#ID_REF = Signature - 20 nt sequence including DpnII site (GATC)
#VALUE = Mean abundance for a signature derived from all MPSS runs for the sample, in transcripts per million (TPM)
#ST_DEV = Standard deviation of the mean abundance from multiple MPSS runs
#REP = Replication_global
ID_REF	VALUE	ST_DEV	REP
GATCTCTGGTGTCATGGTGG	6	7	yes
GATCTGACAAGCCACAGTGT	8	9	yes
GATCATCACTTTCTCCCTCT	12	2	yes
GATCATAGTGGACGTTGTTA	95	6	yes
GATCACCGTCTAAGCCTCAG	18	18	yes
GATCAAGCAGCAAAAAAAAA	46	41	yes
GATCATACCCTAGCCGGGCA	73	8	yes
GATCTCTGAGCCTGAAGGCC	14	16	yes
GATCAGTGTGTGCCAAGGAG	384	30	yes
GATCAAGAGTTCTGTTTCTC	20	1	yes
GATCAGTCAGTGACAACCAA	70	8	yes
GATCAAGAGAAAGAAGTGGG	15	11	yes
GATCAGTAGAGCTTGGACCC	6	10	yes
GATCAGGGCAATGGTCACTG	3185	239	yes
GATCAAGACGCAGGTCGAGG	104	13	yes
GATCAGGCTCTTTGTTTGTG	12	2	yes
GATCTGGCCAACGGCAACAT	88	29	yes
GATCTGGCAGTCATAGCTTG	346	50	yes
GATCTGGCACCCCCTTCTGG	14	14	yes
GATCTGGCAACTGTGCGGGG	22	4	yes
GATCTGGCAAAAACTACGGG	216	6	yes
GATCTGGATTTGGTTGAGAT	52	3	yes
GATCTGGATGGAGTGCCTTT	44	2	yes
GATCTGGAGTCTGGTGTGGC	1168	157	yes
GATCTGGAGTCTCTTAAAGC	69	13	yes
GATCTGGAGGGAGGGGCGGG	303	46	yes
GATCTGGAGGATTCCAGCGA	26	26	yes
GATCTGGAGAGTTTGTTCAG	35	4	yes
GATCTGGACTGGTGTTTCTT	57	2	yes
GATCTGGACTCTCACCTAGG	6	6	yes
GATCTGGACTCAAGGGGCAT	316	28	yes
GATCTGGACGATTCTGAGCC	430	14	yes
GATCCTGTGTTTGAATGACA	37	1	yes
GATCAGCCTACGCTCACATT	9	10	yes
GATCAGACTGTTGCTTTCGC	34	16	yes
GATCAGCACCAAGTGACTTG	17	3	yes
GATCAACTCCTTGAGACACT	37	37	yes
GATCTGCTTTTTGAAATGAA	17	3	yes
GATCTGCTTTGTGCTTGGCT	158	5	yes
GATCTGCTTTCTCAGGACTC	149	3	yes
GATCTGCTTTCCCTTTGTAA	2	2	yes
GATCTGCTTGTGTTGTGTTG	257	15	yes
GATCTGCTTGGCTGCCATTA	32	2	yes
GATCTGCTTGCCCCAAACAA	66	9	yes
GATCTCGGACGCTCAGTGGG	414	151	yes
GATCTCGATTCTACAGTGGT	13	15	yes
GATCTCGAGCACTCTCGTCC	14	16	yes
GATCAACGTGATGGACGCAC	92	1	yes
GATCTCCTGGCCACTGTGGT	12	9	yes
GATCACTGTTTGTGCCTCTG	487	29	yes
GATCACAATGAAGTCCTGGG	5	2	yes
GATCAGAATGGCGGAGGCGG	35	41	yes
GATCACAAGTGGAAAGCAAT	11	8	yes
GATCACTCTTCCCGCTGCTG	61	2	yes
GATCACGAAGAAGGCAGCCT	50	19	yes
GATCACCTGTGGAGTTGTCA	24	5	yes
GATCACCTGACTCCTAACCG	2	2	yes
GATCTCCTCTCCAGGGAGCT	33	33	yes
GATCTCCCTGTGCCGGTGCC	245	99	yes
GATCTCCCTGCCCAGTCAGA	97	1	yes
GATCACCATATCAAGTTTTC	15	1	yes
GATCACATGGGTCGAGGGTT	33	7	yes
GATCACAGCCGAACCTGGGT	2	2	yes
GATCACAGAGTGGGAATCTC	48	2	yes
GATCACACTGTCTGAGGCGT	80	15	yes
GATCACACTCTGGCCCCCAA	56	7	yes
GATCACACCAGAGTCCAGGT	33	7	yes
GATCTCATCGAAACAAAGCT	77	11	yes
GATCAAGTTCAACGGTTTTT	55	17	yes
GATCTCATCAAGATATTTGA	2	3	yes
GATCTCAGTGGGTCACATAA	19	12	yes
GATCTCAGTCGGATGCACCC	16	11	yes
GATCAAGGACATCCATGTGC	208	26	yes
GATCTCAGGTCACGGCTTTG	36	24	yes
GATCAAATCCGACGACGAGG	258	26	yes
GATCAACTTGGCTATGATAA	56	10	yes
GATCAAATATGTGCCCTATG	207	23	yes
GATCTCAGGGCAGAAATGAT	216	140	yes
GATCTCAGAGGCTCGGTATC	23	17	yes
GATCAAACCGCAAAAAAAAA	1	1	yes
GATCAAACCCAGGGCTTTGT	24	4	yes
GATCAAAATCATAAATGACG	8	8	yes
GATCAAAACACGCGAGTCTG	11	1	yes
GATCACTTTATTTGCTAGGG	239	4	yes
GATCAAAGGAAATGGAGCCA	92	21	yes
GATCAAACTACGGCACAGCA	3	6	yes
GATCGCGGTGACAAGCGCCT	9	10	yes
GATCAAAGAGCACACTGGGG	143	3	yes
GATCAAAGACTGCGACACCA	158	18	yes
GATCTTTTTCTCCATCTCTT	5	5	yes
GATCAAACGTGGCTGAGCGC	379	184	yes
GATCGGTCAGTGTCCCATAC	4	3	yes
GATCAAACGTGGCTGAGCGA	180	221	yes
GATCATCTTGTGAAAACCCA	1688	109	yes
GATCAAACCTGAGGGCACAT	69	7	yes
GATCTTTTACTTCGTGGCTG	277	23	yes
GATCTTTGTGTTTCCTTTCC	79	2	yes
GATCTTTGTGGTGTGGGCCA	463	10	yes
GATCTTTGTGAGTTGGAGAC	3	4	yes
GATCTTTGTCTTTTTGAGCG	39	27	yes
GATCTTTGTAAGTTCAAGGC	27	18	yes
GATCTTTCTGGCAAGGAAAC	7652	1322	yes
GATCAAAATCGCAGTTACTT	126	34	yes
GATCCATTCACCTACGGCAA	6	1	yes
GATCGAAGCCAGTGAAGGTG	17	7	yes
GATCACAGTGCCCTCGCTCA	11	3	yes
GATCCTGATGCTGCCACGGA	76	1	yes
GATCTGCGCTTCCAGAGTGC	6832	100	yes
GATCCGCTCGACAAGACAGG	6	6	yes
GATCCACTCAGCCGTGGTTT	30	6	yes
GATCAACTGTGCAGAAAACA	55	71	yes
GATCTCGAGAGGCTTTGTGT	496	197	yes
GATCCTGAGCTTTGACAAGA	40	14	yes
GATCCTGAGCCAGATGTCAT	11	3	yes
GATCCTGACTTTGCCAGCTG	253	45	yes
GATCCTGACTCTGACACTAC	40	2	yes
GATCCTGACCTGGGCTTCCT	7	7	yes
GATCCTGACCACATGAACAA	359	17	yes
GATCCTGACATAAACCCTTG	32	6	yes
GATCCTGACAGTGCACCTAA	44	3	yes
GATCCTGACAGAGCCTTGGT	287	31	yes
GATCCTGAATGTGGAAAAGA	35	3	yes
GATCCTGAATGACGTTCAGG	462	1	yes
GATCCTGAAGTGGCCTCAGC	78	1	yes
GATCCTGAAGGTCATCCGCA	22	6	yes
GATCCACGGCTCTTCACACT	37	13	yes
GATCCACAACGATGGTGTCA	2	2	yes
GATCTGCGTATGGCGGCCAA	3	4	yes
GATCCTGAAAGCCAAGTTAG	42	10	yes
GATCCTCTTTGCCAACCCCA	198	33	yes
GATCCTCTTTGCACAGAAGA	15	11	yes
GATCCTCTTGTTCCACGATG	75	4	yes
GATCCTCTTGTCCACTCCAC	30	4	yes
GATCCTCTTGCTGCAGCTTC	52	3	yes
GATCCTCTTGCTGAAGAAAA	8	8	yes
GATCCTCTTGCGGGACAGTC	113	29	yes
GATCCTCTTGATTCCTTCTG	6	1	yes
GATCCTCTTGATGCAGAGAG	8	1	yes
GATCCTCTTCTTCAGCACAC	181	22	yes
GATCCTCTTCCTGCTCCAGC	35	10	yes
GATCCTCTTCCCATCCATCC	125	6	yes
GATCCTCTTCATCTTGGGCA	400	4	yes
GATCCTCTGTTGGGGCCTCG	209	8	yes
GATCCTCTGTGGACTCATCT	1	1	yes
GATCCTCTGTGCCTCACTCC	65	42	yes
GATCCTCTGGAATGACATTG	10	14	yes
GATCCTCTGCAAGAGCAACA	30	1	yes
GATCCTCTGAGGCAGTATTG	213	0	yes
GATCTCTGTGAGCTAAGGCA	19	12	yes
GATCCACCCCTTAAGAACCA	70	5	yes
GATCCAGCAAGACCCTGAGC	53	35	yes
GATCCTCTCTTGTGCTACCT	69	1	yes
GATCCTCTCTGAACCTCCTG	59	1	yes
GATCCTCTCTCGGTGTGGTT	129	2	yes
GATCCTCTCATTCAGTCTTC	1	1	yes
GATCCTCTAGGGGTTATGGG	110	12	yes
GATCCTCGTGCCTGTCTCCC	167	14	yes
GATCCTCGGGCAAGCCAAGA	799	76	yes
GATCCTCGGGAGACCACTGG	157	35	yes
GATCCTCGGGAATTTTTACC	40	4	yes
GATCCTCGGAGGCTACCGAG	6	6	yes
GATCCTCGGAAGAGCAGCCA	23	26	yes
GATCCTCGCCTGTTGGAGGA	5	5	yes
GATCCTCGCAGCTTCTATGA	108	21	yes
GATCCTCGAGTGAGGACGAC	21	0	yes
GATCCTCGACAGGAAGCCAC	71	15	yes
GATCCTCCTTTTCTTGGCGG	9	6	yes
GATCCTCCTTGTCAAGTACA	546	58	yes
GATCCTCCTGTGAAGTGCCA	4	1	yes
GATCCTCCTGCGTGCTGACA	188	1	yes
GATCCCTTGGAACTAGATTT	4	1	yes
GATCTGAGCTGAATTTGAAG	57	5	yes
GATCCACACGAGGGAAGCTG	2	2	yes
GATCCTAGGCGGGGCACCCT	53	37	yes
GATCCTCCTGCCCCTCCAAT	53	36	yes
GATCCTCCTGCCCCGACAAG	34	32	yes
GATCCTCCTCCTGTGTTTCT	8	3	yes
GATCCTCCGTGAGTATGCCT	27	31	yes
GATCCTCCCCTTTACGGACA	125	27	yes
GATCCTCCCCAGGGATGGGG	33	33	yes
GATCCTCCCAAGTGAATGAC	57	27	yes
GATCCTCCAGTCAGTCTATT	18	12	yes
GATCCTCCAGGACAAGGGGT	24	16	yes
GATCCTCCAGCAGAGTGGAC	53	9	yes
GATCCTCAGTTACTCGCTGC	33	0	yes
GATCCTCAGTGCTACTTGCG	7	2	yes
GATCCTCAGGGTCTGCCCTT	43	5	yes
GATCCTCAGGAGTTGCAATG	1246	38	yes
GATCCTCAGGAAACAGTCTC	54	2	yes
GATCCTCAGCTGGCTGGAGC	40	3	yes
GATCCTCAGCTGCCCTGCCT	121	11	yes
GATCCTCAGCCACCCACAAC	40	9	yes
GATCCTCAGAGACGTGCTCG	117	0	yes
GATCCTCACCATCCACGTTT	12	10	yes
GATCCTCACCAGCCGCGGGC	905	1	yes
GATCCAGTGCCTGTGTAGAA	47	7	yes
GATCCTCAACATCCGCCTGC	51	2	yes
GATCCTCAACAAGATGCTAT	11	4	yes
GATCCTATTTTGGATGGTGA	9	3	yes
GATCCTATTCTTAGGTCTAA	37	1	yes
GATCCTATTCTCCAAAGACT	47	7	yes
GATCCTATTCCAGCCAAATG	67	23	yes
GATCCTATGTGTTGGCCATT	24	6	yes
GATCCTTGGATTCTGACCTG	1	1	yes
GATCCTATCTCCCGGTTGGG	186	4	yes
GATCCTATCATTGCTGGTGG	121	20	yes
GATCCTACTGTGGATGACAC	525	3	yes
GATCCTACTGATGAAGTGCC	70	2	yes
GATCCAAGGGGTGGTAGGGC	2	3	yes
GATCCAAGCTGTCAAGAAGG	729	14	yes
GATCCAAGCAGCCTTCAGGG	14	3	yes
GATCCTACGGAGCAAGTCTA	87	15	yes
GATCCTACCTTCTGCTTTCG	195	6	yes
GATCCTACCTGAGTGGCAGC	695	46	yes
GATCCTACATCCATTCGGCT	67	27	yes
GATCCTACAGTGGCTGGCAA	403	1	yes
GATCCTACAGTCACTTCACA	2	4	yes
GATCCTACACATGGAGGCTG	52	11	yes
GATCCTACACACCTACCAGA	19	3	yes
GATCCTACACACAGTGGTGA	22	3	yes
GATCCTACAAGCCTGTCCGT	2	1	yes
GATCCTAATGAAAAAACTTG	4	4	yes
GATCCTAAGTAGAATCAGAT	31	3	yes
GATCCTAAGCAGATTCTGGG	37	10	yes
GATCCTAACTAAGCACATGA	12	12	yes
GATCCTAACCTAAGATGCCT	66	6	yes
GATCCCGTTGAAGCACGGTG	39	4	yes
GATCCCGTGTCCTGCAGACG	101	57	yes
GATCCCGTCTCAGCCACGTC	25	10	yes
GATCCAACACCGGCGGCCAG	2	3	yes
GATCTCTGTGAATTCAGGGC	19	14	yes
GATCCTAAATTTGACCCAGG	141	11	yes
GATCCTAAATGGCAGCCTTT	5	5	yes
GATCCTAAAGTTCTTTCAGG	4	4	yes
GATCCTAAAGGCCGGTCACA	495	50	yes
GATCCTAAACTCTGTTGCCA	13	1	yes
GATCCGTGAGCTAGTTCTCT	14	9	yes
GATCCGTTTGGCCTCTCAAT	9	1	yes
GATCCGTTGTTTATGTGGAT	71	10	yes
GATCCGTTGCCAGTTACCTG	151	153	yes
GATCCGTTCCTAGGGTACCT	215	12	yes
GATCCGTGTGTGTGTGGGAG	1156	120	yes
GATCCGTGTGAAGGTCCCAT	2	2	yes
GATCCGTGTGAAACTGGATG	8140	608	yes
GATCCGTGTCAACCCCTTTT	2	2	yes
GATCCGTGTATGTCTAAACA	47	16	yes
GATCCGTGGCTGCAGCAGAA	96	17	yes
GATCCGTGGAGAAACTTGCC	24	28	yes
GATCCCGCCGCACGTTCCCA	169	20	yes
GATCCGTGCTGAGCGTCGGC	294	36	yes
GATCCGTGCATCTCATTGGC	183	15	yes
GATCCGTCGCCTGGAGGTGG	15	27	yes
GATCCGTCCGAGATGGCAGA	44	3	yes
GATCCGTCATCTCCAGGACA	15	15	yes
GATCCGTCAGGCTTGCTCGT	23	1	yes
GATCCGTCAAGCTAACTGGA	12	8	yes
GATCCGTATCAGGTTCATGT	64	21	yes
GATCCGTAGTCTGAGTGATG	115	12	yes
GATCCGTACCCTGGTGCTGA	108	2	yes
GATCCGGTTCTGGGACAGCA	39	2	yes
GATCCGGTCCCAAGACCGCT	907	28	yes
GATCCGGTCCAAGGCTCTTG	191	33	yes
GATCCGGGTGTCCAGTGACA	788	35	yes
GATCCGGGTGATGCGAATCG	66	16	yes
GATCCGGGGGAAATTGGGAT	2	0	yes
GATCCGGGCAAAGCCTGCTC	155	1	yes
GATCCGGGAGGTGTGCGGCT	4394	106	yes
GATCCGGCTGTGCCAGGTGT	109	15	yes
GATCCGGCTGGGCCTGGCTC	83	1	yes
GATCCAAAATGTTCCATGGA	63	4	yes
GATCCCCTGGGCTTTAATAA	2	4	yes
GATCCAAAAAGCAGTTCAAC	72	2	yes
GATCAGGCTTTTGTGACGCT	86	11	yes
GATCAGTGTGTGCCAAGGAA	25	43	yes
GATCCCCGTGTACTACCATG	8	6	yes
GATCCGGCAGAAGGATGAGG	171	20	yes
GATCCGGACTCACCTGGGAG	366	122	yes
GATCCGCTTGGCAGCCATTC	383	41	yes
GATCCGCTTCGTGGAATGGG	80	1	yes
GATCCGCTGTCAGGAGCTGA	1	1	yes
GATCCGCTGCTGGAAGAACC	18	12	yes
GATCCGCTGCAACCCGGTGC	61	2	yes
GATCCGCTCTGTGGTCGCCT	96	6	yes
GATCCGCTCTGAGGTTCTGT	1	1	yes
GATCCGCTCTCTGCATCTGT	1	1	yes
GATCCGCTCCTGGCGACTCC	368	4	yes
GATCCGCTCAGAGCCCAGCA	71	13	yes
GATCCGCTCACGCCCAGCAG	86	5	yes
GATCCGCCTTCTACTCGGAA	13	3	yes
GATCCGCCGCTAAGACCTGG	81	15	yes
GATCCGCCCTGTGAGTCACC	50	1	yes
GATCCGCCCGCTCACACAGG	28	5	yes
GATCCGCCCACACCCACGTG	803	62	yes
GATCCGCCAAAAAAATGCAC	124	12	yes
GATCCGCATGGCCTGTGAGG	13	13	yes
GATCCGCATGATGGGAGGAG	52	11	yes
GATCCGCATCCGCAAGCCCT	395	3	yes
GATCCGCAGGTCAGATGACA	28	7	yes
GATCCGCAGCTTTTCCAGCA	35	3	yes
GATCCGCAATTATGAAGAAC	38	11	yes
GATCCGCAAGGTGCTGGACG	228	1	yes
GATCCGCAAGGACTTCTTAT	176	16	yes
GATCCAGACAGCCATCAAGG	90	16	yes
GATCATTGTCTTCTGTCTTC	5	5	yes
GATCCCCCCGGAGTGTTCAG	21	3	yes
GATCCTAGTGATGATAATGT	40	11	yes
GATCCGCAACTGTCCGGAAG	18	3	yes
GATCCGATTTCTGATTTTGC	303	22	yes
GATCCGATGGGCCAGCCTTT	1567	194	yes
GATCCGATGAGGAAGATGAC	124	103	yes
GATCCGATGAAATTATTTCT	4	5	yes
GATCCGAGTGAAAGCCGGAG	84	54	yes
GATCCGAGGCTAGAGGGAGC	65	20	yes
GATCCGAGGCAGCCAATACA	4	5	yes
GATCCGAGGCAGATTTTCTT	48	2	yes
GATCCGAGCGACTGTCACCA	65	5	yes
GATCCGACAGGAGGGTGTAA	171	62	yes
GATCCGAATTGCAGAGCTGT	74	6	yes
GATCCGAATAATCCAGGAGG	147	53	yes
GATCAAACATTTGGAAGAAG	15	5	yes
GATCTGCAAGGCCTAATTAC	15	17	yes
GATCTTAGGCTGCTCCTCCA	14	16	yes
GATCTCTGAGAGTTTGAGGC	27	18	yes
GATCTCTGACGGCTTCTCGA	6	6	yes
GATCTGCTTCCTGAAGAGTG	33	14	yes
GATCTGCTTCCCATTGTGGT	190	13	yes
GATCTGCTTCCATCCATCTC	7	7	yes
GATCCTTTGCTCTGCTTCAT	50	10	yes
GATCCTAGCTCAGAGAGGCT	348	63	yes
GATCTGCTGTTCCTCACGAA	22	4	yes
GATCTGCTGTGGCACAGGGC	112	19	yes
GATCTGCTGTCTACTACCTA	19	5	yes
GATCTGCTGGTCATTAAGGG	333	158	yes
GATCTGCTGGCAGTAGTAGT	377	11	yes
GATCTGCTGGAAGATAATCT	38	7	yes
GATCTGCTGCCTGCTCCCAC	218	24	yes
GATCTGCTGCCAGGTTTTGC	76	4	yes
GATCTGCTGCAGGGTTCTGT	545	40	yes
GATCTGCTGCAGCTAAAGTA	51	1	yes
GATCTGCTGATGTTACGTCG	309	17	yes
GATCTGCTGATATTCCGGGC	57	38	yes
GATCTGCTCTGTAGAAAGAA	25	1	yes
GATCCCTTGTAGAGTATAAA	8	8	yes
GATCCCCAACACCCACCCTC	15	6	yes
GATCTGCTCTCAAAAATTCC	71	1	yes
GATCTGCTCTAACCAGGCGT	24	7	yes
GATCTGCTCCTTCTGTCCCA	440	12	yes
GATCTGCTCCTTAACGTTTT	66	5	yes
GATCTGCTCCTGGAGGTGGT	40	4	yes
GATCTGCTCCTGAGTGCTGT	76	6	yes
GATCTGCTCCCAAGTTATCT	25	1	yes
GATCTGCTCCAACTACAGGA	83	6	yes
GATCTGCTCAGTGACTTGTG	98	5	yes
GATCTGCTATGTACTCCAGG	582	27	yes
GATCTGCTAGAGCTGTAATA	175	16	yes
GATCTGCTACTGGAGATGTT	43	5	yes
GATCTGCGTATGGCGGCCAT	6530	227	yes
GATCTGCGTACACCTGCGTC	228	11	yes
GATCTGCGGTGACTTGATGT	6944	17	yes
GATCTGCGCTATAGAAAAAA	24	3	yes
GATCTGCGCCTGCCTTGTCT	70	2	yes
GATCTGCGCCTGAGCCAAAG	428	12	yes
GATCTGCGAAGCCAGGCTTC	66	5	yes
GATCTGCCTGTTACCTCTTC	87	16	yes
GATCTGCCTGTCACTGTGGC	3	3	yes
GATCTGCCTGAACGTGTGTA	2	2	yes
GATCTGCCTCAGGAAAAATA	12	12	yes
GATCCTGCAGCACGTTATCG	5	0	yes
GATCTGCCGCAGTAAGCGAG	125	19	yes
GATCTGCCCTTTCTGGGTGA	99	9	yes
GATCTGCCCTTGCACCCGGC	83	1	yes
GATCTGCCCGAAGCCATGAG	45	4	yes
GATCTGCCCCATGGTGTTTT	4	4	yes
GATCTGCCATTCCCATCTGT	163	5	yes
GATCTGCCAGTTTTGGTGCC	150	4	yes
GATCTGCCAGTCCGAGGTTC	93	35	yes
GATCTGCCAGGACAAGCTGG	75	52	yes
GATCTGCCACTTGTTTTAAT	37	1	yes
GATCTGCCACTGCTTCTCTA	30	19	yes
GATCTGCCACAGCAAGAGTG	200	16	yes
GATCTGCCAATGGTGCCGTT	12	5	yes
GATCTGATTGCCTTCATGGA	25	20	yes
GATCTGATGTTCTGTGTTTT	13	8	yes
GATCTGATGTTCTCTTCTGG	41	3	yes
GATCTGATGTGGTAATCAGC	70	4	yes
GATCGGTCTGAGATGACTCA	50	77	yes
GATCAGTTCATCCACATAGA	14	12	yes
GATCTGATGTCAGTCGTGGT	35	4	yes
GATCTGATGTATGCCAAGCG	338	18	yes
GATCTGATGGTGGGGTGGCA	53	11	yes
GATCTGATGGGTTTCTGGCT	231	8	yes
GATCCTGGCAGGATGCAGTG	65	8	yes
GATCTGATGCCCTGTTCTGG	181	4	yes
GATCTGATGACTGAGGTGTC	4	4	yes
GATCTGATGACTCCATATTT	2	2	yes
GATCTGATGAATAAAGGAGG	170	15	yes
GATCTGATAGTCAAGTGTAT	237	23	yes
GATCTCAAAACCAAAACCAC	2	3	yes
GATCTATCCTAGCCGGGAGG	377	58	yes
GATCTATCCCATCTAGTGGT	54	9	yes
GATCCTGCTGGGGGAGCTGG	6	8	yes
GATCAGTCTCCATCAGACTT	6	4	yes
GATCTGAGTGGGTGGGGGGT	268	55	yes
GATCTGAGTCAGGAATAGTT	36	8	yes
GATCTGAGGAGCAGATGATG	49	32	yes
GATCTGAGGAAGAACAAAGA	4	5	yes
GATCTGAGCTGCCCTCTGCT	20	14	yes
GATCTGAGCCTCCACCTGTG	113	115	yes
GATCTACTGTGAAAAGCATG	67	14	yes
GATCTTTGGGTTTGAGGATA	73	1	yes
GATCTACTCCCGGGCCCAGC	10	11	yes
GATCTTTGCCAAAATGTGTG	96	14	yes
GATCTTTGAGGTGCTAAGTT	69	47	yes
GATCTTTCGGAGGAGATGTC	58	38	yes
GATCTATACAGTCGGGAAAC	2409	1188	yes
GATCCTGACTTTGTTGGGGT	9	2	yes
GATCTGAGCATAGCGTCAGA	11	1	yes
GATCTGAGCAGGTGAAAAGT	53	19	yes
GATCTGAGAGCCGTGGTGCC	1	1	yes
GATCTGAGACCCTCCCTGAT	14	9	yes
GATCTGACTGTACCCTGCCG	1	1	yes
GATCTGACTCTCTCTTCTGT	2	3	yes
GATCTGACCTGTCCCAGCAA	1	1	yes
GATCTGACCTCGGAGTGTGC	199	129	yes
GATCTGACCGAGAACTGAAC	26	9	yes
GATCTACCGTGCAGGGACTG	53	6	yes
GATCTTTCCAGAAGGTCTTC	4	4	yes
GATCTACACATGGGGCAACC	280	17	yes
GATCTAGTGACTGAGGCACT	17	2	yes
GATCACTGACTGCCCCAAAC	42	11	yes
GATCTAGCTTCCTGGGAGAC	4	4	yes
GATCCTGAAGCGCGCCTGAC	12	0	yes
GATCTTTACAGGAAAACATT	20	13	yes
GATCTTTACAAGTCTGGCAC	10	11	yes
GATCTTGTTTGTGTCTCTGC	57	10	yes
GATCTGAATTTCTTCCTCTT	25	3	yes
GATCTGAATGTCCGAGAGAG	413	44	yes
GATCTGAAGTCTGAATGGCA	53	2	yes
GATCTGAAGCTGCTGATGAA	61	13	yes
GATCTGAACTCCAGAGAACA	44	7	yes
GATCTGAACCTGCCTGGAAA	15	16	yes
GATCTCTTTTGCCAAGAAGT	58	14	yes
GATCTCTTTGTGTTCAAGAC	80	10	yes
GATCTAATTGCAGTGGTTAA	72	50	yes
GATCTACGCACGCATCAGCA	52	3	yes
GATCTTGTGGGTAGGAGGTG	8	8	yes
GATCTTGTGGGAGTGACCAT	78	1	yes
GATCTTGTATTCTCTGGCTT	11	13	yes
GATCTTGTACAAACCGGTTT	30	6	yes
GATCTTGGTTGACTCGGGGG	24	18	yes
GATCTTGGTGGAGTGGGTCT	15	17	yes
GATCTCTTTGAGTTTGAGGG	32	26	yes
GATCTCTTTCTTGTTCCCCC	11	7	yes
GATCTCTTTCTGAGACCTTT	59	2	yes
GATCTCTTCTCGCGCTCTCC	69	3	yes
GATCTCTTCCATGTTACAAG	39	3	yes
GATCTCTTCAGAAGGGCACT	63	0	yes
GATCTCTTCACTGTTTTTCT	9	0	yes
GATCTTGGGGGAGAGAGGGA	79	51	yes
GATCTTGGGGAGTTTGACTG	24	13	yes
GATCTTGGCTCTGTGGAATG	152	30	yes
GATCTAATGGTCCTAACAAT	60	21	yes
GATCTTGCTTTGTGACTTTT	5	5	yes
GATCTCTGTGTGTGTGTGTG	48	24	yes
GATCTCTGTGCTGGCGCCTG	141	4	yes
GATCTCTGTGCGCCTTCCTG	61	13	yes
GATCTCTGTGAGTTTGAGGG	90	72	yes
GATCTCTGTGAGTTCAAGGG	6	7	yes
GATCTTGCTTCAGCCAACGC	19	22	yes
GATCTTGCGTGTTCTGTCCG	27	6	yes
GATCTTGCCCCTGCCAGTGG	435	24	yes
GATCACCTTTTTTGACGAGT	2	4	yes
GATCTTGCATCCGCCAGCCA	20	6	yes
GATCTTGCAAAAGGACCATT	25	16	yes
GATCACGTCTATGACCGGCT	72	10	yes
GATCGTCTGCTGTGAAACGT	6	10	yes
GATCGTCCCCAAAATTGCCT	74	3	yes
GATCACCGTACAGCTGGACA	2	2	yes
GATCTTGACCTTATCCAGTC	6	7	yes
GATCGGTGGGACCCGGGCGA	191	83	yes
GATCGTGGGCTTCAGCACCC	151	31	yes
GATCTTGAAAACCTGTCAGT	17	15	yes
GATCTTCTTGAGGTTTCCAT	1	1	yes
GATCGGTCTGAGATGACTCC	90	49	yes
GATCACACTGAAGATGCCTC	13	15	yes
GATCGGCTTTGAGAGAGGGT	69	7	yes
GATCGGCGTGGCAGCTGTGG	44	43	yes
GATCTTCTCTCCACGTGGGA	12	14	yes
GATCTTTGTCAGGTCTTCTT	4	5	yes
GATCTTCGAGGAGGGCGAGT	7	7	yes
GATCTTCGAGACTTTGTTAG	7	5	yes
GATCTGTTGCTGACCAGCCT	2	3	yes
GATCACTGTGAATCCAGTTC	5	0	yes
GATCAGTTGACAGTGGCAAT	476	335	yes
GATCGGTGCTCTGAAGGGAA	27	1	yes
GATCGCTGGACAGGTGGCAA	237	149	yes
GATCTTCCTCCTGCCCACTC	39	26	yes
GATCACCAGCCTTTTGCAAA	13	6	yes
GATCGGCGGGAAATGGCGGA	47	2	yes
GATCGGCGCCGTGAGATTCG	24	7	yes
GATCGCTCATTGGAACAGCT	458	26	yes
GATCTTCCCACACTGGAGGT	2	2	yes
GATCGCCCTTGCTGGTCTGC	128	6	yes
GATCTTCCAGATTGTGTGCA	12	14	yes
GATCTTCAGTAGTCTCTCCT	55	36	yes
GATCTTCAGCCTCTTGGGGA	37	4	yes
GATCTTCACTCACGTCCGGC	45	3	yes
GATCGCCTGCTAGTGCGGGA	94	13	yes
GATCTTCACCGGAAGGTGCA	84	55	yes
GATCGTCACAGCGGTGTATT	1	1	yes
GATCTTCACCCTATCCAGTC	23	17	yes
GATCGCCTCTCAGTGCTGGT	4	1	yes
GATCTTCACAGTGCATGGCT	20	1	yes
GATCTTCACAAGTTTGGGGC	7	8	yes
GATCTGTTGGTGCTGCTACT	9	1	yes
GATCTTCAACAGTGGGGCTG	31	20	yes
GATCCTAATCTCAGAGCCCT	2	1	yes
GATCAAAACATGGATGAGAA	4	4	yes
GATCTCTTTTCAGAAGTGTC	167	12	yes
GATCCCGGCGGAGAGGCTGG	37	8	yes
GATCCCCGAGTTGACGATGA	2	2	yes
GATCATGTTCACAACGCAGG	61	14	yes
GATCTCTGTGCTGTAAACTA	5	5	yes
GATCCCTTTTCCATTCTGGA	12	7	yes
GATCCCTTTGGGGTGTGGAA	220	7	yes
GATCCCTTTGAAATGTATGT	2	2	yes
GATCCCTTTCTCTGGCCCAG	429	127	yes
GATCCCTTTCCACCTAAAAC	37	2	yes
GATCCCTTTACCCAATCGTC	2	4	yes
GATCCCTTGTGAGCCCTAGT	73	6	yes
GATCCCTTGTAGCCAGAGTT	216	6	yes
GATCCCTTGCTTGCCTCTTG	99	1	yes
GATCCCTTGCTTCAACCTCC	59	18	yes
GATCCCTTGCTACATCTCCT	65	5	yes
GATCCCTTGCCTCCTGAGTT	58	14	yes
GATCCCTTGCCCTTGCATTC	7	5	yes
GATCCCTTGCATTTGCAACA	1	1	yes
GATCCCTTGCAGTTCTGTGC	44	2	yes
GATCCCTTGCACACAGCCCA	655	99	yes
GATCCCTTCTTTTTTGGCAT	2	2	yes
GATCCCTTCTGCTCTACCTC	2	2	yes
GATCCCTTCCTGCCCTCTTT	91	14	yes
GATCCCTTCCCCAGCGGTTC	30	6	yes
GATCCCTTCCAGCTGAGCCC	219	1	yes
GATCCCTTCCAAATCTGCTC	134	24	yes
GATCCCTTACTGTTGTGTCT	11	7	yes
GATCCCTGTGTTCTACATGG	17	16	yes
GATCCCTGTGGTCACTTAGC	125	29	yes
GATCCCTGTGGATTTTGAAA	6	3	yes
GATCCCTGTGAGTTCAAGGC	67	67	yes
GATCCCTGTCTCGGGAGGTC	11	11	yes
GATCCCTGTCTAGTCCCTGT	101	22	yes
GATCCCTGTCCTTTCTGTTT	8	1	yes
GATCCCTGTCCCCCTACCCC	31	3	yes
GATCTTGCCCCTTGAAGTAA	24	24	yes
GATCATGGGTTGGGAGCTCA	184	45	yes
GATCATGGGCAAAAAGCCCG	407	14	yes
GATCAGGAGCTGGAGAGGAA	45	27	yes
GATCCCTGTACACTATGTCT	5	2	yes
GATCCCTGGTGGCTGCCCTT	605	17	yes
GATCCCTGGGTGCCAGTTTT	35	5	yes
GATCCCTGGGGGCTGTGATG	287	4	yes
GATCCCTGGGGCTGCCTGTC	1181	74	yes
GATCCCTGGGGCATGTTGTA	203	12	yes
GATCCCTGGGAGGATATGAG	54	10	yes
GATCCCTGGCTCAGTGAACA	128	25	yes
GATCCCTGGCGTCCCTATCA	35	7	yes
GATCCCTGGCCCCTGTGCCA	21	4	yes
GATCCCTGGCACTGCTGCCT	38	25	yes
GATCCCTGGCACCCAGCATC	61	1	yes
GATCCCTGGAGTGACCAGAG	1420	4	yes
GATCCCTGGAGTCTCTGAAG	32	2	yes
GATCCCTGGAAGCAGGGACA	18	12	yes
GATCCCTGCTTTTGTGGCCT	311	14	yes
GATCCCTGCTTCCTGCCCAG	374	24	yes
GATCCCTGCTGTTGGCAATA	11	11	yes
GATCCCTGCTCTGGACCCTC	193	25	yes
GATCCCTGCTCCCCTCTGGG	121	13	yes
GATCCCTGCTCCAGGTCCTC	130	6	yes
GATCCCTGCTAATGGAAGAA	7	2	yes
GATCCCTGCCTGTGGGGGGT	34	3	yes
GATCCCTGCCTCGTCTGCCT	100	5	yes
GATCCCTGCCGAGGTGCTCA	132	9	yes
GATCATGGCTTTGAGGCCAG	51	10	yes
GATCATGGCGGTCAGCAGAA	20	10	yes
GATCATGGCCTGGTGCAGTA	2	2	yes
GATCATGGCAGGGATACGCA	22	6	yes
GATCATGGCAGGCCTTTAAC	70	5	yes
GATCTTGATGCGGGTGGAAC	32	24	yes
GATCCCAGATTGCCAGCGTC	34	2	yes
GATCCCTGCCCTTTGGCCTG	138	10	yes
GATCCCTGCCACCTCATTGG	51	6	yes
GATCCCTGCATTTCCTCAAG	96	0	yes
GATCCCTGCATAGGACTGTT	2	2	yes
GATCCCTGCAGTACCATCTG	91	0	yes
GATCCCTGCAGGTCGCTCAG	212	39	yes
GATCCCTGCAGCGCTGTTTG	137	29	yes
GATCCCTGCAGAGGCTTCCA	51	5	yes
GATCCCTGCAGAAGGGGGGT	31	3	yes
GATCCCTGCACTCAGAAGGA	41	8	yes
GATCCCTGCACAAGGTGTTT	130	22	yes
GATCCCTGAGTTCAAGGCCA	17	16	yes
GATCCCTGAGTAAACTTCTT	7	7	yes
GATCCCTCTTCTGGTGTGTC	22	4	yes
GATCCCTCTTACCTGCAACG	74	10	yes
GATCCCTCTGTACAGCATCC	35	4	yes
GATCCCTCTGGTGACTCCAC	186	3	yes
GATCCCTCTGGGTCATGTCT	142	13	yes
GATCCCTCTCTTCAATGATG	2	3	yes
GATCCCTCTCTCTGGGGAAT	23	1	yes
GATCTGGGCATTCGTCTGCA	18	1	yes
GATCCCTCTAAGCCCCCTCC	194	21	yes
GATCATGCCATCGCAACTCA	21	5	yes
GATCCCACTTCTGCGTCTTA	115	6	yes
GATCCCTCGGTGACCACATT	48	19	yes
GATCCCTCGACGGCCAAGCC	525	84	yes
GATCCCTCCTTGTGAGCAGC	88	18	yes
GATCCCTCCTGTCACTGCAG	28	0	yes
GATCCCTCCTGGGCATTGCT	29	3	yes
GATCCCTCCTCAGGCATCTG	706	9	yes
GATCCCTCCCTTGGGCCTCC	90	12	yes
GATCCCTCCCTCCGAGGCCA	333	6	yes
GATCCCTCCCCTCCCTGGCT	5	5	yes
GATCCCTCCCCACCCTGCTC	79	14	yes
GATCCCTCCCAGAAACCTGC	1671	144	yes
GATCCCTCCCACTCTGGCTC	205	34	yes
GATCCCTCCAGACACCAAGG	309	40	yes
GATCCCTCCACAAGATTCTG	41	8	yes
GATCCCTCAGGGTGTGTGCC	160	35	yes
GATCCCTCAGGAACAGAGGG	76	3	yes
GATCCCTATGCTGACCCCAA	859	46	yes
GATCCCTATGAAGTGTCTTA	109	4	yes
GATCCCTAGGGAGAAGGTGG	208	14	yes
GATCCCTAGCATTCTGTACT	156	4	yes
GATCCCTAGAGCCAGCACAT	40	4	yes
GATCCCTACTGCACCACCTT	13	6	yes
GATCCCTACTATTGATTCTG	54	8	yes
GATCCCTACTACGTGCTGGA	1719	16	yes
GATCCCTACCTACAACCCTA	47	7	yes
GATCCCTACCCCACATGCTG	15	16	yes
GATCCCTACCCATGGGAATG	226	11	yes
GATCCACATCTCAAAGAAAT	195	36	yes
GATCTGAGCAAGGGCAGGAA	40	68	yes
GATCATGAGCTGGAGGCACC	19	2	yes
GATCATGAGAAAGCTCAGGT	12	12	yes
GATCTTCGGTGCCACCGGCA	95	15	yes
GATCATGACAGTCCCCCCAC	59	5	yes
GATCCCAAGTGGCACTGTTT	6	1	yes
GATCCCTACCCATGGACCCT	4	4	yes
GATCCCTACCACCTGCCCGA	34	13	yes
GATCCCTAATGAGAGCAGAG	98	5	yes
GATCCCTAAACTACCTCTTG	8	8	yes
GATCCCGTTTGTGAAGCCTG	2	2	yes
GATCCCGTGTGACACATTTT	8	1	yes
GATCCCGTGGACTGTTTGCT	2	2	yes
GATCCCGTCCAAGGAGCATC	843	77	yes
GATCCCGCGAGGCCCGGAAG	7774	609	yes
GATCCCGCCTGCCCAGCTGA	121	4	yes
GATCCCGCCCACCCAAAGCT	96	24	yes
GATCCCGCCAAAAGAATTAC	409	38	yes
GATCCCGCACATCCACAAGT	177	7	yes
GATCCCGAGATTGCCAGCCT	712	13	yes
GATCTTCCAAATCCTGGTCA	13	12	yes
GATCCCGACACCAAGGAGAT	6298	336	yes
GATCCCCTTTTTGAACAGGT	38	7	yes
GATCCCCTTTCCTGTGAATG	418	47	yes
GATCCCCTTTACCTTCTGGG	1013	186	yes
GATCCCCTTGGTTGCTGGAT	158	8	yes
GATCCCCTTCTCAGGGTCTA	58	23	yes
GATCCCCTTCCTACCTCTAG	40	14	yes
GATCCCCTGTTGACTTACAA	18	4	yes
GATCCCCTGTATATGTTGAA	7	2	yes
GATCCCCTGGGGCAAGCTGC	980	4	yes
GATCCCCTGGGAGGAGACAG	420	30	yes
GATCCCCTGGATACATGGTC	117	21	yes
GATCCCCTGCTACACTGATG	37	4	yes
GATCCCCTGCTAATGAAAAT	14	2	yes
GATCCCCTGCCTCCACCTCC	115	19	yes
GATCCCCTGCCTCAGCTCCT	130	10	yes
GATCCCCTGCAACAGACATT	30	13	yes
GATCCCCTGAGATGGAATTA	20	3	yes
GATCCCCTCTGGGCCTCCGA	34	3	yes
GATCCTTTCTACTATGATGG	1	1	yes
GATCCCCTCGGACCCCCTTG	1095	9	yes
GATCCCCTCCTTTCTGCCTG	8	1	yes
GATCCCCTCCTCCAGGCAGT	169	13	yes
GATCCCCTCCCACAGAATAG	3896	124	yes
GATCCCCTCACATGTGCTAT	119	0	yes
GATCCCCTATGGGGAGGAGG	157	9	yes
GATCCCCTATGCAAGCTGTG	145	19	yes
GATCCCCGTGTGTTTGCAGG	396	3	yes
GATCCCCGTGCCCCTGCCTA	666	41	yes
GATCTTTCTCTAGGGGGTCC	53	38	yes
GATCTTCACTGCAGATGTGG	72	19	yes
GATCCCCGTCTGTGTCTGTG	293	13	yes
GATCCCCGGTGCTCTTCGTG	17	3	yes
GATCCCCGGGAAAGTGTAGT	15	2	yes
GATCCCCGCAGAATCAGGAA	27	4	yes
GATCCCCGCAAAGTGAGCGA	21	2	yes
GATCCCCCTTTGCTGCCTCC	27	3	yes
GATCCCCCTGATGGAGAGAA	22	3	yes
GATCCCCCTCCCTGCTCTCA	8	1	yes
GATCCCCCTCCCCCGCTGGC	8	14	yes
GATCCCCCTCCCCCCAGTGG	362	56	yes
GATCCCCCCCTTTTTTTGTC	48	2	yes
GATCCCCCCCAGCACACTCT	63	4	yes
GATCCCCCCACCCCACCACC	1385	70	yes
GATCCCCCCAACTGTGTGCC	24	0	yes
GATCCCCCAGGTCTCAGAGG	306	14	yes
GATCCCCCACCTCCTCGGCC	28	20	yes
GATCCCCCACATCCTGGGGC	79	12	yes
GATCCCCATTTGCAGTAAGA	39	16	yes
GATCTTCAAGCCGTGGAAAT	9	10	yes
GATCATATGGGTGATTCAGT	7	13	yes
GATCCCCATGTTGAGCTCTG	261	11	yes
GATCCCCATCTGCAGTACAA	4	4	yes
GATCCCCATCTGACTCAGTA	34	4	yes
GATCCCCAGTCTTTAGTCCC	563	6	yes
GATCCCCAGTATGCAGTAAT	21	4	yes
GATCCCCAGGGGCTCCCGGT	210	31	yes
GATCCCCAGCCTTGGATAGT	6	3	yes
GATCCCCAGCATTAGGCCAT	189	17	yes
GATCCCCAGCAGTAACACTT	52	11	yes
GATCCCCAGCACCACAAAAA	34	1	yes
GATCCCCAGCACAGGAAGGC	57	14	yes
GATCCCCAGAGTCCCCTGTG	330	14	yes
GATCCCCAGAGCCTTGGGGA	85	13	yes
GATCCCCAGAATCCCCAATA	4	4	yes
GATCCCCACTGTGCCTTTTT	97	1	yes
GATCCCCACCAGCCACCCCC	563	15	yes
GATCCCCACAGCTGCGTATG	294	36	yes
GATCCCCAAGTCTGTGACAC	115	24	yes
GATCCCCAACAATGTGAAGA	538	43	yes
GATCCCCAAAGGGCAGGTCC	24	7	yes
GATCCCCAAAGCCTGGAGCC	548	11	yes
GATCCAGTGTGGGGCAGCGC	29	30	yes
GATCATACCCACGTTGCCCA	6	4	yes
GATCATAAGAGGCACGTGAT	69	2	yes
GATCCCATTTTTGACAGCAA	53	12	yes
GATCCCATTGGAGCTCTGTT	17	3	yes
GATCCCATGTTCAAGCTGGT	32	6	yes
GATCCCATGTGTTTAGTAAT	5	0	yes
GATCCCATGTGTCTCCCCCA	41	8	yes
GATCCCATGTGCCACCATCA	47	9	yes
GATCCCATGTCCTGCTTTCT	4	5	yes
GATCCCATGTCCTGCTAAAA	15	6	yes
GATCCCATGCTTTGAAAAAT	5	5	yes
GATCCCATGCTAGCCTCTTG	324	34	yes
GATCCCATGCCTGGAATTTG	52	1	yes
GATCCCATGCAGAGCGGCCT	498	19	yes
GATCCCATGATGGAAATATT	54	10	yes
GATCCCATGAATCATTTGCC	67	10	yes
GATCCCATGAAATCCCCAAA	4	1	yes
GATCCCATCTCCTGGAAGGA	24	10	yes
GATCAGGGCAAGAGTGTGCG	82	2	yes
GATCCCATATCCCTGTGAAA	52	7	yes
GATCCCATACCTGACATGAC	96	7	yes
GATCCCATACAATGCCGCCC	278	24	yes
GATCCCATAAAATTCGAGGG	4	4	yes
GATCCCAGTTTGCTTCATGA	78	6	yes
GATCAGTGGGTGCCCGTGAT	111	24	yes
GATCAAGGCCACGGGGAGGA	139	4	yes
GATCCCAGTGTTGCTACGTG	100	12	yes
GATCCCAGTGTGAATCATGG	79	7	yes
GATCCCAGTGGATGAAGTGT	18	6	yes
GATCCCAGTGCTGTGGAAGT	221	13	yes
GATCCCAGTGCTGGTCAGTT	108	17	yes
GATCCCAGTGAGATGCTGGT	22	9	yes
GATCCCAGTGAAGGGTTTCT	19	10	yes
GATCCCAGTCCTCCTGGGCA	41	4	yes
GATCCCAGGTGTCCCCATTT	89	17	yes
GATCCCAGGTGGAGCAACCC	45	2	yes
GATCCCAGGTCCCTCTGGGA	58	9	yes
GATCCCAGGGTTTTCTTGGT	4	1	yes
GATCCCAGGGGTCCTAGGGG	297	21	yes
GATCCCAGGGGCTCTTCTGC	35	6	yes
GATCCCAGGGAAAGTGCTAT	103	12	yes
GATCCCAGGCTCCACCAGCG	69	23	yes
GATCCCAGGCTAGCAAGCAA	43	10	yes
GATCCCAGGCAAGGGATGGT	13	9	yes
GATCCCAGGAGTCAAGCTCT	20	3	yes
GATCCCAGGAGAGAGGCTTC	19	5	yes
GATCCCAGGAAGGACCATCA	25	9	yes
GATCCCAGGAAAGTTCTAAT	161	3	yes
GATCCCAGCTATGATGTAGC	15	4	yes
GATCCTCTCCCCTCCGTCAG	6	6	yes
GATCCTCTTTGACTTCACGT	13	5	yes
GATCCTACTATGAGCAAAAA	88	61	yes
GATCGGAGACATTGGCACAG	1	1	yes
GATCGCACTCTTGAGATTCT	4	7	yes
GATCCTAGAAGGACAGCTTT	31	5	yes
GATCGAGAAAGAGAGCGAGA	1	1	yes
GATCAATGTCTCCACCTTCC	56	46	yes
GATCAAGTTGCTGAGCCTGA	57	57	yes
GATCTGTCTCTTTTACCAGA	26	5	yes
GATCTCTGTCTTTCCCTGGT	180	2	yes
GATCTCTGTCACATCCGATG	223	145	yes
GATCTCTGTATGTTCGAGCC	300	195	yes
GATCTCTGGTTGCTTTCAAG	7	7	yes
GATCAAGAGGTGAGGAGAGG	3	6	yes
GATCTCTGGGGCAGACGGTG	44	28	yes
GATCTCTGGGCAGTCATGGT	75	49	yes
GATCTCTGGCTCTTCATCCT	32	22	yes
GATCTCTGGCCTGTGGAGTA	65	8	yes
GATCTCTGGCCAGGCAAGTT	9	10	yes
GATCTCTGGATGGAAATGTA	19	14	yes
GATCTCTGGAGGTCCCGGTG	25	16	yes
GATCTCTGGAAGGTGAGCCT	107	70	yes
GATCTCTGCTGTGGGAAAGG	1619	72	yes
GATCTCTGCTGTCGGTTTCT	6	1	yes
GATCTCTGCCCAAACCAGGC	203	14	yes
GATCTCTGCCACCCACCCAC	78	52	yes
GATCCGAGTGTCCCCTCTGC	4	5	yes
GATCCCTGGGGGTGGGGAGG	2	3	yes
GATCCCTGATGGAAGTGTTT	5	5	yes
GATCCGTGGAGGGGTGCAGG	57	12	yes
GATCTCTGCAAGCAGTTGTC	96	7	yes
GATCTCTGCAAAATAGACTT	20	20	yes
GATCTCTGATGGCTGGGGAG	80	53	yes
GATCTCTGAGCGTGTGGGTC	27	18	yes
GATCTCTCTTGTTGGAAGGA	121	18	yes
GATCTCTCTTCCCAGAGGAA	3606	109	yes
GATCTCTCTTACATACTGTT	100	15	yes
GATCTCTCTGGAACTATCTA	38	9	yes
GATCTCTCTGCTCATACCCT	44	6	yes
GATCTCTCTCCTTGGCCTTC	5	6	yes
GATCTCTCTCATTCAACTTT	2	2	yes
GATCCGCCCCAGTGGGAACC	14	14	yes
GATCTCTCGTGTGCCTTTGG	11	11	yes
GATCTCTCGAGCAGCAGCAG	8	9	yes
GATCCGGCCTGTGCTGCTGC	43	8	yes
GATCTCTCCATATCAAGCGA	730	29	yes
GATCCAAAGCAAAAGGGTCA	1	1	yes
GATCTCTCATTCCCAAGTAA	1	1	yes
GATCTCTCAGTTGAATACAT	39	6	yes
GATCTCTCAGGCCAGGATTT	61	39	yes
GATCTCTCACTGGACCAGCG	69	23	yes
GATCCCAGTGGCATCATCGG	1	1	yes
GATCAAGATAACGGTGGCTT	6	10	yes
GATCTCTACTTTGGAGTCCT	91	7	yes
GATCTCTACTGGCAGGCCAT	102	37	yes
GATCTCTACTGCTGTTAGGT	41	1	yes
GATCTCTACCATTTGATTAA	150	110	yes
GATCTCTACCACCCAGGTAG	53	35	yes
GATCTCTACAGACAAAATCT	26	7	yes
GATCTCTAAACTGTGACACA	4	4	yes
GATCTCGTTTTTCAAAAGCA	34	9	yes
GATCTCGTTCATTGGCAAAA	54	38	yes
GATCTCGGTGTCATCAGAGG	29	19	yes
GATCTCGGTCTGTGCCGGGG	226	6	yes
GATCTCGGGTGCGTGGCTGG	78	52	yes
GATCTCGGAGTCCTGGCCCC	16	19	yes
GATCTCGCCGTGTCCCTGGG	2	2	yes
GATCTCCTTTCCGGAAGCAA	239	14	yes
GATCCCACTGTCACCCTCGC	3	6	yes
GATCTTACTGTGCTGAGATT	1	1	yes
GATCTCCTTGGAGTCTCAAG	1816	30	yes
GATCTCCTGTTGTCTGGGCT	29	20	yes
GATCTCCTGTCTATGTGGGC	111	18	yes
GATCTCCTGGTCAGGAAGAA	13	15	yes
GATCTCCTGGAAGCTAGCAG	67	8	yes
GATCTCCTCGCTGGAAAAAG	124	23	yes
GATCACCATTTACGACTGTG	6	6	yes
GATCTCCTCAGAGAAGTCTG	39	13	yes
GATCTCCGTCCCTCAGCTCC	520	18	yes
GATCTCCGCGGCCCGAGTGC	87	8	yes
GATCGCAGAGAGGCGAGAGC	176	89	yes
GATCTTACTTAGCATGCACA	2	4	yes
GATCTGTGCATGGCATTTTT	19	3	yes
GATCCTTGAGGGTCTGAGTG	1	1	yes
GATCTCCGAACAGCAACACG	8	8	yes
GATCTCCCTTTGTACTGTCT	21	12	yes
GATCTCCCTGCCCCTGAGCC	137	90	yes
GATCTCCCTGAGTTCGAGGC	194	134	yes
GATCTCCCTCTTGGAGGCCA	1	1	yes
GATCTCCCTCTGAACACCTG	37	3	yes
GATCTCCCTCTAAATATTTC	47	4	yes
GATCTCCCTCGTGCAGTGGC	76	9	yes
GATCTCCCGTGTTACCAATG	64	4	yes
GATCTCCCCTTTGTAGGACT	11	11	yes
GATCCTTTCAACTCAAAAGC	103	1	yes
GATCCTTGGTTCATCAGGTA	2	2	yes
GATCCTTGGTGTAGCTTCTG	14	14	yes
GATCTTAGGCAAGTTCTTGG	6	10	yes
GATCTTAGAGAAGGAGACAG	6	4	yes
GATCTTAGAGAAAGGCCAAC	143	93	yes
GATCTTAGACAGGCGATGTG	6	8	yes
GATCGCAGCACTGAAAACAA	30	6	yes
GATCTCCATCGTGCAGGGAT	25	1	yes
GATCTCCAGTCCAAGGCTTC	57	2	yes
GATCTCCAGCTTCTCTGCCT	390	3	yes
GATCTCCAGCACAGCAGAGG	38	14	yes
GATCTCCAGAATAGACCTGG	21	21	yes
GATCTCCACTTTCTACAACA	85	8	yes
GATCTCCACTCTCCCTCTGG	89	9	yes
GATCTCCACGGGTGCTTAGT	35	0	yes
GATCTCCACAGGCCAGCCTT	105	14	yes
GATCTCCACACAACAGGTGA	2	2	yes
GATCTCCAATGTTGTGCTAA	31	7	yes
GATCTCCAACTTTGAAAGGC	46	46	yes
GATCTCCAACATTTTGGAGG	56	55	yes
GATCTCATTTCTAGTTTCCA	52	10	yes
GATCACAGCCAGTTCAAAGC	73	13	yes
GATCACAGCAGTAAATGTGA	450	25	yes
GATCACAGCAGCTGAGCTGT	66	11	yes
GATCACAGATTTAAGGGGAG	96	14	yes
GATCACAGATGAGGAAGAAT	18	6	yes
GATCACAGACTTCGGCCTTG	5	5	yes
GATCACAGACTGTTGGCCCC	26	2	yes
GATCACAGACACCTGCACTG	53	12	yes
GATCACAGACAAGAAATACC	96	2	yes
GATCACAGAAGTGAGCGGAT	44	3	yes
GATCCTTCTGCAGACACCGA	26	18	yes
GATCCTTCTGACTTGGCTTT	50	7	yes
GATCCTTCTCAGAAGAGTCT	82	27	yes
GATCACAGGGAGCCTGTGTT	2	2	yes
GATCTTAAATGGCGTAGTAT	39	25	yes
GATCACAGCAGAGATGGCCA	100	2	yes
GATCTCATTCCCGAGAGAGG	2	2	yes
GATCTCATGTCTCTGGAGGA	115	5	yes
GATCCCCTTGGGCCCAACTG	38	11	yes
GATCTCATCCAGTCTGCTGT	2	3	yes
GATCTCAGTTTTCATCAAGT	90	13	yes
GATCTCAGTTTGAGTGGATG	21	12	yes
GATCTCAGTTTGAGGTCAGC	42	28	yes
GATCTCAGTTTCGCTGATGT	48	35	yes
GATCTCAGTTCTGTGTTTAC	136	9	yes
GATCTCAGTTCACGGGGTGG	240	123	yes
GATCTCAGTTCAACAGCTCC	122	98	yes
GATCTCAGTGGGGGTGGGAG	348	127	yes
GATCTCAGTGCTGGGGAGGT	167	169	yes
GATCACACTGATGGAGCTGT	1	1	yes
GATCACACTGAGCAACACCC	56	4	yes
GATCACACGGCAAAACAGTA	130	27	yes
GATCACACCTTGCTGTTCCC	4	4	yes
GATCACACCTGTCCCTACAC	587	24	yes
GATCACACCTGCAGTTTGGG	115	5	yes
GATCACACCGAGACCAGTGG	104	4	yes
GATCACACCATTGAGTTCCG	69	3	yes
GATCACACCAGTCCTGTGAG	17	2	yes
GATCACACATTTGCAAGGGA	90	20	yes
GATCACACAGAGCTGAGGGC	2	3	yes
GATCACACACGGCAACCGAC	19	3	yes
GATCACACAAGTGTGGGTTT	170	31	yes
GATCACACAAAACTGTCAGC	9	7	yes
GATCACAATCTAGTCAATGC	6	6	yes
GATCACAATCAGGAACTCAC	27	4	yes
GATCACAATACAACTTTATG	60	14	yes
GATCACAAGTTTGAGACCAG	22	3	yes
GATCACAAGTGCAGCATTCT	25	1	yes
GATCACAAGTATAAGGCCAG	11	1	yes
GATCCTTCATGTTGAGCCAG	209	39	yes
GATCACAAGAGTTACTAGTT	5	5	yes
GATCTGTTGTTTGCGTTGAA	7	7	yes
GATCTGCGCGTGCTGTGTGG	69	3	yes
GATCCTTCTGTCCTGGATTT	1	1	yes
GATCAGCACACCAGGCTGCT	5	5	yes
GATCTGTTACTTTGGCGAGG	138	14	yes
GATCTGTGTGTGGGAGAGAC	16	12	yes
GATCTGTGTGTCATCAGATG	74	10	yes
GATCCTTCTCTGCCCTTCCC	16	11	yes
GATCTGTGTGGGACCAAGGC	112	73	yes
GATCTGTGTGGCTCCTCTGC	7	11	yes
GATCCTTCCTTTCCCTTGGC	4	1	yes
GATCCTTCCTTCTTCTCTTC	2	3	yes
GATCTCAGTAACTGTCGAGC	445	154	yes
GATCTCAGGGTTCCCATGGT	20	3	yes
GATCTCAGCTTGCATAGCAT	37	10	yes
GATCTCAGCCCCTACTCCCA	70	7	yes
GATCTCAGCACTGTGGCTGT	483	16	yes
GATCTCACTGTTTCATGCTG	92	20	yes
GATCTCACTGCCTCCCTCTC	155	57	yes
GATCTCACTCAGCAACAAGT	31	7	yes
GATCTCACGGGCCGACCGAG	43	5	yes
GATCACAAGAGGCCCGTTTG	28	3	yes
GATCACAAGAAGTTAGTTTG	69	3	yes
GATCGGGGGGATGACCAGCT	292	72	yes
GATCACAACTGTAGGGAATA	303	4	yes
GATCACAACTGATTCCTGCT	27	1	yes
GATCACAACTATTAGCAAAA	40	3	yes
GATCACAACGGCTTGCGTGT	179	11	yes
GATCACAACCCTGATGGCAG	348	22	yes
GATCACAACCCCCAAGTCAG	39	2	yes
GATCACAAATACAGATTCTG	249	20	yes
GATCACAAATAAATGGTGCT	16	2	yes
GATCACAAAGTTTGAGAATG	612	75	yes
GATCCTGTTGTGTGTTTGCA	1	1	yes
GATCACAAAGGTGGAATGTT	73	15	yes
GATCCTGTGCCTGGCCTTTG	9	6	yes
GATCAATGGGCAGCAGCAAT	105	5	yes
GATCTGTGTATACCCCACTC	116	7	yes
GATCTGTGGTCCCTGCCTCC	1	1	yes
GATCTGTGGGGAAGGGGGCT	59	38	yes
GATCTTTGCTGGTAAGCCGC	3	6	yes
GATCTGTGGACGACGAGAAC	22	14	yes
GATCCCCCCGCCACTGTCAC	11	7	yes
GATCTGTGCGATGTTGTGGC	64	6	yes
GATCTGTGCCATCCCATACA	85	11	yes
GATCCCCCAAGGCCCCAGGC	85	7	yes
GATCTCACCGTGAGGCCCCG	9	10	yes
GATCTCAATTGTAAATAGAA	34	4	yes
GATCTCAATGAAGTAGCTAA	45	11	yes
GATCTCAACTGACTCCTCTT	86	23	yes
GATCTCAACTCTGCTCTAGT	2	2	yes
GATCAATGCAATGACGTGGG	319	22	yes
GATCAATGATGAGGACAAAC	1577	162	yes
GATCAATGACAGAGTGAGGT	28	8	yes
GATCAAGTCCGGGAACTCTC	2	3	yes
GATCCTGGGTACTGCACAGT	3270	137	yes
GATCTGTGATTTGCTTCTAT	32	9	yes
GATCCACAGGTCCACTGACA	4	4	yes
GATCCTGGGAGTGGGCCCTG	15	4	yes
GATCCTGGGACATAATCACC	20	8	yes
GATCCTGGGAAGCCTCCTCA	9	0	yes
GATCTCAGAGCCACACCTCT	11	12	yes
GATCTGTCTCAACAGTCTGG	64	2	yes
GATCTGATTCTAGAGCACTT	28	7	yes
GATCGACAAGAACCTGCGGG	30	4	yes
GATCAATAGGGAAACACAGG	889	316	yes
GATCAATAAAGTGGGTTTTT	228	34	yes
GATCAATAAAGTCAATGTTT	80	6	yes
GATCCTGCGGGTGGGAGGAA	87	4	yes
GATCCTGCCTTGAATTCCTG	17	4	yes
GATCAAGTTTGTGGTGTGTT	132	14	yes
GATCAAGTTTCAGGAAGGCT	284	17	yes
GATCCTGCATATCTCAAAGA	7	1	yes
GATCCAGGACTGTGCTTGAC	12	0	yes
GATCCTGCAGCAGGAGTGCA	136	30	yes
GATCTGTCCTGATGAAGGCT	41	20	yes
GATCTGTCCTCAGTTATTCA	7	5	yes
GATCCTGCAAACTTCCCTGG	50	34	yes
GATCCTGATTTAGGAAGTGT	36	13	yes
GATCTGTCCATCTTGGAGTT	162	14	yes
GATCTGTCAGCTGTGCTCTC	60	39	yes
GATCAAGTTGGGAATGAGGG	38	0	yes
GATCAAGTTGAAAGAGTGTG	48	9	yes
GATCAAGTTCAGTGCGCAGG	2	3	yes
GATCAAGTGTTTGCAGGACG	35	5	yes
GATCAAGTGTGACCCAGAAA	43	0	yes
GATCAAGTGTCGGATGGAAT	39	8	yes
GATCAAGTGGATTCGGCGGT	87	1	yes
GATCAAGTGCTTTGCCAAGT	64	8	yes
GATCAAGTGAGAGGACAGAG	77	26	yes
GATCAAGTCTTGTCAGTTTG	8	7	yes
GATCCTGAGTGGCTTGCTAG	139	11	yes
GATCAAGTCGTGCTTCTGGC	7587	851	yes
GATCAAGTCCTTTGTGAAAG	799	61	yes
GATCCTGAGGGCTGCATACC	18	21	yes
GATCCTGAGGAGTCAAATAT	55	13	yes
GATCAAGGTGTTGCCTGGTG	93	0	yes
GATCAAGGTCCTAAAATTTC	77	7	yes
GATCTGTACCTGCGGCTCCA	81	45	yes
GATCCTGAATGGGCAAGAGT	15	16	yes
GATCTGGTTCCTGAGCCCAT	196	32	yes
GATCTGGTGCTGATAGGAAG	45	15	yes
GATCTGGTCACTGGTCAGAG	50	15	yes
GATCTGGTATGAACATCGGC	155	79	yes
GATCTGGGTTGTGAGGAGGT	6	6	yes
GATCTCTGTGAAAGTAGTAC	69	44	yes
GATCAAGGTCCACTTAGTGG	22	1	yes
GATCAAGGTAGCGCATAAAG	17	5	yes
GATCAAGGCTTTCCTCGGGC	41	7	yes
GATCAAGGCTCCCGGTTTTG	690	15	yes
GATCAAGGCCTTTCTGTCCT	252	17	yes
GATCAAGGCCCACTGTGGAG	19	5	yes
GATCAAGGCAAAAGGAGGAT	32	6	yes
GATCAAGGAGAGAAGCAGGA	16	11	yes
GATCCTCTGGCAGATGTTTG	111	23	yes
GATCAAGCTTAGCAGTCAAG	219	30	yes
GATCAAGCGTCCACTCCTCA	13	6	yes
GATCAAGCGGGCTTTCCTTA	873	52	yes
GATCAAGCCTGTTAGCCCTG	21	9	yes
GATCATTGCCATATCACATT	4	4	yes
GATCCTCGACAGGAAGCCAG	15	23	yes
GATCTGGGGCTTTTTGTGTG	35	7	yes
GATCCCTTTGGTGCCCCTGA	4	4	yes
GATCTGGGCAGTTGTTTTGC	98	5	yes
GATCTGGGCACCGAGGCTGG	109	70	yes
GATCTGGGCACCCACTGCCT	41	1	yes
GATCTGGGATAAGGAGAGCG	74	59	yes
GATCGGCGATGTGATGTGCA	58	14	yes
GATCAAGCCCTTCTTCCATT	288	10	yes
GATCAAGCCATCCATCAACT	720	19	yes
GATCAAGCATCATGATGCTC	17	17	yes
GATCAAGCAGTTTCTGGAGT	22	10	yes
GATCAAGCAGTAGAGTTTTT	2	2	yes
GATCAAGCAGCGAGAGGCTG	167	60	yes
GATCAAGCAGCAGCACGGGG	57	6	yes
GATCAAGCAGAACCTGGAGA	93	3	yes
GATCAAGCAAAATATCCCTA	9	0	yes
GATCAAGAGTTTATTGCATT	21	0	yes
GATCCTCCTGCCTCTGCCCC	10	11	yes
GATCAAGAGTGTTGGCTGCT	2	2	yes
GATCCTCCTGCACCATGCCT	5	3	yes
GATCCTCCTCACTTAGCACC	10	7	yes
GATCAAGACTCTCCTGGAGA	96	14	yes
GATCAAGACCCTCCAGAGGT	13	13	yes
GATCAAGACAGCTTGTTGGT	44	5	yes
GATCCTCCCAAAAGCCATCT	11	8	yes
GATCAAGACAACCAAGGCTA	7	13	yes
GATCCTCCAGCTGGGATTCC	4	5	yes
GATCCTCCAGCTCCATCAGC	11	15	yes
GATCCTCAGGTTTGTGTTGC	73	1	yes
GATCTGGGAGCCAAAGGTTG	38	25	yes
GATCCTCACTGGCAGCAGCT	28	7	yes
GATCCTCACCCACCTGCTGG	70	4	yes
GATCTGGGAAAATGGCAGTT	40	28	yes
GATCTGGCTTTTGTTTTCCA	11	11	yes
GATCTGGCTGGACAGTGGAC	6	4	yes
GATCTGGCTGACTCTGCTTC	14	10	yes
GATCTGGCCGAATGGTAAAA	5	5	yes
GATCCTGTGAGTTCTAAATC	85	6	yes
GATCGTGCGTCGCTTTGAGA	19	0	yes
GATCAACTGTGCAGACAACA	7606	1235	yes
GATCAACTGCTACGATGTGT	2	3	yes
GATCAACTGAGGTCTTTCTT	4	4	yes
GATCAACTCTTTGTTTTGGC	32	32	yes
GATCAACTCTTGGCTTTGAC	21	22	yes
GATCTGGCCAGGGTGCCTTT	40	5	yes
GATCTGGCCAACACAAGAAC	202	91	yes
GATCCTCCCTGTTCTCATCT	77	16	yes
GATCTGGCAGATGTGAGGTT	3	4	yes
GATCTGGCACTACTGCCGAG	46	6	yes
GATCTGGAGGTGGAAGTGGT	70	7	yes
GATCAACGCGATTTAGCTGA	4	1	yes
GATCAACGACCGTATTCGAC	249	75	yes
GATCAACCTCGTCGACTGGG	37	16	yes
GATCTTTCAGTAGTTTGGGA	26	30	yes
GATCAACCGACAGCTGGAGG	317	8	yes
GATCAACCACTGACCTGCCT	71	4	yes
GATCAACAGTGAGGCAAGCA	48	52	yes
GATCAACAGTAGTTGTCTTT	9	6	yes
GATCCCCGGCGGGTGCTGTA	11	11	yes
GATCAACAGCTGCCCTGCCT	45	10	yes
GATCATGAGTCCTGAATCAT	2	2	yes
GATCTTGGGATGAAAGCAAG	46	32	yes
GATCCACGCGGTAAGAGAGA	26	7	yes
GATCTCCCCGTCACAGAACC	53	35	yes
GATCCAGGCTATCTCCTCTG	11	1	yes
GATCCAGGATGCACCACTGA	2	2	yes
GATCAGTCCTTCCCTCGAGA	29	10	yes
GATCCAGGAGGCTCTGCACG	139	21	yes
GATCAGTTTCAAGAAGCGTG	3	6	yes
GATCCCAGCATCGGCAAGCG	372	1	yes
GATCCCAGCAGCTGTTACCT	56	4	yes
GATCCCAGCACTGCAAAAGA	18	3	yes
GATCCCAGCACACACCGTGA	102	1	yes
GATCCCAGATGGACATGGCA	12	7	yes
GATCCCAGATGATACCCACT	17	0	yes
GATCCCAGAGGAAAGGGTTT	7	2	yes
GATCCCAGACGCCTCAAATG	12	0	yes
GATCCCAGAAGCCGCACAGG	5	2	yes
GATCCCAGAAGCACACTGGC	136	20	yes
GATCCCAGAACCATTGCCTG	116	9	yes
GATCCCACTTCACCTGTTAT	16	6	yes
GATCCCACTGTTGATAAGGA	19	1	yes
GATCCCACGAGCCAGAGAAC	428	30	yes
GATCCAGGAAATGCTGGAGA	79	10	yes
GATCCTAGCGGACCTCAACC	73	14	yes
GATCTGTCTCCCTTTTAGCT	26	22	yes
GATCTGTCCAGGGGACATTA	58	6	yes
GATCCAAGTCAGGGAGAAAG	2	2	yes
GATCCCACCTGTCACCCCAT	109	20	yes
GATCCCACCTCACGTGTGAT	72	14	yes
GATCCCACCGCAGCTACCAG	32	1	yes
GATCCCACCCCGAGCCTGGT	2	2	yes
GATCCCACCATTCTCCTTGG	82	40	yes
GATCCCACCATCCTACCTAC	86	5	yes
GATCCCACATTTCCCTTGCC	23	27	yes
GATCCCACAGGCCGGTGGAG	35	4	yes
GATCCCACAGCCAGGCTCAC	102	8	yes
GATCCCACACTTAAGACTTC	39	6	yes
GATCCCACACATAAATGACC	364	14	yes
GATCAGGTGGATGTGCAGGA	80	20	yes
GATCAGGTCCTAAACATGGC	98	16	yes
GATCCCACACAGCAGACAGA	2	4	yes
GATCCCAATTGGTGGAAAGG	48	8	yes
GATCCCAATTCTGTCCCAAT	145	5	yes
GATCCCAATTCCCAGTATTA	5	0	yes
GATCCCAATGGTCACACACC	241	22	yes
GATCCCAATGCTGCCCCATC	11	11	yes
GATCCCAATGAGCCCACCTA	84	12	yes
GATCCCAATAAACCCATGAG	9	9	yes
GATCCCAAGTGCTGGGAAAG	29	5	yes
GATCCCAAGTCCAACACCCA	13	4	yes
GATCCCAAGCCTCACCGGCT	27	3	yes
GATCCCAAGCCAAGAAACAC	30	1	yes
GATCCCAAGAGGAAGGGTAT	43	2	yes
GATCCCAAGAAACTACTTGA	85	17	yes
GATCTGACTCCTTCTTCTGT	2	3	yes
GATCCCAACTGTCAGTGCCA	99	6	yes
GATCCCAACACAGCGATATG	491	14	yes
GATCCCAAATCTGTGGTGTG	66	3	yes
GATCCCAAAGGCTCCAGGGT	52	9	yes
GATCAGGGGCCAAGGTCCTT	93	12	yes
GATCCAGAGCTCCTAGCACT	109	11	yes
GATCAGCCTTCATCGTGCAC	14	5	yes
GATCCCAAACTGTATCCTTG	24	9	yes
GATCCCAAACTGAGGCAGCA	95	5	yes
GATCCCAAACTACTTAATAG	30	11	yes
GATCCCAAACAACTAAGAAT	519	10	yes
GATCCCAAAATGCTGCGGAG	87	15	yes
GATCCCAAAATAGGTGTTGA	48	9	yes
GATCCCAAAAACCGTGCAGC	7	2	yes
GATCCCAAAAAATCTGTGCC	383	15	yes
GATCCATTTGCTTACACTGT	2	0	yes
GATCCATTTGATGCTTCCAG	72	11	yes
GATCCATTTCTTCTGCATGA	69	4	yes
GATCCATTGTGTGGTTTAAC	109	8	yes
GATCCATTGTATGGCTTTAT	18	1	yes
GATCCATTGGTTTCTCAGTC	79	8	yes
GATCCATTAGTGTTTGCTGG	2	1	yes
GATCCATCTTTTTCTTTGGA	6	1	yes
GATCCATCTTCAGCTGACTG	19	19	yes
GATCCATCTCTTTCCTTCTG	40	0	yes
GATCCATCTCCTCTGGCTCT	44	5	yes
GATCCATCTCCAGCACATGC	19	14	yes
GATCTGGGTTGGATGGGGCT	11	7	yes
GATCTGGGTGGCCAGTACTT	96	62	yes
GATCTGGGTAGGGGACCAGG	256	105	yes
GATCCAGAAGGGTCTCTCTC	2	2	yes
GATCAGGCCGGGGCGGCAGG	249	32	yes
GATCAGGCCCTAAAGCATTG	37	5	yes
GATCCCCAAATCCCTGGTGA	2	2	yes
GATCCATCGACTGTGATAGG	9	0	yes
GATCCATCCTATCCATCCGT	4	1	yes
GATCCATCCCCGGCAAAGAG	134	2	yes
GATCCATCCCAGAGGGACTG	20	7	yes
GATCCATCCAGCAAAGAGGA	45	8	yes
GATCCATCCACCAGCAGGAG	17	5	yes
GATCCATCCAATGGCTTACC	149	1	yes
GATCCATCAGGGCTGAGCCT	38	2	yes
GATCCATCACAGGACTATGT	52	1	yes
GATCCATATGGGTATGTGTA	11	3	yes
GATCCATAGCACAAAGCCAC	13	1	yes
GATCCACTCACAGCACCTCC	34	10	yes
GATCCACTCCCTGTTCCCTT	43	8	yes
GATCCATACAATTTGTGCCA	974	53	yes
GATCCATAATGGCTCAGTAT	171	17	yes
GATCCATAAGTTTGCCCAGT	71	15	yes
GATCCAGTTTTGGGAAAGGA	212	11	yes
GATCCAGTTTCTGACTCGGG	72	14	yes
GATCCAGTTTCATTCTCTAA	4	1	yes
GATCCAGTTGTTTGAAGATT	34	1	yes
GATCCAGTTGTGCAGTAGAG	38	12	yes
GATCCAGTTGGAGAGATTTG	19	10	yes
GATCCAGTTGCTCTAAGTTT	11	1	yes
GATCCAGTTCTGCTCAACTA	16	5	yes
GATCCAGTTCTACGAGCGGC	311	5	yes
GATCCAGTTCTAAAACTTGT	336	58	yes
GATCCTTGACCAGAAGTCTC	69	16	yes
GATCCAGTTACCAGAAGATG	162	6	yes
GATCCAGTGTGTTGCTGGCA	57	6	yes
GATCCAGTGGCAGCCTCAGC	138	2	yes
GATCCAGTGCTGGGGAGATG	50	12	yes
GATCCAGTGCCTCATTGTTG	33	0	yes
GATCTGGCCGCCCCGGGGAA	11	11	yes
GATCCAGTGAGAGCCAGACA	73	20	yes
GATCCAGTGACGTCAGACGC	8	9	yes
GATCCAGTCTTTAAAGAAGC	53	9	yes
GATCCAGTCTGTCCTAGATG	180	5	yes
GATCCAGTCCTGGAGGACAG	284	18	yes
GATCCAGTCCATTCAGCAGT	78	22	yes
GATCCAGTCAGCCCCTGGGG	180	38	yes
GATCCAGTATCTGAAAGACC	137	8	yes
GATCCAGTACTTGGTTTGTG	91	5	yes
GATCCAGGTTCAGTAAATTA	35	7	yes
GATCCAGGTTCACCACCGGG	33	3	yes
GATCCAGGTTCAATTTCCAG	56	4	yes
GATCCAGGTGTGCTGAGTGG	394	20	yes
GATCCAGGTCCGTGAACCCC	38	7	yes
GATCCAGGGTGTGCAGTGGG	309	7	yes
GATCCAGGGTCCTCTGCCTG	108	9	yes
GATCCAGGGGGGACACCTGC	65	10	yes
GATCCAGGGCGATGTTGGGG	246	7	yes
GATCCAGGGCCTGTGAATCA	17	3	yes
GATCCAGGGCCTGGTGGAGG	301	19	yes
GATCCAGGGCCTCTGCGCCT	30	8	yes
GATCCAGGGCCACTTTGTCT	21	3	yes
GATCCAGGGAGCAATAACCA	4	4	yes
GATCAGCGGCCGAATGTCCC	90	23	yes
GATCCACCACAGCAGGCAGG	26	0	yes
GATCAGCCTCAGTCTTCAGG	58	9	yes
GATCAGCCGGGGCTTTGAGG	17	15	yes
GATCTTTGGAAGGAGAAGAT	19	17	yes
GATCAGCGTGACCACCCCCT	59	1	yes
GATCCAGGCTCACAGTGTGA	15	8	yes
GATCCAGGCTAACCAGACTG	4	6	yes
GATCCAGGCGGCCCTGCCAG	92	4	yes
GATCCAGGCGGCCAAGAACT	398	29	yes
GATCCAGGCGGAGGATGACG	45	9	yes
GATCCAGGCAGCTGTGTACA	58	18	yes
GATCCAGGAGTTCAAAGAGG	1021	135	yes
GATCCAGGACTTCTTCATCC	3	4	yes
GATCCAGGACCATCCTCTCA	21	0	yes
GATCCAGGAAGTTTTGTTGT	2	2	yes
GATCCAGGAACTACTCCACA	83	6	yes
GATCCAGGAAAGCAGCCTGT	54	8	yes
GATCCAGCTGGGCGAGGATG	214	34	yes
GATCCAGCTGGGCAAAATTC	4	4	yes
GATCCAGCTCAGGCGGTGTC	12	9	yes
GATCCAGCGCTCTCGGGACT	51	14	yes
GATCCAGCCTTCCTTAGGCC	16	10	yes
GATCCACAGCCACAGAAGAG	8	1	yes
GATCCACAGACCACCAGCCT	1	1	yes
GATCCACAGAAGACAGGCCT	1	1	yes
GATCAGCAGTCCGCGAGCTT	6	1	yes
GATCCTGTGTCCCCTGGGCG	22	6	yes
GATCCAGCCTGAGCTCAGTG	53	4	yes
GATCCAGCCTGACCTGCACA	402	16	yes
GATCCAGCCAGTCTCTCATT	44	18	yes
GATCCAGCAGTTAAAGCAGT	240	36	yes
GATCCAGCAGGTGCTGACCT	3	5	yes
GATCCAGCAGAGAGGGCAGG	76	1	yes
GATCCAGCAGAAATGTGGCT	34	4	yes
GATCCAGCACCGTGTGTACC	27	3	yes
GATCCAGCACATACAAGTCT	18	3	yes
GATCCAGCAAACTTGGTTGG	141	18	yes
GATCCAGATGATGGTTCTTT	235	6	yes
GATCCAGAGTGGCACAGGGT	284	23	yes
GATCCAGAGTGGAACTGTCC	32	6	yes
GATCCAGAGTGACGTGCTCA	5	5	yes
GATCCAGAGGTGTTAGCTAC	47	7	yes
GATCCAGAGCTTGAATAAAA	2	2	yes
GATCCAGAGCTTCTGCAAGG	48	5	yes
GATCCAATGCTGACCTGGCT	51	8	yes
GATCCAATCCTCCTGCCTTC	5	2	yes
GATCCAGAGCTGGGCTCAGG	8	1	yes
GATCCAGAGCTGGAATAGCA	6	3	yes
GATCCAGAGAACTCAGCTGT	53	5	yes
GATCCAGAGAAAGCAAAGGC	84	3	yes
GATCCAGACGCCAAGGCTGC	19	7	yes
GATCCAGACCTCTTCATGTT	31	4	yes
GATCCAGACCCGGGAAGGGA	238	8	yes
GATCCAGAATTGCTTTCCCA	4	4	yes
GATCCAGAAGTTGGGAAAAC	206	16	yes
GATCCAGAAGCAGTGGAATC	12593	267	yes
GATCCAGAAGAACCTACCAC	60	4	yes
GATCCAGAACAGTACAGCGT	218	5	yes
GATCCAGAACAGCGACGATG	19	3	yes
GATCCAGAACACATTAACCT	158	22	yes
GATCCAGAACAAGCACCAGA	12	2	yes
GATCCAGAAAGAACGATTTG	69	2	yes
GATCCAGAAAGAAAATGTCA	2	2	yes
GATCCACTTGGGCTCTGTCA	27	6	yes
GATCCACTTGGAACTGGCCA	2	2	yes
GATCGCCACCTACCGCCGCC	91	21	yes
GATCCTGAGCAACACCTGAA	17	29	yes
GATCGCCACCTACCGCAAGC	719	35	yes
GATCAAGTTTGCCGTCCATG	7	13	yes
GATCCAAACCCTGCCAGTGA	7	9	yes
GATCCCCACGGGTGCCCAGA	44	4	yes
GATCCCTGATGCTAAAGAGA	2	2	yes
GATCGAGGAATTCCTGGAGA	3	5	yes
GATCTTGCTGTTGTGGATGT	83	8	yes
GATCAAATTCCCACTGCCCG	53	72	yes
GATCATGAAAAACGGGGAGA	165	1	yes
GATCTGCTGGATGTCTGCCG	18	1	yes
GATCGTGCCCGACACCCTGC	12	14	yes
GATCCTCACATGGAAAGTAC	14	10	yes
GATCCTCAACGAGGATGGCA	195	34	yes
GATCCTATGTTGCTGGAGCT	176	20	yes
GATCCTATCAGACATGGTGA	44	31	yes
GATCCTAGTGGGTCTACCAG	344	180	yes
GATCCTAGTGCTGCTCTGGC	210	41	yes
GATCTGAATGTGCCGTCTCT	7	13	yes
GATCCTACCGCCTTTAACAA	53	11	yes
GATCCTACAGAAGGCCCACT	36	15	yes
GATCAAGAATTTGGTGTCGA	33	33	yes
GATCTGGAGGCCGCTGTGAG	82	53	yes
GATCTGGAGCTCCTGGGATG	479	21	yes
GATCTGGAGCCTCCACGATG	18	18	yes
GATCTGGAGAAGCGACGTAT	79	27	yes
GATCTGGACTTGTTTTCTGG	20	3	yes
GATCTGGACTTCTGAATCTG	34	1	yes
GATCTGGACTGTAGGGAGAG	12	0	yes
GATCTGGACCTCACCTCTGA	232	17	yes
GATCCACTTGTGCATGTAGT	2	3	yes
GATCTGGAAGTTGGCAGATG	183	25	yes
GATCTGACCTCGGAGTGTGG	3	4	yes
GATCAACAAATCTCCTAGGC	11772	4397	yes
GATCAACAAAACTGTACCTG	13	8	yes
GATCAAATTGGTCTTCACCT	2	2	yes
GATCAAATTGGTACAGAAAT	20	1	yes
GATCAAATTACAGTAAACCC	45	2	yes
GATCCGTGTCCCTGCGTGCA	492	79	yes
GATCCGTGGGCCTGGCCTCC	308	25	yes
GATCTGGAAGAGACTTTGGC	1572	86	yes
GATCTGGAAAGCTCTGGGGA	103	29	yes
GATCCGGGTGTTGTGCCTAA	168	19	yes
GATCTGGAAAACGCTGGAGA	133	20	yes
GATCTGCTTGCCAGGCCACT	56	15	yes
GATCAAGAATTTGGTGTGGA	10563	357	yes
GATCTGCTTCCAGGTCCTCA	100	0	yes
GATCTGCTTAGCTCCAAGGA	5	6	yes
GATCTGCTGTCCAGAGCAAG	268	15	yes
GATCTGCTGCTGGTGCTTGC	76	10	yes
GATCCTAGAATGTTTGTAAG	2	2	yes
GATCCCCTTTCTCTATGTCT	275	88	yes
GATCAAATCACTGGCAGACA	57	2	yes
GATCAAATATGTGGAGATTT	2	4	yes
GATCAAAGTTGTTTCACTGT	50	4	yes
GATCAAAGTCATTGCGGTTA	95	2	yes
GATCCGGGCAGCCCAGGAAA	27	6	yes
GATCAAAGGCTTCAATCACA	6	6	yes
GATCAAAGGAGACTGGCAGC	9	10	yes
GATCCGGCCCTACTGTGTGT	83	8	yes
GATCAAAGGAAAGGGGAGGG	2155	245	yes
GATCAAAGCTGGCAAGGTAC	391	17	yes
GATCAAAGCCCGGAAAGGCA	5290	202	yes
GATCAAAGCCACGGGGTCAG	51	6	yes
GATCAAAGCCAAGTATCCTG	76	3	yes
GATCCGCTGTACTCTCCTCC	32	21	yes
GATCCGCGCTGAGGAGCAGC	21	24	yes
GATCTGCTGCAGGACCTGGG	100	0	yes
GATCCGCGAATGCTCGGAGG	1094	47	yes
GATCTGCTGAAGGAGAAAGC	99	8	yes
GATCTGCTCTCGGGCCTCGC	223	9	yes
GATCCGCAGTGGCATGTTCT	168	21	yes
GATCCGCAGCGCCTCTTCTT	23	16	yes
GATCCTAACTTACTCCATTT	2	2	yes
GATCCGTTGCTGACCTTGCG	26	26	yes
GATCAAAGAGTTCAGCAAGA	61	8	yes
GATCAAACTGAGTCTGAAGG	487	60	yes
GATCAAACCAGCCTGTTTTT	2	3	yes
GATCAAACAGTAAAGGTGTG	163	12	yes
GATCAAACAGCAGCCAAGTG	2	4	yes
GATCCGAGAAAGAGAGAGGC	4	5	yes
GATCCGACTGCAAAATTCAT	2	4	yes
GATCCGAATGGGTCGACTGA	34	27	yes
GATCAAAATGTGGTGCCAGA	131	21	yes
GATCCCTCCCAGAAACCTGG	4	3	yes
GATCCCTGTGCCTAGCTGCT	24	0	yes
GATCTGCCTGAAACCAGGGG	87	18	yes
GATCGTCTTCAATGCTGATA	7	7	yes
GATCTGCCTCAGTCCACAAG	92	8	yes
GATCTGCCTATCTGTCTATC	22	9	yes
GATCCGTCACAGAGAGCAGG	35	6	yes
GATCTGCCCTGTATTGTTAA	7	6	yes
GATCTGCCCCTGACCCTCCA	96	9	yes
GATCTGCCCATAAGACTTCC	2	3	yes
GATCACGCCCTCGCCCTCAC	6	5	yes
GATCAAAATGCTTGGAGAAA	24	5	yes
GATCAAAATGAGGCAGAGGA	70	50	yes
GATCAAAATCGCAGTTACTG	105	2	yes
GATCACAGTCTTTCAGCTAT	33	32	yes
GATCAAAACTCAAGAAAAGG	32	1	yes
GATCCCTGGTCCTTAGGTGG	91	6	yes
GATCAAAACCCGAAATAGAG	30	1	yes
GATCAAAAACAAAAGCGAAA	147	9	yes
GATCTGCCCACCATATTCCT	111	15	yes
GATCCGGGCGTCGGCAGAGC	25	6	yes
GATCTGCCAGGAACATGAGA	15	16	yes
GATCTGCCAGCCGTACATCC	74	10	yes
GATCCCTGATTGCCTCCATG	722	38	yes
GATCCCTGATGCAAAAGAGA	299	7	yes
GATCTGCAGTTGCTCCAGCA	66	43	yes
GATCTGCAGTTCCTGGAAGG	40	27	yes
GATCCCAGCAGACCTATCAC	80	1	yes
GATCTGCAGGTGCCTGGGAA	69	25	yes
GATCTGCAGGGCAAAGTTTA	11	8	yes
GATCAGCAACTTCTGAGTGG	6	1	yes
GATCCAGCCACTGAGGCCCG	19	0	yes
GATCCCTCTGCAAACCAAAC	107	17	yes
GATCTGCAGGAGGATGGTAA	2	3	yes
GATCTGCAGGAGGATGCCTG	406	58	yes
GATCTGCACTCGGTACCCTC	30	9	yes
GATCCGCGCCTGTGGGGAGC	33	21	yes
GATCAAGACTGTGGATGGCA	5	2	yes
GATCCCTCAGTGTAGCATAG	31	3	yes
GATCCCTCAGCTTTCTCCAA	6	6	yes
GATCTGATTTTGACCAAGAT	15	15	yes
GATCCCGTCAACTTCAAGCT	335	29	yes
GATCCCGGGGGCTCCAGGAA	7	6	yes
GATCCCGGGGCAGTCCAGCC	17	11	yes
GATCCGAGTTGGGGAGCCTG	100	15	yes
GATCAAATTCCCACTGCCCC	2310	810	yes
GATCTGATTCCCGCAGGTTC	1154	95	yes
GATCCAGCCTGGGCTAGCAA	74	12	yes
GATCCCGGGCAATGCTTTCA	17	29	yes
GATCTGTGAGATGAAGCTGG	21	15	yes
GATCTGATGACTTCTTCTGG	78	3	yes
GATCTGAGTTCCCGAAGCAA	174	48	yes
GATCTGAGTGTCGGCACCAG	6	7	yes
GATCTGAGTCCCCTGCTGGG	69	22	yes
GATCCTGCTCCTGTCTTTTC	40	7	yes
GATCCCCTGAGAAGCTGTAT	2	4	yes
GATCCCCGGCGTCTGTTTGA	9978	245	yes
GATCCCCCAGCCAGGCCAAA	2	4	yes
GATCTGAGGCTGAGGGTATA	41	28	yes
GATCTGAGGCAGCGACTGAG	40	26	yes
GATCTGAGCCCCCTGAGGTT	111	24	yes
GATCCCTGGAGCCACCAGCT	133	15	yes
GATCCCTGCTTTCATGGAAG	188	18	yes
GATCTGAGAAGCTGTGATGG	2	2	yes
GATCTGAGAAACGGGGAAGC	117	77	yes
GATCTGACTCCCTCTTCTGT	2165	1423	yes
GATCTGGCGGTGGCTAATAG	11	9	yes
GATCTGACGCCGAGGAGGTA	262	40	yes
GATCTGACCTGGGTCCTGAC	41	17	yes
GATCCCTATGGACACTGACA	98	5	yes
GATCCCTAGTGACTCGTTTA	120	18	yes
GATCTGGTACAACGCAAGGG	31	2	yes
GATCAGCACCTGCATCCTGC	14	7	yes
GATCTATTTTTGCACTGGAA	113	1	yes
GATCGAGCTCAGAGGCGAAA	142	143	yes
GATCCACTGTTGTCCAGAGG	73	1	yes
GATCCACTGTCTTCCTAGAG	249	20	yes
GATCCACTGGGCCAAGGAGC	67	3	yes
GATCCACTGCTGGAAGTACC	182	22	yes
GATCCACTCGGGGGCTGTGA	6	1	yes
GATCCACTCCTGCAGAGCAC	51	5	yes
GATCCACTCCAGGCTGCGAG	119	14	yes
GATCCACTACTGTCTCCTGT	18	1	yes
GATCCACTACCAATCTCGTA	2	2	yes
GATCCACTAATGCAGCTGGT	37	2	yes
GATCCACGTCTCGTCGTCAG	65	0	yes
GATCAAAGCCCGGAAGGGCA	44	41	yes
GATCCACGGGGCACCCGCAC	84	14	yes
GATCCACGGACACCAAGTTA	93	7	yes
GATCCACGACTACTTGGACA	50	2	yes
GATCAGAGCTACACAATGGC	40	27	yes
GATCAGAGCCGCCTGACTTC	119	58	yes
GATCCCAGCTTCAGGACACC	93	10	yes
GATCAGAGCAGGAAGTTTTC	30	1	yes
GATCAGAGCAATGCTGGAGC	48	34	yes
GATCTGCTCGTGTTCCTGTC	19	2	yes
GATCATGTTCCGCCAGCGGT	186	6	yes
GATCCACCTGCCTGTGCCTC	38	2	yes
GATCCACCTACTTTTTCAGC	14	3	yes
GATCCACCCACCCTGGGCAT	99	6	yes
GATCCACCATCTGTAATGTC	14	10	yes
GATCCACCAGTGCTTCTGCT	31	4	yes
GATCCACCACATGTGCCAAA	1153	64	yes
GATCCACATTTGCTGGTTTG	73	6	yes
GATCCACATTGCTGTCCTAT	11	1	yes
GATCCACATGTGCTCGCAAA	72	7	yes
GATCCACATGTACCATCAAC	72	14	yes
GATCCACATGCGTGTAGCAG	329	20	yes
GATCCACATGAGGAGATACT	97	18	yes
GATCCACATCTCCCTCCCCT	31	11	yes
GATCAGACCGTGGCGGTTGG	10	4	yes
GATCCAAAGCCTGAAACTAG	26	26	yes
GATCTGCGAAAGGGGCAAGG	17	16	yes
GATCGCCCTTCCCAACAGTT	2	2	yes
GATCCACAGTCAGCAAATCC	9	2	yes
GATCCACAGGGTACCTCCCT	92	1	yes
GATCCACAGGCAGTTGTGCC	20	4	yes
GATCCACAGGAGGGTTCCAA	242	17	yes
GATCCACAGATTTTCTTGGG	5	2	yes
GATCCACAGATTCTGCCTGT	122	12	yes
GATCCACAGACAGCAGGAGG	64	10	yes
GATCCACAGAAGCACTGCAG	44	1	yes
GATCCACACGGAAGGGGAAA	34	2	yes
GATCCACACCTGATGGCTCC	31	2	yes
GATCCACACCCTAACTCCCA	92	8	yes
GATCCACACACGACTCTCCA	56	15	yes
GATCCTCTTGCTGCAGCTTT	51	15	yes
GATCCACAAGTCTTAGCTGT	19	8	yes
GATCCACAAGCGACTCATTG	4506	245	yes
GATCCACAACCTGATTCCCG	12	2	yes
GATCCACAAATGCATGGATT	24	5	yes
GATCCACAAAGGCAGAGCCC	7	0	yes
GATCCACAAAACCAATAAAA	77	10	yes
GATCTGCCACTGAAGTAGAC	25	1	yes
GATCGCCTCTGAACTAGACT	38	4	yes
GATCCAATGCTCTATCAAAC	65	6	yes
GATCCAGAGGCAGGTGCAGA	52	5	yes
GATCCAATCGACTGGGTTTC	165	14	yes
GATCCAATCCCTGTGCAGCA	27	1	yes
GATCCAAGTTTGGATAATGA	625	36	yes
GATCCAAGTTGTACATGAAT	6	4	yes
GATCCAAGTTCGAAACATGG	5	5	yes
GATCCAAGTGTTTAACCATA	528	40	yes
GATCCAAGTCCAGGAACCCT	189	14	yes
GATCCAAGTCATGATTTGAA	718	19	yes
GATCCAAGTATTGGCACCCA	9	2	yes
GATCCAAGTACTACCATAGG	44	2	yes
GATCCAAGGTCAAGGCAGAG	231	25	yes
GATCCAAGGCCTCAGGTCAC	164	20	yes
GATCCAAGGAGTGGTACCCA	5	0	yes
GATCCAAGCTCATCATTTGC	19	3	yes
GATCCAAGCGTTACAATCGC	14	0	yes
GATCATGTGCCTACCCTGAC	26	9	yes
GATCCAAGCGTGAGCCAGTC	40	3	yes
GATCCAAGCGGACAGAGTGA	75	4	yes
GATCCAAGCAGGCCCCTTAT	93	9	yes
GATCCTTAATGAAGATGATG	39	15	yes
GATCCAAGAGGAGGAGCACA	61	6	yes
GATCCAAGACCAGGGTGGCT	160	10	yes
GATCCAAGAAGTCAGTCGGC	40	3	yes
GATCCAAGAAGAAAAGCAAG	78	4	yes
GATCCAAGAAAGGAAGAAGA	47	14	yes
GATCCAACGTGTTAGCCTTG	112	0	yes
GATCCAACGTGGTCTTTAAG	33	7	yes
GATCCAACGAGTAGGAGTGT	6	1	yes
GATCCAACCCCACCTCAAGT	2	4	yes
GATCCAACATGGAAGGTGTA	28	12	yes
GATCCAACAAAGGTTGTGAG	388	39	yes
GATCACTTCCTTCTGGAATC	1	1	yes
GATCACTGTGGCGTCTTGAA	14	14	yes
GATCACTGTCGTGTTTGGTA	57	1	yes
GATCATGGTTCGGTGGCAAT	52	8	yes
GATCACTGGCCCCGATGGTG	6	6	yes
GATCACTGGAGGCCAGAGAA	22	1	yes
GATCACTGGAGCAGGCCTCC	90	37	yes
GATCATGCTGCTCCGCAATA	50	2	yes
GATCATGCTCTGGCTGAGTT	11	1	yes
GATCCAAATCTTCCAGGCCC	17	5	yes
GATCCAAATATTGTCATAGC	535	40	yes
GATCCAAAGTTGGCCAGCAT	292	23	yes
GATCCAAAGTCACACCTCCA	187	4	yes
GATCCAAAGCTGCTTAAATC	27	4	yes
GATCCAAAGCTCAGGAGACA	20	8	yes
GATCCAAAGCAGTGCTCCCA	189	17	yes
GATCCAAAGAGAGAAAGAGC	20	1	yes
GATCCAAAGACACAGTCTGT	317	1	yes
GATCCAAAGAAGACAAAATG	7	2	yes
GATCCAAACTTAACGAGCCC	35	5	yes
GATCCAAACCCCAGTGTACC	89	3	yes
GATCCAAACCCAGAGACCAA	11	4	yes
GATCCAAACAAAGACACAAG	48	9	yes
GATCCAAAATGCTACTGTTA	29	20	yes
GATCCAAAATCAAATATCTG	5	5	yes
GATCCAAAAGGTTACTGAAA	56	2	yes
GATCCAAAAGGAGACTTCTA	560	13	yes
GATCACTGCAGCCCCAAACT	66	1	yes
GATCCCGCCAAAAGAATTAA	157	219	yes
GATCATGATGTGCTGCCCAG	21	0	yes
GATCTTCTTGCTGGTCTTGC	47	9	yes
GATCCAAAAGCCTGCTCGGT	56	3	yes
GATCCAAAAGCAGCGTTTGC	15	16	yes
GATCCAAAAGAGCCTGATGG	11	8	yes
GATCCAAAACAGCAAATAGG	48	5	yes
GATCCAAAAATGGGGATGTT	58	2	yes
GATCCAAAAATACAGCCTGC	36	2	yes
GATCCAAAAAGCTAATAAAA	303	18	yes
GATCATTTTTTGTCTTACTA	47	12	yes
GATCATTTTTCTGTAGCCAT	8	4	yes
GATCATTTTTATTGTGGGGT	160	14	yes
GATCATTTTGTCGAGTGAGT	145	21	yes
GATCATTTTGTAAAGTACAG	110	26	yes
GATCATTTTCCCAACGTTAC	32	13	yes
GATCACTCCTTGCTTTGCCA	12	2	yes
GATCACTCAGGGTGGGCAGT	65	12	yes
GATCACTCAGGACGGTACCC	14	16	yes
GATCACTAAGTTGAGCAGTT	22	3	yes
GATCATCGATGTGGACCTCG	26	3	yes
GATCACGGTCACTTTCAACA	63	8	yes
GATCCTCAGGAGCCACCTTA	7	7	yes
GATCATTTGCGTTTGGAGGT	63	24	yes
GATCATTTGCCTCTTATTTG	2	2	yes
GATCTGCGCTTCCAGAGTGA	397	452	yes
GATCATTTCTTTCTGGCCTG	264	9	yes
GATCATTTCTCGCTCAGATT	16	12	yes
GATCATTTCAGATGGGCACA	18	1	yes
GATCATTTCACTGGTGGCTG	21	22	yes
GATCACGGCATCGAAAGGAA	133	25	yes
GATCACGCTGAGGGTGTCTG	26	5	yes
GATCACGATGCCACACCCTG	9	9	yes
GATCCTACCTGAGTGGCAGG	13	13	yes
GATCATTGTGGCCCCGCCCC	74	74	yes
GATCATTGTCAACTAAGTGC	80	3	yes
GATCATTGGTTGAATCGGTT	88	28	yes
GATCATTGCCACGGAAAACA	42	11	yes
GATCATTGCATTTGTTGTCT	32	3	yes
GATCATTGCAGTCTGAGGCT	21	3	yes
GATCATTGATGTTGTCTACA	6	6	yes
GATCATTGAGAGCAAGCGAG	24	7	yes
GATCACCTAGGGAGTGTGGG	11	11	yes
GATCACCGCTGCCGCCTGGG	106	11	yes
GATCACCGCCTGCACCGCAG	245	6	yes
GATCATACCCGTCCCTCTCT	26	7	yes
GATCACCCTGTCTCTTTACC	5	7	yes
GATCACCCTGGGCCTGGTCA	38	11	yes
GATCATTCTCCAAAGGCAAC	97	19	yes
GATCATTCCCTAGCTCCTTC	11	11	yes
GATCCCTGCAGAACCTCTCT	118	1	yes
GATCATTCAGACAGTACATT	29	1	yes
GATCATTAGGGGTTTGGTCT	552	50	yes
GATCATTAGCCCACATACCC	87	16	yes
GATCATTAGCCAGAAATCAA	25	1	yes
GATCATTAGCATGCCAGGAA	26	7	yes
GATCATTACTGTGTGAGTGT	50	2	yes
GATCATTACACGGAGAACAC	57	6	yes
GATCGCTCGAACTTAACCAG	3	4	yes
GATCCAGCAGTACCTGAAGG	4	5	yes
GATCCTTGTCCTCACTCTCC	15	1	yes
GATCCTTCTGAATGCCTGCT	3	4	yes
GATCTGTGGATGGGAAGGCA	94	81	yes
GATCTGTTTACAAGGTTTGT	191	31	yes
GATCCCCAATATGCTGTTGA	24	22	yes
GATCCCCAAGGCAGCTACCA	63	62	yes
GATCCCTTCTCTGACCTTTG	1	1	yes
GATCCCTGGCAAAGCCCTCT	30	6	yes
GATCATACGACTCACTGGTT	23	15	yes
GATCCCAGTGGATGAGCATG	169	43	yes
GATCTGACACTCTTCTGGAG	2	2	yes
GATCCCAGCACCGAGGGGAA	227	0	yes
GATCTGACAAAGAAAGTTTA	12	3	yes
GATCTGAAGTTCAAATTCCG	74	11	yes
GATCCCACTGCACCGCCATT	80	17	yes
GATCCCACTGCACATAGGAC	4088	2217	yes
GATCCCACGGGGTGCAGTGA	286	26	yes
GATCCCACCTAGCAGCCACC	391	56	yes
GATCAAACGGTCCCTGCGCT	14	5	yes
GATCTGAAGAATTTTGAAAG	26	17	yes
GATCTGAACTTTGTACAGGA	282	7	yes
GATCCATATTTCATACAGTG	2	2	yes
GATCAAACAACCCAACAGGA	2759	1192	yes
GATCCCCGTGTCTGTGGAAA	77	7	yes
GATCTGAAAGTAGACTCTGC	14	16	yes
GATCTGCATGAAACAGCATA	9	10	yes
GATCCCAAGTTTTTCCTTAA	11	8	yes
GATCTGAAAATGTGTCTAAG	31	36	yes
GATCCCAAGACCACCCACCT	18	12	yes
GATCCAGCCCCACCATCACC	19	5	yes
GATCTGAAAAACAACTCCTA	43	0	yes
GATCTCTTTTCCTGACCCTC	200	41	yes
GATCTCTTTCCCCGAGTTGC	30	4	yes
GATCCATGATGAAAGGATTC	6	7	yes
GATCCCCAGTCCAGGATGTG	11	1	yes
GATCATGGGTGTGGTGCTGC	21	7	yes
GATCCATTCGCTGTAACATG	18	9	yes
GATCCATGTTGGGGGTTGGG	19	16	yes
GATCCATGTTGACCAAATGC	18	13	yes
GATCCATGTGTTGGTTGAGA	23	6	yes
GATCCATGTGATGGACTGCA	20	14	yes
GATCCATGTCCTTTGGCTCC	17	16	yes
GATCACGTACTGTGCCTTGT	4	3	yes
GATCCCCAAGAAGTCTTATT	13	6	yes
GATCCATGGTGGGGCCATTT	152	33	yes
GATCCATGGTAGTCAGATAG	32	5	yes
GATCTCTGTCCGAACTGTGA	73	4	yes
GATCTCTGTCCACTGTATGC	21	2	yes
GATCTCTGTCAAGGTGGTGG	2	2	yes
GATCCATGGGCCTTAGGGCT	68	17	yes
GATCCATGCTCTGATGAGCG	25	6	yes
GATCCATGAAGTTTTCAGTC	82	7	yes
GATCCATGAACTCTAACTCC	2	2	yes
GATCCATCTGCATTTGCGGC	14686	722	yes
GATCCATCTGCACATGGCTC	4	5	yes
GATCTCTGGGCCTCTCGCAG	19	12	yes
GATCTCTGGGAAGGGCTGCG	17	3	yes
GATCTCTGCTCCCTACCCTT	80	11	yes
GATCTCTGCTATGAGGCTAC	46	5	yes
GATCACACTTTCTGAGTTAC	75	23	yes
GATCTCTGAGCTGCTGCCGT	5	6	yes
GATCTTGACATGCAAAAGTC	3	4	yes
GATCTCTGACAGAGCCCATT	260	169	yes
GATCCCAGCAGCATGGCGTC	19	5	yes
GATCCATAGGGAAATTGTCC	1	1	yes
GATCTCTCTCCCTCTACACA	8	5	yes
GATCTCTCGCCTGGACCCCT	10	11	yes
GATCTCTCCCAGATGGTAAA	6	7	yes
GATCTCTCCAAAGCACACGC	233	46	yes
GATCTCTCAGGCCATGGGTC	193	25	yes
GATCCAGTTTCCTCACAAAT	7	5	yes
GATCCAGTGTGGAAGAGGTG	17	11	yes
GATCTCGGTGGCCAGCTTCC	35	24	yes
GATCTCGGGAGATTGGCTGG	536	287	yes
GATCTCGGAATGGACCCCAA	26	30	yes
GATCCCACCTCCCCCCAGTC	164	19	yes
GATCTCGCCTTATGTTGTCC	2	2	yes
GATCTCGCAGCCTTCCCCTC	333	22	yes
GATCTCGCAAGCACAAAGCC	300	82	yes
GATCTCGAGTCACAGCCAGC	38	44	yes
GATCAGGGCCGGGAGGGGGG	14	6	yes
GATCCAGGGTGGGAAGGAAG	225	20	yes
GATCTCTGTAAGTTCATGGC	46	31	yes
GATCCAGGAGACTCGAAGAT	147	21	yes
GATCTCCTGTCTCCACCCAC	121	18	yes
GATCCAGCTTCCCTCCGAGA	165	8	yes
GATCCAGCGAGGGAGCTGCC	183	38	yes
GATCTCCTCACACTGGTAAT	4	4	yes
GATCTCCGCCCGAGCCTACG	2	2	yes
GATCTCCCTGGTCCTGGCAT	35	23	yes
GATCTCCCTGCGGCCATTGT	5	5	yes
GATCCAGCATCACCCAGACA	57	20	yes
GATCTACTTCATTCTTACAT	4	4	yes
GATCCAGCAGACCCAGCACA	15	4	yes
GATCCAGATTACTATGGGGA	26	9	yes
GATCCATTTTGTTCGTGGAC	26	2	yes
GATCTCCCGCAAGCCAGAGC	49	38	yes
GATCTCCCCTCTTCCTGGAT	99	13	yes
GATCTCCCCACCACCCCAGG	121	15	yes
GATCATAGTGTTCAGTGTCT	44	8	yes
GATCTCCATAATTCCAACTT	6	6	yes
GATCCATGCTTTGCCCGAGA	44	31	yes
GATCCTTCTCTGTGTCAGCT	19	2	yes
GATCCTGCTCACCTTGGGCT	11	3	yes
GATCTCCACCCTATGCGAGT	134	17	yes
GATCTCCACACAGCACACAG	670	34	yes
GATCTCCAATGCTGGGTCTG	15	15	yes
GATCTCCAAAGTCCTGCTAG	21	21	yes
GATCCATATCCTGCTCCACC	2	2	yes
GATCCGCGCGCACGAAGCGG	51	3	yes
GATCACCATCCTGATTATAT	56	2	yes
GATCAGTTCGTGTGCAAATA	4	5	yes
GATCACCAGCTGGGGAGCAC	15	8	yes
GATCATTAATGCCCTTGAAG	129	23	yes
GATCATTAAACTTTTCCAAC	11	11	yes
GATCATGTTTCAGGAAGGAA	38	2	yes
GATCATGTTGATTCTGAAAT	6	1	yes
GATCATGTTCTTTCCGCAGG	504	25	yes
GATCATGTTCGCCTGGACAC	343	13	yes
GATCATGTTCCTGGAGGTCA	24	2	yes
GATCATGTTACACTTGCCAG	164	15	yes
GATCATGTGTTCAAGTCCAC	44	18	yes
GATCATGTGTAAGTGTCAAA	33	3	yes
GATCATGTGGCGTTCTCTCT	14	12	yes
GATCATGTGGATGCCTTCCC	177	4	yes
GATCATGTGGAAGGTGAGAT	44	5	yes
GATCATGTGCTCACCTGCAT	11	1	yes
GATCATGTGATTTTCATTTC	47	10	yes
GATCACATTTTGCCTTTGGT	62	10	yes
GATCACATGGTGACTCTAGC	13	3	yes
GATCCTCCTGTCTCTACCTC	33	22	yes
GATCATGTGAGCATCGTGGA	1533	64	yes
GATCATGTCTTCTCCATGTT	995	75	yes
GATCATGTCTGAAAAATCCA	24	3	yes
GATCATGTCTCAAGGTGGCA	54	6	yes
GATCATGTCTATCTCAGGGG	151	1	yes
GATCATGTCCCACAGGCATT	39	9	yes
GATCATGTCATTGCCTGTTA	11	4	yes
GATCATGTCAGAGGGAGATG	223	32	yes
GATCATGTACTGGCTGCAGG	26	0	yes
GATCATGTACAGAGGTCTTT	11	1	yes
GATCATGTACAAGCTGATGG	203	9	yes
GATCATGTAAAGACGCTGGG	60	15	yes
GATCATGGTTCTGATGAAGC	19	7	yes
GATCATGGTTCAAGTGACAA	272	18	yes
GATCATGGTCTTCGGAAAAC	45	5	yes
GATCATGGGTGTTGCTACCA	139	10	yes
GATCATGGGTGTGCCAGGGG	118	3	yes
GATCATGGGGTTCAGTCTTC	4	4	yes
GATCATGGGGATGGACGGGG	65	3	yes
GATCACAGTTCATGTAATGC	43	2	yes
GATCACAGGTGTGATAGCCT	8	1	yes
GATCCCATGGGAGTCACTGA	5	2	yes
GATCATGGCCTTTACGATGC	77	5	yes
GATCATGGCCTTCAGATATG	14	5	yes
GATCATGGCCCAGACCTGAG	87	1	yes
GATCATGGCAAAGGATGACC	208	10	yes
GATCATGGATGTGTGGGGAA	19	5	yes
GATCATGGACATGAAGGAAG	82	21	yes
GATCGCTGGATGAGTCCGCA	26	4	yes
GATCATGCTTTCTTCTCTAT	7	2	yes
GATCATGCTGTGTTCGTGAT	59	8	yes
GATCATGCTCCTGCAGCTGA	37	1	yes
GATCATGCTCCTGAGTGGCA	78	6	yes
GATCATGCTCATCTTCACTG	45	4	yes
GATCATTGGGGGAGGGTAGT	41	27	yes
GATCATGCTAGCTATGTTCT	7	5	yes
GATCATGCTACGTTTTGTCT	6	1	yes
GATCATGCTACCACTGCATC	4	4	yes
GATCATGCGCCTTTCTAAGC	109	15	yes
GATCACAGCTGTGATGGGAG	90	3	yes
GATCACAGCAGCCCAAGCTC	7	7	yes
GATCTGAAGGACCTGGAGGC	10	7	yes
GATCACAGAGATACTACAGT	2	2	yes
GATCCCAAGAGTGGGACGTG	8	1	yes
GATCCGCATGCTGATGGAAG	5	0	yes
GATCATGCCTGGCTGCTCTC	20	20	yes
GATCATGCCGTGCTACGCTC	30	6	yes
GATCATGCCCAAAACAACCA	64	4	yes
GATCATGCAGACTGTTCCTT	255	54	yes
GATCATGCAGAAGAACGGTG	830	66	yes
GATCATGCACTGTATTCACA	18	10	yes
GATCATGATTTCCGAGCTAC	18	4	yes
GATCATGATTCTCCCTCAGC	79	5	yes
GATCATGATAGCAGCACAGA	35	36	yes
GATCATGAGTTCAGTGTTAC	41	13	yes
GATCATGAGTGTCCCACTAC	58	4	yes
GATCATGAGTGACCACAGTT	84	0	yes
GATCATGAGGGAGTTCCGGT	816	71	yes
GATCATGAGAAATATGTTGT	2	2	yes
GATCATGACGCTGGTAGATG	30	9	yes
GATCATGACCAAGAAAGGAA	5	2	yes
GATCATGACATTCCTCAGAT	58	5	yes
GATCACAGACCATGGTCTCA	48	4	yes
GATCACAGAATGGAAACAGC	29	19	yes
GATCATGAACATCATCCAGG	99	15	yes
GATCATCTTGTTGCGTTTCT	48	18	yes
GATCATCTTGGTGTGAGGCT	1	1	yes
GATCATCTTGCTGCTTGACA	7	0	yes
GATCATCTCACAGGACAGGG	97	3	yes
GATCACACATCTGGGCAGTG	54	2	yes
GATCAGCCTGGCTCCAGGGA	8	14	yes
GATCACACAACCCACCTCAG	34	1	yes
GATCTCTGTAACAGAGCCTC	6	7	yes
GATCAGTTCTTCAGCATGGT	2	2	yes
GATCATCGTGTCGGGATGAT	216	23	yes
GATCATCGTGGACTCACCCT	46	2	yes
GATCATCGTCAGTGACGTTT	71	1	yes
GATCCACCACCAAAGTACCT	7	0	yes
GATCATCGGCATGGCATACG	326	6	yes
GATCATCGGACGGCCAGTTG	30	1	yes
GATCATCGCATCGTTTGAAT	7	2	yes
GATCATCCTTGTGTTGTGAA	226	23	yes
GATCATCCTGCTTCCAGCTC	9	10	yes
GATCATCCAGGGCTGCCCCT	20	15	yes
GATCATCCACCTGCTCACTG	2362	151	yes
GATCATCATTCGTGTGCAGA	7	0	yes
GATCATCATGCTTCCAGATG	7	7	yes
GATCAGGTCATCGCCTCCTT	596	22	yes
GATCAGGGTTAAGGAGGAGC	90	11	yes
GATCAGGCTGTCTGGAGACT	36	33	yes
GATCAGCTGTGGGCTCTGGG	86	71	yes
GATCATCAGTTAGAGTTCTG	2	0	yes
GATCATCAGTGTGTTGGAGC	4	4	yes
GATCATCAGCTGAGGCAAGG	1	1	yes
GATCATCACTCACGGACATA	2	0	yes
GATCATCAAGTGTCCTGGCG	13	13	yes
GATCATCAACAAGACTATCT	9	9	yes
GATCATAGTGGGCTCCCCTT	13	6	yes
GATCGTCTTTGAATTTGGAC	7	5	yes
GATCACAAACATAGCCAATG	4	4	yes
GATCAGCTCATGGAAGCGTG	5	4	yes
GATCAGCGTGCGCCTAGCGG	306	12	yes
GATCAGCGACCTTCCAGCAG	2	0	yes
GATCAGCCTCTTTCCCATCA	4	4	yes
GATCAGCCTCCTGCCTCAGC	13	6	yes
GATCAGCCCTGGCAAGGAAG	125	29	yes
GATCCCAGGCGGCGGCGGCA	3	3	yes
GATCAGCCCCATTGCGGTGC	19	7	yes
GATCCCAGCTGTTTGGGGCT	79	7	yes
GATCAGCATTCCACCCCGGA	14	14	yes
GATCATAGCTCTAGCAGAAC	22	1	yes
GATCATAGCTACTTTGTGCT	9	0	yes
GATCATAGCAAAGATGGACG	32	8	yes
GATCATAGATGACTTTGCCT	80	6	yes
GATCATAGAGGTGTGGCTTT	8	1	yes
GATCATAGACCAGAGCGAGG	6	1	yes
GATCATACGTAGTTGTGAAA	8	1	yes
GATCATACCAAGAGGTGAGG	223	18	yes
GATCATAAGCTCCTGTGGGC	11	11	yes
GATCAGCAGGTGGTTATCAA	51	10	yes
GATCAGCAGCTGCTTTTGCA	98	24	yes
GATCAGCAGCCGGAGACGAC	113	30	yes
GATCAGCAGATGTTGGTGGC	61	45	yes
GATCAGCACTCTCGGTATGC	241	14	yes
GATCAGATTGGGAGTATGTA	8	14	yes
GATCAGAGCCCTGTCGATGG	80	1	yes
GATCAGACTAACCCCGGAGT	128	18	yes
GATCAGACCATGGTACTGGC	50	5	yes
GATCAGTTTTTGGTGTCATT	674	111	yes
GATCAGTTTTGGAGTGCAGC	2	3	yes
GATCAGTTTGTTTTCACTGT	15	1	yes
GATCAGTTTGCCAATCATCT	29	50	yes
GATCAGTTTCTGTGTAGTCT	38	10	yes
GATCAGTTTATGATTCAGTT	83	21	yes
GATCAGTTTATCAGTCCGTT	8	5	yes
GATCAGTTGAAACTTGGAAA	459	62	yes
GATCAGTTCTGAGCCGAGGA	15	11	yes
GATCAAGGTCGGAAAGAAAT	667	120	yes
GATCAGAATGAGGGACCTCC	172	50	yes
GATCTGTGCAGGGTATTAAC	2919	2438	yes
GATCCTGTGCGGACTCTGGG	53	7	yes
GATCAGAAACCCGAGCTGAA	81	45	yes
GATCACTTTGACTTCATCCT	40	4	yes
GATCTGTGCAAAAGCAGTGA	589	20	yes
GATCTCTGTGTTCAAGCCAA	22	1	yes
GATCACTGCTGTAGGAAAGC	144	17	yes
GATCACTGCTCTGGACCTAA	1	1	yes
GATCACTGATACTTCCTGGG	3	4	yes
GATCAGTTACTGCCACACCC	3	5	yes
GATCTCCGCTTGCTGACGCC	7	0	yes
GATCAGTGTTTCTGCGAAGG	18	13	yes
GATCGGCGTGACTACCCCTT	5	6	yes
GATCAGTGCTCTGCTAACGC	545	551	yes
GATCAGTGCCTTTGTTGGCA	176	178	yes
GATCAGTGAGTGTGAGTGTG	93	21	yes
GATCATACGGAGCATGAGAG	5	5	yes
GATCACTCAGTAACTGCTGG	86	7	yes
GATCACTCAGCCCTTGAGCA	48	10	yes
GATCACTAGCAAGGACTAAA	98	9	yes
GATCACTACTCCTTAGACGT	12	4	yes
GATCACGTTCTGATTGAGCT	56	10	yes
GATCACGTGTATGTGTCGTG	112	21	yes
GATCACGTGCCTGAGGTATG	9	9	yes
GATCACGTGACCACCCTTTC	17	18	yes
GATCACGGTGCCTGGTTACA	13	3	yes
GATCACGCTATGGGCAGGAG	9	10	yes
GATCACGCAGTCTTAGAAAT	36	10	yes
GATCACGACGACGCCCACGC	204	19	yes
GATCACCTGCCAGACTGTTA	21	0	yes
GATCTGTCTGTTTAGTGGAT	6	7	yes
GATCACCTCCCAGATTCTGA	8	1	yes
GATCACCGTTCCCATCCCCG	1	1	yes
GATCACCCACCCATCAGCCA	72	52	yes
GATCTGCTTCTGTTGTGAAG	4	1	yes
GATCTAATGGTCCTAACATT	10	10	yes
GATCCAGGAAGTGTGTCACC	30	3	yes
GATCACCAGATGCTGAGGCT	7	0	yes
GATCACCACACTGCGCACCG	8	8	yes
GATCACCAAGTGGAATGAAA	13	13	yes
GATCACAGTGGAATCTTCGG	5	5	yes
GATCACAGGTCTGAGCAAAG	261	9	yes
GATCACAGGATTGGCGTCCC	14	14	yes
GATCCAAATATGTCTAAACA	31	0	yes
GATCACACTTGGGGAAGATG	11	5	yes
GATCACACTTCTAACCCTGC	4	4	yes
GATCACACCTGTAGACAAGA	37	10	yes
GATCACACCCAAAGCTGTCC	3	4	yes
GATCACACAGGGAGGCCTTG	539	12	yes
GATCACACACTACTGAGGGC	44	17	yes
GATCACAACTGATGGCGGGT	562	27	yes
GATCTAAGCGGGACTATGAG	8	9	yes
GATCAATGTCGTCATCATCC	17	27	yes
GATCAATCACCAGCGCGAAG	167	14	yes
GATCATAAAATTTGACATTG	77	20	yes
GATCCGACCATTCAGAGTAA	2	2	yes
GATCACTGTGCGGATTGAGC	23	26	yes
GATCAACTCATGGAGCTGGC	90	41	yes
GATCAACGCCATGACCTACC	95	4	yes
GATCCCCAAAGCAATCTGCC	11	11	yes
GATCAACCCGTGTGCATTGC	53	35	yes
GATCAACCCCTACCAGCCAG	32	11	yes
GATCCGAATCTGTGCCCAGC	187	27	yes
GATCTGGGACATTCAAAAGC	15	10	yes
GATCATTCATTGAAGCCCCT	17	13	yes
GATCCCAGCATCGGCAAGCA	99	120	yes
GATCCTCCTGGGCTTGAACT	6	7	yes
GATCAAACAGCTGTACCTCA	5	6	yes
GATCGACACATGTGTGGGGA	42	15	yes
GATCTGGTGCGTGTGGCCCT	11	4	yes
GATCTGGTCCTGCTCCTACC	1	1	yes
GATCCCTCTGCAAACCAAAA	6	10	yes
GATCAGTGCTTAGCAAGTGC	11	13	yes
GATCCAGAGGCCCTAGCCAG	57	20	yes
GATCCAGAGAGCTTCCTAAA	17	13	yes
GATCCAGAATGTGTGGCAAC	1	1	yes
GATCCAGAAATTGGAGATAA	33	23	yes
GATCCCTCTCCAAAGTGGTT	103	70	yes
GATCCACTGCGTTTCCATGC	35	40	yes
GATCTCATGGTTGACTCTCT	15	6	yes
GATCCACCGTACCAGGAAGC	55	9	yes
GATCTCAGTGTGGTACAAAA	59	40	yes
GATCCAGTCGTTCTGCTGCG	96	19	yes
GATCTCAGTCCCCGCCTGCA	56	56	yes
GATCTCAGGGCACATGCTTG	36	25	yes
GATCTCAGGCACCAGGTAGA	65	44	yes
GATCAGGCGAAGCAACTGCT	36	15	yes
GATCCTGCCCCCACGCTGGG	16	19	yes
GATCCACCAAGGTAGAAAAC	13	10	yes
GATCCCAACAACTGCTGCAG	54	9	yes
GATCCACATAGTGCTGCTGC	11	11	yes
GATCCACATAGTAGACCTTG	12	12	yes
GATCCACACGGGCGAGAAGC	33	4	yes
GATCCACACAGGAGAGAAGC	90	1	yes
GATCTCAGAAGAGGCCACAT	5	6	yes
GATCTCACTGTTACTCTGGC	65	14	yes
GATCCAGGACACAGCGTGGT	20	1	yes
GATCTCACTGGACTTGGTGT	14	9	yes
GATCTCACTAACCTGCCACC	58	18	yes
GATCCAGCTGCAGAAGCCAG	44	13	yes
GATCTCACGGCCTGCGGGGT	23	27	yes
GATCCAGCTCTCTTAGACAG	5	4	yes
GATCTCACGGCCAGACAGAC	229	73	yes
GATCCAAGTTATTGGCACAC	36	25	yes
GATCCAAGTCATGATTTGAT	345	243	yes
GATCCAAGTAGAAGCTTCTA	8	6	yes
GATCTCACAGTTAGTAGTCA	82	16	yes
GATCTCAAGAACAAGAACCT	14	10	yes
GATCTCAAAGTGGCTGATGC	50	34	yes
GATCTCAAAGTCTGTTCAAA	14	16	yes
GATCTCAAAGGGAAACTGAC	15	10	yes
GATCCAACTGACTGGCTAGC	65	11	yes
GATCCAACTGACAGATGAGG	11	8	yes
GATCCAACTCTGTAAAGGCT	44	11	yes
GATCCAACTCACCCCATCAG	4	1	yes
GATCCAACGCAGCACCGTCT	90	18	yes
GATCCAACCCCCTCTCCTGA	5	6	yes
GATCGAGCCAAGAGCTGTAA	9	15	yes
GATCCAAAGACGCTAGATGT	6	5	yes
GATCCAAACGTCACAGAATT	87	6	yes
GATCCAGACCCTTCCCAGAA	91	0	yes
GATCTATGTCATGGCCACGC	423	59	yes
GATCTATGGAGGACGGCAGA	74	16	yes
GATCTTGGTGGTAGTAGCAA	24	3	yes
GATCTAGTATTCAGGGCGGA	99	1	yes
GATCTAGGTTTTGTTTTGTC	11	11	yes
GATCTAGCCTTATGCCCGGG	74	7	yes
GATCTACTTGTGTGTGTGTG	102	4	yes
GATCTACTTGCTACCAGTCT	24	7	yes
GATCCACTCCAGGGCTTGGA	9	2	yes
GATCTACTCCTTCAGAGCCT	61	3	yes
GATCTCCCCGAGTTCTGCAC	71	8	yes
GATCTACTACCAGACAGACA	26	3	yes
GATCGATGCAGCTCTCTTCT	4	7	yes
GATCTACGGTTCCCACGCAT	288	77	yes
GATCTACGGCCTGGACTTCT	39	5	yes
GATCTACCTGACCTTGTTGA	2	3	yes
GATCTACCTACCCGTGGTGT	3	6	yes
GATCTACAGGGCACAGAGGG	108	71	yes
GATCTACAGGACCCGCCCCT	7	8	yes
GATCTACACACTCCCTTTTT	4	4	yes
GATCCACCAGCGTGTGCATG	23	4	yes
GATCATTCTGAAGTACATTG	34	25	yes
GATCATTCCAAGTTTCACGT	18	5	yes
GATCTACAAAACACAGGGAG	17	11	yes
GATCCACACAATGGAGACCT	18	3	yes
GATCTAAACTGTGGTGTGAA	28	5	yes
GATCAGAGAAGCAGATATTT	341	120	yes
GATCCAATTGTGTGCTGTGC	5	2	yes
GATCGTTGGTGTTTCAAAGT	1	1	yes
GATCGTTGGATACTCACAGA	22	9	yes
GATCGTTCCAAAGCCGGAAG	6	10	yes
GATCGTGTGGAGTGAAAGGC	22	15	yes
GATCGTGTCCGGCATGAAGT	395	15	yes
GATCGTGTAGCAGGGTAAGG	31	12	yes
GATCCAAGGGGAGAGTCAAG	39	5	yes
GATCGTGGTGAGGAGGCTGG	4	3	yes
GATCCACCTACCTCTGCCTT	8	8	yes
GATCACATCACAGCCAGGTA	4	4	yes
GATCCAAGGCGGCGACCCGA	132	12	yes
GATCGTGGGAACCATTGTCA	9	9	yes
GATCGTGGCTAGTGAGATAG	15	4	yes
GATCCAAGGACTGCGGTGCA	189	9	yes
GATCGTGAGGCGGCTGGACC	1	1	yes
GATCGTGAGGATGGAGAAGG	37	30	yes
GATCGTGAAGCCGCTGAATC	50	10	yes
GATCCTCCTGCCTCCACCCC	5	6	yes
GATCATCCCCTGCACACAGT	57	9	yes
GATCGTCCCCCAGCCACCTG	58	1	yes
GATCCAACCATGACCAGGTG	61	8	yes
GATCGGTGTCGAGCACGGAC	45	19	yes
GATCGTGGTCATCCATGAGG	15	6	yes
GATCATCATGGCAGATTTGG	74	4	yes
GATCGTCATTCTCCAAAGAG	12	2	yes
GATCAAGCAGCAGCACGGGA	10	17	yes
GATCTGCTGCTGTTCTTTGG	151	5	yes
GATCAGTCTTTTCAGTATTT	138	21	yes
GATCAGTCTGAATTGAACAT	5	6	yes
GATCAGTCTATGAGTCAATA	178	9	yes
GATCAGTCCTACAAAGTTCC	57	7	yes
GATCAGTCCCTTCCCCCAAC	73	15	yes
GATCAGTCACCACTGGCACT	1156	363	yes
GATCGCTTTAGCTTGCCTAC	87	6	yes
GATCAATTACCCTTTCTGTT	8	9	yes
GATCAGTAGGAAGCACAGGT	17	29	yes
GATCAGTACTACTGTGGTGT	75	9	yes
GATCAGTAACAGCTCAGACA	6	10	yes
GATCAGGTTTGCACCAAGGT	67	9	yes
GATCAGGTGTTTGGATGGCA	24	2	yes
GATCAGGTGTCAGTTTTCTA	37	3	yes
GATCACAGTGACCCGCAGAC	19	3	yes
GATCTGCGATGAACTGGGAG	676	52	yes
GATCAGGTCAGAGATGCGGT	123	18	yes
GATCAGGTATTTTGAAAATG	34	3	yes
GATCAGGTAGAGAGAGCTTG	139	10	yes
GATCAGGGTCCTCCTTCCCT	4	4	yes
GATCAGGGGGAAGGGGTCAG	36	23	yes
GATCAGGGCGTGGTAGAGAA	79	19	yes
GATCAGGGCCGTGTGGATGC	312	27	yes
GATCAGGGCCGAGTGATGAG	170	11	yes
GATCAGGGCCCATTAGTGAG	25	4	yes
GATCAGGGCCAGGGGAGGTC	472	68	yes
GATCAGGGCCAAGGCATCCC	106	18	yes
GATCAGGGCAGAGATGGAAG	112	14	yes
GATCAGGGCAAGAGGATTGT	46	11	yes
GATCAGGGACCACGAACAGA	1262	329	yes
GATCAGGGAAGTTCATTGTG	201	203	yes
GATCGAGAAGTTCAGGCAGA	15	16	yes
GATCAGGCTGAGCTGAATGT	45	9	yes
GATCAGGCTACTACAAAGTT	2148	1383	yes
GATCAGGCGACAGTGAAGAT	4	7	yes
GATCAGGCCTGAACCCGTCC	137	52	yes
GATCAGGCCCACAGCCGAGT	46	7	yes
GATCAGGCCATCAAGTCACA	51	2	yes
GATCAGGCCATACGTAGCCT	18	18	yes
GATCAGGAGTTTAAGTGGTT	22	3	yes
GATCAGGAGGGTCAGCTGTG	173	0	yes
GATCAGGAGGCAGTGTGTGG	20	8	yes
GATCAGGAGGAGAAAGTGAG	19	14	yes
GATCAGGAGCTGGCATTGGC	272	67	yes
GATCTTTCTCAAGAGCAGTG	68	12	yes
GATCAGGACTTGGTGGAAGC	20	15	yes
GATCAGGACAGCAAAGACAG	102	103	yes
GATCAGGAATGTGTGCAGCA	30	52	yes
GATCAGGAAGATGGTAGCCT	18	31	yes
GATCAGGAAAGTTGTGGAAG	6	11	yes
GATCAGCGGTGGGAATGACA	5739	172	yes
GATCAGCGCTATTTCCTGAG	258	1	yes
GATCAGCGCCTCCAGTTCCT	13100	210	yes
GATCAGCGATTTATTAGTAG	18	3	yes
GATCAGCCTTTTCTGTCTTG	61	4	yes
GATCAGCCTTCAGTTCATTT	33	5	yes
GATCAGCCTGGGCCACCTTG	65	49	yes
GATCAGCCTGCTCCTGGGGC	37	37	yes
GATCAGCCTCCATCCGCTCA	352	20	yes
GATCAGCCGTTCCTCTGGTG	52	2	yes
GATCAGCCGCTCAAGATTCT	349	14	yes
GATCAGCCCTCCCCTGTGTC	43	0	yes
GATCAGCCCTAATCCTCTGG	1054	106	yes
GATCAGCCCGACTGTCTGCT	16	13	yes
GATCAGCCCATCGCAGCTTG	37	9	yes
GATCAGCCCAGCCCATGTGA	395	14	yes
GATCAGCCCACTCAGCCTAA	118	3	yes
GATCAGCCATTTCTTGGGGT	69	17	yes
GATCAGCCAGTGATACCACA	102	26	yes
GATCCACCCGTCACCGTAGC	11	1	yes
GATCAGCCACAAGATTTCAT	6	7	yes
GATCAGCCAAGGGTTCAGAG	32	28	yes
GATCAGCATGGTTGTTCTTC	123	1	yes
GATCAGCATGGGCACACAGC	5	5	yes
GATCAGCATGCCCTTCCATT	38	7	yes
GATCAGCATAGTTGTAGATT	19	0	yes
GATCAGCAGTGTCGGCCATT	180	17	yes
GATCAGCAGTGCCTTGTGTT	61	22	yes
GATCAGCAGGGATTATTCCA	1	1	yes
GATCAGCAGAGTGGTTATGG	138	29	yes
GATCAGCACTTGCCTGGAAA	20	4	yes
GATCAGCACTCTGCCTCCAA	108	0	yes
GATCAGCACTCAACCATTCT	2	0	yes
GATCAGCACTAAGACTGCTA	123	4	yes
GATCAGCACCTCTCCAAGAA	9	0	yes
GATCAGCACAGGGTCAACTA	60	7	yes
GATCAGCAAGTGACATTGAT	60	2	yes
GATCAGCAAGTCAGGAGTCA	29	50	yes
GATCTATGGGGCGCCACACC	25	29	yes
GATCTTGACAGCATAGACCA	1063	707	yes
GATCCGGCCAGTTATTGAGC	30	10	yes
GATCAGATTTGGTCTATCGG	36	13	yes
GATCAGATTTCACTGAATAC	20	20	yes
GATCAGATGTTTTGGGAAGT	36	6	yes
GATCTGTGCTACTGGCCCCC	19	13	yes
GATCAGAGTTCTTTTGTACC	51	2	yes
GATCAGAGTCGCCCTCCCAT	65	7	yes
GATCAGAGTCATAGGCTGGC	5	7	yes
GATCAGAGTATGTCTTGTGT	4	4	yes
GATCAGAGGTTCAGAATATC	95	8	yes
GATCAGAGGTTAGGACGTGA	152	29	yes
GATCGAGGAAAAAGTGCGGA	43	5	yes
GATCAGAGGCTCCCAACTGG	572	13	yes
GATCAGAGGATGCGGAGCTA	11	11	yes
GATCAGAGGAGACTTCCTCG	19	2	yes
GATCAGAGCCGAACCTACTT	2	2	yes
GATCAGAGCCAAGAAACGCC	182	11	yes
GATCAGAGAGAGAGAGTTTC	8	12	yes
GATCAGACTGGTGAGAAAGC	3	6	yes
GATCAGACCTGTGGCTGAGT	53	37	yes
GATCAGACCCAAAGAAAAGT	171	21	yes
GATCAGACACTGACTGGTGA	64	9	yes
GATCAGACACTCCCTCACCA	1	1	yes
GATCAGAATGTAAATGTGTG	62	27	yes
GATCTCGTCAGGGCACTGCG	11	11	yes
GATCAGCTCCTCTCGTCTGA	8	5	yes
GATCTCTCCCTCATATAACT	22	14	yes
GATCCGTGGGCGGGCGCCTA	14	9	yes
GATCCGTTACAGTAACATAA	74	7	yes
GATCCGTCGCCACTGGGGAG	9236	365	yes
GATCTTACCCTGAAAATGGC	1	1	yes
GATCCTTTCACACTGGCGAA	4	1	yes
GATCAGAGCGTGCAACGTGC	38	16	yes
GATCCTGAGGCTTCAGCAAC	7916	0	yes
GATCCCTTCCCCACCTAGCT	64	63	yes
GATCCCAAACTGGGTACAGA	5	0	yes
GATCTGCGGTGACTTGGTGT	66	47	yes
GATCACTTGGATACCCCTGC	3	2	yes
GATCCTGCTAGGGAAAGCCA	9	9	yes
GATCTGGCCATCCCAGGGGG	13	11	yes
GATCCCCAACAATGTCAAGA	50	11	yes
GATCCCCCTCCCCCCAGTGA	25	29	yes
GATCCACGCTCGCTCCACCC	30	10	yes
GATCGGCGCCTCCGGAGTAC	150	15	yes
GATCATTCTGGTTTCAGAAC	11	8	yes
GATCCTCTTGTCTCGGCAAA	1	1	yes
GATCTGGGCTATGAGCCACT	3	6	yes
GATCGCCATATGGACCACCT	32	32	yes
GATCCTTGAGAGGCAAGACG	15	11	yes
GATCACTCATTGTTCAGGTG	19	4	yes
GATCTGACGCCCTCTTCTGT	1589	329	yes
GATCGGGCTGCCTGGCGTGG	40	17	yes
GATCGGGAACAGAAAGGGCG	117	100	yes
GATCGGCGTGTGGGCCAGGC	86	25	yes
GATCCTGAGAAACCTTTGAC	6	3	yes
GATCGGCAACATGTTGAATC	12	12	yes
GATCGCTGTGGCCGAAACTT	53	8	yes
GATCGCTGGGGAGTCGGGTC	246	38	yes
GATCCAAACTAAAGGCAGAG	58	5	yes
GATCTTGAGGTTACGGAAAA	7	8	yes
GATCTTCAGTGGGTTTCTCG	22	6	yes
GATCGCTCTCATTGCCCTTT	31	5	yes
GATCGCTCACAAGGACTGAG	2	2	yes
GATCATTGGGGAACGGCAGC	56	1	yes
GATCGCTACCAAGCAGTTCT	45	9	yes
GATCGCGGACGGGCTGTGCC	118	44	yes
GATCCTCCCCGTATGATGAA	26	5	yes
GATCGCCTTCTCCACCAATT	181	6	yes
GATCCTCAGGGCCTGAGCCT	51	5	yes
GATCATGTTTGGCAAGCGGC	69	6	yes
GATCGCCTCCTCCCTCTCTT	56	5	yes
GATCTGTGATAAGGAGGATA	18	5	yes
GATCTGGTGCTGCGCGGATG	228	13	yes
GATCCCTTCCAGGTCAGCTC	2	0	yes
GATCGCCCTGTCCAACAAGC	1	1	yes
GATCGCCCTCTACATGGCCT	272	21	yes
GATCGCCATCGGCAGGACTG	52	7	yes
GATCATGAGCATGGTTTGGA	7	0	yes
GATCATCTTTCTGAGGGCTG	186	16	yes
GATCGCCACCTACCGCACCC	123	98	yes
GATCCTGGAGGCTTGTTGGC	21	14	yes
GATCCCGCCACCAGCTGTTT	7	7	yes
GATCGCATGAAGAAACCATG	321	13	yes
GATCGCAGTAGCCAGCGCAG	85	12	yes
GATCGCAGAGTCCGCCAACT	46	3	yes
GATCATCTCCTTCCTCACCA	25	1	yes
GATCATCGCCACTGCCCACA	6	6	yes
GATCATCCCCCTCACGATGG	5	5	yes
GATCGACGAGAACTGGTATG	151	37	yes
GATCACGGACGTGCAGCTCG	244	241	yes
GATCCTTTTCCACTCCCAGG	79	3	yes
GATCCTTTGCTCCTAGTGGA	15	6	yes
GATCCTTTCTACTATGATTG	313	41	yes
GATCCTTTCCATGCAAACTG	31	4	yes
GATCCTTTCATTTTCCAAGT	6	1	yes
GATCCTTGTTGTGCCTCTTC	104	11	yes
GATCCTTGTTCAATGCACGT	62	11	yes
GATCCTTGTCCACCCCTCCC	90	1	yes
GATCCTTGTAAGAGCCAACT	68	16	yes
GATCCTTGAGGTCACGTTGC	164	2	yes
GATCCTTCTTGTGGAACAAC	4	4	yes
GATCCTCCCGCACCAAGTAG	1	1	yes
GATCACCCTGCACCCCGTCA	10	11	yes
GATCCTTCCTGCGGGCGGTG	20	1	yes
GATCAGTTTGTCTGAAAAAA	25	24	yes
GATCAGTTTGCCTTCATTCA	32	18	yes
GATCCTTACCCTGTCCCTGT	20	8	yes
GATCAGTGTGTCTGTCTATG	2	3	yes
GATCCTGTTCCGAGCAAGCT	46	8	yes
GATCCTGTTAGTGAGCAGGG	48	4	yes
GATCAGTGCCTGGCGCCAGA	290	24	yes
GATCCTGTGTGGGAGGCTTC	11	1	yes
GATCCTGTGTGCGTTGATGA	56	4	yes
GATCCTGTGGGACCATCTAG	65	2	yes
GATCCTGTGGAAAGGATGCA	7	7	yes
GATCCAGTGTTGTTTTGATT	58	12	yes
GATCAAGTTCCTCCTTAGGG	11	1	yes
GATCAGTCAGCCGCTGCCCG	20	35	yes
GATCCTGTCTCAAGCACACC	1	1	yes
GATCCTGTCCCAGGGGCTAG	132	15	yes
GATCAGGTCTCTCCAACTCA	22	6	yes
GATCCTGTCACTGGGGAGGC	306	5	yes
GATCCTGTAAGAAGGTTCAG	8	8	yes
GATCCAGGGCATCACTCGGG	5	5	yes
GATCCTGGTTGGGGGCAAGG	227	19	yes
GATCCTGGTGTTTCCACATG	8	8	yes
GATCCTGGTGGTTCACCTCA	14	14	yes
GATCAGGCAGCAGAATCAGA	11	18	yes
GATCCTGGTGAATGAACCAT	32	4	yes
GATCCTGGTCCCCAGCACCT	59	2	yes
GATCCTGGTAGCTCACCAAG	51	23	yes
GATCCTGGTAATGCACTTTG	169	54	yes
GATCCTGGGTGCCTCTGATG	22	1	yes
GATCCTGGGTCCCTCGTAAG	117	26	yes
GATCCTGGGTACTAAGGTCA	593	396	yes
GATCCTGGGGACCCAGAATG	210	22	yes
GATCCTGGGCTTCTTGCTAG	8	8	yes
GATCCTGGGAGCGAGGAAAC	30	13	yes
GATCCTGGGAAGTTGGATTA	18	4	yes
GATCCTGGCGCTGGCTGTCC	32	3	yes
GATCCTGGCGCGGGTAGCCA	143	23	yes
GATCCTGGCAGTGGACCGCC	45	4	yes
GATCTGTGTGGCCAAGAGTA	19	13	yes
GATCCTGGCAACAGCTGTTT	6	4	yes
GATCCTGGAGTTTTCTACAG	5	5	yes
GATCAGCTCTGCCGTCTCTA	33	16	yes
GATCCTGGAGAGTCTTCTCT	2	2	yes
GATCCTGGAGACTAGAGGAT	5	8	yes
GATCCTGGACGAGGCCACCA	105	36	yes
GATCAGCGGAGGAAGTTGCA	21	0	yes
GATCCTGCTGCAGGCAGTGG	1015	115	yes
GATCCTGCTGACACGGTGCG	127	21	yes
GATCCTGCTCCGGCTCCTGC	69	6	yes
GATCCTGCTCCAGGAGATTG	53	4	yes
GATCCTGCTAAGCACTGAGG	149	8	yes
GATCCTGCGGGCTGAGGGCC	19	13	yes
GATCCTGCCCTGGGGTGAGG	91	12	yes
GATCCTGCAGGCTAGCCTAT	9	5	yes
GATCCTGCAGCGGTTCCTAC	18	1	yes
GATCGCCAAGTTCAAAGCTG	30	4	yes
GATCCATTCGCAACTTGGCT	142	4	yes
GATCCCAACAATGCAGCCAT	123	1	yes
GATCTCTCCCCAGGGAAGGA	22	23	yes
GATCAAGGTGGGAGGGAAGA	18	18	yes
GATCAGAAGTTCAATACAAT	50	5	yes
GATCAGAAGTTCAAGGTAAT	417	3	yes
GATCAGAAGTTCAAGGCCAG	54	11	yes
GATCAGAAGTGCCTCCTTGT	5	8	yes
GATCAGAAGTACCAGAAACA	2224	751	yes
GATCAGAAGGAGATACTCTG	138	65	yes
GATCAGAAGCTGTGTGCGTT	43	8	yes
GATCAGAAGCCACAGGCAGG	30	30	yes
GATCAGAACTGGGTGCCAGC	37	2	yes
GATCAGAACCCAGCCGAGTG	132	86	yes
GATCATAGAAGTCTACGGTG	4	1	yes
GATCTTGCTGCGATTCCGCC	3	2	yes
GATCAGAACATTTGTTCCAA	8965	315	yes
GATCAGAACAGGTGTCCCTT	7	8	yes
GATCAGAACAACAGACAGTG	97	26	yes
GATCAGAAACAACTGTGTCT	94	12	yes
GATCACTTTTGGTCAATATG	34	6	yes
GATCACTTTGTAGTCATGTA	63	4	yes
GATCACTTTGAGGAAGCCAT	93	94	yes
GATCACTTTCTAGGTTCCTA	82	14	yes
GATCAGGCTCTGGAAGGCGA	2	2	yes
GATCACTTTATTGCTGAACA	37	2	yes
GATCACTTGTTTGTGGTGAG	90	4	yes
GATCACTTGTCAGTGTTCAG	89	5	yes
GATCACTTGGCGGTGACTTT	81	4	yes
GATCACTTGAGTTCTGGTAG	4	3	yes
GATCACTTGAAAACTAATCT	2	2	yes
GATCACTTCGGCCTGTACAC	80	15	yes
GATCACTTCGCCCTTTTTTG	123	20	yes
GATCACTTCCGTGCCTCCCT	11	8	yes
GATCACTTCCCAGGGCCTGT	38	6	yes
GATCACTTAGTGGGGGGTTT	18	21	yes
GATCACTTACTGCCTAATGC	138	17	yes
GATCACTTAACTCTTGTGTA	7	7	yes
GATCACTGTGTTGGACACTC	179	18	yes
GATCACTGTGTACACATTGG	79	14	yes
GATCACTGTCCCCCTGGGAA	74	3	yes
GATCACTGTATGTTTGAGAG	40	7	yes
GATCGACCACATCCTGGATG	112	7	yes
GATCGAATTTCCCTGTGCCT	6	6	yes
GATCACTGGTGTTTCCCATT	4	4	yes
GATCACTGGTGTGTGCCAGT	14	0	yes
GATCACTGGTCTGTGACCTA	4	4	yes
GATCACTGGGTGTGTTTCAG	15	15	yes
GATCACTGGGGGCTCTTGTG	18	6	yes
GATCACTGGGAACAAACGGC	80	60	yes
GATCACTGGCTGAGTAGATG	145	31	yes
GATCACTGGCACCAAAGAAG	38	9	yes
GATCACTGGAAACGATTGCT	14	0	yes
GATCACTGCTCAAGCCTGGG	39	6	yes
GATCACTGCGTTAATCTTGG	7	8	yes
GATCACTGCGAAGTTTCGTT	58	5	yes
GATCACTGCCTTTCCCCCTC	103	2	yes
GATCACTGCAGGGGGTGCCA	246	22	yes
GATCACTGCAGGCGCAGCGG	653	55	yes
GATCACTGCAACCTTGTGCT	21	9	yes
GATCACTGATTCAGAGCTCA	14	16	yes
GATCACTGATGGCCAGAATG	68	18	yes
GATCACTGACCTTGGAGCTT	44	2	yes
GATCACTGAACCAAAGGGAT	7	7	yes
GATCACTGAAATTCAAAGAA	124	7	yes
GATCACTCTGGCCGCTCTTC	1129	74	yes
GATCACTCTGGCCAAGTAAG	32	10	yes
GATCACTCTGGAGTTCAGCG	6853	466	yes
GATCACTCTCTGCATCGCTG	3	5	yes
GATCACTCTCATACGATACG	19	5	yes
GATCACTCTACCCTCGAAGA	19	5	yes
GATCACTCGGAAATTCAGGC	40	0	yes
GATCACTCCTTTTGAGGAAA	163	10	yes
GATCACTCCGTGCACCTGCT	2	0	yes
GATCACTCCCTGCCTGAGCC	204	8	yes
GATCACTCCAAGTTGACATT	61	8	yes
GATCACTCAGCAGCCAGGAC	164	108	yes
GATCACTATGTCCAGGCTTC	27	8	yes
GATCACTAGTGACTGTTGGG	112	24	yes
GATCACTAGCTTCGAGGAGG	404	5	yes
GATCACTACAAACCAAAGCA	10	2	yes
GATCACTAACATTCCCCGTA	2	2	yes
GATCACTAACAGTTTGCATA	55	7	yes
GATCACTAAAGTTCCATCTG	8	8	yes
GATCACGGTTTTCTCTGTAA	259	2	yes
GATCACGGTTCAGATTCGTT	17	7	yes
GATCACGGTGAACCCCCAGT	169	10	yes
GATCACGGTCCCGTGACCGC	57	1	yes
GATCACGGGAGAAGTACAAG	5	5	yes
GATCACGGCAGTGGATTGGG	73	10	yes
GATCACGCGTCCAGATGTGC	15	4	yes
GATCACCTTTGTCTGATAGC	46	4	yes
GATCACCTTGCTGGCATCAG	180	16	yes
GATCACCTTCCTGTCTCATC	14	2	yes
GATCACCTGTTTCGCTGTGG	1038	19	yes
GATCACCTGGGATTTCTCAG	32	1	yes
GATCACCTGGGACTCTAAGC	161	23	yes
GATCACCTGCTCTTTTCCTC	8	8	yes
GATCACCTCTTAGGGATGGT	100	21	yes
GATCACCTCTGCCAGCTCTC	116	12	yes
GATCACCTCTCATCCATGTG	2	0	yes
GATCACCTCATTCCTCGACT	4	1	yes
GATCACCTCAACGTGGGTGT	77	17	yes
GATCACCTCAAACTAATTTG	69	3	yes
GATCACCTAGGAGAGCCACT	11	11	yes
GATCTGTGTGGCGAAGAGCA	2	2	yes
GATCCGAGAAAACATGGCCA	140	103	yes
GATCTGCCTGCCTCTACTGT	5	5	yes
GATCACCTAACTGAGCCAAA	44	1	yes
GATCACCGTTTCAAGGCCCA	113	13	yes
GATCACCGTGTTTTCGTGGT	14	5	yes
GATCACCGTCTCCAGGCTTG	39	1	yes
GATCACCGCTCACCTTTCCA	98	9	yes
GATCACCGAGGAGGGAGACA	37	8	yes
GATCACCGACCGCATCGAGA	3625	129	yes
GATCACCCTCAGGTGCAGGT	123	46	yes
GATCACCCCTCTGCCTTTGT	38	10	yes
GATCACCCCCTTCCCTCTGT	87	1	yes
GATCACCCCCAATTGTATGG	2850	52	yes
GATCACCCCACAGTGAGGCG	268	23	yes
GATCACCCATCATTCTGAGG	257	3	yes
GATCACCCAGAAGTGGCTCT	658	13	yes
GATCACCATTTCCGACTGTG	5792	22	yes
GATCACCATTCCGGTTACTT	117	5	yes
GATCACCATCTAGTGAGTCG	108	7	yes
GATCACCAGTGGGAAAGCAG	22	6	yes
GATCACCAGGGGCTGATGGG	92	20	yes
GATCACCAGCCTGAAGCTGA	22	4	yes
GATCACCAGCAAACAGCTTT	390	16	yes
GATCACCACCCCTGTTAAGC	147	18	yes
GATCACCACCAGGACGCTGA	69	3	yes
GATCACCAAGGTTGATGCAC	10084	23	yes
GATCGTCCTTGCTGTAGAAA	33	4	yes
GATCACCAACAGTGCTTGCT	87	8	yes
GATCACCAAAGGTACAGTTA	30	8	yes
GATCACATTTTTTTTCTCTG	4	4	yes
GATCTGGGGCAGGGTGTCTG	10	7	yes
GATCACATTTGCTTTGTGTT	174	41	yes
GATCACATTCTGGGCTTCCA	4	1	yes
GATCACATGTAGTGGGGAGG	48	8	yes
GATCACGTGAGCCCAAGAGT	22	18	yes
GATCACATGAGGGCAGTACA	26	7	yes
GATCACATGAAGTTTGATTT	11	8	yes
GATCACATCTTTTTTCTATT	19	9	yes
GATCACATCTTGGAAATATC	18	4	yes
GATCACATCTATGAGAAGTT	13	1	yes
GATCACATCCAAAAAGTCAT	48	2	yes
GATCGCTTGTTGGCAATCGG	23	16	yes
GATCACATCAAAGGATGATG	85	13	yes
GATCACATACGCAGGAGTGG	21	2	yes
GATCACATACCTCTTCATAA	53	5	yes
GATCACAGTTCCAGGAACAG	86	12	yes
GATCTTTCCAAGAGTCCAGA	7	11	yes
GATCTGGCTGCGGAGGAGGC	12	10	yes
GATCACAGTGCGTGCCTGGC	83	29	yes
GATCACAGTCCTTCCTCTGG	83	1	yes
GATCTTGATTTGACAGTTTT	22	6	yes
GATCACAGTATTGTCTCAGA	71	1	yes
GATCACAGGTGTGCATACCA	4	4	yes
GATCACAGGGATGCGGCGTC	95	13	yes
GATCACAGGCAGTCCAGGGG	47	32	yes
GATCACAGGACTCTTTCCCT	41	8	yes
GATCACAGCTTAGAGAATGT	8	8	yes
GATCACAGCTCAGTTCCTAT	97	18	yes
GATCACAGCGTTCGTGCCCA	160	9	yes
GATCACAGCGGAGTTAGCTT	7	0	yes
GATCGACATCAACGGGGATG	24	0	yes
GATCGAAGCTGGTACCTGTG	83	1	yes
GATCGCTAGAGAGCAATGTG	20	1	yes
GATCCTCAGAAGGGAAACGT	5	6	yes
GATCTGGCACCCCGCAAATG	28	10	yes
GATCTGGAAGTGTGGGAACG	214	9	yes
GATCTGCCCCCATAGAATAA	2	4	yes
GATCCCGTTGAAACTGCTGC	137	4	yes
GATCTCAACTCGGGTCTTCA	22	3	yes
GATCCACGTTGAGGTGCATG	76	16	yes
GATCCAAGCCCGGAAAGGCA	83	20	yes
GATCCCCTTCTACCTACTCC	807	1	yes
GATCCTGTGTCACAGCTGCC	2	2	yes
GATCCTGTGATGACAATAAA	15	10	yes
GATCTCTGCACAATGTGAAC	30	1	yes
GATCCATCTGTGTAGTTTCT	94	14	yes
GATCCTGCCAAGAGGAGCAA	446	321	yes
GATCCTGGGCAAGGACCACA	2	2	yes
GATCGTTTGTGGCCACCAAT	31	13	yes
GATCCAGTCTCATCTCAGCT	67	4	yes
GATCCTACCTGCCGGCCCCT	40	10	yes
GATCCAGTTTTGTTTGGACC	122	7	yes
GATCCACCAGCTGAGAATTT	206	110	yes
GATCCAGTGTTGGAATTCTT	3	2	yes
GATCCTGCAACCCATTTCCA	30	4	yes
GATCCTGATTGCCTGCCCCG	25	3	yes
GATCCTGATGCAAGGCTGGC	50	36	yes
GATCCTGAGTGAGTGTGAGG	46	9	yes
GATCCTGAGGCCTGTGAGAA	34	33	yes
GATCCTGAGGAGGGGTTTGA	51	1	yes
GATCCTGAGGACAGGAGAGG	368	38	yes
GATCCTGAGCCACAGAGCTG	165	7	yes
GATCCTGAGATGGCTCTGAG	4	4	yes
GATCCTGAGAGTGTCACTGT	6	3	yes
GATCCTGAGAAAATCAGGGC	131	4	yes
GATCCTGACTTCTAGCTGTG	77	5	yes
GATCCTGACCGAGCGTGGCT	90	20	yes
GATCGTTTCCCTTGCATGCC	178	39	yes
GATCCTGACCATCACTATAC	6	3	yes
GATCCTGACCAGGGGGAGTC	193	4	yes
GATCCTGAATTGCTGGAGAG	11	1	yes
GATCCTGAAGTCTGCAGACC	204	88	yes
GATCCCGGGGCTGTAACTGT	82	6	yes
GATCCTGAAGATGTGGACAC	15	4	yes
GATCCTGAACCCACCCCCGT	28	3	yes
GATCCTGAAACGACAGTGGT	22	1	yes
GATCCTCTTGTCTGCTTCGC	667	80	yes
GATCCAGGACCTGGTAGCAA	382	8	yes
GATCCAGGAAGTTGGTGAAC	96	21	yes
GATCCTCTTCTCCGCGTGCC	115	37	yes
GATCCTCTTCCACGAGACAC	1779	16	yes
GATCCTCTGGCACGCCTGGC	104	11	yes
GATCCTGGATTCCCATCTCC	50	1	yes
GATCATGCATGAGTTTGTTG	8	6	yes
GATCCTCTGGAACTGGAATT	1	1	yes
GATCACTGTGGCCCCACCAA	29	23	yes
GATCCTCGGGGTGCCAGCCA	136	17	yes
GATCACTGCGGACATGCTGG	20	13	yes
GATCCTCCTGGCTCCTGATT	33	22	yes
GATCCTTCCTAGAGTCACTC	3	2	yes
GATCCAGCAGCGCAGGCAGG	63	2	yes
GATCACGTTCTGCTTGGAAG	130	10	yes
GATCCTCCTGCCCGTGGGGG	90	31	yes
GATCCTCCTCCAAGTCTGAC	6	2	yes
GATCCTCCCTCAGGACTACG	11	8	yes
GATCCTCCCGTATGCCAACC	47	15	yes
GATCCTCCCCTGGCCTCAGT	64	13	yes
GATCACCTGTGTAGCTCTGC	5	5	yes
GATCCTCCCCGCTCGCTCAC	279	20	yes
GATCCTCCCCCTCTGTCTTT	89	19	yes
GATCCTCCCAGACCCTCTGA	6	6	yes
GATCAAACTGTGCAAATAGT	228	17	yes
GATCACCCGACGCAAGTGGG	55	10	yes
GATCATCCCTGTGGCAAAAG	25	3	yes
GATCCTCCACTCTTCTGGAA	19	9	yes
GATCCTCAGGAGTCAGTATT	26	3	yes
GATCCTCAGCCTCCCAGAGC	125	4	yes
GATCCTCACTTTTCAGTGCG	27	1	yes
GATCCTCACTGACAGATGGG	47	7	yes
GATCACAGTTCCTTATTGTG	26	26	yes
GATCCTGCCCTTCACCTCGG	64	5	yes
GATCATGATTTGGAGAGAGG	69	5	yes
GATCTGGTGCTGAGGCTGCA	43	29	yes
GATCCTATCTCGCCCAGTGA	60	10	yes
GATCCTAGTGCAGGAGGGGG	2	1	yes
GATCCTAGTCCTTGCCCCGT	301	53	yes
GATCACACTTACCAGTCAGC	409	24	yes
GATCCTAGTCATTATCTCCT	23	15	yes
GATCCTAGCAGCGGCGGTGG	170	7	yes
GATCCTAGAGCACTTGAGGA	33	12	yes
GATCCTAGAGAGTTCTCTTT	143	13	yes
GATCCTAGAGACAGGCCATC	45	11	yes
GATCCTAGACTCTCCTTGTT	142	24	yes
GATCCTAGAATAGCGTCTCA	11	1	yes
GATCCTACTCGAACAGGAAG	23	5	yes
GATCCTACTATTAGTCCACA	84	9	yes
GATCCTACGCAGGGGGGACT	86	12	yes
GATCCTACCAGCTACCACAG	17	11	yes
GATCCTACAGTCTGGAATCC	51	2	yes
GATCCTACAGACACAGTAGC	13	2	yes
GATCAATTGGAACCGGCTTT	21	31	yes
GATCCTAAGGAAGACAAGGC	13	1	yes
GATCCTAAGCAAAGGGACTC	125	23	yes
GATCCTAACTTGGAAACTGT	13	4	yes
GATCCTAACCACCCAGCCAT	73	16	yes
GATCCTAAATGTGTGGAAGA	30	2	yes
GATCATGTGTGTAGCCAGAA	43	2	yes
GATCCTAAAGACTCCCCAGG	28	19	yes
GATCCGTTTCTCTCTGCCTT	6	4	yes
GATCCGTGTGAGGTGTGCTG	108	58	yes
GATCAAGTCTTGTCATAGCT	2	3	yes
GATCCGTGTCATTCACACAC	8	4	yes
GATCAAGTCTCGCAGCATGT	24	2	yes
GATCCGTGCCCTGTAAAGTG	57	6	yes
GATCCGTCGGTGCCTGCTGG	374	42	yes
GATCCGTCGCCACTGAGGAG	124	22	yes
GATCCGTCCATGTCTGCCAC	13	10	yes
GATCCGGTCAGCGAAAACCT	28	7	yes
GATCGCACCGTGAGCCCTGC	4	7	yes
GATCCGGGCTGCACATCAGC	5	2	yes
GATCCGGGATGTCGAAGAAC	15	4	yes
GATCCGGCTTCCCAAGAGTA	25	9	yes
GATCAACCTGGAGTTGTATG	4	3	yes
GATCCGGGCCGCGAACGAAA	2	2	yes
GATCTGCTTATTAGTTATGT	14	5	yes
GATCCGCTGGGAGCTCACAC	37	6	yes
GATCAACAAAATTCTGGTTG	98	13	yes
GATCCGCGTGAAACTGGATG	27	30	yes
GATCCGCGTCTACAGCATGA	15	18	yes
GATCCGCGGGGCTCAGTGTG	289	62	yes
GATCCGCGGGCGTAAACGCT	73	49	yes
GATCCGCGAGTACACGGCAG	51	37	yes
GATCCGCGAGTACACGGACA	15	10	yes
GATCAAATTCCCACTCCCCC	631	204	yes
GATCCGCCTCTTCCTGGTCA	152	10	yes
GATCCGCCTCTCACCAGCCA	45	9	yes
GATCCGCCGTTCTCTGGAAC	12	4	yes
GATCCGCAGTGTCTTGGATG	157	27	yes
GATCCGCAGGCGCAAGGCCC	8881	41	yes
GATCCGCAGCCGCCTAACTG	333	11	yes
GATCCCCGCGCAGAAGTAGG	1	1	yes
GATCTTCCAGAGCCTCAGTG	16	13	yes
GATCCCTCCTGTGTAATGTA	19	33	yes
GATCAAACCTAGGGCTTCCT	11	7	yes
GATCCAGGGGTCAAGACGGG	2	2	yes
GATCTGTCACGATTCTGTGT	262	22	yes
GATCTGGTGTCTGGAATCCT	2	2	yes
GATCTGGGCTTCCTGGGTGA	95	8	yes
GATCTGGCACTCGGAGCCCA	4	7	yes
GATCTCCTGCGTCCTTTTGC	45	8	yes
GATCCTGGCGAAGGGAGAGT	2	2	yes
GATCTGGAGAAGCTGCCTGT	3	2	yes
GATCTGGACAGCAAACTCGT	126	27	yes
GATCCTTCTGTCTCAGCCTT	10	2	yes
GATCTGCTCCCCGCATCCTT	2	2	yes
GATCAGACAGAGGTCAGAGG	116	24	yes
GATCTCCAGGGAGACTCCAT	5	5	yes
GATCATTCACTGTGACACCC	12	9	yes
GATCTACAATCATGCTTGAC	20	4	yes
GATCTGCCGGCCAAGAAGAA	20	23	yes
GATCGCCCCGACTTCCTGAC	32	8	yes
GATCGAGAGCGTGGATGACT	9	10	yes
GATCTGTTTCTGGGAGGCGA	2	3	yes
GATCTGCATGCCCTGGGTCC	40	28	yes
GATCCTTGAACGTCTAGATT	83	16	yes
GATCCTGTCCCACAAAGGAA	28	10	yes
GATCCTGGCCACTGTTTTTG	1	1	yes
GATCCTGACACCTACACTCA	2	2	yes
GATCCTGCTGCCCAGGCTGA	25	1	yes
GATCTCTCTGAGTTTAAGGC	28	2	yes
GATCTCAGAGTGCCTCTGAA	22	14	yes
GATCATGTTCAAGAAATTTG	79	7	yes
GATCCTGATGCTGCCAAAGC	131	26	yes
GATCTTGAGCACCTTCCCGC	23	15	yes
GATCTGAGGGTGTCGTGGGC	9	6	yes
GATCCCGAAGTCTGTGACGC	13	11	yes
GATCCCGAACTGTTCAAACA	4	4	yes
GATCCCATCCACCATTCTGC	23	8	yes
GATCCCAGCCATCTCAGCCC	8	1	yes
GATCCCAAGGATGTGCAAGA	2	3	yes
GATCCCAACGAACCCACATA	56	1	yes
GATCCATTTTTCCCTCTCTG	4	4	yes
GATCCAGAGTGGAGAGTGTT	25	3	yes
GATCCACAGCCCGTTTTGTA	46	5	yes
GATCGGCCGGAGCCCTTCCC	17	11	yes
GATCCACGCCGCTCACGTAA	191	31	yes
GATCCAAGTTCAATTCCCAG	33	16	yes
GATCTGAAGATAGCATGCAG	11	11	yes
GATCCAAGCACTGACACTGG	8	1	yes
GATCCAAATCAATTCATATG	12	0	yes
GATCCAAAGCTGAAGTCAGG	5	0	yes
GATCATATCCACCCTCCCAC	6	5	yes
GATCATAGGCAAACGTGGCA	377	3	yes
GATCCTGGGTACTAAGGTCG	405	380	yes
GATCTCATTTCAGAAGAACG	32	8	yes
GATCCATGTGCGTTAATAGA	36	1	yes
GATCCTGTCCCATTGTGTGT	1	1	yes
GATCCAGAGTTTTCGGAAGG	17	16	yes
GATCTAAATCTCTGGCGTTG	22	9	yes
GATCCACTCCAAGTCGCACA	2	2	yes
GATCACTACAACCATGTTAG	66	5	yes
GATCCACTCCCTGTACCGCC	193	22	yes
GATCCCAAGTACTGCCTGAA	783	51	yes
GATCCCAGCGGAGTGGAACA	12	5	yes
GATCTTGTCCCAGAGTGCTT	19	14	yes
GATCAAGAAAGAGATGGGAG	203	33	yes
GATCCAGTTTCATACAAACA	123	1	yes
GATCGAGGAACGGGCGAAAC	19	13	yes
GATCAGTGGTTCTCATCCTT	1	1	yes
GATCTCCGTGGAAGCCTCTG	26	9	yes
GATCTACAAGTTACACGTTG	2	2	yes
GATCCACACGTGTGTGAACA	134	2	yes
GATCCTTGGGTGGTCTTGAT	12	2	yes
GATCCCTCCAATCCGGAAGT	41	8	yes
GATCGACGTACACGTCTTAG	22	1	yes
GATCCGCTCTTACATCAGCC	6	4	yes
GATCTCAGGCTGAGCAAAAT	111	72	yes
GATCCGCACCAAGGTCATGG	20	4	yes
GATCCAGGAACGAGGCTGGG	23	18	yes
GATCCAGCTGATGGAGGAAA	6	1	yes
GATCCGCAAGCTCCCCTTTC	2	3	yes
GATCCGCAAATACGGGCTGA	102	6	yes
GATCCGAGGCACCAGCTACC	125	18	yes
GATCCGAGCCCCAGCGGGAA	142	2	yes
GATCCGAGCAATTGGCAAGA	2	2	yes
GATCCGAGATATACGCAGGA	379	47	yes
GATCCGAGAGCCACGGCAGT	8	9	yes
GATCCGAGAGACCAGCCAGA	770	75	yes
GATCCGAGACCTGGCAGAGC	317	120	yes
GATCCGAGAATTCCAGGACT	7	5	yes
GATCCGAGAATATGAAGATA	9	6	yes
GATCCGACTGTGCCCGGATG	10	2	yes
GATCTCTCTGAGGGGCTGAT	4	4	yes
GATCCGACGCACCAGCATCG	2	3	yes
GATCCAGCCCTTGCCTAGAG	5	2	yes
GATCAGTACCTGGGAAGTAC	10	11	yes
GATCCAGCAGTTTGATGATG	4	1	yes
GATCCAGCACTCTCTTTAGC	2	2	yes
GATCAAGCATTTGCGCCTGA	142	95	yes
GATCCGAAGGGCGGCCGCTG	4	6	yes
GATCCGAAGAAACTGGCTGC	5	6	yes
GATCTTGTATCAACTCTGGG	8	8	yes
GATCCCTTCTGGTGCACACT	68	10	yes
GATCCCTTCTGGGACTCCCC	26	26	yes
GATCCCTTCTAAGTGCCAGT	25	3	yes
GATCCCTTCCCTTCCTTGTG	58	7	yes
GATCCCTTCCCTGATGTTGG	15	2	yes
GATCCCTTATCGAAGTGTCT	11	11	yes
GATCCCTGTTGCAGGGATTA	48	32	yes
GATCTTTGGTGGATTGTGTC	68	44	yes
GATCCCTGTGGACAACAAGG	43	13	yes
GATCCCTGGTGCTGCAGTGG	34	22	yes
GATCCCTGGGCCCCCGGGTC	244	69	yes
GATCCACATGTCACGGAGGT	2	3	yes
GATCCACACCACTGGACCCA	2	2	yes
GATCCCTGCTTTTCAGAGGC	46	9	yes
GATCCCTGCTTCCAGCTTCG	108	5	yes
GATCCCTGCTGGGTACTTGA	45	12	yes
GATCCCTGCTCTGGCCCACT	48	33	yes
GATCCCTGCGCCCTCTGCAG	45	4	yes
GATCCCTGATGCAAGCTGGC	101	7	yes
GATCCCTCTTGGGCCGAGTA	61	16	yes
GATCCCTCTCCACAGGGTCT	40	7	yes
GATCCCTCTCACAGGCTTCG	118	13	yes
GATCCCTCAACACTGAGTCC	402	31	yes
GATCCCTACTCCAAGGTGAA	17	2	yes
GATCCCTAACCCTGGGCTGG	113	20	yes
GATCCCGTGTATGTTATGAC	28	2	yes
GATCCATCTGCCCATGTCAG	78	6	yes
GATCCAGCTCAGATAGACTG	40	15	yes
GATCCAAAGAAGGCTCTTCA	1	1	yes
GATCCCGTCCAGGCAACTGC	32	12	yes
GATCCCGGTGTATCATGGCA	61	7	yes
GATCCCGGTGGTGACCGTGA	6	5	yes
GATCCCGGGTACTGCACAGT	5	8	yes
GATCCCGGGACGGCAACTTT	2	3	yes
GATCCCGGCAAGAAGAGCAC	34	39	yes
GATCCCGCCAATTACAGAGA	19	19	yes
GATCCCGCAGTGGCAAGGTC	84	35	yes
GATCCCGAGCAGACACTGCA	5	3	yes
GATCCCGACACGGACTCTGA	53	10	yes
GATCCCGAATTTTCCTAAGG	24	7	yes
GATCCCCTTACAGCTGGCAT	43	9	yes
GATCCCCTCTTGGCTTGCTT	25	3	yes
GATCCCCTCCCCTGGTGAAC	60	10	yes
GATCCACCCTCTTCTGCTGG	14	3	yes
GATCCCCTCCCATAGGTAGC	147	22	yes
GATCCCCGTTTTCTCTGCAG	1	1	yes
GATCCCCGGTGGTCCTCGAC	39	9	yes
GATCCCCGGCAAAACCACAT	12665	847	yes
GATCCCCCTTTTCAGCCCTG	4	4	yes
GATCCCCCTTACAAACACCA	2	2	yes
GATCCCCCTCTGGGAGAGCC	71	29	yes
GATCCCCCTAAATCCAGGAA	5	5	yes
GATCCCCCCTCTGGAAGGCG	86	12	yes
GATCCCCCCTCACTGACTGA	7	2	yes
GATCCCCCCATTGGAGATGT	38	3	yes
GATCCCCCCAGATGCCGTTG	2	2	yes
GATCCCCATTGCTCCCCAGT	51	10	yes
GATCCCCATCTCCATCAACA	495	7	yes
GATCCCCAGGGCCTCAATGA	45	1	yes
GATCCCCAGCCACAGAATGG	240	16	yes
GATCCCCAGAGGCTACCACC	27	6	yes
GATCCCCAGAAAGGTGGTCG	882	2	yes
GATCCACAGCTCTCAGAGCC	85	9	yes
GATCACACTGCCCAGAGGAA	5	0	yes
GATCCCCAAGACCAAGTTCT	4	1	yes
GATCCCATGTACCCAGGAAT	2	0	yes
GATCCCATCTTTGCCAGTGG	7	0	yes
GATCCCATCCCCTTGCCACA	91	12	yes
GATCCCATCCAGCCCTCCAG	108	7	yes
GATCCCATCATGCCCTGAGC	191	110	yes
GATCCCATAGCAAGAGAGGG	66	21	yes
GATCTCATTCCACGACCCAG	20	20	yes
GATCTCAAAGTAACACTGTG	6	7	yes
GATCATAGACTCCAGGGCTG	17	5	yes
GATCCCAGGGCTGACCATCA	121	13	yes
GATCCCAGCATGGTCAGCGC	113	74	yes
GATCCCAGCAGCAGCATCGT	38	0	yes
GATCCCAGAGAGTGGCGTTG	32	12	yes
GATCCCAGAAGGTCGATGTA	1	1	yes
GATCTACAGCCAGCGCGGAG	240	6	yes
GATCAGTCACTCACAGAGGC	325	44	yes
GATCCCACTGGTTAGGAATA	54	8	yes
GATCCCACCCTCACCCCACC	63	19	yes
GATCCCACCATCCCACTGGA	29	22	yes
GATCCCACATTACCTCTGCC	22	15	yes
GATCCCACAGGTCTTTCATG	9	7	yes
GATCCCAAGGGCCTCGAATG	44	18	yes
GATCCCAAGGCCTATGTCTG	885	111	yes
GATCCCAAGCTCATCATATG	20	10	yes
GATCCCAACCTTGGCCCTGA	9	6	yes
GATCCCAACCCTGAGAACTT	5	5	yes
GATCCCAACACAGCCTATGC	17	3	yes
GATCCCAAAGCCTCTGTTGC	2	2	yes
GATCCCAAAGCACAATCTCC	40	7	yes
GATCCCAAACAGGCGCACGA	61	7	yes
GATCTAAAGAAAAGGCTGGA	17	13	yes
GATCAGCCTGGGTGACAGGG	8	10	yes
GATCCAAGACAAGCAACAGA	117	14	yes
GATCCATTGGTGGAGTATTC	99	3	yes
GATCCATTGCCTGGACTGAG	32	2	yes
GATCCATGTGCTGTCTCCCA	2	3	yes
GATCCATGTAGCTACTTGCA	2	4	yes
GATCCATGTAACTGTTCCAG	23	6	yes
GATCAAGAAGGCTGAGATGG	5	7	yes
GATCCATGCTGTGCGCTACC	240	17	yes
GATCCATGCCAACCACCAGG	46	4	yes
GATCCATCTCTTCCGGACAT	6	0	yes
GATCCATCTCTCTGCCTTAT	2	2	yes
GATCCATCTCCCAGACTTAT	28	7	yes
GATCCATCCTAGGGTCTGTG	195	24	yes
GATCCATCCCCAGTGCCCCT	28	7	yes
GATCTGGGTCTCAAACAGGA	6	7	yes
GATCCATCCCACTTTGTCTT	13	3	yes
GATCCAGTTTTGACAGTGAC	310	15	yes
GATCCAGTTCCTCACCTTCA	70	2	yes
GATCCAGTTCACAGTTGTTG	2	2	yes
GATCCAGTTATTCAGTGGTT	67	8	yes
GATCCAGTGTCCTGAGCAAG	7	2	yes
GATCCAGTGTATTTGGTGAA	19	5	yes
GATCCAGTGCTTCAATGATG	11	11	yes
GATCCAGGTGCTGTGGACTT	66	17	yes
GATCCAGGTGAAGAACGAGG	1140	9	yes
GATCCAGGTCGGTCACCAGG	99	12	yes
GATCCAGGTAGGATTCACTC	6	4	yes
GATCCAGGGTCCTGCATCGG	36	29	yes
GATCACTTATCCAAGTATCT	6	4	yes
GATCTCTACGGCCCTGCCAG	30	14	yes
GATCAGCAAGCAGGAGTACA	602	530	yes
GATCCTGGAAATGAGATGGG	80	10	yes
GATCTGTGCAGCCTTGAAAA	23	2	yes
GATCCACGAGCCCAAGGGCT	9	9	yes
GATCTTCAAGTGAACAAGTC	199	151	yes
GATCCTGCACTGACTCTGGA	14	2	yes
GATCATGAAGTGTTTGGAAT	2	2	yes
GATCTCTTCTTTTTTACTGC	15	18	yes
GATCTGATGTTGGTCCACTA	28	4	yes
GATCTGCCGGCTTCTGCCAC	6	6	yes
GATCCTGTAGGTCAGATGGT	38	10	yes
GATCTCTGTGAGTTTAAGAC	65	42	yes
GATCTCTCCCTGTTAGGCTT	39	12	yes
GATCAGCAGGGGAATGAGGA	35	0	yes
GATCAGACAGGGTGGTGGTT	88	22	yes
GATCCTGGCCTCCATCCTAA	2	2	yes
GATCTCGTCAGTCCTGTGTT	6	1	yes
GATCACCTTTACCAGTGTGA	11	11	yes
GATCACCTTGAAGGAACAGC	9	10	yes
GATCACAGAATGGACAGGAA	30	2	yes
GATCCTCCTTTGAAAAAGTC	1	1	yes
GATCAAAGCGTGGAGGAGAG	25	20	yes
GATCAAAGAGTTGGAGACCA	39	2	yes
GATCTTTTAGGATGTTTGGG	38	4	yes
GATCTTTGGTTTCGTGGCCA	145	0	yes
GATCTTTGACAACCCTGTGG	37	1	yes
GATCTTTACTTCTACATAGA	286	95	yes
GATCTTGTTTTGAACTCAGA	6	6	yes
GATCTCTGCATGCTTCCATC	10	7	yes
GATCCTCAGTCAAGGTACAG	85	18	yes
GATCTGTGGCTGGGACAAGA	241	67	yes
GATCTGTGCTCCTGATGTCT	2	2	yes
GATCTTGGATGAGCCCGTGG	132	87	yes
GATCTTCCCCGAGGGTCGGC	74	63	yes
GATCTTCAGATGCAATGGTT	98	65	yes
GATCCTGCATCTGAAGGTTC	24	3	yes
GATCCATCTTGTGTCCCTCT	4	1	yes
GATCTCAGAGATGCGCCAGA	42	27	yes
GATCTGTTTGGCCAGGCAGC	83	10	yes
GATCTGTGGGACAGAGGAAG	6	4	yes
GATCTGTGACAAGAACCTGG	494	101	yes
GATCACATCTGTGTCACTGC	26	5	yes
GATCCGCCCTTGTGCCCACT	108	28	yes
GATCCCCACGGCTGGTCTGA	14	10	yes
GATCTGGTGCCCTGCTGCTT	38	3	yes
GATCTGGTACATGGATGACA	167	6	yes
GATCTGGGGTAGATTCTGAT	256	124	yes
GATCTGGGCCTCTTTCCACG	115	12	yes
GATCTGGGATTGGCTCAAGA	172	114	yes
GATCTGGCAAGGCCCCTTCA	6	6	yes
GATCTGGAGGAAGCCTGAGG	65	9	yes
GATCTGGACTGAGTGGAGCC	27	1	yes
GATCTGGACCCGAGCGGTCA	33	33	yes
GATCCAGTTCTAAGCAGATT	1527	45	yes
GATCTCACAGCCAGTTCTTT	2	4	yes
GATCTGCTGACTACAGCACG	52	4	yes
GATCTGCCTCATTCAAGATT	22	6	yes
GATCTGATGTGTTGAAGTTG	67	16	yes
GATCTGATGCCCTTTTTTGG	50	49	yes
GATCCAGGCCAAGTACCTGA	53	64	yes
GATCACAAAGTTTGAGAATT	112	78	yes
GATCGGTCTGCAGAAGAGAC	2	4	yes
GATCTGAGACTTCTCCTGCT	146	96	yes
GATCTCTGTCTTTCAGTGAC	134	12	yes
GATCGTGAAAGGGAACGGGA	52	19	yes
GATCCAAACATGAAAGCTGG	81	17	yes
GATCTGCTCCTGAAAAAAAA	44	8	yes
GATCAGCCACTGTTCAAGGA	15	5	yes
GATCTTTGCAGCCTAGGCTG	6	7	yes
GATCCGAGGGCCCAGGGGAC	44	31	yes
GATCCCTTGGAACCCCGAAC	6	8	yes
GATCCAGCTGCTCACGCTGA	70	15	yes
GATCCCACATAACCAGACGT	16	5	yes
GATCCAGAGGGGACTGATAA	4	5	yes
GATCAGTCCCGGAAGAGAGC	7	13	yes
GATCAAGCTACAGATATGGG	7	7	yes
GATCTCTGCCTTTGAGGCCA	32	6	yes
GATCTTTCGGACTCTGGGGA	34	22	yes
GATCATGTGATATGGCCTGA	37	6	yes
GATCTTCCATGTCATTTCCC	22	3	yes
GATCATCCTTACGCTCCCTT	36	23	yes
GATCTTCTACTCCCATGGGC	6	7	yes
GATCTTCGTCTCAGGCCCTG	97	18	yes
GATCTTACTCACCAGGAGGA	234	22	yes
GATCTTCAGGACTGGAGTCA	142	73	yes
GATCTTCACATGTGCACAGT	71	46	yes
GATCTGTTGGACCAGACGCA	11	7	yes
GATCTGTTGAGCTTTAAAAT	17	12	yes
GATCTGTGGGAAAATAAAGC	46	30	yes
GATCTGTGGATAATGTAGGC	13	15	yes
GATCTGTCAGGGCCTGTCTC	45	2	yes
GATCTGGCCCCCATGTGTGG	9	9	yes
GATCTGCCTGGTGCTCTGCT	2	2	yes
GATCCTGGCGGCAACAGCAG	8	3	yes
GATCTGACTTTCCAGAGCTG	139	13	yes
GATCTGTACTTGTTGTGGTA	4	7	yes
GATCTGGGGGAGGGGATGGG	98	46	yes
GATCTGGGCTCAGACAATGG	4	4	yes
GATCTGGGCCTGGAGAGACT	112	0	yes
GATCTGGCTACGTCTCCAGG	54	3	yes
GATCTGGCGCACTGGGCAGC	162	25	yes
GATCTTTTGCTAATGCAGTT	36	26	yes
GATCCTTTTGGTTTGGACAA	4	4	yes
GATCTGCAGATGCTGTCCTC	64	48	yes
GATCGAACCTCTGAGAAGTT	2	3	yes
GATCTGGAAAATGAGTGTTT	56	12	yes
GATCTGCTTGCCTCTGCCAC	45	4	yes
GATCTGCTGAGGTGGAGAAT	86	9	yes
GATCAAACTCTGGGCCTCCT	31	7	yes
GATCAAACTAATCAGGCATT	4	7	yes
GATCTGCCTGTGGCAAGTCA	61	40	yes
GATCACTTCTGAGGCTCCGT	131	16	yes
GATCACTTCATCTCCCTTCA	20	8	yes
GATCCAGGGCCACCGCGTGG	20	4	yes
GATCCAGGATTCCTAGAGCA	12	14	yes
GATCCAGGAGCACCTGCCTG	59	2	yes
GATCCAGGACTACAAGCATC	134	7	yes
GATCCAGGACAACGCCACGG	87	14	yes
GATCCAGCTTCAGGGCCAAT	11	3	yes
GATCGGGGTTTACCTTTTTA	17	12	yes
GATCCAGCTCATACCCCTGC	180	5	yes
GATCCAGCAGTGGGCACCTG	26	7	yes
GATCTGCCCGCCTGGCGCGA	11	1	yes
GATCTGCCCCTTTAATTTAC	121	4	yes
GATCCGAGCAGCTTCTAGTT	11	7	yes
GATCTGAGCTGTAACCCCCC	5	5	yes
GATCCAGCAGCACTCACTGC	12	12	yes
GATCTACCAGCCTTGGCTCA	527	156	yes
GATCCAGCAGAGGAAGAGGC	98	16	yes
GATCCAGATAGTGAGATAGC	22	1	yes
GATCCAGAGTCCCCGTATTC	158	17	yes
GATCCAGAGGCCACAGCAAG	5	3	yes
GATCAGTTCCGGGGCAGGTG	112	38	yes
GATCCAGAGGCAACGTGGGG	44	2	yes
GATCCAGACCTATGCTGAGT	2	2	yes
GATCCAGACCGTGAGATGTT	6	3	yes
GATCCAGACCAATCCAGTGT	144	3	yes
GATCCAGACAGCACCCACTG	47	14	yes
GATCCAGACAGCAATCCTTA	31	4	yes
GATCTGGCGTCCTCTTCTGG	13	15	yes
GATCCAGAAGCTCCAATTTT	67	12	yes
GATCCACTTGTCTTCGGAGA	136	35	yes
GATCTTCCTTCCACAGCAAC	4	3	yes
GATCTGAATGTCCCTCCTGA	12	0	yes
GATCTTTGCCGGCAAGCAGC	6750	2218	yes
GATCACATTCCTTTCGGTTT	5	5	yes
GATCACATCTTCCCGTCTCC	5	5	yes
GATCACAGCTATTGGACTCG	41	5	yes
GATCCACTGGGAGAGAGTGG	234	36	yes
GATCCACTGCTGGAAGTACT	32	37	yes
GATCCACTGCCAGTGGTGTG	306	2	yes
GATCCACTCTTCTCCCGAGG	52	16	yes
GATCCACTCCTTACCGTTTT	45	9	yes
GATCCACTCAGCAGGCAATT	28	3	yes
GATCCACTATCTGGGCCCAG	103	2	yes
GATCCACGTGGGTATCCTGA	54	14	yes
GATCCACGTGGCACCAAGAT	3	3	yes
GATCCACGTGCTCCCACATG	111	8	yes
GATCCACGGAGTGCAGCAGA	1	1	yes
GATCCACCTGCCTTTGTGAG	6	1	yes
GATCCGCACCAACGGCAGTG	8	3	yes
GATCCACCTGACTACTCAGA	1	1	yes
GATCCACCGAAGGACATCTA	18	18	yes
GATCCACCCTCAGGCACCAG	105	9	yes
GATCCACCCGGCACACAGGA	77	17	yes
GATCCACCCACCTCTGTTAC	138	2	yes
GATCCGCCAGGCCTGTGCTG	4	5	yes
GATCTCTGGCTCCTGATGTA	4	1	yes
GATCTCTGCCTCCAAATATG	5	2	yes
GATCTCTCTCTTTCTTCTGA	309	21	yes
GATCCACCAGTGCTCAGCAC	13	13	yes
GATCCACCAGTATTACCCAG	96	12	yes
GATCCACATCAAGCCAGGAG	7	8	yes
GATCCACAGGCAGGAGGAGA	31	3	yes
GATCCACAGCGATATCCAGA	6	3	yes
GATCCACAGAGCTCATCCCA	54	5	yes
GATCCACACTGGTGGCGGGG	87	3	yes
GATCCACACTGGACAGTTCG	34	3	yes
GATCCACACAGGAGAGCGGC	167	3	yes
GATCCACACAGACGCGGCGG	71	15	yes
GATCCACAACAGTGCGTGGG	45	5	yes
GATCCAATGCCTTCTTCTGT	34	8	yes
GATCTCTATCTCGATATCCT	25	4	yes
GATCTCGCAGTGGCCCTGGG	8	8	yes
GATCTCCTGTTTTAGTCTCT	6	1	yes
GATCTCCCTGAATAGGCAGA	9	10	yes
GATCCAAGGAGACAATCTCA	125	44	yes
GATCCAAGCCTGAGCCCAGC	18	4	yes
GATCCAAGCCCGGGGCCCGG	480	18	yes
GATCCAAGAGCCTTGGAGAA	36	31	yes
GATCCAAGACCAGAGGGACA	208	17	yes
GATCCAAGAAGGTTTCTCTG	13	1	yes
GATCCAAGAAAGCGCCAAGG	24	7	yes
GATCCAACTGGCAGGAACCA	105	23	yes
GATCCAACTCTCCGGCCCAC	22	1	yes
GATCCAACGGAAGCCTCTGC	533	17	yes
GATCCAAAGCACATGTTTCT	44	8	yes
GATCTCCATTTCTCACTCTG	4	4	yes
GATCTCCAGCATGCCATCAA	4	4	yes
GATCTCATTTTGTTTTGCAT	49	1	yes
GATCTATTTCATGTTTTTGT	9	5	yes
GATCTCAGCGCAATTACAGT	53	54	yes
GATCAACAGATGCTTCCCCT	13	9	yes
GATCATTGTTTGTGATTGCA	32	32	yes
GATCATTGTTTGGTACAGTC	29	5	yes
GATCATTGCCTGCCCCTATA	22	4	yes
GATCATTCTGCAGTGAAGCT	5	4	yes
GATCATTCCCTGGGTTGGTA	1	1	yes
GATCTCAGCAACCGTGGTAG	123	28	yes
GATCTCACTGCGTAGCCCAG	38	25	yes
GATCTAGTGTTTCAGAGCTG	110	28	yes
GATCTTGTTATCTGACTCAC	295	34	yes
GATCATGTTTTGCTGTGTGA	47	10	yes
GATCATGTGTTCCGCTGGCT	9	2	yes
GATCATGTCTATGCTATCCG	80	8	yes
GATCATGTCTACCTACTATG	72	2	yes
GATCATGGGCCAACCTGGGC	79	14	yes
GATCATGCGGGAATGTTGGC	2	2	yes
GATCATGCCTTGGCAGAGCG	41	6	yes
GATCATGCACTGGGTTGGCT	24	3	yes
GATCAATCCCCTTCTGCTGC	27	32	yes
GATCTTGGCCAGGTCCAGCA	82	19	yes
GATCTTCCCCAAAAGGTCCC	3	4	yes
GATCATGAACAGGCTTTTTA	9	9	yes
GATCATCTTGGTTGTGGGGG	5	5	yes
GATCATCTCAGCATCTGAAG	28	2	yes
GATCATCGTGGACAATTCTC	19	3	yes
GATCATCCGTGAGGCGTACA	47	4	yes
GATCATCCCCTCTGAGAAAC	44	18	yes
GATCAGCACAGCTAAGACAG	85	94	yes
GATCATCCAGTCCAACGGGC	932	62	yes
GATCATCCAGCAGGTGTTTG	44	6	yes
GATCACTCTAAGACTGTCCT	21	2	yes
GATCACTCGGTGGAGACTGA	1	1	yes
GATCATACATGTGCCCTCCA	30	1	yes
GATCCTCAATCAGTGGGTGG	18	4	yes
GATCTGGGGAAAGGTAACTA	2286	581	yes
GATCAGTTTCCTGCTGTGCT	4	5	yes
GATCAGTTGGTGGAAATAAT	6	8	yes
GATCAGTTCCCCCCACCAGA	15	11	yes
GATCAGTTCCAACATCAGCT	63	4	yes
GATCAGTGTTGAAGGTGGGA	103	57	yes
GATCAGTGTGAGTGACTGCA	416	66	yes
GATCAGTGTCAAGAACTTCA	9	10	yes
GATCAGTGTCAACTGCTTGT	3	6	yes
GATCAGTCTGCTCGCCTATC	22	18	yes
GATCAGTCTGACTGTTCTTG	12	10	yes
GATCAGGTTGGTTTAGCACA	83	13	yes
GATCCCCCTGACCCCCCCGA	6	7	yes
GATCAAACTCAGGTCATCAA	2	4	yes
GATCACATTTTGAAATGCCT	67	11	yes
GATCTTCAGTGCAAGGTTAT	113	8	yes
GATCTTAAGCAACTTTTCAT	33	22	yes
GATCTCCTCTTGTTCCCCTT	5	5	yes
GATCTCCCTGGCCGACATCG	180	48	yes
GATCTACACGCACTTCACGT	24	23	yes
GATCCCAGGTTGTCTGCTAA	5	0	yes
GATCTGGTCAGGGTGCCTTT	24	5	yes
GATCACATGGGGAAGCGCTT	28	16	yes
GATCTGGCTTATCTTCTTCT	25	8	yes
GATCTCATCCCGGTGAAGCA	1	1	yes
GATCTCAGAGTGAGAAGCAT	65	42	yes
GATCTAGTGGAGCCATGGGA	48	1	yes
GATCTGCTGCCGCTTTGTCC	32	1	yes
GATCTAGGCTGACCTGAGAG	147	25	yes
GATCTACCGCACTGAGCTCA	65	6	yes
GATCTACAGCCATGGCCTGA	8	8	yes
GATCTACACTGCCTGGCACA	6	6	yes
GATCTCAACACAGACTCTCA	52	19	yes
GATCCATGTTCTTCAAGCAT	2	4	yes
GATCTGAATGTTGGCTCTCA	79	9	yes
GATCCAGCGCGTCCTCCACG	2	2	yes
GATCACAGGTGATTCACACG	12	0	yes
GATCTAATGGAAGGAAGGTT	31	8	yes
GATCTAAACCTGAATGACTG	61	8	yes
GATCGCCTGGATGGTGCTTT	82	4	yes
GATCCAGAAGAATTTTGCCA	6	6	yes
GATCGAGCTTCCCTATGCAG	76	1	yes
GATCGAGAAGATAGCCGAGC	39	7	yes
GATCGACCTCTCAGTGCCTC	6	8	yes
GATCCTGAAGCTGTGTTGTG	54	12	yes
GATCTTGTCTTGACTTGCTG	1	1	yes
GATCCTGTGTTACCCGGCAA	551	25	yes
GATCCTGTGCTGTCTATGGC	30	3	yes
GATCTTGGCTATGAACGGGA	69	1	yes
GATCCTGTACCGACCTGAGC	18	3	yes
GATCCTGTACCATCTGCAAC	1	1	yes
GATCCTGGTGGCTGTGGTGA	25	4	yes
GATCTGCCTTACGTGCACGG	41	7	yes
GATCCCTGGGCTCGGGCGAT	305	27	yes
GATCCAGAAAGATGGCTACC	27	18	yes
GATCGTGGATGAGCTGTGCT	12	2	yes
GATCCTGGCACATTCTCCAC	26	3	yes
GATCCTGCCTCCCAAGTGCT	5	0	yes
GATCCTGCACTCACACTTGG	30	4	yes
GATCTTCTCATCTATTCACT	47	5	yes
GATCCTCCTGGGAGGACAGG	99	64	yes
GATCCTCCCCGCCCCCCGAT	15	3	yes
GATCCTCCAGAGAGGGGGTA	9	7	yes
GATCCACTGTGAAGGATGGC	635	13	yes
GATCTTTGTGGCGCACAGCA	40	27	yes
GATCCCAGAAGCCATTGTCT	6	1	yes
GATCCTCAAACAGCAGGTGA	25	4	yes
GATCCTAGTTTTTGTAGCGG	8	8	yes
GATCCAGTCCTGTTCAGCGC	19	14	yes
GATCCTAATCCCTTTCTTGG	25	3	yes
GATCCTAAAACCCGGAGCTT	9	5	yes
GATCCGTTGCGGAGGCCTGG	132	5	yes
GATCCGCTGCTGCCGAGGAG	11	1	yes
GATCCCTTGGGAGGTAGGGG	63	0	yes
GATCCAGACAGAAACTTCAG	92	6	yes
GATCCCTCGCTGAGAGCCCG	174	7	yes
GATCCCTACCCCCACTTTTT	5	5	yes
GATCCCGCCAGCGTTCTGTG	151	3	yes
GATCCCGAGTTCAAGGCCAG	99	10	yes
GATCCCCTCACAGTGAAGGA	2	0	yes
GATCCCCTCAAGTTGCCTGG	4	4	yes
GATCCCCTCAAAGCTCAGGC	235	15	yes
GATCCCCGTGTCCCACAGCC	63	20	yes
GATCTATCCAATGGGAGGTT	5	6	yes
GATCGCTTCCGGTCCCTGCT	11	1	yes
GATCCCCATCTGCGAGCCAC	90	11	yes
GATCCCCACCTACGGGTTGG	31	0	yes
GATCCCAGTGGCTCTTCCTT	10	4	yes
GATCCCAGCAGTCCTGGCAT	9	0	yes
GATCCCACTGATGCCAAGTA	224	24	yes
GATCCCACTGAGACTTAAGC	120	9	yes
GATCCCACATCCCATTTCTT	61	6	yes
GATCTGTTGAGTTTCTTTGT	2	3	yes
GATCGCAGTGTCTAAACAGA	3	6	yes
GATCTCTGAGTTTTCTGAGT	1	1	yes
GATCCCAACTCGACGGTCCA	191	28	yes
GATCCCAACACCCAGCAAGA	13	15	yes
GATCCAGTCCTGCAAATGTA	99	21	yes
GATCCAGTATTCGAAGCACC	17	11	yes
GATCCAGGAGTTCAAAGAAG	1751	177	yes
GATCCAGGAGGTCTCAGGAC	5	5	yes
GATCAGTCTCTGCAGCCTTT	1	1	yes
GATCCAGCTGGACAAGCTCA	83	11	yes
GATCTCGTCATGGTGTTTTG	7	7	yes
GATCATCTCCCCACAGTGTC	6	4	yes
GATCGTCGTTCTGGTAAGAT	962	680	yes
GATCGGAGACGTTTTCATCA	36	26	yes
GATCTGAGCCCTGAGGGGGG	254	82	yes
GATCCTGTCCGGATTATGAT	20	6	yes
GATCTGAACTTGAGTTAGGG	9	9	yes
GATCCACAAGTTTGAAGAGC	297	36	yes
GATCTCATAGGCTGAGAAAT	2	3	yes
GATCCTAGAACGCAATGAAT	30	2	yes
GATCTCACAGACTACCTCAT	31	23	yes
GATCCTGGACGTTCCTGTCT	62	4	yes
GATCCGTTCTCGAGGGGGTG	30	8	yes
GATCCTGAGGGCCATGCTGA	62	20	yes
GATCCTCTTGGCTTAAATGT	2	2	yes
GATCCCCAGAGTCTCTTAGG	1	1	yes
GATCCTTTTTTGGAGCCCAG	9	9	yes
GATCGGCCTGCCTCTGCCTC	24	17	yes
GATCGATGTAGCCCGGCTGG	21	6	yes
GATCCTCCCATGGGGCACCA	247	74	yes
GATCATGTTGCTGGCTTTTA	27	1	yes
GATCTGCCGCTCCCTCTACA	1	1	yes
GATCCAGGTGTCTGAGGGTT	181	26	yes
GATCCCTGTCGAGAAGCCAG	2	2	yes
GATCGAAGCCCGGAAAGGCA	37	34	yes
GATCCTTTGCTCTGAACTTA	1	1	yes
GATCCCTCTGGCTTCCCCTC	14	1	yes
GATCCCTCTGCCACGCAACC	40	15	yes
GATCCAACTCCAATTCAACA	103	19	yes
GATCCCGGTTCTTGAGTGAT	17	20	yes
GATCCCGACACCAAGAAGAT	198	81	yes
GATCCCCTTGCATACCACTT	19	12	yes
GATCCTGGTTTCCTAGGAAA	2	3	yes
GATCCCCTCCCACAGAATAA	1411	303	yes
GATCCCTTACTTCTTTCAGG	5	5	yes
GATCTACCCGGGACACGGGC	3932	649	yes
GATCTACAAATGTGGTGGAA	40	5	yes
GATCTAATCTTTACACAGGT	38	6	yes
GATCCCTATGGTTCAGGAGG	175	29	yes
GATCCAGGCAGGAGCTGAAA	115	113	yes
GATCCCATTGGCTGTACTCT	67	11	yes
GATCAGCCCTACAGTGTATT	125	1	yes
GATCGTTCTGAAACTCGAGG	4	4	yes
GATCCAGAGTGGAACTGTGG	59	2	yes
GATCGTGTTGTTTACCGTTG	50	7	yes
GATCGTGGCTCCCATCAGTG	41	8	yes
GATCGTCGTTCTGGTAGGAA	284	201	yes
GATCGTCGTGACAGATACTC	352	46	yes
GATCGTCATTGACCTTCAGG	32	3	yes
GATCGGTAGAGGGGAGGGTT	1	1	yes
GATCCCATCCCCTGCAGAGG	44	13	yes
GATCCCAGGTCACACCTATG	54	8	yes
GATCTTGCAAGGGGAAAACT	202	8	yes
GATCCCAGACCCTTCAGTGA	26	18	yes
GATCCACTTGCCTTTGCCTT	6	6	yes
GATCGGGCCGCTGCTGACTG	139	6	yes
GATCGCTTTGATGACCACAA	199	3	yes
GATCGCGGGGCTGCCGGGCG	30	1	yes
GATCAGTTAATTTGTATGTT	61	46	yes
GATCGCAGAACCAGGGCATC	7	7	yes
GATCCATGCTGGGGCTGGGC	24	22	yes
GATCCCACTTAGGATACCAT	63	9	yes
GATCGCAAGCCACAACTCCC	65	11	yes
GATCGAGGCCTTCCGCAGCC	37	13	yes
GATCGAGAGGGCGAACCACG	434	3	yes
GATCGACAAAAATGTTATGG	92	13	yes
GATCAAAGGAGCTCAAGGAC	134	87	yes
GATCCATGACATCCGCTGGA	954	35	yes
GATCCAGTTCAGGGAGGAGG	14	14	yes
GATCTGCTGAAACTGTTTGT	7	8	yes
GATCCAGGTGTATCAAGCCA	22	10	yes
GATCCAGCTATAGGGAACTC	35	21	yes
GATCCTTTGCCCGGCCAGGA	19	22	yes
GATCCATGTCTCCTCGACCA	263	35	yes
GATCCATGAGTACTACAGCA	629	54	yes
GATCCTTGCTGCAAAGCTTT	39	3	yes
GATCCTTGCCTTCTGGCAGA	2	2	yes
GATCCTTGCCTCTCACTCCC	103	16	yes
GATCCTTGAGAGCTAAGTTC	2	3	yes
GATCCTTCTGTCATTTGTCA	29	10	yes
GATCCTTCGGGGGTTCCAGT	5	6	yes
GATCCTTCCTGTCTTCCCCA	44	5	yes
GATCCTTCCTCGACTCTTTC	11	6	yes
GATCCTGTTTCTTTTCTGTT	12	5	yes
GATCCTGTTGTTTGCTCCTA	8	1	yes
GATCCAGTTTGTCCTGGTCT	249	11	yes
GATCTGACGTGCCGCCTGGG	7	8	yes
GATCCACTCAGGTCCCCCGG	4	4	yes
GATCTCTTCCGCTCTCCTTC	2	4	yes
GATCCTGGTTCTTCCCGTTG	1	1	yes
GATCCTGGGGTGGTGTGGGG	14	5	yes
GATCCTGGCTTGGGGTGCTT	15	5	yes
GATCCTGGCGTAGTTCCAGA	12	7	yes
GATCCTGGCCCGGCAGCTGG	196	17	yes
GATCCTGGCCAGGCCAGGCT	24	23	yes
GATCCTGGCCAAGCACCCGA	135	5	yes
GATCCTGGAGTACAGGAACA	9	10	yes
GATCCTGCGGAAACGCGAAT	46	7	yes
GATCCTGCCAGAACCAAGTG	20	1	yes
GATCTTCCCGTTGGCCGCTC	3108	906	yes
GATCTGTGCAACATTTTTGT	51	22	yes
GATCTCGGGGAAACTCAGCG	47	31	yes
GATCTCGGAGACCTTTGGTG	13	15	yes
GATCCTGAGAAAGAAAATGG	46	4	yes
GATCCTGAACACCCAGCATA	8	7	yes
GATCCTCTCCCCCACTGGCA	239	10	yes
GATCCTCGACTCTCACTAAA	51	33	yes
GATCCTCCACTGTTGGCCCT	127	29	yes
GATCCTCAGTTCCTGTTGTT	40	10	yes
GATCTTCCATCCCTTCTGCT	90	60	yes
GATCCTATTCTTGCCAGATT	6	5	yes
GATCCTATGTGAGCACATGA	6	6	yes
GATCATCAGAGCCACAGCTA	162	44	yes
GATCCTATCCAGCTAGCTCT	423	47	yes
GATCCTACCCAGGCCATGTC	41	18	yes
GATCCTACAAGTGCAAAGCA	1	1	yes
GATCCTAAGTGTCCCCCTGT	4	1	yes
GATCCTAAGCCCAGGGCTGT	128	4	yes
GATCCGTGCCACAGGTTGAC	14	16	yes
GATCTCACCCAAAGGCAGCC	99	15	yes
GATCTATGAAACCACCGTGG	97	52	yes
GATCCGAAGCAGGTGCCTGG	46	9	yes
GATCCAGCAAGTCACCATGC	91	21	yes
GATCACCTCAGTTCTCTCTC	40	5	yes
GATCCCTTACCTGGATGGAA	1	1	yes
GATCCCTTACAGAAACAGTC	21	5	yes
GATCCCTGGGGGAAGCAGAT	6	4	yes
GATCCCTGGGAGACTCCCCA	14	14	yes
GATCCCTGCTCCTCCTCAAG	144	8	yes
GATCCCTGCGTAGCCCCTAG	93	33	yes
GATCCCTGCCTTTCATCAGG	4	1	yes
GATCCCTGAAATGGTGGTAT	5	5	yes
GATCCAGGCTCAGTTCTCAG	4	1	yes
GATCGCTTCTGCCTGGGTGG	13	3	yes
GATCGCTCATTGGAACAGCC	17	14	yes
GATCGCGGGCTCGGCGGCAA	56	5	yes
GATCTCTGGTAATCTTCCAA	5	5	yes
GATCTCTGCTCCTGTGGCAT	25	6	yes
GATCTCTGCGTCTGCTTTGG	24	0	yes
GATCTCTCTAAATCCCACTT	62	6	yes
GATCCAAAGCCAAAGCCGAA	13	4	yes
GATCAGCTGGTCCAGGCAGA	102	52	yes
GATCTATTTGCTTAGGCTTG	48	9	yes
GATCTTCCTGAAAGTGAAGT	7	5	yes
GATCATCTTCACCTACTACA	50	15	yes
GATCTTTACCGGACCTTCGA	2	2	yes
GATCTTGCTGTGTAGAGCAC	243	152	yes
GATCCAAGCTGGGGAAAGTA	15	1	yes
GATCATGTTGATAATGCTCG	424	13	yes
GATCCTGGGCTAGAGTTGTG	111	6	yes
GATCCTGAAGAGAAAAAAGA	83	16	yes
GATCTGTGTTTGAGGGATAG	113	20	yes
GATCCAAGCTTAGTTTGTTA	6	1	yes
GATCCGTGGGCGCCGTGATG	1	1	yes
GATCAGTGTCGACTGCACAG	1	1	yes
GATCTGGGAAGCCAGCATTG	48	34	yes
GATCCACCCTGCGGAGGTCG	8	3	yes
GATCACCTTTGACAGCATGA	17	5	yes
GATCAACCTGATTTTCTTGC	1	1	yes
GATCATATCAAGTTTCCTAC	6	7	yes
GATCTGCCAGTGTGACTTCC	28	19	yes
GATCATGGTTTCTTTTTCTC	38	3	yes
GATCATGGACTATGGGTTTT	44	3	yes
GATCCTTGTGTTGTTCGTGA	1	1	yes
GATCAGGACCTCAAGGTTAG	1	1	yes
GATCTGAGAAAACGAGCCTG	471	140	yes
GATCAGGTAGGGGATGTGGT	9	15	yes
GATCCTTCTCAGGACAGGCA	26	21	yes
GATCAATAAATACTTGTGGA	74	4	yes
GATCCTTCCCTCTTATGACC	31	7	yes
GATCCTTCCAAGGGAGAAAG	2	2	yes
GATCACTTTTGTTCGGAAAA	38	9	yes
GATCTCCCCTGTTGGCTGTC	17	0	yes
GATCTGTGCCCTTTGACTTG	46	47	yes
GATCTGCCCCTGCCTGCTTG	40	20	yes
GATCTGCTGGGTCACCAAGG	231	34	yes
GATCTGGCCATCTGGGGCAC	69	45	yes
GATCTGGAACTCACAGAGTT	58	3	yes
GATCTTGCCAAAGCAGTAGC	37	16	yes
GATCCTGTACTCTTAGGGCT	9	6	yes
GATCTAACACTCTCTTCTGG	2	3	yes
GATCGTGAGTTGAACTTAGC	2	2	yes
GATCCTAGCCTAGGACACTG	30	19	yes
GATCGTCGCCATAGGTGTGC	7	0	yes
GATCGGCTGCTTGCGGTGGT	5	5	yes
GATCGGCTCCCGGAGGAGCA	27	6	yes
GATCCTCTTCACTGAGAACA	9	7	yes
GATCCTAGCTCCCCTGCTGG	110	17	yes
GATCTTGGGATTATCTTGGT	2	2	yes
GATCTCGCGCCAGGAGCTGG	137	33	yes
GATCCCGGCCTCCTACACAC	5	7	yes
GATCCAAGTTCAGGGGGTTA	33	2	yes
GATCCTGGGGGAAAAGGGAG	18	6	yes
GATCTGCAGCGGCAGCACGA	32	37	yes
GATCCTGGGAGACACGAGGA	7	7	yes
GATCTCCCATGGGTCACCCA	72	4	yes
GATCCTGAGGACCTGGACAG	185	18	yes
GATCATGCTGGAAGATGGCA	2	2	yes
GATCCCCGTCTGTGTCTGTC	40	13	yes
GATCCAAGACAAGGAAGGCA	25	4	yes
GATCCCATCCCAACACCTCC	157	44	yes
GATCTCGAGAGGCTTTGTGG	77	39	yes
GATCTCCTCCATTCCTAGCT	65	64	yes
GATCTGCCTGTCTCAGCCTC	3	4	yes
GATCTCCGTGGTCAGCTTTT	9	2	yes
GATCCCAATTGGTCCAGGCC	2	2	yes
GATCTCACTGGTCCCGGGAA	70	35	yes
GATCATTCTCTTGCGCTTTA	6	6	yes
GATCATAGAAGGTTGGGGTT	69	5	yes
GATCCATGTGAGCCCCGGCC	7	2	yes
GATCAGCAAGCAGGAATACG	295	142	yes
GATCGTTCTCGAGAACCTGT	32	5	yes
GATCATCCTGTGGCTACTAG	1236	502	yes
GATCCAGCAGAATGGGGGGC	23	5	yes
GATCCCGAGGCAACAGCAGG	8	4	yes
GATCCCCTGGAGACGCCTGG	33	33	yes
GATCCCCGACCCAACATTTT	38	4	yes
GATCCCCCTGCCTCTCAAGT	48	9	yes
GATCCCCCCTTCCCTGGGCA	84	10	yes
GATCGGACCTTCTTTACTGT	24	3	yes
GATCGCAAGTACACCCTAAC	162	20	yes
GATCCCCCAAAAGAAATCAC	56	10	yes
GATCCCCACTTATGTGACTA	484	539	yes
GATCCAAGGCGCCCCGATAC	5	4	yes
GATCCCATGTGCATTGCTCT	2	0	yes
GATCCCATCTGAGGTGCCAC	87	8	yes
GATCCCAGTACGACTACGTC	63	19	yes
GATCAAGCATCTGCGCTTGG	108	62	yes
GATCAAACTCAGGTGGGCAG	23	4	yes
GATCGCCAACAGCAGTGGCA	24	5	yes
GATCCCAGGATGCCCCTGCC	44	5	yes
GATCCCACGCCAGCGTCCAC	843	167	yes
GATCCCACCAATCCTCATTC	48	3	yes
GATCCCACAGTTTACACTTG	25	4	yes
GATCCCACAACCACTCCAGG	3874	1640	yes
GATCATCACAGTTGAGGAGG	57	2	yes
GATCCCAAGTCTAAATAGAG	5	5	yes
GATCTTTCTTCCTGAATGTG	587	37	yes
GATCCATTGCTCCAGGACAA	27	6	yes
GATCCATCAGGGGCAGGCAT	113	2	yes