAGAAG
T7_20307_G11	TGGTGGTGGTAGTAGTAGTCGATAATAATAATGATG
T7_20308_G11	GAGAAGATTGTTGTAGTGTCAGTAGTAGTAGAAGTT
T7_20309_G11	ATGATAGTAGTATAATAGTCAGTAGTGGTGGTGATG
T7_20310_G11	GTAGTGGAAGAAGGTTGGTCTTGTTGGTAATAATAA
T7_20311_G11	TGATTATGATGGTAATAGTCGTAGGGAGATGATGAT
T7_20312_G11	AGTAGTAGTAGTAGTAGGTCTAATATGGTGGTAGTA
T7_20313_G11	TAGTGGAGGATGATGATGTCGATTAATGATGATGAT
T7_20314_G11	ATAATGATGATGATGATGTCGATTAGTAGTAGGGTG
T7_20315_G11	ATGAGGAGAAGATGTTGGTCTTATTGATGATGATGA
T7_20316_G11	TTAATTAGAAGAAGAATGTCAGTGGTGGTGTTGTGA
T7_20317_G11	GATATTATGATGAAGATGTCGGTGGTGATGATGATA
T7_20318_G11	ATGTTGTAGAAAGAGGAGTCAGTAGTAGTATTGTTG
T7_20319_G11	GGTGGAGGAGGAAGATGGTCATAATATTGTATTATT
T7_20320_G11	GTTGTTGATGATGATTAGTCTTATAAGAAGGAGGAG
T7_20321_G11	AGTAGAAGAAGTAGTAGGTCTATTATTAGTGGTGGT
T7_20322_G11	AAGATGATGATGGAGGTGTCATTATTAGTAGTAGTG
T7_20323_G11	GTTTTTTGAAGAAGAATGTCAGTAGTAGGAGTAGTG
T7_20324_G11	ATGGTGGTGGAGGATAAGTCTAATATTAGTGTTGAA
T7_20325_G11	TGATGATGATTAATAGGGTCAGGTAGTAGTAGTAGT
T7_20326_G11	TGATGATGATGAAGAAGGTCATGTAGTAGTAGTTGT
T7_20327_G11	GAAGGAGTAGTAGTAGTGTCTGTAGTAGTAGTATTA
T7_20328_G11	GGAGGATGATGATGATGGTCATGTTGTTATTAAGAA
T7_20329_G11	GGGTGGTGTAGTAGTAGGTCTAGTAATAATAATGAT
T7_20330_G11	AAGAAAGAAGGAGGAGGGTCGATGATTTTTTTTTGT
T7_20331_G11	AAGAAGTGTTGTTGAGTGTCAGTAGTAGTAGTAGTA
T7_20332_G11	GAGGAGGAGTATTATTAGTCTTAGTAGTAGTAGTAG
T7_20333_G11	TAATAATTTTGGTGGTGGTCGTGGAGTAATGAAGAA
T7_20334_G11	TAGTAGAAGAAGAAGTAGTCGTAGTTGTTGTTGATG
T7_20335_G11	TAGTAGTAGTAGTATGAGTCTGATGATGAGGATGAT
T7_20336_G11	AGAAGAAGGATAGTTGTGTCTGTTATTATTAGGAGG
T7_20337_G11	GTGGTGGATGATGATGAGTCTGATAATAATAGTAGT
T7_20338_G11	TGGTGATGAGGAAGGATGTCAATGATGATGATTATT
T7_20339_G11	GAAGATGATGTTATGATGTCGATGATGATGATGATG
T7_20340_G11	AGTATTAGTAGAAGAAGGTCATGATGTTGTTGTAGG
T7_20341_G11	ATGGTTTTTTAATATGAGTCTGAAGAGGAGATGAGG
T7_20342_G11	AGTAATAGTAGTATTATGTCGATGATGATGGTGGGA
T7_20343_G11	GGTGGTGTGATGGTAGTGTCATAATAGTAGTAATAA
T7_20344_G11	GTTGTTGATGATGATGGGTCAAGAAGTATAAGTAGT
T7_20345_G11	AAATAGTAGGAGGTGGTGTCGTTAATAGTTGATGAT
T7_20346_G11	ATTATTAGTAGGAGGATGTCGATGATGATGATGATG
T7_20347_G11	ATGATGTGATGATGATGGTCATGATGATGATGAGTA
T7_20348_G11	ATAATAATAATGAGGTGGTCGTGGTTGATGATGATG
T7_20349_G11	GGTAGTAGTAGAAGATGGTCATGATGTGTTGATAAT
T7_20350_G11	ATTATTATGATGTTGGTGTCGGTGAAGAAGAAGATG
T7_20351_G11	AGTAGTAGTAGTAGTAAGTCTAATAATGGTGGTGGT
T7_20352_G11	GTAATAATAGTAGTAGTGTCTGTAGTAGTAGGGATG
T7_20353_G11	GATGATGTTGGTGGTGGGTCAAGATGATTAATAATA
T7_20354_G11	GGTGGTAGTAATAAGAGGTCTAATAGTTGTTGATAG
T7_20355_G11	TAGTAGTAGTAGTAGTTGTCGTAGTAGTAAGGATGA
T7_20356_G11	AGTTGTTGATGATAATAGTCATGATGATGAAGGTGG
T7_20357_G11	AAAGAGTAGTGATGGTAGTCGTAGTAATGATGTTGT
T7_20358_G11	AGTAGTGGTATTATTGTGTCTGTAGGAAGAAGATGA
T7_20359_G11	GGTGGTGGTGGTAGTAGGTCTAGTATAATAATAATA
T7_20360_G11	TAGTTGTTGTGTTGTAGGTCAAGGAGGAGATAATAA
T7_20361_G11	TTGTGGTGGTGATGAGAGTCAGAATATAATAGTAGT
T7_20362_G11	GATTAATTATGGTAGGAGTCGTAGTGGTAGTAGTAA
T7_20363_G11	AGAAGAAGGAGGAGGAGGTCTAGTTTTATTTTTATG
T7_20364_G11	AAAGAATTAATAATAGTGTCGGTGGAGGTTGTTGTG
T7_20365_G11	ATGGTGGATTATTATGGGTCTAGTAGGAGAAGAATT
T7_20366_G11	GTAGTAGTAATAGTAGTGTCAGAATGAGGAGTTGTT
T7_20367_G11	GTAGTAATAAGAAGAATGTCAGTAGGTGGTGTTGTT
T7_20368_G11	ATGATGATGATGATTATGTCGATGAGGAGTAGTAGT
T7_20369_G11	GAGGGTGTGGAGGATGAGTCTGAAAATTATTATTAT
T7_20370_G11	GTGGTGTAGTAGATAATGTCAATGATGATGATGATG
T7_20371_G11	AGAAAGAAGATGTTGGTGTCGATGATGATGATTGTT
T7_20372_G11	TGATGATGATGATAATAGTCGTAATGATGATGGTGG
T7_20373_G11	TATTATTAGTTGTTGGAGTCGGAGGATGATGAAGAA
T7_20374_G11	GTAGTAATAATAATAAGGTCAAGTGGTGGTGGTTGT
T7_20375_G11	GTGGTGGGTGTAGTAAAGTCTAGTAGTAGTAATAAT
T7_20376_G11	TTAGTAGTAGGAGGTGTGTCTGTTAGTAATAAGAAG
T7_20377_G11	TGGTGATGATGTTGGGGGTCAAGAGTATTATAATAA
T7_20378_G11	TATTGATGATGATGATAGTCGTTATGATGAGGAGGA
T7_20379_G11	GGTGGTGAAGAAGTAGTGTCAGTAGTAGTATTATTA
T7_20380_G11	AGATGATGATGATGATGGTCTTGATGATGATGATGA
T7_20381_G11	TTATTATGATGGTGGTGGTCGTGGAGAATAATAAGA
T7_20382_G11	TAGTGTAGTAGTAGGATGTCGATGATGATGATGATA
T7_20383_G11	GTTGATGATGAGGAGTAGTCGTAGTAGTAGTAATTA
T7_20384_G11	GTGGAAGAAGATGATGAGTCTGATGATGTAGTATTT
T7_20385_G11	GATGTTGTGGTGATGATGTCGATGATGAGAAATAAT
T7_20386_G11	TGATGATGATGATGATGGTCATTAGTAGGATGATGA
T7_20387_G11	GTGAGGTGGTAGTAGTAGTCGTAATAATTATGAAGT
T7_20388_G11	GTGATGATGATGATAAGGTCAAGAGTAGTATTGTTG
T7_20389_G11	ATAGGATTGATGTAGTAGTCGTAGTAGTAGTAGTAG
T7_20390_G11	AGGAGGTGGTGTTTATTGTCATTATTAAGAAGAAGG
T7_20391_G11	GATGAGGAGGAGGATGAGTCTATTATTATTAGTAGT
T7_20392_G11	GATGATGATGATGATGAGTCTGATGAGGAGTATTAT
T7_20393_G11	GAGAAGATGATGGTGTTGTCGTTATTAATAAGGATG
T7_20394_G11	GATGATGAAGATTATTAGTCGTAGTAGTAGGAGGTT
T7_20395_G11	AGAGTGGTGGTATTAGTGTCAATAAGTAGTAGTAGT
T7_20396_G11	AAGAATAGTAGAAGTTGGTCTTGTAGTAGTTGGTGA
T7_20397_G11	GGGTGGTAGTAGTAGTAGTCGTAAGATGATATTATA
T7_20398_G11	GAAGAAGAAGAAGTAGTGTCAGTAGTTGTTGTGTTT
T7_20399_G11	ATGATGATGATGATGATGTCGATGTTGTAGTAGAAG
T7_20400_G11	AAGAAGTAGTAGGAGGAGTCGGAGGATTATTTTTTT
T7_20401_G11	GGAGGATGGTTTAATATGTCGATGAATGATGGTATA
T7_20402_G11	GGAAGAAGTTTTTAATGGTCATGATGATGTTGGAAG
T7_20403_G11	AAAGGTGTGATGATGATGTCGGTGATATTGTGATAA
T7_20404_G11	TAGTGGAGAATGATGAAGTCTAGTTGGTAATGATGT
T7_20405_G11	AGGAATATTATAATAATGTCATTGTGGTGGTGGAGG
T7_20406_G11	AGGGAGGATTGTGATGAGTCTTAATTAGATGATGAT
T7_20407_G11	TGTTAATAATGATGATGGTCATGTTAGGAGGAGAGT
T7_20408_G11	AGGAGATGAGTATGATGGTCATTGATGTTATGATGA
T7_20409_G11	GTAGGAATAGTATAGTAGTCGTAGTAGAGTTATTGG
T7_20410_G11	AGGGAATAGGGAGGGTGGTCATTATTATTATTTAGA
T7_20411_G11	TAGTAGTGGTGGTGAAAGTCTAGATGATGATGAATT
T7_20412_G11	GGTAGATTTTTATTGAAGTCGAAGGAGTAGTAGTAG
T7_20413_G11	GAAAATGTAATAATATGGTCGAGTAGTGGTGGTGTT
T7_20414_G11	GAAGGAGATGTTGTTATGTCTATAATATGAGGTGGA
T7_20415_G11	ATAATATGGTGGTAGTTGTCAGTGATGATGATGAAG
T7_20416_G11	GTAGTAGTGTTTGGTGGGTCTTGATAAAGATAAGAA
T7_20417_G11	GAAGAATTATTGGAAGAGTCTGATTAGTGGTGGTTA
T7_20418_G11	AGTAGTATTGAGAATTAGTCTGTGTAGTAGTAGGAG
T7_20419_G11	GTGTTAATAGTAGAGGAGTCGTAATGATTGTGAGTA
T7_20420_G11	TTTAAAGTAATTAAGTGGTCGGTATGATAGTGGGAG
T7_20421_G11	GAAGGGAGGTGGGGATTGTCAGATAATTATTTTATA
T7_20422_G11	TAGTATTGTAGTGATGAGTCTTAGTGAGTAGAAGGA
T7_20423_G11	TAAGGAAGATAGTAGTTGTCGTTGATGATGGAATTG
T7_20424_G11	TAATGATGATAAGAAGGGTCAGTAGTTGTTATGTGG
T7_20425_G11	AAGTTTTGTTGTGGTGGGTCTTAGAAGAAGAAATGA
T7_20426_G11	GGTTGTTATGGAGAAGAGTCATGTAAGAATATTTGG
T7_20427_G11	AGGGGAGTAATTGGATGGTCATGTAGTATTATAATG
T7_20428_G11	GTAGTAGTGATGATGGTGTCGATAATAAGGTGTAAT
T7_20429_G11	TTGTTGATGAAGAAGAAGTCATAGGTGATGTTGTGA
T7_20430_G11	GTTAAGAGGTGGTGGTAGTCTAATATAAAAGTGTTG
T7_20431_G11	GTAGGGTTGATGATTATGTCTGAGATGAAAATGATG
T7_20432_G11	GGTTGGTTGATTGGAAGGTCAAGAATATATGAGTTA
T7_20433_G11	AGAATATGAGAGGGTGTGTCGTTTGGATATAGTTAA
T7_20434_G11	ATAATGGTGGTTGTAGTGTCATTAGGAGTAGAAGAT
T7_20435_G11	TAAGAATAATGGTGATTGTCATGATGATTGGTGAGG
T7_20436_G11	TAGAAGGTTGTTAATAGGTCTAGGAATAGTTGGTGA
T7_20437_G11	ATAGTAGTTTTTGTAGTGTCAGATGAGAAGAGGAGT
T7_20438_G11	AGAGAGTAAGAAGATGTGTCTGTTGTAATGTTGTGA
T7_20439_G11	TTTGGTGATAGTGGTGAGTCTAATAAGGAGATAATG
T7_20440_G11	ATATTATAATAATGAGGGTCTGGTGGAAATGGTGGT
T7_20441_G11	GGAGTATGAAGTAATTGGTCTTGTAGTGATAAGGAT
T7_20442_G11	TGTTGATGAGATTATTGGTCTAAGAGGAGTGAAGTA
T7_20443_G11	GGTAGAAAATTATGATGGTCGTATATTGTGTAGGAG
T7_20444_G11	GTATTTATGGTGGTAAGGTCAAATAATGGTGGTGAA
T7_20445_G11	GAAAATGGGAGGGTAGAGTCTATTGATTATTATTGG
T7_20446_G11	AATAAGAGGAGTAGTAGGTCTAGTGAGGTAGTTTTT
T7_20447_G11	TTGGTAGTAAGTTAGTAGTCGTATTAAGTAGGAGGA
T7_20448_G11	ATGATAGTAGTAGGGGTGTCAATATGAAGTGGTATT
T7_20449_G11	ATGAATAGTAGGTTTATGTCGATAAGGAGTGGTGAT
T7_20450_G11	TTATAATGGATTATGATGTCGGTAGGAGGAGAAGTT
T7_20451_G11	ATGGAAGTTTTTTATGGGTCATTAGAAAGTGGAGGA
T7_20452_G11	GATTAATAATGTGGAGTGTCGGAAGATGATGATGTT
T7_20453_G11	TGGTGGTGTTTATTAAGGTCGAGGAGTAGAATAATA
T7_20454_G11	AGTAGTGAGGATGATTAGTCTTAATTAGTAGTAGGG
T7_20455_G11	TTAGAATAGTAATGTGGGTCTGGTGGGAGAATAATT
T7_20456_G11	TGAGTTTTAATATGATGGTCAGTAGGTTGGAGAAGA
T7_20457_G11	GTGAGGAGGAGAAGTTAGTCTAAAAGGATGTTTTTT
T7_20458_G11	GTAGTGTGGTGGATATAGTCTTTATTAGAAAGGAGA
T7_20459_G11	TGTTGAAGAGGTGAAATGTCAGAAGTTGTTAGTGAT
T7_20460_G11	GAAGAAGGAAGTAGTATGTCTTTATAATGGTGGTGT
T7_20461_G11	TAATGGTGGAGAGGATTGTCATGTAGGTATGATAAT
T7_20462_G11	AAAGAGGTTTTTATTAGGTCTAGAAGAGGATGTGGT
T7_20463_G11	TTTTGGTGGATAAGTAGGTCTAGTTGATGAAGAAGA
T7_20464_G11	AATAAGAATATTTGTAGGTCTGGTGGAGGATGATGT
T7_20465_G11	TTATTAATAGGAGGATGGTCGTGGTAGTATTAGAAG
T7_20466_G11	AAGGTGGTGGAAGTATTGTCATAGTGGTAGTAATTA
T7_20467_G11	AGTGGTAAGAGGTGTTTGTCTATTAAGAAGATGATG
T7_20468_G11	ATTATTATTATGTTGGGGTCGGAGTGGATAAGAGAA
T7_20469_G11	AAGAAGATTATAGTAGTGTCTGATGTTGGTGATGAG
T7_20470_G11	GAATGATGATGAGGTTAGTCAGAAGAATTGTTGTTG
T7_20471_G11	GTTGATGTATGTTGGAGGTCGAAGAGGAAATTATTA
T7_20472_G11	TGGAAGAATGATTATGAGTCATGGTTGTTGTAAAGG
T7_20473_G11	TAGTTATGATATAAAAGGTCGAGGAGTAGTTGTTGG
T7_20474_G11	TTTTTTGTTAATGGAAGGTCATGAAAGTAGAGAGGG
T7_20475_G11	TTAGAGGAGGAAGATGAGTCTTGATTGTTTGAGTAA
T7_20476_G11	AGTGTTGTTGTAGTAGGGTCATGATAGATGAAAATG
T7_20477_G11	GTGGAGTAGAATGATGTGTCTAATAAATAGTGTTGG
T7_20478_G11	AAGGTTTTTTGGTTGATGTCAATAAAGGTAGGAGGA
T7_20479_G11	GGTAAAGAGAAGTAATGGTCATTATGGTGGTATGTT
T7_20480_G11	TGGTGGTGGTGGATAATGTCAGTAGATTATTAGAAA
T7_20481_G11	ATATAAGTGTGGTTAGTGTCGGAGGTTATAGTAGAA
T7_20482_G11	AAAGTTTAGTGAGTTAGGTCGTAGTGGTGGTATAAA
T7_20483_G11	TAATTAGTGGTGGTAGTGTCAATAGTAGGTGAAAGT
T7_20484_G11	GAATAGTAAAGTAGTATGTCTAGTATTGTGGGGATG
T7_20485_G11	AATAATAGGAGAGGGTTGTCGTTTGAAGTTGTAGTA
T7_20486_G11	TATTATTATGAGGAAAGGTCTAGTGGAGGTTGTAGA
T7_20487_G11	TGATGAATAGAGTAGGAGTCGGTGTTGTTATAATGA
T7_20488_G11	AAGATATTATTTTGGTGGTCGGAGTAGTAATAGAGG
T7_20489_G11	GGAGAATGTAGAAGAAGGTCTATTATGATGTTGTTG
T7_20490_G11	TATAGGGTGGTTGTGATGTCGAAGAATAATTAGTAG
T7_20491_G11	GTATTGTGGAGTAGTAAGTCGAGGAGGTTATATAAT
T7_20492_G11	TTGTTATGAGGATTATTGTCATGAGTAGGAGGAAGA
T7_20493_G11	AAATTTGGTTGGATGATGTCGATGAAGATGTGATGA
T7_20494_G11	GGTGATAATTGGTTGTTGTCATGAAGTAGGTAGAAA
T7_20495_G11	GGGTGATGAGTGATGATGTCATTAAGAGAAGTTATT
T7_20496_G11	GAAAATTATTTTTGTAGGTCGTGATGAGGAGTAGGA
T7_20497_G11	GTAGAATATGGTGGGTAGTCGTTGTAAGTAATTAAG
T7_20498_G11	TAATAGGATGAGGTGGGGTCAAGATGGTATATTATT
T7_20499_G11	GAGAATGATGTGGAGATGTCAAGTTTTTGTTGAGAA
T7_20500_G11	ATTATTATTGGTGGTGGGTCAGATGAATAAAGGATG
T7_20501_G11	AGATGATGGTGGGGAGTGTCAATTATTATTTAAAGG
T7_20502_G11	GTTAATAAATAAAGAAGGTCGTGGTGTTGATTGGTG
T7_20503_G11	AGAAGATTAATGGAATTGTCTTTGTAGGGGAGGATT
T7_20504_G11	AAGTATGATAGTAGTAGGTCTAATGTAGTATTGGGG
T7_20505_G11	AATGATGAGTAGAGGTGGTCATAGTTATTGATGATG
T7_20506_G11	ATAGTATAGTGGTAGTAGTCGTTGAGGAGTTGATAA
T7_20507_G11	TGGTTGGTATAAGGTAGGTCGAGTGATAAGTATAAT
T7_20508_G11	AGAGGATGGTATAAGTAGTCGTGGTATGATGATTAT
T7_20509_G11	TATTAATTGAAGATGGTGTCGGTGTTTAAAGAGAGG
T7_20510_G11	AGAATTATGTTGAGGAAGTCGTAGTGATATGTAGGT
T7_20511_G11	AGATGTTGATTAGTATAGTCTAGGAGGTGTAGGAAT
T7_20512_G11	AAGTATTGGGTGATGGGGTCATATTGAAAAGATGTT
T7_20513_G11	AAGGAGGTGGTGGTGTTGTCATTGTAATATAAGAAT
T7_20514_G11	GTAATAAAGATGTAGTGGTCGAGTAGTAGTATTGGT
T7_20515_G11	ATGATGAGTAGTAGTTGGTCTTGAGGGAAGATTATA
T7_20516_G11	TGGGGAGGTAGAGTAGTGTCAGATAATTATAGTATT
T7_20517_G11	ATTATTGATAATAGAAGGTCGATGGGTGAATTGGTG
T7_20518_G11	GGGAAGAGGTTGTTGATGTCATTATGAATAGTAGTA
T7_20519_G11	TGAAGGATGTTTAGAAGGTCGGTTGGTTAATAAGTA
T7_20520_G11	TGTTGAGGATGATGATAGTCATTAAAAGAGTGGTGT
T7_20521_G11	AAGTAAATAATATGGTGGTCATGGGTGATGATGTTG
T7_20522_G11	AAAGAGGTATTGTTGAAGTCGAATAGTTGGTGTTAG
T7_20523_G11	TATTATGATGTGGGTGTGTCTGAAAAGAATGGGATA
T7_20524_G11	GAGGAGGATTTTATGGGGTCTGGAGTAATAATAATT
T7_20525_G11	AGTGAGGATTAAGTAGTGTCAGTAGTATTATTGGAG
T7_20526_G11	TGGAGAAGAAGAAGATAGTCATTGTTTTGTTAGTGG
T7_20527_G11	ATTATTGGGTAGTGGGTGTCAGTATAAGAAGAGTAT
T7_20528_G11	AAGTTTATGAGGAAGAAGTCGTTTGGTGAGGATTAT
T7_20529_G11	AAGAGGAGTGGTGTTGTGTCTAATAGGAATATGATT
T7_20530_G11	ATGTAGTGGTGGAGAGGGTCAGGAATTAATATTATT
T7_20531_G11	TGGTGATTGAAGAAATGGTCATGGTAGTAAATGTTG
T7_20532_G11	GTAGGAGGTTTGTAGTGGTCGTGAAGAATATAATTA
T7_20533_G11	GAGGATTATAAAGAATGGTCTTGTTGGTGGATTAGA
T7_20534_G11	GTTATTTTTTGGAGTAGGTCGTGGGAGAAATAAGAA
T7_20535_G11	AGTAGAAAGTTATGGGGGTCTGAAAATGTTTATGGT
T7_20536_G11	GATAATAATTGATGATGGTCATGGTGTAGTGGATGA
T7_20537_G11	AGGAAGAGAGGGTTGTTGTCATTTTAATAGGAGTAT
T7_20538_G11	TATAATGATTGTTGGGGGTCGGGAAGTATTAAAATG
T7_20539_G11	TAGTATTATTTTGGTAGGTCATAATGAGGAAGGAGG
T7_20540_G11	AAATGATGATGATGAGGGTCAGGTTATTGTTGATGA
T7_20541_G11	GTGATAATGATGAGAAGGTCTGTTATTATTAGGAGG
T7_20542_G11	GTTGTTGTTGTGGTGGAGTCGAATAAATAAGATGAA
T7_20543_G11	ATTTGGGAAGGAGGAGGGTCAGATTATTGTTATTAA
T7_20544_G11	GAATAATGTAGTATGGTGTCGGTGGTGGAATAATTA
T7_20545_G11	TGAAGAATGAGGTTGTTGTCAATAAATTGGTGAGGT
T7_20546_G11	TGGAGGAGGAGAAATAGGTCTAGAAGGTTATTTTTT
T7_20547_G11	TTTAGAGGATGAGGAGGGTCAAGTATTATGAGTTAT
T7_20548_G11	GTTGTTGAGTTATAGGAGTCGATGATTATAGAAGGA
T7_20549_G11	TTGTAATAGTGGTGATGGTCAAGGAGGAAGATATTT
T7_20550_G11	TTGAGAAGTAGGAATGAGTCTGATGATTGTTAGTAG
T7_20551_G11	TGGTATTAGTATAATTAGTCTTAGAGGGAGTAGAGG
T7_20552_G11	GGGTAGTATAATAGATTGTCGTTGGTGGTATAAAAG
T7_20553_G11	ATTAATTAGTTGGGAGGGTCAGTATTATTAGAAGGG
T7_20554_G11	AAAAGGAGTAGTAGGGTGTCAGTTGTTATTGGTTAA
T7_20555_G11	GTTGTAGTTGATGTAAGGTCAAGGAGAATTAGGATT
T7_20556_G11	GTTGATGATGAAGAAGAGTCGATAGTAGTTGTTGTA
T7_20557_G11	TGTAGTGGATGGAAGAGGTCGATGATAAATTATTGT
T7_20558_G11	GAAGAATATAGTGATGAGTCTTATTATAGGGTGGTG
T7_20559_G11	ATGGAGGAAATAATGAGGTCATTGTTGGTTTGATGA
T7_20560_G11	GAGAATAATAATTATGAGTCTGGATAGTGGTGGTTG
T7_20561_G11	GATGGGAGGAGAGGTGTGTCTTATTAGTAATAATAT
T7_20562_G11	AAAATAGATGATGATGAGTCAGTGGTGGTGATTGTT
T7_20563_G11	TGGTATTATTTGGAGGAGTCAGATAATGTTGAAGAG
T7_20564_G11	TAAAATTGTTATAAGTAGTCGTAGTAGTGGTGGAGG
T7_20565_G11	TAATAGGTGGGATGATGGTCATTTTGATGATGAGAA
T7_20566_G11	TGTTGTAGTAGATTATTGTCAATGAGGAGGAGAAGT
T7_20567_G11	TATAAGAAGTAGTAGTGGTCGAAGTATTGTAGTGTG
T7_20568_G11	GTAGTAAGTAGTAGATGGTCATTTGTAGAGGAGTTA
T7_20569_G11	ATAGTAGTATAAGGTGGGTCTGATGATAAGGTGTTA
T7_20570_G11	TAGAAGATGATGAGGTGGTCGTAGTATAATTGTTGA
T7_20571_G11	TTATGAGTGAGTAGATGGTCTTATAAGAAGAGGTGT
T7_20572_G11	GGAAGATGATGATGATGGTCTTTTAGTAGTAGTAGA
T7_20573_G11	ATGAAAGTATAGTAGAGGTCGTGATAATGTTGTTGG
T7_20574_G11	GTTTATAAAAGGAGGGTGTCGATGGTGTATATAGTA
T7_20575_G11	ATTAGTAGTGGGTGGAGGTCATGATATAATAGTATG
T7_20576_G11	AGGGAGGATGAGTGGAGGTCAAGAATATATTTTTTT
T7_20577_G11	GAGGTATTATTAAGTGGGTCTAGTTTGGAAGAAATG
T7_20578_G11	TGGTAGATAGTAGAAGAGTCTTATAATGATGGGTTG
T7_20579_G11	GTAGGTGAAGTAAGGATGTCTAATTATTGGTGATGA
T7_20580_G11	GGGAGGAGTAGTATTTTGTCGTTGAATTATGAAGAA
T7_20581_G11	TTAATAATTATGGAAGTGTCAGTAGGTGGTAGTGGA
T7_20582_G11	ATAAAGATGGTGGTAGTGTCTGAGGTAGTAATGATT
T7_20583_G11	AAAAGGGTTGTGTTGTTGTCAAGAAGAAGATGTTGT
T7_20584_G11	GGTGGTTATAATAGAATGTCAATAGTTGGTTGAGGA
T7_20585_G11	ATGTTGTTAATAATAATGTCAGGATGGGTGAGTAGG
T7_20586_G11	GGAGAGGGTTGTATTATGTCTAATGTAGTAGAAGAT
T7_20587_G11	GTTTAGGTGGAAGTAAAGTCGATTGATAGTAGTAGT
T7_20588_G11	TAGTTAGTAGATGATGAGTCTTATAGATGAGGAGGT
T7_20589_G11	GTATAAGAATTGTTAGGGTCGGAGAAGATGGTATTT
T7_20590_G11	GTGGATAATTAGGAGAAGTCGAGTTAATGATGTTGT
T7_20591_G11	ATAGTAAGAAGAAGTTGGTCGTGGTGATTATGTTGA
T7_20592_G11	GTTGAAGAAAAGTAGTGGTCTTGTTGTAGAGGATAT
T7_20593_G11	TTATAAAGAAGATGATTGTCATTGTGAGGAGTGGGT
T7_20594_G11	TTTGTTGTAGTGTGTAGGTCAAGAAGGATGAAATGA
T7_20595_G11	TTGGTATTGTTGTGGTAGTCATAAGAGGAATAAGGA
T7_20596_G11	GTGGAAGTAGTAGTAATGTCATTGTGGTTAAGGAAT
T7_20597_G11	AATATGATGATTAGGAAGTCGATTAGGTATGGTGGT
T7_20598_G11	AGTAGAAGAGGAGGATGGTCGTGATTATATTTGTTA
T7_20599_G11	GGAGTTGTAGTAGTAATGTCGAATATTTAGTAGGAG
T7_20600_G11	TAATAGTATAATGGTTGGTCTTTGGAATGAGGGAAG
T7_20601_G11	AAGAATAAATTAGTTGGGTCGAGGTGGTTGATGATT
T7_20602_G11	TATAATAATTAGGAGAAGTCTGATGGTGATTGTGGG
T7_20603_G11	AGAATTTATTATAGTAGGTCGGGTGAGGTGTTGAAA
T7_20604_G11	AATAGTAGTTATGATATGTCAAGGAGGTGGGTAGTT
T7_20605_G11	AGGAGTTGTTGGGATAAGTCTAATAGTAGTAGGTTA
T7_20606_G11	GTGATGAAGATGTTGTAGTCGTAATTAGAATAGGTG
T7_20607_G11	TGAAGAAGAATAAGTTGGTCGTTGTTGTTGTAGAAG
T7_20608_G11	GAGTATTTGTGGAGATTGTCGAAGTAGTAATAGTAG
T7_20609_G11	TTAAGAAGAAGATGTAGGTCTTGTTGTTGATGAGGA
T7_20610_G11	GAGGTAGGAGAGAAGAAGTCTGGTGTTATTATTTTA
T7_20611_G11	ATAAAATAGTATGAGAGGTCGAGGTTTAGTTGTTGG
T7_20612_G11	ATGATGAGTAGGATGTGGTCATGATATTTTGGAAAG
T7_20613_G11	GTGGGTGATGATTAATAGTCGTTGTAGAAGTAATGA
T7_20614_G11	TGTATTGTGGTGGGTTAGTCTAAGAGTAATGAAGAA
T7_20615_G11	AGTAGAGGGGTAGTAATGTCAATTAGGATGATTTTG
T7_20616_G11	GGTTTGTGGAAGGTTGAGTCTGAAAATAATAGTAGT
T7_20617_G11	ATGATGTTGTAGTATTAGTCTGAGAAGTGTGGAAAG
T7_20618_G11	GAGGTAAAATTATTTTTGTCTTGAGGAGTAGGAGAG
T7_20619_G11	GTATTAATATGGTGTTTGTCTGGGGAATAAAAGGAG
T7_20620_G11	AGGTGGAGGATATTGTAGTCTGATGATTATAATGAG
T7_20621_G11	GGAAGAAGAATAGTAGTGTCGGTGTTGTTATAATTG
T7_20622_G11	AGGAGGTAAGAAAGTTAGTCTTGTATTAGGTAGTTG
T7_20623_G11	TATTATTATTAGATGGGGTCGAGGGTGATAAGATGA
T7_20624_G11	TGTTGTTGTATTAAGGAGTCTGATAATGAGGAGGAA
T7_20625_G11	GAAGTTTGTGTTGTATTGTCATTAAAGGGGAAAAGG
T7_20626_G11	ATAGTAAGAGGAGAAGAGTCTGATGATGTTGTTGTT
T7_20627_G11	AGGAGGATGTTTTGATGGTCAAGTGATTATAAGTAG
T7_20628_G11	TATGGAAATTATGATTAGTCGTGGTTGGAGGTAGAA
T7_20629_G11	TGGTATTTATTAATAAGGTCGTGGAGGTGGAAATGA
T7_20630_G11	GAAGGTGGTGAAATAAGGTCATTGTTTTGTGAAATG
T7_20631_G11	ATTTGAAGATGGTGTGGGTCAGTAATGATGATAGAT
T7_20632_G11	GTTGGGATAATATTGTTGTCGTTTAGAAGGAGAGAA
T7_20633_G11	TAGTGGATGGAGGAGTAGTCTTGTTATAAGAATATG
T7_20634_G11	GTGTAGTTGTGTTTTGAGTCAGAAGAAAAGTAGATG
T7_20635_G11	TGTTATTTGGTGTAGTAGTCAGAAGAAGGAATGTAG
T7_20636_G11	GAGGGGAGTAATAATGAGTCTTGTTATAGTAGTGTA
T7_20637_G11	TGTTATGAAGAAGGAAGGTCAATGATGGAGTTGTTT
T7_20638_G11	ATTAAGGGAGTAGTGTAGTCTGTAGTAGTATAATGG
T7_20639_G11	TTATGGAATTGTGAAATGTCGATAAGGGGTAGTATG
T7_20640_G11	TAGTGGTAGAATAAGAGGTCGTGTTGTTGAAGTTAA
T7_20641_G11	ATGAGGTGGTAGGATGAGTCTAATAATGATGTTGTA
T7_20642_G11	GGAAGTAATGGTGTTGAGTCTGATTATGAGTTAAGA
T7_20643_G11	TTATTGGTAGGTAGGAAGTCTAATATTGTAAGGAGG
T7_20644_G11	TGGATGAAGTAGATGATGTCGAGTAGTAGTATTAGT
T7_20645_G11	TGGAAGATAGTAGAATAGTCGTATTATTAGGGGTGT
T7_20646_G11	GTTGTATAATAATAAGAGTCAGGGTTGGTAGGTGAT
T7_20647_G11	ATTGGTATGAGAGAGTAGTCGTGTTGTAGTAAATAG
T7_20648_G11	GTGGAGGAGATAATAATGTCATTAGTAGTGTTGATG
T7_20649_G11	AGTAGTGGTGTATAGTAGTCTTATGATATGGAAGAG
T7_20650_G11	ATAAAAGGAGGGTAATAGTCATTGTTATGGTGTTGG
T7_20651_G11	AGGAGGAGGATGTTGTTGTCTAGAATTATGAAGTAT
T7_20652_G11	ATAATGATGATGTGTTAGTCGTAGTGGAGGAAGTTA
T7_20653_G11	GGAGATATTATGAAAGAGTCTGTTGTAGTAATGGTG
T7_20654_G11	GTTGTTGTGTTTTGAAGGTCAAGTGGAGAAGAAATA
T7_20655_G11	GATGGTAGTAATAATTAGTCTTAAGAAGGGTGTGGT
T7_20656_G11	AGTAATAGGTGGGTGAAGTCTAATAATAGTGTTGGT
T7_20657_G11	TGTGGTGGAGAAGATTAGTCAGATGATTAATTGTAG
T7_20658_G11	AATAGTTATGATGAAGTGTCAGTGGAGTATTGGTGA
T7_20659_G11	AATGGTGGTTGTTAATAGTCATAGTTGATGAGGAGA
T7_20660_G11	TTGGTGATAGAAGTTGTGTCGGTAGTAGAAGAAATT
T7_20661_G11	AAAGTAGTAGTTTTGTAGTCGTGAGGTAATAGTAGG
T7_20662_G11	AATTATTATTGGAGTTGGTCATGGAGGGTAGAGATA
T7_20663_G11	ATGAGGAGGATAGTTGTGTCAGTAATGGTTGTTAAA
T7_20664_G11	AATGATGATTATTGGAGGTCGAGGATGAATGTTGTA
T7_20665_G11	GAATGATTAATGGTGGAGTCTGTGGGGTAATAAATT
T7_20666_G11	GGAGTTTTGAAGAATAAGTCGAAGTAGTAGTGGTTT
T7_20667_G11	AAGATAATTTAGTGGTAGTCTTATGGGGAGGTATGA
T7_20668_G11	AAAATAAAGGTGTTAAGGTCATGGTAGGGTGTTGTT
T7_20669_G11	GGGAGAAGAATAAGATGGTCTTAATTGGTGGTTTTA
T7_20670_G11	TAGTAGGATGATGGAAGGTCAAGATGTTATTTTGGA
T7_20671_G11	ATGAGAATTGTTGAAGAGTCAGTAAGTAGTTGTGGT
T7_20672_G11	TGAAAGGAGTTGATTGTGTCTATAAGTGGAGTAGTA
T7_20673_G11	AGGAGTGGTTATTAGATGTCGATAGAGTATTATGGA
T7_20674_G11	AATGAGGAAGATTATTGGTCGTGTAGGTGGATTATA
T7_20675_G11	ATGAAGGAGGTAGTAATGTCGAGAATATTGTTGTTG
T7_20676_G11	AGGGGAAGGATTATTGTGTCAATTTATAGTGGTAGA
T7_20677_G11	TGATAATAAAGAGTTGTGTCTGTAGTGAAGAGTGGT
T7_20678_G11	ATTAGTAGAGAAGTAGAGTCTTATGGTTTTGAGGAG
T7_20679_G11	TGTTGTAGGAGGAGGAAGTCTAAGAATTGTTATGAT
T7_20680_G11	GAAGAAGGATGTAGGAGGTCAAGGTTGTTATTATTT
T7_20681_G11	GTGTTGTAGGAGGATTAGTCTGATAAATAAAGTGGT
T7_20682_G11	AGTGGATAAGAAGAAGTGTCAAGTATGTTGTTTGGT
T7_20683_G11	AGGGGTGATTATATTAGGTCTAGTTGTAATAGAGGA
T7_20684_G11	ATATATTATGTGGTGAGGTCGGATTAGTTGAAGAAG
T7_20685_G11	AATAGTAGGAGAAGATGGTCTTGTTGTTGGTATGAA
T7_20686_G11	AGTAGTAGTTTTGGTGGGTCAAGATTAGTAGTAGAA
T7_20687_G11	AGTATGAATAATAATTAGTCTGTTGAGGTGGAGTGG
T7_20688_G11	AGGAGGAAAAGATAATAGTCGTTTTGTTGTGGTGAT
T7_20689_G11	GGGTGGATGTTTAAGAAGTCTAATATTGTAGATGAG
T7_20690_G11	GATGAAGATGATGTAATGTCTAGATGATGATGTGGT
T7_20691_G11	GTTGTGGTAGTAGTAGGGTCGAGATTAGAATAATAT
T7_20692_G11	AGGAGGTGAGTTTTTTTGTCTTAGAAGAAGGAAGTA
T7_20693_G11	TGTTGTAAATAATTAGGGTCGGTGGAAGAAGTATTG
T7_20694_G11	GGTAGGAGGGAGTAGTAGTCATAGTATTATGTTATA
T7_20695_G11	GGAAGAATGATGATTTTGTCTTTATGAGGAGAAGTG
T7_20696_G11	GTGGGTTATGTTGTGGAGTCAGATTAAAGAAGATTA
T7_20697_G11	GATTAATGAGGGGTAGTGTCATAATAGTGTAATGGT
T7_20698_G11	GAAAAGAAGAGTAAGGTGTCGTTGATTTTTTGGGAT
T7_20699_G11	AGTAGGATGTTAAGAAGGTCATGATGGTATGTTATG
T7_20700_G11	TGTTTTTTGGTATAAAGGTCAATAGTAGGAGGAGGA
T7_20701_G11	GGATGAGTGGTGATAGTGTCATTATTAATGATGAGA
T7_20702_G11	GAAAAGAAGATGATTATGTCGTGGTGTTGTTGATGA
T7_20703_G11	GTAGATGATAAGAAGTAGTCGGGTGGTGTTTTAATA
T7_20704_G11	GAAGTAATGGTGAATAGGTCTTGGTGGTTATAATAG
T7_20705_G11	AAGTAGTAGTAGTAGATGTCGAGTGTTTGTTGAAGA
T7_20706_G11	TGGATGAGGAATAAATGGTCAAGATGTTGTAGTGTT
T7_20707_G11	AAAGAAATTATAGTGAGGTCATGTTGTTAGGTGGTG
T7_20708_G11	TAAGTAAAGAGGATTGTGTCTGAATGATTGTGATGG
T7_20709_G11	ATTGATAATAGTAGTAAGTCGAAGGAGGTGTTGTGT
T7_20710_G11	TTGTTTATGAATGAGGGGTCAATGTTGAAGAATAGG
T7_20711_G11	ATTTAGTAGTTGTGATGGTCAAGAATGAAGGTGTAG
T7_20712_G11	GATGATGTTATGATGAGGTCATGATGATGGTAAGAT
T7_20713_G11	TTTAAGAATGATGATGTGTCGAGTTGAAGATGATGG
T7_20714_G11	AATTATGGGAGTTGATGGTCGTGGAGTAATTTAAGA
T7_20715_G11	GAGTAATTTGGAGATAAGTCAATGGTGTTGTAGTAG
T7_20716_G11	TGATGGGGTGGTGATGAGTCAGAATAATGATTATTA
T7_20717_G11	GTTGTTATTAGTAATTAGTCGGAGGAGGAGAATAGT
T7_20718_G11	AAAATAAAAGGAGGAATGTCTTGTTTTGGTGTGGTG
T7_20719_G11	GGAGGGGAGAAGATTAAGTCTTATAGTGGTATTATT
T7_20720_G11	GGAGAATGGATGATGATGTCGATGAGGATTATTATT
T7_20721_G11	AGGAGGAGTAGTATGATGTCGATTATTGTTAGTAAG
T7_20722_G11	AAGAAGTGGGGAAAATTGTCTTTTTTGTAGAGGATG
T7_20723_G11	GTTAGTATGGTAATATTGTCAGAGATAGGTGGTAAG
T7_20724_G11	GTGGAAGATAAGTATTAGTCTGGTTGATAGAGTAGT
T7_20725_G11	TGATTAATTATGAAGATGTCGATGAGTGGGGATGAT
T7_20726_G11	AGTAGTGGTTGATAGTAGTCTGAATAAAGGTAGTTG
T7_20727_G11	GATGTGAAGTTGAATAAGTCTTATGGTGGAGTAGTA
T7_20728_G11	GGGTGGTTATTAAAAGTGTCTGTGATATAAGAATGG
T7_20729_G11	GATAGGAGGTAATTAATGTCATTAGTGAAGGTGGTT
T7_20730_G11	TAGTATGTAGGAAGATGGTCAGGAATATTATTGGTG
T7_20731_G11	AGAAGAATTATGAGTGTGTCGTTGGTAAGAGGTTAT
T7_20732_G11	GTAGTGAGGATTATTTAGTCAGAATGATTGGAGTAG
T7_20733_G11	GAAGTAGGATAGTAAATGTCTGTTTGTTGAGTAGAG
T7_20734_G11	GTTGTAGAGGAAGTGGAGTCGTAGAAATAGTATTTT
T7_20735_G11	GTATGTTGTTATGAGAAGTCGATGATGGATGGTAAA
T7_20736_G11	GAGAAGAATTATTTGAGGTCGAGGATTGTGTTAGAT
T7_20737_G11	GGTGTTTATTGGGAGATGTCAATAATAGTAGGAGTA
T7_20738_G11	AGGATGAATAATAATAAGTCTGTTGTGGTGGTGGTA
T7_20739_G11	ATATTATTGATAATGAAGTCGTGGAGTGGGTGATGA
T7_20740_G11	AGTTTTTATTGTAAGATGTCAGGAGAGAGGTAGTGA
T7_20741_G11	TTGTTGTAGTGGGTAATGTCGAATAGAAAGAGGATT
T7_20742_G11	AATTGAAGTAAGGTTGTGTCGGTGTGGTGATAATAA
T7_20743_G11	ATGATGTTGTAGGGTGAGTCTAGGATTATGAATAAG
T7_20744_G11	TGAGGTATTATGAAAGGGTCATTATTGTAGATGAGG
T7_20745_G11	ATTTTGTTGTAGAAGAAGTCGAAGTAGTAGTAGTGG
T7_20746_G11	GGTGGAAGATTATTAAGGTCGGTGGTAGTAATTAAT
T7_20747_G11	AGTAATTAGATTGGTAGGTCTATTATTAGGGGAGGA
T7_20748_G11	TTGTTGTTGTAGATAAAGTCGAGGTGGGATGAATAA
T7_20749_G11	AGTAGTAATAAAATGGGGTCGGGTAGTTGTAGTATT
T7_20750_G11	GAATAATAGTTGTTTATGTCAAGGGGAGGAGATGTT
T7_20751_G11	AGAATAATAGTGGGAGAGTCGGAGTAGTAGTTTTTT
T7_20752_G11	AGGTGATGAATTGTTATGTCGGTAGTAAGGATGATA
T7_20753_G11	GATGATAAAGATAATTAGTCTTGGTAGGATGTGGGT
T7_20754_G11	ATATTGGTAGTGGTGGAGTCTGATGAAGTAATATGA
T7_20755_G11	GGATGAGGAATGGAGGTGTCAGTAGTAATTTATATT
T7_20756_G11	TAGTAGTGATGAGGGTAGTCTTAATAGTAGTAGGAT
T7_20757_G11	AATTTTTTAATAGAGGAGTCGGAGTAGTAGTGGTGA
T7_20758_G11	AAGAGATTAGGAGGAGTGTCTTGTTGGATGATAATT
T7_20759_G11	GGAGTAATTTTTTGGAGGTCGAGAAGTATGATGTAA
T7_20760_G11	TGATGAGTAGTAGAAGAGTCTGTTAGTAGTTGATGA
T7_20761_G11	ATAATTAGGTGGTGATTGTCTGAAGTAGTGGAAGTA
T7_20762_G11	GTATTGTAGTAAGTAGGGTCAGAGGAGGTATTATTA
T7_20763_G11	AGGTAGGATGATGTTGTGTCTGGTAATAATGATAAG
T7_20764_G11	TGATTATGTGGTGAGGAGTCAGTGGTTAAATTGAAA
T7_20765_G11	GATATAATAAGATGAGTGTCGGTTGATGAGGGTTAT
T7_20766_G11	TGTTATTAATAAGATGAGTCGGAGGATGTGGGTAAT
T7_20767_G11	ATAATTGTGTGGGGAGGGTCAGGATTAGTATTAATA
T7_20768_G11	TGGAGGAAAGTTATAGTGTCTTATGAAAGATGTTGG
T7_20769_G11	TTATAGGAGGAGGAGGAGTCAGGTGAATATTATTTT
T7_20770_G11	TAGTAGTGTTTTTTAGGGTCAGAAGAAGAGGTAAGT
T7_20771_G11	GGAGATTATTATTGAAGGTCGAGGATGATGATTATG
T7_20772_G11	TGTGATGATTGTAGGAGGTCATAGTAGTAGGAAATT
T7_20773_G11	GAAAAGGAGGTGGATGAGTCTGATGATATTGTTTTA
T7_20774_G11	GGTAGAAGTAAGTAGGTGTCAGTGTTTAGTAATAGT
T7_20775_G11	TTGGTGGTGATTTTGATGTCGAGAAGAATATAGAAG
T7_20776_G11	TGATGATAATAAATATTGTCGAGGTAGTAGTGGTGG
T7_20777_G11	TGGTGGTAGATGTGGTTGTCGATGATAATAATAAGA
T7_20778_G11	GAGGATGGTAGTGATGGGTCGATAATATTATTATAG
T7_20779_G11	GTAGTAATATTGGGTTTGTCATGAAGAGAATGAGGT
T7_20780_G11	GAATATAGAAGTTAGGAGTCGTGGGTTTATTAATGG
T7_20781_G11	GGAAGTGGTGATGTTATGTCTATTGATAAAATGAGG
T7_20782_G11	TTGGAATAGTGGGTATGGTCATGTAGAAGAAGTATT
T7_20783_G11	AGTGATAATAGTAGTGTGTCTGAGGATGATGATGAT
T7_20784_G11	GTGTGGTTATATTAGGAGTCGAGTAATAGGAGAATT
T7_20785_G11	AGTTGTTAATAGTATTAGTCGGGTGAAGAAGAGTTG
T7_20786_G11	TATTTTTTTTAAGGGAAGTCGGAGGGAAAGAGTAGT
T7_20787_G11	GTTGATGATTAATGGATGTCGATGAGGGAGTATAAT
T7_20788_G11	GAGGTATTATGGTGGTAGTCGTGGTAATAAGTAATA
T7_20789_G11	GAGGAAGGTGGTTAGTAGTCTAATAATGATTGTTGA
T7_20790_G11	TTATTATGAAGAATTTAGTCGGAGGGAGTGGGATTA
T7_20791_G11	TAAGGAGGAAGGAGTATGTCGTAGATGTTTTTAAGT
T7_20792_G11	TAGAAGAAGTAATAGTGGTCGGTAGTAGTTGTTGAT
T7_20793_G11	AGTAGATGTTGATGGTGGTCGAGAAGATATTAGTAT
T7_20794_G11	GAAATGATGATGATGGAGTCAGTATGGTTATGTGAT
T7_20795_G11	TTTTTGGAGGAGGAGGTGTCGAAAATTATGTAATGA
T7_20796_G11	AATAAGTAGTGGTTGTAGTCGAGGTTATGGTAGTAA
T7_20797_G11	GTTATGAAGTAAGGTGGGTCAAAATGTAGTTATTGG
T7_20798_G11	GGTTATTAAAGGAAGTTGTCTAGTGAGGTGATAATG
T7_20799_G11	TGTAGAAGAGATTTGAGGTCGAATAAGGTAGTTGTT
T7_20800_G11	GTTGGGTTGATGAATATGTCTGATAATTAAGAGGAG
T7_20801_G11	TAGATGGTGGTATTAGTGTCAGAAGATTTTGGAAGA
T7_20802_G11	GGAGATGGGTTTTAGGTGTCTTGTAAGAAGATAAAT
T7_20803_G11	GTTAGGTTTTAAAGGAGGTCGTGAAGGTGATTATAA
T7_20804_G11	AAATGTTATGGGGAGGGGTCATTAAGAAGTTGATTT
T7_20805_G11	GTTAAGTAGGGAGTGAAGTCTTAGTAATATAGTGGT
T7_20806_G11	ATTATAGTTGAGGATGTGTCAGGGGATATATAATGG
T7_20807_G11	ATATAAGGGAGGAATGAGTCTTAATATTGTTGGTGG
T7_20808_G11	TGATTATGATGGATGTAGTCAGTTAAGTGTGAGAAG
T7_20809_G11	AATAATAATTGTATATGGTCATGTTGTGGAGGAGGG
T7_20810_G11	TTATTAGATGATGTGTTGTCAGAAAAGATGGTGGAG
T7_20811_G11	TGGTGATGGAAGTTTTAGTCTAAGAAGTATGGAGTA
T7_20812_G11	GATAGTAATTGTGGGTAGTCATTGGAATATAGGAGT
T7_20813_G11	TGGAAGAAGTGTTAGTTGTCATTATAAGGAGTGGTA
T7_20814_G11	TTGATTATTATTGAGGGGTCTGATGGAAGAAGAGTA
T7_20815_G11	TGTTGTTATGATGAAGAGTCGTGATGAAGGAAGTAT
T7_20816_G11	TAATATGAGGGGTGGAGGTCAAGAGTATTTTAGTAT
T7_20817_G11	GTAGAAGAAGGGATTATGTCTTTGGGTAAAGGTTAT
T7_20818_G11	ATTAGTAGATTAGTGGTGTCTGTTGAAAAGAGGATG
T7_20819_G11	GAAGATTGATGTGGGAAGTCTATTGTTGTTGAGAAA
T7_20820_G11	GGTAGGTGTAAAATAATGTCAAAGGGTGGTGATTTT
T7_20821_G11	GTTGGAGAATAGTAGGGGTCTTAATGGAATATTTAG
T7_20822_G11	ATGGTTGAGGAGGATTTGTCTTTAGGAATGAAGTAA
T7_20823_G11	TTGGAGGAGGTTGTAGAGTCTAATATTGTAAATGAG
T7_20824_G11	GAGTTATAATTATAGATGTCGATGGTGGTGGTAGAA
T7_20825_G11	TGTATAAAGTTGGAAATGTCAGGAAGTTGTATGGTG
T7_20826_G11	GTAGTAATAGTAATATGGTCTGGGTGGGTTGAAAAT
T7_20827_G11	TGGGATTAATAATAAGTGTCGGTATTATAGTGGGAG
T7_20828_G11	GAGTAGAGATGTGAGTAGTCGGAAGATATATTTGTT
T7_20829_G11	ATAGTGATAGTAGTAAGGTCTAGTAGAGGTATTGGT
T7_20830_G11	AATAATTATGATTGGGGGTCTGTTGGGAAATTGAAG
T7_20831_G11	GAATAATTAGATTGAAGGTCTTGTTGGAGGATTAGG
T7_20832_G11	AAGAGAGAGTAGTATATGTCGGTTAATGTGTGGTTA
T7_20833_G11	TGTTGAAGTAGTGATGGGTCGTAGTTGATAAAGAAT
T7_20834_G11	TATTTTTGGGAGAAGGAGTCTATGGAAGAATTGTAG
T7_20835_G11	GGGTAAGAAGAATAGATGTCGTAGGATTTTAGTTGT
T7_20836_G11	ATTAGATGATGGGAATAGTCTAAAGTGTGTGGTGAT
T7_20837_G11	TTTTGAGGTGGTGAAGTGTCAAATAGAATGAGGTAT
T7_20838_G11	ATGTGTTTGTGTTGAAGGTCAAGAGATATGAAGGAT
T7_20839_G11	TGATTGTAAGAAGAGTAGTCTTGTATAAGGGGATTG
T7_20840_G11	GTTGTGTAAGAAAATGGGTCAGATGATGTTGTAGAT
T7_20841_G11	TTGTTGTTTTGAGAAGTGTCGAGTAGAAGAAATAGG
T7_20842_G11	GATGTAGTATGGTTATAGTCTAGAGGAGAGTATATG
T7_20843_G11	GGTTTTATTTTATTAAGGTCGAGAAAGAAGAGGGGT
T7_20844_G11	TTAATATGGATGATAAAGTCTGAGGATGGTGTGATG
T7_20845_G11	AGTATTATTGAAGGTGTGTCTGTTAGTAGGAAGGAA
T7_20846_G11	TAGTGTAATAGAGATGAGTCAGGAGATGTTTGTTAG
T7_20847_G11	TTTAATAGTTGATTGGTGTCTGAAGGAGGTAGAAGA
T7_20848_G11	TATAGTGGTGAAGAAGAGTCAAGGTTTGTAGATGTT
T7_20849_G11	GAGAAGTTTGAGTATTAGTCAGGTAATTTGGAGGAT
T7_20850_G11	AAAATGTTATGGAGGTTGTCAGGTTAGTAGATGATG
T7_20851_G11	GGTTTTGTTGATTAGTAGTCGAGTAGGAGAAAAGTA
T7_20852_G11	GGTGTTGGTTATAGAAAGTCATAAATAGTTGAGGGT
T7_20853_G11	GGTTAAGGAGGATATTAGTCTTAATTTTAGGGAAGG
T7_20854_G11	GTAATGAGGGAGTAGTTGTCGTTTATTAATAAGGAG
T7_20855_G11	GAGGAGGAGGGTGGAATGTCTAATAATAATTTTTTG
T7_20856_G11	GGGATTGTGGAGGGAAAGTCATTATGTTTATATGAA
T7_20857_G11	AGTGTTGTTGTAGTGGGGTCAGAGATAATTGAATAA
T7_20858_G11	TAAGGAGTAGTAGTGAGGTCGAATTGGTTTATAATG
T7_20859_G11	TGTATATATTGGTGATAGTCGAAGTAGGAGGATAGT
T7_20860_G11	TAATAAGATGAAGAGTGGTCGTGGTAGGAGTTTATT
T7_20861_G11	GTAAGGGTGGGGTGTAAGTCTTTAATAAAGGTATTA
T7_20862_G11	GTTGTAGAATGAAGTAGGTCTGGAGATATGATTTAG
T7_20863_G11	GTATGTAAAGGGAGTATGTCTAAATTTTTGGGGAGA
T7_20864_G11	GTGATTAGATGAAAGATGTCTTGGGAATTAATGGTG
T7_20865_G11	AGAGGAAGAAATTGGGTGTCGTTTTTATTAGTAGGA
T7_20866_G11	AGGGATGATGAGGGTTAGTCATGATGTGTTATTAAA
T7_20867_G11	ATGGTAGTGAGGATAATGTCAGGTATGATATGATGT
T7_20868_G11	AAGGATGATGAGATGATGTCGTTAATTGATGATTGG
T7_20869_G11	TTAATGAGTAGGGTTGTGTCTAAAAGTAGTGATGAG
T7_20870_G11	TTATTGGGTGGTAATAAGTCTATTAAGGAGGATGGA
T7_20871_G11	TAGTTTTTGTAGGAGGGGTCTTATAATAAAAGGAGG
T7_20872_G11	AAAATGTTGTGGTAGTAGTCATAGGAAAGTTGGGTT
T7_20873_G11	TAGGAGAATATGATTATGTCGTTGTTGTGGAGAAAG
T7_20874_G11	TTGAGTTGGATGATAGTGTCAGAAGAAAGTAGTTGT
T7_20875_G11	ATTGAAGTAGTGAGGATGTCTAATGAGTGAGGTATT
T7_20876_G11	TGGTTGTATAATATAGAGTCTGATGATGGAGGAGAT
T7_20877_G11	AATGAGGTTATTATTATGTCGATAGGAGAGGGTGAT
T7_20878_G11	GATGAGGGTGGAGAATGGTCATGATATTAGTATTAT
T7_20879_G11	GTATAGGTTATAAGGAAGTCTATGGTGGTAGTAGAT
T7_20880_G11	TAGAGTGGTGTTATAAAGTCATGTATGGTAAGATGG
T7_20881_G11	TGTAATGATAATAAGGGGTCGGGTGTTATTTAGAAG
T7_20882_G11	GTAGGATAGATGTTTTTGTCGAAGAAGAGTGGATTA
T7_20883_G11	ATAAGAGGGTGTATTTTGTCTAATATGATGGAGGGA
T7_20884_G11	AGGAGTGTAGTTGAGGTGTCATAGTATTTATGAAGA
T7_20885_G11	TGGTTTGGAGGGATGGAGTCGTATTAAATAATAGAT
T7_20886_G11	TTGATTGTGATAAGGAGGTCTAGTTATAAGGAGATG
T7_20887_G11	GTTGTATAAGGATGGTGGTCATGATGTAAGAAAGTT
T7_20888_G11	TAGATGTTTAAAAGGTTGTCGTGAAGGGTAAGGTTA
T7_20889_G11	TAATGATGTGTTGTAGAGTCGGAAGATGATGATGAT
T7_20890_G11	TTTGTAGGGGTAGTTATGTCTAAGAAGAGAAGATGT
T7_20891_G11	AAGGAATAATAGTTGTGGTCGAGTATTAGTGGTGTA
T7_20892_G11	ATAGAAGGTGGATGTTTGTCAATAATAGTTGGTAGG
T7_20893_G11	GTAGTGATAAAATAGTGGTCTTGAGGTGGTAGTAAT
T7_20894_G11	GGAGATGTTAAATGTTGGTCTTGTGATAGAAGAGTA
T7_20895_G11	TTATAAAGATGTAGTAGGTCTGGTGGTGGTTAAGAA
T7_20896_G11	GTTGTATTAGTAGTAGGGTCAAGATTATGAATGAGG
T7_20897_G11	AAGAAGAGTGGGGTTGAGTCTTTGGAGATATTATTA
T7_20898_G11	TTAATAATTTAGTGGATGTCGGGTGGTGTAAGAAAG
T7_20899_G11	ATAATGTAGAAAATGGAGTCGTGGTATTGTTGGAGT
T7_20900_G11	AGGTGGATGTGATGAAGGTCTGTTAATTATAGATGA
T7_20901_G11	TAGAATTGATAGTATTGGTCTGAAGAGGATGGTGAT
T7_20902_G11	ATAGTAGAATTAGGATGGTCGAATTATTGTTGGAGG
T7_20903_G11	TGTAATAAATAATGAGGGTCGGGTGTTATTGTGAAG
T7_20904_G11	GGTTTTAGTTGATATGAGTCTGATGAAGATGAAGAG
T7_20905_G11	GAGTAGATTATATTGTAGTCATGAGTGGTTGAAGAG
T7_20906_G11	GAAATGGTGTTGAATATGTCGATGTGGGGTATAATA
T7_20907_G11	AAGTGGTAGGAAATTGTGTCTAGTTGTTGTAAAGAG
T7_20908_G11	AAGGATGATGTGGTGTAGTCGTGATGTAAATAATTG
T7_20909_G11	AGTGGTGGTTAATAGTTGTCGAGGAATATGAGAATT
T7_20910_G11	GAGTGTGGAGTAGTAAGGTCATGTGTGATTTAATAA
T7_20911_G11	TTATTTGAGGAGGGTGAGTCATGATGTTATAAGAAG
T7_20912_G11	AAGAAGAATTATTGGAGGTCGTTGTGGGTAGTTTAA
T7_20913_G11	TGTGTTGAAGAATTGATGTCAATAGAAGAGGTGGTT
T7_20914_G11	ATGATTAATGTGGTGGTGTCTTAAGGTGAAGAATGA
T7_20915_G11	AATTGTAAGAAAGTTGGGTCTTTGAAGGATGGTATG
T7_20916_G11	AGTAAAGTGTTGGGTTTGTCAATGTAAGATTAGAGG
T7_20917_G11	TTGATAGAAATAGTAGGGTCTGAAGAATTGTTGGTG
T7_20918_G11	ATAAATGTAGGTGTTGTGTCTATAAGAGGAGGATTG
T7_20919_G11	GAAATAGTGGTTATGATGTCGATGAAGTGTTTAAGG
T7_20920_G11	GGTAATTATGGTTGAATGTCGAGGAATTAGTAGTAG
T7_20921_G11	ATTATTAAAGATGGGTTGTCGAAATAGTGGTGAGGT
T7_20922_G11	GGAAAATAATGAAGAGGGTCAGGGTGTTTTTTATTG
T7_20923_G11	TAAAAGAGGAGTATGATGTCGGAGGATGTTTATGTT
T7_20924_G11	GTAGTTATTAAAGTAGAGTCGGAGGTGGTTATGATA
T7_20925_G11	GGATAATGTGTTTTTGAGTCGATAAAGAGAGAGTTG
T7_20926_G11	GTTATAAGAATGATAAGGTCTTAGTAGTGGTTGAGG
T7_20927_G11	GAAGTAGAATATTGTGGGTCGATGAATTGATGTTGA
T7_20928_G11	TTGTAGAGGTAAATGAGGTCGGGAATATTAGTTGAT
T7_20929_G11	GGTAGTAATTAATATAGGTCGTGGAGATGGTGATAT
T7_20930_G11	GTGAGGAAGAATAGAGTGTCATTATGAAGTTTGTTG
T7_20931_G11	GATGGATATGGTTGATAGTCATAGTAGTAGTGATGA
T7_20932_G11	TGTGGGAGAATATATATGTCTGGAGTATTAGAAGGT
T7_20933_G11	AGTAGTGGTGAAGAGGGGTCTGTTGATATAAATTAT
T7_20934_G11	GGAGAAGTATAATTAGTGTCAGGGGTTAAGTTGTTA
T7_20935_G11	GAATAAAGGATTGGTATGTCTGTTTGGTAGGAGAAT
T7_20936_G11	TGAAGAAATGGAGTTTAGTCAGGGGTGATTAATTGT
T7_20937_G11	AAGAGATTGTTGGAAGTGTCGAATGTGGTATTATGA
T7_20938_G11	GTGAGTAGTTTTGTAGGGTCTGGAAGATGAATATAA
T7_20939_G11	TTGATTATGGTGGAGTAGTCTGATATAGGAAGGTAA
T7_20940_G11	AGTAATGAGTAAAGTGGGTCTATGGTGTTTAAGTAG
T7_20941_G11	GGAGAAATGATGAAAATGTCTGTGGTGTGGATTTAT
T7_20942_G11	TGGATGGAAGAAAGTAGGTCTATTGAGTAATTTGTG
T7_20943_G11	TAGGGTATTTATTATGAGTCTGAGGAGGAAGTAATG
T7_20944_G11	TTGTTTGATAAGGAGGTGTCAGAAGGTGATTATAAG
T7_20945_G11	TAATTTTAATGAGTGGTGTCATAATAGTGGGAGGGA
T7_20946_G11	TGTGGTTGATTAATTGGGTCAGGGGTATAAAGAAAT
T7_20947_G11	GGTTGATGAAATTATTAGTCGAATTAGGATGAGGTG
T7_20948_G11	TTGTAGTGTTGATGAGGGTCTGTTGAAATAGAGAAA
T7_20949_G11	GATGATAAGATGATGATGTCGATGAGGTTGTTAATG
T7_20950_G11	TTGAGGATTATGAAGTGGTCGAAGAAGATTATGGTT
T7_20951_G11	TATATAATGATTTGGAGGTCATAGTAGATGTGGGGA
T7_20952_G11	AATGATGGTTATAAGGTGTCTAGAGGTTGAATGATG
T7_20953_G11	TTTATGAGGATTGATGTGTCTGATAAGAAGATGGGA
T7_20954_G11	TATGATTGGAGGATGATGTCAGGGGTGTAATAATTA
T7_20955_G11	GTTATTAGTATGAGGGAGTCTTAGAGAAGATGATTG
T7_20956_G11	AAAGTAGTGGTGGAAAGGTCGTATATTATTATGGTG
T7_20957_G11	GTAGATGGAGAAGATTAGTCGGA