#ID_REF = Signature - 20 nt sequence including DpnII site (GATC)
#VALUE = Mean abundance for a signature derived from all MPSS runs for the sample, in transcripts per million (TPM)
#ST_DEV = Standard deviation of the mean abundance from multiple MPSS runs
#REP = Replication_global
ID_REF	VALUE	ST_DEV	REP
GATCTCTGTGCAGTTCAAAA	100	71	yes
GATCTCTGGTGTCATGGTGG	55	68	yes
GATCAGAGGTGTACACTAAC	2	2	yes
GATCATAGTGGACGTTGTTA	35	3	yes
GATCATAGGACCACTTTTCA	5	4	yes
GATCACCGTCTAAGCCTCAG	28	6	yes
GATCATACTGTCAAAGAAAT	2	2	yes
GATCATACCCTAGCCGGGCA	117	10	yes
GATCAGTGTGTGCCAAGGAG	124	2	yes
GATCAAGAGTCTCAAACCCA	36	3	yes
GATCACCCTCTGTCCCCAGC	2	2	yes
GATCAGTCAGTGACAACCAA	75	12	yes
GATCAAGAGGAAGCACAATA	140	1	yes
GATCAAGAGAAAGAAGTGGG	31	8	yes
GATCACCCCAAAGCTCGTTA	29	1	yes
GATCAGTAGAGCTTGGACCC	395	14	yes
GATCTCCATTCTTTGCAGAT	7	1	yes
GATCAGTACACGGTGTATGT	36	3	yes
GATCACCCAGTGTCTCCTTC	22	10	yes
GATCAAGACGCAGGTCGAGG	154	32	yes
GATCAGGCTCTTTGTTTGTG	40	1	yes
GATCAGGCGTGAGCTTCAGA	54	4	yes
GATCTGGCCACTTTGTGTTT	6	0	yes
GATCTGGCCAACGGCAACAT	108	6	yes
GATCTGGCAGTCATAGCTTG	14	2	yes
GATCTGGCACTAACAGAACC	6	5	yes
GATCTGGCAACTGTGCGGGG	124	2	yes
GATCTGGCAAAAACTACGGG	140	23	yes
GATCTGGATTTGGTTGAGAT	11	4	yes
GATCTGGATGTGTGATAATC	4	4	yes
GATCTGGATGGAGTGCCTTT	28	8	yes
GATCTGGAGTGGGTGGGATA	12	1	yes
GATCTGGAGTCTGGTGTGGC	601	55	yes
GATCTGGAGTCTCTTAAAGC	52	48	yes
GATCTGGAGTCCGCTTACAA	141	8	yes
GATCTGGAGGGAGGGGCGGG	71	17	yes
GATCTGGAGGATTCCAGCGA	4	4	yes
GATCTGGAGCTCGCCCCCAG	6	6	yes
GATCTGGAGCGTATGGGTCT	37	2	yes
GATCTGGAGCCAGGCAGACT	19	8	yes
GATCTGGAGCATGTCCATGA	9	2	yes
GATCTGGAGAGTTTGTTCAG	27	5	yes
GATCTGGAGAAGAATGGTCG	7	4	yes
GATCTGGACTTTGCTCAACC	16	9	yes
GATCTGGACTGGTGTTTCTT	15	4	yes
GATCTGGACTCTCACCTAGG	11	10	yes
GATCTGGACTCACCTGGGAG	573	88	yes
GATCTGGACTCAAGGGGCAT	170	5	yes
GATCTGGACGGGTCAGCCTC	48	1	yes
GATCTGGACGGAAGTGGAGT	4	4	yes
GATCTGGACGATTCTGAGCC	83	22	yes
GATCCTTACGTAAGAGTGAC	23	5	yes
GATCCTCCTTGGCTACAGTG	2	2	yes
GATCTGAAGCCCAACGGGTC	20	19	yes
GATCCTGTGTTTGAATGACA	93	7	yes
GATCAGGCCCACTCCAGGAG	44	11	yes
GATCAGGAGAACTCCTGGTC	30	16	yes
GATCAGCCTACGCTCACATT	87	8	yes
GATCTCCAGCGGGCCACGTG	2	2	yes
GATCAAGAATGGACCAAGAT	498	14	yes
GATCAAGAAGTCGTCATTCA	3	4	yes
GATCACCAAGTGGTACCTGG	21	17	yes
GATCAGCCAGGTCTACACAC	16	1	yes
GATCAGCAGGTATTATCAGA	18	3	yes
GATCAGACTGTTGCTTTCGC	312	39	yes
GATCAGCACCAAGTGACTTG	57	1	yes
GATCAGAGTACTCAAGAGAG	59	3	yes
GATCAGAGCTTACCTGGAGC	2	2	yes
GATCAGAGCTGGAGGGAGCA	14	1	yes
GATCAGAGAGGAGAGAAACC	54	28	yes
GATCAGAGACATTGAGAGGC	4	4	yes
GATCAGACAGGAACCTTTAT	94	0	yes
GATCAGACAGATTTTGTTCC	122	6	yes
GATCAACTCCTGGGAGCTGT	6	5	yes
GATCAACTCCCGTACTAGAA	93	13	yes
GATCTGGACCTAATAAAACA	35	3	yes
GATCTGGACCAGGCTTGGAA	69	3	yes
GATCTGGAAGAACAAAGCTT	60	10	yes
GATCTGCTTTTTGAAATGAA	94	8	yes
GATCTGCTTTGTGCTTGGCT	29	7	yes
GATCTGCTTTCTCAGGACTC	78	13	yes
GATCTGCTTTCCCTTTGTAA	99	9	yes
GATCTGCTTGGCTGCCATTA	27	16	yes
GATCTGCTTGCCCCAAACAA	4	4	yes
GATCTCGGACGCTCAGTGGG	179	26	yes
GATCTCGCTGGTTCGCACCT	76	2	yes
GATCTCGATTCTACAGTGGT	124	6	yes
GATCTCGAGCACTCTCGTCC	8	2	yes
GATCAGAACCTTGCCGAAAC	114	17	yes
GATCAACTCAAACAGGAGGG	17	0	yes
GATCAACGTGATGGACGCAC	80	2	yes
GATCTCCTTCCTGGCTGTAT	9	4	yes
GATCTCCTTCCAGGCCCAGG	2	1	yes
GATCTCCTGGCCACTGTGGT	25	18	yes
GATCACTGTTTGTGCCTCTG	804	46	yes
GATCACTGTGTCCCAGGCTG	101	5	yes
GATCACTGAGGCATTGAAAG	6	7	yes
GATCACTGACATCTATACCC	60	4	yes
GATCAGAATGGCGGAGGCGG	9	8	yes
GATCACAAGTGGAAAGCAAT	39	2	yes
GATCACTCTTCCCGCTGCTG	39	2	yes
GATCACTCTGGTCGTGTGGG	1	1	yes
GATCACTCTGGCAGTCAAAT	2	1	yes
GATCAACCGACGAGGGCGCC	19	4	yes
GATCACGCTCAGCCCTTGGT	18	2	yes
GATCACGAAGAAGGCAGCCT	24	0	yes
GATCTCATTGGATTGCCTCC	24	8	yes
GATCACCTGTGGAGTTGTCA	75	15	yes
GATCACCTGACTCCTAACCG	130	2	yes
GATCTCCTCTCTTCCCACGG	55	13	yes
GATCTCCTCTCCAGGGAGCT	38	35	yes
GATCTCCGCAGGAAACTCTT	12	1	yes
GATCTCCCTTCCCCGGGGAA	26	22	yes
GATCTCCCTGTGCCGGTGCC	46	14	yes
GATCACCCATGTAAAGCGGT	9	8	yes
GATCACCAGAAAGTTTGTTA	2	2	yes
GATCTTGGCCAACTTGGAGC	6	6	yes
GATCACATGGGTCGAGGGTT	9	4	yes
GATCACAGGGGAACTAATTC	26	4	yes
GATCACAGAGTGGGAATCTC	120	9	yes
GATCACAGAGACCAACATGA	3	3	yes
GATCTTGAAGAAGATGAGGC	24	4	yes
GATCAACACTCCCCACGATG	6	5	yes
GATCACACTGTCTGAGGCGT	87	7	yes
GATCACACTCTGGCCCCCAA	21	4	yes
GATCACACGCAGAATGAAGT	1	1	yes
GATCACACCAGAGTCCAGGT	1	1	yes
GATCAACACCGTGCTCAGTG	26	3	yes
GATCACACAGGAGAGAGAAA	2	2	yes
GATCTGTACTTTGCTCTCGA	7	3	yes
GATCTCTCCACTCTTCATGG	2	2	yes
GATCTCCAGGACTTGTGTGG	11	9	yes
GATCCCTTCAAGTTCTGTAG	2	1	yes
GATCAAGTGCTCAATCGAAG	16	0	yes
GATCAAATTGCTTGCTTGAG	4	4	yes
GATCTCAGTCGGATGCACCC	49	17	yes
GATCAAGGCCGTTCAGATGT	37	14	yes
GATCAAGGACATCCATGTGC	37	10	yes
GATCAAATCCGACGACGAGG	320	9	yes
GATCAAGAGCAGTGCTGCTC	63	1	yes
GATCTGCATGCAGGTCACGC	11	4	yes
GATCAACGTCTGAAAACAAT	4	4	yes
GATCAAATATGTGCCCTATG	92	2	yes
GATCAAAGTTCCCAGAAATG	9	8	yes
GATCCTCAGCCTCCTGCGCC	2	2	yes
GATCGCTGCCAACATCCAGG	7	1	yes
GATCTCAGGGCAGAAATGAT	251	59	yes
GATCTCAGATGAGAGATGGT	2	2	yes
GATCTCAGAGGCTCGGTATC	131	19	yes
GATCAAAGGCATACACCACC	8	1	yes
GATCTCACTGAGTGAACAGA	14	7	yes
GATCTCACTCATTCAGGGCA	10	8	yes
GATCAAAGAAGATGTCCCAC	12	0	yes
GATCAAAGGTGGCTGGGTTT	26	6	yes
GATCAACAACCTCAACCGCC	7	6	yes
GATCAAACCGCAAAAAAAAA	2	2	yes
GATCTCACGATGAGCTATGA	17	15	yes
GATCAAACCCAGGGCTTTGT	232	5	yes
GATCAAAATCAGGAAACGAT	19	12	yes
GATCACTTTATTTGCTAGGG	19	0	yes
GATCAAAGGAAGCAAGTCAC	51	43	yes
GATCAAAGGAAATGGAGCCA	233	20	yes
GATCATCCAGACATTAACTG	12	10	yes
GATCAAACTACGGCACAGCA	7	6	yes
GATCTCACTGAGTAAACACA	7	0	yes
GATCATGCAACAAAAGCAGA	15	2	yes
GATCTCAAGTTGAACCGACT	161	61	yes
GATCTTTTTGTTCTGTTTTG	6	2	yes
GATCTTTTTGGCCTACATAT	30	9	yes
GATCAAAGACTGCGACACCA	3	4	yes
GATCAAAGACGGTCCCCAGA	27	23	yes
GATCAAAGAAGGCTGTTGAC	240	1	yes
GATCTTTTTCTCCATCTCTT	159	25	yes
GATCTCACAAAAGTGCTGCT	43	5	yes
GATCAAACGTGGCTGAGCGC	102	13	yes
GATCAAACGCCCTGGCAGAA	8	2	yes
GATCCCATCCTTCCAACCCC	9	8	yes
GATCATCTTGTGAAAACCCA	557	26	yes
GATCATCTTGGAAGGATTCC	8	1	yes
GATCCACCTGAGAGGGATGG	61	7	yes
GATCAAACCTGAGGGCACAT	4	2	yes
GATCTTTTCCACCTTCAGAG	151	22	yes
GATCAAACCCGTGGAAGAGG	71	7	yes
GATCAAACAGGCTGTCAAGA	12	3	yes
GATCTTTTACTTCGTGGCTG	45	6	yes
GATCAAACACCTACTTCCAT	21	4	yes
GATCTTTGTTGGTGGTATTA	45	4	yes
GATCAAAATGGAAGTCCTCA	16	1	yes
GATCTTTGTGTTTCCTTTCC	38	3	yes
GATCTTTGTGGTGTGGGCCA	277	27	yes
GATCAAAACCCATCAACACC	39	16	yes
GATCTTTGTCCAGTTCTGCA	1	1	yes
GATCTTTGTAAGTTCAAGGC	12	15	yes
GATCGTGACCCCAAGGACTG	60	6	yes
GATCGCCAAGGTGACCATGT	21	9	yes
GATCTTTCTGGCAAGGAAAC	1034	170	yes
GATCAAAATGAAGGTCAGGC	9	1	yes
GATCAAAATCGCAGTTACTT	4	5	yes
GATCAAAAGGACAACCACTC	57	11	yes
GATCCATTGACAGAGACAAC	50	2	yes
GATCCCCGCTTCTCCTCAGA	9	8	yes
GATCATCCAGAACACAGCCT	60	0	yes
GATCCAGGGCTCACCTACAC	54	0	yes
GATCCAGAAACACAAAAAGG	23	21	yes
GATCCACTTTCTAGGAAGGA	33	7	yes
GATCCTGATGCTGCCACGGA	9	6	yes
GATCTGCGCTTCCAGAGTGC	1163	193	yes
GATCCGGACCTGTCAGCCTA	1	1	yes
GATCCGCTCGCGGAAGGCTG	46	0	yes
GATCCGCTCGACAAGACAGG	34	31	yes
GATCCACTCAGCCGTGGTTT	7	1	yes
GATCCTGAGCCAGATGTCAT	183	34	yes
GATCCTGAGATGCAGCTCAT	116	18	yes
GATCCTGAGAGCCTCATCCT	22	20	yes
GATCCTGAGAGAAAACAGCA	15	1	yes
GATCCTGACTTTGCCAGCTG	95	17	yes
GATCCTGACTCTGACACTAC	97	17	yes
GATCCTGACCTGGGCTTCCT	20	7	yes
GATCCTGACCACATGAACAA	49	2	yes
GATCCTGACCAATGACAATA	11	13	yes
GATCCTGACAGTGCACCTAA	240	1	yes
GATCCTGACAGAGCCTTGGT	9	0	yes
GATCCTGAATGAGCTGTACC	3	3	yes
GATCCTGAATGACGTTCAGG	381	1	yes
GATCCTGAAGTGGCCTCAGC	5	3	yes
GATCCTGAAGTAGACAAAAA	2	2	yes
GATCCTGAAGGTCATCCGCA	51	7	yes
GATCACAAGGATGACATTGA	3	3	yes
GATCCGCATCCTCAACCCAT	31	13	yes
GATCCACGCGAAAAGCCGGG	5	5	yes
GATCCGATTTCTGTGTCTGA	55	5	yes
GATCTGCCTGGAGGACAATG	1	1	yes
GATCCTGAACGAGAGCCTGC	1	1	yes
GATCCTGAAAGCCAAGTTAG	129	9	yes
GATCTGGAAAGCTGTTTTCC	4	0	yes
GATCCTCTTTGCCAACCCCA	35	32	yes
GATCCTCTTTCACGCTTCTT	21	2	yes
GATCCTCTTGTTCCACGATG	43	4	yes
GATCCTCTTGTCCACTCCAC	35	3	yes
GATCCTCTTGCTGCAGCTTC	55	7	yes
GATCCTCTTGCGGGACAGTC	30	8	yes
GATCCTCTTGATTCCTTCTG	31	11	yes
GATCCTCTTCTTCCTCGTGA	139	22	yes
GATCCTCTTCTTCAGCACAC	438	21	yes
GATCCTCTTCTGCTGTTCTG	41	2	yes
GATCCTCTTCCTGCTCCAGC	10	9	yes
GATCCTCTTCCCATCCATCC	66	6	yes
GATCCTCTTCATCTTGGGCA	289	4	yes
GATCCTCTGTTGGGGCCTCG	70	8	yes
GATCCTCTGTTGCGTATTCT	192	18	yes
GATCCTCTGTGTCCTTATTT	13	6	yes
GATCCTCTGTGGACTCATCT	12	4	yes
GATCCTCTGTGCCTCACTCC	87	10	yes
GATCCTCTGCAAGAGCAACA	81	0	yes
GATCCTCTGAGGCAGTATTG	45	42	yes
GATCTCTGTGAGCTAAGGCA	4	5	yes
GATCCACCCCTTAAGAACCA	35	32	yes
GATCCGAGAGTGACAAATCC	56	27	yes
GATCCACCACCTAGAATCTA	224	20	yes
GATCAACTTCCGCAAAAGCT	1	1	yes
GATCTTCCCAATGTGAACAA	127	15	yes
GATCCTCTGAATGTTTTCCC	7	2	yes
GATCCTCTCTGAACCTCCTG	59	5	yes
GATCGTGACTGGGTGGCCAG	12	14	yes
GATCCTCTCCTTCTGACCTC	45	4	yes
GATCCTCTCATTCAGTCTTC	8	1	yes
GATCCTCTCAGAGGATTTCA	4	0	yes
GATCCTCTAGGGGTTATGGG	22	0	yes
GATCCTCTAAGACACTCATC	11	2	yes
GATCCTCGGGCAAGCCAAGA	860	30	yes
GATCCTCGGGAGACCACTGG	118	11	yes
GATCCTCGGGAATTTTTACC	49	2	yes
GATCCTCGGAGGCTACCGAG	1	1	yes
GATCCTCGGAAGAGCAGCCA	2	2	yes
GATCCTCGCCTGTTGGAGGA	8	7	yes
GATCCTCGCAGCTTCTATGA	411	49	yes
GATCCTCGACAGGAAGCCAC	1	1	yes
GATCCTCCTTTTCTTGGCGG	13	2	yes
GATCCTCCTTGTCAAGTACA	2563	58	yes
GATCCTCCTGTGTCTTCCTC	20	5	yes
GATCCGCCTGCTTCTGCCTC	212	35	yes
GATCAACCTGTACAAGCAGC	14	5	yes
GATCAACCCTGCTTACCTGG	13	9	yes
GATCCCTTTCCCCTAACTGG	16	15	yes
GATCCCTTGGAACTAGATTT	13	1	yes
GATCTGAGCTGAATTTGAAG	229	19	yes
GATCCTCCTGCCCCTCCAAT	44	11	yes
GATCCTCCTGCCCCGACAAG	15	13	yes
GATCCTCCTGAGTGCTGGGA	10	1	yes
GATCCTCCTCCTGTGTTTCT	48	11	yes
GATCCTCCTCAGACTTGTCC	4	3	yes
GATCCTCCGTGAGTATGCCT	116	5	yes
GATCGTTTAGTTCTCTGTTT	18	7	yes
GATCCTCCCCTTTACGGACA	141	14	yes
GATCCTCCCCAGGGATGGGG	16	13	yes
GATCCTCCCACAGGGACACT	31	3	yes
GATCCTCCCAAGTGAATGAC	101	7	yes
GATCCTCCAGGACAAGGGGT	61	1	yes
GATCGCCCTCAAGGGCGGCA	4	0	yes
GATCCTCATGTTCAGTTTTT	38	3	yes
GATCCTCATCTTCATTCCTT	27	7	yes
GATCCTCATATGAGGACCAT	121	15	yes
GATCCTCATACATCGGCCCC	32	4	yes
GATCCTCAGTGGGTAAGTGC	70	2	yes
GATCCTCAGGGTCTGCCCTT	7	1	yes
GATCCTCAGGAGTTGCAATG	22	0	yes
GATCCTCAGGAAACAGTCTC	78	22	yes
GATCCTCAGCTGGCTGGAGC	67	1	yes
GATCCTCAGATTAGATGTTT	28	10	yes
GATCCTCAGAGACGTGCTCG	79	14	yes
GATCCTCACCATCCACGTTT	17	2	yes
GATCCTCACCAGCCGCGGGC	390	49	yes
GATCCTCAAGCGCCTCAACC	20	19	yes
GATCCAGAGCAAGTCAAGAA	14	5	yes
GATCCACAGCCTACCAAAAC	18	1	yes
GATCCAGTGCCTGTGTAGAA	31	15	yes
GATCCAATGGTATTTTGAAA	32	5	yes
GATCCAATGCGAGGTGGCCC	68	8	yes
GATCCCTGCTCTGCAATGAG	284	2	yes
GATCCAGGCCCTGGGAGGCT	17	2	yes
GATCCTCAACATTCCTCGAA	27	11	yes
GATCCTCAACATCCGCCTGC	54	6	yes
GATCCTCAACAAGATGCTAT	101	29	yes
GATCCTCAAATCAGGCAACC	6	1	yes
GATCCTCAAACAGACATTGT	6	2	yes
GATCCTATTTTGGATGGTGA	7	1	yes
GATCCTATTTCTTACGTTTC	13	12	yes
GATCCTATTCTTTGTCTTAT	14	4	yes
GATCCTATTCCAGCCAAATG	41	2	yes
GATCCTATTCAGTGGCACAA	14	7	yes
GATCCTATTAGCCAAACTTT	67	7	yes
GATCCTATGTGTTGGCCATT	7	7	yes
GATCCTATGTGGCTCTAAAA	18	7	yes
GATCCTATGGTGATTCCAGT	11	1	yes
GATCCTATGGCATATGCAAG	4	4	yes
GATCCTATGCAGGCTGGAGG	17	2	yes
GATCCTATCTCCCGGTTGGG	6	2	yes
GATCCCCAGAGTCCTATGTT	3	1	yes
GATCCTATCATTGCTGGTGG	129	31	yes
GATCCTATCACCAGCACTGA	15	4	yes
GATCCTATATTTCCTGCTGA	26	5	yes
GATCCTATAGATGAACATAG	11	9	yes
GATCCTATAAGTAACCCCAA	9	8	yes
GATCCTACTTTGGGAACATG	2	0	yes
GATCCTACTTACCAATCCAA	25	9	yes
GATCCTACTGTGGATGACAC	2871	87	yes
GATCCCAGGTGTGTGTCACA	3	1	yes
GATCCTACTGATGAAGTGCC	121	3	yes
GATCCCAGGGCTTCTTTCCA	3	1	yes
GATCCCAAGTTAACTGAAGG	1	1	yes
GATCCCTGAGGCTGCCTCGA	6	5	yes
GATCCCTGAGCTATTGCTAG	11	1	yes
GATCGATCGTCGTTCTGGTA	6	7	yes
GATCCAGGTTTTGTGGTCTT	12	1	yes
GATCCAAGGGGTGGTAGGGC	69	5	yes
GATCCCTCTCCCAGGAACAA	7	6	yes
GATCCAAGCTGTCAAGAAGG	433	56	yes
GATCCAAGCTCCATTGTACC	42	9	yes
GATCCTACGGAGCAAGTCTA	10	5	yes
GATCCTACCTTCTGCTTTCG	49	4	yes
GATCCTACCTGAGTGGCAGC	628	20	yes
GATCCTACATCCATTCGGCT	6	5	yes
GATCCTACAGTGGCTGGCAA	94	16	yes
GATCCTACAGTCACTTCACA	54	2	yes
GATCCTACACTCCTGGCAGT	16	1	yes
GATCCTACACATGGAGGCTG	132	20	yes
GATCCAGTGTCAACTAAGAA	1	1	yes
GATCCTACACACCTACCAGA	140	3	yes
GATCCTACACACAGTGGTGA	12	10	yes
GATCCTACAAGCCTGTCCGT	26	5	yes
GATCCTACAAAGGTCTTGAA	42	3	yes
GATCCTAATGATTTCAGCCC	9	2	yes
GATCCAGACAAGTCAGCATT	1	1	yes
GATCCTAATGAAAAAACTTG	23	5	yes
GATCCACTTCTAAACCCGTT	1	1	yes
GATCCTAAGTAGAATCAGAT	78	19	yes
GATCCACTGATGGCCTCTGA	1	1	yes
GATCCTAAGCAGATTCTGGG	232	24	yes
GATCCTAAGAAAGAAAGCTG	8	1	yes
GATCCTAACTGTGGAACCTC	11	8	yes
GATCCTAACTCTGACCTTTC	117	16	yes
GATCCTAACTAAGCACATGA	13	2	yes
GATCCTAACCTAAGATGCCT	59	5	yes
GATCCTAACCCTGAACCCCA	1	1	yes
GATCCTAACCCAGTGGACTC	151	3	yes
GATCAGGGTCTGATTGACAC	44	3	yes
GATCTTTGTGTGACTGGGTT	3	3	yes
GATCCAACTTGCCCCAAGAA	24	11	yes
GATCCCGTTGAAGCACGGTG	8	1	yes
GATCCCGTGTCCTGCAGACG	156	29	yes
GATCCCGTCTCAGCCACGTC	1	1	yes
GATCCCGTCCAGGCCGAGGC	14	13	yes
GATCCAACACCGGCGGCCAG	2	0	yes
GATCCAAATGGGCCAACTCT	1	1	yes
GATCAAGGGGTCCAATCCAG	24	5	yes
GATCCTGTACAGAAACTCTT	6	4	yes
GATCCTAAATTTGACCCAGG	71	5	yes
GATCCTAAATGGCAGCCTTT	9	2	yes
GATCCTAAAGTTCTTTCAGG	136	13	yes
GATCCTAAAGGCCGGTCACA	12	3	yes
GATCCTAAACTCTGTTGCCA	25	5	yes
GATCCTAAACTCCAAGGGGA	1049	60	yes
GATCCTAAAACTGAGGAAAG	8	7	yes
GATCCTAAAACCAAGGGAAT	19	18	yes
GATCCGTGAGCTAGTTCTCT	25	12	yes
GATCTGGGGATAGACTTGAA	7	3	yes
GATCCGTTTGGCCTCTCAAT	40	3	yes
GATCCTGGAACGTTTCTAAA	26	3	yes
GATCCGTTTATTCCATTCTA	12	7	yes
GATCCGTTGGAAGGTTTACC	93	9	yes
GATCCGTTGCCTCCTTAAAG	49	45	yes
GATCCGTTGCCAGTTACCTG	487	77	yes
GATCCCCCTCGCCCCCCCCC	1822	161	yes
GATCCGTTCCTAGGGTACCT	93	1	yes
GATCCGTGTGTTGTTAAGAT	2	2	yes
GATCCGCTGTACCCATCATT	22	2	yes
GATCCGTGTGTGTGTGGGAG	492	58	yes
GATCCCAGGCTTCTGGGGAC	38	8	yes
GATCCGTGTGAAGGTCCCAT	108	6	yes
GATCCGTGTGAAACTGGATG	1195	126	yes
GATCCGTGTCAACCCCTTTT	13	4	yes
GATCCGTGTATGTCTAAACA	462	37	yes
GATCCGTGGCTGCAGCAGAA	96	8	yes
GATCCGTGGAGAAACTTGCC	27	7	yes
GATCAGTACCGCCTTACCCC	10	8	yes
GATCCAAAGTGAAAAGGAAA	5	5	yes
GATCCAAAGGAGCTACTTAG	31	20	yes
GATCCCGGAAAGAAGCAACA	484	41	yes
GATCCAAACTCTACAGAATC	5	3	yes
GATCCGTGCTGAGCGTCGGC	54	10	yes
GATCCGTGCTGAATTGGTTT	7	1	yes
GATCCGTGCATCTCATTGGC	113	8	yes
GATCCGTGAAGAACAAAAAG	7	6	yes
GATCCGTCTGTGGGGGCCTC	4	2	yes
GATCCGTCGCCTGGAGGTGG	139	4	yes
GATCAGGCCTGACGCATTAG	1	1	yes
GATCCGTCATCTCCAGGACA	85	4	yes
GATCCGTCAGTGGTCAGTGC	23	1	yes
GATCCGTCAGGCTTGCTCGT	109	7	yes
GATCCGTATCAGGTTCATGT	154	30	yes
GATCCGTAGTCTGAGTGATG	63	8	yes
GATCCGTACCCTGGTGCTGA	163	14	yes
GATCCGTAAGAAAGAGAAGG	14	13	yes
GATCCGGTTCTGGGACAGCA	23	5	yes
GATCCGGTGCCTGCCTTGCC	40	17	yes
GATCCGGTCCCAAGACCGCT	147	14	yes
GATCCGGTCCAAGGCTCTTG	46	9	yes
GATCCGGGTGTCCAGTGACA	234	5	yes
GATCCGGGTGATGCGAATCG	2	2	yes
GATCAGAAATCTGTGCTCTT	1	1	yes
GATCCGGGGGAAATTGGGAT	10	3	yes
GATCCGGGGCACACATTCTC	27	3	yes
GATCACTTTTATATCCTGGG	2	0	yes
GATCCGGGCTTTGCACCCTG	4	2	yes
GATCCGGGCAAAGCCTGCTC	117	22	yes
GATCCGGGAGTGCTGGACTT	18	7	yes
GATCCGGGAGGTGTGCGGCT	668	57	yes
GATCCGGCTGTGCCAGGTGT	20	19	yes
GATCCGGCTGGGCCTGGCTC	23	1	yes
GATCCCCTTCTACGTGACCA	41	8	yes
GATCCAAAATGTTCCATGGA	127	15	yes
GATCCCCTGGGCTTTAATAA	18	22	yes
GATCCCCTGGCACTACACTC	6	6	yes
GATCCAAAAAGCAGTTCAAC	85	12	yes
GATCAGTGTGTGCCAAGGAA	2	3	yes
GATCCGGCAGAAGGATGAGG	254	8	yes
GATCCGGATGTCCTAACTGA	13	8	yes
GATCCGGATGGACGCACAGC	71	7	yes
GATCACCTTCTACGAGGACC	2	1	yes
GATCCGGATGAAACATTGTC	70	22	yes
GATCCGGACTCACCTGGGAG	48	44	yes
GATCCGGACGCTTTGTGCTC	5	5	yes
GATCCGGACCAAGCCACCAC	56	8	yes
GATCCGGAAGAGCACAGCGA	49	2	yes
GATCACCAGGGAAGTTCTCA	1	1	yes
GATCCGGAAGAAGATGATGG	630	48	yes
GATCCGGAAGAAATAAAGGC	47	44	yes
GATCCGGAAATACAACCGAG	24	4	yes
GATCCGCTTGGCAGCCATTC	175	4	yes
GATCCGCTTCGTGGAATGGG	77	7	yes
GATCCGCTGTCAGGAGCTGA	52	14	yes
GATCCTATTCTGTCACATTA	109	3	yes
GATCCGCTGCAACCCGGTGC	27	5	yes
GATCCGCTCTGTGGTCGCCT	122	10	yes
GATCCGCTCTGAGGTTCTGT	24	5	yes
GATCCGCTCTCTGCATCTGT	1	1	yes
GATCCGCTCCTGGCGACTCC	56	6	yes
GATCCGCTCAGAGCCCAGCA	93	9	yes
GATCCGCTCACGCCCAGCAG	36	3	yes
GATCCGCCTTCTACTCGGAA	6	0	yes
GATCCGCCGCTAAGACCTGG	35	1	yes
GATCCGCCCTGTGAGTCACC	40	7	yes
GATCCGCCCGCTCACACAGG	6	6	yes
GATCCGCCAAGTTATTCAGG	30	0	yes
GATCCGCCAAAAAAATGCAC	123	1	yes
GATCCGCATGATGGGAGGAG	52	2	yes
GATCCGCATCCGCAAGCCCT	191	1	yes
GATCCGCAGGTCAGATGACA	4	2	yes
GATCCGCAGCTTTTCCAGCA	113	12	yes
GATCCGCAATTATGAAGAAC	57	11	yes
GATCCGCAAGGTGCTGGACG	251	11	yes
GATCCGCAAGGACTTCTTAT	8	7	yes
GATCCAGAGAAAGAGAGAAA	17	1	yes
GATCCAGACTTTAAGGGTTT	4	4	yes
GATCAAGATTGACTCAGCTG	2	0	yes
GATCATTTCGGGCCAGTAGG	204	29	yes
GATCCAGACAGCCATCAAGG	41	6	yes
GATCCCCGAAGTCTCTCTCC	61	4	yes
GATCATTGGTGGAGACCAAT	2	3	yes
GATCCAGAACTTGCAGCAAC	17	2	yes
GATCCCCAGGGAGACAGGAG	2	2	yes
GATCTTGTGACAGTGTGTGT	378	22	yes
GATCCGCAACTGTCCGGAAG	43	6	yes
GATCCGATTTCTGATTTTGC	47	8	yes
GATCCGATTGAAGCCTCAGG	63	9	yes
GATCCGATTACAGATGGTGT	4	3	yes
GATCCGATGGGCCAGCCTTT	60	12	yes
GATCCTTTTATTTCACCGGG	9	2	yes
GATCCGATGAGGAAGATGAC	403	7	yes
GATCCGTGCCTGCCCAGGCA	2	2	yes
GATCCGATACAAAACCATCG	8	7	yes
GATCCGAGTGAAAGCCGGAG	35	0	yes
GATCCGAGGCTAGAGGGAGC	125	0	yes
GATCCGAGGCAGCCAATACA	246	36	yes
GATCCGAGGCAGATTTTCTT	23	6	yes
GATCCGAGCGACTGTCACCA	130	14	yes
GATCTTTTTTCAAATGGCTC	16	13	yes
GATCCGAGCCTCACTACCTG	4	3	yes
GATCCGAGCAGCCACATTCC	7	6	yes
GATCTTTTTAGGGGCGGTCT	416	53	yes
GATCCGACAGGAGGGTGTAA	26	8	yes
GATCCGACAGAGGTGCCCCG	39	0	yes
GATCCGAATTGCAGAGCTGT	146	11	yes
GATCCGAATAAACCATTCTT	86	13	yes
GATCCGAAGCTCATTCCAAG	106	14	yes
GATCCGAACTTCACCCTAAT	10	0	yes
GATCTTGAAAACACCAGTAA	1	1	yes
GATCTGCAAGGCCTAATTAC	8	7	yes
GATCTGATAAGCATTGGTCC	7	1	yes
GATCCGAGTAGTGGTTTGAT	3	1	yes
GATCCCCATGGAGATGACCA	1	1	yes
GATCTTGCTGTGTCTTTTCA	27	1	yes
GATCTTGCCTGGTATTAAAG	19	18	yes
GATCCCCACTTCGCTCTTGT	9	1	yes
GATCCCCAAAGCCCCTAGAG	65	5	yes
GATCTGAGACTCGCTAACCA	5	1	yes
GATCCCTGGCTGGGCCCTGG	56	11	yes
GATCTTCTCCTTTGAGGGAA	35	1	yes
GATCTTCTAGTAGCAGCACA	2	2	yes
GATCTTCATGGTGGCAAGAC	25	3	yes
GATCTTCAATGTTCCTTTTT	3	3	yes
GATCTTCAAGGACTTTGCAT	8	1	yes
GATCTTATTGTGCTTGGTAG	4	4	yes
GATCTTACCTGCCGGCAGAA	53	15	yes
GATCTGTTTCCATGGTGATT	11	0	yes
GATCATCTTTGCATAGGGCT	89	3	yes
GATCGCCAATGGCAAGCTGG	1	1	yes
GATCTGAAACACCGTCTTCA	51	35	yes
GATCTCTACACTTCTGTCAG	31	11	yes
GATCTGTTCTTTGTGAAATG	3	1	yes
GATCCATTTGTGGGAGCATT	2	1	yes
GATCTCTGACGGCTTCTCGA	23	28	yes
GATCTGTCCATCAAAATGAG	10	1	yes
GATCTGTCAACAAAGAAACT	7	4	yes
GATCCTTTTGTAACTCCCTG	84	1	yes
GATCCTTTGGAACCAGAGTA	5	1	yes
GATCTGCTTCCTGAAGAGTG	50	10	yes
GATCTGCTTCCCATTGTGGT	456	29	yes
GATCTGCTTCCCAACTGTTA	21	0	yes
GATCTGCTTCCATCCATCTC	2	2	yes
GATCTGCTTCATTATTTCAC	2	1	yes
GATCCTTTGCTCTGCTTCAT	19	4	yes
GATCCTTTAGGGAGTCTTCT	5	5	yes
GATCATCATTGGAGGAGGCT	2	2	yes
GATCGAATCATGGAAAGTGG	3	3	yes
GATCCCCTCAAATCTAGACT	16	15	yes
GATCCCCTAAGAGGGACATT	15	14	yes
GATCCAGGAGACCCTAGAAG	35	30	yes
GATCTGGCCAGTTATGCCAA	38	1	yes
GATCTGGAAAATGTCACCCC	7	2	yes
GATCTGCTTACTGCTCACAT	4	4	yes
GATCTGCTTATCCCATTTAG	45	10	yes
GATCCTAGCTCAGAGAGGCT	90	6	yes
GATCCTTCTTGCAAACAGAA	4	4	yes
GATCTGCTGTTCCTCACGAA	107	12	yes
GATCTGCTGTGGCACAGGGC	31	13	yes
GATCTGCTGTCTACTACCTA	41	2	yes
GATCTGCTGGTCATTAAGGG	372	7	yes
GATCTGCTGGCAGTAGTAGT	20	7	yes
GATCTGCTGGAAGATAATCT	42	7	yes
GATCTGCTGGAAGAAACACA	14	1	yes
GATCTGCTGCCTGCTCCCAC	43	6	yes
GATCTGCTGCCAGGTTTTGC	188	35	yes
GATCTGCTGCAGGGTTCTGT	53	21	yes
GATCTGCTGCAGCTAAAGTA	95	7	yes
GATCTGCTGATGTTACGTCG	19	4	yes
GATCTGCTGATATTCCGGGC	10	3	yes
GATCTGCTCTTTTCGTGTTC	21	2	yes
GATCTGCTCTTGCTAATAAC	59	3	yes
GATCCGAGGGAGATGGACTA	11	3	yes
GATCTGCTCTGTAGAAAGAA	16	1	yes
GATCTGCTCTGATGGTATGT	10	7	yes
GATCTCGTAGATGTTCAGAG	5	1	yes
GATCTCTGAAATGGGCAAAA	3	3	yes
GATCCCCAAACCTCTGTGAG	8	1	yes
GATCTCAATAACTTCAGCAC	1	1	yes
GATCCCAGGGGGAAGTAGTT	5	6	yes
GATCCTTCCCACTTCCCTAG	2	1	yes
GATCCTTCAAAGCAGAAGCC	5	6	yes
GATCCTTATGGAGTAGATTT	60	1	yes
GATCTGCTCTCAAAAATTCC	16	7	yes
GATCTGCTCTAACCAGGCGT	84	1	yes
GATCTGCTCCTTCTGTCCCA	103	7	yes
GATCTGCTCCTTAACGTTTT	96	4	yes
GATCTGCTCCTGGAGGTGGT	44	1	yes
GATCTGCTCCTGAGTGCTGT	43	4	yes
GATCTGCTCCCAAGTTATCT	62	23	yes
GATCTGCTCCAACTACAGGA	382	22	yes
GATCTGCTCAGTGACTTGTG	459	57	yes
GATCTGCTCACTCTATTACT	12	3	yes
GATCTGCTATTGAATCGAAT	4	4	yes
GATCCCTTTACACACAGGCA	2	2	yes
GATCTGCTATGTACTCCAGG	41	10	yes
GATCTGCTATCTCACCTGGC	31	5	yes
GATCTGCTAGCAGAACTTGT	137	26	yes
GATCTGCTAGAGCTGTAATA	403	29	yes
GATCCTGTTTTCTGTGCCAA	10	4	yes
GATCTGCTACTGGAGATGTT	52	2	yes
GATCTGCGTATGGCGGCCAT	541	78	yes
GATCTGCGTACACCTGCGTC	63	18	yes
GATCTGCGGTGACTTGATGT	870	73	yes
GATCTGCGCTATAGAAAAAA	115	10	yes
GATCTGCGCCTGCCTTGTCT	66	0	yes
GATCTGCGCCTGAGCCAAAG	162	2	yes
GATCTGCGAAGTGACAGTTA	46	1	yes
GATCTGCGAAGCCAGGCTTC	29	1	yes
GATCTGCCTTGGATTTCCTC	33	11	yes
GATCTGCCTGTCACTGTGGC	385	12	yes
GATCTGCCTGAACGTGTGTA	4	4	yes
GATCTGCCTCAGGAAAAATA	7	0	yes
GATCCCAACTGTCCAGCGCG	30	25	yes
GATCCTGCTCACAGAATCAC	1	1	yes
GATCCTGTGGAAAAATGAAA	2	0	yes
GATCCTGTGCCACAGTGCTC	14	1	yes
GATCCTGCAGCACGTTATCG	224	0	yes
GATCTGCCGCAGTAAGCGAG	30	4	yes
GATCTGCCCTTTCTGGGTGA	156	4	yes
GATCTGCCCTTGCACCCGGC	22	0	yes
GATCTGCCCTTACATTCTTG	14	3	yes
GATCTGCCCGAAGCCATGAG	9	2	yes
GATCTGCCCCATGGTGTTTT	59	3	yes
GATCTGCCCAATCCTTCCTC	39	0	yes
GATCTGCCATTCCCATCTGT	3	1	yes
GATCTGCCATGGAGGAATCT	72	6	yes
GATCTGCCATGCTGGAAAAA	9	8	yes
GATCTGCCAGTTTTGGTGCC	234	5	yes
GATCCTGGTGCGGCTTTGGA	3	3	yes
GATCTGCCAGTCCGAGGTTC	50	6	yes
GATCTGCCAGGACAAGCTGG	143	15	yes
GATCTGCCACTTGTTTTAAT	5	5	yes
GATCTGCCACAGCAAGAGTG	93	10	yes
GATCTGCCAATGGTGCCGTT	1	1	yes
GATCTGATTCTCTCTTCTGG	26	7	yes
GATCTGATTCCTTCTTTGGG	2	2	yes
GATCTGATGTTCTGTGTTTT	28	4	yes
GATCTGATGTTCTCTTCTGG	35	9	yes
GATCTGATGTGGTAATCAGC	40	7	yes
GATCTGATGTCCACTTCTGG	16	15	yes
GATCGGTCTGAGATGACTCA	12	15	yes
GATCCTCTGTGATTGTGATG	47	8	yes
GATCATGTTTTTAGATGAAC	42	1	yes
GATCAGTTCATCCACATAGA	21	1	yes
GATCTGATGTCAGTCGTGGT	93	15	yes
GATCTGATGTATGCCAAGCG	45	14	yes
GATCTGATGGTGGGGTGGCA	40	3	yes
GATCTGATGGTCCACTCTGC	88	17	yes
GATCTGATGGGTTTCTGGCT	173	32	yes
GATCTGATGCCTTCTGGTGT	28	2	yes
GATCTGATGCCCTTTTGTGG	42	15	yes
GATCTGATGCCAGCCCCAAA	26	24	yes
GATCTGATGACTCCATATTT	13	0	yes
GATCTGATGAATAAAGGAGG	46	1	yes
GATCTGATAGTCAAGTGTAT	316	45	yes
GATCTATTTTCCTATGGAAT	19	7	yes
GATCGGGAAGAACGCGGCGT	3	3	yes
GATCTATGTTTGTAATGCAG	21	18	yes
GATCTATCTGATGTGGGCAA	2	1	yes
GATCTATCTCATCATCCAAA	2	1	yes
GATCTATCGGCCTCTGCCTC	30	8	yes
GATCTATCCTAGCCGGGAGG	1005	119	yes
GATCTATCCCATCTAGTGGT	1	1	yes
GATCTATCCCAGAGTTCTAT	26	11	yes
GATCCTGCTGGGGGAGCTGG	16	4	yes
GATCAGTCTCCATCAGACTT	232	29	yes
GATCAGTATTAGAGGAAAAC	6	5	yes
GATCTGAGTGGGTGGGGGGT	78	3	yes
GATCTGAGTCCTCACACTGG	15	2	yes
GATCTGAGTCCACAGGGCTT	2	2	yes
GATCTGAGTCAGGAATAGTT	11	2	yes
GATCTGAGGGTGATTTCTCT	80	30	yes
GATCTGAGGGACTCTCCCTT	35	9	yes
GATCTGAGGCCTTGTTTTTT	300	10	yes
GATCTGAGGAGCAGATGATG	47	10	yes
GATCTGAGGACAGTTTTCAT	39	4	yes
GATCTGAGCTGCCCTCTGCT	2	2	yes
GATCTGAGCTAAATGTCTAC	2	1	yes
GATCTCAAAACCTTGCACAG	8	7	yes
GATCTTTGGGAGGCCTGGAC	4	2	yes
GATCCTTCAGGCTCTGGCTT	57	12	yes
GATCTTTGCCAAAATGTGTG	100	16	yes
GATCTTTGATTTTGCCCTGA	48	5	yes
GATCTTTGAGGTGCTAAGTT	18	7	yes
GATCTATGGATTTTGAGGAG	119	79	yes
GATCTTTCTACATCCCTGGG	7	3	yes
GATCTTTCGTCTACTGGTCA	20	3	yes
GATCTTTCGGAGGAGATGTC	143	12	yes
GATCTATACAGTCGGGAAAC	385	23	yes
GATCCTGAGATGAAGTCTCT	1	1	yes
GATCCTGACTTTGTTGGGGT	26	2	yes
GATCTGAGCATAGCGTCAGA	38	3	yes
GATCTGAGCATAGAAGAAGG	11	3	yes
GATCTGAGCAGGTGAAAAGT	192	20	yes
GATCTGAGAGGAAGGTGGCT	56	0	yes
GATCTGAGAGCCGTGGTGCC	16	14	yes
GATCTGAGAGAGGAAACCTT	23	4	yes
GATCTGAGAAGATGTGGATG	2	2	yes
GATCTGACTGTAGCCTTTTC	28	4	yes
GATCTGACTGTACCCTGCCG	93	5	yes
GATCTGACCTGTCCCAGCAA	5	1	yes
GATCTGACCTCTCCTGGCAC	5	5	yes
GATCTGACCTCGGAGTGTGC	26	5	yes
GATCTGACCGCTTTGGCCAA	8	1	yes
GATCTGACCGAGAACTGAAC	17	0	yes
GATCTGACCCTCCAGACTTT	33	9	yes
GATCTGACCCCATGGCTTCC	13	16	yes
GATCTGACCAACAAGACCAC	167	95	yes
GATCTACCGTGCAGGGACTG	73	10	yes
GATCTTTCCAGAAGGTCTTC	53	3	yes
GATCTACACATGGGGCAACC	321	18	yes
GATCACTGACTGCCCCAAAC	12	4	yes
GATCTAGGTTCAGAGTTCAG	22	2	yes
GATCCTGAAGCGCGCCTGAC	5	1	yes
GATCTTTACAAGTCTGGCAC	21	0	yes
GATCTTGTTTGTGTCTCTGC	14	7	yes
GATCTTGTTGGGAAACTAAT	27	3	yes
GATCTTGTTGGCTGAAAGCA	7	6	yes
GATCCTGAACAACCTTCTAC	1	1	yes
GATCAGCTGTCCAAAAATAT	21	1	yes
GATCTTGTTCCCTTACACGA	3	3	yes
GATCTGGGCTCATCTTGTTT	6	0	yes
GATCTGAATTTCTTCCTCTT	74	10	yes
GATCTGAATTTCACAAGAAG	34	6	yes
GATCTGAATGTCCGAGAGAG	66	16	yes
GATCTGAATGGAAAAGCCAT	198	54	yes
GATCTGAATGCTGCCGAGTC	170	29	yes
GATCCTCTGGGGAAATGGAC	73	3	yes
GATCTGAATGCTGCAATGAA	1	1	yes
GATCTGAATGCTCTGGGGGC	141	30	yes
GATCTGAATGATACCAACTA	1	1	yes
GATCTGAATCCACTGTGGCT	17	0	yes
GATCTGAAGTTCTGTGTTCA	16	7	yes
GATCTGAAGTGCCTCAGACT	2	2	yes
GATCTGAAGTCTGAATGGCA	52	2	yes
GATCTGAAGTATCTGTACAG	181	16	yes
GATCTGAAGCTGCTGATGAA	258	24	yes
GATCTGAACTGTCTAAAAGA	60	3	yes
GATCTGAACTCCAGAGAACA	636	58	yes
GATCTGAACACCCAGCGAGG	125	7	yes
GATCTCTTTTGGTGTGTCTG	14	7	yes
GATCTCTTTTGCCAAGAAGT	132	5	yes
GATCTCTTTGTGTTCAAGAC	8	4	yes
GATCTGTACTCTCCAGCTGT	87	16	yes
GATCTAATTGCAGTGGTTAA	171	15	yes
GATCAGAGTTGACCAGGCTG	2	2	yes
GATCTAACTATTTTGCATTG	7	6	yes
GATCTACGCACGCATCAGCA	20	3	yes
GATCTTGTGCCAGGTGGACT	58	8	yes
GATCAGACGACGTCCAGAAT	17	15	yes
GATCTACCCTGACTCAGGTT	18	1	yes
GATCACTACAGTGAAGTATT	39	8	yes
GATCTTGTCCAGAGCTTCCT	58	14	yes
GATCTTGTATTCTCTGGCTT	48	8	yes
GATCTTGTACAAACCGGTTT	131	1	yes
GATCTTGGTTTTGCTTTGTT	2	2	yes
GATCTTGGTCACAGAAAAAA	5	6	yes
GATCTCTTTGGGCTGGGCCT	90	15	yes
GATCTCTTTGCTTTGAAACT	60	57	yes
GATCTCTTTGCCCTTGCACT	25	5	yes
GATCCTCGAGTTGAATGAAA	13	4	yes
GATCTCTTTGAGTTTGAGGG	28	34	yes
GATCTCTTTCTTGTTCCCCC	134	21	yes
GATCTCTTTCTGAGACCTTT	139	15	yes
GATCTCTTTCCTGGACATTT	2	2	yes
GATCTCTTTCATTGTACAAG	21	2	yes
GATCTCTTGTGAAACGAAAC	12	10	yes
GATCTCTTGTAATTCTGTAA	23	5	yes
GATCTCTTGAATGACAGACA	26	4	yes
GATCTCTTCTCGCGCTCTCC	184	39	yes
GATCTCTTCCGCATGTTTGA	4	4	yes
GATCTCTTCAGAAGGGCACT	10	5	yes
GATCTCTTCACTGTTTTTCT	63	18	yes
GATCTCTTATGGAGTGGAAA	58	3	yes
GATCTGGGACTGAGAACAAA	1	1	yes
GATCAGACCCCACAGCCCCC	140	18	yes
GATCAGAATCCTTTGAAAAG	107	8	yes
GATCGTTGTTGCCGTGTGTG	2	2	yes
GATCTTGGGGGAGAGAGGGA	44	53	yes
GATCAGAACAGTAGAGTGGG	148	15	yes
GATCTTGGGGAGTTTGACTG	39	1	yes
GATCTTGGGCCTATTACCCA	9	6	yes
GATCTTGGGCCAAACTGGGA	9	8	yes
GATCTTGGGACTCTACTGTG	26	10	yes
GATCTTGGGAAGCAAGAAAC	85	3	yes
GATCTTGGCTCTGTGGAATG	96	18	yes
GATCCTCCCCTCCTCATCGC	265	69	yes
GATCTAAGACCCAGCAGATA	696	124	yes
GATCTAACTGTCCACATTGG	9	8	yes
GATCTTGCTTTGTGACTTTT	95	2	yes
GATCTCTTATCGTTTCTCAG	18	15	yes
GATCTCTTAGATGAAGACGA	28	2	yes
GATCTCTTAGACCCCTGCTT	80	28	yes
GATCTCTTAGAACCGTAAAG	13	2	yes
GATCCTCATCGCGTGCCTGT	6	2	yes
GATCTCTGTGTTCAGGCTCT	69	5	yes
GATCTCTGTGTGTGTGTGTG	122	4	yes
GATCTCTGTGGGCCTTTGGG	9	0	yes
GATCTCTGTGGAGGAAATGG	864	4	yes
GATCTCTGTGCTTTCTTCCT	40	3	yes
GATCTCTGTGCTGGCGCCTG	223	9	yes
GATCTCTGTGCTCTTACTTT	2	0	yes
GATCTCTGTGAGTTTGAGGG	78	77	yes
GATCTCTGTGAGCCTAGGAG	29	3	yes
GATCACTTTCACAGCTTTCT	2	1	yes
GATCACTTGGCCCAGGAGAG	261	4	yes
GATCACTTGCTGCTAGGGCA	11	1	yes
GATCACTCAGGAAAACAGGG	208	27	yes
GATCTAACTCCTGTTGCTCT	112	6	yes
GATCTTGCTTCAGCCAACGC	78	21	yes
GATCACGTCTTAGCAGTATC	733	17	yes
GATCTTGCGTGTCTCTGTGT	2	2	yes
GATCTAAAGAAACTCATCGA	8	2	yes
GATCTCAGGGAAGGGTGTAA	5	5	yes
GATCACGATGGCTATGGCGC	920	25	yes
GATCTTGCCTCGAGGCCCTC	11	6	yes
GATCTAAAAGACCTGGGACT	77	16	yes
GATCTCAGCAGCCTCGTGAA	13	12	yes
GATCACCTTTTTTGACGAGT	26	8	yes
GATCTTGCATCCGCCAGCCA	57	17	yes
GATCTTGCAGGACGTTCTCT	13	0	yes
GATCCCGGCAGCGGCCTCCC	56	4	yes
GATCTTGCAACAAACTCAGA	5	5	yes
GATCACTCCAATTCCAGGGT	2	2	yes
GATCACGTCTATGACCGGCT	26	10	yes
GATCTCTGAGGTCAAGGACA	18	17	yes
GATCGTCTGGCTCCGGCTCC	21	17	yes
GATCGTCTGCTGTGAAACGT	118	3	yes
GATCGTCCCCAAAATTGCCT	72	11	yes
GATCGTCAATCGATGTAGGA	14	1	yes
GATCACCAGGTCCCAGTGGG	2	3	yes
GATCGTACGGGGCTGGAAAC	44	8	yes
GATCACATGAGCCTCCAAAT	182	9	yes
GATCTTGACCTTATCCAGTC	19	2	yes
GATCTTGACAGGGAAGCCCT	44	13	yes
GATCGGTGGGACCCGGGCGA	235	94	yes
GATCTTGACAGGCTGGACCT	119	18	yes
GATCACAGTTAATGAAGGAA	9	3	yes
GATCGTGGGCTTCAGCACCC	28	8	yes
GATCTTGAAGAACTGCACTA	3	2	yes
GATCTTGAAATGGGCACAGC	8	7	yes
GATCTTCTTTGGGGAGGTCG	6	6	yes
GATCAAGACTTGTGCAGCAA	2	0	yes
GATCTTCTTGAGGTTTCCAT	4	0	yes
GATCTTCTTCATGGAGGACT	4	0	yes
GATCTTCTGTCTCATCCGAT	47	8	yes
GATCGGTCTGAGATGACTCC	54	20	yes
GATCTTGTACAAGGGGAGAG	15	2	yes
GATCACACTGAAGATGCCTC	26	2	yes
GATCGGCTTTGAGAGAGGGT	32	5	yes
GATCTTCTGAACATTGTTAT	9	1	yes
GATCGGCAAGCTTAGATTAC	7	6	yes
GATCAATGTAAATGGATGAC	16	13	yes
GATCCGGTCAGTGGAAACAG	14	1	yes
GATCTTCTCTACGGAAGGAT	7	0	yes
GATCTTCTCCCTGGGTTACT	1	1	yes
GATCGTCCAAAGGAATTTTC	5	4	yes
GATCTTCGTGGAGTTCACCT	60	18	yes
GATCTTCGTCCCCGACCATC	23	1	yes
GATCTTCGAGGAGGGCGAGT	71	1	yes
GATCTTCGAGACTTTGTTAG	87	10	yes
GATCTCAGCCTTCAGAATGC	5	3	yes
GATCAGAACTCTTTTTCTGT	33	13	yes
GATCTGACTGCCAAATAAAT	8	10	yes
GATCGGCAAGCTGGAAGGCT	70	17	yes
GATCAGTTGACAGTGGCAAT	631	145	yes
GATCGTAAAGTGTTTGTTGG	19	0	yes
GATCTTCCTCTAGTGTCCAA	4	0	yes
GATCTTGCTTAACTTAAAAT	7	2	yes
GATCTTCCTACAGAAAGTAG	16	13	yes
GATCGGCTCTGAAGATTTCA	104	22	yes
GATCACCAGCCTTTTGCAAA	6	6	yes
GATCGGCGGGAAATGGCGGA	230	5	yes
GATCTTGAAAGAACTCAGAG	2	2	yes
GATCTTTGAAGAGCAGGGAA	6	6	yes
GATCTACGGGGCCGGATGAG	62	9	yes
GATCAGTGACTAAGTGCAGA	12	4	yes
GATCAGGTTCAGCGTCCTCT	22	2	yes
GATCGCTCATTGGAACAGCT	271	18	yes
GATCAACTGGCCAGGAGGAG	10	8	yes
GATCAGTGTACTGTTACCCG	2	2	yes
GATCGCCGCTGGCTAGTTCC	11	9	yes
GATCGCCCTTGCTGGTCTGC	44	3	yes
GATCGCCCTGCACCAGAACT	1	1	yes
GATCTTCCAAGTCTCTCATT	21	4	yes
GATCGGAGAACCGAACTTGC	6	1	yes
GATCTTCATTTATCCTTCTT	14	3	yes
GATCTGAAGAGGCAAAATGC	12	3	yes
GATCTTGTCTCCCTTAAGGA	3	3	yes
GATCTTCAGTTTGCTTTGTG	70	4	yes
GATCTTCAGTAGTCTCTCCT	582	118	yes
GATCTTCAGGTGGCCAAGTG	32	4	yes
GATCTGAAGCAATGTGACTG	39	16	yes
GATCGTGGCGCCCACGCTTG	74	8	yes
GATCACCCTGAGTTTTGAGA	25	15	yes
GATCAACATATGGATGAGCG	11	10	yes
GATCTTCAGCTCTCAGAAGA	30	28	yes
GATCTTCAGCCTCTTGGGGA	16	3	yes
GATCTTCAGCAGCCAAGGAG	1	1	yes
GATCTTCACTCACGTCCGGC	135	16	yes
GATCGCCTGCTAGTGCGGGA	15	2	yes
GATCTTCACCGGAAGGTGCA	191	18	yes
GATCGCCTCTCAGTGCTGGT	33	3	yes
GATCTTCACAGTGCATGGCT	60	3	yes
GATCTTCAATGGCACCTTTG	11	10	yes
GATCTTCAATGGACACATTG	87	31	yes
GATCTTCAATGCCATTGGTT	8	3	yes
GATCGGGTAGCACACATCTA	10	1	yes
GATCTTGGAAGTATGCCACT	1	1	yes
GATCAGAGAATAAAGCCCTA	202	5	yes
GATCAGCGGCTTTCCAAAAA	3	1	yes
GATCTTAGCATTCTGTCAGA	19	2	yes
GATCAAACTTGAGGCCCTTC	17	3	yes
GATCTCGCTGCCTACCTCAG	59	49	yes
GATCAAACGCGATGCCTGCT	12	11	yes
GATCTTCCCAGAAACCAAGT	2	3	yes
GATCAAAAGGGACTCGTGTA	181	4	yes
GATCAAAACTGACCACTGCT	5	1	yes
GATCAAAACATGGATGAGAA	5	5	yes
GATCAAAAATCTATCTACAC	122	12	yes
GATCACAGTTGGAGTTGTAT	3	2	yes
GATCTCTTTTCAGAAGTGTC	1053	73	yes
GATCTCTTGTTTTGTGTTGT	9	1	yes
GATCACAACTAACTTAGAAC	21	10	yes
GATCTGTTGTTGTTCATGTT	4	2	yes
GATCAAGTAGATTTTTGTGG	12	10	yes
GATCTGAGCCGGTCGAGCCC	200	149	yes
GATCACTGAGGTTCAGAAAG	1	1	yes
GATCTAAGCCCTTTCTTGGC	20	5	yes
GATCACGGGACCTGCCTGTA	12	11	yes
GATCAGGGATGCAGTACCAC	36	14	yes
GATCATTCCACAATGGATGT	4	3	yes
GATCAAAGGTGGGATTTGTA	44	7	yes
GATCATTCACAGCTTAAGAT	4	0	yes
GATCACGACCCCTTTGTGGG	44	12	yes
GATCATGTTCACAACGCAGG	60	7	yes
GATCTCTGTGCTGTAAACTA	33	3	yes
GATCATGTGGAGCTTACCTT	2	2	yes
GATCGGGACCCTCACCCTTT	10	1	yes
GATCCCAAGGGGGAGGGCTC	11	9	yes
GATCCCTTTTCCATTCTGGA	116	8	yes
GATCCCTTTGGGGTGTGGGA	11	8	yes
GATCCCTTTGGGGTGTGGAA	242	15	yes
GATCTACAGGAGTGGTGATA	5	5	yes
GATCCCTTTCTCTGGCCCAG	338	1	yes
GATCCCTTTCCACCTAAAAC	37	8	yes
GATCCCTTGTGAGCCCTAGT	77	5	yes
GATCTCTCTGGAGCACAGGC	21	5	yes
GATCCCTTGTAGCCAGAGTT	36	5	yes
GATCCCTTGGGCAAGTATCA	32	6	yes
GATCCCTTGCTTGCCTCTTG	68	8	yes
GATCCCTTGCTTCAACCTCC	25	1	yes
GATCCCTTGCTACATCTCCT	6	6	yes
GATCCCTTGCCTCCTGAGTT	61	0	yes
GATCCCTTGCATTTGCAACA	53	19	yes
GATCCCTTGCAGTTCTGTGC	39	4	yes
GATCCCTTGCACACAGCCCA	59	15	yes
GATCCCTTCTGCTCTACCTC	16	5	yes
GATCCCTTCCTTTGAAGTGA	36	15	yes
GATCCCTTCCTGCCCTCTTT	126	8	yes
GATCCCTTCCCCAGCGGTTC	25	5	yes
GATCCCTTCCAGCTGAGCCC	61	8	yes
GATCCCTTCCAAATCTGCTC	113	2	yes
GATCCCTTAGGTGTAGGTCC	77	13	yes
GATCCCTTACTGTTGTGTCT	19	6	yes
GATCCCTGTTTGGACATCAG	1	1	yes
GATCCCTGTTCCCCTGAGAA	51	1	yes
GATCCCTGTGTTCTACATGG	1	1	yes
GATCCCTGTGGTCACTTAGC	49	2	yes
GATCCCTGTGGATTTTGAAA	17	0	yes
GATCCCTGTCTCGGGAGGTC	12	2	yes
GATCCCTGTCTAGTCCCTGT	101	4	yes
GATCCCTGTCCTTTCTGTTT	21	7	yes
GATCCCTGTCCCCCTACCCC	3	3	yes
GATCTTGGACCGATTGAATG	17	13	yes
GATCCCATCCACGCAGTTTG	4	0	yes
GATCTTGCTGCTGTAGGAAG	5	5	yes
GATCTTGCCCCTTGAAGTAA	15	14	yes
GATCATGGGTTGGGAGCTCA	345	60	yes
GATCATGGGGTACTCAATGC	3	3	yes
GATCAGGAGCTGGAGAGGAA	36	9	yes
GATCAGGAATTTGAGACCAG	13	2	yes
GATCCCTGTACACTATGTCT	2	2	yes
GATCCCTGGTTGCATCTTCG	17	0	yes
GATCCACAAACACACACATA	2	2	yes
GATCCCTGGTGGCTGCCCTT	126	4	yes
GATCCCTGGGTGCCAGTTTT	932	44	yes
GATCCCTGGGGGCTGTGATG	234	25	yes
GATCCCTGGGGCTGCCTGTC	45	6	yes
GATCCCTGGGGCATGTTGTA	185	40	yes
GATCCCTGGGGAGCCTGCGG	21	4	yes
GATCCCTGGGAGGATATGAG	9	0	yes
GATCCCTGGCTCAGTGAACA	68	6	yes
GATCCCTGGCGTCCCTATCA	14	13	yes
GATCCCTGGCCCCTGTGCCA	46	3	yes
GATCCCTGGCCAGAAGTACA	9	8	yes
GATCCCTGGCACTGCTGCCT	12	15	yes
GATCCCTGGCACCCAGCATC	78	3	yes
GATCCCTGGAGTGACCAGAG	952	50	yes
GATCCCTGGAGTCTCTGAAG	50	8	yes
GATCCCTGGAAGCTGTGATG	13	0	yes
GATCCCTGCTTTTGTGGCCT	32	2	yes
GATCCCTGCTTCCTGCCCAG	478	48	yes
GATCCCTGCTGTTGGCAATA	27	33	yes
GATCCCTGCTGTGGGCCTTC	31	3	yes
GATCCCTGCTCTGGACCCTC	16	1	yes
GATCCCTGCTCCCCTCTGGG	110	6	yes
GATCCCTGCTCCAGGTCCTC	177	3	yes
GATCCCTGCTAATGGAAGAA	91	4	yes
GATCCCTGCTAAAACCATGT	29	7	yes
GATCCCTGCCTGTCCTGAAA	67	7	yes
GATCCCTGCCGAGGTGCTCA	168	9	yes
GATCATGGGAGCAGGGCTCT	15	14	yes
GATCCCAGGGACTCTGTTTT	11	9	yes
GATCATGGCTTTGAGGCCAG	52	4	yes
GATCATGGCGGTCAGCAGAA	72	8	yes
GATCATGGCCTGGTGCAGTA	9	10	yes
GATCATGGCAGTGGGAGACC	56	2	yes
GATCATGGCAGGGATACGCA	15	4	yes
GATCATGGCAGGCCTTTAAC	195	21	yes
GATCAAATTTCTATGTCTGT	40	4	yes
GATCATGGAAGACGTGATGA	13	6	yes
GATCAAATCTTCCTGTGCTG	26	2	yes
GATCCCAGATTGCCAGCGTC	1	1	yes
GATCTTGAGCTGTTCACTGA	1	1	yes
GATCCCTGCCCTTTGGCCTG	30	2	yes
GATCCCTGCCCATGCTGTTC	145	22	yes
GATCCCTGCCACCTCATTGG	21	9	yes
GATCCCTGCATTTCCTCAAG	313	2	yes
GATCCCTGCATAGGACTGTT	120	11	yes
GATCCCTGCAGGTCGCTCAG	106	27	yes
GATCCCTGCAGCGCTGTTTG	157	5	yes
GATCCCTGCACAAGGTGTTT	174	21	yes
GATCCCTGAGTTTACCAGCG	43	22	yes
GATCCCTGAGTTCAAGGCTA	81	6	yes
GATCCCTGAGTTCAAGGCCA	13	12	yes
GATCCCTGAGTAAACTTCTT	10	9	yes
GATCCCTGAGGTCTCCTGCC	13	4	yes
GATCCCTCTTACCTGCAACG	534	52	yes
GATCCCTCTGGTGACTCCAC	113	2	yes
GATCCCTCTGGGTCATGTCT	586	3	yes
GATCCCTCTGAACCGCCGAG	44	3	yes
GATCCCTCTCTCTGGGGAAT	7	1	yes
GATCCCTCTAAGCCCCCTCC	79	2	yes
GATCTTCTGACTGTGGAAAC	28	2	yes
GATCATGCCATCGCAACTCA	12	3	yes
GATCCCACTTCTGCGTCTTA	133	56	yes
GATCCCACTTATAGGGCTCC	2	2	yes
GATCCCACCGCACGCTGAGC	1	1	yes
GATCCTGGGCCCTCAGATGG	153	19	yes
GATCAGCTGTCACTCCCGTC	18	7	yes
GATCATGTGATACGTAGGCA	81	10	yes
GATCCCTCGGTGACCACATT	30	6	yes
GATCCCTCCTTGTGAGCAGC	24	8	yes
GATCCCTCCTGTCACTGCAG	14	5	yes
GATCCCTCCTGGGCATTGCT	1	1	yes
GATCCCTCCTCAGGCATCTG	266	5	yes
GATCCCTCCCTTGGGCCTCC	2	0	yes
GATCCCTCCCAGAAACCTGC	807	92	yes
GATCCCTCCAGACACCAAGG	129	7	yes
GATCCCTCCACAAGATTCTG	51	5	yes
GATCCCTCAGGGTGTGTGCC	42	3	yes
GATCCCTCAGGAACAGAGGG	320	40	yes
GATCCCTCACCTCCTTCATC	116	13	yes
GATCCCTATGAAGTGTCTTA	8	1	yes
GATCCCTAGTGGCCCATCAT	12	3	yes
GATCCCTAGGGAGAAGGTGG	171	12	yes
GATCCCTAGCATTCTGTACT	860	16	yes
GATCCCTAGAGCCAGCACAT	48	2	yes
GATCCCTACTGCACCACCTT	26	7	yes
GATCCCTACTATTGATTCTG	61	0	yes
GATCCCTACTACGTGCTGGA	761	30	yes
GATCCCTACCTACAACCCTA	178	3	yes
GATCCCTACCCCACATGCTG	53	12	yes
GATCCCTACCCATGGGAATG	338	31	yes
GATCTGAGCAAGGGCAGGAA	12	14	yes
GATCATGAGCTGGAGGCACC	3	3	yes
GATCATGAGAAAGCTCAGGT	36	1	yes
GATCATGACCATAGAGCTCC	41	2	yes
GATCATGACATTGTAGCCAG	16	1	yes
GATCATGACAGTCCCCCCAC	5	5	yes
GATCCCAAGTGGCACTGTTT	7	3	yes
GATCCCAAGACGACACATGG	3	3	yes
GATCCCTACCCATGGACCCT	844	25	yes
GATCCCTACCCATACAAAAA	19	8	yes
GATCCCTACCACCTGCCCGA	609	22	yes
GATCTGCTGCGTCCGCCCAC	5	1	yes
GATCCCTAATGAGAGCAGAG	119	23	yes
GATCTGCTGAGTGCTCGGCA	5	1	yes
GATCCCTAAACTACCTCTTG	29	1	yes
GATCCCTAAACATAATTGTG	12	11	yes
GATCCCGTGTGACACATTTT	28	4	yes
GATCCCGTGGCTTGTCCTCT	6	6	yes
GATCCCGTGGACTGTTTGCT	2	2	yes
GATCCCGTCCAAGGAGCATC	481	43	yes
GATCCCGCGAGGCCCGGAAG	545	75	yes
GATCCCGCCTGCCCAGCTGA	165	13	yes
GATCCCGCCGTTCCACCCTC	7	1	yes
GATCCCGCCAAAAGAATTAC	177	1	yes
GATCAAGCTGGAGGTGCCAG	3	1	yes
GATCCCGCACATCCACAAGT	76	8	yes
GATCCCGAGATTGCCAGCCT	337	84	yes
GATCTGAGCGCTCTTTGATT	41	6	yes
GATCTGAGCCAACGCCAGAT	2	2	yes
GATCATCTGCTAGGGTGTGG	39	12	yes
GATCATCTGAAGCAGCTCAT	60	19	yes
GATCCACAAACTTCCTGACA	157	1	yes
GATCATCTAGTACGGGTACT	30	6	yes
GATCCATTGCGTAGCTGTCC	11	9	yes
GATCCCGACACCAAGGAGAT	611	30	yes
GATCCCGAATAAATGAGTGT	16	5	yes
GATCCCGAAAACCAGAACTT	12	5	yes
GATCCCCTTTTTGAACAGGT	66	19	yes
GATCCCCTTTCTTTACCTTC	24	4	yes
GATCCCCTTTACCTTCTGGG	1630	26	yes
GATCCCCTTGGTTGCTGGAT	73	11	yes
GATCCCCTTCTCAGGGTCTA	299	13	yes
GATCACAAGGCGACTGAGTA	5	1	yes
GATCCCCTTCCTACCTCTAG	163	30	yes
GATCTGAATTCTGAAGCCTG	7	4	yes
GATCCCCTGTTGACTTACAA	5	1	yes
GATCCCCTGTATATGTTGAA	111	6	yes
GATCCCCTGGGTTGAGAGAT	56	12	yes
GATCCCCTGGGGCAAGCTGC	172	17	yes
GATCCCCTGGGAGGAGACAG	20	1	yes
GATCCCCTGGCAAGAAGGAA	2	2	yes
GATCCCCTGGATACATGGTC	51	17	yes
GATCCCCTGCTACACTGATG	17	2	yes
GATCCCCTGCTAATGAAAAT	11	2	yes
GATCCCCTGCCTCAGCTCCT	86	19	yes
GATCCCCTGAGATGGAATTA	3	3	yes
GATCCCCTCTTCCCAAATAA	133	7	yes
GATCCCCTCTGTGGGTATGA	84	11	yes
GATCCCCTCTGGGCCTCCGA	27	1	yes
GATCCCCTCTCCTGCCCACA	63	3	yes
GATCCCCTCGGACCCCCTTG	59	7	yes
GATCTCTTGTTCTTCTCTCC	27	23	yes
GATCCCCTCCTTTCTGCCTG	13	2	yes
GATCCCCTCCTCCAGGCAGT	74	8	yes
GATCCCCTCCCTTGCTTTCT	161	1	yes
GATCCCCTCCCTCTGATTTT	92	6	yes
GATCAATTTACCCGACTTCA	13	11	yes
GATCCCCTCCCACAGAATAG	3136	140	yes
GATCTCTTCTCATGACTTGG	12	1	yes
GATCCCCTCACATGTGCTAT	148	17	yes
GATCCCCTATGGGGAGGAGG	76	4	yes
GATCCCCTATGCAAGCTGTG	107	46	yes
GATCCCCGTTGTACCTGGTG	5	5	yes
GATCCCCGTGTGTTTGCAGG	28	4	yes
GATCCCCGTGCCCCTGCCTA	103	9	yes
GATCTTTCTCTAGGGGGTCC	210	3	yes
GATCTTCAGATATGGACCAG	24	8	yes
GATCTTCAGAGCTACCCAAC	12	1	yes
GATCTTCACTGCAGATGTGG	457	43	yes
GATCCATCTGCCTTCTCCAG	2	1	yes
GATCAAACTGAATGAAACAC	117	56	yes
GATCAAGAAGAGTCAAATGG	6	5	yes
GATCCCCGTCTGTGTCTGTG	23	13	yes
GATCCCCGGTGCTCTTCGTG	15	0	yes
GATCCCCGGGAAAGTGTAGT	4	5	yes
GATCCCCGCAAAGTGAGCGA	1	1	yes
GATCCCCCTTTGCTGCCTCC	52	9	yes
GATCCCCCTGATGGAGAGAA	51	2	yes
GATCCCCCTCCCTGCTCTCA	4	4	yes
GATCCCCCTCCCCCCAGTGG	471	109	yes
GATCCCCCCCTTTTTTTGTC	302	18	yes
GATCCCCCCCAGCACACTCT	34	0	yes
GATCCCCCCACCCCACCACC	95	1	yes
GATCCCCCCAACTGTGTGCC	4	0	yes
GATCTCTATCATGTATCCTC	6	0	yes
GATCTTGTTGGCCCATCTAT	35	4	yes
GATCCCCCAGGTCTCAGAGG	149	3	yes
GATCCCCCACCCCCACCCCC	25	30	yes
GATCCCCCACATCCTGGGGC	105	18	yes
GATCCCCATTTGCAGTAAGA	39	2	yes
GATCATCACCTGACCCACTT	6	2	yes
GATCATATGGGTGATTCAGT	20	8	yes
GATCATAGTTGTTAGACTTT	7	2	yes
GATCCCCATGTTGAGCTCTG	20	3	yes
GATCCCCATCTGCAGTACAA	15	14	yes
GATCCCCATCTGACTCAGTA	197	7	yes
GATCCCCAGTCTTTAGTCCC	582	43	yes
GATCCCCAGTATGCAGTAAT	6	6	yes
GATCCCCAGGGGCTCCCGGT	57	3	yes
GATCCCCAGGAGATGAGGTC	29	3	yes
GATCCCCAGCCTTGGATAGT	158	6	yes
GATCCCCAGCAGTAACACTT	75	10	yes
GATCCCCAGCACAGGAAGGC	155	25	yes
GATCCCCAGAGTCCCCTGTG	32	2	yes
GATCCCCAGAGCCTTGGGGA	3	3	yes
GATCCCCAGAATCCCCAATA	4	4	yes
GATCCCCACCAGCCACCCCC	253	30	yes
GATCCCCACAGCTGCGTATG	416	17	yes
GATCCCCAAGTCTGTGACAC	43	7	yes
GATCTCCATGAAGGCTGTTT	15	14	yes
GATCCCCAACCCCCCAAAAA	18	17	yes
GATCCAAACATTCCAAGAAA	50	9	yes
GATCCCCAACAATGTGAAGA	964	5	yes
GATCCCCAAAGGGCAGGTCC	325	81	yes
GATCCCCAAAGCCTGGAGCC	315	9	yes
GATCCAGTGTGGGGCAGCGC	53	31	yes
GATCATACCCACGTTGCCCA	15	13	yes
GATCATAAGTTCAAGGTCTT	40	6	yes
GATCATAAGAGGCACGTGAT	62	3	yes
GATCATAAACCTTGCCTGGA	233	4	yes
GATCAGTTTGTGCCCAACAG	5	4	yes
GATCAAAACAAGACCCAGCT	26	1	yes
GATCCCATTTTTGACAGCAA	116	3	yes
GATCCCATTTACTATTTGAA	5	5	yes
GATCCCATTGGAGCTCTGTT	9	6	yes
GATCCCATTACTTAAGTCCT	42	1	yes
GATCCCATGTTCAAGCTGGT	21	6	yes
GATCCCATGTGTTTAGTAAT	4	3	yes
GATCCCATGTGTCTTTTTGC	132	2	yes
GATCCCATGTGCCACCATCA	164	11	yes
GATCCCATGTCCTGCTTTCT	16	3	yes
GATCCCATGTCCTGCTAAAA	3	3	yes
GATCTCAGTTGTGACATTCT	15	4	yes
GATCCCATGCTTTGAAAAAT	23	1	yes
GATCTCAGTCTTAAGGCCCT	2	2	yes
GATCTCAGTCCTCCAGCCTT	2	2	yes
GATCAGGTGGAATTACTCAA	2	2	yes
GATCCCATGCTAGCCTCTTG	301	17	yes
GATCCCATGCCTGGAATTTG	21	6	yes
GATCCCATGCAGAGCGGCCT	19	6	yes
GATCCCATGATGGAAATATT	27	1	yes
GATCCCATGAATCATTTGCC	26	5	yes
GATCCCATGAATACAAACAG	2	2	yes
GATCCCATGAAATCCCCAAA	142	1	yes
GATCCCATCTCCTGGAAGGA	124	16	yes
GATCCCATATCCCTGTGAAA	48	7	yes
GATCCCATACCTGACATGAC	7	1	yes
GATCCCATACAATGCCGCCC	85	14	yes
GATCTATTTCTTCAAGGAAA	7	1	yes
GATCCCAGTTTGCTTCATGA	165	2	yes
GATCAGTTACTTACCCACTC	26	0	yes
GATCCAGGTGTGAGATGATG	15	4	yes
GATCAGTGGGTGCCCGTGAT	4	3	yes
GATCAGTGCTGGGAATACTG	8	4	yes
GATCAAGGCCACGGGGAGGA	68	35	yes
GATCCCAGTTCAAGAGGGGT	4	0	yes
GATCCCAGTGTTGCTACGTG	332	13	yes
GATCCCAGTGTGAATCATGG	69	1	yes
GATCCCAGTGGTATTCCGCC	9	3	yes
GATCCCAGTGGATGAAGTGT	72	23	yes
GATCCCAGTGCTGTGGAAGT	116	3	yes
GATCCCAGTGCTGGTCAGTT	61	5	yes
GATCCCAGTGAGATGCTGGT	39	0	yes
GATCCCAGTGAAGGGTTTCT	39	4	yes
GATCCCAGTCTGAGTGATTA	1	1	yes
GATCCCAGTCCTCCTGGGCA	32	6	yes
GATCTAGGCCTTGTGGCTTG	30	16	yes
GATCCCAGTAATGTAAACAA	32	0	yes
GATCCCAGGTGTCCCCATTT	31	1	yes
GATCCCAGGTGGAGCAACCC	184	31	yes
GATCCCAGGTCCCTCTGGGA	750	19	yes
GATCTAGATGAGTCTTTCAG	5	5	yes
GATCCCAGGGTTTTCTTGGT	22	5	yes
GATCCCAGGGGTCCTAGGGG	104	0	yes
GATCCCAGGGGCTCTTCTGC	35	12	yes
GATCCCAGGGAAAGTGCTAT	103	15	yes
GATCTACTTGGAGACTTTGG	29	1	yes
GATCTACTTACTGGTGTCTA	5	5	yes
GATCTACTGTTGGTGGGTCA	6	0	yes
GATCCCAGGCTAGCAAGCAA	111	8	yes
GATCCCAGGCAAGGGATGGT	7	0	yes
GATCCCAGGAGTCAAGCTCT	115	12	yes
GATCCCAGGAAGGACCATCA	11	10	yes
GATCCCAGGAAAGTTCTAAT	165	31	yes
GATCCCAGCTATGATGTAGC	35	8	yes
GATCCCAGCCCTGGCTCCCC	729	33	yes
GATCGTGTTTTTAAAGCATC	63	4	yes
GATCGTCTTGCTCAGGTGTC	12	3	yes
GATCAGACCTTAATGCCACT	5	6	yes
GATCGTCCACCTTGGAAGGC	2	2	yes
GATCGTCACAAGGCGATTCC	4	4	yes
GATCGTAACTGAGCTTCTGA	5	1	yes
GATCCTACTATGAGCAAAAA	123	34	yes
GATCGGGGCAGATGGGCTTT	2	2	yes
GATCGGGGCACCAGGAACAC	36	7	yes
GATCATCTTCATTCACAGTT	2	1	yes
GATCCTCAACCTGGACCCAG	21	4	yes
GATCGGAACCATTGCCTTCC	4	4	yes
GATCGGAACAGTATCCGCTA	3	1	yes
GATCGGCTCCATGAGCGGTC	43	6	yes
GATCACTGTCAAAATACAGG	32	6	yes
GATCGCGTCTGTTCCAAGGG	5	1	yes
GATCGCGAACTGCTTTGACT	36	1	yes
GATCGCCGTGGTAGGGGCCA	8	1	yes
GATCGCCGGGCGGGGCGTGG	7	6	yes
GATCACTCTTGTACAGTTGG	1	1	yes
GATCGAGGAAGATAGTGAGG	8	1	yes
GATCGAAGATGCCTCGGGCC	74	1	yes
GATCAATGTCTCCACCTTCC	29	6	yes
GATCGAGAATTTAGTTTTTG	4	4	yes
GATCGAGAAGCCCGCAAAGA	7	6	yes
GATCGCTCACTGACATCTAC	30	7	yes
GATCGACATCTACGTGCAGG	17	2	yes
GATCCTTTCGATGTTTGTTT	3	3	yes
GATCCTTTCCTTAAAGGTCT	7	1	yes
GATCCTTGTACAGAAATGGA	4	0	yes
GATCCTTGGACTTCCCATTC	16	1	yes
GATCCTTGCAGTGGTTGAAG	20	3	yes
GATCCTTGACTTAAGCCTTG	3	3	yes
GATCCTTAGTGCTTATCATC	6	6	yes
GATCTCTGTCTTTCCCTGGT	31	1	yes
GATCTCTGTCATTGTTTACA	65	15	yes
GATCTCTGTCACATCCGATG	211	33	yes
GATCTCTGTATGTTCGAGCC	110	31	yes
GATCTCTGTAAACAGTTTGG	38	35	yes
GATCTCTGGTTGCTTTCAAG	24	2	yes
GATCAAGATTTCCTAATTAT	6	3	yes
GATCAAGAGGTGAGGAGAGG	21	1	yes
GATCTCTGGGGCAGACGGTG	2	3	yes
GATCTCTGGGCAGTCATGGT	31	1	yes
GATCTCTGGCTCTTCATCCT	60	2	yes
GATCTCTGGCCTGTGGAGTA	222	42	yes
GATCTCTGGCCAGGCAAGTT	56	8	yes
GATCTCTGGATGGAAATGTA	38	9	yes
GATCTCTGGAGGTCCCGGTG	14	5	yes
GATCTCTGGAAGGTGAGCCT	124	10	yes
GATCTCTGGAAAATTGCCAT	30	8	yes
GATCTCTGCTGTGGGAAAGG	298	19	yes
GATCTCTGCTGTCGGTTTCT	26	4	yes
GATCTCTGCCCCAAATCCAA	1	1	yes
GATCTCTGCCCAAACCAGGC	147	8	yes
GATCTCTGCCACCCACCCAC	49	5	yes
GATCTCTGCAGCTGGAGTCT	42	7	yes
GATCCGAGTGTCCCCTCTGC	18	3	yes
GATCCTGTGAGTAAGTACTG	24	6	yes
GATCCTGTCGCTGGTCGGCG	36	3	yes
GATCCTAAGATGCCTCAGGT	6	2	yes
GATCCTAAGAGTGGTTACAA	2	2	yes
GATCTCTGCAAGCAGTTGTC	19	0	yes
GATCTCTGCAAAATAGACTT	6	0	yes
GATCTCTGATGGCTGGGGAG	291	12	yes
GATCAAAAGGTAAAGGCCAG	36	31	yes
GATCTCTGAGGAGGTGGCTC	59	7	yes
GATCTCTGAAGTCTGAAGAC	418	15	yes
GATCTCTGAAGAAAAGCAGA	12	3	yes
GATCTCTCTTGTTGGAAGGA	31	1	yes
GATCTCTCTTCCCAGAGGAA	567	53	yes
GATCTCTCTGGAACTATCTA	44	3	yes
GATCTCTCTGCTCATACCCT	44	13	yes
GATCTCTCTGATGAAGAAAG	13	2	yes
GATCTCTCTCCTTGGCCTTC	5	4	yes
GATCTCTCTCATTCAACTTT	5	1	yes
GATCTCTCTCATCGAGAGCA	6	6	yes
GATCTCTCGTGTGCCTTTGG	66	2	yes
GATCTCTCGAGCAGCAGCAG	51	5	yes
GATCTCTCGAGAAATAAATG	24	20	yes
GATCCGGCCTGTGCTGCTGC	67	15	yes
GATCTCTCCCGTTCTCAGCA	29	3	yes
GATCTCTCCCCAGAGCAACG	39	4	yes
GATCTCTCCATATCAAGCGA	1416	179	yes
GATCTCTCCATATCAAGCAA	12	14	yes
GATCTCTCCAAGCTCACAAG	14	1	yes
GATCTCTCATTCCCAAGTAA	2	2	yes
GATCTCTCAGGCCAGGATTT	62	1	yes
GATCTCTCACTGGACCAGCG	26	2	yes
GATCTCTCACAGACCTGGTC	39	9	yes
GATCTCTCAAATCTTGGATT	34	6	yes
GATCTCTATCCTAACGTCCA	21	19	yes
GATCTGTTAAACCCTTGAAT	2	2	yes
GATCTCTATCACCGCAGGAA	28	2	yes
GATCTTTTACAGTGTACAGT	1	1	yes
GATCGACAAATACCTGGAAG	2	2	yes
GATCGAAGGGGAAGGGCTGC	1	1	yes
GATCCTTTTCAGACTGGCTT	17	4	yes
GATCAAGGAAAAGGAACCCA	124	23	yes
GATCAAGATAACGGTGGCTT	137	7	yes
GATCAAGAATACAGTGCATT	1	1	yes
GATCTCTAGAAAAGTCGTTT	115	17	yes
GATCTCTACTTTGGAGTCCT	60	16	yes
GATCTCTACTGGCAGGCCAT	147	16	yes
GATCTCTACTGCTGTTAGGT	48	1	yes
GATCTCTACTCCCAGGAGAT	119	6	yes
GATCTCTACCCAACTGTCCA	23	5	yes
GATCTCTACCATTTGATTAA	6	7	yes
GATCACGTGTACTATTTCCT	20	0	yes
GATCTCTACCACCCAGGTAG	162	42	yes
GATCTCTACCAATATTCTCA	12	3	yes
GATCTCTACAGTATTGTGCT	2	0	yes
GATCTCTACAGACAAAATCT	86	3	yes
GATCTCTAAACTGTGACACA	74	14	yes
GATCTCGTTCATTGGCAAAA	115	13	yes
GATCTCGTTCAAAAAAAAAA	26	6	yes
GATCTCGTGCAACTGTTGTC	358	36	yes
GATCTCGGTTTCGTTTCGCT	14	1	yes
GATCTCGGTCTGTGCCGGGG	125	29	yes
GATCTCGGCCTCACAAATCC	100	16	yes
GATCTCGGAAAATGGTAACT	51	3	yes
GATCTCCTTTGTGAATGGTG	13	6	yes
GATCTCCTTTATTCTGCCCT	23	1	yes
GATCTCCTTGGGGAGGTGGG	26	0	yes
GATCCCACTGTCACCCTCGC	79	18	yes
GATCTCCTTGGAGTCTCAAG	778	13	yes
GATCCCTTCCTCCTTTAGTT	7	2	yes
GATCTCCTTCCTTAGGTTAT	10	9	yes
GATCTCCTGTTGTCTGGGCT	24	7	yes
GATCTCCTGTGTTCGTCTTT	1728	100	yes
GATCTCCTGTGAACACCACA	68	16	yes
GATCTCCTGTCTGAGGTGTC	9	2	yes
GATCTCCTGTCTATGTGGGC	48	9	yes
GATCAGTGCAGGCCCACAAA	2	2	yes
GATCTCCTGGTCAGGAAGAA	74	2	yes
GATCTCCTGGGCTGTTTCTC	102	8	yes
GATCTCCTGGAAGCTAGCAG	77	1	yes
GATCTCCTCTTCGGGGTTCT	53	3	yes
GATCTCCTCGCTGGAAAAAG	2	2	yes
GATCTCCTCCTTGCTTTCCT	19	0	yes
GATCTCCTCCTTATTCCCCA	47	8	yes
GATCTCCTCAGAGAAGTCTG	15	4	yes
GATCTCCTCACATACAGCAT	5	1	yes
GATCTCCTAGGAGTGGAGTT	25	3	yes
GATCTCCGTCCCTCAGCTCC	699	81	yes
GATCGCAGAGAGGCGAGAGC	73	24	yes
GATCTTACTTAGCATGCACA	12	1	yes
GATCTTACTCCCTTAGTATA	6	5	yes
GATCCCTGTCCCCACGAGGA	42	7	yes
GATCCCTGGGAACTGGAGTT	52	4	yes
GATCTCCGAACAGCAACACG	67	3	yes
GATCTCCCTTTGTACTGTCT	12	11	yes
GATCTCCCTTTCCTGTAGAG	30	2	yes
GATCTCCCTTGGAATGTGTA	9	1	yes
GATCTCCCTGTTCTGGACTC	23	11	yes
GATCTCCCTGCCCCTGAGCC	84	57	yes
GATCTCCCTCTTGGAGGCCA	19	10	yes
GATCTCCCTCTGAACACCTG	5	5	yes
GATCTCCCTCTAAATATTTC	162	15	yes
GATCTCCCTCGTGCAGTGGC	8	5	yes
GATCTCCCGTGTTACCAATG	116	108	yes
GATCTCCCCTTTGTAGGACT	3	2	yes
GATCTCCCCTGGACCAAAGG	91	18	yes
GATCTCCATTCTATGTGTAA	38	9	yes
GATCCTTTCCTCCGAATAAA	7	2	yes
GATCCTTTCAACTCAAAAGC	30	0	yes
GATCCTTGGTGTAGCTTCTG	12	3	yes
GATCTTATTGGACAGTATTG	14	1	yes
GATCTTATTGCCAAGTTCCT	12	5	yes
GATCTGGGTCTATAAACTCT	60	9	yes
GATCTTATCTTGCCAGGCCG	58	2	yes
GATCGCATACATCATGACTG	2	3	yes
GATCTTAGAGAAAGGCCAAC	50	5	yes
GATCTTAGACTTGTTCCAGC	1	1	yes
GATCGCAGCACTGAAAACAA	22	6	yes
GATCCCTATAGCCTACTCTG	9	6	yes
GATCTCCATCTTCCAAATAC	5	1	yes
GATCTCCATCGTGCAGGGAT	96	12	yes
GATCTCCAGTCCAAGGCTTC	68	8	yes
GATCTCCAGTAACCTTTGTC	7	2	yes
GATCTCCAGCTTCTCTGCCT	6	0	yes
GATCTCCAGAGTCGCTTGGA	14	3	yes
GATCTCCAGAGGAACACCAG	44	7	yes
GATCTCCAGAATAGACCTGG	28	10	yes
GATCTCCAGAAATCTCCTGC	49	5	yes
GATCTCCACTTTCTACAACA	45	8	yes
GATCTCCACTTCAAGCCTTT	2	2	yes
GATCTCCACTCTCCCTCTGG	24	4	yes
GATCTCCACGGGTGCTTAGT	159	23	yes
GATCTCCACATCTCCAAGGA	3	3	yes
GATCTCCACATCCTAACCCT	6	0	yes
GATCTCCACAGCGTGTTCAT	119	14	yes
GATCTCCACACAACAGGTGA	9	2	yes
GATCTCCAATGTTGTGCTAA	2	0	yes
GATCTCCAACATTTTGGAGG	28	26	yes
GATCTCATTTTAACATCCAC	28	6	yes
GATCTCATTTGGAAGATGAG	9	8	yes
GATCTCATTTCTAGTTTCCA	6	0	yes
GATCACAGCCAGTTCAAAGC	7	1	yes
GATCACAGCAGTAAATGTGA	255	25	yes
GATCACAGCAGCTGAGCTGT	141	9	yes
GATCACAGATTTAAGGGGAG	19	18	yes
GATCACAGATTGCTTCTCTG	22	0	yes
GATCACAGATGTAAGAATGG	32	30	yes
GATCACAGATGATACTGAGT	30	3	yes
GATCAAACGAGGAAACGTAT	22	0	yes
GATCACAGAGGGACACACTA	68	1	yes
GATCACAGACTTCGGCCTTG	156	22	yes
GATCACAGACATTAACAAAA	14	13	yes
GATCACAGACACCTGCACTG	249	3	yes
GATCACAGACAAGAAATACC	8	7	yes
GATCACAGAAGTGAGCGGAT	2	3	yes
GATCCTTCTTTACGTGTCTA	15	13	yes
GATCCTTCTGCAGACACCGA	65	7	yes
GATCCACCACCCAGAGTAAT	3	1	yes
GATCCTTCTCAGAAGAGTCT	98	40	yes
GATCACACTTCCCACAACCC	3	3	yes
GATCTTACCCGGGACAAAAT	2	2	yes
GATCTTAATGGCATCTATCT	7	8	yes
GATCTGCAATATTTTTAGGT	16	7	yes
GATCAGACCCAAACATTTTA	70	37	yes
GATCTTAAATGGCGTAGTAT	193	26	yes
GATCACAGCAGAGATGGCCA	129	15	yes
GATCTTAAACCCAAAGTATG	28	5	yes
GATCTGTTTCCCTTCTGTTC	19	16	yes
GATCTCATTGTTCTTGGAGA	14	5	yes
GATCATCCTGGTTGTTATGT	58	8	yes
GATCTCATTCTTTCATGGAT	1	1	yes
GATCTCATTCCGGATGAAGC	18	0	yes
GATCTCATTCCCGAGAGAGG	33	2	yes
GATCTCATGTGTGGGAACCA	190	2	yes
GATCTCATGTCTCTGGAGGA	29	3	yes
GATCTCATGGCATGCTCTGA	138	29	yes
GATCCTGCATCTTTAGTGTT	4	4	yes
GATCTCATCCTCTCACCTCC	2	1	yes
GATCTCATCCATTGAATTTG	187	18	yes
GATCTCATCAGACAGTAGAA	69	11	yes
GATCTCATCACTTTTATCCA	17	16	yes
GATCTCATCACAGGAGCATC	30	10	yes
GATCTCATATGTCTTTTTAT	3	4	yes
GATCTCAGTTTGAGTGGATG	79	2	yes
GATCTCAGTTTCGCTGATGT	22	2	yes
GATCTCAGTTCTGTGTTTAC	233	10	yes
GATCTCAGTTCACGGGGTGG	40	13	yes
GATCTCAGTTCAACAGCTCC	236	39	yes
GATCTCAGTGTGGAGAGCAT	51	11	yes
GATCTCAGTGGGGGTGGGAG	143	57	yes
GATCTCAGTGCTGGGGAGGT	71	3	yes
GATCTGCAAACATGATGAAT	2	2	yes
GATCACACTGATGGAGCTGT	21	1	yes
GATCACACTGAGCAACACCC	10	8	yes
GATCACACGGCAAAACAGTA	25	7	yes
GATCACACCTTGCTGTTCCC	4	3	yes
GATCACACCTGTCCCTACAC	169	4	yes
GATCACACCTGCAGTTTGGG	16	1	yes
GATCACACCGAGATTCTTTT	4	3	yes
GATCACACCGAGACCAGTGG	79	10	yes
GATCACACCATTGAGTTCCG	65	3	yes
GATCACACCAGTCCTGTGAG	68	13	yes
GATCACACCAAGCCCCAGGA	4	4	yes
GATCACACATTTGCAAGGGA	184	7	yes
GATCTGAGCCTTTGACAGAT	2	2	yes
GATCACACAGATGTTTTCTA	2	2	yes
GATCACACACTCAGTCCTTG	87	3	yes
GATCACACACGGCAACCGAC	27	3	yes
GATCACACAAGTGTGGGTTT	138	7	yes
GATCACACAAAACTGTCAGC	9	2	yes
GATCACAATCTAGTCAATGC	3	3	yes
GATCACAATCAGGAACTCAC	5	1	yes
GATCACAATACAACTTTATG	22	4	yes
GATCACAAGTTTGCATTCAG	8	5	yes
GATCACAAGTTTGAGACCAG	20	7	yes
GATCACAAGTTGTTTCCTGT	100	2	yes
GATCACAAGTTAAGGTCAGC	94	18	yes
GATCACAAGTGCAGCATTCT	99	9	yes
GATCACAAGGTTTACATCTG	9	4	yes
GATCCTTCATGTTGAGCCAG	207	30	yes
GATCACAAGGGGGTAATCAA	342	54	yes
GATCACAAGGCTGAAAACAA	95	1	yes
GATCACAAGAGTTACTAGTT	2	2	yes
GATCCTTGGGGTCTTAGGCA	22	2	yes
GATCTGTTGTTTGCGTTGAA	4	2	yes
GATCTGTTGTGCTTGAATGA	30	10	yes
GATCTGTTGGTGGTATAGGC	164	13	yes
GATCCTTGGAATAGTCCAGT	7	6	yes
GATCCTTGACTCTCAAGCCC	2	1	yes
GATCCTTCTGTCGGCTTCCT	36	1	yes
GATCCTTCTGTCCTGGATTT	21	4	yes
GATCTGTTCAGCACACCTGA	274	165	yes
GATCTCTTGAAACAGCTTTA	50	10	yes
GATCTGTTACTTTGGCGAGG	53	2	yes
GATCTGTGTGTCATCAGATG	56	6	yes
GATCCTTCTCTGCCCTTCCC	27	4	yes
GATCTGTGTGGGACCAAGGC	125	0	yes
GATCTGTGTGGCTCCTCTGC	45	38	yes
GATCTGTGTGGATGTCCTGA	95	7	yes
GATCCTTCCTTTCCCTTGGC	331	17	yes
GATCCTTCCTTCTTCTCTTC	173	10	yes
GATCTCAGTAACTGTCGAGC	64	19	yes
GATCTCAGGTGTTTGGTCAT	16	1	yes
GATCTCAGGGTTCCCATGGT	13	0	yes
GATCTCAGGATTTGTTGGGG	22	4	yes
GATCTCAGCTTGCATAGCAT	243	24	yes
GATCTCAGCTGATGGATGGT	5	5	yes
GATCTCAGCTGACTCCTTTT	100	4	yes
GATCTCAGCTCCACTGTGAA	40	7	yes
GATCTCAGCTAAACTTTCAA	3	3	yes
GATCTCAGCACTGTGGCTGT	54	22	yes
GATCTCAGATTTAATGCTCT	12	1	yes
GATCTCAGATAAAAACTTGT	8	5	yes
GATCTCAGACAGCTCTGTGT	133	34	yes
GATCTCACTGTTTCATGCTG	125	9	yes
GATCTCACTGCCTCCCTCTC	104	61	yes
GATCTCACTCAGCAACAAGT	75	4	yes
GATCTCACGGGCCGACCGAG	71	9	yes
GATCACAAGAGGCCCGTTTG	170	3	yes
GATCACAAGAAGTTAGTTTG	101	21	yes
GATCGGGGGGATGACCAGCT	51	13	yes
GATCACAACTTTTGATTTTT	25	9	yes
GATCACAACTTTAATCCCAG	3	3	yes
GATCACAACTTCTGAAACAC	32	2	yes
GATCACAACTGTAGGGAATA	170	11	yes
GATCACAACGGCTTGCGTGT	166	17	yes
GATCACAACCCTGATGGCAG	279	32	yes
GATCACAACCCCCAAGTCAG	59	7	yes
GATCACAACCCAGATGAAAT	16	5	yes
GATCCTGTTTGTTGCACACA	18	22	yes
GATCACAAATACAGATTCTG	425	17	yes
GATCACAAAGTTTGAGAATG	1449	45	yes
GATCCTGTTGTGTGTTTGCA	51	26	yes
GATCACAAAGGTGGAATGTT	217	27	yes
GATCACAAAGAACAAGTGTA	41	3	yes
GATCACAAACTTCTGCAAAA	25	3	yes
GATCACAAACATCACAGAAG	20	3	yes
GATCACAAAATGAGTCACTC	6	5	yes
GATCACAAAAGGCTGTTTTG	47	14	yes
GATCAATGTGTAGTTACTGT	79	10	yes
GATCAATGTGGAATTTTCTG	11	4	yes
GATCAATGTGAGGATGTCTT	8	7	yes
GATCAATGGGCAGCAGCAAT	63	1	yes
GATCAATGGCTTTGATGCAG	1	1	yes
GATCTCGCTCTCCTGGAGGC	19	7	yes
GATCTCCTGTCTGCACTGTT	309	56	yes
GATCACAAAAACTGAAGGTG	2	2	yes
GATCTGTGTATACCCCACTC	68	3	yes
GATCTGTGTAGAACACACAT	8	0	yes
GATCTGTGGTGCTAACCCAA	1	1	yes
GATCTGTGGTCCCTGCCTCC	6	4	yes
GATCCTTACATCAACCTGGC	7	6	yes
GATCCCAGGTGGGAGGTTCC	2	2	yes
GATCTGTGGGGTGCCCAGAA	3	1	yes
GATCTGTGGGGAAGGGGGCT	87	2	yes
GATCTGTGGGGAAAGATAAA	4	5	yes
GATCTGTGGAGTTTTTCTCC	5	2	yes
GATCTGTGGACGACGAGAAC	1391	119	yes
GATCCTGTGTGTTCCCTTCT	7	1	yes
GATCCCCCCCAAAATGGAAT	2	2	yes
GATCTGTGCCATCCCATACA	137	2	yes
GATCTCACCTTCAAGGTTCT	2	1	yes
GATCTGCTGGGCGGTAGTGG	20	7	yes
GATCCCCATGGACTAAGGCT	49	8	yes
GATCTCACCGTGAGGCCCCG	59	9	yes
GATCTCACCCCTGGGACATT	5	4	yes
GATCTGTAAGGGTCTGAGGA	3	3	yes
GATCTCAATTGTAAATAGAA	5	5	yes
GATCTCAATGAAGTAGCTAA	10	1	yes
GATCTCAATGAAAGAGGACT	132	26	yes
GATCTCAACTGACTCCTCTT	663	56	yes
GATCTATTTTCTCACTTCTA	29	1	yes
GATCTATTTTCCTAACCGTT	91	8	yes
GATCTATTTTACAAGTGCAT	204	5	yes
GATCAATGCAATGACGTGGG	223	17	yes
GATCAATGCAAAAATCACCG	16	14	yes
GATCAATGATGAGGACAAAC	2779	138	yes
GATCAATGAGGCCTTTGCAA	35	29	yes
GATCAATGACAGAGTGAGGT	31	6	yes
GATCCTGGTAGGAGCACTTG	121	85	yes
GATCAATGAAGTAGATGCGG	8	7	yes
GATCCTGGGTACTGCACAGT	620	79	yes
GATCAATCTGCCTGTTTTCA	19	16	yes
GATCAATCCTCATAATTCAA	10	8	yes
GATCAATCCAGTTGGTTTTG	7	6	yes
GATCAATCCAGGAGTCTCTG	58	49	yes
GATCTCAGCTCAGGTGTGTT	29	1	yes
GATCTCAGCCTCCTGCTCAG	2	2	yes
GATCAATCATTTCTGCATTA	4	3	yes
GATCAATCACATGGACACTA	146	12	yes
GATCTGTGATTTGCTTCTAT	15	0	yes
GATCCTGGTGGGCACGGGGT	56	0	yes
GATCCTGGGGTTGGACCCCA	26	17	yes
GATCTGTGACACATCATTTT	7	1	yes
GATCCTGGGGCTGGAGAAGT	45	10	yes
GATCCTGGGACATAATCACC	31	5	yes
GATCCTGGGAAGCCTCCTCA	117	8	yes
GATCTGTCTCGGGAGCAGCT	77	3	yes
GATCTGTCTCAACAGTCTGG	66	2	yes
GATCTGATTGAAGTAAGAGA	9	2	yes
GATCTGATTCTAGAGCACTT	11	2	yes
GATCTATGATGCGGAGAAGC	4	4	yes
GATCAATATGGGGAAAGCAG	40	33	yes
GATCAATATCTGCTTCCAGA	15	13	yes
GATCAATATCACCCAAACCT	101	57	yes
GATCAATAGGGAAACACAGG	32	4	yes
GATCTTTTGAACTCCTCCAT	1	1	yes
GATCCTGGAAACCCTGAAAC	2	1	yes
GATCGATGGATTTTGGTTAA	1	1	yes
GATCAATAAAGTTTCCTCTG	33	9	yes
GATCAATAAAGTGGGTTTTT	87	0	yes
GATCCTGCGGGTGGGAGGAA	58	2	yes
GATCCTGCCTTGAATTCCTG	12	2	yes
GATCAATAAACCGTTTTGAT	5	5	yes
GATCCTGCCTCTGCGCAGTG	21	2	yes
GATCGCGAAAGTGGGCCAGA	4	4	yes
GATCAATAAAAACGTCCCTC	82	7	yes
GATCAAGTTTTGGCTCTTGG	41	16	yes
GATCAAGTTTGTGGTGTGTT	67	7	yes
GATCAAGTTTGGTGTTTCCT	4	5	yes
GATCAAGTTTGGGCCTGGCA	21	2	yes
GATCAAGTTTCAGGAAGGCT	21	0	yes
GATCAAGTTTCACATCCTTC	174	5	yes
GATCCTGCATATCTCAAAGA	21	7	yes
GATCCTGCATACCAACGGCC	24	7	yes
GATCCTGCAGCAGGAGTGCA	8	2	yes
GATCTGTCCTGATGAAGGCT	452	26	yes
GATCCTGCAAACTTCCCTGG	55	47	yes
GATCCTGATTTAGGAAGTGT	56	6	yes
GATCTGTCCATCTTGGAGTT	264	22	yes
GATCCTGCTTGTATGTATCT	3	3	yes
GATCTGTCATGTCGGAAAGC	5	1	yes
GATCTGTCAGTGTTATGGAA	65	12	yes
GATCTGTCAGCTGTGCTCTC	35	1	yes
GATCTGTCAGCTCGCCAAGG	15	11	yes
GATCCTGCTCAGACCATACC	10	2	yes
GATCCTGCCAGCCAGACCAA	289	2	yes
GATCTGTATCCCTTTACTGT	8	10	yes
GATCCTGCAGACACTCAGAG	29	14	yes
GATCTCTGCTTTGCTAGGGG	42	3	yes
GATCTCGAGATAACTTGGAG	7	6	yes
GATCAAGTTGTATTAGAAAT	2	2	yes
GATCAAGTTGGTCTGAGGAG	2	1	yes
GATCAAGTTGCCAGCATTTG	24	20	yes
GATCAAGTTGAAAGAGTGTG	148	7	yes
GATCAAGTTCAGTGCGCAGG	25	7	yes
GATCAAGTTACTGTGGAGAG	49	10	yes
GATCAAGTTACAGTCTGTTT	3	3	yes
GATCAAGTGTTTGCAGGACG	14	5	yes
GATCAAGTGTCGGATGGAAT	69	8	yes
GATCAAGTGTATCTCTTCTT	17	2	yes
GATCAAGTGTAAATGTGCTG	59	3	yes
GATCAAGTGGTCAAGGTACT	74	8	yes
GATCAAGTGGATTCGGCGGT	74	6	yes
GATCAAGTGCTTTGCCAAGT	4	2	yes
GATCAAGTGAGCTGTATCAG	115	97	yes
GATCAAGTCTTGTCAGTTTG	52	16	yes
GATCCTGAGTGGCTTGCTAG	20	21	yes
GATCAAGTCGTGCTTCTGGC	1263	87	yes
GATCAAGTCCTTTGTGAAAG	428	42	yes
GATCAAGTCCGAGGTCCCCC	44	4	yes
GATCCTGAGGGCTGCATACC	32	0	yes
GATCCTGAGGAGTCAAATAT	3	2	yes
GATCCTGAGGACATTTGTGC	5	4	yes
GATCCTGAGGACATTCTAGA	10	9	yes
GATCAAGTATGGGGAGAGCC	5	4	yes
GATCTGGTTCCGCTTCGTGT	3	1	yes
GATCCTGAGAGCATCTTCGA	21	5	yes
GATCAAGGTGTTGCCTGGTG	45	8	yes
GATCAAGGTCCTAAAATTTC	45	14	yes
GATCTGTACCTGCGGCTCCA	58	49	yes
GATCTGTACCTACTGTTAGA	2	2	yes
GATCTGGTTTTGCTCCACTC	4	3	yes
GATCTGGTTTTAAGTGCCTC	11	9	yes
GATCCTGAATGGGCAAGAGT	72	18	yes
GATCCTGAAGCTCTGGCTGA	36	5	yes
GATCTGGTGGGGTTACTGGG	12	11	yes
GATCTATACTTGCTAGCCAT	1	1	yes
GATCTGGTGGAACCTCCTCT	1	1	yes
GATCTGGTGCTGATAGGAAG	60	3	yes
GATCTGGTCTGCAGTCAGAC	2	2	yes
GATCCTGACTCCTTGAAGCC	10	3	yes
GATCTGGTCACTGGTCAGAG	28	2	yes
GATCTCTTTGTAGTCAGTAA	9	8	yes
GATCTGGTATGAACATCGGC	104	14	yes
GATCTGGGTTTGTCAACAGG	4	5	yes
GATCTGGGTTGTGAGGAGGT	122	6	yes
GATCTCCCTCACTCCCACAC	51	37	yes
GATCTCTGTGAAAGTAGTAC	27	1	yes
GATCTCACTGAAGAAAGCAG	2	1	yes
GATCAAGGTCCACTTAGTGG	84	21	yes
GATCAAGGGTTCCCTTCCAA	2	0	yes
GATCAAGGGGTTCTCGCGCT	78	3	yes
GATCTGCTGGTTGTATAATT	1	1	yes
GATCAAGGCTTTCCTCGGGC	14	3	yes
GATCAAGGCTCCCGGTTTTG	642	74	yes
GATCAAGGCCTTTCTGTCCT	203	25	yes
GATCAAGGCCTTTCTGCCCT	19	20	yes
GATCCTGAAAGACCGGGAAA	15	1	yes
GATCAAGGAGGTAGATATGG	69	1	yes
GATCAAGGAGGAAGTGTTGT	133	14	yes
GATCAAGGAGAGAAGCAGGA	56	5	yes
GATCCACGTGCACTTGCACT	58	1	yes
GATCAAGGAAGAGGAACCTG	13	2	yes
GATCCTCTGGCAGATGTTTG	14	3	yes
GATCAAGCTTCTGTGTAAAC	60	5	yes
GATCAAGCGTCCACTCCTCA	30	25	yes
GATCAAGCGGGCTTTCCTTA	253	16	yes
GATCTGGGTGGGACAGTCAC	68	4	yes
GATCTGGGGCTTTTTGTGTG	5	3	yes
GATCCCTTTGGTGCCCCTGA	247	17	yes
GATCTGGGGAGGGAGTCAGT	2	2	yes
GATCTGGGCTGAGCTTGGTT	22	6	yes
GATCTGGGCACCGAGGCTGG	30	5	yes
GATCTGGGCACCCACTGCCT	6	6	yes
GATCCTCTGCCTTTACCTCC	32	10	yes
GATCCTCTGATACTGACTTT	4	4	yes
GATCGGCGATGTGATGTGCA	79	16	yes
GATCAAGCCTGAATAAATAT	15	13	yes
GATCAAGCCTAAATAAATTG	13	12	yes
GATCAAGCCCTTCTTCCATT	115	12	yes
GATCAAGCCATCCATCAACT	115	12	yes
GATCAAGCATCATGATGCTC	1	1	yes
GATCAAGCAGTTTCTGGAGT	37	2	yes
GATCAAGCAGTAGAGTTTTT	87	7	yes
GATCAAGCAGCGAGAGGCTG	157	14	yes
GATCAAGCAGCAGCACGGGG	71	21	yes
GATCTTTTTTGTCTTTACCT	11	1	yes
GATCAAGCAGAACCTGGAGA	308	11	yes
GATCAAGCAAAATATCCCTA	16	15	yes
GATCTTTTTGTTAAGTCTTG	1	1	yes
GATCAAGAGTTTATTGCATT	77	10	yes
GATCAAGAGTGTTGGCTGCT	15	8	yes
GATCAAGAGGATTTGGATTT	11	1	yes
GATCCTCCTGCACCATGCCT	52	26	yes
GATCAAGAGCGTTCAGAAGA	4	4	yes
GATCCTCCTCACTTAGCACC	213	40	yes
GATCTTTTGGGTGGGCAGAA	1	1	yes
GATCAAGACTGTGACTTTTG	63	3	yes
GATCAAGACTCTCCTGGAGA	71	7	yes
GATCTCCAGTTGGCAGACAG	2	2	yes
GATCAAGACGCCTGTCATTT	99	10	yes
GATCAAGACCCTCCAGAGGT	4	0	yes
GATCAAGACCACCACTGCAT	473	13	yes
GATCCTCCCAAAAGCCATCT	27	4	yes
GATCCTCCAGCTGGGATTCC	11	7	yes
GATCCTCCAGCTCCATCAGT	40	49	yes
GATCCTCCAGCTCCATCAGC	126	119	yes
GATCAAGAATAAGACCTGGA	810	21	yes
GATCAAGAACTTCCATTACT	2	2	yes
GATCAAGAACAGAATGGGCT	3	3	yes
GATCAAGAAATACACATAAT	7	6	yes
GATCTATGCTTCCTTCTGTC	5	3	yes
GATCCTCACTGGCAGCAGCT	130	18	yes
GATCCTCACCCACCTGCTGG	173	4	yes
GATCTGGGACATAGCATCAC	23	9	yes
GATCTGGGAAGGACCCTTTC	9	6	yes
GATCTGGGAAGACTTCTCTA	50	8	yes
GATCTGGGAAACAGCATTGC	47	1	yes
GATCTGGGAAAATGGCAGTT	92	7	yes
GATCTGGCTTTTGTTTTCCA	93	21	yes
GATCTGGCTTTACTTCTCTG	3	1	yes
GATCTGGCTGGTCCAGTACA	9	8	yes
GATCTGGCCTGAGCCTGTCC	24	6	yes
GATCTGGCCCTTTTGTCCTT	14	0	yes
GATCCTTGACGATGGACAGT	7	1	yes
GATCTCGCCTGGAAACAGAG	265	30	yes
GATCAACTTTTTTCCCCCAA	67	5	yes
GATCAACTTTGACAAATATC	5	5	yes
GATCAACTTTCAGCTGGGAA	123	15	yes
GATCAACTTGCTGGGACCTA	117	6	yes
GATCAACTTGATTATGATGT	5	4	yes
GATCAACTTAATTCCCTTTT	29	9	yes
GATCAACTGTGCAGACAACA	1040	28	yes
GATCTAAATGAGCCAATCAA	3	1	yes
GATCAACTGCGACATCTAGG	37	31	yes
GATCAACTGAGGTCTTTCTT	10	3	yes
GATCAACTCTTTGTTTTGGC	60	12	yes
GATCAACTCTTGGCTTTGAC	130	12	yes
GATCAACTCGGTGATGGCAA	2	1	yes
GATCAACTAATAGCTCTCCT	37	10	yes
GATCAACGCGGAGTTCGTCA	1	1	yes
GATCTGGCCAACACAAGAAC	356	10	yes
GATCTGGCATAAACCCTACT	2	1	yes
GATCCTCCCTGTTCTCATCT	17	6	yes
GATCTGGCAGATGTGAGGTT	3607	522	yes
GATCTGGATTGTGGAGCCAA	62	15	yes
GATCAAGGCTGAGCTGCTGT	3	3	yes
GATCCTGCGGATTGCCCGGG	4	4	yes
GATCTGGAGTAAGGGCTGTT	82	9	yes
GATCTGGAGGTGGACGGACA	27	5	yes
GATCTGGAGGTGGAAGTGGT	3	4	yes
GATCTGGAGGCTGGGAGTCA	9	8	yes
GATCTCCTTTGCCCATGTTT	32	8	yes
GATCTCCTGGTAGCATGACC	428	13	yes
GATCTCCTGCAATCATCTCC	32	8	yes
GATCAACGCGATTTAGCTGA	14	7	yes
GATCAACGAAGTGGATGCTG	22	4	yes
GATCAACCTGAGGAAAATTG	211	34	yes
GATCAACCTGAACTTGGGAC	16	2	yes
GATCAACCTCGTCGACTGGG	8	7	yes
GATCTGGATGAAGGATAAGC	153	15	yes
GATCAACCGACAGCTGGAGG	161	1	yes
GATCCCAGCATCATCTTTGC	24	4	yes
GATCAACCACTGCAAATTCG	901	500	yes
GATCAACCACTGACCTGCCT	32	2	yes
GATCAACATGTTCGTGATGT	3	3	yes
GATCAACATGAACTGAGATT	104	33	yes
GATCAACATCCTCCACCAAG	3	3	yes
GATCAACATCATTGAAGAGT	10	8	yes
GATCAACAGTGAGGCAAGCA	41	2	yes
GATCAACAGTAGTTGTCTTT	50	5	yes
GATCAACAGCGTTGCCTTCC	72	14	yes
GATCAACACTTACGTTAGGA	4	4	yes
GATCCCCAGAAACTGAGTGT	337	2	yes
GATCATGAGTCCTGAATCAT	6	2	yes
GATCATGACATCCCAGTCCC	17	12	yes
GATCACTGGTAACATGGTCT	5	4	yes
GATCGACAGGACCCAGGAGC	12	1	yes
GATCTTGTGCCATCTTTGGT	24	0	yes
GATCTTGTGAACTGATATTC	98	76	yes
GATCCAGGACAGCTAGGGCT	12	0	yes
GATCATTGTCAACCAGGCAT	179	26	yes
GATCTTGGGATGAAAGCAAG	36	3	yes
GATCCTGACAGGAGAGGATT	3	1	yes
GATCTGGCACAAGTAAAATA	106	6	yes
GATCCTCCAGGAGAGGATGG	1	1	yes
GATCAGCTCCAACTATGGTG	14	2	yes
GATCGGCTCTTCCCACCTAC	33	6	yes
GATCTCCCCGTCACAGAACC	37	28	yes
GATCCATGCAGAATGAGCCC	24	20	yes
GATCTTGCTCATCACGTGAA	97	1	yes
GATCCAAGATAGCTCATAGG	2	0	yes
GATCTTGAGAAAACTACTCT	25	1	yes
GATCCATCCCCAGTGACACG	2	2	yes
GATCAGTGCAAATGTTTTTG	6	5	yes
GATCAGTGAATGGGTCAAGA	22	0	yes
GATCCAGGCTATCTCCTCTG	90	7	yes
GATCCAGGATGCACCACTGA	2	2	yes
GATCAGTCCTTCCCTCGAGA	44	9	yes
GATCCAGGAGGCTCTGCACG	16	20	yes
GATCAGTCAGCCCGGGCCAG	31	29	yes
GATCAGTTTCAAGAAGCGTG	15	1	yes
GATCCACTTGCCATTGTCCC	4	3	yes
GATCCTCTGGACTTAGCTTC	15	6	yes
GATCCCAGCATTTCTCAATT	5	5	yes
GATCCCAGCATCGGCAAGCG	75	1	yes
GATCCCAGCAGTTCCAACAC	34	6	yes
GATCCCAGCAGCTGTTACCT	40	1	yes
GATCCCAGCACTGCAAAAGA	64	2	yes
GATCCCAGCACACACCGTGA	77	6	yes
GATCCCAGATGATACCCACT	37	10	yes
GATCCCAGAGGAAAGGGTTT	38	7	yes
GATCCCAGAGACAATCTCAT	137	26	yes
GATCCCAGACGCCTCAAATG	48	7	yes
GATCCCAGAATGAACAGAAC	23	9	yes
GATCCCAGAAGCCGCACAGG	5	1	yes
GATCCCAGAAGCACACTGGC	44	11	yes
GATCCCAGAACCATTGCCTG	57	2	yes
GATCCCACTTCACCTGTTAT	4	2	yes
GATCCCACTGTTGATAAGGA	22	3	yes
GATCCCACTGCTCATTTGAC	161	5	yes
GATCCCACTAACCTGCAGTG	26	1	yes
GATCCCACGGTAGAACCTGA	131	24	yes
GATCCCACGAGCCAGAGAAC	437	30	yes
GATCCTGCATCACTTGTTTT	1	1	yes
GATCCAGGAAATGCTGGAGA	14	5	yes
GATCCAGGAAAAAGTGTTTC	4	3	yes
GATCCTAGCGGACCTCAACC	147	4	yes
GATCAGTAGACCATAGTGTG	4	3	yes
GATCTGTGAACACGGGACAC	2	2	yes
GATCTTCGCTTGTGCTGCTG	11	0	yes
GATCTGTCTCTTTCACGGAA	12	3	yes
GATCTGTCTCCCTTTTAGCT	54	13	yes
GATCAGGTTTCTTCTTTTCC	28	2	yes
GATCTGTCCAGGGGACATTA	119	6	yes
GATCCAAGCCGAGTGGAGAG	3	1	yes
GATCAGCCTGTGCCTGAAGT	54	2	yes
GATCCCACCTCACGTGTGAT	59	3	yes
GATCCCACCGCAGCTACCAG	218	2	yes
GATCCCACCCCAGTAGGAAG	6	7	yes
GATCCCACCATTCTCCTTGG	178	121	yes
GATCCCACATTTCCCTTGCC	26	15	yes
GATCCCACAGTGTGACTGAT	42	4	yes
GATCCCACACTTAAGACTTC	20	17	yes
GATCAGGTGGATGTGCAGGA	47	4	yes
GATCAGGTCCTAAACATGGC	49	2	yes
GATCCAGCAGCCGAGACTGA	20	11	yes
GATCAGGTAGTTTGGCAGGG	2	1	yes
GATCTGTACAAGTCCTTCGT	45	3	yes
GATCTTCAAACACCAGCATC	3	3	yes
GATCCCACACAGCAGACAGA	24	3	yes
GATCCCAATTGGTGGAAAGG	105	17	yes
GATCCCAATTCTGTCCCAAT	973	100	yes
GATCCCAATTCCCAGTATTA	11	10	yes
GATCCCAATGGTCACACACC	99	15	yes
GATCCCAATGCTGCCCCATC	27	7	yes
GATCCCAATGATAGATTCAA	14	1	yes
GATCCCAATGAGCCCACCTA	7	9	yes
GATCCCAATAAACCCATGAG	11	10	yes
GATCCCAAGTGCTGGGAAAG	14	2	yes
GATCCCAAGTCCAACACCCA	108	9	yes
GATCCCAAGGGTCAGCACTG	42	7	yes
GATCCCAAGCCTCACCGGCT	15	4	yes
GATCCCAAGCCAAGAAACAC	347	47	yes
GATCCCAAGAGGAAGGGTAT	21	2	yes
GATCCCAAGAAAGGATGGAA	11	2	yes
GATCCCAAGAAACTACTTGA	896	75	yes
GATCCCAACTGTCAGTGCCA	56	4	yes
GATCCCAACTGTAACAGCAA	1	1	yes
GATCCCAACATTTGAGAGGC	12	3	yes
GATCCCAACATTGTTGGCAA	159	24	yes
GATCCCAACACAGCGATATG	298	29	yes
GATCCCAAATTGGGTTGTCA	141	2	yes
GATCCCAAATTGGGGAAAGT	5	1	yes
GATCCCAAATCTGTGGTGTG	149	21	yes
GATCCCAAATACTCAGTGCT	2	0	yes
GATCCCAAAGGCTCCAGGGT	20	7	yes
GATCAGGGGCCAAGGTCCTT	9	2	yes
GATCTGGTTTCAGGTTTCTT	2	2	yes
GATCAGGGGATGGACTTCAC	47	0	yes
GATCTCATCCAAGCAAATGG	47	8	yes
GATCAGGGCTCCAGTGGTCC	140	43	yes
GATCAGGGCCTGGACTCTGG	50	9	yes
GATCAGGGCAGAGGCAATTG	14	1	yes
GATCCCAAACTGTATCCTTG	42	1	yes
GATCCCAAACTGAGGCAGCA	103	7	yes
GATCCCAAACTACTTAATAG	36	3	yes
GATCCACGTGCCTTTGTCTC	10	1	yes
GATCCCAAACAACTAAGAAT	247	1	yes
GATCCCAAAATGCTGCGGAG	101	5	yes
GATCCCAAAATAGGTGTTGA	107	2	yes
GATCCCAAAAGGGACATTGT	82	7	yes
GATCCCAAAAACCGTGCAGC	8	2	yes
GATCCCAAAAAATCTGTGCC	214	11	yes
GATCCATTTTTTTCCATAAA	1	1	yes
GATCCATTTTTCTGTGACAT	17	2	yes
GATCCATTTGCTTACACTGT	157	23	yes
GATCCATTTGATGCTTCCAG	12	1	yes
GATCCATTTCTTCTGCATGA	6	6	yes
GATCCATTTCTAGAAAAGAT	35	3	yes
GATCCATTGTGTGGTTTAAC	214	29	yes
GATCCATTGGTTTCTCAGTC	171	2	yes
GATCCATTCCTGACTGTATG	1	1	yes
GATCCATTAGTGTTTGCTGG	12	2	yes
GATCCATCTTTTTCTTTGGA	17	2	yes
GATCCATCTTCAGCTGACTG	111	16	yes
GATCCATCTGCTTTCTTTCT	45	4	yes
GATCCCACAGACTGAAGGGA	2	2	yes
GATCCATCTCTTTCCTTCTG	75	1	yes
GATCCATCTCCAGCACATGC	22	4	yes
GATCTGGTGTGTCTGAAGAC	9	8	yes
GATCTCTCCTAGTTAAGAGG	37	2	yes
GATCTGGTCCCCTGTTCTCC	11	2	yes
GATCTGGGTTGGATGGGGCT	22	2	yes
GATCTGGGTGGCCAGTACTT	217	23	yes
GATCTGGGTAGGGGACCAGG	60	26	yes
GATCCAGAATGTCAGCTGGA	30	0	yes
GATCCAGAAGGGTCTCTCTC	34	12	yes
GATCAGGCCGGGGCGGCAGG	273	24	yes
GATCAGGCCCTAAAGCATTG	12	4	yes
GATCTGAAGTTGTGTTTGTG	1	1	yes
GATCCATCGGCAACATCAAG	3	1	yes
GATCCATCGACTGTGATAGG	74	6	yes
GATCCATCCTTACTTGGTTT	34	12	yes
GATCCTGAGGGGGGGTCACT	3	3	yes
GATCCATCCTATCCATCCGT	127	10	yes
GATCCATCCCCGGCAAAGAG	20	3	yes
GATCCATCCCAGAGGGACTG	44	3	yes
GATCCATCCAGCAAAGAGGA	161	10	yes
GATCCATCCACCAGCAGGAG	6	0	yes
GATCCATCCAATGGCTTACC	288	18	yes
GATCCTCTCTTCCCTGAAGG	4	4	yes
GATCCATCATAAGAAAGCTC	12	11	yes
GATCCATCAGTTCTGTTCTG	4	2	yes
GATCCATCAGGTATGTTGAA	5	5	yes
GATCCATCACAGGACTATGT	74	0	yes
GATCCATCACAAGGCAAAAC	10	8	yes
GATCCATCAAGTGGGTAAGT	27	3	yes
GATCCTCCTCCTCACGAAAG	6	2	yes
GATCCATATCACTGGATGTA	87	10	yes
GATCCTCCAGCACACTCTAT	4	4	yes
GATCCATAGCACAAAGCCAC	41	8	yes
GATCCTCAGCTAAATATCCA	26	2	yes
GATCCATACTGTAAACTTGT	115	26	yes
GATCAGGAGCTGCTCATGTA	17	2	yes
GATCAGGAGCAGGCAACACC	9	1	yes
GATCCACTCACAGCACCTCC	4	4	yes
GATCCACTCCCTGTTCCCTT	97	5	yes
GATCCATACTCCCCAGTATG	3	4	yes
GATCCATACAGCATTTTGCG	59	9	yes
GATCCTATCACCCATTTAAC	15	4	yes
GATCCATACAATTTGTGCCA	332	1	yes
GATCCATAATGGCTCAGTAT	17	10	yes
GATCCATAAGTTTGCCCAGT	21	1	yes
GATCCTACCATATGCTTCCT	32	8	yes
GATCCAGTTTTGGGAAAGGA	171	14	yes
GATCCTAATTGGGAATAAGG	2	2	yes
GATCCAGTTTCTGACTCGGG	49	10	yes
GATCCAGTTTCATTCTCTAA	3	1	yes
GATCCAGTTGTTTGAAGATT	54	4	yes
GATCCAGTTGTGCAGTAGAG	146	9	yes
GATCCAGTTGTCAAGACAAA	31	13	yes
GATCCAGTTGGAGAGATTTG	40	1	yes
GATCCAGTTCTGCTCAACTA	76	6	yes
GATCCAGTTCTACGAGCGGC	70	15	yes
GATCCAGTTCTAAAACTTGT	152	1	yes
GATCCGTGCTTCTCAGTCAC	2	2	yes
GATCCAGTTACCAGAAGATG	311	6	yes
GATCCAGTGTGTTGCTGGCA	32	8	yes
GATCCAGTGGCAGCCTCAGC	105	3	yes
GATCCAGTGCTGGGGAGATG	39	2	yes
GATCCAGTGCCTCATTGTTG	74	12	yes
GATCCGATGGTACTATGCAT	18	7	yes
GATCAGGAGAAGGAATTCCT	20	4	yes
GATCTGTCTCAACCAAGAGA	19	4	yes
GATCTGGCCCGCCGAGCCAT	4	4	yes
GATCTCAACTGACTCCTCTA	34	41	yes
GATCCAGTGAGAGCCAGACA	276	20	yes
GATCCAGTGACGTCAGACGC	5	5	yes
GATCCAGTCTGTCCTAGATG	6	5	yes
GATCCAGTCCTGGAGGACAG	147	15	yes
GATCCAGTCCATTCAGCAGT	204	16	yes
GATCCAGTCAGGACATATGA	10	9	yes
GATCCAGTCAGCCCCTGGGG	169	0	yes
GATCCTGGCGGCAGCGGCTG	14	2	yes
GATCCAGTATCTGAAAGACC	121	9	yes
GATCCAGTACTTGGTTTGTG	203	19	yes
GATCCAGTACTACCAGAATG	240	9	yes
GATCCAGGTTCAGTAAATTA	1	1	yes
GATCCAGGTTCAATTTCCAG	129	3	yes
GATCCAGGTGTGCTGAGTGG	131	13	yes
GATCCAGGTCCGTGAACCCC	74	14	yes
GATCCAGGGTGTGCAGTGGG	490	116	yes
GATCCCTGAAGTGCATCATA	4	2	yes
GATCCAGGGTCCTCTGCCTG	157	11	yes
GATCCAGGGGGGACACCTGC	19	8	yes
GATCCAGGGCTCAGGAGCAC	4	3	yes
GATCCAGGGCGATGTTGGGG	103	7	yes
GATCCCTCTTATTGCTAAAT	5	5	yes
GATCAAAGTATGACCACTAG	113	27	yes
GATCCAGGGCCTGTGAATCA	55	3	yes
GATCCAGGGCCTGGTGGAGG	23	7	yes
GATCCAGGGCCTCTGCGCCT	65	3	yes
GATCCAGGGCCACTTTGTCT	23	7	yes
GATCCAGGGAGCAATAACCA	2	2	yes
GATCAGCGGCCGAATGTCCC	9	4	yes
GATCAGCGCAGGCCCCAGCC	10	9	yes
GATCCACCATCCTCTTTTTG	217	25	yes
GATCAGCGCAATGCAAAGCA	33	1	yes
GATCTGGCACTGCTTTAGCC	31	4	yes
GATCCCAGCTCTCTACCCTG	1	1	yes
GATCAGCCGGGGCTTTGAGG	171	6	yes
GATCCACAGTGCAAAGAAAA	15	2	yes
GATCATGTAGTCCTTTGTCA	1	1	yes
GATCATGGCACAGGCATCAG	1	1	yes
GATCTTTGCGAATTACAATG	4	4	yes
GATCTTTGCCTCTCTGTAGA	14	17	yes
GATCAGCGTGACCACCCCCT	142	13	yes
GATCTTTGCAGTGTAATTCT	28	6	yes
GATCCTTCAGAACACTGCTG	22	6	yes
GATCCAGGCTGAGGACATCA	21	6	yes
GATCCAGGCTCTGATGTTTC	24	0	yes
GATCCAGGCTCGGGAGCTAA	9	2	yes
GATCCAGGCTCACAGTGTGA	21	6	yes
GATCCAGGCTAAAATCCCCG	1266	99	yes
GATCCAGGCGGCCCTGCCAG	72	9	yes
GATCCAGGCGGCCAAGAACT	74	10	yes
GATCCAGGCCTCTGAACTGG	5	1	yes
GATCCAGGCCTCCCTTCTTG	28	2	yes
GATCCAGGCCTACTTCGCGT	70	16	yes
GATCAAACCGGTGCAGAGAA	2	0	yes
GATCCAGGCAGCTGTGTACA	107	20	yes
GATCCAGGAGTTCAAAGAGG	1048	79	yes
GATCCCCTGGAATGGAGCTA	28	6	yes
GATCCAGGACCTGGAAGTAT	4	0	yes
GATCCAGGACCATCCTCTCA	15	2	yes
GATCCAGGAACTACTCCACA	183	20	yes
GATCCAGGAAAGCAGCCTGT	137	16	yes
GATCCAGCTTTTTCCTAATA	28	2	yes
GATCCCCGACGGCACTTGGA	3	3	yes
GATCCAGCTGGGCGAGGATG	46	5	yes
GATCCAGCTGGGCAAAATTC	8	7	yes
GATCCCCATACAAAAGGACT	43	10	yes
GATCCAGCTCCTAAACTGTT	11	4	yes
GATCCAGCTCAGGCGGTGTC	19	7	yes
GATCCAGCGCTCTCGGGACT	363	2	yes
GATCCAGCGAGAAAGAAGAA	142	0	yes
GATCACAAAGCAAGCAAAGA	2	0	yes
GATCAGCATGGGGCTCTTCT	12	10	yes
GATCAGCAGTCCGCGAGCTT	100	10	yes
GATCAGCAGTAGTGTTAACT	60	15	yes
GATCCAGCCTGACCTGCACA	128	16	yes
GATCCAGCCCATACAGAAGA	92	6	yes
GATCCAGCCATTTGTGGGTG	3	3	yes
GATCCAGCCAGTCTTCAAAG	7	6	yes
GATCCAGCCAGTCTCTCATT	3	3	yes
GATCCCATCACTCCTATAGT	16	3	yes
GATCCCAGGGGACCCACAGA	3	3	yes
GATCCAGCAGTTAAAGCAGT	140	7	yes
GATCCAGCAGTATTTTTTGT	2	2	yes
GATCCAGCAGAGAGGGCAGG	40	3	yes
GATCCAGCACCGTGTGTACC	136	17	yes
GATCCAGCACATACAAGTCT	3	3	yes
GATCCAGCAAACTTGGTTGG	71	5	yes
GATCCAGCAAAACTACTGCT	49	6	yes
GATCCAGATGGCCTCAAACT	16	15	yes
GATCCAGATGATGGTTCTTT	138	7	yes
GATCCAGATACAACGCTCAC	48	5	yes
GATCCAGAGTGGCACAGGGT	339	50	yes
GATCCAGAGTGGAACTGTCC	69	1	yes
GATCCAGAGCTTCTGCAAGG	12	1	yes
GATCAAGCACACACACACAA	4	0	yes
GATCAGCAGATGCAAAAGAT	29	2	yes
GATCCAATGCTGACCTGGCT	39	4	yes
GATCCAATCCTCCTGCCTTC	46	2	yes
GATCAGCAACTCCTGCTTCA	19	4	yes
GATCTCTCTGAAGCCCCAGG	11	10	yes
GATCCAGAGCTGGAATAGCA	17	2	yes
GATCCAGAGCGTGTTAACAG	126	4	yes
GATCCAGAGAGATGGGTCAG	4	2	yes
GATCCAGAGAGACTTGGTTG	34	12	yes
GATCCAGAGACTGAATAGTT	22	6	yes
GATCCAGAGAACTCAGCTGT	85	5	yes
GATCCAGAGAAAGCAAAGGC	2	0	yes
GATCAAGAGCCCACACCTAG	19	16	yes
GATCCAGAGAAAGACAAAAT	2	2	yes
GATCCAGACTTGCCTTATAA	77	7	yes
GATCCAGACGCCAAGGCTGC	5	5	yes
GATCCAGACGAATCTTGTCA	19	10	yes
GATCCAGACCTGCCACAGAC	4	4	yes
GATCCAGACCCGGGAAGGGA	84	5	yes
GATCCAGACAAAATAAAGAT	5	5	yes
GATCCAGAATTGCTTTCCCA	125	27	yes
GATCCAGAAGTTGGGAAAAC	3	3	yes
GATCCAGAAGCAGTGGAATC	1352	127	yes
GATCCAGGTGAAACCGGCAG	4	4	yes
GATCCAGAACCTCTCAGCCA	89	6	yes
GATCCAGAACATTCTAGAAA	65	1	yes
GATCCAGAACAGTACAGCGT	240	45	yes
GATCCAGGCCTGACTGGACC	10	9	yes
GATCCAGAACACATTAACCT	48	35	yes
GATCCAGAAAGAACGATTTG	20	1	yes
GATCCAGAAAATTTCTACTT	15	2	yes
GATCCACTTGGGCTCTGTCA	4	0	yes
GATCCAGATATGAAGGGGAG	7	4	yes
GATCAAGGCTGCCCAATACC	9	1	yes
GATCCTCCTGCAAAAGTCCA	8	2	yes
GATCACCTCAACAGTCACGT	15	5	yes
GATCCTGCACTGAGGAAGCG	3	3	yes
GATCCAGAGGAAACTGAAGT	14	3	yes
GATCCAGAGAGAGCCTAGGT	16	3	yes
GATCCAGAAAGAGCTAGAAG	4	4	yes
GATCACCCAGTATCGAAGCA	20	24	yes
GATCTTGTGTTTTGCTATCC	62	13	yes
GATCTTGTGTTCTTTGTGCC	444	29	yes
GATCCAATTCCTCCAGTTTT	25	1	yes
GATCCAAATCCCAAAGCTTC	17	0	yes
GATCCAAACAGTCACATGCC	7	3	yes
GATCATTTGACACCTTCCAA	3	1	yes
GATCCCTGGCTCTTGAGGGT	1	1	yes
GATCCTGCCCTACATTGACG	2	2	yes
GATCATTGCCTATCAGCCCT	7	6	yes
GATCATTACAGAGGCAGCCT	9	2	yes
GATCATTAATCCTCTGCCCA	3	3	yes
GATCATTAACTTCTGACAGC	27	1	yes
GATCATGTTTTGAGAGCTGA	5	1	yes
GATCATGTTCCTAAAATACA	2	2	yes
GATCATGTTCATGGACATCT	14	3	yes
GATCATGTGCTTGTGGCCAC	31	13	yes
GATCATGTGCTTACTGCAGG	7	1	yes
GATCATGTCTGTAATATCGT	5	1	yes
GATCAAGTTTGCCGTCCATG	48	5	yes
GATCATGGCCGAGACCAGTT	15	4	yes
GATCATGGAATGGAGGGGAA	2	2	yes
GATCATGCTCAGTCACCGAA	16	3	yes
GATCATGAGTTCAAGGGCGT	8	1	yes
GATCGCCTTAACTACTGTAA	112	7	yes
GATCTTGAACAATGAGGTTT	151	17	yes
GATCTTGGCCTACAGTAAGC	5	5	yes
GATCTTGGCCGTGGTGACTG	1	1	yes
GATCATGAATACGTTCAGCG	3	3	yes
GATCATCTGCTTAGGTTCTC	5	1	yes
GATCATCGCTACTTGTCCCT	20	7	yes
GATCATCACTGACGACTGTG	5	1	yes
GATCATCACCAGAGAAGACC	2	2	yes
GATCATCAACAATGCTATCG	8	1	yes
GATCATAACTTCACTGCTCC	6	2	yes
GATCCCAGGGGAGCTGAGGG	23	3	yes
GATCTTGCTGTTGTGGATGT	6	2	yes
GATCTTGCTGATGAGCAGGG	44	17	yes
GATCCTCACTCCAAAAAAAA	7	6	yes
GATCTGCAAAATCTACATTT	1	1	yes
GATCAACACTACGGTGCCAG	39	5	yes
GATCAAATTCCCACTGCCCG	18	22	yes
GATCACCTTCAAGGTCAACA	76	28	yes
GATCCCAGACCAGCCAGAGG	33	9	yes
GATCAAACTTAATAACTGAG	2	2	yes
GATCTGCTGGATGTCTGCCG	15	6	yes
GATCAAACATCTGTCTGTCT	66	16	yes
GATCCCACGAACACATATTG	61	12	yes
GATCCCACCCCTGTAGTCTT	3	3	yes
GATCATCATTGGCTGCTTTG	43	0	yes
GATCCCAATGACAACCGGTA	19	4	yes
GATCCACTGGTGGGAGAACG	2	0	yes
GATCTAGATACTTCTAGTTT	23	1	yes
GATCCCAACTCATGATGCGC	10	8	yes
GATCAGTTGGACTAAGGATG	11	8	yes
GATCCCAAACATTACAAGCC	474	50	yes
GATCGACTTGGATTACAGAA	86	13	yes
GATCCTCACATGGAAAGTAC	31	26	yes
GATCCTCAACGAGGATGGCA	81	6	yes
GATCCTATGTTGCTGGAGCT	271	32	yes
GATCCTATGGGTGACTGTAC	11	10	yes
GATCCTAGTGGGTCTACCAG	275	187	yes
GATCCTAGTGCTGCTCTGGC	82	3	yes
GATCCGCAAGGAGCTCTGTG	31	1	yes
GATCTCTCATACAGACACAC	3	2	yes
GATCGTGCCCAATAAATTTT	15	4	yes
GATCCTACCGCCTTTAACAA	44	5	yes
GATCCTACAGAAGGCCCACT	25	7	yes
GATCTGGAGGCCGCTGTGAG	11	13	yes
GATCTGGAGGCACCAAGACA	16	1	yes
GATCTGGAGGAAAAAAACTA	7	9	yes
GATCTGGAGCTCCTGGGATG	60	1	yes
GATCTGGAGCCTCCACGATG	50	4	yes
GATCTGGAGCACCATGCCAA	56	12	yes
GATCTGGAGATTTCACAGGG	57	7	yes
GATCTGGAGAGTGAGCTGTG	14	3	yes
GATCTGGAGACTCTCCACAG	37	4	yes
GATCTGGAGAAGCGACGTAT	14	10	yes
GATCTGGACTTGTTTTCTGG	32	4	yes
GATCTGGACTTCTGAATCTG	17	8	yes
GATCTGGACCTCACCTCTGA	210	1	yes
GATCCACTTGTGCATGTAGT	59	15	yes
GATCTGGACAGAATCCAGGC	14	1	yes
GATCTGGAAGTTGGCAGATG	129	1	yes
GATCTGGAAGTAAGCAAATG	57	5	yes
GATCTGGAAGGAGCTGCTGA	15	6	yes
GATCCATAAACATCTTCAAA	4	4	yes
GATCTAAAACTCACTCCATG	27	3	yes
GATCCAGTGACAGAGACCAG	1	1	yes
GATCAACAATCATTATCTGC	7	6	yes
GATCAACAACTTCTGACCTG	1	1	yes
GATCAACAAATCTCCTAGGC	11967	105	yes
GATCAACAAAGAAACAACTA	15	1	yes
GATCGGGCCTGAACACTTTA	10	8	yes
GATCAACAAAACTGTACCTG	21	17	yes
GATCAAATTTGAGAATTACT	3	3	yes
GATCAAATTGGTCTTCACCT	32	4	yes
GATCAAATTGGTACAGAAAT	146	5	yes
GATCAAATGTGCCATAGCAC	17	2	yes
GATCCGTGTCCCTGCGTGCA	279	3	yes
GATCAAATGCTCTTATCATT	9	3	yes
GATCCGTGGGCCTGGCCTCC	222	31	yes
GATCAAATGAGAACACTGCT	96	6	yes
GATCAAATGAAGCTCAAGAA	21	6	yes
GATCTGGAAGAGGCTGTCAA	3	3	yes
GATCTGGAAGAGACTTTGGC	1	1	yes
GATCTGGAACCTGGTGTGCG	79	8	yes
GATCTGGAACAGTTTTTGGC	55	9	yes
GATCCGGTGTAACGATTTAT	10	9	yes
GATCTGGAAAGTTAGTTGAG	11	6	yes
GATCTGGAAAGTGAACAAGA	5	6	yes
GATCTGGAAAGCTCTGGGGA	34	7	yes
GATCCGGTGAGCATCCAAAA	27	25	yes
GATCTGGAAACACTGTAGCA	34	4	yes
GATCCGGGTGTTGTGCCTAA	2	2	yes
GATCTGGAAAACGCTGGAGA	59	6	yes
GATCTGGAAAAAGCAACTCC	57	1	yes
GATCTGCTTGCCAGGCCACT	17	2	yes
GATCAAGAATTTGGTGTGGA	22	8	yes
GATCTGCTTCGCCGGGACGT	559	70	yes
GATCTGCTTCCAGGTCCTCA	75	11	yes
GATCTGCTGTCCAGAGCAAG	688	81	yes
GATCTGCTGTAGTCATTCTT	5	1	yes
GATCTGCTGGAGGGACTTCA	18	17	yes
GATCTGCTGCTGGTGCTTGC	18	5	yes
GATCCCCTTTCTCTATGTCT	73	66	yes
GATCAAATCACTGGCAGACA	66	2	yes
GATCAAATCAAGACCAATCC	34	4	yes
GATCAAATCAAGAAGACACA	11	0	yes
GATCAAATCAAAGACCTACG	8	7	yes
GATCAAATATGTGGAGATTT	45	0	yes
GATCAAATAAAGTTAGCAAT	144	13	yes
GATCAAAGTTGTTTCACTGT	23	1	yes
GATCAAAGTGGTATAGACAA	20	19	yes
GATCAAAGTGCCAACAGCGG	5	5	yes
GATCAAAGTGAGGGAAGCGG	3	3	yes
GATCAAAGTCTCCATAGTTG	736	48	yes
GATCAAAGTCATTGCGGTTA	26	7	yes
GATCCGGGCAGCCCAGGAAA	82	5	yes
GATCAAAGTACTTGTTAGGG	103	7	yes
GATCAAAGGTTTAAAGTCTT	31	1	yes
GATCAAAGGGGGCAAAGTCT	60	11	yes
GATCAAAGGGGCCATTTCTC	16	1	yes
GATCAAAGGCTTCAATCACA	18	1	yes
GATCAAAGGAGACTGGCAGC	58	4	yes
GATCAAAGGACTTCTTACAA	30	6	yes
GATCCGGCCCTACTGTGTGT	109	20	yes
GATCAAAGGAAAGGGGAGGG	938	72	yes
GATCAAAGGAAAAGACCAAA	4	2	yes
GATCAAAGCTGGCAAGGTAC	573	19	yes
GATCAAAGCGGGAGAAGAAA	2	2	yes
GATCAAAGCCTACTTTTCTT	42	2	yes
GATCAAAGCCCGGAAAGGCA	544	23	yes
GATCAAAGCCAAGTATCCTG	137	4	yes
GATCAAAGCAGCTGCCTTAC	21	5	yes
GATCCGCTGTACTCTCCTCC	48	1	yes
GATCCGCGCTGAGGAGCAGC	138	10	yes
GATCTGCTGCAGGACCTGGG	63	10	yes
GATCCGCGAATGCTCGGAGG	359	10	yes
GATCTGCTGAAGGGCAATGG	5	5	yes
GATCTGCTGAAGGAGAAAGC	36	12	yes
GATCTGCTCTTCAATGTTGT	18	11	yes
GATCTGCTCTCGGGCCTCGC	40	6	yes
GATCCGCAGTGGCATGTTCT	202	89	yes
GATCCGCAGCGCCTCTTCTT	14	0	yes
GATCCCTGTCTAAGCTAGAT	31	3	yes
GATCCGTTGCTGACCTTGCG	1483	78	yes
GATCCAGGATTAGTATCTCA	1	1	yes
GATCAAAGAGTTCAGCAAGA	77	8	yes
GATCAAAGAGGCTGCTGTCT	43	16	yes
GATCAAAGACTTGGAGCCTG	61	0	yes
GATCAAAGAAATTTTGAGTT	60	7	yes
GATCAAAGAAAATTCAAAAG	18	5	yes
GATCAAACTTGGCAGTGGTG	56	0	yes
GATCAAACTGAGTCTGAAGG	70	20	yes
GATCCGCAAGTTTTCTATGA	7	6	yes
GATCAAACGAGTTGTGTGTC	1	1	yes
GATCAAACCAGCCTGTTTTT	20	1	yes
GATCAAACAGTAAAGGTGTG	78	5	yes
GATCAAACAGCAGCCAAGTG	54	0	yes
GATCCGAGAAAGAGAGAGGC	16	13	yes
GATCAACAGAGTGCCAAATA	14	17	yes
GATCCGACTGCAAAATTCAT	26	2	yes
GATCCGAATGGGTCGACTGA	30	8	yes
GATCAAAATGTTTGTTGCTT	3	3	yes
GATCAAAATGTGGTGCCAGA	26	8	yes
GATCCCTTGGCATAGGGCCC	191	79	yes
GATCTGCCTTAAGGACCTGG	2	2	yes
GATCCCTGTGCCTAGCTGCT	45	16	yes
GATCACATGATAATTTGCTG	8	3	yes
GATCACATGACCAGGTCTTC	40	11	yes
GATCTGCCTCAGTCCACAAG	127	1	yes
GATCCGTCACAGAGAGCAGG	1	1	yes
GATCCAGCCGTCCATCTCGC	31	5	yes
GATCTGCCGAAGCGGGCTTG	4	4	yes
GATCTGCCCTGTATTGTTAA	2	1	yes
GATCTGCCCCTGACCCTCCA	123	1	yes
GATCCATCCCCGGAGTTCCA	29	5	yes
GATCAAAATGCTTGGAGAAA	140	15	yes
GATCAAAATGAGGCAGAGGA	104	11	yes
GATCAAAATCGCAGTTACTG	9	2	yes
GATCAAAATATGCTGCAGAC	3	1	yes
GATCAAAAGTTGAAAAGAAG	21	2	yes
GATCAAAAGTGCCCAAGAAA	23	9	yes
GATCAAAAGATATGGTCCTT	3	3	yes
GATCAAAAGAAACCTGTTCG	11	1	yes
GATCAAAACTCAAGAAAAGG	81	16	yes
GATCCCTGGTCCTTAGGTGG	5	6	yes
GATCAAAACCTTCTCTGAGG	22	8	yes
GATCAAAACCTGTGACGGAG	9	10	yes
GATCAAAACCCGAAATAGAG	8	1	yes
GATCAAAACAGGTCCAGAAG	56	6	yes
GATCAAAACACGATGTCCAA	14	3	yes
GATCAAAAATGCACAAAAAT	54	4	yes
GATCACAGACCTAAGACACA	616	21	yes
GATCTGCCCAAAGAAACCCT	5	3	yes
GATCTGCCAGGAACATGAGA	539	40	yes
GATCTGCCAGCTTGGGAACT	17	2	yes
GATCTGCCAGCCGTACATCC	35	4	yes
GATCCCTGATTGCCTCCATG	522	71	yes
GATCCCTGATGCAAAAGAGA	117	12	yes
GATCCGGCTCCAGATTCAGG	5	5	yes
GATCTGCATTCGCTCACTGG	40	6	yes
GATCTGCATACTCCTACAGC	14	0	yes
GATCTGCAGTTCCTGGAAGG	19	1	yes
GATCTGCAGGTGCCTGGGAA	40	14	yes
GATCCAGAGCGAGCATCCAT	60	6	yes
GATCAGTATTAGTCCTCGTT	1	1	yes
GATCCCTCTGCAAACCAAAC	39	4	yes
GATCCCTCTCCCAGCTCTTC	91	40	yes
GATCTGCAGGAGGATGGTAA	57	7	yes
GATCTGCAGGAGGATGCCTG	359	22	yes
GATCTGCAGGAGCCGTTTGC	12	7	yes
GATCTCACTATTGGGAGTTT	2	1	yes
GATCCGCTTCCTGCACGACC	2	2	yes
GATCTTTGCCCTTCTGTGAA	273	24	yes
GATCTGCAGCAACAGCAACT	15	13	yes
GATCCGCGCCTGTGGGGAGC	222	43	yes
GATCTGCACAGAGATGCTTC	10	8	yes
GATCTGCACAACTGTGGCCC	12	10	yes
GATCCGCCGCAACTCCACAG	23	14	yes
GATCTACATTGGGGTCCATG	2	1	yes
GATCACTACTGGCACTTTTT	49	2	yes
GATCACTGGCTGTGGGTTTG	1	1	yes
GATCCCTCAGTGTAGCATAG	77	45	yes
GATCCCTCAGCTTTCTCCAA	241	164	yes
GATCGGGAGTTCAAGGTCAT	1	1	yes
GATCTGCAAACGGGAAGGAG	2	2	yes
GATCTGATTTTGACCAAGAT	458	24	yes
GATCCCGTCAACTTCAAGCT	1287	58	yes
GATCTGATTTTCCCCCTGTT	11	0	yes
GATCTGATTTTACAGCTCAG	9	8	yes
GATCCCGGGGGCTCCAGGAA	26	31	yes
GATCCGCAGACGTCACTCTG	34	2	yes
GATCAAATTCCCACTGCCCC	466	3	yes
GATCTGATTCCCGCAGGTTC	133	19	yes
GATCTGATGTCCTCTCCTGG	25	17	yes
GATCCGAGGGCAGAGGAAAG	13	3	yes
GATCTGTGAGTTCGAGGACA	12	11	yes
GATCTTCTGTTCCCGCTGCT	25	6	yes
GATCCCGCCCAGAGTGGAAG	3	1	yes
GATCCCCTTGGGATTAAAGG	77	29	yes
GATCTGTGCATGTTATTTTT	20	0	yes
GATCCTTGGATGAGAAGCTC	36	7	yes
GATCTGAGTCCCCTGCTGGG	235	10	yes
GATCTGTCCTTTGTGTGCAG	28	4	yes
GATCTGTCAAGGAGAGGGTT	63	14	yes
GATCCCCTGAGAAGCTGTAT	39	4	yes
GATCATAAAGTGAGACTCCT	5	4	yes
GATCTGTACCCTCAGTGCAG	17	6	yes
GATCCCCTAAAACGAGTTGC	51	1	yes
GATCCCCGGCGTCTGTTTGA	812	15	yes
GATCCCCCAAGTTCAAGCCA	145	24	yes
GATCTGAGGCTGAGGGTATA	6	7	yes
GATCTGAGGCAGCGACTGAG	109	8	yes
GATCTGAGGAAGACATTTTG	49	6	yes
GATCTGAGCCCTGTGCCTTC	48	13	yes
GATCTGAGCCCCCTGAGGTT	48	11	yes
GATCTGAGCACGTCCCGCTG	98	2	yes
GATCCCTGGAGCCACCAGCT	30	4	yes
GATCTGAGATGAGCAGTGAC	12	1	yes
GATCCCTGCTTTCATGGAAG	35	1	yes
GATCTGAGAAACGGGGAAGC	12	0	yes
GATCTGACTGCCTGCACAGG	27	1	yes
GATCTTGTTGACAAATCTTT	6	7	yes
GATCTTGTCCAAAATGGTCA	11	5	yes
GATCAGCTGAGCTCCTGTTT	31	14	yes
GATCTTGAATAGCCTGTAAA	5	1	yes
GATCAGCCTGGGCAACGTAG	18	7	yes
GATCTGACTGCAAAGCTTGT	69	5	yes
GATCTGGCGGTGGCTAATAG	3	4	yes
GATCTGACTACCATTTACTG	1	1	yes
GATCTGACGCCGAGGAGGTA	876	169	yes
GATCTGACCTGGGTCCTGAC	1152	113	yes
GATCCCTCAACCCACACATT	9	11	yes
GATCTGACCGGCTGCTGTAC	244	17	yes
GATCTGACCCTAGATTTCTC	21	18	yes
GATCCCTATGGACACTGACA	273	26	yes
GATCAGACTGGTCTTGTGAC	5	1	yes
GATCTTCTTCTCCATGGAAG	2	3	yes
GATCTGGCCTCCCCAAAAGT	54	11	yes
GATCTGGCCAAACTTATCCC	9	2	yes
GATCTGCTTCGGGGACGGGC	8	2	yes
GATCAAAGAGATGATGGCTA	3	1	yes
GATCTATTTTTGCACTGGAA	33	5	yes
GATCAGACTTTTAGCTGCTA	7	6	yes
GATCAGAATCAGCCAGCACC	3	3	yes
GATCTGGAGGGAGGTGGGGT	7	6	yes
GATCTTACTCCTCATTACTT	15	1	yes
GATCTGTTCCCCTCTGAGAC	3	1	yes
GATCTGGAGACAAACATGAG	35	5	yes
GATCAACTCTCTTTGATTTA	1	1	yes
GATCTGTATGCACATATACG	5	6	yes
GATCTGTATGACAGCAACCA	3	4	yes
GATCGAGGAAAGCCCTGTAC	1	1	yes
GATCCAAGAGGACATGGACT	93	10	yes
GATCTGCTGCGTTGTTTGCC	5	1	yes
GATCCACTTCAGAAGCAGCC	14	5	yes
GATCATTTGATTGGAATTGG	18	0	yes
GATCCACTGTTGTCCAGAGG	72	14	yes
GATCCACTGTGTGTCTGGTA	10	3	yes
GATCCACTGTCTTCCTAGAG	150	30	yes
GATCCACTGGGCCAAGGAGC	16	1	yes
GATCCACTGGCTGGATATAG	34	2	yes
GATCCACTGGAGATACAGGT	23	7	yes
GATCCACTGCTGGAAGTACC	1204	10	yes
GATCCACTCTTTTCATACCC	70	18	yes
GATCCACTCGGGGGCTGTGA	58	16	yes
GATCCACTCCTGCAGAGCAC	6	2	yes
GATCCACTCCAGGCTGCGAG	202	12	yes
GATCCACTCAGACGAACAGT	62	7	yes
GATCCACTAATGCAGCTGGT	322	26	yes
GATCCACGTCTCGTCGTCAG	52	4	yes
GATCCACGGGGCACCCGCAC	174	44	yes
GATCCACGGACACCAAGTTA	270	3	yes
GATCCACGCAGCCATCTTGG	23	11	yes
GATCCACGACAGAGTGGAGA	27	1	yes
GATCAAACAGAAGCGCCAGG	11	9	yes
GATCCACCTGTGGTGCTAGT	32	12	yes
GATCAGAGCTACACAATGGC	141	7	yes
GATCAGAGCCGCCTGACTTC	150	11	yes
GATCAGAGCATAGCCTATGT	14	2	yes
GATCCCAGCACCGTCTGTGG	11	9	yes
GATCAGAGCAGGAAGTTTTC	17	0	yes
GATCAGAGCAATGCTGGAGC	78	9	yes
GATCTGCTCGTGTTCCTGTC	26	6	yes
GATCCAACACCTTCTTCTGG	23	18	yes
GATCATGTTCCGCCAGCGGT	35	7	yes
GATCCACCTGCTGCTGCCTC	11	4	yes
GATCCACCTGCCTGTGCCTC	30	2	yes
GATCCACCTACTTTTTCAGC	17	2	yes
GATCCACCCCTATCTGAGAA	20	3	yes
GATCCACCCACCCTGGGCAT	268	21	yes
GATCCACCATCTGTAATGTC	33	6	yes
GATCCACCAGTGCTTCTGCT	178	10	yes
GATCCACCAGGATGTTTGAT	26	2	yes
GATCCACCACATGTGCCAAA	5	5	yes
GATCCACATTTGCTGGTTTG	66	2	yes
GATCCACATTCTCCATTCTA	2	2	yes
GATCCACATTACCATCAAGC	39	14	yes
GATCCACATGTGCTCGCAAA	5	5	yes
GATCCACATGTACCATCAAC	72	10	yes
GATCCACATGCGTGTAGCAG	200	34	yes
GATCCACATGAGGAGATACT	179	3	yes
GATCCACATCTCCCTCCCCT	11	2	yes
GATCTAGTGCCTAGTGTTGC	11	10	yes
GATCAGACCGACGTATGCAG	5	4	yes
GATCAGACAGTTAAACTGTG	25	21	yes
GATCTGCCTTTATTATGTTC	30	26	yes
GATCTGCCTTGGGAGAGGGC	17	1	yes
GATCAGAATGGACCAATCCC	19	6	yes
GATCTGCCTGCTGCTGTGAC	2	1	yes
GATCTGCCTCCGGAACTTGT	2	3	yes
GATCCACAGTCAGCAAATCC	32	0	yes
GATCCACAGGGTACCTCCCT	3	3	yes
GATCATTTTCGATGAACCCC	5	4	yes
GATCCACAGGCAGTTGTGCC	30	4	yes
GATCCACAGGAGGGTTCCAA	116	7	yes
GATCCACAGCAAATTGAACA	44	9	yes
GATCCACAGATTTTCTTGGG	26	8	yes
GATCCACAGAAGCACTGCAG	63	4	yes
GATCCACAGAAGACCTGATT	11	2	yes
GATCCACACTTGGATTCTCT	1	1	yes
GATCCACACTTCTGAAGACT	5	5	yes
GATCCACACTGCCACTAAAA	4	4	yes
GATCCACACTAATATCGCTG	145	10	yes
GATCCACACCTGAAATGCTA	20	7	yes
GATCCACACCCTAACTCCCA	10	9	yes
GATCCACACACGACTCTCCA	31	1	yes
GATCCACATCTTCAAATGCC	1143	58	yes
GATCCACAAGTCTTAGCTGT	323	39	yes
GATCCACAAGCGACTCATTG	800	40	yes
GATCCACAACCTGATTCCCG	32	2	yes
GATCCACAGTGCCTTCAGGA	27	1	yes
GATCCACAAAGGCAGAGCCC	49	4	yes
GATCCAATTTTGGAAGCATT	7	5	yes
GATCCAATTGTGGTGTTCTG	25	1	yes
GATCAGAAGGCTGAGCACTG	51	1	yes
GATCTGCCATCCCCTTCAGA	38	1	yes
GATCAGAACACCCCACATTT	73	11	yes
GATCAGAAATGGCGCCACGC	34	12	yes
GATCTGCCACTGAAGTAGAC	34	6	yes
GATCTGAGAGATACAAGAGA	60	11	yes
GATCCAATGGCATCTTCTGG	50	9	yes
GATCCAGCAGGAGCATGAGC	5	3	yes
GATCCAGAGGCAGGTGCAGA	95	9	yes
GATCCAATCTTTGTCTTAGG	172	15	yes
GATCCAATCGACTGGGTTTC	105	18	yes
GATCCAATCCCTGTGCAGCA	36	1	yes
GATCCAATCAGGGCAAGAAC	42	13	yes
GATCCAATAGTGAACAAAAA	7	0	yes
GATCCAATACTGTCTGGAAA	73	6	yes
GATCCAAGTTTGGATAATGA	26	6	yes
GATCCAAGTTGTACATGAAT	2	3	yes
GATCCAAGTTCGAAACATGG	17	6	yes
GATCCAAGTGTTTAACCATA	150	2	yes
GATCCAAGTGCTTCAGCAAC	7	1	yes
GATCCAAGTGCCCTTCTGCT	26	11	yes
GATCCAAGTCCAGGAACCCT	555	91	yes
GATCCAAGTCATGATTTGAA	68	12	yes
GATCCAAGTCACCCCCCGAA	10	9	yes
GATCCAAGTATTGGCACCCA	41	6	yes
GATCCAAGTATGAGATGGCT	3	3	yes
GATCCAAGTACTACCATAGG	10	9	yes
GATCCAAGTACACCTAAGGG	188	25	yes
GATCCAAGGTCAAGGCAGAG	152	28	yes
GATCCAAGGCCTCAGGTCAC	144	27	yes
GATCCAAGGAGTGGTACCCA	202	44	yes
GATCCAAGCTCTGGGAAGCA	5	1	yes
GATCTGCCAAACGCTATGGC	12	6	yes
GATCATTCCCACAGCCAAAA	4	3	yes
GATCATGTGCCTACCCTGAC	32	4	yes
GATCCAAGCGTGAGCCAGTC	42	1	yes
GATCCAAGCAGGTGCTTCCT	12	11	yes
GATCCAAGCAGGCCCCTTAT	140	6	yes
GATCCAAGAGGAGGAGCACA	26	6	yes
GATCCAAGACCAGGGTGGCT	111	18	yes
GATCCAAGAAGTCAGTCGGC	248	22	yes
GATCCAAGAAGAAAAGCAAG	171	10	yes
GATCCAAGAAAGGAAGAAGA	25	3	yes
GATCAGGTTATTTACTGGGG	15	0	yes
GATCCAACGTGTTAGCCTTG	307	4	yes
GATCCAACGAGTAGGAGTGT	11	4	yes
GATCCAACGAAAAACACTTG	94	10	yes
GATCAGGTACCTCACCCTGC	25	7	yes
GATCAGGTAATGTATTAAGT	4	4	yes
GATCCAACCCCACCTCAAGT	59	22	yes
GATCCAGCACGCTCAACATC	26	10	yes
GATCCAACCAACCTGAAGAA	7	3	yes
GATCCAACATTGTCTTCTGG	4	5	yes
GATCCAACATGGAAGGTGTA	21	22	yes
GATCCAACAAAGGTTGTGAG	227	15	yes
GATCACTTCCTTCTGGAATC	29	18	yes
GATCACTGTGGCGTCTTGAA	33	17	yes
GATCACTGTCGTGTTTGGTA	65	17	yes
GATCACTGGCCCCGATGGTG	148	2	yes
GATCACTGGAGGCCAGAGAA	24	0	yes
GATCACTGGAGCAGGCCTCC	2	3	yes
GATCATGCTCTGGCTGAGTT	789	26	yes
GATCCAAATCTTCCAGGCCC	114	1	yes
GATCCAAATCTTCAGTGTAG	1	1	yes
GATCCAAATATTGTCATAGC	147	18	yes
GATCCAAGCAGGTTGGGGAA	176	3	yes
GATCCAAATACCCAGGATAA	10	1	yes
GATCCAAAGTTGGCCAGCAT	63	8	yes
GATCCAAAGTGTTATGTCAA	57	3	yes
GATCCAAAGGCAGCAAGAAG	22	4	yes
GATCCAAAGCTTTCCCATTT	40	5	yes
GATCCAAAGCTGCTTAAATC	159	25	yes
GATCCAAAGCTCAGGAGACA	7	6	yes
GATCCAAAGCCCCAGTAGAA	5	5	yes
GATCCAAAGCAGTGCTCCCA	90	19	yes
GATCCAAAGAGAGAAAGAGC	115	14	yes
GATCCAAAGACTCAGGTGTT	4	0	yes
GATCAGCCCAGACCTTCTCA	4	0	yes
GATCCAAAGACACAGTCTGT	602	48	yes
GATCCAAAGAAGACAAAATG	19	6	yes
GATCCAAACTTAACGAGCCC	403	70	yes
GATCCAAACCCCAGTGTACC	347	89	yes
GATCCAAACCCAGAGACCAA	14	7	yes
GATCCAAACACTTTTATTTT	1	1	yes
GATCCAAACAATAGTATTCG	1	1	yes
GATCCAAACAAGAAGACTGA	13	4	yes
GATCCAAACAAAGACACAAG	528	91	yes
GATCCAAAATGTGGCATTTT	152	2	yes
GATCCAAAAGGTTACTGAAA	3	3	yes
GATCCAAAAGGAGACTTCTA	39	2	yes
GATCACTGCAGCCCCAAACT	242	9	yes
GATCCCGCCAAAAGAATTAA	16	19	yes
GATCATGCACAAACCACTAC	26	2	yes
GATCACTGAAGTGGGGCTGT	3	1	yes
GATCATGACTCTTTGAGATT	1	1	yes
GATCACTGAAGCTCCGCATT	3	3	yes
GATCTTCTTGCTGGTCTTGC	57	3	yes
GATCCTGCTATTGTTCAGTC	1	1	yes
GATCCGTAGACCTCCGTCCT	78	7	yes
GATCCAAAAGCAGCGTTTGC	95	15	yes
GATCCAAAAGAGCCTGATGG	14	1	yes
GATCCCTAACTGAAGGGGTT	5	6	yes
GATCCAAAACAGCACGTCTT	59	1	yes
GATCCAAAACAGCAAATAGG	151	3	yes
GATCCAAAAATGGGGATGTT	45	14	yes
GATCCAAAAATGCTGGACTT	39	8	yes
GATCCAAAAATACAGCCTGC	62	7	yes
GATCCAAAAATAACCTTAAC	23	21	yes
GATCCAAAAAGCTAATAAAA	14	3	yes
GATCAGATACTACCTCATGG	3	3	yes
GATCAGAGGCATTTGAACAG	23	1	yes
GATCAGAGAGCAGTCAGAGG	2	2	yes
GATCATTTTTTGTCTTACTA	1	1	yes
GATCATTTTTCTGTAGCCAT	105	13	yes
GATCATTTTTCCAGAACTCT	23	9	yes
GATCATTTTTATTGTGGGGT	9	8	yes
GATCATTTTGTCGAGTGAGT	82	14	yes
GATCAGAATTCCCACTGCAT	43	6	yes
GATCATTTTGTAAAGTACAG	693	14	yes
GATCATTTTCTGCCGTACCA	25	9	yes
GATCATTTTCTGACTTTTGT	127	3	yes
GATCATTTTCCCAACGTTAC	38	7	yes
GATCATTTTCAAGTTACCCA	4	4	yes
GATCAGAACCCAGCTGAGTG	17	2	yes
GATCATTTTACTGGTGACTT	25	1	yes
GATCTTTCCCATCTCAACTG	48	9	yes
GATCATTTGTCTAGTAATTG	1	1	yes
GATCACTTTTAGAAAGCAAA	4	4	yes
GATCACTCCTTGCTTTGCCA	20	5	yes
GATCATCTGTCCAGACGGCA	12	11	yes
GATCACTCAGGGTGGGCAGT	44	9	yes
GATCACTCAGGACGGTACCC	176	11	yes
GATCACTCACGAGAACATCT	78	0	yes
GATCACTAGCAAGCCAAAAT	22	4	yes
GATCATCGTAAATGACAATC	28	2	yes
GATCATCGCTTAGGAAACCA	27	3	yes
GATCACTAAGTTGAGCAGTT	38	2	yes
GATCACTAAAGGGTTTCCTG	122	11	yes
GATCACGGTCACTTTCAACA	122	3	yes
GATCATTTGGTGCTAAAACA	13	3	yes
GATCACTTGTAAGCTCACAC	24	0	yes
GATCATTTGCGTTTGGAGGT	166	1	yes
GATCATTTGATTCCCCTCCC	7	6	yes
GATCATTTGAAAACTTAGAA	5	5	yes
GATCATTTGAAAACTGAGAA	26	5	yes
GATCTGCGCTTCCAGAGTGA	21	26	yes
GATCATTTCTTTTATTTCTC	2	2	yes
GATCATTTCTTTCTGGCCTG	72	12	yes
GATCACTGGCAGCTCTTTCA	5	5	yes
GATCATTTCTCGCTCAGATT	26	2	yes
GATCATTTCGGTGACTGAAG	10	1	yes
GATCATTTCAGTGAGATTGG	29	5	yes
GATCATTTCAGGTGAGCAAT	33	4	yes
GATCATTTCACTGGTGGCTG	65	1	yes
GATCACTCAAGTTACTTAGT	3	3	yes
GATCACTAGGGGTCCAAAGA	3	3	yes
GATCACTACATTTCCCCAAG	4	4	yes
GATCATTTACAAACTCACAT	1	1	yes
GATCACTACACCTAGCAGAA	5	3	yes
GATCATTTAACTGGCATTTT	27	11	yes
GATCACGGGTTCTAGCCCAG	6	6	yes
GATCAAGCTTGTGGCTGCTT	2	2	yes
GATCATTGTTGTGTATGAGA	1	1	yes
GATCACCTTTTGTCCCTCTG	4	4	yes
GATCACGATGCCACACCCTG	12	10	yes
GATCACGATAAGCTCATCAG	10	8	yes
GATCCTATTCCCGTGCCCAG	7	6	yes
GATCCGAATCTCTATACAAG	11	2	yes
GATCATTGTGGCCCCGCCCC	171	33	yes
GATCATTGTGAACACCTCGT	134	13	yes
GATCATTGTCCTCCAGTCAG	44	7	yes
GATCATTGTCAACTAAGTGC	90	29	yes
GATCATTAACACAGCTGACT	10	2	yes
GATCACCTCCTCCATCAACC	6	6	yes
GATCATAATCACAAACAGCC	3	1	yes
GATCACCTAACTTCTAAGAA	8	7	yes
GATCACCGCCCTCTCCTAGC	9	8	yes
GATCACCGACCCCAGCAGCA	4	4	yes
GATCACCCTTGTCTACAGAG	13	0	yes
GATCATTGGTTGAATCGGTT	39	1	yes
GATCATTGGAGAGGGGTCTG	47	0	yes
GATCACCATGAATTTGAAGC	8	7	yes
GATCTTAGAGAAGATTCGCA	11	13	yes
GATCACCACCGTCACTGCAC	38	3	yes
GATCATTGCCACGGAAAACA	16	20	yes
GATCATTGCATTTGTTGTCT	26	6	yes
GATCACCACACCCTGCTACA	4	4	yes
GATCATTGATGTTGTCTACA	4	5	yes
GATCACATAAGGGCAGCTGT	12	3	yes
GATCATTGAGAGCAAGCGAG	23	8	yes
GATCACAGCTAACACTGCAT	10	1	yes
GATCACCTAGATGACACTTG	13	2	yes
GATCACCGCTGCCGCCTGGG	35	1	yes
GATCACCGCCTGCACCGCAG	133	11	yes
GATCATACCCGTCCCTCTCT	21	1	yes
GATCACCCTGTCTCTTTACC	7	2	yes
GATCACCCTGGGCCTGGTCA	113	16	yes
GATCACCCTCAGCTGAAGAC	16	1	yes
GATCTGAGAGGAGTGTGTGG	33	3	yes
GATCCCTGGAACCTGCAGTT	35	7	yes
GATCACAGCATTCAGGAGTC	15	13	yes
GATCATTCTCCAAAGGCAAC	236	26	yes
GATCATTCCTAAGTTTTGAC	7	6	yes
GATCACAAGTAAATGCCATT	5	1	yes
GATCATTCAGGCAATCACGA	28	2	yes
GATCATTCAGGACAAAGGAG	76	44	yes
GATCATTCAGACAGTACATT	17	1	yes
GATCATTCACATGTGAAACA	1	1	yes
GATCATTCACAGAACAGAGT	12	2	yes
GATCATTATTTGTGTCAGAA	2	2	yes
GATCATTAGTGCAATAGCAA	10	3	yes
GATCATTAGGGGTTTGGTCT	54	21	yes
GATCATTAGCCCACATACCC	335	38	yes
GATCATTAGCATGCCAGGAA	92	8	yes
GATCATTACTGTGTGAGTGT	49	4	yes
GATCATTACACGGAGAACAC	10	9	yes
GATCCAAACGTCAAGTCAAT	38	15	yes
GATCAAGGTAGTACTTTGAG	55	11	yes
GATCTTCATATCTGTTGCAT	31	5	yes
GATCCCTGATGTCTGTCACT	2	2	yes
GATCATTTTTCAGCCTAGCA	18	5	yes
GATCATTATCGCCAAGATTG	2	2	yes
GATCAAGGGGGCAAAGCTTC	13	2	yes
GATCAAGGGGCAGGAGAAGC	20	3	yes
GATCAAGGGGCAGCTGGAAC	18	7	yes
GATCAAGGAACCCCTGTGTG	6	0	yes
GATCAAGCTTGAAAAAGTTT	3	3	yes
GATCCCTATGTAAAGATTCA	22	2	yes
GATCCAGCAGTACCTGAAGG	15	2	yes
GATCAGGAAAACCATCCATT	98	11	yes
GATCTTCAAGAAGTGAAAGA	8	7	yes
GATCCCTAGGGCTTGTGGCT	12	6	yes
GATCACAAAGTTCTCCTTCT	5	5	yes
GATCAGGTCTTCTTGGCTGT	4	4	yes
GATCAAAGGTGTATGTCACC	4	4	yes
GATCAAAGGTGGAGGGATGG	13	1	yes
GATCAAAGATGGCCCAGCTG	4	4	yes
GATCTGGGAAGTACCCACGG	19	2	yes
GATCAAAAGTGGGCATTACA	11	4	yes
GATCCTTGTCCTCACTCTCC	69	3	yes
GATCACTATCTTGATTCAAC	9	8	yes
GATCAAAAATTAGCAAATCC	13	2	yes
GATCCAGACGACCCTCACAG	1	1	yes
GATCATGTAATACTTAACCA	42	7	yes
GATCTTGTTGCCAAATGGTG	14	7	yes
GATCTGTGGTGGAGAAGGTA	42	1	yes
GATCCTTCTGAATGCCTGCT	81	14	yes
GATCTTTACCTCTGCATTTA	4	2	yes
GATCAAGGCTCCCGGTTTGC	12	3	yes
GATCTACTTTAGTTAGCTCA	1	1	yes
GATCTGTGGATGGGAAGGCA	32	39	yes
GATCTGGATTTTAGGTGGTA	128	10	yes
GATCTGCTAACTGAAAGCAG	108	7	yes
GATCATCACCATCACCGTCT	1	1	yes
GATCCACATGTCCTCCTGTG	9	0	yes
GATCCTTGCAATACCCTGTC	2	3	yes
GATCTGTTTACAAGGTTTGT	339	34	yes
GATCCACAAGAAAGAAAGTG	15	4	yes
GATCCAATTCTGTTCTTCTC	2	1	yes
GATCCGTCTTGCCACCAGTG	6	6	yes
GATCCAACGAAACGATATTA	9	1	yes
GATCCCCAATATGCTGTTGA	26	11	yes
GATCCCCAAGGCAGCTACCA	20	24	yes
GATCTGGAAGGGCCTAAATG	2	3	yes
GATCCAAATGAAGCATATCG	308	41	yes
GATCCAAAGGTCGCCAGACA	35	1	yes
GATCCAAACCTCGGCACCCC	37	0	yes
GATCCCAGTGGATGAGCATG	26	1	yes
GATCTGACCAGTTTTAACAT	10	0	yes
GATCTGACCAATAGTACACA	63	10	yes
GATCTGACCAACTAGCTTTT	32	27	yes
GATCCCAGCAGCAGAGCATG	9	1	yes
GATCTGACACTCTTCTGGAG	104	18	yes
GATCCCAGCACCGAGGGGAA	397	20	yes
GATCTCCTTTGACCTCCCAC	16	7	yes
GATCTGACAACAAACCAGAA	9	8	yes
GATCTGACAAAGAAAGTTTA	15	1	yes
GATCTGAATGGGTACCGAGG	9	8	yes
GATCCCGGACGCGAACCCGG	18	2	yes
GATCTGAATCTGAAATCCCA	40	7	yes
GATCATTTGGAACGTGGCTG	9	0	yes
GATCTGAATATTCTGGAAAA	27	5	yes
GATCTGAAGTTCAAATTCCG	108	9	yes
GATCTGAAGTCTTACAAAGC	8	1	yes
GATCATTTGAAATTGCTGAT	41	8	yes
GATCCACAAAAATTTAACAG	27	23	yes
GATCATTGGGGTCATCTTGT	34	7	yes
GATCCCAGAATCCAAGAAGT	293	22	yes
GATCCCACTGCACCGCCATT	14	2	yes
GATCCCACTGCACATAGGAC	20641	784	yes
GATCCCACGGGGTGCAGTGA	210	20	yes
GATCCCACCTAGCAGCCACC	100	8	yes
GATCTGAAGGGGTGCCCTAT	12	14	yes
GATCCCACCCTCATCCACAG	2	2	yes
GATCTGAAGGCACATGCTTA	2	3	yes
GATCTGAAGGAGTCCAGGGT	180	25	yes
GATCCCCTGCAGAAGCCTGT	44	17	yes
GATCTGAAGAGGAATCTGTA	33	5	yes
GATCTGAAGAATTTTGAAAG	102	9	yes
GATCTGAACTTTGTACAGGA	250	24	yes
GATCCCCTCTCAGTGGCTGA	4	0	yes
GATCCCCTCCCTCATGTTAA	15	3	yes
GATCAAACAACCCAACAGGA	13586	5615	yes
GATCCCCGTGTCTGTGGAAA	4	4	yes
GATCTGAAAGTAGACTCTGC	121	21	yes
GATCTGAAAGATAACTGAAA	3	1	yes
GATCTGAAACCAGAGAAAAA	9	8	yes
GATCATGTTATGGGCTGATA	9	2	yes
GATCATGTTACATCACCGAT	39	6	yes
GATCCCGGCCTCACGCCACC	6	0	yes
GATCTGCATGAAACAGCATA	21	2	yes
GATCTGCAGGCTCGTAGCTA	25	27	yes
GATCCCAAGTTTTTCCTTAA	285	18	yes
GATCCAGGCTTCACTCTGAA	12	5	yes
GATCTGAAAATGTGTCTAAG	39	9	yes
GATCTGAAAATCACATGAAG	14	13	yes
GATCTGAAAACCATGCCTGA	100	32	yes
GATCTGAAAAACAACTCCTA	193	15	yes
GATCTCTTTTCCTGACCCTC	328	30	yes
GATCTCTTTGTTAGACATTG	5	2	yes
GATCCCAAAGCCTCGTATGC	35	29	yes
GATCTCTTTCCCCGAGTTGC	1	1	yes
GATCCCCAGTCCAGGATGTG	1	1	yes
GATCTCTTCTCAGTTGATTT	19	1	yes
GATCATGGTCTCACACGGTA	47	10	yes
GATCCATTCTTCACCCTTGA	8	7	yes
GATCTCTCTTCATTTCACCA	112	6	yes
GATCCATTCGCTGTAACATG	26	13	yes
GATCCATTCCAGAGGGACAT	10	2	yes
GATCTCTCCCCCTCGCCTCT	54	45	yes
GATCCATGTTTTCCAGGTAT	5	1	yes
GATCCATGTTGACCAAATGC	29	1	yes
GATCTCTCAAGTGGCTGGAG	3	3	yes
GATCCATGTGTTGGTTGAGA	147	15	yes
GATCCATGTGATTGGAAAGT	8	5	yes
GATCCATGTGATGGACTGCA	14	2	yes
GATCTCTATCCTGTTGACAG	10	9	yes
GATCACGTACTGTGCCTTGT	22	2	yes
GATCTCTGTGGTTGTCAATG	1	1	yes
GATCTCTGTGCTTGGTGAGG	10	1	yes
GATCCATGGTGGGGCCATTT	7	6	yes
GATCCATGGTAGTCAGATAG	35	0	yes
GATCTCTGTCTCTAAAAGAT	41	11	yes
GATCTCTGTCCGAACTGTGA	23	1	yes
GATCTCTGTCCACTGTATGC	5	5	yes
GATCTCTGTCAGGCCTCTGA	20	19	yes
GATCCCATCAGGATGCTTAT	3	3	yes
GATCCACTCATAATTCGGGT	28	4	yes
GATCATGAGCGGAAGGGTTT	12	3	yes
GATCCATGGGCTCCTTTGTG	4	5	yes
GATCCATGGGCCTTAGGGCT	36	3	yes
GATCCATGCTCTGATGAGCG	56	7	yes
GATCCATGCCTGTAATCCAG	12	10	yes
GATCCATGATATTGTCTTGG	2	0	yes
GATCTCGGCCAAAGGCGAGC	53	15	yes
GATCCATGAAGTTTTCAGTC	45	6	yes
GATCCATGAACTCTAACTCC	7	6	yes
GATCCATCTGCATTTGCGGC	814	26	yes
GATCCATCTGCACATGGCTC	149	22	yes
GATCTCTGGGAAGGGCTGCG	9	2	yes
GATCTCTGCTTAGGTGACAG	40	9	yes
GATCTCTGCTCCCCGCCTTT	157	1	yes
GATCTCTGCTATGAGGCTAC	764	106	yes
GATCTCTGCGGTTTGCTTTT	34	0	yes
GATCCCAGGAAGTCCCACGA	131	27	yes
GATCACAATAAGACTGACGT	9	8	yes
GATCTCTGAGCTGCTGCCGT	13	16	yes
GATCTTGACATGCAAAAGTC	13	3	yes
GATCTCTCTGTTCTCCTGTG	92	25	yes
GATCTCTCTGTGACGCCCAT	11	2	yes
GATCCAAAGTCCAAAATGGT	3	3	yes
GATCTGGCCTTGCTTCTACA	26	5	yes
GATCTCCGAGCACACGTATT	15	6	yes
GATCTCCCCTCTCTCTTGTC	68	18	yes
GATCAGGGGATTGGATGAGG	21	8	yes
GATCTCTCTCGGCAACTAGG	6	5	yes
GATCCATAGGGAAATTGTCC	20	17	yes
GATCTCTCTCCCTCTACACA	111	32	yes
GATCTCTCGCCTGGACCCCT	367	51	yes
GATCCATAATTGATTGTGTC	28	4	yes
GATCTCCACTTTTCTAAAGA	1	1	yes
GATCTCCACGTGTGTCATAG	37	8	yes
GATCTCTCCAAAGCACACGC	241	1	yes
GATCTCTCAGGCCATGGGTC	105	5	yes
GATCTCTCACTGATGCCAGC	7	0	yes
GATCTCTCACGCAGACAGAA	119	1	yes
GATCCACGCCCGCTACATCC	2	2	yes
GATCCAGTTTCCTCACAAAT	23	1	yes
GATCCAGTGTGGAAGAGGTG	60	5	yes
GATCAGACACTCAGACTACC	12	0	yes
GATCTCGGTGGCCAGCTTCC	23	28	yes
GATCTCATCTCGGATGCTCT	2	1	yes
GATCCCACTCTCTCAGTCCT	1	1	yes
GATCTCGGGAATCAGAGTTC	67	1	yes
GATCTCGGAGCTAAGTGTAT	157	59	yes
GATCTCGGAGCAGAGATAGA	4	5	yes
GATCTCGGAATGGACCCCAA	383	41	yes
GATCTCGGAAGTGAAGATGG	161	11	yes
GATCTCGCTTACAAGAAACC	35	29	yes
GATCCCACCTCCCCCCAGTC	167	33	yes
GATCTCATCAGACATCCTGC	7	6	yes
GATCTCGCCTTATGTTGTCC	35	3	yes
GATCTCGCCCTGTCAAGCAT	54	0	yes
GATCTCGCAGCCTTCCCCTC	358	22	yes
GATCTCGCAAGCACAAAGCC	117	5	yes
GATCTCGAGTCACAGCCAGC	20	24	yes
GATCTGCTCGCCTCCTAACA	4	4	yes
GATCAAAGCATGCACCTGTA	596	64	yes
GATCTCCTTGGAAAGCGACT	28	26	yes
GATCAAACTGTCTCCAACGT	3	1	yes
GATCTGAAGGTTCCCCGTTG	20	1	yes
GATCTGAAGAAAAGAAGAGG	23	3	yes
GATCTGCTTTTTGTAAGTGT	29	1	yes
GATCCAGGGTGGGAAGGAAG	241	4	yes
GATCCAGGGGCACTGCCCCT	117	18	yes
GATCTCAGCTCCTCCGCTCG	19	18	yes
GATCTGCTGTGAGGTGACAG	23	4	yes
GATCCAGGAGACTCGAAGAT	54	9	yes
GATCCAGGACTGTGACTTAA	4	2	yes
GATCTCCTGTCTCTATGAGG	5	5	yes
GATCTCCTGTCTCCACCCAC	20	5	yes
GATCCAGCTTCCCTCCGAGA	239	8	yes
GATCTATTCCTCAACCCTGT	31	6	yes
GATCTCCTGCCTAACCACTC	17	16	yes
GATCCCAAGGCTCAAAGAAG	1	1	yes
GATCAAGGTCACACCCATAA	26	22	yes
GATCCAGCCTTCTTTCACAC	68	7	yes
GATCTCCTCAGGCACCAGGC	5	5	yes
GATCTCCTACAATGAGACCA	53	19	yes
GATCTCCGTTGATGTAGTGA	30	0	yes
GATCTCCGCCCGAGCCTACG	79	10	yes
GATCTCCCTGGTCCTGGCAT	3	1	yes
GATCAGGGAAAATTTCCTCT	12	1	yes
GATCTCTTGCATGTGCTCCT	51	1	yes
GATCCAGCATGGGTGTCCCG	33	31	yes
GATCTCTTAAGTTGAAAGTC	11	9	yes
GATCTGCATGCCTCTTGGCT	2	3	yes
GATCCAGCATCACCCAGACA	154	1	yes
GATCCAGCAGACCCAGCACA	110	1	yes
GATCCAGATTACTATGGGGA	38	1	yes
GATCCATTTTGTTCGTGGAC	88	7	yes
GATCTCCCCTCTTCCTGGAT	86	15	yes
GATCCAGAGTAAAGACAGCT	43	4	yes
GATCTCCCCGAAGGAGAGAT	45	4	yes
GATCCATTGTACTACAAGTT	40	2	yes
GATCTCCCCACCACCCCAGG	28	10	yes
GATCTCCCCACAGTACACAG	51	4	yes
GATCAGCTGGAAAACAGGCT	11	3	yes
GATCATAGTGTTCAGTGTCT	14	17	yes
GATCCATGTCATCGTTCATT	3	1	yes
GATCTCCATTGAGGAGTTGG	44	41	yes
GATCTCCATCCAGGACTAAG	33	7	yes
GATCTCCATCACGAAGACAG	2	3	yes
GATCCATGCTTTGCCCGAGA	189	20	yes
GATCTCCAGGGTGGATTTCT	30	4	yes
GATCTCCAGGACAACAGACA	5	5	yes
GATCTCTGGCTCTGAGCATC	26	2	yes
GATCTGATATCTCTGGCCTG	56	4	yes
GATCTGATACATCAAACACA	108	1	yes
GATCTCTGCCCAGGATGGAC	225	13	yes
GATCTCTGCAAGAACGGGCA	144	1	yes
GATCCTTCTCTGTGTCAGCT	38	5	yes
GATCTGAGCTCACTGACCAG	7	1	yes
GATCGTGGCTTTGACCCCAG	19	0	yes
GATCTGACTGATGTAAGTAG	2	2	yes
GATCTCCAGCCTCGCCGTGA	3	3	yes
GATCTCCACTCCGCCACCTG	5	5	yes
GATCTCCACCCTATGCGAGT	213	26	yes
GATCTCCACACAGCACACAG	202	8	yes
GATCTCCAATGCTGGGTCTG	16	15	yes
GATCTCCAAGTCTCTCAGTC	25	5	yes
GATCTCCAACTGTGCTTTCA	46	1	yes
GATCTCCAAAGTCCTGCTAG	142	5	yes
GATCTCCAAAGAGTTACTCG	3	3	yes
GATCCATCAGCATTAGCACA	34	0	yes
GATCTCCAAAATCAACAACA	103	7	yes
GATCCATATCCTGCTCCACC	22	0	yes
GATCTCTCACAAAAGGCATA	51	1	yes
GATCTGACACAATCACAAAG	21	8	yes
GATCTGAATGCCTTTAGATG	40	7	yes
GATCCATCATGCCCTGGACG	17	0	yes
GATCTACACTGGCCTGAAGA	41	0	yes
GATCTCTTGTGTTTGGACTT	5	1	yes
GATCTCTTCCATGAGCAAGC	27	3	yes
GATCGGCATTGCCAGGCCCT	2	0	yes
GATCGGCAGCCTGGCTACGA	6	6	yes
GATCGCTTATCATGTCCTTG	44	5	yes
GATCCTGCTGCAAGATTTGT	1	1	yes
GATCTCGCTGTGGATTGGAT	2	0	yes
GATCTCTGGGAAAAGAGTCA	13	12	yes
GATCTCCTGTATACTCCCAG	3	3	yes
GATCTCCTGTAATTTTGTAG	111	8	yes
GATCGGTGCTGTGCTCTACC	12	5	yes
GATCGCTGACTTTTTGCGCA	18	3	yes
GATCGCTGACAAAGCGTTCT	98	0	yes
GATCTCTGACATTAGCGTCC	15	1	yes
GATCGCTAAGTACATGGAGT	10	2	yes
GATCTCTCCAGTGCGGTCTT	5	3	yes
GATCGCCTACAAGCGACACA	13	6	yes
GATCTCGAATCGTCATGGAT	3	1	yes
GATCTCCCACTGAGTCAGGG	9	11	yes
GATCTCCAGCAAAAGCCAGC	36	11	yes
GATCTCATTGTAGATGGTTG	3	3	yes
GATCACCCAGGAAGAGAAAT	30	2	yes
GATCTGAGAATTCTCCCTGG	42	17	yes
GATCACCATCCTGATTATAT	10	9	yes
GATCACCAGGAAACTTGAAA	32	2	yes
GATCAGTTCCTCTTCAGAAT	4	3	yes
GATCACCAGAAGCCATGCTC	33	6	yes
GATCTGACTTATCGTCCACT	24	4	yes
GATCAGTGGTACAGTGTTTG	2	0	yes
GATCTCAGTGATTTTGTAAG	2	2	yes
GATCTCAGCAAAGAAGAGAG	7	3	yes
GATCTCAGAACCAATAAAAA	10	12	yes
GATCTCAAGTCCTGCAGATA	3	4	yes
GATCATTAATGCCCTTGAAG	121	21	yes
GATCATTAAGAAAGTACTTT	28	2	yes
GATCATGTTGATTCTGAAAT	151	1	yes
GATCATGTTCTTTCCGCAGG	228	28	yes
GATCATGTTCGCCTGGACAC	29	11	yes
GATCATGTTCCTGGAGGTCA	55	15	yes
GATCATGTTATTCTGTCTTT	15	6	yes
GATCATGTTACACTTGCCAG	59	7	yes
GATCATGTGTAAGTGTCAAA	60	8	yes
GATCATGTGGCGTTCTCTCT	5	3	yes
GATCATGTGGATTCCAGGAA	52	4	yes
GATCATGTGGAAGGTGAGAT	3	1	yes
GATCATGTGCTCACCTGCAT	23	11	yes
GATCATGTGATTTTCATTTC	4	2	yes
GATCACATTTTGCCTTTGGT	41	8	yes
GATCAGTCCTCTTCAGTTTC	10	8	yes
GATCGTTTTGTTTTGTTTTG	11	2	yes
GATCACATGACCCCTGAAAT	13	2	yes
GATCTATGGGTGAAACACAG	11	1	yes
GATCTATATGTATGTGCTAC	20	0	yes
GATCATGTGATGCTAAACTC	3	3	yes
GATCATGTGAGCATCGTGGA	317	15	yes
GATCATGTGAGAACAGGCAT	24	2	yes
GATCATGTGACAAGTGAGAG	143	24	yes
GATCATGTCTTCTCCATGTT	1398	304	yes
GATCATGTCTGAAAAATCCA	121	11	yes
GATCATGTCTCAAGGTGGCA	30	14	yes
GATCATGTCTATCTCAGGGG	51	1	yes
GATCATGTCCCACAGGCATT	50	6	yes
GATCATGTCATTGCCTGTTA	107	8	yes
GATCATGTACAGAGGTCTTT	87	10	yes
GATCATGTACAAGCTGATGG	372	31	yes
GATCATGTAAAGACGCTGGG	50	6	yes
GATCATGGTTCAAGTGACAA	23	5	yes
GATCATGGTGTGGCTTGTGG	60	12	yes
GATCATGGTGTCTTGTGGTT	102	2	yes
GATCATGGTCTTCGGAAAAC	16	1	yes
GATCAAGCTTCGTGGCTTTT	644	52	yes
GATCATGGGTGTGCCAGGGG	95	9	yes
GATCATGGGGTTCTGACTAT	2	2	yes
GATCATGGGGTTCAGTCTTC	60	4	yes
GATCATGGGGATGGACGGGG	15	2	yes
GATCATGGGCTTTCTGCTTC	3	1	yes
GATCACATAGACCGGACCAG	24	4	yes
GATCACAGGGAGTGATAAAG	3	3	yes
GATCTCAGTTCTCTCATGGT	5	1	yes
GATCACAGGCCTGAGCTGGG	6	2	yes
GATCTGTCTACTTTTCCTAT	10	0	yes
GATCATGGGACTTGTAATCA	4	4	yes
GATCATGGCCTTTACGATGC	7	1	yes
GATCATGGCCTTCAGATATG	227	37	yes
GATCATGGCCCAGACCTGAG	9	4	yes
GATCATGGCATTTAGTTAGT	25	3	yes
GATCATGGCAAAGGATGACC	144	11	yes
GATCATGGATGTGTGGGGAA	55	7	yes
GATCATGGACATGAAGGAAG	71	17	yes
GATCATGCTTTCTTCTCTAT	136	25	yes
GATCATGCTGTGTTCGTGAT	175	14	yes
GATCATGCTCCTGCAGCTGA	99	7	yes
GATCATGCTCCTGAGTGGCA	13	6	yes
GATCATGCTCATCTTCACTG	11	0	yes
GATCATTGGGGGAGGGTAGT	93	10	yes
GATCATGCGCCTTTCTAAGC	137	28	yes
GATCATGCCTTCTGTAAAGC	2	0	yes
GATCATGCCTGGGGGAGCCC	26	4	yes
GATCACAGTGGCTATATCTC	30	23	yes
GATCACAGCTGTGATGGGAG	328	48	yes
GATCACAGCTATGCCCTTTC	31	13	yes
GATCAGGAAAATCTCTCATT	14	3	yes
GATCGTGTGTTGCCATTTTG	1982	289	yes
GATCACAGCAGCCCAAGCTC	72	6	yes
GATCTCACTCTCCCACACTA	54	13	yes
GATCAGAAGGTAATCACAGC	3	3	yes
GATCACAGAGATACTACAGT	18	2	yes
GATCTATTTCCTGAGCACAG	12	10	yes
GATCATGCCGTGCTACGCTC	3	3	yes
GATCATGCCGCCCCTTAGTG	18	17	yes
GATCATGCCCACTGTTGAAA	8	3	yes
GATCATGCCCAAAACAACCA	91	10	yes
GATCATGCAGACTGTTCCTT	2258	239	yes
GATCATGCAGAAGAACGGTG	54	10	yes
GATCATGCACTGTATTCACA	51	9	yes
GATCATGATTTCCGAGCTAC	75	9	yes
GATCATGATTCTCCCTCAGC	43	2	yes
GATCATGATAGCAGCACAGA	474	12	yes
GATCATGATACTGTTTGTTC	3	3	yes
GATCATGAGTTCAGTGTTAC	10	5	yes
GATCATGAGTGTCCCACTAC	22	12	yes
GATCATGAGTGACCACAGTT	192	22	yes
GATCATGAGGGAGTTCCGGT	317	30	yes
GATCATGAGGCTGTCTGCAG	4	0	yes
GATCATGACTGGGAGCATGC	16	3	yes
GATCATGACTCAGTATCAAC	21	12	yes
GATCATGACATTCCTCAGAT	14	1	yes
GATCACAGACCATGGTCTCA	54	4	yes
GATCACAGAATGGAAACAGC	26	11	yes
GATCACCAGAGTTTGGTACA	11	10	yes
GATCAGCTGACCCAGGCTTC	22	5	yes
GATCAGCTCGTCTTTCGCCA	20	6	yes
GATCACACCCTCATCAGAGT	9	1	yes
GATCATGAATCTCTAATTTC	4	0	yes
GATCATGAAGAAAAAGTGAT	29	5	yes
GATCATGAACATCATCCAGG	224	4	yes
GATCATCTTTTCTCATTTCG	27	3	yes
GATCATCTTGTTGCGTTTCT	51	4	yes
GATCATCTTGGTGTGAGGCT	40	9	yes
GATCATCTTGCTGCTTGACA	94	0	yes
GATCATCTTGAAGTGTGCAA	20	5	yes
GATCATCTTCATCCTGGGTT	1	1	yes
GATCATCTTCACTCAGCCAG	1	1	yes
GATCTTTTGCAAGAGCAACA	3	1	yes
GATCCTTTCGGCTGAGCCTC	31	1	yes
GATCATCTGGTGCTGTGTCG	5	4	yes
GATCATCTGGCAAGCAGAAG	17	0	yes
GATCATCTGCTACCAATGTG	15	7	yes
GATCATCTGCCCTTTCTATC	30	4	yes
GATCATCTCTTCTGAGAGTG	15	1	yes
GATCATCTCTTCAGAGGTGG	3	3	yes
GATCATCTCTCACCACAGGC	44	1	yes
GATCATCTCCTGTAAATCTT	2	2	yes
GATCATCTCACAGGACAGGG	30	4	yes
GATCTCTTCTTGACCAGTGA	2	2	yes
GATCACACATCTGGGCAGTG	112	4	yes
GATCACACAACCCACCTCAG	7	6	yes
GATCTCTGTAACAGAGCCTC	108	11	yes
GATCATCTCAAAGCCTGTTT	16	1	yes
GATCATCTAGAAACCATCTA	49	0	yes
GATCATCGTGTCGGGATGAT	82	7	yes
GATCATCGTCAGTGACGTTT	85	14	yes
GATCATCGGCATGGCATACG	392	25	yes
GATCATCGGACGGCCAGTTG	3	3	yes
GATCATCGGAAGGATAGATG	63	10	yes
GATCATCGCATCGTTTGAAT	49	6	yes
GATCATCGAGGACAAAACTT	37	10	yes
GATCATCCTTGTGTTGTGAA	91	2	yes
GATCATCCTTCAAAGGGGAT	77	2	yes
GATCATCCTGCTTCCAGCTC	11	10	yes
GATCATCCTATTCAGTGAGG	4	4	yes
GATCATCCTACACCAGGTTT	44	17	yes
GATCATCCGCAAAGTTGTGA	9	3	yes
GATCATCCATGAGCCATGAT	2	2	yes
GATCATCCAGGGCTGCCCCT	11	2	yes
GATCATCCACCTGCTCACTG	421	27	yes
GATCATCCACAAACTTCCAG	11	4	yes
GATCATCCAAGTGTTTGAGC	2	2	yes
GATCATCATTCGTGTGCAGA	64	0	yes
GATCATCATGTGGTTAAAAG	24	2	yes
GATCATCATGGAGCTGGTGA	68	4	yes
GATCATCATGCTTCCAGATG	11	6	yes
GATCAGCCAAGCACAGAGGA	2	2	yes
GATCAGGTCATCGCCTCCTT	342	15	yes
GATCAGGTAAGGGAGCACAC	19	18	yes
GATCAGGGTTAAGGAGGAGC	31	16	yes
GATCAGGGATATGAGGTTGC	23	14	yes
GATCAGGGAAGCAGACATTG	2605	1079	yes
GATCAGGCTGTCTGGAGACT	32	27	yes
GATCTGTTGAAGAACTCAGC	370	3	yes
GATCAGGCGAGACATGTTCT	46	5	yes
GATCAGGCACAGGGACAGCC	95	10	yes
GATCTGAGGGAAGGAACAGG	19	12	yes
GATCAGGAGTTGTCACCCAG	2	0	yes
GATCAGGAGTGCCAGGTTAG	49	19	yes
GATCAGGAAGCAAAGAAAGA	533	51	yes
GATCAGGAAAAGAAAAAGCA	53	5	yes
GATCAGCTTCTTTTGGACAC	21	17	yes
GATCAGCTGTGGGCTCTGGG	157	52	yes
GATCAGCTGTCTCAGTCCTG	2	1	yes
GATCATCAGTTATCCAGACT	11	4	yes
GATCATCAGTTAGAGTTCTG	162	20	yes
GATCATCAGTATCTCTATCA	2	2	yes
GATCATCAGCTGAGGCAAGG	7	2	yes
GATCATCACTGCTGCCCTAT	5	1	yes
GATCATCACTGAACTTAAAA	4	0	yes
GATCATCACTCACGGACATA	5	1	yes
GATCATCAATGACGACCTGG	76	14	yes
GATCATCAAGTGTCCTGGCG	14	2	yes
GATCATCAAGAAAAAGGAAA	3	3	yes
GATCATCAACAAGACTATCT	29	1	yes
GATCCTCTTTGCCAACCCCC	58	40	yes
GATCATAGGATTCTGATTTT	2	2	yes
GATCATAGCTTCCTGTCCCC	78	9	yes
GATCACAAACATAGCCAATG	2	2	yes
GATCAATGCCTGGACGGCTC	293	247	yes
GATCAGATGAGGCGTCCTGG	7	6	yes
GATCAGAGGCCACATAGCTT	3	3	yes
GATCAGCTCCAACTTTGTTG	48	4	yes
GATCTGTCGCTATTCAACCA	1	1	yes
GATCAGCGTGCGCCTAGCGG	114	1	yes
GATCAGCGGTGGGAATGACG	75	1	yes
GATCAGCGCTGAGCTCCAGA	27	3	yes
GATCAGCGCCGCTGGCTTCT	2	2	yes
GATCAGCCTCTTTCCCATCA	6	6	yes
GATCAGCCCTGGCAAGGAAG	26	4	yes
GATCAGCCCAAAATGAGCGA	3	1	yes
GATCAGCCATCCTGGATGGA	614	29	yes
GATCCCAGCTGTTTGGGGCT	90	11	yes
GATCAGCCAAGCCAGACTTG	17	15	yes
GATCAGCATTCCACCCCGGA	19	18	yes
GATCATAGCTGATGGCCTTC	61	16	yes
GATCATAGCTCTAGCAGAAC	18	3	yes
GATCATAGCTACTTTGTGCT	30	1	yes
GATCATAGCAAAGATGGACG	16	1	yes
GATCATAGATTGGGCTACAT	59	2	yes
GATCATAGATGACTTTGCCT	190	41	yes
GATCATAGAGGTGTGGCTTT	9	6	yes
GATCATACGTAGTTGTGAAA	8	1	yes
GATCATACGCCCAGGGAGAG	212	35	yes
GATCATACCCTCTCTGGCTT	2	0	yes
GATCATACCAAGAGGTGAGG	1049	10	yes
GATCATAATTTGAATAAGCA	19	3	yes
GATCATAATTGCTGTATCAT	4	2	yes
GATCTGGCACCTTGCTGTGG	9	8	yes
GATCATAAGGTATTCGGGAG	3	3	yes
GATCATAAGCTCCTGTGGGC	16	1	yes
GATCATAACTGCTATTATCC	1	1	yes
GATCATAACAGTTCTGTGAA	22	0	yes
GATCAATCAGAGGGATTACC	279	32	yes
GATCTCCTTGGGAGTTTGTG	4	4	yes
GATCAAGTTGGGAGTGGCAG	49	10	yes
GATCAGCAGGTGGTTATCAA	29	0	yes
GATCAGCAGCCGGAGACGAC	2	2	yes
GATCAGCAGATGTTGGTGGC	2	2	yes
GATCAGCACTCTCGGTATGC	104	6	yes
GATCAGCACGCTGACTCTTT	2	2	yes
GATCAGCACCACACTGGACT	7	2	yes
GATCAGCACAGCCTCCTTAG	11	9	yes
GATCAGCAAATTCAGAGATA	44	3	yes
GATCAGATTGGGAGTATGTA	5	1	yes
GATCAGATGGAGTTTATTAA	11	1	yes
GATCCCAGAGGAGTCAGAAG	13	6	yes
GATCAGAGTTCGAGGCCAGC	76	1	yes
GATCAGAGGCGCATCGAATG	139	43	yes
GATCAGAGCCCTGTCGATGG	2	0	yes
GATCAGAGATGGGCTCTGTG	11	1	yes
GATCAGAGAAACTGGGTAGA	63	15	yes
GATCAGAGAAACTCTGACAT	13	4	yes
GATCAGACGAGGTTCTCTCT	14	2	yes
GATCAGACGAAAGACATTTG	38	35	yes
GATCAGACCCAGGCTCTTGC	10	2	yes
GATCAGACCATGGTACTGGC	108	16	yes
GATCATAAACAACAGTGTTA	7	1	yes
GATCTGAGGGGAAAATAGCT	14	17	yes
GATCAGTTTTTTAAGAGATG	39	33	yes
GATCAGTTTTTGGTGTCATT	973	22	yes
GATCAGTTTTGGTCTTGATG	5	2	yes
GATCAGTTTTGACCTCTTAT	30	4	yes
GATCAGTTTGTTTTCACTGT	42	2	yes
GATCAGTTTGGTGGAATAAG	26	2	yes
GATCAGTTTGCCAATCATCT	29	24	yes
GATCAGTTTGAGCCTACCTT	3	3	yes
GATCAGTTTCTGTGTAGTCT	35	12	yes
GATCAGTTTATGATTCAGTT	3	1	yes
GATCCCTGGAACTAAGGTTA	2	1	yes
GATCAGTTTATCAGTCCGTT	21	11	yes
GATCAGTTGGTTGATTCCTA	3	3	yes
GATCAGTTGCCAAATGATTG	25	4	yes
GATCAGTTGATATCTGGGGG	5	3	yes
GATCAGTTGAAACTTGGAAA	2	2	yes
GATCAGTTCTTATCTACTTG	1	1	yes
GATCAGTTCTGAGCCGAGGA	27	6	yes
GATCAGTTCCTGGTATACAG	20	17	yes
GATCTCAGGAATTTTTGTAG	6	6	yes
GATCAAGTGCTGTGACAGTG	63	5	yes
GATCAGAACTTTTCCCTATA	15	6	yes
GATCTCCTGAGACTGGAGTT	37	8	yes
GATCGCTTCTGGCTAGAGAC	23	1	yes
GATCAAGGTGGCGGAGGACG	7	1	yes
GATCAGAACAGTGGTCCAGG	6	0	yes
GATCAAGGTCGGAAAGAAAT	1093	34	yes
GATCAGACAGTATCAGGGCT	23	9	yes
GATCAGACACATTTCGACAG	61	2	yes
GATCAGAATGAGGGACCTCC	63	5	yes
GATCAGAAGTTCCCCTTCAG	115	14	yes
GATCAGAACCCGCAGACCAA	35	3	yes
GATCAGAACCCAGTCTGCTG	8	7	yes
GATCAGAACAGACTCACACA	2	2	yes
GATCTGTGCAGGGTATTAAC	3292	56	yes
GATCTGACACCTGCTTCTGA	25	0	yes
GATCAGAAACCCGAGCTGAA	56	6	yes
GATCACTTTGACTTCATCCT	92	5	yes
GATCTGTGCAATAAAGTGTT	112	17	yes
GATCTGTGCAAAAGCAGTGA	368	16	yes
GATCCCTGCATGTCTATGTG	7	3	yes
GATCACTGCTGTAGGAAAGC	499	40	yes
GATCACTGCTCTGGACCTAA	74	2	yes
GATCACTGATACTTCCTGGG	25	7	yes
GATCACTCTTCAGAGAGTGA	12	10	yes
GATCAGTTCCATGTTACACA	24	5	yes
GATCAGTTCAGTGTGCATCG	33	1	yes
GATCAGTTCAGACAACTGTG	29	14	yes
GATCAGTTCAAAGCTGGCCA	52	6	yes
GATCAGTTATCTAGGTTAAC	53	7	yes
GATCAGTTAATATTGCACAT	1	1	yes
GATCAGTGTTTCTGCGAAGG	60	9	yes
GATCAGTGTAGTGACTCCAG	60	56	yes
GATCATGCGATATCAGTATG	33	7	yes
GATCAGTGGAGCCCATCGCC	65	3	yes
GATCGGCGTGACTACCCCTT	25	4	yes
GATCAGTGCTGTACTTCACT	101	5	yes
GATCAGTGCTCTGCTAACGC	468	339	yes
GATCAGTGCCTTTGTTGGCA	29	12	yes
GATCAGTGCATTTCAGAGTT	8	2	yes
GATCCCTGAGCCTGAATTAC	2	2	yes
GATCAGTGAGTGTGAGTGTG	92	7	yes
GATCCATTTGCTTACACGGT	14	1	yes
GATCATACGGAGCATGAGAG	17	1	yes
GATCAAGAAAAGCAACTTAT	20	3	yes
GATCACTCAGTAACTGCTGG	170	0	yes
GATCACTCAGGATTTGTTCC	38	13	yes
GATCACTCAGCCCTTGAGCA	3	4	yes
GATCACTACTCCTTAGACGT	134	23	yes
GATCTGCAGCAGTCTGTTCT	13	11	yes
GATCTCTTCTGTCTCCCTGA	1	1	yes
GATCACGTTTGTGTTGTCTT	32	0	yes
GATCACGTTGAGTTCTATTT	204	5	yes
GATCACGTTCTGATTGAGCT	10	2	yes
GATCACGTGTATGTGTCGTG	80	3	yes
GATCACGTGGGCTGCGTTTC	39	4	yes
GATCACGTGGCTGTTCTTGT	61	10	yes
GATCACGTGCCTGAGGTATG	10	12	yes
GATCACGTGACCACCCTTTC	362	52	yes
GATCACGGTGCCTGGTTACA	86	6	yes
GATCACGGGAGCTGAGCAAC	15	2	yes
GATCACGGAGCTGGAGTTCG	51	18	yes
GATCACGGAGCCAAGGAAGA	154	1	yes
GATCACGCAGTCTTAGAAAT	105	8	yes
GATCACGACGACGCCCACGC	114	10	yes
GATCACCTGCCAGACTGTTA	163	18	yes
GATCACCTCCCAGATTCTGA	14	1	yes
GATCACCGTTCCCATCCCCG	13	2	yes
GATCACCCATAAGAACCAGA	21	0	yes
GATCACCCACCCATCAGCCA	324	40	yes
GATCCAGCACCCTTTACAAG	2	1	yes
GATCCCACCATGGTTCTTTT	16	4	yes
GATCTGACCTGGAGAGACAT	1	1	yes
GATCACCAGGAAAAAAAAAA	46	7	yes
GATCACCAAGGAATCCAAGG	117	18	yes
GATCACCAACTCACGTCATG	401	121	yes
GATCACCAACCACCCCAGCA	114	57	yes