#ID = 
#SEQUENCE = 
#SPOT_ID = 
ID	SEQUENCE	SPOT_ID
dBr_TALE2072_dinucleotide_substitution_99_replicate_9	TAGCAATGTTCACCAGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_99_replicate_8	TAGCAATGTTCACCAGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_99_replicate_7	TAGCAATGTTCACCAGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_99_replicate_6	TAGCAATGTTCACCAGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_99_replicate_5	TAGCAATGTTCACCAGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_99_replicate_4	TAGCAATGTTCACCAGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_99_replicate_3	TAGCAATGTTCACCAGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_99_replicate_2	TAGCAATGTTCACCAGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_99_replicate_10	TAGCAATGTTCACCAGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_99_replicate_1	TAGCAATGTTCACCAGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_98_replicate_9	TAGCAATGTTCACCACGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_98_replicate_8	TAGCAATGTTCACCACGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_98_replicate_7	TAGCAATGTTCACCACGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_98_replicate_6	TAGCAATGTTCACCACGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_98_replicate_5	TAGCAATGTTCACCACGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_98_replicate_4	TAGCAATGTTCACCACGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_98_replicate_3	TAGCAATGTTCACCACGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_98_replicate_2	TAGCAATGTTCACCACGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_98_replicate_10	TAGCAATGTTCACCACGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_98_replicate_1	TAGCAATGTTCACCACGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_97_replicate_9	TAGCAATGTTCACCAAGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_97_replicate_8	TAGCAATGTTCACCAAGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_97_replicate_7	TAGCAATGTTCACCAAGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_97_replicate_6	TAGCAATGTTCACCAAGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_97_replicate_5	TAGCAATGTTCACCAAGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_97_replicate_4	TAGCAATGTTCACCAAGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_97_replicate_3	TAGCAATGTTCACCAAGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_97_replicate_2	TAGCAATGTTCACCAAGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_97_replicate_10	TAGCAATGTTCACCAAGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_97_replicate_1	TAGCAATGTTCACCAAGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_96_replicate_9	TAGCAATGTTCACTTGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_96_replicate_8	TAGCAATGTTCACTTGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_96_replicate_7	TAGCAATGTTCACTTGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_96_replicate_6	TAGCAATGTTCACTTGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_96_replicate_5	TAGCAATGTTCACTTGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_96_replicate_4	TAGCAATGTTCACTTGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_96_replicate_3	TAGCAATGTTCACTTGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_96_replicate_2	TAGCAATGTTCACTTGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_96_replicate_10	TAGCAATGTTCACTTGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_96_replicate_1	TAGCAATGTTCACTTGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_95_replicate_9	TAGCAATGTTCACTGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_95_replicate_8	TAGCAATGTTCACTGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_95_replicate_7	TAGCAATGTTCACTGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_95_replicate_6	TAGCAATGTTCACTGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_95_replicate_5	TAGCAATGTTCACTGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_95_replicate_4	TAGCAATGTTCACTGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_95_replicate_3	TAGCAATGTTCACTGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_95_replicate_2	TAGCAATGTTCACTGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_95_replicate_10	TAGCAATGTTCACTGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_95_replicate_1	TAGCAATGTTCACTGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_94_replicate_9	TAGCAATGTTCACTCGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_94_replicate_8	TAGCAATGTTCACTCGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_94_replicate_7	TAGCAATGTTCACTCGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_94_replicate_6	TAGCAATGTTCACTCGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_94_replicate_5	TAGCAATGTTCACTCGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_94_replicate_4	TAGCAATGTTCACTCGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_94_replicate_3	TAGCAATGTTCACTCGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_94_replicate_2	TAGCAATGTTCACTCGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_94_replicate_10	TAGCAATGTTCACTCGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_94_replicate_1	TAGCAATGTTCACTCGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_93_replicate_9	TAGCAATGTTCACTAGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_93_replicate_8	TAGCAATGTTCACTAGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_93_replicate_7	TAGCAATGTTCACTAGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_93_replicate_6	TAGCAATGTTCACTAGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_93_replicate_5	TAGCAATGTTCACTAGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_93_replicate_4	TAGCAATGTTCACTAGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_93_replicate_3	TAGCAATGTTCACTAGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_93_replicate_2	TAGCAATGTTCACTAGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_93_replicate_10	TAGCAATGTTCACTAGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_93_replicate_1	TAGCAATGTTCACTAGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_92_replicate_9	TAGCAATGTTCACGTGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_92_replicate_8	TAGCAATGTTCACGTGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_92_replicate_7	TAGCAATGTTCACGTGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_92_replicate_6	TAGCAATGTTCACGTGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_92_replicate_5	TAGCAATGTTCACGTGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_92_replicate_4	TAGCAATGTTCACGTGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_92_replicate_3	TAGCAATGTTCACGTGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_92_replicate_2	TAGCAATGTTCACGTGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_92_replicate_10	TAGCAATGTTCACGTGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_92_replicate_1	TAGCAATGTTCACGTGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_91_replicate_9	TAGCAATGTTCACGGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_91_replicate_8	TAGCAATGTTCACGGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_91_replicate_7	TAGCAATGTTCACGGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_91_replicate_6	TAGCAATGTTCACGGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_91_replicate_5	TAGCAATGTTCACGGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_91_replicate_4	TAGCAATGTTCACGGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_91_replicate_3	TAGCAATGTTCACGGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_91_replicate_2	TAGCAATGTTCACGGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_91_replicate_10	TAGCAATGTTCACGGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_91_replicate_1	TAGCAATGTTCACGGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_90_replicate_9	TAGCAATGTTCACGCGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_90_replicate_8	TAGCAATGTTCACGCGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_90_replicate_7	TAGCAATGTTCACGCGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_90_replicate_6	TAGCAATGTTCACGCGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_90_replicate_5	TAGCAATGTTCACGCGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_90_replicate_4	TAGCAATGTTCACGCGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_90_replicate_3	TAGCAATGTTCACGCGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_90_replicate_2	TAGCAATGTTCACGCGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_90_replicate_10	TAGCAATGTTCACGCGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_90_replicate_1	TAGCAATGTTCACGCGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_9_replicate_9	TAGCAATGGACACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_9_replicate_8	TAGCAATGGACACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_9_replicate_7	TAGCAATGGACACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_9_replicate_6	TAGCAATGGACACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_9_replicate_5	TAGCAATGGACACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_9_replicate_4	TAGCAATGGACACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_9_replicate_3	TAGCAATGGACACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_9_replicate_2	TAGCAATGGACACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_9_replicate_10	TAGCAATGGACACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_9_replicate_1	TAGCAATGGACACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_89_replicate_9	TAGCAATGTTCACGAGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_89_replicate_8	TAGCAATGTTCACGAGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_89_replicate_7	TAGCAATGTTCACGAGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_89_replicate_6	TAGCAATGTTCACGAGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_89_replicate_5	TAGCAATGTTCACGAGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_89_replicate_4	TAGCAATGTTCACGAGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_89_replicate_3	TAGCAATGTTCACGAGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_89_replicate_2	TAGCAATGTTCACGAGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_89_replicate_10	TAGCAATGTTCACGAGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_89_replicate_1	TAGCAATGTTCACGAGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_88_replicate_9	TAGCAATGTTCACCTGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_88_replicate_8	TAGCAATGTTCACCTGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_88_replicate_7	TAGCAATGTTCACCTGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_88_replicate_6	TAGCAATGTTCACCTGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_88_replicate_5	TAGCAATGTTCACCTGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_88_replicate_4	TAGCAATGTTCACCTGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_88_replicate_3	TAGCAATGTTCACCTGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_88_replicate_2	TAGCAATGTTCACCTGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_88_replicate_10	TAGCAATGTTCACCTGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_88_replicate_1	TAGCAATGTTCACCTGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_87_replicate_9	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_87_replicate_8	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_87_replicate_7	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_87_replicate_6	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_87_replicate_5	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_87_replicate_4	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_87_replicate_3	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_87_replicate_2	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_87_replicate_10	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_87_replicate_1	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_86_replicate_9	TAGCAATGTTCACCCGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_86_replicate_8	TAGCAATGTTCACCCGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_86_replicate_7	TAGCAATGTTCACCCGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_86_replicate_6	TAGCAATGTTCACCCGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_86_replicate_5	TAGCAATGTTCACCCGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_86_replicate_4	TAGCAATGTTCACCCGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_86_replicate_3	TAGCAATGTTCACCCGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_86_replicate_2	TAGCAATGTTCACCCGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_86_replicate_10	TAGCAATGTTCACCCGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_86_replicate_1	TAGCAATGTTCACCCGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_85_replicate_9	TAGCAATGTTCACCAGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_85_replicate_8	TAGCAATGTTCACCAGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_85_replicate_7	TAGCAATGTTCACCAGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_85_replicate_6	TAGCAATGTTCACCAGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_85_replicate_5	TAGCAATGTTCACCAGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_85_replicate_4	TAGCAATGTTCACCAGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_85_replicate_3	TAGCAATGTTCACCAGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_85_replicate_2	TAGCAATGTTCACCAGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_85_replicate_10	TAGCAATGTTCACCAGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_85_replicate_1	TAGCAATGTTCACCAGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_84_replicate_9	TAGCAATGTTCACATGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_84_replicate_8	TAGCAATGTTCACATGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_84_replicate_7	TAGCAATGTTCACATGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_84_replicate_6	TAGCAATGTTCACATGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_84_replicate_5	TAGCAATGTTCACATGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_84_replicate_4	TAGCAATGTTCACATGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_84_replicate_3	TAGCAATGTTCACATGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_84_replicate_2	TAGCAATGTTCACATGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_84_replicate_10	TAGCAATGTTCACATGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_84_replicate_1	TAGCAATGTTCACATGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_83_replicate_9	TAGCAATGTTCACAGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_83_replicate_8	TAGCAATGTTCACAGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_83_replicate_7	TAGCAATGTTCACAGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_83_replicate_6	TAGCAATGTTCACAGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_83_replicate_5	TAGCAATGTTCACAGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_83_replicate_4	TAGCAATGTTCACAGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_83_replicate_3	TAGCAATGTTCACAGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_83_replicate_2	TAGCAATGTTCACAGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_83_replicate_10	TAGCAATGTTCACAGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_83_replicate_1	TAGCAATGTTCACAGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_82_replicate_9	TAGCAATGTTCACACGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_82_replicate_8	TAGCAATGTTCACACGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_82_replicate_7	TAGCAATGTTCACACGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_82_replicate_6	TAGCAATGTTCACACGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_82_replicate_5	TAGCAATGTTCACACGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_82_replicate_4	TAGCAATGTTCACACGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_82_replicate_3	TAGCAATGTTCACACGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_82_replicate_2	TAGCAATGTTCACACGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_82_replicate_10	TAGCAATGTTCACACGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_82_replicate_1	TAGCAATGTTCACACGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_81_replicate_9	TAGCAATGTTCACAAGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_81_replicate_8	TAGCAATGTTCACAAGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_81_replicate_7	TAGCAATGTTCACAAGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_81_replicate_6	TAGCAATGTTCACAAGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_81_replicate_5	TAGCAATGTTCACAAGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_81_replicate_4	TAGCAATGTTCACAAGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_81_replicate_3	TAGCAATGTTCACAAGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_81_replicate_2	TAGCAATGTTCACAAGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_81_replicate_10	TAGCAATGTTCACAAGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_81_replicate_1	TAGCAATGTTCACAAGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_80_replicate_9	TAGCAATGTTCATTGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_80_replicate_8	TAGCAATGTTCATTGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_80_replicate_7	TAGCAATGTTCATTGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_80_replicate_6	TAGCAATGTTCATTGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_80_replicate_5	TAGCAATGTTCATTGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_80_replicate_4	TAGCAATGTTCATTGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_80_replicate_3	TAGCAATGTTCATTGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_80_replicate_2	TAGCAATGTTCATTGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_80_replicate_10	TAGCAATGTTCATTGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_80_replicate_1	TAGCAATGTTCATTGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_8_replicate_9	TAGCAATGCTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_8_replicate_8	TAGCAATGCTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_8_replicate_7	TAGCAATGCTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_8_replicate_6	TAGCAATGCTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_8_replicate_5	TAGCAATGCTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_8_replicate_4	TAGCAATGCTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_8_replicate_3	TAGCAATGCTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_8_replicate_2	TAGCAATGCTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_8_replicate_10	TAGCAATGCTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_8_replicate_1	TAGCAATGCTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_79_replicate_9	TAGCAATGTTCATGGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_79_replicate_8	TAGCAATGTTCATGGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_79_replicate_7	TAGCAATGTTCATGGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_79_replicate_6	TAGCAATGTTCATGGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_79_replicate_5	TAGCAATGTTCATGGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_79_replicate_4	TAGCAATGTTCATGGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_79_replicate_3	TAGCAATGTTCATGGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_79_replicate_2	TAGCAATGTTCATGGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_79_replicate_10	TAGCAATGTTCATGGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_79_replicate_1	TAGCAATGTTCATGGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_78_replicate_9	TAGCAATGTTCATCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_78_replicate_8	TAGCAATGTTCATCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_78_replicate_7	TAGCAATGTTCATCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_78_replicate_6	TAGCAATGTTCATCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_78_replicate_5	TAGCAATGTTCATCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_78_replicate_4	TAGCAATGTTCATCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_78_replicate_3	TAGCAATGTTCATCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_78_replicate_2	TAGCAATGTTCATCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_78_replicate_10	TAGCAATGTTCATCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_78_replicate_1	TAGCAATGTTCATCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_77_replicate_9	TAGCAATGTTCATAGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_77_replicate_8	TAGCAATGTTCATAGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_77_replicate_7	TAGCAATGTTCATAGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_77_replicate_6	TAGCAATGTTCATAGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_77_replicate_5	TAGCAATGTTCATAGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_77_replicate_4	TAGCAATGTTCATAGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_77_replicate_3	TAGCAATGTTCATAGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_77_replicate_2	TAGCAATGTTCATAGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_77_replicate_10	TAGCAATGTTCATAGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_77_replicate_1	TAGCAATGTTCATAGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_76_replicate_9	TAGCAATGTTCAGTGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_76_replicate_8	TAGCAATGTTCAGTGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_76_replicate_7	TAGCAATGTTCAGTGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_76_replicate_6	TAGCAATGTTCAGTGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_76_replicate_5	TAGCAATGTTCAGTGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_76_replicate_4	TAGCAATGTTCAGTGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_76_replicate_3	TAGCAATGTTCAGTGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_76_replicate_2	TAGCAATGTTCAGTGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_76_replicate_10	TAGCAATGTTCAGTGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_76_replicate_1	TAGCAATGTTCAGTGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_75_replicate_9	TAGCAATGTTCAGGGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_75_replicate_8	TAGCAATGTTCAGGGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_75_replicate_7	TAGCAATGTTCAGGGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_75_replicate_6	TAGCAATGTTCAGGGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_75_replicate_5	TAGCAATGTTCAGGGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_75_replicate_4	TAGCAATGTTCAGGGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_75_replicate_3	TAGCAATGTTCAGGGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_75_replicate_2	TAGCAATGTTCAGGGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_75_replicate_10	TAGCAATGTTCAGGGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_75_replicate_1	TAGCAATGTTCAGGGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_74_replicate_9	TAGCAATGTTCAGCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_74_replicate_8	TAGCAATGTTCAGCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_74_replicate_7	TAGCAATGTTCAGCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_74_replicate_6	TAGCAATGTTCAGCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_74_replicate_5	TAGCAATGTTCAGCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_74_replicate_4	TAGCAATGTTCAGCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_74_replicate_3	TAGCAATGTTCAGCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_74_replicate_2	TAGCAATGTTCAGCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_74_replicate_10	TAGCAATGTTCAGCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_74_replicate_1	TAGCAATGTTCAGCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_73_replicate_9	TAGCAATGTTCAGAGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_73_replicate_8	TAGCAATGTTCAGAGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_73_replicate_7	TAGCAATGTTCAGAGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_73_replicate_6	TAGCAATGTTCAGAGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_73_replicate_5	TAGCAATGTTCAGAGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_73_replicate_4	TAGCAATGTTCAGAGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_73_replicate_3	TAGCAATGTTCAGAGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_73_replicate_2	TAGCAATGTTCAGAGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_73_replicate_10	TAGCAATGTTCAGAGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_73_replicate_1	TAGCAATGTTCAGAGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_72_replicate_9	TAGCAATGTTCACTGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_72_replicate_8	TAGCAATGTTCACTGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_72_replicate_7	TAGCAATGTTCACTGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_72_replicate_6	TAGCAATGTTCACTGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_72_replicate_5	TAGCAATGTTCACTGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_72_replicate_4	TAGCAATGTTCACTGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_72_replicate_3	TAGCAATGTTCACTGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_72_replicate_2	TAGCAATGTTCACTGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_72_replicate_10	TAGCAATGTTCACTGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_72_replicate_1	TAGCAATGTTCACTGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_71_replicate_9	TAGCAATGTTCACGGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_71_replicate_8	TAGCAATGTTCACGGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_71_replicate_7	TAGCAATGTTCACGGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_71_replicate_6	TAGCAATGTTCACGGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_71_replicate_5	TAGCAATGTTCACGGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_71_replicate_4	TAGCAATGTTCACGGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_71_replicate_3	TAGCAATGTTCACGGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_71_replicate_2	TAGCAATGTTCACGGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_71_replicate_10	TAGCAATGTTCACGGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_71_replicate_1	TAGCAATGTTCACGGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_70_replicate_9	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_70_replicate_8	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_70_replicate_7	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_70_replicate_6	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_70_replicate_5	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_70_replicate_4	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_70_replicate_3	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_70_replicate_2	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_70_replicate_10	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_70_replicate_1	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_7_replicate_9	TAGCAATGCGCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_7_replicate_8	TAGCAATGCGCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_7_replicate_7	TAGCAATGCGCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_7_replicate_6	TAGCAATGCGCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_7_replicate_5	TAGCAATGCGCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_7_replicate_4	TAGCAATGCGCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_7_replicate_3	TAGCAATGCGCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_7_replicate_2	TAGCAATGCGCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_7_replicate_10	TAGCAATGCGCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_7_replicate_1	TAGCAATGCGCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_69_replicate_9	TAGCAATGTTCACAGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_69_replicate_8	TAGCAATGTTCACAGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_69_replicate_7	TAGCAATGTTCACAGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_69_replicate_6	TAGCAATGTTCACAGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_69_replicate_5	TAGCAATGTTCACAGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_69_replicate_4	TAGCAATGTTCACAGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_69_replicate_3	TAGCAATGTTCACAGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_69_replicate_2	TAGCAATGTTCACAGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_69_replicate_10	TAGCAATGTTCACAGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_69_replicate_1	TAGCAATGTTCACAGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_68_replicate_9	TAGCAATGTTCAATGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_68_replicate_8	TAGCAATGTTCAATGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_68_replicate_7	TAGCAATGTTCAATGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_68_replicate_6	TAGCAATGTTCAATGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_68_replicate_5	TAGCAATGTTCAATGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_68_replicate_4	TAGCAATGTTCAATGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_68_replicate_3	TAGCAATGTTCAATGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_68_replicate_2	TAGCAATGTTCAATGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_68_replicate_10	TAGCAATGTTCAATGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_68_replicate_1	TAGCAATGTTCAATGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_67_replicate_9	TAGCAATGTTCAAGGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_67_replicate_8	TAGCAATGTTCAAGGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_67_replicate_7	TAGCAATGTTCAAGGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_67_replicate_6	TAGCAATGTTCAAGGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_67_replicate_5	TAGCAATGTTCAAGGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_67_replicate_4	TAGCAATGTTCAAGGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_67_replicate_3	TAGCAATGTTCAAGGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_67_replicate_2	TAGCAATGTTCAAGGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_67_replicate_10	TAGCAATGTTCAAGGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_67_replicate_1	TAGCAATGTTCAAGGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_66_replicate_9	TAGCAATGTTCAACGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_66_replicate_8	TAGCAATGTTCAACGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_66_replicate_7	TAGCAATGTTCAACGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_66_replicate_6	TAGCAATGTTCAACGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_66_replicate_5	TAGCAATGTTCAACGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_66_replicate_4	TAGCAATGTTCAACGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_66_replicate_3	TAGCAATGTTCAACGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_66_replicate_2	TAGCAATGTTCAACGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_66_replicate_10	TAGCAATGTTCAACGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_66_replicate_1	TAGCAATGTTCAACGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_65_replicate_9	TAGCAATGTTCAAAGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_65_replicate_8	TAGCAATGTTCAAAGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_65_replicate_7	TAGCAATGTTCAAAGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_65_replicate_6	TAGCAATGTTCAAAGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_65_replicate_5	TAGCAATGTTCAAAGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_65_replicate_4	TAGCAATGTTCAAAGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_65_replicate_3	TAGCAATGTTCAAAGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_65_replicate_2	TAGCAATGTTCAAAGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_65_replicate_10	TAGCAATGTTCAAAGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_65_replicate_1	TAGCAATGTTCAAAGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_64_replicate_9	TAGCAATGTTCTTCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_64_replicate_8	TAGCAATGTTCTTCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_64_replicate_7	TAGCAATGTTCTTCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_64_replicate_6	TAGCAATGTTCTTCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_64_replicate_5	TAGCAATGTTCTTCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_64_replicate_4	TAGCAATGTTCTTCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_64_replicate_3	TAGCAATGTTCTTCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_64_replicate_2	TAGCAATGTTCTTCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_64_replicate_10	TAGCAATGTTCTTCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_64_replicate_1	TAGCAATGTTCTTCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_63_replicate_9	TAGCAATGTTCTGCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_63_replicate_8	TAGCAATGTTCTGCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_63_replicate_7	TAGCAATGTTCTGCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_63_replicate_6	TAGCAATGTTCTGCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_63_replicate_5	TAGCAATGTTCTGCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_63_replicate_4	TAGCAATGTTCTGCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_63_replicate_3	TAGCAATGTTCTGCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_63_replicate_2	TAGCAATGTTCTGCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_63_replicate_10	TAGCAATGTTCTGCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_63_replicate_1	TAGCAATGTTCTGCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_62_replicate_9	TAGCAATGTTCTCCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_62_replicate_8	TAGCAATGTTCTCCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_62_replicate_7	TAGCAATGTTCTCCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_62_replicate_6	TAGCAATGTTCTCCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_62_replicate_5	TAGCAATGTTCTCCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_62_replicate_4	TAGCAATGTTCTCCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_62_replicate_3	TAGCAATGTTCTCCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_62_replicate_2	TAGCAATGTTCTCCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_62_replicate_10	TAGCAATGTTCTCCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_62_replicate_1	TAGCAATGTTCTCCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_61_replicate_9	TAGCAATGTTCTACGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_61_replicate_8	TAGCAATGTTCTACGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_61_replicate_7	TAGCAATGTTCTACGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_61_replicate_6	TAGCAATGTTCTACGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_61_replicate_5	TAGCAATGTTCTACGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_61_replicate_4	TAGCAATGTTCTACGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_61_replicate_3	TAGCAATGTTCTACGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_61_replicate_2	TAGCAATGTTCTACGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_61_replicate_10	TAGCAATGTTCTACGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_61_replicate_1	TAGCAATGTTCTACGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_60_replicate_9	TAGCAATGTTCGTCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_60_replicate_8	TAGCAATGTTCGTCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_60_replicate_7	TAGCAATGTTCGTCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_60_replicate_6	TAGCAATGTTCGTCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_60_replicate_5	TAGCAATGTTCGTCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_60_replicate_4	TAGCAATGTTCGTCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_60_replicate_3	TAGCAATGTTCGTCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_60_replicate_2	TAGCAATGTTCGTCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_60_replicate_10	TAGCAATGTTCGTCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_60_replicate_1	TAGCAATGTTCGTCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_6_replicate_9	TAGCAATGCCCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_6_replicate_8	TAGCAATGCCCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_6_replicate_7	TAGCAATGCCCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_6_replicate_6	TAGCAATGCCCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_6_replicate_5	TAGCAATGCCCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_6_replicate_4	TAGCAATGCCCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_6_replicate_3	TAGCAATGCCCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_6_replicate_2	TAGCAATGCCCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_6_replicate_10	TAGCAATGCCCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_6_replicate_1	TAGCAATGCCCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_59_replicate_9	TAGCAATGTTCGGCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_59_replicate_8	TAGCAATGTTCGGCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_59_replicate_7	TAGCAATGTTCGGCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_59_replicate_6	TAGCAATGTTCGGCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_59_replicate_5	TAGCAATGTTCGGCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_59_replicate_4	TAGCAATGTTCGGCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_59_replicate_3	TAGCAATGTTCGGCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_59_replicate_2	TAGCAATGTTCGGCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_59_replicate_10	TAGCAATGTTCGGCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_59_replicate_1	TAGCAATGTTCGGCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_58_replicate_9	TAGCAATGTTCGCCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_58_replicate_8	TAGCAATGTTCGCCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_58_replicate_7	TAGCAATGTTCGCCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_58_replicate_6	TAGCAATGTTCGCCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_58_replicate_5	TAGCAATGTTCGCCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_58_replicate_4	TAGCAATGTTCGCCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_58_replicate_3	TAGCAATGTTCGCCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_58_replicate_2	TAGCAATGTTCGCCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_58_replicate_10	TAGCAATGTTCGCCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_58_replicate_1	TAGCAATGTTCGCCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_57_replicate_9	TAGCAATGTTCGACGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_57_replicate_8	TAGCAATGTTCGACGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_57_replicate_7	TAGCAATGTTCGACGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_57_replicate_6	TAGCAATGTTCGACGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_57_replicate_5	TAGCAATGTTCGACGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_57_replicate_4	TAGCAATGTTCGACGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_57_replicate_3	TAGCAATGTTCGACGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_57_replicate_2	TAGCAATGTTCGACGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_57_replicate_10	TAGCAATGTTCGACGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_57_replicate_1	TAGCAATGTTCGACGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_56_replicate_9	TAGCAATGTTCCTCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_56_replicate_8	TAGCAATGTTCCTCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_56_replicate_7	TAGCAATGTTCCTCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_56_replicate_6	TAGCAATGTTCCTCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_56_replicate_5	TAGCAATGTTCCTCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_56_replicate_4	TAGCAATGTTCCTCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_56_replicate_3	TAGCAATGTTCCTCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_56_replicate_2	TAGCAATGTTCCTCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_56_replicate_10	TAGCAATGTTCCTCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_56_replicate_1	TAGCAATGTTCCTCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_55_replicate_9	TAGCAATGTTCCGCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_55_replicate_8	TAGCAATGTTCCGCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_55_replicate_7	TAGCAATGTTCCGCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_55_replicate_6	TAGCAATGTTCCGCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_55_replicate_5	TAGCAATGTTCCGCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_55_replicate_4	TAGCAATGTTCCGCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_55_replicate_3	TAGCAATGTTCCGCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_55_replicate_2	TAGCAATGTTCCGCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_55_replicate_10	TAGCAATGTTCCGCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_55_replicate_1	TAGCAATGTTCCGCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_54_replicate_9	TAGCAATGTTCCCCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_54_replicate_8	TAGCAATGTTCCCCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_54_replicate_7	TAGCAATGTTCCCCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_54_replicate_6	TAGCAATGTTCCCCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_54_replicate_5	TAGCAATGTTCCCCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_54_replicate_4	TAGCAATGTTCCCCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_54_replicate_3	TAGCAATGTTCCCCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_54_replicate_2	TAGCAATGTTCCCCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_54_replicate_10	TAGCAATGTTCCCCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_54_replicate_1	TAGCAATGTTCCCCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_53_replicate_9	TAGCAATGTTCCACGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_53_replicate_8	TAGCAATGTTCCACGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_53_replicate_7	TAGCAATGTTCCACGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_53_replicate_6	TAGCAATGTTCCACGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_53_replicate_5	TAGCAATGTTCCACGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_53_replicate_4	TAGCAATGTTCCACGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_53_replicate_3	TAGCAATGTTCCACGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_53_replicate_2	TAGCAATGTTCCACGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_53_replicate_10	TAGCAATGTTCCACGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_53_replicate_1	TAGCAATGTTCCACGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_52_replicate_9	TAGCAATGTTCATCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_52_replicate_8	TAGCAATGTTCATCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_52_replicate_7	TAGCAATGTTCATCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_52_replicate_6	TAGCAATGTTCATCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_52_replicate_5	TAGCAATGTTCATCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_52_replicate_4	TAGCAATGTTCATCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_52_replicate_3	TAGCAATGTTCATCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_52_replicate_2	TAGCAATGTTCATCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_52_replicate_10	TAGCAATGTTCATCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_52_replicate_1	TAGCAATGTTCATCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_51_replicate_9	TAGCAATGTTCAGCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_51_replicate_8	TAGCAATGTTCAGCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_51_replicate_7	TAGCAATGTTCAGCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_51_replicate_6	TAGCAATGTTCAGCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_51_replicate_5	TAGCAATGTTCAGCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_51_replicate_4	TAGCAATGTTCAGCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_51_replicate_3	TAGCAATGTTCAGCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_51_replicate_2	TAGCAATGTTCAGCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_51_replicate_10	TAGCAATGTTCAGCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_51_replicate_1	TAGCAATGTTCAGCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_50_replicate_9	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_50_replicate_8	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_50_replicate_7	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_50_replicate_6	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_50_replicate_5	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_50_replicate_4	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_50_replicate_3	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_50_replicate_2	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_50_replicate_10	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_50_replicate_1	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_5_replicate_9	TAGCAATGCACACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_5_replicate_8	TAGCAATGCACACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_5_replicate_7	TAGCAATGCACACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_5_replicate_6	TAGCAATGCACACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_5_replicate_5	TAGCAATGCACACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_5_replicate_4	TAGCAATGCACACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_5_replicate_3	TAGCAATGCACACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_5_replicate_2	TAGCAATGCACACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_5_replicate_10	TAGCAATGCACACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_5_replicate_1	TAGCAATGCACACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_49_replicate_9	TAGCAATGTTCAACGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_49_replicate_8	TAGCAATGTTCAACGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_49_replicate_7	TAGCAATGTTCAACGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_49_replicate_6	TAGCAATGTTCAACGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_49_replicate_5	TAGCAATGTTCAACGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_49_replicate_4	TAGCAATGTTCAACGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_49_replicate_3	TAGCAATGTTCAACGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_49_replicate_2	TAGCAATGTTCAACGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_49_replicate_10	TAGCAATGTTCAACGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_49_replicate_1	TAGCAATGTTCAACGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_48_replicate_9	TAGCAATGTTTTCCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_48_replicate_8	TAGCAATGTTTTCCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_48_replicate_7	TAGCAATGTTTTCCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_48_replicate_6	TAGCAATGTTTTCCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_48_replicate_5	TAGCAATGTTTTCCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_48_replicate_4	TAGCAATGTTTTCCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_48_replicate_3	TAGCAATGTTTTCCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_48_replicate_2	TAGCAATGTTTTCCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_48_replicate_10	TAGCAATGTTTTCCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_48_replicate_1	TAGCAATGTTTTCCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_47_replicate_9	TAGCAATGTTTGCCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_47_replicate_8	TAGCAATGTTTGCCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_47_replicate_7	TAGCAATGTTTGCCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_47_replicate_6	TAGCAATGTTTGCCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_47_replicate_5	TAGCAATGTTTGCCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_47_replicate_4	TAGCAATGTTTGCCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_47_replicate_3	TAGCAATGTTTGCCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_47_replicate_2	TAGCAATGTTTGCCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_47_replicate_10	TAGCAATGTTTGCCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_47_replicate_1	TAGCAATGTTTGCCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_46_replicate_9	TAGCAATGTTTCCCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_46_replicate_8	TAGCAATGTTTCCCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_46_replicate_7	TAGCAATGTTTCCCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_46_replicate_6	TAGCAATGTTTCCCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_46_replicate_5	TAGCAATGTTTCCCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_46_replicate_4	TAGCAATGTTTCCCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_46_replicate_3	TAGCAATGTTTCCCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_46_replicate_2	TAGCAATGTTTCCCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_46_replicate_10	TAGCAATGTTTCCCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_46_replicate_1	TAGCAATGTTTCCCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_45_replicate_9	TAGCAATGTTTACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_45_replicate_8	TAGCAATGTTTACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_45_replicate_7	TAGCAATGTTTACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_45_replicate_6	TAGCAATGTTTACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_45_replicate_5	TAGCAATGTTTACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_45_replicate_4	TAGCAATGTTTACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_45_replicate_3	TAGCAATGTTTACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_45_replicate_2	TAGCAATGTTTACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_45_replicate_10	TAGCAATGTTTACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_45_replicate_1	TAGCAATGTTTACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_44_replicate_9	TAGCAATGTTGTCCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_44_replicate_8	TAGCAATGTTGTCCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_44_replicate_7	TAGCAATGTTGTCCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_44_replicate_6	TAGCAATGTTGTCCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_44_replicate_5	TAGCAATGTTGTCCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_44_replicate_4	TAGCAATGTTGTCCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_44_replicate_3	TAGCAATGTTGTCCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_44_replicate_2	TAGCAATGTTGTCCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_44_replicate_10	TAGCAATGTTGTCCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_44_replicate_1	TAGCAATGTTGTCCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_43_replicate_9	TAGCAATGTTGGCCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_43_replicate_8	TAGCAATGTTGGCCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_43_replicate_7	TAGCAATGTTGGCCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_43_replicate_6	TAGCAATGTTGGCCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_43_replicate_5	TAGCAATGTTGGCCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_43_replicate_4	TAGCAATGTTGGCCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_43_replicate_3	TAGCAATGTTGGCCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_43_replicate_2	TAGCAATGTTGGCCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_43_replicate_10	TAGCAATGTTGGCCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_43_replicate_1	TAGCAATGTTGGCCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_42_replicate_9	TAGCAATGTTGCCCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_42_replicate_8	TAGCAATGTTGCCCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_42_replicate_7	TAGCAATGTTGCCCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_42_replicate_6	TAGCAATGTTGCCCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_42_replicate_5	TAGCAATGTTGCCCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_42_replicate_4	TAGCAATGTTGCCCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_42_replicate_3	TAGCAATGTTGCCCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_42_replicate_2	TAGCAATGTTGCCCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_42_replicate_10	TAGCAATGTTGCCCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_42_replicate_1	TAGCAATGTTGCCCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_41_replicate_9	TAGCAATGTTGACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_41_replicate_8	TAGCAATGTTGACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_41_replicate_7	TAGCAATGTTGACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_41_replicate_6	TAGCAATGTTGACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_41_replicate_5	TAGCAATGTTGACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_41_replicate_4	TAGCAATGTTGACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_41_replicate_3	TAGCAATGTTGACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_41_replicate_2	TAGCAATGTTGACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_41_replicate_10	TAGCAATGTTGACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_41_replicate_1	TAGCAATGTTGACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_40_replicate_9	TAGCAATGTTCTCCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_40_replicate_8	TAGCAATGTTCTCCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_40_replicate_7	TAGCAATGTTCTCCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_40_replicate_6	TAGCAATGTTCTCCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_40_replicate_5	TAGCAATGTTCTCCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_40_replicate_4	TAGCAATGTTCTCCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_40_replicate_3	TAGCAATGTTCTCCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_40_replicate_2	TAGCAATGTTCTCCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_40_replicate_10	TAGCAATGTTCTCCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_40_replicate_1	TAGCAATGTTCTCCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_4_replicate_9	TAGCAATGATCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_4_replicate_8	TAGCAATGATCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_4_replicate_7	TAGCAATGATCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_4_replicate_6	TAGCAATGATCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_4_replicate_5	TAGCAATGATCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_4_replicate_4	TAGCAATGATCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_4_replicate_3	TAGCAATGATCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_4_replicate_2	TAGCAATGATCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_4_replicate_10	TAGCAATGATCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_4_replicate_1	TAGCAATGATCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_39_replicate_9	TAGCAATGTTCGCCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_39_replicate_8	TAGCAATGTTCGCCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_39_replicate_7	TAGCAATGTTCGCCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_39_replicate_6	TAGCAATGTTCGCCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_39_replicate_5	TAGCAATGTTCGCCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_39_replicate_4	TAGCAATGTTCGCCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_39_replicate_3	TAGCAATGTTCGCCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_39_replicate_2	TAGCAATGTTCGCCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_39_replicate_10	TAGCAATGTTCGCCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_39_replicate_1	TAGCAATGTTCGCCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_38_replicate_9	TAGCAATGTTCCCCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_38_replicate_8	TAGCAATGTTCCCCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_38_replicate_7	TAGCAATGTTCCCCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_38_replicate_6	TAGCAATGTTCCCCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_38_replicate_5	TAGCAATGTTCCCCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_38_replicate_4	TAGCAATGTTCCCCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_38_replicate_3	TAGCAATGTTCCCCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_38_replicate_2	TAGCAATGTTCCCCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_38_replicate_10	TAGCAATGTTCCCCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_38_replicate_1	TAGCAATGTTCCCCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_37_replicate_9	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_37_replicate_8	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_37_replicate_7	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_37_replicate_6	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_37_replicate_5	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_37_replicate_4	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_37_replicate_3	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_37_replicate_2	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_37_replicate_10	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_37_replicate_1	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_36_replicate_9	TAGCAATGTTATCCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_36_replicate_8	TAGCAATGTTATCCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_36_replicate_7	TAGCAATGTTATCCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_36_replicate_6	TAGCAATGTTATCCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_36_replicate_5	TAGCAATGTTATCCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_36_replicate_4	TAGCAATGTTATCCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_36_replicate_3	TAGCAATGTTATCCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_36_replicate_2	TAGCAATGTTATCCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_36_replicate_10	TAGCAATGTTATCCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_36_replicate_1	TAGCAATGTTATCCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_35_replicate_9	TAGCAATGTTAGCCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_35_replicate_8	TAGCAATGTTAGCCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_35_replicate_7	TAGCAATGTTAGCCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_35_replicate_6	TAGCAATGTTAGCCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_35_replicate_5	TAGCAATGTTAGCCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_35_replicate_4	TAGCAATGTTAGCCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_35_replicate_3	TAGCAATGTTAGCCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_35_replicate_2	TAGCAATGTTAGCCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_35_replicate_10	TAGCAATGTTAGCCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_35_replicate_1	TAGCAATGTTAGCCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_34_replicate_9	TAGCAATGTTACCCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_34_replicate_8	TAGCAATGTTACCCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_34_replicate_7	TAGCAATGTTACCCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_34_replicate_6	TAGCAATGTTACCCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_34_replicate_5	TAGCAATGTTACCCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_34_replicate_4	TAGCAATGTTACCCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_34_replicate_3	TAGCAATGTTACCCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_34_replicate_2	TAGCAATGTTACCCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_34_replicate_10	TAGCAATGTTACCCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_34_replicate_1	TAGCAATGTTACCCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_33_replicate_9	TAGCAATGTTAACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_33_replicate_8	TAGCAATGTTAACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_33_replicate_7	TAGCAATGTTAACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_33_replicate_6	TAGCAATGTTAACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_33_replicate_5	TAGCAATGTTAACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_33_replicate_4	TAGCAATGTTAACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_33_replicate_3	TAGCAATGTTAACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_33_replicate_2	TAGCAATGTTAACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_33_replicate_10	TAGCAATGTTAACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_33_replicate_1	TAGCAATGTTAACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_32_replicate_9	TAGCAATGTTTACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_32_replicate_8	TAGCAATGTTTACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_32_replicate_7	TAGCAATGTTTACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_32_replicate_6	TAGCAATGTTTACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_32_replicate_5	TAGCAATGTTTACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_32_replicate_4	TAGCAATGTTTACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_32_replicate_3	TAGCAATGTTTACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_32_replicate_2	TAGCAATGTTTACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_32_replicate_10	TAGCAATGTTTACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_32_replicate_1	TAGCAATGTTTACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_31_replicate_9	TAGCAATGTTGACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_31_replicate_8	TAGCAATGTTGACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_31_replicate_7	TAGCAATGTTGACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_31_replicate_6	TAGCAATGTTGACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_31_replicate_5	TAGCAATGTTGACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_31_replicate_4	TAGCAATGTTGACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_31_replicate_3	TAGCAATGTTGACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_31_replicate_2	TAGCAATGTTGACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_31_replicate_10	TAGCAATGTTGACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_31_replicate_1	TAGCAATGTTGACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_304_replicate_9	TAGCAATGTTCACCGGGGTGGTGCCCTTCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_304_replicate_8	TAGCAATGTTCACCGGGGTGGTGCCCTTCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_304_replicate_7	TAGCAATGTTCACCGGGGTGGTGCCCTTCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_304_replicate_6	TAGCAATGTTCACCGGGGTGGTGCCCTTCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_304_replicate_5	TAGCAATGTTCACCGGGGTGGTGCCCTTCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_304_replicate_4	TAGCAATGTTCACCGGGGTGGTGCCCTTCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_304_replicate_3	TAGCAATGTTCACCGGGGTGGTGCCCTTCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_304_replicate_2	TAGCAATGTTCACCGGGGTGGTGCCCTTCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_304_replicate_10	TAGCAATGTTCACCGGGGTGGTGCCCTTCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_304_replicate_1	TAGCAATGTTCACCGGGGTGGTGCCCTTCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_303_replicate_9	TAGCAATGTTCACCGGGGTGGTGCCCTGCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_303_replicate_8	TAGCAATGTTCACCGGGGTGGTGCCCTGCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_303_replicate_7	TAGCAATGTTCACCGGGGTGGTGCCCTGCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_303_replicate_6	TAGCAATGTTCACCGGGGTGGTGCCCTGCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_303_replicate_5	TAGCAATGTTCACCGGGGTGGTGCCCTGCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_303_replicate_4	TAGCAATGTTCACCGGGGTGGTGCCCTGCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_303_replicate_3	TAGCAATGTTCACCGGGGTGGTGCCCTGCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_303_replicate_2	TAGCAATGTTCACCGGGGTGGTGCCCTGCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_303_replicate_10	TAGCAATGTTCACCGGGGTGGTGCCCTGCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_303_replicate_1	TAGCAATGTTCACCGGGGTGGTGCCCTGCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_302_replicate_9	TAGCAATGTTCACCGGGGTGGTGCCCTCCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_302_replicate_8	TAGCAATGTTCACCGGGGTGGTGCCCTCCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_302_replicate_7	TAGCAATGTTCACCGGGGTGGTGCCCTCCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_302_replicate_6	TAGCAATGTTCACCGGGGTGGTGCCCTCCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_302_replicate_5	TAGCAATGTTCACCGGGGTGGTGCCCTCCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_302_replicate_4	TAGCAATGTTCACCGGGGTGGTGCCCTCCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_302_replicate_3	TAGCAATGTTCACCGGGGTGGTGCCCTCCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_302_replicate_2	TAGCAATGTTCACCGGGGTGGTGCCCTCCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_302_replicate_10	TAGCAATGTTCACCGGGGTGGTGCCCTCCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_302_replicate_1	TAGCAATGTTCACCGGGGTGGTGCCCTCCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_301_replicate_9	TAGCAATGTTCACCGGGGTGGTGCCCTACATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_301_replicate_8	TAGCAATGTTCACCGGGGTGGTGCCCTACATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_301_replicate_7	TAGCAATGTTCACCGGGGTGGTGCCCTACATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_301_replicate_6	TAGCAATGTTCACCGGGGTGGTGCCCTACATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_301_replicate_5	TAGCAATGTTCACCGGGGTGGTGCCCTACATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_301_replicate_4	TAGCAATGTTCACCGGGGTGGTGCCCTACATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_301_replicate_3	TAGCAATGTTCACCGGGGTGGTGCCCTACATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_301_replicate_2	TAGCAATGTTCACCGGGGTGGTGCCCTACATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_301_replicate_10	TAGCAATGTTCACCGGGGTGGTGCCCTACATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_301_replicate_1	TAGCAATGTTCACCGGGGTGGTGCCCTACATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_300_replicate_9	TAGCAATGTTCACCGGGGTGGTGCCCGTCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_300_replicate_8	TAGCAATGTTCACCGGGGTGGTGCCCGTCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_300_replicate_7	TAGCAATGTTCACCGGGGTGGTGCCCGTCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_300_replicate_6	TAGCAATGTTCACCGGGGTGGTGCCCGTCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_300_replicate_5	TAGCAATGTTCACCGGGGTGGTGCCCGTCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_300_replicate_4	TAGCAATGTTCACCGGGGTGGTGCCCGTCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_300_replicate_3	TAGCAATGTTCACCGGGGTGGTGCCCGTCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_300_replicate_2	TAGCAATGTTCACCGGGGTGGTGCCCGTCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_300_replicate_10	TAGCAATGTTCACCGGGGTGGTGCCCGTCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_300_replicate_1	TAGCAATGTTCACCGGGGTGGTGCCCGTCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_30_replicate_9	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_30_replicate_8	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_30_replicate_7	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_30_replicate_6	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_30_replicate_5	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_30_replicate_4	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_30_replicate_3	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_30_replicate_2	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_30_replicate_10	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_30_replicate_1	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_3_replicate_9	TAGCAATGAGCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_3_replicate_8	TAGCAATGAGCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_3_replicate_7	TAGCAATGAGCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_3_replicate_6	TAGCAATGAGCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_3_replicate_5	TAGCAATGAGCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_3_replicate_4	TAGCAATGAGCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_3_replicate_3	TAGCAATGAGCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_3_replicate_2	TAGCAATGAGCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_3_replicate_10	TAGCAATGAGCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_3_replicate_1	TAGCAATGAGCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_299_replicate_9	TAGCAATGTTCACCGGGGTGGTGCCCGGCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_299_replicate_8	TAGCAATGTTCACCGGGGTGGTGCCCGGCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_299_replicate_7	TAGCAATGTTCACCGGGGTGGTGCCCGGCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_299_replicate_6	TAGCAATGTTCACCGGGGTGGTGCCCGGCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_299_replicate_5	TAGCAATGTTCACCGGGGTGGTGCCCGGCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_299_replicate_4	TAGCAATGTTCACCGGGGTGGTGCCCGGCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_299_replicate_3	TAGCAATGTTCACCGGGGTGGTGCCCGGCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_299_replicate_2	TAGCAATGTTCACCGGGGTGGTGCCCGGCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_299_replicate_10	TAGCAATGTTCACCGGGGTGGTGCCCGGCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_299_replicate_1	TAGCAATGTTCACCGGGGTGGTGCCCGGCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_298_replicate_9	TAGCAATGTTCACCGGGGTGGTGCCCGCCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_298_replicate_8	TAGCAATGTTCACCGGGGTGGTGCCCGCCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_298_replicate_7	TAGCAATGTTCACCGGGGTGGTGCCCGCCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_298_replicate_6	TAGCAATGTTCACCGGGGTGGTGCCCGCCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_298_replicate_5	TAGCAATGTTCACCGGGGTGGTGCCCGCCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_298_replicate_4	TAGCAATGTTCACCGGGGTGGTGCCCGCCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_298_replicate_3	TAGCAATGTTCACCGGGGTGGTGCCCGCCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_298_replicate_2	TAGCAATGTTCACCGGGGTGGTGCCCGCCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_298_replicate_10	TAGCAATGTTCACCGGGGTGGTGCCCGCCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_298_replicate_1	TAGCAATGTTCACCGGGGTGGTGCCCGCCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_297_replicate_9	TAGCAATGTTCACCGGGGTGGTGCCCGACATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_297_replicate_8	TAGCAATGTTCACCGGGGTGGTGCCCGACATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_297_replicate_7	TAGCAATGTTCACCGGGGTGGTGCCCGACATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_297_replicate_6	TAGCAATGTTCACCGGGGTGGTGCCCGACATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_297_replicate_5	TAGCAATGTTCACCGGGGTGGTGCCCGACATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_297_replicate_4	TAGCAATGTTCACCGGGGTGGTGCCCGACATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_297_replicate_3	TAGCAATGTTCACCGGGGTGGTGCCCGACATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_297_replicate_2	TAGCAATGTTCACCGGGGTGGTGCCCGACATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_297_replicate_10	TAGCAATGTTCACCGGGGTGGTGCCCGACATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_297_replicate_1	TAGCAATGTTCACCGGGGTGGTGCCCGACATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_296_replicate_9	TAGCAATGTTCACCGGGGTGGTGCCCCTCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_296_replicate_8	TAGCAATGTTCACCGGGGTGGTGCCCCTCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_296_replicate_7	TAGCAATGTTCACCGGGGTGGTGCCCCTCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_296_replicate_6	TAGCAATGTTCACCGGGGTGGTGCCCCTCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_296_replicate_5	TAGCAATGTTCACCGGGGTGGTGCCCCTCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_296_replicate_4	TAGCAATGTTCACCGGGGTGGTGCCCCTCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_296_replicate_3	TAGCAATGTTCACCGGGGTGGTGCCCCTCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_296_replicate_2	TAGCAATGTTCACCGGGGTGGTGCCCCTCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_296_replicate_10	TAGCAATGTTCACCGGGGTGGTGCCCCTCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_296_replicate_1	TAGCAATGTTCACCGGGGTGGTGCCCCTCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_295_replicate_9	TAGCAATGTTCACCGGGGTGGTGCCCCGCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_295_replicate_8	TAGCAATGTTCACCGGGGTGGTGCCCCGCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_295_replicate_7	TAGCAATGTTCACCGGGGTGGTGCCCCGCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_295_replicate_6	TAGCAATGTTCACCGGGGTGGTGCCCCGCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_295_replicate_5	TAGCAATGTTCACCGGGGTGGTGCCCCGCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_295_replicate_4	TAGCAATGTTCACCGGGGTGGTGCCCCGCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_295_replicate_3	TAGCAATGTTCACCGGGGTGGTGCCCCGCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_295_replicate_2	TAGCAATGTTCACCGGGGTGGTGCCCCGCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_295_replicate_10	TAGCAATGTTCACCGGGGTGGTGCCCCGCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_295_replicate_1	TAGCAATGTTCACCGGGGTGGTGCCCCGCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_294_replicate_9	TAGCAATGTTCACCGGGGTGGTGCCCCCCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_294_replicate_8	TAGCAATGTTCACCGGGGTGGTGCCCCCCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_294_replicate_7	TAGCAATGTTCACCGGGGTGGTGCCCCCCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_294_replicate_6	TAGCAATGTTCACCGGGGTGGTGCCCCCCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_294_replicate_5	TAGCAATGTTCACCGGGGTGGTGCCCCCCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_294_replicate_4	TAGCAATGTTCACCGGGGTGGTGCCCCCCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_294_replicate_3	TAGCAATGTTCACCGGGGTGGTGCCCCCCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_294_replicate_2	TAGCAATGTTCACCGGGGTGGTGCCCCCCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_294_replicate_10	TAGCAATGTTCACCGGGGTGGTGCCCCCCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_294_replicate_1	TAGCAATGTTCACCGGGGTGGTGCCCCCCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_293_replicate_9	TAGCAATGTTCACCGGGGTGGTGCCCCACATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_293_replicate_8	TAGCAATGTTCACCGGGGTGGTGCCCCACATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_293_replicate_7	TAGCAATGTTCACCGGGGTGGTGCCCCACATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_293_replicate_6	TAGCAATGTTCACCGGGGTGGTGCCCCACATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_293_replicate_5	TAGCAATGTTCACCGGGGTGGTGCCCCACATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_293_replicate_4	TAGCAATGTTCACCGGGGTGGTGCCCCACATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_293_replicate_3	TAGCAATGTTCACCGGGGTGGTGCCCCACATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_293_replicate_2	TAGCAATGTTCACCGGGGTGGTGCCCCACATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_293_replicate_10	TAGCAATGTTCACCGGGGTGGTGCCCCACATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_293_replicate_1	TAGCAATGTTCACCGGGGTGGTGCCCCACATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_292_replicate_9	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_292_replicate_8	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_292_replicate_7	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_292_replicate_6	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_292_replicate_5	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_292_replicate_4	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_292_replicate_3	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_292_replicate_2	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_292_replicate_10	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_292_replicate_1	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_291_replicate_9	TAGCAATGTTCACCGGGGTGGTGCCCAGCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_291_replicate_8	TAGCAATGTTCACCGGGGTGGTGCCCAGCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_291_replicate_7	TAGCAATGTTCACCGGGGTGGTGCCCAGCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_291_replicate_6	TAGCAATGTTCACCGGGGTGGTGCCCAGCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_291_replicate_5	TAGCAATGTTCACCGGGGTGGTGCCCAGCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_291_replicate_4	TAGCAATGTTCACCGGGGTGGTGCCCAGCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_291_replicate_3	TAGCAATGTTCACCGGGGTGGTGCCCAGCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_291_replicate_2	TAGCAATGTTCACCGGGGTGGTGCCCAGCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_291_replicate_10	TAGCAATGTTCACCGGGGTGGTGCCCAGCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_291_replicate_1	TAGCAATGTTCACCGGGGTGGTGCCCAGCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_290_replicate_9	TAGCAATGTTCACCGGGGTGGTGCCCACCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_290_replicate_8	TAGCAATGTTCACCGGGGTGGTGCCCACCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_290_replicate_7	TAGCAATGTTCACCGGGGTGGTGCCCACCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_290_replicate_6	TAGCAATGTTCACCGGGGTGGTGCCCACCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_290_replicate_5	TAGCAATGTTCACCGGGGTGGTGCCCACCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_290_replicate_4	TAGCAATGTTCACCGGGGTGGTGCCCACCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_290_replicate_3	TAGCAATGTTCACCGGGGTGGTGCCCACCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_290_replicate_2	TAGCAATGTTCACCGGGGTGGTGCCCACCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_290_replicate_10	TAGCAATGTTCACCGGGGTGGTGCCCACCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_290_replicate_1	TAGCAATGTTCACCGGGGTGGTGCCCACCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_29_replicate_9	TAGCAATGTTAACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_29_replicate_8	TAGCAATGTTAACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_29_replicate_7	TAGCAATGTTAACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_29_replicate_6	TAGCAATGTTAACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_29_replicate_5	TAGCAATGTTAACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_29_replicate_4	TAGCAATGTTAACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_29_replicate_3	TAGCAATGTTAACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_29_replicate_2	TAGCAATGTTAACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_29_replicate_10	TAGCAATGTTAACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_29_replicate_1	TAGCAATGTTAACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_289_replicate_9	TAGCAATGTTCACCGGGGTGGTGCCCAACATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_289_replicate_8	TAGCAATGTTCACCGGGGTGGTGCCCAACATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_289_replicate_7	TAGCAATGTTCACCGGGGTGGTGCCCAACATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_289_replicate_6	TAGCAATGTTCACCGGGGTGGTGCCCAACATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_289_replicate_5	TAGCAATGTTCACCGGGGTGGTGCCCAACATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_289_replicate_4	TAGCAATGTTCACCGGGGTGGTGCCCAACATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_289_replicate_3	TAGCAATGTTCACCGGGGTGGTGCCCAACATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_289_replicate_2	TAGCAATGTTCACCGGGGTGGTGCCCAACATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_289_replicate_10	TAGCAATGTTCACCGGGGTGGTGCCCAACATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_289_replicate_1	TAGCAATGTTCACCGGGGTGGTGCCCAACATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_288_replicate_9	TAGCAATGTTCACCGGGGTGGTGCCTTTCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_288_replicate_8	TAGCAATGTTCACCGGGGTGGTGCCTTTCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_288_replicate_7	TAGCAATGTTCACCGGGGTGGTGCCTTTCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_288_replicate_6	TAGCAATGTTCACCGGGGTGGTGCCTTTCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_288_replicate_5	TAGCAATGTTCACCGGGGTGGTGCCTTTCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_288_replicate_4	TAGCAATGTTCACCGGGGTGGTGCCTTTCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_288_replicate_3	TAGCAATGTTCACCGGGGTGGTGCCTTTCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_288_replicate_2	TAGCAATGTTCACCGGGGTGGTGCCTTTCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_288_replicate_10	TAGCAATGTTCACCGGGGTGGTGCCTTTCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_288_replicate_1	TAGCAATGTTCACCGGGGTGGTGCCTTTCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_287_replicate_9	TAGCAATGTTCACCGGGGTGGTGCCTGTCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_287_replicate_8	TAGCAATGTTCACCGGGGTGGTGCCTGTCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_287_replicate_7	TAGCAATGTTCACCGGGGTGGTGCCTGTCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_287_replicate_6	TAGCAATGTTCACCGGGGTGGTGCCTGTCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_287_replicate_5	TAGCAATGTTCACCGGGGTGGTGCCTGTCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_287_replicate_4	TAGCAATGTTCACCGGGGTGGTGCCTGTCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_287_replicate_3	TAGCAATGTTCACCGGGGTGGTGCCTGTCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_287_replicate_2	TAGCAATGTTCACCGGGGTGGTGCCTGTCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_287_replicate_10	TAGCAATGTTCACCGGGGTGGTGCCTGTCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_287_replicate_1	TAGCAATGTTCACCGGGGTGGTGCCTGTCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_286_replicate_9	TAGCAATGTTCACCGGGGTGGTGCCTCTCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_286_replicate_8	TAGCAATGTTCACCGGGGTGGTGCCTCTCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_286_replicate_7	TAGCAATGTTCACCGGGGTGGTGCCTCTCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_286_replicate_6	TAGCAATGTTCACCGGGGTGGTGCCTCTCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_286_replicate_5	TAGCAATGTTCACCGGGGTGGTGCCTCTCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_286_replicate_4	TAGCAATGTTCACCGGGGTGGTGCCTCTCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_286_replicate_3	TAGCAATGTTCACCGGGGTGGTGCCTCTCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_286_replicate_2	TAGCAATGTTCACCGGGGTGGTGCCTCTCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_286_replicate_10	TAGCAATGTTCACCGGGGTGGTGCCTCTCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_286_replicate_1	TAGCAATGTTCACCGGGGTGGTGCCTCTCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_285_replicate_9	TAGCAATGTTCACCGGGGTGGTGCCTATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_285_replicate_8	TAGCAATGTTCACCGGGGTGGTGCCTATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_285_replicate_7	TAGCAATGTTCACCGGGGTGGTGCCTATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_285_replicate_6	TAGCAATGTTCACCGGGGTGGTGCCTATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_285_replicate_5	TAGCAATGTTCACCGGGGTGGTGCCTATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_285_replicate_4	TAGCAATGTTCACCGGGGTGGTGCCTATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_285_replicate_3	TAGCAATGTTCACCGGGGTGGTGCCTATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_285_replicate_2	TAGCAATGTTCACCGGGGTGGTGCCTATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_285_replicate_10	TAGCAATGTTCACCGGGGTGGTGCCTATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_285_replicate_1	TAGCAATGTTCACCGGGGTGGTGCCTATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_284_replicate_9	TAGCAATGTTCACCGGGGTGGTGCCGTTCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_284_replicate_8	TAGCAATGTTCACCGGGGTGGTGCCGTTCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_284_replicate_7	TAGCAATGTTCACCGGGGTGGTGCCGTTCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_284_replicate_6	TAGCAATGTTCACCGGGGTGGTGCCGTTCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_284_replicate_5	TAGCAATGTTCACCGGGGTGGTGCCGTTCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_284_replicate_4	TAGCAATGTTCACCGGGGTGGTGCCGTTCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_284_replicate_3	TAGCAATGTTCACCGGGGTGGTGCCGTTCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_284_replicate_2	TAGCAATGTTCACCGGGGTGGTGCCGTTCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_284_replicate_10	TAGCAATGTTCACCGGGGTGGTGCCGTTCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_284_replicate_1	TAGCAATGTTCACCGGGGTGGTGCCGTTCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_283_replicate_9	TAGCAATGTTCACCGGGGTGGTGCCGGTCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_283_replicate_8	TAGCAATGTTCACCGGGGTGGTGCCGGTCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_283_replicate_7	TAGCAATGTTCACCGGGGTGGTGCCGGTCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_283_replicate_6	TAGCAATGTTCACCGGGGTGGTGCCGGTCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_283_replicate_5	TAGCAATGTTCACCGGGGTGGTGCCGGTCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_283_replicate_4	TAGCAATGTTCACCGGGGTGGTGCCGGTCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_283_replicate_3	TAGCAATGTTCACCGGGGTGGTGCCGGTCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_283_replicate_2	TAGCAATGTTCACCGGGGTGGTGCCGGTCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_283_replicate_10	TAGCAATGTTCACCGGGGTGGTGCCGGTCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_283_replicate_1	TAGCAATGTTCACCGGGGTGGTGCCGGTCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_282_replicate_9	TAGCAATGTTCACCGGGGTGGTGCCGCTCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_282_replicate_8	TAGCAATGTTCACCGGGGTGGTGCCGCTCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_282_replicate_7	TAGCAATGTTCACCGGGGTGGTGCCGCTCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_282_replicate_6	TAGCAATGTTCACCGGGGTGGTGCCGCTCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_282_replicate_5	TAGCAATGTTCACCGGGGTGGTGCCGCTCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_282_replicate_4	TAGCAATGTTCACCGGGGTGGTGCCGCTCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_282_replicate_3	TAGCAATGTTCACCGGGGTGGTGCCGCTCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_282_replicate_2	TAGCAATGTTCACCGGGGTGGTGCCGCTCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_282_replicate_10	TAGCAATGTTCACCGGGGTGGTGCCGCTCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_282_replicate_1	TAGCAATGTTCACCGGGGTGGTGCCGCTCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_281_replicate_9	TAGCAATGTTCACCGGGGTGGTGCCGATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_281_replicate_8	TAGCAATGTTCACCGGGGTGGTGCCGATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_281_replicate_7	TAGCAATGTTCACCGGGGTGGTGCCGATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_281_replicate_6	TAGCAATGTTCACCGGGGTGGTGCCGATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_281_replicate_5	TAGCAATGTTCACCGGGGTGGTGCCGATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_281_replicate_4	TAGCAATGTTCACCGGGGTGGTGCCGATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_281_replicate_3	TAGCAATGTTCACCGGGGTGGTGCCGATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_281_replicate_2	TAGCAATGTTCACCGGGGTGGTGCCGATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_281_replicate_10	TAGCAATGTTCACCGGGGTGGTGCCGATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_281_replicate_1	TAGCAATGTTCACCGGGGTGGTGCCGATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_280_replicate_9	TAGCAATGTTCACCGGGGTGGTGCCCTTCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_280_replicate_8	TAGCAATGTTCACCGGGGTGGTGCCCTTCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_280_replicate_7	TAGCAATGTTCACCGGGGTGGTGCCCTTCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_280_replicate_6	TAGCAATGTTCACCGGGGTGGTGCCCTTCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_280_replicate_5	TAGCAATGTTCACCGGGGTGGTGCCCTTCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_280_replicate_4	TAGCAATGTTCACCGGGGTGGTGCCCTTCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_280_replicate_3	TAGCAATGTTCACCGGGGTGGTGCCCTTCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_280_replicate_2	TAGCAATGTTCACCGGGGTGGTGCCCTTCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_280_replicate_10	TAGCAATGTTCACCGGGGTGGTGCCCTTCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_280_replicate_1	TAGCAATGTTCACCGGGGTGGTGCCCTTCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_28_replicate_9	TAGCAATGTGTACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_28_replicate_8	TAGCAATGTGTACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_28_replicate_7	TAGCAATGTGTACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_28_replicate_6	TAGCAATGTGTACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_28_replicate_5	TAGCAATGTGTACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_28_replicate_4	TAGCAATGTGTACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_28_replicate_3	TAGCAATGTGTACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_28_replicate_2	TAGCAATGTGTACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_28_replicate_10	TAGCAATGTGTACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_28_replicate_1	TAGCAATGTGTACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_279_replicate_9	TAGCAATGTTCACCGGGGTGGTGCCCGTCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_279_replicate_8	TAGCAATGTTCACCGGGGTGGTGCCCGTCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_279_replicate_7	TAGCAATGTTCACCGGGGTGGTGCCCGTCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_279_replicate_6	TAGCAATGTTCACCGGGGTGGTGCCCGTCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_279_replicate_5	TAGCAATGTTCACCGGGGTGGTGCCCGTCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_279_replicate_4	TAGCAATGTTCACCGGGGTGGTGCCCGTCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_279_replicate_3	TAGCAATGTTCACCGGGGTGGTGCCCGTCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_279_replicate_2	TAGCAATGTTCACCGGGGTGGTGCCCGTCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_279_replicate_10	TAGCAATGTTCACCGGGGTGGTGCCCGTCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_279_replicate_1	TAGCAATGTTCACCGGGGTGGTGCCCGTCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_278_replicate_9	TAGCAATGTTCACCGGGGTGGTGCCCCTCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_278_replicate_8	TAGCAATGTTCACCGGGGTGGTGCCCCTCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_278_replicate_7	TAGCAATGTTCACCGGGGTGGTGCCCCTCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_278_replicate_6	TAGCAATGTTCACCGGGGTGGTGCCCCTCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_278_replicate_5	TAGCAATGTTCACCGGGGTGGTGCCCCTCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_278_replicate_4	TAGCAATGTTCACCGGGGTGGTGCCCCTCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_278_replicate_3	TAGCAATGTTCACCGGGGTGGTGCCCCTCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_278_replicate_2	TAGCAATGTTCACCGGGGTGGTGCCCCTCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_278_replicate_10	TAGCAATGTTCACCGGGGTGGTGCCCCTCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_278_replicate_1	TAGCAATGTTCACCGGGGTGGTGCCCCTCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_277_replicate_9	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_277_replicate_8	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_277_replicate_7	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_277_replicate_6	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_277_replicate_5	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_277_replicate_4	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_277_replicate_3	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_277_replicate_2	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_277_replicate_10	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_277_replicate_1	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_276_replicate_9	TAGCAATGTTCACCGGGGTGGTGCCATTCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_276_replicate_8	TAGCAATGTTCACCGGGGTGGTGCCATTCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_276_replicate_7	TAGCAATGTTCACCGGGGTGGTGCCATTCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_276_replicate_6	TAGCAATGTTCACCGGGGTGGTGCCATTCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_276_replicate_5	TAGCAATGTTCACCGGGGTGGTGCCATTCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_276_replicate_4	TAGCAATGTTCACCGGGGTGGTGCCATTCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_276_replicate_3	TAGCAATGTTCACCGGGGTGGTGCCATTCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_276_replicate_2	TAGCAATGTTCACCGGGGTGGTGCCATTCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_276_replicate_10	TAGCAATGTTCACCGGGGTGGTGCCATTCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_276_replicate_1	TAGCAATGTTCACCGGGGTGGTGCCATTCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_275_replicate_9	TAGCAATGTTCACCGGGGTGGTGCCAGTCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_275_replicate_8	TAGCAATGTTCACCGGGGTGGTGCCAGTCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_275_replicate_7	TAGCAATGTTCACCGGGGTGGTGCCAGTCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_275_replicate_6	TAGCAATGTTCACCGGGGTGGTGCCAGTCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_275_replicate_5	TAGCAATGTTCACCGGGGTGGTGCCAGTCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_275_replicate_4	TAGCAATGTTCACCGGGGTGGTGCCAGTCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_275_replicate_3	TAGCAATGTTCACCGGGGTGGTGCCAGTCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_275_replicate_2	TAGCAATGTTCACCGGGGTGGTGCCAGTCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_275_replicate_10	TAGCAATGTTCACCGGGGTGGTGCCAGTCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_275_replicate_1	TAGCAATGTTCACCGGGGTGGTGCCAGTCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_274_replicate_9	TAGCAATGTTCACCGGGGTGGTGCCACTCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_274_replicate_8	TAGCAATGTTCACCGGGGTGGTGCCACTCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_274_replicate_7	TAGCAATGTTCACCGGGGTGGTGCCACTCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_274_replicate_6	TAGCAATGTTCACCGGGGTGGTGCCACTCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_274_replicate_5	TAGCAATGTTCACCGGGGTGGTGCCACTCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_274_replicate_4	TAGCAATGTTCACCGGGGTGGTGCCACTCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_274_replicate_3	TAGCAATGTTCACCGGGGTGGTGCCACTCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_274_replicate_2	TAGCAATGTTCACCGGGGTGGTGCCACTCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_274_replicate_10	TAGCAATGTTCACCGGGGTGGTGCCACTCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_274_replicate_1	TAGCAATGTTCACCGGGGTGGTGCCACTCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_273_replicate_9	TAGCAATGTTCACCGGGGTGGTGCCAATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_273_replicate_8	TAGCAATGTTCACCGGGGTGGTGCCAATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_273_replicate_7	TAGCAATGTTCACCGGGGTGGTGCCAATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_273_replicate_6	TAGCAATGTTCACCGGGGTGGTGCCAATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_273_replicate_5	TAGCAATGTTCACCGGGGTGGTGCCAATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_273_replicate_4	TAGCAATGTTCACCGGGGTGGTGCCAATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_273_replicate_3	TAGCAATGTTCACCGGGGTGGTGCCAATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_273_replicate_2	TAGCAATGTTCACCGGGGTGGTGCCAATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_273_replicate_10	TAGCAATGTTCACCGGGGTGGTGCCAATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_273_replicate_1	TAGCAATGTTCACCGGGGTGGTGCCAATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_272_replicate_9	TAGCAATGTTCACCGGGGTGGTGCTTATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_272_replicate_8	TAGCAATGTTCACCGGGGTGGTGCTTATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_272_replicate_7	TAGCAATGTTCACCGGGGTGGTGCTTATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_272_replicate_6	TAGCAATGTTCACCGGGGTGGTGCTTATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_272_replicate_5	TAGCAATGTTCACCGGGGTGGTGCTTATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_272_replicate_4	TAGCAATGTTCACCGGGGTGGTGCTTATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_272_replicate_3	TAGCAATGTTCACCGGGGTGGTGCTTATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_272_replicate_2	TAGCAATGTTCACCGGGGTGGTGCTTATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_272_replicate_10	TAGCAATGTTCACCGGGGTGGTGCTTATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_272_replicate_1	TAGCAATGTTCACCGGGGTGGTGCTTATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_271_replicate_9	TAGCAATGTTCACCGGGGTGGTGCTGATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_271_replicate_8	TAGCAATGTTCACCGGGGTGGTGCTGATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_271_replicate_7	TAGCAATGTTCACCGGGGTGGTGCTGATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_271_replicate_6	TAGCAATGTTCACCGGGGTGGTGCTGATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_271_replicate_5	TAGCAATGTTCACCGGGGTGGTGCTGATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_271_replicate_4	TAGCAATGTTCACCGGGGTGGTGCTGATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_271_replicate_3	TAGCAATGTTCACCGGGGTGGTGCTGATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_271_replicate_2	TAGCAATGTTCACCGGGGTGGTGCTGATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_271_replicate_10	TAGCAATGTTCACCGGGGTGGTGCTGATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_271_replicate_1	TAGCAATGTTCACCGGGGTGGTGCTGATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_270_replicate_9	TAGCAATGTTCACCGGGGTGGTGCTCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_270_replicate_8	TAGCAATGTTCACCGGGGTGGTGCTCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_270_replicate_7	TAGCAATGTTCACCGGGGTGGTGCTCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_270_replicate_6	TAGCAATGTTCACCGGGGTGGTGCTCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_270_replicate_5	TAGCAATGTTCACCGGGGTGGTGCTCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_270_replicate_4	TAGCAATGTTCACCGGGGTGGTGCTCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_270_replicate_3	TAGCAATGTTCACCGGGGTGGTGCTCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_270_replicate_2	TAGCAATGTTCACCGGGGTGGTGCTCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_270_replicate_10	TAGCAATGTTCACCGGGGTGGTGCTCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_270_replicate_1	TAGCAATGTTCACCGGGGTGGTGCTCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_27_replicate_9	TAGCAATGTGGACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_27_replicate_8	TAGCAATGTGGACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_27_replicate_7	TAGCAATGTGGACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_27_replicate_6	TAGCAATGTGGACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_27_replicate_5	TAGCAATGTGGACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_27_replicate_4	TAGCAATGTGGACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_27_replicate_3	TAGCAATGTGGACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_27_replicate_2	TAGCAATGTGGACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_27_replicate_10	TAGCAATGTGGACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_27_replicate_1	TAGCAATGTGGACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_269_replicate_9	TAGCAATGTTCACCGGGGTGGTGCTAATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_269_replicate_8	TAGCAATGTTCACCGGGGTGGTGCTAATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_269_replicate_7	TAGCAATGTTCACCGGGGTGGTGCTAATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_269_replicate_6	TAGCAATGTTCACCGGGGTGGTGCTAATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_269_replicate_5	TAGCAATGTTCACCGGGGTGGTGCTAATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_269_replicate_4	TAGCAATGTTCACCGGGGTGGTGCTAATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_269_replicate_3	TAGCAATGTTCACCGGGGTGGTGCTAATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_269_replicate_2	TAGCAATGTTCACCGGGGTGGTGCTAATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_269_replicate_10	TAGCAATGTTCACCGGGGTGGTGCTAATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_269_replicate_1	TAGCAATGTTCACCGGGGTGGTGCTAATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_268_replicate_9	TAGCAATGTTCACCGGGGTGGTGCGTATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_268_replicate_8	TAGCAATGTTCACCGGGGTGGTGCGTATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_268_replicate_7	TAGCAATGTTCACCGGGGTGGTGCGTATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_268_replicate_6	TAGCAATGTTCACCGGGGTGGTGCGTATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_268_replicate_5	TAGCAATGTTCACCGGGGTGGTGCGTATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_268_replicate_4	TAGCAATGTTCACCGGGGTGGTGCGTATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_268_replicate_3	TAGCAATGTTCACCGGGGTGGTGCGTATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_268_replicate_2	TAGCAATGTTCACCGGGGTGGTGCGTATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_268_replicate_10	TAGCAATGTTCACCGGGGTGGTGCGTATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_268_replicate_1	TAGCAATGTTCACCGGGGTGGTGCGTATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_267_replicate_9	TAGCAATGTTCACCGGGGTGGTGCGGATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_267_replicate_8	TAGCAATGTTCACCGGGGTGGTGCGGATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_267_replicate_7	TAGCAATGTTCACCGGGGTGGTGCGGATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_267_replicate_6	TAGCAATGTTCACCGGGGTGGTGCGGATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_267_replicate_5	TAGCAATGTTCACCGGGGTGGTGCGGATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_267_replicate_4	TAGCAATGTTCACCGGGGTGGTGCGGATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_267_replicate_3	TAGCAATGTTCACCGGGGTGGTGCGGATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_267_replicate_2	TAGCAATGTTCACCGGGGTGGTGCGGATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_267_replicate_10	TAGCAATGTTCACCGGGGTGGTGCGGATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_267_replicate_1	TAGCAATGTTCACCGGGGTGGTGCGGATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_266_replicate_9	TAGCAATGTTCACCGGGGTGGTGCGCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_266_replicate_8	TAGCAATGTTCACCGGGGTGGTGCGCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_266_replicate_7	TAGCAATGTTCACCGGGGTGGTGCGCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_266_replicate_6	TAGCAATGTTCACCGGGGTGGTGCGCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_266_replicate_5	TAGCAATGTTCACCGGGGTGGTGCGCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_266_replicate_4	TAGCAATGTTCACCGGGGTGGTGCGCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_266_replicate_3	TAGCAATGTTCACCGGGGTGGTGCGCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_266_replicate_2	TAGCAATGTTCACCGGGGTGGTGCGCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_266_replicate_10	TAGCAATGTTCACCGGGGTGGTGCGCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_266_replicate_1	TAGCAATGTTCACCGGGGTGGTGCGCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_265_replicate_9	TAGCAATGTTCACCGGGGTGGTGCGAATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_265_replicate_8	TAGCAATGTTCACCGGGGTGGTGCGAATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_265_replicate_7	TAGCAATGTTCACCGGGGTGGTGCGAATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_265_replicate_6	TAGCAATGTTCACCGGGGTGGTGCGAATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_265_replicate_5	TAGCAATGTTCACCGGGGTGGTGCGAATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_265_replicate_4	TAGCAATGTTCACCGGGGTGGTGCGAATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_265_replicate_3	TAGCAATGTTCACCGGGGTGGTGCGAATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_265_replicate_2	TAGCAATGTTCACCGGGGTGGTGCGAATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_265_replicate_10	TAGCAATGTTCACCGGGGTGGTGCGAATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_265_replicate_1	TAGCAATGTTCACCGGGGTGGTGCGAATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_264_replicate_9	TAGCAATGTTCACCGGGGTGGTGCCTATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_264_replicate_8	TAGCAATGTTCACCGGGGTGGTGCCTATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_264_replicate_7	TAGCAATGTTCACCGGGGTGGTGCCTATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_264_replicate_6	TAGCAATGTTCACCGGGGTGGTGCCTATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_264_replicate_5	TAGCAATGTTCACCGGGGTGGTGCCTATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_264_replicate_4	TAGCAATGTTCACCGGGGTGGTGCCTATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_264_replicate_3	TAGCAATGTTCACCGGGGTGGTGCCTATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_264_replicate_2	TAGCAATGTTCACCGGGGTGGTGCCTATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_264_replicate_10	TAGCAATGTTCACCGGGGTGGTGCCTATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_264_replicate_1	TAGCAATGTTCACCGGGGTGGTGCCTATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_263_replicate_9	TAGCAATGTTCACCGGGGTGGTGCCGATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_263_replicate_8	TAGCAATGTTCACCGGGGTGGTGCCGATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_263_replicate_7	TAGCAATGTTCACCGGGGTGGTGCCGATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_263_replicate_6	TAGCAATGTTCACCGGGGTGGTGCCGATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_263_replicate_5	TAGCAATGTTCACCGGGGTGGTGCCGATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_263_replicate_4	TAGCAATGTTCACCGGGGTGGTGCCGATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_263_replicate_3	TAGCAATGTTCACCGGGGTGGTGCCGATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_263_replicate_2	TAGCAATGTTCACCGGGGTGGTGCCGATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_263_replicate_10	TAGCAATGTTCACCGGGGTGGTGCCGATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_263_replicate_1	TAGCAATGTTCACCGGGGTGGTGCCGATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_262_replicate_9	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_262_replicate_8	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_262_replicate_7	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_262_replicate_6	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_262_replicate_5	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_262_replicate_4	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_262_replicate_3	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_262_replicate_2	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_262_replicate_10	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_262_replicate_1	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_261_replicate_9	TAGCAATGTTCACCGGGGTGGTGCCAATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_261_replicate_8	TAGCAATGTTCACCGGGGTGGTGCCAATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_261_replicate_7	TAGCAATGTTCACCGGGGTGGTGCCAATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_261_replicate_6	TAGCAATGTTCACCGGGGTGGTGCCAATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_261_replicate_5	TAGCAATGTTCACCGGGGTGGTGCCAATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_261_replicate_4	TAGCAATGTTCACCGGGGTGGTGCCAATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_261_replicate_3	TAGCAATGTTCACCGGGGTGGTGCCAATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_261_replicate_2	TAGCAATGTTCACCGGGGTGGTGCCAATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_261_replicate_10	TAGCAATGTTCACCGGGGTGGTGCCAATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_261_replicate_1	TAGCAATGTTCACCGGGGTGGTGCCAATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_260_replicate_9	TAGCAATGTTCACCGGGGTGGTGCATATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_260_replicate_8	TAGCAATGTTCACCGGGGTGGTGCATATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_260_replicate_7	TAGCAATGTTCACCGGGGTGGTGCATATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_260_replicate_6	TAGCAATGTTCACCGGGGTGGTGCATATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_260_replicate_5	TAGCAATGTTCACCGGGGTGGTGCATATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_260_replicate_4	TAGCAATGTTCACCGGGGTGGTGCATATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_260_replicate_3	TAGCAATGTTCACCGGGGTGGTGCATATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_260_replicate_2	TAGCAATGTTCACCGGGGTGGTGCATATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_260_replicate_10	TAGCAATGTTCACCGGGGTGGTGCATATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_260_replicate_1	TAGCAATGTTCACCGGGGTGGTGCATATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_26_replicate_9	TAGCAATGTGCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_26_replicate_8	TAGCAATGTGCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_26_replicate_7	TAGCAATGTGCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_26_replicate_6	TAGCAATGTGCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_26_replicate_5	TAGCAATGTGCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_26_replicate_4	TAGCAATGTGCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_26_replicate_3	TAGCAATGTGCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_26_replicate_2	TAGCAATGTGCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_26_replicate_10	TAGCAATGTGCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_26_replicate_1	TAGCAATGTGCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_259_replicate_9	TAGCAATGTTCACCGGGGTGGTGCAGATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_259_replicate_8	TAGCAATGTTCACCGGGGTGGTGCAGATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_259_replicate_7	TAGCAATGTTCACCGGGGTGGTGCAGATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_259_replicate_6	TAGCAATGTTCACCGGGGTGGTGCAGATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_259_replicate_5	TAGCAATGTTCACCGGGGTGGTGCAGATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_259_replicate_4	TAGCAATGTTCACCGGGGTGGTGCAGATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_259_replicate_3	TAGCAATGTTCACCGGGGTGGTGCAGATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_259_replicate_2	TAGCAATGTTCACCGGGGTGGTGCAGATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_259_replicate_10	TAGCAATGTTCACCGGGGTGGTGCAGATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_259_replicate_1	TAGCAATGTTCACCGGGGTGGTGCAGATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_258_replicate_9	TAGCAATGTTCACCGGGGTGGTGCACATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_258_replicate_8	TAGCAATGTTCACCGGGGTGGTGCACATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_258_replicate_7	TAGCAATGTTCACCGGGGTGGTGCACATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_258_replicate_6	TAGCAATGTTCACCGGGGTGGTGCACATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_258_replicate_5	TAGCAATGTTCACCGGGGTGGTGCACATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_258_replicate_4	TAGCAATGTTCACCGGGGTGGTGCACATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_258_replicate_3	TAGCAATGTTCACCGGGGTGGTGCACATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_258_replicate_2	TAGCAATGTTCACCGGGGTGGTGCACATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_258_replicate_10	TAGCAATGTTCACCGGGGTGGTGCACATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_258_replicate_1	TAGCAATGTTCACCGGGGTGGTGCACATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_257_replicate_9	TAGCAATGTTCACCGGGGTGGTGCAAATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_257_replicate_8	TAGCAATGTTCACCGGGGTGGTGCAAATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_257_replicate_7	TAGCAATGTTCACCGGGGTGGTGCAAATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_257_replicate_6	TAGCAATGTTCACCGGGGTGGTGCAAATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_257_replicate_5	TAGCAATGTTCACCGGGGTGGTGCAAATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_257_replicate_4	TAGCAATGTTCACCGGGGTGGTGCAAATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_257_replicate_3	TAGCAATGTTCACCGGGGTGGTGCAAATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_257_replicate_2	TAGCAATGTTCACCGGGGTGGTGCAAATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_257_replicate_10	TAGCAATGTTCACCGGGGTGGTGCAAATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_257_replicate_1	TAGCAATGTTCACCGGGGTGGTGCAAATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_256_replicate_9	TAGCAATGTTCACCGGGGTGGTGTTCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_256_replicate_8	TAGCAATGTTCACCGGGGTGGTGTTCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_256_replicate_7	TAGCAATGTTCACCGGGGTGGTGTTCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_256_replicate_6	TAGCAATGTTCACCGGGGTGGTGTTCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_256_replicate_5	TAGCAATGTTCACCGGGGTGGTGTTCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_256_replicate_4	TAGCAATGTTCACCGGGGTGGTGTTCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_256_replicate_3	TAGCAATGTTCACCGGGGTGGTGTTCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_256_replicate_2	TAGCAATGTTCACCGGGGTGGTGTTCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_256_replicate_10	TAGCAATGTTCACCGGGGTGGTGTTCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_256_replicate_1	TAGCAATGTTCACCGGGGTGGTGTTCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_255_replicate_9	TAGCAATGTTCACCGGGGTGGTGTGCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_255_replicate_8	TAGCAATGTTCACCGGGGTGGTGTGCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_255_replicate_7	TAGCAATGTTCACCGGGGTGGTGTGCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_255_replicate_6	TAGCAATGTTCACCGGGGTGGTGTGCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_255_replicate_5	TAGCAATGTTCACCGGGGTGGTGTGCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_255_replicate_4	TAGCAATGTTCACCGGGGTGGTGTGCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_255_replicate_3	TAGCAATGTTCACCGGGGTGGTGTGCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_255_replicate_2	TAGCAATGTTCACCGGGGTGGTGTGCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_255_replicate_10	TAGCAATGTTCACCGGGGTGGTGTGCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_255_replicate_1	TAGCAATGTTCACCGGGGTGGTGTGCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_254_replicate_9	TAGCAATGTTCACCGGGGTGGTGTCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_254_replicate_8	TAGCAATGTTCACCGGGGTGGTGTCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_254_replicate_7	TAGCAATGTTCACCGGGGTGGTGTCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_254_replicate_6	TAGCAATGTTCACCGGGGTGGTGTCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_254_replicate_5	TAGCAATGTTCACCGGGGTGGTGTCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_254_replicate_4	TAGCAATGTTCACCGGGGTGGTGTCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_254_replicate_3	TAGCAATGTTCACCGGGGTGGTGTCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_254_replicate_2	TAGCAATGTTCACCGGGGTGGTGTCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_254_replicate_10	TAGCAATGTTCACCGGGGTGGTGTCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_254_replicate_1	TAGCAATGTTCACCGGGGTGGTGTCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_253_replicate_9	TAGCAATGTTCACCGGGGTGGTGTACATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_253_replicate_8	TAGCAATGTTCACCGGGGTGGTGTACATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_253_replicate_7	TAGCAATGTTCACCGGGGTGGTGTACATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_253_replicate_6	TAGCAATGTTCACCGGGGTGGTGTACATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_253_replicate_5	TAGCAATGTTCACCGGGGTGGTGTACATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_253_replicate_4	TAGCAATGTTCACCGGGGTGGTGTACATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_253_replicate_3	TAGCAATGTTCACCGGGGTGGTGTACATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_253_replicate_2	TAGCAATGTTCACCGGGGTGGTGTACATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_253_replicate_10	TAGCAATGTTCACCGGGGTGGTGTACATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_253_replicate_1	TAGCAATGTTCACCGGGGTGGTGTACATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_252_replicate_9	TAGCAATGTTCACCGGGGTGGTGGTCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_252_replicate_8	TAGCAATGTTCACCGGGGTGGTGGTCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_252_replicate_7	TAGCAATGTTCACCGGGGTGGTGGTCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_252_replicate_6	TAGCAATGTTCACCGGGGTGGTGGTCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_252_replicate_5	TAGCAATGTTCACCGGGGTGGTGGTCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_252_replicate_4	TAGCAATGTTCACCGGGGTGGTGGTCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_252_replicate_3	TAGCAATGTTCACCGGGGTGGTGGTCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_252_replicate_2	TAGCAATGTTCACCGGGGTGGTGGTCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_252_replicate_10	TAGCAATGTTCACCGGGGTGGTGGTCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_252_replicate_1	TAGCAATGTTCACCGGGGTGGTGGTCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_251_replicate_9	TAGCAATGTTCACCGGGGTGGTGGGCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_251_replicate_8	TAGCAATGTTCACCGGGGTGGTGGGCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_251_replicate_7	TAGCAATGTTCACCGGGGTGGTGGGCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_251_replicate_6	TAGCAATGTTCACCGGGGTGGTGGGCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_251_replicate_5	TAGCAATGTTCACCGGGGTGGTGGGCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_251_replicate_4	TAGCAATGTTCACCGGGGTGGTGGGCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_251_replicate_3	TAGCAATGTTCACCGGGGTGGTGGGCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_251_replicate_2	TAGCAATGTTCACCGGGGTGGTGGGCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_251_replicate_10	TAGCAATGTTCACCGGGGTGGTGGGCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_251_replicate_1	TAGCAATGTTCACCGGGGTGGTGGGCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_250_replicate_9	TAGCAATGTTCACCGGGGTGGTGGCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_250_replicate_8	TAGCAATGTTCACCGGGGTGGTGGCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_250_replicate_7	TAGCAATGTTCACCGGGGTGGTGGCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_250_replicate_6	TAGCAATGTTCACCGGGGTGGTGGCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_250_replicate_5	TAGCAATGTTCACCGGGGTGGTGGCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_250_replicate_4	TAGCAATGTTCACCGGGGTGGTGGCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_250_replicate_3	TAGCAATGTTCACCGGGGTGGTGGCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_250_replicate_2	TAGCAATGTTCACCGGGGTGGTGGCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_250_replicate_10	TAGCAATGTTCACCGGGGTGGTGGCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_250_replicate_1	TAGCAATGTTCACCGGGGTGGTGGCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_25_replicate_9	TAGCAATGTGAACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_25_replicate_8	TAGCAATGTGAACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_25_replicate_7	TAGCAATGTGAACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_25_replicate_6	TAGCAATGTGAACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_25_replicate_5	TAGCAATGTGAACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_25_replicate_4	TAGCAATGTGAACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_25_replicate_3	TAGCAATGTGAACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_25_replicate_2	TAGCAATGTGAACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_25_replicate_10	TAGCAATGTGAACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_25_replicate_1	TAGCAATGTGAACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_249_replicate_9	TAGCAATGTTCACCGGGGTGGTGGACATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_249_replicate_8	TAGCAATGTTCACCGGGGTGGTGGACATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_249_replicate_7	TAGCAATGTTCACCGGGGTGGTGGACATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_249_replicate_6	TAGCAATGTTCACCGGGGTGGTGGACATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_249_replicate_5	TAGCAATGTTCACCGGGGTGGTGGACATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_249_replicate_4	TAGCAATGTTCACCGGGGTGGTGGACATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_249_replicate_3	TAGCAATGTTCACCGGGGTGGTGGACATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_249_replicate_2	TAGCAATGTTCACCGGGGTGGTGGACATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_249_replicate_10	TAGCAATGTTCACCGGGGTGGTGGACATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_249_replicate_1	TAGCAATGTTCACCGGGGTGGTGGACATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_248_replicate_9	TAGCAATGTTCACCGGGGTGGTGCTCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_248_replicate_8	TAGCAATGTTCACCGGGGTGGTGCTCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_248_replicate_7	TAGCAATGTTCACCGGGGTGGTGCTCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_248_replicate_6	TAGCAATGTTCACCGGGGTGGTGCTCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_248_replicate_5	TAGCAATGTTCACCGGGGTGGTGCTCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_248_replicate_4	TAGCAATGTTCACCGGGGTGGTGCTCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_248_replicate_3	TAGCAATGTTCACCGGGGTGGTGCTCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_248_replicate_2	TAGCAATGTTCACCGGGGTGGTGCTCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_248_replicate_10	TAGCAATGTTCACCGGGGTGGTGCTCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_248_replicate_1	TAGCAATGTTCACCGGGGTGGTGCTCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_247_replicate_9	TAGCAATGTTCACCGGGGTGGTGCGCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_247_replicate_8	TAGCAATGTTCACCGGGGTGGTGCGCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_247_replicate_7	TAGCAATGTTCACCGGGGTGGTGCGCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_247_replicate_6	TAGCAATGTTCACCGGGGTGGTGCGCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_247_replicate_5	TAGCAATGTTCACCGGGGTGGTGCGCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_247_replicate_4	TAGCAATGTTCACCGGGGTGGTGCGCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_247_replicate_3	TAGCAATGTTCACCGGGGTGGTGCGCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_247_replicate_2	TAGCAATGTTCACCGGGGTGGTGCGCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_247_replicate_10	TAGCAATGTTCACCGGGGTGGTGCGCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_247_replicate_1	TAGCAATGTTCACCGGGGTGGTGCGCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_246_replicate_9	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_246_replicate_8	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_246_replicate_7	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_246_replicate_6	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_246_replicate_5	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_246_replicate_4	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_246_replicate_3	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_246_replicate_2	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_246_replicate_10	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_246_replicate_1	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_245_replicate_9	TAGCAATGTTCACCGGGGTGGTGCACATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_245_replicate_8	TAGCAATGTTCACCGGGGTGGTGCACATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_245_replicate_7	TAGCAATGTTCACCGGGGTGGTGCACATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_245_replicate_6	TAGCAATGTTCACCGGGGTGGTGCACATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_245_replicate_5	TAGCAATGTTCACCGGGGTGGTGCACATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_245_replicate_4	TAGCAATGTTCACCGGGGTGGTGCACATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_245_replicate_3	TAGCAATGTTCACCGGGGTGGTGCACATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_245_replicate_2	TAGCAATGTTCACCGGGGTGGTGCACATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_245_replicate_10	TAGCAATGTTCACCGGGGTGGTGCACATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_245_replicate_1	TAGCAATGTTCACCGGGGTGGTGCACATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_244_replicate_9	TAGCAATGTTCACCGGGGTGGTGATCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_244_replicate_8	TAGCAATGTTCACCGGGGTGGTGATCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_244_replicate_7	TAGCAATGTTCACCGGGGTGGTGATCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_244_replicate_6	TAGCAATGTTCACCGGGGTGGTGATCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_244_replicate_5	TAGCAATGTTCACCGGGGTGGTGATCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_244_replicate_4	TAGCAATGTTCACCGGGGTGGTGATCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_244_replicate_3	TAGCAATGTTCACCGGGGTGGTGATCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_244_replicate_2	TAGCAATGTTCACCGGGGTGGTGATCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_244_replicate_10	TAGCAATGTTCACCGGGGTGGTGATCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_244_replicate_1	TAGCAATGTTCACCGGGGTGGTGATCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_243_replicate_9	TAGCAATGTTCACCGGGGTGGTGAGCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_243_replicate_8	TAGCAATGTTCACCGGGGTGGTGAGCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_243_replicate_7	TAGCAATGTTCACCGGGGTGGTGAGCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_243_replicate_6	TAGCAATGTTCACCGGGGTGGTGAGCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_243_replicate_5	TAGCAATGTTCACCGGGGTGGTGAGCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_243_replicate_4	TAGCAATGTTCACCGGGGTGGTGAGCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_243_replicate_3	TAGCAATGTTCACCGGGGTGGTGAGCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_243_replicate_2	TAGCAATGTTCACCGGGGTGGTGAGCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_243_replicate_10	TAGCAATGTTCACCGGGGTGGTGAGCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_243_replicate_1	TAGCAATGTTCACCGGGGTGGTGAGCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_242_replicate_9	TAGCAATGTTCACCGGGGTGGTGACCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_242_replicate_8	TAGCAATGTTCACCGGGGTGGTGACCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_242_replicate_7	TAGCAATGTTCACCGGGGTGGTGACCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_242_replicate_6	TAGCAATGTTCACCGGGGTGGTGACCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_242_replicate_5	TAGCAATGTTCACCGGGGTGGTGACCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_242_replicate_4	TAGCAATGTTCACCGGGGTGGTGACCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_242_replicate_3	TAGCAATGTTCACCGGGGTGGTGACCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_242_replicate_2	TAGCAATGTTCACCGGGGTGGTGACCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_242_replicate_10	TAGCAATGTTCACCGGGGTGGTGACCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_242_replicate_1	TAGCAATGTTCACCGGGGTGGTGACCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_241_replicate_9	TAGCAATGTTCACCGGGGTGGTGAACATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_241_replicate_8	TAGCAATGTTCACCGGGGTGGTGAACATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_241_replicate_7	TAGCAATGTTCACCGGGGTGGTGAACATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_241_replicate_6	TAGCAATGTTCACCGGGGTGGTGAACATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_241_replicate_5	TAGCAATGTTCACCGGGGTGGTGAACATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_241_replicate_4	TAGCAATGTTCACCGGGGTGGTGAACATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_241_replicate_3	TAGCAATGTTCACCGGGGTGGTGAACATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_241_replicate_2	TAGCAATGTTCACCGGGGTGGTGAACATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_241_replicate_10	TAGCAATGTTCACCGGGGTGGTGAACATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_241_replicate_1	TAGCAATGTTCACCGGGGTGGTGAACATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_240_replicate_9	TAGCAATGTTCACCGGGGTGGTTTCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_240_replicate_8	TAGCAATGTTCACCGGGGTGGTTTCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_240_replicate_7	TAGCAATGTTCACCGGGGTGGTTTCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_240_replicate_6	TAGCAATGTTCACCGGGGTGGTTTCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_240_replicate_5	TAGCAATGTTCACCGGGGTGGTTTCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_240_replicate_4	TAGCAATGTTCACCGGGGTGGTTTCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_240_replicate_3	TAGCAATGTTCACCGGGGTGGTTTCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_240_replicate_2	TAGCAATGTTCACCGGGGTGGTTTCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_240_replicate_10	TAGCAATGTTCACCGGGGTGGTTTCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_240_replicate_1	TAGCAATGTTCACCGGGGTGGTTTCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_24_replicate_9	TAGCAATGTCTACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_24_replicate_8	TAGCAATGTCTACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_24_replicate_7	TAGCAATGTCTACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_24_replicate_6	TAGCAATGTCTACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_24_replicate_5	TAGCAATGTCTACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_24_replicate_4	TAGCAATGTCTACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_24_replicate_3	TAGCAATGTCTACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_24_replicate_2	TAGCAATGTCTACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_24_replicate_10	TAGCAATGTCTACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_24_replicate_1	TAGCAATGTCTACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_239_replicate_9	TAGCAATGTTCACCGGGGTGGTTGCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_239_replicate_8	TAGCAATGTTCACCGGGGTGGTTGCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_239_replicate_7	TAGCAATGTTCACCGGGGTGGTTGCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_239_replicate_6	TAGCAATGTTCACCGGGGTGGTTGCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_239_replicate_5	TAGCAATGTTCACCGGGGTGGTTGCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_239_replicate_4	TAGCAATGTTCACCGGGGTGGTTGCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_239_replicate_3	TAGCAATGTTCACCGGGGTGGTTGCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_239_replicate_2	TAGCAATGTTCACCGGGGTGGTTGCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_239_replicate_10	TAGCAATGTTCACCGGGGTGGTTGCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_239_replicate_1	TAGCAATGTTCACCGGGGTGGTTGCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_238_replicate_9	TAGCAATGTTCACCGGGGTGGTTCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_238_replicate_8	TAGCAATGTTCACCGGGGTGGTTCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_238_replicate_7	TAGCAATGTTCACCGGGGTGGTTCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_238_replicate_6	TAGCAATGTTCACCGGGGTGGTTCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_238_replicate_5	TAGCAATGTTCACCGGGGTGGTTCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_238_replicate_4	TAGCAATGTTCACCGGGGTGGTTCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_238_replicate_3	TAGCAATGTTCACCGGGGTGGTTCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_238_replicate_2	TAGCAATGTTCACCGGGGTGGTTCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_238_replicate_10	TAGCAATGTTCACCGGGGTGGTTCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_238_replicate_1	TAGCAATGTTCACCGGGGTGGTTCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_237_replicate_9	TAGCAATGTTCACCGGGGTGGTTACCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_237_replicate_8	TAGCAATGTTCACCGGGGTGGTTACCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_237_replicate_7	TAGCAATGTTCACCGGGGTGGTTACCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_237_replicate_6	TAGCAATGTTCACCGGGGTGGTTACCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_237_replicate_5	TAGCAATGTTCACCGGGGTGGTTACCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_237_replicate_4	TAGCAATGTTCACCGGGGTGGTTACCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_237_replicate_3	TAGCAATGTTCACCGGGGTGGTTACCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_237_replicate_2	TAGCAATGTTCACCGGGGTGGTTACCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_237_replicate_10	TAGCAATGTTCACCGGGGTGGTTACCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_237_replicate_1	TAGCAATGTTCACCGGGGTGGTTACCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_236_replicate_9	TAGCAATGTTCACCGGGGTGGTGTCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_236_replicate_8	TAGCAATGTTCACCGGGGTGGTGTCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_236_replicate_7	TAGCAATGTTCACCGGGGTGGTGTCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_236_replicate_6	TAGCAATGTTCACCGGGGTGGTGTCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_236_replicate_5	TAGCAATGTTCACCGGGGTGGTGTCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_236_replicate_4	TAGCAATGTTCACCGGGGTGGTGTCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_236_replicate_3	TAGCAATGTTCACCGGGGTGGTGTCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_236_replicate_2	TAGCAATGTTCACCGGGGTGGTGTCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_236_replicate_10	TAGCAATGTTCACCGGGGTGGTGTCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_236_replicate_1	TAGCAATGTTCACCGGGGTGGTGTCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_235_replicate_9	TAGCAATGTTCACCGGGGTGGTGGCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_235_replicate_8	TAGCAATGTTCACCGGGGTGGTGGCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_235_replicate_7	TAGCAATGTTCACCGGGGTGGTGGCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_235_replicate_6	TAGCAATGTTCACCGGGGTGGTGGCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_235_replicate_5	TAGCAATGTTCACCGGGGTGGTGGCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_235_replicate_4	TAGCAATGTTCACCGGGGTGGTGGCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_235_replicate_3	TAGCAATGTTCACCGGGGTGGTGGCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_235_replicate_2	TAGCAATGTTCACCGGGGTGGTGGCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_235_replicate_10	TAGCAATGTTCACCGGGGTGGTGGCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_235_replicate_1	TAGCAATGTTCACCGGGGTGGTGGCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_234_replicate_9	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_234_replicate_8	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_234_replicate_7	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_234_replicate_6	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_234_replicate_5	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_234_replicate_4	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_234_replicate_3	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_234_replicate_2	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_234_replicate_10	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_234_replicate_1	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_233_replicate_9	TAGCAATGTTCACCGGGGTGGTGACCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_233_replicate_8	TAGCAATGTTCACCGGGGTGGTGACCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_233_replicate_7	TAGCAATGTTCACCGGGGTGGTGACCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_233_replicate_6	TAGCAATGTTCACCGGGGTGGTGACCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_233_replicate_5	TAGCAATGTTCACCGGGGTGGTGACCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_233_replicate_4	TAGCAATGTTCACCGGGGTGGTGACCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_233_replicate_3	TAGCAATGTTCACCGGGGTGGTGACCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_233_replicate_2	TAGCAATGTTCACCGGGGTGGTGACCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_233_replicate_10	TAGCAATGTTCACCGGGGTGGTGACCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_233_replicate_1	TAGCAATGTTCACCGGGGTGGTGACCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_232_replicate_9	TAGCAATGTTCACCGGGGTGGTCTCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_232_replicate_8	TAGCAATGTTCACCGGGGTGGTCTCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_232_replicate_7	TAGCAATGTTCACCGGGGTGGTCTCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_232_replicate_6	TAGCAATGTTCACCGGGGTGGTCTCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_232_replicate_5	TAGCAATGTTCACCGGGGTGGTCTCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_232_replicate_4	TAGCAATGTTCACCGGGGTGGTCTCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_232_replicate_3	TAGCAATGTTCACCGGGGTGGTCTCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_232_replicate_2	TAGCAATGTTCACCGGGGTGGTCTCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_232_replicate_10	TAGCAATGTTCACCGGGGTGGTCTCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_232_replicate_1	TAGCAATGTTCACCGGGGTGGTCTCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_231_replicate_9	TAGCAATGTTCACCGGGGTGGTCGCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_231_replicate_8	TAGCAATGTTCACCGGGGTGGTCGCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_231_replicate_7	TAGCAATGTTCACCGGGGTGGTCGCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_231_replicate_6	TAGCAATGTTCACCGGGGTGGTCGCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_231_replicate_5	TAGCAATGTTCACCGGGGTGGTCGCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_231_replicate_4	TAGCAATGTTCACCGGGGTGGTCGCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_231_replicate_3	TAGCAATGTTCACCGGGGTGGTCGCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_231_replicate_2	TAGCAATGTTCACCGGGGTGGTCGCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_231_replicate_10	TAGCAATGTTCACCGGGGTGGTCGCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_231_replicate_1	TAGCAATGTTCACCGGGGTGGTCGCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_230_replicate_9	TAGCAATGTTCACCGGGGTGGTCCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_230_replicate_8	TAGCAATGTTCACCGGGGTGGTCCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_230_replicate_7	TAGCAATGTTCACCGGGGTGGTCCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_230_replicate_6	TAGCAATGTTCACCGGGGTGGTCCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_230_replicate_5	TAGCAATGTTCACCGGGGTGGTCCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_230_replicate_4	TAGCAATGTTCACCGGGGTGGTCCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_230_replicate_3	TAGCAATGTTCACCGGGGTGGTCCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_230_replicate_2	TAGCAATGTTCACCGGGGTGGTCCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_230_replicate_10	TAGCAATGTTCACCGGGGTGGTCCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_230_replicate_1	TAGCAATGTTCACCGGGGTGGTCCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_23_replicate_9	TAGCAATGTCGACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_23_replicate_8	TAGCAATGTCGACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_23_replicate_7	TAGCAATGTCGACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_23_replicate_6	TAGCAATGTCGACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_23_replicate_5	TAGCAATGTCGACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_23_replicate_4	TAGCAATGTCGACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_23_replicate_3	TAGCAATGTCGACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_23_replicate_2	TAGCAATGTCGACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_23_replicate_10	TAGCAATGTCGACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_23_replicate_1	TAGCAATGTCGACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_229_replicate_9	TAGCAATGTTCACCGGGGTGGTCACCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_229_replicate_8	TAGCAATGTTCACCGGGGTGGTCACCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_229_replicate_7	TAGCAATGTTCACCGGGGTGGTCACCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_229_replicate_6	TAGCAATGTTCACCGGGGTGGTCACCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_229_replicate_5	TAGCAATGTTCACCGGGGTGGTCACCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_229_replicate_4	TAGCAATGTTCACCGGGGTGGTCACCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_229_replicate_3	TAGCAATGTTCACCGGGGTGGTCACCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_229_replicate_2	TAGCAATGTTCACCGGGGTGGTCACCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_229_replicate_10	TAGCAATGTTCACCGGGGTGGTCACCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_229_replicate_1	TAGCAATGTTCACCGGGGTGGTCACCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_228_replicate_9	TAGCAATGTTCACCGGGGTGGTATCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_228_replicate_8	TAGCAATGTTCACCGGGGTGGTATCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_228_replicate_7	TAGCAATGTTCACCGGGGTGGTATCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_228_replicate_6	TAGCAATGTTCACCGGGGTGGTATCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_228_replicate_5	TAGCAATGTTCACCGGGGTGGTATCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_228_replicate_4	TAGCAATGTTCACCGGGGTGGTATCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_228_replicate_3	TAGCAATGTTCACCGGGGTGGTATCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_228_replicate_2	TAGCAATGTTCACCGGGGTGGTATCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_228_replicate_10	TAGCAATGTTCACCGGGGTGGTATCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_228_replicate_1	TAGCAATGTTCACCGGGGTGGTATCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_227_replicate_9	TAGCAATGTTCACCGGGGTGGTAGCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_227_replicate_8	TAGCAATGTTCACCGGGGTGGTAGCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_227_replicate_7	TAGCAATGTTCACCGGGGTGGTAGCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_227_replicate_6	TAGCAATGTTCACCGGGGTGGTAGCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_227_replicate_5	TAGCAATGTTCACCGGGGTGGTAGCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_227_replicate_4	TAGCAATGTTCACCGGGGTGGTAGCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_227_replicate_3	TAGCAATGTTCACCGGGGTGGTAGCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_227_replicate_2	TAGCAATGTTCACCGGGGTGGTAGCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_227_replicate_10	TAGCAATGTTCACCGGGGTGGTAGCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_227_replicate_1	TAGCAATGTTCACCGGGGTGGTAGCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_226_replicate_9	TAGCAATGTTCACCGGGGTGGTACCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_226_replicate_8	TAGCAATGTTCACCGGGGTGGTACCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_226_replicate_7	TAGCAATGTTCACCGGGGTGGTACCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_226_replicate_6	TAGCAATGTTCACCGGGGTGGTACCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_226_replicate_5	TAGCAATGTTCACCGGGGTGGTACCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_226_replicate_4	TAGCAATGTTCACCGGGGTGGTACCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_226_replicate_3	TAGCAATGTTCACCGGGGTGGTACCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_226_replicate_2	TAGCAATGTTCACCGGGGTGGTACCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_226_replicate_10	TAGCAATGTTCACCGGGGTGGTACCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_226_replicate_1	TAGCAATGTTCACCGGGGTGGTACCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_225_replicate_9	TAGCAATGTTCACCGGGGTGGTAACCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_225_replicate_8	TAGCAATGTTCACCGGGGTGGTAACCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_225_replicate_7	TAGCAATGTTCACCGGGGTGGTAACCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_225_replicate_6	TAGCAATGTTCACCGGGGTGGTAACCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_225_replicate_5	TAGCAATGTTCACCGGGGTGGTAACCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_225_replicate_4	TAGCAATGTTCACCGGGGTGGTAACCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_225_replicate_3	TAGCAATGTTCACCGGGGTGGTAACCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_225_replicate_2	TAGCAATGTTCACCGGGGTGGTAACCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_225_replicate_10	TAGCAATGTTCACCGGGGTGGTAACCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_225_replicate_1	TAGCAATGTTCACCGGGGTGGTAACCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_224_replicate_9	TAGCAATGTTCACCGGGGTGGTTCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_224_replicate_8	TAGCAATGTTCACCGGGGTGGTTCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_224_replicate_7	TAGCAATGTTCACCGGGGTGGTTCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_224_replicate_6	TAGCAATGTTCACCGGGGTGGTTCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_224_replicate_5	TAGCAATGTTCACCGGGGTGGTTCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_224_replicate_4	TAGCAATGTTCACCGGGGTGGTTCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_224_replicate_3	TAGCAATGTTCACCGGGGTGGTTCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_224_replicate_2	TAGCAATGTTCACCGGGGTGGTTCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_224_replicate_10	TAGCAATGTTCACCGGGGTGGTTCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_224_replicate_1	TAGCAATGTTCACCGGGGTGGTTCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_223_replicate_9	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_223_replicate_8	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_223_replicate_7	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_223_replicate_6	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_223_replicate_5	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_223_replicate_4	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_223_replicate_3	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_223_replicate_2	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_223_replicate_10	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_223_replicate_1	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_222_replicate_9	TAGCAATGTTCACCGGGGTGGTCCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_222_replicate_8	TAGCAATGTTCACCGGGGTGGTCCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_222_replicate_7	TAGCAATGTTCACCGGGGTGGTCCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_222_replicate_6	TAGCAATGTTCACCGGGGTGGTCCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_222_replicate_5	TAGCAATGTTCACCGGGGTGGTCCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_222_replicate_4	TAGCAATGTTCACCGGGGTGGTCCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_222_replicate_3	TAGCAATGTTCACCGGGGTGGTCCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_222_replicate_2	TAGCAATGTTCACCGGGGTGGTCCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_222_replicate_10	TAGCAATGTTCACCGGGGTGGTCCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_222_replicate_1	TAGCAATGTTCACCGGGGTGGTCCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_221_replicate_9	TAGCAATGTTCACCGGGGTGGTACCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_221_replicate_8	TAGCAATGTTCACCGGGGTGGTACCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_221_replicate_7	TAGCAATGTTCACCGGGGTGGTACCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_221_replicate_6	TAGCAATGTTCACCGGGGTGGTACCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_221_replicate_5	TAGCAATGTTCACCGGGGTGGTACCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_221_replicate_4	TAGCAATGTTCACCGGGGTGGTACCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_221_replicate_3	TAGCAATGTTCACCGGGGTGGTACCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_221_replicate_2	TAGCAATGTTCACCGGGGTGGTACCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_221_replicate_10	TAGCAATGTTCACCGGGGTGGTACCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_221_replicate_1	TAGCAATGTTCACCGGGGTGGTACCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_220_replicate_9	TAGCAATGTTCACCGGGGTGGGTCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_220_replicate_8	TAGCAATGTTCACCGGGGTGGGTCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_220_replicate_7	TAGCAATGTTCACCGGGGTGGGTCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_220_replicate_6	TAGCAATGTTCACCGGGGTGGGTCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_220_replicate_5	TAGCAATGTTCACCGGGGTGGGTCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_220_replicate_4	TAGCAATGTTCACCGGGGTGGGTCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_220_replicate_3	TAGCAATGTTCACCGGGGTGGGTCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_220_replicate_2	TAGCAATGTTCACCGGGGTGGGTCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_220_replicate_10	TAGCAATGTTCACCGGGGTGGGTCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_220_replicate_1	TAGCAATGTTCACCGGGGTGGGTCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_22_replicate_9	TAGCAATGTCCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_22_replicate_8	TAGCAATGTCCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_22_replicate_7	TAGCAATGTCCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_22_replicate_6	TAGCAATGTCCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_22_replicate_5	TAGCAATGTCCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_22_replicate_4	TAGCAATGTCCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_22_replicate_3	TAGCAATGTCCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_22_replicate_2	TAGCAATGTCCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_22_replicate_10	TAGCAATGTCCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_22_replicate_1	TAGCAATGTCCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_219_replicate_9	TAGCAATGTTCACCGGGGTGGGGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_219_replicate_8	TAGCAATGTTCACCGGGGTGGGGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_219_replicate_7	TAGCAATGTTCACCGGGGTGGGGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_219_replicate_6	TAGCAATGTTCACCGGGGTGGGGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_219_replicate_5	TAGCAATGTTCACCGGGGTGGGGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_219_replicate_4	TAGCAATGTTCACCGGGGTGGGGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_219_replicate_3	TAGCAATGTTCACCGGGGTGGGGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_219_replicate_2	TAGCAATGTTCACCGGGGTGGGGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_219_replicate_10	TAGCAATGTTCACCGGGGTGGGGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_219_replicate_1	TAGCAATGTTCACCGGGGTGGGGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_218_replicate_9	TAGCAATGTTCACCGGGGTGGGCCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_218_replicate_8	TAGCAATGTTCACCGGGGTGGGCCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_218_replicate_7	TAGCAATGTTCACCGGGGTGGGCCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_218_replicate_6	TAGCAATGTTCACCGGGGTGGGCCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_218_replicate_5	TAGCAATGTTCACCGGGGTGGGCCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_218_replicate_4	TAGCAATGTTCACCGGGGTGGGCCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_218_replicate_3	TAGCAATGTTCACCGGGGTGGGCCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_218_replicate_2	TAGCAATGTTCACCGGGGTGGGCCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_218_replicate_10	TAGCAATGTTCACCGGGGTGGGCCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_218_replicate_1	TAGCAATGTTCACCGGGGTGGGCCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_217_replicate_9	TAGCAATGTTCACCGGGGTGGGACCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_217_replicate_8	TAGCAATGTTCACCGGGGTGGGACCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_217_replicate_7	TAGCAATGTTCACCGGGGTGGGACCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_217_replicate_6	TAGCAATGTTCACCGGGGTGGGACCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_217_replicate_5	TAGCAATGTTCACCGGGGTGGGACCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_217_replicate_4	TAGCAATGTTCACCGGGGTGGGACCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_217_replicate_3	TAGCAATGTTCACCGGGGTGGGACCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_217_replicate_2	TAGCAATGTTCACCGGGGTGGGACCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_217_replicate_10	TAGCAATGTTCACCGGGGTGGGACCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_217_replicate_1	TAGCAATGTTCACCGGGGTGGGACCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_216_replicate_9	TAGCAATGTTCACCGGGGTGGCTCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_216_replicate_8	TAGCAATGTTCACCGGGGTGGCTCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_216_replicate_7	TAGCAATGTTCACCGGGGTGGCTCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_216_replicate_6	TAGCAATGTTCACCGGGGTGGCTCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_216_replicate_5	TAGCAATGTTCACCGGGGTGGCTCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_216_replicate_4	TAGCAATGTTCACCGGGGTGGCTCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_216_replicate_3	TAGCAATGTTCACCGGGGTGGCTCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_216_replicate_2	TAGCAATGTTCACCGGGGTGGCTCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_216_replicate_10	TAGCAATGTTCACCGGGGTGGCTCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_216_replicate_1	TAGCAATGTTCACCGGGGTGGCTCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_215_replicate_9	TAGCAATGTTCACCGGGGTGGCGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_215_replicate_8	TAGCAATGTTCACCGGGGTGGCGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_215_replicate_7	TAGCAATGTTCACCGGGGTGGCGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_215_replicate_6	TAGCAATGTTCACCGGGGTGGCGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_215_replicate_5	TAGCAATGTTCACCGGGGTGGCGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_215_replicate_4	TAGCAATGTTCACCGGGGTGGCGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_215_replicate_3	TAGCAATGTTCACCGGGGTGGCGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_215_replicate_2	TAGCAATGTTCACCGGGGTGGCGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_215_replicate_10	TAGCAATGTTCACCGGGGTGGCGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_215_replicate_1	TAGCAATGTTCACCGGGGTGGCGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_214_replicate_9	TAGCAATGTTCACCGGGGTGGCCCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_214_replicate_8	TAGCAATGTTCACCGGGGTGGCCCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_214_replicate_7	TAGCAATGTTCACCGGGGTGGCCCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_214_replicate_6	TAGCAATGTTCACCGGGGTGGCCCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_214_replicate_5	TAGCAATGTTCACCGGGGTGGCCCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_214_replicate_4	TAGCAATGTTCACCGGGGTGGCCCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_214_replicate_3	TAGCAATGTTCACCGGGGTGGCCCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_214_replicate_2	TAGCAATGTTCACCGGGGTGGCCCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_214_replicate_10	TAGCAATGTTCACCGGGGTGGCCCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_214_replicate_1	TAGCAATGTTCACCGGGGTGGCCCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_213_replicate_9	TAGCAATGTTCACCGGGGTGGCACCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_213_replicate_8	TAGCAATGTTCACCGGGGTGGCACCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_213_replicate_7	TAGCAATGTTCACCGGGGTGGCACCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_213_replicate_6	TAGCAATGTTCACCGGGGTGGCACCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_213_replicate_5	TAGCAATGTTCACCGGGGTGGCACCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_213_replicate_4	TAGCAATGTTCACCGGGGTGGCACCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_213_replicate_3	TAGCAATGTTCACCGGGGTGGCACCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_213_replicate_2	TAGCAATGTTCACCGGGGTGGCACCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_213_replicate_10	TAGCAATGTTCACCGGGGTGGCACCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_213_replicate_1	TAGCAATGTTCACCGGGGTGGCACCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_212_replicate_9	TAGCAATGTTCACCGGGGTGGATCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_212_replicate_8	TAGCAATGTTCACCGGGGTGGATCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_212_replicate_7	TAGCAATGTTCACCGGGGTGGATCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_212_replicate_6	TAGCAATGTTCACCGGGGTGGATCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_212_replicate_5	TAGCAATGTTCACCGGGGTGGATCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_212_replicate_4	TAGCAATGTTCACCGGGGTGGATCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_212_replicate_3	TAGCAATGTTCACCGGGGTGGATCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_212_replicate_2	TAGCAATGTTCACCGGGGTGGATCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_212_replicate_10	TAGCAATGTTCACCGGGGTGGATCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_212_replicate_1	TAGCAATGTTCACCGGGGTGGATCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_211_replicate_9	TAGCAATGTTCACCGGGGTGGAGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_211_replicate_8	TAGCAATGTTCACCGGGGTGGAGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_211_replicate_7	TAGCAATGTTCACCGGGGTGGAGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_211_replicate_6	TAGCAATGTTCACCGGGGTGGAGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_211_replicate_5	TAGCAATGTTCACCGGGGTGGAGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_211_replicate_4	TAGCAATGTTCACCGGGGTGGAGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_211_replicate_3	TAGCAATGTTCACCGGGGTGGAGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_211_replicate_2	TAGCAATGTTCACCGGGGTGGAGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_211_replicate_10	TAGCAATGTTCACCGGGGTGGAGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_211_replicate_1	TAGCAATGTTCACCGGGGTGGAGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_210_replicate_9	TAGCAATGTTCACCGGGGTGGACCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_210_replicate_8	TAGCAATGTTCACCGGGGTGGACCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_210_replicate_7	TAGCAATGTTCACCGGGGTGGACCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_210_replicate_6	TAGCAATGTTCACCGGGGTGGACCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_210_replicate_5	TAGCAATGTTCACCGGGGTGGACCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_210_replicate_4	TAGCAATGTTCACCGGGGTGGACCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_210_replicate_3	TAGCAATGTTCACCGGGGTGGACCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_210_replicate_2	TAGCAATGTTCACCGGGGTGGACCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_210_replicate_10	TAGCAATGTTCACCGGGGTGGACCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_210_replicate_1	TAGCAATGTTCACCGGGGTGGACCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_21_replicate_9	TAGCAATGTCAACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_21_replicate_8	TAGCAATGTCAACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_21_replicate_7	TAGCAATGTCAACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_21_replicate_6	TAGCAATGTCAACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_21_replicate_5	TAGCAATGTCAACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_21_replicate_4	TAGCAATGTCAACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_21_replicate_3	TAGCAATGTCAACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_21_replicate_2	TAGCAATGTCAACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_21_replicate_10	TAGCAATGTCAACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_21_replicate_1	TAGCAATGTCAACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_209_replicate_9	TAGCAATGTTCACCGGGGTGGAACCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_209_replicate_8	TAGCAATGTTCACCGGGGTGGAACCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_209_replicate_7	TAGCAATGTTCACCGGGGTGGAACCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_209_replicate_6	TAGCAATGTTCACCGGGGTGGAACCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_209_replicate_5	TAGCAATGTTCACCGGGGTGGAACCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_209_replicate_4	TAGCAATGTTCACCGGGGTGGAACCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_209_replicate_3	TAGCAATGTTCACCGGGGTGGAACCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_209_replicate_2	TAGCAATGTTCACCGGGGTGGAACCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_209_replicate_10	TAGCAATGTTCACCGGGGTGGAACCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_209_replicate_1	TAGCAATGTTCACCGGGGTGGAACCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_208_replicate_9	TAGCAATGTTCACCGGGGTGTTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_208_replicate_8	TAGCAATGTTCACCGGGGTGTTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_208_replicate_7	TAGCAATGTTCACCGGGGTGTTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_208_replicate_6	TAGCAATGTTCACCGGGGTGTTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_208_replicate_5	TAGCAATGTTCACCGGGGTGTTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_208_replicate_4	TAGCAATGTTCACCGGGGTGTTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_208_replicate_3	TAGCAATGTTCACCGGGGTGTTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_208_replicate_2	TAGCAATGTTCACCGGGGTGTTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_208_replicate_10	TAGCAATGTTCACCGGGGTGTTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_208_replicate_1	TAGCAATGTTCACCGGGGTGTTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_207_replicate_9	TAGCAATGTTCACCGGGGTGTGGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_207_replicate_8	TAGCAATGTTCACCGGGGTGTGGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_207_replicate_7	TAGCAATGTTCACCGGGGTGTGGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_207_replicate_6	TAGCAATGTTCACCGGGGTGTGGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_207_replicate_5	TAGCAATGTTCACCGGGGTGTGGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_207_replicate_4	TAGCAATGTTCACCGGGGTGTGGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_207_replicate_3	TAGCAATGTTCACCGGGGTGTGGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_207_replicate_2	TAGCAATGTTCACCGGGGTGTGGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_207_replicate_10	TAGCAATGTTCACCGGGGTGTGGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_207_replicate_1	TAGCAATGTTCACCGGGGTGTGGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_206_replicate_9	TAGCAATGTTCACCGGGGTGTCGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_206_replicate_8	TAGCAATGTTCACCGGGGTGTCGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_206_replicate_7	TAGCAATGTTCACCGGGGTGTCGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_206_replicate_6	TAGCAATGTTCACCGGGGTGTCGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_206_replicate_5	TAGCAATGTTCACCGGGGTGTCGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_206_replicate_4	TAGCAATGTTCACCGGGGTGTCGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_206_replicate_3	TAGCAATGTTCACCGGGGTGTCGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_206_replicate_2	TAGCAATGTTCACCGGGGTGTCGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_206_replicate_10	TAGCAATGTTCACCGGGGTGTCGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_206_replicate_1	TAGCAATGTTCACCGGGGTGTCGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_205_replicate_9	TAGCAATGTTCACCGGGGTGTAGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_205_replicate_8	TAGCAATGTTCACCGGGGTGTAGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_205_replicate_7	TAGCAATGTTCACCGGGGTGTAGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_205_replicate_6	TAGCAATGTTCACCGGGGTGTAGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_205_replicate_5	TAGCAATGTTCACCGGGGTGTAGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_205_replicate_4	TAGCAATGTTCACCGGGGTGTAGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_205_replicate_3	TAGCAATGTTCACCGGGGTGTAGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_205_replicate_2	TAGCAATGTTCACCGGGGTGTAGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_205_replicate_10	TAGCAATGTTCACCGGGGTGTAGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_205_replicate_1	TAGCAATGTTCACCGGGGTGTAGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_204_replicate_9	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_204_replicate_8	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_204_replicate_7	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_204_replicate_6	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_204_replicate_5	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_204_replicate_4	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_204_replicate_3	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_204_replicate_2	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_204_replicate_10	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_204_replicate_1	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_203_replicate_9	TAGCAATGTTCACCGGGGTGGGGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_203_replicate_8	TAGCAATGTTCACCGGGGTGGGGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_203_replicate_7	TAGCAATGTTCACCGGGGTGGGGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_203_replicate_6	TAGCAATGTTCACCGGGGTGGGGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_203_replicate_5	TAGCAATGTTCACCGGGGTGGGGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_203_replicate_4	TAGCAATGTTCACCGGGGTGGGGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_203_replicate_3	TAGCAATGTTCACCGGGGTGGGGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_203_replicate_2	TAGCAATGTTCACCGGGGTGGGGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_203_replicate_10	TAGCAATGTTCACCGGGGTGGGGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_203_replicate_1	TAGCAATGTTCACCGGGGTGGGGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_202_replicate_9	TAGCAATGTTCACCGGGGTGGCGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_202_replicate_8	TAGCAATGTTCACCGGGGTGGCGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_202_replicate_7	TAGCAATGTTCACCGGGGTGGCGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_202_replicate_6	TAGCAATGTTCACCGGGGTGGCGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_202_replicate_5	TAGCAATGTTCACCGGGGTGGCGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_202_replicate_4	TAGCAATGTTCACCGGGGTGGCGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_202_replicate_3	TAGCAATGTTCACCGGGGTGGCGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_202_replicate_2	TAGCAATGTTCACCGGGGTGGCGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_202_replicate_10	TAGCAATGTTCACCGGGGTGGCGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_202_replicate_1	TAGCAATGTTCACCGGGGTGGCGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_201_replicate_9	TAGCAATGTTCACCGGGGTGGAGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_201_replicate_8	TAGCAATGTTCACCGGGGTGGAGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_201_replicate_7	TAGCAATGTTCACCGGGGTGGAGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_201_replicate_6	TAGCAATGTTCACCGGGGTGGAGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_201_replicate_5	TAGCAATGTTCACCGGGGTGGAGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_201_replicate_4	TAGCAATGTTCACCGGGGTGGAGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_201_replicate_3	TAGCAATGTTCACCGGGGTGGAGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_201_replicate_2	TAGCAATGTTCACCGGGGTGGAGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_201_replicate_10	TAGCAATGTTCACCGGGGTGGAGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_201_replicate_1	TAGCAATGTTCACCGGGGTGGAGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_200_replicate_9	TAGCAATGTTCACCGGGGTGCTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_200_replicate_8	TAGCAATGTTCACCGGGGTGCTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_200_replicate_7	TAGCAATGTTCACCGGGGTGCTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_200_replicate_6	TAGCAATGTTCACCGGGGTGCTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_200_replicate_5	TAGCAATGTTCACCGGGGTGCTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_200_replicate_4	TAGCAATGTTCACCGGGGTGCTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_200_replicate_3	TAGCAATGTTCACCGGGGTGCTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_200_replicate_2	TAGCAATGTTCACCGGGGTGCTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_200_replicate_10	TAGCAATGTTCACCGGGGTGCTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_200_replicate_1	TAGCAATGTTCACCGGGGTGCTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_20_replicate_9	TAGCAATGTATACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_20_replicate_8	TAGCAATGTATACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_20_replicate_7	TAGCAATGTATACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_20_replicate_6	TAGCAATGTATACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_20_replicate_5	TAGCAATGTATACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_20_replicate_4	TAGCAATGTATACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_20_replicate_3	TAGCAATGTATACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_20_replicate_2	TAGCAATGTATACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_20_replicate_10	TAGCAATGTATACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_20_replicate_1	TAGCAATGTATACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_2_replicate_9	TAGCAATGACCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_2_replicate_8	TAGCAATGACCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_2_replicate_7	TAGCAATGACCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_2_replicate_6	TAGCAATGACCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_2_replicate_5	TAGCAATGACCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_2_replicate_4	TAGCAATGACCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_2_replicate_3	TAGCAATGACCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_2_replicate_2	TAGCAATGACCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_2_replicate_10	TAGCAATGACCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_2_replicate_1	TAGCAATGACCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_199_replicate_9	TAGCAATGTTCACCGGGGTGCGGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_199_replicate_8	TAGCAATGTTCACCGGGGTGCGGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_199_replicate_7	TAGCAATGTTCACCGGGGTGCGGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_199_replicate_6	TAGCAATGTTCACCGGGGTGCGGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_199_replicate_5	TAGCAATGTTCACCGGGGTGCGGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_199_replicate_4	TAGCAATGTTCACCGGGGTGCGGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_199_replicate_3	TAGCAATGTTCACCGGGGTGCGGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_199_replicate_2	TAGCAATGTTCACCGGGGTGCGGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_199_replicate_10	TAGCAATGTTCACCGGGGTGCGGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_199_replicate_1	TAGCAATGTTCACCGGGGTGCGGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_198_replicate_9	TAGCAATGTTCACCGGGGTGCCGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_198_replicate_8	TAGCAATGTTCACCGGGGTGCCGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_198_replicate_7	TAGCAATGTTCACCGGGGTGCCGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_198_replicate_6	TAGCAATGTTCACCGGGGTGCCGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_198_replicate_5	TAGCAATGTTCACCGGGGTGCCGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_198_replicate_4	TAGCAATGTTCACCGGGGTGCCGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_198_replicate_3	TAGCAATGTTCACCGGGGTGCCGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_198_replicate_2	TAGCAATGTTCACCGGGGTGCCGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_198_replicate_10	TAGCAATGTTCACCGGGGTGCCGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_198_replicate_1	TAGCAATGTTCACCGGGGTGCCGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_197_replicate_9	TAGCAATGTTCACCGGGGTGCAGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_197_replicate_8	TAGCAATGTTCACCGGGGTGCAGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_197_replicate_7	TAGCAATGTTCACCGGGGTGCAGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_197_replicate_6	TAGCAATGTTCACCGGGGTGCAGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_197_replicate_5	TAGCAATGTTCACCGGGGTGCAGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_197_replicate_4	TAGCAATGTTCACCGGGGTGCAGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_197_replicate_3	TAGCAATGTTCACCGGGGTGCAGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_197_replicate_2	TAGCAATGTTCACCGGGGTGCAGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_197_replicate_10	TAGCAATGTTCACCGGGGTGCAGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_197_replicate_1	TAGCAATGTTCACCGGGGTGCAGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_196_replicate_9	TAGCAATGTTCACCGGGGTGATGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_196_replicate_8	TAGCAATGTTCACCGGGGTGATGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_196_replicate_7	TAGCAATGTTCACCGGGGTGATGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_196_replicate_6	TAGCAATGTTCACCGGGGTGATGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_196_replicate_5	TAGCAATGTTCACCGGGGTGATGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_196_replicate_4	TAGCAATGTTCACCGGGGTGATGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_196_replicate_3	TAGCAATGTTCACCGGGGTGATGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_196_replicate_2	TAGCAATGTTCACCGGGGTGATGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_196_replicate_10	TAGCAATGTTCACCGGGGTGATGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_196_replicate_1	TAGCAATGTTCACCGGGGTGATGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_195_replicate_9	TAGCAATGTTCACCGGGGTGAGGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_195_replicate_8	TAGCAATGTTCACCGGGGTGAGGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_195_replicate_7	TAGCAATGTTCACCGGGGTGAGGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_195_replicate_6	TAGCAATGTTCACCGGGGTGAGGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_195_replicate_5	TAGCAATGTTCACCGGGGTGAGGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_195_replicate_4	TAGCAATGTTCACCGGGGTGAGGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_195_replicate_3	TAGCAATGTTCACCGGGGTGAGGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_195_replicate_2	TAGCAATGTTCACCGGGGTGAGGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_195_replicate_10	TAGCAATGTTCACCGGGGTGAGGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_195_replicate_1	TAGCAATGTTCACCGGGGTGAGGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_194_replicate_9	TAGCAATGTTCACCGGGGTGACGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_194_replicate_8	TAGCAATGTTCACCGGGGTGACGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_194_replicate_7	TAGCAATGTTCACCGGGGTGACGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_194_replicate_6	TAGCAATGTTCACCGGGGTGACGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_194_replicate_5	TAGCAATGTTCACCGGGGTGACGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_194_replicate_4	TAGCAATGTTCACCGGGGTGACGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_194_replicate_3	TAGCAATGTTCACCGGGGTGACGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_194_replicate_2	TAGCAATGTTCACCGGGGTGACGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_194_replicate_10	TAGCAATGTTCACCGGGGTGACGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_194_replicate_1	TAGCAATGTTCACCGGGGTGACGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_193_replicate_9	TAGCAATGTTCACCGGGGTGAAGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_193_replicate_8	TAGCAATGTTCACCGGGGTGAAGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_193_replicate_7	TAGCAATGTTCACCGGGGTGAAGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_193_replicate_6	TAGCAATGTTCACCGGGGTGAAGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_193_replicate_5	TAGCAATGTTCACCGGGGTGAAGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_193_replicate_4	TAGCAATGTTCACCGGGGTGAAGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_193_replicate_3	TAGCAATGTTCACCGGGGTGAAGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_193_replicate_2	TAGCAATGTTCACCGGGGTGAAGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_193_replicate_10	TAGCAATGTTCACCGGGGTGAAGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_193_replicate_1	TAGCAATGTTCACCGGGGTGAAGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_192_replicate_9	TAGCAATGTTCACCGGGGTTTTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_192_replicate_8	TAGCAATGTTCACCGGGGTTTTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_192_replicate_7	TAGCAATGTTCACCGGGGTTTTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_192_replicate_6	TAGCAATGTTCACCGGGGTTTTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_192_replicate_5	TAGCAATGTTCACCGGGGTTTTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_192_replicate_4	TAGCAATGTTCACCGGGGTTTTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_192_replicate_3	TAGCAATGTTCACCGGGGTTTTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_192_replicate_2	TAGCAATGTTCACCGGGGTTTTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_192_replicate_10	TAGCAATGTTCACCGGGGTTTTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_192_replicate_1	TAGCAATGTTCACCGGGGTTTTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_191_replicate_9	TAGCAATGTTCACCGGGGTTGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_191_replicate_8	TAGCAATGTTCACCGGGGTTGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_191_replicate_7	TAGCAATGTTCACCGGGGTTGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_191_replicate_6	TAGCAATGTTCACCGGGGTTGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_191_replicate_5	TAGCAATGTTCACCGGGGTTGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_191_replicate_4	TAGCAATGTTCACCGGGGTTGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_191_replicate_3	TAGCAATGTTCACCGGGGTTGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_191_replicate_2	TAGCAATGTTCACCGGGGTTGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_191_replicate_10	TAGCAATGTTCACCGGGGTTGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_191_replicate_1	TAGCAATGTTCACCGGGGTTGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_190_replicate_9	TAGCAATGTTCACCGGGGTTCTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_190_replicate_8	TAGCAATGTTCACCGGGGTTCTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_190_replicate_7	TAGCAATGTTCACCGGGGTTCTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_190_replicate_6	TAGCAATGTTCACCGGGGTTCTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_190_replicate_5	TAGCAATGTTCACCGGGGTTCTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_190_replicate_4	TAGCAATGTTCACCGGGGTTCTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_190_replicate_3	TAGCAATGTTCACCGGGGTTCTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_190_replicate_2	TAGCAATGTTCACCGGGGTTCTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_190_replicate_10	TAGCAATGTTCACCGGGGTTCTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_190_replicate_1	TAGCAATGTTCACCGGGGTTCTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_19_replicate_9	TAGCAATGTAGACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_19_replicate_8	TAGCAATGTAGACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_19_replicate_7	TAGCAATGTAGACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_19_replicate_6	TAGCAATGTAGACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_19_replicate_5	TAGCAATGTAGACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_19_replicate_4	TAGCAATGTAGACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_19_replicate_3	TAGCAATGTAGACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_19_replicate_2	TAGCAATGTAGACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_19_replicate_10	TAGCAATGTAGACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_19_replicate_1	TAGCAATGTAGACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_189_replicate_9	TAGCAATGTTCACCGGGGTTATGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_189_replicate_8	TAGCAATGTTCACCGGGGTTATGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_189_replicate_7	TAGCAATGTTCACCGGGGTTATGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_189_replicate_6	TAGCAATGTTCACCGGGGTTATGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_189_replicate_5	TAGCAATGTTCACCGGGGTTATGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_189_replicate_4	TAGCAATGTTCACCGGGGTTATGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_189_replicate_3	TAGCAATGTTCACCGGGGTTATGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_189_replicate_2	TAGCAATGTTCACCGGGGTTATGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_189_replicate_10	TAGCAATGTTCACCGGGGTTATGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_189_replicate_1	TAGCAATGTTCACCGGGGTTATGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_188_replicate_9	TAGCAATGTTCACCGGGGTGTTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_188_replicate_8	TAGCAATGTTCACCGGGGTGTTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_188_replicate_7	TAGCAATGTTCACCGGGGTGTTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_188_replicate_6	TAGCAATGTTCACCGGGGTGTTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_188_replicate_5	TAGCAATGTTCACCGGGGTGTTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_188_replicate_4	TAGCAATGTTCACCGGGGTGTTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_188_replicate_3	TAGCAATGTTCACCGGGGTGTTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_188_replicate_2	TAGCAATGTTCACCGGGGTGTTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_188_replicate_10	TAGCAATGTTCACCGGGGTGTTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_188_replicate_1	TAGCAATGTTCACCGGGGTGTTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_187_replicate_9	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_187_replicate_8	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_187_replicate_7	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_187_replicate_6	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_187_replicate_5	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_187_replicate_4	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_187_replicate_3	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_187_replicate_2	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_187_replicate_10	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_187_replicate_1	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_186_replicate_9	TAGCAATGTTCACCGGGGTGCTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_186_replicate_8	TAGCAATGTTCACCGGGGTGCTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_186_replicate_7	TAGCAATGTTCACCGGGGTGCTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_186_replicate_6	TAGCAATGTTCACCGGGGTGCTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_186_replicate_5	TAGCAATGTTCACCGGGGTGCTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_186_replicate_4	TAGCAATGTTCACCGGGGTGCTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_186_replicate_3	TAGCAATGTTCACCGGGGTGCTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_186_replicate_2	TAGCAATGTTCACCGGGGTGCTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_186_replicate_10	TAGCAATGTTCACCGGGGTGCTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_186_replicate_1	TAGCAATGTTCACCGGGGTGCTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_185_replicate_9	TAGCAATGTTCACCGGGGTGATGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_185_replicate_8	TAGCAATGTTCACCGGGGTGATGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_185_replicate_7	TAGCAATGTTCACCGGGGTGATGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_185_replicate_6	TAGCAATGTTCACCGGGGTGATGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_185_replicate_5	TAGCAATGTTCACCGGGGTGATGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_185_replicate_4	TAGCAATGTTCACCGGGGTGATGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_185_replicate_3	TAGCAATGTTCACCGGGGTGATGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_185_replicate_2	TAGCAATGTTCACCGGGGTGATGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_185_replicate_10	TAGCAATGTTCACCGGGGTGATGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_185_replicate_1	TAGCAATGTTCACCGGGGTGATGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_184_replicate_9	TAGCAATGTTCACCGGGGTCTTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_184_replicate_8	TAGCAATGTTCACCGGGGTCTTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_184_replicate_7	TAGCAATGTTCACCGGGGTCTTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_184_replicate_6	TAGCAATGTTCACCGGGGTCTTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_184_replicate_5	TAGCAATGTTCACCGGGGTCTTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_184_replicate_4	TAGCAATGTTCACCGGGGTCTTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_184_replicate_3	TAGCAATGTTCACCGGGGTCTTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_184_replicate_2	TAGCAATGTTCACCGGGGTCTTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_184_replicate_10	TAGCAATGTTCACCGGGGTCTTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_184_replicate_1	TAGCAATGTTCACCGGGGTCTTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_183_replicate_9	TAGCAATGTTCACCGGGGTCGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_183_replicate_8	TAGCAATGTTCACCGGGGTCGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_183_replicate_7	TAGCAATGTTCACCGGGGTCGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_183_replicate_6	TAGCAATGTTCACCGGGGTCGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_183_replicate_5	TAGCAATGTTCACCGGGGTCGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_183_replicate_4	TAGCAATGTTCACCGGGGTCGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_183_replicate_3	TAGCAATGTTCACCGGGGTCGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_183_replicate_2	TAGCAATGTTCACCGGGGTCGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_183_replicate_10	TAGCAATGTTCACCGGGGTCGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_183_replicate_1	TAGCAATGTTCACCGGGGTCGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_182_replicate_9	TAGCAATGTTCACCGGGGTCCTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_182_replicate_8	TAGCAATGTTCACCGGGGTCCTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_182_replicate_7	TAGCAATGTTCACCGGGGTCCTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_182_replicate_6	TAGCAATGTTCACCGGGGTCCTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_182_replicate_5	TAGCAATGTTCACCGGGGTCCTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_182_replicate_4	TAGCAATGTTCACCGGGGTCCTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_182_replicate_3	TAGCAATGTTCACCGGGGTCCTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_182_replicate_2	TAGCAATGTTCACCGGGGTCCTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_182_replicate_10	TAGCAATGTTCACCGGGGTCCTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_182_replicate_1	TAGCAATGTTCACCGGGGTCCTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_181_replicate_9	TAGCAATGTTCACCGGGGTCATGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_181_replicate_8	TAGCAATGTTCACCGGGGTCATGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_181_replicate_7	TAGCAATGTTCACCGGGGTCATGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_181_replicate_6	TAGCAATGTTCACCGGGGTCATGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_181_replicate_5	TAGCAATGTTCACCGGGGTCATGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_181_replicate_4	TAGCAATGTTCACCGGGGTCATGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_181_replicate_3	TAGCAATGTTCACCGGGGTCATGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_181_replicate_2	TAGCAATGTTCACCGGGGTCATGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_181_replicate_10	TAGCAATGTTCACCGGGGTCATGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_181_replicate_1	TAGCAATGTTCACCGGGGTCATGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_180_replicate_9	TAGCAATGTTCACCGGGGTATTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_180_replicate_8	TAGCAATGTTCACCGGGGTATTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_180_replicate_7	TAGCAATGTTCACCGGGGTATTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_180_replicate_6	TAGCAATGTTCACCGGGGTATTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_180_replicate_5	TAGCAATGTTCACCGGGGTATTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_180_replicate_4	TAGCAATGTTCACCGGGGTATTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_180_replicate_3	TAGCAATGTTCACCGGGGTATTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_180_replicate_2	TAGCAATGTTCACCGGGGTATTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_180_replicate_10	TAGCAATGTTCACCGGGGTATTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_180_replicate_1	TAGCAATGTTCACCGGGGTATTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_18_replicate_9	TAGCAATGTACACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_18_replicate_8	TAGCAATGTACACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_18_replicate_7	TAGCAATGTACACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_18_replicate_6	TAGCAATGTACACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_18_replicate_5	TAGCAATGTACACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_18_replicate_4	TAGCAATGTACACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_18_replicate_3	TAGCAATGTACACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_18_replicate_2	TAGCAATGTACACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_18_replicate_10	TAGCAATGTACACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_18_replicate_1	TAGCAATGTACACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_179_replicate_9	TAGCAATGTTCACCGGGGTAGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_179_replicate_8	TAGCAATGTTCACCGGGGTAGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_179_replicate_7	TAGCAATGTTCACCGGGGTAGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_179_replicate_6	TAGCAATGTTCACCGGGGTAGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_179_replicate_5	TAGCAATGTTCACCGGGGTAGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_179_replicate_4	TAGCAATGTTCACCGGGGTAGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_179_replicate_3	TAGCAATGTTCACCGGGGTAGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_179_replicate_2	TAGCAATGTTCACCGGGGTAGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_179_replicate_10	TAGCAATGTTCACCGGGGTAGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_179_replicate_1	TAGCAATGTTCACCGGGGTAGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_178_replicate_9	TAGCAATGTTCACCGGGGTACTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_178_replicate_8	TAGCAATGTTCACCGGGGTACTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_178_replicate_7	TAGCAATGTTCACCGGGGTACTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_178_replicate_6	TAGCAATGTTCACCGGGGTACTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_178_replicate_5	TAGCAATGTTCACCGGGGTACTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_178_replicate_4	TAGCAATGTTCACCGGGGTACTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_178_replicate_3	TAGCAATGTTCACCGGGGTACTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_178_replicate_2	TAGCAATGTTCACCGGGGTACTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_178_replicate_10	TAGCAATGTTCACCGGGGTACTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_178_replicate_1	TAGCAATGTTCACCGGGGTACTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_177_replicate_9	TAGCAATGTTCACCGGGGTAATGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_177_replicate_8	TAGCAATGTTCACCGGGGTAATGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_177_replicate_7	TAGCAATGTTCACCGGGGTAATGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_177_replicate_6	TAGCAATGTTCACCGGGGTAATGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_177_replicate_5	TAGCAATGTTCACCGGGGTAATGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_177_replicate_4	TAGCAATGTTCACCGGGGTAATGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_177_replicate_3	TAGCAATGTTCACCGGGGTAATGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_177_replicate_2	TAGCAATGTTCACCGGGGTAATGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_177_replicate_10	TAGCAATGTTCACCGGGGTAATGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_177_replicate_1	TAGCAATGTTCACCGGGGTAATGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_176_replicate_9	TAGCAATGTTCACCGGGGTTGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_176_replicate_8	TAGCAATGTTCACCGGGGTTGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_176_replicate_7	TAGCAATGTTCACCGGGGTTGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_176_replicate_6	TAGCAATGTTCACCGGGGTTGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_176_replicate_5	TAGCAATGTTCACCGGGGTTGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_176_replicate_4	TAGCAATGTTCACCGGGGTTGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_176_replicate_3	TAGCAATGTTCACCGGGGTTGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_176_replicate_2	TAGCAATGTTCACCGGGGTTGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_176_replicate_10	TAGCAATGTTCACCGGGGTTGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_176_replicate_1	TAGCAATGTTCACCGGGGTTGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_175_replicate_9	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_175_replicate_8	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_175_replicate_7	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_175_replicate_6	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_175_replicate_5	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_175_replicate_4	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_175_replicate_3	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_175_replicate_2	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_175_replicate_10	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_175_replicate_1	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_174_replicate_9	TAGCAATGTTCACCGGGGTCGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_174_replicate_8	TAGCAATGTTCACCGGGGTCGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_174_replicate_7	TAGCAATGTTCACCGGGGTCGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_174_replicate_6	TAGCAATGTTCACCGGGGTCGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_174_replicate_5	TAGCAATGTTCACCGGGGTCGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_174_replicate_4	TAGCAATGTTCACCGGGGTCGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_174_replicate_3	TAGCAATGTTCACCGGGGTCGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_174_replicate_2	TAGCAATGTTCACCGGGGTCGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_174_replicate_10	TAGCAATGTTCACCGGGGTCGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_174_replicate_1	TAGCAATGTTCACCGGGGTCGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_173_replicate_9	TAGCAATGTTCACCGGGGTAGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_173_replicate_8	TAGCAATGTTCACCGGGGTAGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_173_replicate_7	TAGCAATGTTCACCGGGGTAGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_173_replicate_6	TAGCAATGTTCACCGGGGTAGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_173_replicate_5	TAGCAATGTTCACCGGGGTAGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_173_replicate_4	TAGCAATGTTCACCGGGGTAGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_173_replicate_3	TAGCAATGTTCACCGGGGTAGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_173_replicate_2	TAGCAATGTTCACCGGGGTAGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_173_replicate_10	TAGCAATGTTCACCGGGGTAGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_173_replicate_1	TAGCAATGTTCACCGGGGTAGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_172_replicate_9	TAGCAATGTTCACCGGGGGTGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_172_replicate_8	TAGCAATGTTCACCGGGGGTGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_172_replicate_7	TAGCAATGTTCACCGGGGGTGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_172_replicate_6	TAGCAATGTTCACCGGGGGTGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_172_replicate_5	TAGCAATGTTCACCGGGGGTGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_172_replicate_4	TAGCAATGTTCACCGGGGGTGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_172_replicate_3	TAGCAATGTTCACCGGGGGTGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_172_replicate_2	TAGCAATGTTCACCGGGGGTGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_172_replicate_10	TAGCAATGTTCACCGGGGGTGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_172_replicate_1	TAGCAATGTTCACCGGGGGTGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_171_replicate_9	TAGCAATGTTCACCGGGGGGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_171_replicate_8	TAGCAATGTTCACCGGGGGGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_171_replicate_7	TAGCAATGTTCACCGGGGGGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_171_replicate_6	TAGCAATGTTCACCGGGGGGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_171_replicate_5	TAGCAATGTTCACCGGGGGGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_171_replicate_4	TAGCAATGTTCACCGGGGGGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_171_replicate_3	TAGCAATGTTCACCGGGGGGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_171_replicate_2	TAGCAATGTTCACCGGGGGGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_171_replicate_10	TAGCAATGTTCACCGGGGGGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_171_replicate_1	TAGCAATGTTCACCGGGGGGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_170_replicate_9	TAGCAATGTTCACCGGGGGCGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_170_replicate_8	TAGCAATGTTCACCGGGGGCGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_170_replicate_7	TAGCAATGTTCACCGGGGGCGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_170_replicate_6	TAGCAATGTTCACCGGGGGCGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_170_replicate_5	TAGCAATGTTCACCGGGGGCGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_170_replicate_4	TAGCAATGTTCACCGGGGGCGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_170_replicate_3	TAGCAATGTTCACCGGGGGCGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_170_replicate_2	TAGCAATGTTCACCGGGGGCGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_170_replicate_10	TAGCAATGTTCACCGGGGGCGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_170_replicate_1	TAGCAATGTTCACCGGGGGCGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_17_replicate_9	TAGCAATGTAAACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_17_replicate_8	TAGCAATGTAAACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_17_replicate_7	TAGCAATGTAAACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_17_replicate_6	TAGCAATGTAAACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_17_replicate_5	TAGCAATGTAAACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_17_replicate_4	TAGCAATGTAAACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_17_replicate_3	TAGCAATGTAAACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_17_replicate_2	TAGCAATGTAAACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_17_replicate_10	TAGCAATGTAAACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_17_replicate_1	TAGCAATGTAAACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_169_replicate_9	TAGCAATGTTCACCGGGGGAGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_169_replicate_8	TAGCAATGTTCACCGGGGGAGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_169_replicate_7	TAGCAATGTTCACCGGGGGAGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_169_replicate_6	TAGCAATGTTCACCGGGGGAGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_169_replicate_5	TAGCAATGTTCACCGGGGGAGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_169_replicate_4	TAGCAATGTTCACCGGGGGAGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_169_replicate_3	TAGCAATGTTCACCGGGGGAGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_169_replicate_2	TAGCAATGTTCACCGGGGGAGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_169_replicate_10	TAGCAATGTTCACCGGGGGAGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_169_replicate_1	TAGCAATGTTCACCGGGGGAGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_168_replicate_9	TAGCAATGTTCACCGGGGCTGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_168_replicate_8	TAGCAATGTTCACCGGGGCTGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_168_replicate_7	TAGCAATGTTCACCGGGGCTGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_168_replicate_6	TAGCAATGTTCACCGGGGCTGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_168_replicate_5	TAGCAATGTTCACCGGGGCTGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_168_replicate_4	TAGCAATGTTCACCGGGGCTGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_168_replicate_3	TAGCAATGTTCACCGGGGCTGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_168_replicate_2	TAGCAATGTTCACCGGGGCTGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_168_replicate_10	TAGCAATGTTCACCGGGGCTGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_168_replicate_1	TAGCAATGTTCACCGGGGCTGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_167_replicate_9	TAGCAATGTTCACCGGGGCGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_167_replicate_8	TAGCAATGTTCACCGGGGCGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_167_replicate_7	TAGCAATGTTCACCGGGGCGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_167_replicate_6	TAGCAATGTTCACCGGGGCGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_167_replicate_5	TAGCAATGTTCACCGGGGCGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_167_replicate_4	TAGCAATGTTCACCGGGGCGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_167_replicate_3	TAGCAATGTTCACCGGGGCGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_167_replicate_2	TAGCAATGTTCACCGGGGCGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_167_replicate_10	TAGCAATGTTCACCGGGGCGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_167_replicate_1	TAGCAATGTTCACCGGGGCGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_166_replicate_9	TAGCAATGTTCACCGGGGCCGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_166_replicate_8	TAGCAATGTTCACCGGGGCCGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_166_replicate_7	TAGCAATGTTCACCGGGGCCGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_166_replicate_6	TAGCAATGTTCACCGGGGCCGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_166_replicate_5	TAGCAATGTTCACCGGGGCCGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_166_replicate_4	TAGCAATGTTCACCGGGGCCGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_166_replicate_3	TAGCAATGTTCACCGGGGCCGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_166_replicate_2	TAGCAATGTTCACCGGGGCCGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_166_replicate_10	TAGCAATGTTCACCGGGGCCGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_166_replicate_1	TAGCAATGTTCACCGGGGCCGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_165_replicate_9	TAGCAATGTTCACCGGGGCAGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_165_replicate_8	TAGCAATGTTCACCGGGGCAGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_165_replicate_7	TAGCAATGTTCACCGGGGCAGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_165_replicate_6	TAGCAATGTTCACCGGGGCAGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_165_replicate_5	TAGCAATGTTCACCGGGGCAGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_165_replicate_4	TAGCAATGTTCACCGGGGCAGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_165_replicate_3	TAGCAATGTTCACCGGGGCAGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_165_replicate_2	TAGCAATGTTCACCGGGGCAGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_165_replicate_10	TAGCAATGTTCACCGGGGCAGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_165_replicate_1	TAGCAATGTTCACCGGGGCAGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_164_replicate_9	TAGCAATGTTCACCGGGGATGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_164_replicate_8	TAGCAATGTTCACCGGGGATGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_164_replicate_7	TAGCAATGTTCACCGGGGATGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_164_replicate_6	TAGCAATGTTCACCGGGGATGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_164_replicate_5	TAGCAATGTTCACCGGGGATGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_164_replicate_4	TAGCAATGTTCACCGGGGATGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_164_replicate_3	TAGCAATGTTCACCGGGGATGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_164_replicate_2	TAGCAATGTTCACCGGGGATGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_164_replicate_10	TAGCAATGTTCACCGGGGATGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_164_replicate_1	TAGCAATGTTCACCGGGGATGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_163_replicate_9	TAGCAATGTTCACCGGGGAGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_163_replicate_8	TAGCAATGTTCACCGGGGAGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_163_replicate_7	TAGCAATGTTCACCGGGGAGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_163_replicate_6	TAGCAATGTTCACCGGGGAGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_163_replicate_5	TAGCAATGTTCACCGGGGAGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_163_replicate_4	TAGCAATGTTCACCGGGGAGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_163_replicate_3	TAGCAATGTTCACCGGGGAGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_163_replicate_2	TAGCAATGTTCACCGGGGAGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_163_replicate_10	TAGCAATGTTCACCGGGGAGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_163_replicate_1	TAGCAATGTTCACCGGGGAGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_162_replicate_9	TAGCAATGTTCACCGGGGACGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_162_replicate_8	TAGCAATGTTCACCGGGGACGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_162_replicate_7	TAGCAATGTTCACCGGGGACGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_162_replicate_6	TAGCAATGTTCACCGGGGACGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_162_replicate_5	TAGCAATGTTCACCGGGGACGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_162_replicate_4	TAGCAATGTTCACCGGGGACGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_162_replicate_3	TAGCAATGTTCACCGGGGACGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_162_replicate_2	TAGCAATGTTCACCGGGGACGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_162_replicate_10	TAGCAATGTTCACCGGGGACGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_162_replicate_1	TAGCAATGTTCACCGGGGACGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_161_replicate_9	TAGCAATGTTCACCGGGGAAGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_161_replicate_8	TAGCAATGTTCACCGGGGAAGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_161_replicate_7	TAGCAATGTTCACCGGGGAAGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_161_replicate_6	TAGCAATGTTCACCGGGGAAGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_161_replicate_5	TAGCAATGTTCACCGGGGAAGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_161_replicate_4	TAGCAATGTTCACCGGGGAAGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_161_replicate_3	TAGCAATGTTCACCGGGGAAGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_161_replicate_2	TAGCAATGTTCACCGGGGAAGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_161_replicate_10	TAGCAATGTTCACCGGGGAAGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_161_replicate_1	TAGCAATGTTCACCGGGGAAGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_160_replicate_9	TAGCAATGTTCACCGGGTTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_160_replicate_8	TAGCAATGTTCACCGGGTTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_160_replicate_7	TAGCAATGTTCACCGGGTTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_160_replicate_6	TAGCAATGTTCACCGGGTTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_160_replicate_5	TAGCAATGTTCACCGGGTTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_160_replicate_4	TAGCAATGTTCACCGGGTTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_160_replicate_3	TAGCAATGTTCACCGGGTTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_160_replicate_2	TAGCAATGTTCACCGGGTTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_160_replicate_10	TAGCAATGTTCACCGGGTTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_160_replicate_1	TAGCAATGTTCACCGGGTTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_16_replicate_9	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_16_replicate_8	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_16_replicate_7	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_16_replicate_6	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_16_replicate_5	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_16_replicate_4	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_16_replicate_3	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_16_replicate_2	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_16_replicate_10	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_16_replicate_1	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_159_replicate_9	TAGCAATGTTCACCGGGTGGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_159_replicate_8	TAGCAATGTTCACCGGGTGGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_159_replicate_7	TAGCAATGTTCACCGGGTGGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_159_replicate_6	TAGCAATGTTCACCGGGTGGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_159_replicate_5	TAGCAATGTTCACCGGGTGGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_159_replicate_4	TAGCAATGTTCACCGGGTGGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_159_replicate_3	TAGCAATGTTCACCGGGTGGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_159_replicate_2	TAGCAATGTTCACCGGGTGGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_159_replicate_10	TAGCAATGTTCACCGGGTGGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_159_replicate_1	TAGCAATGTTCACCGGGTGGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_158_replicate_9	TAGCAATGTTCACCGGGTCGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_158_replicate_8	TAGCAATGTTCACCGGGTCGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_158_replicate_7	TAGCAATGTTCACCGGGTCGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_158_replicate_6	TAGCAATGTTCACCGGGTCGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_158_replicate_5	TAGCAATGTTCACCGGGTCGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_158_replicate_4	TAGCAATGTTCACCGGGTCGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_158_replicate_3	TAGCAATGTTCACCGGGTCGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_158_replicate_2	TAGCAATGTTCACCGGGTCGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_158_replicate_10	TAGCAATGTTCACCGGGTCGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_158_replicate_1	TAGCAATGTTCACCGGGTCGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_157_replicate_9	TAGCAATGTTCACCGGGTAGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_157_replicate_8	TAGCAATGTTCACCGGGTAGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_157_replicate_7	TAGCAATGTTCACCGGGTAGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_157_replicate_6	TAGCAATGTTCACCGGGTAGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_157_replicate_5	TAGCAATGTTCACCGGGTAGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_157_replicate_4	TAGCAATGTTCACCGGGTAGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_157_replicate_3	TAGCAATGTTCACCGGGTAGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_157_replicate_2	TAGCAATGTTCACCGGGTAGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_157_replicate_10	TAGCAATGTTCACCGGGTAGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_157_replicate_1	TAGCAATGTTCACCGGGTAGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_156_replicate_9	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_156_replicate_8	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_156_replicate_7	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_156_replicate_6	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_156_replicate_5	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_156_replicate_4	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_156_replicate_3	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_156_replicate_2	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_156_replicate_10	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_156_replicate_1	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_155_replicate_9	TAGCAATGTTCACCGGGGGGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_155_replicate_8	TAGCAATGTTCACCGGGGGGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_155_replicate_7	TAGCAATGTTCACCGGGGGGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_155_replicate_6	TAGCAATGTTCACCGGGGGGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_155_replicate_5	TAGCAATGTTCACCGGGGGGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_155_replicate_4	TAGCAATGTTCACCGGGGGGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_155_replicate_3	TAGCAATGTTCACCGGGGGGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_155_replicate_2	TAGCAATGTTCACCGGGGGGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_155_replicate_10	TAGCAATGTTCACCGGGGGGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_155_replicate_1	TAGCAATGTTCACCGGGGGGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_154_replicate_9	TAGCAATGTTCACCGGGGCGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_154_replicate_8	TAGCAATGTTCACCGGGGCGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_154_replicate_7	TAGCAATGTTCACCGGGGCGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_154_replicate_6	TAGCAATGTTCACCGGGGCGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_154_replicate_5	TAGCAATGTTCACCGGGGCGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_154_replicate_4	TAGCAATGTTCACCGGGGCGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_154_replicate_3	TAGCAATGTTCACCGGGGCGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_154_replicate_2	TAGCAATGTTCACCGGGGCGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_154_replicate_10	TAGCAATGTTCACCGGGGCGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_154_replicate_1	TAGCAATGTTCACCGGGGCGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_153_replicate_9	TAGCAATGTTCACCGGGGAGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_153_replicate_8	TAGCAATGTTCACCGGGGAGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_153_replicate_7	TAGCAATGTTCACCGGGGAGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_153_replicate_6	TAGCAATGTTCACCGGGGAGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_153_replicate_5	TAGCAATGTTCACCGGGGAGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_153_replicate_4	TAGCAATGTTCACCGGGGAGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_153_replicate_3	TAGCAATGTTCACCGGGGAGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_153_replicate_2	TAGCAATGTTCACCGGGGAGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_153_replicate_10	TAGCAATGTTCACCGGGGAGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_153_replicate_1	TAGCAATGTTCACCGGGGAGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_152_replicate_9	TAGCAATGTTCACCGGGCTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_152_replicate_8	TAGCAATGTTCACCGGGCTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_152_replicate_7	TAGCAATGTTCACCGGGCTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_152_replicate_6	TAGCAATGTTCACCGGGCTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_152_replicate_5	TAGCAATGTTCACCGGGCTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_152_replicate_4	TAGCAATGTTCACCGGGCTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_152_replicate_3	TAGCAATGTTCACCGGGCTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_152_replicate_2	TAGCAATGTTCACCGGGCTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_152_replicate_10	TAGCAATGTTCACCGGGCTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_152_replicate_1	TAGCAATGTTCACCGGGCTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_151_replicate_9	TAGCAATGTTCACCGGGCGGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_151_replicate_8	TAGCAATGTTCACCGGGCGGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_151_replicate_7	TAGCAATGTTCACCGGGCGGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_151_replicate_6	TAGCAATGTTCACCGGGCGGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_151_replicate_5	TAGCAATGTTCACCGGGCGGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_151_replicate_4	TAGCAATGTTCACCGGGCGGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_151_replicate_3	TAGCAATGTTCACCGGGCGGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_151_replicate_2	TAGCAATGTTCACCGGGCGGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_151_replicate_10	TAGCAATGTTCACCGGGCGGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_151_replicate_1	TAGCAATGTTCACCGGGCGGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_150_replicate_9	TAGCAATGTTCACCGGGCCGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_150_replicate_8	TAGCAATGTTCACCGGGCCGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_150_replicate_7	TAGCAATGTTCACCGGGCCGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_150_replicate_6	TAGCAATGTTCACCGGGCCGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_150_replicate_5	TAGCAATGTTCACCGGGCCGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_150_replicate_4	TAGCAATGTTCACCGGGCCGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_150_replicate_3	TAGCAATGTTCACCGGGCCGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_150_replicate_2	TAGCAATGTTCACCGGGCCGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_150_replicate_10	TAGCAATGTTCACCGGGCCGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_150_replicate_1	TAGCAATGTTCACCGGGCCGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_15_replicate_9	TAGCAATGTGCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_15_replicate_8	TAGCAATGTGCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_15_replicate_7	TAGCAATGTGCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_15_replicate_6	TAGCAATGTGCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_15_replicate_5	TAGCAATGTGCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_15_replicate_4	TAGCAATGTGCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_15_replicate_3	TAGCAATGTGCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_15_replicate_2	TAGCAATGTGCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_15_replicate_10	TAGCAATGTGCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_15_replicate_1	TAGCAATGTGCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_149_replicate_9	TAGCAATGTTCACCGGGCAGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_149_replicate_8	TAGCAATGTTCACCGGGCAGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_149_replicate_7	TAGCAATGTTCACCGGGCAGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_149_replicate_6	TAGCAATGTTCACCGGGCAGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_149_replicate_5	TAGCAATGTTCACCGGGCAGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_149_replicate_4	TAGCAATGTTCACCGGGCAGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_149_replicate_3	TAGCAATGTTCACCGGGCAGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_149_replicate_2	TAGCAATGTTCACCGGGCAGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_149_replicate_10	TAGCAATGTTCACCGGGCAGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_149_replicate_1	TAGCAATGTTCACCGGGCAGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_148_replicate_9	TAGCAATGTTCACCGGGATGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_148_replicate_8	TAGCAATGTTCACCGGGATGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_148_replicate_7	TAGCAATGTTCACCGGGATGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_148_replicate_6	TAGCAATGTTCACCGGGATGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_148_replicate_5	TAGCAATGTTCACCGGGATGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_148_replicate_4	TAGCAATGTTCACCGGGATGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_148_replicate_3	TAGCAATGTTCACCGGGATGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_148_replicate_2	TAGCAATGTTCACCGGGATGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_148_replicate_10	TAGCAATGTTCACCGGGATGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_148_replicate_1	TAGCAATGTTCACCGGGATGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_147_replicate_9	TAGCAATGTTCACCGGGAGGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_147_replicate_8	TAGCAATGTTCACCGGGAGGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_147_replicate_7	TAGCAATGTTCACCGGGAGGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_147_replicate_6	TAGCAATGTTCACCGGGAGGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_147_replicate_5	TAGCAATGTTCACCGGGAGGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_147_replicate_4	TAGCAATGTTCACCGGGAGGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_147_replicate_3	TAGCAATGTTCACCGGGAGGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_147_replicate_2	TAGCAATGTTCACCGGGAGGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_147_replicate_10	TAGCAATGTTCACCGGGAGGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_147_replicate_1	TAGCAATGTTCACCGGGAGGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_146_replicate_9	TAGCAATGTTCACCGGGACGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_146_replicate_8	TAGCAATGTTCACCGGGACGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_146_replicate_7	TAGCAATGTTCACCGGGACGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_146_replicate_6	TAGCAATGTTCACCGGGACGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_146_replicate_5	TAGCAATGTTCACCGGGACGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_146_replicate_4	TAGCAATGTTCACCGGGACGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_146_replicate_3	TAGCAATGTTCACCGGGACGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_146_replicate_2	TAGCAATGTTCACCGGGACGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_146_replicate_10	TAGCAATGTTCACCGGGACGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_146_replicate_1	TAGCAATGTTCACCGGGACGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_145_replicate_9	TAGCAATGTTCACCGGGAAGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_145_replicate_8	TAGCAATGTTCACCGGGAAGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_145_replicate_7	TAGCAATGTTCACCGGGAAGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_145_replicate_6	TAGCAATGTTCACCGGGAAGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_145_replicate_5	TAGCAATGTTCACCGGGAAGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_145_replicate_4	TAGCAATGTTCACCGGGAAGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_145_replicate_3	TAGCAATGTTCACCGGGAAGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_145_replicate_2	TAGCAATGTTCACCGGGAAGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_145_replicate_10	TAGCAATGTTCACCGGGAAGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_145_replicate_1	TAGCAATGTTCACCGGGAAGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_144_replicate_9	TAGCAATGTTCACCGGTTTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_144_replicate_8	TAGCAATGTTCACCGGTTTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_144_replicate_7	TAGCAATGTTCACCGGTTTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_144_replicate_6	TAGCAATGTTCACCGGTTTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_144_replicate_5	TAGCAATGTTCACCGGTTTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_144_replicate_4	TAGCAATGTTCACCGGTTTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_144_replicate_3	TAGCAATGTTCACCGGTTTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_144_replicate_2	TAGCAATGTTCACCGGTTTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_144_replicate_10	TAGCAATGTTCACCGGTTTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_144_replicate_1	TAGCAATGTTCACCGGTTTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_143_replicate_9	TAGCAATGTTCACCGGTGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_143_replicate_8	TAGCAATGTTCACCGGTGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_143_replicate_7	TAGCAATGTTCACCGGTGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_143_replicate_6	TAGCAATGTTCACCGGTGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_143_replicate_5	TAGCAATGTTCACCGGTGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_143_replicate_4	TAGCAATGTTCACCGGTGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_143_replicate_3	TAGCAATGTTCACCGGTGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_143_replicate_2	TAGCAATGTTCACCGGTGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_143_replicate_10	TAGCAATGTTCACCGGTGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_143_replicate_1	TAGCAATGTTCACCGGTGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_142_replicate_9	TAGCAATGTTCACCGGTCTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_142_replicate_8	TAGCAATGTTCACCGGTCTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_142_replicate_7	TAGCAATGTTCACCGGTCTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_142_replicate_6	TAGCAATGTTCACCGGTCTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_142_replicate_5	TAGCAATGTTCACCGGTCTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_142_replicate_4	TAGCAATGTTCACCGGTCTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_142_replicate_3	TAGCAATGTTCACCGGTCTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_142_replicate_2	TAGCAATGTTCACCGGTCTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_142_replicate_10	TAGCAATGTTCACCGGTCTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_142_replicate_1	TAGCAATGTTCACCGGTCTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_141_replicate_9	TAGCAATGTTCACCGGTATGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_141_replicate_8	TAGCAATGTTCACCGGTATGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_141_replicate_7	TAGCAATGTTCACCGGTATGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_141_replicate_6	TAGCAATGTTCACCGGTATGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_141_replicate_5	TAGCAATGTTCACCGGTATGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_141_replicate_4	TAGCAATGTTCACCGGTATGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_141_replicate_3	TAGCAATGTTCACCGGTATGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_141_replicate_2	TAGCAATGTTCACCGGTATGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_141_replicate_10	TAGCAATGTTCACCGGTATGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_141_replicate_1	TAGCAATGTTCACCGGTATGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_140_replicate_9	TAGCAATGTTCACCGGGTTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_140_replicate_8	TAGCAATGTTCACCGGGTTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_140_replicate_7	TAGCAATGTTCACCGGGTTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_140_replicate_6	TAGCAATGTTCACCGGGTTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_140_replicate_5	TAGCAATGTTCACCGGGTTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_140_replicate_4	TAGCAATGTTCACCGGGTTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_140_replicate_3	TAGCAATGTTCACCGGGTTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_140_replicate_2	TAGCAATGTTCACCGGGTTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_140_replicate_10	TAGCAATGTTCACCGGGTTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_140_replicate_1	TAGCAATGTTCACCGGGTTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_14_replicate_9	TAGCAATGTCCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_14_replicate_8	TAGCAATGTCCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_14_replicate_7	TAGCAATGTCCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_14_replicate_6	TAGCAATGTCCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_14_replicate_5	TAGCAATGTCCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_14_replicate_4	TAGCAATGTCCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_14_replicate_3	TAGCAATGTCCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_14_replicate_2	TAGCAATGTCCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_14_replicate_10	TAGCAATGTCCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_14_replicate_1	TAGCAATGTCCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_139_replicate_9	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_139_replicate_8	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_139_replicate_7	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_139_replicate_6	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_139_replicate_5	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_139_replicate_4	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_139_replicate_3	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_139_replicate_2	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_139_replicate_10	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_139_replicate_1	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_138_replicate_9	TAGCAATGTTCACCGGGCTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_138_replicate_8	TAGCAATGTTCACCGGGCTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_138_replicate_7	TAGCAATGTTCACCGGGCTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_138_replicate_6	TAGCAATGTTCACCGGGCTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_138_replicate_5	TAGCAATGTTCACCGGGCTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_138_replicate_4	TAGCAATGTTCACCGGGCTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_138_replicate_3	TAGCAATGTTCACCGGGCTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_138_replicate_2	TAGCAATGTTCACCGGGCTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_138_replicate_10	TAGCAATGTTCACCGGGCTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_138_replicate_1	TAGCAATGTTCACCGGGCTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_137_replicate_9	TAGCAATGTTCACCGGGATGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_137_replicate_8	TAGCAATGTTCACCGGGATGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_137_replicate_7	TAGCAATGTTCACCGGGATGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_137_replicate_6	TAGCAATGTTCACCGGGATGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_137_replicate_5	TAGCAATGTTCACCGGGATGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_137_replicate_4	TAGCAATGTTCACCGGGATGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_137_replicate_3	TAGCAATGTTCACCGGGATGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_137_replicate_2	TAGCAATGTTCACCGGGATGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_137_replicate_10	TAGCAATGTTCACCGGGATGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_137_replicate_1	TAGCAATGTTCACCGGGATGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_136_replicate_9	TAGCAATGTTCACCGGCTTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_136_replicate_8	TAGCAATGTTCACCGGCTTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_136_replicate_7	TAGCAATGTTCACCGGCTTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_136_replicate_6	TAGCAATGTTCACCGGCTTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_136_replicate_5	TAGCAATGTTCACCGGCTTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_136_replicate_4	TAGCAATGTTCACCGGCTTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_136_replicate_3	TAGCAATGTTCACCGGCTTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_136_replicate_2	TAGCAATGTTCACCGGCTTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_136_replicate_10	TAGCAATGTTCACCGGCTTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_136_replicate_1	TAGCAATGTTCACCGGCTTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_135_replicate_9	TAGCAATGTTCACCGGCGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_135_replicate_8	TAGCAATGTTCACCGGCGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_135_replicate_7	TAGCAATGTTCACCGGCGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_135_replicate_6	TAGCAATGTTCACCGGCGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_135_replicate_5	TAGCAATGTTCACCGGCGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_135_replicate_4	TAGCAATGTTCACCGGCGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_135_replicate_3	TAGCAATGTTCACCGGCGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_135_replicate_2	TAGCAATGTTCACCGGCGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_135_replicate_10	TAGCAATGTTCACCGGCGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_135_replicate_1	TAGCAATGTTCACCGGCGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_134_replicate_9	TAGCAATGTTCACCGGCCTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_134_replicate_8	TAGCAATGTTCACCGGCCTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_134_replicate_7	TAGCAATGTTCACCGGCCTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_134_replicate_6	TAGCAATGTTCACCGGCCTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_134_replicate_5	TAGCAATGTTCACCGGCCTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_134_replicate_4	TAGCAATGTTCACCGGCCTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_134_replicate_3	TAGCAATGTTCACCGGCCTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_134_replicate_2	TAGCAATGTTCACCGGCCTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_134_replicate_10	TAGCAATGTTCACCGGCCTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_134_replicate_1	TAGCAATGTTCACCGGCCTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_133_replicate_9	TAGCAATGTTCACCGGCATGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_133_replicate_8	TAGCAATGTTCACCGGCATGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_133_replicate_7	TAGCAATGTTCACCGGCATGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_133_replicate_6	TAGCAATGTTCACCGGCATGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_133_replicate_5	TAGCAATGTTCACCGGCATGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_133_replicate_4	TAGCAATGTTCACCGGCATGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_133_replicate_3	TAGCAATGTTCACCGGCATGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_133_replicate_2	TAGCAATGTTCACCGGCATGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_133_replicate_10	TAGCAATGTTCACCGGCATGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_133_replicate_1	TAGCAATGTTCACCGGCATGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_132_replicate_9	TAGCAATGTTCACCGGATTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_132_replicate_8	TAGCAATGTTCACCGGATTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_132_replicate_7	TAGCAATGTTCACCGGATTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_132_replicate_6	TAGCAATGTTCACCGGATTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_132_replicate_5	TAGCAATGTTCACCGGATTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_132_replicate_4	TAGCAATGTTCACCGGATTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_132_replicate_3	TAGCAATGTTCACCGGATTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_132_replicate_2	TAGCAATGTTCACCGGATTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_132_replicate_10	TAGCAATGTTCACCGGATTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_132_replicate_1	TAGCAATGTTCACCGGATTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_131_replicate_9	TAGCAATGTTCACCGGAGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_131_replicate_8	TAGCAATGTTCACCGGAGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_131_replicate_7	TAGCAATGTTCACCGGAGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_131_replicate_6	TAGCAATGTTCACCGGAGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_131_replicate_5	TAGCAATGTTCACCGGAGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_131_replicate_4	TAGCAATGTTCACCGGAGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_131_replicate_3	TAGCAATGTTCACCGGAGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_131_replicate_2	TAGCAATGTTCACCGGAGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_131_replicate_10	TAGCAATGTTCACCGGAGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_131_replicate_1	TAGCAATGTTCACCGGAGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_130_replicate_9	TAGCAATGTTCACCGGACTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_130_replicate_8	TAGCAATGTTCACCGGACTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_130_replicate_7	TAGCAATGTTCACCGGACTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_130_replicate_6	TAGCAATGTTCACCGGACTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_130_replicate_5	TAGCAATGTTCACCGGACTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_130_replicate_4	TAGCAATGTTCACCGGACTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_130_replicate_3	TAGCAATGTTCACCGGACTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_130_replicate_2	TAGCAATGTTCACCGGACTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_130_replicate_10	TAGCAATGTTCACCGGACTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_130_replicate_1	TAGCAATGTTCACCGGACTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_13_replicate_9	TAGCAATGTACACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_13_replicate_8	TAGCAATGTACACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_13_replicate_7	TAGCAATGTACACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_13_replicate_6	TAGCAATGTACACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_13_replicate_5	TAGCAATGTACACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_13_replicate_4	TAGCAATGTACACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_13_replicate_3	TAGCAATGTACACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_13_replicate_2	TAGCAATGTACACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_13_replicate_10	TAGCAATGTACACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_13_replicate_1	TAGCAATGTACACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_129_replicate_9	TAGCAATGTTCACCGGAATGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_129_replicate_8	TAGCAATGTTCACCGGAATGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_129_replicate_7	TAGCAATGTTCACCGGAATGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_129_replicate_6	TAGCAATGTTCACCGGAATGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_129_replicate_5	TAGCAATGTTCACCGGAATGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_129_replicate_4	TAGCAATGTTCACCGGAATGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_129_replicate_3	TAGCAATGTTCACCGGAATGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_129_replicate_2	TAGCAATGTTCACCGGAATGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_129_replicate_10	TAGCAATGTTCACCGGAATGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_129_replicate_1	TAGCAATGTTCACCGGAATGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_128_replicate_9	TAGCAATGTTCACCGTTGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_128_replicate_8	TAGCAATGTTCACCGTTGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_128_replicate_7	TAGCAATGTTCACCGTTGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_128_replicate_6	TAGCAATGTTCACCGTTGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_128_replicate_5	TAGCAATGTTCACCGTTGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_128_replicate_4	TAGCAATGTTCACCGTTGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_128_replicate_3	TAGCAATGTTCACCGTTGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_128_replicate_2	TAGCAATGTTCACCGTTGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_128_replicate_10	TAGCAATGTTCACCGTTGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_128_replicate_1	TAGCAATGTTCACCGTTGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_127_replicate_9	TAGCAATGTTCACCGTGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_127_replicate_8	TAGCAATGTTCACCGTGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_127_replicate_7	TAGCAATGTTCACCGTGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_127_replicate_6	TAGCAATGTTCACCGTGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_127_replicate_5	TAGCAATGTTCACCGTGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_127_replicate_4	TAGCAATGTTCACCGTGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_127_replicate_3	TAGCAATGTTCACCGTGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_127_replicate_2	TAGCAATGTTCACCGTGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_127_replicate_10	TAGCAATGTTCACCGTGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_127_replicate_1	TAGCAATGTTCACCGTGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_126_replicate_9	TAGCAATGTTCACCGTCGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_126_replicate_8	TAGCAATGTTCACCGTCGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_126_replicate_7	TAGCAATGTTCACCGTCGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_126_replicate_6	TAGCAATGTTCACCGTCGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_126_replicate_5	TAGCAATGTTCACCGTCGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_126_replicate_4	TAGCAATGTTCACCGTCGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_126_replicate_3	TAGCAATGTTCACCGTCGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_126_replicate_2	TAGCAATGTTCACCGTCGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_126_replicate_10	TAGCAATGTTCACCGTCGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_126_replicate_1	TAGCAATGTTCACCGTCGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_125_replicate_9	TAGCAATGTTCACCGTAGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_125_replicate_8	TAGCAATGTTCACCGTAGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_125_replicate_7	TAGCAATGTTCACCGTAGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_125_replicate_6	TAGCAATGTTCACCGTAGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_125_replicate_5	TAGCAATGTTCACCGTAGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_125_replicate_4	TAGCAATGTTCACCGTAGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_125_replicate_3	TAGCAATGTTCACCGTAGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_125_replicate_2	TAGCAATGTTCACCGTAGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_125_replicate_10	TAGCAATGTTCACCGTAGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_125_replicate_1	TAGCAATGTTCACCGTAGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_124_replicate_9	TAGCAATGTTCACCGGTGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_124_replicate_8	TAGCAATGTTCACCGGTGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_124_replicate_7	TAGCAATGTTCACCGGTGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_124_replicate_6	TAGCAATGTTCACCGGTGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_124_replicate_5	TAGCAATGTTCACCGGTGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_124_replicate_4	TAGCAATGTTCACCGGTGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_124_replicate_3	TAGCAATGTTCACCGGTGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_124_replicate_2	TAGCAATGTTCACCGGTGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_124_replicate_10	TAGCAATGTTCACCGGTGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_124_replicate_1	TAGCAATGTTCACCGGTGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_123_replicate_9	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_123_replicate_8	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_123_replicate_7	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_123_replicate_6	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_123_replicate_5	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_123_replicate_4	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_123_replicate_3	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_123_replicate_2	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_123_replicate_10	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_123_replicate_1	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_122_replicate_9	TAGCAATGTTCACCGGCGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_122_replicate_8	TAGCAATGTTCACCGGCGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_122_replicate_7	TAGCAATGTTCACCGGCGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_122_replicate_6	TAGCAATGTTCACCGGCGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_122_replicate_5	TAGCAATGTTCACCGGCGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_122_replicate_4	TAGCAATGTTCACCGGCGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_122_replicate_3	TAGCAATGTTCACCGGCGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_122_replicate_2	TAGCAATGTTCACCGGCGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_122_replicate_10	TAGCAATGTTCACCGGCGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_122_replicate_1	TAGCAATGTTCACCGGCGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_121_replicate_9	TAGCAATGTTCACCGGAGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_121_replicate_8	TAGCAATGTTCACCGGAGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_121_replicate_7	TAGCAATGTTCACCGGAGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_121_replicate_6	TAGCAATGTTCACCGGAGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_121_replicate_5	TAGCAATGTTCACCGGAGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_121_replicate_4	TAGCAATGTTCACCGGAGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_121_replicate_3	TAGCAATGTTCACCGGAGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_121_replicate_2	TAGCAATGTTCACCGGAGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_121_replicate_10	TAGCAATGTTCACCGGAGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_121_replicate_1	TAGCAATGTTCACCGGAGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_120_replicate_9	TAGCAATGTTCACCGCTGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_120_replicate_8	TAGCAATGTTCACCGCTGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_120_replicate_7	TAGCAATGTTCACCGCTGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_120_replicate_6	TAGCAATGTTCACCGCTGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_120_replicate_5	TAGCAATGTTCACCGCTGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_120_replicate_4	TAGCAATGTTCACCGCTGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_120_replicate_3	TAGCAATGTTCACCGCTGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_120_replicate_2	TAGCAATGTTCACCGCTGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_120_replicate_10	TAGCAATGTTCACCGCTGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_120_replicate_1	TAGCAATGTTCACCGCTGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_12_replicate_9	TAGCAATGGTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_12_replicate_8	TAGCAATGGTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_12_replicate_7	TAGCAATGGTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_12_replicate_6	TAGCAATGGTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_12_replicate_5	TAGCAATGGTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_12_replicate_4	TAGCAATGGTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_12_replicate_3	TAGCAATGGTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_12_replicate_2	TAGCAATGGTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_12_replicate_10	TAGCAATGGTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_12_replicate_1	TAGCAATGGTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_119_replicate_9	TAGCAATGTTCACCGCGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_119_replicate_8	TAGCAATGTTCACCGCGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_119_replicate_7	TAGCAATGTTCACCGCGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_119_replicate_6	TAGCAATGTTCACCGCGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_119_replicate_5	TAGCAATGTTCACCGCGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_119_replicate_4	TAGCAATGTTCACCGCGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_119_replicate_3	TAGCAATGTTCACCGCGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_119_replicate_2	TAGCAATGTTCACCGCGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_119_replicate_10	TAGCAATGTTCACCGCGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_119_replicate_1	TAGCAATGTTCACCGCGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_118_replicate_9	TAGCAATGTTCACCGCCGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_118_replicate_8	TAGCAATGTTCACCGCCGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_118_replicate_7	TAGCAATGTTCACCGCCGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_118_replicate_6	TAGCAATGTTCACCGCCGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_118_replicate_5	TAGCAATGTTCACCGCCGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_118_replicate_4	TAGCAATGTTCACCGCCGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_118_replicate_3	TAGCAATGTTCACCGCCGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_118_replicate_2	TAGCAATGTTCACCGCCGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_118_replicate_10	TAGCAATGTTCACCGCCGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_118_replicate_1	TAGCAATGTTCACCGCCGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_117_replicate_9	TAGCAATGTTCACCGCAGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_117_replicate_8	TAGCAATGTTCACCGCAGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_117_replicate_7	TAGCAATGTTCACCGCAGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_117_replicate_6	TAGCAATGTTCACCGCAGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_117_replicate_5	TAGCAATGTTCACCGCAGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_117_replicate_4	TAGCAATGTTCACCGCAGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_117_replicate_3	TAGCAATGTTCACCGCAGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_117_replicate_2	TAGCAATGTTCACCGCAGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_117_replicate_10	TAGCAATGTTCACCGCAGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_117_replicate_1	TAGCAATGTTCACCGCAGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_116_replicate_9	TAGCAATGTTCACCGATGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_116_replicate_8	TAGCAATGTTCACCGATGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_116_replicate_7	TAGCAATGTTCACCGATGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_116_replicate_6	TAGCAATGTTCACCGATGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_116_replicate_5	TAGCAATGTTCACCGATGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_116_replicate_4	TAGCAATGTTCACCGATGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_116_replicate_3	TAGCAATGTTCACCGATGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_116_replicate_2	TAGCAATGTTCACCGATGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_116_replicate_10	TAGCAATGTTCACCGATGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_116_replicate_1	TAGCAATGTTCACCGATGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_115_replicate_9	TAGCAATGTTCACCGAGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_115_replicate_8	TAGCAATGTTCACCGAGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_115_replicate_7	TAGCAATGTTCACCGAGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_115_replicate_6	TAGCAATGTTCACCGAGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_115_replicate_5	TAGCAATGTTCACCGAGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_115_replicate_4	TAGCAATGTTCACCGAGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_115_replicate_3	TAGCAATGTTCACCGAGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_115_replicate_2	TAGCAATGTTCACCGAGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_115_replicate_10	TAGCAATGTTCACCGAGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_115_replicate_1	TAGCAATGTTCACCGAGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_114_replicate_9	TAGCAATGTTCACCGACGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_114_replicate_8	TAGCAATGTTCACCGACGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_114_replicate_7	TAGCAATGTTCACCGACGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_114_replicate_6	TAGCAATGTTCACCGACGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_114_replicate_5	TAGCAATGTTCACCGACGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_114_replicate_4	TAGCAATGTTCACCGACGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_114_replicate_3	TAGCAATGTTCACCGACGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_114_replicate_2	TAGCAATGTTCACCGACGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_114_replicate_10	TAGCAATGTTCACCGACGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_114_replicate_1	TAGCAATGTTCACCGACGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_113_replicate_9	TAGCAATGTTCACCGAAGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_113_replicate_8	TAGCAATGTTCACCGAAGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_113_replicate_7	TAGCAATGTTCACCGAAGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_113_replicate_6	TAGCAATGTTCACCGAAGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_113_replicate_5	TAGCAATGTTCACCGAAGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_113_replicate_4	TAGCAATGTTCACCGAAGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_113_replicate_3	TAGCAATGTTCACCGAAGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_113_replicate_2	TAGCAATGTTCACCGAAGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_113_replicate_10	TAGCAATGTTCACCGAAGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_113_replicate_1	TAGCAATGTTCACCGAAGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_112_replicate_9	TAGCAATGTTCACCTTGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_112_replicate_8	TAGCAATGTTCACCTTGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_112_replicate_7	TAGCAATGTTCACCTTGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_112_replicate_6	TAGCAATGTTCACCTTGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_112_replicate_5	TAGCAATGTTCACCTTGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_112_replicate_4	TAGCAATGTTCACCTTGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_112_replicate_3	TAGCAATGTTCACCTTGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_112_replicate_2	TAGCAATGTTCACCTTGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_112_replicate_10	TAGCAATGTTCACCTTGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_112_replicate_1	TAGCAATGTTCACCTTGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_111_replicate_9	TAGCAATGTTCACCTGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_111_replicate_8	TAGCAATGTTCACCTGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_111_replicate_7	TAGCAATGTTCACCTGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_111_replicate_6	TAGCAATGTTCACCTGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_111_replicate_5	TAGCAATGTTCACCTGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_111_replicate_4	TAGCAATGTTCACCTGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_111_replicate_3	TAGCAATGTTCACCTGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_111_replicate_2	TAGCAATGTTCACCTGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_111_replicate_10	TAGCAATGTTCACCTGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_111_replicate_1	TAGCAATGTTCACCTGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_110_replicate_9	TAGCAATGTTCACCTCGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_110_replicate_8	TAGCAATGTTCACCTCGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_110_replicate_7	TAGCAATGTTCACCTCGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_110_replicate_6	TAGCAATGTTCACCTCGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_110_replicate_5	TAGCAATGTTCACCTCGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_110_replicate_4	TAGCAATGTTCACCTCGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_110_replicate_3	TAGCAATGTTCACCTCGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_110_replicate_2	TAGCAATGTTCACCTCGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_110_replicate_10	TAGCAATGTTCACCTCGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_110_replicate_1	TAGCAATGTTCACCTCGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_11_replicate_9	TAGCAATGGGCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_11_replicate_8	TAGCAATGGGCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_11_replicate_7	TAGCAATGGGCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_11_replicate_6	TAGCAATGGGCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_11_replicate_5	TAGCAATGGGCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_11_replicate_4	TAGCAATGGGCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_11_replicate_3	TAGCAATGGGCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_11_replicate_2	TAGCAATGGGCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_11_replicate_10	TAGCAATGGGCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_11_replicate_1	TAGCAATGGGCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_109_replicate_9	TAGCAATGTTCACCTAGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_109_replicate_8	TAGCAATGTTCACCTAGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_109_replicate_7	TAGCAATGTTCACCTAGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_109_replicate_6	TAGCAATGTTCACCTAGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_109_replicate_5	TAGCAATGTTCACCTAGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_109_replicate_4	TAGCAATGTTCACCTAGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_109_replicate_3	TAGCAATGTTCACCTAGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_109_replicate_2	TAGCAATGTTCACCTAGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_109_replicate_10	TAGCAATGTTCACCTAGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_109_replicate_1	TAGCAATGTTCACCTAGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_108_replicate_9	TAGCAATGTTCACCGTGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_108_replicate_8	TAGCAATGTTCACCGTGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_108_replicate_7	TAGCAATGTTCACCGTGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_108_replicate_6	TAGCAATGTTCACCGTGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_108_replicate_5	TAGCAATGTTCACCGTGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_108_replicate_4	TAGCAATGTTCACCGTGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_108_replicate_3	TAGCAATGTTCACCGTGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_108_replicate_2	TAGCAATGTTCACCGTGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_108_replicate_10	TAGCAATGTTCACCGTGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_108_replicate_1	TAGCAATGTTCACCGTGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_107_replicate_9	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_107_replicate_8	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_107_replicate_7	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_107_replicate_6	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_107_replicate_5	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_107_replicate_4	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_107_replicate_3	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_107_replicate_2	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_107_replicate_10	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_107_replicate_1	TAGCAATGTTCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_106_replicate_9	TAGCAATGTTCACCGCGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_106_replicate_8	TAGCAATGTTCACCGCGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_106_replicate_7	TAGCAATGTTCACCGCGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_106_replicate_6	TAGCAATGTTCACCGCGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_106_replicate_5	TAGCAATGTTCACCGCGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_106_replicate_4	TAGCAATGTTCACCGCGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_106_replicate_3	TAGCAATGTTCACCGCGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_106_replicate_2	TAGCAATGTTCACCGCGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_106_replicate_10	TAGCAATGTTCACCGCGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_106_replicate_1	TAGCAATGTTCACCGCGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_105_replicate_9	TAGCAATGTTCACCGAGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_105_replicate_8	TAGCAATGTTCACCGAGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_105_replicate_7	TAGCAATGTTCACCGAGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_105_replicate_6	TAGCAATGTTCACCGAGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_105_replicate_5	TAGCAATGTTCACCGAGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_105_replicate_4	TAGCAATGTTCACCGAGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_105_replicate_3	TAGCAATGTTCACCGAGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_105_replicate_2	TAGCAATGTTCACCGAGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_105_replicate_10	TAGCAATGTTCACCGAGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_105_replicate_1	TAGCAATGTTCACCGAGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_104_replicate_9	TAGCAATGTTCACCCTGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_104_replicate_8	TAGCAATGTTCACCCTGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_104_replicate_7	TAGCAATGTTCACCCTGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_104_replicate_6	TAGCAATGTTCACCCTGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_104_replicate_5	TAGCAATGTTCACCCTGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_104_replicate_4	TAGCAATGTTCACCCTGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_104_replicate_3	TAGCAATGTTCACCCTGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_104_replicate_2	TAGCAATGTTCACCCTGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_104_replicate_10	TAGCAATGTTCACCCTGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_104_replicate_1	TAGCAATGTTCACCCTGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_103_replicate_9	TAGCAATGTTCACCCGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_103_replicate_8	TAGCAATGTTCACCCGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_103_replicate_7	TAGCAATGTTCACCCGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_103_replicate_6	TAGCAATGTTCACCCGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_103_replicate_5	TAGCAATGTTCACCCGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_103_replicate_4	TAGCAATGTTCACCCGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_103_replicate_3	TAGCAATGTTCACCCGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_103_replicate_2	TAGCAATGTTCACCCGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_103_replicate_10	TAGCAATGTTCACCCGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_103_replicate_1	TAGCAATGTTCACCCGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_102_replicate_9	TAGCAATGTTCACCCCGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_102_replicate_8	TAGCAATGTTCACCCCGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_102_replicate_7	TAGCAATGTTCACCCCGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_102_replicate_6	TAGCAATGTTCACCCCGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_102_replicate_5	TAGCAATGTTCACCCCGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_102_replicate_4	TAGCAATGTTCACCCCGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_102_replicate_3	TAGCAATGTTCACCCCGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_102_replicate_2	TAGCAATGTTCACCCCGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_102_replicate_10	TAGCAATGTTCACCCCGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_102_replicate_1	TAGCAATGTTCACCCCGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_101_replicate_9	TAGCAATGTTCACCCAGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_101_replicate_8	TAGCAATGTTCACCCAGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_101_replicate_7	TAGCAATGTTCACCCAGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_101_replicate_6	TAGCAATGTTCACCCAGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_101_replicate_5	TAGCAATGTTCACCCAGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_101_replicate_4	TAGCAATGTTCACCCAGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_101_replicate_3	TAGCAATGTTCACCCAGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_101_replicate_2	TAGCAATGTTCACCCAGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_101_replicate_10	TAGCAATGTTCACCCAGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_101_replicate_1	TAGCAATGTTCACCCAGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_100_replicate_9	TAGCAATGTTCACCATGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_100_replicate_8	TAGCAATGTTCACCATGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_100_replicate_7	TAGCAATGTTCACCATGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_100_replicate_6	TAGCAATGTTCACCATGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_100_replicate_5	TAGCAATGTTCACCATGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_100_replicate_4	TAGCAATGTTCACCATGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_100_replicate_3	TAGCAATGTTCACCATGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_100_replicate_2	TAGCAATGTTCACCATGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_100_replicate_10	TAGCAATGTTCACCATGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_100_replicate_1	TAGCAATGTTCACCATGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_10_replicate_9	TAGCAATGGCCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_10_replicate_8	TAGCAATGGCCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_10_replicate_7	TAGCAATGGCCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_10_replicate_6	TAGCAATGGCCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_10_replicate_5	TAGCAATGGCCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_10_replicate_4	TAGCAATGGCCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_10_replicate_3	TAGCAATGGCCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_10_replicate_2	TAGCAATGGCCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_10_replicate_10	TAGCAATGGCCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_10_replicate_1	TAGCAATGGCCACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_1_replicate_9	TAGCAATGAACACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_1_replicate_8	TAGCAATGAACACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_1_replicate_7	TAGCAATGAACACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_1_replicate_6	TAGCAATGAACACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_1_replicate_5	TAGCAATGAACACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_1_replicate_4	TAGCAATGAACACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_1_replicate_3	TAGCAATGAACACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_1_replicate_2	TAGCAATGAACACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_1_replicate_10	TAGCAATGAACACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2072_dinucleotide_substitution_1_replicate_1	TAGCAATGAACACCGGGGTGGTGCCCATCATTGCTAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_99_replicate_9	CTATAGCAATGTTGTGGAGGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_99_replicate_8	CTATAGCAATGTTGTGGAGGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_99_replicate_7	CTATAGCAATGTTGTGGAGGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_99_replicate_6	CTATAGCAATGTTGTGGAGGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_99_replicate_5	CTATAGCAATGTTGTGGAGGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_99_replicate_4	CTATAGCAATGTTGTGGAGGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_99_replicate_3	CTATAGCAATGTTGTGGAGGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_99_replicate_2	CTATAGCAATGTTGTGGAGGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_99_replicate_10	CTATAGCAATGTTGTGGAGGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_99_replicate_1	CTATAGCAATGTTGTGGAGGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_98_replicate_9	CTATAGCAATGTTGTGGACGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_98_replicate_8	CTATAGCAATGTTGTGGACGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_98_replicate_7	CTATAGCAATGTTGTGGACGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_98_replicate_6	CTATAGCAATGTTGTGGACGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_98_replicate_5	CTATAGCAATGTTGTGGACGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_98_replicate_4	CTATAGCAATGTTGTGGACGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_98_replicate_3	CTATAGCAATGTTGTGGACGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_98_replicate_2	CTATAGCAATGTTGTGGACGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_98_replicate_10	CTATAGCAATGTTGTGGACGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_98_replicate_1	CTATAGCAATGTTGTGGACGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_97_replicate_9	CTATAGCAATGTTGTGGAAGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_97_replicate_8	CTATAGCAATGTTGTGGAAGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_97_replicate_7	CTATAGCAATGTTGTGGAAGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_97_replicate_6	CTATAGCAATGTTGTGGAAGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_97_replicate_5	CTATAGCAATGTTGTGGAAGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_97_replicate_4	CTATAGCAATGTTGTGGAAGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_97_replicate_3	CTATAGCAATGTTGTGGAAGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_97_replicate_2	CTATAGCAATGTTGTGGAAGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_97_replicate_10	CTATAGCAATGTTGTGGAAGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_97_replicate_1	CTATAGCAATGTTGTGGAAGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_96_replicate_9	CTATAGCAATGTTGTGTTCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_96_replicate_8	CTATAGCAATGTTGTGTTCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_96_replicate_7	CTATAGCAATGTTGTGTTCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_96_replicate_6	CTATAGCAATGTTGTGTTCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_96_replicate_5	CTATAGCAATGTTGTGTTCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_96_replicate_4	CTATAGCAATGTTGTGTTCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_96_replicate_3	CTATAGCAATGTTGTGTTCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_96_replicate_2	CTATAGCAATGTTGTGTTCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_96_replicate_10	CTATAGCAATGTTGTGTTCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_96_replicate_1	CTATAGCAATGTTGTGTTCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_95_replicate_9	CTATAGCAATGTTGTGTGCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_95_replicate_8	CTATAGCAATGTTGTGTGCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_95_replicate_7	CTATAGCAATGTTGTGTGCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_95_replicate_6	CTATAGCAATGTTGTGTGCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_95_replicate_5	CTATAGCAATGTTGTGTGCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_95_replicate_4	CTATAGCAATGTTGTGTGCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_95_replicate_3	CTATAGCAATGTTGTGTGCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_95_replicate_2	CTATAGCAATGTTGTGTGCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_95_replicate_10	CTATAGCAATGTTGTGTGCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_95_replicate_1	CTATAGCAATGTTGTGTGCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_94_replicate_9	CTATAGCAATGTTGTGTCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_94_replicate_8	CTATAGCAATGTTGTGTCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_94_replicate_7	CTATAGCAATGTTGTGTCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_94_replicate_6	CTATAGCAATGTTGTGTCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_94_replicate_5	CTATAGCAATGTTGTGTCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_94_replicate_4	CTATAGCAATGTTGTGTCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_94_replicate_3	CTATAGCAATGTTGTGTCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_94_replicate_2	CTATAGCAATGTTGTGTCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_94_replicate_10	CTATAGCAATGTTGTGTCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_94_replicate_1	CTATAGCAATGTTGTGTCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_93_replicate_9	CTATAGCAATGTTGTGTACGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_93_replicate_8	CTATAGCAATGTTGTGTACGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_93_replicate_7	CTATAGCAATGTTGTGTACGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_93_replicate_6	CTATAGCAATGTTGTGTACGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_93_replicate_5	CTATAGCAATGTTGTGTACGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_93_replicate_4	CTATAGCAATGTTGTGTACGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_93_replicate_3	CTATAGCAATGTTGTGTACGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_93_replicate_2	CTATAGCAATGTTGTGTACGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_93_replicate_10	CTATAGCAATGTTGTGTACGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_93_replicate_1	CTATAGCAATGTTGTGTACGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_92_replicate_9	CTATAGCAATGTTGTGGTCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_92_replicate_8	CTATAGCAATGTTGTGGTCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_92_replicate_7	CTATAGCAATGTTGTGGTCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_92_replicate_6	CTATAGCAATGTTGTGGTCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_92_replicate_5	CTATAGCAATGTTGTGGTCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_92_replicate_4	CTATAGCAATGTTGTGGTCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_92_replicate_3	CTATAGCAATGTTGTGGTCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_92_replicate_2	CTATAGCAATGTTGTGGTCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_92_replicate_10	CTATAGCAATGTTGTGGTCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_92_replicate_1	CTATAGCAATGTTGTGGTCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_91_replicate_9	CTATAGCAATGTTGTGGGCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_91_replicate_8	CTATAGCAATGTTGTGGGCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_91_replicate_7	CTATAGCAATGTTGTGGGCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_91_replicate_6	CTATAGCAATGTTGTGGGCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_91_replicate_5	CTATAGCAATGTTGTGGGCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_91_replicate_4	CTATAGCAATGTTGTGGGCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_91_replicate_3	CTATAGCAATGTTGTGGGCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_91_replicate_2	CTATAGCAATGTTGTGGGCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_91_replicate_10	CTATAGCAATGTTGTGGGCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_91_replicate_1	CTATAGCAATGTTGTGGGCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_90_replicate_9	CTATAGCAATGTTGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_90_replicate_8	CTATAGCAATGTTGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_90_replicate_7	CTATAGCAATGTTGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_90_replicate_6	CTATAGCAATGTTGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_90_replicate_5	CTATAGCAATGTTGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_90_replicate_4	CTATAGCAATGTTGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_90_replicate_3	CTATAGCAATGTTGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_90_replicate_2	CTATAGCAATGTTGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_90_replicate_10	CTATAGCAATGTTGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_90_replicate_1	CTATAGCAATGTTGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_9_replicate_9	CTATAGCAATGGAGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_9_replicate_8	CTATAGCAATGGAGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_9_replicate_7	CTATAGCAATGGAGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_9_replicate_6	CTATAGCAATGGAGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_9_replicate_5	CTATAGCAATGGAGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_9_replicate_4	CTATAGCAATGGAGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_9_replicate_3	CTATAGCAATGGAGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_9_replicate_2	CTATAGCAATGGAGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_9_replicate_10	CTATAGCAATGGAGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_9_replicate_1	CTATAGCAATGGAGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_89_replicate_9	CTATAGCAATGTTGTGGACGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_89_replicate_8	CTATAGCAATGTTGTGGACGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_89_replicate_7	CTATAGCAATGTTGTGGACGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_89_replicate_6	CTATAGCAATGTTGTGGACGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_89_replicate_5	CTATAGCAATGTTGTGGACGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_89_replicate_4	CTATAGCAATGTTGTGGACGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_89_replicate_3	CTATAGCAATGTTGTGGACGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_89_replicate_2	CTATAGCAATGTTGTGGACGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_89_replicate_10	CTATAGCAATGTTGTGGACGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_89_replicate_1	CTATAGCAATGTTGTGGACGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_88_replicate_9	CTATAGCAATGTTGTGCTCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_88_replicate_8	CTATAGCAATGTTGTGCTCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_88_replicate_7	CTATAGCAATGTTGTGCTCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_88_replicate_6	CTATAGCAATGTTGTGCTCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_88_replicate_5	CTATAGCAATGTTGTGCTCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_88_replicate_4	CTATAGCAATGTTGTGCTCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_88_replicate_3	CTATAGCAATGTTGTGCTCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_88_replicate_2	CTATAGCAATGTTGTGCTCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_88_replicate_10	CTATAGCAATGTTGTGCTCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_88_replicate_1	CTATAGCAATGTTGTGCTCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_87_replicate_9	CTATAGCAATGTTGTGCGCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_87_replicate_8	CTATAGCAATGTTGTGCGCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_87_replicate_7	CTATAGCAATGTTGTGCGCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_87_replicate_6	CTATAGCAATGTTGTGCGCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_87_replicate_5	CTATAGCAATGTTGTGCGCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_87_replicate_4	CTATAGCAATGTTGTGCGCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_87_replicate_3	CTATAGCAATGTTGTGCGCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_87_replicate_2	CTATAGCAATGTTGTGCGCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_87_replicate_10	CTATAGCAATGTTGTGCGCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_87_replicate_1	CTATAGCAATGTTGTGCGCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_86_replicate_9	CTATAGCAATGTTGTGCCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_86_replicate_8	CTATAGCAATGTTGTGCCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_86_replicate_7	CTATAGCAATGTTGTGCCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_86_replicate_6	CTATAGCAATGTTGTGCCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_86_replicate_5	CTATAGCAATGTTGTGCCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_86_replicate_4	CTATAGCAATGTTGTGCCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_86_replicate_3	CTATAGCAATGTTGTGCCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_86_replicate_2	CTATAGCAATGTTGTGCCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_86_replicate_10	CTATAGCAATGTTGTGCCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_86_replicate_1	CTATAGCAATGTTGTGCCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_85_replicate_9	CTATAGCAATGTTGTGCACGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_85_replicate_8	CTATAGCAATGTTGTGCACGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_85_replicate_7	CTATAGCAATGTTGTGCACGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_85_replicate_6	CTATAGCAATGTTGTGCACGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_85_replicate_5	CTATAGCAATGTTGTGCACGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_85_replicate_4	CTATAGCAATGTTGTGCACGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_85_replicate_3	CTATAGCAATGTTGTGCACGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_85_replicate_2	CTATAGCAATGTTGTGCACGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_85_replicate_10	CTATAGCAATGTTGTGCACGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_85_replicate_1	CTATAGCAATGTTGTGCACGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_84_replicate_9	CTATAGCAATGTTGTGATCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_84_replicate_8	CTATAGCAATGTTGTGATCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_84_replicate_7	CTATAGCAATGTTGTGATCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_84_replicate_6	CTATAGCAATGTTGTGATCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_84_replicate_5	CTATAGCAATGTTGTGATCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_84_replicate_4	CTATAGCAATGTTGTGATCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_84_replicate_3	CTATAGCAATGTTGTGATCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_84_replicate_2	CTATAGCAATGTTGTGATCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_84_replicate_10	CTATAGCAATGTTGTGATCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_84_replicate_1	CTATAGCAATGTTGTGATCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_83_replicate_9	CTATAGCAATGTTGTGAGCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_83_replicate_8	CTATAGCAATGTTGTGAGCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_83_replicate_7	CTATAGCAATGTTGTGAGCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_83_replicate_6	CTATAGCAATGTTGTGAGCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_83_replicate_5	CTATAGCAATGTTGTGAGCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_83_replicate_4	CTATAGCAATGTTGTGAGCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_83_replicate_3	CTATAGCAATGTTGTGAGCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_83_replicate_2	CTATAGCAATGTTGTGAGCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_83_replicate_10	CTATAGCAATGTTGTGAGCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_83_replicate_1	CTATAGCAATGTTGTGAGCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_82_replicate_9	CTATAGCAATGTTGTGACCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_82_replicate_8	CTATAGCAATGTTGTGACCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_82_replicate_7	CTATAGCAATGTTGTGACCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_82_replicate_6	CTATAGCAATGTTGTGACCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_82_replicate_5	CTATAGCAATGTTGTGACCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_82_replicate_4	CTATAGCAATGTTGTGACCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_82_replicate_3	CTATAGCAATGTTGTGACCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_82_replicate_2	CTATAGCAATGTTGTGACCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_82_replicate_10	CTATAGCAATGTTGTGACCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_82_replicate_1	CTATAGCAATGTTGTGACCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_81_replicate_9	CTATAGCAATGTTGTGAACGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_81_replicate_8	CTATAGCAATGTTGTGAACGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_81_replicate_7	CTATAGCAATGTTGTGAACGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_81_replicate_6	CTATAGCAATGTTGTGAACGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_81_replicate_5	CTATAGCAATGTTGTGAACGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_81_replicate_4	CTATAGCAATGTTGTGAACGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_81_replicate_3	CTATAGCAATGTTGTGAACGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_81_replicate_2	CTATAGCAATGTTGTGAACGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_81_replicate_10	CTATAGCAATGTTGTGAACGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_81_replicate_1	CTATAGCAATGTTGTGAACGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_80_replicate_9	CTATAGCAATGTTGTTTCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_80_replicate_8	CTATAGCAATGTTGTTTCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_80_replicate_7	CTATAGCAATGTTGTTTCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_80_replicate_6	CTATAGCAATGTTGTTTCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_80_replicate_5	CTATAGCAATGTTGTTTCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_80_replicate_4	CTATAGCAATGTTGTTTCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_80_replicate_3	CTATAGCAATGTTGTTTCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_80_replicate_2	CTATAGCAATGTTGTTTCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_80_replicate_10	CTATAGCAATGTTGTTTCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_80_replicate_1	CTATAGCAATGTTGTTTCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_8_replicate_9	CTATAGCAATGCTGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_8_replicate_8	CTATAGCAATGCTGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_8_replicate_7	CTATAGCAATGCTGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_8_replicate_6	CTATAGCAATGCTGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_8_replicate_5	CTATAGCAATGCTGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_8_replicate_4	CTATAGCAATGCTGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_8_replicate_3	CTATAGCAATGCTGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_8_replicate_2	CTATAGCAATGCTGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_8_replicate_10	CTATAGCAATGCTGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_8_replicate_1	CTATAGCAATGCTGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_79_replicate_9	CTATAGCAATGTTGTTGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_79_replicate_8	CTATAGCAATGTTGTTGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_79_replicate_7	CTATAGCAATGTTGTTGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_79_replicate_6	CTATAGCAATGTTGTTGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_79_replicate_5	CTATAGCAATGTTGTTGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_79_replicate_4	CTATAGCAATGTTGTTGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_79_replicate_3	CTATAGCAATGTTGTTGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_79_replicate_2	CTATAGCAATGTTGTTGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_79_replicate_10	CTATAGCAATGTTGTTGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_79_replicate_1	CTATAGCAATGTTGTTGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_78_replicate_9	CTATAGCAATGTTGTTCCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_78_replicate_8	CTATAGCAATGTTGTTCCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_78_replicate_7	CTATAGCAATGTTGTTCCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_78_replicate_6	CTATAGCAATGTTGTTCCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_78_replicate_5	CTATAGCAATGTTGTTCCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_78_replicate_4	CTATAGCAATGTTGTTCCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_78_replicate_3	CTATAGCAATGTTGTTCCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_78_replicate_2	CTATAGCAATGTTGTTCCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_78_replicate_10	CTATAGCAATGTTGTTCCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_78_replicate_1	CTATAGCAATGTTGTTCCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_77_replicate_9	CTATAGCAATGTTGTTACCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_77_replicate_8	CTATAGCAATGTTGTTACCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_77_replicate_7	CTATAGCAATGTTGTTACCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_77_replicate_6	CTATAGCAATGTTGTTACCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_77_replicate_5	CTATAGCAATGTTGTTACCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_77_replicate_4	CTATAGCAATGTTGTTACCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_77_replicate_3	CTATAGCAATGTTGTTACCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_77_replicate_2	CTATAGCAATGTTGTTACCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_77_replicate_10	CTATAGCAATGTTGTTACCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_77_replicate_1	CTATAGCAATGTTGTTACCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_76_replicate_9	CTATAGCAATGTTGTGTCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_76_replicate_8	CTATAGCAATGTTGTGTCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_76_replicate_7	CTATAGCAATGTTGTGTCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_76_replicate_6	CTATAGCAATGTTGTGTCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_76_replicate_5	CTATAGCAATGTTGTGTCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_76_replicate_4	CTATAGCAATGTTGTGTCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_76_replicate_3	CTATAGCAATGTTGTGTCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_76_replicate_2	CTATAGCAATGTTGTGTCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_76_replicate_10	CTATAGCAATGTTGTGTCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_76_replicate_1	CTATAGCAATGTTGTGTCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_75_replicate_9	CTATAGCAATGTTGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_75_replicate_8	CTATAGCAATGTTGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_75_replicate_7	CTATAGCAATGTTGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_75_replicate_6	CTATAGCAATGTTGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_75_replicate_5	CTATAGCAATGTTGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_75_replicate_4	CTATAGCAATGTTGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_75_replicate_3	CTATAGCAATGTTGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_75_replicate_2	CTATAGCAATGTTGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_75_replicate_10	CTATAGCAATGTTGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_75_replicate_1	CTATAGCAATGTTGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_74_replicate_9	CTATAGCAATGTTGTGCCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_74_replicate_8	CTATAGCAATGTTGTGCCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_74_replicate_7	CTATAGCAATGTTGTGCCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_74_replicate_6	CTATAGCAATGTTGTGCCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_74_replicate_5	CTATAGCAATGTTGTGCCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_74_replicate_4	CTATAGCAATGTTGTGCCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_74_replicate_3	CTATAGCAATGTTGTGCCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_74_replicate_2	CTATAGCAATGTTGTGCCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_74_replicate_10	CTATAGCAATGTTGTGCCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_74_replicate_1	CTATAGCAATGTTGTGCCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_73_replicate_9	CTATAGCAATGTTGTGACCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_73_replicate_8	CTATAGCAATGTTGTGACCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_73_replicate_7	CTATAGCAATGTTGTGACCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_73_replicate_6	CTATAGCAATGTTGTGACCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_73_replicate_5	CTATAGCAATGTTGTGACCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_73_replicate_4	CTATAGCAATGTTGTGACCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_73_replicate_3	CTATAGCAATGTTGTGACCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_73_replicate_2	CTATAGCAATGTTGTGACCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_73_replicate_10	CTATAGCAATGTTGTGACCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_73_replicate_1	CTATAGCAATGTTGTGACCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_72_replicate_9	CTATAGCAATGTTGTCTCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_72_replicate_8	CTATAGCAATGTTGTCTCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_72_replicate_7	CTATAGCAATGTTGTCTCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_72_replicate_6	CTATAGCAATGTTGTCTCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_72_replicate_5	CTATAGCAATGTTGTCTCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_72_replicate_4	CTATAGCAATGTTGTCTCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_72_replicate_3	CTATAGCAATGTTGTCTCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_72_replicate_2	CTATAGCAATGTTGTCTCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_72_replicate_10	CTATAGCAATGTTGTCTCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_72_replicate_1	CTATAGCAATGTTGTCTCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_71_replicate_9	CTATAGCAATGTTGTCGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_71_replicate_8	CTATAGCAATGTTGTCGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_71_replicate_7	CTATAGCAATGTTGTCGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_71_replicate_6	CTATAGCAATGTTGTCGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_71_replicate_5	CTATAGCAATGTTGTCGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_71_replicate_4	CTATAGCAATGTTGTCGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_71_replicate_3	CTATAGCAATGTTGTCGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_71_replicate_2	CTATAGCAATGTTGTCGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_71_replicate_10	CTATAGCAATGTTGTCGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_71_replicate_1	CTATAGCAATGTTGTCGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_70_replicate_9	CTATAGCAATGTTGTCCCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_70_replicate_8	CTATAGCAATGTTGTCCCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_70_replicate_7	CTATAGCAATGTTGTCCCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_70_replicate_6	CTATAGCAATGTTGTCCCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_70_replicate_5	CTATAGCAATGTTGTCCCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_70_replicate_4	CTATAGCAATGTTGTCCCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_70_replicate_3	CTATAGCAATGTTGTCCCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_70_replicate_2	CTATAGCAATGTTGTCCCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_70_replicate_10	CTATAGCAATGTTGTCCCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_70_replicate_1	CTATAGCAATGTTGTCCCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_7_replicate_9	CTATAGCAATGCGGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_7_replicate_8	CTATAGCAATGCGGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_7_replicate_7	CTATAGCAATGCGGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_7_replicate_6	CTATAGCAATGCGGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_7_replicate_5	CTATAGCAATGCGGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_7_replicate_4	CTATAGCAATGCGGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_7_replicate_3	CTATAGCAATGCGGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_7_replicate_2	CTATAGCAATGCGGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_7_replicate_10	CTATAGCAATGCGGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_7_replicate_1	CTATAGCAATGCGGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_69_replicate_9	CTATAGCAATGTTGTCACCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_69_replicate_8	CTATAGCAATGTTGTCACCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_69_replicate_7	CTATAGCAATGTTGTCACCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_69_replicate_6	CTATAGCAATGTTGTCACCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_69_replicate_5	CTATAGCAATGTTGTCACCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_69_replicate_4	CTATAGCAATGTTGTCACCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_69_replicate_3	CTATAGCAATGTTGTCACCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_69_replicate_2	CTATAGCAATGTTGTCACCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_69_replicate_10	CTATAGCAATGTTGTCACCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_69_replicate_1	CTATAGCAATGTTGTCACCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_68_replicate_9	CTATAGCAATGTTGTATCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_68_replicate_8	CTATAGCAATGTTGTATCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_68_replicate_7	CTATAGCAATGTTGTATCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_68_replicate_6	CTATAGCAATGTTGTATCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_68_replicate_5	CTATAGCAATGTTGTATCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_68_replicate_4	CTATAGCAATGTTGTATCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_68_replicate_3	CTATAGCAATGTTGTATCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_68_replicate_2	CTATAGCAATGTTGTATCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_68_replicate_10	CTATAGCAATGTTGTATCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_68_replicate_1	CTATAGCAATGTTGTATCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_67_replicate_9	CTATAGCAATGTTGTAGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_67_replicate_8	CTATAGCAATGTTGTAGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_67_replicate_7	CTATAGCAATGTTGTAGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_67_replicate_6	CTATAGCAATGTTGTAGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_67_replicate_5	CTATAGCAATGTTGTAGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_67_replicate_4	CTATAGCAATGTTGTAGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_67_replicate_3	CTATAGCAATGTTGTAGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_67_replicate_2	CTATAGCAATGTTGTAGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_67_replicate_10	CTATAGCAATGTTGTAGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_67_replicate_1	CTATAGCAATGTTGTAGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_66_replicate_9	CTATAGCAATGTTGTACCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_66_replicate_8	CTATAGCAATGTTGTACCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_66_replicate_7	CTATAGCAATGTTGTACCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_66_replicate_6	CTATAGCAATGTTGTACCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_66_replicate_5	CTATAGCAATGTTGTACCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_66_replicate_4	CTATAGCAATGTTGTACCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_66_replicate_3	CTATAGCAATGTTGTACCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_66_replicate_2	CTATAGCAATGTTGTACCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_66_replicate_10	CTATAGCAATGTTGTACCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_66_replicate_1	CTATAGCAATGTTGTACCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_65_replicate_9	CTATAGCAATGTTGTAACCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_65_replicate_8	CTATAGCAATGTTGTAACCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_65_replicate_7	CTATAGCAATGTTGTAACCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_65_replicate_6	CTATAGCAATGTTGTAACCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_65_replicate_5	CTATAGCAATGTTGTAACCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_65_replicate_4	CTATAGCAATGTTGTAACCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_65_replicate_3	CTATAGCAATGTTGTAACCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_65_replicate_2	CTATAGCAATGTTGTAACCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_65_replicate_10	CTATAGCAATGTTGTAACCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_65_replicate_1	CTATAGCAATGTTGTAACCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_64_replicate_9	CTATAGCAATGTTGTTGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_64_replicate_8	CTATAGCAATGTTGTTGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_64_replicate_7	CTATAGCAATGTTGTTGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_64_replicate_6	CTATAGCAATGTTGTTGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_64_replicate_5	CTATAGCAATGTTGTTGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_64_replicate_4	CTATAGCAATGTTGTTGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_64_replicate_3	CTATAGCAATGTTGTTGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_64_replicate_2	CTATAGCAATGTTGTTGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_64_replicate_10	CTATAGCAATGTTGTTGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_64_replicate_1	CTATAGCAATGTTGTTGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_63_replicate_9	CTATAGCAATGTTGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_63_replicate_8	CTATAGCAATGTTGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_63_replicate_7	CTATAGCAATGTTGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_63_replicate_6	CTATAGCAATGTTGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_63_replicate_5	CTATAGCAATGTTGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_63_replicate_4	CTATAGCAATGTTGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_63_replicate_3	CTATAGCAATGTTGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_63_replicate_2	CTATAGCAATGTTGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_63_replicate_10	CTATAGCAATGTTGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_63_replicate_1	CTATAGCAATGTTGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_62_replicate_9	CTATAGCAATGTTGTCGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_62_replicate_8	CTATAGCAATGTTGTCGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_62_replicate_7	CTATAGCAATGTTGTCGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_62_replicate_6	CTATAGCAATGTTGTCGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_62_replicate_5	CTATAGCAATGTTGTCGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_62_replicate_4	CTATAGCAATGTTGTCGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_62_replicate_3	CTATAGCAATGTTGTCGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_62_replicate_2	CTATAGCAATGTTGTCGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_62_replicate_10	CTATAGCAATGTTGTCGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_62_replicate_1	CTATAGCAATGTTGTCGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_61_replicate_9	CTATAGCAATGTTGTAGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_61_replicate_8	CTATAGCAATGTTGTAGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_61_replicate_7	CTATAGCAATGTTGTAGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_61_replicate_6	CTATAGCAATGTTGTAGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_61_replicate_5	CTATAGCAATGTTGTAGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_61_replicate_4	CTATAGCAATGTTGTAGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_61_replicate_3	CTATAGCAATGTTGTAGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_61_replicate_2	CTATAGCAATGTTGTAGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_61_replicate_10	CTATAGCAATGTTGTAGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_61_replicate_1	CTATAGCAATGTTGTAGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_60_replicate_9	CTATAGCAATGTTGGTGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_60_replicate_8	CTATAGCAATGTTGGTGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_60_replicate_7	CTATAGCAATGTTGGTGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_60_replicate_6	CTATAGCAATGTTGGTGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_60_replicate_5	CTATAGCAATGTTGGTGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_60_replicate_4	CTATAGCAATGTTGGTGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_60_replicate_3	CTATAGCAATGTTGGTGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_60_replicate_2	CTATAGCAATGTTGGTGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_60_replicate_10	CTATAGCAATGTTGGTGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_60_replicate_1	CTATAGCAATGTTGGTGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_6_replicate_9	CTATAGCAATGCCGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_6_replicate_8	CTATAGCAATGCCGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_6_replicate_7	CTATAGCAATGCCGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_6_replicate_6	CTATAGCAATGCCGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_6_replicate_5	CTATAGCAATGCCGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_6_replicate_4	CTATAGCAATGCCGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_6_replicate_3	CTATAGCAATGCCGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_6_replicate_2	CTATAGCAATGCCGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_6_replicate_10	CTATAGCAATGCCGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_6_replicate_1	CTATAGCAATGCCGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_59_replicate_9	CTATAGCAATGTTGGGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_59_replicate_8	CTATAGCAATGTTGGGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_59_replicate_7	CTATAGCAATGTTGGGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_59_replicate_6	CTATAGCAATGTTGGGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_59_replicate_5	CTATAGCAATGTTGGGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_59_replicate_4	CTATAGCAATGTTGGGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_59_replicate_3	CTATAGCAATGTTGGGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_59_replicate_2	CTATAGCAATGTTGGGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_59_replicate_10	CTATAGCAATGTTGGGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_59_replicate_1	CTATAGCAATGTTGGGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_58_replicate_9	CTATAGCAATGTTGGCGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_58_replicate_8	CTATAGCAATGTTGGCGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_58_replicate_7	CTATAGCAATGTTGGCGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_58_replicate_6	CTATAGCAATGTTGGCGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_58_replicate_5	CTATAGCAATGTTGGCGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_58_replicate_4	CTATAGCAATGTTGGCGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_58_replicate_3	CTATAGCAATGTTGGCGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_58_replicate_2	CTATAGCAATGTTGGCGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_58_replicate_10	CTATAGCAATGTTGGCGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_58_replicate_1	CTATAGCAATGTTGGCGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_57_replicate_9	CTATAGCAATGTTGGAGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_57_replicate_8	CTATAGCAATGTTGGAGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_57_replicate_7	CTATAGCAATGTTGGAGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_57_replicate_6	CTATAGCAATGTTGGAGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_57_replicate_5	CTATAGCAATGTTGGAGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_57_replicate_4	CTATAGCAATGTTGGAGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_57_replicate_3	CTATAGCAATGTTGGAGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_57_replicate_2	CTATAGCAATGTTGGAGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_57_replicate_10	CTATAGCAATGTTGGAGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_57_replicate_1	CTATAGCAATGTTGGAGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_56_replicate_9	CTATAGCAATGTTGCTGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_56_replicate_8	CTATAGCAATGTTGCTGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_56_replicate_7	CTATAGCAATGTTGCTGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_56_replicate_6	CTATAGCAATGTTGCTGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_56_replicate_5	CTATAGCAATGTTGCTGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_56_replicate_4	CTATAGCAATGTTGCTGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_56_replicate_3	CTATAGCAATGTTGCTGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_56_replicate_2	CTATAGCAATGTTGCTGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_56_replicate_10	CTATAGCAATGTTGCTGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_56_replicate_1	CTATAGCAATGTTGCTGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_55_replicate_9	CTATAGCAATGTTGCGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_55_replicate_8	CTATAGCAATGTTGCGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_55_replicate_7	CTATAGCAATGTTGCGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_55_replicate_6	CTATAGCAATGTTGCGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_55_replicate_5	CTATAGCAATGTTGCGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_55_replicate_4	CTATAGCAATGTTGCGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_55_replicate_3	CTATAGCAATGTTGCGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_55_replicate_2	CTATAGCAATGTTGCGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_55_replicate_10	CTATAGCAATGTTGCGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_55_replicate_1	CTATAGCAATGTTGCGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_54_replicate_9	CTATAGCAATGTTGCCGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_54_replicate_8	CTATAGCAATGTTGCCGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_54_replicate_7	CTATAGCAATGTTGCCGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_54_replicate_6	CTATAGCAATGTTGCCGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_54_replicate_5	CTATAGCAATGTTGCCGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_54_replicate_4	CTATAGCAATGTTGCCGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_54_replicate_3	CTATAGCAATGTTGCCGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_54_replicate_2	CTATAGCAATGTTGCCGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_54_replicate_10	CTATAGCAATGTTGCCGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_54_replicate_1	CTATAGCAATGTTGCCGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_53_replicate_9	CTATAGCAATGTTGCAGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_53_replicate_8	CTATAGCAATGTTGCAGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_53_replicate_7	CTATAGCAATGTTGCAGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_53_replicate_6	CTATAGCAATGTTGCAGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_53_replicate_5	CTATAGCAATGTTGCAGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_53_replicate_4	CTATAGCAATGTTGCAGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_53_replicate_3	CTATAGCAATGTTGCAGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_53_replicate_2	CTATAGCAATGTTGCAGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_53_replicate_10	CTATAGCAATGTTGCAGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_53_replicate_1	CTATAGCAATGTTGCAGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_52_replicate_9	CTATAGCAATGTTGATGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_52_replicate_8	CTATAGCAATGTTGATGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_52_replicate_7	CTATAGCAATGTTGATGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_52_replicate_6	CTATAGCAATGTTGATGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_52_replicate_5	CTATAGCAATGTTGATGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_52_replicate_4	CTATAGCAATGTTGATGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_52_replicate_3	CTATAGCAATGTTGATGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_52_replicate_2	CTATAGCAATGTTGATGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_52_replicate_10	CTATAGCAATGTTGATGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_52_replicate_1	CTATAGCAATGTTGATGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_51_replicate_9	CTATAGCAATGTTGAGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_51_replicate_8	CTATAGCAATGTTGAGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_51_replicate_7	CTATAGCAATGTTGAGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_51_replicate_6	CTATAGCAATGTTGAGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_51_replicate_5	CTATAGCAATGTTGAGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_51_replicate_4	CTATAGCAATGTTGAGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_51_replicate_3	CTATAGCAATGTTGAGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_51_replicate_2	CTATAGCAATGTTGAGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_51_replicate_10	CTATAGCAATGTTGAGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_51_replicate_1	CTATAGCAATGTTGAGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_50_replicate_9	CTATAGCAATGTTGACGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_50_replicate_8	CTATAGCAATGTTGACGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_50_replicate_7	CTATAGCAATGTTGACGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_50_replicate_6	CTATAGCAATGTTGACGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_50_replicate_5	CTATAGCAATGTTGACGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_50_replicate_4	CTATAGCAATGTTGACGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_50_replicate_3	CTATAGCAATGTTGACGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_50_replicate_2	CTATAGCAATGTTGACGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_50_replicate_10	CTATAGCAATGTTGACGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_50_replicate_1	CTATAGCAATGTTGACGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_5_replicate_9	CTATAGCAATGCAGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_5_replicate_8	CTATAGCAATGCAGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_5_replicate_7	CTATAGCAATGCAGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_5_replicate_6	CTATAGCAATGCAGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_5_replicate_5	CTATAGCAATGCAGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_5_replicate_4	CTATAGCAATGCAGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_5_replicate_3	CTATAGCAATGCAGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_5_replicate_2	CTATAGCAATGCAGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_5_replicate_10	CTATAGCAATGCAGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_5_replicate_1	CTATAGCAATGCAGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_49_replicate_9	CTATAGCAATGTTGAAGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_49_replicate_8	CTATAGCAATGTTGAAGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_49_replicate_7	CTATAGCAATGTTGAAGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_49_replicate_6	CTATAGCAATGTTGAAGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_49_replicate_5	CTATAGCAATGTTGAAGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_49_replicate_4	CTATAGCAATGTTGAAGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_49_replicate_3	CTATAGCAATGTTGAAGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_49_replicate_2	CTATAGCAATGTTGAAGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_49_replicate_10	CTATAGCAATGTTGAAGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_49_replicate_1	CTATAGCAATGTTGAAGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_48_replicate_9	CTATAGCAATGTTTTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_48_replicate_8	CTATAGCAATGTTTTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_48_replicate_7	CTATAGCAATGTTTTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_48_replicate_6	CTATAGCAATGTTTTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_48_replicate_5	CTATAGCAATGTTTTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_48_replicate_4	CTATAGCAATGTTTTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_48_replicate_3	CTATAGCAATGTTTTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_48_replicate_2	CTATAGCAATGTTTTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_48_replicate_10	CTATAGCAATGTTTTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_48_replicate_1	CTATAGCAATGTTTTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_47_replicate_9	CTATAGCAATGTTTGGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_47_replicate_8	CTATAGCAATGTTTGGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_47_replicate_7	CTATAGCAATGTTTGGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_47_replicate_6	CTATAGCAATGTTTGGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_47_replicate_5	CTATAGCAATGTTTGGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_47_replicate_4	CTATAGCAATGTTTGGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_47_replicate_3	CTATAGCAATGTTTGGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_47_replicate_2	CTATAGCAATGTTTGGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_47_replicate_10	CTATAGCAATGTTTGGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_47_replicate_1	CTATAGCAATGTTTGGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_46_replicate_9	CTATAGCAATGTTTCGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_46_replicate_8	CTATAGCAATGTTTCGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_46_replicate_7	CTATAGCAATGTTTCGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_46_replicate_6	CTATAGCAATGTTTCGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_46_replicate_5	CTATAGCAATGTTTCGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_46_replicate_4	CTATAGCAATGTTTCGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_46_replicate_3	CTATAGCAATGTTTCGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_46_replicate_2	CTATAGCAATGTTTCGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_46_replicate_10	CTATAGCAATGTTTCGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_46_replicate_1	CTATAGCAATGTTTCGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_45_replicate_9	CTATAGCAATGTTTAGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_45_replicate_8	CTATAGCAATGTTTAGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_45_replicate_7	CTATAGCAATGTTTAGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_45_replicate_6	CTATAGCAATGTTTAGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_45_replicate_5	CTATAGCAATGTTTAGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_45_replicate_4	CTATAGCAATGTTTAGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_45_replicate_3	CTATAGCAATGTTTAGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_45_replicate_2	CTATAGCAATGTTTAGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_45_replicate_10	CTATAGCAATGTTTAGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_45_replicate_1	CTATAGCAATGTTTAGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_44_replicate_9	CTATAGCAATGTTGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_44_replicate_8	CTATAGCAATGTTGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_44_replicate_7	CTATAGCAATGTTGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_44_replicate_6	CTATAGCAATGTTGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_44_replicate_5	CTATAGCAATGTTGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_44_replicate_4	CTATAGCAATGTTGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_44_replicate_3	CTATAGCAATGTTGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_44_replicate_2	CTATAGCAATGTTGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_44_replicate_10	CTATAGCAATGTTGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_44_replicate_1	CTATAGCAATGTTGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_43_replicate_9	CTATAGCAATGTTGGGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_43_replicate_8	CTATAGCAATGTTGGGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_43_replicate_7	CTATAGCAATGTTGGGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_43_replicate_6	CTATAGCAATGTTGGGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_43_replicate_5	CTATAGCAATGTTGGGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_43_replicate_4	CTATAGCAATGTTGGGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_43_replicate_3	CTATAGCAATGTTGGGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_43_replicate_2	CTATAGCAATGTTGGGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_43_replicate_10	CTATAGCAATGTTGGGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_43_replicate_1	CTATAGCAATGTTGGGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_42_replicate_9	CTATAGCAATGTTGCGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_42_replicate_8	CTATAGCAATGTTGCGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_42_replicate_7	CTATAGCAATGTTGCGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_42_replicate_6	CTATAGCAATGTTGCGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_42_replicate_5	CTATAGCAATGTTGCGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_42_replicate_4	CTATAGCAATGTTGCGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_42_replicate_3	CTATAGCAATGTTGCGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_42_replicate_2	CTATAGCAATGTTGCGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_42_replicate_10	CTATAGCAATGTTGCGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_42_replicate_1	CTATAGCAATGTTGCGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_41_replicate_9	CTATAGCAATGTTGAGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_41_replicate_8	CTATAGCAATGTTGAGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_41_replicate_7	CTATAGCAATGTTGAGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_41_replicate_6	CTATAGCAATGTTGAGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_41_replicate_5	CTATAGCAATGTTGAGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_41_replicate_4	CTATAGCAATGTTGAGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_41_replicate_3	CTATAGCAATGTTGAGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_41_replicate_2	CTATAGCAATGTTGAGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_41_replicate_10	CTATAGCAATGTTGAGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_41_replicate_1	CTATAGCAATGTTGAGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_40_replicate_9	CTATAGCAATGTTCTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_40_replicate_8	CTATAGCAATGTTCTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_40_replicate_7	CTATAGCAATGTTCTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_40_replicate_6	CTATAGCAATGTTCTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_40_replicate_5	CTATAGCAATGTTCTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_40_replicate_4	CTATAGCAATGTTCTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_40_replicate_3	CTATAGCAATGTTCTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_40_replicate_2	CTATAGCAATGTTCTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_40_replicate_10	CTATAGCAATGTTCTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_40_replicate_1	CTATAGCAATGTTCTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_4_replicate_9	CTATAGCAATGATGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_4_replicate_8	CTATAGCAATGATGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_4_replicate_7	CTATAGCAATGATGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_4_replicate_6	CTATAGCAATGATGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_4_replicate_5	CTATAGCAATGATGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_4_replicate_4	CTATAGCAATGATGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_4_replicate_3	CTATAGCAATGATGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_4_replicate_2	CTATAGCAATGATGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_4_replicate_10	CTATAGCAATGATGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_4_replicate_1	CTATAGCAATGATGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_39_replicate_9	CTATAGCAATGTTCGGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_39_replicate_8	CTATAGCAATGTTCGGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_39_replicate_7	CTATAGCAATGTTCGGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_39_replicate_6	CTATAGCAATGTTCGGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_39_replicate_5	CTATAGCAATGTTCGGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_39_replicate_4	CTATAGCAATGTTCGGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_39_replicate_3	CTATAGCAATGTTCGGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_39_replicate_2	CTATAGCAATGTTCGGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_39_replicate_10	CTATAGCAATGTTCGGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_39_replicate_1	CTATAGCAATGTTCGGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_38_replicate_9	CTATAGCAATGTTCCGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_38_replicate_8	CTATAGCAATGTTCCGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_38_replicate_7	CTATAGCAATGTTCCGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_38_replicate_6	CTATAGCAATGTTCCGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_38_replicate_5	CTATAGCAATGTTCCGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_38_replicate_4	CTATAGCAATGTTCCGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_38_replicate_3	CTATAGCAATGTTCCGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_38_replicate_2	CTATAGCAATGTTCCGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_38_replicate_10	CTATAGCAATGTTCCGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_38_replicate_1	CTATAGCAATGTTCCGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_37_replicate_9	CTATAGCAATGTTCAGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_37_replicate_8	CTATAGCAATGTTCAGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_37_replicate_7	CTATAGCAATGTTCAGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_37_replicate_6	CTATAGCAATGTTCAGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_37_replicate_5	CTATAGCAATGTTCAGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_37_replicate_4	CTATAGCAATGTTCAGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_37_replicate_3	CTATAGCAATGTTCAGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_37_replicate_2	CTATAGCAATGTTCAGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_37_replicate_10	CTATAGCAATGTTCAGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_37_replicate_1	CTATAGCAATGTTCAGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_36_replicate_9	CTATAGCAATGTTATGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_36_replicate_8	CTATAGCAATGTTATGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_36_replicate_7	CTATAGCAATGTTATGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_36_replicate_6	CTATAGCAATGTTATGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_36_replicate_5	CTATAGCAATGTTATGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_36_replicate_4	CTATAGCAATGTTATGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_36_replicate_3	CTATAGCAATGTTATGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_36_replicate_2	CTATAGCAATGTTATGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_36_replicate_10	CTATAGCAATGTTATGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_36_replicate_1	CTATAGCAATGTTATGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_35_replicate_9	CTATAGCAATGTTAGGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_35_replicate_8	CTATAGCAATGTTAGGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_35_replicate_7	CTATAGCAATGTTAGGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_35_replicate_6	CTATAGCAATGTTAGGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_35_replicate_5	CTATAGCAATGTTAGGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_35_replicate_4	CTATAGCAATGTTAGGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_35_replicate_3	CTATAGCAATGTTAGGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_35_replicate_2	CTATAGCAATGTTAGGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_35_replicate_10	CTATAGCAATGTTAGGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_35_replicate_1	CTATAGCAATGTTAGGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_34_replicate_9	CTATAGCAATGTTACGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_34_replicate_8	CTATAGCAATGTTACGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_34_replicate_7	CTATAGCAATGTTACGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_34_replicate_6	CTATAGCAATGTTACGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_34_replicate_5	CTATAGCAATGTTACGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_34_replicate_4	CTATAGCAATGTTACGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_34_replicate_3	CTATAGCAATGTTACGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_34_replicate_2	CTATAGCAATGTTACGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_34_replicate_10	CTATAGCAATGTTACGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_34_replicate_1	CTATAGCAATGTTACGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_33_replicate_9	CTATAGCAATGTTAAGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_33_replicate_8	CTATAGCAATGTTAAGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_33_replicate_7	CTATAGCAATGTTAAGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_33_replicate_6	CTATAGCAATGTTAAGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_33_replicate_5	CTATAGCAATGTTAAGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_33_replicate_4	CTATAGCAATGTTAAGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_33_replicate_3	CTATAGCAATGTTAAGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_33_replicate_2	CTATAGCAATGTTAAGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_33_replicate_10	CTATAGCAATGTTAAGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_33_replicate_1	CTATAGCAATGTTAAGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_32_replicate_9	CTATAGCAATGTTTTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_32_replicate_8	CTATAGCAATGTTTTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_32_replicate_7	CTATAGCAATGTTTTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_32_replicate_6	CTATAGCAATGTTTTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_32_replicate_5	CTATAGCAATGTTTTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_32_replicate_4	CTATAGCAATGTTTTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_32_replicate_3	CTATAGCAATGTTTTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_32_replicate_2	CTATAGCAATGTTTTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_32_replicate_10	CTATAGCAATGTTTTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_32_replicate_1	CTATAGCAATGTTTTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_31_replicate_9	CTATAGCAATGTTGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_31_replicate_8	CTATAGCAATGTTGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_31_replicate_7	CTATAGCAATGTTGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_31_replicate_6	CTATAGCAATGTTGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_31_replicate_5	CTATAGCAATGTTGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_31_replicate_4	CTATAGCAATGTTGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_31_replicate_3	CTATAGCAATGTTGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_31_replicate_2	CTATAGCAATGTTGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_31_replicate_10	CTATAGCAATGTTGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_31_replicate_1	CTATAGCAATGTTGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_30_replicate_9	CTATAGCAATGTTCTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_30_replicate_8	CTATAGCAATGTTCTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_30_replicate_7	CTATAGCAATGTTCTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_30_replicate_6	CTATAGCAATGTTCTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_30_replicate_5	CTATAGCAATGTTCTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_30_replicate_4	CTATAGCAATGTTCTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_30_replicate_3	CTATAGCAATGTTCTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_30_replicate_2	CTATAGCAATGTTCTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_30_replicate_10	CTATAGCAATGTTCTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_30_replicate_1	CTATAGCAATGTTCTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_3_replicate_9	CTATAGCAATGAGGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_3_replicate_8	CTATAGCAATGAGGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_3_replicate_7	CTATAGCAATGAGGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_3_replicate_6	CTATAGCAATGAGGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_3_replicate_5	CTATAGCAATGAGGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_3_replicate_4	CTATAGCAATGAGGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_3_replicate_3	CTATAGCAATGAGGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_3_replicate_2	CTATAGCAATGAGGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_3_replicate_10	CTATAGCAATGAGGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_3_replicate_1	CTATAGCAATGAGGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_29_replicate_9	CTATAGCAATGTTATGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_29_replicate_8	CTATAGCAATGTTATGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_29_replicate_7	CTATAGCAATGTTATGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_29_replicate_6	CTATAGCAATGTTATGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_29_replicate_5	CTATAGCAATGTTATGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_29_replicate_4	CTATAGCAATGTTATGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_29_replicate_3	CTATAGCAATGTTATGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_29_replicate_2	CTATAGCAATGTTATGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_29_replicate_10	CTATAGCAATGTTATGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_29_replicate_1	CTATAGCAATGTTATGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_28_replicate_9	CTATAGCAATGTGTTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_28_replicate_8	CTATAGCAATGTGTTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_28_replicate_7	CTATAGCAATGTGTTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_28_replicate_6	CTATAGCAATGTGTTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_28_replicate_5	CTATAGCAATGTGTTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_28_replicate_4	CTATAGCAATGTGTTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_28_replicate_3	CTATAGCAATGTGTTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_28_replicate_2	CTATAGCAATGTGTTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_28_replicate_10	CTATAGCAATGTGTTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_28_replicate_1	CTATAGCAATGTGTTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_27_replicate_9	CTATAGCAATGTGGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_27_replicate_8	CTATAGCAATGTGGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_27_replicate_7	CTATAGCAATGTGGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_27_replicate_6	CTATAGCAATGTGGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_27_replicate_5	CTATAGCAATGTGGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_27_replicate_4	CTATAGCAATGTGGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_27_replicate_3	CTATAGCAATGTGGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_27_replicate_2	CTATAGCAATGTGGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_27_replicate_10	CTATAGCAATGTGGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_27_replicate_1	CTATAGCAATGTGGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_26_replicate_9	CTATAGCAATGTGCTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_26_replicate_8	CTATAGCAATGTGCTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_26_replicate_7	CTATAGCAATGTGCTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_26_replicate_6	CTATAGCAATGTGCTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_26_replicate_5	CTATAGCAATGTGCTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_26_replicate_4	CTATAGCAATGTGCTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_26_replicate_3	CTATAGCAATGTGCTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_26_replicate_2	CTATAGCAATGTGCTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_26_replicate_10	CTATAGCAATGTGCTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_26_replicate_1	CTATAGCAATGTGCTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_25_replicate_9	CTATAGCAATGTGATGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_25_replicate_8	CTATAGCAATGTGATGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_25_replicate_7	CTATAGCAATGTGATGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_25_replicate_6	CTATAGCAATGTGATGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_25_replicate_5	CTATAGCAATGTGATGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_25_replicate_4	CTATAGCAATGTGATGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_25_replicate_3	CTATAGCAATGTGATGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_25_replicate_2	CTATAGCAATGTGATGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_25_replicate_10	CTATAGCAATGTGATGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_25_replicate_1	CTATAGCAATGTGATGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_24_replicate_9	CTATAGCAATGTCTTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_24_replicate_8	CTATAGCAATGTCTTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_24_replicate_7	CTATAGCAATGTCTTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_24_replicate_6	CTATAGCAATGTCTTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_24_replicate_5	CTATAGCAATGTCTTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_24_replicate_4	CTATAGCAATGTCTTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_24_replicate_3	CTATAGCAATGTCTTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_24_replicate_2	CTATAGCAATGTCTTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_24_replicate_10	CTATAGCAATGTCTTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_24_replicate_1	CTATAGCAATGTCTTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_23_replicate_9	CTATAGCAATGTCGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_23_replicate_8	CTATAGCAATGTCGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_23_replicate_7	CTATAGCAATGTCGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_23_replicate_6	CTATAGCAATGTCGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_23_replicate_5	CTATAGCAATGTCGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_23_replicate_4	CTATAGCAATGTCGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_23_replicate_3	CTATAGCAATGTCGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_23_replicate_2	CTATAGCAATGTCGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_23_replicate_10	CTATAGCAATGTCGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_23_replicate_1	CTATAGCAATGTCGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_224_replicate_9	CTATAGCAATGTTGTGGCCGTTTATTCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_224_replicate_8	CTATAGCAATGTTGTGGCCGTTTATTCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_224_replicate_7	CTATAGCAATGTTGTGGCCGTTTATTCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_224_replicate_6	CTATAGCAATGTTGTGGCCGTTTATTCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_224_replicate_5	CTATAGCAATGTTGTGGCCGTTTATTCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_224_replicate_4	CTATAGCAATGTTGTGGCCGTTTATTCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_224_replicate_3	CTATAGCAATGTTGTGGCCGTTTATTCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_224_replicate_2	CTATAGCAATGTTGTGGCCGTTTATTCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_224_replicate_10	CTATAGCAATGTTGTGGCCGTTTATTCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_224_replicate_1	CTATAGCAATGTTGTGGCCGTTTATTCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_223_replicate_9	CTATAGCAATGTTGTGGCCGTTTATGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_223_replicate_8	CTATAGCAATGTTGTGGCCGTTTATGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_223_replicate_7	CTATAGCAATGTTGTGGCCGTTTATGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_223_replicate_6	CTATAGCAATGTTGTGGCCGTTTATGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_223_replicate_5	CTATAGCAATGTTGTGGCCGTTTATGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_223_replicate_4	CTATAGCAATGTTGTGGCCGTTTATGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_223_replicate_3	CTATAGCAATGTTGTGGCCGTTTATGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_223_replicate_2	CTATAGCAATGTTGTGGCCGTTTATGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_223_replicate_10	CTATAGCAATGTTGTGGCCGTTTATGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_223_replicate_1	CTATAGCAATGTTGTGGCCGTTTATGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_222_replicate_9	CTATAGCAATGTTGTGGCCGTTTATCCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_222_replicate_8	CTATAGCAATGTTGTGGCCGTTTATCCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_222_replicate_7	CTATAGCAATGTTGTGGCCGTTTATCCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_222_replicate_6	CTATAGCAATGTTGTGGCCGTTTATCCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_222_replicate_5	CTATAGCAATGTTGTGGCCGTTTATCCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_222_replicate_4	CTATAGCAATGTTGTGGCCGTTTATCCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_222_replicate_3	CTATAGCAATGTTGTGGCCGTTTATCCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_222_replicate_2	CTATAGCAATGTTGTGGCCGTTTATCCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_222_replicate_10	CTATAGCAATGTTGTGGCCGTTTATCCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_222_replicate_1	CTATAGCAATGTTGTGGCCGTTTATCCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_221_replicate_9	CTATAGCAATGTTGTGGCCGTTTATACATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_221_replicate_8	CTATAGCAATGTTGTGGCCGTTTATACATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_221_replicate_7	CTATAGCAATGTTGTGGCCGTTTATACATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_221_replicate_6	CTATAGCAATGTTGTGGCCGTTTATACATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_221_replicate_5	CTATAGCAATGTTGTGGCCGTTTATACATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_221_replicate_4	CTATAGCAATGTTGTGGCCGTTTATACATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_221_replicate_3	CTATAGCAATGTTGTGGCCGTTTATACATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_221_replicate_2	CTATAGCAATGTTGTGGCCGTTTATACATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_221_replicate_10	CTATAGCAATGTTGTGGCCGTTTATACATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_221_replicate_1	CTATAGCAATGTTGTGGCCGTTTATACATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_220_replicate_9	CTATAGCAATGTTGTGGCCGTTTAGTCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_220_replicate_8	CTATAGCAATGTTGTGGCCGTTTAGTCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_220_replicate_7	CTATAGCAATGTTGTGGCCGTTTAGTCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_220_replicate_6	CTATAGCAATGTTGTGGCCGTTTAGTCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_220_replicate_5	CTATAGCAATGTTGTGGCCGTTTAGTCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_220_replicate_4	CTATAGCAATGTTGTGGCCGTTTAGTCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_220_replicate_3	CTATAGCAATGTTGTGGCCGTTTAGTCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_220_replicate_2	CTATAGCAATGTTGTGGCCGTTTAGTCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_220_replicate_10	CTATAGCAATGTTGTGGCCGTTTAGTCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_220_replicate_1	CTATAGCAATGTTGTGGCCGTTTAGTCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_22_replicate_9	CTATAGCAATGTCCTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_22_replicate_8	CTATAGCAATGTCCTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_22_replicate_7	CTATAGCAATGTCCTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_22_replicate_6	CTATAGCAATGTCCTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_22_replicate_5	CTATAGCAATGTCCTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_22_replicate_4	CTATAGCAATGTCCTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_22_replicate_3	CTATAGCAATGTCCTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_22_replicate_2	CTATAGCAATGTCCTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_22_replicate_10	CTATAGCAATGTCCTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_22_replicate_1	CTATAGCAATGTCCTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_219_replicate_9	CTATAGCAATGTTGTGGCCGTTTAGGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_219_replicate_8	CTATAGCAATGTTGTGGCCGTTTAGGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_219_replicate_7	CTATAGCAATGTTGTGGCCGTTTAGGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_219_replicate_6	CTATAGCAATGTTGTGGCCGTTTAGGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_219_replicate_5	CTATAGCAATGTTGTGGCCGTTTAGGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_219_replicate_4	CTATAGCAATGTTGTGGCCGTTTAGGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_219_replicate_3	CTATAGCAATGTTGTGGCCGTTTAGGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_219_replicate_2	CTATAGCAATGTTGTGGCCGTTTAGGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_219_replicate_10	CTATAGCAATGTTGTGGCCGTTTAGGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_219_replicate_1	CTATAGCAATGTTGTGGCCGTTTAGGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_218_replicate_9	CTATAGCAATGTTGTGGCCGTTTAGCCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_218_replicate_8	CTATAGCAATGTTGTGGCCGTTTAGCCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_218_replicate_7	CTATAGCAATGTTGTGGCCGTTTAGCCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_218_replicate_6	CTATAGCAATGTTGTGGCCGTTTAGCCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_218_replicate_5	CTATAGCAATGTTGTGGCCGTTTAGCCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_218_replicate_4	CTATAGCAATGTTGTGGCCGTTTAGCCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_218_replicate_3	CTATAGCAATGTTGTGGCCGTTTAGCCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_218_replicate_2	CTATAGCAATGTTGTGGCCGTTTAGCCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_218_replicate_10	CTATAGCAATGTTGTGGCCGTTTAGCCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_218_replicate_1	CTATAGCAATGTTGTGGCCGTTTAGCCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_217_replicate_9	CTATAGCAATGTTGTGGCCGTTTAGACATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_217_replicate_8	CTATAGCAATGTTGTGGCCGTTTAGACATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_217_replicate_7	CTATAGCAATGTTGTGGCCGTTTAGACATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_217_replicate_6	CTATAGCAATGTTGTGGCCGTTTAGACATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_217_replicate_5	CTATAGCAATGTTGTGGCCGTTTAGACATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_217_replicate_4	CTATAGCAATGTTGTGGCCGTTTAGACATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_217_replicate_3	CTATAGCAATGTTGTGGCCGTTTAGACATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_217_replicate_2	CTATAGCAATGTTGTGGCCGTTTAGACATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_217_replicate_10	CTATAGCAATGTTGTGGCCGTTTAGACATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_217_replicate_1	CTATAGCAATGTTGTGGCCGTTTAGACATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_216_replicate_9	CTATAGCAATGTTGTGGCCGTTTACTCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_216_replicate_8	CTATAGCAATGTTGTGGCCGTTTACTCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_216_replicate_7	CTATAGCAATGTTGTGGCCGTTTACTCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_216_replicate_6	CTATAGCAATGTTGTGGCCGTTTACTCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_216_replicate_5	CTATAGCAATGTTGTGGCCGTTTACTCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_216_replicate_4	CTATAGCAATGTTGTGGCCGTTTACTCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_216_replicate_3	CTATAGCAATGTTGTGGCCGTTTACTCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_216_replicate_2	CTATAGCAATGTTGTGGCCGTTTACTCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_216_replicate_10	CTATAGCAATGTTGTGGCCGTTTACTCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_216_replicate_1	CTATAGCAATGTTGTGGCCGTTTACTCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_215_replicate_9	CTATAGCAATGTTGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_215_replicate_8	CTATAGCAATGTTGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_215_replicate_7	CTATAGCAATGTTGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_215_replicate_6	CTATAGCAATGTTGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_215_replicate_5	CTATAGCAATGTTGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_215_replicate_4	CTATAGCAATGTTGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_215_replicate_3	CTATAGCAATGTTGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_215_replicate_2	CTATAGCAATGTTGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_215_replicate_10	CTATAGCAATGTTGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_215_replicate_1	CTATAGCAATGTTGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_214_replicate_9	CTATAGCAATGTTGTGGCCGTTTACCCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_214_replicate_8	CTATAGCAATGTTGTGGCCGTTTACCCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_214_replicate_7	CTATAGCAATGTTGTGGCCGTTTACCCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_214_replicate_6	CTATAGCAATGTTGTGGCCGTTTACCCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_214_replicate_5	CTATAGCAATGTTGTGGCCGTTTACCCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_214_replicate_4	CTATAGCAATGTTGTGGCCGTTTACCCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_214_replicate_3	CTATAGCAATGTTGTGGCCGTTTACCCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_214_replicate_2	CTATAGCAATGTTGTGGCCGTTTACCCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_214_replicate_10	CTATAGCAATGTTGTGGCCGTTTACCCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_214_replicate_1	CTATAGCAATGTTGTGGCCGTTTACCCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_213_replicate_9	CTATAGCAATGTTGTGGCCGTTTACACATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_213_replicate_8	CTATAGCAATGTTGTGGCCGTTTACACATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_213_replicate_7	CTATAGCAATGTTGTGGCCGTTTACACATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_213_replicate_6	CTATAGCAATGTTGTGGCCGTTTACACATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_213_replicate_5	CTATAGCAATGTTGTGGCCGTTTACACATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_213_replicate_4	CTATAGCAATGTTGTGGCCGTTTACACATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_213_replicate_3	CTATAGCAATGTTGTGGCCGTTTACACATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_213_replicate_2	CTATAGCAATGTTGTGGCCGTTTACACATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_213_replicate_10	CTATAGCAATGTTGTGGCCGTTTACACATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_213_replicate_1	CTATAGCAATGTTGTGGCCGTTTACACATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_212_replicate_9	CTATAGCAATGTTGTGGCCGTTTAATCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_212_replicate_8	CTATAGCAATGTTGTGGCCGTTTAATCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_212_replicate_7	CTATAGCAATGTTGTGGCCGTTTAATCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_212_replicate_6	CTATAGCAATGTTGTGGCCGTTTAATCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_212_replicate_5	CTATAGCAATGTTGTGGCCGTTTAATCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_212_replicate_4	CTATAGCAATGTTGTGGCCGTTTAATCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_212_replicate_3	CTATAGCAATGTTGTGGCCGTTTAATCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_212_replicate_2	CTATAGCAATGTTGTGGCCGTTTAATCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_212_replicate_10	CTATAGCAATGTTGTGGCCGTTTAATCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_212_replicate_1	CTATAGCAATGTTGTGGCCGTTTAATCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_211_replicate_9	CTATAGCAATGTTGTGGCCGTTTAAGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_211_replicate_8	CTATAGCAATGTTGTGGCCGTTTAAGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_211_replicate_7	CTATAGCAATGTTGTGGCCGTTTAAGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_211_replicate_6	CTATAGCAATGTTGTGGCCGTTTAAGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_211_replicate_5	CTATAGCAATGTTGTGGCCGTTTAAGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_211_replicate_4	CTATAGCAATGTTGTGGCCGTTTAAGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_211_replicate_3	CTATAGCAATGTTGTGGCCGTTTAAGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_211_replicate_2	CTATAGCAATGTTGTGGCCGTTTAAGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_211_replicate_10	CTATAGCAATGTTGTGGCCGTTTAAGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_211_replicate_1	CTATAGCAATGTTGTGGCCGTTTAAGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_210_replicate_9	CTATAGCAATGTTGTGGCCGTTTAACCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_210_replicate_8	CTATAGCAATGTTGTGGCCGTTTAACCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_210_replicate_7	CTATAGCAATGTTGTGGCCGTTTAACCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_210_replicate_6	CTATAGCAATGTTGTGGCCGTTTAACCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_210_replicate_5	CTATAGCAATGTTGTGGCCGTTTAACCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_210_replicate_4	CTATAGCAATGTTGTGGCCGTTTAACCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_210_replicate_3	CTATAGCAATGTTGTGGCCGTTTAACCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_210_replicate_2	CTATAGCAATGTTGTGGCCGTTTAACCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_210_replicate_10	CTATAGCAATGTTGTGGCCGTTTAACCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_210_replicate_1	CTATAGCAATGTTGTGGCCGTTTAACCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_21_replicate_9	CTATAGCAATGTCATGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_21_replicate_8	CTATAGCAATGTCATGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_21_replicate_7	CTATAGCAATGTCATGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_21_replicate_6	CTATAGCAATGTCATGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_21_replicate_5	CTATAGCAATGTCATGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_21_replicate_4	CTATAGCAATGTCATGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_21_replicate_3	CTATAGCAATGTCATGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_21_replicate_2	CTATAGCAATGTCATGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_21_replicate_10	CTATAGCAATGTCATGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_21_replicate_1	CTATAGCAATGTCATGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_209_replicate_9	CTATAGCAATGTTGTGGCCGTTTAAACATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_209_replicate_8	CTATAGCAATGTTGTGGCCGTTTAAACATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_209_replicate_7	CTATAGCAATGTTGTGGCCGTTTAAACATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_209_replicate_6	CTATAGCAATGTTGTGGCCGTTTAAACATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_209_replicate_5	CTATAGCAATGTTGTGGCCGTTTAAACATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_209_replicate_4	CTATAGCAATGTTGTGGCCGTTTAAACATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_209_replicate_3	CTATAGCAATGTTGTGGCCGTTTAAACATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_209_replicate_2	CTATAGCAATGTTGTGGCCGTTTAAACATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_209_replicate_10	CTATAGCAATGTTGTGGCCGTTTAAACATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_209_replicate_1	CTATAGCAATGTTGTGGCCGTTTAAACATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_208_replicate_9	CTATAGCAATGTTGTGGCCGTTTTTGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_208_replicate_8	CTATAGCAATGTTGTGGCCGTTTTTGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_208_replicate_7	CTATAGCAATGTTGTGGCCGTTTTTGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_208_replicate_6	CTATAGCAATGTTGTGGCCGTTTTTGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_208_replicate_5	CTATAGCAATGTTGTGGCCGTTTTTGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_208_replicate_4	CTATAGCAATGTTGTGGCCGTTTTTGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_208_replicate_3	CTATAGCAATGTTGTGGCCGTTTTTGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_208_replicate_2	CTATAGCAATGTTGTGGCCGTTTTTGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_208_replicate_10	CTATAGCAATGTTGTGGCCGTTTTTGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_208_replicate_1	CTATAGCAATGTTGTGGCCGTTTTTGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_207_replicate_9	CTATAGCAATGTTGTGGCCGTTTTGGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_207_replicate_8	CTATAGCAATGTTGTGGCCGTTTTGGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_207_replicate_7	CTATAGCAATGTTGTGGCCGTTTTGGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_207_replicate_6	CTATAGCAATGTTGTGGCCGTTTTGGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_207_replicate_5	CTATAGCAATGTTGTGGCCGTTTTGGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_207_replicate_4	CTATAGCAATGTTGTGGCCGTTTTGGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_207_replicate_3	CTATAGCAATGTTGTGGCCGTTTTGGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_207_replicate_2	CTATAGCAATGTTGTGGCCGTTTTGGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_207_replicate_10	CTATAGCAATGTTGTGGCCGTTTTGGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_207_replicate_1	CTATAGCAATGTTGTGGCCGTTTTGGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_206_replicate_9	CTATAGCAATGTTGTGGCCGTTTTCGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_206_replicate_8	CTATAGCAATGTTGTGGCCGTTTTCGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_206_replicate_7	CTATAGCAATGTTGTGGCCGTTTTCGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_206_replicate_6	CTATAGCAATGTTGTGGCCGTTTTCGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_206_replicate_5	CTATAGCAATGTTGTGGCCGTTTTCGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_206_replicate_4	CTATAGCAATGTTGTGGCCGTTTTCGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_206_replicate_3	CTATAGCAATGTTGTGGCCGTTTTCGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_206_replicate_2	CTATAGCAATGTTGTGGCCGTTTTCGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_206_replicate_10	CTATAGCAATGTTGTGGCCGTTTTCGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_206_replicate_1	CTATAGCAATGTTGTGGCCGTTTTCGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_205_replicate_9	CTATAGCAATGTTGTGGCCGTTTTAGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_205_replicate_8	CTATAGCAATGTTGTGGCCGTTTTAGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_205_replicate_7	CTATAGCAATGTTGTGGCCGTTTTAGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_205_replicate_6	CTATAGCAATGTTGTGGCCGTTTTAGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_205_replicate_5	CTATAGCAATGTTGTGGCCGTTTTAGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_205_replicate_4	CTATAGCAATGTTGTGGCCGTTTTAGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_205_replicate_3	CTATAGCAATGTTGTGGCCGTTTTAGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_205_replicate_2	CTATAGCAATGTTGTGGCCGTTTTAGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_205_replicate_10	CTATAGCAATGTTGTGGCCGTTTTAGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_205_replicate_1	CTATAGCAATGTTGTGGCCGTTTTAGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_204_replicate_9	CTATAGCAATGTTGTGGCCGTTTGTGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_204_replicate_8	CTATAGCAATGTTGTGGCCGTTTGTGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_204_replicate_7	CTATAGCAATGTTGTGGCCGTTTGTGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_204_replicate_6	CTATAGCAATGTTGTGGCCGTTTGTGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_204_replicate_5	CTATAGCAATGTTGTGGCCGTTTGTGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_204_replicate_4	CTATAGCAATGTTGTGGCCGTTTGTGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_204_replicate_3	CTATAGCAATGTTGTGGCCGTTTGTGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_204_replicate_2	CTATAGCAATGTTGTGGCCGTTTGTGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_204_replicate_10	CTATAGCAATGTTGTGGCCGTTTGTGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_204_replicate_1	CTATAGCAATGTTGTGGCCGTTTGTGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_203_replicate_9	CTATAGCAATGTTGTGGCCGTTTGGGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_203_replicate_8	CTATAGCAATGTTGTGGCCGTTTGGGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_203_replicate_7	CTATAGCAATGTTGTGGCCGTTTGGGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_203_replicate_6	CTATAGCAATGTTGTGGCCGTTTGGGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_203_replicate_5	CTATAGCAATGTTGTGGCCGTTTGGGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_203_replicate_4	CTATAGCAATGTTGTGGCCGTTTGGGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_203_replicate_3	CTATAGCAATGTTGTGGCCGTTTGGGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_203_replicate_2	CTATAGCAATGTTGTGGCCGTTTGGGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_203_replicate_10	CTATAGCAATGTTGTGGCCGTTTGGGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_203_replicate_1	CTATAGCAATGTTGTGGCCGTTTGGGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_202_replicate_9	CTATAGCAATGTTGTGGCCGTTTGCGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_202_replicate_8	CTATAGCAATGTTGTGGCCGTTTGCGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_202_replicate_7	CTATAGCAATGTTGTGGCCGTTTGCGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_202_replicate_6	CTATAGCAATGTTGTGGCCGTTTGCGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_202_replicate_5	CTATAGCAATGTTGTGGCCGTTTGCGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_202_replicate_4	CTATAGCAATGTTGTGGCCGTTTGCGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_202_replicate_3	CTATAGCAATGTTGTGGCCGTTTGCGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_202_replicate_2	CTATAGCAATGTTGTGGCCGTTTGCGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_202_replicate_10	CTATAGCAATGTTGTGGCCGTTTGCGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_202_replicate_1	CTATAGCAATGTTGTGGCCGTTTGCGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_201_replicate_9	CTATAGCAATGTTGTGGCCGTTTGAGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_201_replicate_8	CTATAGCAATGTTGTGGCCGTTTGAGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_201_replicate_7	CTATAGCAATGTTGTGGCCGTTTGAGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_201_replicate_6	CTATAGCAATGTTGTGGCCGTTTGAGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_201_replicate_5	CTATAGCAATGTTGTGGCCGTTTGAGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_201_replicate_4	CTATAGCAATGTTGTGGCCGTTTGAGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_201_replicate_3	CTATAGCAATGTTGTGGCCGTTTGAGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_201_replicate_2	CTATAGCAATGTTGTGGCCGTTTGAGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_201_replicate_10	CTATAGCAATGTTGTGGCCGTTTGAGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_201_replicate_1	CTATAGCAATGTTGTGGCCGTTTGAGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_200_replicate_9	CTATAGCAATGTTGTGGCCGTTTCTGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_200_replicate_8	CTATAGCAATGTTGTGGCCGTTTCTGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_200_replicate_7	CTATAGCAATGTTGTGGCCGTTTCTGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_200_replicate_6	CTATAGCAATGTTGTGGCCGTTTCTGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_200_replicate_5	CTATAGCAATGTTGTGGCCGTTTCTGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_200_replicate_4	CTATAGCAATGTTGTGGCCGTTTCTGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_200_replicate_3	CTATAGCAATGTTGTGGCCGTTTCTGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_200_replicate_2	CTATAGCAATGTTGTGGCCGTTTCTGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_200_replicate_10	CTATAGCAATGTTGTGGCCGTTTCTGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_200_replicate_1	CTATAGCAATGTTGTGGCCGTTTCTGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_20_replicate_9	CTATAGCAATGTATTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_20_replicate_8	CTATAGCAATGTATTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_20_replicate_7	CTATAGCAATGTATTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_20_replicate_6	CTATAGCAATGTATTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_20_replicate_5	CTATAGCAATGTATTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_20_replicate_4	CTATAGCAATGTATTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_20_replicate_3	CTATAGCAATGTATTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_20_replicate_2	CTATAGCAATGTATTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_20_replicate_10	CTATAGCAATGTATTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_20_replicate_1	CTATAGCAATGTATTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_2_replicate_9	CTATAGCAATGACGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_2_replicate_8	CTATAGCAATGACGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_2_replicate_7	CTATAGCAATGACGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_2_replicate_6	CTATAGCAATGACGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_2_replicate_5	CTATAGCAATGACGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_2_replicate_4	CTATAGCAATGACGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_2_replicate_3	CTATAGCAATGACGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_2_replicate_2	CTATAGCAATGACGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_2_replicate_10	CTATAGCAATGACGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_2_replicate_1	CTATAGCAATGACGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_199_replicate_9	CTATAGCAATGTTGTGGCCGTTTCGGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_199_replicate_8	CTATAGCAATGTTGTGGCCGTTTCGGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_199_replicate_7	CTATAGCAATGTTGTGGCCGTTTCGGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_199_replicate_6	CTATAGCAATGTTGTGGCCGTTTCGGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_199_replicate_5	CTATAGCAATGTTGTGGCCGTTTCGGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_199_replicate_4	CTATAGCAATGTTGTGGCCGTTTCGGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_199_replicate_3	CTATAGCAATGTTGTGGCCGTTTCGGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_199_replicate_2	CTATAGCAATGTTGTGGCCGTTTCGGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_199_replicate_10	CTATAGCAATGTTGTGGCCGTTTCGGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_199_replicate_1	CTATAGCAATGTTGTGGCCGTTTCGGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_198_replicate_9	CTATAGCAATGTTGTGGCCGTTTCCGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_198_replicate_8	CTATAGCAATGTTGTGGCCGTTTCCGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_198_replicate_7	CTATAGCAATGTTGTGGCCGTTTCCGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_198_replicate_6	CTATAGCAATGTTGTGGCCGTTTCCGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_198_replicate_5	CTATAGCAATGTTGTGGCCGTTTCCGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_198_replicate_4	CTATAGCAATGTTGTGGCCGTTTCCGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_198_replicate_3	CTATAGCAATGTTGTGGCCGTTTCCGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_198_replicate_2	CTATAGCAATGTTGTGGCCGTTTCCGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_198_replicate_10	CTATAGCAATGTTGTGGCCGTTTCCGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_198_replicate_1	CTATAGCAATGTTGTGGCCGTTTCCGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_197_replicate_9	CTATAGCAATGTTGTGGCCGTTTCAGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_197_replicate_8	CTATAGCAATGTTGTGGCCGTTTCAGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_197_replicate_7	CTATAGCAATGTTGTGGCCGTTTCAGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_197_replicate_6	CTATAGCAATGTTGTGGCCGTTTCAGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_197_replicate_5	CTATAGCAATGTTGTGGCCGTTTCAGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_197_replicate_4	CTATAGCAATGTTGTGGCCGTTTCAGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_197_replicate_3	CTATAGCAATGTTGTGGCCGTTTCAGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_197_replicate_2	CTATAGCAATGTTGTGGCCGTTTCAGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_197_replicate_10	CTATAGCAATGTTGTGGCCGTTTCAGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_197_replicate_1	CTATAGCAATGTTGTGGCCGTTTCAGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_196_replicate_9	CTATAGCAATGTTGTGGCCGTTTATGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_196_replicate_8	CTATAGCAATGTTGTGGCCGTTTATGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_196_replicate_7	CTATAGCAATGTTGTGGCCGTTTATGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_196_replicate_6	CTATAGCAATGTTGTGGCCGTTTATGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_196_replicate_5	CTATAGCAATGTTGTGGCCGTTTATGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_196_replicate_4	CTATAGCAATGTTGTGGCCGTTTATGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_196_replicate_3	CTATAGCAATGTTGTGGCCGTTTATGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_196_replicate_2	CTATAGCAATGTTGTGGCCGTTTATGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_196_replicate_10	CTATAGCAATGTTGTGGCCGTTTATGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_196_replicate_1	CTATAGCAATGTTGTGGCCGTTTATGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_195_replicate_9	CTATAGCAATGTTGTGGCCGTTTAGGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_195_replicate_8	CTATAGCAATGTTGTGGCCGTTTAGGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_195_replicate_7	CTATAGCAATGTTGTGGCCGTTTAGGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_195_replicate_6	CTATAGCAATGTTGTGGCCGTTTAGGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_195_replicate_5	CTATAGCAATGTTGTGGCCGTTTAGGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_195_replicate_4	CTATAGCAATGTTGTGGCCGTTTAGGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_195_replicate_3	CTATAGCAATGTTGTGGCCGTTTAGGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_195_replicate_2	CTATAGCAATGTTGTGGCCGTTTAGGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_195_replicate_10	CTATAGCAATGTTGTGGCCGTTTAGGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_195_replicate_1	CTATAGCAATGTTGTGGCCGTTTAGGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_194_replicate_9	CTATAGCAATGTTGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_194_replicate_8	CTATAGCAATGTTGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_194_replicate_7	CTATAGCAATGTTGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_194_replicate_6	CTATAGCAATGTTGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_194_replicate_5	CTATAGCAATGTTGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_194_replicate_4	CTATAGCAATGTTGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_194_replicate_3	CTATAGCAATGTTGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_194_replicate_2	CTATAGCAATGTTGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_194_replicate_10	CTATAGCAATGTTGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_194_replicate_1	CTATAGCAATGTTGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_193_replicate_9	CTATAGCAATGTTGTGGCCGTTTAAGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_193_replicate_8	CTATAGCAATGTTGTGGCCGTTTAAGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_193_replicate_7	CTATAGCAATGTTGTGGCCGTTTAAGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_193_replicate_6	CTATAGCAATGTTGTGGCCGTTTAAGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_193_replicate_5	CTATAGCAATGTTGTGGCCGTTTAAGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_193_replicate_4	CTATAGCAATGTTGTGGCCGTTTAAGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_193_replicate_3	CTATAGCAATGTTGTGGCCGTTTAAGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_193_replicate_2	CTATAGCAATGTTGTGGCCGTTTAAGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_193_replicate_10	CTATAGCAATGTTGTGGCCGTTTAAGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_193_replicate_1	CTATAGCAATGTTGTGGCCGTTTAAGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_192_replicate_9	CTATAGCAATGTTGTGGCCGTTTTCGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_192_replicate_8	CTATAGCAATGTTGTGGCCGTTTTCGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_192_replicate_7	CTATAGCAATGTTGTGGCCGTTTTCGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_192_replicate_6	CTATAGCAATGTTGTGGCCGTTTTCGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_192_replicate_5	CTATAGCAATGTTGTGGCCGTTTTCGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_192_replicate_4	CTATAGCAATGTTGTGGCCGTTTTCGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_192_replicate_3	CTATAGCAATGTTGTGGCCGTTTTCGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_192_replicate_2	CTATAGCAATGTTGTGGCCGTTTTCGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_192_replicate_10	CTATAGCAATGTTGTGGCCGTTTTCGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_192_replicate_1	CTATAGCAATGTTGTGGCCGTTTTCGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_191_replicate_9	CTATAGCAATGTTGTGGCCGTTTGCGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_191_replicate_8	CTATAGCAATGTTGTGGCCGTTTGCGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_191_replicate_7	CTATAGCAATGTTGTGGCCGTTTGCGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_191_replicate_6	CTATAGCAATGTTGTGGCCGTTTGCGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_191_replicate_5	CTATAGCAATGTTGTGGCCGTTTGCGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_191_replicate_4	CTATAGCAATGTTGTGGCCGTTTGCGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_191_replicate_3	CTATAGCAATGTTGTGGCCGTTTGCGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_191_replicate_2	CTATAGCAATGTTGTGGCCGTTTGCGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_191_replicate_10	CTATAGCAATGTTGTGGCCGTTTGCGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_191_replicate_1	CTATAGCAATGTTGTGGCCGTTTGCGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_190_replicate_9	CTATAGCAATGTTGTGGCCGTTTCCGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_190_replicate_8	CTATAGCAATGTTGTGGCCGTTTCCGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_190_replicate_7	CTATAGCAATGTTGTGGCCGTTTCCGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_190_replicate_6	CTATAGCAATGTTGTGGCCGTTTCCGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_190_replicate_5	CTATAGCAATGTTGTGGCCGTTTCCGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_190_replicate_4	CTATAGCAATGTTGTGGCCGTTTCCGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_190_replicate_3	CTATAGCAATGTTGTGGCCGTTTCCGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_190_replicate_2	CTATAGCAATGTTGTGGCCGTTTCCGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_190_replicate_10	CTATAGCAATGTTGTGGCCGTTTCCGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_190_replicate_1	CTATAGCAATGTTGTGGCCGTTTCCGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_19_replicate_9	CTATAGCAATGTAGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_19_replicate_8	CTATAGCAATGTAGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_19_replicate_7	CTATAGCAATGTAGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_19_replicate_6	CTATAGCAATGTAGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_19_replicate_5	CTATAGCAATGTAGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_19_replicate_4	CTATAGCAATGTAGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_19_replicate_3	CTATAGCAATGTAGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_19_replicate_2	CTATAGCAATGTAGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_19_replicate_10	CTATAGCAATGTAGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_19_replicate_1	CTATAGCAATGTAGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_189_replicate_9	CTATAGCAATGTTGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_189_replicate_8	CTATAGCAATGTTGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_189_replicate_7	CTATAGCAATGTTGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_189_replicate_6	CTATAGCAATGTTGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_189_replicate_5	CTATAGCAATGTTGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_189_replicate_4	CTATAGCAATGTTGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_189_replicate_3	CTATAGCAATGTTGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_189_replicate_2	CTATAGCAATGTTGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_189_replicate_10	CTATAGCAATGTTGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_189_replicate_1	CTATAGCAATGTTGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_188_replicate_9	CTATAGCAATGTTGTGGCCGTTGTCGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_188_replicate_8	CTATAGCAATGTTGTGGCCGTTGTCGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_188_replicate_7	CTATAGCAATGTTGTGGCCGTTGTCGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_188_replicate_6	CTATAGCAATGTTGTGGCCGTTGTCGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_188_replicate_5	CTATAGCAATGTTGTGGCCGTTGTCGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_188_replicate_4	CTATAGCAATGTTGTGGCCGTTGTCGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_188_replicate_3	CTATAGCAATGTTGTGGCCGTTGTCGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_188_replicate_2	CTATAGCAATGTTGTGGCCGTTGTCGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_188_replicate_10	CTATAGCAATGTTGTGGCCGTTGTCGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_188_replicate_1	CTATAGCAATGTTGTGGCCGTTGTCGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_187_replicate_9	CTATAGCAATGTTGTGGCCGTTGGCGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_187_replicate_8	CTATAGCAATGTTGTGGCCGTTGGCGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_187_replicate_7	CTATAGCAATGTTGTGGCCGTTGGCGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_187_replicate_6	CTATAGCAATGTTGTGGCCGTTGGCGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_187_replicate_5	CTATAGCAATGTTGTGGCCGTTGGCGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_187_replicate_4	CTATAGCAATGTTGTGGCCGTTGGCGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_187_replicate_3	CTATAGCAATGTTGTGGCCGTTGGCGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_187_replicate_2	CTATAGCAATGTTGTGGCCGTTGGCGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_187_replicate_10	CTATAGCAATGTTGTGGCCGTTGGCGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_187_replicate_1	CTATAGCAATGTTGTGGCCGTTGGCGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_186_replicate_9	CTATAGCAATGTTGTGGCCGTTGCCGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_186_replicate_8	CTATAGCAATGTTGTGGCCGTTGCCGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_186_replicate_7	CTATAGCAATGTTGTGGCCGTTGCCGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_186_replicate_6	CTATAGCAATGTTGTGGCCGTTGCCGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_186_replicate_5	CTATAGCAATGTTGTGGCCGTTGCCGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_186_replicate_4	CTATAGCAATGTTGTGGCCGTTGCCGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_186_replicate_3	CTATAGCAATGTTGTGGCCGTTGCCGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_186_replicate_2	CTATAGCAATGTTGTGGCCGTTGCCGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_186_replicate_10	CTATAGCAATGTTGTGGCCGTTGCCGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_186_replicate_1	CTATAGCAATGTTGTGGCCGTTGCCGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_185_replicate_9	CTATAGCAATGTTGTGGCCGTTGACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_185_replicate_8	CTATAGCAATGTTGTGGCCGTTGACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_185_replicate_7	CTATAGCAATGTTGTGGCCGTTGACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_185_replicate_6	CTATAGCAATGTTGTGGCCGTTGACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_185_replicate_5	CTATAGCAATGTTGTGGCCGTTGACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_185_replicate_4	CTATAGCAATGTTGTGGCCGTTGACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_185_replicate_3	CTATAGCAATGTTGTGGCCGTTGACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_185_replicate_2	CTATAGCAATGTTGTGGCCGTTGACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_185_replicate_10	CTATAGCAATGTTGTGGCCGTTGACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_185_replicate_1	CTATAGCAATGTTGTGGCCGTTGACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_184_replicate_9	CTATAGCAATGTTGTGGCCGTTCTCGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_184_replicate_8	CTATAGCAATGTTGTGGCCGTTCTCGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_184_replicate_7	CTATAGCAATGTTGTGGCCGTTCTCGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_184_replicate_6	CTATAGCAATGTTGTGGCCGTTCTCGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_184_replicate_5	CTATAGCAATGTTGTGGCCGTTCTCGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_184_replicate_4	CTATAGCAATGTTGTGGCCGTTCTCGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_184_replicate_3	CTATAGCAATGTTGTGGCCGTTCTCGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_184_replicate_2	CTATAGCAATGTTGTGGCCGTTCTCGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_184_replicate_10	CTATAGCAATGTTGTGGCCGTTCTCGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_184_replicate_1	CTATAGCAATGTTGTGGCCGTTCTCGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_183_replicate_9	CTATAGCAATGTTGTGGCCGTTCGCGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_183_replicate_8	CTATAGCAATGTTGTGGCCGTTCGCGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_183_replicate_7	CTATAGCAATGTTGTGGCCGTTCGCGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_183_replicate_6	CTATAGCAATGTTGTGGCCGTTCGCGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_183_replicate_5	CTATAGCAATGTTGTGGCCGTTCGCGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_183_replicate_4	CTATAGCAATGTTGTGGCCGTTCGCGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_183_replicate_3	CTATAGCAATGTTGTGGCCGTTCGCGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_183_replicate_2	CTATAGCAATGTTGTGGCCGTTCGCGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_183_replicate_10	CTATAGCAATGTTGTGGCCGTTCGCGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_183_replicate_1	CTATAGCAATGTTGTGGCCGTTCGCGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_182_replicate_9	CTATAGCAATGTTGTGGCCGTTCCCGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_182_replicate_8	CTATAGCAATGTTGTGGCCGTTCCCGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_182_replicate_7	CTATAGCAATGTTGTGGCCGTTCCCGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_182_replicate_6	CTATAGCAATGTTGTGGCCGTTCCCGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_182_replicate_5	CTATAGCAATGTTGTGGCCGTTCCCGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_182_replicate_4	CTATAGCAATGTTGTGGCCGTTCCCGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_182_replicate_3	CTATAGCAATGTTGTGGCCGTTCCCGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_182_replicate_2	CTATAGCAATGTTGTGGCCGTTCCCGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_182_replicate_10	CTATAGCAATGTTGTGGCCGTTCCCGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_182_replicate_1	CTATAGCAATGTTGTGGCCGTTCCCGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_181_replicate_9	CTATAGCAATGTTGTGGCCGTTCACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_181_replicate_8	CTATAGCAATGTTGTGGCCGTTCACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_181_replicate_7	CTATAGCAATGTTGTGGCCGTTCACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_181_replicate_6	CTATAGCAATGTTGTGGCCGTTCACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_181_replicate_5	CTATAGCAATGTTGTGGCCGTTCACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_181_replicate_4	CTATAGCAATGTTGTGGCCGTTCACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_181_replicate_3	CTATAGCAATGTTGTGGCCGTTCACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_181_replicate_2	CTATAGCAATGTTGTGGCCGTTCACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_181_replicate_10	CTATAGCAATGTTGTGGCCGTTCACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_181_replicate_1	CTATAGCAATGTTGTGGCCGTTCACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_180_replicate_9	CTATAGCAATGTTGTGGCCGTTATCGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_180_replicate_8	CTATAGCAATGTTGTGGCCGTTATCGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_180_replicate_7	CTATAGCAATGTTGTGGCCGTTATCGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_180_replicate_6	CTATAGCAATGTTGTGGCCGTTATCGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_180_replicate_5	CTATAGCAATGTTGTGGCCGTTATCGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_180_replicate_4	CTATAGCAATGTTGTGGCCGTTATCGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_180_replicate_3	CTATAGCAATGTTGTGGCCGTTATCGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_180_replicate_2	CTATAGCAATGTTGTGGCCGTTATCGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_180_replicate_10	CTATAGCAATGTTGTGGCCGTTATCGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_180_replicate_1	CTATAGCAATGTTGTGGCCGTTATCGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_18_replicate_9	CTATAGCAATGTACTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_18_replicate_8	CTATAGCAATGTACTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_18_replicate_7	CTATAGCAATGTACTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_18_replicate_6	CTATAGCAATGTACTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_18_replicate_5	CTATAGCAATGTACTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_18_replicate_4	CTATAGCAATGTACTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_18_replicate_3	CTATAGCAATGTACTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_18_replicate_2	CTATAGCAATGTACTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_18_replicate_10	CTATAGCAATGTACTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_18_replicate_1	CTATAGCAATGTACTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_179_replicate_9	CTATAGCAATGTTGTGGCCGTTAGCGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_179_replicate_8	CTATAGCAATGTTGTGGCCGTTAGCGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_179_replicate_7	CTATAGCAATGTTGTGGCCGTTAGCGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_179_replicate_6	CTATAGCAATGTTGTGGCCGTTAGCGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_179_replicate_5	CTATAGCAATGTTGTGGCCGTTAGCGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_179_replicate_4	CTATAGCAATGTTGTGGCCGTTAGCGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_179_replicate_3	CTATAGCAATGTTGTGGCCGTTAGCGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_179_replicate_2	CTATAGCAATGTTGTGGCCGTTAGCGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_179_replicate_10	CTATAGCAATGTTGTGGCCGTTAGCGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_179_replicate_1	CTATAGCAATGTTGTGGCCGTTAGCGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_178_replicate_9	CTATAGCAATGTTGTGGCCGTTACCGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_178_replicate_8	CTATAGCAATGTTGTGGCCGTTACCGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_178_replicate_7	CTATAGCAATGTTGTGGCCGTTACCGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_178_replicate_6	CTATAGCAATGTTGTGGCCGTTACCGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_178_replicate_5	CTATAGCAATGTTGTGGCCGTTACCGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_178_replicate_4	CTATAGCAATGTTGTGGCCGTTACCGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_178_replicate_3	CTATAGCAATGTTGTGGCCGTTACCGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_178_replicate_2	CTATAGCAATGTTGTGGCCGTTACCGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_178_replicate_10	CTATAGCAATGTTGTGGCCGTTACCGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_178_replicate_1	CTATAGCAATGTTGTGGCCGTTACCGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_177_replicate_9	CTATAGCAATGTTGTGGCCGTTAACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_177_replicate_8	CTATAGCAATGTTGTGGCCGTTAACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_177_replicate_7	CTATAGCAATGTTGTGGCCGTTAACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_177_replicate_6	CTATAGCAATGTTGTGGCCGTTAACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_177_replicate_5	CTATAGCAATGTTGTGGCCGTTAACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_177_replicate_4	CTATAGCAATGTTGTGGCCGTTAACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_177_replicate_3	CTATAGCAATGTTGTGGCCGTTAACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_177_replicate_2	CTATAGCAATGTTGTGGCCGTTAACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_177_replicate_10	CTATAGCAATGTTGTGGCCGTTAACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_177_replicate_1	CTATAGCAATGTTGTGGCCGTTAACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_176_replicate_9	CTATAGCAATGTTGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_176_replicate_8	CTATAGCAATGTTGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_176_replicate_7	CTATAGCAATGTTGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_176_replicate_6	CTATAGCAATGTTGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_176_replicate_5	CTATAGCAATGTTGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_176_replicate_4	CTATAGCAATGTTGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_176_replicate_3	CTATAGCAATGTTGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_176_replicate_2	CTATAGCAATGTTGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_176_replicate_10	CTATAGCAATGTTGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_176_replicate_1	CTATAGCAATGTTGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_175_replicate_9	CTATAGCAATGTTGTGGCCGTTGACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_175_replicate_8	CTATAGCAATGTTGTGGCCGTTGACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_175_replicate_7	CTATAGCAATGTTGTGGCCGTTGACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_175_replicate_6	CTATAGCAATGTTGTGGCCGTTGACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_175_replicate_5	CTATAGCAATGTTGTGGCCGTTGACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_175_replicate_4	CTATAGCAATGTTGTGGCCGTTGACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_175_replicate_3	CTATAGCAATGTTGTGGCCGTTGACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_175_replicate_2	CTATAGCAATGTTGTGGCCGTTGACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_175_replicate_10	CTATAGCAATGTTGTGGCCGTTGACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_175_replicate_1	CTATAGCAATGTTGTGGCCGTTGACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_174_replicate_9	CTATAGCAATGTTGTGGCCGTTCACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_174_replicate_8	CTATAGCAATGTTGTGGCCGTTCACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_174_replicate_7	CTATAGCAATGTTGTGGCCGTTCACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_174_replicate_6	CTATAGCAATGTTGTGGCCGTTCACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_174_replicate_5	CTATAGCAATGTTGTGGCCGTTCACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_174_replicate_4	CTATAGCAATGTTGTGGCCGTTCACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_174_replicate_3	CTATAGCAATGTTGTGGCCGTTCACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_174_replicate_2	CTATAGCAATGTTGTGGCCGTTCACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_174_replicate_10	CTATAGCAATGTTGTGGCCGTTCACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_174_replicate_1	CTATAGCAATGTTGTGGCCGTTCACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_173_replicate_9	CTATAGCAATGTTGTGGCCGTTAACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_173_replicate_8	CTATAGCAATGTTGTGGCCGTTAACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_173_replicate_7	CTATAGCAATGTTGTGGCCGTTAACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_173_replicate_6	CTATAGCAATGTTGTGGCCGTTAACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_173_replicate_5	CTATAGCAATGTTGTGGCCGTTAACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_173_replicate_4	CTATAGCAATGTTGTGGCCGTTAACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_173_replicate_3	CTATAGCAATGTTGTGGCCGTTAACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_173_replicate_2	CTATAGCAATGTTGTGGCCGTTAACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_173_replicate_10	CTATAGCAATGTTGTGGCCGTTAACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_173_replicate_1	CTATAGCAATGTTGTGGCCGTTAACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_172_replicate_9	CTATAGCAATGTTGTGGCCGTGTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_172_replicate_8	CTATAGCAATGTTGTGGCCGTGTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_172_replicate_7	CTATAGCAATGTTGTGGCCGTGTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_172_replicate_6	CTATAGCAATGTTGTGGCCGTGTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_172_replicate_5	CTATAGCAATGTTGTGGCCGTGTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_172_replicate_4	CTATAGCAATGTTGTGGCCGTGTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_172_replicate_3	CTATAGCAATGTTGTGGCCGTGTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_172_replicate_2	CTATAGCAATGTTGTGGCCGTGTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_172_replicate_10	CTATAGCAATGTTGTGGCCGTGTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_172_replicate_1	CTATAGCAATGTTGTGGCCGTGTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_171_replicate_9	CTATAGCAATGTTGTGGCCGTGGACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_171_replicate_8	CTATAGCAATGTTGTGGCCGTGGACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_171_replicate_7	CTATAGCAATGTTGTGGCCGTGGACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_171_replicate_6	CTATAGCAATGTTGTGGCCGTGGACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_171_replicate_5	CTATAGCAATGTTGTGGCCGTGGACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_171_replicate_4	CTATAGCAATGTTGTGGCCGTGGACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_171_replicate_3	CTATAGCAATGTTGTGGCCGTGGACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_171_replicate_2	CTATAGCAATGTTGTGGCCGTGGACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_171_replicate_10	CTATAGCAATGTTGTGGCCGTGGACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_171_replicate_1	CTATAGCAATGTTGTGGCCGTGGACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_170_replicate_9	CTATAGCAATGTTGTGGCCGTGCACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_170_replicate_8	CTATAGCAATGTTGTGGCCGTGCACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_170_replicate_7	CTATAGCAATGTTGTGGCCGTGCACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_170_replicate_6	CTATAGCAATGTTGTGGCCGTGCACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_170_replicate_5	CTATAGCAATGTTGTGGCCGTGCACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_170_replicate_4	CTATAGCAATGTTGTGGCCGTGCACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_170_replicate_3	CTATAGCAATGTTGTGGCCGTGCACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_170_replicate_2	CTATAGCAATGTTGTGGCCGTGCACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_170_replicate_10	CTATAGCAATGTTGTGGCCGTGCACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_170_replicate_1	CTATAGCAATGTTGTGGCCGTGCACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_17_replicate_9	CTATAGCAATGTAATGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_17_replicate_8	CTATAGCAATGTAATGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_17_replicate_7	CTATAGCAATGTAATGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_17_replicate_6	CTATAGCAATGTAATGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_17_replicate_5	CTATAGCAATGTAATGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_17_replicate_4	CTATAGCAATGTAATGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_17_replicate_3	CTATAGCAATGTAATGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_17_replicate_2	CTATAGCAATGTAATGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_17_replicate_10	CTATAGCAATGTAATGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_17_replicate_1	CTATAGCAATGTAATGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_169_replicate_9	CTATAGCAATGTTGTGGCCGTGAACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_169_replicate_8	CTATAGCAATGTTGTGGCCGTGAACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_169_replicate_7	CTATAGCAATGTTGTGGCCGTGAACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_169_replicate_6	CTATAGCAATGTTGTGGCCGTGAACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_169_replicate_5	CTATAGCAATGTTGTGGCCGTGAACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_169_replicate_4	CTATAGCAATGTTGTGGCCGTGAACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_169_replicate_3	CTATAGCAATGTTGTGGCCGTGAACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_169_replicate_2	CTATAGCAATGTTGTGGCCGTGAACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_169_replicate_10	CTATAGCAATGTTGTGGCCGTGAACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_169_replicate_1	CTATAGCAATGTTGTGGCCGTGAACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_168_replicate_9	CTATAGCAATGTTGTGGCCGTCTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_168_replicate_8	CTATAGCAATGTTGTGGCCGTCTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_168_replicate_7	CTATAGCAATGTTGTGGCCGTCTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_168_replicate_6	CTATAGCAATGTTGTGGCCGTCTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_168_replicate_5	CTATAGCAATGTTGTGGCCGTCTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_168_replicate_4	CTATAGCAATGTTGTGGCCGTCTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_168_replicate_3	CTATAGCAATGTTGTGGCCGTCTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_168_replicate_2	CTATAGCAATGTTGTGGCCGTCTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_168_replicate_10	CTATAGCAATGTTGTGGCCGTCTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_168_replicate_1	CTATAGCAATGTTGTGGCCGTCTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_167_replicate_9	CTATAGCAATGTTGTGGCCGTCGACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_167_replicate_8	CTATAGCAATGTTGTGGCCGTCGACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_167_replicate_7	CTATAGCAATGTTGTGGCCGTCGACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_167_replicate_6	CTATAGCAATGTTGTGGCCGTCGACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_167_replicate_5	CTATAGCAATGTTGTGGCCGTCGACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_167_replicate_4	CTATAGCAATGTTGTGGCCGTCGACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_167_replicate_3	CTATAGCAATGTTGTGGCCGTCGACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_167_replicate_2	CTATAGCAATGTTGTGGCCGTCGACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_167_replicate_10	CTATAGCAATGTTGTGGCCGTCGACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_167_replicate_1	CTATAGCAATGTTGTGGCCGTCGACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_166_replicate_9	CTATAGCAATGTTGTGGCCGTCCACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_166_replicate_8	CTATAGCAATGTTGTGGCCGTCCACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_166_replicate_7	CTATAGCAATGTTGTGGCCGTCCACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_166_replicate_6	CTATAGCAATGTTGTGGCCGTCCACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_166_replicate_5	CTATAGCAATGTTGTGGCCGTCCACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_166_replicate_4	CTATAGCAATGTTGTGGCCGTCCACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_166_replicate_3	CTATAGCAATGTTGTGGCCGTCCACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_166_replicate_2	CTATAGCAATGTTGTGGCCGTCCACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_166_replicate_10	CTATAGCAATGTTGTGGCCGTCCACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_166_replicate_1	CTATAGCAATGTTGTGGCCGTCCACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_165_replicate_9	CTATAGCAATGTTGTGGCCGTCAACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_165_replicate_8	CTATAGCAATGTTGTGGCCGTCAACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_165_replicate_7	CTATAGCAATGTTGTGGCCGTCAACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_165_replicate_6	CTATAGCAATGTTGTGGCCGTCAACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_165_replicate_5	CTATAGCAATGTTGTGGCCGTCAACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_165_replicate_4	CTATAGCAATGTTGTGGCCGTCAACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_165_replicate_3	CTATAGCAATGTTGTGGCCGTCAACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_165_replicate_2	CTATAGCAATGTTGTGGCCGTCAACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_165_replicate_10	CTATAGCAATGTTGTGGCCGTCAACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_165_replicate_1	CTATAGCAATGTTGTGGCCGTCAACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_164_replicate_9	CTATAGCAATGTTGTGGCCGTATACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_164_replicate_8	CTATAGCAATGTTGTGGCCGTATACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_164_replicate_7	CTATAGCAATGTTGTGGCCGTATACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_164_replicate_6	CTATAGCAATGTTGTGGCCGTATACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_164_replicate_5	CTATAGCAATGTTGTGGCCGTATACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_164_replicate_4	CTATAGCAATGTTGTGGCCGTATACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_164_replicate_3	CTATAGCAATGTTGTGGCCGTATACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_164_replicate_2	CTATAGCAATGTTGTGGCCGTATACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_164_replicate_10	CTATAGCAATGTTGTGGCCGTATACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_164_replicate_1	CTATAGCAATGTTGTGGCCGTATACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_163_replicate_9	CTATAGCAATGTTGTGGCCGTAGACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_163_replicate_8	CTATAGCAATGTTGTGGCCGTAGACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_163_replicate_7	CTATAGCAATGTTGTGGCCGTAGACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_163_replicate_6	CTATAGCAATGTTGTGGCCGTAGACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_163_replicate_5	CTATAGCAATGTTGTGGCCGTAGACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_163_replicate_4	CTATAGCAATGTTGTGGCCGTAGACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_163_replicate_3	CTATAGCAATGTTGTGGCCGTAGACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_163_replicate_2	CTATAGCAATGTTGTGGCCGTAGACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_163_replicate_10	CTATAGCAATGTTGTGGCCGTAGACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_163_replicate_1	CTATAGCAATGTTGTGGCCGTAGACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_162_replicate_9	CTATAGCAATGTTGTGGCCGTACACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_162_replicate_8	CTATAGCAATGTTGTGGCCGTACACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_162_replicate_7	CTATAGCAATGTTGTGGCCGTACACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_162_replicate_6	CTATAGCAATGTTGTGGCCGTACACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_162_replicate_5	CTATAGCAATGTTGTGGCCGTACACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_162_replicate_4	CTATAGCAATGTTGTGGCCGTACACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_162_replicate_3	CTATAGCAATGTTGTGGCCGTACACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_162_replicate_2	CTATAGCAATGTTGTGGCCGTACACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_162_replicate_10	CTATAGCAATGTTGTGGCCGTACACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_162_replicate_1	CTATAGCAATGTTGTGGCCGTACACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_161_replicate_9	CTATAGCAATGTTGTGGCCGTAAACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_161_replicate_8	CTATAGCAATGTTGTGGCCGTAAACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_161_replicate_7	CTATAGCAATGTTGTGGCCGTAAACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_161_replicate_6	CTATAGCAATGTTGTGGCCGTAAACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_161_replicate_5	CTATAGCAATGTTGTGGCCGTAAACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_161_replicate_4	CTATAGCAATGTTGTGGCCGTAAACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_161_replicate_3	CTATAGCAATGTTGTGGCCGTAAACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_161_replicate_2	CTATAGCAATGTTGTGGCCGTAAACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_161_replicate_10	CTATAGCAATGTTGTGGCCGTAAACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_161_replicate_1	CTATAGCAATGTTGTGGCCGTAAACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_160_replicate_9	CTATAGCAATGTTGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_160_replicate_8	CTATAGCAATGTTGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_160_replicate_7	CTATAGCAATGTTGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_160_replicate_6	CTATAGCAATGTTGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_160_replicate_5	CTATAGCAATGTTGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_160_replicate_4	CTATAGCAATGTTGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_160_replicate_3	CTATAGCAATGTTGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_160_replicate_2	CTATAGCAATGTTGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_160_replicate_10	CTATAGCAATGTTGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_160_replicate_1	CTATAGCAATGTTGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_16_replicate_9	CTATAGCAATGTTGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_16_replicate_8	CTATAGCAATGTTGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_16_replicate_7	CTATAGCAATGTTGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_16_replicate_6	CTATAGCAATGTTGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_16_replicate_5	CTATAGCAATGTTGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_16_replicate_4	CTATAGCAATGTTGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_16_replicate_3	CTATAGCAATGTTGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_16_replicate_2	CTATAGCAATGTTGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_16_replicate_10	CTATAGCAATGTTGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_16_replicate_1	CTATAGCAATGTTGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_159_replicate_9	CTATAGCAATGTTGTGGCCGTGTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_159_replicate_8	CTATAGCAATGTTGTGGCCGTGTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_159_replicate_7	CTATAGCAATGTTGTGGCCGTGTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_159_replicate_6	CTATAGCAATGTTGTGGCCGTGTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_159_replicate_5	CTATAGCAATGTTGTGGCCGTGTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_159_replicate_4	CTATAGCAATGTTGTGGCCGTGTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_159_replicate_3	CTATAGCAATGTTGTGGCCGTGTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_159_replicate_2	CTATAGCAATGTTGTGGCCGTGTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_159_replicate_10	CTATAGCAATGTTGTGGCCGTGTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_159_replicate_1	CTATAGCAATGTTGTGGCCGTGTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_158_replicate_9	CTATAGCAATGTTGTGGCCGTCTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_158_replicate_8	CTATAGCAATGTTGTGGCCGTCTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_158_replicate_7	CTATAGCAATGTTGTGGCCGTCTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_158_replicate_6	CTATAGCAATGTTGTGGCCGTCTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_158_replicate_5	CTATAGCAATGTTGTGGCCGTCTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_158_replicate_4	CTATAGCAATGTTGTGGCCGTCTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_158_replicate_3	CTATAGCAATGTTGTGGCCGTCTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_158_replicate_2	CTATAGCAATGTTGTGGCCGTCTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_158_replicate_10	CTATAGCAATGTTGTGGCCGTCTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_158_replicate_1	CTATAGCAATGTTGTGGCCGTCTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_157_replicate_9	CTATAGCAATGTTGTGGCCGTATACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_157_replicate_8	CTATAGCAATGTTGTGGCCGTATACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_157_replicate_7	CTATAGCAATGTTGTGGCCGTATACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_157_replicate_6	CTATAGCAATGTTGTGGCCGTATACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_157_replicate_5	CTATAGCAATGTTGTGGCCGTATACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_157_replicate_4	CTATAGCAATGTTGTGGCCGTATACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_157_replicate_3	CTATAGCAATGTTGTGGCCGTATACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_157_replicate_2	CTATAGCAATGTTGTGGCCGTATACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_157_replicate_10	CTATAGCAATGTTGTGGCCGTATACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_157_replicate_1	CTATAGCAATGTTGTGGCCGTATACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_156_replicate_9	CTATAGCAATGTTGTGGCCGGTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_156_replicate_8	CTATAGCAATGTTGTGGCCGGTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_156_replicate_7	CTATAGCAATGTTGTGGCCGGTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_156_replicate_6	CTATAGCAATGTTGTGGCCGGTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_156_replicate_5	CTATAGCAATGTTGTGGCCGGTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_156_replicate_4	CTATAGCAATGTTGTGGCCGGTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_156_replicate_3	CTATAGCAATGTTGTGGCCGGTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_156_replicate_2	CTATAGCAATGTTGTGGCCGGTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_156_replicate_10	CTATAGCAATGTTGTGGCCGGTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_156_replicate_1	CTATAGCAATGTTGTGGCCGGTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_155_replicate_9	CTATAGCAATGTTGTGGCCGGGTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_155_replicate_8	CTATAGCAATGTTGTGGCCGGGTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_155_replicate_7	CTATAGCAATGTTGTGGCCGGGTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_155_replicate_6	CTATAGCAATGTTGTGGCCGGGTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_155_replicate_5	CTATAGCAATGTTGTGGCCGGGTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_155_replicate_4	CTATAGCAATGTTGTGGCCGGGTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_155_replicate_3	CTATAGCAATGTTGTGGCCGGGTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_155_replicate_2	CTATAGCAATGTTGTGGCCGGGTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_155_replicate_10	CTATAGCAATGTTGTGGCCGGGTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_155_replicate_1	CTATAGCAATGTTGTGGCCGGGTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_154_replicate_9	CTATAGCAATGTTGTGGCCGGCTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_154_replicate_8	CTATAGCAATGTTGTGGCCGGCTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_154_replicate_7	CTATAGCAATGTTGTGGCCGGCTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_154_replicate_6	CTATAGCAATGTTGTGGCCGGCTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_154_replicate_5	CTATAGCAATGTTGTGGCCGGCTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_154_replicate_4	CTATAGCAATGTTGTGGCCGGCTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_154_replicate_3	CTATAGCAATGTTGTGGCCGGCTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_154_replicate_2	CTATAGCAATGTTGTGGCCGGCTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_154_replicate_10	CTATAGCAATGTTGTGGCCGGCTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_154_replicate_1	CTATAGCAATGTTGTGGCCGGCTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_153_replicate_9	CTATAGCAATGTTGTGGCCGGATACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_153_replicate_8	CTATAGCAATGTTGTGGCCGGATACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_153_replicate_7	CTATAGCAATGTTGTGGCCGGATACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_153_replicate_6	CTATAGCAATGTTGTGGCCGGATACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_153_replicate_5	CTATAGCAATGTTGTGGCCGGATACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_153_replicate_4	CTATAGCAATGTTGTGGCCGGATACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_153_replicate_3	CTATAGCAATGTTGTGGCCGGATACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_153_replicate_2	CTATAGCAATGTTGTGGCCGGATACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_153_replicate_10	CTATAGCAATGTTGTGGCCGGATACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_153_replicate_1	CTATAGCAATGTTGTGGCCGGATACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_152_replicate_9	CTATAGCAATGTTGTGGCCGCTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_152_replicate_8	CTATAGCAATGTTGTGGCCGCTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_152_replicate_7	CTATAGCAATGTTGTGGCCGCTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_152_replicate_6	CTATAGCAATGTTGTGGCCGCTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_152_replicate_5	CTATAGCAATGTTGTGGCCGCTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_152_replicate_4	CTATAGCAATGTTGTGGCCGCTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_152_replicate_3	CTATAGCAATGTTGTGGCCGCTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_152_replicate_2	CTATAGCAATGTTGTGGCCGCTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_152_replicate_10	CTATAGCAATGTTGTGGCCGCTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_152_replicate_1	CTATAGCAATGTTGTGGCCGCTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_151_replicate_9	CTATAGCAATGTTGTGGCCGCGTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_151_replicate_8	CTATAGCAATGTTGTGGCCGCGTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_151_replicate_7	CTATAGCAATGTTGTGGCCGCGTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_151_replicate_6	CTATAGCAATGTTGTGGCCGCGTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_151_replicate_5	CTATAGCAATGTTGTGGCCGCGTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_151_replicate_4	CTATAGCAATGTTGTGGCCGCGTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_151_replicate_3	CTATAGCAATGTTGTGGCCGCGTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_151_replicate_2	CTATAGCAATGTTGTGGCCGCGTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_151_replicate_10	CTATAGCAATGTTGTGGCCGCGTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_151_replicate_1	CTATAGCAATGTTGTGGCCGCGTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_150_replicate_9	CTATAGCAATGTTGTGGCCGCCTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_150_replicate_8	CTATAGCAATGTTGTGGCCGCCTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_150_replicate_7	CTATAGCAATGTTGTGGCCGCCTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_150_replicate_6	CTATAGCAATGTTGTGGCCGCCTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_150_replicate_5	CTATAGCAATGTTGTGGCCGCCTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_150_replicate_4	CTATAGCAATGTTGTGGCCGCCTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_150_replicate_3	CTATAGCAATGTTGTGGCCGCCTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_150_replicate_2	CTATAGCAATGTTGTGGCCGCCTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_150_replicate_10	CTATAGCAATGTTGTGGCCGCCTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_150_replicate_1	CTATAGCAATGTTGTGGCCGCCTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_15_replicate_9	CTATAGCAATGTGGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_15_replicate_8	CTATAGCAATGTGGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_15_replicate_7	CTATAGCAATGTGGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_15_replicate_6	CTATAGCAATGTGGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_15_replicate_5	CTATAGCAATGTGGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_15_replicate_4	CTATAGCAATGTGGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_15_replicate_3	CTATAGCAATGTGGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_15_replicate_2	CTATAGCAATGTGGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_15_replicate_10	CTATAGCAATGTGGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_15_replicate_1	CTATAGCAATGTGGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_149_replicate_9	CTATAGCAATGTTGTGGCCGCATACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_149_replicate_8	CTATAGCAATGTTGTGGCCGCATACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_149_replicate_7	CTATAGCAATGTTGTGGCCGCATACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_149_replicate_6	CTATAGCAATGTTGTGGCCGCATACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_149_replicate_5	CTATAGCAATGTTGTGGCCGCATACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_149_replicate_4	CTATAGCAATGTTGTGGCCGCATACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_149_replicate_3	CTATAGCAATGTTGTGGCCGCATACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_149_replicate_2	CTATAGCAATGTTGTGGCCGCATACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_149_replicate_10	CTATAGCAATGTTGTGGCCGCATACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_149_replicate_1	CTATAGCAATGTTGTGGCCGCATACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_148_replicate_9	CTATAGCAATGTTGTGGCCGATTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_148_replicate_8	CTATAGCAATGTTGTGGCCGATTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_148_replicate_7	CTATAGCAATGTTGTGGCCGATTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_148_replicate_6	CTATAGCAATGTTGTGGCCGATTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_148_replicate_5	CTATAGCAATGTTGTGGCCGATTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_148_replicate_4	CTATAGCAATGTTGTGGCCGATTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_148_replicate_3	CTATAGCAATGTTGTGGCCGATTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_148_replicate_2	CTATAGCAATGTTGTGGCCGATTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_148_replicate_10	CTATAGCAATGTTGTGGCCGATTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_148_replicate_1	CTATAGCAATGTTGTGGCCGATTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_147_replicate_9	CTATAGCAATGTTGTGGCCGAGTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_147_replicate_8	CTATAGCAATGTTGTGGCCGAGTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_147_replicate_7	CTATAGCAATGTTGTGGCCGAGTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_147_replicate_6	CTATAGCAATGTTGTGGCCGAGTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_147_replicate_5	CTATAGCAATGTTGTGGCCGAGTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_147_replicate_4	CTATAGCAATGTTGTGGCCGAGTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_147_replicate_3	CTATAGCAATGTTGTGGCCGAGTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_147_replicate_2	CTATAGCAATGTTGTGGCCGAGTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_147_replicate_10	CTATAGCAATGTTGTGGCCGAGTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_147_replicate_1	CTATAGCAATGTTGTGGCCGAGTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_146_replicate_9	CTATAGCAATGTTGTGGCCGACTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_146_replicate_8	CTATAGCAATGTTGTGGCCGACTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_146_replicate_7	CTATAGCAATGTTGTGGCCGACTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_146_replicate_6	CTATAGCAATGTTGTGGCCGACTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_146_replicate_5	CTATAGCAATGTTGTGGCCGACTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_146_replicate_4	CTATAGCAATGTTGTGGCCGACTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_146_replicate_3	CTATAGCAATGTTGTGGCCGACTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_146_replicate_2	CTATAGCAATGTTGTGGCCGACTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_146_replicate_10	CTATAGCAATGTTGTGGCCGACTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_146_replicate_1	CTATAGCAATGTTGTGGCCGACTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_145_replicate_9	CTATAGCAATGTTGTGGCCGAATACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_145_replicate_8	CTATAGCAATGTTGTGGCCGAATACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_145_replicate_7	CTATAGCAATGTTGTGGCCGAATACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_145_replicate_6	CTATAGCAATGTTGTGGCCGAATACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_145_replicate_5	CTATAGCAATGTTGTGGCCGAATACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_145_replicate_4	CTATAGCAATGTTGTGGCCGAATACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_145_replicate_3	CTATAGCAATGTTGTGGCCGAATACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_145_replicate_2	CTATAGCAATGTTGTGGCCGAATACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_145_replicate_10	CTATAGCAATGTTGTGGCCGAATACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_145_replicate_1	CTATAGCAATGTTGTGGCCGAATACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_144_replicate_9	CTATAGCAATGTTGTGGCCTTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_144_replicate_8	CTATAGCAATGTTGTGGCCTTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_144_replicate_7	CTATAGCAATGTTGTGGCCTTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_144_replicate_6	CTATAGCAATGTTGTGGCCTTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_144_replicate_5	CTATAGCAATGTTGTGGCCTTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_144_replicate_4	CTATAGCAATGTTGTGGCCTTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_144_replicate_3	CTATAGCAATGTTGTGGCCTTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_144_replicate_2	CTATAGCAATGTTGTGGCCTTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_144_replicate_10	CTATAGCAATGTTGTGGCCTTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_144_replicate_1	CTATAGCAATGTTGTGGCCTTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_143_replicate_9	CTATAGCAATGTTGTGGCCTGTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_143_replicate_8	CTATAGCAATGTTGTGGCCTGTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_143_replicate_7	CTATAGCAATGTTGTGGCCTGTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_143_replicate_6	CTATAGCAATGTTGTGGCCTGTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_143_replicate_5	CTATAGCAATGTTGTGGCCTGTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_143_replicate_4	CTATAGCAATGTTGTGGCCTGTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_143_replicate_3	CTATAGCAATGTTGTGGCCTGTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_143_replicate_2	CTATAGCAATGTTGTGGCCTGTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_143_replicate_10	CTATAGCAATGTTGTGGCCTGTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_143_replicate_1	CTATAGCAATGTTGTGGCCTGTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_142_replicate_9	CTATAGCAATGTTGTGGCCTCTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_142_replicate_8	CTATAGCAATGTTGTGGCCTCTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_142_replicate_7	CTATAGCAATGTTGTGGCCTCTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_142_replicate_6	CTATAGCAATGTTGTGGCCTCTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_142_replicate_5	CTATAGCAATGTTGTGGCCTCTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_142_replicate_4	CTATAGCAATGTTGTGGCCTCTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_142_replicate_3	CTATAGCAATGTTGTGGCCTCTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_142_replicate_2	CTATAGCAATGTTGTGGCCTCTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_142_replicate_10	CTATAGCAATGTTGTGGCCTCTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_142_replicate_1	CTATAGCAATGTTGTGGCCTCTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_141_replicate_9	CTATAGCAATGTTGTGGCCTATTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_141_replicate_8	CTATAGCAATGTTGTGGCCTATTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_141_replicate_7	CTATAGCAATGTTGTGGCCTATTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_141_replicate_6	CTATAGCAATGTTGTGGCCTATTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_141_replicate_5	CTATAGCAATGTTGTGGCCTATTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_141_replicate_4	CTATAGCAATGTTGTGGCCTATTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_141_replicate_3	CTATAGCAATGTTGTGGCCTATTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_141_replicate_2	CTATAGCAATGTTGTGGCCTATTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_141_replicate_10	CTATAGCAATGTTGTGGCCTATTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_141_replicate_1	CTATAGCAATGTTGTGGCCTATTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_140_replicate_9	CTATAGCAATGTTGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_140_replicate_8	CTATAGCAATGTTGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_140_replicate_7	CTATAGCAATGTTGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_140_replicate_6	CTATAGCAATGTTGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_140_replicate_5	CTATAGCAATGTTGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_140_replicate_4	CTATAGCAATGTTGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_140_replicate_3	CTATAGCAATGTTGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_140_replicate_2	CTATAGCAATGTTGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_140_replicate_10	CTATAGCAATGTTGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_140_replicate_1	CTATAGCAATGTTGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_14_replicate_9	CTATAGCAATGTCGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_14_replicate_8	CTATAGCAATGTCGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_14_replicate_7	CTATAGCAATGTCGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_14_replicate_6	CTATAGCAATGTCGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_14_replicate_5	CTATAGCAATGTCGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_14_replicate_4	CTATAGCAATGTCGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_14_replicate_3	CTATAGCAATGTCGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_14_replicate_2	CTATAGCAATGTCGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_14_replicate_10	CTATAGCAATGTCGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_14_replicate_1	CTATAGCAATGTCGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_139_replicate_9	CTATAGCAATGTTGTGGCCGGTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_139_replicate_8	CTATAGCAATGTTGTGGCCGGTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_139_replicate_7	CTATAGCAATGTTGTGGCCGGTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_139_replicate_6	CTATAGCAATGTTGTGGCCGGTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_139_replicate_5	CTATAGCAATGTTGTGGCCGGTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_139_replicate_4	CTATAGCAATGTTGTGGCCGGTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_139_replicate_3	CTATAGCAATGTTGTGGCCGGTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_139_replicate_2	CTATAGCAATGTTGTGGCCGGTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_139_replicate_10	CTATAGCAATGTTGTGGCCGGTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_139_replicate_1	CTATAGCAATGTTGTGGCCGGTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_138_replicate_9	CTATAGCAATGTTGTGGCCGCTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_138_replicate_8	CTATAGCAATGTTGTGGCCGCTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_138_replicate_7	CTATAGCAATGTTGTGGCCGCTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_138_replicate_6	CTATAGCAATGTTGTGGCCGCTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_138_replicate_5	CTATAGCAATGTTGTGGCCGCTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_138_replicate_4	CTATAGCAATGTTGTGGCCGCTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_138_replicate_3	CTATAGCAATGTTGTGGCCGCTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_138_replicate_2	CTATAGCAATGTTGTGGCCGCTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_138_replicate_10	CTATAGCAATGTTGTGGCCGCTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_138_replicate_1	CTATAGCAATGTTGTGGCCGCTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_137_replicate_9	CTATAGCAATGTTGTGGCCGATTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_137_replicate_8	CTATAGCAATGTTGTGGCCGATTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_137_replicate_7	CTATAGCAATGTTGTGGCCGATTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_137_replicate_6	CTATAGCAATGTTGTGGCCGATTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_137_replicate_5	CTATAGCAATGTTGTGGCCGATTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_137_replicate_4	CTATAGCAATGTTGTGGCCGATTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_137_replicate_3	CTATAGCAATGTTGTGGCCGATTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_137_replicate_2	CTATAGCAATGTTGTGGCCGATTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_137_replicate_10	CTATAGCAATGTTGTGGCCGATTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_137_replicate_1	CTATAGCAATGTTGTGGCCGATTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_136_replicate_9	CTATAGCAATGTTGTGGCCCTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_136_replicate_8	CTATAGCAATGTTGTGGCCCTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_136_replicate_7	CTATAGCAATGTTGTGGCCCTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_136_replicate_6	CTATAGCAATGTTGTGGCCCTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_136_replicate_5	CTATAGCAATGTTGTGGCCCTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_136_replicate_4	CTATAGCAATGTTGTGGCCCTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_136_replicate_3	CTATAGCAATGTTGTGGCCCTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_136_replicate_2	CTATAGCAATGTTGTGGCCCTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_136_replicate_10	CTATAGCAATGTTGTGGCCCTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_136_replicate_1	CTATAGCAATGTTGTGGCCCTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_135_replicate_9	CTATAGCAATGTTGTGGCCCGTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_135_replicate_8	CTATAGCAATGTTGTGGCCCGTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_135_replicate_7	CTATAGCAATGTTGTGGCCCGTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_135_replicate_6	CTATAGCAATGTTGTGGCCCGTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_135_replicate_5	CTATAGCAATGTTGTGGCCCGTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_135_replicate_4	CTATAGCAATGTTGTGGCCCGTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_135_replicate_3	CTATAGCAATGTTGTGGCCCGTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_135_replicate_2	CTATAGCAATGTTGTGGCCCGTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_135_replicate_10	CTATAGCAATGTTGTGGCCCGTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_135_replicate_1	CTATAGCAATGTTGTGGCCCGTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_134_replicate_9	CTATAGCAATGTTGTGGCCCCTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_134_replicate_8	CTATAGCAATGTTGTGGCCCCTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_134_replicate_7	CTATAGCAATGTTGTGGCCCCTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_134_replicate_6	CTATAGCAATGTTGTGGCCCCTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_134_replicate_5	CTATAGCAATGTTGTGGCCCCTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_134_replicate_4	CTATAGCAATGTTGTGGCCCCTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_134_replicate_3	CTATAGCAATGTTGTGGCCCCTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_134_replicate_2	CTATAGCAATGTTGTGGCCCCTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_134_replicate_10	CTATAGCAATGTTGTGGCCCCTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_134_replicate_1	CTATAGCAATGTTGTGGCCCCTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_133_replicate_9	CTATAGCAATGTTGTGGCCCATTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_133_replicate_8	CTATAGCAATGTTGTGGCCCATTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_133_replicate_7	CTATAGCAATGTTGTGGCCCATTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_133_replicate_6	CTATAGCAATGTTGTGGCCCATTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_133_replicate_5	CTATAGCAATGTTGTGGCCCATTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_133_replicate_4	CTATAGCAATGTTGTGGCCCATTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_133_replicate_3	CTATAGCAATGTTGTGGCCCATTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_133_replicate_2	CTATAGCAATGTTGTGGCCCATTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_133_replicate_10	CTATAGCAATGTTGTGGCCCATTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_133_replicate_1	CTATAGCAATGTTGTGGCCCATTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_132_replicate_9	CTATAGCAATGTTGTGGCCATTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_132_replicate_8	CTATAGCAATGTTGTGGCCATTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_132_replicate_7	CTATAGCAATGTTGTGGCCATTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_132_replicate_6	CTATAGCAATGTTGTGGCCATTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_132_replicate_5	CTATAGCAATGTTGTGGCCATTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_132_replicate_4	CTATAGCAATGTTGTGGCCATTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_132_replicate_3	CTATAGCAATGTTGTGGCCATTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_132_replicate_2	CTATAGCAATGTTGTGGCCATTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_132_replicate_10	CTATAGCAATGTTGTGGCCATTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_132_replicate_1	CTATAGCAATGTTGTGGCCATTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_131_replicate_9	CTATAGCAATGTTGTGGCCAGTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_131_replicate_8	CTATAGCAATGTTGTGGCCAGTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_131_replicate_7	CTATAGCAATGTTGTGGCCAGTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_131_replicate_6	CTATAGCAATGTTGTGGCCAGTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_131_replicate_5	CTATAGCAATGTTGTGGCCAGTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_131_replicate_4	CTATAGCAATGTTGTGGCCAGTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_131_replicate_3	CTATAGCAATGTTGTGGCCAGTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_131_replicate_2	CTATAGCAATGTTGTGGCCAGTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_131_replicate_10	CTATAGCAATGTTGTGGCCAGTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_131_replicate_1	CTATAGCAATGTTGTGGCCAGTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_130_replicate_9	CTATAGCAATGTTGTGGCCACTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_130_replicate_8	CTATAGCAATGTTGTGGCCACTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_130_replicate_7	CTATAGCAATGTTGTGGCCACTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_130_replicate_6	CTATAGCAATGTTGTGGCCACTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_130_replicate_5	CTATAGCAATGTTGTGGCCACTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_130_replicate_4	CTATAGCAATGTTGTGGCCACTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_130_replicate_3	CTATAGCAATGTTGTGGCCACTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_130_replicate_2	CTATAGCAATGTTGTGGCCACTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_130_replicate_10	CTATAGCAATGTTGTGGCCACTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_130_replicate_1	CTATAGCAATGTTGTGGCCACTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_13_replicate_9	CTATAGCAATGTAGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_13_replicate_8	CTATAGCAATGTAGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_13_replicate_7	CTATAGCAATGTAGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_13_replicate_6	CTATAGCAATGTAGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_13_replicate_5	CTATAGCAATGTAGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_13_replicate_4	CTATAGCAATGTAGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_13_replicate_3	CTATAGCAATGTAGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_13_replicate_2	CTATAGCAATGTAGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_13_replicate_10	CTATAGCAATGTAGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_13_replicate_1	CTATAGCAATGTAGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_129_replicate_9	CTATAGCAATGTTGTGGCCAATTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_129_replicate_8	CTATAGCAATGTTGTGGCCAATTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_129_replicate_7	CTATAGCAATGTTGTGGCCAATTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_129_replicate_6	CTATAGCAATGTTGTGGCCAATTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_129_replicate_5	CTATAGCAATGTTGTGGCCAATTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_129_replicate_4	CTATAGCAATGTTGTGGCCAATTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_129_replicate_3	CTATAGCAATGTTGTGGCCAATTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_129_replicate_2	CTATAGCAATGTTGTGGCCAATTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_129_replicate_10	CTATAGCAATGTTGTGGCCAATTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_129_replicate_1	CTATAGCAATGTTGTGGCCAATTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_128_replicate_9	CTATAGCAATGTTGTGGCTTTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_128_replicate_8	CTATAGCAATGTTGTGGCTTTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_128_replicate_7	CTATAGCAATGTTGTGGCTTTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_128_replicate_6	CTATAGCAATGTTGTGGCTTTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_128_replicate_5	CTATAGCAATGTTGTGGCTTTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_128_replicate_4	CTATAGCAATGTTGTGGCTTTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_128_replicate_3	CTATAGCAATGTTGTGGCTTTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_128_replicate_2	CTATAGCAATGTTGTGGCTTTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_128_replicate_10	CTATAGCAATGTTGTGGCTTTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_128_replicate_1	CTATAGCAATGTTGTGGCTTTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_127_replicate_9	CTATAGCAATGTTGTGGCTGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_127_replicate_8	CTATAGCAATGTTGTGGCTGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_127_replicate_7	CTATAGCAATGTTGTGGCTGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_127_replicate_6	CTATAGCAATGTTGTGGCTGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_127_replicate_5	CTATAGCAATGTTGTGGCTGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_127_replicate_4	CTATAGCAATGTTGTGGCTGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_127_replicate_3	CTATAGCAATGTTGTGGCTGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_127_replicate_2	CTATAGCAATGTTGTGGCTGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_127_replicate_10	CTATAGCAATGTTGTGGCTGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_127_replicate_1	CTATAGCAATGTTGTGGCTGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_126_replicate_9	CTATAGCAATGTTGTGGCTCTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_126_replicate_8	CTATAGCAATGTTGTGGCTCTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_126_replicate_7	CTATAGCAATGTTGTGGCTCTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_126_replicate_6	CTATAGCAATGTTGTGGCTCTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_126_replicate_5	CTATAGCAATGTTGTGGCTCTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_126_replicate_4	CTATAGCAATGTTGTGGCTCTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_126_replicate_3	CTATAGCAATGTTGTGGCTCTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_126_replicate_2	CTATAGCAATGTTGTGGCTCTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_126_replicate_10	CTATAGCAATGTTGTGGCTCTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_126_replicate_1	CTATAGCAATGTTGTGGCTCTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_125_replicate_9	CTATAGCAATGTTGTGGCTATTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_125_replicate_8	CTATAGCAATGTTGTGGCTATTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_125_replicate_7	CTATAGCAATGTTGTGGCTATTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_125_replicate_6	CTATAGCAATGTTGTGGCTATTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_125_replicate_5	CTATAGCAATGTTGTGGCTATTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_125_replicate_4	CTATAGCAATGTTGTGGCTATTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_125_replicate_3	CTATAGCAATGTTGTGGCTATTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_125_replicate_2	CTATAGCAATGTTGTGGCTATTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_125_replicate_10	CTATAGCAATGTTGTGGCTATTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_125_replicate_1	CTATAGCAATGTTGTGGCTATTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_124_replicate_9	CTATAGCAATGTTGTGGCGTTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_124_replicate_8	CTATAGCAATGTTGTGGCGTTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_124_replicate_7	CTATAGCAATGTTGTGGCGTTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_124_replicate_6	CTATAGCAATGTTGTGGCGTTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_124_replicate_5	CTATAGCAATGTTGTGGCGTTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_124_replicate_4	CTATAGCAATGTTGTGGCGTTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_124_replicate_3	CTATAGCAATGTTGTGGCGTTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_124_replicate_2	CTATAGCAATGTTGTGGCGTTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_124_replicate_10	CTATAGCAATGTTGTGGCGTTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_124_replicate_1	CTATAGCAATGTTGTGGCGTTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_123_replicate_9	CTATAGCAATGTTGTGGCGGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_123_replicate_8	CTATAGCAATGTTGTGGCGGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_123_replicate_7	CTATAGCAATGTTGTGGCGGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_123_replicate_6	CTATAGCAATGTTGTGGCGGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_123_replicate_5	CTATAGCAATGTTGTGGCGGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_123_replicate_4	CTATAGCAATGTTGTGGCGGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_123_replicate_3	CTATAGCAATGTTGTGGCGGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_123_replicate_2	CTATAGCAATGTTGTGGCGGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_123_replicate_10	CTATAGCAATGTTGTGGCGGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_123_replicate_1	CTATAGCAATGTTGTGGCGGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_122_replicate_9	CTATAGCAATGTTGTGGCGCTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_122_replicate_8	CTATAGCAATGTTGTGGCGCTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_122_replicate_7	CTATAGCAATGTTGTGGCGCTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_122_replicate_6	CTATAGCAATGTTGTGGCGCTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_122_replicate_5	CTATAGCAATGTTGTGGCGCTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_122_replicate_4	CTATAGCAATGTTGTGGCGCTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_122_replicate_3	CTATAGCAATGTTGTGGCGCTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_122_replicate_2	CTATAGCAATGTTGTGGCGCTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_122_replicate_10	CTATAGCAATGTTGTGGCGCTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_122_replicate_1	CTATAGCAATGTTGTGGCGCTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_121_replicate_9	CTATAGCAATGTTGTGGCGATTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_121_replicate_8	CTATAGCAATGTTGTGGCGATTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_121_replicate_7	CTATAGCAATGTTGTGGCGATTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_121_replicate_6	CTATAGCAATGTTGTGGCGATTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_121_replicate_5	CTATAGCAATGTTGTGGCGATTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_121_replicate_4	CTATAGCAATGTTGTGGCGATTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_121_replicate_3	CTATAGCAATGTTGTGGCGATTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_121_replicate_2	CTATAGCAATGTTGTGGCGATTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_121_replicate_10	CTATAGCAATGTTGTGGCGATTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_121_replicate_1	CTATAGCAATGTTGTGGCGATTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_120_replicate_9	CTATAGCAATGTTGTGGCCTTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_120_replicate_8	CTATAGCAATGTTGTGGCCTTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_120_replicate_7	CTATAGCAATGTTGTGGCCTTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_120_replicate_6	CTATAGCAATGTTGTGGCCTTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_120_replicate_5	CTATAGCAATGTTGTGGCCTTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_120_replicate_4	CTATAGCAATGTTGTGGCCTTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_120_replicate_3	CTATAGCAATGTTGTGGCCTTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_120_replicate_2	CTATAGCAATGTTGTGGCCTTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_120_replicate_10	CTATAGCAATGTTGTGGCCTTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_120_replicate_1	CTATAGCAATGTTGTGGCCTTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_12_replicate_9	CTATAGCAATGGTGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_12_replicate_8	CTATAGCAATGGTGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_12_replicate_7	CTATAGCAATGGTGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_12_replicate_6	CTATAGCAATGGTGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_12_replicate_5	CTATAGCAATGGTGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_12_replicate_4	CTATAGCAATGGTGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_12_replicate_3	CTATAGCAATGGTGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_12_replicate_2	CTATAGCAATGGTGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_12_replicate_10	CTATAGCAATGGTGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_12_replicate_1	CTATAGCAATGGTGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_119_replicate_9	CTATAGCAATGTTGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_119_replicate_8	CTATAGCAATGTTGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_119_replicate_7	CTATAGCAATGTTGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_119_replicate_6	CTATAGCAATGTTGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_119_replicate_5	CTATAGCAATGTTGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_119_replicate_4	CTATAGCAATGTTGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_119_replicate_3	CTATAGCAATGTTGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_119_replicate_2	CTATAGCAATGTTGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_119_replicate_10	CTATAGCAATGTTGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_119_replicate_1	CTATAGCAATGTTGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_118_replicate_9	CTATAGCAATGTTGTGGCCCTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_118_replicate_8	CTATAGCAATGTTGTGGCCCTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_118_replicate_7	CTATAGCAATGTTGTGGCCCTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_118_replicate_6	CTATAGCAATGTTGTGGCCCTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_118_replicate_5	CTATAGCAATGTTGTGGCCCTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_118_replicate_4	CTATAGCAATGTTGTGGCCCTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_118_replicate_3	CTATAGCAATGTTGTGGCCCTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_118_replicate_2	CTATAGCAATGTTGTGGCCCTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_118_replicate_10	CTATAGCAATGTTGTGGCCCTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_118_replicate_1	CTATAGCAATGTTGTGGCCCTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_117_replicate_9	CTATAGCAATGTTGTGGCCATTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_117_replicate_8	CTATAGCAATGTTGTGGCCATTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_117_replicate_7	CTATAGCAATGTTGTGGCCATTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_117_replicate_6	CTATAGCAATGTTGTGGCCATTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_117_replicate_5	CTATAGCAATGTTGTGGCCATTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_117_replicate_4	CTATAGCAATGTTGTGGCCATTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_117_replicate_3	CTATAGCAATGTTGTGGCCATTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_117_replicate_2	CTATAGCAATGTTGTGGCCATTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_117_replicate_10	CTATAGCAATGTTGTGGCCATTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_117_replicate_1	CTATAGCAATGTTGTGGCCATTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_116_replicate_9	CTATAGCAATGTTGTGGCATTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_116_replicate_8	CTATAGCAATGTTGTGGCATTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_116_replicate_7	CTATAGCAATGTTGTGGCATTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_116_replicate_6	CTATAGCAATGTTGTGGCATTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_116_replicate_5	CTATAGCAATGTTGTGGCATTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_116_replicate_4	CTATAGCAATGTTGTGGCATTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_116_replicate_3	CTATAGCAATGTTGTGGCATTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_116_replicate_2	CTATAGCAATGTTGTGGCATTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_116_replicate_10	CTATAGCAATGTTGTGGCATTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_116_replicate_1	CTATAGCAATGTTGTGGCATTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_115_replicate_9	CTATAGCAATGTTGTGGCAGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_115_replicate_8	CTATAGCAATGTTGTGGCAGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_115_replicate_7	CTATAGCAATGTTGTGGCAGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_115_replicate_6	CTATAGCAATGTTGTGGCAGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_115_replicate_5	CTATAGCAATGTTGTGGCAGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_115_replicate_4	CTATAGCAATGTTGTGGCAGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_115_replicate_3	CTATAGCAATGTTGTGGCAGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_115_replicate_2	CTATAGCAATGTTGTGGCAGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_115_replicate_10	CTATAGCAATGTTGTGGCAGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_115_replicate_1	CTATAGCAATGTTGTGGCAGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_114_replicate_9	CTATAGCAATGTTGTGGCACTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_114_replicate_8	CTATAGCAATGTTGTGGCACTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_114_replicate_7	CTATAGCAATGTTGTGGCACTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_114_replicate_6	CTATAGCAATGTTGTGGCACTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_114_replicate_5	CTATAGCAATGTTGTGGCACTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_114_replicate_4	CTATAGCAATGTTGTGGCACTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_114_replicate_3	CTATAGCAATGTTGTGGCACTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_114_replicate_2	CTATAGCAATGTTGTGGCACTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_114_replicate_10	CTATAGCAATGTTGTGGCACTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_114_replicate_1	CTATAGCAATGTTGTGGCACTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_113_replicate_9	CTATAGCAATGTTGTGGCAATTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_113_replicate_8	CTATAGCAATGTTGTGGCAATTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_113_replicate_7	CTATAGCAATGTTGTGGCAATTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_113_replicate_6	CTATAGCAATGTTGTGGCAATTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_113_replicate_5	CTATAGCAATGTTGTGGCAATTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_113_replicate_4	CTATAGCAATGTTGTGGCAATTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_113_replicate_3	CTATAGCAATGTTGTGGCAATTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_113_replicate_2	CTATAGCAATGTTGTGGCAATTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_113_replicate_10	CTATAGCAATGTTGTGGCAATTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_113_replicate_1	CTATAGCAATGTTGTGGCAATTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_112_replicate_9	CTATAGCAATGTTGTGGTTGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_112_replicate_8	CTATAGCAATGTTGTGGTTGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_112_replicate_7	CTATAGCAATGTTGTGGTTGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_112_replicate_6	CTATAGCAATGTTGTGGTTGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_112_replicate_5	CTATAGCAATGTTGTGGTTGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_112_replicate_4	CTATAGCAATGTTGTGGTTGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_112_replicate_3	CTATAGCAATGTTGTGGTTGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_112_replicate_2	CTATAGCAATGTTGTGGTTGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_112_replicate_10	CTATAGCAATGTTGTGGTTGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_112_replicate_1	CTATAGCAATGTTGTGGTTGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_111_replicate_9	CTATAGCAATGTTGTGGTGGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_111_replicate_8	CTATAGCAATGTTGTGGTGGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_111_replicate_7	CTATAGCAATGTTGTGGTGGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_111_replicate_6	CTATAGCAATGTTGTGGTGGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_111_replicate_5	CTATAGCAATGTTGTGGTGGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_111_replicate_4	CTATAGCAATGTTGTGGTGGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_111_replicate_3	CTATAGCAATGTTGTGGTGGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_111_replicate_2	CTATAGCAATGTTGTGGTGGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_111_replicate_10	CTATAGCAATGTTGTGGTGGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_111_replicate_1	CTATAGCAATGTTGTGGTGGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_110_replicate_9	CTATAGCAATGTTGTGGTCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_110_replicate_8	CTATAGCAATGTTGTGGTCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_110_replicate_7	CTATAGCAATGTTGTGGTCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_110_replicate_6	CTATAGCAATGTTGTGGTCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_110_replicate_5	CTATAGCAATGTTGTGGTCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_110_replicate_4	CTATAGCAATGTTGTGGTCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_110_replicate_3	CTATAGCAATGTTGTGGTCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_110_replicate_2	CTATAGCAATGTTGTGGTCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_110_replicate_10	CTATAGCAATGTTGTGGTCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_110_replicate_1	CTATAGCAATGTTGTGGTCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_11_replicate_9	CTATAGCAATGGGGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_11_replicate_8	CTATAGCAATGGGGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_11_replicate_7	CTATAGCAATGGGGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_11_replicate_6	CTATAGCAATGGGGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_11_replicate_5	CTATAGCAATGGGGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_11_replicate_4	CTATAGCAATGGGGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_11_replicate_3	CTATAGCAATGGGGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_11_replicate_2	CTATAGCAATGGGGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_11_replicate_10	CTATAGCAATGGGGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_11_replicate_1	CTATAGCAATGGGGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_109_replicate_9	CTATAGCAATGTTGTGGTAGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_109_replicate_8	CTATAGCAATGTTGTGGTAGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_109_replicate_7	CTATAGCAATGTTGTGGTAGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_109_replicate_6	CTATAGCAATGTTGTGGTAGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_109_replicate_5	CTATAGCAATGTTGTGGTAGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_109_replicate_4	CTATAGCAATGTTGTGGTAGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_109_replicate_3	CTATAGCAATGTTGTGGTAGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_109_replicate_2	CTATAGCAATGTTGTGGTAGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_109_replicate_10	CTATAGCAATGTTGTGGTAGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_109_replicate_1	CTATAGCAATGTTGTGGTAGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_108_replicate_9	CTATAGCAATGTTGTGGGTGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_108_replicate_8	CTATAGCAATGTTGTGGGTGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_108_replicate_7	CTATAGCAATGTTGTGGGTGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_108_replicate_6	CTATAGCAATGTTGTGGGTGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_108_replicate_5	CTATAGCAATGTTGTGGGTGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_108_replicate_4	CTATAGCAATGTTGTGGGTGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_108_replicate_3	CTATAGCAATGTTGTGGGTGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_108_replicate_2	CTATAGCAATGTTGTGGGTGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_108_replicate_10	CTATAGCAATGTTGTGGGTGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_108_replicate_1	CTATAGCAATGTTGTGGGTGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_107_replicate_9	CTATAGCAATGTTGTGGGGGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_107_replicate_8	CTATAGCAATGTTGTGGGGGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_107_replicate_7	CTATAGCAATGTTGTGGGGGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_107_replicate_6	CTATAGCAATGTTGTGGGGGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_107_replicate_5	CTATAGCAATGTTGTGGGGGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_107_replicate_4	CTATAGCAATGTTGTGGGGGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_107_replicate_3	CTATAGCAATGTTGTGGGGGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_107_replicate_2	CTATAGCAATGTTGTGGGGGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_107_replicate_10	CTATAGCAATGTTGTGGGGGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_107_replicate_1	CTATAGCAATGTTGTGGGGGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_106_replicate_9	CTATAGCAATGTTGTGGGCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_106_replicate_8	CTATAGCAATGTTGTGGGCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_106_replicate_7	CTATAGCAATGTTGTGGGCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_106_replicate_6	CTATAGCAATGTTGTGGGCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_106_replicate_5	CTATAGCAATGTTGTGGGCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_106_replicate_4	CTATAGCAATGTTGTGGGCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_106_replicate_3	CTATAGCAATGTTGTGGGCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_106_replicate_2	CTATAGCAATGTTGTGGGCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_106_replicate_10	CTATAGCAATGTTGTGGGCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_106_replicate_1	CTATAGCAATGTTGTGGGCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_105_replicate_9	CTATAGCAATGTTGTGGGAGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_105_replicate_8	CTATAGCAATGTTGTGGGAGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_105_replicate_7	CTATAGCAATGTTGTGGGAGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_105_replicate_6	CTATAGCAATGTTGTGGGAGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_105_replicate_5	CTATAGCAATGTTGTGGGAGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_105_replicate_4	CTATAGCAATGTTGTGGGAGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_105_replicate_3	CTATAGCAATGTTGTGGGAGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_105_replicate_2	CTATAGCAATGTTGTGGGAGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_105_replicate_10	CTATAGCAATGTTGTGGGAGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_105_replicate_1	CTATAGCAATGTTGTGGGAGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_104_replicate_9	CTATAGCAATGTTGTGGCTGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_104_replicate_8	CTATAGCAATGTTGTGGCTGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_104_replicate_7	CTATAGCAATGTTGTGGCTGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_104_replicate_6	CTATAGCAATGTTGTGGCTGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_104_replicate_5	CTATAGCAATGTTGTGGCTGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_104_replicate_4	CTATAGCAATGTTGTGGCTGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_104_replicate_3	CTATAGCAATGTTGTGGCTGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_104_replicate_2	CTATAGCAATGTTGTGGCTGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_104_replicate_10	CTATAGCAATGTTGTGGCTGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_104_replicate_1	CTATAGCAATGTTGTGGCTGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_103_replicate_9	CTATAGCAATGTTGTGGCGGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_103_replicate_8	CTATAGCAATGTTGTGGCGGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_103_replicate_7	CTATAGCAATGTTGTGGCGGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_103_replicate_6	CTATAGCAATGTTGTGGCGGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_103_replicate_5	CTATAGCAATGTTGTGGCGGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_103_replicate_4	CTATAGCAATGTTGTGGCGGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_103_replicate_3	CTATAGCAATGTTGTGGCGGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_103_replicate_2	CTATAGCAATGTTGTGGCGGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_103_replicate_10	CTATAGCAATGTTGTGGCGGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_103_replicate_1	CTATAGCAATGTTGTGGCGGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_102_replicate_9	CTATAGCAATGTTGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_102_replicate_8	CTATAGCAATGTTGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_102_replicate_7	CTATAGCAATGTTGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_102_replicate_6	CTATAGCAATGTTGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_102_replicate_5	CTATAGCAATGTTGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_102_replicate_4	CTATAGCAATGTTGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_102_replicate_3	CTATAGCAATGTTGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_102_replicate_2	CTATAGCAATGTTGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_102_replicate_10	CTATAGCAATGTTGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_102_replicate_1	CTATAGCAATGTTGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_101_replicate_9	CTATAGCAATGTTGTGGCAGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_101_replicate_8	CTATAGCAATGTTGTGGCAGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_101_replicate_7	CTATAGCAATGTTGTGGCAGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_101_replicate_6	CTATAGCAATGTTGTGGCAGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_101_replicate_5	CTATAGCAATGTTGTGGCAGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_101_replicate_4	CTATAGCAATGTTGTGGCAGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_101_replicate_3	CTATAGCAATGTTGTGGCAGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_101_replicate_2	CTATAGCAATGTTGTGGCAGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_101_replicate_10	CTATAGCAATGTTGTGGCAGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_101_replicate_1	CTATAGCAATGTTGTGGCAGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_100_replicate_9	CTATAGCAATGTTGTGGATGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_100_replicate_8	CTATAGCAATGTTGTGGATGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_100_replicate_7	CTATAGCAATGTTGTGGATGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_100_replicate_6	CTATAGCAATGTTGTGGATGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_100_replicate_5	CTATAGCAATGTTGTGGATGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_100_replicate_4	CTATAGCAATGTTGTGGATGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_100_replicate_3	CTATAGCAATGTTGTGGATGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_100_replicate_2	CTATAGCAATGTTGTGGATGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_100_replicate_10	CTATAGCAATGTTGTGGATGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_100_replicate_1	CTATAGCAATGTTGTGGATGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_10_replicate_9	CTATAGCAATGGCGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_10_replicate_8	CTATAGCAATGGCGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_10_replicate_7	CTATAGCAATGGCGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_10_replicate_6	CTATAGCAATGGCGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_10_replicate_5	CTATAGCAATGGCGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_10_replicate_4	CTATAGCAATGGCGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_10_replicate_3	CTATAGCAATGGCGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_10_replicate_2	CTATAGCAATGGCGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_10_replicate_10	CTATAGCAATGGCGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_10_replicate_1	CTATAGCAATGGCGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_1_replicate_9	CTATAGCAATGAAGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_1_replicate_8	CTATAGCAATGAAGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_1_replicate_7	CTATAGCAATGAAGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_1_replicate_6	CTATAGCAATGAAGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_1_replicate_5	CTATAGCAATGAAGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_1_replicate_4	CTATAGCAATGAAGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_1_replicate_3	CTATAGCAATGAAGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_1_replicate_2	CTATAGCAATGAAGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_1_replicate_10	CTATAGCAATGAAGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2043_dinucleotide_substitution_1_replicate_1	CTATAGCAATGAAGTGGCCGTTTACGCATTGCTATAGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_99_replicate_9	CTATAGCAATGTTCTTCAGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_99_replicate_8	CTATAGCAATGTTCTTCAGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_99_replicate_7	CTATAGCAATGTTCTTCAGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_99_replicate_6	CTATAGCAATGTTCTTCAGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_99_replicate_5	CTATAGCAATGTTCTTCAGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_99_replicate_4	CTATAGCAATGTTCTTCAGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_99_replicate_3	CTATAGCAATGTTCTTCAGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_99_replicate_2	CTATAGCAATGTTCTTCAGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_99_replicate_10	CTATAGCAATGTTCTTCAGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_99_replicate_1	CTATAGCAATGTTCTTCAGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_98_replicate_9	CTATAGCAATGTTCTTCACCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_98_replicate_8	CTATAGCAATGTTCTTCACCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_98_replicate_7	CTATAGCAATGTTCTTCACCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_98_replicate_6	CTATAGCAATGTTCTTCACCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_98_replicate_5	CTATAGCAATGTTCTTCACCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_98_replicate_4	CTATAGCAATGTTCTTCACCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_98_replicate_3	CTATAGCAATGTTCTTCACCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_98_replicate_2	CTATAGCAATGTTCTTCACCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_98_replicate_10	CTATAGCAATGTTCTTCACCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_98_replicate_1	CTATAGCAATGTTCTTCACCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_97_replicate_9	CTATAGCAATGTTCTTCAACTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_97_replicate_8	CTATAGCAATGTTCTTCAACTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_97_replicate_7	CTATAGCAATGTTCTTCAACTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_97_replicate_6	CTATAGCAATGTTCTTCAACTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_97_replicate_5	CTATAGCAATGTTCTTCAACTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_97_replicate_4	CTATAGCAATGTTCTTCAACTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_97_replicate_3	CTATAGCAATGTTCTTCAACTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_97_replicate_2	CTATAGCAATGTTCTTCAACTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_97_replicate_10	CTATAGCAATGTTCTTCAACTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_97_replicate_1	CTATAGCAATGTTCTTCAACTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_96_replicate_9	CTATAGCAATGTTCTTTTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_96_replicate_8	CTATAGCAATGTTCTTTTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_96_replicate_7	CTATAGCAATGTTCTTTTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_96_replicate_6	CTATAGCAATGTTCTTTTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_96_replicate_5	CTATAGCAATGTTCTTTTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_96_replicate_4	CTATAGCAATGTTCTTTTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_96_replicate_3	CTATAGCAATGTTCTTTTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_96_replicate_2	CTATAGCAATGTTCTTTTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_96_replicate_10	CTATAGCAATGTTCTTTTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_96_replicate_1	CTATAGCAATGTTCTTTTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_95_replicate_9	CTATAGCAATGTTCTTTGGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_95_replicate_8	CTATAGCAATGTTCTTTGGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_95_replicate_7	CTATAGCAATGTTCTTTGGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_95_replicate_6	CTATAGCAATGTTCTTTGGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_95_replicate_5	CTATAGCAATGTTCTTTGGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_95_replicate_4	CTATAGCAATGTTCTTTGGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_95_replicate_3	CTATAGCAATGTTCTTTGGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_95_replicate_2	CTATAGCAATGTTCTTTGGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_95_replicate_10	CTATAGCAATGTTCTTTGGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_95_replicate_1	CTATAGCAATGTTCTTTGGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_94_replicate_9	CTATAGCAATGTTCTTTCGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_94_replicate_8	CTATAGCAATGTTCTTTCGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_94_replicate_7	CTATAGCAATGTTCTTTCGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_94_replicate_6	CTATAGCAATGTTCTTTCGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_94_replicate_5	CTATAGCAATGTTCTTTCGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_94_replicate_4	CTATAGCAATGTTCTTTCGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_94_replicate_3	CTATAGCAATGTTCTTTCGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_94_replicate_2	CTATAGCAATGTTCTTTCGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_94_replicate_10	CTATAGCAATGTTCTTTCGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_94_replicate_1	CTATAGCAATGTTCTTTCGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_93_replicate_9	CTATAGCAATGTTCTTTAGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_93_replicate_8	CTATAGCAATGTTCTTTAGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_93_replicate_7	CTATAGCAATGTTCTTTAGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_93_replicate_6	CTATAGCAATGTTCTTTAGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_93_replicate_5	CTATAGCAATGTTCTTTAGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_93_replicate_4	CTATAGCAATGTTCTTTAGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_93_replicate_3	CTATAGCAATGTTCTTTAGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_93_replicate_2	CTATAGCAATGTTCTTTAGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_93_replicate_10	CTATAGCAATGTTCTTTAGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_93_replicate_1	CTATAGCAATGTTCTTTAGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_92_replicate_9	CTATAGCAATGTTCTTGTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_92_replicate_8	CTATAGCAATGTTCTTGTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_92_replicate_7	CTATAGCAATGTTCTTGTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_92_replicate_6	CTATAGCAATGTTCTTGTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_92_replicate_5	CTATAGCAATGTTCTTGTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_92_replicate_4	CTATAGCAATGTTCTTGTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_92_replicate_3	CTATAGCAATGTTCTTGTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_92_replicate_2	CTATAGCAATGTTCTTGTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_92_replicate_10	CTATAGCAATGTTCTTGTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_92_replicate_1	CTATAGCAATGTTCTTGTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_91_replicate_9	CTATAGCAATGTTCTTGGGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_91_replicate_8	CTATAGCAATGTTCTTGGGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_91_replicate_7	CTATAGCAATGTTCTTGGGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_91_replicate_6	CTATAGCAATGTTCTTGGGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_91_replicate_5	CTATAGCAATGTTCTTGGGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_91_replicate_4	CTATAGCAATGTTCTTGGGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_91_replicate_3	CTATAGCAATGTTCTTGGGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_91_replicate_2	CTATAGCAATGTTCTTGGGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_91_replicate_10	CTATAGCAATGTTCTTGGGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_91_replicate_1	CTATAGCAATGTTCTTGGGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_90_replicate_9	CTATAGCAATGTTCTTGCGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_90_replicate_8	CTATAGCAATGTTCTTGCGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_90_replicate_7	CTATAGCAATGTTCTTGCGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_90_replicate_6	CTATAGCAATGTTCTTGCGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_90_replicate_5	CTATAGCAATGTTCTTGCGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_90_replicate_4	CTATAGCAATGTTCTTGCGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_90_replicate_3	CTATAGCAATGTTCTTGCGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_90_replicate_2	CTATAGCAATGTTCTTGCGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_90_replicate_10	CTATAGCAATGTTCTTGCGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_90_replicate_1	CTATAGCAATGTTCTTGCGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_9_replicate_9	CTATAGCAATGGACTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_9_replicate_8	CTATAGCAATGGACTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_9_replicate_7	CTATAGCAATGGACTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_9_replicate_6	CTATAGCAATGGACTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_9_replicate_5	CTATAGCAATGGACTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_9_replicate_4	CTATAGCAATGGACTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_9_replicate_3	CTATAGCAATGGACTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_9_replicate_2	CTATAGCAATGGACTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_9_replicate_10	CTATAGCAATGGACTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_9_replicate_1	CTATAGCAATGGACTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_89_replicate_9	CTATAGCAATGTTCTTGAGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_89_replicate_8	CTATAGCAATGTTCTTGAGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_89_replicate_7	CTATAGCAATGTTCTTGAGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_89_replicate_6	CTATAGCAATGTTCTTGAGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_89_replicate_5	CTATAGCAATGTTCTTGAGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_89_replicate_4	CTATAGCAATGTTCTTGAGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_89_replicate_3	CTATAGCAATGTTCTTGAGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_89_replicate_2	CTATAGCAATGTTCTTGAGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_89_replicate_10	CTATAGCAATGTTCTTGAGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_89_replicate_1	CTATAGCAATGTTCTTGAGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_88_replicate_9	CTATAGCAATGTTCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_88_replicate_8	CTATAGCAATGTTCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_88_replicate_7	CTATAGCAATGTTCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_88_replicate_6	CTATAGCAATGTTCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_88_replicate_5	CTATAGCAATGTTCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_88_replicate_4	CTATAGCAATGTTCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_88_replicate_3	CTATAGCAATGTTCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_88_replicate_2	CTATAGCAATGTTCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_88_replicate_10	CTATAGCAATGTTCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_88_replicate_1	CTATAGCAATGTTCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_87_replicate_9	CTATAGCAATGTTCTTCGGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_87_replicate_8	CTATAGCAATGTTCTTCGGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_87_replicate_7	CTATAGCAATGTTCTTCGGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_87_replicate_6	CTATAGCAATGTTCTTCGGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_87_replicate_5	CTATAGCAATGTTCTTCGGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_87_replicate_4	CTATAGCAATGTTCTTCGGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_87_replicate_3	CTATAGCAATGTTCTTCGGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_87_replicate_2	CTATAGCAATGTTCTTCGGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_87_replicate_10	CTATAGCAATGTTCTTCGGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_87_replicate_1	CTATAGCAATGTTCTTCGGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_86_replicate_9	CTATAGCAATGTTCTTCCGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_86_replicate_8	CTATAGCAATGTTCTTCCGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_86_replicate_7	CTATAGCAATGTTCTTCCGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_86_replicate_6	CTATAGCAATGTTCTTCCGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_86_replicate_5	CTATAGCAATGTTCTTCCGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_86_replicate_4	CTATAGCAATGTTCTTCCGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_86_replicate_3	CTATAGCAATGTTCTTCCGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_86_replicate_2	CTATAGCAATGTTCTTCCGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_86_replicate_10	CTATAGCAATGTTCTTCCGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_86_replicate_1	CTATAGCAATGTTCTTCCGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_85_replicate_9	CTATAGCAATGTTCTTCAGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_85_replicate_8	CTATAGCAATGTTCTTCAGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_85_replicate_7	CTATAGCAATGTTCTTCAGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_85_replicate_6	CTATAGCAATGTTCTTCAGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_85_replicate_5	CTATAGCAATGTTCTTCAGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_85_replicate_4	CTATAGCAATGTTCTTCAGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_85_replicate_3	CTATAGCAATGTTCTTCAGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_85_replicate_2	CTATAGCAATGTTCTTCAGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_85_replicate_10	CTATAGCAATGTTCTTCAGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_85_replicate_1	CTATAGCAATGTTCTTCAGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_84_replicate_9	CTATAGCAATGTTCTTATGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_84_replicate_8	CTATAGCAATGTTCTTATGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_84_replicate_7	CTATAGCAATGTTCTTATGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_84_replicate_6	CTATAGCAATGTTCTTATGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_84_replicate_5	CTATAGCAATGTTCTTATGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_84_replicate_4	CTATAGCAATGTTCTTATGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_84_replicate_3	CTATAGCAATGTTCTTATGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_84_replicate_2	CTATAGCAATGTTCTTATGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_84_replicate_10	CTATAGCAATGTTCTTATGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_84_replicate_1	CTATAGCAATGTTCTTATGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_83_replicate_9	CTATAGCAATGTTCTTAGGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_83_replicate_8	CTATAGCAATGTTCTTAGGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_83_replicate_7	CTATAGCAATGTTCTTAGGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_83_replicate_6	CTATAGCAATGTTCTTAGGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_83_replicate_5	CTATAGCAATGTTCTTAGGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_83_replicate_4	CTATAGCAATGTTCTTAGGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_83_replicate_3	CTATAGCAATGTTCTTAGGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_83_replicate_2	CTATAGCAATGTTCTTAGGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_83_replicate_10	CTATAGCAATGTTCTTAGGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_83_replicate_1	CTATAGCAATGTTCTTAGGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_82_replicate_9	CTATAGCAATGTTCTTACGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_82_replicate_8	CTATAGCAATGTTCTTACGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_82_replicate_7	CTATAGCAATGTTCTTACGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_82_replicate_6	CTATAGCAATGTTCTTACGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_82_replicate_5	CTATAGCAATGTTCTTACGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_82_replicate_4	CTATAGCAATGTTCTTACGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_82_replicate_3	CTATAGCAATGTTCTTACGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_82_replicate_2	CTATAGCAATGTTCTTACGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_82_replicate_10	CTATAGCAATGTTCTTACGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_82_replicate_1	CTATAGCAATGTTCTTACGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_81_replicate_9	CTATAGCAATGTTCTTAAGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_81_replicate_8	CTATAGCAATGTTCTTAAGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_81_replicate_7	CTATAGCAATGTTCTTAAGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_81_replicate_6	CTATAGCAATGTTCTTAAGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_81_replicate_5	CTATAGCAATGTTCTTAAGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_81_replicate_4	CTATAGCAATGTTCTTAAGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_81_replicate_3	CTATAGCAATGTTCTTAAGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_81_replicate_2	CTATAGCAATGTTCTTAAGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_81_replicate_10	CTATAGCAATGTTCTTAAGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_81_replicate_1	CTATAGCAATGTTCTTAAGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_80_replicate_9	CTATAGCAATGTTCTTTTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_80_replicate_8	CTATAGCAATGTTCTTTTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_80_replicate_7	CTATAGCAATGTTCTTTTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_80_replicate_6	CTATAGCAATGTTCTTTTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_80_replicate_5	CTATAGCAATGTTCTTTTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_80_replicate_4	CTATAGCAATGTTCTTTTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_80_replicate_3	CTATAGCAATGTTCTTTTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_80_replicate_2	CTATAGCAATGTTCTTTTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_80_replicate_10	CTATAGCAATGTTCTTTTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_80_replicate_1	CTATAGCAATGTTCTTTTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_8_replicate_9	CTATAGCAATGCTCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_8_replicate_8	CTATAGCAATGCTCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_8_replicate_7	CTATAGCAATGCTCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_8_replicate_6	CTATAGCAATGCTCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_8_replicate_5	CTATAGCAATGCTCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_8_replicate_4	CTATAGCAATGCTCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_8_replicate_3	CTATAGCAATGCTCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_8_replicate_2	CTATAGCAATGCTCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_8_replicate_10	CTATAGCAATGCTCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_8_replicate_1	CTATAGCAATGCTCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_79_replicate_9	CTATAGCAATGTTCTTGTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_79_replicate_8	CTATAGCAATGTTCTTGTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_79_replicate_7	CTATAGCAATGTTCTTGTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_79_replicate_6	CTATAGCAATGTTCTTGTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_79_replicate_5	CTATAGCAATGTTCTTGTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_79_replicate_4	CTATAGCAATGTTCTTGTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_79_replicate_3	CTATAGCAATGTTCTTGTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_79_replicate_2	CTATAGCAATGTTCTTGTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_79_replicate_10	CTATAGCAATGTTCTTGTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_79_replicate_1	CTATAGCAATGTTCTTGTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_78_replicate_9	CTATAGCAATGTTCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_78_replicate_8	CTATAGCAATGTTCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_78_replicate_7	CTATAGCAATGTTCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_78_replicate_6	CTATAGCAATGTTCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_78_replicate_5	CTATAGCAATGTTCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_78_replicate_4	CTATAGCAATGTTCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_78_replicate_3	CTATAGCAATGTTCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_78_replicate_2	CTATAGCAATGTTCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_78_replicate_10	CTATAGCAATGTTCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_78_replicate_1	CTATAGCAATGTTCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_77_replicate_9	CTATAGCAATGTTCTTATGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_77_replicate_8	CTATAGCAATGTTCTTATGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_77_replicate_7	CTATAGCAATGTTCTTATGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_77_replicate_6	CTATAGCAATGTTCTTATGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_77_replicate_5	CTATAGCAATGTTCTTATGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_77_replicate_4	CTATAGCAATGTTCTTATGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_77_replicate_3	CTATAGCAATGTTCTTATGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_77_replicate_2	CTATAGCAATGTTCTTATGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_77_replicate_10	CTATAGCAATGTTCTTATGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_77_replicate_1	CTATAGCAATGTTCTTATGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_76_replicate_9	CTATAGCAATGTTCTGTTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_76_replicate_8	CTATAGCAATGTTCTGTTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_76_replicate_7	CTATAGCAATGTTCTGTTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_76_replicate_6	CTATAGCAATGTTCTGTTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_76_replicate_5	CTATAGCAATGTTCTGTTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_76_replicate_4	CTATAGCAATGTTCTGTTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_76_replicate_3	CTATAGCAATGTTCTGTTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_76_replicate_2	CTATAGCAATGTTCTGTTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_76_replicate_10	CTATAGCAATGTTCTGTTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_76_replicate_1	CTATAGCAATGTTCTGTTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_75_replicate_9	CTATAGCAATGTTCTGGTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_75_replicate_8	CTATAGCAATGTTCTGGTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_75_replicate_7	CTATAGCAATGTTCTGGTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_75_replicate_6	CTATAGCAATGTTCTGGTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_75_replicate_5	CTATAGCAATGTTCTGGTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_75_replicate_4	CTATAGCAATGTTCTGGTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_75_replicate_3	CTATAGCAATGTTCTGGTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_75_replicate_2	CTATAGCAATGTTCTGGTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_75_replicate_10	CTATAGCAATGTTCTGGTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_75_replicate_1	CTATAGCAATGTTCTGGTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_74_replicate_9	CTATAGCAATGTTCTGCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_74_replicate_8	CTATAGCAATGTTCTGCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_74_replicate_7	CTATAGCAATGTTCTGCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_74_replicate_6	CTATAGCAATGTTCTGCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_74_replicate_5	CTATAGCAATGTTCTGCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_74_replicate_4	CTATAGCAATGTTCTGCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_74_replicate_3	CTATAGCAATGTTCTGCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_74_replicate_2	CTATAGCAATGTTCTGCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_74_replicate_10	CTATAGCAATGTTCTGCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_74_replicate_1	CTATAGCAATGTTCTGCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_73_replicate_9	CTATAGCAATGTTCTGATGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_73_replicate_8	CTATAGCAATGTTCTGATGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_73_replicate_7	CTATAGCAATGTTCTGATGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_73_replicate_6	CTATAGCAATGTTCTGATGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_73_replicate_5	CTATAGCAATGTTCTGATGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_73_replicate_4	CTATAGCAATGTTCTGATGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_73_replicate_3	CTATAGCAATGTTCTGATGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_73_replicate_2	CTATAGCAATGTTCTGATGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_73_replicate_10	CTATAGCAATGTTCTGATGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_73_replicate_1	CTATAGCAATGTTCTGATGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_72_replicate_9	CTATAGCAATGTTCTCTTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_72_replicate_8	CTATAGCAATGTTCTCTTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_72_replicate_7	CTATAGCAATGTTCTCTTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_72_replicate_6	CTATAGCAATGTTCTCTTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_72_replicate_5	CTATAGCAATGTTCTCTTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_72_replicate_4	CTATAGCAATGTTCTCTTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_72_replicate_3	CTATAGCAATGTTCTCTTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_72_replicate_2	CTATAGCAATGTTCTCTTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_72_replicate_10	CTATAGCAATGTTCTCTTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_72_replicate_1	CTATAGCAATGTTCTCTTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_71_replicate_9	CTATAGCAATGTTCTCGTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_71_replicate_8	CTATAGCAATGTTCTCGTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_71_replicate_7	CTATAGCAATGTTCTCGTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_71_replicate_6	CTATAGCAATGTTCTCGTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_71_replicate_5	CTATAGCAATGTTCTCGTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_71_replicate_4	CTATAGCAATGTTCTCGTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_71_replicate_3	CTATAGCAATGTTCTCGTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_71_replicate_2	CTATAGCAATGTTCTCGTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_71_replicate_10	CTATAGCAATGTTCTCGTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_71_replicate_1	CTATAGCAATGTTCTCGTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_70_replicate_9	CTATAGCAATGTTCTCCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_70_replicate_8	CTATAGCAATGTTCTCCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_70_replicate_7	CTATAGCAATGTTCTCCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_70_replicate_6	CTATAGCAATGTTCTCCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_70_replicate_5	CTATAGCAATGTTCTCCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_70_replicate_4	CTATAGCAATGTTCTCCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_70_replicate_3	CTATAGCAATGTTCTCCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_70_replicate_2	CTATAGCAATGTTCTCCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_70_replicate_10	CTATAGCAATGTTCTCCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_70_replicate_1	CTATAGCAATGTTCTCCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_7_replicate_9	CTATAGCAATGCGCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_7_replicate_8	CTATAGCAATGCGCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_7_replicate_7	CTATAGCAATGCGCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_7_replicate_6	CTATAGCAATGCGCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_7_replicate_5	CTATAGCAATGCGCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_7_replicate_4	CTATAGCAATGCGCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_7_replicate_3	CTATAGCAATGCGCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_7_replicate_2	CTATAGCAATGCGCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_7_replicate_10	CTATAGCAATGCGCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_7_replicate_1	CTATAGCAATGCGCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_69_replicate_9	CTATAGCAATGTTCTCATGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_69_replicate_8	CTATAGCAATGTTCTCATGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_69_replicate_7	CTATAGCAATGTTCTCATGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_69_replicate_6	CTATAGCAATGTTCTCATGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_69_replicate_5	CTATAGCAATGTTCTCATGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_69_replicate_4	CTATAGCAATGTTCTCATGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_69_replicate_3	CTATAGCAATGTTCTCATGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_69_replicate_2	CTATAGCAATGTTCTCATGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_69_replicate_10	CTATAGCAATGTTCTCATGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_69_replicate_1	CTATAGCAATGTTCTCATGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_68_replicate_9	CTATAGCAATGTTCTATTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_68_replicate_8	CTATAGCAATGTTCTATTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_68_replicate_7	CTATAGCAATGTTCTATTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_68_replicate_6	CTATAGCAATGTTCTATTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_68_replicate_5	CTATAGCAATGTTCTATTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_68_replicate_4	CTATAGCAATGTTCTATTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_68_replicate_3	CTATAGCAATGTTCTATTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_68_replicate_2	CTATAGCAATGTTCTATTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_68_replicate_10	CTATAGCAATGTTCTATTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_68_replicate_1	CTATAGCAATGTTCTATTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_67_replicate_9	CTATAGCAATGTTCTAGTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_67_replicate_8	CTATAGCAATGTTCTAGTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_67_replicate_7	CTATAGCAATGTTCTAGTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_67_replicate_6	CTATAGCAATGTTCTAGTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_67_replicate_5	CTATAGCAATGTTCTAGTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_67_replicate_4	CTATAGCAATGTTCTAGTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_67_replicate_3	CTATAGCAATGTTCTAGTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_67_replicate_2	CTATAGCAATGTTCTAGTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_67_replicate_10	CTATAGCAATGTTCTAGTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_67_replicate_1	CTATAGCAATGTTCTAGTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_66_replicate_9	CTATAGCAATGTTCTACTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_66_replicate_8	CTATAGCAATGTTCTACTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_66_replicate_7	CTATAGCAATGTTCTACTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_66_replicate_6	CTATAGCAATGTTCTACTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_66_replicate_5	CTATAGCAATGTTCTACTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_66_replicate_4	CTATAGCAATGTTCTACTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_66_replicate_3	CTATAGCAATGTTCTACTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_66_replicate_2	CTATAGCAATGTTCTACTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_66_replicate_10	CTATAGCAATGTTCTACTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_66_replicate_1	CTATAGCAATGTTCTACTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_65_replicate_9	CTATAGCAATGTTCTAATGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_65_replicate_8	CTATAGCAATGTTCTAATGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_65_replicate_7	CTATAGCAATGTTCTAATGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_65_replicate_6	CTATAGCAATGTTCTAATGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_65_replicate_5	CTATAGCAATGTTCTAATGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_65_replicate_4	CTATAGCAATGTTCTAATGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_65_replicate_3	CTATAGCAATGTTCTAATGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_65_replicate_2	CTATAGCAATGTTCTAATGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_65_replicate_10	CTATAGCAATGTTCTAATGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_65_replicate_1	CTATAGCAATGTTCTAATGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_64_replicate_9	CTATAGCAATGTTCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_64_replicate_8	CTATAGCAATGTTCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_64_replicate_7	CTATAGCAATGTTCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_64_replicate_6	CTATAGCAATGTTCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_64_replicate_5	CTATAGCAATGTTCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_64_replicate_4	CTATAGCAATGTTCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_64_replicate_3	CTATAGCAATGTTCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_64_replicate_2	CTATAGCAATGTTCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_64_replicate_10	CTATAGCAATGTTCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_64_replicate_1	CTATAGCAATGTTCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_63_replicate_9	CTATAGCAATGTTCTGCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_63_replicate_8	CTATAGCAATGTTCTGCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_63_replicate_7	CTATAGCAATGTTCTGCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_63_replicate_6	CTATAGCAATGTTCTGCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_63_replicate_5	CTATAGCAATGTTCTGCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_63_replicate_4	CTATAGCAATGTTCTGCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_63_replicate_3	CTATAGCAATGTTCTGCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_63_replicate_2	CTATAGCAATGTTCTGCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_63_replicate_10	CTATAGCAATGTTCTGCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_63_replicate_1	CTATAGCAATGTTCTGCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_62_replicate_9	CTATAGCAATGTTCTCCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_62_replicate_8	CTATAGCAATGTTCTCCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_62_replicate_7	CTATAGCAATGTTCTCCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_62_replicate_6	CTATAGCAATGTTCTCCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_62_replicate_5	CTATAGCAATGTTCTCCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_62_replicate_4	CTATAGCAATGTTCTCCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_62_replicate_3	CTATAGCAATGTTCTCCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_62_replicate_2	CTATAGCAATGTTCTCCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_62_replicate_10	CTATAGCAATGTTCTCCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_62_replicate_1	CTATAGCAATGTTCTCCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_61_replicate_9	CTATAGCAATGTTCTACTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_61_replicate_8	CTATAGCAATGTTCTACTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_61_replicate_7	CTATAGCAATGTTCTACTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_61_replicate_6	CTATAGCAATGTTCTACTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_61_replicate_5	CTATAGCAATGTTCTACTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_61_replicate_4	CTATAGCAATGTTCTACTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_61_replicate_3	CTATAGCAATGTTCTACTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_61_replicate_2	CTATAGCAATGTTCTACTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_61_replicate_10	CTATAGCAATGTTCTACTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_61_replicate_1	CTATAGCAATGTTCTACTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_60_replicate_9	CTATAGCAATGTTCGTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_60_replicate_8	CTATAGCAATGTTCGTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_60_replicate_7	CTATAGCAATGTTCGTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_60_replicate_6	CTATAGCAATGTTCGTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_60_replicate_5	CTATAGCAATGTTCGTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_60_replicate_4	CTATAGCAATGTTCGTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_60_replicate_3	CTATAGCAATGTTCGTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_60_replicate_2	CTATAGCAATGTTCGTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_60_replicate_10	CTATAGCAATGTTCGTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_60_replicate_1	CTATAGCAATGTTCGTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_6_replicate_9	CTATAGCAATGCCCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_6_replicate_8	CTATAGCAATGCCCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_6_replicate_7	CTATAGCAATGCCCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_6_replicate_6	CTATAGCAATGCCCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_6_replicate_5	CTATAGCAATGCCCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_6_replicate_4	CTATAGCAATGCCCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_6_replicate_3	CTATAGCAATGCCCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_6_replicate_2	CTATAGCAATGCCCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_6_replicate_10	CTATAGCAATGCCCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_6_replicate_1	CTATAGCAATGCCCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_59_replicate_9	CTATAGCAATGTTCGGCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_59_replicate_8	CTATAGCAATGTTCGGCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_59_replicate_7	CTATAGCAATGTTCGGCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_59_replicate_6	CTATAGCAATGTTCGGCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_59_replicate_5	CTATAGCAATGTTCGGCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_59_replicate_4	CTATAGCAATGTTCGGCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_59_replicate_3	CTATAGCAATGTTCGGCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_59_replicate_2	CTATAGCAATGTTCGGCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_59_replicate_10	CTATAGCAATGTTCGGCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_59_replicate_1	CTATAGCAATGTTCGGCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_58_replicate_9	CTATAGCAATGTTCGCCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_58_replicate_8	CTATAGCAATGTTCGCCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_58_replicate_7	CTATAGCAATGTTCGCCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_58_replicate_6	CTATAGCAATGTTCGCCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_58_replicate_5	CTATAGCAATGTTCGCCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_58_replicate_4	CTATAGCAATGTTCGCCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_58_replicate_3	CTATAGCAATGTTCGCCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_58_replicate_2	CTATAGCAATGTTCGCCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_58_replicate_10	CTATAGCAATGTTCGCCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_58_replicate_1	CTATAGCAATGTTCGCCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_57_replicate_9	CTATAGCAATGTTCGACTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_57_replicate_8	CTATAGCAATGTTCGACTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_57_replicate_7	CTATAGCAATGTTCGACTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_57_replicate_6	CTATAGCAATGTTCGACTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_57_replicate_5	CTATAGCAATGTTCGACTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_57_replicate_4	CTATAGCAATGTTCGACTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_57_replicate_3	CTATAGCAATGTTCGACTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_57_replicate_2	CTATAGCAATGTTCGACTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_57_replicate_10	CTATAGCAATGTTCGACTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_57_replicate_1	CTATAGCAATGTTCGACTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_56_replicate_9	CTATAGCAATGTTCCTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_56_replicate_8	CTATAGCAATGTTCCTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_56_replicate_7	CTATAGCAATGTTCCTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_56_replicate_6	CTATAGCAATGTTCCTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_56_replicate_5	CTATAGCAATGTTCCTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_56_replicate_4	CTATAGCAATGTTCCTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_56_replicate_3	CTATAGCAATGTTCCTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_56_replicate_2	CTATAGCAATGTTCCTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_56_replicate_10	CTATAGCAATGTTCCTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_56_replicate_1	CTATAGCAATGTTCCTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_55_replicate_9	CTATAGCAATGTTCCGCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_55_replicate_8	CTATAGCAATGTTCCGCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_55_replicate_7	CTATAGCAATGTTCCGCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_55_replicate_6	CTATAGCAATGTTCCGCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_55_replicate_5	CTATAGCAATGTTCCGCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_55_replicate_4	CTATAGCAATGTTCCGCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_55_replicate_3	CTATAGCAATGTTCCGCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_55_replicate_2	CTATAGCAATGTTCCGCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_55_replicate_10	CTATAGCAATGTTCCGCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_55_replicate_1	CTATAGCAATGTTCCGCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_54_replicate_9	CTATAGCAATGTTCCCCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_54_replicate_8	CTATAGCAATGTTCCCCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_54_replicate_7	CTATAGCAATGTTCCCCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_54_replicate_6	CTATAGCAATGTTCCCCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_54_replicate_5	CTATAGCAATGTTCCCCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_54_replicate_4	CTATAGCAATGTTCCCCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_54_replicate_3	CTATAGCAATGTTCCCCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_54_replicate_2	CTATAGCAATGTTCCCCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_54_replicate_10	CTATAGCAATGTTCCCCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_54_replicate_1	CTATAGCAATGTTCCCCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_53_replicate_9	CTATAGCAATGTTCCACTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_53_replicate_8	CTATAGCAATGTTCCACTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_53_replicate_7	CTATAGCAATGTTCCACTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_53_replicate_6	CTATAGCAATGTTCCACTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_53_replicate_5	CTATAGCAATGTTCCACTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_53_replicate_4	CTATAGCAATGTTCCACTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_53_replicate_3	CTATAGCAATGTTCCACTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_53_replicate_2	CTATAGCAATGTTCCACTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_53_replicate_10	CTATAGCAATGTTCCACTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_53_replicate_1	CTATAGCAATGTTCCACTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_52_replicate_9	CTATAGCAATGTTCATCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_52_replicate_8	CTATAGCAATGTTCATCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_52_replicate_7	CTATAGCAATGTTCATCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_52_replicate_6	CTATAGCAATGTTCATCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_52_replicate_5	CTATAGCAATGTTCATCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_52_replicate_4	CTATAGCAATGTTCATCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_52_replicate_3	CTATAGCAATGTTCATCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_52_replicate_2	CTATAGCAATGTTCATCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_52_replicate_10	CTATAGCAATGTTCATCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_52_replicate_1	CTATAGCAATGTTCATCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_51_replicate_9	CTATAGCAATGTTCAGCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_51_replicate_8	CTATAGCAATGTTCAGCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_51_replicate_7	CTATAGCAATGTTCAGCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_51_replicate_6	CTATAGCAATGTTCAGCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_51_replicate_5	CTATAGCAATGTTCAGCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_51_replicate_4	CTATAGCAATGTTCAGCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_51_replicate_3	CTATAGCAATGTTCAGCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_51_replicate_2	CTATAGCAATGTTCAGCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_51_replicate_10	CTATAGCAATGTTCAGCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_51_replicate_1	CTATAGCAATGTTCAGCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_50_replicate_9	CTATAGCAATGTTCACCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_50_replicate_8	CTATAGCAATGTTCACCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_50_replicate_7	CTATAGCAATGTTCACCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_50_replicate_6	CTATAGCAATGTTCACCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_50_replicate_5	CTATAGCAATGTTCACCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_50_replicate_4	CTATAGCAATGTTCACCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_50_replicate_3	CTATAGCAATGTTCACCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_50_replicate_2	CTATAGCAATGTTCACCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_50_replicate_10	CTATAGCAATGTTCACCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_50_replicate_1	CTATAGCAATGTTCACCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_5_replicate_9	CTATAGCAATGCACTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_5_replicate_8	CTATAGCAATGCACTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_5_replicate_7	CTATAGCAATGCACTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_5_replicate_6	CTATAGCAATGCACTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_5_replicate_5	CTATAGCAATGCACTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_5_replicate_4	CTATAGCAATGCACTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_5_replicate_3	CTATAGCAATGCACTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_5_replicate_2	CTATAGCAATGCACTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_5_replicate_10	CTATAGCAATGCACTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_5_replicate_1	CTATAGCAATGCACTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_49_replicate_9	CTATAGCAATGTTCAACTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_49_replicate_8	CTATAGCAATGTTCAACTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_49_replicate_7	CTATAGCAATGTTCAACTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_49_replicate_6	CTATAGCAATGTTCAACTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_49_replicate_5	CTATAGCAATGTTCAACTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_49_replicate_4	CTATAGCAATGTTCAACTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_49_replicate_3	CTATAGCAATGTTCAACTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_49_replicate_2	CTATAGCAATGTTCAACTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_49_replicate_10	CTATAGCAATGTTCAACTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_49_replicate_1	CTATAGCAATGTTCAACTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_48_replicate_9	CTATAGCAATGTTTTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_48_replicate_8	CTATAGCAATGTTTTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_48_replicate_7	CTATAGCAATGTTTTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_48_replicate_6	CTATAGCAATGTTTTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_48_replicate_5	CTATAGCAATGTTTTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_48_replicate_4	CTATAGCAATGTTTTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_48_replicate_3	CTATAGCAATGTTTTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_48_replicate_2	CTATAGCAATGTTTTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_48_replicate_10	CTATAGCAATGTTTTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_48_replicate_1	CTATAGCAATGTTTTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_47_replicate_9	CTATAGCAATGTTTGTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_47_replicate_8	CTATAGCAATGTTTGTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_47_replicate_7	CTATAGCAATGTTTGTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_47_replicate_6	CTATAGCAATGTTTGTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_47_replicate_5	CTATAGCAATGTTTGTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_47_replicate_4	CTATAGCAATGTTTGTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_47_replicate_3	CTATAGCAATGTTTGTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_47_replicate_2	CTATAGCAATGTTTGTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_47_replicate_10	CTATAGCAATGTTTGTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_47_replicate_1	CTATAGCAATGTTTGTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_46_replicate_9	CTATAGCAATGTTTCTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_46_replicate_8	CTATAGCAATGTTTCTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_46_replicate_7	CTATAGCAATGTTTCTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_46_replicate_6	CTATAGCAATGTTTCTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_46_replicate_5	CTATAGCAATGTTTCTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_46_replicate_4	CTATAGCAATGTTTCTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_46_replicate_3	CTATAGCAATGTTTCTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_46_replicate_2	CTATAGCAATGTTTCTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_46_replicate_10	CTATAGCAATGTTTCTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_46_replicate_1	CTATAGCAATGTTTCTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_45_replicate_9	CTATAGCAATGTTTATCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_45_replicate_8	CTATAGCAATGTTTATCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_45_replicate_7	CTATAGCAATGTTTATCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_45_replicate_6	CTATAGCAATGTTTATCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_45_replicate_5	CTATAGCAATGTTTATCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_45_replicate_4	CTATAGCAATGTTTATCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_45_replicate_3	CTATAGCAATGTTTATCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_45_replicate_2	CTATAGCAATGTTTATCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_45_replicate_10	CTATAGCAATGTTTATCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_45_replicate_1	CTATAGCAATGTTTATCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_44_replicate_9	CTATAGCAATGTTGTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_44_replicate_8	CTATAGCAATGTTGTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_44_replicate_7	CTATAGCAATGTTGTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_44_replicate_6	CTATAGCAATGTTGTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_44_replicate_5	CTATAGCAATGTTGTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_44_replicate_4	CTATAGCAATGTTGTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_44_replicate_3	CTATAGCAATGTTGTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_44_replicate_2	CTATAGCAATGTTGTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_44_replicate_10	CTATAGCAATGTTGTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_44_replicate_1	CTATAGCAATGTTGTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_43_replicate_9	CTATAGCAATGTTGGTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_43_replicate_8	CTATAGCAATGTTGGTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_43_replicate_7	CTATAGCAATGTTGGTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_43_replicate_6	CTATAGCAATGTTGGTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_43_replicate_5	CTATAGCAATGTTGGTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_43_replicate_4	CTATAGCAATGTTGGTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_43_replicate_3	CTATAGCAATGTTGGTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_43_replicate_2	CTATAGCAATGTTGGTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_43_replicate_10	CTATAGCAATGTTGGTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_43_replicate_1	CTATAGCAATGTTGGTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_42_replicate_9	CTATAGCAATGTTGCTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_42_replicate_8	CTATAGCAATGTTGCTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_42_replicate_7	CTATAGCAATGTTGCTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_42_replicate_6	CTATAGCAATGTTGCTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_42_replicate_5	CTATAGCAATGTTGCTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_42_replicate_4	CTATAGCAATGTTGCTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_42_replicate_3	CTATAGCAATGTTGCTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_42_replicate_2	CTATAGCAATGTTGCTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_42_replicate_10	CTATAGCAATGTTGCTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_42_replicate_1	CTATAGCAATGTTGCTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_41_replicate_9	CTATAGCAATGTTGATCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_41_replicate_8	CTATAGCAATGTTGATCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_41_replicate_7	CTATAGCAATGTTGATCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_41_replicate_6	CTATAGCAATGTTGATCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_41_replicate_5	CTATAGCAATGTTGATCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_41_replicate_4	CTATAGCAATGTTGATCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_41_replicate_3	CTATAGCAATGTTGATCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_41_replicate_2	CTATAGCAATGTTGATCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_41_replicate_10	CTATAGCAATGTTGATCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_41_replicate_1	CTATAGCAATGTTGATCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_40_replicate_9	CTATAGCAATGTTCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_40_replicate_8	CTATAGCAATGTTCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_40_replicate_7	CTATAGCAATGTTCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_40_replicate_6	CTATAGCAATGTTCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_40_replicate_5	CTATAGCAATGTTCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_40_replicate_4	CTATAGCAATGTTCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_40_replicate_3	CTATAGCAATGTTCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_40_replicate_2	CTATAGCAATGTTCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_40_replicate_10	CTATAGCAATGTTCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_40_replicate_1	CTATAGCAATGTTCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_4_replicate_9	CTATAGCAATGATCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_4_replicate_8	CTATAGCAATGATCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_4_replicate_7	CTATAGCAATGATCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_4_replicate_6	CTATAGCAATGATCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_4_replicate_5	CTATAGCAATGATCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_4_replicate_4	CTATAGCAATGATCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_4_replicate_3	CTATAGCAATGATCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_4_replicate_2	CTATAGCAATGATCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_4_replicate_10	CTATAGCAATGATCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_4_replicate_1	CTATAGCAATGATCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_39_replicate_9	CTATAGCAATGTTCGTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_39_replicate_8	CTATAGCAATGTTCGTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_39_replicate_7	CTATAGCAATGTTCGTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_39_replicate_6	CTATAGCAATGTTCGTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_39_replicate_5	CTATAGCAATGTTCGTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_39_replicate_4	CTATAGCAATGTTCGTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_39_replicate_3	CTATAGCAATGTTCGTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_39_replicate_2	CTATAGCAATGTTCGTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_39_replicate_10	CTATAGCAATGTTCGTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_39_replicate_1	CTATAGCAATGTTCGTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_38_replicate_9	CTATAGCAATGTTCCTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_38_replicate_8	CTATAGCAATGTTCCTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_38_replicate_7	CTATAGCAATGTTCCTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_38_replicate_6	CTATAGCAATGTTCCTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_38_replicate_5	CTATAGCAATGTTCCTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_38_replicate_4	CTATAGCAATGTTCCTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_38_replicate_3	CTATAGCAATGTTCCTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_38_replicate_2	CTATAGCAATGTTCCTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_38_replicate_10	CTATAGCAATGTTCCTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_38_replicate_1	CTATAGCAATGTTCCTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_37_replicate_9	CTATAGCAATGTTCATCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_37_replicate_8	CTATAGCAATGTTCATCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_37_replicate_7	CTATAGCAATGTTCATCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_37_replicate_6	CTATAGCAATGTTCATCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_37_replicate_5	CTATAGCAATGTTCATCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_37_replicate_4	CTATAGCAATGTTCATCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_37_replicate_3	CTATAGCAATGTTCATCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_37_replicate_2	CTATAGCAATGTTCATCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_37_replicate_10	CTATAGCAATGTTCATCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_37_replicate_1	CTATAGCAATGTTCATCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_36_replicate_9	CTATAGCAATGTTATTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_36_replicate_8	CTATAGCAATGTTATTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_36_replicate_7	CTATAGCAATGTTATTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_36_replicate_6	CTATAGCAATGTTATTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_36_replicate_5	CTATAGCAATGTTATTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_36_replicate_4	CTATAGCAATGTTATTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_36_replicate_3	CTATAGCAATGTTATTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_36_replicate_2	CTATAGCAATGTTATTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_36_replicate_10	CTATAGCAATGTTATTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_36_replicate_1	CTATAGCAATGTTATTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_35_replicate_9	CTATAGCAATGTTAGTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_35_replicate_8	CTATAGCAATGTTAGTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_35_replicate_7	CTATAGCAATGTTAGTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_35_replicate_6	CTATAGCAATGTTAGTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_35_replicate_5	CTATAGCAATGTTAGTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_35_replicate_4	CTATAGCAATGTTAGTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_35_replicate_3	CTATAGCAATGTTAGTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_35_replicate_2	CTATAGCAATGTTAGTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_35_replicate_10	CTATAGCAATGTTAGTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_35_replicate_1	CTATAGCAATGTTAGTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_34_replicate_9	CTATAGCAATGTTACTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_34_replicate_8	CTATAGCAATGTTACTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_34_replicate_7	CTATAGCAATGTTACTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_34_replicate_6	CTATAGCAATGTTACTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_34_replicate_5	CTATAGCAATGTTACTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_34_replicate_4	CTATAGCAATGTTACTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_34_replicate_3	CTATAGCAATGTTACTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_34_replicate_2	CTATAGCAATGTTACTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_34_replicate_10	CTATAGCAATGTTACTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_34_replicate_1	CTATAGCAATGTTACTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_33_replicate_9	CTATAGCAATGTTAATCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_33_replicate_8	CTATAGCAATGTTAATCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_33_replicate_7	CTATAGCAATGTTAATCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_33_replicate_6	CTATAGCAATGTTAATCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_33_replicate_5	CTATAGCAATGTTAATCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_33_replicate_4	CTATAGCAATGTTAATCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_33_replicate_3	CTATAGCAATGTTAATCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_33_replicate_2	CTATAGCAATGTTAATCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_33_replicate_10	CTATAGCAATGTTAATCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_33_replicate_1	CTATAGCAATGTTAATCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_32_replicate_9	CTATAGCAATGTTTTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_32_replicate_8	CTATAGCAATGTTTTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_32_replicate_7	CTATAGCAATGTTTTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_32_replicate_6	CTATAGCAATGTTTTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_32_replicate_5	CTATAGCAATGTTTTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_32_replicate_4	CTATAGCAATGTTTTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_32_replicate_3	CTATAGCAATGTTTTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_32_replicate_2	CTATAGCAATGTTTTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_32_replicate_10	CTATAGCAATGTTTTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_32_replicate_1	CTATAGCAATGTTTTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_31_replicate_9	CTATAGCAATGTTGTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_31_replicate_8	CTATAGCAATGTTGTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_31_replicate_7	CTATAGCAATGTTGTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_31_replicate_6	CTATAGCAATGTTGTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_31_replicate_5	CTATAGCAATGTTGTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_31_replicate_4	CTATAGCAATGTTGTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_31_replicate_3	CTATAGCAATGTTGTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_31_replicate_2	CTATAGCAATGTTGTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_31_replicate_10	CTATAGCAATGTTGTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_31_replicate_1	CTATAGCAATGTTGTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_30_replicate_9	CTATAGCAATGTTCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_30_replicate_8	CTATAGCAATGTTCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_30_replicate_7	CTATAGCAATGTTCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_30_replicate_6	CTATAGCAATGTTCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_30_replicate_5	CTATAGCAATGTTCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_30_replicate_4	CTATAGCAATGTTCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_30_replicate_3	CTATAGCAATGTTCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_30_replicate_2	CTATAGCAATGTTCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_30_replicate_10	CTATAGCAATGTTCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_30_replicate_1	CTATAGCAATGTTCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_3_replicate_9	CTATAGCAATGAGCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_3_replicate_8	CTATAGCAATGAGCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_3_replicate_7	CTATAGCAATGAGCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_3_replicate_6	CTATAGCAATGAGCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_3_replicate_5	CTATAGCAATGAGCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_3_replicate_4	CTATAGCAATGAGCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_3_replicate_3	CTATAGCAATGAGCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_3_replicate_2	CTATAGCAATGAGCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_3_replicate_10	CTATAGCAATGAGCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_3_replicate_1	CTATAGCAATGAGCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_29_replicate_9	CTATAGCAATGTTATTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_29_replicate_8	CTATAGCAATGTTATTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_29_replicate_7	CTATAGCAATGTTATTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_29_replicate_6	CTATAGCAATGTTATTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_29_replicate_5	CTATAGCAATGTTATTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_29_replicate_4	CTATAGCAATGTTATTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_29_replicate_3	CTATAGCAATGTTATTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_29_replicate_2	CTATAGCAATGTTATTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_29_replicate_10	CTATAGCAATGTTATTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_29_replicate_1	CTATAGCAATGTTATTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_28_replicate_9	CTATAGCAATGTGTTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_28_replicate_8	CTATAGCAATGTGTTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_28_replicate_7	CTATAGCAATGTGTTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_28_replicate_6	CTATAGCAATGTGTTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_28_replicate_5	CTATAGCAATGTGTTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_28_replicate_4	CTATAGCAATGTGTTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_28_replicate_3	CTATAGCAATGTGTTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_28_replicate_2	CTATAGCAATGTGTTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_28_replicate_10	CTATAGCAATGTGTTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_28_replicate_1	CTATAGCAATGTGTTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_27_replicate_9	CTATAGCAATGTGGTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_27_replicate_8	CTATAGCAATGTGGTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_27_replicate_7	CTATAGCAATGTGGTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_27_replicate_6	CTATAGCAATGTGGTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_27_replicate_5	CTATAGCAATGTGGTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_27_replicate_4	CTATAGCAATGTGGTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_27_replicate_3	CTATAGCAATGTGGTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_27_replicate_2	CTATAGCAATGTGGTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_27_replicate_10	CTATAGCAATGTGGTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_27_replicate_1	CTATAGCAATGTGGTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_26_replicate_9	CTATAGCAATGTGCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_26_replicate_8	CTATAGCAATGTGCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_26_replicate_7	CTATAGCAATGTGCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_26_replicate_6	CTATAGCAATGTGCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_26_replicate_5	CTATAGCAATGTGCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_26_replicate_4	CTATAGCAATGTGCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_26_replicate_3	CTATAGCAATGTGCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_26_replicate_2	CTATAGCAATGTGCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_26_replicate_10	CTATAGCAATGTGCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_26_replicate_1	CTATAGCAATGTGCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_25_replicate_9	CTATAGCAATGTGATTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_25_replicate_8	CTATAGCAATGTGATTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_25_replicate_7	CTATAGCAATGTGATTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_25_replicate_6	CTATAGCAATGTGATTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_25_replicate_5	CTATAGCAATGTGATTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_25_replicate_4	CTATAGCAATGTGATTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_25_replicate_3	CTATAGCAATGTGATTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_25_replicate_2	CTATAGCAATGTGATTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_25_replicate_10	CTATAGCAATGTGATTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_25_replicate_1	CTATAGCAATGTGATTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_24_replicate_9	CTATAGCAATGTCTTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_24_replicate_8	CTATAGCAATGTCTTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_24_replicate_7	CTATAGCAATGTCTTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_24_replicate_6	CTATAGCAATGTCTTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_24_replicate_5	CTATAGCAATGTCTTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_24_replicate_4	CTATAGCAATGTCTTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_24_replicate_3	CTATAGCAATGTCTTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_24_replicate_2	CTATAGCAATGTCTTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_24_replicate_10	CTATAGCAATGTCTTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_24_replicate_1	CTATAGCAATGTCTTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_23_replicate_9	CTATAGCAATGTCGTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_23_replicate_8	CTATAGCAATGTCGTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_23_replicate_7	CTATAGCAATGTCGTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_23_replicate_6	CTATAGCAATGTCGTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_23_replicate_5	CTATAGCAATGTCGTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_23_replicate_4	CTATAGCAATGTCGTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_23_replicate_3	CTATAGCAATGTCGTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_23_replicate_2	CTATAGCAATGTCGTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_23_replicate_10	CTATAGCAATGTCGTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_23_replicate_1	CTATAGCAATGTCGTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_22_replicate_9	CTATAGCAATGTCCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_22_replicate_8	CTATAGCAATGTCCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_22_replicate_7	CTATAGCAATGTCCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_22_replicate_6	CTATAGCAATGTCCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_22_replicate_5	CTATAGCAATGTCCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_22_replicate_4	CTATAGCAATGTCCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_22_replicate_3	CTATAGCAATGTCCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_22_replicate_2	CTATAGCAATGTCCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_22_replicate_10	CTATAGCAATGTCCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_22_replicate_1	CTATAGCAATGTCCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_21_replicate_9	CTATAGCAATGTCATTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_21_replicate_8	CTATAGCAATGTCATTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_21_replicate_7	CTATAGCAATGTCATTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_21_replicate_6	CTATAGCAATGTCATTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_21_replicate_5	CTATAGCAATGTCATTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_21_replicate_4	CTATAGCAATGTCATTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_21_replicate_3	CTATAGCAATGTCATTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_21_replicate_2	CTATAGCAATGTCATTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_21_replicate_10	CTATAGCAATGTCATTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_21_replicate_1	CTATAGCAATGTCATTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_208_replicate_9	CTATAGCAATGTTCTTCTGCTTGTTCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_208_replicate_8	CTATAGCAATGTTCTTCTGCTTGTTCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_208_replicate_7	CTATAGCAATGTTCTTCTGCTTGTTCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_208_replicate_6	CTATAGCAATGTTCTTCTGCTTGTTCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_208_replicate_5	CTATAGCAATGTTCTTCTGCTTGTTCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_208_replicate_4	CTATAGCAATGTTCTTCTGCTTGTTCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_208_replicate_3	CTATAGCAATGTTCTTCTGCTTGTTCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_208_replicate_2	CTATAGCAATGTTCTTCTGCTTGTTCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_208_replicate_10	CTATAGCAATGTTCTTCTGCTTGTTCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_208_replicate_1	CTATAGCAATGTTCTTCTGCTTGTTCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_207_replicate_9	CTATAGCAATGTTCTTCTGCTTGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_207_replicate_8	CTATAGCAATGTTCTTCTGCTTGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_207_replicate_7	CTATAGCAATGTTCTTCTGCTTGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_207_replicate_6	CTATAGCAATGTTCTTCTGCTTGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_207_replicate_5	CTATAGCAATGTTCTTCTGCTTGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_207_replicate_4	CTATAGCAATGTTCTTCTGCTTGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_207_replicate_3	CTATAGCAATGTTCTTCTGCTTGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_207_replicate_2	CTATAGCAATGTTCTTCTGCTTGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_207_replicate_10	CTATAGCAATGTTCTTCTGCTTGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_207_replicate_1	CTATAGCAATGTTCTTCTGCTTGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_206_replicate_9	CTATAGCAATGTTCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_206_replicate_8	CTATAGCAATGTTCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_206_replicate_7	CTATAGCAATGTTCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_206_replicate_6	CTATAGCAATGTTCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_206_replicate_5	CTATAGCAATGTTCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_206_replicate_4	CTATAGCAATGTTCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_206_replicate_3	CTATAGCAATGTTCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_206_replicate_2	CTATAGCAATGTTCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_206_replicate_10	CTATAGCAATGTTCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_206_replicate_1	CTATAGCAATGTTCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_205_replicate_9	CTATAGCAATGTTCTTCTGCTTGTACATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_205_replicate_8	CTATAGCAATGTTCTTCTGCTTGTACATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_205_replicate_7	CTATAGCAATGTTCTTCTGCTTGTACATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_205_replicate_6	CTATAGCAATGTTCTTCTGCTTGTACATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_205_replicate_5	CTATAGCAATGTTCTTCTGCTTGTACATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_205_replicate_4	CTATAGCAATGTTCTTCTGCTTGTACATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_205_replicate_3	CTATAGCAATGTTCTTCTGCTTGTACATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_205_replicate_2	CTATAGCAATGTTCTTCTGCTTGTACATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_205_replicate_10	CTATAGCAATGTTCTTCTGCTTGTACATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_205_replicate_1	CTATAGCAATGTTCTTCTGCTTGTACATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_204_replicate_9	CTATAGCAATGTTCTTCTGCTTGGTCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_204_replicate_8	CTATAGCAATGTTCTTCTGCTTGGTCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_204_replicate_7	CTATAGCAATGTTCTTCTGCTTGGTCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_204_replicate_6	CTATAGCAATGTTCTTCTGCTTGGTCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_204_replicate_5	CTATAGCAATGTTCTTCTGCTTGGTCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_204_replicate_4	CTATAGCAATGTTCTTCTGCTTGGTCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_204_replicate_3	CTATAGCAATGTTCTTCTGCTTGGTCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_204_replicate_2	CTATAGCAATGTTCTTCTGCTTGGTCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_204_replicate_10	CTATAGCAATGTTCTTCTGCTTGGTCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_204_replicate_1	CTATAGCAATGTTCTTCTGCTTGGTCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_203_replicate_9	CTATAGCAATGTTCTTCTGCTTGGGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_203_replicate_8	CTATAGCAATGTTCTTCTGCTTGGGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_203_replicate_7	CTATAGCAATGTTCTTCTGCTTGGGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_203_replicate_6	CTATAGCAATGTTCTTCTGCTTGGGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_203_replicate_5	CTATAGCAATGTTCTTCTGCTTGGGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_203_replicate_4	CTATAGCAATGTTCTTCTGCTTGGGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_203_replicate_3	CTATAGCAATGTTCTTCTGCTTGGGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_203_replicate_2	CTATAGCAATGTTCTTCTGCTTGGGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_203_replicate_10	CTATAGCAATGTTCTTCTGCTTGGGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_203_replicate_1	CTATAGCAATGTTCTTCTGCTTGGGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_202_replicate_9	CTATAGCAATGTTCTTCTGCTTGGCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_202_replicate_8	CTATAGCAATGTTCTTCTGCTTGGCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_202_replicate_7	CTATAGCAATGTTCTTCTGCTTGGCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_202_replicate_6	CTATAGCAATGTTCTTCTGCTTGGCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_202_replicate_5	CTATAGCAATGTTCTTCTGCTTGGCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_202_replicate_4	CTATAGCAATGTTCTTCTGCTTGGCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_202_replicate_3	CTATAGCAATGTTCTTCTGCTTGGCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_202_replicate_2	CTATAGCAATGTTCTTCTGCTTGGCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_202_replicate_10	CTATAGCAATGTTCTTCTGCTTGGCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_202_replicate_1	CTATAGCAATGTTCTTCTGCTTGGCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_201_replicate_9	CTATAGCAATGTTCTTCTGCTTGGACATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_201_replicate_8	CTATAGCAATGTTCTTCTGCTTGGACATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_201_replicate_7	CTATAGCAATGTTCTTCTGCTTGGACATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_201_replicate_6	CTATAGCAATGTTCTTCTGCTTGGACATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_201_replicate_5	CTATAGCAATGTTCTTCTGCTTGGACATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_201_replicate_4	CTATAGCAATGTTCTTCTGCTTGGACATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_201_replicate_3	CTATAGCAATGTTCTTCTGCTTGGACATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_201_replicate_2	CTATAGCAATGTTCTTCTGCTTGGACATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_201_replicate_10	CTATAGCAATGTTCTTCTGCTTGGACATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_201_replicate_1	CTATAGCAATGTTCTTCTGCTTGGACATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_200_replicate_9	CTATAGCAATGTTCTTCTGCTTGCTCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_200_replicate_8	CTATAGCAATGTTCTTCTGCTTGCTCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_200_replicate_7	CTATAGCAATGTTCTTCTGCTTGCTCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_200_replicate_6	CTATAGCAATGTTCTTCTGCTTGCTCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_200_replicate_5	CTATAGCAATGTTCTTCTGCTTGCTCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_200_replicate_4	CTATAGCAATGTTCTTCTGCTTGCTCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_200_replicate_3	CTATAGCAATGTTCTTCTGCTTGCTCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_200_replicate_2	CTATAGCAATGTTCTTCTGCTTGCTCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_200_replicate_10	CTATAGCAATGTTCTTCTGCTTGCTCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_200_replicate_1	CTATAGCAATGTTCTTCTGCTTGCTCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_20_replicate_9	CTATAGCAATGTATTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_20_replicate_8	CTATAGCAATGTATTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_20_replicate_7	CTATAGCAATGTATTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_20_replicate_6	CTATAGCAATGTATTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_20_replicate_5	CTATAGCAATGTATTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_20_replicate_4	CTATAGCAATGTATTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_20_replicate_3	CTATAGCAATGTATTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_20_replicate_2	CTATAGCAATGTATTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_20_replicate_10	CTATAGCAATGTATTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_20_replicate_1	CTATAGCAATGTATTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_2_replicate_9	CTATAGCAATGACCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_2_replicate_8	CTATAGCAATGACCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_2_replicate_7	CTATAGCAATGACCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_2_replicate_6	CTATAGCAATGACCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_2_replicate_5	CTATAGCAATGACCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_2_replicate_4	CTATAGCAATGACCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_2_replicate_3	CTATAGCAATGACCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_2_replicate_2	CTATAGCAATGACCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_2_replicate_10	CTATAGCAATGACCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_2_replicate_1	CTATAGCAATGACCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_199_replicate_9	CTATAGCAATGTTCTTCTGCTTGCGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_199_replicate_8	CTATAGCAATGTTCTTCTGCTTGCGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_199_replicate_7	CTATAGCAATGTTCTTCTGCTTGCGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_199_replicate_6	CTATAGCAATGTTCTTCTGCTTGCGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_199_replicate_5	CTATAGCAATGTTCTTCTGCTTGCGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_199_replicate_4	CTATAGCAATGTTCTTCTGCTTGCGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_199_replicate_3	CTATAGCAATGTTCTTCTGCTTGCGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_199_replicate_2	CTATAGCAATGTTCTTCTGCTTGCGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_199_replicate_10	CTATAGCAATGTTCTTCTGCTTGCGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_199_replicate_1	CTATAGCAATGTTCTTCTGCTTGCGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_198_replicate_9	CTATAGCAATGTTCTTCTGCTTGCCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_198_replicate_8	CTATAGCAATGTTCTTCTGCTTGCCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_198_replicate_7	CTATAGCAATGTTCTTCTGCTTGCCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_198_replicate_6	CTATAGCAATGTTCTTCTGCTTGCCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_198_replicate_5	CTATAGCAATGTTCTTCTGCTTGCCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_198_replicate_4	CTATAGCAATGTTCTTCTGCTTGCCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_198_replicate_3	CTATAGCAATGTTCTTCTGCTTGCCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_198_replicate_2	CTATAGCAATGTTCTTCTGCTTGCCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_198_replicate_10	CTATAGCAATGTTCTTCTGCTTGCCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_198_replicate_1	CTATAGCAATGTTCTTCTGCTTGCCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_197_replicate_9	CTATAGCAATGTTCTTCTGCTTGCACATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_197_replicate_8	CTATAGCAATGTTCTTCTGCTTGCACATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_197_replicate_7	CTATAGCAATGTTCTTCTGCTTGCACATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_197_replicate_6	CTATAGCAATGTTCTTCTGCTTGCACATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_197_replicate_5	CTATAGCAATGTTCTTCTGCTTGCACATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_197_replicate_4	CTATAGCAATGTTCTTCTGCTTGCACATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_197_replicate_3	CTATAGCAATGTTCTTCTGCTTGCACATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_197_replicate_2	CTATAGCAATGTTCTTCTGCTTGCACATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_197_replicate_10	CTATAGCAATGTTCTTCTGCTTGCACATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_197_replicate_1	CTATAGCAATGTTCTTCTGCTTGCACATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_196_replicate_9	CTATAGCAATGTTCTTCTGCTTGATCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_196_replicate_8	CTATAGCAATGTTCTTCTGCTTGATCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_196_replicate_7	CTATAGCAATGTTCTTCTGCTTGATCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_196_replicate_6	CTATAGCAATGTTCTTCTGCTTGATCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_196_replicate_5	CTATAGCAATGTTCTTCTGCTTGATCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_196_replicate_4	CTATAGCAATGTTCTTCTGCTTGATCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_196_replicate_3	CTATAGCAATGTTCTTCTGCTTGATCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_196_replicate_2	CTATAGCAATGTTCTTCTGCTTGATCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_196_replicate_10	CTATAGCAATGTTCTTCTGCTTGATCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_196_replicate_1	CTATAGCAATGTTCTTCTGCTTGATCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_195_replicate_9	CTATAGCAATGTTCTTCTGCTTGAGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_195_replicate_8	CTATAGCAATGTTCTTCTGCTTGAGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_195_replicate_7	CTATAGCAATGTTCTTCTGCTTGAGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_195_replicate_6	CTATAGCAATGTTCTTCTGCTTGAGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_195_replicate_5	CTATAGCAATGTTCTTCTGCTTGAGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_195_replicate_4	CTATAGCAATGTTCTTCTGCTTGAGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_195_replicate_3	CTATAGCAATGTTCTTCTGCTTGAGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_195_replicate_2	CTATAGCAATGTTCTTCTGCTTGAGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_195_replicate_10	CTATAGCAATGTTCTTCTGCTTGAGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_195_replicate_1	CTATAGCAATGTTCTTCTGCTTGAGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_194_replicate_9	CTATAGCAATGTTCTTCTGCTTGACCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_194_replicate_8	CTATAGCAATGTTCTTCTGCTTGACCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_194_replicate_7	CTATAGCAATGTTCTTCTGCTTGACCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_194_replicate_6	CTATAGCAATGTTCTTCTGCTTGACCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_194_replicate_5	CTATAGCAATGTTCTTCTGCTTGACCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_194_replicate_4	CTATAGCAATGTTCTTCTGCTTGACCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_194_replicate_3	CTATAGCAATGTTCTTCTGCTTGACCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_194_replicate_2	CTATAGCAATGTTCTTCTGCTTGACCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_194_replicate_10	CTATAGCAATGTTCTTCTGCTTGACCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_194_replicate_1	CTATAGCAATGTTCTTCTGCTTGACCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_193_replicate_9	CTATAGCAATGTTCTTCTGCTTGAACATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_193_replicate_8	CTATAGCAATGTTCTTCTGCTTGAACATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_193_replicate_7	CTATAGCAATGTTCTTCTGCTTGAACATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_193_replicate_6	CTATAGCAATGTTCTTCTGCTTGAACATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_193_replicate_5	CTATAGCAATGTTCTTCTGCTTGAACATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_193_replicate_4	CTATAGCAATGTTCTTCTGCTTGAACATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_193_replicate_3	CTATAGCAATGTTCTTCTGCTTGAACATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_193_replicate_2	CTATAGCAATGTTCTTCTGCTTGAACATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_193_replicate_10	CTATAGCAATGTTCTTCTGCTTGAACATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_193_replicate_1	CTATAGCAATGTTCTTCTGCTTGAACATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_192_replicate_9	CTATAGCAATGTTCTTCTGCTTTTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_192_replicate_8	CTATAGCAATGTTCTTCTGCTTTTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_192_replicate_7	CTATAGCAATGTTCTTCTGCTTTTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_192_replicate_6	CTATAGCAATGTTCTTCTGCTTTTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_192_replicate_5	CTATAGCAATGTTCTTCTGCTTTTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_192_replicate_4	CTATAGCAATGTTCTTCTGCTTTTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_192_replicate_3	CTATAGCAATGTTCTTCTGCTTTTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_192_replicate_2	CTATAGCAATGTTCTTCTGCTTTTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_192_replicate_10	CTATAGCAATGTTCTTCTGCTTTTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_192_replicate_1	CTATAGCAATGTTCTTCTGCTTTTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_191_replicate_9	CTATAGCAATGTTCTTCTGCTTTGCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_191_replicate_8	CTATAGCAATGTTCTTCTGCTTTGCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_191_replicate_7	CTATAGCAATGTTCTTCTGCTTTGCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_191_replicate_6	CTATAGCAATGTTCTTCTGCTTTGCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_191_replicate_5	CTATAGCAATGTTCTTCTGCTTTGCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_191_replicate_4	CTATAGCAATGTTCTTCTGCTTTGCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_191_replicate_3	CTATAGCAATGTTCTTCTGCTTTGCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_191_replicate_2	CTATAGCAATGTTCTTCTGCTTTGCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_191_replicate_10	CTATAGCAATGTTCTTCTGCTTTGCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_191_replicate_1	CTATAGCAATGTTCTTCTGCTTTGCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_190_replicate_9	CTATAGCAATGTTCTTCTGCTTTCCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_190_replicate_8	CTATAGCAATGTTCTTCTGCTTTCCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_190_replicate_7	CTATAGCAATGTTCTTCTGCTTTCCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_190_replicate_6	CTATAGCAATGTTCTTCTGCTTTCCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_190_replicate_5	CTATAGCAATGTTCTTCTGCTTTCCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_190_replicate_4	CTATAGCAATGTTCTTCTGCTTTCCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_190_replicate_3	CTATAGCAATGTTCTTCTGCTTTCCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_190_replicate_2	CTATAGCAATGTTCTTCTGCTTTCCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_190_replicate_10	CTATAGCAATGTTCTTCTGCTTTCCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_190_replicate_1	CTATAGCAATGTTCTTCTGCTTTCCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_19_replicate_9	CTATAGCAATGTAGTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_19_replicate_8	CTATAGCAATGTAGTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_19_replicate_7	CTATAGCAATGTAGTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_19_replicate_6	CTATAGCAATGTAGTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_19_replicate_5	CTATAGCAATGTAGTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_19_replicate_4	CTATAGCAATGTAGTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_19_replicate_3	CTATAGCAATGTAGTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_19_replicate_2	CTATAGCAATGTAGTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_19_replicate_10	CTATAGCAATGTAGTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_19_replicate_1	CTATAGCAATGTAGTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_189_replicate_9	CTATAGCAATGTTCTTCTGCTTTACCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_189_replicate_8	CTATAGCAATGTTCTTCTGCTTTACCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_189_replicate_7	CTATAGCAATGTTCTTCTGCTTTACCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_189_replicate_6	CTATAGCAATGTTCTTCTGCTTTACCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_189_replicate_5	CTATAGCAATGTTCTTCTGCTTTACCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_189_replicate_4	CTATAGCAATGTTCTTCTGCTTTACCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_189_replicate_3	CTATAGCAATGTTCTTCTGCTTTACCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_189_replicate_2	CTATAGCAATGTTCTTCTGCTTTACCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_189_replicate_10	CTATAGCAATGTTCTTCTGCTTTACCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_189_replicate_1	CTATAGCAATGTTCTTCTGCTTTACCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_188_replicate_9	CTATAGCAATGTTCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_188_replicate_8	CTATAGCAATGTTCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_188_replicate_7	CTATAGCAATGTTCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_188_replicate_6	CTATAGCAATGTTCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_188_replicate_5	CTATAGCAATGTTCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_188_replicate_4	CTATAGCAATGTTCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_188_replicate_3	CTATAGCAATGTTCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_188_replicate_2	CTATAGCAATGTTCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_188_replicate_10	CTATAGCAATGTTCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_188_replicate_1	CTATAGCAATGTTCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_187_replicate_9	CTATAGCAATGTTCTTCTGCTTGGCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_187_replicate_8	CTATAGCAATGTTCTTCTGCTTGGCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_187_replicate_7	CTATAGCAATGTTCTTCTGCTTGGCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_187_replicate_6	CTATAGCAATGTTCTTCTGCTTGGCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_187_replicate_5	CTATAGCAATGTTCTTCTGCTTGGCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_187_replicate_4	CTATAGCAATGTTCTTCTGCTTGGCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_187_replicate_3	CTATAGCAATGTTCTTCTGCTTGGCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_187_replicate_2	CTATAGCAATGTTCTTCTGCTTGGCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_187_replicate_10	CTATAGCAATGTTCTTCTGCTTGGCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_187_replicate_1	CTATAGCAATGTTCTTCTGCTTGGCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_186_replicate_9	CTATAGCAATGTTCTTCTGCTTGCCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_186_replicate_8	CTATAGCAATGTTCTTCTGCTTGCCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_186_replicate_7	CTATAGCAATGTTCTTCTGCTTGCCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_186_replicate_6	CTATAGCAATGTTCTTCTGCTTGCCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_186_replicate_5	CTATAGCAATGTTCTTCTGCTTGCCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_186_replicate_4	CTATAGCAATGTTCTTCTGCTTGCCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_186_replicate_3	CTATAGCAATGTTCTTCTGCTTGCCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_186_replicate_2	CTATAGCAATGTTCTTCTGCTTGCCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_186_replicate_10	CTATAGCAATGTTCTTCTGCTTGCCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_186_replicate_1	CTATAGCAATGTTCTTCTGCTTGCCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_185_replicate_9	CTATAGCAATGTTCTTCTGCTTGACCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_185_replicate_8	CTATAGCAATGTTCTTCTGCTTGACCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_185_replicate_7	CTATAGCAATGTTCTTCTGCTTGACCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_185_replicate_6	CTATAGCAATGTTCTTCTGCTTGACCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_185_replicate_5	CTATAGCAATGTTCTTCTGCTTGACCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_185_replicate_4	CTATAGCAATGTTCTTCTGCTTGACCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_185_replicate_3	CTATAGCAATGTTCTTCTGCTTGACCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_185_replicate_2	CTATAGCAATGTTCTTCTGCTTGACCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_185_replicate_10	CTATAGCAATGTTCTTCTGCTTGACCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_185_replicate_1	CTATAGCAATGTTCTTCTGCTTGACCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_184_replicate_9	CTATAGCAATGTTCTTCTGCTTCTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_184_replicate_8	CTATAGCAATGTTCTTCTGCTTCTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_184_replicate_7	CTATAGCAATGTTCTTCTGCTTCTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_184_replicate_6	CTATAGCAATGTTCTTCTGCTTCTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_184_replicate_5	CTATAGCAATGTTCTTCTGCTTCTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_184_replicate_4	CTATAGCAATGTTCTTCTGCTTCTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_184_replicate_3	CTATAGCAATGTTCTTCTGCTTCTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_184_replicate_2	CTATAGCAATGTTCTTCTGCTTCTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_184_replicate_10	CTATAGCAATGTTCTTCTGCTTCTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_184_replicate_1	CTATAGCAATGTTCTTCTGCTTCTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_183_replicate_9	CTATAGCAATGTTCTTCTGCTTCGCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_183_replicate_8	CTATAGCAATGTTCTTCTGCTTCGCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_183_replicate_7	CTATAGCAATGTTCTTCTGCTTCGCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_183_replicate_6	CTATAGCAATGTTCTTCTGCTTCGCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_183_replicate_5	CTATAGCAATGTTCTTCTGCTTCGCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_183_replicate_4	CTATAGCAATGTTCTTCTGCTTCGCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_183_replicate_3	CTATAGCAATGTTCTTCTGCTTCGCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_183_replicate_2	CTATAGCAATGTTCTTCTGCTTCGCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_183_replicate_10	CTATAGCAATGTTCTTCTGCTTCGCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_183_replicate_1	CTATAGCAATGTTCTTCTGCTTCGCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_182_replicate_9	CTATAGCAATGTTCTTCTGCTTCCCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_182_replicate_8	CTATAGCAATGTTCTTCTGCTTCCCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_182_replicate_7	CTATAGCAATGTTCTTCTGCTTCCCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_182_replicate_6	CTATAGCAATGTTCTTCTGCTTCCCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_182_replicate_5	CTATAGCAATGTTCTTCTGCTTCCCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_182_replicate_4	CTATAGCAATGTTCTTCTGCTTCCCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_182_replicate_3	CTATAGCAATGTTCTTCTGCTTCCCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_182_replicate_2	CTATAGCAATGTTCTTCTGCTTCCCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_182_replicate_10	CTATAGCAATGTTCTTCTGCTTCCCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_182_replicate_1	CTATAGCAATGTTCTTCTGCTTCCCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_181_replicate_9	CTATAGCAATGTTCTTCTGCTTCACCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_181_replicate_8	CTATAGCAATGTTCTTCTGCTTCACCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_181_replicate_7	CTATAGCAATGTTCTTCTGCTTCACCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_181_replicate_6	CTATAGCAATGTTCTTCTGCTTCACCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_181_replicate_5	CTATAGCAATGTTCTTCTGCTTCACCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_181_replicate_4	CTATAGCAATGTTCTTCTGCTTCACCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_181_replicate_3	CTATAGCAATGTTCTTCTGCTTCACCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_181_replicate_2	CTATAGCAATGTTCTTCTGCTTCACCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_181_replicate_10	CTATAGCAATGTTCTTCTGCTTCACCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_181_replicate_1	CTATAGCAATGTTCTTCTGCTTCACCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_180_replicate_9	CTATAGCAATGTTCTTCTGCTTATCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_180_replicate_8	CTATAGCAATGTTCTTCTGCTTATCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_180_replicate_7	CTATAGCAATGTTCTTCTGCTTATCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_180_replicate_6	CTATAGCAATGTTCTTCTGCTTATCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_180_replicate_5	CTATAGCAATGTTCTTCTGCTTATCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_180_replicate_4	CTATAGCAATGTTCTTCTGCTTATCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_180_replicate_3	CTATAGCAATGTTCTTCTGCTTATCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_180_replicate_2	CTATAGCAATGTTCTTCTGCTTATCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_180_replicate_10	CTATAGCAATGTTCTTCTGCTTATCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_180_replicate_1	CTATAGCAATGTTCTTCTGCTTATCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_18_replicate_9	CTATAGCAATGTACTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_18_replicate_8	CTATAGCAATGTACTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_18_replicate_7	CTATAGCAATGTACTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_18_replicate_6	CTATAGCAATGTACTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_18_replicate_5	CTATAGCAATGTACTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_18_replicate_4	CTATAGCAATGTACTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_18_replicate_3	CTATAGCAATGTACTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_18_replicate_2	CTATAGCAATGTACTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_18_replicate_10	CTATAGCAATGTACTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_18_replicate_1	CTATAGCAATGTACTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_179_replicate_9	CTATAGCAATGTTCTTCTGCTTAGCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_179_replicate_8	CTATAGCAATGTTCTTCTGCTTAGCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_179_replicate_7	CTATAGCAATGTTCTTCTGCTTAGCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_179_replicate_6	CTATAGCAATGTTCTTCTGCTTAGCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_179_replicate_5	CTATAGCAATGTTCTTCTGCTTAGCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_179_replicate_4	CTATAGCAATGTTCTTCTGCTTAGCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_179_replicate_3	CTATAGCAATGTTCTTCTGCTTAGCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_179_replicate_2	CTATAGCAATGTTCTTCTGCTTAGCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_179_replicate_10	CTATAGCAATGTTCTTCTGCTTAGCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_179_replicate_1	CTATAGCAATGTTCTTCTGCTTAGCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_178_replicate_9	CTATAGCAATGTTCTTCTGCTTACCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_178_replicate_8	CTATAGCAATGTTCTTCTGCTTACCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_178_replicate_7	CTATAGCAATGTTCTTCTGCTTACCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_178_replicate_6	CTATAGCAATGTTCTTCTGCTTACCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_178_replicate_5	CTATAGCAATGTTCTTCTGCTTACCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_178_replicate_4	CTATAGCAATGTTCTTCTGCTTACCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_178_replicate_3	CTATAGCAATGTTCTTCTGCTTACCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_178_replicate_2	CTATAGCAATGTTCTTCTGCTTACCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_178_replicate_10	CTATAGCAATGTTCTTCTGCTTACCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_178_replicate_1	CTATAGCAATGTTCTTCTGCTTACCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_177_replicate_9	CTATAGCAATGTTCTTCTGCTTAACCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_177_replicate_8	CTATAGCAATGTTCTTCTGCTTAACCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_177_replicate_7	CTATAGCAATGTTCTTCTGCTTAACCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_177_replicate_6	CTATAGCAATGTTCTTCTGCTTAACCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_177_replicate_5	CTATAGCAATGTTCTTCTGCTTAACCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_177_replicate_4	CTATAGCAATGTTCTTCTGCTTAACCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_177_replicate_3	CTATAGCAATGTTCTTCTGCTTAACCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_177_replicate_2	CTATAGCAATGTTCTTCTGCTTAACCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_177_replicate_10	CTATAGCAATGTTCTTCTGCTTAACCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_177_replicate_1	CTATAGCAATGTTCTTCTGCTTAACCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_176_replicate_9	CTATAGCAATGTTCTTCTGCTTTTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_176_replicate_8	CTATAGCAATGTTCTTCTGCTTTTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_176_replicate_7	CTATAGCAATGTTCTTCTGCTTTTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_176_replicate_6	CTATAGCAATGTTCTTCTGCTTTTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_176_replicate_5	CTATAGCAATGTTCTTCTGCTTTTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_176_replicate_4	CTATAGCAATGTTCTTCTGCTTTTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_176_replicate_3	CTATAGCAATGTTCTTCTGCTTTTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_176_replicate_2	CTATAGCAATGTTCTTCTGCTTTTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_176_replicate_10	CTATAGCAATGTTCTTCTGCTTTTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_176_replicate_1	CTATAGCAATGTTCTTCTGCTTTTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_175_replicate_9	CTATAGCAATGTTCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_175_replicate_8	CTATAGCAATGTTCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_175_replicate_7	CTATAGCAATGTTCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_175_replicate_6	CTATAGCAATGTTCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_175_replicate_5	CTATAGCAATGTTCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_175_replicate_4	CTATAGCAATGTTCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_175_replicate_3	CTATAGCAATGTTCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_175_replicate_2	CTATAGCAATGTTCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_175_replicate_10	CTATAGCAATGTTCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_175_replicate_1	CTATAGCAATGTTCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_174_replicate_9	CTATAGCAATGTTCTTCTGCTTCTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_174_replicate_8	CTATAGCAATGTTCTTCTGCTTCTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_174_replicate_7	CTATAGCAATGTTCTTCTGCTTCTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_174_replicate_6	CTATAGCAATGTTCTTCTGCTTCTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_174_replicate_5	CTATAGCAATGTTCTTCTGCTTCTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_174_replicate_4	CTATAGCAATGTTCTTCTGCTTCTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_174_replicate_3	CTATAGCAATGTTCTTCTGCTTCTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_174_replicate_2	CTATAGCAATGTTCTTCTGCTTCTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_174_replicate_10	CTATAGCAATGTTCTTCTGCTTCTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_174_replicate_1	CTATAGCAATGTTCTTCTGCTTCTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_173_replicate_9	CTATAGCAATGTTCTTCTGCTTATCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_173_replicate_8	CTATAGCAATGTTCTTCTGCTTATCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_173_replicate_7	CTATAGCAATGTTCTTCTGCTTATCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_173_replicate_6	CTATAGCAATGTTCTTCTGCTTATCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_173_replicate_5	CTATAGCAATGTTCTTCTGCTTATCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_173_replicate_4	CTATAGCAATGTTCTTCTGCTTATCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_173_replicate_3	CTATAGCAATGTTCTTCTGCTTATCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_173_replicate_2	CTATAGCAATGTTCTTCTGCTTATCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_173_replicate_10	CTATAGCAATGTTCTTCTGCTTATCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_173_replicate_1	CTATAGCAATGTTCTTCTGCTTATCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_172_replicate_9	CTATAGCAATGTTCTTCTGCTGTTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_172_replicate_8	CTATAGCAATGTTCTTCTGCTGTTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_172_replicate_7	CTATAGCAATGTTCTTCTGCTGTTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_172_replicate_6	CTATAGCAATGTTCTTCTGCTGTTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_172_replicate_5	CTATAGCAATGTTCTTCTGCTGTTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_172_replicate_4	CTATAGCAATGTTCTTCTGCTGTTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_172_replicate_3	CTATAGCAATGTTCTTCTGCTGTTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_172_replicate_2	CTATAGCAATGTTCTTCTGCTGTTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_172_replicate_10	CTATAGCAATGTTCTTCTGCTGTTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_172_replicate_1	CTATAGCAATGTTCTTCTGCTGTTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_171_replicate_9	CTATAGCAATGTTCTTCTGCTGGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_171_replicate_8	CTATAGCAATGTTCTTCTGCTGGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_171_replicate_7	CTATAGCAATGTTCTTCTGCTGGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_171_replicate_6	CTATAGCAATGTTCTTCTGCTGGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_171_replicate_5	CTATAGCAATGTTCTTCTGCTGGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_171_replicate_4	CTATAGCAATGTTCTTCTGCTGGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_171_replicate_3	CTATAGCAATGTTCTTCTGCTGGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_171_replicate_2	CTATAGCAATGTTCTTCTGCTGGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_171_replicate_10	CTATAGCAATGTTCTTCTGCTGGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_171_replicate_1	CTATAGCAATGTTCTTCTGCTGGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_170_replicate_9	CTATAGCAATGTTCTTCTGCTGCTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_170_replicate_8	CTATAGCAATGTTCTTCTGCTGCTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_170_replicate_7	CTATAGCAATGTTCTTCTGCTGCTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_170_replicate_6	CTATAGCAATGTTCTTCTGCTGCTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_170_replicate_5	CTATAGCAATGTTCTTCTGCTGCTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_170_replicate_4	CTATAGCAATGTTCTTCTGCTGCTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_170_replicate_3	CTATAGCAATGTTCTTCTGCTGCTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_170_replicate_2	CTATAGCAATGTTCTTCTGCTGCTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_170_replicate_10	CTATAGCAATGTTCTTCTGCTGCTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_170_replicate_1	CTATAGCAATGTTCTTCTGCTGCTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_17_replicate_9	CTATAGCAATGTAATTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_17_replicate_8	CTATAGCAATGTAATTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_17_replicate_7	CTATAGCAATGTAATTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_17_replicate_6	CTATAGCAATGTAATTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_17_replicate_5	CTATAGCAATGTAATTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_17_replicate_4	CTATAGCAATGTAATTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_17_replicate_3	CTATAGCAATGTAATTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_17_replicate_2	CTATAGCAATGTAATTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_17_replicate_10	CTATAGCAATGTAATTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_17_replicate_1	CTATAGCAATGTAATTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_169_replicate_9	CTATAGCAATGTTCTTCTGCTGATCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_169_replicate_8	CTATAGCAATGTTCTTCTGCTGATCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_169_replicate_7	CTATAGCAATGTTCTTCTGCTGATCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_169_replicate_6	CTATAGCAATGTTCTTCTGCTGATCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_169_replicate_5	CTATAGCAATGTTCTTCTGCTGATCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_169_replicate_4	CTATAGCAATGTTCTTCTGCTGATCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_169_replicate_3	CTATAGCAATGTTCTTCTGCTGATCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_169_replicate_2	CTATAGCAATGTTCTTCTGCTGATCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_169_replicate_10	CTATAGCAATGTTCTTCTGCTGATCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_169_replicate_1	CTATAGCAATGTTCTTCTGCTGATCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_168_replicate_9	CTATAGCAATGTTCTTCTGCTCTTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_168_replicate_8	CTATAGCAATGTTCTTCTGCTCTTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_168_replicate_7	CTATAGCAATGTTCTTCTGCTCTTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_168_replicate_6	CTATAGCAATGTTCTTCTGCTCTTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_168_replicate_5	CTATAGCAATGTTCTTCTGCTCTTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_168_replicate_4	CTATAGCAATGTTCTTCTGCTCTTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_168_replicate_3	CTATAGCAATGTTCTTCTGCTCTTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_168_replicate_2	CTATAGCAATGTTCTTCTGCTCTTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_168_replicate_10	CTATAGCAATGTTCTTCTGCTCTTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_168_replicate_1	CTATAGCAATGTTCTTCTGCTCTTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_167_replicate_9	CTATAGCAATGTTCTTCTGCTCGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_167_replicate_8	CTATAGCAATGTTCTTCTGCTCGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_167_replicate_7	CTATAGCAATGTTCTTCTGCTCGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_167_replicate_6	CTATAGCAATGTTCTTCTGCTCGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_167_replicate_5	CTATAGCAATGTTCTTCTGCTCGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_167_replicate_4	CTATAGCAATGTTCTTCTGCTCGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_167_replicate_3	CTATAGCAATGTTCTTCTGCTCGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_167_replicate_2	CTATAGCAATGTTCTTCTGCTCGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_167_replicate_10	CTATAGCAATGTTCTTCTGCTCGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_167_replicate_1	CTATAGCAATGTTCTTCTGCTCGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_166_replicate_9	CTATAGCAATGTTCTTCTGCTCCTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_166_replicate_8	CTATAGCAATGTTCTTCTGCTCCTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_166_replicate_7	CTATAGCAATGTTCTTCTGCTCCTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_166_replicate_6	CTATAGCAATGTTCTTCTGCTCCTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_166_replicate_5	CTATAGCAATGTTCTTCTGCTCCTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_166_replicate_4	CTATAGCAATGTTCTTCTGCTCCTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_166_replicate_3	CTATAGCAATGTTCTTCTGCTCCTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_166_replicate_2	CTATAGCAATGTTCTTCTGCTCCTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_166_replicate_10	CTATAGCAATGTTCTTCTGCTCCTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_166_replicate_1	CTATAGCAATGTTCTTCTGCTCCTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_165_replicate_9	CTATAGCAATGTTCTTCTGCTCATCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_165_replicate_8	CTATAGCAATGTTCTTCTGCTCATCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_165_replicate_7	CTATAGCAATGTTCTTCTGCTCATCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_165_replicate_6	CTATAGCAATGTTCTTCTGCTCATCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_165_replicate_5	CTATAGCAATGTTCTTCTGCTCATCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_165_replicate_4	CTATAGCAATGTTCTTCTGCTCATCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_165_replicate_3	CTATAGCAATGTTCTTCTGCTCATCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_165_replicate_2	CTATAGCAATGTTCTTCTGCTCATCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_165_replicate_10	CTATAGCAATGTTCTTCTGCTCATCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_165_replicate_1	CTATAGCAATGTTCTTCTGCTCATCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_164_replicate_9	CTATAGCAATGTTCTTCTGCTATTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_164_replicate_8	CTATAGCAATGTTCTTCTGCTATTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_164_replicate_7	CTATAGCAATGTTCTTCTGCTATTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_164_replicate_6	CTATAGCAATGTTCTTCTGCTATTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_164_replicate_5	CTATAGCAATGTTCTTCTGCTATTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_164_replicate_4	CTATAGCAATGTTCTTCTGCTATTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_164_replicate_3	CTATAGCAATGTTCTTCTGCTATTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_164_replicate_2	CTATAGCAATGTTCTTCTGCTATTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_164_replicate_10	CTATAGCAATGTTCTTCTGCTATTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_164_replicate_1	CTATAGCAATGTTCTTCTGCTATTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_163_replicate_9	CTATAGCAATGTTCTTCTGCTAGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_163_replicate_8	CTATAGCAATGTTCTTCTGCTAGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_163_replicate_7	CTATAGCAATGTTCTTCTGCTAGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_163_replicate_6	CTATAGCAATGTTCTTCTGCTAGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_163_replicate_5	CTATAGCAATGTTCTTCTGCTAGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_163_replicate_4	CTATAGCAATGTTCTTCTGCTAGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_163_replicate_3	CTATAGCAATGTTCTTCTGCTAGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_163_replicate_2	CTATAGCAATGTTCTTCTGCTAGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_163_replicate_10	CTATAGCAATGTTCTTCTGCTAGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_163_replicate_1	CTATAGCAATGTTCTTCTGCTAGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_162_replicate_9	CTATAGCAATGTTCTTCTGCTACTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_162_replicate_8	CTATAGCAATGTTCTTCTGCTACTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_162_replicate_7	CTATAGCAATGTTCTTCTGCTACTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_162_replicate_6	CTATAGCAATGTTCTTCTGCTACTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_162_replicate_5	CTATAGCAATGTTCTTCTGCTACTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_162_replicate_4	CTATAGCAATGTTCTTCTGCTACTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_162_replicate_3	CTATAGCAATGTTCTTCTGCTACTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_162_replicate_2	CTATAGCAATGTTCTTCTGCTACTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_162_replicate_10	CTATAGCAATGTTCTTCTGCTACTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_162_replicate_1	CTATAGCAATGTTCTTCTGCTACTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_161_replicate_9	CTATAGCAATGTTCTTCTGCTAATCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_161_replicate_8	CTATAGCAATGTTCTTCTGCTAATCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_161_replicate_7	CTATAGCAATGTTCTTCTGCTAATCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_161_replicate_6	CTATAGCAATGTTCTTCTGCTAATCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_161_replicate_5	CTATAGCAATGTTCTTCTGCTAATCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_161_replicate_4	CTATAGCAATGTTCTTCTGCTAATCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_161_replicate_3	CTATAGCAATGTTCTTCTGCTAATCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_161_replicate_2	CTATAGCAATGTTCTTCTGCTAATCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_161_replicate_10	CTATAGCAATGTTCTTCTGCTAATCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_161_replicate_1	CTATAGCAATGTTCTTCTGCTAATCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_160_replicate_9	CTATAGCAATGTTCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_160_replicate_8	CTATAGCAATGTTCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_160_replicate_7	CTATAGCAATGTTCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_160_replicate_6	CTATAGCAATGTTCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_160_replicate_5	CTATAGCAATGTTCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_160_replicate_4	CTATAGCAATGTTCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_160_replicate_3	CTATAGCAATGTTCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_160_replicate_2	CTATAGCAATGTTCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_160_replicate_10	CTATAGCAATGTTCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_160_replicate_1	CTATAGCAATGTTCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_16_replicate_9	CTATAGCAATGTTCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_16_replicate_8	CTATAGCAATGTTCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_16_replicate_7	CTATAGCAATGTTCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_16_replicate_6	CTATAGCAATGTTCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_16_replicate_5	CTATAGCAATGTTCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_16_replicate_4	CTATAGCAATGTTCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_16_replicate_3	CTATAGCAATGTTCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_16_replicate_2	CTATAGCAATGTTCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_16_replicate_10	CTATAGCAATGTTCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_16_replicate_1	CTATAGCAATGTTCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_159_replicate_9	CTATAGCAATGTTCTTCTGCTGGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_159_replicate_8	CTATAGCAATGTTCTTCTGCTGGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_159_replicate_7	CTATAGCAATGTTCTTCTGCTGGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_159_replicate_6	CTATAGCAATGTTCTTCTGCTGGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_159_replicate_5	CTATAGCAATGTTCTTCTGCTGGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_159_replicate_4	CTATAGCAATGTTCTTCTGCTGGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_159_replicate_3	CTATAGCAATGTTCTTCTGCTGGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_159_replicate_2	CTATAGCAATGTTCTTCTGCTGGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_159_replicate_10	CTATAGCAATGTTCTTCTGCTGGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_159_replicate_1	CTATAGCAATGTTCTTCTGCTGGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_158_replicate_9	CTATAGCAATGTTCTTCTGCTCGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_158_replicate_8	CTATAGCAATGTTCTTCTGCTCGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_158_replicate_7	CTATAGCAATGTTCTTCTGCTCGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_158_replicate_6	CTATAGCAATGTTCTTCTGCTCGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_158_replicate_5	CTATAGCAATGTTCTTCTGCTCGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_158_replicate_4	CTATAGCAATGTTCTTCTGCTCGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_158_replicate_3	CTATAGCAATGTTCTTCTGCTCGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_158_replicate_2	CTATAGCAATGTTCTTCTGCTCGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_158_replicate_10	CTATAGCAATGTTCTTCTGCTCGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_158_replicate_1	CTATAGCAATGTTCTTCTGCTCGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_157_replicate_9	CTATAGCAATGTTCTTCTGCTAGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_157_replicate_8	CTATAGCAATGTTCTTCTGCTAGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_157_replicate_7	CTATAGCAATGTTCTTCTGCTAGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_157_replicate_6	CTATAGCAATGTTCTTCTGCTAGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_157_replicate_5	CTATAGCAATGTTCTTCTGCTAGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_157_replicate_4	CTATAGCAATGTTCTTCTGCTAGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_157_replicate_3	CTATAGCAATGTTCTTCTGCTAGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_157_replicate_2	CTATAGCAATGTTCTTCTGCTAGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_157_replicate_10	CTATAGCAATGTTCTTCTGCTAGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_157_replicate_1	CTATAGCAATGTTCTTCTGCTAGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_156_replicate_9	CTATAGCAATGTTCTTCTGCGTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_156_replicate_8	CTATAGCAATGTTCTTCTGCGTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_156_replicate_7	CTATAGCAATGTTCTTCTGCGTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_156_replicate_6	CTATAGCAATGTTCTTCTGCGTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_156_replicate_5	CTATAGCAATGTTCTTCTGCGTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_156_replicate_4	CTATAGCAATGTTCTTCTGCGTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_156_replicate_3	CTATAGCAATGTTCTTCTGCGTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_156_replicate_2	CTATAGCAATGTTCTTCTGCGTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_156_replicate_10	CTATAGCAATGTTCTTCTGCGTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_156_replicate_1	CTATAGCAATGTTCTTCTGCGTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_155_replicate_9	CTATAGCAATGTTCTTCTGCGGGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_155_replicate_8	CTATAGCAATGTTCTTCTGCGGGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_155_replicate_7	CTATAGCAATGTTCTTCTGCGGGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_155_replicate_6	CTATAGCAATGTTCTTCTGCGGGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_155_replicate_5	CTATAGCAATGTTCTTCTGCGGGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_155_replicate_4	CTATAGCAATGTTCTTCTGCGGGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_155_replicate_3	CTATAGCAATGTTCTTCTGCGGGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_155_replicate_2	CTATAGCAATGTTCTTCTGCGGGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_155_replicate_10	CTATAGCAATGTTCTTCTGCGGGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_155_replicate_1	CTATAGCAATGTTCTTCTGCGGGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_154_replicate_9	CTATAGCAATGTTCTTCTGCGCGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_154_replicate_8	CTATAGCAATGTTCTTCTGCGCGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_154_replicate_7	CTATAGCAATGTTCTTCTGCGCGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_154_replicate_6	CTATAGCAATGTTCTTCTGCGCGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_154_replicate_5	CTATAGCAATGTTCTTCTGCGCGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_154_replicate_4	CTATAGCAATGTTCTTCTGCGCGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_154_replicate_3	CTATAGCAATGTTCTTCTGCGCGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_154_replicate_2	CTATAGCAATGTTCTTCTGCGCGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_154_replicate_10	CTATAGCAATGTTCTTCTGCGCGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_154_replicate_1	CTATAGCAATGTTCTTCTGCGCGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_153_replicate_9	CTATAGCAATGTTCTTCTGCGAGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_153_replicate_8	CTATAGCAATGTTCTTCTGCGAGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_153_replicate_7	CTATAGCAATGTTCTTCTGCGAGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_153_replicate_6	CTATAGCAATGTTCTTCTGCGAGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_153_replicate_5	CTATAGCAATGTTCTTCTGCGAGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_153_replicate_4	CTATAGCAATGTTCTTCTGCGAGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_153_replicate_3	CTATAGCAATGTTCTTCTGCGAGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_153_replicate_2	CTATAGCAATGTTCTTCTGCGAGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_153_replicate_10	CTATAGCAATGTTCTTCTGCGAGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_153_replicate_1	CTATAGCAATGTTCTTCTGCGAGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_152_replicate_9	CTATAGCAATGTTCTTCTGCCTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_152_replicate_8	CTATAGCAATGTTCTTCTGCCTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_152_replicate_7	CTATAGCAATGTTCTTCTGCCTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_152_replicate_6	CTATAGCAATGTTCTTCTGCCTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_152_replicate_5	CTATAGCAATGTTCTTCTGCCTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_152_replicate_4	CTATAGCAATGTTCTTCTGCCTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_152_replicate_3	CTATAGCAATGTTCTTCTGCCTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_152_replicate_2	CTATAGCAATGTTCTTCTGCCTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_152_replicate_10	CTATAGCAATGTTCTTCTGCCTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_152_replicate_1	CTATAGCAATGTTCTTCTGCCTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_151_replicate_9	CTATAGCAATGTTCTTCTGCCGGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_151_replicate_8	CTATAGCAATGTTCTTCTGCCGGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_151_replicate_7	CTATAGCAATGTTCTTCTGCCGGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_151_replicate_6	CTATAGCAATGTTCTTCTGCCGGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_151_replicate_5	CTATAGCAATGTTCTTCTGCCGGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_151_replicate_4	CTATAGCAATGTTCTTCTGCCGGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_151_replicate_3	CTATAGCAATGTTCTTCTGCCGGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_151_replicate_2	CTATAGCAATGTTCTTCTGCCGGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_151_replicate_10	CTATAGCAATGTTCTTCTGCCGGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_151_replicate_1	CTATAGCAATGTTCTTCTGCCGGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_150_replicate_9	CTATAGCAATGTTCTTCTGCCCGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_150_replicate_8	CTATAGCAATGTTCTTCTGCCCGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_150_replicate_7	CTATAGCAATGTTCTTCTGCCCGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_150_replicate_6	CTATAGCAATGTTCTTCTGCCCGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_150_replicate_5	CTATAGCAATGTTCTTCTGCCCGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_150_replicate_4	CTATAGCAATGTTCTTCTGCCCGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_150_replicate_3	CTATAGCAATGTTCTTCTGCCCGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_150_replicate_2	CTATAGCAATGTTCTTCTGCCCGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_150_replicate_10	CTATAGCAATGTTCTTCTGCCCGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_150_replicate_1	CTATAGCAATGTTCTTCTGCCCGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_15_replicate_9	CTATAGCAATGTGCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_15_replicate_8	CTATAGCAATGTGCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_15_replicate_7	CTATAGCAATGTGCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_15_replicate_6	CTATAGCAATGTGCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_15_replicate_5	CTATAGCAATGTGCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_15_replicate_4	CTATAGCAATGTGCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_15_replicate_3	CTATAGCAATGTGCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_15_replicate_2	CTATAGCAATGTGCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_15_replicate_10	CTATAGCAATGTGCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_15_replicate_1	CTATAGCAATGTGCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_149_replicate_9	CTATAGCAATGTTCTTCTGCCAGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_149_replicate_8	CTATAGCAATGTTCTTCTGCCAGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_149_replicate_7	CTATAGCAATGTTCTTCTGCCAGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_149_replicate_6	CTATAGCAATGTTCTTCTGCCAGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_149_replicate_5	CTATAGCAATGTTCTTCTGCCAGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_149_replicate_4	CTATAGCAATGTTCTTCTGCCAGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_149_replicate_3	CTATAGCAATGTTCTTCTGCCAGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_149_replicate_2	CTATAGCAATGTTCTTCTGCCAGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_149_replicate_10	CTATAGCAATGTTCTTCTGCCAGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_149_replicate_1	CTATAGCAATGTTCTTCTGCCAGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_148_replicate_9	CTATAGCAATGTTCTTCTGCATGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_148_replicate_8	CTATAGCAATGTTCTTCTGCATGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_148_replicate_7	CTATAGCAATGTTCTTCTGCATGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_148_replicate_6	CTATAGCAATGTTCTTCTGCATGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_148_replicate_5	CTATAGCAATGTTCTTCTGCATGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_148_replicate_4	CTATAGCAATGTTCTTCTGCATGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_148_replicate_3	CTATAGCAATGTTCTTCTGCATGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_148_replicate_2	CTATAGCAATGTTCTTCTGCATGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_148_replicate_10	CTATAGCAATGTTCTTCTGCATGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_148_replicate_1	CTATAGCAATGTTCTTCTGCATGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_147_replicate_9	CTATAGCAATGTTCTTCTGCAGGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_147_replicate_8	CTATAGCAATGTTCTTCTGCAGGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_147_replicate_7	CTATAGCAATGTTCTTCTGCAGGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_147_replicate_6	CTATAGCAATGTTCTTCTGCAGGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_147_replicate_5	CTATAGCAATGTTCTTCTGCAGGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_147_replicate_4	CTATAGCAATGTTCTTCTGCAGGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_147_replicate_3	CTATAGCAATGTTCTTCTGCAGGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_147_replicate_2	CTATAGCAATGTTCTTCTGCAGGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_147_replicate_10	CTATAGCAATGTTCTTCTGCAGGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_147_replicate_1	CTATAGCAATGTTCTTCTGCAGGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_146_replicate_9	CTATAGCAATGTTCTTCTGCACGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_146_replicate_8	CTATAGCAATGTTCTTCTGCACGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_146_replicate_7	CTATAGCAATGTTCTTCTGCACGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_146_replicate_6	CTATAGCAATGTTCTTCTGCACGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_146_replicate_5	CTATAGCAATGTTCTTCTGCACGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_146_replicate_4	CTATAGCAATGTTCTTCTGCACGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_146_replicate_3	CTATAGCAATGTTCTTCTGCACGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_146_replicate_2	CTATAGCAATGTTCTTCTGCACGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_146_replicate_10	CTATAGCAATGTTCTTCTGCACGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_146_replicate_1	CTATAGCAATGTTCTTCTGCACGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_145_replicate_9	CTATAGCAATGTTCTTCTGCAAGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_145_replicate_8	CTATAGCAATGTTCTTCTGCAAGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_145_replicate_7	CTATAGCAATGTTCTTCTGCAAGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_145_replicate_6	CTATAGCAATGTTCTTCTGCAAGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_145_replicate_5	CTATAGCAATGTTCTTCTGCAAGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_145_replicate_4	CTATAGCAATGTTCTTCTGCAAGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_145_replicate_3	CTATAGCAATGTTCTTCTGCAAGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_145_replicate_2	CTATAGCAATGTTCTTCTGCAAGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_145_replicate_10	CTATAGCAATGTTCTTCTGCAAGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_145_replicate_1	CTATAGCAATGTTCTTCTGCAAGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_144_replicate_9	CTATAGCAATGTTCTTCTGTTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_144_replicate_8	CTATAGCAATGTTCTTCTGTTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_144_replicate_7	CTATAGCAATGTTCTTCTGTTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_144_replicate_6	CTATAGCAATGTTCTTCTGTTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_144_replicate_5	CTATAGCAATGTTCTTCTGTTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_144_replicate_4	CTATAGCAATGTTCTTCTGTTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_144_replicate_3	CTATAGCAATGTTCTTCTGTTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_144_replicate_2	CTATAGCAATGTTCTTCTGTTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_144_replicate_10	CTATAGCAATGTTCTTCTGTTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_144_replicate_1	CTATAGCAATGTTCTTCTGTTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_143_replicate_9	CTATAGCAATGTTCTTCTGTGTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_143_replicate_8	CTATAGCAATGTTCTTCTGTGTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_143_replicate_7	CTATAGCAATGTTCTTCTGTGTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_143_replicate_6	CTATAGCAATGTTCTTCTGTGTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_143_replicate_5	CTATAGCAATGTTCTTCTGTGTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_143_replicate_4	CTATAGCAATGTTCTTCTGTGTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_143_replicate_3	CTATAGCAATGTTCTTCTGTGTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_143_replicate_2	CTATAGCAATGTTCTTCTGTGTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_143_replicate_10	CTATAGCAATGTTCTTCTGTGTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_143_replicate_1	CTATAGCAATGTTCTTCTGTGTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_142_replicate_9	CTATAGCAATGTTCTTCTGTCTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_142_replicate_8	CTATAGCAATGTTCTTCTGTCTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_142_replicate_7	CTATAGCAATGTTCTTCTGTCTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_142_replicate_6	CTATAGCAATGTTCTTCTGTCTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_142_replicate_5	CTATAGCAATGTTCTTCTGTCTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_142_replicate_4	CTATAGCAATGTTCTTCTGTCTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_142_replicate_3	CTATAGCAATGTTCTTCTGTCTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_142_replicate_2	CTATAGCAATGTTCTTCTGTCTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_142_replicate_10	CTATAGCAATGTTCTTCTGTCTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_142_replicate_1	CTATAGCAATGTTCTTCTGTCTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_141_replicate_9	CTATAGCAATGTTCTTCTGTATGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_141_replicate_8	CTATAGCAATGTTCTTCTGTATGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_141_replicate_7	CTATAGCAATGTTCTTCTGTATGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_141_replicate_6	CTATAGCAATGTTCTTCTGTATGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_141_replicate_5	CTATAGCAATGTTCTTCTGTATGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_141_replicate_4	CTATAGCAATGTTCTTCTGTATGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_141_replicate_3	CTATAGCAATGTTCTTCTGTATGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_141_replicate_2	CTATAGCAATGTTCTTCTGTATGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_141_replicate_10	CTATAGCAATGTTCTTCTGTATGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_141_replicate_1	CTATAGCAATGTTCTTCTGTATGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_140_replicate_9	CTATAGCAATGTTCTTCTGGTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_140_replicate_8	CTATAGCAATGTTCTTCTGGTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_140_replicate_7	CTATAGCAATGTTCTTCTGGTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_140_replicate_6	CTATAGCAATGTTCTTCTGGTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_140_replicate_5	CTATAGCAATGTTCTTCTGGTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_140_replicate_4	CTATAGCAATGTTCTTCTGGTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_140_replicate_3	CTATAGCAATGTTCTTCTGGTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_140_replicate_2	CTATAGCAATGTTCTTCTGGTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_140_replicate_10	CTATAGCAATGTTCTTCTGGTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_140_replicate_1	CTATAGCAATGTTCTTCTGGTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_14_replicate_9	CTATAGCAATGTCCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_14_replicate_8	CTATAGCAATGTCCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_14_replicate_7	CTATAGCAATGTCCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_14_replicate_6	CTATAGCAATGTCCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_14_replicate_5	CTATAGCAATGTCCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_14_replicate_4	CTATAGCAATGTCCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_14_replicate_3	CTATAGCAATGTCCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_14_replicate_2	CTATAGCAATGTCCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_14_replicate_10	CTATAGCAATGTCCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_14_replicate_1	CTATAGCAATGTCCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_139_replicate_9	CTATAGCAATGTTCTTCTGGGTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_139_replicate_8	CTATAGCAATGTTCTTCTGGGTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_139_replicate_7	CTATAGCAATGTTCTTCTGGGTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_139_replicate_6	CTATAGCAATGTTCTTCTGGGTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_139_replicate_5	CTATAGCAATGTTCTTCTGGGTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_139_replicate_4	CTATAGCAATGTTCTTCTGGGTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_139_replicate_3	CTATAGCAATGTTCTTCTGGGTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_139_replicate_2	CTATAGCAATGTTCTTCTGGGTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_139_replicate_10	CTATAGCAATGTTCTTCTGGGTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_139_replicate_1	CTATAGCAATGTTCTTCTGGGTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_138_replicate_9	CTATAGCAATGTTCTTCTGGCTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_138_replicate_8	CTATAGCAATGTTCTTCTGGCTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_138_replicate_7	CTATAGCAATGTTCTTCTGGCTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_138_replicate_6	CTATAGCAATGTTCTTCTGGCTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_138_replicate_5	CTATAGCAATGTTCTTCTGGCTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_138_replicate_4	CTATAGCAATGTTCTTCTGGCTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_138_replicate_3	CTATAGCAATGTTCTTCTGGCTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_138_replicate_2	CTATAGCAATGTTCTTCTGGCTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_138_replicate_10	CTATAGCAATGTTCTTCTGGCTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_138_replicate_1	CTATAGCAATGTTCTTCTGGCTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_137_replicate_9	CTATAGCAATGTTCTTCTGGATGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_137_replicate_8	CTATAGCAATGTTCTTCTGGATGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_137_replicate_7	CTATAGCAATGTTCTTCTGGATGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_137_replicate_6	CTATAGCAATGTTCTTCTGGATGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_137_replicate_5	CTATAGCAATGTTCTTCTGGATGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_137_replicate_4	CTATAGCAATGTTCTTCTGGATGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_137_replicate_3	CTATAGCAATGTTCTTCTGGATGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_137_replicate_2	CTATAGCAATGTTCTTCTGGATGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_137_replicate_10	CTATAGCAATGTTCTTCTGGATGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_137_replicate_1	CTATAGCAATGTTCTTCTGGATGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_136_replicate_9	CTATAGCAATGTTCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_136_replicate_8	CTATAGCAATGTTCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_136_replicate_7	CTATAGCAATGTTCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_136_replicate_6	CTATAGCAATGTTCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_136_replicate_5	CTATAGCAATGTTCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_136_replicate_4	CTATAGCAATGTTCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_136_replicate_3	CTATAGCAATGTTCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_136_replicate_2	CTATAGCAATGTTCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_136_replicate_10	CTATAGCAATGTTCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_136_replicate_1	CTATAGCAATGTTCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_135_replicate_9	CTATAGCAATGTTCTTCTGCGTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_135_replicate_8	CTATAGCAATGTTCTTCTGCGTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_135_replicate_7	CTATAGCAATGTTCTTCTGCGTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_135_replicate_6	CTATAGCAATGTTCTTCTGCGTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_135_replicate_5	CTATAGCAATGTTCTTCTGCGTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_135_replicate_4	CTATAGCAATGTTCTTCTGCGTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_135_replicate_3	CTATAGCAATGTTCTTCTGCGTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_135_replicate_2	CTATAGCAATGTTCTTCTGCGTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_135_replicate_10	CTATAGCAATGTTCTTCTGCGTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_135_replicate_1	CTATAGCAATGTTCTTCTGCGTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_134_replicate_9	CTATAGCAATGTTCTTCTGCCTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_134_replicate_8	CTATAGCAATGTTCTTCTGCCTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_134_replicate_7	CTATAGCAATGTTCTTCTGCCTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_134_replicate_6	CTATAGCAATGTTCTTCTGCCTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_134_replicate_5	CTATAGCAATGTTCTTCTGCCTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_134_replicate_4	CTATAGCAATGTTCTTCTGCCTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_134_replicate_3	CTATAGCAATGTTCTTCTGCCTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_134_replicate_2	CTATAGCAATGTTCTTCTGCCTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_134_replicate_10	CTATAGCAATGTTCTTCTGCCTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_134_replicate_1	CTATAGCAATGTTCTTCTGCCTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_133_replicate_9	CTATAGCAATGTTCTTCTGCATGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_133_replicate_8	CTATAGCAATGTTCTTCTGCATGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_133_replicate_7	CTATAGCAATGTTCTTCTGCATGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_133_replicate_6	CTATAGCAATGTTCTTCTGCATGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_133_replicate_5	CTATAGCAATGTTCTTCTGCATGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_133_replicate_4	CTATAGCAATGTTCTTCTGCATGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_133_replicate_3	CTATAGCAATGTTCTTCTGCATGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_133_replicate_2	CTATAGCAATGTTCTTCTGCATGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_133_replicate_10	CTATAGCAATGTTCTTCTGCATGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_133_replicate_1	CTATAGCAATGTTCTTCTGCATGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_132_replicate_9	CTATAGCAATGTTCTTCTGATTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_132_replicate_8	CTATAGCAATGTTCTTCTGATTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_132_replicate_7	CTATAGCAATGTTCTTCTGATTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_132_replicate_6	CTATAGCAATGTTCTTCTGATTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_132_replicate_5	CTATAGCAATGTTCTTCTGATTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_132_replicate_4	CTATAGCAATGTTCTTCTGATTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_132_replicate_3	CTATAGCAATGTTCTTCTGATTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_132_replicate_2	CTATAGCAATGTTCTTCTGATTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_132_replicate_10	CTATAGCAATGTTCTTCTGATTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_132_replicate_1	CTATAGCAATGTTCTTCTGATTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_131_replicate_9	CTATAGCAATGTTCTTCTGAGTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_131_replicate_8	CTATAGCAATGTTCTTCTGAGTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_131_replicate_7	CTATAGCAATGTTCTTCTGAGTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_131_replicate_6	CTATAGCAATGTTCTTCTGAGTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_131_replicate_5	CTATAGCAATGTTCTTCTGAGTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_131_replicate_4	CTATAGCAATGTTCTTCTGAGTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_131_replicate_3	CTATAGCAATGTTCTTCTGAGTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_131_replicate_2	CTATAGCAATGTTCTTCTGAGTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_131_replicate_10	CTATAGCAATGTTCTTCTGAGTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_131_replicate_1	CTATAGCAATGTTCTTCTGAGTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_130_replicate_9	CTATAGCAATGTTCTTCTGACTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_130_replicate_8	CTATAGCAATGTTCTTCTGACTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_130_replicate_7	CTATAGCAATGTTCTTCTGACTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_130_replicate_6	CTATAGCAATGTTCTTCTGACTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_130_replicate_5	CTATAGCAATGTTCTTCTGACTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_130_replicate_4	CTATAGCAATGTTCTTCTGACTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_130_replicate_3	CTATAGCAATGTTCTTCTGACTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_130_replicate_2	CTATAGCAATGTTCTTCTGACTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_130_replicate_10	CTATAGCAATGTTCTTCTGACTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_130_replicate_1	CTATAGCAATGTTCTTCTGACTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_13_replicate_9	CTATAGCAATGTACTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_13_replicate_8	CTATAGCAATGTACTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_13_replicate_7	CTATAGCAATGTACTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_13_replicate_6	CTATAGCAATGTACTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_13_replicate_5	CTATAGCAATGTACTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_13_replicate_4	CTATAGCAATGTACTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_13_replicate_3	CTATAGCAATGTACTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_13_replicate_2	CTATAGCAATGTACTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_13_replicate_10	CTATAGCAATGTACTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_13_replicate_1	CTATAGCAATGTACTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_129_replicate_9	CTATAGCAATGTTCTTCTGAATGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_129_replicate_8	CTATAGCAATGTTCTTCTGAATGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_129_replicate_7	CTATAGCAATGTTCTTCTGAATGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_129_replicate_6	CTATAGCAATGTTCTTCTGAATGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_129_replicate_5	CTATAGCAATGTTCTTCTGAATGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_129_replicate_4	CTATAGCAATGTTCTTCTGAATGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_129_replicate_3	CTATAGCAATGTTCTTCTGAATGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_129_replicate_2	CTATAGCAATGTTCTTCTGAATGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_129_replicate_10	CTATAGCAATGTTCTTCTGAATGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_129_replicate_1	CTATAGCAATGTTCTTCTGAATGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_128_replicate_9	CTATAGCAATGTTCTTCTTTTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_128_replicate_8	CTATAGCAATGTTCTTCTTTTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_128_replicate_7	CTATAGCAATGTTCTTCTTTTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_128_replicate_6	CTATAGCAATGTTCTTCTTTTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_128_replicate_5	CTATAGCAATGTTCTTCTTTTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_128_replicate_4	CTATAGCAATGTTCTTCTTTTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_128_replicate_3	CTATAGCAATGTTCTTCTTTTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_128_replicate_2	CTATAGCAATGTTCTTCTTTTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_128_replicate_10	CTATAGCAATGTTCTTCTTTTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_128_replicate_1	CTATAGCAATGTTCTTCTTTTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_127_replicate_9	CTATAGCAATGTTCTTCTTGTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_127_replicate_8	CTATAGCAATGTTCTTCTTGTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_127_replicate_7	CTATAGCAATGTTCTTCTTGTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_127_replicate_6	CTATAGCAATGTTCTTCTTGTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_127_replicate_5	CTATAGCAATGTTCTTCTTGTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_127_replicate_4	CTATAGCAATGTTCTTCTTGTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_127_replicate_3	CTATAGCAATGTTCTTCTTGTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_127_replicate_2	CTATAGCAATGTTCTTCTTGTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_127_replicate_10	CTATAGCAATGTTCTTCTTGTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_127_replicate_1	CTATAGCAATGTTCTTCTTGTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_126_replicate_9	CTATAGCAATGTTCTTCTTCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_126_replicate_8	CTATAGCAATGTTCTTCTTCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_126_replicate_7	CTATAGCAATGTTCTTCTTCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_126_replicate_6	CTATAGCAATGTTCTTCTTCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_126_replicate_5	CTATAGCAATGTTCTTCTTCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_126_replicate_4	CTATAGCAATGTTCTTCTTCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_126_replicate_3	CTATAGCAATGTTCTTCTTCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_126_replicate_2	CTATAGCAATGTTCTTCTTCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_126_replicate_10	CTATAGCAATGTTCTTCTTCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_126_replicate_1	CTATAGCAATGTTCTTCTTCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_125_replicate_9	CTATAGCAATGTTCTTCTTATTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_125_replicate_8	CTATAGCAATGTTCTTCTTATTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_125_replicate_7	CTATAGCAATGTTCTTCTTATTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_125_replicate_6	CTATAGCAATGTTCTTCTTATTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_125_replicate_5	CTATAGCAATGTTCTTCTTATTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_125_replicate_4	CTATAGCAATGTTCTTCTTATTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_125_replicate_3	CTATAGCAATGTTCTTCTTATTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_125_replicate_2	CTATAGCAATGTTCTTCTTATTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_125_replicate_10	CTATAGCAATGTTCTTCTTATTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_125_replicate_1	CTATAGCAATGTTCTTCTTATTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_124_replicate_9	CTATAGCAATGTTCTTCTGTTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_124_replicate_8	CTATAGCAATGTTCTTCTGTTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_124_replicate_7	CTATAGCAATGTTCTTCTGTTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_124_replicate_6	CTATAGCAATGTTCTTCTGTTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_124_replicate_5	CTATAGCAATGTTCTTCTGTTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_124_replicate_4	CTATAGCAATGTTCTTCTGTTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_124_replicate_3	CTATAGCAATGTTCTTCTGTTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_124_replicate_2	CTATAGCAATGTTCTTCTGTTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_124_replicate_10	CTATAGCAATGTTCTTCTGTTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_124_replicate_1	CTATAGCAATGTTCTTCTGTTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_123_replicate_9	CTATAGCAATGTTCTTCTGGTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_123_replicate_8	CTATAGCAATGTTCTTCTGGTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_123_replicate_7	CTATAGCAATGTTCTTCTGGTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_123_replicate_6	CTATAGCAATGTTCTTCTGGTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_123_replicate_5	CTATAGCAATGTTCTTCTGGTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_123_replicate_4	CTATAGCAATGTTCTTCTGGTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_123_replicate_3	CTATAGCAATGTTCTTCTGGTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_123_replicate_2	CTATAGCAATGTTCTTCTGGTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_123_replicate_10	CTATAGCAATGTTCTTCTGGTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_123_replicate_1	CTATAGCAATGTTCTTCTGGTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_122_replicate_9	CTATAGCAATGTTCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_122_replicate_8	CTATAGCAATGTTCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_122_replicate_7	CTATAGCAATGTTCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_122_replicate_6	CTATAGCAATGTTCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_122_replicate_5	CTATAGCAATGTTCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_122_replicate_4	CTATAGCAATGTTCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_122_replicate_3	CTATAGCAATGTTCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_122_replicate_2	CTATAGCAATGTTCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_122_replicate_10	CTATAGCAATGTTCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_122_replicate_1	CTATAGCAATGTTCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_121_replicate_9	CTATAGCAATGTTCTTCTGATTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_121_replicate_8	CTATAGCAATGTTCTTCTGATTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_121_replicate_7	CTATAGCAATGTTCTTCTGATTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_121_replicate_6	CTATAGCAATGTTCTTCTGATTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_121_replicate_5	CTATAGCAATGTTCTTCTGATTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_121_replicate_4	CTATAGCAATGTTCTTCTGATTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_121_replicate_3	CTATAGCAATGTTCTTCTGATTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_121_replicate_2	CTATAGCAATGTTCTTCTGATTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_121_replicate_10	CTATAGCAATGTTCTTCTGATTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_121_replicate_1	CTATAGCAATGTTCTTCTGATTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_120_replicate_9	CTATAGCAATGTTCTTCTCTTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_120_replicate_8	CTATAGCAATGTTCTTCTCTTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_120_replicate_7	CTATAGCAATGTTCTTCTCTTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_120_replicate_6	CTATAGCAATGTTCTTCTCTTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_120_replicate_5	CTATAGCAATGTTCTTCTCTTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_120_replicate_4	CTATAGCAATGTTCTTCTCTTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_120_replicate_3	CTATAGCAATGTTCTTCTCTTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_120_replicate_2	CTATAGCAATGTTCTTCTCTTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_120_replicate_10	CTATAGCAATGTTCTTCTCTTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_120_replicate_1	CTATAGCAATGTTCTTCTCTTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_12_replicate_9	CTATAGCAATGGTCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_12_replicate_8	CTATAGCAATGGTCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_12_replicate_7	CTATAGCAATGGTCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_12_replicate_6	CTATAGCAATGGTCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_12_replicate_5	CTATAGCAATGGTCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_12_replicate_4	CTATAGCAATGGTCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_12_replicate_3	CTATAGCAATGGTCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_12_replicate_2	CTATAGCAATGGTCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_12_replicate_10	CTATAGCAATGGTCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_12_replicate_1	CTATAGCAATGGTCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_119_replicate_9	CTATAGCAATGTTCTTCTCGTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_119_replicate_8	CTATAGCAATGTTCTTCTCGTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_119_replicate_7	CTATAGCAATGTTCTTCTCGTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_119_replicate_6	CTATAGCAATGTTCTTCTCGTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_119_replicate_5	CTATAGCAATGTTCTTCTCGTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_119_replicate_4	CTATAGCAATGTTCTTCTCGTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_119_replicate_3	CTATAGCAATGTTCTTCTCGTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_119_replicate_2	CTATAGCAATGTTCTTCTCGTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_119_replicate_10	CTATAGCAATGTTCTTCTCGTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_119_replicate_1	CTATAGCAATGTTCTTCTCGTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_118_replicate_9	CTATAGCAATGTTCTTCTCCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_118_replicate_8	CTATAGCAATGTTCTTCTCCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_118_replicate_7	CTATAGCAATGTTCTTCTCCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_118_replicate_6	CTATAGCAATGTTCTTCTCCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_118_replicate_5	CTATAGCAATGTTCTTCTCCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_118_replicate_4	CTATAGCAATGTTCTTCTCCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_118_replicate_3	CTATAGCAATGTTCTTCTCCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_118_replicate_2	CTATAGCAATGTTCTTCTCCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_118_replicate_10	CTATAGCAATGTTCTTCTCCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_118_replicate_1	CTATAGCAATGTTCTTCTCCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_117_replicate_9	CTATAGCAATGTTCTTCTCATTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_117_replicate_8	CTATAGCAATGTTCTTCTCATTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_117_replicate_7	CTATAGCAATGTTCTTCTCATTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_117_replicate_6	CTATAGCAATGTTCTTCTCATTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_117_replicate_5	CTATAGCAATGTTCTTCTCATTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_117_replicate_4	CTATAGCAATGTTCTTCTCATTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_117_replicate_3	CTATAGCAATGTTCTTCTCATTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_117_replicate_2	CTATAGCAATGTTCTTCTCATTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_117_replicate_10	CTATAGCAATGTTCTTCTCATTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_117_replicate_1	CTATAGCAATGTTCTTCTCATTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_116_replicate_9	CTATAGCAATGTTCTTCTATTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_116_replicate_8	CTATAGCAATGTTCTTCTATTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_116_replicate_7	CTATAGCAATGTTCTTCTATTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_116_replicate_6	CTATAGCAATGTTCTTCTATTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_116_replicate_5	CTATAGCAATGTTCTTCTATTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_116_replicate_4	CTATAGCAATGTTCTTCTATTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_116_replicate_3	CTATAGCAATGTTCTTCTATTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_116_replicate_2	CTATAGCAATGTTCTTCTATTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_116_replicate_10	CTATAGCAATGTTCTTCTATTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_116_replicate_1	CTATAGCAATGTTCTTCTATTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_115_replicate_9	CTATAGCAATGTTCTTCTAGTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_115_replicate_8	CTATAGCAATGTTCTTCTAGTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_115_replicate_7	CTATAGCAATGTTCTTCTAGTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_115_replicate_6	CTATAGCAATGTTCTTCTAGTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_115_replicate_5	CTATAGCAATGTTCTTCTAGTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_115_replicate_4	CTATAGCAATGTTCTTCTAGTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_115_replicate_3	CTATAGCAATGTTCTTCTAGTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_115_replicate_2	CTATAGCAATGTTCTTCTAGTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_115_replicate_10	CTATAGCAATGTTCTTCTAGTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_115_replicate_1	CTATAGCAATGTTCTTCTAGTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_114_replicate_9	CTATAGCAATGTTCTTCTACTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_114_replicate_8	CTATAGCAATGTTCTTCTACTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_114_replicate_7	CTATAGCAATGTTCTTCTACTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_114_replicate_6	CTATAGCAATGTTCTTCTACTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_114_replicate_5	CTATAGCAATGTTCTTCTACTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_114_replicate_4	CTATAGCAATGTTCTTCTACTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_114_replicate_3	CTATAGCAATGTTCTTCTACTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_114_replicate_2	CTATAGCAATGTTCTTCTACTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_114_replicate_10	CTATAGCAATGTTCTTCTACTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_114_replicate_1	CTATAGCAATGTTCTTCTACTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_113_replicate_9	CTATAGCAATGTTCTTCTAATTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_113_replicate_8	CTATAGCAATGTTCTTCTAATTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_113_replicate_7	CTATAGCAATGTTCTTCTAATTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_113_replicate_6	CTATAGCAATGTTCTTCTAATTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_113_replicate_5	CTATAGCAATGTTCTTCTAATTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_113_replicate_4	CTATAGCAATGTTCTTCTAATTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_113_replicate_3	CTATAGCAATGTTCTTCTAATTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_113_replicate_2	CTATAGCAATGTTCTTCTAATTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_113_replicate_10	CTATAGCAATGTTCTTCTAATTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_113_replicate_1	CTATAGCAATGTTCTTCTAATTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_112_replicate_9	CTATAGCAATGTTCTTCTTCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_112_replicate_8	CTATAGCAATGTTCTTCTTCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_112_replicate_7	CTATAGCAATGTTCTTCTTCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_112_replicate_6	CTATAGCAATGTTCTTCTTCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_112_replicate_5	CTATAGCAATGTTCTTCTTCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_112_replicate_4	CTATAGCAATGTTCTTCTTCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_112_replicate_3	CTATAGCAATGTTCTTCTTCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_112_replicate_2	CTATAGCAATGTTCTTCTTCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_112_replicate_10	CTATAGCAATGTTCTTCTTCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_112_replicate_1	CTATAGCAATGTTCTTCTTCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_111_replicate_9	CTATAGCAATGTTCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_111_replicate_8	CTATAGCAATGTTCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_111_replicate_7	CTATAGCAATGTTCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_111_replicate_6	CTATAGCAATGTTCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_111_replicate_5	CTATAGCAATGTTCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_111_replicate_4	CTATAGCAATGTTCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_111_replicate_3	CTATAGCAATGTTCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_111_replicate_2	CTATAGCAATGTTCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_111_replicate_10	CTATAGCAATGTTCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_111_replicate_1	CTATAGCAATGTTCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_110_replicate_9	CTATAGCAATGTTCTTCTCCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_110_replicate_8	CTATAGCAATGTTCTTCTCCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_110_replicate_7	CTATAGCAATGTTCTTCTCCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_110_replicate_6	CTATAGCAATGTTCTTCTCCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_110_replicate_5	CTATAGCAATGTTCTTCTCCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_110_replicate_4	CTATAGCAATGTTCTTCTCCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_110_replicate_3	CTATAGCAATGTTCTTCTCCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_110_replicate_2	CTATAGCAATGTTCTTCTCCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_110_replicate_10	CTATAGCAATGTTCTTCTCCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_110_replicate_1	CTATAGCAATGTTCTTCTCCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_11_replicate_9	CTATAGCAATGGGCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_11_replicate_8	CTATAGCAATGGGCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_11_replicate_7	CTATAGCAATGGGCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_11_replicate_6	CTATAGCAATGGGCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_11_replicate_5	CTATAGCAATGGGCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_11_replicate_4	CTATAGCAATGGGCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_11_replicate_3	CTATAGCAATGGGCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_11_replicate_2	CTATAGCAATGGGCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_11_replicate_10	CTATAGCAATGGGCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_11_replicate_1	CTATAGCAATGGGCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_109_replicate_9	CTATAGCAATGTTCTTCTACTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_109_replicate_8	CTATAGCAATGTTCTTCTACTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_109_replicate_7	CTATAGCAATGTTCTTCTACTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_109_replicate_6	CTATAGCAATGTTCTTCTACTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_109_replicate_5	CTATAGCAATGTTCTTCTACTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_109_replicate_4	CTATAGCAATGTTCTTCTACTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_109_replicate_3	CTATAGCAATGTTCTTCTACTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_109_replicate_2	CTATAGCAATGTTCTTCTACTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_109_replicate_10	CTATAGCAATGTTCTTCTACTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_109_replicate_1	CTATAGCAATGTTCTTCTACTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_108_replicate_9	CTATAGCAATGTTCTTCGTCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_108_replicate_8	CTATAGCAATGTTCTTCGTCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_108_replicate_7	CTATAGCAATGTTCTTCGTCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_108_replicate_6	CTATAGCAATGTTCTTCGTCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_108_replicate_5	CTATAGCAATGTTCTTCGTCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_108_replicate_4	CTATAGCAATGTTCTTCGTCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_108_replicate_3	CTATAGCAATGTTCTTCGTCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_108_replicate_2	CTATAGCAATGTTCTTCGTCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_108_replicate_10	CTATAGCAATGTTCTTCGTCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_108_replicate_1	CTATAGCAATGTTCTTCGTCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_107_replicate_9	CTATAGCAATGTTCTTCGGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_107_replicate_8	CTATAGCAATGTTCTTCGGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_107_replicate_7	CTATAGCAATGTTCTTCGGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_107_replicate_6	CTATAGCAATGTTCTTCGGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_107_replicate_5	CTATAGCAATGTTCTTCGGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_107_replicate_4	CTATAGCAATGTTCTTCGGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_107_replicate_3	CTATAGCAATGTTCTTCGGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_107_replicate_2	CTATAGCAATGTTCTTCGGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_107_replicate_10	CTATAGCAATGTTCTTCGGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_107_replicate_1	CTATAGCAATGTTCTTCGGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_106_replicate_9	CTATAGCAATGTTCTTCGCCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_106_replicate_8	CTATAGCAATGTTCTTCGCCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_106_replicate_7	CTATAGCAATGTTCTTCGCCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_106_replicate_6	CTATAGCAATGTTCTTCGCCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_106_replicate_5	CTATAGCAATGTTCTTCGCCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_106_replicate_4	CTATAGCAATGTTCTTCGCCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_106_replicate_3	CTATAGCAATGTTCTTCGCCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_106_replicate_2	CTATAGCAATGTTCTTCGCCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_106_replicate_10	CTATAGCAATGTTCTTCGCCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_106_replicate_1	CTATAGCAATGTTCTTCGCCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_105_replicate_9	CTATAGCAATGTTCTTCGACTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_105_replicate_8	CTATAGCAATGTTCTTCGACTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_105_replicate_7	CTATAGCAATGTTCTTCGACTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_105_replicate_6	CTATAGCAATGTTCTTCGACTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_105_replicate_5	CTATAGCAATGTTCTTCGACTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_105_replicate_4	CTATAGCAATGTTCTTCGACTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_105_replicate_3	CTATAGCAATGTTCTTCGACTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_105_replicate_2	CTATAGCAATGTTCTTCGACTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_105_replicate_10	CTATAGCAATGTTCTTCGACTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_105_replicate_1	CTATAGCAATGTTCTTCGACTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_104_replicate_9	CTATAGCAATGTTCTTCCTCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_104_replicate_8	CTATAGCAATGTTCTTCCTCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_104_replicate_7	CTATAGCAATGTTCTTCCTCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_104_replicate_6	CTATAGCAATGTTCTTCCTCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_104_replicate_5	CTATAGCAATGTTCTTCCTCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_104_replicate_4	CTATAGCAATGTTCTTCCTCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_104_replicate_3	CTATAGCAATGTTCTTCCTCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_104_replicate_2	CTATAGCAATGTTCTTCCTCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_104_replicate_10	CTATAGCAATGTTCTTCCTCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_104_replicate_1	CTATAGCAATGTTCTTCCTCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_103_replicate_9	CTATAGCAATGTTCTTCCGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_103_replicate_8	CTATAGCAATGTTCTTCCGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_103_replicate_7	CTATAGCAATGTTCTTCCGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_103_replicate_6	CTATAGCAATGTTCTTCCGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_103_replicate_5	CTATAGCAATGTTCTTCCGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_103_replicate_4	CTATAGCAATGTTCTTCCGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_103_replicate_3	CTATAGCAATGTTCTTCCGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_103_replicate_2	CTATAGCAATGTTCTTCCGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_103_replicate_10	CTATAGCAATGTTCTTCCGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_103_replicate_1	CTATAGCAATGTTCTTCCGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_102_replicate_9	CTATAGCAATGTTCTTCCCCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_102_replicate_8	CTATAGCAATGTTCTTCCCCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_102_replicate_7	CTATAGCAATGTTCTTCCCCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_102_replicate_6	CTATAGCAATGTTCTTCCCCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_102_replicate_5	CTATAGCAATGTTCTTCCCCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_102_replicate_4	CTATAGCAATGTTCTTCCCCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_102_replicate_3	CTATAGCAATGTTCTTCCCCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_102_replicate_2	CTATAGCAATGTTCTTCCCCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_102_replicate_10	CTATAGCAATGTTCTTCCCCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_102_replicate_1	CTATAGCAATGTTCTTCCCCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_101_replicate_9	CTATAGCAATGTTCTTCCACTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_101_replicate_8	CTATAGCAATGTTCTTCCACTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_101_replicate_7	CTATAGCAATGTTCTTCCACTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_101_replicate_6	CTATAGCAATGTTCTTCCACTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_101_replicate_5	CTATAGCAATGTTCTTCCACTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_101_replicate_4	CTATAGCAATGTTCTTCCACTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_101_replicate_3	CTATAGCAATGTTCTTCCACTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_101_replicate_2	CTATAGCAATGTTCTTCCACTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_101_replicate_10	CTATAGCAATGTTCTTCCACTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_101_replicate_1	CTATAGCAATGTTCTTCCACTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_100_replicate_9	CTATAGCAATGTTCTTCATCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_100_replicate_8	CTATAGCAATGTTCTTCATCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_100_replicate_7	CTATAGCAATGTTCTTCATCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_100_replicate_6	CTATAGCAATGTTCTTCATCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_100_replicate_5	CTATAGCAATGTTCTTCATCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_100_replicate_4	CTATAGCAATGTTCTTCATCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_100_replicate_3	CTATAGCAATGTTCTTCATCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_100_replicate_2	CTATAGCAATGTTCTTCATCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_100_replicate_10	CTATAGCAATGTTCTTCATCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_100_replicate_1	CTATAGCAATGTTCTTCATCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_10_replicate_9	CTATAGCAATGGCCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_10_replicate_8	CTATAGCAATGGCCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_10_replicate_7	CTATAGCAATGGCCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_10_replicate_6	CTATAGCAATGGCCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_10_replicate_5	CTATAGCAATGGCCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_10_replicate_4	CTATAGCAATGGCCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_10_replicate_3	CTATAGCAATGGCCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_10_replicate_2	CTATAGCAATGGCCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_10_replicate_10	CTATAGCAATGGCCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_10_replicate_1	CTATAGCAATGGCCTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_1_replicate_9	CTATAGCAATGAACTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_1_replicate_8	CTATAGCAATGAACTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_1_replicate_7	CTATAGCAATGAACTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_1_replicate_6	CTATAGCAATGAACTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_1_replicate_5	CTATAGCAATGAACTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_1_replicate_4	CTATAGCAATGAACTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_1_replicate_3	CTATAGCAATGAACTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_1_replicate_2	CTATAGCAATGAACTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_1_replicate_10	CTATAGCAATGAACTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2041_dinucleotide_substitution_1_replicate_1	CTATAGCAATGAACTTCTGCTTGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_99_replicate_9	CTATAGCAATGTTGAAGAGGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_99_replicate_8	CTATAGCAATGTTGAAGAGGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_99_replicate_7	CTATAGCAATGTTGAAGAGGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_99_replicate_6	CTATAGCAATGTTGAAGAGGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_99_replicate_5	CTATAGCAATGTTGAAGAGGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_99_replicate_4	CTATAGCAATGTTGAAGAGGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_99_replicate_3	CTATAGCAATGTTGAAGAGGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_99_replicate_2	CTATAGCAATGTTGAAGAGGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_99_replicate_10	CTATAGCAATGTTGAAGAGGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_99_replicate_1	CTATAGCAATGTTGAAGAGGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_98_replicate_9	CTATAGCAATGTTGAAGACGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_98_replicate_8	CTATAGCAATGTTGAAGACGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_98_replicate_7	CTATAGCAATGTTGAAGACGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_98_replicate_6	CTATAGCAATGTTGAAGACGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_98_replicate_5	CTATAGCAATGTTGAAGACGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_98_replicate_4	CTATAGCAATGTTGAAGACGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_98_replicate_3	CTATAGCAATGTTGAAGACGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_98_replicate_2	CTATAGCAATGTTGAAGACGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_98_replicate_10	CTATAGCAATGTTGAAGACGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_98_replicate_1	CTATAGCAATGTTGAAGACGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_97_replicate_9	CTATAGCAATGTTGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_97_replicate_8	CTATAGCAATGTTGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_97_replicate_7	CTATAGCAATGTTGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_97_replicate_6	CTATAGCAATGTTGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_97_replicate_5	CTATAGCAATGTTGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_97_replicate_4	CTATAGCAATGTTGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_97_replicate_3	CTATAGCAATGTTGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_97_replicate_2	CTATAGCAATGTTGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_97_replicate_10	CTATAGCAATGTTGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_97_replicate_1	CTATAGCAATGTTGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_96_replicate_9	CTATAGCAATGTTGAATTAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_96_replicate_8	CTATAGCAATGTTGAATTAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_96_replicate_7	CTATAGCAATGTTGAATTAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_96_replicate_6	CTATAGCAATGTTGAATTAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_96_replicate_5	CTATAGCAATGTTGAATTAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_96_replicate_4	CTATAGCAATGTTGAATTAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_96_replicate_3	CTATAGCAATGTTGAATTAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_96_replicate_2	CTATAGCAATGTTGAATTAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_96_replicate_10	CTATAGCAATGTTGAATTAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_96_replicate_1	CTATAGCAATGTTGAATTAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_95_replicate_9	CTATAGCAATGTTGAATGAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_95_replicate_8	CTATAGCAATGTTGAATGAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_95_replicate_7	CTATAGCAATGTTGAATGAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_95_replicate_6	CTATAGCAATGTTGAATGAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_95_replicate_5	CTATAGCAATGTTGAATGAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_95_replicate_4	CTATAGCAATGTTGAATGAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_95_replicate_3	CTATAGCAATGTTGAATGAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_95_replicate_2	CTATAGCAATGTTGAATGAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_95_replicate_10	CTATAGCAATGTTGAATGAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_95_replicate_1	CTATAGCAATGTTGAATGAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_94_replicate_9	CTATAGCAATGTTGAATCAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_94_replicate_8	CTATAGCAATGTTGAATCAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_94_replicate_7	CTATAGCAATGTTGAATCAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_94_replicate_6	CTATAGCAATGTTGAATCAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_94_replicate_5	CTATAGCAATGTTGAATCAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_94_replicate_4	CTATAGCAATGTTGAATCAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_94_replicate_3	CTATAGCAATGTTGAATCAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_94_replicate_2	CTATAGCAATGTTGAATCAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_94_replicate_10	CTATAGCAATGTTGAATCAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_94_replicate_1	CTATAGCAATGTTGAATCAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_93_replicate_9	CTATAGCAATGTTGAATAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_93_replicate_8	CTATAGCAATGTTGAATAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_93_replicate_7	CTATAGCAATGTTGAATAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_93_replicate_6	CTATAGCAATGTTGAATAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_93_replicate_5	CTATAGCAATGTTGAATAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_93_replicate_4	CTATAGCAATGTTGAATAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_93_replicate_3	CTATAGCAATGTTGAATAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_93_replicate_2	CTATAGCAATGTTGAATAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_93_replicate_10	CTATAGCAATGTTGAATAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_93_replicate_1	CTATAGCAATGTTGAATAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_92_replicate_9	CTATAGCAATGTTGAAGTAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_92_replicate_8	CTATAGCAATGTTGAAGTAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_92_replicate_7	CTATAGCAATGTTGAAGTAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_92_replicate_6	CTATAGCAATGTTGAAGTAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_92_replicate_5	CTATAGCAATGTTGAAGTAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_92_replicate_4	CTATAGCAATGTTGAAGTAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_92_replicate_3	CTATAGCAATGTTGAAGTAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_92_replicate_2	CTATAGCAATGTTGAAGTAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_92_replicate_10	CTATAGCAATGTTGAAGTAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_92_replicate_1	CTATAGCAATGTTGAAGTAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_91_replicate_9	CTATAGCAATGTTGAAGGAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_91_replicate_8	CTATAGCAATGTTGAAGGAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_91_replicate_7	CTATAGCAATGTTGAAGGAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_91_replicate_6	CTATAGCAATGTTGAAGGAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_91_replicate_5	CTATAGCAATGTTGAAGGAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_91_replicate_4	CTATAGCAATGTTGAAGGAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_91_replicate_3	CTATAGCAATGTTGAAGGAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_91_replicate_2	CTATAGCAATGTTGAAGGAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_91_replicate_10	CTATAGCAATGTTGAAGGAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_91_replicate_1	CTATAGCAATGTTGAAGGAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_90_replicate_9	CTATAGCAATGTTGAAGCAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_90_replicate_8	CTATAGCAATGTTGAAGCAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_90_replicate_7	CTATAGCAATGTTGAAGCAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_90_replicate_6	CTATAGCAATGTTGAAGCAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_90_replicate_5	CTATAGCAATGTTGAAGCAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_90_replicate_4	CTATAGCAATGTTGAAGCAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_90_replicate_3	CTATAGCAATGTTGAAGCAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_90_replicate_2	CTATAGCAATGTTGAAGCAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_90_replicate_10	CTATAGCAATGTTGAAGCAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_90_replicate_1	CTATAGCAATGTTGAAGCAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_9_replicate_9	CTATAGCAATGGAGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_9_replicate_8	CTATAGCAATGGAGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_9_replicate_7	CTATAGCAATGGAGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_9_replicate_6	CTATAGCAATGGAGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_9_replicate_5	CTATAGCAATGGAGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_9_replicate_4	CTATAGCAATGGAGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_9_replicate_3	CTATAGCAATGGAGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_9_replicate_2	CTATAGCAATGGAGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_9_replicate_10	CTATAGCAATGGAGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_9_replicate_1	CTATAGCAATGGAGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_89_replicate_9	CTATAGCAATGTTGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_89_replicate_8	CTATAGCAATGTTGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_89_replicate_7	CTATAGCAATGTTGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_89_replicate_6	CTATAGCAATGTTGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_89_replicate_5	CTATAGCAATGTTGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_89_replicate_4	CTATAGCAATGTTGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_89_replicate_3	CTATAGCAATGTTGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_89_replicate_2	CTATAGCAATGTTGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_89_replicate_10	CTATAGCAATGTTGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_89_replicate_1	CTATAGCAATGTTGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_88_replicate_9	CTATAGCAATGTTGAACTAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_88_replicate_8	CTATAGCAATGTTGAACTAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_88_replicate_7	CTATAGCAATGTTGAACTAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_88_replicate_6	CTATAGCAATGTTGAACTAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_88_replicate_5	CTATAGCAATGTTGAACTAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_88_replicate_4	CTATAGCAATGTTGAACTAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_88_replicate_3	CTATAGCAATGTTGAACTAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_88_replicate_2	CTATAGCAATGTTGAACTAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_88_replicate_10	CTATAGCAATGTTGAACTAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_88_replicate_1	CTATAGCAATGTTGAACTAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_87_replicate_9	CTATAGCAATGTTGAACGAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_87_replicate_8	CTATAGCAATGTTGAACGAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_87_replicate_7	CTATAGCAATGTTGAACGAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_87_replicate_6	CTATAGCAATGTTGAACGAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_87_replicate_5	CTATAGCAATGTTGAACGAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_87_replicate_4	CTATAGCAATGTTGAACGAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_87_replicate_3	CTATAGCAATGTTGAACGAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_87_replicate_2	CTATAGCAATGTTGAACGAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_87_replicate_10	CTATAGCAATGTTGAACGAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_87_replicate_1	CTATAGCAATGTTGAACGAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_86_replicate_9	CTATAGCAATGTTGAACCAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_86_replicate_8	CTATAGCAATGTTGAACCAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_86_replicate_7	CTATAGCAATGTTGAACCAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_86_replicate_6	CTATAGCAATGTTGAACCAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_86_replicate_5	CTATAGCAATGTTGAACCAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_86_replicate_4	CTATAGCAATGTTGAACCAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_86_replicate_3	CTATAGCAATGTTGAACCAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_86_replicate_2	CTATAGCAATGTTGAACCAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_86_replicate_10	CTATAGCAATGTTGAACCAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_86_replicate_1	CTATAGCAATGTTGAACCAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_85_replicate_9	CTATAGCAATGTTGAACAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_85_replicate_8	CTATAGCAATGTTGAACAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_85_replicate_7	CTATAGCAATGTTGAACAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_85_replicate_6	CTATAGCAATGTTGAACAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_85_replicate_5	CTATAGCAATGTTGAACAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_85_replicate_4	CTATAGCAATGTTGAACAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_85_replicate_3	CTATAGCAATGTTGAACAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_85_replicate_2	CTATAGCAATGTTGAACAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_85_replicate_10	CTATAGCAATGTTGAACAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_85_replicate_1	CTATAGCAATGTTGAACAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_84_replicate_9	CTATAGCAATGTTGAAATAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_84_replicate_8	CTATAGCAATGTTGAAATAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_84_replicate_7	CTATAGCAATGTTGAAATAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_84_replicate_6	CTATAGCAATGTTGAAATAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_84_replicate_5	CTATAGCAATGTTGAAATAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_84_replicate_4	CTATAGCAATGTTGAAATAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_84_replicate_3	CTATAGCAATGTTGAAATAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_84_replicate_2	CTATAGCAATGTTGAAATAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_84_replicate_10	CTATAGCAATGTTGAAATAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_84_replicate_1	CTATAGCAATGTTGAAATAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_83_replicate_9	CTATAGCAATGTTGAAAGAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_83_replicate_8	CTATAGCAATGTTGAAAGAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_83_replicate_7	CTATAGCAATGTTGAAAGAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_83_replicate_6	CTATAGCAATGTTGAAAGAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_83_replicate_5	CTATAGCAATGTTGAAAGAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_83_replicate_4	CTATAGCAATGTTGAAAGAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_83_replicate_3	CTATAGCAATGTTGAAAGAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_83_replicate_2	CTATAGCAATGTTGAAAGAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_83_replicate_10	CTATAGCAATGTTGAAAGAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_83_replicate_1	CTATAGCAATGTTGAAAGAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_82_replicate_9	CTATAGCAATGTTGAAACAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_82_replicate_8	CTATAGCAATGTTGAAACAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_82_replicate_7	CTATAGCAATGTTGAAACAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_82_replicate_6	CTATAGCAATGTTGAAACAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_82_replicate_5	CTATAGCAATGTTGAAACAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_82_replicate_4	CTATAGCAATGTTGAAACAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_82_replicate_3	CTATAGCAATGTTGAAACAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_82_replicate_2	CTATAGCAATGTTGAAACAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_82_replicate_10	CTATAGCAATGTTGAAACAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_82_replicate_1	CTATAGCAATGTTGAAACAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_81_replicate_9	CTATAGCAATGTTGAAAAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_81_replicate_8	CTATAGCAATGTTGAAAAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_81_replicate_7	CTATAGCAATGTTGAAAAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_81_replicate_6	CTATAGCAATGTTGAAAAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_81_replicate_5	CTATAGCAATGTTGAAAAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_81_replicate_4	CTATAGCAATGTTGAAAAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_81_replicate_3	CTATAGCAATGTTGAAAAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_81_replicate_2	CTATAGCAATGTTGAAAAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_81_replicate_10	CTATAGCAATGTTGAAAAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_81_replicate_1	CTATAGCAATGTTGAAAAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_80_replicate_9	CTATAGCAATGTTGATTAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_80_replicate_8	CTATAGCAATGTTGATTAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_80_replicate_7	CTATAGCAATGTTGATTAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_80_replicate_6	CTATAGCAATGTTGATTAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_80_replicate_5	CTATAGCAATGTTGATTAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_80_replicate_4	CTATAGCAATGTTGATTAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_80_replicate_3	CTATAGCAATGTTGATTAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_80_replicate_2	CTATAGCAATGTTGATTAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_80_replicate_10	CTATAGCAATGTTGATTAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_80_replicate_1	CTATAGCAATGTTGATTAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_8_replicate_9	CTATAGCAATGCTGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_8_replicate_8	CTATAGCAATGCTGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_8_replicate_7	CTATAGCAATGCTGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_8_replicate_6	CTATAGCAATGCTGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_8_replicate_5	CTATAGCAATGCTGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_8_replicate_4	CTATAGCAATGCTGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_8_replicate_3	CTATAGCAATGCTGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_8_replicate_2	CTATAGCAATGCTGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_8_replicate_10	CTATAGCAATGCTGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_8_replicate_1	CTATAGCAATGCTGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_79_replicate_9	CTATAGCAATGTTGATGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_79_replicate_8	CTATAGCAATGTTGATGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_79_replicate_7	CTATAGCAATGTTGATGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_79_replicate_6	CTATAGCAATGTTGATGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_79_replicate_5	CTATAGCAATGTTGATGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_79_replicate_4	CTATAGCAATGTTGATGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_79_replicate_3	CTATAGCAATGTTGATGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_79_replicate_2	CTATAGCAATGTTGATGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_79_replicate_10	CTATAGCAATGTTGATGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_79_replicate_1	CTATAGCAATGTTGATGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_78_replicate_9	CTATAGCAATGTTGATCAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_78_replicate_8	CTATAGCAATGTTGATCAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_78_replicate_7	CTATAGCAATGTTGATCAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_78_replicate_6	CTATAGCAATGTTGATCAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_78_replicate_5	CTATAGCAATGTTGATCAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_78_replicate_4	CTATAGCAATGTTGATCAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_78_replicate_3	CTATAGCAATGTTGATCAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_78_replicate_2	CTATAGCAATGTTGATCAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_78_replicate_10	CTATAGCAATGTTGATCAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_78_replicate_1	CTATAGCAATGTTGATCAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_77_replicate_9	CTATAGCAATGTTGATAAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_77_replicate_8	CTATAGCAATGTTGATAAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_77_replicate_7	CTATAGCAATGTTGATAAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_77_replicate_6	CTATAGCAATGTTGATAAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_77_replicate_5	CTATAGCAATGTTGATAAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_77_replicate_4	CTATAGCAATGTTGATAAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_77_replicate_3	CTATAGCAATGTTGATAAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_77_replicate_2	CTATAGCAATGTTGATAAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_77_replicate_10	CTATAGCAATGTTGATAAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_77_replicate_1	CTATAGCAATGTTGATAAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_76_replicate_9	CTATAGCAATGTTGAGTAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_76_replicate_8	CTATAGCAATGTTGAGTAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_76_replicate_7	CTATAGCAATGTTGAGTAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_76_replicate_6	CTATAGCAATGTTGAGTAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_76_replicate_5	CTATAGCAATGTTGAGTAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_76_replicate_4	CTATAGCAATGTTGAGTAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_76_replicate_3	CTATAGCAATGTTGAGTAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_76_replicate_2	CTATAGCAATGTTGAGTAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_76_replicate_10	CTATAGCAATGTTGAGTAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_76_replicate_1	CTATAGCAATGTTGAGTAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_75_replicate_9	CTATAGCAATGTTGAGGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_75_replicate_8	CTATAGCAATGTTGAGGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_75_replicate_7	CTATAGCAATGTTGAGGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_75_replicate_6	CTATAGCAATGTTGAGGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_75_replicate_5	CTATAGCAATGTTGAGGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_75_replicate_4	CTATAGCAATGTTGAGGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_75_replicate_3	CTATAGCAATGTTGAGGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_75_replicate_2	CTATAGCAATGTTGAGGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_75_replicate_10	CTATAGCAATGTTGAGGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_75_replicate_1	CTATAGCAATGTTGAGGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_74_replicate_9	CTATAGCAATGTTGAGCAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_74_replicate_8	CTATAGCAATGTTGAGCAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_74_replicate_7	CTATAGCAATGTTGAGCAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_74_replicate_6	CTATAGCAATGTTGAGCAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_74_replicate_5	CTATAGCAATGTTGAGCAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_74_replicate_4	CTATAGCAATGTTGAGCAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_74_replicate_3	CTATAGCAATGTTGAGCAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_74_replicate_2	CTATAGCAATGTTGAGCAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_74_replicate_10	CTATAGCAATGTTGAGCAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_74_replicate_1	CTATAGCAATGTTGAGCAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_73_replicate_9	CTATAGCAATGTTGAGAAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_73_replicate_8	CTATAGCAATGTTGAGAAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_73_replicate_7	CTATAGCAATGTTGAGAAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_73_replicate_6	CTATAGCAATGTTGAGAAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_73_replicate_5	CTATAGCAATGTTGAGAAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_73_replicate_4	CTATAGCAATGTTGAGAAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_73_replicate_3	CTATAGCAATGTTGAGAAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_73_replicate_2	CTATAGCAATGTTGAGAAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_73_replicate_10	CTATAGCAATGTTGAGAAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_73_replicate_1	CTATAGCAATGTTGAGAAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_72_replicate_9	CTATAGCAATGTTGACTAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_72_replicate_8	CTATAGCAATGTTGACTAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_72_replicate_7	CTATAGCAATGTTGACTAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_72_replicate_6	CTATAGCAATGTTGACTAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_72_replicate_5	CTATAGCAATGTTGACTAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_72_replicate_4	CTATAGCAATGTTGACTAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_72_replicate_3	CTATAGCAATGTTGACTAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_72_replicate_2	CTATAGCAATGTTGACTAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_72_replicate_10	CTATAGCAATGTTGACTAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_72_replicate_1	CTATAGCAATGTTGACTAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_71_replicate_9	CTATAGCAATGTTGACGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_71_replicate_8	CTATAGCAATGTTGACGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_71_replicate_7	CTATAGCAATGTTGACGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_71_replicate_6	CTATAGCAATGTTGACGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_71_replicate_5	CTATAGCAATGTTGACGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_71_replicate_4	CTATAGCAATGTTGACGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_71_replicate_3	CTATAGCAATGTTGACGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_71_replicate_2	CTATAGCAATGTTGACGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_71_replicate_10	CTATAGCAATGTTGACGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_71_replicate_1	CTATAGCAATGTTGACGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_70_replicate_9	CTATAGCAATGTTGACCAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_70_replicate_8	CTATAGCAATGTTGACCAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_70_replicate_7	CTATAGCAATGTTGACCAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_70_replicate_6	CTATAGCAATGTTGACCAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_70_replicate_5	CTATAGCAATGTTGACCAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_70_replicate_4	CTATAGCAATGTTGACCAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_70_replicate_3	CTATAGCAATGTTGACCAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_70_replicate_2	CTATAGCAATGTTGACCAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_70_replicate_10	CTATAGCAATGTTGACCAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_70_replicate_1	CTATAGCAATGTTGACCAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_7_replicate_9	CTATAGCAATGCGGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_7_replicate_8	CTATAGCAATGCGGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_7_replicate_7	CTATAGCAATGCGGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_7_replicate_6	CTATAGCAATGCGGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_7_replicate_5	CTATAGCAATGCGGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_7_replicate_4	CTATAGCAATGCGGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_7_replicate_3	CTATAGCAATGCGGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_7_replicate_2	CTATAGCAATGCGGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_7_replicate_10	CTATAGCAATGCGGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_7_replicate_1	CTATAGCAATGCGGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_69_replicate_9	CTATAGCAATGTTGACAAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_69_replicate_8	CTATAGCAATGTTGACAAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_69_replicate_7	CTATAGCAATGTTGACAAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_69_replicate_6	CTATAGCAATGTTGACAAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_69_replicate_5	CTATAGCAATGTTGACAAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_69_replicate_4	CTATAGCAATGTTGACAAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_69_replicate_3	CTATAGCAATGTTGACAAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_69_replicate_2	CTATAGCAATGTTGACAAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_69_replicate_10	CTATAGCAATGTTGACAAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_69_replicate_1	CTATAGCAATGTTGACAAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_68_replicate_9	CTATAGCAATGTTGAATAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_68_replicate_8	CTATAGCAATGTTGAATAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_68_replicate_7	CTATAGCAATGTTGAATAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_68_replicate_6	CTATAGCAATGTTGAATAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_68_replicate_5	CTATAGCAATGTTGAATAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_68_replicate_4	CTATAGCAATGTTGAATAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_68_replicate_3	CTATAGCAATGTTGAATAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_68_replicate_2	CTATAGCAATGTTGAATAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_68_replicate_10	CTATAGCAATGTTGAATAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_68_replicate_1	CTATAGCAATGTTGAATAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_67_replicate_9	CTATAGCAATGTTGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_67_replicate_8	CTATAGCAATGTTGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_67_replicate_7	CTATAGCAATGTTGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_67_replicate_6	CTATAGCAATGTTGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_67_replicate_5	CTATAGCAATGTTGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_67_replicate_4	CTATAGCAATGTTGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_67_replicate_3	CTATAGCAATGTTGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_67_replicate_2	CTATAGCAATGTTGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_67_replicate_10	CTATAGCAATGTTGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_67_replicate_1	CTATAGCAATGTTGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_66_replicate_9	CTATAGCAATGTTGAACAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_66_replicate_8	CTATAGCAATGTTGAACAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_66_replicate_7	CTATAGCAATGTTGAACAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_66_replicate_6	CTATAGCAATGTTGAACAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_66_replicate_5	CTATAGCAATGTTGAACAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_66_replicate_4	CTATAGCAATGTTGAACAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_66_replicate_3	CTATAGCAATGTTGAACAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_66_replicate_2	CTATAGCAATGTTGAACAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_66_replicate_10	CTATAGCAATGTTGAACAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_66_replicate_1	CTATAGCAATGTTGAACAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_65_replicate_9	CTATAGCAATGTTGAAAAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_65_replicate_8	CTATAGCAATGTTGAAAAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_65_replicate_7	CTATAGCAATGTTGAAAAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_65_replicate_6	CTATAGCAATGTTGAAAAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_65_replicate_5	CTATAGCAATGTTGAAAAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_65_replicate_4	CTATAGCAATGTTGAAAAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_65_replicate_3	CTATAGCAATGTTGAAAAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_65_replicate_2	CTATAGCAATGTTGAAAAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_65_replicate_10	CTATAGCAATGTTGAAAAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_65_replicate_1	CTATAGCAATGTTGAAAAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_64_replicate_9	CTATAGCAATGTTGTTGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_64_replicate_8	CTATAGCAATGTTGTTGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_64_replicate_7	CTATAGCAATGTTGTTGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_64_replicate_6	CTATAGCAATGTTGTTGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_64_replicate_5	CTATAGCAATGTTGTTGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_64_replicate_4	CTATAGCAATGTTGTTGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_64_replicate_3	CTATAGCAATGTTGTTGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_64_replicate_2	CTATAGCAATGTTGTTGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_64_replicate_10	CTATAGCAATGTTGTTGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_64_replicate_1	CTATAGCAATGTTGTTGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_63_replicate_9	CTATAGCAATGTTGTGGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_63_replicate_8	CTATAGCAATGTTGTGGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_63_replicate_7	CTATAGCAATGTTGTGGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_63_replicate_6	CTATAGCAATGTTGTGGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_63_replicate_5	CTATAGCAATGTTGTGGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_63_replicate_4	CTATAGCAATGTTGTGGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_63_replicate_3	CTATAGCAATGTTGTGGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_63_replicate_2	CTATAGCAATGTTGTGGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_63_replicate_10	CTATAGCAATGTTGTGGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_63_replicate_1	CTATAGCAATGTTGTGGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_62_replicate_9	CTATAGCAATGTTGTCGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_62_replicate_8	CTATAGCAATGTTGTCGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_62_replicate_7	CTATAGCAATGTTGTCGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_62_replicate_6	CTATAGCAATGTTGTCGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_62_replicate_5	CTATAGCAATGTTGTCGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_62_replicate_4	CTATAGCAATGTTGTCGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_62_replicate_3	CTATAGCAATGTTGTCGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_62_replicate_2	CTATAGCAATGTTGTCGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_62_replicate_10	CTATAGCAATGTTGTCGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_62_replicate_1	CTATAGCAATGTTGTCGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_61_replicate_9	CTATAGCAATGTTGTAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_61_replicate_8	CTATAGCAATGTTGTAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_61_replicate_7	CTATAGCAATGTTGTAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_61_replicate_6	CTATAGCAATGTTGTAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_61_replicate_5	CTATAGCAATGTTGTAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_61_replicate_4	CTATAGCAATGTTGTAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_61_replicate_3	CTATAGCAATGTTGTAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_61_replicate_2	CTATAGCAATGTTGTAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_61_replicate_10	CTATAGCAATGTTGTAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_61_replicate_1	CTATAGCAATGTTGTAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_60_replicate_9	CTATAGCAATGTTGGTGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_60_replicate_8	CTATAGCAATGTTGGTGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_60_replicate_7	CTATAGCAATGTTGGTGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_60_replicate_6	CTATAGCAATGTTGGTGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_60_replicate_5	CTATAGCAATGTTGGTGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_60_replicate_4	CTATAGCAATGTTGGTGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_60_replicate_3	CTATAGCAATGTTGGTGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_60_replicate_2	CTATAGCAATGTTGGTGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_60_replicate_10	CTATAGCAATGTTGGTGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_60_replicate_1	CTATAGCAATGTTGGTGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_6_replicate_9	CTATAGCAATGCCGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_6_replicate_8	CTATAGCAATGCCGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_6_replicate_7	CTATAGCAATGCCGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_6_replicate_6	CTATAGCAATGCCGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_6_replicate_5	CTATAGCAATGCCGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_6_replicate_4	CTATAGCAATGCCGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_6_replicate_3	CTATAGCAATGCCGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_6_replicate_2	CTATAGCAATGCCGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_6_replicate_10	CTATAGCAATGCCGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_6_replicate_1	CTATAGCAATGCCGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_59_replicate_9	CTATAGCAATGTTGGGGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_59_replicate_8	CTATAGCAATGTTGGGGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_59_replicate_7	CTATAGCAATGTTGGGGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_59_replicate_6	CTATAGCAATGTTGGGGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_59_replicate_5	CTATAGCAATGTTGGGGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_59_replicate_4	CTATAGCAATGTTGGGGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_59_replicate_3	CTATAGCAATGTTGGGGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_59_replicate_2	CTATAGCAATGTTGGGGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_59_replicate_10	CTATAGCAATGTTGGGGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_59_replicate_1	CTATAGCAATGTTGGGGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_58_replicate_9	CTATAGCAATGTTGGCGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_58_replicate_8	CTATAGCAATGTTGGCGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_58_replicate_7	CTATAGCAATGTTGGCGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_58_replicate_6	CTATAGCAATGTTGGCGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_58_replicate_5	CTATAGCAATGTTGGCGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_58_replicate_4	CTATAGCAATGTTGGCGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_58_replicate_3	CTATAGCAATGTTGGCGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_58_replicate_2	CTATAGCAATGTTGGCGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_58_replicate_10	CTATAGCAATGTTGGCGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_58_replicate_1	CTATAGCAATGTTGGCGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_57_replicate_9	CTATAGCAATGTTGGAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_57_replicate_8	CTATAGCAATGTTGGAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_57_replicate_7	CTATAGCAATGTTGGAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_57_replicate_6	CTATAGCAATGTTGGAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_57_replicate_5	CTATAGCAATGTTGGAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_57_replicate_4	CTATAGCAATGTTGGAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_57_replicate_3	CTATAGCAATGTTGGAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_57_replicate_2	CTATAGCAATGTTGGAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_57_replicate_10	CTATAGCAATGTTGGAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_57_replicate_1	CTATAGCAATGTTGGAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_56_replicate_9	CTATAGCAATGTTGCTGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_56_replicate_8	CTATAGCAATGTTGCTGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_56_replicate_7	CTATAGCAATGTTGCTGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_56_replicate_6	CTATAGCAATGTTGCTGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_56_replicate_5	CTATAGCAATGTTGCTGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_56_replicate_4	CTATAGCAATGTTGCTGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_56_replicate_3	CTATAGCAATGTTGCTGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_56_replicate_2	CTATAGCAATGTTGCTGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_56_replicate_10	CTATAGCAATGTTGCTGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_56_replicate_1	CTATAGCAATGTTGCTGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_55_replicate_9	CTATAGCAATGTTGCGGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_55_replicate_8	CTATAGCAATGTTGCGGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_55_replicate_7	CTATAGCAATGTTGCGGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_55_replicate_6	CTATAGCAATGTTGCGGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_55_replicate_5	CTATAGCAATGTTGCGGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_55_replicate_4	CTATAGCAATGTTGCGGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_55_replicate_3	CTATAGCAATGTTGCGGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_55_replicate_2	CTATAGCAATGTTGCGGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_55_replicate_10	CTATAGCAATGTTGCGGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_55_replicate_1	CTATAGCAATGTTGCGGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_54_replicate_9	CTATAGCAATGTTGCCGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_54_replicate_8	CTATAGCAATGTTGCCGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_54_replicate_7	CTATAGCAATGTTGCCGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_54_replicate_6	CTATAGCAATGTTGCCGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_54_replicate_5	CTATAGCAATGTTGCCGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_54_replicate_4	CTATAGCAATGTTGCCGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_54_replicate_3	CTATAGCAATGTTGCCGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_54_replicate_2	CTATAGCAATGTTGCCGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_54_replicate_10	CTATAGCAATGTTGCCGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_54_replicate_1	CTATAGCAATGTTGCCGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_53_replicate_9	CTATAGCAATGTTGCAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_53_replicate_8	CTATAGCAATGTTGCAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_53_replicate_7	CTATAGCAATGTTGCAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_53_replicate_6	CTATAGCAATGTTGCAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_53_replicate_5	CTATAGCAATGTTGCAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_53_replicate_4	CTATAGCAATGTTGCAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_53_replicate_3	CTATAGCAATGTTGCAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_53_replicate_2	CTATAGCAATGTTGCAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_53_replicate_10	CTATAGCAATGTTGCAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_53_replicate_1	CTATAGCAATGTTGCAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_52_replicate_9	CTATAGCAATGTTGATGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_52_replicate_8	CTATAGCAATGTTGATGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_52_replicate_7	CTATAGCAATGTTGATGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_52_replicate_6	CTATAGCAATGTTGATGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_52_replicate_5	CTATAGCAATGTTGATGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_52_replicate_4	CTATAGCAATGTTGATGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_52_replicate_3	CTATAGCAATGTTGATGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_52_replicate_2	CTATAGCAATGTTGATGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_52_replicate_10	CTATAGCAATGTTGATGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_52_replicate_1	CTATAGCAATGTTGATGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_51_replicate_9	CTATAGCAATGTTGAGGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_51_replicate_8	CTATAGCAATGTTGAGGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_51_replicate_7	CTATAGCAATGTTGAGGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_51_replicate_6	CTATAGCAATGTTGAGGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_51_replicate_5	CTATAGCAATGTTGAGGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_51_replicate_4	CTATAGCAATGTTGAGGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_51_replicate_3	CTATAGCAATGTTGAGGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_51_replicate_2	CTATAGCAATGTTGAGGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_51_replicate_10	CTATAGCAATGTTGAGGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_51_replicate_1	CTATAGCAATGTTGAGGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_50_replicate_9	CTATAGCAATGTTGACGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_50_replicate_8	CTATAGCAATGTTGACGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_50_replicate_7	CTATAGCAATGTTGACGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_50_replicate_6	CTATAGCAATGTTGACGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_50_replicate_5	CTATAGCAATGTTGACGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_50_replicate_4	CTATAGCAATGTTGACGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_50_replicate_3	CTATAGCAATGTTGACGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_50_replicate_2	CTATAGCAATGTTGACGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_50_replicate_10	CTATAGCAATGTTGACGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_50_replicate_1	CTATAGCAATGTTGACGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_5_replicate_9	CTATAGCAATGCAGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_5_replicate_8	CTATAGCAATGCAGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_5_replicate_7	CTATAGCAATGCAGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_5_replicate_6	CTATAGCAATGCAGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_5_replicate_5	CTATAGCAATGCAGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_5_replicate_4	CTATAGCAATGCAGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_5_replicate_3	CTATAGCAATGCAGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_5_replicate_2	CTATAGCAATGCAGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_5_replicate_10	CTATAGCAATGCAGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_5_replicate_1	CTATAGCAATGCAGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_49_replicate_9	CTATAGCAATGTTGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_49_replicate_8	CTATAGCAATGTTGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_49_replicate_7	CTATAGCAATGTTGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_49_replicate_6	CTATAGCAATGTTGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_49_replicate_5	CTATAGCAATGTTGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_49_replicate_4	CTATAGCAATGTTGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_49_replicate_3	CTATAGCAATGTTGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_49_replicate_2	CTATAGCAATGTTGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_49_replicate_10	CTATAGCAATGTTGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_49_replicate_1	CTATAGCAATGTTGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_48_replicate_9	CTATAGCAATGTTTTAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_48_replicate_8	CTATAGCAATGTTTTAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_48_replicate_7	CTATAGCAATGTTTTAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_48_replicate_6	CTATAGCAATGTTTTAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_48_replicate_5	CTATAGCAATGTTTTAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_48_replicate_4	CTATAGCAATGTTTTAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_48_replicate_3	CTATAGCAATGTTTTAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_48_replicate_2	CTATAGCAATGTTTTAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_48_replicate_10	CTATAGCAATGTTTTAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_48_replicate_1	CTATAGCAATGTTTTAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_47_replicate_9	CTATAGCAATGTTTGAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_47_replicate_8	CTATAGCAATGTTTGAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_47_replicate_7	CTATAGCAATGTTTGAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_47_replicate_6	CTATAGCAATGTTTGAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_47_replicate_5	CTATAGCAATGTTTGAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_47_replicate_4	CTATAGCAATGTTTGAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_47_replicate_3	CTATAGCAATGTTTGAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_47_replicate_2	CTATAGCAATGTTTGAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_47_replicate_10	CTATAGCAATGTTTGAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_47_replicate_1	CTATAGCAATGTTTGAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_46_replicate_9	CTATAGCAATGTTTCAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_46_replicate_8	CTATAGCAATGTTTCAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_46_replicate_7	CTATAGCAATGTTTCAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_46_replicate_6	CTATAGCAATGTTTCAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_46_replicate_5	CTATAGCAATGTTTCAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_46_replicate_4	CTATAGCAATGTTTCAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_46_replicate_3	CTATAGCAATGTTTCAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_46_replicate_2	CTATAGCAATGTTTCAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_46_replicate_10	CTATAGCAATGTTTCAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_46_replicate_1	CTATAGCAATGTTTCAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_45_replicate_9	CTATAGCAATGTTTAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_45_replicate_8	CTATAGCAATGTTTAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_45_replicate_7	CTATAGCAATGTTTAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_45_replicate_6	CTATAGCAATGTTTAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_45_replicate_5	CTATAGCAATGTTTAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_45_replicate_4	CTATAGCAATGTTTAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_45_replicate_3	CTATAGCAATGTTTAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_45_replicate_2	CTATAGCAATGTTTAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_45_replicate_10	CTATAGCAATGTTTAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_45_replicate_1	CTATAGCAATGTTTAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_44_replicate_9	CTATAGCAATGTTGTAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_44_replicate_8	CTATAGCAATGTTGTAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_44_replicate_7	CTATAGCAATGTTGTAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_44_replicate_6	CTATAGCAATGTTGTAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_44_replicate_5	CTATAGCAATGTTGTAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_44_replicate_4	CTATAGCAATGTTGTAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_44_replicate_3	CTATAGCAATGTTGTAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_44_replicate_2	CTATAGCAATGTTGTAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_44_replicate_10	CTATAGCAATGTTGTAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_44_replicate_1	CTATAGCAATGTTGTAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_43_replicate_9	CTATAGCAATGTTGGAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_43_replicate_8	CTATAGCAATGTTGGAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_43_replicate_7	CTATAGCAATGTTGGAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_43_replicate_6	CTATAGCAATGTTGGAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_43_replicate_5	CTATAGCAATGTTGGAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_43_replicate_4	CTATAGCAATGTTGGAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_43_replicate_3	CTATAGCAATGTTGGAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_43_replicate_2	CTATAGCAATGTTGGAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_43_replicate_10	CTATAGCAATGTTGGAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_43_replicate_1	CTATAGCAATGTTGGAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_42_replicate_9	CTATAGCAATGTTGCAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_42_replicate_8	CTATAGCAATGTTGCAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_42_replicate_7	CTATAGCAATGTTGCAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_42_replicate_6	CTATAGCAATGTTGCAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_42_replicate_5	CTATAGCAATGTTGCAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_42_replicate_4	CTATAGCAATGTTGCAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_42_replicate_3	CTATAGCAATGTTGCAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_42_replicate_2	CTATAGCAATGTTGCAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_42_replicate_10	CTATAGCAATGTTGCAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_42_replicate_1	CTATAGCAATGTTGCAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_41_replicate_9	CTATAGCAATGTTGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_41_replicate_8	CTATAGCAATGTTGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_41_replicate_7	CTATAGCAATGTTGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_41_replicate_6	CTATAGCAATGTTGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_41_replicate_5	CTATAGCAATGTTGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_41_replicate_4	CTATAGCAATGTTGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_41_replicate_3	CTATAGCAATGTTGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_41_replicate_2	CTATAGCAATGTTGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_41_replicate_10	CTATAGCAATGTTGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_41_replicate_1	CTATAGCAATGTTGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_40_replicate_9	CTATAGCAATGTTCTAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_40_replicate_8	CTATAGCAATGTTCTAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_40_replicate_7	CTATAGCAATGTTCTAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_40_replicate_6	CTATAGCAATGTTCTAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_40_replicate_5	CTATAGCAATGTTCTAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_40_replicate_4	CTATAGCAATGTTCTAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_40_replicate_3	CTATAGCAATGTTCTAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_40_replicate_2	CTATAGCAATGTTCTAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_40_replicate_10	CTATAGCAATGTTCTAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_40_replicate_1	CTATAGCAATGTTCTAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_4_replicate_9	CTATAGCAATGATGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_4_replicate_8	CTATAGCAATGATGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_4_replicate_7	CTATAGCAATGATGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_4_replicate_6	CTATAGCAATGATGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_4_replicate_5	CTATAGCAATGATGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_4_replicate_4	CTATAGCAATGATGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_4_replicate_3	CTATAGCAATGATGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_4_replicate_2	CTATAGCAATGATGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_4_replicate_10	CTATAGCAATGATGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_4_replicate_1	CTATAGCAATGATGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_39_replicate_9	CTATAGCAATGTTCGAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_39_replicate_8	CTATAGCAATGTTCGAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_39_replicate_7	CTATAGCAATGTTCGAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_39_replicate_6	CTATAGCAATGTTCGAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_39_replicate_5	CTATAGCAATGTTCGAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_39_replicate_4	CTATAGCAATGTTCGAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_39_replicate_3	CTATAGCAATGTTCGAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_39_replicate_2	CTATAGCAATGTTCGAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_39_replicate_10	CTATAGCAATGTTCGAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_39_replicate_1	CTATAGCAATGTTCGAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_38_replicate_9	CTATAGCAATGTTCCAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_38_replicate_8	CTATAGCAATGTTCCAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_38_replicate_7	CTATAGCAATGTTCCAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_38_replicate_6	CTATAGCAATGTTCCAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_38_replicate_5	CTATAGCAATGTTCCAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_38_replicate_4	CTATAGCAATGTTCCAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_38_replicate_3	CTATAGCAATGTTCCAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_38_replicate_2	CTATAGCAATGTTCCAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_38_replicate_10	CTATAGCAATGTTCCAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_38_replicate_1	CTATAGCAATGTTCCAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_37_replicate_9	CTATAGCAATGTTCAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_37_replicate_8	CTATAGCAATGTTCAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_37_replicate_7	CTATAGCAATGTTCAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_37_replicate_6	CTATAGCAATGTTCAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_37_replicate_5	CTATAGCAATGTTCAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_37_replicate_4	CTATAGCAATGTTCAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_37_replicate_3	CTATAGCAATGTTCAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_37_replicate_2	CTATAGCAATGTTCAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_37_replicate_10	CTATAGCAATGTTCAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_37_replicate_1	CTATAGCAATGTTCAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_36_replicate_9	CTATAGCAATGTTATAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_36_replicate_8	CTATAGCAATGTTATAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_36_replicate_7	CTATAGCAATGTTATAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_36_replicate_6	CTATAGCAATGTTATAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_36_replicate_5	CTATAGCAATGTTATAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_36_replicate_4	CTATAGCAATGTTATAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_36_replicate_3	CTATAGCAATGTTATAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_36_replicate_2	CTATAGCAATGTTATAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_36_replicate_10	CTATAGCAATGTTATAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_36_replicate_1	CTATAGCAATGTTATAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_35_replicate_9	CTATAGCAATGTTAGAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_35_replicate_8	CTATAGCAATGTTAGAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_35_replicate_7	CTATAGCAATGTTAGAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_35_replicate_6	CTATAGCAATGTTAGAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_35_replicate_5	CTATAGCAATGTTAGAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_35_replicate_4	CTATAGCAATGTTAGAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_35_replicate_3	CTATAGCAATGTTAGAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_35_replicate_2	CTATAGCAATGTTAGAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_35_replicate_10	CTATAGCAATGTTAGAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_35_replicate_1	CTATAGCAATGTTAGAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_34_replicate_9	CTATAGCAATGTTACAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_34_replicate_8	CTATAGCAATGTTACAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_34_replicate_7	CTATAGCAATGTTACAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_34_replicate_6	CTATAGCAATGTTACAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_34_replicate_5	CTATAGCAATGTTACAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_34_replicate_4	CTATAGCAATGTTACAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_34_replicate_3	CTATAGCAATGTTACAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_34_replicate_2	CTATAGCAATGTTACAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_34_replicate_10	CTATAGCAATGTTACAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_34_replicate_1	CTATAGCAATGTTACAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_33_replicate_9	CTATAGCAATGTTAAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_33_replicate_8	CTATAGCAATGTTAAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_33_replicate_7	CTATAGCAATGTTAAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_33_replicate_6	CTATAGCAATGTTAAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_33_replicate_5	CTATAGCAATGTTAAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_33_replicate_4	CTATAGCAATGTTAAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_33_replicate_3	CTATAGCAATGTTAAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_33_replicate_2	CTATAGCAATGTTAAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_33_replicate_10	CTATAGCAATGTTAAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_33_replicate_1	CTATAGCAATGTTAAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_32_replicate_9	CTATAGCAATGTTTAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_32_replicate_8	CTATAGCAATGTTTAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_32_replicate_7	CTATAGCAATGTTTAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_32_replicate_6	CTATAGCAATGTTTAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_32_replicate_5	CTATAGCAATGTTTAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_32_replicate_4	CTATAGCAATGTTTAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_32_replicate_3	CTATAGCAATGTTTAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_32_replicate_2	CTATAGCAATGTTTAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_32_replicate_10	CTATAGCAATGTTTAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_32_replicate_1	CTATAGCAATGTTTAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_31_replicate_9	CTATAGCAATGTTGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_31_replicate_8	CTATAGCAATGTTGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_31_replicate_7	CTATAGCAATGTTGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_31_replicate_6	CTATAGCAATGTTGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_31_replicate_5	CTATAGCAATGTTGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_31_replicate_4	CTATAGCAATGTTGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_31_replicate_3	CTATAGCAATGTTGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_31_replicate_2	CTATAGCAATGTTGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_31_replicate_10	CTATAGCAATGTTGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_31_replicate_1	CTATAGCAATGTTGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_30_replicate_9	CTATAGCAATGTTCAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_30_replicate_8	CTATAGCAATGTTCAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_30_replicate_7	CTATAGCAATGTTCAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_30_replicate_6	CTATAGCAATGTTCAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_30_replicate_5	CTATAGCAATGTTCAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_30_replicate_4	CTATAGCAATGTTCAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_30_replicate_3	CTATAGCAATGTTCAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_30_replicate_2	CTATAGCAATGTTCAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_30_replicate_10	CTATAGCAATGTTCAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_30_replicate_1	CTATAGCAATGTTCAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_3_replicate_9	CTATAGCAATGAGGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_3_replicate_8	CTATAGCAATGAGGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_3_replicate_7	CTATAGCAATGAGGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_3_replicate_6	CTATAGCAATGAGGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_3_replicate_5	CTATAGCAATGAGGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_3_replicate_4	CTATAGCAATGAGGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_3_replicate_3	CTATAGCAATGAGGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_3_replicate_2	CTATAGCAATGAGGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_3_replicate_10	CTATAGCAATGAGGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_3_replicate_1	CTATAGCAATGAGGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_29_replicate_9	CTATAGCAATGTTAAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_29_replicate_8	CTATAGCAATGTTAAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_29_replicate_7	CTATAGCAATGTTAAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_29_replicate_6	CTATAGCAATGTTAAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_29_replicate_5	CTATAGCAATGTTAAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_29_replicate_4	CTATAGCAATGTTAAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_29_replicate_3	CTATAGCAATGTTAAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_29_replicate_2	CTATAGCAATGTTAAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_29_replicate_10	CTATAGCAATGTTAAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_29_replicate_1	CTATAGCAATGTTAAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_28_replicate_9	CTATAGCAATGTGTAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_28_replicate_8	CTATAGCAATGTGTAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_28_replicate_7	CTATAGCAATGTGTAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_28_replicate_6	CTATAGCAATGTGTAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_28_replicate_5	CTATAGCAATGTGTAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_28_replicate_4	CTATAGCAATGTGTAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_28_replicate_3	CTATAGCAATGTGTAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_28_replicate_2	CTATAGCAATGTGTAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_28_replicate_10	CTATAGCAATGTGTAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_28_replicate_1	CTATAGCAATGTGTAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_27_replicate_9	CTATAGCAATGTGGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_27_replicate_8	CTATAGCAATGTGGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_27_replicate_7	CTATAGCAATGTGGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_27_replicate_6	CTATAGCAATGTGGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_27_replicate_5	CTATAGCAATGTGGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_27_replicate_4	CTATAGCAATGTGGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_27_replicate_3	CTATAGCAATGTGGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_27_replicate_2	CTATAGCAATGTGGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_27_replicate_10	CTATAGCAATGTGGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_27_replicate_1	CTATAGCAATGTGGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_26_replicate_9	CTATAGCAATGTGCAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_26_replicate_8	CTATAGCAATGTGCAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_26_replicate_7	CTATAGCAATGTGCAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_26_replicate_6	CTATAGCAATGTGCAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_26_replicate_5	CTATAGCAATGTGCAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_26_replicate_4	CTATAGCAATGTGCAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_26_replicate_3	CTATAGCAATGTGCAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_26_replicate_2	CTATAGCAATGTGCAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_26_replicate_10	CTATAGCAATGTGCAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_26_replicate_1	CTATAGCAATGTGCAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_25_replicate_9	CTATAGCAATGTGAAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_25_replicate_8	CTATAGCAATGTGAAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_25_replicate_7	CTATAGCAATGTGAAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_25_replicate_6	CTATAGCAATGTGAAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_25_replicate_5	CTATAGCAATGTGAAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_25_replicate_4	CTATAGCAATGTGAAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_25_replicate_3	CTATAGCAATGTGAAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_25_replicate_2	CTATAGCAATGTGAAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_25_replicate_10	CTATAGCAATGTGAAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_25_replicate_1	CTATAGCAATGTGAAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_24_replicate_9	CTATAGCAATGTCTAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_24_replicate_8	CTATAGCAATGTCTAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_24_replicate_7	CTATAGCAATGTCTAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_24_replicate_6	CTATAGCAATGTCTAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_24_replicate_5	CTATAGCAATGTCTAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_24_replicate_4	CTATAGCAATGTCTAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_24_replicate_3	CTATAGCAATGTCTAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_24_replicate_2	CTATAGCAATGTCTAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_24_replicate_10	CTATAGCAATGTCTAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_24_replicate_1	CTATAGCAATGTCTAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_23_replicate_9	CTATAGCAATGTCGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_23_replicate_8	CTATAGCAATGTCGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_23_replicate_7	CTATAGCAATGTCGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_23_replicate_6	CTATAGCAATGTCGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_23_replicate_5	CTATAGCAATGTCGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_23_replicate_4	CTATAGCAATGTCGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_23_replicate_3	CTATAGCAATGTCGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_23_replicate_2	CTATAGCAATGTCGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_23_replicate_10	CTATAGCAATGTCGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_23_replicate_1	CTATAGCAATGTCGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_22_replicate_9	CTATAGCAATGTCCAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_22_replicate_8	CTATAGCAATGTCCAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_22_replicate_7	CTATAGCAATGTCCAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_22_replicate_6	CTATAGCAATGTCCAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_22_replicate_5	CTATAGCAATGTCCAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_22_replicate_4	CTATAGCAATGTCCAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_22_replicate_3	CTATAGCAATGTCCAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_22_replicate_2	CTATAGCAATGTCCAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_22_replicate_10	CTATAGCAATGTCCAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_22_replicate_1	CTATAGCAATGTCCAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_21_replicate_9	CTATAGCAATGTCAAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_21_replicate_8	CTATAGCAATGTCAAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_21_replicate_7	CTATAGCAATGTCAAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_21_replicate_6	CTATAGCAATGTCAAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_21_replicate_5	CTATAGCAATGTCAAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_21_replicate_4	CTATAGCAATGTCAAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_21_replicate_3	CTATAGCAATGTCAAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_21_replicate_2	CTATAGCAATGTCAAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_21_replicate_10	CTATAGCAATGTCAAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_21_replicate_1	CTATAGCAATGTCAAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_208_replicate_9	CTATAGCAATGTTGAAGAAGTCGTTCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_208_replicate_8	CTATAGCAATGTTGAAGAAGTCGTTCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_208_replicate_7	CTATAGCAATGTTGAAGAAGTCGTTCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_208_replicate_6	CTATAGCAATGTTGAAGAAGTCGTTCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_208_replicate_5	CTATAGCAATGTTGAAGAAGTCGTTCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_208_replicate_4	CTATAGCAATGTTGAAGAAGTCGTTCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_208_replicate_3	CTATAGCAATGTTGAAGAAGTCGTTCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_208_replicate_2	CTATAGCAATGTTGAAGAAGTCGTTCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_208_replicate_10	CTATAGCAATGTTGAAGAAGTCGTTCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_208_replicate_1	CTATAGCAATGTTGAAGAAGTCGTTCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_207_replicate_9	CTATAGCAATGTTGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_207_replicate_8	CTATAGCAATGTTGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_207_replicate_7	CTATAGCAATGTTGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_207_replicate_6	CTATAGCAATGTTGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_207_replicate_5	CTATAGCAATGTTGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_207_replicate_4	CTATAGCAATGTTGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_207_replicate_3	CTATAGCAATGTTGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_207_replicate_2	CTATAGCAATGTTGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_207_replicate_10	CTATAGCAATGTTGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_207_replicate_1	CTATAGCAATGTTGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_206_replicate_9	CTATAGCAATGTTGAAGAAGTCGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_206_replicate_8	CTATAGCAATGTTGAAGAAGTCGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_206_replicate_7	CTATAGCAATGTTGAAGAAGTCGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_206_replicate_6	CTATAGCAATGTTGAAGAAGTCGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_206_replicate_5	CTATAGCAATGTTGAAGAAGTCGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_206_replicate_4	CTATAGCAATGTTGAAGAAGTCGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_206_replicate_3	CTATAGCAATGTTGAAGAAGTCGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_206_replicate_2	CTATAGCAATGTTGAAGAAGTCGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_206_replicate_10	CTATAGCAATGTTGAAGAAGTCGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_206_replicate_1	CTATAGCAATGTTGAAGAAGTCGTCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_205_replicate_9	CTATAGCAATGTTGAAGAAGTCGTACATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_205_replicate_8	CTATAGCAATGTTGAAGAAGTCGTACATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_205_replicate_7	CTATAGCAATGTTGAAGAAGTCGTACATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_205_replicate_6	CTATAGCAATGTTGAAGAAGTCGTACATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_205_replicate_5	CTATAGCAATGTTGAAGAAGTCGTACATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_205_replicate_4	CTATAGCAATGTTGAAGAAGTCGTACATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_205_replicate_3	CTATAGCAATGTTGAAGAAGTCGTACATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_205_replicate_2	CTATAGCAATGTTGAAGAAGTCGTACATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_205_replicate_10	CTATAGCAATGTTGAAGAAGTCGTACATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_205_replicate_1	CTATAGCAATGTTGAAGAAGTCGTACATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_204_replicate_9	CTATAGCAATGTTGAAGAAGTCGGTCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_204_replicate_8	CTATAGCAATGTTGAAGAAGTCGGTCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_204_replicate_7	CTATAGCAATGTTGAAGAAGTCGGTCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_204_replicate_6	CTATAGCAATGTTGAAGAAGTCGGTCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_204_replicate_5	CTATAGCAATGTTGAAGAAGTCGGTCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_204_replicate_4	CTATAGCAATGTTGAAGAAGTCGGTCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_204_replicate_3	CTATAGCAATGTTGAAGAAGTCGGTCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_204_replicate_2	CTATAGCAATGTTGAAGAAGTCGGTCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_204_replicate_10	CTATAGCAATGTTGAAGAAGTCGGTCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_204_replicate_1	CTATAGCAATGTTGAAGAAGTCGGTCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_203_replicate_9	CTATAGCAATGTTGAAGAAGTCGGGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_203_replicate_8	CTATAGCAATGTTGAAGAAGTCGGGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_203_replicate_7	CTATAGCAATGTTGAAGAAGTCGGGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_203_replicate_6	CTATAGCAATGTTGAAGAAGTCGGGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_203_replicate_5	CTATAGCAATGTTGAAGAAGTCGGGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_203_replicate_4	CTATAGCAATGTTGAAGAAGTCGGGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_203_replicate_3	CTATAGCAATGTTGAAGAAGTCGGGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_203_replicate_2	CTATAGCAATGTTGAAGAAGTCGGGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_203_replicate_10	CTATAGCAATGTTGAAGAAGTCGGGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_203_replicate_1	CTATAGCAATGTTGAAGAAGTCGGGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_202_replicate_9	CTATAGCAATGTTGAAGAAGTCGGCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_202_replicate_8	CTATAGCAATGTTGAAGAAGTCGGCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_202_replicate_7	CTATAGCAATGTTGAAGAAGTCGGCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_202_replicate_6	CTATAGCAATGTTGAAGAAGTCGGCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_202_replicate_5	CTATAGCAATGTTGAAGAAGTCGGCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_202_replicate_4	CTATAGCAATGTTGAAGAAGTCGGCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_202_replicate_3	CTATAGCAATGTTGAAGAAGTCGGCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_202_replicate_2	CTATAGCAATGTTGAAGAAGTCGGCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_202_replicate_10	CTATAGCAATGTTGAAGAAGTCGGCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_202_replicate_1	CTATAGCAATGTTGAAGAAGTCGGCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_201_replicate_9	CTATAGCAATGTTGAAGAAGTCGGACATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_201_replicate_8	CTATAGCAATGTTGAAGAAGTCGGACATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_201_replicate_7	CTATAGCAATGTTGAAGAAGTCGGACATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_201_replicate_6	CTATAGCAATGTTGAAGAAGTCGGACATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_201_replicate_5	CTATAGCAATGTTGAAGAAGTCGGACATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_201_replicate_4	CTATAGCAATGTTGAAGAAGTCGGACATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_201_replicate_3	CTATAGCAATGTTGAAGAAGTCGGACATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_201_replicate_2	CTATAGCAATGTTGAAGAAGTCGGACATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_201_replicate_10	CTATAGCAATGTTGAAGAAGTCGGACATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_201_replicate_1	CTATAGCAATGTTGAAGAAGTCGGACATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_200_replicate_9	CTATAGCAATGTTGAAGAAGTCGCTCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_200_replicate_8	CTATAGCAATGTTGAAGAAGTCGCTCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_200_replicate_7	CTATAGCAATGTTGAAGAAGTCGCTCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_200_replicate_6	CTATAGCAATGTTGAAGAAGTCGCTCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_200_replicate_5	CTATAGCAATGTTGAAGAAGTCGCTCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_200_replicate_4	CTATAGCAATGTTGAAGAAGTCGCTCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_200_replicate_3	CTATAGCAATGTTGAAGAAGTCGCTCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_200_replicate_2	CTATAGCAATGTTGAAGAAGTCGCTCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_200_replicate_10	CTATAGCAATGTTGAAGAAGTCGCTCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_200_replicate_1	CTATAGCAATGTTGAAGAAGTCGCTCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_20_replicate_9	CTATAGCAATGTATAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_20_replicate_8	CTATAGCAATGTATAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_20_replicate_7	CTATAGCAATGTATAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_20_replicate_6	CTATAGCAATGTATAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_20_replicate_5	CTATAGCAATGTATAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_20_replicate_4	CTATAGCAATGTATAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_20_replicate_3	CTATAGCAATGTATAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_20_replicate_2	CTATAGCAATGTATAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_20_replicate_10	CTATAGCAATGTATAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_20_replicate_1	CTATAGCAATGTATAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_2_replicate_9	CTATAGCAATGACGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_2_replicate_8	CTATAGCAATGACGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_2_replicate_7	CTATAGCAATGACGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_2_replicate_6	CTATAGCAATGACGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_2_replicate_5	CTATAGCAATGACGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_2_replicate_4	CTATAGCAATGACGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_2_replicate_3	CTATAGCAATGACGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_2_replicate_2	CTATAGCAATGACGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_2_replicate_10	CTATAGCAATGACGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_2_replicate_1	CTATAGCAATGACGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_199_replicate_9	CTATAGCAATGTTGAAGAAGTCGCGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_199_replicate_8	CTATAGCAATGTTGAAGAAGTCGCGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_199_replicate_7	CTATAGCAATGTTGAAGAAGTCGCGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_199_replicate_6	CTATAGCAATGTTGAAGAAGTCGCGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_199_replicate_5	CTATAGCAATGTTGAAGAAGTCGCGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_199_replicate_4	CTATAGCAATGTTGAAGAAGTCGCGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_199_replicate_3	CTATAGCAATGTTGAAGAAGTCGCGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_199_replicate_2	CTATAGCAATGTTGAAGAAGTCGCGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_199_replicate_10	CTATAGCAATGTTGAAGAAGTCGCGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_199_replicate_1	CTATAGCAATGTTGAAGAAGTCGCGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_198_replicate_9	CTATAGCAATGTTGAAGAAGTCGCCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_198_replicate_8	CTATAGCAATGTTGAAGAAGTCGCCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_198_replicate_7	CTATAGCAATGTTGAAGAAGTCGCCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_198_replicate_6	CTATAGCAATGTTGAAGAAGTCGCCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_198_replicate_5	CTATAGCAATGTTGAAGAAGTCGCCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_198_replicate_4	CTATAGCAATGTTGAAGAAGTCGCCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_198_replicate_3	CTATAGCAATGTTGAAGAAGTCGCCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_198_replicate_2	CTATAGCAATGTTGAAGAAGTCGCCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_198_replicate_10	CTATAGCAATGTTGAAGAAGTCGCCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_198_replicate_1	CTATAGCAATGTTGAAGAAGTCGCCCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_197_replicate_9	CTATAGCAATGTTGAAGAAGTCGCACATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_197_replicate_8	CTATAGCAATGTTGAAGAAGTCGCACATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_197_replicate_7	CTATAGCAATGTTGAAGAAGTCGCACATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_197_replicate_6	CTATAGCAATGTTGAAGAAGTCGCACATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_197_replicate_5	CTATAGCAATGTTGAAGAAGTCGCACATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_197_replicate_4	CTATAGCAATGTTGAAGAAGTCGCACATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_197_replicate_3	CTATAGCAATGTTGAAGAAGTCGCACATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_197_replicate_2	CTATAGCAATGTTGAAGAAGTCGCACATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_197_replicate_10	CTATAGCAATGTTGAAGAAGTCGCACATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_197_replicate_1	CTATAGCAATGTTGAAGAAGTCGCACATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_196_replicate_9	CTATAGCAATGTTGAAGAAGTCGATCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_196_replicate_8	CTATAGCAATGTTGAAGAAGTCGATCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_196_replicate_7	CTATAGCAATGTTGAAGAAGTCGATCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_196_replicate_6	CTATAGCAATGTTGAAGAAGTCGATCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_196_replicate_5	CTATAGCAATGTTGAAGAAGTCGATCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_196_replicate_4	CTATAGCAATGTTGAAGAAGTCGATCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_196_replicate_3	CTATAGCAATGTTGAAGAAGTCGATCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_196_replicate_2	CTATAGCAATGTTGAAGAAGTCGATCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_196_replicate_10	CTATAGCAATGTTGAAGAAGTCGATCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_196_replicate_1	CTATAGCAATGTTGAAGAAGTCGATCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_195_replicate_9	CTATAGCAATGTTGAAGAAGTCGAGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_195_replicate_8	CTATAGCAATGTTGAAGAAGTCGAGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_195_replicate_7	CTATAGCAATGTTGAAGAAGTCGAGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_195_replicate_6	CTATAGCAATGTTGAAGAAGTCGAGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_195_replicate_5	CTATAGCAATGTTGAAGAAGTCGAGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_195_replicate_4	CTATAGCAATGTTGAAGAAGTCGAGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_195_replicate_3	CTATAGCAATGTTGAAGAAGTCGAGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_195_replicate_2	CTATAGCAATGTTGAAGAAGTCGAGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_195_replicate_10	CTATAGCAATGTTGAAGAAGTCGAGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_195_replicate_1	CTATAGCAATGTTGAAGAAGTCGAGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_194_replicate_9	CTATAGCAATGTTGAAGAAGTCGACCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_194_replicate_8	CTATAGCAATGTTGAAGAAGTCGACCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_194_replicate_7	CTATAGCAATGTTGAAGAAGTCGACCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_194_replicate_6	CTATAGCAATGTTGAAGAAGTCGACCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_194_replicate_5	CTATAGCAATGTTGAAGAAGTCGACCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_194_replicate_4	CTATAGCAATGTTGAAGAAGTCGACCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_194_replicate_3	CTATAGCAATGTTGAAGAAGTCGACCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_194_replicate_2	CTATAGCAATGTTGAAGAAGTCGACCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_194_replicate_10	CTATAGCAATGTTGAAGAAGTCGACCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_194_replicate_1	CTATAGCAATGTTGAAGAAGTCGACCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_193_replicate_9	CTATAGCAATGTTGAAGAAGTCGAACATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_193_replicate_8	CTATAGCAATGTTGAAGAAGTCGAACATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_193_replicate_7	CTATAGCAATGTTGAAGAAGTCGAACATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_193_replicate_6	CTATAGCAATGTTGAAGAAGTCGAACATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_193_replicate_5	CTATAGCAATGTTGAAGAAGTCGAACATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_193_replicate_4	CTATAGCAATGTTGAAGAAGTCGAACATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_193_replicate_3	CTATAGCAATGTTGAAGAAGTCGAACATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_193_replicate_2	CTATAGCAATGTTGAAGAAGTCGAACATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_193_replicate_10	CTATAGCAATGTTGAAGAAGTCGAACATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_193_replicate_1	CTATAGCAATGTTGAAGAAGTCGAACATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_192_replicate_9	CTATAGCAATGTTGAAGAAGTCTTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_192_replicate_8	CTATAGCAATGTTGAAGAAGTCTTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_192_replicate_7	CTATAGCAATGTTGAAGAAGTCTTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_192_replicate_6	CTATAGCAATGTTGAAGAAGTCTTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_192_replicate_5	CTATAGCAATGTTGAAGAAGTCTTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_192_replicate_4	CTATAGCAATGTTGAAGAAGTCTTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_192_replicate_3	CTATAGCAATGTTGAAGAAGTCTTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_192_replicate_2	CTATAGCAATGTTGAAGAAGTCTTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_192_replicate_10	CTATAGCAATGTTGAAGAAGTCTTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_192_replicate_1	CTATAGCAATGTTGAAGAAGTCTTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_191_replicate_9	CTATAGCAATGTTGAAGAAGTCTGGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_191_replicate_8	CTATAGCAATGTTGAAGAAGTCTGGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_191_replicate_7	CTATAGCAATGTTGAAGAAGTCTGGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_191_replicate_6	CTATAGCAATGTTGAAGAAGTCTGGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_191_replicate_5	CTATAGCAATGTTGAAGAAGTCTGGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_191_replicate_4	CTATAGCAATGTTGAAGAAGTCTGGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_191_replicate_3	CTATAGCAATGTTGAAGAAGTCTGGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_191_replicate_2	CTATAGCAATGTTGAAGAAGTCTGGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_191_replicate_10	CTATAGCAATGTTGAAGAAGTCTGGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_191_replicate_1	CTATAGCAATGTTGAAGAAGTCTGGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_190_replicate_9	CTATAGCAATGTTGAAGAAGTCTCGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_190_replicate_8	CTATAGCAATGTTGAAGAAGTCTCGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_190_replicate_7	CTATAGCAATGTTGAAGAAGTCTCGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_190_replicate_6	CTATAGCAATGTTGAAGAAGTCTCGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_190_replicate_5	CTATAGCAATGTTGAAGAAGTCTCGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_190_replicate_4	CTATAGCAATGTTGAAGAAGTCTCGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_190_replicate_3	CTATAGCAATGTTGAAGAAGTCTCGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_190_replicate_2	CTATAGCAATGTTGAAGAAGTCTCGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_190_replicate_10	CTATAGCAATGTTGAAGAAGTCTCGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_190_replicate_1	CTATAGCAATGTTGAAGAAGTCTCGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_19_replicate_9	CTATAGCAATGTAGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_19_replicate_8	CTATAGCAATGTAGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_19_replicate_7	CTATAGCAATGTAGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_19_replicate_6	CTATAGCAATGTAGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_19_replicate_5	CTATAGCAATGTAGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_19_replicate_4	CTATAGCAATGTAGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_19_replicate_3	CTATAGCAATGTAGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_19_replicate_2	CTATAGCAATGTAGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_19_replicate_10	CTATAGCAATGTAGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_19_replicate_1	CTATAGCAATGTAGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_189_replicate_9	CTATAGCAATGTTGAAGAAGTCTAGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_189_replicate_8	CTATAGCAATGTTGAAGAAGTCTAGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_189_replicate_7	CTATAGCAATGTTGAAGAAGTCTAGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_189_replicate_6	CTATAGCAATGTTGAAGAAGTCTAGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_189_replicate_5	CTATAGCAATGTTGAAGAAGTCTAGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_189_replicate_4	CTATAGCAATGTTGAAGAAGTCTAGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_189_replicate_3	CTATAGCAATGTTGAAGAAGTCTAGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_189_replicate_2	CTATAGCAATGTTGAAGAAGTCTAGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_189_replicate_10	CTATAGCAATGTTGAAGAAGTCTAGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_189_replicate_1	CTATAGCAATGTTGAAGAAGTCTAGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_188_replicate_9	CTATAGCAATGTTGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_188_replicate_8	CTATAGCAATGTTGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_188_replicate_7	CTATAGCAATGTTGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_188_replicate_6	CTATAGCAATGTTGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_188_replicate_5	CTATAGCAATGTTGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_188_replicate_4	CTATAGCAATGTTGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_188_replicate_3	CTATAGCAATGTTGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_188_replicate_2	CTATAGCAATGTTGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_188_replicate_10	CTATAGCAATGTTGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_188_replicate_1	CTATAGCAATGTTGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_187_replicate_9	CTATAGCAATGTTGAAGAAGTCGGGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_187_replicate_8	CTATAGCAATGTTGAAGAAGTCGGGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_187_replicate_7	CTATAGCAATGTTGAAGAAGTCGGGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_187_replicate_6	CTATAGCAATGTTGAAGAAGTCGGGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_187_replicate_5	CTATAGCAATGTTGAAGAAGTCGGGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_187_replicate_4	CTATAGCAATGTTGAAGAAGTCGGGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_187_replicate_3	CTATAGCAATGTTGAAGAAGTCGGGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_187_replicate_2	CTATAGCAATGTTGAAGAAGTCGGGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_187_replicate_10	CTATAGCAATGTTGAAGAAGTCGGGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_187_replicate_1	CTATAGCAATGTTGAAGAAGTCGGGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_186_replicate_9	CTATAGCAATGTTGAAGAAGTCGCGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_186_replicate_8	CTATAGCAATGTTGAAGAAGTCGCGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_186_replicate_7	CTATAGCAATGTTGAAGAAGTCGCGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_186_replicate_6	CTATAGCAATGTTGAAGAAGTCGCGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_186_replicate_5	CTATAGCAATGTTGAAGAAGTCGCGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_186_replicate_4	CTATAGCAATGTTGAAGAAGTCGCGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_186_replicate_3	CTATAGCAATGTTGAAGAAGTCGCGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_186_replicate_2	CTATAGCAATGTTGAAGAAGTCGCGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_186_replicate_10	CTATAGCAATGTTGAAGAAGTCGCGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_186_replicate_1	CTATAGCAATGTTGAAGAAGTCGCGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_185_replicate_9	CTATAGCAATGTTGAAGAAGTCGAGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_185_replicate_8	CTATAGCAATGTTGAAGAAGTCGAGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_185_replicate_7	CTATAGCAATGTTGAAGAAGTCGAGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_185_replicate_6	CTATAGCAATGTTGAAGAAGTCGAGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_185_replicate_5	CTATAGCAATGTTGAAGAAGTCGAGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_185_replicate_4	CTATAGCAATGTTGAAGAAGTCGAGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_185_replicate_3	CTATAGCAATGTTGAAGAAGTCGAGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_185_replicate_2	CTATAGCAATGTTGAAGAAGTCGAGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_185_replicate_10	CTATAGCAATGTTGAAGAAGTCGAGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_185_replicate_1	CTATAGCAATGTTGAAGAAGTCGAGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_184_replicate_9	CTATAGCAATGTTGAAGAAGTCCTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_184_replicate_8	CTATAGCAATGTTGAAGAAGTCCTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_184_replicate_7	CTATAGCAATGTTGAAGAAGTCCTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_184_replicate_6	CTATAGCAATGTTGAAGAAGTCCTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_184_replicate_5	CTATAGCAATGTTGAAGAAGTCCTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_184_replicate_4	CTATAGCAATGTTGAAGAAGTCCTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_184_replicate_3	CTATAGCAATGTTGAAGAAGTCCTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_184_replicate_2	CTATAGCAATGTTGAAGAAGTCCTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_184_replicate_10	CTATAGCAATGTTGAAGAAGTCCTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_184_replicate_1	CTATAGCAATGTTGAAGAAGTCCTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_183_replicate_9	CTATAGCAATGTTGAAGAAGTCCGGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_183_replicate_8	CTATAGCAATGTTGAAGAAGTCCGGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_183_replicate_7	CTATAGCAATGTTGAAGAAGTCCGGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_183_replicate_6	CTATAGCAATGTTGAAGAAGTCCGGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_183_replicate_5	CTATAGCAATGTTGAAGAAGTCCGGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_183_replicate_4	CTATAGCAATGTTGAAGAAGTCCGGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_183_replicate_3	CTATAGCAATGTTGAAGAAGTCCGGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_183_replicate_2	CTATAGCAATGTTGAAGAAGTCCGGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_183_replicate_10	CTATAGCAATGTTGAAGAAGTCCGGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_183_replicate_1	CTATAGCAATGTTGAAGAAGTCCGGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_182_replicate_9	CTATAGCAATGTTGAAGAAGTCCCGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_182_replicate_8	CTATAGCAATGTTGAAGAAGTCCCGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_182_replicate_7	CTATAGCAATGTTGAAGAAGTCCCGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_182_replicate_6	CTATAGCAATGTTGAAGAAGTCCCGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_182_replicate_5	CTATAGCAATGTTGAAGAAGTCCCGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_182_replicate_4	CTATAGCAATGTTGAAGAAGTCCCGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_182_replicate_3	CTATAGCAATGTTGAAGAAGTCCCGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_182_replicate_2	CTATAGCAATGTTGAAGAAGTCCCGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_182_replicate_10	CTATAGCAATGTTGAAGAAGTCCCGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_182_replicate_1	CTATAGCAATGTTGAAGAAGTCCCGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_181_replicate_9	CTATAGCAATGTTGAAGAAGTCCAGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_181_replicate_8	CTATAGCAATGTTGAAGAAGTCCAGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_181_replicate_7	CTATAGCAATGTTGAAGAAGTCCAGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_181_replicate_6	CTATAGCAATGTTGAAGAAGTCCAGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_181_replicate_5	CTATAGCAATGTTGAAGAAGTCCAGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_181_replicate_4	CTATAGCAATGTTGAAGAAGTCCAGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_181_replicate_3	CTATAGCAATGTTGAAGAAGTCCAGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_181_replicate_2	CTATAGCAATGTTGAAGAAGTCCAGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_181_replicate_10	CTATAGCAATGTTGAAGAAGTCCAGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_181_replicate_1	CTATAGCAATGTTGAAGAAGTCCAGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_180_replicate_9	CTATAGCAATGTTGAAGAAGTCATGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_180_replicate_8	CTATAGCAATGTTGAAGAAGTCATGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_180_replicate_7	CTATAGCAATGTTGAAGAAGTCATGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_180_replicate_6	CTATAGCAATGTTGAAGAAGTCATGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_180_replicate_5	CTATAGCAATGTTGAAGAAGTCATGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_180_replicate_4	CTATAGCAATGTTGAAGAAGTCATGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_180_replicate_3	CTATAGCAATGTTGAAGAAGTCATGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_180_replicate_2	CTATAGCAATGTTGAAGAAGTCATGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_180_replicate_10	CTATAGCAATGTTGAAGAAGTCATGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_180_replicate_1	CTATAGCAATGTTGAAGAAGTCATGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_18_replicate_9	CTATAGCAATGTACAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_18_replicate_8	CTATAGCAATGTACAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_18_replicate_7	CTATAGCAATGTACAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_18_replicate_6	CTATAGCAATGTACAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_18_replicate_5	CTATAGCAATGTACAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_18_replicate_4	CTATAGCAATGTACAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_18_replicate_3	CTATAGCAATGTACAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_18_replicate_2	CTATAGCAATGTACAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_18_replicate_10	CTATAGCAATGTACAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_18_replicate_1	CTATAGCAATGTACAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_179_replicate_9	CTATAGCAATGTTGAAGAAGTCAGGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_179_replicate_8	CTATAGCAATGTTGAAGAAGTCAGGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_179_replicate_7	CTATAGCAATGTTGAAGAAGTCAGGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_179_replicate_6	CTATAGCAATGTTGAAGAAGTCAGGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_179_replicate_5	CTATAGCAATGTTGAAGAAGTCAGGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_179_replicate_4	CTATAGCAATGTTGAAGAAGTCAGGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_179_replicate_3	CTATAGCAATGTTGAAGAAGTCAGGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_179_replicate_2	CTATAGCAATGTTGAAGAAGTCAGGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_179_replicate_10	CTATAGCAATGTTGAAGAAGTCAGGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_179_replicate_1	CTATAGCAATGTTGAAGAAGTCAGGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_178_replicate_9	CTATAGCAATGTTGAAGAAGTCACGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_178_replicate_8	CTATAGCAATGTTGAAGAAGTCACGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_178_replicate_7	CTATAGCAATGTTGAAGAAGTCACGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_178_replicate_6	CTATAGCAATGTTGAAGAAGTCACGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_178_replicate_5	CTATAGCAATGTTGAAGAAGTCACGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_178_replicate_4	CTATAGCAATGTTGAAGAAGTCACGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_178_replicate_3	CTATAGCAATGTTGAAGAAGTCACGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_178_replicate_2	CTATAGCAATGTTGAAGAAGTCACGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_178_replicate_10	CTATAGCAATGTTGAAGAAGTCACGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_178_replicate_1	CTATAGCAATGTTGAAGAAGTCACGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_177_replicate_9	CTATAGCAATGTTGAAGAAGTCAAGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_177_replicate_8	CTATAGCAATGTTGAAGAAGTCAAGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_177_replicate_7	CTATAGCAATGTTGAAGAAGTCAAGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_177_replicate_6	CTATAGCAATGTTGAAGAAGTCAAGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_177_replicate_5	CTATAGCAATGTTGAAGAAGTCAAGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_177_replicate_4	CTATAGCAATGTTGAAGAAGTCAAGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_177_replicate_3	CTATAGCAATGTTGAAGAAGTCAAGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_177_replicate_2	CTATAGCAATGTTGAAGAAGTCAAGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_177_replicate_10	CTATAGCAATGTTGAAGAAGTCAAGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_177_replicate_1	CTATAGCAATGTTGAAGAAGTCAAGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_176_replicate_9	CTATAGCAATGTTGAAGAAGTTTTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_176_replicate_8	CTATAGCAATGTTGAAGAAGTTTTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_176_replicate_7	CTATAGCAATGTTGAAGAAGTTTTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_176_replicate_6	CTATAGCAATGTTGAAGAAGTTTTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_176_replicate_5	CTATAGCAATGTTGAAGAAGTTTTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_176_replicate_4	CTATAGCAATGTTGAAGAAGTTTTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_176_replicate_3	CTATAGCAATGTTGAAGAAGTTTTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_176_replicate_2	CTATAGCAATGTTGAAGAAGTTTTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_176_replicate_10	CTATAGCAATGTTGAAGAAGTTTTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_176_replicate_1	CTATAGCAATGTTGAAGAAGTTTTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_175_replicate_9	CTATAGCAATGTTGAAGAAGTTGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_175_replicate_8	CTATAGCAATGTTGAAGAAGTTGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_175_replicate_7	CTATAGCAATGTTGAAGAAGTTGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_175_replicate_6	CTATAGCAATGTTGAAGAAGTTGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_175_replicate_5	CTATAGCAATGTTGAAGAAGTTGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_175_replicate_4	CTATAGCAATGTTGAAGAAGTTGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_175_replicate_3	CTATAGCAATGTTGAAGAAGTTGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_175_replicate_2	CTATAGCAATGTTGAAGAAGTTGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_175_replicate_10	CTATAGCAATGTTGAAGAAGTTGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_175_replicate_1	CTATAGCAATGTTGAAGAAGTTGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_174_replicate_9	CTATAGCAATGTTGAAGAAGTTCTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_174_replicate_8	CTATAGCAATGTTGAAGAAGTTCTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_174_replicate_7	CTATAGCAATGTTGAAGAAGTTCTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_174_replicate_6	CTATAGCAATGTTGAAGAAGTTCTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_174_replicate_5	CTATAGCAATGTTGAAGAAGTTCTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_174_replicate_4	CTATAGCAATGTTGAAGAAGTTCTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_174_replicate_3	CTATAGCAATGTTGAAGAAGTTCTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_174_replicate_2	CTATAGCAATGTTGAAGAAGTTCTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_174_replicate_10	CTATAGCAATGTTGAAGAAGTTCTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_174_replicate_1	CTATAGCAATGTTGAAGAAGTTCTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_173_replicate_9	CTATAGCAATGTTGAAGAAGTTATGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_173_replicate_8	CTATAGCAATGTTGAAGAAGTTATGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_173_replicate_7	CTATAGCAATGTTGAAGAAGTTATGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_173_replicate_6	CTATAGCAATGTTGAAGAAGTTATGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_173_replicate_5	CTATAGCAATGTTGAAGAAGTTATGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_173_replicate_4	CTATAGCAATGTTGAAGAAGTTATGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_173_replicate_3	CTATAGCAATGTTGAAGAAGTTATGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_173_replicate_2	CTATAGCAATGTTGAAGAAGTTATGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_173_replicate_10	CTATAGCAATGTTGAAGAAGTTATGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_173_replicate_1	CTATAGCAATGTTGAAGAAGTTATGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_172_replicate_9	CTATAGCAATGTTGAAGAAGTGTTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_172_replicate_8	CTATAGCAATGTTGAAGAAGTGTTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_172_replicate_7	CTATAGCAATGTTGAAGAAGTGTTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_172_replicate_6	CTATAGCAATGTTGAAGAAGTGTTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_172_replicate_5	CTATAGCAATGTTGAAGAAGTGTTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_172_replicate_4	CTATAGCAATGTTGAAGAAGTGTTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_172_replicate_3	CTATAGCAATGTTGAAGAAGTGTTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_172_replicate_2	CTATAGCAATGTTGAAGAAGTGTTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_172_replicate_10	CTATAGCAATGTTGAAGAAGTGTTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_172_replicate_1	CTATAGCAATGTTGAAGAAGTGTTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_171_replicate_9	CTATAGCAATGTTGAAGAAGTGGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_171_replicate_8	CTATAGCAATGTTGAAGAAGTGGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_171_replicate_7	CTATAGCAATGTTGAAGAAGTGGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_171_replicate_6	CTATAGCAATGTTGAAGAAGTGGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_171_replicate_5	CTATAGCAATGTTGAAGAAGTGGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_171_replicate_4	CTATAGCAATGTTGAAGAAGTGGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_171_replicate_3	CTATAGCAATGTTGAAGAAGTGGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_171_replicate_2	CTATAGCAATGTTGAAGAAGTGGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_171_replicate_10	CTATAGCAATGTTGAAGAAGTGGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_171_replicate_1	CTATAGCAATGTTGAAGAAGTGGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_170_replicate_9	CTATAGCAATGTTGAAGAAGTGCTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_170_replicate_8	CTATAGCAATGTTGAAGAAGTGCTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_170_replicate_7	CTATAGCAATGTTGAAGAAGTGCTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_170_replicate_6	CTATAGCAATGTTGAAGAAGTGCTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_170_replicate_5	CTATAGCAATGTTGAAGAAGTGCTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_170_replicate_4	CTATAGCAATGTTGAAGAAGTGCTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_170_replicate_3	CTATAGCAATGTTGAAGAAGTGCTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_170_replicate_2	CTATAGCAATGTTGAAGAAGTGCTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_170_replicate_10	CTATAGCAATGTTGAAGAAGTGCTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_170_replicate_1	CTATAGCAATGTTGAAGAAGTGCTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_17_replicate_9	CTATAGCAATGTAAAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_17_replicate_8	CTATAGCAATGTAAAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_17_replicate_7	CTATAGCAATGTAAAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_17_replicate_6	CTATAGCAATGTAAAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_17_replicate_5	CTATAGCAATGTAAAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_17_replicate_4	CTATAGCAATGTAAAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_17_replicate_3	CTATAGCAATGTAAAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_17_replicate_2	CTATAGCAATGTAAAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_17_replicate_10	CTATAGCAATGTAAAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_17_replicate_1	CTATAGCAATGTAAAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_169_replicate_9	CTATAGCAATGTTGAAGAAGTGATGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_169_replicate_8	CTATAGCAATGTTGAAGAAGTGATGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_169_replicate_7	CTATAGCAATGTTGAAGAAGTGATGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_169_replicate_6	CTATAGCAATGTTGAAGAAGTGATGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_169_replicate_5	CTATAGCAATGTTGAAGAAGTGATGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_169_replicate_4	CTATAGCAATGTTGAAGAAGTGATGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_169_replicate_3	CTATAGCAATGTTGAAGAAGTGATGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_169_replicate_2	CTATAGCAATGTTGAAGAAGTGATGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_169_replicate_10	CTATAGCAATGTTGAAGAAGTGATGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_169_replicate_1	CTATAGCAATGTTGAAGAAGTGATGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_168_replicate_9	CTATAGCAATGTTGAAGAAGTCTTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_168_replicate_8	CTATAGCAATGTTGAAGAAGTCTTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_168_replicate_7	CTATAGCAATGTTGAAGAAGTCTTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_168_replicate_6	CTATAGCAATGTTGAAGAAGTCTTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_168_replicate_5	CTATAGCAATGTTGAAGAAGTCTTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_168_replicate_4	CTATAGCAATGTTGAAGAAGTCTTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_168_replicate_3	CTATAGCAATGTTGAAGAAGTCTTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_168_replicate_2	CTATAGCAATGTTGAAGAAGTCTTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_168_replicate_10	CTATAGCAATGTTGAAGAAGTCTTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_168_replicate_1	CTATAGCAATGTTGAAGAAGTCTTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_167_replicate_9	CTATAGCAATGTTGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_167_replicate_8	CTATAGCAATGTTGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_167_replicate_7	CTATAGCAATGTTGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_167_replicate_6	CTATAGCAATGTTGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_167_replicate_5	CTATAGCAATGTTGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_167_replicate_4	CTATAGCAATGTTGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_167_replicate_3	CTATAGCAATGTTGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_167_replicate_2	CTATAGCAATGTTGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_167_replicate_10	CTATAGCAATGTTGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_167_replicate_1	CTATAGCAATGTTGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_166_replicate_9	CTATAGCAATGTTGAAGAAGTCCTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_166_replicate_8	CTATAGCAATGTTGAAGAAGTCCTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_166_replicate_7	CTATAGCAATGTTGAAGAAGTCCTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_166_replicate_6	CTATAGCAATGTTGAAGAAGTCCTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_166_replicate_5	CTATAGCAATGTTGAAGAAGTCCTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_166_replicate_4	CTATAGCAATGTTGAAGAAGTCCTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_166_replicate_3	CTATAGCAATGTTGAAGAAGTCCTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_166_replicate_2	CTATAGCAATGTTGAAGAAGTCCTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_166_replicate_10	CTATAGCAATGTTGAAGAAGTCCTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_166_replicate_1	CTATAGCAATGTTGAAGAAGTCCTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_165_replicate_9	CTATAGCAATGTTGAAGAAGTCATGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_165_replicate_8	CTATAGCAATGTTGAAGAAGTCATGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_165_replicate_7	CTATAGCAATGTTGAAGAAGTCATGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_165_replicate_6	CTATAGCAATGTTGAAGAAGTCATGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_165_replicate_5	CTATAGCAATGTTGAAGAAGTCATGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_165_replicate_4	CTATAGCAATGTTGAAGAAGTCATGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_165_replicate_3	CTATAGCAATGTTGAAGAAGTCATGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_165_replicate_2	CTATAGCAATGTTGAAGAAGTCATGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_165_replicate_10	CTATAGCAATGTTGAAGAAGTCATGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_165_replicate_1	CTATAGCAATGTTGAAGAAGTCATGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_164_replicate_9	CTATAGCAATGTTGAAGAAGTATTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_164_replicate_8	CTATAGCAATGTTGAAGAAGTATTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_164_replicate_7	CTATAGCAATGTTGAAGAAGTATTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_164_replicate_6	CTATAGCAATGTTGAAGAAGTATTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_164_replicate_5	CTATAGCAATGTTGAAGAAGTATTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_164_replicate_4	CTATAGCAATGTTGAAGAAGTATTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_164_replicate_3	CTATAGCAATGTTGAAGAAGTATTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_164_replicate_2	CTATAGCAATGTTGAAGAAGTATTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_164_replicate_10	CTATAGCAATGTTGAAGAAGTATTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_164_replicate_1	CTATAGCAATGTTGAAGAAGTATTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_163_replicate_9	CTATAGCAATGTTGAAGAAGTAGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_163_replicate_8	CTATAGCAATGTTGAAGAAGTAGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_163_replicate_7	CTATAGCAATGTTGAAGAAGTAGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_163_replicate_6	CTATAGCAATGTTGAAGAAGTAGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_163_replicate_5	CTATAGCAATGTTGAAGAAGTAGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_163_replicate_4	CTATAGCAATGTTGAAGAAGTAGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_163_replicate_3	CTATAGCAATGTTGAAGAAGTAGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_163_replicate_2	CTATAGCAATGTTGAAGAAGTAGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_163_replicate_10	CTATAGCAATGTTGAAGAAGTAGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_163_replicate_1	CTATAGCAATGTTGAAGAAGTAGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_162_replicate_9	CTATAGCAATGTTGAAGAAGTACTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_162_replicate_8	CTATAGCAATGTTGAAGAAGTACTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_162_replicate_7	CTATAGCAATGTTGAAGAAGTACTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_162_replicate_6	CTATAGCAATGTTGAAGAAGTACTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_162_replicate_5	CTATAGCAATGTTGAAGAAGTACTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_162_replicate_4	CTATAGCAATGTTGAAGAAGTACTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_162_replicate_3	CTATAGCAATGTTGAAGAAGTACTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_162_replicate_2	CTATAGCAATGTTGAAGAAGTACTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_162_replicate_10	CTATAGCAATGTTGAAGAAGTACTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_162_replicate_1	CTATAGCAATGTTGAAGAAGTACTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_161_replicate_9	CTATAGCAATGTTGAAGAAGTAATGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_161_replicate_8	CTATAGCAATGTTGAAGAAGTAATGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_161_replicate_7	CTATAGCAATGTTGAAGAAGTAATGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_161_replicate_6	CTATAGCAATGTTGAAGAAGTAATGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_161_replicate_5	CTATAGCAATGTTGAAGAAGTAATGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_161_replicate_4	CTATAGCAATGTTGAAGAAGTAATGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_161_replicate_3	CTATAGCAATGTTGAAGAAGTAATGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_161_replicate_2	CTATAGCAATGTTGAAGAAGTAATGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_161_replicate_10	CTATAGCAATGTTGAAGAAGTAATGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_161_replicate_1	CTATAGCAATGTTGAAGAAGTAATGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_160_replicate_9	CTATAGCAATGTTGAAGAAGTTGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_160_replicate_8	CTATAGCAATGTTGAAGAAGTTGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_160_replicate_7	CTATAGCAATGTTGAAGAAGTTGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_160_replicate_6	CTATAGCAATGTTGAAGAAGTTGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_160_replicate_5	CTATAGCAATGTTGAAGAAGTTGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_160_replicate_4	CTATAGCAATGTTGAAGAAGTTGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_160_replicate_3	CTATAGCAATGTTGAAGAAGTTGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_160_replicate_2	CTATAGCAATGTTGAAGAAGTTGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_160_replicate_10	CTATAGCAATGTTGAAGAAGTTGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_160_replicate_1	CTATAGCAATGTTGAAGAAGTTGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_16_replicate_9	CTATAGCAATGTTGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_16_replicate_8	CTATAGCAATGTTGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_16_replicate_7	CTATAGCAATGTTGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_16_replicate_6	CTATAGCAATGTTGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_16_replicate_5	CTATAGCAATGTTGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_16_replicate_4	CTATAGCAATGTTGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_16_replicate_3	CTATAGCAATGTTGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_16_replicate_2	CTATAGCAATGTTGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_16_replicate_10	CTATAGCAATGTTGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_16_replicate_1	CTATAGCAATGTTGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_159_replicate_9	CTATAGCAATGTTGAAGAAGTGGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_159_replicate_8	CTATAGCAATGTTGAAGAAGTGGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_159_replicate_7	CTATAGCAATGTTGAAGAAGTGGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_159_replicate_6	CTATAGCAATGTTGAAGAAGTGGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_159_replicate_5	CTATAGCAATGTTGAAGAAGTGGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_159_replicate_4	CTATAGCAATGTTGAAGAAGTGGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_159_replicate_3	CTATAGCAATGTTGAAGAAGTGGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_159_replicate_2	CTATAGCAATGTTGAAGAAGTGGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_159_replicate_10	CTATAGCAATGTTGAAGAAGTGGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_159_replicate_1	CTATAGCAATGTTGAAGAAGTGGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_158_replicate_9	CTATAGCAATGTTGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_158_replicate_8	CTATAGCAATGTTGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_158_replicate_7	CTATAGCAATGTTGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_158_replicate_6	CTATAGCAATGTTGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_158_replicate_5	CTATAGCAATGTTGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_158_replicate_4	CTATAGCAATGTTGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_158_replicate_3	CTATAGCAATGTTGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_158_replicate_2	CTATAGCAATGTTGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_158_replicate_10	CTATAGCAATGTTGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_158_replicate_1	CTATAGCAATGTTGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_157_replicate_9	CTATAGCAATGTTGAAGAAGTAGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_157_replicate_8	CTATAGCAATGTTGAAGAAGTAGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_157_replicate_7	CTATAGCAATGTTGAAGAAGTAGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_157_replicate_6	CTATAGCAATGTTGAAGAAGTAGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_157_replicate_5	CTATAGCAATGTTGAAGAAGTAGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_157_replicate_4	CTATAGCAATGTTGAAGAAGTAGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_157_replicate_3	CTATAGCAATGTTGAAGAAGTAGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_157_replicate_2	CTATAGCAATGTTGAAGAAGTAGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_157_replicate_10	CTATAGCAATGTTGAAGAAGTAGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_157_replicate_1	CTATAGCAATGTTGAAGAAGTAGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_156_replicate_9	CTATAGCAATGTTGAAGAAGGTGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_156_replicate_8	CTATAGCAATGTTGAAGAAGGTGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_156_replicate_7	CTATAGCAATGTTGAAGAAGGTGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_156_replicate_6	CTATAGCAATGTTGAAGAAGGTGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_156_replicate_5	CTATAGCAATGTTGAAGAAGGTGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_156_replicate_4	CTATAGCAATGTTGAAGAAGGTGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_156_replicate_3	CTATAGCAATGTTGAAGAAGGTGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_156_replicate_2	CTATAGCAATGTTGAAGAAGGTGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_156_replicate_10	CTATAGCAATGTTGAAGAAGGTGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_156_replicate_1	CTATAGCAATGTTGAAGAAGGTGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_155_replicate_9	CTATAGCAATGTTGAAGAAGGGGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_155_replicate_8	CTATAGCAATGTTGAAGAAGGGGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_155_replicate_7	CTATAGCAATGTTGAAGAAGGGGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_155_replicate_6	CTATAGCAATGTTGAAGAAGGGGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_155_replicate_5	CTATAGCAATGTTGAAGAAGGGGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_155_replicate_4	CTATAGCAATGTTGAAGAAGGGGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_155_replicate_3	CTATAGCAATGTTGAAGAAGGGGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_155_replicate_2	CTATAGCAATGTTGAAGAAGGGGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_155_replicate_10	CTATAGCAATGTTGAAGAAGGGGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_155_replicate_1	CTATAGCAATGTTGAAGAAGGGGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_154_replicate_9	CTATAGCAATGTTGAAGAAGGCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_154_replicate_8	CTATAGCAATGTTGAAGAAGGCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_154_replicate_7	CTATAGCAATGTTGAAGAAGGCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_154_replicate_6	CTATAGCAATGTTGAAGAAGGCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_154_replicate_5	CTATAGCAATGTTGAAGAAGGCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_154_replicate_4	CTATAGCAATGTTGAAGAAGGCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_154_replicate_3	CTATAGCAATGTTGAAGAAGGCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_154_replicate_2	CTATAGCAATGTTGAAGAAGGCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_154_replicate_10	CTATAGCAATGTTGAAGAAGGCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_154_replicate_1	CTATAGCAATGTTGAAGAAGGCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_153_replicate_9	CTATAGCAATGTTGAAGAAGGAGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_153_replicate_8	CTATAGCAATGTTGAAGAAGGAGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_153_replicate_7	CTATAGCAATGTTGAAGAAGGAGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_153_replicate_6	CTATAGCAATGTTGAAGAAGGAGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_153_replicate_5	CTATAGCAATGTTGAAGAAGGAGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_153_replicate_4	CTATAGCAATGTTGAAGAAGGAGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_153_replicate_3	CTATAGCAATGTTGAAGAAGGAGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_153_replicate_2	CTATAGCAATGTTGAAGAAGGAGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_153_replicate_10	CTATAGCAATGTTGAAGAAGGAGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_153_replicate_1	CTATAGCAATGTTGAAGAAGGAGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_152_replicate_9	CTATAGCAATGTTGAAGAAGCTGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_152_replicate_8	CTATAGCAATGTTGAAGAAGCTGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_152_replicate_7	CTATAGCAATGTTGAAGAAGCTGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_152_replicate_6	CTATAGCAATGTTGAAGAAGCTGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_152_replicate_5	CTATAGCAATGTTGAAGAAGCTGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_152_replicate_4	CTATAGCAATGTTGAAGAAGCTGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_152_replicate_3	CTATAGCAATGTTGAAGAAGCTGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_152_replicate_2	CTATAGCAATGTTGAAGAAGCTGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_152_replicate_10	CTATAGCAATGTTGAAGAAGCTGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_152_replicate_1	CTATAGCAATGTTGAAGAAGCTGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_151_replicate_9	CTATAGCAATGTTGAAGAAGCGGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_151_replicate_8	CTATAGCAATGTTGAAGAAGCGGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_151_replicate_7	CTATAGCAATGTTGAAGAAGCGGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_151_replicate_6	CTATAGCAATGTTGAAGAAGCGGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_151_replicate_5	CTATAGCAATGTTGAAGAAGCGGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_151_replicate_4	CTATAGCAATGTTGAAGAAGCGGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_151_replicate_3	CTATAGCAATGTTGAAGAAGCGGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_151_replicate_2	CTATAGCAATGTTGAAGAAGCGGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_151_replicate_10	CTATAGCAATGTTGAAGAAGCGGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_151_replicate_1	CTATAGCAATGTTGAAGAAGCGGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_150_replicate_9	CTATAGCAATGTTGAAGAAGCCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_150_replicate_8	CTATAGCAATGTTGAAGAAGCCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_150_replicate_7	CTATAGCAATGTTGAAGAAGCCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_150_replicate_6	CTATAGCAATGTTGAAGAAGCCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_150_replicate_5	CTATAGCAATGTTGAAGAAGCCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_150_replicate_4	CTATAGCAATGTTGAAGAAGCCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_150_replicate_3	CTATAGCAATGTTGAAGAAGCCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_150_replicate_2	CTATAGCAATGTTGAAGAAGCCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_150_replicate_10	CTATAGCAATGTTGAAGAAGCCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_150_replicate_1	CTATAGCAATGTTGAAGAAGCCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_15_replicate_9	CTATAGCAATGTGGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_15_replicate_8	CTATAGCAATGTGGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_15_replicate_7	CTATAGCAATGTGGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_15_replicate_6	CTATAGCAATGTGGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_15_replicate_5	CTATAGCAATGTGGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_15_replicate_4	CTATAGCAATGTGGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_15_replicate_3	CTATAGCAATGTGGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_15_replicate_2	CTATAGCAATGTGGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_15_replicate_10	CTATAGCAATGTGGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_15_replicate_1	CTATAGCAATGTGGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_149_replicate_9	CTATAGCAATGTTGAAGAAGCAGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_149_replicate_8	CTATAGCAATGTTGAAGAAGCAGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_149_replicate_7	CTATAGCAATGTTGAAGAAGCAGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_149_replicate_6	CTATAGCAATGTTGAAGAAGCAGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_149_replicate_5	CTATAGCAATGTTGAAGAAGCAGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_149_replicate_4	CTATAGCAATGTTGAAGAAGCAGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_149_replicate_3	CTATAGCAATGTTGAAGAAGCAGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_149_replicate_2	CTATAGCAATGTTGAAGAAGCAGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_149_replicate_10	CTATAGCAATGTTGAAGAAGCAGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_149_replicate_1	CTATAGCAATGTTGAAGAAGCAGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_148_replicate_9	CTATAGCAATGTTGAAGAAGATGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_148_replicate_8	CTATAGCAATGTTGAAGAAGATGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_148_replicate_7	CTATAGCAATGTTGAAGAAGATGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_148_replicate_6	CTATAGCAATGTTGAAGAAGATGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_148_replicate_5	CTATAGCAATGTTGAAGAAGATGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_148_replicate_4	CTATAGCAATGTTGAAGAAGATGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_148_replicate_3	CTATAGCAATGTTGAAGAAGATGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_148_replicate_2	CTATAGCAATGTTGAAGAAGATGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_148_replicate_10	CTATAGCAATGTTGAAGAAGATGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_148_replicate_1	CTATAGCAATGTTGAAGAAGATGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_147_replicate_9	CTATAGCAATGTTGAAGAAGAGGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_147_replicate_8	CTATAGCAATGTTGAAGAAGAGGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_147_replicate_7	CTATAGCAATGTTGAAGAAGAGGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_147_replicate_6	CTATAGCAATGTTGAAGAAGAGGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_147_replicate_5	CTATAGCAATGTTGAAGAAGAGGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_147_replicate_4	CTATAGCAATGTTGAAGAAGAGGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_147_replicate_3	CTATAGCAATGTTGAAGAAGAGGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_147_replicate_2	CTATAGCAATGTTGAAGAAGAGGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_147_replicate_10	CTATAGCAATGTTGAAGAAGAGGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_147_replicate_1	CTATAGCAATGTTGAAGAAGAGGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_146_replicate_9	CTATAGCAATGTTGAAGAAGACGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_146_replicate_8	CTATAGCAATGTTGAAGAAGACGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_146_replicate_7	CTATAGCAATGTTGAAGAAGACGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_146_replicate_6	CTATAGCAATGTTGAAGAAGACGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_146_replicate_5	CTATAGCAATGTTGAAGAAGACGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_146_replicate_4	CTATAGCAATGTTGAAGAAGACGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_146_replicate_3	CTATAGCAATGTTGAAGAAGACGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_146_replicate_2	CTATAGCAATGTTGAAGAAGACGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_146_replicate_10	CTATAGCAATGTTGAAGAAGACGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_146_replicate_1	CTATAGCAATGTTGAAGAAGACGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_145_replicate_9	CTATAGCAATGTTGAAGAAGAAGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_145_replicate_8	CTATAGCAATGTTGAAGAAGAAGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_145_replicate_7	CTATAGCAATGTTGAAGAAGAAGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_145_replicate_6	CTATAGCAATGTTGAAGAAGAAGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_145_replicate_5	CTATAGCAATGTTGAAGAAGAAGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_145_replicate_4	CTATAGCAATGTTGAAGAAGAAGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_145_replicate_3	CTATAGCAATGTTGAAGAAGAAGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_145_replicate_2	CTATAGCAATGTTGAAGAAGAAGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_145_replicate_10	CTATAGCAATGTTGAAGAAGAAGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_145_replicate_1	CTATAGCAATGTTGAAGAAGAAGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_144_replicate_9	CTATAGCAATGTTGAAGAATTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_144_replicate_8	CTATAGCAATGTTGAAGAATTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_144_replicate_7	CTATAGCAATGTTGAAGAATTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_144_replicate_6	CTATAGCAATGTTGAAGAATTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_144_replicate_5	CTATAGCAATGTTGAAGAATTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_144_replicate_4	CTATAGCAATGTTGAAGAATTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_144_replicate_3	CTATAGCAATGTTGAAGAATTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_144_replicate_2	CTATAGCAATGTTGAAGAATTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_144_replicate_10	CTATAGCAATGTTGAAGAATTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_144_replicate_1	CTATAGCAATGTTGAAGAATTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_143_replicate_9	CTATAGCAATGTTGAAGAATGCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_143_replicate_8	CTATAGCAATGTTGAAGAATGCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_143_replicate_7	CTATAGCAATGTTGAAGAATGCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_143_replicate_6	CTATAGCAATGTTGAAGAATGCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_143_replicate_5	CTATAGCAATGTTGAAGAATGCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_143_replicate_4	CTATAGCAATGTTGAAGAATGCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_143_replicate_3	CTATAGCAATGTTGAAGAATGCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_143_replicate_2	CTATAGCAATGTTGAAGAATGCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_143_replicate_10	CTATAGCAATGTTGAAGAATGCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_143_replicate_1	CTATAGCAATGTTGAAGAATGCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_142_replicate_9	CTATAGCAATGTTGAAGAATCCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_142_replicate_8	CTATAGCAATGTTGAAGAATCCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_142_replicate_7	CTATAGCAATGTTGAAGAATCCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_142_replicate_6	CTATAGCAATGTTGAAGAATCCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_142_replicate_5	CTATAGCAATGTTGAAGAATCCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_142_replicate_4	CTATAGCAATGTTGAAGAATCCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_142_replicate_3	CTATAGCAATGTTGAAGAATCCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_142_replicate_2	CTATAGCAATGTTGAAGAATCCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_142_replicate_10	CTATAGCAATGTTGAAGAATCCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_142_replicate_1	CTATAGCAATGTTGAAGAATCCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_141_replicate_9	CTATAGCAATGTTGAAGAATACGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_141_replicate_8	CTATAGCAATGTTGAAGAATACGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_141_replicate_7	CTATAGCAATGTTGAAGAATACGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_141_replicate_6	CTATAGCAATGTTGAAGAATACGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_141_replicate_5	CTATAGCAATGTTGAAGAATACGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_141_replicate_4	CTATAGCAATGTTGAAGAATACGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_141_replicate_3	CTATAGCAATGTTGAAGAATACGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_141_replicate_2	CTATAGCAATGTTGAAGAATACGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_141_replicate_10	CTATAGCAATGTTGAAGAATACGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_141_replicate_1	CTATAGCAATGTTGAAGAATACGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_140_replicate_9	CTATAGCAATGTTGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_140_replicate_8	CTATAGCAATGTTGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_140_replicate_7	CTATAGCAATGTTGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_140_replicate_6	CTATAGCAATGTTGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_140_replicate_5	CTATAGCAATGTTGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_140_replicate_4	CTATAGCAATGTTGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_140_replicate_3	CTATAGCAATGTTGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_140_replicate_2	CTATAGCAATGTTGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_140_replicate_10	CTATAGCAATGTTGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_140_replicate_1	CTATAGCAATGTTGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_14_replicate_9	CTATAGCAATGTCGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_14_replicate_8	CTATAGCAATGTCGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_14_replicate_7	CTATAGCAATGTCGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_14_replicate_6	CTATAGCAATGTCGAAGAAGTCGTGCATTGCTATAGGTCTGTGTTCCGTTGTCCGTGCTG	
dBr_TALE2039_dinucleotide_substitution_14_replicate