#TAG = RST sequences (5'->3')
#COUNT = Frequency of each RST
#RST_ID = ID of ribosomal sequence tags (RSTs)
TAG	COUNT	RST_ID
AACGAGGCGACCTTAAGACGACTCAGTGCTTGCACAAAGTTGGAAGAAGATCATCGCCTAGTGGCAGACGGGT	1	SR-ad-1
GAGCGGGAGTATTGCAACCAGAGATTCGTCAAAGTGAGKGATATGAGAGCGGCGGACGGGT	1	SR-ad-2
CGAACGGGGTTATTTAGAAGCTTGCTTRTGGATAACTTAGTGGCGGACGGGT	2	SR-ad-3
CGAGGGGCAGCATGAGATTAGCTTGCTAATCTTGATGGCGACCGGCGCACGGGT	10	SR-ad-4
CGAACGGGGTTTAAGAAGGAAGCTTGCTTTCATTTTAAGCCTAGTGGGTGAC	1	SR-ad-5
TTGACCGTGCAGCCTAATGCATGCAAGT	12	SR-ad-6
CGAACGGACATGGCACCGGAGCAGAAGAGTTCGCTTGGACGCTCCCCGTCATGTTAGTGGCGGACGGGT	1	SR-ad-7
GCGTAACACGTGGACTGCACGGTCAA	18	SR-ad-8
CGAACGGACTTTACATGAAGCCTAGCGATTGTAAAGTTAGTGGCGGACGGGT	14	SR-ad-9
CGAACGGGGTTTAAGAAGGAAGCTTGCTTTCATTTTAAACTTAGTGGCGGACGGGT	240	SR-ad-10
CGAACGAAGCACATTCCTTCGGGGATGTGACTGAGTGGCGGAC	2	SR-ad-11
CGAGGGGCAGCATGAAGTTTGCTTGCAAACTTTGATGGCGACCGGCGCACGGGT	201	SR-ad-12
CGAGCGGGAATCTGTTGATTGAGACTTCGGTGGATTGATGCAGAGGATAGCGGCGGACGGGT	2	SR-ad-13
CGAACGGGGTTTAAGAAGGAAGCTTMCTTTCATTTTAAACYTAGMGGCGGACGGGT	1	SR-ad-14
CGAGGGGCAGCGCTGAGTAGCAATACTCTGACGGCGACCGGCGCACG	1	SR-ad-15
CGAGCGGGAGTATCGCAAACAGAGATTCGTCAAAGTGAGCGATATGAGAGCGGCGGACGGGT	4	SR-ad-16
CGAACGTGAAAGTGCCTTCGGGTGCGAGTAAAGTGGCGCACGGGT	1	SR-ad-17
GGAAGAGGGGCATCATGGAGTTTGCTTGCAAACTCTGATGGCGACCGGCGCACGGGT	6	SR-ad-18
CGAACGGAATTATGGGGCTTGCTCCATAATTTAGCGGCGCACGG	1	SR-ad-19
CGAACGGGGTTTAAGAAGGAAGCTTGCTTTTGTTTATACTTAGTGGCGGACGG	1	SR-ad-20
GCGTAACGCGTGAACTGCACGGTACCGTGCAACTTAATGCATGCAAGT	1	SR-ad-21
CGAGGGGCAGCATGAAGTTTGCTTGCAAACTTTGATGGKGACCGGCGCACGGGT	1	SR-ad-22
CGAGGGGCAGCATGGGAGTTGCTTGCAATTCCTGATGGCGACCGGCGCACGGGT	1	SR-ad-23
CGAGGGGCAGCATGAAGATGTGCTTGCACAACTTTGATGGCGACCGGCGCACGGGT	6	SR-ad-24
CGAACGAAGCACTTAATTACGATCCCTTCGGGGTGACGATTTTGTGACTTAGTGGCGGACGGGT	3	SR-ad-25
CGAGGGGCAGCATGATCAAAGCTTGCTTTGATTGATGGCGACCGGCGCACGGGT	14	SR-ad-26
GAACGAAGCACTTAAGATGATTTCTTCGGATTGAATTTTTTGTGACTTAGTGGCGGACGGGT	3	SR-ad-27
CGAACGAAGCGTCCCGCCCGAAGAGAAGGAGTGCTTGCACAAATTTAATTCAATTGGGACGACTTAGTGGCGGACGGGT	13	SR-ad-28
CGAACGGAGATACTGAGAGCTTGCTTTTGGTATCTTAGTGGCGGACGGGT	22	SR-ad-29
GAGCGGGAAATTGCGGAAATAAGCTTCGGCAGAAATAAGCGATGGATAGCGGCGGACGGGT	1	SR-ad-30
CGAACGGAGTATTGAGGATGAAGTTTTCGGATGGATTTTTCAATACTTAGTGGCGGACGGGT	3	SR-ad-31
CGAACGGAGTTTAAGAAGGAAGCTTGCTTTCATTTTAAACCTAGTAGGCGGAC	1	SR-ad-32
TTGACCGTGCAGCTTAATACATGCAAGT	4	SR-ad-33
CGAGGGGCAGCATGAAGTCAGCTTGCTGACTTTGATGGCGACCGGCGCACGGGT	5	SR-ad-34
CGAGGGGCAGCATGGGATTAGCTTGCTAATCCTGATGGCGACCGGCGCACGGGT	3	SR-ad-35
CGAACGAAGCAATTTTCTACGATCCCTTCGGGGTGACGGATTATTGACTGAGTGGCGGACGGGT	4	SR-ad-36
ACGGGGTTTAAGAAGGAAGCTTGCTCTCATTTTACACCTAGTGGCGGACGGGT	1	SR-ad-37
CGAGCGGCACACTTTCGGGTGTATAGCGGCAGACGGGT	1	SR-ad-38
CGAGCGGCACACTTTCGGGTGTTTKTCCGCAGACGGGT	1	SR-ad-39
CGAGGCGCGCGCATATCGAAAGCTTGCTTTGGTCGATGGCGACCGGCGCACGGGT	1	SR-ad-40
GCGTAACACGTGGGCTTTAACGCTTCCGAAGCTTCGGCAGAGGATTGTTAAAACCTAGTGGCGGACGGGT	1	SR-ad-41
CGAGGGGTAACGCGAGGTAGCAATACTTCGGCGACGACCGGCGCACGGGT	7	SR-ad-42
CGAGCGGGAGCTGTTCCGGCRCCGTGCTATCTGAGGGGAGAAGAGGAAGGATGGCAGGGT	1	SR-ad-43
GCTGGGAGAGCTTTAGCGGCGGACGGGT	1	SR-ad-44
CGAGCGGGGACATTGCGACAGAATTGAAGTTTTCGGATGGATAGGAAGATGTAATGTTCTAGCGGCGGACGGGT	11	SR-ad-45
CGAGCGGAGACATTTGGAAAGCTTGCTTTTTGGATGTTTCAGCGGCGGACGGGT	28	SR-ad-46
CGAACGGGGATTTTGTTTCGGCAGAATCCTAGTGGCGAACGGGT	19	SR-ad-47
CGAGGGGCATCATTATCGAAGCTTGCTTTGATAGATGGCGACCGGCGCACGGGT	12	SR-ad-48
CGAACGCGAAAGGGGCTTCGGCCCCGAGTAGAGTGGCGCACGG	3	SR-ad-49
CGAGGGGCAGCATAATCGAAGCTTGCTTTGATTGATGGCGACCGGCGCACGGGT	1	SR-ad-50
CGAACGGGGTTATTTAGAAGCTTGCTTTTGGATAACTTAGTGGCGGACGGGT	5	SR-ad-51
CGAGGGGCAGCATGTCGGTTGCTTGCAACCGATGATGGCGACCGGCGCACGGGT	6	SR-ad-52
CGAACGGGTGTAGCAATACATCAGTGGCGAACGGGT	4	SR-ad-53
CGAACGGGGATTTTGTTTCGGCAGAATCTCAGTGGCGCGC	1	SR-ad-54
CGAACGGAGTCAGAAAGCTTGCTTTTTGACTTAGTGGCGGACGGGT	1	SR-ad-55
CGAGCGAGAATCTCTTCAGAAGCGTTTTCGGACAATTCCGAGGAGAGGAAAGCGGCGGACGGGT	1	SR-ad-56
GCGTACGGGAACTAAGAAGGAAGCTTGCTTTCATTTTAAACCTAGTGGCGGAC	1	SR-ad-57
CGAACGGGCTTAGATCGGAAGCTTGCTTTTGATTTAAGTTAGTGGCGGACGGGT	25	SR-ad-58
CGAGGGGCAGCATGGAGTCAGCTTGCTGGCTCTGATGGCGACCGGCGCACGGGT	3	SR-ad-59
CGAACGAGGGTGCAGGAGAGCTTGCTCGAA	1	SR-ad-60
CGAACGGAGATACGCGGAATGCGGAKTTGTCCAAATGAAGCGTATACTTAGTGGCGGACGG	1	SR-ad-61
CGAGGGGCAGCATAACGAAAGCTTGCTTTTGTTGATGGCGACCGGCGCACGGGT	2	SR-ad-62
CGAGGGGCATCATTATCGAAGCTTGCTTTGATTGATGGCGACCGGCGCACGGGT	1	SR-ad-63
CGAACGGGGGTTTTGCTTCGGTAGAACCCTAGTGGCGAACGGGT	4	SR-ad-64
GAACGGAGTATATTTAAAAGCTTGCTTTTGTTTATACCTAGTGGCGGACGGGT	1	SR-ad-65
CGAGCGGAGACATGTTTCGGAGAGCTTCGGCAGGAAGAGATATGTTTTAGCGGCGGACGGGT	2	SR-ad-66
CGAGGGGCAGCAGGACGATAGCTTGCTATTGTTGCTGGCGACCGRCGCACGGGT	1	SR-ad-67
CGAACGGAGTTTAGATGAAACCTAGTGATTCTAAACTTAGTGGCGGACGGGT	9	SR-ad-68
CGAGGGGCAGCATGGTCTTAGCTTGCTAAGGCCGATGGCGACCGGCGCACGGGT	7	SR-ad-69
CGAACGGAGATACTGAGAGCTTGCTTTTGGTATCTTAGAGCGGACGG	2	SR-ad-70
CGAGGGGCAGCAGATCGAAAGCTTGCTTTTGATGCTGGCGACCGGCGCACGGGT	3	SR-ad-71
CGAACGAAGCACTGAGAAATGAAGCTTTCGGGTTGATTTTCTCTTTGACTTAGTGGCGGACGG	2	SR-ad-72
CGAACGGAGTATTAGAAATGAAGTTTTCGGATGGATTTTTTAATACTTAGTGGCGGACGGGT	1	SR-ad-73
CGAACGGGCGAAGGGAGCTTGCTCCCGGAGCTAGTGGCGAACGGGT	2	SR-ad-74
CGAACGAAGCACTTTTGGCGGATCCCTTCGGGGTGAAGCCGGTTGTGACTTAGTGGCGGACGG	1	SR-ad-75
CGAGCGGAACACTTTCGGGTGTTTAGCGGCAGACGGGT	12	SR-ad-76
CGAACGGAGATATGCGCTGATTGAAGCTTCGGCAGATTTCTTGCATATCTTAGTGGCGGACGGGT	3	SR-ad-77
CGAGGGGCAGCGAGAAGAAAGCTTGCTTTCTTTGTCGGCGACCGGCGCACGGGT	11	SR-ad-78
CGAGCGGTAAGTTGGAAGCTTGCTTCTAACCTAGAGCGGCKGACGGGT	1	SR-ad-79
CGAGGGGCASCATGAASTGGGGCARCCTGAAKTTTGCTTGCAAACTTTGATGGCGACCGGCGCACGGGT	1	SR-ad-80
TTGACCGTGCAGCTTAACGCATGCAAGT	10	SR-ad-81
ACGGTAAAATCCCCTTCGGGGGATTGAGAGTGGCGGACGGGT	1	SR-ad-82
ACGGATATTTTGAGTTTACTTAGGATATCTTAGTGGCGGACGG	1	SR-ad-83
CGAGGGGCAGCATATCGAAAGCTTGCTTTTGATGATGGCGACCGGCGCACGGGT	6	SR-ad-84
CGAGGGGCAGCAGGACGGTAGCTTGCTACTGTCGCTGGCGACCGGCGCACGGGT	2	SR-ad-85
CGAACGGTAAGGCCGAGCGTAGCAATACGTGAGGTACACGAGTGGCGCACGGGT	2	SR-ad-86
CGAACGGAGATGAGAGAGCTTGCTTTCTCATCTTAGTGGCGGACGGGT	1	SR-ad-87
CGAGCGGGGACCAGGGAAGAGCTTGCTCAGAACTGGTTTCAGCGGCGGACGGGT	2	SR-ad-88
CGAGGGGCAGCATTGTCGAAGCTTGCTTTGACAGATGGCGACCGGCGCACGGGT	1	SR-ad-89
CGAGCGGGACTCTTTCGGGAGTCTAGCGGCAGACGGGT	2	SR-ad-90
CGAACGGGAATTACATTTTAGCTTGCTAAGTTGTAATTCTAGTGGCGGACGGGT	10	SR-ad-91
CGAACGGGGCGATTGAAAGCTTGCTTTTAAGAGCCTAGTGGCAAACGGG	2	SR-ad-92
CGAACGGAGAATTTGCTTCGGTGAATTCTTAGTGGCGAACGGGT	1	SR-ad-93
CGAACGAGCCTTGTCGGACGGATCCCTTCGGGGTGAAGACCGGCGCTGGCGAGTGGCGGACGGGT	1	SR-ad-94
CGAACGGAGTGCTTAAAGCTTGCTTTGAACACTTAGTGGCGGACGGGT	2	SR-ad-95
ATCCTTTCGGGGTGACGATTTGTTGACTGAGTGGCGGACGGGT	1	SR-ad-96
CGAGGGGCAGCATGGGGATGGCTTGCCATTCCCGATGGCGACCGGCGCACGGGT	2	SR-ad-97
CGAACGGGGTTTAAGAAGGAAGCTTGCTTTCATTTTAAACCTAGCGGCAGACGG	1	SR-ad-98
CGAACGAAGCTCTCACACTCGAGTTTTCGGACAAGAGAGTGAGATGACTTAGTGGCGGACGGGT	1	SR-ad-99
GAGCGKATACATTTGAAAAKTTTGYTTTTTGGATGTTTCAKCGGCGRACGGGT	2	SR-ad-100
CGAGGGGTAACATGATAGAAGCTTGCTTTTATTGATGACGACCGGCGCACGGGT	3	SR-ad-101
CGAGGGGCAGCATMAAGTTTGCTTGCWATGTTCGATGGCGACCGGCACACGG	1	SR-ad-102
GGGGCAGCTTGAAGTTTGCTTGCAACGAATCAGGAGACCAGCTGRCAGGACG	1	SR-ad-103
AGGGGCAGCATTGGAAAAGCTTCATTTGGTAGATGGCGATTGACGCACGGGT	1	SR-ad-104
CGAGAGGCAGTAGGAAGCTCGCTTGCAAACTTTGATGGCGACCGGCGCACGGGT	1	SR-ad-105
CGAGGGGCAGCATGTCGGTTGCTTGCATCAGATAATGGCGACCGGCGCACGGGT	1	SR-ad-106
CGAACGGAGTTTAAGAAGGAAGCTTGCTTTCATTTTAAACTTTATGGCGGACGGGT	1	SR-ad-107
CGAGGGGCAGCATGACGAGTMCTTACACTTGGTGATGGCGACCGGCGTACGGGG	1	SR-ad-108
CGAACGGGGTTTAAGAAAGAAACTTGCTTTCATTTTAAAKKTAGTGGCGCACGGGT	1	SR-ad-109
CTAGGAGGAGCATGAAGTAMGCTTGCAAACTTYGAAGGCSACCGGGTCGCGG	1	SR-ad-110
GGGATATGTTTGATGAGAGCTTCGGCAGGAATCGGATGTGTTCTAGCGGCGGACGGGT	1	SR-ad-111
CGAGCGAGAAGGTCAAGAACAGAGATTCGTCAACGGGAATGACCGGACAGCGGCGGACGGGT	1	SR-ad-112
CGAACGGGGATAAAGATGAAACCTAGTGATTTTTTATCCTAGTGGCGGACGG	1	SR-ad-113
CGAACGAAGCACTTAGTTACGATCCCTTCGGGGTGACGACTTTGTGACTGAGTGGCGGACGGG	1	SR-ad-114
CGAACGGACGAGAAGGAGCTTGCTCCTTCAAGTTAGTGGCGGACGGGT	8	SR-ad-115
CGAACGGTGTTTACTTAGCTTGCTTTGTAAACATAGTGGCGGACGGGT	1	SR-ad-116
CGAACGGGGCTGAATAGCTTGCTATGAAAGCCTAGTGGCAAACGG	1	SR-ad-117
CGAACGGAGTATTTCGCCCGAGACCTGAGGTAGCTTGCTACGGATGGAATCAATTGAAATACTTAGTGGCGGACGG	1	SR-ad-118
CAGCTTAATGCATGTATGT	1	SR-ad-119
CGAGGGGCAGCGTGACGAGTGCTTGCACTTGTTGATGGCGACCGGCGCACGGGT	4	SR-ad-120
CGAACGGTAAGGTCCGAGGTAGCAATACCGAGGATACACGAGTGGCGCACGGGT	1	SR-ad-121
CGAACGGAGACATTTTGGTTTACTGAGATGTCTTAGTGGCGGACGGGT	4	SR-ad-122
CGAACGTGAAAGTGGCTTCGGCCATGAGTAAAGTGGCGCACGGGT	1	SR-ad-123
CGAACGAAGCACTTACGATTGACTGGAGAGCTTGCTCGAAGGGATTTTGTTTGTGACTTAGTGGCGGACGG	1	SR-ad-124
CGAGGGGCAGCATGTTGGTTGCTTGCAACCAATGATGGCGACCGGCGCACGGGT	1	SR-ad-125
CGAACGGAGTTTATATGAAACCTAGTGATTATAAACTTAGTGGCGGACGGGT	8	SR-ad-126
CGAACGGAGTTACTTTTGATGGAGATTCGTCAAAGTCAGCTGTAACTTAGTGGCGGAC	1	SR-ad-127
CGAGGGGCAGCATGAAGTTTGCTTGCAAACCCCGATGGCGACCGGCGCACGGGT	2	SR-ad-128
CGAACGAAGCCAAAAGGAAGCTTGCTTTCTTTGAAGCTTAGTGGCGGACGGGT	3	SR-ad-129
CGAACGGAGTATATGCGCTGATGATCGAAGTGCTTGCATAGAGAGAATCATGTGTATACTTAGTGGCGGACGGGT	7	SR-ad-130
CGAACGGCAGCAGCAATGCTGTAGTGGCGAACGGAACTTTGATGGCGACCGGCGCACGG	1	SR-ad-131
AGGGGCAGCATTATCGAAGCTTGCCAGATAGATGRCGACCGGCGCACGGGT	1	SR-ad-132
CGAGCGGAGACATGTTCCGGAGAGCTTCGGCAGGAAGAGATATGAATAGCGGCGGACGGGT	1	SR-ad-133
CGAACGGAAGAGAAGGAGCTTGCAAGCTCAATTTAGTGGCGGACGG	1	SR-ad-134
AGCGGAGACATTTGGAAAGCAGCTTTTTGAATGTTTCAGCGGCGGACGGGT	1	SR-ad-135
GAACGGAGAGTTTTTCTTCGGAGAAGCTYTTAGTGGCGGACGGGT	1	SR-ad-136
CGAGGGGCAGCATGAAGTTTGCTTGCAAACTTTGATAACGACCGGCGAACGGGT	1	SR-ad-137
GAACGAAGCACTTGAGATGAGACCTTCGGGTGGATTTTCTTGTGACTTAGTGGCGGACGG	1	SR-ad-138
ACAGCCTGCAAGGCCGCCAAAGTGTGCGCCACCACAGCCTGGCCAGCCACCGGGTGGTACTGCTTGGGGCC	1	SR-ad-139
CGAGCGGAGATTCCAGGAAGAGCTTGCTCGGAGAGGAATTTCAGCGGCGGACGGGT	1	SR-ad-140
GAGCGGGAATCTGTTGATTGAGACTTCGGTGGATTGATGCAGAGGATAGCGGCACGG	1	SR-ad-141
CGAGGGGCAGCATGAAGTTTGCTTGCAAACTTTGATGGCGACCGGCACTCGG	1	SR-ad-142
CGAACGGAAACCATTAGATAGTTTACTATTTGAGAAGTTTTAGTGGCGGACGGGT	1	SR-ad-143
CGAACGGACGAGGGGAGCTTGCTCCCCAAGTTAGTGGCGGACGG	1	SR-ad-144
CGAACGGGGATTTTGTTTCGGCAGAATCTAKGTGACTCAC	1	SR-ad-145
CGAGCGGAGACATACGACGGAGATGAAGTTTTCGGATGGAGTCAAAGATGTATGTTTTAGCGGCGGACGG	2	SR-ad-146
CGAGGGGCAGCATGAAGTTTGCTTGCAAACTTTGATGGCGTACGGCTTCGG	1	SR-ad-147
CGAGGGGCAGCATTATCGAAGCTTGCTTTGGTAGATGGCGACCGGCGCACGGGT	1	SR-ad-148
CGAACGGAGTATTGAGAATGAAGTTTTCGGATGGATTTTTTAATACTTAGTGGCGGACGGGT	3	SR-ad-149
CGAACGGAGATCATATGGACAGAGGCTTCGGCCGAAGGAAGTTTGATCTTAGTGGCGGACGGGT	1	SR-ad-150
CGAACGAAGCTTGAAGAATGATTTCTTCGGAATGAATTTTGATATGACTTAGTGGCGGACGGGT	1	SR-ad-151
CGAACGGGGTTTAAGAAGGAAGCTTGCTTTCATTTTAAACCTAGCGGCACGG	1	SR-ad-152
CGTGCGGAACACTTTTGTGTGTTTAGCGTCAGACGGGT	1	SR-ad-153
CGAACGGAGTTTAAGAAGGAAGCTTGAATTCATMTTAAAKCTAGGGCCCACGG	1	SR-ad-154
CGAACGGAGTTATCGAGAGCTTGCTTTTGATAACTTAGTGGCGGACGGGT	10	SR-ad-155
CGAGGGGCAGCAGGGGAGCAATCCCGCTGGCGACCGGCGCACGGGT	1	SR-ad-156
CGAGCGTGGCAGCAATGCCGAGCGGCGAACGGGT	1	SR-ad-157
GAACGGAAACTACTCGCTGAAGCGAACTCGTTCAATTCTTGAGTAGTTTTAGTGGCGGACGGGT	1	SR-ad-158
GCAAGACTGAGGGGCCAGCATGAAGTTTTGCATTTGCAAACTTATGATGGCGACCCGGGCGCACGGGT	1	SR-ad-159
CGAACGGGGTTTAAGAAGGAAGCTTGCTTTCATTTTTAAACCTAGTGGCGGACGGGT	1	SR-ad-160
CGAACGGACTGATTCCCTTCGGGGATGAAAGTTAGTGGCGGACGGGT	3	SR-ad-161
CGAGCGGAGACACATGACGGATATGAAGTTTTCGGATGGAGTAGAAGACATGTGTTTTAGCGGCGGACGGGT	1	SR-ad-162
CGAACGGGGTTTTAACGCTTCCGAAGCTTCGGCAGAGGATTGTTAAAACTTAGTGGCGGACGGGT	2	SR-ad-163
GAGTTGTTACGCTGAAGAGGCTTCGGCTGAATCTTGTAGCAACTTAGTGGCGGACGGGT	1	SR-ad-164
CGAGCGAGAAATCCATGATCGGAGATTCGTCAAAGTGATTGGATGGACAGCGGCGGACGGGT	1	SR-ad-165
CGAACGAAGCACTTTCAAACGGAGATTCGTCGAAGTTTGGATTTGACTTAGTGGCGGACGGGT	1	SR-ad-166
CGAGCGGACATTGCGACAGAATTGAAGTTTTCGGATGGATAGGAAGATGCAATG	1	SR-ad-167
GAGGGGCAGCGGGACGTAGCAATACGTTGCCGGCGACCGGCGCACGGGT	1	SR-ad-168
GAGCGAAGCGCCTGATCTGATTTCTTCGGATTGAAGTGAAGGATGACTGAGCGGCGGACGGGT	1	SR-ad-169
GAACGGGGCTGATTAGCTTGCTAAGAAAGCCCAGTGGCAAACGGGT	1	SR-ad-170
CGAACGGAGCTATTTAGACGGAACCCTTCGGGGGGAAGATTACTTAGCTTAGTGGCGGACGGGT	1	SR-ad-171
CGAGGGGCAGCATGGGGTTTGCTTGCAAACCCCGATGGCGACCGGCGCACGG	1	SR-ad-172
AACGATTAAGACCCTTCGGGGTGAATAAAGTGGCGAACGGGT	1	SR-ad-173
CGAACGAGAATCTAAGGACGGAGTTTTCGGACAACTGAATTAGAGGAAAGTGGCGGACGGGT	1	SR-ad-174
GAGCGGTAAGTTGTAGCTTGCTACAACCTAGAGCGGCGGACGG	1	SR-ad-175
CGAGCGGGGACATTGCGACAGATATGAAGTTTTCGGATGGATTTGAAGATGTAATGTTCTAGCGGCGGACGGGT	3	SR-ad-176
CGAACGGGGATGCACCGCTGATGCGATTTCGGTCAAATCTTGGTGTATCCTAGTGGCGGACGG	1	SR-ad-177
CGAACGAAGCACCTATCCGGATTTCTTCGGACTGACGGATTTGTGACTTAGTGGCGGACGGAT	1	SR-ad-178
CGAGGGGCAGCATGAAGGAAGCTTGCTTCCTTTGATGGCGACCGGCGCACGGGT	2	SR-ad-179
GAACGGGGAACAAACGCTTCGGCATTTGTTTCCAGTGGCGGACGGGGT	1	SR-ad-180
AAGATGGAAGCTTGCTTCTATCCTAGAGCGGCGGACGGGT	1	SR-ad-181
CGAGGGGCAGCGCGGGTGGCAACATCTGGCGGCGACCGGCGGACGGGT	1	SR-ad-182
CGAGCGGAGACATTTGGAAAGCTTGCTTTTTGGACAAGTGATGAGAATTCTTAGTGGCGGACGG	1	SR-ad-183
CAGCCTAACGCATGCATGTCGAACGAGAAAGGGGCTTCGGCCCTGAGTAGAGTGGCGCACGGGT	1	SR-ad-184
CGAACGAGAAGCACTGGAAGGAGTTTTCGGACAACGGAAGGTGTGGAAAGTGGCGGACGGGT	2	SR-ad-185
CGCCATCAAAGTTTGCTTGCAAACTTTGATGGCGACCGGCGCACGGGT	1	SR-ad-186
GAGCGGAGCCATCTTGAAGATCCCTTCGGGGTGATTCAGGGGAAGCTTAGCGGCGGACGGGT	1	SR-ad-187
CGAACGGAGGACCCTTGACGGAGTTTTCGGACAACAGATAGGAATCCTTAGTGGCGGACGGT	2	SR-ad-188
AGTTATCGAGAGTTTGCTTTTGATAACTTAGTGGCGGACGGGT	1	SR-ad-189
CGAACGGAGAGATACGCCGATCGAAGCTTCGGCAGAAATCATGTATCTCTTAGCGGCGGACGGGT	2	SR-ad-190
CGAACGGGGTTAAGGGAAATTTTCGGATGGAACTTAACTTAGTGGCGGACGGGT	2	SR-ad-191
CGAACGGGGTTTAAGAAGGAAGCTTGCTTTCATTTTAGTACCTAGTGGCGGACGGGT	1	SR-ad-192
CGAKCGGGGTTTACACGCTGAYGAAGCTTCGGCAGAATCCTGTMTAAACTTAGTGGCGGACGGGT	1	SR-ad-193
CGAGGGGCAGCACGAAGTAGGCTTGCTTCCTTTGATGSCGACCGGCGCACGGGT	1	SR-ad-194
CGAGCGAGAAGCCCATGACGGAATCTTCGGAAGACGGATTGGGCGGAAAGCGGCGGACGGGT	2	SR-ad-195
CGAACGGACCCATGGAATAGAATAAGCTTGCTAGGACATTCCGGAAGGTTAGTGGCGGACGGGT	1	SR-ad-196
CGAACGGAACTCTTTGGATCGAGACTT	1	SR-ad-197
CGAGCGAGAATTAAGGAAACGATACTTCGGTAAAGCGGAATTAAGGACAGCGGCGGACGGGT	1	SR-ad-198
CGAGGGGCAGCAGGCGGTAGCAATACTGTGCTGGCGACCGGCGCACGG	1	SR-ad-199
CGAACGGAGCACTTCGGTGCTTAGTGGCGAACGGGT	1	SR-ad-200
CGAACGGAGACTGTTGATGAAGCGGAAGGGCTTGCCCGGAAGTGGAATTGATAGTCTTAGTGGCGGACGG	2	SR-ad-201
CGAACGGGGTATCAACGCTGATGCGATTTCGGTCAAATCTTGTTGATACTTAGTGGCGGACGGGT	2	SR-ad-202
CGAACGGGGCGATTGAAAGCTTGCTTTTGAAAGCCTAGTGGCAAACGGGT	2	SR-ad-203
CGGACGGGGTTCTTTTGATCAGCTTGCTGAATGAGAGGACCTAGTGGCAAACGGGT	1	SR-ad-204
CGAACGAAGCACTTCTCCCGTCAAAGTAGATTAGCTTGCTATGAAGCGGAGACATTTGAAGTGACTTAGTGGCGGACGGGT	1	SR-ad-205
CGAGCGGAGACATGTAACGGAAAGCTTCGGCTGGAAGATATATGTTTTAGCGGCGGACGG	1	SR-ad-206
CGAACGAAGCACAGGAAGCCGATCTTTCGGGCGAAGCATCCTGTGACTTAGTGGCGGACGG	1	SR-ad-207
CGCACGTAWTTACGATCCCTTCGGGGTGACGATTTTGTGACTTAGTGGCGGACGG	1	SR-ad-208
CGAGCGAGAAGCTCATGACCAATACTTCGGTAGCGTGAATGAGTGGAAAGCGGCGGACGGGT	1	SR-ad-209
CGAACGGAGCCAACTTGAAGATCCCTTCGGGGTGAATCAGGGGAAGCTTAGTGGCGGACGGGT	1	SR-ad-210
GAGGGGCAGCATTGGGTTAGCTTGCTATTCCAGATGGCGACCGGCGCACGGGT	1	SR-ad-211
CGAGCGGGGATATATTGGATGAGAGCTTCGGCAGGATTCTGGTATATTCTAGCGGCGGACGGG	1	SR-ad-212
CGAGCGTGAAAGGGGCTTCGGCCCTGAGTAAAGCGGCGCACGGGT	1	SR-ad-213
CGAACGGACGAAGCTCTTCGGAGCCTAGTTAGTGGCGAACGGGT	1	SR-ad-214
CGAACGGAGTTAAGGAGGAGCTTGCTTCATCTTAACTTAGTGGCGGACGGGT	1	SR-ad-215
GAGCGGAGACATATTTTGGAAGGCTTCGGCCGGAAGAGATATGTTTTAGCGGCGGACGGGT	1	SR-ad-216
AGGGGGCAGCATGATCAAAGCTTGCTTGAATGATGCCGACCCGGCGCACGGGT	1	SR-ad-217
CGAACGGGCTTACGGAATCCACCGTTGAGGCTTWAAGAGGTGAAGTCACTTCGAGCGT	1	SR-ad-218
CGTGAATGCCAAAGCATTCACCACACTTTTATAAAGTTGCTTACACTCTTAAGGGT	1	SR-ad-219
GAACGGTGAAGCCGGAAGCTAGTGGCAAACGGGT	1	SR-ad-220
CGAACCGGAGTTAACTTTTGATAGAGATTCCGTCAAAGTCAGCTTGTAACTTTAGTTGGCGGACGGGGG	1	SR-ad-221
CAGCATGAAGTTTGCTTGCAAAACTTTTGATGGCGACCGGCGCACGGGT	1	SR-ad-222
CGAACGAGGTTTACTGGAGAGCTTGCTCGAAGGTAAAGCGAGTGGCGGACGGGT	1	SR-ad-223
CGAACGGACGATTCAGAATCGGAGATTCGTCGAAGAATCTGGAAAGTTAGTGGCGAACGGGT	1	SR-ad-224
CGAGCGAGAATCAAGTGAACGGAGATTCGTCAAAGTGATCTTGAGGAAAGCGGCGGACGG	1	SR-ad-225
CGAACGGAACTATTATGGAAAATCTTCGGATCGGAAGTTTTAGTTTAGTGGCGAACGGGT	1	SR-ad-226
GCAGTCCACGCGTTACGC	1	SR-ad-227
CGAACGGGGTTTAGCGAGAGCTTGCTTTTGCTAAACCTAGTGGCGGACGGGT	1	SR-ad-228
GAGTAACACGTGAACTGCACGT	1	SR-ad-229
CGAACGGGGTTTAGCGAGAGCTTGCTTTTGCTAAACCTAGCGAGCGGACG	1	SR-ad-230
CGAGGGGCAGCGGGCCGTAGCAATACGGTGCCGGCGACCGGCGGACGGGT	1	SR-ad-231
CGAGGGGCAGCATGGTGTAGCAATACACTGATGGCGACCGGCGCACGGGT	1	SR-ad-232
AGGGGCAGCATGAGGGTAGCAATACCCTTGATGGCGACCGGCGCACGGGT	1	SR-ad-233
CGAACGGAGATATTTTGAGTTTACTTAGGATATCTTAGTGGCGGACGGGT	3	SR-ad-234
CGAACGGAGATAATTTGAGTTTACTTAGGTTATCTTAGTGGCGGACGGGT	2	SR-ad-235
CGAACGGAGATAATTTGAGTTTACTTAGGTTATATTAGTGGCGGGCGGGT	1	SR-ad-236