#ID = 
#Class Name = Probes are described as endogenous genes or internal controls (housekeeping, positive, negative)
#SEQUENCE = Nucleotide sequence recognized by NanoString probe for each target gene
#SPOT_ID = 
ID	Class Name	SEQUENCE	SPOT_ID
4930578C19Rik	Endogenous	CTGTGATCCTAGATTTGCCTACCGTTACCCAGACTGCAAGTATAATGATAGATTCTGAGTGGCTGAAGGGACAATCTGCAAGCTCTTCCATGTCCTTGGT	4930578C19Rik
A2m	Endogenous	AGAGGACATGTATGGCTTCCTAAAGGATATGGGCTTAAAGGTATTCACCAACTTGAACATCCGTAAACCCAAAGTCTGTGAACGCCTTGGAGTCAATAAA	A2m
Acvr1c	Endogenous	TGTAGAGCAGAGGCCGAGAGGACTTGCCTCGAAAGTGAAAAGATTTGGGTTCAATTTTCAGCACTGGTAAGAGAAGGAAGATAGGAAGGAGGTAAGAAGG	Acvr1c
Adam12	Endogenous	AAGATGTCTCCCCTGGAACCTCTCAAATGCGGGCAAGAAGGCATAAGAGAGAGACCCTTAAGATGACCAAGTACGTAGAGCTGGTTATTGTGGCAGACAA	Adam12
Adgre1	Endogenous	TGATGAGTGCACCCAAGATCCATTACAATGTGGACTGAATTCTGTCTGCACCAATGTACCAGGCTCCTACATCTGTGGCTGCCTCCCTGACTTTCAAATG	Adgre1
Adm	Endogenous	ACTGCCTTGCCCGCTCATAAACTGGTTTCTCACGGGGCATAAGCCTCATTACTACTTGAACTTTCCAAAACCTAGCGAGGAACGTGCAATGCTTGTTGTC	Adm
Adora2a	Endogenous	ACTATGAAAGGCAGGGTGCCAGAGTGTGGGCTCACGTCTCAGGATTGAGTTTAGAGACATCAAGTCATGGACCCGAGCTGGATAGTTCAGAGCTGCCCTG	Adora2a
Akt1	Endogenous	GCATCATCCCTGGGTTACCCCTGTCTCTGGGGGCCACGGATACCATGAACGACGTAGCCATTGTGAAGGAGGGCTGGCTGCACAAACGAGGGGAATATAT	Akt1
Aldoa	Endogenous	GGCCAGTCTGGAGCCGCAGCCAGTGAATCTCTCTTCATCTCTAACCATGCCTACTAACCAGAGCTGAACTAAGGCTGCTCCATCAACACTCCAGGCCCCT	Aldoa
Aldoc	Endogenous	CTCCACCAGCCCTTACAGTTACCCTTGATGGTATAGTTTGTCCTTGGGCTCTGCTTGCTAATTTTCTCTCTTGGGATCAGGGGGACGTGAACTCCAGCCC	Aldoc
Angpt1	Endogenous	GTCATGTCACCTGGGTTTGGAGCCTTCTGAGGTCAACAGAATCGCCACTTGGGTCCAGAGAATGCCACTCACAATCATGTTTAAAAGGGAAGAAACTTCT	Angpt1
Angpt2	Endogenous	GAAGAATGTTCCGTGGGAGTTCAGCAGTAAATAACTGGAAAACAGAACACTTAGATGGTGCAGATAAATCTTGGGACCACATTCCTCTAAGCACGGTTTC	Angpt2
Angptl4	Endogenous	GGTACCTGTAGCCATTCCAATCTCAATGGACAATACTTCCACTCTATCCCACGGCAACGGCAGGAGCGTAAAAAGGGTATCTTCTGGAAAACATGGAAGG	Angptl4
Anln	Endogenous	CACTGTCAGAACACTCCACTCAAGAAACATCAAACTGTCGCAAGCACCCCATTGACTTCTGTAACAGATAAGGTGGCTGAAAATGAACCAGCAGTGAAGC	Anln
Apc	Endogenous	TTAGATCATTTCTGGGCACACACCCGCAGTTTGATAAGAGTTGATCTGGAGAGGGCTACAAGAATTTGCATCTGTAATGTATTTAGGGATGGTGGGTGGT	Apc
Aph1b	Endogenous	GTGCAGCAGTAGTGACATTTTCAGAACATCTTGATGAAATGTGCTCCAGGGAAGTGAGGACAGTGTCTTCAGACTGCTCAGAAGATAGCTTTTGTTCCCA	Aph1b
Api5	Endogenous	GAGTGTACAACCAATCAATACATTAAATTCTCGGAAGGGGTCCTCTGACATAGCGATTATCCCTTTGAGGCTGAATCCATTACTGACTTGGTATCTAGGT	Api5
Aplnr	Endogenous	CTGGCTGCCCTTCTAGCTGTGCCTGTCATGGTGTTCCGTTCCACAGACGCCTCGGAAAATGGCACCAAGATCCAGTGCTACATGGACTACTCTATGGTGG	Aplnr
Apoe	Endogenous	TGGCCAATCACAATTGCGAAGATGAAGGCTCTGTGGGCCGTGCTGTTGGTCACATTGCTGACAGGATGCCTAGCCGAGGGAGAGCCGGAGGTGACAGATC	Apoe
Apol6	Endogenous	GGCAGTTGCCGGGGTCACCGAGATCGTGACCAATGTGAGGAAAAACTCTCGCAATAAAAGAGCCCTTGCTCAGGTCAACAGCATCATGCCTAACAGCGAC	Apol6
Aqp9	Endogenous	TGTAGAAGCACCACTCCGGGCCTTTGATTTCCATACGCCATGTTTACTGTTTTTATTCCCAGTTTTACTGAGGCACGGATGAAGGGACAAGGTAGCCGTT	Aqp9
Areg	Endogenous	AAGATTACTTTGGTGAACGGTGTGGAGAAAAATCCATGAAGACTCACAGCGAGGATGACAAGGACCTATCCAAGATTGCAGTAGTAGCTGTCACTATCTT	Areg
Arg1	Endogenous	CAACGGGAGGGTAACCATAAGCCAGGGACTGACTACCTTAAACCACCTAAGTGACTGTGAATGCGCCACATGAAAACCATCTGGGGCATCACAGCAAAGC	Arg1
Arg2	Endogenous	TTCCTGAGGAGCAGCGCCTCCCGTCTCCTCCACGGGCAAATTCCTTGCGTCCTGACGAGATCCGTCCACTCTGTAGCTATAGTCGGAGCCCCTTTCTCTC	Arg2
Arid1a	Endogenous	TTAAAGGAGTATGAGGTAGGGGACCCAGGACAGAGAACATTACTAGACCCTGGGAGATTCACCAAGGTGTATAGTCCAGCCCATACAGAGGAAGAAGAGG	Arid1a
Arnt2	Endogenous	AAAATGGAGCTTTTCACAGGTCATCCAGGGCCCAGCTGTTTGCTTTGTCTAACCGTCTCTTTCCTTAAAGAAAACTTCACAAGCAGGCTTCCAAGAACAG	Arnt2
Atf3	Endogenous	ACCGTGGAGCAGGCAGGAGCATCCTTTGTCTCACCAATTCCAGGATTTAGGCCTTATCATCCCGGCCAGTCTCAGATGACCTAGCTGGCCCCAGGCTGGG	Atf3
Atm	Endogenous	AAACTCTCACCTTGATGAGGATCGAACAGAGGCTGCAACCAGAATCATCCACTCCATCAGAAGTAAGCGATGTAAGATGGTGAAGGACATGGAGGCGCTC	Atm
Axin1	Endogenous	GTGCACCCCTGGGTCAGCGCTCAGCTTCGGAATTCTGTCCAGCCTTCTCATCTTTTCATCCAAGATCCCACAATGCCACCCAATCCAGCCCCTAATCCCC	Axin1
Axl	Endogenous	GAGATTCTAAAGGTCCACAGTCTAGAGTATTAGGTACGACTCCAAGGGTGGGCGCTTGTAGCCATCCTAAGTCCTTTCCCTCCTTAAGCACCTATGCTCC	Axl
B2m	Endogenous	CTGAACTGCTACGTAACACAGTTCCACCCGCCTCACATTGAAATCCAAATGCTGAAGAACGGGAAAAAAATTCCTAAAGTAGAGATGTCAGATATGTCCT	B2m
Bad	Endogenous	TTCGAGGCCTTAGGAAAAAAAAAGAGGATCGCTGTGTCCCTTTAACAGGGAGAAGAGCTGACGTACAGCTTGAGTCCCTTCCGGTGCGTGCAATAGCCAC	Bad
Bambi	Endogenous	GGATTGAGAGCCCTGCTTTAAAAGTGTCACTCTACATTCTCTAGTGCTGTGGAGGCACAGTCTCCTCTATCTGCTCCTTATTTGCGAATTTCAGGTCACT	Bambi
Batf3	Endogenous	CCTATGAACTTTGTGCAGCTTCGGTCAGACCCCGTGGCCAGCTGTCTACCACGATGACACCCCAGCTCACTCCTCCTTTGTCCGGCTCGGAACCTTGGTT	Batf3
Bax	Endogenous	CATAAATTATGACATTTTCCTGGGATGAATGGGGGAAGGGGAAAGGCATTTTTCTTACTTTTGTAATTATTGGGAGGGGTGGGAATGGTGGCCTGGGGAG	Bax
Bbc3	Endogenous	TCAGATTGAACAGTGAACACTCTTTTTGTTAGCTTTACCAGTGACAGAGCATCTGGCACTACCTGTAAGGACATGAAAGAAACGGTGTGTGTGTGTATGT	Bbc3
Bbs1	Endogenous	CTTCCACCTCCTCTCCAGTACAAGAGACTTGCCTGGATTAACTCTAAGCCGTTGTCAGCTCTGGCACCATTAGAGCTTGGCAGCTCCTCAGGAGAAAGGG	Bbs1
Bcat1	Endogenous	TCCTCTGCGTCTGGATGGGAGAAACCTCACATTAAGCCTTTTGGAAACTTGCCCATACATCCCGCTGCCTCTGTTTTGCACTACGCTGTGGAACTGTTTG	Bcat1
Bcl2	Endogenous	CCGCGGCCCCAGCGCGTCCGTGCCTGCATTTAGCAAGCTGCTTTTTTTCCCGTTTCGGAAAGCGCGTTGGCCCTTCGGAGTTTAATCAGAAGAGGATTCC	Bcl2
Bcl2l1	Endogenous	CCCCTGAGCCTCTCGGGAATGCTTTTCCAGCAGGGAGCTCTTCCCCTGAAGGAGACTAGCTTGCCTTGGTTTTGATGTGTGTGGCCTCAGACGTGATCAT	Bcl2l1
Bcl6b	Endogenous	GGTTTGTATTAAACCCATAATCCTCTCACCGGGCCTGACTTAGTATCTCCTGAAGATCCTTACTAGAGACTACAGGACCGTTTCTTATCTGTCTGGGTTC	Bcl6b
Bid	Endogenous	AATCATGCACACGACTTATCTGTGTGGTGTCAGTTACACTCAGGCTCTTGCTACGGAATGCAAAGAACAACTCACATACCAGTGTCAAACAGAATGCACA	Bid
Birc3	Endogenous	CCCTGTCATCTCACCATGAACATGGTTCAAGACAGCGCCTTTCTAGCCAAGCTGATGAAGAGTGCTGACACCTTTGAGTTGAAGTATGACTTTTCCTGTG	Birc3
Birc5	Endogenous	TAAGCAATAAGGAAGTGATGAAGGGACAGTGTTCTCTGACAGGACCTGTGGGGGTCGGGGTGCCTGTGCAAGGTCTTGGTTCTGATTGTGATATTTCCAT	Birc5
Blk	Endogenous	AAGGATTGTGTTAGAACTTACCTCCAGTTGTGTTCAGACCCCGATAGTCCCGAAATCAGTCTGACCAGTTAGCGATGGACAGGATGTCAGGCTGTCATAA	Blk
Blm	Endogenous	AAAGATGTGAACGTGTCTGAGGCCTTTTCATTCACTGAGTCTCCACTCCACAAACCAAAGCAGCAGGCAAAGATTGAAGGCTTCTTTAAACATTTCCCTG	Blm
Bmp2	Endogenous	ACTGTGACTATGTCAGGAAGTGATGATGGCATCTTGTTCTTTCTTAAGCCTATAATCCCTTCCAGGGGGCTGATCTGGCCAAAGTACTAAATAAAATATA	Bmp2
Bnip3	Endogenous	TGTGGCCTTATAATCCTATTACATAGCAGAAAATTAAAGGGTGCGTGCGGGTTATCTGTAAAGGCCTCTAACTTTGTGAACTGAGTAGCAAGTAGAAGCT	Bnip3
Bnip3l	Endogenous	TGACTTGGAAAAGTAGACTTGGGTTGTGGGAACAGTTGATAAAGTTCTGGAAAGATGCCATTCATTCTACAGTCTTCCCAAGGTGTCCTAGTCTCTCCCA	Bnip3l
Brca1	Endogenous	CGATTTGAGAGACATACATCATCAACTGAGATGGCGGTGGGAAATGAGAACATTCTTCAGAGTACAGTGCACACAGTTAGCCTGAATAACAGAGGAAATG	Brca1
Brca2	Endogenous	GGAACATGAAGGACAGCATTTTGAATCACTTGAAGACTCCATTGCAGGGAAGCAAATGGTGTCTAGAACAAGTCAAGCAGCCTGTCTTTCTCCGAGTATC	Brca2
Brd3	Endogenous	ACCAGCCTCTCCCTTAGTAACTTGAAGGAAGCTTTGCAAGGGTGTTTCTCTGGAATGGGTTCTGTGTTTGAAAGCTGTTAGAACACTAACCAGCAGGTTA	Brd3
Brd4	Endogenous	AGAAGCGGCAGCTAAGTCTAGATATCAACAAACTTCCTGGTGAGAAGCTAGGCCGTGTAGTACACATAATTCAGTCAAGGGAACCATCACTTAAAAACTC	Brd4
Brip1	Endogenous	ACACAAACCTGGACACTTCACCTCATTTCAATAGTCCAAGCAAACCATCTTCTGGAAGAAATGGAGTCTCAACTCCCTGTCAAGACTCTCCTGAAAAAAA	Brip1
Btla	Endogenous	AGTGCCTGCCATGCTTGGGACTCCTCGGTTATTTAGGGAATTCTTCATCCTCCATCTGGGCCTCTGGAGCATCCTTTGTGAGAAAGCTACTAAGAGGAAT	Btla
C1qa	Endogenous	CAGTGCCCGGCTTCTATTACTTCAACTTCCAAGTGATCTCCAAGTGGGACCTTTGTCTGTTTATCAAGTCTTCCTCCGGGGGCCAGCCCAGGGATTCCCT	C1qa
C1qb	Endogenous	GTGCCAACAGCATCTTCACTGGCTTTCTGCTTTTCCCTGACATGGATGCGTAATCACGGGGTCAAATTACACCTATCCAACACCATCTTCCTGCCTCCCT	C1qb
C2	Endogenous	ATGGTGTCCTGGACTTTCTGCCACTTTAACATGGTCACTGACTCCTTTATTAGTCTGAACTTCCTGTCTAATACCTCTGAGCGTTCTCACTCCTGGATAC	C2
C5ar1	Endogenous	CATTGCTCCTCACCATTCCATCCTTCGTGTACCGGGAGGCATATAAGGACTTCTACTCAGAGCACACTGTATGTGGTATTAACTATGGTGGGGGTAGCTT	C5ar1
C7	Endogenous	TCGTCAGCAGATCAGAGATGTATGAAACAGCTAGAGACTGAAAAATCAACTTCAGGAAATAAGGGCAGGTTGCTTCGAGGAAAACCATTGGTCAGAGGTG	C7
Casp1	Endogenous	GACAATAAATGGATTGTTGGATGAACTTTTAGAGAAGAGAGTGCTGAATCAGGAAGAAATGGATAAAATAAAACTTGCAAACATTACTGCTATGGACAAG	Casp1
Casp3	Endogenous	GTGTGTGATTCTAAGCCATGGTGATGAAGGGGTCATTTATGGGACAAATGGGCCTGTTGAACTGAAAAAGTTGACTAGCTTCTTCAGAGGCGACTACTGC	Casp3
Casp8	Endogenous	TTTCATTCAGGCTTGCCAAGGAAGTAACTTCCAGAAAGGAGTGCCTGATGAGGCAGGCTTCGAGCAACAGAACCACACTTTAGAAGTGGATTCATCATCT	Casp8
Casp9	Endogenous	ATAACTGTCCTGCTAAGATAGGATTTTGAACTGGGGCAGGCTGCTCTTTCCCTTTGGCGATGCAAACATGCTCCTAGCAGCTTTCAGGTTGTAGGGCAAT	Casp9
Cblc	Endogenous	CTGGAGGCAGAATTGTGGAGTTCGGTGCGTGCTTCCCTGGGCTGAGTTCCAGTCCCTCCTGTGTGCCTGCCACCCTGTGGAACCAGGCCCCACCATGCAG	Cblc
Ccl1	Endogenous	ATGCTTACGGTCTCCAATAGCTGCTGCTTGAACACCTTGAAGAAAGAGCTTCCCCTGAAGTTTATCCAGTGTTACAGAAAGATGGGCTCCTCCTGTCCTG	Ccl1
Ccl11	Endogenous	CAACCTCCTCTCTTGACACTAACCCAGAGCCTAAGAACTGCTTGATTCCTTCTCTTTCCTAAGACGTGCTCTGAGGGAATATCAGCACCAGTCGCCCAAG	Ccl11
Ccl12	Endogenous	CAGAAGATTCACGTCCGGAAGCTGAAGAGCTACAGGAGAATCACAAGCAGCCAGTGTCCCCGGGAAGCTGTGATCTTCAGGACCATACTGGATAAGGAGA	Ccl12
Ccl17	Endogenous	TCTGTGCAGACCCCAAAGACAAACATGTGAAGAAGGCCATCAGATTGGTGAAAAACCCAAGGCCATGACCTTCCCGCTGAGGCATTTGGAGACGCCAGGG	Ccl17
Ccl19	Endogenous	CTTCTGCCAAGAACAAAGGCAACAGCACCAGAAGGAGCCCTGTGTCTTGAGTAAAGAGATGTGAATCACTCTGGCCCAGGAAACCAAGGACCAGAAGAGA	Ccl19
Ccl2	Endogenous	TCTTCAGCACCTTTGAATGTGAAGTTGACCCGTAAATCTGAAGCTAATGCATCCACTACCTTTTCCACAACCACCTCAAGCACTTCTGTAGGAGTGACCA	Ccl2
Ccl20	Endogenous	GCAGCAAGCAACTACGACTGTTGCCTCTCGTACATACAGACGCCTCTTCCTTCCAGAGCTATTGTGGGTTTCACAAGACAGATGGCCGATGAAGCTTGTG	Ccl20
Ccl21a	Endogenous	TTAAGTACAGCCAGAAGAAAATTCCCTACAGTATTGTCCGAGGCTATAGGAAGCAAGAACCAAGTTTAGGCTGTCCCATCCCGGCAATCCTGTTCTCACC	Ccl21a
Ccl22	Endogenous	CCAAGAATCAACTTCCACCCCTCTTCAACCACATGCTAGGGTCTTTTACTTTCTCTGCCCCACACCTTTGACTCCTTGCCTGTGTAGCTGATAGTCGAAG	Ccl22
Ccl24	Endogenous	CTGGATGCCAAGAAAAACCAGCCTTCTAAAGGGGCCAAGGCAGTGAGAACCAAGTTTGCTGTCCAGAGACGCCGTGGCAATAGCACCGAGGTTTAGCCGC	Ccl24
Ccl25	Endogenous	GTGCCAATGAACTCACTGAAGCTACAGTTTCCTGTACAAGACCAGACCCACCAACGTCTCAGCATGTATGAGGAAGGAACTACTGCGCTAAAGGCCCTCC	Ccl25
Ccl26	Endogenous	CAGCTATAAGTTCACCGACAAGAGCTGCACCAGTGACGGTGTGATATTCTTTACAAAAACAGGTAAGCAATTCTGTGTCCAGCCAGGGGCCAAATGGGTG	Ccl26
Ccl27a	Endogenous	GCCTCTGCCCTCCAGCACTAGCTGCTGTACTCAGCTCTATAGACAGCCACTCCCAAGCAGGCTGCTGAGGAGGATTGTCCACATGGAACTGCAGGAGGCC	Ccl27a
Ccl28	Endogenous	AGGGAAAAACTGGAATGTGGAGTCTTCCCTTCAGGGTGTGTCCTGTCTTTGTTTCACACCACCAAGAAGCAAGCAGCTTCCTTGGTCTCATATTTCCACC	Ccl28
Ccl3	Endogenous	TCTGTCACCTGCTCAACATCATGAAGGTCTCCACCACTGCCCTTGCTGTTCTTCTCTGTACCATGACACTCTGCAACCAAGTCTTCTCAGCGCCATATGG	Ccl3
Ccl4	Endogenous	GCAGGGCAGGAGGAGCCACTTCAGGAGAGGCCTCCTCAGCCCTGATGCTTCTCACTGAGAAGCGTCCTTGCTCCTCACGTTCAGATTTCCTGCCCCTCTT	Ccl4
Ccl5	Endogenous	TGGGTTCAAGAATACATCAACTATTTGGAGATGAGCTAGGATAGAGGGTTTCTTGATTCTGACCCTGTATAGCTTCCCTGTCATTGCTTGCTCTAGTCCT	Ccl5
Ccl6	Endogenous	ATGTAGCCACAGGACTGTCTCTTTCTTCAGATTCATAGAACTACGGGGCCAGTCTGAAACTGGGCTCTTGGGGTGAAATTATCTCACTCACTCACCTTGA	Ccl6
Ccl7	Endogenous	CAACCAGATGGGCCCAATGCATCCACATGCTGCTATGTCAAGAAACAAAAGATCCCCAAGAGGAATCTCAAGAGCTACAGAAGGATCACCAGTAGTCGGT	Ccl7
Ccl8	Endogenous	ACCTGCTGCTTTCATGTACTAAAGCTGAAGATCCCCCTTCGGGTGCTGAAAAGCTACGAGAGAATCAACAATATCCAGTGCCCCATGGAAGCTGTGGTTT	Ccl8
Ccl9	Endogenous	ATGGCAACCCAGGTACATTCAACTAGGATGAAATAAATTCTGCCTTAGCCCAGTAGTATGTCTGTGTTTGTAAGGACCCAGCTGATTTTCCCACCACCCC	Ccl9
Ccna1	Endogenous	ACGTGGGTTTGATATCTATATGGATGATCCTGAACAGGGGGACAGAGATACCTGCTCGGGGAAAGAGGGCATCATATTTGAGGATGTGTATGAAGTCGAC	Ccna1
Ccnb1	Endogenous	TCATAGTAGCTCTTCCAGGGGTGTGCTTTGAATTCTGACAGCCAGATGGGTGTGGCTGCCACCATACCAAGGCGCCACTCCTGTCTTGTAATGCCACCTG	Ccnb1
Ccnd1	Endogenous	GGAGGGGTTCTAATGGAATGGATGGGGATGTCCACACACGCATTCAGATGGCTGTACAACAGGTTGTAGGGCTGGTAGTATGAGGTGCTTGGGAAGTTTT	Ccnd1
Ccnd2	Endogenous	CCAACCACATGACTGAACCATTTTGGATGTAAGAAGCGCCTTGATGCCTCACCACGTGTTCCCAAGACTGAGCGTCCGGGTCTCTCCGTCGCATACTCTT	Ccnd2
Ccnd3	Endogenous	GCCATGATGGTCAGAGAAATACAAACAGGTAAAATCCACACACCAGCATTTCTTTTGAGTCCCTCTTCTGTCCGGGGCTCCAACCTTCTCAGTTGCCAAA	Ccnd3
Ccne1	Endogenous	ATGATGATGAAGGCCCTTAAGTGGCGTCTAAGCCCTCTGACCATTGTGTCCTGGCTGAATGTCTATGTCCAAGTGGCCTATGTCAACGACACGGGTGAGG	Ccne1
Ccno	Endogenous	CTTTTCCCAGGCGAAGTCCATCACGAGGTAGCCAATTCCGGAGGCTCTTCCCTGCTCCCACAGTTTTACTTTGTAGTTAGCTCTGTGAAAACAACCTGGC	Ccno
Ccr2	Endogenous	ATGAACTAACATAGACAGCTCAGGATTAACAGGGACTTGTGGTTTGTGGTCTGTGGGCTTATCCAAGCATGGTGATTTAGACTCTAAGGTCCGTCTGGAT	Ccr2
Ccr4	Endogenous	GCTTGTAGAAGAAGCTCGTCGGTGCAGAGAAGGGTGAAATGCCCTTGTAATTCTAGCTACTCCGGGGATAAGGCCAAGAGATCTTAGATTCAAGGATGGC	Ccr4
Ccr5	Endogenous	GGAGCAGGGAGAACGAGTCTTTTATCAGGGCCGGGAAATATGCACAAAGAGACTTGAGGCAGGTGCCATGACCCATATGCAAAGGGACGGACACAGGGCC	Ccr5
Ccr9	Endogenous	GGGTAGCTTGAAGCTTTCTTCTATGCTACTGGAGACAACTTCGGGGGCTCTCTCCCTATGAGAGAACTTCTCACAGGGCATATGGTCCTTTTTGGAAATA	Ccr9
Cd14	Endogenous	CTAGACGAGGAAAGTTGTTCCTGCAACTTCTCAGATCCGAAGCCAGATTGGTCCAGCGCTTTCAATTGTTTGGGGGCGGCAGATGTGGAATTGTACGGCG	Cd14
Cd163	Endogenous	TCACGGCACTCTTGGTTTGTGGAGCCATTCTATTGGTCCTCCTCATTGTCTTCCTCCTGTGGACTCTGAAGCGACGACAGATTCAGCGACTTACAGTTTC	Cd163
Cd19	Endogenous	GACTTCGTTAGGTCCCAAGAACCACATCTGATTCTGAAATCTGGAGATCCCAGATGGTGTCAGTCAGTGAAATGACCTTGATCAGGATGTGTGCATGCTG	Cd19
Cd1d1	Endogenous	GTTTTATGGGATTTGCACTGAACTAGAAAGCATACTTCCTGCCCAAACAGACGCTCTGAGGTTAGTTGGCAAGTGTAAAGTCCAACACCAACCTGGCTGT	Cd1d1
Cd2	Endogenous	ATCAGAAACGTATGAGGTCTTAGCAAACGGATCCCTGAAGATAAAGAAGCCGATGATGAGAAACGACAGTGGCACCTATAATGTAATGGTGTATGGCACA	Cd2
Cd200r1	Endogenous	GGAGAAAAAGTACCGAGTGAGCGGCGGAAAACCAGAAAACCGAAATGTTTTGCTTTTGGAGAACTTCTGCCCTAGCAGTGCTCTTAATATGGGGGGTCTT	Cd200r1
Cd209e	Endogenous	CCAGTTGGGGAGTGGACTTTCACTCATGCGTTTCCCAGTTCCTACTCCCTGTCTATGGGCATGGAAATCTTAGTATTACCTCTGGGACTCATCAGTCTCC	Cd209e
Cd244	Endogenous	TACAGACAAAAGATGTTTCTGTTCAATGGAAGAAGACAGAACAGGGCTCACACAGAAAAATTGAGATCCTGAATTGGTATAATGATGGTCCCAGTTGGTC	Cd244
Cd247	Endogenous	CCAGGGAAGCAGAAGATGAAGTGGAAAGTGTCTGTTCTCGCCTGCATCCTCCACGTGCGGTTCCCAGGAGCAGAGGCACAGAGCTTTGGTCTGCTGGATC	Cd247
Cd27	Endogenous	GTGGCCCAGCAAGCTGGGGAGACTCAGGCTCTAGCTATAAAGCACACTTACTCTAAGTGAAACCGTCCAGCTGACAAAACTACATGCCAGGGGTGGAAAT	Cd27
Cd274	Endogenous	TGAACTAATATGTCAGGCCGAGGGTTATCCAGAAGCTGAGGTAATCTGGACAAACAGTGACCACCAACCCGTGAGTGGGAAGAGAAGTGTCACCACTTCC	Cd274
Cd276	Endogenous	TGGTCCATAGACCACCCACAGCCTTACTTTTCCAATGGACTTAATTCCCATCATCCTGCAGCCTCATTTCTCCAGTGACACGATACACGAACCATCCTGC	Cd276
Cd28	Endogenous	TCCTAAGCTGTTTTGGGCACTGGTCGTGGTTGCTGGAGTCCTGTTTTGTTATGGCTTGCTAGTGACAGTGGCTCTTTGTGTTATCTGGACAAATAGTAGA	Cd28
Cd300a	Endogenous	GCTTCACTATTCATCCGTGGCATTCAACTCCCAGAGGCAGGATTCTCACGCCAATGGAGATTCTCTTCATCAACCTCAGGACCAGAAAGCAGAGTACAGT	Cd300a
Cd36	Endogenous	GGGACCATTGGTGATGAAAAAGCAGAAATGTTCAAAACACAAGTGACTGGGAAAATCAAGCTCCTTGGCATGGTAGAGATGGCCTTACTTGGGATTGGAG	Cd36
Cd38	Endogenous	TATTCACATGGTAAACCTGAGGTCATAGGGTCATTATAGGGAAGGTGCTGTGTGGGAACTACCCACGTGCCCTGTGCTTTAATCTTTAACTCAACACATC	Cd38
Cd3d	Endogenous	GGCTGATCATCCTGTGGCTTGCCTCTATTTGTTGCATGATTCCCTCTGGAAGATGGAACACAGCGGGATTCTGGCTAGTCTGATACTGATTGCTGTTCTC	Cd3d
Cd3e	Endogenous	TGAGTACTGTGTGGAGGTGGACCTGACAGCAGTAGCCATAATCATCATTGTTGACATCTGTATCACTCTGGGCTTGCTGATGGTCATTTATTACTGGAGC	Cd3e
Cd3g	Endogenous	GCATTGAGCTAAACATAGGCACCATATCCGGCTTTATCTTCGCTGAGGTCATCAGCATCTTCTTCCTTGCTCTTGGTGTATATCTCATTGCGGGACAGGA	Cd3g
Cd4	Endogenous	AAGAGGTGTCCGTACAAAAGTCCACCAAAGACCTCAAGCTCCAGCTGAAGGAAACGCTCCCACTCACCCTCAAGATACCCCAGGTCTCGCTTCAGTTTGC	Cd4
Cd40	Endogenous	GCTGCCCAAACCCGGTTACCTGATTTTGATCCCTGGGACTTCATGGTAAAAGGGAGAGAACCAAATCCAGAGGGTTGTCATTTGACCTCCATGTGTGCTC	Cd40
Cd40lg	Endogenous	AGCAGTGGATCTGAGAGAATCTTACTCAAGGCGGCAAATACCCACAGTTCCTCCCAGCTTTGCGAGCAGCAGTCTGTTCACTTGGGCGGAGTGTTTGAAT	Cd40lg
Cd44	Endogenous	TCGCTTTGGGTGTGTCCTTCGCGCGCTCCCTCCCTCTTAGGTCACTCACTCTTTCAAAGCCTGGAATAAAAACCACAGCCAACTTCCGAAGCGGTCTCAT	Cd44
Cd47	Endogenous	CTCCTGCTGCTGCGGTTCAGCTCAACTACTGTTTAGTAACGTCAACTCCATAGAGTTCACTTCATGCAATGAAACTGTGGTCATCCCTTGCATCGTCCGT	Cd47
Cd48	Endogenous	TGCGTGAAACTGAGAACGAGTTGAAGATAACCCTGGAAGTATTTGATCCTGTGCCCAAGCCTTCCATAGAAATCAATAAGACTGAAGCGTCGACTGATTC	Cd48
Cd5	Endogenous	ATTGAACAGACCCCAGAACCAGGTCTTCTGCCAAGGATCTCCGTGGTCTATATCCAACTGCAACAACACAAGTTCACAAGACCAGTGCCTTCCGCTGAGC	Cd5
Cd6	Endogenous	GAAGTGCCTTCCAGAGTTCCAGTCACGATAGAATCTTCTGTGCCGGTGAGCGTGAAGGATAAGGACTCACAAGGGCTGACACTTCTCATTCTCTGTATTG	Cd6
Cd68	Endogenous	ACGGTACCCATCCCCACCTGTCTCTCTCATTTCCTTATGGACAGCTTACCTTTGGATTCAAACAGGACCTACATCAGAGCCCGAGTACAGTCTACCTGGA	Cd68
Cd69	Endogenous	CTGAAAACTGTTCTATAACGGAAAATAGCTCTTCACATCTGGAGAGAGGGCAGAAGGACCATGGCACCAGTATACATTTTGAGAAGCATCATGAAGGATC	Cd69
Cd7	Endogenous	CTCAGGCTTACAATGTGATTTACTTTGAAGACCGGCAGGAGCCCACAGTAGACAGGACCTTCTCAGGCCGAATTAATTTCTCTGGTTCCCAGAAGAACCT	Cd7
Cd70	Endogenous	CGCCTGACATACCTGGTCCACGGAGATGTCCTCTGTACCAACCTCACCCTGCCTCTGCTGCCGTCCCGCAACGCTGATGAGACCTTCTTTGGAGTTCAGT	Cd70
Cd74	Endogenous	ATGGATAACATGCTCCTTGGGCCTGTGAAGAACGTTACCAAGTACGGCAACATGACCCAGGACCATGTGATGCATCTGCTCACGAGGTCTGGACCCCTGG	Cd74
Cd79a	Endogenous	AAATAACAGGAAGTCTCTTGGGGAAGTCCCCACCCCAATTGAAATGCTGGTTTATCTCCCTTATAGGGCCTCACCCTCCTCATGTCCCAAAGCAAGGGGG	Cd79a
Cd79b	Endogenous	CAGACCCAGAATGGCTCTGTCTACACCCTCACTATCCAAAACATCCAGTACGAGGATAATGGTATCTACTTCTGCAAGCAGAAATGTGACAGCGCCAACC	Cd79b
Cd80	Endogenous	TGGCTTTCCCCATCATGTTCTCCAAAGCATCTGAAGCTATGGCTTGCAATTGTCAGTTGATGCAGGATACACCACTCCTCAAGTTTCCATGTCCAAGGCT	Cd80
Cd84	Endogenous	CTATGATGAAATCCCTCAGTCCAAGATGCTGTCCTGTAAGAAAGATCCGGTGACCACCATTTATTCCTCAGTGCAGCTTTCTGAGAAGATGAAGGAAACC	Cd84
Cd86	Endogenous	CCAACAGCCTCTCTCTTTCATTCCCGGATGGTGTGTGGCATATGACCGTTGTGTGTGTTCTGGAAACGGAGTCAATGAAGATTTCCTCCAAACCTCTCAA	Cd86
Cd8a	Endogenous	CCACCTTCGTTGTCTATATGGCTTCATCCCACAACAAGATAACGTGGGACGAGAAGCTGAATTCGTCGAAACTGTTTTCTGCCATGAGGGACACGAATAA	Cd8a
Cd8b1	Endogenous	GCCACCTCATGAATAAAGTTTTCTGCAAACAGTTTCAGGGCTCTCAGCAGCCATCTTACTCTCTCAGGCCTTGCCGTGGGTTTGGGAGGCTGTTGGCTCA	Cd8b1
Cd96	Endogenous	GAAGGGTGTAACAAATTGGACTCTGTACTTAAGGAATATCTCTTCTGCCCTGGGTGGAAAGTATGAGTGCATCTTTACTCTGTATCCAGAAGGCATCAAG	Cd96
Cdc20	Endogenous	ATCGCGCTTGGTCGCCTTTCGCCCCGGTAGCGGTGCCATGGCGCAGTTCGTGTTCGAGAGCGATTTGCACTCACTGCTTCAACTGGACGCACCCATCCCC	Cdc20
Cdc25c	Endogenous	GAACCTCGGGCCACGTAGATGCAATTTTAACCCGAAGAATCGCTTCTGTTCCTCAGATCCCTTGTCATTCTGTGGAGTCTTCGCTTACGTCCAGTCCTGC	Cdc25c
Cdh1	Endogenous	AGAACTCATTTACAGTGGCATTCCTTGTTCGGCTATGTGTCTGGGGCAGAACAAAAAAAAGGGACCACTATGCATGCTGCACACGTCTCAGATTCTTAGG	Cdh1
Cdh11	Endogenous	CAGACCTCTCGATGTTCTAGATATAGACTTGATGCCCTGCCTTGAGCATTGTGGAGTTGAAGGGGTGCAGAGTCAAAGCCAACTCTGGTTTTCCTTATGT	Cdh11
Cdh2	Endogenous	AGCCTATGAAGGAACCACATGAAATTGAAGAAATAGTATTCCCTAGACAACTTGCCAAGCACAGTGGAGCTCTACAAAGGCAGAAGAGAGACTGGGTCAT	Cdh2
Cdh5	Endogenous	GTGGTGGCCAAAGACCCTGACAAGGCTCAGCGCAGCATCGGGTACTCCATCCGCAAGACCAGTGACAGAGGCCAATTCTTCCGAATAACCAAGCAGGGAA	Cdh5
Cdk2	Endogenous	CGGCTCTGATGCCCTTCCCAAAGCCCTTTTCACCCGTGGTCTGACTTGACCCTGGGCCTTTTGGACACAGGTCAGCCTTCTGATGTTTTCTGGCTGTCTT	Cdk2
Cdk6	Endogenous	TAAAGAGTAGAGGTGACTGATAGTAAGAAGGGCTTGTTCAGTGAAAGGTGATTCACAATGGAGTCTTGTTAGGAAGGTTGGACCTAAGTCCTCAGAGTTG	Cdk6
Cdkn1a	Endogenous	AATACCGTGGGTGTCAAAGCACTTAGTGGGTCTGACTCCAGCCCCAAACATCCCTGTTTCTGTAACATCCTGGTCTGGACTGTCTACCCTTAGCCCGCAC	Cdkn1a
Cdkn1c	Endogenous	CTGGGACCTTTCGTTCATGTAGCAGGAACCGGAGATGGTTGCGTAGAGCAGCCCACGGTTTTGTGGAAATCTGAAAACTGTGCAATGTATTGAGAACACT	Cdkn1c
Cdkn2a	Endogenous	CCAATCCCAAGAGCAGAGCTAAATCCGGCCTCAGCCCGCCTTTTTCTTCTTAGCTTCACTTCTAGCGATGCTAGCGTGTCTAGCATGTGGCTTTAAAAAA	Cdkn2a
Cdkn2b	Endogenous	AAATGGGAAACCTGGAGAGTAGATGAGAGGCACTGAAGTGGTTTTATGTACTGTCATGTGTGGGGATTCACCTGCAAAATGGCATTTATAGAAACTGAGA	Cdkn2b
Ceacam3	Endogenous	CATTTTGACCTGTGGACGCCCTCCCACCTCTGCTCAGCTCAGTATTGAATCAGTGCCGCCCAGTGTTGCTAAAGGAGAAAGTGTTCTTCTTCTTGCTCGA	Ceacam3
Cebpb	Endogenous	CGCGCCCGCGCACCACGACTTCCTCTCCGACCTCTTCGCCGACGACTACGGCGCCAAGCCGAGCAAGAAGCCGGCCGACTACGGTTACGTGAGCCTCGGC	Cebpb
Cenpf	Endogenous	TGCTCAGGTCTCCCATATGTAAGACTGCAAACGTTGAAAGCACCCATTACCTAGTAGTCCTAATCCTTAACCCTAAGTGTAAATAGCAGTGGATAGAGCG	Cenpf
Cep55	Endogenous	TTGGCACTCTGGCATATGAGGGCATCCTTGTATTTTTCTGGCCACTTTGCATTTCCTTGGTAGCCATTCCTCCCTGAGTTGGTTCGTCATCAGGCTGCAG	Cep55
Ces3a	Endogenous	TATTGTCTCATCCCTGCTCCTGTCTCCAATGTCTGCTGGGCTCTTCCACAGAGCCATATCGCAGAGTGGGGTTGTCATCAGCAAGATTCTGGAAGACTTG	Ces3a
Chd9	Endogenous	GGTTTTTAAGCACGGTTATGAAAAGTACAACACGATCAGAGCAGACCCAGCTTTGTGCTTCTTGGAAAGAGTGGGCAAGCCTGACGACAAGGCTGTCGCT	Chd9
Chuk	Endogenous	CGTGAAGCAAATGAGGACCAGAGCAGTAGTTTGATGAGTCTTGATTGGAGTTGGTTAGCAGAATGACTCGACACTCGTTTACTGTCCTGGAGCCTACGAA	Chuk
Clec14a	Endogenous	ACTGTGACTGTGCTCTGCCATAAATCGGAAGTGCAATGTTGCCAGTTTCTGACTCCAGAAGCAAATTACAGTTGACCACCAATCCAAGTGTTTACTGTGT	Clec14a
Clec4e	Endogenous	CCAGGAAGAACTGGAATGATATACCCTGTTTCTACAGTATGCCTTGGATTTGTGAGATGCCAGAAATAAGTCCTCTGGACTAAGTGCAAGGAAATACAAG	Clec4e
Clec5a	Endogenous	TCTTCTCCTTCTCCGAATCACCTTGGAAAGACAGCATGGATTATTGTGCAACACAAGGATCCACACTGGCAATTGTCAACACTCCAGAGAAACTGAAGTA	Clec5a
Clec7a	Endogenous	GGATGAAGAAGCTGAGACTTTTGTACTTGTCATCTTCACAAAGATGGTGGCACTATCTTCCAGTTAGGAAGTCACTAGACATGGAGTGAGGGCAGCTCAA	Clec7a
Cmklr1	Endogenous	ATTGTCATCGCCACCTTCAAGATGAAGAAGACCGTGAACACTGTGTGGTTTGTCAACCTGGCTGTGGCCGACTTCCTGTTCAACATCTTTTTGCCGATGC	Cmklr1
Cmtm4	Endogenous	TGAGGCGGAAGAAAGAAGCATTCAGATGGGGTTTCTGCTCGCTTTCCCAAGTCCCTTCAATAAACCCGTTTTATCCTGTGATGAAAGGAGGCCTTCTGAG	Cmtm4
Cmtm6	Endogenous	TATTCTTAATTCCTTCTGAGCCATGCATTGCCTAACAGAAAGCGTGTGGGCTGGTGCTGTTTATGTGTGTGAAAGCAACCGTGTAGCAGCCTTGTGGAGG	Cmtm6
Cntfr	Endogenous	GATAATATTGATGTGTGTGGAGAACAGCTGGTGGTAACGAGATGGCTGCTTCTGTCCCATGGGCCTGCTGTGCTGTGCTTGCCGCTGCCGCCGCCGCTGT	Cntfr
Col11a1	Endogenous	AGGAAAAAAAATACCTTGGTGCCACCAACCATTTTACGCCACATGCAAGTTTTGAATAAGGACGGTATAGAAAACGTGCTTAGGAATCGCTGTTGCCTAC	Col11a1
Col11a2	Endogenous	TAGGCCTGTCTCTGACGCTGTCAACCAAAACCAGGTCTAGCTGGAGTCACACAGCACGGACTCCATGTCACCTCTCGTGAGGATCTCTCATCGTCTAGAG	Col11a2
Col17a1	Endogenous	TGTAGATGACGTGTGATGGGTTATGTTACGAAGGCTGCTGTCAGCTCCTCCTCCTCTCTTCACTCTGCATTCTCCAGTCACAGAGGTGACTCTTGCAACT	Col17a1
Col4a5	Endogenous	CCCAGTTGCCATCCAGAGATGAAATCTGTAAAGCAGGCCCTCCTGGGCCTCCAGGACCTCCAGGTGATAAAGGACTCCAAGGAGAGCGAGGAGTAAAAGG	Col4a5
Col5a1	Endogenous	CCTTCAGCTCTCAGGATAGGTTCATTAAAGGTGTTAATGGACCGTTGGCCGGGAGTGGGGGCGGGACAGTATTTGAAGATCACTTTAAAAAAAATTCAAC	Col5a1
Col6a3	Endogenous	TCACAGATTGTGAGCCTTCTGAAAGCAGAACAGGGTTCAGGCCCTGTATCAGGTGAAAAGGATGTGGTGTTTCTCATTGATGGCTCTGAGGGTGTCCGCA	Col6a3
Comp	Endogenous	ACCGTTGCAATGATACAATCCCTGAGGACTACGAGAGTCACCGGCTGCAGAGAGTCTAGGGACCAGTGGGGTCCCGCTGCCTGATGGACTGTGGTGGCAC	Comp
Cpa3	Endogenous	TCCAGAATGAAAAGCACGCCAGTGTCTTGAAGAACTTGACCCAAAGCATTGAGCTCGACTTCTGGTATCCAGATGCTATCCATGATATTGCTGTGAATAT	Cpa3
Crabp2	Endogenous	AAAGGACTCAGCGTCCAGTGTTCTAGTTGAAGATCTAAAGAGAAAGCCACCTTGCTGCCACTATGCCTAACTTTTCTGGCAACTGGAAGATCATCCGATC	Crabp2
Csf1	Endogenous	ATCCTAGTCTTGCTGACTGTTGGGGGCCTCCTGTTCTACAAGTGGAAGTGGAGGAGCCATCGAGACCCTCAGACATTGGATTCTTCTGTGGGGCGACCAG	Csf1
Csf1r	Endogenous	CCACCACTCTTGACCTTCACTCTGTCTATAGTCCCGCCTCATCCTGGATCTTGTACTGAGCGGCAGCTAAAAGTGTTCTACCCAGTGCCCTGTCACTCTA	Csf1r
Csf2	Endogenous	CTGAATCCAGCTTCTCAGACTGCTGCTTTTGTGCCTGCGTAATGAGCCAGGAACTTGGAATTTCTGCCTTAAAGGGACCAAGAGATGTGGCACAGCCACA	Csf2
Csf2rb	Endogenous	ATTGCGTGTCTGCATTGCTATGAGATGGGTTGCCGAGCCACACCTGTCTTTGGGTCCCTGTTTGCAGGGGTCTTTGCTGTAAGTGCACACGTGCCTTTGT	Csf2rb
Csf3	Endogenous	TTGTTCTCCTGCTTAGAGCAGAGAGAGAAGGCTCTTGTGTCCTCCTGTGGAGGCCAGGGAAGGAGATGGGTAAATACCAAGTATTGATTCCTGCTGCTGC	Csf3
Csf3r	Endogenous	CCCAGCCTTCTGCCTCAGGGCTATCTCATTGAGTGGGAAATGAGTTCTCCCAGCTACAATAACAGCTATAAGTCCTGGATGATAGAACCTAACGGGAACA	Csf3r
Ctla4	Endogenous	TGGACTCGAGGTCCTGCACCAACTGGCTTGGAAACTAGATGAGGCTGTCACAGGGCTCAGTTGCATAAACCGATGGTGATGGAGTGTAAACTGGGTCTTT	Ctla4
Ctnnb1	Endogenous	TCCAGAAAGACTTGGTAGGGTGGGAATGGTTTTAGGCCTGTTTGTAAATCTGCCACCAAACAGATACATACCTTGGAAGGAGATGTTCATGTGTGGAAGT	Ctnnb1
Ctss	Endogenous	CTTAACTTTGGTGATCAAGGATACATTCGGATGGCAAGAAATAATAAAAATCACTGCGGAATTGCTAGTTATTGCTCTTACCCAGAAATCTAAACCATTT	Ctss
Ctsw	Endogenous	CCTGAAGGCAGCAGCCACTCTTCTGCTTCTCCCACATGGCCACTGCCCCTTGTCAGCCCTGCCCACATCCTCTCTGTATGGCTTCATAAACCAAGACTGC	Ctsw
Cx3cl1	Endogenous	CGTTCTTCCATTTGTGTACTCTGCTGCCGGGTCAGCACCTCGGCATGACGAAATGCGAAATCATGTGCGACAAGATGACCTCACGAATCCCAGTGGCTTT	Cx3cl1
Cx3cr1	Endogenous	TCCTGTGTTGGTTGTGATAACCATTTCAGAAGTCTCTCCCAGCCTGTTGCTCACGGCGGCATGTCTGATATCTCCTTGGCAGTCTGTATGTTTGTGTCGA	Cx3cr1
Cxcl1	Endogenous	TGCTAGTAGAAGGGTGTTGTGCGAAAAGAAGTGCAGAGAGATAGAGTTTAGTATTATGTTTTGTATGTATTAGGGTGAGGACATGTGTGGGAGGCTGTGT	Cxcl1
Cxcl10	Endogenous	AGGACGGTCCGCTGCAACTGCATCCATATCGATGACGGGCCAGTGAGAATGAGGGCCATAGGGAAGCTTGAAATCATCCCTGCGAGCCTATCCTGCCCAC	Cxcl10
Cxcl11	Endogenous	TTAAGGCGTCAAAACATGTGACATCCTGGGAACGTCTGACTGTGAGCCCTCCAATAAGAACTCTGTGCCAGGAACCTGACCCTCTGCTGTCTTGGAACAT	Cxcl11
Cxcl12	Endogenous	TAGGGATCCTTTCAAAGTCTCCTTCACAGTGAGGAAAAAGAGAAGGGTAGAAACTTTAGGGAGCCGGATTTGTGTATCAATTCCTCCGCTGACAGTCAGT	Cxcl12
Cxcl13	Endogenous	CTGAGAGGGAATGCTCAAGCTCCGTTGCATACCCAACCCACATCCTTGTTCCTTAAGAAAGGCTATTTGAGAACAGGCATTTAGTGACAACCCACTTCAG	Cxcl13
Cxcl14	Endogenous	GCAGGGTCTACGAAGAATAGGGTGGACGATCATGGAAAGAAAAACTCCAGGCCAGTTGAGAGACTTCAGCAGAGGACTTTGCAGATTAAAATAAAAGCCC	Cxcl14
Cxcl15	Endogenous	AGAGAATATTTCCCTTTCCAATTCGGGAGACCTCTAGACACTTTGCTGATTTAGCTCACAACAGTGATAGGAATTTTCTACGGGACTCCAGTGAAGTCAG	Cxcl15
Cxcl16	Endogenous	CGCAGGGTACTTTGGATCACATCCGAAAATACCTGAAAGCATTTCATCGTTGTCCATTCTTTATCAGGTTCCAGTTGCAGTCCAAAAGCGTGTGTGGGGG	Cxcl16
Cxcl2	Endogenous	GGTGGGGGTGGGGACAAATAGATGCAGTCGGATGGCTTTCATGGAAGGAGTGTGCATGTTCACATCATTTTTTTGTAAGCACCGAGGAGAGTAGAACAGC	Cxcl2
Cxcl3	Endogenous	ACTCTCAAGGATGGTCAAGAAGTTTGCCTCAACCCCCAAGGCCCCAGGCTTCAGATAATCATCAAGAAGATACTGAAGAGCGGCAAGTCCAGCTGAGCCG	Cxcl3
Cxcl5	Endogenous	CCCAGTGAAGATAAGAAGAAAGGGCTGATTCTCTCCACCCACGGATTTTCTTTATGAACTCCCTGCTTTGATGAGAAAAGGGAAACCATTGTCCCTGAAG	Cxcl5
Cxcl9	Endogenous	TAGAACTCAGCTCTGCCATGAAGTCCGCTGTTCTTTTCCTCTTGGGCATCATCTTCCTGGAGCAGTGTGGAGTTCGAGGAACCCTAGTGATAAGGAATGC	Cxcl9
Cxcr2	Endogenous	CCTTGCCTGTCTGGGCTGCATCTAAAGTAAATGGATGGACTTTTGGCTCAACCCTGTGCAAGATATTCTCATACGTGAAGGAGGTTACCTTCTACAGCAG	Cxcr2
Cxcr3	Endogenous	GACAGCTCAGCATATATCCAGGTCTCCTGAGAATCAATCTCAGCAACAAGGACAACACCATTACTGTGCCTTAGCTGCCATGCCCTATCTTGCTGTTTTA	Cxcr3
Cxcr4	Endogenous	CTGTGACCGCCTTTACCCCGATAGCCTGTGGATGGTGGTGTTTCAATTCCAGCATATAATGGTGGGTCTCGTCCTGCCCGGCATCGTCATCCTCTCCTGT	Cxcr4
Cxcr5	Endogenous	ACCGTGCCTTTCTCTTAACCAAGCAGAAAGCTGAAACCGATCTACTTTAGGTAGCTGTCTGGTTCCAACCTAACCAGCATTGGGTCAGCCCCATGTTACT	Cxcr5
Cxcr6	Endogenous	AGTGAGGAGATATCCACTATGGTTCTTGTTATACAGATGACTCTGGGGTTCTTCCTGCCATTGCTCACTATGATTCTGTGCTACTCAGGCATTATCAAGA	Cxcr6
Cybb	Endogenous	TCTGGGACTCTCTCTAGGATAAACAATAGGATCTCAAATGAGTTCCACACCTTCCTTCCAATTCAGAAGTTGAAACCACACCTAAGCCATCTGACTCTGG	Cybb
Dab2	Endogenous	CTGCCCCGAAAGCGCCATCAAAGAAGGAGAAGAAGAAAGGTTCTGAAAAGACAGACGAGTACTTGTTGGCCAGGTTCAAAGGTGATGGTGTAAAATACAA	Dab2
Ddb2	Endogenous	GCCCGGAGGAGCGTTTGGCGCGAAGGTGTCTTAGCTGCGCTACCTGCGACGGCGCTGCCTCATACGTAGTCCCTTCCTGTTTTCTCCACGGAGGCTTTTC	Ddb2
Deptor	Endogenous	CCATGAGGATAATCCTTCGCCACCATGATGTGCTCTCCTAACTCATTTTGGGCACTGTTACCTACACACGTCCTCTTTTCATAGACAAGGAAACTGAGAA	Deptor
Dkk1	Endogenous	GCCAGCCGCCGTGCAAAGTGACCTCTCTTTTCCTGACCTTTGCCTGTTTGCGTCCTTCGGAGATGATGGTTGTGTGTGCAGCGGCAGCTGTCCGGTTCTT	Dkk1
Dll1	Endogenous	CAGACCTCCGGTACTCTTACCGGTTTGTGTGTGACGAGCACTACTACGGAGAAGGTTGCTCTGTGTTCTGCCGACCTCGGGATGACGCCTTTGGCCACTT	Dll1
Dll4	Endogenous	GGGAACAGAGTTGAGGAGTTAGAGGAGCATCAGTTGAGCTGATATCTAAGGTGCCTCTCGAACTTGGACTTGCTCTGCCAACAGTGGTCATCATGGAGCT	Dll4
Dnmt1	Endogenous	CTCGGTCATTCCAGATGATTCCTCCAAACCACTCTATCTAGCCAGGGTCACAGCTCTGTGGGAAGACAAAAATGGTCAGATGATGTTCCATGCGCACTGG	Dnmt1
Dpp4	Endogenous	GACACCGTGGAAGGTTCTTCTGGGACTGCTTGGTGTCGCTGCGCTTGTCACCATCATCACCGTGCCAATAGTTCTGCTGAGCAAAGATGAAGCGGCAGCT	Dpp4
Dsc3	Endogenous	AAAGATGGGGTACACGGACATTTCAGCTGTGGATCCTGATGAACCTATCCATGGCCCTCCCTTTCAGTTCAACTTGGCAAACACTTCTCCAGAAGTCAAC	Dsc3
Dtx3l	Endogenous	TCGCTTACACAATACCAAGTTTGCCGACAACTTTAAAAAAGAGCACCCGAATGTGCACTTTGTGACATCTCAGGAGTCAGTGACCTTGACTGGCTTGCCA	Dtx3l
Dtx4	Endogenous	CCTTTGCCAGCCCATCTCGTAATAAACTTGGACCCTAATGGACATAGAATTGTACTTGGGAAGATGTCTTGATTCAAGAGCTAGATTGACCCTTCTCCTT	Dtx4
Dusp1	Endogenous	TGCGTACTGTACTATCTTGTAAATAGACCCAGAGCAGGTTTGCTTTCGGCACTGACAGACAAAGCCAGTGTAGGTTTGTAGCTTTCAGTTATCGACAGTT	Dusp1
Dusp2	Endogenous	GTGTTCAACTGACATTTAACGCTCTCTCCCCAACTTCCTCCCGGCCCTGTGGGCCAGGGAGGGGCGTTGGAAACAGCACTTTATATTTATATAGAACATT	Dusp2
Dusp5	Endogenous	CTGAGTGCTGTGTGGATGTGAAGCCCACCTCACAAGAGAAGATCGAAGGCGAGAGAAGCCTCCTCAGCCAGTGTGGAAAGCCCGTTCTCAGCGTCGCCTA	Dusp5
E2f3	Endogenous	AGGCTCCCAAATCTTCCTGATGAGTCAGCAAGTGAGAAGATGTGCAATCAGGTGTCTCTCACCTGTCCTTCCCTCCCCTCCTTCCTCTCCTTTCCTTGCG	E2f3
Edn1	Endogenous	GTCCAAGCGTTCCTTGAAAGACTTACTTCCCAATAAGGCCACAGACCAGGCAGTTAGATGTCAGTGCGCTCACCAAAAAGACAAGAAGTGCTGGAATTTC	Edn1
Egf	Endogenous	ATCTGAGCGGGAAGCATCATCGAATAATCATCCAGGAGAGAATCTCGAGGCCGCGAGGAATAGCTGTGCATCCAAGGGCCAGGAGACTGTTCTGGACGGA	Egf
Egfr	Endogenous	CTGACAGAGGTCGCAACCCGCAGGTTGAGAGCCACTGCCTTCAAGGCTTTAATCAAGAGAGTAGTGAGCTGAGGGCTTTACTGGTAAGTCAGGGGCAAGT	Egfr
Egr1	Endogenous	CAGCGCTAGACCATCAAGTTGGCATAAAGAAAAAAAAATGGGTTTGGGCCCTCAGAACCCTGCCCTGCATCTTTGTACAGCATCTGTGCCATGGATTTTG	Egr1
Eif2ak2	Endogenous	CATGCATTGTGTTCTGATCCCACTCTGAACCCTCTGCCATTCATGCCTTGTCTGTCATGTGAACTGTTGCCTCTGAATGTGGGGGTCCAAATTAACCCTC	Eif2ak2
Eif2b4	Endogenous	GCGAAGAATCGAGATCCGAGATGAAGACTGAACTTTCTCCTCGGCCCGGGGCAGCAGGGCGGGAGTTGACCCAAGAAGAGAAGCTTCAGCTTCGAAAAGA	Eif2b4
Eif4ebp1	Endogenous	CTGCTCCTCACTCAGGGTGCCAGCTCTGCCTTGAATTTTGTGAACACCAGCACATACCTCCTTGTGCCTCTGTCTATACCGAGCTGCTACTGCAGGGGAA	Eif4ebp1
Elob	Endogenous	CCGCCAGAGGAGCAGCGGCTTTACAAGGATGACCAGCTCCTTGATGATGGCAAAACTCTGGGCGAGTGTGGCTTCACTAGCCAGACAGCACGGCCACAGG	Elob
Eno1	Endogenous	CTGCTCCGGTACAGGGTCGCGCTCGCGTCTGTCCTTAAGGCTCTCCTCGGTGTCCACGGCACCCTCTTTCCTTGCTTTGCAGCGATCCTACTGCCAGAAA	Eno1
Entpd1	Endogenous	CAAACCCAGTCCAAGCCTGCCCTTTGGATAGGAGAGTTTTCTAAAGTAGATAAATATGTGCTAAAGCCAAAGAGTCCTTGCCAAGGAGCTTATGTGCTCG	Entpd1
Eomes	Endogenous	ACTGAAAAGGTCGTTCAAGGTGCTGGATTGATTCATTTATGGGAAACGAGAAATGTTCAGAAAAAGCAGGCTATGAAGAACGAGTGCCCGGTGCTATTAA	Eomes
Epcam	Endogenous	TGAAATTTGTACTCGTAAATACAAGCAGCTGGACACCGGCATTACCGATCGTAAAATTAGACGAACGTCTTATAGGTGCAGGTCCAGTGTGGTACTCAGA	Epcam
Epm2aip1	Endogenous	TCAACCTGAAGCCTGATCTAAAAGCAGCACTGATTTGTAACTCCTCCTCGTGCAGTTTACAAGCTGATGTGCTCCGTTCTGTCTTAAATACGGCAGCACA	Epm2aip1
Erbb2	Endogenous	GTTATATGAAAGTCGGGGGGTGCTGTCCCCTTTCTCCATTTGCAATGAGATTTGTAAAATAACTGGACCCCAGCCTATGTCTGAGAGTGGTCCCGGGCCG	Erbb2
Ero1l	Endogenous	ACCTTCAGCCTAATTCCTGCTGGCAAGTTTCATGAGCTTTTTGGTGAGAGTCTCTGCTTGATATCCAAGACCCTCCTCTTGTGTTTGCCACTGTTCTGAT	Ero1l
Esr1	Endogenous	GGCCCACGCGCTGCTGAGCCCTCTGCGTGCGCGGGGAGCCAGTCTGTAACTCGCCGGCTGCCACTTACCATGACCATGACCCTTCACACCAAAGCCTCGG	Esr1
Exo1	Endogenous	AGCCTTCCAGTAGGGATTCAGGTTCAGAGGAGTCGGATTGTAACAATAAGTCACTTGATAATCAAGGGGAACAGAACTCCAAGCAACACTTACCTCACTT	Exo1
Ezh2	Endogenous	AGAGTCAAGGAGTCCAGTATCATAGCACCTGTTCCCACTGAGGATGTAGACACTCCTCCAAGAAAGAAGAAAAGGAAACATCGGTTGTGGGCTGCACACT	Ezh2
F2rl1	Endogenous	ACGCAACAACAGTAAAGGAAGAAGTCTTATTGGCAGATTAGAAACCCAGCCTCCAATCACTGGGAAAGGGGTTCCGGTAGAACCAGGCTTTTCCATCGAT	F2rl1
Fadd	Endogenous	TTAAGTGGCAGTATTGAGTTACTACTGTTGCAGGGCTTTTGGGCCACCAAAGAAACTTATCCCTTTGTACAGAGTCCCTTCAACCACGTTGGGGATTAAA	Fadd
Fam124b	Endogenous	GACAAATGTTGACACTGGCTTCACCATCATCAATTCCGAACCCAGGCGATCTTTTCCGAGCAGATTTCCCAGGGATTTTCAGAGCAGCCAACCACCACGC	Fam124b
Fanca	Endogenous	AGAGGTAGAAGAGCCACAGTGTAAAAGGTTGCGTCTCAGTGAGCTGATCGACCGCGACAGTGCTGACGCTTCCTCCGACCGGTCTGCTTCCTTCATCCGC	Fanca
Fap	Endogenous	CTGAACCAATGCAAGTACTAGCGTGTAGGACAGTCTGAAGGCTTCACATGGACGACTTGGACCATGAATATTGTAAAAGCCGCTAAAAATTTAGGAGGGC	Fap
Fas	Endogenous	GGCTCACAGTTAAGAGTTCATACTCAAGGTACTAATAGCATCTCCGAGAGTTTAAAGCTGAGGAGGCGGGTTCGTGAAACTGATAAAAACTGCTCAGAAG	Fas
Fasl	Endogenous	TTTTCTGAGCCGACCTTTGATCCTAACGGAGAAGTAAGAGGGATGTTTGAGGCACAAATCATTCTCTACATAGCATGCATACCTCCAGTGCAATGATGTC	Fasl
Fbp1	Endogenous	GGACAAAGATATATTAGACATCGTTCCCACCGAGATCCACCAGAAGGCACCAGTCGTCATGGGGTCCTCTGAAGATGTGCAGGAGTTCCTGGAGATCTAC	Fbp1
Fcer1a	Endogenous	GAGAAATCTGTACTGACCTTGGACCCACCATGGATTAGAATATTTACAGGAGAGAAAGTGACCCTTTCCTGCTATGGGAACAATCACCTTCAAATGAACT	Fcer1a
Fcgr1	Endogenous	GAGACAGTTCCACACAATGGTTTATCAACGGAACAGCCGTTCAGATCTCCACGCCTAGTTATAGCATCCCAGAGGCCAGTTTTCAGGACAGTGGCGAATA	Fcgr1
Fcgr2b	Endogenous	TTGGTTCCCAATGGTTGACTGTACTAATGACTCCCATAACTTACAGCTTCCCAACTCAAGACTCTTCTGCTATCGATCCACACTGCCACTAAAATTAATC	Fcgr2b
Fcgr3	Endogenous	TCTGACCTCCACCATCCACCATGGCAGGTGCACACAATAAATTAAAATGTCATGTATATTTTTAAACAAGAGACAGGGGCAGGCTAAGGGTTGATGGCAT	Fcgr3
Fcgr4	Endogenous	GGCGATCCAGGGTCTCCATCCATGTTTCCACCGTGGCATCAAATCACATTCTGCCTGCTGATAGGACTCTTGTTTGCAATAGACACAGTGCTGTATTTCT	Fcgr4
Fcgrt	Endogenous	GCCTCGGATAATTCCTCAGTGCCCACGGCTGTGTTTGCCCTCAATGGTGAGGAGTTTATGAAATTCAACCCAAGAATCGGCAATTGGACTGGGGAGTGGC	Fcgrt
Fcnb	Endogenous	AAGACAATGACGGCAGTACTTCCAGCTGTGCCATGGGTTACCATGGAGCCTGGTGGTACTCCCAGTGCCACACTTCCAACCTGAATGGCCTCTACCTGAG	Fcnb
Fcrlb	Endogenous	AGCACCCGTCAGTGATCCTATCCACCTCTCTGTGTCTAACGACTGGCTAATTCTGCAAGTGCCGTATGCTGCGGTGTTCGAGGGAGAGCCCTTGGTGATG	Fcrlb
Fgf13	Endogenous	ATATTAACCAAAGGCAGGGTTGAATCTGAATTGGCATCTGAGGTTCAAGGTAACCGTGTTCTTATGGGTTTTCCTCTCTCGCACCCTCTCCTTTCCACCC	Fgf13
Fgf18	Endogenous	TTGACCTGAACCCCATGACAAAGGACTCACACAAGGGGACCGCTGTCAACCCACAGGTGCTTGCCTCTCTCTAGGAGGTGACAATTCAAAACTCATCCCC	Fgf18
Fgf9	Endogenous	TTCAGCCCACTTCTGTGACAACAGGGCTAACATCAAACATGGCACTGATTAAAAATTCCCAAGGGAGAGGAAAATCCATTTACATAGCTCCTCCTCCTCT	Fgf9
Fgfr1	Endogenous	ATCTCTTTGGTTGGGGTCAACTTGGCAACTCAATTCTGCCACCTGCTGGTTGCTTTGGTACCTTGGTCTCTTATTCAAACCCACACCACTCAAGCCTTAG	Fgfr1
Flnb	Endogenous	GCTTCGTCTTGGGGCCCTGATCACTTTGACTTCATCCTAAAGCCAGCTCTGGAGCAGAAGGCATGCAGAACACTCCATACCCCATTTTTGGAATTCTGTA	Flnb
Flt1	Endogenous	AACGTGTCTCTAGAAGACTCGGGCACCTATGCGTGCAGAGCCAGGAACATATACACAGGGGAAGACATCCTTCGGAAGACAGAAGTTCTCGTTAGAGATT	Flt1
Fosl1	Endogenous	GCAGCAGAAGTTCCACCTTGTGCCAAGCATCGACAGCAGCAGCCAGGAACTGCACTGGATGGTGCAGCCTCATTTCCTGGGACCCACTGGCTATCCCCGA	Fosl1
Foxp3	Endogenous	TGCCTTCAGACGAGACTTGGAAGACAGTCACATCTCAGCAGCTCCTCTGCCGTTATCCAGCCTGCCTCTGACAAGAACCCAATGCCCAACCCTAGGCCAG	Foxp3
Fpr1	Endogenous	TTGCCATTTGCTATGGGTTAATAACCACTAAAATTCACAGGCAGGGCCTGATCAAATCCAGCCGTCCTTTGCGGGTTCTCTCCTTTGTTGTGGCTGCCTT	Fpr1
Fpr3	Endogenous	GAGTGAGGACTCTGGTCATATCAGTGATACAAGAACCAATTTGGCTTCACTTCCTGAAGACATTGAAATAAAGGCAATATGAGGAGGGGGCTGTGGGATG	Fpr3
Fstl3	Endogenous	TTTGGGGAGCCCTGGTCTGGACAGTGGGATCCGTGGGCGCCGTGATGGGCTCCGAGGATTCTGTGCCCGGTGGCGTGTGCTGGCTCCAGCAGGGCAGAGA	Fstl3
Fut4	Endogenous	GGTTTTTGAAAGCCGGTGGGTATGAGATAGTGGAAGGATTGTGCCCACAGGTGGGGTTTTCTTTGGTGGTTGGATTCCTCAAACCGTCTGAACCTGGAAA	Fut4
Fyn	Endogenous	GAGCATTTTAAGCAAAAAGCAGCCAGCCAGTTCTACCACAAGAGCTGCAAGACGGAGACCACACAAACTTCCTGTATAAATATGAATGCTGAAGGGTTCA	Fyn
Fzd8	Endogenous	TCATGGTCTCTCCTTGCTGACCTATGGGTTACAGCTCTTCATGGTGTGTGTGGATGGACAGTTTGCTAAGGTGGCCATTCTACTTGGCCTGTTTATTTGG	Fzd8
Fzd9	Endogenous	CAGGGAGTGGTCCTAGTCCACAGAGGGTCCCAGGATAAGAAGGGGCAGAAGGGGGCAGGGTCCAGTGCAGAGTTATTTAATGATGTAATTTATTGTGGCA	Fzd9
Gas1	Endogenous	AAACTGTTTTCCGGTGAGGGAACACATAGTACTGGTAACGACTTAAATTGCTTGTGACCACTGAGAAACACAGCAATCGTAAGTAAATAGAAAAGTTCCC	Gas1
Gata3	Endogenous	CATGCGTGAGGAGTCTCCAAGTGTGCGAAGAGTTCCTCCGACCCCTTCTACTTGCGTTTTTCGCAGGAGCAGTATCATGAAGCCCGAAAGCGACAGATCT	Gata3
Gbp2	Endogenous	GAGCATCTTCAGGCTTTGAAACAACTGCTATGAAACTCAATTCACCTCAGCTCAAAATCAATCATATGCGACTCCATTTTGGGGTCACTGTCTGACCACT	Gbp2
Gbp2b	Endogenous	GAAGCAGCAAATAGAGCATTGGCAGAAATGCAAAAGAAGCATGAGATGCTGATGGAACAGAAGGAACAGAGTTATCAAGAGCACATGAAACAGCTGACTG	Gbp2b
Gbp3	Endogenous	CTGAAGGTCCAAGAAGAACTGCTTATTGAAGGATTCAGAGAGAAATCTGATATGTTAAAGAATGAAATAAGTCACCTGAGAGAAGAGATGGAAAGAACAA	Gbp3
Ghr	Endogenous	GCTAAAAGGGAAAGCCAACGACAAGCTGCAAGAATTGCTCATGAATGGACCCAGGAATGGAAAGAATGCCCTGATTATGTCTCTGCTGGAAAAAACAGCT	Ghr
Gimap4	Endogenous	GTATTACTGCCTGCTGCCTTGAGTTCTTCCTCAAATGAAAACCACCCAGGAGGCCACAGAAAATGACTGTAAGATGAACCCATTTCTCCACTGGATTCTC	Gimap4
Gimap6	Endogenous	CTTATGGAGGAAGTCGAATTGATCTTGTGGGAAAATGAGGGCCATTGTTACACCATGGAATTTCCAAATGTTCCCAGCAAGACACTGTAACCAAATAGCA	Gimap6
Gli1	Endogenous	GAGCCAGAGGTTGGAACTTCTGTGATGGGCAATGGTCTGAACCCATACATGGATTTTTCCTCCACTGATACTCTGGGATATGGGGGACCCGAGGGGACGG	Gli1
Gls	Endogenous	AGAGTAGTTACCAATGCCAGCTGAACTGTGTGGTCTTCATGGTTTGCGTTCTGTACATTTTCAAGCCCTGGTGATGATACGCTCATATGCACTTAGGAGT	Gls
Glud1	Endogenous	CCCTTCCAAGGCTTTGCATTCTGCTCACCGCTTCACCAGCAGCAGGCTAGAGACTGCCTGCCTGGGCTTGACTTTTGTTTGGGGGGTTATTGGCCAGGGC	Glud1
Glul	Endogenous	CCAGGCTTAGGTTTAGGGGATGCGTATACTTACTCCACACACGAGTTAGAAGTATGAGTTGGCTGGTCAACTTGAACACTGTTACTGATGGGTGGGTGGG	Glul
Gm5150	Endogenous	GAAGTTCCAGAAAGGACCATCAGAGCCTGACATTGAGATTCAGTCTGGAGGCGGCACTGAGTTGTTTGTCCTTGGAGCCGCTGGAAAAGAGTTGAAGGTG	Gm5150
Gmip	Endogenous	TAAACAGCTAGGCAACACAGGTGCAGGTGTTTCGGGGTCAAGACTCAATGGTCAATACAGATCAGTAGATCCTTGGGGACTACCCGAGTCTCTGACCTCT	Gmip
Gng4	Endogenous	TTAGTTTCACTACTGGGCACGAGATGAGAGGCTAAGACTCTGGTTTTGTTGGGCTGTAAGAAGATCTCTTTATTCTGTGGCTCATGTTGGCATCATCAAC	Gng4
Got1	Endogenous	AGAACCTAGATTACGTCGCTACCTCCATCCATGAAGCCGTCACCAAAATCCAGTGAAGAAACACCTCGTAGTTCACGCCACCAAAGCAGTTCTTGTCACA	Got1
Got2	Endogenous	GGCTGGTATCTGGAACTTCGTCGGCTCTAAACCAAACTCCCTCATCCTTTTGTCTCCAGCTTTTCTGAAAGTTTACACACGCAAGAAAAATCACAGCACC	Got2
Gpc4	Endogenous	AGTTCGAGTACAACGCCACTGACCATTCTGGGAAGAGTGCCAACGAGAAAGCTGACAGTGCCGGTGGTGCCCATGCAGAGGCAAAGCCCTACCTCCTCGC	Gpc4
Gpr160	Endogenous	CAAGGCCGCCCTCTACTTTCCTTTCCCACTCCACTGCGGTTACGCCCTGAGCTGCAGAGAAGCACTCTTGCCCAGGCTCATCGTGTGCTTTCTTGGGACC	Gpr160
Gpsm3	Endogenous	GGTAACCAGAGATGGAAGACCCGGCTAAAATTGCTGTATTTACCACCCACTTTCCCTGGGGACTGGACTTGGGACAAGTACTCTAACCATGAAGATAAGC	Gpsm3
Gzma	Endogenous	TGATGGTATTTTGCGAGGCATCACCTCTTTTGGTGGAGAGAAGTGTGGAGATCGCCGATGGCCTGGTGTCTATACTTTCCTCTCAGATAAACACCTCAAT	Gzma
Gzmb	Endogenous	TTCTGCCACCATGCTGTGACAACCCAACTGACATCTTCCTATGGAAGTTTGCCCTCTCCACAAAAGAAGTAGAATGTTTGCATTGGAGCTGGGCATGCTC	Gzmb
Gzme	Endogenous	GCTGGAGCAGAGGAGATCATCGGCGGCCATGTGGTGAAGCCACACTCCCGCCCCTACATGGCGTTTGTTAAGTCTGTGGATATTGAAGGTAATAGGAGAT	Gzme
H2-Aa	Endogenous	TCAGAAATAGCAAGTCAGTCGCAGACGGTGTTTATGAGACCAGCTTCTTCGTCAACCGTGACTATTCCTTCCACAAGCTGTCTTATCTCACCTTCATCCC	H2-Aa
H2-Ab1	Endogenous	GAAAGGCATTTCGTGTACCAGTTCATGGGCGAGTGCTACTTCACCAACGGGACGCAGCGCATACGATATGTGACCAGATACATCTACAACCGGGAGGAGT	H2-Ab1
H2-D1	Endogenous	GTGACAGACGATGTGTTCAGGTCTCTCCTGTGACATCCAGAGCCCTCAGTTCTCTTTACACAACATTGTCTGATGTTCCCTGTGAGCTTGGGTTCAGTGT	H2-D1
H2-DMa	Endogenous	TGGCCTTTGGCCTCGGTGTGCTAGGCACCATCATGGGCATTGTCTTCTTCCTCTGCTCCCAGAGACCGTGCTCAGGTGACTGATTCTTCTCAAGGAGATC	H2-DMa
H2-DMb1	Endogenous	CTCTATTCAGGTCCCCTTCCTGAAATAAATATTAGTAGTTTGGGGGGGTATTTATAATGAAGTCTGTCCCAGGTGGGGGAGCTGAGGTGAGCTGAAATGA	H2-DMb1
H2-DMb2	Endogenous	TTTGGGGTGCTGTCTAGATTGGCTGAAATAATTTCAAATATCCTCAACGAACAGGAGAGCCTTATTCATCGCTTGCAAAACGGGCTTCAGGACTGTGCCA	H2-DMb2
H2-Eb1	Endogenous	AAACATGTCCTGCTTGGCCCACATCCCTCCAGAGACACTGCTCTTCCAGGACCTGGCTCCTCCTGATTCTCCACCCTGGAGATCTGTGCTCCTGATGGCT	H2-Eb1
H2-K1	Endogenous	CCCGCAGAACTCAGAAGTCGCGAATCGCCGACAGGTGCGATGGTACCGTGCACGCTGCTCCTGCTGTTGGCGGCCGCCCTGGCTCCGACTCAGACCCGCG	H2-K1
H2-M3	Endogenous	GAGTCTCCTCTCCATACCTGTGTCTCCTCCTTTTCTCACCTGTACCACAGGGGGATCCAGGACTTCTTCATCCCTTGTGGAACTTTAGGTTTCTATGGGC	H2-M3
H2-Ob	Endogenous	GGCAACCGCAGTGAAGTATAAATCAATGACTTGTTCAAGGCAAAACCCGTGTCATCACTTGCTCAGGTCAAAACACAAACAGTGGTGGTCTCTGTGGAAT	H2-Ob
H2-Pa	Endogenous	CTTCTGAGACCGTCTTCTGCCCAGCACAGAACTCAGATTTCACAAGTTCCACTACCTTACCATCATACCCACGGCGCAGGATGTGTATAACTGCAGAGTG	H2-Pa
H2-Q1	Endogenous	CGGCATTCACACCTTCCAGAAGTTGTCTGGCTGTGATCTGGGGTCAGATGGGCGCCTTCAAAGCGGGTACCTGCAGTTCGCCTATGATGGCCTTGATTAC	H2-Q1
H2-Q10	Endogenous	TGAGCCCCTCACCCTGAGATGGGAACCTCCTCCTTCCACTGACTCTATCATGTCACACATTGCTGATCTGCTGTGGCCATCATTAAAGCTCTGGTGGTAT	H2-Q10
H2-Q2	Endogenous	ACCTGGCAGCACTGAAGACCCGAAGCAAGTTGGAGCAGGCTGGTCTTGCAGAGAAGCGCAGGGCCTACCTGGAGGTCGATTGCTTGACGTGGCTCCGCAG	H2-Q2
H2-T23	Endogenous	TCTCCCTGAACGAGGACCTGCGTTCCTGGACCGCGAATGACATAGCCTCACAGATCTCTAAGCACAAGTCAGAGGCAGTCGATGAGGCCCACCAACAGAG	H2-T23
H2afx	Endogenous	TGGCCTCATACCAGTTGACCCTGTCGCCATTCGTAGGCCAGTGTGGTGTGGCGGGGCCAAAAATGGTTGTAATGTGAACCCAGTTTCTCTAGGAATACCT	H2afx
Havcr2	Endogenous	TGGAAAATGCTTATGTGTTTGAGGTTGGTAAGAATGCCTATCTGCCCTGCAGTTACACTCTATCTACACCTGGGGCACTTGTGCCTATGTGCTGGGGCAA	Havcr2
Hc	Endogenous	AGTAGCTGTGTTTGTGCTGAACCTCCCATCAAATGTGACGGTGCTAAAGTTTGAGATCAGAACTGATGACCCAGAACTTCCCGAAGAAAATCAAGCCAGC	Hc
Hck	Endogenous	GAGGACTTCACAATCTCTTTCTGACTCTAGTCATCTGCAATCCGCCACTCTCAGGGCCTCCAAGTTGGTATGTCTCATTTGCCTGGAATGACTGAATTCA	Hck
Hdac11	Endogenous	CCCTGGATCTGCTCCAACTACAGGACTCATATTCATTACCATGTGGGGGTATTCCCACAGCCTTCATAGTGTCCTTCATACTCCCTCTGCTGGAGTCGGG	Hdac11
Hdac3	Endogenous	TTGGACGGTACTAAAGTCACCTCTGACTTCCTTCTGGGTTCCCCTACTACAGTTCTTGCTTCCATGCAAGGTGAACCTGAGGGGAGGAAGGCGTGGCTCT	Hdac3
Hdac4	Endogenous	GAACCACCACTGTAGCCCGAAGCTGCTGTTCTCTCCTTTGTTTGTCTGTCTTGAAGCTCAGCCAAGAAACTTACCCGTATCACTCCTGCGTCCTGCCTTG	Hdac4
Hdac5	Endogenous	GAGAGTGGTCCTGATGAAGGCCCTGACTTAGAAGAGTCCAGTGCTGGTTACAAAAAGTTGTTCGCAGATGCCCAGCAGTTACAGCCCCTCCAGGTGTACC	Hdac5
Hdc	Endogenous	GGAGTTGGGGAACCCCTCGAAATTGCGTGCAGTTTGTGTGCTTATTATGTGTGTGTGCATCTTGAGGGAAGCAAGCCCATTATTTTGATCATAACCTCAC	Hdc
Hells	Endogenous	ACCGTCGGAAATTAGTAAAGAATATCCACAAAAGACAAGGGACACTGCAGATTCATCCTGTGGTGGTCACATCATTCGAGATCGCTATGCGAGACCAGAA	Hells
Herc6	Endogenous	AAAAGAAAAGATCGTGAAGGCGCCAAAAGAGAAATCAGCTTGATATTTTCATCTTCTGCTTGTTTGACAGCGAGCTTTCTGAAGAAAAGAGATGCTGGAG	Herc6
Hes1	Endogenous	TCGCTCACTTCGGACTCCATGTGGAGACCGTGGCGGAACTGAGAGCCTCAGGCCACTGCTACCCGTAAAGTCCCTAGCCCACCTCTCTCTTCTGACGGAC	Hes1
Hey1	Endogenous	TCAGTCTCACGGATTTCACCGTTCACCAGTGTCGACCTGCGTAAGCGATCGGAGTCTGAAAGTAGCTTGGTGCCTGTGAAACACAACCCGATTTTCCTAG	Hey1
Hif1a	Endogenous	CATGTCTAATCTGTTCCCATTAGCAGGTGAAGGAAGCTAGGGCTGAAACAAGAGTTTTCCGCGCTCTCAGGGAGCTATGTGGCATGTCAGAATCTTAGGT	Hif1a
Hk1	Endogenous	TGTCCGTCCGTGGAGCCAGTCCTAGCCACATTATTGACAGTCTTGCATTTTGTTTTGTCTCGTGATGGTGGTGGTGGTAGGGGTACGCTTAGGTGGGCAG	Hk1
Hk2	Endogenous	TTTTAAAGTCACATCAGATCGTTGGAGCAGACCACATGAAGCATCGAGAGAACTCGACCAAACCTCAGGGGCGTCTCGGGGTGTTTGTACATTTATTTGC	Hk2
Hmga1	Endogenous	CCATCCTGACAAGGCTAACTTCCCATTTAGCCGCAGCCCGACCTGCTGCGCACCTCCCTCAGAGCCGTGGCTCTCTGGGCGCTTTGTTTTGCGGGTCCCT	Hmga1
Hmgb1	Endogenous	GTGGGACTATTAGGATCAAGCAATCTGAACGTCTGTCCTTGAAGGACTGATAGAAAAGTACCTTCTAATCCTTACACGAGGACTCTCCTTTAACCGCCAT	Hmgb1
Hnf1a	Endogenous	GCCATCTGTTCCCTTGGATGTGTCTTCTGATGCCAGCCTGGCAACTTGCATCCACTAGAAAGGCCATTTCAGGGCTCGGGTTGTCATCCCTGTTCCTTAG	Hnf1a
Hras	Endogenous	AGGATAGTCAGGTGATATGACCTATTGTCCTTTAACTAATGGGAGGAGGAGGGCTCTGAGAGTAAGAGGGTATCCCTTGTCTCCAGCAGGAAACACATTT	Hras
Hsd11b1	Endogenous	GACATGACATTTGCGGAGCAATTTATTGTCAAGGCGGGAAAGCTCATGGGCGGACTGGACATGCTTATTCTAAACCACATCACTCAGACCTCGCTGTCTC	Hsd11b1
Icam1	Endogenous	CACATGGGTCGAGGGTTTCTCTACTGGTCAGGATGCTTTTCTCATAAGGGTCGACTTTTTTCACCAGTCACATAAACACTATGTGGACTGGCAGTGGTTC	Icam1
Icam2	Endogenous	GAAGTGGAAACAGTTCTTAGTCTCAAACGTCTCCAAAGACACGGTCTTCTTTTGCCATTTCACGTGTTCGGGAAAGCAGCACTCGGAGAGTCTCAACATC	Icam2
Icam5	Endogenous	GTTTTCCTGTGAAGTTGATGGGAAGCCAGAACCACGTGTGGAGTGCGTAGGCTCGGAGGGTGCAAGCGAAGGGATAGTGTTGCCCTTGGTGTCCTCAAAC	Icam5
Icos	Endogenous	TTCACAATGGAGGTGTACAGATTTCTTGTAAATACCCTGAGACTGTCCAGCAGTTAAAAATGCGATTGTTCAGAGAGAGAGAAGTCCTCTGCGAACTCAC	Icos
Icosl	Endogenous	CCCCACAGACGCCATTTCAACTTGAGTGGTCTGTATGTCTATTGGCAAATCGAAAACCCAGAAGTTTCGGTGACTTACTACCTGCCTTACAAGTCTCCAG	Icosl
Id4	Endogenous	TTTGAAGGTGCAGTTAAACTTCGAAGCTTAAGTGTTGTCGACCAGACTGCTAAGTAGAAGAGCAATCGTGAATCCAACCTTAGAGGCTACATTGTGACAA	Id4
Ido1	Endogenous	GCATCTTCCAGAGTCTTGATGTCCTTCTGGGAATAAAACACGAGGCTGGCAAAGAATCTCCTGCAGAATTCCTCCAGGAAATGAGAGAGTACATGCCTCC	Ido1
Ier3	Endogenous	GAGCCTTTGAACCTGACCTCGGAGTCCTCGGACTATGCGCTGGATCTTAAAGCTTTTCTCCAGCAACATCCGGCGGCCTTCTAAACGCGATGGGTCACAG	Ier3
Ifi203	Endogenous	GGTAAGGAGCATACATAGGGATTTGGACAGCTGAAATGTAGGCAAGAAGAGGCAAGAGCTAAGGATGGGTAACTCTCTCATCTTCTAAATCCATGTGTTA	Ifi203
Ifi27	Endogenous	GGTTCCTGTTTGGAAACTTAACTGGTCCTCATGGCGTTTTCGGGCACAGGGACACTGGTGGCTTCCATTGTCTCCAAGATGACATCTTCAGCAGCCATGG	Ifi27
Ifi35	Endogenous	GTCTCTCCCTATGTGAGTGGTGAGATCCAGAAAGCCGAGATCAAATTCCAGCAAGCCCCTCATTCAGTGCTGGTGACAAATATTCCTGATGTCATGGATG	Ifi35
Ifih1	Endogenous	ACAAATCAACGACACGATCCGAATGATTGATGCATATAGCCACCTGGAGACATTCTACACTGATGAGAAAGAAAAGAAGTTCGCAGTCCTCAATGACAGC	Ifih1
Ifit1	Endogenous	AACAGGGCCTTGCAGGCATCACCTTCCTCTGGCTACTTACATTATCAAAAAGGGCTCTGCTACAAGCAACAAATCTCCCAACTGAGGACATCCCGAAACA	Ifit1
Ifit2	Endogenous	ACAACGAGTAAGGAGTCACTGGAGAGCAATCTGCGACAGCTAAAATGCCATTTCACCTGGAACCTGATAGCAGAAGATGAGTCCTTGGATGAGTTTGAGG	Ifit2
Ifit3	Endogenous	AATTGTGGTGGATTCTTGGCAGTTGCAGGGATAAAGGAGTGGCTGAATGGTTTTGGGGTTTGGGAGGCAACGCACTTTGGGGCACAGGCAGGCTTTTCCT	Ifit3
Ifitm1	Endogenous	CCTCCACCGCCAAGTGCCTGAACATCAGCTCCCTGTTCTTCACCATCCTCACGGCCATCGTCGTCATCGTTGTCTGTGCCATTAGATGATGTGAGATGTC	Ifitm1
Ifitm2	Endogenous	GCTTCCTCCAAGCTATGAGACAATCAAAGAGGAGTACGGGGTGACTGAGCTGGGGGAACCCAGCAACTCAGCTGTTGTGAGGACCACCGTGATCAACATG	Ifitm2
Ifna1	Endogenous	CTGCAAGGCTGTCTGATGCAGCAGGTGGGGGTGCAGGAATTTCCCCTGACCCAGGAAGATGCCCTGCTGGCTGTGAGGAAATACTTCCACAGGATCACTG	Ifna1
Ifnar1	Endogenous	TGGGAAAACACTTCCAATACTAAGATAAGCATGGAGAAGGATGGCCCAGAGTTCACCCTCAAGAACCTGCAGCCGCTGACTGTGTACTGTGTCCAGGCCA	Ifnar1
Ifng	Endogenous	CTAGCTCTGAGACAATGAACGCTACACACTGCATCTTGGCTTTGCAGCTCTTCCTCATGGCTGTTTCTGGCTGTTACTGCCACGGCACAGTCATTGAAAG	Ifng
Ifngr1	Endogenous	AAAGCATAATGTTACCTAAGTCCTTGCTCTCTGTGGTAAAAAGTGCCACGTTAGAGACAAAACCTGAATCGAAGTATTCACTTGTCACACCGCACCAGCC	Ifngr1
Ifngr2	Endogenous	CATCCTGATTCCGTTGGGCATCTTCGCATTGCTGCTCGGCCTGACGGGCGCCTGCTTCACCCTGTTCCTCAAATACCAAAGCCGAGTGAAGTACTGGTTT	Ifngr2
Igf2r	Endogenous	TGTGTTTAATCTTAGCCCACTCAACGATTCTGCTCAAGGACATGTGGTCTTAGGCATCGGAAAGACTTTTGTGTTCAATATCTGTGGTGCAATGCCTGCC	Igf2r
Ihh	Endogenous	ATCTGTCTTTGGACTGCTTACTCCAATGTTTCTCGGGGCCTGGGATTGTGACTTTACTGTTGGCAACTGATCACAGTATGAAGAGAGGCTGCCCGTAGAT	Ihh
Ikbkb	Endogenous	GAGCTGGCCCGTGGCTCTGCATGTGACGATGTTCTGGTATCTCCAGGTGGACATCTCACTCTGCCAGCAGCTGTGATACTTGCCCGCAGCAGCCTAGGCT	Ikbkb
Ikbkg	Endogenous	ACAGCTTTTCTTCTCTCCAACTGGTACCTTTCTTGCCGGTGAACTGCAGGCTCTCCTCCCAGGGCATGTGGCACTTGGGTCTATAACATGTGTTACCTCT	Ikbkg
Ikzf1	Endogenous	ATGTTAGTGACAGGATTGCATTGCATCAGGAACATTCACAACATCCATCCTTCTAGCCAGTTTTGTTCACTGGTAGCTGAGGTTTCCCGGATATGTGGCT	Ikzf1
Ikzf2	Endogenous	AATTATGGAACTGTGATCTAAAAACGGTTTGACAGTGGAGCACCAGAGAGGATGTCCACCACTCACTTGCCCTTCGGTACGACTAAGCTCTGAGTTTGCG	Ikzf2
Ikzf3	Endogenous	CCTTATCCAGTAGACTGAACTCAAACCCACAGTCCCACCCAGTTCTGTTAGCTCTCAATCATGTCCACATGAACAGTCAGGGAAATAACTGTCTTCATTC	Ikzf3
Il10	Endogenous	GGGCCCTTTGCTATGGTGTCCTTTCAATTGCTCTCATCCCTGAGTTCAGAGCTCCTAAGAGAGTTGTGAAGAAACTCATGGGTCTTGGGAAGAGAAACCA	Il10
Il10ra	Endogenous	CTGTCTGTCTGTGTTAGTACACTACCCTTTAGGTGGCCTTTGGGCTTGAGCACTGGCCCAGGCTTAGGACTTATGTCTGCTTTTGCTGCTAATCTCTAAC	Il10ra
Il11	Endogenous	GCGCTGGGACATTGGGATCTTTGCAGCTTCCTGGTGTGCTGACAAGGCTTCGAGTAGACTTGATGTCCTACCTCCGGCATGTACAATGGCTGCGCCGTGC	Il11
Il11ra1	Endogenous	CTGGGGTCCCACAACTCAGTGGAGCGGGAGACAGTTCTTAGCCTGTAGGAGGAAGTCTTGGAGGCCATGGGCACTCAGTCACTGTGATTATCAAGATGAG	Il11ra1
Il12rb2	Endogenous	CCTAGCCATGAAGGCTATTTACCCTCCAACATAGAAGATCTGTCACCACATGAGGCTGACCCAACTGATTCTTTTGACCTGGAGCATCAACATATTTCTC	Il12rb2
Il15	Endogenous	CTTGCAAACAGCACTCTGTCTTCTAACAAGAATGTAGCAGAATCTGGCTGCAAGGAATGTGAGGAGCTGGAGGAGAAAACCTTCACAGAGTTTTTGCAAA	Il15
Il16	Endogenous	AGCTGTTGGATGAAAAGGCCAGTAAGCTTTACTCCATCAGCAGCCAGCTATCATCTGCTGTCATGAAATCCCTGCTGTGCCTTCCATCTTCAGTCTCTTG	Il16
Il17a	Endogenous	ACCTCAAAGTCTTTAACTCCCTTGGCGCAAAAGTGAGCTCCAGAAGGCCCTCAGACTACCTCAACCGTTCCACGTCACCCTGGACTCTCCACCGCAATGA	Il17a
Il18	Endogenous	ACTTTGGCCGACTTCACTGTACAACCGCAGTAATACGGAATATAAATGACCAAGTTCTCTTCGTTGACAAAAGACAGCCTGTGTTCGAGGATATGACTGA	Il18
Il18bp	Endogenous	CTTGGTGGGTCCTGCTTTTGTATGTCCATGTCATTTTGGCCAGAGCCACATCTGCACCTCAGACAACTGCCACTGTCTTAACTGGAAGCTCAAAAGACCC	Il18bp
Il18r1	Endogenous	AGATGGTTCAAAGGCAGTGCTTCACATGAGTATAGAGAGCTGAACAACAGAAGCTCGCCCAGAGTCACTTTTCATGATCACACCTTGGAATTCTGGCCAG	Il18r1
Il1a	Endogenous	ACCTCTGAAACGTCAAAGATGTCCAACTTCACCTTCAAGGAGAGCCGGGTGACAGTATCAGCAACGTCAAGCAACGGGAAGATTCTGAAGAAGAGACGGC	Il1a
Il1b	Endogenous	GTTGATTCAAGGGGACATTAGGCAGCACTCTCTAGAACAGAACCTAGCTGTCAACGTGTGGGGGATGAATTGGTCATAGCCCGCACTGAGGTCTTTCATT	Il1b
Il1r2	Endogenous	AGAAACGCATCCCACTGTGAGCAAATGTCTGTGGAACTCAAGGTCTTTAAGAATACTGAAGCATCTCTGCCTCATGTCTCCTACTTGCAAATCTCAGCTC	Il1r2
Il1rn	Endogenous	AGGCCAGCCTTATTCCATGTCGGCAAGAGGTTTCTTGTGGAAATTATGTCCTTTCTGAGAGGAGCTGGGGATTAGATGCTCCTGCATTTGTGAAATGGTT	Il1rn
Il2	Endogenous	TCTTCAGTGCCTAGAAGATGAACTTGGACCTCTGCGGCATGTTCTGGATTTGACTCAAAGCAAAAGCTTTCAATTGGAAGATGCTGAGAATTTCATCAGC	Il2
Il21r	Endogenous	TATGGTACACGTGCCATATGCGCTTGTCTCAATTCCTGTCCGATGAAGTTTTCATTGTCAATGTGACGGACCAGTCTGGCAACAACTCCCAAGAGTGTGG	Il21r
Il22ra1	Endogenous	ACTCCTTCTCGGGCGCCGTGCTCTTTTCCATGGGTTTCCTCGTCGGCTTGCTCTGTTATCTGGGCTACAAATACATCACCAAGCCACCTGTACCTCCTAA	Il22ra1
Il23r	Endogenous	AAGTATTTGGTATGGGTCCAAGCTGTCAATTCCCTAGGCATGGAGAACTCACAACAACTACACGTCCATCTGGATGATATAGTGATACCTTCTGCGTCCA	Il23r
Il24	Endogenous	CATAGTCATCATGTCACAACTACAGCCCAGTAAGGACAATTCCATGCTTCCCATTAGTGAGAGTGCACACCAGCGGTTTTTGCTGTTCCGCAGAGCATTC	Il24
Il2ra	Endogenous	AAGGAATTGGTCTATATGCGTTGCTTAGGAAACTCCTGGAGCAGCAACTGCCAGTGCACCAGCAACTCCCATGACAAATCGAGAAAGCAAGTTACAGCTC	Il2ra
Il2rb	Endogenous	TTATTTTATGTGTTCTTGGGCGATGCTGGTCTATGTAAGGGGTGGGGGCGCGGGGTTGATTGAAGTGAGGGCTCCTTCTATGTTGCTTTGGGGACCTTGT	Il2rb
Il2rg	Endogenous	GACATATTAAAGAACGCTGTTTACAATACTTGGTGCAGTACCGGAGCAACAGAGATCGAAGCTGGACGGAACTAATAGTGAATCATGAACCTAGATTCTC	Il2rg
Il33	Endogenous	ATGACTTACGGCGTTGGTAAAGAAACTGAAGGAGATTCAGCCTTGCTCTTTCCTTTTCTCTGCCTTGAGTCCTGTATGAAATCACACTCACGGACTTCAG	Il33
Il34	Endogenous	CAGGCTACCTTCGGGGCAAGCTGCAGTACAAGAACCGGCTTCAGTACATGAAACATTACTTCCCCATCAACTACAGGATTGCTGTGCCTTATGAGGGGGT	Il34
Il4	Endogenous	TGCTTGAAGAAGAACTCTAGTGTTCTCATGGAGCTGCAGAGACTCTTTCGGGCTTTTCGATGCCTGGATTCATCGATAAGCTGCACCATGAATGAGTCCA	Il4
Il6	Endogenous	CTCTCTGCAAGAGACTTCCATCCAGTTGCCTTCTTGGGACTGATGCTGGTGACAACCACGGCCTTCCCTACTTCACAAGTCCGGAGAGGAGACTTCACAG	Il6
Il6ra	Endogenous	CACCTCACTGCCACCTTGGCCTTCCTTGCTTTACGTTTGACTGAGTGGCCTCAGATGCTTTCCCCTGGGGCTTTGAGGAATCCAGTGATGTTAGTGGTCA	Il6ra
Il7r	Endogenous	GTTTCCTGGACTGCCAGATTCATGAGGTGAAAGGCGTTGAAGCCAGGGACGAGGTGGAAAGTTTTCTGCCCAATGATCTTCCTGCACAGCCAGAGGAGTT	Il7r
Inhba	Endogenous	CCTGGAAGTCTACTTGTCTATTCTGCAGTAATGTGGGTTAGCACAACCCAAATAATAATGTCTAGAAAGCCATGAGTTTTAAAGGGCCAGTCCCACCCAC	Inhba
Irf1	Endogenous	CTCTCTGAGTGGCATATGCAGATGGACATTATACCAGATAGCACCACTGATCTGTATAACCTACAGGTGTCACCCATGCCTTCCACCTCCGAAGCCGCAA	Irf1
Irf2	Endogenous	ACTCCTCCCCAACTCCTCCATTCTAGCCCATTACCCACGCCTCTCTCCTCAGCCCAGCCTACCCCATCCCACCCTGTTCCTTTCCTCCAGTTTCCTCTCC	Irf2
Irf3	Endogenous	GAAAGAAGTGTTGCGGTTAGCTGCTGACAATAGCAAGGACCCTTATGACCCTCATAAAGTGTATGAGTTTGTGACTCCAGGGGCGCGGGACTTCGTACAT	Irf3
Irf4	Endogenous	AAGGGACTTGGTTCTTAGGTCCAGTCTAGGCTATCATGTCCTGATCCTGCACTCTCTCTGAGTAGACCCTACATCCTGTTTGCTCCCTCTTCTTGCCCTT	Irf4
Irf5	Endogenous	CTGCAGAGAATAACCCTGATTTAGGGGTCCCCTAGTTTGAACCTTTCCCCTCATCCTTATGACAAGGATTTCTCCAGGCACCCTCCTTCAGAGTCTGAGA	Irf5
Irf7	Endogenous	CGCTGTGCACTCCACAGCACAGGGCGTTTTATCTTGCGCCAAGACAATTCAGGGGATCCAGTTGATCCGCATAAGGTGTACGAACTTAGCCGGGAGCTTG	Irf7
Irf8	Endogenous	GCAGGGAGAGTCATCATCTGCTTTTGTCTGAGAGAAGGAGAGCTTCTCCGTTTGTTCAACTTTGTAACAAGCTGGGTTACATGCTCCACGCAGCTAGAGA	Irf8
Irf9	Endogenous	TGCTTCTGTGATGGTTCTTATCACCGTGTGTTATCCAGCATGGCCAAGAGAAAGTGCAAGGGTGATGTTTCTCCTTACAAATTGAGTTTGCGAGGCAGAC	Irf9
Isg15	Endogenous	TATGAGGTCTTTCTGACGCAGACTGTAGACACGCTTAAGAAGAAGGTGTCCCAGCGGGAACAAGTCCACGAAGACCAGTTCTGGCTGAGCTTCGAGGGAA	Isg15
Itga1	Endogenous	ACTGGAAGCTAGAAGAAAGATGCGCTCCATTTTCACTCTCTCGCCAGCTTTGGAAGTCATACTTTGCTCCTGTTCTTTGCCCAACAGAACTCGGGTGATT	Itga1
Itga2	Endogenous	AGAGTACTTCATCAATGTGACAACCAGAGTTTGGAACAGGACCTTTGCTGCTTCGACTTTCCAGACTGTGCAGCTGACAGCAGCGGCAGAGATCGATACA	Itga2
Itga4	Endogenous	AATTTGTTGAGACCACTGGTCACTTGGACAGTCCCTTACTTCAACAGGGTGGAGCTTTGATCTTCAGGCTACTGGCCTTAGTCATCTGACAAGACTTAGA	Itga4
Itga6	Endogenous	ATCCCAGCCTGCTCCCACAAGCATTCTTCTCATAAGATTGACCTTGGCTCAAGACTGCCAATGGATAGCTGTGCCTCTGGTGAAAGTTCTGTCTTAAATG	Itga6
Itgae	Endogenous	CCAGACTGAGTTTGATCTTCAAGAGAGCCGGGACATTAACGCCTCCCTTGCCAAAGTTCAGAGCATCGTTCAAGTGAAGGAAGTCACTAAGACCGCCTCA	Itgae
Itgal	Endogenous	TAACCCGCTACATCATCGGGATTGGCAAGCATTTTGTGAGCGTACAAAAGCAAAAGACGCTCCACATATTTGCCTCAGAACCTGTAGAGGAATTTGTGAA	Itgal
Itgam	Endogenous	ATCCCTGTTCAGATCAACAATGTGACCGTATGGGATCATCCCCAGGTCATCTTCTCCCAGAACCTCTCAAGTGCCTGTCACACTGAGCAGAAATCCCCCC	Itgam
Itgav	Endogenous	ACAACAACAACACTCTGTTGTACATTCTTCATTACGACATTGACGGGCCAATGAACTGCACGGCAGATACAGAGATCAACCCTTTGAGAATCAAGACACC	Itgav
Itgax	Endogenous	GGGCCTGTCCCTTGCTGCTGCCACCAACCCTTCCTGGCTGTTGGCTTGTGGTCCTACTGTGCACCACACATGCAGAGAGAATATATACTTGACAGGGCTC	Itgax
Itgb2	Endogenous	GCTCGGTTTCTTTCCGCCATTATATCAAGTCTGCCAGGGTTTCCAGGGACTTGTCTTCCGACCTGCACAATCTTGCCGCAGAGCCCTAAGAATTGTCCCG	Itgb2
Itgb3	Endogenous	TGGGAATGTATCTCTCTGTGTGTACTTATGTGTGTGACGAGTGTGGGGAAATGTGTAATTTAAAACTTGTGATGTGTCTCACAGGCAGAGCTCCACAGCC	Itgb3
Itgb8	Endogenous	GCTGCCCTTGATCAGTGTAAATCCTCCTGTGCTGTCATGGAACAGCATCGCATGGACCAAACATCAGAATGTTTATCTGGCCCAAGCTATCTGCGAATAT	Itgb8
Itpk1	Endogenous	GATGTCAATGCCTTCCCAGGCTATGAAGGAGTGAGTGAGTTCTTTACCGACCTCCTGAACCACATTGCCACAGTTCTGCAAGGCCAGAGCACGGGAGGAG	Itpk1
Jag1	Endogenous	CAGGCGATCTGCTACAGAGCAGTCAGTTTTAAGGGAACAGACTGAGCTATATGACTTATGTAGCCAGAAAGTGACTGGTTGAATCTCATTACAAATATCA	Jag1
Jag2	Endogenous	GTCGCCATTGCGAACTAGAGTACGACAAGTGTGCCAGCAGCCCCTGCCGCCGGGGTGGCATCTGTGAGGACCTGGTGGATGGCTTCCGCTGCCACTGCCC	Jag2
Jak1	Endogenous	CATAGCAAAGGACTGTGCCGCTGGCATATTGATCTCAGATAAAAACTTGTGGACTTGGCTGACACTCTCCCTTGCCCTGAAATCTCAATGTCTATTCAGT	Jak1
Jak2	Endogenous	GTGCTGGAACAACAATGTGAGCCAGCGTCCCTCCTTCAGGGACCTTTCCCTTCGGGTGGATCAAATCCGGGACAGTATAGCTGCGTGAAAGAGATGGCCT	Jak2
Jak3	Endogenous	GAGGATTTATGTGTGCGAGCTGCCAAGGCCTGTGGCATCCTGCCTGTTTATCATTCGCTTTTCGCTCTGGCCACTGAGGACTTCTCTTGCTGGTTTCCCC	Jak3
Jup	Endogenous	CCACAGGCAAGCTCCTTGCTGGCTTCAGCCTCTGCTGTCCTGCTGTGACATCAGACCGTCTTCTATACCTCAGCTCTCCATGGCCCTCGGCTTACTAATA	Jup
Kat2b	Endogenous	CTTCCACAATAGCGGCTGCTATGACTCCTAAGGAAGGGACTTTTTATAAGCTCCTGGGGCTTTGATCATTCTGTCTACCTATTACAGACTTGAGAGTGCA	Kat2b
Kdr	Endogenous	TTAAATTGTACAGCGAGAACAGAGCTCAATGTGGGGCTTGATTTCACCTGGCACTCTCCACCTTCAAAGTCTCATCATAAGAAGATTGTAAACCGGGATG	Kdr
Kif2c	Endogenous	TGTGCCTACAAACTCTCGCAAGCAGTTTGCCATTCCCAGCCACCCTCGGGCCTCCTGCTCCACAGTGACAGAATTGCCGTTGTTGATGGTCAGTGAGGAG	Kif2c
Kir3dl1	Endogenous	TGTGGTCCTCCCCAAGTGACCCCTTGTACCTTCCTGCCAAAGGAAACTGTCCTGCATACACAGAAGCAGATACCAAAACAAATAACTACAAGAACCTGCA	Kir3dl1
Kir3dl2	Endogenous	AAAGACTATGGTCCTCACTGACAGCATTACAGAAATCACATTCTATTTATTAGTCCATGGTTCTCCACGTATTCCCTAGTTTCAGACCTCTACAATGTAA	Kir3dl2
Kit	Endogenous	CAGTTTCCCTGCATGTCGCTCACTGTCTAGAATTTACTCAAAGCCGCCACAGAGGCTTAGCGGAGTGAAGTGCCGAAGGACCTCTTTATTTGGAGTCCTC	Kit
Klra1	Endogenous	ACAAAGTCCTCACTTCTCTCTGTGTTAAATCCTTCATTGCTGAAACAGCTTCTTTCCCAGGAATTCTCATCACAAACACATGTACAAAACTCATAGAAGA	Klra1
Klrb1	Endogenous	AGACCTTGGGCTGACGGTCTGGTTGACTGTAATTTGAAAGGAGCCACTTTGCTGCTCATTCAAGATGAAGAAGAATTGAGATTATTGCAGAACTTCTCAA	Klrb1
Klrd1	Endogenous	AGTTATCAGGCCAGAGCACTGCATTGTTTACAGTCCAAGCAAAAGCGTTTCTGCTGAATCCTGTGAAAATAAAAACCGTTACATCTGTAAGAAACTGCCT	Klrd1
Klrg1	Endogenous	TGGATAAAGTTTATTTTAATGGATACCCACCCTGCAGATAGCCACCCTGGCTCTCTCATCCCTTCCTCTGCCATCTCTGTCAAAGATATGTAGAAAACTA	Klrg1
Klrk1	Endogenous	ATAAGAGGAAGATACCCTATAGAAAAACTCAAAATATCTCCAATGTTCGTTGTTCGAGTCCTTGCTATAGCCTTGGCAATTCGATTCACCCTTAACACAT	Klrk1
Kras	Endogenous	GGGCCACTACAACAATTCAATCTCAATCCTTTGGACTTCATTCCTGCTGCCCAGGCCACTGGTGCCTCAGTAGGAATTTTCAAAATTAGTGTGAACAGAC	Kras
Lag3	Endogenous	GTTCTCGTTCTCATCCTTGGTGCCCTCTCCCTGTTCCTTTTGGTGGCCGGGGCCTTTGGCTTTCACTGGTGGAGAAAACAGTTGCTACTGAGAAGATTTT	Lag3
Lair1	Endogenous	CTTACCTGGAGTCAGATTCAGTGATCCCATACCCATGCACATATAGTCAGCACTAGTTAGACTCAGAGACAGATCAGCAACAACAACAGTGGTAACAGTA	Lair1
Lama1	Endogenous	CACAAGACGGCGAATAAGACAGACTTGATCTCCGAATCCCTGGCTTCTCGGGGGAAAGCAGTCCTTCAGCGCTCGTCCCGGTTTCTAAAGGAAAGTGTCA	Lama1
Lamb3	Endogenous	TCACGGACATGCCGACCGCTGTGCCCCTAATCCTGGAGGTTCTACCACTGCTGTGCAGGTCAACAATGTCTGTGTCTGCCAGCATAACACAGCTGGCCCC	Lamb3
Lamc2	Endogenous	TGAATTCTGGGATATAGAAAGTCCTGCTGCTATGTCAGGACAAGAGATCTAATCCCGCTGTGGCCAGTAAAGTACTCTTGCTTCACCCACTAGACGTTTT	Lamc2
Lck	Endogenous	GTCTAAGCCTTGGATACCTCCTAAGATGTCTCTTCCTATACCGTTCCATTTCCTGAAGCCATAGAGAGGAGAAGGTCTGCGATTGATGCGTGTCTCTGTC	Lck
Ldha	Endogenous	CTGCAGGCTTCGATTACCCCTGTGAGCCTGCTGCATTGCTGCCCTGCACCAAACATGCCTAGGCCGACGAGTTCCCAGTTAAGTCGTATAACCTGGCTCC	Ldha
Ldhb	Endogenous	TGTGACCATGAACCTTTAGTCTTCAGCCATGTATGTAGGTCACAGTTTGCTTCTTCCCTGACATGTGATATGAGCTCACAGATCAAAGCCCAGGCTTGTT	Ldhb
Lgals9	Endogenous	ACAAGAAATTCTTTGTGCAGTACCAACACCGCGTACCCTACCACCTCGTGGACACCATCGCTGTCTCCGGCTGCTTGAAGCTGTCCTTTATCACCTTCCA	Lgals9
Lif	Endogenous	ACATCTTTCACCTGGAAGCATTGACTTCCACCGAGCATAGTAGGTAGTGTGTCTGGACCAGAGAAAAAGGGATGGGGCATTTTGCAGTTTATCCAGAGAG	Lif
Lilra5	Endogenous	AACACCTGGGTACTTGGGTGGAAAATTCTTCTATGGCCAATCATCCTGTTATCACTTCACCTAGATGTATAACTTTGGCTGACAGTCTCCTCTGTCTCCC	Lilra5
Lilrb4a	Endogenous	ACCAGGAATAAGGCCAAGTTCAACATTCCAAGCATGACAACCTCATATGCAGGCATATATAAGTGTTACTATGAGAGTGCTGCTGGCTTCTCAGAGCACA	Lilrb4a
Loxl2	Endogenous	TTCCACTTGGCGCTCTGGTCTTCCAAACTCCCACCACAATAACCCATTCAGTTCTGTTCTCTAAAAGCGCTCTAGGGCTTCTGGACCCAAAGTTCTAAGT	Loxl2
Ltb	Endogenous	ATCAGGGACGTCGGGTTGAGAAGATCATTGGCTCAGGAGCACAGGCTCAGAAAAGACTGGATGACAGCAAACCGTCGTGCATCTTGCCCTCACCCTCTAG	Ltb
Ly6c1	Endogenous	AACCCTTCTCTGAGGATGGACACTTCTCACACTACAAAGTCCTGTGTGCTCATTCTTCTTGTGGCCCTACTGTGTGCAGAAAGAGCTCAGGGACTGCAGT	Ly6c1
Ly6g	Endogenous	ATTGTATTGGGGTCCCACCTGAGACTTCCTGCAACACAACTACCTGCCCCTTCTCTGATGGATTTTGCGTTGCTCTGGAGATAGAAGTTATTGTGGACTC	Ly6g
Ly9	Endogenous	ACGGTGGTGGAAACAATGTGACATACACATGGATGCCTCTACAAAACAAAGCTGTCATGTCCCAAGGGAAGTCGCACCTCAACGTCTCCTGGGAAAGTGG	Ly9
Ly96	Endogenous	TTTCAACCTATTCATCAGTGTCAACTCCATAGAGTTGCCGAAGCGTAAGGAAGTTCTGTGCCATGGACATGATGATGACTATTCTTTTTGCAGAGCTCTG	Ly96
Lyz1	Endogenous	TCAGTCTGTTTAACCCTTGAGAGGATGTTCCCAGTGTCATGAGGCATTCAGGAGGACTAGTGAGCTGTGCCTGTCCTGATCTTTCTTAAGTTCCTTCATT	Lyz1
Magea1	Endogenous	TCAGACAGAGTCACTGATTCCATTGTTGTACCCTCATTGGACAGCTGGGTGGAGGAGAGCATAACACATTCAATTTTCACTCTGTTTGGGTGACTTGAGG	Magea1
Magea3	Endogenous	AATGAAGGCATTCACTACCAAAGCAGAAATGTTGGAAAATATTGGTAGAGAGTATGAGGAGTACTACCCTCTGATCTTTAGTGAGGCCTCTGAGTGCTTG	Magea3
Magea4	Endogenous	AGCCTCCAAGGCAGTGCTCGGAGCCAAAGGGAGTTAGACAATGTTCAGGCTACAATAGCTGTGGTAGATGAAGAGGAAGCCACTCCCACCTCAAAGAAGG	Magea4
Mageb4	Endogenous	CTTGAGGTGAAAGAAATTAAGCCCAATGGTGGCTACTACACCCTTGTTAGCAAGTTAGATCCCAGTGTCGGTAATGCTCTGACCACTAGCCTGCCATTTC	Mageb4
Maml2	Endogenous	CTCAGTGCACACATCTATGTACACTGCAAAGTGGAGCTGGTATCCAGGTTTGAAAGGCATCTAAAAGAGCACTACCACCTTCCTAAATCCAGAGAATCAA	Maml2
Map3k12	Endogenous	GAGGTGGTCCCTGAACGTGAAGCCAGCTCCTTGCCCATGCAACACCAGGATGGCCAGGGCCCCAATCCTGAAGACTCAGACTGTGACAGCACTGAATTGG	Map3k12
Map3k5	Endogenous	GGAGAAGACAGAACGTTTGTTTCGTGAGACTGCGTACCACTGGAACAAAACCAAAATGTGACCACGGCTTTTTAGGGTTCTCTGTGTGTGTAGTGTGCCC	Map3k5
Map3k7	Endogenous	CAATACTAACTGTAGTCCCACCTGTTACTATTAAAGGTGAGTGGTGGCAGCTGTGCTTAAGGAGAGCAAGTTTACTGACTTTCGTGAGGTTGAGCATCGT	Map3k7
Map3k8	Endogenous	GGTTCTCATTTCTCAGGTGGTGGGACTAGACAGAGGGAGTGGCAAGCTCAGGGAAGGATCATTTCTGGTGATAATTCCATTCACTTTGCACTTTGATGGG	Map3k8
Mapk10	Endogenous	CTCCAACACTCCTGCCCTCATGGATACGTGCACATGTTAACTTCAAGAGTCCACTGTCTTCCACGTGTAGCCTTAGAAATGGCACTAACTAAACAAACTA	Mapk10
Marco	Endogenous	GCACAGAAGACAGAGCCGATTTTGACCAAGCTATGTTCCCTGTGATGGAGACCTTCGAAATCAATGATCCAGTGCCCAAGAAGAGAAATGGGGGGACCTT	Marco
Mb21d1	Endogenous	ACAAAAGTGAGGACCAATCTAAGACGAGAGCCGTTTTATCTCGTACCCAAGAATGCAAAGGATGGAAATAGTTTTCAAGGAGAGACCTGGCGCCTCTCTT	Mb21d1
Mdm2	Endogenous	CCCGAGTTTCTCTGTGAAGGAGCACAGGAAAATATATGCAATGATCTACAGAAATTTAGTGGCTGTAAGTCAGCAAGACTCTGGCACATCGCTGAGTGAG	Mdm2
Melk	Endogenous	GAAGATATGAGCACAAGTGATGATAACTGTGTGGCTGGATTGATAGACTATGAATTGTGTGAAGATAAATTATTAGCTCCCAAGACGCCACAGGTTACCA	Melk
Met	Endogenous	GGGAAGAAGTGTTTAATATCCTCCAAGCCGCGTATGTCAGTAAACCAGGGGCCAATCTTGCTAAGCAAATAGGAGCTAGCCCTTCTGATGACATTCTCTT	Met
Mfge8	Endogenous	ACTTGGACAACAACTCCCACAAGAAGAACATCTTCGAGAAACCCTTCATGGCTCGCTACGTGCGTGTCCTTCCAGTGTCCTGGCATAACCGCATCACCCT	Mfge8
Mfng	Endogenous	GGAAAGGCTACGATATGGACACTGCTTGGTGTTGAGGGTGTCTTGGGCTGGTCATACCACAGAGGCGGCAGGAACGCTTGAGTTGGTGTGTGGGAGGGGA	Mfng
Mgmt	Endogenous	GCAGCCACAGAGGGGCTTCCCTTGCCTGCTCTCCATCACCCTGTGTTCCAGCAAGATTCATTCACCAGACAGGTGTTATGGAAGCTGCTGAAGGTTGTGA	Mgmt
Mill2	Endogenous	AAAAATGAAAGCCAGTTCTGGAAAGCCCAGAGAATTCAGACCAGCAGTCCTACTGTTGATCTTAGGGCTGCTCCTTAGAGACTCACGGGGATCCAGCATC	Mill2
Mki67	Endogenous	CGGCAAGCACAAAGAGACTCTCCAAGACAGATCTCAGTAAGGTGGATGTGAGAGAAGACCCTTCAATACTTGGGAAAAAAACAAAGTCACCAGGCAGAGC	Mki67
Mlana	Endogenous	GAAGACGAAGTGGATACAGAACCTTGATGGACAAAAGGCGTCATATTGGTATTCAAAAAACCTCAAGGGAAAGATGCTCATGTGAGAGCCCTGATCACCA	Mlana
Mlh1	Endogenous	ACTGCATGACCATCCAAGGCGAAGTGTATGGTACTAATCTGGAAGCCACAGAATAGGACACTTGGTTTCCAAGCTCCAGGGTTTCCAGTGCTCACTATTC	Mlh1
Mmp12	Endogenous	AAGGTGGTACACTAGCCCATGCTTTTTATCCTGGACCTGGTATTCAAGGAGATGCACATTTTGATGAGGCAGAAACGTGGACTAAAAGTTTTCAAGGCAC	Mmp12
Mmp13	Endogenous	ACAGTGACCTCCACAGTTGACAGGCTCCGAGAAATGCAATCTTTCTTTGGCTTAGAGGTGACTGGCAAACTTGATGATCCCACCTTAGACATCATGAGAA	Mmp13
Mmp1a	Endogenous	ACATTCGGGTAAATAGATTCATGCCAGAACCTGAGCTCAATTTAATAGGTATTCTCTGGCCAAATCTTCCAGTTAAACTTGACGCTGCTTATGAAGCTAG	Mmp1a
Mmp7	Endogenous	CACCTACAGAATTGTATCCTATACTTCAGACTTACCTCGGATCGTAGTGGATCAAATCGTGAAAAAAGCTCTCAGAATGTGGAGTATGCAGATCCCACTG	Mmp7
Mmp9	Endogenous	CCTCTACAGAGTCTTTGAGTCCGGCAGACAATCCTTGCAATGTGGATGTTTTTGATGCTATTGCTGAGATCCAGGGCGCTCTGCATTTCTTCAAGGACGG	Mmp9
Mmrn2	Endogenous	GTCCCAGAGTTTAATGAGATTAAGGTGCCACAAGAACAACAGGAAAACCTGCTTCAAAATCTCCAGAATGATGCCCAGTCAGTAGAAGATGGCTTTCCAG	Mmrn2
Mrc1	Endogenous	AACAAGGCTATATATGTCAAACACAGACTGACCCTTCCCTGCCTGTTTCTCCAACCACTACTCCAAAAGATGGCTTTGTTACATATGGGAAAAGCAGCTA	Mrc1
Mre11a	Endogenous	AAGCCATTTCCTAGCCCAATGATAAGGAGATTGCAGCTCTTCTTAGCCTTTAACCTGGTTGTTATTGTCTGGGGCTGCTCTGCCATATCGAGAACATTAA	Mre11a
Ms4a1	Endogenous	ACTCCTGGCAGCTGCAGCAGAAAAAACCTCCAGGAAGAGTTTGGTCAAAGCAAAAGTGATAATGAGCTCTCTAAGCCTCTTTGCTGCCATTTCTGGAATA	Ms4a1
Ms4a2	Endogenous	ACAGAAAATAGGAGCAGAGCAGATCTTGCTCTCCCAAATCCACAAGAATCCTCCAGTGCACCTGACATTGAACTCTTGGAAGCATCTCCTGCCAAAGCAG	Ms4a2
Ms4a4a	Endogenous	AACCCAAAATCCTTGGGATTGTGCAGATTGTAATCGCCATCATGAACCTCAGCATAGGAATTATGATGATAATTGCCACTGTGTCGACCGGTGAAATACC	Ms4a4a
Ms4a6b	Endogenous	AGAGCAAGGAGCTTAGACCAACTGAATATCATTACTACCAATTCTTGGACAGGAACGAGTGCTTTGCCGCCAAGTCTGTTCTGGCTGGAGTCTTTTCACT	Ms4a6b
Msh2	Endogenous	AGAAAATTATTCTGGAGTTCCTGTCGAAGGTCAAGCAGGTGCCCTTTACTGCCATGTCGGAGGAGAGCATCTCCGCGAAGCTGAAGCAACTGAAAGCCGA	Msh2
Msh6	Endogenous	AGCTATTTCGGGAAGTTTGTCTGGCTACTGAAAAGCCGACTATAAACGGTGAAGCTATCCATAGGCTGCTGGCCTTGATTAACGGATTGTAGACTACATT	Msh6
Mtor	Endogenous	CATTGGCTGGTGTCCCTTCTGGTAACTGAGGCCTGGAAAACCACGTCGTCTCCTCCCAGGCTTTAGTACCTTGTCTGTGCTTCCAGTGGACTAAAACCAT	Mtor
Mx1	Endogenous	ACAAGGATTCCACCTCTCTTTTAGCCCACCACCCATCAGAGGTAGTGGAAGAGAAAAGTTATTAGGCTATGGAGGAAGTGGACCTGTTCAGCAATAGTTC	Mx1
Mxi1	Endogenous	TCCTATATTTGGAAAGAGTACAGTTTCTAACGGCAGCAGAAACCATGCGCGTGATTATCTTGAGTTGACCAGGTTGACTTGAGAGACAATGGAGACTTCA	Mxi1
Myc	Endogenous	CTCACCTCTGAAAAGGACTTATTGAGGAAACGACGAGAACAGTTGAAACACAAACTCGAACAGCTTCGAAACTCTGGTGCATAAACTGACCTAACTCGAG	Myc
Myct1	Endogenous	GGCGATTGGGCTTGCAATCGGAGGATTTCTCTGGGCGCTGTTCGTTTTTCTGTCTCGAAGAAGAAGAGCCAGTGCACCCATTTCGCAGTGGAGTCCCACC	Myct1
Myd88	Endogenous	GCTGCAGGCTCAGCTGTTTTCTCCCCAGCAGCGAGGTTTGCATCTTCTTATTCCTTTCACGTTCTCTACCATAGAGGCAATGTCATGGTCCCTCTCAGGG	Myd88
Nbn	Endogenous	TATAAAGGAGGCCCCTAAACCAAGCTCCAAAGCTAACAACGTAGCATCAGATACGCTGGTTAGAGGAAAGACCCCGAGCTATCAGCTTTCTCCAATGAAA	Nbn
Ncam1	Endogenous	GAGCAAGGCTGCAACCACAAACCCTTCCCAGGGCGAGGACTTAAAAATGGACGAAGGGAACTTCAAGACCCCAGATATTGACCTTGCAAAGGATGTTTTT	Ncam1
Ncr1	Endogenous	CCTTGTGAGCTCTATGCTGTACCCTGGATAAAGAAAGAGATCTTTTCAGAAATGAAGGGGTAGGAGTGTTACCAAGTTTGGCAAAGCATTCTAAAGGACA	Ncr1
Ndufa4l2	Endogenous	GCAAGCAGGGGCCCGAGTGCCAGGGACGTGGCAGGCCCCACGTTTGTTTTGACAGAGTTTTGAGCAGGGTTCAGGGCGGTGTCTGCCCAGGCTCGACTGG	Ndufa4l2
Nectin1	Endogenous	TGTGGAAACTGCAAACACAATTGAAGGGGGACTGCTAGCGTCTCATATGGGAAGGCTGGCCTAGATGTGTCTCGGGTCTCAAAGAAAGTGCAGGGGCACC	Nectin1
Nectin2	Endogenous	CGATACTCCTTGGTGCCCGTGGGCCGAGCGGATGGCGTCAAGGTCACGTGTAGAGTGGAACACGAGAGCTTCGAAGAGCCGATCCTGCTGCCAGTGACCC	Nectin2
Neil1	Endogenous	GACCCTGTGTCTTGCTGGAGTATGAACGGTTCAGAGAGAACGTACTTCGGAACCTATCAGACAAAGCCTTTGACCGGCCCATCTGTGAGGCCTTGTTGGA	Neil1
Nf1	Endogenous	CTAGTGACCCCTCACCTTGCACTGCTGCACTTCGTGTCTTATGATCCCATCTGGTCGCCGTGTCGCCAGACGGTCATCTCTTGGAGCATTGCCTAAGTTT	Nf1
Nfam1	Endogenous	GGCATTTACTACTTCATAGTCGAAGGAGAGGAAACATATCAGAGCGATGGCGTTGTCATTCTGGTCAGAGACACAGTGTACCAGCCACCTGCATTCAAGG	Nfam1
Nfatc2	Endogenous	GTGGTGTCGTTCCGGTGACAGTTCCATATTGCTAAATGTGGCACTTTCTCTTCCAAGTCCACACATCTCCCTGACTGTACAAAGGCACCGCTGATGGGGA	Nfatc2
Nfil3	Endogenous	CTTACCGCACAAGCTTCGGATTAAAGCCAAGGCCATGCAGGTCAAAGTGGAGGCTTTGGACAGCGAGTTTGAAGGCATGCAGAAACTCTCTTCACCCGCC	Nfil3
Nfkb1	Endogenous	GCATCGTCCCAAAGGAGGAAGGCAAAGCGAATCCAAAGGTGCTGGAGAATCGCCGGCCTGCAGGGTCACTCGATTTCATTCAAGGCCTTCCGAATTTGGC	Nfkb1
Nfkb2	Endogenous	TCCACCCAGATCCCTCTGTACAGCATCCCTGTCTAATCGAAATCTTATTTAAACCTCAAGCCCACATCTCGGTGGGTCAAATAAAGGGGAAGACCCCTCC	Nfkb2
Nfkbia	Endogenous	TATTGTGCTTTTGATTGAACCACCATAGACCTAGTAAGTGAGCCCAGTGTGTCCTCCCATGTAAGAGCCAGGTGTTCAGTGGCATGTGCTTAAAAGTCGC	Nfkbia
Nfkbie	Endogenous	TTTTATGTTGTGATGGGATCTCAATGAGTTGCCAGAGATGGCCTGGAACTCACTCTATAGCCCAGGCAGTCATCTTTGAACTGGGAACTTCCTGTCTCAG	Nfkbie
Ngfr	Endogenous	AACAGGGAGATCAATTGTAGGCTGACACACTCCTTTCTGAATGAGGGCGTCAAGTGCTTGTTGGCAGGGATGGAGTGACTTTCAGGGAAACATCTGGAAA	Ngfr
Nid2	Endogenous	CAGGTTCCGACCGCGCTTCTCCTTGGCCATATCCAGCACCTGGTAACTGGCCATCCTACCGGGAAACAGAATCGGCTTCTTTGGACCCTCAAACCAAACA	Nid2
Nkg7	Endogenous	TTTCTCAAGTCCAGACATTCTTCTCCTGGTCCTTCTACCTAGGCTGGGTCTCCTTCATCCTCTTCCTCTTTGCAGGCTGCCTGAGCCTGGGTGCTCACTG	Nkg7
Nlrc5	Endogenous	CCCAGGCTTAGGAGTTAACCTGACCTTGGGAGAGTTCGCACTCATCTCTTCTTTCCTGGTTTAAGGGACAAAGCCGAGCTACAGGTTTAGGGATAAGTAC	Nlrc5
Nlrp3	Endogenous	ACGTGTACATCACATTCCTCTATGGTATGCCAGGAGGACAGCCTTGAAGAAGAGTGGATGGGTTTGCTGGGATATCTCTCCCGCATCTCCATTTGTAAAA	Nlrp3
Nod2	Endogenous	CTGTGACGAAGGGGTATATTCTCTCGCAGAAGGACTCAAGAGAAATTCAACTTTGAAATTCTTGAAACTGTCCAACAATGGCATCACCTACCGGGGTGCA	Nod2
Nos2	Endogenous	CCCCCCTCCTCCACCCTACCAAGTAGTATTGTACTATTGTGGACTACTAAATCTCTCTCCTCTCCTCCCTCCCCTCTCTCCCTTTCCTCCCTTCTTCTCC	Nos2
Notch1	Endogenous	CAAGGAGTCTGAAGACTATGAGAGTTTTTCCTGTGTCTGTCCCACAGGCTGGCAAGGTCAAACCTGCGAGGTTGACATCAATGAGTGTGTGAAAAGCCCA	Notch1
Notch2	Endogenous	GGCTTCTCATGCCATCCAAGGGACCCTATCCTACCCTCTAGTGTCTGTTTTCAGTGAACTGGAGAGTCCAAGAAACGCCCAGCTTCTCTATCTGCTCGCG	Notch2
Nras	Endogenous	CCAGGACTTAGCGTGTGTGAGTTGGTAGCTCAGTACGAGTTTACTAGTTCCGCAGTGTGTACAATGGAGGCGGGTTTGTTTTAGCTGGCCACCTGTAGAA	Nras
Nt5e	Endogenous	GTTCTTCACAAGGAAGAGACTGTAACATCATTTGTTGGGGCCAGCAACTCAGTGAGCAGATAGAAAGTCACAGTGAACCAACAGGGTCCTTCTGGCAGGG	Nt5e
Oas1a	Endogenous	TCTGCATCAGGAGGTGGAGTTTGATGTGCTGCCAGCCTTTGATGTCCTGGGTCATGTTAATACTTCCAGCAAGCCTGATCCCAGAATCTATGCCATCCTC	Oas1a
Oas2	Endogenous	GTACTCTCCCAGCCTGAATACTGAGTCACCTGCACCATATTGGGATGTTCTGCCCATGCCACTTTTCGTCACTCCAAGCCACTTACTGAACAAGTTCATC	Oas2
Oas3	Endogenous	CCCGGGCCTGGCCTGACTTTTGAGTTTTCTCAGTCAAAGGCGTCCAGGATCTTACAGTTTCGTCTGGCATCGGCAGACGGAGAACACTGGATAGATGTTA	Oas3
Oasl1	Endogenous	AGCTGGTCGTGTTCCTGAGCTGTTTCCACAGCTTCCAGGAAGAAGCCAAGCACCATCAGGCTGTCCTGAGACTGATACAGAAAAGGATGTACTACTGCCA	Oasl1
Olfml2b	Endogenous	GACAGCCGAGATTTGAAGCTGTCTACAATTATAGACCTGTTGGAAGGTGCTTTCTACGGCCTGGACCTCCTAAAGCTGCATTCGGTTACCACTAAACTCG	Olfml2b
Olr1	Endogenous	AAAAACCGGCAGACCTGCCAATCTTTGGGTGGCCAGTTACTACAAATTAATGGTGCAGATGATCTGACATTCATCTTACAAGCAATTTCCCATACCACCT	Olr1
Otoa	Endogenous	ATGAACTGCACACTGTTGCCACAAAGTTTCCTGAAATCCTTCAGCAAACAGCTTCCAAGATGGTTGGGGTGTTGCTTCCTAAAGAATTTCTCTGGGCTGT	Otoa
P2ry13	Endogenous	AAAAAGACGGCTTTCGCAAAAACAGTCTCCATTTCCGTCTGGTCCCTGATGTTCTTCATCTCCCTGCCAAACATGATCTTGAACAAGGAGGCAACGCCAT	P2ry13
P4ha1	Endogenous	ATGGCTCCATGAACGTGGACAAGAATTTCGAAGGCCGTGCACCCTGTCAGAATTGGAATGACAACCAGGCTTCCCTTGGCTCCTGTTGTCCTCTAACGCA	P4ha1
P4ha2	Endogenous	CCGCGGGAGGTTCTGGAAACGCCGGCTTCTGCGCGTGTTCAGTTTCAGAGACCGGTGGCGATTGGCTGACTGATTCAACAAATAGAGCATTCTCTGTGCC	P4ha2
Palmd	Endogenous	ATCTGATGACTTTAAAAGCACAGGGATAAAAGTGTATGAGGACCGGCAGAAATCAGTCTATGCTGTTAGCTCCAATCAGAACACAACCTACAATGGCACC	Palmd
Parp12	Endogenous	CCATCTTTGTTGCCCTAGGTAACTTGTTCACTAGCCGCCAGTAAGTATGGCCAGGATGCATTAGGCGTTTCTGCCACATCTGTCTGTCTGGTGGAGCTAT	Parp12
Parp4	Endogenous	AGTGAATGAAGCTACGGAGTTTTTAAGCAAACTGGGCAACGTGCGACTCTTATTTCATGGATCTCCTGTGCGGAACATTCTTGGAATCTTGTCCCGAGGG	Parp4
Parp9	Endogenous	TGCAATACGGTGTGCAGAGTCGGCTTCCACAGAATGTATTCGACATCCTATAACCCAGTTTATGGAGCCGGCATATATTTCACCAAGAGCCTCAAAAATC	Parp9
Pcdhb11	Endogenous	AAGTTAGGGTTTATAGAAGAATCTAAGAAGACGGCGTCTTCCTAGTCGGATTTACTCCAATATCTCCGCGGACACTCAGCAGTGGACTGTAATCAACCAG	Pcdhb11
Pck2	Endogenous	ACATGAACAATCTGACATTAAAATGTGTGAGTGTTGGAAGGCCAAGCCACAGGACTCCCCATGCTGTCTGATAAGAGATGCACACTTTTATACACGCGTT	Pck2
Pcx	Endogenous	TGGCCTGCCCATTCCCTTCAGCTATTTGTCCTTTTCTTACTGGCAGGTAGTTGCTCACATATTCATCTCTTGCCAAATAAGGGCCTGCTCCTCGTGGGAG	Pcx
Pdcd1	Endogenous	AGCAGGCTTCCCGGTTTCCTATTGTCACAAGGTGCAGAGCTGGGGCCTAAGCCTATGTCTCCTGAATCCTACTGTTGGGCACTTCTAGGGACTTGAGACA	Pdcd1
Pdcd1lg2	Endogenous	ATTGTTAGGGCACTTGAGGGTGGGCGTTCTGGAAGTCCTTTCAGGTTAGTGTTTGGGGGCAGGGTTGCTCAGAATACATAAAGGTGCTAACTTAAACTGC	Pdcd1lg2
Pdgfa	Endogenous	AGAGAGGCGAGCCAGAGACGGCCGTGCTTCTGCAGCGGCCTCCTCCCCTCCCCGCCCGGTGCCGCAGGATTGCAGCTGGCACTGAAGGGTGGGCAAGCTC	Pdgfa
Pdgfb	Endogenous	AGCAAGGTTGTAATGGGATGTATATTGCACATGATGCACTGCGTGTGGAGACTGCTGTTCACACCCTAAATATGGCCAACTTGCCTATTATGACGTTCTG	Pdgfb
Pdgfrb	Endogenous	GGGTGGTGTTCGAGGCTTATCCGATGCCTTCTGTCCTGTGGCTCAAGGACAACCGTACCTTGGGTGACTCCGGCGCTGGCGAGTTAGTTTTGTCTACTCG	Pdgfrb
Pdk1	Endogenous	ATCGTGACTACTGCTGTTGTCAGAGTGACAGACTAGATTGGGAAGCTTGTCGGGTTGCTACACATTAGGGGACATAATCTGAATCTCAAGCCTGGTGCAA	Pdk1
Pdzk1ip1	Endogenous	TGGGGTCCTGGTGGGAATGGATGGCAGATACTCCTCAATGGCATCTGGTTTTAGGTCCAGCGAGCACAAGAATGCCTACGAGAATGTTCTGGAGGAAGAG	Pdzk1ip1
Pecam1	Endogenous	ACACCTGCAAAGTGGAATCAAACCGTATCTCCAAAGCCAGTAGCATCATGGTCAACATAACAGAGCTGTTTCCCAAGCCGAAGTTAGAGTTCTCCTCCAG	Pecam1
Pf4	Endogenous	TGAGCGTCGCTGCGGTGTTTCGAGGCCTCCGGCCCAGTCCTGAGCTGCTGCTTCTGGGCCTGTTGTTTCTGCCAGCGGTGGTTGCTGTCACCAGCGCTGG	Pf4
Pfkfb3	Endogenous	CTGTCTCAGCCTCTCAAATGTTAGCTGTTCGGGTTATAAGCATGAGCCACCACCACACCACGCCTGGTACTATGGCTTTGTACCTAAATGTGGTTTCTTC	Pfkfb3
Pfkm	Endogenous	CTCCTAGGTGGCTGTCCTTCCTCCCTTCCACTCCAGCTTCATCGGTCACACAGGCTGGGTCTCTCTAGTGCTACGGCTAGATTTCAGCTACTCAAGAGTT	Pfkm
Pgpep1	Endogenous	ACCCACCTTCCTTCAGTGCTAGAACAGAACAGCGTAACTTATGTTCCCATTGTTAAGACTTCAGGCCTAACCAACAAGTGTCTTTCCTTTCTCCTGGGGA	Pgpep1
Pias4	Endogenous	GACCAGGGCCTTGCAGCTGGTGCAGTTCGACTGTAGCCCAGAGCTTTTCAAGAAGATCAAAGAGCTGTATGAGACTCGCTATGCCAAGAAGAGTGCAGAG	Pias4
Pik3ca	Endogenous	GAAGGGACTCGCTTTTTGCTTTGAACAAACAACACTTTGATGGACTTGGGGTCTCACCTGCGGTTTTGAAAGCAGTCACAATACTTGCAGACAGCTGCGT	Pik3ca
Pik3cd	Endogenous	CCCACCAACTCTGAAATAGGAAACGTGTCTGTGTGTGTGTATGTATGTATGCCATGTTATTTATTGAAAAGAGTCTAGGTGCTCTCTGGTGTGGCTGCAG	Pik3cd
Pik3cg	Endogenous	GTTCTTGGCATCAAACAAGGAGAAAAGCACTCCGCTTGATATGTGGTGCTAGGGCCCAAAGCAATGTAGTGTTCTGGAGCTTTTAGATCAGCATGTCAAT	Pik3cg
Pik3r1	Endogenous	CAGACACTAAGCTAGACTATAGAAGTGGGAGGGTTGGGACCTTGTGTTCCACACCAGAGTGATCATAGCCATGGGATAAGGCAGCAAGCATATTTTGCAA	Pik3r1
Pik3r2	Endogenous	CCTATCCCAGCTTGACCATCTGATGGGTGACACAAGCCAAATAATTTGAGAAAACACCAGGAACATCATTGCACAGGTGACTAAATGGTGGCCTCTGTGA	Pik3r2
Pik3r5	Endogenous	CACACACACAGGCTTTCTCTCTCAAGTTCCCTGGATCCCTTGAAAAACAGCACTAATACTTGGTCCTTTGCTAGGACCTGGTACATTTTCTCTCCCAAGC	Pik3r5
Pirb	Endogenous	TTCTTCGACGAAGACATCGGGGAAAATTCAGGAAAGATGTCCAGAAAGAGAAAGACTTGCAACTTTCTTCAGGAGCTGAAGAGCCCATAACCAGGAAAGG	Pirb
Pkm	Endogenous	GGCTGCGGAGGGATTGCGGCGGCCCGCAGCTGTGATAACCTTGAGGCCCAGTCGGCGCAGCCCCGCACAGCAGCGACTCGTCTTCACTTGACTGACGTCC	Pkm
Pkp3	Endogenous	TGCAACTGGGGATTGATTGGCTTCTGCAGGGCAGGGAAAGGGGGTAGAGCTTGAGCTGCTCTGGTGTACTGGGTGGCGATTAGTCACAATGGCAAGGGCG	Pkp3
Pla1a	Endogenous	CCCGTACTGTGTGCACCACAGCCTTGTGGAGTTTTATTTGAAGGAGAAGAGAAAAAAGGATACCAGCATCGAGGTCACGTTTCTTAGCAACAACGTAACG	Pla1a
Pla2g2a	Endogenous	ACCGGTGCTGTGTTACTCATGACTGTTGCTACAAGAGCCTGGAGAAAAGTGGATGTGGTACTAAGTTACTGAAATACAAGTACTCCCACCAAGGGGGCCA	Pla2g2a
Plod2	Endogenous	AACCTGAAAGCCTGGGATTCTGACGCCTACTGGCTCTATGTAATTATTAAGTCACATTGACCTCTGTGTAGGGCTGTTTTCCAGGAATTAGGAAGAAAAC	Plod2
Pms2	Endogenous	AGCACTTCCAGGACGCCACAAAACCTTTTCTACGTTTCGGGCTTCATTTCACAGTGCACGCACGGCGCCGGGAGGAGTGCAACAGACAGGCAGTTTTTCT	Pms2
Pnoc	Endogenous	CAGCCTCCCGATTCCCACTGCTGCACCATGAAAATCCTCTTTTGTGACGTTCTGCTGCTCAGCCTGCTCTCCAGCGTGTTCAGCAGCTGTCCCAGGGACT	Pnoc
Pold1	Endogenous	ACTGGGTTCGGGCGGCAGATGATTGAGAAAACCAAGCAGCTTGTGGAGTCCAAGTACACCGTGGAAAATGGCTACGATGCCAACGCCAAGGTAGTCTACG	Pold1
Pparg	Endogenous	TTTTATGCTGTTATGGGTGAAACTCTGGGAGATTCTCCTGTTGACCCAGAGCATGGTGCCTTCGCTGATGCACTGCCTATGAGCACTTCACAAGAAATTA	Pparg
Ppargc1b	Endogenous	GGTGTTCGGTGAGATTGTAGAGTGCCAGGTGCTGACGAGAAGTAAAAGAGGCCAGAAGCACGGTTTTATCACCTTCCGGTGTTCAGAGCACGCTGCCCTG	Ppargc1b
Ppl	Endogenous	GGCTGCTGACCTTCCTTCTTGCCATTCCATTTTTCTGACTGGGATCAAACTATCAACAGTGCCTGCTCAGTAGTGACTTTTCTCATTGAACAGGGCTCTA	Ppl
Prdm1	Endogenous	CCAATGGCTTGAGCACCATGAACAACATCAATGGTATCAACAACTTCAGCCTCTTCCCTAGGTTGTATCCCGTCTACAGTAACCTCCTTAGTGGCAGCAG	Prdm1
Prf1	Endogenous	ACAGCTACTGATGCCTACCTAAAGGTCTTCTTTGGTGGCCAGGAGTTCAGGACCGGTGTCGTGTGGAACAATAACAATCCCCGGTGGACTGACAAGATGG	Prf1
Prkaa2	Endogenous	TCCAGCATTCTGTTTACTCGTAGAACTCTGTAACTCTCCTGTGCCTGTGACAAGTTTGCATGGGTAGTACTGGGTGAGTGTGGTGGCGCTTGCTAACTTA	Prkaa2
Prkacb	Endogenous	TTCCCTCCTCAGCTAATATTCTCAAGGGTATCCCGCTGTGAAGTAAGCTTTGATAGCAACACGTTTCTGTTTGTCCTCCCTCTTACCTCCACAGTGTGCT	Prkacb
Prkca	Endogenous	TGGCTCAGCATTCGTGTGGTCAGGTGTCAGTCAATGAACAGAAGACACACCAGGTTGTTAAACAGCCTTACTGTGACCCTCCTCAGAAGCCCACAAGTTC	Prkca
Prkx	Endogenous	ATCGTGGCCGATTCTCCTCAGTTGCTTCAGTCTTCTACGCCACAGAGATTGTGTGTGCCATAGAATATCTACACTCAAAGGAAATCGTATACAGGGACCT	Prkx
Prlr	Endogenous	TGGAGTAGATGGGGCCAGGAGAAATCTATTGAAATACCAAATGACTTCACCTTGAAAGACACAACTGTGTGGATCATTGTGGCCGTTCTCTCTGCTGTCA	Prlr
Prom1	Endogenous	ATGTTGCGGACCCTCTGAATTTGTTCTGGTTCGGCATAGGGAAAGCCACGGTGCTCTTACTTCCGGCTGTAATCATTGCTATCAAGCTGGCCAAGTACTA	Prom1
Prr5	Endogenous	GAAGACTATCTGCGCCTCGAGACACTGATTCAGAAGGTGGTGTCGCCGTACCTGGGCACCTATGGTCTCTATTCCAATGAAGGACCTTGTACCCATTCCT	Prr5
Psmb10	Endogenous	CTGAAGCAGGCAGTGGAACCCACAGGAGGCTTCTCTTTCGAGAACTGCCAGAGGAATGCGTCCTTGGAACACGTCCTTCCGGGACTTCGGGTTCCTCATG	Psmb10
Psmb5	Endogenous	CAGGATCTCTGGGACCGCCTTCTCAGTGGGCTCTGGCTCCGTGTATGCTTACGGCGTTATGGATCGAGGCTACTCCTATGACCTGAAAGTGGAGGAGGCC	Psmb5
Psmb8	Endogenous	CCTGAGGTCCTTTGGTGGTGACCAGGAAAGGAATGTTCAAATTGAGATGGCCCACGGCACAACCACACTCGCCTTCAAGTTCCAGCATGGCGTCATCGTG	Psmb8
Psmb9	Endogenous	GAGCTGGAGGAGCCGCCCCTCGTTCTGGCTGCTGCAAACGTGGTGAAGAACATCTCCTACAAGTACCGTGAGGACTTGTTAGCGCATCTCATAGTAGCTG	Psmb9
Ptcd2	Endogenous	GAGGCCTTCCTCGTCTCCGCCATCGTTATTCCATCTGTGAGGCGATGCTGCCTGGGTGTGCTTGGATGACTTCACATTTCCATTCAAGGTTCAGTAGAGT	Ptcd2
Pten	Endogenous	TCAGTAAATACAAGTTACGTTGGTTTAGCAGAGCAAGCTCAGTGTGGGTATTTCTCTTTGAAGCGTGGTGCGTGACGCACTGTGAGTAGAGAATTTGGTC	Pten
Ptger4	Endogenous	AGACACTGACAGTTTCGTGTAACTCCCAGGAATACTGTACCTGTGTTTGGAGGAGCTTTCTCAGAGAAATAGCAAGCATGTCCTGTTGCTTAACGTGTCC	Ptger4
Ptgs2	Endogenous	GACCTGGGTTCACCCGAGGACTGGGCCATGGAGTGGACTTAAATCACATTTATGGTGAAACTCTGGACAGACAACATAAACTGCGCCTTTTCAAGGATGG	Ptgs2
Ptpn11	Endogenous	CCTCTGCCCAGTGTTGATCCTTGAGAGCACGTTTCAGCGAGAGCTTCCAGATGTGATGCTCGTGACCAAGCAACCGCACAGTCTCCACTTGATTCTTCTT	Ptpn11
Ptprc	Endogenous	AGATGTCCAAAATGCTAAGTGTGGAAATGAGGATTGTGAAAACGTGTTAAATAATCTAGAAGAATGCTCACAGATAAAAAACATCAGTGTGTCTAATGAC	Ptprc
Pvr	Endogenous	CGAACACGGGTGACTTTCCCAACTCTGTTAAGCGCCAGGGCAATATGCTTCTAATCTCCACCGTAGAGGATGGTCTCAATAACACGGTCATTGTGTGCGA	Pvr
Pvrig	Endogenous	ATAGCCTCATCTCCCTGGTAACAGTGAGCTGTGAAGGATTTGTTGACGCTGGAAGGACCAAACTAGCTGTGTTACATCCAGAATTTGGTACCCAGCAGTG	Pvrig
Rad50	Endogenous	AGTGCAGCATCAGCTCCCTGGGTTCTTATGTTCACTAACTTGTCTTGGGAAGGATATGGATTGTGTGACGGGAACCATGTGTGTCAGGTTTGAGAGTCCC	Rad50
Rad51	Endogenous	AGCGGCCCGTGGCCGCGGGACAGTCATGGCTATGCAAATGCAGCTTGAAGCAAGTGCAGATACTTCAGTGGAAGAAGAAAGTTTTGGTCCACAGCCTATT	Rad51
Rad51c	Endogenous	AAGCCAGAAGGAGTCTACGATACCATTTCAGATCACACCTCAGGGATTTAGAGACGCTGTTGTCACTGCTGCCTCATCACAGACAGAGAGTTCTTTGAAT	Rad51c
Rasal1	Endogenous	TTTCCACTTCTGCTAGCCACTGTGACCTCACAGATCCTTCTGTATTCCACTCTCATCTGGCAGCCCCAACCAGGTGTTCTCAGAAGAACGGACTGGGGGC	Rasal1
Rasgrf1	Endogenous	CGAGGGGCATTCGGATGCCTCTCTGAGATGTAAGTGCGTAGCAGTCTCTCAGGCCTTCTAGCATCATGCAGAAAGCCATCCGGCTTAACGATGGCCACGT	Rasgrf1
Rb1	Endogenous	TCCTGGCTCATGGTTGTGACTAGTTCCCAGGTTCTGCTCATGTTAGAGATATAAAATGTGCAGGTACAAGCTGAATATTTGTGTGGGTGATTCGTAAGCC	Rb1
Rbl2	Endogenous	AGAAAATCTTACTGGCTTCCTGGAGCCCGGAAACTTTGGAGAGAGTTTTAAGGCCGTTAATAAGGCATATGAAGAATACGTGTTAGCCGCTGGGAATCTG	Rbl2
Rela	Endogenous	AGAGAGGGACAGACTGGAGCCATGGCCTTAGGCCATATAGCCTTACTATCAAGTGTCTTCCTCCACGCGGATTCCTGTACACCTTGATCCAAAGCAGTGC	Rela
Relb	Endogenous	TTCTCTTTGAGCCCATTTTACAGAATGCTGAGTCCGAAGAGGAAAAGGGGCTCCTGCAGATGGACCCCTTCTCAGGACAGATTCTCAGAGATTGTACATA	Relb
Reln	Endogenous	AACAAAGATGAAGGACTTGGCGAACAGAAAGCCCTTCGAGATCTTGTGTACCCCACCTTCCCACACTGTGAGCTAATGATGTGTGGTTTCTCTGCACATA	Reln
Ren1	Endogenous	GAACCAGATGGACAGAAGGAGGATGCCTCTCTGGGCACTCTTGTTGCTCTGGAGTCCTTGCACCTTCAGTCTCCCAACACGCACCGCTACCTTTGAACGA	Ren1
Rictor	Endogenous	AGGAACACACTCGCCTTTCCACACTTCTTAATGTCTGTAACACTACTTCAGAGGTTTATAACTTCACAGCAGAAGGAACACCTCAGCACTCGGAACTTGG	Rictor
Ripk1	Endogenous	CGCAGTGTGCAGGCTAAGCTGCAAGAGGAAGCCAGCTATCATGCTTTTGGAATATTTGCAGAGAAACAGACAAAACCGCAGCCAAGGCAGAATGAGGCTT	Ripk1
Ripk2	Endogenous	CCAGGGACATCGACCTGACACCAGTGAGGAGAATTTGCCATTTGATATACCTCATCGAGGTCTCATGATCTCTCTAATACAGAGTGGATGGGCGCAAAAC	Ripk2
Ripk3	Endogenous	CACAGAACATGGAACCATGATGTAGCAGTCAAGATCGTGAACTCGAAGAAGATATCCTGGGAGGTGAAGGCTATGGTTAATCTTCGTAATGAGAACGTTC	Ripk3
Rnls	Endogenous	CTCAAGCCTTTCCTGGTGTGCGGAGGGGATGGATTTACTCACTCCAACTTCAATGGCTGCATCTCCTCTGCCCTGAGTGTCATGAAAGTTTTAAAGCGTT	Rnls
Robo4	Endogenous	CCCAGTCACACCATGCAAGGAAACTAAAGGAGAAAGGTCGTGGATGCAGTGGGCCCTATACAGCGTCACAGTCAATGCTTCAAAGTGAGATCAATGGAGG	Robo4
Rock1	Endogenous	TCCGGCTCCTCTGCCCTGCGGCTACAAACCCACCGCGGAGGAAGTTGGTTGAACTTGCTTTCCGCTGCGGGCAAGAAGGTATCGTCACAAGTAGCAGCAT	Rock1
Ror2	Endogenous	CTTTATCCTGATGGTAGATGGGTAGTGAGCTAAGGATATTGGGCACAGAAACAGGCTACATCTTCACCGCCCTGCTTTATGGGCGGAGGGTTCAGAGACT	Ror2
Rorc	Endogenous	GGGGCCTCCTGCCACCTTGAGTATAGTCCAGAACGAGGCAAAGCTGAAGGCAGAGACAGCATCTATAGCACTGACGGCCAACTTACTCTTGGAAGATGTG	Rorc
Rpl23	Endogenous	AACCAAAAAAAACAAAACACGCATTCTTTTCAGGTCTTTGCTGGGACCAGGTACACATAACACAGATAAATATTAGAGCAAACCATGCACATATGGTAAA	Rpl23
Rpl7a	Endogenous	CCAAGAAGGTGGTCAACCCTCTGTTCGAGAAGAGGCCCAAGAACTTCGGCATTGGACAGGACATCCAGCCCAAAAGAGATTTAACGCGCTTCGTCAAATG	Rpl7a
Rps6kb1	Endogenous	AGTACTGCTGTGTGTTTGGCGTAACTGCAAGCCTTGGGACAGGCAGAAGTTGTATGATCTACATTGCATCCTTGTCCTGGGCCTGCACTACACTGGAAAC	Rps6kb1
Rptor	Endogenous	TGCCCACAGGCTGGGCCTCACAAGTCTGATGCGGAAATTCAATCATGAAGCTAAGCAAAGCTCGAGAGAGCGCTGACCTAGAGCGCATTTCTCTATTTAT	Rptor
Rrm2	Endogenous	AAAACAACCAACTGGCTACACCATGAATTGTCATTAAATTTGCTAAACAGGTGTCTAAAAAGCTGTGTAGCTACCTCAGTCCTGTTTGCCAGGCTGGTCA	Rrm2
Rsad2	Endogenous	TGCTGGGAGAATAGGGGATGATCTAGTGGACATTTGTTAAGTGTTACAGGCTGATGCCTTGTGTCCCATGACTGATTGATGCAGAGTAGTAATGCTGTGA	Rsad2
Runx3	Endogenous	TACCTCCTGTTACAGTGTCTCTTGTCCCACCCTTACTGGAGGAAAAAAAAAAAAAAAACTCTATCTCTTGGAAGTAGCTGAGGTAACCTTCCAGCTCCCT	Runx3
S100a8	Endogenous	TGGACATCAATAGTGACAATGCAATTAACTTCGAGGAGTTCCTTGCGATGGTGATAAAAGTGGGTGTGGCATCTCACAAAGACAGCCACAAGGAGTAGCA	S100a8
S100a9	Endogenous	AAGGACACCCTGACACCCTGAGCAAGAAGGAATTCAGACAAATGGTGGAAGCACAGTTGGCAACCTTTATGAAGAAAGAGAAGAGAAATGAAGCCCTCAT	S100a9
Samsn1	Endogenous	ATGAAGAAACCACTGTAGAACATGAAAAGGAATCCGTGCCTCTATCCTCAAACCCAGACATCTTGAGTGCATCACAGCTAGAGGACTGCCCGAGGGACTC	Samsn1
Sbno2	Endogenous	GAGGAAACGGCGGCCTCGGGGTCGTGGCCCCAAGGCTTCCAGACTGTCACTGGAGGCAGCAGGAGTTATCCGTATTAGTGATGGCAGCAGCACAGAGTCA	Sbno2
Sele	Endogenous	TCAGTGGCTGCCGAAGTATTCTTGAACATTGTGTTCTGTGTCCTGGCACTGAAGCCAGCATGAGATCCATCATTCTTATGTCAGCTCAAGGGTCAAAAGG	Sele
Sell	Endogenous	GTCCAAGTGTGCTTTCAACTGTTCTGAGGGAAGAGAGCTACTTGGGACTGCAGAAACACAGTGTGGAGCATCTGGAAACTGGTCATCTCCAGAGCCAATC	Sell
Selp	Endogenous	TGGATTGTTCTCATGTCCACGGAGAGTTTGGTGTTGGCTCTATCTGTCACTTCTCCTGCAATGAGGACTTTGAGCTACTGGGATCTGAAAATGTGGAATG	Selp
Serpina1a	Endogenous	CTTGATATCTCCTCCAGCCATGCAAATAGGTTGTGGGTAGAGGACTGTGGCTGAGACCACAGACTCTGGTCCAAGAACCATCTGCTCTAAAAAAAATAAA	Serpina1a
Serpinb5	Endogenous	GACTAAGACCCTAAGGGAAAGCTCAGCTTTTACAAAAGTTGGCTTTCATTTTTCCTAGATCTCCCATGTGGTCATTTGGGCAATGTTGTTGCTGGCAGGC	Serpinb5
Serpinh1	Endogenous	GGAGCCCAGATACTATGATACCAAATTCAGGGGTGTCACAGCCATTTTGTTCTGCCCTGCAAGTTTTAGATCCAATCTGCCTCAACAGTCAATCAGTGTT	Serpinh1
Sfrp1	Endogenous	TGCATTCCTCCGGTCATATTCTTTTGAGGCTAAAGTGCCCTATCCGAGGAGATGGTTTCAAAGGCTAACTAATCTGCAGCTTTCCCAAGTGCCCAGAGGT	Sfrp1
Sfrp4	Endogenous	AGCCACCCTTACAGGATAAGGTGGTGCTGCCTGGGACAGCCTACAGAAGGCCACATACCACTTGCCTTAAGGACCCACTGTGGTTCTCTTTATAGACACT	Sfrp4
Sfxn1	Endogenous	GATGGGACCAGAGCACGTTCATTGGCCGAGCCAGTCACTTCTTCACGGTTACTGATCCCAGAAATATCCTTTTAACGAACGAACAGCTAGAGAATGCGAG	Sfxn1
Sgk1	Endogenous	TTGTTTTTCCCTTGGCGGATTTCCCGTGTGTGCAGTGGCGTGAGTGTGCTATGCCTGATCACAGACGGTTTTGTTGTGAGCATCAATGTGACACTTGCAG	Sgk1
Sh2d1a	Endogenous	AAAAATCTCATCTCAGCGTTTCAGAAGCCGGATCAAGGCATCGTGACGCCTCTGCAGTATCCAGTTGAAAAGTCCTCTGGCAGGGGCCCACAAGCTCCCA	Sh2d1a
Shc2	Endogenous	AGCTTCCTTCTGCCTCAAGCATGAGACATCATTAAGGTCAAAGTTACAGGTCACCTTGATGCTCTCTTCTTCCAAATACAGAAAGGCTCAGAGTCCCACC	Shc2
Siglec1	Endogenous	ATTGGCTTCAGGAGGGACCGGCTTCCTCACTCCAGTTCCTGGTGACTACACGGGCTCACGCTGGTGCTTACTTTTGCCAGGTGCATGATACACAAGGCAC	Siglec1
Siglecf	Endogenous	ATCGACACAGGGACGTACTTCTTCAGATTGGATGGTTCTGTGAAATACAGTTTTCAGAAGTCAATGCTCTCTGTGCTTGTGATAGCTCTGACTGAGGTCC	Siglecf
Sirpa	Endogenous	AGGTTGCGTCCTTGATGTTCCAGAGCTTGGTCTTCTGTGTGGAGAAGAGCTCACCATCTCTACCCAACTTGAGCTTTGGGACCAGACTCCCTTTAGATCA	Sirpa
Slamf7	Endogenous	TACCGTGCAGAGATTTACAGTACATCGAGTCAGGCTTCCTTAATCCAGGAGTATGTGCTGCATGTCTACAAGCATTTGTCAAGGCCCAAGGTCACCATAG	Slamf7
Slc11a1	Endogenous	TCCCAGCATCAACGTGGTGGCTTTCAACTGAAGGTGACTCCAGTTCCCAGAACACCTCAAACAGAACTGCCACAACTCCATTGTCTCACTCCAGCTCGTG	Slc11a1
Slc16a1	Endogenous	GCAGTGGGCACTCTGAGCCTTGTCCGTCACTCCTTTGAATGCTGATTTTGTCTCAAGTCCTTTCAGTTCACATAGCCGTGGCTGCTGGGTAATAGATGTG	Slc16a1
Slc1a5	Endogenous	ACTCCAGTGCCACGTTCGAAAAGGAATCTGTCATGTGAATATCAGGAGGGACTTTCTACGCCCTGGTGACTTCACGTTGGAAGCCGGGTCTTGCGAGCTG	Slc1a5
Slc2a1	Endogenous	TGGACCTATGGCCAAGGACACACTAATACCGAACTCTGAGCTAGGAGGCTTTACCGCTGGAGGCGGTAGCTGCCACCCACTTCCGCAGGCCTGGACCTCG	Slc2a1
Slc7a5	Endogenous	GGTGTCTACTGGAATGGCTACTATGCAGTTCTTACATAGTGGTGACTTACCACTGGCCACCCTGACCTCTCCTCTGTGCTTCTGGGGTTCCCTTTCATTG	Slc7a5
Smad5	Endogenous	ATACCTTTGCTCCTTACCAGACTTGTCATACAAGGACTCGTGCAGTGTAGCCAGTAGAGGCTCTTTGGTTGGCCCAAGAATGAGGCTGTTGGTGTAAGTG	Smad5
Smap1	Endogenous	CCCCGGCTCAGGGGACTGCCTCCGTACCAGCACCTGCTACCCTGTCTACCGTTACATCTGGGGACCTGGATCTGTTTACTGAGCAAACTACAAAGTCAGA	Smap1
Snai1	Endogenous	TCACTGCCAGGACTCCTTCCAGCCTTGGTCCGGGGACCTGTGGCGTCCATGTCTGGACCTGGTTCCTGCTTGGCTCTCTTGGTGGCCTTTGCCGCAGGTG	Snai1
Snca	Endogenous	CCTAAGATCTGCCGGCTGCTCTTCCATGGCGTACAAGTGCTCAGTTCCAATGTGCCCAGTCATGACCTTTTCTCAAAGCTGTACAGTGTGTTTCAAAGTC	Snca
Socs1	Endogenous	CGGTACTCCGTGACTACCTGAGTTCCTTCCCCTTCCAGATCTGACCGGCTGCCGCTGTGCCGCAGCATTAAGTGGGGGCGCCTTATTATTTCTTATTATT	Socs1
Sox10	Endogenous	CCATCTCCTGTCTGCAGCCCAGTCCACATGTAACACATCGCTGCCCCTTTATTTATCTCCATAGTCGCCATGTTCCTATCCCTCTAGCTACTCCAGCCCC	Sox10
Sox11	Endogenous	GCAAAGTATAGAGGGGTAGGTTAGCCTGTTTGTCAGAGTTAGAGGATGAAGGGATTATTCAGGGGCAGTTGCTGATGTTGAATCCAATGCCAGCAAACTC	Sox11
Sox2	Endogenous	AGATTTTCAAAGAGATACAAGGGAATTGGGAGGGGTGCAAAAAGAGGAGAGTAGGAAAAATCTGATAATGCTCAAAAGGAAAAAAAATCTCCGCAGCGAA	Sox2
Spib	Endogenous	TCTTAAGTCAAGGTCTATTTGTGTAGCCCAGGCTGGCTTCAAGCTCATGACACTCTTCCTGCCTCTGCGTCTGGAACTATGAACATACCTTACTACTCTG	Spib
Spp1	Endogenous	TGAATCTGACGAATCTCACCATTCGGATGAGTCTGATGAGACCGTCACTGCTAGTACACAAGCAGACACTTTCACTCCAATCGTCCCTACAGTCGATGTC	Spp1
Spry4	Endogenous	CGACAGCTCCGCCAGAGCTAGACAAGCACTTCTTGCTGTGTGAGGCCTGTGGAAAGTGTAAGTGCAAAGAGTGTGCGTCCCCTCGGACGTTACCTTCCTG	Spry4
Srebf1	Endogenous	GGTTGCTGCCACCCCTAGTCTGGCTGGCCAATGGACTACTAGTGTTGGCCTGCTTGGCTCTTCTCTTTGTCTATGGGGAACCTGTGACTAGGCCACACTC	Srebf1
Srp54a	Endogenous	GAAGTACTGGGACTACATTGCTACCGTGTCTACCTTTTTTTGGTTTGGGGAGAAAGGCTCAGGCTGTCCTGGAACTCATGACAAATCTCCTGCTTCAGCC	Srp54a
Stat1	Endogenous	TCTGTCTGCCTCAGGGAGGCATCAGACAAAGCTGGAAAGGATTTAGAAAATTCTTTTACCTACTCTGGGAGCTGGGAGGCTGTCCTTCATCCCGAGGGCA	Stat1
Stat2	Endogenous	AGTGGGACCACTACAGCTCAGACTCCAATCACTTTTTATTACAGCATAACTTGCGAAAATTCAGCCGGGATATTCAGACCTTTCCCAATGGCCCTACCCA	Stat2
Stat3	Endogenous	TGCTATCTTTGGGCAATCTGGGCACTTTTTAAAATAGAGAAATGAGTGAGTGTGGGTGATAAACTGTTATGTAAAGAGGAGAGCACCTCTGAGTCTGGGG	Stat3
Stat4	Endogenous	CCTGCTGTTGGTTGGTGTGTTGATGCTGGCTCCCTAGAAAGGATGGAGTTATGTCTAGGAAAACAGGAATCCCAGTCCTTCAGTGTGTACCTCTTACTCT	Stat4
Stc1	Endogenous	GAGTGGGATATTGTTCCACTAAGCCAATCAGGAATGAGTCAATCAGCCTTTGGGTCTTTAGTCCGGGAAACTTGGGCTTAAGGGGGTATGAATAACCCTG	Stc1
Syk	Endogenous	TGAGGCTTCGCAATTACTACTACGACGTGGTTAACTAACAGCTCCGGCGCCTGTCCGTGCACACCACGGATTCCCAAGCGATCACAGGAAATTCATTCAG	Syk
Taf3	Endogenous	CCACTCCCTCCACGGGGAGGTAATCAGAAGGAAAGAACGCTCCAGTCACAGCACTGGGAATATTTTTGTGATGAGAGTATATGAAGCTCCCCACCTCACC	Taf3
Tap1	Endogenous	CCAGTGCCTGGTCCAGTATGATCACCATTACCTGCACACTCAGGTGGCCGCAGTGGGACAAGAGCCGCTGCTATTTGGAAGAAGCTTTCGAGAAAATATT	Tap1
Tap2	Endogenous	CCGCAGAACCCACCATGGCGCTGTCCTACCTGAGGCCCTGGGTCTCTCTGCTGCTGGCGGACATGGCTTTACTTGGGTTGCTACAAGGATCTCTGGGAAA	Tap2
Tapbp	Endogenous	AGGGAGTTTCAGGTCAGTCGGGGTTACTTGGCGGGGCTTTGTTGAGAGAACTAAATATAAGAACACACATGCGTAGAGTCCCAGGGTTGAGAAGAACCAG	Tapbp
Tapbpl	Endogenous	TTCACAGACAGCAAGCTTCTTCATCAAGGTCCACCAGGCCTATGAGGCATTCTGGGTAGCCGCCTGCCTGCCTCCGAATACAAAGTAAAGTACTCCACAT	Tapbpl
Tbx21	Endogenous	TCAACTGTTGGTCTGACACCTGTGTTAATCTCTGACCTGAAAGTGAAGATACACGCATTTTTACAACAGCCAGCCAAACAGAGAAGACTCAGGTGACTGC	Tbx21
Tbxas1	Endogenous	CCTCCACATCTAAGCCTTTCACTGTGGATGAAATTGTGGGCCAGGCCTTCCTCTTCCTCATTGCGGGCCATGAGGTCATCACAAACACGCTGTCCTTCAT	Tbxas1
Tcf3	Endogenous	CCTCATGTGAAGTGGGCCGTCCTCATGGTCCTCAATACTTGGGTGTCATGCATTAGGGGACCTCTAAAGAAAAGTTGCTAGAATAAGGTGTGTGTGTGTG	Tcf3
Tcl1	Endogenous	TGACTCTTCCGTCTTTCCCTTTGGCCTCACAAGACAACTAGTGTCTCTGACTTATGAACTTGCCTTCTTCCTCACGGGTCCCTCAGCAGTACATACACCA	Tcl1
Tdo2	Endogenous	ATGAGTGGGTGCCCGTTTGCAGGAAACAGTGTAGGATACACTTTGAAAAACGTATCTATGGAGGACAATGAAGAAGACAGAGCTCAAACTGGTGTAAACA	Tdo2
Tgfb1	Endogenous	GGAGTTGTACGGCAGTGGCTGAACCAAGGAGACGGAATACAGGGCTTTCGATTCAGCGCTCACTGCTCTTGTGACAGCAAAGATAACAAACTCCACGTGG	Tgfb1
Tgfb2	Endogenous	TGGTGAAGGCAGAGTTCAGGGTCTTCCGCTTGCAAAACCCCAAAGCCAGAGTGGCCGAGCAGCGGATTGAACTGTATCAGATCCTTAAATCCAAAGACTT	Tgfb2
Tgfb3	Endogenous	TCATGTAATTAGTTTCTGGGCCAGCAACTAGCTATCTCAGGTCCCTTAGAGATGCTGGACTCAAAAGCAGAGGTCAGAATTGGTTCTCTCATGTATTCCC	Tgfb3
Tgfbr1	Endogenous	TCAGAAGTAGTGGCCAGCTGTGTCTCTAGTAGGACAGTAAAGGCATGAAGCTCAGCCTGTAATCCTGCTACTACAGTAGTACTCCAGAAGTGCCTTGAGG	Tgfbr1
Tgfbr2	Endogenous	CGGGCGAGACTTTCTTCATGTGTGCCTGTAACATGGAAGAGTGCAACGATTACATCATCTTTTCGGAAGAATACACCACCAGCAGTCCCGACCTGTTGTT	Tgfbr2
Thbd	Endogenous	CCCTTTGACATGACAATAGGACATTGCTATCTTGAGACATACTGGGCCACATTCATAGCTTTCCAAGGATGTATGTGGTCCTGCCTCAACATATCAGAGC	Thbd
Thbs1	Endogenous	CACTGCCTGGAGTCAGCCAGCCTCATCGGACTTCTGCAGGCAATCGCGAAGCTGCTATCCAGTTCTGCCACGGTCTCTCCCGGCGCACCGGCAGTCTCAG	Thbs1
Thy1	Endogenous	ACTTTTGTGAGCTTCAAGTCTCGGGCGCGAATCCCATGAGCTCCAATAAAAGTATCAGTGTGTATAGAGACAAGCTGGTCAAGTGTGGCGGCATAAGCCT	Thy1
Ticam1	Endogenous	TCCAGTCTCTTCCCCACAGTCCCAATCCTTTCCATCAGCCTCCTCCCCAGCCCCACAGACTCCAGGACCTCAGCCTCTCATTATTCACCATGCCCAGATG	Ticam1
Tie1	Endogenous	TCTTGCCAGCTGTTCCCATAGCTACCCTTCCTCTCTGCGGCTCCCCAAACCCAAACCCCACTTCTGATCCTCCACCTAAAGCAGCATGCATGTTACTAAC	Tie1
Tigit	Endogenous	GCAGAAGATGACTATGCTGACCCACAGGAATACTTTAATGTCCTGAGCTACAGAAGCCTAGAGAGCTTCATTGCTGTATCGAAGACTGGCTAACGACAGC	Tigit
Tlr1	Endogenous	TCAGCACTACGATCGGTTTGGAACTGTCTAACATCAAGTGTGTGCTTGAAGACCAGGGCTGCTCTTATTTCTTACGTGCTTTGTCAAAGCTTGGAAAGAA	Tlr1
Tlr2	Endogenous	GCAGGCGGTCACTGGCAGGAGATGTGTCCGCAATCATAGTTTCTGATGGTGAAGGTTGGACGGCAGTCTCTGCGACCTAGAAGTGGAAAAGATGTCGTTC	Tlr2
Tlr3	Endogenous	TTTCTCTGGGCTGAAGTGGACAAATCTCACCCAGCTCGATCTTTCCTACAACAACCTCCATGATGTCGGCAACGGTTCCTTCTCCTATCTCCCAAGCCTG	Tlr3
Tlr4	Endogenous	AACGGCAACTTGGACCTGAGGAGAACAAAACTCTGGGGCCTAAACCCAGTCTGTTTGCAATTAATAAATGCTACAGCTCACCTGGGGCTCTGCTATGGAC	Tlr4
Tlr5	Endogenous	CTGGGGACCCAGTATGCTAACTTGACCATTGGTCCAGGGGCTTTCAGAAACCTGCCCAATCTTAGGATCTTGGACTTGGGCCAAAGCCAGATCGAAGTCT	Tlr5
Tlr7	Endogenous	TTTAAGATGCAATTGTGTACCTGTTCTACTGGGGTCCAAAGCCAATGTGTGTACCAAGAGGCTGCAGATTAGACCTGGAAGCTTTAGTGGACTCTCTGAC	Tlr7
Tlr8	Endogenous	TCCATAAAGCGAACTATTCCAGAAGCTATCCTTGTGACGAGATAAGGCACAACTCCCTTGTGATTGCAGAATGCAACCATCGTCAACTGCATGAAGTTCC	Tlr8
Tlr9	Endogenous	GGCCACAATTTCAGTTTTGTGACCCATCTGTCCATGCTACAGAGCCTTAGCCTGGCACACAATGACATTCATACCCGTGTGTCCTCACATCTCAACAGCA	Tlr9
Tmem140	Endogenous	CTGTCTCGGCACAAAGGGCTCCTTTCTCCAAGGCACGAGTTTGACAGTGCTATGGATGTACCCTGAGCCAACCGAAAAGCCAGCACGGCACACGACCAAG	Tmem140
Tmem173	Endogenous	GCAGACTTCCAACCCTCCAGCTTCTGGTCACGTGTGTTCAATGGGAGCTTAAGTAGATGGCGAGAGGGAGAAGGAACATTTGTTCTGTTAGCTGTATACA	Tmem173
Tnf	Endogenous	TGGATCTCAAAGACAACCAACTAGTGGTGCCAGCCGATGGGTTGTACCTTGTCTACTCCCAGGTTCTCTTCAAGGGACAAGGCTGCCCCGACTACGTGCT	Tnf
Tnfaip3	Endogenous	CTAGGAAAGAAGGGGTTGCTTTATGGATAAGCCTGTAGAATCGGCTGCTTCCTATGACTCCCTGGCTGCACAAGAAGAAATTGTCTGTCTTCCATATATG	Tnfaip3
Tnfaip6	Endogenous	TGCAACCGAAGAGATGGTCGTCCTCCTTTGCTTATGCGTCTTGCTGTGGGAAGAGGCTCACGGATGGGGATTCAAGAACGGGATCTTTCATAACTCCATA	Tnfaip6
Tnfrsf10b	Endogenous	CTGGTTCACATAAGATCCCATATAATGTGCAGGATGGCTAAACTTGCTGAGAGCTGACTCTGTGGTCTCCTGTCCCAGATTCTAGCGATATTCATTACTA	Tnfrsf10b
Tnfrsf11a	Endogenous	TAGTGGCTGCCATCATCTTCGGCGTTTACTACAGGAAGGGAGGGAAAGCGCTGACAGCTAATTTGTGGAATTGGGTCAATGATGCTTGCAGTAGTCTAAG	Tnfrsf11a
Tnfrsf11b	Endogenous	CCGGAGTGTCCCAAAGCCCCACCACTAGCTCCCAAGGTTCCTAAAAAGGAACAAGGTTTGTCCAGACAGAGACTAATAGATCAAAGGCAGGGCATACTTC	Tnfrsf11b
Tnfrsf14	Endogenous	ACAGACACCACCTGCTCCTCCCAGGTCGTCTACTACGTTGTGTCCATCCTTTTGCCACTTGTGATAGTGGGAGCTGGGATAGCTGGATTCCTCATCTGCA	Tnfrsf14
Tnfrsf17	Endogenous	CCTCATGGCGCAACAGTGTTTCCACAGTGAATATTTTGACAGTCTGCTGCATGCTTGCAAACCGTGTCACTTGCGATGTTCCAACCCTCCTGCAACCTGT	Tnfrsf17
Tnfrsf18	Endogenous	CTCCCCTCAACAGTGGCGGAAGTGGGTGTATGAGAGCGGTGAGTTACGATTGGGCCCTATGGCTGCCTTTCTCATTTGACAGCTCTGTTGGAGTAGGGTC	Tnfrsf18
Tnfrsf1a	Endogenous	CTCCTTGCCAAGCTGACAAGGACACGGTGTGTGGCTGTAAGGAGAACCAGTTCCAACGCTACCTGAGTGAGACACACTTCCAGTGCGTGGACTGCAGCCC	Tnfrsf1a
Tnfrsf1b	Endogenous	GTGTGTGTCCATGTTTGCATGTATGTGTGTGCCAGTGTGTGGAGGCCAGAGGTTGGCTTTGGGTGTGTTTGATCACTCTCAGTTACTGAGGCAGGGCTCT	Tnfrsf1b
Tnfrsf25	Endogenous	TTGGGTCCAGGTGCTTCTAGGAGTCGCGTTCCTTTTTGGGGCTATCCTGATCTGTGCATATTGTCGATGGCAGCCTTGTAAGGCCGTGGTCACTGCAGAC	Tnfrsf25
Tnfrsf4	Endogenous	ATGGTGAGCCGCTGTGATCATACCAGGGATACTCTATGTCATCCGTGTGAGACTGGCTTCTACAATGAAGCTGTCAATTATGATACCTGCAAGCAGTGTA	Tnfrsf4
Tnfrsf8	Endogenous	TGAAGACGGGAAGTGCACAGCCTGCGTGACCTGTTTGCCAGGCCTTGTGGAGAAGGCTCCGTGTTCCGGGAACTCTCCTCGAATCTGTGAGTGTCAGCCT	Tnfrsf8
Tnfrsf9	Endogenous	TCTTCAGAGCAGTTCAAGGGCCTGCTTCTCCTGTTTCCTCTGTGTCAGGCTTTTCAATAAAAAGGCCGTTTAGGAAAGGGACAAAGCACTGTGAGGTGGG	Tnfrsf9
Tnfsf10	Endogenous	GTTCACCATGCTTGCTTTGTCCAGATTGCGACTGTCACCCAGTCCTCTGGCTCTTCCATCTGTCTGTCCACTCCACCTACCAAGATGTTGAACACTTGTT	Tnfsf10
Tnfsf12	Endogenous	TCAAAGGCAGCCAGAGCTTGTTCACATGTTTTCCATTCCACAGACGTATCCTTGCTCTTCTTTAACATCCCATCCCACCACAACTATCCACCTCACTAGC	Tnfsf12
Tnfsf13	Endogenous	TTTCTCCCTTGCGTAACCCGCTCTTCCCTTCTGTGCCTTTGCCTGTATTCCCACCCTCCCTGCTACCTCTTGGCCACCTCACTTCTGAGACCACAGCTGT	Tnfsf13
Tnfsf13b	Endogenous	TCTGCAAAGACCCTGCCACCACCGTGCCTCTGTTTTTGCTCCGAGAAAGGAGAAGATATGAAAGTGGGATATGATCCCATCACTCCGCAGAAGGAGGAGG	Tnfsf13b
Tnfsf18	Endogenous	GCACAGTGAGAACATGGGTAGATGAACCCTAAGACTCTTACCTCAATTCAGAACTCGCAAGGAGTTAAGTGAGTGGGGTCTTCATTAGACCATTCACATG	Tnfsf18
Tnfsf4	Endogenous	CCAGATGTGAGGATGGGCAACTATTCATCAGCTCATACAAGAATGAGTATCAAACTATGGAGGTGCAGAACAATTCGGTTGTCATCAAGTGCGATGGGCT	Tnfsf4
Tnfsf8	Endogenous	TGTGGACCTGACATTGCAGCTCCTCATCAATTCCAAGATCAAAAAGCAGACGTTGGTAACAGTGTGTGAGTCTGGAGTTCAGAGTAAGAACATCTACCAG	Tnfsf8
Tnfsf9	Endogenous	GCTCTATGGCCTAGTCGCTTTGGTTTTGCTGCTTCTGATCGCCGCCTGTGTTCCTATCTTCACCCGCACCGAGCCTCGGCCAGCGCTCACAATCACCACC	Tnfsf9
Tnks	Endogenous	ACCAAAGGTATCAGGAGTGTATTCAAGTTGGCAAAAAGGTGGTTGCTTAGGATTTCCTTGTACAGCAGCATAGACTGTAGAAGAGCCCTCTGGACTAGAC	Tnks
Tpi1	Endogenous	GGAGTTCTGCTTCACAGCCATCTATATAAGTGGCCAGTGGAGAGAGCCGTGCGTTTGTACTGACCTTCAGAGACTTGAGCCTGGTACAATGGCGCCTACC	Tpi1
Tpm1	Endogenous	GGTTGCCACCCTTCATAGAGTTTAGGCATGCAGTTTGCTTAGCCAGTGTAGGAAGCCTCATGAGAACAGAACCATTAACAGCCAGAGTGCCAATGGTGGG	Tpm1
Tpsab1	Endogenous	GGCTGGGGTAACATCGACAATGGTGTAAACCTGCCGCCACCATTTCCTTTGAAGGAGGTGCAAGTTCCCATTATAGAAAACCACCTTTGTGACTTGAAGT	Tpsab1
Traf1	Endogenous	GCTCAGACATATTGAAGACCGTGTGACATAGGGTAGCCAAATGACAGTGTGAGAAAGTGACATTTACTCAAGGCCACCCAGATATCCTGGAGGACCCAGA	Traf1
Trat1	Endogenous	GCATTCATGATGATCCCGCTAGACTGTTTGGGTTGATCCGTGCCAAGAGAGAGCCTGTAATCTAACTGGACCATCATCCATCTCAATGATAACACCCTAT	Trat1
Trem1	Endogenous	GTGGCTCCTGTGCTTTCTCTAGGACACACTGGCATTTGCTTGTTTCCACCTCTTTGGGTGGGAAAAGGATGGTAGATCCATTCCTTCTACTTCAGCAGTG	Trem1
Trem2	Endogenous	GAATCAAGAGACCTCCTTCCCACCCACCTCCATTCTTCTCCTCCTGGCCTGCGTTCTCCTGAGCAAGTTTCTTGCAGCCAGCATCCTCTGGGCTGTGGCC	Trem2
Trim21	Endogenous	CAAAAATGTCTCTGGAAAAGATGTGGGAGGAGGTCACCTGTTCTATCTGCCTGGATCCCATGGTGGAGCCTATGAGTATCGAATGTGGCCATTGCTTTTG	Trim21
Trp53	Endogenous	CCCTCTCTGAGTAGTGGTTCCTGGCCCAAGTTGGGGAATAGGTTGATAGTTGTCAGGTCTCTGCTGGCCCAGCGAAATTCTATCCAGCCAGTTGTTGGAC	Trp53
Tslp	Endogenous	CTGTACTGTTAATGACCAGCTTCTGAGAAGTCTTTCTCACCTCCCCTGCACACACCTTACTCTAGGGCAAACCTAACTGTAGTAGGAAGAGAATTGAAAG	Tslp
Ttc30a1	Endogenous	TCAGGGATTATGTCAACGGTTCCTAGTCATGCGGAACAGATCCTTTCTACCTCAGACCTAACCGCCACCCGCTGGATGAACTTCCGTTTCCGGTTACCTA	Ttc30a1
Twf1	Endogenous	TAATCTTCAATATTTCCCATAGGTGGGCCAGTTCCACCAAGCATAAGGTCTTGCTCTGTAGAACTCTGTAGTGAGGTCTAACGTTCCCTATGAAGGGAAG	Twf1
Twist1	Endogenous	GGAATTTTAACACCTTTAGAAATAAAAACGCTGGGATCAAACTGGCCTGCAAAATCATAGTCAGTGAATTCCTTAAAAACCATACTTCCTCTGAAGGAAA	Twist1
Twist2	Endogenous	GTGACTGTTTCGAGGAAGCCTGGAATTCTTGCCCGCATACTCCTGTTCTTTACGTCTCCATGGCCTGCTCAGCTAGCCGTGTTTTCTATTCCCTGTTCAG	Twist2
Tymp	Endogenous	TGCAAAGCTGGTTCCTGCTGATGGGATCCTGTATGCTGCACGAGATGTGACAGCCACTGTGGACAGTGTCCCACTCATTACAGCTTCAATCCTCAGTAAG	Tymp
Tyms	Endogenous	TTTCTCATTGTAAACCCACCTATTCGCTAGGCCATGGTGAATACCCTTGTCTGGGTAAGACTGGCTACTGTCCCAAGTAAATACTCTGTAGACTAGCCCT	Tyms
Uba7	Endogenous	AACAGTTGTTCTCCACAGTCTGTCCGTGTGCAGAAAGACGGGTCCTTGGAGATTGGAGATACGACAACTTTCTCCCGTTACTTGAGAGGTGGGGTTGTCA	Uba7
Ube2c	Endogenous	CAGCATTTAAGAAATACCTGCAAGAAACCTATTCAAAGCAGGTCTCCAGCCAAGATCCCTGATGCAAGCTGGCCGCCCTGCCCCTCTTTTGTGTTGTCTT	Ube2c
Ube2t	Endogenous	CACACAGAAAAGGAAGGCCAGGCCATTAGGAGGAATGGAAAAAAAGTTTTCCCCTGACGTTCAGAGAGTCTATCCTGGTCCCTCTTAGTTACGGCAGTCT	Ube2t
Ulbp1	Endogenous	GGCAACTGGACCCAACTGGATCATGAATTCGAGAAGTTTATAGAAATGTGCAAGGAAGACAAGGTTTTAGCTGCCTTTTTAAAGAAGACTACAGAGGGCG	Ulbp1
Vcam1	Endogenous	TTGCAGTCTCTCAAGCTTTTAAAATCGAGATCTCCCCTGAATACAAAACGATTGCTCAAATCGGTGACTCCATGGCCCTCACTTGCAGCACTACGGGCTG	Vcam1
Vcan	Endogenous	AAGTATGAGGGAGCTGTTACCCTTTCTCCAACTGAGGAATCATTTGAAGGCTCTGGTGATGCGCTTCTTGCTGGCTATACTCAAGCAATATACAATGAGT	Vcan
Vegfa	Endogenous	AGGTGACCAAGCACGGTCCCTCGTGGGACTGGATTCGCCATTTTCTTATATCTGCTGCTAAATCGCCAAGCCCGGAAGATTAGGGTTGTTTCTGGGATTC	Vegfa
Vegfb	Endogenous	GCTGCCATCTAACAATTGTCAAGGAACCTCATGTCTCACCTCAGGGGCCAGGGTACTCTCTCACTTAACCACCCTGGTCAAGTGAGCATCTTCTGGCTGG	Vegfb
Vegfc	Endogenous	CTCTCTTGAAGAACTGTTGCCACATTAGCACTGTCTATGCACAGAAAGACTCTGTGGGACCATGGTAACAGAGGCCCAAGTCTGTGTTTATTGAACCATG	Vegfc
Vhl	Endogenous	GGCTTTGTAGTGTTTAAGAATAAACATGCAAAGTGCCACTGCGTCTGCCCTTTGTAGAGCACTCACCCGAGGGAGGAAGACGTTTTCAGTTTTGCTTCCT	Vhl
Vsir	Endogenous	CTTGGGATGCTGAGTTCTCCCTAGAGACTTGACTTCGACAGCCACAGATGTCAGATGACCTGCATCCTATGAACGTCCGGCTTGGCAAGAGCCTTTCTTC	Vsir
Vtcn1	Endogenous	TTCTAGGGCAAACAAAATAGTTGAGGGATGCTGATTTCCCAAATCATCCGAATCACTTCTCCCTTGAGCAAACAAGCGCCCTGTTATTTCTCAAATGCTG	Vtcn1
Wdr76	Endogenous	CCTTTGACTTCTTGAACGATTCCTCCAGTCTGCTAGTGGGACACTGGGATGGACATTTGTCACTGGTAGATAGACGGACACCTGGAACTTCTTATGAGAA	Wdr76
Wnt10a	Endogenous	TGACTCTAAGGGCTCCAGACCTCTGCTCCTGTCTTTCACTTAACAGATATTTATTTTTGCGCTCTCTTTGAGACACTCTCTGGGGAAAAAGAAGCTCCGG	Wnt10a
Wnt11	Endogenous	TGGGGCCTGAGTGCCCACATGTTGCCTTCCAGGCTGCTCCAAGAAGTCAGGGCAGGGATGGGTAAGACTGTGCATTTGACCTTTCAAGGCCAGAAAGACC	Wnt11
Wnt2	Endogenous	ACACCCTATTCTGTCTATCTTGGGCATTCTGATGTCACCTCTCTTCCTGCTGATTTCTTTTTGGAAATGGCATGACAGGCTGTTAGAGGAGGAGGGTCAT	Wnt2
Wnt2b	Endogenous	ATAGCTAGATGGGTTAGCCACATTGAACAAGGCTCCACATCATGCTTCTACGCAGCTTATAAAGTAGTGGTTTGGTGAGGAGGAAAATCACAATGCTCTA	Wnt2b
Wnt3a	Endogenous	AGATCCTACCTGTGAGGGTCTCATACCTAAGGACCCGGTTTCTGCCTTCAGCCTGGGCTCCTATTTGGGATCTGGGTTCCTTTTTAGGGGAGAAGCTCCT	Wnt3a
Wnt4	Endogenous	TGAGCCTTTGTGTGTGGCTGCCTCTGACCAAAGGGACTTTGTTTATGCCTCTGGCTGTCCACATTGACCACTGTTGACTACTCAGTCTTGTCAAGTGTCC	Wnt4
Wnt5a	Endogenous	TGGAGGTACGGTAACTTGATGTGTTTTGATGATATCTCTTGGCCCAGGGAGTCCACAGAGGTGTTGCAGCTGTTTGGTTGTTATCCTCCTGCGTTTAGAC	Wnt5a
Wnt5b	Endogenous	AAAATGCACCGAGGTTGTGGACCAGTATGTCTGTAAGTGACTGCACCACACGGGCCTTCAGGCCGCTCCTCTCCGCCTCACAAAAGTCTATATTATATAA	Wnt5b
Wnt7b	Endogenous	TACAAGGCCTGAGATGGCCGCAGAGGACAGCCAATCTTCCATTCCATTTGGAGACTGTCATGCAAATCAAATGTCCCTTGTGTCAGGCTCCAGGCATGCC	Wnt7b
Xcl1	Endogenous	AGAGAGTAGCTGTGTGAACTTACAAACCCAGCGGCTGCCAGTTCAAAAAATCAAGACCTATATCATCTGGGAGGGGGCCATGAGAGCTGTAATTTTTGTC	Xcl1
Zap70	Endogenous	AGCACGCTTAGCGTCATCGACAGACAAGCCCCGGCCGATGCCCATGGACACAAGTGTGTACGAGAGTCCCTACAGCGACCCTGAGGAACTCAAAGACAAG	Zap70
Zc3h12a	Endogenous	AAGAGGCCCCTACTTCCGAGCTGCAGATGAAGGTGGACTTTTTCCGTAAACTGGGGTACTCGTCCTCTGAGATCCACAGTGTCCTGCAGAAGCTGGGAGT	Zc3h12a
Zeb1	Endogenous	GCGTACGTTAGCAACCATGAAGGATCTATAGGAAGCAAGCGCTGTGTCCCTTTGGCCTTAAGCAAGACCTGTGCTCTAAGTGCCATTCTCAGTATTGCAA	Zeb1
Zeb2	Endogenous	ACTCACAGAACTAATACTAAAAGAGGGGGAAACACCAAAGAATTTACGTGGGGGAAAATATATGTGAAAGCAATGTTATTGTAGATGTTATAAGGTAGCC	Zeb2
Abcf1	Housekeeping	AGAAAAAGCGAGACACCAGGAAAGGCCGTCGGAAAAAGGATGTGGACGATGATAGTGATGAGAGAGTGCTCATGGAGCGACTTAAGCAACTGTCTGTGCC	Abcf1
Dnajc14	Housekeeping	TGCTCATCCGTATTCTTAGGGTAGTGGGTGCTTTCCTACTCCTGGCTCTCGCCCTCTTTTTGGGATGTCTACAATTGGGCTGGAGGTTTTCGGTGGGACT	Dnajc14
Ercc3	Housekeeping	TGGTGCGGTGTGCCGGCCTGCCTGCATCTAGAGCTGTTATGGGCAAAAGAGATCGAGTGGACCGCGACAAAAAGAAATCCAAGAAGAGGCAGTATGAAGA	Ercc3
G6pdx	Housekeeping	ACATTCTAGTTCCTGGGCTTGGACCGCCATTTTGTCCTATGCTGCTGCCACTGCCACCACCAGTAAACCCAGCTACATTCCTCAAATACCAGGCATTTAA	G6pdx
Gusb	Housekeeping	GAAGGCTGTTCTGGAGAATTACCATTCAGTTCTGGATCAGAAACGTAAAGAATACGTGGTCGGAGAGCTCATCTGGAATTTCGCCGACTTCATGACGAAC	Gusb
Mrpl19	Housekeeping	ACCGCCATGGGCATACATATACCTCATGATCAGGCTCAGGAGTCCTTTCAGTCACGTTGGCCACGTTTTACTCTTGAGAGAGACTGTACTATCTGGCCTG	Mrpl19
Nrde2	Housekeeping	TTCATCCCAGTGAAGGACTCTGCTGAGGCAGCTACTCCTGTTACATCATGGCTGAATCCTCTGGGGATTTATGATCAGTCTACCACACAGTGGTTACAAG	Nrde2
Oaz1	Housekeeping	CCCTGTGCCCTCTCCTGGGTTAGTCCACATGTCGTGATTGTGCAGAATAAACGCTCACTCCATTAGCGGGGTGCTTCTTCGAGCTGAATGCTGTGTTTGT	Oaz1
Polr2a	Housekeeping	CAAGCCCTAAATATTCACCCACTTCTCCCAAGTATTCTCCTACCAGCCCCACTTACTCACCTACCACCCCAAAATATTCTCCAACCTCCCCGACATACTC	Polr2a
Psmc4	Housekeeping	GACTTCGAGAAAGCATACAAGACCGTGATCAAGAAAGATGAACAGGAACATGAATTTTACAAGTGACCTCCTCCCCACACTTCCCCAGGCACCTGTCCCA	Psmc4
Pum1	Housekeeping	TATATACATATATGAAATGGGAACGTTTCAGAGTTGCTAGAGCATCAGCCTGTGATATGGAGTTTATGACGCTCTTTTTTTGGAGATGACCTCGTGCTGA	Pum1
Sdha	Housekeeping	CTGTGCCACCGTACCTCCTGCTATCCGCTCCTACTGATGAAACCTGACAGCTACAGGACCAGCTTATGTGATTATATAGCATAGCTTACCTGCGTTTCCC	Sdha
Sf3a1	Housekeeping	ATGTGCCTCGCTCTTGGTCACTAACTGCTGTCCTGATGTGGGTTATTATTTTTGGAGTTGTGGTCTTGTGGAGGCATGGGTGGTGTTGCTGTGTGTATTC	Sf3a1
Stk11ip	Housekeeping	TGCAGCTGTATCGCACAAGCCCTTTGGACCTGCGGCTGATCTTCTATGATGAGGTGTCTCGACTGGAGAGTTTCTGGGCCCTTCATGTTGTGTGTGGGGA	Stk11ip
Tbc1d10b	Housekeeping	GAGTCCAGGGGTGGAACCCAATGTTTACATTCTCTTCTGTCTTGGTCCCACCTCAGTGGCAGTTTTGTGGCGCTTTGAGGAACCGGAAAATGAACCTGCT	Tbc1d10b
Tbp	Housekeeping	GTGGCGGGTATCTGCTGGCGGTTTGGCTAGGTTTCTGCGGTCGCGTCATTTTCTCCGCAGTGCCCAGCATCACTATTTCATGGTGTGTGAAGATAACCCA	Tbp
Tfrc	Housekeeping	ATACCTATGAGGCATTGACTCAGAAAGTTCCTCAGCTCAACCAAATGGTTCGTACAGCAGCGGAAGTGGCTGGTCAGCTCATTATTAAACTTACCCATGA	Tfrc
Tlk2	Housekeeping	AATGTGTATTTTGTGTGTACCTCTCCCCTGCTTAAATGCTAGGGCTGGAGCAGGACCTTCCGTATGCCAGGCAAGTGCAGCTCTAGCCTCAACCTGCGCT	Tlk2
Tmub2	Housekeeping	ATGGCCTTAGCATACTTCTGTAGGAAGCCTCAAGTACCTTCCACTCCTTAGATGAGTGTGGACCTTTTGAAACTAAATTCACAGGGATGAAGACTGCCAG	Tmub2
Ubb	Housekeeping	GGAGGTGGGGGCCCGCGGAACTACTTTCGGTGGCGCAGGAAGACAACAGCTACGTAGGAGTGAGCAGTCACGCAACAGACGCTGCATAAATAGCGGCTCG	Ubb
NEG_A	Negative	AACCGCCGCATACGGCCGATTGTCGCAGCCCGGGTCGATTATAACAACGGTGCAATCTCAGCTAAACCGACGCAGTTTTGCTCCTTGGATTCTGAGCCCG	NEG_A
NEG_B	Negative	GCACTGGCATTGGTCGTTTCAGGAGGCCATACAGAACTGGTTTATATGAAGGAACATGGATCATTTGAAGTCATTGGGGAAACCCTTGATGATGCGGCAG	NEG_B
NEG_C	Negative	GTACAGGCTGCTGGCTCATGTTTCCTTCTACGCTGCACTTGCGGGCATAGAGGTCGGTTGCGATCTATATTCGGAGATAACTATTCACCCAGCGCCACTC	NEG_C
NEG_D	Negative	AGAGATCACGTGGACCAAAGCTGATTGATTACGGGACTGGCCGTAAGTGCTGCCCGCGAGTAGATCGTCTAGATCCGGCTAAAATTCCCTGCGGTGCCTT	NEG_D
NEG_E	Negative	CCCAGATGACCTTCTCCCTCATAATCACTTAATCTGAGCGCAGGAGGCAGGCTGTATTAATTCCGGCCTCCAACCGGACCGTGGAACGACGCGACCAAGT	NEG_E
NEG_F	Negative	GGGTCCTTACCGGCTGTAAGCTCACTACAATCCAGGTACAGAGTGCGTTAACCGGCCATTAGAGGGCCGCTACACCCGTCAGAATTTAAACGTATGGGCG	NEG_F
NEG_G	Negative	ACCCGTATGAACTGTTGCCGGCTCGGAAATGTTAAGGCTCTGCGCACGCACTTTATCATTCGCAGCCTGTTCTGTCAGCGGGTCAGCCTAGGTTACGGTG	NEG_G
NEG_H	Negative	TTGGTCCGAGGAGGCATATAGGAAACGATGGGCACGCGCTATTCAGACGTTATTTGGTATGGAGTAAGAGGCCGGAAACTGGGCTCGATTGATGGATACT	NEG_H
POS_A	Positive	TCAGGCCTTGCCCTTACTAATGGCGCGTTGTAACGGGCCTTGAGGGAATGTCACTATTGAGGCACCCGTTCGACCCTCAGAGATATACCATTCCGCCTAT	POS_A
POS_B	Positive	ATGAAAGCGCTGCTACTATGATAAGAGTACACGTACAGGTCTCGCCCGATTGGATTATGGCGAGCTGCCGCATTGACGGACATACCTTTGAACGTAATCG	POS_B
POS_C	Positive	GCCGCTTTCGCTCGGGTCTGCGGGTTATAGCTTTTCAGTCTCGACGGGCTAGCACACATCTGGTTGACTAGGCGCATAGTCGCCATTCACAGATTTGCTC	POS_C
POS_D	Positive	TACCTGGCATTTGGGCACTTCTTGCGTTTAAGCGGGAAAGATCGCGAGGGCCCGCTATTTGCGATACTTCCCATGTCGGTGCCGTCGCCTCTATGTACTC	POS_D
POS_E	Positive	GGTTGAATTTGAGCGGATGGGCTCAACTGCGTCGTAACCGGTAGATACAGGGCATACGAGCCTCCCTATTTAACGGCATCATCCCGCGTAGTGCTGGTCA	POS_E
POS_F	Positive	ACGAAGCTGTTCGGCCGCACGCAAGTACCTCCCACTTAGAAAGCGAATAACCCAACGACCGTGTTCAACCCTGGCCGTCTCTCAACCAGGTATGCAATCA	POS_F