#ID = Agilent feature number
#SPOT_ID = 
#ACCESSION_STRING = 
#miRNA_ID = 
#miRNA_ID = 
#CHROMOSOMAL_LOCATION = 
#SEQUENCE = 
ID	SPOT_ID	ACCESSION_STRING	miRNA_ID	miRNA_ID	CHROMOSOMAL_LOCATION	SEQUENCE
A_38_P00001000	A_38_P00001000	mir|aga-miR-1891|mir|MIMAT0007862	aga-miR-1891	MIMAT0007862	unmapped	CGCTCGGGTTTTCCCGAGCGGAAAACACGCAAATTAACTTTTTTTTTTT
A_38_P00001001	A_38_P00001001	mir|aga-miR-1891|mir|MIMAT0007862	aga-miR-1891	MIMAT0007862	unmapped	CGCTCGGGTTTTCCCGAGCGGAAAACACGCAAATTAACTCTATTTTTTTT
A_38_P00001004	A_38_P00001004	mir|aga-bantam|mir|MIMAT0001494	aga-bantam	MIMAT0001494	unmapped	CGCTCGGGTTTTCCCGAGCGGAATCAGCTTTCAAAGTGAATTTTTTTTT
A_38_P00001005	A_38_P00001005	mir|aga-bantam|mir|MIMAT0001494	aga-bantam	MIMAT0001494	unmapped	CGCTCGGGTTTTCCCGAGCGGAATCAGCTTTCAAAGTGATTATTTTTTTT
A_38_P00001006	A_38_P00001006	mir|aga-bantam|mir|MIMAT0001494	aga-bantam	MIMAT0001494	unmapped	CGCTCGGGTTTTCCCGAGCGGAATCAGCTTTCAAAGTGATCATTTTTTTTT
A_38_P00001011	A_38_P00001011	mir|aga-miR-87|mir|MIMAT0007858	aga-miR-87	MIMAT0007858	unmapped	CGCTCGGGTTTTCCCGAGCGGACACCTGAATATTTGCTCTTTTTTTTTT
A_38_P00001012	A_38_P00001012	mir|aga-miR-87|mir|MIMAT0007858	aga-miR-87	MIMAT0007858	unmapped	CGCTCGGGTTTTCCCGAGCGGACACCTGAATATTTGCTCATTTTTTTTTT
A_38_P00001013	A_38_P00001013	mir|aga-miR-282|mir|MIMAT0001514	aga-miR-282	MIMAT0001514	unmapped	CGCTCGGGTTTTCCCGAGCGGACAGACAAAGCCTAGAATTTTTTTTTT
A_38_P00001014	A_38_P00001014	mir|aga-miR-282|mir|MIMAT0001514	aga-miR-282	MIMAT0001514	unmapped	CGCTCGGGTTTTCCCGAGCGGACAGACAAAGCCTAGAAGTTTTTTTTTT
A_38_P00001017	A_38_P00001017	mir|aga-miR-34|mir|MIMAT0005526	aga-miR-34	MIMAT0005526	unmapped	CGCTCGGGTTTTCCCGAGCGGACCAGCTAACCACACATTTTTTTTT
A_38_P00001018	A_38_P00001018	mir|aga-miR-34|mir|MIMAT0005526	aga-miR-34	MIMAT0005526	unmapped	CGCTCGGGTTTTCCCGAGCGGACCAGCTAACCACACTTTTTTTTTTT
A_38_P00001023	A_38_P00001023	mir|aga-let-7|mir|MIMAT0001495	aga-let-7	MIMAT0001495	unmapped	CGCTCGGGTTTTCCCGAGCGGACTATACAACCAACTACCTTTTTTTTTTT
A_38_P00001024	A_38_P00001024	mir|aga-let-7|mir|MIMAT0001495	aga-let-7	MIMAT0001495	unmapped	CGCTCGGGTTTTCCCGAGCGGACTATACAACCAACTACCTCTTTTTTTTTT
A_38_P00001027	A_38_P00001027	mir|aga-miR-317|mir|MIMAT0001522	aga-miR-317	MIMAT0001522	unmapped	CGCTCGGGTTTTCCCGAGCGGACTGAGATACCACCAGTATTTTTTTT
A_38_P00001028	A_38_P00001028	mir|aga-miR-317|mir|MIMAT0001522	aga-miR-317	MIMAT0001522	unmapped	CGCTCGGGTTTTCCCGAGCGGACTGAGATACCACCAGAATTTTTTTTT
A_38_P00001032	A_38_P00001032	mir|aga-miR-1890|mir|MIMAT0007861	aga-miR-1890	MIMAT0007861	unmapped	CGCTCGGGTTTTCCCGAGCGGAGACCTAATCAAAGATTTCTTTTTTTTTT
A_38_P00001033	A_38_P00001033	mir|aga-miR-1890|mir|MIMAT0007861	aga-miR-1890	MIMAT0007861	unmapped	CGCTCGGGTTTTCCCGAGCGGAGACCTAATCAAAGATTTCATTTTTTTTTT
A_38_P00001034	A_38_P00001034	mir|aga-miR-996|mir|MIMAT0005528	aga-miR-996	MIMAT0005528	unmapped	CGCTCGGGTTTTCCCGAGCGGAGACGAGCATGTAATCTTTTTTTTTTT
A_38_P00001035	A_38_P00001035	mir|aga-miR-996|mir|MIMAT0005528	aga-miR-996	MIMAT0005528	unmapped	CGCTCGGGTTTTCCCGAGCGGAGACGAGCATGTAATCTATATTTTTTTT
A_38_P00001036	A_38_P00001036	mir|aga-miR-996|mir|MIMAT0005528	aga-miR-996	MIMAT0005528	unmapped	CGCTCGGGTTTTCCCGAGCGGAGACGAGCATGTAATCTAGATTTTTTTTT
A_38_P00001039	A_38_P00001039	mir|aga-miR-11|mir|MIMAT0007856	aga-miR-11	MIMAT0007856	unmapped	CGCTCGGGTTTTCCCGAGCGGAGCAAGAACTCAGACTTATTTTTTTT
A_38_P00001040	A_38_P00001040	mir|aga-miR-11|mir|MIMAT0007856	aga-miR-11	MIMAT0007856	unmapped	CGCTCGGGTTTTCCCGAGCGGAGCAAGAACTCAGACTGATTTTTTTTT
A_38_P00001041	A_38_P00001041	mir|aga-miR-281|mir|MIMAT0001513	aga-miR-281	MIMAT0001513	unmapped	CGCTCGGGTTTTCCCGAGCGGATAAAGAGAGCAATTCCATTTTTTTTTTT
A_38_P00001042	A_38_P00001042	mir|aga-miR-281|mir|MIMAT0001513	aga-miR-281	MIMAT0001513	unmapped	CGCTCGGGTTTTCCCGAGCGGATAAAGAGAGCAATTCCATGTTTTTTTTTT
A_38_P00001053	A_38_P00001053	mir|aga-miR-981|mir|MIMAT0007857	aga-miR-981	MIMAT0007857	unmapped	CGCTCGGGTTTTCCCGAGCGGCAGGTTTCGTCGACTTTTTTTTTT
A_38_P00001054	A_38_P00001054	mir|aga-miR-981|mir|MIMAT0007857	aga-miR-981	MIMAT0007857	unmapped	CGCTCGGGTTTTCCCGAGCGGCAGGTTTCGTCGACATTTTTTTTTT
A_38_P00001057	A_38_P00001057	mir|aga-miR-1174|mir|MIMAT0005524	aga-miR-1174	MIMAT0005524	unmapped	CGCTCGGGTTTTCCCGAGCGGCATGGGTATGAAGTAGAATTTTTTTTT
A_38_P00001058	A_38_P00001058	mir|aga-miR-1174|mir|MIMAT0005524	aga-miR-1174	MIMAT0005524	unmapped	CGCTCGGGTTTTCCCGAGCGGCATGGGTATGAAGTAGATTATTTTTTTT
A_38_P00001059	A_38_P00001059	mir|aga-miR-1174|mir|MIMAT0005524	aga-miR-1174	MIMAT0005524	unmapped	CGCTCGGGTTTTCCCGAGCGGCATGGGTATGAAGTAGATCATTTTTTTTT
A_38_P00001060	A_38_P00001060	mir|aga-miR-184|mir|MIMAT0001504	aga-miR-184	MIMAT0001504	unmapped	CGCTCGGGTTTTCCCGAGCGGCCCTTATCAGTTCTCCTATTTTTTTT
A_38_P00001061	A_38_P00001061	mir|aga-miR-184|mir|MIMAT0001504	aga-miR-184	MIMAT0001504	unmapped	CGCTCGGGTTTTCCCGAGCGGCCCTTATCAGTTCTCCGATTTTTTTTT
A_38_P00001064	A_38_P00001064	mir|aga-miR-308|mir|MIMAT0001520	aga-miR-308	MIMAT0001520	unmapped	CGCTCGGGTTTTCCCGAGCGGCTCACAGTATACTCCTGATTTTTTTTT
A_38_P00001065	A_38_P00001065	mir|aga-miR-308|mir|MIMAT0001520	aga-miR-308	MIMAT0001520	unmapped	CGCTCGGGTTTTCCCGAGCGGCTCACAGTATACTCCTGTTTTTTTTTTT
A_38_P00001070	A_38_P00001070	mir|aga-miR-306|mir|MIMAT0005530	aga-miR-306	MIMAT0005530	unmapped	CGCTCGGGTTTTCCCGAGCGGCTGAGAGTCATCCAGTTTTTTTTTTT
A_38_P00001071	A_38_P00001071	mir|aga-miR-306|mir|MIMAT0005530	aga-miR-306	MIMAT0005530	unmapped	CGCTCGGGTTTTCCCGAGCGGCTGAGAGTCATCCAGTATTTTTTTTTT
A_38_P00001081	A_38_P00001081	mir|aga-miR-989|mir|MIMAT0005529	aga-miR-989	MIMAT0005529	unmapped	CGCTCGGGTTTTCCCGAGCGGGTACCACTACGTCACTATTTTTTTT
A_38_P00001082	A_38_P00001082	mir|aga-miR-989|mir|MIMAT0005529	aga-miR-989	MIMAT0005529	unmapped	CGCTCGGGTTTTCCCGAGCGGGTACCACTACGTCACAATTTTTTTTT
A_38_P00001085	A_38_P00001085	mir|aga-miR-375|mir|MIMAT0007860	aga-miR-375	MIMAT0007860	unmapped	CGCTCGGGTTTTCCCGAGCGGTAACTCGAGCCAAACTTTTTTTTTT
A_38_P00001086	A_38_P00001086	mir|aga-miR-375|mir|MIMAT0007860	aga-miR-375	MIMAT0007860	unmapped	CGCTCGGGTTTTCCCGAGCGGTAACTCGAGCCAAACGTTTTTTTTTT
A_38_P00001087	A_38_P00001087	mir|aga-miR-1889|mir|MIMAT0007859	aga-miR-1889	MIMAT0007859	unmapped	CGCTCGGGTTTTCCCGAGCGGTAATCCCAATCTGTAATGTTATTTTTTTT
A_38_P00001088	A_38_P00001088	mir|aga-miR-1889|mir|MIMAT0007859	aga-miR-1889	MIMAT0007859	unmapped	CGCTCGGGTTTTCCCGAGCGGTAATCCCAATCTGTAATGTGATTTTTTTTT
A_38_P00001089	A_38_P00001089	mir|aga-miR-210|mir|MIMAT0001505	aga-miR-210	MIMAT0001505	unmapped	CGCTCGGGTTTTCCCGAGCGGTAGCCGTTGTCACACTTTTTTTTTT
A_38_P00001090	A_38_P00001090	mir|aga-miR-210|mir|MIMAT0001505	aga-miR-210	MIMAT0001505	unmapped	CGCTCGGGTTTTCCCGAGCGGTAGCCGTTGTCACACGTTTTTTTTTT
A_38_P00001091	A_38_P00001091	mir|aga-miR-276-5p|mir|MIMAT0001509	aga-miR-276-5p	MIMAT0001509	unmapped	CGCTCGGGTTTTCCCGAGCGGTAGGAACTCTATACCTCGTATTTTTTTT
A_38_P00001092	A_38_P00001092	mir|aga-miR-276-5p|mir|MIMAT0001509	aga-miR-276-5p	MIMAT0001509	unmapped	CGCTCGGGTTTTCCCGAGCGGTAGGAACTCTATACCTCGCATTTTTTTTT
A_38_P00001107	A_38_P00001107	mir|aga-miR-1175|mir|MIMAT0005525	aga-miR-1175	MIMAT0005525	unmapped	CGCTCGGGTTTTCCCGAGCGGTTAAGTCGGAGAAGTAGATATTTTTTTT
A_38_P00001108	A_38_P00001108	mir|aga-miR-1175|mir|MIMAT0005525	aga-miR-1175	MIMAT0005525	unmapped	CGCTCGGGTTTTCCCGAGCGGTTAAGTCGGAGAAGTAGAAATTTTTTTTT
A_38_P00002436	A_38_P00002436	mir|dme-miR-6-3p|mir|MIMAT0000111|mir|dme-miR-6_v16.0|mir|MIMAT0000111	dme-miR-6-3p	MIMAT0000111	unmapped	CGCTCGGGTTTTCCCGAGCGGAAAAAGAACAGCCACTGATTTTTTTTT
A_38_P00002437	A_38_P00002437	mir|dme-miR-6-3p|mir|MIMAT0000111|mir|dme-miR-6_v16.0|mir|MIMAT0000111	dme-miR-6-3p	MIMAT0000111	unmapped	CGCTCGGGTTTTCCCGAGCGGAAAAAGAACAGCCACTGTTTTTTTTTTT
A_38_P00002438	A_38_P00002438	mir|dme-miR-969-5p|mir|MIMAT0005485|mir|dme-miR-969_v16.0|mir|MIMAT0005485	dme-miR-969-5p	MIMAT0005485	unmapped	CGCTCGGGTTTTCCCGAGCGGAAAACTTGCTTAGTGGAATATTTTTTTT
A_38_P00002439	A_38_P00002439	mir|dme-miR-969-5p|mir|MIMAT0005485|mir|dme-miR-969_v16.0|mir|MIMAT0005485	dme-miR-969-5p	MIMAT0005485	unmapped	CGCTCGGGTTTTCCCGAGCGGAAAACTTGCTTAGTGGAACATTTTTTTTT
A_38_P00002440	A_38_P00002440	mir|dme-miR-973-5p|mir|MIMAT0005489|mir|dme-miR-973_v16.0|mir|MIMAT0005489	dme-miR-973-5p	MIMAT0005489	unmapped	CGCTCGGGTTTTCCCGAGCGGAAAATCGAAGTTCAACCTTTTTTTTTT
A_38_P00002441	A_38_P00002441	mir|dme-miR-973-5p|mir|MIMAT0005489|mir|dme-miR-973_v16.0|mir|MIMAT0005489	dme-miR-973-5p	MIMAT0005489	unmapped	CGCTCGGGTTTTCCCGAGCGGAAAATCGAAGTTCAACCATTTTTTTTTT
A_38_P00002442	A_38_P00002442	mir|dme-miR-278-3p|mir|MIMAT0000339|mir|dme-miR-278_v16.0|mir|MIMAT0000339	dme-miR-278-3p	MIMAT0000339	unmapped	CGCTCGGGTTTTCCCGAGCGGAAACGGACGAAAGTCTTTTTTTTTT
A_38_P00002443	A_38_P00002443	mir|dme-miR-278-3p|mir|MIMAT0000339|mir|dme-miR-278_v16.0|mir|MIMAT0000339	dme-miR-278-3p	MIMAT0000339	unmapped	CGCTCGGGTTTTCCCGAGCGGAAACGGACGAAAGTCCTTTTTTTTTT
A_38_P00002444	A_38_P00002444	mir|dme-miR-310-3p|mir|MIMAT0000402|mir|dme-miR-310_v16.0|mir|MIMAT0000402	dme-miR-310-3p	MIMAT0000402	unmapped	CGCTCGGGTTTTCCCGAGCGGAAAGGCCGGGAAGTTATTTTTTTT
A_38_P00002445	A_38_P00002445	mir|dme-miR-310-3p|mir|MIMAT0000402|mir|dme-miR-310_v16.0|mir|MIMAT0000402	dme-miR-310-3p	MIMAT0000402	unmapped	CGCTCGGGTTTTCCCGAGCGGAAAGGCCGGGAAGTGATTTTTTTTT
A_38_P00002446	A_38_P00002446	mir|dme-miR-958-3p|mir|MIMAT0005471|mir|dme-miR-958_v16.0|mir|MIMAT0005471	dme-miR-958-3p	MIMAT0005471	unmapped	CGCTCGGGTTTTCCCGAGCGGAAAGTAGAATAGAAGAATCTCTTTTTTTTTT
A_38_P00002447	A_38_P00002447	mir|dme-miR-958-3p|mir|MIMAT0005471|mir|dme-miR-958_v16.0|mir|MIMAT0005471	dme-miR-958-3p	MIMAT0005471	unmapped	CGCTCGGGTTTTCCCGAGCGGAAAGTAGAATAGAAGAATCTCATTTTTTTTTT
A_38_P00002448	A_38_P00002448	mir|dme-miR-984-5p|mir|MIMAT0005500|mir|dme-miR-984_v16.0|mir|MIMAT0005500	dme-miR-984-5p	MIMAT0005500	unmapped	CGCTCGGGTTTTCCCGAGCGGAAATTCCAACCGTATTTACTATTTTTTTT
A_38_P00002449	A_38_P00002449	mir|dme-miR-984-5p|mir|MIMAT0005500|mir|dme-miR-984_v16.0|mir|MIMAT0005500	dme-miR-984-5p	MIMAT0005500	unmapped	CGCTCGGGTTTTCCCGAGCGGAAATTCCAACCGTATTTACCATTTTTTTTT
A_38_P00002450	A_38_P00002450	mir|dme-miR-995-3p|mir|MIMAT0005514|mir|dme-miR-995_v16.0|mir|MIMAT0005514	dme-miR-995-3p	MIMAT0005514	unmapped	CGCTCGGGTTTTCCCGAGCGGAAGCCGAATCATGTGTATTTTTTTT
A_38_P00002451	A_38_P00002451	mir|dme-miR-995-3p|mir|MIMAT0005514|mir|dme-miR-995_v16.0|mir|MIMAT0005514	dme-miR-995-3p	MIMAT0005514	unmapped	CGCTCGGGTTTTCCCGAGCGGAAGCCGAATCATGTGGATTTTTTTTT
A_38_P00002452	A_38_P00002452	mir|dme-miR-965-3p|mir|MIMAT0005480|mir|dme-miR-965_v16.0|mir|MIMAT0005480	dme-miR-965-3p	MIMAT0005480	unmapped	CGCTCGGGTTTTCCCGAGCGGAAGGGGAAAAGCTATACTTTTTTTTTT
A_38_P00002453	A_38_P00002453	mir|dme-miR-965-3p|mir|MIMAT0005480|mir|dme-miR-965_v16.0|mir|MIMAT0005480	dme-miR-965-3p	MIMAT0005480	unmapped	CGCTCGGGTTTTCCCGAGCGGAAGGGGAAAAGCTATACGTATTTTTTTT
A_38_P00002454	A_38_P00002454	mir|dme-miR-964-5p|mir|MIMAT0005478|mir|dme-miR-964_v16.0|mir|MIMAT0005478	dme-miR-964-5p	MIMAT0005478	unmapped	CGCTCGGGTTTTCCCGAGCGGAAGTTAAGCTCCCCTATTTATTTTTTTT
A_38_P00002455	A_38_P00002455	mir|dme-miR-964-5p|mir|MIMAT0005478|mir|dme-miR-964_v16.0|mir|MIMAT0005478	dme-miR-964-5p	MIMAT0005478	unmapped	CGCTCGGGTTTTCCCGAGCGGAAGTTAAGCTCCCCTATTCATTTTTTTTT
A_38_P00002456	A_38_P00002456	mir|dme-miR-974-5p|mir|MIMAT0005490|mir|dme-miR-974_v16.0|mir|MIMAT0005490	dme-miR-974-5p	MIMAT0005490	unmapped	CGCTCGGGTTTTCCCGAGCGGAATACTACTTCTTTGCTCGTATTTTTTTT
A_38_P00002457	A_38_P00002457	mir|dme-miR-974-5p|mir|MIMAT0005490|mir|dme-miR-974_v16.0|mir|MIMAT0005490	dme-miR-974-5p	MIMAT0005490	unmapped	CGCTCGGGTTTTCCCGAGCGGAATACTACTTCTTTGCTCGCAATTTTTTTT
A_38_P00002458	A_38_P00002458	mir|dme-bantam-3p|mir|MIMAT0000365|mir|dme-bantam_v16.0|mir|MIMAT0000365	dme-bantam-3p	MIMAT0000365	unmapped	CGCTCGGGTTTTCCCGAGCGGAATCAGCTTTCAAAATGATTATTTTTTTT
A_38_P00002459	A_38_P00002459	mir|dme-bantam-3p|mir|MIMAT0000365|mir|dme-bantam_v16.0|mir|MIMAT0000365	dme-bantam-3p	MIMAT0000365	unmapped	CGCTCGGGTTTTCCCGAGCGGAATCAGCTTTCAAAATGATCATTTTTTTTT
A_38_P00002460	A_38_P00002460	mir|dme-miR-956-3p|mir|MIMAT0005469|mir|dme-miR-956_v16.0|mir|MIMAT0005469	dme-miR-956-3p	MIMAT0005469	unmapped	CGCTCGGGTTTTCCCGAGCGGAATGGATTAGAGTGGTCTTTTTTTTTTT
A_38_P00002461	A_38_P00002461	mir|dme-miR-956-3p|mir|MIMAT0005469|mir|dme-miR-956_v16.0|mir|MIMAT0005469	dme-miR-956-3p	MIMAT0005469	unmapped	CGCTCGGGTTTTCCCGAGCGGAATGGATTAGAGTGGTCTCTTTTTTTTTT
A_38_P00002462	A_38_P00002462	mir|dme-miR-281-3p|mir|MIMAT0000345|mir|dme-miR-281_v16.0|mir|MIMAT0000345	dme-miR-281-3p	MIMAT0000345	unmapped	CGCTCGGGTTTTCCCGAGCGGACAAAGAGAGCAATTCCTATTTTTTTT
A_38_P00002463	A_38_P00002463	mir|dme-miR-281-3p|mir|MIMAT0000345|mir|dme-miR-281_v16.0|mir|MIMAT0000345	dme-miR-281-3p	MIMAT0000345	unmapped	CGCTCGGGTTTTCCCGAGCGGACAAAGAGAGCAATTCCAATTTTTTTTT
A_38_P00002464	A_38_P00002464	mir|dme-miR-10_v13.0|mir|MIMAT0000115	dme-miR-10_v13.0	MIMAT0000115	unmapped	CGCTCGGGTTTTCCCGAGCGGACAAATTCGGATCTACAGTTTTTTTTTT
A_38_P00002465	A_38_P00002465	mir|dme-miR-10_v13.0|mir|MIMAT0000115	dme-miR-10_v13.0	MIMAT0000115	unmapped	CGCTCGGGTTTTCCCGAGCGGACAAATTCGGATCTACAGGTATTTTTTTT
A_38_P00002466	A_38_P00002466	mir|dme-miR-7-5p|mir|MIMAT0000112|mir|dme-miR-7_v16.0|mir|MIMAT0000112	dme-miR-7-5p	MIMAT0000112	unmapped	CGCTCGGGTTTTCCCGAGCGGACAACAAAATCACTAGTCTTCTTTTTTTTTT
A_38_P00002467	A_38_P00002467	mir|dme-miR-7-5p|mir|MIMAT0000112|mir|dme-miR-7_v16.0|mir|MIMAT0000112	dme-miR-7-5p	MIMAT0000112	unmapped	CGCTCGGGTTTTCCCGAGCGGACAACAAAATCACTAGTCTTCCTTTTTTTTTT
A_38_P00002468	A_38_P00002468	mir|dme-miR-954-5p|mir|MIMAT0005465|mir|dme-miR-954_v16.0|mir|MIMAT0005465	dme-miR-954-5p	MIMAT0005465	unmapped	CGCTCGGGTTTTCCCGAGCGGACACACAACGCAACATTTTTTTTTT
A_38_P00002469	A_38_P00002469	mir|dme-miR-954-5p|mir|MIMAT0005465|mir|dme-miR-954_v16.0|mir|MIMAT0005465	dme-miR-954-5p	MIMAT0005465	unmapped	CGCTCGGGTTTTCCCGAGCGGACACACAACGCAACACTTTTTTTTTT
A_38_P00002470	A_38_P00002470	mir|dme-miR-282-5p|mir|MIMAT0000346|mir|dme-miR-282_v16.0|mir|MIMAT0000346|mir|dme-miR-282-5p_v17.0|mir|MIMAT0000346	dme-miR-282-5p	MIMAT0000346	unmapped	CGCTCGGGTTTTCCCGAGCGGACAGACAAAGCCTAGTATTTTTTTTTT
A_38_P00002471	A_38_P00002471	mir|dme-miR-282-5p|mir|MIMAT0000346|mir|dme-miR-282_v16.0|mir|MIMAT0000346|mir|dme-miR-282-5p_v17.0|mir|MIMAT0000346	dme-miR-282-5p	MIMAT0000346	unmapped	CGCTCGGGTTTTCCCGAGCGGACAGACAAAGCCTAGTAGTTTTTTTTTT
A_38_P00002472	A_38_P00002472	mir|dme-miR-282-5p|mir|MIMAT0000346|mir|dme-miR-282_v16.0|mir|MIMAT0000346|mir|dme-miR-282-5p_v17.0|mir|MIMAT0000346	dme-miR-282-5p	MIMAT0000346	unmapped	CGCTCGGGTTTTCCCGAGCGGACAGACAAAGCCTAGTAGATTTTTTTTTT
A_38_P00002473	A_38_P00002473	mir|dme-miR-133-3p|mir|MIMAT0000340|mir|dme-miR-133_v16.0|mir|MIMAT0000340	dme-miR-133-3p	MIMAT0000340	unmapped	CGCTCGGGTTTTCCCGAGCGGACAGCTGGTTGAAGGTTTTTTTTTT
A_38_P00002474	A_38_P00002474	mir|dme-miR-133-3p|mir|MIMAT0000340|mir|dme-miR-133_v16.0|mir|MIMAT0000340	dme-miR-133-3p	MIMAT0000340	unmapped	CGCTCGGGTTTTCCCGAGCGGACAGCTGGTTGAAGGGTTTTTTTTTT
A_38_P00002475	A_38_P00002475	mir|dme-miR-12-5p|mir|MIMAT0000117|mir|dme-miR-12_v16.0|mir|MIMAT0000117	dme-miR-12-5p	MIMAT0000117	unmapped	CGCTCGGGTTTTCCCGAGCGGACCAGTACCTGATGTAAATTTTTTTTT
A_38_P00002476	A_38_P00002476	mir|dme-miR-12-5p|mir|MIMAT0000117|mir|dme-miR-12_v16.0|mir|MIMAT0000117	dme-miR-12-5p	MIMAT0000117	unmapped	CGCTCGGGTTTTCCCGAGCGGACCAGTACCTGATGTAATTTTTTTTTTT
A_38_P00002477	A_38_P00002477	mir|dme-miR-12-5p|mir|MIMAT0000117|mir|dme-miR-12_v16.0|mir|MIMAT0000117	dme-miR-12-5p	MIMAT0000117	unmapped	CGCTCGGGTTTTCCCGAGCGGACCAGTACCTGATGTAATATATTTTTTTT
A_38_P00002478	A_38_P00002478	mir|dme-miR-12-5p|mir|MIMAT0000117|mir|dme-miR-12_v16.0|mir|MIMAT0000117	dme-miR-12-5p	MIMAT0000117	unmapped	CGCTCGGGTTTTCCCGAGCGGACCAGTACCTGATGTAATACATTTTTTTTT
A_38_P00002479	A_38_P00002479	mir|dme-miR-303-5p|mir|MIMAT0000388|mir|dme-miR-303_v16.0|mir|MIMAT0000388	dme-miR-303-5p	MIMAT0000388	unmapped	CGCTCGGGTTTTCCCGAGCGGACCAGTTTCCTGTGAATTTTTTTTTT
A_38_P00002480	A_38_P00002480	mir|dme-miR-303-5p|mir|MIMAT0000388|mir|dme-miR-303_v16.0|mir|MIMAT0000388	dme-miR-303-5p	MIMAT0000388	unmapped	CGCTCGGGTTTTCCCGAGCGGACCAGTTTCCTGTGAAATTTTTTTTTT
A_38_P00002481	A_38_P00002481	mir|dme-let-7-5p|mir|MIMAT0000396|mir|dme-let-7_v16.0|mir|MIMAT0000396	dme-let-7-5p	MIMAT0000396	unmapped	CGCTCGGGTTTTCCCGAGCGGACTATACAACCTACTACCTTTTTTTTTTT
A_38_P00002482	A_38_P00002482	mir|dme-let-7-5p|mir|MIMAT0000396|mir|dme-let-7_v16.0|mir|MIMAT0000396	dme-let-7-5p	MIMAT0000396	unmapped	CGCTCGGGTTTTCCCGAGCGGACTATACAACCTACTACCTCTTTTTTTTTT
A_38_P00002483	A_38_P00002483	mir|dme-miR-13a-3p|mir|MIMAT0000118|mir|dme-miR-13a_v16.0|mir|MIMAT0000118	dme-miR-13a-3p	MIMAT0000118	unmapped	CGCTCGGGTTTTCCCGAGCGGACTCATCAAAATGGCTGATTTTTTTTT
A_38_P00002484	A_38_P00002484	mir|dme-miR-13a-3p|mir|MIMAT0000118|mir|dme-miR-13a_v16.0|mir|MIMAT0000118	dme-miR-13a-3p	MIMAT0000118	unmapped	CGCTCGGGTTTTCCCGAGCGGACTCATCAAAATGGCTGTTTTTTTTTTT
A_38_P00002485	A_38_P00002485	mir|dme-miR-13b-3p|mir|MIMAT0000119|mir|dme-miR-13b_v16.0|mir|MIMAT0000119	dme-miR-13b-3p	MIMAT0000119	unmapped	CGCTCGGGTTTTCCCGAGCGGACTCGTCAAAATGGCTTATTTTTTTT
A_38_P00002486	A_38_P00002486	mir|dme-miR-13b-3p|mir|MIMAT0000119|mir|dme-miR-13b_v16.0|mir|MIMAT0000119	dme-miR-13b-3p	MIMAT0000119	unmapped	CGCTCGGGTTTTCCCGAGCGGACTCGTCAAAATGGCTGATTTTTTTTT
A_38_P00002487	A_38_P00002487	mir|dme-miR-1000-5p|mir|MIMAT0005520|mir|dme-miR-1000_v16.0|mir|MIMAT0005520	dme-miR-1000-5p	MIMAT0005520	unmapped	CGCTCGGGTTTTCCCGAGCGGACTGCTGTGACAGGATTTTTTTTTT
A_38_P00002488	A_38_P00002488	mir|dme-miR-1000-5p|mir|MIMAT0005520|mir|dme-miR-1000_v16.0|mir|MIMAT0005520	dme-miR-1000-5p	MIMAT0005520	unmapped	CGCTCGGGTTTTCCCGAGCGGACTGCTGTGACAGGACTTTTTTTTTT
A_38_P00002489	A_38_P00002489	mir|dme-miR-317-3p|mir|MIMAT0000409|mir|dme-miR-317_v16.0|mir|MIMAT0000409	dme-miR-317-3p	MIMAT0000409	unmapped	CGCTCGGGTTTTCCCGAGCGGACTGGATACCACCAGTATTTTTTTT
A_38_P00002490	A_38_P00002490	mir|dme-miR-317-3p|mir|MIMAT0000409|mir|dme-miR-317_v16.0|mir|MIMAT0000409	dme-miR-317-3p	MIMAT0000409	unmapped	CGCTCGGGTTTTCCCGAGCGGACTGGATACCACCAGCATTTTTTTTT
A_38_P00002491	A_38_P00002491	mir|dme-miR-281-1-5p|mir|MIMAT0000344|mir|dme-miR-281-1*_v16.0|mir|MIMAT0000344	dme-miR-281-1-5p	MIMAT0000344	unmapped	CGCTCGGGTTTTCCCGAGCGGACTGTCGACGGACATTTTTTTTTT
A_38_P00002492	A_38_P00002492	mir|dme-miR-281-1-5p|mir|MIMAT0000344|mir|dme-miR-281-1*_v16.0|mir|MIMAT0000344	dme-miR-281-1-5p	MIMAT0000344	unmapped	CGCTCGGGTTTTCCCGAGCGGACTGTCGACGGACAGTATTTTTTTT
A_38_P00002493	A_38_P00002493	mir|dme-miR-281-2-5p|mir|MIMAT0000349|mir|dme-miR-281-2*_v16.0|mir|MIMAT0000349	dme-miR-281-2-5p	MIMAT0000349	unmapped	CGCTCGGGTTTTCCCGAGCGGACTGTCGACGGATAGTATTTTTTTT
A_38_P00002494	A_38_P00002494	mir|dme-miR-281-2-5p|mir|MIMAT0000349|mir|dme-miR-281-2*_v16.0|mir|MIMAT0000349	dme-miR-281-2-5p	MIMAT0000349	unmapped	CGCTCGGGTTTTCCCGAGCGGACTGTCGACGGATAGCATTTTTTTTT
A_38_P00002495	A_38_P00002495	mir|dme-miR-991-3p|mir|MIMAT0005509|mir|dme-miR-991_v16.0|mir|MIMAT0005509	dme-miR-991-3p	MIMAT0005509	unmapped	CGCTCGGGTTTTCCCGAGCGGACTTTCCAAACTACAACTAATTTTTTTT
A_38_P00002496	A_38_P00002496	mir|dme-miR-991-3p|mir|MIMAT0005509|mir|dme-miR-991_v16.0|mir|MIMAT0005509	dme-miR-991-3p	MIMAT0005509	unmapped	CGCTCGGGTTTTCCCGAGCGGACTTTCCAAACTACAACTTATTTTTTTTT
A_38_P00002497	A_38_P00002497	mir|dme-miR-991-3p|mir|MIMAT0005509|mir|dme-miR-991_v16.0|mir|MIMAT0005509	dme-miR-991-3p	MIMAT0005509	unmapped	CGCTCGGGTTTTCCCGAGCGGACTTTCCAAACTACAACTTTTTTTTTTTTT
A_38_P00002498	A_38_P00002498	mir|dme-miR-283-5p_v17.0|mir|MIMAT0000347|mir|dme-miR-283_v16.0|mir|MIMAT0000347	dme-miR-283-5p_v17.0	MIMAT0000347	unmapped	CGCTCGGGTTTTCCCGAGCGGAGAATTACCAGCTGATATTATTTTTTTTT
A_38_P00002499	A_38_P00002499	mir|dme-miR-283-5p_v17.0|mir|MIMAT0000347|mir|dme-miR-283_v16.0|mir|MIMAT0000347	dme-miR-283-5p_v17.0	MIMAT0000347	unmapped	CGCTCGGGTTTTCCCGAGCGGAGAATTACCAGCTGATATTTTTTTTTTTTT
A_38_P00002500	A_38_P00002500	mir|dme-miR-283-5p_v17.0|mir|MIMAT0000347|mir|dme-miR-283_v16.0|mir|MIMAT0000347	dme-miR-283-5p_v17.0	MIMAT0000347	unmapped	CGCTCGGGTTTTCCCGAGCGGAGAATTACCAGCTGATATTTATTTTTTTTTT
A_38_P00002501	A_38_P00002501	mir|dme-miR-999-3p|mir|MIMAT0005519|mir|dme-miR-999_v16.0|mir|MIMAT0005519	dme-miR-999-3p	MIMAT0005519	unmapped	CGCTCGGGTTTTCCCGAGCGGAGACACAGTCTTACAGTATTTTTTTTT
A_38_P00002502	A_38_P00002502	mir|dme-miR-999-3p|mir|MIMAT0005519|mir|dme-miR-999_v16.0|mir|MIMAT0005519	dme-miR-999-3p	MIMAT0005519	unmapped	CGCTCGGGTTTTCCCGAGCGGAGACACAGTCTTACAGTTTTTTTTTTTT
A_38_P00002503	A_38_P00002503	mir|dme-miR-999-3p|mir|MIMAT0005519|mir|dme-miR-999_v16.0|mir|MIMAT0005519	dme-miR-999-3p	MIMAT0005519	unmapped	CGCTCGGGTTTTCCCGAGCGGAGACACAGTCTTACAGTTATTTTTTTTTT
A_38_P00002504	A_38_P00002504	mir|dme-miR-999-3p|mir|MIMAT0005519|mir|dme-miR-999_v16.0|mir|MIMAT0005519	dme-miR-999-3p	MIMAT0005519	unmapped	CGCTCGGGTTTTCCCGAGCGGAGACACAGTCTTACAGTTAATTTTTTTTTT
A_38_P00002505	A_38_P00002505	mir|dme-miR-996-3p|mir|MIMAT0005515|mir|dme-miR-996_v16.0|mir|MIMAT0005515	dme-miR-996-3p	MIMAT0005515	unmapped	CGCTCGGGTTTTCCCGAGCGGAGACGAGCATGAAATCTTTTTTTTTTT
A_38_P00002506	A_38_P00002506	mir|dme-miR-996-3p|mir|MIMAT0005515|mir|dme-miR-996_v16.0|mir|MIMAT0005515	dme-miR-996-3p	MIMAT0005515	unmapped	CGCTCGGGTTTTCCCGAGCGGAGACGAGCATGAAATCTATATTTTTTTT
A_38_P00002507	A_38_P00002507	mir|dme-miR-996-3p|mir|MIMAT0005515|mir|dme-miR-996_v16.0|mir|MIMAT0005515	dme-miR-996-3p	MIMAT0005515	unmapped	CGCTCGGGTTTTCCCGAGCGGAGACGAGCATGAAATCTAGATTTTTTTTT
A_38_P00002508	A_38_P00002508	mir|dme-miR-276a-3p|mir|MIMAT0000337|mir|dme-miR-276a_v16.0|mir|MIMAT0000337	dme-miR-276a-3p	MIMAT0000337	unmapped	CGCTCGGGTTTTCCCGAGCGGAGAGCACGGTATGAAGAATTTTTTTT
A_38_P00002509	A_38_P00002509	mir|dme-miR-276a-3p|mir|MIMAT0000337|mir|dme-miR-276a_v16.0|mir|MIMAT0000337	dme-miR-276a-3p	MIMAT0000337	unmapped	CGCTCGGGTTTTCCCGAGCGGAGAGCACGGTATGAAGTATTTTTTTTT
A_38_P00002510	A_38_P00002510	mir|dme-miR-276b-3p|mir|MIMAT0000354|mir|dme-miR-276b_v16.0|mir|MIMAT0000354	dme-miR-276b-3p	MIMAT0000354	unmapped	CGCTCGGGTTTTCCCGAGCGGAGAGCACGGTATTAAGTATTTTTTTTT
A_38_P00002511	A_38_P00002511	mir|dme-miR-276b-3p|mir|MIMAT0000354|mir|dme-miR-276b_v16.0|mir|MIMAT0000354	dme-miR-276b-3p	MIMAT0000354	unmapped	CGCTCGGGTTTTCCCGAGCGGAGAGCACGGTATTAAGTTTTTTTTTTTT
A_38_P00002512	A_38_P00002512	mir|dme-miR-276b-3p|mir|MIMAT0000354|mir|dme-miR-276b_v16.0|mir|MIMAT0000354	dme-miR-276b-3p	MIMAT0000354	unmapped	CGCTCGGGTTTTCCCGAGCGGAGAGCACGGTATTAAGTTCTATTTTTTTT
A_38_P00002513	A_38_P00002513	mir|dme-miR-993-3p|mir|MIMAT0005512|mir|dme-miR-993_v16.0|mir|MIMAT0005512	dme-miR-993-3p	MIMAT0005512	unmapped	CGCTCGGGTTTTCCCGAGCGGAGATACCTGTAGAGACGTTTTTTTTTT
A_38_P00002514	A_38_P00002514	mir|dme-miR-993-3p|mir|MIMAT0005512|mir|dme-miR-993_v16.0|mir|MIMAT0005512	dme-miR-993-3p	MIMAT0005512	unmapped	CGCTCGGGTTTTCCCGAGCGGAGATACCTGTAGAGACGATTTTTTTTTT
A_38_P00002515	A_38_P00002515	mir|dme-miR-286-3p|mir|MIMAT0000359|mir|dme-miR-286_v16.0|mir|MIMAT0000359	dme-miR-286-3p	MIMAT0000359	unmapped	CGCTCGGGTTTTCCCGAGCGGAGCACGAGTGTTCGTATTTTTTTT
A_38_P00002516	A_38_P00002516	mir|dme-miR-286-3p|mir|MIMAT0000359|mir|dme-miR-286_v16.0|mir|MIMAT0000359	dme-miR-286-3p	MIMAT0000359	unmapped	CGCTCGGGTTTTCCCGAGCGGAGCACGAGTGTTCGGATTTTTTTTT
A_38_P00002517	A_38_P00002517	mir|dme-miR-289-5p|mir|MIMAT0000364|mir|dme-miR-289_v16.0|mir|MIMAT0000364	dme-miR-289-5p	MIMAT0000364	unmapped	CGCTCGGGTTTTCCCGAGCGGAGTCGCAGGCTCCTTTTTTTTTT
A_38_P00002518	A_38_P00002518	mir|dme-miR-289-5p|mir|MIMAT0000364|mir|dme-miR-289_v16.0|mir|MIMAT0000364	dme-miR-289-5p	MIMAT0000364	unmapped	CGCTCGGGTTTTCCCGAGCGGAGTCGCAGGCTCCATATTTTTTTT
A_38_P00002519	A_38_P00002519	mir|dme-miR-975-5p|mir|MIMAT0005491|mir|dme-miR-975_v16.0|mir|MIMAT0005491	dme-miR-975-5p	MIMAT0005491	unmapped	CGCTCGGGTTTTCCCGAGCGGATACAGGATGTAGGAAGTTATTTTTTTT
A_38_P00002520	A_38_P00002520	mir|dme-miR-975-5p|mir|MIMAT0005491|mir|dme-miR-975_v16.0|mir|MIMAT0005491	dme-miR-975-5p	MIMAT0005491	unmapped	CGCTCGGGTTTTCCCGAGCGGATACAGGATGTAGGAAGTGAATTTTTTTT
A_38_P00002521	A_38_P00002521	mir|dme-miR-970-3p|mir|MIMAT0005486|mir|dme-miR-970_v16.0|mir|MIMAT0005486	dme-miR-970-3p	MIMAT0005486	unmapped	CGCTCGGGTTTTCCCGAGCGGATAGCCGCGTGTGTTATTTTTTTT
A_38_P00002522	A_38_P00002522	mir|dme-miR-970-3p|mir|MIMAT0005486|mir|dme-miR-970_v16.0|mir|MIMAT0005486	dme-miR-970-3p	MIMAT0005486	unmapped	CGCTCGGGTTTTCCCGAGCGGATAGCCGCGTGTGTCAATTTTTTTT
A_38_P00002523	A_38_P00002523	mir|dme-miR-92a-3p|mir|MIMAT0000334|mir|dme-miR-92a_v16.0|mir|MIMAT0000334	dme-miR-92a-3p	MIMAT0000334	unmapped	CGCTCGGGTTTTCCCGAGCGGATAGGCCGGGACAATATTTTTTTT
A_38_P00002524	A_38_P00002524	mir|dme-miR-92a-3p|mir|MIMAT0000334|mir|dme-miR-92a_v16.0|mir|MIMAT0000334	dme-miR-92a-3p	MIMAT0000334	unmapped	CGCTCGGGTTTTCCCGAGCGGATAGGCCGGGACAAGATTTTTTTTT
A_38_P00002525	A_38_P00002525	mir|dme-miR-994-5p|mir|MIMAT0005513|mir|dme-miR-994_v16.0|mir|MIMAT0005513	dme-miR-994-5p	MIMAT0005513	unmapped	CGCTCGGGTTTTCCCGAGCGGATCACGGCTACTATTTCTATTTTTTTT
A_38_P00002526	A_38_P00002526	mir|dme-miR-994-5p|mir|MIMAT0005513|mir|dme-miR-994_v16.0|mir|MIMAT0005513	dme-miR-994-5p	MIMAT0005513	unmapped	CGCTCGGGTTTTCCCGAGCGGATCACGGCTACTATTTCCAATTTTTTTT
A_38_P00002527	A_38_P00002527	mir|dme-miR-961-5p|mir|MIMAT0005475|mir|dme-miR-961_v16.0|mir|MIMAT0005475	dme-miR-961-5p	MIMAT0005475	unmapped	CGCTCGGGTTTTCCCGAGCGGATCTCAGTTACTGGTGAATTTTTTTTT
A_38_P00002528	A_38_P00002528	mir|dme-miR-961-5p|mir|MIMAT0005475|mir|dme-miR-961_v16.0|mir|MIMAT0005475	dme-miR-961-5p	MIMAT0005475	unmapped	CGCTCGGGTTTTCCCGAGCGGATCTCAGTTACTGGTGATTTTTTTTTTT
A_38_P00002529	A_38_P00002529	mir|dme-miR-961-5p|mir|MIMAT0005475|mir|dme-miR-961_v16.0|mir|MIMAT0005475	dme-miR-961-5p	MIMAT0005475	unmapped	CGCTCGGGTTTTCCCGAGCGGATCTCAGTTACTGGTGATCTTTTTTTTTT
A_38_P00002530	A_38_P00002530	mir|dme-miR-79-3p|mir|MIMAT0000352|mir|dme-miR-79_v16.0|mir|MIMAT0000352	dme-miR-79-3p	MIMAT0000352	unmapped	CGCTCGGGTTTTCCCGAGCGGATGCTTTGGTAATCTAGCAATTTTTTTT
A_38_P00002531	A_38_P00002531	mir|dme-miR-79-3p|mir|MIMAT0000352|mir|dme-miR-79_v16.0|mir|MIMAT0000352	dme-miR-79-3p	MIMAT0000352	unmapped	CGCTCGGGTTTTCCCGAGCGGATGCTTTGGTAATCTAGCTAATTTTTTTT
A_38_P00002532	A_38_P00002532	mir|dme-miR-274-5p|mir|MIMAT0000332|mir|dme-miR-274_v16.0|mir|MIMAT0000332	dme-miR-274-5p	MIMAT0000332	unmapped	CGCTCGGGTTTTCCCGAGCGGATTACCCGTTAGTGTCTTTTTTTTTT
A_38_P00002533	A_38_P00002533	mir|dme-miR-274-5p|mir|MIMAT0000332|mir|dme-miR-274_v16.0|mir|MIMAT0000332	dme-miR-274-5p	MIMAT0000332	unmapped	CGCTCGGGTTTTCCCGAGCGGATTACCCGTTAGTGTCGTATTTTTTTT
A_38_P00002534	A_38_P00002534	mir|dme-miR-982-5p|mir|MIMAT0005498|mir|dme-miR-982_v16.0|mir|MIMAT0005498	dme-miR-982-5p	MIMAT0005498	unmapped	CGCTCGGGTTTTCCCGAGCGGATTTACTTCATATTTGTCCAGTTTTTTTTTT
A_38_P00002535	A_38_P00002535	mir|dme-miR-982-5p|mir|MIMAT0005498|mir|dme-miR-982_v16.0|mir|MIMAT0005498	dme-miR-982-5p	MIMAT0005498	unmapped	CGCTCGGGTTTTCCCGAGCGGATTTACTTCATATTTGTCCAGGTTTTTTTTTT
A_38_P00002536	A_38_P00002536	mir|dme-miR-190-5p|mir|MIMAT0005467|mir|dme-miR-190_v16.0|mir|MIMAT0005467	dme-miR-190-5p	MIMAT0005467	unmapped	CGCTCGGGTTTTCCCGAGCGGCAACCAAGAATATCAAACTATTTTTTTT
A_38_P00002537	A_38_P00002537	mir|dme-miR-190-5p|mir|MIMAT0005467|mir|dme-miR-190_v16.0|mir|MIMAT0005467	dme-miR-190-5p	MIMAT0005467	unmapped	CGCTCGGGTTTTCCCGAGCGGCAACCAAGAATATCAAACAATTTTTTTTT
A_38_P00002538	A_38_P00002538	mir|dme-miR-968-5p|mir|MIMAT0005484|mir|dme-miR-968_v16.0|mir|MIMAT0005484	dme-miR-968-5p	MIMAT0005484	unmapped	CGCTCGGGTTTTCCCGAGCGGCAACCCTTTAATGGATACATTTTTTTTT
A_38_P00002539	A_38_P00002539	mir|dme-miR-968-5p|mir|MIMAT0005484|mir|dme-miR-968_v16.0|mir|MIMAT0005484	dme-miR-968-5p	MIMAT0005484	unmapped	CGCTCGGGTTTTCCCGAGCGGCAACCCTTTAATGGATACTTTTTTTTTTT
A_38_P00002540	A_38_P00002540	mir|dme-miR-219-5p|mir|MIMAT0000335|mir|dme-miR-219_v16.0|mir|MIMAT0000335	dme-miR-219-5p	MIMAT0000335	unmapped	CGCTCGGGTTTTCCCGAGCGGCAAGAATTGCGTTTGGTTTTTTTTTT
A_38_P00002541	A_38_P00002541	mir|dme-miR-219-5p|mir|MIMAT0000335|mir|dme-miR-219_v16.0|mir|MIMAT0000335	dme-miR-219-5p	MIMAT0000335	unmapped	CGCTCGGGTTTTCCCGAGCGGCAAGAATTGCGTTTGGATTTTTTTTTT
A_38_P00002542	A_38_P00002542	mir|dme-miR-929-3p|mir|MIMAT0005511|mir|dme-miR-929_v16.0|mir|MIMAT0005511	dme-miR-929-3p	MIMAT0005511	unmapped	CGCTCGGGTTTTCCCGAGCGGCAATCTGACTCCGTTATTTTTTTTTT
A_38_P00002543	A_38_P00002543	mir|dme-miR-929-3p|mir|MIMAT0005511|mir|dme-miR-929_v16.0|mir|MIMAT0005511	dme-miR-929-3p	MIMAT0005511	unmapped	CGCTCGGGTTTTCCCGAGCGGCAATCTGACTCCGTTAGTTTTTTTTTT
A_38_P00002544	A_38_P00002544	mir|dme-miR-33-5p_v17.0|mir|MIMAT0000342|mir|dme-miR-33_v16.0|mir|MIMAT0000342	dme-miR-33-5p_v17.0	MIMAT0000342	unmapped	CGCTCGGGTTTTCCCGAGCGGCAATGCGACTACAATGTTTTTTTTTT
A_38_P00002545	A_38_P00002545	mir|dme-miR-33-5p_v17.0|mir|MIMAT0000342|mir|dme-miR-33_v16.0|mir|MIMAT0000342	dme-miR-33-5p_v17.0	MIMAT0000342	unmapped	CGCTCGGGTTTTCCCGAGCGGCAATGCGACTACAATGCTTTTTTTTTT
A_38_P00002546	A_38_P00002546	mir|dme-miR-284-3p|mir|MIMAT0000348|mir|dme-miR-284_v16.0|mir|MIMAT0000348	dme-miR-284-3p	MIMAT0000348	unmapped	CGCTCGGGTTTTCCCGAGCGGCAATTGCTGGAATCAAGAATTTTTTTT
A_38_P00002547	A_38_P00002547	mir|dme-miR-284-3p|mir|MIMAT0000348|mir|dme-miR-284_v16.0|mir|MIMAT0000348	dme-miR-284-3p	MIMAT0000348	unmapped	CGCTCGGGTTTTCCCGAGCGGCAATTGCTGGAATCAAGTATTTTTTTTT
A_38_P00002548	A_38_P00002548	mir|dme-miR-34-5p|mir|MIMAT0000350|mir|dme-miR-34_v16.0|mir|MIMAT0000350	dme-miR-34-5p	MIMAT0000350	unmapped	CGCTCGGGTTTTCCCGAGCGGCACAACCAGCTAACCTTTTTTTTTT
A_38_P00002549	A_38_P00002549	mir|dme-miR-34-5p|mir|MIMAT0000350|mir|dme-miR-34_v16.0|mir|MIMAT0000350	dme-miR-34-5p	MIMAT0000350	unmapped	CGCTCGGGTTTTCCCGAGCGGCACAACCAGCTAACCATTTTTTTTTT
A_38_P00002550	A_38_P00002550	mir|dme-miR-100-5p|mir|MIMAT0000357|mir|dme-miR-100_v16.0|mir|MIMAT0000357	dme-miR-100-5p	MIMAT0000357	unmapped	CGCTCGGGTTTTCCCGAGCGGCACAAGTTCGGATTTACTTTTTTTTTT
A_38_P00002551	A_38_P00002551	mir|dme-miR-100-5p|mir|MIMAT0000357|mir|dme-miR-100_v16.0|mir|MIMAT0000357	dme-miR-100-5p	MIMAT0000357	unmapped	CGCTCGGGTTTTCCCGAGCGGCACAAGTTCGGATTTACGTTTTTTTTTT
A_38_P00002552	A_38_P00002552	mir|dme-miR-87-3p|mir|MIMAT0000361|mir|dme-miR-87_v16.0|mir|MIMAT0000361	dme-miR-87-3p	MIMAT0000361	unmapped	CGCTCGGGTTTTCCCGAGCGGCACACCTGAAATTTTGTATTTTTTTT
A_38_P00002553	A_38_P00002553	mir|dme-miR-87-3p|mir|MIMAT0000361|mir|dme-miR-87_v16.0|mir|MIMAT0000361	dme-miR-87-3p	MIMAT0000361	unmapped	CGCTCGGGTTTTCCCGAGCGGCACACCTGAAATTTTGCATTTTTTTTT
A_38_P00002554	A_38_P00002554	mir|dme-miR-305-5p|mir|MIMAT0000391|mir|dme-miR-305_v16.0|mir|MIMAT0000391	dme-miR-305-5p	MIMAT0000391	unmapped	CGCTCGGGTTTTCCCGAGCGGCAGAGCACCTGATGATTTTTTTTTT
A_38_P00002555	A_38_P00002555	mir|dme-miR-305-5p|mir|MIMAT0000391|mir|dme-miR-305_v16.0|mir|MIMAT0000391	dme-miR-305-5p	MIMAT0000391	unmapped	CGCTCGGGTTTTCCCGAGCGGCAGAGCACCTGATGAATATTTTTTTT
A_38_P00002556	A_38_P00002556	mir|dme-miR-31b-5p|mir|MIMAT0000389|mir|dme-miR-31b_v16.0|mir|MIMAT0000389	dme-miR-31b-5p	MIMAT0000389	unmapped	CGCTCGGGTTTTCCCGAGCGGCAGCTATTCCGACATCAATTTTTTTT
A_38_P00002557	A_38_P00002557	mir|dme-miR-31b-5p|mir|MIMAT0000389|mir|dme-miR-31b_v16.0|mir|MIMAT0000389	dme-miR-31b-5p	MIMAT0000389	unmapped	CGCTCGGGTTTTCCCGAGCGGCAGCTATTCCGACATCTATTTTTTTTT
A_38_P00002558	A_38_P00002558	mir|dme-miR-9b-5p|mir|MIMAT0000395|mir|dme-miR-9b_v16.0|mir|MIMAT0000395	dme-miR-9b-5p	MIMAT0000395	unmapped	CGCTCGGGTTTTCCCGAGCGGCATACAGCTAAAATCACCTTTTTTTTTT
A_38_P00002559	A_38_P00002559	mir|dme-miR-9b-5p|mir|MIMAT0000395|mir|dme-miR-9b_v16.0|mir|MIMAT0000395	dme-miR-9b-5p	MIMAT0000395	unmapped	CGCTCGGGTTTTCCCGAGCGGCATACAGCTAAAATCACCATTTTTTTTTT
A_38_P00002560	A_38_P00002560	mir|dme-miR-5-5p|mir|MIMAT0000110|mir|dme-miR-5_v16.0|mir|MIMAT0000110	dme-miR-5-5p	MIMAT0000110	unmapped	CGCTCGGGTTTTCCCGAGCGGCATATCACAACGATCGTATTTTTTTTT
A_38_P00002561	A_38_P00002561	mir|dme-miR-5-5p|mir|MIMAT0000110|mir|dme-miR-5_v16.0|mir|MIMAT0000110	dme-miR-5-5p	MIMAT0000110	unmapped	CGCTCGGGTTTTCCCGAGCGGCATATCACAACGATCGTTTTTTTTTTTT
A_38_P00002562	A_38_P00002562	mir|dme-miR-987-5p|mir|MIMAT0005504|mir|dme-miR-987_v16.0|mir|MIMAT0005504	dme-miR-987-5p	MIMAT0005504	unmapped	CGCTCGGGTTTTCCCGAGCGGCATCAATCCAGACTATTTATATTTTTTTT
A_38_P00002563	A_38_P00002563	mir|dme-miR-987-5p|mir|MIMAT0005504|mir|dme-miR-987_v16.0|mir|MIMAT0005504	dme-miR-987-5p	MIMAT0005504	unmapped	CGCTCGGGTTTTCCCGAGCGGCATCAATCCAGACTATTTACAATTTTTTTT
A_38_P00002564	A_38_P00002564	mir|dme-miR-288-3p|mir|MIMAT0000363|mir|dme-miR-288_v16.0|mir|MIMAT0000363	dme-miR-288-3p	MIMAT0000363	unmapped	CGCTCGGGTTTTCCCGAGCGGCATGAAATGAAATCGACAATTTTTTTTT
A_38_P00002565	A_38_P00002565	mir|dme-miR-288-3p|mir|MIMAT0000363|mir|dme-miR-288_v16.0|mir|MIMAT0000363	dme-miR-288-3p	MIMAT0000363	unmapped	CGCTCGGGTTTTCCCGAGCGGCATGAAATGAAATCGACATTTTTTTTTTT
A_38_P00002566	A_38_P00002566	mir|dme-miR-966-5p|mir|MIMAT0005481|mir|dme-miR-966_v16.0|mir|MIMAT0005481	dme-miR-966-5p	MIMAT0005481	unmapped	CGCTCGGGTTTTCCCGAGCGGCCACACAGCCCACTTTTTTTTTT
A_38_P00002567	A_38_P00002567	mir|dme-miR-966-5p|mir|MIMAT0005481|mir|dme-miR-966_v16.0|mir|MIMAT0005481	dme-miR-966-5p	MIMAT0005481	unmapped	CGCTCGGGTTTTCCCGAGCGGCCACACAGCCCACATTTTTTTTTT
A_38_P00002568	A_38_P00002568	mir|dme-miR-314-3p|mir|MIMAT0000406|mir|dme-miR-314_v16.0|mir|MIMAT0000406	dme-miR-314-3p	MIMAT0000406	unmapped	CGCTCGGGTTTTCCCGAGCGGCCGAACTTATTGGCTTTTTTTTTTT
A_38_P00002569	A_38_P00002569	mir|dme-miR-314-3p|mir|MIMAT0000406|mir|dme-miR-314_v16.0|mir|MIMAT0000406	dme-miR-314-3p	MIMAT0000406	unmapped	CGCTCGGGTTTTCCCGAGCGGCCGAACTTATTGGCTCTTTTTTTTTT
A_38_P00002570	A_38_P00002570	mir|dme-miR-1013-3p|mir|MIMAT0005026|mir|dme-miR-1013_v16.0|mir|MIMAT0005026	dme-miR-1013-3p	MIMAT0005026	unmapped	CGCTCGGGTTTTCCCGAGCGGCGAGTTCGGCATACAATTTTTTTT
A_38_P00002571	A_38_P00002571	mir|dme-miR-1013-3p|mir|MIMAT0005026|mir|dme-miR-1013_v16.0|mir|MIMAT0005026	dme-miR-1013-3p	MIMAT0005026	unmapped	CGCTCGGGTTTTCCCGAGCGGCGAGTTCGGCATACTAATTTTTTTT
A_38_P00002572	A_38_P00002572	mir|dme-miR-316-5p|mir|MIMAT0000408|mir|dme-miR-316_v16.0|mir|MIMAT0000408	dme-miR-316-5p	MIMAT0000408	unmapped	CGCTCGGGTTTTCCCGAGCGGCGCCAGTAAGCGGTTTTTTTTTT
A_38_P00002573	A_38_P00002573	mir|dme-miR-316-5p|mir|MIMAT0000408|mir|dme-miR-316_v16.0|mir|MIMAT0000408	dme-miR-316-5p	MIMAT0000408	unmapped	CGCTCGGGTTTTCCCGAGCGGCGCCAGTAAGCGGATTTTTTTTTT
A_38_P00002574	A_38_P00002574	mir|dme-miR-275-3p|mir|MIMAT0000333|mir|dme-miR-275_v16.0|mir|MIMAT0000333	dme-miR-275-3p	MIMAT0000333	unmapped	CGCTCGGGTTTTCCCGAGCGGCGCGCGCTACTTTTTTTTTTTT
A_38_P00002575	A_38_P00002575	mir|dme-miR-275-3p|mir|MIMAT0000333|mir|dme-miR-275_v16.0|mir|MIMAT0000333	dme-miR-275-3p	MIMAT0000333	unmapped	CGCTCGGGTTTTCCCGAGCGGCGCGCGCTACTTCTTTTTTTTTT
A_38_P00002576	A_38_P00002576	mir|dme-miR-967-5p|mir|MIMAT0005482|mir|dme-miR-967_v16.0|mir|MIMAT0005482	dme-miR-967-5p	MIMAT0005482	unmapped	CGCTCGGGTTTTCCCGAGCGGCGCTTCTCCAGAGGATTTTTTTTT
A_38_P00002577	A_38_P00002577	mir|dme-miR-967-5p|mir|MIMAT0005482|mir|dme-miR-967_v16.0|mir|MIMAT0005482	dme-miR-967-5p	MIMAT0005482	unmapped	CGCTCGGGTTTTCCCGAGCGGCGCTTCTCCAGAGGTTATTTTTTTT
A_38_P00002578	A_38_P00002578	mir|dme-miR-184-5p|mir|MIMAT0000330|mir|dme-miR-184*_v16.0|mir|MIMAT0000330	dme-miR-184-5p	MIMAT0000330	unmapped	CGCTCGGGTTTTCCCGAGCGGCGGGGCGAGAGATATTTTTTTT
A_38_P00002579	A_38_P00002579	mir|dme-miR-184-5p|mir|MIMAT0000330|mir|dme-miR-184*_v16.0|mir|MIMAT0000330	dme-miR-184-5p	MIMAT0000330	unmapped	CGCTCGGGTTTTCCCGAGCGGCGGGGCGAGAGAAATTTTTTTTT
A_38_P00002580	A_38_P00002580	mir|dme-miR-iab-8-5p|mir|MIMAT0005463|mir|dme-miR-iab-4as-5p_v16.0|mir|MIMAT0005463	dme-miR-iab-8-5p	MIMAT0005463	unmapped	CGCTCGGGTTTTCCCGAGCGGCGGTATACCTTCAGTATATTTTTTTTTT
A_38_P00002581	A_38_P00002581	mir|dme-miR-iab-8-5p|mir|MIMAT0005463|mir|dme-miR-iab-4as-5p_v16.0|mir|MIMAT0005463	dme-miR-iab-8-5p	MIMAT0005463	unmapped	CGCTCGGGTTTTCCCGAGCGGCGGTATACCTTCAGTATACTATTTTTTTT
A_38_P00002582	A_38_P00002582	mir|dme-miR-276a-5p|mir|MIMAT0000336|mir|dme-miR-276*_v16.0|mir|MIMAT0000336|mir|dme-miR-276b-5p|mir|MIMAT0020815	dme-miR-276a-5p	MIMAT0000336	unmapped	CGCTCGGGTTTTCCCGAGCGGCGTAGGAACTCTATACCATTTTTTTTT
A_38_P00002583	A_38_P00002583	mir|dme-miR-276a-5p|mir|MIMAT0000336|mir|dme-miR-276*_v16.0|mir|MIMAT0000336|mir|dme-miR-276b-5p|mir|MIMAT0020815	dme-miR-276a-5p	MIMAT0000336	unmapped	CGCTCGGGTTTTCCCGAGCGGCGTAGGAACTCTATACCTTTTTTTTTTT
A_38_P00002584	A_38_P00002584	mir|dme-miR-1016-3p|mir|MIMAT0005029|mir|dme-miR-1016_v16.0|mir|MIMAT0005029	dme-miR-1016-3p	MIMAT0005029	unmapped	CGCTCGGGTTTTCCCGAGCGGCTAAGTATGGAGAGAGGATTTTTTTTT
A_38_P00002585	A_38_P00002585	mir|dme-miR-1016-3p|mir|MIMAT0005029|mir|dme-miR-1016_v16.0|mir|MIMAT0005029	dme-miR-1016-3p	MIMAT0005029	unmapped	CGCTCGGGTTTTCCCGAGCGGCTAAGTATGGAGAGAGGTTTTTTTTTTT
A_38_P00002586	A_38_P00002586	mir|dme-miR-137-3p|mir|MIMAT0005507|mir|dme-miR-137_v16.0|mir|MIMAT0005507	dme-miR-137-3p	MIMAT0005507	unmapped	CGCTCGGGTTTTCCCGAGCGGCTACGTGTATTCTCAAGTTTTTTTTTT
A_38_P00002587	A_38_P00002587	mir|dme-miR-137-3p|mir|MIMAT0005507|mir|dme-miR-137_v16.0|mir|MIMAT0005507	dme-miR-137-3p	MIMAT0005507	unmapped	CGCTCGGGTTTTCCCGAGCGGCTACGTGTATTCTCAAGCTTTTTTTTTT
A_38_P00002588	A_38_P00002588	mir|dme-miR-1006-3p|mir|MIMAT0005019|mir|dme-miR-1006_v16.0|mir|MIMAT0005019	dme-miR-1006-3p	MIMAT0005019	unmapped	CGCTCGGGTTTTCCCGAGCGGCTATGAATAAGAAATCGAATTATTTTTTTTT
A_38_P00002589	A_38_P00002589	mir|dme-miR-1006-3p|mir|MIMAT0005019|mir|dme-miR-1006_v16.0|mir|MIMAT0005019	dme-miR-1006-3p	MIMAT0005019	unmapped	CGCTCGGGTTTTCCCGAGCGGCTATGAATAAGAAATCGAATTTTTTTTTTTTT
A_38_P00002590	A_38_P00002590	mir|dme-miR-1012-3p|mir|MIMAT0005025|mir|dme-miR-1012_v16.0|mir|MIMAT0005025	dme-miR-1012-3p	MIMAT0005025	unmapped	CGCTCGGGTTTTCCCGAGCGGCTATGGGGAAAATCTTTGTTTTTTTTTT
A_38_P00002591	A_38_P00002591	mir|dme-miR-1012-3p|mir|MIMAT0005025|mir|dme-miR-1012_v16.0|mir|MIMAT0005025	dme-miR-1012-3p	MIMAT0005025	unmapped	CGCTCGGGTTTTCCCGAGCGGCTATGGGGAAAATCTTTGATATTTTTTTT
A_38_P00002592	A_38_P00002592	mir|dme-miR-308-3p|mir|MIMAT0000399|mir|dme-miR-308_v16.0|mir|MIMAT0000399	dme-miR-308-3p	MIMAT0000399	unmapped	CGCTCGGGTTTTCCCGAGCGGCTCACAGTATAATCCTGTTTTTTTTTTT
A_38_P00002593	A_38_P00002593	mir|dme-miR-308-3p|mir|MIMAT0000399|mir|dme-miR-308_v16.0|mir|MIMAT0000399	dme-miR-308-3p	MIMAT0000399	unmapped	CGCTCGGGTTTTCCCGAGCGGCTCACAGTATAATCCTGTGTATTTTTTTT
A_38_P00002594	A_38_P00002594	mir|dme-miR-304-5p|mir|MIMAT0000390|mir|dme-miR-304_v16.0|mir|MIMAT0000390	dme-miR-304-5p	MIMAT0000390	unmapped	CGCTCGGGTTTTCCCGAGCGGCTCACATTTACAAATTGAGTATTTTTTTT
A_38_P00002595	A_38_P00002595	mir|dme-miR-304-5p|mir|MIMAT0000390|mir|dme-miR-304_v16.0|mir|MIMAT0000390	dme-miR-304-5p	MIMAT0000390	unmapped	CGCTCGGGTTTTCCCGAGCGGCTCACATTTACAAATTGAGAAATTTTTTTT
A_38_P00002596	A_38_P00002596	mir|dme-miR-307a-3p|mir|MIMAT0000398|mir|dme-miR-307_v16.0|mir|MIMAT0000398	dme-miR-307a-3p	MIMAT0000398	unmapped	CGCTCGGGTTTTCCCGAGCGGCTCACTCAAGGAGGTATTTTTTTTT
A_38_P00002597	A_38_P00002597	mir|dme-miR-307a-3p|mir|MIMAT0000398|mir|dme-miR-307_v16.0|mir|MIMAT0000398	dme-miR-307a-3p	MIMAT0000398	unmapped	CGCTCGGGTTTTCCCGAGCGGCTCACTCAAGGAGGTTTATTTTTTTT
A_38_P00002598	A_38_P00002598	mir|dme-miR-1-3p|mir|MIMAT0000105|mir|dme-miR-1_v16.0|mir|MIMAT0000105	dme-miR-1-3p	MIMAT0000105	unmapped	CGCTCGGGTTTTCCCGAGCGGCTCCATACTTCTTTACATTTTTTTTTTTT
A_38_P00002599	A_38_P00002599	mir|dme-miR-1-3p|mir|MIMAT0000105|mir|dme-miR-1_v16.0|mir|MIMAT0000105	dme-miR-1-3p	MIMAT0000105	unmapped	CGCTCGGGTTTTCCCGAGCGGCTCCATACTTCTTTACATTCTTTTTTTTTT
A_38_P00002600	A_38_P00002600	mir|dme-miR-252-5p|mir|MIMAT0005516|mir|dme-miR-252_v16.0|mir|MIMAT0005516	dme-miR-252-5p	MIMAT0005516	unmapped	CGCTCGGGTTTTCCCGAGCGGCTCCTGCGGCACATTTTTTTTT
A_38_P00002601	A_38_P00002601	mir|dme-miR-252-5p|mir|MIMAT0005516|mir|dme-miR-252_v16.0|mir|MIMAT0005516	dme-miR-252-5p	MIMAT0005516	unmapped	CGCTCGGGTTTTCCCGAGCGGCTCCTGCGGCACTTTTTTTTTTT
A_38_P00002602	A_38_P00002602	mir|dme-miR-1009-3p|mir|MIMAT0005022|mir|dme-miR-1009_v16.0|mir|MIMAT0005022	dme-miR-1009-3p	MIMAT0005022	unmapped	CGCTCGGGTTTTCCCGAGCGGCTGAAATGTAACAATTTTTGTTTTTTTTTT
A_38_P00002603	A_38_P00002603	mir|dme-miR-1009-3p|mir|MIMAT0005022|mir|dme-miR-1009_v16.0|mir|MIMAT0005022	dme-miR-1009-3p	MIMAT0005022	unmapped	CGCTCGGGTTTTCCCGAGCGGCTGAAATGTAACAATTTTTGATTTTTTTTTT
A_38_P00002604	A_38_P00002604	mir|dme-miR-1014-3p|mir|MIMAT0005027|mir|dme-miR-1014_v16.0|mir|MIMAT0005027	dme-miR-1014-3p	MIMAT0005027	unmapped	CGCTCGGGTTTTCCCGAGCGGCTGCAAATGAAAATGAATTAATTTTTTTT
A_38_P00002605	A_38_P00002605	mir|dme-miR-1014-3p|mir|MIMAT0005027|mir|dme-miR-1014_v16.0|mir|MIMAT0005027	dme-miR-1014-3p	MIMAT0005027	unmapped	CGCTCGGGTTTTCCCGAGCGGCTGCAAATGAAAATGAATTTATTTTTTTTT
A_38_P00002606	A_38_P00002606	mir|dme-miR-1010-3p|mir|MIMAT0005023|mir|dme-miR-1010_v16.0|mir|MIMAT0005023	dme-miR-1010-3p	MIMAT0005023	unmapped	CGCTCGGGTTTTCCCGAGCGGCTGCAAATGGAACGAATTTTTTTTT
A_38_P00002607	A_38_P00002607	mir|dme-miR-1010-3p|mir|MIMAT0005023|mir|dme-miR-1010_v16.0|mir|MIMAT0005023	dme-miR-1010-3p	MIMAT0005023	unmapped	CGCTCGGGTTTTCCCGAGCGGCTGCAAATGGAACGATTTTTTTTTTT
A_38_P00002608	A_38_P00002608	mir|dme-miR-1015-3p|mir|MIMAT0005028|mir|dme-miR-1015_v16.0|mir|MIMAT0005028	dme-miR-1015-3p	MIMAT0005028	unmapped	CGCTCGGGTTTTCCCGAGCGGCTGCAAGAGAGATGTCTTTTTTTTTT
A_38_P00002609	A_38_P00002609	mir|dme-miR-1015-3p|mir|MIMAT0005028|mir|dme-miR-1015_v16.0|mir|MIMAT0005028	dme-miR-1015-3p	MIMAT0005028	unmapped	CGCTCGGGTTTTCCCGAGCGGCTGCAAGAGAGATGTCCTTTTTTTTTT
A_38_P00002610	A_38_P00002610	mir|dme-miR-932-5p|mir|MIMAT0005479|mir|dme-miR-932_v16.0|mir|MIMAT0005479	dme-miR-932-5p	MIMAT0005479	unmapped	CGCTCGGGTTTTCCCGAGCGGCTGCAATGCACTACGTTTTTTTTTT
A_38_P00002611	A_38_P00002611	mir|dme-miR-932-5p|mir|MIMAT0005479|mir|dme-miR-932_v16.0|mir|MIMAT0005479	dme-miR-932-5p	MIMAT0005479	unmapped	CGCTCGGGTTTTCCCGAGCGGCTGCAATGCACTACGGTTTTTTTTTT
A_38_P00002612	A_38_P00002612	mir|dme-miR-978-3p|mir|MIMAT0005494|mir|dme-miR-978_v16.0|mir|MIMAT0005494	dme-miR-978-3p	MIMAT0005494	unmapped	CGCTCGGGTTTTCCCGAGCGGCTGCAATTTACGGCATATTTTTTTT
A_38_P00002613	A_38_P00002613	mir|dme-miR-978-3p|mir|MIMAT0005494|mir|dme-miR-978_v16.0|mir|MIMAT0005494	dme-miR-978-3p	MIMAT0005494	unmapped	CGCTCGGGTTTTCCCGAGCGGCTGCAATTTACGGCACATTTTTTTTT
A_38_P00002614	A_38_P00002614	mir|dme-miR-1005-3p|mir|MIMAT0005018|mir|dme-miR-1005_v16.0|mir|MIMAT0005018	dme-miR-1005-3p	MIMAT0005018	unmapped	CGCTCGGGTTTTCCCGAGCGGCTGCGAATTAAAGATTCTTTTTTTTTT
A_38_P00002615	A_38_P00002615	mir|dme-miR-1005-3p|mir|MIMAT0005018|mir|dme-miR-1005_v16.0|mir|MIMAT0005018	dme-miR-1005-3p	MIMAT0005018	unmapped	CGCTCGGGTTTTCCCGAGCGGCTGCGAATTAAAGATTCCTTTTTTTTTT
A_38_P00002616	A_38_P00002616	mir|dme-miR-1011-3p|mir|MIMAT0005024|mir|dme-miR-1011_v16.0|mir|MIMAT0005024	dme-miR-1011-3p	MIMAT0005024	unmapped	CGCTCGGGTTTTCCCGAGCGGCTGCGAGCGATTTGTTTTTTTTTT
A_38_P00002617	A_38_P00002617	mir|dme-miR-1011-3p|mir|MIMAT0005024|mir|dme-miR-1011_v16.0|mir|MIMAT0005024	dme-miR-1011-3p	MIMAT0005024	unmapped	CGCTCGGGTTTTCCCGAGCGGCTGCGAGCGATTTGATTTTTTTTTT
A_38_P00002618	A_38_P00002618	mir|dme-miR-1003-3p|mir|MIMAT0005016|mir|dme-miR-1003_v16.0|mir|MIMAT0005016	dme-miR-1003-3p	MIMAT0005016	unmapped	CGCTCGGGTTTTCCCGAGCGGCTGTGAATATGTAAATGTGATTTTTTTTTT
A_38_P00002619	A_38_P00002619	mir|dme-miR-1003-3p|mir|MIMAT0005016|mir|dme-miR-1003_v16.0|mir|MIMAT0005016	dme-miR-1003-3p	MIMAT0005016	unmapped	CGCTCGGGTTTTCCCGAGCGGCTGTGAATATGTAAATGTGAGTTTTTTTTTT
A_38_P00002620	A_38_P00002620	mir|dme-miR-1004-3p|mir|MIMAT0005017|mir|dme-miR-1004_v16.0|mir|MIMAT0005017	dme-miR-1004-3p	MIMAT0005017	unmapped	CGCTCGGGTTTTCCCGAGCGGCTGTGAGGGAAGTGAATTTTTTTTT
A_38_P00002621	A_38_P00002621	mir|dme-miR-1004-3p|mir|MIMAT0005017|mir|dme-miR-1004_v16.0|mir|MIMAT0005017	dme-miR-1004-3p	MIMAT0005017	unmapped	CGCTCGGGTTTTCCCGAGCGGCTGTGAGGGAAGTGATTATTTTTTTT
A_38_P00002622	A_38_P00002622	mir|dme-miR-992-3p|mir|MIMAT0005510|mir|dme-miR-992_v16.0|mir|MIMAT0005510	dme-miR-992-3p	MIMAT0005510	unmapped	CGCTCGGGTTTTCCCGAGCGGCTTAGTACCAGAAACGTTATTTTTTTT
A_38_P00002623	A_38_P00002623	mir|dme-miR-992-3p|mir|MIMAT0005510|mir|dme-miR-992_v16.0|mir|MIMAT0005510	dme-miR-992-3p	MIMAT0005510	unmapped	CGCTCGGGTTTTCCCGAGCGGCTTAGTACCAGAAACGTGATTTTTTTTT
A_38_P00002624	A_38_P00002624	mir|dme-miR-124-3p|mir|MIMAT0000351|mir|dme-miR-124_v16.0|mir|MIMAT0000351	dme-miR-124-3p	MIMAT0000351	unmapped	CGCTCGGGTTTTCCCGAGCGGCTTGGCATTCACCGTTTTTTTTTT
A_38_P00002625	A_38_P00002625	mir|dme-miR-124-3p|mir|MIMAT0000351|mir|dme-miR-124_v16.0|mir|MIMAT0000351	dme-miR-124-3p	MIMAT0000351	unmapped	CGCTCGGGTTTTCCCGAGCGGCTTGGCATTCACCGCTATTTTTTTT
A_38_P00002626	A_38_P00002626	mir|dme-miR-963-5p|mir|MIMAT0005477|mir|dme-miR-963_v16.0|mir|MIMAT0005477	dme-miR-963-5p	MIMAT0005477	unmapped	CGCTCGGGTTTTCCCGAGCGGGAAACAACCTGATATTTACTATTTTTTTT
A_38_P00002627	A_38_P00002627	mir|dme-miR-963-5p|mir|MIMAT0005477|mir|dme-miR-963_v16.0|mir|MIMAT0005477	dme-miR-963-5p	MIMAT0005477	unmapped	CGCTCGGGTTTTCCCGAGCGGGAAACAACCTGATATTTACCAATTTTTTTT
A_38_P00002628	A_38_P00002628	mir|dme-miR-955-5p|mir|MIMAT0005466|mir|dme-miR-955_v16.0|mir|MIMAT0005466	dme-miR-955-5p	MIMAT0005466	unmapped	CGCTCGGGTTTTCCCGAGCGGGACACTCAAACCTCTGTTTTTTTTTT
A_38_P00002629	A_38_P00002629	mir|dme-miR-955-5p|mir|MIMAT0005466|mir|dme-miR-955_v16.0|mir|MIMAT0005466	dme-miR-955-5p	MIMAT0005466	unmapped	CGCTCGGGTTTTCCCGAGCGGGACACTCAAACCTCTGCTTTTTTTTTT
A_38_P00002630	A_38_P00002630	mir|dme-miR-962-5p|mir|MIMAT0005476|mir|dme-miR-962_v16.0|mir|MIMAT0005476	dme-miR-962-5p	MIMAT0005476	unmapped	CGCTCGGGTTTTCCCGAGCGGGACAGCATCAATTTCTCATTTTTTTTT
A_38_P00002631	A_38_P00002631	mir|dme-miR-962-5p|mir|MIMAT0005476|mir|dme-miR-962_v16.0|mir|MIMAT0005476	dme-miR-962-5p	MIMAT0005476	unmapped	CGCTCGGGTTTTCCCGAGCGGGACAGCATCAATTTCTCTTTTTTTTTTT
A_38_P00002632	A_38_P00002632	mir|dme-miR-8-3p|mir|MIMAT0000113|mir|dme-miR-8_v16.0|mir|MIMAT0000113	dme-miR-8-3p	MIMAT0000113	unmapped	CGCTCGGGTTTTCCCGAGCGGGACATCTTTACCTGACATATTTTTTTT
A_38_P00002633	A_38_P00002633	mir|dme-miR-8-3p|mir|MIMAT0000113|mir|dme-miR-8_v16.0|mir|MIMAT0000113	dme-miR-8-3p	MIMAT0000113	unmapped	CGCTCGGGTTTTCCCGAGCGGGACATCTTTACCTGACAGATTTTTTTTT
A_38_P00002634	A_38_P00002634	mir|dme-miR-998-3p|mir|MIMAT0005518|mir|dme-miR-998_v16.0|mir|MIMAT0005518	dme-miR-998-3p	MIMAT0005518	unmapped	CGCTCGGGTTTTCCCGAGCGGGAGCTGAATCTCATGGATTTTTTTTT
A_38_P00002635	A_38_P00002635	mir|dme-miR-998-3p|mir|MIMAT0005518|mir|dme-miR-998_v16.0|mir|MIMAT0005518	dme-miR-998-3p	MIMAT0005518	unmapped	CGCTCGGGTTTTCCCGAGCGGGAGCTGAATCTCATGGTTTTTTTTTTT
A_38_P00002636	A_38_P00002636	mir|dme-miR-11-3p|mir|MIMAT0000116|mir|dme-miR-11_v16.0|mir|MIMAT0000116	dme-miR-11-3p	MIMAT0000116	unmapped	CGCTCGGGTTTTCCCGAGCGGGCAAGAACTCAGACTGATTTTTTTTT
A_38_P00002637	A_38_P00002637	mir|dme-miR-11-3p|mir|MIMAT0000116|mir|dme-miR-11_v16.0|mir|MIMAT0000116	dme-miR-11-3p	MIMAT0000116	unmapped	CGCTCGGGTTTTCCCGAGCGGGCAAGAACTCAGACTGTTTTTTTTTTT
A_38_P00002638	A_38_P00002638	mir|dme-miR-306-3p|mir|MIMAT0000394|mir|dme-miR-306*_v16.0|mir|MIMAT0000394	dme-miR-306-3p	MIMAT0000394	unmapped	CGCTCGGGTTTTCCCGAGCGGGCACAGGCACAGATATTTTTTTT
A_38_P00002639	A_38_P00002639	mir|dme-miR-306-3p|mir|MIMAT0000394|mir|dme-miR-306*_v16.0|mir|MIMAT0000394	dme-miR-306-3p	MIMAT0000394	unmapped	CGCTCGGGTTTTCCCGAGCGGGCACAGGCACAGAGATTTTTTTTT
A_38_P00002640	A_38_P00002640	mir|dme-miR-306-3p|mir|MIMAT0000394|mir|dme-miR-306*_v16.0|mir|MIMAT0000394	dme-miR-306-3p	MIMAT0000394	unmapped	CGCTCGGGTTTTCCCGAGCGGGCACAGGCACAGAGTTTTTTTTTTT
A_38_P00002641	A_38_P00002641	mir|dme-miR-285-3p|mir|MIMAT0000356|mir|dme-miR-285_v16.0|mir|MIMAT0000356	dme-miR-285-3p	MIMAT0000356	unmapped	CGCTCGGGTTTTCCCGAGCGGGCACTGATTTCGAATGTATTTTTTTT
A_38_P00002642	A_38_P00002642	mir|dme-miR-285-3p|mir|MIMAT0000356|mir|dme-miR-285_v16.0|mir|MIMAT0000356	dme-miR-285-3p	MIMAT0000356	unmapped	CGCTCGGGTTTTCCCGAGCGGGCACTGATTTCGAATGGATTTTTTTTT
A_38_P00002643	A_38_P00002643	mir|dme-miR-92b-3p|mir|MIMAT0000358|mir|dme-miR-92b_v16.0|mir|MIMAT0000358	dme-miR-92b-3p	MIMAT0000358	unmapped	CGCTCGGGTTTTCCCGAGCGGGCAGGCCGGGATATTTTTTTT
A_38_P00002644	A_38_P00002644	mir|dme-miR-92b-3p|mir|MIMAT0000358|mir|dme-miR-92b_v16.0|mir|MIMAT0000358	dme-miR-92b-3p	MIMAT0000358	unmapped	CGCTCGGGTTTTCCCGAGCGGGCAGGCCGGGACATTTTTTTTT
A_38_P00002645	A_38_P00002645	mir|dme-miR-976-3p|mir|MIMAT0005492|mir|dme-miR-976_v16.0|mir|MIMAT0005492	dme-miR-976-3p	MIMAT0005492	unmapped	CGCTCGGGTTTTCCCGAGCGGGCATTGATGATAACTAATCTTTTTTTTTT
A_38_P00002646	A_38_P00002646	mir|dme-miR-976-3p|mir|MIMAT0005492|mir|dme-miR-976_v16.0|mir|MIMAT0005492	dme-miR-976-3p	MIMAT0005492	unmapped	CGCTCGGGTTTTCCCGAGCGGGCATTGATGATAACTAATCCTTTTTTTTTT
A_38_P00002647	A_38_P00002647	mir|dme-miR-2c-3p|mir|MIMAT0000411|mir|dme-miR-2c_v16.0|mir|MIMAT0000411	dme-miR-2c-3p	MIMAT0000411	unmapped	CGCTCGGGTTTTCCCGAGCGGGCCCATCAAAGCTGTTTTTTTTTT
A_38_P00002648	A_38_P00002648	mir|dme-miR-2c-3p|mir|MIMAT0000411|mir|dme-miR-2c_v16.0|mir|MIMAT0000411	dme-miR-2c-3p	MIMAT0000411	unmapped	CGCTCGGGTTTTCCCGAGCGGGCCCATCAAAGCTGGTATTTTTTTT
A_38_P00002649	A_38_P00002649	mir|dme-miR-184-3p|mir|MIMAT0000331|mir|dme-miR-184_v16.0|mir|MIMAT0000331	dme-miR-184-3p	MIMAT0000331	unmapped	CGCTCGGGTTTTCCCGAGCGGGCCCTTATCAGTTCTCTTTTTTTTTT
A_38_P00002650	A_38_P00002650	mir|dme-miR-184-3p|mir|MIMAT0000331|mir|dme-miR-184_v16.0|mir|MIMAT0000331	dme-miR-184-3p	MIMAT0000331	unmapped	CGCTCGGGTTTTCCCGAGCGGGCCCTTATCAGTTCTCCTATTTTTTTT
A_38_P00002651	A_38_P00002651	mir|dme-miR-972-3p|mir|MIMAT0005488|mir|dme-miR-972_v16.0|mir|MIMAT0005488	dme-miR-972-3p	MIMAT0005488	unmapped	CGCTCGGGTTTTCCCGAGCGGGCCTAAATATTCGTATTGTTTTTTTTTTT
A_38_P00002652	A_38_P00002652	mir|dme-miR-972-3p|mir|MIMAT0005488|mir|dme-miR-972_v16.0|mir|MIMAT0005488	dme-miR-972-3p	MIMAT0005488	unmapped	CGCTCGGGTTTTCCCGAGCGGGCCTAAATATTCGTATTGTATTTTTTTTTT
A_38_P00002653	A_38_P00002653	mir|dme-miR-972-3p|mir|MIMAT0005488|mir|dme-miR-972_v16.0|mir|MIMAT0005488	dme-miR-972-3p	MIMAT0005488	unmapped	CGCTCGGGTTTTCCCGAGCGGGCCTAAATATTCGTATTGTACTTTTTTTTTT
A_38_P00002654	A_38_P00002654	mir|dme-miR-957-3p|mir|MIMAT0005470|mir|dme-miR-957_v16.0|mir|MIMAT0005470	dme-miR-957-3p	MIMAT0005470	unmapped	CGCTCGGGTTTTCCCGAGCGGGCCTCAGTTTTGGACTTTTTTTTTT
A_38_P00002655	A_38_P00002655	mir|dme-miR-957-3p|mir|MIMAT0005470|mir|dme-miR-957_v16.0|mir|MIMAT0005470	dme-miR-957-3p	MIMAT0005470	unmapped	CGCTCGGGTTTTCCCGAGCGGGCCTCAGTTTTGGACGTATTTTTTTT
A_38_P00002656	A_38_P00002656	mir|dme-miR-988-3p|mir|MIMAT0005505|mir|dme-miR-988_v16.0|mir|MIMAT0005505	dme-miR-988-3p	MIMAT0005505	unmapped	CGCTCGGGTTTTCCCGAGCGGGCGTGAGGTTTGCTTTTTTTTTT
A_38_P00002657	A_38_P00002657	mir|dme-miR-988-3p|mir|MIMAT0005505|mir|dme-miR-988_v16.0|mir|MIMAT0005505	dme-miR-988-3p	MIMAT0005505	unmapped	CGCTCGGGTTTTCCCGAGCGGGCGTGAGGTTTGCATTTTTTTTTT
A_38_P00002658	A_38_P00002658	mir|dme-miR-960-5p|mir|MIMAT0005474|mir|dme-miR-960_v16.0|mir|MIMAT0005474	dme-miR-960-5p	MIMAT0005474	unmapped	CGCTCGGGTTTTCCCGAGCGGGCTATGCAATCTGGAAATTTTTTTTT
A_38_P00002659	A_38_P00002659	mir|dme-miR-960-5p|mir|MIMAT0005474|mir|dme-miR-960_v16.0|mir|MIMAT0005474	dme-miR-960-5p	MIMAT0005474	unmapped	CGCTCGGGTTTTCCCGAGCGGGCTATGCAATCTGGAATTTTTTTTTTT
A_38_P00002660	A_38_P00002660	mir|dme-miR-960-5p|mir|MIMAT0005474|mir|dme-miR-960_v16.0|mir|MIMAT0005474	dme-miR-960-5p	MIMAT0005474	unmapped	CGCTCGGGTTTTCCCGAGCGGGCTATGCAATCTGGAATATATTTTTTTT
A_38_P00002661	A_38_P00002661	mir|dme-miR-960-5p|mir|MIMAT0005474|mir|dme-miR-960_v16.0|mir|MIMAT0005474	dme-miR-960-5p	MIMAT0005474	unmapped	CGCTCGGGTTTTCCCGAGCGGGCTATGCAATCTGGAATACATTTTTTTTT
A_38_P00002662	A_38_P00002662	mir|dme-miR-2a-3p|mir|MIMAT0000106|mir|dme-miR-2a_v16.0|mir|MIMAT0000106	dme-miR-2a-3p	MIMAT0000106	unmapped	CGCTCGGGTTTTCCCGAGCGGGCTCATCAAAGCTGGTATTTTTTTT
A_38_P00002663	A_38_P00002663	mir|dme-miR-2a-3p|mir|MIMAT0000106|mir|dme-miR-2a_v16.0|mir|MIMAT0000106	dme-miR-2a-3p	MIMAT0000106	unmapped	CGCTCGGGTTTTCCCGAGCGGGCTCATCAAAGCTGGCATTTTTTTTT
A_38_P00002664	A_38_P00002664	mir|dme-miR-2b-3p|mir|MIMAT0000107|mir|dme-miR-2b_v16.0|mir|MIMAT0000107	dme-miR-2b-3p	MIMAT0000107	unmapped	CGCTCGGGTTTTCCCGAGCGGGCTCCTCAAAGCTGTTTTTTTTTT
A_38_P00002665	A_38_P00002665	mir|dme-miR-2b-3p|mir|MIMAT0000107|mir|dme-miR-2b_v16.0|mir|MIMAT0000107	dme-miR-2b-3p	MIMAT0000107	unmapped	CGCTCGGGTTTTCCCGAGCGGGCTCCTCAAAGCTGGTATTTTTTTT
A_38_P00002666	A_38_P00002666	mir|dme-miR-315-5p|mir|MIMAT0000407|mir|dme-miR-315_v16.0|mir|MIMAT0000407	dme-miR-315-5p	MIMAT0000407	unmapped	CGCTCGGGTTTTCCCGAGCGGGCTTTCTGAGCAACATATTTTTTTT
A_38_P00002667	A_38_P00002667	mir|dme-miR-315-5p|mir|MIMAT0000407|mir|dme-miR-315_v16.0|mir|MIMAT0000407	dme-miR-315-5p	MIMAT0000407	unmapped	CGCTCGGGTTTTCCCGAGCGGGCTTTCTGAGCAACAAATTTTTTTTT
A_38_P00002668	A_38_P00002668	mir|dme-miR-315-5p|mir|MIMAT0000407|mir|dme-miR-315_v16.0|mir|MIMAT0000407	dme-miR-315-5p	MIMAT0000407	unmapped	CGCTCGGGTTTTCCCGAGCGGGCTTTCTGAGCAACAATTTTTTTTTTT
A_38_P00002669	A_38_P00002669	mir|dme-miR-1017-3p|mir|MIMAT0005030|mir|dme-miR-1017_v16.0|mir|MIMAT0005030	dme-miR-1017-3p	MIMAT0005030	unmapped	CGCTCGGGTTTTCCCGAGCGGGGATGAGTTTGGGTAGTTTTTTTTTT
A_38_P00002670	A_38_P00002670	mir|dme-miR-1017-3p|mir|MIMAT0005030|mir|dme-miR-1017_v16.0|mir|MIMAT0005030	dme-miR-1017-3p	MIMAT0005030	unmapped	CGCTCGGGTTTTCCCGAGCGGGGATGAGTTTGGGTAGATTTTTTTTTT
A_38_P00002671	A_38_P00002671	mir|dme-miR-990-5p|mir|MIMAT0005508|mir|dme-miR-990_v16.0|mir|MIMAT0005508	dme-miR-990-5p	MIMAT0005508	unmapped	CGCTCGGGTTTTCCCGAGCGGGGCCAACTCAGAACTTTTTTTTTT
A_38_P00002672	A_38_P00002672	mir|dme-miR-990-5p|mir|MIMAT0005508|mir|dme-miR-990_v16.0|mir|MIMAT0005508	dme-miR-990-5p	MIMAT0005508	unmapped	CGCTCGGGTTTTCCCGAGCGGGGCCAACTCAGAACGTATTTTTTTT
A_38_P00002673	A_38_P00002673	mir|dme-miR-927-5p|mir|MIMAT0005501|mir|dme-miR-927_v16.0|mir|MIMAT0005501	dme-miR-927-5p	MIMAT0005501	unmapped	CGCTCGGGTTTTCCCGAGCGGGGTAAAGCGTAGGAATATTTTTTTTT
A_38_P00002674	A_38_P00002674	mir|dme-miR-927-5p|mir|MIMAT0005501|mir|dme-miR-927_v16.0|mir|MIMAT0005501	dme-miR-927-5p	MIMAT0005501	unmapped	CGCTCGGGTTTTCCCGAGCGGGGTAAAGCGTAGGAATTTATTTTTTTT
A_38_P00002675	A_38_P00002675	mir|dme-miR-927-5p|mir|MIMAT0005501|mir|dme-miR-927_v16.0|mir|MIMAT0005501	dme-miR-927-5p	MIMAT0005501	unmapped	CGCTCGGGTTTTCCCGAGCGGGGTAAAGCGTAGGAATTCATTTTTTTTT
A_38_P00002676	A_38_P00002676	mir|dme-miR-263b-5p|mir|MIMAT0000362|mir|dme-miR-263b_v16.0|mir|MIMAT0000362	dme-miR-263b-5p	MIMAT0000362	unmapped	CGCTCGGGTTTTCCCGAGCGGGTGAATTCTCCCAGTGTTTTTTTTTT
A_38_P00002677	A_38_P00002677	mir|dme-miR-263b-5p|mir|MIMAT0000362|mir|dme-miR-263b_v16.0|mir|MIMAT0000362	dme-miR-263b-5p	MIMAT0000362	unmapped	CGCTCGGGTTTTCCCGAGCGGGTGAATTCTCCCAGTGCTTTTTTTTTT
A_38_P00002678	A_38_P00002678	mir|dme-miR-263a-5p|mir|MIMAT0000319|mir|dme-miR-263a_v16.0|mir|MIMAT0000319	dme-miR-263a-5p	MIMAT0000319	unmapped	CGCTCGGGTTTTCCCGAGCGGGTGAATTCTTCCAGTGTTTTTTTTTT
A_38_P00002679	A_38_P00002679	mir|dme-miR-263a-5p|mir|MIMAT0000319|mir|dme-miR-263a_v16.0|mir|MIMAT0000319	dme-miR-263a-5p	MIMAT0000319	unmapped	CGCTCGGGTTTTCCCGAGCGGGTGAATTCTTCCAGTGCTTTTTTTTTT
A_38_P00002680	A_38_P00002680	mir|dme-miR-287-3p|mir|MIMAT0000360|mir|dme-miR-287_v16.0|mir|MIMAT0000360	dme-miR-287-3p	MIMAT0000360	unmapped	CGCTCGGGTTTTCCCGAGCGGGTGCAAACGATTTTCATTTTTTTTTT
A_38_P00002681	A_38_P00002681	mir|dme-miR-287-3p|mir|MIMAT0000360|mir|dme-miR-287_v16.0|mir|MIMAT0000360	dme-miR-287-3p	MIMAT0000360	unmapped	CGCTCGGGTTTTCCCGAGCGGGTGCAAACGATTTTCAATTTTTTTTTT
A_38_P00002682	A_38_P00002682	mir|dme-miR-iab-4-3p|mir|MIMAT0000413	dme-miR-iab-4-3p	MIMAT0000413	unmapped	CGCTCGGGTTTTCCCGAGCGGGTTACGTATACTGAAGGTTATTTTTTTT
A_38_P00002683	A_38_P00002683	mir|dme-miR-iab-4-3p|mir|MIMAT0000413	dme-miR-iab-4-3p	MIMAT0000413	unmapped	CGCTCGGGTTTTCCCGAGCGGGTTACGTATACTGAAGGTAATTTTTTTTT
A_38_P00002684	A_38_P00002684	mir|dme-miR-iab-4-3p|mir|MIMAT0000413	dme-miR-iab-4-3p	MIMAT0000413	unmapped	CGCTCGGGTTTTCCCGAGCGGGTTACGTATACTGAAGGTATTTTTTTTTTT
A_38_P00002685	A_38_P00002685	mir|dme-miR-989-3p|mir|MIMAT0005506|mir|dme-miR-989_v16.0|mir|MIMAT0005506	dme-miR-989-3p	MIMAT0005506	unmapped	CGCTCGGGTTTTCCCGAGCGGGTTCCACTACGTCACTATTTTTTTT
A_38_P00002686	A_38_P00002686	mir|dme-miR-989-3p|mir|MIMAT0005506|mir|dme-miR-989_v16.0|mir|MIMAT0005506	dme-miR-989-3p	MIMAT0005506	unmapped	CGCTCGGGTTTTCCCGAGCGGGTTCCACTACGTCACAATTTTTTTTT
A_38_P00002687	A_38_P00002687	mir|dme-miR-193-3p|mir|MIMAT0005468|mir|dme-miR-193_v16.0|mir|MIMAT0005468	dme-miR-193-3p	MIMAT0005468	unmapped	CGCTCGGGTTTTCCCGAGCGGGTTGGGACTTAGTAGGTTTTTTTTTT
A_38_P00002688	A_38_P00002688	mir|dme-miR-193-3p|mir|MIMAT0005468|mir|dme-miR-193_v16.0|mir|MIMAT0005468	dme-miR-193-3p	MIMAT0005468	unmapped	CGCTCGGGTTTTCCCGAGCGGGTTGGGACTTAGTAGGCTTTTTTTTTT
A_38_P00002689	A_38_P00002689	mir|dme-miR-iab-8-3p|mir|MIMAT0005464|mir|dme-miR-iab-4as-3p_v16.0|mir|MIMAT0005464	dme-miR-iab-8-3p	MIMAT0005464	unmapped	CGCTCGGGTTTTCCCGAGCGGTAAACGTATACTGAATGTATCTTTTTTTTTT
A_38_P00002690	A_38_P00002690	mir|dme-miR-iab-8-3p|mir|MIMAT0005464|mir|dme-miR-iab-4as-3p_v16.0|mir|MIMAT0005464	dme-miR-iab-8-3p	MIMAT0005464	unmapped	CGCTCGGGTTTTCCCGAGCGGTAAACGTATACTGAATGTATCCTTTTTTTTTT
A_38_P00002691	A_38_P00002691	mir|dme-miR-375-3p|mir|MIMAT0005472|mir|dme-miR-375_v16.0|mir|MIMAT0005472	dme-miR-375-3p	MIMAT0005472	unmapped	CGCTCGGGTTTTCCCGAGCGGTAACTTAAGCCAAACGATTTTTTTTTT
A_38_P00002692	A_38_P00002692	mir|dme-miR-375-3p|mir|MIMAT0005472|mir|dme-miR-375_v16.0|mir|MIMAT0005472	dme-miR-375-3p	MIMAT0005472	unmapped	CGCTCGGGTTTTCCCGAGCGGTAACTTAAGCCAAACGAATTTTTTTTTT
A_38_P00002693	A_38_P00002693	mir|dme-miR-375-3p|mir|MIMAT0005472|mir|dme-miR-375_v16.0|mir|MIMAT0005472	dme-miR-375-3p	MIMAT0005472	unmapped	CGCTCGGGTTTTCCCGAGCGGTAACTTAAGCCAAACGAACTTTTTTTTTT
A_38_P00002694	A_38_P00002694	mir|dme-miR-980-3p|mir|MIMAT0005496|mir|dme-miR-980_v16.0|mir|MIMAT0005496	dme-miR-980-3p	MIMAT0005496	unmapped	CGCTCGGGTTTTCCCGAGCGGTAAGCCCTTCACAAGGTTTTTTTTTT
A_38_P00002695	A_38_P00002695	mir|dme-miR-980-3p|mir|MIMAT0005496|mir|dme-miR-980_v16.0|mir|MIMAT0005496	dme-miR-980-3p	MIMAT0005496	unmapped	CGCTCGGGTTTTCCCGAGCGGTAAGCCCTTCACAAGGCTTTTTTTTTT
A_38_P00002696	A_38_P00002696	mir|dme-miR-210-3p|mir|MIMAT0000355|mir|dme-miR-210_v16.0|mir|MIMAT0000355	dme-miR-210-3p	MIMAT0000355	unmapped	CGCTCGGGTTTTCCCGAGCGGTAGCCGCTGTCACATTTTTTTTTT
A_38_P00002697	A_38_P00002697	mir|dme-miR-210-3p|mir|MIMAT0000355|mir|dme-miR-210_v16.0|mir|MIMAT0000355	dme-miR-210-3p	MIMAT0000355	unmapped	CGCTCGGGTTTTCCCGAGCGGTAGCCGCTGTCACACTTTTTTTTTT
A_38_P00002698	A_38_P00002698	mir|dme-miR-309-3p|mir|MIMAT0000401|mir|dme-miR-309_v16.0|mir|MIMAT0000401	dme-miR-309-3p	MIMAT0000401	unmapped	CGCTCGGGTTTTCCCGAGCGGTAGGACAAACTTTACCCTTTTTTTTTT
A_38_P00002699	A_38_P00002699	mir|dme-miR-309-3p|mir|MIMAT0000401|mir|dme-miR-309_v16.0|mir|MIMAT0000401	dme-miR-309-3p	MIMAT0000401	unmapped	CGCTCGGGTTTTCCCGAGCGGTAGGACAAACTTTACCCATATTTTTTTT
A_38_P00002700	A_38_P00002700	mir|dme-miR-14-3p_v17.0|mir|MIMAT0000120|mir|dme-miR-14_v16.0|mir|MIMAT0000120	dme-miR-14-3p_v17.0	MIMAT0000120	unmapped	CGCTCGGGTTTTCCCGAGCGGTAGGAGAGAGAAAAAGACATTTTTTTTT
A_38_P00002701	A_38_P00002701	mir|dme-miR-14-3p_v17.0|mir|MIMAT0000120|mir|dme-miR-14_v16.0|mir|MIMAT0000120	dme-miR-14-3p_v17.0	MIMAT0000120	unmapped	CGCTCGGGTTTTCCCGAGCGGTAGGAGAGAGAAAAAGACTTTTTTTTTTT
A_38_P00002702	A_38_P00002702	mir|dme-miR-280-5p|mir|MIMAT0000343|mir|dme-miR-280_v16.0|mir|MIMAT0000343	dme-miR-280-5p	MIMAT0000343	unmapped	CGCTCGGGTTTTCCCGAGCGGTATCATTTCATATGCAACGATTTTTTTTT
A_38_P00002703	A_38_P00002703	mir|dme-miR-280-5p|mir|MIMAT0000343|mir|dme-miR-280_v16.0|mir|MIMAT0000343	dme-miR-280-5p	MIMAT0000343	unmapped	CGCTCGGGTTTTCCCGAGCGGTATCATTTCATATGCAACGTTTTTTTTTTT
A_38_P00002704	A_38_P00002704	mir|dme-miR-4-3p|mir|MIMAT0000109|mir|dme-miR-4_v16.0|mir|MIMAT0000109	dme-miR-4-3p	MIMAT0000109	unmapped	CGCTCGGGTTTTCCCGAGCGGTCAATGGTTGTCTAGCTAATTTTTTTT
A_38_P00002705	A_38_P00002705	mir|dme-miR-4-3p|mir|MIMAT0000109|mir|dme-miR-4_v16.0|mir|MIMAT0000109	dme-miR-4-3p	MIMAT0000109	unmapped	CGCTCGGGTTTTCCCGAGCGGTCAATGGTTGTCTAGCTTATTTTTTTTT
A_38_P00002706	A_38_P00002706	mir|dme-miR-125-5p|mir|MIMAT0000397|mir|dme-miR-125_v16.0|mir|MIMAT0000397	dme-miR-125-5p	MIMAT0000397	unmapped	CGCTCGGGTTTTCCCGAGCGGTCACAAGTTAGGGTCTTTTTTTTTTT
A_38_P00002707	A_38_P00002707	mir|dme-miR-125-5p|mir|MIMAT0000397|mir|dme-miR-125_v16.0|mir|MIMAT0000397	dme-miR-125-5p	MIMAT0000397	unmapped	CGCTCGGGTTTTCCCGAGCGGTCACAAGTTAGGGTCTCTTTTTTTTTT
A_38_P00002708	A_38_P00002708	mir|dme-miR-971-3p|mir|MIMAT0005487|mir|dme-miR-971_v16.0|mir|MIMAT0005487	dme-miR-971-3p	MIMAT0005487	unmapped	CGCTCGGGTTTTCCCGAGCGGTCACTGTAAGAAGTAACACTTTTTTTTTT
A_38_P00002709	A_38_P00002709	mir|dme-miR-971-3p|mir|MIMAT0005487|mir|dme-miR-971_v16.0|mir|MIMAT0005487	dme-miR-971-3p	MIMAT0005487	unmapped	CGCTCGGGTTTTCCCGAGCGGTCACTGTAAGAAGTAACACCTTTTTTTTTT
A_38_P00002710	A_38_P00002710	mir|dme-miR-31a-5p|mir|MIMAT0000400|mir|dme-miR-31a_v16.0|mir|MIMAT0000400	dme-miR-31a-5p	MIMAT0000400	unmapped	CGCTCGGGTTTTCCCGAGCGGTCAGCTATGCCGACAATTTTTTTTT
A_38_P00002711	A_38_P00002711	mir|dme-miR-31a-5p|mir|MIMAT0000400|mir|dme-miR-31a_v16.0|mir|MIMAT0000400	dme-miR-31a-5p	MIMAT0000400	unmapped	CGCTCGGGTTTTCCCGAGCGGTCAGCTATGCCGACATTATTTTTTTT
A_38_P00002712	A_38_P00002712	mir|dme-miR-iab-4-5p|mir|MIMAT0000412	dme-miR-iab-4-5p	MIMAT0000412	unmapped	CGCTCGGGTTTTCCCGAGCGGTCAGGATACATTCAGTATACTATTTTTTTT
A_38_P00002713	A_38_P00002713	mir|dme-miR-iab-4-5p|mir|MIMAT0000412	dme-miR-iab-4-5p	MIMAT0000412	unmapped	CGCTCGGGTTTTCCCGAGCGGTCAGGATACATTCAGTATACGATTTTTTTTT
A_38_P00002714	A_38_P00002714	mir|dme-miR-311-3p|mir|MIMAT0000403|mir|dme-miR-311_v16.0|mir|MIMAT0000403	dme-miR-311-3p	MIMAT0000403	unmapped	CGCTCGGGTTTTCCCGAGCGGTCAGGCCGGTGAAATTTTTTTTT
A_38_P00002715	A_38_P00002715	mir|dme-miR-311-3p|mir|MIMAT0000403|mir|dme-miR-311_v16.0|mir|MIMAT0000403	dme-miR-311-3p	MIMAT0000403	unmapped	CGCTCGGGTTTTCCCGAGCGGTCAGGCCGGTGAATTATTTTTTTT
A_38_P00002716	A_38_P00002716	mir|dme-miR-311-3p|mir|MIMAT0000403|mir|dme-miR-311_v16.0|mir|MIMAT0000403	dme-miR-311-3p	MIMAT0000403	unmapped	CGCTCGGGTTTTCCCGAGCGGTCAGGCCGGTGAATGATTTTTTTTT
A_38_P00002717	A_38_P00002717	mir|dme-miR-312-3p|mir|MIMAT0000404|mir|dme-miR-312_v16.0|mir|MIMAT0000404	dme-miR-312-3p	MIMAT0000404	unmapped	CGCTCGGGTTTTCCCGAGCGGTCAGGCCGTCTCAATATTTTTTTT
A_38_P00002718	A_38_P00002718	mir|dme-miR-312-3p|mir|MIMAT0000404|mir|dme-miR-312_v16.0|mir|MIMAT0000404	dme-miR-312-3p	MIMAT0000404	unmapped	CGCTCGGGTTTTCCCGAGCGGTCAGGCCGTCTCAAGATTTTTTTTT
A_38_P00002719	A_38_P00002719	mir|dme-miR-986-5p|mir|MIMAT0005503|mir|dme-miR-986_v16.0|mir|MIMAT0005503	dme-miR-986-5p	MIMAT0005503	unmapped	CGCTCGGGTTTTCCCGAGCGGTCAGTCACAACGCTATATTTTTTTTT
A_38_P00002720	A_38_P00002720	mir|dme-miR-986-5p|mir|MIMAT0005503|mir|dme-miR-986_v16.0|mir|MIMAT0005503	dme-miR-986-5p	MIMAT0005503	unmapped	CGCTCGGGTTTTCCCGAGCGGTCAGTCACAACGCTATTTTTTTTTTTT
A_38_P00002721	A_38_P00002721	mir|dme-miR-986-5p|mir|MIMAT0005503|mir|dme-miR-986_v16.0|mir|MIMAT0005503	dme-miR-986-5p	MIMAT0005503	unmapped	CGCTCGGGTTTTCCCGAGCGGTCAGTCACAACGCTATTCTTTTTTTTTT
A_38_P00002722	A_38_P00002722	mir|dme-miR-9a-5p|mir|MIMAT0000114|mir|dme-miR-9a_v16.0|mir|MIMAT0000114	dme-miR-9a-5p	MIMAT0000114	unmapped	CGCTCGGGTTTTCCCGAGCGGTCATACAGCTAGATAACCTTTTTTTTTT
A_38_P00002723	A_38_P00002723	mir|dme-miR-9a-5p|mir|MIMAT0000114|mir|dme-miR-9a_v16.0|mir|MIMAT0000114	dme-miR-9a-5p	MIMAT0000114	unmapped	CGCTCGGGTTTTCCCGAGCGGTCATACAGCTAGATAACCATTTTTTTTTT
A_38_P00002724	A_38_P00002724	mir|dme-miR-983-5p|mir|MIMAT0005499|mir|dme-miR-983_v16.0|mir|MIMAT0005499	dme-miR-983-5p	MIMAT0005499	unmapped	CGCTCGGGTTTTCCCGAGCGGTCATTAGTTCGAAACGTTATTTTTTTT
A_38_P00002725	A_38_P00002725	mir|dme-miR-983-5p|mir|MIMAT0005499|mir|dme-miR-983_v16.0|mir|MIMAT0005499	dme-miR-983-5p	MIMAT0005499	unmapped	CGCTCGGGTTTTCCCGAGCGGTCATTAGTTCGAAACGTAAATTTTTTTT
A_38_P00002726	A_38_P00002726	mir|dme-miR-983-5p|mir|MIMAT0005499|mir|dme-miR-983_v16.0|mir|MIMAT0005499	dme-miR-983-5p	MIMAT0005499	unmapped	CGCTCGGGTTTTCCCGAGCGGTCATTAGTTCGAAACGTATATTTTTTTTT
A_38_P00002727	A_38_P00002727	mir|dme-miR-983-5p|mir|MIMAT0005499|mir|dme-miR-983_v16.0|mir|MIMAT0005499	dme-miR-983-5p	MIMAT0005499	unmapped	CGCTCGGGTTTTCCCGAGCGGTCATTAGTTCGAAACGTATTTATTTTTTTT
A_38_P00002728	A_38_P00002728	mir|dme-miR-1002-5p|mir|MIMAT0005483|mir|dme-miR-1002_v16.0|mir|MIMAT0005483	dme-miR-1002-5p	MIMAT0005483	unmapped	CGCTCGGGTTTTCCCGAGCGGTCGCCCTTTGTATCCTTTTTTTTTT
A_38_P00002729	A_38_P00002729	mir|dme-miR-1002-5p|mir|MIMAT0005483|mir|dme-miR-1002_v16.0|mir|MIMAT0005483	dme-miR-1002-5p	MIMAT0005483	unmapped	CGCTCGGGTTTTCCCGAGCGGTCGCCCTTTGTATCCATATTTTTTTT
A_38_P00002730	A_38_P00002730	mir|dme-miR-313-3p|mir|MIMAT0000405|mir|dme-miR-313_v16.0|mir|MIMAT0000405	dme-miR-313-3p	MIMAT0000405	unmapped	CGCTCGGGTTTTCCCGAGCGGTCGGGCTGTGAAAATATTTTTTTT
A_38_P00002731	A_38_P00002731	mir|dme-miR-313-3p|mir|MIMAT0000405|mir|dme-miR-313_v16.0|mir|MIMAT0000405	dme-miR-313-3p	MIMAT0000405	unmapped	CGCTCGGGTTTTCCCGAGCGGTCGGGCTGTGAAAAGATTTTTTTTT
A_38_P00002732	A_38_P00002732	mir|dme-miR-313-3p|mir|MIMAT0000405|mir|dme-miR-313_v16.0|mir|MIMAT0000405	dme-miR-313-3p	MIMAT0000405	unmapped	CGCTCGGGTTTTCCCGAGCGGTCGGGCTGTGAAAAGTTTTTTTTTTT
A_38_P00002733	A_38_P00002733	mir|dme-miR-9c-5p|mir|MIMAT0000392|mir|dme-miR-9c_v16.0|mir|MIMAT0000392	dme-miR-9c-5p	MIMAT0000392	unmapped	CGCTCGGGTTTTCCCGAGCGGTCTACAGCTAGAATACCAATTTTTTTTTT
A_38_P00002734	A_38_P00002734	mir|dme-miR-9c-5p|mir|MIMAT0000392|mir|dme-miR-9c_v16.0|mir|MIMAT0000392	dme-miR-9c-5p	MIMAT0000392	unmapped	CGCTCGGGTTTTCCCGAGCGGTCTACAGCTAGAATACCAAATTTTTTTTTT
A_38_P00002735	A_38_P00002735	mir|dme-miR-997-5p|mir|MIMAT0005517|mir|dme-miR-997_v16.0|mir|MIMAT0005517	dme-miR-997-5p	MIMAT0005517	unmapped	CGCTCGGGTTTTCCCGAGCGGTGAAACTCCTTCGAGTAATTTTTTTT
A_38_P00002736	A_38_P00002736	mir|dme-miR-997-5p|mir|MIMAT0005517|mir|dme-miR-997_v16.0|mir|MIMAT0005517	dme-miR-997-5p	MIMAT0005517	unmapped	CGCTCGGGTTTTCCCGAGCGGTGAAACTCCTTCGAGTTATTTTTTTTT
A_38_P00002737	A_38_P00002737	mir|dme-miR-3-3p|mir|MIMAT0000108|mir|dme-miR-3_v16.0|mir|MIMAT0000108	dme-miR-3-3p	MIMAT0000108	unmapped	CGCTCGGGTTTTCCCGAGCGGTGAGACACACTTTGCTTTTTTTTTT
A_38_P00002738	A_38_P00002738	mir|dme-miR-3-3p|mir|MIMAT0000108|mir|dme-miR-3_v16.0|mir|MIMAT0000108	dme-miR-3-3p	MIMAT0000108	unmapped	CGCTCGGGTTTTCCCGAGCGGTGAGACACACTTTGCCTTTTTTTTTT
A_38_P00002739	A_38_P00002739	mir|dme-miR-318-3p|mir|MIMAT0000410|mir|dme-miR-318_v16.0|mir|MIMAT0000410	dme-miR-318-3p	MIMAT0000410	unmapped	CGCTCGGGTTTTCCCGAGCGGTGAGATAAACAAAGCCCTTTTTTTTTT
A_38_P00002740	A_38_P00002740	mir|dme-miR-318-3p|mir|MIMAT0000410|mir|dme-miR-318_v16.0|mir|MIMAT0000410	dme-miR-318-3p	MIMAT0000410	unmapped	CGCTCGGGTTTTCCCGAGCGGTGAGATAAACAAAGCCCATATTTTTTTT
A_38_P00002741	A_38_P00002741	mir|dme-miR-1001-5p|mir|MIMAT0005521|mir|dme-miR-1001_v16.0|mir|MIMAT0005521	dme-miR-1001-5p	MIMAT0005521	unmapped	CGCTCGGGTTTTCCCGAGCGGTGATCCTTGGGAGTTTTTTTTTTTTT
A_38_P00002742	A_38_P00002742	mir|dme-miR-1001-5p|mir|MIMAT0005521|mir|dme-miR-1001_v16.0|mir|MIMAT0005521	dme-miR-1001-5p	MIMAT0005521	unmapped	CGCTCGGGTTTTCCCGAGCGGTGATCCTTGGGAGTTTATTTTTTTTTT
A_38_P00002743	A_38_P00002743	mir|dme-miR-1001-5p|mir|MIMAT0005521|mir|dme-miR-1001_v16.0|mir|MIMAT0005521	dme-miR-1001-5p	MIMAT0005521	unmapped	CGCTCGGGTTTTCCCGAGCGGTGATCCTTGGGAGTTTACTTTTTTTTTT
A_38_P00002744	A_38_P00002744	mir|dme-miR-1007-3p|mir|MIMAT0005020|mir|dme-miR-1007_v16.0|mir|MIMAT0005020	dme-miR-1007-3p	MIMAT0005020	unmapped	CGCTCGGGTTTTCCCGAGCGGTGCAAACAGTTAATTGAGTATTTTTTTT
A_38_P00002745	A_38_P00002745	mir|dme-miR-1007-3p|mir|MIMAT0005020|mir|dme-miR-1007_v16.0|mir|MIMAT0005020	dme-miR-1007-3p	MIMAT0005020	unmapped	CGCTCGGGTTTTCCCGAGCGGTGCAAACAGTTAATTGAGCAATTTTTTTT
A_38_P00002746	A_38_P00002746	mir|dme-miR-981-3p|mir|MIMAT0005497|mir|dme-miR-981_v16.0|mir|MIMAT0005497	dme-miR-981-3p	MIMAT0005497	unmapped	CGCTCGGGTTTTCCCGAGCGGTGCAGGTTTCGTCGTTTTTTTTTT
A_38_P00002747	A_38_P00002747	mir|dme-miR-981-3p|mir|MIMAT0005497|mir|dme-miR-981_v16.0|mir|MIMAT0005497	dme-miR-981-3p	MIMAT0005497	unmapped	CGCTCGGGTTTTCCCGAGCGGTGCAGGTTTCGTCGATTTTTTTTTT
A_38_P00002748	A_38_P00002748	mir|dme-miR-985-3p|mir|MIMAT0005502|mir|dme-miR-985_v16.0|mir|MIMAT0005502	dme-miR-985-3p	MIMAT0005502	unmapped	CGCTCGGGTTTTCCCGAGCGGTGCCCGACCATTGTTTTTTTTTT
A_38_P00002749	A_38_P00002749	mir|dme-miR-985-3p|mir|MIMAT0005502|mir|dme-miR-985_v16.0|mir|MIMAT0005502	dme-miR-985-3p	MIMAT0005502	unmapped	CGCTCGGGTTTTCCCGAGCGGTGCCCGACCATTGGTTTTTTTTTT
A_38_P00002750	A_38_P00002750	mir|dme-miR-1008-3p|mir|MIMAT0005021|mir|dme-miR-1008_v16.0|mir|MIMAT0005021	dme-miR-1008-3p	MIMAT0005021	unmapped	CGCTCGGGTTTTCCCGAGCGGTGTAAACACAAAAAGCTGATTTTTTTTT
A_38_P00002751	A_38_P00002751	mir|dme-miR-1008-3p|mir|MIMAT0005021|mir|dme-miR-1008_v16.0|mir|MIMAT0005021	dme-miR-1008-3p	MIMAT0005021	unmapped	CGCTCGGGTTTTCCCGAGCGGTGTAAACACAAAAAGCTGTTTTTTTTTTT
A_38_P00002752	A_38_P00002752	mir|dme-miR-277-3p|mir|MIMAT0000338|mir|dme-miR-277_v16.0|mir|MIMAT0000338	dme-miR-277-3p	MIMAT0000338	unmapped	CGCTCGGGTTTTCCCGAGCGGTGTCGTACCAGATAGTGTTTTTTTTTT
A_38_P00002753	A_38_P00002753	mir|dme-miR-277-3p|mir|MIMAT0000338|mir|dme-miR-277_v16.0|mir|MIMAT0000338	dme-miR-277-3p	MIMAT0000338	unmapped	CGCTCGGGTTTTCCCGAGCGGTGTCGTACCAGATAGTGCTATTTTTTTT
A_38_P00002754	A_38_P00002754	mir|dme-miR-279-3p|mir|MIMAT0000341|mir|dme-miR-279_v16.0|mir|MIMAT0000341	dme-miR-279-3p	MIMAT0000341	unmapped	CGCTCGGGTTTTCCCGAGCGGTTAATGAGTGTGGATCTAGATTTTTTTTT
A_38_P00002755	A_38_P00002755	mir|dme-miR-279-3p|mir|MIMAT0000341|mir|dme-miR-279_v16.0|mir|MIMAT0000341	dme-miR-279-3p	MIMAT0000341	unmapped	CGCTCGGGTTTTCCCGAGCGGTTAATGAGTGTGGATCTAGTTTTTTTTTTT
A_38_P00002756	A_38_P00002756	mir|dme-miR-977-3p|mir|MIMAT0005493|mir|dme-miR-977_v16.0|mir|MIMAT0005493	dme-miR-977-3p	MIMAT0005493	unmapped	CGCTCGGGTTTTCCCGAGCGGTTAGACAACGTGAATATCTTTTTTTTTTT
A_38_P00002757	A_38_P00002757	mir|dme-miR-977-3p|mir|MIMAT0005493|mir|dme-miR-977_v16.0|mir|MIMAT0005493	dme-miR-977-3p	MIMAT0005493	unmapped	CGCTCGGGTTTTCCCGAGCGGTTAGACAACGTGAATATCTCTTTTTTTTTT
A_38_P00002758	A_38_P00002758	mir|dme-miR-979-3p|mir|MIMAT0005495|mir|dme-miR-979_v16.0|mir|MIMAT0005495	dme-miR-979-3p	MIMAT0005495	unmapped	CGCTCGGGTTTTCCCGAGCGGTTAGCCTGAGTTCGGTTTTTTTTTT
A_38_P00002759	A_38_P00002759	mir|dme-miR-979-3p|mir|MIMAT0005495|mir|dme-miR-979_v16.0|mir|MIMAT0005495	dme-miR-979-3p	MIMAT0005495	unmapped	CGCTCGGGTTTTCCCGAGCGGTTAGCCTGAGTTCGGGTTTTTTTTTT
A_38_P00002760	A_38_P00002760	mir|dme-miR-959-3p|mir|MIMAT0005473|mir|dme-miR-959_v16.0|mir|MIMAT0005473	dme-miR-959-3p	MIMAT0005473	unmapped	CGCTCGGGTTTTCCCGAGCGGTTCATAATACCCCCGAATTTTTTTTT
A_38_P00002761	A_38_P00002761	mir|dme-miR-959-3p|mir|MIMAT0005473|mir|dme-miR-959_v16.0|mir|MIMAT0005473	dme-miR-959-3p	MIMAT0005473	unmapped	CGCTCGGGTTTTCCCGAGCGGTTCATAATACCCCCGATTTTTTTTTTT
A_38_P00002762	A_38_P00002762	mir|dme-miR-959-3p|mir|MIMAT0005473|mir|dme-miR-959_v16.0|mir|MIMAT0005473	dme-miR-959-3p	MIMAT0005473	unmapped	CGCTCGGGTTTTCCCGAGCGGTTCATAATACCCCCGATGTTTTTTTTTT
A_38_P00002763	A_38_P00002763	mir|dme-miR-306-5p|mir|MIMAT0000393|mir|dme-miR-306_v16.0|mir|MIMAT0000393	dme-miR-306-5p	MIMAT0000393	unmapped	CGCTCGGGTTTTCCCGAGCGGTTGAGAGTCACTAAGTACTATTTTTTTT
A_38_P00002764	A_38_P00002764	mir|dme-miR-306-5p|mir|MIMAT0000393|mir|dme-miR-306_v16.0|mir|MIMAT0000393	dme-miR-306-5p	MIMAT0000393	unmapped	CGCTCGGGTTTTCCCGAGCGGTTGAGAGTCACTAAGTACCATTTTTTTTT
A_38_P00007486	A_38_P00007486	mir|ame-miR-190|mir|MIMAT0004440	ame-miR-190	MIMAT0004440	unmapped	CGCTCGGGTTTTCCCGAGCGGAACAACCAAGAATATCAAATTTTTTTTTT
A_38_P00007487	A_38_P00007487	mir|ame-miR-190|mir|MIMAT0004440	ame-miR-190	MIMAT0004440	unmapped	CGCTCGGGTTTTCCCGAGCGGAACAACCAAGAATATCAAACTATTTTTTTT
A_38_P00007488	A_38_P00007488	mir|ame-bantam|mir|MIMAT0001470	ame-bantam	MIMAT0001470	unmapped	CGCTCGGGTTTTCCCGAGCGGAATCAGCTTTCACAATGAATTTTTTTTT
A_38_P00007489	A_38_P00007489	mir|ame-bantam|mir|MIMAT0001470	ame-bantam	MIMAT0001470	unmapped	CGCTCGGGTTTTCCCGAGCGGAATCAGCTTTCACAATGATTATTTTTTTT
A_38_P00007490	A_38_P00007490	mir|ame-bantam|mir|MIMAT0001470	ame-bantam	MIMAT0001470	unmapped	CGCTCGGGTTTTCCCGAGCGGAATCAGCTTTCACAATGATCATTTTTTTTT
A_38_P00007491	A_38_P00007491	mir|ame-miR-281|mir|MIMAT0001483	ame-miR-281	MIMAT0001483	unmapped	CGCTCGGGTTTTCCCGAGCGGACAAAGAGAGCAACTCTTTTTTTTTT
A_38_P00007492	A_38_P00007492	mir|ame-miR-281|mir|MIMAT0001483	ame-miR-281	MIMAT0001483	unmapped	CGCTCGGGTTTTCCCGAGCGGACAAAGAGAGCAACTCCTATTTTTTTT
A_38_P00007497	A_38_P00007497	mir|ame-miR-87|mir|MIMAT0004434	ame-miR-87	MIMAT0004434	unmapped	CGCTCGGGTTTTCCCGAGCGGACACCTGAAACTTTGCATTTTTTTTT
A_38_P00007498	A_38_P00007498	mir|ame-miR-87|mir|MIMAT0004434	ame-miR-87	MIMAT0004434	unmapped	CGCTCGGGTTTTCCCGAGCGGACACCTGAAACTTTGCTTTTTTTTTTT
A_38_P00007499	A_38_P00007499	mir|ame-miR-282|mir|MIMAT0001484	ame-miR-282	MIMAT0001484	unmapped	CGCTCGGGTTTTCCCGAGCGGACAGACAAAGCCTAGGTTTTTTTTTT
A_38_P00007500	A_38_P00007500	mir|ame-miR-282|mir|MIMAT0001484	ame-miR-282	MIMAT0001484	unmapped	CGCTCGGGTTTTCCCGAGCGGACAGACAAAGCCTAGGATTTTTTTTTT
A_38_P00007509	A_38_P00007509	mir|ame-miR-317|mir|MIMAT0001488	ame-miR-317	MIMAT0001488	unmapped	CGCTCGGGTTTTCCCGAGCGGACTGAGATACCACCAGTATTTTTTTT
A_38_P00007510	A_38_P00007510	mir|ame-miR-317|mir|MIMAT0001488	ame-miR-317	MIMAT0001488	unmapped	CGCTCGGGTTTTCCCGAGCGGACTGAGATACCACCAGCATTTTTTTTT
A_38_P00007511	A_38_P00007511	mir|ame-miR-29b|mir|MIMAT0004427	ame-miR-29b	MIMAT0004427	unmapped	CGCTCGGGTTTTCCCGAGCGGACTGATTTCAAATGGTGTATTTTTTTT
A_38_P00007512	A_38_P00007512	mir|ame-miR-29b|mir|MIMAT0004427	ame-miR-29b	MIMAT0004427	unmapped	CGCTCGGGTTTTCCCGAGCGGACTGATTTCAAATGGTGCATTTTTTTTT
A_38_P00007513	A_38_P00007513	mir|ame-miR-283|mir|MIMAT0004426	ame-miR-283	MIMAT0004426	unmapped	CGCTCGGGTTTTCCCGAGCGGAGAATTACCAGCTGATATTATTTTTTTTT
A_38_P00007514	A_38_P00007514	mir|ame-miR-283|mir|MIMAT0004426	ame-miR-283	MIMAT0004426	unmapped	CGCTCGGGTTTTCCCGAGCGGAGAATTACCAGCTGATATTTTTTTTTTTTT
A_38_P00007519	A_38_P00007519	mir|ame-miR-34|mir|MIMAT0004430	ame-miR-34	MIMAT0004430	unmapped	CGCTCGGGTTTTCCCGAGCGGCAACCAGCTAACAACATATTTTTTTT
A_38_P00007520	A_38_P00007520	mir|ame-miR-34|mir|MIMAT0004430	ame-miR-34	MIMAT0004430	unmapped	CGCTCGGGTTTTCCCGAGCGGCAACCAGCTAACAACACATTTTTTTTT
A_38_P00007523	A_38_P00007523	mir|ame-miR-33|mir|MIMAT0004429	ame-miR-33	MIMAT0004429	unmapped	CGCTCGGGTTTTCCCGAGCGGCAATGCAACTACAATGCTTTTTTTTTT
A_38_P00007524	A_38_P00007524	mir|ame-miR-33|mir|MIMAT0004429	ame-miR-33	MIMAT0004429	unmapped	CGCTCGGGTTTTCCCGAGCGGCAATGCAACTACAATGCATTTTTTTTTT
A_38_P00007531	A_38_P00007531	mir|ame-miR-13a|mir|MIMAT0004422	ame-miR-13a	MIMAT0004422	unmapped	CGCTCGGGTTTTCCCGAGCGGCTCATCAAAATGGCTGATTTTTTTTT
A_38_P00007532	A_38_P00007532	mir|ame-miR-13a|mir|MIMAT0004422	ame-miR-13a	MIMAT0004422	unmapped	CGCTCGGGTTTTCCCGAGCGGCTCATCAAAATGGCTGTTTTTTTTTTT
A_38_P00007557	A_38_P00007557	mir|ame-miR-375|mir|MIMAT0004431	ame-miR-375	MIMAT0004431	unmapped	CGCTCGGGTTTTCCCGAGCGGTAACTCGAGCCGAACTTTTTTTTTT
A_38_P00007558	A_38_P00007558	mir|ame-miR-375|mir|MIMAT0004431	ame-miR-375	MIMAT0004431	unmapped	CGCTCGGGTTTTCCCGAGCGGTAACTCGAGCCGAACGTTTTTTTTTT
A_38_P00007583	A_38_P00007583	mir|ame-miR-79|mir|MIMAT0004433	ame-miR-79	MIMAT0004433	unmapped	CGCTCGGGTTTTCCCGAGCGGTGCTTTGGTAATCTAGCTAATTTTTTTT
A_38_P00007584	A_38_P00007584	mir|ame-miR-79|mir|MIMAT0004433	ame-miR-79	MIMAT0004433	unmapped	CGCTCGGGTTTTCCCGAGCGGTGCTTTGGTAATCTAGCTTATTTTTTTTT
A_38_P00007589	A_38_P00007589	mir|ame-miR-928|mir|MIMAT0004439	ame-miR-928	MIMAT0004439	unmapped	CGCTCGGGTTTTCCCGAGCGGTTCGCCAGCTTCCTTTTTTTTTT
A_38_P00007590	A_38_P00007590	mir|ame-miR-928|mir|MIMAT0004439	ame-miR-928	MIMAT0004439	unmapped	CGCTCGGGTTTTCCCGAGCGGTTCGCCAGCTTCCATTTTTTTTTT
A_38_P00007591	A_38_P00007591	mir|bmo-miR-278-3p|mir|MIMAT0009164|mir|bmo-miR-278_v18.0|mir|MIMAT0009164	bmo-miR-278-3p	MIMAT0009164	unmapped	CGCTCGGGTTTTCCCGAGCGGAAACGGACGAAGATCTTTTTTTTTT
A_38_P00007592	A_38_P00007592	mir|bmo-miR-278-3p|mir|MIMAT0009164|mir|bmo-miR-278_v18.0|mir|MIMAT0009164	bmo-miR-278-3p	MIMAT0009164	unmapped	CGCTCGGGTTTTCCCGAGCGGAAACGGACGAAGATCCTTTTTTTTTT
A_38_P00007593	A_38_P00007593	mir|bmo-miR-190-5p|mir|MIMAT0009153|mir|bmo-miR-190_v18.0|mir|MIMAT0009153	bmo-miR-190-5p	MIMAT0009153	unmapped	CGCTCGGGTTTTCCCGAGCGGAACCAAGAATATCAAACATATTATTTTTTTT
A_38_P00007594	A_38_P00007594	mir|bmo-miR-190-5p|mir|MIMAT0009153|mir|bmo-miR-190_v18.0|mir|MIMAT0009153	bmo-miR-190-5p	MIMAT0009153	unmapped	CGCTCGGGTTTTCCCGAGCGGAACCAAGAATATCAAACATATCATTTTTTTTT
A_38_P00007595	A_38_P00007595	mir|bmo-miR-281-3p|mir|MIMAT0007905|mir|bmo-miR-281_v18.0|mir|MIMAT0007905	bmo-miR-281-3p	MIMAT0007905	unmapped	CGCTCGGGTTTTCCCGAGCGGAAGAGAGCAACTCCATTTTTTTTTTT
A_38_P00007596	A_38_P00007596	mir|bmo-miR-281-3p|mir|MIMAT0007905|mir|bmo-miR-281_v18.0|mir|MIMAT0007905	bmo-miR-281-3p	MIMAT0007905	unmapped	CGCTCGGGTTTTCCCGAGCGGAAGAGAGCAACTCCATGTTTTTTTTTT
A_38_P00007597	A_38_P00007597	mir|bmo-bantam-3p|mir|MIMAT0007907|mir|bmo-bantam_v18.0|mir|MIMAT0007907	bmo-bantam-3p	MIMAT0007907	unmapped	CGCTCGGGTTTTCCCGAGCGGAATTAGCTTTCACAATGATCATTTTTTTTT
A_38_P00007598	A_38_P00007598	mir|bmo-bantam-3p|mir|MIMAT0007907|mir|bmo-bantam_v18.0|mir|MIMAT0007907	bmo-bantam-3p	MIMAT0007907	unmapped	CGCTCGGGTTTTCCCGAGCGGAATTAGCTTTCACAATGATCTTTTTTTTTTT
A_38_P00007603	A_38_P00007603	mir|bmo-miR-87|mir|MIMAT0007900	bmo-miR-87	MIMAT0007900	unmapped	CGCTCGGGTTTTCCCGAGCGGACACACCTGAAAGTTTGTATTTTTTTT
A_38_P00007604	A_38_P00007604	mir|bmo-miR-87|mir|MIMAT0007900	bmo-miR-87	MIMAT0007900	unmapped	CGCTCGGGTTTTCCCGAGCGGACACACCTGAAAGTTTGCATTTTTTTTT
A_38_P00007605	A_38_P00007605	mir|bmo-miR-282-5p|mir|MIMAT0004205|mir|bmo-miR-282_v18.0|mir|MIMAT0004205	bmo-miR-282-5p	MIMAT0004205	unmapped	CGCTCGGGTTTTCCCGAGCGGACAGACAAAGCCAAGTTTTTTTTTT
A_38_P00007606	A_38_P00007606	mir|bmo-miR-282-5p|mir|MIMAT0004205|mir|bmo-miR-282_v18.0|mir|MIMAT0004205	bmo-miR-282-5p	MIMAT0004205	unmapped	CGCTCGGGTTTTCCCGAGCGGACAGACAAAGCCAAGGTTTTTTTTTT
A_38_P00007609	A_38_P00007609	mir|bmo-miR-12|mir|MIMAT0009151	bmo-miR-12	MIMAT0009151	unmapped	CGCTCGGGTTTTCCCGAGCGGACCAGTACCTGAAGTAAATTTTTTTTT
A_38_P00007610	A_38_P00007610	mir|bmo-miR-12|mir|MIMAT0009151	bmo-miR-12	MIMAT0009151	unmapped	CGCTCGGGTTTTCCCGAGCGGACCAGTACCTGAAGTAATTTTTTTTTTT
A_38_P00007611	A_38_P00007611	mir|bmo-miR-12|mir|MIMAT0009151	bmo-miR-12	MIMAT0009151	unmapped	CGCTCGGGTTTTCCCGAGCGGACCAGTACCTGAAGTAATATATTTTTTTT
A_38_P00007612	A_38_P00007612	mir|bmo-miR-12|mir|MIMAT0009151	bmo-miR-12	MIMAT0009151	unmapped	CGCTCGGGTTTTCCCGAGCGGACCAGTACCTGAAGTAATACATTTTTTTTT
A_38_P00007617	A_38_P00007617	mir|bmo-miR-2b-3p|mir|MIMAT0007895|mir|bmo-miR-2b_v18.0|mir|MIMAT0007895	bmo-miR-2b-3p	MIMAT0007895	unmapped	CGCTCGGGTTTTCCCGAGCGGACTCAACAAAGCTGGTATTTTTTTT
A_38_P00007618	A_38_P00007618	mir|bmo-miR-2b-3p|mir|MIMAT0007895|mir|bmo-miR-2b_v18.0|mir|MIMAT0007895	bmo-miR-2b-3p	MIMAT0007895	unmapped	CGCTCGGGTTTTCCCGAGCGGACTCAACAAAGCTGGCATTTTTTTTT
A_38_P00007619	A_38_P00007619	mir|bmo-miR-13b-3p|mir|MIMAT0007898|mir|bmo-miR-13b_v18.0|mir|MIMAT0007898	bmo-miR-13b-3p	MIMAT0007898	unmapped	CGCTCGGGTTTTCCCGAGCGGACTCGTCAAAAATGGCATTTTTTTTT
A_38_P00007620	A_38_P00007620	mir|bmo-miR-13b-3p|mir|MIMAT0007898|mir|bmo-miR-13b_v18.0|mir|MIMAT0007898	bmo-miR-13b-3p	MIMAT0007898	unmapped	CGCTCGGGTTTTCCCGAGCGGACTCGTCAAAAATGGCTTATTTTTTTT
A_38_P00007626	A_38_P00007626	mir|bmo-miR-210|mir|MIMAT0007903	bmo-miR-210	MIMAT0007903	unmapped	CGCTCGGGTTTTCCCGAGCGGAGCCGCTGTCACATTTTTTTTTT
A_38_P00007627	A_38_P00007627	mir|bmo-miR-210|mir|MIMAT0007903	bmo-miR-210	MIMAT0007903	unmapped	CGCTCGGGTTTTCCCGAGCGGAGCCGCTGTCACACTTTTTTTTTT
A_38_P00007628	A_38_P00007628	mir|bmo-miR-279a|mir|MIMAT0004204|mir|bmo-miR-279_v14.0|mir|MIMAT0004204	bmo-miR-279a	MIMAT0004204	unmapped	CGCTCGGGTTTTCCCGAGCGGATGAGTGTGGATCTAGTCTTTTTTTTTT
A_38_P00007629	A_38_P00007629	mir|bmo-miR-279a|mir|MIMAT0004204|mir|bmo-miR-279_v14.0|mir|MIMAT0004204	bmo-miR-279a	MIMAT0004204	unmapped	CGCTCGGGTTTTCCCGAGCGGATGAGTGTGGATCTAGTCATTTTTTTTTT
A_38_P00007632	A_38_P00007632	mir|bmo-miR-34-5p|mir|MIMAT0004197|mir|bmo-miR-34_v18.0|mir|MIMAT0004197	bmo-miR-34-5p	MIMAT0004197	unmapped	CGCTCGGGTTTTCCCGAGCGGCAACCAGCTAACCACTTTTTTTTTT
A_38_P00007633	A_38_P00007633	mir|bmo-miR-34-5p|mir|MIMAT0004197|mir|bmo-miR-34_v18.0|mir|MIMAT0004197	bmo-miR-34-5p	MIMAT0004197	unmapped	CGCTCGGGTTTTCCCGAGCGGCAACCAGCTAACCACATATTTTTTTT
A_38_P00007634	A_38_P00007634	mir|bmo-miR-13a-3p|mir|MIMAT0007897|mir|bmo-miR-13a_v18.0|mir|MIMAT0007897	bmo-miR-13a-3p	MIMAT0007897	unmapped	CGCTCGGGTTTTCCCGAGCGGCACATCAAAGTGGCTTATTTTTTTT
A_38_P00007635	A_38_P00007635	mir|bmo-miR-13a-3p|mir|MIMAT0007897|mir|bmo-miR-13a_v18.0|mir|MIMAT0007897	bmo-miR-13a-3p	MIMAT0007897	unmapped	CGCTCGGGTTTTCCCGAGCGGCACATCAAAGTGGCTGATTTTTTTTT
A_38_P00007640	A_38_P00007640	mir|bmo-miR-31-5p|mir|MIMAT0004213|mir|bmo-miR-31_v18.0|mir|MIMAT0004213	bmo-miR-31-5p	MIMAT0004213	unmapped	CGCTCGGGTTTTCCCGAGCGGCAGCTATGCCGACTATTTTTTTTT
A_38_P00007641	A_38_P00007641	mir|bmo-miR-31-5p|mir|MIMAT0004213|mir|bmo-miR-31_v18.0|mir|MIMAT0004213	bmo-miR-31-5p	MIMAT0004213	unmapped	CGCTCGGGTTTTCCCGAGCGGCAGCTATGCCGACTTTATTTTTTTT
A_38_P00007642	A_38_P00007642	mir|bmo-miR-31-5p|mir|MIMAT0004213|mir|bmo-miR-31_v18.0|mir|MIMAT0004213	bmo-miR-31-5p	MIMAT0004213	unmapped	CGCTCGGGTTTTCCCGAGCGGCAGCTATGCCGACTTCAATTTTTTTT
A_38_P00007643	A_38_P00007643	mir|bmo-miR-1926|mir|MIMAT0007933	bmo-miR-1926	MIMAT0007933	unmapped	CGCTCGGGTTTTCCCGAGCGGCCTTTTTGCTTTAGAATTCTATTTTTTTT
A_38_P00007644	A_38_P00007644	mir|bmo-miR-1926|mir|MIMAT0007933	bmo-miR-1926	MIMAT0007933	unmapped	CGCTCGGGTTTTCCCGAGCGGCCTTTTTGCTTTAGAATTCCATTTTTTTTT
A_38_P00007661	A_38_P00007661	mir|bmo-miR-317-3p|mir|MIMAT0007906|mir|bmo-miR-317_v18.0|mir|MIMAT0007906	bmo-miR-317-3p	MIMAT0007906	unmapped	CGCTCGGGTTTTCCCGAGCGGGATACCACCAGCTGTTATTTTTTTT
A_38_P00007662	A_38_P00007662	mir|bmo-miR-317-3p|mir|MIMAT0007906|mir|bmo-miR-317_v18.0|mir|MIMAT0007906	bmo-miR-317-3p	MIMAT0007906	unmapped	CGCTCGGGTTTTCCCGAGCGGGATACCACCAGCTGTGAATTTTTTTT
A_38_P00007663	A_38_P00007663	mir|bmo-miR-285|mir|MIMAT0009154	bmo-miR-285	MIMAT0009154	unmapped	CGCTCGGGTTTTCCCGAGCGGGCACTGAATTCGAATGTATTTTTTTT
A_38_P00007664	A_38_P00007664	mir|bmo-miR-285|mir|MIMAT0009154	bmo-miR-285	MIMAT0009154	unmapped	CGCTCGGGTTTTCCCGAGCGGGCACTGAATTCGAATGGATTTTTTTTT
A_38_P00007665	A_38_P00007665	mir|bmo-miR-92b|mir|MIMAT0009155|mir|bmo-miR-92_v14.0|mir|MIMAT0009155	bmo-miR-92b	MIMAT0009155	unmapped	CGCTCGGGTTTTCCCGAGCGGGCAGGCCGGGAAATTTTTTTT
A_38_P00007666	A_38_P00007666	mir|bmo-miR-92b|mir|MIMAT0009155|mir|bmo-miR-92_v14.0|mir|MIMAT0009155	bmo-miR-92b	MIMAT0009155	unmapped	CGCTCGGGTTTTCCCGAGCGGGCAGGCCGGGATATTTTTTTTT
A_38_P00007667	A_38_P00007667	mir|bmo-miR-92b|mir|MIMAT0009155|mir|bmo-miR-92_v14.0|mir|MIMAT0009155	bmo-miR-92b	MIMAT0009155	unmapped	CGCTCGGGTTTTCCCGAGCGGGCAGGCCGGGATTTTTTTTTTTT
A_38_P00007668	A_38_P00007668	mir|bmo-miR-1923|mir|MIMAT0007932	bmo-miR-1923	MIMAT0007932	unmapped	CGCTCGGGTTTTCCCGAGCGGGCCACGGCTATGCTTTTTTTTTT
A_38_P00007669	A_38_P00007669	mir|bmo-miR-1923|mir|MIMAT0007932	bmo-miR-1923	MIMAT0007932	unmapped	CGCTCGGGTTTTCCCGAGCGGGCCACGGCTATGCATTTTTTTTTT
A_38_P00007676	A_38_P00007676	mir|bmo-miR-929-5p|mir|MIMAT0009158|mir|bmo-miR-929_v18.0|mir|MIMAT0009158	bmo-miR-929-5p	MIMAT0009158	unmapped	CGCTCGGGTTTTCCCGAGCGGGGACTCCCTACTAGAGATTTTTTTTT
A_38_P00007677	A_38_P00007677	mir|bmo-miR-929-5p|mir|MIMAT0009158|mir|bmo-miR-929_v18.0|mir|MIMAT0009158	bmo-miR-929-5p	MIMAT0009158	unmapped	CGCTCGGGTTTTCCCGAGCGGGGACTCCCTACTAGAGTTTTTTTTTTT
A_38_P00007691	A_38_P00007691	mir|bmo-miR-137|mir|MIMAT0009152	bmo-miR-137	MIMAT0009152	unmapped	CGCTCGGGTTTTCCCGAGCGGTACGTGTATTCTCAAGCTTTTTTTTTT
A_38_P00007692	A_38_P00007692	mir|bmo-miR-137|mir|MIMAT0009152	bmo-miR-137	MIMAT0009152	unmapped	CGCTCGGGTTTTCCCGAGCGGTACGTGTATTCTCAAGCATATTTTTTTT
A_38_P00007695	A_38_P00007695	mir|bmo-miR-71-5p|mir|MIMAT0004214|mir|bmo-miR-71_v18.0|mir|MIMAT0004214	bmo-miR-71-5p	MIMAT0004214	unmapped	CGCTCGGGTTTTCCCGAGCGGTCACTACCCATGTCTTTTTTTTTTTTT
A_38_P00007696	A_38_P00007696	mir|bmo-miR-71-5p|mir|MIMAT0004214|mir|bmo-miR-71_v18.0|mir|MIMAT0004214	bmo-miR-71-5p	MIMAT0004214	unmapped	CGCTCGGGTTTTCCCGAGCGGTCACTACCCATGTCTTTCTTTTTTTTTT
A_38_P00007699	A_38_P00007699	mir|bmo-miR-9b-5p|mir|MIMAT0009161|mir|bmo-miR-9b_v18.0|mir|MIMAT0009161	bmo-miR-9b-5p	MIMAT0009161	unmapped	CGCTCGGGTTTTCCCGAGCGGTCATAAAGCTAGATTACCAATTTTTTTTTT
A_38_P00007700	A_38_P00007700	mir|bmo-miR-9b-5p|mir|MIMAT0009161|mir|bmo-miR-9b_v18.0|mir|MIMAT0009161	bmo-miR-9b-5p	MIMAT0009161	unmapped	CGCTCGGGTTTTCCCGAGCGGTCATAAAGCTAGATTACCAAATTTTTTTTTT
A_38_P00007710	A_38_P00007710	mir|bmo-miR-13a-5p|mir|MIMAT0007896|mir|bmo-miR-13a*_v18.0|mir|MIMAT0007896	bmo-miR-13a-5p	MIMAT0007896	unmapped	CGCTCGGGTTTTCCCGAGCGGTTTCACCGCCGCTAATTTTTTTT
A_38_P00007711	A_38_P00007711	mir|bmo-miR-13a-5p|mir|MIMAT0007896|mir|bmo-miR-13a*_v18.0|mir|MIMAT0007896	bmo-miR-13a-5p	MIMAT0007896	unmapped	CGCTCGGGTTTTCCCGAGCGGTTTCACCGCCGCTTATTTTTTTTT
A_38_P00014157	A_38_P00014157	mir|tca-miR-281-3p|mir|MIMAT0008385|mir|tca-miR-281_v16.0|mir|MIMAT0008385	tca-miR-281-3p	MIMAT0008385	unmapped	CGCTCGGGTTTTCCCGAGCGGAAAGAGAGCAACTCCAATTTTTTTTT
A_38_P00014158	A_38_P00014158	mir|tca-miR-281-3p|mir|MIMAT0008385|mir|tca-miR-281_v16.0|mir|MIMAT0008385	tca-miR-281-3p	MIMAT0008385	unmapped	CGCTCGGGTTTTCCCGAGCGGAAAGAGAGCAACTCCATTTTTTTTTTT
A_38_P00014159	A_38_P00014159	mir|tca-miR-281-3p|mir|MIMAT0008385|mir|tca-miR-281_v16.0|mir|MIMAT0008385	tca-miR-281-3p	MIMAT0008385	unmapped	CGCTCGGGTTTTCCCGAGCGGAAAGAGAGCAACTCCATGTTTTTTTTTT
A_38_P00014164	A_38_P00014164	mir|tca-miR-190_v16.0|mir|MIMAT0008375	tca-miR-190_v16.0	MIMAT0008375	unmapped	CGCTCGGGTTTTCCCGAGCGGACAACCAAGAATATCAAACTATTTTTTTT
A_38_P00014165	A_38_P00014165	mir|tca-miR-190_v16.0|mir|MIMAT0008375	tca-miR-190_v16.0	MIMAT0008375	unmapped	CGCTCGGGTTTTCCCGAGCGGACAACCAAGAATATCAAACAATTTTTTTTT
A_38_P00014186	A_38_P00014186	mir|tca-miR-71-5p|mir|MIMAT0008365|mir|tca-miR-71_v16.0|mir|MIMAT0008365	tca-miR-71-5p	MIMAT0008365	unmapped	CGCTCGGGTTTTCCCGAGCGGATCTCACTACCCATGTCAATTTTTTTT
A_38_P00014187	A_38_P00014187	mir|tca-miR-71-5p|mir|MIMAT0008365|mir|tca-miR-71_v16.0|mir|MIMAT0008365	tca-miR-71-5p	MIMAT0008365	unmapped	CGCTCGGGTTTTCCCGAGCGGATCTCACTACCCATGTCTAATTTTTTTT
A_38_P00014196	A_38_P00014196	mir|tca-miR-87a-3p|mir|MIMAT0008366|mir|tca-miR-87_v16.0|mir|MIMAT0008366	tca-miR-87a-3p	MIMAT0008366	unmapped	CGCTCGGGTTTTCCCGAGCGGCACACCTGAAACTTTGTATTTTTTTT
A_38_P00014197	A_38_P00014197	mir|tca-miR-87a-3p|mir|MIMAT0008366|mir|tca-miR-87_v16.0|mir|MIMAT0008366	tca-miR-87a-3p	MIMAT0008366	unmapped	CGCTCGGGTTTTCCCGAGCGGCACACCTGAAACTTTGCATTTTTTTTT
A_38_P00014200	A_38_P00014200	mir|tca-miR-92b-3p|mir|MIMAT0008368|mir|tca-miR-92b_v16.0|mir|MIMAT0008368	tca-miR-92b-3p	MIMAT0008368	unmapped	CGCTCGGGTTTTCCCGAGCGGCAGGCCGGGACAAGTGTTTTTTTTTT
A_38_P00014201	A_38_P00014201	mir|tca-miR-92b-3p|mir|MIMAT0008368|mir|tca-miR-92b_v16.0|mir|MIMAT0008368	tca-miR-92b-3p	MIMAT0008368	unmapped	CGCTCGGGTTTTCCCGAGCGGCAGGCCGGGACAAGTGCTTTTTTTTTT
A_38_P00014218	A_38_P00014218	mir|tca-miR-13a-3p|mir|MIMAT0008359|mir|tca-miR-13a_v16.0|mir|MIMAT0008359	tca-miR-13a-3p	MIMAT0008359	unmapped	CGCTCGGGTTTTCCCGAGCGGGCTCATCAAAGTGGCATTTTTTTTT
A_38_P00014219	A_38_P00014219	mir|tca-miR-13a-3p|mir|MIMAT0008359|mir|tca-miR-13a_v16.0|mir|MIMAT0008359	tca-miR-13a-3p	MIMAT0008359	unmapped	CGCTCGGGTTTTCCCGAGCGGGCTCATCAAAGTGGCTTATTTTTTTT
A_38_P00014225	A_38_P00014225	mir|tca-miR-276*_v16.0|mir|MIMAT0008380	tca-miR-276*_v16.0	MIMAT0008380	unmapped	CGCTCGGGTTTTCCCGAGCGGGTAGGAACTCTATACCTCTTTTTTTTTT
A_38_P00014226	A_38_P00014226	mir|tca-miR-276*_v16.0|mir|MIMAT0008380	tca-miR-276*_v16.0	MIMAT0008380	unmapped	CGCTCGGGTTTTCCCGAGCGGGTAGGAACTCTATACCTCGTTTTTTTTTT
A_38_P00014240	A_38_P00014240	mir|tca-miR-92a-3p|mir|MIMAT0008367|mir|tca-miR-92a_v16.0|mir|MIMAT0008367	tca-miR-92a-3p	MIMAT0008367	unmapped	CGCTCGGGTTTTCCCGAGCGGTAGGCCGGGACTAGATTTTTTTTT
A_38_P00014241	A_38_P00014241	mir|tca-miR-92a-3p|mir|MIMAT0008367|mir|tca-miR-92a_v16.0|mir|MIMAT0008367	tca-miR-92a-3p	MIMAT0008367	unmapped	CGCTCGGGTTTTCCCGAGCGGTAGGCCGGGACTAGTTTTTTTTTTT
A_38_P00014989	A_38_P00014989	mir|aga-miR-965|mir|MIMAT0010108	aga-miR-965	MIMAT0010108	unmapped	CGCTCGGGTTTTCCCGAGCGGAATGGGAAAAGCTATACGTATTTTTTTT
A_38_P00014990	A_38_P00014990	mir|aga-miR-965|mir|MIMAT0010108	aga-miR-965	MIMAT0010108	unmapped	CGCTCGGGTTTTCCCGAGCGGAATGGGAAAAGCTATACGCAATTTTTTTT
A_38_P00014993	A_38_P00014993	mir|aga-miR-993|mir|MIMAT0010103	aga-miR-993	MIMAT0010103	unmapped	CGCTCGGGTTTTCCCGAGCGGAGATACCTCTATAGAAACGATTTTTTTTTT
A_38_P00014994	A_38_P00014994	mir|aga-miR-993|mir|MIMAT0010103	aga-miR-993	MIMAT0010103	unmapped	CGCTCGGGTTTTCCCGAGCGGAGATACCTCTATAGAAACGAGTATTTTTTTT
A_38_P00015003	A_38_P00015003	mir|aga-miR-286|mir|MIMAT0010110	aga-miR-286	MIMAT0010110	unmapped	CGCTCGGGTTTTCCCGAGCGGGACGCGAGTGTTCTTTTTTTTTT
A_38_P00015004	A_38_P00015004	mir|aga-miR-286|mir|MIMAT0010110	aga-miR-286	MIMAT0010110	unmapped	CGCTCGGGTTTTCCCGAGCGGGACGCGAGTGTTCGTATTTTTTTT
A_38_P00015016	A_38_P00015016	mir|aga-miR-309|mir|MIMAT0010112	aga-miR-309	MIMAT0010112	unmapped	CGCTCGGGTTTTCCCGAGCGGTGCGACAAACTTTGCTTTTTTTTTT
A_38_P00015017	A_38_P00015017	mir|aga-miR-309|mir|MIMAT0010112	aga-miR-309	MIMAT0010112	unmapped	CGCTCGGGTTTTCCCGAGCGGTGCGACAAACTTTGCCTTTTTTTTTT
A_38_P00015767	A_38_P00015767	mir|dme-miR-995-5p|mir|MIMAT0010206|mir|dme-miR-995*_v16.0|mir|MIMAT0010206	dme-miR-995-5p	MIMAT0010206	unmapped	CGCTCGGGTTTTCCCGAGCGGCGCAGCTCCCACTATTTTTTTT
A_38_P00015768	A_38_P00015768	mir|dme-miR-995-5p|mir|MIMAT0010206|mir|dme-miR-995*_v16.0|mir|MIMAT0010206	dme-miR-995-5p	MIMAT0010206	unmapped	CGCTCGGGTTTTCCCGAGCGGCGCAGCTCCCACAATTTTTTTTT
A_38_P00015792	A_38_P00015792	mir|ame-miR-13b|mir|MIMAT0010114	ame-miR-13b	MIMAT0010114	unmapped	CGCTCGGGTTTTCCCGAGCGGAATCGTCAAAAATGGCTTATTTTTTTT
A_38_P00015793	A_38_P00015793	mir|ame-miR-13b|mir|MIMAT0010114	ame-miR-13b	MIMAT0010114	unmapped	CGCTCGGGTTTTCCCGAGCGGAATCGTCAAAAATGGCTGATTTTTTTTT
A_38_P00015794	A_38_P00015794	mir|ame-miR-1000|mir|MIMAT0010119	ame-miR-1000	MIMAT0010119	unmapped	CGCTCGGGTTTTCCCGAGCGGACTGCTGTGACAAGACTTTTTTTTTT
A_38_P00015795	A_38_P00015795	mir|ame-miR-1000|mir|MIMAT0010119	ame-miR-1000	MIMAT0010119	unmapped	CGCTCGGGTTTTCCCGAGCGGACTGCTGTGACAAGACATATTTTTTTT
A_38_P00015796	A_38_P00015796	mir|ame-miR-996|mir|MIMAT0010115	ame-miR-996	MIMAT0010115	unmapped	CGCTCGGGTTTTCCCGAGCGGAGACGAGTATGTATCTAGTTTTTTTTTTT
A_38_P00015797	A_38_P00015797	mir|ame-miR-996|mir|MIMAT0010115	ame-miR-996	MIMAT0010115	unmapped	CGCTCGGGTTTTCCCGAGCGGAGACGAGTATGTATCTAGTCTTTTTTTTTT
A_38_P00015800	A_38_P00015800	mir|ame-miR-316|mir|MIMAT0010122	ame-miR-316	MIMAT0010122	unmapped	CGCTCGGGTTTTCCCGAGCGGCGGCAGCAAAGCTTTTTTTTTT
A_38_P00015801	A_38_P00015801	mir|ame-miR-316|mir|MIMAT0010122	ame-miR-316	MIMAT0010122	unmapped	CGCTCGGGTTTTCCCGAGCGGCGGCAGCAAAGCGTTTTTTTTTT
A_38_P00015804	A_38_P00015804	mir|ame-miR-1006|mir|MIMAT0010120	ame-miR-1006	MIMAT0010120	unmapped	CGCTCGGGTTTTCCCGAGCGGTAATGATAGAAGAAATCGAATAATTTTTTTT
A_38_P00015805	A_38_P00015805	mir|ame-miR-1006|mir|MIMAT0010120	ame-miR-1006	MIMAT0010120	unmapped	CGCTCGGGTTTTCCCGAGCGGTAATGATAGAAGAAATCGAATTAATTTTTTTT
A_38_P00015806	A_38_P00015806	mir|ame-miR-1006|mir|MIMAT0010120	ame-miR-1006	MIMAT0010120	unmapped	CGCTCGGGTTTTCCCGAGCGGTAATGATAGAAGAAATCGAATTTATTTTTTTTT
A_38_P00015807	A_38_P00015807	mir|ame-miR-92b|mir|MIMAT0010117	ame-miR-92b	MIMAT0010117	unmapped	CGCTCGGGTTTTCCCGAGCGGTCAGGCCGGGACTTTTTTTTTT
A_38_P00015808	A_38_P00015808	mir|ame-miR-92b|mir|MIMAT0010117	ame-miR-92b	MIMAT0010117	unmapped	CGCTCGGGTTTTCCCGAGCGGTCAGGCCGGGACGTTTTTTTTTT
A_38_P00015809	A_38_P00015809	mir|ame-miR-981|mir|MIMAT0010121	ame-miR-981	MIMAT0010121	unmapped	CGCTCGGGTTTTCCCGAGCGGTGCAGGTTTCGTTGATTTTTTTTTT
A_38_P00015810	A_38_P00015810	mir|ame-miR-981|mir|MIMAT0010121	ame-miR-981	MIMAT0010121	unmapped	CGCTCGGGTTTTCCCGAGCGGTGCAGGTTTCGTTGACTTTTTTTTTT
A_38_P00015811	A_38_P00015811	mir|ame-miR-985|mir|MIMAT0010118	ame-miR-985	MIMAT0010118	unmapped	CGCTCGGGTTTTCCCGAGCGGTGCCCGATATTGGAATTTTTTTTTT
A_38_P00015812	A_38_P00015812	mir|ame-miR-985|mir|MIMAT0010118	ame-miR-985	MIMAT0010118	unmapped	CGCTCGGGTTTTCCCGAGCGGTGCCCGATATTGGAACTATTTTTTTT
A_38_P00015815	A_38_P00015815	mir|bmo-miR-274-5p|mir|MIMAT0010127|mir|bmo-miR-274_v18.0|mir|MIMAT0010127	bmo-miR-274-5p	MIMAT0010127	unmapped	CGCTCGGGTTTTCCCGAGCGGACTGCCCGTTAGTGATTTTTTTTTT
A_38_P00015816	A_38_P00015816	mir|bmo-miR-274-5p|mir|MIMAT0010127|mir|bmo-miR-274_v18.0|mir|MIMAT0010127	bmo-miR-274-5p	MIMAT0010127	unmapped	CGCTCGGGTTTTCCCGAGCGGACTGCCCGTTAGTGACTTTTTTTTTT
A_38_P00015817	A_38_P00015817	mir|bmo-miR-970-3p|mir|MIMAT0010125|mir|bmo-miR-970_v18.0|mir|MIMAT0010125	bmo-miR-970-3p	MIMAT0010125	unmapped	CGCTCGGGTTTTCCCGAGCGGAGAGCCGCGTGTGATTTTTTTTT
A_38_P00015818	A_38_P00015818	mir|bmo-miR-970-3p|mir|MIMAT0010125|mir|bmo-miR-970_v18.0|mir|MIMAT0010125	bmo-miR-970-3p	MIMAT0010125	unmapped	CGCTCGGGTTTTCCCGAGCGGAGAGCCGCGTGTGTTATTTTTTTT
A_38_P00015821	A_38_P00015821	mir|bmo-miR-993b-3p|mir|MIMAT0010128|mir|bmo-miR-993b_v18.0|mir|MIMAT0010128	bmo-miR-993b-3p	MIMAT0010128	unmapped	CGCTCGGGTTTTCCCGAGCGGATATACCTGTAGAGACGAGTATTTTTTTT
A_38_P00015822	A_38_P00015822	mir|bmo-miR-993b-3p|mir|MIMAT0010128|mir|bmo-miR-993b_v18.0|mir|MIMAT0010128	bmo-miR-993b-3p	MIMAT0010128	unmapped	CGCTCGGGTTTTCCCGAGCGGATATACCTGTAGAGACGAGCAATTTTTTTT
A_38_P00016028	A_38_P00016028	mir|tca-miR-304|mir|MIMAT0010099	tca-miR-304	MIMAT0010099	unmapped	CGCTCGGGTTTTCCCGAGCGGTACACATTTACAATTTGAGAAATTTTTTTT
A_38_P00016029	A_38_P00016029	mir|tca-miR-304|mir|MIMAT0010099	tca-miR-304	MIMAT0010099	unmapped	CGCTCGGGTTTTCCCGAGCGGTACACATTTACAATTTGAGATAATTTTTTTT
A_38_P00016030	A_38_P00016030	mir|tca-miR-304|mir|MIMAT0010099	tca-miR-304	MIMAT0010099	unmapped	CGCTCGGGTTTTCCCGAGCGGTACACATTTACAATTTGAGATTATTTTTTTTT
A_38_P00016035	A_38_P00016035	mir|tca-miR-279b-3p|mir|MIMAT0010201|mir|tca-miR-279b_v16.0|mir|MIMAT0010201	tca-miR-279b-3p	MIMAT0010201	unmapped	CGCTCGGGTTTTCCCGAGCGGTGGATGAGTGTGGATCATTTTTTTTT
A_38_P00016036	A_38_P00016036	mir|tca-miR-279b-3p|mir|MIMAT0010201|mir|tca-miR-279b_v16.0|mir|MIMAT0010201	tca-miR-279b-3p	MIMAT0010201	unmapped	CGCTCGGGTTTTCCCGAGCGGTGGATGAGTGTGGATCTTTTTTTTTTT
A_38_P00017688	A_38_P00017688	mir|dme-miR-10-3p|mir|MIMAT0012531|mir|dme-miR-10_v14.0|mir|MIMAT0012531	dme-miR-10-3p	MIMAT0012531	unmapped	CGCTCGGGTTTTCCCGAGCGGAAACCTCTCTAGAACCGTTTTTTTTTT
A_38_P00017689	A_38_P00017689	mir|dme-miR-10-3p|mir|MIMAT0012531|mir|dme-miR-10_v14.0|mir|MIMAT0012531	dme-miR-10-3p	MIMAT0012531	unmapped	CGCTCGGGTTTTCCCGAGCGGAAACCTCTCTAGAACCGATATTTTTTTT
A_38_P00017690	A_38_P00017690	mir|dme-miR-2279-3p|mir|MIMAT0011785|mir|dme-miR-2279_v16.0|mir|MIMAT0011785	dme-miR-2279-3p	MIMAT0011785	unmapped	CGCTCGGGTTTTCCCGAGCGGAAATAAATATCTTCGCGTGTTTTTTTTTT
A_38_P00017691	A_38_P00017691	mir|dme-miR-2279-3p|mir|MIMAT0011785|mir|dme-miR-2279_v16.0|mir|MIMAT0011785	dme-miR-2279-3p	MIMAT0011785	unmapped	CGCTCGGGTTTTCCCGAGCGGAAATAAATATCTTCGCGTGATTTTTTTTTT
A_38_P00017692	A_38_P00017692	mir|dme-miR-10-5p|mir|MIMAT0000115|mir|dme-miR-10*_v14.0|mir|MIMAT0000115	dme-miR-10-5p	MIMAT0000115	unmapped	CGCTCGGGTTTTCCCGAGCGGAACAAATTCGGATCTACATTTTTTTTTT
A_38_P00017693	A_38_P00017693	mir|dme-miR-10-5p|mir|MIMAT0000115|mir|dme-miR-10*_v14.0|mir|MIMAT0000115	dme-miR-10-5p	MIMAT0000115	unmapped	CGCTCGGGTTTTCCCGAGCGGAACAAATTCGGATCTACAGTTTTTTTTTT
A_38_P00017694	A_38_P00017694	mir|dme-miR-2279-5p|mir|MIMAT0011784|mir|dme-miR-2279*_v16.0|mir|MIMAT0011784	dme-miR-2279-5p	MIMAT0011784	unmapped	CGCTCGGGTTTTCCCGAGCGGAATTTCACACACAGATATTTTTTTTTTTTT
A_38_P00017695	A_38_P00017695	mir|dme-miR-2279-5p|mir|MIMAT0011784|mir|dme-miR-2279*_v16.0|mir|MIMAT0011784	dme-miR-2279-5p	MIMAT0011784	unmapped	CGCTCGGGTTTTCCCGAGCGGAATTTCACACACAGATATTTATTTTTTTTTT
A_38_P00017696	A_38_P00017696	mir|dme-miR-2279-5p|mir|MIMAT0011784|mir|dme-miR-2279*_v16.0|mir|MIMAT0011784	dme-miR-2279-5p	MIMAT0011784	unmapped	CGCTCGGGTTTTCCCGAGCGGAATTTCACACACAGATATTTAATTTTTTTTTT
A_38_P00017697	A_38_P00017697	mir|dme-miR-2280-5p|mir|MIMAT0011786|mir|dme-miR-2280_v16.0|mir|MIMAT0011786	dme-miR-2280-5p	MIMAT0011786	unmapped	CGCTCGGGTTTTCCCGAGCGGATATTTTATTGCCAAGCTAAGTTTTTTTTTT
A_38_P00017698	A_38_P00017698	mir|dme-miR-2280-5p|mir|MIMAT0011786|mir|dme-miR-2280_v16.0|mir|MIMAT0011786	dme-miR-2280-5p	MIMAT0011786	unmapped	CGCTCGGGTTTTCCCGAGCGGATATTTTATTGCCAAGCTAAGATTTTTTTTTT
A_38_P00017699	A_38_P00017699	mir|dme-miR-2282-3p|mir|MIMAT0011790|mir|dme-miR-2282_v16.0|mir|MIMAT0011790	dme-miR-2282-3p	MIMAT0011790	unmapped	CGCTCGGGTTTTCCCGAGCGGATTCTATTTTTAGCTCACCTTTTTTTTTT
A_38_P00017700	A_38_P00017700	mir|dme-miR-2282-3p|mir|MIMAT0011790|mir|dme-miR-2282_v16.0|mir|MIMAT0011790	dme-miR-2282-3p	MIMAT0011790	unmapped	CGCTCGGGTTTTCCCGAGCGGATTCTATTTTTAGCTCACCGTATTTTTTTT
A_38_P00017701	A_38_P00017701	mir|dme-miR-2283-5p|mir|MIMAT0011791|mir|dme-miR-2283_v16.0|mir|MIMAT0011791	dme-miR-2283-5p	MIMAT0011791	unmapped	CGCTCGGGTTTTCCCGAGCGGATTGTCGTATTCATGATATTTATTTTTTTTT
A_38_P00017702	A_38_P00017702	mir|dme-miR-2283-5p|mir|MIMAT0011791|mir|dme-miR-2283_v16.0|mir|MIMAT0011791	dme-miR-2283-5p	MIMAT0011791	unmapped	CGCTCGGGTTTTCCCGAGCGGATTGTCGTATTCATGATATTTTTTTTTTTTTT
A_38_P00017703	A_38_P00017703	mir|dme-miR-2283-5p|mir|MIMAT0011791|mir|dme-miR-2283_v16.0|mir|MIMAT0011791	dme-miR-2283-5p	MIMAT0011791	unmapped	CGCTCGGGTTTTCCCGAGCGGATTGTCGTATTCATGATATTTTCTTTTTTTTTT
A_38_P00017704	A_38_P00017704	mir|dme-miR-2281-3p|mir|MIMAT0011789|mir|dme-miR-2281_v16.0|mir|MIMAT0011789	dme-miR-2281-3p	MIMAT0011789	unmapped	CGCTCGGGTTTTCCCGAGCGGGCAATACTGCAGATACATTTTTTTTTT
A_38_P00017705	A_38_P00017705	mir|dme-miR-2281-3p|mir|MIMAT0011789|mir|dme-miR-2281_v16.0|mir|MIMAT0011789	dme-miR-2281-3p	MIMAT0011789	unmapped	CGCTCGGGTTTTCCCGAGCGGGCAATACTGCAGATACAGTATTTTTTTT
A_38_P00017706	A_38_P00017706	mir|dme-miR-2280-3p|mir|MIMAT0011787|mir|dme-miR-2280*_v16.0|mir|MIMAT0011787	dme-miR-2280-3p	MIMAT0011787	unmapped	CGCTCGGGTTTTCCCGAGCGGTCAGTTAGCTTGGAAGTTTTTTTTTTT
A_38_P00017707	A_38_P00017707	mir|dme-miR-2280-3p|mir|MIMAT0011787|mir|dme-miR-2280*_v16.0|mir|MIMAT0011787	dme-miR-2280-3p	MIMAT0011787	unmapped	CGCTCGGGTTTTCCCGAGCGGTCAGTTAGCTTGGAAGTATTTTTTTTTT
A_38_P00017708	A_38_P00017708	mir|dme-miR-2280-3p|mir|MIMAT0011787|mir|dme-miR-2280*_v16.0|mir|MIMAT0011787	dme-miR-2280-3p	MIMAT0011787	unmapped	CGCTCGGGTTTTCCCGAGCGGTCAGTTAGCTTGGAAGTAATATTTTTTTT
A_38_P00017709	A_38_P00017709	mir|dme-miR-2281-5p|mir|MIMAT0011788|mir|dme-miR-2281*_v16.0|mir|MIMAT0011788	dme-miR-2281-5p	MIMAT0011788	unmapped	CGCTCGGGTTTTCCCGAGCGGTTGCATCTGCAGCTGTTTTTTTTTT
A_38_P00017710	A_38_P00017710	mir|dme-miR-2281-5p|mir|MIMAT0011788|mir|dme-miR-2281*_v16.0|mir|MIMAT0011788	dme-miR-2281-5p	MIMAT0011788	unmapped	CGCTCGGGTTTTCCCGAGCGGTTGCATCTGCAGCTGCTTTTTTTTTT
A_38_P00017922	A_38_P00017922	mir|bmo-miR-2751|mir|MIMAT0012631	bmo-miR-2751	MIMAT0012631	unmapped	CGCTCGGGTTTTCCCGAGCGGAAACGCTCCACGGTTTTTTTTTT
A_38_P00017923	A_38_P00017923	mir|bmo-miR-2751|mir|MIMAT0012631	bmo-miR-2751	MIMAT0012631	unmapped	CGCTCGGGTTTTCCCGAGCGGAAACGCTCCACGGCTTTTTTTTTT
A_38_P00017924	A_38_P00017924	mir|bmo-miR-2742|mir|MIMAT0012620	bmo-miR-2742	MIMAT0012620	unmapped	CGCTCGGGTTTTCCCGAGCGGAACACTAATCCAATGATTTTTTTTTT
A_38_P00017925	A_38_P00017925	mir|bmo-miR-2742|mir|MIMAT0012620	bmo-miR-2742	MIMAT0012620	unmapped	CGCTCGGGTTTTCCCGAGCGGAACACTAATCCAATGAATTTTTTTTTT
A_38_P00017926	A_38_P00017926	mir|bmo-miR-2742|mir|MIMAT0012620	bmo-miR-2742	MIMAT0012620	unmapped	CGCTCGGGTTTTCCCGAGCGGAACACTAATCCAATGAAATTTTTTTTTT
A_38_P00017927	A_38_P00017927	mir|bmo-miR-2742|mir|MIMAT0012620	bmo-miR-2742	MIMAT0012620	unmapped	CGCTCGGGTTTTCCCGAGCGGAACACTAATCCAATGAAAATTTTTTTTTT
A_38_P00017932	A_38_P00017932	mir|bmo-miR-2737|mir|MIMAT0012615	bmo-miR-2737	MIMAT0012615	unmapped	CGCTCGGGTTTTCCCGAGCGGACAAATCTGGACAGTATAATTTTTTTTTT
A_38_P00017933	A_38_P00017933	mir|bmo-miR-2737|mir|MIMAT0012615	bmo-miR-2737	MIMAT0012615	unmapped	CGCTCGGGTTTTCCCGAGCGGACAAATCTGGACAGTATAAATTTTTTTTTT
A_38_P00017934	A_38_P00017934	mir|bmo-miR-2737|mir|MIMAT0012615	bmo-miR-2737	MIMAT0012615	unmapped	CGCTCGGGTTTTCCCGAGCGGACAAATCTGGACAGTATAAAATTTTTTTTTT
A_38_P00017935	A_38_P00017935	mir|bmo-miR-2733b|mir|MIMAT0013777	bmo-miR-2733b	MIMAT0013777	unmapped	CGCTCGGGTTTTCCCGAGCGGACAATCATCACGCACTTTTTTTTTT
A_38_P00017936	A_38_P00017936	mir|bmo-miR-2733b|mir|MIMAT0013777	bmo-miR-2733b	MIMAT0013777	unmapped	CGCTCGGGTTTTCCCGAGCGGACAATCATCACGCACCTTTTTTTTTT
A_38_P00017937	A_38_P00017937	mir|bmo-miR-2733a-5p|mir|MIMAT0012611|mir|bmo-miR-2733a_v18.0|mir|MIMAT0012611	bmo-miR-2733a-5p	MIMAT0012611	unmapped	CGCTCGGGTTTTCCCGAGCGGACAATCATCATGCACCTTTTTTTTTT
A_38_P00017938	A_38_P00017938	mir|bmo-miR-2733a-5p|mir|MIMAT0012611|mir|bmo-miR-2733a_v18.0|mir|MIMAT0012611	bmo-miR-2733a-5p	MIMAT0012611	unmapped	CGCTCGGGTTTTCCCGAGCGGACAATCATCATGCACCCTTTTTTTTTT
A_38_P00017939	A_38_P00017939	mir|bmo-miR-2729|mir|MIMAT0012606	bmo-miR-2729	MIMAT0012606	unmapped	CGCTCGGGTTTTCCCGAGCGGATGGACCGACCTCAATTTTTTTTT
A_38_P00017940	A_38_P00017940	mir|bmo-miR-2729|mir|MIMAT0012606	bmo-miR-2729	MIMAT0012606	unmapped	CGCTCGGGTTTTCCCGAGCGGATGGACCGACCTCATTTTTTTTTTT
A_38_P00017941	A_38_P00017941	mir|bmo-miR-2729|mir|MIMAT0012606	bmo-miR-2729	MIMAT0012606	unmapped	CGCTCGGGTTTTCCCGAGCGGATGGACCGACCTCATATTTTTTTTTT
A_38_P00017942	A_38_P00017942	mir|bmo-miR-2729|mir|MIMAT0012606	bmo-miR-2729	MIMAT0012606	unmapped	CGCTCGGGTTTTCCCGAGCGGATGGACCGACCTCATAATTTTTTTTTT
A_38_P00017943	A_38_P00017943	mir|bmo-miR-2723|mir|MIMAT0012599	bmo-miR-2723	MIMAT0012599	unmapped	CGCTCGGGTTTTCCCGAGCGGCACAGACGTCCACTTTTTTTTTTT
A_38_P00017944	A_38_P00017944	mir|bmo-miR-2723|mir|MIMAT0012599	bmo-miR-2723	MIMAT0012599	unmapped	CGCTCGGGTTTTCCCGAGCGGCACAGACGTCCACTGTATTTTTTTT
A_38_P00017945	A_38_P00017945	mir|bmo-miR-2738|mir|MIMAT0012616	bmo-miR-2738	MIMAT0012616	unmapped	CGCTCGGGTTTTCCCGAGCGGCATCAGATGGCCGTATTTTTTTTT
A_38_P00017946	A_38_P00017946	mir|bmo-miR-2738|mir|MIMAT0012616	bmo-miR-2738	MIMAT0012616	unmapped	CGCTCGGGTTTTCCCGAGCGGCATCAGATGGCCGTTTATTTTTTTT
A_38_P00017951	A_38_P00017951	mir|bmo-miR-2748|mir|MIMAT0012627	bmo-miR-2748	MIMAT0012627	unmapped	CGCTCGGGTTTTCCCGAGCGGCCCACTGAGTTTTCTTTTTTTTTTT
A_38_P00017952	A_38_P00017952	mir|bmo-miR-2748|mir|MIMAT0012627	bmo-miR-2748	MIMAT0012627	unmapped	CGCTCGGGTTTTCCCGAGCGGCCCACTGAGTTTTCTCTTTTTTTTTT
A_38_P00017957	A_38_P00017957	mir|bmo-miR-2739|mir|MIMAT0012617	bmo-miR-2739	MIMAT0012617	unmapped	CGCTCGGGTTTTCCCGAGCGGCCTCCACACCATAATATTTTTTTTTTT
A_38_P00017958	A_38_P00017958	mir|bmo-miR-2739|mir|MIMAT0012617	bmo-miR-2739	MIMAT0012617	unmapped	CGCTCGGGTTTTCCCGAGCGGCCTCCACACCATAATATCTTTTTTTTTT
A_38_P00017959	A_38_P00017959	mir|bmo-miR-2744|mir|MIMAT0012623	bmo-miR-2744	MIMAT0012623	unmapped	CGCTCGGGTTTTCCCGAGCGGCTAGCTAGGACTCTCATTTTTTTTTT
A_38_P00017960	A_38_P00017960	mir|bmo-miR-2744|mir|MIMAT0012623	bmo-miR-2744	MIMAT0012623	unmapped	CGCTCGGGTTTTCCCGAGCGGCTAGCTAGGACTCTCAATTTTTTTTTT
A_38_P00017961	A_38_P00017961	mir|bmo-miR-2744|mir|MIMAT0012623	bmo-miR-2744	MIMAT0012623	unmapped	CGCTCGGGTTTTCCCGAGCGGCTAGCTAGGACTCTCAAATTTTTTTTTT
A_38_P00017962	A_38_P00017962	mir|bmo-miR-2736|mir|MIMAT0012614	bmo-miR-2736	MIMAT0012614	unmapped	CGCTCGGGTTTTCCCGAGCGGCTGCTGGTACCATCTTTTTTTTTT
A_38_P00017963	A_38_P00017963	mir|bmo-miR-2736|mir|MIMAT0012614	bmo-miR-2736	MIMAT0012614	unmapped	CGCTCGGGTTTTCCCGAGCGGCTGCTGGTACCATCGTTTTTTTTTT
A_38_P00017971	A_38_P00017971	mir|bmo-miR-2745|mir|MIMAT0012624	bmo-miR-2745	MIMAT0012624	unmapped	CGCTCGGGTTTTCCCGAGCGGGCCCGAAAGACCTTTTTTTTTT
A_38_P00017972	A_38_P00017972	mir|bmo-miR-2745|mir|MIMAT0012624	bmo-miR-2745	MIMAT0012624	unmapped	CGCTCGGGTTTTCCCGAGCGGGCCCGAAAGACCGTTTTTTTTTT
A_38_P00017973	A_38_P00017973	mir|bmo-miR-2734|mir|MIMAT0012612	bmo-miR-2734	MIMAT0012612	unmapped	CGCTCGGGTTTTCCCGAGCGGGCGACTACCAGACATTTTTTTTTT
A_38_P00017974	A_38_P00017974	mir|bmo-miR-2734|mir|MIMAT0012612	bmo-miR-2734	MIMAT0012612	unmapped	CGCTCGGGTTTTCCCGAGCGGGCGACTACCAGACACTTTTTTTTTT
A_38_P00017975	A_38_P00017975	mir|bmo-miR-2724|mir|MIMAT0012600	bmo-miR-2724	MIMAT0012600	unmapped	CGCTCGGGTTTTCCCGAGCGGGGAGCTATCACACCTTTTTTTTTT
A_38_P00017976	A_38_P00017976	mir|bmo-miR-2724|mir|MIMAT0012600	bmo-miR-2724	MIMAT0012600	unmapped	CGCTCGGGTTTTCCCGAGCGGGGAGCTATCACACCGTTTTTTTTTT
A_38_P00017983	A_38_P00017983	mir|bmo-miR-9c-3p|mir|MIMAT0012621|mir|bmo-miR-9c_v18.0|mir|MIMAT0012621	bmo-miR-9c-3p	MIMAT0012621	unmapped	CGCTCGGGTTTTCCCGAGCGGTAACTTCGGTACCATAACAATTTTTTTT
A_38_P00017984	A_38_P00017984	mir|bmo-miR-9c-3p|mir|MIMAT0012621|mir|bmo-miR-9c_v18.0|mir|MIMAT0012621	bmo-miR-9c-3p	MIMAT0012621	unmapped	CGCTCGGGTTTTCCCGAGCGGTAACTTCGGTACCATAACTAATTTTTTTT
A_38_P00017985	A_38_P00017985	mir|bmo-miR-2753|mir|MIMAT0012604	bmo-miR-2753	MIMAT0012604	unmapped	CGCTCGGGTTTTCCCGAGCGGTACCAGCTTCTTCCATTATTTTTTTTT
A_38_P00017986	A_38_P00017986	mir|bmo-miR-2753|mir|MIMAT0012604	bmo-miR-2753	MIMAT0012604	unmapped	CGCTCGGGTTTTCCCGAGCGGTACCAGCTTCTTCCATTTTTTTTTTTTT
A_38_P00017987	A_38_P00017987	mir|bmo-miR-306a-5p|mir|MIMAT0012629|mir|bmo-miR-306_v16.0|mir|MIMAT0012629|mir|bmo-miR-306a_v18.0|mir|MIMAT0012629	bmo-miR-306a-5p	MIMAT0012629	unmapped	CGCTCGGGTTTTCCCGAGCGGTCAGAGTCACCTAGTACTATTTTTTTT
A_38_P00017988	A_38_P00017988	mir|bmo-miR-306a-5p|mir|MIMAT0012629|mir|bmo-miR-306_v16.0|mir|MIMAT0012629|mir|bmo-miR-306a_v18.0|mir|MIMAT0012629	bmo-miR-306a-5p	MIMAT0012629	unmapped	CGCTCGGGTTTTCCCGAGCGGTCAGAGTCACCTAGTACCATTTTTTTTT
A_38_P00017991	A_38_P00017991	mir|bmo-miR-2731|mir|MIMAT0012608|mir|bmo-miR-2731a_v14.0|mir|MIMAT0012608|mir|bmo-miR-2731b_v14.0|mir|MIMAT0012609	bmo-miR-2731	MIMAT0012608	unmapped	CGCTCGGGTTTTCCCGAGCGGTCCACATACCATGGTCATTTTTTTTT
A_38_P00017992	A_38_P00017992	mir|bmo-miR-2731|mir|MIMAT0012608|mir|bmo-miR-2731a_v14.0|mir|MIMAT0012608|mir|bmo-miR-2731b_v14.0|mir|MIMAT0012609	bmo-miR-2731	MIMAT0012608	unmapped	CGCTCGGGTTTTCCCGAGCGGTCCACATACCATGGTCTTTTTTTTTTT
A_38_P00017995	A_38_P00017995	mir|bmo-miR-2752|mir|MIMAT0012632	bmo-miR-2752	MIMAT0012632	unmapped	CGCTCGGGTTTTCCCGAGCGGTCCGTGGCCATCGATTTTTTTTT
A_38_P00017996	A_38_P00017996	mir|bmo-miR-2752|mir|MIMAT0012632	bmo-miR-2752	MIMAT0012632	unmapped	CGCTCGGGTTTTCCCGAGCGGTCCGTGGCCATCGTTATTTTTTTT
A_38_P00017997	A_38_P00017997	mir|bmo-miR-989a|mir|MIMAT0012633|mir|bmo-miR-989_v18.0|mir|MIMAT0012633	bmo-miR-989a	MIMAT0012633	unmapped	CGCTCGGGTTTTCCCGAGCGGTTCCACTACGTCACATTTTTTTTTTT
A_38_P00017998	A_38_P00017998	mir|bmo-miR-989a|mir|MIMAT0012633|mir|bmo-miR-989_v18.0|mir|MIMAT0012633	bmo-miR-989a	MIMAT0012633	unmapped	CGCTCGGGTTTTCCCGAGCGGTTCCACTACGTCACATCTTTTTTTTTT
A_38_P00020069	A_38_P00020069	mir|dme-miR-2501*_v15.0|mir|MIMAT0012217	dme-miR-2501*_v15.0	MIMAT0012217	unmapped	CGCTCGGGTTTTCCCGAGCGGAAAGAAAGTTTGATTGCAATTTTTTTTTT
A_38_P00020070	A_38_P00020070	mir|dme-miR-2501*_v15.0|mir|MIMAT0012217	dme-miR-2501*_v15.0	MIMAT0012217	unmapped	CGCTCGGGTTTTCCCGAGCGGAAAGAAAGTTTGATTGCAAGTTTTTTTTTT
A_38_P00020071	A_38_P00020071	mir|dme-miR-2497-5p|mir|MIMAT0012208|mir|dme-miR-2497*_v16.0|mir|MIMAT0012208	dme-miR-2497-5p	MIMAT0012208	unmapped	CGCTCGGGTTTTCCCGAGCGGAACAACTACATTTTGCAATTTTTTTTTTT
A_38_P00020072	A_38_P00020072	mir|dme-miR-2497-5p|mir|MIMAT0012208|mir|dme-miR-2497*_v16.0|mir|MIMAT0012208	dme-miR-2497-5p	MIMAT0012208	unmapped	CGCTCGGGTTTTCCCGAGCGGAACAACTACATTTTGCAATGTATTTTTTTT
A_38_P00020073	A_38_P00020073	mir|dme-miR-2498-3p|mir|MIMAT0012211|mir|dme-miR-2498_v16.0|mir|MIMAT0012211	dme-miR-2498-3p	MIMAT0012211	unmapped	CGCTCGGGTTTTCCCGAGCGGAAGTAAGACGGGAATGTTTTTTTTTT
A_38_P00020074	A_38_P00020074	mir|dme-miR-2498-3p|mir|MIMAT0012211|mir|dme-miR-2498_v16.0|mir|MIMAT0012211	dme-miR-2498-3p	MIMAT0012211	unmapped	CGCTCGGGTTTTCCCGAGCGGAAGTAAGACGGGAATGCTTTTTTTTTT
A_38_P00020075	A_38_P00020075	mir|dme-miR-2493-3p|mir|MIMAT0012201|mir|dme-miR-2493_v16.0|mir|MIMAT0012201	dme-miR-2493-3p	MIMAT0012201	unmapped	CGCTCGGGTTTTCCCGAGCGGACGCCTCGCACATTTTTTTTTT
A_38_P00020076	A_38_P00020076	mir|dme-miR-2493-3p|mir|MIMAT0012201|mir|dme-miR-2493_v16.0|mir|MIMAT0012201	dme-miR-2493-3p	MIMAT0012201	unmapped	CGCTCGGGTTTTCCCGAGCGGACGCCTCGCACAATATTTTTTTT
A_38_P00020077	A_38_P00020077	mir|dme-miR-2493-3p|mir|MIMAT0012201|mir|dme-miR-2493_v16.0|mir|MIMAT0012201	dme-miR-2493-3p	MIMAT0012201	unmapped	CGCTCGGGTTTTCCCGAGCGGACGCCTCGCACAAAATTTTTTTTT
A_38_P00020078	A_38_P00020078	mir|dme-miR-2489-3p|mir|MIMAT0012196|mir|dme-miR-2489_v16.0|mir|MIMAT0012196	dme-miR-2489-3p	MIMAT0012196	unmapped	CGCTCGGGTTTTCCCGAGCGGACTGCAAATACAACATACATATTTTTTTT
A_38_P00020079	A_38_P00020079	mir|dme-miR-2489-3p|mir|MIMAT0012196|mir|dme-miR-2489_v16.0|mir|MIMAT0012196	dme-miR-2489-3p	MIMAT0012196	unmapped	CGCTCGGGTTTTCCCGAGCGGACTGCAAATACAACATACAAATTTTTTTTT
A_38_P00020080	A_38_P00020080	mir|dme-miR-2491-5p|mir|MIMAT0012198|mir|dme-miR-2491_v16.0|mir|MIMAT0012198	dme-miR-2491-5p	MIMAT0012198	unmapped	CGCTCGGGTTTTCCCGAGCGGAGCAACTGCAAAGGTTTTTTTTTT
A_38_P00020081	A_38_P00020081	mir|dme-miR-2491-5p|mir|MIMAT0012198|mir|dme-miR-2491_v16.0|mir|MIMAT0012198	dme-miR-2491-5p	MIMAT0012198	unmapped	CGCTCGGGTTTTCCCGAGCGGAGCAACTGCAAAGGCTTTTTTTTTT
A_38_P00020082	A_38_P00020082	mir|dme-miR-2495-5p|mir|MIMAT0012204|mir|dme-miR-2495_v16.0|mir|MIMAT0012204	dme-miR-2495-5p	MIMAT0012204	unmapped	CGCTCGGGTTTTCCCGAGCGGAGTCAGCCCAATTGAATATTTTTTTT
A_38_P00020083	A_38_P00020083	mir|dme-miR-2495-5p|mir|MIMAT0012204|mir|dme-miR-2495_v16.0|mir|MIMAT0012204	dme-miR-2495-5p	MIMAT0012204	unmapped	CGCTCGGGTTTTCCCGAGCGGAGTCAGCCCAATTGAAGATTTTTTTTT
A_38_P00020084	A_38_P00020084	mir|dme-miR-2498-5p|mir|MIMAT0012210|mir|dme-miR-2498*_v16.0|mir|MIMAT0012210	dme-miR-2498-5p	MIMAT0012210	unmapped	CGCTCGGGTTTTCCCGAGCGGCAAAAATAAGCATAACAGCTATTTTTTTT
A_38_P00020085	A_38_P00020085	mir|dme-miR-2498-5p|mir|MIMAT0012210|mir|dme-miR-2498*_v16.0|mir|MIMAT0012210	dme-miR-2498-5p	MIMAT0012210	unmapped	CGCTCGGGTTTTCCCGAGCGGCAAAAATAAGCATAACAGCCAATTTTTTTT
A_38_P00020086	A_38_P00020086	mir|dme-miR-307b-5p|mir|MIMAT0012194|mir|dme-miR-307-as*_v16.0|mir|MIMAT0012194	dme-miR-307b-5p	MIMAT0012194	unmapped	CGCTCGGGTTTTCCCGAGCGGCCATCACAACCTCCTATTTTTTTTT
A_38_P00020087	A_38_P00020087	mir|dme-miR-307b-5p|mir|MIMAT0012194|mir|dme-miR-307-as*_v16.0|mir|MIMAT0012194	dme-miR-307b-5p	MIMAT0012194	unmapped	CGCTCGGGTTTTCCCGAGCGGCCATCACAACCTCCTTTTTTTTTTTT
A_38_P00020088	A_38_P00020088	mir|dme-miR-2500-3p|mir|MIMAT0012215|mir|dme-miR-2500_v16.0|mir|MIMAT0012215	dme-miR-2500-3p	MIMAT0012215	unmapped	CGCTCGGGTTTTCCCGAGCGGCTGAGGTCCACACATTTTTTTTTT
A_38_P00020089	A_38_P00020089	mir|dme-miR-2500-3p|mir|MIMAT0012215|mir|dme-miR-2500_v16.0|mir|MIMAT0012215	dme-miR-2500-3p	MIMAT0012215	unmapped	CGCTCGGGTTTTCCCGAGCGGCTGAGGTCCACACACTTTTTTTTTT
A_38_P00020090	A_38_P00020090	mir|dme-miR-2497-3p|mir|MIMAT0012209|mir|dme-miR-2497_v16.0|mir|MIMAT0012209	dme-miR-2497-3p	MIMAT0012209	unmapped	CGCTCGGGTTTTCCCGAGCGGCTGCAAACATTGTAAATGAATTTTTTTT
A_38_P00020091	A_38_P00020091	mir|dme-miR-2497-3p|mir|MIMAT0012209|mir|dme-miR-2497_v16.0|mir|MIMAT0012209	dme-miR-2497-3p	MIMAT0012209	unmapped	CGCTCGGGTTTTCCCGAGCGGCTGCAAACATTGTAAATGTATTTTTTTTT
A_38_P00020092	A_38_P00020092	mir|dme-miR-2494-3p|mir|MIMAT0012203|mir|dme-miR-2494_v16.0|mir|MIMAT0012203	dme-miR-2494-3p	MIMAT0012203	unmapped	CGCTCGGGTTTTCCCGAGCGGCTTGTAAGTGGACATTACATTTTTTTTT
A_38_P00020093	A_38_P00020093	mir|dme-miR-2494-3p|mir|MIMAT0012203|mir|dme-miR-2494_v16.0|mir|MIMAT0012203	dme-miR-2494-3p	MIMAT0012203	unmapped	CGCTCGGGTTTTCCCGAGCGGCTTGTAAGTGGACATTACTTTTTTTTTTT
A_38_P00020094	A_38_P00020094	mir|dme-miR-307b-3p|mir|MIMAT0012195|mir|dme-miR-307-as_v16.0|mir|MIMAT0012195	dme-miR-307b-3p	MIMAT0012195	unmapped	CGCTCGGGTTTTCCCGAGCGGGACTCACTCAACCTGTTTTTTTTTT
A_38_P00020095	A_38_P00020095	mir|dme-miR-307b-3p|mir|MIMAT0012195|mir|dme-miR-307-as_v16.0|mir|MIMAT0012195	dme-miR-307b-3p	MIMAT0012195	unmapped	CGCTCGGGTTTTCCCGAGCGGGACTCACTCAACCTGGTATTTTTTTT
A_38_P00020096	A_38_P00020096	mir|dme-miR-2499-5p|mir|MIMAT0012212|mir|dme-miR-2499*_v16.0|mir|MIMAT0012212	dme-miR-2499-5p	MIMAT0012212	unmapped	CGCTCGGGTTTTCCCGAGCGGGCATTGCGCTGACTATTTTTTTT
A_38_P00020097	A_38_P00020097	mir|dme-miR-2499-5p|mir|MIMAT0012212|mir|dme-miR-2499*_v16.0|mir|MIMAT0012212	dme-miR-2499-5p	MIMAT0012212	unmapped	CGCTCGGGTTTTCCCGAGCGGGCATTGCGCTGACGATTTTTTTTT
A_38_P00020098	A_38_P00020098	mir|dme-miR-2495-3p|mir|MIMAT0012205|mir|dme-miR-2495*_v16.0|mir|MIMAT0012205	dme-miR-2495-3p	MIMAT0012205	unmapped	CGCTCGGGTTTTCCCGAGCGGGGCGGGCATTTCATATTTTTTTT
A_38_P00020099	A_38_P00020099	mir|dme-miR-2495-3p|mir|MIMAT0012205|mir|dme-miR-2495*_v16.0|mir|MIMAT0012205	dme-miR-2495-3p	MIMAT0012205	unmapped	CGCTCGGGTTTTCCCGAGCGGGGCGGGCATTTCAAAATTTTTTTT
A_38_P00020100	A_38_P00020100	mir|dme-miR-2500-5p|mir|MIMAT0012214|mir|dme-miR-2500*_v16.0|mir|MIMAT0012214	dme-miR-2500-5p	MIMAT0012214	unmapped	CGCTCGGGTTTTCCCGAGCGGGGTATTGTATATGTGTGTTTTTTTTTTTT
A_38_P00020101	A_38_P00020101	mir|dme-miR-2500-5p|mir|MIMAT0012214|mir|dme-miR-2500*_v16.0|mir|MIMAT0012214	dme-miR-2500-5p	MIMAT0012214	unmapped	CGCTCGGGTTTTCCCGAGCGGGGTATTGTATATGTGTGTTCTATTTTTTTT
A_38_P00020102	A_38_P00020102	mir|dme-miR-2496-5p|mir|MIMAT0012206|mir|dme-miR-2496*_v16.0|mir|MIMAT0012206	dme-miR-2496-5p	MIMAT0012206	unmapped	CGCTCGGGTTTTCCCGAGCGGTACGATGGCCTCTCATTTTTTTTTT
A_38_P00020103	A_38_P00020103	mir|dme-miR-2496-5p|mir|MIMAT0012206|mir|dme-miR-2496*_v16.0|mir|MIMAT0012206	dme-miR-2496-5p	MIMAT0012206	unmapped	CGCTCGGGTTTTCCCGAGCGGTACGATGGCCTCTCACTTTTTTTTTT
A_38_P00020104	A_38_P00020104	mir|dme-miR-2499-3p|mir|MIMAT0012213|mir|dme-miR-2499_v16.0|mir|MIMAT0012213	dme-miR-2499-3p	MIMAT0012213	unmapped	CGCTCGGGTTTTCCCGAGCGGTACGGACGTGAATGTTTTTTTTTTT
A_38_P00020105	A_38_P00020105	mir|dme-miR-2499-3p|mir|MIMAT0012213|mir|dme-miR-2499_v16.0|mir|MIMAT0012213	dme-miR-2499-3p	MIMAT0012213	unmapped	CGCTCGGGTTTTCCCGAGCGGTACGGACGTGAATGTCTATTTTTTTT
A_38_P00020106	A_38_P00020106	mir|dme-miR-2496-3p|mir|MIMAT0012207|mir|dme-miR-2496_v16.0|mir|MIMAT0012207	dme-miR-2496-3p	MIMAT0012207	unmapped	CGCTCGGGTTTTCCCGAGCGGTATGCGTGTGTGAGTGTTTTTTTTTT
A_38_P00020107	A_38_P00020107	mir|dme-miR-2496-3p|mir|MIMAT0012207|mir|dme-miR-2496_v16.0|mir|MIMAT0012207	dme-miR-2496-3p	MIMAT0012207	unmapped	CGCTCGGGTTTTCCCGAGCGGTATGCGTGTGTGAGTGCTTTTTTTTTT
A_38_P00020108	A_38_P00020108	mir|dme-miR-2493-5p|mir|MIMAT0012200|mir|dme-miR-2493*_v16.0|mir|MIMAT0012200	dme-miR-2493-5p	MIMAT0012200	unmapped	CGCTCGGGTTTTCCCGAGCGGTGGCTGTGTGTGTGATTTTTTTTT
A_38_P00020109	A_38_P00020109	mir|dme-miR-2493-5p|mir|MIMAT0012200|mir|dme-miR-2493*_v16.0|mir|MIMAT0012200	dme-miR-2493-5p	MIMAT0012200	unmapped	CGCTCGGGTTTTCCCGAGCGGTGGCTGTGTGTGTGTTATTTTTTTT
A_38_P00020110	A_38_P00020110	mir|dme-miR-2501_v15.0|mir|MIMAT0012216	dme-miR-2501_v15.0	MIMAT0012216	unmapped	CGCTCGGGTTTTCCCGAGCGGTTAGCCCAGGCACTTTTTTTTTTT
A_38_P00020111	A_38_P00020111	mir|dme-miR-2501_v15.0|mir|MIMAT0012216	dme-miR-2501_v15.0	MIMAT0012216	unmapped	CGCTCGGGTTTTCCCGAGCGGTTAGCCCAGGCACTCTTTTTTTTTT
A_38_P00020112	A_38_P00020112	mir|dme-miR-2494-5p|mir|MIMAT0012202|mir|dme-miR-2494*_v16.0|mir|MIMAT0012202	dme-miR-2494-5p	MIMAT0012202	unmapped	CGCTCGGGTTTTCCCGAGCGGTTCCCAATCTGGTGCTTTTTTTTTT
A_38_P00020113	A_38_P00020113	mir|dme-miR-2494-5p|mir|MIMAT0012202|mir|dme-miR-2494*_v16.0|mir|MIMAT0012202	dme-miR-2494-5p	MIMAT0012202	unmapped	CGCTCGGGTTTTCCCGAGCGGTTCCCAATCTGGTGCATATTTTTTTT
A_38_P00020114	A_38_P00020114	mir|dme-miR-2490-5p|mir|MIMAT0012197|mir|dme-miR-2490_v16.0|mir|MIMAT0012197	dme-miR-2490-5p	MIMAT0012197	unmapped	CGCTCGGGTTTTCCCGAGCGGTTGCAACCTGCTTTATCTTTTTTTTTT
A_38_P00020115	A_38_P00020115	mir|dme-miR-2490-5p|mir|MIMAT0012197|mir|dme-miR-2490_v16.0|mir|MIMAT0012197	dme-miR-2490-5p	MIMAT0012197	unmapped	CGCTCGGGTTTTCCCGAGCGGTTGCAACCTGCTTTATCGTATTTTTTTT
A_38_P00020116	A_38_P00020116	mir|dme-miR-2492-3p|mir|MIMAT0012199|mir|dme-miR-2492_v16.0|mir|MIMAT0012199	dme-miR-2492-3p	MIMAT0012199	unmapped	CGCTCGGGTTTTCCCGAGCGGTTTGAAAGCTCTCGACTTTTTTTTTT
A_38_P00020117	A_38_P00020117	mir|dme-miR-2492-3p|mir|MIMAT0012199|mir|dme-miR-2492_v16.0|mir|MIMAT0012199	dme-miR-2492-3p	MIMAT0012199	unmapped	CGCTCGGGTTTTCCCGAGCGGTTTGAAAGCTCTCGACATTTTTTTTTT
A_38_P00020783	A_38_P00020783	mir|bmo-miR-3259|mir|MIMAT0015443	bmo-miR-3259	MIMAT0015443	unmapped	CGCTCGGGTTTTCCCGAGCGGAAAAGATTTTCTTGTCAATTGTTTTTTTTTT
A_38_P00020784	A_38_P00020784	mir|bmo-miR-3259|mir|MIMAT0015443	bmo-miR-3259	MIMAT0015443	unmapped	CGCTCGGGTTTTCCCGAGCGGAAAAGATTTTCTTGTCAATTGCTTTTTTTTTT
A_38_P00020785	A_38_P00020785	mir|bmo-miR-993a-5p|mir|MIMAT0015298|mir|bmo-miR-993a*_v18.0|mir|MIMAT0015298	bmo-miR-993a-5p	MIMAT0015298	unmapped	CGCTCGGGTTTTCCCGAGCGGAAAAGCCCGGATCTACTTTTTTTTTT
A_38_P00020786	A_38_P00020786	mir|bmo-miR-993a-5p|mir|MIMAT0015298|mir|bmo-miR-993a*_v18.0|mir|MIMAT0015298	bmo-miR-993a-5p	MIMAT0015298	unmapped	CGCTCGGGTTTTCCCGAGCGGAAAAGCCCGGATCTACATTTTTTTTTT
A_38_P00020787	A_38_P00020787	mir|bmo-miR-2833b|mir|MIMAT0013791	bmo-miR-2833b	MIMAT0013791	unmapped	CGCTCGGGTTTTCCCGAGCGGAAAAGTACATTTCCAATCTCATTTTTTTTT
A_38_P00020788	A_38_P00020788	mir|bmo-miR-2833b|mir|MIMAT0013791	bmo-miR-2833b	MIMAT0013791	unmapped	CGCTCGGGTTTTCCCGAGCGGAAAAGTACATTTCCAATCTCTTTTTTTTTTT
A_38_P00020789	A_38_P00020789	mir|bmo-miR-3290|mir|MIMAT0015477	bmo-miR-3290	MIMAT0015477	unmapped	CGCTCGGGTTTTCCCGAGCGGAAAATCATAAATTTAATTACATTTTTTTTTT
A_38_P00020790	A_38_P00020790	mir|bmo-miR-3290|mir|MIMAT0015477	bmo-miR-3290	MIMAT0015477	unmapped	CGCTCGGGTTTTCCCGAGCGGAAAATCATAAATTTAATTACAATTTTTTTTTT
A_38_P00020791	A_38_P00020791	mir|bmo-miR-3290|mir|MIMAT0015477	bmo-miR-3290	MIMAT0015477	unmapped	CGCTCGGGTTTTCCCGAGCGGAAAATCATAAATTTAATTACAAATTTTTTTTTT
A_38_P00020794	A_38_P00020794	mir|bmo-miR-3363|mir|MIMAT0015549	bmo-miR-3363	MIMAT0015549	unmapped	CGCTCGGGTTTTCCCGAGCGGAAACGCAGTACACAAATTTTTTTTTTT
A_38_P00020795	A_38_P00020795	mir|bmo-miR-3363|mir|MIMAT0015549	bmo-miR-3363	MIMAT0015549	unmapped	CGCTCGGGTTTTCCCGAGCGGAAACGCAGTACACAAATATTTTTTTTTT
A_38_P00020796	A_38_P00020796	mir|bmo-miR-3363|mir|MIMAT0015549	bmo-miR-3363	MIMAT0015549	unmapped	CGCTCGGGTTTTCCCGAGCGGAAACGCAGTACACAAATACTATTTTTTTT
A_38_P00020797	A_38_P00020797	mir|bmo-miR-3412|mir|MIMAT0015618	bmo-miR-3412	MIMAT0015618	unmapped	CGCTCGGGTTTTCCCGAGCGGAAACTAATGAAGAATACATTCTTTTTTTTTT
A_38_P00020798	A_38_P00020798	mir|bmo-miR-3412|mir|MIMAT0015618	bmo-miR-3412	MIMAT0015618	unmapped	CGCTCGGGTTTTCCCGAGCGGAAACTAATGAAGAATACATTCCTTTTTTTTTT
A_38_P00020799	A_38_P00020799	mir|bmo-miR-3264|mir|MIMAT0015448	bmo-miR-3264	MIMAT0015448	unmapped	CGCTCGGGTTTTCCCGAGCGGAAACTCTAAATGGCTCTCTATTTTTTTT
A_38_P00020800	A_38_P00020800	mir|bmo-miR-3264|mir|MIMAT0015448	bmo-miR-3264	MIMAT0015448	unmapped	CGCTCGGGTTTTCCCGAGCGGAAACTCTAAATGGCTCTCCATTTTTTTTT
A_38_P00020801	A_38_P00020801	mir|bmo-miR-2797c|mir|MIMAT0013700	bmo-miR-2797c	MIMAT0013700	unmapped	CGCTCGGGTTTTCCCGAGCGGAAACTGAATAAAACCTACTTTATTTTTTTT
A_38_P00020802	A_38_P00020802	mir|bmo-miR-2797c|mir|MIMAT0013700	bmo-miR-2797c	MIMAT0013700	unmapped	CGCTCGGGTTTTCCCGAGCGGAAACTGAATAAAACCTACTTAATTTTTTTTT
A_38_P00020803	A_38_P00020803	mir|bmo-miR-2797c|mir|MIMAT0013700	bmo-miR-2797c	MIMAT0013700	unmapped	CGCTCGGGTTTTCCCGAGCGGAAACTGAATAAAACCTACTTATTTTTTTTTTT
A_38_P00020804	A_38_P00020804	mir|bmo-miR-3296-3p|mir|MIMAT0015484|mir|bmo-miR-3296_v18.0|mir|MIMAT0015484	bmo-miR-3296-3p	MIMAT0015484	unmapped	CGCTCGGGTTTTCCCGAGCGGAAAGACAGCATATCCCTTTTTTTTTT
A_38_P00020805	A_38_P00020805	mir|bmo-miR-3296-3p|mir|MIMAT0015484|mir|bmo-miR-3296_v18.0|mir|MIMAT0015484	bmo-miR-3296-3p	MIMAT0015484	unmapped	CGCTCGGGTTTTCCCGAGCGGAAAGACAGCATATCCCGTTTTTTTTTT
A_38_P00020806	A_38_P00020806	mir|bmo-miR-2774b|mir|MIMAT0013661	bmo-miR-2774b	MIMAT0013661	unmapped	CGCTCGGGTTTTCCCGAGCGGAAAGGGAAGATCTTCTACTTTTTTTTTT
A_38_P00020807	A_38_P00020807	mir|bmo-miR-2774b|mir|MIMAT0013661	bmo-miR-2774b	MIMAT0013661	unmapped	CGCTCGGGTTTTCCCGAGCGGAAAGGGAAGATCTTCTACCTTTTTTTTTT
A_38_P00020808	A_38_P00020808	mir|bmo-miR-2755-3p|mir|MIMAT0013616|mir|bmo-miR-2755_v18.0|mir|MIMAT0013616	bmo-miR-2755-3p	MIMAT0013616	unmapped	CGCTCGGGTTTTCCCGAGCGGAACAAGTATGGTCTGACTTTTTTTTTT
A_38_P00020809	A_38_P00020809	mir|bmo-miR-2755-3p|mir|MIMAT0013616|mir|bmo-miR-2755_v18.0|mir|MIMAT0013616	bmo-miR-2755-3p	MIMAT0013616	unmapped	CGCTCGGGTTTTCCCGAGCGGAACAAGTATGGTCTGACATTTTTTTTTT
A_38_P00020810	A_38_P00020810	mir|bmo-miR-2755-5p|mir|MIMAT0013615|mir|bmo-miR-2755*_v18.0|mir|MIMAT0013615	bmo-miR-2755-5p	MIMAT0013615	unmapped	CGCTCGGGTTTTCCCGAGCGGAACACTCTGCTAGGCTTTTTTTTTT
A_38_P00020811	A_38_P00020811	mir|bmo-miR-2755-5p|mir|MIMAT0013615|mir|bmo-miR-2755*_v18.0|mir|MIMAT0013615	bmo-miR-2755-5p	MIMAT0013615	unmapped	CGCTCGGGTTTTCCCGAGCGGAACACTCTGCTAGGCCTTTTTTTTTT
A_38_P00020812	A_38_P00020812	mir|bmo-miR-3383-5p|mir|MIMAT0015577|mir|bmo-miR-3383*_v18.0|mir|MIMAT0015577	bmo-miR-3383-5p	MIMAT0015577	unmapped	CGCTCGGGTTTTCCCGAGCGGAACATGGACGAAGCCTATTTTTTTT
A_38_P00020813	A_38_P00020813	mir|bmo-miR-3383-5p|mir|MIMAT0015577|mir|bmo-miR-3383*_v18.0|mir|MIMAT0015577	bmo-miR-3383-5p	MIMAT0015577	unmapped	CGCTCGGGTTTTCCCGAGCGGAACATGGACGAAGCCCATTTTTTTTT
A_38_P00020814	A_38_P00020814	mir|bmo-miR-3280|mir|MIMAT0015465	bmo-miR-3280	MIMAT0015465	unmapped	CGCTCGGGTTTTCCCGAGCGGAACCATGACCACCTAGTATTTTTTTT
A_38_P00020815	A_38_P00020815	mir|bmo-miR-3280|mir|MIMAT0015465	bmo-miR-3280	MIMAT0015465	unmapped	CGCTCGGGTTTTCCCGAGCGGAACCATGACCACCTAGAATTTTTTTTT
A_38_P00020816	A_38_P00020816	mir|bmo-miR-3247|mir|MIMAT0015429	bmo-miR-3247	MIMAT0015429	unmapped	CGCTCGGGTTTTCCCGAGCGGAACCCACGCTTTTTTATTTTTTTTTT
A_38_P00020817	A_38_P00020817	mir|bmo-miR-3247|mir|MIMAT0015429	bmo-miR-3247	MIMAT0015429	unmapped	CGCTCGGGTTTTCCCGAGCGGAACCCACGCTTTTTTACTTTTTTTTTT
A_38_P00020818	A_38_P00020818	mir|bmo-miR-2828|mir|MIMAT0013740	bmo-miR-2828	MIMAT0013740	unmapped	CGCTCGGGTTTTCCCGAGCGGAACCGTTCACATATCGTTTTTTTTTT
A_38_P00020819	A_38_P00020819	mir|bmo-miR-2828|mir|MIMAT0013740	bmo-miR-2828	MIMAT0013740	unmapped	CGCTCGGGTTTTCCCGAGCGGAACCGTTCACATATCGATATTTTTTTT
A_38_P00020820	A_38_P00020820	mir|bmo-miR-2757-3p|mir|MIMAT0013628|mir|bmo-miR-2757*_v18.0|mir|MIMAT0013628	bmo-miR-2757-3p	MIMAT0013628	unmapped	CGCTCGGGTTTTCCCGAGCGGAACGGAAATGGACACTAATTTTTTTT
A_38_P00020821	A_38_P00020821	mir|bmo-miR-2757-3p|mir|MIMAT0013628|mir|bmo-miR-2757*_v18.0|mir|MIMAT0013628	bmo-miR-2757-3p	MIMAT0013628	unmapped	CGCTCGGGTTTTCCCGAGCGGAACGGAAATGGACACTTATTTTTTTTT
A_38_P00020822	A_38_P00020822	mir|bmo-miR-3251|mir|MIMAT0015434	bmo-miR-3251	MIMAT0015434	unmapped	CGCTCGGGTTTTCCCGAGCGGAACTATCTGACTAACTGCTATTTTTTTTT
A_38_P00020823	A_38_P00020823	mir|bmo-miR-3251|mir|MIMAT0015434	bmo-miR-3251	MIMAT0015434	unmapped	CGCTCGGGTTTTCCCGAGCGGAACTATCTGACTAACTGCTTTATTTTTTTT
A_38_P00020824	A_38_P00020824	mir|bmo-miR-3288|mir|MIMAT0015475	bmo-miR-3288	MIMAT0015475	unmapped	CGCTCGGGTTTTCCCGAGCGGAAGCAAGCTACTCCAATTTTTTTTTT
A_38_P00020825	A_38_P00020825	mir|bmo-miR-3288|mir|MIMAT0015475	bmo-miR-3288	MIMAT0015475	unmapped	CGCTCGGGTTTTCCCGAGCGGAAGCAAGCTACTCCAAGTTTTTTTTTT
A_38_P00020826	A_38_P00020826	mir|bmo-miR-2797d|mir|MIMAT0013701	bmo-miR-2797d	MIMAT0013701	unmapped	CGCTCGGGTTTTCCCGAGCGGAAGCCGGACAATGTCATTTTTTTTT
A_38_P00020827	A_38_P00020827	mir|bmo-miR-2797d|mir|MIMAT0013701	bmo-miR-2797d	MIMAT0013701	unmapped	CGCTCGGGTTTTCCCGAGCGGAAGCCGGACAATGTCTTTTTTTTTTT
A_38_P00020828	A_38_P00020828	mir|bmo-miR-2822|mir|MIMAT0013733	bmo-miR-2822	MIMAT0013733	unmapped	CGCTCGGGTTTTCCCGAGCGGAAGCGGAGTAAAATATCCTATTTTTTTT
A_38_P00020829	A_38_P00020829	mir|bmo-miR-2822|mir|MIMAT0013733	bmo-miR-2822	MIMAT0013733	unmapped	CGCTCGGGTTTTCCCGAGCGGAAGCGGAGTAAAATATCCCATTTTTTTTT
A_38_P00020830	A_38_P00020830	mir|bmo-miR-3337|mir|MIMAT0015524	bmo-miR-3337	MIMAT0015524	unmapped	CGCTCGGGTTTTCCCGAGCGGAAGCGTCCGAGCATTTTTTTTTT
A_38_P00020831	A_38_P00020831	mir|bmo-miR-3337|mir|MIMAT0015524	bmo-miR-3337	MIMAT0015524	unmapped	CGCTCGGGTTTTCCCGAGCGGAAGCGTCCGAGCACTTTTTTTTTT
A_38_P00020832	A_38_P00020832	mir|bmo-miR-2774c|mir|MIMAT0013759	bmo-miR-2774c	MIMAT0013759	unmapped	CGCTCGGGTTTTCCCGAGCGGAAGGGAAGGTCTTCCTTTTTTTTTT
A_38_P00020833	A_38_P00020833	mir|bmo-miR-2774c|mir|MIMAT0013759	bmo-miR-2774c	MIMAT0013759	unmapped	CGCTCGGGTTTTCCCGAGCGGAAGGGAAGGTCTTCCATTTTTTTTTT
A_38_P00020834	A_38_P00020834	mir|bmo-miR-3212|mir|MIMAT0015391	bmo-miR-3212	MIMAT0015391	unmapped	CGCTCGGGTTTTCCCGAGCGGAAGTACCTTAAGAAAGACATATTTTTTTT
A_38_P00020835	A_38_P00020835	mir|bmo-miR-3212|mir|MIMAT0015391	bmo-miR-3212	MIMAT0015391	unmapped	CGCTCGGGTTTTCCCGAGCGGAAGTACCTTAAGAAAGACAGATTTTTTTTT
A_38_P00020836	A_38_P00020836	mir|bmo-miR-2797a|mir|MIMAT0013698	bmo-miR-2797a	MIMAT0013698	unmapped	CGCTCGGGTTTTCCCGAGCGGAAGTCGAATAAAACCTACTATTTTTTTTT
A_38_P00020837	A_38_P00020837	mir|bmo-miR-2797a|mir|MIMAT0013698	bmo-miR-2797a	MIMAT0013698	unmapped	CGCTCGGGTTTTCCCGAGCGGAAGTCGAATAAAACCTACTTTATTTTTTTT
A_38_P00020838	A_38_P00020838	mir|bmo-miR-305-3p|mir|MIMAT0015236|mir|bmo-miR-305*_v18.0|mir|MIMAT0015236	bmo-miR-305-3p	MIMAT0015236	unmapped	CGCTCGGGTTTTCCCGAGCGGAAGTGTACTCCAACAAGTTTTTTTTTT
A_38_P00020839	A_38_P00020839	mir|bmo-miR-305-3p|mir|MIMAT0015236|mir|bmo-miR-305*_v18.0|mir|MIMAT0015236	bmo-miR-305-3p	MIMAT0015236	unmapped	CGCTCGGGTTTTCCCGAGCGGAAGTGTACTCCAACAAGCTTTTTTTTTT
A_38_P00020840	A_38_P00020840	mir|bmo-miR-3242|mir|MIMAT0015424	bmo-miR-3242	MIMAT0015424	unmapped	CGCTCGGGTTTTCCCGAGCGGAAGTTGCAGAAGATGAAGTTTTTTTTTT
A_38_P00020841	A_38_P00020841	mir|bmo-miR-3242|mir|MIMAT0015424	bmo-miR-3242	MIMAT0015424	unmapped	CGCTCGGGTTTTCCCGAGCGGAAGTTGCAGAAGATGAAGGTTTTTTTTTT
A_38_P00020842	A_38_P00020842	mir|bmo-miR-2800|mir|MIMAT0013704	bmo-miR-2800	MIMAT0013704	unmapped	CGCTCGGGTTTTCCCGAGCGGAAGTTTACAAGACACAATATTTATTTTTTTT
A_38_P00020843	A_38_P00020843	mir|bmo-miR-2800|mir|MIMAT0013704	bmo-miR-2800	MIMAT0013704	unmapped	CGCTCGGGTTTTCCCGAGCGGAAGTTTACAAGACACAATATTCATTTTTTTTT
A_38_P00020844	A_38_P00020844	mir|bmo-miR-3367|mir|MIMAT0015553	bmo-miR-3367	MIMAT0015553	unmapped	CGCTCGGGTTTTCCCGAGCGGAATATCAGCGCAGCGATTTTTTTTT
A_38_P00020845	A_38_P00020845	mir|bmo-miR-3367|mir|MIMAT0015553	bmo-miR-3367	MIMAT0015553	unmapped	CGCTCGGGTTTTCCCGAGCGGAATATCAGCGCAGCGTTTTTTTTTTT
A_38_P00020846	A_38_P00020846	mir|bmo-miR-2760-3p|mir|MIMAT0013633|mir|bmo-miR-2760_v18.0|mir|MIMAT0013633	bmo-miR-2760-3p	MIMAT0013633	unmapped	CGCTCGGGTTTTCCCGAGCGGAATGGAACTTAACAACCATTTTTTTTTT
A_38_P00020847	A_38_P00020847	mir|bmo-miR-2760-3p|mir|MIMAT0013633|mir|bmo-miR-2760_v18.0|mir|MIMAT0013633	bmo-miR-2760-3p	MIMAT0013633	unmapped	CGCTCGGGTTTTCCCGAGCGGAATGGAACTTAACAACCAATTTTTTTTTT
A_38_P00020848	A_38_P00020848	mir|bmo-miR-2792-3p|mir|MIMAT0013691	bmo-miR-2792-3p	MIMAT0013691	unmapped	CGCTCGGGTTTTCCCGAGCGGAATGGAATCGCTATCTAATTATTTTTTTT
A_38_P00020849	A_38_P00020849	mir|bmo-miR-2792-3p|mir|MIMAT0013691	bmo-miR-2792-3p	MIMAT0013691	unmapped	CGCTCGGGTTTTCCCGAGCGGAATGGAATCGCTATCTAATCATTTTTTTTT
A_38_P00020850	A_38_P00020850	mir|bmo-miR-3267a|mir|MIMAT0015451	bmo-miR-3267a	MIMAT0015451	unmapped	CGCTCGGGTTTTCCCGAGCGGAATGGGTGGACGAGTATTTTTTTT
A_38_P00020851	A_38_P00020851	mir|bmo-miR-3267a|mir|MIMAT0015451	bmo-miR-3267a	MIMAT0015451	unmapped	CGCTCGGGTTTTCCCGAGCGGAATGGGTGGACGAGCATTTTTTTTT
A_38_P00020852	A_38_P00020852	mir|bmo-miR-2775a|mir|MIMAT0013659	bmo-miR-2775a	MIMAT0013659	unmapped	CGCTCGGGTTTTCCCGAGCGGAATGTCCTACTTTTCTCCTTTTTTTTTT
A_38_P00020853	A_38_P00020853	mir|bmo-miR-2775a|mir|MIMAT0013659	bmo-miR-2775a	MIMAT0013659	unmapped	CGCTCGGGTTTTCCCGAGCGGAATGTCCTACTTTTCTCCCTTTTTTTTTT
A_38_P00020854	A_38_P00020854	mir|bmo-miR-2810|mir|MIMAT0013718	bmo-miR-2810	MIMAT0013718	unmapped	CGCTCGGGTTTTCCCGAGCGGAATTAGCTGTTCTCGAAATATTTTTTTT
A_38_P00020855	A_38_P00020855	mir|bmo-miR-2810|mir|MIMAT0013718	bmo-miR-2810	MIMAT0013718	unmapped	CGCTCGGGTTTTCCCGAGCGGAATTAGCTGTTCTCGAAAAATTTTTTTTT
A_38_P00020856	A_38_P00020856	mir|bmo-miR-2778c-3p|mir|MIMAT0013667|mir|bmo-miR-2778c*_v18.0|mir|MIMAT0013667	bmo-miR-2778c-3p	MIMAT0013667	unmapped	CGCTCGGGTTTTCCCGAGCGGAATTGATTTTTTGCGTACTTATTTTTTTT
A_38_P00020857	A_38_P00020857	mir|bmo-miR-2778c-3p|mir|MIMAT0013667|mir|bmo-miR-2778c*_v18.0|mir|MIMAT0013667	bmo-miR-2778c-3p	MIMAT0013667	unmapped	CGCTCGGGTTTTCCCGAGCGGAATTGATTTTTTGCGTACTCATTTTTTTTT
A_38_P00020858	A_38_P00020858	mir|bmo-miR-2768-5p|mir|MIMAT0013646|mir|bmo-miR-2768*_v18.0|mir|MIMAT0013646	bmo-miR-2768-5p	MIMAT0013646	unmapped	CGCTCGGGTTTTCCCGAGCGGAATTGGTCAAAATATTTCACTTTTTTTTTT
A_38_P00020859	A_38_P00020859	mir|bmo-miR-2768-5p|mir|MIMAT0013646|mir|bmo-miR-2768*_v18.0|mir|MIMAT0013646	bmo-miR-2768-5p	MIMAT0013646	unmapped	CGCTCGGGTTTTCCCGAGCGGAATTGGTCAAAATATTTCACCTTTTTTTTTT
A_38_P00020860	A_38_P00020860	mir|bmo-miR-2778d-3p|mir|MIMAT0013674|mir|bmo-miR-2778d*_v18.0|mir|MIMAT0013674	bmo-miR-2778d-3p	MIMAT0013674	unmapped	CGCTCGGGTTTTCCCGAGCGGAATTGTTTTTTGCGTACTTATTTTTTTT
A_38_P00020861	A_38_P00020861	mir|bmo-miR-2778d-3p|mir|MIMAT0013674|mir|bmo-miR-2778d*_v18.0|mir|MIMAT0013674	bmo-miR-2778d-3p	MIMAT0013674	unmapped	CGCTCGGGTTTTCCCGAGCGGAATTGTTTTTTGCGTACTCATTTTTTTTT
A_38_P00020862	A_38_P00020862	mir|bmo-miR-2778b-3p|mir|MIMAT0013676|mir|bmo-miR-2778b_v18.0|mir|MIMAT0013676	bmo-miR-2778b-3p	MIMAT0013676	unmapped	CGCTCGGGTTTTCCCGAGCGGAATTGTTTTTTTGCCTACTTATTTTTTTT
A_38_P00020863	A_38_P00020863	mir|bmo-miR-2778b-3p|mir|MIMAT0013676|mir|bmo-miR-2778b_v18.0|mir|MIMAT0013676	bmo-miR-2778b-3p	MIMAT0013676	unmapped	CGCTCGGGTTTTCCCGAGCGGAATTGTTTTTTTGCCTACTCATTTTTTTTT
A_38_P00020864	A_38_P00020864	mir|bmo-miR-2776|mir|MIMAT0013660|mir|bmo-miR-2778a_v18.0|mir|MIMAT0013665|mir|bmo-miR-2778a-3p|mir|MIMAT0013665	bmo-miR-2776	MIMAT0013660	unmapped	CGCTCGGGTTTTCCCGAGCGGAATTGTTTTTTTGCGTACTTATTTTTTTT
A_38_P00020865	A_38_P00020865	mir|bmo-miR-2776|mir|MIMAT0013660|mir|bmo-miR-2778a_v18.0|mir|MIMAT0013665|mir|bmo-miR-2778a-3p|mir|MIMAT0013665	bmo-miR-2776	MIMAT0013660	unmapped	CGCTCGGGTTTTCCCGAGCGGAATTGTTTTTTTGCGTACTCATTTTTTTTT
A_38_P00020866	A_38_P00020866	mir|bmo-miR-2733d|mir|MIMAT0013618	bmo-miR-2733d	MIMAT0013618	unmapped	CGCTCGGGTTTTCCCGAGCGGACAATCTTCATACACCCTTTTTTTTTT
A_38_P00020867	A_38_P00020867	mir|bmo-miR-2733d|mir|MIMAT0013618	bmo-miR-2733d	MIMAT0013618	unmapped	CGCTCGGGTTTTCCCGAGCGGACAATCTTCATACACCCATATTTTTTTT
A_38_P00020868	A_38_P00020868	mir|bmo-miR-2784|mir|MIMAT0013680	bmo-miR-2784	MIMAT0013680	unmapped	CGCTCGGGTTTTCCCGAGCGGACACACACACTCGCTTTTTTTTTT
A_38_P00020869	A_38_P00020869	mir|bmo-miR-2784|mir|MIMAT0013680	bmo-miR-2784	MIMAT0013680	unmapped	CGCTCGGGTTTTCCCGAGCGGACACACACACTCGCCTTTTTTTTTT
A_38_P00020870	A_38_P00020870	mir|bmo-miR-3219|mir|MIMAT0015399	bmo-miR-3219	MIMAT0015399	unmapped	CGCTCGGGTTTTCCCGAGCGGACACCATGGATATATTAGTCATTTTTTTTT
A_38_P00020871	A_38_P00020871	mir|bmo-miR-3219|mir|MIMAT0015399	bmo-miR-3219	MIMAT0015399	unmapped	CGCTCGGGTTTTCCCGAGCGGACACCATGGATATATTAGTCTTTTTTTTTTT
A_38_P00020874	A_38_P00020874	mir|bmo-miR-9d|mir|MIMAT0013620	bmo-miR-9d	MIMAT0013620	unmapped	CGCTCGGGTTTTCCCGAGCGGACACTCAGTGAATTAGCTAATTTTTTTT
A_38_P00020875	A_38_P00020875	mir|bmo-miR-9d|mir|MIMAT0013620	bmo-miR-9d	MIMAT0013620	unmapped	CGCTCGGGTTTTCCCGAGCGGACACTCAGTGAATTAGCTTATTTTTTTTT
A_38_P00020876	A_38_P00020876	mir|bmo-miR-11-5p|mir|MIMAT0013601|mir|bmo-miR-11*_v18.0|mir|MIMAT0013601	bmo-miR-11-5p	MIMAT0013601	unmapped	CGCTCGGGTTTTCCCGAGCGGACAGGTCACATGTCGTTTTTTTTTT
A_38_P00020877	A_38_P00020877	mir|bmo-miR-11-5p|mir|MIMAT0013601|mir|bmo-miR-11*_v18.0|mir|MIMAT0013601	bmo-miR-11-5p	MIMAT0013601	unmapped	CGCTCGGGTTTTCCCGAGCGGACAGGTCACATGTCGATATTTTTTTT
A_38_P00020878	A_38_P00020878	mir|bmo-miR-3424|mir|MIMAT0015632	bmo-miR-3424	MIMAT0015632	unmapped	CGCTCGGGTTTTCCCGAGCGGACATAGGTAAAATACTACATATGTTTTTTTTTT
A_38_P00020879	A_38_P00020879	mir|bmo-miR-3424|mir|MIMAT0015632	bmo-miR-3424	MIMAT0015632	unmapped	CGCTCGGGTTTTCCCGAGCGGACATAGGTAAAATACTACATATGATTTTTTTTTT
A_38_P00020880	A_38_P00020880	mir|bmo-miR-3230|mir|MIMAT0015412	bmo-miR-3230	MIMAT0015412	unmapped	CGCTCGGGTTTTCCCGAGCGGACATGGACTCCCATTTTTTTTTTTTT
A_38_P00020881	A_38_P00020881	mir|bmo-miR-3230|mir|MIMAT0015412	bmo-miR-3230	MIMAT0015412	unmapped	CGCTCGGGTTTTCCCGAGCGGACATGGACTCCCATTTCTTTTTTTTTT
A_38_P00020882	A_38_P00020882	mir|bmo-miR-3285|mir|MIMAT0015471	bmo-miR-3285	MIMAT0015471	unmapped	CGCTCGGGTTTTCCCGAGCGGACATTAATTGGAATATAGCGTATTTTTTTT
A_38_P00020883	A_38_P00020883	mir|bmo-miR-3285|mir|MIMAT0015471	bmo-miR-3285	MIMAT0015471	unmapped	CGCTCGGGTTTTCCCGAGCGGACATTAATTGGAATATAGCGAATTTTTTTTT
A_38_P00020884	A_38_P00020884	mir|bmo-miR-2771-3p|mir|MIMAT0013655|mir|bmo-miR-2771_v18.0|mir|MIMAT0013655	bmo-miR-2771-3p	MIMAT0013655	unmapped	CGCTCGGGTTTTCCCGAGCGGACATTAGTGTTCTGCATAAATTTTTTTTT
A_38_P00020885	A_38_P00020885	mir|bmo-miR-2771-3p|mir|MIMAT0013655|mir|bmo-miR-2771_v18.0|mir|MIMAT0013655	bmo-miR-2771-3p	MIMAT0013655	unmapped	CGCTCGGGTTTTCCCGAGCGGACATTAGTGTTCTGCATAATTATTTTTTTT
A_38_P00020886	A_38_P00020886	mir|bmo-miR-2771-3p|mir|MIMAT0013655|mir|bmo-miR-2771_v18.0|mir|MIMAT0013655	bmo-miR-2771-3p	MIMAT0013655	unmapped	CGCTCGGGTTTTCCCGAGCGGACATTAGTGTTCTGCATAATAATTTTTTTTT
A_38_P00020887	A_38_P00020887	mir|bmo-miR-2771-3p|mir|MIMAT0013655|mir|bmo-miR-2771_v18.0|mir|MIMAT0013655	bmo-miR-2771-3p	MIMAT0013655	unmapped	CGCTCGGGTTTTCCCGAGCGGACATTAGTGTTCTGCATAATATTTTTTTTTTT
A_38_P00020888	A_38_P00020888	mir|bmo-miR-308-5p|mir|MIMAT0013604|mir|bmo-miR-308*_v18.0|mir|MIMAT0013604	bmo-miR-308-5p	MIMAT0013604	unmapped	CGCTCGGGTTTTCCCGAGCGGACATTCACAAGAATAATACCTTTTTTTTTT
A_38_P00020889	A_38_P00020889	mir|bmo-miR-308-5p|mir|MIMAT0013604|mir|bmo-miR-308*_v18.0|mir|MIMAT0013604	bmo-miR-308-5p	MIMAT0013604	unmapped	CGCTCGGGTTTTCCCGAGCGGACATTCACAAGAATAATACCATTTTTTTTTT
A_38_P00020890	A_38_P00020890	mir|bmo-miR-3375-5p|mir|MIMAT0015565|mir|bmo-miR-3375*_v18.0|mir|MIMAT0015565	bmo-miR-3375-5p	MIMAT0015565	unmapped	CGCTCGGGTTTTCCCGAGCGGACCAAGAAGAATTACACAATTTTTTTTT
A_38_P00020891	A_38_P00020891	mir|bmo-miR-3375-5p|mir|MIMAT0015565|mir|bmo-miR-3375*_v18.0|mir|MIMAT0015565	bmo-miR-3375-5p	MIMAT0015565	unmapped	CGCTCGGGTTTTCCCGAGCGGACCAAGAAGAATTACACATTTTTTTTTTT
A_38_P00020892	A_38_P00020892	mir|bmo-miR-3375-5p|mir|MIMAT0015565|mir|bmo-miR-3375*_v18.0|mir|MIMAT0015565	bmo-miR-3375-5p	MIMAT0015565	unmapped	CGCTCGGGTTTTCCCGAGCGGACCAAGAAGAATTACACATGTTTTTTTTTT
A_38_P00020893	A_38_P00020893	mir|bmo-miR-3261|mir|MIMAT0015445	bmo-miR-3261	MIMAT0015445	unmapped	CGCTCGGGTTTTCCCGAGCGGACCCTACCTTATCCTTAATATTTTTTTT
A_38_P00020894	A_38_P00020894	mir|bmo-miR-3261|mir|MIMAT0015445	bmo-miR-3261	MIMAT0015445	unmapped	CGCTCGGGTTTTCCCGAGCGGACCCTACCTTATCCTTAAAAATTTTTTTT
A_38_P00020895	A_38_P00020895	mir|bmo-miR-3261|mir|MIMAT0015445	bmo-miR-3261	MIMAT0015445	unmapped	CGCTCGGGTTTTCCCGAGCGGACCCTACCTTATCCTTAAATATTTTTTTTT
A_38_P00020896	A_38_P00020896	mir|bmo-miR-2839-3p|mir|MIMAT0013755|mir|bmo-miR-2839_v18.0|mir|MIMAT0013755	bmo-miR-2839-3p	MIMAT0013755	unmapped	CGCTCGGGTTTTCCCGAGCGGACCGTCAAACAGTGTTTTTTTTTT
A_38_P00020897	A_38_P00020897	mir|bmo-miR-2839-3p|mir|MIMAT0013755|mir|bmo-miR-2839_v18.0|mir|MIMAT0013755	bmo-miR-2839-3p	MIMAT0013755	unmapped	CGCTCGGGTTTTCCCGAGCGGACCGTCAAACAGTGCTTTTTTTTTT
A_38_P00020898	A_38_P00020898	mir|bmo-miR-2814|mir|MIMAT0013723	bmo-miR-2814	MIMAT0013723	unmapped	CGCTCGGGTTTTCCCGAGCGGACCTACTACCACAGAATTATTTTTTTTT
A_38_P00020899	A_38_P00020899	mir|bmo-miR-2814|mir|MIMAT0013723	bmo-miR-2814	MIMAT0013723	unmapped	CGCTCGGGTTTTCCCGAGCGGACCTACTACCACAGAATTTTATTTTTTTT
A_38_P00020900	A_38_P00020900	mir|bmo-miR-3324|mir|MIMAT0015511	bmo-miR-3324	MIMAT0015511	unmapped	CGCTCGGGTTTTCCCGAGCGGACCTAGGCACTCAGGTTTTTTTTTT
A_38_P00020901	A_38_P00020901	mir|bmo-miR-3324|mir|MIMAT0015511	bmo-miR-3324	MIMAT0015511	unmapped	CGCTCGGGTTTTCCCGAGCGGACCTAGGCACTCAGGGTATTTTTTTT
A_38_P00020902	A_38_P00020902	mir|bmo-miR-3382-5p|mir|MIMAT0015575|mir|bmo-miR-3382_v18.0|mir|MIMAT0015575	bmo-miR-3382-5p	MIMAT0015575	unmapped	CGCTCGGGTTTTCCCGAGCGGACGACCCAGAACACTTTTTTTTTT
A_38_P00020903	A_38_P00020903	mir|bmo-miR-3382-5p|mir|MIMAT0015575|mir|bmo-miR-3382_v18.0|mir|MIMAT0015575	bmo-miR-3382-5p	MIMAT0015575	unmapped	CGCTCGGGTTTTCCCGAGCGGACGACCCAGAACACATTTTTTTTTT
A_38_P00020904	A_38_P00020904	mir|bmo-miR-2816|mir|MIMAT0013726	bmo-miR-2816	MIMAT0013726	unmapped	CGCTCGGGTTTTCCCGAGCGGACGACTCTACCTCACTTTTTTTTTTT
A_38_P00020905	A_38_P00020905	mir|bmo-miR-2816|mir|MIMAT0013726	bmo-miR-2816	MIMAT0013726	unmapped	CGCTCGGGTTTTCCCGAGCGGACGACTCTACCTCACTCTTTTTTTTTT
A_38_P00020906	A_38_P00020906	mir|bmo-miR-3411|mir|MIMAT0015617	bmo-miR-3411	MIMAT0015617	unmapped	CGCTCGGGTTTTCCCGAGCGGACGAGTACAGATGAGGTATTTTTTTT
A_38_P00020907	A_38_P00020907	mir|bmo-miR-3411|mir|MIMAT0015617	bmo-miR-3411	MIMAT0015617	unmapped	CGCTCGGGTTTTCCCGAGCGGACGAGTACAGATGAGGAATTTTTTTTT
A_38_P00020908	A_38_P00020908	mir|bmo-miR-2768-3p|mir|MIMAT0013647|mir|bmo-miR-2768_v18.0|mir|MIMAT0013647	bmo-miR-2768-3p	MIMAT0013647	unmapped	CGCTCGGGTTTTCCCGAGCGGACGATGCAATATCTTAACTTTTTTTTTT
A_38_P00020909	A_38_P00020909	mir|bmo-miR-2768-3p|mir|MIMAT0013647|mir|bmo-miR-2768_v18.0|mir|MIMAT0013647	bmo-miR-2768-3p	MIMAT0013647	unmapped	CGCTCGGGTTTTCCCGAGCGGACGATGCAATATCTTAACCTTTTTTTTTT
A_38_P00020910	A_38_P00020910	mir|bmo-miR-3258|mir|MIMAT0015442	bmo-miR-3258	MIMAT0015442	unmapped	CGCTCGGGTTTTCCCGAGCGGACGTACCCAACGCTTTTTTTTTT
A_38_P00020911	A_38_P00020911	mir|bmo-miR-3258|mir|MIMAT0015442	bmo-miR-3258	MIMAT0015442	unmapped	CGCTCGGGTTTTCCCGAGCGGACGTACCCAACGCGTATTTTTTTT
A_38_P00020912	A_38_P00020912	mir|bmo-miR-3370|mir|MIMAT0015557	bmo-miR-3370	MIMAT0015557	unmapped	CGCTCGGGTTTTCCCGAGCGGACGTTTCAAGACATTGTTTTTTTTTTT
A_38_P00020913	A_38_P00020913	mir|bmo-miR-3370|mir|MIMAT0015557	bmo-miR-3370	MIMAT0015557	unmapped	CGCTCGGGTTTTCCCGAGCGGACGTTTCAAGACATTGTATTTTTTTTTT
A_38_P00020914	A_38_P00020914	mir|bmo-miR-3370|mir|MIMAT0015557	bmo-miR-3370	MIMAT0015557	unmapped	CGCTCGGGTTTTCCCGAGCGGACGTTTCAAGACATTGTACTTTTTTTTTT
A_38_P00020915	A_38_P00020915	mir|bmo-miR-3301|mir|MIMAT0015489	bmo-miR-3301	MIMAT0015489	unmapped	CGCTCGGGTTTTCCCGAGCGGACTCAACGGGTTACTATTTTTTTTTTT
A_38_P00020916	A_38_P00020916	mir|bmo-miR-3301|mir|MIMAT0015489	bmo-miR-3301	MIMAT0015489	unmapped	CGCTCGGGTTTTCCCGAGCGGACTCAACGGGTTACTATCTTTTTTTTTT
A_38_P00020917	A_38_P00020917	mir|bmo-miR-3260|mir|MIMAT0015444	bmo-miR-3260	MIMAT0015444	unmapped	CGCTCGGGTTTTCCCGAGCGGACTCACGAAAGTAATCAATTTTTTTTTT
A_38_P00020918	A_38_P00020918	mir|bmo-miR-3260|mir|MIMAT0015444	bmo-miR-3260	MIMAT0015444	unmapped	CGCTCGGGTTTTCCCGAGCGGACTCACGAAAGTAATCAAGTTTTTTTTTT
A_38_P00020921	A_38_P00020921	mir|bmo-miR-2733f|mir|MIMAT0014661	bmo-miR-2733f	MIMAT0014661	unmapped	CGCTCGGGTTTTCCCGAGCGGACTGTCATTACATACCCATATTTTTTTT
A_38_P00020922	A_38_P00020922	mir|bmo-miR-2733f|mir|MIMAT0014661	bmo-miR-2733f	MIMAT0014661	unmapped	CGCTCGGGTTTTCCCGAGCGGACTGTCATTACATACCCAGATTTTTTTTT
A_38_P00020923	A_38_P00020923	mir|bmo-miR-3353|mir|MIMAT0015538	bmo-miR-3353	MIMAT0015538	unmapped	CGCTCGGGTTTTCCCGAGCGGACTTTGGTTTAAAAATTATCTGTTTTTTTTTT
A_38_P00020924	A_38_P00020924	mir|bmo-miR-3353|mir|MIMAT0015538	bmo-miR-3353	MIMAT0015538	unmapped	CGCTCGGGTTTTCCCGAGCGGACTTTGGTTTAAAAATTATCTGATTTTTTTTTT
A_38_P00020925	A_38_P00020925	mir|bmo-miR-2804-5p|mir|MIMAT0013709|mir|bmo-miR-2804*_v18.0|mir|MIMAT0013709	bmo-miR-2804-5p	MIMAT0013709	unmapped	CGCTCGGGTTTTCCCGAGCGGACTTTGTATTGTAATACACTATTTTTTTTTT
A_38_P00020926	A_38_P00020926	mir|bmo-miR-2804-5p|mir|MIMAT0013709|mir|bmo-miR-2804*_v18.0|mir|MIMAT0013709	bmo-miR-2804-5p	MIMAT0013709	unmapped	CGCTCGGGTTTTCCCGAGCGGACTTTGTATTGTAATACACTACTTTTTTTTTT
A_38_P00020927	A_38_P00020927	mir|bmo-miR-3276|mir|MIMAT0015461	bmo-miR-3276	MIMAT0015461	unmapped	CGCTCGGGTTTTCCCGAGCGGACTTTTCACAAACACCATATTTTTTTT
A_38_P00020928	A_38_P00020928	mir|bmo-miR-3276|mir|MIMAT0015461	bmo-miR-3276	MIMAT0015461	unmapped	CGCTCGGGTTTTCCCGAGCGGACTTTTCACAAACACCAAATTTTTTTTT
A_38_P00020929	A_38_P00020929	mir|bmo-miR-3338-3p|mir|MIMAT0015526|mir|bmo-miR-3338_v18.0|mir|MIMAT0015526	bmo-miR-3338-3p	MIMAT0015526	unmapped	CGCTCGGGTTTTCCCGAGCGGAGAACAAACAAAGTAAGTACTATTTTTTTT
A_38_P00020930	A_38_P00020930	mir|bmo-miR-3338-3p|mir|MIMAT0015526|mir|bmo-miR-3338_v18.0|mir|MIMAT0015526	bmo-miR-3338-3p	MIMAT0015526	unmapped	CGCTCGGGTTTTCCCGAGCGGAGAACAAACAAAGTAAGTACAATTTTTTTTT
A_38_P00020931	A_38_P00020931	mir|bmo-miR-3425|mir|MIMAT0015633	bmo-miR-3425	MIMAT0015633	unmapped	CGCTCGGGTTTTCCCGAGCGGAGACCAAAAAAGGGTAATTTTTTTTTT
A_38_P00020932	A_38_P00020932	mir|bmo-miR-3425|mir|MIMAT0015633	bmo-miR-3425	MIMAT0015633	unmapped	CGCTCGGGTTTTCCCGAGCGGAGACCAAAAAAGGGTAAATTTTTTTTTT
A_38_P00020933	A_38_P00020933	mir|bmo-miR-3425|mir|MIMAT0015633	bmo-miR-3425	MIMAT0015633	unmapped	CGCTCGGGTTTTCCCGAGCGGAGACCAAAAAAGGGTAAAATATTTTTTTT
A_38_P00020934	A_38_P00020934	mir|bmo-miR-3421|mir|MIMAT0015629	bmo-miR-3421	MIMAT0015629	unmapped	CGCTCGGGTTTTCCCGAGCGGAGACCTCTGATTTAATTCGAATTTTTTTT
A_38_P00020935	A_38_P00020935	mir|bmo-miR-3421|mir|MIMAT0015629	bmo-miR-3421	MIMAT0015629	unmapped	CGCTCGGGTTTTCCCGAGCGGAGACCTCTGATTTAATTCGTAATTTTTTTT
A_38_P00020936	A_38_P00020936	mir|bmo-miR-3383-3p|mir|MIMAT0015578|mir|bmo-miR-3383_v18.0|mir|MIMAT0015578	bmo-miR-3383-3p	MIMAT0015578	unmapped	CGCTCGGGTTTTCCCGAGCGGAGAGACAGCGCGTTTTTTTTTTT
A_38_P00020937	A_38_P00020937	mir|bmo-miR-3383-3p|mir|MIMAT0015578|mir|bmo-miR-3383_v18.0|mir|MIMAT0015578	bmo-miR-3383-3p	MIMAT0015578	unmapped	CGCTCGGGTTTTCCCGAGCGGAGAGACAGCGCGTCTTTTTTTTTT
A_38_P00020938	A_38_P00020938	mir|bmo-miR-317-5p|mir|MIMAT0015277|mir|bmo-miR-317*_v18.0|mir|MIMAT0015277	bmo-miR-317-5p	MIMAT0015277	unmapped	CGCTCGGGTTTTCCCGAGCGGAGAGAGCACAGCGTTTTTTTTTTT
A_38_P00020939	A_38_P00020939	mir|bmo-miR-317-5p|mir|MIMAT0015277|mir|bmo-miR-317*_v18.0|mir|MIMAT0015277	bmo-miR-317-5p	MIMAT0015277	unmapped	CGCTCGGGTTTTCCCGAGCGGAGAGAGCACAGCGTGTTTTTTTTTT
A_38_P00020942	A_38_P00020942	mir|bmo-miR-3395|mir|MIMAT0015599	bmo-miR-3395	MIMAT0015599	unmapped	CGCTCGGGTTTTCCCGAGCGGAGAGCGACATCGCTTTTTTTTTT
A_38_P00020943	A_38_P00020943	mir|bmo-miR-3395|mir|MIMAT0015599	bmo-miR-3395	MIMAT0015599	unmapped	CGCTCGGGTTTTCCCGAGCGGAGAGCGACATCGCCTTTTTTTTTT
A_38_P00020944	A_38_P00020944	mir|bmo-miR-190-3p|mir|MIMAT0015287|mir|bmo-miR-190*_v18.0|mir|MIMAT0015287	bmo-miR-190-3p	MIMAT0015287	unmapped	CGCTCGGGTTTTCCCGAGCGGAGAGTAATATGTTTGATTCCTTTTTTTTTT
A_38_P00020945	A_38_P00020945	mir|bmo-miR-190-3p|mir|MIMAT0015287|mir|bmo-miR-190*_v18.0|mir|MIMAT0015287	bmo-miR-190-3p	MIMAT0015287	unmapped	CGCTCGGGTTTTCCCGAGCGGAGAGTAATATGTTTGATTCCCTTTTTTTTTT
A_38_P00020946	A_38_P00020946	mir|bmo-miR-3267c|mir|MIMAT0015556	bmo-miR-3267c	MIMAT0015556	unmapped	CGCTCGGGTTTTCCCGAGCGGAGATGAATGGACGAGCATTTTTTTTT
A_38_P00020947	A_38_P00020947	mir|bmo-miR-3267c|mir|MIMAT0015556	bmo-miR-3267c	MIMAT0015556	unmapped	CGCTCGGGTTTTCCCGAGCGGAGATGAATGGACGAGCTTTTTTTTTTT
A_38_P00020948	A_38_P00020948	mir|bmo-miR-3234|mir|MIMAT0015416	bmo-miR-3234	MIMAT0015416	unmapped	CGCTCGGGTTTTCCCGAGCGGAGATGACCGTTCCCTATTTTTTTT
A_38_P00020949	A_38_P00020949	mir|bmo-miR-3234|mir|MIMAT0015416	bmo-miR-3234	MIMAT0015416	unmapped	CGCTCGGGTTTTCCCGAGCGGAGATGACCGTTCCCAATTTTTTTTT
A_38_P00020950	A_38_P00020950	mir|bmo-miR-745-5p|mir|MIMAT0013625|mir|bmo-miR-745*_v18.0|mir|MIMAT0013625	bmo-miR-745-5p	MIMAT0013625	unmapped	CGCTCGGGTTTTCCCGAGCGGAGCAAACTGCCACACTTTTTTTTTT
A_38_P00020951	A_38_P00020951	mir|bmo-miR-745-5p|mir|MIMAT0013625|mir|bmo-miR-745*_v18.0|mir|MIMAT0013625	bmo-miR-745-5p	MIMAT0013625	unmapped	CGCTCGGGTTTTCCCGAGCGGAGCAAACTGCCACACGTATTTTTTTT
A_38_P00020952	A_38_P00020952	mir|bmo-miR-3352|mir|MIMAT0015537	bmo-miR-3352	MIMAT0015537	unmapped	CGCTCGGGTTTTCCCGAGCGGAGCACAAATAGAACAGAATTTTTTTTTT
A_38_P00020953	A_38_P00020953	mir|bmo-miR-3352|mir|MIMAT0015537	bmo-miR-3352	MIMAT0015537	unmapped	CGCTCGGGTTTTCCCGAGCGGAGCACAAATAGAACAGAAGTTTTTTTTTT
A_38_P00020954	A_38_P00020954	mir|bmo-miR-2808d|mir|MIMAT0015386	bmo-miR-2808d	MIMAT0015386	unmapped	CGCTCGGGTTTTCCCGAGCGGAGCACACCGAGCTTTATTTTTTTT
A_38_P00020955	A_38_P00020955	mir|bmo-miR-2808d|mir|MIMAT0015386	bmo-miR-2808d	MIMAT0015386	unmapped	CGCTCGGGTTTTCCCGAGCGGAGCACACCGAGCTTCATTTTTTTTT
A_38_P00020956	A_38_P00020956	mir|bmo-miR-3387-3p|mir|MIMAT0015586|mir|bmo-miR-3387_v18.0|mir|MIMAT0015586	bmo-miR-3387-3p	MIMAT0015586	unmapped	CGCTCGGGTTTTCCCGAGCGGAGCACATTATGCACGATTTTTTTTTT
A_38_P00020957	A_38_P00020957	mir|bmo-miR-3387-3p|mir|MIMAT0015586|mir|bmo-miR-3387_v18.0|mir|MIMAT0015586	bmo-miR-3387-3p	MIMAT0015586	unmapped	CGCTCGGGTTTTCCCGAGCGGAGCACATTATGCACGAATTTTTTTTTT
A_38_P00020958	A_38_P00020958	mir|bmo-miR-3271|mir|MIMAT0015456	bmo-miR-3271	MIMAT0015456	unmapped	CGCTCGGGTTTTCCCGAGCGGAGCAGCACGCGCTTTTTTTTTT
A_38_P00020959	A_38_P00020959	mir|bmo-miR-3271|mir|MIMAT0015456	bmo-miR-3271	MIMAT0015456	unmapped	CGCTCGGGTTTTCCCGAGCGGAGCAGCACGCGCATTTTTTTTTT
A_38_P00020960	A_38_P00020960	mir|bmo-miR-3406-3p|mir|MIMAT0015612|mir|bmo-miR-3406*_v18.0|mir|MIMAT0015612	bmo-miR-3406-3p	MIMAT0015612	unmapped	CGCTCGGGTTTTCCCGAGCGGAGCATGGCGCAGTATTTTTTTT
A_38_P00020961	A_38_P00020961	mir|bmo-miR-3406-3p|mir|MIMAT0015612|mir|bmo-miR-3406*_v18.0|mir|MIMAT0015612	bmo-miR-3406-3p	MIMAT0015612	unmapped	CGCTCGGGTTTTCCCGAGCGGAGCATGGCGCAGCAATTTTTTTT
A_38_P00020962	A_38_P00020962	mir|bmo-miR-3416|mir|MIMAT0015623	bmo-miR-3416	MIMAT0015623	unmapped	CGCTCGGGTTTTCCCGAGCGGAGCCAGCACGTCCATTTTTTTTT
A_38_P00020963	A_38_P00020963	mir|bmo-miR-3416|mir|MIMAT0015623	bmo-miR-3416	MIMAT0015623	unmapped	CGCTCGGGTTTTCCCGAGCGGAGCCAGCACGTCCTTTTTTTTTTT
A_38_P00020964	A_38_P00020964	mir|bmo-miR-2797b|mir|MIMAT0013699	bmo-miR-2797b	MIMAT0013699	unmapped	CGCTCGGGTTTTCCCGAGCGGAGCCGAATAAGAACCTTTTTTTTTTT
A_38_P00020965	A_38_P00020965	mir|bmo-miR-2797b|mir|MIMAT0013699	bmo-miR-2797b	MIMAT0013699	unmapped	CGCTCGGGTTTTCCCGAGCGGAGCCGAATAAGAACCTATATTTTTTTT
A_38_P00020966	A_38_P00020966	mir|bmo-miR-2797b|mir|MIMAT0013699	bmo-miR-2797b	MIMAT0013699	unmapped	CGCTCGGGTTTTCCCGAGCGGAGCCGAATAAGAACCTACAATTTTTTTT
A_38_P00020967	A_38_P00020967	mir|bmo-miR-3340|mir|MIMAT0015528	bmo-miR-3340	MIMAT0015528	unmapped	CGCTCGGGTTTTCCCGAGCGGAGCCGATCGTCATCTTTTTTTTTT
A_38_P00020968	A_38_P00020968	mir|bmo-miR-3340|mir|MIMAT0015528	bmo-miR-3340	MIMAT0015528	unmapped	CGCTCGGGTTTTCCCGAGCGGAGCCGATCGTCATCGTTTTTTTTTT
A_38_P00020969	A_38_P00020969	mir|bmo-miR-279e|mir|MIMAT0015406	bmo-miR-279e	MIMAT0015406	unmapped	CGCTCGGGTTTTCCCGAGCGGAGCCGGAGTGTATCTTTTTTTTTT
A_38_P00020970	A_38_P00020970	mir|bmo-miR-279e|mir|MIMAT0015406	bmo-miR-279e	MIMAT0015406	unmapped	CGCTCGGGTTTTCCCGAGCGGAGCCGGAGTGTATCGTATTTTTTTT
A_38_P00020971	A_38_P00020971	mir|bmo-miR-14-5p|mir|MIMAT0015227|mir|bmo-miR-14*_v18.0|mir|MIMAT0015227	bmo-miR-14-5p	MIMAT0015227	unmapped	CGCTCGGGTTTTCCCGAGCGGAGCCTCGTCGATTTCATTTTTTTTT
A_38_P00020972	A_38_P00020972	mir|bmo-miR-14-5p|mir|MIMAT0015227|mir|bmo-miR-14*_v18.0|mir|MIMAT0015227	bmo-miR-14-5p	MIMAT0015227	unmapped	CGCTCGGGTTTTCCCGAGCGGAGCCTCGTCGATTTCTTATTTTTTTT
A_38_P00020973	A_38_P00020973	mir|bmo-miR-2812|mir|MIMAT0013720	bmo-miR-2812	MIMAT0013720	unmapped	CGCTCGGGTTTTCCCGAGCGGAGCCTTTCTATTACAGCTATTTTTTTT
A_38_P00020974	A_38_P00020974	mir|bmo-miR-2812|mir|MIMAT0013720	bmo-miR-2812	MIMAT0013720	unmapped	CGCTCGGGTTTTCCCGAGCGGAGCCTTTCTATTACAGCCATTTTTTTTT
A_38_P00020975	A_38_P00020975	mir|bmo-miR-3307|mir|MIMAT0015495	bmo-miR-3307	MIMAT0015495	unmapped	CGCTCGGGTTTTCCCGAGCGGAGCGATACAATGTGCATATTTTTTTT
A_38_P00020976	A_38_P00020976	mir|bmo-miR-3307|mir|MIMAT0015495	bmo-miR-3307	MIMAT0015495	unmapped	CGCTCGGGTTTTCCCGAGCGGAGCGATACAATGTGCAGAATTTTTTTT
A_38_P00020977	A_38_P00020977	mir|bmo-miR-2830|mir|MIMAT0013743	bmo-miR-2830	MIMAT0013743	unmapped	CGCTCGGGTTTTCCCGAGCGGAGCGCGCCCTGTTTTTTTTTT
A_38_P00020978	A_38_P00020978	mir|bmo-miR-2830|mir|MIMAT0013743	bmo-miR-2830	MIMAT0013743	unmapped	CGCTCGGGTTTTCCCGAGCGGAGCGCGCCCTGATTTTTTTTTT
A_38_P00020979	A_38_P00020979	mir|bmo-miR-3427|mir|MIMAT0015635	bmo-miR-3427	MIMAT0015635	unmapped	CGCTCGGGTTTTCCCGAGCGGAGCGTTTATAATGAAGACTAATTTTTTTT
A_38_P00020980	A_38_P00020980	mir|bmo-miR-3427|mir|MIMAT0015635	bmo-miR-3427	MIMAT0015635	unmapped	CGCTCGGGTTTTCCCGAGCGGAGCGTTTATAATGAAGACTTAATTTTTTTT
A_38_P00020981	A_38_P00020981	mir|bmo-miR-11-3p|mir|MIMAT0013602|mir|bmo-miR-11_v18.0|mir|MIMAT0013602	bmo-miR-11-3p	MIMAT0013602	unmapped	CGCTCGGGTTTTCCCGAGCGGAGCTAGAACTCTGACTGATTTTTTTTT
A_38_P00020982	A_38_P00020982	mir|bmo-miR-11-3p|mir|MIMAT0013602|mir|bmo-miR-11_v18.0|mir|MIMAT0013602	bmo-miR-11-3p	MIMAT0013602	unmapped	CGCTCGGGTTTTCCCGAGCGGAGCTAGAACTCTGACTGTTTTTTTTTTT
A_38_P00020983	A_38_P00020983	mir|bmo-miR-3402|mir|MIMAT0015606	bmo-miR-3402	MIMAT0015606	unmapped	CGCTCGGGTTTTCCCGAGCGGAGCTCAGCGGTTTAAATATTTTTTTT
A_38_P00020984	A_38_P00020984	mir|bmo-miR-3402|mir|MIMAT0015606	bmo-miR-3402	MIMAT0015606	unmapped	CGCTCGGGTTTTCCCGAGCGGAGCTCAGCGGTTTAAAGAATTTTTTTT
A_38_P00020985	A_38_P00020985	mir|bmo-miR-998|mir|MIMAT0013603	bmo-miR-998	MIMAT0013603	unmapped	CGCTCGGGTTTTCCCGAGCGGAGCTGAATCCCATGGATTTTTTTTT
A_38_P00020986	A_38_P00020986	mir|bmo-miR-998|mir|MIMAT0013603	bmo-miR-998	MIMAT0013603	unmapped	CGCTCGGGTTTTCCCGAGCGGAGCTGAATCCCATGGTTTTTTTTTTT
A_38_P00020987	A_38_P00020987	mir|bmo-miR-750-3p|mir|MIMAT0013645|mir|bmo-miR-750_v18.0|mir|MIMAT0013645	bmo-miR-750-3p	MIMAT0013645	unmapped	CGCTCGGGTTTTCCCGAGCGGAGCTGGAAAGATAGATCTTTTTTTTTTT
A_38_P00020988	A_38_P00020988	mir|bmo-miR-750-3p|mir|MIMAT0013645|mir|bmo-miR-750_v18.0|mir|MIMAT0013645	bmo-miR-750-3p	MIMAT0013645	unmapped	CGCTCGGGTTTTCCCGAGCGGAGCTGGAAAGATAGATCTGTTTTTTTTTT
A_38_P00020989	A_38_P00020989	mir|bmo-miR-3327-3p|mir|MIMAT0015515|mir|bmo-miR-3327*_v18.0|mir|MIMAT0015515	bmo-miR-3327-3p	MIMAT0015515	unmapped	CGCTCGGGTTTTCCCGAGCGGAGGACAACAAAAACGTATTTTTTTTT
A_38_P00020990	A_38_P00020990	mir|bmo-miR-3327-3p|mir|MIMAT0015515|mir|bmo-miR-3327*_v18.0|mir|MIMAT0015515	bmo-miR-3327-3p	MIMAT0015515	unmapped	CGCTCGGGTTTTCCCGAGCGGAGGACAACAAAAACGTTTTTTTTTTTT
A_38_P00020991	A_38_P00020991	mir|bmo-miR-3327-3p|mir|MIMAT0015515|mir|bmo-miR-3327*_v18.0|mir|MIMAT0015515	bmo-miR-3327-3p	MIMAT0015515	unmapped	CGCTCGGGTTTTCCCGAGCGGAGGACAACAAAAACGTTATTTTTTTTTT
A_38_P00020992	A_38_P00020992	mir|bmo-miR-34-3p|mir|MIMAT0015228|mir|bmo-miR-34*_v18.0|mir|MIMAT0015228	bmo-miR-34-3p	MIMAT0015228	unmapped	CGCTCGGGTTTTCCCGAGCGGAGGAGCAGTGTCGTATTTTTTTTT
A_38_P00020993	A_38_P00020993	mir|bmo-miR-34-3p|mir|MIMAT0015228|mir|bmo-miR-34*_v18.0|mir|MIMAT0015228	bmo-miR-34-3p	MIMAT0015228	unmapped	CGCTCGGGTTTTCCCGAGCGGAGGAGCAGTGTCGTTTTTTTTTTTT
A_38_P00020994	A_38_P00020994	mir|bmo-miR-34-3p|mir|MIMAT0015228|mir|bmo-miR-34*_v18.0|mir|MIMAT0015228	bmo-miR-34-3p	MIMAT0015228	unmapped	CGCTCGGGTTTTCCCGAGCGGAGGAGCAGTGTCGTTATATTTTTTTT
A_38_P00020995	A_38_P00020995	mir|bmo-miR-279d-3p|mir|MIMAT0013607|mir|bmo-miR-279d_v18.0|mir|MIMAT0013607	bmo-miR-279d-3p	MIMAT0013607	unmapped	CGCTCGGGTTTTCCCGAGCGGAGGATAAGTGAAAATCTAGTTTTTTTTTTT
A_38_P00020996	A_38_P00020996	mir|bmo-miR-279d-3p|mir|MIMAT0013607|mir|bmo-miR-279d_v18.0|mir|MIMAT0013607	bmo-miR-279d-3p	MIMAT0013607	unmapped	CGCTCGGGTTTTCCCGAGCGGAGGATAAGTGAAAATCTAGTCTTTTTTTTTT
A_38_P00020997	A_38_P00020997	mir|bmo-miR-3323|mir|MIMAT0015510	bmo-miR-3323	MIMAT0015510	unmapped	CGCTCGGGTTTTCCCGAGCGGAGGCATTAACATTATTCGTTATTTTTTTT
A_38_P00020998	A_38_P00020998	mir|bmo-miR-3323|mir|MIMAT0015510	bmo-miR-3323	MIMAT0015510	unmapped	CGCTCGGGTTTTCCCGAGCGGAGGCATTAACATTATTCGTAAATTTTTTTT
A_38_P00020999	A_38_P00020999	mir|bmo-miR-3323|mir|MIMAT0015510	bmo-miR-3323	MIMAT0015510	unmapped	CGCTCGGGTTTTCCCGAGCGGAGGCATTAACATTATTCGTATATTTTTTTTT
A_38_P00021000	A_38_P00021000	mir|bmo-miR-2774a|mir|MIMAT0013658	bmo-miR-2774a	MIMAT0013658	unmapped	CGCTCGGGTTTTCCCGAGCGGAGGGACGATCTTCCATTTTTTTTTT
A_38_P00021001	A_38_P00021001	mir|bmo-miR-2774a|mir|MIMAT0013658	bmo-miR-2774a	MIMAT0013658	unmapped	CGCTCGGGTTTTCCCGAGCGGAGGGACGATCTTCCACTTTTTTTTTT
A_38_P00021002	A_38_P00021002	mir|bmo-miR-275-5p|mir|MIMAT0015231|mir|bmo-miR-275*_v18.0|mir|MIMAT0015231	bmo-miR-275-5p	MIMAT0015231	unmapped	CGCTCGGGTTTTCCCGAGCGGAGTCCTGGCGCCTTTTTTTTTT
A_38_P00021003	A_38_P00021003	mir|bmo-miR-275-5p|mir|MIMAT0015231|mir|bmo-miR-275*_v18.0|mir|MIMAT0015231	bmo-miR-275-5p	MIMAT0015231	unmapped	CGCTCGGGTTTTCCCGAGCGGAGTCCTGGCGCCGTTTTTTTTTT
A_38_P00021004	A_38_P00021004	mir|bmo-miR-3225|mir|MIMAT0015407	bmo-miR-3225	MIMAT0015407	unmapped	CGCTCGGGTTTTCCCGAGCGGAGTGTTATAAACAGTCATATGATTTTTTTTT
A_38_P00021005	A_38_P00021005	mir|bmo-miR-3225|mir|MIMAT0015407	bmo-miR-3225	MIMAT0015407	unmapped	CGCTCGGGTTTTCCCGAGCGGAGTGTTATAAACAGTCATATGTTTTTTTTTTT
A_38_P00021006	A_38_P00021006	mir|bmo-miR-2808e|mir|MIMAT0015417	bmo-miR-2808e	MIMAT0015417	unmapped	CGCTCGGGTTTTCCCGAGCGGAGTTACTCACCGGATCAATTTTTTTT
A_38_P00021007	A_38_P00021007	mir|bmo-miR-2808e|mir|MIMAT0015417	bmo-miR-2808e	MIMAT0015417	unmapped	CGCTCGGGTTTTCCCGAGCGGAGTTACTCACCGGATCTATTTTTTTTT
A_38_P00021008	A_38_P00021008	mir|bmo-miR-2757-5p|mir|MIMAT0013627|mir|bmo-miR-2757_v18.0|mir|MIMAT0013627	bmo-miR-2757-5p	MIMAT0013627	unmapped	CGCTCGGGTTTTCCCGAGCGGAGTTGTAAGTGACCATTCTTTTTTTTTT
A_38_P00021009	A_38_P00021009	mir|bmo-miR-2757-5p|mir|MIMAT0013627|mir|bmo-miR-2757_v18.0|mir|MIMAT0013627	bmo-miR-2757-5p	MIMAT0013627	unmapped	CGCTCGGGTTTTCCCGAGCGGAGTTGTAAGTGACCATTCCTTTTTTTTTT
A_38_P00021010	A_38_P00021010	mir|bmo-miR-375-5p|mir|MIMAT0013648|mir|bmo-miR-375_v18.0|mir|MIMAT0013648	bmo-miR-375-5p	MIMAT0013648	unmapped	CGCTCGGGTTTTCCCGAGCGGAGTTTGCTCAGACCGTATTTTTTTT
A_38_P00021011	A_38_P00021011	mir|bmo-miR-375-5p|mir|MIMAT0013648|mir|bmo-miR-375_v18.0|mir|MIMAT0013648	bmo-miR-375-5p	MIMAT0013648	unmapped	CGCTCGGGTTTTCCCGAGCGGAGTTTGCTCAGACCGCATTTTTTTTT
A_38_P00021012	A_38_P00021012	mir|bmo-miR-3239|mir|MIMAT0015422	bmo-miR-3239	MIMAT0015422	unmapped	CGCTCGGGTTTTCCCGAGCGGATAAAAATCTCTTTTTCTCTGTTTTTTTTTT
A_38_P00021013	A_38_P00021013	mir|bmo-miR-3239|mir|MIMAT0015422	bmo-miR-3239	MIMAT0015422	unmapped	CGCTCGGGTTTTCCCGAGCGGATAAAAATCTCTTTTTCTCTGATTTTTTTTTT
A_38_P00021014	A_38_P00021014	mir|bmo-miR-2763-5p|mir|MIMAT0013637|mir|bmo-miR-2763*_v18.0|mir|MIMAT0013637	bmo-miR-2763-5p	MIMAT0013637	unmapped	CGCTCGGGTTTTCCCGAGCGGATAAATTATGTTCACTACTTTGTTTTTTTTTT
A_38_P00021015	A_38_P00021015	mir|bmo-miR-2763-5p|mir|MIMAT0013637|mir|bmo-miR-2763*_v18.0|mir|MIMAT0013637	bmo-miR-2763-5p	MIMAT0013637	unmapped	CGCTCGGGTTTTCCCGAGCGGATAAATTATGTTCACTACTTTGCTTTTTTTTTT
A_38_P00021016	A_38_P00021016	mir|bmo-miR-2777-5p|mir|MIMAT0013662|mir|bmo-miR-2777_v18.0|mir|MIMAT0013662	bmo-miR-2777-5p	MIMAT0013662	unmapped	CGCTCGGGTTTTCCCGAGCGGATAACCCAGGCAAGGATTTTTTTTT
A_38_P00021017	A_38_P00021017	mir|bmo-miR-2777-5p|mir|MIMAT0013662|mir|bmo-miR-2777_v18.0|mir|MIMAT0013662	bmo-miR-2777-5p	MIMAT0013662	unmapped	CGCTCGGGTTTTCCCGAGCGGATAACCCAGGCAAGGTTTTTTTTTTT
A_38_P00021018	A_38_P00021018	mir|bmo-miR-3286-3p|mir|MIMAT0015473|mir|bmo-miR-3286_v18.0|mir|MIMAT0015473	bmo-miR-3286-3p	MIMAT0015473	unmapped	CGCTCGGGTTTTCCCGAGCGGATAACTATTGGAACACGCTTTTTTTTTT
A_38_P00021019	A_38_P00021019	mir|bmo-miR-3286-3p|mir|MIMAT0015473|mir|bmo-miR-3286_v18.0|mir|MIMAT0015473	bmo-miR-3286-3p	MIMAT0015473	unmapped	CGCTCGGGTTTTCCCGAGCGGATAACTATTGGAACACGCATTTTTTTTTT
A_38_P00021020	A_38_P00021020	mir|bmo-miR-2780a-5p|mir|MIMAT0013669|mir|bmo-miR-2780a_v18.0|mir|MIMAT0013669	bmo-miR-2780a-5p	MIMAT0013669	unmapped	CGCTCGGGTTTTCCCGAGCGGATAAGTCTTCATTTAACACCTATTTTTTTT
A_38_P00021021	A_38_P00021021	mir|bmo-miR-2780a-5p|mir|MIMAT0013669|mir|bmo-miR-2780a_v18.0|mir|MIMAT0013669	bmo-miR-2780a-5p	MIMAT0013669	unmapped	CGCTCGGGTTTTCCCGAGCGGATAAGTCTTCATTTAACACCCAATTTTTTTT
A_38_P00021022	A_38_P00021022	mir|bmo-miR-2756-3p|mir|MIMAT0013624|mir|bmo-miR-2756*_v18.0|mir|MIMAT0013624	bmo-miR-2756-3p	MIMAT0013624	unmapped	CGCTCGGGTTTTCCCGAGCGGATACAATGTAGCAGCCTTTTTTTTTT
A_38_P00021023	A_38_P00021023	mir|bmo-miR-2756-3p|mir|MIMAT0013624|mir|bmo-miR-2756*_v18.0|mir|MIMAT0013624	bmo-miR-2756-3p	MIMAT0013624	unmapped	CGCTCGGGTTTTCCCGAGCGGATACAATGTAGCAGCCGTTTTTTTTTT
A_38_P00021024	A_38_P00021024	mir|bmo-miR-279b-5p|mir|MIMAT0013608|mir|bmo-miR-279b*_v18.0|mir|MIMAT0013608	bmo-miR-279b-5p	MIMAT0013608	unmapped	CGCTCGGGTTTTCCCGAGCGGATACTAGACCTATACCCTATTTTTTTT
A_38_P00021025	A_38_P00021025	mir|bmo-miR-279b-5p|mir|MIMAT0013608|mir|bmo-miR-279b*_v18.0|mir|MIMAT0013608	bmo-miR-279b-5p	MIMAT0013608	unmapped	CGCTCGGGTTTTCCCGAGCGGATACTAGACCTATACCCAATTTTTTTTT
A_38_P00021026	A_38_P00021026	mir|bmo-miR-279b-5p|mir|MIMAT0013608|mir|bmo-miR-279b*_v18.0|mir|MIMAT0013608	bmo-miR-279b-5p	MIMAT0013608	unmapped	CGCTCGGGTTTTCCCGAGCGGATACTAGACCTATACCCATTTTTTTTTTT
A_38_P00021027	A_38_P00021027	mir|bmo-miR-3328|mir|MIMAT0015516	bmo-miR-3328	MIMAT0015516	unmapped	CGCTCGGGTTTTCCCGAGCGGATAGATTCCCTGAAGTGTTTTTTTTTT
A_38_P00021028	A_38_P00021028	mir|bmo-miR-3328|mir|MIMAT0015516	bmo-miR-3328	MIMAT0015516	unmapped	CGCTCGGGTTTTCCCGAGCGGATAGATTCCCTGAAGTGCTTTTTTTTTT
A_38_P00021029	A_38_P00021029	mir|bmo-miR-2839-5p|mir|MIMAT0013754|mir|bmo-miR-2839*_v18.0|mir|MIMAT0013754	bmo-miR-2839-5p	MIMAT0013754	unmapped	CGCTCGGGTTTTCCCGAGCGGATAGCGCTGGCGCATTTTTTTTT
A_38_P00021030	A_38_P00021030	mir|bmo-miR-2839-5p|mir|MIMAT0013754|mir|bmo-miR-2839*_v18.0|mir|MIMAT0013754	bmo-miR-2839-5p	MIMAT0013754	unmapped	CGCTCGGGTTTTCCCGAGCGGATAGCGCTGGCGCTTATTTTTTTT
A_38_P00021031	A_38_P00021031	mir|bmo-miR-2733e|mir|MIMAT0013617	bmo-miR-2733e	MIMAT0013617	unmapped	CGCTCGGGTTTTCCCGAGCGGATAGCTATTACATTCCCAGATTTTTTTTT
A_38_P00021032	A_38_P00021032	mir|bmo-miR-2733e|mir|MIMAT0013617	bmo-miR-2733e	MIMAT0013617	unmapped	CGCTCGGGTTTTCCCGAGCGGATAGCTATTACATTCCCAGTTTTTTTTTTT
A_38_P00021033	A_38_P00021033	mir|bmo-miR-2825|mir|MIMAT0013736	bmo-miR-2825	MIMAT0013736	unmapped	CGCTCGGGTTTTCCCGAGCGGATAGCTTCTTCGTGATCTATTTTTTTT
A_38_P00021034	A_38_P00021034	mir|bmo-miR-2825|mir|MIMAT0013736	bmo-miR-2825	MIMAT0013736	unmapped	CGCTCGGGTTTTCCCGAGCGGATAGCTTCTTCGTGATCCATTTTTTTTT
A_38_P00021035	A_38_P00021035	mir|bmo-miR-92a|mir|MIMAT0016927	bmo-miR-92a	MIMAT0016927	unmapped	CGCTCGGGTTTTCCCGAGCGGATAGGCCGGGACTGTATTTTTTTT
A_38_P00021036	A_38_P00021036	mir|bmo-miR-92a|mir|MIMAT0016927	bmo-miR-92a	MIMAT0016927	unmapped	CGCTCGGGTTTTCCCGAGCGGATAGGCCGGGACTGGATTTTTTTTT
A_38_P00021037	A_38_P00021037	mir|bmo-miR-2733i-3p|mir|MIMAT0015592|mir|bmo-miR-2733i_v18.0|mir|MIMAT0015592	bmo-miR-2733i-3p	MIMAT0015592	unmapped	CGCTCGGGTTTTCCCGAGCGGATAGTCATTACATTCCCAGATTTTTTTTT
A_38_P00021038	A_38_P00021038	mir|bmo-miR-2733i-3p|mir|MIMAT0015592|mir|bmo-miR-2733i_v18.0|mir|MIMAT0015592	bmo-miR-2733i-3p	MIMAT0015592	unmapped	CGCTCGGGTTTTCCCGAGCGGATAGTCATTACATTCCCAGTTTTTTTTTTT
A_38_P00021039	A_38_P00021039	mir|bmo-miR-3204b|mir|MIMAT0015638|mir|bmo-miR-3204a_v18.0|mir|MIMAT0015381|mir|bmo-miR-3204a-5p|mir|MIMAT0015381	bmo-miR-3204b	MIMAT0015638	unmapped	CGCTCGGGTTTTCCCGAGCGGATATGGGAAGTTTATGACGTTTTTTTTTT
A_38_P00021040	A_38_P00021040	mir|bmo-miR-3204b|mir|MIMAT0015638|mir|bmo-miR-3204a_v18.0|mir|MIMAT0015381|mir|bmo-miR-3204a-5p|mir|MIMAT0015381	bmo-miR-3204b	MIMAT0015638	unmapped	CGCTCGGGTTTTCCCGAGCGGATATGGGAAGTTTATGACGCTTTTTTTTTT
A_38_P00021041	A_38_P00021041	mir|bmo-miR-2809|mir|MIMAT0013717	bmo-miR-2809	MIMAT0013717	unmapped	CGCTCGGGTTTTCCCGAGCGGATCAGGTGATCCGTTCTTTTTTTTTT
A_38_P00021042	A_38_P00021042	mir|bmo-miR-2809|mir|MIMAT0013717	bmo-miR-2809	MIMAT0013717	unmapped	CGCTCGGGTTTTCCCGAGCGGATCAGGTGATCCGTTCGTATTTTTTTT
A_38_P00021043	A_38_P00021043	mir|bmo-miR-2763-3p|mir|MIMAT0013638|mir|bmo-miR-2763_v18.0|mir|MIMAT0013638	bmo-miR-2763-3p	MIMAT0013638	unmapped	CGCTCGGGTTTTCCCGAGCGGATCCAAAGAAATGAGCATTTTTTTTTTT
A_38_P00021044	A_38_P00021044	mir|bmo-miR-2763-3p|mir|MIMAT0013638|mir|bmo-miR-2763_v18.0|mir|MIMAT0013638	bmo-miR-2763-3p	MIMAT0013638	unmapped	CGCTCGGGTTTTCCCGAGCGGATCCAAAGAAATGAGCATATATTTTTTTT
A_38_P00021045	A_38_P00021045	mir|bmo-miR-2763-3p|mir|MIMAT0013638|mir|bmo-miR-2763_v18.0|mir|MIMAT0013638	bmo-miR-2763-3p	MIMAT0013638	unmapped	CGCTCGGGTTTTCCCGAGCGGATCCAAAGAAATGAGCATAAATTTTTTTTT
A_38_P00021046	A_38_P00021046	mir|bmo-miR-2789|mir|MIMAT0013686	bmo-miR-2789	MIMAT0013686	unmapped	CGCTCGGGTTTTCCCGAGCGGATCCACCTCCAAACTTATTTTTTTTT
A_38_P00021047	A_38_P00021047	mir|bmo-miR-2789|mir|MIMAT0013686	bmo-miR-2789	MIMAT0013686	unmapped	CGCTCGGGTTTTCCCGAGCGGATCCACCTCCAAACTTTTATTTTTTTT
A_38_P00021048	A_38_P00021048	mir|bmo-miR-3279|mir|MIMAT0015464	bmo-miR-3279	MIMAT0015464	unmapped	CGCTCGGGTTTTCCCGAGCGGATCCACCTGACTATTTTGTTTTTTTTTT
A_38_P00021049	A_38_P00021049	mir|bmo-miR-3279|mir|MIMAT0015464	bmo-miR-3279	MIMAT0015464	unmapped	CGCTCGGGTTTTCCCGAGCGGATCCACCTGACTATTTTGATTTTTTTTTT
A_38_P00021050	A_38_P00021050	mir|bmo-miR-3277|mir|MIMAT0015462	bmo-miR-3277	MIMAT0015462	unmapped	CGCTCGGGTTTTCCCGAGCGGATCGAATTTCAGAAACATGTTTTTTTTTT
A_38_P00021051	A_38_P00021051	mir|bmo-miR-3277|mir|MIMAT0015462	bmo-miR-3277	MIMAT0015462	unmapped	CGCTCGGGTTTTCCCGAGCGGATCGAATTTCAGAAACATGCTTTTTTTTTT
A_38_P00021052	A_38_P00021052	mir|bmo-miR-3208|mir|MIMAT0015387	bmo-miR-3208	MIMAT0015387	unmapped	CGCTCGGGTTTTCCCGAGCGGATCTCTCTCTCTTTCCTCTTTTTTTTTT
A_38_P00021053	A_38_P00021053	mir|bmo-miR-3208|mir|MIMAT0015387	bmo-miR-3208	MIMAT0015387	unmapped	CGCTCGGGTTTTCCCGAGCGGATCTCTCTCTCTTTCCTCGTTTTTTTTTT
A_38_P00021054	A_38_P00021054	mir|bmo-miR-3329|mir|MIMAT0015517	bmo-miR-3329	MIMAT0015517	unmapped	CGCTCGGGTTTTCCCGAGCGGATCTGTCATAAATTATTGTATGTTTTTTTTTT
A_38_P00021055	A_38_P00021055	mir|bmo-miR-3329|mir|MIMAT0015517	bmo-miR-3329	MIMAT0015517	unmapped	CGCTCGGGTTTTCCCGAGCGGATCTGTCATAAATTATTGTATGCTTTTTTTTTT
A_38_P00021056	A_38_P00021056	mir|bmo-miR-71-3p|mir|MIMAT0015243|mir|bmo-miR-71*_v18.0|mir|MIMAT0015243	bmo-miR-71-3p	MIMAT0015243	unmapped	CGCTCGGGTTTTCCCGAGCGGATGAAAGACAAGGTAGTGTTTTTTTTTT
A_38_P00021057	A_38_P00021057	mir|bmo-miR-71-3p|mir|MIMAT0015243|mir|bmo-miR-71*_v18.0|mir|MIMAT0015243	bmo-miR-71-3p	MIMAT0015243	unmapped	CGCTCGGGTTTTCCCGAGCGGATGAAAGACAAGGTAGTGATTTTTTTTTT
A_38_P00021058	A_38_P00021058	mir|bmo-miR-3246|mir|MIMAT0015428	bmo-miR-3246	MIMAT0015428	unmapped	CGCTCGGGTTTTCCCGAGCGGATGACACAATGTTCTGATTTTTTTTTTT
A_38_P00021059	A_38_P00021059	mir|bmo-miR-3246|mir|MIMAT0015428	bmo-miR-3246	MIMAT0015428	unmapped	CGCTCGGGTTTTCCCGAGCGGATGACACAATGTTCTGATATTTTTTTTTT
A_38_P00021060	A_38_P00021060	mir|bmo-miR-3246|mir|MIMAT0015428	bmo-miR-3246	MIMAT0015428	unmapped	CGCTCGGGTTTTCCCGAGCGGATGACACAATGTTCTGATAGTTTTTTTTTT
A_38_P00021061	A_38_P00021061	mir|bmo-miR-3373-5p|mir|MIMAT0015561|mir|bmo-miR-3373_v18.0|mir|MIMAT0015561	bmo-miR-3373-5p	MIMAT0015561	unmapped	CGCTCGGGTTTTCCCGAGCGGATGCCCGAACAGTTCATTTTTTTTT
A_38_P00021062	A_38_P00021062	mir|bmo-miR-3373-5p|mir|MIMAT0015561|mir|bmo-miR-3373_v18.0|mir|MIMAT0015561	bmo-miR-3373-5p	MIMAT0015561	unmapped	CGCTCGGGTTTTCCCGAGCGGATGCCCGAACAGTTCTTTTTTTTTTT
A_38_P00021063	A_38_P00021063	mir|bmo-miR-1a-5p|mir|MIMAT0015222|mir|bmo-miR-1*_v16.0|mir|MIMAT0015222|mir|bmo-miR-1a*_v18.0|mir|MIMAT0015222	bmo-miR-1a-5p	MIMAT0015222	unmapped	CGCTCGGGTTTTCCCGAGCGGATGGGAAGTAAGGAAGTTTTTTTTTT
A_38_P00021064	A_38_P00021064	mir|bmo-miR-1a-5p|mir|MIMAT0015222|mir|bmo-miR-1*_v16.0|mir|MIMAT0015222|mir|bmo-miR-1a*_v18.0|mir|MIMAT0015222	bmo-miR-1a-5p	MIMAT0015222	unmapped	CGCTCGGGTTTTCCCGAGCGGATGGGAAGTAAGGAAGCTTTTTTTTTT
A_38_P00021065	A_38_P00021065	mir|bmo-miR-2857|mir|MIMAT0013796	bmo-miR-2857	MIMAT0013796	unmapped	CGCTCGGGTTTTCCCGAGCGGATGTTCCGTATGTGTCTTTTTTTTTT
A_38_P00021066	A_38_P00021066	mir|bmo-miR-2857|mir|MIMAT0013796	bmo-miR-2857	MIMAT0013796	unmapped	CGCTCGGGTTTTCCCGAGCGGATGTTCCGTATGTGTCCTTTTTTTTTT
A_38_P00021067	A_38_P00021067	mir|bmo-miR-2843-2-3p|mir|MIMAT0015307|mir|bmo-miR-2843-2*_v18.0|mir|MIMAT0015307	bmo-miR-2843-2-3p	MIMAT0015307	unmapped	CGCTCGGGTTTTCCCGAGCGGATTAAGGGGTCAGGCAATTTTTTTT
A_38_P00021068	A_38_P00021068	mir|bmo-miR-2843-2-3p|mir|MIMAT0015307|mir|bmo-miR-2843-2*_v18.0|mir|MIMAT0015307	bmo-miR-2843-2-3p	MIMAT0015307	unmapped	CGCTCGGGTTTTCCCGAGCGGATTAAGGGGTCAGGCTATTTTTTTTT
A_38_P00021069	A_38_P00021069	mir|bmo-miR-2843-2-3p|mir|MIMAT0015307|mir|bmo-miR-2843-2*_v18.0|mir|MIMAT0015307	bmo-miR-2843-2-3p	MIMAT0015307	unmapped	CGCTCGGGTTTTCCCGAGCGGATTAAGGGGTCAGGCTTTTTTTTTTTT
A_38_P00021070	A_38_P00021070	mir|bmo-miR-3364|mir|MIMAT0015550	bmo-miR-3364	MIMAT0015550	unmapped	CGCTCGGGTTTTCCCGAGCGGATTATGGAAGTGATAGTCACTTTTTTTTTT
A_38_P00021071	A_38_P00021071	mir|bmo-miR-3364|mir|MIMAT0015550	bmo-miR-3364	MIMAT0015550	unmapped	CGCTCGGGTTTTCCCGAGCGGATTATGGAAGTGATAGTCACGTTTTTTTTTT
A_38_P00021072	A_38_P00021072	mir|bmo-miR-3214|mir|MIMAT0015394	bmo-miR-3214	MIMAT0015394	unmapped	CGCTCGGGTTTTCCCGAGCGGATTCGACCTTTCTATCTATCAATTTTTTTT
A_38_P00021073	A_38_P00021073	mir|bmo-miR-3214|mir|MIMAT0015394	bmo-miR-3214	MIMAT0015394	unmapped	CGCTCGGGTTTTCCCGAGCGGATTCGACCTTTCTATCTATCTATTTTTTTTT
A_38_P00021074	A_38_P00021074	mir|bmo-miR-3397|mir|MIMAT0015601	bmo-miR-3397	MIMAT0015601	unmapped	CGCTCGGGTTTTCCCGAGCGGATTCTACCGAGATATTCAGTTTTTTTTTT
A_38_P00021075	A_38_P00021075	mir|bmo-miR-3397|mir|MIMAT0015601	bmo-miR-3397	MIMAT0015601	unmapped	CGCTCGGGTTTTCCCGAGCGGATTCTACCGAGATATTCAGCTATTTTTTTT
A_38_P00021076	A_38_P00021076	mir|bmo-miR-3206|mir|MIMAT0015384	bmo-miR-3206	MIMAT0015384	unmapped	CGCTCGGGTTTTCCCGAGCGGATTTTACCTACAAACTGATGTTTTTTTTTT
A_38_P00021077	A_38_P00021077	mir|bmo-miR-3206|mir|MIMAT0015384	bmo-miR-3206	MIMAT0015384	unmapped	CGCTCGGGTTTTCCCGAGCGGATTTTACCTACAAACTGATGGTATTTTTTTT
A_38_P00021078	A_38_P00021078	mir|bmo-miR-2833|mir|MIMAT0013747	bmo-miR-2833	MIMAT0013747	unmapped	CGCTCGGGTTTTCCCGAGCGGCAAAAAGTACATTTCCAATTATTTTTTTT
A_38_P00021079	A_38_P00021079	mir|bmo-miR-2833|mir|MIMAT0013747	bmo-miR-2833	MIMAT0013747	unmapped	CGCTCGGGTTTTCCCGAGCGGCAAAAAGTACATTTCCAATCATTTTTTTTT
A_38_P00021080	A_38_P00021080	mir|bmo-miR-3417|mir|MIMAT0015624	bmo-miR-3417	MIMAT0015624	unmapped	CGCTCGGGTTTTCCCGAGCGGCAAAACATTATCGAATATCTTATTTTTTTT
A_38_P00021081	A_38_P00021081	mir|bmo-miR-3417|mir|MIMAT0015624	bmo-miR-3417	MIMAT0015624	unmapped	CGCTCGGGTTTTCCCGAGCGGCAAAACATTATCGAATATCTCATTTTTTTTT
A_38_P00021082	A_38_P00021082	mir|bmo-miR-2767|mir|MIMAT0013643	bmo-miR-2767	MIMAT0013643	unmapped	CGCTCGGGTTTTCCCGAGCGGCAAACCGCACGAGTATTTTTTTT
A_38_P00021083	A_38_P00021083	mir|bmo-miR-2767|mir|MIMAT0013643	bmo-miR-2767	MIMAT0013643	unmapped	CGCTCGGGTTTTCCCGAGCGGCAAACCGCACGAGAAATTTTTTTT
A_38_P00021084	A_38_P00021084	mir|bmo-miR-3377-3p|mir|MIMAT0015568|mir|bmo-miR-3377*_v18.0|mir|MIMAT0015568	bmo-miR-3377-3p	MIMAT0015568	unmapped	CGCTCGGGTTTTCCCGAGCGGCAAATCAAGAACCTATGATTTTTTTTTT
A_38_P00021085	A_38_P00021085	mir|bmo-miR-3377-3p|mir|MIMAT0015568|mir|bmo-miR-3377*_v18.0|mir|MIMAT0015568	bmo-miR-3377-3p	MIMAT0015568	unmapped	CGCTCGGGTTTTCCCGAGCGGCAAATCAAGAACCTATGAATTTTTTTTTT
A_38_P00021086	A_38_P00021086	mir|bmo-miR-3377-3p|mir|MIMAT0015568|mir|bmo-miR-3377*_v18.0|mir|MIMAT0015568	bmo-miR-3377-3p	MIMAT0015568	unmapped	CGCTCGGGTTTTCCCGAGCGGCAAATCAAGAACCTATGAAATTTTTTTTTT
A_38_P00021087	A_38_P00021087	mir|bmo-miR-3403|mir|MIMAT0015607	bmo-miR-3403	MIMAT0015607	unmapped	CGCTCGGGTTTTCCCGAGCGGCAAATCAGACTTCAGACATTTTTTTTT
A_38_P00021088	A_38_P00021088	mir|bmo-miR-3403|mir|MIMAT0015607	bmo-miR-3403	MIMAT0015607	unmapped	CGCTCGGGTTTTCCCGAGCGGCAAATCAGACTTCAGACTTTTTTTTTTT
A_38_P00021089	A_38_P00021089	mir|bmo-miR-3429|mir|MIMAT0015637	bmo-miR-3429	MIMAT0015637	unmapped	CGCTCGGGTTTTCCCGAGCGGCAAATCGTTAAGAAATTATTAATTTTTTTTTT
A_38_P00021090	A_38_P00021090	mir|bmo-miR-3429|mir|MIMAT0015637	bmo-miR-3429	MIMAT0015637	unmapped	CGCTCGGGTTTTCCCGAGCGGCAAATCGTTAAGAAATTATTAAGTTTTTTTTTT
A_38_P00021091	A_38_P00021091	mir|bmo-miR-3223-3p|mir|MIMAT0015404|mir|bmo-miR-3223*_v18.0|mir|MIMAT0015404	bmo-miR-3223-3p	MIMAT0015404	unmapped	CGCTCGGGTTTTCCCGAGCGGCAAATTATCCTCCCCATTTTTTTTTT
A_38_P00021092	A_38_P00021092	mir|bmo-miR-3223-3p|mir|MIMAT0015404|mir|bmo-miR-3223*_v18.0|mir|MIMAT0015404	bmo-miR-3223-3p	MIMAT0015404	unmapped	CGCTCGGGTTTTCCCGAGCGGCAAATTATCCTCCCCAGTTTTTTTTTT
A_38_P00021095	A_38_P00021095	mir|bmo-miR-3407|mir|MIMAT0015613	bmo-miR-3407	MIMAT0015613	unmapped	CGCTCGGGTTTTCCCGAGCGGCAACTTCCCGTCTCATTTTTTTTT
A_38_P00021096	A_38_P00021096	mir|bmo-miR-3407|mir|MIMAT0015613	bmo-miR-3407	MIMAT0015613	unmapped	CGCTCGGGTTTTCCCGAGCGGCAACTTCCCGTCTCTTTTTTTTTTT
A_38_P00021097	A_38_P00021097	mir|bmo-miR-3309|mir|MIMAT0015498	bmo-miR-3309	MIMAT0015498	unmapped	CGCTCGGGTTTTCCCGAGCGGCAAGAGCACAATTATACTATATTTTTTTTT
A_38_P00021098	A_38_P00021098	mir|bmo-miR-3309|mir|MIMAT0015498	bmo-miR-3309	MIMAT0015498	unmapped	CGCTCGGGTTTTCCCGAGCGGCAAGAGCACAATTATACTATTTTTTTTTTTT
A_38_P00021099	A_38_P00021099	mir|bmo-miR-2826|mir|MIMAT0013737	bmo-miR-2826	MIMAT0013737	unmapped	CGCTCGGGTTTTCCCGAGCGGCAATATCGGATCCTCGTATTTTTTTT
A_38_P00021100	A_38_P00021100	mir|bmo-miR-2826|mir|MIMAT0013737	bmo-miR-2826	MIMAT0013737	unmapped	CGCTCGGGTTTTCCCGAGCGGCAATATCGGATCCTCGAATTTTTTTTT
A_38_P00021101	A_38_P00021101	mir|bmo-miR-2733h|mir|MIMAT0014663	bmo-miR-2733h	MIMAT0014663	unmapped	CGCTCGGGTTTTCCCGAGCGGCAATCATCATACACCCATATTTTTTTT
A_38_P00021102	A_38_P00021102	mir|bmo-miR-2733h|mir|MIMAT0014663	bmo-miR-2733h	MIMAT0014663	unmapped	CGCTCGGGTTTTCCCGAGCGGCAATCATCATACACCCAGATTTTTTTTT
A_38_P00021103	A_38_P00021103	mir|bmo-miR-2733g|mir|MIMAT0014662	bmo-miR-2733g	MIMAT0014662	unmapped	CGCTCGGGTTTTCCCGAGCGGCAATCTTCATGCACCTTTTTTTTTT
A_38_P00021104	A_38_P00021104	mir|bmo-miR-2733g|mir|MIMAT0014662	bmo-miR-2733g	MIMAT0014662	unmapped	CGCTCGGGTTTTCCCGAGCGGCAATCTTCATGCACCCTTTTTTTTTT
A_38_P00021105	A_38_P00021105	mir|bmo-miR-100|mir|MIMAT0013596	bmo-miR-100	MIMAT0013596	unmapped	CGCTCGGGTTTTCCCGAGCGGCACAAGTTCGGATCTACGTTTTTTTTTT
A_38_P00021106	A_38_P00021106	mir|bmo-miR-100|mir|MIMAT0013596	bmo-miR-100	MIMAT0013596	unmapped	CGCTCGGGTTTTCCCGAGCGGCACAAGTTCGGATCTACGGTATTTTTTTT
A_38_P00021107	A_38_P00021107	mir|bmo-miR-2788|mir|MIMAT0013685	bmo-miR-2788	MIMAT0013685	unmapped	CGCTCGGGTTTTCCCGAGCGGCACATACCGCTTTGATTTTTTTTTT
A_38_P00021108	A_38_P00021108	mir|bmo-miR-2788|mir|MIMAT0013685	bmo-miR-2788	MIMAT0013685	unmapped	CGCTCGGGTTTTCCCGAGCGGCACATACCGCTTTGAATTTTTTTTTT
A_38_P00021109	A_38_P00021109	mir|bmo-miR-2788|mir|MIMAT0013685	bmo-miR-2788	MIMAT0013685	unmapped	CGCTCGGGTTTTCCCGAGCGGCACATACCGCTTTGAAATTTTTTTTTT
A_38_P00021110	A_38_P00021110	mir|bmo-miR-3298|mir|MIMAT0015487	bmo-miR-3298	MIMAT0015487	unmapped	CGCTCGGGTTTTCCCGAGCGGCACATGTGTTCGCATATTTTTTTT
A_38_P00021111	A_38_P00021111	mir|bmo-miR-3298|mir|MIMAT0015487	bmo-miR-3298	MIMAT0015487	unmapped	CGCTCGGGTTTTCCCGAGCGGCACATGTGTTCGCAAATTTTTTTTT
A_38_P00021112	A_38_P00021112	mir|bmo-miR-3298|mir|MIMAT0015487	bmo-miR-3298	MIMAT0015487	unmapped	CGCTCGGGTTTTCCCGAGCGGCACATGTGTTCGCAATTTTTTTTTTT
A_38_P00021113	A_38_P00021113	mir|bmo-miR-2766-3p|mir|MIMAT0013642|mir|bmo-miR-2766_v18.0|mir|MIMAT0013642	bmo-miR-2766-3p	MIMAT0013642	unmapped	CGCTCGGGTTTTCCCGAGCGGCACCATTCGACAAGATATTTTTTTT
A_38_P00021114	A_38_P00021114	mir|bmo-miR-2766-3p|mir|MIMAT0013642|mir|bmo-miR-2766_v18.0|mir|MIMAT0013642	bmo-miR-2766-3p	MIMAT0013642	unmapped	CGCTCGGGTTTTCCCGAGCGGCACCATTCGACAAGACATTTTTTTTT
A_38_P00021115	A_38_P00021115	mir|bmo-miR-2856-5p|mir|MIMAT0013792|mir|bmo-miR-2856*_v18.0|mir|MIMAT0013792	bmo-miR-2856-5p	MIMAT0013792	unmapped	CGCTCGGGTTTTCCCGAGCGGCACCCTCGAACCATTTTTTTTTT
A_38_P00021116	A_38_P00021116	mir|bmo-miR-2856-5p|mir|MIMAT0013792|mir|bmo-miR-2856*_v18.0|mir|MIMAT0013792	bmo-miR-2856-5p	MIMAT0013792	unmapped	CGCTCGGGTTTTCCCGAGCGGCACCCTCGAACCACTTTTTTTTTT
A_38_P00021117	A_38_P00021117	mir|bmo-miR-13b-5p|mir|MIMAT0015274|mir|bmo-miR-13b*_v18.0|mir|MIMAT0015274	bmo-miR-13b-5p	MIMAT0015274	unmapped	CGCTCGGGTTTTCCCGAGCGGCACGACACAGCCAAATTTTTTTT
A_38_P00021118	A_38_P00021118	mir|bmo-miR-13b-5p|mir|MIMAT0015274|mir|bmo-miR-13b*_v18.0|mir|MIMAT0015274	bmo-miR-13b-5p	MIMAT0015274	unmapped	CGCTCGGGTTTTCCCGAGCGGCACGACACAGCCATAATTTTTTTT
A_38_P00021119	A_38_P00021119	mir|bmo-miR-13b-5p|mir|MIMAT0015274|mir|bmo-miR-13b*_v18.0|mir|MIMAT0015274	bmo-miR-13b-5p	MIMAT0015274	unmapped	CGCTCGGGTTTTCCCGAGCGGCACGACACAGCCATTAATTTTTTTT
A_38_P00021120	A_38_P00021120	mir|bmo-miR-3387-5p|mir|MIMAT0015585|mir|bmo-miR-3387*_v18.0|mir|MIMAT0015585	bmo-miR-3387-5p	MIMAT0015585	unmapped	CGCTCGGGTTTTCCCGAGCGGCACGATCGTTTTCATTTTTTTTTTTT
A_38_P00021121	A_38_P00021121	mir|bmo-miR-3387-5p|mir|MIMAT0015585|mir|bmo-miR-3387*_v18.0|mir|MIMAT0015585	bmo-miR-3387-5p	MIMAT0015585	unmapped	CGCTCGGGTTTTCCCGAGCGGCACGATCGTTTTCATTATATTTTTTTT
A_38_P00021122	A_38_P00021122	mir|bmo-miR-3387-5p|mir|MIMAT0015585|mir|bmo-miR-3387*_v18.0|mir|MIMAT0015585	bmo-miR-3387-5p	MIMAT0015585	unmapped	CGCTCGGGTTTTCCCGAGCGGCACGATCGTTTTCATTAAATTTTTTTTT
A_38_P00021123	A_38_P00021123	mir|bmo-miR-3312|mir|MIMAT0015501	bmo-miR-3312	MIMAT0015501	unmapped	CGCTCGGGTTTTCCCGAGCGGCACGCAAGCGAAGTTTTTTTTTT
A_38_P00021124	A_38_P00021124	mir|bmo-miR-3312|mir|MIMAT0015501	bmo-miR-3312	MIMAT0015501	unmapped	CGCTCGGGTTTTCCCGAGCGGCACGCAAGCGAAGCTTTTTTTTTT
A_38_P00021125	A_38_P00021125	mir|bmo-miR-2775b|mir|MIMAT0013745	bmo-miR-2775b	MIMAT0013745	unmapped	CGCTCGGGTTTTCCCGAGCGGCACGCGGGAGGTTTTTTTTTT
A_38_P00021126	A_38_P00021126	mir|bmo-miR-2775b|mir|MIMAT0013745	bmo-miR-2775b	MIMAT0013745	unmapped	CGCTCGGGTTTTCCCGAGCGGCACGCGGGAGGATTTTTTTTTT
A_38_P00021127	A_38_P00021127	mir|bmo-miR-3319|mir|MIMAT0015507	bmo-miR-3319	MIMAT0015507	unmapped	CGCTCGGGTTTTCCCGAGCGGCACGGAGCCGGTATTTTTTTT
A_38_P00021128	A_38_P00021128	mir|bmo-miR-3319|mir|MIMAT0015507	bmo-miR-3319	MIMAT0015507	unmapped	CGCTCGGGTTTTCCCGAGCGGCACGGAGCCGGGAATTTTTTTT
A_38_P00021129	A_38_P00021129	mir|bmo-miR-3203-5p|mir|MIMAT0015379|mir|bmo-miR-3203*_v18.0|mir|MIMAT0015379	bmo-miR-3203-5p	MIMAT0015379	unmapped	CGCTCGGGTTTTCCCGAGCGGCACGTCAAGCTATTTCTTTTTTTTTT
A_38_P00021130	A_38_P00021130	mir|bmo-miR-3203-5p|mir|MIMAT0015379|mir|bmo-miR-3203*_v18.0|mir|MIMAT0015379	bmo-miR-3203-5p	MIMAT0015379	unmapped	CGCTCGGGTTTTCCCGAGCGGCACGTCAAGCTATTTCATATTTTTTTT
A_38_P00021131	A_38_P00021131	mir|bmo-miR-3291|mir|MIMAT0015478	bmo-miR-3291	MIMAT0015478	unmapped	CGCTCGGGTTTTCCCGAGCGGCACTCTCACTATCACGATTTTTTTTT
A_38_P00021132	A_38_P00021132	mir|bmo-miR-3291|mir|MIMAT0015478	bmo-miR-3291	MIMAT0015478	unmapped	CGCTCGGGTTTTCCCGAGCGGCACTCTCACTATCACGTTATTTTTTTT
A_38_P00021133	A_38_P00021133	mir|bmo-miR-3414-5p|mir|MIMAT0015620|mir|bmo-miR-3414_v18.0|mir|MIMAT0015620	bmo-miR-3414-5p	MIMAT0015620	unmapped	CGCTCGGGTTTTCCCGAGCGGCACTGCGTTCAAAAATTTTTTTTTT
A_38_P00021134	A_38_P00021134	mir|bmo-miR-3414-5p|mir|MIMAT0015620|mir|bmo-miR-3414_v18.0|mir|MIMAT0015620	bmo-miR-3414-5p	MIMAT0015620	unmapped	CGCTCGGGTTTTCCCGAGCGGCACTGCGTTCAAAAAATATTTTTTTT
A_38_P00021135	A_38_P00021135	mir|bmo-miR-3414-5p|mir|MIMAT0015620|mir|bmo-miR-3414_v18.0|mir|MIMAT0015620	bmo-miR-3414-5p	MIMAT0015620	unmapped	CGCTCGGGTTTTCCCGAGCGGCACTGCGTTCAAAAAACAATTTTTTTT
A_38_P00021136	A_38_P00021136	mir|bmo-miR-3368|mir|MIMAT0015554	bmo-miR-3368	MIMAT0015554	unmapped	CGCTCGGGTTTTCCCGAGCGGCACTTCTTCTCTAAAAGATATTTTTTTT
A_38_P00021137	A_38_P00021137	mir|bmo-miR-3368|mir|MIMAT0015554	bmo-miR-3368	MIMAT0015554	unmapped	CGCTCGGGTTTTCCCGAGCGGCACTTCTTCTCTAAAAGACATTTTTTTTT
A_38_P00021138	A_38_P00021138	mir|bmo-miR-3333|mir|MIMAT0015520	bmo-miR-3333	MIMAT0015520	unmapped	CGCTCGGGTTTTCCCGAGCGGCACTTTGTCTTGCTTCATTTTTTTTT
A_38_P00021139	A_38_P00021139	mir|bmo-miR-3333|mir|MIMAT0015520	bmo-miR-3333	MIMAT0015520	unmapped	CGCTCGGGTTTTCCCGAGCGGCACTTTGTCTTGCTTCTTTTTTTTTTT
A_38_P00021140	A_38_P00021140	mir|bmo-miR-279c-3p|mir|MIMAT0013611|mir|bmo-miR-279c_v18.0|mir|MIMAT0013611	bmo-miR-279c-3p	MIMAT0013611	unmapped	CGCTCGGGTTTTCCCGAGCGGCAGACGAGTATGGATCATTTTTTTTT
A_38_P00021141	A_38_P00021141	mir|bmo-miR-279c-3p|mir|MIMAT0013611|mir|bmo-miR-279c_v18.0|mir|MIMAT0013611	bmo-miR-279c-3p	MIMAT0013611	unmapped	CGCTCGGGTTTTCCCGAGCGGCAGACGAGTATGGATCTTTTTTTTTTT
A_38_P00021142	A_38_P00021142	mir|bmo-miR-3317|mir|MIMAT0015505	bmo-miR-3317	MIMAT0015505	unmapped	CGCTCGGGTTTTCCCGAGCGGCAGAGCTTATCACAACAAATTTTTTTT
A_38_P00021143	A_38_P00021143	mir|bmo-miR-3317|mir|MIMAT0015505	bmo-miR-3317	MIMAT0015505	unmapped	CGCTCGGGTTTTCCCGAGCGGCAGAGCTTATCACAACATATTTTTTTTT
A_38_P00021144	A_38_P00021144	mir|bmo-miR-316-5p|mir|MIMAT0013597|mir|bmo-miR-316*_v18.0|mir|MIMAT0013597	bmo-miR-316-5p	MIMAT0013597	unmapped	CGCTCGGGTTTTCCCGAGCGGCAGCAGCAAAGCGTTTTTTTTTT
A_38_P00021145	A_38_P00021145	mir|bmo-miR-316-5p|mir|MIMAT0013597|mir|bmo-miR-316*_v18.0|mir|MIMAT0013597	bmo-miR-316-5p	MIMAT0013597	unmapped	CGCTCGGGTTTTCCCGAGCGGCAGCAGCAAAGCGGTTTTTTTTTT
A_38_P00021146	A_38_P00021146	mir|bmo-miR-2827|mir|MIMAT0013738	bmo-miR-2827	MIMAT0013738	unmapped	CGCTCGGGTTTTCCCGAGCGGCAGCGTACGTACTGAATTTTTTTTT
A_38_P00021147	A_38_P00021147	mir|bmo-miR-2827|mir|MIMAT0013738	bmo-miR-2827	MIMAT0013738	unmapped	CGCTCGGGTTTTCCCGAGCGGCAGCGTACGTACTGATTTTTTTTTTT
A_38_P00021148	A_38_P00021148	mir|bmo-miR-9c-5p|mir|MIMAT0015302|mir|bmo-miR-9c*_v18.0|mir|MIMAT0015302	bmo-miR-9c-5p	MIMAT0015302	unmapped	CGCTCGGGTTTTCCCGAGCGGCAGCTAGGATACCAAAGTTTTTTTTTT
A_38_P00021149	A_38_P00021149	mir|bmo-miR-9c-5p|mir|MIMAT0015302|mir|bmo-miR-9c*_v18.0|mir|MIMAT0015302	bmo-miR-9c-5p	MIMAT0015302	unmapped	CGCTCGGGTTTTCCCGAGCGGCAGCTAGGATACCAAAGATTTTTTTTTT
A_38_P00021150	A_38_P00021150	mir|bmo-miR-184-5p|mir|MIMAT0015276|mir|bmo-miR-184*_v18.0|mir|MIMAT0015276	bmo-miR-184-5p	MIMAT0015276	unmapped	CGCTCGGGTTTTCCCGAGCGGCAGGGCCTGAAGAAATTTTTTTTT
A_38_P00021151	A_38_P00021151	mir|bmo-miR-184-5p|mir|MIMAT0015276|mir|bmo-miR-184*_v18.0|mir|MIMAT0015276	bmo-miR-184-5p	MIMAT0015276	unmapped	CGCTCGGGTTTTCCCGAGCGGCAGGGCCTGAAGAATTTTTTTTTTT
A_38_P00021152	A_38_P00021152	mir|bmo-miR-184-5p|mir|MIMAT0015276|mir|bmo-miR-184*_v18.0|mir|MIMAT0015276	bmo-miR-184-5p	MIMAT0015276	unmapped	CGCTCGGGTTTTCCCGAGCGGCAGGGCCTGAAGAATGTTTTTTTTTT
A_38_P00021153	A_38_P00021153	mir|bmo-miR-3248|mir|MIMAT0015430	bmo-miR-3248	MIMAT0015430	unmapped	CGCTCGGGTTTTCCCGAGCGGCAGGTGTACACATTTGTATTTTTTTT
A_38_P00021154	A_38_P00021154	mir|bmo-miR-3248|mir|MIMAT0015430	bmo-miR-3248	MIMAT0015430	unmapped	CGCTCGGGTTTTCCCGAGCGGCAGGTGTACACATTTGAAATTTTTTTT
A_38_P00021155	A_38_P00021155	mir|bmo-miR-2818|mir|MIMAT0013728	bmo-miR-2818	MIMAT0013728	unmapped	CGCTCGGGTTTTCCCGAGCGGCATACAGATATCTTCCCTATTTTTTTTT
A_38_P00021156	A_38_P00021156	mir|bmo-miR-2818|mir|MIMAT0013728	bmo-miR-2818	MIMAT0013728	unmapped	CGCTCGGGTTTTCCCGAGCGGCATACAGATATCTTCCCTTTTTTTTTTTT
A_38_P00021157	A_38_P00021157	mir|bmo-miR-2818|mir|MIMAT0013728	bmo-miR-2818	MIMAT0013728	unmapped	CGCTCGGGTTTTCCCGAGCGGCATACAGATATCTTCCCTTGTTTTTTTTTT
A_38_P00021158	A_38_P00021158	mir|bmo-miR-2a-2-5p|mir|MIMAT0015272|mir|bmo-miR-2a-2*_v18.0|mir|MIMAT0015272	bmo-miR-2a-2-5p	MIMAT0015272	unmapped	CGCTCGGGTTTTCCCGAGCGGCATACGACAACCACTTATTTTTTTTT
A_38_P00021159	A_38_P00021159	mir|bmo-miR-2a-2-5p|mir|MIMAT0015272|mir|bmo-miR-2a-2*_v18.0|mir|MIMAT0015272	bmo-miR-2a-2-5p	MIMAT0015272	unmapped	CGCTCGGGTTTTCCCGAGCGGCATACGACAACCACTTTTATTTTTTTT
A_38_P00021160	A_38_P00021160	mir|bmo-miR-3399|mir|MIMAT0015603	bmo-miR-3399	MIMAT0015603	unmapped	CGCTCGGGTTTTCCCGAGCGGCATAGCCAGGTATTCAAATTTTTTTTT
A_38_P00021161	A_38_P00021161	mir|bmo-miR-3399|mir|MIMAT0015603	bmo-miR-3399	MIMAT0015603	unmapped	CGCTCGGGTTTTCCCGAGCGGCATAGCCAGGTATTCAATTATTTTTTTT
A_38_P00021162	A_38_P00021162	mir|bmo-miR-3399|mir|MIMAT0015603	bmo-miR-3399	MIMAT0015603	unmapped	CGCTCGGGTTTTCCCGAGCGGCATAGCCAGGTATTCAATGATTTTTTTTT
A_38_P00021163	A_38_P00021163	mir|bmo-miR-965-5p|mir|MIMAT0015295|mir|bmo-miR-965_v18.0|mir|MIMAT0015295	bmo-miR-965-5p	MIMAT0015295	unmapped	CGCTCGGGTTTTCCCGAGCGGCATATAGCGCTATAGCTTTATTTTTTTT
A_38_P00021164	A_38_P00021164	mir|bmo-miR-965-5p|mir|MIMAT0015295|mir|bmo-miR-965_v18.0|mir|MIMAT0015295	bmo-miR-965-5p	MIMAT0015295	unmapped	CGCTCGGGTTTTCCCGAGCGGCATATAGCGCTATAGCTTCATTTTTTTTT
A_38_P00021165	A_38_P00021165	mir|bmo-miR-3273|mir|MIMAT0015458	bmo-miR-3273	MIMAT0015458	unmapped	CGCTCGGGTTTTCCCGAGCGGCATATCTAAGATGGGTGGTTTTTTTTTT
A_38_P00021166	A_38_P00021166	mir|bmo-miR-3273|mir|MIMAT0015458	bmo-miR-3273	MIMAT0015458	unmapped	CGCTCGGGTTTTCCCGAGCGGCATATCTAAGATGGGTGGATTTTTTTTTT
A_38_P00021167	A_38_P00021167	mir|bmo-miR-307-5p|mir|MIMAT0015237|mir|bmo-miR-307*_v18.0|mir|MIMAT0015237	bmo-miR-307-5p	MIMAT0015237	unmapped	CGCTCGGGTTTTCCCGAGCGGCATCACACCCAGGTATTTTTTTTT
A_38_P00021168	A_38_P00021168	mir|bmo-miR-307-5p|mir|MIMAT0015237|mir|bmo-miR-307*_v18.0|mir|MIMAT0015237	bmo-miR-307-5p	MIMAT0015237	unmapped	CGCTCGGGTTTTCCCGAGCGGCATCACACCCAGGTTTTTTTTTTTT
A_38_P00021169	A_38_P00021169	mir|bmo-miR-3381-3p|mir|MIMAT0015574|mir|bmo-miR-3381*_v18.0|mir|MIMAT0015574	bmo-miR-3381-3p	MIMAT0015574	unmapped	CGCTCGGGTTTTCCCGAGCGGCATCGGCCAGGTATTTTTTTTTTT
A_38_P00021170	A_38_P00021170	mir|bmo-miR-3381-3p|mir|MIMAT0015574|mir|bmo-miR-3381*_v18.0|mir|MIMAT0015574	bmo-miR-3381-3p	MIMAT0015574	unmapped	CGCTCGGGTTTTCCCGAGCGGCATCGGCCAGGTATGTTTTTTTTTT
A_38_P00021171	A_38_P00021171	mir|bmo-miR-2787-3p|mir|MIMAT0013684|mir|bmo-miR-2787_v18.0|mir|MIMAT0013684	bmo-miR-2787-3p	MIMAT0013684	unmapped	CGCTCGGGTTTTCCCGAGCGGCATGCACATCGTGGTTTTTTTTTT
A_38_P00021172	A_38_P00021172	mir|bmo-miR-2787-3p|mir|MIMAT0013684|mir|bmo-miR-2787_v18.0|mir|MIMAT0013684	bmo-miR-2787-3p	MIMAT0013684	unmapped	CGCTCGGGTTTTCCCGAGCGGCATGCACATCGTGGATTTTTTTTTT
A_38_P00021173	A_38_P00021173	mir|bmo-miR-2806|mir|MIMAT0013715	bmo-miR-2806	MIMAT0013715	unmapped	CGCTCGGGTTTTCCCGAGCGGCATGCAGTATCGGTTATTTTTTTTTT
A_38_P00021174	A_38_P00021174	mir|bmo-miR-2806|mir|MIMAT0013715	bmo-miR-2806	MIMAT0013715	unmapped	CGCTCGGGTTTTCCCGAGCGGCATGCAGTATCGGTTAGTTTTTTTTTT
A_38_P00021175	A_38_P00021175	mir|bmo-miR-3238|mir|MIMAT0015421	bmo-miR-3238	MIMAT0015421	unmapped	CGCTCGGGTTTTCCCGAGCGGCATGTAGTCAATGCATGTATTTTTTTT
A_38_P00021176	A_38_P00021176	mir|bmo-miR-3238|mir|MIMAT0015421	bmo-miR-3238	MIMAT0015421	unmapped	CGCTCGGGTTTTCCCGAGCGGCATGTAGTCAATGCATGAAATTTTTTTT
A_38_P00021177	A_38_P00021177	mir|bmo-miR-2b-5p|mir|MIMAT0015273|mir|bmo-miR-2b*_v18.0|mir|MIMAT0015273	bmo-miR-2b-5p	MIMAT0015273	unmapped	CGCTCGGGTTTTCCCGAGCGGCATGTCACAACCACCAATTTTTTTT
A_38_P00021178	A_38_P00021178	mir|bmo-miR-2b-5p|mir|MIMAT0015273|mir|bmo-miR-2b*_v18.0|mir|MIMAT0015273	bmo-miR-2b-5p	MIMAT0015273	unmapped	CGCTCGGGTTTTCCCGAGCGGCATGTCACAACCACCTATTTTTTTTT
A_38_P00021179	A_38_P00021179	mir|bmo-miR-2837|mir|MIMAT0013751	bmo-miR-2837	MIMAT0013751	unmapped	CGCTCGGGTTTTCCCGAGCGGCATTCCCACGTAGTACTTTTTTTTTT
A_38_P00021180	A_38_P00021180	mir|bmo-miR-2837|mir|MIMAT0013751	bmo-miR-2837	MIMAT0013751	unmapped	CGCTCGGGTTTTCCCGAGCGGCATTCCCACGTAGTACCTATTTTTTTT
A_38_P00021181	A_38_P00021181	mir|bmo-miR-3216|mir|MIMAT0015396	bmo-miR-3216	MIMAT0015396	unmapped	CGCTCGGGTTTTCCCGAGCGGCATTTGACTAATGTTTTGCTATTTTTTTT
A_38_P00021182	A_38_P00021182	mir|bmo-miR-3216|mir|MIMAT0015396	bmo-miR-3216	MIMAT0015396	unmapped	CGCTCGGGTTTTCCCGAGCGGCATTTGACTAATGTTTTGCCATTTTTTTTT
A_38_P00021183	A_38_P00021183	mir|bmo-miR-274-3p|mir|MIMAT0015296|mir|bmo-miR-274*_v18.0|mir|MIMAT0015296	bmo-miR-274-3p	MIMAT0015296	unmapped	CGCTCGGGTTTTCCCGAGCGGCATTTTGCGATCGCTTTTTTTTTT
A_38_P00021184	A_38_P00021184	mir|bmo-miR-274-3p|mir|MIMAT0015296|mir|bmo-miR-274*_v18.0|mir|MIMAT0015296	bmo-miR-274-3p	MIMAT0015296	unmapped	CGCTCGGGTTTTCCCGAGCGGCATTTTGCGATCGCCTTTTTTTTTT
A_38_P00021185	A_38_P00021185	mir|bmo-miR-3245|mir|MIMAT0015427	bmo-miR-3245	MIMAT0015427	unmapped	CGCTCGGGTTTTCCCGAGCGGCCAGGACGTCTCCTTTTTTTTTT
A_38_P00021186	A_38_P00021186	mir|bmo-miR-3245|mir|MIMAT0015427	bmo-miR-3245	MIMAT0015427	unmapped	CGCTCGGGTTTTCCCGAGCGGCCAGGACGTCTCCCTTTTTTTTTT
A_38_P00021187	A_38_P00021187	mir|bmo-miR-3357|mir|MIMAT0015543	bmo-miR-3357	MIMAT0015543	unmapped	CGCTCGGGTTTTCCCGAGCGGCCAGGGAGAGGTAAATTTTTTTTTT
A_38_P00021188	A_38_P00021188	mir|bmo-miR-3357|mir|MIMAT0015543	bmo-miR-3357	MIMAT0015543	unmapped	CGCTCGGGTTTTCCCGAGCGGCCAGGGAGAGGTAAAATTTTTTTTTT
A_38_P00021189	A_38_P00021189	mir|bmo-miR-2764|mir|MIMAT0013639	bmo-miR-2764	MIMAT0013639	unmapped	CGCTCGGGTTTTCCCGAGCGGCCAGTAACTACAATATCTACTTTTTTTTTT
A_38_P00021190	A_38_P00021190	mir|bmo-miR-2764|mir|MIMAT0013639	bmo-miR-2764	MIMAT0013639	unmapped	CGCTCGGGTTTTCCCGAGCGGCCAGTAACTACAATATCTACGTTTTTTTTTT
A_38_P00021191	A_38_P00021191	mir|bmo-miR-3391-5p|mir|MIMAT0015594|mir|bmo-miR-3391*_v18.0|mir|MIMAT0015594	bmo-miR-3391-5p	MIMAT0015594	unmapped	CGCTCGGGTTTTCCCGAGCGGCCATGAAGGTACGAAAATTTTTTTTT
A_38_P00021192	A_38_P00021192	mir|bmo-miR-3391-5p|mir|MIMAT0015594|mir|bmo-miR-3391*_v18.0|mir|MIMAT0015594	bmo-miR-3391-5p	MIMAT0015594	unmapped	CGCTCGGGTTTTCCCGAGCGGCCATGAAGGTACGAAATTTTTTTTTTT
A_38_P00021193	A_38_P00021193	mir|bmo-miR-3282|mir|MIMAT0015468	bmo-miR-3282	MIMAT0015468	unmapped	CGCTCGGGTTTTCCCGAGCGGCCCAAAAAAAACGCAATTTTTTTTT
A_38_P00021194	A_38_P00021194	mir|bmo-miR-3282|mir|MIMAT0015468	bmo-miR-3282	MIMAT0015468	unmapped	CGCTCGGGTTTTCCCGAGCGGCCCAAAAAAAACGCATTTTTTTTTTT
A_38_P00021195	A_38_P00021195	mir|bmo-miR-3282|mir|MIMAT0015468	bmo-miR-3282	MIMAT0015468	unmapped	CGCTCGGGTTTTCCCGAGCGGCCCAAAAAAAACGCATGTTTTTTTTTT
A_38_P00021196	A_38_P00021196	mir|bmo-miR-3354|mir|MIMAT0015540	bmo-miR-3354	MIMAT0015540	unmapped	CGCTCGGGTTTTCCCGAGCGGCCCCTGTAACTGTGTTTTTTTTTT
A_38_P00021197	A_38_P00021197	mir|bmo-miR-3354|mir|MIMAT0015540	bmo-miR-3354	MIMAT0015540	unmapped	CGCTCGGGTTTTCCCGAGCGGCCCCTGTAACTGTGCTATTTTTTTT
A_38_P00021198	A_38_P00021198	mir|bmo-miR-3227|mir|MIMAT0015409	bmo-miR-3227	MIMAT0015409	unmapped	CGCTCGGGTTTTCCCGAGCGGCCGAGCGTCCTGTTTTTTTTTT
A_38_P00021199	A_38_P00021199	mir|bmo-miR-3227|mir|MIMAT0015409	bmo-miR-3227	MIMAT0015409	unmapped	CGCTCGGGTTTTCCCGAGCGGCCGAGCGTCCTGATTTTTTTTTT
A_38_P00021200	A_38_P00021200	mir|bmo-miR-278-5p|mir|MIMAT0015291|mir|bmo-miR-278*_v18.0|mir|MIMAT0015291	bmo-miR-278-5p	MIMAT0015291	unmapped	CGCTCGGGTTTTCCCGAGCGGCCGAGCTGGGAAGAATTTTTTTT
A_38_P00021201	A_38_P00021201	mir|bmo-miR-278-5p|mir|MIMAT0015291|mir|bmo-miR-278*_v18.0|mir|MIMAT0015291	bmo-miR-278-5p	MIMAT0015291	unmapped	CGCTCGGGTTTTCCCGAGCGGCCGAGCTGGGAAGTATTTTTTTTT
A_38_P00021202	A_38_P00021202	mir|bmo-miR-3211|mir|MIMAT0015390	bmo-miR-3211	MIMAT0015390	unmapped	CGCTCGGGTTTTCCCGAGCGGCCGGACTGACCGTATTTTTTTT
A_38_P00021203	A_38_P00021203	mir|bmo-miR-3211|mir|MIMAT0015390	bmo-miR-3211	MIMAT0015390	unmapped	CGCTCGGGTTTTCCCGAGCGGCCGGACTGACCGGATTTTTTTTT
A_38_P00021204	A_38_P00021204	mir|bmo-miR-3253|mir|MIMAT0015436	bmo-miR-3253	MIMAT0015436	unmapped	CGCTCGGGTTTTCCCGAGCGGCCGTACACAGTGAGTATTTTTTTTT
A_38_P00021205	A_38_P00021205	mir|bmo-miR-3253|mir|MIMAT0015436	bmo-miR-3253	MIMAT0015436	unmapped	CGCTCGGGTTTTCCCGAGCGGCCGTACACAGTGAGTTTTTTTTTTTT
A_38_P00021206	A_38_P00021206	mir|bmo-miR-2854|mir|MIMAT0013789	bmo-miR-2854	MIMAT0013789	unmapped	CGCTCGGGTTTTCCCGAGCGGCCGTCCTGCAGTTAATTTTTTTT
A_38_P00021207	A_38_P00021207	mir|bmo-miR-2854|mir|MIMAT0013789	bmo-miR-2854	MIMAT0013789	unmapped	CGCTCGGGTTTTCCCGAGCGGCCGTCCTGCAGTTTATTTTTTTTT
A_38_P00021208	A_38_P00021208	mir|bmo-miR-3345|mir|MIMAT0015532	bmo-miR-3345	MIMAT0015532	unmapped	CGCTCGGGTTTTCCCGAGCGGCCTAAGCGACGCTTTTTTTTTT
A_38_P00021209	A_38_P00021209	mir|bmo-miR-3345|mir|MIMAT0015532	bmo-miR-3345	MIMAT0015532	unmapped	CGCTCGGGTTTTCCCGAGCGGCCTAAGCGACGCGTTTTTTTTTT
A_38_P00021210	A_38_P00021210	mir|bmo-miR-3204a-3p|mir|MIMAT0015382|mir|bmo-miR-3204a*_v18.0|mir|MIMAT0015382	bmo-miR-3204a-3p	MIMAT0015382	unmapped	CGCTCGGGTTTTCCCGAGCGGCCTAAGTCATAAACTCCTTTTTTTTTT
A_38_P00021211	A_38_P00021211	mir|bmo-miR-3204a-3p|mir|MIMAT0015382|mir|bmo-miR-3204a*_v18.0|mir|MIMAT0015382	bmo-miR-3204a-3p	MIMAT0015382	unmapped	CGCTCGGGTTTTCCCGAGCGGCCTAAGTCATAAACTCCCTATTTTTTTT
A_38_P00021212	A_38_P00021212	mir|bmo-miR-2840|mir|MIMAT0013757	bmo-miR-2840	MIMAT0013757	unmapped	CGCTCGGGTTTTCCCGAGCGGCCTCCTCTTCTTCCATATTTTTTTT
A_38_P00021213	A_38_P00021213	mir|bmo-miR-2840|mir|MIMAT0013757	bmo-miR-2840	MIMAT0013757	unmapped	CGCTCGGGTTTTCCCGAGCGGCCTCCTCTTCTTCCAGAATTTTTTTT
A_38_P00021214	A_38_P00021214	mir|bmo-miR-3265|mir|MIMAT0015449	bmo-miR-3265	MIMAT0015449	unmapped	CGCTCGGGTTTTCCCGAGCGGCCTTAAGACACGAGCATTTTTTTTT
A_38_P00021215	A_38_P00021215	mir|bmo-miR-3265|mir|MIMAT0015449	bmo-miR-3265	MIMAT0015449	unmapped	CGCTCGGGTTTTCCCGAGCGGCCTTAAGACACGAGCTTATTTTTTTT
A_38_P00021216	A_38_P00021216	mir|bmo-miR-993b-5p|mir|MIMAT0015297|mir|bmo-miR-993b*_v18.0|mir|MIMAT0015297	bmo-miR-993b-5p	MIMAT0015297	unmapped	CGCTCGGGTTTTCCCGAGCGGCGAAAGCCCGGAATTTTTTTTT
A_38_P00021217	A_38_P00021217	mir|bmo-miR-993b-5p|mir|MIMAT0015297|mir|bmo-miR-993b*_v18.0|mir|MIMAT0015297	bmo-miR-993b-5p	MIMAT0015297	unmapped	CGCTCGGGTTTTCCCGAGCGGCGAAAGCCCGGATTATTTTTTTT
A_38_P00021218	A_38_P00021218	mir|bmo-miR-993b-5p|mir|MIMAT0015297|mir|bmo-miR-993b*_v18.0|mir|MIMAT0015297	bmo-miR-993b-5p	MIMAT0015297	unmapped	CGCTCGGGTTTTCCCGAGCGGCGAAAGCCCGGATCATTTTTTTTT
A_38_P00021219	A_38_P00021219	mir|bmo-miR-375-3p|mir|MIMAT0013649|mir|bmo-miR-375*_v18.0|mir|MIMAT0013649	bmo-miR-375-3p	MIMAT0013649	unmapped	CGCTCGGGTTTTCCCGAGCGGCGACACGAGCCGTTTTTTTTTT
A_38_P00021220	A_38_P00021220	mir|bmo-miR-375-3p|mir|MIMAT0013649|mir|bmo-miR-375*_v18.0|mir|MIMAT0013649	bmo-miR-375-3p	MIMAT0013649	unmapped	CGCTCGGGTTTTCCCGAGCGGCGACACGAGCCGGTTTTTTTTTT
A_38_P00021221	A_38_P00021221	mir|bmo-miR-3389-3p|mir|MIMAT0015590|mir|bmo-miR-3389*_v18.0|mir|MIMAT0015590	bmo-miR-3389-3p	MIMAT0015590	unmapped	CGCTCGGGTTTTCCCGAGCGGCGAGCGCGGTGAATTTTTTTT
A_38_P00021222	A_38_P00021222	mir|bmo-miR-3389-3p|mir|MIMAT0015590|mir|bmo-miR-3389*_v18.0|mir|MIMAT0015590	bmo-miR-3389-3p	MIMAT0015590	unmapped	CGCTCGGGTTTTCCCGAGCGGCGAGCGCGGTGTATTTTTTTTT
A_38_P00021223	A_38_P00021223	mir|bmo-miR-2798|mir|MIMAT0013702	bmo-miR-2798	MIMAT0013702	unmapped	CGCTCGGGTTTTCCCGAGCGGCGAGCGCTATCTCTTATTTTTTTT
A_38_P00021224	A_38_P00021224	mir|bmo-miR-2798|mir|MIMAT0013702	bmo-miR-2798	MIMAT0013702	unmapped	CGCTCGGGTTTTCCCGAGCGGCGAGCGCTATCTCTGATTTTTTTTT
A_38_P00021225	A_38_P00021225	mir|bmo-miR-3310|mir|MIMAT0015499	bmo-miR-3310	MIMAT0015499	unmapped	CGCTCGGGTTTTCCCGAGCGGCGAGGGGCTGGTAATTTTTTTT
A_38_P00021226	A_38_P00021226	mir|bmo-miR-3310|mir|MIMAT0015499	bmo-miR-3310	MIMAT0015499	unmapped	CGCTCGGGTTTTCCCGAGCGGCGAGGGGCTGGTTATTTTTTTTT
A_38_P00021227	A_38_P00021227	mir|bmo-miR-3361|mir|MIMAT0015547	bmo-miR-3361	MIMAT0015547	unmapped	CGCTCGGGTTTTCCCGAGCGGCGAGTTTGACACGCTTTTTTTTTT
A_38_P00021228	A_38_P00021228	mir|bmo-miR-3361|mir|MIMAT0015547	bmo-miR-3361	MIMAT0015547	unmapped	CGCTCGGGTTTTCCCGAGCGGCGAGTTTGACACGCATTTTTTTTTT
A_38_P00021229	A_38_P00021229	mir|bmo-miR-2808a-5p|mir|MIMAT0013711|mir|bmo-miR-2808a_v18.0|mir|MIMAT0013711	bmo-miR-2808a-5p	MIMAT0013711	unmapped	CGCTCGGGTTTTCCCGAGCGGCGATCCGATGGTAGAAATTTTTTTT
A_38_P00021230	A_38_P00021230	mir|bmo-miR-2808a-5p|mir|MIMAT0013711|mir|bmo-miR-2808a_v18.0|mir|MIMAT0013711	bmo-miR-2808a-5p	MIMAT0013711	unmapped	CGCTCGGGTTTTCCCGAGCGGCGATCCGATGGTAGATATTTTTTTTT
A_38_P00021231	A_38_P00021231	mir|bmo-miR-2846|mir|MIMAT0013767	bmo-miR-2846	MIMAT0013767	unmapped	CGCTCGGGTTTTCCCGAGCGGCGCACTACGCCATATTTTTTTTT
A_38_P00021232	A_38_P00021232	mir|bmo-miR-2846|mir|MIMAT0013767	bmo-miR-2846	MIMAT0013767	unmapped	CGCTCGGGTTTTCCCGAGCGGCGCACTACGCCATTTTTTTTTTTT
A_38_P00021233	A_38_P00021233	mir|bmo-miR-2783|mir|MIMAT0013679	bmo-miR-2783	MIMAT0013679	unmapped	CGCTCGGGTTTTCCCGAGCGGCGCCACACCCACTTTTTTTTTT
A_38_P00021234	A_38_P00021234	mir|bmo-miR-2783|mir|MIMAT0013679	bmo-miR-2783	MIMAT0013679	unmapped	CGCTCGGGTTTTCCCGAGCGGCGCCACACCCACATTTTTTTTTT
A_38_P00021235	A_38_P00021235	mir|bmo-miR-2766-5p|mir|MIMAT0013641|mir|bmo-miR-2766*_v18.0|mir|MIMAT0013641	bmo-miR-2766-5p	MIMAT0013641	unmapped	CGCTCGGGTTTTCCCGAGCGGCGCCAGTCAAGACTTTTTTTTTT
A_38_P00021236	A_38_P00021236	mir|bmo-miR-2766-5p|mir|MIMAT0013641|mir|bmo-miR-2766*_v18.0|mir|MIMAT0013641	bmo-miR-2766-5p	MIMAT0013641	unmapped	CGCTCGGGTTTTCCCGAGCGGCGCCAGTCAAGACGTTTTTTTTTT
A_38_P00021237	A_38_P00021237	mir|bmo-miR-2756-5p|mir|MIMAT0013623|mir|bmo-miR-2756_v18.0|mir|MIMAT0013623	bmo-miR-2756-5p	MIMAT0013623	unmapped	CGCTCGGGTTTTCCCGAGCGGCGCCCCTTGGCTTTTTTTTTT
A_38_P00021238	A_38_P00021238	mir|bmo-miR-2756-5p|mir|MIMAT0013623|mir|bmo-miR-2756_v18.0|mir|MIMAT0013623	bmo-miR-2756-5p	MIMAT0013623	unmapped	CGCTCGGGTTTTCCCGAGCGGCGCCCCTTGGCATTTTTTTTTT
A_38_P00021239	A_38_P00021239	mir|bmo-miR-3215|mir|MIMAT0015395	bmo-miR-3215	MIMAT0015395	unmapped	CGCTCGGGTTTTCCCGAGCGGCGCGGCGACAGTTTTTTTTTT
A_38_P00021240	A_38_P00021240	mir|bmo-miR-3215|mir|MIMAT0015395	bmo-miR-3215	MIMAT0015395	unmapped	CGCTCGGGTTTTCCCGAGCGGCGCGGCGACAGCTTTTTTTTTT
A_38_P00021241	A_38_P00021241	mir|bmo-miR-3408|mir|MIMAT0015614	bmo-miR-3408	MIMAT0015614	unmapped	CGCTCGGGTTTTCCCGAGCGGCGCTACTCACACCTTTTTTTTTT
A_38_P00021242	A_38_P00021242	mir|bmo-miR-3408|mir|MIMAT0015614	bmo-miR-3408	MIMAT0015614	unmapped	CGCTCGGGTTTTCCCGAGCGGCGCTACTCACACCGTTTTTTTTTT
A_38_P00021243	A_38_P00021243	mir|bmo-miR-3218|mir|MIMAT0015398	bmo-miR-3218	MIMAT0015398	unmapped	CGCTCGGGTTTTCCCGAGCGGCGCTGCTCACTCTTATTTTTTTT
A_38_P00021244	A_38_P00021244	mir|bmo-miR-3218|mir|MIMAT0015398	bmo-miR-3218	MIMAT0015398	unmapped	CGCTCGGGTTTTCCCGAGCGGCGCTGCTCACTCTGATTTTTTTTT
A_38_P00021245	A_38_P00021245	mir|bmo-miR-9b-3p|mir|MIMAT0015290|mir|bmo-miR-9b*_v18.0|mir|MIMAT0015290	bmo-miR-9b-3p	MIMAT0015290	unmapped	CGCTCGGGTTTTCCCGAGCGGCGCTTTGGCGATTTTTTTTTTTTT
A_38_P00021246	A_38_P00021246	mir|bmo-miR-9b-3p|mir|MIMAT0015290|mir|bmo-miR-9b*_v18.0|mir|MIMAT0015290	bmo-miR-9b-3p	MIMAT0015290	unmapped	CGCTCGGGTTTTCCCGAGCGGCGCTTTGGCGATTTATTTTTTTTTT
A_38_P00021247	A_38_P00021247	mir|bmo-miR-9b-3p|mir|MIMAT0015290|mir|bmo-miR-9b*_v18.0|mir|MIMAT0015290	bmo-miR-9b-3p	MIMAT0015290	unmapped	CGCTCGGGTTTTCCCGAGCGGCGCTTTGGCGATTTAGTATTTTTTTT
A_38_P00021248	A_38_P00021248	mir|bmo-miR-3356|mir|MIMAT0015542	bmo-miR-3356	MIMAT0015542	unmapped	CGCTCGGGTTTTCCCGAGCGGCGGAACCCACCGTATTTTTTTT
A_38_P00021249	A_38_P00021249	mir|bmo-miR-3356|mir|MIMAT0015542	bmo-miR-3356	MIMAT0015542	unmapped	CGCTCGGGTTTTCCCGAGCGGCGGAACCCACCGGATTTTTTTTT
A_38_P00021250	A_38_P00021250	mir|bmo-miR-3316|mir|MIMAT0015504	bmo-miR-3316	MIMAT0015504	unmapped	CGCTCGGGTTTTCCCGAGCGGCGGAGTCGAAGAAATTTTTTTTTT
A_38_P00021251	A_38_P00021251	mir|bmo-miR-3316|mir|MIMAT0015504	bmo-miR-3316	MIMAT0015504	unmapped	CGCTCGGGTTTTCCCGAGCGGCGGAGTCGAAGAAACTTTTTTTTTT
A_38_P00021254	A_38_P00021254	mir|bmo-miR-282-3p|mir|MIMAT0015234|mir|bmo-miR-282*_v18.0|mir|MIMAT0015234	bmo-miR-282-3p	MIMAT0015234	unmapped	CGCTCGGGTTTTCCCGAGCGGCGTAACCTCTATCAGGTATTTTTTTT
A_38_P00021255	A_38_P00021255	mir|bmo-miR-282-3p|mir|MIMAT0015234|mir|bmo-miR-282*_v18.0|mir|MIMAT0015234	bmo-miR-282-3p	MIMAT0015234	unmapped	CGCTCGGGTTTTCCCGAGCGGCGTAACCTCTATCAGGCATTTTTTTTT
A_38_P00021256	A_38_P00021256	mir|bmo-miR-2808a-3p|mir|MIMAT0013712|mir|bmo-miR-2808a*_v18.0|mir|MIMAT0013712	bmo-miR-2808a-3p	MIMAT0013712	unmapped	CGCTCGGGTTTTCCCGAGCGGCGTACTTCGCAGAATTATTTTTTTT
A_38_P00021257	A_38_P00021257	mir|bmo-miR-2808a-3p|mir|MIMAT0013712|mir|bmo-miR-2808a*_v18.0|mir|MIMAT0013712	bmo-miR-2808a-3p	MIMAT0013712	unmapped	CGCTCGGGTTTTCCCGAGCGGCGTACTTCGCAGAATCATTTTTTTTT
A_38_P00021258	A_38_P00021258	mir|bmo-miR-2807c-3p|mir|MIMAT0013622|mir|bmo-miR-2807c*_v18.0|mir|MIMAT0013622	bmo-miR-2807c-3p	MIMAT0013622	unmapped	CGCTCGGGTTTTCCCGAGCGGCGTCAACAATGCGATTTTTTTTTT
A_38_P00021259	A_38_P00021259	mir|bmo-miR-2807c-3p|mir|MIMAT0013622|mir|bmo-miR-2807c*_v18.0|mir|MIMAT0013622	bmo-miR-2807c-3p	MIMAT0013622	unmapped	CGCTCGGGTTTTCCCGAGCGGCGTCAACAATGCGAATATTTTTTTT
A_38_P00021260	A_38_P00021260	mir|bmo-miR-3203-3p|mir|MIMAT0015380|mir|bmo-miR-3203_v18.0|mir|MIMAT0015380	bmo-miR-3203-3p	MIMAT0015380	unmapped	CGCTCGGGTTTTCCCGAGCGGCGTGTACTGACTGAGTATTTTTTTT
A_38_P00021261	A_38_P00021261	mir|bmo-miR-3203-3p|mir|MIMAT0015380|mir|bmo-miR-3203_v18.0|mir|MIMAT0015380	bmo-miR-3203-3p	MIMAT0015380	unmapped	CGCTCGGGTTTTCCCGAGCGGCGTGTACTGACTGAGCATTTTTTTTT
A_38_P00021262	A_38_P00021262	mir|bmo-miR-3378-3p|mir|MIMAT0015570|mir|bmo-miR-3378*_v18.0|mir|MIMAT0015570	bmo-miR-3378-3p	MIMAT0015570	unmapped	CGCTCGGGTTTTCCCGAGCGGCGTGTCCAGACAATTTTTTTTTTTT
A_38_P00021263	A_38_P00021263	mir|bmo-miR-3378-3p|mir|MIMAT0015570|mir|bmo-miR-3378*_v18.0|mir|MIMAT0015570	bmo-miR-3378-3p	MIMAT0015570	unmapped	CGCTCGGGTTTTCCCGAGCGGCGTGTCCAGACAATTGTTTTTTTTTT
A_38_P00021264	A_38_P00021264	mir|bmo-miR-745-3p|mir|MIMAT0013626|mir|bmo-miR-745_v18.0|mir|MIMAT0013626	bmo-miR-745-3p	MIMAT0013626	unmapped	CGCTCGGGTTTTCCCGAGCGGCGTTGCCCTTCGTATTTTTTTT
A_38_P00021265	A_38_P00021265	mir|bmo-miR-745-3p|mir|MIMAT0013626|mir|bmo-miR-745_v18.0|mir|MIMAT0013626	bmo-miR-745-3p	MIMAT0013626	unmapped	CGCTCGGGTTTTCCCGAGCGGCGTTGCCCTTCGCATTTTTTTTT
A_38_P00021266	A_38_P00021266	mir|bmo-miR-2770-3p|mir|MIMAT0013652|mir|bmo-miR-2770*_v18.0|mir|MIMAT0013652	bmo-miR-2770-3p	MIMAT0013652	unmapped	CGCTCGGGTTTTCCCGAGCGGCTAACAGTACACGGGTTTTTTTTTT
A_38_P00021267	A_38_P00021267	mir|bmo-miR-2770-3p|mir|MIMAT0013652|mir|bmo-miR-2770*_v18.0|mir|MIMAT0013652	bmo-miR-2770-3p	MIMAT0013652	unmapped	CGCTCGGGTTTTCCCGAGCGGCTAACAGTACACGGGGTATTTTTTTT
A_38_P00021268	A_38_P00021268	mir|bmo-miR-3400|mir|MIMAT0015604	bmo-miR-3400	MIMAT0015604	unmapped	CGCTCGGGTTTTCCCGAGCGGCTAAGAAAATGACTTGCATTTTTTTTTT
A_38_P00021269	A_38_P00021269	mir|bmo-miR-3400|mir|MIMAT0015604	bmo-miR-3400	MIMAT0015604	unmapped	CGCTCGGGTTTTCCCGAGCGGCTAAGAAAATGACTTGCAATTTTTTTTTT
A_38_P00021270	A_38_P00021270	mir|bmo-miR-2777-3p|mir|MIMAT0013663|mir|bmo-miR-2777*_v18.0|mir|MIMAT0013663	bmo-miR-2777-3p	MIMAT0013663	unmapped	CGCTCGGGTTTTCCCGAGCGGCTAAGCACCTCCCCATTTTTTTTT
A_38_P00021271	A_38_P00021271	mir|bmo-miR-2777-3p|mir|MIMAT0013663|mir|bmo-miR-2777*_v18.0|mir|MIMAT0013663	bmo-miR-2777-3p	MIMAT0013663	unmapped	CGCTCGGGTTTTCCCGAGCGGCTAAGCACCTCCCCTTTTTTTTTTT
A_38_P00021272	A_38_P00021272	mir|bmo-miR-263b-3p|mir|MIMAT0015229|mir|bmo-miR-263b*_v18.0|mir|MIMAT0015229	bmo-miR-263b-3p	MIMAT0015229	unmapped	CGCTCGGGTTTTCCCGAGCGGCTAAGGCATCGGGATTTTTTTTTT
A_38_P00021273	A_38_P00021273	mir|bmo-miR-263b-3p|mir|MIMAT0015229|mir|bmo-miR-263b*_v18.0|mir|MIMAT0015229	bmo-miR-263b-3p	MIMAT0015229	unmapped	CGCTCGGGTTTTCCCGAGCGGCTAAGGCATCGGGAATATTTTTTTT
A_38_P00021274	A_38_P00021274	mir|bmo-miR-2780d|mir|MIMAT0013765	bmo-miR-2780d	MIMAT0013765	unmapped	CGCTCGGGTTTTCCCGAGCGGCTAAGTCTTCATTTAACACTATTTTTTTT
A_38_P00021275	A_38_P00021275	mir|bmo-miR-2780d|mir|MIMAT0013765	bmo-miR-2780d	MIMAT0013765	unmapped	CGCTCGGGTTTTCCCGAGCGGCTAAGTCTTCATTTAACACCAATTTTTTTT
A_38_P00021276	A_38_P00021276	mir|bmo-miR-2780c|mir|MIMAT0013760	bmo-miR-2780c	MIMAT0013760	unmapped	CGCTCGGGTTTTCCCGAGCGGCTAAGTCTTCATTTAACGTTTTTTTTTT
A_38_P00021277	A_38_P00021277	mir|bmo-miR-2780c|mir|MIMAT0013760	bmo-miR-2780c	MIMAT0013760	unmapped	CGCTCGGGTTTTCCCGAGCGGCTAAGTCTTCATTTAACGCTTTTTTTTTT
A_38_P00021278	A_38_P00021278	mir|bmo-miR-3322|mir|MIMAT0015509	bmo-miR-3322	MIMAT0015509	unmapped	CGCTCGGGTTTTCCCGAGCGGCTAGCCAACTTCAAACTTTTTTTTTT
A_38_P00021279	A_38_P00021279	mir|bmo-miR-3322|mir|MIMAT0015509	bmo-miR-3322	MIMAT0015509	unmapped	CGCTCGGGTTTTCCCGAGCGGCTAGCCAACTTCAAACCTTTTTTTTTT
A_38_P00021280	A_38_P00021280	mir|bmo-miR-3305|mir|MIMAT0015493	bmo-miR-3305	MIMAT0015493	unmapped	CGCTCGGGTTTTCCCGAGCGGCTAGTGACGTAATAACCAATTTTTTTTT
A_38_P00021281	A_38_P00021281	mir|bmo-miR-3305|mir|MIMAT0015493	bmo-miR-3305	MIMAT0015493	unmapped	CGCTCGGGTTTTCCCGAGCGGCTAGTGACGTAATAACCATTATTTTTTTT
A_38_P00021282	A_38_P00021282	mir|bmo-miR-2754|mir|MIMAT0013614	bmo-miR-2754	MIMAT0013614	unmapped	CGCTCGGGTTTTCCCGAGCGGCTATTACAGTCAATACCAGTTTTTTTTTT
A_38_P00021283	A_38_P00021283	mir|bmo-miR-2754|mir|MIMAT0013614	bmo-miR-2754	MIMAT0013614	unmapped	CGCTCGGGTTTTCCCGAGCGGCTATTACAGTCAATACCAGATTTTTTTTTT
A_38_P00021284	A_38_P00021284	mir|bmo-miR-3386-3p|mir|MIMAT0015584|mir|bmo-miR-3386*_v18.0|mir|MIMAT0015584	bmo-miR-3386-3p	MIMAT0015584	unmapped	CGCTCGGGTTTTCCCGAGCGGCTCAGCTTAATAAATGGTAATTTTTTTTT
A_38_P00021285	A_38_P00021285	mir|bmo-miR-3386-3p|mir|MIMAT0015584|mir|bmo-miR-3386*_v18.0|mir|MIMAT0015584	bmo-miR-3386-3p	MIMAT0015584	unmapped	CGCTCGGGTTTTCCCGAGCGGCTCAGCTTAATAAATGGTATTATTTTTTTT
A_38_P00021286	A_38_P00021286	mir|bmo-miR-3386-3p|mir|MIMAT0015584|mir|bmo-miR-3386*_v18.0|mir|MIMAT0015584	bmo-miR-3386-3p	MIMAT0015584	unmapped	CGCTCGGGTTTTCCCGAGCGGCTCAGCTTAATAAATGGTATAAATTTTTTTT
A_38_P00021287	A_38_P00021287	mir|bmo-miR-3386-3p|mir|MIMAT0015584|mir|bmo-miR-3386*_v18.0|mir|MIMAT0015584	bmo-miR-3386-3p	MIMAT0015584	unmapped	CGCTCGGGTTTTCCCGAGCGGCTCAGCTTAATAAATGGTATATATTTTTTTTT
A_38_P00021288	A_38_P00021288	mir|bmo-miR-3422|mir|MIMAT0015630	bmo-miR-3422	MIMAT0015630	unmapped	CGCTCGGGTTTTCCCGAGCGGCTCAGTCCTTCACAGATTTTTTTTT
A_38_P00021289	A_38_P00021289	mir|bmo-miR-3422|mir|MIMAT0015630	bmo-miR-3422	MIMAT0015630	unmapped	CGCTCGGGTTTTCCCGAGCGGCTCAGTCCTTCACAGTTTTTTTTTTT
A_38_P00021290	A_38_P00021290	mir|bmo-miR-2799|mir|MIMAT0013703	bmo-miR-2799	MIMAT0013703	unmapped	CGCTCGGGTTTTCCCGAGCGGCTCATCATGTTCATAAACTATTTTTTTT
A_38_P00021291	A_38_P00021291	mir|bmo-miR-2799|mir|MIMAT0013703	bmo-miR-2799	MIMAT0013703	unmapped	CGCTCGGGTTTTCCCGAGCGGCTCATCATGTTCATAAACCATTTTTTTTT
A_38_P00021292	A_38_P00021292	mir|bmo-miR-3297-5p|mir|MIMAT0015485|mir|bmo-miR-3297_v18.0|mir|MIMAT0015485	bmo-miR-3297-5p	MIMAT0015485	unmapped	CGCTCGGGTTTTCCCGAGCGGCTCCAATATTTTTGACTAGAATTTTTTTTT
A_38_P00021293	A_38_P00021293	mir|bmo-miR-3297-5p|mir|MIMAT0015485|mir|bmo-miR-3297_v18.0|mir|MIMAT0015485	bmo-miR-3297-5p	MIMAT0015485	unmapped	CGCTCGGGTTTTCCCGAGCGGCTCCAATATTTTTGACTAGATTATTTTTTTT
A_38_P00021294	A_38_P00021294	mir|bmo-miR-2781|mir|MIMAT0013672	bmo-miR-2781	MIMAT0013672	unmapped	CGCTCGGGTTTTCCCGAGCGGCTCCTTCAATCTAACATCATTTTTTTTT
A_38_P00021295	A_38_P00021295	mir|bmo-miR-2781|mir|MIMAT0013672	bmo-miR-2781	MIMAT0013672	unmapped	CGCTCGGGTTTTCCCGAGCGGCTCCTTCAATCTAACATCTTTTTTTTTTT
A_38_P00021296	A_38_P00021296	mir|bmo-miR-308-3p|mir|MIMAT0013605|mir|bmo-miR-308_v18.0|mir|MIMAT0013605	bmo-miR-308-3p	MIMAT0013605	unmapped	CGCTCGGGTTTTCCCGAGCGGCTCGCAGTATTATCCTGATTTTTTTTT
A_38_P00021297	A_38_P00021297	mir|bmo-miR-308-3p|mir|MIMAT0013605|mir|bmo-miR-308_v18.0|mir|MIMAT0013605	bmo-miR-308-3p	MIMAT0013605	unmapped	CGCTCGGGTTTTCCCGAGCGGCTCGCAGTATTATCCTGTTTTTTTTTTT
A_38_P00021298	A_38_P00021298	mir|bmo-miR-3344|mir|MIMAT0015531	bmo-miR-3344	MIMAT0015531	unmapped	CGCTCGGGTTTTCCCGAGCGGCTCGCTGGCTGAGATTTTTTTTT
A_38_P00021299	A_38_P00021299	mir|bmo-miR-3344|mir|MIMAT0015531	bmo-miR-3344	MIMAT0015531	unmapped	CGCTCGGGTTTTCCCGAGCGGCTCGCTGGCTGAGTTTTTTTTTTT
A_38_P00021300	A_38_P00021300	mir|bmo-miR-3336|mir|MIMAT0015523	bmo-miR-3336	MIMAT0015523	unmapped	CGCTCGGGTTTTCCCGAGCGGCTCGGCGATCACTTTTTTTTTT
A_38_P00021301	A_38_P00021301	mir|bmo-miR-3336|mir|MIMAT0015523	bmo-miR-3336	MIMAT0015523	unmapped	CGCTCGGGTTTTCCCGAGCGGCTCGGCGATCACGTTTTTTTTTT
A_38_P00021302	A_38_P00021302	mir|bmo-miR-2817|mir|MIMAT0013727	bmo-miR-2817	MIMAT0013727	unmapped	CGCTCGGGTTTTCCCGAGCGGCTCGGTCTACGCAGATTTTTTTTT
A_38_P00021303	A_38_P00021303	mir|bmo-miR-2817|mir|MIMAT0013727	bmo-miR-2817	MIMAT0013727	unmapped	CGCTCGGGTTTTCCCGAGCGGCTCGGTCTACGCAGTTATTTTTTTT
A_38_P00021304	A_38_P00021304	mir|bmo-miR-3385-3p|mir|MIMAT0015582|mir|bmo-miR-3385_v18.0|mir|MIMAT0015582	bmo-miR-3385-3p	MIMAT0015582	unmapped	CGCTCGGGTTTTCCCGAGCGGCTCTACCATACACCAAATTTTTTTTTT
A_38_P00021305	A_38_P00021305	mir|bmo-miR-3385-3p|mir|MIMAT0015582|mir|bmo-miR-3385_v18.0|mir|MIMAT0015582	bmo-miR-3385-3p	MIMAT0015582	unmapped	CGCTCGGGTTTTCCCGAGCGGCTCTACCATACACCAAAATTTTTTTTTT
A_38_P00021306	A_38_P00021306	mir|bmo-miR-3413|mir|MIMAT0015619	bmo-miR-3413	MIMAT0015619	unmapped	CGCTCGGGTTTTCCCGAGCGGCTCTCTCGGGCGTTTTTTTTTT
A_38_P00021307	A_38_P00021307	mir|bmo-miR-3413|mir|MIMAT0015619	bmo-miR-3413	MIMAT0015619	unmapped	CGCTCGGGTTTTCCCGAGCGGCTCTCTCGGGCGCTTTTTTTTTT
A_38_P00021308	A_38_P00021308	mir|bmo-miR-3254|mir|MIMAT0015437	bmo-miR-3254	MIMAT0015437	unmapped	CGCTCGGGTTTTCCCGAGCGGCTCTTCTTTAAGTTCGTCTTTTTTTTTT
A_38_P00021309	A_38_P00021309	mir|bmo-miR-3254|mir|MIMAT0015437	bmo-miR-3254	MIMAT0015437	unmapped	CGCTCGGGTTTTCCCGAGCGGCTCTTCTTTAAGTTCGTCCTTTTTTTTTT
A_38_P00021310	A_38_P00021310	mir|bmo-miR-3418|mir|MIMAT0015625	bmo-miR-3418	MIMAT0015625	unmapped	CGCTCGGGTTTTCCCGAGCGGCTGACCAGAAAGATTCTTTTTTTTTTT
A_38_P00021311	A_38_P00021311	mir|bmo-miR-3418|mir|MIMAT0015625	bmo-miR-3418	MIMAT0015625	unmapped	CGCTCGGGTTTTCCCGAGCGGCTGACCAGAAAGATTCTATTTTTTTTTT
A_38_P00021312	A_38_P00021312	mir|bmo-miR-3418|mir|MIMAT0015625	bmo-miR-3418	MIMAT0015625	unmapped	CGCTCGGGTTTTCCCGAGCGGCTGACCAGAAAGATTCTAATTTTTTTTTT
A_38_P00021313	A_38_P00021313	mir|bmo-miR-306a-3p|mir|MIMAT0015303|mir|bmo-miR-306**_v16.0|mir|MIMAT0015303|mir|bmo-miR-306a*_v18.0|mir|MIMAT0015303	bmo-miR-306a-3p	MIMAT0015303	unmapped	CGCTCGGGTTTTCCCGAGCGGCTGAGGCACGAGGTTTTTTTTTT
A_38_P00021314	A_38_P00021314	mir|bmo-miR-306a-3p|mir|MIMAT0015303|mir|bmo-miR-306**_v16.0|mir|MIMAT0015303|mir|bmo-miR-306a*_v18.0|mir|MIMAT0015303	bmo-miR-306a-3p	MIMAT0015303	unmapped	CGCTCGGGTTTTCCCGAGCGGCTGAGGCACGAGGCTTTTTTTTTT
A_38_P00021315	A_38_P00021315	mir|bmo-miR-2849|mir|MIMAT0013769	bmo-miR-2849	MIMAT0013769	unmapped	CGCTCGGGTTTTCCCGAGCGGCTGAGTCCATAATCGTATTTTTTTTTT
A_38_P00021316	A_38_P00021316	mir|bmo-miR-2849|mir|MIMAT0013769	bmo-miR-2849	MIMAT0013769	unmapped	CGCTCGGGTTTTCCCGAGCGGCTGAGTCCATAATCGTAATTTTTTTTTT
A_38_P00021317	A_38_P00021317	mir|bmo-miR-2849|mir|MIMAT0013769	bmo-miR-2849	MIMAT0013769	unmapped	CGCTCGGGTTTTCCCGAGCGGCTGAGTCCATAATCGTAAATATTTTTTTT
A_38_P00021318	A_38_P00021318	mir|bmo-miR-3389-5p|mir|MIMAT0015589|mir|bmo-miR-3389_v18.0|mir|MIMAT0015589	bmo-miR-3389-5p	MIMAT0015589	unmapped	CGCTCGGGTTTTCCCGAGCGGCTGCTGTGGAACATCTTTTTTTTTT
A_38_P00021319	A_38_P00021319	mir|bmo-miR-3389-5p|mir|MIMAT0015589|mir|bmo-miR-3389_v18.0|mir|MIMAT0015589	bmo-miR-3389-5p	MIMAT0015589	unmapped	CGCTCGGGTTTTCCCGAGCGGCTGCTGTGGAACATCGTTTTTTTTTT
A_38_P00021320	A_38_P00021320	mir|bmo-miR-3304a|mir|MIMAT0015492	bmo-miR-3304a	MIMAT0015492	unmapped	CGCTCGGGTTTTCCCGAGCGGCTGTAAATATTCCAAGCTTATTTTTTTT
A_38_P00021321	A_38_P00021321	mir|bmo-miR-3304a|mir|MIMAT0015492	bmo-miR-3304a	MIMAT0015492	unmapped	CGCTCGGGTTTTCCCGAGCGGCTGTAAATATTCCAAGCTGAATTTTTTTT
A_38_P00021322	A_38_P00021322	mir|bmo-miR-3250|mir|MIMAT0015432	bmo-miR-3250	MIMAT0015432	unmapped	CGCTCGGGTTTTCCCGAGCGGCTGTACTGTACTGTGCATTTTTTTTT
A_38_P00021323	A_38_P00021323	mir|bmo-miR-3250|mir|MIMAT0015432	bmo-miR-3250	MIMAT0015432	unmapped	CGCTCGGGTTTTCCCGAGCGGCTGTACTGTACTGTGCTTTTTTTTTTT
A_38_P00021324	A_38_P00021324	mir|bmo-miR-283-3p|mir|MIMAT0015235|mir|bmo-miR-283*_v18.0|mir|MIMAT0015235	bmo-miR-283-3p	MIMAT0015235	unmapped	CGCTCGGGTTTTCCCGAGCGGCTGTATACCAGCTGATAGTTTTTTTTTT
A_38_P00021325	A_38_P00021325	mir|bmo-miR-283-3p|mir|MIMAT0015235|mir|bmo-miR-283*_v18.0|mir|MIMAT0015235	bmo-miR-283-3p	MIMAT0015235	unmapped	CGCTCGGGTTTTCCCGAGCGGCTGTATACCAGCTGATAGCTATTTTTTTT
A_38_P00021326	A_38_P00021326	mir|bmo-miR-3334|mir|MIMAT0015521	bmo-miR-3334	MIMAT0015521	unmapped	CGCTCGGGTTTTCCCGAGCGGCTGTCCTTCCATCATTTATTTTTTTT
A_38_P00021327	A_38_P00021327	mir|bmo-miR-3334|mir|MIMAT0015521	bmo-miR-3334	MIMAT0015521	unmapped	CGCTCGGGTTTTCCCGAGCGGCTGTCCTTCCATCATTCATTTTTTTTT
A_38_P00021328	A_38_P00021328	mir|bmo-miR-3205|mir|MIMAT0015383	bmo-miR-3205	MIMAT0015383	unmapped	CGCTCGGGTTTTCCCGAGCGGCTGTTAGACTGCTCGTTTTTTTTTT
A_38_P00021329	A_38_P00021329	mir|bmo-miR-3205|mir|MIMAT0015383	bmo-miR-3205	MIMAT0015383	unmapped	CGCTCGGGTTTTCCCGAGCGGCTGTTAGACTGCTCGATTTTTTTTTT
A_38_P00021330	A_38_P00021330	mir|bmo-miR-2758-5p|mir|MIMAT0013629|mir|bmo-miR-2758_v18.0|mir|MIMAT0013629	bmo-miR-2758-5p	MIMAT0013629	unmapped	CGCTCGGGTTTTCCCGAGCGGCTTACTACGTGTTCTACTTTTTTTTTT
A_38_P00021331	A_38_P00021331	mir|bmo-miR-2758-5p|mir|MIMAT0013629|mir|bmo-miR-2758_v18.0|mir|MIMAT0013629	bmo-miR-2758-5p	MIMAT0013629	unmapped	CGCTCGGGTTTTCCCGAGCGGCTTACTACGTGTTCTACCTTTTTTTTTT
A_38_P00021332	A_38_P00021332	mir|bmo-miR-3207|mir|MIMAT0015385	bmo-miR-3207	MIMAT0015385	unmapped	CGCTCGGGTTTTCCCGAGCGGCTTCCCTACGTCACTATTTTTTTTT
A_38_P00021333	A_38_P00021333	mir|bmo-miR-3207|mir|MIMAT0015385	bmo-miR-3207	MIMAT0015385	unmapped	CGCTCGGGTTTTCCCGAGCGGCTTCCCTACGTCACTTTTTTTTTTTT
A_38_P00021334	A_38_P00021334	mir|bmo-miR-989b|mir|MIMAT0015627	bmo-miR-989b	MIMAT0015627	unmapped	CGCTCGGGTTTTCCCGAGCGGCTTGTTCACGTCACAATTTTTTTTT
A_38_P00021335	A_38_P00021335	mir|bmo-miR-989b|mir|MIMAT0015627	bmo-miR-989b	MIMAT0015627	unmapped	CGCTCGGGTTTTCCCGAGCGGCTTGTTCACGTCACATTTTTTTTTTT
A_38_P00021336	A_38_P00021336	mir|bmo-miR-989b|mir|MIMAT0015627	bmo-miR-989b	MIMAT0015627	unmapped	CGCTCGGGTTTTCCCGAGCGGCTTGTTCACGTCACATCTTTTTTTTTT
A_38_P00021337	A_38_P00021337	mir|bmo-miR-2801|mir|MIMAT0013705	bmo-miR-2801	MIMAT0013705	unmapped	CGCTCGGGTTTTCCCGAGCGGCTTTACAAAGTCACAAGAAATTTTTTTT
A_38_P00021338	A_38_P00021338	mir|bmo-miR-2801|mir|MIMAT0013705	bmo-miR-2801	MIMAT0013705	unmapped	CGCTCGGGTTTTCCCGAGCGGCTTTACAAAGTCACAAGATATTTTTTTTT
A_38_P00021339	A_38_P00021339	mir|bmo-miR-2801|mir|MIMAT0013705	bmo-miR-2801	MIMAT0013705	unmapped	CGCTCGGGTTTTCCCGAGCGGCTTTACAAAGTCACAAGATTTTTTTTTTTT
A_38_P00021340	A_38_P00021340	mir|bmo-miR-2819|mir|MIMAT0013729	bmo-miR-2819	MIMAT0013729	unmapped	CGCTCGGGTTTTCCCGAGCGGGAACCGATAGAGCAGTTTTTTTTTT
A_38_P00021341	A_38_P00021341	mir|bmo-miR-2819|mir|MIMAT0013729	bmo-miR-2819	MIMAT0013729	unmapped	CGCTCGGGTTTTCCCGAGCGGGAACCGATAGAGCAGGTTTTTTTTTT
A_38_P00021342	A_38_P00021342	mir|bmo-miR-3378-5p|mir|MIMAT0015569|mir|bmo-miR-3378_v18.0|mir|MIMAT0015569	bmo-miR-3378-5p	MIMAT0015569	unmapped	CGCTCGGGTTTTCCCGAGCGGGAAGCAGCCCCGTATTTTTTTT
A_38_P00021343	A_38_P00021343	mir|bmo-miR-3378-5p|mir|MIMAT0015569|mir|bmo-miR-3378_v18.0|mir|MIMAT0015569	bmo-miR-3378-5p	MIMAT0015569	unmapped	CGCTCGGGTTTTCCCGAGCGGGAAGCAGCCCCGAATTTTTTTTT
A_38_P00021344	A_38_P00021344	mir|bmo-miR-3373-3p|mir|MIMAT0015562|mir|bmo-miR-3373*_v18.0|mir|MIMAT0015562	bmo-miR-3373-3p	MIMAT0015562	unmapped	CGCTCGGGTTTTCCCGAGCGGGAAGCTGCGGGAAATTTTTTTTT
A_38_P00021345	A_38_P00021345	mir|bmo-miR-3373-3p|mir|MIMAT0015562|mir|bmo-miR-3373*_v18.0|mir|MIMAT0015562	bmo-miR-3373-3p	MIMAT0015562	unmapped	CGCTCGGGTTTTCCCGAGCGGGAAGCTGCGGGAATTATTTTTTTT
A_38_P00021346	A_38_P00021346	mir|bmo-miR-3373-3p|mir|MIMAT0015562|mir|bmo-miR-3373*_v18.0|mir|MIMAT0015562	bmo-miR-3373-3p	MIMAT0015562	unmapped	CGCTCGGGTTTTCCCGAGCGGGAAGCTGCGGGAATGATTTTTTTTT
A_38_P00021347	A_38_P00021347	mir|bmo-miR-3275|mir|MIMAT0015460	bmo-miR-3275	MIMAT0015460	unmapped	CGCTCGGGTTTTCCCGAGCGGGAAGGAAGTCCTACTCTTTTTTTTTT
A_38_P00021348	A_38_P00021348	mir|bmo-miR-3275|mir|MIMAT0015460	bmo-miR-3275	MIMAT0015460	unmapped	CGCTCGGGTTTTCCCGAGCGGGAAGGAAGTCCTACTCATTTTTTTTTT
A_38_P00021349	A_38_P00021349	mir|bmo-miR-3308-5p|mir|MIMAT0015496|mir|bmo-miR-3308_v18.0|mir|MIMAT0015496	bmo-miR-3308-5p	MIMAT0015496	unmapped	CGCTCGGGTTTTCCCGAGCGGGACAACCAATTACCAAGTATTTTTTTT
A_38_P00021350	A_38_P00021350	mir|bmo-miR-3308-5p|mir|MIMAT0015496|mir|bmo-miR-3308_v18.0|mir|MIMAT0015496	bmo-miR-3308-5p	MIMAT0015496	unmapped	CGCTCGGGTTTTCCCGAGCGGGACAACCAATTACCAAGAATTTTTTTTT
A_38_P00021351	A_38_P00021351	mir|bmo-miR-3315|mir|MIMAT0015503	bmo-miR-3315	MIMAT0015503	unmapped	CGCTCGGGTTTTCCCGAGCGGGACAGGAACAGCCTTTTTTTTTT
A_38_P00021352	A_38_P00021352	mir|bmo-miR-3315|mir|MIMAT0015503	bmo-miR-3315	MIMAT0015503	unmapped	CGCTCGGGTTTTCCCGAGCGGGACAGGAACAGCCCTTTTTTTTTT
A_38_P00021353	A_38_P00021353	mir|bmo-miR-2832|mir|MIMAT0013746	bmo-miR-2832	MIMAT0013746	unmapped	CGCTCGGGTTTTCCCGAGCGGGACATCCAAAACGCATATTTTTTTT
A_38_P00021354	A_38_P00021354	mir|bmo-miR-2832|mir|MIMAT0013746	bmo-miR-2832	MIMAT0013746	unmapped	CGCTCGGGTTTTCCCGAGCGGGACATCCAAAACGCACATTTTTTTTT
A_38_P00021355	A_38_P00021355	mir|bmo-miR-2769|mir|MIMAT0013650	bmo-miR-2769	MIMAT0013650	unmapped	CGCTCGGGTTTTCCCGAGCGGGACCGAAAATCTGATAATTATTTTTTTT
A_38_P00021356	A_38_P00021356	mir|bmo-miR-2769|mir|MIMAT0013650	bmo-miR-2769	MIMAT0013650	unmapped	CGCTCGGGTTTTCCCGAGCGGGACCGAAAATCTGATAATAATTTTTTTTT
A_38_P00021357	A_38_P00021357	mir|bmo-miR-2769|mir|MIMAT0013650	bmo-miR-2769	MIMAT0013650	unmapped	CGCTCGGGTTTTCCCGAGCGGGACCGAAAATCTGATAATATTATTTTTTTT
A_38_P00021358	A_38_P00021358	mir|bmo-miR-2769|mir|MIMAT0013650	bmo-miR-2769	MIMAT0013650	unmapped	CGCTCGGGTTTTCCCGAGCGGGACCGAAAATCTGATAATATAATTTTTTTTT
A_38_P00021359	A_38_P00021359	mir|bmo-miR-3358|mir|MIMAT0015544	bmo-miR-3358	MIMAT0015544	unmapped	CGCTCGGGTTTTCCCGAGCGGGACGCACGGAGGTTTTTTTTTT
A_38_P00021360	A_38_P00021360	mir|bmo-miR-3358|mir|MIMAT0015544	bmo-miR-3358	MIMAT0015544	unmapped	CGCTCGGGTTTTCCCGAGCGGGACGCACGGAGGATTTTTTTTTT
A_38_P00021361	A_38_P00021361	mir|bmo-miR-3391-3p|mir|MIMAT0015595|mir|bmo-miR-3391_v18.0|mir|MIMAT0015595	bmo-miR-3391-3p	MIMAT0015595	unmapped	CGCTCGGGTTTTCCCGAGCGGGACGGACTCACATCATATTTTTTTT
A_38_P00021362	A_38_P00021362	mir|bmo-miR-3391-3p|mir|MIMAT0015595|mir|bmo-miR-3391_v18.0|mir|MIMAT0015595	bmo-miR-3391-3p	MIMAT0015595	unmapped	CGCTCGGGTTTTCCCGAGCGGGACGGACTCACATCACAATTTTTTTT
A_38_P00021363	A_38_P00021363	mir|bmo-miR-3226|mir|MIMAT0015408	bmo-miR-3226	MIMAT0015408	unmapped	CGCTCGGGTTTTCCCGAGCGGGAGAAGTTCCCGTAGTTTTTTTTTT
A_38_P00021364	A_38_P00021364	mir|bmo-miR-3226|mir|MIMAT0015408	bmo-miR-3226	MIMAT0015408	unmapped	CGCTCGGGTTTTCCCGAGCGGGAGAAGTTCCCGTAGATTTTTTTTTT
A_38_P00021365	A_38_P00021365	mir|bmo-miR-3430|mir|MIMAT0015639	bmo-miR-3430	MIMAT0015639	unmapped	CGCTCGGGTTTTCCCGAGCGGGAGCACAAATTCTTAATAAGTTTTTTTTTT
A_38_P00021366	A_38_P00021366	mir|bmo-miR-3430|mir|MIMAT0015639	bmo-miR-3430	MIMAT0015639	unmapped	CGCTCGGGTTTTCCCGAGCGGGAGCACAAATTCTTAATAAGCTTTTTTTTTT
A_38_P00021367	A_38_P00021367	mir|bmo-miR-3384-5p|mir|MIMAT0015579|mir|bmo-miR-3384*_v18.0|mir|MIMAT0015579	bmo-miR-3384-5p	MIMAT0015579	unmapped	CGCTCGGGTTTTCCCGAGCGGGAGCCGGATAGAGGTTTTTTTTTT
A_38_P00021368	A_38_P00021368	mir|bmo-miR-3384-5p|mir|MIMAT0015579|mir|bmo-miR-3384*_v18.0|mir|MIMAT0015579	bmo-miR-3384-5p	MIMAT0015579	unmapped	CGCTCGGGTTTTCCCGAGCGGGAGCCGGATAGAGGATTTTTTTTTT
A_38_P00021369	A_38_P00021369	mir|bmo-miR-3235|mir|MIMAT0015418	bmo-miR-3235	MIMAT0015418	unmapped	CGCTCGGGTTTTCCCGAGCGGGAGGTAGAGGCCCTTTTTTTTTT
A_38_P00021370	A_38_P00021370	mir|bmo-miR-3235|mir|MIMAT0015418	bmo-miR-3235	MIMAT0015418	unmapped	CGCTCGGGTTTTCCCGAGCGGGAGGTAGAGGCCCGTTTTTTTTTT
A_38_P00021371	A_38_P00021371	mir|bmo-miR-3303|mir|MIMAT0015491	bmo-miR-3303	MIMAT0015491	unmapped	CGCTCGGGTTTTCCCGAGCGGGAGGTGTCAGAGGGTTTTTTTTTT
A_38_P00021372	A_38_P00021372	mir|bmo-miR-3303|mir|MIMAT0015491	bmo-miR-3303	MIMAT0015491	unmapped	CGCTCGGGTTTTCCCGAGCGGGAGGTGTCAGAGGGCTATTTTTTTT
A_38_P00021373	A_38_P00021373	mir|bmo-miR-2808b|mir|MIMAT0013739	bmo-miR-2808b	MIMAT0013739	unmapped	CGCTCGGGTTTTCCCGAGCGGGATCCGATGGTAGATTCATTTTTTTTT
A_38_P00021374	A_38_P00021374	mir|bmo-miR-2808b|mir|MIMAT0013739	bmo-miR-2808b	MIMAT0013739	unmapped	CGCTCGGGTTTTCCCGAGCGGGATCCGATGGTAGATTCTTTTTTTTTTT
A_38_P00021375	A_38_P00021375	mir|bmo-miR-33-3p|mir|MIMAT0013600|mir|bmo-miR-33*_v18.0|mir|MIMAT0013600	bmo-miR-33-3p	MIMAT0013600	unmapped	CGCTCGGGTTTTCCCGAGCGGGATTTGCCTTGTAGTCAATTTTTTTTT
A_38_P00021376	A_38_P00021376	mir|bmo-miR-33-3p|mir|MIMAT0013600|mir|bmo-miR-33*_v18.0|mir|MIMAT0013600	bmo-miR-33-3p	MIMAT0013600	unmapped	CGCTCGGGTTTTCCCGAGCGGGATTTGCCTTGTAGTCATTATTTTTTTT
A_38_P00021377	A_38_P00021377	mir|bmo-miR-277-5p|mir|MIMAT0015233|mir|bmo-miR-277*_v18.0|mir|MIMAT0015233	bmo-miR-277-5p	MIMAT0015233	unmapped	CGCTCGGGTTTTCCCGAGCGGGCAAACGCACTCCATTTTTTTTT
A_38_P00021378	A_38_P00021378	mir|bmo-miR-277-5p|mir|MIMAT0015233|mir|bmo-miR-277*_v18.0|mir|MIMAT0015233	bmo-miR-277-5p	MIMAT0015233	unmapped	CGCTCGGGTTTTCCCGAGCGGGCAAACGCACTCCTTTTTTTTTTT
A_38_P00021379	A_38_P00021379	mir|bmo-miR-3318|mir|MIMAT0015506	bmo-miR-3318	MIMAT0015506	unmapped	CGCTCGGGTTTTCCCGAGCGGGCAACATGCAAAAATGTTTTTTTTTTT
A_38_P00021380	A_38_P00021380	mir|bmo-miR-3318|mir|MIMAT0015506	bmo-miR-3318	MIMAT0015506	unmapped	CGCTCGGGTTTTCCCGAGCGGGCAACATGCAAAAATGTATTTTTTTTTT
A_38_P00021381	A_38_P00021381	mir|bmo-miR-2796-3p|mir|MIMAT0013697	bmo-miR-2796-3p	MIMAT0013697	unmapped	CGCTCGGGTTTTCCCGAGCGGGCAAGTAGTTTCCGCTTTTTTTTTT
A_38_P00021382	A_38_P00021382	mir|bmo-miR-2796-3p|mir|MIMAT0013697	bmo-miR-2796-3p	MIMAT0013697	unmapped	CGCTCGGGTTTTCCCGAGCGGGCAAGTAGTTTCCGCCTTTTTTTTTT
A_38_P00021383	A_38_P00021383	mir|bmo-miR-2733c|mir|MIMAT0013619	bmo-miR-2733c	MIMAT0013619	unmapped	CGCTCGGGTTTTCCCGAGCGGGCAATCATCACTCTCCTTTTTTTTTT
A_38_P00021384	A_38_P00021384	mir|bmo-miR-2733c|mir|MIMAT0013619	bmo-miR-2733c	MIMAT0013619	unmapped	CGCTCGGGTTTTCCCGAGCGGGCAATCATCACTCTCCCTTTTTTTTTT
A_38_P00021385	A_38_P00021385	mir|bmo-miR-2778a-2-5p|mir|MIMAT0015305|mir|bmo-miR-2778a-2*_v18.0|mir|MIMAT0015305	bmo-miR-2778a-2-5p	MIMAT0015305	unmapped	CGCTCGGGTTTTCCCGAGCGGGCAGGATATACAAAAAAATTTTTTTTTT
A_38_P00021386	A_38_P00021386	mir|bmo-miR-2778a-2-5p|mir|MIMAT0015305|mir|bmo-miR-2778a-2*_v18.0|mir|MIMAT0015305	bmo-miR-2778a-2-5p	MIMAT0015305	unmapped	CGCTCGGGTTTTCCCGAGCGGGCAGGATATACAAAAAAACTTTTTTTTTT
A_38_P00021387	A_38_P00021387	mir|bmo-miR-3232|mir|MIMAT0015414	bmo-miR-3232	MIMAT0015414	unmapped	CGCTCGGGTTTTCCCGAGCGGGCAGTTTAATTAAGAAACAAATTTTTTTTT
A_38_P00021388	A_38_P00021388	mir|bmo-miR-3232|mir|MIMAT0015414	bmo-miR-3232	MIMAT0015414	unmapped	CGCTCGGGTTTTCCCGAGCGGGCAGTTTAATTAAGAAACAATTATTTTTTTT
A_38_P00021389	A_38_P00021389	mir|bmo-miR-2765|mir|MIMAT0013640	bmo-miR-2765	MIMAT0013640	unmapped	CGCTCGGGTTTTCCCGAGCGGGCCAACGGTGGTTTTTTTTTTT
A_38_P00021390	A_38_P00021390	mir|bmo-miR-2765|mir|MIMAT0013640	bmo-miR-2765	MIMAT0013640	unmapped	CGCTCGGGTTTTCCCGAGCGGGCCAACGGTGGTGTTTTTTTTTT
A_38_P00021391	A_38_P00021391	mir|bmo-miR-2807d|mir|MIMAT0015433	bmo-miR-2807d	MIMAT0015433	unmapped	CGCTCGGGTTTTCCCGAGCGGGCCCAATTTTGTATGCTTTTTTTTTT
A_38_P00021392	A_38_P00021392	mir|bmo-miR-2807d|mir|MIMAT0015433	bmo-miR-2807d	MIMAT0015433	unmapped	CGCTCGGGTTTTCCCGAGCGGGCCCAATTTTGTATGCATTTTTTTTTT
A_38_P00021393	A_38_P00021393	mir|bmo-miR-3351|mir|MIMAT0015536	bmo-miR-3351	MIMAT0015536	unmapped	CGCTCGGGTTTTCCCGAGCGGGCCCATAGACATCCATTTTTTTTTT
A_38_P00021394	A_38_P00021394	mir|bmo-miR-3351|mir|MIMAT0015536	bmo-miR-3351	MIMAT0015536	unmapped	CGCTCGGGTTTTCCCGAGCGGGCCCATAGACATCCACTTTTTTTTTT
A_38_P00021395	A_38_P00021395	mir|bmo-miR-3295|mir|MIMAT0015482	bmo-miR-3295	MIMAT0015482	unmapped	CGCTCGGGTTTTCCCGAGCGGGCGAGTTATTTAACTTCTTTTTTTTTTT
A_38_P00021396	A_38_P00021396	mir|bmo-miR-3295|mir|MIMAT0015482	bmo-miR-3295	MIMAT0015482	unmapped	CGCTCGGGTTTTCCCGAGCGGGCGAGTTATTTAACTTCTCTTTTTTTTTT
A_38_P00021397	A_38_P00021397	mir|bmo-miR-2842|mir|MIMAT0013761	bmo-miR-2842	MIMAT0013761	unmapped	CGCTCGGGTTTTCCCGAGCGGGCGCCACCAGTACTTTTTTTTTT
A_38_P00021398	A_38_P00021398	mir|bmo-miR-2842|mir|MIMAT0013761	bmo-miR-2842	MIMAT0013761	unmapped	CGCTCGGGTTTTCCCGAGCGGGCGCCACCAGTACGTTTTTTTTTT
A_38_P00021399	A_38_P00021399	mir|bmo-miR-2795|mir|MIMAT0013695	bmo-miR-2795	MIMAT0013695	unmapped	CGCTCGGGTTTTCCCGAGCGGGCGCCCGCGTTATTTTTTTT
A_38_P00021400	A_38_P00021400	mir|bmo-miR-2795|mir|MIMAT0013695	bmo-miR-2795	MIMAT0013695	unmapped	CGCTCGGGTTTTCCCGAGCGGGCGCCCGCGTAATTTTTTTTT
A_38_P00021401	A_38_P00021401	mir|bmo-miR-2795|mir|MIMAT0013695	bmo-miR-2795	MIMAT0013695	unmapped	CGCTCGGGTTTTCCCGAGCGGGCGCCCGCGTATTTTTTTTTTT
A_38_P00021402	A_38_P00021402	mir|bmo-miR-3209|mir|MIMAT0015388	bmo-miR-3209	MIMAT0015388	unmapped	CGCTCGGGTTTTCCCGAGCGGGCGGAATAGACTCACTATTTTTTTT
A_38_P00021403	A_38_P00021403	mir|bmo-miR-3209|mir|MIMAT0015388	bmo-miR-3209	MIMAT0015388	unmapped	CGCTCGGGTTTTCCCGAGCGGGCGGAATAGACTCACGATTTTTTTTT
A_38_P00021404	A_38_P00021404	mir|bmo-miR-2836|mir|MIMAT0013750	bmo-miR-2836	MIMAT0013750	unmapped	CGCTCGGGTTTTCCCGAGCGGGCGTCGTCTACAGTTTTTTTTTT
A_38_P00021405	A_38_P00021405	mir|bmo-miR-2836|mir|MIMAT0013750	bmo-miR-2836	MIMAT0013750	unmapped	CGCTCGGGTTTTCCCGAGCGGGCGTCGTCTACAGCTTTTTTTTTT
A_38_P00021406	A_38_P00021406	mir|bmo-miR-3343|mir|MIMAT0015530	bmo-miR-3343	MIMAT0015530	unmapped	CGCTCGGGTTTTCCCGAGCGGGCTACGGTGCAGGTTTTTTTTTT
A_38_P00021407	A_38_P00021407	mir|bmo-miR-3343|mir|MIMAT0015530	bmo-miR-3343	MIMAT0015530	unmapped	CGCTCGGGTTTTCCCGAGCGGGCTACGGTGCAGGATTTTTTTTTT
A_38_P00021408	A_38_P00021408	mir|bmo-miR-3249|mir|MIMAT0015431	bmo-miR-3249	MIMAT0015431	unmapped	CGCTCGGGTTTTCCCGAGCGGGCTAGTTAAGATAACAGATGTTTTTTTTTT
A_38_P00021409	A_38_P00021409	mir|bmo-miR-3249|mir|MIMAT0015431	bmo-miR-3249	MIMAT0015431	unmapped	CGCTCGGGTTTTCCCGAGCGGGCTAGTTAAGATAACAGATGCTATTTTTTTT
A_38_P00021410	A_38_P00021410	mir|bmo-miR-3348|mir|MIMAT0015534	bmo-miR-3348	MIMAT0015534	unmapped	CGCTCGGGTTTTCCCGAGCGGGCTCGCCGGGATTTTTTTTTT
A_38_P00021411	A_38_P00021411	mir|bmo-miR-3348|mir|MIMAT0015534	bmo-miR-3348	MIMAT0015534	unmapped	CGCTCGGGTTTTCCCGAGCGGGCTCGCCGGGAGTTTTTTTTTT
A_38_P00021412	A_38_P00021412	mir|bmo-miR-3306|mir|MIMAT0015494	bmo-miR-3306	MIMAT0015494	unmapped	CGCTCGGGTTTTCCCGAGCGGGCTCTCGTCAAAATCTTATTTTTTTT
A_38_P00021413	A_38_P00021413	mir|bmo-miR-3306|mir|MIMAT0015494	bmo-miR-3306	MIMAT0015494	unmapped	CGCTCGGGTTTTCCCGAGCGGGCTCTCGTCAAAATCTAATTTTTTTTT
A_38_P00021414	A_38_P00021414	mir|bmo-miR-3306|mir|MIMAT0015494	bmo-miR-3306	MIMAT0015494	unmapped	CGCTCGGGTTTTCCCGAGCGGGCTCTCGTCAAAATCTATTTTTTTTTTT
A_38_P00021415	A_38_P00021415	mir|bmo-miR-2791|mir|MIMAT0013689	bmo-miR-2791	MIMAT0013689	unmapped	CGCTCGGGTTTTCCCGAGCGGGCTGACAGAGCTGTATTTTTTTTT
A_38_P00021416	A_38_P00021416	mir|bmo-miR-2791|mir|MIMAT0013689	bmo-miR-2791	MIMAT0013689	unmapped	CGCTCGGGTTTTCCCGAGCGGGCTGACAGAGCTGTTTATTTTTTTT
A_38_P00021417	A_38_P00021417	mir|bmo-miR-2791|mir|MIMAT0013689	bmo-miR-2791	MIMAT0013689	unmapped	CGCTCGGGTTTTCCCGAGCGGGCTGACAGAGCTGTTAATTTTTTTTT
A_38_P00021418	A_38_P00021418	mir|bmo-miR-3213-5p|mir|MIMAT0015392|mir|bmo-miR-3213_v18.0|mir|MIMAT0015392	bmo-miR-3213-5p	MIMAT0015392	unmapped	CGCTCGGGTTTTCCCGAGCGGGCTGAGCATTCCCTTATTTTTTTT
A_38_P00021419	A_38_P00021419	mir|bmo-miR-3213-5p|mir|MIMAT0015392|mir|bmo-miR-3213_v18.0|mir|MIMAT0015392	bmo-miR-3213-5p	MIMAT0015392	unmapped	CGCTCGGGTTTTCCCGAGCGGGCTGAGCATTCCCTGATTTTTTTTT
A_38_P00021420	A_38_P00021420	mir|bmo-miR-31-3p|mir|MIMAT0015242|mir|bmo-miR-31*_v18.0|mir|MIMAT0015242	bmo-miR-31-3p	MIMAT0015242	unmapped	CGCTCGGGTTTTCCCGAGCGGGCTGGCTCGAAGTTTTTTTTTTT
A_38_P00021421	A_38_P00021421	mir|bmo-miR-31-3p|mir|MIMAT0015242|mir|bmo-miR-31*_v18.0|mir|MIMAT0015242	bmo-miR-31-3p	MIMAT0015242	unmapped	CGCTCGGGTTTTCCCGAGCGGGCTGGCTCGAAGTGTTTTTTTTTT
A_38_P00021422	A_38_P00021422	mir|bmo-miR-2760-5p|mir|MIMAT0013632|mir|bmo-miR-2760*_v18.0|mir|MIMAT0013632	bmo-miR-2760-5p	MIMAT0013632	unmapped	CGCTCGGGTTTTCCCGAGCGGGCTTTTTGGTTCAATTAATTTTTTTTTT
A_38_P00021423	A_38_P00021423	mir|bmo-miR-2760-5p|mir|MIMAT0013632|mir|bmo-miR-2760*_v18.0|mir|MIMAT0013632	bmo-miR-2760-5p	MIMAT0013632	unmapped	CGCTCGGGTTTTCCCGAGCGGGCTTTTTGGTTCAATTAAGTTTTTTTTTT
A_38_P00021424	A_38_P00021424	mir|bmo-miR-2760-5p|mir|MIMAT0013632|mir|bmo-miR-2760*_v18.0|mir|MIMAT0013632	bmo-miR-2760-5p	MIMAT0013632	unmapped	CGCTCGGGTTTTCCCGAGCGGGCTTTTTGGTTCAATTAAGCTATTTTTTTT
A_38_P00021425	A_38_P00021425	mir|bmo-let-7-3p|mir|MIMAT0015221|mir|bmo-let-7*_v18.0|mir|MIMAT0015221	bmo-let-7-3p	MIMAT0015221	unmapped	CGCTCGGGTTTTCCCGAGCGGGGAAAGTTAGCAGGCATTTTTTTTT
A_38_P00021426	A_38_P00021426	mir|bmo-let-7-3p|mir|MIMAT0015221|mir|bmo-let-7*_v18.0|mir|MIMAT0015221	bmo-let-7-3p	MIMAT0015221	unmapped	CGCTCGGGTTTTCCCGAGCGGGGAAAGTTAGCAGGCTTATTTTTTTT
A_38_P00021427	A_38_P00021427	mir|bmo-miR-3296-5p|mir|MIMAT0015483|mir|bmo-miR-3296*_v18.0|mir|MIMAT0015483	bmo-miR-3296-5p	MIMAT0015483	unmapped	CGCTCGGGTTTTCCCGAGCGGGGAATTGTACAGCGGTTTTTTTTTT
A_38_P00021428	A_38_P00021428	mir|bmo-miR-3296-5p|mir|MIMAT0015483|mir|bmo-miR-3296*_v18.0|mir|MIMAT0015483	bmo-miR-3296-5p	MIMAT0015483	unmapped	CGCTCGGGTTTTCCCGAGCGGGGAATTGTACAGCGGGTTTTTTTTTT
A_38_P00021429	A_38_P00021429	mir|bmo-miR-316-3p|mir|MIMAT0013598|mir|bmo-miR-316_v18.0|mir|MIMAT0013598	bmo-miR-316-3p	MIMAT0013598	unmapped	CGCTCGGGTTTTCCCGAGCGGGGAGACCTTTTCACTTATTTTTTTTT
A_38_P00021430	A_38_P00021430	mir|bmo-miR-316-3p|mir|MIMAT0013598|mir|bmo-miR-316_v18.0|mir|MIMAT0013598	bmo-miR-316-3p	MIMAT0013598	unmapped	CGCTCGGGTTTTCCCGAGCGGGGAGACCTTTTCACTTTTTTTTTTTTT
A_38_P00021431	A_38_P00021431	mir|bmo-miR-3347b|mir|MIMAT0015608	bmo-miR-3347b	MIMAT0015608	unmapped	CGCTCGGGTTTTCCCGAGCGGGGAGATAGCAAGATCAAATTTTTTTTT
A_38_P00021432	A_38_P00021432	mir|bmo-miR-3347b|mir|MIMAT0015608	bmo-miR-3347b	MIMAT0015608	unmapped	CGCTCGGGTTTTCCCGAGCGGGGAGATAGCAAGATCAATTTTTTTTTTT
A_38_P00021433	A_38_P00021433	mir|bmo-miR-3347b|mir|MIMAT0015608	bmo-miR-3347b	MIMAT0015608	unmapped	CGCTCGGGTTTTCCCGAGCGGGGAGATAGCAAGATCAATGTATTTTTTTT
A_38_P00021434	A_38_P00021434	mir|bmo-miR-3314|mir|MIMAT0015502	bmo-miR-3314	MIMAT0015502	unmapped	CGCTCGGGTTTTCCCGAGCGGGGAGGCGGCCTTTTTTTTTT
A_38_P00021435	A_38_P00021435	mir|bmo-miR-3314|mir|MIMAT0015502	bmo-miR-3314	MIMAT0015502	unmapped	CGCTCGGGTTTTCCCGAGCGGGGAGGCGGCCGTATTTTTTTT
A_38_P00021436	A_38_P00021436	mir|bmo-miR-3386-5p|mir|MIMAT0015583|mir|bmo-miR-3386_v18.0|mir|MIMAT0015583	bmo-miR-3386-5p	MIMAT0015583	unmapped	CGCTCGGGTTTTCCCGAGCGGGGCATACCAGAGAACTTTTTTTTTTT
A_38_P00021437	A_38_P00021437	mir|bmo-miR-3386-5p|mir|MIMAT0015583|mir|bmo-miR-3386_v18.0|mir|MIMAT0015583	bmo-miR-3386-5p	MIMAT0015583	unmapped	CGCTCGGGTTTTCCCGAGCGGGGCATACCAGAGAACTGTATTTTTTTT
A_38_P00021438	A_38_P00021438	mir|bmo-miR-3374-5p|mir|MIMAT0015563|mir|bmo-miR-3374*_v18.0|mir|MIMAT0015563	bmo-miR-3374-5p	MIMAT0015563	unmapped	CGCTCGGGTTTTCCCGAGCGGGGCCTCTCAACATCTTTTTTTTTTT
A_38_P00021439	A_38_P00021439	mir|bmo-miR-3374-5p|mir|MIMAT0015563|mir|bmo-miR-3374*_v18.0|mir|MIMAT0015563	bmo-miR-3374-5p	MIMAT0015563	unmapped	CGCTCGGGTTTTCCCGAGCGGGGCCTCTCAACATCTGTATTTTTTTT
A_38_P00021440	A_38_P00021440	mir|bmo-miR-3342|mir|MIMAT0015529	bmo-miR-3342	MIMAT0015529	unmapped	CGCTCGGGTTTTCCCGAGCGGGGGCTCGACTCGATTTTTTTTT
A_38_P00021441	A_38_P00021441	mir|bmo-miR-3342|mir|MIMAT0015529	bmo-miR-3342	MIMAT0015529	unmapped	CGCTCGGGTTTTCCCGAGCGGGGGCTCGACTCGTTTTTTTTTTT
A_38_P00021442	A_38_P00021442	mir|bmo-miR-2824|mir|MIMAT0013735	bmo-miR-2824	MIMAT0013735	unmapped	CGCTCGGGTTTTCCCGAGCGGGGTTACCTGTGGCTTTTTTTTTT
A_38_P00021443	A_38_P00021443	mir|bmo-miR-2824|mir|MIMAT0013735	bmo-miR-2824	MIMAT0013735	unmapped	CGCTCGGGTTTTCCCGAGCGGGGTTACCTGTGGCGTATTTTTTTT
A_38_P00021444	A_38_P00021444	mir|bmo-miR-3382-3p|mir|MIMAT0015576|mir|bmo-miR-3382*_v18.0|mir|MIMAT0015576	bmo-miR-3382-3p	MIMAT0015576	unmapped	CGCTCGGGTTTTCCCGAGCGGGGTTCAAGAATCCAGTTTTTTTTTTT
A_38_P00021445	A_38_P00021445	mir|bmo-miR-3382-3p|mir|MIMAT0015576|mir|bmo-miR-3382*_v18.0|mir|MIMAT0015576	bmo-miR-3382-3p	MIMAT0015576	unmapped	CGCTCGGGTTTTCCCGAGCGGGGTTCAAGAATCCAGTCTTTTTTTTTT
A_38_P00021446	A_38_P00021446	mir|bmo-miR-3233|mir|MIMAT0015415	bmo-miR-3233	MIMAT0015415	unmapped	CGCTCGGGTTTTCCCGAGCGGGTAAGAGTAATGGAACACTTTTTTTTTT
A_38_P00021447	A_38_P00021447	mir|bmo-miR-3233|mir|MIMAT0015415	bmo-miR-3233	MIMAT0015415	unmapped	CGCTCGGGTTTTCCCGAGCGGGTAAGAGTAATGGAACACGTTTTTTTTTT
A_38_P00021448	A_38_P00021448	mir|bmo-miR-3327-5p|mir|MIMAT0015514|mir|bmo-miR-3327_v18.0|mir|MIMAT0015514	bmo-miR-3327-5p	MIMAT0015514	unmapped	CGCTCGGGTTTTCCCGAGCGGGTACATAACATTCCTGTTGAATTTTTTTT
A_38_P00021449	A_38_P00021449	mir|bmo-miR-3327-5p|mir|MIMAT0015514|mir|bmo-miR-3327_v18.0|mir|MIMAT0015514	bmo-miR-3327-5p	MIMAT0015514	unmapped	CGCTCGGGTTTTCCCGAGCGGGTACATAACATTCCTGTTGTATTTTTTTTT
A_38_P00021450	A_38_P00021450	mir|bmo-miR-3404|mir|MIMAT0015609	bmo-miR-3404	MIMAT0015609	unmapped	CGCTCGGGTTTTCCCGAGCGGGTCACACTATTGCAGAATTTTTTTTTT
A_38_P00021451	A_38_P00021451	mir|bmo-miR-3404|mir|MIMAT0015609	bmo-miR-3404	MIMAT0015609	unmapped	CGCTCGGGTTTTCCCGAGCGGGTCACACTATTGCAGAAATTTTTTTTTT
A_38_P00021452	A_38_P00021452	mir|bmo-miR-3359|mir|MIMAT0015545	bmo-miR-3359	MIMAT0015545	unmapped	CGCTCGGGTTTTCCCGAGCGGGTCAGGGCGGTTCTTTTTTTTTT
A_38_P00021453	A_38_P00021453	mir|bmo-miR-3359|mir|MIMAT0015545	bmo-miR-3359	MIMAT0015545	unmapped	CGCTCGGGTTTTCCCGAGCGGGTCAGGGCGGTTCATTTTTTTTTT
A_38_P00021454	A_38_P00021454	mir|bmo-miR-2782|mir|MIMAT0013678	bmo-miR-2782	MIMAT0013678	unmapped	CGCTCGGGTTTTCCCGAGCGGGTCGCCAATTTCATACTTTTTTTTTT
A_38_P00021455	A_38_P00021455	mir|bmo-miR-2782|mir|MIMAT0013678	bmo-miR-2782	MIMAT0013678	unmapped	CGCTCGGGTTTTCCCGAGCGGGTCGCCAATTTCATACATTTTTTTTTT
A_38_P00021456	A_38_P00021456	mir|bmo-miR-2834|mir|MIMAT0013748	bmo-miR-2834	MIMAT0013748	unmapped	CGCTCGGGTTTTCCCGAGCGGGTCGTCTAGTCCCGTATTTTTTTT
A_38_P00021457	A_38_P00021457	mir|bmo-miR-2834|mir|MIMAT0013748	bmo-miR-2834	MIMAT0013748	unmapped	CGCTCGGGTTTTCCCGAGCGGGTCGTCTAGTCCCGAATTTTTTTTT
A_38_P00021458	A_38_P00021458	mir|bmo-miR-3381-5p|mir|MIMAT0015573|mir|bmo-miR-3381_v18.0|mir|MIMAT0015573	bmo-miR-3381-5p	MIMAT0015573	unmapped	CGCTCGGGTTTTCCCGAGCGGGTGAACCTTTGCGATTTTTTTTTT
A_38_P00021459	A_38_P00021459	mir|bmo-miR-3381-5p|mir|MIMAT0015573|mir|bmo-miR-3381_v18.0|mir|MIMAT0015573	bmo-miR-3381-5p	MIMAT0015573	unmapped	CGCTCGGGTTTTCCCGAGCGGGTGAACCTTTGCGAGTTTTTTTTTT
A_38_P00021460	A_38_P00021460	mir|bmo-miR-3381-5p|mir|MIMAT0015573|mir|bmo-miR-3381_v18.0|mir|MIMAT0015573	bmo-miR-3381-5p	MIMAT0015573	unmapped	CGCTCGGGTTTTCCCGAGCGGGTGAACCTTTGCGAGGTTTTTTTTTT
A_38_P00021461	A_38_P00021461	mir|bmo-miR-3237|mir|MIMAT0015420	bmo-miR-3237	MIMAT0015420	unmapped	CGCTCGGGTTTTCCCGAGCGGGTGACCACTTAAACAACTATTTTTTTT
A_38_P00021462	A_38_P00021462	mir|bmo-miR-3237|mir|MIMAT0015420	bmo-miR-3237	MIMAT0015420	unmapped	CGCTCGGGTTTTCCCGAGCGGGTGACCACTTAAACAACAATTTTTTTTT
A_38_P00021463	A_38_P00021463	mir|bmo-miR-263a-3p|mir|MIMAT0015230|mir|bmo-miR-263a*_v18.0|mir|MIMAT0015230	bmo-miR-263a-3p	MIMAT0015230	unmapped	CGCTCGGGTTTTCCCGAGCGGGTGATGCCACTAAGAGTATTTTTTTT
A_38_P00021464	A_38_P00021464	mir|bmo-miR-263a-3p|mir|MIMAT0015230|mir|bmo-miR-263a*_v18.0|mir|MIMAT0015230	bmo-miR-263a-3p	MIMAT0015230	unmapped	CGCTCGGGTTTTCCCGAGCGGGTGATGCCACTAAGAGAATTTTTTTTT
A_38_P00021465	A_38_P00021465	mir|bmo-miR-3287|mir|MIMAT0015474	bmo-miR-3287	MIMAT0015474	unmapped	CGCTCGGGTTTTCCCGAGCGGGTTACGCCACCCTATTTTTTTTT
A_38_P00021466	A_38_P00021466	mir|bmo-miR-3287|mir|MIMAT0015474	bmo-miR-3287	MIMAT0015474	unmapped	CGCTCGGGTTTTCCCGAGCGGGTTACGCCACCCTTTTTTTTTTTT
A_38_P00021467	A_38_P00021467	mir|bmo-miR-3287|mir|MIMAT0015474	bmo-miR-3287	MIMAT0015474	unmapped	CGCTCGGGTTTTCCCGAGCGGGTTACGCCACCCTTCTTTTTTTTTT
A_38_P00021468	A_38_P00021468	mir|bmo-miR-3374-3p|mir|MIMAT0015564|mir|bmo-miR-3374_v18.0|mir|MIMAT0015564	bmo-miR-3374-3p	MIMAT0015564	unmapped	CGCTCGGGTTTTCCCGAGCGGGTTGAGTGCGAGCATTTTTTTTTT
A_38_P00021469	A_38_P00021469	mir|bmo-miR-3374-3p|mir|MIMAT0015564|mir|bmo-miR-3374_v18.0|mir|MIMAT0015564	bmo-miR-3374-3p	MIMAT0015564	unmapped	CGCTCGGGTTTTCCCGAGCGGGTTGAGTGCGAGCAATATTTTTTTT
A_38_P00021470	A_38_P00021470	mir|bmo-miR-3278|mir|MIMAT0015463	bmo-miR-3278	MIMAT0015463	unmapped	CGCTCGGGTTTTCCCGAGCGGGTTGTAAGATCCAAACATTTTTTTTTT
A_38_P00021471	A_38_P00021471	mir|bmo-miR-3278|mir|MIMAT0015463	bmo-miR-3278	MIMAT0015463	unmapped	CGCTCGGGTTTTCCCGAGCGGGTTGTAAGATCCAAACACTTTTTTTTTT
A_38_P00021472	A_38_P00021472	mir|bmo-miR-3398|mir|MIMAT0015602	bmo-miR-3398	MIMAT0015602	unmapped	CGCTCGGGTTTTCCCGAGCGGGTTTACATATAGTCTGATCTGTTTTTTTTTT
A_38_P00021473	A_38_P00021473	mir|bmo-miR-3398|mir|MIMAT0015602	bmo-miR-3398	MIMAT0015602	unmapped	CGCTCGGGTTTTCCCGAGCGGGTTTACATATAGTCTGATCTGCTTTTTTTTTT
A_38_P00021474	A_38_P00021474	mir|bmo-miR-3419|mir|MIMAT0015626	bmo-miR-3419	MIMAT0015626	unmapped	CGCTCGGGTTTTCCCGAGCGGGTTTTACAGTATTAAAGGCATTTTTTTTT
A_38_P00021475	A_38_P00021475	mir|bmo-miR-3419|mir|MIMAT0015626	bmo-miR-3419	MIMAT0015626	unmapped	CGCTCGGGTTTTCCCGAGCGGGTTTTACAGTATTAAAGGCTTTTTTTTTTT
A_38_P00021476	A_38_P00021476	mir|bmo-miR-3419|mir|MIMAT0015626	bmo-miR-3419	MIMAT0015626	unmapped	CGCTCGGGTTTTCCCGAGCGGGTTTTACAGTATTAAAGGCTATTTTTTTTTT
A_38_P00021477	A_38_P00021477	mir|bmo-miR-3217|mir|MIMAT0015397	bmo-miR-3217	MIMAT0015397	unmapped	CGCTCGGGTTTTCCCGAGCGGTAACAAAAAACATATACTCATTTTTTTTT
A_38_P00021478	A_38_P00021478	mir|bmo-miR-3217|mir|MIMAT0015397	bmo-miR-3217	MIMAT0015397	unmapped	CGCTCGGGTTTTCCCGAGCGGTAACAAAAAACATATACTCTTTTTTTTTTT
A_38_P00021479	A_38_P00021479	mir|bmo-miR-3217|mir|MIMAT0015397	bmo-miR-3217	MIMAT0015397	unmapped	CGCTCGGGTTTTCCCGAGCGGTAACAAAAAACATATACTCTGTTTTTTTTTT
A_38_P00021480	A_38_P00021480	mir|bmo-miR-2804-3p|mir|MIMAT0013710|mir|bmo-miR-2804_v18.0|mir|MIMAT0013710	bmo-miR-2804-3p	MIMAT0013710	unmapped	CGCTCGGGTTTTCCCGAGCGGTAACAGTGTATTACAATGCATTTTTTTTTT
A_38_P00021481	A_38_P00021481	mir|bmo-miR-2804-3p|mir|MIMAT0013710|mir|bmo-miR-2804_v18.0|mir|MIMAT0013710	bmo-miR-2804-3p	MIMAT0013710	unmapped	CGCTCGGGTTTTCCCGAGCGGTAACAGTGTATTACAATGCAATTTTTTTTTT
A_38_P00021482	A_38_P00021482	mir|bmo-miR-2771-5p|mir|MIMAT0013654|mir|bmo-miR-2771*_v18.0|mir|MIMAT0013654	bmo-miR-2771-5p	MIMAT0013654	unmapped	CGCTCGGGTTTTCCCGAGCGGTAACTAAACCCATCCTCTATTTTTTTT
A_38_P00021483	A_38_P00021483	mir|bmo-miR-2771-5p|mir|MIMAT0013654|mir|bmo-miR-2771*_v18.0|mir|MIMAT0013654	bmo-miR-2771-5p	MIMAT0013654	unmapped	CGCTCGGGTTTTCCCGAGCGGTAACTAAACCCATCCTCGATTTTTTTTT
A_38_P00021484	A_38_P00021484	mir|bmo-miR-9a-3p|mir|MIMAT0015225|mir|bmo-miR-9a*_v18.0|mir|MIMAT0015225	bmo-miR-9a-3p	MIMAT0015225	unmapped	CGCTCGGGTTTTCCCGAGCGGTAACTCCGGTAACCTAGTATTTTTTTT
A_38_P00021485	A_38_P00021485	mir|bmo-miR-9a-3p|mir|MIMAT0015225|mir|bmo-miR-9a*_v18.0|mir|MIMAT0015225	bmo-miR-9a-3p	MIMAT0015225	unmapped	CGCTCGGGTTTTCCCGAGCGGTAACTCCGGTAACCTAGCAATTTTTTTT
A_38_P00021486	A_38_P00021486	mir|bmo-miR-2758-3p|mir|MIMAT0013630|mir|bmo-miR-2758*_v18.0|mir|MIMAT0013630	bmo-miR-2758-3p	MIMAT0013630	unmapped	CGCTCGGGTTTTCCCGAGCGGTAACTTGGTAGAACACGTTTTTTTTTT
A_38_P00021487	A_38_P00021487	mir|bmo-miR-2758-3p|mir|MIMAT0013630|mir|bmo-miR-2758*_v18.0|mir|MIMAT0013630	bmo-miR-2758-3p	MIMAT0013630	unmapped	CGCTCGGGTTTTCCCGAGCGGTAACTTGGTAGAACACGCTTTTTTTTTT
A_38_P00021488	A_38_P00021488	mir|bmo-miR-3428|mir|MIMAT0015636	bmo-miR-3428	MIMAT0015636	unmapped	CGCTCGGGTTTTCCCGAGCGGTAATAGGAAAAATGACACGATTTTTTTTT
A_38_P00021489	A_38_P00021489	mir|bmo-miR-3428|mir|MIMAT0015636	bmo-miR-3428	MIMAT0015636	unmapped	CGCTCGGGTTTTCCCGAGCGGTAATAGGAAAAATGACACGTTATTTTTTTT
A_38_P00021490	A_38_P00021490	mir|bmo-miR-2852|mir|MIMAT0013785	bmo-miR-2852	MIMAT0013785	unmapped	CGCTCGGGTTTTCCCGAGCGGTACAAAAAATCCGAAATCTTTTTTTTTTT
A_38_P00021491	A_38_P00021491	mir|bmo-miR-2852|mir|MIMAT0013785	bmo-miR-2852	MIMAT0013785	unmapped	CGCTCGGGTTTTCCCGAGCGGTACAAAAAATCCGAAATCTGTTTTTTTTTT
A_38_P00021492	A_38_P00021492	mir|bmo-miR-3236|mir|MIMAT0015419	bmo-miR-3236	MIMAT0015419	unmapped	CGCTCGGGTTTTCCCGAGCGGTACAAACAAAATGACTTGTAATTTTTTTT
A_38_P00021493	A_38_P00021493	mir|bmo-miR-3236|mir|MIMAT0015419	bmo-miR-3236	MIMAT0015419	unmapped	CGCTCGGGTTTTCCCGAGCGGTACAAACAAAATGACTTGTTAATTTTTTTT
A_38_P00021494	A_38_P00021494	mir|bmo-miR-3236|mir|MIMAT0015419	bmo-miR-3236	MIMAT0015419	unmapped	CGCTCGGGTTTTCCCGAGCGGTACAAACAAAATGACTTGTTTATTTTTTTTT
A_38_P00021495	A_38_P00021495	mir|bmo-miR-3362|mir|MIMAT0015548	bmo-miR-3362	MIMAT0015548	unmapped	CGCTCGGGTTTTCCCGAGCGGTACAACATTCATAAACTTCATTTTTTTTTT
A_38_P00021496	A_38_P00021496	mir|bmo-miR-3362|mir|MIMAT0015548	bmo-miR-3362	MIMAT0015548	unmapped	CGCTCGGGTTTTCCCGAGCGGTACAACATTCATAAACTTCAATATTTTTTTT
A_38_P00021497	A_38_P00021497	mir|bmo-miR-3362|mir|MIMAT0015548	bmo-miR-3362	MIMAT0015548	unmapped	CGCTCGGGTTTTCCCGAGCGGTACAACATTCATAAACTTCAAAATTTTTTTTT
A_38_P00021498	A_38_P00021498	mir|bmo-miR-3256|mir|MIMAT0015439	bmo-miR-3256	MIMAT0015439	unmapped	CGCTCGGGTTTTCCCGAGCGGTACAAGCGGAAATCAGATTTTTTTTTT
A_38_P00021499	A_38_P00021499	mir|bmo-miR-3256|mir|MIMAT0015439	bmo-miR-3256	MIMAT0015439	unmapped	CGCTCGGGTTTTCCCGAGCGGTACAAGCGGAAATCAGAGTTTTTTTTTT
A_38_P00021500	A_38_P00021500	mir|bmo-miR-3231|mir|MIMAT0015413	bmo-miR-3231	MIMAT0015413	unmapped	CGCTCGGGTTTTCCCGAGCGGTACAGATATATTTCAGTAAGGTTTTTTTTTTT
A_38_P00021501	A_38_P00021501	mir|bmo-miR-3231|mir|MIMAT0015413	bmo-miR-3231	MIMAT0015413	unmapped	CGCTCGGGTTTTCCCGAGCGGTACAGATATATTTCAGTAAGGTGTTTTTTTTTT
A_38_P00021502	A_38_P00021502	mir|bmo-miR-970-5p|mir|MIMAT0015294|mir|bmo-miR-970*_v18.0|mir|MIMAT0015294	bmo-miR-970-5p	MIMAT0015294	unmapped	CGCTCGGGTTTTCCCGAGCGGTACCAATAAGAGCACACTTTTTTTTTT
A_38_P00021503	A_38_P00021503	mir|bmo-miR-970-5p|mir|MIMAT0015294|mir|bmo-miR-970*_v18.0|mir|MIMAT0015294	bmo-miR-970-5p	MIMAT0015294	unmapped	CGCTCGGGTTTTCCCGAGCGGTACCAATAAGAGCACACGTTTTTTTTTT
A_38_P00021504	A_38_P00021504	mir|bmo-miR-2762|mir|MIMAT0013636	bmo-miR-2762	MIMAT0013636	unmapped	CGCTCGGGTTTTCCCGAGCGGTACCGTACATTTCCCGTTTTTTTTTT
A_38_P00021505	A_38_P00021505	mir|bmo-miR-2762|mir|MIMAT0013636	bmo-miR-2762	MIMAT0013636	unmapped	CGCTCGGGTTTTCCCGAGCGGTACCGTACATTTCCCGATTTTTTTTTT
A_38_P00021506	A_38_P00021506	mir|bmo-miR-2860|mir|MIMAT0013800	bmo-miR-2860	MIMAT0013800	unmapped	CGCTCGGGTTTTCCCGAGCGGTACCTCGGACAATCATATTTTTTTTTT
A_38_P00021507	A_38_P00021507	mir|bmo-miR-2860|mir|MIMAT0013800	bmo-miR-2860	MIMAT0013800	unmapped	CGCTCGGGTTTTCCCGAGCGGTACCTCGGACAATCATACTTTTTTTTTT
A_38_P00021508	A_38_P00021508	mir|bmo-miR-3243|mir|MIMAT0015425	bmo-miR-3243	MIMAT0015425	unmapped	CGCTCGGGTTTTCCCGAGCGGTACGAACGACTGGAAATTTTTTTTT
A_38_P00021509	A_38_P00021509	mir|bmo-miR-3243|mir|MIMAT0015425	bmo-miR-3243	MIMAT0015425	unmapped	CGCTCGGGTTTTCCCGAGCGGTACGAACGACTGGAATTATTTTTTTT
A_38_P00021510	A_38_P00021510	mir|bmo-miR-3243|mir|MIMAT0015425	bmo-miR-3243	MIMAT0015425	unmapped	CGCTCGGGTTTTCCCGAGCGGTACGAACGACTGGAATGAATTTTTTTT
A_38_P00021511	A_38_P00021511	mir|bmo-miR-3415|mir|MIMAT0015622	bmo-miR-3415	MIMAT0015622	unmapped	CGCTCGGGTTTTCCCGAGCGGTACGACTGAGAAACAGTTTTTTTTTTT
A_38_P00021512	A_38_P00021512	mir|bmo-miR-3415|mir|MIMAT0015622	bmo-miR-3415	MIMAT0015622	unmapped	CGCTCGGGTTTTCCCGAGCGGTACGACTGAGAAACAGTGTTTTTTTTTT
A_38_P00021513	A_38_P00021513	mir|bmo-miR-2845|mir|MIMAT0013766	bmo-miR-2845	MIMAT0013766	unmapped	CGCTCGGGTTTTCCCGAGCGGTACGCACAGCAGCTTTTTTTTTTT
A_38_P00021514	A_38_P00021514	mir|bmo-miR-2845|mir|MIMAT0013766	bmo-miR-2845	MIMAT0013766	unmapped	CGCTCGGGTTTTCCCGAGCGGTACGCACAGCAGCTGTTTTTTTTTT
A_38_P00021515	A_38_P00021515	mir|bmo-miR-3244|mir|MIMAT0015426	bmo-miR-3244	MIMAT0015426	unmapped	CGCTCGGGTTTTCCCGAGCGGTAGAAAGATTCCATCGTCTTTTTTTTTT
A_38_P00021516	A_38_P00021516	mir|bmo-miR-3244|mir|MIMAT0015426	bmo-miR-3244	MIMAT0015426	unmapped	CGCTCGGGTTTTCCCGAGCGGTAGAAAGATTCCATCGTCATTTTTTTTTT
A_38_P00021517	A_38_P00021517	mir|bmo-miR-3293|mir|MIMAT0015480	bmo-miR-3293	MIMAT0015480	unmapped	CGCTCGGGTTTTCCCGAGCGGTAGAAATCTATTTTTCACGTTTTTTTTTTT
A_38_P00021518	A_38_P00021518	mir|bmo-miR-3293|mir|MIMAT0015480	bmo-miR-3293	MIMAT0015480	unmapped	CGCTCGGGTTTTCCCGAGCGGTAGAAATCTATTTTTCACGTATTTTTTTTTT
A_38_P00021519	A_38_P00021519	mir|bmo-miR-3293|mir|MIMAT0015480	bmo-miR-3293	MIMAT0015480	unmapped	CGCTCGGGTTTTCCCGAGCGGTAGAAATCTATTTTTCACGTACTTTTTTTTTT
A_38_P00021520	A_38_P00021520	mir|bmo-miR-3299|mir|MIMAT0015488	bmo-miR-3299	MIMAT0015488	unmapped	CGCTCGGGTTTTCCCGAGCGGTAGACTACAGACTTTAACAAATTTTTTTTT
A_38_P00021521	A_38_P00021521	mir|bmo-miR-3299|mir|MIMAT0015488	bmo-miR-3299	MIMAT0015488	unmapped	CGCTCGGGTTTTCCCGAGCGGTAGACTACAGACTTTAACAATTTTTTTTTTT
A_38_P00021522	A_38_P00021522	mir|bmo-miR-3299|mir|MIMAT0015488	bmo-miR-3299	MIMAT0015488	unmapped	CGCTCGGGTTTTCCCGAGCGGTAGACTACAGACTTTAACAATGTTTTTTTTTT
A_38_P00021523	A_38_P00021523	mir|bmo-miR-3405|mir|MIMAT0015610	bmo-miR-3405	MIMAT0015610	unmapped	CGCTCGGGTTTTCCCGAGCGGTAGAGAGTTTCAAGAACACTTTTTTTTTT
A_38_P00021524	A_38_P00021524	mir|bmo-miR-3405|mir|MIMAT0015610	bmo-miR-3405	MIMAT0015610	unmapped	CGCTCGGGTTTTCCCGAGCGGTAGAGAGTTTCAAGAACACATATTTTTTTT
A_38_P00021525	A_38_P00021525	mir|bmo-miR-7-3p|mir|MIMAT0015223|mir|bmo-miR-7*_v18.0|mir|MIMAT0015223	bmo-miR-7-3p	MIMAT0015223	unmapped	CGCTCGGGTTTTCCCGAGCGGTAGGCAGATTAGTGATTTCAATTTTTTTT
A_38_P00021526	A_38_P00021526	mir|bmo-miR-7-3p|mir|MIMAT0015223|mir|bmo-miR-7*_v18.0|mir|MIMAT0015223	bmo-miR-7-3p	MIMAT0015223	unmapped	CGCTCGGGTTTTCCCGAGCGGTAGGCAGATTAGTGATTTCTATTTTTTTTT
A_38_P00021527	A_38_P00021527	mir|bmo-miR-3414-3p|mir|MIMAT0015621|mir|bmo-miR-3414*_v18.0|mir|MIMAT0015621	bmo-miR-3414-3p	MIMAT0015621	unmapped	CGCTCGGGTTTTCCCGAGCGGTAGGTTGACATCGAACATTTTTTTTTT
A_38_P00021528	A_38_P00021528	mir|bmo-miR-3414-3p|mir|MIMAT0015621|mir|bmo-miR-3414*_v18.0|mir|MIMAT0015621	bmo-miR-3414-3p	MIMAT0015621	unmapped	CGCTCGGGTTTTCCCGAGCGGTAGGTTGACATCGAACAATTTTTTTTTT
A_38_P00021529	A_38_P00021529	mir|bmo-miR-3366|mir|MIMAT0015552	bmo-miR-3366	MIMAT0015552	unmapped	CGCTCGGGTTTTCCCGAGCGGTAGTACCAACCACCCTATTTTTTTTT
A_38_P00021530	A_38_P00021530	mir|bmo-miR-3366|mir|MIMAT0015552	bmo-miR-3366	MIMAT0015552	unmapped	CGCTCGGGTTTTCCCGAGCGGTAGTACCAACCACCCTTTTTTTTTTTT
A_38_P00021531	A_38_P00021531	mir|bmo-miR-3268-5p|mir|MIMAT0015452|mir|bmo-miR-3268_v18.0|mir|MIMAT0015452	bmo-miR-3268-5p	MIMAT0015452	unmapped	CGCTCGGGTTTTCCCGAGCGGTAGTCTACTAATGAATCATACTATTTTTTTTT
A_38_P00021532	A_38_P00021532	mir|bmo-miR-3268-5p|mir|MIMAT0015452|mir|bmo-miR-3268_v18.0|mir|MIMAT0015452	bmo-miR-3268-5p	MIMAT0015452	unmapped	CGCTCGGGTTTTCCCGAGCGGTAGTCTACTAATGAATCATACTTTTTTTTTTTT
A_38_P00021533	A_38_P00021533	mir|bmo-miR-3268-5p|mir|MIMAT0015452|mir|bmo-miR-3268_v18.0|mir|MIMAT0015452	bmo-miR-3268-5p	MIMAT0015452	unmapped	CGCTCGGGTTTTCCCGAGCGGTAGTCTACTAATGAATCATACTTCTTTTTTTTTT
A_38_P00021534	A_38_P00021534	mir|bmo-miR-3000|mir|MIMAT0014664	bmo-miR-3000	MIMAT0014664	unmapped	CGCTCGGGTTTTCCCGAGCGGTAGTGTCTTCATCTAAGCTTTTTTTTTT
A_38_P00021535	A_38_P00021535	mir|bmo-miR-3000|mir|MIMAT0014664	bmo-miR-3000	MIMAT0014664	unmapped	CGCTCGGGTTTTCCCGAGCGGTAGTGTCTTCATCTAAGCGTTTTTTTTTT
A_38_P00021536	A_38_P00021536	mir|bmo-miR-3350|mir|MIMAT0015535	bmo-miR-3350	MIMAT0015535	unmapped	CGCTCGGGTTTTCCCGAGCGGTATAAAGAAAAATTAGAATACATGTTTTTTTTTT
A_38_P00021537	A_38_P00021537	mir|bmo-miR-3350|mir|MIMAT0015535	bmo-miR-3350	MIMAT0015535	unmapped	CGCTCGGGTTTTCCCGAGCGGTATAAAGAAAAATTAGAATACATGATTTTTTTTTT
A_38_P00021538	A_38_P00021538	mir|bmo-miR-2847|mir|MIMAT0013768	bmo-miR-2847	MIMAT0013768	unmapped	CGCTCGGGTTTTCCCGAGCGGTATACCGCACTGACAATTTTTTTTTT
A_38_P00021539	A_38_P00021539	mir|bmo-miR-2847|mir|MIMAT0013768	bmo-miR-2847	MIMAT0013768	unmapped	CGCTCGGGTTTTCCCGAGCGGTATACCGCACTGACAAATTTTTTTTTT
A_38_P00021540	A_38_P00021540	mir|bmo-miR-2847|mir|MIMAT0013768	bmo-miR-2847	MIMAT0013768	unmapped	CGCTCGGGTTTTCCCGAGCGGTATACCGCACTGACAAACTTTTTTTTTT
A_38_P00021541	A_38_P00021541	mir|bmo-miR-2733j|mir|MIMAT0015539	bmo-miR-2733j	MIMAT0015539	unmapped	CGCTCGGGTTTTCCCGAGCGGTATCAACTGAGAGTATGATGTTTTTTTTTT
A_38_P00021542	A_38_P00021542	mir|bmo-miR-2733j|mir|MIMAT0015539	bmo-miR-2733j	MIMAT0015539	unmapped	CGCTCGGGTTTTCCCGAGCGGTATCAACTGAGAGTATGATGATATTTTTTTT
A_38_P00021543	A_38_P00021543	mir|bmo-miR-2733a-3p|mir|MIMAT0015593|mir|bmo-miR-2733a*_v18.0|mir|MIMAT0015593	bmo-miR-2733a-3p	MIMAT0015593	unmapped	CGCTCGGGTTTTCCCGAGCGGTATCAACTGAGAGTGTGAATTTTTTTTT
A_38_P00021544	A_38_P00021544	mir|bmo-miR-2733a-3p|mir|MIMAT0015593|mir|bmo-miR-2733a*_v18.0|mir|MIMAT0015593	bmo-miR-2733a-3p	MIMAT0015593	unmapped	CGCTCGGGTTTTCCCGAGCGGTATCAACTGAGAGTGTGATTTTTTTTTTT
A_38_P00021545	A_38_P00021545	mir|bmo-miR-3377-5p|mir|MIMAT0015567|mir|bmo-miR-3377_v18.0|mir|MIMAT0015567	bmo-miR-3377-5p	MIMAT0015567	unmapped	CGCTCGGGTTTTCCCGAGCGGTATCCTGACTTCATAACTTCTTTTTTTTTT
A_38_P00021546	A_38_P00021546	mir|bmo-miR-3377-5p|mir|MIMAT0015567|mir|bmo-miR-3377_v18.0|mir|MIMAT0015567	bmo-miR-3377-5p	MIMAT0015567	unmapped	CGCTCGGGTTTTCCCGAGCGGTATCCTGACTTCATAACTTCATTTTTTTTTT
A_38_P00021547	A_38_P00021547	mir|bmo-miR-2a-1-5p|mir|MIMAT0015271|mir|bmo-miR-2a-1*_v18.0|mir|MIMAT0015271	bmo-miR-2a-1-5p	MIMAT0015271	unmapped	CGCTCGGGTTTTCCCGAGCGGTATGACAAACCGACTTTTTTTTTTTTT
A_38_P00021548	A_38_P00021548	mir|bmo-miR-2a-1-5p|mir|MIMAT0015271|mir|bmo-miR-2a-1*_v18.0|mir|MIMAT0015271	bmo-miR-2a-1-5p	MIMAT0015271	unmapped	CGCTCGGGTTTTCCCGAGCGGTATGACAAACCGACTTTGTATTTTTTTT
A_38_P00021549	A_38_P00021549	mir|bmo-miR-1b-5p|mir|MIMAT0013787|mir|bmo-miR-1-as*_v16.0|mir|MIMAT0013787|mir|bmo-miR-1b*_v18.0|mir|MIMAT0013787	bmo-miR-1b-5p	MIMAT0013787	unmapped	CGCTCGGGTTTTCCCGAGCGGTATGGAATGTAAAGAAGTATGTTTTTTTTTT
A_38_P00021550	A_38_P00021550	mir|bmo-miR-1b-5p|mir|MIMAT0013787|mir|bmo-miR-1-as*_v16.0|mir|MIMAT0013787|mir|bmo-miR-1b*_v18.0|mir|MIMAT0013787	bmo-miR-1b-5p	MIMAT0013787	unmapped	CGCTCGGGTTTTCCCGAGCGGTATGGAATGTAAAGAAGTATGGTTTTTTTTTT
A_38_P00021551	A_38_P00021551	mir|bmo-miR-2820|mir|MIMAT0013730	bmo-miR-2820	MIMAT0013730	unmapped	CGCTCGGGTTTTCCCGAGCGGTATTCACGTTCCATCTTGTATTTTTTTT
A_38_P00021552	A_38_P00021552	mir|bmo-miR-2820|mir|MIMAT0013730	bmo-miR-2820	MIMAT0013730	unmapped	CGCTCGGGTTTTCCCGAGCGGTATTCACGTTCCATCTTGCATTTTTTTTT
A_38_P00021553	A_38_P00021553	mir|bmo-miR-3375-3p|mir|MIMAT0015566|mir|bmo-miR-3375_v18.0|mir|MIMAT0015566	bmo-miR-3375-3p	MIMAT0015566	unmapped	CGCTCGGGTTTTCCCGAGCGGTATTCCAAACTTTTCAAAGAATTTTTTTTT
A_38_P00021554	A_38_P00021554	mir|bmo-miR-3375-3p|mir|MIMAT0015566|mir|bmo-miR-3375_v18.0|mir|MIMAT0015566	bmo-miR-3375-3p	MIMAT0015566	unmapped	CGCTCGGGTTTTCCCGAGCGGTATTCCAAACTTTTCAAAGATTTTTTTTTTT
A_38_P00021555	A_38_P00021555	mir|bmo-miR-2786|mir|MIMAT0013682	bmo-miR-2786	MIMAT0013682	unmapped	CGCTCGGGTTTTCCCGAGCGGTATTCCTTCGCCTGCTATTTTTTTT
A_38_P00021556	A_38_P00021556	mir|bmo-miR-2786|mir|MIMAT0013682	bmo-miR-2786	MIMAT0013682	unmapped	CGCTCGGGTTTTCCCGAGCGGTATTCCTTCGCCTGCAATTTTTTTTT
A_38_P00021557	A_38_P00021557	mir|bmo-miR-3326|mir|MIMAT0015513	bmo-miR-3326	MIMAT0015513	unmapped	CGCTCGGGTTTTCCCGAGCGGTATTTCACAAGAACCACATTTTTTTTTT
A_38_P00021558	A_38_P00021558	mir|bmo-miR-3326|mir|MIMAT0015513	bmo-miR-3326	MIMAT0015513	unmapped	CGCTCGGGTTTTCCCGAGCGGTATTTCACAAGAACCACAATTTTTTTTTT
A_38_P00021559	A_38_P00021559	mir|bmo-miR-3001|mir|MIMAT0014665	bmo-miR-3001	MIMAT0014665	unmapped	CGCTCGGGTTTTCCCGAGCGGTCAAAATCTACAATTCTTTCATTTTTTTTTT
A_38_P00021560	A_38_P00021560	mir|bmo-miR-3001|mir|MIMAT0014665	bmo-miR-3001	MIMAT0014665	unmapped	CGCTCGGGTTTTCCCGAGCGGTCAAAATCTACAATTCTTTCAATATTTTTTTT
A_38_P00021561	A_38_P00021561	mir|bmo-miR-3267b|mir|MIMAT0015467	bmo-miR-3267b	MIMAT0015467	unmapped	CGCTCGGGTTTTCCCGAGCGGTCAAAATGAATAGACGAGTATTTTTTTT
A_38_P00021562	A_38_P00021562	mir|bmo-miR-3267b|mir|MIMAT0015467	bmo-miR-3267b	MIMAT0015467	unmapped	CGCTCGGGTTTTCCCGAGCGGTCAAAATGAATAGACGAGCATTTTTTTTT
A_38_P00021563	A_38_P00021563	mir|bmo-miR-2831|mir|MIMAT0013744	bmo-miR-2831	MIMAT0013744	unmapped	CGCTCGGGTTTTCCCGAGCGGTCAAACAAATGCTTTGTTATTTTTTTTT
A_38_P00021564	A_38_P00021564	mir|bmo-miR-2831|mir|MIMAT0013744	bmo-miR-2831	MIMAT0013744	unmapped	CGCTCGGGTTTTCCCGAGCGGTCAAACAAATGCTTTGTTTTATTTTTTTT
A_38_P00021565	A_38_P00021565	mir|bmo-miR-929-3p|mir|MIMAT0015289|mir|bmo-miR-929*_v18.0|mir|MIMAT0015289	bmo-miR-929-3p	MIMAT0015289	unmapped	CGCTCGGGTTTTCCCGAGCGGTCAACCTGACTCGATTTTTTTTTTTT
A_38_P00021566	A_38_P00021566	mir|bmo-miR-929-3p|mir|MIMAT0015289|mir|bmo-miR-929*_v18.0|mir|MIMAT0015289	bmo-miR-929-3p	MIMAT0015289	unmapped	CGCTCGGGTTTTCCCGAGCGGTCAACCTGACTCGATTATTTTTTTTTT
A_38_P00021567	A_38_P00021567	mir|bmo-miR-929-3p|mir|MIMAT0015289|mir|bmo-miR-929*_v18.0|mir|MIMAT0015289	bmo-miR-929-3p	MIMAT0015289	unmapped	CGCTCGGGTTTTCCCGAGCGGTCAACCTGACTCGATTAGTTTTTTTTTT
A_38_P00021568	A_38_P00021568	mir|bmo-miR-3394|mir|MIMAT0015598	bmo-miR-3394	MIMAT0015598	unmapped	CGCTCGGGTTTTCCCGAGCGGTCAAGGCACCCGGTTTTTTTTTT
A_38_P00021569	A_38_P00021569	mir|bmo-miR-3394|mir|MIMAT0015598	bmo-miR-3394	MIMAT0015598	unmapped	CGCTCGGGTTTTCCCGAGCGGTCAAGGCACCCGGATTTTTTTTTT
A_38_P00021570	A_38_P00021570	mir|bmo-miR-279b-3p|mir|MIMAT0013609|mir|bmo-miR-279b_v18.0|mir|MIMAT0013609	bmo-miR-279b-3p	MIMAT0013609	unmapped	CGCTCGGGTTTTCCCGAGCGGTCAATGAGTGTAGATCTAGTTTTTTTTTTT
A_38_P00021571	A_38_P00021571	mir|bmo-miR-279b-3p|mir|MIMAT0013609|mir|bmo-miR-279b_v18.0|mir|MIMAT0013609	bmo-miR-279b-3p	MIMAT0013609	unmapped	CGCTCGGGTTTTCCCGAGCGGTCAATGAGTGTAGATCTAGTCTTTTTTTTTT
A_38_P00021572	A_38_P00021572	mir|bmo-miR-2821|mir|MIMAT0013731	bmo-miR-2821	MIMAT0013731	unmapped	CGCTCGGGTTTTCCCGAGCGGTCACCGGTGCCCATTTTTTTTT
A_38_P00021573	A_38_P00021573	mir|bmo-miR-2821|mir|MIMAT0013731	bmo-miR-2821	MIMAT0013731	unmapped	CGCTCGGGTTTTCCCGAGCGGTCACCGGTGCCCTTTTTTTTTTT
A_38_P00021574	A_38_P00021574	mir|bmo-miR-3401|mir|MIMAT0015605	bmo-miR-3401	MIMAT0015605	unmapped	CGCTCGGGTTTTCCCGAGCGGTCACGAACGATTTACACATTTTTTTTT
A_38_P00021575	A_38_P00021575	mir|bmo-miR-3401|mir|MIMAT0015605	bmo-miR-3401	MIMAT0015605	unmapped	CGCTCGGGTTTTCCCGAGCGGTCACGAACGATTTACACTTATTTTTTTT
A_38_P00021576	A_38_P00021576	mir|bmo-miR-79-5p|mir|MIMAT0015275|mir|bmo-miR-79*_v18.0|mir|MIMAT0015275	bmo-miR-79-5p	MIMAT0015275	unmapped	CGCTCGGGTTTTCCCGAGCGGTCACGGAGCTAAATCGTTTTTTTTTT
A_38_P00021577	A_38_P00021577	mir|bmo-miR-79-5p|mir|MIMAT0015275|mir|bmo-miR-79*_v18.0|mir|MIMAT0015275	bmo-miR-79-5p	MIMAT0015275	unmapped	CGCTCGGGTTTTCCCGAGCGGTCACGGAGCTAAATCGCTTTTTTTTTT
A_38_P00021578	A_38_P00021578	mir|bmo-miR-3426|mir|MIMAT0015634	bmo-miR-3426	MIMAT0015634	unmapped	CGCTCGGGTTTTCCCGAGCGGTCACTCAACATATGCACTATTTTTTTT
A_38_P00021579	A_38_P00021579	mir|bmo-miR-3426|mir|MIMAT0015634	bmo-miR-3426	MIMAT0015634	unmapped	CGCTCGGGTTTTCCCGAGCGGTCACTCAACATATGCACAATTTTTTTTT
A_38_P00021580	A_38_P00021580	mir|bmo-miR-3266|mir|MIMAT0015450	bmo-miR-3266	MIMAT0015450	unmapped	CGCTCGGGTTTTCCCGAGCGGTCACTTCCCAATGTAACAATTTTTTTT
A_38_P00021581	A_38_P00021581	mir|bmo-miR-3266|mir|MIMAT0015450	bmo-miR-3266	MIMAT0015450	unmapped	CGCTCGGGTTTTCCCGAGCGGTCACTTCCCAATGTAACTATTTTTTTTT
A_38_P00021582	A_38_P00021582	mir|bmo-miR-306b|mir|MIMAT0013782|mir|bmo-miR-306-as_v16.0|mir|MIMAT0013782	bmo-miR-306b	MIMAT0013782	unmapped	CGCTCGGGTTTTCCCGAGCGGTCAGAGCCGCCTCTATTTTTTTT
A_38_P00021583	A_38_P00021583	mir|bmo-miR-306b|mir|MIMAT0013782|mir|bmo-miR-306-as_v16.0|mir|MIMAT0013782	bmo-miR-306b	MIMAT0013782	unmapped	CGCTCGGGTTTTCCCGAGCGGTCAGAGCCGCCTCGATTTTTTTTT
A_38_P00021584	A_38_P00021584	mir|bmo-miR-3294|mir|MIMAT0015481	bmo-miR-3294	MIMAT0015481	unmapped	CGCTCGGGTTTTCCCGAGCGGTCAGGTTAGATACTGTCTTATTTTTTTT
A_38_P00021585	A_38_P00021585	mir|bmo-miR-3294|mir|MIMAT0015481	bmo-miR-3294	MIMAT0015481	unmapped	CGCTCGGGTTTTCCCGAGCGGTCAGGTTAGATACTGTCTGATTTTTTTTT
A_38_P00021586	A_38_P00021586	mir|bmo-miR-3388-3p|mir|MIMAT0015588|mir|bmo-miR-3388_v18.0|mir|MIMAT0015588	bmo-miR-3388-3p	MIMAT0015588	unmapped	CGCTCGGGTTTTCCCGAGCGGTCAGTCATCCAGGTCTTTTTTTTTT
A_38_P00021587	A_38_P00021587	mir|bmo-miR-3388-3p|mir|MIMAT0015588|mir|bmo-miR-3388_v18.0|mir|MIMAT0015588	bmo-miR-3388-3p	MIMAT0015588	unmapped	CGCTCGGGTTTTCCCGAGCGGTCAGTCATCCAGGTCCTTTTTTTTTT
A_38_P00021588	A_38_P00021588	mir|bmo-miR-2733i-5p|mir|MIMAT0015591|mir|bmo-miR-2733i*_v18.0|mir|MIMAT0015591	bmo-miR-2733i-5p	MIMAT0015591	unmapped	CGCTCGGGTTTTCCCGAGCGGTCATCTGAGGAAGTAACATTTTTTTTTT
A_38_P00021589	A_38_P00021589	mir|bmo-miR-2733i-5p|mir|MIMAT0015591|mir|bmo-miR-2733i*_v18.0|mir|MIMAT0015591	bmo-miR-2733i-5p	MIMAT0015591	unmapped	CGCTCGGGTTTTCCCGAGCGGTCATCTGAGGAAGTAACAATATTTTTTTT
A_38_P00021590	A_38_P00021590	mir|bmo-miR-3372-3p|mir|MIMAT0015560|mir|bmo-miR-3372_v18.0|mir|MIMAT0015560	bmo-miR-3372-3p	MIMAT0015560	unmapped	CGCTCGGGTTTTCCCGAGCGGTCATTGCTTAAAATAGCTTGTTTTTTTTTT
A_38_P00021591	A_38_P00021591	mir|bmo-miR-3372-3p|mir|MIMAT0015560|mir|bmo-miR-3372_v18.0|mir|MIMAT0015560	bmo-miR-3372-3p	MIMAT0015560	unmapped	CGCTCGGGTTTTCCCGAGCGGTCATTGCTTAAAATAGCTTGGTTTTTTTTTT
A_38_P00021592	A_38_P00021592	mir|bmo-miR-3220|mir|MIMAT0015400	bmo-miR-3220	MIMAT0015400	unmapped	CGCTCGGGTTTTCCCGAGCGGTCCAAACCGTCACGTTTTTTTTTT
A_38_P00021593	A_38_P00021593	mir|bmo-miR-3220|mir|MIMAT0015400	bmo-miR-3220	MIMAT0015400	unmapped	CGCTCGGGTTTTCCCGAGCGGTCCAAACCGTCACGCTTTTTTTTTT
A_38_P00021594	A_38_P00021594	mir|bmo-miR-3228|mir|MIMAT0015410	bmo-miR-3228	MIMAT0015410	unmapped	CGCTCGGGTTTTCCCGAGCGGTCCAAGGACAGCAACTATTTTTTTT
A_38_P00021595	A_38_P00021595	mir|bmo-miR-3228|mir|MIMAT0015410	bmo-miR-3228	MIMAT0015410	unmapped	CGCTCGGGTTTTCCCGAGCGGTCCAAGGACAGCAACAAATTTTTTTT
A_38_P00021596	A_38_P00021596	mir|bmo-miR-2772b|mir|MIMAT0013653	bmo-miR-2772b	MIMAT0013653	unmapped	CGCTCGGGTTTTCCCGAGCGGTCCAGATCCAGAACTCTTTTTTTTTT
A_38_P00021597	A_38_P00021597	mir|bmo-miR-2772b|mir|MIMAT0013653	bmo-miR-2772b	MIMAT0013653	unmapped	CGCTCGGGTTTTCCCGAGCGGTCCAGATCCAGAACTCATTTTTTTTTT
A_38_P00021598	A_38_P00021598	mir|bmo-miR-2772a|mir|MIMAT0013656	bmo-miR-2772a	MIMAT0013656	unmapped	CGCTCGGGTTTTCCCGAGCGGTCCAGGTCCAGAACTTTTTTTTTTT
A_38_P00021599	A_38_P00021599	mir|bmo-miR-2772a|mir|MIMAT0013656	bmo-miR-2772a	MIMAT0013656	unmapped	CGCTCGGGTTTTCCCGAGCGGTCCAGGTCCAGAACTCTTTTTTTTTT
A_38_P00021600	A_38_P00021600	mir|bmo-miR-2761-3p|mir|MIMAT0013635|mir|bmo-miR-2761_v18.0|mir|MIMAT0013635	bmo-miR-2761-3p	MIMAT0013635	unmapped	CGCTCGGGTTTTCCCGAGCGGTCCATCGACGACGTATTTTTTTT
A_38_P00021601	A_38_P00021601	mir|bmo-miR-2761-3p|mir|MIMAT0013635|mir|bmo-miR-2761_v18.0|mir|MIMAT0013635	bmo-miR-2761-3p	MIMAT0013635	unmapped	CGCTCGGGTTTTCCCGAGCGGTCCATCGACGACGGAATTTTTTTT
A_38_P00021602	A_38_P00021602	mir|bmo-miR-2803|mir|MIMAT0013708	bmo-miR-2803	MIMAT0013708	unmapped	CGCTCGGGTTTTCCCGAGCGGTCCCTGGCATTGGTTTTTTTTTTT
A_38_P00021603	A_38_P00021603	mir|bmo-miR-2803|mir|MIMAT0013708	bmo-miR-2803	MIMAT0013708	unmapped	CGCTCGGGTTTTCCCGAGCGGTCCCTGGCATTGGTATTTTTTTTTT
A_38_P00021604	A_38_P00021604	mir|bmo-miR-2803|mir|MIMAT0013708	bmo-miR-2803	MIMAT0013708	unmapped	CGCTCGGGTTTTCCCGAGCGGTCCCTGGCATTGGTAATTTTTTTTTT
A_38_P00021605	A_38_P00021605	mir|bmo-miR-3229|mir|MIMAT0015411	bmo-miR-3229	MIMAT0015411	unmapped	CGCTCGGGTTTTCCCGAGCGGTCCGGTATCAAGGAAGTATTTTTTTT
A_38_P00021606	A_38_P00021606	mir|bmo-miR-3229|mir|MIMAT0015411	bmo-miR-3229	MIMAT0015411	unmapped	CGCTCGGGTTTTCCCGAGCGGTCCGGTATCAAGGAAGAATTTTTTTTT
A_38_P00021607	A_38_P00021607	mir|bmo-miR-2835|mir|MIMAT0013749	bmo-miR-2835	MIMAT0013749	unmapped	CGCTCGGGTTTTCCCGAGCGGTCCTAAAGCTCATAATGTGATTTTTTTTT
A_38_P00021608	A_38_P00021608	mir|bmo-miR-2835|mir|MIMAT0013749	bmo-miR-2835	MIMAT0013749	unmapped	CGCTCGGGTTTTCCCGAGCGGTCCTAAAGCTCATAATGTGTTTTTTTTTTT
A_38_P00021609	A_38_P00021609	mir|bmo-miR-3385-5p|mir|MIMAT0015581|mir|bmo-miR-3385*_v18.0|mir|MIMAT0015581	bmo-miR-3385-5p	MIMAT0015581	unmapped	CGCTCGGGTTTTCCCGAGCGGTCCTTTGAAGGTAAGGTAATTTTTTTT
A_38_P00021610	A_38_P00021610	mir|bmo-miR-3385-5p|mir|MIMAT0015581|mir|bmo-miR-3385*_v18.0|mir|MIMAT0015581	bmo-miR-3385-5p	MIMAT0015581	unmapped	CGCTCGGGTTTTCCCGAGCGGTCCTTTGAAGGTAAGGTTATTTTTTTTT
A_38_P00021611	A_38_P00021611	mir|bmo-miR-3392|mir|MIMAT0015596	bmo-miR-3392	MIMAT0015596	unmapped	CGCTCGGGTTTTCCCGAGCGGTCGAAGAAATCGACTGTTTTTTTTTT
A_38_P00021612	A_38_P00021612	mir|bmo-miR-3392|mir|MIMAT0015596	bmo-miR-3392	MIMAT0015596	unmapped	CGCTCGGGTTTTCCCGAGCGGTCGAAGAAATCGACTGATATTTTTTTT
A_38_P00021613	A_38_P00021613	mir|bmo-miR-2794|mir|MIMAT0013694	bmo-miR-2794	MIMAT0013694	unmapped	CGCTCGGGTTTTCCCGAGCGGTCGCTACGAAAAGTCTTTTTTTTTT
A_38_P00021614	A_38_P00021614	mir|bmo-miR-2794|mir|MIMAT0013694	bmo-miR-2794	MIMAT0013694	unmapped	CGCTCGGGTTTTCCCGAGCGGTCGCTACGAAAAGTCGTTTTTTTTTT
A_38_P00021617	A_38_P00021617	mir|bmo-miR-3330|mir|MIMAT0015518	bmo-miR-3330	MIMAT0015518	unmapped	CGCTCGGGTTTTCCCGAGCGGTCGTGGAGCGCTTATTTTTTTTT
A_38_P00021618	A_38_P00021618	mir|bmo-miR-3330|mir|MIMAT0015518	bmo-miR-3330	MIMAT0015518	unmapped	CGCTCGGGTTTTCCCGAGCGGTCGTGGAGCGCTTTTTTTTTTTTT
A_38_P00021619	A_38_P00021619	mir|bmo-miR-3221|mir|MIMAT0015401	bmo-miR-3221	MIMAT0015401	unmapped	CGCTCGGGTTTTCCCGAGCGGTCTAAAACGTCGGGTATTTTTTTT
A_38_P00021620	A_38_P00021620	mir|bmo-miR-3221|mir|MIMAT0015401	bmo-miR-3221	MIMAT0015401	unmapped	CGCTCGGGTTTTCCCGAGCGGTCTAAAACGTCGGGCAATTTTTTTT
A_38_P00021623	A_38_P00021623	mir|bmo-miR-3224|mir|MIMAT0015405	bmo-miR-3224	MIMAT0015405	unmapped	CGCTCGGGTTTTCCCGAGCGGTCTACCGCAAGAAGGTTTTTTTTTT
A_38_P00021624	A_38_P00021624	mir|bmo-miR-3224|mir|MIMAT0015405	bmo-miR-3224	MIMAT0015405	unmapped	CGCTCGGGTTTTCCCGAGCGGTCTACCGCAAGAAGGCTTTTTTTTTT
A_38_P00021625	A_38_P00021625	mir|bmo-miR-2851|mir|MIMAT0013783	bmo-miR-2851	MIMAT0013783	unmapped	CGCTCGGGTTTTCCCGAGCGGTCTCTCTAATACAGTCATCATTTTTTTTTT
A_38_P00021626	A_38_P00021626	mir|bmo-miR-2851|mir|MIMAT0013783	bmo-miR-2851	MIMAT0013783	unmapped	CGCTCGGGTTTTCCCGAGCGGTCTCTCTAATACAGTCATCACTTTTTTTTTT
A_38_P00021627	A_38_P00021627	mir|bmo-miR-3257-5p|mir|MIMAT0015440|mir|bmo-miR-3257*_v18.0|mir|MIMAT0015440	bmo-miR-3257-5p	MIMAT0015440	unmapped	CGCTCGGGTTTTCCCGAGCGGTCTGGTCACGGCATTTTTTTTTT
A_38_P00021628	A_38_P00021628	mir|bmo-miR-3257-5p|mir|MIMAT0015440|mir|bmo-miR-3257*_v18.0|mir|MIMAT0015440	bmo-miR-3257-5p	MIMAT0015440	unmapped	CGCTCGGGTTTTCCCGAGCGGTCTGGTCACGGCAATATTTTTTTT
A_38_P00021629	A_38_P00021629	mir|bmo-miR-3257-5p|mir|MIMAT0015440|mir|bmo-miR-3257*_v18.0|mir|MIMAT0015440	bmo-miR-3257-5p	MIMAT0015440	unmapped	CGCTCGGGTTTTCCCGAGCGGTCTGGTCACGGCAAAATTTTTTTTT
A_38_P00021630	A_38_P00021630	mir|bmo-miR-3223-5p|mir|MIMAT0015403|mir|bmo-miR-3223_v18.0|mir|MIMAT0015403	bmo-miR-3223-5p	MIMAT0015403	unmapped	CGCTCGGGTTTTCCCGAGCGGTCTGTGGTAAAGGTAAAATTTTTTTTTT
A_38_P00021631	A_38_P00021631	mir|bmo-miR-3223-5p|mir|MIMAT0015403|mir|bmo-miR-3223_v18.0|mir|MIMAT0015403	bmo-miR-3223-5p	MIMAT0015403	unmapped	CGCTCGGGTTTTCCCGAGCGGTCTGTGGTAAAGGTAAAAGTATTTTTTTT
A_38_P00021632	A_38_P00021632	mir|bmo-miR-3384-3p|mir|MIMAT0015580|mir|bmo-miR-3384_v18.0|mir|MIMAT0015580	bmo-miR-3384-3p	MIMAT0015580	unmapped	CGCTCGGGTTTTCCCGAGCGGTCTTCTACCAGCGCATTTTTTTTTT
A_38_P00021633	A_38_P00021633	mir|bmo-miR-3384-3p|mir|MIMAT0015580|mir|bmo-miR-3384_v18.0|mir|MIMAT0015580	bmo-miR-3384-3p	MIMAT0015580	unmapped	CGCTCGGGTTTTCCCGAGCGGTCTTCTACCAGCGCACTTTTTTTTTT
A_38_P00021634	A_38_P00021634	mir|bmo-miR-3262|mir|MIMAT0015446	bmo-miR-3262	MIMAT0015446	unmapped	CGCTCGGGTTTTCCCGAGCGGTCTTGACACTATTCCGATTTTTTTTTT
A_38_P00021635	A_38_P00021635	mir|bmo-miR-3262|mir|MIMAT0015446	bmo-miR-3262	MIMAT0015446	unmapped	CGCTCGGGTTTTCCCGAGCGGTCTTGACACTATTCCGAGTTTTTTTTTT
A_38_P00021636	A_38_P00021636	mir|bmo-miR-3369|mir|MIMAT0015555	bmo-miR-3369	MIMAT0015555	unmapped	CGCTCGGGTTTTCCCGAGCGGTGAAAACGATCTATCTGTATTTTTTTTTT
A_38_P00021637	A_38_P00021637	mir|bmo-miR-3369|mir|MIMAT0015555	bmo-miR-3369	MIMAT0015555	unmapped	CGCTCGGGTTTTCCCGAGCGGTGAAAACGATCTATCTGTAATATTTTTTTT
A_38_P00021638	A_38_P00021638	mir|bmo-miR-3369|mir|MIMAT0015555	bmo-miR-3369	MIMAT0015555	unmapped	CGCTCGGGTTTTCCCGAGCGGTGAAAACGATCTATCTGTAAGATTTTTTTTT
A_38_P00021639	A_38_P00021639	mir|bmo-miR-3335|mir|MIMAT0015522	bmo-miR-3335	MIMAT0015522	unmapped	CGCTCGGGTTTTCCCGAGCGGTGAAAGCGGTACGGTTTTTTTTTT
A_38_P00021640	A_38_P00021640	mir|bmo-miR-3335|mir|MIMAT0015522	bmo-miR-3335	MIMAT0015522	unmapped	CGCTCGGGTTTTCCCGAGCGGTGAAAGCGGTACGGATTTTTTTTTT
A_38_P00021641	A_38_P00021641	mir|bmo-miR-2807a|mir|MIMAT0013716	bmo-miR-2807a	MIMAT0013716	unmapped	CGCTCGGGTTTTCCCGAGCGGTGAAATTTGTATGCAGCTTTTTTTTTTT
A_38_P00021642	A_38_P00021642	mir|bmo-miR-2807a|mir|MIMAT0013716	bmo-miR-2807a	MIMAT0013716	unmapped	CGCTCGGGTTTTCCCGAGCGGTGAAATTTGTATGCAGCTGTTTTTTTTTT
A_38_P00021643	A_38_P00021643	mir|bmo-miR-279c-5p|mir|MIMAT0013610|mir|bmo-miR-279c*_v18.0|mir|MIMAT0013610	bmo-miR-279c-5p	MIMAT0013610	unmapped	CGCTCGGGTTTTCCCGAGCGGTGAACCAGAAGCAAACATTTTTTTTT
A_38_P00021644	A_38_P00021644	mir|bmo-miR-279c-5p|mir|MIMAT0013610|mir|bmo-miR-279c*_v18.0|mir|MIMAT0013610	bmo-miR-279c-5p	MIMAT0013610	unmapped	CGCTCGGGTTTTCCCGAGCGGTGAACCAGAAGCAAACTTTTTTTTTTT
A_38_P00021645	A_38_P00021645	mir|bmo-miR-1175-5p|mir|MIMAT0013612	bmo-miR-1175-5p	MIMAT0013612	unmapped	CGCTCGGGTTTTCCCGAGCGGTGAAGAGATCACACCTCTTTTTTTTTT
A_38_P00021646	A_38_P00021646	mir|bmo-miR-1175-5p|mir|MIMAT0013612	bmo-miR-1175-5p	MIMAT0013612	unmapped	CGCTCGGGTTTTCCCGAGCGGTGAAGAGATCACACCTCCTTTTTTTTTT
A_38_P00021647	A_38_P00021647	mir|bmo-miR-3332|mir|MIMAT0015519	bmo-miR-3332	MIMAT0015519	unmapped	CGCTCGGGTTTTCCCGAGCGGTGAAGCGGCGGTTTTTTTTTTT
A_38_P00021648	A_38_P00021648	mir|bmo-miR-3332|mir|MIMAT0015519	bmo-miR-3332	MIMAT0015519	unmapped	CGCTCGGGTTTTCCCGAGCGGTGAAGCGGCGGTGTTTTTTTTTT
A_38_P00021649	A_38_P00021649	mir|bmo-miR-2796-5p|mir|MIMAT0013696	bmo-miR-2796-5p	MIMAT0013696	unmapped	CGCTCGGGTTTTCCCGAGCGGTGAAGGCCGAAAGAATTTTTTTTTT
A_38_P00021650	A_38_P00021650	mir|bmo-miR-2796-5p|mir|MIMAT0013696	bmo-miR-2796-5p	MIMAT0013696	unmapped	CGCTCGGGTTTTCCCGAGCGGTGAAGGCCGAAAGAAATTTTTTTTTT
A_38_P00021651	A_38_P00021651	mir|bmo-miR-3270|mir|MIMAT0015455	bmo-miR-3270	MIMAT0015455	unmapped	CGCTCGGGTTTTCCCGAGCGGTGAATCGTTTTAGGAAAAATTTTTTTTTT
A_38_P00021652	A_38_P00021652	mir|bmo-miR-3270|mir|MIMAT0015455	bmo-miR-3270	MIMAT0015455	unmapped	CGCTCGGGTTTTCCCGAGCGGTGAATCGTTTTAGGAAAAAGTTTTTTTTTT
A_38_P00021653	A_38_P00021653	mir|bmo-miR-3388-5p|mir|MIMAT0015587|mir|bmo-miR-3388*_v18.0|mir|MIMAT0015587	bmo-miR-3388-5p	MIMAT0015587	unmapped	CGCTCGGGTTTTCCCGAGCGGTGAATGGGCCAAGGTTTTTTTTTT
A_38_P00021654	A_38_P00021654	mir|bmo-miR-3388-5p|mir|MIMAT0015587|mir|bmo-miR-3388*_v18.0|mir|MIMAT0015587	bmo-miR-3388-5p	MIMAT0015587	unmapped	CGCTCGGGTTTTCCCGAGCGGTGAATGGGCCAAGGCTATTTTTTTT
A_38_P00021655	A_38_P00021655	mir|bmo-miR-3396|mir|MIMAT0015600	bmo-miR-3396	MIMAT0015600	unmapped	CGCTCGGGTTTTCCCGAGCGGTGACGTCCGTGAAAATTTTTTTTT
A_38_P00021656	A_38_P00021656	mir|bmo-miR-3396|mir|MIMAT0015600	bmo-miR-3396	MIMAT0015600	unmapped	CGCTCGGGTTTTCCCGAGCGGTGACGTCCGTGAAATTTTTTTTTTT
A_38_P00021657	A_38_P00021657	mir|bmo-miR-3396|mir|MIMAT0015600	bmo-miR-3396	MIMAT0015600	unmapped	CGCTCGGGTTTTCCCGAGCGGTGACGTCCGTGAAATATTTTTTTTTT
A_38_P00021658	A_38_P00021658	mir|bmo-miR-3396|mir|MIMAT0015600	bmo-miR-3396	MIMAT0015600	unmapped	CGCTCGGGTTTTCCCGAGCGGTGACGTCCGTGAAATAGTTTTTTTTTT
A_38_P00021659	A_38_P00021659	mir|bmo-miR-3272|mir|MIMAT0015457	bmo-miR-3272	MIMAT0015457	unmapped	CGCTCGGGTTTTCCCGAGCGGTGACTCACATTTAGATAACTTATTTTTTTT
A_38_P00021660	A_38_P00021660	mir|bmo-miR-3272|mir|MIMAT0015457	bmo-miR-3272	MIMAT0015457	unmapped	CGCTCGGGTTTTCCCGAGCGGTGACTCACATTTAGATAACTGAATTTTTTTT
A_38_P00021661	A_38_P00021661	mir|bmo-miR-3355|mir|MIMAT0015541	bmo-miR-3355	MIMAT0015541	unmapped	CGCTCGGGTTTTCCCGAGCGGTGACTTGAACCTTTATAGTTATTTTTTTT
A_38_P00021662	A_38_P00021662	mir|bmo-miR-3355|mir|MIMAT0015541	bmo-miR-3355	MIMAT0015541	unmapped	CGCTCGGGTTTTCCCGAGCGGTGACTTGAACCTTTATAGTAAATTTTTTTT
A_38_P00021663	A_38_P00021663	mir|bmo-miR-3355|mir|MIMAT0015541	bmo-miR-3355	MIMAT0015541	unmapped	CGCTCGGGTTTTCCCGAGCGGTGACTTGAACCTTTATAGTATATTTTTTTTT
A_38_P00021664	A_38_P00021664	mir|bmo-miR-3355|mir|MIMAT0015541	bmo-miR-3355	MIMAT0015541	unmapped	CGCTCGGGTTTTCCCGAGCGGTGACTTGAACCTTTATAGTATTTTTTTTTTTT
A_38_P00021665	A_38_P00021665	mir|bmo-miR-3420|mir|MIMAT0015628	bmo-miR-3420	MIMAT0015628	unmapped	CGCTCGGGTTTTCCCGAGCGGTGAGCGAGGCCAGTTTTTTTTTT
A_38_P00021666	A_38_P00021666	mir|bmo-miR-3420|mir|MIMAT0015628	bmo-miR-3420	MIMAT0015628	unmapped	CGCTCGGGTTTTCCCGAGCGGTGAGCGAGGCCAGGTTTTTTTTTT
A_38_P00021667	A_38_P00021667	mir|bmo-miR-3268-3p|mir|MIMAT0015453|mir|bmo-miR-3268*_v18.0|mir|MIMAT0015453	bmo-miR-3268-3p	MIMAT0015453	unmapped	CGCTCGGGTTTTCCCGAGCGGTGAGTACCAATAATTCATCTTTTTTTTTT
A_38_P00021668	A_38_P00021668	mir|bmo-miR-3268-3p|mir|MIMAT0015453|mir|bmo-miR-3268*_v18.0|mir|MIMAT0015453	bmo-miR-3268-3p	MIMAT0015453	unmapped	CGCTCGGGTTTTCCCGAGCGGTGAGTACCAATAATTCATCGTTTTTTTTTT
A_38_P00021669	A_38_P00021669	mir|bmo-miR-3297-3p|mir|MIMAT0015486|mir|bmo-miR-3297*_v18.0|mir|MIMAT0015486	bmo-miR-3297-3p	MIMAT0015486	unmapped	CGCTCGGGTTTTCCCGAGCGGTGAGTCAGAAATATTGCAATTTTTTTTT
A_38_P00021670	A_38_P00021670	mir|bmo-miR-3297-3p|mir|MIMAT0015486|mir|bmo-miR-3297*_v18.0|mir|MIMAT0015486	bmo-miR-3297-3p	MIMAT0015486	unmapped	CGCTCGGGTTTTCCCGAGCGGTGAGTCAGAAATATTGCATTTTTTTTTTT
A_38_P00021671	A_38_P00021671	mir|bmo-miR-3297-3p|mir|MIMAT0015486|mir|bmo-miR-3297*_v18.0|mir|MIMAT0015486	bmo-miR-3297-3p	MIMAT0015486	unmapped	CGCTCGGGTTTTCCCGAGCGGTGAGTCAGAAATATTGCATATTTTTTTTTT
A_38_P00021672	A_38_P00021672	mir|bmo-miR-3297-3p|mir|MIMAT0015486|mir|bmo-miR-3297*_v18.0|mir|MIMAT0015486	bmo-miR-3297-3p	MIMAT0015486	unmapped	CGCTCGGGTTTTCCCGAGCGGTGAGTCAGAAATATTGCATAATATTTTTTTT
A_38_P00021673	A_38_P00021673	mir|bmo-miR-252-3p|mir|MIMAT0015293|mir|bmo-miR-252*_v18.0|mir|MIMAT0015293	bmo-miR-252-3p	MIMAT0015293	unmapped	CGCTCGGGTTTTCCCGAGCGGTGATAAGCACTTAGGCATTTTTTTTTT
A_38_P00021674	A_38_P00021674	mir|bmo-miR-252-3p|mir|MIMAT0015293|mir|bmo-miR-252*_v18.0|mir|MIMAT0015293	bmo-miR-252-3p	MIMAT0015293	unmapped	CGCTCGGGTTTTCCCGAGCGGTGATAAGCACTTAGGCAGTTTTTTTTTT
A_38_P00021675	A_38_P00021675	mir|bmo-miR-3308-3p|mir|MIMAT0015497|mir|bmo-miR-3308*_v18.0|mir|MIMAT0015497	bmo-miR-3308-3p	MIMAT0015497	unmapped	CGCTCGGGTTTTCCCGAGCGGTGATTTTGTCCCATTGTTTTTTTTTT
A_38_P00021676	A_38_P00021676	mir|bmo-miR-3308-3p|mir|MIMAT0015497|mir|bmo-miR-3308*_v18.0|mir|MIMAT0015497	bmo-miR-3308-3p	MIMAT0015497	unmapped	CGCTCGGGTTTTCCCGAGCGGTGATTTTGTCCCATTGCTATTTTTTTT
A_38_P00021677	A_38_P00021677	mir|bmo-miR-33-5p|mir|MIMAT0013599|mir|bmo-miR-33_v18.0|mir|MIMAT0013599	bmo-miR-33-5p	MIMAT0013599	unmapped	CGCTCGGGTTTTCCCGAGCGGTGCAATGCAACTACAATGCATTTTTTTTTT
A_38_P00021678	A_38_P00021678	mir|bmo-miR-33-5p|mir|MIMAT0013599|mir|bmo-miR-33_v18.0|mir|MIMAT0013599	bmo-miR-33-5p	MIMAT0013599	unmapped	CGCTCGGGTTTTCCCGAGCGGTGCAATGCAACTACAATGCACTTTTTTTTTT
A_38_P00021679	A_38_P00021679	mir|bmo-miR-2778a-5p|mir|MIMAT0013664|mir|bmo-miR-2778a*_v18.0|mir|MIMAT0013664|mir|bmo-miR-2778b*_v18.0|mir|MIMAT0013675|mir|bmo-miR-2778b-5p|mir|MIMAT0013675|mir|bmo-miR-2778c_v18.0|mir|MIMAT0013666	bmo-miR-2778a-5p	MIMAT0013664	unmapped	CGCTCGGGTTTTCCCGAGCGGTGCAGGATATGCAAAAATTTTTTTTTT
A_38_P00021680	A_38_P00021680	mir|bmo-miR-2778a-5p|mir|MIMAT0013664|mir|bmo-miR-2778a*_v18.0|mir|MIMAT0013664|mir|bmo-miR-2778b*_v18.0|mir|MIMAT0013675|mir|bmo-miR-2778b-5p|mir|MIMAT0013675|mir|bmo-miR-2778c_v18.0|mir|MIMAT0013666	bmo-miR-2778a-5p	MIMAT0013664	unmapped	CGCTCGGGTTTTCCCGAGCGGTGCAGGATATGCAAAAAATTTTTTTTTT
A_38_P00021681	A_38_P00021681	mir|bmo-miR-2778a-5p|mir|MIMAT0013664|mir|bmo-miR-2778a*_v18.0|mir|MIMAT0013664|mir|bmo-miR-2778b*_v18.0|mir|MIMAT0013675|mir|bmo-miR-2778b-5p|mir|MIMAT0013675|mir|bmo-miR-2778c_v18.0|mir|MIMAT0013666	bmo-miR-2778a-5p	MIMAT0013664	unmapped	CGCTCGGGTTTTCCCGAGCGGTGCAGGATATGCAAAAAAATTTTTTTTTT
A_38_P00021682	A_38_P00021682	mir|bmo-miR-2778a-4-5p|mir|MIMAT0015306|mir|bmo-miR-2778a-4*_v18.0|mir|MIMAT0015306	bmo-miR-2778a-4-5p	MIMAT0015306	unmapped	CGCTCGGGTTTTCCCGAGCGGTGCAGGATATGCAAAATATTTTTTTTTT
A_38_P00021683	A_38_P00021683	mir|bmo-miR-2778a-4-5p|mir|MIMAT0015306|mir|bmo-miR-2778a-4*_v18.0|mir|MIMAT0015306	bmo-miR-2778a-4-5p	MIMAT0015306	unmapped	CGCTCGGGTTTTCCCGAGCGGTGCAGGATATGCAAAATAATTTTTTTTTT
A_38_P00021684	A_38_P00021684	mir|bmo-miR-2778a-4-5p|mir|MIMAT0015306|mir|bmo-miR-2778a-4*_v18.0|mir|MIMAT0015306	bmo-miR-2778a-4-5p	MIMAT0015306	unmapped	CGCTCGGGTTTTCCCGAGCGGTGCAGGATATGCAAAATAACTTTTTTTTTT
A_38_P00021685	A_38_P00021685	mir|bmo-miR-3274|mir|MIMAT0015459	bmo-miR-3274	MIMAT0015459	unmapped	CGCTCGGGTTTTCCCGAGCGGTGCATGGAGACGCATTTTTTTTTT
A_38_P00021686	A_38_P00021686	mir|bmo-miR-3274|mir|MIMAT0015459	bmo-miR-3274	MIMAT0015459	unmapped	CGCTCGGGTTTTCCCGAGCGGTGCATGGAGACGCAATATTTTTTTT
A_38_P00021687	A_38_P00021687	mir|bmo-miR-2855|mir|MIMAT0013790	bmo-miR-2855	MIMAT0013790	unmapped	CGCTCGGGTTTTCCCGAGCGGTGCCAGCGATGCATTTTTTTTTT
A_38_P00021688	A_38_P00021688	mir|bmo-miR-2855|mir|MIMAT0013790	bmo-miR-2855	MIMAT0013790	unmapped	CGCTCGGGTTTTCCCGAGCGGTGCCAGCGATGCAATTTTTTTTTT
A_38_P00021689	A_38_P00021689	mir|bmo-miR-3311|mir|MIMAT0015500	bmo-miR-3311	MIMAT0015500	unmapped	CGCTCGGGTTTTCCCGAGCGGTGCGCCAGGTTGTTTTTTTTTT
A_38_P00021690	A_38_P00021690	mir|bmo-miR-3311|mir|MIMAT0015500	bmo-miR-3311	MIMAT0015500	unmapped	CGCTCGGGTTTTCCCGAGCGGTGCGCCAGGTTGGTTTTTTTTTT
A_38_P00021691	A_38_P00021691	mir|bmo-miR-2999|mir|MIMAT0014660	bmo-miR-2999	MIMAT0014660	unmapped	CGCTCGGGTTTTCCCGAGCGGTGCGCGTCTAGTCTTTTTTTTTT
A_38_P00021692	A_38_P00021692	mir|bmo-miR-2999|mir|MIMAT0014660	bmo-miR-2999	MIMAT0014660	unmapped	CGCTCGGGTTTTCCCGAGCGGTGCGCGTCTAGTCCTATTTTTTTT
A_38_P00021693	A_38_P00021693	mir|bmo-miR-3371|mir|MIMAT0015558	bmo-miR-3371	MIMAT0015558	unmapped	CGCTCGGGTTTTCCCGAGCGGTGCGTATATGTTGTTATTATGTTTTTTTTTT
A_38_P00021694	A_38_P00021694	mir|bmo-miR-3371|mir|MIMAT0015558	bmo-miR-3371	MIMAT0015558	unmapped	CGCTCGGGTTTTCCCGAGCGGTGCGTATATGTTGTTATTATGCTTTTTTTTTT
A_38_P00021695	A_38_P00021695	mir|bmo-miR-3406-5p|mir|MIMAT0015611|mir|bmo-miR-3406_v18.0|mir|MIMAT0015611	bmo-miR-3406-5p	MIMAT0015611	unmapped	CGCTCGGGTTTTCCCGAGCGGTGCTCATCAAACGTGTATTTTTTTT
A_38_P00021696	A_38_P00021696	mir|bmo-miR-3406-5p|mir|MIMAT0015611|mir|bmo-miR-3406_v18.0|mir|MIMAT0015611	bmo-miR-3406-5p	MIMAT0015611	unmapped	CGCTCGGGTTTTCCCGAGCGGTGCTCATCAAACGTGCATTTTTTTTT
A_38_P00021697	A_38_P00021697	mir|bmo-miR-3241|mir|MIMAT0015423	bmo-miR-3241	MIMAT0015423	unmapped	CGCTCGGGTTTTCCCGAGCGGTGCTTTGGTAAAGATCCAATTTTTTTT
A_38_P00021698	A_38_P00021698	mir|bmo-miR-3241|mir|MIMAT0015423	bmo-miR-3241	MIMAT0015423	unmapped	CGCTCGGGTTTTCCCGAGCGGTGCTTTGGTAAAGATCCTAATTTTTTTT
A_38_P00021699	A_38_P00021699	mir|bmo-miR-3321|mir|MIMAT0015508	bmo-miR-3321	MIMAT0015508	unmapped	CGCTCGGGTTTTCCCGAGCGGTGGAAGGCGATGCTATTTTTTTTT
A_38_P00021700	A_38_P00021700	mir|bmo-miR-3321|mir|MIMAT0015508	bmo-miR-3321	MIMAT0015508	unmapped	CGCTCGGGTTTTCCCGAGCGGTGGAAGGCGATGCTTTTTTTTTTTT
A_38_P00021701	A_38_P00021701	mir|bmo-miR-3409|mir|MIMAT0015615	bmo-miR-3409	MIMAT0015615	unmapped	CGCTCGGGTTTTCCCGAGCGGTGGCACTTGCGGATTTTTTTTTT
A_38_P00021702	A_38_P00021702	mir|bmo-miR-3409|mir|MIMAT0015615	bmo-miR-3409	MIMAT0015615	unmapped	CGCTCGGGTTTTCCCGAGCGGTGGCACTTGCGGAATTTTTTTTTT
A_38_P00021703	A_38_P00021703	mir|bmo-miR-3210|mir|MIMAT0015389	bmo-miR-3210	MIMAT0015389	unmapped	CGCTCGGGTTTTCCCGAGCGGTGGGTGAGCAGGGTTTTTTTTTT
A_38_P00021704	A_38_P00021704	mir|bmo-miR-3210|mir|MIMAT0015389	bmo-miR-3210	MIMAT0015389	unmapped	CGCTCGGGTTTTCCCGAGCGGTGGGTGAGCAGGGGTATTTTTTTT
A_38_P00021705	A_38_P00021705	mir|bmo-miR-2779|mir|MIMAT0013668	bmo-miR-2779	MIMAT0013668	unmapped	CGCTCGGGTTTTCCCGAGCGGTGGTCCTTCGAGCTTTTTTTTTT
A_38_P00021706	A_38_P00021706	mir|bmo-miR-2779|mir|MIMAT0013668	bmo-miR-2779	MIMAT0013668	unmapped	CGCTCGGGTTTTCCCGAGCGGTGGTCCTTCGAGCCTTTTTTTTTT
A_38_P00021707	A_38_P00021707	mir|bmo-miR-3325|mir|MIMAT0015512	bmo-miR-3325	MIMAT0015512	unmapped	CGCTCGGGTTTTCCCGAGCGGTGGTGTATTTGACTCATCTTTTTTTTTT
A_38_P00021708	A_38_P00021708	mir|bmo-miR-3325|mir|MIMAT0015512	bmo-miR-3325	MIMAT0015512	unmapped	CGCTCGGGTTTTCCCGAGCGGTGGTGTATTTGACTCATCATATTTTTTTT
A_38_P00021709	A_38_P00021709	mir|bmo-miR-2843-5p|mir|MIMAT0013762|mir|bmo-miR-2843_v18.0|mir|MIMAT0013762	bmo-miR-2843-5p	MIMAT0013762	unmapped	CGCTCGGGTTTTCCCGAGCGGTGTATCCGACCTAATTTCTATTTTTTTT
A_38_P00021710	A_38_P00021710	mir|bmo-miR-2843-5p|mir|MIMAT0013762|mir|bmo-miR-2843_v18.0|mir|MIMAT0013762	bmo-miR-2843-5p	MIMAT0013762	unmapped	CGCTCGGGTTTTCCCGAGCGGTGTATCCGACCTAATTTCCAATTTTTTTT
A_38_P00021711	A_38_P00021711	mir|bmo-miR-2761-5p|mir|MIMAT0013634|mir|bmo-miR-2761*_v18.0|mir|MIMAT0013634	bmo-miR-2761-5p	MIMAT0013634	unmapped	CGCTCGGGTTTTCCCGAGCGGTGTATGGAACCGTCTCTTTTTTTTTT
A_38_P00021712	A_38_P00021712	mir|bmo-miR-2761-5p|mir|MIMAT0013634|mir|bmo-miR-2761*_v18.0|mir|MIMAT0013634	bmo-miR-2761-5p	MIMAT0013634	unmapped	CGCTCGGGTTTTCCCGAGCGGTGTATGGAACCGTCTCGTATTTTTTTT
A_38_P00021713	A_38_P00021713	mir|bmo-bantam-5p|mir|MIMAT0015278|mir|bmo-bantam*_v18.0|mir|MIMAT0015278	bmo-bantam-5p	MIMAT0015278	unmapped	CGCTCGGGTTTTCCCGAGCGGTGTCAAATCATTATGAAAACTTTTTTTTTT
A_38_P00021714	A_38_P00021714	mir|bmo-bantam-5p|mir|MIMAT0015278|mir|bmo-bantam*_v18.0|mir|MIMAT0015278	bmo-bantam-5p	MIMAT0015278	unmapped	CGCTCGGGTTTTCCCGAGCGGTGTCAAATCATTATGAAAACCTTTTTTTTTT
A_38_P00021715	A_38_P00021715	mir|bmo-miR-750-5p|mir|MIMAT0013644|mir|bmo-miR-750*_v18.0|mir|MIMAT0013644	bmo-miR-750-5p	MIMAT0013644	unmapped	CGCTCGGGTTTTCCCGAGCGGTGTCAAGATCCCCTGATTTTTTTTT
A_38_P00021716	A_38_P00021716	mir|bmo-miR-750-5p|mir|MIMAT0013644|mir|bmo-miR-750*_v18.0|mir|MIMAT0013644	bmo-miR-750-5p	MIMAT0013644	unmapped	CGCTCGGGTTTTCCCGAGCGGTGTCAAGATCCCCTGTTTTTTTTTTT
A_38_P00021717	A_38_P00021717	mir|bmo-miR-2807c-5p|mir|MIMAT0013621|mir|bmo-miR-2807c_v18.0|mir|MIMAT0013621	bmo-miR-2807c-5p	MIMAT0013621	unmapped	CGCTCGGGTTTTCCCGAGCGGTGTCATATTTGTCGCATCTATTTTTTTT
A_38_P00021718	A_38_P00021718	mir|bmo-miR-2807c-5p|mir|MIMAT0013621|mir|bmo-miR-2807c_v18.0|mir|MIMAT0013621	bmo-miR-2807c-5p	MIMAT0013621	unmapped	CGCTCGGGTTTTCCCGAGCGGTGTCATATTTGTCGCATCGATTTTTTTTT
A_38_P00021719	A_38_P00021719	mir|bmo-miR-2792-5p|mir|MIMAT0013690	bmo-miR-2792-5p	MIMAT0013690	unmapped	CGCTCGGGTTTTCCCGAGCGGTGTTGATTAAAGAACGATACTTTTTTTTTT
A_38_P00021720	A_38_P00021720	mir|bmo-miR-2792-5p|mir|MIMAT0013690	bmo-miR-2792-5p	MIMAT0013690	unmapped	CGCTCGGGTTTTCCCGAGCGGTGTTGATTAAAGAACGATACCTTTTTTTTTT
A_38_P00021721	A_38_P00021721	mir|bmo-miR-3252|mir|MIMAT0015435	bmo-miR-3252	MIMAT0015435	unmapped	CGCTCGGGTTTTCCCGAGCGGTGTTTCAGATATTCGGAAAATTTTTTTT
A_38_P00021722	A_38_P00021722	mir|bmo-miR-3252|mir|MIMAT0015435	bmo-miR-3252	MIMAT0015435	unmapped	CGCTCGGGTTTTCCCGAGCGGTGTTTCAGATATTCGGAATATTTTTTTTT
A_38_P00021723	A_38_P00021723	mir|bmo-miR-3252|mir|MIMAT0015435	bmo-miR-3252	MIMAT0015435	unmapped	CGCTCGGGTTTTCCCGAGCGGTGTTTCAGATATTCGGAATTTATTTTTTTT
A_38_P00021724	A_38_P00021724	mir|bmo-miR-2808c|mir|MIMAT0013671	bmo-miR-2808c	MIMAT0013671	unmapped	CGCTCGGGTTTTCCCGAGCGGTGTTTCGCTGAATCTACTTTTTTTTTT
A_38_P00021725	A_38_P00021725	mir|bmo-miR-2808c|mir|MIMAT0013671	bmo-miR-2808c	MIMAT0013671	unmapped	CGCTCGGGTTTTCCCGAGCGGTGTTTCGCTGAATCTACCTTTTTTTTTT
A_38_P00021726	A_38_P00021726	mir|bmo-miR-3257-3p|mir|MIMAT0015441|mir|bmo-miR-3257_v18.0|mir|MIMAT0015441	bmo-miR-3257-3p	MIMAT0015441	unmapped	CGCTCGGGTTTTCCCGAGCGGTTAACGCGACGACTTTTTTTTTTT
A_38_P00021727	A_38_P00021727	mir|bmo-miR-3257-3p|mir|MIMAT0015441|mir|bmo-miR-3257_v18.0|mir|MIMAT0015441	bmo-miR-3257-3p	MIMAT0015441	unmapped	CGCTCGGGTTTTCCCGAGCGGTTAACGCGACGACTCTATTTTTTTT
A_38_P00021728	A_38_P00021728	mir|bmo-miR-2780b|mir|MIMAT0013732	bmo-miR-2780b	MIMAT0013732	unmapped	CGCTCGGGTTTTCCCGAGCGGTTAAGTCTTCATTTAACACCTATTTTTTTT
A_38_P00021729	A_38_P00021729	mir|bmo-miR-2780b|mir|MIMAT0013732	bmo-miR-2780b	MIMAT0013732	unmapped	CGCTCGGGTTTTCCCGAGCGGTTAAGTCTTCATTTAACACCCAATTTTTTTT
A_38_P00021730	A_38_P00021730	mir|bmo-miR-1175-3p|mir|MIMAT0013613	bmo-miR-1175-3p	MIMAT0013613	unmapped	CGCTCGGGTTTTCCCGAGCGGTTAAGTTGGAGGAGTTGTTTTTTTTTT
A_38_P00021731	A_38_P00021731	mir|bmo-miR-1175-3p|mir|MIMAT0013613	bmo-miR-1175-3p	MIMAT0013613	unmapped	CGCTCGGGTTTTCCCGAGCGGTTAAGTTGGAGGAGTTGATATTTTTTTT
A_38_P00021732	A_38_P00021732	mir|bmo-miR-3255|mir|MIMAT0015438	bmo-miR-3255	MIMAT0015438	unmapped	CGCTCGGGTTTTCCCGAGCGGTTAATTCACATCATATTATGGTTTTTTTTTT
A_38_P00021733	A_38_P00021733	mir|bmo-miR-3255|mir|MIMAT0015438	bmo-miR-3255	MIMAT0015438	unmapped	CGCTCGGGTTTTCCCGAGCGGTTAATTCACATCATATTATGGCTTTTTTTTTT
A_38_P00021734	A_38_P00021734	mir|bmo-miR-3410|mir|MIMAT0015616	bmo-miR-3410	MIMAT0015616	unmapped	CGCTCGGGTTTTCCCGAGCGGTTACACTCAATGTAGGATCAATTTTTTTT
A_38_P00021735	A_38_P00021735	mir|bmo-miR-3410|mir|MIMAT0015616	bmo-miR-3410	MIMAT0015616	unmapped	CGCTCGGGTTTTCCCGAGCGGTTACACTCAATGTAGGATCTAATTTTTTTT
A_38_P00021736	A_38_P00021736	mir|bmo-miR-927-3p|mir|MIMAT0015288|mir|bmo-miR-927*_v18.0|mir|MIMAT0015288	bmo-miR-927-3p	MIMAT0015288	unmapped	CGCTCGGGTTTTCCCGAGCGGTTAGAATCCAAACGCTTATTTTTTTTT
A_38_P00021737	A_38_P00021737	mir|bmo-miR-927-3p|mir|MIMAT0015288|mir|bmo-miR-927*_v18.0|mir|MIMAT0015288	bmo-miR-927-3p	MIMAT0015288	unmapped	CGCTCGGGTTTTCCCGAGCGGTTAGAATCCAAACGCTTTTTTTTTTTTT
A_38_P00021738	A_38_P00021738	mir|bmo-miR-927-3p|mir|MIMAT0015288|mir|bmo-miR-927*_v18.0|mir|MIMAT0015288	bmo-miR-927-3p	MIMAT0015288	unmapped	CGCTCGGGTTTTCCCGAGCGGTTAGAATCCAAACGCTTTGTTTTTTTTTT
A_38_P00021739	A_38_P00021739	mir|bmo-miR-2780a-3p|mir|MIMAT0013670|mir|bmo-miR-2780a*_v18.0|mir|MIMAT0013670	bmo-miR-2780a-3p	MIMAT0013670	unmapped	CGCTCGGGTTTTCCCGAGCGGTTAGACGAGCATTCAAATTTTTTTTTT
A_38_P00021740	A_38_P00021740	mir|bmo-miR-2780a-3p|mir|MIMAT0013670|mir|bmo-miR-2780a*_v18.0|mir|MIMAT0013670	bmo-miR-2780a-3p	MIMAT0013670	unmapped	CGCTCGGGTTTTCCCGAGCGGTTAGACGAGCATTCAAACTTTTTTTTTT
A_38_P00021741	A_38_P00021741	mir|bmo-miR-2785|mir|MIMAT0013681	bmo-miR-2785	MIMAT0013681	unmapped	CGCTCGGGTTTTCCCGAGCGGTTAGCCTCGTTCCGTTTTTTTTTT
A_38_P00021742	A_38_P00021742	mir|bmo-miR-2785|mir|MIMAT0013681	bmo-miR-2785	MIMAT0013681	unmapped	CGCTCGGGTTTTCCCGAGCGGTTAGCCTCGTTCCGCTTTTTTTTTT
A_38_P00021743	A_38_P00021743	mir|bmo-miR-2770-5p|mir|MIMAT0013651|mir|bmo-miR-2770_v18.0|mir|MIMAT0013651	bmo-miR-2770-5p	MIMAT0013651	unmapped	CGCTCGGGTTTTCCCGAGCGGTTATCCACCGACGAAAATTTTTTTT
A_38_P00021744	A_38_P00021744	mir|bmo-miR-2770-5p|mir|MIMAT0013651|mir|bmo-miR-2770_v18.0|mir|MIMAT0013651	bmo-miR-2770-5p	MIMAT0013651	unmapped	CGCTCGGGTTTTCCCGAGCGGTTATCCACCGACGAATATTTTTTTTT
A_38_P00021745	A_38_P00021745	mir|bmo-miR-2770-5p|mir|MIMAT0013651|mir|bmo-miR-2770_v18.0|mir|MIMAT0013651	bmo-miR-2770-5p	MIMAT0013651	unmapped	CGCTCGGGTTTTCCCGAGCGGTTATCCACCGACGAATTTATTTTTTTT
A_38_P00021746	A_38_P00021746	mir|bmo-miR-3393|mir|MIMAT0015597	bmo-miR-3393	MIMAT0015597	unmapped	CGCTCGGGTTTTCCCGAGCGGTTATCCAGATAAATCTCCTCTATTTTTTTT
A_38_P00021747	A_38_P00021747	mir|bmo-miR-3393|mir|MIMAT0015597	bmo-miR-3393	MIMAT0015597	unmapped	CGCTCGGGTTTTCCCGAGCGGTTATCCAGATAAATCTCCTCCATTTTTTTTT
A_38_P00021748	A_38_P00021748	mir|bmo-miR-2838|mir|MIMAT0013753	bmo-miR-2838	MIMAT0013753	unmapped	CGCTCGGGTTTTCCCGAGCGGTTATCCCGTGAGTTTGTATTTTTTTT
A_38_P00021749	A_38_P00021749	mir|bmo-miR-2838|mir|MIMAT0013753	bmo-miR-2838	MIMAT0013753	unmapped	CGCTCGGGTTTTCCCGAGCGGTTATCCCGTGAGTTTGCATTTTTTTTT
A_38_P00021750	A_38_P00021750	mir|bmo-miR-2813|mir|MIMAT0013721	bmo-miR-2813	MIMAT0013721	unmapped	CGCTCGGGTTTTCCCGAGCGGTTCCAACGGCTTAATCATTTTTTTTT
A_38_P00021751	A_38_P00021751	mir|bmo-miR-2813|mir|MIMAT0013721	bmo-miR-2813	MIMAT0013721	unmapped	CGCTCGGGTTTTCCCGAGCGGTTCCAACGGCTTAATCTTTTTTTTTTT
A_38_P00021752	A_38_P00021752	mir|bmo-miR-1b-3p|mir|MIMAT0013788|mir|bmo-miR-1_v18.0|mir|MIMAT0013788|mir|bmo-miR-1-as_v16.0|mir|MIMAT0013788	bmo-miR-1b-3p	MIMAT0013788	unmapped	CGCTCGGGTTTTCCCGAGCGGTTCCGTGCTTCCTTATATTTTTTTT
A_38_P00021753	A_38_P00021753	mir|bmo-miR-1b-3p|mir|MIMAT0013788|mir|bmo-miR-1_v18.0|mir|MIMAT0013788|mir|bmo-miR-1-as_v16.0|mir|MIMAT0013788	bmo-miR-1b-3p	MIMAT0013788	unmapped	CGCTCGGGTTTTCCCGAGCGGTTCCGTGCTTCCTTACAATTTTTTTT
A_38_P00021754	A_38_P00021754	mir|bmo-miR-3286-5p|mir|MIMAT0015472|mir|bmo-miR-3286*_v18.0|mir|MIMAT0015472	bmo-miR-3286-5p	MIMAT0015472	unmapped	CGCTCGGGTTTTCCCGAGCGGTTCCTGTGCAGTGACTTTTTTTTTT
A_38_P00021755	A_38_P00021755	mir|bmo-miR-3286-5p|mir|MIMAT0015472|mir|bmo-miR-3286*_v18.0|mir|MIMAT0015472	bmo-miR-3286-5p	MIMAT0015472	unmapped	CGCTCGGGTTTTCCCGAGCGGTTCCTGTGCAGTGACCTTTTTTTTTT
A_38_P00021756	A_38_P00021756	mir|bmo-miR-3263|mir|MIMAT0015447	bmo-miR-3263	MIMAT0015447	unmapped	CGCTCGGGTTTTCCCGAGCGGTTCTCAACGGGACTCTTTTTTTTTT
A_38_P00021757	A_38_P00021757	mir|bmo-miR-3263|mir|MIMAT0015447	bmo-miR-3263	MIMAT0015447	unmapped	CGCTCGGGTTTTCCCGAGCGGTTCTCAACGGGACTCATTTTTTTTTT
A_38_P00021758	A_38_P00021758	mir|bmo-miR-3269|mir|MIMAT0015454	bmo-miR-3269	MIMAT0015454	unmapped	CGCTCGGGTTTTCCCGAGCGGTTCTGTTTTTTGTATGCAGTTTTTTTTTT
A_38_P00021759	A_38_P00021759	mir|bmo-miR-3269|mir|MIMAT0015454	bmo-miR-3269	MIMAT0015454	unmapped	CGCTCGGGTTTTCCCGAGCGGTTCTGTTTTTTGTATGCAGATTTTTTTTTT
A_38_P00021760	A_38_P00021760	mir|bmo-miR-3292|mir|MIMAT0015479	bmo-miR-3292	MIMAT0015479	unmapped	CGCTCGGGTTTTCCCGAGCGGTTCTTAAGACACTAGACAAATTTTTTTTT
A_38_P00021761	A_38_P00021761	mir|bmo-miR-3292|mir|MIMAT0015479	bmo-miR-3292	MIMAT0015479	unmapped	CGCTCGGGTTTTCCCGAGCGGTTCTTAAGACACTAGACAATTATTTTTTTT
A_38_P00021762	A_38_P00021762	mir|bmo-miR-3292|mir|MIMAT0015479	bmo-miR-3292	MIMAT0015479	unmapped	CGCTCGGGTTTTCCCGAGCGGTTCTTAAGACACTAGACAATCATTTTTTTTT
A_38_P00021763	A_38_P00021763	mir|bmo-miR-3284|mir|MIMAT0015470	bmo-miR-3284	MIMAT0015470	unmapped	CGCTCGGGTTTTCCCGAGCGGTTCTTCAAGCCCCAATTTTTTTTTT
A_38_P00021764	A_38_P00021764	mir|bmo-miR-3284|mir|MIMAT0015470	bmo-miR-3284	MIMAT0015470	unmapped	CGCTCGGGTTTTCCCGAGCGGTTCTTCAAGCCCCAAATTTTTTTTTT
A_38_P00021765	A_38_P00021765	mir|bmo-miR-3360|mir|MIMAT0015546	bmo-miR-3360	MIMAT0015546	unmapped	CGCTCGGGTTTTCCCGAGCGGTTGAACATTTCCATAATTACTTTTTTTTTT
A_38_P00021766	A_38_P00021766	mir|bmo-miR-3360|mir|MIMAT0015546	bmo-miR-3360	MIMAT0015546	unmapped	CGCTCGGGTTTTCCCGAGCGGTTGAACATTTCCATAATTACCTTTTTTTTTT
A_38_P00021767	A_38_P00021767	mir|bmo-miR-279d-5p|mir|MIMAT0013606|mir|bmo-miR-279d*_v18.0|mir|MIMAT0013606	bmo-miR-279d-5p	MIMAT0013606	unmapped	CGCTCGGGTTTTCCCGAGCGGTTGAACTAAACGGTCACATTTTTTTTT
A_38_P00021768	A_38_P00021768	mir|bmo-miR-279d-5p|mir|MIMAT0013606|mir|bmo-miR-279d*_v18.0|mir|MIMAT0013606	bmo-miR-279d-5p	MIMAT0013606	unmapped	CGCTCGGGTTTTCCCGAGCGGTTGAACTAAACGGTCACTTTTTTTTTTT
A_38_P00021769	A_38_P00021769	mir|bmo-miR-3339|mir|MIMAT0015527	bmo-miR-3339	MIMAT0015527	unmapped	CGCTCGGGTTTTCCCGAGCGGTTGACCAACATCTAAAAAGATTTTTTTTT
A_38_P00021770	A_38_P00021770	mir|bmo-miR-3339|mir|MIMAT0015527	bmo-miR-3339	MIMAT0015527	unmapped	CGCTCGGGTTTTCCCGAGCGGTTGACCAACATCTAAAAAGTTATTTTTTTT
A_38_P00021771	A_38_P00021771	mir|bmo-miR-3347a|mir|MIMAT0015533	bmo-miR-3347a	MIMAT0015533	unmapped	CGCTCGGGTTTTCCCGAGCGGTTGAGACAGCAAGATCATATTTTTTTT
A_38_P00021772	A_38_P00021772	mir|bmo-miR-3347a|mir|MIMAT0015533	bmo-miR-3347a	MIMAT0015533	unmapped	CGCTCGGGTTTTCCCGAGCGGTTGAGACAGCAAGATCAAATTTTTTTTT
A_38_P00021773	A_38_P00021773	mir|bmo-miR-2843-1-3p|mir|MIMAT0013763|mir|bmo-miR-2843-1*_v18.0|mir|MIMAT0013763	bmo-miR-2843-1-3p	MIMAT0013763	unmapped	CGCTCGGGTTTTCCCGAGCGGTTGATCACGAAGACAGTTTTTTTTTT
A_38_P00021774	A_38_P00021774	mir|bmo-miR-2843-1-3p|mir|MIMAT0013763|mir|bmo-miR-2843-1*_v18.0|mir|MIMAT0013763	bmo-miR-2843-1-3p	MIMAT0013763	unmapped	CGCTCGGGTTTTCCCGAGCGGTTGATCACGAAGACAGCTATTTTTTTT
A_38_P00021775	A_38_P00021775	mir|bmo-miR-3302|mir|MIMAT0015490	bmo-miR-3302	MIMAT0015490	unmapped	CGCTCGGGTTTTCCCGAGCGGTTGCAATCAGACTGAAAAATTTTTTTT
A_38_P00021776	A_38_P00021776	mir|bmo-miR-3302|mir|MIMAT0015490	bmo-miR-3302	MIMAT0015490	unmapped	CGCTCGGGTTTTCCCGAGCGGTTGCAATCAGACTGAAATATTTTTTTTT
A_38_P00021777	A_38_P00021777	mir|bmo-miR-3302|mir|MIMAT0015490	bmo-miR-3302	MIMAT0015490	unmapped	CGCTCGGGTTTTCCCGAGCGGTTGCAATCAGACTGAAATTTTTTTTTTTT
A_38_P00021778	A_38_P00021778	mir|bmo-miR-3338-5p|mir|MIMAT0015525|mir|bmo-miR-3338*_v18.0|mir|MIMAT0015525	bmo-miR-3338-5p	MIMAT0015525	unmapped	CGCTCGGGTTTTCCCGAGCGGTTGCACACTACTGTGTAATTTTTTTT
A_38_P00021779	A_38_P00021779	mir|bmo-miR-3338-5p|mir|MIMAT0015525|mir|bmo-miR-3338*_v18.0|mir|MIMAT0015525	bmo-miR-3338-5p	MIMAT0015525	unmapped	CGCTCGGGTTTTCCCGAGCGGTTGCACACTACTGTGTTATTTTTTTTT
A_38_P00021780	A_38_P00021780	mir|bmo-miR-3338-5p|mir|MIMAT0015525|mir|bmo-miR-3338*_v18.0|mir|MIMAT0015525	bmo-miR-3338-5p	MIMAT0015525	unmapped	CGCTCGGGTTTTCCCGAGCGGTTGCACACTACTGTGTTTTTTTTTTTTT
A_38_P00021781	A_38_P00021781	mir|bmo-miR-3289|mir|MIMAT0015476	bmo-miR-3289	MIMAT0015476	unmapped	CGCTCGGGTTTTCCCGAGCGGTTGCTGAGTAATCCCCTTTTTTTTTT
A_38_P00021782	A_38_P00021782	mir|bmo-miR-3289|mir|MIMAT0015476	bmo-miR-3289	MIMAT0015476	unmapped	CGCTCGGGTTTTCCCGAGCGGTTGCTGAGTAATCCCCGTTTTTTTTTT
A_38_P00021783	A_38_P00021783	mir|bmo-miR-3365|mir|MIMAT0015551	bmo-miR-3365	MIMAT0015551	unmapped	CGCTCGGGTTTTCCCGAGCGGTTGCTGTGGTAGATCTAGATTTTTTTTT
A_38_P00021784	A_38_P00021784	mir|bmo-miR-3365|mir|MIMAT0015551	bmo-miR-3365	MIMAT0015551	unmapped	CGCTCGGGTTTTCCCGAGCGGTTGCTGTGGTAGATCTAGTTTTTTTTTTT
A_38_P00021785	A_38_P00021785	mir|bmo-miR-2807b|mir|MIMAT0013742	bmo-miR-2807b	MIMAT0013742	unmapped	CGCTCGGGTTTTCCCGAGCGGTTGTATGGAGTTGAAACATATTTTTTTT
A_38_P00021786	A_38_P00021786	mir|bmo-miR-2807b|mir|MIMAT0013742	bmo-miR-2807b	MIMAT0013742	unmapped	CGCTCGGGTTTTCCCGAGCGGTTGTATGGAGTTGAAACAGAATTTTTTTT
A_38_P00021787	A_38_P00021787	mir|bmo-miR-2859|mir|MIMAT0013799	bmo-miR-2859	MIMAT0013799	unmapped	CGCTCGGGTTTTCCCGAGCGGTTGTCCTGCCCGAATTTTTTTTT
A_38_P00021788	A_38_P00021788	mir|bmo-miR-2859|mir|MIMAT0013799	bmo-miR-2859	MIMAT0013799	unmapped	CGCTCGGGTTTTCCCGAGCGGTTGTCCTGCCCGATTTTTTTTTTT
A_38_P00021789	A_38_P00021789	mir|bmo-miR-2859|mir|MIMAT0013799	bmo-miR-2859	MIMAT0013799	unmapped	CGCTCGGGTTTTCCCGAGCGGTTGTCCTGCCCGATCTTTTTTTTTT
A_38_P00021790	A_38_P00021790	mir|bmo-miR-2856-3p|mir|MIMAT0013793|mir|bmo-miR-2856_v18.0|mir|MIMAT0013793	bmo-miR-2856-3p	MIMAT0013793	unmapped	CGCTCGGGTTTTCCCGAGCGGTTGTCTTACGGTTCTCTTTTTTTTTT
A_38_P00021791	A_38_P00021791	mir|bmo-miR-2856-3p|mir|MIMAT0013793|mir|bmo-miR-2856_v18.0|mir|MIMAT0013793	bmo-miR-2856-3p	MIMAT0013793	unmapped	CGCTCGGGTTTTCCCGAGCGGTTGTCTTACGGTTCTCGTTTTTTTTTT
A_38_P00021792	A_38_P00021792	mir|bmo-miR-2790-5p|mir|MIMAT0013687|mir|bmo-miR-2790*_v18.0|mir|MIMAT0013687	bmo-miR-2790-5p	MIMAT0013687	unmapped	CGCTCGGGTTTTCCCGAGCGGTTTAAGAATTGTTCTTTATCCTTTTTTTTTT
A_38_P00021793	A_38_P00021793	mir|bmo-miR-2790-5p|mir|MIMAT0013687|mir|bmo-miR-2790*_v18.0|mir|MIMAT0013687	bmo-miR-2790-5p	MIMAT0013687	unmapped	CGCTCGGGTTTTCCCGAGCGGTTTAAGAATTGTTCTTTATCCATTTTTTTTTT
A_38_P00021794	A_38_P00021794	mir|bmo-miR-2787-5p|mir|MIMAT0013683|mir|bmo-miR-2787*_v18.0|mir|MIMAT0013683	bmo-miR-2787-5p	MIMAT0013683	unmapped	CGCTCGGGTTTTCCCGAGCGGTTTAGTGCTAATCAAATTCATTTTTTTTTT
A_38_P00021795	A_38_P00021795	mir|bmo-miR-2787-5p|mir|MIMAT0013683|mir|bmo-miR-2787*_v18.0|mir|MIMAT0013683	bmo-miR-2787-5p	MIMAT0013683	unmapped	CGCTCGGGTTTTCCCGAGCGGTTTAGTGCTAATCAAATTCAATTTTTTTTTT
A_38_P00021796	A_38_P00021796	mir|bmo-miR-2787-5p|mir|MIMAT0013683|mir|bmo-miR-2787*_v18.0|mir|MIMAT0013683	bmo-miR-2787-5p	MIMAT0013683	unmapped	CGCTCGGGTTTTCCCGAGCGGTTTAGTGCTAATCAAATTCAAGTATTTTTTTT
A_38_P00021797	A_38_P00021797	mir|bmo-miR-3423|mir|MIMAT0015631	bmo-miR-3423	MIMAT0015631	unmapped	CGCTCGGGTTTTCCCGAGCGGTTTATCATGCAATAGACCTTTTTTTTTTT
A_38_P00021798	A_38_P00021798	mir|bmo-miR-3423|mir|MIMAT0015631	bmo-miR-3423	MIMAT0015631	unmapped	CGCTCGGGTTTTCCCGAGCGGTTTATCATGCAATAGACCTATTTTTTTTTT
A_38_P00021799	A_38_P00021799	mir|bmo-miR-3423|mir|MIMAT0015631	bmo-miR-3423	MIMAT0015631	unmapped	CGCTCGGGTTTTCCCGAGCGGTTTATCATGCAATAGACCTAATTTTTTTTTT
A_38_P00021800	A_38_P00021800	mir|bmo-miR-2998|mir|MIMAT0014659	bmo-miR-2998	MIMAT0014659	unmapped	CGCTCGGGTTTTCCCGAGCGGTTTATCTACCTCATCCTGTATTTTTTTTT
A_38_P00021801	A_38_P00021801	mir|bmo-miR-2998|mir|MIMAT0014659	bmo-miR-2998	MIMAT0014659	unmapped	CGCTCGGGTTTTCCCGAGCGGTTTATCTACCTCATCCTGTTTATTTTTTTT
A_38_P00021802	A_38_P00021802	mir|bmo-miR-3222|mir|MIMAT0015402	bmo-miR-3222	MIMAT0015402	unmapped	CGCTCGGGTTTTCCCGAGCGGTTTCATAGATACTATGATAATATTTTTTTT
A_38_P00021803	A_38_P00021803	mir|bmo-miR-3222|mir|MIMAT0015402	bmo-miR-3222	MIMAT0015402	unmapped	CGCTCGGGTTTTCCCGAGCGGTTTCATAGATACTATGATAAGATTTTTTTTT
A_38_P00021804	A_38_P00021804	mir|bmo-miR-3222|mir|MIMAT0015402	bmo-miR-3222	MIMAT0015402	unmapped	CGCTCGGGTTTTCCCGAGCGGTTTCATAGATACTATGATAAGTTTTTTTTTTT
A_38_P00021805	A_38_P00021805	mir|bmo-miR-3222|mir|MIMAT0015402	bmo-miR-3222	MIMAT0015402	unmapped	CGCTCGGGTTTTCCCGAGCGGTTTCATAGATACTATGATAAGTATTTTTTTTTT
A_38_P00021806	A_38_P00021806	mir|bmo-miR-2805|mir|MIMAT0013713	bmo-miR-2805	MIMAT0013713	unmapped	CGCTCGGGTTTTCCCGAGCGGTTTCCGTGGTTCGTTTTTTTTTTT
A_38_P00021807	A_38_P00021807	mir|bmo-miR-2805|mir|MIMAT0013713	bmo-miR-2805	MIMAT0013713	unmapped	CGCTCGGGTTTTCCCGAGCGGTTTCCGTGGTTCGTCTTTTTTTTTT
A_38_P00021808	A_38_P00021808	mir|bmo-miR-2759|mir|MIMAT0013631	bmo-miR-2759	MIMAT0013631	unmapped	CGCTCGGGTTTTCCCGAGCGGTTTCGCATTCTATGATCTTATTTTTTTTT
A_38_P00021809	A_38_P00021809	mir|bmo-miR-2759|mir|MIMAT0013631	bmo-miR-2759	MIMAT0013631	unmapped	CGCTCGGGTTTTCCCGAGCGGTTTCGCATTCTATGATCTTTTTTTTTTTTT
A_38_P00021810	A_38_P00021810	mir|bmo-miR-3283|mir|MIMAT0015469	bmo-miR-3283	MIMAT0015469	unmapped	CGCTCGGGTTTTCCCGAGCGGTTTCGTTTAAAGAAAGTTAAGTTTTTTTTTT
A_38_P00021811	A_38_P00021811	mir|bmo-miR-3283|mir|MIMAT0015469	bmo-miR-3283	MIMAT0015469	unmapped	CGCTCGGGTTTTCCCGAGCGGTTTCGTTTAAAGAAAGTTAAGGTTTTTTTTTT
A_38_P00021812	A_38_P00021812	mir|bmo-miR-3213-3p|mir|MIMAT0015393|mir|bmo-miR-3213*_v18.0|mir|MIMAT0015393	bmo-miR-3213-3p	MIMAT0015393	unmapped	CGCTCGGGTTTTCCCGAGCGGTTTCTAACAAACACTCGTATTTTTTTT
A_38_P00021813	A_38_P00021813	mir|bmo-miR-3213-3p|mir|MIMAT0015393|mir|bmo-miR-3213*_v18.0|mir|MIMAT0015393	bmo-miR-3213-3p	MIMAT0015393	unmapped	CGCTCGGGTTTTCCCGAGCGGTTTCTAACAAACACTCGGATTTTTTTTT
A_38_P00021814	A_38_P00021814	mir|bmo-miR-2848|mir|MIMAT0013770	bmo-miR-2848	MIMAT0013770	unmapped	CGCTCGGGTTTTCCCGAGCGGTTTGCCTATTTCTGCCTTTTTTTTTT
A_38_P00021815	A_38_P00021815	mir|bmo-miR-2848|mir|MIMAT0013770	bmo-miR-2848	MIMAT0013770	unmapped	CGCTCGGGTTTTCCCGAGCGGTTTGCCTATTTCTGCCGTTTTTTTTTT
A_38_P00021816	A_38_P00021816	mir|bmo-miR-2790-3p|mir|MIMAT0013688|mir|bmo-miR-2790_v18.0|mir|MIMAT0013688	bmo-miR-2790-3p	MIMAT0013688	unmapped	CGCTCGGGTTTTCCCGAGCGGTTTGGACAAAATACAGTTCAATTTTTTTT
A_38_P00021817	A_38_P00021817	mir|bmo-miR-2790-3p|mir|MIMAT0013688|mir|bmo-miR-2790_v18.0|mir|MIMAT0013688	bmo-miR-2790-3p	MIMAT0013688	unmapped	CGCTCGGGTTTTCCCGAGCGGTTTGGACAAAATACAGTTCTATTTTTTTTT
A_38_P00021818	A_38_P00021818	mir|bmo-miR-3372-5p|mir|MIMAT0015559|mir|bmo-miR-3372*_v18.0|mir|MIMAT0015559	bmo-miR-3372-5p	MIMAT0015559	unmapped	CGCTCGGGTTTTCCCGAGCGGTTTGGCTCTGACGCTTTTTTTTTT
A_38_P00021819	A_38_P00021819	mir|bmo-miR-3372-5p|mir|MIMAT0015559|mir|bmo-miR-3372*_v18.0|mir|MIMAT0015559	bmo-miR-3372-5p	MIMAT0015559	unmapped	CGCTCGGGTTTTCCCGAGCGGTTTGGCTCTGACGCCTTTTTTTTTT
A_38_P00021820	A_38_P00021820	mir|bmo-miR-2841|mir|MIMAT0013758	bmo-miR-2841	MIMAT0013758	unmapped	CGCTCGGGTTTTCCCGAGCGGTTTTGAGCTCTTAACTATGAATTTTTTTTT
A_38_P00021821	A_38_P00021821	mir|bmo-miR-2841|mir|MIMAT0013758	bmo-miR-2841	MIMAT0013758	unmapped	CGCTCGGGTTTTCCCGAGCGGTTTTGAGCTCTTAACTATGATTTTTTTTTTT
A_38_P00026409	A_38_P00026409	mir|aae-miR-993|mir|MIMAT0014266	aae-miR-993	MIMAT0014266	unmapped	CGCTCGGGTTTTCCCGAGCGGAAAAGCCCGGAACTATTTTTTTTTT
A_38_P00026410	A_38_P00026410	mir|aae-miR-993|mir|MIMAT0014266	aae-miR-993	MIMAT0014266	unmapped	CGCTCGGGTTTTCCCGAGCGGAAAAGCCCGGAACTACTTTTTTTTTT
A_38_P00026411	A_38_P00026411	mir|aae-miR-1891|mir|MIMAT0014263	aae-miR-1891	MIMAT0014263	unmapped	CGCTCGGGTTTTCCCGAGCGGAAACACGCAAATTAACTCTATTTTTTTT
A_38_P00026412	A_38_P00026412	mir|aae-miR-1891|mir|MIMAT0014263	aae-miR-1891	MIMAT0014263	unmapped	CGCTCGGGTTTTCCCGAGCGGAAACACGCAAATTAACTCCATTTTTTTTT
A_38_P00026417	A_38_P00026417	mir|aae-miR-13-3p|mir|MIMAT0014256|mir|aae-miR-13_v18.0|mir|MIMAT0014256	aae-miR-13-3p	MIMAT0014256	unmapped	CGCTCGGGTTTTCCCGAGCGGAACTCGTCAAAATGGCATTTTTTTTT
A_38_P00026418	A_38_P00026418	mir|aae-miR-13-3p|mir|MIMAT0014256|mir|aae-miR-13_v18.0|mir|MIMAT0014256	aae-miR-13-3p	MIMAT0014256	unmapped	CGCTCGGGTTTTCCCGAGCGGAACTCGTCAAAATGGCTTATTTTTTTT
A_38_P00026421	A_38_P00026421	mir|aae-miR-92a-5p|mir|MIMAT0015369|mir|aae-miR-92a*_v18.0|mir|MIMAT0015369	aae-miR-92a-5p	MIMAT0015369	unmapped	CGCTCGGGTTTTCCCGAGCGGAATGTTGCCCCTGTCTTTTTTTTTT
A_38_P00026422	A_38_P00026422	mir|aae-miR-92a-5p|mir|MIMAT0015369|mir|aae-miR-92a*_v18.0|mir|MIMAT0015369	aae-miR-92a-5p	MIMAT0015369	unmapped	CGCTCGGGTTTTCCCGAGCGGAATGTTGCCCCTGTCCTATTTTTTTT
A_38_P00026425	A_38_P00026425	mir|aae-miR-87|mir|MIMAT0014252	aae-miR-87	MIMAT0014252	unmapped	CGCTCGGGTTTTCCCGAGCGGACACACCTGAAAATTTGTATTTTTTTT
A_38_P00026426	A_38_P00026426	mir|aae-miR-87|mir|MIMAT0014252	aae-miR-87	MIMAT0014252	unmapped	CGCTCGGGTTTTCCCGAGCGGACACACCTGAAAATTTGCATTTTTTTTT
A_38_P00026433	A_38_P00026433	mir|aae-miR-263b-3p|mir|MIMAT0014310|mir|aae-miR-263b*_v18.0|mir|MIMAT0014310	aae-miR-263b-3p	MIMAT0014310	unmapped	CGCTCGGGTTTTCCCGAGCGGACGATGGCACGAAATTTTTTTTTT
A_38_P00026434	A_38_P00026434	mir|aae-miR-263b-3p|mir|MIMAT0014310|mir|aae-miR-263b*_v18.0|mir|MIMAT0014310	aae-miR-263b-3p	MIMAT0014310	unmapped	CGCTCGGGTTTTCCCGAGCGGACGATGGCACGAAAATTTTTTTTTT
A_38_P00026435	A_38_P00026435	mir|aae-miR-263b-3p|mir|MIMAT0014310|mir|aae-miR-263b*_v18.0|mir|MIMAT0014310	aae-miR-263b-3p	MIMAT0014310	unmapped	CGCTCGGGTTTTCCCGAGCGGACGATGGCACGAAAAGTATTTTTTTT
A_38_P00026444	A_38_P00026444	mir|aae-miR-12-3p|mir|MIMAT0014254|mir|aae-miR-12*_v18.0|mir|MIMAT0014254	aae-miR-12-3p	MIMAT0014254	unmapped	CGCTCGGGTTTTCCCGAGCGGAGAGAGCATAACATAAGTACATTTTTTTTT
A_38_P00026445	A_38_P00026445	mir|aae-miR-12-3p|mir|MIMAT0014254|mir|aae-miR-12*_v18.0|mir|MIMAT0014254	aae-miR-12-3p	MIMAT0014254	unmapped	CGCTCGGGTTTTCCCGAGCGGAGAGAGCATAACATAAGTACTTTTTTTTTTT
A_38_P00026446	A_38_P00026446	mir|aae-miR-317|mir|MIMAT0014224	aae-miR-317	MIMAT0014224	unmapped	CGCTCGGGTTTTCCCGAGCGGAGATACCACCAGCTGTTATTTTTTTT
A_38_P00026447	A_38_P00026447	mir|aae-miR-317|mir|MIMAT0014224	aae-miR-317	MIMAT0014224	unmapped	CGCTCGGGTTTTCCCGAGCGGAGATACCACCAGCTGTGAATTTTTTTT
A_38_P00026450	A_38_P00026450	mir|aae-miR-2b|mir|MIMAT0014306	aae-miR-2b	MIMAT0014306	unmapped	CGCTCGGGTTTTCCCGAGCGGAGCTCATCAAAGCTGGTATTTTTTTT
A_38_P00026451	A_38_P00026451	mir|aae-miR-2b|mir|MIMAT0014306	aae-miR-2b	MIMAT0014306	unmapped	CGCTCGGGTTTTCCCGAGCGGAGCTCATCAAAGCTGGCATTTTTTTTT
A_38_P00026452	A_38_P00026452	mir|aae-miR-286a|mir|MIMAT0014314	aae-miR-286a	MIMAT0014314	unmapped	CGCTCGGGTTTTCCCGAGCGGAGGACGCGAGTGTATTTTTTTTT
A_38_P00026453	A_38_P00026453	mir|aae-miR-286a|mir|MIMAT0014314	aae-miR-286a	MIMAT0014314	unmapped	CGCTCGGGTTTTCCCGAGCGGAGGACGCGAGTGTTTTTTTTTTTT
A_38_P00026454	A_38_P00026454	mir|aae-miR-286a|mir|MIMAT0014314	aae-miR-286a	MIMAT0014314	unmapped	CGCTCGGGTTTTCCCGAGCGGAGGACGCGAGTGTTCTTTTTTTTTT
A_38_P00026455	A_38_P00026455	mir|aae-miR-2940-3p|mir|MIMAT0014284|mir|aae-miR-2940*_v18.0|mir|MIMAT0014284	aae-miR-2940-3p	MIMAT0014284	unmapped	CGCTCGGGTTTTCCCGAGCGGAGTGATTTATCTCCCTGTTTTTTTTTTT
A_38_P00026456	A_38_P00026456	mir|aae-miR-2940-3p|mir|MIMAT0014284|mir|aae-miR-2940*_v18.0|mir|MIMAT0014284	aae-miR-2940-3p	MIMAT0014284	unmapped	CGCTCGGGTTTTCCCGAGCGGAGTGATTTATCTCCCTGTCTTTTTTTTTT
A_38_P00026461	A_38_P00026461	mir|aae-bantam-3p|mir|MIMAT0014219	aae-bantam-3p	MIMAT0014219	unmapped	CGCTCGGGTTTTCCCGAGCGGATCAGCTTTCAAAATGATCATTTTTTTTT
A_38_P00026462	A_38_P00026462	mir|aae-bantam-3p|mir|MIMAT0014219	aae-bantam-3p	MIMAT0014219	unmapped	CGCTCGGGTTTTCCCGAGCGGATCAGCTTTCAAAATGATCTTTTTTTTTTT
A_38_P00026467	A_38_P00026467	mir|aae-miR-1174|mir|MIMAT0014265	aae-miR-1174	MIMAT0014265	unmapped	CGCTCGGGTTTTCCCGAGCGGATGGGTATTAAGTAGATCTGTTTTTTTTTT
A_38_P00026468	A_38_P00026468	mir|aae-miR-1174|mir|MIMAT0014265	aae-miR-1174	MIMAT0014265	unmapped	CGCTCGGGTTTTCCCGAGCGGATGGGTATTAAGTAGATCTGATTTTTTTTTT
A_38_P00026469	A_38_P00026469	mir|aae-miR-2942|mir|MIMAT0014300	aae-miR-2942	MIMAT0014300	unmapped	CGCTCGGGTTTTCCCGAGCGGATTAACTCGTGAAGTCTCTTTTTTTTTT
A_38_P00026470	A_38_P00026470	mir|aae-miR-2942|mir|MIMAT0014300	aae-miR-2942	MIMAT0014300	unmapped	CGCTCGGGTTTTCCCGAGCGGATTAACTCGTGAAGTCTCGTTTTTTTTTT
A_38_P00026471	A_38_P00026471	mir|aae-miR-92b-5p|mir|MIMAT0014321|mir|aae-miR-92b*_v18.0|mir|MIMAT0014321	aae-miR-92b-5p	MIMAT0014321	unmapped	CGCTCGGGTTTTCCCGAGCGGCAAACGGGCACAAGATTTTTTTTT
A_38_P00026472	A_38_P00026472	mir|aae-miR-92b-5p|mir|MIMAT0014321|mir|aae-miR-92b*_v18.0|mir|MIMAT0014321	aae-miR-92b-5p	MIMAT0014321	unmapped	CGCTCGGGTTTTCCCGAGCGGCAAACGGGCACAAGTTTTTTTTTTT
A_38_P00026479	A_38_P00026479	mir|aae-miR-308-5p|mir|MIMAT0014260|mir|aae-miR-308_v18.0|mir|MIMAT0014260	aae-miR-308-5p	MIMAT0014260	unmapped	CGCTCGGGTTTTCCCGAGCGGCAAGCCACAAGAATATACTTTTTTTTTT
A_38_P00026480	A_38_P00026480	mir|aae-miR-308-5p|mir|MIMAT0014260|mir|aae-miR-308_v18.0|mir|MIMAT0014260	aae-miR-308-5p	MIMAT0014260	unmapped	CGCTCGGGTTTTCCCGAGCGGCAAGCCACAAGAATATACCTTTTTTTTTT
A_38_P00026483	A_38_P00026483	mir|aae-miR-13-5p|mir|MIMAT0014255|mir|aae-miR-13*_v18.0|mir|MIMAT0014255	aae-miR-13-5p	MIMAT0014255	unmapped	CGCTCGGGTTTTCCCGAGCGGCACAGCACAACCATTAATTTTTTTT
A_38_P00026484	A_38_P00026484	mir|aae-miR-13-5p|mir|MIMAT0014255|mir|aae-miR-13*_v18.0|mir|MIMAT0014255	aae-miR-13-5p	MIMAT0014255	unmapped	CGCTCGGGTTTTCCCGAGCGGCACAGCACAACCATTTAATTTTTTTT
A_38_P00026485	A_38_P00026485	mir|aae-miR-11-5p|mir|MIMAT0014241|mir|aae-miR-11*_v18.0|mir|MIMAT0014241	aae-miR-11-5p	MIMAT0014241	unmapped	CGCTCGGGTTTTCCCGAGCGGCACAGGTCACAGCTTTTTTTTTT
A_38_P00026486	A_38_P00026486	mir|aae-miR-11-5p|mir|MIMAT0014241|mir|aae-miR-11*_v18.0|mir|MIMAT0014241	aae-miR-11-5p	MIMAT0014241	unmapped	CGCTCGGGTTTTCCCGAGCGGCACAGGTCACAGCCTTTTTTTTTT
A_38_P00026487	A_38_P00026487	mir|aae-miR-309b-5p|mir|MIMAT0014319|mir|aae-miR-309b*_v18.0|mir|MIMAT0014319	aae-miR-309b-5p	MIMAT0014319	unmapped	CGCTCGGGTTTTCCCGAGCGGCACCAACTGAACGGTTTTTTTTTT
A_38_P00026488	A_38_P00026488	mir|aae-miR-309b-5p|mir|MIMAT0014319|mir|aae-miR-309b*_v18.0|mir|MIMAT0014319	aae-miR-309b-5p	MIMAT0014319	unmapped	CGCTCGGGTTTTCCCGAGCGGCACCAACTGAACGGATATTTTTTTT
A_38_P00026489	A_38_P00026489	mir|aae-miR-282-5p|mir|MIMAT0014311|mir|aae-miR-282_v18.0|mir|MIMAT0014311	aae-miR-282-5p	MIMAT0014311	unmapped	CGCTCGGGTTTTCCCGAGCGGCAGACAAAGCCTAGGTTTTTTTTTT
A_38_P00026490	A_38_P00026490	mir|aae-miR-282-5p|mir|MIMAT0014311|mir|aae-miR-282_v18.0|mir|MIMAT0014311	aae-miR-282-5p	MIMAT0014311	unmapped	CGCTCGGGTTTTCCCGAGCGGCAGACAAAGCCTAGGATTTTTTTTTT
A_38_P00026491	A_38_P00026491	mir|aae-miR-308-3p|mir|MIMAT0014261|mir|aae-miR-308*_v18.0|mir|MIMAT0014261	aae-miR-308-3p	MIMAT0014261	unmapped	CGCTCGGGTTTTCCCGAGCGGCAGTATACTCCTGTGATATTTTTTTTT
A_38_P00026492	A_38_P00026492	mir|aae-miR-308-3p|mir|MIMAT0014261|mir|aae-miR-308*_v18.0|mir|MIMAT0014261	aae-miR-308-3p	MIMAT0014261	unmapped	CGCTCGGGTTTTCCCGAGCGGCAGTATACTCCTGTGATTTTTTTTTTTT
A_38_P00026495	A_38_P00026495	mir|aae-miR-2945-5p|mir|MIMAT0014315|mir|aae-miR-2945*_v18.0|mir|MIMAT0014315	aae-miR-2945-5p	MIMAT0014315	unmapped	CGCTCGGGTTTTCCCGAGCGGCATGACACTAGAAACGTTTTTTTTTT
A_38_P00026496	A_38_P00026496	mir|aae-miR-2945-5p|mir|MIMAT0014315|mir|aae-miR-2945*_v18.0|mir|MIMAT0014315	aae-miR-2945-5p	MIMAT0014315	unmapped	CGCTCGGGTTTTCCCGAGCGGCATGACACTAGAAACGGTTTTTTTTTT
A_38_P00026497	A_38_P00026497	mir|aae-miR-1889-5p|mir|MIMAT0014233|mir|aae-miR-1889*_v18.0|mir|MIMAT0014233	aae-miR-1889-5p	MIMAT0014233	unmapped	CGCTCGGGTTTTCCCGAGCGGCCACTGTTACAATTTGATTTTTTTTTT
A_38_P00026498	A_38_P00026498	mir|aae-miR-1889-5p|mir|MIMAT0014233|mir|aae-miR-1889*_v18.0|mir|MIMAT0014233	aae-miR-1889-5p	MIMAT0014233	unmapped	CGCTCGGGTTTTCCCGAGCGGCCACTGTTACAATTTGAGTATTTTTTTT
A_38_P00026499	A_38_P00026499	mir|aae-miR-1890|mir|MIMAT0014247	aae-miR-1890	MIMAT0014247	unmapped	CGCTCGGGTTTTCCCGAGCGGCCAGACCTAATCAAAGAAATTTTTTTT
A_38_P00026500	A_38_P00026500	mir|aae-miR-1890|mir|MIMAT0014247	aae-miR-1890	MIMAT0014247	unmapped	CGCTCGGGTTTTCCCGAGCGGCCAGACCTAATCAAAGATAATTTTTTTT
A_38_P00026501	A_38_P00026501	mir|aae-miR-1890|mir|MIMAT0014247	aae-miR-1890	MIMAT0014247	unmapped	CGCTCGGGTTTTCCCGAGCGGCCAGACCTAATCAAAGATTATTTTTTTTT
A_38_P00026502	A_38_P00026502	mir|aae-miR-305-5p|mir|MIMAT0014249|mir|aae-miR-305_v18.0|mir|MIMAT0014249	aae-miR-305-5p	MIMAT0014249	unmapped	CGCTCGGGTTTTCCCGAGCGGCCAGAGCACCTGATTTTTTTTTTT
A_38_P00026503	A_38_P00026503	mir|aae-miR-305-5p|mir|MIMAT0014249|mir|aae-miR-305_v18.0|mir|MIMAT0014249	aae-miR-305-5p	MIMAT0014249	unmapped	CGCTCGGGTTTTCCCGAGCGGCCAGAGCACCTGATGTTTTTTTTTT
A_38_P00026504	A_38_P00026504	mir|aae-miR-263a-5p|mir|MIMAT0014289|mir|aae-miR-263a_v18.0|mir|MIMAT0014289	aae-miR-263a-5p	MIMAT0014289	unmapped	CGCTCGGGTTTTCCCGAGCGGCCGTGAATTCTTCCATATTTTTTTT
A_38_P00026505	A_38_P00026505	mir|aae-miR-263a-5p|mir|MIMAT0014289|mir|aae-miR-263a_v18.0|mir|MIMAT0014289	aae-miR-263a-5p	MIMAT0014289	unmapped	CGCTCGGGTTTTCCCGAGCGGCCGTGAATTCTTCCAGATTTTTTTTT
A_38_P00026506	A_38_P00026506	mir|aae-miR-2941|mir|MIMAT0014286	aae-miR-2941	MIMAT0014286	unmapped	CGCTCGGGTTTTCCCGAGCGGCCGTGGAGTTCTAGTTTTTTTTTT
A_38_P00026507	A_38_P00026507	mir|aae-miR-2941|mir|MIMAT0014286	aae-miR-2941	MIMAT0014286	unmapped	CGCTCGGGTTTTCCCGAGCGGCCGTGGAGTTCTAGCTTTTTTTTTT
A_38_P00026508	A_38_P00026508	mir|aae-miR-210|mir|MIMAT0014293	aae-miR-210	MIMAT0014293	unmapped	CGCTCGGGTTTTCCCGAGCGGCCGTTGTCACACGTTTTTTTTTT
A_38_P00026509	A_38_P00026509	mir|aae-miR-210|mir|MIMAT0014293	aae-miR-210	MIMAT0014293	unmapped	CGCTCGGGTTTTCCCGAGCGGCCGTTGTCACACGCTTTTTTTTTT
A_38_P00026510	A_38_P00026510	mir|aae-miR-282-3p|mir|MIMAT0014312|mir|aae-miR-282*_v18.0|mir|MIMAT0014312	aae-miR-282-3p	MIMAT0014312	unmapped	CGCTCGGGTTTTCCCGAGCGGCCTAACCTCTGTCAGTTTTTTTTTT
A_38_P00026511	A_38_P00026511	mir|aae-miR-282-3p|mir|MIMAT0014312|mir|aae-miR-282*_v18.0|mir|MIMAT0014312	aae-miR-282-3p	MIMAT0014312	unmapped	CGCTCGGGTTTTCCCGAGCGGCCTAACCTCTGTCAGGTATTTTTTTT
A_38_P00026512	A_38_P00026512	mir|aae-miR-252-3p|mir|MIMAT0014217|mir|aae-miR-252*_v18.0|mir|MIMAT0014217	aae-miR-252-3p	MIMAT0014217	unmapped	CGCTCGGGTTTTCCCGAGCGGCGATAAGCACTTGGGTTTTTTTTTT
A_38_P00026513	A_38_P00026513	mir|aae-miR-252-3p|mir|MIMAT0014217|mir|aae-miR-252*_v18.0|mir|MIMAT0014217	aae-miR-252-3p	MIMAT0014217	unmapped	CGCTCGGGTTTTCCCGAGCGGCGATAAGCACTTGGGCTTTTTTTTTT
A_38_P00026514	A_38_P00026514	mir|aae-miR-1175-5p|mir|MIMAT0014264|mir|aae-miR-1175_v18.0|mir|MIMAT0014264	aae-miR-1175-5p	MIMAT0014264	unmapped	CGCTCGGGTTTTCCCGAGCGGCGATGAGACCACTACTTTTTTTTTTT
A_38_P00026515	A_38_P00026515	mir|aae-miR-1175-5p|mir|MIMAT0014264|mir|aae-miR-1175_v18.0|mir|MIMAT0014264	aae-miR-1175-5p	MIMAT0014264	unmapped	CGCTCGGGTTTTCCCGAGCGGCGATGAGACCACTACTCTTTTTTTTTT
A_38_P00026516	A_38_P00026516	mir|aae-miR-316|mir|MIMAT0014317	aae-miR-316	MIMAT0014317	unmapped	CGCTCGGGTTTTCCCGAGCGGCGGCAGTAAGCGGTTTTTTTTTT
A_38_P00026517	A_38_P00026517	mir|aae-miR-316|mir|MIMAT0014317	aae-miR-316	MIMAT0014317	unmapped	CGCTCGGGTTTTCCCGAGCGGCGGCAGTAAGCGGATTTTTTTTTT
A_38_P00026524	A_38_P00026524	mir|aae-miR-306-5p|mir|MIMAT0014229|mir|aae-miR-306_v18.0|mir|MIMAT0014229	aae-miR-306-5p	MIMAT0014229	unmapped	CGCTCGGGTTTTCCCGAGCGGCTGAGAGTCACTCAGTTTTTTTTTTT
A_38_P00026525	A_38_P00026525	mir|aae-miR-306-5p|mir|MIMAT0014229|mir|aae-miR-306_v18.0|mir|MIMAT0014229	aae-miR-306-5p	MIMAT0014229	unmapped	CGCTCGGGTTTTCCCGAGCGGCTGAGAGTCACTCAGTATTTTTTTTTT
A_38_P00026526	A_38_P00026526	mir|aae-miR-306-5p|mir|MIMAT0014229|mir|aae-miR-306_v18.0|mir|MIMAT0014229	aae-miR-306-5p	MIMAT0014229	unmapped	CGCTCGGGTTTTCCCGAGCGGCTGAGAGTCACTCAGTACTATTTTTTTT
A_38_P00026529	A_38_P00026529	mir|aae-miR-263b-5p|mir|MIMAT0014309|mir|aae-miR-263b_v18.0|mir|MIMAT0014309	aae-miR-263b-5p	MIMAT0014309	unmapped	CGCTCGGGTTTTCCCGAGCGGCTGTGAATTCTCCCAGATTTTTTTTT
A_38_P00026530	A_38_P00026530	mir|aae-miR-263b-5p|mir|MIMAT0014309|mir|aae-miR-263b_v18.0|mir|MIMAT0014309	aae-miR-263b-5p	MIMAT0014309	unmapped	CGCTCGGGTTTTCCCGAGCGGCTGTGAATTCTCCCAGTTTTTTTTTTT
A_38_P00026531	A_38_P00026531	mir|aae-miR-932-3p|mir|MIMAT0014270|mir|aae-miR-932_v18.0|mir|MIMAT0014270	aae-miR-932-3p	MIMAT0014270	unmapped	CGCTCGGGTTTTCCCGAGCGGCTTCACTTCCACATTGTATTTTTTTT
A_38_P00026532	A_38_P00026532	mir|aae-miR-932-3p|mir|MIMAT0014270|mir|aae-miR-932_v18.0|mir|MIMAT0014270	aae-miR-932-3p	MIMAT0014270	unmapped	CGCTCGGGTTTTCCCGAGCGGCTTCACTTCCACATTGCAATTTTTTTT
A_38_P00026535	A_38_P00026535	mir|aae-miR-9c-3p|mir|MIMAT0014213|mir|aae-miR-9*_v15.0|mir|MIMAT0014213|mir|aae-miR-9c_v15.0|mir|MIMAT0015647	aae-miR-9c-3p	MIMAT0014213	unmapped	CGCTCGGGTTTTCCCGAGCGGGACCTCTGGTACTAAAGTATTTTTTTT
A_38_P00026536	A_38_P00026536	mir|aae-miR-9c-3p|mir|MIMAT0014213|mir|aae-miR-9*_v15.0|mir|MIMAT0014213|mir|aae-miR-9c_v15.0|mir|MIMAT0015647	aae-miR-9c-3p	MIMAT0014213	unmapped	CGCTCGGGTTTTCCCGAGCGGGACCTCTGGTACTAAAGCAATTTTTTTT
A_38_P00026537	A_38_P00026537	mir|aae-miR-996|mir|MIMAT0014251	aae-miR-996	MIMAT0014251	unmapped	CGCTCGGGTTTTCCCGAGCGGGACGAGCATGTAATCTATATTTTTTTT
A_38_P00026538	A_38_P00026538	mir|aae-miR-996|mir|MIMAT0014251	aae-miR-996	MIMAT0014251	unmapped	CGCTCGGGTTTTCCCGAGCGGGACGAGCATGTAATCTAGATTTTTTTTT
A_38_P00026539	A_38_P00026539	mir|aae-miR-315-3p|mir|MIMAT0015370|mir|aae-miR-315*_v18.0|mir|MIMAT0015370	aae-miR-315-3p	MIMAT0015370	unmapped	CGCTCGGGTTTTCCCGAGCGGGACTTTGATTACTGCTCTTTTTTTTTT
A_38_P00026540	A_38_P00026540	mir|aae-miR-315-3p|mir|MIMAT0015370|mir|aae-miR-315*_v18.0|mir|MIMAT0015370	aae-miR-315-3p	MIMAT0015370	unmapped	CGCTCGGGTTTTCCCGAGCGGGACTTTGATTACTGCTCGTTTTTTTTTT
A_38_P00026541	A_38_P00026541	mir|aae-miR-276-3p|mir|MIMAT0014223|mir|aae-miR-276_v18.0|mir|MIMAT0014223	aae-miR-276-3p	MIMAT0014223	unmapped	CGCTCGGGTTTTCCCGAGCGGGAGCACGGTATGAAGAATTTTTTTT
A_38_P00026542	A_38_P00026542	mir|aae-miR-276-3p|mir|MIMAT0014223|mir|aae-miR-276_v18.0|mir|MIMAT0014223	aae-miR-276-3p	MIMAT0014223	unmapped	CGCTCGGGTTTTCCCGAGCGGGAGCACGGTATGAAGTATTTTTTTTT
A_38_P00026545	A_38_P00026545	mir|aae-miR-9b|mir|MIMAT0014324	aae-miR-9b	MIMAT0014324	unmapped	CGCTCGGGTTTTCCCGAGCGGGCATACAGCTAAAATCACTTTTTTTTTT
A_38_P00026546	A_38_P00026546	mir|aae-miR-9b|mir|MIMAT0014324	aae-miR-9b	MIMAT0014324	unmapped	CGCTCGGGTTTTCCCGAGCGGGCATACAGCTAAAATCACCTTTTTTTTTT
A_38_P00026547	A_38_P00026547	mir|aae-miR-124|mir|MIMAT0014282	aae-miR-124	MIMAT0014282	unmapped	CGCTCGGGTTTTCCCGAGCGGGCATTCACCGCGTTTTTTTTTTT
A_38_P00026548	A_38_P00026548	mir|aae-miR-124|mir|MIMAT0014282	aae-miR-124	MIMAT0014282	unmapped	CGCTCGGGTTTTCCCGAGCGGGCATTCACCGCGTGTTTTTTTTTT
A_38_P00026551	A_38_P00026551	mir|aae-miR-283|mir|MIMAT0014279	aae-miR-283	MIMAT0014279	unmapped	CGCTCGGGTTTTCCCGAGCGGGCCCAGAATTACCAGTATTTTTTTT
A_38_P00026552	A_38_P00026552	mir|aae-miR-283|mir|MIMAT0014279	aae-miR-283	MIMAT0014279	unmapped	CGCTCGGGTTTTCCCGAGCGGGCCCAGAATTACCAGCATTTTTTTTT
A_38_P00026555	A_38_P00026555	mir|aae-miR-980-3p|mir|MIMAT0014236|mir|aae-miR-980_v18.0|mir|MIMAT0014236	aae-miR-980-3p	MIMAT0014236	unmapped	CGCTCGGGTTTTCCCGAGCGGGCCCTTCACTAGGCTTTTTTTTTT
A_38_P00026556	A_38_P00026556	mir|aae-miR-980-3p|mir|MIMAT0014236|mir|aae-miR-980_v18.0|mir|MIMAT0014236	aae-miR-980-3p	MIMAT0014236	unmapped	CGCTCGGGTTTTCCCGAGCGGGCCCTTCACTAGGCATTTTTTTTTT
A_38_P00026559	A_38_P00026559	mir|aae-miR-2940-5p|mir|MIMAT0014283|mir|aae-miR-2940_v18.0|mir|MIMAT0014283	aae-miR-2940-5p	MIMAT0014283	unmapped	CGCTCGGGTTTTCCCGAGCGGGCCTCGACAGATAAGAATTTTTTTTT
A_38_P00026560	A_38_P00026560	mir|aae-miR-2940-5p|mir|MIMAT0014283|mir|aae-miR-2940_v18.0|mir|MIMAT0014283	aae-miR-2940-5p	MIMAT0014283	unmapped	CGCTCGGGTTTTCCCGAGCGGGCCTCGACAGATAAGATTTTTTTTTTT
A_38_P00026561	A_38_P00026561	mir|aae-miR-309a|mir|MIMAT0014272	aae-miR-309a	MIMAT0014272	unmapped	CGCTCGGGTTTTCCCGAGCGGGCGACAAACTTTGCTTTTTTTTTT
A_38_P00026562	A_38_P00026562	mir|aae-miR-309a|mir|MIMAT0014272	aae-miR-309a	MIMAT0014272	unmapped	CGCTCGGGTTTTCCCGAGCGGGCGACAAACTTTGCCTTTTTTTTTT
A_38_P00026563	A_38_P00026563	mir|aae-miR-275-3p|mir|MIMAT0014209|mir|aae-miR-275_v18.0|mir|MIMAT0014209	aae-miR-275-3p	MIMAT0014209	unmapped	CGCTCGGGTTTTCCCGAGCGGGCGCTACTTCAGGTTTTTTTTTTT
A_38_P00026564	A_38_P00026564	mir|aae-miR-275-3p|mir|MIMAT0014209|mir|aae-miR-275_v18.0|mir|MIMAT0014209	aae-miR-275-3p	MIMAT0014209	unmapped	CGCTCGGGTTTTCCCGAGCGGGCGCTACTTCAGGTATTTTTTTTTT
A_38_P00026565	A_38_P00026565	mir|aae-miR-275-3p|mir|MIMAT0014209|mir|aae-miR-275_v18.0|mir|MIMAT0014209	aae-miR-275-3p	MIMAT0014209	unmapped	CGCTCGGGTTTTCCCGAGCGGGCGCTACTTCAGGTACTATTTTTTTT
A_38_P00026568	A_38_P00026568	mir|aae-miR-980-5p|mir|MIMAT0014235|mir|aae-miR-980*_v18.0|mir|MIMAT0014235	aae-miR-980-5p	MIMAT0014235	unmapped	CGCTCGGGTTTTCCCGAGCGGGCTAGATGACCCAATGTTTTTTTTTT
A_38_P00026569	A_38_P00026569	mir|aae-miR-980-5p|mir|MIMAT0014235|mir|aae-miR-980*_v18.0|mir|MIMAT0014235	aae-miR-980-5p	MIMAT0014235	unmapped	CGCTCGGGTTTTCCCGAGCGGGCTAGATGACCCAATGATTTTTTTTTT
A_38_P00026572	A_38_P00026572	mir|aae-miR-2a-3p|mir|MIMAT0014226|mir|aae-miR-2a_v18.0|mir|MIMAT0014226	aae-miR-2a-3p	MIMAT0014226	unmapped	CGCTCGGGTTTTCCCGAGCGGGCTCTTCAAAGCTGGTATTTTTTTT
A_38_P00026573	A_38_P00026573	mir|aae-miR-2a-3p|mir|MIMAT0014226|mir|aae-miR-2a_v18.0|mir|MIMAT0014226	aae-miR-2a-3p	MIMAT0014226	unmapped	CGCTCGGGTTTTCCCGAGCGGGCTCTTCAAAGCTGGCATTTTTTTTT
A_38_P00026574	A_38_P00026574	mir|aae-miR-998|mir|MIMAT0014227	aae-miR-998	MIMAT0014227	unmapped	CGCTCGGGTTTTCCCGAGCGGGCTGAATCTCATGGTGTATTTTTTTT
A_38_P00026575	A_38_P00026575	mir|aae-miR-998|mir|MIMAT0014227	aae-miR-998	MIMAT0014227	unmapped	CGCTCGGGTTTTCCCGAGCGGGCTGAATCTCATGGTGCATTTTTTTTT
A_38_P00026576	A_38_P00026576	mir|aae-miR-306-3p|mir|MIMAT0014230|mir|aae-miR-306*_v18.0|mir|MIMAT0014230	aae-miR-306-3p	MIMAT0014230	unmapped	CGCTCGGGTTTTCCCGAGCGGGCTTAGATACCGAGGTTTTTTTTTTT
A_38_P00026577	A_38_P00026577	mir|aae-miR-306-3p|mir|MIMAT0014230|mir|aae-miR-306*_v18.0|mir|MIMAT0014230	aae-miR-306-3p	MIMAT0014230	unmapped	CGCTCGGGTTTTCCCGAGCGGGCTTAGATACCGAGGTGTATTTTTTTT
A_38_P00026581	A_38_P00026581	mir|aae-miR-1889-3p|mir|MIMAT0014234|mir|aae-miR-1889_v18.0|mir|MIMAT0014234	aae-miR-1889-3p	MIMAT0014234	unmapped	CGCTCGGGTTTTCCCGAGCGGGGAAACCCCAATCTGATTTTTTTTT
A_38_P00026582	A_38_P00026582	mir|aae-miR-1889-3p|mir|MIMAT0014234|mir|aae-miR-1889_v18.0|mir|MIMAT0014234	aae-miR-1889-3p	MIMAT0014234	unmapped	CGCTCGGGTTTTCCCGAGCGGGGAAACCCCAATCTGTTTTTTTTTTT
A_38_P00026585	A_38_P00026585	mir|aae-miR-278-5p|mir|MIMAT0014237|mir|aae-miR-278_v18.0|mir|MIMAT0014237	aae-miR-278-5p	MIMAT0014237	unmapped	CGCTCGGGTTTTCCCGAGCGGGGCCGCTGAAGACATTTTTTTTT
A_38_P00026586	A_38_P00026586	mir|aae-miR-278-5p|mir|MIMAT0014237|mir|aae-miR-278_v18.0|mir|MIMAT0014237	aae-miR-278-5p	MIMAT0014237	unmapped	CGCTCGGGTTTTCCCGAGCGGGGCCGCTGAAGACTTATTTTTTTT
A_38_P00026587	A_38_P00026587	mir|aae-miR-34-3p|mir|MIMAT0014246|mir|aae-miR-34*_v18.0|mir|MIMAT0014246	aae-miR-34-3p	MIMAT0014246	unmapped	CGCTCGGGTTTTCCCGAGCGGGGCGGCAGGGTTTTTTTTTT
A_38_P00026588	A_38_P00026588	mir|aae-miR-34-3p|mir|MIMAT0014246|mir|aae-miR-34*_v18.0|mir|MIMAT0014246	aae-miR-34-3p	MIMAT0014246	unmapped	CGCTCGGGTTTTCCCGAGCGGGGCGGCAGGGCTTTTTTTTTT
A_38_P00026589	A_38_P00026589	mir|aae-miR-286b|mir|MIMAT0014313	aae-miR-286b	MIMAT0014313	unmapped	CGCTCGGGTTTTCCCGAGCGGGGGATACGAGTGTTCTTTTTTTTTT
A_38_P00026590	A_38_P00026590	mir|aae-miR-286b|mir|MIMAT0014313	aae-miR-286b	MIMAT0014313	unmapped	CGCTCGGGTTTTCCCGAGCGGGGGATACGAGTGTTCGTATTTTTTTT
A_38_P00026591	A_38_P00026591	mir|aae-miR-263a-3p|mir|MIMAT0015372|mir|aae-miR-263a*_v18.0|mir|MIMAT0015372	aae-miR-263a-3p	MIMAT0015372	unmapped	CGCTCGGGTTTTCCCGAGCGGGGGATGCCACTGCTTTTTTTTTT
A_38_P00026592	A_38_P00026592	mir|aae-miR-263a-3p|mir|MIMAT0015372|mir|aae-miR-263a*_v18.0|mir|MIMAT0015372	aae-miR-263a-3p	MIMAT0015372	unmapped	CGCTCGGGTTTTCCCGAGCGGGGGATGCCACTGCCTTTTTTTTTT
A_38_P00026595	A_38_P00026595	mir|aae-miR-285|mir|MIMAT0014273	aae-miR-285	MIMAT0014273	unmapped	CGCTCGGGTTTTCCCGAGCGGGTACTGATTTCGAATGGATTTTTTTTT
A_38_P00026596	A_38_P00026596	mir|aae-miR-285|mir|MIMAT0014273	aae-miR-285	MIMAT0014273	unmapped	CGCTCGGGTTTTCCCGAGCGGGTACTGATTTCGAATGGTTTTTTTTTTT
A_38_P00026599	A_38_P00026599	mir|aae-bantam-5p|mir|MIMAT0014218	aae-bantam-5p	MIMAT0014218	unmapped	CGCTCGGGTTTTCCCGAGCGGGTCAGATCGAAAATGAATTTTTTTTTT
A_38_P00026600	A_38_P00026600	mir|aae-bantam-5p|mir|MIMAT0014218	aae-bantam-5p	MIMAT0014218	unmapped	CGCTCGGGTTTTCCCGAGCGGGTCAGATCGAAAATGAAATTTTTTTTTT
A_38_P00026601	A_38_P00026601	mir|aae-bantam-5p|mir|MIMAT0014218	aae-bantam-5p	MIMAT0014218	unmapped	CGCTCGGGTTTTCCCGAGCGGGTCAGATCGAAAATGAAAATTTTTTTTTT
A_38_P00026602	A_38_P00026602	mir|aae-miR-281-5p|mir|MIMAT0014231|mir|aae-miR-281_v18.0|mir|MIMAT0014231	aae-miR-281-5p	MIMAT0014231	unmapped	CGCTCGGGTTTTCCCGAGCGGGTCGACGGATAGCTTATTTTTTTT
A_38_P00026603	A_38_P00026603	mir|aae-miR-281-5p|mir|MIMAT0014231|mir|aae-miR-281_v18.0|mir|MIMAT0014231	aae-miR-281-5p	MIMAT0014231	unmapped	CGCTCGGGTTTTCCCGAGCGGGTCGACGGATAGCTCATTTTTTTTT
A_38_P00026604	A_38_P00026604	mir|aae-miR-277-3p|mir|MIMAT0014211|mir|aae-miR-277_v18.0|mir|MIMAT0014211	aae-miR-277-3p	MIMAT0014211	unmapped	CGCTCGGGTTTTCCCGAGCGGGTCGTACCAGATAGTGTTTTTTTTTT
A_38_P00026605	A_38_P00026605	mir|aae-miR-277-3p|mir|MIMAT0014211|mir|aae-miR-277_v18.0|mir|MIMAT0014211	aae-miR-277-3p	MIMAT0014211	unmapped	CGCTCGGGTTTTCCCGAGCGGGTCGTACCAGATAGTGCTATTTTTTTT
A_38_P00026606	A_38_P00026606	mir|aae-miR-275-5p|mir|MIMAT0014208|mir|aae-miR-275*_v18.0|mir|MIMAT0014208	aae-miR-275-5p	MIMAT0014208	unmapped	CGCTCGGGTTTTCCCGAGCGGGTCTCGGTTCCTGTATTTTTTTT
A_38_P00026607	A_38_P00026607	mir|aae-miR-275-5p|mir|MIMAT0014208|mir|aae-miR-275*_v18.0|mir|MIMAT0014208	aae-miR-275-5p	MIMAT0014208	unmapped	CGCTCGGGTTTTCCCGAGCGGGTCTCGGTTCCTGCAATTTTTTTT
A_38_P00026613	A_38_P00026613	mir|aae-miR-927|mir|MIMAT0014271	aae-miR-927	MIMAT0014271	unmapped	CGCTCGGGTTTTCCCGAGCGGGTTTCAGAACCCAAACTTTTTTTTTT
A_38_P00026614	A_38_P00026614	mir|aae-miR-927|mir|MIMAT0014271	aae-miR-927	MIMAT0014271	unmapped	CGCTCGGGTTTTCCCGAGCGGGTTTCAGAACCCAAACGTATTTTTTTT
A_38_P00026615	A_38_P00026615	mir|aae-miR-2945-3p|mir|MIMAT0014316|mir|aae-miR-2945_v18.0|mir|MIMAT0014316	aae-miR-2945-3p	MIMAT0014316	unmapped	CGCTCGGGTTTTCCCGAGCGGTAAACGAGTCTGCCTCATTTTTTTTT
A_38_P00026616	A_38_P00026616	mir|aae-miR-2945-3p|mir|MIMAT0014316|mir|aae-miR-2945_v18.0|mir|MIMAT0014316	aae-miR-2945-3p	MIMAT0014316	unmapped	CGCTCGGGTTTTCCCGAGCGGTAAACGAGTCTGCCTCTTTTTTTTTTT
A_38_P00026617	A_38_P00026617	mir|aae-miR-281-3p|mir|MIMAT0014232|mir|aae-miR-281*_v18.0|mir|MIMAT0014232	aae-miR-281-3p	MIMAT0014232	unmapped	CGCTCGGGTTTTCCCGAGCGGTAAAGAGAGCAATTCCATTTTTTTTTTT
A_38_P00026618	A_38_P00026618	mir|aae-miR-281-3p|mir|MIMAT0014232|mir|aae-miR-281*_v18.0|mir|MIMAT0014232	aae-miR-281-3p	MIMAT0014232	unmapped	CGCTCGGGTTTTCCCGAGCGGTAAAGAGAGCAATTCCATGTTTTTTTTTT
A_38_P00026621	A_38_P00026621	mir|aae-miR-305-3p|mir|MIMAT0014250|mir|aae-miR-305*_v18.0|mir|MIMAT0014250	aae-miR-305-3p	MIMAT0014250	unmapped	CGCTCGGGTTTTCCCGAGCGGTAAGTGTACTCCAACATGATTTTTTTTT
A_38_P00026622	A_38_P00026622	mir|aae-miR-305-3p|mir|MIMAT0014250|mir|aae-miR-305*_v18.0|mir|MIMAT0014250	aae-miR-305-3p	MIMAT0014250	unmapped	CGCTCGGGTTTTCCCGAGCGGTAAGTGTACTCCAACATGTTTTTTTTTTT
A_38_P00026623	A_38_P00026623	mir|aae-miR-92a-3p|mir|MIMAT0014228|mir|aae-miR-92a_v18.0|mir|MIMAT0014228	aae-miR-92a-3p	MIMAT0014228	unmapped	CGCTCGGGTTTTCCCGAGCGGTAGGCCGGGACAATATTTTTTTT
A_38_P00026624	A_38_P00026624	mir|aae-miR-92a-3p|mir|MIMAT0014228|mir|aae-miR-92a_v18.0|mir|MIMAT0014228	aae-miR-92a-3p	MIMAT0014228	unmapped	CGCTCGGGTTTTCCCGAGCGGTAGGCCGGGACAAGATTTTTTTTT
A_38_P00026625	A_38_P00026625	mir|aae-miR-92a-3p|mir|MIMAT0014228|mir|aae-miR-92a_v18.0|mir|MIMAT0014228	aae-miR-92a-3p	MIMAT0014228	unmapped	CGCTCGGGTTTTCCCGAGCGGTAGGCCGGGACAAGTTTTTTTTTTT
A_38_P00026626	A_38_P00026626	mir|aae-miR-2944b-5p|mir|MIMAT0014304|mir|aae-miR-2944b_v18.0|mir|MIMAT0014304	aae-miR-2944b-5p	MIMAT0014304	unmapped	CGCTCGGGTTTTCCCGAGCGGTATATCACACCGGGAGAATTTTTTTT
A_38_P00026627	A_38_P00026627	mir|aae-miR-2944b-5p|mir|MIMAT0014304|mir|aae-miR-2944b_v18.0|mir|MIMAT0014304	aae-miR-2944b-5p	MIMAT0014304	unmapped	CGCTCGGGTTTTCCCGAGCGGTATATCACACCGGGAGTATTTTTTTTT
A_38_P00026630	A_38_P00026630	mir|aae-miR-2944a-5p|mir|MIMAT0014302|mir|aae-miR-2944a_v18.0|mir|MIMAT0014302	aae-miR-2944a-5p	MIMAT0014302	unmapped	CGCTCGGGTTTTCCCGAGCGGTCAGATCACAGCAGAATATTTTTTTT
A_38_P00026631	A_38_P00026631	mir|aae-miR-2944a-5p|mir|MIMAT0014302|mir|aae-miR-2944a_v18.0|mir|MIMAT0014302	aae-miR-2944a-5p	MIMAT0014302	unmapped	CGCTCGGGTTTTCCCGAGCGGTCAGATCACAGCAGAAGAATTTTTTTT
A_38_P00026632	A_38_P00026632	mir|aae-miR-2944a-5p|mir|MIMAT0014302|mir|aae-miR-2944a_v18.0|mir|MIMAT0014302	aae-miR-2944a-5p	MIMAT0014302	unmapped	CGCTCGGGTTTTCCCGAGCGGTCAGATCACAGCAGAAGTATTTTTTTTT
A_38_P00026633	A_38_P00026633	mir|aae-miR-31|mir|MIMAT0014276	aae-miR-31	MIMAT0014276	unmapped	CGCTCGGGTTTTCCCGAGCGGTCAGCTATGCCAACATTATTTTTTTT
A_38_P00026634	A_38_P00026634	mir|aae-miR-31|mir|MIMAT0014276	aae-miR-31	MIMAT0014276	unmapped	CGCTCGGGTTTTCCCGAGCGGTCAGCTATGCCAACATCAATTTTTTTT
A_38_P00026637	A_38_P00026637	mir|aae-miR-2944b-3p|mir|MIMAT0015373|mir|aae-miR-2944b*_v18.0|mir|MIMAT0015373	aae-miR-2944b-3p	MIMAT0015373	unmapped	CGCTCGGGTTTTCCCGAGCGGTCAGGTAACTACTGCTGATTTTTTTTT
A_38_P00026638	A_38_P00026638	mir|aae-miR-2944b-3p|mir|MIMAT0015373|mir|aae-miR-2944b*_v18.0|mir|MIMAT0015373	aae-miR-2944b-3p	MIMAT0015373	unmapped	CGCTCGGGTTTTCCCGAGCGGTCAGGTAACTACTGCTGTTTTTTTTTTT
A_38_P00026643	A_38_P00026643	mir|aae-miR-2946|mir|MIMAT0014325	aae-miR-2946	MIMAT0014325	unmapped	CGCTCGGGTTTTCCCGAGCGGTCCCCATATCTTTTCCTATTTTTTTT
A_38_P00026644	A_38_P00026644	mir|aae-miR-2946|mir|MIMAT0014325	aae-miR-2946	MIMAT0014325	unmapped	CGCTCGGGTTTTCCCGAGCGGTCCCCATATCTTTTCCGATTTTTTTTT
A_38_P00026645	A_38_P00026645	mir|aae-miR-307|mir|MIMAT0014296	aae-miR-307	MIMAT0014296	unmapped	CGCTCGGGTTTTCCCGAGCGGTCGCTCACTCAAGGATTTTTTTTTT
A_38_P00026646	A_38_P00026646	mir|aae-miR-307|mir|MIMAT0014296	aae-miR-307	MIMAT0014296	unmapped	CGCTCGGGTTTTCCCGAGCGGTCGCTCACTCAAGGAGTATTTTTTTT
A_38_P00026651	A_38_P00026651	mir|aae-miR-988-5p|mir|MIMAT0014280|mir|aae-miR-988*_v18.0|mir|MIMAT0014280	aae-miR-988-5p	MIMAT0014280	unmapped	CGCTCGGGTTTTCCCGAGCGGTCTCATTGTCACAAAGCTTTTTTTTTT
A_38_P00026652	A_38_P00026652	mir|aae-miR-988-5p|mir|MIMAT0014280|mir|aae-miR-988*_v18.0|mir|MIMAT0014280	aae-miR-988-5p	MIMAT0014280	unmapped	CGCTCGGGTTTTCCCGAGCGGTCTCATTGTCACAAAGCATTTTTTTTTT
A_38_P00026657	A_38_P00026657	mir|aae-miR-309b-3p|mir|MIMAT0014320|mir|aae-miR-309b_v18.0|mir|MIMAT0014320	aae-miR-309b-3p	MIMAT0014320	unmapped	CGCTCGGGTTTTCCCGAGCGGTGCGACAAACTATGCTTTTTTTTTT
A_38_P00026658	A_38_P00026658	mir|aae-miR-309b-3p|mir|MIMAT0014320|mir|aae-miR-309b_v18.0|mir|MIMAT0014320	aae-miR-309b-3p	MIMAT0014320	unmapped	CGCTCGGGTTTTCCCGAGCGGTGCGACAAACTATGCCTTTTTTTTTT
A_38_P00026659	A_38_P00026659	mir|aae-miR-277-5p|mir|MIMAT0014210|mir|aae-miR-277*_v18.0|mir|MIMAT0014210	aae-miR-277-5p	MIMAT0014210	unmapped	CGCTCGGGTTTTCCCGAGCGGTGTAAATGCACTTCTGACTTTTTTTTTT
A_38_P00026660	A_38_P00026660	mir|aae-miR-277-5p|mir|MIMAT0014210|mir|aae-miR-277*_v18.0|mir|MIMAT0014210	aae-miR-277-5p	MIMAT0014210	unmapped	CGCTCGGGTTTTCCCGAGCGGTGTAAATGCACTTCTGACATTTTTTTTTT
A_38_P00026661	A_38_P00026661	mir|aae-miR-2944a-3p|mir|MIMAT0014303|mir|aae-miR-2944a*_v18.0|mir|MIMAT0014303	aae-miR-2944a-3p	MIMAT0014303	unmapped	CGCTCGGGTTTTCCCGAGCGGTTAAAGTACAACTACTGTGAATTTTTTTTT
A_38_P00026662	A_38_P00026662	mir|aae-miR-2944a-3p|mir|MIMAT0014303|mir|aae-miR-2944a*_v18.0|mir|MIMAT0014303	aae-miR-2944a-3p	MIMAT0014303	unmapped	CGCTCGGGTTTTCCCGAGCGGTTAAAGTACAACTACTGTGATTTTTTTTTTT
A_38_P00026667	A_38_P00026667	mir|aae-miR-2a-5p|mir|MIMAT0014225|mir|aae-miR-2a*_v18.0|mir|MIMAT0014225	aae-miR-2a-5p	MIMAT0014225	unmapped	CGCTCGGGTTTTCCCGAGCGGTTTCACAACCACTTTGATTTTTTTTTT
A_38_P00026668	A_38_P00026668	mir|aae-miR-2a-5p|mir|MIMAT0014225|mir|aae-miR-2a*_v18.0|mir|MIMAT0014225	aae-miR-2a-5p	MIMAT0014225	unmapped	CGCTCGGGTTTTCCCGAGCGGTTTCACAACCACTTTGAGTTTTTTTTTT
A_38_P00026669	A_38_P00026669	mir|aae-miR-2943|mir|MIMAT0014301	aae-miR-2943	MIMAT0014301	unmapped	CGCTCGGGTTTTCCCGAGCGGTTTGCCTGCAAGTGTTTTTTTTTT
A_38_P00026670	A_38_P00026670	mir|aae-miR-2943|mir|MIMAT0014301	aae-miR-2943	MIMAT0014301	unmapped	CGCTCGGGTTTTCCCGAGCGGTTTGCCTGCAAGTGCTATTTTTTTT
A_38_P00026681	A_38_P00026681	mir|cqu-miR-281-3p|mir|MIMAT0014359|mir|cqu-miR-281*_v18.0|mir|MIMAT0014359	cqu-miR-281-3p	MIMAT0014359	unmapped	CGCTCGGGTTTTCCCGAGCGGAAAGAGAGCAATTCCATGTTTTTTTTTT
A_38_P00026682	A_38_P00026682	mir|cqu-miR-281-3p|mir|MIMAT0014359|mir|cqu-miR-281*_v18.0|mir|MIMAT0014359	cqu-miR-281-3p	MIMAT0014359	unmapped	CGCTCGGGTTTTCCCGAGCGGAAAGAGAGCAATTCCATGATTTTTTTTTT
A_38_P00026693	A_38_P00026693	mir|cqu-miR-8-3p|mir|MIMAT0014409|mir|cqu-miR-8_v18.0|mir|MIMAT0014409	cqu-miR-8-3p	MIMAT0014409	unmapped	CGCTCGGGTTTTCCCGAGCGGACATCTTTACCTGACAGTTATTTTTTTT
A_38_P00026694	A_38_P00026694	mir|cqu-miR-8-3p|mir|MIMAT0014409|mir|cqu-miR-8_v18.0|mir|MIMAT0014409	cqu-miR-8-3p	MIMAT0014409	unmapped	CGCTCGGGTTTTCCCGAGCGGACATCTTTACCTGACAGTAAATTTTTTTT
A_38_P00026699	A_38_P00026699	mir|cqu-miR-996|mir|MIMAT0014419	cqu-miR-996	MIMAT0014419	unmapped	CGCTCGGGTTTTCCCGAGCGGACGAGCATGTAATCTAGTTTTTTTTTTT
A_38_P00026700	A_38_P00026700	mir|cqu-miR-996|mir|MIMAT0014419	cqu-miR-996	MIMAT0014419	unmapped	CGCTCGGGTTTTCCCGAGCGGACGAGCATGTAATCTAGTCTTTTTTTTTT
A_38_P00026713	A_38_P00026713	mir|cqu-miR-305-5p|mir|MIMAT0014382|mir|cqu-miR-305_v18.0|mir|MIMAT0014382	cqu-miR-305-5p	MIMAT0014382	unmapped	CGCTCGGGTTTTCCCGAGCGGAGAGCACCTGATGAAGATTTTTTTTT
A_38_P00026714	A_38_P00026714	mir|cqu-miR-305-5p|mir|MIMAT0014382|mir|cqu-miR-305_v18.0|mir|MIMAT0014382	cqu-miR-305-5p	MIMAT0014382	unmapped	CGCTCGGGTTTTCCCGAGCGGAGAGCACCTGATGAAGTTTTTTTTTTT
A_38_P00026721	A_38_P00026721	mir|cqu-miR-276-5p|mir|MIMAT0014392|mir|cqu-miR-276*_v18.0|mir|MIMAT0014392	cqu-miR-276-5p	MIMAT0014392	unmapped	CGCTCGGGTTTTCCCGAGCGGAGGAACTCTATACCTCGTATTTTTTTT
A_38_P00026722	A_38_P00026722	mir|cqu-miR-276-5p|mir|MIMAT0014392|mir|cqu-miR-276*_v18.0|mir|MIMAT0014392	cqu-miR-276-5p	MIMAT0014392	unmapped	CGCTCGGGTTTTCCCGAGCGGAGGAACTCTATACCTCGCATTTTTTTTT
A_38_P00026723	A_38_P00026723	mir|cqu-miR-92|mir|MIMAT0014399	cqu-miR-92	MIMAT0014399	unmapped	CGCTCGGGTTTTCCCGAGCGGAGGCCGGGACAAGATTTTTTTTT
A_38_P00026724	A_38_P00026724	mir|cqu-miR-92|mir|MIMAT0014399	cqu-miR-92	MIMAT0014399	unmapped	CGCTCGGGTTTTCCCGAGCGGAGGCCGGGACAAGTTTTTTTTTTT
A_38_P00026725	A_38_P00026725	mir|cqu-miR-1175-3p|mir|MIMAT0014391|mir|cqu-miR-1175*_v18.0|mir|MIMAT0014391	cqu-miR-1175-3p	MIMAT0014391	unmapped	CGCTCGGGTTTTCCCGAGCGGAGTCGGAGAAGTAGAATTATTTTTTTT
A_38_P00026726	A_38_P00026726	mir|cqu-miR-1175-3p|mir|MIMAT0014391|mir|cqu-miR-1175*_v18.0|mir|MIMAT0014391	cqu-miR-1175-3p	MIMAT0014391	unmapped	CGCTCGGGTTTTCCCGAGCGGAGTCGGAGAAGTAGAATCATTTTTTTTT
A_38_P00026729	A_38_P00026729	mir|cqu-miR-31-3p|mir|MIMAT0014426|mir|cqu-miR-31*_v18.0|mir|MIMAT0014426	cqu-miR-31-3p	MIMAT0014426	unmapped	CGCTCGGGTTTTCCCGAGCGGATAGACAAGAAGTTGAATAGTATTTTTTTT
A_38_P00026730	A_38_P00026730	mir|cqu-miR-31-3p|mir|MIMAT0014426|mir|cqu-miR-31*_v18.0|mir|MIMAT0014426	cqu-miR-31-3p	MIMAT0014426	unmapped	CGCTCGGGTTTTCCCGAGCGGATAGACAAGAAGTTGAATAGCATTTTTTTTT
A_38_P00026733	A_38_P00026733	mir|cqu-miR-210-3p|mir|MIMAT0014397|mir|cqu-miR-210_v18.0|mir|MIMAT0014397	cqu-miR-210-3p	MIMAT0014397	unmapped	CGCTCGGGTTTTCCCGAGCGGATAGCCGTTGTCACACTTTTTTTTTT
A_38_P00026734	A_38_P00026734	mir|cqu-miR-210-3p|mir|MIMAT0014397|mir|cqu-miR-210_v18.0|mir|MIMAT0014397	cqu-miR-210-3p	MIMAT0014397	unmapped	CGCTCGGGTTTTCCCGAGCGGATAGCCGTTGTCACACGTTTTTTTTTT
A_38_P00026737	A_38_P00026737	mir|cqu-miR-12-5p|mir|MIMAT0014394|mir|cqu-miR-12*_v18.0|mir|MIMAT0014394	cqu-miR-12-5p	MIMAT0014394	unmapped	CGCTCGGGTTTTCCCGAGCGGATCCGACAGGGCAGTTTTTTTTTT
A_38_P00026738	A_38_P00026738	mir|cqu-miR-12-5p|mir|MIMAT0014394|mir|cqu-miR-12*_v18.0|mir|MIMAT0014394	cqu-miR-12-5p	MIMAT0014394	unmapped	CGCTCGGGTTTTCCCGAGCGGATCCGACAGGGCAGGTATTTTTTTT
A_38_P00026741	A_38_P00026741	mir|cqu-miR-2951-3p|mir|MIMAT0014433|mir|cqu-miR-2951*_v18.0|mir|MIMAT0014433	cqu-miR-2951-3p	MIMAT0014433	unmapped	CGCTCGGGTTTTCCCGAGCGGATTTCCAGTACACGGATTTTTTTTTT
A_38_P00026742	A_38_P00026742	mir|cqu-miR-2951-3p|mir|MIMAT0014433|mir|cqu-miR-2951*_v18.0|mir|MIMAT0014433	cqu-miR-2951-3p	MIMAT0014433	unmapped	CGCTCGGGTTTTCCCGAGCGGATTTCCAGTACACGGAATTTTTTTTTT
A_38_P00026756	A_38_P00026756	mir|cqu-miR-283|mir|MIMAT0014379	cqu-miR-283	MIMAT0014379	unmapped	CGCTCGGGTTTTCCCGAGCGGCCCAGAATTACCAGCATTTTTTTTT
A_38_P00026757	A_38_P00026757	mir|cqu-miR-283|mir|MIMAT0014379	cqu-miR-283	MIMAT0014379	unmapped	CGCTCGGGTTTTCCCGAGCGGCCCAGAATTACCAGCTTTTTTTTTTT
A_38_P00026762	A_38_P00026762	mir|cqu-miR-993-3p|mir|MIMAT0014376|mir|cqu-miR-993*_v18.0|mir|MIMAT0014376	cqu-miR-993-3p	MIMAT0014376	unmapped	CGCTCGGGTTTTCCCGAGCGGCCTCTATAGAAACGAGCAATTTTTTTT
A_38_P00026763	A_38_P00026763	mir|cqu-miR-993-3p|mir|MIMAT0014376|mir|cqu-miR-993*_v18.0|mir|MIMAT0014376	cqu-miR-993-3p	MIMAT0014376	unmapped	CGCTCGGGTTTTCCCGAGCGGCCTCTATAGAAACGAGCTATTTTTTTTT
A_38_P00026781	A_38_P00026781	mir|cqu-miR-279-5p|mir|MIMAT0014417|mir|cqu-miR-279*_v18.0|mir|MIMAT0014417	cqu-miR-279-5p	MIMAT0014417	unmapped	CGCTCGGGTTTTCCCGAGCGGGAACCACTAGATTCACATTTTTTTTTT
A_38_P00026782	A_38_P00026782	mir|cqu-miR-279-5p|mir|MIMAT0014417|mir|cqu-miR-279*_v18.0|mir|MIMAT0014417	cqu-miR-279-5p	MIMAT0014417	unmapped	CGCTCGGGTTTTCCCGAGCGGGAACCACTAGATTCACACTTTTTTTTTT
A_38_P00026785	A_38_P00026785	mir|cqu-miR-100-3p|mir|MIMAT0014388|mir|cqu-miR-100*_v18.0|mir|MIMAT0014388	cqu-miR-100-3p	MIMAT0014388	unmapped	CGCTCGGGTTTTCCCGAGCGGGATCCCATATATCCGGTTTTTTTTTT
A_38_P00026786	A_38_P00026786	mir|cqu-miR-100-3p|mir|MIMAT0014388|mir|cqu-miR-100*_v18.0|mir|MIMAT0014388	cqu-miR-100-3p	MIMAT0014388	unmapped	CGCTCGGGTTTTCCCGAGCGGGATCCCATATATCCGGCTATTTTTTTT
A_38_P00026787	A_38_P00026787	mir|cqu-miR-317-5p|mir|MIMAT0014384|mir|cqu-miR-317*_v18.0|mir|MIMAT0014384	cqu-miR-317-5p	MIMAT0014384	unmapped	CGCTCGGGTTTTCCCGAGCGGGCAAAGCGAGCACTTTTTTTTTT
A_38_P00026788	A_38_P00026788	mir|cqu-miR-317-5p|mir|MIMAT0014384|mir|cqu-miR-317*_v18.0|mir|MIMAT0014384	cqu-miR-317-5p	MIMAT0014384	unmapped	CGCTCGGGTTTTCCCGAGCGGGCAAAGCGAGCACATTTTTTTTTT
A_38_P00026789	A_38_P00026789	mir|cqu-miR-2941-1-5p|mir|MIMAT0014434|mir|cqu-miR-2941-1*_v18.0|mir|MIMAT0014434	cqu-miR-2941-1-5p	MIMAT0014434	unmapped	CGCTCGGGTTTTCCCGAGCGGGCACTACGACTAAACATTTTTTTTTT
A_38_P00026790	A_38_P00026790	mir|cqu-miR-2941-1-5p|mir|MIMAT0014434|mir|cqu-miR-2941-1*_v18.0|mir|MIMAT0014434	cqu-miR-2941-1-5p	MIMAT0014434	unmapped	CGCTCGGGTTTTCCCGAGCGGGCACTACGACTAAACACTTTTTTTTTT
A_38_P00026793	A_38_P00026793	mir|cqu-miR-2951-5p|mir|MIMAT0014432|mir|cqu-miR-2951_v18.0|mir|MIMAT0014432	cqu-miR-2951-5p	MIMAT0014432	unmapped	CGCTCGGGTTTTCCCGAGCGGGCCACCCCTGCTATTTTTTTT
A_38_P00026794	A_38_P00026794	mir|cqu-miR-2951-5p|mir|MIMAT0014432|mir|cqu-miR-2951_v18.0|mir|MIMAT0014432	cqu-miR-2951-5p	MIMAT0014432	unmapped	CGCTCGGGTTTTCCCGAGCGGGCCACCCCTGCGATTTTTTTTT
A_38_P00026795	A_38_P00026795	mir|cqu-miR-2952|mir|MIMAT0014436	cqu-miR-2952	MIMAT0014436	unmapped	CGCTCGGGTTTTCCCGAGCGGGCCCTCAGTCATGGTTTTTTTTTT
A_38_P00026796	A_38_P00026796	mir|cqu-miR-2952|mir|MIMAT0014436	cqu-miR-2952	MIMAT0014436	unmapped	CGCTCGGGTTTTCCCGAGCGGGCCCTCAGTCATGGCTTTTTTTTTT
A_38_P00026801	A_38_P00026801	mir|cqu-miR-1174|mir|MIMAT0014354	cqu-miR-1174	MIMAT0014354	unmapped	CGCTCGGGTTTTCCCGAGCGGGCCGATGATCTAAAATACTTTTTTTTTT
A_38_P00026802	A_38_P00026802	mir|cqu-miR-1174|mir|MIMAT0014354	cqu-miR-1174	MIMAT0014354	unmapped	CGCTCGGGTTTTCCCGAGCGGGCCGATGATCTAAAATACCTTTTTTTTTT
A_38_P00026805	A_38_P00026805	mir|cqu-miR-309|mir|MIMAT0014444	cqu-miR-309	MIMAT0014444	unmapped	CGCTCGGGTTTTCCCGAGCGGGCGACAAACTATGCCTTTTTTTTTT
A_38_P00026806	A_38_P00026806	mir|cqu-miR-309|mir|MIMAT0014444	cqu-miR-309	MIMAT0014444	unmapped	CGCTCGGGTTTTCCCGAGCGGGCGACAAACTATGCCCTTTTTTTTTT
A_38_P00026821	A_38_P00026821	mir|cqu-miR-11-5p|mir|MIMAT0014406|mir|cqu-miR-11*_v18.0|mir|MIMAT0014406	cqu-miR-11-5p	MIMAT0014406	unmapped	CGCTCGGGTTTTCCCGAGCGGGGTCACAGCCGGTTTTTTTTTT
A_38_P00026822	A_38_P00026822	mir|cqu-miR-11-5p|mir|MIMAT0014406|mir|cqu-miR-11*_v18.0|mir|MIMAT0014406	cqu-miR-11-5p	MIMAT0014406	unmapped	CGCTCGGGTTTTCCCGAGCGGGGTCACAGCCGGATATTTTTTTT
A_38_P00026832	A_38_P00026832	mir|cqu-miR-305-3p|mir|MIMAT0014383|mir|cqu-miR-305*_v18.0|mir|MIMAT0014383	cqu-miR-305-3p	MIMAT0014383	unmapped	CGCTCGGGTTTTCCCGAGCGGGTGTACTCCAACATGTTTTTTTTTTT
A_38_P00026833	A_38_P00026833	mir|cqu-miR-305-3p|mir|MIMAT0014383|mir|cqu-miR-305*_v18.0|mir|MIMAT0014383	cqu-miR-305-3p	MIMAT0014383	unmapped	CGCTCGGGTTTTCCCGAGCGGGTGTACTCCAACATGTGTTTTTTTTTT
A_38_P00026834	A_38_P00026834	mir|cqu-let-7-3p|mir|MIMAT0014367|mir|cqu-let-7*_v18.0|mir|MIMAT0014367	cqu-let-7-3p	MIMAT0014367	unmapped	CGCTCGGGTTTTCCCGAGCGGGTTAAGCTAGCGGATTTTTTTTTTTT
A_38_P00026835	A_38_P00026835	mir|cqu-let-7-3p|mir|MIMAT0014367|mir|cqu-let-7*_v18.0|mir|MIMAT0014367	cqu-let-7-3p	MIMAT0014367	unmapped	CGCTCGGGTTTTCCCGAGCGGGTTAAGCTAGCGGATTGTTTTTTTTTT
A_38_P00026840	A_38_P00026840	mir|cqu-miR-932-3p|mir|MIMAT0014415|mir|cqu-miR-932_v18.0|mir|MIMAT0014415	cqu-miR-932-3p	MIMAT0014415	unmapped	CGCTCGGGTTTTCCCGAGCGGTCACTTCCACATTGCTATTTTTTTTT
A_38_P00026841	A_38_P00026841	mir|cqu-miR-932-3p|mir|MIMAT0014415|mir|cqu-miR-932_v18.0|mir|MIMAT0014415	cqu-miR-932-3p	MIMAT0014415	unmapped	CGCTCGGGTTTTCCCGAGCGGTCACTTCCACATTGCTTTTTTTTTTTT
A_38_P00026844	A_38_P00026844	mir|cqu-bantam-3p|mir|MIMAT0014421|mir|cqu-bantam*_v18.0|mir|MIMAT0014421	cqu-bantam-3p	MIMAT0014421	unmapped	CGCTCGGGTTTTCCCGAGCGGTCAGCTTTCAAAATGATCATTTTTTTTT
A_38_P00026845	A_38_P00026845	mir|cqu-bantam-3p|mir|MIMAT0014421|mir|cqu-bantam*_v18.0|mir|MIMAT0014421	cqu-bantam-3p	MIMAT0014421	unmapped	CGCTCGGGTTTTCCCGAGCGGTCAGCTTTCAAAATGATCTTTTTTTTTTT
A_38_P00026846	A_38_P00026846	mir|cqu-bantam-3p|mir|MIMAT0014421|mir|cqu-bantam*_v18.0|mir|MIMAT0014421	cqu-bantam-3p	MIMAT0014421	unmapped	CGCTCGGGTTTTCCCGAGCGGTCAGCTTTCAAAATGATCTCTTTTTTTTTT
A_38_P00026851	A_38_P00026851	mir|cqu-miR-2941-2-5p|mir|MIMAT0016971|mir|cqu-miR-2941-2*_v18.0|mir|MIMAT0016971	cqu-miR-2941-2-5p	MIMAT0016971	unmapped	CGCTCGGGTTTTCCCGAGCGGTCCGGCAGAACTCTTTTTTTTTT
A_38_P00026852	A_38_P00026852	mir|cqu-miR-2941-2-5p|mir|MIMAT0016971|mir|cqu-miR-2941-2*_v18.0|mir|MIMAT0016971	cqu-miR-2941-2-5p	MIMAT0016971	unmapped	CGCTCGGGTTTTCCCGAGCGGTCCGGCAGAACTCCTTTTTTTTTT
A_38_P00026857	A_38_P00026857	mir|cqu-miR-285-5p|mir|MIMAT0014410|mir|cqu-miR-285*_v18.0|mir|MIMAT0014410	cqu-miR-285-5p	MIMAT0014410	unmapped	CGCTCGGGTTTTCCCGAGCGGTCTACTCACCTTTGGAATTTTTTTTTT
A_38_P00026858	A_38_P00026858	mir|cqu-miR-285-5p|mir|MIMAT0014410|mir|cqu-miR-285*_v18.0|mir|MIMAT0014410	cqu-miR-285-5p	MIMAT0014410	unmapped	CGCTCGGGTTTTCCCGAGCGGTCTACTCACCTTTGGAAGTTTTTTTTTT
A_38_P00026859	A_38_P00026859	mir|cqu-miR-988-5p|mir|MIMAT0014362|mir|cqu-miR-988*_v18.0|mir|MIMAT0014362	cqu-miR-988-5p	MIMAT0014362	unmapped	CGCTCGGGTTTTCCCGAGCGGTCTCGTTGTCACAAAGTTTTTTTTTT
A_38_P00026860	A_38_P00026860	mir|cqu-miR-988-5p|mir|MIMAT0014362|mir|cqu-miR-988*_v18.0|mir|MIMAT0014362	cqu-miR-988-5p	MIMAT0014362	unmapped	CGCTCGGGTTTTCCCGAGCGGTCTCGTTGTCACAAAGCTTTTTTTTTT
A_38_P00026861	A_38_P00026861	mir|cqu-miR-210-5p|mir|MIMAT0014396|mir|cqu-miR-210*_v18.0|mir|MIMAT0014396	cqu-miR-210-5p	MIMAT0014396	unmapped	CGCTCGGGTTTTCCCGAGCGGTCTTGTGCAGTGGTCTTTTTTTTTT
A_38_P00026862	A_38_P00026862	mir|cqu-miR-210-5p|mir|MIMAT0014396|mir|cqu-miR-210*_v18.0|mir|MIMAT0014396	cqu-miR-210-5p	MIMAT0014396	unmapped	CGCTCGGGTTTTCCCGAGCGGTCTTGTGCAGTGGTCATTTTTTTTTT
A_38_P00027568	A_38_P00027568	mir|dme-miR-3643-3p|mir|MIMAT0018060|mir|dme-miR-3643_v16.0|mir|MIMAT0018060	dme-miR-3643-3p	MIMAT0018060	unmapped	CGCTCGGGTTTTCCCGAGCGGAAAGGAGCATAAATAAGTATGTTTTTTTTTT
A_38_P00027569	A_38_P00027569	mir|dme-miR-3643-3p|mir|MIMAT0018060|mir|dme-miR-3643_v16.0|mir|MIMAT0018060	dme-miR-3643-3p	MIMAT0018060	unmapped	CGCTCGGGTTTTCCCGAGCGGAAAGGAGCATAAATAAGTATGATTTTTTTTTT
A_38_P00027570	A_38_P00027570	mir|dme-miR-2501-3p|mir|MIMAT0012217|mir|dme-miR-2501*_v16.0|mir|MIMAT0012217	dme-miR-2501-3p	MIMAT0012217	unmapped	CGCTCGGGTTTTCCCGAGCGGAAGAAAGTTTGATTGCAAGTTTTTTTTTT
A_38_P00027571	A_38_P00027571	mir|dme-miR-2501-3p|mir|MIMAT0012217|mir|dme-miR-2501*_v16.0|mir|MIMAT0012217	dme-miR-2501-3p	MIMAT0012217	unmapped	CGCTCGGGTTTTCCCGAGCGGAAGAAAGTTTGATTGCAAGATATTTTTTTT
A_38_P00027572	A_38_P00027572	mir|dme-miR-3642-5p|mir|MIMAT0018057|mir|dme-miR-3642*_v16.0|mir|MIMAT0018057	dme-miR-3642-5p	MIMAT0018057	unmapped	CGCTCGGGTTTTCCCGAGCGGACGCTCCGTGCGTTTTTTTTTT
A_38_P00027573	A_38_P00027573	mir|dme-miR-3642-5p|mir|MIMAT0018057|mir|dme-miR-3642*_v16.0|mir|MIMAT0018057	dme-miR-3642-5p	MIMAT0018057	unmapped	CGCTCGGGTTTTCCCGAGCGGACGCTCCGTGCGATTTTTTTTTT
A_38_P00027574	A_38_P00027574	mir|dme-miR-3645-3p|mir|MIMAT0018064|mir|dme-miR-3645_v16.0|mir|MIMAT0018064	dme-miR-3645-3p	MIMAT0018064	unmapped	CGCTCGGGTTTTCCCGAGCGGACTTGAGTGCTGGCTATTTTTTTTT
A_38_P00027575	A_38_P00027575	mir|dme-miR-3645-3p|mir|MIMAT0018064|mir|dme-miR-3645_v16.0|mir|MIMAT0018064	dme-miR-3645-3p	MIMAT0018064	unmapped	CGCTCGGGTTTTCCCGAGCGGACTTGAGTGCTGGCTTTTTTTTTTTT
A_38_P00027576	A_38_P00027576	mir|dme-miR-3642-3p|mir|MIMAT0018058|mir|dme-miR-3642_v16.0|mir|MIMAT0018058	dme-miR-3642-3p	MIMAT0018058	unmapped	CGCTCGGGTTTTCCCGAGCGGAGAAGAGCAGAGTGAACTATTTTTTTT
A_38_P00027577	A_38_P00027577	mir|dme-miR-3642-3p|mir|MIMAT0018058|mir|dme-miR-3642_v16.0|mir|MIMAT0018058	dme-miR-3642-3p	MIMAT0018058	unmapped	CGCTCGGGTTTTCCCGAGCGGAGAAGAGCAGAGTGAACGAATTTTTTTT
A_38_P00027578	A_38_P00027578	mir|dme-miR-3644-3p|mir|MIMAT0018062|mir|dme-miR-3644*_v16.0|mir|MIMAT0018062	dme-miR-3644-3p	MIMAT0018062	unmapped	CGCTCGGGTTTTCCCGAGCGGATAGTGGTTAAATATAGTTTTATTTTTTTT
A_38_P00027579	A_38_P00027579	mir|dme-miR-3644-3p|mir|MIMAT0018062|mir|dme-miR-3644*_v16.0|mir|MIMAT0018062	dme-miR-3644-3p	MIMAT0018062	unmapped	CGCTCGGGTTTTCCCGAGCGGATAGTGGTTAAATATAGTTTAATTTTTTTTT
A_38_P00027580	A_38_P00027580	mir|dme-miR-3644-3p|mir|MIMAT0018062|mir|dme-miR-3644*_v16.0|mir|MIMAT0018062	dme-miR-3644-3p	MIMAT0018062	unmapped	CGCTCGGGTTTTCCCGAGCGGATAGTGGTTAAATATAGTTTATTTTTTTTTTT
A_38_P00027581	A_38_P00027581	mir|dme-miR-3644-3p|mir|MIMAT0018062|mir|dme-miR-3644*_v16.0|mir|MIMAT0018062	dme-miR-3644-3p	MIMAT0018062	unmapped	CGCTCGGGTTTTCCCGAGCGGATAGTGGTTAAATATAGTTTATGTTTTTTTTTT
A_38_P00027582	A_38_P00027582	mir|dme-miR-3645-5p|mir|MIMAT0018063|mir|dme-miR-3645*_v16.0|mir|MIMAT0018063	dme-miR-3645-5p	MIMAT0018063	unmapped	CGCTCGGGTTTTCCCGAGCGGCAATAAACAGCCTGCATATTTTTTTT
A_38_P00027583	A_38_P00027583	mir|dme-miR-3645-5p|mir|MIMAT0018063|mir|dme-miR-3645*_v16.0|mir|MIMAT0018063	dme-miR-3645-5p	MIMAT0018063	unmapped	CGCTCGGGTTTTCCCGAGCGGCAATAAACAGCCTGCACATTTTTTTTT
A_38_P00027584	A_38_P00027584	mir|dme-miR-3641-3p|mir|MIMAT0018056|mir|dme-miR-3641_v16.0|mir|MIMAT0018056	dme-miR-3641-3p	MIMAT0018056	unmapped	CGCTCGGGTTTTCCCGAGCGGGAGTGGAAGTGACCATATTTTTTTT
A_38_P00027585	A_38_P00027585	mir|dme-miR-3641-3p|mir|MIMAT0018056|mir|dme-miR-3641_v16.0|mir|MIMAT0018056	dme-miR-3641-3p	MIMAT0018056	unmapped	CGCTCGGGTTTTCCCGAGCGGGAGTGGAAGTGACCAGAATTTTTTTT
A_38_P00027586	A_38_P00027586	mir|dme-miR-3641-5p|mir|MIMAT0018055|mir|dme-miR-3641*_v16.0|mir|MIMAT0018055	dme-miR-3641-5p	MIMAT0018055	unmapped	CGCTCGGGTTTTCCCGAGCGGGCTGTAAACAGGACACATTTTTTTTT
A_38_P00027587	A_38_P00027587	mir|dme-miR-3641-5p|mir|MIMAT0018055|mir|dme-miR-3641*_v16.0|mir|MIMAT0018055	dme-miR-3641-5p	MIMAT0018055	unmapped	CGCTCGGGTTTTCCCGAGCGGGCTGTAAACAGGACACTTTTTTTTTTT
A_38_P00027588	A_38_P00027588	mir|dme-miR-3643-5p|mir|MIMAT0018059|mir|dme-miR-3643*_v16.0|mir|MIMAT0018059	dme-miR-3643-5p	MIMAT0018059	unmapped	CGCTCGGGTTTTCCCGAGCGGGGGCATATTTAGATAAACTTTTTTTTTTT
A_38_P00027589	A_38_P00027589	mir|dme-miR-3643-5p|mir|MIMAT0018059|mir|dme-miR-3643*_v16.0|mir|MIMAT0018059	dme-miR-3643-5p	MIMAT0018059	unmapped	CGCTCGGGTTTTCCCGAGCGGGGGCATATTTAGATAAACTCTTTTTTTTTT
A_38_P00027590	A_38_P00027590	mir|dme-miR-3644-5p|mir|MIMAT0018061|mir|dme-miR-3644_v16.0|mir|MIMAT0018061	dme-miR-3644-5p	MIMAT0018061	unmapped	CGCTCGGGTTTTCCCGAGCGGTACTTAAACCATAATCACTCTTTTTTTTTT
A_38_P00027591	A_38_P00027591	mir|dme-miR-3644-5p|mir|MIMAT0018061|mir|dme-miR-3644_v16.0|mir|MIMAT0018061	dme-miR-3644-5p	MIMAT0018061	unmapped	CGCTCGGGTTTTCCCGAGCGGTACTTAAACCATAATCACTCATTTTTTTTTT
A_38_P00027592	A_38_P00027592	mir|dme-miR-2501-5p|mir|MIMAT0012216|mir|dme-miR-2501_v16.0|mir|MIMAT0012216	dme-miR-2501-5p	MIMAT0012216	unmapped	CGCTCGGGTTTTCCCGAGCGGTAGCCCAGGCACTCTTTTTTTTTT
A_38_P00027593	A_38_P00027593	mir|dme-miR-2501-5p|mir|MIMAT0012216|mir|dme-miR-2501_v16.0|mir|MIMAT0012216	dme-miR-2501-5p	MIMAT0012216	unmapped	CGCTCGGGTTTTCCCGAGCGGTAGCCCAGGCACTCCTTTTTTTTTT
A_38_P00029737	A_38_P00029737	mir|dme-miR-992-5p|mir|MIMAT0020891	dme-miR-992-5p	MIMAT0020891	unmapped	CGCTCGGGTTTTCCCGAGCGGAAATAACACTTTGCTGATACTTTTTTTTTT
A_38_P00029738	A_38_P00029738	mir|dme-miR-992-5p|mir|MIMAT0020891	dme-miR-992-5p	MIMAT0020891	unmapped	CGCTCGGGTTTTCCCGAGCGGAAATAACACTTTGCTGATACCTTTTTTTTTT
A_38_P00029739	A_38_P00029739	mir|dme-miR-4982-3p|mir|MIMAT0020216	dme-miR-4982-3p	MIMAT0020216	unmapped	CGCTCGGGTTTTCCCGAGCGGAAATGCAATTGCAATTCCTTTTTTTTTT
A_38_P00029740	A_38_P00029740	mir|dme-miR-4982-3p|mir|MIMAT0020216	dme-miR-4982-3p	MIMAT0020216	unmapped	CGCTCGGGTTTTCCCGAGCGGAAATGCAATTGCAATTCCATTTTTTTTTT
A_38_P00029741	A_38_P00029741	mir|dme-miR-963-3p|mir|MIMAT0020858	dme-miR-963-3p	MIMAT0020858	unmapped	CGCTCGGGTTTTCCCGAGCGGAACAAAGGTATATACAGATGTATTTTTTTTT
A_38_P00029742	A_38_P00029742	mir|dme-miR-963-3p|mir|MIMAT0020858	dme-miR-963-3p	MIMAT0020858	unmapped	CGCTCGGGTTTTCCCGAGCGGAACAAAGGTATATACAGATGTTTTTTTTTTTT
A_38_P00029743	A_38_P00029743	mir|dme-miR-4945-5p|mir|MIMAT0020155	dme-miR-4945-5p	MIMAT0020155	unmapped	CGCTCGGGTTTTCCCGAGCGGAACAACAAAAAGAAGAGAATTTTTTTTTT
A_38_P00029744	A_38_P00029744	mir|dme-miR-4945-5p|mir|MIMAT0020155	dme-miR-4945-5p	MIMAT0020155	unmapped	CGCTCGGGTTTTCCCGAGCGGAACAACAAAAAGAAGAGAAATTTTTTTTTT
A_38_P00029745	A_38_P00029745	mir|dme-miR-4982-5p|mir|MIMAT0020215	dme-miR-4982-5p	MIMAT0020215	unmapped	CGCTCGGGTTTTCCCGAGCGGAACAAGGACATGCAATTTTTTTTTTTT
A_38_P00029746	A_38_P00029746	mir|dme-miR-4982-5p|mir|MIMAT0020215	dme-miR-4982-5p	MIMAT0020215	unmapped	CGCTCGGGTTTTCCCGAGCGGAACAAGGACATGCAATTGTTTTTTTTTT
A_38_P00029747	A_38_P00029747	mir|dme-miR-4966-5p|mir|MIMAT0020190	dme-miR-4966-5p	MIMAT0020190	unmapped	CGCTCGGGTTTTCCCGAGCGGAACATGTGCAATATATTTAGTTTTTTTTTTT
A_38_P00029748	A_38_P00029748	mir|dme-miR-4966-5p|mir|MIMAT0020190	dme-miR-4966-5p	MIMAT0020190	unmapped	CGCTCGGGTTTTCCCGAGCGGAACATGTGCAATATATTTAGTATTTTTTTTTT
A_38_P00029749	A_38_P00029749	mir|dme-miR-999-5p|mir|MIMAT0020899	dme-miR-999-5p	MIMAT0020899	unmapped	CGCTCGGGTTTTCCCGAGCGGAACATTCACCGTATGACATTTTTTTTT
A_38_P00029750	A_38_P00029750	mir|dme-miR-999-5p|mir|MIMAT0020899	dme-miR-999-5p	MIMAT0020899	unmapped	CGCTCGGGTTTTCCCGAGCGGAACATTCACCGTATGACTTATTTTTTTT
A_38_P00029751	A_38_P00029751	mir|dme-miR-4940-5p|mir|MIMAT0020146	dme-miR-4940-5p	MIMAT0020146	unmapped	CGCTCGGGTTTTCCCGAGCGGAACCAATGATCTATATCCGTTTTTTTTTT
A_38_P00029752	A_38_P00029752	mir|dme-miR-4940-5p|mir|MIMAT0020146	dme-miR-4940-5p	MIMAT0020146	unmapped	CGCTCGGGTTTTCCCGAGCGGAACCAATGATCTATATCCGCTTTTTTTTTT
A_38_P00029753	A_38_P00029753	mir|dme-miR-4985-3p|mir|MIMAT0020222	dme-miR-4985-3p	MIMAT0020222	unmapped	CGCTCGGGTTTTCCCGAGCGGAACGATTTACATGGCTCTTTTTTTTTT
A_38_P00029754	A_38_P00029754	mir|dme-miR-4985-3p|mir|MIMAT0020222	dme-miR-4985-3p	MIMAT0020222	unmapped	CGCTCGGGTTTTCCCGAGCGGAACGATTTACATGGCTCGTTTTTTTTTT
A_38_P00029755	A_38_P00029755	mir|dme-miR-92a-5p|mir|MIMAT0020802	dme-miR-92a-5p	MIMAT0020802	unmapped	CGCTCGGGTTTTCCCGAGCGGAACGTTGACACCTTCTTTTTTTTTT
A_38_P00029756	A_38_P00029756	mir|dme-miR-92a-5p|mir|MIMAT0020802	dme-miR-92a-5p	MIMAT0020802	unmapped	CGCTCGGGTTTTCCCGAGCGGAACGTTGACACCTTCCTTTTTTTTTT
A_38_P00029757	A_38_P00029757	mir|dme-miR-4968-5p|mir|MIMAT0020194	dme-miR-4968-5p	MIMAT0020194	unmapped	CGCTCGGGTTTTCCCGAGCGGAAGCAACAAACCGTGTTTTTTTTTT
A_38_P00029758	A_38_P00029758	mir|dme-miR-4968-5p|mir|MIMAT0020194	dme-miR-4968-5p	MIMAT0020194	unmapped	CGCTCGGGTTTTCCCGAGCGGAAGCAACAAACCGTGGTTTTTTTTTT
A_38_P00029759	A_38_P00029759	mir|dme-miR-4941-5p|mir|MIMAT0020148	dme-miR-4941-5p	MIMAT0020148	unmapped	CGCTCGGGTTTTCCCGAGCGGAAGGCGGTGAGCATTTTTTTTTT
A_38_P00029760	A_38_P00029760	mir|dme-miR-4941-5p|mir|MIMAT0020148	dme-miR-4941-5p	MIMAT0020148	unmapped	CGCTCGGGTTTTCCCGAGCGGAAGGCGGTGAGCAGTATTTTTTTT
A_38_P00029761	A_38_P00029761	mir|dme-miR-2535b-3p|mir|MIMAT0020510	dme-miR-2535b-3p	MIMAT0020510	unmapped	CGCTCGGGTTTTCCCGAGCGGAAGTGAATGAAATGCCGATTTTTTTTT
A_38_P00029762	A_38_P00029762	mir|dme-miR-2535b-3p|mir|MIMAT0020510	dme-miR-2535b-3p	MIMAT0020510	unmapped	CGCTCGGGTTTTCCCGAGCGGAAGTGAATGAAATGCCGTTTTTTTTTTT
A_38_P00029763	A_38_P00029763	mir|dme-miR-4918-5p|mir|MIMAT0020512	dme-miR-4918-5p	MIMAT0020512	unmapped	CGCTCGGGTTTTCCCGAGCGGAATAAATGTGGCCATCGATTTTTTTTT
A_38_P00029764	A_38_P00029764	mir|dme-miR-4918-5p|mir|MIMAT0020512	dme-miR-4918-5p	MIMAT0020512	unmapped	CGCTCGGGTTTTCCCGAGCGGAATAAATGTGGCCATCGTTTTTTTTTTT
A_38_P00029765	A_38_P00029765	mir|dme-miR-252-3p|mir|MIMAT0020896	dme-miR-252-3p	MIMAT0020896	unmapped	CGCTCGGGTTTTCCCGAGCGGAATAAGCACTTGGGCATTTTTTTTTT
A_38_P00029766	A_38_P00029766	mir|dme-miR-252-3p|mir|MIMAT0020896	dme-miR-252-3p	MIMAT0020896	unmapped	CGCTCGGGTTTTCCCGAGCGGAATAAGCACTTGGGCAGTTTTTTTTTT
A_38_P00029767	A_38_P00029767	mir|dme-miR-190-3p|mir|MIMAT0020848	dme-miR-190-3p	MIMAT0020848	unmapped	CGCTCGGGTTTTCCCGAGCGGAATAATATGTTTGATTCCTGGTTTTTTTTTT
A_38_P00029768	A_38_P00029768	mir|dme-miR-190-3p|mir|MIMAT0020848	dme-miR-190-3p	MIMAT0020848	unmapped	CGCTCGGGTTTTCCCGAGCGGAATAATATGTTTGATTCCTGGGTTTTTTTTTT
A_38_P00029769	A_38_P00029769	mir|dme-miR-4979-5p|mir|MIMAT0020211	dme-miR-4979-5p	MIMAT0020211	unmapped	CGCTCGGGTTTTCCCGAGCGGAATACATAGAACAAGTATATATTTTTTTTTTT
A_38_P00029770	A_38_P00029770	mir|dme-miR-311-5p|mir|MIMAT0020837	dme-miR-311-5p	MIMAT0020837	unmapped	CGCTCGGGTTTTCCCGAGCGGAATATTAACCCATATACCGTTTTTTTTTTT
A_38_P00029771	A_38_P00029771	mir|dme-miR-311-5p|mir|MIMAT0020837	dme-miR-311-5p	MIMAT0020837	unmapped	CGCTCGGGTTTTCCCGAGCGGAATATTAACCCATATACCGTCTTTTTTTTTT
A_38_P00029772	A_38_P00029772	mir|dme-miR-4987-5p|mir|MIMAT0020225	dme-miR-4987-5p	MIMAT0020225	unmapped	CGCTCGGGTTTTCCCGAGCGGAATCGTGCCGCACTTTTTTTTTT
A_38_P00029773	A_38_P00029773	mir|dme-miR-4987-5p|mir|MIMAT0020225	dme-miR-4987-5p	MIMAT0020225	unmapped	CGCTCGGGTTTTCCCGAGCGGAATCGTGCCGCACGTATTTTTTTT
A_38_P00029774	A_38_P00029774	mir|dme-miR-4967-3p|mir|MIMAT0020193	dme-miR-4967-3p	MIMAT0020193	unmapped	CGCTCGGGTTTTCCCGAGCGGACATTGCAAATGCCCTAATTTTTTTT
A_38_P00029775	A_38_P00029775	mir|dme-miR-4967-3p|mir|MIMAT0020193	dme-miR-4967-3p	MIMAT0020193	unmapped	CGCTCGGGTTTTCCCGAGCGGACATTGCAAATGCCCTTATTTTTTTTT
A_38_P00029776	A_38_P00029776	mir|dme-miR-957-5p|mir|MIMAT0020851	dme-miR-957-5p	MIMAT0020851	unmapped	CGCTCGGGTTTTCCCGAGCGGACCAAAACACGTCGATTTTTTTTTT
A_38_P00029777	A_38_P00029777	mir|dme-miR-957-5p|mir|MIMAT0020851	dme-miR-957-5p	MIMAT0020851	unmapped	CGCTCGGGTTTTCCCGAGCGGACCAAAACACGTCGAATTTTTTTTTT
A_38_P00029778	A_38_P00029778	mir|dme-miR-4958-5p|mir|MIMAT0020177	dme-miR-4958-5p	MIMAT0020177	unmapped	CGCTCGGGTTTTCCCGAGCGGACCAGAGCCCGTTTTTTTTTTTT
A_38_P00029779	A_38_P00029779	mir|dme-miR-4958-5p|mir|MIMAT0020177	dme-miR-4958-5p	MIMAT0020177	unmapped	CGCTCGGGTTTTCCCGAGCGGACCAGAGCCCGTTCTTTTTTTTTT
A_38_P00029780	A_38_P00029780	mir|dme-miR-4960-3p|mir|MIMAT0020180	dme-miR-4960-3p	MIMAT0020180	unmapped	CGCTCGGGTTTTCCCGAGCGGACCGTAAGCCCAAGTATTTTTTTT
A_38_P00029781	A_38_P00029781	mir|dme-miR-4960-3p|mir|MIMAT0020180	dme-miR-4960-3p	MIMAT0020180	unmapped	CGCTCGGGTTTTCCCGAGCGGACCGTAAGCCCAAGGATTTTTTTTT
A_38_P00029782	A_38_P00029782	mir|dme-miR-4974-5p|mir|MIMAT0020203	dme-miR-4974-5p	MIMAT0020203	unmapped	CGCTCGGGTTTTCCCGAGCGGACCTAAAATCAATATACTCTCATTTTTTTTT
A_38_P00029783	A_38_P00029783	mir|dme-miR-4974-5p|mir|MIMAT0020203	dme-miR-4974-5p	MIMAT0020203	unmapped	CGCTCGGGTTTTCCCGAGCGGACCTAAAATCAATATACTCTCTTTTTTTTTTT
A_38_P00029784	A_38_P00029784	mir|dme-miR-4959-5p|mir|MIMAT0020179	dme-miR-4959-5p	MIMAT0020179	unmapped	CGCTCGGGTTTTCCCGAGCGGACCTGCTGCAAATCAATTTTTTTTT
A_38_P00029785	A_38_P00029785	mir|dme-miR-4959-5p|mir|MIMAT0020179	dme-miR-4959-5p	MIMAT0020179	unmapped	CGCTCGGGTTTTCCCGAGCGGACCTGCTGCAAATCATTTTTTTTTTT
A_38_P00029786	A_38_P00029786	mir|dme-miR-4959-5p|mir|MIMAT0020179	dme-miR-4959-5p	MIMAT0020179	unmapped	CGCTCGGGTTTTCCCGAGCGGACCTGCTGCAAATCATGTTTTTTTTTT
A_38_P00029787	A_38_P00029787	mir|dme-miR-969-3p|mir|MIMAT0020866	dme-miR-969-3p	MIMAT0020866	unmapped	CGCTCGGGTTTTCCCGAGCGGACGAGCTCAACGTGATTTTTTTTT
A_38_P00029788	A_38_P00029788	mir|dme-miR-969-3p|mir|MIMAT0020866	dme-miR-969-3p	MIMAT0020866	unmapped	CGCTCGGGTTTTCCCGAGCGGACGAGCTCAACGTGTTTTTTTTTTT
A_38_P00029789	A_38_P00029789	mir|dme-miR-2492-5p|mir|MIMAT0020913	dme-miR-2492-5p	MIMAT0020913	unmapped	CGCTCGGGTTTTCCCGAGCGGACGCTTTATAAAGAGATCCTTTTTTTTTT
A_38_P00029790	A_38_P00029790	mir|dme-miR-2492-5p|mir|MIMAT0020913	dme-miR-2492-5p	MIMAT0020913	unmapped	CGCTCGGGTTTTCCCGAGCGGACGCTTTATAAAGAGATCCCTTTTTTTTTT
A_38_P00029791	A_38_P00029791	mir|dme-miR-4958-3p|mir|MIMAT0020178	dme-miR-4958-3p	MIMAT0020178	unmapped	CGCTCGGGTTTTCCCGAGCGGACGGGACCTGGAGTTTTTTTTTT
A_38_P00029792	A_38_P00029792	mir|dme-miR-4958-3p|mir|MIMAT0020178	dme-miR-4958-3p	MIMAT0020178	unmapped	CGCTCGGGTTTTCCCGAGCGGACGGGACCTGGAGCTTTTTTTTTT
A_38_P00029793	A_38_P00029793	mir|dme-miR-4976-5p|mir|MIMAT0020206	dme-miR-4976-5p	MIMAT0020206	unmapped	CGCTCGGGTTTTCCCGAGCGGACTCCATGGACGACATTTTTTTTTT
A_38_P00029794	A_38_P00029794	mir|dme-miR-4976-5p|mir|MIMAT0020206	dme-miR-4976-5p	MIMAT0020206	unmapped	CGCTCGGGTTTTCCCGAGCGGACTCCATGGACGACAGTTTTTTTTTT
A_38_P00029795	A_38_P00029795	mir|dme-miR-4941-3p|mir|MIMAT0020149	dme-miR-4941-3p	MIMAT0020149	unmapped	CGCTCGGGTTTTCCCGAGCGGACTCCCAGAGCGGTTTTTTTTTT
A_38_P00029796	A_38_P00029796	mir|dme-miR-4941-3p|mir|MIMAT0020149	dme-miR-4941-3p	MIMAT0020149	unmapped	CGCTCGGGTTTTCCCGAGCGGACTCCCAGAGCGGCTTTTTTTTTT
A_38_P00029797	A_38_P00029797	mir|dme-miR-31a-3p|mir|MIMAT0020834	dme-miR-31a-3p	MIMAT0020834	unmapped	CGCTCGGGTTTTCCCGAGCGGACTGACTAGATGCAGCTATTTTTTTT
A_38_P00029798	A_38_P00029798	mir|dme-miR-31a-3p|mir|MIMAT0020834	dme-miR-31a-3p	MIMAT0020834	unmapped	CGCTCGGGTTTTCCCGAGCGGACTGACTAGATGCAGCAATTTTTTTTT
A_38_P00029799	A_38_P00029799	mir|dme-miR-4978-5p|mir|MIMAT0020210	dme-miR-4978-5p	MIMAT0020210	unmapped	CGCTCGGGTTTTCCCGAGCGGAGAAAGAGAGCTTTTCCTTTTTTTTTT
A_38_P00029800	A_38_P00029800	mir|dme-miR-4978-5p|mir|MIMAT0020210	dme-miR-4978-5p	MIMAT0020210	unmapped	CGCTCGGGTTTTCCCGAGCGGAGAAAGAGAGCTTTTCCATTTTTTTTTT
A_38_P00029801	A_38_P00029801	mir|dme-let-7-3p|mir|MIMAT0020830	dme-let-7-3p	MIMAT0020830	unmapped	CGCTCGGGTTTTCCCGAGCGGAGAAAGCTAGCACATTGATTTTTTTTT
A_38_P00029802	A_38_P00029802	mir|dme-let-7-3p|mir|MIMAT0020830	dme-let-7-3p	MIMAT0020830	unmapped	CGCTCGGGTTTTCCCGAGCGGAGAAAGCTAGCACATTGTTATTTTTTTT
A_38_P00029803	A_38_P00029803	mir|dme-miR-979-5p|mir|MIMAT0020876	dme-miR-979-5p	MIMAT0020876	unmapped	CGCTCGGGTTTTCCCGAGCGGAGAATTCCCCCCAAAAATTTTTTTT
A_38_P00029804	A_38_P00029804	mir|dme-miR-979-5p|mir|MIMAT0020876	dme-miR-979-5p	MIMAT0020876	unmapped	CGCTCGGGTTTTCCCGAGCGGAGAATTCCCCCCAAATATTTTTTTTT
A_38_P00029805	A_38_P00029805	mir|dme-miR-979-5p|mir|MIMAT0020876	dme-miR-979-5p	MIMAT0020876	unmapped	CGCTCGGGTTTTCCCGAGCGGAGAATTCCCCCCAAATTTTTTTTTTTT
A_38_P00029806	A_38_P00029806	mir|dme-miR-312-5p|mir|MIMAT0020838	dme-miR-312-5p	MIMAT0020838	unmapped	CGCTCGGGTTTTCCCGAGCGGAGAATTGCCCTTGTGATTTTTTTTTT
A_38_P00029807	A_38_P00029807	mir|dme-miR-312-5p|mir|MIMAT0020838	dme-miR-312-5p	MIMAT0020838	unmapped	CGCTCGGGTTTTCCCGAGCGGAGAATTGCCCTTGTGACTTTTTTTTTT
A_38_P00029808	A_38_P00029808	mir|dme-miR-4981-3p|mir|MIMAT0020214	dme-miR-4981-3p	MIMAT0020214	unmapped	CGCTCGGGTTTTCCCGAGCGGAGACGCTGCTCGATTTTTTTTTT
A_38_P00029809	A_38_P00029809	mir|dme-miR-4981-3p|mir|MIMAT0020214	dme-miR-4981-3p	MIMAT0020214	unmapped	CGCTCGGGTTTTCCCGAGCGGAGACGCTGCTCGACTTTTTTTTTT
A_38_P00029810	A_38_P00029810	mir|dme-miR-286-5p|mir|MIMAT0020820	dme-miR-286-5p	MIMAT0020820	unmapped	CGCTCGGGTTTTCCCGAGCGGAGAGACCATACCGACAAATTTTTTTT
A_38_P00029811	A_38_P00029811	mir|dme-miR-286-5p|mir|MIMAT0020820	dme-miR-286-5p	MIMAT0020820	unmapped	CGCTCGGGTTTTCCCGAGCGGAGAGACCATACCGACATATTTTTTTTT
A_38_P00029812	A_38_P00029812	mir|dme-miR-967-3p|mir|MIMAT0020863	dme-miR-967-3p	MIMAT0020863	unmapped	CGCTCGGGTTTTCCCGAGCGGAGAGAGACACCTAGGTTTTTTTTTTT
A_38_P00029813	A_38_P00029813	mir|dme-miR-967-3p|mir|MIMAT0020863	dme-miR-967-3p	MIMAT0020863	unmapped	CGCTCGGGTTTTCCCGAGCGGAGAGAGACACCTAGGTGTTTTTTTTTT
A_38_P00029814	A_38_P00029814	mir|dme-miR-983-3p|mir|MIMAT0020880	dme-miR-983-3p	MIMAT0020880	unmapped	CGCTCGGGTTTTCCCGAGCGGAGATAATGCGTAACTACCTTTTTTTTTTT
A_38_P00029815	A_38_P00029815	mir|dme-miR-983-3p|mir|MIMAT0020880	dme-miR-983-3p	MIMAT0020880	unmapped	CGCTCGGGTTTTCCCGAGCGGAGATAATGCGTAACTACCTATATTTTTTTT
A_38_P00029816	A_38_P00029816	mir|dme-miR-304-3p|mir|MIMAT0020826	dme-miR-304-3p	MIMAT0020826	unmapped	CGCTCGGGTTTTCCCGAGCGGAGCAATCTCCAATTGCTTTTTTTTTT
A_38_P00029817	A_38_P00029817	mir|dme-miR-304-3p|mir|MIMAT0020826	dme-miR-304-3p	MIMAT0020826	unmapped	CGCTCGGGTTTTCCCGAGCGGAGCAATCTCCAATTGCATTTTTTTTTT
A_38_P00029818	A_38_P00029818	mir|dme-miR-4951-5p|mir|MIMAT0020164	dme-miR-4951-5p	MIMAT0020164	unmapped	CGCTCGGGTTTTCCCGAGCGGAGCATCAGAAACCTCATTTTTTTTTT
A_38_P00029819	A_38_P00029819	mir|dme-miR-4951-5p|mir|MIMAT0020164	dme-miR-4951-5p	MIMAT0020164	unmapped	CGCTCGGGTTTTCCCGAGCGGAGCATCAGAAACCTCACTTTTTTTTTT
A_38_P00029820	A_38_P00029820	mir|dme-miR-275-5p|mir|MIMAT0020801	dme-miR-275-5p	MIMAT0020801	unmapped	CGCTCGGGTTTTCCCGAGCGGAGCCCCGGTCACATTTTTTTTT
A_38_P00029821	A_38_P00029821	mir|dme-miR-275-5p|mir|MIMAT0020801	dme-miR-275-5p	MIMAT0020801	unmapped	CGCTCGGGTTTTCCCGAGCGGAGCCCCGGTCACTTTTTTTTTTT
A_38_P00029822	A_38_P00029822	mir|dme-miR-981-5p|mir|MIMAT0020878	dme-miR-981-5p	MIMAT0020878	unmapped	CGCTCGGGTTTTCCCGAGCGGAGCCCGCTGCTAATTTTTTTTTT
A_38_P00029823	A_38_P00029823	mir|dme-miR-981-5p|mir|MIMAT0020878	dme-miR-981-5p	MIMAT0020878	unmapped	CGCTCGGGTTTTCCCGAGCGGAGCCCGCTGCTAACTTTTTTTTTT
A_38_P00029824	A_38_P00029824	mir|dme-miR-4950-3p|mir|MIMAT0020163	dme-miR-4950-3p	MIMAT0020163	unmapped	CGCTCGGGTTTTCCCGAGCGGAGCCTTACCATGCATCAATTTTTTTT
A_38_P00029825	A_38_P00029825	mir|dme-miR-4950-3p|mir|MIMAT0020163	dme-miR-4950-3p	MIMAT0020163	unmapped	CGCTCGGGTTTTCCCGAGCGGAGCCTTACCATGCATCTATTTTTTTTT
A_38_P00029826	A_38_P00029826	mir|dme-miR-317-5p|mir|MIMAT0020843	dme-miR-317-5p	MIMAT0020843	unmapped	CGCTCGGGTTTTCCCGAGCGGAGCGAGCACAGGGATTTTTTTTT
A_38_P00029827	A_38_P00029827	mir|dme-miR-317-5p|mir|MIMAT0020843	dme-miR-317-5p	MIMAT0020843	unmapped	CGCTCGGGTTTTCCCGAGCGGAGCGAGCACAGGGTTATTTTTTTT
A_38_P00029828	A_38_P00029828	mir|dme-miR-4956-5p|mir|MIMAT0020173	dme-miR-4956-5p	MIMAT0020173	unmapped	CGCTCGGGTTTTCCCGAGCGGAGCGAGTTGTTGCTGTTTTTTTTTT
A_38_P00029829	A_38_P00029829	mir|dme-miR-4956-5p|mir|MIMAT0020173	dme-miR-4956-5p	MIMAT0020173	unmapped	CGCTCGGGTTTTCCCGAGCGGAGCGAGTTGTTGCTGGTTTTTTTTTT
A_38_P00029830	A_38_P00029830	mir|dme-miR-4957-5p|mir|MIMAT0020175	dme-miR-4957-5p	MIMAT0020175	unmapped	CGCTCGGGTTTTCCCGAGCGGAGCGCTGCCAGCTTTTTTTTTT
A_38_P00029831	A_38_P00029831	mir|dme-miR-4957-5p|mir|MIMAT0020175	dme-miR-4957-5p	MIMAT0020175	unmapped	CGCTCGGGTTTTCCCGAGCGGAGCGCTGCCAGCATTTTTTTTTT
A_38_P00029832	A_38_P00029832	mir|dme-miR-956-5p|mir|MIMAT0020850	dme-miR-956-5p	MIMAT0020850	unmapped	CGCTCGGGTTTTCCCGAGCGGAGCTAACGAGACCATTTTTTTTTTTT
A_38_P00029833	A_38_P00029833	mir|dme-miR-956-5p|mir|MIMAT0020850	dme-miR-956-5p	MIMAT0020850	unmapped	CGCTCGGGTTTTCCCGAGCGGAGCTAACGAGACCATTCTTTTTTTTTT
A_38_P00029834	A_38_P00029834	mir|dme-miR-33-3p|mir|MIMAT0020808	dme-miR-33-3p	MIMAT0020808	unmapped	CGCTCGGGTTTTCCCGAGCGGAGCTTGCACTGAAGTTTATTTTTTTT
A_38_P00029835	A_38_P00029835	mir|dme-miR-33-3p|mir|MIMAT0020808	dme-miR-33-3p	MIMAT0020808	unmapped	CGCTCGGGTTTTCCCGAGCGGAGCTTGCACTGAAGTTGATTTTTTTTT
A_38_P00029836	A_38_P00029836	mir|dme-miR-313-5p|mir|MIMAT0020839	dme-miR-313-5p	MIMAT0020839	unmapped	CGCTCGGGTTTTCCCGAGCGGAGTACTGCCCCCATCTTTTTTTTTT
A_38_P00029837	A_38_P00029837	mir|dme-miR-313-5p|mir|MIMAT0020839	dme-miR-313-5p	MIMAT0020839	unmapped	CGCTCGGGTTTTCCCGAGCGGAGTACTGCCCCCATCCTTTTTTTTTT
A_38_P00029838	A_38_P00029838	mir|dme-bantam-5p|mir|MIMAT0020823	dme-bantam-5p	MIMAT0020823	unmapped	CGCTCGGGTTTTCCCGAGCGGAGTCAAACCAAATCGAATTTTTTTTTT
A_38_P00029839	A_38_P00029839	mir|dme-bantam-5p|mir|MIMAT0020823	dme-bantam-5p	MIMAT0020823	unmapped	CGCTCGGGTTTTCCCGAGCGGAGTCAAACCAAATCGAAATTTTTTTTTT
A_38_P00029840	A_38_P00029840	mir|dme-miR-14-5p|mir|MIMAT0020798	dme-miR-14-5p	MIMAT0020798	unmapped	CGCTCGGGTTTTCCCGAGCGGAGTGAGTCCCCGTCATTTTTTTTT
A_38_P00029841	A_38_P00029841	mir|dme-miR-14-5p|mir|MIMAT0020798	dme-miR-14-5p	MIMAT0020798	unmapped	CGCTCGGGTTTTCCCGAGCGGAGTGAGTCCCCGTCTTTTTTTTTTT
A_38_P00029842	A_38_P00029842	mir|dme-miR-1002-3p|mir|MIMAT0020864	dme-miR-1002-3p	MIMAT0020864	unmapped	CGCTCGGGTTTTCCCGAGCGGAGTTAAGTAGGTCATACAATTTTTTTTTTT
A_38_P00029843	A_38_P00029843	mir|dme-miR-1002-3p|mir|MIMAT0020864	dme-miR-1002-3p	MIMAT0020864	unmapped	CGCTCGGGTTTTCCCGAGCGGAGTTAAGTAGGTCATACAATGTTTTTTTTTT
A_38_P00029844	A_38_P00029844	mir|dme-miR-375-5p|mir|MIMAT0020853	dme-miR-375-5p	MIMAT0020853	unmapped	CGCTCGGGTTTTCCCGAGCGGAGTTTGCATTCCCTTGTTTTTTTTTT
A_38_P00029845	A_38_P00029845	mir|dme-miR-375-5p|mir|MIMAT0020853	dme-miR-375-5p	MIMAT0020853	unmapped	CGCTCGGGTTTTCCCGAGCGGAGTTTGCATTCCCTTGGTTTTTTTTTT
A_38_P00029846	A_38_P00029846	mir|dme-miR-125-3p|mir|MIMAT0020831	dme-miR-125-3p	MIMAT0020831	unmapped	CGCTCGGGTTTTCCCGAGCGGATACCGGAGATCAAAACAATTTTTTTT
A_38_P00029847	A_38_P00029847	mir|dme-miR-125-3p|mir|MIMAT0020831	dme-miR-125-3p	MIMAT0020831	unmapped	CGCTCGGGTTTTCCCGAGCGGATACCGGAGATCAAAACTATTTTTTTTT
A_38_P00029848	A_38_P00029848	mir|dme-miR-4979-3p|mir|MIMAT0020212	dme-miR-4979-3p	MIMAT0020212	unmapped	CGCTCGGGTTTTCCCGAGCGGATATATATACAGGCACATGTAATTTTTTTTT
A_38_P00029849	A_38_P00029849	mir|dme-miR-4979-3p|mir|MIMAT0020212	dme-miR-4979-3p	MIMAT0020212	unmapped	CGCTCGGGTTTTCCCGAGCGGATATATATACAGGCACATGTATTTTTTTTTTT
A_38_P00029850	A_38_P00029850	mir|dme-miR-4972-5p|mir|MIMAT0020199	dme-miR-4972-5p	MIMAT0020199	unmapped	CGCTCGGGTTTTCCCGAGCGGATATATATCTGTAAAGCCGAGTTTTTTTTTT
A_38_P00029851	A_38_P00029851	mir|dme-miR-4972-5p|mir|MIMAT0020199	dme-miR-4972-5p	MIMAT0020199	unmapped	CGCTCGGGTTTTCCCGAGCGGATATATATCTGTAAAGCCGAGGTTTTTTTTTT
A_38_P00029852	A_38_P00029852	mir|dme-miR-307a-5p|mir|MIMAT0020832	dme-miR-307a-5p	MIMAT0020832	unmapped	CGCTCGGGTTTTCCCGAGCGGATCACACCCAGGTTGTTTTTTTTTT
A_38_P00029853	A_38_P00029853	mir|dme-miR-307a-5p|mir|MIMAT0020832	dme-miR-307a-5p	MIMAT0020832	unmapped	CGCTCGGGTTTTCCCGAGCGGATCACACCCAGGTTGATATTTTTTTT
A_38_P00029854	A_38_P00029854	mir|dme-miR-4965-5p|mir|MIMAT0020188	dme-miR-4965-5p	MIMAT0020188	unmapped	CGCTCGGGTTTTCCCGAGCGGATCACATCAGGCGCTTTTTTTTTTT
A_38_P00029855	A_38_P00029855	mir|dme-miR-4965-5p|mir|MIMAT0020188	dme-miR-4965-5p	MIMAT0020188	unmapped	CGCTCGGGTTTTCCCGAGCGGATCACATCAGGCGCTCTATTTTTTTT
A_38_P00029856	A_38_P00029856	mir|dme-miR-4948-5p|mir|MIMAT0020158	dme-miR-4948-5p	MIMAT0020158	unmapped	CGCTCGGGTTTTCCCGAGCGGATCACGCACGCCATTTTTTTTTT
A_38_P00029857	A_38_P00029857	mir|dme-miR-4948-5p|mir|MIMAT0020158	dme-miR-4948-5p	MIMAT0020158	unmapped	CGCTCGGGTTTTCCCGAGCGGATCACGCACGCCACTTTTTTTTTT
A_38_P00029858	A_38_P00029858	mir|dme-miR-988-5p|mir|MIMAT0020886	dme-miR-988-5p	MIMAT0020886	unmapped	CGCTCGGGTTTTCCCGAGCGGATCACTTTGCTACAAATCATTTTTTTTTT
A_38_P00029859	A_38_P00029859	mir|dme-miR-988-5p|mir|MIMAT0020886	dme-miR-988-5p	MIMAT0020886	unmapped	CGCTCGGGTTTTCCCGAGCGGATCACTTTGCTACAAATCACTTTTTTTTTT
A_38_P00029860	A_38_P00029860	mir|dme-miR-994-3p|mir|MIMAT0020894	dme-miR-994-3p	MIMAT0020894	unmapped	CGCTCGGGTTTTCCCGAGCGGATCTAAAAGAAACAGCAACATTTTTTTTT
A_38_P00029861	A_38_P00029861	mir|dme-miR-994-3p|mir|MIMAT0020894	dme-miR-994-3p	MIMAT0020894	unmapped	CGCTCGGGTTTTCCCGAGCGGATCTAAAAGAAACAGCAACTTATTTTTTTT
A_38_P00029862	A_38_P00029862	mir|dme-miR-133-5p|mir|MIMAT0020806	dme-miR-133-5p	MIMAT0020806	unmapped	CGCTCGGGTTTTCCCGAGCGGATCTGACCCGATGTCTTTTTTTTTT
A_38_P00029863	A_38_P00029863	mir|dme-miR-133-5p|mir|MIMAT0020806	dme-miR-133-5p	MIMAT0020806	unmapped	CGCTCGGGTTTTCCCGAGCGGATCTGACCCGATGTCATTTTTTTTTT
A_38_P00029864	A_38_P00029864	mir|dme-miR-210-5p|mir|MIMAT0020816	dme-miR-210-5p	MIMAT0020816	unmapped	CGCTCGGGTTTTCCCGAGCGGATCTTGTGCAGTGGCTTTTTTTTTT
A_38_P00029865	A_38_P00029865	mir|dme-miR-210-5p|mir|MIMAT0020816	dme-miR-210-5p	MIMAT0020816	unmapped	CGCTCGGGTTTTCCCGAGCGGATCTTGTGCAGTGGCCTTTTTTTTTT
A_38_P00029866	A_38_P00029866	mir|dme-miR-2c-5p|mir|MIMAT0020845	dme-miR-2c-5p	MIMAT0020845	unmapped	CGCTCGGGTTTTCCCGAGCGGATCTTTCTTCAGCCCTAATTTTTTTT
A_38_P00029867	A_38_P00029867	mir|dme-miR-2c-5p|mir|MIMAT0020845	dme-miR-2c-5p	MIMAT0020845	unmapped	CGCTCGGGTTTTCCCGAGCGGATCTTTCTTCAGCCCTTAATTTTTTTT
A_38_P00029868	A_38_P00029868	mir|dme-miR-2c-5p|mir|MIMAT0020845	dme-miR-2c-5p	MIMAT0020845	unmapped	CGCTCGGGTTTTCCCGAGCGGATCTTTCTTCAGCCCTTTAATTTTTTTT
A_38_P00029869	A_38_P00029869	mir|dme-miR-985-5p|mir|MIMAT0020883	dme-miR-985-5p	MIMAT0020883	unmapped	CGCTCGGGTTTTCCCGAGCGGATGAAATGTACCAATGAGTTTTTTTTTT
A_38_P00029870	A_38_P00029870	mir|dme-miR-985-5p|mir|MIMAT0020883	dme-miR-985-5p	MIMAT0020883	unmapped	CGCTCGGGTTTTCCCGAGCGGATGAAATGTACCAATGAGCTTTTTTTTTT
A_38_P00029871	A_38_P00029871	mir|dme-miR-4942-3p|mir|MIMAT0020150	dme-miR-4942-3p	MIMAT0020150	unmapped	CGCTCGGGTTTTCCCGAGCGGATGCCAACAGCGATGATTTTTTTTT
A_38_P00029872	A_38_P00029872	mir|dme-miR-4942-3p|mir|MIMAT0020150	dme-miR-4942-3p	MIMAT0020150	unmapped	CGCTCGGGTTTTCCCGAGCGGATGCCAACAGCGATGTTTTTTTTTTT
A_38_P00029873	A_38_P00029873	mir|dme-miR-990-3p|mir|MIMAT0020889	dme-miR-990-3p	MIMAT0020889	unmapped	CGCTCGGGTTTTCCCGAGCGGATGGCACCGAAGCTTTTTTTTTTT
A_38_P00029874	A_38_P00029874	mir|dme-miR-990-3p|mir|MIMAT0020889	dme-miR-990-3p	MIMAT0020889	unmapped	CGCTCGGGTTTTCCCGAGCGGATGGCACCGAAGCTGTTTTTTTTTT
A_38_P00029875	A_38_P00029875	mir|dme-miR-4985-5p|mir|MIMAT0020221	dme-miR-4985-5p	MIMAT0020221	unmapped	CGCTCGGGTTTTCCCGAGCGGATGTCACGATCAATGTAAAATTTTTTTT
A_38_P00029876	A_38_P00029876	mir|dme-miR-4985-5p|mir|MIMAT0020221	dme-miR-4985-5p	MIMAT0020221	unmapped	CGCTCGGGTTTTCCCGAGCGGATGTCACGATCAATGTAATATTTTTTTTT
A_38_P00029877	A_38_P00029877	mir|dme-miR-4985-5p|mir|MIMAT0020221	dme-miR-4985-5p	MIMAT0020221	unmapped	CGCTCGGGTTTTCCCGAGCGGATGTCACGATCAATGTAATTTTTTTTTTTT
A_38_P00029878	A_38_P00029878	mir|dme-miR-1014-5p|mir|MIMAT0020907	dme-miR-1014-5p	MIMAT0020907	unmapped	CGCTCGGGTTTTCCCGAGCGGATTAAAATCTATTTCCATTATATTTTTTTTTT
A_38_P00029879	A_38_P00029879	mir|dme-miR-991-5p|mir|MIMAT0020890	dme-miR-991-5p	MIMAT0020890	unmapped	CGCTCGGGTTTTCCCGAGCGGATTAATAGGTGTAGTTGGGTTTTTTTTTT
A_38_P00029880	A_38_P00029880	mir|dme-miR-991-5p|mir|MIMAT0020890	dme-miR-991-5p	MIMAT0020890	unmapped	CGCTCGGGTTTTCCCGAGCGGATTAATAGGTGTAGTTGGGATTTTTTTTTT
A_38_P00029881	A_38_P00029881	mir|dme-miR-31b-3p|mir|MIMAT0020825	dme-miR-31b-3p	MIMAT0020825	unmapped	CGCTCGGGTTTTCCCGAGCGGATTGACTAGATGAGGCAATTTTTTTTT
A_38_P00029882	A_38_P00029882	mir|dme-miR-31b-3p|mir|MIMAT0020825	dme-miR-31b-3p	MIMAT0020825	unmapped	CGCTCGGGTTTTCCCGAGCGGATTGACTAGATGAGGCATTTTTTTTTTT
A_38_P00029883	A_38_P00029883	mir|dme-miR-31b-3p|mir|MIMAT0020825	dme-miR-31b-3p	MIMAT0020825	unmapped	CGCTCGGGTTTTCCCGAGCGGATTGACTAGATGAGGCATATTTTTTTTTT
A_38_P00029884	A_38_P00029884	mir|dme-miR-31b-3p|mir|MIMAT0020825	dme-miR-31b-3p	MIMAT0020825	unmapped	CGCTCGGGTTTTCCCGAGCGGATTGACTAGATGAGGCATAGTTTTTTTTTT
A_38_P00029885	A_38_P00029885	mir|dme-miR-4914-5p|mir|MIMAT0020507	dme-miR-4914-5p	MIMAT0020507	unmapped	CGCTCGGGTTTTCCCGAGCGGATTGGAACTCGCTCTCTTTTTTTTTT
A_38_P00029886	A_38_P00029886	mir|dme-miR-4914-5p|mir|MIMAT0020507	dme-miR-4914-5p	MIMAT0020507	unmapped	CGCTCGGGTTTTCCCGAGCGGATTGGAACTCGCTCTCATATTTTTTTT
A_38_P00029887	A_38_P00029887	mir|dme-miR-308-5p|mir|MIMAT0020833	dme-miR-308-5p	MIMAT0020833	unmapped	CGCTCGGGTTTTCCCGAGCGGCAAAACACAAAAATATACTGTTTTTTTTTT
A_38_P00029888	A_38_P00029888	mir|dme-miR-308-5p|mir|MIMAT0020833	dme-miR-308-5p	MIMAT0020833	unmapped	CGCTCGGGTTTTCCCGAGCGGCAAAACACAAAAATATACTGCTTTTTTTTTT
A_38_P00029889	A_38_P00029889	mir|dme-miR-309-5p|mir|MIMAT0020835	dme-miR-309-5p	MIMAT0020835	unmapped	CGCTCGGGTTTTCCCGAGCGGCAAAACCGAACAAGGAATTTTTTTT
A_38_P00029890	A_38_P00029890	mir|dme-miR-309-5p|mir|MIMAT0020835	dme-miR-309-5p	MIMAT0020835	unmapped	CGCTCGGGTTTTCCCGAGCGGCAAAACCGAACAAGGTAATTTTTTTT
A_38_P00029891	A_38_P00029891	mir|dme-miR-318-5p|mir|MIMAT0020844	dme-miR-318-5p	MIMAT0020844	unmapped	CGCTCGGGTTTTCCCGAGCGGCAAAACTGAACTGTGTGATTTTTTTTT
A_38_P00029892	A_38_P00029892	mir|dme-miR-318-5p|mir|MIMAT0020844	dme-miR-318-5p	MIMAT0020844	unmapped	CGCTCGGGTTTTCCCGAGCGGCAAAACTGAACTGTGTGTTATTTTTTTT
A_38_P00029893	A_38_P00029893	mir|dme-miR-993-5p|mir|MIMAT0020893	dme-miR-993-5p	MIMAT0020893	unmapped	CGCTCGGGTTTTCCCGAGCGGCAAAAGCCCGGAACATTTTTTTTT
A_38_P00029894	A_38_P00029894	mir|dme-miR-993-5p|mir|MIMAT0020893	dme-miR-993-5p	MIMAT0020893	unmapped	CGCTCGGGTTTTCCCGAGCGGCAAAAGCCCGGAACTTTTTTTTTTT
A_38_P00029895	A_38_P00029895	mir|dme-miR-92b-5p|mir|MIMAT0020819	dme-miR-92b-5p	MIMAT0020819	unmapped	CGCTCGGGTTTTCCCGAGCGGCAAATAAGCACTGGGTTTTTTTTTT
A_38_P00029896	A_38_P00029896	mir|dme-miR-92b-5p|mir|MIMAT0020819	dme-miR-92b-5p	MIMAT0020819	unmapped	CGCTCGGGTTTTCCCGAGCGGCAAATAAGCACTGGGCTTTTTTTTTT
A_38_P00029897	A_38_P00029897	mir|dme-miR-4972-3p|mir|MIMAT0020200	dme-miR-4972-3p	MIMAT0020200	unmapped	CGCTCGGGTTTTCCCGAGCGGCAATCCCGATCGCTTTTTTTTTT
A_38_P00029898	A_38_P00029898	mir|dme-miR-4972-3p|mir|MIMAT0020200	dme-miR-4972-3p	MIMAT0020200	unmapped	CGCTCGGGTTTTCCCGAGCGGCAATCCCGATCGCATTTTTTTTTT
A_38_P00029899	A_38_P00029899	mir|dme-miR-4954-5p|mir|MIMAT0020169	dme-miR-4954-5p	MIMAT0020169	unmapped	CGCTCGGGTTTTCCCGAGCGGCAATCTATCATGGCTCTTTTTTTTTT
A_38_P00029900	A_38_P00029900	mir|dme-miR-4954-5p|mir|MIMAT0020169	dme-miR-4954-5p	MIMAT0020169	unmapped	CGCTCGGGTTTTCCCGAGCGGCAATCTATCATGGCTCGTTTTTTTTTT
A_38_P00029901	A_38_P00029901	mir|dme-miR-4983-3p|mir|MIMAT0020218	dme-miR-4983-3p	MIMAT0020218	unmapped	CGCTCGGGTTTTCCCGAGCGGCACACTTGCTCAAAAGTTTTTTTTTT
A_38_P00029902	A_38_P00029902	mir|dme-miR-4983-3p|mir|MIMAT0020218	dme-miR-4983-3p	MIMAT0020218	unmapped	CGCTCGGGTTTTCCCGAGCGGCACACTTGCTCAAAAGATATTTTTTTT
A_38_P00029903	A_38_P00029903	mir|dme-miR-989-5p|mir|MIMAT0020887	dme-miR-989-5p	MIMAT0020887	unmapped	CGCTCGGGTTTTCCCGAGCGGCACGTGACTGCAAGTATTTTTTTT
A_38_P00029904	A_38_P00029904	mir|dme-miR-989-5p|mir|MIMAT0020887	dme-miR-989-5p	MIMAT0020887	unmapped	CGCTCGGGTTTTCCCGAGCGGCACGTGACTGCAAGGATTTTTTTTT
A_38_P00029905	A_38_P00029905	mir|dme-miR-4983-5p|mir|MIMAT0020217	dme-miR-4983-5p	MIMAT0020217	unmapped	CGCTCGGGTTTTCCCGAGCGGCAGAAATGCAAACGAGTTTTTTTTTT
A_38_P00029906	A_38_P00029906	mir|dme-miR-4983-5p|mir|MIMAT0020217	dme-miR-4983-5p	MIMAT0020217	unmapped	CGCTCGGGTTTTCCCGAGCGGCAGAAATGCAAACGAGCTTTTTTTTTT
A_38_P00029907	A_38_P00029907	mir|dme-miR-3-5p|mir|MIMAT0020784	dme-miR-3-5p	MIMAT0020784	unmapped	CGCTCGGGTTTTCCCGAGCGGCATAACTGCACAAGATGTTTTTTTTTT
A_38_P00029908	A_38_P00029908	mir|dme-miR-3-5p|mir|MIMAT0020784	dme-miR-3-5p	MIMAT0020784	unmapped	CGCTCGGGTTTTCCCGAGCGGCATAACTGCACAAGATGCTATTTTTTTT
A_38_P00029909	A_38_P00029909	mir|dme-miR-13b-1-5p|mir|MIMAT0020796	dme-miR-13b-1-5p	MIMAT0020796	unmapped	CGCTCGGGTTTTCCCGAGCGGCATAAGTTCACAAACATTTATTTTTTTTT
A_38_P00029910	A_38_P00029910	mir|dme-miR-13b-1-5p|mir|MIMAT0020796	dme-miR-13b-1-5p	MIMAT0020796	unmapped	CGCTCGGGTTTTCCCGAGCGGCATAAGTTCACAAACATTTTTTTTTTTTTT
A_38_P00029911	A_38_P00029911	mir|dme-miR-13b-1-5p|mir|MIMAT0020796	dme-miR-13b-1-5p	MIMAT0020796	unmapped	CGCTCGGGTTTTCCCGAGCGGCATAAGTTCACAAACATTTTATTTTTTTTTT
A_38_P00029912	A_38_P00029912	mir|dme-miR-13b-2-5p|mir|MIMAT0020797	dme-miR-13b-2-5p	MIMAT0020797	unmapped	CGCTCGGGTTTTCCCGAGCGGCATAGCTCACAGTCATTAATTTTTTTT
A_38_P00029913	A_38_P00029913	mir|dme-miR-13b-2-5p|mir|MIMAT0020797	dme-miR-13b-2-5p	MIMAT0020797	unmapped	CGCTCGGGTTTTCCCGAGCGGCATAGCTCACAGTCATTTATTTTTTTTT
A_38_P00029914	A_38_P00029914	mir|dme-miR-965-5p|mir|MIMAT0020861	dme-miR-965-5p	MIMAT0020861	unmapped	CGCTCGGGTTTTCCCGAGCGGCATATAACGTACAGTTTTACTTTTTTTTTT
A_38_P00029915	A_38_P00029915	mir|dme-miR-965-5p|mir|MIMAT0020861	dme-miR-965-5p	MIMAT0020861	unmapped	CGCTCGGGTTTTCCCGAGCGGCATATAACGTACAGTTTTACCTTTTTTTTTT
A_38_P00029916	A_38_P00029916	mir|dme-miR-124-5p|mir|MIMAT0020813	dme-miR-124-5p	MIMAT0020813	unmapped	CGCTCGGGTTTTCCCGAGCGGCATATAGGCCTACAGTGTTTTTTTTTT
A_38_P00029917	A_38_P00029917	mir|dme-miR-124-5p|mir|MIMAT0020813	dme-miR-124-5p	MIMAT0020813	unmapped	CGCTCGGGTTTTCCCGAGCGGCATATAGGCCTACAGTGGTATTTTTTTT
A_38_P00029918	A_38_P00029918	mir|dme-miR-2b-1-5p|mir|MIMAT0020782	dme-miR-2b-1-5p	MIMAT0020782	unmapped	CGCTCGGGTTTTCCCGAGCGGCATGTCACTGCCACAATTTTTTTT
A_38_P00029919	A_38_P00029919	mir|dme-miR-2b-1-5p|mir|MIMAT0020782	dme-miR-2b-1-5p	MIMAT0020782	unmapped	CGCTCGGGTTTTCCCGAGCGGCATGTCACTGCCACTAATTTTTTTT
A_38_P00029920	A_38_P00029920	mir|dme-miR-2b-2-5p|mir|MIMAT0020783|mir|dme-miR-2a-1-5p|mir|MIMAT0020780	dme-miR-2b-2-5p	MIMAT0020783	unmapped	CGCTCGGGTTTTCCCGAGCGGCATTTCACAACCACTTTTTTTTTTTTT
A_38_P00029921	A_38_P00029921	mir|dme-miR-2b-2-5p|mir|MIMAT0020783|mir|dme-miR-2a-1-5p|mir|MIMAT0020780	dme-miR-2b-2-5p	MIMAT0020783	unmapped	CGCTCGGGTTTTCCCGAGCGGCATTTCACAACCACTTTGTTTTTTTTTT
A_38_P00029922	A_38_P00029922	mir|dme-miR-13a-5p|mir|MIMAT0020795	dme-miR-13a-5p	MIMAT0020795	unmapped	CGCTCGGGTTTTCCCGAGCGGCATTTCACAACCCTTTTTTTTTTTTT
A_38_P00029923	A_38_P00029923	mir|dme-miR-13a-5p|mir|MIMAT0020795	dme-miR-13a-5p	MIMAT0020795	unmapped	CGCTCGGGTTTTCCCGAGCGGCATTTCACAACCCTTTGTTTTTTTTTT
A_38_P00029924	A_38_P00029924	mir|dme-miR-1003-5p|mir|MIMAT0020902	dme-miR-1003-5p	MIMAT0020902	unmapped	CGCTCGGGTTTTCCCGAGCGGCCAACCACATCCAGTATTTTTTTT
A_38_P00029925	A_38_P00029925	mir|dme-miR-1003-5p|mir|MIMAT0020902	dme-miR-1003-5p	MIMAT0020902	unmapped	CGCTCGGGTTTTCCCGAGCGGCCAACCACATCCAGAATTTTTTTTT
A_38_P00029926	A_38_P00029926	mir|dme-miR-1007-5p|mir|MIMAT0020904	dme-miR-1007-5p	MIMAT0020904	unmapped	CGCTCGGGTTTTCCCGAGCGGCCAAGATCGAGTTCAATTTTTTTTTT
A_38_P00029927	A_38_P00029927	mir|dme-miR-1007-5p|mir|MIMAT0020904	dme-miR-1007-5p	MIMAT0020904	unmapped	CGCTCGGGTTTTCCCGAGCGGCCAAGATCGAGTTCAAATTTTTTTTTT
A_38_P00029928	A_38_P00029928	mir|dme-miR-4984-3p|mir|MIMAT0020220	dme-miR-4984-3p	MIMAT0020220	unmapped	CGCTCGGGTTTTCCCGAGCGGCCAGCGAATACGTCTTTTTTTTTT
A_38_P00029929	A_38_P00029929	mir|dme-miR-4984-3p|mir|MIMAT0020220	dme-miR-4984-3p	MIMAT0020220	unmapped	CGCTCGGGTTTTCCCGAGCGGCCAGCGAATACGTCATTTTTTTTTT
A_38_P00029930	A_38_P00029930	mir|dme-miR-1001-3p|mir|MIMAT0020901	dme-miR-1001-3p	MIMAT0020901	unmapped	CGCTCGGGTTTTCCCGAGCGGCCGAGAGCAGAAACTTTTTTTTTT
A_38_P00029931	A_38_P00029931	mir|dme-miR-1001-3p|mir|MIMAT0020901	dme-miR-1001-3p	MIMAT0020901	unmapped	CGCTCGGGTTTTCCCGAGCGGCCGAGAGCAGAAACCTTTTTTTTTT
A_38_P00029932	A_38_P00029932	mir|dme-miR-4957-3p|mir|MIMAT0020176	dme-miR-4957-3p	MIMAT0020176	unmapped	CGCTCGGGTTTTCCCGAGCGGCCGCTCGCTGCATTTTTTTTT
A_38_P00029933	A_38_P00029933	mir|dme-miR-4957-3p|mir|MIMAT0020176	dme-miR-4957-3p	MIMAT0020176	unmapped	CGCTCGGGTTTTCCCGAGCGGCCGCTCGCTGCTTTTTTTTTTT
A_38_P00029934	A_38_P00029934	mir|dme-miR-4956-3p|mir|MIMAT0020174	dme-miR-4956-3p	MIMAT0020174	unmapped	CGCTCGGGTTTTCCCGAGCGGCCGCTGCCCAGTTTTTTTTTT
A_38_P00029935	A_38_P00029935	mir|dme-miR-4956-3p|mir|MIMAT0020174	dme-miR-4956-3p	MIMAT0020174	unmapped	CGCTCGGGTTTTCCCGAGCGGCCGCTGCCCAGCTTTTTTTTTT
A_38_P00029936	A_38_P00029936	mir|dme-miR-2283-3p|mir|MIMAT0020909	dme-miR-2283-3p	MIMAT0020909	unmapped	CGCTCGGGTTTTCCCGAGCGGCCTAAAATATCACGTATACATTTTTTTTT
A_38_P00029937	A_38_P00029937	mir|dme-miR-2283-3p|mir|MIMAT0020909	dme-miR-2283-3p	MIMAT0020909	unmapped	CGCTCGGGTTTTCCCGAGCGGCCTAAAATATCACGTATACTTTTTTTTTTT
A_38_P00029938	A_38_P00029938	mir|dme-miR-2283-3p|mir|MIMAT0020909	dme-miR-2283-3p	MIMAT0020909	unmapped	CGCTCGGGTTTTCCCGAGCGGCCTAAAATATCACGTATACTATTTTTTTTTT
A_38_P00029939	A_38_P00029939	mir|dme-miR-282-3p|mir|MIMAT0020809	dme-miR-282-3p	MIMAT0020809	unmapped	CGCTCGGGTTTTCCCGAGCGGCCTAACCTCTTATAGGCATTTTTTTTT
A_38_P00029940	A_38_P00029940	mir|dme-miR-282-3p|mir|MIMAT0020809	dme-miR-282-3p	MIMAT0020809	unmapped	CGCTCGGGTTTTCCCGAGCGGCCTAACCTCTTATAGGCTTATTTTTTTT
A_38_P00029941	A_38_P00029941	mir|dme-miR-4980-3p|mir|MIMAT0020213	dme-miR-4980-3p	MIMAT0020213	unmapped	CGCTCGGGTTTTCCCGAGCGGCGAAACGCAGAACTTTTTTTTTT
A_38_P00029942	A_38_P00029942	mir|dme-miR-4980-3p|mir|MIMAT0020213	dme-miR-4980-3p	MIMAT0020213	unmapped	CGCTCGGGTTTTCCCGAGCGGCGAAACGCAGAACGTTTTTTTTTT
A_38_P00029943	A_38_P00029943	mir|dme-miR-4947-5p|mir|MIMAT0020157	dme-miR-4947-5p	MIMAT0020157	unmapped	CGCTCGGGTTTTCCCGAGCGGCGAAGGATAAATATGGGTTTTTTTTTT
A_38_P00029944	A_38_P00029944	mir|dme-miR-4947-5p|mir|MIMAT0020157	dme-miR-4947-5p	MIMAT0020157	unmapped	CGCTCGGGTTTTCCCGAGCGGCGAAGGATAAATATGGGCTTTTTTTTTT
A_38_P00029945	A_38_P00029945	mir|dme-miR-4939-3p|mir|MIMAT0020145	dme-miR-4939-3p	MIMAT0020145	unmapped	CGCTCGGGTTTTCCCGAGCGGCGAATCTTCACCTGCTTTTTTTTTT
A_38_P00029946	A_38_P00029946	mir|dme-miR-4939-3p|mir|MIMAT0020145	dme-miR-4939-3p	MIMAT0020145	unmapped	CGCTCGGGTTTTCCCGAGCGGCGAATCTTCACCTGCATTTTTTTTTT
A_38_P00029947	A_38_P00029947	mir|dme-miR-984-3p|mir|MIMAT0020881	dme-miR-984-3p	MIMAT0020881	unmapped	CGCTCGGGTTTTCCCGAGCGGCGAGCCAAATTCGGAATTTTTTTT
A_38_P00029948	A_38_P00029948	mir|dme-miR-984-3p|mir|MIMAT0020881	dme-miR-984-3p	MIMAT0020881	unmapped	CGCTCGGGTTTTCCCGAGCGGCGAGCCAAATTCGGTATTTTTTTTT
A_38_P00029949	A_38_P00029949	mir|dme-miR-4949-3p|mir|MIMAT0020161	dme-miR-4949-3p	MIMAT0020161	unmapped	CGCTCGGGTTTTCCCGAGCGGCGAGGCACACACTTTTTTTTTT
A_38_P00029950	A_38_P00029950	mir|dme-miR-4949-3p|mir|MIMAT0020161	dme-miR-4949-3p	MIMAT0020161	unmapped	CGCTCGGGTTTTCCCGAGCGGCGAGGCACACACGTTTTTTTTTT
A_38_P00029951	A_38_P00029951	mir|dme-miR-4970-5p|mir|MIMAT0020197	dme-miR-4970-5p	MIMAT0020197	unmapped	CGCTCGGGTTTTCCCGAGCGGCGCCAGCAACTGTATTTTTTTT
A_38_P00029952	A_38_P00029952	mir|dme-miR-4970-5p|mir|MIMAT0020197	dme-miR-4970-5p	MIMAT0020197	unmapped	CGCTCGGGTTTTCCCGAGCGGCGCCAGCAACTGCATTTTTTTTT
A_38_P00029953	A_38_P00029953	mir|dme-miR-219-3p|mir|MIMAT0020803	dme-miR-219-3p	MIMAT0020803	unmapped	CGCTCGGGTTTTCCCGAGCGGCGCGATGCCCAGATTTTTTTTT
A_38_P00029954	A_38_P00029954	mir|dme-miR-219-3p|mir|MIMAT0020803	dme-miR-219-3p	MIMAT0020803	unmapped	CGCTCGGGTTTTCCCGAGCGGCGCGATGCCCAGTTTTTTTTTTT
A_38_P00029955	A_38_P00029955	mir|dme-miR-4976-3p|mir|MIMAT0020207	dme-miR-4976-3p	MIMAT0020207	unmapped	CGCTCGGGTTTTCCCGAGCGGCGCTGGCTGACATTTTTTTTTTT
A_38_P00029956	A_38_P00029956	mir|dme-miR-4976-3p|mir|MIMAT0020207	dme-miR-4976-3p	MIMAT0020207	unmapped	CGCTCGGGTTTTCCCGAGCGGCGCTGGCTGACATCTTTTTTTTTT
A_38_P00029957	A_38_P00029957	mir|dme-miR-11-5p|mir|MIMAT0020793	dme-miR-11-5p	MIMAT0020793	unmapped	CGCTCGGGTTTTCCCGAGCGGCGGGTCACAGAGAATTTTTTTTTT
A_38_P00029958	A_38_P00029958	mir|dme-miR-11-5p|mir|MIMAT0020793	dme-miR-11-5p	MIMAT0020793	unmapped	CGCTCGGGTTTTCCCGAGCGGCGGGTCACAGAGAAATATTTTTTTT
A_38_P00029959	A_38_P00029959	mir|dme-miR-978-5p|mir|MIMAT0020875	dme-miR-978-5p	MIMAT0020875	unmapped	CGCTCGGGTTTTCCCGAGCGGCGTAAGCCAGTGGTTTTTTTTTT
A_38_P00029960	A_38_P00029960	mir|dme-miR-978-5p|mir|MIMAT0020875	dme-miR-978-5p	MIMAT0020875	unmapped	CGCTCGGGTTTTCCCGAGCGGCGTAAGCCAGTGGCTATTTTTTTT
A_38_P00029961	A_38_P00029961	mir|dme-miR-996-5p|mir|MIMAT0020895	dme-miR-996-5p	MIMAT0020895	unmapped	CGCTCGGGTTTTCCCGAGCGGCGTGCACTAGATCCAATTTTTTTTT
A_38_P00029962	A_38_P00029962	mir|dme-miR-996-5p|mir|MIMAT0020895	dme-miR-996-5p	MIMAT0020895	unmapped	CGCTCGGGTTTTCCCGAGCGGCGTGCACTAGATCCATTATTTTTTTT
A_38_P00029963	A_38_P00029963	mir|dme-miR-4909-3p|mir|MIMAT0020515	dme-miR-4909-3p	MIMAT0020515	unmapped	CGCTCGGGTTTTCCCGAGCGGCTAAAATGAAGACCGGTATTTTTTTT
A_38_P00029964	A_38_P00029964	mir|dme-miR-4909-3p|mir|MIMAT0020515	dme-miR-4909-3p	MIMAT0020515	unmapped	CGCTCGGGTTTTCCCGAGCGGCTAAAATGAAGACCGGAATTTTTTTTT
A_38_P00029965	A_38_P00029965	mir|dme-miR-4913-3p|mir|MIMAT0020506	dme-miR-4913-3p	MIMAT0020506	unmapped	CGCTCGGGTTTTCCCGAGCGGCTAAGCAATTCGAATTGTATTTTTTTT
A_38_P00029966	A_38_P00029966	mir|dme-miR-4913-3p|mir|MIMAT0020506	dme-miR-4913-3p	MIMAT0020506	unmapped	CGCTCGGGTTTTCCCGAGCGGCTAAGCAATTCGAATTGGAATTTTTTTT
A_38_P00029967	A_38_P00029967	mir|dme-miR-4973-5p|mir|MIMAT0020201	dme-miR-4973-5p	MIMAT0020201	unmapped	CGCTCGGGTTTTCCCGAGCGGCTACAACACGCAACTTTTTTTTTT
A_38_P00029968	A_38_P00029968	mir|dme-miR-4973-5p|mir|MIMAT0020201	dme-miR-4973-5p	MIMAT0020201	unmapped	CGCTCGGGTTTTCCCGAGCGGCTACAACACGCAACGTTTTTTTTTT
A_38_P00029969	A_38_P00029969	mir|dme-miR-4952-3p|mir|MIMAT0020167	dme-miR-4952-3p	MIMAT0020167	unmapped	CGCTCGGGTTTTCCCGAGCGGCTACCCGATTCGAATTTTTTTTTTT
A_38_P00029970	A_38_P00029970	mir|dme-miR-4952-3p|mir|MIMAT0020167	dme-miR-4952-3p	MIMAT0020167	unmapped	CGCTCGGGTTTTCCCGAGCGGCTACCCGATTCGAATGTTTTTTTTTT
A_38_P00029971	A_38_P00029971	mir|dme-miR-4911-3p|mir|MIMAT0020504	dme-miR-4911-3p	MIMAT0020504	unmapped	CGCTCGGGTTTTCCCGAGCGGCTACGCGGGGGTTTTTTTTTT
A_38_P00029972	A_38_P00029972	mir|dme-miR-4911-3p|mir|MIMAT0020504	dme-miR-4911-3p	MIMAT0020504	unmapped	CGCTCGGGTTTTCCCGAGCGGCTACGCGGGGGGTTTTTTTTTT
A_38_P00029973	A_38_P00029973	mir|dme-miR-4908-3p|mir|MIMAT0020514	dme-miR-4908-3p	MIMAT0020514	unmapped	CGCTCGGGTTTTCCCGAGCGGCTATAGAACTTTATGAGCACTTTTTTTTTT
A_38_P00029974	A_38_P00029974	mir|dme-miR-4908-3p|mir|MIMAT0020514	dme-miR-4908-3p	MIMAT0020514	unmapped	CGCTCGGGTTTTCCCGAGCGGCTATAGAACTTTATGAGCACATTTTTTTTTT
A_38_P00029975	A_38_P00029975	mir|dme-miR-4910-5p|mir|MIMAT0020503	dme-miR-4910-5p	MIMAT0020503	unmapped	CGCTCGGGTTTTCCCGAGCGGCTCATGGAATTCCATACTTTTTTTTTT
A_38_P00029976	A_38_P00029976	mir|dme-miR-4910-5p|mir|MIMAT0020503	dme-miR-4910-5p	MIMAT0020503	unmapped	CGCTCGGGTTTTCCCGAGCGGCTCATGGAATTCCATACATTTTTTTTTT
A_38_P00029977	A_38_P00029977	mir|dme-miR-4977-3p|mir|MIMAT0020209	dme-miR-4977-3p	MIMAT0020209	unmapped	CGCTCGGGTTTTCCCGAGCGGCTCTCTTTTGGAACGTATTTTTTTT
A_38_P00029978	A_38_P00029978	mir|dme-miR-4977-3p|mir|MIMAT0020209	dme-miR-4977-3p	MIMAT0020209	unmapped	CGCTCGGGTTTTCCCGAGCGGCTCTCTTTTGGAACGGATTTTTTTTT
A_38_P00029979	A_38_P00029979	mir|dme-miR-193-5p|mir|MIMAT0020849	dme-miR-193-5p	MIMAT0020849	unmapped	CGCTCGGGTTTTCCCGAGCGGCTGCTGATCTAAAAAATCTTTTTTTTTT
A_38_P00029980	A_38_P00029980	mir|dme-miR-193-5p|mir|MIMAT0020849	dme-miR-193-5p	MIMAT0020849	unmapped	CGCTCGGGTTTTCCCGAGCGGCTGCTGATCTAAAAAATCCTTTTTTTTTT
A_38_P00029981	A_38_P00029981	mir|dme-miR-4963-3p|mir|MIMAT0020186	dme-miR-4963-3p	MIMAT0020186	unmapped	CGCTCGGGTTTTCCCGAGCGGCTGGTTCCAGCCCTTTTTTTTTT
A_38_P00029982	A_38_P00029982	mir|dme-miR-4963-3p|mir|MIMAT0020186	dme-miR-4963-3p	MIMAT0020186	unmapped	CGCTCGGGTTTTCCCGAGCGGCTGGTTCCAGCCCGTTTTTTTTTT
A_38_P00029983	A_38_P00029983	mir|dme-miR-964-3p|mir|MIMAT0020859	dme-miR-964-3p	MIMAT0020859	unmapped	CGCTCGGGTTTTCCCGAGCGGCTTAGAACAGAGGCTTTATTTTTTTTT
A_38_P00029984	A_38_P00029984	mir|dme-miR-964-3p|mir|MIMAT0020859	dme-miR-964-3p	MIMAT0020859	unmapped	CGCTCGGGTTTTCCCGAGCGGCTTAGAACAGAGGCTTTTTTTTTTTTTT
A_38_P00029985	A_38_P00029985	mir|dme-miR-974-3p|mir|MIMAT0020871	dme-miR-974-3p	MIMAT0020871	unmapped	CGCTCGGGTTTTCCCGAGCGGCTTAGCTTCCAATGAAGAATTTTTTTT
A_38_P00029986	A_38_P00029986	mir|dme-miR-974-3p|mir|MIMAT0020871	dme-miR-974-3p	MIMAT0020871	unmapped	CGCTCGGGTTTTCCCGAGCGGCTTAGCTTCCAATGAAGTATTTTTTTTT
A_38_P00029987	A_38_P00029987	mir|dme-miR-973-3p|mir|MIMAT0020870	dme-miR-973-3p	MIMAT0020870	unmapped	CGCTCGGGTTTTCCCGAGCGGCTTGTGTCGGAGAATTTTTTTTTTT
A_38_P00029988	A_38_P00029988	mir|dme-miR-973-3p|mir|MIMAT0020870	dme-miR-973-3p	MIMAT0020870	unmapped	CGCTCGGGTTTTCCCGAGCGGCTTGTGTCGGAGAATGTTTTTTTTTT
A_38_P00029989	A_38_P00029989	mir|dme-miR-959-5p|mir|MIMAT0020854	dme-miR-959-5p	MIMAT0020854	unmapped	CGCTCGGGTTTTCCCGAGCGGCTTTATCAACCCGAGTTTTTTTTTTT
A_38_P00029990	A_38_P00029990	mir|dme-miR-959-5p|mir|MIMAT0020854	dme-miR-959-5p	MIMAT0020854	unmapped	CGCTCGGGTTTTCCCGAGCGGCTTTATCAACCCGAGTATATTTTTTTT
A_38_P00029991	A_38_P00029991	mir|dme-miR-959-5p|mir|MIMAT0020854	dme-miR-959-5p	MIMAT0020854	unmapped	CGCTCGGGTTTTCCCGAGCGGCTTTATCAACCCGAGTACATTTTTTTTT
A_38_P00029992	A_38_P00029992	mir|dme-miR-961-3p|mir|MIMAT0020856	dme-miR-961-3p	MIMAT0020856	unmapped	CGCTCGGGTTTTCCCGAGCGGCTTTTGATTGCCAGAAATTTTTTTTTT
A_38_P00029993	A_38_P00029993	mir|dme-miR-961-3p|mir|MIMAT0020856	dme-miR-961-3p	MIMAT0020856	unmapped	CGCTCGGGTTTTCCCGAGCGGCTTTTGATTGCCAGAAAATTTTTTTTTT
A_38_P00029994	A_38_P00029994	mir|dme-miR-100-3p|mir|MIMAT0020818	dme-miR-100-3p	MIMAT0020818	unmapped	CGCTCGGGTTTTCCCGAGCGGGACTCCCATAATGCCTTTTTTTTTT
A_38_P00029995	A_38_P00029995	mir|dme-miR-100-3p|mir|MIMAT0020818	dme-miR-100-3p	MIMAT0020818	unmapped	CGCTCGGGTTTTCCCGAGCGGGACTCCCATAATGCCGTATTTTTTTT
A_38_P00029996	A_38_P00029996	mir|dme-miR-929-5p|mir|MIMAT0020892	dme-miR-929-5p	MIMAT0020892	unmapped	CGCTCGGGTTTTCCCGAGCGGGACTCCCTACTAGAGTCTTTTTTTTTT
A_38_P00029997	A_38_P00029997	mir|dme-miR-929-5p|mir|MIMAT0020892	dme-miR-929-5p	MIMAT0020892	unmapped	CGCTCGGGTTTTCCCGAGCGGGACTCCCTACTAGAGTCATATTTTTTTT
A_38_P00029998	A_38_P00029998	mir|dme-miR-4954-3p|mir|MIMAT0020170	dme-miR-4954-3p	MIMAT0020170	unmapped	CGCTCGGGTTTTCCCGAGCGGGAGCACTCGAACCTTTTTTTTTT
A_38_P00029999	A_38_P00029999	mir|dme-miR-4954-3p|mir|MIMAT0020170	dme-miR-4954-3p	MIMAT0020170	unmapped	CGCTCGGGTTTTCCCGAGCGGGAGCACTCGAACCGTTTTTTTTTT
A_38_P00030000	A_38_P00030000	mir|dme-miR-9c-3p|mir|MIMAT0020828	dme-miR-9c-3p	MIMAT0020828	unmapped	CGCTCGGGTTTTCCCGAGCGGGAGCTTTGGTATAAAAGCAATTTTTTTT
A_38_P00030001	A_38_P00030001	mir|dme-miR-9c-3p|mir|MIMAT0020828	dme-miR-9c-3p	MIMAT0020828	unmapped	CGCTCGGGTTTTCCCGAGCGGGAGCTTTGGTATAAAAGCTAATTTTTTTT
A_38_P00030002	A_38_P00030002	mir|dme-miR-4948-3p|mir|MIMAT0020159	dme-miR-4948-3p	MIMAT0020159	unmapped	CGCTCGGGTTTTCCCGAGCGGGAGGGCAAGCGCTTTTTTTTTT
A_38_P00030003	A_38_P00030003	mir|dme-miR-4948-3p|mir|MIMAT0020159	dme-miR-4948-3p	MIMAT0020159	unmapped	CGCTCGGGTTTTCCCGAGCGGGAGGGCAAGCGCATTTTTTTTTT
A_38_P00030004	A_38_P00030004	mir|dme-miR-4961-5p|mir|MIMAT0020181	dme-miR-4961-5p	MIMAT0020181	unmapped	CGCTCGGGTTTTCCCGAGCGGGATACATACATACACATAGAGTTTTTTTTTT
A_38_P00030005	A_38_P00030005	mir|dme-miR-4961-5p|mir|MIMAT0020181	dme-miR-4961-5p	MIMAT0020181	unmapped	CGCTCGGGTTTTCCCGAGCGGGATACATACATACACATAGAGATTTTTTTTTT
A_38_P00030006	A_38_P00030006	mir|dme-miR-977-5p|mir|MIMAT0020874	dme-miR-977-5p	MIMAT0020874	unmapped	CGCTCGGGTTTTCCCGAGCGGGATGTGATATTCGAGTTATTATTTTTTTT
A_38_P00030007	A_38_P00030007	mir|dme-miR-977-5p|mir|MIMAT0020874	dme-miR-977-5p	MIMAT0020874	unmapped	CGCTCGGGTTTTCCCGAGCGGGATGTGATATTCGAGTTATCATTTTTTTTT
A_38_P00030008	A_38_P00030008	mir|dme-miR-4963-5p|mir|MIMAT0020185	dme-miR-4963-5p	MIMAT0020185	unmapped	CGCTCGGGTTTTCCCGAGCGGGATTCTCTGCGTTATGATTTTTTTTTT
A_38_P00030009	A_38_P00030009	mir|dme-miR-4963-5p|mir|MIMAT0020185	dme-miR-4963-5p	MIMAT0020185	unmapped	CGCTCGGGTTTTCCCGAGCGGGATTCTCTGCGTTATGAATTTTTTTTTT
A_38_P00030010	A_38_P00030010	mir|dme-miR-4986-5p|mir|MIMAT0020223	dme-miR-4986-5p	MIMAT0020223	unmapped	CGCTCGGGTTTTCCCGAGCGGGCCATGCAGAATGGTTTTTTTTTT
A_38_P00030011	A_38_P00030011	mir|dme-miR-4986-5p|mir|MIMAT0020223	dme-miR-4986-5p	MIMAT0020223	unmapped	CGCTCGGGTTTTCCCGAGCGGGCCATGCAGAATGGGTTTTTTTTTT
A_38_P00030012	A_38_P00030012	mir|dme-miR-976-5p|mir|MIMAT0020873	dme-miR-976-5p	MIMAT0020873	unmapped	CGCTCGGGTTTTCCCGAGCGGGCCGCGGCACTTTTTTTTTTT
A_38_P00030013	A_38_P00030013	mir|dme-miR-976-5p|mir|MIMAT0020873	dme-miR-976-5p	MIMAT0020873	unmapped	CGCTCGGGTTTTCCCGAGCGGGCCGCGGCACTGTTTTTTTTTT
A_38_P00030014	A_38_P00030014	mir|dme-miR-12-3p|mir|MIMAT0020794	dme-miR-12-3p	MIMAT0020794	unmapped	CGCTCGGGTTTTCCCGAGCGGGCGTAGTATGACATAAGTTTTTTTTTTT
A_38_P00030015	A_38_P00030015	mir|dme-miR-12-3p|mir|MIMAT0020794	dme-miR-12-3p	MIMAT0020794	unmapped	CGCTCGGGTTTTCCCGAGCGGGCGTAGTATGACATAAGTATATTTTTTTT
A_38_P00030016	A_38_P00030016	mir|dme-miR-12-3p|mir|MIMAT0020794	dme-miR-12-3p	MIMAT0020794	unmapped	CGCTCGGGTTTTCCCGAGCGGGCGTAGTATGACATAAGTACATTTTTTTTT
A_38_P00030017	A_38_P00030017	mir|dme-miR-4919-5p|mir|MIMAT0020513	dme-miR-4919-5p	MIMAT0020513	unmapped	CGCTCGGGTTTTCCCGAGCGGGCTAATCCCCTAGAGATATTTTTTTT
A_38_P00030018	A_38_P00030018	mir|dme-miR-4919-5p|mir|MIMAT0020513	dme-miR-4919-5p	MIMAT0020513	unmapped	CGCTCGGGTTTTCCCGAGCGGGCTAATCCCCTAGAGACATTTTTTTTT
A_38_P00030019	A_38_P00030019	mir|dme-miR-980-5p|mir|MIMAT0020877	dme-miR-980-5p	MIMAT0020877	unmapped	CGCTCGGGTTTTCCCGAGCGGGCTAGCCAGGCCATTTTTTTTTT
A_38_P00030020	A_38_P00030020	mir|dme-miR-980-5p|mir|MIMAT0020877	dme-miR-980-5p	MIMAT0020877	unmapped	CGCTCGGGTTTTCCCGAGCGGGCTAGCCAGGCCAATATTTTTTTT
A_38_P00030021	A_38_P00030021	mir|dme-miR-4961-3p|mir|MIMAT0020182	dme-miR-4961-3p	MIMAT0020182	unmapped	CGCTCGGGTTTTCCCGAGCGGGCTCTCTGATATGGATATATTTTTTTTTT
A_38_P00030022	A_38_P00030022	mir|dme-miR-4961-3p|mir|MIMAT0020182	dme-miR-4961-3p	MIMAT0020182	unmapped	CGCTCGGGTTTTCCCGAGCGGGCTCTCTGATATGGATATACTATTTTTTTT
A_38_P00030023	A_38_P00030023	mir|dme-miR-966-3p|mir|MIMAT0020862	dme-miR-966-3p	MIMAT0020862	unmapped	CGCTCGGGTTTTCCCGAGCGGGCTGGGGGTTATCATTTTTTTTTT
A_38_P00030024	A_38_P00030024	mir|dme-miR-966-3p|mir|MIMAT0020862	dme-miR-966-3p	MIMAT0020862	unmapped	CGCTCGGGTTTTCCCGAGCGGGCTGGGGGTTATCAATATTTTTTTT
A_38_P00030025	A_38_P00030025	mir|dme-miR-966-3p|mir|MIMAT0020862	dme-miR-966-3p	MIMAT0020862	unmapped	CGCTCGGGTTTTCCCGAGCGGGCTGGGGGTTATCAACATTTTTTTTT
A_38_P00030026	A_38_P00030026	mir|dme-miR-4987-3p|mir|MIMAT0020226	dme-miR-4987-3p	MIMAT0020226	unmapped	CGCTCGGGTTTTCCCGAGCGGGCTTGCAATGGCGTTTTTTTTTT
A_38_P00030027	A_38_P00030027	mir|dme-miR-4987-3p|mir|MIMAT0020226	dme-miR-4987-3p	MIMAT0020226	unmapped	CGCTCGGGTTTTCCCGAGCGGGCTTGCAATGGCGATTTTTTTTTT
A_38_P00030028	A_38_P00030028	mir|dme-miR-971-5p|mir|MIMAT0020868	dme-miR-971-5p	MIMAT0020868	unmapped	CGCTCGGGTTTTCCCGAGCGGGCTTTGATGATTACAATTTATTTTTTTTTT
A_38_P00030029	A_38_P00030029	mir|dme-miR-971-5p|mir|MIMAT0020868	dme-miR-971-5p	MIMAT0020868	unmapped	CGCTCGGGTTTTCCCGAGCGGGCTTTGATGATTACAATTTACTTTTTTTTTT
A_38_P00030030	A_38_P00030030	mir|dme-miR-4986-3p|mir|MIMAT0020224	dme-miR-4986-3p	MIMAT0020224	unmapped	CGCTCGGGTTTTCCCGAGCGGGGAAGTTCCGCCAATTTTTTTTT
A_38_P00030031	A_38_P00030031	mir|dme-miR-4986-3p|mir|MIMAT0020224	dme-miR-4986-3p	MIMAT0020224	unmapped	CGCTCGGGTTTTCCCGAGCGGGGAAGTTCCGCCATTTTTTTTTTT
A_38_P00030032	A_38_P00030032	mir|dme-miR-4986-3p|mir|MIMAT0020224	dme-miR-4986-3p	MIMAT0020224	unmapped	CGCTCGGGTTTTCCCGAGCGGGGAAGTTCCGCCATCTTTTTTTTTT
A_38_P00030033	A_38_P00030033	mir|dme-miR-34-3p|mir|MIMAT0020812	dme-miR-34-3p	MIMAT0020812	unmapped	CGCTCGGGTTTTCCCGAGCGGGGCGGCAGTGAAGTATTTTTTTT
A_38_P00030034	A_38_P00030034	mir|dme-miR-34-3p|mir|MIMAT0020812	dme-miR-34-3p	MIMAT0020812	unmapped	CGCTCGGGTTTTCCCGAGCGGGGCGGCAGTGAAGAATTTTTTTTT
A_38_P00030035	A_38_P00030035	mir|dme-miR-4940-3p|mir|MIMAT0020147	dme-miR-4940-3p	MIMAT0020147	unmapped	CGCTCGGGTTTTCCCGAGCGGGGCGGCCGAAATTTTTTTTTT
A_38_P00030036	A_38_P00030036	mir|dme-miR-4940-3p|mir|MIMAT0020147	dme-miR-4940-3p	MIMAT0020147	unmapped	CGCTCGGGTTTTCCCGAGCGGGGCGGCCGAAACTTTTTTTTTT
A_38_P00030037	A_38_P00030037	mir|dme-miR-284-5p|mir|MIMAT0020811	dme-miR-284-5p	MIMAT0020811	unmapped	CGCTCGGGTTTTCCCGAGCGGGGCTACACAGTCAACAATTTTTTTT
A_38_P00030038	A_38_P00030038	mir|dme-miR-284-5p|mir|MIMAT0020811	dme-miR-284-5p	MIMAT0020811	unmapped	CGCTCGGGTTTTCCCGAGCGGGGCTACACAGTCAACTATTTTTTTTT
A_38_P00030039	A_38_P00030039	mir|dme-miR-314-5p|mir|MIMAT0020840	dme-miR-314-5p	MIMAT0020840	unmapped	CGCTCGGGTTTTCCCGAGCGGGGTAAGTTCGAAGCCTTTTTTTTTT
A_38_P00030040	A_38_P00030040	mir|dme-miR-314-5p|mir|MIMAT0020840	dme-miR-314-5p	MIMAT0020840	unmapped	CGCTCGGGTTTTCCCGAGCGGGGTAAGTTCGAAGCCATTTTTTTTTT
A_38_P00030041	A_38_P00030041	mir|dme-miR-278-5p|mir|MIMAT0020805	dme-miR-278-5p	MIMAT0020805	unmapped	CGCTCGGGTTTTCCCGAGCGGGGTCGTTGTGAACCTATTTTTTTT
A_38_P00030042	A_38_P00030042	mir|dme-miR-278-5p|mir|MIMAT0020805	dme-miR-278-5p	MIMAT0020805	unmapped	CGCTCGGGTTTTCCCGAGCGGGGTCGTTGTGAACCAATTTTTTTTT
A_38_P00030043	A_38_P00030043	mir|dme-miR-4965-3p|mir|MIMAT0020189	dme-miR-4965-3p	MIMAT0020189	unmapped	CGCTCGGGTTTTCCCGAGCGGGGTGAGTGAGTGTGTTTTTTTTTTT
A_38_P00030044	A_38_P00030044	mir|dme-miR-4965-3p|mir|MIMAT0020189	dme-miR-4965-3p	MIMAT0020189	unmapped	CGCTCGGGTTTTCCCGAGCGGGGTGAGTGAGTGTGTGTATTTTTTTT
A_38_P00030045	A_38_P00030045	mir|dme-miR-4969-3p|mir|MIMAT0020196	dme-miR-4969-3p	MIMAT0020196	unmapped	CGCTCGGGTTTTCCCGAGCGGGGTGGTATTGATTGACATTTTTTTTTT
A_38_P00030046	A_38_P00030046	mir|dme-miR-4969-3p|mir|MIMAT0020196	dme-miR-4969-3p	MIMAT0020196	unmapped	CGCTCGGGTTTTCCCGAGCGGGGTGGTATTGATTGACAGTATTTTTTTT
A_38_P00030047	A_38_P00030047	mir|dme-miR-315-3p|mir|MIMAT0020841	dme-miR-315-3p	MIMAT0020841	unmapped	CGCTCGGGTTTTCCCGAGCGGGGTTTCAATTATTGCTCTTTTTTTTTT
A_38_P00030048	A_38_P00030048	mir|dme-miR-315-3p|mir|MIMAT0020841	dme-miR-315-3p	MIMAT0020841	unmapped	CGCTCGGGTTTTCCCGAGCGGGGTTTCAATTATTGCTCGTTTTTTTTTT
A_38_P00030049	A_38_P00030049	mir|dme-miR-9b-3p|mir|MIMAT0020829	dme-miR-9b-3p	MIMAT0020829	unmapped	CGCTCGGGTTTTCCCGAGCGGGGTTTTTGGTAATAAAGCATTTTTTTTT
A_38_P00030050	A_38_P00030050	mir|dme-miR-9b-3p|mir|MIMAT0020829	dme-miR-9b-3p	MIMAT0020829	unmapped	CGCTCGGGTTTTCCCGAGCGGGGTTTTTGGTAATAAAGCTTATTTTTTTT
A_38_P00030051	A_38_P00030051	mir|dme-miR-954-3p|mir|MIMAT0020846	dme-miR-954-3p	MIMAT0020846	unmapped	CGCTCGGGTTTTCCCGAGCGGGTAAGGGATGTTGCATTATTTTTTTT
A_38_P00030052	A_38_P00030052	mir|dme-miR-954-3p|mir|MIMAT0020846	dme-miR-954-3p	MIMAT0020846	unmapped	CGCTCGGGTTTTCCCGAGCGGGTAAGGGATGTTGCATGATTTTTTTTT
A_38_P00030053	A_38_P00030053	mir|dme-miR-4967-5p|mir|MIMAT0020192	dme-miR-4967-5p	MIMAT0020192	unmapped	CGCTCGGGTTTTCCCGAGCGGGTTAACAGAGAGAAAATGTTTTTTTTTT
A_38_P00030054	A_38_P00030054	mir|dme-miR-4967-5p|mir|MIMAT0020192	dme-miR-4967-5p	MIMAT0020192	unmapped	CGCTCGGGTTTTCCCGAGCGGGTTAACAGAGAGAAAATGCTTTTTTTTTT
A_38_P00030055	A_38_P00030055	mir|dme-miR-137-5p|mir|MIMAT0020888	dme-miR-137-5p	MIMAT0020888	unmapped	CGCTCGGGTTTTCCCGAGCGGGTTATAGCTACGAGCATATTTTTTTTTT
A_38_P00030056	A_38_P00030056	mir|dme-miR-137-5p|mir|MIMAT0020888	dme-miR-137-5p	MIMAT0020888	unmapped	CGCTCGGGTTTTCCCGAGCGGGTTATAGCTACGAGCATACTTTTTTTTTT
A_38_P00030057	A_38_P00030057	mir|dme-miR-87-5p|mir|MIMAT0020821	dme-miR-87-5p	MIMAT0020821	unmapped	CGCTCGGGTTTTCCCGAGCGGGTTCAGCAAGATACAGTTTTTTTTTT
A_38_P00030058	A_38_P00030058	mir|dme-miR-87-5p|mir|MIMAT0020821	dme-miR-87-5p	MIMAT0020821	unmapped	CGCTCGGGTTTTCCCGAGCGGGTTCAGCAAGATACAGGTTTTTTTTTT
A_38_P00030059	A_38_P00030059	mir|dme-miR-927-3p|mir|MIMAT0020882	dme-miR-927-3p	MIMAT0020882	unmapped	CGCTCGGGTTTTCCCGAGCGGGTTTCAGAATCCAAACTTTTTTTTTT
A_38_P00030060	A_38_P00030060	mir|dme-miR-927-3p|mir|MIMAT0020882	dme-miR-927-3p	MIMAT0020882	unmapped	CGCTCGGGTTTTCCCGAGCGGGTTTCAGAATCCAAACGTATTTTTTTT
A_38_P00030061	A_38_P00030061	mir|dme-miR-263b-3p|mir|MIMAT0020822	dme-miR-263b-3p	MIMAT0020822	unmapped	CGCTCGGGTTTTCCCGAGCGGGTTTTGGCACCCGTTTTTTTTTT
A_38_P00030062	A_38_P00030062	mir|dme-miR-263b-3p|mir|MIMAT0020822	dme-miR-263b-3p	MIMAT0020822	unmapped	CGCTCGGGTTTTCCCGAGCGGGTTTTGGCACCCGCTTTTTTTTTT
A_38_P00030063	A_38_P00030063	mir|dme-miR-960-3p|mir|MIMAT0020855	dme-miR-960-3p	MIMAT0020855	unmapped	CGCTCGGGTTTTCCCGAGCGGTAAAAGTGTCCCAGACTTTTTTTTTT
A_38_P00030064	A_38_P00030064	mir|dme-miR-960-3p|mir|MIMAT0020855	dme-miR-960-3p	MIMAT0020855	unmapped	CGCTCGGGTTTTCCCGAGCGGTAAAAGTGTCCCAGACCTATTTTTTTT
A_38_P00030065	A_38_P00030065	mir|dme-miR-9a-3p|mir|MIMAT0020792	dme-miR-9a-3p	MIMAT0020792	unmapped	CGCTCGGGTTTTCCCGAGCGGTAACTTCGGTAAGCTAGTATTTTTTTT
A_38_P00030066	A_38_P00030066	mir|dme-miR-9a-3p|mir|MIMAT0020792	dme-miR-9a-3p	MIMAT0020792	unmapped	CGCTCGGGTTTTCCCGAGCGGTAACTTCGGTAAGCTAGCAATTTTTTTT
A_38_P00030067	A_38_P00030067	mir|dme-miR-7-3p|mir|MIMAT0020790	dme-miR-7-3p	MIMAT0020790	unmapped	CGCTCGGGTTTTCCCGAGCGGTAAGAAGACAAGGGATTTTATTTTTTTT
A_38_P00030068	A_38_P00030068	mir|dme-miR-7-3p|mir|MIMAT0020790	dme-miR-7-3p	MIMAT0020790	unmapped	CGCTCGGGTTTTCCCGAGCGGTAAGAAGACAAGGGATTTAAATTTTTTTT
A_38_P00030069	A_38_P00030069	mir|dme-miR-7-3p|mir|MIMAT0020790	dme-miR-7-3p	MIMAT0020790	unmapped	CGCTCGGGTTTTCCCGAGCGGTAAGAAGACAAGGGATTTATATTTTTTTTT
A_38_P00030070	A_38_P00030070	mir|dme-miR-7-3p|mir|MIMAT0020790	dme-miR-7-3p	MIMAT0020790	unmapped	CGCTCGGGTTTTCCCGAGCGGTAAGAAGACAAGGGATTTATTTTTTTTTTTT
A_38_P00030071	A_38_P00030071	mir|dme-miR-274-3p|mir|MIMAT0020800	dme-miR-274-3p	MIMAT0020800	unmapped	CGCTCGGGTTTTCCCGAGCGGTAATTTGTGATCGCAAAATTTTTTTTTT
A_38_P00030072	A_38_P00030072	mir|dme-miR-274-3p|mir|MIMAT0020800	dme-miR-274-3p	MIMAT0020800	unmapped	CGCTCGGGTTTTCCCGAGCGGTAATTTGTGATCGCAAAAATTTTTTTTTT
A_38_P00030073	A_38_P00030073	mir|dme-miR-274-3p|mir|MIMAT0020800	dme-miR-274-3p	MIMAT0020800	unmapped	CGCTCGGGTTTTCCCGAGCGGTAATTTGTGATCGCAAAAACTTTTTTTTTT
A_38_P00030074	A_38_P00030074	mir|dme-miR-310-5p|mir|MIMAT0020836	dme-miR-310-5p	MIMAT0020836	unmapped	CGCTCGGGTTTTCCCGAGCGGTACACTGACACACGACTTTTTTTTTT
A_38_P00030075	A_38_P00030075	mir|dme-miR-310-5p|mir|MIMAT0020836	dme-miR-310-5p	MIMAT0020836	unmapped	CGCTCGGGTTTTCCCGAGCGGTACACTGACACACGACCTTTTTTTTTT
A_38_P00030076	A_38_P00030076	mir|dme-miR-6-1-5p|mir|MIMAT0020787	dme-miR-6-1-5p	MIMAT0020787	unmapped	CGCTCGGGTTTTCCCGAGCGGTACAGCACAGCAACTATATTTTTTTTT
A_38_P00030077	A_38_P00030077	mir|dme-miR-6-1-5p|mir|MIMAT0020787	dme-miR-6-1-5p	MIMAT0020787	unmapped	CGCTCGGGTTTTCCCGAGCGGTACAGCACAGCAACTATTTTTTTTTTTT
A_38_P00030078	A_38_P00030078	mir|dme-miR-6-1-5p|mir|MIMAT0020787	dme-miR-6-1-5p	MIMAT0020787	unmapped	CGCTCGGGTTTTCCCGAGCGGTACAGCACAGCAACTATTCTTTTTTTTTT
A_38_P00030079	A_38_P00030079	mir|dme-miR-6-3-5p|mir|MIMAT0020789	dme-miR-6-3-5p	MIMAT0020789	unmapped	CGCTCGGGTTTTCCCGAGCGGTACATCATCAGCAACCTATTTTTTTT
A_38_P00030080	A_38_P00030080	mir|dme-miR-6-3-5p|mir|MIMAT0020789	dme-miR-6-3-5p	MIMAT0020789	unmapped	CGCTCGGGTTTTCCCGAGCGGTACATCATCAGCAACCGAATTTTTTTT
A_38_P00030081	A_38_P00030081	mir|dme-miR-970-5p|mir|MIMAT0020867	dme-miR-970-5p	MIMAT0020867	unmapped	CGCTCGGGTTTTCCCGAGCGGTACCAAATAAAACACCCTTTTTTTTTT
A_38_P00030082	A_38_P00030082	mir|dme-miR-970-5p|mir|MIMAT0020867	dme-miR-970-5p	MIMAT0020867	unmapped	CGCTCGGGTTTTCCCGAGCGGTACCAAATAAAACACCCGTATTTTTTTT
A_38_P00030083	A_38_P00030083	mir|dme-miR-316-3p|mir|MIMAT0020842	dme-miR-316-3p	MIMAT0020842	unmapped	CGCTCGGGTTTTCCCGAGCGGTACGCCTTTTTCCCTAATTTTTTTT
A_38_P00030084	A_38_P00030084	mir|dme-miR-316-3p|mir|MIMAT0020842	dme-miR-316-3p	MIMAT0020842	unmapped	CGCTCGGGTTTTCCCGAGCGGTACGCCTTTTTCCCTTATTTTTTTTT
A_38_P00030085	A_38_P00030085	mir|dme-miR-316-3p|mir|MIMAT0020842	dme-miR-316-3p	MIMAT0020842	unmapped	CGCTCGGGTTTTCCCGAGCGGTACGCCTTTTTCCCTTTTTTTTTTTTT
A_38_P00030086	A_38_P00030086	mir|dme-miR-263a-3p|mir|MIMAT0020799	dme-miR-263a-3p	MIMAT0020799	unmapped	CGCTCGGGTTTTCCCGAGCGGTAGATGCCACTAAGAGATTTTTTTTTTT
A_38_P00030087	A_38_P00030087	mir|dme-miR-263a-3p|mir|MIMAT0020799	dme-miR-263a-3p	MIMAT0020799	unmapped	CGCTCGGGTTTTCCCGAGCGGTAGATGCCACTAAGAGATCTTTTTTTTTT
A_38_P00030088	A_38_P00030088	mir|dme-miR-5-3p|mir|MIMAT0020786	dme-miR-5-3p	MIMAT0020786	unmapped	CGCTCGGGTTTTCCCGAGCGGTATAAAGGAAAATCACTGTGTATTTTTTTT
A_38_P00030089	A_38_P00030089	mir|dme-miR-5-3p|mir|MIMAT0020786	dme-miR-5-3p	MIMAT0020786	unmapped	CGCTCGGGTTTTCCCGAGCGGTATAAAGGAAAATCACTGTGAATTTTTTTTT
A_38_P00030090	A_38_P00030090	mir|dme-miR-6-2-5p|mir|MIMAT0020788	dme-miR-6-2-5p	MIMAT0020788	unmapped	CGCTCGGGTTTTCCCGAGCGGTATATCAGCAGCAGAAGTATTTTTTTTT
A_38_P00030091	A_38_P00030091	mir|dme-miR-6-2-5p|mir|MIMAT0020788	dme-miR-6-2-5p	MIMAT0020788	unmapped	CGCTCGGGTTTTCCCGAGCGGTATATCAGCAGCAGAAGTTTTTTTTTTTT
A_38_P00030092	A_38_P00030092	mir|dme-miR-2a-2-5p|mir|MIMAT0020781	dme-miR-2a-2-5p	MIMAT0020781	unmapped	CGCTCGGGTTTTCCCGAGCGGTATCACAACCACTTGATGTTTTTTTTTT
A_38_P00030093	A_38_P00030093	mir|dme-miR-2a-2-5p|mir|MIMAT0020781	dme-miR-2a-2-5p	MIMAT0020781	unmapped	CGCTCGGGTTTTCCCGAGCGGTATCACAACCACTTGATGATTTTTTTTTT
A_38_P00030094	A_38_P00030094	mir|dme-miR-1012-5p|mir|MIMAT0020906	dme-miR-1012-5p	MIMAT0020906	unmapped	CGCTCGGGTTTTCCCGAGCGGTATTAATCAAAGTTCTACCCTTTTTTTTTT
A_38_P00030095	A_38_P00030095	mir|dme-miR-1012-5p|mir|MIMAT0020906	dme-miR-1012-5p	MIMAT0020906	unmapped	CGCTCGGGTTTTCCCGAGCGGTATTAATCAAAGTTCTACCCATTTTTTTTTT
A_38_P00030096	A_38_P00030096	mir|dme-miR-1-5p|mir|MIMAT0020779	dme-miR-1-5p	MIMAT0020779	unmapped	CGCTCGGGTTTTCCCGAGCGGTATTGAATGCAAGGAAGCTATTTTTTTT
A_38_P00030097	A_38_P00030097	mir|dme-miR-1-5p|mir|MIMAT0020779	dme-miR-1-5p	MIMAT0020779	unmapped	CGCTCGGGTTTTCCCGAGCGGTATTGAATGCAAGGAAGCAATTTTTTTTT
A_38_P00030098	A_38_P00030098	mir|dme-miR-4977-5p|mir|MIMAT0020208	dme-miR-4977-5p	MIMAT0020208	unmapped	CGCTCGGGTTTTCCCGAGCGGTATTGCACGTCGCAATTTTTTTTTT
A_38_P00030099	A_38_P00030099	mir|dme-miR-4977-5p|mir|MIMAT0020208	dme-miR-4977-5p	MIMAT0020208	unmapped	CGCTCGGGTTTTCCCGAGCGGTATTGCACGTCGCAAATTTTTTTTTT
A_38_P00030100	A_38_P00030100	mir|dme-miR-4962-5p|mir|MIMAT0020183	dme-miR-4962-5p	MIMAT0020183	unmapped	CGCTCGGGTTTTCCCGAGCGGTCAATGTAAACAGAGAGAGTTTTTTTTTT
A_38_P00030101	A_38_P00030101	mir|dme-miR-4962-5p|mir|MIMAT0020183	dme-miR-4962-5p	MIMAT0020183	unmapped	CGCTCGGGTTTTCCCGAGCGGTCAATGTAAACAGAGAGAGGTTTTTTTTTT
A_38_P00030102	A_38_P00030102	mir|dme-miR-1016-5p|mir|MIMAT0020908	dme-miR-1016-5p	MIMAT0020908	unmapped	CGCTCGGGTTTTCCCGAGCGGTCACATCCTCTCTATACTATTTTTTTTT
A_38_P00030103	A_38_P00030103	mir|dme-miR-1016-5p|mir|MIMAT0020908	dme-miR-1016-5p	MIMAT0020908	unmapped	CGCTCGGGTTTTCCCGAGCGGTCACATCCTCTCTATACTTTTTTTTTTTT
A_38_P00030104	A_38_P00030104	mir|dme-miR-1016-5p|mir|MIMAT0020908	dme-miR-1016-5p	MIMAT0020908	unmapped	CGCTCGGGTTTTCCCGAGCGGTCACATCCTCTCTATACTTATTTTTTTTTT
A_38_P00030105	A_38_P00030105	mir|dme-miR-4-5p|mir|MIMAT0020785	dme-miR-4-5p	MIMAT0020785	unmapped	CGCTCGGGTTTTCCCGAGCGGTCACCTAAGGCTGGATTTTTTTTTT
A_38_P00030106	A_38_P00030106	mir|dme-miR-4-5p|mir|MIMAT0020785	dme-miR-4-5p	MIMAT0020785	unmapped	CGCTCGGGTTTTCCCGAGCGGTCACCTAAGGCTGGACTTTTTTTTTT
A_38_P00030107	A_38_P00030107	mir|dme-miR-79-5p|mir|MIMAT0020814	dme-miR-79-5p	MIMAT0020814	unmapped	CGCTCGGGTTTTCCCGAGCGGTCATACAGCTAAAGCGTTTTTTTTTT
A_38_P00030108	A_38_P00030108	mir|dme-miR-79-5p|mir|MIMAT0020814	dme-miR-79-5p	MIMAT0020814	unmapped	CGCTCGGGTTTTCCCGAGCGGTCATACAGCTAAAGCGCTTTTTTTTTT
A_38_P00030109	A_38_P00030109	mir|dme-miR-4950-5p|mir|MIMAT0020162	dme-miR-4950-5p	MIMAT0020162	unmapped	CGCTCGGGTTTTCCCGAGCGGTCATGATGAATGGTTGGTTTTTTTTTT
A_38_P00030110	A_38_P00030110	mir|dme-miR-4950-5p|mir|MIMAT0020162	dme-miR-4950-5p	MIMAT0020162	unmapped	CGCTCGGGTTTTCCCGAGCGGTCATGATGAATGGTTGGCTATTTTTTTT
A_38_P00030111	A_38_P00030111	mir|dme-miR-4969-5p|mir|MIMAT0020195	dme-miR-4969-5p	MIMAT0020195	unmapped	CGCTCGGGTTTTCCCGAGCGGTCCCACTCATCATTCATATTTTTTTT
A_38_P00030112	A_38_P00030112	mir|dme-miR-4969-5p|mir|MIMAT0020195	dme-miR-4969-5p	MIMAT0020195	unmapped	CGCTCGGGTTTTCCCGAGCGGTCCCACTCATCATTCAAAATTTTTTTT
A_38_P00030113	A_38_P00030113	mir|dme-miR-4969-5p|mir|MIMAT0020195	dme-miR-4969-5p	MIMAT0020195	unmapped	CGCTCGGGTTTTCCCGAGCGGTCCCACTCATCATTCAATAATTTTTTTT
A_38_P00030114	A_38_P00030114	mir|dme-miR-4971-5p|mir|MIMAT0020198	dme-miR-4971-5p	MIMAT0020198	unmapped	CGCTCGGGTTTTCCCGAGCGGTCCGCCACTGACATTTTTTTTTT
A_38_P00030115	A_38_P00030115	mir|dme-miR-4971-5p|mir|MIMAT0020198	dme-miR-4971-5p	MIMAT0020198	unmapped	CGCTCGGGTTTTCCCGAGCGGTCCGCCACTGACAATTTTTTTTTT
A_38_P00030116	A_38_P00030116	mir|dme-miR-4971-5p|mir|MIMAT0020198	dme-miR-4971-5p	MIMAT0020198	unmapped	CGCTCGGGTTTTCCCGAGCGGTCCGCCACTGACAAGTATTTTTTTT
A_38_P00030117	A_38_P00030117	mir|dme-miR-283-3p|mir|MIMAT0020810	dme-miR-283-3p	MIMAT0020810	unmapped	CGCTCGGGTTTTCCCGAGCGGTCGATACCAACTGAAATTTTTTTTTTTT
A_38_P00030118	A_38_P00030118	mir|dme-miR-283-3p|mir|MIMAT0020810	dme-miR-283-3p	MIMAT0020810	unmapped	CGCTCGGGTTTTCCCGAGCGGTCGATACCAACTGAAATTCTTTTTTTTTT
A_38_P00030119	A_38_P00030119	mir|dme-miR-4952-5p|mir|MIMAT0020166	dme-miR-4952-5p	MIMAT0020166	unmapped	CGCTCGGGTTTTCCCGAGCGGTCGCCGCGACATTTTTTTTTTT
A_38_P00030120	A_38_P00030120	mir|dme-miR-4952-5p|mir|MIMAT0020166	dme-miR-4952-5p	MIMAT0020166	unmapped	CGCTCGGGTTTTCCCGAGCGGTCGCCGCGACATCTTTTTTTTTT
A_38_P00030121	A_38_P00030121	mir|dme-miR-8-5p|mir|MIMAT0020791	dme-miR-8-5p	MIMAT0020791	unmapped	CGCTCGGGTTTTCCCGAGCGGTCTAATGCTGCCCGTATTTTTTTT
A_38_P00030122	A_38_P00030122	mir|dme-miR-8-5p|mir|MIMAT0020791	dme-miR-8-5p	MIMAT0020791	unmapped	CGCTCGGGTTTTCCCGAGCGGTCTAATGCTGCCCGGATTTTTTTTT
A_38_P00030123	A_38_P00030123	mir|dme-miR-955-3p|mir|MIMAT0020847	dme-miR-955-3p	MIMAT0020847	unmapped	CGCTCGGGTTTTCCCGAGCGGTCTACCGTTCAGAAATTGTTTTTTTTTT
A_38_P00030124	A_38_P00030124	mir|dme-miR-955-3p|mir|MIMAT0020847	dme-miR-955-3p	MIMAT0020847	unmapped	CGCTCGGGTTTTCCCGAGCGGTCTACCGTTCAGAAATTGATATTTTTTTT
A_38_P00030125	A_38_P00030125	mir|dme-miR-285-5p|mir|MIMAT0020817	dme-miR-285-5p	MIMAT0020817	unmapped	CGCTCGGGTTTTCCCGAGCGGTCTATGCACCAATCGAATTTTTTTTT
A_38_P00030126	A_38_P00030126	mir|dme-miR-285-5p|mir|MIMAT0020817	dme-miR-285-5p	MIMAT0020817	unmapped	CGCTCGGGTTTTCCCGAGCGGTCTATGCACCAATCGATTATTTTTTTT
A_38_P00030127	A_38_P00030127	mir|dme-miR-285-5p|mir|MIMAT0020817	dme-miR-285-5p	MIMAT0020817	unmapped	CGCTCGGGTTTTCCCGAGCGGTCTATGCACCAATCGATCATTTTTTTTT
A_38_P00030128	A_38_P00030128	mir|dme-miR-4962-3p|mir|MIMAT0020184	dme-miR-4962-3p	MIMAT0020184	unmapped	CGCTCGGGTTTTCCCGAGCGGTCTCCCTCACTCTCTATTTTTTTTTT
A_38_P00030129	A_38_P00030129	mir|dme-miR-4962-3p|mir|MIMAT0020184	dme-miR-4962-3p	MIMAT0020184	unmapped	CGCTCGGGTTTTCCCGAGCGGTCTCCCTCACTCTCTACTATTTTTTTT
A_38_P00030130	A_38_P00030130	mir|dme-miR-4955-5p|mir|MIMAT0020171	dme-miR-4955-5p	MIMAT0020171	unmapped	CGCTCGGGTTTTCCCGAGCGGTCTGGGGATTTTTTTCTTTTTTTTTTT
A_38_P00030131	A_38_P00030131	mir|dme-miR-4955-5p|mir|MIMAT0020171	dme-miR-4955-5p	MIMAT0020171	unmapped	CGCTCGGGTTTTCCCGAGCGGTCTGGGGATTTTTTTCTCTTTTTTTTTT
A_38_P00030132	A_38_P00030132	mir|dme-miR-4943-3p|mir|MIMAT0020152	dme-miR-4943-3p	MIMAT0020152	unmapped	CGCTCGGGTTTTCCCGAGCGGTCTTTCATTTAGCACTGTTATTTTTTTT
A_38_P00030133	A_38_P00030133	mir|dme-miR-4943-3p|mir|MIMAT0020152	dme-miR-4943-3p	MIMAT0020152	unmapped	CGCTCGGGTTTTCCCGAGCGGTCTTTCATTTAGCACTGTGAATTTTTTTT
A_38_P00030134	A_38_P00030134	mir|dme-miR-4943-5p|mir|MIMAT0020151	dme-miR-4943-5p	MIMAT0020151	unmapped	CGCTCGGGTTTTCCCGAGCGGTGAAAACACAGAGAAAATAATTTTTTTTTT
A_38_P00030135	A_38_P00030135	mir|dme-miR-4943-5p|mir|MIMAT0020151	dme-miR-4943-5p	MIMAT0020151	unmapped	CGCTCGGGTTTTCCCGAGCGGTGAAAACACAGAGAAAATAAATTTTTTTTTT
A_38_P00030136	A_38_P00030136	mir|dme-miR-962-3p|mir|MIMAT0020857	dme-miR-962-3p	MIMAT0020857	unmapped	CGCTCGGGTTTTCCCGAGCGGTGAAAGGTAATGAAACTGATTTTTTTTTT
A_38_P00030137	A_38_P00030137	mir|dme-miR-962-3p|mir|MIMAT0020857	dme-miR-962-3p	MIMAT0020857	unmapped	CGCTCGGGTTTTCCCGAGCGGTGAAAGGTAATGAAACTGAATATTTTTTTT
A_38_P00030138	A_38_P00030138	mir|dme-miR-4975-5p|mir|MIMAT0020205	dme-miR-4975-5p	MIMAT0020205	unmapped	CGCTCGGGTTTTCCCGAGCGGTGAACAGAAAACCCAAGATTTTTTTTT
A_38_P00030139	A_38_P00030139	mir|dme-miR-4975-5p|mir|MIMAT0020205	dme-miR-4975-5p	MIMAT0020205	unmapped	CGCTCGGGTTTTCCCGAGCGGTGAACAGAAAACCCAAGTTTTTTTTTTT
A_38_P00030140	A_38_P00030140	mir|dme-miR-987-3p|mir|MIMAT0020885	dme-miR-987-3p	MIMAT0020885	unmapped	CGCTCGGGTTTTCCCGAGCGGTGAAGTAAATGCCTGTTTTTTTTTTTT
A_38_P00030141	A_38_P00030141	mir|dme-miR-987-3p|mir|MIMAT0020885	dme-miR-987-3p	MIMAT0020885	unmapped	CGCTCGGGTTTTCCCGAGCGGTGAAGTAAATGCCTGTTGTATTTTTTTT
A_38_P00030142	A_38_P00030142	mir|dme-miR-4966-3p|mir|MIMAT0020191	dme-miR-4966-3p	MIMAT0020191	unmapped	CGCTCGGGTTTTCCCGAGCGGTGAGTGCTAAATATGTTGATTTTTTTTTT
A_38_P00030143	A_38_P00030143	mir|dme-miR-4966-3p|mir|MIMAT0020191	dme-miR-4966-3p	MIMAT0020191	unmapped	CGCTCGGGTTTTCCCGAGCGGTGAGTGCTAAATATGTTGAATTTTTTTTTT
A_38_P00030144	A_38_P00030144	mir|dme-miR-305-3p|mir|MIMAT0020827	dme-miR-305-3p	MIMAT0020827	unmapped	CGCTCGGGTTTTCCCGAGCGGTGAGTGTACTTCAACATGATTTTTTTTT
A_38_P00030145	A_38_P00030145	mir|dme-miR-305-3p|mir|MIMAT0020827	dme-miR-305-3p	MIMAT0020827	unmapped	CGCTCGGGTTTTCCCGAGCGGTGAGTGTACTTCAACATGTTTTTTTTTTT
A_38_P00030146	A_38_P00030146	mir|dme-miR-997-3p|mir|MIMAT0020897	dme-miR-997-3p	MIMAT0020897	unmapped	CGCTCGGGTTTTCCCGAGCGGTGATCAAAATCGAATGAGAATTTTTTTT
A_38_P00030147	A_38_P00030147	mir|dme-miR-997-3p|mir|MIMAT0020897	dme-miR-997-3p	MIMAT0020897	unmapped	CGCTCGGGTTTTCCCGAGCGGTGATCAAAATCGAATGAGTAATTTTTTTT
A_38_P00030148	A_38_P00030148	mir|dme-miR-4984-5p|mir|MIMAT0020219	dme-miR-4984-5p	MIMAT0020219	unmapped	CGCTCGGGTTTTCCCGAGCGGTGATTGGATCCGAGGTTTTTTTTTT
A_38_P00030149	A_38_P00030149	mir|dme-miR-4984-5p|mir|MIMAT0020219	dme-miR-4984-5p	MIMAT0020219	unmapped	CGCTCGGGTTTTCCCGAGCGGTGATTGGATCCGAGGCTATTTTTTTT
A_38_P00030150	A_38_P00030150	mir|dme-miR-975-3p|mir|MIMAT0020872	dme-miR-975-3p	MIMAT0020872	unmapped	CGCTCGGGTTTTCCCGAGCGGTGCAAACGACTCCCTTTTTTTTTT
A_38_P00030151	A_38_P00030151	mir|dme-miR-975-3p|mir|MIMAT0020872	dme-miR-975-3p	MIMAT0020872	unmapped	CGCTCGGGTTTTCCCGAGCGGTGCAAACGACTCCCATTTTTTTTTT
A_38_P00030152	A_38_P00030152	mir|dme-miR-277-5p|mir|MIMAT0020804	dme-miR-277-5p	MIMAT0020804	unmapped	CGCTCGGGTTTTCCCGAGCGGTGCAAATGCACTCCTTTTTTTTTTT
A_38_P00030153	A_38_P00030153	mir|dme-miR-277-5p|mir|MIMAT0020804	dme-miR-277-5p	MIMAT0020804	unmapped	CGCTCGGGTTTTCCCGAGCGGTGCAAATGCACTCCTGTTTTTTTTTT
A_38_P00030154	A_38_P00030154	mir|dme-miR-4946-5p|mir|MIMAT0020156	dme-miR-4946-5p	MIMAT0020156	unmapped	CGCTCGGGTTTTCCCGAGCGGTGCAATGAACAACTGAATTTTTTTTTT
A_38_P00030155	A_38_P00030155	mir|dme-miR-4946-5p|mir|MIMAT0020156	dme-miR-4946-5p	MIMAT0020156	unmapped	CGCTCGGGTTTTCCCGAGCGGTGCAATGAACAACTGAAATATTTTTTTT
A_38_P00030156	A_38_P00030156	mir|dme-miR-4955-3p|mir|MIMAT0020172	dme-miR-4955-3p	MIMAT0020172	unmapped	CGCTCGGGTTTTCCCGAGCGGTGCACGGAGAAAAAAATTTTTTTTTT
A_38_P00030157	A_38_P00030157	mir|dme-miR-4955-3p|mir|MIMAT0020172	dme-miR-4955-3p	MIMAT0020172	unmapped	CGCTCGGGTTTTCCCGAGCGGTGCACGGAGAAAAAAAGTTTTTTTTTT
A_38_P00030158	A_38_P00030158	mir|dme-miR-4964-3p|mir|MIMAT0020187	dme-miR-4964-3p	MIMAT0020187	unmapped	CGCTCGGGTTTTCCCGAGCGGTGCAGACAAATAAATACGTTTTTTTTTTT
A_38_P00030159	A_38_P00030159	mir|dme-miR-4964-3p|mir|MIMAT0020187	dme-miR-4964-3p	MIMAT0020187	unmapped	CGCTCGGGTTTTCCCGAGCGGTGCAGACAAATAAATACGTATTTTTTTTTT
A_38_P00030160	A_38_P00030160	mir|dme-miR-998-5p|mir|MIMAT0020898	dme-miR-998-5p	MIMAT0020898	unmapped	CGCTCGGGTTTTCCCGAGCGGTGCAGACCCACGATTTTTTTTTT
A_38_P00030161	A_38_P00030161	mir|dme-miR-998-5p|mir|MIMAT0020898	dme-miR-998-5p	MIMAT0020898	unmapped	CGCTCGGGTTTTCCCGAGCGGTGCAGACCCACGAGTTTTTTTTTT
A_38_P00030162	A_38_P00030162	mir|dme-miR-932-3p|mir|MIMAT0020860	dme-miR-932-3p	MIMAT0020860	unmapped	CGCTCGGGTTTTCCCGAGCGGTGCCAAATCCGCAGTTTTTTTTTT
A_38_P00030163	A_38_P00030163	mir|dme-miR-932-3p|mir|MIMAT0020860	dme-miR-932-3p	MIMAT0020860	unmapped	CGCTCGGGTTTTCCCGAGCGGTGCCAAATCCGCAGCTTTTTTTTTT
A_38_P00030164	A_38_P00030164	mir|dme-miR-4944-5p|mir|MIMAT0020153	dme-miR-4944-5p	MIMAT0020153	unmapped	CGCTCGGGTTTTCCCGAGCGGTGCTCAGCGGCAGTTTTTTTTTT
A_38_P00030165	A_38_P00030165	mir|dme-miR-4944-5p|mir|MIMAT0020153	dme-miR-4944-5p	MIMAT0020153	unmapped	CGCTCGGGTTTTCCCGAGCGGTGCTCAGCGGCAGATTTTTTTTTT
A_38_P00030166	A_38_P00030166	mir|dme-miR-4915-5p|mir|MIMAT0020508	dme-miR-4915-5p	MIMAT0020508	unmapped	CGCTCGGGTTTTCCCGAGCGGTGCTTAATTTACTACTTTTTCATTTTTTTTT
A_38_P00030167	A_38_P00030167	mir|dme-miR-4915-5p|mir|MIMAT0020508	dme-miR-4915-5p	MIMAT0020508	unmapped	CGCTCGGGTTTTCCCGAGCGGTGCTTAATTTACTACTTTTTCTTTTTTTTTTT
A_38_P00030168	A_38_P00030168	mir|dme-miR-4915-5p|mir|MIMAT0020508	dme-miR-4915-5p	MIMAT0020508	unmapped	CGCTCGGGTTTTCCCGAGCGGTGCTTAATTTACTACTTTTTCTCTTTTTTTTTT
A_38_P00030169	A_38_P00030169	mir|dme-miR-4951-3p|mir|MIMAT0020165	dme-miR-4951-3p	MIMAT0020165	unmapped	CGCTCGGGTTTTCCCGAGCGGTGGTGGGTGAGGTTAATTTTTTTT
A_38_P00030170	A_38_P00030170	mir|dme-miR-4951-3p|mir|MIMAT0020165	dme-miR-4951-3p	MIMAT0020165	unmapped	CGCTCGGGTTTTCCCGAGCGGTGGTGGGTGAGGTTTAATTTTTTTT
A_38_P00030171	A_38_P00030171	mir|dme-miR-4953-3p|mir|MIMAT0020168	dme-miR-4953-3p	MIMAT0020168	unmapped	CGCTCGGGTTTTCCCGAGCGGTGTCCATGACCTTCAAATTTTTTTTT
A_38_P00030172	A_38_P00030172	mir|dme-miR-4953-3p|mir|MIMAT0020168	dme-miR-4953-3p	MIMAT0020168	unmapped	CGCTCGGGTTTTCCCGAGCGGTGTCCATGACCTTCAATTTTTTTTTTT
A_38_P00030173	A_38_P00030173	mir|dme-miR-4953-3p|mir|MIMAT0020168	dme-miR-4953-3p	MIMAT0020168	unmapped	CGCTCGGGTTTTCCCGAGCGGTGTCCATGACCTTCAATATTTTTTTTTT
A_38_P00030174	A_38_P00030174	mir|dme-miR-279-5p|mir|MIMAT0020807	dme-miR-279-5p	MIMAT0020807	unmapped	CGCTCGGGTTTTCCCGAGCGGTGTGAAACACTGGACTTTTTTTTTT
A_38_P00030175	A_38_P00030175	mir|dme-miR-279-5p|mir|MIMAT0020807	dme-miR-279-5p	MIMAT0020807	unmapped	CGCTCGGGTTTTCCCGAGCGGTGTGAAACACTGGACCTTTTTTTTTT
A_38_P00030176	A_38_P00030176	mir|dme-miR-958-5p|mir|MIMAT0020852	dme-miR-958-5p	MIMAT0020852	unmapped	CGCTCGGGTTTTCCCGAGCGGTGTGATAAGCCTGCTATTTATTTTTTTT
A_38_P00030177	A_38_P00030177	mir|dme-miR-958-5p|mir|MIMAT0020852	dme-miR-958-5p	MIMAT0020852	unmapped	CGCTCGGGTTTTCCCGAGCGGTGTGATAAGCCTGCTATTCATTTTTTTTT
A_38_P00030178	A_38_P00030178	mir|dme-miR-4949-5p|mir|MIMAT0020160	dme-miR-4949-5p	MIMAT0020160	unmapped	CGCTCGGGTTTTCCCGAGCGGTGTGTGTGTGCGAGATTTTTTTTT
A_38_P00030179	A_38_P00030179	mir|dme-miR-4949-5p|mir|MIMAT0020160	dme-miR-4949-5p	MIMAT0020160	unmapped	CGCTCGGGTTTTCCCGAGCGGTGTGTGTGTGCGAGTTATTTTTTTT
A_38_P00030180	A_38_P00030180	mir|dme-miR-1000-3p|mir|MIMAT0020900	dme-miR-1000-3p	MIMAT0020900	unmapped	CGCTCGGGTTTTCCCGAGCGGTGTTAATGCCCCGACTTTTTTTTTT
A_38_P00030181	A_38_P00030181	mir|dme-miR-1000-3p|mir|MIMAT0020900	dme-miR-1000-3p	MIMAT0020900	unmapped	CGCTCGGGTTTTCCCGAGCGGTGTTAATGCCCCGACCTTTTTTTTTT
A_38_P00030182	A_38_P00030182	mir|dme-miR-4917-3p|mir|MIMAT0020511	dme-miR-4917-3p	MIMAT0020511	unmapped	CGCTCGGGTTTTCCCGAGCGGTGTTGAGCAGACGATATATTTTTTTT
A_38_P00030183	A_38_P00030183	mir|dme-miR-4917-3p|mir|MIMAT0020511	dme-miR-4917-3p	MIMAT0020511	unmapped	CGCTCGGGTTTTCCCGAGCGGTGTTGAGCAGACGATAGATTTTTTTTT
A_38_P00030184	A_38_P00030184	mir|dme-miR-1010-5p|mir|MIMAT0020905	dme-miR-1010-5p	MIMAT0020905	unmapped	CGCTCGGGTTTTCCCGAGCGGTGTTTCATCTACACCACAATTTTTTTT
A_38_P00030185	A_38_P00030185	mir|dme-miR-1010-5p|mir|MIMAT0020905	dme-miR-1010-5p	MIMAT0020905	unmapped	CGCTCGGGTTTTCCCGAGCGGTGTTTCATCTACACCACTATTTTTTTTT
A_38_P00030186	A_38_P00030186	mir|dme-miR-968-3p|mir|MIMAT0020865	dme-miR-968-3p	MIMAT0020865	unmapped	CGCTCGGGTTTTCCCGAGCGGTTAAAGTAGTACATCAAAAGGATTTTTTTTT
A_38_P00030187	A_38_P00030187	mir|dme-miR-968-3p|mir|MIMAT0020865	dme-miR-968-3p	MIMAT0020865	unmapped	CGCTCGGGTTTTCCCGAGCGGTTAAAGTAGTACATCAAAAGGTTTTTTTTTTT
A_38_P00030188	A_38_P00030188	mir|dme-miR-2490-3p|mir|MIMAT0020911	dme-miR-2490-3p	MIMAT0020911	unmapped	CGCTCGGGTTTTCCCGAGCGGTTAAGCGATAAAGTAAGAGTTTTTTTTTT
A_38_P00030189	A_38_P00030189	mir|dme-miR-2490-3p|mir|MIMAT0020911	dme-miR-2490-3p	MIMAT0020911	unmapped	CGCTCGGGTTTTCCCGAGCGGTTAAGCGATAAAGTAAGAGCTTTTTTTTTT
A_38_P00030190	A_38_P00030190	mir|dme-miR-4912-5p|mir|MIMAT0020505	dme-miR-4912-5p	MIMAT0020505	unmapped	CGCTCGGGTTTTCCCGAGCGGTTAATAAACATACGACTACTCTTTTTTTTTT
A_38_P00030191	A_38_P00030191	mir|dme-miR-4912-5p|mir|MIMAT0020505	dme-miR-4912-5p	MIMAT0020505	unmapped	CGCTCGGGTTTTCCCGAGCGGTTAATAAACATACGACTACTCATTTTTTTTTT
A_38_P00030192	A_38_P00030192	mir|dme-miR-986-3p|mir|MIMAT0020884	dme-miR-986-3p	MIMAT0020884	unmapped	CGCTCGGGTTTTCCCGAGCGGTTACTTGAATAGCCTCGTTTTTTTTTT
A_38_P00030193	A_38_P00030193	mir|dme-miR-986-3p|mir|MIMAT0020884	dme-miR-986-3p	MIMAT0020884	unmapped	CGCTCGGGTTTTCCCGAGCGGTTACTTGAATAGCCTCGCTTTTTTTTTT
A_38_P00030194	A_38_P00030194	mir|dme-miR-303-3p|mir|MIMAT0020824	dme-miR-303-3p	MIMAT0020824	unmapped	CGCTCGGGTTTTCCCGAGCGGTTAGGATTTTAGAGGAAACTTTTTTTTTTT
A_38_P00030195	A_38_P00030195	mir|dme-miR-303-3p|mir|MIMAT0020824	dme-miR-303-3p	MIMAT0020824	unmapped	CGCTCGGGTTTTCCCGAGCGGTTAGGATTTTAGAGGAAACTATTTTTTTTTT
A_38_P00030196	A_38_P00030196	mir|dme-miR-303-3p|mir|MIMAT0020824	dme-miR-303-3p	MIMAT0020824	unmapped	CGCTCGGGTTTTCCCGAGCGGTTAGGATTTTAGAGGAAACTAGTTTTTTTTTT
A_38_P00030197	A_38_P00030197	mir|dme-miR-982-3p|mir|MIMAT0020879	dme-miR-982-3p	MIMAT0020879	unmapped	CGCTCGGGTTTTCCCGAGCGGTTCAAGGATGAATATCAAGTTTTTTTTTTT
A_38_P00030198	A_38_P00030198	mir|dme-miR-982-3p|mir|MIMAT0020879	dme-miR-982-3p	MIMAT0020879	unmapped	CGCTCGGGTTTTCCCGAGCGGTTCAAGGATGAATATCAAGTATTTTTTTTTT
A_38_P00030199	A_38_P00030199	mir|dme-miR-4944-3p|mir|MIMAT0020154	dme-miR-4944-3p	MIMAT0020154	unmapped	CGCTCGGGTTTTCCCGAGCGGTTCTTCCTGCAGCTGATTTTTTTTT
A_38_P00030200	A_38_P00030200	mir|dme-miR-4944-3p|mir|MIMAT0020154	dme-miR-4944-3p	MIMAT0020154	unmapped	CGCTCGGGTTTTCCCGAGCGGTTCTTCCTGCAGCTGTTTTTTTTTTT
A_38_P00030201	A_38_P00030201	mir|dme-miR-4973-3p|mir|MIMAT0020202	dme-miR-4973-3p	MIMAT0020202	unmapped	CGCTCGGGTTTTCCCGAGCGGTTGCCGTGGTGTGTTTTTTTTTT
A_38_P00030202	A_38_P00030202	mir|dme-miR-4973-3p|mir|MIMAT0020202	dme-miR-4973-3p	MIMAT0020202	unmapped	CGCTCGGGTTTTCCCGAGCGGTTGCCGTGGTGTGATATTTTTTTT
A_38_P00030203	A_38_P00030203	mir|dme-miR-2491-3p|mir|MIMAT0020912	dme-miR-2491-3p	MIMAT0020912	unmapped	CGCTCGGGTTTTCCCGAGCGGTTGCTGCTGCTGTTGAATTTTTTTT
A_38_P00030204	A_38_P00030204	mir|dme-miR-2491-3p|mir|MIMAT0020912	dme-miR-2491-3p	MIMAT0020912	unmapped	CGCTCGGGTTTTCCCGAGCGGTTGCTGCTGCTGTTGTATTTTTTTTT
A_38_P00030205	A_38_P00030205	mir|dme-miR-1006-5p|mir|MIMAT0020903	dme-miR-1006-5p	MIMAT0020903	unmapped	CGCTCGGGTTTTCCCGAGCGGTTTACGCATTTCAATTTCATTTTTTTTTT
A_38_P00030206	A_38_P00030206	mir|dme-miR-1006-5p|mir|MIMAT0020903	dme-miR-1006-5p	MIMAT0020903	unmapped	CGCTCGGGTTTTCCCGAGCGGTTTACGCATTTCAATTTCAATTTTTTTTTT
A_38_P00030207	A_38_P00030207	mir|dme-miR-2489-5p|mir|MIMAT0020910	dme-miR-2489-5p	MIMAT0020910	unmapped	CGCTCGGGTTTTCCCGAGCGGTTTGTATAGCCATACTCACTATTTTTTTT
A_38_P00030208	A_38_P00030208	mir|dme-miR-2489-5p|mir|MIMAT0020910	dme-miR-2489-5p	MIMAT0020910	unmapped	CGCTCGGGTTTTCCCGAGCGGTTTGTATAGCCATACTCACGATTTTTTTTT
A_38_P00030209	A_38_P00030209	mir|dme-miR-4916-3p|mir|MIMAT0020509	dme-miR-4916-3p	MIMAT0020509	unmapped	CGCTCGGGTTTTCCCGAGCGGTTTTAGGAGTAATCAGAAATTATTTTTTTTT
A_38_P00030210	A_38_P00030210	mir|dme-miR-4916-3p|mir|MIMAT0020509	dme-miR-4916-3p	MIMAT0020509	unmapped	CGCTCGGGTTTTCCCGAGCGGTTTTAGGAGTAATCAGAAATTTTTTTTTTTTT
A_38_P00030491	A_38_P00030491	mir|ame-miR-3754|mir|MIMAT0018524	ame-miR-3754	MIMAT0018524	unmapped	CGCTCGGGTTTTCCCGAGCGGAAAGAATGAGTTTTTCACCTATTTTTTTT
A_38_P00030492	A_38_P00030492	mir|ame-miR-3754|mir|MIMAT0018524	ame-miR-3754	MIMAT0018524	unmapped	CGCTCGGGTTTTCCCGAGCGGAAAGAATGAGTTTTTCACCAATTTTTTTTT
A_38_P00030493	A_38_P00030493	mir|ame-miR-3784|mir|MIMAT0018563	ame-miR-3784	MIMAT0018563	unmapped	CGCTCGGGTTTTCCCGAGCGGAAATAGAAATTATTTTCCGCTTTTTTTTTT
A_38_P00030494	A_38_P00030494	mir|ame-miR-3784|mir|MIMAT0018563	ame-miR-3784	MIMAT0018563	unmapped	CGCTCGGGTTTTCCCGAGCGGAAATAGAAATTATTTTCCGCGTTTTTTTTTT
A_38_P00030495	A_38_P00030495	mir|ame-miR-3796|mir|MIMAT0018581	ame-miR-3796	MIMAT0018581	unmapped	CGCTCGGGTTTTCCCGAGCGGAAATCCTCTCCTCCCTATTTTTTTT
A_38_P00030496	A_38_P00030496	mir|ame-miR-3796|mir|MIMAT0018581	ame-miR-3796	MIMAT0018581	unmapped	CGCTCGGGTTTTCCCGAGCGGAAATCCTCTCCTCCCCAATTTTTTTT
A_38_P00030497	A_38_P00030497	mir|ame-miR-3795|mir|MIMAT0018580	ame-miR-3795	MIMAT0018580	unmapped	CGCTCGGGTTTTCCCGAGCGGAACACGTCCAACGTTATTTTTTTT
A_38_P00030498	A_38_P00030498	mir|ame-miR-3795|mir|MIMAT0018580	ame-miR-3795	MIMAT0018580	unmapped	CGCTCGGGTTTTCCCGAGCGGAACACGTCCAACGTGATTTTTTTTT
A_38_P00030499	A_38_P00030499	mir|ame-miR-3737|mir|MIMAT0018606	ame-miR-3737	MIMAT0018606	unmapped	CGCTCGGGTTTTCCCGAGCGGAACATATCAAAATTTCCGAATTTTTTTTT
A_38_P00030500	A_38_P00030500	mir|ame-miR-3737|mir|MIMAT0018606	ame-miR-3737	MIMAT0018606	unmapped	CGCTCGGGTTTTCCCGAGCGGAACATATCAAAATTTCCGATTTTTTTTTTT
A_38_P00030501	A_38_P00030501	mir|ame-miR-3737|mir|MIMAT0018606	ame-miR-3737	MIMAT0018606	unmapped	CGCTCGGGTTTTCCCGAGCGGAACATATCAAAATTTCCGATCTTTTTTTTTT
A_38_P00030502	A_38_P00030502	mir|ame-miR-3722|mir|MIMAT0018550	ame-miR-3722	MIMAT0018550	unmapped	CGCTCGGGTTTTCCCGAGCGGAACCGTCACACCTCTTTTTTTTTT
A_38_P00030503	A_38_P00030503	mir|ame-miR-3722|mir|MIMAT0018550	ame-miR-3722	MIMAT0018550	unmapped	CGCTCGGGTTTTCCCGAGCGGAACCGTCACACCTCGTTTTTTTTTT
A_38_P00030504	A_38_P00030504	mir|ame-miR-11|mir|MIMAT0018506	ame-miR-11	MIMAT0018506	unmapped	CGCTCGGGTTTTCCCGAGCGGAACTAGAACTCTGCCTGATTTTTTTTT
A_38_P00030505	A_38_P00030505	mir|ame-miR-11|mir|MIMAT0018506	ame-miR-11	MIMAT0018506	unmapped	CGCTCGGGTTTTCCCGAGCGGAACTAGAACTCTGCCTGTTTTTTTTTTT
A_38_P00030506	A_38_P00030506	mir|ame-miR-3757|mir|MIMAT0018529	ame-miR-3757	MIMAT0018529	unmapped	CGCTCGGGTTTTCCCGAGCGGAAGAAAATGAAAAAATAATTCCTTTTTTTTTT
A_38_P00030507	A_38_P00030507	mir|ame-miR-3757|mir|MIMAT0018529	ame-miR-3757	MIMAT0018529	unmapped	CGCTCGGGTTTTCCCGAGCGGAAGAAAATGAAAAAATAATTCCATTTTTTTTTT
A_38_P00030508	A_38_P00030508	mir|ame-miR-3748|mir|MIMAT0018517	ame-miR-3748	MIMAT0018517	unmapped	CGCTCGGGTTTTCCCGAGCGGAAGTTTTACTTTGAAACGTTTTTTTTTT
A_38_P00030509	A_38_P00030509	mir|ame-miR-3748|mir|MIMAT0018517	ame-miR-3748	MIMAT0018517	unmapped	CGCTCGGGTTTTCCCGAGCGGAAGTTTTACTTTGAAACGGTTTTTTTTTT
A_38_P00030510	A_38_P00030510	mir|ame-miR-3797|mir|MIMAT0018582	ame-miR-3797	MIMAT0018582	unmapped	CGCTCGGGTTTTCCCGAGCGGAATAAAATACGAGCCAGTATTTTTTTTT
A_38_P00030511	A_38_P00030511	mir|ame-miR-3797|mir|MIMAT0018582	ame-miR-3797	MIMAT0018582	unmapped	CGCTCGGGTTTTCCCGAGCGGAATAAAATACGAGCCAGTTTATTTTTTTT
A_38_P00030512	A_38_P00030512	mir|ame-miR-3797|mir|MIMAT0018582	ame-miR-3797	MIMAT0018582	unmapped	CGCTCGGGTTTTCCCGAGCGGAATAAAATACGAGCCAGTTCATTTTTTTTT
A_38_P00030513	A_38_P00030513	mir|ame-miR-3770|mir|MIMAT0018545	ame-miR-3770	MIMAT0018545	unmapped	CGCTCGGGTTTTCCCGAGCGGACAACGCACTTGATGTTTTTTTTTT
A_38_P00030514	A_38_P00030514	mir|ame-miR-3770|mir|MIMAT0018545	ame-miR-3770	MIMAT0018545	unmapped	CGCTCGGGTTTTCCCGAGCGGACAACGCACTTGATGCTTTTTTTTTT
A_38_P00030515	A_38_P00030515	mir|ame-miR-3761|mir|MIMAT0018534	ame-miR-3761	MIMAT0018534	unmapped	CGCTCGGGTTTTCCCGAGCGGACACACGAGGCCCTTTTTTTTTT
A_38_P00030516	A_38_P00030516	mir|ame-miR-3761|mir|MIMAT0018534	ame-miR-3761	MIMAT0018534	unmapped	CGCTCGGGTTTTCCCGAGCGGACACACGAGGCCCGTTTTTTTTTT
A_38_P00030517	A_38_P00030517	mir|ame-miR-927b|mir|MIMAT0018576	ame-miR-927b	MIMAT0018576	unmapped	CGCTCGGGTTTTCCCGAGCGGACAGAGCGTACAAATTCATTTTTTTTT
A_38_P00030518	A_38_P00030518	mir|ame-miR-927b|mir|MIMAT0018576	ame-miR-927b	MIMAT0018576	unmapped	CGCTCGGGTTTTCCCGAGCGGACAGAGCGTACAAATTCTTTTTTTTTTT
A_38_P00030519	A_38_P00030519	mir|ame-miR-2944|mir|MIMAT0018573	ame-miR-2944	MIMAT0018573	unmapped	CGCTCGGGTTTTCCCGAGCGGACCAGGTAACTACTGCATTTTTTTTT
A_38_P00030520	A_38_P00030520	mir|ame-miR-2944|mir|MIMAT0018573	ame-miR-2944	MIMAT0018573	unmapped	CGCTCGGGTTTTCCCGAGCGGACCAGGTAACTACTGCTTATTTTTTTT
A_38_P00030521	A_38_P00030521	mir|ame-miR-3783|mir|MIMAT0018561	ame-miR-3783	MIMAT0018561	unmapped	CGCTCGGGTTTTCCCGAGCGGACCTCATCAAACAATTGATTTTTTTTTT
A_38_P00030522	A_38_P00030522	mir|ame-miR-3783|mir|MIMAT0018561	ame-miR-3783	MIMAT0018561	unmapped	CGCTCGGGTTTTCCCGAGCGGACCTCATCAAACAATTGAATTTTTTTTTT
A_38_P00030523	A_38_P00030523	mir|ame-miR-3758|mir|MIMAT0018530	ame-miR-3758	MIMAT0018530	unmapped	CGCTCGGGTTTTCCCGAGCGGACCTGGTCCAGGACTATTTTTTTT
A_38_P00030524	A_38_P00030524	mir|ame-miR-3758|mir|MIMAT0018530	ame-miR-3758	MIMAT0018530	unmapped	CGCTCGGGTTTTCCCGAGCGGACCTGGTCCAGGACAATTTTTTTTT
A_38_P00030525	A_38_P00030525	mir|ame-miR-3746|mir|MIMAT0018514	ame-miR-3746	MIMAT0018514	unmapped	CGCTCGGGTTTTCCCGAGCGGACGCATACCTTCCTCATTTTTTTTT
A_38_P00030526	A_38_P00030526	mir|ame-miR-3746|mir|MIMAT0018514	ame-miR-3746	MIMAT0018514	unmapped	CGCTCGGGTTTTCCCGAGCGGACGCATACCTTCCTCTTTTTTTTTTT
A_38_P00030527	A_38_P00030527	mir|ame-miR-3746|mir|MIMAT0018514	ame-miR-3746	MIMAT0018514	unmapped	CGCTCGGGTTTTCCCGAGCGGACGCATACCTTCCTCTCTTTTTTTTTT
A_38_P00030528	A_38_P00030528	mir|ame-miR-3726|mir|MIMAT0018593	ame-miR-3726	MIMAT0018593	unmapped	CGCTCGGGTTTTCCCGAGCGGACGCTGGCATCCATTTTTTTTTT
A_38_P00030529	A_38_P00030529	mir|ame-miR-3726|mir|MIMAT0018593	ame-miR-3726	MIMAT0018593	unmapped	CGCTCGGGTTTTCCCGAGCGGACGCTGGCATCCACTTTTTTTTTT
A_38_P00030530	A_38_P00030530	mir|ame-miR-3768|mir|MIMAT0018542	ame-miR-3768	MIMAT0018542	unmapped	CGCTCGGGTTTTCCCGAGCGGACGGTTGGAGAGACTTTTTTTTTT
A_38_P00030531	A_38_P00030531	mir|ame-miR-3768|mir|MIMAT0018542	ame-miR-3768	MIMAT0018542	unmapped	CGCTCGGGTTTTCCCGAGCGGACGGTTGGAGAGACCTATTTTTTTT
A_38_P00030532	A_38_P00030532	mir|ame-miR-3733|mir|MIMAT0018602	ame-miR-3733	MIMAT0018602	unmapped	CGCTCGGGTTTTCCCGAGCGGAGAAAAATTCGAGATTAGTATTTTTTTTTT
A_38_P00030533	A_38_P00030533	mir|ame-miR-3733|mir|MIMAT0018602	ame-miR-3733	MIMAT0018602	unmapped	CGCTCGGGTTTTCCCGAGCGGAGAAAAATTCGAGATTAGTAATTTTTTTTTT
A_38_P00030534	A_38_P00030534	mir|ame-miR-989|mir|MIMAT0018511	ame-miR-989	MIMAT0018511	unmapped	CGCTCGGGTTTTCCCGAGCGGAGAACCACTACGTCACTATTTTTTTT
A_38_P00030535	A_38_P00030535	mir|ame-miR-989|mir|MIMAT0018511	ame-miR-989	MIMAT0018511	unmapped	CGCTCGGGTTTTCCCGAGCGGAGAACCACTACGTCACAATTTTTTTTT
A_38_P00030536	A_38_P00030536	mir|ame-miR-3049-3p|mir|MIMAT0018528|mir|ame-miR-3049_v18.0|mir|MIMAT0018528	ame-miR-3049-3p	MIMAT0018528	unmapped	CGCTCGGGTTTTCCCGAGCGGAGACGGAAAGGAGTTTTTTTTTTTT
A_38_P00030537	A_38_P00030537	mir|ame-miR-3049-3p|mir|MIMAT0018528|mir|ame-miR-3049_v18.0|mir|MIMAT0018528	ame-miR-3049-3p	MIMAT0018528	unmapped	CGCTCGGGTTTTCCCGAGCGGAGACGGAAAGGAGTTGTTTTTTTTTT
A_38_P00030538	A_38_P00030538	mir|ame-miR-3732|mir|MIMAT0018600	ame-miR-3732	MIMAT0018600	unmapped	CGCTCGGGTTTTCCCGAGCGGAGATGAGACCAAACATGTTTTTTTTTT
A_38_P00030539	A_38_P00030539	mir|ame-miR-3732|mir|MIMAT0018600	ame-miR-3732	MIMAT0018600	unmapped	CGCTCGGGTTTTCCCGAGCGGAGATGAGACCAAACATGGTTTTTTTTTT
A_38_P00030540	A_38_P00030540	mir|ame-miR-3739|mir|MIMAT0018608	ame-miR-3739	MIMAT0018608	unmapped	CGCTCGGGTTTTCCCGAGCGGAGCTGCTCTCTCCCTTTTTTTTTT
A_38_P00030541	A_38_P00030541	mir|ame-miR-3739|mir|MIMAT0018608	ame-miR-3739	MIMAT0018608	unmapped	CGCTCGGGTTTTCCCGAGCGGAGCTGCTCTCTCCCCTATTTTTTTT
A_38_P00030542	A_38_P00030542	mir|ame-miR-3743|mir|MIMAT0018612	ame-miR-3743	MIMAT0018612	unmapped	CGCTCGGGTTTTCCCGAGCGGAGGGGCTGAAAAGAATTTTTTTTTT
A_38_P00030543	A_38_P00030543	mir|ame-miR-3743|mir|MIMAT0018612	ame-miR-3743	MIMAT0018612	unmapped	CGCTCGGGTTTTCCCGAGCGGAGGGGCTGAAAAGAAATATTTTTTTT
A_38_P00030544	A_38_P00030544	mir|ame-miR-3743|mir|MIMAT0018612	ame-miR-3743	MIMAT0018612	unmapped	CGCTCGGGTTTTCCCGAGCGGAGGGGCTGAAAAGAAAGATTTTTTTTT
A_38_P00030545	A_38_P00030545	mir|ame-miR-3715|mir|MIMAT0018597	ame-miR-3715	MIMAT0018597	unmapped	CGCTCGGGTTTTCCCGAGCGGAGGTCTTATACTCTGCTTTTTTTTTTTT
A_38_P00030546	A_38_P00030546	mir|ame-miR-3715|mir|MIMAT0018597	ame-miR-3715	MIMAT0018597	unmapped	CGCTCGGGTTTTCCCGAGCGGAGGTCTTATACTCTGCTTATTTTTTTTTT
A_38_P00030547	A_38_P00030547	mir|ame-miR-3715|mir|MIMAT0018597	ame-miR-3715	MIMAT0018597	unmapped	CGCTCGGGTTTTCCCGAGCGGAGGTCTTATACTCTGCTTACTTTTTTTTTT
A_38_P00030548	A_38_P00030548	mir|ame-miR-3767|mir|MIMAT0018541	ame-miR-3767	MIMAT0018541	unmapped	CGCTCGGGTTTTCCCGAGCGGAGTAGTAGTAAATAATGTGATTTTTTTTT
A_38_P00030549	A_38_P00030549	mir|ame-miR-3767|mir|MIMAT0018541	ame-miR-3767	MIMAT0018541	unmapped	CGCTCGGGTTTTCCCGAGCGGAGTAGTAGTAAATAATGTGTTTTTTTTTTT
A_38_P00030550	A_38_P00030550	mir|ame-miR-3767|mir|MIMAT0018541	ame-miR-3767	MIMAT0018541	unmapped	CGCTCGGGTTTTCCCGAGCGGAGTAGTAGTAAATAATGTGTATTTTTTTTTT
A_38_P00030551	A_38_P00030551	mir|ame-miR-3785|mir|MIMAT0018564	ame-miR-3785	MIMAT0018564	unmapped	CGCTCGGGTTTTCCCGAGCGGAGTCTCAGGACGTTACTTTTTTTTTT
A_38_P00030552	A_38_P00030552	mir|ame-miR-3785|mir|MIMAT0018564	ame-miR-3785	MIMAT0018564	unmapped	CGCTCGGGTTTTCCCGAGCGGAGTCTCAGGACGTTACATTTTTTTTTT
A_38_P00030553	A_38_P00030553	mir|ame-miR-3781|mir|MIMAT0018559	ame-miR-3781	MIMAT0018559	unmapped	CGCTCGGGTTTTCCCGAGCGGATCCACGATCGATCAAATTTTTTTTT
A_38_P00030554	A_38_P00030554	mir|ame-miR-3781|mir|MIMAT0018559	ame-miR-3781	MIMAT0018559	unmapped	CGCTCGGGTTTTCCCGAGCGGATCCACGATCGATCAATTTTTTTTTTT
A_38_P00030555	A_38_P00030555	mir|ame-miR-3781|mir|MIMAT0018559	ame-miR-3781	MIMAT0018559	unmapped	CGCTCGGGTTTTCCCGAGCGGATCCACGATCGATCAATCTTTTTTTTTT
A_38_P00030556	A_38_P00030556	mir|ame-miR-3799|mir|MIMAT0018585	ame-miR-3799	MIMAT0018585	unmapped	CGCTCGGGTTTTCCCGAGCGGATCGAGTCAATCAATATCGAATTTTTTTT
A_38_P00030557	A_38_P00030557	mir|ame-miR-3799|mir|MIMAT0018585	ame-miR-3799	MIMAT0018585	unmapped	CGCTCGGGTTTTCCCGAGCGGATCGAGTCAATCAATATCGTATTTTTTTTT
A_38_P00030558	A_38_P00030558	mir|ame-miR-3721|mir|MIMAT0018546	ame-miR-3721	MIMAT0018546	unmapped	CGCTCGGGTTTTCCCGAGCGGATCTTCTCCTCTTTTTCATTTTTTTTTT
A_38_P00030559	A_38_P00030559	mir|ame-miR-3721|mir|MIMAT0018546	ame-miR-3721	MIMAT0018546	unmapped	CGCTCGGGTTTTCCCGAGCGGATCTTCTCCTCTTTTTCAATTTTTTTTTT
A_38_P00030560	A_38_P00030560	mir|ame-miR-3721|mir|MIMAT0018546	ame-miR-3721	MIMAT0018546	unmapped	CGCTCGGGTTTTCCCGAGCGGATCTTCTCCTCTTTTTCAACTTTTTTTTTT
A_38_P00030561	A_38_P00030561	mir|ame-miR-3738|mir|MIMAT0018607	ame-miR-3738	MIMAT0018607	unmapped	CGCTCGGGTTTTCCCGAGCGGATTGCGAAAACATCCGTATTTTTTTT
A_38_P00030562	A_38_P00030562	mir|ame-miR-3738|mir|MIMAT0018607	ame-miR-3738	MIMAT0018607	unmapped	CGCTCGGGTTTTCCCGAGCGGATTGCGAAAACATCCGGATTTTTTTTT
A_38_P00030563	A_38_P00030563	mir|ame-miR-3747b|mir|MIMAT0018516	ame-miR-3747b	MIMAT0018516	unmapped	CGCTCGGGTTTTCCCGAGCGGCACGACTGAAAAGAAAATTTTTTTTT
A_38_P00030564	A_38_P00030564	mir|ame-miR-3747b|mir|MIMAT0018516	ame-miR-3747b	MIMAT0018516	unmapped	CGCTCGGGTTTTCCCGAGCGGCACGACTGAAAAGAAATTATTTTTTTT
A_38_P00030565	A_38_P00030565	mir|ame-miR-3747b|mir|MIMAT0018516	ame-miR-3747b	MIMAT0018516	unmapped	CGCTCGGGTTTTCCCGAGCGGCACGACTGAAAAGAAATCATTTTTTTTT
A_38_P00030566	A_38_P00030566	mir|ame-miR-3755|mir|MIMAT0018525	ame-miR-3755	MIMAT0018525	unmapped	CGCTCGGGTTTTCCCGAGCGGCACGATATAATTATATATACACAAATTTTTTTT
A_38_P00030567	A_38_P00030567	mir|ame-miR-3755|mir|MIMAT0018525	ame-miR-3755	MIMAT0018525	unmapped	CGCTCGGGTTTTCCCGAGCGGCACGATATAATTATATATACACATATTTTTTTTT
A_38_P00030568	A_38_P00030568	mir|ame-miR-3755|mir|MIMAT0018525	ame-miR-3755	MIMAT0018525	unmapped	CGCTCGGGTTTTCCCGAGCGGCACGATATAATTATATATACACATTTTTTTTTTTT
A_38_P00030569	A_38_P00030569	mir|ame-miR-3730|mir|MIMAT0018598	ame-miR-3730	MIMAT0018598	unmapped	CGCTCGGGTTTTCCCGAGCGGCACGCAATCTTCACTTTTTTTTTT
A_38_P00030570	A_38_P00030570	mir|ame-miR-3730|mir|MIMAT0018598	ame-miR-3730	MIMAT0018598	unmapped	CGCTCGGGTTTTCCCGAGCGGCACGCAATCTTCACCTATTTTTTTT
A_38_P00030571	A_38_P00030571	mir|ame-miR-3793|mir|MIMAT0018577	ame-miR-3793	MIMAT0018577	unmapped	CGCTCGGGTTTTCCCGAGCGGCAGTCCAGGGAAAACTTTTTTTTTT
A_38_P00030572	A_38_P00030572	mir|ame-miR-3793|mir|MIMAT0018577	ame-miR-3793	MIMAT0018577	unmapped	CGCTCGGGTTTTCCCGAGCGGCAGTCCAGGGAAAACATTTTTTTTTT
A_38_P00030573	A_38_P00030573	mir|ame-miR-3750|mir|MIMAT0018519	ame-miR-3750	MIMAT0018519	unmapped	CGCTCGGGTTTTCCCGAGCGGCAGTCCTGCTGATGATTTTTTTTTT
A_38_P00030574	A_38_P00030574	mir|ame-miR-3750|mir|MIMAT0018519	ame-miR-3750	MIMAT0018519	unmapped	CGCTCGGGTTTTCCCGAGCGGCAGTCCTGCTGATGAATTTTTTTTTT
A_38_P00030575	A_38_P00030575	mir|ame-miR-965-5p|mir|MIMAT0018557|mir|ame-miR-965_v18.0|mir|MIMAT0018557	ame-miR-965-5p	MIMAT0018557	unmapped	CGCTCGGGTTTTCCCGAGCGGCATAATCGCTATAACCTTTTTTTTTTTTT
A_38_P00030576	A_38_P00030576	mir|ame-miR-965-5p|mir|MIMAT0018557|mir|ame-miR-965_v18.0|mir|MIMAT0018557	ame-miR-965-5p	MIMAT0018557	unmapped	CGCTCGGGTTTTCCCGAGCGGCATAATCGCTATAACCTTTCTTTTTTTTTT
A_38_P00030577	A_38_P00030577	mir|ame-miR-3763|mir|MIMAT0018536	ame-miR-3763	MIMAT0018536	unmapped	CGCTCGGGTTTTCCCGAGCGGCCACCGATATTTTAGTAATTTTTTTTTTT
A_38_P00030578	A_38_P00030578	mir|ame-miR-3763|mir|MIMAT0018536	ame-miR-3763	MIMAT0018536	unmapped	CGCTCGGGTTTTCCCGAGCGGCCACCGATATTTTAGTAATGTTTTTTTTTT
A_38_P00030579	A_38_P00030579	mir|ame-miR-3751|mir|MIMAT0018521	ame-miR-3751	MIMAT0018521	unmapped	CGCTCGGGTTTTCCCGAGCGGCCCCGACTTCCACTTTTTTTTTT
A_38_P00030580	A_38_P00030580	mir|ame-miR-3751|mir|MIMAT0018521	ame-miR-3751	MIMAT0018521	unmapped	CGCTCGGGTTTTCCCGAGCGGCCCCGACTTCCACCTTTTTTTTTT
A_38_P00030581	A_38_P00030581	mir|ame-miR-3717|mir|MIMAT0018512	ame-miR-3717	MIMAT0018512	unmapped	CGCTCGGGTTTTCCCGAGCGGCCGACACTCTCTTTTATTTTTTTTT
A_38_P00030582	A_38_P00030582	mir|ame-miR-3717|mir|MIMAT0018512	ame-miR-3717	MIMAT0018512	unmapped	CGCTCGGGTTTTCCCGAGCGGCCGACACTCTCTTTTTTATTTTTTTT
A_38_P00030583	A_38_P00030583	mir|ame-miR-3717|mir|MIMAT0018512	ame-miR-3717	MIMAT0018512	unmapped	CGCTCGGGTTTTCCCGAGCGGCCGACACTCTCTTTTTCATTTTTTTTT
A_38_P00030584	A_38_P00030584	mir|ame-miR-3745|mir|MIMAT0018513	ame-miR-3745	MIMAT0018513	unmapped	CGCTCGGGTTTTCCCGAGCGGCCGGGCCGGGTTTTTTTTTT
A_38_P00030585	A_38_P00030585	mir|ame-miR-3745|mir|MIMAT0018513	ame-miR-3745	MIMAT0018513	unmapped	CGCTCGGGTTTTCCCGAGCGGCCGGGCCGGGGTTTTTTTTTT
A_38_P00030586	A_38_P00030586	mir|ame-miR-3744|mir|MIMAT0018613	ame-miR-3744	MIMAT0018613	unmapped	CGCTCGGGTTTTCCCGAGCGGCGAAATTTTTCACAAAGAATTTTTTTTT
A_38_P00030587	A_38_P00030587	mir|ame-miR-3744|mir|MIMAT0018613	ame-miR-3744	MIMAT0018613	unmapped	CGCTCGGGTTTTCCCGAGCGGCGAAATTTTTCACAAAGATTTTTTTTTTT
A_38_P00030588	A_38_P00030588	mir|ame-miR-3744|mir|MIMAT0018613	ame-miR-3744	MIMAT0018613	unmapped	CGCTCGGGTTTTCCCGAGCGGCGAAATTTTTCACAAAGATATTTTTTTTTT
A_38_P00030589	A_38_P00030589	mir|ame-miR-3786|mir|MIMAT0018565	ame-miR-3786	MIMAT0018565	unmapped	CGCTCGGGTTTTCCCGAGCGGCGCCCTACATGAACTTTTTTTTTT
A_38_P00030590	A_38_P00030590	mir|ame-miR-3786|mir|MIMAT0018565	ame-miR-3786	MIMAT0018565	unmapped	CGCTCGGGTTTTCCCGAGCGGCGCCCTACATGAACCTTTTTTTTTT
A_38_P00030591	A_38_P00030591	mir|ame-miR-3776|mir|MIMAT0018553	ame-miR-3776	MIMAT0018553	unmapped	CGCTCGGGTTTTCCCGAGCGGCGCTTCTCTCTCCCTTTTTTTTTT
A_38_P00030592	A_38_P00030592	mir|ame-miR-3776|mir|MIMAT0018553	ame-miR-3776	MIMAT0018553	unmapped	CGCTCGGGTTTTCCCGAGCGGCGCTTCTCTCTCCCCTTTTTTTTTT
A_38_P00030593	A_38_P00030593	mir|ame-miR-3753|mir|MIMAT0018523	ame-miR-3753	MIMAT0018523	unmapped	CGCTCGGGTTTTCCCGAGCGGCGGTCGAGTCCCTTTTTTTTTT
A_38_P00030594	A_38_P00030594	mir|ame-miR-3753|mir|MIMAT0018523	ame-miR-3753	MIMAT0018523	unmapped	CGCTCGGGTTTTCCCGAGCGGCGGTCGAGTCCCGTTTTTTTTTT
A_38_P00030595	A_38_P00030595	mir|ame-miR-3769|mir|MIMAT0018543	ame-miR-3769	MIMAT0018543	unmapped	CGCTCGGGTTTTCCCGAGCGGCGTCAACCTTCTCTTTTTTTTTTTT
A_38_P00030596	A_38_P00030596	mir|ame-miR-3769|mir|MIMAT0018543	ame-miR-3769	MIMAT0018543	unmapped	CGCTCGGGTTTTCCCGAGCGGCGTCAACCTTCTCTTGTTTTTTTTTT
A_38_P00030597	A_38_P00030597	mir|ame-miR-3766|mir|MIMAT0018540	ame-miR-3766	MIMAT0018540	unmapped	CGCTCGGGTTTTCCCGAGCGGCGTCATTTTCAAAACCTTTTTTTTTT
A_38_P00030598	A_38_P00030598	mir|ame-miR-3766|mir|MIMAT0018540	ame-miR-3766	MIMAT0018540	unmapped	CGCTCGGGTTTTCCCGAGCGGCGTCATTTTCAAAACCATTTTTTTTTT
A_38_P00030599	A_38_P00030599	mir|ame-miR-3779|mir|MIMAT0018556	ame-miR-3779	MIMAT0018556	unmapped	CGCTCGGGTTTTCCCGAGCGGCGTGTCGAGCGGTTTTTTTTTT
A_38_P00030600	A_38_P00030600	mir|ame-miR-3779|mir|MIMAT0018556	ame-miR-3779	MIMAT0018556	unmapped	CGCTCGGGTTTTCCCGAGCGGCGTGTCGAGCGGCTTTTTTTTTT
A_38_P00030601	A_38_P00030601	mir|ame-miR-3734|mir|MIMAT0018603	ame-miR-3734	MIMAT0018603	unmapped	CGCTCGGGTTTTCCCGAGCGGCTAACGTCCTCCCTATTTTTTTT
A_38_P00030602	A_38_P00030602	mir|ame-miR-3734|mir|MIMAT0018603	ame-miR-3734	MIMAT0018603	unmapped	CGCTCGGGTTTTCCCGAGCGGCTAACGTCCTCCCGATTTTTTTTT
A_38_P00030603	A_38_P00030603	mir|ame-miR-3760|mir|MIMAT0018533	ame-miR-3760	MIMAT0018533	unmapped	CGCTCGGGTTTTCCCGAGCGGCTAGAAATGATTATTCATATGAAATTTTTTTT
A_38_P00030604	A_38_P00030604	mir|ame-miR-3760|mir|MIMAT0018533	ame-miR-3760	MIMAT0018533	unmapped	CGCTCGGGTTTTCCCGAGCGGCTAGAAATGATTATTCATATGATATTTTTTTTT
A_38_P00030605	A_38_P00030605	mir|ame-miR-3760|mir|MIMAT0018533	ame-miR-3760	MIMAT0018533	unmapped	CGCTCGGGTTTTCCCGAGCGGCTAGAAATGATTATTCATATGATTTTTTTTTTTT
A_38_P00030606	A_38_P00030606	mir|ame-miR-3718a|mir|MIMAT0018520	ame-miR-3718a	MIMAT0018520	unmapped	CGCTCGGGTTTTCCCGAGCGGCTATCGGGACAGGATTTTTTTTTT
A_38_P00030607	A_38_P00030607	mir|ame-miR-3718a|mir|MIMAT0018520	ame-miR-3718a	MIMAT0018520	unmapped	CGCTCGGGTTTTCCCGAGCGGCTATCGGGACAGGACTTTTTTTTTT
A_38_P00030608	A_38_P00030608	mir|ame-miR-3477|mir|MIMAT0018583	ame-miR-3477	MIMAT0018583	unmapped	CGCTCGGGTTTTCCCGAGCGGCTCACAGTTACCGCTATTTTTTTT
A_38_P00030609	A_38_P00030609	mir|ame-miR-3477|mir|MIMAT0018583	ame-miR-3477	MIMAT0018583	unmapped	CGCTCGGGTTTTCCCGAGCGGCTCACAGTTACCGCAATTTTTTTTT
A_38_P00030610	A_38_P00030610	mir|ame-miR-3789|mir|MIMAT0018568	ame-miR-3789	MIMAT0018568	unmapped	CGCTCGGGTTTTCCCGAGCGGCTCACCTCACCGAGTTTTTTTTTT
A_38_P00030611	A_38_P00030611	mir|ame-miR-3789|mir|MIMAT0018568	ame-miR-3789	MIMAT0018568	unmapped	CGCTCGGGTTTTCCCGAGCGGCTCACCTCACCGAGCTTTTTTTTTT
A_38_P00030612	A_38_P00030612	mir|ame-miR-971|mir|MIMAT0018544	ame-miR-971	MIMAT0018544	unmapped	CGCTCGGGTTTTCCCGAGCGGCTCACTGTAAGGTAGAATTTTTTTTTT
A_38_P00030613	A_38_P00030613	mir|ame-miR-971|mir|MIMAT0018544	ame-miR-971	MIMAT0018544	unmapped	CGCTCGGGTTTTCCCGAGCGGCTCACTGTAAGGTAGAACTTTTTTTTTT
A_38_P00030614	A_38_P00030614	mir|ame-miR-306|mir|MIMAT0018579	ame-miR-306	MIMAT0018579	unmapped	CGCTCGGGTTTTCCCGAGCGGCTCAGAGTCACTCAGTTTTTTTTTTT
A_38_P00030615	A_38_P00030615	mir|ame-miR-306|mir|MIMAT0018579	ame-miR-306	MIMAT0018579	unmapped	CGCTCGGGTTTTCCCGAGCGGCTCAGAGTCACTCAGTATTTTTTTTTT
A_38_P00030616	A_38_P00030616	mir|ame-miR-306|mir|MIMAT0018579	ame-miR-306	MIMAT0018579	unmapped	CGCTCGGGTTTTCCCGAGCGGCTCAGAGTCACTCAGTACTATTTTTTTT
A_38_P00030617	A_38_P00030617	mir|ame-miR-3790|mir|MIMAT0018569	ame-miR-3790	MIMAT0018569	unmapped	CGCTCGGGTTTTCCCGAGCGGCTCGATCGCTTAATCTTTTTTTTTT
A_38_P00030618	A_38_P00030618	mir|ame-miR-3790|mir|MIMAT0018569	ame-miR-3790	MIMAT0018569	unmapped	CGCTCGGGTTTTCCCGAGCGGCTCGATCGCTTAATCGTATTTTTTTT
A_38_P00030619	A_38_P00030619	mir|ame-miR-3771|mir|MIMAT0018547	ame-miR-3771	MIMAT0018547	unmapped	CGCTCGGGTTTTCCCGAGCGGCTCGTGCAACTCGTATTTTTTTT
A_38_P00030620	A_38_P00030620	mir|ame-miR-3771|mir|MIMAT0018547	ame-miR-3771	MIMAT0018547	unmapped	CGCTCGGGTTTTCCCGAGCGGCTCGTGCAACTCGCATTTTTTTTT
A_38_P00030621	A_38_P00030621	mir|ame-miR-3720|mir|MIMAT0018538	ame-miR-3720	MIMAT0018538	unmapped	CGCTCGGGTTTTCCCGAGCGGCTGTTTAAACTCATCACCTATTTTTTTT
A_38_P00030622	A_38_P00030622	mir|ame-miR-3720|mir|MIMAT0018538	ame-miR-3720	MIMAT0018538	unmapped	CGCTCGGGTTTTCCCGAGCGGCTGTTTAAACTCATCACCGATTTTTTTTT
A_38_P00030623	A_38_P00030623	mir|ame-miR-3725|mir|MIMAT0018592	ame-miR-3725	MIMAT0018592	unmapped	CGCTCGGGTTTTCCCGAGCGGCTTTACGAAGAAATGTAGATTTTTTTTTT
A_38_P00030624	A_38_P00030624	mir|ame-miR-3725|mir|MIMAT0018592	ame-miR-3725	MIMAT0018592	unmapped	CGCTCGGGTTTTCCCGAGCGGCTTTACGAAGAAATGTAGAATTTTTTTTTT
A_38_P00030625	A_38_P00030625	mir|ame-miR-3774|mir|MIMAT0018551	ame-miR-3774	MIMAT0018551	unmapped	CGCTCGGGTTTTCCCGAGCGGGACAATCTTAAGTAATTTTTTTTTTTTTTT
A_38_P00030626	A_38_P00030626	mir|ame-miR-3774|mir|MIMAT0018551	ame-miR-3774	MIMAT0018551	unmapped	CGCTCGGGTTTTCCCGAGCGGGACAATCTTAAGTAATTTTTCTTTTTTTTTT
A_38_P00030627	A_38_P00030627	mir|ame-miR-750|mir|MIMAT0018615	ame-miR-750	MIMAT0018615	unmapped	CGCTCGGGTTTTCCCGAGCGGGAGCTGGAAGAGTTAGTATTTTTTTT
A_38_P00030628	A_38_P00030628	mir|ame-miR-750|mir|MIMAT0018615	ame-miR-750	MIMAT0018615	unmapped	CGCTCGGGTTTTCCCGAGCGGGAGCTGGAAGAGTTAGAATTTTTTTTT
A_38_P00030629	A_38_P00030629	mir|ame-miR-3788|mir|MIMAT0018567	ame-miR-3788	MIMAT0018567	unmapped	CGCTCGGGTTTTCCCGAGCGGGAGGGACAGGAGGATTTTTTTTT
A_38_P00030630	A_38_P00030630	mir|ame-miR-3788|mir|MIMAT0018567	ame-miR-3788	MIMAT0018567	unmapped	CGCTCGGGTTTTCCCGAGCGGGAGGGACAGGAGGTTTTTTTTTTT
A_38_P00030633	A_38_P00030633	mir|ame-miR-3778|mir|MIMAT0018555	ame-miR-3778	MIMAT0018555	unmapped	CGCTCGGGTTTTCCCGAGCGGGCACAAAGCATCCAAAATTTTTTTT
A_38_P00030634	A_38_P00030634	mir|ame-miR-3778|mir|MIMAT0018555	ame-miR-3778	MIMAT0018555	unmapped	CGCTCGGGTTTTCCCGAGCGGGCACAAAGCATCCAATATTTTTTTTT
A_38_P00030635	A_38_P00030635	mir|ame-miR-3778|mir|MIMAT0018555	ame-miR-3778	MIMAT0018555	unmapped	CGCTCGGGTTTTCCCGAGCGGGCACAAAGCATCCAATTTATTTTTTTT
A_38_P00030636	A_38_P00030636	mir|ame-miR-3716b|mir|MIMAT0018562	ame-miR-3716b	MIMAT0018562	unmapped	CGCTCGGGTTTTCCCGAGCGGGCCAATGATTTCAAATAACTATTTTTTTT
A_38_P00030637	A_38_P00030637	mir|ame-miR-3716b|mir|MIMAT0018562	ame-miR-3716b	MIMAT0018562	unmapped	CGCTCGGGTTTTCCCGAGCGGGCCAATGATTTCAAATAACAATTTTTTTTT
A_38_P00030638	A_38_P00030638	mir|ame-miR-3759|mir|MIMAT0018532	ame-miR-3759	MIMAT0018532	unmapped	CGCTCGGGTTTTCCCGAGCGGGCGGACACCCAGATTTTTTTTT
A_38_P00030639	A_38_P00030639	mir|ame-miR-3759|mir|MIMAT0018532	ame-miR-3759	MIMAT0018532	unmapped	CGCTCGGGTTTTCCCGAGCGGGCGGACACCCAGTTTTTTTTTTT
A_38_P00030640	A_38_P00030640	mir|ame-miR-3801|mir|MIMAT0018588	ame-miR-3801	MIMAT0018588	unmapped	CGCTCGGGTTTTCCCGAGCGGGCTCGCCTTCTCATATTTTTTTT
A_38_P00030641	A_38_P00030641	mir|ame-miR-3801|mir|MIMAT0018588	ame-miR-3801	MIMAT0018588	unmapped	CGCTCGGGTTTTCCCGAGCGGGCTCGCCTTCTCAAATTTTTTTTT
A_38_P00030642	A_38_P00030642	mir|ame-miR-3801|mir|MIMAT0018588	ame-miR-3801	MIMAT0018588	unmapped	CGCTCGGGTTTTCCCGAGCGGGCTCGCCTTCTCAATTTTTTTTTTT
A_38_P00030643	A_38_P00030643	mir|ame-miR-3794|mir|MIMAT0018578	ame-miR-3794	MIMAT0018578	unmapped	CGCTCGGGTTTTCCCGAGCGGGGAAACGTCCTCTTCTTTTTTTTTT
A_38_P00030644	A_38_P00030644	mir|ame-miR-3794|mir|MIMAT0018578	ame-miR-3794	MIMAT0018578	unmapped	CGCTCGGGTTTTCCCGAGCGGGGAAACGTCCTCTTCCTATTTTTTTT
A_38_P00030645	A_38_P00030645	mir|ame-miR-3736|mir|MIMAT0018605	ame-miR-3736	MIMAT0018605	unmapped	CGCTCGGGTTTTCCCGAGCGGGGAGCATACTCAGGGATTTTTTTTT
A_38_P00030646	A_38_P00030646	mir|ame-miR-3736|mir|MIMAT0018605	ame-miR-3736	MIMAT0018605	unmapped	CGCTCGGGTTTTCCCGAGCGGGGAGCATACTCAGGGTTTTTTTTTTT
A_38_P00030647	A_38_P00030647	mir|ame-miR-3735|mir|MIMAT0018604	ame-miR-3735	MIMAT0018604	unmapped	CGCTCGGGTTTTCCCGAGCGGGGCACGAGGAAACTAATTTTTTTT
A_38_P00030648	A_38_P00030648	mir|ame-miR-3735|mir|MIMAT0018604	ame-miR-3735	MIMAT0018604	unmapped	CGCTCGGGTTTTCCCGAGCGGGGCACGAGGAAACTTATTTTTTTTT
A_38_P00030649	A_38_P00030649	mir|ame-miR-3749|mir|MIMAT0018518	ame-miR-3749	MIMAT0018518	unmapped	CGCTCGGGTTTTCCCGAGCGGGGGAAGGTGAAAGGTTTTTTTTTT
A_38_P00030650	A_38_P00030650	mir|ame-miR-3749|mir|MIMAT0018518	ame-miR-3749	MIMAT0018518	unmapped	CGCTCGGGTTTTCCCGAGCGGGGGAAGGTGAAAGGGTTTTTTTTTT
A_38_P00030651	A_38_P00030651	mir|ame-miR-318|mir|MIMAT0018574	ame-miR-318	MIMAT0018574	unmapped	CGCTCGGGTTTTCCCGAGCGGGGGACAAACATAACCTTTTTTTTTT
A_38_P00030652	A_38_P00030652	mir|ame-miR-318|mir|MIMAT0018574	ame-miR-318	MIMAT0018574	unmapped	CGCTCGGGTTTTCCCGAGCGGGGGACAAACATAACCCTTTTTTTTTT
A_38_P00030653	A_38_P00030653	mir|ame-miR-279b|mir|MIMAT0018571	ame-miR-279b	MIMAT0018571	unmapped	CGCTCGGGTTTTCCCGAGCGGGGGACGAGTATTTCGTATTTTTTTT
A_38_P00030654	A_38_P00030654	mir|ame-miR-279b|mir|MIMAT0018571	ame-miR-279b	MIMAT0018571	unmapped	CGCTCGGGTTTTCCCGAGCGGGGGACGAGTATTTCGAATTTTTTTTT
A_38_P00030655	A_38_P00030655	mir|ame-miR-1175|mir|MIMAT0018507	ame-miR-1175	MIMAT0018507	unmapped	CGCTCGGGTTTTCCCGAGCGGGTAAGTTGGAGGAGTGTTTTTTTTTT
A_38_P00030656	A_38_P00030656	mir|ame-miR-1175|mir|MIMAT0018507	ame-miR-1175	MIMAT0018507	unmapped	CGCTCGGGTTTTCCCGAGCGGGTAAGTTGGAGGAGTGATATTTTTTTT
A_38_P00030657	A_38_P00030657	mir|ame-miR-3780|mir|MIMAT0018558	ame-miR-3780	MIMAT0018558	unmapped	CGCTCGGGTTTTCCCGAGCGGGTCAGTTACGATGCCTTTTTTTTTT
A_38_P00030658	A_38_P00030658	mir|ame-miR-3780|mir|MIMAT0018558	ame-miR-3780	MIMAT0018558	unmapped	CGCTCGGGTTTTCCCGAGCGGGTCAGTTACGATGCCGTTTTTTTTTT
A_38_P00030659	A_38_P00030659	mir|ame-miR-3742|mir|MIMAT0018611	ame-miR-3742	MIMAT0018611	unmapped	CGCTCGGGTTTTCCCGAGCGGGTCCGTCGTTTAAAATAATTTTTTTTT
A_38_P00030660	A_38_P00030660	mir|ame-miR-3742|mir|MIMAT0018611	ame-miR-3742	MIMAT0018611	unmapped	CGCTCGGGTTTTCCCGAGCGGGTCCGTCGTTTAAAATATTATTTTTTTT
A_38_P00030661	A_38_P00030661	mir|ame-miR-3742|mir|MIMAT0018611	ame-miR-3742	MIMAT0018611	unmapped	CGCTCGGGTTTTCCCGAGCGGGTCCGTCGTTTAAAATATAAATTTTTTTT
A_38_P00030662	A_38_P00030662	mir|ame-miR-3742|mir|MIMAT0018611	ame-miR-3742	MIMAT0018611	unmapped	CGCTCGGGTTTTCCCGAGCGGGTCCGTCGTTTAAAATATATAATTTTTTTT
A_38_P00030663	A_38_P00030663	mir|ame-miR-3782|mir|MIMAT0018560	ame-miR-3782	MIMAT0018560	unmapped	CGCTCGGGTTTTCCCGAGCGGGTGTCCGCCAGATTATTTTTTTT
A_38_P00030664	A_38_P00030664	mir|ame-miR-3782|mir|MIMAT0018560	ame-miR-3782	MIMAT0018560	unmapped	CGCTCGGGTTTTCCCGAGCGGGTGTCCGCCAGATGATTTTTTTTT
A_38_P00030665	A_38_P00030665	mir|ame-miR-3731|mir|MIMAT0018599	ame-miR-3731	MIMAT0018599	unmapped	CGCTCGGGTTTTCCCGAGCGGGTTGCAAGCTTTGGTTTTTTTTTTT
A_38_P00030666	A_38_P00030666	mir|ame-miR-3731|mir|MIMAT0018599	ame-miR-3731	MIMAT0018599	unmapped	CGCTCGGGTTTTCCCGAGCGGGTTGCAAGCTTTGGTCTTTTTTTTTT
A_38_P00030667	A_38_P00030667	mir|ame-miR-3798|mir|MIMAT0018584	ame-miR-3798	MIMAT0018584	unmapped	CGCTCGGGTTTTCCCGAGCGGTAAAGAAATACAGATTATTTATGTTTTTTTTTT
A_38_P00030668	A_38_P00030668	mir|ame-miR-3798|mir|MIMAT0018584	ame-miR-3798	MIMAT0018584	unmapped	CGCTCGGGTTTTCCCGAGCGGTAAAGAAATACAGATTATTTATGATTTTTTTTTT
A_38_P00030669	A_38_P00030669	mir|ame-miR-3728|mir|MIMAT0018595	ame-miR-3728	MIMAT0018595	unmapped	CGCTCGGGTTTTCCCGAGCGGTAAATTACGAATCCCACTTTTTTTTTT
A_38_P00030670	A_38_P00030670	mir|ame-miR-3728|mir|MIMAT0018595	ame-miR-3728	MIMAT0018595	unmapped	CGCTCGGGTTTTCCCGAGCGGTAAATTACGAATCCCACGTTTTTTTTTT
A_38_P00030671	A_38_P00030671	mir|ame-miR-3723|mir|MIMAT0018589	ame-miR-3723	MIMAT0018589	unmapped	CGCTCGGGTTTTCCCGAGCGGTACGAAAACTTTGAAACGTATTTTTTTT
A_38_P00030672	A_38_P00030672	mir|ame-miR-3723|mir|MIMAT0018589	ame-miR-3723	MIMAT0018589	unmapped	CGCTCGGGTTTTCCCGAGCGGTACGAAAACTTTGAAACGCATTTTTTTTT
A_38_P00030673	A_38_P00030673	mir|ame-miR-3741|mir|MIMAT0018610	ame-miR-3741	MIMAT0018610	unmapped	CGCTCGGGTTTTCCCGAGCGGTACTTCTCTCTCCCCTATTTTTTTT
A_38_P00030674	A_38_P00030674	mir|ame-miR-3741|mir|MIMAT0018610	ame-miR-3741	MIMAT0018610	unmapped	CGCTCGGGTTTTCCCGAGCGGTACTTCTCTCTCCCCCATTTTTTTTT
A_38_P00030675	A_38_P00030675	mir|ame-miR-3716a|mir|MIMAT0018601	ame-miR-3716a	MIMAT0018601	unmapped	CGCTCGGGTTTTCCCGAGCGGTATATGATTTCAAATCCACAATTTTTTTTT
A_38_P00030676	A_38_P00030676	mir|ame-miR-3716a|mir|MIMAT0018601	ame-miR-3716a	MIMAT0018601	unmapped	CGCTCGGGTTTTCCCGAGCGGTATATGATTTCAAATCCACATTTTTTTTTTT
A_38_P00030677	A_38_P00030677	mir|ame-miR-3716a|mir|MIMAT0018601	ame-miR-3716a	MIMAT0018601	unmapped	CGCTCGGGTTTTCCCGAGCGGTATATGATTTCAAATCCACATATTTTTTTTTT
A_38_P00030678	A_38_P00030678	mir|ame-miR-3724|mir|MIMAT0018590	ame-miR-3724	MIMAT0018590	unmapped	CGCTCGGGTTTTCCCGAGCGGTATATTCAAAGTTTACCACGTATTTTTTTT
A_38_P00030679	A_38_P00030679	mir|ame-miR-3724|mir|MIMAT0018590	ame-miR-3724	MIMAT0018590	unmapped	CGCTCGGGTTTTCCCGAGCGGTATATTCAAAGTTTACCACGAATTTTTTTTT
A_38_P00030680	A_38_P00030680	mir|ame-miR-3762|mir|MIMAT0018535	ame-miR-3762	MIMAT0018535	unmapped	CGCTCGGGTTTTCCCGAGCGGTATCATCTAATTTACAGATTATTTTTTTT
A_38_P00030681	A_38_P00030681	mir|ame-miR-3762|mir|MIMAT0018535	ame-miR-3762	MIMAT0018535	unmapped	CGCTCGGGTTTTCCCGAGCGGTATCATCTAATTTACAGATCAATTTTTTTT
A_38_P00030682	A_38_P00030682	mir|ame-miR-3762|mir|MIMAT0018535	ame-miR-3762	MIMAT0018535	unmapped	CGCTCGGGTTTTCCCGAGCGGTATCATCTAATTTACAGATCTATTTTTTTTT
A_38_P00030683	A_38_P00030683	mir|ame-miR-3762|mir|MIMAT0018535	ame-miR-3762	MIMAT0018535	unmapped	CGCTCGGGTTTTCCCGAGCGGTATCATCTAATTTACAGATCTTTTTTTTTTTT
A_38_P00030684	A_38_P00030684	mir|ame-miR-3800|mir|MIMAT0018587	ame-miR-3800	MIMAT0018587	unmapped	CGCTCGGGTTTTCCCGAGCGGTATGGCACAATCAGCTTTTTTTTTT
A_38_P00030685	A_38_P00030685	mir|ame-miR-3800|mir|MIMAT0018587	ame-miR-3800	MIMAT0018587	unmapped	CGCTCGGGTTTTCCCGAGCGGTATGGCACAATCAGCGTTTTTTTTTT
A_38_P00030686	A_38_P00030686	mir|ame-miR-3775|mir|MIMAT0018552	ame-miR-3775	MIMAT0018552	unmapped	CGCTCGGGTTTTCCCGAGCGGTATTCAACCTCCTCATCTTTTTTTTTT
A_38_P00030687	A_38_P00030687	mir|ame-miR-3775|mir|MIMAT0018552	ame-miR-3775	MIMAT0018552	unmapped	CGCTCGGGTTTTCCCGAGCGGTATTCAACCTCCTCATCCTTTTTTTTTT
A_38_P00030688	A_38_P00030688	mir|ame-miR-3747a|mir|MIMAT0018515	ame-miR-3747a	MIMAT0018515	unmapped	CGCTCGGGTTTTCCCGAGCGGTCATCGCTGAAAAAAAGTTTTTTTTTT
A_38_P00030689	A_38_P00030689	mir|ame-miR-3747a|mir|MIMAT0018515	ame-miR-3747a	MIMAT0018515	unmapped	CGCTCGGGTTTTCCCGAGCGGTCATCGCTGAAAAAAAGCTATTTTTTTT
A_38_P00030690	A_38_P00030690	mir|ame-miR-3777|mir|MIMAT0018554	ame-miR-3777	MIMAT0018554	unmapped	CGCTCGGGTTTTCCCGAGCGGTCCCAGGGAAGAAATGAATTTTTTTT
A_38_P00030691	A_38_P00030691	mir|ame-miR-3777|mir|MIMAT0018554	ame-miR-3777	MIMAT0018554	unmapped	CGCTCGGGTTTTCCCGAGCGGTCCCAGGGAAGAAATGTAATTTTTTTT
A_38_P00030692	A_38_P00030692	mir|ame-miR-3756|mir|MIMAT0018527	ame-miR-3756	MIMAT0018527	unmapped	CGCTCGGGTTTTCCCGAGCGGTCCTCCTTATGAAAGAAAATTTTTTTTT
A_38_P00030693	A_38_P00030693	mir|ame-miR-3756|mir|MIMAT0018527	ame-miR-3756	MIMAT0018527	unmapped	CGCTCGGGTTTTCCCGAGCGGTCCTCCTTATGAAAGAAATTTTTTTTTTT
A_38_P00030694	A_38_P00030694	mir|ame-miR-3756|mir|MIMAT0018527	ame-miR-3756	MIMAT0018527	unmapped	CGCTCGGGTTTTCCCGAGCGGTCCTCCTTATGAAAGAAATCTTTTTTTTTT
A_38_P00030695	A_38_P00030695	mir|ame-miR-3792|mir|MIMAT0018575	ame-miR-3792	MIMAT0018575	unmapped	CGCTCGGGTTTTCCCGAGCGGTCCTTCTCTCTTTCCTCTTTTTTTTTT
A_38_P00030696	A_38_P00030696	mir|ame-miR-3792|mir|MIMAT0018575	ame-miR-3792	MIMAT0018575	unmapped	CGCTCGGGTTTTCCCGAGCGGTCCTTCTCTCTTTCCTCATATTTTTTTT
A_38_P00030697	A_38_P00030697	mir|ame-miR-3719|mir|MIMAT0018531	ame-miR-3719	MIMAT0018531	unmapped	CGCTCGGGTTTTCCCGAGCGGTCGAAAAGTCACGCATATTTTTTTT
A_38_P00030698	A_38_P00030698	mir|ame-miR-3719|mir|MIMAT0018531	ame-miR-3719	MIMAT0018531	unmapped	CGCTCGGGTTTTCCCGAGCGGTCGAAAAGTCACGCAAATTTTTTTTT
A_38_P00030699	A_38_P00030699	mir|ame-miR-307|mir|MIMAT0018509	ame-miR-307	MIMAT0018509	unmapped	CGCTCGGGTTTTCCCGAGCGGTCGCTCACTCAAAAAGTATTTTTTTT
A_38_P00030700	A_38_P00030700	mir|ame-miR-307|mir|MIMAT0018509	ame-miR-307	MIMAT0018509	unmapped	CGCTCGGGTTTTCCCGAGCGGTCGCTCACTCAAAAAGGAATTTTTTTT
A_38_P00030701	A_38_P00030701	mir|ame-miR-3718b|mir|MIMAT0018526	ame-miR-3718b	MIMAT0018526	unmapped	CGCTCGGGTTTTCCCGAGCGGTCTGTCCCCTGTCCATTTTTTTTT
A_38_P00030702	A_38_P00030702	mir|ame-miR-3718b|mir|MIMAT0018526	ame-miR-3718b	MIMAT0018526	unmapped	CGCTCGGGTTTTCCCGAGCGGTCTGTCCCCTGTCCTTATTTTTTTT
A_38_P00030703	A_38_P00030703	mir|ame-miR-3765|mir|MIMAT0018539	ame-miR-3765	MIMAT0018539	unmapped	CGCTCGGGTTTTCCCGAGCGGTCTTTCAACTTGCCTTTATTTTTTTTT
A_38_P00030704	A_38_P00030704	mir|ame-miR-3765|mir|MIMAT0018539	ame-miR-3765	MIMAT0018539	unmapped	CGCTCGGGTTTTCCCGAGCGGTCTTTCAACTTGCCTTTTTATTTTTTTT
A_38_P00030705	A_38_P00030705	mir|ame-miR-3729|mir|MIMAT0018596	ame-miR-3729	MIMAT0018596	unmapped	CGCTCGGGTTTTCCCGAGCGGTGCAAGTGAGTTGGGTTTTTTTTTT
A_38_P00030706	A_38_P00030706	mir|ame-miR-3729|mir|MIMAT0018596	ame-miR-3729	MIMAT0018596	unmapped	CGCTCGGGTTTTCCCGAGCGGTGCAAGTGAGTTGGGATTTTTTTTTT
A_38_P00030707	A_38_P00030707	mir|ame-miR-9c|mir|MIMAT0018572	ame-miR-9c	MIMAT0018572	unmapped	CGCTCGGGTTTTCCCGAGCGGTGCCTTGCTGAACTAGTATTTTTTTT
A_38_P00030708	A_38_P00030708	mir|ame-miR-9c|mir|MIMAT0018572	ame-miR-9c	MIMAT0018572	unmapped	CGCTCGGGTTTTCCCGAGCGGTGCCTTGCTGAACTAGCAATTTTTTTT
A_38_P00030709	A_38_P00030709	mir|ame-miR-279c|mir|MIMAT0018586	ame-miR-279c	MIMAT0018586	unmapped	CGCTCGGGTTTTCCCGAGCGGTGGACGAGTGTGACTTATTTTTTTT
A_38_P00030710	A_38_P00030710	mir|ame-miR-279c|mir|MIMAT0018586	ame-miR-279c	MIMAT0018586	unmapped	CGCTCGGGTTTTCCCGAGCGGTGGACGAGTGTGACTCATTTTTTTTT
A_38_P00030711	A_38_P00030711	mir|ame-miR-3791|mir|MIMAT0018570	ame-miR-3791	MIMAT0018570	unmapped	CGCTCGGGTTTTCCCGAGCGGTGGATGAATCCTACCCTTTTTTTTTT
A_38_P00030712	A_38_P00030712	mir|ame-miR-3791|mir|MIMAT0018570	ame-miR-3791	MIMAT0018570	unmapped	CGCTCGGGTTTTCCCGAGCGGTGGATGAATCCTACCCGTATTTTTTTT
A_38_P00030713	A_38_P00030713	mir|ame-miR-980|mir|MIMAT0018614	ame-miR-980	MIMAT0018614	unmapped	CGCTCGGGTTTTCCCGAGCGGTGTTGCCCTTCAAAAGTTTTTTTTTT
A_38_P00030714	A_38_P00030714	mir|ame-miR-980|mir|MIMAT0018614	ame-miR-980	MIMAT0018614	unmapped	CGCTCGGGTTTTCCCGAGCGGTGTTGCCCTTCAAAAGGTTTTTTTTTT
A_38_P00030715	A_38_P00030715	mir|ame-miR-3764|mir|MIMAT0018537	ame-miR-3764	MIMAT0018537	unmapped	CGCTCGGGTTTTCCCGAGCGGTTAAGATCAAAGAAAAATTATTTTTTTT
A_38_P00030716	A_38_P00030716	mir|ame-miR-3764|mir|MIMAT0018537	ame-miR-3764	MIMAT0018537	unmapped	CGCTCGGGTTTTCCCGAGCGGTTAAGATCAAAGAAAAATCATTTTTTTTT
A_38_P00030717	A_38_P00030717	mir|ame-miR-3764|mir|MIMAT0018537	ame-miR-3764	MIMAT0018537	unmapped	CGCTCGGGTTTTCCCGAGCGGTTAAGATCAAAGAAAAATCTTTTTTTTTTT
A_38_P00030718	A_38_P00030718	mir|ame-miR-3764|mir|MIMAT0018537	ame-miR-3764	MIMAT0018537	unmapped	CGCTCGGGTTTTCCCGAGCGGTTAAGATCAAAGAAAAATCTATTTTTTTTTT
A_38_P00030719	A_38_P00030719	mir|ame-miR-3740|mir|MIMAT0018609	ame-miR-3740	MIMAT0018609	unmapped	CGCTCGGGTTTTCCCGAGCGGTTAATCCTCGTCATCCTAATTTTTTTT
A_38_P00030720	A_38_P00030720	mir|ame-miR-3740|mir|MIMAT0018609	ame-miR-3740	MIMAT0018609	unmapped	CGCTCGGGTTTTCCCGAGCGGTTAATCCTCGTCATCCTTAATTTTTTTT
A_38_P00030721	A_38_P00030721	mir|ame-miR-3773|mir|MIMAT0018549	ame-miR-3773	MIMAT0018549	unmapped	CGCTCGGGTTTTCCCGAGCGGTTACAGACAAGAGCTGTTTTTTTTTTT
A_38_P00030722	A_38_P00030722	mir|ame-miR-3773|mir|MIMAT0018549	ame-miR-3773	MIMAT0018549	unmapped	CGCTCGGGTTTTCCCGAGCGGTTACAGACAAGAGCTGTGTATTTTTTTT
A_38_P00030723	A_38_P00030723	mir|ame-miR-3727|mir|MIMAT0018594	ame-miR-3727	MIMAT0018594	unmapped	CGCTCGGGTTTTCCCGAGCGGTTAGCGGGAGCGCTATTTTTTTT
A_38_P00030724	A_38_P00030724	mir|ame-miR-3727|mir|MIMAT0018594	ame-miR-3727	MIMAT0018594	unmapped	CGCTCGGGTTTTCCCGAGCGGTTAGCGGGAGCGCGAATTTTTTTT
A_38_P00030725	A_38_P00030725	mir|ame-miR-3787|mir|MIMAT0018566	ame-miR-3787	MIMAT0018566	unmapped	CGCTCGGGTTTTCCCGAGCGGTTCCACACACAAGCTTTTTTTTTTT
A_38_P00030726	A_38_P00030726	mir|ame-miR-3787|mir|MIMAT0018566	ame-miR-3787	MIMAT0018566	unmapped	CGCTCGGGTTTTCCCGAGCGGTTCCACACACAAGCTCTTTTTTTTTT
A_38_P00030727	A_38_P00030727	mir|ame-miR-3752|mir|MIMAT0018522	ame-miR-3752	MIMAT0018522	unmapped	CGCTCGGGTTTTCCCGAGCGGTTCGCAAGGAAACTTTTATTTTTTTT
A_38_P00030728	A_38_P00030728	mir|ame-miR-3752|mir|MIMAT0018522	ame-miR-3752	MIMAT0018522	unmapped	CGCTCGGGTTTTCCCGAGCGGTTCGCAAGGAAACTTTAATTTTTTTTT
A_38_P00030729	A_38_P00030729	mir|ame-miR-3752|mir|MIMAT0018522	ame-miR-3752	MIMAT0018522	unmapped	CGCTCGGGTTTTCCCGAGCGGTTCGCAAGGAAACTTTATTTTTTTTTTT
A_38_P00030730	A_38_P00030730	mir|ame-miR-3752|mir|MIMAT0018522	ame-miR-3752	MIMAT0018522	unmapped	CGCTCGGGTTTTCCCGAGCGGTTCGCAAGGAAACTTTATCTTTTTTTTTT
A_38_P00030731	A_38_P00030731	mir|ame-miR-3772|mir|MIMAT0018548	ame-miR-3772	MIMAT0018548	unmapped	CGCTCGGGTTTTCCCGAGCGGTTCGTTCCTTCTCAATCATTTTTTTTT
A_38_P00030732	A_38_P00030732	mir|ame-miR-3772|mir|MIMAT0018548	ame-miR-3772	MIMAT0018548	unmapped	CGCTCGGGTTTTCCCGAGCGGTTCGTTCCTTCTCAATCTTTTTTTTTTT
A_38_P00030733	A_38_P00030733	mir|ame-miR-193|mir|MIMAT0018508	ame-miR-193	MIMAT0018508	unmapped	CGCTCGGGTTTTCCCGAGCGGTTGGGACTTAGCAGGTTTTTTTTTT
A_38_P00030734	A_38_P00030734	mir|ame-miR-193|mir|MIMAT0018508	ame-miR-193	MIMAT0018508	unmapped	CGCTCGGGTTTTCCCGAGCGGTTGGGACTTAGCAGGCTTTTTTTTTT
A_38_P00030735	A_38_P00030735	mir|ame-miR-2788|mir|MIMAT0018510	ame-miR-2788	MIMAT0018510	unmapped	CGCTCGGGTTTTCCCGAGCGGTTTGGGATTTCGAAGGTTTTTTTTTT
A_38_P00030736	A_38_P00030736	mir|ame-miR-2788|mir|MIMAT0018510	ame-miR-2788	MIMAT0018510	unmapped	CGCTCGGGTTTTCCCGAGCGGTTTGGGATTTCGAAGGGTTTTTTTTTT
A_38_P00030808	A_38_P00030808	mir|tca-miR-3804a-5p|mir|MIMAT0018624	tca-miR-3804a-5p	MIMAT0018624	unmapped	CGCTCGGGTTTTCCCGAGCGGAAAAACGTGGACATTGAATTTTTTTTT
A_38_P00030809	A_38_P00030809	mir|tca-miR-3804a-5p|mir|MIMAT0018624	tca-miR-3804a-5p	MIMAT0018624	unmapped	CGCTCGGGTTTTCCCGAGCGGAAAAACGTGGACATTGATTATTTTTTTT
A_38_P00030810	A_38_P00030810	mir|tca-miR-3813-5p|mir|MIMAT0018648	tca-miR-3813-5p	MIMAT0018648	unmapped	CGCTCGGGTTTTCCCGAGCGGAAAACGTCGAAAAGAGTTTTTTTTTT
A_38_P00030811	A_38_P00030811	mir|tca-miR-3813-5p|mir|MIMAT0018648	tca-miR-3813-5p	MIMAT0018648	unmapped	CGCTCGGGTTTTCCCGAGCGGAAAACGTCGAAAAGAGCTTTTTTTTTT
A_38_P00030814	A_38_P00030814	mir|tca-miR-3885-3p|mir|MIMAT0018869	tca-miR-3885-3p	MIMAT0018869	unmapped	CGCTCGGGTTTTCCCGAGCGGAAACGTAAAAACAAAACCTTTTTTTTTT
A_38_P00030815	A_38_P00030815	mir|tca-miR-3885-3p|mir|MIMAT0018869	tca-miR-3885-3p	MIMAT0018869	unmapped	CGCTCGGGTTTTCCCGAGCGGAAACGTAAAAACAAAACCCTTTTTTTTTT
A_38_P00030816	A_38_P00030816	mir|tca-miR-3881-5p|mir|MIMAT0018858	tca-miR-3881-5p	MIMAT0018858	unmapped	CGCTCGGGTTTTCCCGAGCGGAAAGACTCAACATAATTTAAACATTTTTTTTT
A_38_P00030817	A_38_P00030817	mir|tca-miR-3881-5p|mir|MIMAT0018858	tca-miR-3881-5p	MIMAT0018858	unmapped	CGCTCGGGTTTTCCCGAGCGGAAAGACTCAACATAATTTAAACTTTTTTTTTTT
A_38_P00030818	A_38_P00030818	mir|tca-miR-3824-5p|mir|MIMAT0018674	tca-miR-3824-5p	MIMAT0018674	unmapped	CGCTCGGGTTTTCCCGAGCGGAAATAGTCGAACCAATTTTTTTTTTTTTT
A_38_P00030819	A_38_P00030819	mir|tca-miR-3824-5p|mir|MIMAT0018674	tca-miR-3824-5p	MIMAT0018674	unmapped	CGCTCGGGTTTTCCCGAGCGGAAATAGTCGAACCAATTTTATTTTTTTTTT
A_38_P00030820	A_38_P00030820	mir|tca-miR-3824-5p|mir|MIMAT0018674	tca-miR-3824-5p	MIMAT0018674	unmapped	CGCTCGGGTTTTCCCGAGCGGAAATAGTCGAACCAATTTTACTTTTTTTTTT
A_38_P00030821	A_38_P00030821	mir|tca-miR-3825-5p|mir|MIMAT0018678	tca-miR-3825-5p	MIMAT0018678	unmapped	CGCTCGGGTTTTCCCGAGCGGAAATAGTGCAGAAGAAGAATTTTTTTTTT
A_38_P00030822	A_38_P00030822	mir|tca-miR-3825-5p|mir|MIMAT0018678	tca-miR-3825-5p	MIMAT0018678	unmapped	CGCTCGGGTTTTCCCGAGCGGAAATAGTGCAGAAGAAGAAATTTTTTTTTT
A_38_P00030823	A_38_P00030823	mir|tca-miR-2788-5p|mir|MIMAT0018798	tca-miR-2788-5p	MIMAT0018798	unmapped	CGCTCGGGTTTTCCCGAGCGGAAATGCCGCTAAGAAACTTTTTTTTTT
A_38_P00030824	A_38_P00030824	mir|tca-miR-2788-5p|mir|MIMAT0018798	tca-miR-2788-5p	MIMAT0018798	unmapped	CGCTCGGGTTTTCCCGAGCGGAAATGCCGCTAAGAAACCTTTTTTTTTT
A_38_P00030825	A_38_P00030825	mir|tca-miR-3868-3p|mir|MIMAT0018829	tca-miR-3868-3p	MIMAT0018829	unmapped	CGCTCGGGTTTTCCCGAGCGGAAATTAAACTTTAGTTGATTTTTTTTTTT
A_38_P00030826	A_38_P00030826	mir|tca-miR-3847-5p|mir|MIMAT0018742	tca-miR-3847-5p	MIMAT0018742	unmapped	CGCTCGGGTTTTCCCGAGCGGAAATTAAATAAAAAGTTCGTTTTTTTTTT
A_38_P00030827	A_38_P00030827	mir|tca-miR-3847-5p|mir|MIMAT0018742	tca-miR-3847-5p	MIMAT0018742	unmapped	CGCTCGGGTTTTCCCGAGCGGAAATTAAATAAAAAGTTCGATTTTTTTTTT
A_38_P00030828	A_38_P00030828	mir|tca-miR-3847-5p|mir|MIMAT0018742	tca-miR-3847-5p	MIMAT0018742	unmapped	CGCTCGGGTTTTCCCGAGCGGAAATTAAATAAAAAGTTCGAATTTTTTTTTT
A_38_P00030829	A_38_P00030829	mir|tca-miR-3821-5p|mir|MIMAT0018668	tca-miR-3821-5p	MIMAT0018668	unmapped	CGCTCGGGTTTTCCCGAGCGGAAATTCCTAAGAGGAGGAATTTTTTTTT
A_38_P00030830	A_38_P00030830	mir|tca-miR-3821-5p|mir|MIMAT0018668	tca-miR-3821-5p	MIMAT0018668	unmapped	CGCTCGGGTTTTCCCGAGCGGAAATTCCTAAGAGGAGGATTTTTTTTTTT
A_38_P00030831	A_38_P00030831	mir|tca-miR-317-5p|mir|MIMAT0019130	tca-miR-317-5p	MIMAT0019130	unmapped	CGCTCGGGTTTTCCCGAGCGGAACACAGGGTGGTCTTTTTTTTTT
A_38_P00030832	A_38_P00030832	mir|tca-miR-317-5p|mir|MIMAT0019130	tca-miR-317-5p	MIMAT0019130	unmapped	CGCTCGGGTTTTCCCGAGCGGAACACAGGGTGGTCCTTTTTTTTTT
A_38_P00030833	A_38_P00030833	mir|tca-miR-3811d-5p|mir|MIMAT0018650	tca-miR-3811d-5p	MIMAT0018650	unmapped	CGCTCGGGTTTTCCCGAGCGGAACATGTAAACCCTGAGTTTTTTTTTT
A_38_P00030834	A_38_P00030834	mir|tca-miR-3811d-5p|mir|MIMAT0018650	tca-miR-3811d-5p	MIMAT0018650	unmapped	CGCTCGGGTTTTCCCGAGCGGAACATGTAAACCCTGAGATTTTTTTTTT
A_38_P00030835	A_38_P00030835	mir|tca-miR-2c-5p|mir|MIMAT0019093	tca-miR-2c-5p	MIMAT0019093	unmapped	CGCTCGGGTTTTCCCGAGCGGAACCGCCAACTCTGTATTTTTTTT
A_38_P00030836	A_38_P00030836	mir|tca-miR-2c-5p|mir|MIMAT0019093	tca-miR-2c-5p	MIMAT0019093	unmapped	CGCTCGGGTTTTCCCGAGCGGAACCGCCAACTCTGAATTTTTTTTT
A_38_P00030837	A_38_P00030837	mir|tca-miR-3847-3p|mir|MIMAT0018743	tca-miR-3847-3p	MIMAT0018743	unmapped	CGCTCGGGTTTTCCCGAGCGGAACCTGATCGAAATTCGTTTTTTTTTT
A_38_P00030838	A_38_P00030838	mir|tca-miR-3847-3p|mir|MIMAT0018743	tca-miR-3847-3p	MIMAT0018743	unmapped	CGCTCGGGTTTTCCCGAGCGGAACCTGATCGAAATTCGATTTTTTTTTT
A_38_P00030839	A_38_P00030839	mir|tca-miR-3873-5p|mir|MIMAT0018838	tca-miR-3873-5p	MIMAT0018838	unmapped	CGCTCGGGTTTTCCCGAGCGGAACCTTATAACATTCGGTTTTTTTTTT
A_38_P00030840	A_38_P00030840	mir|tca-miR-3873-5p|mir|MIMAT0018838	tca-miR-3873-5p	MIMAT0018838	unmapped	CGCTCGGGTTTTCCCGAGCGGAACCTTATAACATTCGGCTTTTTTTTTT
A_38_P00030841	A_38_P00030841	mir|tca-miR-3804b-5p|mir|MIMAT0018626	tca-miR-3804b-5p	MIMAT0018626	unmapped	CGCTCGGGTTTTCCCGAGCGGAAGAATGTGGACATTGTTTATTTTTTTT
A_38_P00030842	A_38_P00030842	mir|tca-miR-3804b-5p|mir|MIMAT0018626	tca-miR-3804b-5p	MIMAT0018626	unmapped	CGCTCGGGTTTTCCCGAGCGGAAGAATGTGGACATTGTTGATTTTTTTTT
A_38_P00030843	A_38_P00030843	mir|tca-miR-993-5p|mir|MIMAT0019182	tca-miR-993-5p	MIMAT0019182	unmapped	CGCTCGGGTTTTCCCGAGCGGAAGCCCGGATCTACATTTTTTTTTT
A_38_P00030844	A_38_P00030844	mir|tca-miR-993-5p|mir|MIMAT0019182	tca-miR-993-5p	MIMAT0019182	unmapped	CGCTCGGGTTTTCCCGAGCGGAAGCCCGGATCTACAGTTTTTTTTTT
A_38_P00030845	A_38_P00030845	mir|tca-miR-3898-3p|mir|MIMAT0018901	tca-miR-3898-3p	MIMAT0018901	unmapped	CGCTCGGGTTTTCCCGAGCGGAAGTAACATCCCGGTTTTTTTTTTTT
A_38_P00030846	A_38_P00030846	mir|tca-miR-3898-3p|mir|MIMAT0018901	tca-miR-3898-3p	MIMAT0018901	unmapped	CGCTCGGGTTTTCCCGAGCGGAAGTAACATCCCGGTTCTATTTTTTTT
A_38_P00030847	A_38_P00030847	mir|tca-miR-3868-5p|mir|MIMAT0018828	tca-miR-3868-5p	MIMAT0018828	unmapped	CGCTCGGGTTTTCCCGAGCGGAATACATACTGGTGCTGTATTTTTTTT
A_38_P00030848	A_38_P00030848	mir|tca-miR-3868-5p|mir|MIMAT0018828	tca-miR-3868-5p	MIMAT0018828	unmapped	CGCTCGGGTTTTCCCGAGCGGAATACATACTGGTGCTGGATTTTTTTTT
A_38_P00030849	A_38_P00030849	mir|tca-miR-3811a-5p|mir|MIMAT0018684	tca-miR-3811a-5p	MIMAT0018684	unmapped	CGCTCGGGTTTTCCCGAGCGGAATATGTAAACTCTGAGCATTTTTTTTTT
A_38_P00030850	A_38_P00030850	mir|tca-miR-3811a-5p|mir|MIMAT0018684	tca-miR-3811a-5p	MIMAT0018684	unmapped	CGCTCGGGTTTTCCCGAGCGGAATATGTAAACTCTGAGCAATTTTTTTTTT
A_38_P00030851	A_38_P00030851	mir|tca-miR-3811a-5p|mir|MIMAT0018684	tca-miR-3811a-5p	MIMAT0018684	unmapped	CGCTCGGGTTTTCCCGAGCGGAATATGTAAACTCTGAGCAAGTTTTTTTTTT
A_38_P00030852	A_38_P00030852	mir|tca-miR-3808-5p|mir|MIMAT0018638	tca-miR-3808-5p	MIMAT0018638	unmapped	CGCTCGGGTTTTCCCGAGCGGAATATGTCAAGTGCGAATTATTTTTTTT
A_38_P00030853	A_38_P00030853	mir|tca-miR-3808-5p|mir|MIMAT0018638	tca-miR-3808-5p	MIMAT0018638	unmapped	CGCTCGGGTTTTCCCGAGCGGAATATGTCAAGTGCGAATAATTTTTTTTT
A_38_P00030854	A_38_P00030854	mir|tca-miR-3808-5p|mir|MIMAT0018638	tca-miR-3808-5p	MIMAT0018638	unmapped	CGCTCGGGTTTTCCCGAGCGGAATATGTCAAGTGCGAATATTTTTTTTTTT
A_38_P00030855	A_38_P00030855	mir|tca-miR-3808-5p|mir|MIMAT0018638	tca-miR-3808-5p	MIMAT0018638	unmapped	CGCTCGGGTTTTCCCGAGCGGAATATGTCAAGTGCGAATATGTTTTTTTTTT
A_38_P00030856	A_38_P00030856	mir|tca-miR-3823-5p|mir|MIMAT0018672	tca-miR-3823-5p	MIMAT0018672	unmapped	CGCTCGGGTTTTCCCGAGCGGAATGCCAAAACCACGTTTTTTTTTT
A_38_P00030857	A_38_P00030857	mir|tca-miR-3823-5p|mir|MIMAT0018672	tca-miR-3823-5p	MIMAT0018672	unmapped	CGCTCGGGTTTTCCCGAGCGGAATGCCAAAACCACGATTTTTTTTTT
A_38_P00030858	A_38_P00030858	mir|tca-miR-3894-3p|mir|MIMAT0018891	tca-miR-3894-3p	MIMAT0018891	unmapped	CGCTCGGGTTTTCCCGAGCGGAATTAATTCCAATAAACCGTTTTTTTTTT
A_38_P00030859	A_38_P00030859	mir|tca-miR-3894-3p|mir|MIMAT0018891	tca-miR-3894-3p	MIMAT0018891	unmapped	CGCTCGGGTTTTCCCGAGCGGAATTAATTCCAATAAACCGCTTTTTTTTTT
A_38_P00030860	A_38_P00030860	mir|tca-miR-9b-5p|mir|MIMAT0019134	tca-miR-9b-5p	MIMAT0019134	unmapped	CGCTCGGGTTTTCCCGAGCGGACAAACGCTAAATTACCATTTTTTTTTT
A_38_P00030861	A_38_P00030861	mir|tca-miR-9b-5p|mir|MIMAT0019134	tca-miR-9b-5p	MIMAT0019134	unmapped	CGCTCGGGTTTTCCCGAGCGGACAAACGCTAAATTACCAATTTTTTTTTT
A_38_P00030862	A_38_P00030862	mir|tca-miR-3878-5p|mir|MIMAT0018848	tca-miR-3878-5p	MIMAT0018848	unmapped	CGCTCGGGTTTTCCCGAGCGGACAATTAGTTCTCCGTCTTTTTTTTTT
A_38_P00030863	A_38_P00030863	mir|tca-miR-3878-5p|mir|MIMAT0018848	tca-miR-3878-5p	MIMAT0018848	unmapped	CGCTCGGGTTTTCCCGAGCGGACAATTAGTTCTCCGTCCTTTTTTTTTT
A_38_P00030864	A_38_P00030864	mir|tca-miR-3846-5p|mir|MIMAT0018740	tca-miR-3846-5p	MIMAT0018740	unmapped	CGCTCGGGTTTTCCCGAGCGGACACAAAGACTTATAAGCCTTTTTTTTTT
A_38_P00030865	A_38_P00030865	mir|tca-miR-3846-5p|mir|MIMAT0018740	tca-miR-3846-5p	MIMAT0018740	unmapped	CGCTCGGGTTTTCCCGAGCGGACACAAAGACTTATAAGCCATTTTTTTTTT
A_38_P00030866	A_38_P00030866	mir|tca-miR-3832-5p|mir|MIMAT0018694	tca-miR-3832-5p	MIMAT0018694	unmapped	CGCTCGGGTTTTCCCGAGCGGACACACCAGAATCATTTCTTTTTTTTTT
A_38_P00030867	A_38_P00030867	mir|tca-miR-3832-5p|mir|MIMAT0018694	tca-miR-3832-5p	MIMAT0018694	unmapped	CGCTCGGGTTTTCCCGAGCGGACACACCAGAATCATTTCGTTTTTTTTTT
A_38_P00030868	A_38_P00030868	mir|tca-miR-3832-3p|mir|MIMAT0018695	tca-miR-3832-3p	MIMAT0018695	unmapped	CGCTCGGGTTTTCCCGAGCGGACAGGAGAAACGATTTTTTTTTTTTTT
A_38_P00030869	A_38_P00030869	mir|tca-miR-3832-3p|mir|MIMAT0018695	tca-miR-3832-3p	MIMAT0018695	unmapped	CGCTCGGGTTTTCCCGAGCGGACAGGAGAAACGATTTTGTATTTTTTTT
A_38_P00030870	A_38_P00030870	mir|tca-miR-11-5p|mir|MIMAT0018854	tca-miR-11-5p	MIMAT0018854	unmapped	CGCTCGGGTTTTCCCGAGCGGACAGGTCACAGTCAGTTTTTTTTTT
A_38_P00030871	A_38_P00030871	mir|tca-miR-11-5p|mir|MIMAT0018854	tca-miR-11-5p	MIMAT0018854	unmapped	CGCTCGGGTTTTCCCGAGCGGACAGGTCACAGTCAGATATTTTTTTT
A_38_P00030872	A_38_P00030872	mir|tca-miR-3851d-3p|mir|MIMAT0018779	tca-miR-3851d-3p	MIMAT0018779	unmapped	CGCTCGGGTTTTCCCGAGCGGACAGTACCACCCCAATTTTTTTTT
A_38_P00030873	A_38_P00030873	mir|tca-miR-3851d-3p|mir|MIMAT0018779	tca-miR-3851d-3p	MIMAT0018779	unmapped	CGCTCGGGTTTTCCCGAGCGGACAGTACCACCCCATTATTTTTTTT
A_38_P00030874	A_38_P00030874	mir|tca-miR-3851d-3p|mir|MIMAT0018779	tca-miR-3851d-3p	MIMAT0018779	unmapped	CGCTCGGGTTTTCCCGAGCGGACAGTACCACCCCATGATTTTTTTTT
A_38_P00030875	A_38_P00030875	mir|tca-miR-3811c-5p|mir|MIMAT0018644	tca-miR-3811c-5p	MIMAT0018644	unmapped	CGCTCGGGTTTTCCCGAGCGGACATGTAAACCCTGAGTTTTTTTTTT
A_38_P00030876	A_38_P00030876	mir|tca-miR-3811c-5p|mir|MIMAT0018644	tca-miR-3811c-5p	MIMAT0018644	unmapped	CGCTCGGGTTTTCCCGAGCGGACATGTAAACCCTGAGCTTTTTTTTTT
A_38_P00030877	A_38_P00030877	mir|tca-miR-3815-5p|mir|MIMAT0018654	tca-miR-3815-5p	MIMAT0018654	unmapped	CGCTCGGGTTTTCCCGAGCGGACATTTGAGCATCCTACTTTTTTTTTT
A_38_P00030878	A_38_P00030878	mir|tca-miR-3815-5p|mir|MIMAT0018654	tca-miR-3815-5p	MIMAT0018654	unmapped	CGCTCGGGTTTTCCCGAGCGGACATTTGAGCATCCTACCTTTTTTTTTT
A_38_P00030879	A_38_P00030879	mir|tca-miR-3850-3p|mir|MIMAT0018755	tca-miR-3850-3p	MIMAT0018755	unmapped	CGCTCGGGTTTTCCCGAGCGGACCAACATTAGTCTCGATTTTTTTTTT
A_38_P00030880	A_38_P00030880	mir|tca-miR-3850-3p|mir|MIMAT0018755	tca-miR-3850-3p	MIMAT0018755	unmapped	CGCTCGGGTTTTCCCGAGCGGACCAACATTAGTCTCGAATTTTTTTTTT
A_38_P00030883	A_38_P00030883	mir|tca-miR-3879-5p|mir|MIMAT0018850	tca-miR-3879-5p	MIMAT0018850	unmapped	CGCTCGGGTTTTCCCGAGCGGACCGGCACACAATAATTTTTTTTTT
A_38_P00030884	A_38_P00030884	mir|tca-miR-3879-5p|mir|MIMAT0018850	tca-miR-3879-5p	MIMAT0018850	unmapped	CGCTCGGGTTTTCCCGAGCGGACCGGCACACAATAACTTTTTTTTTT
A_38_P00030885	A_38_P00030885	mir|tca-miR-184-5p|mir|MIMAT0019118	tca-miR-184-5p	MIMAT0019118	unmapped	CGCTCGGGTTTTCCCGAGCGGACCGGGCGAGAGTTTTTTTTTT
A_38_P00030886	A_38_P00030886	mir|tca-miR-184-5p|mir|MIMAT0019118	tca-miR-184-5p	MIMAT0019118	unmapped	CGCTCGGGTTTTCCCGAGCGGACCGGGCGAGAGATATTTTTTTT
A_38_P00030887	A_38_P00030887	mir|tca-miR-3896-3p|mir|MIMAT0018895	tca-miR-3896-3p	MIMAT0018895	unmapped	CGCTCGGGTTTTCCCGAGCGGACCTTATCCGTTTGCATATTTTTTTT
A_38_P00030888	A_38_P00030888	mir|tca-miR-3896-3p|mir|MIMAT0018895	tca-miR-3896-3p	MIMAT0018895	unmapped	CGCTCGGGTTTTCCCGAGCGGACCTTATCCGTTTGCAGAATTTTTTTT
A_38_P00030889	A_38_P00030889	mir|tca-miR-252b-5p|mir|MIMAT0018806	tca-miR-252b-5p	MIMAT0018806	unmapped	CGCTCGGGTTTTCCCGAGCGGACCTTCGGCGCATTTTTTTTTT
A_38_P00030890	A_38_P00030890	mir|tca-miR-252b-5p|mir|MIMAT0018806	tca-miR-252b-5p	MIMAT0018806	unmapped	CGCTCGGGTTTTCCCGAGCGGACCTTCGGCGCAATATTTTTTTT
A_38_P00030891	A_38_P00030891	mir|tca-miR-252b-5p|mir|MIMAT0018806	tca-miR-252b-5p	MIMAT0018806	unmapped	CGCTCGGGTTTTCCCGAGCGGACCTTCGGCGCAACATTTTTTTTT
A_38_P00030892	A_38_P00030892	mir|tca-miR-3901-3p|mir|MIMAT0018907	tca-miR-3901-3p	MIMAT0018907	unmapped	CGCTCGGGTTTTCCCGAGCGGACGTAATTGAAATATAAATTTTTTTTTTT
A_38_P00030893	A_38_P00030893	mir|tca-miR-3901-3p|mir|MIMAT0018907	tca-miR-3901-3p	MIMAT0018907	unmapped	CGCTCGGGTTTTCCCGAGCGGACGTAATTGAAATATAAATGTTTTTTTTTT
A_38_P00030894	A_38_P00030894	mir|tca-miR-3839-3p|mir|MIMAT0018723	tca-miR-3839-3p	MIMAT0018723	unmapped	CGCTCGGGTTTTCCCGAGCGGACGTAGGAAACGGCTTTTTTTTTT
A_38_P00030895	A_38_P00030895	mir|tca-miR-3839-3p|mir|MIMAT0018723	tca-miR-3839-3p	MIMAT0018723	unmapped	CGCTCGGGTTTTCCCGAGCGGACGTAGGAAACGGCATTTTTTTTTT
A_38_P00030896	A_38_P00030896	mir|tca-miR-3857-5p|mir|MIMAT0018774	tca-miR-3857-5p	MIMAT0018774	unmapped	CGCTCGGGTTTTCCCGAGCGGACGTGGGATAGTATCAATTTTTTTTTT
A_38_P00030897	A_38_P00030897	mir|tca-miR-3857-5p|mir|MIMAT0018774	tca-miR-3857-5p	MIMAT0018774	unmapped	CGCTCGGGTTTTCCCGAGCGGACGTGGGATAGTATCAAGTTTTTTTTTT
A_38_P00030898	A_38_P00030898	mir|tca-miR-3828-5p|mir|MIMAT0018686	tca-miR-3828-5p	MIMAT0018686	unmapped	CGCTCGGGTTTTCCCGAGCGGACTATCCTGCACTTCAGTTTTTTTTTT
A_38_P00030899	A_38_P00030899	mir|tca-miR-3828-5p|mir|MIMAT0018686	tca-miR-3828-5p	MIMAT0018686	unmapped	CGCTCGGGTTTTCCCGAGCGGACTATCCTGCACTTCAGATTTTTTTTTT
A_38_P00030900	A_38_P00030900	mir|tca-miR-3852-5p|mir|MIMAT0018760	tca-miR-3852-5p	MIMAT0018760	unmapped	CGCTCGGGTTTTCCCGAGCGGACTCCTTAAAGGCCCTTTTTTTTTT
A_38_P00030901	A_38_P00030901	mir|tca-miR-3852-5p|mir|MIMAT0018760	tca-miR-3852-5p	MIMAT0018760	unmapped	CGCTCGGGTTTTCCCGAGCGGACTCCTTAAAGGCCCCTATTTTTTTT
A_38_P00030902	A_38_P00030902	mir|tca-miR-932-5p|mir|MIMAT0008392	tca-miR-932-5p	MIMAT0008392	unmapped	CGCTCGGGTTTTCCCGAGCGGACTGCAATGCACTACGTTTTTTTTTT
A_38_P00030903	A_38_P00030903	mir|tca-miR-932-5p|mir|MIMAT0008392	tca-miR-932-5p	MIMAT0008392	unmapped	CGCTCGGGTTTTCCCGAGCGGACTGCAATGCACTACGGTTTTTTTTTT
A_38_P00030904	A_38_P00030904	mir|tca-miR-193-3p|mir|MIMAT0018897	tca-miR-193-3p	MIMAT0018897	unmapped	CGCTCGGGTTTTCCCGAGCGGACTTGGGACTTAACAGTTTTTTTTTT
A_38_P00030905	A_38_P00030905	mir|tca-miR-193-3p|mir|MIMAT0018897	tca-miR-193-3p	MIMAT0018897	unmapped	CGCTCGGGTTTTCCCGAGCGGACTTGGGACTTAACAGGTTTTTTTTTT
A_38_P00030906	A_38_P00030906	mir|tca-miR-219-5p|mir|MIMAT0008377	tca-miR-219-5p	MIMAT0008377	unmapped	CGCTCGGGTTTTCCCGAGCGGAGAATTGCGTTTGGACAATCTTTTTTTTTT
A_38_P00030907	A_38_P00030907	mir|tca-miR-219-5p|mir|MIMAT0008377	tca-miR-219-5p	MIMAT0008377	unmapped	CGCTCGGGTTTTCCCGAGCGGAGAATTGCGTTTGGACAATCATTTTTTTTTT
A_38_P00030908	A_38_P00030908	mir|tca-miR-309b-3p|mir|MIMAT0018887	tca-miR-309b-3p	MIMAT0018887	unmapped	CGCTCGGGTTTTCCCGAGCGGAGACAAACTCAACCCATATTTTTTTT
A_38_P00030909	A_38_P00030909	mir|tca-miR-309b-3p|mir|MIMAT0018887	tca-miR-309b-3p	MIMAT0018887	unmapped	CGCTCGGGTTTTCCCGAGCGGAGACAAACTCAACCCAGATTTTTTTTT
A_38_P00030910	A_38_P00030910	mir|tca-miR-282-5p|mir|MIMAT0008386	tca-miR-282-5p	MIMAT0008386	unmapped	CGCTCGGGTTTTCCCGAGCGGAGACAAAGCCTAGGAGTTTTTTTTTT
A_38_P00030911	A_38_P00030911	mir|tca-miR-282-5p|mir|MIMAT0008386	tca-miR-282-5p	MIMAT0008386	unmapped	CGCTCGGGTTTTCCCGAGCGGAGACAAAGCCTAGGAGATTTTTTTTTT
A_38_P00030912	A_38_P00030912	mir|tca-miR-3823-3p|mir|MIMAT0018673	tca-miR-3823-3p	MIMAT0018673	unmapped	CGCTCGGGTTTTCCCGAGCGGAGACCGTAGTCTGATATATTTTTTTTTT
A_38_P00030913	A_38_P00030913	mir|tca-miR-3823-3p|mir|MIMAT0018673	tca-miR-3823-3p	MIMAT0018673	unmapped	CGCTCGGGTTTTCCCGAGCGGAGACCGTAGTCTGATATACTTTTTTTTTT
A_38_P00030914	A_38_P00030914	mir|tca-miR-3836b-3p|mir|MIMAT0018711	tca-miR-3836b-3p	MIMAT0018711	unmapped	CGCTCGGGTTTTCCCGAGCGGAGAGTCTACCTTGCCTTTTTTTTTT
A_38_P00030915	A_38_P00030915	mir|tca-miR-3836b-3p|mir|MIMAT0018711	tca-miR-3836b-3p	MIMAT0018711	unmapped	CGCTCGGGTTTTCCCGAGCGGAGAGTCTACCTTGCCCTTTTTTTTTT
A_38_P00030916	A_38_P00030916	mir|tca-miR-3791-3p|mir|MIMAT0018883	tca-miR-3791-3p	MIMAT0018883	unmapped	CGCTCGGGTTTTCCCGAGCGGAGATGATTTCTACCCGGATTTTTTTTT
A_38_P00030917	A_38_P00030917	mir|tca-miR-3791-3p|mir|MIMAT0018883	tca-miR-3791-3p	MIMAT0018883	unmapped	CGCTCGGGTTTTCCCGAGCGGAGATGATTTCTACCCGGTTTTTTTTTTT
A_38_P00030918	A_38_P00030918	mir|tca-miR-3866-3p|mir|MIMAT0018825	tca-miR-3866-3p	MIMAT0018825	unmapped	CGCTCGGGTTTTCCCGAGCGGAGCACAGGATTATAACCTTTTTTTTTT
A_38_P00030919	A_38_P00030919	mir|tca-miR-3866-3p|mir|MIMAT0018825	tca-miR-3866-3p	MIMAT0018825	unmapped	CGCTCGGGTTTTCCCGAGCGGAGCACAGGATTATAACCGTTTTTTTTTT
A_38_P00030920	A_38_P00030920	mir|tca-miR-3849-5p|mir|MIMAT0018752	tca-miR-3849-5p	MIMAT0018752	unmapped	CGCTCGGGTTTTCCCGAGCGGAGCACTATGGTTAAAATGTTTTTTTTTTT
A_38_P00030921	A_38_P00030921	mir|tca-miR-3849-5p|mir|MIMAT0018752	tca-miR-3849-5p	MIMAT0018752	unmapped	CGCTCGGGTTTTCCCGAGCGGAGCACTATGGTTAAAATGTCTTTTTTTTTT
A_38_P00030922	A_38_P00030922	mir|tca-miR-3818-5p|mir|MIMAT0018660	tca-miR-3818-5p	MIMAT0018660	unmapped	CGCTCGGGTTTTCCCGAGCGGAGCATCATTGGAACGATTTTTTTTTT
A_38_P00030923	A_38_P00030923	mir|tca-miR-3818-5p|mir|MIMAT0018660	tca-miR-3818-5p	MIMAT0018660	unmapped	CGCTCGGGTTTTCCCGAGCGGAGCATCATTGGAACGAATTTTTTTTTT
A_38_P00030924	A_38_P00030924	mir|tca-miR-3872-3p|mir|MIMAT0018837	tca-miR-3872-3p	MIMAT0018837	unmapped	CGCTCGGGTTTTCCCGAGCGGAGCATGAACAATTAGTAAAATTTTTTTTTT
A_38_P00030925	A_38_P00030925	mir|tca-miR-3872-3p|mir|MIMAT0018837	tca-miR-3872-3p	MIMAT0018837	unmapped	CGCTCGGGTTTTCCCGAGCGGAGCATGAACAATTAGTAAAAATATTTTTTTT
A_38_P00030926	A_38_P00030926	mir|tca-miR-3872-3p|mir|MIMAT0018837	tca-miR-3872-3p	MIMAT0018837	unmapped	CGCTCGGGTTTTCCCGAGCGGAGCATGAACAATTAGTAAAAAAATTTTTTTTT
A_38_P00030927	A_38_P00030927	mir|tca-miR-309a-5p|mir|MIMAT0018750	tca-miR-309a-5p	MIMAT0018750	unmapped	CGCTCGGGTTTTCCCGAGCGGAGCCGAGTCGAGTTTTTTTTTTTT
A_38_P00030928	A_38_P00030928	mir|tca-miR-309a-5p|mir|MIMAT0018750	tca-miR-309a-5p	MIMAT0018750	unmapped	CGCTCGGGTTTTCCCGAGCGGAGCCGAGTCGAGTTCTATTTTTTTT
A_38_P00030929	A_38_P00030929	mir|tca-miR-3833-5p|mir|MIMAT0018696	tca-miR-3833-5p	MIMAT0018696	unmapped	CGCTCGGGTTTTCCCGAGCGGAGCCTGCTGTGACTATTTTTTTTT
A_38_P00030930	A_38_P00030930	mir|tca-miR-3833-5p|mir|MIMAT0018696	tca-miR-3833-5p	MIMAT0018696	unmapped	CGCTCGGGTTTTCCCGAGCGGAGCCTGCTGTGACTTTTTTTTTTTT
A_38_P00030931	A_38_P00030931	mir|tca-miR-3833-5p|mir|MIMAT0018696	tca-miR-3833-5p	MIMAT0018696	unmapped	CGCTCGGGTTTTCCCGAGCGGAGCCTGCTGTGACTTGTTTTTTTTTT
A_38_P00030932	A_38_P00030932	mir|tca-miR-965-5p|mir|MIMAT0019183	tca-miR-965-5p	MIMAT0019183	unmapped	CGCTCGGGTTTTCCCGAGCGGAGCGGTACAACTTTCTTTTTTTTTT
A_38_P00030933	A_38_P00030933	mir|tca-miR-965-5p|mir|MIMAT0019183	tca-miR-965-5p	MIMAT0019183	unmapped	CGCTCGGGTTTTCCCGAGCGGAGCGGTACAACTTTCCTTTTTTTTTT
A_38_P00030934	A_38_P00030934	mir|tca-miR-11-3p|mir|MIMAT0018855	tca-miR-11-3p	MIMAT0018855	unmapped	CGCTCGGGTTTTCCCGAGCGGAGCTAGAACTCTGCCTTATTTTTTTT
A_38_P00030935	A_38_P00030935	mir|tca-miR-11-3p|mir|MIMAT0018855	tca-miR-11-3p	MIMAT0018855	unmapped	CGCTCGGGTTTTCCCGAGCGGAGCTAGAACTCTGCCTGATTTTTTTTT
A_38_P00030936	A_38_P00030936	mir|tca-miR-31-5p|mir|MIMAT0008362	tca-miR-31-5p	MIMAT0008362	unmapped	CGCTCGGGTTTTCCCGAGCGGAGCTATGCCGACATCTATTTTTTTTT
A_38_P00030937	A_38_P00030937	mir|tca-miR-31-5p|mir|MIMAT0008362	tca-miR-31-5p	MIMAT0008362	unmapped	CGCTCGGGTTTTCCCGAGCGGAGCTATGCCGACATCTTTTTTTTTTTT
A_38_P00030938	A_38_P00030938	mir|tca-miR-87b-5p|mir|MIMAT0018768	tca-miR-87b-5p	MIMAT0018768	unmapped	CGCTCGGGTTTTCCCGAGCGGAGGAAAAACAAAGTTCAATTTTTTTTTT
A_38_P00030939	A_38_P00030939	mir|tca-miR-87b-5p|mir|MIMAT0018768	tca-miR-87b-5p	MIMAT0018768	unmapped	CGCTCGGGTTTTCCCGAGCGGAGGAAAAACAAAGTTCAAGTTTTTTTTTT
A_38_P00030940	A_38_P00030940	mir|tca-miR-3810-5p|mir|MIMAT0018642	tca-miR-3810-5p	MIMAT0018642	unmapped	CGCTCGGGTTTTCCCGAGCGGAGGACCAAATTCGTGTTTTTTTTTTT
A_38_P00030941	A_38_P00030941	mir|tca-miR-3810-5p|mir|MIMAT0018642	tca-miR-3810-5p	MIMAT0018642	unmapped	CGCTCGGGTTTTCCCGAGCGGAGGACCAAATTCGTGTATTTTTTTTTT
A_38_P00030942	A_38_P00030942	mir|tca-miR-13b-5p|mir|MIMAT0019104	tca-miR-13b-5p	MIMAT0019104	unmapped	CGCTCGGGTTTTCCCGAGCGGAGGTTTCACAACCAAATATTTTTTTTT
A_38_P00030943	A_38_P00030943	mir|tca-miR-13b-5p|mir|MIMAT0019104	tca-miR-13b-5p	MIMAT0019104	unmapped	CGCTCGGGTTTTCCCGAGCGGAGGTTTCACAACCAAATTTTTTTTTTTT
A_38_P00030944	A_38_P00030944	mir|tca-miR-14-5p|mir|MIMAT0019105	tca-miR-14-5p	MIMAT0019105	unmapped	CGCTCGGGTTTTCCCGAGCGGAGTAAGTCCAATCCGCATTTTTTTTT
A_38_P00030945	A_38_P00030945	mir|tca-miR-14-5p|mir|MIMAT0019105	tca-miR-14-5p	MIMAT0019105	unmapped	CGCTCGGGTTTTCCCGAGCGGAGTAAGTCCAATCCGCTTTTTTTTTTT
A_38_P00030946	A_38_P00030946	mir|tca-miR-3851c-5p|mir|MIMAT0018772	tca-miR-3851c-5p	MIMAT0018772	unmapped	CGCTCGGGTTTTCCCGAGCGGAGTACGACTCCAAATCATTTTTTTTTT
A_38_P00030947	A_38_P00030947	mir|tca-miR-3851c-5p|mir|MIMAT0018772	tca-miR-3851c-5p	MIMAT0018772	unmapped	CGCTCGGGTTTTCCCGAGCGGAGTACGACTCCAAATCAATATTTTTTTT
A_38_P00030948	A_38_P00030948	mir|tca-miR-3811e-3p|mir|MIMAT0018665	tca-miR-3811e-3p	MIMAT0018665	unmapped	CGCTCGGGTTTTCCCGAGCGGAGTCTCCACTCACGTATTTTTTTT
A_38_P00030949	A_38_P00030949	mir|tca-miR-3811e-3p|mir|MIMAT0018665	tca-miR-3811e-3p	MIMAT0018665	unmapped	CGCTCGGGTTTTCCCGAGCGGAGTCTCCACTCACGGAATTTTTTTT
A_38_P00030950	A_38_P00030950	mir|tca-miR-33-3p|mir|MIMAT0019107	tca-miR-33-3p	MIMAT0019107	unmapped	CGCTCGGGTTTTCCCGAGCGGAGTTGCACTGGAGAGTTTTTTTTTT
A_38_P00030951	A_38_P00030951	mir|tca-miR-33-3p|mir|MIMAT0019107	tca-miR-33-3p	MIMAT0019107	unmapped	CGCTCGGGTTTTCCCGAGCGGAGTTGCACTGGAGAGATTTTTTTTTT
A_38_P00030952	A_38_P00030952	mir|tca-miR-3874-3p|mir|MIMAT0018841	tca-miR-3874-3p	MIMAT0018841	unmapped	CGCTCGGGTTTTCCCGAGCGGATAAGTCGTCAATGAGGTTTTTTTTTT
A_38_P00030953	A_38_P00030953	mir|tca-miR-3874-3p|mir|MIMAT0018841	tca-miR-3874-3p	MIMAT0018841	unmapped	CGCTCGGGTTTTCCCGAGCGGATAAGTCGTCAATGAGGCTTTTTTTTTT
A_38_P00030954	A_38_P00030954	mir|tca-miR-9a-5p|mir|MIMAT0010090	tca-miR-9a-5p	MIMAT0010090	unmapped	CGCTCGGGTTTTCCCGAGCGGATACAGCTAGATAACCAAAGTTTTTTTTTT
A_38_P00030955	A_38_P00030955	mir|tca-miR-9a-5p|mir|MIMAT0010090	tca-miR-9a-5p	MIMAT0010090	unmapped	CGCTCGGGTTTTCCCGAGCGGATACAGCTAGATAACCAAAGATTTTTTTTTT
A_38_P00030956	A_38_P00030956	mir|tca-miR-124-5p|mir|MIMAT0019114	tca-miR-124-5p	MIMAT0019114	unmapped	CGCTCGGGTTTTCCCGAGCGGATACAGGCCAACAGTGTTTTTTTTTT
A_38_P00030957	A_38_P00030957	mir|tca-miR-124-5p|mir|MIMAT0019114	tca-miR-124-5p	MIMAT0019114	unmapped	CGCTCGGGTTTTCCCGAGCGGATACAGGCCAACAGTGATTTTTTTTTT
A_38_P00030958	A_38_P00030958	mir|tca-miR-3817-5p|mir|MIMAT0018658	tca-miR-3817-5p	MIMAT0018658	unmapped	CGCTCGGGTTTTCCCGAGCGGATACCACTCCCACACTTTTTTTTTT
A_38_P00030959	A_38_P00030959	mir|tca-miR-3817-5p|mir|MIMAT0018658	tca-miR-3817-5p	MIMAT0018658	unmapped	CGCTCGGGTTTTCCCGAGCGGATACCACTCCCACACCTTTTTTTTTT
A_38_P00030960	A_38_P00030960	mir|tca-miR-980-3p|mir|MIMAT0018865	tca-miR-980-3p	MIMAT0018865	unmapped	CGCTCGGGTTTTCCCGAGCGGATAGCCCTTCAAAAGGTTTTTTTTTT
A_38_P00030961	A_38_P00030961	mir|tca-miR-980-3p|mir|MIMAT0018865	tca-miR-980-3p	MIMAT0018865	unmapped	CGCTCGGGTTTTCCCGAGCGGATAGCCCTTCAAAAGGCTTTTTTTTTT
A_38_P00030962	A_38_P00030962	mir|tca-miR-3840-3p|mir|MIMAT0018725	tca-miR-3840-3p	MIMAT0018725	unmapped	CGCTCGGGTTTTCCCGAGCGGATAGTGAGTACCGTTCGATTTTTTTTT
A_38_P00030963	A_38_P00030963	mir|tca-miR-3840-3p|mir|MIMAT0018725	tca-miR-3840-3p	MIMAT0018725	unmapped	CGCTCGGGTTTTCCCGAGCGGATAGTGAGTACCGTTCGTTTTTTTTTTT
A_38_P00030964	A_38_P00030964	mir|tca-miR-263b-3p|mir|MIMAT0019122	tca-miR-263b-3p	MIMAT0019122	unmapped	CGCTCGGGTTTTCCCGAGCGGATATGGCATTAAAAGAATCATTTTTTTTTT
A_38_P00030965	A_38_P00030965	mir|tca-miR-263b-3p|mir|MIMAT0019122	tca-miR-263b-3p	MIMAT0019122	unmapped	CGCTCGGGTTTTCCCGAGCGGATATGGCATTAAAAGAATCACTTTTTTTTTT
A_38_P00030966	A_38_P00030966	mir|tca-miR-3806-5p|mir|MIMAT0018634	tca-miR-3806-5p	MIMAT0018634	unmapped	CGCTCGGGTTTTCCCGAGCGGATATGTGACAATCCGGTTTTTTTTTT
A_38_P00030967	A_38_P00030967	mir|tca-miR-3806-5p|mir|MIMAT0018634	tca-miR-3806-5p	MIMAT0018634	unmapped	CGCTCGGGTTTTCCCGAGCGGATATGTGACAATCCGGGTTTTTTTTTT
A_38_P00030968	A_38_P00030968	mir|tca-miR-190-3p|mir|MIMAT0019119	tca-miR-190-3p	MIMAT0019119	unmapped	CGCTCGGGTTTTCCCGAGCGGATATGTTTGACTCCTGGTTTTTTTTTT
A_38_P00030969	A_38_P00030969	mir|tca-miR-190-3p|mir|MIMAT0019119	tca-miR-190-3p	MIMAT0019119	unmapped	CGCTCGGGTTTTCCCGAGCGGATATGTTTGACTCCTGGGTTTTTTTTTT
A_38_P00030970	A_38_P00030970	mir|tca-miR-3826-5p|mir|MIMAT0018680	tca-miR-3826-5p	MIMAT0018680	unmapped	CGCTCGGGTTTTCCCGAGCGGATATTACCGCCCACCTTTTTTTTTT
A_38_P00030971	A_38_P00030971	mir|tca-miR-3826-5p|mir|MIMAT0018680	tca-miR-3826-5p	MIMAT0018680	unmapped	CGCTCGGGTTTTCCCGAGCGGATATTACCGCCCACCATTTTTTTTTT
A_38_P00030972	A_38_P00030972	mir|tca-miR-92a-5p|mir|MIMAT0019111	tca-miR-92a-5p	MIMAT0019111	unmapped	CGCTCGGGTTTTCCCGAGCGGATATTGTCACGCATCACTTTTTTTTTT
A_38_P00030973	A_38_P00030973	mir|tca-miR-92a-5p|mir|MIMAT0019111	tca-miR-92a-5p	MIMAT0019111	unmapped	CGCTCGGGTTTTCCCGAGCGGATATTGTCACGCATCACGTTTTTTTTTT
A_38_P00030974	A_38_P00030974	mir|tca-miR-3836b-5p|mir|MIMAT0018710	tca-miR-3836b-5p	MIMAT0018710	unmapped	CGCTCGGGTTTTCCCGAGCGGATCAACTTAAGCAGAGGTTTTTTTTTTT
A_38_P00030975	A_38_P00030975	mir|tca-miR-3836b-5p|mir|MIMAT0018710	tca-miR-3836b-5p	MIMAT0018710	unmapped	CGCTCGGGTTTTCCCGAGCGGATCAACTTAAGCAGAGGTGTTTTTTTTTT
A_38_P00030976	A_38_P00030976	mir|tca-miR-3899-3p|mir|MIMAT0018903	tca-miR-3899-3p	MIMAT0018903	unmapped	CGCTCGGGTTTTCCCGAGCGGATCCCTATCGAGTGTCTTTTTTTTTT
A_38_P00030977	A_38_P00030977	mir|tca-miR-3899-3p|mir|MIMAT0018903	tca-miR-3899-3p	MIMAT0018903	unmapped	CGCTCGGGTTTTCCCGAGCGGATCCCTATCGAGTGTCGTTTTTTTTTT
A_38_P00030978	A_38_P00030978	mir|tca-miR-3831-5p|mir|MIMAT0018692	tca-miR-3831-5p	MIMAT0018692	unmapped	CGCTCGGGTTTTCCCGAGCGGATCGAGCGACAAAATAGTTTTTTTTTT
A_38_P00030979	A_38_P00030979	mir|tca-miR-3831-5p|mir|MIMAT0018692	tca-miR-3831-5p	MIMAT0018692	unmapped	CGCTCGGGTTTTCCCGAGCGGATCGAGCGACAAAATAGCTTTTTTTTTT
A_38_P00030980	A_38_P00030980	mir|tca-miR-3834-3p|mir|MIMAT0018701	tca-miR-3834-3p	MIMAT0018701	unmapped	CGCTCGGGTTTTCCCGAGCGGATGACGTACTTTCTACCATTTTTTTTTT
A_38_P00030981	A_38_P00030981	mir|tca-miR-3834-3p|mir|MIMAT0018701	tca-miR-3834-3p	MIMAT0018701	unmapped	CGCTCGGGTTTTCCCGAGCGGATGACGTACTTTCTACCAGTTTTTTTTTT
A_38_P00030982	A_38_P00030982	mir|tca-miR-3830-5p|mir|MIMAT0018690	tca-miR-3830-5p	MIMAT0018690	unmapped	CGCTCGGGTTTTCCCGAGCGGATGCCGGTGCCGTTTTTTTTTT
A_38_P00030983	A_38_P00030983	mir|tca-miR-3830-5p|mir|MIMAT0018690	tca-miR-3830-5p	MIMAT0018690	unmapped	CGCTCGGGTTTTCCCGAGCGGATGCCGGTGCCGCTTTTTTTTTT
A_38_P00030984	A_38_P00030984	mir|tca-miR-3863-3p|mir|MIMAT0018809	tca-miR-3863-3p	MIMAT0018809	unmapped	CGCTCGGGTTTTCCCGAGCGGATGGATCAAGCAACGATTTTTTTTTT
A_38_P00030985	A_38_P00030985	mir|tca-miR-3863-3p|mir|MIMAT0018809	tca-miR-3863-3p	MIMAT0018809	unmapped	CGCTCGGGTTTTCCCGAGCGGATGGATCAAGCAACGACTTTTTTTTTT
A_38_P00030986	A_38_P00030986	mir|tca-miR-3873-3p|mir|MIMAT0018839	tca-miR-3873-3p	MIMAT0018839	unmapped	CGCTCGGGTTTTCCCGAGCGGATTATGAGCTAAAATTACAATTTTTTTTT
A_38_P00030987	A_38_P00030987	mir|tca-miR-3873-3p|mir|MIMAT0018839	tca-miR-3873-3p	MIMAT0018839	unmapped	CGCTCGGGTTTTCCCGAGCGGATTATGAGCTAAAATTACATTTTTTTTTTT
A_38_P00030988	A_38_P00030988	mir|tca-miR-3870-3p|mir|MIMAT0018833	tca-miR-3870-3p	MIMAT0018833	unmapped	CGCTCGGGTTTTCCCGAGCGGATTCCGGGCACTTGATTTTTTTTT
A_38_P00030989	A_38_P00030989	mir|tca-miR-3870-3p|mir|MIMAT0018833	tca-miR-3870-3p	MIMAT0018833	unmapped	CGCTCGGGTTTTCCCGAGCGGATTCCGGGCACTTGTTTTTTTTTTT
A_38_P00030990	A_38_P00030990	mir|tca-miR-3835-5p|mir|MIMAT0018702	tca-miR-3835-5p	MIMAT0018702	unmapped	CGCTCGGGTTTTCCCGAGCGGATTCTAGCAGTAATTCATCATATTTTTTTT
A_38_P00030991	A_38_P00030991	mir|tca-miR-3835-5p|mir|MIMAT0018702	tca-miR-3835-5p	MIMAT0018702	unmapped	CGCTCGGGTTTTCCCGAGCGGATTCTAGCAGTAATTCATCAGATTTTTTTTT
A_38_P00030992	A_38_P00030992	mir|tca-miR-3831-3p|mir|MIMAT0018693	tca-miR-3831-3p	MIMAT0018693	unmapped	CGCTCGGGTTTTCCCGAGCGGATTGCAATTTTGTTGTGTTTTTTTTTTT
A_38_P00030993	A_38_P00030993	mir|tca-miR-3831-3p|mir|MIMAT0018693	tca-miR-3831-3p	MIMAT0018693	unmapped	CGCTCGGGTTTTCCCGAGCGGATTGCAATTTTGTTGTGTCTATTTTTTTT
A_38_P00030994	A_38_P00030994	mir|tca-miR-3816-5p|mir|MIMAT0018656	tca-miR-3816-5p	MIMAT0018656	unmapped	CGCTCGGGTTTTCCCGAGCGGATTGCTGCCAAACATGTTTTTTTTTT
A_38_P00030995	A_38_P00030995	mir|tca-miR-3816-5p|mir|MIMAT0018656	tca-miR-3816-5p	MIMAT0018656	unmapped	CGCTCGGGTTTTCCCGAGCGGATTGCTGCCAAACATGCTATTTTTTTT
A_38_P00030996	A_38_P00030996	mir|tca-miR-3837-5p|mir|MIMAT0018708	tca-miR-3837-5p	MIMAT0018708	unmapped	CGCTCGGGTTTTCCCGAGCGGATTTATTTATTAGACAAATGTATTTTTTTTT
A_38_P00030997	A_38_P00030997	mir|tca-miR-3837-5p|mir|MIMAT0018708	tca-miR-3837-5p	MIMAT0018708	unmapped	CGCTCGGGTTTTCCCGAGCGGATTTATTTATTAGACAAATGTTTTTTTTTTTT
A_38_P00030998	A_38_P00030998	mir|tca-miR-3864-5p|mir|MIMAT0018812	tca-miR-3864-5p	MIMAT0018812	unmapped	CGCTCGGGTTTTCCCGAGCGGCAAACTCAAACCATGCTATTTTTTTT
A_38_P00030999	A_38_P00030999	mir|tca-miR-3864-5p|mir|MIMAT0018812	tca-miR-3864-5p	MIMAT0018812	unmapped	CGCTCGGGTTTTCCCGAGCGGCAAACTCAAACCATGCCATTTTTTTTT
A_38_P00031000	A_38_P00031000	mir|tca-miR-3883-3p|mir|MIMAT0018863	tca-miR-3883-3p	MIMAT0018863	unmapped	CGCTCGGGTTTTCCCGAGCGGCAAAGATGCTGTTAAAGATTTTTTTTTT
A_38_P00031001	A_38_P00031001	mir|tca-miR-3883-3p|mir|MIMAT0018863	tca-miR-3883-3p	MIMAT0018863	unmapped	CGCTCGGGTTTTCCCGAGCGGCAAAGATGCTGTTAAAGAGTATTTTTTTT
A_38_P00031002	A_38_P00031002	mir|tca-miR-3827-3p|mir|MIMAT0018683	tca-miR-3827-3p	MIMAT0018683	unmapped	CGCTCGGGTTTTCCCGAGCGGCAAAGCAACTACAAATGATTTTTTTTTT
A_38_P00031003	A_38_P00031003	mir|tca-miR-3827-3p|mir|MIMAT0018683	tca-miR-3827-3p	MIMAT0018683	unmapped	CGCTCGGGTTTTCCCGAGCGGCAAAGCAACTACAAATGAATTTTTTTTTT
A_38_P00031004	A_38_P00031004	mir|tca-miR-3900-3p|mir|MIMAT0018905	tca-miR-3900-3p	MIMAT0018905	unmapped	CGCTCGGGTTTTCCCGAGCGGCAAAGCGATCACACTATTTTTTTT
A_38_P00031005	A_38_P00031005	mir|tca-miR-3900-3p|mir|MIMAT0018905	tca-miR-3900-3p	MIMAT0018905	unmapped	CGCTCGGGTTTTCCCGAGCGGCAAAGCGATCACACCATTTTTTTTT
A_38_P00031006	A_38_P00031006	mir|tca-miR-2944a-5p|mir|MIMAT0018718	tca-miR-2944a-5p	MIMAT0018718	unmapped	CGCTCGGGTTTTCCCGAGCGGCAAATCACACCAATAGTTTTTTTTTTTT
A_38_P00031007	A_38_P00031007	mir|tca-miR-2944a-5p|mir|MIMAT0018718	tca-miR-2944a-5p	MIMAT0018718	unmapped	CGCTCGGGTTTTCCCGAGCGGCAAATCACACCAATAGTTCTATTTTTTTT
A_38_P00031008	A_38_P00031008	mir|tca-miR-9c-3p|mir|MIMAT0018715	tca-miR-9c-3p	MIMAT0018715	unmapped	CGCTCGGGTTTTCCCGAGCGGCAAATCTTGGCGACTATTTTTTTTT
A_38_P00031009	A_38_P00031009	mir|tca-miR-9c-3p|mir|MIMAT0018715	tca-miR-9c-3p	MIMAT0018715	unmapped	CGCTCGGGTTTTCCCGAGCGGCAAATCTTGGCGACTTTTTTTTTTTT
A_38_P00031010	A_38_P00031010	mir|tca-miR-3814-3p|mir|MIMAT0018653	tca-miR-3814-3p	MIMAT0018653	unmapped	CGCTCGGGTTTTCCCGAGCGGCAACAAACGCTCATGTATTTTTTTT
A_38_P00031011	A_38_P00031011	mir|tca-miR-3814-3p|mir|MIMAT0018653	tca-miR-3814-3p	MIMAT0018653	unmapped	CGCTCGGGTTTTCCCGAGCGGCAACAAACGCTCATGCATTTTTTTTT
A_38_P00031012	A_38_P00031012	mir|tca-miR-87b-3p|mir|MIMAT0018769	tca-miR-87b-3p	MIMAT0018769	unmapped	CGCTCGGGTTTTCCCGAGCGGCAACACACCTGAATCTAATTTTTTTT
A_38_P00031013	A_38_P00031013	mir|tca-miR-87b-3p|mir|MIMAT0018769	tca-miR-87b-3p	MIMAT0018769	unmapped	CGCTCGGGTTTTCCCGAGCGGCAACACACCTGAATCTTATTTTTTTTT
A_38_P00031014	A_38_P00031014	mir|tca-miR-3878-3p|mir|MIMAT0018849	tca-miR-3878-3p	MIMAT0018849	unmapped	CGCTCGGGTTTTCCCGAGCGGCAACACGGACACTAATTTTTTTTTT
A_38_P00031015	A_38_P00031015	mir|tca-miR-3878-3p|mir|MIMAT0018849	tca-miR-3878-3p	MIMAT0018849	unmapped	CGCTCGGGTTTTCCCGAGCGGCAACACGGACACTAAATTTTTTTTTT
A_38_P00031016	A_38_P00031016	mir|tca-miR-3878-3p|mir|MIMAT0018849	tca-miR-3878-3p	MIMAT0018849	unmapped	CGCTCGGGTTTTCCCGAGCGGCAACACGGACACTAAAATATTTTTTTT
A_38_P00031017	A_38_P00031017	mir|tca-miR-929-3p|mir|MIMAT0019133	tca-miR-929-3p	MIMAT0019133	unmapped	CGCTCGGGTTTTCCCGAGCGGCAACCTGACTCCGTATTTTTTTTT
A_38_P00031018	A_38_P00031018	mir|tca-miR-929-3p|mir|MIMAT0019133	tca-miR-929-3p	MIMAT0019133	unmapped	CGCTCGGGTTTTCCCGAGCGGCAACCTGACTCCGTTTTTTTTTTTT
A_38_P00031019	A_38_P00031019	mir|tca-miR-193-5p|mir|MIMAT0018896	tca-miR-193-5p	MIMAT0018896	unmapped	CGCTCGGGTTTTCCCGAGCGGCAACTGAACCTATAAGGTTTTTTTTTT
A_38_P00031020	A_38_P00031020	mir|tca-miR-193-5p|mir|MIMAT0018896	tca-miR-193-5p	MIMAT0018896	unmapped	CGCTCGGGTTTTCCCGAGCGGCAACTGAACCTATAAGGCTTTTTTTTTT
A_38_P00031021	A_38_P00031021	mir|tca-miR-309b-5p|mir|MIMAT0018886	tca-miR-309b-5p	MIMAT0018886	unmapped	CGCTCGGGTTTTCCCGAGCGGCAACTGAATCGAGTTAGATTTTTTTTT
A_38_P00031022	A_38_P00031022	mir|tca-miR-309b-5p|mir|MIMAT0018886	tca-miR-309b-5p	MIMAT0018886	unmapped	CGCTCGGGTTTTCCCGAGCGGCAACTGAATCGAGTTAGTTTTTTTTTTT
A_38_P00031023	A_38_P00031023	mir|tca-miR-3815-3p|mir|MIMAT0018655	tca-miR-3815-3p	MIMAT0018655	unmapped	CGCTCGGGTTTTCCCGAGCGGCAACTGAGGTTAGAAGTTTTTTTTTT
A_38_P00031024	A_38_P00031024	mir|tca-miR-3815-3p|mir|MIMAT0018655	tca-miR-3815-3p	MIMAT0018655	unmapped	CGCTCGGGTTTTCCCGAGCGGCAACTGAGGTTAGAAGGTTTTTTTTTT
A_38_P00031025	A_38_P00031025	mir|tca-miR-3805b-3p|mir|MIMAT0018663	tca-miR-3805b-3p	MIMAT0018663	unmapped	CGCTCGGGTTTTCCCGAGCGGCAAGACCATCACAGACTTTTTTTTTT
A_38_P00031026	A_38_P00031026	mir|tca-miR-3805b-3p|mir|MIMAT0018663	tca-miR-3805b-3p	MIMAT0018663	unmapped	CGCTCGGGTTTTCCCGAGCGGCAAGACCATCACAGACGTTTTTTTTTT
A_38_P00031027	A_38_P00031027	mir|tca-miR-3900-5p|mir|MIMAT0018904	tca-miR-3900-5p	MIMAT0018904	unmapped	CGCTCGGGTTTTCCCGAGCGGCAAGGAGGTGCCATTTTTTTTTT
A_38_P00031028	A_38_P00031028	mir|tca-miR-3900-5p|mir|MIMAT0018904	tca-miR-3900-5p	MIMAT0018904	unmapped	CGCTCGGGTTTTCCCGAGCGGCAAGGAGGTGCCACTTTTTTTTTT
A_38_P00031029	A_38_P00031029	mir|tca-miR-3842-3p|mir|MIMAT0018729	tca-miR-3842-3p	MIMAT0018729	unmapped	CGCTCGGGTTTTCCCGAGCGGCAAGGATAAAAACGAAGTTTTTTTTTT
A_38_P00031030	A_38_P00031030	mir|tca-miR-3842-3p|mir|MIMAT0018729	tca-miR-3842-3p	MIMAT0018729	unmapped	CGCTCGGGTTTTCCCGAGCGGCAAGGATAAAAACGAAGCTATTTTTTTT
A_38_P00031031	A_38_P00031031	mir|tca-miR-3895-3p|mir|MIMAT0018893	tca-miR-3895-3p	MIMAT0018893	unmapped	CGCTCGGGTTTTCCCGAGCGGCAAGGCGATTCCGTATTTTTTTT
A_38_P00031032	A_38_P00031032	mir|tca-miR-3895-3p|mir|MIMAT0018893	tca-miR-3895-3p	MIMAT0018893	unmapped	CGCTCGGGTTTTCCCGAGCGGCAAGGCGATTCCGGAATTTTTTTT
A_38_P00031033	A_38_P00031033	mir|tca-miR-3905-5p|mir|MIMAT0018913	tca-miR-3905-5p	MIMAT0018913	unmapped	CGCTCGGGTTTTCCCGAGCGGCAAGGCGGCTCCTTTTTTTTTT
A_38_P00031034	A_38_P00031034	mir|tca-miR-3905-5p|mir|MIMAT0018913	tca-miR-3905-5p	MIMAT0018913	unmapped	CGCTCGGGTTTTCCCGAGCGGCAAGGCGGCTCCCTTTTTTTTTT
A_38_P00031035	A_38_P00031035	mir|tca-miR-3841-5p|mir|MIMAT0018726	tca-miR-3841-5p	MIMAT0018726	unmapped	CGCTCGGGTTTTCCCGAGCGGCAAGTAGGAATGGAAAGTATTTTTTTT
A_38_P00031036	A_38_P00031036	mir|tca-miR-3841-5p|mir|MIMAT0018726	tca-miR-3841-5p	MIMAT0018726	unmapped	CGCTCGGGTTTTCCCGAGCGGCAAGTAGGAATGGAAAGAATTTTTTTTT
A_38_P00031037	A_38_P00031037	mir|tca-miR-92b-5p|mir|MIMAT0019112	tca-miR-92b-5p	MIMAT0019112	unmapped	CGCTCGGGTTTTCCCGAGCGGCAAGTTGCACAAGACTTTTTTTTTT
A_38_P00031038	A_38_P00031038	mir|tca-miR-92b-5p|mir|MIMAT0019112	tca-miR-92b-5p	MIMAT0019112	unmapped	CGCTCGGGTTTTCCCGAGCGGCAAGTTGCACAAGACATTTTTTTTTT
A_38_P00031039	A_38_P00031039	mir|tca-miR-125-3p|mir|MIMAT0019115	tca-miR-125-3p	MIMAT0019115	unmapped	CGCTCGGGTTTTCCCGAGCGGCAATACCCGAGTCGTATTTTTTTT
A_38_P00031040	A_38_P00031040	mir|tca-miR-125-3p|mir|MIMAT0019115	tca-miR-125-3p	MIMAT0019115	unmapped	CGCTCGGGTTTTCCCGAGCGGCAATACCCGAGTCGCATTTTTTTTT
A_38_P00031041	A_38_P00031041	mir|tca-miR-3812-5p|mir|MIMAT0018646	tca-miR-3812-5p	MIMAT0018646	unmapped	CGCTCGGGTTTTCCCGAGCGGCAATAGTGTCATCAAAATCTTTTTTTTTT
A_38_P00031042	A_38_P00031042	mir|tca-miR-3812-5p|mir|MIMAT0018646	tca-miR-3812-5p	MIMAT0018646	unmapped	CGCTCGGGTTTTCCCGAGCGGCAATAGTGTCATCAAAATCATATTTTTTTT
A_38_P00031043	A_38_P00031043	mir|tca-miR-3822-5p|mir|MIMAT0018670	tca-miR-3822-5p	MIMAT0018670	unmapped	CGCTCGGGTTTTCCCGAGCGGCAATATTAACTGTGCAACATTTTTTTTTT
A_38_P00031044	A_38_P00031044	mir|tca-miR-3822-5p|mir|MIMAT0018670	tca-miR-3822-5p	MIMAT0018670	unmapped	CGCTCGGGTTTTCCCGAGCGGCAATATTAACTGTGCAACACTATTTTTTTT
A_38_P00031045	A_38_P00031045	mir|tca-miR-2b-5p|mir|MIMAT0019096	tca-miR-2b-5p	MIMAT0019096	unmapped	CGCTCGGGTTTTCCCGAGCGGCACAACCAGATGATGATTTTTTTTTT
A_38_P00031046	A_38_P00031046	mir|tca-miR-2b-5p|mir|MIMAT0019096	tca-miR-2b-5p	MIMAT0019096	unmapped	CGCTCGGGTTTTCCCGAGCGGCACAACCAGATGATGAGTTTTTTTTTT
A_38_P00031047	A_38_P00031047	mir|tca-miR-3805b-5p|mir|MIMAT0018662	tca-miR-3805b-5p	MIMAT0018662	unmapped	CGCTCGGGTTTTCCCGAGCGGCACAATAAAATCCGAATGATTTTTTTTT
A_38_P00031048	A_38_P00031048	mir|tca-miR-3805b-5p|mir|MIMAT0018662	tca-miR-3805b-5p	MIMAT0018662	unmapped	CGCTCGGGTTTTCCCGAGCGGCACAATAAAATCCGAATGTTTTTTTTTTT
A_38_P00031049	A_38_P00031049	mir|tca-miR-3889-5p|mir|MIMAT0018876	tca-miR-3889-5p	MIMAT0018876	unmapped	CGCTCGGGTTTTCCCGAGCGGCACACAATACAGAGAGATTTTTTTTTT
A_38_P00031050	A_38_P00031050	mir|tca-miR-3889-5p|mir|MIMAT0018876	tca-miR-3889-5p	MIMAT0018876	unmapped	CGCTCGGGTTTTCCCGAGCGGCACACAATACAGAGAGAATTTTTTTTTT
A_38_P00031051	A_38_P00031051	mir|tca-miR-9c-5p|mir|MIMAT0018714	tca-miR-9c-5p	MIMAT0018714	unmapped	CGCTCGGGTTTTCCCGAGCGGCACACGGCTAGATCATTTTTTTTTT
A_38_P00031052	A_38_P00031052	mir|tca-miR-9c-5p|mir|MIMAT0018714	tca-miR-9c-5p	MIMAT0018714	unmapped	CGCTCGGGTTTTCCCGAGCGGCACACGGCTAGATCACTTTTTTTTTT
A_38_P00031053	A_38_P00031053	mir|tca-miR-307-5p|mir|MIMAT0019129	tca-miR-307-5p	MIMAT0019129	unmapped	CGCTCGGGTTTTCCCGAGCGGCACATCACACCCAGTATTTTTTTT
A_38_P00031054	A_38_P00031054	mir|tca-miR-307-5p|mir|MIMAT0019129	tca-miR-307-5p	MIMAT0019129	unmapped	CGCTCGGGTTTTCCCGAGCGGCACATCACACCCAGGAATTTTTTTT
A_38_P00031055	A_38_P00031055	mir|tca-miR-2944b-5p|mir|MIMAT0018746	tca-miR-2944b-5p	MIMAT0018746	unmapped	CGCTCGGGTTTTCCCGAGCGGCACATCACACCTGTAGAATTTTTTTT
A_38_P00031056	A_38_P00031056	mir|tca-miR-2944b-5p|mir|MIMAT0018746	tca-miR-2944b-5p	MIMAT0018746	unmapped	CGCTCGGGTTTTCCCGAGCGGCACATCACACCTGTAGTATTTTTTTTT
A_38_P00031057	A_38_P00031057	mir|tca-miR-276-5p|mir|MIMAT0008380	tca-miR-276-5p	MIMAT0008380	unmapped	CGCTCGGGTTTTCCCGAGCGGCACGTAGGAACTCTATACTATTTTTTTT
A_38_P00031058	A_38_P00031058	mir|tca-miR-276-5p|mir|MIMAT0008380	tca-miR-276-5p	MIMAT0008380	unmapped	CGCTCGGGTTTTCCCGAGCGGCACGTAGGAACTCTATACCATTTTTTTTT
A_38_P00031059	A_38_P00031059	mir|tca-miR-3843-5p|mir|MIMAT0018732	tca-miR-3843-5p	MIMAT0018732	unmapped	CGCTCGGGTTTTCCCGAGCGGCACTAAAGCCACATCATTTTTTTTTT
A_38_P00031060	A_38_P00031060	mir|tca-miR-3843-5p|mir|MIMAT0018732	tca-miR-3843-5p	MIMAT0018732	unmapped	CGCTCGGGTTTTCCCGAGCGGCACTAAAGCCACATCAATTTTTTTTTT
A_38_P00031061	A_38_P00031061	mir|tca-miR-283-5p|mir|MIMAT0008387	tca-miR-283-5p	MIMAT0008387	unmapped	CGCTCGGGTTTTCCCGAGCGGCAGAATTACCAGCTGAATTTTTTTTT
A_38_P00031062	A_38_P00031062	mir|tca-miR-283-5p|mir|MIMAT0008387	tca-miR-283-5p	MIMAT0008387	unmapped	CGCTCGGGTTTTCCCGAGCGGCAGAATTACCAGCTGATTATTTTTTTT
A_38_P00031063	A_38_P00031063	mir|tca-miR-283-5p|mir|MIMAT0008387	tca-miR-283-5p	MIMAT0008387	unmapped	CGCTCGGGTTTTCCCGAGCGGCAGAATTACCAGCTGATAAATTTTTTTT
A_38_P00031064	A_38_P00031064	mir|tca-miR-283-5p|mir|MIMAT0008387	tca-miR-283-5p	MIMAT0008387	unmapped	CGCTCGGGTTTTCCCGAGCGGCAGAATTACCAGCTGATATAATTTTTTTT
A_38_P00031065	A_38_P00031065	mir|tca-miR-3890-3p|mir|MIMAT0018879	tca-miR-3890-3p	MIMAT0018879	unmapped	CGCTCGGGTTTTCCCGAGCGGCAGCCGTACATAACCTTTTTTTTTT
A_38_P00031066	A_38_P00031066	mir|tca-miR-3890-3p|mir|MIMAT0018879	tca-miR-3890-3p	MIMAT0018879	unmapped	CGCTCGGGTTTTCCCGAGCGGCAGCCGTACATAACCGTTTTTTTTTT
A_38_P00031067	A_38_P00031067	mir|tca-miR-3865-5p|mir|MIMAT0018814	tca-miR-3865-5p	MIMAT0018814	unmapped	CGCTCGGGTTTTCCCGAGCGGCAGCTCAAGATCTTGCTATTTTTTTT
A_38_P00031068	A_38_P00031068	mir|tca-miR-3865-5p|mir|MIMAT0018814	tca-miR-3865-5p	MIMAT0018814	unmapped	CGCTCGGGTTTTCCCGAGCGGCAGCTCAAGATCTTGCCATTTTTTTTT
A_38_P00031069	A_38_P00031069	mir|tca-miR-12-5p|mir|MIMAT0008358	tca-miR-12-5p	MIMAT0008358	unmapped	CGCTCGGGTTTTCCCGAGCGGCAGTACCTGATGTAATACTTTTTTTTTTT
A_38_P00031070	A_38_P00031070	mir|tca-miR-12-5p|mir|MIMAT0008358	tca-miR-12-5p	MIMAT0008358	unmapped	CGCTCGGGTTTTCCCGAGCGGCAGTACCTGATGTAATACTCTTTTTTTTTT
A_38_P00031071	A_38_P00031071	mir|tca-miR-3851e-5p|mir|MIMAT0018780	tca-miR-3851e-5p	MIMAT0018780	unmapped	CGCTCGGGTTTTCCCGAGCGGCATAGTACGACTCCAAAATTTTTTTTT
A_38_P00031072	A_38_P00031072	mir|tca-miR-3851e-5p|mir|MIMAT0018780	tca-miR-3851e-5p	MIMAT0018780	unmapped	CGCTCGGGTTTTCCCGAGCGGCATAGTACGACTCCAAATTTTTTTTTTT
A_38_P00031073	A_38_P00031073	mir|tca-miR-3851e-5p|mir|MIMAT0018780	tca-miR-3851e-5p	MIMAT0018780	unmapped	CGCTCGGGTTTTCCCGAGCGGCATAGTACGACTCCAAATCTTTTTTTTTT
A_38_P00031074	A_38_P00031074	mir|tca-miR-3851a-5p|mir|MIMAT0018758|mir|tca-miR-3851b-5p|mir|MIMAT0018756	tca-miR-3851a-5p	MIMAT0018758	unmapped	CGCTCGGGTTTTCCCGAGCGGCATAGTACTACTCCAAATCTTTTTTTTTT
A_38_P00031075	A_38_P00031075	mir|tca-miR-3851a-5p|mir|MIMAT0018758|mir|tca-miR-3851b-5p|mir|MIMAT0018756	tca-miR-3851a-5p	MIMAT0018758	unmapped	CGCTCGGGTTTTCCCGAGCGGCATAGTACTACTCCAAATCATTTTTTTTTT
A_38_P00031076	A_38_P00031076	mir|tca-miR-2944c-5p|mir|MIMAT0018810	tca-miR-2944c-5p	MIMAT0018810	unmapped	CGCTCGGGTTTTCCCGAGCGGCATATCACACCAGAAGTATTTTTTTTT
A_38_P00031077	A_38_P00031077	mir|tca-miR-2944c-5p|mir|MIMAT0018810	tca-miR-2944c-5p	MIMAT0018810	unmapped	CGCTCGGGTTTTCCCGAGCGGCATATCACACCAGAAGTTTTTTTTTTTT
A_38_P00031078	A_38_P00031078	mir|tca-miR-71-3p|mir|MIMAT0019109	tca-miR-71-3p	MIMAT0019109	unmapped	CGCTCGGGTTTTCCCGAGCGGCATGAAAGACAAGGTAGATTTTTTTTT
A_38_P00031079	A_38_P00031079	mir|tca-miR-71-3p|mir|MIMAT0019109	tca-miR-71-3p	MIMAT0019109	unmapped	CGCTCGGGTTTTCCCGAGCGGCATGAAAGACAAGGTAGTTTTTTTTTTT
A_38_P00031080	A_38_P00031080	mir|tca-miR-33-5p|mir|MIMAT0008363	tca-miR-33-5p	MIMAT0008363	unmapped	CGCTCGGGTTTTCCCGAGCGGCATGCAATGCAACTACTTTTTTTTTT
A_38_P00031081	A_38_P00031081	mir|tca-miR-33-5p|mir|MIMAT0008363	tca-miR-33-5p	MIMAT0008363	unmapped	CGCTCGGGTTTTCCCGAGCGGCATGCAATGCAACTACATATTTTTTTT
A_38_P00031082	A_38_P00031082	mir|tca-miR-279b-5p|mir|MIMAT0019181	tca-miR-279b-5p	MIMAT0019181	unmapped	CGCTCGGGTTTTCCCGAGCGGCATGCACCAAACCCATTTTTTTTT
A_38_P00031083	A_38_P00031083	mir|tca-miR-279b-5p|mir|MIMAT0019181	tca-miR-279b-5p	MIMAT0019181	unmapped	CGCTCGGGTTTTCCCGAGCGGCATGCACCAAACCCTTTTTTTTTTT
A_38_P00031084	A_38_P00031084	mir|tca-miR-750-5p|mir|MIMAT0018820	tca-miR-750-5p	MIMAT0018820	unmapped	CGCTCGGGTTTTCCCGAGCGGCATGCGAAGATCCAATTTTTTTTTT
A_38_P00031085	A_38_P00031085	mir|tca-miR-750-5p|mir|MIMAT0018820	tca-miR-750-5p	MIMAT0018820	unmapped	CGCTCGGGTTTTCCCGAGCGGCATGCGAAGATCCAACTATTTTTTTT
A_38_P00031086	A_38_P00031086	mir|tca-miR-309a-3p|mir|MIMAT0018751	tca-miR-309a-3p	MIMAT0018751	unmapped	CGCTCGGGTTTTCCCGAGCGGCATTGGACAAACTGAATTTTTTTTTT
A_38_P00031087	A_38_P00031087	mir|tca-miR-309a-3p|mir|MIMAT0018751	tca-miR-309a-3p	MIMAT0018751	unmapped	CGCTCGGGTTTTCCCGAGCGGCATTGGACAAACTGAACTTTTTTTTTT
A_38_P00031088	A_38_P00031088	mir|tca-miR-2a-5p|mir|MIMAT0019094	tca-miR-2a-5p	MIMAT0019094	unmapped	CGCTCGGGTTTTCCCGAGCGGCATTTCACATCCAGTTGTATTTTTTTT
A_38_P00031089	A_38_P00031089	mir|tca-miR-2a-5p|mir|MIMAT0019094	tca-miR-2a-5p	MIMAT0019094	unmapped	CGCTCGGGTTTTCCCGAGCGGCATTTCACATCCAGTTGAATTTTTTTTT
A_38_P00031090	A_38_P00031090	mir|tca-miR-3830-3p|mir|MIMAT0018691	tca-miR-3830-3p	MIMAT0018691	unmapped	CGCTCGGGTTTTCCCGAGCGGCCAACGCGACCTTTTTTTTTT
A_38_P00031091	A_38_P00031091	mir|tca-miR-3830-3p|mir|MIMAT0018691	tca-miR-3830-3p	MIMAT0018691	unmapped	CGCTCGGGTTTTCCCGAGCGGCCAACGCGACCGTTTTTTTTTT
A_38_P00031092	A_38_P00031092	mir|tca-miR-190-5p|mir|MIMAT0008375	tca-miR-190-5p	MIMAT0008375	unmapped	CGCTCGGGTTTTCCCGAGCGGCCAAGAATATCAAACATATCATTTTTTTTT
A_38_P00031093	A_38_P00031093	mir|tca-miR-190-5p|mir|MIMAT0008375	tca-miR-190-5p	MIMAT0008375	unmapped	CGCTCGGGTTTTCCCGAGCGGCCAAGAATATCAAACATATCTTTTTTTTTTT
A_38_P00031094	A_38_P00031094	mir|tca-miR-3899-5p|mir|MIMAT0018902	tca-miR-3899-5p	MIMAT0018902	unmapped	CGCTCGGGTTTTCCCGAGCGGCCAAGGCGGGCATTTTTTTTT
A_38_P00031095	A_38_P00031095	mir|tca-miR-3899-5p|mir|MIMAT0018902	tca-miR-3899-5p	MIMAT0018902	unmapped	CGCTCGGGTTTTCCCGAGCGGCCAAGGCGGGCTTATTTTTTTT
A_38_P00031096	A_38_P00031096	mir|tca-miR-3845-5p|mir|MIMAT0018738	tca-miR-3845-5p	MIMAT0018738	unmapped	CGCTCGGGTTTTCCCGAGCGGCCAAGGCGTGGGTTTTTTTTTT
A_38_P00031097	A_38_P00031097	mir|tca-miR-3845-5p|mir|MIMAT0018738	tca-miR-3845-5p	MIMAT0018738	unmapped	CGCTCGGGTTTTCCCGAGCGGCCAAGGCGTGGGATTTTTTTTTT
A_38_P00031098	A_38_P00031098	mir|tca-miR-3854-3p|mir|MIMAT0018765	tca-miR-3854-3p	MIMAT0018765	unmapped	CGCTCGGGTTTTCCCGAGCGGCCACAATACTAAACGCTTTTTTTTTT
A_38_P00031099	A_38_P00031099	mir|tca-miR-3854-3p|mir|MIMAT0018765	tca-miR-3854-3p	MIMAT0018765	unmapped	CGCTCGGGTTTTCCCGAGCGGCCACAATACTAAACGCCTTTTTTTTTT
A_38_P00031100	A_38_P00031100	mir|tca-miR-989-3p|mir|MIMAT0018823	tca-miR-989-3p	MIMAT0018823	unmapped	CGCTCGGGTTTTCCCGAGCGGCCACTACGTCACATCTTTTTTTTTT
A_38_P00031101	A_38_P00031101	mir|tca-miR-989-3p|mir|MIMAT0018823	tca-miR-989-3p	MIMAT0018823	unmapped	CGCTCGGGTTTTCCCGAGCGGCCACTACGTCACATCATTTTTTTTTT
A_38_P00031102	A_38_P00031102	mir|tca-miR-3886-3p|mir|MIMAT0018871	tca-miR-3886-3p	MIMAT0018871	unmapped	CGCTCGGGTTTTCCCGAGCGGCCACTGATATATAACCGAATTTTTTTTT
A_38_P00031103	A_38_P00031103	mir|tca-miR-3886-3p|mir|MIMAT0018871	tca-miR-3886-3p	MIMAT0018871	unmapped	CGCTCGGGTTTTCCCGAGCGGCCACTGATATATAACCGATTTTTTTTTTT
A_38_P00031104	A_38_P00031104	mir|tca-miR-3886-3p|mir|MIMAT0018871	tca-miR-3886-3p	MIMAT0018871	unmapped	CGCTCGGGTTTTCCCGAGCGGCCACTGATATATAACCGATATTTTTTTTTT
A_38_P00031105	A_38_P00031105	mir|tca-miR-275-5p|mir|MIMAT0019123	tca-miR-275-5p	MIMAT0019123	unmapped	CGCTCGGGTTTTCCCGAGCGGCCAGCCTAGGTACTGTTTTTTTTTT
A_38_P00031106	A_38_P00031106	mir|tca-miR-275-5p|mir|MIMAT0019123	tca-miR-275-5p	MIMAT0019123	unmapped	CGCTCGGGTTTTCCCGAGCGGCCAGCCTAGGTACTGATTTTTTTTTT
A_38_P00031107	A_38_P00031107	mir|tca-miR-3895-5p|mir|MIMAT0018892	tca-miR-3895-5p	MIMAT0018892	unmapped	CGCTCGGGTTTTCCCGAGCGGCCATCGTAATCAACTCATATTTTTTTT
A_38_P00031108	A_38_P00031108	mir|tca-miR-3895-5p|mir|MIMAT0018892	tca-miR-3895-5p	MIMAT0018892	unmapped	CGCTCGGGTTTTCCCGAGCGGCCATCGTAATCAACTCAAATTTTTTTTT
A_38_P00031109	A_38_P00031109	mir|tca-miR-308-5p|mir|MIMAT0018706	tca-miR-308-5p	MIMAT0018706	unmapped	CGCTCGGGTTTTCCCGAGCGGCCATTCACAAGCAAATTTTTTTTTTT
A_38_P00031110	A_38_P00031110	mir|tca-miR-308-5p|mir|MIMAT0018706	tca-miR-308-5p	MIMAT0018706	unmapped	CGCTCGGGTTTTCCCGAGCGGCCATTCACAAGCAAATCTATTTTTTTT
A_38_P00031111	A_38_P00031111	mir|tca-miR-3859-3p|mir|MIMAT0018791	tca-miR-3859-3p	MIMAT0018791	unmapped	CGCTCGGGTTTTCCCGAGCGGCCCACAACGAGCATTTTTTTTTT
A_38_P00031112	A_38_P00031112	mir|tca-miR-3859-3p|mir|MIMAT0018791	tca-miR-3859-3p	MIMAT0018791	unmapped	CGCTCGGGTTTTCCCGAGCGGCCCACAACGAGCACTTTTTTTTTT
A_38_P00031113	A_38_P00031113	mir|tca-miR-100-5p|mir|MIMAT0008369	tca-miR-100-5p	MIMAT0008369	unmapped	CGCTCGGGTTTTCCCGAGCGGCCCACAAGTTCGGTATTTTTTTT
A_38_P00031114	A_38_P00031114	mir|tca-miR-100-5p|mir|MIMAT0008369	tca-miR-100-5p	MIMAT0008369	unmapped	CGCTCGGGTTTTCCCGAGCGGCCCACAAGTTCGGAATTTTTTTTT
A_38_P00031115	A_38_P00031115	mir|tca-miR-3897-3p|mir|MIMAT0018899	tca-miR-3897-3p	MIMAT0018899	unmapped	CGCTCGGGTTTTCCCGAGCGGCCCCACCCCCATTTTTTTTTT
A_38_P00031116	A_38_P00031116	mir|tca-miR-3897-3p|mir|MIMAT0018899	tca-miR-3897-3p	MIMAT0018899	unmapped	CGCTCGGGTTTTCCCGAGCGGCCCCACCCCCACTTTTTTTTTT
A_38_P00031117	A_38_P00031117	mir|tca-miR-3808-3p|mir|MIMAT0018639	tca-miR-3808-3p	MIMAT0018639	unmapped	CGCTCGGGTTTTCCCGAGCGGCCCCATATCCACACTATTTTTTTT
A_38_P00031118	A_38_P00031118	mir|tca-miR-3808-3p|mir|MIMAT0018639	tca-miR-3808-3p	MIMAT0018639	unmapped	CGCTCGGGTTTTCCCGAGCGGCCCCATATCCACACGATTTTTTTTT
A_38_P00031119	A_38_P00031119	mir|tca-miR-263a-5p|mir|MIMAT0010093	tca-miR-263a-5p	MIMAT0010093	unmapped	CGCTCGGGTTTTCCCGAGCGGCCCGTGAATTCTTCCTTTTTTTTTT
A_38_P00031120	A_38_P00031120	mir|tca-miR-263a-5p|mir|MIMAT0010093	tca-miR-263a-5p	MIMAT0010093	unmapped	CGCTCGGGTTTTCCCGAGCGGCCCGTGAATTCTTCCATATTTTTTTT
A_38_P00031121	A_38_P00031121	mir|tca-miR-3874-5p|mir|MIMAT0018840	tca-miR-3874-5p	MIMAT0018840	unmapped	CGCTCGGGTTTTCCCGAGCGGCCCTTATTATGACAGCAATTTTTTTTT
A_38_P00031122	A_38_P00031122	mir|tca-miR-3874-5p|mir|MIMAT0018840	tca-miR-3874-5p	MIMAT0018840	unmapped	CGCTCGGGTTTTCCCGAGCGGCCCTTATTATGACAGCATTTTTTTTTTT
A_38_P00031123	A_38_P00031123	mir|tca-miR-3874-5p|mir|MIMAT0018840	tca-miR-3874-5p	MIMAT0018840	unmapped	CGCTCGGGTTTTCCCGAGCGGCCCTTATTATGACAGCATCTTTTTTTTTT
A_38_P00031124	A_38_P00031124	mir|tca-miR-3842-5p|mir|MIMAT0018728	tca-miR-3842-5p	MIMAT0018728	unmapped	CGCTCGGGTTTTCCCGAGCGGCCGACTCGTTTTTCTATTTTTTTT
A_38_P00031125	A_38_P00031125	mir|tca-miR-3842-5p|mir|MIMAT0018728	tca-miR-3842-5p	MIMAT0018728	unmapped	CGCTCGGGTTTTCCCGAGCGGCCGACTCGTTTTTCCATTTTTTTTT
A_38_P00031126	A_38_P00031126	mir|tca-miR-3881-3p|mir|MIMAT0018859	tca-miR-3881-3p	MIMAT0018859	unmapped	CGCTCGGGTTTTCCCGAGCGGCCGAGAAATTAAAGATCTTTTTTTTTT
A_38_P00031127	A_38_P00031127	mir|tca-miR-3881-3p|mir|MIMAT0018859	tca-miR-3881-3p	MIMAT0018859	unmapped	CGCTCGGGTTTTCCCGAGCGGCCGAGAAATTAAAGATCCTATTTTTTTT
A_38_P00031128	A_38_P00031128	mir|tca-miR-3826-3p|mir|MIMAT0018681	tca-miR-3826-3p	MIMAT0018681	unmapped	CGCTCGGGTTTTCCCGAGCGGCCGAGGCGTAGTCTTTTTTTTTT
A_38_P00031129	A_38_P00031129	mir|tca-miR-3826-3p|mir|MIMAT0018681	tca-miR-3826-3p	MIMAT0018681	unmapped	CGCTCGGGTTTTCCCGAGCGGCCGAGGCGTAGTCGTTTTTTTTTT
A_38_P00031130	A_38_P00031130	mir|tca-miR-3866-5p|mir|MIMAT0018824	tca-miR-3866-5p	MIMAT0018824	unmapped	CGCTCGGGTTTTCCCGAGCGGCCGATTGATCAAACTGATTTTTTTTT
A_38_P00031131	A_38_P00031131	mir|tca-miR-3866-5p|mir|MIMAT0018824	tca-miR-3866-5p	MIMAT0018824	unmapped	CGCTCGGGTTTTCCCGAGCGGCCGATTGATCAAACTGTTTTTTTTTTT
A_38_P00031132	A_38_P00031132	mir|tca-miR-3867-3p|mir|MIMAT0018827	tca-miR-3867-3p	MIMAT0018827	unmapped	CGCTCGGGTTTTCCCGAGCGGCCGCTGCAAATAACTTTTTTTTTT
A_38_P00031133	A_38_P00031133	mir|tca-miR-3867-3p|mir|MIMAT0018827	tca-miR-3867-3p	MIMAT0018827	unmapped	CGCTCGGGTTTTCCCGAGCGGCCGCTGCAAATAACGTTTTTTTTTT
A_38_P00031134	A_38_P00031134	mir|tca-miR-3884-5p|mir|MIMAT0018866	tca-miR-3884-5p	MIMAT0018866	unmapped	CGCTCGGGTTTTCCCGAGCGGCCGGCAGTTAACTCTATTTTTTTT
A_38_P00031135	A_38_P00031135	mir|tca-miR-3884-5p|mir|MIMAT0018866	tca-miR-3884-5p	MIMAT0018866	unmapped	CGCTCGGGTTTTCCCGAGCGGCCGGCAGTTAACTCGATTTTTTTTT
A_38_P00031136	A_38_P00031136	mir|tca-miR-3477-5p|mir|MIMAT0018736	tca-miR-3477-5p	MIMAT0018736	unmapped	CGCTCGGGTTTTCCCGAGCGGCCTCACAGTTACCAAAATTTTTTTTT
A_38_P00031137	A_38_P00031137	mir|tca-miR-3477-5p|mir|MIMAT0018736	tca-miR-3477-5p	MIMAT0018736	unmapped	CGCTCGGGTTTTCCCGAGCGGCCTCACAGTTACCAAATTTTTTTTTTT
A_38_P00031138	A_38_P00031138	mir|tca-miR-3477-5p|mir|MIMAT0018736	tca-miR-3477-5p	MIMAT0018736	unmapped	CGCTCGGGTTTTCCCGAGCGGCCTCACAGTTACCAAATGTTTTTTTTTT
A_38_P00031139	A_38_P00031139	mir|tca-miR-252a-5p|mir|MIMAT0018804	tca-miR-252a-5p	MIMAT0018804	unmapped	CGCTCGGGTTTTCCCGAGCGGCCTGCGGCACTAGATTTTTTTTT
A_38_P00031140	A_38_P00031140	mir|tca-miR-252a-5p|mir|MIMAT0018804	tca-miR-252a-5p	MIMAT0018804	unmapped	CGCTCGGGTTTTCCCGAGCGGCCTGCGGCACTAGTTTTTTTTTTT
A_38_P00031141	A_38_P00031141	mir|tca-miR-3877-3p|mir|MIMAT0018847	tca-miR-3877-3p	MIMAT0018847	unmapped	CGCTCGGGTTTTCCCGAGCGGCCTTCCAGTGACAACATTTTTTTTT
A_38_P00031142	A_38_P00031142	mir|tca-miR-3877-3p|mir|MIMAT0018847	tca-miR-3877-3p	MIMAT0018847	unmapped	CGCTCGGGTTTTCCCGAGCGGCCTTCCAGTGACAACTTTTTTTTTTT
A_38_P00031143	A_38_P00031143	mir|tca-miR-3861-3p|mir|MIMAT0018797	tca-miR-3861-3p	MIMAT0018797	unmapped	CGCTCGGGTTTTCCCGAGCGGCGAAATGGAATTAAATGGATTTTTTTTT
A_38_P00031144	A_38_P00031144	mir|tca-miR-3861-3p|mir|MIMAT0018797	tca-miR-3861-3p	MIMAT0018797	unmapped	CGCTCGGGTTTTCCCGAGCGGCGAAATGGAATTAAATGGTTTTTTTTTTT
A_38_P00031145	A_38_P00031145	mir|tca-miR-3839-5p|mir|MIMAT0018722	tca-miR-3839-5p	MIMAT0018722	unmapped	CGCTCGGGTTTTCCCGAGCGGCGAACATATCGCAATTTTTTTTTTTTT
A_38_P00031146	A_38_P00031146	mir|tca-miR-3839-5p|mir|MIMAT0018722	tca-miR-3839-5p	MIMAT0018722	unmapped	CGCTCGGGTTTTCCCGAGCGGCGAACATATCGCAATTTCTATTTTTTTT
A_38_P00031147	A_38_P00031147	mir|tca-miR-3880-5p|mir|MIMAT0018856	tca-miR-3880-5p	MIMAT0018856	unmapped	CGCTCGGGTTTTCCCGAGCGGCGAATTCTTTCGTTTCTATTTTTTTTT
A_38_P00031148	A_38_P00031148	mir|tca-miR-3880-5p|mir|MIMAT0018856	tca-miR-3880-5p	MIMAT0018856	unmapped	CGCTCGGGTTTTCCCGAGCGGCGAATTCTTTCGTTTCTTTTTTTTTTTT
A_38_P00031149	A_38_P00031149	mir|tca-miR-279c-3p|mir|MIMAT0018731	tca-miR-279c-3p	MIMAT0018731	unmapped	CGCTCGGGTTTTCCCGAGCGGCGAGCGAATGTTCGTATTTTTTTT
A_38_P00031150	A_38_P00031150	mir|tca-miR-279c-3p|mir|MIMAT0018731	tca-miR-279c-3p	MIMAT0018731	unmapped	CGCTCGGGTTTTCCCGAGCGGCGAGCGAATGTTCGAATTTTTTTTT
A_38_P00031151	A_38_P00031151	mir|tca-miR-3822-3p|mir|MIMAT0018671	tca-miR-3822-3p	MIMAT0018671	unmapped	CGCTCGGGTTTTCCCGAGCGGCGAGGTTCACACAGTTTTTTTTTT
A_38_P00031152	A_38_P00031152	mir|tca-miR-3822-3p|mir|MIMAT0018671	tca-miR-3822-3p	MIMAT0018671	unmapped	CGCTCGGGTTTTCCCGAGCGGCGAGGTTCACACAGATTTTTTTTTT
A_38_P00031153	A_38_P00031153	mir|tca-miR-3851c-3p|mir|MIMAT0018773|mir|tca-miR-3851a-3p|mir|MIMAT0018759|mir|tca-miR-3851d-5p|mir|MIMAT0018778|mir|tca-miR-3851f-3p|mir|MIMAT0018785	tca-miR-3851c-3p	MIMAT0018773	unmapped	CGCTCGGGTTTTCCCGAGCGGCGAGTCGATTCGGATATTTTTTTT
A_38_P00031154	A_38_P00031154	mir|tca-miR-3851c-3p|mir|MIMAT0018773|mir|tca-miR-3851a-3p|mir|MIMAT0018759|mir|tca-miR-3851d-5p|mir|MIMAT0018778|mir|tca-miR-3851f-3p|mir|MIMAT0018785	tca-miR-3851c-3p	MIMAT0018773	unmapped	CGCTCGGGTTTTCCCGAGCGGCGAGTCGATTCGGAAATTTTTTTTT
A_38_P00031155	A_38_P00031155	mir|tca-miR-3851b-3p|mir|MIMAT0018757	tca-miR-3851b-3p	MIMAT0018757	unmapped	CGCTCGGGTTTTCCCGAGCGGCGAGTTGATTCGGAATTTTTTTTTT
A_38_P00031156	A_38_P00031156	mir|tca-miR-3851b-3p|mir|MIMAT0018757	tca-miR-3851b-3p	MIMAT0018757	unmapped	CGCTCGGGTTTTCCCGAGCGGCGAGTTGATTCGGAACTATTTTTTTT
A_38_P00031157	A_38_P00031157	mir|tca-miR-927a-3p|mir|MIMAT0019131|mir|tca-miR-927-3p_v18.0|mir|MIMAT0019131	tca-miR-927a-3p	MIMAT0019131	unmapped	CGCTCGGGTTTTCCCGAGCGGCGATTCAGAATCCAAACTTTTTTTTTT
A_38_P00031158	A_38_P00031158	mir|tca-miR-927a-3p|mir|MIMAT0019131|mir|tca-miR-927-3p_v18.0|mir|MIMAT0019131	tca-miR-927a-3p	MIMAT0019131	unmapped	CGCTCGGGTTTTCCCGAGCGGCGATTCAGAATCCAAACGTATTTTTTTT
A_38_P00031159	A_38_P00031159	mir|tca-miR-3828-3p|mir|MIMAT0018687	tca-miR-3828-3p	MIMAT0018687	unmapped	CGCTCGGGTTTTCCCGAGCGGCGATTCCGAGTACGTTTTTTTTTT
A_38_P00031160	A_38_P00031160	mir|tca-miR-3828-3p|mir|MIMAT0018687	tca-miR-3828-3p	MIMAT0018687	unmapped	CGCTCGGGTTTTCCCGAGCGGCGATTCCGAGTACGATTTTTTTTTT
A_38_P00031161	A_38_P00031161	mir|tca-miR-3791-5p|mir|MIMAT0018882	tca-miR-3791-5p	MIMAT0018882	unmapped	CGCTCGGGTTTTCCCGAGCGGCGCAACCACCGTTTTTTTTTTT
A_38_P00031162	A_38_P00031162	mir|tca-miR-3791-5p|mir|MIMAT0018882	tca-miR-3791-5p	MIMAT0018882	unmapped	CGCTCGGGTTTTCCCGAGCGGCGCAACCACCGTATATTTTTTTT
A_38_P00031163	A_38_P00031163	mir|tca-miR-3791-5p|mir|MIMAT0018882	tca-miR-3791-5p	MIMAT0018882	unmapped	CGCTCGGGTTTTCCCGAGCGGCGCAACCACCGTAAATTTTTTTTT
A_38_P00031164	A_38_P00031164	mir|tca-miR-308-3p|mir|MIMAT0018707	tca-miR-308-3p	MIMAT0018707	unmapped	CGCTCGGGTTTTCCCGAGCGGCGCACAGAATTTTCCATTTTTTTTT
A_38_P00031165	A_38_P00031165	mir|tca-miR-308-3p|mir|MIMAT0018707	tca-miR-308-3p	MIMAT0018707	unmapped	CGCTCGGGTTTTCCCGAGCGGCGCACAGAATTTTCCTTATTTTTTTT
A_38_P00031166	A_38_P00031166	mir|tca-miR-2796-5p|mir|MIMAT0018712	tca-miR-2796-5p	MIMAT0018712	unmapped	CGCTCGGGTTTTCCCGAGCGGCGCTGGAGGCCTTTTTTTTTT
A_38_P00031167	A_38_P00031167	mir|tca-miR-2796-5p|mir|MIMAT0018712	tca-miR-2796-5p	MIMAT0018712	unmapped	CGCTCGGGTTTTCCCGAGCGGCGCTGGAGGCCGTTTTTTTTTT
A_38_P00031168	A_38_P00031168	mir|tca-miR-3885-5p|mir|MIMAT0018868	tca-miR-3885-5p	MIMAT0018868	unmapped	CGCTCGGGTTTTCCCGAGCGGCGGCCGCCGTTTTTTTTTT
A_38_P00031169	A_38_P00031169	mir|tca-miR-3885-5p|mir|MIMAT0018868	tca-miR-3885-5p	MIMAT0018868	unmapped	CGCTCGGGTTTTCCCGAGCGGCGGCCGCCGCTTTTTTTTTT
A_38_P00031170	A_38_P00031170	mir|tca-miR-995-3p|mir|MIMAT0018629	tca-miR-995-3p	MIMAT0018629	unmapped	CGCTCGGGTTTTCCCGAGCGGCGTAAGCTGAATCATGTTTTTTTTTTT
A_38_P00031171	A_38_P00031171	mir|tca-miR-995-3p|mir|MIMAT0018629	tca-miR-995-3p	MIMAT0018629	unmapped	CGCTCGGGTTTTCCCGAGCGGCGTAAGCTGAATCATGTGTATTTTTTTT
A_38_P00031172	A_38_P00031172	mir|tca-miR-iab-8-3p|mir|MIMAT0018699|mir|tca-miR-iab-3p_v17.0|mir|MIMAT0018699	tca-miR-iab-8-3p	MIMAT0018699	unmapped	CGCTCGGGTTTTCCCGAGCGGCGTATACTGAATGTATCCATTTTTTTTT
A_38_P00031173	A_38_P00031173	mir|tca-miR-iab-8-3p|mir|MIMAT0018699|mir|tca-miR-iab-3p_v17.0|mir|MIMAT0018699	tca-miR-iab-8-3p	MIMAT0018699	unmapped	CGCTCGGGTTTTCCCGAGCGGCGTATACTGAATGTATCCTTTTTTTTTTT
A_38_P00031174	A_38_P00031174	mir|tca-miR-750-3p|mir|MIMAT0018821	tca-miR-750-3p	MIMAT0018821	unmapped	CGCTCGGGTTTTCCCGAGCGGCGTCATATGGAAGAGTTTTTTTTTTTT
A_38_P00031175	A_38_P00031175	mir|tca-miR-750-3p|mir|MIMAT0018821	tca-miR-750-3p	MIMAT0018821	unmapped	CGCTCGGGTTTTCCCGAGCGGCGTCATATGGAAGAGTTATTTTTTTTTT
A_38_P00031176	A_38_P00031176	mir|tca-miR-750-3p|mir|MIMAT0018821	tca-miR-750-3p	MIMAT0018821	unmapped	CGCTCGGGTTTTCCCGAGCGGCGTCATATGGAAGAGTTAGTATTTTTTTT
A_38_P00031177	A_38_P00031177	mir|tca-miR-279a-5p|mir|MIMAT0019125	tca-miR-279a-5p	MIMAT0019125	unmapped	CGCTCGGGTTTTCCCGAGCGGCGTGCCACTAGACTTTTTTTTTT
A_38_P00031178	A_38_P00031178	mir|tca-miR-279a-5p|mir|MIMAT0019125	tca-miR-279a-5p	MIMAT0019125	unmapped	CGCTCGGGTTTTCCCGAGCGGCGTGCCACTAGACCTTTTTTTTTT
A_38_P00031179	A_38_P00031179	mir|tca-miR-279d-5p|mir|MIMAT0018788	tca-miR-279d-5p	MIMAT0018788	unmapped	CGCTCGGGTTTTCCCGAGCGGCGTGGACTAAACCCTTTTTTTTTT
A_38_P00031180	A_38_P00031180	mir|tca-miR-279d-5p|mir|MIMAT0018788	tca-miR-279d-5p	MIMAT0018788	unmapped	CGCTCGGGTTTTCCCGAGCGGCGTGGACTAAACCCATTTTTTTTTT
A_38_P00031181	A_38_P00031181	mir|tca-miR-3806-3p|mir|MIMAT0018635	tca-miR-3806-3p	MIMAT0018635	unmapped	CGCTCGGGTTTTCCCGAGCGGCTAGATCTACTCCCGGTATTTTTTTT
A_38_P00031182	A_38_P00031182	mir|tca-miR-3806-3p|mir|MIMAT0018635	tca-miR-3806-3p	MIMAT0018635	unmapped	CGCTCGGGTTTTCCCGAGCGGCTAGATCTACTCCCGGAATTTTTTTTT
A_38_P00031183	A_38_P00031183	mir|tca-miR-316-3p|mir|MIMAT0018717	tca-miR-316-3p	MIMAT0018717	unmapped	CGCTCGGGTTTTCCCGAGCGGCTAGCCTCATCCTCTCATTTTTTTTT
A_38_P00031184	A_38_P00031184	mir|tca-miR-316-3p|mir|MIMAT0018717	tca-miR-316-3p	MIMAT0018717	unmapped	CGCTCGGGTTTTCCCGAGCGGCTAGCCTCATCCTCTCTTTTTTTTTTT
A_38_P00031185	A_38_P00031185	mir|tca-miR-3851e-3p|mir|MIMAT0018781	tca-miR-3851e-3p	MIMAT0018781	unmapped	CGCTCGGGTTTTCCCGAGCGGCTAGTCGATTCGGAACTATTTTTTTT
A_38_P00031186	A_38_P00031186	mir|tca-miR-3851e-3p|mir|MIMAT0018781	tca-miR-3851e-3p	MIMAT0018781	unmapped	CGCTCGGGTTTTCCCGAGCGGCTAGTCGATTCGGAACGATTTTTTTTT
A_38_P00031187	A_38_P00031187	mir|tca-let-7-5p|mir|MIMAT0008354	tca-let-7-5p	MIMAT0008354	unmapped	CGCTCGGGTTTTCCCGAGCGGCTATACAACCTACTACCTCTTTTTTTTTT
A_38_P00031188	A_38_P00031188	mir|tca-let-7-5p|mir|MIMAT0008354	tca-let-7-5p	MIMAT0008354	unmapped	CGCTCGGGTTTTCCCGAGCGGCTATACAACCTACTACCTCATTTTTTTTTT
A_38_P00031189	A_38_P00031189	mir|tca-miR-279d-3p|mir|MIMAT0018789	tca-miR-279d-3p	MIMAT0018789	unmapped	CGCTCGGGTTTTCCCGAGCGGCTATAGACGAGTATGGATCATTTTTTTTT
A_38_P00031190	A_38_P00031190	mir|tca-miR-279d-3p|mir|MIMAT0018789	tca-miR-279d-3p	MIMAT0018789	unmapped	CGCTCGGGTTTTCCCGAGCGGCTATAGACGAGTATGGATCTTTTTTTTTTT
A_38_P00031191	A_38_P00031191	mir|tca-miR-29-5p|mir|MIMAT0018802	tca-miR-29-5p	MIMAT0018802	unmapped	CGCTCGGGTTTTCCCGAGCGGCTCACCACCACACTTTTTTTTTT
A_38_P00031192	A_38_P00031192	mir|tca-miR-29-5p|mir|MIMAT0018802	tca-miR-29-5p	MIMAT0018802	unmapped	CGCTCGGGTTTTCCCGAGCGGCTCACCACCACACGTTTTTTTTTT
A_38_P00031193	A_38_P00031193	mir|tca-miR-932-3p|mir|MIMAT0019132	tca-miR-932-3p	MIMAT0019132	unmapped	CGCTCGGGTTTTCCCGAGCGGCTCACTTCCGCACTTTTTTTTTTT
A_38_P00031194	A_38_P00031194	mir|tca-miR-932-3p|mir|MIMAT0019132	tca-miR-932-3p	MIMAT0019132	unmapped	CGCTCGGGTTTTCCCGAGCGGCTCACTTCCGCACTGTATTTTTTTT
A_38_P00031195	A_38_P00031195	mir|tca-miR-3876-3p|mir|MIMAT0018845	tca-miR-3876-3p	MIMAT0018845	unmapped	CGCTCGGGTTTTCCCGAGCGGCTCATTTTACCACTGGTTATTTTTTTT
A_38_P00031196	A_38_P00031196	mir|tca-miR-3876-3p|mir|MIMAT0018845	tca-miR-3876-3p	MIMAT0018845	unmapped	CGCTCGGGTTTTCCCGAGCGGCTCATTTTACCACTGGTCATTTTTTTTT
A_38_P00031197	A_38_P00031197	mir|tca-miR-9a-3p|mir|MIMAT0019177	tca-miR-9a-3p	MIMAT0019177	unmapped	CGCTCGGGTTTTCCCGAGCGGCTCCGGTAACCTAGTATTTTTTTT
A_38_P00031198	A_38_P00031198	mir|tca-miR-9a-3p|mir|MIMAT0019177	tca-miR-9a-3p	MIMAT0019177	unmapped	CGCTCGGGTTTTCCCGAGCGGCTCCGGTAACCTAGCAATTTTTTTT
A_38_P00031199	A_38_P00031199	mir|tca-miR-3886-5p|mir|MIMAT0018870	tca-miR-3886-5p	MIMAT0018870	unmapped	CGCTCGGGTTTTCCCGAGCGGCTGTCAAAGCTCGCATTTTTTTTT
A_38_P00031200	A_38_P00031200	mir|tca-miR-3886-5p|mir|MIMAT0018870	tca-miR-3886-5p	MIMAT0018870	unmapped	CGCTCGGGTTTTCCCGAGCGGCTGTCAAAGCTCGCTTATTTTTTTT
A_38_P00031201	A_38_P00031201	mir|tca-bantam-5p|mir|MIMAT0019178	tca-bantam-5p	MIMAT0019178	unmapped	CGCTCGGGTTTTCCCGAGCGGCTGTCAAATCACTGTGTTTTTTTTTT
A_38_P00031202	A_38_P00031202	mir|tca-bantam-5p|mir|MIMAT0019178	tca-bantam-5p	MIMAT0019178	unmapped	CGCTCGGGTTTTCCCGAGCGGCTGTCAAATCACTGTGATTTTTTTTTT
A_38_P00031203	A_38_P00031203	mir|tca-miR-210-5p|mir|MIMAT0019120	tca-miR-210-5p	MIMAT0019120	unmapped	CGCTCGGGTTTTCCCGAGCGGCTTGTGCAGCGTCTTTTTTTTTT
A_38_P00031204	A_38_P00031204	mir|tca-miR-210-5p|mir|MIMAT0019120	tca-miR-210-5p	MIMAT0019120	unmapped	CGCTCGGGTTTTCCCGAGCGGCTTGTGCAGCGTCCTTTTTTTTTT
A_38_P00031205	A_38_P00031205	mir|tca-miR-3825-3p|mir|MIMAT0018679	tca-miR-3825-3p	MIMAT0018679	unmapped	CGCTCGGGTTTTCCCGAGCGGCTTGTTGTCTTCTCCTTTTTTTTTT
A_38_P00031206	A_38_P00031206	mir|tca-miR-3825-3p|mir|MIMAT0018679	tca-miR-3825-3p	MIMAT0018679	unmapped	CGCTCGGGTTTTCCCGAGCGGCTTGTTGTCTTCTCCGTTTTTTTTTT
A_38_P00031207	A_38_P00031207	mir|tca-miR-3837-3p|mir|MIMAT0018709	tca-miR-3837-3p	MIMAT0018709	unmapped	CGCTCGGGTTTTCCCGAGCGGCTTTCATAAAAACAATCAATTTTTTTT
A_38_P00031208	A_38_P00031208	mir|tca-miR-3837-3p|mir|MIMAT0018709	tca-miR-3837-3p	MIMAT0018709	unmapped	CGCTCGGGTTTTCCCGAGCGGCTTTCATAAAAACAATCTATTTTTTTTT
A_38_P00031209	A_38_P00031209	mir|tca-miR-3837-3p|mir|MIMAT0018709	tca-miR-3837-3p	MIMAT0018709	unmapped	CGCTCGGGTTTTCCCGAGCGGCTTTCATAAAAACAATCTTTTTTTTTTTT
A_38_P00031210	A_38_P00031210	mir|tca-miR-9d-3p|mir|MIMAT0018749	tca-miR-9d-3p	MIMAT0018749	unmapped	CGCTCGGGTTTTCCCGAGCGGCTTTGGTGAATCTAGCTAATTTTTTTT
A_38_P00031211	A_38_P00031211	mir|tca-miR-9d-3p|mir|MIMAT0018749	tca-miR-9d-3p	MIMAT0018749	unmapped	CGCTCGGGTTTTCCCGAGCGGCTTTGGTGAATCTAGCTTATTTTTTTTT
A_38_P00031212	A_38_P00031212	mir|tca-miR-3858-5p|mir|MIMAT0018782	tca-miR-3858-5p	MIMAT0018782	unmapped	CGCTCGGGTTTTCCCGAGCGGGAAAAAACTTCGCTTCATATTTTTTTT
A_38_P00031213	A_38_P00031213	mir|tca-miR-3858-5p|mir|MIMAT0018782	tca-miR-3858-5p	MIMAT0018782	unmapped	CGCTCGGGTTTTCCCGAGCGGGAAAAAACTTCGCTTCACATTTTTTTTT
A_38_P00031214	A_38_P00031214	mir|tca-miR-3829-5p|mir|MIMAT0018688	tca-miR-3829-5p	MIMAT0018688	unmapped	CGCTCGGGTTTTCCCGAGCGGGAAACGGCATCGAGTTTTTTTTTT
A_38_P00031215	A_38_P00031215	mir|tca-miR-3829-5p|mir|MIMAT0018688	tca-miR-3829-5p	MIMAT0018688	unmapped	CGCTCGGGTTTTCCCGAGCGGGAAACGGCATCGAGGTTTTTTTTTT
A_38_P00031216	A_38_P00031216	mir|tca-miR-7-5p|mir|MIMAT0008355	tca-miR-7-5p	MIMAT0008355	unmapped	CGCTCGGGTTTTCCCGAGCGGGAACAACAAAATCACTAGTTATTTTTTTT
A_38_P00031217	A_38_P00031217	mir|tca-miR-7-5p|mir|MIMAT0008355	tca-miR-7-5p	MIMAT0008355	unmapped	CGCTCGGGTTTTCCCGAGCGGGAACAACAAAATCACTAGTCAATTTTTTTT
A_38_P00031218	A_38_P00031218	mir|tca-miR-29-3p|mir|MIMAT0018803	tca-miR-29-3p	MIMAT0018803	unmapped	CGCTCGGGTTTTCCCGAGCGGGAACTGATTTCATATGGTTTTTTTTTTT
A_38_P00031219	A_38_P00031219	mir|tca-miR-29-3p|mir|MIMAT0018803	tca-miR-29-3p	MIMAT0018803	unmapped	CGCTCGGGTTTTCCCGAGCGGGAACTGATTTCATATGGTGTATTTTTTTT
A_38_P00031220	A_38_P00031220	mir|tca-miR-3814-5p|mir|MIMAT0018652	tca-miR-3814-5p	MIMAT0018652	unmapped	CGCTCGGGTTTTCCCGAGCGGGAATAGAGCGCTAAATTGATTTTTTTTT
A_38_P00031221	A_38_P00031221	mir|tca-miR-3814-5p|mir|MIMAT0018652	tca-miR-3814-5p	MIMAT0018652	unmapped	CGCTCGGGTTTTCCCGAGCGGGAATAGAGCGCTAAATTGTTTTTTTTTTT
A_38_P00031222	A_38_P00031222	mir|tca-miR-3803-3p|mir|MIMAT0018623	tca-miR-3803-3p	MIMAT0018623	unmapped	CGCTCGGGTTTTCCCGAGCGGGACACCAGTTACAATGTATTTTTTTT
A_38_P00031223	A_38_P00031223	mir|tca-miR-3803-3p|mir|MIMAT0018623	tca-miR-3803-3p	MIMAT0018623	unmapped	CGCTCGGGTTTTCCCGAGCGGGACACCAGTTACAATGGATTTTTTTTT
A_38_P00031224	A_38_P00031224	mir|tca-miR-3863-5p|mir|MIMAT0018808	tca-miR-3863-5p	MIMAT0018808	unmapped	CGCTCGGGTTTTCCCGAGCGGGACCAAGCGGCGTATTTTTTTT
A_38_P00031225	A_38_P00031225	mir|tca-miR-3863-5p|mir|MIMAT0018808	tca-miR-3863-5p	MIMAT0018808	unmapped	CGCTCGGGTTTTCCCGAGCGGGACCAAGCGGCGCATTTTTTTTT
A_38_P00031226	A_38_P00031226	mir|tca-miR-3805a-3p|mir|MIMAT0018633	tca-miR-3805a-3p	MIMAT0018633	unmapped	CGCTCGGGTTTTCCCGAGCGGGACCGTCAGATGCTTTTTTTTTT
A_38_P00031227	A_38_P00031227	mir|tca-miR-3805a-3p|mir|MIMAT0018633	tca-miR-3805a-3p	MIMAT0018633	unmapped	CGCTCGGGTTTTCCCGAGCGGGACCGTCAGATGCGTTTTTTTTTT
A_38_P00031228	A_38_P00031228	mir|tca-miR-3849-3p|mir|MIMAT0018753	tca-miR-3849-3p	MIMAT0018753	unmapped	CGCTCGGGTTTTCCCGAGCGGGACGACATTTCCAACTTTTTTTTTT
A_38_P00031229	A_38_P00031229	mir|tca-miR-3849-3p|mir|MIMAT0018753	tca-miR-3849-3p	MIMAT0018753	unmapped	CGCTCGGGTTTTCCCGAGCGGGACGACATTTCCAACATTTTTTTTTT
A_38_P00031230	A_38_P00031230	mir|tca-miR-3901-5p|mir|MIMAT0018906	tca-miR-3901-5p	MIMAT0018906	unmapped	CGCTCGGGTTTTCCCGAGCGGGACTCATAAAATCAAATATTTTTTTT
A_38_P00031231	A_38_P00031231	mir|tca-miR-3901-5p|mir|MIMAT0018906	tca-miR-3901-5p	MIMAT0018906	unmapped	CGCTCGGGTTTTCCCGAGCGGGACTCATAAAATCAAAAATTTTTTTTT
A_38_P00031232	A_38_P00031232	mir|tca-miR-3901-5p|mir|MIMAT0018906	tca-miR-3901-5p	MIMAT0018906	unmapped	CGCTCGGGTTTTCCCGAGCGGGACTCATAAAATCAAAATTTTTTTTTTT
A_38_P00031233	A_38_P00031233	mir|tca-miR-3901-5p|mir|MIMAT0018906	tca-miR-3901-5p	MIMAT0018906	unmapped	CGCTCGGGTTTTCCCGAGCGGGACTCATAAAATCAAAATGTTTTTTTTTT
A_38_P00031236	A_38_P00031236	mir|tca-miR-1175-3p|mir|MIMAT0018819	tca-miR-1175-3p	MIMAT0018819	unmapped	CGCTCGGGTTTTCCCGAGCGGGAGATGGAGGAGTTGATATTTTTTTT
A_38_P00031237	A_38_P00031237	mir|tca-miR-1175-3p|mir|MIMAT0018819	tca-miR-1175-3p	MIMAT0018819	unmapped	CGCTCGGGTTTTCCCGAGCGGGAGATGGAGGAGTTGAAATTTTTTTTT
A_38_P00031238	A_38_P00031238	mir|tca-miR-305-5p|mir|MIMAT0008388	tca-miR-305-5p	MIMAT0008388	unmapped	CGCTCGGGTTTTCCCGAGCGGGAGCACCTGATGAAGATTTTTTTTT
A_38_P00031239	A_38_P00031239	mir|tca-miR-305-5p|mir|MIMAT0008388	tca-miR-305-5p	MIMAT0008388	unmapped	CGCTCGGGTTTTCCCGAGCGGGAGCACCTGATGAAGTTTTTTTTTTT
A_38_P00031240	A_38_P00031240	mir|tca-miR-3857-3p|mir|MIMAT0018775	tca-miR-3857-3p	MIMAT0018775	unmapped	CGCTCGGGTTTTCCCGAGCGGGAGCATTGAGACACCTTTTTTTTTT
A_38_P00031241	A_38_P00031241	mir|tca-miR-3857-3p|mir|MIMAT0018775	tca-miR-3857-3p	MIMAT0018775	unmapped	CGCTCGGGTTTTCCCGAGCGGGAGCATTGAGACACCATTTTTTTTTT
A_38_P00031242	A_38_P00031242	mir|tca-miR-263a-3p|mir|MIMAT0019180	tca-miR-263a-3p	MIMAT0019180	unmapped	CGCTCGGGTTTTCCCGAGCGGGAGGATGGCACTCATTTTTTTTTT
A_38_P00031243	A_38_P00031243	mir|tca-miR-263a-3p|mir|MIMAT0019180	tca-miR-263a-3p	MIMAT0019180	unmapped	CGCTCGGGTTTTCCCGAGCGGGAGGATGGCACTCAATTTTTTTTTT
A_38_P00031244	A_38_P00031244	mir|tca-miR-263a-3p|mir|MIMAT0019180	tca-miR-263a-3p	MIMAT0019180	unmapped	CGCTCGGGTTTTCCCGAGCGGGAGGATGGCACTCAAATATTTTTTTT
A_38_P00031245	A_38_P00031245	mir|tca-miR-3879-3p|mir|MIMAT0018851	tca-miR-3879-3p	MIMAT0018851	unmapped	CGCTCGGGTTTTCCCGAGCGGGAGGGCTTTATGGCTTTTTTTTTT
A_38_P00031246	A_38_P00031246	mir|tca-miR-3879-3p|mir|MIMAT0018851	tca-miR-3879-3p	MIMAT0018851	unmapped	CGCTCGGGTTTTCCCGAGCGGGAGGGCTTTATGGCCTTTTTTTTTT
A_38_P00031247	A_38_P00031247	mir|tca-miR-3877-5p|mir|MIMAT0018846	tca-miR-3877-5p	MIMAT0018846	unmapped	CGCTCGGGTTTTCCCGAGCGGGAGTGCTTTTTTGGAATTTTTTTTTT
A_38_P00031248	A_38_P00031248	mir|tca-miR-3877-5p|mir|MIMAT0018846	tca-miR-3877-5p	MIMAT0018846	unmapped	CGCTCGGGTTTTCCCGAGCGGGAGTGCTTTTTTGGAAGTATTTTTTTT
A_38_P00031249	A_38_P00031249	mir|tca-miR-3877-5p|mir|MIMAT0018846	tca-miR-3877-5p	MIMAT0018846	unmapped	CGCTCGGGTTTTCCCGAGCGGGAGTGCTTTTTTGGAAGGATTTTTTTTT
A_38_P00031250	A_38_P00031250	mir|tca-miR-13a-5p|mir|MIMAT0019103	tca-miR-13a-5p	MIMAT0019103	unmapped	CGCTCGGGTTTTCCCGAGCGGGAGTTCACAACCAAATTTTTTTTTTTT
A_38_P00031251	A_38_P00031251	mir|tca-miR-13a-5p|mir|MIMAT0019103	tca-miR-13a-5p	MIMAT0019103	unmapped	CGCTCGGGTTTTCCCGAGCGGGAGTTCACAACCAAATTGTTTTTTTTTT
A_38_P00031252	A_38_P00031252	mir|tca-miR-252a-3p|mir|MIMAT0018805	tca-miR-252a-3p	MIMAT0018805	unmapped	CGCTCGGGTTTTCCCGAGCGGGATAAGCACTTGAGCATTTTTTTTTT
A_38_P00031253	A_38_P00031253	mir|tca-miR-252a-3p|mir|MIMAT0018805	tca-miR-252a-3p	MIMAT0018805	unmapped	CGCTCGGGTTTTCCCGAGCGGGATAAGCACTTGAGCAGTTTTTTTTTT
A_38_P00031254	A_38_P00031254	mir|tca-miR-252a-3p|mir|MIMAT0018805	tca-miR-252a-3p	MIMAT0018805	unmapped	CGCTCGGGTTTTCCCGAGCGGGATAAGCACTTGAGCAGCTTTTTTTTTT
A_38_P00031255	A_38_P00031255	mir|tca-miR-3861-5p|mir|MIMAT0018796	tca-miR-3861-5p	MIMAT0018796	unmapped	CGCTCGGGTTTTCCCGAGCGGGATACCAAATAATTCCTATTTTTTTT
A_38_P00031256	A_38_P00031256	mir|tca-miR-3861-5p|mir|MIMAT0018796	tca-miR-3861-5p	MIMAT0018796	unmapped	CGCTCGGGTTTTCCCGAGCGGGATACCAAATAATTCCAATTTTTTTTT
A_38_P00031257	A_38_P00031257	mir|tca-miR-3861-5p|mir|MIMAT0018796	tca-miR-3861-5p	MIMAT0018796	unmapped	CGCTCGGGTTTTCCCGAGCGGGATACCAAATAATTCCATTTTTTTTTTT
A_38_P00031258	A_38_P00031258	mir|tca-miR-3867-5p|mir|MIMAT0018826	tca-miR-3867-5p	MIMAT0018826	unmapped	CGCTCGGGTTTTCCCGAGCGGGATACCGTTCCCTGTATTTTTTTT
A_38_P00031259	A_38_P00031259	mir|tca-miR-3867-5p|mir|MIMAT0018826	tca-miR-3867-5p	MIMAT0018826	unmapped	CGCTCGGGTTTTCCCGAGCGGGATACCGTTCCCTGCAATTTTTTTT
A_38_P00031260	A_38_P00031260	mir|tca-miR-219-3p|mir|MIMAT0019121	tca-miR-219-3p	MIMAT0019121	unmapped	CGCTCGGGTTTTCCCGAGCGGGATGATGTCCACACACTTTTTTTTTT
A_38_P00031261	A_38_P00031261	mir|tca-miR-219-3p|mir|MIMAT0019121	tca-miR-219-3p	MIMAT0019121	unmapped	CGCTCGGGTTTTCCCGAGCGGGATGATGTCCACACACATATTTTTTTT
A_38_P00031262	A_38_P00031262	mir|tca-miR-279e-3p|mir|MIMAT0018817	tca-miR-279e-3p	MIMAT0018817	unmapped	CGCTCGGGTTTTCCCGAGCGGGCAAGCGAGTGTTCTTTTTTTTTT
A_38_P00031263	A_38_P00031263	mir|tca-miR-279e-3p|mir|MIMAT0018817	tca-miR-279e-3p	MIMAT0018817	unmapped	CGCTCGGGTTTTCCCGAGCGGGCAAGCGAGTGTTCGTATTTTTTTT
A_38_P00031264	A_38_P00031264	mir|tca-miR-3833-3p|mir|MIMAT0018697	tca-miR-3833-3p	MIMAT0018697	unmapped	CGCTCGGGTTTTCCCGAGCGGGCAAGCTTCAGGAAGTTTTTTTTTT
A_38_P00031265	A_38_P00031265	mir|tca-miR-3833-3p|mir|MIMAT0018697	tca-miR-3833-3p	MIMAT0018697	unmapped	CGCTCGGGTTTTCCCGAGCGGGCAAGCTTCAGGAAGGTATTTTTTTT
A_38_P00031266	A_38_P00031266	mir|tca-miR-3865-3p|mir|MIMAT0018815	tca-miR-3865-3p	MIMAT0018815	unmapped	CGCTCGGGTTTTCCCGAGCGGGCAAGGAAACCACATATTTTTTTT
A_38_P00031267	A_38_P00031267	mir|tca-miR-3865-3p|mir|MIMAT0018815	tca-miR-3865-3p	MIMAT0018815	unmapped	CGCTCGGGTTTTCCCGAGCGGGCAAGGAAACCACACATTTTTTTTT
A_38_P00031270	A_38_P00031270	mir|tca-miR-3804b-3p|mir|MIMAT0018627	tca-miR-3804b-3p	MIMAT0018627	unmapped	CGCTCGGGTTTTCCCGAGCGGGCACACTTATGGAACAAATTTTTTTT
A_38_P00031271	A_38_P00031271	mir|tca-miR-3804b-3p|mir|MIMAT0018627	tca-miR-3804b-3p	MIMAT0018627	unmapped	CGCTCGGGTTTTCCCGAGCGGGCACACTTATGGAACATATTTTTTTTT
A_38_P00031272	A_38_P00031272	mir|tca-miR-3804b-3p|mir|MIMAT0018627	tca-miR-3804b-3p	MIMAT0018627	unmapped	CGCTCGGGTTTTCCCGAGCGGGCACACTTATGGAACATTTTTTTTTTTT
A_38_P00031273	A_38_P00031273	mir|tca-miR-316-5p|mir|MIMAT0018716	tca-miR-316-5p	MIMAT0018716	unmapped	CGCTCGGGTTTTCCCGAGCGGGCAGCAAAGCGGATTTTTTTTTT
A_38_P00031274	A_38_P00031274	mir|tca-miR-316-5p|mir|MIMAT0018716	tca-miR-316-5p	MIMAT0018716	unmapped	CGCTCGGGTTTTCCCGAGCGGGCAGCAAAGCGGAATTTTTTTTTT
A_38_P00031275	A_38_P00031275	mir|tca-miR-3883-5p|mir|MIMAT0018862	tca-miR-3883-5p	MIMAT0018862	unmapped	CGCTCGGGTTTTCCCGAGCGGGCCAAACTCGCTAACTTTTTTTTTT
A_38_P00031276	A_38_P00031276	mir|tca-miR-3883-5p|mir|MIMAT0018862	tca-miR-3883-5p	MIMAT0018862	unmapped	CGCTCGGGTTTTCCCGAGCGGGCCAAACTCGCTAACGTTTTTTTTTT
A_38_P00031279	A_38_P00031279	mir|tca-miR-998-5p|mir|MIMAT0018852	tca-miR-998-5p	MIMAT0018852	unmapped	CGCTCGGGTTTTCCCGAGCGGGCCCACATGAAATTCATATTTTTTTT
A_38_P00031280	A_38_P00031280	mir|tca-miR-998-5p|mir|MIMAT0018852	tca-miR-998-5p	MIMAT0018852	unmapped	CGCTCGGGTTTTCCCGAGCGGGCCCACATGAAATTCAGATTTTTTTTT
A_38_P00031281	A_38_P00031281	mir|tca-miR-3892-3p|mir|MIMAT0018885	tca-miR-3892-3p	MIMAT0018885	unmapped	CGCTCGGGTTTTCCCGAGCGGGCCCCCAATGTGATATTTTTTTT
A_38_P00031282	A_38_P00031282	mir|tca-miR-3892-3p|mir|MIMAT0018885	tca-miR-3892-3p	MIMAT0018885	unmapped	CGCTCGGGTTTTCCCGAGCGGGCCCCCAATGTGAAAATTTTTTTT
A_38_P00031283	A_38_P00031283	mir|tca-miR-3892-3p|mir|MIMAT0018885	tca-miR-3892-3p	MIMAT0018885	unmapped	CGCTCGGGTTTTCCCGAGCGGGCCCCCAATGTGAATATTTTTTTTT
A_38_P00031284	A_38_P00031284	mir|tca-miR-3871-3p|mir|MIMAT0018835	tca-miR-3871-3p	MIMAT0018835	unmapped	CGCTCGGGTTTTCCCGAGCGGGCCCGATTAGGCATTTTTTTTTT
A_38_P00031285	A_38_P00031285	mir|tca-miR-3871-3p|mir|MIMAT0018835	tca-miR-3871-3p	MIMAT0018835	unmapped	CGCTCGGGTTTTCCCGAGCGGGCCCGATTAGGCAATATTTTTTTT
A_38_P00031286	A_38_P00031286	mir|tca-miR-3871-3p|mir|MIMAT0018835	tca-miR-3871-3p	MIMAT0018835	unmapped	CGCTCGGGTTTTCCCGAGCGGGCCCGATTAGGCAAAATTTTTTTTT
A_38_P00031287	A_38_P00031287	mir|tca-miR-3855-5p|mir|MIMAT0018766	tca-miR-3855-5p	MIMAT0018766	unmapped	CGCTCGGGTTTTCCCGAGCGGGCGAAACCTTTAACAATATTTTTTTT
A_38_P00031288	A_38_P00031288	mir|tca-miR-3855-5p|mir|MIMAT0018766	tca-miR-3855-5p	MIMAT0018766	unmapped	CGCTCGGGTTTTCCCGAGCGGGCGAAACCTTTAACAAAATTTTTTTTT
A_38_P00031289	A_38_P00031289	mir|tca-miR-3855-5p|mir|MIMAT0018766	tca-miR-3855-5p	MIMAT0018766	unmapped	CGCTCGGGTTTTCCCGAGCGGGCGAAACCTTTAACAAATTATTTTTTTT
A_38_P00031290	A_38_P00031290	mir|tca-miR-3864-3p|mir|MIMAT0018813	tca-miR-3864-3p	MIMAT0018813	unmapped	CGCTCGGGTTTTCCCGAGCGGGCGACATAGTAGGAGTATTTTTTTT
A_38_P00031291	A_38_P00031291	mir|tca-miR-3864-3p|mir|MIMAT0018813	tca-miR-3864-3p	MIMAT0018813	unmapped	CGCTCGGGTTTTCCCGAGCGGGCGACATAGTAGGAGGAATTTTTTTT
A_38_P00031292	A_38_P00031292	mir|tca-miR-3889-3p|mir|MIMAT0018877	tca-miR-3889-3p	MIMAT0018877	unmapped	CGCTCGGGTTTTCCCGAGCGGGCGACGTGTTCAATTTTTTTTTTT
A_38_P00031293	A_38_P00031293	mir|tca-miR-3889-3p|mir|MIMAT0018877	tca-miR-3889-3p	MIMAT0018877	unmapped	CGCTCGGGTTTTCCCGAGCGGGCGACGTGTTCAATCTTTTTTTTTT
A_38_P00031294	A_38_P00031294	mir|tca-miR-3875-3p|mir|MIMAT0018843	tca-miR-3875-3p	MIMAT0018843	unmapped	CGCTCGGGTTTTCCCGAGCGGGCGCTATCTAGCGCTTTTTTTTTT
A_38_P00031295	A_38_P00031295	mir|tca-miR-3875-3p|mir|MIMAT0018843	tca-miR-3875-3p	MIMAT0018843	unmapped	CGCTCGGGTTTTCCCGAGCGGGCGCTATCTAGCGCATTTTTTTTTT
A_38_P00031296	A_38_P00031296	mir|tca-miR-3871-5p|mir|MIMAT0018834	tca-miR-3871-5p	MIMAT0018834	unmapped	CGCTCGGGTTTTCCCGAGCGGGCGGCACAAGGCTTTTTTTTTT
A_38_P00031297	A_38_P00031297	mir|tca-miR-3871-5p|mir|MIMAT0018834	tca-miR-3871-5p	MIMAT0018834	unmapped	CGCTCGGGTTTTCCCGAGCGGGCGGCACAAGGCATTTTTTTTTT
A_38_P00031298	A_38_P00031298	mir|tca-miR-3891-3p|mir|MIMAT0018881	tca-miR-3891-3p	MIMAT0018881	unmapped	CGCTCGGGTTTTCCCGAGCGGGCGGTGAGGTATTTACTTTTTTTTTT
A_38_P00031299	A_38_P00031299	mir|tca-miR-3891-3p|mir|MIMAT0018881	tca-miR-3891-3p	MIMAT0018881	unmapped	CGCTCGGGTTTTCCCGAGCGGGCGGTGAGGTATTTACATATTTTTTTT
A_38_P00031300	A_38_P00031300	mir|tca-miR-3844-5p|mir|MIMAT0018734	tca-miR-3844-5p	MIMAT0018734	unmapped	CGCTCGGGTTTTCCCGAGCGGGCGTGGGGTTTTCATTTTTTTTT
A_38_P00031301	A_38_P00031301	mir|tca-miR-3844-5p|mir|MIMAT0018734	tca-miR-3844-5p	MIMAT0018734	unmapped	CGCTCGGGTTTTCCCGAGCGGGCGTGGGGTTTTCTTTTTTTTTTT
A_38_P00031302	A_38_P00031302	mir|tca-miR-3845-3p|mir|MIMAT0018739	tca-miR-3845-3p	MIMAT0018739	unmapped	CGCTCGGGTTTTCCCGAGCGGGCGTGGGTCCCTTTTTTTTTT
A_38_P00031303	A_38_P00031303	mir|tca-miR-3845-3p|mir|MIMAT0018739	tca-miR-3845-3p	MIMAT0018739	unmapped	CGCTCGGGTTTTCCCGAGCGGGCGTGGGTCCCATTTTTTTTTT
A_38_P00031304	A_38_P00031304	mir|tca-miR-3887-5p|mir|MIMAT0018872	tca-miR-3887-5p	MIMAT0018872	unmapped	CGCTCGGGTTTTCCCGAGCGGGCGTTTTTATGACAACTTTTTTTTTT
A_38_P00031305	A_38_P00031305	mir|tca-miR-3887-5p|mir|MIMAT0018872	tca-miR-3887-5p	MIMAT0018872	unmapped	CGCTCGGGTTTTCCCGAGCGGGCGTTTTTATGACAACCTTTTTTTTTT
A_38_P00031306	A_38_P00031306	mir|tca-miR-3812-3p|mir|MIMAT0018647	tca-miR-3812-3p	MIMAT0018647	unmapped	CGCTCGGGTTTTCCCGAGCGGGCTAAGTGATGATGTGTTTTTTTTTT
A_38_P00031307	A_38_P00031307	mir|tca-miR-3812-3p|mir|MIMAT0018647	tca-miR-3812-3p	MIMAT0018647	unmapped	CGCTCGGGTTTTCCCGAGCGGGCTAAGTGATGATGTGCTTTTTTTTTT
A_38_P00031308	A_38_P00031308	mir|tca-miR-980-5p|mir|MIMAT0018864	tca-miR-980-5p	MIMAT0018864	unmapped	CGCTCGGGTTTTCCCGAGCGGGCTACCCCATGACGTTTTTTTTTT
A_38_P00031309	A_38_P00031309	mir|tca-miR-980-5p|mir|MIMAT0018864	tca-miR-980-5p	MIMAT0018864	unmapped	CGCTCGGGTTTTCCCGAGCGGGCTACCCCATGACGATTTTTTTTTT
A_38_P00031310	A_38_P00031310	mir|tca-miR-3820-5p|mir|MIMAT0018666	tca-miR-3820-5p	MIMAT0018666	unmapped	CGCTCGGGTTTTCCCGAGCGGGCTGTAACGGCTTGTTTTTTTTTT
A_38_P00031311	A_38_P00031311	mir|tca-miR-3820-5p|mir|MIMAT0018666	tca-miR-3820-5p	MIMAT0018666	unmapped	CGCTCGGGTTTTCCCGAGCGGGCTGTAACGGCTTGGTTTTTTTTTT
A_38_P00031312	A_38_P00031312	mir|tca-miR-1000-5p|mir|MIMAT0010097	tca-miR-1000-5p	MIMAT0010097	unmapped	CGCTCGGGTTTTCCCGAGCGGGCTGTGACAGGACATATTTTTTTT
A_38_P00031313	A_38_P00031313	mir|tca-miR-1000-5p|mir|MIMAT0010097	tca-miR-1000-5p	MIMAT0010097	unmapped	CGCTCGGGTTTTCCCGAGCGGGCTGTGACAGGACAAATTTTTTTTT
A_38_P00031314	A_38_P00031314	mir|tca-miR-995-5p|mir|MIMAT0018628	tca-miR-995-5p	MIMAT0018628	unmapped	CGCTCGGGTTTTCCCGAGCGGGGAAGCACCTCAAGAAATTTTTTTT
A_38_P00031315	A_38_P00031315	mir|tca-miR-995-5p|mir|MIMAT0018628	tca-miR-995-5p	MIMAT0018628	unmapped	CGCTCGGGTTTTCCCGAGCGGGGAAGCACCTCAAGATATTTTTTTTT
A_38_P00031316	A_38_P00031316	mir|tca-miR-34-3p|mir|MIMAT0019108	tca-miR-34-3p	MIMAT0019108	unmapped	CGCTCGGGTTTTCCCGAGCGGGGAGGGAGTATGGATATATTTTTTTT
A_38_P00031317	A_38_P00031317	mir|tca-miR-34-3p|mir|MIMAT0019108	tca-miR-34-3p	MIMAT0019108	unmapped	CGCTCGGGTTTTCCCGAGCGGGGAGGGAGTATGGATAGATTTTTTTTT
A_38_P00031318	A_38_P00031318	mir|tca-miR-3834-5p|mir|MIMAT0018700	tca-miR-3834-5p	MIMAT0018700	unmapped	CGCTCGGGTTTTCCCGAGCGGGGAGGTCGAAAATAACTATTTTTTTT
A_38_P00031319	A_38_P00031319	mir|tca-miR-3834-5p|mir|MIMAT0018700	tca-miR-3834-5p	MIMAT0018700	unmapped	CGCTCGGGTTTTCCCGAGCGGGGAGGTCGAAAATAACAATTTTTTTTT
A_38_P00031320	A_38_P00031320	mir|tca-miR-3838-3p|mir|MIMAT0018721	tca-miR-3838-3p	MIMAT0018721	unmapped	CGCTCGGGTTTTCCCGAGCGGGGCAGGTAGACAGGTATTTTTTTT
A_38_P00031321	A_38_P00031321	mir|tca-miR-3838-3p|mir|MIMAT0018721	tca-miR-3838-3p	MIMAT0018721	unmapped	CGCTCGGGTTTTCCCGAGCGGGGCAGGTAGACAGGAATTTTTTTTT
A_38_P00031322	A_38_P00031322	mir|tca-miR-3802-3p|mir|MIMAT0018621	tca-miR-3802-3p	MIMAT0018621	unmapped	CGCTCGGGTTTTCCCGAGCGGGGCGACTACGATATAACTTTTTTTTTT
A_38_P00031323	A_38_P00031323	mir|tca-miR-3802-3p|mir|MIMAT0018621	tca-miR-3802-3p	MIMAT0018621	unmapped	CGCTCGGGTTTTCCCGAGCGGGGCGACTACGATATAACGTATTTTTTTT
A_38_P00031324	A_38_P00031324	mir|tca-miR-3888-5p|mir|MIMAT0018874	tca-miR-3888-5p	MIMAT0018874	unmapped	CGCTCGGGTTTTCCCGAGCGGGGCGTGACATTCAAATTTTTTTTTT
A_38_P00031325	A_38_P00031325	mir|tca-miR-3888-5p|mir|MIMAT0018874	tca-miR-3888-5p	MIMAT0018874	unmapped	CGCTCGGGTTTTCCCGAGCGGGGCGTGACATTCAAAGTTTTTTTTTT
A_38_P00031326	A_38_P00031326	mir|tca-miR-3859-5p|mir|MIMAT0018790	tca-miR-3859-5p	MIMAT0018790	unmapped	CGCTCGGGTTTTCCCGAGCGGGGCTTAAATGTGTGGTTTTTTTTTT
A_38_P00031327	A_38_P00031327	mir|tca-miR-3859-5p|mir|MIMAT0018790	tca-miR-3859-5p	MIMAT0018790	unmapped	CGCTCGGGTTTTCCCGAGCGGGGCTTAAATGTGTGGGTATTTTTTTT
A_38_P00031328	A_38_P00031328	mir|tca-miR-3869-5p|mir|MIMAT0018830	tca-miR-3869-5p	MIMAT0018830	unmapped	CGCTCGGGTTTTCCCGAGCGGGGCTTTTCGAGACCTATTTTTTTT
A_38_P00031329	A_38_P00031329	mir|tca-miR-3869-5p|mir|MIMAT0018830	tca-miR-3869-5p	MIMAT0018830	unmapped	CGCTCGGGTTTTCCCGAGCGGGGCTTTTCGAGACCAATTTTTTTTT
A_38_P00031330	A_38_P00031330	mir|tca-let-7-3p|mir|MIMAT0019098	tca-let-7-3p	MIMAT0019098	unmapped	CGCTCGGGTTTTCCCGAGCGGGGGAAAGTTAGCAGGTATTTTTTTT
A_38_P00031331	A_38_P00031331	mir|tca-let-7-3p|mir|MIMAT0019098	tca-let-7-3p	MIMAT0019098	unmapped	CGCTCGGGTTTTCCCGAGCGGGGGAAAGTTAGCAGGCATTTTTTTTT
A_38_P00031332	A_38_P00031332	mir|tca-miR-3049-3p|mir|MIMAT0018777	tca-miR-3049-3p	MIMAT0018777	unmapped	CGCTCGGGTTTTCCCGAGCGGGGGAATGCAGCGATTTTTTTTTT
A_38_P00031333	A_38_P00031333	mir|tca-miR-3049-3p|mir|MIMAT0018777	tca-miR-3049-3p	MIMAT0018777	unmapped	CGCTCGGGTTTTCCCGAGCGGGGGAATGCAGCGAATTTTTTTTTT
A_38_P00031334	A_38_P00031334	mir|tca-miR-87a-5p|mir|MIMAT0019110	tca-miR-87a-5p	MIMAT0019110	unmapped	CGCTCGGGTTTTCCCGAGCGGGGGAGAGCAAGATTTCTTTTTTTTTT
A_38_P00031335	A_38_P00031335	mir|tca-miR-87a-5p|mir|MIMAT0019110	tca-miR-87a-5p	MIMAT0019110	unmapped	CGCTCGGGTTTTCCCGAGCGGGGGAGAGCAAGATTTCATTTTTTTTTT
A_38_P00031336	A_38_P00031336	mir|tca-miR-2788-3p|mir|MIMAT0018799	tca-miR-2788-3p	MIMAT0018799	unmapped	CGCTCGGGTTTTCCCGAGCGGGGGATTTCCAAGGGTTTTTTTTTT
A_38_P00031337	A_38_P00031337	mir|tca-miR-2788-3p|mir|MIMAT0018799	tca-miR-2788-3p	MIMAT0018799	unmapped	CGCTCGGGTTTTCCCGAGCGGGGGATTTCCAAGGGCTATTTTTTTT
A_38_P00031338	A_38_P00031338	mir|tca-miR-3892-5p|mir|MIMAT0018884	tca-miR-3892-5p	MIMAT0018884	unmapped	CGCTCGGGTTTTCCCGAGCGGGGGTTTTCCACCAGTTTTTTTTTT
A_38_P00031339	A_38_P00031339	mir|tca-miR-3892-5p|mir|MIMAT0018884	tca-miR-3892-5p	MIMAT0018884	unmapped	CGCTCGGGTTTTCCCGAGCGGGGGTTTTCCACCAGGTTTTTTTTTT
A_38_P00031340	A_38_P00031340	mir|tca-miR-2944c-3p|mir|MIMAT0018811	tca-miR-2944c-3p	MIMAT0018811	unmapped	CGCTCGGGTTTTCCCGAGCGGGGTAACTACTGGCTGTTTTTTTTTTT
A_38_P00031341	A_38_P00031341	mir|tca-miR-2944c-3p|mir|MIMAT0018811	tca-miR-2944c-3p	MIMAT0018811	unmapped	CGCTCGGGTTTTCCCGAGCGGGGTAACTACTGGCTGTGTATTTTTTTT
A_38_P00031342	A_38_P00031342	mir|tca-miR-100-3p|mir|MIMAT0019113	tca-miR-100-3p	MIMAT0019113	unmapped	CGCTCGGGTTTTCCCGAGCGGGGTACCCATAAACAAGATTTTTTTTTT
A_38_P00031343	A_38_P00031343	mir|tca-miR-100-3p|mir|MIMAT0019113	tca-miR-100-3p	MIMAT0019113	unmapped	CGCTCGGGTTTTCCCGAGCGGGGTACCCATAAACAAGAATATTTTTTTT
A_38_P00031344	A_38_P00031344	mir|tca-miR-3811a-3p|mir|MIMAT0018685|mir|tca-miR-3811b-3p|mir|MIMAT0018677|mir|tca-miR-3811c-3p|mir|MIMAT0018645|mir|tca-miR-3811d-3p|mir|MIMAT0018651	tca-miR-3811a-3p	MIMAT0018685	unmapped	CGCTCGGGTTTTCCCGAGCGGGGTCTCCACTCACGTATTTTTTTT
A_38_P00031345	A_38_P00031345	mir|tca-miR-3811a-3p|mir|MIMAT0018685|mir|tca-miR-3811b-3p|mir|MIMAT0018677|mir|tca-miR-3811c-3p|mir|MIMAT0018645|mir|tca-miR-3811d-3p|mir|MIMAT0018651	tca-miR-3811a-3p	MIMAT0018685	unmapped	CGCTCGGGTTTTCCCGAGCGGGGTCTCCACTCACGGAATTTTTTTT
A_38_P00031346	A_38_P00031346	mir|tca-miR-3824-3p|mir|MIMAT0018675	tca-miR-3824-3p	MIMAT0018675	unmapped	CGCTCGGGTTTTCCCGAGCGGGGTGCAAAACTGACTTTTTTTTTTT
A_38_P00031347	A_38_P00031347	mir|tca-miR-3824-3p|mir|MIMAT0018675	tca-miR-3824-3p	MIMAT0018675	unmapped	CGCTCGGGTTTTCCCGAGCGGGGTGCAAAACTGACTCTTTTTTTTTT
A_38_P00031348	A_38_P00031348	mir|tca-miR-3902-3p|mir|MIMAT0018909	tca-miR-3902-3p	MIMAT0018909	unmapped	CGCTCGGGTTTTCCCGAGCGGGGTTATATGCCGATTAATTTTTTTTT
A_38_P00031349	A_38_P00031349	mir|tca-miR-3902-3p|mir|MIMAT0018909	tca-miR-3902-3p	MIMAT0018909	unmapped	CGCTCGGGTTTTCCCGAGCGGGGTTATATGCCGATTATTATTTTTTTT
A_38_P00031350	A_38_P00031350	mir|tca-miR-3902-3p|mir|MIMAT0018909	tca-miR-3902-3p	MIMAT0018909	unmapped	CGCTCGGGTTTTCCCGAGCGGGGTTATATGCCGATTATAATTTTTTTTT
A_38_P00031351	A_38_P00031351	mir|tca-miR-3902-3p|mir|MIMAT0018909	tca-miR-3902-3p	MIMAT0018909	unmapped	CGCTCGGGTTTTCCCGAGCGGGGTTATATGCCGATTATATTTTTTTTTTT
A_38_P00031352	A_38_P00031352	mir|tca-miR-3811b-5p|mir|MIMAT0018676	tca-miR-3811b-5p	MIMAT0018676	unmapped	CGCTCGGGTTTTCCCGAGCGGGTAAACCCTGAGCAAGTTTTTTTTTT
A_38_P00031353	A_38_P00031353	mir|tca-miR-3811b-5p|mir|MIMAT0018676	tca-miR-3811b-5p	MIMAT0018676	unmapped	CGCTCGGGTTTTCCCGAGCGGGTAAACCCTGAGCAAGATTTTTTTTTT
A_38_P00031354	A_38_P00031354	mir|tca-miR-3836a-3p|mir|MIMAT0018705	tca-miR-3836a-3p	MIMAT0018705	unmapped	CGCTCGGGTTTTCCCGAGCGGGTAAAGTCTACCTTGCTTTTTTTTTT
A_38_P00031355	A_38_P00031355	mir|tca-miR-3836a-3p|mir|MIMAT0018705	tca-miR-3836a-3p	MIMAT0018705	unmapped	CGCTCGGGTTTTCCCGAGCGGGTAAAGTCTACCTTGCCTTTTTTTTTT
A_38_P00031356	A_38_P00031356	mir|tca-miR-3869-3p|mir|MIMAT0018831	tca-miR-3869-3p	MIMAT0018831	unmapped	CGCTCGGGTTTTCCCGAGCGGGTAACTAACAGGGGTCATTTTTTTTT
A_38_P00031357	A_38_P00031357	mir|tca-miR-3869-3p|mir|MIMAT0018831	tca-miR-3869-3p	MIMAT0018831	unmapped	CGCTCGGGTTTTCCCGAGCGGGTAACTAACAGGGGTCTTTTTTTTTTT
A_38_P00031358	A_38_P00031358	mir|tca-miR-2944b-3p|mir|MIMAT0018747	tca-miR-2944b-3p	MIMAT0018747	unmapped	CGCTCGGGTTTTCCCGAGCGGGTAAGGCAACTACGGTATTTTTTTT
A_38_P00031359	A_38_P00031359	mir|tca-miR-2944b-3p|mir|MIMAT0018747	tca-miR-2944b-3p	MIMAT0018747	unmapped	CGCTCGGGTTTTCCCGAGCGGGTAAGGCAACTACGGCATTTTTTTTT
A_38_P00031360	A_38_P00031360	mir|tca-miR-3816-3p|mir|MIMAT0018657	tca-miR-3816-3p	MIMAT0018657	unmapped	CGCTCGGGTTTTCCCGAGCGGGTAAGGTATGAATGGCATTTTTTTTTT
A_38_P00031361	A_38_P00031361	mir|tca-miR-3816-3p|mir|MIMAT0018657	tca-miR-3816-3p	MIMAT0018657	unmapped	CGCTCGGGTTTTCCCGAGCGGGTAAGGTATGAATGGCAGTTTTTTTTTT
A_38_P00031362	A_38_P00031362	mir|tca-miR-3876-5p|mir|MIMAT0018844	tca-miR-3876-5p	MIMAT0018844	unmapped	CGCTCGGGTTTTCCCGAGCGGGTAAGTGGTAAAATAAATTTTTTTTTT
A_38_P00031363	A_38_P00031363	mir|tca-miR-3876-5p|mir|MIMAT0018844	tca-miR-3876-5p	MIMAT0018844	unmapped	CGCTCGGGTTTTCCCGAGCGGGTAAGTGGTAAAATAAAATTTTTTTTTT
A_38_P00031364	A_38_P00031364	mir|tca-miR-3876-5p|mir|MIMAT0018844	tca-miR-3876-5p	MIMAT0018844	unmapped	CGCTCGGGTTTTCCCGAGCGGGTAAGTGGTAAAATAAAACTTTTTTTTTT
A_38_P00031365	A_38_P00031365	mir|tca-miR-3902-5p|mir|MIMAT0018908	tca-miR-3902-5p	MIMAT0018908	unmapped	CGCTCGGGTTTTCCCGAGCGGGTAATATGCCGGTTAATTTTTTTTT
A_38_P00031366	A_38_P00031366	mir|tca-miR-3902-5p|mir|MIMAT0018908	tca-miR-3902-5p	MIMAT0018908	unmapped	CGCTCGGGTTTTCCCGAGCGGGTAATATGCCGGTTATTATTTTTTTT
A_38_P00031367	A_38_P00031367	mir|tca-miR-3902-5p|mir|MIMAT0018908	tca-miR-3902-5p	MIMAT0018908	unmapped	CGCTCGGGTTTTCCCGAGCGGGTAATATGCCGGTTATAATTTTTTTTT
A_38_P00031368	A_38_P00031368	mir|tca-miR-3902-5p|mir|MIMAT0018908	tca-miR-3902-5p	MIMAT0018908	unmapped	CGCTCGGGTTTTCCCGAGCGGGTAATATGCCGGTTATATTTTTTTTTTT
A_38_P00031369	A_38_P00031369	mir|tca-miR-3855-3p|mir|MIMAT0018767	tca-miR-3855-3p	MIMAT0018767	unmapped	CGCTCGGGTTTTCCCGAGCGGGTCACTTTGCCAAAAAAATTTTTTTT
A_38_P00031370	A_38_P00031370	mir|tca-miR-3855-3p|mir|MIMAT0018767	tca-miR-3855-3p	MIMAT0018767	unmapped	CGCTCGGGTTTTCCCGAGCGGGTCACTTTGCCAAAAATATTTTTTTTT
A_38_P00031371	A_38_P00031371	mir|tca-miR-3855-3p|mir|MIMAT0018767	tca-miR-3855-3p	MIMAT0018767	unmapped	CGCTCGGGTTTTCCCGAGCGGGTCACTTTGCCAAAAATTTTTTTTTTTT
A_38_P00031372	A_38_P00031372	mir|tca-miR-92c-3p|mir|MIMAT0018787	tca-miR-92c-3p	MIMAT0018787	unmapped	CGCTCGGGTTTTCCCGAGCGGGTCAGGCCGGGATATTTTTTTT
A_38_P00031373	A_38_P00031373	mir|tca-miR-92c-3p|mir|MIMAT0018787	tca-miR-92c-3p	MIMAT0018787	unmapped	CGCTCGGGTTTTCCCGAGCGGGTCAGGCCGGGACATTTTTTTTT
A_38_P00031374	A_38_P00031374	mir|tca-miR-3862-3p|mir|MIMAT0018801	tca-miR-3862-3p	MIMAT0018801	unmapped	CGCTCGGGTTTTCCCGAGCGGGTCATGCAAAAGAGCTTTTTTTTTT
A_38_P00031375	A_38_P00031375	mir|tca-miR-3862-3p|mir|MIMAT0018801	tca-miR-3862-3p	MIMAT0018801	unmapped	CGCTCGGGTTTTCCCGAGCGGGTCATGCAAAAGAGCGTTTTTTTTTT
A_38_P00031376	A_38_P00031376	mir|tca-miR-3893-3p|mir|MIMAT0018889	tca-miR-3893-3p	MIMAT0018889	unmapped	CGCTCGGGTTTTCCCGAGCGGGTCCACGTTACTGACTTTTTTTTTT
A_38_P00031377	A_38_P00031377	mir|tca-miR-3893-3p|mir|MIMAT0018889	tca-miR-3893-3p	MIMAT0018889	unmapped	CGCTCGGGTTTTCCCGAGCGGGTCCACGTTACTGACATTTTTTTTTT
A_38_P00031378	A_38_P00031378	mir|tca-miR-iab-8-5p|mir|MIMAT0018698|mir|tca-miR-iab-5p_v17.0|mir|MIMAT0018698	tca-miR-iab-8-5p	MIMAT0018698	unmapped	CGCTCGGGTTTTCCCGAGCGGGTCCGGTATACCTTCATATTTTTTTT
A_38_P00031379	A_38_P00031379	mir|tca-miR-iab-8-5p|mir|MIMAT0018698|mir|tca-miR-iab-5p_v17.0|mir|MIMAT0018698	tca-miR-iab-8-5p	MIMAT0018698	unmapped	CGCTCGGGTTTTCCCGAGCGGGTCCGGTATACCTTCAGATTTTTTTTT
A_38_P00031380	A_38_P00031380	mir|tca-miR-3477-3p|mir|MIMAT0018737	tca-miR-3477-3p	MIMAT0018737	unmapped	CGCTCGGGTTTTCCCGAGCGGGTCGATCCCATTCAGATTTTTTTTT
A_38_P00031381	A_38_P00031381	mir|tca-miR-3477-3p|mir|MIMAT0018737	tca-miR-3477-3p	MIMAT0018737	unmapped	CGCTCGGGTTTTCCCGAGCGGGTCGATCCCATTCAGTTTTTTTTTTT
A_38_P00031382	A_38_P00031382	mir|tca-miR-1175-5p|mir|MIMAT0018818	tca-miR-1175-5p	MIMAT0018818	unmapped	CGCTCGGGTTTTCCCGAGCGGGTGAAGAGACCACTGTATTTTTTTT
A_38_P00031383	A_38_P00031383	mir|tca-miR-1175-5p|mir|MIMAT0018818	tca-miR-1175-5p	MIMAT0018818	unmapped	CGCTCGGGTTTTCCCGAGCGGGTGAAGAGACCACTGCATTTTTTTTT
A_38_P00031384	A_38_P00031384	mir|tca-miR-2944a-3p|mir|MIMAT0018719	tca-miR-2944a-3p	MIMAT0018719	unmapped	CGCTCGGGTTTTCCCGAGCGGGTGAAGTAACTAATGGCTTATTTTTTTT
A_38_P00031385	A_38_P00031385	mir|tca-miR-2944a-3p|mir|MIMAT0018719	tca-miR-2944a-3p	MIMAT0018719	unmapped	CGCTCGGGTTTTCCCGAGCGGGTGAAGTAACTAATGGCTGATTTTTTTTT
A_38_P00031386	A_38_P00031386	mir|tca-miR-3841-3p|mir|MIMAT0018727	tca-miR-3841-3p	MIMAT0018727	unmapped	CGCTCGGGTTTTCCCGAGCGGGTGAGATAATTCCGTACATTTTTTTTT
A_38_P00031387	A_38_P00031387	mir|tca-miR-3841-3p|mir|MIMAT0018727	tca-miR-3841-3p	MIMAT0018727	unmapped	CGCTCGGGTTTTCCCGAGCGGGTGAGATAATTCCGTACTTTTTTTTTTT
A_38_P00031388	A_38_P00031388	mir|tca-miR-3841-3p|mir|MIMAT0018727	tca-miR-3841-3p	MIMAT0018727	unmapped	CGCTCGGGTTTTCCCGAGCGGGTGAGATAATTCCGTACTATTTTTTTTTT
A_38_P00031389	A_38_P00031389	mir|tca-miR-3854-5p|mir|MIMAT0018764	tca-miR-3854-5p	MIMAT0018764	unmapped	CGCTCGGGTTTTCCCGAGCGGGTGGAGCTGGGATTTATTTTTTTT
A_38_P00031390	A_38_P00031390	mir|tca-miR-3854-5p|mir|MIMAT0018764	tca-miR-3854-5p	MIMAT0018764	unmapped	CGCTCGGGTTTTCCCGAGCGGGTGGAGCTGGGATTGATTTTTTTTT
A_38_P00031391	A_38_P00031391	mir|tca-miR-7-3p|mir|MIMAT0019099	tca-miR-7-3p	MIMAT0019099	unmapped	CGCTCGGGTTTTCCCGAGCGGGTGGGATGATTAGTGATATTTTTTTTT
A_38_P00031392	A_38_P00031392	mir|tca-miR-7-3p|mir|MIMAT0019099	tca-miR-7-3p	MIMAT0019099	unmapped	CGCTCGGGTTTTCCCGAGCGGGTGGGATGATTAGTGATTTTTTTTTTTT
A_38_P00031393	A_38_P00031393	mir|tca-miR-7-3p|mir|MIMAT0019099	tca-miR-7-3p	MIMAT0019099	unmapped	CGCTCGGGTTTTCCCGAGCGGGTGGGATGATTAGTGATTCTATTTTTTTT
A_38_P00031394	A_38_P00031394	mir|tca-miR-277-5p|mir|MIMAT0019124	tca-miR-277-5p	MIMAT0019124	unmapped	CGCTCGGGTTTTCCCGAGCGGGTGTAAACGCGCATTATTTTTTTT
A_38_P00031395	A_38_P00031395	mir|tca-miR-277-5p|mir|MIMAT0019124	tca-miR-277-5p	MIMAT0019124	unmapped	CGCTCGGGTTTTCCCGAGCGGGTGTAAACGCGCATCATTTTTTTTT
A_38_P00031396	A_38_P00031396	mir|tca-miR-3810-3p|mir|MIMAT0018643	tca-miR-3810-3p	MIMAT0018643	unmapped	CGCTCGGGTTTTCCCGAGCGGGTGTAGATTACCCACGTTTTTTTTTT
A_38_P00031397	A_38_P00031397	mir|tca-miR-3810-3p|mir|MIMAT0018643	tca-miR-3810-3p	MIMAT0018643	unmapped	CGCTCGGGTTTTCCCGAGCGGGTGTAGATTACCCACGATATTTTTTTT
A_38_P00031398	A_38_P00031398	mir|tca-miR-137-5p|mir|MIMAT0019117	tca-miR-137-5p	MIMAT0019117	unmapped	CGCTCGGGTTTTCCCGAGCGGGTGTTAATTACCCAAGAAATTTTTTTTT
A_38_P00031399	A_38_P00031399	mir|tca-miR-137-5p|mir|MIMAT0019117	tca-miR-137-5p	MIMAT0019117	unmapped	CGCTCGGGTTTTCCCGAGCGGGTGTTAATTACCCAAGAATTTTTTTTTTT
A_38_P00031400	A_38_P00031400	mir|tca-miR-137-5p|mir|MIMAT0019117	tca-miR-137-5p	MIMAT0019117	unmapped	CGCTCGGGTTTTCCCGAGCGGGTGTTAATTACCCAAGAATATTTTTTTTTT
A_38_P00031401	A_38_P00031401	mir|tca-miR-137-5p|mir|MIMAT0019117	tca-miR-137-5p	MIMAT0019117	unmapped	CGCTCGGGTTTTCCCGAGCGGGTGTTAATTACCCAAGAATACTTTTTTTTTT
A_38_P00031402	A_38_P00031402	mir|tca-miR-989-5p|mir|MIMAT0018822	tca-miR-989-5p	MIMAT0018822	unmapped	CGCTCGGGTTTTCCCGAGCGGGTGTTATGCGACCTAGATTTTTTTTT
A_38_P00031403	A_38_P00031403	mir|tca-miR-989-5p|mir|MIMAT0018822	tca-miR-989-5p	MIMAT0018822	unmapped	CGCTCGGGTTTTCCCGAGCGGGTGTTATGCGACCTAGTTTTTTTTTTT
A_38_P00031404	A_38_P00031404	mir|tca-miR-2765-3p|mir|MIMAT0018631	tca-miR-2765-3p	MIMAT0018631	unmapped	CGCTCGGGTTTTCCCGAGCGGGTTAAGGAACTCCTCGTTTTTTTTTT
A_38_P00031405	A_38_P00031405	mir|tca-miR-2765-3p|mir|MIMAT0018631	tca-miR-2765-3p	MIMAT0018631	unmapped	CGCTCGGGTTTTCCCGAGCGGGTTAAGGAACTCCTCGATTTTTTTTTT
A_38_P00031406	A_38_P00031406	mir|tca-miR-3890-5p|mir|MIMAT0018878	tca-miR-3890-5p	MIMAT0018878	unmapped	CGCTCGGGTTTTCCCGAGCGGGTTCCGCAGATACAGTATTTTTTTT
A_38_P00031407	A_38_P00031407	mir|tca-miR-3890-5p|mir|MIMAT0018878	tca-miR-3890-5p	MIMAT0018878	unmapped	CGCTCGGGTTTTCCCGAGCGGGTTCCGCAGATACAGCATTTTTTTTT
A_38_P00031408	A_38_P00031408	mir|tca-miR-3804a-3p|mir|MIMAT0018625	tca-miR-3804a-3p	MIMAT0018625	unmapped	CGCTCGGGTTTTCCCGAGCGGGTTCTAGCACACTTATGTTTTTTTTTT
A_38_P00031409	A_38_P00031409	mir|tca-miR-3804a-3p|mir|MIMAT0018625	tca-miR-3804a-3p	MIMAT0018625	unmapped	CGCTCGGGTTTTCCCGAGCGGGTTCTAGCACACTTATGGTTTTTTTTTT
A_38_P00031410	A_38_P00031410	mir|tca-miR-31-3p|mir|MIMAT0019106	tca-miR-31-3p	MIMAT0019106	unmapped	CGCTCGGGTTTTCCCGAGCGGGTTGGCCGGATGATTTTTTTTTT
A_38_P00031411	A_38_P00031411	mir|tca-miR-31-3p|mir|MIMAT0019106	tca-miR-31-3p	MIMAT0019106	unmapped	CGCTCGGGTTTTCCCGAGCGGGTTGGCCGGATGAGTTTTTTTTTT
A_38_P00031412	A_38_P00031412	mir|tca-miR-252b-3p|mir|MIMAT0018807	tca-miR-252b-3p	MIMAT0018807	unmapped	CGCTCGGGTTTTCCCGAGCGGTAAAGCAGCCAGACCTTTTTTTTTT
A_38_P00031413	A_38_P00031413	mir|tca-miR-252b-3p|mir|MIMAT0018807	tca-miR-252b-3p	MIMAT0018807	unmapped	CGCTCGGGTTTTCCCGAGCGGTAAAGCAGCCAGACCGTTTTTTTTTT
A_38_P00031414	A_38_P00031414	mir|tca-miR-927a-5p|mir|MIMAT0008391|mir|tca-miR-927-5p_v18.0|mir|MIMAT0008391	tca-miR-927a-5p	MIMAT0008391	unmapped	CGCTCGGGTTTTCCCGAGCGGTAAAGCGTAGGAATTCTAATTTTTTTTTT
A_38_P00031415	A_38_P00031415	mir|tca-miR-927a-5p|mir|MIMAT0008391|mir|tca-miR-927-5p_v18.0|mir|MIMAT0008391	tca-miR-927a-5p	MIMAT0008391	unmapped	CGCTCGGGTTTTCCCGAGCGGTAAAGCGTAGGAATTCTAAATTTTTTTTTT
A_38_P00031416	A_38_P00031416	mir|tca-miR-3821-3p|mir|MIMAT0018669	tca-miR-3821-3p	MIMAT0018669	unmapped	CGCTCGGGTTTTCCCGAGCGGTAACATCCTCACTCACTTTTTTTTTTT
A_38_P00031417	A_38_P00031417	mir|tca-miR-3821-3p|mir|MIMAT0018669	tca-miR-3821-3p	MIMAT0018669	unmapped	CGCTCGGGTTTTCCCGAGCGGTAACATCCTCACTCACTATTTTTTTTTT
A_38_P00031418	A_38_P00031418	mir|tca-miR-3821-3p|mir|MIMAT0018669	tca-miR-3821-3p	MIMAT0018669	unmapped	CGCTCGGGTTTTCCCGAGCGGTAACATCCTCACTCACTAGTTTTTTTTTT
A_38_P00031419	A_38_P00031419	mir|tca-miR-3888-3p|mir|MIMAT0018875	tca-miR-3888-3p	MIMAT0018875	unmapped	CGCTCGGGTTTTCCCGAGCGGTAACCTTAACTACGTCACTTTTTTTTTT
A_38_P00031420	A_38_P00031420	mir|tca-miR-3888-3p|mir|MIMAT0018875	tca-miR-3888-3p	MIMAT0018875	unmapped	CGCTCGGGTTTTCCCGAGCGGTAACCTTAACTACGTCACGTTTTTTTTTT
A_38_P00031421	A_38_P00031421	mir|tca-miR-3848-5p|mir|MIMAT0018744	tca-miR-3848-5p	MIMAT0018744	unmapped	CGCTCGGGTTTTCCCGAGCGGTAACCTTATATACCGCATTTTTTTTT
A_38_P00031422	A_38_P00031422	mir|tca-miR-3848-5p|mir|MIMAT0018744	tca-miR-3848-5p	MIMAT0018744	unmapped	CGCTCGGGTTTTCCCGAGCGGTAACCTTATATACCGCTTTTTTTTTTT
A_38_P00031423	A_38_P00031423	mir|tca-miR-3848-5p|mir|MIMAT0018744	tca-miR-3848-5p	MIMAT0018744	unmapped	CGCTCGGGTTTTCCCGAGCGGTAACCTTATATACCGCTATTTTTTTTTT
A_38_P00031424	A_38_P00031424	mir|tca-miR-3848-5p|mir|MIMAT0018744	tca-miR-3848-5p	MIMAT0018744	unmapped	CGCTCGGGTTTTCCCGAGCGGTAACCTTATATACCGCTACTTTTTTTTTT
A_38_P00031425	A_38_P00031425	mir|tca-miR-375-3p|mir|MIMAT0018795	tca-miR-375-3p	MIMAT0018795	unmapped	CGCTCGGGTTTTCCCGAGCGGTAACTCGAGCCACACTTTTTTTTTT
A_38_P00031426	A_38_P00031426	mir|tca-miR-375-3p|mir|MIMAT0018795	tca-miR-375-3p	MIMAT0018795	unmapped	CGCTCGGGTTTTCCCGAGCGGTAACTCGAGCCACACGTTTTTTTTTT
A_38_P00031427	A_38_P00031427	mir|tca-miR-3838-5p|mir|MIMAT0018720	tca-miR-3838-5p	MIMAT0018720	unmapped	CGCTCGGGTTTTCCCGAGCGGTAAGACGACTTAGGCTAATTTTTTTTTT
A_38_P00031428	A_38_P00031428	mir|tca-miR-3838-5p|mir|MIMAT0018720	tca-miR-3838-5p	MIMAT0018720	unmapped	CGCTCGGGTTTTCCCGAGCGGTAAGACGACTTAGGCTAAATTTTTTTTTT
A_38_P00031429	A_38_P00031429	mir|tca-miR-3848-3p|mir|MIMAT0018745	tca-miR-3848-3p	MIMAT0018745	unmapped	CGCTCGGGTTTTCCCGAGCGGTAAGCACATTAAGTGGGATTTTTTTTT
A_38_P00031430	A_38_P00031430	mir|tca-miR-3848-3p|mir|MIMAT0018745	tca-miR-3848-3p	MIMAT0018745	unmapped	CGCTCGGGTTTTCCCGAGCGGTAAGCACATTAAGTGGGTTTTTTTTTTT
A_38_P00031431	A_38_P00031431	mir|tca-miR-3843-3p|mir|MIMAT0018733	tca-miR-3843-3p	MIMAT0018733	unmapped	CGCTCGGGTTTTCCCGAGCGGTAATTGCTGACATAGCTTTTTTTTTTTTT
A_38_P00031432	A_38_P00031432	mir|tca-miR-3843-3p|mir|MIMAT0018733	tca-miR-3843-3p	MIMAT0018733	unmapped	CGCTCGGGTTTTCCCGAGCGGTAATTGCTGACATAGCTTTATTTTTTTTTT
A_38_P00031433	A_38_P00031433	mir|tca-miR-3843-3p|mir|MIMAT0018733	tca-miR-3843-3p	MIMAT0018733	unmapped	CGCTCGGGTTTTCCCGAGCGGTAATTGCTGACATAGCTTTAATTTTTTTTTT
A_38_P00031434	A_38_P00031434	mir|tca-miR-3852-3p|mir|MIMAT0018761	tca-miR-3852-3p	MIMAT0018761	unmapped	CGCTCGGGTTTTCCCGAGCGGTACAATTATGGCGCAGATTTTTTTTTT
A_38_P00031435	A_38_P00031435	mir|tca-miR-3852-3p|mir|MIMAT0018761	tca-miR-3852-3p	MIMAT0018761	unmapped	CGCTCGGGTTTTCCCGAGCGGTACAATTATGGCGCAGAATTTTTTTTTT
A_38_P00031436	A_38_P00031436	mir|tca-miR-3803-5p|mir|MIMAT0018622	tca-miR-3803-5p	MIMAT0018622	unmapped	CGCTCGGGTTTTCCCGAGCGGTACCTCCATTTTTAATAAATTTTTTTT
A_38_P00031437	A_38_P00031437	mir|tca-miR-3803-5p|mir|MIMAT0018622	tca-miR-3803-5p	MIMAT0018622	unmapped	CGCTCGGGTTTTCCCGAGCGGTACCTCCATTTTTAATATATTTTTTTTT
A_38_P00031438	A_38_P00031438	mir|tca-miR-3803-5p|mir|MIMAT0018622	tca-miR-3803-5p	MIMAT0018622	unmapped	CGCTCGGGTTTTCCCGAGCGGTACCTCCATTTTTAATATTTTTTTTTTTT
A_38_P00031439	A_38_P00031439	mir|tca-miR-3803-5p|mir|MIMAT0018622	tca-miR-3803-5p	MIMAT0018622	unmapped	CGCTCGGGTTTTCCCGAGCGGTACCTCCATTTTTAATATTCTTTTTTTTTT
A_38_P00031440	A_38_P00031440	mir|tca-miR-3805a-5p|mir|MIMAT0018632	tca-miR-3805a-5p	MIMAT0018632	unmapped	CGCTCGGGTTTTCCCGAGCGGTACGACCCACATGTGTATTTTTTTT
A_38_P00031441	A_38_P00031441	mir|tca-miR-3805a-5p|mir|MIMAT0018632	tca-miR-3805a-5p	MIMAT0018632	unmapped	CGCTCGGGTTTTCCCGAGCGGTACGACCCACATGTGAATTTTTTTTT
A_38_P00031442	A_38_P00031442	mir|tca-miR-3851f-5p|mir|MIMAT0018784	tca-miR-3851f-5p	MIMAT0018784	unmapped	CGCTCGGGTTTTCCCGAGCGGTACGACTCCAAATCAACTTTTTTTTTT
A_38_P00031443	A_38_P00031443	mir|tca-miR-3851f-5p|mir|MIMAT0018784	tca-miR-3851f-5p	MIMAT0018784	unmapped	CGCTCGGGTTTTCCCGAGCGGTACGACTCCAAATCAACGTTTTTTTTTT
A_38_P00031444	A_38_P00031444	mir|tca-miR-3840-5p|mir|MIMAT0018724	tca-miR-3840-5p	MIMAT0018724	unmapped	CGCTCGGGTTTTCCCGAGCGGTACGTACTTACAGTACCCTTTTTTTTTT
A_38_P00031445	A_38_P00031445	mir|tca-miR-3840-5p|mir|MIMAT0018724	tca-miR-3840-5p	MIMAT0018724	unmapped	CGCTCGGGTTTTCCCGAGCGGTACGTACTTACAGTACCCCTATTTTTTTT
A_38_P00031446	A_38_P00031446	mir|tca-miR-3853-5p|mir|MIMAT0018762	tca-miR-3853-5p	MIMAT0018762	unmapped	CGCTCGGGTTTTCCCGAGCGGTAGCATTTCACAAAATACACTTTTTTTTTT
A_38_P00031447	A_38_P00031447	mir|tca-miR-3853-5p|mir|MIMAT0018762	tca-miR-3853-5p	MIMAT0018762	unmapped	CGCTCGGGTTTTCCCGAGCGGTAGCATTTCACAAAATACACATTTTTTTTTT
A_38_P00031448	A_38_P00031448	mir|tca-miR-305-3p|mir|MIMAT0019128	tca-miR-305-3p	MIMAT0019128	unmapped	CGCTCGGGTTTTCCCGAGCGGTAGTGCACTCCAACAGTATTTTTTTT
A_38_P00031449	A_38_P00031449	mir|tca-miR-305-3p|mir|MIMAT0019128	tca-miR-305-3p	MIMAT0019128	unmapped	CGCTCGGGTTTTCCCGAGCGGTAGTGCACTCCAACAGGATTTTTTTTT
A_38_P00031450	A_38_P00031450	mir|tca-miR-3807-3p|mir|MIMAT0018637	tca-miR-3807-3p	MIMAT0018637	unmapped	CGCTCGGGTTTTCCCGAGCGGTAGTGGCGAGGATGTATTTTTTTTT
A_38_P00031451	A_38_P00031451	mir|tca-miR-3807-3p|mir|MIMAT0018637	tca-miR-3807-3p	MIMAT0018637	unmapped	CGCTCGGGTTTTCCCGAGCGGTAGTGGCGAGGATGTTTTTTTTTTTT
A_38_P00031452	A_38_P00031452	mir|tca-miR-970-5p|mir|MIMAT0019179	tca-miR-970-5p	MIMAT0019179	unmapped	CGCTCGGGTTTTCCCGAGCGGTATCAGTACGACACACTTTTTTTTTT
A_38_P00031453	A_38_P00031453	mir|tca-miR-970-5p|mir|MIMAT0019179	tca-miR-970-5p	MIMAT0019179	unmapped	CGCTCGGGTTTTCCCGAGCGGTATCAGTACGACACACGTATTTTTTTT
A_38_P00031454	A_38_P00031454	mir|tca-miR-3802-5p|mir|MIMAT0018620	tca-miR-3802-5p	MIMAT0018620	unmapped	CGCTCGGGTTTTCCCGAGCGGTATCTCGTCATTCAAGCTTTTTTTTTT
A_38_P00031455	A_38_P00031455	mir|tca-miR-3802-5p|mir|MIMAT0018620	tca-miR-3802-5p	MIMAT0018620	unmapped	CGCTCGGGTTTTCCCGAGCGGTATCTCGTCATTCAAGCATTTTTTTTTT
A_38_P00031456	A_38_P00031456	mir|tca-miR-1-5p|mir|MIMAT0019092	tca-miR-1-5p	MIMAT0019092	unmapped	CGCTCGGGTTTTCCCGAGCGGTATGGGAAGTAAGGAAGTTTTTTTTTT
A_38_P00031457	A_38_P00031457	mir|tca-miR-1-5p|mir|MIMAT0019092	tca-miR-1-5p	MIMAT0019092	unmapped	CGCTCGGGTTTTCCCGAGCGGTATGGGAAGTAAGGAAGCTTTTTTTTTT
A_38_P00031458	A_38_P00031458	mir|tca-miR-3820-3p|mir|MIMAT0018667	tca-miR-3820-3p	MIMAT0018667	unmapped	CGCTCGGGTTTTCCCGAGCGGTATTGCAAAACCTGTACATTTTTTTTTT
A_38_P00031459	A_38_P00031459	mir|tca-miR-3820-3p|mir|MIMAT0018667	tca-miR-3820-3p	MIMAT0018667	unmapped	CGCTCGGGTTTTCCCGAGCGGTATTGCAAAACCTGTACAGTTTTTTTTTT
A_38_P00031460	A_38_P00031460	mir|tca-miR-3809-5p|mir|MIMAT0018640	tca-miR-3809-5p	MIMAT0018640	unmapped	CGCTCGGGTTTTCCCGAGCGGTCAGCGAGCAAGTTATTTTTTTTTTT
A_38_P00031461	A_38_P00031461	mir|tca-miR-3809-5p|mir|MIMAT0018640	tca-miR-3809-5p	MIMAT0018640	unmapped	CGCTCGGGTTTTCCCGAGCGGTCAGCGAGCAAGTTATGTATTTTTTTT
A_38_P00031462	A_38_P00031462	mir|tca-miR-3880-3p|mir|MIMAT0018857	tca-miR-3880-3p	MIMAT0018857	unmapped	CGCTCGGGTTTTCCCGAGCGGTCAGGACAACATCGATTTTTTTTTT
A_38_P00031463	A_38_P00031463	mir|tca-miR-3880-3p|mir|MIMAT0018857	tca-miR-3880-3p	MIMAT0018857	unmapped	CGCTCGGGTTTTCCCGAGCGGTCAGGACAACATCGACTTTTTTTTTT
A_38_P00031464	A_38_P00031464	mir|tca-miR-9d-5p|mir|MIMAT0018748	tca-miR-9d-5p	MIMAT0018748	unmapped	CGCTCGGGTTTTCCCGAGCGGTCATAAGTTAGATCACCAATTTTTTTTTT
A_38_P00031465	A_38_P00031465	mir|tca-miR-9d-5p|mir|MIMAT0018748	tca-miR-9d-5p	MIMAT0018748	unmapped	CGCTCGGGTTTTCCCGAGCGGTCATAAGTTAGATCACCAAATTTTTTTTTT
A_38_P00031466	A_38_P00031466	mir|tca-miR-9d-5p|mir|MIMAT0018748	tca-miR-9d-5p	MIMAT0018748	unmapped	CGCTCGGGTTTTCCCGAGCGGTCATAAGTTAGATCACCAAAGTTTTTTTTTT
A_38_P00031467	A_38_P00031467	mir|tca-miR-3893-5p|mir|MIMAT0018888	tca-miR-3893-5p	MIMAT0018888	unmapped	CGCTCGGGTTTTCCCGAGCGGTCATGTAAAGCCGTCTATTTTTTTT
A_38_P00031468	A_38_P00031468	mir|tca-miR-3893-5p|mir|MIMAT0018888	tca-miR-3893-5p	MIMAT0018888	unmapped	CGCTCGGGTTTTCCCGAGCGGTCATGTAAAGCCGTCGATTTTTTTTT
A_38_P00031469	A_38_P00031469	mir|tca-miR-3049-5p|mir|MIMAT0018776	tca-miR-3049-5p	MIMAT0018776	unmapped	CGCTCGGGTTTTCCCGAGCGGTCCGCCGCAACTTATTTTTTTT
A_38_P00031470	A_38_P00031470	mir|tca-miR-3049-5p|mir|MIMAT0018776	tca-miR-3049-5p	MIMAT0018776	unmapped	CGCTCGGGTTTTCCCGAGCGGTCCGCCGCAACTGATTTTTTTTT
A_38_P00031473	A_38_P00031473	mir|tca-miR-279e-5p|mir|MIMAT0018816	tca-miR-279e-5p	MIMAT0018816	unmapped	CGCTCGGGTTTTCCCGAGCGGTGAAACAATAGACTGAACATATTTTTTTT
A_38_P00031474	A_38_P00031474	mir|tca-miR-279e-5p|mir|MIMAT0018816	tca-miR-279e-5p	MIMAT0018816	unmapped	CGCTCGGGTTTTCCCGAGCGGTGAAACAATAGACTGAACACATTTTTTTTT
A_38_P00031475	A_38_P00031475	mir|tca-miR-133-5p|mir|MIMAT0019116	tca-miR-133-5p	MIMAT0019116	unmapped	CGCTCGGGTTTTCCCGAGCGGTGACCCGGATTCAACTTTTTTTTTT
A_38_P00031476	A_38_P00031476	mir|tca-miR-133-5p|mir|MIMAT0019116	tca-miR-133-5p	MIMAT0019116	unmapped	CGCTCGGGTTTTCCCGAGCGGTGACCCGGATTCAACCTTTTTTTTTT
A_38_P00031477	A_38_P00031477	mir|tca-miR-3853-3p|mir|MIMAT0018763	tca-miR-3853-3p	MIMAT0018763	unmapped	CGCTCGGGTTTTCCCGAGCGGTGAGCATATTTTGAAAAAAATTTTTTTTTT
A_38_P00031478	A_38_P00031478	mir|tca-miR-3853-3p|mir|MIMAT0018763	tca-miR-3853-3p	MIMAT0018763	unmapped	CGCTCGGGTTTTCCCGAGCGGTGAGCATATTTTGAAAAAAACTTTTTTTTTT
A_38_P00031479	A_38_P00031479	mir|tca-miR-998-3p|mir|MIMAT0018853	tca-miR-998-3p	MIMAT0018853	unmapped	CGCTCGGGTTTTCCCGAGCGGTGAGCTGAATCCCATGTATTTTTTTT
A_38_P00031480	A_38_P00031480	mir|tca-miR-998-3p|mir|MIMAT0018853	tca-miR-998-3p	MIMAT0018853	unmapped	CGCTCGGGTTTTCCCGAGCGGTGAGCTGAATCCCATGGATTTTTTTTT
A_38_P00031481	A_38_P00031481	mir|tca-miR-3846-3p|mir|MIMAT0018741	tca-miR-3846-3p	MIMAT0018741	unmapped	CGCTCGGGTTTTCCCGAGCGGTGAGGCAACGTAATTGATTTTTTTTT
A_38_P00031482	A_38_P00031482	mir|tca-miR-3846-3p|mir|MIMAT0018741	tca-miR-3846-3p	MIMAT0018741	unmapped	CGCTCGGGTTTTCCCGAGCGGTGAGGCAACGTAATTGTTTTTTTTTTT
A_38_P00031483	A_38_P00031483	mir|tca-miR-283-3p|mir|MIMAT0019127	tca-miR-283-3p	MIMAT0019127	unmapped	CGCTCGGGTTTTCCCGAGCGGTGATAATATCAGTCGATATTCTTTTTTTTTTT
A_38_P00031484	A_38_P00031484	mir|tca-miR-283-3p|mir|MIMAT0019127	tca-miR-283-3p	MIMAT0019127	unmapped	CGCTCGGGTTTTCCCGAGCGGTGATAATATCAGTCGATATTCTGTTTTTTTTTT
A_38_P00031485	A_38_P00031485	mir|tca-miR-3860-3p|mir|MIMAT0018793	tca-miR-3860-3p	MIMAT0018793	unmapped	CGCTCGGGTTTTCCCGAGCGGTGCACTGTTTCCTTTACTTTTTTTTTT
A_38_P00031486	A_38_P00031486	mir|tca-miR-3860-3p|mir|MIMAT0018793	tca-miR-3860-3p	MIMAT0018793	unmapped	CGCTCGGGTTTTCCCGAGCGGTGCACTGTTTCCTTTACATTTTTTTTTT
A_38_P00031487	A_38_P00031487	mir|tca-miR-3882-5p|mir|MIMAT0018860	tca-miR-3882-5p	MIMAT0018860	unmapped	CGCTCGGGTTTTCCCGAGCGGTGCATGGTAGAACACCTTTTTTTTTT
A_38_P00031488	A_38_P00031488	mir|tca-miR-3882-5p|mir|MIMAT0018860	tca-miR-3882-5p	MIMAT0018860	unmapped	CGCTCGGGTTTTCCCGAGCGGTGCATGGTAGAACACCGTATTTTTTTT
A_38_P00031489	A_38_P00031489	mir|tca-miR-3894-5p|mir|MIMAT0018890	tca-miR-3894-5p	MIMAT0018890	unmapped	CGCTCGGGTTTTCCCGAGCGGTGCATTATGGAATTAAAACTTTTTTTTTT
A_38_P00031490	A_38_P00031490	mir|tca-miR-3894-5p|mir|MIMAT0018890	tca-miR-3894-5p	MIMAT0018890	unmapped	CGCTCGGGTTTTCCCGAGCGGTGCATTATGGAATTAAAACCTTTTTTTTTT
A_38_P00031491	A_38_P00031491	mir|tca-miR-3872-5p|mir|MIMAT0018836	tca-miR-3872-5p	MIMAT0018836	unmapped	CGCTCGGGTTTTCCCGAGCGGTGCATTTCTGGCTGTTTTTTTTTTT
A_38_P00031492	A_38_P00031492	mir|tca-miR-3872-5p|mir|MIMAT0018836	tca-miR-3872-5p	MIMAT0018836	unmapped	CGCTCGGGTTTTCCCGAGCGGTGCATTTCTGGCTGTATTTTTTTTTT
A_38_P00031493	A_38_P00031493	mir|tca-miR-3872-5p|mir|MIMAT0018836	tca-miR-3872-5p	MIMAT0018836	unmapped	CGCTCGGGTTTTCCCGAGCGGTGCATTTCTGGCTGTAGTATTTTTTTT
A_38_P00031494	A_38_P00031494	mir|tca-miR-3882-3p|mir|MIMAT0018861	tca-miR-3882-3p	MIMAT0018861	unmapped	CGCTCGGGTTTTCCCGAGCGGTGCCATCGGTGTTAGTTTTTTTTTT
A_38_P00031495	A_38_P00031495	mir|tca-miR-3882-3p|mir|MIMAT0018861	tca-miR-3882-3p	MIMAT0018861	unmapped	CGCTCGGGTTTTCCCGAGCGGTGCCATCGGTGTTAGCTTTTTTTTTT
A_38_P00031496	A_38_P00031496	mir|tca-miR-3897-5p|mir|MIMAT0018898	tca-miR-3897-5p	MIMAT0018898	unmapped	CGCTCGGGTTTTCCCGAGCGGTGCCGGCGAAGGTTTTTTTTTT
A_38_P00031497	A_38_P00031497	mir|tca-miR-3897-5p|mir|MIMAT0018898	tca-miR-3897-5p	MIMAT0018898	unmapped	CGCTCGGGTTTTCCCGAGCGGTGCCGGCGAAGGCTTTTTTTTTT
A_38_P00031498	A_38_P00031498	mir|tca-miR-3898-5p|mir|MIMAT0018900	tca-miR-3898-5p	MIMAT0018900	unmapped	CGCTCGGGTTTTCCCGAGCGGTGCTATGAGCCGGTTTTTTTTTTT
A_38_P00031499	A_38_P00031499	mir|tca-miR-3898-5p|mir|MIMAT0018900	tca-miR-3898-5p	MIMAT0018900	unmapped	CGCTCGGGTTTTCCCGAGCGGTGCTATGAGCCGGTATTTTTTTTTT
A_38_P00031500	A_38_P00031500	mir|tca-miR-3898-5p|mir|MIMAT0018900	tca-miR-3898-5p	MIMAT0018900	unmapped	CGCTCGGGTTTTCCCGAGCGGTGCTATGAGCCGGTACTTTTTTTTTT
A_38_P00031503	A_38_P00031503	mir|tca-miR-3819-5p|mir|MIMAT0018914	tca-miR-3819-5p	MIMAT0018914	unmapped	CGCTCGGGTTTTCCCGAGCGGTGGAATATTAATACGAATATTTTTTTTT
A_38_P00031504	A_38_P00031504	mir|tca-miR-3819-5p|mir|MIMAT0018914	tca-miR-3819-5p	MIMAT0018914	unmapped	CGCTCGGGTTTTCCCGAGCGGTGGAATATTAATACGAATTTTTTTTTTTT
A_38_P00031505	A_38_P00031505	mir|tca-miR-3896-5p|mir|MIMAT0018894	tca-miR-3896-5p	MIMAT0018894	unmapped	CGCTCGGGTTTTCCCGAGCGGTGGAATTTCACTCGAGTATTTTTTTT
A_38_P00031506	A_38_P00031506	mir|tca-miR-3896-5p|mir|MIMAT0018894	tca-miR-3896-5p	MIMAT0018894	unmapped	CGCTCGGGTTTTCCCGAGCGGTGGAATTTCACTCGAGAATTTTTTTTT
A_38_P00031507	A_38_P00031507	mir|tca-miR-3817-3p|mir|MIMAT0018659	tca-miR-3817-3p	MIMAT0018659	unmapped	CGCTCGGGTTTTCCCGAGCGGTGGAGGTGTAGTGAGTTTTTTTTTT
A_38_P00031508	A_38_P00031508	mir|tca-miR-3817-3p|mir|MIMAT0018659	tca-miR-3817-3p	MIMAT0018659	unmapped	CGCTCGGGTTTTCCCGAGCGGTGGAGGTGTAGTGAGCTTTTTTTTTT
A_38_P00031509	A_38_P00031509	mir|tca-miR-3844-3p|mir|MIMAT0018735	tca-miR-3844-3p	MIMAT0018735	unmapped	CGCTCGGGTTTTCCCGAGCGGTGGCACCTCATTTTATCTTTTTTTTTT
A_38_P00031510	A_38_P00031510	mir|tca-miR-3844-3p|mir|MIMAT0018735	tca-miR-3844-3p	MIMAT0018735	unmapped	CGCTCGGGTTTTCCCGAGCGGTGGCACCTCATTTTATCATTTTTTTTTT
A_38_P00031511	A_38_P00031511	mir|tca-miR-3807-5p|mir|MIMAT0018636	tca-miR-3807-5p	MIMAT0018636	unmapped	CGCTCGGGTTTTCCCGAGCGGTGGCCGCACATCAATTTTTTTTT
A_38_P00031512	A_38_P00031512	mir|tca-miR-3807-5p|mir|MIMAT0018636	tca-miR-3807-5p	MIMAT0018636	unmapped	CGCTCGGGTTTTCCCGAGCGGTGGCCGCACATCATTTTTTTTTTT
A_38_P00031513	A_38_P00031513	mir|tca-miR-3807-5p|mir|MIMAT0018636	tca-miR-3807-5p	MIMAT0018636	unmapped	CGCTCGGGTTTTCCCGAGCGGTGGCCGCACATCATCTTTTTTTTTT
A_38_P00031514	A_38_P00031514	mir|tca-miR-1000-3p|mir|MIMAT0019184	tca-miR-1000-3p	MIMAT0019184	unmapped	CGCTCGGGTTTTCCCGAGCGGTGGTCATGTCCCGATTTTTTTTTT
A_38_P00031515	A_38_P00031515	mir|tca-miR-1000-3p|mir|MIMAT0019184	tca-miR-1000-3p	MIMAT0019184	unmapped	CGCTCGGGTTTTCCCGAGCGGTGGTCATGTCCCGAATTTTTTTTTT
A_38_P00031516	A_38_P00031516	mir|tca-miR-12-3p|mir|MIMAT0019102	tca-miR-12-3p	MIMAT0019102	unmapped	CGCTCGGGTTTTCCCGAGCGGTGTAAGTGTTACTCAGGTTTTTTTTTT
A_38_P00031517	A_38_P00031517	mir|tca-miR-12-3p|mir|MIMAT0019102	tca-miR-12-3p	MIMAT0019102	unmapped	CGCTCGGGTTTTCCCGAGCGGTGTAAGTGTTACTCAGGGTTTTTTTTTT
A_38_P00031518	A_38_P00031518	mir|tca-miR-3811e-5p|mir|MIMAT0018664	tca-miR-3811e-5p	MIMAT0018664	unmapped	CGCTCGGGTTTTCCCGAGCGGTGTACACCGCAAGTAATTTTTTTTTT
A_38_P00031519	A_38_P00031519	mir|tca-miR-3811e-5p|mir|MIMAT0018664	tca-miR-3811e-5p	MIMAT0018664	unmapped	CGCTCGGGTTTTCCCGAGCGGTGTACACCGCAAGTAAGTTTTTTTTTT
A_38_P00031520	A_38_P00031520	mir|tca-miR-279c-5p|mir|MIMAT0018730	tca-miR-279c-5p	MIMAT0018730	unmapped	CGCTCGGGTTTTCCCGAGCGGTGTGACTCGAAACGATTTTTTTTTT
A_38_P00031521	A_38_P00031521	mir|tca-miR-279c-5p|mir|MIMAT0018730	tca-miR-279c-5p	MIMAT0018730	unmapped	CGCTCGGGTTTTCCCGAGCGGTGTGACTCGAAACGAATTTTTTTTTT
A_38_P00031522	A_38_P00031522	mir|tca-miR-3862-5p|mir|MIMAT0018800	tca-miR-3862-5p	MIMAT0018800	unmapped	CGCTCGGGTTTTCCCGAGCGGTGTTCAGGCGGACTAATTTTTTTT
A_38_P00031523	A_38_P00031523	mir|tca-miR-3862-5p|mir|MIMAT0018800	tca-miR-3862-5p	MIMAT0018800	unmapped	CGCTCGGGTTTTCCCGAGCGGTGTTCAGGCGGACTTAATTTTTTTT
A_38_P00031524	A_38_P00031524	mir|tca-miR-3836a-5p|mir|MIMAT0018704	tca-miR-3836a-5p	MIMAT0018704	unmapped	CGCTCGGGTTTTCCCGAGCGGTTAACTTAAGCAGAGGTAGTTTTTTTTTT
A_38_P00031525	A_38_P00031525	mir|tca-miR-3836a-5p|mir|MIMAT0018704	tca-miR-3836a-5p	MIMAT0018704	unmapped	CGCTCGGGTTTTCCCGAGCGGTTAACTTAAGCAGAGGTAGATTTTTTTTTT
A_38_P00031526	A_38_P00031526	mir|tca-miR-3850-5p|mir|MIMAT0018754	tca-miR-3850-5p	MIMAT0018754	unmapped	CGCTCGGGTTTTCCCGAGCGGTTAGACTAATATCGGCCATTTTTTTTT
A_38_P00031527	A_38_P00031527	mir|tca-miR-3850-5p|mir|MIMAT0018754	tca-miR-3850-5p	MIMAT0018754	unmapped	CGCTCGGGTTTTCCCGAGCGGTTAGACTAATATCGGCCTTTTTTTTTTT
A_38_P00031528	A_38_P00031528	mir|tca-miR-3858-3p|mir|MIMAT0018783	tca-miR-3858-3p	MIMAT0018783	unmapped	CGCTCGGGTTTTCCCGAGCGGTTAGAGAAGCAAGAGAGTAATTTTTTTT
A_38_P00031529	A_38_P00031529	mir|tca-miR-3858-3p|mir|MIMAT0018783	tca-miR-3858-3p	MIMAT0018783	unmapped	CGCTCGGGTTTTCCCGAGCGGTTAGAGAAGCAAGAGAGTTATTTTTTTTT
A_38_P00031530	A_38_P00031530	mir|tca-miR-3860-5p|mir|MIMAT0018792	tca-miR-3860-5p	MIMAT0018792	unmapped	CGCTCGGGTTTTCCCGAGCGGTTAGATCGTCCAGTGCATTTTTTTTT
A_38_P00031531	A_38_P00031531	mir|tca-miR-3860-5p|mir|MIMAT0018792	tca-miR-3860-5p	MIMAT0018792	unmapped	CGCTCGGGTTTTCCCGAGCGGTTAGATCGTCCAGTGCTTTTTTTTTTT
A_38_P00031532	A_38_P00031532	mir|tca-miR-282-3p|mir|MIMAT0019126	tca-miR-282-3p	MIMAT0019126	unmapped	CGCTCGGGTTTTCCCGAGCGGTTAGCCTCAATCAGGCATTTTTTTTT
A_38_P00031533	A_38_P00031533	mir|tca-miR-282-3p|mir|MIMAT0019126	tca-miR-282-3p	MIMAT0019126	unmapped	CGCTCGGGTTTTCCCGAGCGGTTAGCCTCAATCAGGCTTATTTTTTTT
A_38_P00031534	A_38_P00031534	mir|tca-miR-3829-3p|mir|MIMAT0018689	tca-miR-3829-3p	MIMAT0018689	unmapped	CGCTCGGGTTTTCCCGAGCGGTTAGGGTTCCTTGAAACTTTTTTTTTT
A_38_P00031535	A_38_P00031535	mir|tca-miR-3829-3p|mir|MIMAT0018689	tca-miR-3829-3p	MIMAT0018689	unmapped	CGCTCGGGTTTTCCCGAGCGGTTAGGGTTCCTTGAAACCTTTTTTTTTT
A_38_P00031536	A_38_P00031536	mir|tca-miR-3813-3p|mir|MIMAT0018649	tca-miR-3813-3p	MIMAT0018649	unmapped	CGCTCGGGTTTTCCCGAGCGGTTATCCTGACTCCTTCGTTTTTTTTTT
A_38_P00031537	A_38_P00031537	mir|tca-miR-3813-3p|mir|MIMAT0018649	tca-miR-3813-3p	MIMAT0018649	unmapped	CGCTCGGGTTTTCCCGAGCGGTTATCCTGACTCCTTCGATTTTTTTTTT
A_38_P00031538	A_38_P00031538	mir|tca-miR-375-5p|mir|MIMAT0018794	tca-miR-375-5p	MIMAT0018794	unmapped	CGCTCGGGTTTTCCCGAGCGGTTATTCGCAAGGCTCATTTTTTTTTT
A_38_P00031539	A_38_P00031539	mir|tca-miR-375-5p|mir|MIMAT0018794	tca-miR-375-5p	MIMAT0018794	unmapped	CGCTCGGGTTTTCCCGAGCGGTTATTCGCAAGGCTCAATATTTTTTTT
A_38_P00031540	A_38_P00031540	mir|tca-miR-3856-5p|mir|MIMAT0018770	tca-miR-3856-5p	MIMAT0018770	unmapped	CGCTCGGGTTTTCCCGAGCGGTTCAAATGACTTTCTTGCTTTTTTTTTT
A_38_P00031541	A_38_P00031541	mir|tca-miR-3856-5p|mir|MIMAT0018770	tca-miR-3856-5p	MIMAT0018770	unmapped	CGCTCGGGTTTTCCCGAGCGGTTCAAATGACTTTCTTGCATTTTTTTTTT
A_38_P00031542	A_38_P00031542	mir|tca-miR-3809-3p|mir|MIMAT0018641	tca-miR-3809-3p	MIMAT0018641	unmapped	CGCTCGGGTTTTCCCGAGCGGTTCATAACCAACTGACCTTTTTTTTTT
A_38_P00031543	A_38_P00031543	mir|tca-miR-3809-3p|mir|MIMAT0018641	tca-miR-3809-3p	MIMAT0018641	unmapped	CGCTCGGGTTTTCCCGAGCGGTTCATAACCAACTGACCGTTTTTTTTTT
A_38_P00031544	A_38_P00031544	mir|tca-miR-3856-3p|mir|MIMAT0018771	tca-miR-3856-3p	MIMAT0018771	unmapped	CGCTCGGGTTTTCCCGAGCGGTTCCGCAACGAAAAAATTTTTTTTT
A_38_P00031545	A_38_P00031545	mir|tca-miR-3856-3p|mir|MIMAT0018771	tca-miR-3856-3p	MIMAT0018771	unmapped	CGCTCGGGTTTTCCCGAGCGGTTCCGCAACGAAAAATTTTTTTTTTT
A_38_P00031546	A_38_P00031546	mir|tca-miR-3856-3p|mir|MIMAT0018771	tca-miR-3856-3p	MIMAT0018771	unmapped	CGCTCGGGTTTTCCCGAGCGGTTCCGCAACGAAAAATCTTTTTTTTTT
A_38_P00031547	A_38_P00031547	mir|tca-miR-3884-3p|mir|MIMAT0018867	tca-miR-3884-3p	MIMAT0018867	unmapped	CGCTCGGGTTTTCCCGAGCGGTTGAGGCTGGGGAATTTTTTTTTT
A_38_P00031548	A_38_P00031548	mir|tca-miR-3884-3p|mir|MIMAT0018867	tca-miR-3884-3p	MIMAT0018867	unmapped	CGCTCGGGTTTTCCCGAGCGGTTGAGGCTGGGGAAATTTTTTTTTT
A_38_P00031549	A_38_P00031549	mir|tca-miR-3835-3p|mir|MIMAT0018703	tca-miR-3835-3p	MIMAT0018703	unmapped	CGCTCGGGTTTTCCCGAGCGGTTGCCTCAGAAACTGTTTTTTTTTT
A_38_P00031550	A_38_P00031550	mir|tca-miR-3835-3p|mir|MIMAT0018703	tca-miR-3835-3p	MIMAT0018703	unmapped	CGCTCGGGTTTTCCCGAGCGGTTGCCTCAGAAACTGCTTTTTTTTTT
A_38_P00031551	A_38_P00031551	mir|tca-miR-3827-5p|mir|MIMAT0018682	tca-miR-3827-5p	MIMAT0018682	unmapped	CGCTCGGGTTTTCCCGAGCGGTTGCGGCATCCGTTTTTTTTTT
A_38_P00031552	A_38_P00031552	mir|tca-miR-3827-5p|mir|MIMAT0018682	tca-miR-3827-5p	MIMAT0018682	unmapped	CGCTCGGGTTTTCCCGAGCGGTTGCGGCATCCGCTTTTTTTTTT
A_38_P00031553	A_38_P00031553	mir|tca-miR-3887-3p|mir|MIMAT0018873	tca-miR-3887-3p	MIMAT0018873	unmapped	CGCTCGGGTTTTCCCGAGCGGTTGGAATAAAAAGGCGTTTTTTTTTT
A_38_P00031554	A_38_P00031554	mir|tca-miR-3887-3p|mir|MIMAT0018873	tca-miR-3887-3p	MIMAT0018873	unmapped	CGCTCGGGTTTTCCCGAGCGGTTGGAATAAAAAGGCGCTTTTTTTTTT
A_38_P00031555	A_38_P00031555	mir|tca-miR-3903-3p|mir|MIMAT0018910	tca-miR-3903-3p	MIMAT0018910	unmapped	CGCTCGGGTTTTCCCGAGCGGTTGGAATAGTATGTAATATTTTTTTTTTT
A_38_P00031556	A_38_P00031556	mir|tca-miR-3891-5p|mir|MIMAT0018880	tca-miR-3891-5p	MIMAT0018880	unmapped	CGCTCGGGTTTTCCCGAGCGGTTTACGACACATTAACCTTATTTTTTTT
A_38_P00031557	A_38_P00031557	mir|tca-miR-3891-5p|mir|MIMAT0018880	tca-miR-3891-5p	MIMAT0018880	unmapped	CGCTCGGGTTTTCCCGAGCGGTTTACGACACATTAACCTCATTTTTTTTT
A_38_P00031558	A_38_P00031558	mir|tca-miR-3818-3p|mir|MIMAT0018661	tca-miR-3818-3p	MIMAT0018661	unmapped	CGCTCGGGTTTTCCCGAGCGGTTTAGCTCCGCAGATGAATTTTTTTT
A_38_P00031559	A_38_P00031559	mir|tca-miR-3818-3p|mir|MIMAT0018661	tca-miR-3818-3p	MIMAT0018661	unmapped	CGCTCGGGTTTTCCCGAGCGGTTTAGCTCCGCAGATGTATTTTTTTTT
A_38_P00031560	A_38_P00031560	mir|tca-miR-3875-5p|mir|MIMAT0018842	tca-miR-3875-5p	MIMAT0018842	unmapped	CGCTCGGGTTTTCCCGAGCGGTTTATTGAGCTAAAGACGTTTTTTTTTT
A_38_P00031561	A_38_P00031561	mir|tca-miR-3875-5p|mir|MIMAT0018842	tca-miR-3875-5p	MIMAT0018842	unmapped	CGCTCGGGTTTTCCCGAGCGGTTTATTGAGCTAAAGACGCTTTTTTTTTT
A_38_P00031562	A_38_P00031562	mir|tca-miR-92c-5p|mir|MIMAT0018786	tca-miR-92c-5p	MIMAT0018786	unmapped	CGCTCGGGTTTTCCCGAGCGGTTTGCACAAATCACGATTTTTTTTTT
A_38_P00031563	A_38_P00031563	mir|tca-miR-92c-5p|mir|MIMAT0018786	tca-miR-92c-5p	MIMAT0018786	unmapped	CGCTCGGGTTTTCCCGAGCGGTTTGCACAAATCACGACTTTTTTTTTT
A_38_P00031564	A_38_P00031564	mir|tca-miR-3870-5p|mir|MIMAT0018832	tca-miR-3870-5p	MIMAT0018832	unmapped	CGCTCGGGTTTTCCCGAGCGGTTTTCCTCTTGTGCCTTTTTTTTTTT
A_38_P00031565	A_38_P00031565	mir|tca-miR-3870-5p|mir|MIMAT0018832	tca-miR-3870-5p	MIMAT0018832	unmapped	CGCTCGGGTTTTCCCGAGCGGTTTTCCTCTTGTGCCTCTTTTTTTTTT
A_38_P00033356	A_38_P00033356	mir|dme-miR-14-3p|mir|MIMAT0000120	dme-miR-14-3p	MIMAT0000120	unmapped	CGCTCGGGTTTTCCCGAGCGGATAGGAGAGAGAAAAAGACATTTTTTTTT
A_38_P00033357	A_38_P00033357	mir|dme-miR-14-3p|mir|MIMAT0000120	dme-miR-14-3p	MIMAT0000120	unmapped	CGCTCGGGTTTTCCCGAGCGGATAGGAGAGAGAAAAAGACTTTTTTTTTTT
A_38_P00033360	A_38_P00033360	mir|dme-miR-283-5p|mir|MIMAT0000347	dme-miR-283-5p	MIMAT0000347	unmapped	CGCTCGGGTTTTCCCGAGCGGCCAGAATTACCAGCTGTATTTTTTTT
A_38_P00033361	A_38_P00033361	mir|dme-miR-283-5p|mir|MIMAT0000347	dme-miR-283-5p	MIMAT0000347	unmapped	CGCTCGGGTTTTCCCGAGCGGCCAGAATTACCAGCTGAATTTTTTTTT
A_38_P00033362	A_38_P00033362	mir|dme-miR-33-5p|mir|MIMAT0000342	dme-miR-33-5p	MIMAT0000342	unmapped	CGCTCGGGTTTTCCCGAGCGGGACAATGCGACTACAAATTTTTTTTT
A_38_P00033363	A_38_P00033363	mir|dme-miR-33-5p|mir|MIMAT0000342	dme-miR-33-5p	MIMAT0000342	unmapped	CGCTCGGGTTTTCCCGAGCGGGACAATGCGACTACAATTTTTTTTTTT
A_38_P00033364	A_38_P00033364	mir|dme-miR-33-5p|mir|MIMAT0000342	dme-miR-33-5p	MIMAT0000342	unmapped	CGCTCGGGTTTTCCCGAGCGGGACAATGCGACTACAATGTTTTTTTTTT
A_38_P00037436	A_38_P00037436	mir|ame-miR-6056|mir|MIMAT0023680	ame-miR-6056	MIMAT0023680	unmapped	CGCTCGGGTTTTCCCGAGCGGAACCTCCCTCCTCGATTTTTTTTT
A_38_P00037437	A_38_P00037437	mir|ame-miR-6056|mir|MIMAT0023680	ame-miR-6056	MIMAT0023680	unmapped	CGCTCGGGTTTTCCCGAGCGGAACCTCCCTCCTCGTTTTTTTTTTT
A_38_P00037438	A_38_P00037438	mir|ame-miR-965-3p|mir|MIMAT0022969	ame-miR-965-3p	MIMAT0022969	unmapped	CGCTCGGGTTTTCCCGAGCGGAAGGGAAAAAGCTATACGTATTTTTTTT
A_38_P00037439	A_38_P00037439	mir|ame-miR-965-3p|mir|MIMAT0022969	ame-miR-965-3p	MIMAT0022969	unmapped	CGCTCGGGTTTTCCCGAGCGGAAGGGAAAAAGCTATACGCAATTTTTTTT
A_38_P00037440	A_38_P00037440	mir|ame-miR-6003-3p|mir|MIMAT0023546	ame-miR-6003-3p	MIMAT0023546	unmapped	CGCTCGGGTTTTCCCGAGCGGAATCGAGACGCAAAGATTTTTTTTTT
A_38_P00037441	A_38_P00037441	mir|ame-miR-6003-3p|mir|MIMAT0023546	ame-miR-6003-3p	MIMAT0023546	unmapped	CGCTCGGGTTTTCCCGAGCGGAATCGAGACGCAAAGACTATTTTTTTT
A_38_P00037442	A_38_P00037442	mir|ame-miR-6038|mir|MIMAT0023658	ame-miR-6038	MIMAT0023658	unmapped	CGCTCGGGTTTTCCCGAGCGGAATGAAATAAGACAGAAACTATTTTTTTT
A_38_P00037443	A_38_P00037443	mir|ame-miR-6038|mir|MIMAT0023658	ame-miR-6038	MIMAT0023658	unmapped	CGCTCGGGTTTTCCCGAGCGGAATGAAATAAGACAGAAACAATTTTTTTTT
A_38_P00037444	A_38_P00037444	mir|ame-miR-6038|mir|MIMAT0023658	ame-miR-6038	MIMAT0023658	unmapped	CGCTCGGGTTTTCCCGAGCGGAATGAAATAAGACAGAAACATTTTTTTTTTT
A_38_P00037445	A_38_P00037445	mir|ame-miR-6038|mir|MIMAT0023658	ame-miR-6038	MIMAT0023658	unmapped	CGCTCGGGTTTTCCCGAGCGGAATGAAATAAGACAGAAACATATTTTTTTTTT
A_38_P00037446	A_38_P00037446	mir|ame-miR-6012|mir|MIMAT0023670	ame-miR-6012	MIMAT0023670	unmapped	CGCTCGGGTTTTCCCGAGCGGACAGGCTGATCTCATCTTTTTTTTTT
A_38_P00037447	A_38_P00037447	mir|ame-miR-6012|mir|MIMAT0023670	ame-miR-6012	MIMAT0023670	unmapped	CGCTCGGGTTTTCCCGAGCGGACAGGCTGATCTCATCGTTTTTTTTTT
A_38_P00037448	A_38_P00037448	mir|ame-miR-6005-3p|mir|MIMAT0023550	ame-miR-6005-3p	MIMAT0023550	unmapped	CGCTCGGGTTTTCCCGAGCGGACATATAATCTCTTACGCATTATTTTTTTT
A_38_P00037449	A_38_P00037449	mir|ame-miR-6005-3p|mir|MIMAT0023550	ame-miR-6005-3p	MIMAT0023550	unmapped	CGCTCGGGTTTTCCCGAGCGGACATATAATCTCTTACGCATGATTTTTTTTT
A_38_P00037450	A_38_P00037450	mir|ame-miR-6053|mir|MIMAT0023677	ame-miR-6053	MIMAT0023677	unmapped	CGCTCGGGTTTTCCCGAGCGGACATCCGCGCGGATTTTTTTTT
A_38_P00037451	A_38_P00037451	mir|ame-miR-6053|mir|MIMAT0023677	ame-miR-6053	MIMAT0023677	unmapped	CGCTCGGGTTTTCCCGAGCGGACATCCGCGCGGTTATTTTTTTT
A_38_P00037452	A_38_P00037452	mir|ame-miR-6048|mir|MIMAT0023672	ame-miR-6048	MIMAT0023672	unmapped	CGCTCGGGTTTTCCCGAGCGGACCAGTCGGTCCATTTTTTTTTT
A_38_P00037453	A_38_P00037453	mir|ame-miR-6048|mir|MIMAT0023672	ame-miR-6048	MIMAT0023672	unmapped	CGCTCGGGTTTTCCCGAGCGGACCAGTCGGTCCACTATTTTTTTT
A_38_P00037454	A_38_P00037454	mir|ame-miR-6063|mir|MIMAT0023687	ame-miR-6063	MIMAT0023687	unmapped	CGCTCGGGTTTTCCCGAGCGGACCGCGTCTTCGAATTTTTTTTT
A_38_P00037455	A_38_P00037455	mir|ame-miR-6063|mir|MIMAT0023687	ame-miR-6063	MIMAT0023687	unmapped	CGCTCGGGTTTTCCCGAGCGGACCGCGTCTTCGATTTTTTTTTTT
A_38_P00037456	A_38_P00037456	mir|ame-miR-6063|mir|MIMAT0023687	ame-miR-6063	MIMAT0023687	unmapped	CGCTCGGGTTTTCCCGAGCGGACCGCGTCTTCGATCTTTTTTTTTT
A_38_P00037457	A_38_P00037457	mir|ame-miR-6046|mir|MIMAT0023669	ame-miR-6046	MIMAT0023669	unmapped	CGCTCGGGTTTTCCCGAGCGGACCGGTCACGGAAAATTTTTTTT
A_38_P00037458	A_38_P00037458	mir|ame-miR-6046|mir|MIMAT0023669	ame-miR-6046	MIMAT0023669	unmapped	CGCTCGGGTTTTCCCGAGCGGACCGGTCACGGAATATTTTTTTTT
A_38_P00037459	A_38_P00037459	mir|ame-miR-6046|mir|MIMAT0023669	ame-miR-6046	MIMAT0023669	unmapped	CGCTCGGGTTTTCCCGAGCGGACCGGTCACGGAATTTATTTTTTTT
A_38_P00037460	A_38_P00037460	mir|ame-miR-6054|mir|MIMAT0023678	ame-miR-6054	MIMAT0023678	unmapped	CGCTCGGGTTTTCCCGAGCGGACCGTCACATCGTTCTTTTTTTTTT
A_38_P00037461	A_38_P00037461	mir|ame-miR-6054|mir|MIMAT0023678	ame-miR-6054	MIMAT0023678	unmapped	CGCTCGGGTTTTCCCGAGCGGACCGTCACATCGTTCATTTTTTTTTT
A_38_P00037462	A_38_P00037462	mir|ame-miR-6049|mir|MIMAT0023673	ame-miR-6049	MIMAT0023673	unmapped	CGCTCGGGTTTTCCCGAGCGGACCGTCTATTCCTCCTATTTTTTTT
A_38_P00037463	A_38_P00037463	mir|ame-miR-6049|mir|MIMAT0023673	ame-miR-6049	MIMAT0023673	unmapped	CGCTCGGGTTTTCCCGAGCGGACCGTCTATTCCTCCGAATTTTTTTT
A_38_P00037464	A_38_P00037464	mir|ame-miR-6039|mir|MIMAT0023659	ame-miR-6039	MIMAT0023659	unmapped	CGCTCGGGTTTTCCCGAGCGGACGTAAACTCACGCTATTTTTTTT
A_38_P00037465	A_38_P00037465	mir|ame-miR-6039|mir|MIMAT0023659	ame-miR-6039	MIMAT0023659	unmapped	CGCTCGGGTTTTCCCGAGCGGACGTAAACTCACGCGAATTTTTTTT
A_38_P00037466	A_38_P00037466	mir|ame-miR-6060|mir|MIMAT0023684	ame-miR-6060	MIMAT0023684	unmapped	CGCTCGGGTTTTCCCGAGCGGACGTTGCCAACGTCTATTTTTTTT
A_38_P00037467	A_38_P00037467	mir|ame-miR-6060|mir|MIMAT0023684	ame-miR-6060	MIMAT0023684	unmapped	CGCTCGGGTTTTCCCGAGCGGACGTTGCCAACGTCGATTTTTTTTT
A_38_P00037468	A_38_P00037468	mir|ame-miR-6045|mir|MIMAT0023667	ame-miR-6045	MIMAT0023667	unmapped	CGCTCGGGTTTTCCCGAGCGGAGCCCATTGCCGTTTTTTTTTTT
A_38_P00037469	A_38_P00037469	mir|ame-miR-6045|mir|MIMAT0023667	ame-miR-6045	MIMAT0023667	unmapped	CGCTCGGGTTTTCCCGAGCGGAGCCCATTGCCGTCTTTTTTTTTT
A_38_P00037470	A_38_P00037470	mir|ame-miR-6047b|mir|MIMAT0023688	ame-miR-6047b	MIMAT0023688	unmapped	CGCTCGGGTTTTCCCGAGCGGAGTGGACTGACTGGTTTTTTTTTT
A_38_P00037471	A_38_P00037471	mir|ame-miR-6047b|mir|MIMAT0023688	ame-miR-6047b	MIMAT0023688	unmapped	CGCTCGGGTTTTCCCGAGCGGAGTGGACTGACTGGCTATTTTTTTT
A_38_P00037472	A_38_P00037472	mir|ame-miR-6000a-5p|mir|MIMAT0023539	ame-miR-6000a-5p	MIMAT0023539	unmapped	CGCTCGGGTTTTCCCGAGCGGATAGAGACGAGTAGTACCTTTTTTTTTT
A_38_P00037473	A_38_P00037473	mir|ame-miR-6000a-5p|mir|MIMAT0023539	ame-miR-6000a-5p	MIMAT0023539	unmapped	CGCTCGGGTTTTCCCGAGCGGATAGAGACGAGTAGTACCCTTTTTTTTTT
A_38_P00037474	A_38_P00037474	mir|ame-miR-6051|mir|MIMAT0023675	ame-miR-6051	MIMAT0023675	unmapped	CGCTCGGGTTTTCCCGAGCGGATATTCAGAGCGTGCGTTTTTTTTTT
A_38_P00037475	A_38_P00037475	mir|ame-miR-6051|mir|MIMAT0023675	ame-miR-6051	MIMAT0023675	unmapped	CGCTCGGGTTTTCCCGAGCGGATATTCAGAGCGTGCGCTTTTTTTTTT
A_38_P00037476	A_38_P00037476	mir|ame-miR-6044|mir|MIMAT0023666	ame-miR-6044	MIMAT0023666	unmapped	CGCTCGGGTTTTCCCGAGCGGATCACTTGCCTAAGAAGTTTTTTTTTT
A_38_P00037477	A_38_P00037477	mir|ame-miR-6044|mir|MIMAT0023666	ame-miR-6044	MIMAT0023666	unmapped	CGCTCGGGTTTTCCCGAGCGGATCACTTGCCTAAGAAGCTATTTTTTTT
A_38_P00037478	A_38_P00037478	mir|ame-miR-3049-5p|mir|MIMAT0022968	ame-miR-3049-5p	MIMAT0022968	unmapped	CGCTCGGGTTTTCCCGAGCGGATCCGCCGCAACTTTTTTTTTTT
A_38_P00037479	A_38_P00037479	mir|ame-miR-3049-5p|mir|MIMAT0022968	ame-miR-3049-5p	MIMAT0022968	unmapped	CGCTCGGGTTTTCCCGAGCGGATCCGCCGCAACTATTTTTTTTTT
A_38_P00037480	A_38_P00037480	mir|ame-miR-3049-5p|mir|MIMAT0022968	ame-miR-3049-5p	MIMAT0022968	unmapped	CGCTCGGGTTTTCCCGAGCGGATCCGCCGCAACTACTATTTTTTTT
A_38_P00037481	A_38_P00037481	mir|ame-miR-6047a|mir|MIMAT0023671	ame-miR-6047a	MIMAT0023671	unmapped	CGCTCGGGTTTTCCCGAGCGGATTGTGGACTGTAGGCATTTTTTTTT
A_38_P00037482	A_38_P00037482	mir|ame-miR-6047a|mir|MIMAT0023671	ame-miR-6047a	MIMAT0023671	unmapped	CGCTCGGGTTTTCCCGAGCGGATTGTGGACTGTAGGCTTATTTTTTTT
A_38_P00037483	A_38_P00037483	mir|ame-miR-92c|mir|MIMAT0023668	ame-miR-92c	MIMAT0023668	unmapped	CGCTCGGGTTTTCCCGAGCGGCAAATAATGCCCACATCTTTTTTTTTT
A_38_P00037484	A_38_P00037484	mir|ame-miR-92c|mir|MIMAT0023668	ame-miR-92c	MIMAT0023668	unmapped	CGCTCGGGTTTTCCCGAGCGGCAAATAATGCCCACATCCTTTTTTTTTT
A_38_P00037485	A_38_P00037485	mir|ame-miR-6057|mir|MIMAT0023681	ame-miR-6057	MIMAT0023681	unmapped	CGCTCGGGTTTTCCCGAGCGGCATTTGTTGTTACAGTCATTTTTTTTTT
A_38_P00037486	A_38_P00037486	mir|ame-miR-6057|mir|MIMAT0023681	ame-miR-6057	MIMAT0023681	unmapped	CGCTCGGGTTTTCCCGAGCGGCATTTGTTGTTACAGTCACTTTTTTTTTT
A_38_P00037487	A_38_P00037487	mir|ame-miR-6002-3p|mir|MIMAT0023544	ame-miR-6002-3p	MIMAT0023544	unmapped	CGCTCGGGTTTTCCCGAGCGGCCACGAAACGTTACTTATTTTTTTT
A_38_P00037488	A_38_P00037488	mir|ame-miR-6002-3p|mir|MIMAT0023544	ame-miR-6002-3p	MIMAT0023544	unmapped	CGCTCGGGTTTTCCCGAGCGGCCACGAAACGTTACTCATTTTTTTTT
A_38_P00037489	A_38_P00037489	mir|ame-miR-6006-5p|mir|MIMAT0023553	ame-miR-6006-5p	MIMAT0023553	unmapped	CGCTCGGGTTTTCCCGAGCGGCCTCTCTCTTCCCAGAATTTTTTTT
A_38_P00037490	A_38_P00037490	mir|ame-miR-6006-5p|mir|MIMAT0023553	ame-miR-6006-5p	MIMAT0023553	unmapped	CGCTCGGGTTTTCCCGAGCGGCCTCTCTCTTCCCAGTATTTTTTTTT
A_38_P00037491	A_38_P00037491	mir|ame-miR-6004-5p|mir|MIMAT0023547	ame-miR-6004-5p	MIMAT0023547	unmapped	CGCTCGGGTTTTCCCGAGCGGCGATCATTAACGCTCTTTTTTTTTT
A_38_P00037492	A_38_P00037492	mir|ame-miR-6004-5p|mir|MIMAT0023547	ame-miR-6004-5p	MIMAT0023547	unmapped	CGCTCGGGTTTTCCCGAGCGGCGATCATTAACGCTCCTATTTTTTTT
A_38_P00037493	A_38_P00037493	mir|ame-miR-6061|mir|MIMAT0023685	ame-miR-6061	MIMAT0023685	unmapped	CGCTCGGGTTTTCCCGAGCGGCGGCGTGGTAACTATTTTTTTT
A_38_P00037494	A_38_P00037494	mir|ame-miR-6061|mir|MIMAT0023685	ame-miR-6061	MIMAT0023685	unmapped	CGCTCGGGTTTTCCCGAGCGGCGGCGTGGTAACGATTTTTTTTT
A_38_P00037495	A_38_P00037495	mir|ame-miR-6064|mir|MIMAT0023689	ame-miR-6064	MIMAT0023689	unmapped	CGCTCGGGTTTTCCCGAGCGGCGTCTCGTTGCAAATATTTTTTTT
A_38_P00037496	A_38_P00037496	mir|ame-miR-6064|mir|MIMAT0023689	ame-miR-6064	MIMAT0023689	unmapped	CGCTCGGGTTTTCCCGAGCGGCGTCTCGTTGCAAAAAATTTTTTTT
A_38_P00037497	A_38_P00037497	mir|ame-miR-6066|mir|MIMAT0023691	ame-miR-6066	MIMAT0023691	unmapped	CGCTCGGGTTTTCCCGAGCGGCGTGGTCACGAGGTTTTTTTTTT
A_38_P00037498	A_38_P00037498	mir|ame-miR-6066|mir|MIMAT0023691	ame-miR-6066	MIMAT0023691	unmapped	CGCTCGGGTTTTCCCGAGCGGCGTGGTCACGAGGCTATTTTTTTT
A_38_P00037499	A_38_P00037499	mir|ame-miR-6058|mir|MIMAT0023682	ame-miR-6058	MIMAT0023682	unmapped	CGCTCGGGTTTTCCCGAGCGGCGTTGTCATCACCATATTTTTTTTT
A_38_P00037500	A_38_P00037500	mir|ame-miR-6058|mir|MIMAT0023682	ame-miR-6058	MIMAT0023682	unmapped	CGCTCGGGTTTTCCCGAGCGGCGTTGTCATCACCATTTATTTTTTTT
A_38_P00037501	A_38_P00037501	mir|ame-miR-6058|mir|MIMAT0023682	ame-miR-6058	MIMAT0023682	unmapped	CGCTCGGGTTTTCCCGAGCGGCGTTGTCATCACCATTGATTTTTTTTT
A_38_P00037502	A_38_P00037502	mir|ame-miR-6000b|mir|MIMAT0023661	ame-miR-6000b	MIMAT0023661	unmapped	CGCTCGGGTTTTCCCGAGCGGCTCGTGGGTACTACTTTTTTTTTTT
A_38_P00037503	A_38_P00037503	mir|ame-miR-6000b|mir|MIMAT0023661	ame-miR-6000b	MIMAT0023661	unmapped	CGCTCGGGTTTTCCCGAGCGGCTCGTGGGTACTACTCTATTTTTTTT
A_38_P00037504	A_38_P00037504	mir|ame-miR-2765-3p|mir|MIMAT0023552	ame-miR-2765-3p	MIMAT0023552	unmapped	CGCTCGGGTTTTCCCGAGCGGGAAGGAAACTCGTACCTTTTTTTTTT
A_38_P00037505	A_38_P00037505	mir|ame-miR-2765-3p|mir|MIMAT0023552	ame-miR-2765-3p	MIMAT0023552	unmapped	CGCTCGGGTTTTCCCGAGCGGGAAGGAAACTCGTACCCTTTTTTTTTT
A_38_P00037508	A_38_P00037508	mir|ame-miR-6055|mir|MIMAT0023679	ame-miR-6055	MIMAT0023679	unmapped	CGCTCGGGTTTTCCCGAGCGGGCGACACACAGCTTATTTTTTTT
A_38_P00037509	A_38_P00037509	mir|ame-miR-6055|mir|MIMAT0023679	ame-miR-6055	MIMAT0023679	unmapped	CGCTCGGGTTTTCCCGAGCGGGCGACACACAGCTAAATTTTTTTT
A_38_P00037510	A_38_P00037510	mir|ame-miR-6055|mir|MIMAT0023679	ame-miR-6055	MIMAT0023679	unmapped	CGCTCGGGTTTTCCCGAGCGGGCGACACACAGCTATATTTTTTTTT
A_38_P00037511	A_38_P00037511	mir|ame-miR-6055|mir|MIMAT0023679	ame-miR-6055	MIMAT0023679	unmapped	CGCTCGGGTTTTCCCGAGCGGGCGACACACAGCTATTTTTTTTTTTT
A_38_P00037512	A_38_P00037512	mir|ame-miR-6002-5p|mir|MIMAT0023543	ame-miR-6002-5p	MIMAT0023543	unmapped	CGCTCGGGTTTTCCCGAGCGGGGAATACCCTTCGCTATTTTTTTTT
A_38_P00037513	A_38_P00037513	mir|ame-miR-6002-5p|mir|MIMAT0023543	ame-miR-6002-5p	MIMAT0023543	unmapped	CGCTCGGGTTTTCCCGAGCGGGGAATACCCTTCGCTTTTTTTTTTTT
A_38_P00037514	A_38_P00037514	mir|ame-miR-6003-5p|mir|MIMAT0023545	ame-miR-6003-5p	MIMAT0023545	unmapped	CGCTCGGGTTTTCCCGAGCGGGGCCTCTTTTCCCTTTTTTTTTT
A_38_P00037515	A_38_P00037515	mir|ame-miR-6003-5p|mir|MIMAT0023545	ame-miR-6003-5p	MIMAT0023545	unmapped	CGCTCGGGTTTTCCCGAGCGGGGCCTCTTTTCCCCTTTTTTTTTT
A_38_P00037516	A_38_P00037516	mir|ame-miR-6037|mir|MIMAT0023657	ame-miR-6037	MIMAT0023657	unmapped	CGCTCGGGTTTTCCCGAGCGGGTAAAAAGTACACAGAGCAATTTTTTTT
A_38_P00037517	A_38_P00037517	mir|ame-miR-6037|mir|MIMAT0023657	ame-miR-6037	MIMAT0023657	unmapped	CGCTCGGGTTTTCCCGAGCGGGTAAAAAGTACACAGAGCTATTTTTTTTT
A_38_P00037518	A_38_P00037518	mir|ame-miR-6004-3p|mir|MIMAT0023548	ame-miR-6004-3p	MIMAT0023548	unmapped	CGCTCGGGTTTTCCCGAGCGGGTAGAACGCAACGCTTTTTTTTTT
A_38_P00037519	A_38_P00037519	mir|ame-miR-6004-3p|mir|MIMAT0023548	ame-miR-6004-3p	MIMAT0023548	unmapped	CGCTCGGGTTTTCCCGAGCGGGTAGAACGCAACGCATATTTTTTTT
A_38_P00037520	A_38_P00037520	mir|ame-miR-6001-5p|mir|MIMAT0023541	ame-miR-6001-5p	MIMAT0023541	unmapped	CGCTCGGGTTTTCCCGAGCGGGTTCCCATCAGTCGAATTTTTTTT
A_38_P00037521	A_38_P00037521	mir|ame-miR-6001-5p|mir|MIMAT0023541	ame-miR-6001-5p	MIMAT0023541	unmapped	CGCTCGGGTTTTCCCGAGCGGGTTCCCATCAGTCGTATTTTTTTTT
A_38_P00037522	A_38_P00037522	mir|ame-miR-6065|mir|MIMAT0023690	ame-miR-6065	MIMAT0023690	unmapped	CGCTCGGGTTTTCCCGAGCGGTACCGGGGGGATCTTTTTTTTTT
A_38_P00037523	A_38_P00037523	mir|ame-miR-6065|mir|MIMAT0023690	ame-miR-6065	MIMAT0023690	unmapped	CGCTCGGGTTTTCCCGAGCGGTACCGGGGGGATCGTTTTTTTTTT
A_38_P00037524	A_38_P00037524	mir|ame-miR-6001-3p|mir|MIMAT0023542	ame-miR-6001-3p	MIMAT0023542	unmapped	CGCTCGGGTTTTCCCGAGCGGTAGTGGTAACAACCAAAGTTTTTTTTTT
A_38_P00037525	A_38_P00037525	mir|ame-miR-6001-3p|mir|MIMAT0023542	ame-miR-6001-3p	MIMAT0023542	unmapped	CGCTCGGGTTTTCCCGAGCGGTAGTGGTAACAACCAAAGATTTTTTTTTT
A_38_P00037526	A_38_P00037526	mir|ame-miR-6067|mir|MIMAT0023692	ame-miR-6067	MIMAT0023692	unmapped	CGCTCGGGTTTTCCCGAGCGGTCACAAAAAGCTTGATCTTTTTTTTTT
A_38_P00037527	A_38_P00037527	mir|ame-miR-6067|mir|MIMAT0023692	ame-miR-6067	MIMAT0023692	unmapped	CGCTCGGGTTTTCCCGAGCGGTCACAAAAAGCTTGATCCTATTTTTTTT
A_38_P00037528	A_38_P00037528	mir|ame-miR-6005-5p|mir|MIMAT0023549	ame-miR-6005-5p	MIMAT0023549	unmapped	CGCTCGGGTTTTCCCGAGCGGTCACGTACATAAGAGTTCTATTTTTTTT
A_38_P00037529	A_38_P00037529	mir|ame-miR-6005-5p|mir|MIMAT0023549	ame-miR-6005-5p	MIMAT0023549	unmapped	CGCTCGGGTTTTCCCGAGCGGTCACGTACATAAGAGTTCAATTTTTTTTT
A_38_P00037530	A_38_P00037530	mir|ame-miR-252b|mir|MIMAT0023662	ame-miR-252b	MIMAT0023662	unmapped	CGCTCGGGTTTTCCCGAGCGGTCATCTACGACACTACTATATTTTTTTT
A_38_P00037531	A_38_P00037531	mir|ame-miR-252b|mir|MIMAT0023662	ame-miR-252b	MIMAT0023662	unmapped	CGCTCGGGTTTTCCCGAGCGGTCATCTACGACACTACTACAATTTTTTTT
A_38_P00037532	A_38_P00037532	mir|ame-miR-6040|mir|MIMAT0023660	ame-miR-6040	MIMAT0023660	unmapped	CGCTCGGGTTTTCCCGAGCGGTCCCAGTACTGCCCTATTTTTTTT
A_38_P00037533	A_38_P00037533	mir|ame-miR-6040|mir|MIMAT0023660	ame-miR-6040	MIMAT0023660	unmapped	CGCTCGGGTTTTCCCGAGCGGTCCCAGTACTGCCCGATTTTTTTTT
A_38_P00037534	A_38_P00037534	mir|ame-miR-6041|mir|MIMAT0023663	ame-miR-6041	MIMAT0023663	unmapped	CGCTCGGGTTTTCCCGAGCGGTCCTTCGATCTCGATGTATTTTTTTT
A_38_P00037535	A_38_P00037535	mir|ame-miR-6041|mir|MIMAT0023663	ame-miR-6041	MIMAT0023663	unmapped	CGCTCGGGTTTTCCCGAGCGGTCCTTCGATCTCGATGAATTTTTTTTT
A_38_P00037536	A_38_P00037536	mir|ame-miR-6052|mir|MIMAT0023676	ame-miR-6052	MIMAT0023676	unmapped	CGCTCGGGTTTTCCCGAGCGGTCTATGAGTTCTAGCTTTTTTTTTTTTTT
A_38_P00037537	A_38_P00037537	mir|ame-miR-6052|mir|MIMAT0023676	ame-miR-6052	MIMAT0023676	unmapped	CGCTCGGGTTTTCCCGAGCGGTCTATGAGTTCTAGCTTTTGTTTTTTTTTT
A_38_P00037538	A_38_P00037538	mir|ame-miR-6042|mir|MIMAT0023664	ame-miR-6042	MIMAT0023664	unmapped	CGCTCGGGTTTTCCCGAGCGGTCTCCACTACTACCGTATTTTTTTTT
A_38_P00037539	A_38_P00037539	mir|ame-miR-6042|mir|MIMAT0023664	ame-miR-6042	MIMAT0023664	unmapped	CGCTCGGGTTTTCCCGAGCGGTCTCCACTACTACCGTTTTTTTTTTTT
A_38_P00037540	A_38_P00037540	mir|ame-miR-6043|mir|MIMAT0023665	ame-miR-6043	MIMAT0023665	unmapped	CGCTCGGGTTTTCCCGAGCGGTGGAATAGATCACGGTTTTTTTTTTT
A_38_P00037541	A_38_P00037541	mir|ame-miR-6043|mir|MIMAT0023665	ame-miR-6043	MIMAT0023665	unmapped	CGCTCGGGTTTTCCCGAGCGGTGGAATAGATCACGGTCTTTTTTTTTT
A_38_P00037542	A_38_P00037542	mir|ame-miR-6059|mir|MIMAT0023683	ame-miR-6059	MIMAT0023683	unmapped	CGCTCGGGTTTTCCCGAGCGGTGGTTCCGTCTCTCTTTTTTTTTT
A_38_P00037543	A_38_P00037543	mir|ame-miR-6059|mir|MIMAT0023683	ame-miR-6059	MIMAT0023683	unmapped	CGCTCGGGTTTTCCCGAGCGGTGGTTCCGTCTCTCCTATTTTTTTT
A_38_P00037544	A_38_P00037544	mir|ame-miR-6062|mir|MIMAT0023686	ame-miR-6062	MIMAT0023686	unmapped	CGCTCGGGTTTTCCCGAGCGGTGTCCTAAATACCAATATCTATTTTTTTT
A_38_P00037545	A_38_P00037545	mir|ame-miR-6062|mir|MIMAT0023686	ame-miR-6062	MIMAT0023686	unmapped	CGCTCGGGTTTTCCCGAGCGGTGTCCTAAATACCAATATCGATTTTTTTTT
A_38_P00037546	A_38_P00037546	mir|ame-miR-6000a-3p|mir|MIMAT0023540	ame-miR-6000a-3p	MIMAT0023540	unmapped	CGCTCGGGTTTTCCCGAGCGGTGTGGGTACTTCTCGATTTTTTTTT
A_38_P00037547	A_38_P00037547	mir|ame-miR-6000a-3p|mir|MIMAT0023540	ame-miR-6000a-3p	MIMAT0023540	unmapped	CGCTCGGGTTTTCCCGAGCGGTGTGGGTACTTCTCGTTTTTTTTTTT
A_38_P00037548	A_38_P00037548	mir|ame-miR-6006-3p|mir|MIMAT0023554	ame-miR-6006-3p	MIMAT0023554	unmapped	CGCTCGGGTTTTCCCGAGCGGTTATAACTGAAAAAGAAAAATTTTTTTTT
A_38_P00037549	A_38_P00037549	mir|ame-miR-6006-3p|mir|MIMAT0023554	ame-miR-6006-3p	MIMAT0023554	unmapped	CGCTCGGGTTTTCCCGAGCGGTTATAACTGAAAAAGAAAATTTTTTTTTTT
A_38_P00037550	A_38_P00037550	mir|ame-miR-6050|mir|MIMAT0023674	ame-miR-6050	MIMAT0023674	unmapped	CGCTCGGGTTTTCCCGAGCGGTTCCACCCTCCACATTTTTTTTTT
A_38_P00037551	A_38_P00037551	mir|ame-miR-6050|mir|MIMAT0023674	ame-miR-6050	MIMAT0023674	unmapped	CGCTCGGGTTTTCCCGAGCGGTTCCACCCTCCACAATTTTTTTTTT
A_38_P00037552	A_38_P00037552	mir|bmo-miR-6496-5p|mir|MIMAT0025319	bmo-miR-6496-5p	MIMAT0025319	unmapped	CGCTCGGGTTTTCCCGAGCGGAACAACGGGATTCAGTTTTTTTTTTT
A_38_P00037553	A_38_P00037553	mir|bmo-miR-6496-5p|mir|MIMAT0025319	bmo-miR-6496-5p	MIMAT0025319	unmapped	CGCTCGGGTTTTCCCGAGCGGAACAACGGGATTCAGTGTATTTTTTTT
A_38_P00037554	A_38_P00037554	mir|bmo-miR-6498-3p|mir|MIMAT0025324	bmo-miR-6498-3p	MIMAT0025324	unmapped	CGCTCGGGTTTTCCCGAGCGGAACTGTATCATCGCAGATTTTTTTTTT
A_38_P00037555	A_38_P00037555	mir|bmo-miR-6498-3p|mir|MIMAT0025324	bmo-miR-6498-3p	MIMAT0025324	unmapped	CGCTCGGGTTTTCCCGAGCGGAACTGTATCATCGCAGACTATTTTTTTT
A_38_P00037556	A_38_P00037556	mir|bmo-miR-6497-3p|mir|MIMAT0025322	bmo-miR-6497-3p	MIMAT0025322	unmapped	CGCTCGGGTTTTCCCGAGCGGAGACCCGGCACCTTTTTTTTTT
A_38_P00037557	A_38_P00037557	mir|bmo-miR-6497-3p|mir|MIMAT0025322	bmo-miR-6497-3p	MIMAT0025322	unmapped	CGCTCGGGTTTTCCCGAGCGGAGACCCGGCACCGTTTTTTTTTT
A_38_P00037558	A_38_P00037558	mir|bmo-miR-6495-5p|mir|MIMAT0025317	bmo-miR-6495-5p	MIMAT0025317	unmapped	CGCTCGGGTTTTCCCGAGCGGATGGAACTCGAACGCATTTTTTTTT
A_38_P00037559	A_38_P00037559	mir|bmo-miR-6495-5p|mir|MIMAT0025317	bmo-miR-6495-5p	MIMAT0025317	unmapped	CGCTCGGGTTTTCCCGAGCGGATGGAACTCGAACGCTTTTTTTTTTT
A_38_P00037560	A_38_P00037560	mir|bmo-miR-6496-3p|mir|MIMAT0025320	bmo-miR-6496-3p	MIMAT0025320	unmapped	CGCTCGGGTTTTCCCGAGCGGCCGAACACCACATCATTTTTTTTT
A_38_P00037561	A_38_P00037561	mir|bmo-miR-6496-3p|mir|MIMAT0025320	bmo-miR-6496-3p	MIMAT0025320	unmapped	CGCTCGGGTTTTCCCGAGCGGCCGAACACCACATCTTTTTTTTTTT
A_38_P00037562	A_38_P00037562	mir|bmo-miR-6497-5p|mir|MIMAT0025321	bmo-miR-6497-5p	MIMAT0025321	unmapped	CGCTCGGGTTTTCCCGAGCGGGACACGCCCCGTATTTTTTTT
A_38_P00037563	A_38_P00037563	mir|bmo-miR-6497-5p|mir|MIMAT0025321	bmo-miR-6497-5p	MIMAT0025321	unmapped	CGCTCGGGTTTTCCCGAGCGGGACACGCCCCGGATTTTTTTTT
A_38_P00037564	A_38_P00037564	mir|bmo-miR-6498-5p|mir|MIMAT0025323	bmo-miR-6498-5p	MIMAT0025323	unmapped	CGCTCGGGTTTTCCCGAGCGGGCACGGCTGCGTTTTTTTTTT
A_38_P00037565	A_38_P00037565	mir|bmo-miR-6498-5p|mir|MIMAT0025323	bmo-miR-6498-5p	MIMAT0025323	unmapped	CGCTCGGGTTTTCCCGAGCGGGCACGGCTGCGATTTTTTTTTT
A_38_P00037566	A_38_P00037566	mir|bmo-miR-6495-3p|mir|MIMAT0025318	bmo-miR-6495-3p	MIMAT0025318	unmapped	CGCTCGGGTTTTCCCGAGCGGGTGCTCTTCGCGTATTTTTTTTT
A_38_P00037567	A_38_P00037567	mir|bmo-miR-6495-3p|mir|MIMAT0025318	bmo-miR-6495-3p	MIMAT0025318	unmapped	CGCTCGGGTTTTCCCGAGCGGGTGCTCTTCGCGTTTTTTTTTTTT
A_38_P00039798	A_38_P00039798	mir|tca-miR-6010-5p|mir|MIMAT0023561	tca-miR-6010-5p	MIMAT0023561	unmapped	CGCTCGGGTTTTCCCGAGCGGAAAAGGCGACAAAAACTTTTTTTTTT
A_38_P00039799	A_38_P00039799	mir|tca-miR-6010-5p|mir|MIMAT0023561	tca-miR-6010-5p	MIMAT0023561	unmapped	CGCTCGGGTTTTCCCGAGCGGAAAAGGCGACAAAAACATTTTTTTTTT
A_38_P00039800	A_38_P00039800	mir|tca-miR-6008-5p|mir|MIMAT0023557	tca-miR-6008-5p	MIMAT0023557	unmapped	CGCTCGGGTTTTCCCGAGCGGAATACATGACACCAGCATATTTTTTTT
A_38_P00039801	A_38_P00039801	mir|tca-miR-6008-5p|mir|MIMAT0023557	tca-miR-6008-5p	MIMAT0023557	unmapped	CGCTCGGGTTTTCCCGAGCGGAATACATGACACCAGCAGATTTTTTTTT
A_38_P00039802	A_38_P00039802	mir|tca-miR-6017-3p|mir|MIMAT0023576	tca-miR-6017-3p	MIMAT0023576	unmapped	CGCTCGGGTTTTCCCGAGCGGAATTGGAATTGATTAGAGGTTTTTTTTTT
A_38_P00039803	A_38_P00039803	mir|tca-miR-6017-3p|mir|MIMAT0023576	tca-miR-6017-3p	MIMAT0023576	unmapped	CGCTCGGGTTTTCCCGAGCGGAATTGGAATTGATTAGAGGCTTTTTTTTTT
A_38_P00039804	A_38_P00039804	mir|tca-miR-927b-5p|mir|MIMAT0023579	tca-miR-927b-5p	MIMAT0023579	unmapped	CGCTCGGGTTTTCCCGAGCGGACAAAGCGTACAGATTCATTTTTTTTT
A_38_P00039805	A_38_P00039805	mir|tca-miR-927b-5p|mir|MIMAT0023579	tca-miR-927b-5p	MIMAT0023579	unmapped	CGCTCGGGTTTTCCCGAGCGGACAAAGCGTACAGATTCTTTTTTTTTTT
A_38_P00039806	A_38_P00039806	mir|tca-miR-6015-3p|mir|MIMAT0023572	tca-miR-6015-3p	MIMAT0023572	unmapped	CGCTCGGGTTTTCCCGAGCGGACCGGCGCTGCTATTTTTTTT
A_38_P00039807	A_38_P00039807	mir|tca-miR-6015-3p|mir|MIMAT0023572	tca-miR-6015-3p	MIMAT0023572	unmapped	CGCTCGGGTTTTCCCGAGCGGACCGGCGCTGCAATTTTTTTTT
A_38_P00039808	A_38_P00039808	mir|tca-miR-6016-3p|mir|MIMAT0023574	tca-miR-6016-3p	MIMAT0023574	unmapped	CGCTCGGGTTTTCCCGAGCGGAGGAGGACTTGTGGTTTTTTTTTT
A_38_P00039809	A_38_P00039809	mir|tca-miR-6016-3p|mir|MIMAT0023574	tca-miR-6016-3p	MIMAT0023574	unmapped	CGCTCGGGTTTTCCCGAGCGGAGGAGGACTTGTGGGTTTTTTTTTT
A_38_P00039810	A_38_P00039810	mir|tca-miR-6016-5p|mir|MIMAT0023573	tca-miR-6016-5p	MIMAT0023573	unmapped	CGCTCGGGTTTTCCCGAGCGGATAACCACGACCACATTATTTTTTTT
A_38_P00039811	A_38_P00039811	mir|tca-miR-6016-5p|mir|MIMAT0023573	tca-miR-6016-5p	MIMAT0023573	unmapped	CGCTCGGGTTTTCCCGAGCGGATAACCACGACCACATGAATTTTTTTT
A_38_P00039812	A_38_P00039812	mir|tca-miR-9e-5p|mir|MIMAT0023581	tca-miR-9e-5p	MIMAT0023581	unmapped	CGCTCGGGTTTTCCCGAGCGGATACAACTAGATCACCAAATTTTTTTTTT
A_38_P00039813	A_38_P00039813	mir|tca-miR-9e-5p|mir|MIMAT0023581	tca-miR-9e-5p	MIMAT0023581	unmapped	CGCTCGGGTTTTCCCGAGCGGATACAACTAGATCACCAAAGTTTTTTTTTT
A_38_P00039814	A_38_P00039814	mir|tca-miR-9e-5p|mir|MIMAT0023581	tca-miR-9e-5p	MIMAT0023581	unmapped	CGCTCGGGTTTTCCCGAGCGGATACAACTAGATCACCAAAGATTTTTTTTTT
A_38_P00039815	A_38_P00039815	mir|tca-miR-6013-3p|mir|MIMAT0023568	tca-miR-6013-3p	MIMAT0023568	unmapped	CGCTCGGGTTTTCCCGAGCGGCAAGGCGGTCGTTTTTTTTTTT
A_38_P00039816	A_38_P00039816	mir|tca-miR-6013-3p|mir|MIMAT0023568	tca-miR-6013-3p	MIMAT0023568	unmapped	CGCTCGGGTTTTCCCGAGCGGCAAGGCGGTCGTCTTTTTTTTTT
A_38_P00039817	A_38_P00039817	mir|tca-miR-6014-3p|mir|MIMAT0023570	tca-miR-6014-3p	MIMAT0023570	unmapped	CGCTCGGGTTTTCCCGAGCGGCCACTCAACACGGTTTTTTTTTT
A_38_P00039818	A_38_P00039818	mir|tca-miR-6014-3p|mir|MIMAT0023570	tca-miR-6014-3p	MIMAT0023570	unmapped	CGCTCGGGTTTTCCCGAGCGGCCACTCAACACGGGTTTTTTTTTT
A_38_P00039819	A_38_P00039819	mir|tca-miR-6007-5p|mir|MIMAT0023555	tca-miR-6007-5p	MIMAT0023555	unmapped	CGCTCGGGTTTTCCCGAGCGGCCTGTTTCTAACGTCTAATTTTTTTT
A_38_P00039820	A_38_P00039820	mir|tca-miR-6007-5p|mir|MIMAT0023555	tca-miR-6007-5p	MIMAT0023555	unmapped	CGCTCGGGTTTTCCCGAGCGGCCTGTTTCTAACGTCTTATTTTTTTTT
A_38_P00039821	A_38_P00039821	mir|tca-miR-927b-3p|mir|MIMAT0023580	tca-miR-927b-3p	MIMAT0023580	unmapped	CGCTCGGGTTTTCCCGAGCGGCGAGAATCCGTAAGCATTTTTTTTT
A_38_P00039822	A_38_P00039822	mir|tca-miR-927b-3p|mir|MIMAT0023580	tca-miR-927b-3p	MIMAT0023580	unmapped	CGCTCGGGTTTTCCCGAGCGGCGAGAATCCGTAAGCTTATTTTTTTT
A_38_P00039823	A_38_P00039823	mir|tca-miR-6011-3p|mir|MIMAT0023564	tca-miR-6011-3p	MIMAT0023564	unmapped	CGCTCGGGTTTTCCCGAGCGGCGGACGTGGAGCTTTTTTTTTT
A_38_P00039824	A_38_P00039824	mir|tca-miR-6011-3p|mir|MIMAT0023564	tca-miR-6011-3p	MIMAT0023564	unmapped	CGCTCGGGTTTTCCCGAGCGGCGGACGTGGAGCATATTTTTTTT
A_38_P00039825	A_38_P00039825	mir|tca-miR-6018-3p|mir|MIMAT0023578	tca-miR-6018-3p	MIMAT0023578	unmapped	CGCTCGGGTTTTCCCGAGCGGCTAGTCACAAGTTGAATTTATTTTTTTT
A_38_P00039826	A_38_P00039826	mir|tca-miR-6018-3p|mir|MIMAT0023578	tca-miR-6018-3p	MIMAT0023578	unmapped	CGCTCGGGTTTTCCCGAGCGGCTAGTCACAAGTTGAATTCATTTTTTTTT
A_38_P00039827	A_38_P00039827	mir|tca-miR-6012-3p|mir|MIMAT0023566	tca-miR-6012-3p	MIMAT0023566	unmapped	CGCTCGGGTTTTCCCGAGCGGGACAGGCTGATCTCAATTTTTTTTT
A_38_P00039828	A_38_P00039828	mir|tca-miR-6012-3p|mir|MIMAT0023566	tca-miR-6012-3p	MIMAT0023566	unmapped	CGCTCGGGTTTTCCCGAGCGGGACAGGCTGATCTCATTTTTTTTTTT
A_38_P00039829	A_38_P00039829	mir|tca-miR-6012-3p|mir|MIMAT0023566	tca-miR-6012-3p	MIMAT0023566	unmapped	CGCTCGGGTTTTCCCGAGCGGGACAGGCTGATCTCATCTTTTTTTTTT
A_38_P00039830	A_38_P00039830	mir|tca-miR-6009-3p|mir|MIMAT0023560	tca-miR-6009-3p	MIMAT0023560	unmapped	CGCTCGGGTTTTCCCGAGCGGGGACTCGTCGAGCTTTTTTTTTT
A_38_P00039831	A_38_P00039831	mir|tca-miR-6009-3p|mir|MIMAT0023560	tca-miR-6009-3p	MIMAT0023560	unmapped	CGCTCGGGTTTTCCCGAGCGGGGACTCGTCGAGCGTTTTTTTTTT
A_38_P00039832	A_38_P00039832	mir|tca-miR-6013-5p|mir|MIMAT0023567	tca-miR-6013-5p	MIMAT0023567	unmapped	CGCTCGGGTTTTCCCGAGCGGGGAGCGCTTTGGATTTTTTTTTT
A_38_P00039833	A_38_P00039833	mir|tca-miR-6013-5p|mir|MIMAT0023567	tca-miR-6013-5p	MIMAT0023567	unmapped	CGCTCGGGTTTTCCCGAGCGGGGAGCGCTTTGGACTTTTTTTTTT
A_38_P00039834	A_38_P00039834	mir|tca-miR-6011-5p|mir|MIMAT0023563	tca-miR-6011-5p	MIMAT0023563	unmapped	CGCTCGGGTTTTCCCGAGCGGGGTTCCGCTTACATCTATTTTTTTT
A_38_P00039835	A_38_P00039835	mir|tca-miR-6011-5p|mir|MIMAT0023563	tca-miR-6011-5p	MIMAT0023563	unmapped	CGCTCGGGTTTTCCCGAGCGGGGTTCCGCTTACATCAATTTTTTTTT
A_38_P00039836	A_38_P00039836	mir|tca-miR-6009-5p|mir|MIMAT0023559	tca-miR-6009-5p	MIMAT0023559	unmapped	CGCTCGGGTTTTCCCGAGCGGGTCTCGCTCAACATTTTTTTTTTTTT
A_38_P00039837	A_38_P00039837	mir|tca-miR-6009-5p|mir|MIMAT0023559	tca-miR-6009-5p	MIMAT0023559	unmapped	CGCTCGGGTTTTCCCGAGCGGGTCTCGCTCAACATTTGTTTTTTTTTT
A_38_P00039838	A_38_P00039838	mir|tca-miR-6008-3p|mir|MIMAT0023558	tca-miR-6008-3p	MIMAT0023558	unmapped	CGCTCGGGTTTTCCCGAGCGGGTTCCGCTAGCGTTTTTTTTTTT
A_38_P00039839	A_38_P00039839	mir|tca-miR-6008-3p|mir|MIMAT0023558	tca-miR-6008-3p	MIMAT0023558	unmapped	CGCTCGGGTTTTCCCGAGCGGGTTCCGCTAGCGTGTATTTTTTTT
A_38_P00039840	A_38_P00039840	mir|tca-miR-6017-5p|mir|MIMAT0023575	tca-miR-6017-5p	MIMAT0023575	unmapped	CGCTCGGGTTTTCCCGAGCGGTAAAAAATACAACATACCTTTTTTTTTT
A_38_P00039841	A_38_P00039841	mir|tca-miR-6017-5p|mir|MIMAT0023575	tca-miR-6017-5p	MIMAT0023575	unmapped	CGCTCGGGTTTTCCCGAGCGGTAAAAAATACAACATACCATTTTTTTTTT
A_38_P00039842	A_38_P00039842	mir|tca-miR-6017-5p|mir|MIMAT0023575	tca-miR-6017-5p	MIMAT0023575	unmapped	CGCTCGGGTTTTCCCGAGCGGTAAAAAATACAACATACCAATTTTTTTTTT
A_38_P00039843	A_38_P00039843	mir|tca-miR-6010-3p|mir|MIMAT0023562	tca-miR-6010-3p	MIMAT0023562	unmapped	CGCTCGGGTTTTCCCGAGCGGTACAAGTCGAGCACCTATTTTTTTT
A_38_P00039844	A_38_P00039844	mir|tca-miR-6010-3p|mir|MIMAT0023562	tca-miR-6010-3p	MIMAT0023562	unmapped	CGCTCGGGTTTTCCCGAGCGGTACAAGTCGAGCACCCAATTTTTTTT
A_38_P00039845	A_38_P00039845	mir|tca-miR-6012-5p|mir|MIMAT0023565	tca-miR-6012-5p	MIMAT0023565	unmapped	CGCTCGGGTTTTCCCGAGCGGTCCGCAGAAACAAGAATTTTTTTTT
A_38_P00039846	A_38_P00039846	mir|tca-miR-6012-5p|mir|MIMAT0023565	tca-miR-6012-5p	MIMAT0023565	unmapped	CGCTCGGGTTTTCCCGAGCGGTCCGCAGAAACAAGATTTTTTTTTTT
A_38_P00039847	A_38_P00039847	mir|tca-miR-6012-5p|mir|MIMAT0023565	tca-miR-6012-5p	MIMAT0023565	unmapped	CGCTCGGGTTTTCCCGAGCGGTCCGCAGAAACAAGATCTTTTTTTTTT
A_38_P00039848	A_38_P00039848	mir|tca-miR-6007-3p|mir|MIMAT0023556	tca-miR-6007-3p	MIMAT0023556	unmapped	CGCTCGGGTTTTCCCGAGCGGTGCAAAACGAAAGAGATTTTTTTTTT
A_38_P00039849	A_38_P00039849	mir|tca-miR-6007-3p|mir|MIMAT0023556	tca-miR-6007-3p	MIMAT0023556	unmapped	CGCTCGGGTTTTCCCGAGCGGTGCAAAACGAAAGAGACTTTTTTTTTT
A_38_P00039850	A_38_P00039850	mir|tca-miR-9e-3p|mir|MIMAT0023582	tca-miR-9e-3p	MIMAT0023582	unmapped	CGCTCGGGTTTTCCCGAGCGGTGCTTTGCTGAACCATTTTTTTTTT
A_38_P00039851	A_38_P00039851	mir|tca-miR-9e-3p|mir|MIMAT0023582	tca-miR-9e-3p	MIMAT0023582	unmapped	CGCTCGGGTTTTCCCGAGCGGTGCTTTGCTGAACCAGTATTTTTTTT
A_38_P00039852	A_38_P00039852	mir|tca-miR-6014-5p|mir|MIMAT0023569	tca-miR-6014-5p	MIMAT0023569	unmapped	CGCTCGGGTTTTCCCGAGCGGTGGAATACGTCAAGAGATATTTTTTTT
A_38_P00039853	A_38_P00039853	mir|tca-miR-6014-5p|mir|MIMAT0023569	tca-miR-6014-5p	MIMAT0023569	unmapped	CGCTCGGGTTTTCCCGAGCGGTGGAATACGTCAAGAGAGATTTTTTTTT
A_38_P00039854	A_38_P00039854	mir|tca-miR-6018-5p|mir|MIMAT0023577	tca-miR-6018-5p	MIMAT0023577	unmapped	CGCTCGGGTTTTCCCGAGCGGTTAATTCCATTGAAACTTTTTTTTTTT
A_38_P00039855	A_38_P00039855	mir|tca-miR-6018-5p|mir|MIMAT0023577	tca-miR-6018-5p	MIMAT0023577	unmapped	CGCTCGGGTTTTCCCGAGCGGTTAATTCCATTGAAACTATTTTTTTTTT
A_38_P00039856	A_38_P00039856	mir|tca-miR-6018-5p|mir|MIMAT0023577	tca-miR-6018-5p	MIMAT0023577	unmapped	CGCTCGGGTTTTCCCGAGCGGTTAATTCCATTGAAACTAGTTTTTTTTTT
A_38_P00039857	A_38_P00039857	mir|tca-miR-6015-5p|mir|MIMAT0023571	tca-miR-6015-5p	MIMAT0023571	unmapped	CGCTCGGGTTTTCCCGAGCGGTTGGAGCGGCAGGATTTTTTTTT
A_38_P00039858	A_38_P00039858	mir|tca-miR-6015-5p|mir|MIMAT0023571	tca-miR-6015-5p	MIMAT0023571	unmapped	CGCTCGGGTTTTCCCGAGCGGTTGGAGCGGCAGGTTATTTTTTTT
Blank	Blank					
Mosq_P00000001	Mosq_P00000001	mir|chrX:33411	chrX:33411		unmapped	CGCTCGGGTTTTCCCGAGCGGAAAAACGCATCGTGGATTTTTTTTT
Mosq_P00000002	Mosq_P00000002	mir|chrX:33411	chrX:33411		unmapped	CGCTCGGGTTTTCCCGAGCGGAAAAACGCATCGTGGTTTTTTTTTTT
Mosq_P00000003	Mosq_P00000003	mir|chr2L:56941	chr2L:56941		unmapped	CGCTCGGGTTTTCCCGAGCGGAAAAGCAGATGTTTGTCTATTTTTTTT
Mosq_P00000004	Mosq_P00000004	mir|chr2L:56941	chr2L:56941		unmapped	CGCTCGGGTTTTCCCGAGCGGAAAAGCAGATGTTTGTCGAATTTTTTTT
Mosq_P00000005	Mosq_P00000005	mir|chr2R:82651_mir-999	chr2R:82651_mir-999		unmapped	CGCTCGGGTTTTCCCGAGCGGAAAGACACAGTCTTACAGAATTTTTTTT
Mosq_P00000006	Mosq_P00000006	mir|chr2R:82651_mir-999	chr2R:82651_mir-999		unmapped	CGCTCGGGTTTTCCCGAGCGGAAAGACACAGTCTTACAGTATTTTTTTTT
Mosq_P00000007	Mosq_P00000007	mir|chr2L:371901_mir-71-3p	chr2L:371901_mir-71-3p		unmapped	CGCTCGGGTTTTCCCGAGCGGAACATGAAAGACAAGGTATATTTTTTTT
Mosq_P00000008	Mosq_P00000008	mir|chr2L:371901_mir-71-3p	chr2L:371901_mir-71-3p		unmapped	CGCTCGGGTTTTCCCGAGCGGAACATGAAAGACAAGGTAGATTTTTTTTT
Mosq_P00000009	Mosq_P00000009	mir|chrU:495641	chrU:495641		unmapped	CGCTCGGGTTTTCCCGAGCGGAACCGAGCCAGTTCTTTTTTTTTT
Mosq_P00000010	Mosq_P00000010	mir|chrU:495641	chrU:495641		unmapped	CGCTCGGGTTTTCCCGAGCGGAACCGAGCCAGTTCCTTTTTTTTTT
Mosq_P00000011	Mosq_P00000011	mir|chr3L:170776	chr3L:170776		unmapped	CGCTCGGGTTTTCCCGAGCGGAATAAGAAAAGGAACCCATTTTTTTTTT
Mosq_P00000012	Mosq_P00000012	mir|chr3L:170776	chr3L:170776		unmapped	CGCTCGGGTTTTCCCGAGCGGAATAAGAAAAGGAACCCAATTTTTTTTTT
Mosq_P00000013	Mosq_P00000013	mir|chrX:116044	chrX:116044		unmapped	CGCTCGGGTTTTCCCGAGCGGACAAGATAACCGACAAAGTTTTTTTTTT
Mosq_P00000014	Mosq_P00000014	mir|chrX:116044	chrX:116044		unmapped	CGCTCGGGTTTTCCCGAGCGGACAAGATAACCGACAAAGGTTTTTTTTTT
Mosq_P00000015	Mosq_P00000015	mir|chrX:217231	chrX:217231		unmapped	CGCTCGGGTTTTCCCGAGCGGACACGTCACATGCACTTTTTTTTTT
Mosq_P00000016	Mosq_P00000016	mir|chrX:217231	chrX:217231		unmapped	CGCTCGGGTTTTCCCGAGCGGACACGTCACATGCACATATTTTTTTT
Mosq_P00000017	Mosq_P00000017	mir|chrU:125234	chrU:125234		unmapped	CGCTCGGGTTTTCCCGAGCGGACAGCAGCCAGCGTTTTTTTTTT
Mosq_P00000018	Mosq_P00000018	mir|chrU:125234	chrU:125234		unmapped	CGCTCGGGTTTTCCCGAGCGGACAGCAGCCAGCGCTTTTTTTTTT
Mosq_P00000019	Mosq_P00000019	mir|chrU:129144	chrU:129144		unmapped	CGCTCGGGTTTTCCCGAGCGGACATGACATCCCCCTTTTTTTTTTT
Mosq_P00000020	Mosq_P00000020	mir|chrU:129144	chrU:129144		unmapped	CGCTCGGGTTTTCCCGAGCGGACATGACATCCCCCTGTTTTTTTTTT
Mosq_P00000021	Mosq_P00000021	mir|chrU:554752	chrU:554752		unmapped	CGCTCGGGTTTTCCCGAGCGGACGCACCACGAATGTTTTTTTTTT
Mosq_P00000022	Mosq_P00000022	mir|chrU:554752	chrU:554752		unmapped	CGCTCGGGTTTTCCCGAGCGGACGCACCACGAATGCTTTTTTTTTT
Mosq_P00000023	Mosq_P00000023	mir|chrX:74167	chrX:74167		unmapped	CGCTCGGGTTTTCCCGAGCGGACTACAGCAATCAGGGATTTTTTTTT
Mosq_P00000024	Mosq_P00000024	mir|chrX:74167	chrX:74167		unmapped	CGCTCGGGTTTTCCCGAGCGGACTACAGCAATCAGGGTTTTTTTTTTT
Mosq_P00000025	Mosq_P00000025	mir|chr3R:436978_mir-2944	chr3R:436978_mir-2944		unmapped	CGCTCGGGTTTTCCCGAGCGGAGATCACAGCAGAAGTTTTTTTTTTTT
Mosq_P00000026	Mosq_P00000026	mir|chr3R:436978_mir-2944	chr3R:436978_mir-2944		unmapped	CGCTCGGGTTTTCCCGAGCGGAGATCACAGCAGAAGTTCTATTTTTTTT
Mosq_P00000027	Mosq_P00000027	mir|chr2R:224272_mir-2796	chr2R:224272_mir-2796		unmapped	CGCTCGGGTTTTCCCGAGCGGAGCAAGTAGTTTCCGTTTTTTTTTT
Mosq_P00000028	Mosq_P00000028	mir|chr2R:224272_mir-2796	chr2R:224272_mir-2796		unmapped	CGCTCGGGTTTTCCCGAGCGGAGCAAGTAGTTTCCGCTTTTTTTTTT
Mosq_P00000029	Mosq_P00000029	mir|chrU:480277	chrU:480277		unmapped	CGCTCGGGTTTTCCCGAGCGGAGCAGCAAGGTGAGTTTTTTTTTT
Mosq_P00000030	Mosq_P00000030	mir|chrU:480277	chrU:480277		unmapped	CGCTCGGGTTTTCCCGAGCGGAGCAGCAAGGTGAGCTTTTTTTTTT
Mosq_P00000031	Mosq_P00000031	mir|chr2R:219858_mir-980	chr2R:219858_mir-980		unmapped	CGCTCGGGTTTTCCCGAGCGGAGCTAGATGACCTAATGATTTTTTTTTT
Mosq_P00000032	Mosq_P00000032	mir|chr2R:219858_mir-980	chr2R:219858_mir-980		unmapped	CGCTCGGGTTTTCCCGAGCGGAGCTAGATGACCTAATGAATTTTTTTTTT
Mosq_P00000033	Mosq_P00000033	mir|chr2R:219858_mir-980	chr2R:219858_mir-980		unmapped	CGCTCGGGTTTTCCCGAGCGGAGCTAGATGACCTAATGAACTTTTTTTTTT
Mosq_P00000034	Mosq_P00000034	mir|chrU:2288	chrU:2288		unmapped	CGCTCGGGTTTTCCCGAGCGGAGGTTTCGTACCGGTTTTTTTTTT
Mosq_P00000035	Mosq_P00000035	mir|chrU:2288	chrU:2288		unmapped	CGCTCGGGTTTTCCCGAGCGGAGGTTTCGTACCGGCTTTTTTTTTT
Mosq_P00000036	Mosq_P00000036	mir|chr3R:181801	chr3R:181801		unmapped	CGCTCGGGTTTTCCCGAGCGGAGTGGGATTCGAACCTTTTTTTTTT
Mosq_P00000037	Mosq_P00000037	mir|chr3R:181801	chr3R:181801		unmapped	CGCTCGGGTTTTCCCGAGCGGAGTGGGATTCGAACCCTTTTTTTTTT
Mosq_P00000038	Mosq_P00000038	mir|chrU:201284	chrU:201284		unmapped	CGCTCGGGTTTTCCCGAGCGGATCTGCCTCACCATCTTTTTTTTTT
Mosq_P00000039	Mosq_P00000039	mir|chrU:201284	chrU:201284		unmapped	CGCTCGGGTTTTCCCGAGCGGATCTGCCTCACCATCCTTTTTTTTTT
Mosq_P00000040	Mosq_P00000040	mir|chr2L:273302	chr2L:273302		unmapped	CGCTCGGGTTTTCCCGAGCGGCAAATGTATCTGCGCTTTTTTTTTT
Mosq_P00000041	Mosq_P00000041	mir|chr2L:273302	chr2L:273302		unmapped	CGCTCGGGTTTTCCCGAGCGGCAAATGTATCTGCGCGTATTTTTTTT
Mosq_P00000042	Mosq_P00000042	mir|chrU:304118	chrU:304118		unmapped	CGCTCGGGTTTTCCCGAGCGGCAACCGAGCCAGTATTTTTTTTT
Mosq_P00000043	Mosq_P00000043	mir|chrU:304118	chrU:304118		unmapped	CGCTCGGGTTTTCCCGAGCGGCAACCGAGCCAGTTTTTTTTTTTT
Mosq_P00000044	Mosq_P00000044	mir|chrU:10427	chrU:10427		unmapped	CGCTCGGGTTTTCCCGAGCGGCACATATACATATATATACATTTTTTTTTTT
Mosq_P00000045	Mosq_P00000045	mir|chrU:207234	chrU:207234		unmapped	CGCTCGGGTTTTCCCGAGCGGCACCAAGCACTTCGTTTTTTTTTT
Mosq_P00000046	Mosq_P00000046	mir|chrU:207234	chrU:207234		unmapped	CGCTCGGGTTTTCCCGAGCGGCACCAAGCACTTCGATTTTTTTTTT
Mosq_P00000047	Mosq_P00000047	mir|chr2R:71978	chr2R:71978		unmapped	CGCTCGGGTTTTCCCGAGCGGCACGACCGCCCTTTTTTTTTT
Mosq_P00000048	Mosq_P00000048	mir|chr2R:71978	chr2R:71978		unmapped	CGCTCGGGTTTTCCCGAGCGGCACGACCGCCCCTTTTTTTTTT
Mosq_P00000049	Mosq_P00000049	mir|chr3R:102350	chr3R:102350		unmapped	CGCTCGGGTTTTCCCGAGCGGCACGATCTCGCCCTATTTTTTTT
Mosq_P00000050	Mosq_P00000050	mir|chr3R:102350	chr3R:102350		unmapped	CGCTCGGGTTTTCCCGAGCGGCACGATCTCGCCCGATTTTTTTTT
Mosq_P00000051	Mosq_P00000051	mir|chr3L:34611	chr3L:34611		unmapped	CGCTCGGGTTTTCCCGAGCGGCAGCAGTATCGTCAAATTTTTTTTTT
Mosq_P00000052	Mosq_P00000052	mir|chr3L:34611	chr3L:34611		unmapped	CGCTCGGGTTTTCCCGAGCGGCAGCAGTATCGTCAAACTATTTTTTTT
Mosq_P00000053	Mosq_P00000053	mir|chrU:509547	chrU:509547		unmapped	CGCTCGGGTTTTCCCGAGCGGCAGGCATGAGGAGTTTTTTTTTTT
Mosq_P00000054	Mosq_P00000054	mir|chrU:509547	chrU:509547		unmapped	CGCTCGGGTTTTCCCGAGCGGCAGGCATGAGGAGTGTTTTTTTTTT
Mosq_P00000055	Mosq_P00000055	mir|chr2R:598145	chr2R:598145		unmapped	CGCTCGGGTTTTCCCGAGCGGCAGGGAAACGATCACTTTTTTTTTT
Mosq_P00000056	Mosq_P00000056	mir|chr2R:598145	chr2R:598145		unmapped	CGCTCGGGTTTTCCCGAGCGGCAGGGAAACGATCACGTTTTTTTTTT
Mosq_P00000057	Mosq_P00000057	mir|chrX:28404_mir-2940-3p	chrX:28404_mir-2940-3p		unmapped	CGCTCGGGTTTTCCCGAGCGGCAGTGATTTATCTCTCTGATTTTTTTTT
Mosq_P00000058	Mosq_P00000058	mir|chrX:28404_mir-2940-3p	chrX:28404_mir-2940-3p		unmapped	CGCTCGGGTTTTCCCGAGCGGCAGTGATTTATCTCTCTGTTTTTTTTTTT
Mosq_P00000059	Mosq_P00000059	mir|chr3R:436980	chr3R:436980		unmapped	CGCTCGGGTTTTCCCGAGCGGCATATCACACCGGGATATTTTTTTT
Mosq_P00000060	Mosq_P00000060	mir|chr3R:436980	chr3R:436980		unmapped	CGCTCGGGTTTTCCCGAGCGGCATATCACACCGGGAGAATTTTTTTT
Mosq_P00000061	Mosq_P00000061	mir|chrX:207778	chrX:207778		unmapped	CGCTCGGGTTTTCCCGAGCGGCATCGGACACCAGTTTTTTTTTT
Mosq_P00000062	Mosq_P00000062	mir|chrX:207778	chrX:207778		unmapped	CGCTCGGGTTTTCCCGAGCGGCATCGGACACCAGCTTTTTTTTTT
Mosq_P00000063	Mosq_P00000063	mir|chr3R:103142_mir-2945-3p	chr3R:103142_mir-2945-3p		unmapped	CGCTCGGGTTTTCCCGAGCGGCCAAACGAGTCTGCTATTTTTTTT
Mosq_P00000064	Mosq_P00000064	mir|chr3R:103142_mir-2945-3p	chr3R:103142_mir-2945-3p		unmapped	CGCTCGGGTTTTCCCGAGCGGCCAAACGAGTCTGCCATTTTTTTTT
Mosq_P00000065	Mosq_P00000065	mir|chr2L:50036	chr2L:50036		unmapped	CGCTCGGGTTTTCCCGAGCGGCCAACGGACCGTATTTTTTTTT
Mosq_P00000066	Mosq_P00000066	mir|chr2L:50036	chr2L:50036		unmapped	CGCTCGGGTTTTCCCGAGCGGCCAACGGACCGTTTTTTTTTTTT
Mosq_P00000067	Mosq_P00000067	mir|chr2L:50036	chr2L:50036		unmapped	CGCTCGGGTTTTCCCGAGCGGCCAACGGACCGTTGTTTTTTTTTT
Mosq_P00000068	Mosq_P00000068	mir|chr2R:153388	chr2R:153388		unmapped	CGCTCGGGTTTTCCCGAGCGGCCACTCAGTGTACAAATTTTTTTTTT
Mosq_P00000069	Mosq_P00000069	mir|chr2R:153388	chr2R:153388		unmapped	CGCTCGGGTTTTCCCGAGCGGCCACTCAGTGTACAAAATTTTTTTTTT
Mosq_P00000070	Mosq_P00000070	mir|chrU:219813	chrU:219813		unmapped	CGCTCGGGTTTTCCCGAGCGGCCAGCGATATACCGTTATTTTTTTT
Mosq_P00000071	Mosq_P00000071	mir|chrU:219813	chrU:219813		unmapped	CGCTCGGGTTTTCCCGAGCGGCCAGCGATATACCGTCAATTTTTTTT
Mosq_P00000072	Mosq_P00000072	mir|chrU:309674	chrU:309674		unmapped	CGCTCGGGTTTTCCCGAGCGGCCCAGCACAGCTCTTTTTTTTTT
Mosq_P00000073	Mosq_P00000073	mir|chrU:309674	chrU:309674		unmapped	CGCTCGGGTTTTCCCGAGCGGCCCAGCACAGCTCATATTTTTTTT
Mosq_P00000074	Mosq_P00000074	mir|chr2R:409315	chr2R:409315		unmapped	CGCTCGGGTTTTCCCGAGCGGCCCGTGAAGCTTCTTTTTTTTTTT
Mosq_P00000075	Mosq_P00000075	mir|chr2R:409315	chr2R:409315		unmapped	CGCTCGGGTTTTCCCGAGCGGCCCGTGAAGCTTCTCTTTTTTTTTT
Mosq_P00000076	Mosq_P00000076	mir|chrX:217357	chrX:217357		unmapped	CGCTCGGGTTTTCCCGAGCGGCCGCGTGTACCAGTTTTTTTTTT
Mosq_P00000077	Mosq_P00000077	mir|chrX:217357	chrX:217357		unmapped	CGCTCGGGTTTTCCCGAGCGGCCGCGTGTACCAGGTTTTTTTTTT
Mosq_P00000078	Mosq_P00000078	mir|chrU:69110	chrU:69110		unmapped	CGCTCGGGTTTTCCCGAGCGGCCGGCTCGAGCTTTTTTTTTT
Mosq_P00000079	Mosq_P00000079	mir|chrU:69110	chrU:69110		unmapped	CGCTCGGGTTTTCCCGAGCGGCCGGCTCGAGCATATTTTTTTT
Mosq_P00000080	Mosq_P00000080	mir|chrU:439858	chrU:439858		unmapped	CGCTCGGGTTTTCCCGAGCGGCGAGCGCGTACATTTTTTTTTT
Mosq_P00000081	Mosq_P00000081	mir|chrU:439858	chrU:439858		unmapped	CGCTCGGGTTTTCCCGAGCGGCGAGCGCGTACACTTTTTTTTTT
Mosq_P00000082	Mosq_P00000082	mir|chrU:225891	chrU:225891		unmapped	CGCTCGGGTTTTCCCGAGCGGCGCAGAAGTTGGGATTTTTTTTT
Mosq_P00000083	Mosq_P00000083	mir|chrU:225891	chrU:225891		unmapped	CGCTCGGGTTTTCCCGAGCGGCGCAGAAGTTGGGTTTTTTTTTTT
Mosq_P00000084	Mosq_P00000084	mir|chrU:442989	chrU:442989		unmapped	CGCTCGGGTTTTCCCGAGCGGCGCAGCATTCACACTTTTTTTTTT
Mosq_P00000085	Mosq_P00000085	mir|chrU:442989	chrU:442989		unmapped	CGCTCGGGTTTTCCCGAGCGGCGCAGCATTCACACATTTTTTTTTT
Mosq_P00000086	Mosq_P00000086	mir|chr2L:124452	chr2L:124452		unmapped	CGCTCGGGTTTTCCCGAGCGGCGCCGAGTATCGGTTTTTTTTTT
Mosq_P00000087	Mosq_P00000087	mir|chr2L:124452	chr2L:124452		unmapped	CGCTCGGGTTTTCCCGAGCGGCGCCGAGTATCGGCTTTTTTTTTT
Mosq_P00000088	Mosq_P00000088	mir|chrU:513660	chrU:513660		unmapped	CGCTCGGGTTTTCCCGAGCGGCGCCTACAGGGAAATTTTTTTTTT
Mosq_P00000089	Mosq_P00000089	mir|chrU:513660	chrU:513660		unmapped	CGCTCGGGTTTTCCCGAGCGGCGCCTACAGGGAAACTTTTTTTTTT
Mosq_P00000090	Mosq_P00000090	mir|chrU:258129	chrU:258129		unmapped	CGCTCGGGTTTTCCCGAGCGGCGGCCACCCCATTTTTTTTTT
Mosq_P00000091	Mosq_P00000091	mir|chrU:258129	chrU:258129		unmapped	CGCTCGGGTTTTCCCGAGCGGCGGCCACCCCAGTATTTTTTTT
Mosq_P00000092	Mosq_P00000092	mir|chrX:22380	chrX:22380		unmapped	CGCTCGGGTTTTCCCGAGCGGCGGGACCTGGACTTTTTTTTTT
Mosq_P00000093	Mosq_P00000093	mir|chrX:22380	chrX:22380		unmapped	CGCTCGGGTTTTCCCGAGCGGCGGGACCTGGACCTTTTTTTTTT
Mosq_P00000094	Mosq_P00000094	mir|chrX:12559	chrX:12559		unmapped	CGCTCGGGTTTTCCCGAGCGGCGGGTTGCATTGCTTTTTTTTTT
Mosq_P00000095	Mosq_P00000095	mir|chrX:12559	chrX:12559		unmapped	CGCTCGGGTTTTCCCGAGCGGCGGGTTGCATTGCATTTTTTTTTT
Mosq_P00000096	Mosq_P00000096	mir|chrU:489149	chrU:489149		unmapped	CGCTCGGGTTTTCCCGAGCGGCGGTTGAGACAGTCTATTTTTTTT
Mosq_P00000097	Mosq_P00000097	mir|chrU:489149	chrU:489149		unmapped	CGCTCGGGTTTTCCCGAGCGGCGGTTGAGACAGTCCATTTTTTTTT
Mosq_P00000098	Mosq_P00000098	mir|chrU:216901	chrU:216901		unmapped	CGCTCGGGTTTTCCCGAGCGGCTACAGCCTGAAACTGTATTTTTTTT
Mosq_P00000099	Mosq_P00000099	mir|chrU:216901	chrU:216901		unmapped	CGCTCGGGTTTTCCCGAGCGGCTACAGCCTGAAACTGGATTTTTTTTT
Mosq_P00000100	Mosq_P00000100	mir|chrX:74175	chrX:74175		unmapped	CGCTCGGGTTTTCCCGAGCGGCTACAGTCTTGTTCGTATTTTTTTTT
Mosq_P00000101	Mosq_P00000101	mir|chrX:74175	chrX:74175		unmapped	CGCTCGGGTTTTCCCGAGCGGCTACAGTCTTGTTCGTTTATTTTTTTT
Mosq_P00000102	Mosq_P00000102	mir|chrX:74175	chrX:74175		unmapped	CGCTCGGGTTTTCCCGAGCGGCTACAGTCTTGTTCGTTCAATTTTTTTT
Mosq_P00000103	Mosq_P00000103	mir|chrU:151868	chrU:151868		unmapped	CGCTCGGGTTTTCCCGAGCGGCTAGTATTGAGCCAGTGTATTTTTTTT
Mosq_P00000104	Mosq_P00000104	mir|chrU:151868	chrU:151868		unmapped	CGCTCGGGTTTTCCCGAGCGGCTAGTATTGAGCCAGTGGATTTTTTTTT
Mosq_P00000105	Mosq_P00000105	mir|chrX:218085	chrX:218085		unmapped	CGCTCGGGTTTTCCCGAGCGGCTCTGAGCTCACACTTTTTTTTTTT
Mosq_P00000106	Mosq_P00000106	mir|chrX:218085	chrX:218085		unmapped	CGCTCGGGTTTTCCCGAGCGGCTCTGAGCTCACACTCTTTTTTTTTT
Mosq_P00000107	Mosq_P00000107	mir|chr2R:610810	chr2R:610810		unmapped	CGCTCGGGTTTTCCCGAGCGGCTGAAAAAGGATAGCGTTTTTTTTTT
Mosq_P00000108	Mosq_P00000108	mir|chr2R:610810	chr2R:610810		unmapped	CGCTCGGGTTTTCCCGAGCGGCTGAAAAAGGATAGCGCTTTTTTTTTT
Mosq_P00000109	Mosq_P00000109	mir|chr2R:151998_mir-932-5p	chr2R:151998_mir-932-5p		unmapped	CGCTCGGGTTTTCCCGAGCGGCTTCACTCCCACAATTTTTTTTTTT
Mosq_P00000110	Mosq_P00000110	mir|chr2R:151998_mir-932-5p	chr2R:151998_mir-932-5p		unmapped	CGCTCGGGTTTTCCCGAGCGGCTTCACTCCCACAATGTATTTTTTTT
Mosq_P00000111	Mosq_P00000111	mir|chrX:143759_mir-31	chrX:143759_mir-31		unmapped	CGCTCGGGTTTTCCCGAGCGGCTTTTAGCTATGCCAACTATTTTTTTT
Mosq_P00000112	Mosq_P00000112	mir|chrX:143759_mir-31	chrX:143759_mir-31		unmapped	CGCTCGGGTTTTCCCGAGCGGCTTTTAGCTATGCCAACAATTTTTTTTT
Mosq_P00000113	Mosq_P00000113	mir|chrU:267251	chrU:267251		unmapped	CGCTCGGGTTTTCCCGAGCGGGACATCCCCCTGGTTTTTTTTTT
Mosq_P00000114	Mosq_P00000114	mir|chrU:267251	chrU:267251		unmapped	CGCTCGGGTTTTCCCGAGCGGGACATCCCCCTGGATTTTTTTTTT
Mosq_P00000115	Mosq_P00000115	mir|chr2L:3530	chr2L:3530		unmapped	CGCTCGGGTTTTCCCGAGCGGGAGAAATGGCTCCGTTTTTTTTTT
Mosq_P00000116	Mosq_P00000116	mir|chr2L:3530	chr2L:3530		unmapped	CGCTCGGGTTTTCCCGAGCGGGAGAAATGGCTCCGATTTTTTTTTT
Mosq_P00000117	Mosq_P00000117	mir|chrU:403012	chrU:403012		unmapped	CGCTCGGGTTTTCCCGAGCGGGAGTTCTTATTGAAACCATTTTTTTTTT
Mosq_P00000118	Mosq_P00000118	mir|chrU:403012	chrU:403012		unmapped	CGCTCGGGTTTTCCCGAGCGGGAGTTCTTATTGAAACCAGTTTTTTTTTT
Mosq_P00000119	Mosq_P00000119	mir|chr2R:518664	chr2R:518664		unmapped	CGCTCGGGTTTTCCCGAGCGGGATGAGAAAACGAATCCTTTTTTTTTT
Mosq_P00000120	Mosq_P00000120	mir|chr2R:518664	chr2R:518664		unmapped	CGCTCGGGTTTTCCCGAGCGGGATGAGAAAACGAATCCATTTTTTTTTT
Mosq_P00000121	Mosq_P00000121	mir|chrU:523918	chrU:523918		unmapped	CGCTCGGGTTTTCCCGAGCGGGCACGTCCGCCTTTTTTTTTT
Mosq_P00000122	Mosq_P00000122	mir|chrU:523918	chrU:523918		unmapped	CGCTCGGGTTTTCCCGAGCGGGCACGTCCGCCATTTTTTTTTT
Mosq_P00000123	Mosq_P00000123	mir|chrU:240156	chrU:240156		unmapped	CGCTCGGGTTTTCCCGAGCGGGCAGCATCCGGGTTTTTTTTTT
Mosq_P00000124	Mosq_P00000124	mir|chrU:240156	chrU:240156		unmapped	CGCTCGGGTTTTCCCGAGCGGGCAGCATCCGGGCTTTTTTTTTT
Mosq_P00000125	Mosq_P00000125	mir|chr3R:98491	chr3R:98491		unmapped	CGCTCGGGTTTTCCCGAGCGGGCAGGTTTCGTACCTTTTTTTTTT
Mosq_P00000126	Mosq_P00000126	mir|chr3R:98491	chr3R:98491		unmapped	CGCTCGGGTTTTCCCGAGCGGGCAGGTTTCGTACCGTTTTTTTTTT
Mosq_P00000127	Mosq_P00000127	mir|chrX:203380	chrX:203380		unmapped	CGCTCGGGTTTTCCCGAGCGGGCCAAAGTAGCACATGTTTTTTTTTT
Mosq_P00000128	Mosq_P00000128	mir|chrX:203380	chrX:203380		unmapped	CGCTCGGGTTTTCCCGAGCGGGCCAAAGTAGCACATGATTTTTTTTTT
Mosq_P00000129	Mosq_P00000129	mir|chr2R:374036_mir-2765	chr2R:374036_mir-2765		unmapped	CGCTCGGGTTTTCCCGAGCGGGCCAACGGTGGTTTTTTTTTTT
Mosq_P00000130	Mosq_P00000130	mir|chr2R:374036_mir-2765	chr2R:374036_mir-2765		unmapped	CGCTCGGGTTTTCCCGAGCGGGCCAACGGTGGTGTTTTTTTTTT
Mosq_P00000131	Mosq_P00000131	mir|chrU:445868	chrU:445868		unmapped	CGCTCGGGTTTTCCCGAGCGGGCCAGGCCGCTTTTTTTTTTT
Mosq_P00000132	Mosq_P00000132	mir|chrU:445868	chrU:445868		unmapped	CGCTCGGGTTTTCCCGAGCGGGCCAGGCCGCTCTTTTTTTTTT
Mosq_P00000133	Mosq_P00000133	mir|chr2R:598154	chr2R:598154		unmapped	CGCTCGGGTTTTCCCGAGCGGGCCGCCGCAGTTTTTTTTTT
Mosq_P00000134	Mosq_P00000134	mir|chr2R:598154	chr2R:598154		unmapped	CGCTCGGGTTTTCCCGAGCGGGCCGCCGCAGCTTTTTTTTTT
Mosq_P00000135	Mosq_P00000135	mir|chrU:12764	chrU:12764		unmapped	CGCTCGGGTTTTCCCGAGCGGGCCGCTTACAAGGATTTTTTTTTT
Mosq_P00000136	Mosq_P00000136	mir|chrU:12764	chrU:12764		unmapped	CGCTCGGGTTTTCCCGAGCGGGCCGCTTACAAGGAATTTTTTTTTT
Mosq_P00000137	Mosq_P00000137	mir|chrU:513677	chrU:513677		unmapped	CGCTCGGGTTTTCCCGAGCGGGCCTACTAGCCGAAATTTTTTTTTT
Mosq_P00000138	Mosq_P00000138	mir|chrU:513677	chrU:513677		unmapped	CGCTCGGGTTTTCCCGAGCGGGCCTACTAGCCGAAAATTTTTTTTTT
Mosq_P00000139	Mosq_P00000139	mir|chr2R:165697	chr2R:165697		unmapped	CGCTCGGGTTTTCCCGAGCGGGCGCGGCGTTCTTTTTTTTTT
Mosq_P00000140	Mosq_P00000140	mir|chr2R:165697	chr2R:165697		unmapped	CGCTCGGGTTTTCCCGAGCGGGCGCGGCGTTCCTTTTTTTTTT
Mosq_P00000141	Mosq_P00000141	mir|chrU:288048	chrU:288048		unmapped	CGCTCGGGTTTTCCCGAGCGGGCGCTTCTCGGAATTTTTTTTTT
Mosq_P00000142	Mosq_P00000142	mir|chrU:288048	chrU:288048		unmapped	CGCTCGGGTTTTCCCGAGCGGGCGCTTCTCGGAAGTTTTTTTTTT
Mosq_P00000143	Mosq_P00000143	mir|chrU:559411	chrU:559411		unmapped	CGCTCGGGTTTTCCCGAGCGGGCTCGCCGCAGATTTTTTTTT
Mosq_P00000144	Mosq_P00000144	mir|chrU:559411	chrU:559411		unmapped	CGCTCGGGTTTTCCCGAGCGGGCTCGCCGCAGTTTTTTTTTTT
Mosq_P00000145	Mosq_P00000145	mir|chr2L:444702	chr2L:444702		unmapped	CGCTCGGGTTTTCCCGAGCGGGCTGTGAGTCCATGTTTTTTTTTTT
Mosq_P00000146	Mosq_P00000146	mir|chr2L:444702	chr2L:444702		unmapped	CGCTCGGGTTTTCCCGAGCGGGCTGTGAGTCCATGTATTTTTTTTTT
Mosq_P00000147	Mosq_P00000147	mir|chrU:513684	chrU:513684		unmapped	CGCTCGGGTTTTCCCGAGCGGGGAAGACGAACGCTTTTTTTTTT
Mosq_P00000148	Mosq_P00000148	mir|chrU:513684	chrU:513684		unmapped	CGCTCGGGTTTTCCCGAGCGGGGAAGACGAACGCCTTTTTTTTTT
Mosq_P00000149	Mosq_P00000149	mir|chr2R:611026	chr2R:611026		unmapped	CGCTCGGGTTTTCCCGAGCGGGGAGAAGTCACACAGATTTTTTTTT
Mosq_P00000150	Mosq_P00000150	mir|chr2R:611026	chr2R:611026		unmapped	CGCTCGGGTTTTCCCGAGCGGGGAGAAGTCACACAGTTTTTTTTTTT
Mosq_P00000151	Mosq_P00000151	mir|chr2R:130423_mir-998	chr2R:130423_mir-998		unmapped	CGCTCGGGTTTTCCCGAGCGGGGAGCTGAATCTCATGTATTTTTTTT
Mosq_P00000152	Mosq_P00000152	mir|chr2R:130423_mir-998	chr2R:130423_mir-998		unmapped	CGCTCGGGTTTTCCCGAGCGGGGAGCTGAATCTCATGGATTTTTTTTT
Mosq_P00000153	Mosq_P00000153	mir|chr2L:394180	chr2L:394180		unmapped	CGCTCGGGTTTTCCCGAGCGGGGCATCCAGAACCTATTTTTTTT
Mosq_P00000154	Mosq_P00000154	mir|chr2L:394180	chr2L:394180		unmapped	CGCTCGGGTTTTCCCGAGCGGGGCATCCAGAACCGATTTTTTTTT
Mosq_P00000155	Mosq_P00000155	mir|chrU:509475	chrU:509475		unmapped	CGCTCGGGTTTTCCCGAGCGGGGCCTCCAACGTAATTTTTTTTT
Mosq_P00000156	Mosq_P00000156	mir|chrU:509475	chrU:509475		unmapped	CGCTCGGGTTTTCCCGAGCGGGGCCTCCAACGTATTTTTTTTTTT
Mosq_P00000157	Mosq_P00000157	mir|chrU:509475	chrU:509475		unmapped	CGCTCGGGTTTTCCCGAGCGGGGCCTCCAACGTATCTATTTTTTTT
Mosq_P00000158	Mosq_P00000158	mir|chrU:50626	chrU:50626		unmapped	CGCTCGGGTTTTCCCGAGCGGGGGGTCAGAGCTTAATTTTTTTTTT
Mosq_P00000159	Mosq_P00000159	mir|chrU:50626	chrU:50626		unmapped	CGCTCGGGTTTTCCCGAGCGGGGGGTCAGAGCTTAACTTTTTTTTTT
Mosq_P00000160	Mosq_P00000160	mir|chr3L:385632_mir-285	chr3L:385632_mir-285		unmapped	CGCTCGGGTTTTCCCGAGCGGGGTACTGATTTCGAATGTATTTTTTTT
Mosq_P00000161	Mosq_P00000161	mir|chr3L:385632_mir-285	chr3L:385632_mir-285		unmapped	CGCTCGGGTTTTCCCGAGCGGGGTACTGATTTCGAATGGATTTTTTTTT
Mosq_P00000162	Mosq_P00000162	mir|chrU:412263	chrU:412263		unmapped	CGCTCGGGTTTTCCCGAGCGGGTCCAGCTTCTAATCGTATTTTTTTT
Mosq_P00000163	Mosq_P00000163	mir|chrU:412263	chrU:412263		unmapped	CGCTCGGGTTTTCCCGAGCGGGTCCAGCTTCTAATCGAAATTTTTTTT
Mosq_P00000164	Mosq_P00000164	mir|chrU:558887	chrU:558887		unmapped	CGCTCGGGTTTTCCCGAGCGGGTTCTGTCTCAAACTGTTTTTTTTTT
Mosq_P00000165	Mosq_P00000165	mir|chrU:558887	chrU:558887		unmapped	CGCTCGGGTTTTCCCGAGCGGGTTCTGTCTCAAACTGCTTTTTTTTTT
Mosq_P00000166	Mosq_P00000166	mir|chr2L:351221	chr2L:351221		unmapped	CGCTCGGGTTTTCCCGAGCGGTACATCTAGGCCGTACTTTTTTTTTT
Mosq_P00000167	Mosq_P00000167	mir|chr2L:351221	chr2L:351221		unmapped	CGCTCGGGTTTTCCCGAGCGGTACATCTAGGCCGTACGTTTTTTTTTT
Mosq_P00000168	Mosq_P00000168	mir|chrU:513669	chrU:513669		unmapped	CGCTCGGGTTTTCCCGAGCGGTACCAGGAAGACGAACTTTTTTTTTT
Mosq_P00000169	Mosq_P00000169	mir|chrU:513669	chrU:513669		unmapped	CGCTCGGGTTTTCCCGAGCGGTACCAGGAAGACGAACGTTTTTTTTTT
Mosq_P00000170	Mosq_P00000170	mir|chr2R:7091	chr2R:7091		unmapped	CGCTCGGGTTTTCCCGAGCGGTCCAGAACCGTGTGTATTTTTTTT
Mosq_P00000171	Mosq_P00000171	mir|chr2R:7091	chr2R:7091		unmapped	CGCTCGGGTTTTCCCGAGCGGTCCAGAACCGTGTGAATTTTTTTTT
Mosq_P00000172	Mosq_P00000172	mir|chrU:549828	chrU:549828		unmapped	CGCTCGGGTTTTCCCGAGCGGTCCAGATTCATCCGGTTTTTTTTTT
Mosq_P00000173	Mosq_P00000173	mir|chrU:549828	chrU:549828		unmapped	CGCTCGGGTTTTCCCGAGCGGTCCAGATTCATCCGGATATTTTTTTT
Mosq_P00000174	Mosq_P00000174	mir|chrX:35753	chrX:35753		unmapped	CGCTCGGGTTTTCCCGAGCGGTCCAGCACCGACGATTTTTTTTT
Mosq_P00000175	Mosq_P00000175	mir|chrX:35753	chrX:35753		unmapped	CGCTCGGGTTTTCCCGAGCGGTCCAGCACCGACGTTTTTTTTTTT
Mosq_P00000176	Mosq_P00000176	mir|chrX:33430	chrX:33430		unmapped	CGCTCGGGTTTTCCCGAGCGGTCCCGCGGAATAGTTTTTTTTTTT
Mosq_P00000177	Mosq_P00000177	mir|chrX:33430	chrX:33430		unmapped	CGCTCGGGTTTTCCCGAGCGGTCCCGCGGAATAGTCTATTTTTTTT
Mosq_P00000178	Mosq_P00000178	mir|chr3R:5068	chr3R:5068		unmapped	CGCTCGGGTTTTCCCGAGCGGTCCCTCGTACGTATTCTATTTTTTTT
Mosq_P00000179	Mosq_P00000179	mir|chr3R:5068	chr3R:5068		unmapped	CGCTCGGGTTTTCCCGAGCGGTCCCTCGTACGTATTCGATTTTTTTTT
Mosq_P00000180	Mosq_P00000180	mir|chr2R:434843	chr2R:434843		unmapped	CGCTCGGGTTTTCCCGAGCGGTCCTTGTGATTTGTTGATTTTTTTTTT
Mosq_P00000181	Mosq_P00000181	mir|chr2R:434843	chr2R:434843		unmapped	CGCTCGGGTTTTCCCGAGCGGTCCTTGTGATTTGTTGAATTTTTTTTTT
Mosq_P00000182	Mosq_P00000182	mir|chr2R:434843	chr2R:434843		unmapped	CGCTCGGGTTTTCCCGAGCGGTCCTTGTGATTTGTTGAAATATTTTTTTT
Mosq_P00000183	Mosq_P00000183	mir|chrU:509480	chrU:509480		unmapped	CGCTCGGGTTTTCCCGAGCGGTCGGTGTCCGAGTTTTTTTTTTT
Mosq_P00000184	Mosq_P00000184	mir|chrU:509480	chrU:509480		unmapped	CGCTCGGGTTTTCCCGAGCGGTCGGTGTCCGAGTCTTTTTTTTTT
Mosq_P00000185	Mosq_P00000185	mir|chrX:12560_mir-33	chrX:12560_mir-33		unmapped	CGCTCGGGTTTTCCCGAGCGGTGCAATGCAACTACAATTTTTTTTTTT
Mosq_P00000186	Mosq_P00000186	mir|chrX:12560_mir-33	chrX:12560_mir-33		unmapped	CGCTCGGGTTTTCCCGAGCGGTGCAATGCAACTACAATGTTTTTTTTTT
Mosq_P00000187	Mosq_P00000187	mir|chrX:17239	chrX:17239		unmapped	CGCTCGGGTTTTCCCGAGCGGTGCATTACAGAAAACCCAATTTTTTTT
Mosq_P00000188	Mosq_P00000188	mir|chrX:17239	chrX:17239		unmapped	CGCTCGGGTTTTCCCGAGCGGTGCATTACAGAAAACCCTATTTTTTTTT
Mosq_P00000189	Mosq_P00000189	mir|chrX:94568	chrX:94568		unmapped	CGCTCGGGTTTTCCCGAGCGGTGCCATCTCCTAGCTTTTTTTTTTT
Mosq_P00000190	Mosq_P00000190	mir|chrX:94568	chrX:94568		unmapped	CGCTCGGGTTTTCCCGAGCGGTGCCATCTCCTAGCTCTTTTTTTTTT
Mosq_P00000191	Mosq_P00000191	mir|chrU:440167	chrU:440167		unmapped	CGCTCGGGTTTTCCCGAGCGGTGCCGCAGGTTGTATTTTTTTT
Mosq_P00000192	Mosq_P00000192	mir|chrU:440167	chrU:440167		unmapped	CGCTCGGGTTTTCCCGAGCGGTGCCGCAGGTTGCATTTTTTTTT
Mosq_P00000193	Mosq_P00000193	mir|chr2L:273300	chr2L:273300		unmapped	CGCTCGGGTTTTCCCGAGCGGTGGTCACAAACAGGGTTTTTTTTTT
Mosq_P00000194	Mosq_P00000194	mir|chr2L:273300	chr2L:273300		unmapped	CGCTCGGGTTTTCCCGAGCGGTGGTCACAAACAGGGCTTTTTTTTTT
Mosq_P00000195	Mosq_P00000195	mir|chrU:345003	chrU:345003		unmapped	CGCTCGGGTTTTCCCGAGCGGTGTCCGAGTCCGTATTTTTTTTT
Mosq_P00000196	Mosq_P00000196	mir|chrU:345003	chrU:345003		unmapped	CGCTCGGGTTTTCCCGAGCGGTGTCCGAGTCCGTTTATTTTTTTT
Mosq_P00000197	Mosq_P00000197	mir|chrU:345003	chrU:345003		unmapped	CGCTCGGGTTTTCCCGAGCGGTGTCCGAGTCCGTTAATTTTTTTTT
Mosq_P00000198	Mosq_P00000198	mir|chrX:94572	chrX:94572		unmapped	CGCTCGGGTTTTCCCGAGCGGTGTGGGTGGGTAGTTTTTTTTTTT
Mosq_P00000199	Mosq_P00000199	mir|chrX:94572	chrX:94572		unmapped	CGCTCGGGTTTTCCCGAGCGGTGTGGGTGGGTAGTGTATTTTTTTT
Mosq_P00000200	Mosq_P00000200	mir|chr3L:384890	chr3L:384890		unmapped	CGCTCGGGTTTTCCCGAGCGGTGTTGTACGGAGGAGTATTTTTTTT
Mosq_P00000201	Mosq_P00000201	mir|chr3L:384890	chr3L:384890		unmapped	CGCTCGGGTTTTCCCGAGCGGTGTTGTACGGAGGAGGATTTTTTTTT
Mosq_P00000202	Mosq_P00000202	mir|chr2L:131779	chr2L:131779		unmapped	CGCTCGGGTTTTCCCGAGCGGTTATCATTATGTACCAGCCTATTTTTTTT
Mosq_P00000203	Mosq_P00000203	mir|chr2L:131779	chr2L:131779		unmapped	CGCTCGGGTTTTCCCGAGCGGTTATCATTATGTACCAGCCGATTTTTTTTT
NC1_00000197	NC1_00000197					
NC1_00000215	NC1_00000215					
NC2_00079215	NC2_00079215					
NC2_00092197	NC2_00092197					
NC2_00106057	NC2_00106057					
NC2_00122731	NC2_00122731					
dmr_285	dmr_285					
dmr_3	dmr_3					
dmr_308	dmr_308					
dmr_316	dmr_316					
dmr_31a	dmr_31a					
dmr_6	dmr_6					
hur_1	hur_1					
hur_2	hur_2					
hur_4	hur_4					
hur_5	hur_5					
hur_6	hur_6					
miRFill	miRFill				unmapped	GCTAGCGAAAGCTAGCTTTTCGATCGGAAACGATCGTTTTCCAGTGACGAAAGTCACTGG
miRNABrightCorner30	miRNABrightCorner30					
mr_1	mr_1					
(-)3xSLv1	(-)3xSLv1					
hur_4_27	hur_4_27					
dmr_6_21	dmr_6_21					
dmr_316_21	dmr_316_21					
hur_2_22	hur_2_22					
dmr_285_18	dmr_285_18					
dmr_31a_19	dmr_31a_19					
mr_1_21	mr_1_21					
mr_1_22	mr_1_22					
hur_6_28	hur_6_28					
hur_5_23	hur_5_23					
dmr_308_22	dmr_308_22					
dmr_285_19	dmr_285_19					
mr_1_20	mr_1_20					
hur_5_24	hur_5_24					
hur_1_19	hur_1_19					
hur_4_28	hur_4_28					
hur_1_22	hur_1_22					
dmr_6_22	dmr_6_22					
mr_1_23	mr_1_23					
dmr_3_16	dmr_3_16					
hur_2_21	hur_2_21					
hur_6_27	hur_6_27					
hur_5_22	hur_5_22					
hur_2_20	hur_2_20					
hur_1_21	hur_1_21					
hur_1_20	hur_1_20					
dmr_316_22	dmr_316_22					
hur_4_26	hur_4_26					
hur_6_29	hur_6_29					
dmr_31a_18	dmr_31a_18					
dmr_3_17	dmr_3_17					
dmr_308_21	dmr_308_21					
hur_4_29	hur_4_29					
hur_5_25	hur_5_25					
hur_2_19	hur_2_19