#ID = 
#Probe Name = miRBase miRNA Gene Name or the name of the control on the array
#Human Mature Sanger Registry Name = miRBase human miRNA Gene Name
#Human Sanger Accession Number(s) = miRBase Accession Number (human)
#Mouse Mature Sanger Registry Name = miRBase mouse miRNA Gene Name
#Mouse Sanger Accession Number(s) = miRBase Accession Number (mouse)
#Rat Mature Sanger Registry Name = miRBase Rat miRNA Gene Name
#Rat Sanger Accession Number(s) = miRBase Accession Number (Rat)
#SEQUENCE = Mature miRNA Sequence
#SPOT_ID = 
ID	Probe Name	Human Mature Sanger Registry Name	Human Sanger Accession Number(s)	Mouse Mature Sanger Registry Name	Mouse Sanger Accession Number(s)	Rat Mature Sanger Registry Name	Rat Sanger Accession Number(s)	SEQUENCE	SPOT_ID
PS20001	Control_1								Control
PS20101	hsa_let_7a	hsa-let-7a	MI0000060,MI0000061,MI0000062			rno-let-7a	MI0000827,MI0000828	UGAGGUAGUAGGUUGUAUAGUU	hsa_let_7a
PS20102	hsa_let_7b	hsa-let-7b	MI0000063	mmu-let-7b	MI0000558	rno-let-7b	MI0000829	UGAGGUAGUAGGUUGUGUGGUU	hsa_let_7b
PS20103	hsa_let_7c	hsa-let-7c	MI0000064	mmu-let-7c	MI0000559,MI0000560	rno-let-7c	MI0000830,MI0000831	UGAGGUAGUAGGUUGUAUGGUU	hsa_let_7c
PS20104	hsa_let_7d	hsa-let-7d	MI0000065	mmu-let-7d	MI0000405	rno-let-7d	MI0000601	AGAGGUAGUAGGUUGCAUAGU	hsa_let_7d
PS20105	hsa_let_7e	hsa-let-7e	MI0000066	mmu-let-7e	MI0000561	rno-let-7e	MI0000832	UGAGGUAGGAGGUUGUAUAGU	hsa_let_7e
PS20106	hsa_let_7f	hsa-let-7f	MI0000067,MI0000068			rno-let-7f	MI0000833,MI0000834	UGAGGUAGUAGAUUGUAUAGUU	hsa_let_7f
PS20107	hsa_let_7g	hsa-let-7g	MI0000433	mmu-let-7g	MI0000137			UGAGGUAGUAGUUUGUACAGU	hsa_let_7g
PS20108	hsa_let_7i	hsa-let-7i	MI0000434	mmu-let-7i	MI0000138	rno-let-7i	MI0000835	UGAGGUAGUAGUUUGUGCUGU	hsa_let_7i
PS20109	hsa_miR_1	hsa-miR-1	MI0000651,MI0000437	mmu-miR-1	MI0000139,MI0000652			UGGAAUGUAAAGAAGUAUGUA	hsa_miR_1
PS20110	hsa_miR_100	hsa-miR-100	MI0000102	mmu-miR-100	MI0000692	rno-miR-100	MI0000885	AACCCGUAGAUCCGAACUUGUG	hsa_miR_100
PS20111	hsa_miR_101	hsa-miR-101	MI0000103,MI0000739	mmu-miR-101a	MI0000148	rno-miR-101	MI0000886	UACAGUACUGUGAUAACUGAAG	hsa_miR_101
PS20112	hsa_miR_103	hsa-miR-103	MI0000109,MI0000108	mmu-miR-103	MI0000587,MI0000588	rno-miR-103	MI0000888,MI0000887	AGCAGCAUUGUACAGGGCUAUGA	hsa_miR_103
PS20113	hsa_miR_105	hsa-miR-105	MI0000111,MI0000112					UCAAAUGCUCAGACUCCUGU	hsa_miR_105
PS20114	hsa_miR_106a	hsa-miR-106a	MI0000113					AAAAGUGCUUACAGUGCAGGUAGC	hsa_miR_106a
PS20115	hsa_miR_106b	hsa-miR-106b	MI0000734	mmu-miR-106b	MI0000407	rno-miR-106b	MI0000889	UAAAGUGCUGACAGUGCAGAU	hsa_miR_106b
PS20116	hsa_miR_107	hsa-miR-107	MI0000114	mmu-miR-107	MI0000684	rno-miR-107	MI0000890	AGCAGCAUUGUACAGGGCUAUCA	hsa_miR_107
PS20117	hsa_miR_10a	hsa-miR-10a	MI0000266	mmu-miR-10a	MI0000685	rno-miR-10a	MI0000841	UACCCUGUAGAUCCGAAUUUGUG	hsa_miR_10a
PS20118	hsa_miR_10b	hsa-miR-10b	MI0000267					UACCCUGUAGAACCGAAUUUGU	hsa_miR_10b
PS20119	hsa_miR_122a	hsa-miR-122a	MI0000442	mmu-miR-122a	MI0000256	rno-miR-122a	MI0000891	UGGAGUGUGACAAUGGUGUUUGU	hsa_miR_122a
PS20120	hsa_miR_124a	hsa-miR-124a	MI0000443,MI0000444,MI0000445			rno-miR-124a	MI0000893,MI0000894,MI0000892	UUAAGGCACGCGGUGAAUGCCA	hsa_miR_124a
PS20121	hsa_miR_125a	hsa-miR-125a	MI0000469	mmu-miR-125a	MI0000151	rno-miR-125a	MI0000895	UCCCUGAGACCCUUUAACCUGUG	hsa_miR_125a
PS20122	hsa_miR_125b	hsa-miR-125b	MI0000446,MI0000470	mmu-miR-125b	MI0000725,MI0000152	rno-miR-125b	MI0000896,MI0000897	UCCCUGAGACCCUAACUUGUGA	hsa_miR_125b
PS20123	hsa_miR_126	hsa-miR-126	MI0000471	mmu-miR-126-3p	MI0000153	rno-miR-126	MI0000898	UCGUACCGUGAGUAAUAAUGC	hsa_miR_126
PS20124	hsa_miR_126_AS	hsa-miR-126*	MI0000471	mmu-miR-126-5p	MI0000153	rno-miR-126*	MI0000898	CAUUAUUACUUUUGGUACGCG	hsa_miR_126_AS
PS20125	hsa_miR_127	hsa-miR-127	MI0000472			rno-miR-127	MI0000899	UCGGAUCCGUCUGAGCUUGGCU	hsa_miR_127
PS20126	hsa_miR_128a	hsa-miR-128a	MI0000447	mmu-miR-128a	MI0000155	rno-miR-128a	MI0000900	UCACAGUGAACCGGUCUCUUUU	hsa_miR_128a
PS20127	hsa_miR_129	hsa-miR-129	MI0000252,MI0000473					CUUUUUGCGGUCUGGGCUUGC	hsa_miR_129
PS20128	hsa_miR_130a	hsa-miR-130a	MI0000448	mmu-miR-130a	MI0000156	rno-miR-130a	MI0000903	CAGUGCAAUGUUAAAAGGGCAU	hsa_miR_130a
PS20129	hsa_miR_130b	hsa-miR-130b	MI0000748	mmu-miR-130b	MI0000408	rno-miR-130b	MI0000904	CAGUGCAAUGAUGAAAGGGCAU	hsa_miR_130b
PS20130	hsa_miR_132	hsa-miR-132	MI0000449	mmu-miR-132	MI0000158	rno-miR-132	MI0000905	UAACAGUCUACAGCCAUGGUCG	hsa_miR_132
PS20131	hsa_miR_133a	hsa-miR-133a	MI0000450,MI0000451	mmu-miR-133a	MI0000159,MI0000820	rno-miR-133a	MI0000906	UUGGUCCCCUUCAACCAGCUGU	hsa_miR_133a
PS20132	hsa_miR_134	hsa-miR-134	MI0000474			rno-miR-134	MI0000907	UGUGACUGGUUGACCAGAGGG	hsa_miR_134
PS20133	hsa_miR_135a	hsa-miR-135a	MI0000452,MI0000453	mmu-miR-135a	MI0000161,MI0000715	rno-miR-135a	MI0000908	UAUGGCUUUUUAUUCCUAUGUGA	hsa_miR_135a
PS20134	hsa_miR_135b	hsa-miR-135b	MI0000810	mmu-miR-135b	MI0000646	rno-miR-135b	MI0000645	UAUGGCUUUUCAUUCCUAUGUG	hsa_miR_135b
PS20135	hsa_miR_136	hsa-miR-136	MI0000475	mmu-miR-136	MI0000162	rno-miR-136	MI0000909	ACUCCAUUUGUUUUGAUGAUGGA	hsa_miR_136
PS20136	hsa_miR_137	hsa-miR-137	MI0000454			rno-miR-137	MI0000910	UAUUGCUUAAGAAUACGCGUAG	hsa_miR_137
PS20137	hsa_miR_138	hsa-miR-138	MI0000476,MI0000455	mmu-miR-138	MI0000722,MI0000164	rno-miR-138	MI0000912,MI0000911	AGCUGGUGUUGUGAAUC	hsa_miR_138
PS20138	hsa_miR_139	hsa-miR-139	MI0000261	mmu-miR-139	MI0000693	rno-miR-139	MI0000913	UCUACAGUGCACGUGUCU	hsa_miR_139
PS20139	hsa_miR_140	hsa-miR-140	MI0000456			rno-miR-140	MI0000611	AGUGGUUUUACCCUAUGGUAG	hsa_miR_140
PS20140	hsa_miR_141	hsa-miR-141	MI0000457	mmu-miR-141	MI0000166	rno-miR-141	MI0000914	UAACACUGUCUGGUAAAGAUGG	hsa_miR_141
PS20141	hsa_miR_142_3p	hsa-miR-142-3p	MI0000458			rno-miR-142-3p	MI0000915	UGUAGUGUUUCCUACUUUAUGGA	hsa_miR_142_3p
PS20142	hsa_miR_142_5p	hsa-miR-142-5p	MI0000458	mmu-miR-142-5p	MI0000167	rno-miR-142-5p	MI0000915	CAUAAAGUAGAAAGCACUAC	hsa_miR_142_5p
PS20143	hsa_miR_143	hsa-miR-143	MI0000459	mmu-miR-143	MI0000257	rno-miR-143	MI0000916	UGAGAUGAAGCACUGUAGCUCA	hsa_miR_143
PS20144	hsa_miR_144	hsa-miR-144	MI0000460	mmu-miR-144	MI0000168	rno-miR-144	MI0000917	UACAGUAUAGAUGAUGUACUAG	hsa_miR_144
PS20145	hsa_miR_145	hsa-miR-145	MI0000461	mmu-miR-145	MI0000169	rno-miR-145	MI0000918	GUCCAGUUUUCCCAGGAAUCCCUU	hsa_miR_145
PS20146	hsa_miR_146a	hsa-miR-146a	MI0000477	mmu-miR-146	MI0000170	rno-miR-146	MI0000919	UGAGAACUGAAUUCCAUGGGUU	hsa_miR_146a
PS20147	hsa_miR_147	hsa-miR-147	MI0000262					GUGUGUGGAAAUGCUUCUGC	hsa_miR_147
PS20148	hsa_miR_148a	hsa-miR-148a	MI0000253	mmu-miR-148a	MI0000550			UCAGUGCACUACAGAACUUUGU	hsa_miR_148a
PS20149	hsa_miR_148b	hsa-miR-148b	MI0000811	mmu-miR-148b	MI0000617	rno-miR-148b	MI0000616	UCAGUGCAUCACAGAACUUUGU	hsa_miR_148b
PS20150	hsa_miR_149	hsa-miR-149	MI0000478	mmu-miR-149	MI0000171			UCUGGCUCCGUGUCUUCACUCC	hsa_miR_149
PS20151	hsa_miR_150	hsa-miR-150	MI0000479	mmu-miR-150	MI0000172	rno-miR-150	MI0000920	UCUCCCAACCCUUGUACCAGUG	hsa_miR_150
PS20152	hsa_miR_151	hsa-miR-151	MI0000809					ACUAGACUGAAGCUCCUUGAGG	hsa_miR_151
PS20153	hsa_miR_152	hsa-miR-152	MI0000462	mmu-miR-152	MI0000174	rno-miR-152	MI0000921	UCAGUGCAUGACAGAACUUGGG	hsa_miR_152
PS20154	hsa_miR_153	hsa-miR-153	MI0000463,MI0000464			rno-miR-153	MI0000922	UUGCAUAGUCACAAAAGUGA	hsa_miR_153
PS20155	hsa_miR_154	hsa-miR-154	MI0000480	mmu-miR-154	MI0000176	rno-miR-154	MI0000923	UAGGUUAUCCGUGUUGCCUUCG	hsa_miR_154
PS20156	hsa_miR_155	hsa-miR-155	MI0000681					UUAAUGCUAAUCGUGAUAGGGG	hsa_miR_155
PS20157	hsa_miR_15a	hsa-miR-15a	MI0000069	mmu-miR-15a	MI0000564			UAGCAGCACAUAAUGGUUUGUG	hsa_miR_15a
PS20158	hsa_miR_15b	hsa-miR-15b	MI0000438	mmu-miR-15b	MI0000140	rno-miR-15b	MI0000843	UAGCAGCACAUCAUGGUUUACA	hsa_miR_15b
PS20159	hsa_miR_16	hsa-miR-16	MI0000070,MI0000115	mmu-miR-16	MI0000565,MI0000566	rno-miR-16	MI0000844	UAGCAGCACGUAAAUAUUGGCG	hsa_miR_16
PS20160	hsa_miR_17_3p	hsa-miR-17-3p	MI0000071					ACUGCAGUGAAGGCACUUGU	hsa_miR_17_3p
PS20161	hsa_miR_17_5p	hsa-miR-17-5p	MI0000071	mmu-miR-17-5p	MI0000687	rno-miR-17	MI0000845	CAAAGUGCUUACAGUGCAGGUAGU	hsa_miR_17_5p
PS20162	hsa_miR_18a	hsa-miR-18a	MI0000072	mmu-miR-18	MI0000567	rno-miR-18	MI0000846	UAAGGUGCAUCUAGUGCAGAUA	hsa_miR_18a
PS20163	hsa_miR_181a	hsa-miR-181a	MI0000269,MI0000289	mmu-miR-181a	MI0000223,MI0000697	rno-miR-181a	MI0000925	AACAUUCAACGCUGUCGGUGAGU	hsa_miR_181a
PS20164	hsa_miR_181b	hsa-miR-181b	MI0000270,MI0000683	mmu-miR-181b	MI0000723,MI0000823	rno-miR-181b	MI0000926,MI0000927	AACAUUCAUUGCUGUCGGUGGG	hsa_miR_181b
PS20165	hsa_miR_181c	hsa-miR-181c	MI0000271	mmu-miR-181c	MI0000724	rno-miR-181c	MI0000924	AACAUUCAACCUGUCGGUGAGU	hsa_miR_181c
PS20166	hsa_miR_182	hsa-miR-182	MI0000272	mmu-miR-182	MI0000224			UUUGGCAAUGGUAGAACUCACA	hsa_miR_182
PS20167	hsa_miR_182_AS	hsa-miR-182*	MI0000272					UGGUUCUAGACUUGCCAACUA	hsa_miR_182_AS
PS20168	hsa_miR_183	hsa-miR-183	MI0000273	mmu-miR-183	MI0000225	rno-miR-183	MI0000928	UAUGGCACUGGUAGAAUUCACUG	hsa_miR_183
PS20169	hsa_miR_184	hsa-miR-184	MI0000481	mmu-miR-184	MI0000226	rno-miR-184	MI0000929	UGGACGGAGAACUGAUAAGGGU	hsa_miR_184
PS20170	hsa_miR_185	hsa-miR-185	MI0000482	mmu-miR-185	MI0000227	rno-miR-185	MI0000930	UGGAGAGAAAGGCAGUUC	hsa_miR_185
PS20171	hsa_miR_186	hsa-miR-186	MI0000483	mmu-miR-186	MI0000228	rno-miR-186	MI0000931	CAAAGAAUUCUCCUUUUGGGCUU	hsa_miR_186
PS20172	hsa_miR_187	hsa-miR-187	MI0000274			rno-miR-187	MI0000932	UCGUGUCUUGUGUUGCAGCCG	hsa_miR_187
PS20173	hsa_miR_188	hsa-miR-188	MI0000484	mmu-miR-188	MI0000230			CAUCCCUUGCAUGGUGGAGGGU	hsa_miR_188
PS20174	hsa_miR_189	hsa-miR-189	MI0000080	mmu-miR-189	MI0000231			GUGCCUACUGAGCUGAUAUCAGU	hsa_miR_189
PS20175	hsa_miR_190	hsa-miR-190	MI0000486	mmu-miR-190	MI0000232	rno-miR-190	MI0000933	UGAUAUGUUUGAUAUAUUAGGU	hsa_miR_190
PS20176	hsa_miR_191	hsa-miR-191	MI0000465	mmu-miR-191	MI0000233	rno-miR-191	MI0000934	CAACGGAAUCCCAAAAGCAGCU	hsa_miR_191
PS20177	hsa_miR_192	hsa-miR-192	MI0000234			rno-miR-192	MI0000935	CUGACCUAUGAAUUGACAGCC	hsa_miR_192
PS20178	hsa_miR_193a	hsa-miR-193a	MI0000487	mmu-miR-193	MI0000235	rno-miR-193	MI0000936	AACUGGCCUACAAAGUCCCAG	hsa_miR_193a
PS20179	hsa_miR_194	hsa-miR-194	MI0000488,MI0000732	mmu-miR-194	MI0000236,MI0000733	rno-miR-194	MI0000937,MI0000938	UGUAACAGCAACUCCAUGUGGA	hsa_miR_194
PS20180	hsa_miR_195	hsa-miR-195	MI0000489	mmu-miR-195	MI0000237	rno-miR-195	MI0000939	UAGCAGCACAGAAAUAUUGGC	hsa_miR_195
PS20181	hsa_miR_196a	hsa-miR-196a	MI0000238,MI0000279	mmu-miR-196a	MI0000552,MI0000553	rno-miR-196a	MI0000940	UAGGUAGUUUCAUGUUGUUGG	hsa_miR_196a
PS20182	hsa_miR_196b	hsa-miR-196b	MI0001150	mmu-miR-196b	MI0001151	rno-miR-196b	MI0001152	UAGGUAGUUUCCUGUUGUUGG	hsa_miR_196b
PS20183	hsa_miR_197	hsa-miR-197	MI0000239					UUCACCACCUUCUCCACCCAGC	hsa_miR_197
PS20184	hsa_miR_198	hsa-miR-198	MI0000240					GGUCCAGAGGGGAGAUAGG	hsa_miR_198
PS20185	hsa_miR_199a	hsa-miR-199a	MI0000242,MI0000281	mmu-miR-199a	MI0000241,MI0000713	rno-miR-199a	MI0000941	CCCAGUGUUCAGACUACCUGUUC	hsa_miR_199a
PS20186	hsa_miR_199a_AS	hsa-miR-199a*	MI0000242,MI0000281	mmu-miR-199a*	MI0000241,MI0000713			UACAGUAGUCUGCACAUUGGUU	hsa_miR_199a_AS
PS20187	hsa_miR_199b	hsa-miR-199b	MI0000282					CCCAGUGUUUAGACUAUCUGUUC	hsa_miR_199b
PS20188	hsa_miR_19a	hsa-miR-19a	MI0000073	mmu-miR-19a	MI0000688	rno-miR-19a	MI0000849	UGUGCAAAUCUAUGCAAAACUGA	hsa_miR_19a
PS20189	hsa_miR_19b	hsa-miR-19b	MI0000074,MI0000075	mmu-miR-19b	MI0000718,MI0000546	rno-miR-19b	MI0000847,MI0000848	UGUGCAAAUCCAUGCAAAACUGA	hsa_miR_19b
PS20190	hsa_miR_20a	hsa-miR-20a	MI0000076	mmu-miR-20	MI0000568	rno-miR-20	MI0000638	UAAAGUGCUUAUAGUGCAGGUAG	hsa_miR_20a
PS20191	hsa_miR_200a	hsa-miR-200a	MI0000737	mmu-miR-200a	MI0000554	rno-miR-200a	MI0000943	UAACACUGUCUGGUAACGAUGU	hsa_miR_200a
PS20192	hsa_miR_200b	hsa-miR-200b	MI0000342	mmu-miR-200b	MI0000243	rno-miR-200b	MI0000944	UAAUACUGCCUGGUAAUGAUGAC	hsa_miR_200b
PS20193	hsa_miR_200c	hsa-miR-200c	MI0000650	mmu-miR-200c	MI0000694	rno-miR-200c	MI0000942	UAAUACUGCCGGGUAAUGAUGG	hsa_miR_200c
PS20194	hsa_miR_203	hsa-miR-203	MI0000283			rno-miR-203	MI0000945	GUGAAAUGUUUAGGACCACUAG	hsa_miR_203
PS20195	hsa_miR_204	hsa-miR-204	MI0000284			rno-miR-204	MI0000946	UUCCCUUUGUCAUCCUAUGCCU	hsa_miR_204
PS20196	hsa_miR_205	hsa-miR-205	MI0000285	mmu-miR-205	MI0000248	rno-miR-205	MI0000947	UCCUUCAUUCCACCGGAGUCUG	hsa_miR_205
PS20197	hsa_miR_206	hsa-miR-206	MI0000490	mmu-miR-206	MI0000249	rno-miR-206	MI0000948	UGGAAUGUAAGGAAGUGUGUGG	hsa_miR_206
PS20198	hsa_miR_208	hsa-miR-208	MI0000251	mmu-miR-208	MI0000555	rno-miR-208	MI0000949	AUAAGACGAGCAAAAAGCUUGU	hsa_miR_208
PS20199	hsa_miR_21	hsa-miR-21	MI0000077	mmu-miR-21	MI0000569	rno-miR-21	MI0000850	UAGCUUAUCAGACUGAUGUUGA	hsa_miR_21
PS20200	hsa_miR_210	hsa-miR-210	MI0000286	mmu-miR-210	MI0000695	rno-miR-210	MI0000950	CUGUGCGUGUGACAGCGGCUGA	hsa_miR_210
PS20201	hsa_miR_211	hsa-miR-211	MI0000287					UUCCCUUUGUCAUCCUUCGCCU	hsa_miR_211
PS20202	hsa_miR_212	hsa-miR-212	MI0000288	mmu-miR-212	MI0000696	rno-miR-212	MI0000952	UAACAGUCUCCAGUCACGGCC	hsa_miR_212
PS20203	hsa_miR_213	hsa-miR-213	MI0000289	mmu-miR-213	MI0000697	rno-miR-213	MI0000953	ACCAUCGACCGUUGAUUGUACC	hsa_miR_213
PS20204	hsa_miR_214	hsa-miR-214	MI0000290	mmu-miR-214	MI0000698	rno-miR-214	MI0000954	ACAGCAGGCACAGACAGGCAG	hsa_miR_214
PS20205	hsa_miR_215	hsa-miR-215	MI0000291					AUGACCUAUGAAUUGACAGAC	hsa_miR_215
PS20206	hsa_miR_216	hsa-miR-216	MI0000292	mmu-miR-216	MI0000699	rno-miR-216	MI0000955	UAAUCUCAGCUGGCAACUGUG	hsa_miR_216
PS20207	hsa_miR_217	hsa-miR-217	MI0000293					UACUGCAUCAGGAACUGAUUGGAU	hsa_miR_217
PS20208	hsa_miR_218	hsa-miR-218	MI0000294,MI0000295	mmu-miR-218	MI0000700,MI0000701	rno-miR-218	MI0000958,MI0000957	UUGUGCUUGAUCUAACCAUGU	hsa_miR_218
PS20209	hsa_miR_219	hsa-miR-219	MI0000296,MI0000740	mmu-miR-219	MI0000702,MI0000741	rno-miR-219	MI0000959,MI0000960	UGAUUGUCCAAACGCAAUUCU	hsa_miR_219
PS20210	hsa_miR_22	hsa-miR-22	MI0000078	mmu-miR-22	MI0000570	rno-miR-22	MI0000851	AAGCUGCCAGUUGAAGAACUGU	hsa_miR_22
PS20211	hsa_miR_220	hsa-miR-220	MI0000297					CCACACCGUAUCUGACACUUU	hsa_miR_220
PS20212	hsa_miR_221	hsa-miR-221	MI0000298			rno-miR-221	MI0000961	AGCUACAUUGUCUGCUGGGUUUC	hsa_miR_221
PS20213	hsa_miR_222	hsa-miR-222	MI0000299	mmu-miR-222	MI0000710	rno-miR-222	MI0000962	AGCUACAUCUGGCUACUGGGUCUC	hsa_miR_222
PS20214	hsa_miR_223	hsa-miR-223	MI0000300	mmu-miR-223	MI0000703	rno-miR-223	MI0000963	UGUCAGUUUGUCAAAUACCCC	hsa_miR_223
PS20215	hsa_miR_224	hsa-miR-224	MI0000301					CAAGUCACUAGUGGUUCCGUUUA	hsa_miR_224
PS20216	hsa_miR_23a	hsa-miR-23a	MI0000079	mmu-miR-23a	MI0000571	rno-miR-23a	MI0000852	AUCACAUUGCCAGGGAUUUCC	hsa_miR_23a
PS20217	hsa_miR_23b	hsa-miR-23b	MI0000439	mmu-miR-23b	MI0000141	rno-miR-23b	MI0000853	AUCACAUUGCCAGGGAUUACC	hsa_miR_23b
PS20218	hsa_miR_24	hsa-miR-24	MI0000080,MI0000081	mmu-miR-24	MI0000231,MI0000572	rno-miR-24	MI0000854,MI0000855	UGGCUCAGUUCAGCAGGAACAG	hsa_miR_24
PS20219	hsa_miR_25	hsa-miR-25	MI0000082	mmu-miR-25	MI0000689	rno-miR-25	MI0000856	CAUUGCACUUGUCUCGGUCUGA	hsa_miR_25
PS20220	hsa_miR_26a	hsa-miR-26a	MI0000083,MI0000750	mmu-miR-26a	MI0000573,MI0000706	rno-miR-26a	MI0000857	UUCAAGUAAUCCAGGAUAGGC	hsa_miR_26a
PS20221	hsa_miR_26b	hsa-miR-26b	MI0000084	mmu-miR-26b	MI0000575	rno-miR-26b	MI0000858	UUCAAGUAAUUCAGGAUAGGUU	hsa_miR_26b
PS20222	hsa_miR_27a	hsa-miR-27a	MI0000085	mmu-miR-27a	MI0000578	rno-miR-27a	MI0000860	UUCACAGUGGCUAAGUUCCGC	hsa_miR_27a
PS20223	hsa_miR_27b	hsa-miR-27b	MI0000440	mmu-miR-27b	MI0000142	rno-miR-27b	MI0000859	UUCACAGUGGCUAAGUUCUGC	hsa_miR_27b
PS20224	hsa_miR_28	hsa-miR-28	MI0000086	mmu-miR-28	MI0000690	rno-miR-28	MI0000861	AAGGAGCUCACAGUCUAUUGAG	hsa_miR_28
PS20225	hsa_miR_296	hsa-miR-296	MI0000747	mmu-miR-296	MI0000394	rno-miR-296	MI0000967	AGGGCCCCCCCUCAAUCCUGU	hsa_miR_296
PS20226	hsa_miR_299_5p	hsa-miR-299-5p	MI0000744	mmu-miR-299	MI0000399	rno-miR-299	MI0000970	UGGUUUACCGUCCCACAUACAU	hsa_miR_299_5p
PS20227	hsa_miR_29a	hsa-miR-29a	MI0000087	mmu-miR-29a	MI0000576	rno-miR-29a	MI0000863	UAGCACCAUCUGAAAUCGGUU	hsa_miR_29a
PS20228	hsa_miR_29b	hsa-miR-29b	MI0000105,MI0000107	mmu-miR-29b	MI0000143,MI0000712	rno-miR-29b	MI0000864,MI0000862	UAGCACCAUUUGAAAUCAGUGUU	hsa_miR_29b
PS20229	hsa_miR_29c	hsa-miR-29c	MI0000735	mmu-miR-29c	MI0000577	rno-miR-29c	MI0000865	UAGCACCAUUUGAAAUCGGU	hsa_miR_29c
PS20230	hsa_miR_301	hsa-miR-301	MI0000745	mmu-miR-301	MI0000401			CAGUGCAAUAGUAUUGUCAAAGC	hsa_miR_301
PS20231	hsa_miR_302a	hsa-miR-302a	MI0000738	mmu-miR-302	MI0000402			UAAGUGCUUCCAUGUUUUGGUGA	hsa_miR_302a
PS20232	hsa_miR_302b	hsa-miR-302b	MI0000772					UAAGUGCUUCCAUGUUUUAGUAG	hsa_miR_302b
PS20233	hsa_miR_302b_AS	hsa-miR-302b*	MI0000772					ACUUUAACAUGGAAGUGCUUUCU	hsa_miR_302b_AS
PS20234	hsa_miR_302c	hsa-miR-302c	MI0000773					UAAGUGCUUCCAUGUUUCAGUGG	hsa_miR_302c
PS20235	hsa_miR_302c_AS	hsa-miR-302c*	MI0000773					UUUAACAUGGGGGUACCUGCUG	hsa_miR_302c_AS
PS20236	hsa_miR_302d	hsa-miR-302d	MI0000774					UAAGUGCUUCCAUGUUUGAGUGU	hsa_miR_302d
PS20237	hsa_miR_30a_3p	hsa-miR-30a-3p	MI0000088	mmu-miR-30a-3p	MI0000144	rno-miR-30a-3p	MI0000870	CUUUCAGUCGGAUGUUUGCAGC	hsa_miR_30a_3p
PS20238	hsa_miR_30a_5p	hsa-miR-30a-5p	MI0000088	mmu-miR-30a-5p	MI0000144	rno-miR-30a-5p	MI0000870	UGUAAACAUCCUCGACUGGAAG	hsa_miR_30a_5p
PS20239	hsa_miR_30b	hsa-miR-30b	MI0000441	mmu-miR-30b	MI0000145	rno-miR-30b	MI0000868	UGUAAACAUCCUACACUCAGCU	hsa_miR_30b
PS20240	hsa_miR_30c	hsa-miR-30c	MI0000736,MI0000254	mmu-miR-30c	MI0000547,MI0000548	rno-miR-30c	MI0000866,MI0000871	UGUAAACAUCCUACACUCUCAGC	hsa_miR_30c
PS20241	hsa_miR_30d	hsa-miR-30d	MI0000255	mmu-miR-30d	MI0000549	rno-miR-30d	MI0000869	UGUAAACAUCCCCGACUGGAAG	hsa_miR_30d
PS20242	hsa_miR_30e_3p	hsa-miR-30e-3p	MI0000749					CUUUCAGUCGGAUGUUUACAGC	hsa_miR_30e_3p
PS20243	hsa_miR_30e_5p	hsa-miR-30e-5p	MI0000749	mmu-miR-30e	MI0000259	rno-miR-30e	MI0000867	UGUAAACAUCCUUGACUGGA	hsa_miR_30e_5p
PS20244	hsa_miR_31	hsa-miR-31	MI0000089					GGCAAGAUGCUGGCAUAGCUG	hsa_miR_31
PS20245	hsa_miR_32	hsa-miR-32	MI0000090	mmu-miR-32	MI0000691	rno-miR-32	MI0000873	UAUUGCACAUUACUAAGUUGC	hsa_miR_32
PS20246	hsa_miR_320	hsa-miR-320	MI0000542	mmu-miR-320	MI0000704	rno-miR-320	MI0000972	AAAAGCUGGGUUGAGAGGGCGAA	hsa_miR_320
PS20247	hsa_miR_323	hsa-miR-323	MI0000807	mmu-miR-323	MI0000592	rno-miR-323	MI0000591	GCACAUUACACGGUCGACCUCU	hsa_miR_323
PS20248	hsa_miR_324_3p	hsa-miR-324-3p	MI0000813	mmu-miR-324-3p	MI0000595	rno-miR-324-3p	MI0000594	CCACUGCCCCAGGUGCUGCUGG	hsa_miR_324_3p
PS20249	hsa_miR_324_5p	hsa-miR-324-5p	MI0000813			rno-miR-324-5p	MI0000594	CGCAUCCCCUAGGGCAUUGGUGU	hsa_miR_324_5p
PS20250	hsa_miR_325	hsa-miR-325	MI0000824					CCUAGUAGGUGUCCAGUAAGUGU	hsa_miR_325
PS20251	hsa_miR_326	hsa-miR-326	MI0000808					CCUCUGGGCCCUUCCUCCAG	hsa_miR_326
PS20252	hsa_miR_328	hsa-miR-328	MI0000804	mmu-miR-328	MI0000603	rno-miR-328	MI0000602	CUGGCCCUCUCUGCCCUUCCGU	hsa_miR_328
PS20253	hsa_miR_33	hsa-miR-33	MI0000091	mmu-miR-33	MI0000707	rno-miR-33	MI0000874	GUGCAUUGUAGUUGCAUUG	hsa_miR_33
PS20254	hsa_miR_330	hsa-miR-330	MI0000803					GCAAAGCACACGGCCUGCAGAGA	hsa_miR_330
PS20255	hsa_miR_331	hsa-miR-331	MI0000812	mmu-miR-331	MI0000609	rno-miR-331	MI0000608	GCCCCUGGGCCUAUCCUAGAA	hsa_miR_331
PS20256	hsa_miR_335	hsa-miR-335	MI0000816	mmu-miR-335	MI0000817	rno-miR-335	MI0000612	UCAAGAGCAAUAACGAAAAAUGU	hsa_miR_335
PS20257	hsa_miR_337	hsa-miR-337	MI0000806					UCCAGCUCCUAUAUGAUGCCUUU	hsa_miR_337
PS20258	hsa_miR_338	hsa-miR-338	MI0000814	mmu-miR-338	MI0000619	rno-miR-338	MI0000618	UCCAGCAUCAGUGAUUUUGUUGA	hsa_miR_338
PS20259	hsa_miR_339	hsa-miR-339	MI0000815	mmu-miR-339	MI0000621	rno-miR-339	MI0000620	UCCCUGUCCUCCAGGAGCUCA	hsa_miR_339
PS20260	hsa_miR_340	hsa-miR-340	MI0000802	mmu-miR-340	MI0000623	rno-miR-340	MI0000622	UCCGUCUCAGUUACUUUAUAGCC	hsa_miR_340
PS20261	hsa_miR_342	hsa-miR-342	MI0000805	mmu-miR-342	MI0000627	rno-miR-342	MI0000626	UCUCACACAGAAAUCGCACCCGUC	hsa_miR_342
PS20262	hsa_miR_345	hsa-miR-345	MI0000825					UGCUGACUCCUAGUCCAGGGC	hsa_miR_345
PS20263	hsa_miR_346	hsa-miR-346	MI0000826					UGUCUGCCCGCAUGCCUGCCUCU	hsa_miR_346
PS20264	hsa_miR_34a	hsa-miR-34a	MI0000268	mmu-miR-34a	MI0000584	rno-miR-34a	MI0000877	UGGCAGUGUCUUAGCUGGUUGUU	hsa_miR_34a
PS20265	hsa_miR_34b	hsa-miR-34b	MI0000742					UAGGCAGUGUCAUUAGCUGAUUG	hsa_miR_34b
PS20266	hsa_miR_34c	hsa-miR-34c	MI0000743	mmu-miR-34c	MI0000403	rno-miR-34c	MI0000876	AGGCAGUGUAGUUAGCUGAUUGC	hsa_miR_34c
PS20267	hsa_miR_361	hsa-miR-361	MI0000760	mmu-miR-361	MI0000761			UUAUCAGAAUCUCCAGGGGUAC	hsa_miR_361
PS20268	hsa_miR_365	hsa-miR-365	MI0000767,MI0000769	mmu-miR-365	MI0000768,MI0001645	rno-miR-365	MI0001656	UAAUGCCCCUAAAAAUCCUUAU	hsa_miR_365
PS20269	hsa_miR_367	hsa-miR-367	MI0000775					AAUUGCACUUUAGCAAUGGUGA	hsa_miR_367
PS20270	hsa_miR_368	hsa-miR-368	MI0000776					ACAUAGAGGAAAUUCCACGUUU	hsa_miR_368
PS20271	hsa_miR_369_3p	hsa-miR-369-3p	MI0000777					AAUAAUACAUGGUUGAUCUUU	hsa_miR_369_3p
PS20272	hsa_miR_370	hsa-miR-370	MI0000778					GCCUGCUGGGGUGGAACCUGG	hsa_miR_370
PS20273	hsa_miR_371	hsa-miR-371	MI0000779					GUGCCGCCAUCUUUUGAGUGU	hsa_miR_371
PS20274	hsa_miR_372	hsa-miR-372	MI0000780					AAAGUGCUGCGACAUUUGAGCGU	hsa_miR_372
PS20275	hsa_miR_373	hsa-miR-373	MI0000781					GAAGUGCUUCGAUUUUGGGGUGU	hsa_miR_373
PS20276	hsa_miR_373_AS	hsa-miR-373*	MI0000781					ACUCAAAAUGGGGGCGCUUUCC	hsa_miR_373_AS
PS20277	hsa_miR_374	hsa-miR-374	MI0000782					UUAUAAUACAACCUGAUAAGUG	hsa_miR_374
PS20278	hsa_miR_375	hsa-miR-375	MI0000783	mmu-miR-375	MI0000792			UUUGUUCGUUCGGCUCGCGUGA	hsa_miR_375
PS20279	hsa_miR_376a	hsa-miR-376a	MI0000784					AUCAUAGAGGAAAAUCCACGU	hsa_miR_376a
PS20280	hsa_miR_377	hsa-miR-377	MI0000785	mmu-miR-377	MI0000794			AUCACACAAAGGCAACUUUUGU	hsa_miR_377
PS20281	hsa_miR_378	hsa-miR-378	MI0000786	mmu-miR-378	MI0000795			CUCCUGACUCCAGGUCCUGUGU	hsa_miR_378
PS20282	hsa_miR_379	hsa-miR-379	MI0000787					UGGUAGACUAUGGAACGUA	hsa_miR_379
PS20283	hsa_miR_380_3p	hsa-miR-380-3p	MI0000788					UAUGUAAUAUGGUCCACAUCUU	hsa_miR_380_3p
PS20284	hsa_miR_380_5p	hsa-miR-380-5p	MI0000788	mmu-miR-380-5p	MI0000797			UGGUUGACCAUAGAACAUGCGC	hsa_miR_380_5p
PS20285	hsa_miR_381	hsa-miR-381	MI0000789	mmu-miR-381	MI0000798			UAUACAAGGGCAAGCUCUCUGU	hsa_miR_381
PS20286	hsa_miR_382	hsa-miR-382	MI0000790	mmu-miR-382	MI0000799			GAAGUUGUUCGUGGUGGAUUCG	hsa_miR_382
PS20287	hsa_miR_383	hsa-miR-383	MI0000791					AGAUCAGAAGGUGAUUGUGGCU	hsa_miR_383
PS20288	hsa_miR_384	hsa-miR-384	MI0001145					AUUCCUAGAAAUUGUUCAUA	hsa_miR_384
PS20289	hsa_miR_422a	hsa-miR-422a	MI0001444					CUGGACUUAGGGUCAGAAGGCC	hsa_miR_422a
PS20290	hsa_miR_422b	hsa-miR-422b	MI0000786					CUGGACUUGGAGUCAGAAGGCC	hsa_miR_422b
PS20291	hsa_miR_423	hsa-miR-423	MI0001445					AGCUCGGUCUGAGGCCCCUCAG	hsa_miR_423
PS20292	hsa_miR_424	hsa-miR-424	MI0001446					CAGCAGCAAUUCAUGUUUUGAA	hsa_miR_424
PS20293	hsa_miR_425	hsa-miR-425	MI0001448	mmu-miR-425	MI0001447			AUCGGGAAUGUCGUGUCCGCC	hsa_miR_425
PS20294	hsa_miR_429	hsa-miR-429	MI0001641					UAAUACUGUCUGGUAAAACCGU	hsa_miR_429
PS20295	hsa_miR_448	hsa-miR-448	MI0001637	mmu-miR-448	MI0001638	rno-miR-448	MI0001639	UUGCAUAUGUAGGAUGUCCCAU	hsa_miR_448
PS20296	hsa_miR_449	hsa-miR-449	MI0001648	mmu-miR-449	MI0001649	rno-miR-449	MI0001650	UGGCAGUGUAUUGUUAGCUGGU	hsa_miR_449
PS20297	hsa_miR_450	hsa-miR-450	MI0001652,MI0003187	mmu-miR-450	MI0001653			UUUUUGCGAUGUGUUCCUAAUA	hsa_miR_450
PS20298	hsa_miR_7	hsa-miR-7	MI0000263,MI0000264,MI0000265	mmu-miR-7	MI0000728,MI0000729			UGGAAGACUAGUGAUUUUGUUG	hsa_miR_7
PS20299	hsa_miR_9	hsa-miR-9	MI0000466,MI0000467,MI0000468			rno-miR-9	MI0000838,MI0000840,MI0000839	UCUUUGGUUAUCUAGCUGUAUGA	hsa_miR_9
PS20300	hsa_miR_9_AS	hsa-miR-9*	MI0000466,MI0000467,MI0000468	mmu-miR-9*	MI0000720,MI0000157,MI0000721			UAAAGCUAGAUAACCGAAAGU	hsa_miR_9_AS
PS20301	hsa_miR_92	hsa-miR-92	MI0000093,MI0000094	mmu-miR-92	MI0000719,MI0000580	rno-miR-92	MI0000878,MI0000879	UAUUGCACUUGUCCCGGCCUG	hsa_miR_92
PS20302	hsa_miR_93	hsa-miR-93	MI0000095					AAAGUGCUGUUCGUGCAGGUAG	hsa_miR_93
PS20303	hsa_miR_95	hsa-miR-95	MI0000097					UUCAACGGGUAUUUAUUGAGCA	hsa_miR_95
PS20304	hsa_miR_96	hsa-miR-96	MI0000098					UUUGGCACUAGCACAUUUUUGC	hsa_miR_96
PS20305	hsa_miR_98	hsa-miR-98	MI0000100	mmu-miR-98	MI0000586	rno-miR-98	MI0000882	UGAGGUAGUAAGUUGUAUUGUU	hsa_miR_98
PS20306	hsa_miR_99a	hsa-miR-99a	MI0000101			rno-miR-99a	MI0000883	AACCCGUAGAUCCGAUCUUGUG	hsa_miR_99a
PS20307	hsa_miR_99b	hsa-miR-99b	MI0000746	mmu-miR-99b	MI0000147	rno-miR-99b	MI0000884	CACCCGUAGAACCGACCUUGCG	hsa_miR_99b
PS20308	mmu_let_7d_AS			mmu-let-7d*	MI0000405	rno-let-7d*	MI0000601	CUAUACGACCUGCUGCCUUUCU	mmu_let_7d_AS
PS20309	mmu_miR_101b			mmu-miR-101b	MI0000649	rno-miR-101b	MI0000648	UACAGUACUGUGAUAGCUGAAG	mmu_miR_101b
PS20310	mmu_miR_106a			mmu-miR-106a	MI0000406			CAAAGUGCUAACAGUGCAGGUA	mmu_miR_106a
PS20311	mmu_miR_129_3p			mmu-miR-129-3p	MI0000585	rno-miR-129*	MI0000637	AAGCCCUUACCCCAAAAAGCAU	mmu_miR_129_3p
PS20312	mmu_miR_140_AS			mmu-miR-140*	MI0000165			UACCACAGGGUAGAACCACGGA	mmu_miR_140_AS
PS20313	mmu_miR_151			mmu-miR-151	MI0000173			CUAGACUGAGGCUCCUUGAGG	mmu_miR_151
PS20314	mmu_miR_155			mmu-miR-155	MI0000177			UUAAUGCUAAUUGUGAUAGGGG	mmu_miR_155
PS20315	mmu_miR_17_3p			mmu-miR-17-3p	MI0000687			ACUGCAGUGAGGGCACUUGUA	mmu_miR_17_3p
PS20316	mmu_miR_192			mmu-miR-192	MI0000551			CUGACCUAUGAAUUGACA	mmu_miR_192
PS20317	mmu_miR_199b			mmu-miR-199b	MI0000714			CCCAGUGUUUAGACUACCUGUUC	mmu_miR_199b
PS20318	mmu_miR_201			mmu-miR-201	MI0000244			UACUCAGUAAGGCAUUGUUCU	mmu_miR_201
PS20319	mmu_miR_202			mmu-miR-202	MI0000245			AGAGGUAUAGCGCAUGGGAAGA	mmu_miR_202
PS20320	mmu_miR_207			mmu-miR-207	MI0000250			GCUUCUCCUGGCUCUCCUCCCUC	mmu_miR_207
PS20321	mmu_miR_211			mmu-miR-211	MI0000708	rno-miR-211	MI0000951	UUCCCUUUGUCAUCCUUUGCCU	mmu_miR_211
PS20322	mmu_miR_215			mmu-miR-215	MI0000974			AUGACCUAUGAUUUGACAGAC	mmu_miR_215
PS20323	mmu_miR_217			mmu-miR-217	MI0000731	rno-miR-217	MI0000956	UACUGCAUCAGGAACUGACUGGAU	mmu_miR_217
PS20324	mmu_miR_290			mmu-miR-290	MI0000388	rno-miR-290	MI0000964	CUCAAACUAUGGGGGCACUUUUU	mmu_miR_290
PS20325	mmu_miR_291_3p			mmu-miR-291-3p	MI0000389	rno-miR-291-3p	MI0000965	AAAGUGCUUCCACUUUGUGUGCC	mmu_miR_291_3p
PS20326	mmu_miR_291_5p			mmu-miR-291-5p	MI0000389	rno-miR-291-5p	MI0000965	CAUCAAAGUGGAGGCCCUCUCU	mmu_miR_291_5p
PS20327	mmu_miR_292_3p			mmu-miR-292-3p	MI0000390	rno-miR-292-3p	MI0000966	AAGUGCCGCCAGGUUUUGAGUGU	mmu_miR_292_3p
PS20328	mmu_miR_292_5p			mmu-miR-292-5p	MI0000390	rno-miR-292-5p	MI0000966	ACUCAAACUGGGGGCUCUUUUG	mmu_miR_292_5p
PS20329	mmu_miR_293			mmu-miR-293	MI0000391			AGUGCCGCAGAGUUUGUAGUGU	mmu_miR_293
PS20330	mmu_miR_294			mmu-miR-294	MI0000392			AAAGUGCUUCCCUUUUGUGUGU	mmu_miR_294
PS20331	mmu_miR_295			mmu-miR-295	MI0000393			AAAGUGCUACUACUUUUGAGUCU	mmu_miR_295
PS20332	mmu_miR_297			mmu-miR-297	MI0000395,MI0000397			AUGUAUGUGUGCAUGUGCAUG	mmu_miR_297
PS20333	mmu_miR_298			mmu-miR-298	MI0000398	rno-miR-298	MI0000969	GGCAGAGGAGGGCUGUUCUUCC	mmu_miR_298
PS20334	mmu_miR_300			mmu-miR-300	MI0000400	rno-miR-300	MI0000971	UAUGCAAGGGCAAGCUCUCUUC	mmu_miR_300
PS20335	mmu_miR_322			mmu-miR-322	MI0000590	rno-miR-322	MI0000589	AAACAUGAAGCGCUGCAACA	mmu_miR_322
PS20336	mmu_miR_424			mmu-miR-424	MI0000590	rno-miR-424	MI0000589	CAGCAGCAAUUCAUGUUUUGGA	mmu_miR_424
PS20337	mmu_miR_325			mmu-miR-325	MI0000597	rno-miR-325	MI0000596	CCUAGUAGGUGCUCAGUAAGUGU	mmu_miR_325
PS20338	mmu_miR_329			mmu-miR-329	MI0000605	rno-miR-329	MI0000604	AACACACCCAGCUAACCUUUUU	mmu_miR_329
PS20339	mmu_miR_330			mmu-miR-330	MI0000607	rno-miR-330	MI0000606	GCAAAGCACAGGGCCUGCAGAGA	mmu_miR_330
PS20340	mmu_miR_337			mmu-miR-337	MI0000615	rno-miR-337	MI0000614	UUCAGCUCCUAUAUGAUGCCUUU	mmu_miR_337
PS20341	mmu_miR_341			mmu-miR-341	MI0000625	rno-miR-341	MI0000624	UCGAUCGGUCGGUCGGUCAGU	mmu_miR_341
PS20342	mmu_miR_344			mmu-miR-344	MI0000630			UGAUCUAGCCAAAGCCUGACUGU	mmu_miR_344
PS20343	mmu_miR_345			mmu-miR-345	MI0000632	rno-miR-345	MI0000631	UGCUGACCCCUAGUCCAGUGC	mmu_miR_345
PS20344	mmu_miR_346			mmu-miR-346	MI0000634			UGUCUGCCCGAGUGCCUGCCUCU	mmu_miR_346
PS20345	mmu_miR_34b			mmu-miR-34b	MI0000404	rno-miR-34b	MI0000875	UAGGCAGUGUAAUUAGCUGAUUG	mmu_miR_34b
PS20346	mmu_miR_350			mmu-miR-350	MI0000640			UUCACAAAGCCCAUACACUUUCA	mmu_miR_350
PS20347	mmu_miR_351			mmu-miR-351	MI0000643	rno-miR-351	MI0000642	UCCCUGAGGAGCCCUUUGAGCCUG	mmu_miR_351
PS20348	mmu_miR_376a			mmu-miR-376a	MI0000793			AUCGUAGAGGAAAAUCCACGU	mmu_miR_376a
PS20349	mmu_miR_376b			mmu-miR-376b	MI0001162			AUCAUAGAGGAACAUCCACUUU	mmu_miR_376b
PS20350	mmu_miR_380_3p			mmu-miR-380-3p	MI0000797			UAUGUAGUAUGGUCCACAUCUU	mmu_miR_380_3p
PS20351	mmu_miR_383			mmu-miR-383	MI0000800			AGAUCAGAAGGUGACUGUGGCU	mmu_miR_383
PS20352	mmu_miR_384			mmu-miR-384	MI0001146			AUUCCUAGAAAUUGUUCACA	mmu_miR_384
PS20353	mmu_miR_409			mmu-miR-409	MI0001160			GAAUGUUGCUCGGUGAACCCCUU	mmu_miR_409
PS20354	hsa_miR_410	hsa-miR-410	MI0002465	mmu-miR-410	MI0001161			AAUAUAACACAGAUGGCCUGUU	hsa_miR_410
PS20355	mmu_miR_411			mmu-miR-411	MI0001163			AACACGGUCCACUAACCCUCAGU	mmu_miR_411
PS20356	hsa_miR_412	hsa-miR-412	MI0002464	mmu-miR-412	MI0001164			ACUUCACCUGGUCCACUAGCCGU	hsa_miR_412
PS20357	mmu_miR_429			mmu-miR-429	MI0001642	rno-miR-429	MI0001643	UAAUACUGUCUGGUAAUGCCGU	mmu_miR_429
PS20358	mmu_miR_7b			mmu-miR-7b	MI0000730	rno-miR-7b	MI0000837	UGGAAGACUUGUGAUUUUGUU	mmu_miR_7b
PS20359	rno_miR_151_AS					rno-miR-151*	MI0000647	UCGAGGAGCUCACAGUCUAGUA	rno_miR_151_AS
PS20360	rno_miR_20_AS					rno-miR-20*	MI0000638	ACUGCAUUACGAGCACUUACA	rno_miR_20_AS
PS20361	rno_miR_297					rno-miR-297	MI0000968	AUGUAUGUGUGCAUGUAUGCAUG	rno_miR_297
PS20362	rno_miR_327					rno-miR-327	MI0000600	CCUUGAGGGGCAUGAGGGU	rno_miR_327
PS20363	rno_miR_333					rno-miR-333	MI0000610	GUGGUGUGCUAGUUACUUUU	rno_miR_333
PS20364	rno_miR_336					rno-miR-336	MI0000613	UCACCCUUCCAUAUCUAGUCU	rno_miR_336
PS20365	rno_miR_343					rno-miR-343	MI0000628	UCUCCCUCCGUGUGCCCAGA	rno_miR_343
PS20366	rno_miR_344					rno-miR-344	MI0000629	UGAUCUAGCCAAAGCCUGACCGU	rno_miR_344
PS20367	rno_miR_346					rno-miR-346	MI0000633	UGUCUGCCUGAGUGCCUGCCUCU	rno_miR_346
PS20368	rno_miR_347					rno-miR-347	MI0000635	UGUCCCUCUGGGUCGCCCA	rno_miR_347
PS20369	rno_miR_349					rno-miR-349	MI0000636	CAGCCCUGCUGUCUUAACCUCU	rno_miR_349
PS20370	rno_miR_352					rno-miR-352	MI0000644	AGAGUAGUAGGUUGCAUAGUA	rno_miR_352
PS20371	rno_miR_421					rno-miR-421	MI0001423	GGCCUCAUUAAAUGUUUGUUG	rno_miR_421
PS20372	rno_miR_7_AS					rno-miR-7*	MI0000641	CAACAAAUCACAGUCUGCCAUA	rno_miR_7_AS
PS20373	hsa_miR_522	hsa-miR-522	MI0003177					AAAAUGGUUCCCUUUAGAGUGUU	hsa_miR_522
PS20374	hsa_miR_519b	hsa-miR-519b	MI0003151					AAAGUGCAUCCUUUUAGAGGUUU	hsa_miR_519b
PS20375	hsa_miR_520c	hsa-miR-520c	MI0003158					AAAGUGCUUCCUUUUAGAGGGUU	hsa_miR_520c
PS20376	hsa_miR_519e	hsa-miR-519e	MI0003145					AAAGUGCCUCCUUUUAGAGUGU	hsa_miR_519e
PS20377	hsa_miR_519d	hsa-miR-519d	MI0003162					CAAAGUGCCUCCCUUUAGAGUGU	hsa_miR_519d
PS20378	hsa_miR_520b	hsa-miR-520b	MI0003155					AAAGUGCUUCCUUUUAGAGGG	hsa_miR_520b
PS20379	hsa_miR_519c	hsa-miR-519c	MI0003148					AAAGUGCAUCUUUUUAGAGGAU	hsa_miR_519c
PS20380	hsa_miR_526b_AS	hsa-miR-526b*	MI0003150					AAAGUGCUUCCUUUUAGAGGC	hsa_miR_526b_AS
PS20381	hsa_miR_520e	hsa-miR-520e	MI0003143					AAAGUGCUUCCUUUUUGAGGG	hsa_miR_520e
PS20382	hsa_miR_520a	hsa-miR-520a	MI0003149					AAAGUGCUUCCCUUUGGACUGU	hsa_miR_520a
PS20383	hsa_miR_520d	hsa-miR-520d	MI0003164					AAAGUGCUUCUCUUUGGUGGGUU	hsa_miR_520d
PS20384	hsa_miR_520h	hsa-miR-520h	MI0003175					ACAAAGUGCUUCCCUUUAGAGU	hsa_miR_520h
PS20385	hsa_miR_517a	hsa-miR-517a	MI0003161					AUCGUGCAUCCCUUUAGAGUGUU	hsa_miR_517a
PS20386	hsa_miR_518e	hsa-miR-518e	MI0003169					AAAGCGCUUCCCUUCAGAGUGU	hsa_miR_518e
PS20387	hsa_miR_521	hsa-miR-521	MI0003176,MI0003163					AACGCACUUCCCUUUAGAGUGU	hsa_miR_521
PS20388	hsa_miR_523	hsa-miR-523	MI0003153					AACGCGCUUCCCUAUAGAGGG	hsa_miR_523
PS20389	hsa_miR_518f	hsa-miR-518f	MI0003154					AAAGCGCUUCUCUUUAGAGGA	hsa_miR_518f
PS20390	hsa_miR_518c	hsa-miR-518c	MI0003159					CAAAGCGCUUCUCUUUAGAGUG	hsa_miR_518c
PS20391	hsa_miR_518b	hsa-miR-518b	MI0003156					CAAAGCGCUCCCCUUUAGAGGU	hsa_miR_518b
PS20392	hsa_miR_518d	hsa-miR-518d	MI0003171					CAAAGCGCUUCCCUUUGGAGC	hsa_miR_518d
PS20393	hsa_miR_525_AS	hsa-miR-525*	MI0003152					GAAGGCGCUUCCCUUUAGAGC	hsa_miR_525_AS
PS20394	hsa_miR_524	hsa-miR-524	MI0003160					GAAGGCGCUUCCCUUUGGAGU	hsa_miR_524
PS20395	hsa_miR_518a	hsa-miR-518a	MI0003170,MI0003173					AAAGCGCUUCCCUUUGCUGGA	hsa_miR_518a
PS20396	hsa_miR_515_3p	hsa-miR-515-3p	MI0003144,MI0003147					GAGUGCCUUCUUUUGGAGCGU	hsa_miR_515_3p
PS20397	hsa_miR_516_3p	hsa-miR-516-3p	MI0003180,MI0003181,MI0003167,MI0003172					UGCUUCCUUUCAGAGGGU	hsa_miR_516_3p
PS20398	ambi_miR_7026								ambi_miR_7026
PS20399	ambi_miR_7027								ambi_miR_7027
PS20400	hsa_miR_512_3p	hsa-miR-512-3p	MI0003140,MI0003141					AAGUGCUGUCAUAGCUGAGGUC	hsa_miR_512_3p
PS20401	ambi_miR_7029								ambi_miR_7029
PS20402	hsa_miR_491	hsa-miR-491	MI0003126					AGUGGGGAACCCUUCCAUGAGGA	hsa_miR_491
PS20403	hsa_miR_506	hsa-miR-506	MI0003193					UAAGGCACCCUUCUGAGUAGA	hsa_miR_506
PS20404	hsa_miR_514	hsa-miR-514	MI0003198,MI0003199,MI0003200					AUUGACACUUCUGUGAGUAG	hsa_miR_514
PS20405	hsa_miR_509	hsa-miR-509	MI0003196					UGAUUGGUACGUCUGUGGGUAGA	hsa_miR_509
PS20406	hsa_miR_508	hsa-miR-508	MI0003195					UGAUUGUAGCCUUUUGGAGUAGA	hsa_miR_508
PS20407	hsa_miR_507	hsa-miR-507	MI0003194					UUUUGCACCUUUUGGAGUGAA	hsa_miR_507
PS20408	ambi_miR_7036								ambi_miR_7036
PS20409	hsa_miR_193b	hsa-miR-193b	MI0003137					AACUGGCCCUCAAAGUCCCGCUUU	hsa_miR_193b
PS20410	ambi_miR_7038_1								ambi_miR_7038_1
PS20411	ambi_miR_7039								ambi_miR_7039
PS20412	hsa_miR_488	hsa-miR-488	MI0003123					CCCAGAUAAUGGCACUCUCAA	hsa_miR_488
PS20413	hsa_miR_510	hsa-miR-510	MI0003197					UACUCAGGAGAGUGGCAAUCACA	hsa_miR_510
PS20414	hsa_miR_517_AS	hsa-miR-517*	MI0003161,MI0003165,MI0003174					CCUCUAGAUGGAAGCACUGUCU	hsa_miR_517_AS
PS20415	hsa_miR_518f_AS	hsa-miR-518f*	MI0003154					CUCUAGAGGGAAGCACUUUCUCU	hsa_miR_518f_AS
PS20416	hsa_miR_518c_AS	hsa-miR-518c*	MI0003159					UCUCUGGAGGGAAGCACUUUCUG	hsa_miR_518c_AS
PS20417	hsa_miR_526c	hsa-miR-526c	MI0003169,MI0003178,MI0003151,MI0003148,MI0003177,MI0003153					CUCUAGAGGGAAGCGCUUUCUGUU	hsa_miR_526c
PS20418	hsa_miR_526b	hsa-miR-526b	MI0003150					CUCUUGAGGGAAGCACUUUCUGUU	hsa_miR_526b
PS20419	hsa_miR_520a_AS	hsa-miR-520a*	MI0003149					CUCCAGAGGGAAGUACUUUCU	hsa_miR_520a_AS
PS20420	hsa_miR_525	hsa-miR-525	MI0003152					CUCCAGAGGGAUGCACUUUCU	hsa_miR_525
PS20421	hsa_miR_524_AS	hsa-miR-524*	MI0003160					CUACAAAGGGAAGCACUUUCUC	hsa_miR_524_AS
PS20422	hsa_miR_520d_AS	hsa-miR-520d*	MI0003164					UCUACAAAGGGAAGCCCUUUCUG	hsa_miR_520d_AS
PS20423	hsa_miR_527	hsa-miR-527	MI0003170,MI0003179					CUGCAAAGGGAAGCCCUUUCU	hsa_miR_527
PS20424	hsa_miR_515_5p	hsa-miR-515-5p	MI0003144,MI0003147					UUCUCCAAAAGAAAGCACUUUCUG	hsa_miR_515_5p
PS20425	hsa_miR_519e_AS	hsa-miR-519e*	MI0003145					UUCUCCAAAAGGGAGCACUUUC	hsa_miR_519e_AS
PS20426	ambi_miR_7054								ambi_miR_7054
PS20427	ambi_miR_7055								ambi_miR_7055
PS20428	hsa_miR_498	hsa-miR-498	MI0003142					UUUCAAGCCAGGGGGCGUUUUUC	hsa_miR_498
PS20429	hsa_miR_513	hsa-miR-513	MI0003191,MI0003192					UUCACAGGGAGGUGUCAUUUAU	hsa_miR_513
PS20430	ambi_miR_7058								ambi_miR_7058
PS20431	ambi_miR_7059_1								ambi_miR_7059_1
PS20432	hsa_miR_452	hsa-miR-452	MI0001733	mmu-miR-452	MI0001734			UGUUUGCAGAGGAAACUGAGAC	hsa_miR_452
PS20433	hsa_miR_493	hsa-miR-493	MI0003132					UUGUACAUGGUAGGCUUUCAUU	hsa_miR_493
PS20434	ambi_miR_7062								ambi_miR_7062
PS20435	hsa_miR_432	hsa-miR-432	MI0003133					UCUUGGAGUAGGUCAUUGGGUGG	hsa_miR_432
PS20436	hsa_miR_495	hsa-miR-495	MI0003135					AAACAAACAUGGUGCACUUCUUU	hsa_miR_495
PS20437	hsa_miR_494	hsa-miR-494	MI0003134					UGAAACAUACACGGGAAACCUCUU	hsa_miR_494
PS20438	ambi_miR_7066								ambi_miR_7066
PS20439	ambi_miR_7067								ambi_miR_7067
PS20440	ambi_miR_7068_1								ambi_miR_7068_1
PS20441	hsa_miR_496	hsa-miR-496	MI0003136					AUUACAUGGCCAAUCUC	hsa_miR_496
PS20442	ambi_miR_7070								ambi_miR_7070
PS20443	hsa_miR_492	hsa-miR-492	MI0003131					AGGACCUGCGGGACAAGAUUCUU	hsa_miR_492
PS20444	hsa_miR_490	hsa-miR-490	MI0003125					CAACCUGGAGGACUCCAUGCUG	hsa_miR_490
PS20445	hsa_miR_497	hsa-miR-497	MI0003138					CAGCAGCACACUGUGGUUUGU	hsa_miR_497
PS20446	ambi_miR_7074								ambi_miR_7074
PS20447	ambi_miR_7075								ambi_miR_7075
PS20448	ambi_miR_7076								ambi_miR_7076
PS20449	hsa_miR_501	hsa-miR-501	MI0003185					AAUCCUUUGUCCCUGGGUGAGA	hsa_miR_501
PS20450	hsa_miR_502	hsa-miR-502	MI0003186					AUCCUUGCUAUCUGGGUGCUA	hsa_miR_502
PS20451	ambi_miR_7079								ambi_miR_7079
PS20452	ambi_miR_7080								ambi_miR_7080
PS20453	ambi_miR_7081								ambi_miR_7081
PS20454	hsa_miR_202_AS	hsa-miR-202*	MI0003130					UUUCCUAUGCAUAUACUUCUUU	hsa_miR_202_AS
PS20455	ambi_miR_7083								ambi_miR_7083
PS20456	ambi_miR_7084								ambi_miR_7084
PS20457	ambi_miR_7085								ambi_miR_7085
PS20458	ambi_miR_7086								ambi_miR_7086
PS20459	hsa_miR_512_5p	hsa-miR-512-5p	MI0003140,MI0003141					CACUCAGCCUUGAGGGCACUUUC	hsa_miR_512_5p
PS20460	hsa_miR_504	hsa-miR-504	MI0003189					AGACCCUGGUCUGCACUCUAU	hsa_miR_504
PS20461	ambi_miR_7089								ambi_miR_7089
PS20462	hsa_miR_511	hsa-miR-511	MI0003127,MI0003128					GUGUCUUUUGCUCUGCAGUCA	hsa_miR_511
PS20463	hsa_miR_452_AS	hsa-miR-452*	MI0001733					UCAGUCUCAUCUGCAAAGAAG	hsa_miR_452_AS
PS20464	hsa_miR_503	hsa-miR-503	MI0003188					UAGCAGCGGGAACAGUUCUGCAG	hsa_miR_503
PS20465	hsa_miR_485_5p	hsa-miR-485-5p	MI0002469					AGAGGCUGGCCGUGAUGAAUUC	hsa_miR_485_5p
PS20466	hsa_miR_499	hsa-miR-499	MI0003183					UUAAGACUUGCAGUGAUGUUUAA	hsa_miR_499
PS20467	ambi_miR_7095								ambi_miR_7095
PS20468	hsa_miR_505	hsa-miR-505	MI0003190					GUCAACACUUGCUGGUUUCCUC	hsa_miR_505
PS20469	ambi_miR_7097								ambi_miR_7097
PS20470	ambi_miR_7098								ambi_miR_7098
PS20471	hsa_miR_489	hsa-miR-489	MI0003124					AGUGACAUCACAUAUACGGCAGC	hsa_miR_489
PS20472	ambi_miR_7100								ambi_miR_7100
PS20473	ambi_miR_7101								ambi_miR_7101
PS20474	hsa_miR_432_AS	hsa-miR-432*	MI0003133					CUGGAUGGCUCCUCCAUGUCU	hsa_miR_432_AS
PS20475	ambi_miR_7103								ambi_miR_7103
PS20476	hsa_miR_500	hsa-miR-500	MI0003184					AUGCACCUGGGCAAGGAUUCUG	hsa_miR_500
PS20477	ambi_miR_7105								ambi_miR_7105