#SEQUENCE = small RNA sequence (DNA form)
#COUNT = number of times small RNA was sequenced
SEQUENCE	COUNT
AAAAAAAAAAAAGCCGACTCGATTC	1
AAAAAAAGGTAAGGTTGAAAATGGT	1
AAAAAAAGTGGTACCTCATGATAC	1
AAAAAAATACCCGTGCATTACAACG	1
AAAAAACAATGCACGTGGTTGATGG	1
AAAAAACCCTTCGTAAAAGAAATGC	2
AAAAAACCGGTGCAAATTAGCTC	1
AAAAAACCTGGTACCAAAAAATAGC	1
AAAAAACGAATGGTGGATGATTGT	1
AAAAAACGAGGTGAGCCATTAGCGCA	1
AAAAAACGATTTTGGTACACAGAT	1
AAAAAACGCACCGCTTAGCAGTTTG	1
AAAAAACGGTGGCCCTTATATGG	1
AAAAAACGTGAGACGGTTGATGGA	1
AAAAAACGTGCTAATAGAAATCGAG	1
AAAAAACTACTATTTCCGTCCTA	1
AAAAAAGAGTGGCTACATTTAGG	1
AAAAAAGGGTGGTGATGAGTTTGCC	1
AAAAAAGTAGTTGTGCCTTATATT	1
AAAAAAGTGAATGGTGGAGGATTGT	1
AAAAAATATTTTAATGGGTGCAG	1
AAAAAATCGCCCCCTACAGCCTCCC	1
AAAAAATGGCATCAATCTGAACAGC	1
AAAAAATTTTGGTCAAAAACGTC	1
AAAAACAAATTTAATTAGGACCGA	1
AAAAACAATGTGGTGCAGTTTTAG	1
AAAAACACACCAATAGTTAAGTGC	1
AAAAACACAGAAAGAAACGGTTGC	1
AAAAACACAGGATTTTGGTAGG	1
AAAAACATCTCGAGGTACTGGTATC	1
AAAAACCAATAACTGAATCGTGAC	1
AAAAACCCTACTATTGATAACCTTA	1
AAAAACGACGCGGGGCCATTTCGG	1
AAAAACGAGGTGAGCCATTAGCGC	1
AAAAACGAGGTGAGCCATTAGCGCA	1
AAAAACGCTGACTGGATTGCCA	1
AAAAACGGTGGCCTGTGCTTCTCG	1
AAAAACGGTTACCGACAAAACGGT	1
AAAAACGTGAGACGGTTGATGGAC	3
AAAAACGTGATACGGCTGATGGA	1
AAAAACGTGCCATAAAAATGTTAA	1
AAAAACGTGCGCGTGAAAACGAGG	2
AAAAACGTGTAATTGGCTGAGAGAC	1
AAAAACTGAGCCGACATACATTAAG	1
AAAAACTGTGTTGGATGGTAAAA	1
AAAAACTTATCCTAGAAATGGTC	1
AAAAACTTGATCGCCTACCTACCC	1
AAAAAGAAATTAACTGGACTGTCA	1
AAAAAGAAATTTGTGCACCAACC	6
AAAAAGACTACATATATCCAGTTG	1
AAAAAGAGTGCGAGAAGGGTGTCTT	1
AAAAAGATACCTACTATATTTAG	1
AAAAAGATATGGCCGCTTAGTCGC	1
AAAAAGCACTGATTGGACTGCCAC	1
AAAAAGCGATGGTAGGATGTCTA	2
AAAAAGCGTGCCACGATGAATATC	1
AAAAAGCGTTGGGCCCCATGCGGGA	1
AAAAAGCTGCGGTGCCAAGCGCTTC	1
AAAAAGGAAACGAAAAGGTGGCG	1
AAAAAGGCTTAGGTCTGATTGTGG	1
AAAAAGGGTTTCTCCACCGGTGTG	1
AAAAAGGTGTTTGGACTTAGCTTC	1
AAAAAGGTTAGCCATAAATGTGA	1
AAAAAGTAGTACTGCTCATGTGCC	1
AAAAAGTCAACGGTGTCATACATT	2
AAAAAGTCACGGTAAGCTACACAC	1
AAAAAGTGAAAGACGATCAAATTGC	1
AAAAAGTGAATGGTGGAAGGTTGT	1
AAAAAGTGAATGGTGGAGGGTTGT	1
AAAAAGTGAGGGCAAAAATGCAAA	1
AAAAAGTGCCCGATTGAGTTATGG	1
AAAAAGTGCCTAATGAAACTAGAT	1
AAAAAGTGCGACCACATGGGTGAA	1
AAAAAGTGCGGCTGACATGTAGGCC	1
AAAAAGTGCTCTACAAAACTAG	1
AAAAAGTGCTTTGGGACCACTCC	1
AAAAAGTGCTTTGGGACCACTCCCT	1
AAAAAGTGGTGTGGCAAAGTGT	2
AAAAAGTGGTTACATTTAGTTTGC	1
AAAAAGTGTAGAACACGATGGGTC	1
AAAAAGTGTTAATGGATTGAAAC	1
AAAAAGTTAAAAGTTCATGTGTGT	1
AAAAAGTTAAAAGTTTATGTGTGTA	1
AAAAAGTTGGGAACTAAACAAGC	1
AAAAATAAGGTGTGCCTTTGTGTA	1
AAAAATAAGTAAGGCTTCCAGTAG	1
AAAAATACAACCAAACCGTGCGC	1
AAAAATACGATGGAAGCGTCAACC	1
AAAAATACTAGTTGGTGTTTAGAT	1
AAAAATAGAGGGACCGACACCAGT	2
AAAAATAGGCTTATTTTTACGTGC	1
AAAAATAGTAATGGTGATAGATAG	1
AAAAATATGGATCGGCCAGATAAA	1
AAAAATATGGCGCCATAAATATAG	1
AAAAATATTCTAAAGGGTAGATGC	1
AAAAATCACAATAATCCTGGTCCA	2
AAAAATCCAACACGTTTGAGGTGA	1
AAAAATCGAAATTCCGCGTGCGAC	1
AAAAATCGAAGGGGTGCTCCAGAA	1
AAAAATGATGTGGCAAGTGAATA	2
AAAAATGATGTGTGTTGTAACGAGT	1
AAAAATGCTGATTGGACTGCCACG	1
AAAAATGCTTATATTCTACGACGG	1
AAAAATGGACGTACGAGATTTGGT	1
AAAAATGGATGGCTGAGATGATGT	1
AAAAATGGTGGTCACAACAAGACT	2
AAAAATGTCTAAATGCAACCTA	1
AAAAATGTTTGGGTATCACATCGG	1
AAAAATTAAAGGTGTTTTTCTGGT	2
AAAAATTGGAACGATGTGACGGAAA	1
AAAAATTGGTAGTGCCAAAATATGC	1
AAAACAAACAAGGTTGGGTCCAAC	1
AAAACAACCTAGGAGGAGATGTG	1
AAAACAACGGGAGGCGCGGTGGTT	1
AAAACAACTTTATTGGTGCTATAA	1
AAAACAAGGGACCTAACATATACG	1
AAAACAAGGGTCAGATTTTTGTCA	1
AAAACAAGTGCAGATGAGATACCT	1
AAAACAATCTAGTGCCGAATGTAA	1
AAAACACAGGAATGACCGTTTGAT	1
AAAACACGAAACCTGCCTTCCCGAG	1
AAAACACGGCGACGATCTTGATGC	1
AAAACACGGGACCGACGATCACAC	1
AAAACAGACGGTCAAACGTTGGGC	1
AAAACAGAGGATTGCAAAACACAG	1
AAAACAGAGGATTGCAAAACGTAG	1
AAAACAGAGGTGAGATGAATAAGA	1
AAAACAGATGGAATCGCTACTGGC	1
AAAACAGCAGGGGACTGAGACAGG	1
AAAACAGCGAAGCCCTCATGTTTA	1
AAAACAGGAGAGAAAAACCACGG	1
AAAACAGTAGGCTGCAAATGGGTC	1
AAAACAGTAGGCTGTAAATGGGTC	1
AAAACAGTATGGGACTATGTATGG	1
AAAACAGTCAACGGTGTCAAATAT	1
AAAACAGTGCAAGCAAAAAGTCAAA	1
AAAACATACTTTCGCAGCGGTTTC	1
AAAACATATTCGAGAAACTGGACC	1
AAAACATCACATCAAATGTTTGGA	1
AAAACATCCGGTTTGGACGAT	1
AAAACATCGGTGTCTACGTCAGAA	1
AAAACATGAACAGAGTTGGGTGGA	1
AAAACATGATGCCTGCCTCTGTGCC	2
AAAACATGGTGTGTGTATGACAGG	1
AAAACATGTGAGCATGGTATGTGC	1
AAAACATGTTTTCATAAGTGGCCA	1
AAAACCAACACGGGAGTAGGGTGT	2
AAAACCACCGAGGGACCTAAAATGA	1
AAAACCACGGGTGTCTACCGGCAA	1
AAAACCATCGCTTTGGGGTGCTAG	1
AAAACCATGAGTGCACATACTGAC	1
AAAACCCTAGAGGGCAACAGGAGG	1
AAAACCGCAGCCACATGGTCCCGC	1
AAAACCGCCAACCTAGGAGGGGAC	1
AAAACCGCCGAGGGATCTAGTTTGC	1
AAAACCGCTTTGGATTGGGTCGAT	1
AAAACCGGGGTGAAAACCGCCTA	1
AAAACCGGGTCACGCGCGTTGTGG	1
AAAACCGGTGCAATTTGACTCCCT	2
AAAACCGGTGCAATTTGACTTCCT	1
AAAACCGGTGCACTTTGACTCCCA	1
AAAACCGGTGCAGATGAGGTCCCT	1
AAAACCGGTGCAGATTAGGTCTC	2
AAAACCGTAGGGGTGGTTGATCTT	1
AAAACCTAATTGACCCAATGATAT	1
AAAACCTAGAATCGGATGGGATA	1
AAAACCTAGGACATGATGGGACAT	2
AAAACCTAGTTTGATGAGTGAG	2
AAAACCTCGGTAAAGAGGGTGGC	1
AAAACCTTGATAACTTTGCCA	1
AAAACGAAATATGTGGGTTGGGAA	1
AAAACGAACGGTGAAACGTTGGAC	2
AAAACGAATGGTCAAACGTGTGAT	1
AAAACGAATGGTCAAGCGTTGGTC	1
AAAACGAATGGTGAAACGTTGAAT	1
AAAACGAATGGTGGATGATTGTGA	1
AAAACGAATGGTTAAACGTTACAA	1
AAAACGACAAGTATTATCGGTGCG	1
AAAACGACATGTTGCCAGGTTCAC	1
AAAACGAGGTGAGCCATTAGCACA	1
AAAACGAGGTGAGCCATTAGTGCA	1
AAAACGAGTGAACGGAGTGAGGGG	1
AAAACGATGTGAGAGGGCCTT	1
AAAACGATGTGAGAGGGCCTTAC	1
AAAACGATGTGATGGAAAAGTTGG	1
AAAACGATTTGGTACCTCAAAGCA	1
AAAACGATTTGGTATCGTGAGGTA	1
AAAACGCAGACAAAAAGATGTGAC	2
AAAACGCATGGTGCAGTAACGTTTG	1
AAAACGCCACAGGTGAAGAGGAGA	1
AAAACGCGAATATTAAGGAATGA	1
AAAACGGACAGTCAAACGTTGGAC	1
AAAACGGACAGTCAAACGTTGGGC	2
AAAACGGACGGTCAAACGTTGAAC	1
AAAACGGAGCAAAAACGAACCGG	1
AAAACGGATCCGCCAGCGAAAA	1
AAAACGGATGGTCAAAATTGGGCA	1
AAAACGGTCTTTCCAGGTGGATAG	1
AAAACGGTGCTCGGGTGATAAGG	1
AAAACGGTGTGACAATTTAACGAT	1
AAAACGGTTGTTGCCGTCGGATGC	1
AAAACGTGAATTGCCTAAGGACAC	1
AAAACGTGACAGGCCACACCTGAA	1
AAAACGTGACGGTGATGGTACGGT	1
AAAACGTGAGACGGTTGATGGACA	1
AAAACGTGCAACATGACAAAA	1
AAAACGTGCTAATGGAAAACAAGA	1
AAAACGTTCGATGTGACAGGGTGTA	1
AAAACGTTCGATGTGACGGGGTGT	1
AAAACGTTCGATGTGATAGGGTGTA	1
AAAACTAACCTAGATTTGTTGTAC	1
AAAACTAAGGCAGATAAAACGACG	1
AAAACTAGAAGGTCCCGAGCAACC	1
AAAACTAGATATGTGAGGTCCC	3
AAAACTATGTTAATTGGGTGTTTG	1
AAAACTATTTATGTGGGTCCTATC	2
AAAACTGAATGCTGAGATGGATGA	1
AAAACTGCCTAACTTGAGGTGTGG	1
AAAACTGGCTGCCATACTGAT	2
AAAACTGGGAGTGGAGTTGGGTGG	2
AAAACTGGGAGTGGAGTTGGGTGT	2
AAAACTGGGTCAAAACCAACTAAG	3
AAAACTGTGAAGTCACGATGTCCT	1
AAAACTGTGGTGTTTTTTTGTGCA	1
AAAACTTAGCTCGATAAAGTCACC	1
AAAACTTGATAGTGTCTAGTGCAT	2
AAAACTTGATAGTGTCTAGTGCATA	1
AAAACTTTAGATGTGTAAACTTGAG	1
AAAAGAAAAATAAACTAGAGGTGA	2
AAAAGAAAAGGAGACCTACGCAC	1
AAAAGAAAATAAAAAAGACGTGCC	1
AAAAGAAAATTTTTAGGTGGTCAC	1
AAAAGAAATTTGTGCACCAACC	1
AAAAGAACCTTTAGCCTCCCTTGG	1
AAAAGAACTACGTAGACGAGACAA	2
AAAAGAAGACGAGGAAGTGTGCCA	1
AAAAGAAGATAAATGGTTCACACA	1
AAAAGAAGATGTGGTGATATAATC	2
AAAAGAAGCCACCACGTTCGCTGTG	1
AAAAGAAGGGTAGGTAGAAATGGTA	1
AAAAGAAGGTGCTATACAAATTAG	2
AAAAGAATGGTTGTGATTGGTTGA	2
AAAAGAATGGTTTCTGCGAGTGAC	1
AAAAGACTAGTCTGATGGGGTGAG	1
AAAAGAGAAACAGGTGGAGCTATAG	1
AAAAGAGACAAACTCTGTGTGTCA	1
AAAAGAGAGAAACGGTGTCT	6
AAAAGAGAGAATTTTGGTGCAAAG	2
AAAAGAGGAAATGTGTAAAAAAAG	1
AAAAGAGGAGCAGAAATAGGTGGG	1
AAAAGAGGTGGAAAGCATTTATTT	1
AAAAGAGTGCTCATTGAGAGGTA	1
AAAAGATAGGCCACGCCATTCACA	1
AAAAGATATGTTTAAGGGTGGTCC	1
AAAAGATCGGGCCACGAGAGAGAG	1
AAAAGATGAGAGAGAAGAGCAGCGA	1
AAAAGATGAGATATTACTTAGTGC	1
AAAAGATGCCGACATAATTTTAG	3
AAAAGATGCTAAAGCTGAAGGGC	1
AAAAGATGCTAAAGCTGAAGGGCA	1
AAAAGATGCTGAACATATGAG	1
AAAAGATGGGTGTATGACATGTGG	1
AAAAGATGGTGTCTGCCTCTATGC	2
AAAAGATGTCTCACATATCAGTGA	1
AAAAGATGTGCAGCTGACATGTG	1
AAAAGATGTGGCTTGTAAACTG	2
AAAAGATTCACGATCTTCGGGTGT	1
AAAAGATTCACGTTCTTCGGGTGT	1
AAAAGCACAGAGTTTTAAGGGCCA	3
AAAAGCAGCGGGCTACATATTTAT	1
AAAAGCAGGTGCGTGGAATGCAAG	1
AAAAGCAGTGGGCTATAAATTTGT	1
AAAAGCCAACCTTGATATGGATGT	1
AAAAGCCAACTTAGATGGGGATGG	1
AAAAGCCATATGGCATGGTGTC	1
AAAAGCCATATGGCATGGTGTCCA	1
AAAAGCCCACATCAGAAGACTTTT	2
AAAAGCCCACCTCATGTGATGGCA	1
AAAAGCCCTACATATGTACACACT	1
AAAAGCCGATGGTTTGGTGGTTCG	2
AAAAGCGATACCGGGAAGCCTCAC	1
AAAAGCGTATCTAGGATGTGGTTA	1
AAAAGCTAAATTGATGGACGCTTG	1
AAAAGCTAGCCGTTGAGGTGAGGA	2
AAAAGCTGATGAGTTTAGGTGTCC	1
AAAAGCTGGCCTTTATTATGTGCA	1
AAAAGCTTAGGCCTGGTGGTACAA	1
AAAAGGAAATTTTTAGGTGTCAC	1
AAAAGGAAGGTGCTCAAAGTACAG	1
AAAAGGCGATGTAATTGATACCTG	1
AAAAGGGGAACATCTGGTACTGCC	2
AAAAGGGGGTGGCTATCAAGCTGG	1
AAAAGGGTCTACTGCATGGGCAAG	1
AAAAGGGTGAGCTTTTTGAGGGCT	1
AAAAGGGTGATTTTTACAGAC	1
AAAAGGGTGTTATGTACATGCAAG	1
AAAAGGTACAACATAGATAGATGC	1
AAAAGGTCCGCCTGTGATAATGCA	1
AAAAGGTCCTAAGGATTCGGTGA	1
AAAAGGTCCTATACTAGCTGTGAA	2
AAAAGGTGAAACTACTCAAAAGAA	1
AAAAGGTGAATGGCAGAGAGTTGT	1
AAAAGGTGAGATGGGACAAACCC	1
AAAAGGTGAGGGCTAAACATTAGC	4
AAAAGGTGAGGGCTAAACATTAGCC	2
AAAAGGTGATACAACTAGGGGTGA	1
AAAAGGTGATGATTAAGTGATATC	1
AAAAGGTGCGTGATAAGCGGGATC	1
AAAAGGTGGAGAATGGTGAGATTAC	1
AAAAGGTGGAGGCAGTCCTCAC	1
AAAAGGTGGGAGGCGCGGTACTCA	1
AAAAGGTGTACCCGACTATCGGA	1
AAAAGGTGTGTGGTTTCAACCCCA	1
AAAAGGTTGACCTATTTGGGAA	1
AAAAGGTTGTGTGCGTAGAAAAG	1
AAAAGTAGATAATAAGGTGAGTCC	1
AAAAGTAGGGAGATAGTTTGGA	1
AAAAGTAGTACTGCTCATGTGCC	2
AAAAGTAGTTGTGCCTTATATTA	1
AAAAGTATGGGGCAACACGAGTCG	1
AAAAGTATGTAGTGGTGACGGTGA	1
AAAAGTCAACGGCGTCAAACATTC	1
AAAAGTCAACGGTGTCAAACATTTC	1
AAAAGTCAACGGTGTCATATATTTA	4
AAAAGTGAACGGTGTCAAACATTT	1
AAAAGTGAAGAGAGAGATGATGAG	1
AAAAGTGACCTGCGGTCCGACCGT	1
AAAAGTGACGCGATGGTTGTTGGA	1
AAAAGTGACGTGGTGAGATGGAAGT	1
AAAAGTGACTTCGTGCGGTGTCTT	1
AAAAGTGACTTGGGGTGGTCCAAA	1
AAAAGTGAGCCACACCTTAGCTA	1
AAAAGTGAGGGTAAAATTGCAAAC	2
AAAAGTGAGTTGTTTGGGTCCT	1
AAAAGTGCCCGATTGAGATATGGT	1
AAAAGTGCCTGAAAAGTTCAG	1
AAAAGTGCGGCTGACATGTAGGCC	2
AAAAGTGCTTAATGAAATTAG	2
AAAAGTGCTTTGGGACCACTCCCA	2
AAAAGTGGAGCCTATTCAATTTGG	1
AAAAGTGGATGGATGCGGAGATAA	1
AAAAGTGGCTACATTTAGTTTGC	1
AAAAGTGGTCTATATAGATGGGA	3
AAAAGTGGTCTATATAGATGTGAC	1
AAAAGTGTCTTAGGTGGTGTTTGA	3
AAAAGTGTGACATGACTATAGGAC	1
AAAAGTGTGCACGCGGAAAACGAG	1
AAAAGTGTGCCCACTGACATGTGGG	1
AAAAGTGTGGCTGCCACAACTCACG	1
AAAAGTGTTTATACTATGGGATGG	1
AAAAGTTAAAAGTTTTAAGGTGAT	1
AAAAGTTAGAGGTGCTTTCGTCGT	1
AAAAGTTGAGGGATTTTTTGCAAA	1
AAAAGTTGATGGGTGTAAAACGTCC	2
AAAAGTTGCATAACTGTTGTCTCAA	1
AAAAGTTGGAAGTTTATGTGTGTA	2
AAAAGTTGGCAATTTGGCATTTGGC	1
AAAAGTTGTGCAAAAAAGAGTGAA	1
AAAAGTTTATGGTGAGATGCAAAA	1
AAAAGTTTGTCTAAGAAAAAGGTC	2
AAAATAAACCAATCTCGTGTATGC	1
AAAATAAACGTGTACGGTGTGTAT	1
AAAATAACTAATTACACAGATTGC	1
AAAATAACTAATTACGCAGATTGC	1
AAAATAACTAATTGCACAGATTGC	1
AAAATAATGAGGTGGGTGTTCAGC	1
AAAATAATGATTGACGATGTTTAG	2
AAAATAATTTTGGATGAACGTGAC	1
AAAATACCTACGAACGAGAAGATG	1
AAAATACCTACTTGAGAACTGAG	1
AAAATACCTCGAGGTACTGGTACC	1
AAAATACCTCTATTTTTGCAAGCA	1
AAAATACGAGTAGTATTTGGTTGC	1
AAAATACGATGATAAACAGCTAAC	1
AAAATACTAGAGATGGGTGTAGAT	1
AAAATAGAAAAATAATGCGGTGTC	1
AAAATAGAAAAGTAATGCAGTGCC	1
AAAATAGAGAAATGATGGAACATG	4
AAAATAGATGCACAACGGAGATAC	1
AAAATAGGAAAATAATGTGGTGTC	1
AAAATAGGAAGGTAATGCGGTGTC	1
AAAATAGGACGTCCTACAATTGG	1
AAAATAGGGTTGATGTTACTGAC	2
AAAATAGGTGGACGTATTAAGTC	1
AAAATAGGTGGTCTGGTGCATGCA	1
AAAATAGTAAAGTGGAGCACTGATG	1
AAAATAGTAATGGTGATAGATAG	1
AAAATAGTAGGCCTATATTGTTTA	1
AAAATAGTATGGTTGAAAATAGC	1
AAAATAGTTGATGGTGTAAAATGT	1
AAAATATAAAAGATTTTAGGTGG	1
AAAATATAAAAGATTTTGGGTGGA	1
AAAATATAGGGCCTATTCAAATTG	1
AAAATATATATGGTGAAGTGAT	1
AAAATATCAAGGGCTAATTTGTAA	1
AAAATATGGGAATACGTAAGGAGC	1
AAAATATGGGGCCATAAATATAGC	1
AAAATATGGTCCGCCTGCGAAAAT	1
AAAATATGTGGGTGATTTGTTGCA	1
AAAATATGTGTTTATATTGTAGGG	1
AAAATATTTTTTGAAAAGGTGTAT	1
AAAATCAAGAAGATTAGTGCACATG	1
AAAATCAGCATGATGCCTTCTAAG	1
AAAATCATGGTTGCATTTAAATTG	4
AAAATCCATATGCAATGTGTGCCA	1
AAAATCCTACTTTTTTCCTATTCC	1
AAAATCCTATGAAGGCCTTTGAGA	1
AAAATCGATTCGTTGGTGTCATAAC	1
AAAATCGCCGATGGAGCCGATCC	1
AAAATCGGGCGTTGTTTCATCACT	1
AAAATCGGGCTACAAATTTGTA	1
AAAATCGGTGCGAATCAACTCCTT	1
AAAATCTACGAGTGAATATGGTAC	2
AAAATGAACTAGAAGCTAGAAGC	1
AAAATGAATATGCTGATCAGATCA	1
AAAATGAATTTGTAGGTGAAACTTT	1
AAAATGACTTACAGAATTGGTAGC	1
AAAATGAGATGGTATTACGTATGA	1
AAAATGAGCAGTTAATGCTGATGT	1
AAAATGAGCCTATTTTTACAAACG	1
AAAATGAGTGCAGCCGAACAGAGC	2
AAAATGATTGAATGAGATGAATGG	1
AAAATGCCACATAGAATTGGATGA	1
AAAATGCTGACTGGACTGCCACGCGC	1
AAAATGCTTATATTTTAGGATGGA	1
AAAATGGGACCAATCTAGAAATG	1
AAAATGGGCCTTAGAACTGATGTC	1
AAAATGGGGTGTTGTTATCTCCGG	1
AAAATGGTACGGTTAAAAATAGCA	1
AAAATGGTGCTAAATACTCCCTCC	1
AAAATGGTGTATAGGTAAGAATAG	3
AAAATGGTGTCACTTTTAAAATGG	1
AAAATGGTTGTGCCTTATATTATG	1
AAAATGTAAGGTGCAATCATTAAA	1
AAAATGTGCAAACCTAAAAGGGGT	1
AAAATGTGCACCACTATGATGAAT	1
AAAATGTGTAATTGGCCATAGGAC	1
AAAATGTGTAATTGGCCGTAGGA	3
AAAATGTGTCTACATTTGGTTTAT	2
AAAATGTTGAGGAAGCCTTTG	1
AAAATGTTTAGGTGTAACATCGGA	1
AAAATGTTTGCGGGTCCTGTAACA	1
AAAATTAAAAGGAAGTCTGATGGA	1
AAAATTACTAGAGATAGGTGTAGA	1
AAAATTATGGGTCTATTTGAGGA	1
AAAATTATTATGGTAATCGGTGCA	1
AAAATTCAGAGGTACAGAAGGGATT	1
AAAATTCGGGGTTTCAGCAAC	1
AAAATTGAAACGGTGTGATTGAA	1
AAAATTGAAACGGTGTGATTGAAA	1
AAAATTGAAAGTTCATGTGTCT	1
AAAATTGCGTGTGTGATGGAGAA	1
AAAATTGGAACGATATGATGGAAA	1
AAAATTGGACCGACATGTATTGAG	3
AAAATTGGTGTGGCAAATTGAGGC	1
AAAATTTAAATGATGAAGGGTTGT	1
AAAATTTGAAGTGGGTGAGAAGGA	1
AAAATTTGAAGTGGGTGGAAGTGA	2
AAAATTTGCAAGATTTGAGGTAGG	1
AAAATTTGGGTGTCACATTATATC	2
AAAATTTTGGGTGTCACATCGG	1
AAAATTTTGGGTGTCACATTGGA	1
AAAATTTTGTTTTGGGGTGTCAC	1
AAAATTTTTGAGTGTCACATCGAAC	1
AAAATTTTTGGGTGTCACATCAGA	1
AAAATTTTTTGATTTGCGGACCGA	3
AAACAAAATGATGTGCCGGATTGA	3
AAACAAAATGTGGAGCTAGAAGG	1
AAACAAACAAAAGAAGGTGAA	1
AAACAAACAATATCGGTGTTGATC	1
AAACAAACATATGTCCGGATACGC	1
AAACAAACCTAGGATGAGATGTGA	1
AAACAAACCTCGGGAAAGATGTGA	1
AAACAAACTACGTTTATGATGTGA	1
AAACAAAGAGGGCCAAAGAATGGA	2
AAACAAAGAGTGTTAATGGATTGA	2
AAACAAAGGGATGTCCAGATTCA	1
AAACAAAGGTGTCGGTGGCGAA	3
AAACAAATAGGGCCGTTTTGATTTG	1
AAACAAATATTAGACCCCGGTGAC	1
AAACAAATCAATTGGCACTGGTAC	1
AAACAAATGTTAATATTGGGTGTA	1
AAACAACAGATTCAAGCCAATGGT	1
AAACAACCTAGTATAAGATGTGAC	2
AAACAACTGCATGTTTTAAAGGAC	1
AAACAAGATATATACAGGGTTAGC	1
AAACAAGATGGATAATAATGGTA	1
AAACAAGATGGTAACGCAGAGCGG	1
AAACAAGATGGTGGACCTAGATGT	4
AAACAAGCTGTAAGGGTATCGATC	1
AAACAAGGCTAAGATGGGAGCAAG	1
AAACAAGGGCCTAGTGTAGTTGTA	1
AAACAAGGTGGTAATAACGTGCAA	1
AAACAAGTTATTTACAGGGCCCTG	1
AAACAAGTTGGTAGACCTAAACGA	1
AAACAAGTTTAAGGACCTGAACGG	1
AAACAATATAGAAGGAGACGTGAC	1
AAACAATATAGGCCTACTATTTTA	1
AAACAATCGGGTGATACCTCCACG	1
AAACAATGTGTCGACGTTTGAGGT	1
AAACACACAGGTGGAATCGTCCTA	2
AAACACACATCGTGCTGGTGCAA	2
AAACACATGATTTTTGCATGCGGA	1
AAACACATTAAATAAGATGCCCGC	1
AAACACCGCATTGGCTACAGTGAT	1
AAACACCTCCGAAAGACTGGGCCG	1
AAACACCTGGAGATGCTTGCCCCC	2
AAACACGCACTACAAAATTAACG	1
AAACACTACCACTGGTAACCCCTA	2
AAACAGACGCCATTTGATAGGTAC	1
AAACAGACTCTGGTAGCCACTTCC	1
AAACAGAGAACAACCTTTAAGCCA	2
AAACAGAGGATTGCAAAACACAGG	2
AAACAGCGACAAGGCTGAGGGCAG	1
AAACAGCGCGGGGATCAAGCCATG	1
AAACAGGAATGACCGTTTGATTGA	4
AAACAGGCCCTTAGAGAGAGATGG	1
AAACAGGGTTTTGCTGAAATGCCA	1
AAACAGGTGGACCAAATTTACT	1
AAACAGGTGGGCTAATTCATTAGC	2
AAACAGGTGGGCTAATTTGAGGCT	1
AAACAGGTGGGCTAATTTTTGGCT	1
AAACAGGTTTTAGGGGCTTTGAA	1
AAACAGTGAGCTAGTGTTAGCAGC	1
AAACAGTGATGTGTGTTGTCGAAG	1
AAACAGTGCAAGCAAAATGTCAAA	1
AAACAGTGTAAGAACGATTGGGGT	1
AAACAGTGTTACGGGTAAGATGGA	1
AAACAGTTTATGTGTCACATCCTC	1
AAACATACACAGGTGTTGCGGGCA	1
AAACATCCGATGTGACATGGGCTA	1
AAACATCTGCCGAACAATCATGT	1
AAACATGACACGGCTGATGGACA	1
AAACATGACACGGCTGATGGACAC	4
AAACATGACCTTAGATGGATGAGT	1
AAACATGATACGGCTAATGGACAC	2
AAACATGATGAGGACATACACCGC	1
AAACATGCCAATAGTTTGAGT	1
AAACATGCCATTTTTAATCGA	1
AAACATGCCCGAAAGATGGACCGC	1
AAACATGGCCAAAGAATACATCGA	1
AAACATGGCCTAATTTCCCCCGAG	1
AAACATGGGCTAGCCTACTTTAC	2
AAACATGGGCTAGCCTACTTTACC	13
AAACATGGGTTTTGCCACATATGC	1
AAACATGTGAGAAAGTCAACGGC	1
AAACATGTGAGCATGGTATGTGC	1
AAACATGTGCTAAAAAGTCAAC	1
AAACATGTGCTAAAAAGTCAACGG	5
AAACATGTGCTAAAAAGTTAACGG	1
AAACATGTGCTAGAAAGTCAAC	1
AAACATGTGCTAGAAAGTCTAACA	1
AAACATGTGGAGTTAGTTCAGATG	1
AAACATTAAGTTATATAGGGTGAA	1
AAACATTCAATGTGACAGGGTGAA	2
AAACATTCAATGTGACATGGTGTA	1
AAACATTCGATGTGACAAGGTGTA	2
AAACATTCGATGTGACAATTTACT	1
AAACATTCGATGTGACAGGGTGAA	1
AAACATTCGATGTGATAGGGTGAA	2
AAACATTGGGGGCACTAGAACTAG	1
AAACATTGTGAAGGTAGTAAGCAA	1
AAACATTGTGAGTACACTAGGTGA	1
AAACATTGTGAGTATACTAGGTGA	1
AAACATTTGATATGACAGGGTGAA	1
AAACATTTGATGTGACAGGGTGAA	1
AAACATTTTAAAACGGAGGGAGTA	1
AAACCAAACAGAATAGCAACGGA	1
AAACCAAACGGTGGAGTGGTGGT	1
AAACCAAATATATGTCATCCCTC	1
AAACCAACCTAGATTGGATGTGAC	1
AAACCAACCTAGGATATGATGTGA	1
AAACCAACCTAGTATCGGATGTGA	1
AAACCAACTTAGTCTGGATGTGA	1
AAACCAAGTGGCCTGATGTGC	1
AAACCAATATGAAATTTGCTCCTA	1
AAACCAATTTAGTACTAGATGTGA	1
AAACCACAAATGGACCTTCGAGAG	1
AAACCACCGAAGGACCTTGTTTGC	1
AAACCACCGAGGGACCTAGTTTGC	1
AAACCACGAAATCATAGTGTCCTG	3
AAACCACGGGGCAATGACATTCAT	2
AAACCACGGGTGCCGACCGACAAT	1
AAACCACTATGCATGGATACTGCC	2
AAACCACTGAGGGACCTAGTTTGC	1
AAACCACTGAGGGAGTCAAATTGC	1
AAACCACTGTAGATTGAACCGATG	1
AAACCACTTAAAGGGTGTGTCTGA	1
AAACCAGCCTCCTCACACCAAG	1
AAACCAGCTAACAGGTCCTGGGAA	1
AAACCAGGGTTTGTCTTTTTTGGG	2
AAACCAGTGAATCGTGTGCCTTA	1
AAACCAGTGCAAACGAGGTCCCTCG	1
AAACCAGTTGTCTGATTGATGTAA	1
AAACCATATCGTTCCTACTTAGCC	1
AAACCATGTATAGTGTCTTGGGTTG	1
AAACCATGTGTGCCTGGCGTGTCC	1
AAACCCACCGTTGGACTCGATGGA	1
AAACCCACGTGAGAGGTTGTAAGC	1
AAACCCAGTGGACCGCGGGTGTGA	1
AAACCCATTTAGTTGACATGCAAC	1
AAACCGATGAGTATTAGCTGGTAC	1
AAACCGATGTAGGGCACGCCTCTC	1
AAACCGCCACTTAAAACCACTGAG	1
AAACCGCGCCTGCAAAAATGGTAC	1
AAACCGCTCTGGTTTGGGTCGAAG	1
AAACCGCTGAGGGATCACGTTTGC	2
AAACCGGCCAAGATGGAGGATGA	1
AAACCGGGACTACCAATCCAGGAC	2
AAACCGGGCACTACGGTGAGACGTG	1
AAACCGGGCCCAAAAAACATACA	1
AAACCGGTGCAAATCAACTACCAG	1
AAACCGGTTGCTAACATCAAA	1
AAACCGTCAAGGGACCTAATCTGC	1
AAACCGTGGGAGCTGAAGCTGGCG	1
AAACCGTGTCGCTGTCTTAAAC	5
AAACCGTTTATTTTAAAAGGTAG	1
AAACCTAAATGGCGTACACAGAGA	1
AAACCTAAGAGGGGCATTTGGATA	2
AAACCTACAAATAAACCCATGCGC	2
AAACCTAGTCCATGGTGCTGGCTC	2
AAACCTGCCTTCCCGAGTAAGGAA	2
AAACCTGCTACGTGCCACTGAACT	1
AAACCTGGTGAAACACAAATCGAA	1
AAACCTGGTTGCGTGATGCAAGAA	1
AAACCTGTTGGTTATAAGGTCCAC	1
AAACCTTAGGGCCTGTTTGGTAGA	1
AAACGAAAACATTGGTATGGTCT	1
AAACGAAAACCCTACAAAATCAAT	1
AAACGAAAGCTGTGCCTAATGACT	2
AAACGAAAGGAGCCTAAGCGATAA	1
AAACGAACGGTACAGCCGTACAGA	1
AAACGAACGGTCAAACATGTGCTA	2
AAACGAACGGTCAAACATGTGCTAA	1
AAACGAAGATAGGTGTCGGTTTTA	1
AAACGAAGCTGAGAAACCTAGTTT	2
AAACGAATAATGAAAGGTGATACC	2
AAACGAATCTAAAACTGGATGTGA	1
AAACGAATCTAGTACCGGATGTGA	1
AAACGAATGGACTGTCATGGTTGG	1
AAACGAATGGTGGATGATTGTGAT	1
AAACGAATGTGTCACATCCAGTAC	1
AAACGACAAGGACTACTCGGA	1
AAACGACATGTTGCCAGGTTCAC	1
AAACGACTGAGGGTCTACACCAAT	1
AAACGACTTGTGCCCAAAAAACGA	1
AAACGAGACACGGCTGATGGACAC	1
AAACGAGACGGATGAAGTACGTA	1
AAACGAGATGGTAGTAGCGTGTG	1
AAACGAGGCAATGCATTAGAGAGC	3
AAACGAGGTAGTATTAACGTATGA	1
AAACGAGGTGAGCCATTAACACATGA	1
AAACGAGGTGAGCCATTAACATAT	1
AAACGAGGTGAGCCATTAACGCAA	1
AAACGAGGTGAGCCATTAGCACAT	1
AAACGAGGTGAGCCATTAGCATA	1
AAACGAGGTGAGCCATTAGCGCA	1
AAACGAGGTGAGCCATTAGCGTAT	1
AAACGAGGTGAGCCATTAGTACA	1
AAACGAGGTGAGCCATTAGTACAT	3
AAACGAGGTGAGCCATTAGTGCAT	1
AAACGAGGTGAGCTATTAGTGCAT	1
AAACGAGGTGGTAATAACGTGTGA	1
AAACGAGTGGTGTCGAAAAGTCAA	1
AAACGAGTGGTTGCCGTGAAGTGT	1
AAACGAGTTGCCTGTAAAATAGCG	1
AAACGATAGTCCAACGTTGTGCGA	1
AAACGATATGATGGAAAAGTTGAA	1
AAACGATATGGTTAGAAACAATA	2
AAACGATATTAGGAGATTACTTAC	1
AAACGATGCCTCAAGGGATGTTGC	1
AAACGATGTGATGGAAAAGTTGA	1
AAACGATGTGATGGAAAAGTTGAA	3
AAACGATGTGATGGAAAAGTTGTA	1
AAACGATTACAGCTCTACTTCTAC	1
AAACGATTGCGACTGGATTTGAAAT	1
AAACGATTTAGTATCGTGAGGTAC	1
AAACGATTTGATATCGTGAGGTAC	2
AAACGCAACGTAGTATAGATGTGA	1
AAACGCAGGGGATACATTGGGCTA	1
AAACGCATGGTGCAGTAACGTTTG	1
AAACGCCTCACTGTCGATGGATA	1
AAACGCCTCACTGTCGATGGATAC	3
AAACGCCTTGTGGTGATATGGAGTC	1
AAACGCGATAGAGTGGCACGGTTC	1
AAACGCTAAGTGTCAGTGTGTGGT	1
AAACGCTCCTAGACCACCACGTGG	1
AAACGCTCTCAAACCGCCACGTGG	1
AAACGCTCTCAAGCCGCCACGTGG	1
AAACGCTCTCGAGTCGCCAAGTGG	1
AAACGCTGAGTGGATACGTGGGTC	1
AAACGCTGGGCTGCGGAGATGGCA	1
AAACGCTGTACCTAGAGGATAG	3
AAACGGAAAAGTTTAGGCCTAGAC	1
AAACGGACGAAGCAGGTATGGGTA	3
AAACGGACGATCAAAGTTAGGCGC	1
AAACGGACGGTTAAAGTTGGGTGT	1
AAACGGAGCACCCCAAATGATGG	1
AAACGGATCCGTAACTTCGGGAAA	1
AAACGGCCTATCGGATAATCCGCA	1
AAACGGCTAAATGGTGCGTTTCGT	1
AAACGGGGTCTAAACTGAAGATGG	1
AAACGGGTTCTAGCCGTATGGGAA	1
AAACGGTGCCTTTGTTTCGGGTAA	1
AAACGGTGCGTTTCGTGCGAAAAC	1
AAACGGTGTCAAACATTTCGAAACG	1
AAACGGTGTGTGTATATTTTTCCT	1
AAACGGTGTGTTTCGTATGAAAAC	1
AAACGTAATACGGCTGATGGACAC	1
AAACGTAGGAATTAGAGGAGTGAC	1
AAACGTATAAAGGCCTTAGGCAAG	1
AAACGTCCAATGTGCCACCAAAAA	1
AAACGTCCGATATGACACCCA	1
AAACGTCCGATGTAACACCCAAAA	1
AAACGTCGGACACGGTTCCCCACGA	1
AAACGTCTCGCTTTCAAGGGTATGT	1
AAACGTGACACAGCTGATGGACAC	4
AAACGTGACACGGCTGATGGACA	1
AAACGTGACACGGCTGATGGACAC	2
AAACGTGACACGGGTGATGGACA	1
AAACGTGACACGGGTGATGGACAC	1
AAACGTGACACTGTCGATGGATAC	1
AAACGTGACAGCGATGGTATGGT	2
AAACGTGACATAGCTGATGGACAC	7
AAACGTGACATGGTCCATGGGCCT	1
AAACGTGAGACGGTTGATGGACAC	1
AAACGTGAGCCAACAGTTGATTGT	1
AAACGTGATACGGCTGATGGACA	2
AAACGTGATACGGCTGATGGACAC	7
AAACGTGATAGGGCTGATGGATAC	1
AAACGTGGTGTCTCCTTTCAAGGC	1
AAACGTGGTGTCTTCTTTTAAGGC	1
AAACGTGTATTGATGACTGATGAT	1
AAACGTGTGCTAAAAAATTAATGG	1
AAACGTTCCATGTGACATGGTGTA	1
AAACGTTCGATATGACAGGGTGAA	1
AAACGTTCGATATGATATGGTGAA	1
AAACGTTCGATGTGACAGGGTGTA	1
AAACGTTCGATGTGACATGGTGTA	1
AAACGTTCGATGTGAGAAGGTGAA	1
AAACGTTCGATGTGATAGGGTGTA	1
AAACGTTGCAAGCAAAAACTCAAA	1
AAACGTTGTAAGGGTGATAGGTAT	1
AAACGTTTAATATGATAGGGTGTA	1
AAACGTTTATGTGAGAGGGTGTAAA	1
AAACGTTTGATGTGACAGGGTGTA	1
AAACGTTTGATGTGACATGGTGAA	1
AAACGTTTGATGTGAGAGGGTGTA	1
AAACGTTTGCATAGGTGCGATTCC	1
AAACTAAAATGTTTAGGGTGTTAC	1
AAACTAAAGTTTAGTCACTGGATC	1
AAACTAAATGGTGAGTGGATAGG	1
AAACTAACACTTCAGTGGATGCCT	1
AAACTAACTTGATATTTTGGATGC	1
AAACTAAGAGTAGAGTTAGGTGCA	1
AAACTAAGATGAAGAAAGGAGCCA	1
AAACTAAGGGGTGTTCACCGAAATA	1
AAACTAAGGGTAGAGTGATACACA	1
AAACTAAGGTTGGAAATGGTAGCG	1
AAACTAATATAGGTGTCTAAGTTT	2
AAACTACAAAATTAGGATCCTGC	2
AAACTACACAGGCATATTGGT	1
AAACTACAGGTGTAGAGCTGGGTT	1
AAACTACTAGCAGGATAAGGGAC	2
AAACTAGAAGTAGAGTTAGGTGGA	1
AAACTAGAGATATGACCCAACTGC	1
AAACTAGATAGAGTTACAGTCCC	1
AAACTAGCATGGTGGCCTGTACAG	2
AAACTAGCTGTTGGAGGCCAAGAC	1
AAACTAGGAGTGGAGTTGGGTGGA	1
AAACTAGGTCGTTTTGACGTGATG	1
AAACTAGGTTGCTATATTATGGGA	1
AAACTAGTAGCAAACTGTGAA	1
AAACTAGTCAGAGTGAACCGGTGA	1
AAACTAGTTGGGTGGCCCGCGC	1
AAACTATGATATGCAAGATATGGT	1
AAACTATGGTACCGGATGTCTGA	1
AAACTCAACTGGAGAGACGGTACC	1
AAACTCAATTGTTGCGTGTGGATG	1
AAACTCATGGTTGCGCTTAAAATG	1
AAACTCGAGTACTGGAATTATCGC	1
AAACTCGCCTTCGGATGTGTGAGC	1
AAACTCGTGGCCTTGGAGTATCTA	1
AAACTCTAAGTTTCCGTGTCCAA	1
AAACTCTGACGGTGCACCCACAG	1
AAACTCTGTGAAAGAGACAGGTGG	1
AAACTGAATGCTGAGATGGATGA	1
AAACTGCCAAACGGTGTGTTTCGT	1
AAACTGCCCAGATGTGATGGTTTC	1
AAACTGCCTTTTAAAGTGATCGTCA	1
AAACTGCGGTTGTTCAACAGGTGA	1
AAACTGCTAAGGGAGGTAAGTTGC	1
AAACTGCTATGTAGGACGAAAGT	1
AAACTGGCAGTGGAGTTGGGTGG	1
AAACTGGGAGTGGAGCTGGGTGGA	1
AAACTGGGAGTGGAGTTGGGTGG	1
AAACTGGGAGTGGAGTTGGGTGGA	3
AAACTGTAAGTGGAGCTGGGTGGA	1
AAACTGTCGACGACGGATGTGCGC	1
AAACTGTGGAATCACTAAAGTGTG	1
AAACTGTGTCGAAGTCTAAAATGC	1
AAACTGTTCAGACTGCCGATGGTAC	1
AAACTGTTGAACTACGAAACTAAT	1
AAACTGTTTAAGGAGCTTTTGACA	1
AAACTGTTTTAAACACTGGGTGTA	1
AAACTTAATGGGATAAATAAAGC	2
AAACTTAGTGTGCCGATAAGTAGT	1
AAACTTCATATATTCTGGGACAGA	1
AAACTTGAGGTGTACAAACTTTAG	4
AAACTTGAGGTGTACAACTATAGA	2
AAACTTGAGGTGTACGAACTATAG	2
AAACTTGAGGTGTATAAACTTTAG	2
AAACTTGAGGTGTATAAATTTTAG	2
AAACTTGATAGTGTCTAGTGCATA	1
AAACTTGATGGTGAGGCCACACAT	1
AAACTTGGTAAGATTGAAAATGAT	1
AAACTTGTAATTGGCTGAGAGTCA	1
AAACTTGTAGGGTTGTGTCATATA	1
AAACTTGTGTATTGATTAGTTCAA	2
AAACTTTAAATGTGTAAAAGGTGTA	1
AAACTTTGTGTCTACAAACTTTAG	1
AAACTTTTGGGTGAACTGGTCGAT	1
AAAGAAAACTTTTGGGTGTCATATC	1
AAAGAAAAGATGTTGGATGGTCTC	1
AAAGAAAATAAAAAAGACGTGCC	1
AAAGAAAATAGATAACAGGATGAC	1
AAAGAAAATGTTTGGGTGTCACA	1
AAAGAAAATTTTTAGGTGTCATGT	1
AAAGAAAATTTTTGGGTGTCACATC	1
AAAGAAACATAAACTGGTTGTGCA	1
AAAGAAACCGAGGTGCTGGAGCAG	1
AAAGAAAGAGTGGCAAGGTGCA	1
AAAGAAAGGTAGGCTGAGTGGAGG	1
AAAGAAATAGCAGGGGGTCTAAAC	2
AAAGAAATAGGGCATATCGACTGC	2
AAAGAAATCAACGCCTAGGACAAT	1
AAAGAAATTGAAACGATGTGATGA	1
AAAGAAATTGAAACGATGTGATGG	6
AAAGAAATTGGAACTATGTGATGAA	1
AAAGAAATTTCAATGGTGTATTTG	1
AAAGAAATTTCTGGATGAGTTAC	1
AAAGAACAAAGAAAGGTGTTTGCA	1
AAAGAACAATGAACAGGGAGAGAGA	1
AAAGAACACTGTGCCATTTCAGAC	1
AAAGAACATGTGTGCTTAACTCTT	1
AAAGAACCCCTCCCAACAAGTGCA	1
AAAGAACCTGATGATTAGATGCA	1
AAAGAACGAGGTAGCAGTTGACTG	1
AAAGAACGATAAAACCTACTCCT	1
AAAGAACTAGAGAATGGTGCGAGG	1
AAAGAACTCCAGGGTTAAGCGTGC	1
AAAGAACTCTAGGGTTAAGCGTGC	1
AAAGAACTTCAGGGTTAAGCGTGC	1
AAAGAACTTTAACGTTAAGTGTGC	1
AAAGAAGAAGAACAGACTTGGTGT	1
AAAGAAGGCACCACGTTGGGGTT	1
AAAGAAGGGGCCAAATGAGATCGA	1
AAAGAAGGTACAACGTTTGTAGGC	1
AAAGAAGGTAGTTTTGTATGGATA	1
AAAGAAGGTGATGCTAACACAAGG	1
AAAGAAGGTGCTATACAAATTAGG	1
AAAGAATAGCAGGATCGGAGGCCA	1
AAAGAATCTTAGTATACGATATGA	2
AAAGAATGGGGTATATGGATGTGA	1
AAAGACATATTTAGGGTCCTAGAA	1
AAAGACCGGTTGCTTGGTTGAAAC	1
AAAGACGAATGGTCAAATATGTGAG	1
AAAGACGATTGAATCGAGGGTGGT	1
AAAGACGCAAAAGTCGGGTGGCGA	1
AAAGACGGATTCAGCGTGGGTGCTA	1
AAAGACGGATTTAGCCTGCCTGAA	1
AAAGACGGCCTATTCTACAGTGCA	1
AAAGACGTCATCTCCTAAGGTCC	1
AAAGACTAGTCTGATGGGTGAGGA	1
AAAGACTAGTCTGATGGTACGTAC	1
AAAGAGAAAACTACCAGATGGGAC	1
AAAGAGAAAAGGCAAGGCTGGGAA	1
AAAGAGAAATCACCCTCGGTGCA	1
AAAGAGAAATTTATAGGTGTCAC	1
AAAGAGACCGAGCGTAAGGAATGCA	1
AAAGAGAGAAGAGTAGCGGGCTA	1
AAAGAGAGAATTTTGGTGCAAAGC	4
AAAGAGAGGAGAACAGCGGGATACA	3
AAAGAGAGTAGTGCTGGTGGTGGT	1
AAAGAGATAGCGCTGTTACACAA	1
AAAGAGATAGGTGTCGGTTTTGAT	1
AAAGAGCAATCCGGGCATTTAGAT	1
AAAGAGCCTGCCTATTCGTAATCC	1
AAAGAGCCTGTAACCTAGTGATTA	1
AAAGAGCGGACTATACCTAGGTAC	1
AAAGAGCTAAACTGGGTGCAC	1
AAAGAGCTAGAAGTTTGTGTGTAG	1
AAAGAGCTATCCACGGGTTTTCAC	1
AAAGAGGAGCAGAAATAGGTGGG	1
AAAGAGGATAGATAATAGCAACGG	1
AAAGAGGATGCTCGTACATGAAAC	1
AAAGAGGGAAGGCTGCACATGTAG	2
AAAGAGGGTACCTGAGCAGATAG	1
AAAGAGGGTGCAAGAATATCGGTCT	1
AAAGAGGTCAGCAATGGCATGTGC	1
AAAGAGGTGCACTTTTAAAGTAGT	2
AAAGAGGTGGAAAGCATTTATTTG	2
AAAGAGGTGTATGTCTAATAGCAA	1
AAAGAGGTGTTAGGCAAGTAGA	1
AAAGAGGTGTTAGGCAAGTAGATC	1
AAAGAGGTGTTTTCAACAGAGTAG	1
AAAGAGTGAATGCAAGCATACAAC	1
AAAGAGTGGCTACATTTAGGTTGC	1
AAAGAGTGTAATAGTTCATGTGAC	1
AAAGAGTGTCCACAAAGCAAACGC	1
AAAGATAAATGTCTACACAACCA	1
AAAGATAACTCGTACAAGTGGTCC	1
AAAGATACCTACTATATTTAGTCC	1
AAAGATACGCAAAACGAGGTGAGCC	1
AAAGATAGAATTCTACTCGGGTAC	1
AAAGATAGAGGGTGACGTGGAC	1
AAAGATAGGATACAAAAGGAAAGC	1
AAAGATAGGTGACCTATGAATTTG	1
AAAGATATCGGGGGGCCTGACAAG	1
AAAGATATTCTATCTACATATGGT	1
AAAGATCATAATCTTTCGGTGTCC	1
AAAGATCGCTGGTGACTCCAATCA	2
AAAGATGAAATGTGCCCTTTGAT	1
AAAGATGACCACAAATTAGAGAGG	1
AAAGATGAGGCCTCTTATTTTGGG	1
AAAGATGAGGGTTTGGGCCCGTCA	1
AAAGATGAGTGCATTGTAGAGAGG	1
AAAGATGATCTCGATCTGGTGCAA	1
AAAGATGATCTGTAATCCTGGTTC	1
AAAGATGATTTTTAGTGCCGGTTC	1
AAAGATGCATGAGCCATGTGCTCG	1
AAAGATGCCAAGTGGCAGTCTA	1
AAAGATGCCTTTTGATGGGTGGGA	2
AAAGATGCTAAGGAAGGCGATGGA	1
AAAGATGCTGCTACAACTCGGTAC	1
AAAGATGCTTTACTCTCGGTTGGT	1
AAAGATGGCCCTATGAGAGGATGG	3
AAAGATGGGGTAGAAGAAAGGGAC	1
AAAGATGGGTGTATGACATGTGG	1
AAAGATGGTGTCTGCCCTTGTGCC	1
AAAGATGGTTTCTCCACCAGTGTC	3
AAAGATGGTTTCTCCAGTAGTGTG	1
AAAGATGTACACAAAGTGAGAAGC	1
AAAGATGTCTTTTGGTGGGTGGGA	2
AAAGATGTGGCTTGTAAACTG	4
AAAGATTACTGTTGTGCTGACGAA	1
AAAGATTGGTGACACGATGTGTA	1
AAAGATTTAGGAGGTGTCCAATAA	1
AAAGATTTGGTAGCAAAAGATTTG	1
AAAGCAAAAAGGTGACGATGCGCC	1
AAAGCAAAGCAGACGTTTAGAATG	1
AAAGCAAAGCCAAATTTTAAAAT	1
AAAGCAATAGGTGAAGACTCACGA	1
AAAGCAATTCGAGAGGTTTAAGCG	1
AAAGCACCTGGCCCTGATGGTTTT	1
AAAGCAGACGGGTGGAGCTACACC	1
AAAGCAGAGATGAATCGGATGTAA	1
AAAGCAGCAGTTTGCTCAGGTCC	4
AAAGCATACATCGGGTACGTACCA	1
AAAGCATGGGACGAATCTTTTGAG	1
AAAGCATGTACATCTCAGGAATA	1
AAAGCATTGCTATTGTGGTACC	1
AAAGCCAAAAGCATAACAAGGTCC	2
AAAGCCAAATATTTGGAAATGCCT	1
AAAGCCAACCTTAGTATGGATGGA	2
AAAGCCAACGGTGTCAAACATTTA	1
AAAGCCACCTAAGGACCTTGTGCG	2
AAAGCCAGAGGTCTCGAGTTCGAA	1
AAAGCCATACGATAATCATTGAA	1
AAAGCCATATGGCATGGTGTCCAC	1
AAAGCCATCGACAAGATACGACGC	1
AAAGCCCATCTCATGTGATGTCAT	2
AAAGCCCGATTGGTGATATCAACC	1
AAAGCCCGTCACAGATGACCTCAT	1
AAAGCCCGTCACCGATAGCTTTGA	1
AAAGCCGACGGTGACGATGGTGAA	1
AAAGCCGATGGCCCTCCTGTAA	3
AAAGCCGATTGAGATGTGTCATCCG	1
AAAGCCGCTGACGATTTGGTGGGA	1
AAAGCCGGCGACTTGTGAGGTTGG	2
AAAGCCGGTGACTCTCTTAGGAGG	1
AAAGCCGTTGACGGTTTGGTGGGA	1
AAAGCCTAAACCCTAATGGGGGAA	1
AAAGCCTAAATCATAGAGAGTGAT	1
AAAGCCTAATGGACGATCGATCGC	1
AAAGCCTAGAATAGTCCTTGGGTCC	1
AAAGCCTCGTTATCCTAGTAGTAC	1
AAAGCCTGGGTCTGGACTGCCCCG	1
AAAGCGAATGGTCAAACGTTACAA	1
AAAGCGAATGTAGAGCGGGTGTGGA	1
AAAGCGATATAGGGAAGCCTCACGC	1
AAAGCGCCACGTGATATTCTACAA	1
AAAGCGCGGGGTATCATTATCTTA	1
AAAGCGGAAGCCAGGACTTGGACC	1
AAAGCGGTGGTAGAGCTCGGGTTC	2
AAAGCGGTTTTGTCCTACGTAGCG	1
AAAGCGGTTTTTGTCCTATGTGG	6
AAAGCGTACGTGCGGAATGCGATC	1
AAAGCGTATGATGATGCTCAG	1
AAAGCGTGCACATGGTACACGAAG	1
AAAGCGTGCACGTGAAAAACGAGG	2
AAAGCTACATCAAGAGGTGAGTGA	1
AAAGCTACTAATGGCTCTGGGTTC	1
AAAGCTATGTTAAGAATTTCGTT	1
AAAGCTCAAGCAGGTGTGAGAGAG	1
AAAGCTCGCCTTCGAATGTATGAG	1
AAAGCTGAATGATGAGGTGGATGA	1
AAAGCTGCAGTTGGGACAATCTCC	1
AAAGCTGGATGGATACCTTTTGAC	1
AAAGCTGGTGTGTCTACGTGCCAA	1
AAAGCTGGTTGTCTGCCAAGTACA	1
AAAGCTGTAGTTGTAGAATCCAGA	1
AAAGCTGTGCAGAAACTTACTTGC	1
AAAGCTTGCACACGAAATGAGAGA	1
AAAGCTTGTGGCCTTTGCTGTGA	1
AAAGCTTTCATGTATGTGCGATGG	3
AAAGGAAACCAGGTGGAGGAAGT	1
AAAGGAAAGAATGGTACTAAAAAA	1
AAAGGAAAGAGATGTCGGTGCTG	2
AAAGGAAATTTTTGGGTGTCACA	1
AAAGGAAATTTTTGGGTGTCACAT	1
AAAGGAACATATGTGCCGGGCCT	1
AAAGGAACTACAATCAAGATCGCC	1
AAAGGAAGACGTTTAGGACAATGT	1
AAAGGAAGAGACTACTACGGTGAC	1
AAAGGAAGGAGAGGTGTTGGGAA	1
AAAGGAAGGCCTACAAGAATTGAA	2
AAAGGAATAGTTGCGATTGAAGTG	1
AAAGGAATTGACGGAAGGGCACCAC	1
AAAGGAATTTTTGCAGGCAGGTAGC	1
AAAGGACCCAAGTGCAAAATGCGC	1
AAAGGACCTGCATATAAGATACAT	1
AAAGGACCTTCGGTACTGATATGC	1
AAAGGACGGCTCACCAGAAAGGGA	1
AAAGGACTAGATGGTGATTCAGAT	1
AAAGGACTGACCTAAGATGGCACC	1
AAAGGAGAGGGCTACGACGGCCAT	1
AAAGGAGAGTCACATATGGTGGGA	1
AAAGGAGATGTCTGAACAAACAGA	1
AAAGGAGCCAATTGTGGTCTTGT	1
AAAGGAGCCAATTGTGGTCTTGTA	7
AAAGGAGCCACCATGTTTATCGG	1
AAAGGAGCCACGTAGACGCCACG	1
AAAGGAGCCACGTAGGCGCCACAT	1
AAAGGAGGACCTTGCCCACCGAAG	1
AAAGGAGGTACCACGTTCACTGTA	2
AAAGGAGGTAGTATACGATGTA	1
AAAGGAGTGATTGAAAAAGGTGTA	2
AAAGGATAAGTAAATGCTGATGGA	1
AAAGGATGACTTATGAGAGATTGA	1
AAAGGATGTAATGTCCATGCGAGC	2
AAAGGATTATCTGTCTATATAAAA	2
AAAGGATTTGTCTCACAATTTACA	1
AAAGGATTTTAGATGGATAGGACAA	1
AAAGGCAAACGCAAAAGGAAGGCA	1
AAAGGCAACCTAGAAGAGGATGTG	1
AAAGGCAACTTTGCAAGATTGAAC	1
AAAGGCCGCAATCTTTTGATGTC	1
AAAGGCCTGTTCACCTTGATGCCA	1
AAAGGCGAGGCGATGACGGTTC	1
AAAGGCGGCGACCAGATGTGTTAC	1
AAAGGCTAGAAATAATTAGGGTGA	1
AAAGGCTAGGTTGGCATATCTTGA	1
AAAGGCTGACTGTGCAGGCCCGAT	1
AAAGGCTGCATATATCCGGTTGGA	1
AAAGGCTGCATGCCGCAGGTTGGA	1
AAAGGCTTTAGGTGTTGCAGAGTG	1
AAAGGGAGGCCAGAAGTTATGCAT	1
AAAGGGAGTACTACTTGTAGC	1
AAAGGGATCCTCTGACTTAACTGC	1
AAAGGGCATGAAGCCTAGTGGTTGC	1
AAAGGGCCCACAACACACACACGC	1
AAAGGGCCTAAATAAGATGAACTA	2
AAAGGGCTTATTCGGAATGTAGGG	1
AAAGGGGATCTAGCCGATTAGGAC	1
AAAGGGGGCCTTAATAGCATTAA	1
AAAGGGGTAGCGCGTTAGATCTAA	1
AAAGGGGTGACCGTGGATCGGATC	1
AAAGGGGTTTAAACAAAGATATGGT	1
AAAGGGGTTTACTGATTGAATGGG	1
AAAGGGTAGTAGTGAGGGTTC	2
AAAGGGTCCTGAGTTCAAATCTC	1
AAAGGGTCTACTGCATGGGCAAGG	1
AAAGGGTGAATAGCCAAAGTGGTC	1
AAAGGGTGAATAGCTAAAATGGTC	1
AAAGGGTGAGACTTCGAACACTGG	1
AAAGGGTGAGCTATTTAAGGGCT	1
AAAGGGTGGATACGGGTGAAGGA	1
AAAGGGTGGTCCACTATATAATT	1
AAAGGGTGTAGCTATGTTTATGGC	1
AAAGGGTGTATTACCAACGGGACT	2
AAAGGGTGTCACAGTGATGTTGCT	1
AAAGGGTGTCCAGCTTCATTAGAC	2
AAAGGGTGTCCAGGATGATGCGGCC	1
AAAGGGTGTCGGGCTTGAAACCGG	1
AAAGGGTGTGTCTGAGAAGAAGGG	1
AAAGGGTGTTATGCAATTGAATTG	1
AAAGGGTGTTCTGACATGAATGA	1
AAAGGTAAGGTTGAAAATGGTAG	1
AAAGGTACGGTGCTAGATAATCCT	1
AAAGGTACTTACCAGTAAGGTGTG	2
AAAGGTAGGACAGGTGGTCAGAGA	1
AAAGGTAGTACTGGTGATAGGTAGG	1
AAAGGTATGGTATAGACTATGAAG	1
AAAGGTATTTTGGGTGAACGTGAC	1
AAAGGTCCCTAAATAGCTAGAGGT	1
AAAGGTCTTTTGCTTACGGCCAGC	1
AAAGGTGACAACTGACAAAGTAAG	2
AAAGGTGACCCTCATCACTGATCA	2
AAAGGTGACCGGTCTGTGACTGGT	1
AAAGGTGACCTTAAGGTAATGATT	1
AAAGGTGACGGAGCATATGTCTA	1
AAAGGTGACGTACGAAAGTTTCTG	1
AAAGGTGACTTATCGGCTTTGTG	1
AAAGGTGAGATCATCTGTGATGAA	1
AAAGGTGAGGGTAAAACTACAAAC	1
AAAGGTGATACGTTTTGGAAAGA	1
AAAGGTGATGGCTAAACATTAGCC	1
AAAGGTGATGGCTTATCTGGTATA	1
AAAGGTGCACACTTTCCATGTGAG	1
AAAGGTGCATATGTTCTACATTAG	1
AAAGGTGGAGCTGTGTTTAGGTT	1
AAAGGTGGGCTAGGTAGATCGTGTT	2
AAAGGTGGGGGCTAATAATTAGCC	1
AAAGGTGTCGGTTCTTAAACCGG	1
AAAGGTGTCGGTTTTGAATACAGA	1
AAAGGTGTCGGTTTTTACTGAA	1
AAAGGTGTCGGTTTTTACTGAAAA	2
AAAGGTGTGCCATGTGGGATGAC	1
AAAGGTGTGCGACATCAGTTCCGC	1
AAAGGTGTGTGTATGACAGGTTGA	2
AAAGGTGTGTGTTGATATTTCTTA	1
AAAGGTGTGTTGATGGAACTCTC	1
AAAGGTGTTTTCGGATACGAATGA	2
AAAGGTGTTTTGATTATTATTCT	1
AAAGGTGTTTTTGATTATTATTCT	2
AAAGGTTCAGTCCTAGGTTGTTTA	1
AAAGGTTCCGAACCAATGGGTATA	1
AAAGGTTGCATGTCGCAAGTTGG	1
AAAGGTTGCCAAAAACAAAGTTG	1
AAAGTAAAAAGGGTGGCGATGCAC	2
AAAGTAAGGTGCTATCTATAAAAA	1
AAAGTAATACGGTGCTTAAAAGAA	1
AAAGTACCTCGAAGTATCCGTACC	2
AAAGTACGGTGTCTTTGAAAGCAG	1
AAAGTAGACTACACTGTTTGCCCC	1
AAAGTAGATGAAACAGACGGTACC	1
AAAGTAGATGGAGAGTATGGACGA	2
AAAGTAGCAACATTTTCAACTCA	1
AAAGTAGGGTCTACATATCAGTGA	1
AAAGTAGGGTCTACATGTCAGTGG	1
AAAGTAGGTAGAAGTGAATGATGG	1
AAAGTAGGTCCCTGTCGAACGGGT	1
AAAGTAGGTGAGAATAATTGAAGA	1
AAAGTAGTGCGCGTGGAAAACGAG	3
AAAGTAGTTGTGCCTTGTACTAAA	1
AAAGTATCTCGAGGAACTGTCGCT	1
AAAGTATCTCGAGGTACCGGTACC	2
AAAGTATGAAGATGATGGAGAGCT	1
AAAGTATGTACGCCATTACAAAGT	1
AAAGTATTTTAGGTGGATGGGACG	2
AAAGTCAAAGGTGTCGTGCATTAA	1
AAAGTCAAAGTCAACGGTGTCAA	1
AAAGTCAACGACGCCATACATTCA	3
AAAGTCAACGGTGTCATATATT	1
AAAGTCAACGGTGTCATATATTT	7
AAAGTCAACGGTGTCATATATTTA	34
AAAGTCAACGGTGTCATCTATTA	1
AAAGTCAACGGTGTCATCTATTAA	2
AAAGTCAACGGTGTCATCTATTTA	1
AAAGTCAATGGTGTCATGAAACGGA	1
AAAGTCAGCTGCAAATATATTTGA	1
AAAGTCCCGATACAGTATAGATGC	2
AAAGTCGACACGATTGTTCTCGAA	1
AAAGTCGATGGTATATTGTAGAAC	1
AAAGTCGTTGGTGTCGAAAGCAT	1
AAAGTCTAATGCAGGAGTTGATCA	1
AAAGTCTATGACATATGGGTCCAC	1
AAAGTGAACGGTGTCAAATATTTT	1
AAAGTGAACGGTGTCATATATTAA	1
AAAGTGAATAGACCCGACGATTTC	1
AAAGTGAATCCTCTAACGTCGTGC	1
AAAGTGAATGGTGCATGGTTGT	1
AAAGTGAATGGTGGAGGATTATGA	1
AAAGTGAATGGTGGAGGGTTGAG	1
AAAGTGAATGGTGGAGGGTTGTGA	1
AAAGTGACCTATGCAAGTGCTACC	1
AAAGTGACTACATTTAGTTTGTTGC	1
AAAGTGACTTAAAGTGGAGGGAC	1
AAAGTGAGATAAGGGCCATACTAG	1
AAAGTGAGGGCAGAATCGTCTAGT	1
AAAGTGATGTTGAGGTTTTGAA	1
AAAGTGCAAATGATGGTAACTATA	1
AAAGTGCAAGCCCATGTATAACGA	1
AAAGTGCACGAGCCTCATTTCAAG	1
AAAGTGCACTAGGAAATTTTGTTC	1
AAAGTGCAGAAGATCTTAGTCTTC	1
AAAGTGCAGTTGTGAGTTTCCATA	1
AAAGTGCATTGGTGGTCCTTAAACT	1
AAAGTGCCAACAAGAAAACCAATG	2
AAAGTGCTATATAACTTGGTGGTA	1
AAAGTGCTCGAAGGAATATGATGG	1
AAAGTGCTTAGTTAAGAAACTATG	1
AAAGTGCTTCCACAGCTGGTC	1
AAAGTGCTTGACAACTAAGAGTTG	2
AAAGTGCTTTGGGACCGCTCCCT	2
AAAGTGCTTTGGGACTACTCCCT	1
AAAGTGGACCAAAATTACGTAATA	1
AAAGTGGAGTTGTGGAGCTGTGGA	1
AAAGTGGATGGATACGGAGACAAG	1
AAAGTGGATGGATGCGGAGACAAA	3
AAAGTGGATGTTTTTAGGAGC	1
AAAGTGGCTTGCAATATGGTAGAG	1
AAAGTGGGGGGCCAAACCGTCCTC	1
AAAGTGGGTTTCACTGGAATGCCA	1
AAAGTGGTGCTAAAATTTTGGTAA	2
AAAGTGGTGGGCTAAACGATCTGG	1
AAAGTGGTGGGCTAGACGACCTGG	1
AAAGTGGTGTACGATTAAGTTGTA	1
AAAGTGGTTGTGCCTTATATTTTGG	1
AAAGTGGTTTTGGTCCTACGTGAC	1
AAAGTGTACGTGCGGAAAACGAG	1
AAAGTGTCACAAAGGTAAAAGTAC	2
AAAGTGTGCAGAAAAGACATGTGT	3
AAAGTGTGCGCGTGGAAAACGAG	1
AAAGTGTGCTAAAGAAATCTAGT	1
AAAGTGTGCTAACGAAAACTGAG	1
AAAGTGTGGCCAACAATTTGTTA	1
AAAGTGTGGTGGATAAATTGCTA	1
AAAGTGTGTGAAGAAGTTTTTGAT	2
AAAGTGTGTGAAGGCCTGATGGAC	1
AAAGTTAAAAGGTTGTGTGCGTAG	1
AAAGTTAAAAGTTTACGTGTGTAG	1
AAAGTTAAAAGTTTAGGTGTGTAA	1
AAAGTTAAAAGTTTATGTGTGTAG	1
AAAGTTAAGAAAATACTATGGGAC	1
AAAGTTAGAATTTAAACAGGGCCT	1
AAAGTTAGATAGGGTCACGTGAAC	4
AAAGTTAGATATTTGCTGGTGAA	1
AAAGTTAGGTGCGGAAACTTATGG	1
AAAGTTATGTGTGTATGAAAGGT	1
AAAGTTCGACGATGGTATAGAGGG	1
AAAGTTCGGGGTGCTAGATAGACT	1
AAAGTTGAAAGTTGAGGATAGTT	1
AAAGTTGAAGGATGACGGGTGAAC	1
AAAGTTGAGGGTGAATGATGTCTG	4
AAAGTTGATGCAGGGGTGTTAGGT	1
AAAGTTGCCAACACGATTTTGG	1
AAAGTTGGAAACTAAATAGGGCCT	1
AAAGTTGGGCCAGATTGCACTAGA	1
AAAGTTGGGTGCTGAAACTTATGG	1
AAAGTTGGTACTCATATACTCGG	1
AAAGTTGGTAGTCTGGAGAAA	1
AAAGTTGTGCTGAAAGTACTTTG	1
AAAGTTGTGCTTAAAATACTGTAG	1
AAAGTTGTGGCTCCGGTTGGACC	1
AAAGTTGTGTGCTGCCTTATTTGAA	2
AAAGTTGTGTGCTGCCTTATTTGAAC	1
AAAGTTGTGTGTCTTGAAGTGAGG	1
AAAGTTTGGAAATTGAGTGTTTGA	1
AAAGTTTTAGCGTGTCACATTGA	1
AAAGTTTTGATGTGATGGAAAAG	1
AAAGTTTTGATGTGATGGAAAAGT	3
AAAGTTTTGGATGTGATACGATGT	2
AAAGTTTTGGATGTGATGTGATA	1
AAAGTTTTGGTGGCAAAAGTTTTG	2
AAAGTTTTGGTGTGTCACATTAGA	1
AAAGTTTTTGATGTGATGTGATGT	1
AAAGTTTTTGTGCCATAATAAAG	1
AAATAAAAAATGATGTGGCAAGTGA	1
AAATAAAAATGGTGGATTGGTACA	1
AAATAAACATGCCACTACTGGAGA	1
AAATAAACTTTAGGTGCTGTTTGG	1
AAATAAAGGGGCGTGCCTGTTGTA	1
AAATAAATACAAGGCGAGCCTAAC	1
AAATAAATAGGAGCTGCAATATTG	1
AAATAACATCTCGAAGATCGTGTC	1
AAATAACCATTGCGGGTGCCCTAA	1
AAATAACGAATAGACCTAATGAAT	1
AAATAACGGTTGTAACGGTGTGGA	1
AAATAACTAATTACACAGATTGC	1
AAATAACTAATTACGCAGATTGC	1
AAATAAGAAGAGAGATTTCAGTGA	1
AAATAAGACGAACGGTCAAAGTTG	1
AAATAAGACGAGTGGTCAAACGTTA	1
AAATAAGAGAGAGAAGTGGGTGGGCC	1
AAATAAGATGAGTGGTCAAACGTTG	1
AAATAAGATGGGGATATAGCTTAC	2
AAATAAGCGTAGCCATGAGTTTTC	1
AAATAAGCTTTCACGTGTAGCCT	2
AAATAAGGTGATAATAACGTGTGA	1
AAATAAGGTGATGGGACAAATCCC	2
AAATAAGGTGGTAATAACGTGTGA	1
AAATAAGTGCAGCCATGGTTTTCCA	1
AAATAATAGGTGGTCTAATTTGGA	2
AAATAATCGGGACTAAAAATAGAT	1
AAATAATTGAGAGTGCAAAATGTC	1
AAATAATTTTTGGGTGGTCCGGGA	2
AAATACAGAAAACATGCCGATAAA	1
AAATACATGATTTTGGGTGTCTCA	1
AAATACATGCCGACTATTTTTTGA	2
AAATACATGCCTATTATTTTTATG	1
AAATACATTAAATGCACAGGTGAG	3
AAATACCACTATCAAACGGGGGCA	1
AAATACCCGCCTACAATTCATTAC	1
AAATACGAAATGTAAAAGGTTGAC	1
AAATACGAATCGGCTGTGTCT	1
AAATACGCGACGGGGCATTGTA	2
AAATACGCGACGGGGCATTGTAAG	1
AAATACTCGCCACTTTCAGTCGG	1
AAATACTGCTGTTGCTGCTACTGA	1
AAATACTGTGTGCTGATGGGA	2
AAATACTTATATTTTGGGACAAAG	1
AAATAGAAAAAGGAGCCTCCACGT	1
AAATAGACCCTAGATATGTTAGA	1
AAATAGACTTATTTTTGCGTGCGG	1
AAATAGAGATAGCGACCATCACTG	1
AAATAGAGGACTGCAAAACATAAG	1
AAATAGAGGAGAACTAGTTATGGT	1
AAATAGAGTGCTGACTGGACTGCC	2
AAATAGATCGGGAGGCCGACTGGA	2
AAATAGATGGCATTGCGATGGCAC	1
AAATAGATGTCACTTACGATTCAA	1
AAATAGATGTGAGATTCATGGTAC	2
AAATAGCAGCTGGGCTAGGTGTAA	1
AAATAGCCCTAAGTTGTTCGGATC	1
AAATAGCCGGTGGAAGCTGGTGAG	1
AAATAGCCGTTGATGTGAGCACGT	1
AAATAGCCTAGTGGTTATGGAAT	1
AAATAGCCTTTGATGTATTAGATA	1
AAATAGCGGGGTAAGACATTTAGC	1
AAATAGCGTGTCTCTCCCCATGGA	2
AAATAGGAGTCTGACTCTCTAGCA	1
AAATAGGATAGGGCCACTACCAAA	1
AAATAGGCCATTTCAATAGTGAAC	1
AAATAGGGCATTCATTAACATGAG	1
AAATAGGGGTGAAAATGGTATGGA	1
AAATAGGGTACACACGTATGCGCG	1
AAATAGGGTTGATGTTACTGAC	1
AAATAGGTAGAGTGAGGGGAAG	1
AAATAGGTGAAGATTGTGACTGGT	1
AAATAGGTGAATAGTAATGGTATT	1
AAATAGGTGGTTGGATTGAAATAT	1
AAATAGGTTGTAAACTGGTGTAAC	1
AAATAGTAAAATTTTGAAGGGCTA	1
AAATAGTGAGAATGGTGTATGCAT	1
AAATAGTGGAACCCGATTAGAGC	1
AAATAGTGTCCCAAAATAATATGG	2
AAATAGTGTGAATTGGGTGTCA	1
AAATAGTGTGCCTTGCCCTACTAC	1
AAATAGTGTGGCCGACGTGAACCC	2
AAATAGTTGTGCCTTATATTATG	1
AAATATAAGAGATTTTGGGTGGA	1
AAATATAAGGGATTTTAGGTGGAT	1
AAATATAATATGTGCCGGTTTTTA	1
AAATATAATGATGCTAGCCGTGCA	1
AAATATAGGATAATTTTTACAGAC	1
AAATATATGGTCCACATGTCTGTC	1
AAATATCAACATTTGAGAGTGTCT	1
AAATATCAAGATTTCGGATGGCTA	1
AAATATCAGCATCGTCAGGTCGAC	1
AAATATGAGGAAGGAGGTGCTAGC	5
AAATATGATTTTTGCAGGCGGAACC	1
AAATATGGAAAATGCTAGAGTGAC	1
AAATATGGAAAGTGCTCATGGCTA	1
AAATATGGCGCCATAAATATAGC	1
AAATATGGGATGACCGTTGGTGAT	2
AAATATGGGATTGGGACCACCCG	1
AAATATGGGCAGTGCTAAAAAGTC	1
AAATATGGGCCTAGACAACCGCC	1
AAATATGTGCTAAAAAGTTAACGG	3
AAATATGTGGGTGATTTATT	1
AAATATGTGTCTATATATTTGATG	1
AAATATTCAATATAACAGGGTGAA	1
AAATATTCGATGTGACAAGGTGAA	1
AAATATTCGATGTGATAAGGTGAA	1
AAATATTCGGTGTGAGAGGGTGAA	1
AAATATTGCCAAGATAATATCTGA	1
AAATATTGCTATGCGGTGGAAAC	1
AAATATTGGGTGTCATATCGGAT	1
AAATATTGGTAAGCCTAATTTAGG	1
AAATATTGTAGGTCGCTATTTTAG	1
AAATATTTGATGCCGTTGATTTTT	1
AAATCAAAATTCGGTGGTCTATTC	1
AAATCAAATAGAGCCGCATATGAT	1
AAATCAACAGTGTAGCTGGTGGCC	1
AAATCAACCTAATATCAGATGTGA	1
AAATCAACCTACTAACAGACGTGA	1
AAATCAACCTAGTATTGGATGTGA	1
AAATCAACCTAGTCCTAGATGTGA	1
AAATCAACGGTGTCAAATATTTAG	1
AAATCAATGGTGAGATGATTTTCT	1
AAATCAATGGTGTCAAATATTTAG	1
AAATCACCCAACGATGATTTACGG	1
AAATCATACAGGAGTGGTAATGAC	1
AAATCATGATAAGTGCACGTTAG	1
AAATCATGGCTGACTGCACTTAAA	2
AAATCATGGCTGCACTTAAAATAG	1
AAATCATGGCTGCACTTAAAATG	1
AAATCATGTTTTGGTGCTTTTTGA	2
AAATCATTGTGCCCACGTGAGTAT	1
AAATCCAACGATAGCTAGGGTGCA	1
AAATCCAACGGACTTTGCCACCACC	2
AAATCCATCGATATGGCTGCAA	3
AAATCCATCTTGGAGATCAGGTAC	2
AAATCCATCTTGGAGATTGACGAA	1
AAATCCCCAAACAGGAGTAGGGTA	1
AAATCCGGCTTGATGAGTATTTTC	1
AAATCCGTGTGGTGCCAAATCCTC	1
AAATCCTACGTTTTCCTATTCCT	1
AAATCGAACACACCGGCCTAGGAA	1
AAATCGAATTCGTAGGGTGTCTTA	1
AAATCGATCGCCACCAACGAACGG	1
AAATCGATTTTTGTGTGCTGTCT	1
AAATCGCCGGTGAATGGTGCGGAT	1
AAATCGGGGTGAAGTTAATGACT	1
AAATCGGTGGAAACGAAATATGGT	1
AAATCGGTGGACAGTACCTCGTGC	1
AAATCGGTGTCTCGAGGTTGACTC	2
AAATCGTACTCCAACAGCCTCTC	2
AAATCGTATTTTGGTGCTTTTTGA	3
AAATCGTCTGATATCTGATAGGTA	1
AAATCGTGAGGACGCCTACTCCCT	4
AAATCGTGCACTACGGTAACTATG	1
AAATCGTTTGAATGGATGAAGTGAA	1
AAATCTAAAATAGCCGCCACGAAA	1
AAATCTAATGTGGTAAACGATGTA	1
AAATCTAGATGCACTCGTAGCATG	1
AAATCTGAAGATAGATATAGGTGT	1
AAATCTGATACCTATGATACTCGT	1
AAATCTGGGCTACTATGACGATTA	2
AAATCTGGGTGGTACTTGTATGAG	1
AAATCTGGTTAAGCCTGTTTTGGT	6
AAATCTGTAGAAGAGGCCAAGAGG	1
AAATCTTTCTATCATTACATGGAG	1
AAATGAAAAGGACTGCTTTGTATG	2
AAATGAACTTCAGTTAGATGGCCA	1
AAATGAAGAAATGCTCGTGTTGAA	2
AAATGAAGGGCCGTGTTCTCATTA	1
AAATGAAGTAGAGCTGCACATGAC	1
AAATGAATGGAGGGCTAAGATGAA	2
AAATGAATGGTGGATGATTGTGA	1
AAATGACAGGTATACCTCGTGAGT	1
AAATGACCAGGAGAGGAGGTGGGA	1
AAATGACCGACGGCCGAGGATACT	1
AAATGACCGCCTACAAAAATATAA	1
AAATGACTGCTTACTATCTGGTAC	1
AAATGAGGTGGTAATAACGTGTGA	1
AAATGAGGTGTAACTACTGTGTAA	3
AAATGAGGTGTTAATAACGTGTGA	1
AAATGAGTGCCTAATTTATATAGG	3
AAATGAGTGTCTTTAGATCAATGT	1
AAATGAGTGTCTTTGGATTGATG	1
AAATGATAAAAGAGTGCACAGAGG	2
AAATGATAAAATTGGTGTGCTCAC	2
AAATGATAAAATTGGTGTGCTTGT	1
AAATGATAAATGCCAAATTGACAA	1
AAATGATCTATAGAGGTGGAGCTG	1
AAATGATGAACGGAGCCTGATATG	1
AAATGATGGAGGATTGTGATTGGT	1
AAATGATGTGACTGAAAAATTGTG	1
AAATGATTGAGCTATTAGAGGATGG	1
AAATGATTTGGTGTCATGAGGTAA	1
AAATGCAAAACTTGATAGTGTCTA	1
AAATGCAGCGGGAAAGATAAAAGC	1
AAATGCAGGATTACAAAAGATGG	1
AAATGCATGGTGTCTTCATCAGGG	2
AAATGCCAAATGCCAAACTGCCAA	1
AAATGCCACATAGAATTAAATGAT	1
AAATGCCACCTGGGTCCACATGTC	1
AAATGCCAGAATGACTTACATTGT	1
AAATGCCGAATGACGGGATGGCCC	2
AAATGCGTATGAACAGGGTGTGGTA	1
AAATGCTAGAATGACTTACATTGT	1
AAATGCTATATGATGAACTGTGTA	1
AAATGCTGAGGAGCCTCCACTATA	2
AAATGCTGTTAGGTGGGCTCGCCG	1
AAATGCTTATATTTTGGGACGGAT	1
AAATGCTTGCATTCGGTCGCCTGA	1
AAATGGAAGCCTATTCATTGGTAA	1
AAATGGAATGCCACATTCATACCA	1
AAATGGACCAACAAAGAGCTGCTG	1
AAATGGACCGCACACGAAAATGAG	2
AAATGGACTGAACCAATTCGGGAC	1
AAATGGAGAGTAAGGGATCGGGAG	2
AAATGGAGAGTTGGCCAAATAGA	1
AAATGGATTTCTTCAGATGGCATC	1
AAATGGCATTATGGTCTGCCTA	1
AAATGGCCGTCTGCGAAAATGAC	1
AAATGGCTATAGAAATAACAGAAC	1
AAATGGCTGGTGTGGTTACATGGA	1
AAATGGGCCCATACCATTCTCTCT	1
AAATGGGTGTATCTACCTAGGTGA	1
AAATGGTACTGTTTACACGATTGA	1
AAATGGTCCTTTTAGGGGCACCAG	1
AAATGGTGAAAAAATTATGATTGG	1
AAATGGTGAATGGTGTGTTGGCGA	1
AAATGGTGAATGGTTGTAATTGG	2
AAATGGTGATGAAGATAAGTGCAA	2
AAATGGTGTTTATATCTACCCTAT	1
AAATGGTTCCTCGTGGTACCTCCT	1
AAATGGTTGTGCCTTATATTATG	1
AAATGTAGAAAGGTGAGCCGATA	1
AAATGTAGTGCAAGAATAAGCTTT	1
AAATGTATGGTGTCTTTGAAGGT	1
AAATGTCAATCATCTGTCGTGTCA	1
AAATGTGATGTACGGAGGTATTGAG	1
AAATGTGATGTGATGTGATGTAAA	2
AAATGTGCAAACCTAAAAGGGGT	5
AAATGTGCAGATGGCATTGGTGAA	2
AAATGTGCCGATGTTTGATGTCGT	1
AAATGTGGAGCTAGAAGGCCTCGT	1
AAATGTGTACACCTAAACTCACTC	1
AAATGTGTCAACTCTGGTGTGCAA	1
AAATGTGTCCAGATTTATAGCTAG	1
AAATGTGTCGTGCTACAGTATGAG	1
AAATGTGTCTACATTTGGTTTAT	1
AAATGTGTCTACGTTAGTTTGTT	2
AAATGTGTGCCCGTATATCCAATG	1
AAATGTGTGCTTAAAAATCAACGG	1
AAATGTGTGTCCGTATATCCGATA	1
AAATGTGTGTCCGTATATCTGATG	1
AAATGTGTGTCCGTATATTCGATG	2
AAATGTGTGTCTATATATTCGATG	1
AAATGTGTTCTTGGTGATTTAAAA	1
AAATGTTAAACATGTGCTAAAAAG	3
AAATGTTGCAAGAAAAAGTCAAAG	1
AAATGTTGTCGGTGACCACTAACC	1
AAATGTTTAAAGAAAAAAGGTTGG	2
AAATGTTTGGGTGTCACATCGGA	1
AAATGTTTTGTGAATTTGGTGCAA	1
AAATTAAAACGATGTGATGGAAAA	1
AAATTAAAGAAATAGTAAGTTTGC	1
AAATTAAATGGTGAACGATTATGA	1
AAATTACACAGTACAGCACAGACA	1
AAATTACAGGGACTCAAATGCA	1
AAATTACCACGTTTATGGAGTGCA	1
AAATTAGCCACGTATGCGCCA	1
AAATTAGCCGTAAATACGAGCACC	1
AAATTAGGGCACACAATTACGTAT	2
AAATTAGGGGCCTCCAAAATATGT	1
AAATTAGTGTCTAACATCCGATGT	1
AAATTATACAATTTTTGAGTGTCA	1
AAATTATATTTGAAGTATAGGTGG	1
AAATTATGATTGGGAAGCTTACTAC	1
AAATTATGTTGCTTGCAAATGCGG	1
AAATTATTAAGTGCAAACCTAAGAG	1
AAATTATTTCTGAAACTGTTTGGC	1
AAATTCAAGAAATGCCATCGACGAA	1
AAATTCTGAATTCCGCCAGTGCCC	1
AAATTGAAAAACGTGCTGATGGA	1
AAATTGAAACGATGTGATGGAAAAG	1
AAATTGAAGTGCAAAATAAGATGA	1
AAATTGACCATTCAGGTCCTCAAA	1
AAATTGAGAAGGTGTGTGTTTCCG	1
AAATTGATAATAGAGTGCTAACAA	1
AAATTGATGATGAGATTAAGATGG	1
AAATTGCCATATTGGATTGAGTGA	1
AAATTGCTATATTTTGGGGCGGAG	1
AAATTGGAACGATGTGACTGAAAA	1
AAATTGGAAGTGGAGTTAGGTGAA	1
AAATTGGACATGATGTGACTAGTTG	1
AAATTGGAGATGATGTGACTGAA	1
AAATTGGAGGTGGAGCAAAAGCGA	1
AAATTGGAGGTTTGGTTGAAA	1
AAATTGGGAACCAGAAATTACGAG	1
AAATTGGGCTAGGCTTTCGTTTGT	1
AAATTGGGTTATTTGTGGGGCTAA	1
AAATTGGGTTGTTGTCTGAGAGG	1
AAATTGGTGACGGTATATGTTTAG	1
AAATTGGTGTGTTGCAACGAGACG	1
AAATTGGTGTTGGTGATAGTGAAG	1
AAATTGTAGTGGTGTGTTATCTAGGT	1
AAATTGTCAAATATTGGTAGGCCT	1
AAATTGTGCCAAAAAGTGCTTTGG	1
AAATTGTGCCAAAAAGTGTTTCGG	2
AAATTGTGTCAAAAAGTGCTTTGG	1
AAATTGTTGGGTGTCACATCAGAT	1
AAATTTACAATAGAAAAATGGTAC	1
AAATTTACACGGTAGTTACACCCC	1
AAATTTATGGTTGCACTTAAAATG	1
AAATTTCCATTGCAACGCACAGAC	1
AAATTTGTTTTGGGGCATTTACAA	1
AAATTTTACAGAACCTCATGGTAC	1
AAATTTTGCCATATTTAAAAGATA	1
AAATTTTGCCTAATTATTTATACC	1
AAATTTTGCCTTTATAATAAGAAG	1
AAATTTTGGGCATACGAACTAAAC	1
AAATTTTGGGTGGTATCTAAATAG	1
AAATTTTGGTGACTATATAAAAAA	1
AAATTTTGGTGGGATGGGGAATGG	1
AAATTTTGTCTAGAAAAAGTGGTA	1
AAATTTTTAGGTGTCATGTCGAAC	1
AAATTTTTGGGTGTCACGTTATAC	1
AACAAAAAACTGGATCGCCATATCC	1
AACAAAAACGTAACGAGGGGTGGA	1
AACAAAAATAATAGATATAGTTGC	1
AACAAAAATAGAAACTAAGGGTGT	1
AACAAAACAGTTAATAGCCTCATC	1
AACAAAACTGCAAAAGGAGGCTGC	3
AACAAAAGGCTTCTATCGGTGCAA	1
AACAAAAGGTGCATATGTTCTATA	1
AACAAAAGTGCCATGCTACGAAAC	2
AACAAAAGTGTAAGTGAGGTGCAT	1
AACAAAATCGGGCTACAAATTTGT	1
AACAAAATGTTTGTTGGGTGGGCT	1
AACAAAATTATGGACCTAAATGCC	1
AACAAAATTGGATGCCCTGATACA	1
AACAAACAAGATAAAATGGATGTG	1
AACAAACAGGACCTAAACAGAACC	1
AACAAACCTATTACGGGATGTGAC	1
AACAAACGTTTGAGTGTCCGTC	1
AACAAAGAGTGTTAATGGATTGAA	1
AACAAAGGACCTAATGAACGGTTT	1
AACAAAGGGGTTACAAACGCCTCA	1
AACAAAGGTATGGTGTCTGTGAAG	2
AACAAAGTGAACAGGGCCAAACAC	1
AACAAAGTGCGAAGTGAGTGTAGC	1
AACAAAGTGCTTGACAACTAAGAG	4
AACAAATAAAAACCTACAAGACTA	2
AACAAATACGGATAGATATATGTC	1
AACAAATACGGTGACGGATATTAA	2
AACAAATCTAAGATAGGATGTGAC	1
AACAAATCTAATAGCCTACTACAC	1
AACAAATCTAGATGTGAATGTGAC	1
AACAAATCTGGACACGAGTCTGTC	1
AACAAATGGGGCCAAATTACAAAG	2
AACAAATTGAAGGAGGTGCACCAC	1
AACAAATTGGAGGACCTAAACGAG	1
AACAAATTGGAGGACCTATACGAG	3
AACAAATTTAATGGTGCAATTGGA	1
AACAAATTTAGGATCAGATGTGAC	1
AACAACAATGCTATCGGTCGC	1
AACAACACTTGATGGTTTTGGTTA	2
AACAACAGGTGCAAATAGTTATCG	1
AACAACAGTAACAAGTGAAGGAGC	1
AACAACCCTGGTCAACACGGATGC	1
AACAACCTAAAACCGGATGTGACT	1
AACAACCTAGTACCAGATGTGA	1
AACAACGCATAAACCACTATACTC	1
AACAACGGGTTGCCAGTGCTTGAA	1
AACAACGTCAACGAGAGCAGCTGC	1
AACAACGTTGCCACACCAATCTAA	2
AACAACTAGCATGGTGGCCCGTG	1
AACAACTCGGTAACTACATGATCA	2
AACAACTCTGATGGTGACAAAAAT	1
AACAACTGGGAATAAAGATCAAAA	1
AACAACTTGGTGAGTGGGTGCGA	2
AACAACTTGGTGAGTGGGTGCGAT	1
AACAACTTTTGAGTGAATGGGACG	1
AACAAGAAACGCGAGGACCGGAGA	3
AACAAGACAACTGGTGCTGTCCAC	2
AACAAGACGGTGTGATGGTTGGAG	1
AACAAGATGAGTGGAAGTATGGTA	1
AACAAGATGATCGGAGTGTGGTTC	1
AACAAGATGGTGCCAGTAATAGC	1
AACAAGATTATACAGGTTCGGGCC	1
AACAAGATTTCACACGTAGGT	1
AACAAGCAAACAAATGGTGGT	1
AACAAGCAGAGATTGAAGGTA	2
AACAAGCCAAGCCTAAACATGTTA	1
AACAAGCCAGCATTGCCACGCCAG	1
AACAAGCTCTTGTCTTTTGGTGTA	2
AACAAGGATTTTGTCTGTGACT	1
AACAAGGTCGACATGGATGGTCTC	1
AACAAGGTGGTACTAAACATG	1
AACAAGGTGGTATTAACATATGG	1
AACAAGTGAGTGTATGACATATGGA	1
AACAAGTGATTGGTGTCACTGACA	1
AACAAGTGCGACCATATAGGTGAA	1
AACAAGTGGATGCCCGACATATAG	1
AACAAGTGTGTTCGACCTTGAGGC	1
AACAAGTTGAGGTACCACGTTGC	1
AACAAGTTGCAACTTCTTTTCCGG	2
AACAAGTTGGAGGACCTAAACGAG	4
AACAAGTTGGAGGACCTAAATGAG	2
AACAAGTTGGAGGATCTAAACGAG	1
AACAAGTTGGTGTCATTGTCGGT	1
AACAAGTTTAAGGACCGCTAGTGCA	1
AACAAGTTTGAGGACCTAAACGG	1
AACAATAAAATTTACTGAAGGTAGC	2
AACAATACCCATCCTGCCTAGCTA	1
AACAATACTGACACGTCACACACA	1
AACAATAGATATGAGATTGAGGTA	2
AACAATAGGAGTCTTTGATAGTG	2
AACAATAGTGGTAGTACCAGATGG	1
AACAATATAGAAGGAGACGTGAC	1
AACAATATGCCACTGACTTTGTCG	1
AACAATATGGTGCAATTTGTGATG	2
AACAATCAAGCCTTGTTGTGCC	1
AACAATCCGGCCTAGGTGGGGTTG	1
AACAATCGCATCAGATGTCCGATC	1
AACAATCTTACCAAAGAGGGATGT	1
AACAATGCCTCTGGGTGGTTTTGG	1
AACAATGGGTGGGTACTCCAGATC	1
AACAATGGTGTTTGCATTGAAAGA	1
AACAATGTCACGCCTACTTATAAT	1
AACAATTAACATTTTGCAGTGCCA	1
AACAATTAATGCAGGTGGTACATC	2
AACAATTCAAAAGGTGTTGGTGTA	1
AACAATTCTTAAAATATAGGTGAC	1
AACAATTGATGATTAGGTGCGTTTG	1
AACAATTGATGTGATATGACTTAA	1
AACACAAACGCCTATAAATACACG	1
AACACAAATACTCACAACGCGCGC	2
AACACAAATATGTGCCGGTTGAGA	1
AACACAAATTGTATGGTTAAGATG	1
AACACAACCTAAGATGGGATGAGA	1
AACACAACCTCTGTGTCTGCATGG	1
AACACAACGCCGTTAAAACCTGAA	1
AACACAATCTCTATTTAGGTGACC	3
AACACAATGGTGTAATCGGATTGT	1
AACACACAACTAATAAAGGAC	2
AACACACGTTCCTACAACATTCCT	1
AACACAGATCGTTGATCGAGTCAA	1
AACACAGCCATGGATGCATCTCGC	2
AACACAGGAATAATATAGGATTGC	1
AACACAGGGTAGAAATCGGTGTGG	1
AACACATAATGGATGGCCAGATAG	1
AACACATAGGAGAAGGTCTTGAAC	1
AACACATAGGGTATGTTTGGTTC	1
AACACATATAGCCTGATGCATGGA	5
AACACATATCGTATTAAGGGCCT	1
AACACATCTGGTCGCCACCTTCGA	1
AACACATGGGTCAACACAACACGG	1
AACACATGGTATGTGGTGGGTCCT	1
AACACCAACCGGGACTAAAAATGC	1
AACACCAACCGGGACTAAAGATGG	2
AACACCACCTAAATGCGCCGTTA	1
AACACCACGATATCGATGAATGCA	1
AACACCAGCCACTCTAGATGGAGA	1
AACACCCAGGTAGCCTCGTCGCCA	1
AACACCGAGTGCCTAGGTGATACC	1
AACACCGTGATACGGGTTGATAGT	1
AACACCTACATAGATGCTGAGTTA	1
AACACCTAGGGATGAAAATGGTAC	1
AACACCTGATGGTACTGTTGTTGC	1
AACACCTGCTAGCGCTCCGAGGAC	1
AACACCTGGAGATGCTTGCCCCC	1
AACACCTTATCGAATAACCGTGTC	1
AACACCTTGTTGCTGATAGGTAAA	1
AACACGAGAACCTATGCACTAGAC	1
AACACGCGGGGTATCATCTAGTTCA	1
AACACGGCCCGATTGAGATGAAT	1
AACACGGGTGCTTCGCTGTTGACGG	1
AACACGGTCCTCGGCGTCCTAGGT	2
AACACGGTCTACAAGATATATTT	1
AACACGTATTGGTGTCTATTCTGAC	1
AACACGTGCTAAAAAGTCAACGGT	1
AACACGTGGGATCAAGACTGGGTC	1
AACACGTGGGGCTGAACAAACTAG	1
AACACGTGGGTATTCGCTGGAATGC	1
AACACTAACACAAAGGGTGCTGCC	2
AACACTAACCGGGACTAAAGATGG	1
AACACTACCGAGTGATAATGTGCA	1
AACACTGAAGTGCGGATGGCGTGA	1
AACACTGTCACATGTGCGCCACGT	2
AACACTGTGTCTTACGTGCAGTAA	1
AACACTGTGTTTTACGTGCAGTAAC	1
AACACTTTCATGTGCGGGTGGTCC	2
AACAGAAAACTGAGGAGAATATAA	1
AACAGAAGAATTGAAGTGCAC	1
AACAGAAGATGGACGGAATGGCAC	1
AACAGAATAAGTTGGAGGACCTA	1
AACAGAATAGCGACGGAATGGTGT	1
AACAGAATGCTGACTGGACTGCCA	1
AACAGAATTTAGGTGGTGTCTGGT	2
AACAGACCATGCTACTGAAGGGCA	3
AACAGACGCCTGGTCTACCTGTA	1
AACAGACGGAATGGTGTGGAGG	1
AACAGACTCTCCATCTAGATGGCC	1
AACAGAGGCAGCCTGATCGAACAG	1
AACAGAGGTAGCAGCTACATAGGA	1
AACAGAGGTGTAGTCATCAGTGAC	1
AACAGAGTTGCTTAACACCAG	1
AACAGATGATCTCGGTTGGTAAAG	1
AACAGATGATGATTAGTAACCAGC	1
AACAGATGGACAGCTAGACTGCTA	2
AACAGATGTGCTTGAGTCCCTAG	2
AACAGCAAATGGGTTTGAAAGTGG	1
AACAGCAACCTTTGCAAAGTGACC	1
AACAGCAAGTTCAGGAAATGTTGG	1
AACAGCACCCTGGTGGTTGATGGC	1
AACAGCAGATGGCTAGGTGGCCGG	1
AACAGCAGCTGTACTACTGGTAGC	1
AACAGCATCTTTGCATACGGTTGC	1
AACAGCATGGACTTCATCAATTTA	1
AACAGCATTTATTGCAGTCTGGTC	1
AACAGCCCTGCTCCGTAGCTACTC	3
AACAGCCGAAGAGATGGGCGCACC	2
AACAGCCGGAGAGATGGGCGCACC	1
AACAGCCTCAAACAGATAATGTGC	1
AACAGCCTGCTTTTTTTGAGAGAG	1
AACAGCCTTAAAAGGAGTCACCAC	1
AACAGCCTTGAGTGTCGAGTGGA	1
AACAGCGAGATTTTTTGAGGTTCC	1
AACAGCGCCAATGGTGGTGCTAGA	2
AACAGCGGGCCTTACGTGTACATG	1
AACAGCGGGTGAAATCGTTGATGG	1
AACAGCGGTAAGGTGACATGCTTT	3
AACAGCTACTATGGTGGTGTTTGG	1
AACAGGAAATAGGTGGAACACTGA	1
AACAGGAACAAATTGTGTATTGCCA	1
AACAGGAATTGAAGTGTAAAACAG	1
AACAGGACCCTGTTTTGTAGCAGC	1
AACAGGAGCGACGATCAATGAGCA	1
AACAGGAGCGGATCTGGGTGGAGC	1
AACAGGAGCTTAGCTCTAGTGGGA	2
AACAGGATGTAGGGTTATTACCTG	2
AACAGGCCCTAAGAAACGCAATT	1
AACAGGCCCTATATATTTACGTGA	1
AACAGGCGTTACAAGTAGGGGCAA	1
AACAGGGCAGCTTATGGTATAAA	1
AACAGGGCCTTAGAAGAGATAGAG	1
AACAGGGGCACAACAATATTTTGG	1
AACAGGGGGTCTACGGCGGGTGAA	1
AACAGGGTACCTATCAAACTGTG	1
AACAGGTGATGGGTAAATTGGTAG	1
AACAGGTGTTGCCAGTGGTGGTCC	3
AACAGGTTGAAACAGTGCCAACAA	1
AACAGTAAAGTGTTTATGGTAAC	1
AACAGTAAATTGTTTTAGGTCCCT	2
AACAGTATCGAGGGCCTAGATGAT	2
AACAGTATTTTAGTATATGGGCCT	1
AACAGTCTATCTGTAGCCAGCTGC	1
AACAGTGAGGTGTTTGTGTTAACT	1
AACAGTGATGTTGTGACCTGCTGC	1
AACAGTGCCAGTGCGTACACGAC	1
AACAGTGCCATATATTTTGAAAGG	1
AACAGTGCCCTTGTTGATTGAACG	1
AACAGTGCGACTAACTTATGT	1
AACAGTGGTGGTTGCCCTGATGGC	1
AACAGTGTGGAGCTAAAAAGGTCC	1
AACAGTGTGGTGGTGGAGCATGAC	1
AACAGTGTGTATGACAGGTGGGAC	1
AACAGTTCGGGAAACGTGCATGTG	2
AACAGTTGTCGATGATGATGGCGA	1
AACAGTTTGAAAAGTGTGCGTGCG	2
AACATAAAACATTTACAGGTGTCA	1
AACATAAGATTTTGATAGGAATGT	1
AACATAAGCTTTACTGGTGTTACC	1
AACATAAGGCTAAGGAGGTGTGGC	1
AACATAAGTTTGGTAGCCAGGTTC	1
AACATAATATAGGTGCCCCGACAC	1
AACATAATGGCTGCCACAAGGGT	1
AACATACAATAAACGGGTGAACGTC	1
AACATACCTGAAGCTGCCACCGCC	1
AACATACGACCACGTGGCTGCCTA	1
AACATAGAAGCCTACATACGCCAA	1
AACATAGGAGTAGGGTGTTACGC	1
AACATAGGATTCTGACAGGAATG	1
AACATAGGTAACAAAAGGTGGCCC	2
AACATAGGTCCCGCATCTGGCTTG	1
AACATATAGGTGTCTGTTCTTTAA	2
AACATATATAAATGTGGGCAATGC	1
AACATATCCTATGCACACAGG	1
AACATATGATTCTAACAGGAATGT	2
AACATATGGCGCCATATTTCTAGC	2
AACATATGGGCAGTCTACCAGAC	1
AACATATGGGTCCACATGTGTCTA	2
AACATATTGTATGTATGAGAGGTGG	1
AACATATTTAAAAAAGTCAACGG	1
AACATATTTAGAAAAATCGGTGTC	1
AACATATTTGGTGACGTGAAAGA	1
AACATATTTTGGTGCTTTTTGAA	1
AACATCAAGTTTGGGGATCGC	1
AACATCATGGGCCAATTTGGATA	2
AACATCCGATATGATAGGGACTTA	1
AACATCCGATGTGACAGGTACTAA	1
AACATCCTAGTACTATAATGTGTC	1
AACATCGCCGGATGCTGCTGC	1
AACATCTATGGGTGTCGATTCTAA	1
AACATCTCTGGCCCGATGGACACA	1
AACATCTGTTTGCCGCCGGCCGAA	3
AACATGAAAGTGTGAAGCTAGTGC	1
AACATGAAGTGGTAACCTGTATGAG	1
AACATGACACGGCTGATGGACAG	2
AACATGAGACCACAGAAGGTGCAA	1
AACATGAGATTTTGATAGAAATGT	1
AACATGATGACGACACCGAGGTAC	2
AACATGATTGTGCAGCACTGCTA	1
AACATGATTTAAAACAGCAAGTGC	1
AACATGCAGGCAAACACGGTTGAA	1
AACATGCCTACACGGGAAAATCGG	1
AACATGGAACTACACACTGCCT	1
AACATGGCCTACCAAATATATCTT	1
AACATGGCTGTCTGCTGACGATAT	1
AACATGGGCAACGAATTTATCGTG	1
AACATGGGGCTTTAAAACTATAAA	1
AACATGGGTATTAAGGTGCTATAG	3
AACATGGTAAGCTTTAGGTGCTAT	1
AACATGGTCAATGGTGTAGAGGAG	1
AACATGGTGCAATTTGTGATGTCA	4
AACATGGTGTTCGATAAAATGG	1
AACATGTAGAAGGGCCCACAGGT	1
AACATGTAGCGAGTGTGTGCA	1
AACATGTGAGCCTGAGGGTGGTAT	1
AACATGTGCAAGGAAAACAAGGT	2
AACATGTGCTAAAATGTCAACGGT	1
AACATGTGGACCCGATGTGTCATA	1
AACATGTGGATGATAGAAGAGTGA	1
AACATGTGGATGATAGAAGGGTGA	1
AACATGTGGCCAATAAAATTGAAG	1
AACATGTGGGCCATACTAAAGTGG	1
AACATGTGGGTCCATTATCTATGG	1
AACATGTGGGTCCTCATGTGTCTA	1
AACATGTGGTAACGTGTACTTGCC	1
AACATGTGGTCCTACTTTACTATC	1
AACATGTGTATGATAGGTGTGACC	1
AACATGTGTGCTCTTTTCTGTT	1
AACATGTGTGCTTAACTCTTCTAC	1
AACATGTGTTTTTGCCGGTGGGGG	1
AACATGTTACCGCCTGCTAACTAG	1
AACATGTTGGTAGCTGATTTGG	1
AACATGTTTTCATGGACCAATCAA	2
AACATTAAGGTGGTTTTACAACTC	1
AACATTAGGGCTTCGCTGTTTTGA	1
AACATTATGAGTGTACTAGGTGAA	1
AACATTCAATGTGACAAGGTGTA	1
AACATTCGATATGATAGGGCGTAA	1
AACATTCGATATGATAGGGTGTA	3
AACATTCGATGTAATATGGGTGA	2
AACATTCGATGTGACCTTTTTAGC	1
AACATTCGATGTGATAAGGTGAA	1
AACATTCGATGTGTTGGTGTGTAA	1
AACATTGAGGATGCCCTAATTGAC	1
AACATTGAGTGAGCCATAAATCTG	1
AACATTGGTCCTAAGTTAACTTTC	1
AACATTGGTCGAAAAGTCAACGG	1
AACATTGTAAGTATACTAGGTGAA	1
AACATTGTGAGTACACTAGGTGAA	1
AACATTGTGAGTATACTAGGTG	1
AACATTTAATGTGAATAGTGCAAA	2
AACATTTAGTTGGGCTAGAATGG	1
AACATTTCATATGAGCTAACATGA	1
AACATTTGAATGGTTGTTTCAGAC	1
AACATTTGATGTAATATGGTGTAA	1
AACATTTTCGGTGGAACAAAA	1
AACATTTTGGTGTCATTTAGATAC	2
AACCAAAAACGTGAACTTTCGATGC	1
AACCAAAAAGGAGTGAAGTTGGTTA	1
AACCAAAATGATGGCCCGCACAGA	1
AACCAAACAAAAAATAGGGTGCGC	1
AACCAAACAGAGCCTAGAACGAG	1
AACCAAACCAGAGCGATCCAAGAG	1
AACCAAAGCCACACCTAGAGTGCCC	1
AACCAAAGGAAACCCGAAACATGC	1
AACCAACCAGGACTAAAGATGGTA	4
AACCAACCTAATATCAGATGTGAC	1
AACCAACCTAGCACCGGATGTGAC	1
AACCAACCTAGTAACAGATGTGA	1
AACCAACCTAGTACAAAATGTGAC	1
AACCAACCTAGTACTAGATGTGAC	1
AACCAACCTAGTACTGAATGTGAC	1
AACCAACCTAGTACTGGATGTGAC	2
AACCAACCTATAACTAAATGTGAC	2
AACCAACGAGCTTACGGATACTAG	1
AACCAACTGACAGCGACAAGACAG	1
AACCAACTGTGTGCCATGAAAATC	2
AACCAACTTCGTATAAAATGTGAC	1
AACCAAGCCTAAATTGGGTGTC	1
AACCAAGTCGTGTCTGAGAGGGTC	3
AACCAATACGGTATCGGTTTCCTA	2
AACCAATAGGTGTCGGTTCTAGA	1
AACCAATATGGTATCGGTTTCCTA	1
AACCAATCAACAGGAACAGGTGAA	1
AACCAATCTAGGTGGGAATGTGAC	1
AACCAATGAGGTGATGATGGGCTC	3
AACCAATTAGGTGAAGAGGTCTCC	2
AACCACATGGAGGTCATGAGATGC	2
AACCACCAAAGGACCTATTGTGAC	1
AACCACCGAAGGACCTATTCTGAC	1
AACCACCGTGACCCGATGCGCCTG	2
AACCACGATCAAACAAGGCTTTGG	1
AACCACGGGTGCCGACCGACAAT	2
AACCACGGTACCCCGAAACGGAGC	1
AACCACGTCATGGCATGCAAGAAG	1
AACCACTCAAGGACCTAAAGCGAA	1
AACCACTGAATATGGTAAGGGTGT	1
AACCAGACCTAGCTAGATGGCCCC	1
AACCAGACTGAGCCACAAACTAAG	1
AACCAGAGAGGAGTGAATGGTTGG	1
AACCAGCATGGCCTATTAGTTGAT	1
AACCAGCGACGAACTAATTGTGAA	1
AACCAGCTGATTTTGATGTGCTTCA	1
AACCAGGAACCATGCAATTATTAG	1
AACCAGGAATAGATGTAACGA	1
AACCAGGAGAAGTCTAACATCGAA	1
AACCAGGGTTTCCCAAACCGTCGG	1
AACCAGTAGTCCTTCAGGTCAAGT	1
AACCAGTGGTGAGTACAAATTGGT	1
AACCATATATAGACTGTGTTCG	1
AACCATATATGTATGGGGGTGTT	1
AACCATCCAAGGAATGGGGTGTAA	1
AACCATCGAAGGACCTATTGTGAC	2
AACCATCGGCGGCTCTGCCATTGT	1
AACCATCGGTCCGGCACCTTCGTG	1
AACCATGACAATATGTGAGGTGCT	1
AACCATGTTTAGTGTCTTGGGTTG	1
AACCATGTTTTGGTGCTTTTTGAA	1
AACCATTAACCATTGAGAGTGAAG	1
AACCATTGGTTAAAAGGTCTC	1
AACCATTGTGGATGCCCTTAGTTC	1
AACCATTGTGGGTGTCCTTAGCGG	1
AACCCAAAAGCTAGCCATTGAGGT	1
AACCCAAATTGGCCGCAACGTTGAA	1
AACCCAACCTAGGATGGGATGGGA	1
AACCCAACCTATAATGAAATGA	2
AACCCAATCTCCGACGAATTAGGG	1
AACCCACAAAACTAGTCTGAAAAA	1
AACCCAGATGACAGGCCACTTATG	1
AACCCAGCTGCTAGATGGTGTA	2
AACCCAGCTTTTGATTTGATGTCC	1
AACCCAGGACTTAAGGTGTCTGGA	1
AACCCATGAGGAGGAGGAGGTGTCG	1
AACCCATGGTGCATAGATATAAAA	1
AACCCATGGTTTGTCTTTTTTCGA	1
AACCCATTTACACAGGTGTTTTCA	1
AACCCATTTTCCAAACACACCCGA	1
AACCCCACCTGGGCCGGATTGTGC	1
AACCCCCAAAATACTGGTATAAGGG	1
AACCCCCAGCCGCCACCACACA	1
AACCCCTACGTAGACTGTGATGTA	1
AACCCGAAGCGGTGTCGACCAGAT	1
AACCCGGGATACTAGGGCAGGTGA	1
AACCCGGTAACCGCGGTAACTGCG	1
AACCCGGTCACAGTACACCACCAC	1
AACCCTAAAGATGATGGTGGGTAC	1
AACCCTAAATTATTTTTGCGTGTG	1
AACCCTACATCCTGTTGGCCAAAA	1
AACCCTACATCCTGTTGGCTGAAG	1
AACCCTACGCTATGATGGGTGTCA	1
AACCCTATAGAGAGTATGTTTGG	1
AACCCTATATAGTATGGTGCACAC	1
AACCCTATGTATGTGAAGGTAGCG	2
AACCCTGATGAGTTGTGCATGTGC	2
AACCCTGCGTGGTTGGTGAAGTGG	1
AACCCTGGTGTTAAGAAGTTA	1
AACCGAAACTGGAAATGGTGCTGC	1
AACCGAATACTTGCGCCAATCGGA	2
AACCGACTAATACACAGATGGCGT	2
AACCGACTACTTACCTACTCTACC	1
AACCGAGATGTATTGCCTTCGCCC	2
AACCGAGCCTGTCGAACTATGGTT	1
AACCGAGGGACCTAGTTCACACT	1
AACCGAGGGAGGAGGTTCTCTGC	2
AACCGAGTGTCTAAATTCGTTGTC	1
AACCGATAACAATAATATGAGTGC	1
AACCGATATGATGAATAGTAGTG	1
AACCGATCGACGGCCTACAATGTA	1
AACCGATCGGGCGCCATCATCAGA	1
AACCGATGGCGACCTAGCAATGGC	1
AACCGATGGGAGCCTTAGATGGAA	1
AACCGATGTAGCCCCGCGTTAGGT	1
AACCGATGTGCACATTTGCAGATG	1
AACCGATGTGGTGCTTAAATCTT	1
AACCGATGTGGTGCTTAAATCTTC	1
AACCGCACGATCAAGGATATGTGG	1
AACCGCATCCAGGGTGTGCTATAA	1
AACCGCCAATGGATGAGGATTGCA	2
AACCGCCGAAGGACCTATTGTGAC	3
AACCGCCGAGAGATCTCGGGTGAC	1
AACCGCCGAGGGACCTTGTTTGCC	1
AACCGCCTCCTAAAACCGCCCAGG	1
AACCGCGAGTAAAGGTGGTTGCCA	3
AACCGCGGTTGTTCGACAGGGTGCTA	1
AACCGCTAAATGGTGCGTTTCGT	1
AACCGCTTTGGATTAGATTGAGGG	1
AACCGGAAGATCGATGTGCTACA	1
AACCGGAAGCCTGGTTACGGTG	1
AACCGGAAGTAAGGTAATCATACC	1
AACCGGACGTCTATACTGCCTAGG	1
AACCGGAGCCAATATGTTGCCCTGA	1
AACCGGAGCCACAACTTTAGGTCC	1
AACCGGATGATGTGGCAGGGGAAG	1
AACCGGATGGAGGGAACGTTGTGC	1
AACCGGATGTGACATATGTATGCC	1
AACCGGCGAGGTGGAGGTGTGCCC	1
AACCGGCGTGAATATGGTAACGA	1
AACCGGGAATAAAGATGGATTTT	1
AACCGGGAATAAAGCGTACGCATC	1
AACCGGGACTAAAGAGAGGGTTGC	1
AACCGGGACTAAAGATAAAATATG	1
AACCGGGACTAAAGATTGAGCTGAC	2
AACCGGGACTAAAGATTTAGGGA	1
AACCGGGACTACCAATCCAGGAC	1
AACCGGGACTACGAATTCAGGACT	1
AACCGGGACTATCGTGGAATTCGG	1
AACCGGGACTATTATGGTTTTGGG	1
AACCGGGACTATTGTGGAAATCGG	3
AACCGGGACTATTGTGGATTTGAG	1
AACCGGGACTATTGTGGTTTTGG	3
AACCGGGATCGCCCAAGCCCAACC	1
AACCGGTACCAATACTATAGATG	1
AACCGGTCACCCGAGGTCCTTCGG	1
AACCGGTCACCTGAGGTCCTTTAG	1
AACCGGTCACTCGATGTTCTTCGA	1
AACCGGTGCAAACAATATCCTTAG	1
AACCGGTGCAATTTGGCTCCCTC	1
AACCGGTTTTGTATAGGTAAGGGAC	1
AACCGTCACAGGTGATGGGCGTCA	1
AACCGTCCTCCAAAACCACTGG	1
AACCGTGATGAGGAAGGTAGTCTG	1
AACCGTGCACATAAGGTCCTATAG	1
AACCGTGCCATTGAAATTTTACAA	1
AACCGTGGTTTATACAAGTTCGGG	1
AACCGTGTATACGTATGATGATGG	1
AACCGTGTTTAGGCCTGAGGTGCA	1
AACCGTTAAGGGACCTAATGTGCA	1
AACCGTTAATTTCACCTCACCTCA	1
AACCGTTGGGTGCACAATTTGGA	1
AACCGTTGGGTGCACAATTTGGAT	1
AACCGTTTGATTGGACTACAGAAA	2
AACCTAATAAGATATGTGACTCCT	1
AACCTACAAATCTAATACTACGAA	1
AACCTACATAACTGTGTCTCAAGT	1
AACCTACATAGTACTCGATGTGAC	1
AACCTACCATAGGATAAAGACGGA	1
AACCTACCGGATGTGATATATCCT	1
AACCTACCTACGGTCAGACCGGCC	1
AACCTACGTGACAGCTTAGTCAGC	4
AACCTACTGAATCTGAATCTACAG	1
AACCTAGAATGGGATGGGACATGT	1
AACCTAGCAGGGGTCTACAACGAA	1
AACCTAGCTGGCAGACGGTGATGG	1
AACCTAGGACTAGATGTGACACAT	1
AACCTAGTCTTTTGGGTGGTGTAG	1
AACCTAGTGCAGCATTGCAGCGGG	1
AACCTATATACAGCACGTCGCATG	5
AACCTCGGGAAAGATGTGACACA	1
AACCTCGTTGATGAAGTCCATGGG	1
AACCTGAGCCAGATCCCGAACCTG	3
AACCTGAGGTGTGGTGTACTTGGT	1
AACCTGATATGCCGATGAAGAGGA	1
AACCTGATGCGGAAGCTCGGCCTA	1
AACCTGCATGTGCTAATAATGGTT	1
AACCTGCGCCTCACCGCCACCGTC	2
AACCTGCTATTGTACCTGCTCTTAC	1
AACCTGGAGATAGTCTATATAGAA	1
AACCTGGGCTATCGTTTTAAGAAT	1
AACCTGGTAATAGCCATTGTGGAA	1
AACCTGGTACTAGATGTGACACAT	2
AACCTGTAAACTACCGTTGGATAA	1
AACCTGTCATACACACACAACTTT	1
AACCTGTGACAAAACTACGAACCA	1
AACCTGTGTAAGAGAAATGTGCT	1
AACCTTAAGGTGGGCCCTATGAAT	3
AACCTTACTAAAATTTGGCATTGC	1
AACCTTCGGGTGTCGAGGAGTATA	1
AACCTTCTGATGTAACCAAACAAC	1
AACCTTGATGCTACCAAGCTTGAC	1
AACCTTGGCGGTGCTGGCGTTGGA	1
AACCTTGGTAAGGATGGGACGTAA	2
AACGAAAAATTGTGCTTAAAGTAC	2
AACGAAAAGATGGGCCGATAATAAA	1
AACGAAACAAATGTGCCAGTAAAT	1
AACGAAACGATTAGATTATGGAG	1
AACGAAACGGTGTGAAAGCGTGTC	1
AACGAAAGTGTAAATGGGTCCACC	1
AACGAAATCGTTGTCTACATTGGG	1
AACGAAATGAAGGGGGTGTCACTT	1
AACGAAATGTGGCTAGTGTTTGG	1
AACGAACACAATGGTGTAATCGG	1
AACGAACACAATGGTGTAATCGGA	41
AACGAACACAATGGTGTAATCGGAT	1
AACGAACACAATGGTGTAATTGGA	50
AACGAACATGGTGCGTCATTTCAA	2
AACGAACGTGGTGTCTTCTTTCAA	3
AACGAAGAGAGCCTGTTATTAGAC	1
AACGAAGGAAGTAATATCGAATGC	1
AACGAAGGAGGGCGCGGTAACAAC	2
AACGAAGGGGAAAAAAGAGGTGAA	1
AACGAAGGGTTAGGATTAAATGG	2
AACGAAGGTACTCACATGCTG	1
AACGAAGGTTAGATAAGTTGTGAC	1
AACGAATACAATGGTGTGATCGGA	1
AACGAATAGCCAAACGTTGGTTGA	1
AACGAATAGTCAAACATGTGAGA	1
AACGAATATAACGGTGTGATTGGA	2
AACGAATATAGGACCGGATATGAC	1
AACGAATCGGCAAGCTGCCAATTTC	1
AACGAATCTAAGACTGGATGTGAC	3
AACGAATCTAGAACCGAATGTGAC	1
AACGAATCTAGATAGAGATGTGTC	1
AACGAATCTAGGACCACATGTGAC	1
AACGAATCTGAGTAGGGGTGTGTC	1
AACGAATCTGGATAAAAGGGTGT	2
AACGAATGGGTCCACTTACGAGAT	1
AACGAATGGTCAAACGTTGGTTGA	2
AACGAATGTAATGGTGCAATCAGA	1
AACGAATTAGTTTAAGATTATGGA	1
AACGAATTATATGTTTGGATGCT	1
AACGAATTCTGAGGGCTAAAAGT	1
AACGAATTGTGGACTGCCTGGATC	1
AACGAATTTAATGGTGCAATCGGA	4
AACGAATTTAATGGTGTAATCGAA	1
AACGAATTTAATGGTGTAATCGG	2
AACGAATTTAATGGTGTAATCGGA	2
AACGAATTTTAATGGTGCAATCGGA	1
AACGACAAATGTCCTTGGTGGCCA	1
AACGACAGGATATGAACCGGAGAA	1
AACGACATGCTTTGCATAGGTGCA	1
AACGACATGGATGGTAGTGGCATG	1
AACGACCCGGTTAGCCTTTTTCAA	1
AACGACGACAGGAAGGTGATGACC	1
AACGACGAGGAGGTGGTGAGAGGG	3
AACGACGGCCGAAAGAATATGGGT	1
AACGACGTGATGGAAAAATTGAAAA	1
AACGACTACTACTAGGGGTGTAAG	1
AACGACTGATCAGGTGGGTACTAC	1
AACGACTGTTTGTGGATGATGATA	1
AACGAGATGGTGAAGATGGAGCCAC	1
AACGAGATGGTGGTTGCCATGGAG	4
AACGAGATGTATTAGGATGTGTCA	1
AACGAGCCGTATGAGAATCAAGGG	1
AACGAGCGGTCAAATAGTATAAGC	1
AACGAGCTATACTATTAGCATTGC	1
AACGAGCTCTACGCATTCACGGAG	3
AACGAGGAGAATACATTTATTCAA	1
AACGAGGATTGGTGTACCTTGCAG	1
AACGAGGGGTGAGGGGTTACGGAC	1
AACGAGGTGAGCTATTAGTGCAT	1
AACGAGGTGATATTAACGTATGA	1
AACGAGGTGATTATAATGTGTGAT	1
AACGAGGTGCAGCGAAGAAGCTT	1
AACGAGGTGGATCTAGGTTTAGGC	1
AACGAGGTGGTAATAACGTGTGA	1
AACGAGGTGGTAATAATGTGTGA	1
AACGAGGTGGTGATAACGTGTGA	1
AACGAGTCCCCTCGGCGGTTTTGA	1
AACGAGTGATATGGTGATGGAATC	1
AACGAGTGATCTACAAGTTTAGG	1
AACGAGTGATCTGCAAGTTTAGAG	2
AACGAGTGGATACACACTGTACTA	1
AACGAGTGGTCAAACGGTGTAAAC	1
AACGAGTGGTCTGCAAGTTTAGG	2
AACGATAACAGTGGAGTGCACTAAC	1
AACGATAACGGTGTTAGTGTTATA	3
AACGATAACGTTAGGACTTGGGAC	1
AACGATAAGGACTACTCGGATTG	1
AACGATAAGTATGTGTGCTGTGAA	1
AACGATACAATCAAATGTGACACC	2
AACGATACGGGCCGGCTCAAGTGG	1
AACGATATGAGAGATCACCGGTGG	1
AACGATATGGTAATAATGTGTGA	1
AACGATATTTGACCCGCTGTTGCC	1
AACGATCAAAAACGATTTGGTACC	2
AACGATCAAAAATGATTTGGTGTC	2
AACGATCAATGATATGAAGGTACC	1
AACGATCTAACGGTGAAGATTCAT	1
AACGATCTGGGCACTGTCTCGGA	1
AACGATGAAACGAGCAACCA	1
AACGATGAGAAACCGTTGGTGTCA	1
AACGATGCGATGGAAAAGTTAGA	1
AACGATGGGCCAGGGTTTACGATT	2
AACGATGGGGGCGAAGATATTGCA	2
AACGATGGTGATGGAGAAGGAGGC	1
AACGATGTGACTGAAAAATTGCGT	1
AACGATGTGATGAAAAAGTTAGAA	1
AACGATGTGATGGAAAAGTTAGAA	1
AACGATGTGATGGAAAAGTTGAAA	3
AACGATGTGATGGAAAAGTTGGA	1
AACGATGTGATGGAAAAGTTGGAA	2
AACGATTCCTGAGTTTGTACTTGCA	1
AACGATTGAACATGTGCATAAAGT	1
AACGATTGAAGGACCACGAGAATG	2
AACGATTGATAACAGTGGGATGAC	3
AACGATTGCGACTGGATTTGAAAT	1
AACGATTGTGGGGCATTTTCGACA	1
AACGATTTGAGATCTAGATGACAC	1
AACGATTTGGTACCGTAAGG	1
AACGATTTTATAAGTTGAGGGAC	1
AACGCAACCAGTCGAACTGCCA	1
AACGCAACGGGGTCGTGCCATATA	1
AACGCAAGAGAGAGAGAGAGTGCC	1
AACGCAAGTTAAGGTGTCCAAGAC	1
AACGCAGACACTCACACTACATGG	2
AACGCAGGATTTTGATAGGAATGT	1
AACGCCAAAGTTAACAGATGCTGC	1
AACGCCAACATGTGTTTAGATTGA	1
AACGCCACACAGATTGGTCGAGG	1
AACGCCACGACTGATGTGCGTTAC	1
AACGCCACTGGCTATGACCGATAAG	1
AACGCCACTTTAGATGAAGACCGA	1
AACGCCCAGGGGTCTTCTGTTGGG	1
AACGCCGACCATAAATACCAATGT	1
AACGCCGACGCCGGTGAGGTGAGA	6
AACGCCGCGTGGAATGAAGACTC	1
AACGCCTCAAATGGGCAGGTCAGC	1
AACGCCTGCACGAGAAAATCGATT	1
AACGCGAAACATGAAACCGGGCCT	1
AACGCGACCGCACGTGATGATGCA	1
AACGCTCCTAAACTGACAAGTGG	1
AACGCTCCTAGATTGCCACGTGCC	3
AACGCTGGTGGGTACGGCGGGGTA	1
AACGCTGTGTAGATCGAGTGATGC	1
AACGCTGTGTGGGCCTCAAATGG	1
AACGCTTAATGCTGAGGTGGATGA	2
AACGCTTCTGGTAGCCTGGGAAAT	1
AACGCTTGGAGCCTATCAAACCTA	1
AACGCTTGTCAGTGGCCACGCTA	1
AACGGAAGCACATGCGATTTTACC	1
AACGGAAGTGCGACACTGATGGTA	1
AACGGAAGTGCTAAAATGGGGAAC	1
AACGGACCTCTTAAGTGACAGCCA	1
AACGGACTTCACGAGGTGTGTGCG	1
AACGGAGCACACTGATGGAAGCAA	1
AACGGAGCCTTACTATTGTTTCAAC	1
AACGGAGGAGAGTGTTTGGAC	1
AACGGAGGGAGTACTTAGTACTAC	1
AACGGAGTCTCTTGTTTACGGTGA	1
AACGGAGTGAGTAATAGATGGCGT	1
AACGGATAAGTGACCTGGTGGAGC	3
AACGGATACAATTCACGGGTGCAT	1
AACGGATGGAGTATTTCAGAGAAG	1
AACGGATGTAATGGGAAGAAGGGA	1
AACGGATTTTGGCTGAATGTGACA	1
AACGGCCCTATCCTTAAAATTGAA	1
AACGGCCGATTCCCACTTCGCTGC	1
AACGGCGACAGCAACTGTGGAGGC	1
AACGGCGATGGTATTTCTGGGACA	1
AACGGCGGTGATGACCGGCGATGCC	1
AACGGCGTCAAACATTTAGAGAAG	1
AACGGCGTCAAATATTTTAGGATG	1
AACGGCGTCAATTTAGGGACGGAG	1
AACGGCGTTGTGCTTTCAGTGGTA	1
AACGGCTCAAGGGGGCCTTGACTC	1
AACGGCTGTCACAAGTGAGGGTA	1
AACGGCTGTCACAAGTGAGGGTAG	1
AACGGGAAAATCTCCGAGGTTGCG	1
AACGGGATGATACCGGTTAGGTGT	1
AACGGGCATGCTGCCGATGCCAGC	2
AACGGGCCTAAGGGATTGTTTGGT	1
AACGGGCTTGATACATGTAGATGT	1
AACGGGGAAAACAGCCACAAGTGA	1
AACGGGGATGGTGTCCATAGC	1
AACGGGGGCCCATATCAAACAAAC	1
AACGGGGGTGTATACAGCCTCTAC	1
AACGGGTACGTCGTCTAACACTA	1
AACGGGTCCACCAACTTAAATGA	2
AACGGGTCCCGAAATTTTTCTCGT	1
AACGGGTGCATATCCATCGGGTT	1
AACGGGTGCTGGCCGGTAGATGGC	1
AACGGGTGGAGACTATTTTAATCT	1
AACGGTAAACAACTCAAGTAAAAG	1
AACGGTAAGGTTACTAAGGGTGTG	1
AACGGTACGTAGCCTAGTGGTTGC	1
AACGGTAGCTAAAGACCACAA	1
AACGGTAGTGATATTATGGTGGA	1
AACGGTATACAGATTTATAGCCA	1
AACGGTATCCTAGATTTTGAAAAG	1
AACGGTCAAACATGTGCTAAAAAG	3
AACGGTCAACTAACGGAATGGGCA	1
AACGGTCAACTGACGGTGGAGTGA	1
AACGGTCTAGTGGCCCGAGGTGAC	2
AACGGTGAGATTAGATAGTGCCAT	1
AACGGTGAGCCGATACCCACCCAA	3
AACGGTGCAAATGAGATCCCTCGG	1
AACGGTGCAGCATCCATTGCAACC	2
AACGGTGGGCCGCGTTGAGGACGG	1
AACGGTGGTCTCGATTGTGATAAG	1
AACGGTGGTGGATACGTGAACGG	3
AACGGTGTCAAACATTAAAAACC	1
AACGGTGTCAAACATTTAGGGATG	2
AACGGTGTCAAACATTTCGAAACA	2
AACGGTGTCAAACATTTCGAAACG	2
AACGGTGTCAAACATTTCGAAATG	4
AACGGTGTCAAACATTTTAAAACG	2
AACGGTGTCAAACATTTTGAAACG	3
AACGGTGTCAAACATTTTGTTACG	1
AACGGTGTCAAATATTTAGAGATG	1
AACGGTGTCAAATATTTAGGGAGT	1
AACGGTGTCATATATTAAAATATG	1
AACGGTGTGGTAGGAGATGAGTCA	1
AACGGTGTGGTGGTGTTCTGAAGT	1
AACGGTGTTAGATCTGAGTGGAGA	1
AACGGTTAGAAACGATTTGGTACC	1
AACGGTTAGATGTGTCTTGGTACC	1
AACGGTTAGCCTAATAAGTCAAAG	1
AACGGTTCTAAAAAATGGGATAGT	1
AACGGTTGCTCATGACCTAGTGAA	1
AACGGTTGCTGGCAAACCACGGCA	1
AACGGTTGTAAACGGTCGCAGTGC	1
AACGGTTTGAGTGAGTTTAGGGGT	1
AACGGTTTGGTTGGACTACAAGAG	1
AACGTAAAAAGTAAGGTGGTATGA	1
AACGTAAAATCAGAGAGACGTGGG	1
AACGTAAGATTTTGGTAGGAATGC	3
AACGTAAGTGTGAGTAAGGTGATC	1
AACGTACGGTGGGATACGTAGCCA	1
AACGTAGGTTACCGACAAAACTGA	1
AACGTAGTGCAATGAATCTAGGTAAC	1
AACGTATAATTAGCCGGTGGACAC	1
AACGTATGTGCCTAGCTGTTTCT	1
AACGTCACGGTGATGGTATGGTTC	1
AACGTCACGTGTCACTTTAATAAA	1
AACGTCCTCGTCGCATTCGATGGA	1
AACGTCGGTCTAGACTTTCGTGTG	1
AACGTCTAAGTGTTGGTGGAGAAG	1
AACGTCTTACGGTGATATGGAGTC	1
AACGTCTTTAGGTATGCTCATGTA	1
AACGTGACGGCAGTGGTATGGTTC	1
AACGTGAGACGGTTGATGGACAC	1
AACGTGATACGGCTGATGGACACT	1
AACGTGCAAATATGAAACATACAA	1
AACGTGCACGTGGAACACGATGGA	1
AACGTGCCATCTCCAGGAGGTAAC	1
AACGTGCCTGTTGTAACCGCATGAC	2
AACGTGCTTACGAACTTTTTACCC	1
AACGTGGATGCAGGGAGAATTGAG	2
AACGTGGCACTTACGTGGCTAG	2
AACGTGGCAGAAAGCCGATGGCCC	1
AACGTGGTGCCTCTTTTTCGAACT	1
AACGTGGTGTCTTCTTTCAAGGCT	1
AACGTGTAGTTAGATGGTTGTTGG	2
AACGTGTATATGACAGGTGGGACC	1
AACGTGTCTAACGGTGTCATAGTA	1
AACGTGTCTCCTGGCAGATATGG	2
AACGTGTGGGTGATCGTGCATTAG	2
AACGTGTGTATAACAGGTGGGACC	1
AACGTGTGTATGACAGGTGGGACC	1
AACGTGTGTGATTATCTCCTCGTC	1
AACGTGTGTGTTGTGATCCAACTG	1
AACGTGTTGAATAACTAGTGGCCT	2
AACGTTAAACGTGAATAGTGCAA	1
AACGTTCAAATGAGGTCCCATGGC	1
AACGTTCAATGTGACAAGGTGTA	1
AACGTTCCAGGGTTACGGTACGGA	1
AACGTTCGATGTAACAGGGTGTA	1
AACGTTCGATGTAACAGGGTGTAA	1
AACGTTCGATGTAACTGGGTGTA	1
AACGTTCGATGTGACAAGGTGTA	1
AACGTTCGATGTGACAGGGTGTAA	3
AACGTTCGATGTGATATGGTGTAA	1
AACGTTGGGCGCTTAGGAGAGAGC	1
AACGTTGGTAGCAACATATGGGAC	1
AACGTTGTTATTCTGATGTGCGTA	1
AACGTTTAATATGATAGGGTGTA	1
AACGTTTACCTGGATTGTCTGTGA	1
AACGTTTGACTACATATTACGGGAA	1
AACGTTTGATGTCGCGATTCCGGT	2
AACGTTTGATGTGACAGGGTGTA	1
AACGTTTGATGTGACAGGGTGTAA	2
AACGTTTGCCTGCGTGCGTATGCG	1
AACTAAAATGCGACTGAATGATGG	1
AACTAAAGATAGGTGTCCTGGTTT	2
AACTAAAGGTTCCTATATAACTGGA	1
AACTAAATAAGACGGTGGGTGCAA	1
AACTAAATAGGTGAAGATTGTGAC	1
AACTAAATGAATGTGGGTAATGCT	1
AACTAAATGGTGAGTGGATAGGAG	1
AACTAACTGGTGAGAAAAAAATGGG	2
AACTAAGATGGTATGCATAGCATT	1
AACTAAGATTAGGTAAGTTGTAGC	1
AACTAAGGTTGCTTATGGTATGAC	1
AACTAAGTAGGGGCACAAAAATGA	1
AACTAAGTTACTGTGCTAGAAATA	1
AACTAAGTTGGGTTGTATGATGGA	1
AACTAATATCTGGTCCTATCTGTC	1
AACTAATCTAGATAGGAAGGTGTC	3
AACTAATGCTAGGTAGTAAGCTTA	1
AACTAATTACACAGATTGCGCCT	2
AACTAATTAGGTTCCTATTGATAA	1
AACTAATTGCATAGTTAGGGTGAA	1
AACTACACCGAGAGTGCTAGCTGG	1
AACTACGAATCTGGACATGTCTCC	2
AACTACTAAACGGTGCATTTTTCT	2
AACTACTAACTGGGCCTAGTACA	1
AACTACTATTTATGTTATCGGCCA	1
AACTACTTATCTGATCTACGATCC	1
AACTAGAAAGGTGGAGATGGGTTT	1
AACTAGAAGCCAAAAAGGCCCTGA	1
AACTAGAATTTCTACACGAGTGAC	1
AACTAGACTTTCGGCTGGCTG	2
AACTAGAGTGGGTCAACGGGTACC	6
AACTAGATACCGGGTGTTCCTCAA	1
AACTAGATATGAGATTGAGGTA	1
AACTAGCAGTTGTACCACACAGCT	1
AACTAGGAAACCAGATAAGGTGAC	2
AACTAGGAGTGGAATTGGGTGGA	1
AACTAGGATGAAAAATGATGCGGC	2
AACTAGGATGTACACAGCCAAAAC	1
AACTAGGTATGGGTTGGCGATGGT	1
AACTAGGTGACATGCAGGGTGTCA	4
AACTAGGTGTATTGCGTTTTCCGA	1
AACTAGTGCAATTGATAAAGTGAA	1
AACTAGTTGGTAGCCAATTTCTG	1
AACTATAAAAGGAGGACCTCGCCC	1
AACTATACAAAACAGGTCACCTGA	1
AACTATAGAGCCCGAGGGAGTTGC	1
AACTATAGGTGCTAAATTTATGAT	1
AACTATCAAAACCGGTGCAAACAA	1
AACTATCAGGCAAAGCCATGGTAA	1
AACTATCATTGGTAGCCTATTGAA	1
AACTATGAAAATAAATGGTGTCAG	1
AACTATGAGTTGCCTTTGTAGTGC	1
AACTATGCCACACAAATTTTGCAA	1
AACTATGGTACCGGATGTCTGATT	2
AACTATGGTGGTCGTCCGAATGAC	1
AACTATGTGAGAGAAATAGATGG	1
AACTATGTTAATTGGGTGTTTGTG	2
AACTATTAAAAGAATTAGGGTCC	1
AACTATTAAACCGGTGCAATTTGA	2
AACTATTGCATGTGTCCTTTATCC	1
AACTATTGTGGGTGCACTAAGAGT	3
AACTATTGTGGGTGCCCTTAGTAA	1
AACTATTTACCACTTTTACGACGA	1
AACTATTTATAGAGGTGGGAGGAC	1
AACTATTTGGGTGACATGCAAACA	1
AACTCAAATATACATTTCAGAGA	1
AACTCAAATGTGAAATAGGTGTA	1
AACTCAACCTAGGAGGGGATGTGA	2
AACTCAAGAAGAAAAGATAGGTCC	1
AACTCAAGGGCTATTTCATTGA	1
AACTCAAGGTACCAATACCTCATA	1
AACTCAAGGTATCACATTTTGCAC	1
AACTCACAAGTGGAGCTATACGAA	1
AACTCAGAGTGATATTTGGGGTGG	1
AACTCAGATGAGGTGCTTGTACTG	1
AACTCAGCCCCGCAAACAACCCAA	1
AACTCAGCCTAGGTGAATTGTGCA	1
AACTCATGACGAGATGTTTGGGAG	1
AACTCCACAAGGTGTTGAACTAGC	5
AACTCCGCGGATGGTGATAAGTGA	1
AACTCGAGTGCTCAAAGTATGGAG	1
AACTCGGAGCTATTATGTGAC	2
AACTCGGCCTAAAATGAGTGGAAC	1
AACTCGGTGGCGGGCCGACCGTGC	1
AACTCGTGGGTAGTATGGACAG	2
AACTCTAGGTATGAGGGATGTCCA	1
AACTCTGATACGTTGTAATATGCT	1
AACTGAAACTAAAGATAGGTGTCC	1
AACTGAATTGGGACATACGGTGGCC	1
AACTGACGTTGAATGCCGTGCCAC	1
AACTGAGCGTGCTAGTTGGATGGA	1
AACTGAGGTACGCCTTCAACTGAG	1
AACTGAGGTTTGATGATTGTTGCA	1
AACTGAGGTTTGATTGATTATTG	2
AACTGAGTGGTTTTTTGTTTTCGA	5
AACTGATAAACAGTGTGTTTATA	1
AACTGATGTAAGGTATGAGGGTAT	1
AACTGATTAGGCTACTGGAGGTGA	1
AACTGCAAGGTGTTCGTCAACGTA	1
AACTGCACATTGGCCCTGCAC	1
AACTGCATCCTGCCTCGAACTAGC	1
AACTGCCACCTAATATCTTATCCG	1
AACTGCCGCAGCCACTGGACCGCC	1
AACTGCCTTAAGGAAGTCGATGCTC	1
AACTGCCTTGGTTATTGTTTGTGA	1
AACTGCCTTTTAAAGTGATCGTCA	1
AACTGCGAAAGATGGTGATGGCGA	2
AACTGCGGACGATCACAACACACG	1
AACTGCGGGTTGATAGGGGGCGGA	1
AACTGCTTTAATTAGATGTGG	1
AACTGGCAGGCGATAAAGGAGATG	1
AACTGGCGAACTTCGGATGGA	2
AACTGGCTGCCAAAAAAATTATGT	1
AACTGGCTGGTAAAACTACACATA	2
AACTGGCTTATAGGCTGCTATGGT	1
AACTGGGTCGTCACTGTATCGTGT	1
AACTGGTGAACTGTTAGGAGGCGG	1
AACTGGTGAGAAACTAACTGGTAA	1
AACTGGTGCAAAATAGATCCCTCG	1
AACTGGTGCTACATGGAGTATGG	1
AACTGGTGCTACATGGAGTATGGG	1
AACTGGTGTGACTTTTAAAAACTA	1
AACTGGTGTGACTTTTAAAACCTA	1
AACTGGTGTGACTTTTGAAAACTA	1
AACTGGTTGCTTATGTCTCAC	1
AACTGTAAGGGGTTATAGGTGCA	1
AACTGTCAAAAGCCGGCTGGCCCC	1
AACTGTCTAGTTGTTGAATTTGAA	1
AACTGTGACATCTAAAAGTGTGGT	1
AACTGTGACGAAAAAGATGAATAC	1
AACTGTGCAATTGATTTTTTTCGT	1
AACTGTGCACAATACGAGGAAAGA	1
AACTGTGGCTACAACCAAACAC	1
AACTGTGGTCTTGCCTACGTAGCA	2
AACTGTGTGCCATGAAAATCAATA	1
AACTGTGTGCGAAGGTGGAGAAGC	2
AACTGTTCCGGTATCTATAGCGTCA	1
AACTGTTGCCTTATCTACTACT	1
AACTGTTGTAGGATGCTAATCTCT	1
AACTGTTGTGTGAAAATGATGTTG	1
AACTTAACGTAGAAGTAGGAGGAC	1
AACTTAAGGGTCCCTTTGAAACGC	1
AACTTACTGTTTGTGTTGGCTGCA	2
AACTTAGCCTTAGGCTGTGTTCGGG	1
AACTTAGGGGGTGTTTGGGAACTA	1
AACTTAGGGTGTGTTTGGATTCCA	2
AACTTAGTGTGCTTTGCTTTGCAT	1
AACTTATATCTTAGGTCCTTTGCT	1
AACTTATCGTTGGTGCAATAATTG	1
AACTTATGGCTACACTTATAATGG	1
AACTTATGGTGATGTGGATGAATC	3
AACTTCACCAAGAACGCGTGCCAA	1
AACTTCATGGTCCTATTACCCACT	1
AACTTCGGGATTAGCCTACTAGAC	1
AACTTCGTGATGGTGTTCTAATGC	1
AACTTGACAAGTGGGTGCATTCCG	1
AACTTGACAAGTGGGTGCGTTCTAG	1
AACTTGAGGTGTATAAATTTTAGG	1
AACTTGATGAGATGTAGGCGTGCC	2
AACTTGCCCGTCAAAGGTGGGTGT	1
AACTTGGTGTGTTCGTAAGTT	1
AACTTGTAAAGGTGTCATTTAGA	1
AACTTGTAATTGGCTGAGAGTCA	1
AACTTGTAGCCTGCTATTGTACTT	1
AACTTGTGGGATATGGAGCTCCTG	1
AACTTGTGTGCCAAGATGGAGCG	1
AACTTTAACTACGAACCTGGACA	1
AACTTTAGGCCCGATTGAGATAAC	1
AACTTTAGGTGCATAAATTTACTA	1
AACTTTAGGTGTATACACTTTCTGT	1
AACTTTATAGTAAGATAGGATGC	1
AACTTTGAAGGGCATCGGTACCGA	1
AACTTTGATGGACGATTGAGGCGA	1
AACTTTGCCTTGTCAAAATTAGCC	1
AACTTTGCTAAAAAATAGTATGGT	2
AACTTTGGCCTGGTCCATGGGTGA	1
AACTTTGGGTGCTATTAAAGTGAA	1
AACTTTGTCGATGCCATCACCAGTA	1
AACTTTTCAGTATAAATATATGGT	3
AACTTTTCTATAGAAAACTTTTGC	1
AAGAAAAAGAAGGCAACAGATGG	1
AAGAAAAAGTTGGTAGGGCTTAGC	1
AAGAAAAATCTACTGAGTGCACGC	1
AAGAAAAATTACCCACCTATGCCA	1
AAGAAAACACGAAACCTGCCTTC	1
AAGAAAACCAGGTGGAGAGAAGG	1
AAGAAAACTAAATGCTGGGGTGGA	1
AAGAAAACTGAATGCTGAGATGGA	1
AAGAAAAGCCTGGCAGGTGGGTCC	2
AAGAAAAGCTGCCAAATGTAAGTGG	1
AAGAAAAGTGCAAGATGATGTGAG	1
AAGAAAAGTGGTTGTGCCTTATGG	1
AAGAAAAGTTTTGATGTGATGGAAA	1
AAGAAAATATTCCCTACGAACACAC	1
AAGAAAATTTGGTGTCACATTGAA	2
AAGAAACCAACAAGATAATGTGCA	2
AAGAAACCTTCAAATTGATTGTGA	1
AAGAAACGATTGAGTGCGAGTTAG	1
AAGAAACGGCAAGAACCTCAGCCA	1
AAGAAACTAGGATTGGATGGGACA	1
AAGAAACTATGGGTTGTGGAGTGT	1
AAGAAACTGTGTGCGAAGGTGGAG	3
AAGAAAGAACGAAAGTGTAAGTGC	1
AAGAAAGAGGAGCAAATAGATGGT	1
AAGAAAGATGTTTTAGGTAAAAGC	2
AAGAAAGCGGTACCAAAAAATAGCA	1
AAGAAAGCTGAATGCTGAGGTGGA	1
AAGAAAGGAACATGATTACACCCT	1
AAGAAAGTAAGTGTGCATCTTCGC	1
AAGAAAGTAGGTAAAAGTGAGTGG	1
AAGAAAGTCAGCTGTCCTGAGGGC	1
AAGAAAGTTTTAATGTGATGGAAA	1
AAGAAATAAAAGGATGTCAGGAAT	1
AAGAAATAAGTCTAAAGGTGTCA	1
AAGAAATAGATATTAAATGAGGAA	1
AAGAAATAGCCCTCCAATGAAATA	1
AAGAAATCGTGCCAAAATTTTGAT	1
AAGAAATCTTAAGCCGCAACATGT	1
AAGAAATTAGGGCACACAATTACG	1
AAGAAATTGAAACGATGTGATGGA	2
AAGAAATTGAAACTATGATCATGG	1
AAGAAATTGGAACTATGTGATGAA	1
AAGAAATTTGAATAGAAGGTGATC	1
AAGAAATTTTGGATGGACGTGACA	1
AAGAAATTTTTGGGTGTCACATCG	1
AAGAACAAGAACACCTACAACAAG	1
AAGAACAATATTAGCCCACGTGAC	1
AAGAACAGTAGGGTCCACATGTCA	1
AAGAACATGGTGCAAACATACGC	1
AAGAACATGTGAGTTCCACGGCGC	1
AAGAACCGGGACTACTGATAAGC	1
AAGAACCTACTTGCCAGCTGA	2
AAGAACGAGAAGACTTGACGGAAC	1
AAGAACGCCTGATACGCCGATTGC	1
AAGAACGGATGTAGGGTTCAAGCC	1
AAGAACGGGTCCTGAAAGAAGGGG	2
AAGAACGTTGTTTAGATGGGT	6
AAGAACTCAGGATCCTATTGTGCA	2
AAGAACTGGATGTGCAAGTTGTGC	1
AAGAAGAAAAAGATGTGCAGCTGA	1
AAGAAGAGGAACCTACCAGCGTCC	1
AAGAAGATGCAAGGGTCGCCGGAG	3
AAGAAGATGTCTTAGGTGGAGTCC	1
AAGAAGCAACCATACCGACAGGG	1
AAGAAGCAACCGGTGGTGTCTCGC	1
AAGAAGCCGTTTTGCCAGTTGAGG	1
AAGAAGCCTGAATGCTGAGGTGGA	1
AAGAAGCGTAATACCCTACTCCTG	1
AAGAAGCTCGACGGCAACGACTGC	1
AAGAAGCTGCGTGCGCATACGAAG	2
AAGAAGGATGGACCATTTACGGAA	1
AAGAAGGCGCTAAGAAGTCGAAG	1
AAGAAGGCTGAATACTGAGGTGGA	1
AAGAAGGCTGAATGCTGAGGTGGA	3
AAGAAGGGCGAACATGCAGATTGC	1
AAGAAGGGTACTATGATTGAGTGT	1
AAGAAGGGTGCTATTACACGAAGC	2
AAGAAGGTGACATGGCAGGTCCAT	1
AAGAAGGTGCACATACATAATCTG	2
AAGAAGGTGCTAGGAGGTAAGCAG	1
AAGAAGTAAATGCCTCGTCAGCGG	1
AAGAAGTAAGGACCATTCCCGCGC	1
AAGAAGTAATCGAGTGAAGGTACC	1
AAGAAGTCTACACAATGTCAGTAT	1
AAGAAGTGCAATCTTTTTGTGTGA	1
AAGAAGTGCACTGAGGAGTTTGGT	1
AAGAAGTGCAGATGGCCTAAATGG	3
AAGAAGTGTCGTCGGCTTGTTGAG	2
AAGAAGTGTGATGGAATCAAGATC	1
AAGAAGTTAATGGTGAAGAATGTC	1
AAGAAGTTCGCTACAAGGGTCGTA	1
AAGAAGTTTTAGAGGGTGTTTGGG	4
AAGAAGTTTTAGAGTTGAACACGG	1
AAGAATAAGGTGGACCATTTACAG	2
AAGAATAATCTGATGGGTGAGGAC	1
AAGAATAGAAAAAGGAGCCTCCAC	1
AAGAATAGTGTCGACGTTTGATGT	2
AAGAATATGCATATGTGGTAGCCC	1
AAGAATATTTTGGGTGAATGTGA	1
AAGAATCGGTTAGAGCAGGTGTAC	1
AAGAATCGTGTCATGGAGTGCAAG	1
AAGAATGACGGACTACATATCTG	1
AAGAATGATTAAAAGTTGTCTGAG	2
AAGAATGCGGGTGCGTTGGTGTCA	1
AAGAATGGAGAGTTACGCATTAAA	1
AAGAATGGCAACAAAATGTTGATG	2
AAGAATGGCTTACATTGTGAAAC	1
AAGAATGGCTTCGCTAGAATACCA	1
AAGAATGGGAAGGCAAGATATAAG	3
AAGAATGGTGTCTCTCTTTAGCAC	1
AAGAATGGTTGAGCCTTATATTTT	2
AAGAATGTGACAAGAAGAGTGCA	1
AAGAATGTGCTAAAAAGTCAACGG	2
AAGAATTGCATGATGCCTGATAGGTA	1
AAGAATTGCCTCCAAAAACCATACC	1
AAGAATTGGTTATATAGGTGTTT	1
AAGAATTTGATACACGTGATACGAC	1
AAGAATTTTATATAAGATGGACGT	1
AAGACAAAGTAGGTGAAAAAGAAT	2
AAGACAAATGGTAAAACGTTGAAG	1
AAGACAAATGGTCAAACACGTGAG	1
AAGACAAATGGTGAAACGTTATGC	2
AAGACAACATATTGGTTCCGGTGT	1
AAGACAAGTGGTCAAACGGTGTAA	1
AAGACACCAAATAGGAACTCCTA	1
AAGACACGGGCGACGTAGACAGGT	1
AAGACACTGGTGGATGACAAGTAG	1
AAGACAGACGGTCAAACGTTGGAC	1
AAGACAGAGAAGGAAGAAGATGGA	1
AAGACAGATGGTCAAAACGTTGAG	2
AAGACAGATGGTCAAACGTTGAGC	2
AAGACAGATGGTCAAACGTTGGAC	1
AAGACAGCCAGGAGGTTTGCCTA	2
AAGACAGGGACTTAAGTTAAGTC	1
AAGACAGTCCGATGAGATGGTTGTA	1
AAGACAGTGTGTGTATGACAAGT	2
AAGACAGTTTTGCTGACGTGGCGC	1
AAGACATAAGTCAATTGGCAACCT	1
AAGACATACGTTGTACTCGTGCCA	1
AAGACATCGATCTAGAGTAGGGCC	1
AAGACATGGTATGTGGTGGGTCCT	1
AAGACATGTCAAAAGTGATTTGGA	3
AAGACATGTGGTGGCCTGTAAGG	1
AAGACCAGGTCAATACCGCCACGT	1
AAGACCCCCTAGGAGGAGAGGGGA	1
AAGACCCTTTGCCATGGGAAAGT	2
AAGACCTCCTCACACGGTGTCCGC	1
AAGACCTTAGGATACTACTTAGGC	1
AAGACGAACAGTCAAACATGTGCT	1
AAGACGAACAGTCAAACATGTGCTA	1
AAGACGAACGGTAAAAGATGTGCT	1
AAGACGAACGGTCAAAACTGGGCG	1
AAGACGAACGGTCAAACATGCGCT	2
AAGACGAACGGTCAAACATGTGCT	6
AAGACGAACGGTCAAACATGTGCTA	1
AAGACGAACGGTCAAACATGTGT	1
AAGACGAACGGTCAAACGTTGGAC	2
AAGACGAACGGTTAAACATGTGCC	1
AAGACGAACGGTTAAACATGTGCTA	1
AAGACGAATAGTCAAATATGTGCT	1
AAGACGAATGGTCAAACATATGAG	2
AAGACGAATGGTCAAACATGTCTA	1
AAGACGAATGGTCAAACATGTGAG	3
AAGACGAATGGTCAAACATGTGCTA	1
AAGACGAATGGTCAAACGTTGGAC	1
AAGACGAATGGTCAAATTTGGGTAC	1
AAGACGACCTACACGCATTGACAC	1
AAGACGACTGTGGTGATAGGAGAG	1
AAGACGAGACTTTGGTGTGCA	2
AAGACGAGTAATTAGGTGGTCTA	1
AAGACGAGTAGTCAAACAGTGCAA	1
AAGACGAGTGGCCAAACGTTGTAA	1
AAGACGAGTGGTCAAACAGTGCAA	1
AAGACGAGTGGTCAAACGTTACAA	3
AAGACGAGTGGTCAAACGTTGCAA	1
AAGACGCAGTGTGTCTATGACGGG	1
AAGACGCCCGTGGTGATATGTTGG	1
AAGACGGAAGAGAGAGTTACAAGC	1
AAGACGGAAGGTGGTGTCAGACC	3
AAGACGGACGGTCAAACATTGAAC	1
AAGACGGACGGTCAAACGTTGGGA	1
AAGACGGACGGTCAAACGTTGTGC	1
AAGACGGACGGTCAAATGTTGGTC	1
AAGACGGACGGTTAAATGTTGGAC	1
AAGACGGATGATCAAACATTGGAT	1
AAGACGGATGATTAAAGTTGGATA	3
AAGACGGATGGTCAAACGTTGGAC	1
AAGACGGATGGTCAAATATTAGGC	1
AAGACGGATGGTGAAACGTTGGAC	3
AAGACGGATTCAGCGTGGGTGCTA	1
AAGACGGGTGTCCGATTAAATGAA	2
AAGACGGTGAGCTGCTCATGGTGG	5
AAGACGGTTTTAGATGTTGCC	1
AAGACGTATGGTCAAACGTTGTGC	1
AAGACGTCAATGGTGCTTGTAATC	1
AAGACGTGATGGTGATGGCATGG	1
AAGACGTGCAATTCAAACTTAGAT	1
AAGACGTTAAAGAGTGGCCACATC	1
AAGACGTTGTGCCATTGAGAC	1
AAGACTCGCCACAAAGACCTGGTA	2
AAGACTGACTGACATGTGGATGAA	1
AAGACTGAGAGCCACGTTTGGTAT	1
AAGACTGATGGTCAAAACGCTGAG	1
AAGACTGGGCCAGCATATATTGAG	1
AAGACTGGGCCGGCATATCTTGAG	2
AAGACTTTCTAGCGTTGCCCACAT	1
AAGAGAAAAGCAGCGAACTACAGC	1
AAGAGAAAGGTGCATCTACATCCA	1
AAGAGAAATTAGGTGAAAAAGAA	1
AAGAGAACGGTTGTGATTGGTTGA	1
AAGAGAAGAATGCAATGATGGTAA	1
AAGAGAAGAGCCAATTTTGTGTGG	2
AAGAGAAGCACGAGTGCAAGCTGA	1
AAGAGAAGCTACGGCAGTAGAAGC	1
AAGAGAAGGCATTAGCCTGGGTTC	2
AAGAGAAGGTTTTGCTGGGTT	1
AAGAGAATATGGTGAAGAAGTTGT	1
AAGAGAATCCACTCAGTGCCATTGA	1
AAGAGAATCTACGAGCTGACCGG	1
AAGAGAATGTTGGTGGAAAAGTT	1
AAGAGACCGTGTGTAAGGAATGC	1
AAGAGACTGAGAATGGTTGTTGAA	1
AAGAGACTGATGGACCAAGTACAC	1
AAGAGAGAATAGCAACGAACTACA	1
AAGAGAGAATAGCAGTGGGCTAC	1
AAGAGAGAGAATAGCAGCGTGCT	1
AAGAGAGAGCTGTTTGTTTGACGG	1
AAGAGAGAGGATGAGGAGAATTGC	2
AAGAGAGGAGCCAATTTAAAGTGG	1
AAGAGAGGATGCCATTTTAGGT	2
AAGAGAGGGACCTGCAAATACTTG	1
AAGAGAGGGGCTAAACTGAGGGAC	2
AAGAGAGTACTTGATCATCTGTGC	1
AAGAGAGTAGGTGCTGACATGGAC	1
AAGAGATAAGCCATGGTGTAGGAA	1
AAGAGATAAGGTGTTGATGTGGA	1
AAGAGATCTGCCAGCAAAAATATG	2
AAGAGATGCCTAAAAATAGAATCCC	4
AAGAGATTTAGACAGGTTCAGGCC	1
AAGAGATTTTAAACGGACGTCTA	1
AAGAGATTTTAGATGAATGTGACA	2
AAGAGATTTTAGGTGAATTTAACA	1
AAGAGATTTTGGATGGACATGATA	1
AAGAGCACGGGGAGGATGCTG	1
AAGAGCAGCCGCGATGATGGGAGG	1
AAGAGCAGTTGTTTGCGAGGCT	1
AAGAGCATTGACGAATGGTGTGAG	1
AAGAGCATTTTCAGGATGGGTGAC	2
AAGAGCCATATGTGTTGTGTCATC	1
AAGAGCCTCAGTAGCACCGAGGTC	1
AAGAGCCTCCATGTGCCCGTCTTC	2
AAGAGCGAATGGATGTCGGCGGTGT	1
AAGAGCGTTTAGGTGGAGCTGAAA	2
AAGAGCTACATTTGCTCGATTTGC	1
AAGAGCTACCATGTGATGTCAAGG	2
AAGAGCTTAGTCTAACAAACTGAG	1
AAGAGCTTTCCGATGGCTATGGTA	1
AAGAGGAAGTGTCACATCTATCAA	1
AAGAGGACCAACCCCAGAGAGTAC	2
AAGAGGACCGGTCATCAACTTTGA	1
AAGAGGAGGCCTCAGGAAGACAG	1
AAGAGGATGACGACGCGAACTCAC	1
AAGAGGATGGTCAAAGTTGGGCGC	1
AAGAGGCATGTGTTAAAGTGACAGG	2
AAGAGGCCACACACAAAAATAAGC	1
AAGAGGCCACCAACACGTATGGT	1
AAGAGGCGGACCTACACGATGTAC	1
AAGAGGGTCCTTGAGGAGGTATCA	1
AAGAGGGTGACTATTGGGAGCTTG	1
AAGAGGGTGATACAACATGTACAG	1
AAGAGGGTGCTCCGGGGTATCCAT	1
AAGAGGGTTTGAGAAGATATGGAC	1
AAGAGGTAACCTATACAATATGTC	1
AAGAGGTAGAACTAGAGTTGTAGC	5
AAGAGGTAGCCCAATGTGTAATTC	1
AAGAGGTAGCGTACGAGACCTAAA	1
AAGAGGTAGTGCACGAGACTTAAA	1
AAGAGGTATATATACGGTGGAACC	1
AAGAGGTCCACTTGAGAAAATAGA	1
AAGAGGTCTTTGGAGGATCGG	1
AAGAGGTGACTAGATACCTGTGAC	2
AAGAGGTGAGCTATGTCATGTA	1
AAGAGGTGAGTAACGAGGTACCCA	1
AAGAGGTGAGTGCACACGTGTTGT	1
AAGAGGTGGAAGAGGTTATGCAGG	2
AAGAGGTGGAGCTGGGTTTAGGT	1
AAGAGGTGGATCTGGAGCTGTGCC	1
AAGAGGTGTACGAGTAGTGTCGT	1
AAGAGGTGTGCGCTCTAGGGCTAA	1
AAGAGGTGTTTCAACAGGAAGGCTT	2
AAGAGGTTTTCGGACACGAATGAA	1
AAGAGGTTTTCGGATACGAATGA	1
AAGAGTAAAGTCCTTCACCGGTCC	1
AAGAGTAGTGGGCTGAAGAAGGA	1
AAGAGTAGTGTCTAGTAAAATTTA	1
AAGAGTAGTGTCTAGTGCTAGTTT	1
AAGAGTCTATGACTAGTGGGACC	1
AAGAGTGAATGCTAAGGTGGATGA	1
AAGAGTGAGGGCCTGTTTGGTAGA	1
AAGAGTGCTAGCTAAGTGGGTC	1
AAGAGTGGTACCAACTATATGAAG	1
AAGAGTGGTTCGGCCGATATCCCT	1
AAGAGTGTCCTGTAGCAAAATTTG	1
AAGAGTGTGCACAATTTGATGTTC	1
AAGAGTTGAAGCCTCAATTATTGC	1
AAGAGTTTAGATGATGGAATTGAT	1
AAGAGTTTGGGGACCTATATGACA	1
AAGAGTTTGGGGTGTCAAATGTCC	3
AAGATAAATGCTGAGGTGGATGAG	1
AAGATAACCTAAAACTGAATGTG	1
AAGATAATCCAAGAGTAGAGTGAC	1
AAGATAATCTAAGGTAGAGTGACA	1
AAGATACATGTGTGTATGATAGGT	1
AAGATACCAAATCGATAATGTGCA	1
AAGATACGCAAAACGAGGTGGGCC	1
AAGATACGGAAAGTCCATGGTGTA	1
AAGATACGTAAAACGAGGTGAGC	1
AAGATACGTAAAACGAGGTGAGCT	1
AAGATACGTTAGGGTTTAAGGTGG	1
AAGATACTAAGTTTTAGGGGAAGC	1
AAGATACTAGATGGAATCAGTATC	1
AAGATACTGTTCGACTTGGGCCTA	1
AAGATACTTTAGAGTGCAGGTGGG	3
AAGATAGCACATGTTCTAGCTAAG	1
AAGATAGCGATATTTAGTCTCGGA	1
AAGATAGGAGGTGCTAAAGGTCTT	1
AAGATAGGATGGATTACTTCAGG	1
AAGATAGGATTTGATGGTAAGATC	1
AAGATAGGCAAATGGTAGAGAGGA	1
AAGATAGGTCCACCTACTAAACT	1
AAGATAGGTCCCACATGTATATA	1
AAGATAGGTGCCGGTACCATTTAA	1
AAGATAGTAGAATGCCACGGCAAA	1
AAGATAGTGCAACATTTACATTGG	2
AAGATATAAAAGGAGGACCTTGCC	1
AAGATATAATGGATTTTGAATGG	1
AAGATATAGGGTGTGCTAAATTGT	2
AAGATATATTGGTTGCTCATAGAG	1
AAGATATCTATCTTCATGGATGCA	1
AAGATATCTTTAGTCCCGGGTGAA	1
AAGATATGCCGGCCTAATTTTCTG	1
AAGATATGCCGGTCCAATCTTTCG	1
AAGATATGGTGTCTTTGAAGAC	1
AAGATATGTGCTTCGATTTTATGT	1
AAGATATGTTATATCCAGTGCTAG	5
AAGATCATGGACCTAAGTGACAGC	1
AAGATCCTCACCCGGTAAGTTGAA	1
AAGATCGCCGGAGATGGACCTAGA	1
AAGATCGGATTGCCTGCATATTTG	2
AAGATCTGCCTCTACTGTCGCAAC	1
AAGATCTGTAGATGTCCTGAGTAG	1
AAGATGAAAGTTATCGTGTGCTTA	1
AAGATGAATATGACGGGTGGGTTC	1
AAGATGAATCTGATGGATGGGTA	1
AAGATGAATGGTCAAACATATGAG	1
AAGATGAATGGTCAAACGTTATGC	1
AAGATGAATTGTTGGAATTGGGCA	1
AAGATGACAATTGGTGTGAAATAG	1
AAGATGACCGCACTTCTAATTGCA	1
AAGATGACTAAATGTATGTGTGCA	1
AAGATGACTAATAGCTGATAGTGA	1
AAGATGACTACGTTGGCATGCTAG	1
AAGATGACTTCGTTCTGACGGTCC	1
AAGATGAGGAGCTATTTGCATTGC	1
AAGATGAGGTGGTAAAAAAGGGAA	1
AAGATGAGTATAGAAAAGAGTTGC	1
AAGATGAGTGATTAAATAGTGCAA	1
AAGATGAGTTTTTTCAGTGGTGGAT	1
AAGATGATAGGTTGTTGGTTTGAA	1
AAGATGATGGCTAATGCAATTCTG	1
AAGATGATGGGTTAATTGGATCGA	1
AAGATGATGGTTATGATTGATTGA	2
AAGATGATGTAAGTGCACATGTAC	1
AAGATGATTGTGTGCTGCCAATGA	1
AAGATGCAAGGGGCGACTAGGAGT	1
AAGATGCAATGTGTGTACAACAGG	2
AAGATGCAGGGTGTGTATGACAGG	1
AAGATGCCTGCGTCAGTCACGTGG	1
AAGATGCTCATAGGTAGGGTTTAC	1
AAGATGGACGATTAAAATTGGGCA	2
AAGATGGACGGTCAAACGTTGGAC	2
AAGATGGAGCTGAAACTATTTGGC	1
AAGATGGAGTTGTTTGATGTAA	1
AAGATGGGAGAAACGTTATGCCT	2
AAGATGGGTCTAGTCTAGTACAAG	2
AAGATGGGTCTTACGAAATAAGGT	4
AAGATGGTATAATATTTTGGGTAG	1
AAGATGGTGAATTAGACGATCTG	1
AAGATGGTGGATCTAGATGTGTA	1
AAGATGGTGGGCTAGACGACCTG	1
AAGATGGTGGGCTAGACGATCTG	1
AAGATGGTGGGCTAGATGACCTG	1
AAGATGGTGTCTGCCTCTGTGCCA	1
AAGATGGTTGCTACGCATGACAAC	1
AAGATGGTTGTCCCTGGAGAGTGC	1
AAGATGGTTTCTCCAGTAGTGTG	1
AAGATGTAATGTGTTTATGATACGT	1
AAGATGTATAGGTACTCCCATGGC	1
AAGATGTCAATAGCCCGCAATGAA	1
AAGATGTGAGGTGTGGTGTTGCGA	1
AAGATGTGATAGATAAAACATTAA	2
AAGATGTGTACGATATGGAGGTGG	2
AAGATGTGTCAAATTCCATCCTAC	1
AAGATGTGTCAACCGGTTGGAGGA	2
AAGATGTGTCACATAAGATACTAG	1
AAGATGTGTCATATTTAATACTAG	1
AAGATGTGTGATATATTATGGTAC	3
AAGATGTGTTGATAGAAGTCATGA	1
AAGATGTGTTTCGGATGTGTTCCA	2
AAGATGTTAGATGTGCTATTA	1
AAGATGTTGGGTAGTATACGGATA	1
AAGATGTTTCACCTAGTATACTTA	1
AAGATGTTTGACAATAATTTGAAG	1
AAGATGTTTGCATATGGTCGTCTG	1
AAGATTAAGGGCTTGTTTGAGGGA	1
AAGATTAGCTATTAGGTGGTGTTT	1
AAGATTATAAGAAACAGCTGGTGT	1
AAGATTATTTGTGCCCGTGGATAT	1
AAGATTCACGATCTTTGGGTGTCT	2
AAGATTCGTAGTGCTAGGAAGTGT	1
AAGATTCTGATAGAATGTAAGTGG	1
AAGATTCTTGTATGTCAACTTCGG	1
AAGATTGAATTGCCACGTAAGCGC	1
AAGATTGACGAAATCACCACATGC	1
AAGATTGAGCATATATAGTCGTAC	2
AAGATTGCCATAGGTAAAAACTACA	1
AAGATTGGATGTGACACATTATAG	1
AAGATTGGGAGTATACGTAAAATG	1
AAGATTGGGTTGCTGACACATAGG	1
AAGATTGGGTTGTCACTTCACTAT	1
AAGATTGGTTGCATGGACATCGAG	2
AAGATTGTGGCCTTTACTGTGGGA	1
AAGATTGTTCTAGCTGGTGTCCTA	1
AAGATTTATAGGTGTCGGTGTTAG	1
AAGATTTATCTTAGTGCCCATCGG	1
AAGATTTATGAGGTGGCCTTTGGG	1
AAGATTTGAATTGCTATATTCACC	1
AAGATTTGACTTACAACATGCATC	1
AAGATTTGGTGAGATGGACAA	1
AAGATTTGGTGCAATGAATGAAGT	1
AAGATTTTCTACACCTAGGTGCCA	1
AAGATTTTGGGGGGCTTGGTTTCA	1
AAGATTTTGGGTGGATATAATAC	1
AAGATTTTTGGACCTGCACTGGAG	1
AAGATTTTTGGTGTTGTAGTTCAG	1
AAGCAAACTAGAAAGATGGAACTA	1
AAGCAAAGGAAGATCGGTTTTGGA	1
AAGCAACATTAAATAAGTGCCCGC	1
AAGCAAGAATGAAAGTGTAAGTGC	1
AAGCAAGCTAACTTGGTGTCTG	1
AAGCAAGGTGCATATAACTATAGT	1
AAGCAAGTGCAGAAGTGCCCGGAG	1
AAGCAATAATTGACGGAAGAATAAA	1
AAGCACAAGTGTGATGTGAGTGTCT	1
AAGCACAGGGTCATGTGTATACATG	1
AAGCACCCGTTTAGATGGGACTAA	1
AAGCACCTGTGTGAATTGAGATGC	1
AAGCACGAATGTGTAAAGGTGTAA	1
AAGCACGGTACTTAGATTATTAGA	1
AAGCACGGTGCTTAGATTATTGGA	2
AAGCACTAGATATTGTGGGTTTGC	1
AAGCACTGTGAAGTTGTTGTGTCCT	1
AAGCAGACAGAAGCAGCACAGGC	1
AAGCAGATGGCGCCAAATATAGGG	1
AAGCAGCCAAAATACGTAGTGCAA	1
AAGCAGCCGGATGCCTTACAC	1
AAGCAGCCTAAGAACACACGA	1
AAGCAGTGTCTATGGTGTCATGTC	1
AAGCATAAACGAAAAGATGAGGTC	4
AAGCATAAGCCAAAAGATGAGACC	1
AAGCATAAGCGAAATAATGATGGC	1
AAGCATATGCGAAAAGATGAGGTC	1
AAGCATATTAAGGTTCTATTCGGC	2
AAGCATCGGGGTGTGTCACAGGGC	1
AAGCATCTTTGGGTGGATAGCAAA	2
AAGCATGGTGCATTTGAAGGTAGAG	1
AAGCATGTACGATGACAAATGGGC	2
AAGCATGTGTGCGAACAACGAGGA	1
AAGCATTTAATTGATACAAGTTGC	1
AAGCCAAATAGTTGCAGTGTGCAC	1
AAGCCAACAAAGGCAAGGGGGTCC	1
AAGCCAACCTAAAAAGGGATGTGA	1
AAGCCAACCTAGTACAACGAATC	1
AAGCCAACCTTGACTAGAATGTGA	1
AAGCCAACTGACCTACCACCTTGT	1
AAGCCAATATATATAATAGATTAG	1
AAGCCAATGACATGTGGATCCCAC	1
AAGCCAATGATTAGAGGCATCGGGGGCGC	1
AAGCCACACAATTTGCATCTTGCC	1
AAGCCACACTTGTGACAAAGTTAG	1
AAGCCACACTTTGCCACAGTTTGC	1
AAGCCACCATTGACATCTTGTTGT	1
AAGCCACTTTCAATCTTATGCGG	2
AAGCCATAGGACGAATGATGAGGC	1
AAGCCATCGCCGAATTTGCTGCCT	2
AAGCCATCTTAAAAGGGAGAGCCA	1
AAGCCATGCGTGGACTGTTGTGCA	1
AAGCCCACCTACATGTACGTAATA	1
AAGCCCCAAGATGCCACATAGGAG	1
AAGCCCCACAAAATAAAGAGTGC	1
AAGCCCCACGGGTAGCTACCACCC	1
AAGCCCCAGATGGTTTGGTGGGAC	1
AAGCCCGAAACCCTGGTTTGAGAC	2
AAGCCCGAAATGATGTGACGGAAA	1
AAGCCCGAGACAGTCGAGGATGGC	1
AAGCCCGCAAAAGGTGATGGTTAA	1
AAGCCCGTAAAAGGTGATGGTTAA	4
AAGCCCTACCGAACTATTAGA	1
AAGCCCTGATGGTGGAACTCT	1
AAGCCGAAGGAAGATGGCGGCCTC	1
AAGCCGATGACTACTCCGGGCTT	1
AAGCCGATGATGACTTTGGGCTTA	1
AAGCCGATGCAACAAGTTTGACCGC	1
AAGCCGATGTCTAAGATGATGGTCGA	2
AAGCCGCAGGTGTCATCGGATCGC	1
AAGCCGCATTTGACCGTGGTCTTG	1
AAGCCGCTAACGGTTTGGTGGGA	1
AAGCCGCTGTTGCCTCCTCCGTGCA	2
AAGCCGGACGGTCAAAGTTGTGCA	1
AAGCCGGCTAAATGCTGAGATGGA	1
AAGCCGGCTAAATGCTGAGGTGGA	3
AAGCCGGTCGGTGAAGACGTAGAC	1
AAGCCGGTGACTAATTAGGGCAAG	1
AAGCCGGTGGGTGGCAACGGGTT	1
AAGCCGGTGGTGAAGTCGTAGACG	1
AAGCCGTGTCAATGTTGTTTTGCG	1
AAGCCTAACATACGAACATGCCAC	1
AAGCCTAATAACGCTATGATTTGG	1
AAGCCTACTATAAGCTTAGATGGA	1
AAGCCTAGACTTGCGGATGGACAA	1
AAGCCTCAATTATTGCACCAACGAT	1
AAGCCTCCACTACTGTCATTAGGA	1
AAGCCTCCATATTGTAGTGCTCGA	1
AAGCCTGATGGAGCAATGCCGCAC	2
AAGCCTGGTAACCACGGTAACCGC	1
AAGCGAAAAGACTATGATGCCTA	1
AAGCGAAATGATGGGACCGTTAAT	2
AAGCGAACGTGGTGGCTCCTTTCA	1
AAGCGAATATAGGACTGAATGTGA	1
AAGCGAATGTTGAGAAGCCTC	1
AAGCGACACATCAATACCACGTGG	1
AAGCGACGAGGATGATGGCGACGC	1
AAGCGAGAGGTGACTAAAACTGTC	1
AAGCGAGGGGAGCCGTCAAAGATG	1
AAGCGAGGGTGCGACTCCTTTCTC	1
AAGCGAGTTCGTGACAGAGGTTGC	1
AAGCGATAAATAATATGAGACGGA	1
AAGCGATAACTAATATGGGATGG	1
AAGCGATAATAGGTGCCAAATTGA	1
AAGCGATATAAACTGTTAGGTTGT	1
AAGCGCAAACTGATTGGAGGTGGT	2
AAGCGCAATAGAACCTGTGGTAGA	1
AAGCGCCAAAGCAGGTAATGTGCA	1
AAGCGCCTGTGGTCGTTGCCCTAG	1
AAGCGCGGTGCTTAGATTATTAGA	1
AAGCGCTACGTCAATGCCACGTGG	1
AAGCGCTTACCTGATAATAAGTGA	1
AAGCGGAAAAAGAAACGGGTTTGC	2
AAGCGGAAGCTAAAAGGAGCCACC	1
AAGCGGACAACATCGGCTGTGGCT	1
AAGCGGACCACTTAAGCGGCGCCT	1
AAGCGGTACCAAAAAATAGCACAA	1
AAGCGGTGCAGGTATGGAAATTAG	2
AAGCGGTGGTGACGAACGGGTCC	1
AAGCGGTGGTTGAAGGGCTTTGCA	2
AAGCGGTTGTACAGGTGAAGGTCC	1
AAGCGGTTTTGGCTGACGTGGCGC	1
AAGCGTAAAAGCAGATCTGTGC	1
AAGCGTAATACCCTACTCCTGTG	1
AAGCGTCACGTAAATGCCAAGTGC	1
AAGCGTGATTTTGATGAGTATGGT	2
AAGCGTGCTCACGGAAAACGAG	1
AAGCGTGCTCACGGAAAACGAGGG	16
AAGCGTGGTGCTTAGATTATTAGA	5
AAGCGTGTACACGAAAAACGAGAG	1
AAGCTAAAATAGTGAGGTGGAGGA	3
AAGCTAAATAGGTACTAACTAAGA	1
AAGCTAAATTTTAGCTATTCCAGCA	1
AAGCTAACGTTTTGCAAAAGGGTC	1
AAGCTAACTCCAACGGGAGAAGTG	1
AAGCTAAGCAAAGAGGAAGGGTGG	1
AAGCTAAGGACCTATGAATTGTAT	1
AAGCTAAGGGCCTGTTTGGTACAGC	1
AAGCTACCGTGTGCCGGATTAT	1
AAGCTACTGACTGATGATGCA	2
AAGCTACTTACGAGGAAATGTGAC	1
AAGCTATACGTGAGATTGCGGT	1
AAGCTCAAACATAAGATGCATTGC	1
AAGCTCAACAAGCTTGTCTATGTC	2
AAGCTCAAGGCTAGATATGTGCCA	1
AAGCTCAGGAGGGATAGCGCC	2
AAGCTCAGGAGGGATAGCGCCTCG	1
AAGCTCCCCGACTGACCGACTCCT	1
AAGCTCCGACGTGGGGCATGGGCA	1
AAGCTCGATAGGGCCTACCATATA	1
AAGCTCGGCCAGGCTTGATAAAGC	1
AAGCTCGGTTCCCAGGAATGATGC	1
AAGCTCGTCGGGGAGGTGATGC	1
AAGCTCTGGAGTAGATGACCGGGC	1
AAGCTGAAAATGATGGAACCACTG	3
AAGCTGACGACGGCTACGGTGA	1
AAGCTGATACGGGTGTCTAATTTAG	3
AAGCTGATAGGGAAAGATGGACAA	1
AAGCTGATGAAGAATGATGGGCAA	2
AAGCTGCACAACACGGCTAGGTGG	1
AAGCTGCATAATGGGTACTTC	1
AAGCTGCTTGTGGGATGGAGAC	1
AAGCTGGAGCTGTGGACTACTGGA	1
AAGCTGGATTGTTTGGGGGAGCTTC	2
AAGCTGGCTTCTTCTGTAAGCTGG	1
AAGCTGGTGGGTGTAATATAGCGC	1
AAGCTGGTTGTAGGTGTTCGATG	1
AAGCTGTCACCTAGGATGAAAAAT	1
AAGCTGTGTCAGGGATGTCATGGA	1
AAGCTGTGTGATGCGAGCGGTTGC	2
AAGCTGTTGAGGGTGATTGAA	1
AAGCTTAACATGCAAAGATGCCAC	1
AAGCTTAGGCCTTATTTAGATGG	1
AAGCTTATACTTGTGGGAGCCTC	2
AAGCTTGAAACGATGATTATGCAA	1
AAGCTTGGGGGATCCTCACAGGGCT	1
AAGCTTTCGGATAATACATACTTC	1
AAGCTTTGAGGGAGGGAGGTGCTG	1
AAGCTTTGGACGATGTGGTTGGCGG	1
AAGCTTTTGGGTGAACTGGCCAGC	1
AAGGAAAAAAGCGCGGGAAAGTGC	1
AAGGAAACCATGTCTTATGTAGAC	3
AAGGAAACCTACAAATAAACCCA	1
AAGGAAACGGCAGCCCCCAACCTTA	1
AAGGAAACGGTCCTTAAGTGCAAG	2
AAGGAAACTAACAAACTCTT	1
AAGGAAACTTACAACGTGATTGC	1
AAGGAAAGACAACCAAGTCAGGTC	1
AAGGAAAGAGAAATATGGTTGCTA	1
AAGGAAAGGGCTAGCACTGGGACC	1
AAGGAAATACCTCTATGTGTGCCA	1
AAGGAACAGGGATATCAGTGC	2
AAGGAACTCGACAGTCAGGGGTGG	1
AAGGAACTCGGCAGTAAGGGGTGG	2
AAGGAAGAAGAGAAGATTGATGCA	1
AAGGAAGAGACTACTACGGTGAC	1
AAGGAAGATGGACCGATAGGCGGG	1
AAGGAAGATTGTCCGTGACGTGTC	2
AAGGAAGCAGGATTACAGTTTGAG	2
AAGGAAGCTACGGTCGAGACCACTC	3
AAGGAAGGATTACAGATATGGAAG	1
AAGGAAGGTGTTCTCGTGTGGGAC	1
AAGGAAGTATTTGTCTAGTGTCT	1
AAGGAAGTTTATCCAGAAGTGAC	1
AAGGAATAAGAGGAGCCTACGCGT	1
AAGGAATAAGCTCACTTGAGGTC	2
AAGGAATACGGAATGAAGAGATGG	1
AAGGAATATATGTAGAGATTTGTG	2
AAGGAATCAGGGGCATACAGC	1
AAGGAATGCCACGTTGATGTCCGC	1
AAGGAATGTCCTGATTCATTGTGC	1
AAGGAATGTGTTGATGATTGAGTG	1
AAGGAATTCTTTGAGGTGTTCTAC	1
AAGGAATTTCGGGTGAATGTGACA	1
AAGGAATTTTTCCAAGAGGTTGTAC	1
AAGGACACATAAAGTGAAGGTGAT	1
AAGGACACTGCCACATAATGTCTC	1
AAGGACAGACCCAGCCCTCGGCCC	1
AAGGACAGCTTGCATAGATGGACC	1
AAGGACAGTGGATGATGGTATAGT	1
AAGGACATGTAGCCTAGTGGTTGT	2
AAGGACCAATGAGTGTATGCATGC	3
AAGGACCGACATGGCTGTCACCAC	1
AAGGACCGTTGGTGCAGTGGTTAA	1
AAGGACCGTTGGTGCATTTTACTC	1
AAGGACCTAAAGTGAATGGGTTTTG	1
AAGGACGACATTGAGGGCGACGCCA	1
AAGGACGGGATTGAGGAGACTGAG	2
AAGGACGTGCGTGCATTACACTCA	1
AAGGACTACTCGGATTGTTGGTTT	1
AAGGACTAGTATGTTTGGGAC	5
AAGGACTGACAGGGGATGAACCAA	1
AAGGACTGGGTGCTAGAGCATAAT	3
AAGGACTTACAATGTAAATACATG	2
AAGGAGAAGAACGATGGTGATTCA	1
AAGGAGAAGTGCAGGGCGCCC	1
AAGGAGAGGAAGAACTGCCGGTGTA	1
AAGGAGAGTTTGATAGTGTTC	1
AAGGAGATGTCTGAACAAACAGA	1
AAGGAGCACCAGGAATGATGCGAC	2
AAGGAGCCAATTGTGGTCTTGTA	1
AAGGAGCCAATTGTGGTCTTGTAC	1
AAGGAGCCATATGTGAAAATAGAG	2
AAGGAGCCGTCTGTGAAAATGCAG	2
AAGGAGCCGTCTGTGAAAATGCCA	1
AAGGAGCGCCGCCGTCCACGTCGG	1
AAGGAGGAATGTGCTAGCAATGAA	3
AAGGAGGAGGGAAGGAAGGAGGGG	2
AAGGAGGAGTGTCGCCGCTGATGG	1
AAGGAGGCACCACGTTTACTGTGG	1
AAGGAGGCGGGTGTAGAATAGAGC	3
AAGGAGGGATGTGATTTAGACTTC	1
AAGGAGGGTGTCTTTGTCCAGA	1
AAGGAGGTACCACGTTCACTGTA	3
AAGGAGGTGCATCTATAATCAATG	1
AAGGAGGTGCGGCATTATAGATTG	1
AAGGAGGTGCTTACATTGGAG	1
AAGGAGTAGTTAAGATGTGAATAA	2
AAGGAGTATGCCTGCGTGTTTCGA	2
AAGGAGTCCTATTGAAACCAAG	1
AAGGAGTGATTGAAAAAGGTGTAT	1
AAGGAGTGCAACTAACACCTGAGA	1
AAGGAGTGCGCATTGGGAACATGCA	1
AAGGAGTGTTAAAGAAGAGAGTAT	1
AAGGATAGGGTGAGTGCCGCTAGT	1
AAGGATATACCTAAGCTGCGATAC	1
AAGGATGAAGCGGTTGCATTGGTC	1
AAGGATGACGATGATTGTGGGT	1
AAGGATGAGGCTTCGAACCCAGAT	1
AAGGATGATACTGGTCACAC	1
AAGGATGCCGATACAAATTTCCAG	2
AAGGATGCTGATCTGGATTGTTGA	1
AAGGATGGAGAAACCGATAGGCGG	1
AAGGATGTGCCACTGGTACTAGT	1
AAGGATGTGTTCTATCGTAGTACG	1
AAGGATTCCAATGGTGGTGGTGGG	1
AAGGATTGTGTACAGGGTGGTCCA	1
AAGGCAAACCGTGGGTTCCCGTG	1
AAGGCAAATTGATGGAGATTGGAG	1
AAGGCAACCTAGAAGAGGATGTGA	1
AAGGCAACCTAGAAGATGGGATGT	1
AAGGCAACCTAGGAGGGGATGTGA	1
AAGGCAAGTCACACAGATCCCAAA	4
AAGGCACGGTGTAGTGGGCAGTGA	2
AAGGCACTACGTTCAGCGGCATTA	1
AAGGCAGAGCCACTGATGGAAGGA	1
AAGGCAGGCAAGAGGCCCTCTAGG	1
AAGGCAGTGGTGAGCTGGATTCGC	1
AAGGCATGTGGCCCTCTGGAGCGG	1
AAGGCCAAGGGTGGTGATGTACGT	1
AAGGCCATAGAGAGATACTACGAC	1
AAGGCCATGCCTAGGGCACACCAA	1
AAGGCCATGGTAAACTACTTACC	1
AAGGCCCAAAACGCTGTAGAAGGT	2
AAGGCCCAACTAAATCTACGTGA	1
AAGGCCCCGTTTGGTAGGGCTCCA	1
AAGGCCCTAGGCTTGCCTCGCCTC	1
AAGGCCCTGTGTAGTTGAGGAAAA	1
AAGGCCCTGTTTAGATGAGACTAA	1
AAGGCCGCGATCTACTGGAGTAGC	1
AAGGCCGTCAGAGGTGTTGGTCTA	1
AAGGCCTATTGCTGAAGATGTGCT	1
AAGGCCTCTCACAGTGCACTGAGC	1
AAGGCCTGTTTGGGAGAACTTAAG	1
AAGGCGCTTTGGTTGATGGAGACC	1
AAGGCGGACGATCAAAATTGAGAGA	1
AAGGCGGACGATCAAAGTTGTGCA	1
AAGGCGGTGCTTGATTTTTCCTGT	1
AAGGCGTGTAAAAATATGGTGTCA	1
AAGGCGTTACAATAGTATTGAAGC	1
AAGGCTAAAAACAATTGAGGTGAT	1
AAGGCTAAATCTGTTGTCGGTGGA	1
AAGGCTAGAAATAATTGGGGTGAT	1
AAGGCTAGCCTCAAGTGTCTCAAG	3
AAGGCTAGTCTCGAGGGCGTGCCA	1
AAGGCTATAAACTTTGGGTGACC	1
AAGGCTATGTTGAAGGATGTCTT	1
AAGGCTCAGTGTCTAGGAATAGTC	1
AAGGCTCTGATACCATGTGATGGA	2
AAGGCTGAATACTGAGGTGGATGA	4
AAGGCTGAATACTGGGATGGATGA	1
AAGGCTGAATGCTGAGGTGGATGA	1
AAGGCTGCGAGAGTGCTAACACCT	1
AAGGCTGTGTTCGCATGGGGTGG	1
AAGGCTTATGATCGAGTTGACTGG	1
AAGGCTTTGAATCGCTCCGAT	1
AAGGGAACCCTAGGGTCGTGCTAC	1
AAGGGAACTAAACACAGCCAGTG	1
AAGGGAATGGTCTAGATTCGTTGT	1
AAGGGAATGGTTGTGATTGGTTGA	1
AAGGGACCAATACAGTCGAGGCTA	1
AAGGGACCCCCTGGACAGGACCTA	1
AAGGGACCTAACATATACGTAGTG	1
AAGGGACTAACCCATTGGGCTCAG	1
AAGGGAGAAGCACCGCCGCAGAAG	1
AAGGGAGCCTTGTTTGATTTA	1
AAGGGAGGTAGCGAACTGGGTTGG	1
AAGGGATATTTTATTTTCCTGTGC	1
AAGGGATGCTATAGGAGTATCTGG	1
AAGGGATTCGTAATATTAGGATGC	1
AAGGGATTTTGATATTTTGCTTAC	1
AAGGGCAACAACAATGTATATGG	1
AAGGGCAACCTCAATGTTTATGGT	1
AAGGGCAAGAGGTGTATGGTTTC	1
AAGGGCACCTTTGAATCAAAGGA	1
AAGGGCAGGCAATGATGGAAAGAA	1
AAGGGCATCCTCAATATTTGTGGT	1
AAGGGCATGTAGCCTAGTGATTGC	2
AAGGGCATGTAGCCTAGTGGTTAC	3
AAGGGCATGTAGCCTAGTGGTTGC	1
AAGGGCATGTAGTCTAGTGGTTGC	2
AAGGGCATTGGCGGCTTCCGTCGG	1
AAGGGCCAAATAGGAAAATTTCCT	1
AAGGGCCACGACAGCGTAAATCGC	1
AAGGGCCCCTTTGATTTGTAGGA	1
AAGGGCCGCCAGCGGAAACACATC	1
AAGGGCCGTTAGGAGGAGGTGGAG	2
AAGGGCCTAAAGCGAACGGTTTT	1
AAGGGCCTAACATGAATGTATGAC	1
AAGGGCCTAATAGCAAATATGCGG	1
AAGGGCCTATAGCCTAGTGGTTAT	1
AAGGGCCTCAAAAAATCTCGCTGT	1
AAGGGCCTGCAAAACATCGGCTCA	1
AAGGGCCTGTGTGCATAGGATACG	1
AAGGGCCTGTTCACTTTGATGTC	2
AAGGGCCTGTTTGACACACCTCC	1
AAGGGCCTGTTTGGGGTAGCTTTA	1
AAGGGCCTGTTTGGTACAGCTCCA	1
AAGGGCGAACATGCAGATTGATAA	1
AAGGGCGTGCCAGTATAACTAAGT	2
AAGGGCTATGTGGCATATCCATGT	1
AAGGGCTATTTCATTGAAGGGCTA	2
AAGGGCTGCCTGCGCCTCCTG	1
AAGGGCTGTGACAGTTGAAGATGT	3
AAGGGCTGTTTGGTTGAGTGCCAA	1
AAGGGCTTATAGATTTGTGGTTAC	1
AAGGGCTTATTTGGTACAGCTCCA	1
AAGGGCTTGCACAAAACTAAGTTG	1
AAGGGGACACCTATGGGTATAAAT	1
AAGGGGAGGATGAAAGGTGGCC	2
AAGGGGATACCACATGTGCTGCGA	1
AAGGGGCCGCATCTCTCAGGAGAGC	3
AAGGGGCCGCCTGCAAAATAGCCG	1
AAGGGGCCGCCTGCAAAATGGC	1
AAGGGGCGGAATTCGTGAGTC	3
AAGGGGCTTGTTGGATATGTGGA	1
AAGGGGCTTTCGGACATGAATGAA	1
AAGGGGGATTGAAATTGTTTGG	1
AAGGGGGCCGCCTGCAAAATGGCA	1
AAGGGGTATGCGATTTCAATCTGA	2
AAGGGGTATTTGAATAAGTGCCAA	3
AAGGGGTCGGTCTTTTTGGAAGGC	1
AAGGGGTGACGTTTCCATTGTGAT	1
AAGGGGTGAGACTTCAAACACAGG	1
AAGGGGTGATGGGTATGTCGTGGG	1
AAGGGGTGCTCTTGATAGAGTTGT	1
AAGGGGTGTATGCAATTGAATTG	1
AAGGGGTGTGTGATTTCAAATCTA	1
AAGGGGTTATACGATATATCGG	1
AAGGGGTTTTCGGACACGAATGGAA	1
AAGGGGTTTTTGGACACGAATGA	1
AAGGGTAACTACATTAGTGCATAA	3
AAGGGTAAGATAAAGGTGACACAC	1
AAGGGTAAGCGGCCTTCTCGGTGA	1
AAGGGTACAGAAGGATTAGGTGAA	3
AAGGGTACCACAATAGCAATGCTT	1
AAGGGTACTGTCACGATTTCCCC	1
AAGGGTAGTCTACAGACGGTCTAG	1
AAGGGTATATAGCCTAGTGGTTGC	1
AAGGGTATTTTCGTATTCGGGGCT	1
AAGGGTCAGAAAAGATGGGTGTTT	1
AAGGGTCATCTGTGACGGGCGCTA	2
AAGGGTCCACATATCATTGACAGG	1
AAGGGTCCTGAAGATTGAACAGTG	1
AAGGGTGAATAGCCAAAGTGGTCC	2
AAGGGTGAATAGCCAAAGTGGTTC	1
AAGGGTGAATAGCTAATATGGTCC	1
AAGGGTGACACATAGACAACAAGGTTGTCAG	1
AAGGGTGCATAATGGACATTATAA	1
AAGGGTGCGCCCTGCGTCAGTGGG	2
AAGGGTGCTAGCTCAGATGTGAGC	2
AAGGGTGCTGGATTTTTAACAGAC	1
AAGGGTGCTGGTGCTAACCATGTA	1
AAGGGTGGAAACTGGGTTAACTAG	2
AAGGGTGGAGCTAGAACGAAATG	1
AAGGGTGTACTTGGCATACTGTAG	1
AAGGGTGTAGCTATATTTATGGCG	2
AAGGGTGTATAACTTTTGATGGTTA	1
AAGGGTGTGTGTATATATATATAT	2
AAGGGTGTTATGGATTATAGTCCA	1
AAGGGTGTTGCCTGAAAAATGGTC	1
AAGGGTGTTTGCATGGCTGGATCC	2
AAGGGTGTTTGGTTGGTGGGCAAA	3
AAGGGTTATGTCTGCATGCGA	1
AAGGGTTGAACAGGAAATACGCGG	1
AAGGTAAAATAAATGGATGGTTAA	1
AAGGTAAAGAGGATGCCCGCTGCT	1
AAGGTAAGGTTGCCTATGGTGTT	2
AAGGTACCAAAAATTTAGTGTAA	1
AAGGTACCACTGCAACATCCGACC	1
AAGGTACCATGAGGTAGCAATA	1
AAGGTACCGAATTTACAGTAAAAA	1
AAGGTACCGGATATATGATGATACC	1
AAGGTACCGTCTGGATACTCCAC	1
AAGGTACCTAAATTTTACACTAA	1
AAGGTACCTCGGCAGTATTTGACC	1
AAGGTACTATGAGGTGTAATGAGG	1
AAGGTACTTACCAGTAAGGTGTG	1
AAGGTAGAAATGTTATTGATTGCA	1
AAGGTAGGCCGCTGATAGTGACAG	3
AAGGTAGTACAAGAGGTTTGGTAA	1
AAGGTATCGTTGTCATTAACAGG	1
AAGGTATGGTGTCTTTGAAAGCA	1
AAGGTATGTCCTTCCGTTGGTGGT	1
AAGGTATTGTAATGGTGTGATCCG	2
AAGGTATTTTGGTAGGATGTGACA	1
AAGGTCAGCGCCAACTTACTTGGC	1
AAGGTCATGTAGCCTGGCGGGTAC	1
AAGGTCCAAAGGTTGATGAGATGCG	1
AAGGTCGAAATGCCCGTTGGTTGC	1
AAGGTCGATACTAGCAGTTACAAG	2
AAGGTCGCCACATTCGTTGGGAGA	2
AAGGTCGCCGAACAGATCAGGTCG	1
AAGGTCGCCGCGCGAGTCGCGAAG	1
AAGGTCGGTGGTGTCGGTCTTACA	6
AAGGTCGTTCAGAAGCAAATGCCT	1
AAGGTCTAACTAGCAAACCGCTCC	2
AAGGTCTTGGCTTTTGGATTGTGT	1
AAGGTGAAAATGGCATCTCAC	1
AAGGTGAAGCTAATATTGTTTGGT	2
AAGGTGAATGAAGCAAATGATGAC	3
AAGGTGAATGGTGAGATTAGGCAG	1
AAGGTGAATTATGCAGCAATTAGG	1
AAGGTGACAAGGAGCTTGAAAGGT	1
AAGGTGACATAGGGTGAATCTCGG	1
AAGGTGACCGGTCTGTGACTGGT	2
AAGGTGAGAGCTAAACATTGGCCC	1
AAGGTGAGATACGCCTGCTACTGC	1
AAGGTGAGGGATAAACATTAGCC	1
AAGGTGAGTAGTTCAGGAATTGAA	1
AAGGTGAGTGCGCGTGTGTTGTT	2
AAGGTGATAATAACGTGTGATTAA	1
AAGGTGATATGTGTAAGTGGGTCCG	1
AAGGTGATCTTTGTAAATGGGCGC	2
AAGGTGATGAGCTAGACGGCCTAG	2
AAGGTGATGGGCTAGACGACCTGG	2
AAGGTGATGTAATGGCCACTGATTA	1
AAGGTGATTGAGGAGATTGGGAA	2
AAGGTGATTGGCTAGACGATTTGG	2
AAGGTGATTTGGGATACGCTTCGG	2
AAGGTGATTTTGGTACCTCATGGT	1
AAGGTGCACATACATAATCCGTTG	1
AAGGTGCAGTTGTAGTTACGACTG	1
AAGGTGCATATGTGTATTGTGCAG	1
AAGGTGCATGACATTTCAAGAACC	1
AAGGTGCCCACGCATGTGCGCGGG	1
AAGGTGCCCGCGCATGTGCGTGGG	2
AAGGTGCGATGGGTTAGACTCATC	1
AAGGTGCGCTGTAATGGGTTATGT	1
AAGGTGCGGGGCTAGAGGGTACAG	2
AAGGTGCTAATAACGTGTGATTAA	2
AAGGTGCTGAGTTCAAATCTTCA	1
AAGGTGCTGAGTTGGAATCCCATT	2
AAGGTGGAAAAGAGGTGAAGAAGC	1
AAGGTGGAAATGGACACCATGCCA	1
AAGGTGGAAGGAGACTCAGGGTAGC	1
AAGGTGGACCATATTTTTAGCTGT	3
AAGGTGGAGATGGGCCTAACTATG	1
AAGGTGGAGCTGAAACTGTTTGGCT	1
AAGGTGGAGCTGGGTTTAGATAAC	1
AAGGTGGAGGCTAATAATTAGCC	1
AAGGTGGCACAACCCAGTGTGCAT	1
AAGGTGGCGACTAGATGTGTTACA	1
AAGGTGGCGTTGCCGATGAGGCAG	2
AAGGTGGGAGTAGTTAGTACTACA	1
AAGGTGGGCCCTATGAATAGTGAG	1
AAGGTGGGCCTTATGAATAGTGAG	4
AAGGTGGGCTAGGTAGATCGTGTT	1
AAGGTGGGCTCTATGAATTGTGAA	1
AAGGTGGGCTTTTGTGATTTTCCAA	1
AAGGTGGGTGTATGTCGTTGTTGA	1
AAGGTGGTACTAAACTCTACATGC	1
AAGGTGGTACTAAAGGTTGACATG	1
AAGGTGGTACTCCCTGCGTTTCAG	3
AAGGTGGTAGCATACTCACTCCGT	1
AAGGTGGTAGGCCAGATGATCTGG	1
AAGGTGGTCTTTGGTTGGAGGGAC	1
AAGGTGGTGAAAGGGTAGAATTGT	1
AAGGTGGTGAGCTCAACGAGAGGT	1
AAGGTGGTGATAGACGATCTGGGT	1
AAGGTGGTGCGAATTGAGTGGCAT	1
AAGGTGGTGGACTAGATGATCTGG	1
AAGGTGGTGGACTAGTCGATCTG	1
AAGGTGGTGGGATAAGCGGCCTGA	1
AAGGTGGTGGGCTAAACGATCTGG	1
AAGGTGGTGGGCTAAATAACCTGG	1
AAGGTGGTGGGCTAGACAACCTG	6
AAGGTGGTGGGCTAGACAACCTGA	1
AAGGTGGTGGGCTAGACGACCCG	1
AAGGTGGTGGGCTAGACGACCTA	2
AAGGTGGTGGGCTAGACGACCTGG	2
AAGGTGGTGGGCTAGACGATCTGA	1
AAGGTGGTGGGCTAGATGACCTG	3
AAGGTGGTGGGCTAGATGACCTGA	1
AAGGTGGTGGGCTTGCCAACCTAG	1
AAGGTGGTGGGTTAGATGACCTG	2
AAGGTGGTGTTTAGATCCAGGGA	1
AAGGTGGTGTTTGAATGTCCTGAA	1
AAGGTGGTGTTTGGATTCAGTGACT	1
AAGGTGGTTTCGTCGACGTGGCAGT	6
AAGGTGTAATATCGACCGGGTGAC	1
AAGGTGTAATTAGCTGATGGACAC	1
AAGGTGTAGACGTGCATTATGCAG	1
AAGGTGTATATGACATATCCTAGT	1
AAGGTGTATGGTTTCTATTTTAAC	2
AAGGTGTCAAATGCGCTTTTGTGG	1
AAGGTGTCAATCTGAATTGTTTGGA	1
AAGGTGTCACATCGAATGTTTGAT	1
AAGGTGTCCGGAAAGATTGTGTCC	1
AAGGTGTCGGTTCCGTATAACCAG	1
AAGGTGTCGGTTCTACCGGATGAC	1
AAGGTGTCGGTTCTATGTTTT	1
AAGGTGTCGGTTTTGAATACAGA	1
AAGGTGTCTAAAGTGAAACCACTA	1
AAGGTGTCTATTTTGATTGGTAAT	3
AAGGTGTCTGGAAAATTCGCTCCC	1
AAGGTGTGATGAGGACAGCAAGCT	1
AAGGTGTGCTTGGTTTGTTACTAT	3
AAGGTGTGGCTCATTTTTTTAAGC	1
AAGGTGTGGGCCCAATTAATTCCC	1
AAGGTGTGTATGAAAAGTGAGATC	1
AAGGTGTGTCCTGAATTGTGCA	4
AAGGTGTGTTTGGTTGTTGGCCACA	1
AAGGTGTTACACGAAGAAGGGCAA	1
AAGGTGTTTTGACTTTGGTCA	2
AAGGTTAAATGGGGGCTGCCCCC	1
AAGGTTAGAGCTACTTTTTGATGG	1
AAGGTTAGGATCTTGCCATTTAGG	1
AAGGTTAGTTGCTAAAGGTTATAG	1
AAGGTTCAATTCCCAGGAGGGAG	1
AAGGTTCCTTGGAGGTTTCGAGGG	1
AAGGTTCGGAAGCGTTTGAGGAAG	1
AAGGTTGAAGTGTTATGGGTGTAC	1
AAGGTTGATGCGGCTGGATTTGGG	1
AAGGTTGATTTAGGCCCTGTTTAG	1
AAGGTTGCACAGGGTGGACGGACA	1
AAGGTTGCGCCGGAGGATTTGCCA	1
AAGGTTGGAGCTGTATTACGT	1
AAGGTTGGATATGATATGTATATG	1
AAGGTTGGCTTTTTTTGACGGAAG	1
AAGGTTGGGCTCATCTGAAAAGGC	1
AAGGTTGTCAAAAAATGTCTACGT	1
AAGGTTGTCGTATGAGGTGTTCGG	1
AAGGTTGTTGGGCCCGATGTTCGG	1
AAGGTTTAAATGGTGTTTTGTCGA	1
AAGGTTTGACTAAAAGATGGGTGT	1
AAGGTTTGACTTAAACATTGTCCTA	1
AAGGTTTGATGCGATGGAAAGTT	1
AAGGTTTGATGTGATGAAAAGTTG	1
AAGGTTTGGTCACGCGTTTTCTCCT	1
AAGGTTTGTACTTTGATGTGATGG	1
AAGGTTTGTCTATTGGGTTGCTG	1
AAGGTTTTAAGGAGGATGAATAGA	1
AAGGTTTTACATACTCTGCCT	1
AAGGTTTTCTACGTAGGTTCGAATCCTGCC	1
AAGGTTTTGCTCTTGATTGATTGT	1
AAGTAAAAATACGGGCCTGTTCAC	1
AAGTAAACTTCAGATCTACCGTGC	3
AAGTAAATTGGGCCTAGATAGATC	1
AAGTAAATTGGTAGCCTAACTAGT	1
AAGTAAATTTAGGACTGGATGTGA	1
AAGTAACCAAGCCTACCAGAGGG	1
AAGTAACTAGCTTATCAGGGGAGC	1
AAGTAACTATAGGTGTCGGTTCTA	1
AAGTAACTTCAGATCTACCGTGCCA	1
AAGTAAGACCTGAACGGTTGATGG	2
AAGTAAGAGCAACGTAGATTGCAA	1
AAGTAAGGGAAAAATCATAATTGC	1
AAGTAATCGTAACAAGGGCCA	1
AAGTAATTATAGGTGTCGGTTCTA	1
AAGTACACGGATTGGATGATGCAC	1
AAGTACCCATAAGGGTAGGGTGCA	1
AAGTACCCGTGTAATTTCAGCCTG	1
AAGTACCGCTTACGGGGTGCTGGT	1
AAGTACCGGTACCTCGAGATACTT	1
AAGTACCTATGTAGTTTTGGGAAA	1
AAGTACTACTATCCAGTGATGTAA	1
AAGTACTGTAGCCCGTGCTGGTGT	1
AAGTACTTGCTACAAGTGCCACATC	1
AAGTAGAGATGCTAGATGATGCAA	2
AAGTAGATATTTACGGGTTTACCT	1
AAGTAGATGGTAATAAACTCGATC	1
AAGTAGCATTAGCTTAGGGTGCA	1
AAGTAGGAAAAGGCTTATAAGTGC	1
AAGTAGGCGGTGAACTCGAGCGGG	1
AAGTAGGGTCTACTGATCGAGTGA	3
AAGTAGGTAAAAGTGAATGGTGGA	1
AAGTAGGTACCGGTACCTCACGG	1
AAGTAGGTAGAAGTGAATGATGGA	2
AAGTAGGTGGAGAATTTAATTGGT	1
AAGTAGGTGGTATGTATGGGTTGG	1
AAGTAGGTTGTCTAGCAAAGGTGG	1
AAGTAGTAATGGTGAGTGATATGT	1
AAGTAGTATCCTGATTCCACGATC	1
AAGTAGTCAGCTATGAGACGATGA	1
AAGTAGTCCATATAGATGGGACCC	1
AAGTAGTGACGAGTGTGACAACAC	1
AAGTAGTTCCTGTTAGATTAA	1
AAGTAGTTGTGCCTTGTACTAAA	1
AAGTATAAAATTTAATGTGTCA	1
AAGTATAAATACCAATATTCATGG	1
AAGTATAAGAGAAAAGATGATGCC	1
AAGTATAAGTCTCTATGGTAGG	1
AAGTATGCCTGGTGTGGTTGTACT	2
AAGTATGGAATAGTGGTGTTTGCA	1
AAGTATGGTATGTCCTTCAGGTTA	1
AAGTATGGTGAATGGTGGCAAAC	1
AAGTATGTAGATGTGTCTTGATCA	1
AAGTATGTTCATTGTGAGTGCAGG	1
AAGTATTCCCATAAAACGCACCG	1
AAGTATTCCTACTGGTAGCAACTA	1
AAGTATTCTGTGGGCCATATACGG	1
AAGTCAACACTGCCACGTGTGCGC	3
AAGTCAACCACACAGGAAAATAGC	1
AAGTCAACGGCGTTATTTAGGGAC	1
AAGTCAACGGTGTCAAACATTTCG	2
AAGTCAACGGTGTCAAACATTTTG	2
AAGTCAACGGTGTCAAACATTTTGA	1
AAGTCAACGGTGTCAAATATTTAG	1
AAGTCAACGGTGTCATACATTTTG	1
AAGTCAACGGTGTCATATATTTA	1
AAGTCAACGGTGTCTAACATTTAG	1
AAGTCAACGGTGTTAAATATTTAG	1
AAGTCAATAGTGCCAAATATGTGT	1
AAGTCACCACAGGAGTCTCGCTGT	1
AAGTCACGATGGGTGTCTTATTGT	8
AAGTCACGTTGGGCCTGCTTC	1
AAGTCACTACTTTATCCCCAGA	1
AAGTCACTGTACTTAGGTGAA	2
AAGTCCAGTGGCTCTACGACAACT	1
AAGTCCATGGGCCGGAATATTTT	1
AAGTCCATGGGGGTCGCTGGGGAG	1
AAGTCCCGATACAGTATAGATGC	1
AAGTCCCGGTTTGTGAAGGATGGC	1
AAGTCCGGTTGATGTGCCGCGCGA	1
AAGTCCTAGACTTGATACGGAGCT	1
AAGTCGATGCGATATGTGGATGCC	1
AAGTCGCGCCTGTGATGTGTGGTC	1
AAGTCGGCTAAATGCTGAGGTGTA	1
AAGTCGGGTGTCTGAGTTTCGTCA	1
AAGTCGTCTACTGCCTCAGCCCAT	1
AAGTCGTGCGTGTGAAAGGTTTG	1
AAGTCGTTTTGACTTTTTTCTTAG	2
AAGTCTAAAAGTGGATGGATGTAC	1
AAGTCTAAACAAAGAGGGCCATAC	1
AAGTCTATAGATCGATCAACTTGC	2
AAGTCTCGCAGATGATGGTAGTGA	1
AAGTCTCTGATTGGTTGTGAAGAA	1
AAGTCTGTGGTTGATGGTACGATA	1
AAGTGAAAAGATGAGGTACTGCTC	1
AAGTGAAATTGTGGAGCTGTCTAA	1
AAGTGAACCAGAAGCTAGAAGC	1
AAGTGAACCCTGGTTAGTGGTGTGG	1
AAGTGAAGATCAACGAATGGATGTT	1
AAGTGAAGATCAACGGATGGATGT	2
AAGTGAAGGGATACCAGTGACGGG	1
AAGTGAAGTTTTGGTGTTAGACAT	3
AAGTGAATGAAACACAGAAGTGGC	1
AAGTGAATGGTAAAGGGTGATTGG	2
AAGTGAATGGTGGAGGATTGTGAT	1
AAGTGACAGTGACATGGTGTAGAA	1
AAGTGACCACTTTAGAGTAGTACT	1
AAGTGACCGCATGCGAAGATCAAT	1
AAGTGACCGGTTTTGATTAGTTAA	1
AAGTGACGTGGTGATGTAGAGGTA	1
AAGTGACTTTTAAATGCCGTTTAC	1
AAGTGAGAAGTTTGTGTGTGTTA	1
AAGTGAGACGAAGACTAGGTCAAC	1
AAGTGAGAGTTAGTTAGTAAAGCA	1
AAGTGAGATACTGGGTGTGAACCA	1
AAGTGAGATCAAAATAGTTTGC	1
AAGTGAGCCCCACCTATCAGCGAC	1
AAGTGAGCCTGCTCATCAGATGGG	1
AAGTGAGGCATGATACAAGTGTAGC	1
AAGTGAGGTGTAAATGATATGTAA	1
AAGTGAGTAGAAGTGTCAAATCT	6
AAGTGAGTCCGTGTGGTGTTTTAC	1
AAGTGAGTGCTTCTCAAACGACACG	1
AAGTGAGTGCTTGGTGAGGACCTT	1
AAGTGAGTGGTGGAGGATTGTGAT	1
AAGTGAGTTCGAGCGGTGTTCTA	1
AAGTGATACCTGTGAAGATCGTGC	1
AAGTGATACTTAGATAGGTTGATG	2
AAGTGATAGAGGCTACAAGATTGC	1
AAGTGATCTCGGCGTGCATTTGAC	2
AAGTGATGATCTTTAGTCCCGG	1
AAGTGATGGTATTTCTACGAAGCC	1
AAGTGCAAAATAAGATGACGTGAA	1
AAGTGCAAATGAATTTGGATCACA	1
AAGTGCAACCATAGATATTTGTGT	1
AAGTGCAACCTAGTATAGATGTGA	1
AAGTGCAAGAGCGGGAAACCGTAC	2
AAGTGCAAGTTAGACTATGGCAGC	1
AAGTGCAATCCTTATCGGGTCATCC	1
AAGTGCACTGTAAGTTTAGTACAA	1
AAGTGCAGCCATAGATATTAGTAT	4
AAGTGCAGCCATGAGAATCCGTG	1
AAGTGCAGCCATGAGTTTCCGTGC	3
AAGTGCAGCCATGATTTTCCAT	1
AAGTGCAGCCATGGTTTTCCACGC	1
AAGTGCAGCCATGGTTTTTCGTAC	1
AAGTGCAGCTGTAGATATTTATGT	2
AAGTGCAGTAACACGGTACGTTAC	1
AAGTGCAGTCGTGGATATGTGTGT	1
AAGTGCATCTATGGTTTTCCGCGT	1
AAGTGCATGATTGGATTGGAGATA	1
AAGTGCATGTAGCCTAGTGGTTGT	1
AAGTGCCGATGCCTGAAGCGCTGA	1
AAGTGCCTCTTCTGTAAGTATTTA	1
AAGTGCCTGGAGAGTTTGTCAGAG	1
AAGTGCGACTGTATACCAAGATGT	3
AAGTGCGCAAGCCTGTAGTGGCAC	1
AAGTGCTAAAAATGGGAACATGGT	1
AAGTGCTAAAATTACATATGTAAG	1
AAGTGCTACAACGGTATATCCGTG	2
AAGTGCTACAACGGTATTCCGTG	1
AAGTGCTACATCGGTATATCCGTG	1
AAGTGCTAGGAAGTGAAATAGAATG	1
AAGTGCTAGTAGGACACCATGCTA	1
AAGTGCTATTTTACTATGTGGTTA	1
AAGTGCTATTTTCCTGTACGGTTA	1
AAGTGCTCATAGGGGTAGGGTGTG	1
AAGTGCTCATGAAGGTACACCTCT	1
AAGTGCTCTTGAGGGTTGTCACCA	1
AAGTGCTTGACAACTAAGAGTTGA	1
AAGTGCTTGCAAGGAACTCTTGG	1
AAGTGCTTGCTCATATCATTAGGG	1
AAGTGGAAGCCGTCAGAGGTGTAA	1
AAGTGGACCCAAAGATGATTTCAA	1
AAGTGGACTCTATATTAATTGTAA	1
AAGTGGAGTTGTGGAGCTGCCTAA	1
AAGTGGATTTACGGGTTGACCTAC	1
AAGTGGCAGGTGGGGACAGGTGAC	1
AAGTGGCATAAAAACAACGAGGAG	1
AAGTGGCATACGAGGTACACCAAA	1
AAGTGGCATGCAAGAAACGGGTGT	1
AAGTGGCGCCGGATCTGATCCTCC	1
AAGTGGCTAAAGACCCACTACCC	1
AAGTGGCTACATTCAGTTTGCTGC	1
AAGTGGCTACATTTAATTTGCTGC	4
AAGTGGCTACATTTAGTTTGCAGC	1
AAGTGGCTACATTTAGTTTGTTG	1
AAGTGGCTGACTCGACGTGCCGCTG	1
AAGTGGGAAGATACGTAAAACGAG	1
AAGTGGGCGGCGACGTGGGCGTGC	1
AAGTGGGGAGGTCAATGGGTGTGT	1
AAGTGGGGCTAAATTTTTTGTGAG	1
AAGTGGGTCCTATATTAATTGTAA	1
AAGTGGGTCCTGTATTAATTGTAA	2
AAGTGGGTGCGCTCACGGTGTGGC	1
AAGTGGGTGCTTTCTAGTACAAGA	2
AAGTGGGTGTATAAAATTAAAAGG	1
AAGTGGGTTTCGTCCAAATGCCAC	1
AAGTGGTCCACATGCAAAAATGGA	1
AAGTGGTCCGCCTATGAAATTGGC	1
AAGTGGTGGGCTAAACGATCTGGG	1
AAGTGGTGGGCTAGACGATCTGAA	1
AAGTGGTTCTAAAGGATTTGCCAG	1
AAGTGGTTGCATTGGTTGTATTC	1
AAGTGGTTGCTTCTACACAAAGTA	2
AAGTGGTTGGGACTTGGGTGT	2
AAGTGGTTGGGACTTGGGTGTCCA	1
AAGTGGTTGTGCCTTATATTATGG	2
AAGTGGTTGTGCCTTATATTTTGG	1
AAGTGTAAGTGGGGTGCTATGTGA	1
AAGTGTATACGATAGCAATTGCTT	1
AAGTGTATGGTGAACGAATGTTAG	5
AAGTGTATGGTGAACGAATGTTAGT	1
AAGTGTATGGTGTGCGTATGTGCG	1
AAGTGTCACTGTTAGATCAACAAT	1
AAGTGTCAGTGATTGAAATGGATC	1
AAGTGTCCAGCTACGGTCGATCGA	2
AAGTGTCTATAATTGGAGTGCCAC	2
AAGTGTCTTACTGTCGACAGGTAC	1
AAGTGTCTTATGGTGAATTGTCTC	5
AAGTGTCTTGTAGCAAATTACTA	1
AAGTGTGAAGATGATGGAGAGCTT	1
AAGTGTGATGGTAGTAGAAATAGA	1
AAGTGTGATGTGATAAAGGGTGAT	2
AAGTGTGCATGGGGTGTGGGACCA	1
AAGTGTGCCACAAAAATCTTTATC	2
AAGTGTGCTGGTGTCCTCGAC	7
AAGTGTGGCATGCCAAAGTTATAG	1
AAGTGTGGCCAACAATTTGTTAGC	2
AAGTGTGGCTTACAATTTGTAGGC	2
AAGTGTGGCTTATAATTTGTAGGC	1
AAGTGTGGTAGCTAGACAAATTAC	1
AAGTGTGGTGTCAAACTTCTCATG	1
AAGTGTGGTGTTACGTGTACAGT	1
AAGTGTGTGATTGGTTGAAAAGAG	1
AAGTGTGTGATTGGTTGAAAGA	1
AAGTGTTATGGTAGATATGACTAC	1
AAGTGTTCGGTGTCTAAGGAAACTA	1
AAGTGTTGCACTGTTGGTCTTCT	2
AAGTGTTGCACTGTTGGTCTTCTT	2
AAGTGTTGTCTACGTGGCATGCCAC	1
AAGTGTTTGGGCCTATTACAGGA	1
AAGTGTTTGGGCCTATTACAGGAG	1
AAGTGTTTTGATTGGTTGGGAGAGA	1
AAGTTAAAAGGTTGTGTGCGTAG	1
AAGTTAAAAGTCCTACATGCCAAT	1
AAGTTAAAAGTTTACGTGTGTAG	1
AAGTTAAAGGAAAGTTTGGCATG	1
AAGTTAAGTGCAGCTGAACAGG	1
AAGTTAATGCCCGTCACAGATGAC	1
AAGTTACTTCCTACATCCAGATTC	2
AAGTTAGAGAGGCCTATATGTCAG	1
AAGTTAGGTGGTAGTAGAACTAGA	1
AAGTTATGGTAGTCACAAAAGTGT	2
AAGTTATGTGTATATGAAAGGTTT	1
AAGTTCCTGGACCTAATAGCGC	1
AAGTTCGATGATGACATAGAGGAA	2
AAGTTCTAGGCTACTACTTTCTA	2
AAGTTGAAAATGGTAGCAAAGTGA	1
AAGTTGAAAATTTGTGTGCGTGGA	1
AAGTTGAAACGGAAAAGTTGAAAG	1
AAGTTGAAGGCTTGGATTTCGGTGA	1
AAGTTGAGCTGCCTGTGGGAGTGGA	1
AAGTTGAGGGTACAACGATTCTGA	1
AAGTTGAGGGTGAACGATGTCTAG	1
AAGTTGAGGGTGAAGGTTGTTTGA	1
AAGTTGAGGTGGATTGCATGGTTGA	1
AAGTTGATATACTTTCAAGTGTT	6
AAGTTGCACAAAACCACAGGTATC	2
AAGTTGCAGATGGGTTTACTAAAC	1
AAGTTGCCACACTTTGCCATACTT	2
AAGTTGGACGCGAAAATTTATGAT	1
AAGTTGGAGGACCTAAACGAGTGA	4
AAGTTGGATGTAGATAGATAAA	1
AAGTTGGGGTTCCGAAGAACAAG	2
AAGTTGGGTGCGAAAAACCACGGC	1
AAGTTGGTACATCCAATAGCCTAA	1
AAGTTGGTAGTTTATATGTGTA	1
AAGTTGGTGGTACTAATTGTAGTA	7
AAGTTGGTGTCATTGTCGGTGCAA	1
AAGTTGTATGGGCTAAAGATGCAGG	1
AAGTTGTGCAGTTGCTGCCTC	1
AAGTTGTGCTTAAAGTATTGTAG	1
AAGTTGTGTGCAAATAAAACAGA	1
AAGTTGTGTGTGTATGAAATGTT	2
AAGTTTAAAGACTGCCTATGCACT	1
AAGTTTAAGCCTAAACAAACAAG	1
AAGTTTAGAACTAAACCAGGTGTG	1
AAGTTTAGACAGACCACTGGTGTA	1
AAGTTTAGAGTGAACGGTGTCTG	1
AAGTTTATGTGTGTAGGAAAGTTC	1
AAGTTTATTGAGGGTGTTTTTGAT	1
AAGTTTGACAAAAAAGGTACAAGC	1
AAGTTTGAGGTGAACTTAACATGG	1
AAGTTTGGGACTCGAACGCTGGTC	1
AAGTTTGTATACATTGGTTTTTT	1
AAGTTTTATAGTAGAGGTGATTGC	1
AAGTTTTATGTGATATGATGTGA	1
AAGTTTTGGCGTGCCACATCGGAT	2
AAGTTTTGGTGTGTCATATCGGA	1
AAGTTTTTATGTGATATGATGTGA	1
AATAAAAACAAAAGGATAGGTGAA	1
AATAAAACAAAAATAAAAAGGTTGC	1
AATAAAACAGGGATGGACCTAACC	1
AATAAAAGAAAAACCGATGTTAAT	1
AATAAAATAATGAGAAGAGGGTCC	6
AATAAAATAATGGAAGAAGTGTCC	1
AATAAACAATATAATTGGGTGTTC	2
AATAAACAGAGGAATGCCTACACC	2
AATAAACGTGAGTGCCAAACATTA	1
AATAAACTACATCAGCATAAATCG	1
AATAAAGAATTACGTAGTGTGCAA	1
AATAAAGGAACTACAATCAAGATC	1
AATAAAGGGCCTGTGGTGACTTCA	1
AATAAAGGTGCCGGTTTTGGGTTGA	1
AATAAAGTATGTGTAATGGTTGAA	1
AATAAATACAACGGTGTGATCAGG	1
AATAAATACGGTGTCTCCTTTAAT	1
AATAAATAGGGTGGTAATATGTTA	1
AATAAATATGTGTAGGGCCATTTG	1
AATAAATCAGATGGTCAATTGTTGG	1
AATAAATCGGTTGCCATATTTTGA	1
AATAAATCTAGAATCAGATGTGAC	3
AATAAATGAGCCCGACGACACAT	1
AATAAATGGACCGCAACGAAAATG	1
AATAAATGGATGTCGACTCTACAC	1
AATAAATGGATGTTAACTGACGGC	1
AATAAATGGGAGACGTCTACGCGT	2
AATAAATGGGGGTTATCAACCGGG	1
AATAAATTTGTCTTGGGTTGAAAA	1
AATAACAAAACAAATTACAGGTTC	2
AATAACAAAATGTTTGTTGGGTGG	2
AATAACCAAGTTGGACCTCGATACC	1
AATAACCGTGTCTACCTCTAAAAC	1
AATAACGAATAGACTTAGGGCCTG	1
AATAACGTATACGTAGTGTCTAG	1
AATAACTAGGATGGTGTCCATAGC	1
AATAACTGTGCTGTACTATATATA	1
AATAAGACGAGTGGTCAAACGTTGC	1
AATAAGAGACCCTTGGCTACCGA	1
AATAAGATGAATGGTCAAAGTTGG	1
AATAAGATGGAAGAGATGAGGTGG	1
AATAAGATGGACGAAAAAAAAGAC	1
AATAAGATGGGACCTGATATTAAT	1
AATAAGCAAGGTGGTACTAAACTC	1
AATAAGCCATGCAACTTCTAA	2
AATAAGCCTAAGCCTAAACAAAGA	2
AATAAGCTAGAGAGGTGGACCTGA	1
AATAAGGAGCAATATAAATAGACC	1
AATAAGGATTGTGACATGGATGCA	3
AATAAGGGACGGGATACAAGCGAT	2
AATAAGGGTATTATTGCAGGCAGC	1
AATAAGGTGGTTTGATTGCTTTAA	1
AATAAGGTGTGACCACGTGGGAAT	1
AATAAGGTGTTGATAACGTATGAT	1
AATAAGTATATTAGGGTGTGTTT	1
AATAAGTATTGTGGAAGTGGGTAG	1
AATAAGTGAGGAAAGAGAAAGTG	2
AATAAGTGCAGCCATGGTTTTCCA	1
AATAAGTGCAGCCGTGGATATCC	1
AATAAGTGCAGCCTTGAATATTCG	1
AATAAGTGTCTTATGGTGAATTA	1
AATAATAAAAGTCAATAGTGCCAA	1
AATAATAGGTTCGGTGTCCAGCAG	1
AATAATATATGCTACTTTGAG	1
AATAATATTAAACCCTGGGCCTG	1
AATAATCCTCGTACCGGGATAACC	1
AATAATCTTGATGCCTCACTC	1
AATAATGAGGTGCTCATGATGACT	2
AATAATGCAAAAGGACCTTCGGTA	1
AATAATGGTGATGTGTGCTTTAGG	1
AATAATGTGATGGAAGCAGAGGAG	2
AATAATTAAGAATTGTTGCAACTA	1
AATAATTAGTCGTAAATATGTGCA	1
AATAATTCGGGTGGTTGTTGTGAT	1
AATAATTTCTAGGTTGGTATGGGT	1
AATACAAAACGAGAGATAGTGATGG	1
AATACAACCAATGCAACCACTTAG	1
AATACAACTATAGTGCCCTCACAT	1
AATACAATGGTGTGATCGGATCGT	1
AATACAATTGTGTCTGTTATAGGT	1
AATACACCGCCTAATAGTTTGAGA	1
AATACAGATGCACACGTCGTCGTC	1
AATACAGGACCATTAGTACTAATA	1
AATACATATGTATCGGGTCGGGCA	1
AATACATCATGTGTTCTTGTGCCA	1
AATACATCTGGTCGCCACCTTCGA	1
AATACATGTGTGTATGATATGTGG	1
AATACATTATAGTACTACGAATCA	1
AATACATTCTAGTACTACATTACA	1
AATACCAAAATACAAGATGGATGG	1
AATACCACATGGAACGAAGACCTA	1
AATACCACATGTTTAAGTGTGGGA	1
AATACCAGGGATGATACCTTTCAG	2
AATACCGACAGCTGGTACTGGTTC	1
AATACCGGATGTGACACTTTATAG	1
AATACCGTTTTCGGGCCGGGGTGT	1
AATACCTACTAAAAATGTATCTGC	1
AATACCTGGTCCTACCTGTTATGC	2
AATACCTGGTCCTACTTGTCATAC	2
AATACGACCTTCGTCATCATGTGT	1
AATACGAGACGGAACGAATATGGT	1
AATACGGATATTTATGGCTGCAC	1
AATACGGATGGTCAATGTTGGACA	1
AATACGGGGTATACTATGAAAGA	1
AATACGGGTAGTGGGGTAGAGACC	3
AATACGGGTGTCTAAATTTGCATA	1
AATACGGGTGTCTAGATTTATCGT	1
AATACGGTGGACCCATTATTTGTC	1
AATACGTAGCACCTTAAGATGCCA	7
AATACGTGATGGTTTGATGGGCTT	1
AATACGTGCGACAACGGTAAGTTG	1
AATACGTGTATGATGGGTGGGACC	1
AATACGTTTGAGGTGGGTGTAGAG	1
AATACGTTTTGGTGTCGTTTTCAC	4
AATACTAAAATGTGTCACATCCGA	1
AATACTACAAATCTGGACAGGTTC	1
AATACTACTTTGATCCACAGTATC	5
AATACTAGGATGTGTCATAGCCAG	1
AATACTCATGTGTTGTGAATCGA	1
AATACTCGATGACCGATGTGACAC	1
AATACTCGGGAATAAAGATGGGAG	1
AATACTGATGTGTTTTGGCCGAAG	2
AATACTGCTAGATGTTGCATT	1
AATACTTACGGATACCAAGTTTGA	2
AATACTTCAAATGTGTGTCCGTAT	1
AATACTTTAAATGTGTGTCCGTATG	1
AATACTTTCCGAGTATATAAATGC	1
AATACTTTTTACCTGCCTATCACT	1
AATAGAAAAAGTGGTACCTCATGG	1
AATAGAAAACTGCTGGTGCACCC	2
AATAGAAAAGTAATGCAGTGCCAA	1
AATAGAAAATATACCTGCTTACAT	1
AATAGAAACATGGTGAACTTTGGG	1
AATAGAAGAAAATAAGGTGAA	1
AATAGAAGGTGATGACGTGGCCAC	1
AATAGAATGCTGACTAGACTGCCA	1
AATAGAGACGGTACTGATGAATGC	1
AATAGAGAGAAAATAATGGCGCAC	1
AATAGAGAGACGGTTGGAGTGA	1
AATAGAGAGGTGCTACCTGCTTGT	2
AATAGAGGGTATACGACAATGTGG	1
AATAGAGGGTTTCCAAAATATATA	1
AATAGAGGGTTTCCAAAATATGTG	1
AATAGAGGTCGTGGGAACAAATCC	1
AATAGAGGTGATGGGTAACCTAGC	1
AATAGAGGTGGGTGCTACATCTAA	1
AATAGATAAATTTAGAGGTGATAG	1
AATAGATAGATAGATATGGACGC	1
AATAGATAGGTGATACCATTAGAG	1
AATAGATGGCTGAATGAAATATTC	1
AATAGATGGTGTGAGGAGTGAGAG	1
AATAGATGGTTTCCAAAATATGTG	1
AATAGATGTCTAGGATTCATGCAC	1
AATAGATGTCTGAGATTGATTCAC	1
AATAGCAAAATTAGCTACAGGGAT	2
AATAGCAGCCTCAACATATGCAAC	1
AATAGCCAAATTGTTGCAAAGG	1
AATAGCCGGTGGAAGCTGGTGAG	1
AATAGCCGTACTCACATTTAATGA	2
AATAGCCGTGCCCGCGGTTATGGG	1
AATAGCCGTTAGAACAGCTGGTGCTT	1
AATAGCCTACTGATACAATAGTTA	1
AATAGCTAAGGTGCACTAGATGAA	1
AATAGCTATTCTATATCCGGGTGT	1
AATAGCTGCTCATGATATGTA	1
AATAGGAAAATAATGTGGTGTCAA	1
AATAGGAAAGTAATACGGTGCCAA	2
AATAGGACCATCATGCTGTACATG	1
AATAGGACTGCAAGTTAGTGACTG	1
AATAGGAGCCCAACCATAAAATAC	1
AATAGGAGCTATTACTGGAGATGC	1
AATAGGAGTGAAAACGGGGTGGAT	3
AATAGGCGATCAGGAACAGCGGAT	1
AATAGGGTGTTTGGATACTAATAA	2
AATAGGGTTAATAAATGGTTCGAC	2
AATAGGTAGAAGTGAATAATGGA	3
AATAGGTATCGACTTATAGGTGTC	1
AATAGGTCCTTTGGTGGTTTTGGA	1
AATAGGTGAAGTTGAGAACATCGA	1
AATAGGTGCATAACGGAGATACGA	1
AATAGGTGGATCCATGAGTAGTGG	1
AATAGGTGGTCTAATTTGGATAAC	1
AATAGGTGTTGACACTATAGGTG	1
AATAGGTGTTGACCCAACTGGGGA	1
AATAGTAAAGGTTGGTTAAGTGCA	1
AATAGTAATGGTGATAGATAGGT	1
AATAGTAGAACTTGGTGTTATAGC	2
AATAGTAGGCGCTCACAACGAACG	1
AATAGTAGTGCAATTAGGAAGCGG	1
AATAGTATTACACACAGGTGTGAA	1
AATAGTCTACGTTTAATATTTATA	1
AATAGTGATAGGTGAGTAGGTGAG	1
AATAGTGGACGATAAGCCAGCTAT	1
AATAGTGTGGCCGACGTGAACCC	1
AATAGTGTGTGAACTATGTGGCCC	1
AATAGTGTTAGAGTGGCTTATGGC	1
AATAGTTAGGTCGACTGGCCAAAT	1
AATAGTTCAGGGTGGTAATTCGTA	1
AATAGTTGCTTACTACACTATTAA	1
AATAGTTGCTTACTATACTATTAA	3
AATATAAACTATACATGGTCAAGC	1
AATATAAGAACCTATAATCAAATA	1
AATATAAGAGATTTTAGATGGATG	1
AATATAATAATGGTAGCCGCGTAA	1
AATATACCCTTTAGATGTATGAC	2
AATATACGGTGATATCGACATACA	1
AATATACGTGTCATACAATTAGAT	1
AATATACTCGGCGACTGGAAACTC	2
AATATACTGGTTGGTTTGGTTGAC	1
AATATAGAAATATTAAAGGTACCA	1
AATATAGATGTGTCTAGATTCATA	1
AATATAGCCTGCTGTTAACTCTAA	1
AATATAGGAGAATACTACTACGT	1
AATATAGGTGTCGGTTTCTAAAGA	1
AATATAGTGCCAAATAAGTTAAAA	1
AATATATAGTATTAGGTGTTTGAA	2
AATATATGACGAGGTTGCCTG	1
AATATATGGGTCAGATAACTACAGC	1
AATATATGGGTGATTTATTGCAAC	1
AATATATGGTCCCACCTCTCATAC	1
AATATATGGTCCTACCTTTCATAC	1
AATATATGGTGTGTTTAGTTCACG	1
AATATATTCTGGTGGAGAAACTCT	1
AATATCAGTTGTTTTGAGGACATA	1
AATATCCGGTCCTACCTCTCATGC	1
AATATCCTACTACGAATCGGATA	1
AATATCGAGGTATAAGGTGTGCGT	2
AATATCGATGGTAAATTGTTGAAC	1
AATATCTATTTAGCCAACTCTCCA	1
AATATCTGTTGGAACCTAAATACG	1
AATATGAGGTTGGCTTTTTTAAGA	4
AATATGAGTGTGAGAAATACTAGA	1
AATATGCCAATACACAGTAATCCT	2
AATATGCCCCCTCTAATTGGGCCA	1
AATATGCCTTGAACTTATACTGA	1
AATATGGGTTGCAGACATATTAGGC	1
AATATGGTAACCGACAAAATGGT	1
AATATGGTACACATGACAAATGAC	1
AATATGGTGAATACTAGAATGAC	1
AATATGGTGCAATTTGTGATGTCA	1
AATATGTACACTACACAAGGTGCG	1
AATATGTGCTGGTCCTCCATAAAA	1
AATATGTGGGCCATATCAAAGTAG	1
AATATGTGGGTGATTTTTTGCAA	1
AATATGTGTAACATGAGGGAGGTA	2
AATATTAAGGGTCACAAGTTAAAC	1
AATATTAGGTTGCTATATTGTGA	1
AATATTCACCCTGTCAGCGATAAA	2
AATATTGAAACCGGTGCAATTTGA	1
AATATTGAAGGCCCTACATAAGTG	2
AATATTGCACGGGGTGAAAGAAA	1
AATATTGGGCACGGGAATTTTTAG	1
AATATTGGTGTTTGCATTGAAAGA	1
AATATTGTAAGGATACCACTCGAA	1
AATATTGTACTGGTGTGATTATGG	2
AATATTTAAACCCGTGCCATTGCA	1
AATATTTGGTGACTGATACTTGAA	3
AATATTTTGGACACATGCATAGAG	1
AATCAAAATGTCCAAGAGCAACT	1
AATCAAACCACTACTTATTGATCA	1
AATCAACACGGTGTCTATTGGCAA	1
AATCAACCGAGCTGGCGCCACTAC	1
AATCAACCGAGCTGGCGCCACTGC	1
AATCAACGAGATGGTGAAGATGGA	1
AATCAACGGTGAGATTAGATAGTG	2
AATCAACGTTAGGTGAAGGTGGGA	1
AATCAAGCAAAATTGGTGCTAGAG	4
AATCAAGCATGCCTCCGGATTCAC	1
AATCAATACCTCCTAACAGTGCCC	3
AATCAATCTAGTACCAGATGTGAC	1
AATCAATTACGGTACAAGGTGGGA	1
AATCAATTGGTACTTGGTATATAG	1
AATCACAAAACCAGATACCGTGCG	1
AATCACGGCTGTTGATCGTTGATG	1
AATCACGGTCAAACGCAGCTTTAG	1
AATCACGTTGCGGATTGTGGGAGC	2
AATCACTACTATGCGAAGAAGTGCC	1
AATCACTCCAACCTCTTTGGCCTG	1
AATCACTGGGGCAAGTTCATCAAG	1
AATCAGACTGAAGGGCATTTTGG	1
AATCAGATTAGAGCTGCGGAGTGT	1
AATCAGGTCTACTCGATGATGTGT	1
AATCAGTATGTCAGTACATTGGTA	1
AATCAGTGAGAAACTAGTTGGTGA	1
AATCAGTGGTGCGATATGTGCGAT	1
AATCAGTTGCACTGAAGCGAGTGA	2
AATCATAGAGCCAACAAGTTGTGC	1
AATCATAGTGTAATTACGTTGTAA	1
AATCATCACGCGTGCCATCGTCAC	1
AATCATGATAATTTGCCAGCGGAC	1
AATCATGATGATTAAGGTTTATGC	2
AATCATGTGAAATGTCAGGAATGC	1
AATCATGTGCTAATGGCTCACCTC	4
AATCATGTGTAAGATATCGGTGCT	1
AATCATGTGTGTAAGAATGGAGAG	1
AATCATGTTTTGGTGCTTTTTGAA	1
AATCCAAACGCCGATACTGAG	1
AATCCACAGTGCACCATTATAGGG	1
AATCCACGATGGTTTTGGTCTACA	1
AATCCACGCGGACTCCCAAGATCG	1
AATCCACTAGTCAAGAGGTGTGGA	1
AATCCAGTTAGGTTTAGTGACTAG	1
AATCCATGGGTGTCCAGCAGCTAA	1
AATCCGAATATATTGTGGGCCTAA	1
AATCCGATCGCCAATGAGGGCCGG	1
AATCCGCGTACATGGTAAACGAGA	1
AATCCGGATTCGGATCAGGTGCAG	1
AATCCGGGACTACAAAGGGGTTGC	1
AATCCGTGCTCGGCCGATGGTACC	1
AATCCGTGGGTCAAACGTGGGGGC	1
AATCCTAACTCTAGTCATCTTCTC	1
AATCCTAAGTGCTAAAAATTGTTA	1
AATCCTAAGTTAAAGGTGGTGTT	1
AATCCTACACCTACAACTACCCGT	1
AATCCTACGTTTTTCCTATTCCTA	1
AATCCTAGATGGAGGGTTGGGACT	1
AATCCTGCGTATGTGATGGTTTCC	2
AATCCTGGTGTCTACCAATATTAC	1
AATCCTGGTTGGTGTAGATGGGAG	2
AATCCTTAATTGCCACTTATAAGA	1
AATCCTTGTCTCTACATCCATCCA	1
AATCGAAGGCATTGCGGTGGTCGG	1
AATCGAATTTAGAGATGCTGTTGG	1
AATCGACGGTGAGATTAGATAGTG	3
AATCGAGAACTCGGTGAGATGTGT	1
AATCGAGAGAAGTGAGAGGTGTAG	3
AATCGATGTCAATCAGTCTAACCG	3
AATCGCAGGTGGTCGCCTTACGTG	1
AATCGCGCACAGATTGATAAACAG	4
AATCGGATGTGGGGCCAGTGAAGC	1
AATCGGCCGACCGACGAAAGATGG	1
AATCGGCTGCTGCTGGGATGGATC	1
AATCGGGATACTAACAACTTTGAC	1
AATCGGGCGACCGACGAAAGATGG	1
AATCGGGGGCCAGCCACAATGACC	1
AATCGGTAGCCTGTGCTTTTGATT	1
AATCGGTGGACCTGATAATTTGGA	1
AATCGTGACTGCAGGATATGCCT	1
AATCGTGGATATTTGCTGATGGAC	1
AATCGTGTGAAATGCTAAAAATGC	1
AATCGTTGGTTGCCACAAATTGAT	1
AATCGTTTGATGTGACATGGTGAA	2
AATCTAACGGTTGCCGATGATGAC	1
AATCTAATGGTCTAAATTAACAGG	1
AATCTAGTCTATTGTTGAGGTGTA	3
AATCTATGATGAAAGATGATGTAGC	2
AATCTATGATTAGCCTATGTGATG	1
AATCTATGTTGTGCAATGCTT	2
AATCTCAGAGGCATAAAAGGGATT	1
AATCTCCATGGGTCACATGGTGGA	1
AATCTCCGTTATTGGTGCTGGTCC	1
AATCTGAATAGAAGCCTGCCCAGA	1
AATCTGATATGATGGAGTGCTA	1
AATCTGATGGTTGCTGTACCGAGC	1
AATCTGCATCTCGAAGAATCTGGC	1
AATCTGGACACTATAAAAGA	1
AATCTGGAGATGTGTCCCATCCCA	2
AATCTGGATGGAGTAGTAAGGGCA	1
AATCTGGGCTGGTCACAACATCAT	2
AATCTGGGTGACAATCTGAATTGT	2
AATCTGTCGCGTGCGGGCGGGAGA	1
AATCTGTGCTGAGCCCATGTGACC	2
AATCTGTTGGTGATGCTTTAATGG	1
AATCTTACTACAATACTATTGAAA	1
AATCTTAGGTGGTGTTTGGATCCA	1
AATCTTCTAGGTGGTTGGTCAAGG	1
AATCTTGGTGTCTATAAATATTAC	1
AATCTTTTCGCTTTGGACTAGGT	1
AATCTTTTTGTTTGGCTGACGTGT	1
AATGAAAATAAAAACCGGGGTGAA	1
AATGAAAATGTTTAGGTGTCACA	1
AATGAAACCATATTTTGGAGTGAC	1
AATGAAATCCTCGAGGTGGTGGTT	1
AATGAAATTGTGTGCGTAAATAAG	3
AATGAACACAGATATAGGGTGGAG	1
AATGAACATGGTGCTTTCTTTTAA	2
AATGAACGCCTGAGATTTGTTCAC	1
AATGAACTACTTTTTGGGTGA	1
AATGAACTAGAGATGTGGTGTTGG	1
AATGAAGTAGAGCTGCACATGAC	1
AATGAAGTGTTAGAAAAAGGATGG	1
AATGAATACAACGGTGTGATCGGA	1
AATGAATATAACGGTGTGATTGGA	1
AATGAATATAGAAGGAGGGTTGTC	1
AATGAATATTTCAGATTTGCAAGC	1
AATGAATGTGATGGTAACCTAGGA	1
AATGAATTATACAGTGAGGAAAGC	1
AATGAATTTAATAAAGGTACGTGC	1
AATGACAAGTAGGACCTACATGAG	2
AATGACACAGTCTACGAGATATA	2
AATGACACGGTCTACAAAATGTAC	1
AATGACACTAGCCATTGTGACTGG	1
AATGACAGGGCTGTCCCCCGTTTC	1
AATGACATGTGTGTTAAGATGGT	1
AATGACCTTCTGATGGGACGGCCC	1
AATGACGGATTAATTCAGGGGTGG	1
AATGACTAAGTCGTTATAGGTGTA	1
AATGACTTATTAATTTGATGGACC	1
AATGAGAAATAAGGTGATGGGACA	1
AATGAGACTACGCTAAACCGACGA	1
AATGAGACTAGTCCTAGGATGGGT	1
AATGAGACTTCGGACCGGGATGAT	1
AATGAGGACTGCTATATCACGGGG	1
AATGAGGGCTATTACCGGAGATGC	1
AATGAGGTGCTGTGAATGGCCTAA	1
AATGAGGTGTAACTACTATGTAAG	1
AATGAGGTGTGAAGAATGAATGGC	1
AATGAGGTTTCCCCGAGATGGTT	1
AATGAGTCAAGATGAGTAGGTGGG	1
AATGAGTGATACAATGTGGGAGAA	1
AATGAGTGATCTACAAGTTTAGG	1
AATGAGTGCCAAGTAATTTGAAAT	1
AATGAGTGTCGTTGTCCTAGATAA	1
AATGAGTTGATGCATGGGTTGCAC	2
AATGATAAAAGAGTGCACAGAGG	1
AATGATAAGAAGGTGTTGATTCGG	1
AATGATAATAGACCTACAAAACAC	1
AATGATAATAGATGGCTGAATGAA	2
AATGATACTGTGCCCTCACTAAAG	2
AATGATAGCCTCAGTGTGGTATGC	2
AATGATAGGTGAATAAAAAGAGAG	1
AATGATAGTTAAGCGGTGTCT	1
AATGATATGGGAATAACGTTATGG	1
AATGATATTGTTGAACTACACAGA	1
AATGATCACGATGAAGTATATGCC	1
AATGATCATTCCGTTTTACGTGCA	2
AATGATCTTTAGTCCCGTATTCGT	1
AATGATGCGTTCATGCTAATTTTC	1
AATGATGCTAGCCGCGAATCTGCG	1
AATGATGGATGAATGGTGTTGATC	1
AATGATGTGGTGCAATGTCTTGTC	1
AATGATTGAAGAAGGTGTGTGATT	1
AATGATTGATGACAGTGGGATGAC	1
AATGATTTAGATGGGCCTAGACGC	1
AATGATTTGACAACACGGTGCTAC	1
AATGCAAAACTTGATAGTGTCTA	1
AATGCAAGTACGGTGGTGGTGGAC	3
AATGCACGTACGGTGAGGCTGGGG	1
AATGCACTAGTAAAGTTGTTGGTA	1
AATGCAGATGTGCATCTGGGTGTA	1
AATGCATGGACAGGTTTTGGTGTA	2
AATGCATGTGTACATGATGCGCGC	1
AATGCATGTGTTTGATTCTGGTCC	1
AATGCCAAAATTTAATAAGATTAA	3
AATGCCAAACCATGATATGGTGAT	2
AATGCCACATAACCAAGAACATGA	1
AATGCCACATCAAATGTTTGGACA	1
AATGCCACCCACTTAATACATCGA	1
AATGCCACCTCTCACAATGGTAAA	1
AATGCCACGTAGGATAGAGACCT	1
AATGCCACGTGGGACGAAGACCGA	1
AATGCCACGTGGGATGAAGACCT	2
AATGCCACTGCTTGTCTATGCTAA	1
AATGCCATGTAAGTTTTGGAGGA	1
AATGCCATGTCAGAATGTGGTTGA	1
AATGCCATGTCAGATGAAGACCGA	1
AATGCCCATCACAGATTATGGTCA	2
AATGCCCCATCATGGTGGAGAAAT	1
AATGCCGATGGACAGCACTGCTGC	1
AATGCCGGGTTACAGAGTTTGACT	1
AATGCCGTCGGTGCGTGGTGGTCC	2
AATGCCGTGGTGGTGCATTAGGGT	1
AATGCCTCCAAAAGAGAATAGTGCG	1
AATGCCTTATAGTGAATTGTCTC	1
AATGCGATAAAATAGCTTGGGTTC	1
AATGCGATAATAGTAGGGGGCTT	1
AATGCGATAGATGGTCTACTAGAA	1
AATGCGATAGATGGTCTGCTAGA	1
AATGCGCGTGCGTTGTGAGTGTCT	1
AATGCGGGTGCGTTGGTAAGTCCA	1
AATGCGGGTGTCTAAATTTGTATC	1
AATGCGTCATGGGCCACGAACGAA	1
AATGCTAAAGTGTGCCTATACAAC	1
AATGCTAACTTGACCAATCTAC	2
AATGCTACAATGGTATACCGTGCG	1
AATGCTACGTTAGACCAGTCACCG	1
AATGCTATGGACATCATCCTAATT	2
AATGCTCAATCTACACTACCCGCC	1
AATGCTCATAGGCAGCCACATGGT	1
AATGCTCCATACATGTATCCAAAG	2
AATGCTCCATGCATGTGTCCAAAG	1
AATGCTGAGAAGATGATCAAGTTC	1
AATGCTGGATGGGCGGATGACCT	1
AATGCTGTGGCTTGCTCAGGCGAC	1
AATGCTTACTACAGATGATGTGTC	2
AATGCTTCATGCATGTGTCCAAAG	2
AATGCTTGATGTGATAGGGTGTAA	3
AATGGAAACATTAAGGAAAGCCTA	1
AATGGAATGAGTGACCATGCTGC	1
AATGGAATGCCAAAAGTCAACACT	1
AATGGACCTAGATGGAAGGACCGC	1
AATGGACCTATTTTGGAACGAAGG	1
AATGGACGAAAATTCAACGGCGTC	2
AATGGAGACGATTTTGGGATGTGT	1
AATGGAGCACGGAATTGAGATGAC	1
AATGGAGCTCTGATCGTGTTGTCG	1
AATGGAGGCCCAAGGATTCAGTCG	1
AATGGAGGTACCATCGGTGTA	4
AATGGAGGTGACGGTGATTCCGTT	1
AATGGATCGCTATCTTTTTTGTGC	1
AATGGATGCGTTCTAGTACAAAAA	3
AATGGATGGTGTCTTCGAATTGAA	1
AATGGATTTTCCTACTGACGGAGC	1
AATGGCAAAAAGTGCTACAAAATG	1
AATGGCAACTAGCTCAATCGGTGT	1
AATGGCACGCTCTACAAAATATAC	2
AATGGCAGTAATATTATGGTAGA	1
AATGGCCACGATTTTTATGAC	4
AATGGCCTTAGCGACTTAGCTTTC	1
AATGGCCTTGATGTTAGTGATGAT	1
AATGGCGCATAAATACTTCTGGTA	1
AATGGCTAGATTTGATTTGGTACC	1
AATGGCTTGTCTTGTTTTGTGTGC	4
AATGGGACAACGAACGCCTGGGAG	2
AATGGGACCTTACAAAATTGCCAC	1
AATGGGACCTTTAATATAGATAGA	1
AATGGGAGGAGATTGGAATGGACT	1
AATGGGATGATCTGATGATGTGAT	1
AATGGGATGGTGTAGTTCTGTAT	1
AATGGGCATGTGATCGCTGTGGG	1
AATGGGCCTATTTTCACATGCGGC	1
AATGGGCGCATAATCGAGTTTAGG	1
AATGGGCGTATATGTGCAGCG	1
AATGGGCTACAGGTGCGTCACAAA	1
AATGGGCTACCTTAGTCAAGCGGT	1
AATGGGGCTGAACACATAAAAGGT	2
AATGGGGGCAAATGCATCCTTGAC	1
AATGGGGGTTTCACTGGTGTGTCA	4
AATGGGGTATGTCTCATGGGTCCT	1
AATGGGTACGTCGCCTACCGCTAA	1
AATGGGTATACCCACGGGCACAAA	2
AATGGGTGAAACAATGTTCGA	3
AATGGGTGAGGCTTCGAAGCTAAG	1
AATGGGTGATTCTATGAGTGGACT	1
AATGGGTGTATGTAACACATTCTA	1
AATGGGTGTGTAGGAGCAAAATGC	1
AATGGGTTGTAGTGCCTTCGCGCC	1
AATGGGTTTACTGATGGGCGAAAA	1
AATGGGTTTCCTTTAATTGGTAAT	1
AATGGGTTTTGTCAGTAATCTAC	1
AATGGTAATGGCATTACGATAAAG	2
AATGGTAGAAGCGACAAATGAACA	1
AATGGTAGCCAAATAATTTTACCC	1
AATGGTAGGAGGCCTGTTGTTGCC	1
AATGGTAGTAACATTATGGTAGAG	3
AATGGTATATCTCAAAACAGGTA	2
AATGGTATCACGTAGTCTTGTGAA	1
AATGGTATGTCTACATGGGTATCT	1
AATGGTCAAACAGTGTAAGCAAAA	1
AATGGTCAAACGTTGGATAAAAAG	2
AATGGTCATTACGAAACTGAGATG	1
AATGGTCGGAAACGATTTGGTACC	1
AATGGTCTATATCTATTTGTA	2
AATGGTGAAACGTTATGCGAAAGG	1
AATGGTGAAAGATTGTGATTGGTT	1
AATGGTGATCCAAAGTGATATGGA	1
AATGGTGATCCAGCGGGCCGGGGTA	3
AATGGTGATGGACAGAGACGTGGC	1
AATGGTGCAAGATTATGGACCCAC	1
AATGGTGGAAATCCTATGAAATGG	2
AATGGTGGCTTCGTTGGAGGTATA	1
AATGGTGGTGCATTGACTCATCGC	1
AATGGTGTAATCGAATCGTAGATC	1
AATGGTGTAATCGGATTGTAGGTC	1
AATGGTGTAGGGTTATGATTGGA	1
AATGGTGTCAAACAATTAGGGAAG	4
AATGGTGTCAAACATTTTAAAATGG	1
AATGGTGTCAAATATTTACAAACG	1
AATGGTGTCAAATATTTAGAAATG	1
AATGGTGTCAACTATTTTAAAACG	1
AATGGTGTCTCTTATAGATGGAGT	1
AATGGTGTCTTCGTTGTTGTGTTG	1
AATGGTGTGCTTTTTTAAAAGGTT	1
AATGGTGTTAAATATTTAGAAACG	1
AATGGTGTTGATGTAGAGATATAG	1
AATGGTTGAGTATCAATTTACGGC	1
AATGGTTGATTGGTTGTTGGGCCT	1
AATGGTTGCTTACTATATTATTAG	1
AATGGTTGGCCTGGGTTGGCTTGG	1
AATGGTTGGTGAGTACAAATGCTA	1
AATGGTTGTACTTTGTACTTTGGT	2
AATGGTTGTGATTGGTTAAGAGGA	1
AATGTAACTAGGGTGTAACTACAA	1
AATGTAAGAAGACAATTAAAGTGC	1
AATGTAGAATACCTGTGCCTTTTC	1
AATGTAGATGATGGGCCTGTTCAC	1
AATGTATAGGTGGTCCCTTCTACG	1
AATGTATCCAACGGGTGCAAGTGC	2
AATGTATGAAAAAGGTGACCTTAA	1
AATGTATGTATAACAGGTGGGACC	1
AATGTCAGCCTAACTGGCCTCATG	1
AATGTCCGATGTGATAGGGTGTAA	2
AATGTCCTAAGTTTAGTGGTGGA	1
AATGTCCTATCCGTCTAAAATCTA	1
AATGTCGATCAGACTACGGTATGC	1
AATGTCGCGATCGAGCCAGATGGT	1
AATGTCTACACCACCACGTAGTT	2
AATGTCTAGTACGGTTGTAATCGG	1
AATGTCTGGTCCTACCTATCATAC	1
AATGTGAAATAGGTGTAACTTTTG	1
AATGTGAACAATCGGGATAAGAGT	1
AATGTGAAGATGGTGATTTGACAT	1
AATGTGACGGGTGAGTCAGCGTGG	1
AATGTGACGTGGCATCATCTTGAC	1
AATGTGATGTGATGTGATGGAAAG	1
AATGTGCATGCGACAATATAGGTA	1
AATGTGCATTAAATCCCTGT	1
AATGTGCCAGTAAATCAACGAGGG	1
AATGTGCCGTTGGTTTTCATCTTT	1
AATGTGCGTGGTTTTGAATAACTG	1
AATGTGCTAATAAATAAAATTGAT	1
AATGTGCTGTAGGTGATACTGTGA	1
AATGTGGGTAAAGCTAAATGTGGG	1
AATGTGGTAGACGATGGACGATA	1
AATGTGGTCCGCCTGCAAAAATGT	1
AATGTGGTGTTCGGGTACTAATA	1
AATGTGTAAACTTGAGGTGTATA	1
AATGTGTAAATGGGGTGCTTTGT	1
AATGTGTCAACTCTGGTGTGCAA	1
AATGTGTCACATTCAGTACTAGT	1
AATGTGTCGCATCGTAATACGAGG	1
AATGTGTGAAAAGCTACGCTGTAA	1
AATGTGTGGACGATGATTGATCTG	3
AATGTGTGTATGACAGATGGCACC	1
AATGTGTGTATGACAGATGGGACC	1
AATGTGTGTATGACAGGTGGGACC	2
AATGTGTGTCCGTATATTCGATG	1
AATGTGTGTCTGTTCTTTTTGACC	2
AATGTGTGTGCAGTTGGTCTC	1
AATGTGTGTGGACTATCGTGCATT	1
AATGTGTTATAAATTATGGATGG	1
AATGTGTTGCGCTACCCCTGGAAG	1
AATGTGTTTATGACAGGTGGGACT	1
AATGTGTTTGGTTGGTGGGCGAGA	1
AATGTTAATAAATATGGGAAATGC	1
AATGTTAGAATGACTTACATTGC	2
AATGTTATGGATCAGATGTTGCGA	1
AATGTTATTAGGTGGCTTATGGAC	1
AATGTTCCATACGTGATAGTGAT	1
AATGTTCGATGCGACAGGGTGTA	1
AATGTTCGATGTGACAGGGTGTA	1
AATGTTCGGCTTCGGGCACCACGG	1
AATGTTGCTAGGTGGCTGAATCA	1
AATGTTGGACATGGATATCTACGGC	1
AATGTTGGAGATAACTGTTGTTAC	2
AATGTTGGCGCTGAGACGTTATAG	1
AATGTTGGTTGACCACCGGTGTGC	1
AATGTTGTGCACTAGTGCTTACCA	1
AATGTTTCATGAGGTGATTTGGT	1
AATGTTTTAAACAGTGCCATGAAT	1
AATTAAAACAAACTAGGAAGGTAGC	1
AATTAAAAGGGTGGTCTACTATAC	2
AATTAAAAGTTTATGTGTGTAGAA	1
AATTAACCGACGCCTATAATATAC	1
AATTAACGATTTGCCACACCC	1
AATTAACGTGGATGCTTACATATG	1
AATTAACTATTTGCCACACCTATC	1
AATTAACTGTGCACTGTAAGGTTTA	1
AATTAAGAGGCCTATACAATATA	1
AATTAAGGGTGAAATTTATGCGAA	1
AATTAAGGTGGGTCACACTAAAGG	1
AATTAAGTGAAAGTGGGAGGGGTC	1
AATTAATAGGGTGGCTAAATGCG	1
AATTACACGGTGTATTTTTTGCAA	1
AATTACGGTGTAGTAGGAAGAGAA	1
AATTACTCAGTGTCGATGTTAATA	1
AATTACTGAGCCAGGGGCATCCCA	2
AATTAGAACCGTGCCAATCCGTCG	1
AATTAGAAGGGGTGAGGCTTTGAA	1
AATTAGAAGGTGTGAGGATTCGAA	1
AATTAGAATGATGTGACAGAAAA	1
AATTAGATAATGTGTTTGGTGAG	1
AATTAGATTGGTGTCTCAATTGAA	1
AATTAGCTATGGGACACCACGAAA	1
AATTAGCTGAGGGACACCGAGAAA	1
AATTAGCTGGGAGACACCGCGAAA	2
AATTAGGTATAACAAGGTGTGAAC	1
AATTAGTAATGGTGATAATAGGAG	1
AATTAGTGCGATTATCATGGTGTG	2
AATTAGTGCTATTGACTTTTGTCA	1
AATTAGTGTATATATGAAATGTT	2
AATTATAGGTGTCGGTTTTTTAAA	1
AATTATATTTGAAGTATAGGTGGA	1
AATTATCAGGTGATACATATAAGG	1
AATTATGATTGGGAAGCTTACTAC	2
AATTATGTTTAGATCATGGTGCTA	1
AATTCAAATTTGAATCGGGTGTGT	1
AATTCAACGGTGTGTATAGGAAAA	1
AATTCAAGCTTGATGTCCATAGGT	1
AATTCAGTTAAAAGGGTAGGGTGA	1
AATTCATGATTAGCCTATGTGATG	1
AATTCCGGGTGAAGATGGATGTTG	1
AATTCCGGTGTACCTCAATTTCAG	1
AATTCGAATGGTGGAAACTGATGAA	1
AATTCGTAGTACACGATATGTC	1
AATTCGTCCGGTTTGCCTAGTTGG	1
AATTCGTGGTCCAGTTGCAAAACC	1
AATTCTAATACCACGTAATTGCCA	1
AATTCTAGAGGTGATGCGAATTGA	1
AATTCTATTCGGGAATTTCTGGGC	2
AATTCTTATGGAATTACGCCACCC	1
AATTCTTGTTGTTTGGTGATTTGG	1
AATTGAAACGATGTGATGGAAAAA	2
AATTGAAATGATGTGACAGAAAAG	1
AATTGAAATGATGTGACCGAAAAG	1
AATTGAACTTACTTTTGGGGCGCC	1
AATTGAAGGTTGGTTGAAATTGAA	1
AATTGACAATGGTGCTGTTGTGTC	2
AATTGACATGCAATAAACGGGTGG	1
AATTGAGCGTGGGCACTACCAATTG	1
AATTGAGGAGGTACCATGAGGTA	2
AATTGAGGGGTACACATTTCTGGT	1
AATTGAGGGTATAAAACGTATGGT	1
AATTGATATAAACCACACGTGAT	1
AATTGATTTACGGAGTTGCTAGAA	1
AATTGCAATATCAGGTATAACGCG	1
AATTGCCACGTGTACGCCACGTA	1
AATTGCCACTTGTAAAAATGGTAA	1
AATTGCTGATGATACCAAAACACA	1
AATTGGAAACTTAGCCTCTTAAAC	1
AATTGGAAGCTTGAATGAAATTGG	2
AATTGGAATGATGTGACGGAAAAG	1
AATTGGAGACGATGTGACTGAAAA	2
AATTGGATGGTATTCAAAGGC	6
AATTGGATGTGATGTAACATAGTA	1
AATTGGATTAATGACACGTGGGAC	4
AATTGGCACGGTGTCTGCATGCAA	1
AATTGGCTGTAGAACACTGGTCGC	1
AATTGGGATGATGTGACTTAATAA	1
AATTGGGGCTATTTCAGGTAGGGT	1
AATTGGGGTCTAACTCGGTCCGA	1
AATTGGTCGATACTGATATAGTGT	3
AATTGGTGGACTCGTTATTGTAGG	1
AATTGGTGTGTTGCAACGAGACGT	1
AATTGGTGTTGGTGATAGTGAAGC	4
AATTGTAAATGAGTGTCTTTAGAT	2
AATTGTAACGAATATAATGGTGTA	1
AATTGTAAGTGTGCTGGGGATTGA	1
AATTGTCTGCCTGTGAAGTTACGT	1
AATTGTGCCCAGATTAATTTACCG	1
AATTGTGGATACAGATAACGGCGC	2
AATTGTGGGCAGGTTTAATCTCGG	1
AATTGTGGTTTCCTCAAGATTGGA	1
AATTGTTATTTTAAAGGGTGCGGT	1
AATTGTTGGCCACACTTTGTTTGC	1
AATTGTTGGGTGTCACATCAGAT	1
AATTGTTGTGCCGCCTTGGTTCAG	1
AATTTAAGAATGAGAGCCTATGCA	1
AATTTACAATAGAAAAATGGTACC	2
AATTTAGTGTAAAATTTGGTACCT	1
AATTTATCCTACGTACGGTGCATG	1
AATTTATGTGCGTATGAAATGTTT	1
AATTTATGTGTTTTTCTGTGGTC	1
AATTTATTGATCATAGCCAAAG	2
AATTTCAGATTGGGTTGTTTGCGG	1
AATTTCGAATTCAAGTTTGACTTA	1
AATTTCGTGATGGTGTTCTAATGC	1
AATTTCTGGATGAGTTACGTAAA	1
AATTTCTGGGCGTGACACAAAACC	1
AATTTGAATGCTCATGCGGTAAAA	1
AATTTGACGCTTGACGAGATTGAT	3
AATTTGAGGGTCTTTTATTTT	1
AATTTGATGAATGGACCACTTTAG	1
AATTTGATGACATGGAAGAAAGAG	2
AATTTGATGGGTTGAAAAAAAGAG	1
AATTTGGATAACTAAGATGTGCCA	1
AATTTGGGCCCACAATATATTTGG	8
AATTTGGGTTGCTGCATAATTATG	1
AATTTGGTAGCAAACTAAATGTAG	1
AATTTGGTGGTGTTTTAAAATGAA	1
AATTTGTAGTGTCCTAGAGCAG	1
AATTTGTAGTTGTGCTATATCGAC	1
AATTTGTATGCCAAGCGAGAACAG	1
AATTTGTATTACTACTAGCATGGC	1
AATTTTAAGGTGGTGTTTGGGAAG	1
AATTTTAGGCCTGGTATATGTGAA	1
AATTTTAGTAGTGCCAAATCTTGG	1
AATTTTAGTTGAAATTGGAGATGA	1
AATTTTGGCATGACTAATTTTGGT	1
AATTTTGGCCCTATGTGGCATTGC	2
AATTTTGGGGCTTACATTGTAAAT	1
AATTTTGGGTCTCTAAACTTTAGA	1
AATTTTGGGTGTAGCTATATTTA	2
AATTTTGGTAACTATATAAGAAA	1
AATTTTTCAAGAGCATATATCACT	1
AATTTTTGGGTGTCACATCGGATAT	1
AATTTTTTGAATAAGATGAATGGT	1
ACAAAAAAAATTAAGGGTGTTGGC	1
ACAAAAAACAACACGATATGCGGC	2
ACAAAAAACGAAACGGTGCATTAG	2
ACAAAAAAGGTAAAGTTGTGCCAA	1
ACAAAAAATCAGGATGTGACATGG	1
ACAAAAAATGATGTGGCAGGTGAA	2
ACAAAAAATGGCCATAGCGATACC	3
ACAAAAACAGAACCTACATGTCGA	2
ACAAAAACAGAATAAGGAGAACGC	1
ACAAAAACCATTCACTTTAGGTCC	1
ACAAAAACCGGGATGAAGGGACCT	2
ACAAAAACGATAAAGATGGTTTCC	1
ACAAAAACGATTGAAGGTGAATGG	1
ACAAAAACGTGACACGGCTGATGG	1
ACAAAAAGACCCGATTGGGTAGCC	2
ACAAAAAGCTAACCTAGTATTGGA	1
ACAAAAAGGATAAGGGGCATTTGC	1
ACAAAAAGGGAAAACAGGTGGAGG	1
ACAAAAAGGTGCGAGGGATTGTCT	1
ACAAAAAGTAGGAAGTTGGTGGTA	1
ACAAAAAGTGCCACGTAAGCATGC	1
ACAAAAAGTGCTACAAAATGACAA	1
ACAAAAAGTGGGCCACACCTTAGC	1
ACAAAAATAATTGTGACTATTACC	1
ACAAAAATAGACGGCCAAAGTTGC	2
ACAAAAATATAAATCAAGGTGAAA	1
ACAAAAATATAGGGCCTGTTCACT	1
ACAAAAATATGCCTTGAACTGAAC	2
ACAAAAATCTGGTGGGACACATGT	1
ACAAAAATGACAAATGTCAGGTGA	1
ACAAAAATGATTGTTTGATTGAAC	1
ACAAAAATGGACCTTGCCGCCC	1
ACAAAAATTATAAAGGTGGAAGCG	1
ACAAAACAAAAGTAAAAGGGTGGC	1
ACAAAACAACAAAACAGCTGC	1
ACAAAACACATAAAGCGAGGTTGC	2
ACAAAACACTTAATAGCCTCATCC	1
ACAAAACAGGTTGACCGTGGTCAG	1
ACAAAACAGTATAGCCTTGAAGAA	1
ACAAAACAGTGATGGAATGAC	2
ACAAAACATAAAACGGTGGACCTG	1
ACAAAACATATGGAGCATGGT	3
ACAAAACATATGGAGCATGGTCGC	4
ACAAAACATCACACATGCCTGGTC	1
ACAAAACATGGCCTCACTATCAGT	1
ACAAAACATTAAATAGGTGTCGCC	1
ACAAAACCAAATCGTGCATAAGAG	1
ACAAAACCACTGAAGGACCTATAG	1
ACAAAACCACTGTAGATTGAGTCG	2
ACAAAACCAGATATGCGAGGTCCC	1
ACAAAACCAGGACAGACTAGA	1
ACAAAACCAGTACAAATTAGGTCC	2
ACAAAACCAGTGCACATAAGGTC	2
ACAAAACCAGTGTAAATTAGATCC	1
ACAAAACCATGTAGAAGAGGTCC	1
ACAAAACCGGTCACCTGAGGTCC	1
ACAAAACCGGTGCACTTTGACTCC	1
ACAAAACGAAAGTAAAAGGGTGGC	2
ACAAAACGAAGTGACAGTTTAGCGC	1
ACAAAACGTACGATGCCAAATTAG	1
ACAAAACTAAAATGTTTAGGGTGT	2
ACAAAACTACAGATTTAGTGTCCC	1
ACAAAACTACATGTTTTATGGTTC	3
ACAAAACTAGAAAATATGCGTGCG	3
ACAAAACTATAGATTTAGGGCCTG	1
ACAAAACTATGATGTGGCAAGAGA	1
ACAAAACTGTAGATTTAAGGTGAT	1
ACAAAACTTTGGTGGTGTTTGAGA	2
ACAAAAGAAATTTCTAGAAGTGAC	3
ACAAAAGAGAAGGGTGTTGGCTC	1
ACAAAAGAGCCTGATAGATGTGGT	1
ACAAAAGAGGTATTTGCACTGTAG	1
ACAAAAGATAGTTCATAAATGCCT	1
ACAAAAGATGTGTCAGAACTATAG	1
ACAAAAGCATGGTGCATTTGAAGG	1
ACAAAAGCCTACCTCATGGGATGG	2
ACAAAAGCTGAACTGTTTAGAGAA	2
ACAAAAGCTTAAGGTGGTGTTTGG	1
ACAAAAGGAAAGCATGGGGCATT	1
ACAAAAGGGCCAAAATTTTGCAAA	1
ACAAAAGGGTGGTGATGCGCCGAA	2
ACAAAAGGTAGGACAGGTGGTCA	1
ACAAAAGTACACGGATGGAGATGG	1
ACAAAAGTACTAATTGGTGTTTA	1
ACAAAAGTATGATGGACAAATTG	3
ACAAAAGTCATACCTACCCGAGA	1
ACAAAAGTCGATGGTATATTGTA	1
ACAAAAGTGTGAGGAAGATAGTGA	1
ACAAAAGTGTGATGAAGAGGGCGA	1
ACAAAAGTGTGGTGAATAAATTGC	4
ACAAAAGTGTGGTGGACAAATTGC	1
ACAAAAGTGTGGTGGATAAATTGC	1
ACAAAATAAAAAGAGAACCTGGTT	1
ACAAAATAAACTAACGAGGTGGAT	1
ACAAAATAAAGTTGCATAAGGTAA	1
ACAAAATAAGGTGGTATTAACGTA	1
ACAAAATAGAGTTTGGACCTCCGA	1
ACAAAATATCAAATAGGTGTCAGC	1
ACAAAATATCAAATAGGTGTCGC	2
ACAAAATATCGGACGCCTCTCACA	1
ACAAAATATCGGGACAAGTTAGGG	1
ACAAAATCCTATGTGTGCCATAAC	3
ACAAAATCGACGTTATGGCTACAC	1
ACAAAATCGCTTGTACGATGGCAT	1
ACAAAATCTTGGTGTGTTGTAGTC	1
ACAAAATGAAATGAGAAGGTGTTA	2
ACAAAATGAACTAAAGAGGTGCAG	1
ACAAAATGAACTAGAGAGGTGGAG	1
ACAAAATGAACTAGATAGGTGGAG	1
ACAAAATGAGGGCCTGTTTAGTAC	2
ACAAAATGAGGTAGTGTCCAAGGA	2
ACAAAATGCATAGTATGGGTACCC	1
ACAAAATGCCTAAATACTCTTTGT	1
ACAAAATGGAACGAATACGGTGA	1
ACAAAATGGACCAGTATTGATAAT	1
ACAAAATGGGTGACTCGTTTGAGC	1
ACAAAATGGGTTTATACAGGTTC	1
ACAAAATGGTGTAGTGGAAAGGAA	1
ACAAAATGGTGTCTTCTCCTTTGC	1
ACAAAATGTACTAGAGGAGGTGAA	1
ACAAAATGTACTAGAGTTGTGGAG	1
ACAAAATGTCGCATAGGGTGTCCG	1
ACAAAATGTGACCAACAAACCGT	1
ACAAAATGTGAGAGTGGTTGTGG	2
ACAAAATGTGAGAGTGGTTGTGGA	1
ACAAAATGTGTGTATGATATGTGA	1
ACAAAATGTTGCTATCTAAGATGG	1
ACAAAATGTTTGGACACATGCTTG	3
ACAAAATTAGAACCGTGCCACTAT	1
ACAAAATTAGAACCGTGCCATTGC	1
ACAAAATTATAACCGTGCCATTAC	1
ACAAAATTCAGGGGCATAGAAATG	1
ACAAAATTGATTGCTTTGAAGCC	1
ACAAAATTGGATGCCCTGATACAA	1
ACAAAATTGGGACCATGTCATTGC	1
ACAAAATTGTACTACGGGGGTGGA	1
ACAAAATTGTGACAAGTTGCCAAA	1
ACAAAATTTCCTAGTGCACTTTAC	1
ACAAAATTTGAGATATGCCACCTG	1
ACAAAATTTGGACGGCTGACAGAT	1
ACAAACAAAATACAAACTAGGTGA	1
ACAAACAAATGCCAAGTTAGGAAG	1
ACAAACAACGATGATGAAGAAGAC	1
ACAAACAAGATAAAATGGATGTG	1
ACAAACAAGCAGCTAGGGGTGGA	1
ACAAACAATAATAATATACATGTG	1
ACAAACAATATCGGTGTTGATCCA	1
ACAAACACAGTACTAGGATGGTCTT	1
ACAAACACGTGCTTTGATGGA	1
ACAAACACTGAGTAAAATGGAGCT	1
ACAAACACTTATGCCGGTGTTAAA	1
ACAAACACTTATGTTGCTGGTGAG	1
ACAAACAGTTGTAGTGGAGATGGC	2
ACAAACATGGCGCCAATACCACAG	1
ACAAACATGTTAGATGGAAATAAA	1
ACAAACATTGTAAGCCTAACACAG	1
ACAAACCAATCGTCAATCGTGCTA	1
ACAAACCACGGAGAGGTGTATTGA	1
ACAAACCACTACGATGCAAGC	1
ACAAACCAGTGATTGGACCTACGAC	3
ACAAACCCAATCTGGTGCTTGTGG	1
ACAAACCGCGACAAACCGTACAAA	2
ACAAACCGGGGTGAAGCTCGTTGTC	1
ACAAACCGTACAATCAAGGGCCTA	1
ACAAACCTAATACGAGATGTGAC	2
ACAAACCTACAAAGAGATGTCGCA	1
ACAAACCTACAAAGAGATGTTGCA	1
ACAAACCTACAAAGAGGTGGCGCA	1
ACAAACCTACCTACGGTCAGACCG	1
ACAAACCTAGTATGTAATATGCCA	1
ACAAACCTAGTATTGTATGTGACC	2
ACAAACCTCGGGAAAGATGTGACA	1
ACAAACCTTGAGTTTTCGTGTCTA	1
ACAAACGACCAAACATGTGCTAAA	1
ACAAACGATCAAAGCTGGACGCGA	1
ACAAACGCTCCTAGGTTGCCACAT	1
ACAAACGCTCTCAAGCTGCCACGT	1
ACAAACGGGGCCTAATTCTTTTAC	1
ACAAACGGTACCACAAAATAGCAC	1
ACAAACGGTCAAACATGTGCTTAA	3
ACAAACGGTCCTTGCACAGTTGTG	1
ACAAACGGTGGTCTCGATTGTGAT	2
ACAAACGTAGGAGATACATTGGGC	1
ACAAACGTAGGTGATACATTGGGC	1
ACAAACGTGCAGGAATACTTAAGG	1
ACAAACGTTGAACGTGAATAGTGCA	1
ACAAACTAAAAAGTCAACGGTGTC	3
ACAAACTAGTCGGCCCGTTTGGAA	3
ACAAACTGCTGCCCGATTCCGGT	1
ACAAACTGGGCTAAAAATCACAAG	1
ACAAACTGGTAGAGGCACGGTTGC	1
ACAAACTGTTCGAACAGCCGTGC	3
ACAAACTTATTAGGTGGGTGCA	1
ACAAACTTATTAGGTGGGTGCAAT	1
ACAAACTTGTCTAGTTCATGTGAA	2
ACAAACTTGTTAGGTGGGTGCA	1
ACAAACTTGTTCAGTTGTGTCACCCC	1
ACAAACTTTAGGTGCATAAATTG	1
ACAAACTTTAGGTGCATAAATTTAC	1
ACAAAGAAAACACGGTCGGGATCG	1
ACAAAGAAATAATGTTCACTGC	3
ACAAAGAACATGTGTGCTTAACTC	1
ACAAAGAATAGAGGTGTAATTGAC	1
ACAAAGACTTAGTCAAAGGAGCCA	1
ACAAAGAGAATATGGGCGACCCTA	1
ACAAAGAGGGCCTAATTAAGTTAG	1
ACAAAGAGGTCACAATAGTTGG	1
ACAAAGAGGTGTCGCACTCTCGCA	1
ACAAAGAGGTTTCTTTTACGGTTC	1
ACAAAGAGTCTGTTTGTGATGCCT	1
ACAAAGAGTTAGGTGCCGGATTG	1
ACAAAGATCTGGTCAACACTGCTA	1
ACAAAGATGAGGTGCAAGCGTGCA	1
ACAAAGATGGACCATTGATGCAAA	1
ACAAAGATGGAGATGTCGCCTGGC	1
ACAAAGATGTAATCAGTGGGC	1
ACAAAGCCACCTAAGGACCTTGTG	1
ACAAAGCCAGAGGTGAAAGGATGG	1
ACAAAGCGTGGTGCCAATTTGCCT	1
ACAAAGCTGTATTTATTTTAGGAC	1
ACAAAGGAACATGGATGTCGA	1
ACAAAGGAATTGGTGCAGTCCTAA	1
ACAAAGGAGGTCCTGGGGAACCAA	1
ACAAAGGAGTGCCACATCAGCAT	1
ACAAAGGATGGTCTCAACGCCCGA	3
ACAAAGGATTACGTATGGGCAA	2
ACAAAGGCCGTGTTTAGATACTGT	1
ACAAAGGGGCCCCGAGTCTTTATC	1
ACAAAGGGGCCGTCATGATGAGTA	1
ACAAAGGTAGAGACCGATATGGTC	1
ACAAAGGTAGAGACCGGTATGGCC	1
ACAAAGGTAGAGTCTAATACGAGC	1
ACAAAGGTGACCGGTCTGTGACTG	1
ACAAAGGTGACGGTTCTATGACTG	1
ACAAAGGTGATGCAATCAATTCA	2
ACAAAGGTGCAGCCTCCTCCGGGA	1
ACAAAGGTGCCGGTTCTAGCCGA	1
ACAAAGGTGTCGGTTGAAAAACCA	1
ACAAAGGTGTCGGTTTTGAATACA	1
ACAAAGGTTAGGCCCACACATCA	1
ACAAAGTAGTCCAACGGGGTTGCA	1
ACAAAGTGATCCATTAGTGTGTGA	1
ACAAAGTGCATGTATAGATTCGTA	1
ACAAAGTGTCTTGCATTTCTTGAA	1
ACAAAGTGTGCAGAAAAGACATGT	1
ACAAAGTGTGGCAAAGTTAGCAAG	1
ACAAAGTGTGTCCACTTCTCCTCC	1
ACAAAGTTTAGGTGCATAAATTTA	1
ACAAAGTTTGCCTGGTTTTTCTA	1
ACAAAGTTTGCCTGGTTTTTCTAAG	1
ACAAATAAAATATAGCATGTGTAC	1
ACAAATAAAGATTTTGGTGATCTA	1
ACAAATAACATTTGGTGCTATAGA	1
ACAAATAAGGAAGGTGCTAGAGGC	1
ACAAATAAGGTGGTGTTTGGATCC	1
ACAAATAATGCCTAGCGCCTTTTC	1
ACAAATACTATGAGCGGTGATGGT	1
ACAAATACTGAGTGTTAAAGGTTG	2
ACAAATAGAGGTACTTAAAGTGAA	1
ACAAATAGGTCCATCTGTGT	1
ACAAATAGGTGAAAGCAGATTGT	1
ACAAATAGGTGAAAGCAGATTGTT	1
ACAAATAGTGAAACGTTAGATAAA	1
ACAAATATAACGAGGGGCCATGAC	1
ACAAATATAATGGTGTGATCGGAT	1
ACAAATATAGTACTGGATGTGAC	1
ACAAATATAGTTGCGAATGTGCCA	1
ACAAATATAGTTGCGACGGTGCGA	1
ACAAATATCAGGTGATATGCTGAC	2
ACAAATATTTATAAGGATGGTTAA	1
ACAAATCAAATCATAGCGGTCGCCA	1
ACAAATCAATAGGAAATGCTAT	1
ACAAATCATATGGTACCTGGAGGT	1
ACAAATCATCACGATGAGCGGGAC	1
ACAAATCCGAATATATTGTGGTCC	1
ACAAATCCTAGTGCTCAAGATCAA	1
ACAAATCCTGGGGGCTAAAAGTAG	1
ACAAATCGAGACATGGCACATGGA	2
ACAAATCTAGGATGTGATGTGACG	2
ACAAATCTAGGCCTGAATATGAC	1
ACAAATCTGATGTGGTAGCTTGTA	2
ACAAATCTGTGTGATTCGGGATGT	2
ACAAATCTTACATCAAGGTGTAGC	1
ACAAATGAACAGGCTGTATGTGCA	1
ACAAATGACTCATCTGTGACGGGC	1
ACAAATGACTGCAGTGTGCTTGAC	1
ACAAATGAGGTGGAGCTAGCAACT	1
ACAAATGAGTGGATTGTTGGA	1
ACAAATGAGTGGCCTATATTTTCT	1
ACAAATGATTTAGACAGGTTTAGG	1
ACAAATGCATGTGCGGCCTTAGCC	1
ACAAATGCCACTAGGGTTTACCGT	1
ACAAATGGAAAGGAGGGAGCCGGT	1
ACAAATGGAAGGTGATGATGTGTC	1
ACAAATGGACTTACCATGTGT	1
ACAAATGGAGACTGCTACGGATCG	1
ACAAATGGTAAAAGTTTTGGTGGC	1
ACAAATGGTACGTGTCGACGGGAC	1
ACAAATGGTAGTCTTGACAAGTGT	1
ACAAATGGTCAAACGTGATGGCGA	1
ACAAATGGTCAAACGTTAAACGTG	2
ACAAATGGTCAAACGTTGGTCGAA	2
ACAAATGGTCGAGTGACAAGTTAG	1
ACAAATGGTGAAACGTTATGCGAA	1
ACAAATGGTGCAAAAGGAAGTGCC	1
ACAAATGGTGCTTAATGATTTGCC	13
ACAAATGGTGTCTAACGATTTGCC	5
ACAAATGGTGTGTTCGCAAGTGCA	1
ACAAATTACAGATTCTGCCTATA	2
ACAAATTACCTACGCGATGTACGC	3
ACAAATTAGAGGGGCTTTTAACTA	2
ACAAATTCTTAGAATTTAGGTGAC	1
ACAAATTGAGGAACGTAAGGTGAA	1
ACAAATTGATAAGTGGGTGCGTTC	1
ACAAATTGGAGGACCTAAACGAGT	1
ACAAATTGGAGGACCTATACGAG	1
ACAAATTGGGGTGAAGCTAGCTGT	1
ACAAATTGGTGTGCTAGTCGGTCT	2
ACAAATTTAAGGACCGCCAGTAC	1
ACAAATTTAAGGACCGCCAGTACA	1
ACAAATTTAGGGGCCAGTGATGGA	1
ACAAATTTAGGTGGTGTTTGGTTG	1
ACAAATTTGTAATACGGGGGTGGAG	1
ACAAATTTGTACTACGGGGGTGGA	1
ACAAATTTGTGTGAAGTAAGATGAA	1
ACAAATTTTAGCGGAGGGGGCTGC	1
ACAAATTTTAGGTGCGTAAAGTAG	1
ACAAATTTTCTCAGTCGGCCATCC	2
ACAAATTTTGGACGGAGCCGTCAG	1
ACAACAAAACATCACACATGCCTA	1
ACAACAAAATAAATTATAAGTGCA	1
ACAACAAAGTGCTTGACAACTAAG	5
ACAACAAATCGATGATGATGAAGG	3
ACAACAAATGAATGCCATTGAAG	1
ACAACAAATTGACAGGTGATATGC	1
ACAACAACCGGGGACTAAAGATGG	1
ACAACAACCGGGGCTAAAGTTAGG	1
ACAACAACCTAAAACCGGATGTGA	1
ACAACAACGGTGACACGGTGATGT	3
ACAACAACTACCTGGTTGTAGTGC	1
ACAACAACTTAGGGTGTGTTTGG	1
ACAACAACTTGGTAGGTGAGTGCG	1
ACAACAAGAGGGTGAAAGCAAAGT	1
ACAACAAGATCTGTCGGTGGTGAG	1
ACAACAAGATTAGTGCAATACCAT	1
ACAACAAGCTGAACGATGGTGTAG	3
ACAACAAGGAATGTCCTCTGGAGA	1
ACAACAAGGGGATGTCCTCTCGAG	1
ACAACAAGGTGGATCAATTAAGAG	1
ACAACAATAAAAGTGGAATGCCTA	3
ACAACAATAAAGTTAAGTGCAGCC	1
ACAACAATAATATTAATTATAAGA	1
ACAACAATAGGGCACTGATGAG	1
ACAACACAGCCACCGGGCACCAGC	1
ACAACACAGGTAGTGGGAGCTCGA	1
ACAACACCACACTTACACACCGCG	1
ACAACACCCGATGTGACACTCTAA	1
ACAACACCCGATTTAAATGAGTGA	2
ACAACACCTAGTGCTGCCCTTCCA	1
ACAACACCTGTAACCAGACCTGCC	1
ACAACACGGTCAGAGCTCCATTGC	1
ACAACAGATAAAAGTTGGGGTAGC	1
ACAACAGATGAGTGTCATCAA	1
ACAACAGATGCCATATATGTATGA	1
ACAACAGATGCCCTGTGCCCAAGA	1
ACAACAGCAGCTGTACTACTGGTA	1
ACAACAGCCAAGCCTACCCCAGAG	2
ACAACAGCGTGCTTCTCTGACTGC	1
ACAACAGGATACTATGCGCAATGG	2
ACAACAGGGTAGCCTTCCTCCTCG	1
ACAACAGGTACAAATTGATGAGGA	1
ACAACAGGTTTGTGAACAGGTGGT	1
ACAACAGTGAAATTAAGTGCAGCC	1
ACAACATAAGTGGGCCACATGGAG	1
ACAACATAGGTGGAATGGATGCCC	1
ACAACATATAGTATCAGTAAGGAC	2
ACAACATATATGGTGAGGAGTGTC	1
ACAACATCTGCAGGATGTCTTAGC	1
ACAACATGGAAGAATGTCTGCATA	1
ACAACATGGCATACGGTGGATGGA	1
ACAACATGTGCAGCATGTCGATGC	2
ACAACATGTTCGATGGAATGCCTA	1
ACAACATGTTGCCCCTGTTTGAGG	1
ACAACATTGTAGATGCCTCCTGTA	1
ACAACATTTGAGGCAATATGGTA	1
ACAACATTTTGTATGCGGTGCGAG	1
ACAACCAAAAGACTAGTTTGATGG	1
ACAACCAAAGTTCGACAAGGGTAC	1
ACAACCAAATGCCGACTTAGATGC	1
ACAACCAAGTAAGTAAGATGGCAA	1
ACAACCACAACACCTACAACAAAT	1
ACAACCACAGGGCCCAACATAAAG	1
ACAACCACCCTTAACCCAAAGAC	1
ACAACCACGTCATATCACGGGTGA	1
ACAACCAGAGAATTGGTGAGTGAC	1
ACAACCAGCGACCTCCACCTCCGC	1
ACAACCAGGAGTGAAAAGAGTGCT	1
ACAACCAGGTCATAGTCCTATTGC	1
ACAACCATAGTTATACGTGCTCAA	2
ACAACCCAATCTGAAATTCGCTCC	1
ACAACCCACACACCCAATGCAAAC	1
ACAACCCCAGAGTGTTACGCGCCT	1
ACAACCCCTTCAGGATCCTGCGTG	1
ACAACCCCTTTAGGATCCTACGTG	1
ACAACCCGAAACCGAAACCGACAC	1
ACAACCCTACAAGTTTAAGGACCA	1
ACAACCCTGGTTGCTTATAGATGG	1
ACAACCGATAGAGATGATGCAGCC	1
ACAACCGATGCTCCTAGAGGTGGG	1
ACAACCGATTGATGGTCATCC	1
ACAACCGGGGCTAAATACGGAGGA	3
ACAACCGGTACTAAAGATGTCTAC	1
ACAACCTAACCAGGGAGGTGGCCA	1
ACAACCTACTGTGCAGCGATAGAT	1
ACAACCTAGTATCAGATGCGACAC	1
ACAACCTATGACCGGATGGGACGT	1
ACAACCTCTCTAGACTACGGATGT	1
ACAACCTGAGAATCATCCTTGAGG	1
ACAACCTGATGGAGTAGTTCCGGC	2
ACAACCTGTAGGTGTCGATTGTGGC	1
ACAACCTTACATGTGTGTCCCACG	1
ACAACGAACCTACACCTACACATA	1
ACAACGAACGCATACTCACTCCTA	1
ACAACGAACGTGGTGTCTTCTTTC	5
ACAACGAAGGAGTCTTAGCCCTGC	1
ACAACGAATCTAGACATGTCTATG	1
ACAACGAATCTGGACAAAGGGTAG	1
ACAACGAATCTGGACAGGTGTATA	1
ACAACGACAGCCTCGACATCAGAA	1
ACAACGAGAGGTGCTGATGAAGGA	1
ACAACGAGCAACGATGCTGGGGAC	1
ACAACGAGTTGCTAGTGCCTGAAG	1
ACAACGATCGAAAACGATTTGGTA	1
ACAACGATCTTGTCCCACGGTTGT	1
ACAACGATGAGAGGAACGGTGTCG	1
ACAACGATGGATGTCGGTTGGGAA	6
ACAACGCAATTGGTGCATGCTGAG	1
ACAACGCCAGATTGAGGTGCTTGG	1
ACAACGCCGGCAATGGGGGTTTAA	1
ACAACGCGTAATTTGTTTGGGCTA	1
ACAACGCTGCCATAGCTAAAAGGT	1
ACAACGGAACCACGAGGACTACTC	1
ACAACGGAAGACGTTAAAGAGTGG	1
ACAACGGGATCCAACGACAGCAAG	1
ACAACGGGATGCCCGGCTGATGGT	2
ACAACGGGTCCTTGAACTATCAAA	2
ACAACGGGTGTGTGGTTTCAATCT	1
ACAACGGTGCAAGAATTTCTGAAC	1
ACAACGGTGCAATCGGATCGTAGA	1
ACAACGGTGTAATCGGATTGTAAA	1
ACAACGGTGTGATCGGATCGTAGA	1
ACAACGGTGTGATTGGATCGTAGA	1
ACAACGGTTGTTTGGTTTATGTGT	2
ACAACGGTTTCACATGGTTGATGT	1
ACAACGTAAGTGTGAGTAAGGTGA	1
ACAACGTATTGGAATTCGTGCTGC	1
ACAACGTATTTGGACTGTCTAGAT	1
ACAACGTCGCGTCCGCTGGAAGAC	1
ACAACGTGAATGGAACACTGC	1
ACAACGTGCGATTGATCAAGACTA	2
ACAACGTGGGGGATACATTGGGCT	1
ACAACGTGTCAAATATTTATACAA	2
ACAACGTGTCCTATATTACGCGGT	1
ACAACGTGTGTATGACAGATGGGA	1
ACAACGTTACTCTAGATGACATGG	1
ACAACGTTGACTACACCGCGGAGA	1
ACAACGTTGTACTAGGATATGTTA	1
ACAACGTTTAGTAGTTTGGGAAGC	1
ACAACGTTTGATGTCGCGATTCCG	1
ACAACTAACTATTGTATGAGTGGA	1
ACAACTAACTCTATCAGGAC	1
ACAACTACAAAGGTGTGATGAAGA	3
ACAACTACAGAGGTGTGATGAAGA	2
ACAACTACCTGGTTGTAGTGCTA	1
ACAACTACGAATTGCAGATGATGG	1
ACAACTAGATGTAAAATGTGTGGC	1
ACAACTAGCATGTGTCACATTCGA	1
ACAACTAGGCCCGATTGAGATGAC	1
ACAACTAGTATGGTGGCCCGCGCA	1
ACAACTCACCGAAAGATCGGGCCA	1
ACAACTCAGTAATATGGTGATTGT	1
ACAACTCCTGTCTTTTCTTTGTGG	5
ACAACTCGGTAACTACATGATCAA	1
ACAACTCTCGCAGCTAATGATGGA	1
ACAACTCTTGATTAGGTGCTCCAT	1
ACAACTGAACAAGTTGGAGGACCT	3
ACAACTGAGATGTAAAGTAAGGGC	2
ACAACTGATCGGACGGCTTACGAA	1
ACAACTGATGACCGAATTTGTGAC	1
ACAACTGATGCCAACAAACAAGAT	1
ACAACTGCTTTTCAACGAGGTGGT	1
ACAACTGGGAATAAAGATCAAAA	1
ACAACTGTACCCACAAGACACAGC	1
ACAACTGTGGATAGATTAAGGTTG	2
ACAACTGTTCAACCAGATCAC	1
ACAACTTAATTTTTTAGGTCTAAC	1
ACAACTTCATAGGGAGCCAGGGAC	1
ACAACTTCTAGCTACGAATTTAAA	1
ACAACTTGACAGTATAAGGTGAGA	1
ACAACTTGAGGAGTTGGGGTGTCG	1
ACAACTTGATAAGTGGGTGCGTTC	1
ACAACTTGATGTGCAGAATGCTT	2
ACAACTTGATTTTGTTTGGTACCT	1
ACAACTTTACCTACGCAAGCTACT	1
ACAACTTTAGGTCCTGAGTCTACA	2
ACAACTTTTAGTGAATCAGTTGGT	1
ACAACTTTTCAGTCACATCATCTC	1
ACAAGAAAAGTAAAAGGGTGGCGA	1
ACAAGAAAATAGACAGCATGCCAA	1
ACAAGAAAATTAACTATGGATGCA	1
ACAAGAAACCTAACCAGTTGTGCA	1
ACAAGAACACAAGAGTAGGGTGAT	1
ACAAGAACGAAGGTGTAAGTGAGC	3
ACAAGAACGTGTCGACATATGTGA	1
ACAAGAACTTGATAGGTGCATGTG	4
ACAAGAAGCTCTGGGTGATTTTCC	1
ACAAGAAGGTTGAGATCCACGTAC	1
ACAAGAAGTATATATGAAGGTGAA	1
ACAAGAATGAGTGAGTGCATATGT	1
ACAAGAATTGAAGCCTACAAGGAC	3
ACAAGACATGGTACAAAAGGTGAT	2
ACAAGACGAACGGTGAATAGTGCA	1
ACAAGACGGCCGCTTCATCGCAAC	1
ACAAGACTAAATGGTGAGGGTGGA	1
ACAAGACTACATGATGACTACTGC	2
ACAAGACTGGTTGCTAGAAGGTGT	1
ACAAGAGAACTCTTGATGT	1
ACAAGAGAGCGGTGTCTACTCAAT	1
ACAAGAGATAGTTCTAACACGTGC	1
ACAAGAGATCTTATTATAGGTGAC	1
ACAAGAGCATGATTAGAGGTGTCG	2
ACAAGAGCCGCGTGTATAGAGGGG	1
ACAAGAGCGGTGTCCGGCATTTGC	1
ACAAGAGCTTGCCCTCGTCGC	5
ACAAGAGGAGCCAATAATATTCAG	1
ACAAGAGGGGACCCGTAAATGGAC	1
ACAAGAGGGTCCACATATCAGTTA	2
ACAAGAGGTCCCCCTTAAGGTGAA	4
ACAAGAGGTTGTGCAGATTTATTG	1
ACAAGAGGTTTGGTAAGATTACGA	1
ACAAGATACAAGGGAGTTTGT	1
ACAAGATAGCAGAAATGGTGGCCG	3
ACAAGATAGGGCCTGCGAATTTGC	1
ACAAGATAGGGTGGTACGTATTCA	1
ACAAGATAGGTCCACATAAAATGA	1
ACAAGATATATATACAAAGGTGAA	1
ACAAGATATCTACCACTATCGACT	1
ACAAGATATGGTTTCCTTCTCTTT	1
ACAAGATCTATATCTTCAAGGTGCT	1
ACAAGATGACAAAAGCACAGTGCA	1
ACAAGATGAGGAAGGCCAGGATGC	2
ACAAGATGAGTGGCCAAACGTTGG	1
ACAAGATGATGGGCTAGCCGGTCT	2
ACAAGATGCGTGTGCCTTTGC	1
ACAAGATGGCAAGAGTGTTTGGAT	1
ACAAGATGGGTCCGACGATGACCA	1
ACAAGATGGGTCTTACGAAATAAG	1
ACAAGATGGTATGTCTAGATGTGC	1
ACAAGATGGTGGATTACGACCTGG	1
ACAAGATGGTGGGCTATACGATAT	3
ACAAGATGTAAAGGGCAGACCTAA	1
ACAAGATGTACCAAAATGCACCTA	1
ACAAGATGTCAATGGTGGCTTTGT	1
ACAAGATTACAACCCTAGGAGGTC	2
ACAAGATTGAAAGAGAAGCTTGGC	1
ACAAGATTGAAATTGTGCCAGCC	1
ACAAGATTGATTAAGTTAGTCTA	2
ACAAGATTGCCATAACGTACCAA	2
ACAAGATTGGACACAAGGTTGCA	3
ACAAGATTGGATACAAGGTTGCA	2
ACAAGATTGGTTGCATGGGCATCG	1
ACAAGCAGTGAAGATGAAAGGGGA	1
ACAAGCCAAATGGTGAAGTAA	1
ACAAGCCAATTTCTCAGATGATGC	2
ACAAGCCCAAACATCGCCCAC	1
ACAAGCCCAAAGATGATGGTGTTCG	1
ACAAGCCCCAAGATGCCACATAGG	1
ACAAGCCCGTAGGATGGTAGTTAA	1
ACAAGCCGTAAGGGGCAGATGGTC	1
ACAAGCCTACACCCTATGGGAGAA	1
ACAAGCCTTAATACGTTGAGTTGG	1
ACAAGCGATGGTAACCAGAAGCTG	1
ACAAGCGGCACTGGTTGGAGC	1
ACAAGCGGTTGCTGGTAAAGTCGG	1
ACAAGCTACACTTTCTGAACGAGG	1
ACAAGCTAGTACTACGAATCTGAA	1
ACAAGCTCACGTGTTGAGTTATGC	3
ACAAGCTCCTCAGGCTGACCTGGT	1
ACAAGCTCTTGTCTTTTGGTGTAG	4
ACAAGCTGCTAACCAACATATTGC	1
ACAAGCTTGGAGGATGTCGGTGAC	1
ACAAGCTTGTCAAGGCCGTTGC	1
ACAAGGAAAACACGATGGAGTGAC	1
ACAAGGAAACAAGAGTGACGACACA	1
ACAAGGAAACTAACTAGTTGAGCT	2
ACAAGGAACATTTATGGAGAAGAG	2
ACAAGGAACCTAAACAATTGAGC	2
ACAAGGAACCTAGCTAACCAGTTG	1
ACAAGGAAGCAGAAGAGCCGGCGG	1
ACAAGGAATACAAGCAAAGGCGAC	1
ACAAGGAATCAGGGTAGAACGGCC	1
ACAAGGACTAAGGTGAGCCCGAAA	1
ACAAGGAGATATGTGGCTAAAAGA	1
ACAAGGAGGAGATGAAATTTTGGA	2
ACAAGGAGTAAGAATTGACGGGCCA	2
ACAAGGATACAATAGTCCAATGGA	1
ACAAGGATTAGTAAGCTATGGGAG	1
ACAAGGATTCCAAAGGATGGCA	4
ACAAGGATTGCTCAATCTGGT	1
ACAAGGCCCCCTAGGAGGAGATGG	1
ACAAGGCCTGAGTTGCAACACACC	1
ACAAGGCCTTAGCTAATACAACAG	2
ACAAGGCGGCCAAGAGCTGGGGAG	1
ACAAGGCTAAGGAAGTGTGGCAGC	1
ACAAGGGAAACTGCGTGGGGGGAG	1
ACAAGGGACCACACGTCAGTGCAC	1
ACAAGGGACCTAACATATACGTAG	1
ACAAGGGAGGTGGCACTGATTGAA	2
ACAAGGGCATGGGGGTTATAGCCA	1
ACAAGGGCCAGAGAAGCAGTC	2
ACAAGGGCCCTGTTTGGATCCGGA	1
ACAAGGGCCCTGTTTGGATTCAAG	1
ACAAGGGCCTTGTTCAGTAACTGG	3
ACAAGGGCCTTTGACAGAGGATGC	2
ACAAGGGCTGACATATAAATAGAT	1
ACAAGGGCTTCGGCTATGTGTTGC	1
ACAAGGGGAATGATGGCGAAAGGA	1
ACAAGGGGAGCAGAGGTGGATCCA	1
ACAAGGGGTGTCTACACCTAAGCC	1
ACAAGGGGTTACCTTGCGCCTGAG	1
ACAAGGGTACGGTAATATAAATAC	1
ACAAGGGTGCAAGTGGGTAGACTC	1
ACAAGGGTGCTTGTTGAAGGCAAG	1
ACAAGGTACCACAGGTTTGAT	1
ACAAGGTACCTATCGAACAACCAC	1
ACAAGGTATATTTGTTGTAGTGCA	7
ACAAGGTCCAGTTAGGTTTGC	1
ACAAGGTCCAGTTAGGTTTGCC	1
ACAAGGTCCTATGATAGTATACAT	1
ACAAGGTGAGCCATTAGCATATGA	1
ACAAGGTGATAGGTACGGTGTAG	3
ACAAGGTGATGGGCTAGACGACCTG	1
ACAAGGTGCACTGGGCTATCCGGA	1
ACAAGGTGCAGCATCTGTGTT	1
ACAAGGTGGAGTATGATTCAAGGT	1
ACAAGGTGGGATTGCTATTTCATG	1
ACAAGGTGGTGATAGACGATCTGG	1
ACAAGGTGGTGGGCTAGACAACCTG	1
ACAAGGTGGTGGGCTAGACGACCTGG	1
ACAAGGTGTGAATGTCTAACAGA	1
ACAAGGTGTGAATGTCTAACAGAT	1
ACAAGGTGTGGCAACTTTTGTTGG	1
ACAAGGTGTGGCAATTTTGTTGGC	1
ACAAGGTGTGGCTCATATGGACTA	1
ACAAGGTGTGTGAGTATGGTGTT	2
ACAAGGTTATACTAGATGGAGTCT	1
ACAAGGTTCAAAGAAAGGGTGGA	1
ACAAGGTTGATGGTCTGTCCA	1
ACAAGGTTGCCACACAATAGTTGG	10
ACAAGTAAAGGATACTGTGTGCCC	1
ACAAGTAAAGTGCATTGGCGGTCC	1
ACAAGTAAGTGTTTCAAAGATGGA	1
ACAAGTACAAGTGATAGACGACGC	1
ACAAGTACTAGGATGTGACAACGA	2
ACAAGTACTTAAACAGGCTGT	1
ACAAGTAGATGTGTGTAGAGATGG	1
ACAAGTAGCCATACGCACAGTCTG	1
ACAAGTAGGGCCTGATTGGTACAG	1
ACAAGTAGGTGTACGTTTACTAGC	1
ACAAGTAGTCAAGTGCTATCATGG	1
ACAAGTATAGGGGAGTGGATTCA	1
ACAAGTATCAGGCCTGGTACCCA	1
ACAAGTATCATATGTATCAGGTCC	1
ACAAGTATCCAGGTGGTCTAGCCG	1
ACAAGTATGCTTAAGTGATGGGCG	1
ACAAGTCCGGATAGAAGGTTGTTC	3
ACAAGTCCTTGATGTTGATGGTTA	1
ACAAGTCGAGGTGACATGCGTGTA	1
ACAAGTCTAAGACAGAGGTAGCAA	2
ACAAGTCTAAGGATCGACCGAAA	1
ACAAGTCTAGAACGTCGTGCA	1
ACAAGTCTAGGGACCGCGTGTGCA	1
ACAAGTCTAGTGACCGGTGATGGA	5
ACAAGTCTATACACAACCGGCTGC	1
ACAAGTCTGGGTGATAGATTGCCA	1
ACAAGTGAATAAACGAGGAAAGAG	1
ACAAGTGACGTGGTGAGACCGAGC	1
ACAAGTGAGAGTAGACGGTTGCTT	1
ACAAGTGAGTGTATGACATGTGGG	2
ACAAGTGATTGGTGTCACTGACAA	1
ACAAGTGCAATATTTGTGGTACA	1
ACAAGTGCAGAACCAGCAAGGGAA	1
ACAAGTGCTAAAAAAGTGCATGTGA	1
ACAAGTGCTATAGGCGTGGGTGGT	1
ACAAGTGCTTTATATGACTTGGA	1
ACAAGTGGACACCTATGGGTATAA	2
ACAAGTGGATTGACTTGAGTGCT	1
ACAAGTGGGCCATATATTAATTGT	1
ACAAGTGGGTCCGCGAGTGGTGGG	1
ACAAGTGGGTCCTATATTAATTGT	1
ACAAGTGTAGCTTGCATTGTGGAC	1
ACAAGTGTGCCCTATATTAATTGT	1
ACAAGTGTGTCACATTTGTCCCT	1
ACAAGTTAAGTGACTATGAAAGCA	2
ACAAGTTAGAGAGGCCTATATGTC	1
ACAAGTTAGCATGGTGTAAGATGA	2
ACAAGTTCTAGGACCTGGATATGC	1
ACAAGTTGAGAGACCTTCGGTGT	1
ACAAGTTGAGGGACCTTGGGTGTA	2
ACAAGTTGAGGTGTTACGCTGCCA	2
ACAAGTTGCAAGATGATGAGTCC	1
ACAAGTTGCAAGATGATGGGTCTG	1
ACAAGTTGGAGGACCTAAACGA	1
ACAAGTTGGAGGACCTAAACGAGT	2
ACAAGTTGGAGGATCTAAACGAGT	1
ACAAGTTGGATGACCTAAACGAGT	1
ACAAGTTGGTGGGCTAGACGACCT	1
ACAAGTTGGTGTCATTGTCGGTGT	4
ACAAGTTGTAGGACCTAAACGAGT	3
ACAAGTTTAAGGACCGCCGGTGCA	1
ACAAGTTTAAGGACCGTCCGTGCA	1
ACAAGTTTAGGATCTGCTCGTGCA	1
ACAAGTTTAGGGACCGATGATGGA	2
ACAAGTTTAGGGACCGCTCGTGCA	1
ACAAGTTTAGGGATCTCGACGTGC	1
ACAAGTTTAGGGCCTGTTTGGTAC	2
ACAAGTTTTAGAACCTGAATCTGC	1
ACAAGTTTTTTGGATGTCCTGTAG	1
ACAAGTTTTTTGGATGTCCTGTAGC	1
ACAATAAAAACCGGGGCTAAAGAT	1
ACAATAAAAATGAGTGCAGCCGAA	1
ACAATAAAAGTGGGTCTACATCAG	1
ACAATAAATAACAATACCGGGCGC	1
ACAATAAATACCGTTCGGACAGAA	1
ACAATAAATATGTAAGAGTGCTAG	1
ACAATAAATATTCGTGCCCAACAT	1
ACAATAAATCTAGACAGAGGTACG	1
ACAATAAATCTGAATAAAGGGTAC	1
ACAATAAATCTGGACAGGGTGTA	1
ACAATAAATGTTAAAGATAGCCTA	1
ACAATAACATAAATAAGGTGTTGC	1
ACAATAACATGTGAGACGGTGTAC	1
ACAATAACTTGTCAGGTGGGTGCA	1
ACAATAAGATTGCCTAACCTTGAT	1
ACAATAAGCCTGCGGTTGCCCAAT	1
ACAATAAGTGTTAGCTAGGTGAGA	1
ACAATAATTAAGGTGCAAGCA	1
ACAATACAAACGCAGGCGCTCACA	1
ACAATACAGACGTCGCTTATATAC	1
ACAATACAGGTAGTGGAGTCTCGA	1
ACAATACAGTGTATGTGCGGGAGA	1
ACAATACTAACAATTTTAGGTGCA	2
ACAATACTATAAAGACATTTGCCC	1
ACAATACTTAAGGTGATATA	1
ACAATAGAAGTAGGGATGAGCCGC	1
ACAATAGATATGAGATTGAGGTA	1
ACAATAGATGTAGGCCGCTGATGC	2
ACAATAGCGCCGTGACGTGGACGT	1
ACAATAGGAACGCCAACCCTTCAC	1
ACAATAGGAGTCCTTTGATAGTGCT	1
ACAATAGGGAGTGCCCCATGGAGG	1
ACAATAGGTACAGTGTGACAAAA	1
ACAATAGGTGCAGTGAAGGTGACC	1
ACAATAGGTGCCGCTTCCGGAGCA	1
ACAATAGGTGTGTCTTCAATCAAAA	1
ACAATAGGTGTTGGTTTTTATCTA	1
ACAATAGGTTTGAGGTGGGTGTAA	1
ACAATAGTCCCGGTTCCACTAAAA	3
ACAATAGTGATACCGAGTTGATGC	1
ACAATAGTTAGAGATGATATGGTC	1
ACAATAGTTATGGTCCATATGTGT	2
ACAATAGTTCCGGTTGCTCGAAAA	1
ACAATATAAGGGTGAGTACTTTCA	2
ACAATATAAGGGTGAGTACTTTCAA	1
ACAATATAGTTAATGCCATAGACA	1
ACAATATAGTTATAGTAGCACAAG	1
ACAATATATAGATGGAGAAGGGGT	2
ACAATATATAGGGAGAATGTAGAG	1
ACAATATATATGTTGAGGAGTGTC	1
ACAATATGACTACCAAGAATGGTA	1
ACAATATGAGTCATTGACAGGTGA	1
ACAATATGCCACTAACTTTGTTCA	1
ACAATATGGTGCAATTTGTGATGT	3
ACAATATGTGGGTAGCCTATCTAA	1
ACAATATGTGTATGATAGGATAGA	1
ACAATATGTGTATGATAGGTGGGA	1
ACAATATGTTTATGATAGGTGGGAC	1
ACAATATTATCAGTGGGCTAGTAC	2
ACAATATTTGGGGTAGTCTATCT	1
ACAATCAATAACACACTCGGTGGA	1
ACAATCACGGTGGTTGGTGGAACT	1
ACAATCAGAATGAGCCACGTC	1
ACAATCAGCCGTAAGCAACCGATC	1
ACAATCAGTCAAGTGGTACTGCCA	1
ACAATCATAGATGTGGTGTCTAGG	1
ACAATCATCTCTATGTTGCCTCTA	1
ACAATCATGGTGTCCTAAGAGCAA	1
ACAATCCCGGTCTCATGTAGCTTA	2
ACAATCCGAAGCCTCCTGGACTCC	1
ACAATCCGGCCTAGGTGGGGTTGG	1
ACAATCCGGTTTAGGTGAGGTCGG	1
ACAATCCGTCGTGCCATCCCTAGT	1
ACAATCCTTCGTAAGTTGAGTTTT	1
ACAATCGAGTTCGCTATGGTTCTAC	1
ACAATCGGATTAACTAGCTTACAA	1
ACAATCGGCCTAGCCTATTACTTA	1
ACAATCGGGTGGCACAGAGGCGCA	1
ACAATCTAAAATCGAATGGGATGC	1
ACAATCTAGAACCGGATGAGAGA	1
ACAATCTAGGTGATGATTTGATAC	1
ACAATCTAGGTGATGATTTGATACC	1
ACAATCTAGTATTGAATGTGACAC	1
ACAATCTAGTCCTACGAATCTGGA	1
ACAATCTCCGGTTGTCTATGGTAC	1
ACAATCTCGGGTGATCGGTTTTGT	2
ACAATCTGAACTGTTTGGGGAGC	1
ACAATCTGATATGTGCCAAATCTG	1
ACAATCTGGATTCGAAGCCTCACC	1
ACAATCTGGTGTGCAGTTCAACAT	1
ACAATCTTTGCAGTAAGGTGATGG	1
ACAATCTTTTGGTGTCTTCTAGCA	4
ACAATGAAATTAAAAAAGGGTGGC	1
ACAATGAACGTGTATAGATGGTAAA	1
ACAATGAATCTGGATAAATGGTAG	1
ACAATGAATCTGGTACTAGGATGT	1
ACAATGAATTTGGACAGGAGCTA	2
ACAATGAGATACGTGGAAAGCAGA	1
ACAATGAGATTCTAGGTACTGTGG	1
ACAATGAGGGACCAACTAAATCAC	1
ACAATGAGGGGATGTCCTTACGAG	1
ACAATGAGGTACTAGTATTATGAG	2
ACAATGATAGTATAGGGTGCTTGC	1
ACAATGATGAATAGTAGGTGGCCC	1
ACAATGATGATGGCTACGTGATTG	2
ACAATGATGCTGATGGTGTGGAGG	1
ACAATGATTATAGGTCCATTA	1
ACAATGCAAAACTTGATAGTGTC	2
ACAATGCAAATCCAAGCCAATCAG	1
ACAATGCAACAAGGAAGATGGATC	1
ACAATGCAACGAGGATGTGGCGCC	1
ACAATGCAATGAATGTGTGCTCCA	1
ACAATGCACGGATGTCTTACTAGGT	1
ACAATGCAGATACATGGTGTTTG	1
ACAATGCCAACTAGGATGAGATAT	1
ACAATGCCACACCCACATGGCGCA	1
ACAATGCCCTCCTGGTACTTCGAG	1
ACAATGCCTGTGTGTTGCACTGGG	1
ACAATGCGTGTATGACAGGTGGGA	1
ACAATGCTGCAATCGATAGAAG	1
ACAATGCTTACTACCTGGTATGAA	1
ACAATGGAAATGCCACTAGGACC	2
ACAATGGAACAGGGAATAGATGGC	1
ACAATGGACTACGCCTTGAATTGC	1
ACAATGGACTATGCCTTGAATTGT	2
ACAATGGATAAAGATAGCTTAC	1
ACAATGGATGCGGACACCGGTAAC	1
ACAATGGGACCTTTAATATAGATA	1
ACAATGGGCCCCGCCTCCCATGGA	1
ACAATGGGTATGTAATGGTATAAA	2
ACAATGGTAAAGGTACCCATATAG	1
ACAATGGTAATCCGTGCACGAGCG	1
ACAATGGTATATACGTGCGCTTGC	2
ACAATGGTGGTCTATGTTTACATC	3
ACAATGGTGTAATCGGATCGTAGA	1
ACAATGGTGTAATCGGATTGTAAA	2
ACAATGGTGTAATCGGATTGTAGA	5
ACAATGGTGTAATTGGATTGTAGA	1
ACAATGGTGTGATCGAATCGTAGA	2
ACAATGGTGTGATCGGATTGTAGA	2
ACAATGGTTTAAGTCACACGAATG	1
ACAATGGTTTCATGCTGCCGT	1
ACAATGTAATTACACTACGATTGT	2
ACAATGTACAGTTACTTGTTGCTA	1
ACAATGTAGCCAGTTGAGGTCC	1
ACAATGTAGCGATTGAAATCTAAC	1
ACAATGTAGTACAAGTTCAGATGG	2
ACAATGTATATAAATACAAGGTAGC	1
ACAATGTATATTTGTTGTAGTGCA	1
ACAATGTATGTATATCAGGTGGG	1
ACAATGTATGTATATCAGGTGGGA	2
ACAATGTATGTATATCAGGTGGGAC	1
ACAATGTATGTATGACAGGTGGGA	1
ACAATGTATTGGAGTATGTGCTGC	1
ACAATGTGAGTATGATAGGTGGA	1
ACAATGTGCTATGAGACAATCTATT	2
ACAATGTGGATCGTACGGTTGATG	2
ACAATGTGGTGCGTTGCTTGTCTA	2
ACAATGTGTATATGACAGGTGAGA	1
ACAATGTGTCTTAGATTCCGCGCT	1
ACAATGTGTCTTGCAGTTCGTGCT	1
ACAATGTGTGAAGGCCTGATGGAT	1
ACAATGTGTGATAAGGACTTTAC	1
ACAATGTGTGCATGGTATGTGAGA	1
ACAATGTGTGTAATTAAGGTGGGT	1
ACAATGTGTGTATGACAGGTGGGA	1
ACAATGTGTGTATGACAGGTGTGA	1
ACAATGTGTTGTGTCTGTAGCAGC	1
ACAATGTTTAGGTCAAACCTTGG	1
ACAATGTTTGTTGCCTGCCATAG	1
ACAATTAAAGGAGTCTAAGTGCA	1
ACAATTAAGGTTGGGCACGGAATC	1
ACAATTAATACAGGTCCACTTATC	1
ACAATTAATACCTAGTGCCACATA	1
ACAATTAATATAGGGTCCACTTGT	2
ACAATTACACTCTTTAGCATGCCA	1
ACAATTACAGTTGAAAGTAGGGGC	2
ACAATTACGATATACTTGGTGGAA	1
ACAATTAGGTGGCTGAATACAGGA	1
ACAATTAGTTTTGTGGGTAGTCTA	1
ACAATTATTGAAGCCTATATGTGA	2
ACAATTATTGGAGTGTCCATCAGC	1
ACAATTATTGTTGAGGTTGCCAAA	1
ACAATTCAAATGTGCATGGGTCTA	4
ACAATTCAGGACGCATACTTACAC	1
ACAATTCAGTGACATACAACAGGA	2
ACAATTCGTCTATTCGTAACCGCA	1
ACAATTCTCGGTGCTATCCCAACA	1
ACAATTCTGGTCAACTACAAGAAG	1
ACAATTCTGGTGTGGAATCATTCC	1
ACAATTGAAACACTTTGGGGGGCC	1
ACAATTGAGATGTAAAGTAAGGGC	1
ACAATTGGCTTTTAAAGTGGGGCA	1
ACAATTGGGTAAGCCTATGGGAAA	2
ACAATTTACGGTGCAGTTGTTCAA	2
ACAATTTCCACGAGGAGACGTTGC	1
ACAATTTCGTGTGTTGGTCCTCAG	1
ACAATTTGAAAATTTGTAGGGTAC	2
ACAATTTGAGGTGTCGAGAACCAC	1
ACAATTTGCCTATTTGTAACCGTG	1
ACAATTTGCCTCTGACTTTATCAC	1
ACAATTTGGTGCAAGAACTTAAGA	1
ACAATTTGTACATAGTCTCACGTA	1
ACAATTTTGTAGGGCATATTTTGG	2
ACACAAAACGAGGTAAGCCATTA	1
ACACAAAACGAGGTAAGCCATTAG	2
ACACAAAACGAGGTGAGCCATTAG	1
ACACAAAACTGGTACCTATGTGG	1
ACACAAAATAATCATATTCAGTGT	1
ACACAAACCCTACCGCTATGAGCA	1
ACACAAACCGTGTATAAAAGGTCC	1
ACACAAACGAATGCAGCCTAGATT	1
ACACAAACTGTGCACTCAAGGTCC	1
ACACAAACTTATTAGGTGGGTGCA	1
ACACAAACTTGTAAGGTGGGTGCA	2
ACACAAACTTGTTAGCTGGGTGCG	1
ACACAAACTTGTTAGGTGGGTGCA	2
ACACAAACTTGTTAGGTGGGTGCAA	1
ACACAAATAGGTGTCGTCATTATA	1
ACACAAATGTGCTTGGTCTGATCC	1
ACACAAATTTACATGCAAGCC	1
ACACAAATTTCAAGAGAGGTGTGA	1
ACACAAATTTGTTAGGTAGGTGCA	2
ACACAACAGAGTGAAGAGCGGA	2
ACACAACCCTACAACTTTAAGGAC	1
ACACAACCTAGATAAGCTGGCTGC	2
ACACAACCTGTAGGTGTCGATTGT	1
ACACAACGACGGTGCACTAGGGAC	1
ACACAACGACTTGGGTTTAAAGCC	1
ACACAACGCAATCAGCTAGACCGG	6
ACACAACGGTATAAGTTTAGGGAC	1
ACACAACGGTGAGGATTTGGATGG	1
ACACAACGGTGTAACAGATCGTAA	1
ACACAACGGTGTAATCGGATTGTA	1
ACACAACGTGTGTATGATATGTGG	1
ACACAACTTTCAAGAAGGATGT	1
ACACAACTTTTCAGTCACATCATA	1
ACACAACTTTTCAGTCACATCATC	1
ACACAAGAACATCTGTTAGAGTGC	1
ACACAAGACCTATCCTTCACGTGT	1
ACACAAGATGATGGACTAGATGAC	2
ACACAAGATTGACTACATGGGCAT	1
ACACAAGATTGGCTACATGGGC	1
ACACAAGATTGGCTACATGGGCAT	1
ACACAAGCCATGTTGAGGTGTCA	1
ACACAAGGATGATAAGGTTTGGTC	1
ACACAAGGTCCTATGGCAGTATAC	1
ACACAAGGTGGTGGGCTATACGAC	1
ACACAAGTAGAGGCTGCAACTTTG	1
ACACAAGTATCTTGGAGTCCGTGC	1
ACACAAGTATTTATAACCCACAT	1
ACACAAGTGGGTCACTTAAAAGGC	1
ACACAATAAATTTTGTTTTGCCTA	1
ACACAATACCACAGGTTTAAGTGTG	1
ACACAATACCTCCATCGTATGCCA	1
ACACAATACTGCCGATGGACACC	1
ACACAATAGACTATACGGGTTGCC	1
ACACAATAGAGATAGGATCGTAGG	1
ACACAATAGGAGGTGTTTATGGTC	1
ACACAATATGTACGGCAAGGCTA	1
ACACAATCCACGGTGGTTTTGGTC	3
ACACAATCGATATGGCGCCGGCG	1
ACACAATGGTGTAATCGGATGGTA	10
ACACAATGGTTTAAGTCACACGAA	4
ACACAATGTATGTACAACAGGTTG	2
ACACAATGTGTTTATGACAAGTGG	1
ACACAATTATTGTTGAGGTTGCCA	2
ACACAATTGGTTGTTTTATGTTGC	1
ACACACAAACTATTCAATTTGCCA	1
ACACACAAAGCGGTGGAGAAAAG	1
ACACACAACTTTTCAGTCACATCA	1
ACACACAAGTCGTATGGTTTGCCT	1
ACACACAATACCATTAAACACAC	1
ACACACAATAGTGCTACATGGATG	1
ACACACAATGCTCGATCTGTA	1
ACACACACAAACTTCCAACCTTT	1
ACACACACAATGTGTCTCAGAGTC	1
ACACACACTCAGGTACGTTGCCTA	1
ACACACACTGTGAGGTCTTTCTAC	1
ACACACACTGTGTCTTGGAGTCCG	1
ACACACAGAACATCGGTGATCCAA	1
ACACACAGTACGTCTTAGAGTCCG	1
ACACACAGTGTGTCTTGGAGCC	1
ACACACAGTGTGTCTTGGAGTCCG	1
ACACACATAATGAAAATAAGTGAG	1
ACACACATTGCGTCTGGGAGTCCG	1
ACACACATTGTGTCTACAAATCTG	3
ACACACATTGTGTCTTGGAGTCTG	1
ACACACCAAACAAGAGAAGAGTGT	1
ACACACCACACTAATGAGGGCACA	1
ACACACCAGGCCCATCTACTATA	1
ACACACCATAAGTTGAAAAGTTGC	3
ACACACCATGCAGCCAGTACCATA	1
ACACACCCACACAAGTTTAGGTAC	1
ACACACCCATAGTGGATTTGTCTC	1
ACACACCCATGGTGGTTGGTTGA	1
ACACACCCGCGGGTTGAAAATTGC	1
ACACACCGCGATAATGGTATACT	1
ACACACCGGATCGCAACGATGGGA	1
ACACACCGGCCTACCAGAATGCAA	1
ACACACCGTTTAGTAGTTTGAAAA	1
ACACACCTGATTTGTGCCAAGATG	1
ACACACGAAATAGCCGCGTGATGTA	1
ACACACGCATGGTGGATGGTCTAC	2
ACACACGCTAGGATTGAGAATGGA	1
ACACACGGGTGCGATGTTTAT	1
ACACACGTGCACTTACCCATATGA	2
ACACACGTGCTAATGAGATACACA	2
ACACACGTTGCAAATAAGAGATGG	1
ACACACTAAAAATAAGTGCAGCCG	1
ACACACTAGATGGGTGGGTTGCTC	1
ACACACTATGACAAATTCTGGGAC	3
ACACACTCAAAAACTGGATCGCCA	1
ACACACTCGTCAGGATGGGATTAC	3
ACACACTGCGCTTTGGAGTTTGT	2
ACACACTGCGTCTTGGAGTCTG	1
ACACACTGTGTCGGAGTCCGTGCTA	1
ACACACTGTGTCTTAGAGTCCGTG	1
ACACACTGTGTCTTGAAGTTCGTG	1
ACACACTTCTATATTTCAGGGAAG	1
ACACACTTGGGGCCGGATCACTCC	2
ACACACTTTGCAAGTTCATGGACC	1
ACACAGAAAGATTGTGGCCTTTGC	1
ACACAGACGGTACAACAAATTGAC	1
ACACAGAGAAAGGGTGTCGGAGGCC	1
ACACAGAGAATAGATGAATTCGGC	1
ACACAGAGTACGGTGATAGTGCAA	1
ACACAGATCCACCAAAACACAGG	1
ACACAGCCATGACATATCTAGACC	1
ACACAGCCGAAAGCTATATGGCGA	1
ACACAGCCTAGAACTCACCGCGA	1
ACACAGCGAGTACCTGCGTGGTTC	1
ACACAGCTGATGTGGTAAGGGTC	1
ACACAGCTGATGTGGTAAGGGTCC	2
ACACAGCTTGCGATTGAGGAGTGG	1
ACACAGGAAAACACAAGAATGGT	1
ACACAGGAAAGATGAAGAGGGTCC	1
ACACAGGAATAACCGTTTGATTGA	1
ACACAGGAATAACTGTTTGATTGG	1
ACACAGGAATGAACGTTTGATTAA	1
ACACAGGAATGACCGTTTGATTGA	4
ACACAGGAATGATACGGTTTGGTC	2
ACACAGGAATGGTCGTTTGATGG	1
ACACAGGAATGGTCGTTTGATTGG	3
ACACAGGAATTTGATGAGAGATA	2
ACACAGGACAATGAGGTGGGAGGA	1
ACACAGGACACACATGTCAGCTGC	1
ACACAGGAGCTGTGTTGGGCGGAC	1
ACACAGGAGTTGTCGTTTGATTGG	1
ACACAGGCACATGATATGATGGTA	1
ACACAGGCACTAGAGATTGTGGGT	1
ACACAGGCCTTCACGTGTACACAA	1
ACACAGGTAAGGCTTCACCCGCCA	1
ACACAGGTCCTCACGTGTACACAG	2
ACACAGGTGATCTTTGTAATAAGA	1
ACACAGGTGATGGTGGGGAAGAGG	2
ACACAGGTGGAATCGTCCTAACCC	1
ACACAGGTGGTGCATGGCTGTCGT	2
ACACAGGTGGTGTGATGACGTGTA	1
ACACAGTAGAAAATCGTCCTCCCA	1
ACACAGTAGTGTAAAGGGTCTAAG	1
ACACAGTGCAACGACGGCGTGGGC	1
ACACAGTGCACATGACACAACAGT	1
ACACAGTGTATGTATAACAGGTGG	1
ACACAGTGTCTTGAAGTCCGTGTA	1
ACACAGTGTGCTTAGGGAAGTCCAA	1
ACACAGTGTGTACACGCGAGGGCC	1
ACACAGTGTGTATACGCAAGGGCC	1
ACACAGTGTGTATGACAGATGG	1
ACACAGTGTGTATGACAGGTGGG	1
ACACAGTGTGTATGACAGGTGGGA	1
ACACAGTGTGTCCATCCAACGTGT	2
ACACAGTGTGTGAACGCTTGATGG	1
ACACAGTGTGTGAAGGCCTGATGG	1
ACACAGTGTGTGTATGACAGATGG	2
ACACAGTGTGTGTATGACTGATGA	1
ACACAGTGTGTGTATGATAAGTG	2
ACACAGTGTGTGTATGATAAGTGG	1
ACACAGTGTGTGTATGATAGATGG	1
ACACAGTGTGTGTATGATATGTGG	2
ACACAGTGTTACTGTATAGTGGTC	1
ACACAGTTCATTAGCTTCAGTTGC	1
ACACAGTTGTCACTACTGGAGT	1
ACACAGTTTAGCTGTTCGGGATGT	1
ACACATAAGGGTCCACATGTCATA	1
ACACATAAGGGTCTACATGTTATA	1
ACACATAATCCTAGATATTATGGT	1
ACACATACAGAAGATTGCCTGAAG	1
ACACATACAGTAGCTGCCACTGAC	1
ACACATACATAGCCGAATCACAAC	1
ACACATACCGTGCACAAGGTCCTA	1
ACACATACCTAGAGAGATGAAGGC	1
ACACATACTAGTACTACGAATCTG	4
ACACATAGAATTAGGTGATGAGGT	4
ACACATAGAGGTGGATGGGTGGAA	1
ACACATAGGGGCTGTTTGGTTGAT	1
ACACATATAAGAGAAAAGGTTGCA	1
ACACATATAGCCTGATGCATGGA	1
ACACATATATGAAAGGATTTGT	1
ACACATATATGGGTATCGTCGACA	1
ACACATATCGTGCTGGTGTAAGGC	1
ACACATATGGACTCACATGTTATA	1
ACACATATGGTGAAAATCGGTGA	1
ACACATATGGTGGGAGACGGTA	1
ACACATATGGTGGGAGACGGTAAA	1
ACACATCAAAGGTGTAGTTGGTGG	1
ACACATCACAGACTCACAGGGCCT	1
ACACATCACAGGTGAATACCTCATC	1
ACACATCACAGTGCTACGAATCTG	1
ACACATCCGAGATCGCCCAAAAAC	1
ACACATCCTACTACGTCTGTCCAG	1
ACACATCCTACTACTTATACACGA	1
ACACATCCTAGGACAGAGATATGT	1
ACACATCCTATGACAATGAATTTG	1
ACACATCCTGGTACTACGAATCTG	3
ACACATCGGCTCGGCTCCGAAGGG	1
ACACATCGGGCCTATACGTGAGTG	1
ACACATCGGTGAGAACAGAGGCCC	1
ACACATCGTGGGATCAAGGGTTGA	1
ACACATCTACATGTATCCAGCCCG	1
ACACATCTGGTCGCCGCCTTCGAG	1
ACACATGAAAGAGAGAAGGAAAGC	1
ACACATGAATGTTTGATTGGACCA	1
ACACATGACACTGTAGACGGTCCA	1
ACACATGACCCTGTGCTTCATGAG	1
ACACATGAGGGCCCACATGTCAGA	1
ACACATGATACGGATAGAGAGGTC	1
ACACATGATCGTGCACAAACACAG	1
ACACATGATGATGATATGGATGGC	1
ACACATGATGGCCTAGACTCGCGA	1
ACACATGATTGGCTACATGGGCA	1
ACACATGATTGGCTACATGGGCAT	2
ACACATGATTTTTGGTTAACTA	1
ACACATGCAGGCCATATAGACATG	1
ACACATGCGCACAAGCAGGGCCG	1
ACACATGCTTACATTTTAGGACGG	1
ACACATGCTTCAAGTGACTAGGAG	1
ACACATGGAACAAACAAAGAAATC	1
ACACATGGAGTTGGTCGCCGTTAC	1
ACACATGGCAGGTGTTTACGGGGA	1
ACACATGGTACTTGAATAATTGAA	1
ACACATGGTATGTGGTGGGTCCTA	1
ACACATGTCAATGACAAAGGTACC	1
ACACATGTGCTCTCTGCAAGTCAG	2
ACACATGTGTCTATGACATGTAGG	2
ACACATTAAATTTGGTACTTTTGC	1
ACACATTACGTCTTGTCGTCTTGG	1
ACACATTATGCTGCCTGCGTACAA	1
ACACATTCAAAAACTGGATCGCCA	2
ACACATTCATCCTTTTTATGTCCA	1
ACACATTGATATTGCGGAGAAGAC	2
ACACATTGATTGGTTGATGGATTC	1
ACACATTGCGTCTTGAAGTCCATG	1
ACACATTGGCAATGGTGGTCTA	1
ACACATTGTAATGCTACGAATCTA	1
ACACATTGTATTGAGCCTCAGGG	1
ACACATTGTGCGTATGATAGATGG	4
ACACATTGTGCTGCCTGCATACAA	2
ACACATTGTGGATGCCCTAAGAAC	1
ACACATTGTGTCTACAAATCTGTA	2
ACACATTGTGTCTTATAGTCCGTA	1
ACACATTTGGTGGCCAATGGT	1
ACACATTTGTCAGCGTCATGGTCC	1
ACACATTTGTTTTTTGGGTTC	1
ACACATTTTCTGCTGATATGAGTG	1
ACACATTTTGTCAGTTACCTT	1
ACACCAAAACAAAATTAGGATGAC	1
ACACCAAACTGTATTCTCCCTTC	2
ACACCAAAGGTCCCTCAACTTGTC	1
ACACCAAATAAGAAATTAGGGCAC	3
ACACCAAATAAGTGTCACATTAAC	1
ACACCAACCAGAACTAAAGATGCC	2
ACACCAACCCTGCAGAACATTGAA	3
ACACCAACCGGGAAAAAAAGATGC	1
ACACCAACCGGGACTAAAGATGGA	2
ACACCAACCGGGACTAAAGATGGC	2
ACACCAACGCCACCAGGTACATGC	4
ACACCAACTTGGTGGGCCTTAGGA	1
ACACCAAGAGGACCTACCAAGCAA	1
ACACCAAGCTTGACTGAGGGGGT	1
ACACCAAGCTTGCTTTACCGGTGG	1
ACACCAATCGAGACCAAAGATGGA	2
ACACCAATGGAGGCCCAAGGATA	1
ACACCAATTAGGACTAAAGATCGT	1
ACACCACAAACATTGAGGATGCCC	1
ACACCACAAACATTGAGGATGCCT	1
ACACCACACGCGTGTCCACACACA	1
ACACCACCTGACAAATGATGTCCC	1
ACACCACCTTACAATGATGAATGC	1
ACACCACCTTCAGCTTAGGCCCTA	2
ACACCACGTTCACTGTAGAGGCTA	1
ACACCACTACATATGCAGACCGCA	1
ACACCACTGTCTAAGATGTTGCCA	1
ACACCACTTTTAAAACGGATGGAA	1
ACACCAGAAAACTGCGAGACGAAT	1
ACACCAGACCTTAGGTGGTGGTAC	2
ACACCAGTAAAGTGTCTACTCAGC	1
ACACCAGTAGTGGGGCCTCGAGAC	4
ACACCATAAGTTGAAAAGTTGCCC	1
ACACCATATCTACACCACCTCTA	1
ACACCATGAACAGCCGCAAGTGAC	1
ACACCATGGAGCGCAGGACCAGGA	1
ACACCATGTTAGTAGGGTTGGGAGT	1
ACACCATTTAGCGGTTTAGGAAGT	1
ACACCATTTAGTAGTTTGGGAAGC	2
ACACCCACAGAAAATGGGCCGCCA	2
ACACCCACATTGGATCTGCCCCTA	1
ACACCCATACTACTACAGATGAAT	1
ACACCCATCTTGAAATTTGTGTGG	1
ACACCCATGAGTGGGTTTGGGTCC	1
ACACCCATGGTGACTTTATTAATC	1
ACACCCCATGTATTCATTTAT	1
ACACCCCTATTAAATGAGAGATGG	1
ACACCCGATGTGACACGCCAAAAC	1
ACACCCGATGTGACATGGGCTAAA	1
ACACCCGATTTAAATGAGTGAAAC	1
ACACCCGGGGTCTATGTAATCTA	1
ACACCCGTGAGGGATTGGGGCAGC	2
ACACCCTAAGTGTCCTATAGCAAA	1
ACACCCTATATAATACCTGATGTG	1
ACACCCTATATAATATCTGATGTG	3
ACACCCTGGGTGCGTTATAACTAA	1
ACACCCTGGTTTGATAGATGGTAT	1
ACACCGAACTTGCCTACACACAAC	1
ACACCGACAGCACCTACACACAAC	2
ACACCGAGAGTGCTAGCTATATGG	1
ACACCGAGAGTGCTAGCTGGATA	1
ACACCGAGGGTACCTGCAATATTC	1
ACACCGAGTGCCTAGGTGATACCTC	1
ACACCGATGATGAAGCAAGTGTCC	1
ACACCGATGGAAGCTGTGGTGTGA	1
ACACCGATGGAAGGTGCGGTGCGA	1
ACACCGCGTACCGTCTAGATGGGA	1
ACACCGCTCCTACAATGGGTCGTG	2
ACACCGCTGAGCCCCAACTAAAA	1
ACACCGGAAAATGGAGTGCAGCCT	1
ACACCGGAATTGTAAGGTACGTGC	2
ACACCGGATCTACGGTTGGAGCAC	1
ACACCGGCCTGGGAGATCTGCTTA	1
ACACCGGGGATCGATGATGCG	1
ACACCGGGTTGATTGCGTGAACTA	1
ACACCGGTAAGACGTATGCTGTGC	1
ACACCGGTTTCTACCCTCCGTTGCC	1
ACACCGTAACTGGGCCACGTGGAC	1
ACACCGTAGCGTTGTGCAGTTGCG	1
ACACCGTATTTAACAATTCAGGGA	1
ACACCGTGCACATACCTTCAAGGA	1
ACACCGTGTCTATAACGTGTGGGC	1
ACACCGTGTGATATTTTGATACTT	1
ACACCGTTGAGTAGTTTGGGAAGC	1
ACACCGTTTAACAATTTGAGTAGC	1
ACACCGTTTAACATTTTGGGAAGC	1
ACACCGTTTAATAGTTTGGGAAGC	2
ACACCGTTTGGTAGTTTGGGAAGC	4
ACACCTAACGGAGATGTTGCCATA	2
ACACCTAAGACTAGACGAGACACC	1
ACACCTAAGATGAAAGATGATGTA	1
ACACCTAAGTACTATGAGGTACAA	1
ACACCTAATAGGACTCCTACTAGG	1
ACACCTACAAAAATGGGATGGACC	1
ACACCTACAATCACTTAAAGATG	3
ACACCTACACGACATATTACTGGG	1
ACACCTACCTCCACTACTCATCCA	1
ACACCTACTAGAGTTTAAATACTG	1
ACACCTAGGTAGTGTTTGGTTGCA	2
ACACCTAGGTGTTATGTACTCCCC	1
ACACCTATAAATATGTATCCTATC	1
ACACCTATATAATAATCGATGTGA	3
ACACCTATCCACGGATTGATTGAT	3
ACACCTATGGGTATAAATACAAGG	3
ACACCTGAGGGACCGTGGTGAAAC	1
ACACCTGATTTGTGCCAAGATGTA	1
ACACCTGTACAGGCAGGACGGGTTA	1
ACACCTTTAAACGAAGATAGGTGT	1
ACACCTTTAAGGACCCACATGTCA	2
ACACCTTTGTAGTTGTGCCCAAAA	1
ACACCTTTTTTCAGTACAGAGTGT	1
ACACGAAAACTAAATAAGGGATGG	1
ACACGAAAACTTATGGTGCTGCGC	1
ACACGAAAAGATGAGGCCCTAAAA	1
ACACGAAAATGGAAGCCTATTCAT	2
ACACGAAACGAAGTGTCCGGTAGC	1
ACACGAAAGTGTCGCCGATAAAGA	2
ACACGAAATAATCCAAAAGGGTCC	1
ACACGAAATGCTAACACCGAA	1
ACACGAAATTATGTGGTGGGTGTA	1
ACACGAAATTGTGTATGGTTGC	1
ACACGAACCAACTACGCGCAGTGG	2
ACACGAACCCTAAGACGTTGGCAC	2
ACACGAACGCTACGTGCCAAGTGT	1
ACACGAACTTATCAGGTGGGTGCA	3
ACACGAACTTGTCAGGTAGGTGCA	1
ACACGAACTTGTCAGGTGGGTGCA	3
ACACGAACTTGTTAGGTGGGTGCA	5
ACACGAACTTTGTAAGGTGGGTGT	1
ACACGAAGACAGCGTTGGCGAGCTC	1
ACACGAAGATTGAACCTTGATCGG	1
ACACGAAGCAGTCCAAGAGGGTCC	1
ACACGAAGCCGCCACACCTCAGTC	1
ACACGAAGCGAGGACGAAAGTGCA	1
ACACGAAGGTGTGATAGATTTGCT	2
ACACGAAGTGAGGACGAATGTGTA	1
ACACGAATCTGGACACTCCGTCCA	1
ACACGAATGCCGTACCAAAATACC	1
ACACGAATGCTGGTGGCATATTTCA	1
ACACGAATGGGTAGCGGTAACCGC	2
ACACGACACCGTGAATGGTCTTAT	1
ACACGACCGACAAGACATGGTCCC	1
ACACGACGCCTTCGTTTGCTTCGG	2
ACACGACGGTGCTGGACGGGTTAG	1
ACACGACGTGGTGAACCGATAGCC	1
ACACGACTTGACGAGCCACGAGAG	2
ACACGAGAAAATTGATGATGAGAT	1
ACACGAGAACCTACGCACTAGACA	3
ACACGAGAACCTATGCACTAGACA	1
ACACGAGAACCTATGCACTAGATAC	1
ACACGAGAACCTATGTACTAGACA	1
ACACGAGATAAAAGTCAGTGGCCT	1
ACACGAGCAAGAAATAAGGGATGC	1
ACACGAGCACATACGGGACTCACA	1
ACACGAGGATGATAAGGTTTGGTC	1
ACACGAGGGTGCGATGTTTTCTAC	1
ACACGAGGTACACCACAACAAACT	1
ACACGAGGTAGGCAGCCTAAAGCC	3
ACACGAGTGAGGACAAAGTGTGCA	1
ACACGAGTGAGGACAAAGTGTGCAC	2
ACACGAGTGGTCTACGATGATGAC	1
ACACGATACGAGGTTCGTCGCCGCC	1
ACACGATAGACTAGACTCACGAGCC	2
ACACGATAGCCACGTGAATGTGCG	1
ACACGATATGGTAAAGACCCAGTA	1
ACACGATATGGTGGGGTTCCGATT	1
ACACGATATTGGTTACATGGGCA	1
ACACGATATTTGTTAATGAGGTTC	1
ACACGATCAATTGATGAACACCTC	1
ACACGATCGATTTTCCTGAACGCC	1
ACACGATCGGTTGCTGCAACAAGT	1
ACACGATCTTCGGGTGTCTCACA	2
ACACGATGACCACTATACAGTAAC	3
ACACGATGATAAGTATACATTGAC	1
ACACGATGATAATGGTGGACACCC	2
ACACGATGCAGAGGCAAGGTGATC	1
ACACGATGCAGCGCACATAATGAT	1
ACACGATGTGTGTATGATAGGTAA	1
ACACGATTAACGAGGATTGGTGTA	2
ACACGATTAAGATGGTGTTTAGA	1
ACACGATTACGAATATATGGATGA	2
ACACGATTCCACACATGTCGCCAT	1
ACACGATTGACACACAAGTTCAGG	1
ACACGATTGACACGGGGGCCTTGG	1
ACACGCAAACCTAAGGTTCGCCTT	1
ACACGCAAGGGCCTGTGTGCATAG	1
ACACGCAATGTGTTTGAGATGTAG	2
ACACGCACAAATCGAGAAATGGTC	3
ACACGCACAACAAGCTGTAGGATG	2
ACACGCACACGGTAAACAAGTAGC	3
ACACGCAGATGGCTATAGGTTGG	1
ACACGCAGATGTGCTAGCACCCGC	2
ACACGCAGGAGTAGGGTGTTACGC	1
ACACGCAGGGAGATGATGGCGGCG	3
ACACGCATGGAGCATTAAATTTG	1
ACACGCATGTGCATTCAATGGGAC	4
ACACGCATTATAAAGGTGAGAAGA	4
ACACGCATTTCCGATGTTGGACGG	1
ACACGCCAAAACTTTACACCCATA	4
ACACGCCACAAAAGGTATGGTAGG	3
ACACGCCACGTGTGTGCACTGTGA	1
ACACGCCATGATGGGCCACATCAC	1
ACACGCCCCGAACCATGTGCCAAC	1
ACACGCCGACTATTTTTAGGTGAA	1
ACACGCCTAAGGTTTGGTGTGG	1
ACACGCCTCAAGAGATGTGTGCAA	2
ACACGCCTCGAACATTTGCAC	1
ACACGCCTGAGTGAGATTGGGAAA	1
ACACGCCTGGCCGCTAAGTAGTGA	1
ACACGCCTTGCGGTGATATGGAGT	1
ACACGCGAAAAACAAGAGAAGTGA	1
ACACGCGAGGGCCTGTGTGCATAG	3
ACACGCGATGGTGGTGGTCGACTG	1
ACACGCGCAACGACGATCGGCGAC	1
ACACGCTAGGATTGAGATTGGAAC	5
ACACGCTAGGTGTGGTGATGTTGG	1
ACACGCTCGGACAATCGGCGGCGC	1
ACACGCTCTGGTCTTACTGATACC	1
ACACGGAAACTTATGGCTACACGG	1
ACACGGAATTGATGGTGAGATTAA	1
ACACGGACAGCTTATCCGACCAGC	1
ACACGGACGACGATGATGATGATG	2
ACACGGACGCATATCCGCGGTGGC	1
ACACGGACTCCAAGACGCAATGTA	1
ACACGGAGATCGAGGCTTGTGCGT	1
ACACGGAGCCAGATCTATCAAGCC	1
ACACGGATACCTACAAGGCTACAA	1
ACACGGATAGTGCCGAATAAGGAT	1
ACACGGATGTGCAGCGCTGTAATC	2
ACACGGATTGGAGATGGATGAAGT	2
ACACGGCAGCCTACACATGTTATC	1
ACACGGCCTAATTAATATCAAAGA	1
ACACGGCGAGCACGAGAACGGTGG	1
ACACGGCGGATGGACATAGTGTGG	1
ACACGGCTGATGGACACTACAAAA	1
ACACGGCTGATTGGATGAAGC	1
ACACGGGAACCTAACCGATGGAGG	1
ACACGGGTCAATAAAAATTGGGCT	1
ACACGGGTGCATGCCGCTTTGGTA	1
ACACGGGTGCTAATATTTATGG	1
ACACGGGTTGTTCTGATCTGA	2
ACACGGTACTCGTATTTATGGTTA	1
ACACGGTGCTCGTATTTATGGCTA	2
ACACGGTGGCCGACGTGCTGGTGT	1
ACACGGTGGCTGCGTGTTGAAGAG	1
ACACGGTGGTGATAAATTTTACAG	1
ACACGGTGTATACACGTGAGGGCC	1
ACACGGTGTCTAGCTTCAAGCCTA	1
ACACGGTGTCTTGGAGTCCGTGCTA	1
ACACGGTGTGTACACGCGAGGGCC	3
ACACGGTGTGTACACGCGAGGGTC	1
ACACGGTTCTGGTTGACGGGTTGT	3
ACACGTAAAACGATGGAGATGGGT	1
ACACGTAAACTTATGGCCGTGC	1
ACACGTAAGGACCACACAACAGAC	1
ACACGTACGCCACAAACAATATGA	1
ACACGTAGATGATAAGGTTTGGT	1
ACACGTAGGTGCGACGTTATATAA	1
ACACGTATATCAAGAAAAGACAAC	1
ACACGTATATGTACAGGTTCGT	1
ACACGTATCGTGCTGGTGCAAGGC	2
ACACGTCAAAACTTTACACCC	1
ACACGTCAAGTGCAAGCGTGCAAC	2
ACACGTCAGTGCTTGTAATGGTAG	6
ACACGTCAGTGTCTACTACTGCAT	1
ACACGTCATGGTGCAGTTCGAGGA	3
ACACGTCGCTAGTTCGTAGGGTGT	1
ACACGTCGGCCTAGGAGATCTGCT	1
ACACGTCGTGCTGTGTCGTGCCTG	1
ACACGTCTACGATTTGCCACTAAC	1
ACACGTGAATGATAGGTCTTGGGT	1
ACACGTGAGGGCCTATGTGTATAG	1
ACACGTGAGGGCCTGTGTACATCG	1
ACACGTGAGGGCCTGTGTGCACTA	2
ACACGTGAGGGCCTGTGTGCATA	1
ACACGTGAGGGCCTGTGTGCATAG	4
ACACGTGAGGGCCTGTGTGCATAGG	1
ACACGTGATGTGTGTGGTAATGTC	1
ACACGTGATGTGTGTGGTAATGTCT	1
ACACGTGCATGCTTTTTTTCAATG	1
ACACGTGCCTGTGAAACCGCGAGA	1
ACACGTGCGAAAGGCAAAGGTGCA	1
ACACGTGGAAAACGAGGGTGACAA	1
ACACGTGGCAGGTGGAGGCATGAC	1
ACACGTGGCAGTGTTGACTTGGTC	1
ACACGTGGCAGTGTTGTCTTGGTC	2
ACACGTGGGTAGGCTTACATGTGT	1
ACACGTGGGTGCATAGATCCTCGG	3
ACACGTGGGTGCGATGTAATATA	1
ACACGTGGGTGCGATGTAATATAC	4
ACACGTGGGTGCGATGTTTTTGA	1
ACACGTGGTGCATGGTGGGCTGGC	1
ACACGTGGTGGACAAGAATGAC	1
ACACGTGGTGGATAAGAATGACC	1
ACACGTGGTGTTGTGTGTATGGAA	1
ACACGTGTAACATAGGAATGGTC	1
ACACGTGTAGATGGGAAGTGACGA	1
ACACGTGTATGCGCGTTATGGTAC	1
ACACGTGTCGTATGGGAGTGGGAG	3
ACACGTGTCGTTGATATGGCGTTT	1
ACACGTGTGCGCGTTCAGTGGGAC	1
ACACGTGTGTATATGAGCGTCTGC	1
ACACGTGTGTATGATAAGTGGGAC	1
ACACGTGTGTGCCATGTGTAGTGC	1
ACACGTGTTAGATGAACTTATCTC	2
ACACGTTCTTTGGGTGACTCATAG	1
ACACGTTTTTTCGATGCACTGTAG	1
ACACTAAACACACACGATGGCGAC	1
ACACTAACCGGGACTAAAGATGCA	1
ACACTAAGATGGTGTTTGGATGGG	1
ACACTAAGGACAAAACGCTGCGTA	1
ACACTAATGAAGTGGGGTCCAC	1
ACACTACATGAGAAACGATGAGAG	2
ACACTACATTGGATCCTAGGATGC	1
ACACTACCCTGAGTGTGCACAAAC	1
ACACTACGAGGTGTAAAGATGGCC	1
ACACTACGATTGAATTTGGTGGAC	1
ACACTAGAAAGTATGTGGAGGTAC	1
ACACTAGAATGTGATGCATGC	1
ACACTAGACCGGCAGACCGCCACA	2
ACACTAGATAGGTGCGGGCACAAA	1
ACACTAGATGGATGAACACAAAGC	1
ACACTAGGGTGGAAAAATGGCAAC	3
ACACTAGGTGTTGTTAATGTTGCA	3
ACACTAGTGGTGTGATGGACTG	1
ACACTATACAGATGGGGTGCGTTG	1
ACACTATAGAAGGTATGGGGCGAA	1
ACACTATAGGTGCCGAAACAGTTA	1
ACACTATAGGTGCCGGTTTTACCA	1
ACACTATCGGTACACTCACAAATG	1
ACACTATGCTAGATAACGGGAGGC	1
ACACTATGTATATATGAGAGGTGG	2
ACACTATGTCGGGCGACAAACACT	1
ACACTATTAGAGTCCGTGGTGCAG	1
ACACTATTATTATGGGGCTGTAC	1
ACACTATTTAGTAGTTCGGGAAGC	1
ACACTATTTTTCGTGCTAAGGTGG	1
ACACTCAAAAATTGAATAGGGGCT	1
ACACTCACCCATGTGAATGCACAC	1
ACACTCACCTGCTAAGTTGATGCA	1
ACACTCACCTGCTAAGTTGATGTA	2
ACACTCAGGGAGGAGTTGAGGTCC	3
ACACTCAGTTGAAGATGGTATTCC	1
ACACTCATACCCCTACAAATGCAT	1
ACACTCATGGCAGTCCTACCAATG	1
ACACTCATTCGTGAGAGAAGGTTC	1
ACACTCGAGAAGTATGGTATTTGC	1
ACACTCGATACCCTGCAACTGTAA	1
ACACTCGTCTCTATAAACACGGGC	1
ACACTCTAGTGCAATGAATTTGGA	1
ACACTCTGAATCAGTGGTGAATGA	1
ACACTCTGTACAAGTGTTGTGTAA	1
ACACTCTTTGGGTGGTTTTGGACAA	1
ACACTGAAAGATTGCGGCCTTTGC	1
ACACTGAAGTGCGGATGGCGTGAG	1
ACACTGACATATGGGCCTAGGAC	1
ACACTGACCCAAGAGAAGGCTAGC	1
ACACTGACCTCGGATATGGATGAA	1
ACACTGATGACTATGATTGGCTAA	2
ACACTGATGATCTGTGCCGGTTTG	1
ACACTGCATGATGGAAGCCTAAAA	2
ACACTGCCACGTGTGCGCCACGTCA	1
ACACTGCCGGAGGACTGCCTTATC	1
ACACTGCCTGCGCGGACTCTGTGC	1
ACACTGCGGAGTGCATTCGGTCAG	1
ACACTGCGTTGCCACGTTGGCATA	3
ACACTGCTATGTGCCTCACTAAGA	1
ACACTGCTTATGGATATTATGGA	1
ACACTGCTTTAACAGATGTGCTTAC	1
ACACTGGAATGACTTACATTGTGA	1
ACACTGGAGCAGTTGGTGTCGAAA	1
ACACTGGCCTACACCAAAAGTCTC	1
ACACTGGCCTAGGAGATTTGCTTA	1
ACACTGGCCTGGAAGATCTGCTTA	1
ACACTGGGCCTCCAAAAATTAGGG	1
ACACTGGGGCTATATTCAGGGTCC	1
ACACTGGGTTTGCGAGAACAA	1
ACACTGGTACACAATGGAATGGTC	3
ACACTGGTCCTGCAAAAATTAGG	1
ACACTGGTGGAGAAACTATCTTTC	1
ACACTGGTGGAGAAATAATCTTTG	1
ACACTGGTGGAGAAATGCTTTTTA	1
ACACTGGTGGATAAAGCGTTTGTA	1
ACACTGGTGGTTGGTGGCTCCTCC	1
ACACTGGTGTCGCTGATAAAAGCC	1
ACACTGGTTGTTTAAGTCACTGAG	1
ACACTGTACAAACATAGGCGCCTG	1
ACACTGTAGTTGTAACTAGGGTGT	1
ACACTGTCGAACAAAGTTGGTCCA	2
ACACTGTCGGTGCCGGTTGAATAG	2
ACACTGTGAAGGGCCTAAAGAGAG	1
ACACTGTGACGGTCTGTAAGCCCC	2
ACACTGTGGCGGCACTGCCTATGG	1
ACACTGTGGTGCAATTGTAAGTAC	1
ACACTGTGTATGACAGGTGGGACC	2
ACACTGTGTCTTACGTGTAGTAAC	1
ACACTGTGTCTTGAAGTCCGTGCT	1
ACACTGTGTCTTGGAGTCCGTACA	3
ACACTGTGTCTTGGAGTCCGTGCTA	1
ACACTGTGTGGGTGGATTGTTGTC	1
ACACTGTGTGTACGATAGGTGAGA	1
ACACTGTGTGTATGACACGTGGGA	1
ACACTGTGTGTATGATAAATGGGA	1
ACACTGTGTGTATGATAGGTGGGA	2
ACACTGTGTTTGGCAAATGGGATA	1
ACACTGTTGACCTTTTAACATATG	1
ACACTGTTGATAGAGGTGAGTGTG	1
ACACTGTTTAGCAGTTTGAAAAGC	1
ACACTTAAAAGTGTGACCGAGGGAG	1
ACACTTAAACTGCAAGCATGGAAC	1
ACACTTACATTTCTATCAAAATCC	1
ACACTTACGTGAGAGATGGTCTA	1
ACACTTACGTGAGAGATGGTCTAG	1
ACACTTACTTAGCTGCCACGTCA	1
ACACTTAGAGCCAAATGACCGCCT	1
ACACTTAGGATGAACTTGCGAC	1
ACACTTATAGGTGCCGAGTATGAT	1
ACACTTATCTGTGACGGGCCATAG	1
ACACTTATGTGGTGTTGATATGGC	2
ACACTTCACAAGCCTATTTTCACA	1
ACACTTCCCGGTCGGTCACCCATC	1
ACACTTCGGTGCAGACGGGCGTTA	1
ACACTTCTACAACATACTGTC	2
ACACTTCTTAGGTGTTGGGTCTA	2
ACACTTGAGGATTTTAGGTATGGA	1
ACACTTGCCTATAGGTATGTACGG	1
ACACTTGCGAGCCAAAAGATGGGT	1
ACACTTGGTGTGCGTCTCCTTGGA	1
ACACTTGGTGTGGAGAATATGAAG	1
ACACTTGTCTATCTCCACATTGGA	1
ACACTTGTGTACACGTGAAGGCC	1
ACACTTGTGTACACGTGAAGGCCT	1
ACACTTGTTGATAGCATTTCTGGG	1
ACACTTTGCCACGCCACACTTTAG	1
ACACTTTGGGCCACATTTTATTAC	1
ACACTTTGTCATGTGCTTCACACGA	2
ACACTTTGTCTAAGGTGAGGTGA	1
ACACTTTTACAAGTTCTGGGACCT	1
ACACTTTTCTGCGTCAGGAGGAGCC	2
ACACTTTTGCTTACTCATAGGTGG	1
ACACTTTTGTAATTGTGCCCACAG	2
ACAGAAAAAATCAAGGGTGTTGGC	1
ACAGAAAAAGTAGGATGAGCATGC	1
ACAGAAAAATAGAGGCCTGGTGTC	1
ACAGAAAAATAGATAGAGGTCGAC	1
ACAGAAAAATTAAATGGTGGAGGA	2
ACAGAAAACCACAAATATTGACAC	1
ACAGAAAACCACACGCACTTTGAC	1
ACAGAAAAGGACCGAATGCCATGG	1
ACAGAAAAGTAATGCGGTGCGGAA	1
ACAGAAAATGAAAGGTACCAGGGA	1
ACAGAAAATGGAGCAGCGATTAGC	1
ACAGAAACGCGAGGTCGATGTTGG	1
ACAGAAAGGAAAATAAAATGGTAC	1
ACAGAAAGGATGATTCGATGGAAC	1
ACAGAAATAGTGCGATTTTCGAA	1
ACAGAAATAGTGCGATTTTCGAAA	1
ACAGAAATGGTTGCCACACTAGGA	1
ACAGAAATTGTGCGACGGCAAGGT	1
ACAGAACAAGCATTGAGGTGTAAA	2
ACAGAACACGCCAAGACTGATGCA	2
ACAGAACAGTGGATTGGGGGGGAA	1
ACAGAACCCAAGATGCAAAGGCCT	1
ACAGAACGCCCCGAGTAATCGA	1
ACAGAACGGGTGGTGTGATTGAC	1
ACAGAAGACCTATTTTACGTGCTA	2
ACAGAAGACTCATTTTGCGTGCTA	1
ACAGAAGATGCCATTTATATGAA	2
ACAGAAGATGCCATTTATATGAAA	1
ACAGAAGCGATGACATATGGTGTA	1
ACAGAAGGGATTAGGTGAACTTTC	1
ACAGAAGGTGTAAAAACATGACGG	1
ACAGAAGGTGTCGTATAAGAAAT	1
ACAGAATATAATCATTTTTAGTGC	1
ACAGAATATCAGCTGTCCAACAAC	1
ACAGAATATGAAGGTTGCATGACA	3
ACAGAATCTGCCTATAAACTGCGA	1
ACAGAATGAACTAGAGAGGTGG	1
ACAGAATGAACTAGAGAGGTGGA	1
ACAGAATGAGACCTACAACTTCCA	1
ACAGAATGGGTTAGCTGAACGGAA	1
ACAGAATGTGAGAATCTGGTTGAC	1
ACAGAATGTGATACGATGAGAT	1
ACAGAATGTTCATACGTGCGC	1
ACAGACAAGGCCTTATGGAATGCC	1
ACAGACACAGGTGGTAGTAGTC	1
ACAGACATAGCCCTCGAGTGGAAA	1
ACAGACCATGCTACTGAAGGGCAA	1
ACAGACCATGGTAGATTAGCGCAT	1
ACAGACCCCAAGACGCAGTGTGT	1
ACAGACCCGGGTTCGTTTCCCGGCTGGTGCA	1
ACAGACCCTAAAACAGTATGATGA	1
ACAGACCCTAAATCCCTCAGGTAC	1
ACAGACCCTAAGTTGATGTGGCT	1
ACAGACCCTTACAAACCAACGTCG	1
ACAGACCCTTTCGTTTCGGGCACT	1
ACAGACCGCCAGCGAAGATGAAGCC	1
ACAGACCGCGACGGAAGATGGCCA	1
ACAGACCGGTTGAGTGCACTGCAC	2
ACAGACCGTGGACGGTGATGGTAA	1
ACAGACCTAAGTGACACCACCACA	1
ACAGACGCACATACACCACTACAG	2
ACAGACGCCGAATACGCGACTCGC	1
ACAGACGCCTGGTCTACCTGTAGG	1
ACAGACGGGGCAATGTGGGAGACA	1
ACAGACGGTTAATGGGTTCTC	1
ACAGACGTGTTTATGATTAAAGTA	1
ACAGACGTTGGATGTCCATGG	1
ACAGACTAGCCAAATGCCTCTCCA	2
ACAGACTCGCAACAAAGGGATGGC	1
ACAGACTCGCGTTGTGTTGTGCAC	1
ACAGACTCGGACTTGGACCCTACC	1
ACAGACTGTGAGAATTGCCTTGGA	1
ACAGACTGTGAGAATTGCCTTGGAC	1
ACAGACTTAGGTGCGGGCCTGACC	1
ACAGAGAAGGCAAAGAGAACATGC	1
ACAGAGAAGTGGTGAGGAAAAGA	1
ACAGAGATCAACAAGTATGTGCCA	1
ACAGAGATGATGGTAAATAACGTG	1
ACAGAGCAATAAGGGTGGATGAGT	1
ACAGAGCCCAACATATTGCAGAGA	1
ACAGAGCCCACATGCGCCATACCA	1
ACAGAGCCTATAGATAACCATTGC	4
ACAGAGCCTGCTTTGATGGAATT	1
ACAGAGCTATCGTGTAATTAAGAA	1
ACAGAGCTTATGCATATGTGATAA	1
ACAGAGCTTTGGGCTCGGCACGAC	3
ACAGAGGAATGAGATAGATAGGAA	1
ACAGAGGACCAAAACAACTTATA	1
ACAGAGGAGGCAGTGGTCGGTAC	1
ACAGAGGCAGTAGCAAATCCTTGG	1
ACAGAGGCCCGGTTACAGCCCACC	1
ACAGAGGCGATCGATGATGATGCA	1
ACAGAGGGAGTAGAAGGGTACCG	1
ACAGAGGGTACCCTGTGTGCA	10
ACAGAGGGTGTAGATAATAAACTG	1
ACAGAGGGTGTATCACATAAAAG	1
ACAGAGGGTTTCCAAAATATGTGA	1
ACAGAGGTAACCACCGATCGATGG	1
ACAGAGGTAGTACTTATATAAGG	2
ACAGAGGTGGAAGCGCAAACGTGC	2
ACAGAGGTGGAGTTGGATTTAGAC	1
ACAGAGGTGTAACAAATACTA	1
ACAGAGGTGTTAGAGGCTGTGTAA	1
ACAGAGTAAGCGCGTTCTTGTGAC	2
ACAGAGTACAGAGTGATGGACCAT	3
ACAGAGTGCGGGATTATTAACTCA	2
ACAGAGTGGTCTATTAGCGTGCGA	1
ACAGAGTGTAATATATGGAGAGAC	1
ACAGAGTGTCTATGTCCCGCTGTA	1
ACAGAGTGTTGCCTTTTTCTGGAA	1
ACAGAGTTGGTGGAAATGGTTGA	1
ACAGAGTTGGTGGAAATGGTTGAC	4
ACAGATAAATCTGCAGGTGTACGG	1
ACAGATAAGTGTCATCCGTGATGG	1
ACAGATAATAACCATGTGCTTAAC	1
ACAGATAATTTGGTGCTGCCTTAA	1
ACAGATACGTGAGTATGGTGTTAC	1
ACAGATAGAAAGACAAGGCGC	1
ACAGATAGAGCCCGTCACAGGTGA	2
ACAGATAGAGTAATAAAATGGTGA	1
ACAGATAGAGTAGCTAGAGGGTTC	1
ACAGATAGATGTTGCCATATGCCA	1
ACAGATAGGTGTGTATACATAGG	1
ACAGATATACTTGTGCTTTTGATG	1
ACAGATATAGGTGGTGTTTGG	1
ACAGATATATCTGTAGCCTGATGC	1
ACAGATATGCATCTATGGATACAG	1
ACAGATATGCCGTTAAAGGTGTGA	1
ACAGATATGGTGTACGTGTGTGCA	1
ACAGATATGTAGCCTTAAAATATG	1
ACAGATATGTCCATGATGCCCTGC	1
ACAGATATTAAAAAAGTAGGTGAA	1
ACAGATATTCTTGTCACGGTGTTC	1
ACAGATCCAATCTGGTGCCTGCGG	2
ACAGATCCGGTTCCCGTTGTTTGT	1
ACAGATCCTCTAACTTTATGTGCA	1
ACAGATCCTCTGACTTATTTGTCC	1
ACAGATCCTTCCATCTGTGGCTGC	1
ACAGATCGGTACCTATGAACATCA	1
ACAGATCTAAATCATAATGGTGTA	1
ACAGATGAAGGTGTCATAAATGTA	1
ACAGATGACATGTCATCGGGTGTA	1
ACAGATGACCTATCTTAATCGGGC	1
ACAGATGACCTTATCTCAATCGGG	1
ACAGATGACGCGATACGAACGAGC	1
ACAGATGACTAGTACTACAAATGA	1
ACAGATGACTCATCAGTGATGGG	1
ACAGATGAGAATGTCCCTATGGTC	1
ACAGATGAGTGCTTACGTTTGACG	1
ACAGATGATAGCAGGCTCAGTGAC	1
ACAGATGATGGTCATTTGTGACTG	1
ACAGATGATGTGCATTTACTTGTG	3
ACAGATGCGTCGTCTATCACTGAA	1
ACAGATGCTGTTTGGTGATGGTTT	2
ACAGATGCTTGTGGTCTCCATGAC	1
ACAGATGGAAACACGAAACATGAC	1
ACAGATGGAGTTTACGTGCAGTGT	2
ACAGATGGATAGTTTGCAAGTGCA	1
ACAGATGGATCGGTAGAATGTCC	1
ACAGATGGCCCGTCACCGATGTCC	3
ACAGATGGGACATGTCTAGATTTG	1
ACAGATGGGACATGTCTAGATTTGT	1
ACAGATGGGGTTGTCAATTGTTTG	1
ACAGATGGTCAAACGTTGAGCACA	1
ACAGATGGTGTTGATACATAGCAG	1
ACAGATGTACGCGTTCTAACC	1
ACAGATGTAGGATGATCTAGTGAC	1
ACAGATGTATGGGCTGATAAAATA	1
ACAGATGTCTAGTGCGATCGGGAT	1
ACAGATGTGCTAAAATATATGGAA	2
ACAGATGTGTCATCTAGGTATCTA	2
ACAGATGTTAAGGTCTATGGTTGG	1
ACAGATGTTAGCCGATTGTAGG	1
ACAGATGTTGCTTAACGATTTGCC	1
ACAGATTACCCGATGATGGTTGCA	1
ACAGATTAGTGGACAGGTGCGGAC	1
ACAGATTAGTTAGGGCTTAATAAA	1
ACAGATTCCGCCTATAAACTGTG	1
ACAGATTCGGACCGTATGGGTGCA	1
ACAGATTCTTAGAATTTAGGTGAC	4
ACAGATTGATGTGATGGAAAAGG	1
ACAGATTGATGTGATGGAAAAGGA	1
ACAGATTGCACAAAGGTTGAAGTG	1
ACAGATTGCACGCAGAAATGA	1
ACAGATTGGGTGTAGTGAAGAATC	1
ACAGATTTTTAGAATTTGGGTGAC	1
ACAGCAAAATTGATGGCACACTGG	3
ACAGCAAACGAGAAGATGGCCTGC	1
ACAGCAAAGGAGATATCAGGCCTA	2
ACAGCAAAGTGGTGGGTGGGGGAG	1
ACAGCAACGAATCGAGGGGGAAGA	1
ACAGCAAGATGGATGTACACGGCC	3
ACAGCAAGGCCATGAGTGCGGTCC	2
ACAGCACAAAGATGCAGGGACAGC	1
ACAGCACAACACGTTGCCCTAGGA	1
ACAGCACCAGTCTCGACGTGC	1
ACAGCACGGATGGGACATTACATA	3
ACAGCACTGACTTCAAACGGACCT	1
ACAGCAGACGATGGACTACTTCTC	1
ACAGCAGGAGAGGTTTGGCGATGG	2
ACAGCAGGGTCGGTTTAGTTGTC	1
ACAGCAGGTGGCCGGCAGCAGCAC	1
ACAGCAGTATATCAGTGTGCTTGT	1
ACAGCAGTGAGCTCGCGCTGATGG	1
ACAGCATACGTCTTACCGGTGTCA	1
ACAGCATATGATTTAGGCCGTTGG	1
ACAGCATGAGTGCAGATTATGGT	2
ACAGCATGATGGTCCTATTACCC	2
ACAGCATGTGGTATTAGTTATTGC	1
ACAGCATGTGGTGTCGATGTCAGC	1
ACAGCATTCAATTGCACAGAGCCT	1
ACAGCCAAAGTTCGATAAGGTTGC	2
ACAGCCAAAGTTCGATAGGGTTGC	2
ACAGCCACACTCAGTGCAAGAGGC	1
ACAGCCACACTTGAGGGTTGTGAC	1
ACAGCCACAGCGTGGTCTCATGAC	1
ACAGCCACTGTATGCAGCCGTTGC	1
ACAGCCAGAAAAGTGTGATGGACA	1
ACAGCCAGCATGCCCAGTTGC	1
ACAGCCAGGTGGATCATGACTATT	1
ACAGCCAGTCCTGCTAAACGGGG	1
ACAGCCATGGACAGCCATGATGGA	1
ACAGCCATGGACTAAAGTGATTAG	1
ACAGCCCACGGAGAGGTGTATTGA	1
ACAGCCCATAGAGTTGAGGGATGA	1
ACAGCCCGTTTTTCCTCTCTCTCC	2
ACAGCCCTGCTCCGTAGCTACTC	1
ACAGCCGACTTGGATCTGCTTA	1
ACAGCCGATAGAGGTAATGCAGCC	1
ACAGCCGCACCCGTCGTTGGGTCC	1
ACAGCCGGAGAGATGGGCGCACC	1
ACAGCCGGTTGCGAGTTGTTGAGC	1
ACAGCCGTAAATATCTGTGTCTAA	1
ACAGCCGTACTGTATGAGTGCATC	2
ACAGCCTAAGGATAGTCCAGATTC	1
ACAGCCTAATTTGTATATCTCTA	1
ACAGCCTACCCAATACAACTTA	1
ACAGCCTAGACATGAGCACATGGC	1
ACAGCCTAGGTGAAAATGGCGATC	1
ACAGCCTAGTACTTGGAGTGGTC	1
ACAGCCTAGTACTTGGAGTGGTCC	1
ACAGCCTAGTCATTCATCCATGAG	1
ACAGCCTATAGCAACCACATTAA	3
ACAGCCTATATCTACCGTTGTTGC	1
ACAGCCTATATGCATAGTGTGCAC	2
ACAGCCTATATGTTGTATGAAGAA	1
ACAGCCTCCAAGATGTATGTGTGT	2
ACAGCCTCGGCTATGATGGAGCGA	1
ACAGCCTCTCCAATGAACTCTCCA	1
ACAGCCTCTCTATCTACCATCTCT	2
ACAGCCTCTCTATCTCCCTCTCCA	3
ACAGCCTGACAACGTGTTAAACCA	3
ACAGCCTGCTGGTGCTCCGTCGTC	1
ACAGCCTGGACTAGTATGGTACT	1
ACAGCCTGTGCTAGAATGAAGTCC	1
ACAGCCTTAGGCTACGACGTGTGC	1
ACAGCCTTCGAGGTGGTACTTTGA	1
ACAGCCTTGTTGGTTGTGGTTTGC	1
ACAGCGAACGTGGAGCCTTCTTTC	2
ACAGCGAACGTGGTGTCTCCTTTC	1
ACAGCGAACGTGGTGTCTCCTTTT	1
ACAGCGAATATGGTGTCTCTTTTC	1
ACAGCGAGGTGCCTGGGTGATGTC	3
ACAGCGAGTCTCAGCCAGTGCTGA	1
ACAGCGAGTGTCCTACGTGGCTGA	1
ACAGCGAGTTGCTAGTGCCTGAAG	2
ACAGCGATTGGTCTCTTGTGTCT	1
ACAGCGCAAACCGACAAAGATGGA	1
ACAGCGCAAATCGACAAAGATGGA	1
ACAGCGCCATGTGCTGCCCGTGCC	1
ACAGCGCCGAGTCGGATGGTGCTG	1
ACAGCGCCTGGGAAGCGGTTGTCC	1
ACAGCGCGGGAGGCTAAGGTGGAC	1
ACAGCGCTATGGAGCTCGTGGCCT	2
ACAGCGCTCTGCATTAGGTTGTGT	1
ACAGCGGGAGCTCGTCGTCGGTGA	1
ACAGCGGGTGAAAACGTTGAGGG	3
ACAGCGGGTGAAAATCGTTGAGGG	1
ACAGCGGTGCAAACCTGCGGCTGC	1
ACAGCGGTGGACCAAGTAGGGTTG	2
ACAGCGGTTAACCTGTTATGGTAG	1
ACAGCGTACCGGTGTTAGGCGACA	2
ACAGCGTGTGGTAGAGATCTTTGC	1
ACAGCGTTAAATATTTAGGGATGG	1
ACAGCTAAAAATATGGTCCACCT	2
ACAGCTAAAAGAAGACCACTACGC	1
ACAGCTAACCTAATAGCCAGCCTA	1
ACAGCTAACCTACTAGAGATCTA	1
ACAGCTAACTTAACAGCCAGCCTA	1
ACAGCTAATGGTAATGGAAACGAT	1
ACAGCTACAAAGATGTGAGGATGA	1
ACAGCTACAAAGGTGTGAGGATGA	4
ACAGCTACAAAGGTGTGATGAT	1
ACAGCTACCAAGAGACCAGGAGCA	1
ACAGCTACGTATAGACAAATTGTAG	1
ACAGCTAGATGCCATGGTACCTA	1
ACAGCTAGCTTTTGGGATGGGAA	1
ACAGCTAGGATTGCGAGGGGA	1
ACAGCTAGGGGCATCGAGCAGCGG	1
ACAGCTAGGTGCCATGTGGCGG	2
ACAGCTATATTAGAAATCGGGCGT	1
ACAGCTATGAAATGCTTCTGGGTGA	1
ACAGCTCACCGGTGCTAACAAATC	1
ACAGCTCATGTGGCATGGGTA	2
ACAGCTCGGTAACTACATGTTCA	2
ACAGCTGAGGGGCCATAATATTTG	1
ACAGCTGCATGTGTATCTACTTGG	1
ACAGCTGGGGCTGGATGGACGGAC	1
ACAGCTGGTGGATGACAAGTAGAG	3
ACAGCTGGTGGGTGCGTCCATAGA	2
ACAGCTGTAAAGGTGTGATGATGA	5
ACAGCTGTAAGTAGAGTTGAGTGA	1
ACAGCTGTCTACAAATCTGTAGCC	3
ACAGCTTAAGCCTAGCCTGACTAA	1
ACAGCTTACAAAGGAAAAGATGGA	1
ACAGCTTCCAATCACGGCAGTAGC	1
ACAGCTTCGGCAGATCGCTTAGCC	1
ACAGCTTGACACTAGACAATGGGA	1
ACAGCTTGGCGCTGATGTTGTGCA	1
ACAGCTTTGAAAGAAGACAGGTGG	2
ACAGGAAAAACAAATGAATGGTC	1
ACAGGAAAATCAACTTTCGTGTGC	1
ACAGGAAAGAAAGCGGTACCAAAA	1
ACAGGAACAAGTGTCTAAGGTCGC	1
ACAGGAACATACCAGTAATGCGAT	3
ACAGGAACGAGGAATGTGGGACGC	1
ACAGGAAGACGAAAGTGCCCATGT	3
ACAGGAAGGGACGTTTGATTGGAG	1
ACAGGAATCGGATGAGAGAGATA	1
ACAGGAATGACCGTTTGATTGAAC	1
ACAGGAATGACCGTTTGATTGGAC	1
ACAGGAATGCTAATTGGCGCGTAT	1
ACAGGAATGCTTGGGTGTCGTGCA	1
ACAGGAATGGCCGTTTGATTGGA	1
ACAGGAATGGCTGTTTGATATTGG	1
ACAGGAATGGTCGTTTGATTGGAG	1
ACAGGAATTAGATAAGAGAGATGG	2
ACAGGAATTGTGTCTAGAGCGAA	1
ACAGGACACTGCTATTGTGTGGTT	1
ACAGGACAGCAGCATATCCACTGC	1
ACAGGACATCATAATTGTGTGGT	1
ACAGGACCAGCAAACCCAGTGCCA	2
ACAGGACGCTTAGATAAACGAAAA	1
ACAGGACGTGGGCGTCGTGTGTGG	1
ACAGGAGAAACTGTGTTGCCA	1
ACAGGAGATTTTTGATGGATGTGA	1
ACAGGAGCCGAGGATTACTCATCA	1
ACAGGAGGGCTATCGAGATTCGTA	1
ACAGGAGGGTGATAGAATATTTTAT	1
ACAGGAGTAGGGTATTACGCTTGG	1
ACAGGATACTTATCGAACAACCGC	1
ACAGGATATATCCAGGATCTGCGG	1
ACAGGATGTGACATTACTTAATGT	1
ACAGGATGTGACATTATCCAGTAC	5
ACAGGATTGCTGTGCCATAGGAAG	1
ACAGGCAAGGTGTTACACGAAGAA	1
ACAGGCCACACCTTAAAATATGGG	1
ACAGGCCACGTGGGCGATTGTGTCT	1
ACAGGCCAGGAAGATGCATGATTCC	1
ACAGGCCCGACGACGGTGGTGGTA	1
ACAGGCCCGATAGTCTTTGTGCAC	1
ACAGGCCCTAAATGAAGATGTGAA	1
ACAGGCCCTATCTTCTTACTTTGA	2
ACAGGCCCTCACGTGTACACATGT	1
ACAGGCCGTAAGGGATTTTGGATG	1
ACAGGCCTAGGGCATGTTCGGTAC	2
ACAGGCCTATAATACAGTTATAAC	1
ACAGGCCTGGGCCTCACGTGGGAC	1
ACAGGCGAAAGTAGTTATGGTCCA	1
ACAGGCGATAGGTGAGGCGCTCCA	1
ACAGGCGTGGTGTTAAAGAGGTCT	1
ACAGGCTAGAAGTCACTGATGTGA	1
ACAGGCTGAGAAACTGGTACCTAG	1
ACAGGGACGCAGAATTAAGGTGGT	1
ACAGGGACGGAACCAAGAACGCCTTG	1
ACAGGGACTTATGTTTATGTAGGA	1
ACAGGGCATGCAGGATGTGGTGTA	1
ACAGGGCTGAAAGATGATAGTGAC	1
ACAGGGTACCATGTATAGATAGA	1
ACAGGGTATACGTACTGTGGCTGT	1
ACAGGGTCATAGTTTTTCAGTTGG	1
ACAGGGTGAACTTTGGGTGCTA	1
ACAGGGTGAGAACAAAGAAGGTGA	1
ACAGGGTGCATGCCTTTAAAAGAG	1
ACAGGGTGTAAAGTTTTTGATGGA	2
ACAGGGTGTGACACATGATAGTAC	2
ACAGGGTGTTTGACGAAATGCTGA	1
ACAGGGTGTTTGGTTCATGACCA	3
ACAGGGTGTTTGGTTCATGACCAC	6
ACAGGGTTTCAAAAACCGCCGGGG	1
ACAGGTAAAATATTATAGTTGTGC	1
ACAGGTAAAGTTTCCTCTGGTTGC	1
ACAGGTACCGCACAGTAACCGTAG	2
ACAGGTACTAGATTATGTCCCATC	1
ACAGGTAGAGACCCATGAGTGCTG	1
ACAGGTAGATGCGATTAGGTGCAA	1
ACAGGTAGGTCCTATCTTTATGGA	2
ACAGGTATCGGGTACCATACAGC	1
ACAGGTATCTATAGCTCTCTCATG	2
ACAGGTCAGTGTTGGTTTTGTAGA	1
ACAGGTCCTAAGTCAGTGACGATG	1
ACAGGTCGAAGCCGACATGGAAGC	1
ACAGGTCTGTGTGACCTGGGGTGT	1
ACAGGTGAAATTGAATGTGTGAAG	1
ACAGGTGAACCATATATTTATAGG	1
ACAGGTGACTCACTTGTGATGTGT	1
ACAGGTGATCTATTTACTGCCCGG	2
ACAGGTGATTTTGACTAGGGTTGA	1
ACAGGTGCGATGTTTTCGACCGAA	2
ACAGGTGGAATCTATAATTTGTTT	1
ACAGGTGGAATTTGCAATTTGTTC	1
ACAGGTGGACCCGAGAGTGGTGGG	1
ACAGGTGGACCTGGGGTTCATCGG	2
ACAGGTGGAGCACATGGGCCGGCC	2
ACAGGTGGGACCATATATTAATAG	1
ACAGGTGGGCTAATTTTGAGCTAA	1
ACAGGTGGTAATGGACTGCATAAG	1
ACAGGTGGTAGGCTAGACGACCTG	1
ACAGGTGGTGATAACCCTGCCCGT	1
ACAGGTGGTGCATGGCTGTCGTCA	1
ACAGGTGGTGTACCAGTGTTGGT	1
ACAGGTGGTGTTTACATACTACA	2
ACAGGTGTCCTCTTGTTCGAGTAG	2
ACAGGTGTCGCGATTTGATTTGGC	1
ACAGGTGTGGTCTTAAAGAGGTCC	1
ACAGGTTAAGAAGTGCGCTCTGAA	1
ACAGGTTAATGTGATGGAAAAGAA	1
ACAGGTTACCTGTCAAAGTGCTGA	2
ACAGGTTCGCACGCTTAATGGGCC	1
ACAGGTTGACTTGGTCCAAACATA	1
ACAGGTTGATGTGATGAAAAAGG	1
ACAGGTTGATGTGATGGAAAAAGT	2
ACAGGTTGATGTGATGGAAAAGG	3
ACAGGTTGATGTGATGGAAAAGGA	1
ACAGGTTGATGTGATGGAAAATGA	1
ACAGGTTGTACATGTATATGACAG	1
ACAGGTTGTGTAATACCTCATTAA	1
ACAGTAAAAATGAGTGCAGTCGAA	1
ACAGTAACACTGTGTCTTACGTGCA	1
ACAGTAACCCATCAGGCCATATGT	1
ACAGTAACGATATAAAACGATGG	1
ACAGTAATGACCGTTTGATTGGAC	1
ACAGTAATGGAAGTTTACGGA	2
ACAGTAATGGTGATATCCGACAGA	3
ACAGTACAACAACTTGGCGGGTGG	1
ACAGTACAGTGCAGACACTCACAA	1
ACAGTACCTGATACCTGTTGTGGT	1
ACAGTACGTAGGTGGGTGTAGAGG	1
ACAGTAGAGGATACCGATAGAGTG	3
ACAGTAGCAGACTGATGTGTGGGC	1
ACAGTAGCAGTGGCTAAGATGTG	1
ACAGTAGCCAACGCATGTTATCGT	1
ACAGTAGCCGTTGCCAGCTCCAGA	1
ACAGTAGCGAAGAGATAAGCAGGA	1
ACAGTAGCTAGACATGATGGACA	1
ACAGTAGCTATATGTGGTGCAGAG	1
ACAGTAGGAGTAGTTCTAGGTGAC	4
ACAGTAGGTACAGCTAGTCCGTG	1
ACAGTAGTACTAGGTGATGTCA	1
ACAGTAGTCGTGCTGTGATGGCCC	1
ACAGTATAAATGAGAGAGGTAGT	1
ACAGTATAAATGTAGGCGCTCACA	1
ACAGTATATGTAGGTGACAATAGC	1
ACAGTATGATGGTGTTGGTACCT	1
ACAGTATGATGGTGTTGGTACCTG	1
ACAGTATGGTGATGATGTAGATTA	1
ACAGTATGTTGCAAAAAAAGGTGA	1
ACAGTCAAACGTTGACACGGGAAC	2
ACAGTCAAACGTTGGGTACAGATA	1
ACAGTCAATTGGTTGCTGTGTGGG	1
ACAGTCACAAGTATATGGGTCCTA	1
ACAGTCACTAAGGCCTGTTGCCTG	1
ACAGTCATCTCTATGAACGTGCA	3
ACAGTCATGTTGGGCTGCGGACAG	4
ACAGTCCACTCGGCAGGTTTTGG	1
ACAGTCCAGCTTTTGGTCCAGATTC	1
ACAGTCCATCGTCTGGCCGGGTCC	1
ACAGTCCTACAATTGGTATTAGAG	1
ACAGTCCTACATAACTAAAATTAC	1
ACAGTCCTACATTCTAGCATTGCC	1
ACAGTCCTCCATTGTTAGGCCAGT	1
ACAGTCCTTGGTATGGAACAC	1
ACAGTCGAACAAGTTTGAGGACCT	1
ACAGTCGTGCGCCGTTGGGCCTGT	1
ACAGTCTAATGCTATACGTTC	1
ACAGTCTATAGAGAAAAACGGGAC	2
ACAGTCTGAAACCTACCGCCTCCA	1
ACAGTCTGCCAGCAAGGTGTTTGA	1
ACAGTCTTGTAGATGCAGCGCTGC	1
ACAGTCTTGTGCTGCGGGGAG	2
ACAGTGAAAACTCGTGCCGTGAAG	1
ACAGTGAAATTAAGTGCAGCCGA	1
ACAGTGAATACCTGTATAGTGCAG	1
ACAGTGAATAGTGTAGGTGCAGGG	1
ACAGTGAATCTGGATAAAAGGTAC	7
ACAGTGAATGTGGTGTCTCTTTTC	1
ACAGTGACACACTACGCACGCGGT	1
ACAGTGACACGGTGGCCTCTGACC	1
ACAGTGACCACCCGTCCCCGTCCC	1
ACAGTGACCCGATGCGCCTGGAAA	1
ACAGTGACCTAGTTTCACATGAGC	1
ACAGTGACCTGAACAGCACCCTA	1
ACAGTGACCTGAGTAATACTCCAAG	1
ACAGTGACCTGAGTAGTACCCT	1
ACAGTGACCTGAGTAGTACCCTAA	1
ACAGTGACCTGAGTAGTACCTCAA	1
ACAGTGACCTGAGTAGTATCCCAA	1
ACAGTGACCTGAGTGGTACCCTAA	1
ACAGTGAGAGAGGCCCTCACGGTA	1
ACAGTGAGAGTAAGAGATGGTACA	1
ACAGTGAGGTGAGTCACAAGATT	1
ACAGTGAGGTGTTTGTGTTAACTA	1
ACAGTGAGTGGGGGCAAATGCGGA	1
ACAGTGATAAAGGTACGGTGCAAT	1
ACAGTGATCGGCAAATCTATGGCC	2
ACAGTGATGGGAAGGGGAGGTGCA	1
ACAGTGATGTGTGGTGCATTGGTA	1
ACAGTGCAAACAAAATGTTAAAAT	1
ACAGTGCAAACGGATTAGAAAAAC	1
ACAGTGCAAATACTAGTAGTGGGTC	2
ACAGTGCAAGATTTGTTGGGA	1
ACAGTGCAAGCAAAATGTCAAAAT	1
ACAGTGCAAGTAAAATGTTAAAATC	1
ACAGTGCACATAAGGTCCCAAGGC	1
ACAGTGCACTACCTAGTTGACCTC	1
ACAGTGCAGAACAGTGGGTTACGC	1
ACAGTGCAGTTGTATGGTTTTTGG	1
ACAGTGCCAAAACAAGAAAGCTAT	1
ACAGTGCCCGACAACGACGGTGGC	1
ACAGTGCCCGGCAGGACATATCGA	1
ACAGTGCCTTAGGCTTTGTTGCCC	1
ACAGTGCGGCACCTATGTTGGGAC	1
ACAGTGCGGTTTGCCAGCTCTAAG	1
ACAGTGCGTCTCATCCGGTCGGA	1
ACAGTGCGTTATGTTGTTGAGCCT	1
ACAGTGCTAAATCCATCGCCGATG	1
ACAGTGCTACAATCGTGTTAAGGG	1
ACAGTGCTAGCTGTTAATTGTTGG	1
ACAGTGCTAGTGCTTGAGGAGTAC	2
ACAGTGCTATATAGGTGTCGGTTC	1
ACAGTGCTATTCGGATATCCGCAG	1
ACAGTGCTCCCTGATTTCTAGGA	1
ACAGTGCTGAGGGGTATTGCTAGG	1
ACAGTGCTGCATGTAGCCCGCTGC	1
ACAGTGCTGGTATCACAGGAAGAC	1
ACAGTGCTGGTATCACAGGGAGAC	1
ACAGTGGATTGATACGGTTC	1
ACAGTGGATTGATACGGTTCA	2
ACAGTGGCATGCGTAGGGAGGTCG	2
ACAGTGGTCTGCTATGATGTTGAT	1
ACAGTGGTGATGCATCGTTTGTTG	1
ACAGTGGTGCAAGTCGTTGAGTC	2
ACAGTGGTGCCGGTGCACTAATCA	2
ACAGTGGTGTAATCGGATTGTAGA	1
ACAGTGTAAGAACGATTGGGGTA	1
ACAGTGTAAGAACGATTGGGGTAT	1
ACAGTGTAATTACACTACGATTG	2
ACAGTGTAATTACACTACGATTGT	3
ACAGTGTAATTACACTACGATTGTG	2
ACAGTGTAATTACGTTATGATTGT	1
ACAGTGTAATTATACTACGATTGT	6
ACAGTGTAGTTGAGGATACGATGG	1
ACAGTGTATATATGGTAGGTGGG	1
ACAGTGTATGTATGACAGGTGGGA	1
ACAGTGTCAAACATTTTGAAATGG	1
ACAGTGTCAAATATTTTGAAACGG	1
ACAGTGTCCATATGTAATAGCTGT	2
ACAGTGTCGAAGCCTCGACGATGC	1
ACAGTGTCGGGCTGTCGGCGGGGA	1
ACAGTGTCTATGGTGTCACGTCAA	1
ACAGTGTCTTGAGGTGAAGTCAAT	1
ACAGTGTGACGGGGGCCCACCAGC	2
ACAGTGTGCATCGGTAGTTACCGA	1
ACAGTGTGCTCTGCATATGGTGGT	1
ACAGTGTGTATATGACAGGTGGGAC	1
ACAGTGTGTATGATAGGTGGGACC	1
ACAGTGTGTCTTGGAGCCCGCTGC	2
ACAGTGTGTGAAGACCTGATGGAC	3
ACAGTGTGTGAAGGACTGATGGACC	1
ACAGTGTGTGAAGGCCTGATGGAC	1
ACAGTGTGTGTATGACAGGTGAGA	1
ACAGTGTGTGTATGACAGGTGGGA	3
ACAGTGTGTGTATGGCATGTGGGA	1
ACAGTGTTACTACACGGTGACCGT	1
ACAGTGTTACTGCACAGTGGTCGT	1
ACAGTGTTAGATGACCACAACCT	2
ACAGTGTTCTACAGTATCCGGGTG	2
ACAGTGTTGACGATGATGTTGGAG	1
ACAGTGTTGCAGTTATGGTCTA	1
ACAGTGTTGGACGTAATACAAGAG	1
ACAGTGTTTAGAATAGAAAAATATG	1
ACAGTGTTTTAGGGCTAAAACCAC	1
ACAGTGTTTTGCTACAGTGCTCGG	4
ACAGTTAAAAGAGTGGAACCGAGC	1
ACAGTTAATTTAATATATGGAGAC	1
ACAGTTACGTGGTGGTGTTGACCC	1
ACAGTTAGGGTGGTCCTCTCGG	2
ACAGTTATGGTGTGACAATATGG	1
ACAGTTGAAAGTAGGGGCACGAAT	1
ACAGTTGAGATGATTGTTAGTGCA	1
ACAGTTGATGACAAGAGTAGGGC	1
ACAGTTGGACTACGATGCAGATG	1
ACAGTTGGGGCGCTGCGCATTGAT	1
ACAGTTGGTGCATGGTGAATGAAT	1
ACAGTTGGTTGACCTCGAAAGCAA	2
ACAGTTGGTTTACTGCGAATATCA	1
ACAGTTGTAGTTGGGCCATCAACA	3
ACAGTTGTCTGAAGAATGTGCACA	1
ACAGTTGTGAACCATGGTGCATGT	1
ACAGTTGTTCGATATGTACCCTGT	3
ACAGTTTAAAGCCTGAGTTGCCCT	2
ACAGTTTACAAGGTAAGTTAAAGG	1
ACAGTTTACATTATCGTAGGTGGT	1
ACAGTTTAGGAGATGGAGTTGTAC	1
ACAGTTTATGTGTCACATCCTCCA	1
ACAGTTTGAAAAACGTGCCACGAA	2
ACAGTTTGAAAAACGTGCCAGTTT	1
ACAGTTTGACCTCTACAACGTCGT	1
ACAGTTTGCTGCGAAACGTGGTGA	1
ACAGTTTGGGAAGTATGCGCATGG	1
ACAGTTTGTTAGGTATGTGTCTGG	1
ACAGTTTTGAATTGAGTTAGGTGG	1
ACAGTTTTGGTTGCTATAGATAGA	1
ACAGTTTTTTAGGCATGTATTTGG	1
ACATAAAATAAAAAATGATGTGACA	1
ACATAAAATATGTATGGTGTTTGG	1
ACATAAAATTACTGCGATCGGTTG	1
ACATAAAATTGACAATCACGTGCA	1
ACATAAAATTGATAGCGGTTGTTT	1
ACATAAACATAAGGTGATTTGCCA	1
ACATAAACTTATGTGGTGGGTGTA	1
ACATAAAGGTCACACTACCCACAA	1
ACATAAAGGTGTGATAGACTGTGC	1
ACATAAAGGTGTTGTTCTAACCAA	1
ACATAAATAGGTAGGGCCCGTAAC	1
ACATAAATGTAGTGTCTAGGTCAG	1
ACATAAATTTTAGGAATTTGGTGA	1
ACATAACAACTTTTAGCCTTCAGG	1
ACATAACAAGTGTGCTATAGTAAA	1
ACATAACACTTTATAATACAACGA	1
ACATAACCAGTAAGTGATCTTCGC	1
ACATAACCGTGTGTCTAGATTTGT	2
ACATAACCTAGACAAGGATGTGAC	1
ACATAACTACGACCGGGTCATACC	1
ACATAACTATTGGGGGTTACGAAC	1
ACATAAGAATTTTGGTGAGATGGA	1
ACATAAGAGATTTTAGGTGGATGG	4
ACATAAGATGAAAGATGATATGGC	1
ACATAAGATTGGCTACATGGGCAT	1
ACATAAGCCTTCCAGATTTATTGT	2
ACATAAGCTAAAATAGTGAGGTGG	4
ACATAAGGATCCACGTATCGTTAA	1
ACATAAGGGTGTAAGTGGGGCGGG	1
ACATAAGGTGGTAGACTAGTCGGT	2
ACATAAGGTGGTGGGCTAGCCGAC	2
ACATAAGGTGGTGTTTGGTTGGAG	1
ACATAAGTAAGAGAGACATGTGTC	1
ACATAAGTAGGTGTTTGGGAGA	1
ACATAAGTGCTGATCAGTGATGAG	3
ACATAAGTTTAAATAGTGAGGTGA	1
ACATAAGTTTGGGGACTACTACTG	1
ACATAATAAATGCTCTCTGGTCCA	2
ACATAATAATATATTATAGGTGTC	1
ACATAATACGTTGTGCTGAGGCCA	1
ACATAATATGTGGTGTGCCTCGCA	1
ACATAATGAAAATGGGTGAGGTAC	1
ACATAATGAGATGGAAAACGAT	1
ACATAATGGAACAATCGACGGTGT	1
ACATAATGGTGTTACCAACCGGGA	1
ACATAATGTGGGATAGTAAGGTGA	1
ACATAATGTGTATATGATAGGTAG	1
ACATACAATGCATTACAGACGT	1
ACATACACAGATCGGTACTATAGG	1
ACATACACAGCCATGGAGCCA	5
ACATACAGGATATATTGCGGCGGC	1
ACATACAGTAAACTAATAGGTGTA	2
ACATACAGTAGCTGCCACTGACAG	1
ACATACATAACTACACACGCCATA	3
ACATACATAGGTGTTGTGGGCGG	1
ACATACATCCGACGAATCACGTGC	1
ACATACATGCACATTGTATTTCA	1
ACATACATTGAGGGCGAGTTA	1
ACATACATTGGGTGGACATCAGTA	2
ACATACCACTACACACGCAACACC	1
ACATACCAGTGGCTGTAATGGTAG	1
ACATACCCAAGTATGGTAGGTGAA	1
ACATACCCATCAACAGCGAGACA	1
ACATACCCCCGGCCCATATCTCC	1
ACATACCTAATAGTAGTTGACTAA	1
ACATACCTACGGTCAGACCGGCC	1
ACATACCTATATCCTGACACCAAG	1
ACATACCTATGAGTATCAAGATGG	1
ACATACCTGGGTGCAGATGGGTCA	2
ACATACCTGTCACGGTAATGGTAG	1
ACATACCTTACCTGGGTACAAACG	1
ACATACGAATGACCGTTTGATTGG	1
ACATACGACGACGGGTTGCCATGG	2
ACATACGATGGTGTTGTTTATGGC	1
ACATACGCGTGCGTGCCTTATAGT	1
ACATACGGCTTGCATATGTGTGGC	2
ACATACTAGTGGTGTGGTGGTATA	5
ACATACTCAACGGTGTAAGTTGCT	1
ACATACTCCACTGTGCTAGGGTAG	2
ACATACTCTAAGGTGCATGTGTGT	1
ACATACTGCAGATGGGCCAGCTCA	3
ACATACTTAAAAAGTCAACGGTGT	1
ACATACTTCAAGTTGCCCTTTTAA	1
ACATAGAAAACCTACACCCGTGCC	2
ACATAGAACGTGGTGTCTCCTTTC	1
ACATAGAATTCTAACAGGAAGTGA	1
ACATAGAGAGAGGATCTGACAAAG	1
ACATAGAGATTGCTTAGAGTGAAC	2
ACATAGAGGTACCAATTTTAGATA	1
ACATAGAGTGTCTAGATTTATTGT	2
ACATAGATATATTCCGGCGAC	1
ACATAGATGTATGATAGGTGGGAC	1
ACATAGATTGTGGTTGCTTATGAT	1
ACATAGCAGTGACGGTGCGAGTAC	1
ACATAGCATGTTATGTAGGTAAGA	1
ACATAGCGACTATTTTTTGGTGAA	1
ACATAGCGATGTGCCTGTTTACCC	1
ACATAGCGGCCGTGATAATAGGGC	1
ACATAGCGTACCTCGGTCGCCTGC	1
ACATAGCGTTGTCTTTGATCTTGC	1
ACATAGCTCATAAACAGGCATATG	1
ACATAGGAAAATGATGATGTGGCA	1
ACATAGGAATAGTCGTCTGATTGG	1
ACATAGGAATTAAAATAATGATGG	4
ACATAGGACCGAACAACAGAA	1
ACATAGGACCGAACAACAGAACAC	1
ACATAGGACCTACTGATACTGATT	2
ACATAGGACTAAATGATAAGGTGG	1
ACATAGGATAAAAATTGATGTGAC	1
ACATAGGATAAAACCGGTGTCAAA	5
ACATAGGATCCGCGTGTGCAGGCC	1
ACATAGGATTAGGTGATAAGATGA	1
ACATAGGATTAGGTGATGAGTTGG	1
ACATAGGCAAGACCACGGTTAAACC	1
ACATAGGGCCCATATGTCAGCTGC	1
ACATAGGGCCTATTTAGTTGGTGA	1
ACATAGGGTTGGTACTGTCACGAA	1
ACATAGGTCCCACGCTAACTCAGC	2
ACATAGGTCCTCGCGTGTGCACAC	1
ACATAGGTGATGGGTTGATGTGAC	4
ACATAGGTTTGTGATAGTTTGGTC	1
ACATAGTGAAACATTGTGAGTGCA	4
ACATAGTGCCTTCTTTCAAAGTTA	1
ACATAGTGTCTATATGGTATAGTA	1
ACATAGTGTGTATATGACAGGTGG	1
ACATATAAACTTTCAACTTTCTTT	1
ACATATAAATAGATAGGGGCTGAC	1
ACATATAAGGTGTCCTACGGATAATGCAAATC	1
ACATATAAGTTACAGTGTGGTCAC	1
ACATATAATAAACGGGTGGACGTC	1
ACATATAATGATAGGGTGTACGTA	1
ACATATAATTATTTCGGTGTCTGC	1
ACATATACAAGGAGCCTTAAATGT	1
ACATATACTAAAAAGTCAACGGTG	1
ACATATAGAACGTATCCAGGGGC	1
ACATATAGGACCAGGTCCACATGT	1
ACATATAGGACCAGGTCCACATGTC	2
ACATATAGGTGACAATTGTAGCAG	1
ACATATAGGTGTAATACTATTGAA	1
ACATATAGTGCTGCCCACTGATAT	1
ACATATAGTGGTAAGCAGTGGCGG	1
ACATATAGTGTGTCGGAGATTGGT	1
ACATATATACGCGCTTAGGTTGT	2
ACATATATATGAATGTGGGCA	1
ACATATATATGAATGTGGGCAGTG	1
ACATATATGTGTACCTAGATTCAT	1
ACATATATGTGTGCCTAGAATCAT	1
ACATATATGTGTGCCTAGATTCAT	1
ACATATATTGGTGGTACGGTATGG	1
ACATATATTTGTGCCTAGATTCA	1
ACATATATTTTAGGTGTCCTGTAG	3
ACATATCACGTACGCGAGGGGAGC	1
ACATATCATTGAGATACGGGTGGC	27
ACATATCATTGAGATAGGTGTGGC	1
ACATATCCTAGGACTACGAATCTG	2
ACATATCCTATGCACACAGGCCC	1
ACATATCGCCTAGTAGTATGAACA	1
ACATATCTCGAGATTGATGAAGT	1
ACATATCTGGTTGGGTGTATAGAC	1
ACATATCTTACTAACGGCAAC	1
ACATATGATACTTATTGGTGCTAG	1
ACATATGATGAAAAATGATGTGGC	1
ACATATGATGGTCATGCCTGTGCG	1
ACATATGATGTGACCACTTACCAA	1
ACATATGCATAAATGGTGAGGTGG	1
ACATATGCCACAATGTGTGAATGC	2
ACATATGGAAAAACGCTAGAGAAG	1
ACATATGGGACCAAAATGCTAGA	1
ACATATGGGCCATAGCAAAGTGGG	1
ACATATGGGTGAACGTATTGAGAA	1
ACATATGGGTTGTACTGATACGTA	1
ACATATGGTGCTTATTCCTTGTCT	2
ACATATGGTGTGTATGATAAGTG	1
ACATATGGTTAAGTTAAGGTGGT	1
ACATATGGTTTAAGATGGTAAGA	1
ACATATGTAATAGGTGCAAGTTC	2
ACATATGTACTTATGTAGGGCCTG	2
ACATATGTATTTGGTGTTCTGTAG	2
ACATATGTCCTAGGGAGCCACAAC	1
ACATATGTGACTAGATTTATTAAC	1
ACATATGTGGCTGATTTGACTCGG	1
ACATATGTGTATGATAGGTAGGAC	1
ACATATGTGTATGATAGGTGGGAC	1
ACATATGTGTCTAGATTTATTAAC	2
ACATATGTGTCTTTAGCAATCTA	1
ACATATGTTGTAGTCGGTGCAAGT	1
ACATATGTTGTCTAGATTCATCGT	1
ACATATTAGGTGGGCATAAAACTT	1
ACATATTAGGTGGTGTTTGGATC	1
ACATATTAGGTGGTGTTTGGGAAG	1
ACATATTATGTATGACAGGTGGGA	1
ACATATTCATGTATTGGGTGAAGC	1
ACATATTCTTAAAATCTGGGTGGA	1
ACATATTCTTAGAATCTGGGTGAC	2
ACATATTGGAGTGTATTGGGT	1
ACATATTGGAGTGTATTGGGTGCG	4
ACATATTGGAGTGTGTTGGGTGCA	1
ACATATTGGTAGGGTGCTAAACCA	1
ACATATTGTGTCTTGTAGTTCGCT	3
ACATATTGTTAGCTTAACGTTTGG	1
ACATATTTAACAATGTCTCGTCCA	1
ACATATTTAACAGGCCTCTACCCC	1
ACATATTTCATAGGTACACCAAGA	2
ACATATTTCTTGGAGTTTGTATGC	6
ACATCAAAGGTTTGAACAGGTTGC	1
ACATCAAAGTACGGAGTGCCTTCC	1
ACATCAAAGTGATCATGCCCGTGC	1
ACATCAAAGTTGGTAGGTACAAAG	1
ACATCAAATAATTAGAAAGGGTGA	2
ACATCAAATAGGTGTCATAAGTGC	1
ACATCAAATATGTGTCGCTGCAAT	1
ACATCAAATATTTGGTCACAGGCA	1
ACATCAACATGTCATACACACACA	1
ACATCAACCGGAGGGCCTCTGAGT	1
ACATCAACGAGCCAATGATTTGGG	2
ACATCAACGCCACGTAGGATCCCA	1
ACATCAAGGGTGATACAACCGTAC	1
ACATCAAGGTAAACGCATGAAGAG	1
ACATCAATAGTATGTCTACATGGG	1
ACATCAATATAAACCGAACCTACA	1
ACATCAATATGAATGTGGGAATGC	1
ACATCAATCCAGGTGGAGACGGGG	1
ACATCAATGGAGGCAATACGAATA	1
ACATCACAGGTGAGGTTGATGTGAT	1
ACATCACATCCGATTTTAGATTGC	1
ACATCACATCGAATCTTTAGGTAC	1
ACATCACCCGTAGGTGCACCTGAG	1
ACATCACCTTTGATGATTTGATGG	1
ACATCACGGGTAAGGATGGTTGCC	1
ACATCACGTGTGTGCATTATGAAC	1
ACATCAGATATTATATAAGGTGTC	1
ACATCAGATGTGACATGGGCTAAA	1
ACATCAGATGTTAGTGGGCCCGGC	3
ACATCAGATTTTTGCTTATGTGGC	2
ACATCAGCCCGTGGTACTACGTCG	1
ACATCAGCGCCACGTAGGATCCTA	1
ACATCAGGAGCTGCCATTTCA	1
ACATCAGGATTGTAAGTTTCG	2
ACATCAGGGAATTAGGGCAGCTAC	1
ACATCAGGTACGATATTCTTGTCA	1
ACATCAGTGGTGGGATGTAAGTGC	1
ACATCATAGACACTACTTATGGA	1
ACATCATATGTTGGACACGAAAAC	1
ACATCATATTGATTGTTTGGGCAC	1
ACATCATCGGTGACATTGAGGAGG	1
ACATCATGAAGTGTCACATCCAAC	1
ACATCATGCATGTCTACACACTAC	2
ACATCATGGTACCTTCTTATGAAC	5
ACATCATGGTGGAAACGGTTTTAA	1
ACATCATTCCAGATGGGTGCATA	1
ACATCATTCTAGGTAGAGGGTTGG	1
ACATCATTGGTGTCGATTGGAACC	1
ACATCCAAAGTTCGATAGGTCTGC	1
ACATCCAACGATTAGACTGGTACC	1
ACATCCAACTGGATATATGTGCTC	1
ACATCCAATGATCAGCATTAGGCG	1
ACATCCACAATGTGTCATAAGAAT	1
ACATCCCAATTTTGGGCTGGCCTA	2
ACATCCCACGGAGAGCAAGGTGTT	1
ACATCCCACGGGGTAAGTTGCCTC	1
ACATCCCCGGGGCTCTGATTATGG	1
ACATCCCTGGGGCACTGATTATG	1
ACATCCGACTGGGTATAAGGGTAC	1
ACATCCGATGTGACATGGGCTAAA	1
ACATCCGATGTGATAGGGACTTAA	3
ACATCCGATGTGATAGGGTCTTAA	1
ACATCCGATGTGGTAGGGACTTAA	1
ACATCCGGTACTAGGTTAGGTTGT	1
ACATCCGGTCAAACATCCGATGTG	1
ACATCCGGTCAAACGTATGATGTG	1
ACATCCGGTCAAACGTCTGATATG	1
ACATCCGGTCAAACGTCTGATGTG	1
ACATCCGGTCAAACGTTCGATGTG	2
ACATCCGGTCAAACGTTCTATGTGA	1
ACATCCGGTGAAACGTTCGATGT	2
ACATCCGGTTAAACGTCCGATGTGA	1
ACATCCTAATACAACGAATCTGGA	1
ACATCCTAATACTATGAATCTAGA	1
ACATCCTACAATAAGCATAGGTAC	1
ACATCCTAGTACAACGAATCTGGA	1
ACATCCTAGTACAACGAATTCGGG	1
ACATCCTGATTGTGTGTCCTTAAT	1
ACATCCTGGTACTACGAATCTGAA	5
ACATCCTTTACCCGTTGCTCTCTA	1
ACATCGAATGTTTGACCGGATGT	1
ACATCGACAGACCCGCCTTAGTGC	1
ACATCGATGGGCCCATGACCTCTC	1
ACATCGCATGCGGTTGCTCTACCC	1
ACATCGCATTCCTATGGAGATCGA	1
ACATCGCCACCATCGATATGACCA	1
ACATCGGACCTACATGTAAATGAT	1
ACATCGGATATTACGTAGGGTGTC	1
ACATCGGATATTATATAGGGTGTC	1
ACATCGGATGTTTGACTAGAAGT	1
ACATCGGATTTGTGCTTATGTAAA	1
ACATCGGCAAACGCGTGTGATGCA	2
ACATCGGCAAATAACCAGGATTGC	1
ACATCGGGCCTATACGTGAGTGAC	1
ACATCGGGTATCTGATTTTGTGGT	2
ACATCGGGTATTATACAGGGTGTC	1
ACATCGGGTATTATATAGGATGTC	1
ACATCGGGTATTATATAGGGTGTC	1
ACATCGGGTATTATATGGGGTGTC	1
ACATCGGGTCCACATGTTAGTGAC	5
ACATCGGGTGTTATATAGGGTGTC	1
ACATCGGTAATTGATGATATGTGA	2
ACATCGGTAATTGATGATGGATGA	2
ACATCGGTGGCTCGGTAGGTGA	1
ACATCGGTTGATGAGGCGCCTAAG	2
ACATCGTAGACCTGCTGATATTAG	1
ACATCGTCAGTGGCGGAGTGCACC	1
ACATCGTGGAGGTTGCTATAGTTAA	1
ACATCGTTATAACATGGTACCATG	1
ACATCGTTTAAAAAAGTGCTTAAA	1
ACATCTAAGAAAAATGGTTGCGCC	2
ACATCTACACAAGGTTGAGGAGCC	1
ACATCTACTTCTGGGCCACATGGG	1
ACATCTACTTGTGTGCACACTGAG	1
ACATCTAGGAACAACGGGTTGCCA	1
ACATCTATATAAATGTGAATAATA	1
ACATCTATATGAATGTGGGCAA	1
ACATCTATGGGTGTCGATTCTAAA	2
ACATCTATGTGAATGTGGGCAATGA	1
ACATCTATTAGAAGAGGGGGCTA	1
ACATCTATTGATGCCTCGCCCACC	1
ACATCTCACTGGATCGTGCCTGAA	1
ACATCTCCGCCAGATGCGGTGCCA	1
ACATCTCGACGGTGTTGGGTTAGG	2
ACATCTGACAGGGGATGAACCGGG	1
ACATCTGAGAACAGCGGGTTGCCA	3
ACATCTGAGGGTCAAGAGAAGCC	1
ACATCTGATCTGATTGGGTGAGGA	1
ACATCTGATGTGACATGGGCTAAA	1
ACATCTGATGTGATAGGGACTTGA	1
ACATCTGCCTGAAAAATATAATT	1
ACATCTGCCTGAAAAATATAATTT	1
ACATCTGGGAACAGCGGGTTGCTA	1
ACATCTGGTCACCACCTTCGAGT	2
ACATCTGGTTCAGGTGGGGTTGGC	4
ACATCTGTCAAATTTTTAGGAGA	1
ACATCTTGGAAGGATATGGCCTGC	1
ACATCTTGGTGAAACAAAATGATG	1
ACATCTTTTGTCAGGATTGAGGTC	1
ACATGAAAATGATAAGGTTTGGTC	1
ACATGAAATAAACGGGTGGACGTC	1
ACATGAACACATTGGCCCATCTCC	1
ACATGAACATAATGTAAGGTTGGC	1
ACATGAACTCAGTTGTGCAAGCA	1
ACATGAACTTGTAAGGTAGGTGAA	1
ACATGAAGCACGACTATCAGGTCC	1
ACATGAATTTTGGTGGACTAGTAG	1
ACATGACAACTTTAGATGTCTCAC	1
ACATGACACCCTATGATGATTGTG	2
ACATGACACCTACGTAGCAATGAT	1
ACATGACACGGCTGATGGACGCTA	1
ACATGACAGGGCGTCACCGCTGG	1
ACATGACATACAATAAACGGGTGG	2
ACATGACATCGCAATTGTGTGGTTT	1
ACATGACATTTATCGATCAAGTGG	1
ACATGACCAACTGTGGATGGGAAG	1
ACATGACCAATAGACTTCGTGCCA	1
ACATGACCTGATTGATTGCCAA	1
ACATGACGGCTGCTGACTAGTGAC	1
ACATGACGGGTAAGAATGGTTGCC	1
ACATGACGGGTAAGGATGGTTGTC	1
ACATGAGAAATTGGACATCCTGCC	1
ACATGAGAACCTATACACTAGACA	2
ACATGAGAGCCTGTGGATGCCATG	1
ACATGAGATTTTGGTGTAGCGAAT	1
ACATGAGCCTGCGGGTATGTGTGG	2
ACATGAGCTACCTAAGGGCACTGA	1
ACATGAGGAGCCCAAATCACTACA	1
ACATGAGGATGGGTTTGAAATGGT	1
ACATGAGGGCTTCGTTGTTTTGAC	1
ACATGAGGGGACCAACTGTTGGAC	1
ACATGAGGTCAATGATATGTGGAT	1
ACATGAGGTGCGGCATTATGTGA	2
ACATGAGGTGTAACAATGTTTGGC	1
ACATGAGTCAATGACATGTGGGTC	1
ACATGAGTCAATGACATGTTGGT	2
ACATGAGTCAATGACATGTTGGTC	1
ACATGAGTGAGGTCAAAGTGTGCA	1
ACATGATAAGGTAGAGCCGTAGAG	2
ACATGATACTTCGGGCACTGGCAA	1
ACATGATAGGCGTGTCTCTATGAC	2
ACATGATAGTACTACGGATATGGA	1
ACATGATATAATGAGAAAGGGAGG	1
ACATGATATCCAGGGTTTGCCTT	2
ACATGATATTTTAGTGTCCTG	1
ACATGATGCCTTGGATGTTATATA	1
ACATGATGCTTTACAGGAGGGAAG	1
ACATGATGGCCGGTTTGATAAATA	1
ACATGATGGCCTAGACTCACGA	1
ACATGATGGGACATTTTCAAGTAC	2
ACATGATGGTTTGGAAGCGTTCCT	1
ACATGATGTACCGCCGGTATCAAA	2
ACATGATGTCTTAGATGTTGTGTA	3
ACATGATGTGACTGAAAAATTG	1
ACATGATGTGACTGAAAAATTGTG	1
ACATGATGTGCATTGTTAGATCCA	1
ACATGATGTGTGCTTGCTCAGATG	1
ACATGATGTTTTGGATGTTGTGTA	1
ACATGATTGGTGATATGAATTCTG	3
ACATGATTGGTGCAGGATCGTAGC	1
ACATGATTGTTTCAAAGATACCAT	2
ACATGATTTTTGAGTGTCCGGTAG	1
ACATGCAAAACAAAAGATTGGAAC	1
ACATGCAAATGATGGATGTCATGG	1
ACATGCAAATTAGATCCAATATGC	1
ACATGCAACAAATGGGTGGATGTC	1
ACATGCAAGAAAGGGGTGGACATC	2
ACATGCAAGAAATGGGTGGACGTC	1
ACATGCAAGTAGAGGTGGGGTGGA	2
ACATGCAAGTAGGGATACAAGCGG	1
ACATGCAATAAACGGGTGGACATC	1
ACATGCAATAAATGGGTGGACA	1
ACATGCAATAAATGGGTGGACGTC	1
ACATGCAGTACTGCAGACGACCT	1
ACATGCATACACCTAGACGCCATG	1
ACATGCATACTAAGCTTAACGAGC	1
ACATGCATGGAGCATTAAATATGG	1
ACATGCCACATAAGATTGAATGAT	2
ACATGCCACCTAAATGATTATGAA	1
ACATGCCATCCTACGACTATGAGG	1
ACATGCCATCGGTCCAAATTTGTG	1
ACATGCCATGTAACCACTATGCTA	1
ACATGCCCCTTCTTGCTAGGGAAG	1
ACATGCCCGCGCGAATACGTGGTC	1
ACATGCCCTTAACTAATGTGAATG	2
ACATGCCGACTAACTTTTAGTGAA	1
ACATGCCGACTATTTTTTAATGAA	1
ACATGCCGACTATTTTTTAGTGAA	9
ACATGCCGACTATTTTTTAGTGT	1
ACATGCCGACTATTTTTTAGTGTA	2
ACATGCCGACTATTTTTTGATGAA	4
ACATGCCGACTATTTTTTGGTGAA	1
ACATGCCGGCTATTTTTTTATAAA	1
ACATGCCGTCATGAAGTGCCA	2
ACATGCCGTGGGTAGATTGGATGG	1
ACATGCCGTGTGAGTATGGGGTAC	1
ACATGCCTAACAACTCAAGAAGG	1
ACATGCCTAATAAACTGTGTGTGG	1
ACATGCCTATGACACTGATTACGG	4
ACATGCCTGAGCAACGTGGGCCGT	2
ACATGCCTGTTTACCCATCGGGTA	2
ACATGCGAAAGGCAAAAGGTGCAG	1
ACATGCGGGACAGTCCTTGGGTGT	1
ACATGCGGGTCCACGTTACTACC	1
ACATGCGTGCAAAATGACTTTAAA	1
ACATGCTAGAAATGCCACGAACTC	1
ACATGCTAGGAATGGGTGAACGTC	1
ACATGCTATATAGGGCCTGTTTGG	2
ACATGCTCAAAGGGTTGTTTGG	1
ACATGCTCGTGGTCTCGTGGACTG	1
ACATGCTCTGACATGCCTATGTGC	2
ACATGCTGACTAGTTTTTGGTGAA	1
ACATGCTGTGAGATGCGGGCGTGC	1
ACATGCTGTGTGGGTATAGGGTAC	2
ACATGCTGTTTGCTCTGGTTGTGT	1
ACATGCTTCAAGTGGCTAGGAGGG	4
ACATGCTTCTGTTCATGGTGTTGG	2
ACATGCTTGTTGATGATGTGTCA	1
ACATGCTTTAGGATAAAGAAGTGT	1
ACATGGAACTGATGGAGCTGTGAG	1
ACATGGAAGAAAGAGATTGAATGG	1
ACATGGAAGAGCATGGCAGGGTGG	2
ACATGGAAGGACTAGTTTGCT	1
ACATGGACAACGCTCTCTCCCT	1
ACATGGACCCACGTAACGTGTAGA	1
ACATGGACTTAGATTGTTCAATGG	1
ACATGGAGGAATACTCGTACTGAG	1
ACATGGAGGGTTGAAGATGGCTGG	2
ACATGGATAAAATTAGATGTGACA	1
ACATGGATGACCGTTTGATTGGAC	1
ACATGGATGGAGGAAGTACTACTT	2
ACATGGATTTTGTGGTTGCTTTGC	1
ACATGGCACCCTATAAATAATCT	1
ACATGGCAGCTTCCATGATGG	1
ACATGGCCACTACGTATGTAGCG	1
ACATGGCCCTACTAAAATTTTGGA	1
ACATGGCGCTTACATGGCGGTGTTG	1
ACATGGCGGCAGAGGTTGAGTGGT	1
ACATGGGACCTAATTTATTGGAA	1
ACATGGGATACGTGTCGAAAGTAA	1
ACATGGGCCAAACACCACATGAGC	1
ACATGGGGCTCACATGTCAGCTGC	1
ACATGGGGGTACTTGGTGAAAGTC	1
ACATGGGGTGCTTGGCGAAAGTC	1
ACATGGGTATAGAAAGCCTAGTGG	2
ACATGGGTCCTACGCTGACTCAGC	1
ACATGGGTCCTAGTTGGGCCGGGA	1
ACATGGGTGCCCACTTCCACAACC	1
ACATGGGTGCTCACATTTACGA	1
ACATGGGTGCTCGTATTTACGGCT	2
ACATGGGTGTAAAGCTTCGGCGTA	1
ACATGGTAAGAAAACAAGTTGTGT	1
ACATGGTACAGATGATCAGTGATA	3
ACATGGTACGTGGTGCGTCCTGCC	2
ACATGGTAGACCTAACGTATGTGA	1
ACATGGTAGGTGGGAATAAAGATC	1
ACATGGTATATGCGATTAGAGCA	1
ACATGGTATGCACTTGTGGAA	1
ACATGGTATGTGATGGGTACTGCC	1
ACATGGTCACATATATCATACATA	1
ACATGGTCCAATAACAAATAGTC	1
ACATGGTCGCGATTATGATGAG	1
ACATGGTCGTCCTATCGCCAG	1
ACATGGTGAAAAATGTTAGGGTGG	1
ACATGGTGAAAATAGATAAGGTA	1
ACATGGTGAAAATAGATGAGGTAG	1
ACATGGTGAAAATAGATGAGGTAT	4
ACATGGTGAAAATAGGTCAGGT	1
ACATGGTGAAAATAGGTGAGGTAT	1
ACATGGTGACATGATGTGGGGCT	1
ACATGGTGACATGGTGTGGGGCTG	1
ACATGGTGACTATCAATAAGACTC	1
ACATGGTGACTATTTTTTGGTGAA	2
ACATGGTGACTTAGGAACGTTTG	3
ACATGGTGAGTGAGTTAATTGCTT	1
ACATGGTGATGTGAAAAATTGTGA	1
ACATGGTGCAATTGTTTGGACTGA	1
ACATGGTGCACTTTTATACAACTA	1
ACATGGTGCTGGTGCTAGTATGG	2
ACATGGTGGATTTGGATGTAATA	1
ACATGGTGGCGAGAAATTGGTCTA	18
ACATGGTGGCTTCGCTGTTTTGAC	1
ACATGGTGGTCTATGAGCATTTAT	1
ACATGGTGTAAAATTTTAAGGTGA	2
ACATGGTGTACCGGAGCAAGAAGC	1
ACATGGTGTAGTGGTGCTCCTGAC	1
ACATGGTGTATTGAATATAGGCT	2
ACATGGTGTCCTTCTCTTTCCTC	2
ACATGGTGTCTCCTTTCAAAGCTG	1
ACATGGTGTCTTGATGTTGTGTA	1
ACATGGTGTCTTGATTGATGTGAT	2
ACATGGTGTCTTGGATGTTATGTA	2
ACATGGTGTCTTGGATGTTGTGTA	1
ACATGGTGTGAAGGATATCCTCCA	3
ACATGGTGTGGACGTTATATTGCG	2
ACATGGTGTGTACACGCGAAGGTC	1
ACATGGTGTGTACACGCGAGGGCC	6
ACATGGTGTTAGGGTTATGGATAC	2
ACATGGTGTTCTAATAAATTAGGA	1
ACATGGTGTTGTATAGGATGTTC	1
ACATGGTGTTTTAGAACGTTCTGC	1
ACATGGTTATTTGCCAGCGGACAC	1
ACATGGTTTCTACACAACATCCAA	1
ACATGGTTTCTACACAACATCTAA	2
ACATGGTTTCTACACAACATTCAA	1
ACATGGTTTCTACACAATATCGAT	1
ACATGGTTTGTCTTACAATATAGG	1
ACATGTAAAAACTTGGCCCTGCCC	1
ACATGTAAAGAACACAGTGTGCCC	1
ACATGTAACAAAGGTGCATAACTA	1
ACATGTAAGTGTGCCACATCATTA	1
ACATGTAAGTTAGATTTCGCGGGT	1
ACATGTAATAAACGGGTGGACATC	1
ACATGTAATAAATGGGTGGACGTC	1
ACATGTAATAAATGGGTGGATGTC	1
ACATGTACCCAGCAGCAAGGGCAT	1
ACATGTACCTGTCGAACTGTGGTT	1
ACATGTAGAAGAATGATTGGTGAA	1
ACATGTAGACATGTGAGCCTGAAG	1
ACATGTAGAGGTGGAAAATGGTC	1
ACATGTAGATGTGTGTGGAGATGG	1
ACATGTAGCCTAGTGGTTGTAGTG	2
ACATGTAGGCCCGTGTAGTAAGAA	2
ACATGTAGGTACTGGTGATGATAC	1
ACATGTAGTAGATCTAGGGTGCGT	2
ACATGTATAGTGGTGCGTGTGTGT	1
ACATGTATATGTACTGTCGGTGAC	1
ACATGTATGCGACGGTTGGTGGGA	1
ACATGTATGGGCCAGGATTTTGAG	2
ACATGTATGTGTGCAATACTAGAA	1
ACATGTCAACGAGCAGTAATGTGT	2
ACATGTCACCATGTGCCTCAATA	1
ACATGTCACCATGTGCCTCAATAC	1
ACATGTCACGAGATGTTGAGGACC	1
ACATGTCAGGGTGGCCACGTCAGC	1
ACATGTCATAGACACATGAGGGCC	2
ACATGTCATAGACACATGTGGACC	1
ACATGTCATGAGTGTCACATAGGT	1
ACATGTCATTGACAGGGTGTGGCA	3
ACATGTCATTGACTCATGTGGGTT	3
ACATGTCATTGAGATACCGATGG	1
ACATGTCATTGAGATACGGGTAGC	2
ACATGTCATTGAGATACGGGTGG	1
ACATGTCATTGAGATACGGGTGGC	6
ACATGTCATTGAGATAGGGGTGGC	4
ACATGTCATTGAGATAGGGGTGGT	1
ACATGTCATTGAGATAGGTGTGG	1
ACATGTCATTGAGATAGGTGTGGC	1
ACATGTCGTGCTATGAGTGTGTCT	3
ACATGTCTAAATCATTTGAGCGGA	1
ACATGTCTACAATTTGCATCTGA	1
ACATGTCTACCCTATGTCACTCAA	1
ACATGTCTATGATATGTGGGTCCA	3
ACATGTCTCGATGTGCAGATGGT	1
ACATGTGAACCGTACTGAGCT	1
ACATGTGAGAAAAAGTCAACGGCG	1
ACATGTGAGAAAAAGTCAACGGTGT	2
ACATGTGAGAAATGTCAACGGCGC	1
ACATGTGAGAAATGTCAACGGCGCCA	1
ACATGTGAGCCACAGATCCTCTAA	1
ACATGTGAGCTCAGGGATCATCGG	1
ACATGTGATGTGACAAAGGGTGAT	1
ACATGTGCACACGTATATACACGG	2
ACATGTGCATAACACATTCGTGGG	3
ACATGTGCATCTATATGAATGTGT	1
ACATGTGCATGGTGTCTTGATTGA	1
ACATGTGCGTATATTATAGGTATC	1
ACATGTGCTAAAAAGTCAACAGTG	1
ACATGTGCTAAAAAGTCAACGGCG	1
ACATGTGCTAAAAAGTCAACGGTG	1
ACATGTGCTAAAAAGTCAACGGTGA	1
ACATGTGCTAAAAAGTCAATAGTG	1
ACATGTGCTAAAAAGTTAACGACC	1
ACATGTGCTGATTATCTAAATATA	1
ACATGTGCTGGCTCTTCCGTAGCG	1
ACATGTGGACTATTATATTAAAGAG	1
ACATGTGGGACCAACATGTGCCTG	1
ACATGTGGGACCCACATGTGCCTG	1
ACATGTGGGACCTATCTTATTACC	2
ACATGTGGGATAGGATGGTCAGGA	3
ACATGTGGGCCATACTAAAGTGGG	1
ACATGTGGGCCCTCATGTGTCTATG	1
ACATGTGGGCCTATAAAGATGGG	1
ACATGTGGGGCCAATACTAGATCC	1
ACATGTGGGGCCATGTAGGAT	1
ACATGTGGGTCCGATGAACCCTGA	1
ACATGTGGGTCCTACTTTGCTATG	4
ACATGTGGGTCCTCATGTGTCTAT	1
ACATGTGGGTGCGATGTAATATAC	1
ACATGTGGTGCTTACTATCCTCCG	1
ACATGTGGTGGTGATATATGTA	1
ACATGTGGTGTGGCAATGTGTGG	2
ACATGTGGTTGTTTGGTTGCTAG	1
ACATGTGTAGAAAAGTTTTGGATG	1
ACATGTGTAGATCTAATGATGCGT	1
ACATGTGTATATGATATGTGGGAC	1
ACATGTGTATTGTGAATGGCC	1
ACATGTGTCAAACATTTGATGTGA	2
ACATGTGTCCAAACATTCGATGTG	1
ACATGTGTCCGAACATTCAATGTG	1
ACATGTGTCTATAACATGTGGGT	3
ACATGTGTCTATGACATGGGGGTA	3
ACATGTGTCTATGACATGTGGGTC	1
ACATGTGTCTATGATATGTGGGT	1
ACATGTGTGAATAGTCCTACCTGT	1
ACATGTGTGCCAACATTGCCTTAT	1
ACATGTGTGCCAAGAAAAATATGC	1
ACATGTGTGCGGGGCGCTTGCTTA	1
ACATGTGTGCTCTTTTCTGTTTCT	1
ACATGTGTGCTTAACTCTTCTACA	1
ACATGTGTGCTTCAAGGTTGATAA	1
ACATGTGTGCTTGGGACTATTATA	2
ACATGTGTGTATGACAGGTGAGACC	1
ACATGTGTGTATTCGTATGGGTGA	1
ACATGTGTGTGTCTATATATATA	1
ACATGTGTTAGTCCGTAGTGGTAC	1
ACATGTGTTTAAATGTTCGATGTG	2
ACATGTGTTTATAGATTTAAGTGT	1
ACATGTGTTTATGATATATGGGGTC	1
ACATGTTAAGAGGACCACCTACAA	1
ACATGTTAGCCACCCACGTAAGA	1
ACATGTTAGCTAAATGAAGTATGG	1
ACATGTTAGTGACAAAGGCACCTA	1
ACATGTTATAGACACGTGTGGACC	1
ACATGTTATAGACATATGAGGTCC	1
ACATGTTATATGTATGGGAATGAA	1
ACATGTTATGTCTTGGAGTCCGTG	1
ACATGTTATTGAGATAGGTGTGA	1
ACATGTTATTGGGCCAGTGATATA	1
ACATGTTCTACCACCTAGGGCTGA	1
ACATGTTGAAATAATGGGAAGTAC	1
ACATGTTGATGCCGCAAAACTTAG	1
ACATGTTGATGCGATGGAAAAGGA	2
ACATGTTGATGTGATGAAAAAGGA	1
ACATGTTGATTACGTTCGCCG	1
ACATGTTGCCAATGTTACAGCAAA	1
ACATGTTGCCATATATTGAATGAA	1
ACATGTTGCGAGGGTGCTCTGCCA	2
ACATGTTGGTGAACATGTTGTTAG	1
ACATGTTGGTGAAGATGAAGTAGA	1
ACATGTTGTCAGGGGCTGTCAGGCC	1
ACATGTTGTGACTAATTTACGAGA	1
ACATGTTTAAAAAAGTCAACGATG	1
ACATGTTTAAAAAAGTCAACGGCGA	1
ACATGTTTAAATGAAGGGCCCAAC	4
ACATGTTTAGATCTACGGGTGAA	1
ACATGTTTGGTTGCTAAGTTTGAT	1
ACATGTTTGTATGAGTGTCTGCGA	1
ACATGTTTTTTGCGTGTCCTGTGG	1
ACATTAAAAGATGTAAGTGGGTGG	2
ACATTAAAATATAATATCCACCCA	1
ACATTAAAATTTTTGGTACCTCGA	2
ACATTAAATAAGCTGTCACCTAG	1
ACATTAAATGTATAAGTAAGGCCG	1
ACATTAAGGGTGTGTTTGAGAAG	1
ACATTAATGGTGACCTGAGCAGAC	1
ACATTAATTTGCCATTTTGTTGAG	2
ACATTACAAGCCGTCACAGGTGAT	1
ACATTACAGAATAGCTTGACGAGG	1
ACATTACATCTCGTGCTAGGCTTA	1
ACATTACATTTTGAAGTCCGTCC	1
ACATTACCTTGGGCCACTTTGAAT	1
ACATTACGTCTTGGAATCTGTGCT	1
ACATTACGTCTTGGAGTCTGTGCC	1
ACATTAGAAGATCCTCTATAGCCT	3
ACATTAGACACGGATATCCACGGC	1
ACATTAGATTAAATGATGAGGTGA	2
ACATTAGCCAGAGCAGAGAATGGA	1
ACATTAGGTCTTAGAGTCCGTGCT	1
ACATTAGGTGATTATGAATGGTAG	1
ACATTAGGTTTTATATAGGGTGTC	1
ACATTAGTGAGCCCGAAGATGTGT	1
ACATTATAGGTGCCAGTAGTACTA	1
ACATTATAGGTGCCGATTCTAC	1
ACATTATCCCCAGCAATGGTACCA	2
ACATTATGAAACGGAGGAAGTAGC	2
ACATTATGAAATGGATAGAGTGCT	1
ACATTATGAGTGTACTAGGTGAA	2
ACATTATGAGTGTACTAGGTGAAA	1
ACATTATGGTAGCACTAAGAGGAC	2
ACATTATGTACCACACGTCCACAC	1
ACATTATGTCTTGGAGTCCGTGCT	1
ACATTATGTGTATATGAGATGTGG	2
ACATTCAAAAGTGCATGGGTCCCA	1
ACATTCAATGTGACAGGGTGAAAA	1
ACATTCAGCGCCGTGCTATTTGGC	2
ACATTCATACCACGATACACACGC	1
ACATTCATATAAATGTTGTGTCTA	1
ACATTCCCAATGTGCGATTATGGA	1
ACATTCCTACTCAACGACGGTGGT	1
ACATTCGATATGACATGGTGAAAA	1
ACATTCGATGTAATGGGTGAAAAG	2
ACATTCGATGTAATTGGGTGAAAA	4
ACATTCGATGTGACCTATCTAAA	2
ACATTCGATGTGATAGGTACTTAA	1
ACATTCGATGTGATGGGTGAAAAG	1
ACATTCGGTGGTGGTTATTGTGCA	1
ACATTCGGTGTAACCACGAGTTGG	1
ACATTCGTAGTACTAGGATATGTC	1
ACATTCTACCGATCCATCTGTGTC	1
ACATTCTATTACTATGAATCTGGA	1
ACATTCTTTTTCACCTACTTTCTC	1
ACATTGAAATATGGAGGTAGCAGC	1
ACATTGAAATGTGGACCTAGTGAC	2
ACATTGAACATGGTCAAAAGTGCA	1
ACATTGAAGTTGATTTGGTTAAGC	1
ACATTGACGATTAGGGTTGCT	2
ACATTGACGTATGGTGCAATAG	1
ACATTGAGGATGCCCTAATGGTAA	4
ACATTGATGACGAGTAGAAGTGAA	2
ACATTGCATGTGGATTTTGGA	2
ACATTGCCTGCACATCTTATTGTA	1
ACATTGCTCGGGGGGTTGAGTGGA	1
ACATTGGATTGAGTGACAAGGTGG	1
ACATTGGGCATGCTCTACCACAGG	2
ACATTGGGCATGGAAACCAAGG	2
ACATTGGGCCTGTTAACTGTACAA	1
ACATTGGGCTGTCGTACCCTCCTC	1
ACATTGGGGCTAGTGTATTAGAAT	2
ACATTGGTACCATGGATCCCT	1
ACATTGGTACGACTATGGCTGTGT	1
ACATTGGTCCTAAGGTGGTCCAAA	1
ACATTGGTGGTTGTTTTCGATGT	1
ACATTGGTGTTGTAACAAATAGCA	1
ACATTGTAAATATACTAGGTGAAA	1
ACATTGTAAGTACACTAGGTGAAA	1
ACATTGTAAGTACATTAGGTGAAA	2
ACATTGTAAGTATACTAGGTGAA	1
ACATTGTAAGTATACTAGGTGAAAC	1
ACATTGTAAGTGTCTGCGTTGTAC	1
ACATTGTAGTACTACGAATATGG	1
ACATTGTATGTGTTGCCTCTTAAT	1
ACATTGTCACACTAGCCAGATGGA	1
ACATTGTGAAACGGAGAGAGTAGC	1
ACATTGTGAGGATTGCTATAGTTA	1
ACATTGTGAGTACACTAGGTGAAA	1
ACATTGTGAGTACACTTGGTGGA	1
ACATTGTGAGTGCACTAGATGAA	1
ACATTGTGAGTGTATTGTAAGTGT	1
ACATTGTGAGTGTCTGCGTTGTAC	3
ACATTGTGCGTATGATAGATGGGA	2
ACATTGTGGATGCCCTAATGGTCA	1
ACATTGTGGATGTCCTAAGAGTAG	1
ACATTGTGGATGTCCTACTAGTAG	1
ACATTGTGGGTACACTAGATGAA	3
ACATTGTGGTGCATCTTCAATCTA	1
ACATTGTGGTGGTTTCTAAAACTA	1
ACATTGTGTCGTAGAGTCCGTGCT	1
ACATTGTGTGTGTATGATAGATGA	1
ACATTGTGTTTATAATTGGG	1
ACATTGTTTCACTTGTGCCAC	1
ACATTTAACGGTGTTGTGCTCATA	1
ACATTTAATAGGGGTAAGAC	1
ACATTTAGTGTAGCCTTCTCAAAC	1
ACATTTATAGATTGAGTGGTT	1
ACATTTATATTATTGTGACTTTGT	1
ACATTTCAATGTGTGGACGATGAT	1
ACATTTCCTCTGAGTCTATCTCTC	1
ACATTTCGTACATGGGCCTCAAAT	1
ACATTTCTATCAAAATCCTACGTT	1
ACATTTGATCTGATGTTGGAAGG	1
ACATTTGATGTGATAGGAACTTAA	1
ACATTTGCTAGATTCGTGGTGATA	1
ACATTTGTAGTTGTGCCCAAAACC	1
ACATTTTAACGGTGTCTCTCAGCC	1
ACATTTTAAGGGACTGCACGTGAA	1
ACATTTTACTGGGCCCTTTGATGA	1
ACATTTTAGAATGTGCCATCAATT	1
ACATTTTAGACAATAACATGGCCT	1
ACATTTTAGTGCTATGAATATGAA	1
ACATTTTAGTGGCACAACTGCAGA	3
ACATTTTCAGAAAATCTAAGGGCT	1
ACATTTTCGTAGGCGGCCATTTAG	1
ACATTTTCTAGCGTAAATTTTGGT	2
ACATTTTGAAGAGTGTCTCATAAA	5
ACATTTTGAATGAAACGAATGGTC	1
ACATTTTGAGAGTTTATGGACCTA	1
ACATTTTGCTAAGATGTCTTGCCT	2
ACATTTTTCGGAAGATCTAAGTGA	1
ACATTTTTGGGTCCTCGAACTTGT	1
ACATTTTTGTAGACGGTCATTTGG	1
ACATTTTTTAGTTGGTGTGCACGT	1
ACCAAAAACAAGGAGCCGCCGTAC	1
ACCAAAAACGACATTTAGAGGGAG	1
ACCAAAAATGCAGGGTGACGGAGC	1
ACCAAAAATTTGTGGTACCTCGAG	1
ACCAAAACATCAAGTGCTACTGAG	1
ACCAAAACCACCGCAGATTAGGTC	2
ACCAAAACCACCGCGGATTGGGT	1
ACCAAAACCATCGTCTTCTCAGTA	1
ACCAAAACCGACACAGAGTTGGCC	1
ACCAAAACTGAGAATGAAGCTGGG	2
ACCAAAACTGGAAGTGGAGTTGGG	1
ACCAAAACTGGGAGTGGAGTTGGG	1
ACCAAAAGCAGCCCAGATGGCCCA	1
ACCAAAAGCTGGACTGTTTAAGAG	1
ACCAAAAGGTGTACTGTTTTAGGA	1
ACCAAAAGTGAAGTGGTGAGATGGA	1
ACCAAAAGTGACATGGTGAGGTAA	1
ACCAAAAGTGACATGGTGAGGTAGA	1
ACCAAAAGTGGAGCCAGTAGAAAG	1
ACCAAAAGTGGAGCCAGTAGGAAG	4
ACCAAAATAGGGCCGCAAACAAAG	2
ACCAAAATATATGTACTCAAGTGA	1
ACCAAAATATATGTACTTAAGTGC	1
ACCAAAATATTGGTAGGGTAAAAT	1
ACCAAAATATTGGTAGTGCCAAAC	1
ACCAAAATCCAAAGGAGGTAGCTA	1
ACCAAAATCCAAAGGAGGTAGCTAA	1
ACCAAAATGCATGGTCGCTGA	1
ACCAAAATGCATGGTTGCTAA	5
ACCAAAATTTTAGGGCCTGTTCAC	1
ACCAAAATTTTGGTAGTGCCAAAT	1
ACCAAACAAAACAGTTAATAGCC	1
ACCAAACAAGCCCTCTGTACCTGC	1
ACCAAACACATGCCTAAAAAACTA	1
ACCAAACACATGCCTAACAAACTG	3
ACCAAACAGGCCCTTAGACACAAT	1
ACCAAACAGGGCCTTAGTTTGAC	1
ACCAAACAGGTCCTATGTTAAGTC	2
ACCAAACATCCAATTTTGGCGTGA	1
ACCAAACATGCCTTCAGGAGTTGG	1
ACCAAACATGTGGGTTGCACCGAG	1
ACCAAACCCTACCTAGCTAACTAT	1
ACCAAACCTACTAAAGAAGGGGGA	1
ACCAAACCTTAGGCTTACCACAAA	1
ACCAAACCTTGGGTACATTTTAGC	1
ACCAAACGGGGCCGTACATTCAGC	1
ACCAAACGGGGTCTACACATAGTT	1
ACCAAACTAGGGTCCACATATCAG	1
ACCAAACTAGTACCGGATGTGACA	1
ACCAAACTCGGTGTAAAATTGAGG	1
ACCAAACTTTTAATTTTAGTGTGA	2
ACCAAAGAAAACCTGAAACATGCC	1
ACCAAAGACAGTGGTCAGTCTGGA	1
ACCAAAGATAAGGGTTGTTGCGGG	1
ACCAAAGATGTAAAGGTAATCCTA	2
ACCAAAGATGTTTCAACTAGTGTA	1
ACCAAAGCAATACTTCATATCTG	1
ACCAAAGCCACACCTAGAGTGCCC	1
ACCAAAGCGGTGCCACTAATCCAA	1
ACCAAAGCGGTGTCACTAATCCAA	2
ACCAAAGGATACGCGCAGGTGGTA	1
ACCAAAGGATCTAGATTGAACGGT	1
ACCAAAGGATGGCATAATATAGGC	1
ACCAAAGGGTGTTGGTGATTTGAA	1
ACCAAAGTCTATGATACCTAGGTA	1
ACCAAAGTTTTGTGCCGTGACCAA	1
ACCAAATATACGGGTCCTTTAAC	1
ACCAAATCCAACAGGTGGAGTTGC	1
ACCAAATCTACCAGAGAGGGTGAA	1
ACCAAATCTAGAATCGGATGTGA	1
ACCAAATCTAGAATCGGATGTGAC	1
ACCAAATGATGTGGGTTTGCCA	1
ACCAAATGCAGGGAAATCATTGAT	1
ACCAAATGCCAATGCAAAACGATC	1
ACCAAATGTGATACTTTATGGTA	1
ACCAAATTACTGAACTAGTGC	1
ACCAAATTATACAGGTTCGGGCCG	1
ACCAAATTGGGCCAAAATTTACA	1
ACCAAATTGGGTGGTGTTTAGTT	2
ACCAAATTTACCTACATGACAACG	1
ACCAAATTTGGTCGTTAACAGGTC	1
ACCAAATTTTGATAAAGTTGCTAA	1
ACCAAATTTTGGGATGCTGTTGGT	1
ACCAAATTTTGGTAAAGTTGTCAA	3
ACCAAATTTTGGTAGAGGTTTAAG	1
ACCAACAAAATTTGGTAAGGCCTA	1
ACCAACAATGAGATGGGAAGGTGG	1
ACCAACAGGGACTAAATATGTGGC	1
ACCAACATAGTACTGGATGTGACA	1
ACCAACATCATTGCCATGGGAAGA	1
ACCAACATGGTGTAGGATCGTAAA	2
ACCAACCAGGACTAAAGAGGGGAA	1
ACCAACCAGGACTAAAGATGTTGG	1
ACCAACCAGGTCCGGGTGACATCC	2
ACCAACCAGGTCGTCTAGCCCACC	1
ACCAACCCAGTACTAGATGTGACA	2
ACCAACCCAGTCTTCCGATGTGCT	1
ACCAACCGATACTAAAGATGCC	1
ACCAACCGCGGCGCATGCCGCTGC	1
ACCAACCGGAACTAAAGATGGCAG	1
ACCAACCGGCACTAAAGTGGTGAT	1
ACCAACCGGGACTAAAGATACTTT	1
ACCAACCGGGACTAAAGATAGAGC	2
ACCAACCGGGACTAAAGATCGATC	1
ACCAACCGGGACTAAAGATGGATC	1
ACCAACCGGGACTAAAGATGGCTC	9
ACCAACCGGGACTAAAGATGGGTA	1
ACCAACCGGGACTACAAATAGATC	1
ACCAACCGGGACTTAAAAATGGAT	1
ACCAACCGGGACTTAAAATGGAT	1
ACCAACCGGGAGTAACTAAAGATC	1
ACCAACCGGTAATAAAGATGTCTC	1
ACCAACCGTGACTAAAGTGGTGTA	1
ACCAACCTAATACTGAATGTGACA	1
ACCAACCTAATACTTGATGTTGAC	2
ACCAACCTAGACAGGATGTGTGAC	4
ACCAACCTAGATTGGATGTGACA	1
ACCAACCTAGGACTTCGATGGGAC	1
ACCAACCTAGGTATGGATGGGACA	1
ACCAACCTAGTACCGGATGTGACA	1
ACCAACCTAGTACCGGATGTGACG	1
ACCAACCTAGTATTGGATGTGACA	1
ACCAACCTAGTGGAAGCAGGTGAT	1
ACCAACCTATTACTGGATGTGACA	1
ACCAACCTCCTCCCATGCTCCGCG	2
ACCAACCTCGTACTTGGATGGGAC	1
ACCAACCTCGTATTAGGATGTGAC	3
ACCAACGAGGGTTTATGATGTCGC	1
ACCAACGAGGTGTGCTAACGAGT	3
ACCAACGGAAGGACATACCTTGGC	1
ACCAACGTTGCGATGGTGTTGAAA	1
ACCAACTACTGATTCAGGGATTGG	2
ACCAACTAGAGAGGGGTGAATGGT	1
ACCAACTAGTAATTATTATCTAGA	2
ACCAACTATAGGTGCTGGTTACTA	1
ACCAACTGACAATGATGCTGGGAA	1
ACCAACTGCATGTGCATTACAGCC	1
ACCAACTTCTGTAGATAAACCTGG	1
ACCAACTTTAGGCTGCAACTGCTC	1
ACCAAGAACTTAAGGTGCTGCTGA	2
ACCAAGAAGGGACCAAAAGGTGAG	1
ACCAAGAATGCAAGGGGTCTA	9
ACCAAGAGGACTAGAATTTTGTTGG	1
ACCAAGAGGGTGCCACTCGCTC	1
ACCAAGAGTGGAGCCAATTGGAAC	1
ACCAAGATAGGTGTGTGCATAGGA	1
ACCAAGATCGTGGACCTAAATATG	1
ACCAAGCAATAAGGGTGGGCCCGT	1
ACCAAGCACAAAGATGTGTGACGA	1
ACCAAGGACATTGAGGATGCCAAA	1
ACCAAGGATGCGGATTGGTGCGTC	1
ACCAAGGCCAACCGTAGGACGTAA	1
ACCAAGGGAGGGCCGATGCTTGAA	1
ACCAAGGGGACCCAATTGATTGG	1
ACCAAGGGGCTACCACGTAATGTG	1
ACCAAGGTCCCTATCACCTGCTGC	1
ACCAAGGTGATACAAGACATATGC	1
ACCAAGGTGGACATGATGGAGGAG	1
ACCAAGGTTGAGCCAAGCCCGAGC	1
ACCAAGGTTTGGTACCACGATGGG	1
ACCAAGTACCTCGTATCAATCACA	1
ACCAAGTAGAATGAACAAAGGTCC	2
ACCAAGTATTGGTTGCTGAAGAAC	3
ACCAAGTCTACACCGTCAAGGTCC	1
ACCAAGTGCAAAACTAAGGGCCTG	1
ACCAAGTGGTGAGTGTGAGAATGA	1
ACCAAGTGGTGTGCCGATTCGGTA	1
ACCAAGTGTGTCTCGATTACAGAA	1
ACCAAGTTCTAGATGTGACATATT	2
ACCAAGTTTACGGATCTAGGTGAC	1
ACCAATAAAAGAGAGCCCAAACTG	1
ACCAATAACAAATGGTAGGGCGCC	1
ACCAATAAGTATTAAGATGACTGC	1
ACCAATAATATAGCCTACTACCAG	1
ACCAATAATTCAAAGGTGCTGGT	1
ACCAATAATTCAAAGGTGCTGGTT	1
ACCAATACCTATAGGTGCATTGAT	1
ACCAATACGATACTACCTCCATCCC	1
ACCAATAGAAGTCCTATCATTGTC	1
ACCAATATATTATAGGTGTCGGT	1
ACCAATATGCATGTAACTCAC	1
ACCAATATGGTGGATTGATCAAGA	2
ACCAATATTTTGGTAGTGCCAAAG	2
ACCAATCAGGTGATGGAGGTCGAC	1
ACCAATCATTGGTCCTAATGCATC	1
ACCAATCGAGAAGAAAGCAGGTGA	1
ACCAATCGGGACTTAAAGAGGGTA	2
ACCAATCTCGTATTAAGATGTGAC	1
ACCAATCTTAGATGGGATGGGTCC	1
ACCAATGAAGATCTTTATACAGGA	1
ACCAATGAAGGGTTACCAATTT	1
ACCAATGAAGTCACTAGTGATGTT	1
ACCAATGAGGTGAGGGGCTCCCCC	1
ACCAATGATGCCAAACATTTCGAA	1
ACCAATGGACACTGCACCGATTACC	1
ACCAATGGAGGTTGCGGTGCAAGA	3
ACCAATGGATGTGCGATAGCAGA	1
ACCAATGGCATATAAGGGAAGAGC	3
ACCAATGTGAAAGGGGTGGGGTCA	1
ACCAATGTGACAACTCGGGGTGAA	1
ACCAATGTGTCTACTATTGTTGCC	2
ACCAATTAGGTGAAGAGGTCTCCC	7
ACCAATTCATACAATAGTTGCTTA	1
ACCAATTCTACCTACGAATTTGG	1
ACCAATTTAAGTGAAAACGGATGG	1
ACCAATTTGACCCTACTTTTTCAA	1
ACCACAAAAACGTGCCATGGCTGA	1
ACCACAAACATTGAGGATGCCTTA	1
ACCACAAAGCCTTTTGTCAACAC	1
ACCACAACACGTTGCTCAAGAGAA	1
ACCACAACGCGTGTCTACAACAAC	2
ACCACAACTTGCAAGGTGTGTGCA	1
ACCACAAGAACCGTGAGGTGTTGG	1
ACCACAAGAGGGAGACTACATAGG	1
ACCACAATATACCTTACGATATCC	1
ACCACAATGGAATCAGCCAGACCA	1
ACCACAATGTCAAATCATGGCG	1
ACCACAATGTCAAATCATGGCGCA	1
ACCACAATTTCTTAGGTATGTGTT	1
ACCACACACACGTCTACGGTAAAA	1
ACCACACACACTTTGACACTTGGC	1
ACCACACAGAAATAACTAGGGGGC	1
ACCACACAGGCACATGATATGATG	1
ACCACACGTGCCGTTCCAACAAAT	1
ACCACAGATGGCCCTCCGAATGGA	1
ACCACAGATGGCCTTCCGAGTGGA	1
ACCACAGGGCCCAACATAAAGCAG	2
ACCACAGTGAACATGCCTGCCCAA	1
ACCACATAACTGGCGCCTGTGAAA	1
ACCACATAAGGGGCCGCCTGCGAA	1
ACCACATAAGTAGGTGTTTGGGAG	1
ACCACATAATAGTTGAGGTGCATG	1
ACCACATACTGAATGCCACGTGGG	1
ACCACATAGAAGGTGATACTTGCG	2
ACCACATATCGGTGCCGGTTGGGA	1
ACCACATCCTTGATATGATAGTGCT	1
ACCACATGAGGGCGTCTTTGTTGG	1
ACCACATGCACTGTGGAGGGTGTT	1
ACCACATGGAAAATCTACGTAGCC	2
ACCACATGGGCCCAACAACCTAAC	1
ACCACATGGTGTATATAATGGATA	3
ACCACATGTCAGGACGCCACGCCA	1
ACCACATGTGATCGGATGGGGTGG	1
ACCACATGTGCTAGTATGGGATAG	1
ACCACATGTGGCCGGTCTGACCGC	1
ACCACATGTTGCCACACTTTGCCA	1
ACCACATTAGTGCCGGTTGGGAAC	1
ACCACATTGGTTGTGGAAGGGCA	2
ACCACCAAAGAATCTCGGGTGACC	2
ACCACCAAAGGGCCTACTGTGACC	1
ACCACCACAAGTAGAGAATCCCAA	1
ACCACCACGATGATTGAGGCGCA	1
ACCACCACGGATTGAATTGAGGC	1
ACCACCACGGATTGGGTCGAGGG	2
ACCACCACGTAGGTGTCATGGCAG	3
ACCACCACGTAGGTGTCATGGCAGC	3
ACCACCACTACTTTCTTTTAAAGG	1
ACCACCACTAGAGTGTTTTTGAAG	3
ACCACCACTGGTATGGAGGCCTA	1
ACCACCAGGACACTACTAGTAGGA	1
ACCACCAGGTCCTCCATAGTAAAA	1
ACCACCATGACGATGGAGAAGTCC	1
ACCACCCTCTAGATCCGCCACTGC	1
ACCACCGAAGAAGATGGAGAGCGC	1
ACCACCGAAGGACCTAAAGTGAAC	2
ACCACCGAAGGACCTATTGTGACC	1
ACCACCGAAGGACCTATTTATGAC	1
ACCACCGAGGGACCTATTGTAACC	1
ACCACCGAGGGACCTATTGTGACC	3
ACCACCGGATGTGCCACGACTTG	1
ACCACCGGTAAACTCTGAATGCTA	1
ACCACCGGTGTTCCATAAATCGAA	1
ACCACCGTACTCAGCAAGCCACAC	1
ACCACCTAAGAACCTCGGGTGACC	1
ACCACCTAGGAACCTAAAGTGAAC	1
ACCACCTGAGATGAAGACCCGGT	2
ACCACCTTAGTAGGCCTAGTCACA	4
ACCACCTTGCTTATTCTAGGAGAG	1
ACCACCTTGTAGAGATAGCTGGAA	3
ACCACCTTTGGGACTGCCACCAGT	1
ACCACGAAAGTGAAGTTTTGGGGG	1
ACCACGAACTTTAAATACCGGAC	1
ACCACGAAGAGAGGGTGTGGTGG	2
ACCACGAAGAGAGGGTGTGGTGGT	2
ACCACGAAGTACACACACATCAGG	1
ACCACGACGAGCATGATGGCGTA	1
ACCACGACTTTAGGTTATGGGTTTA	1
ACCACGAGCTACTTTTTTGTTGGA	1
ACCACGAGGTAATATGAGGTACGA	1
ACCACGATAGTTGCACTGATGAGC	2
ACCACGATATCGGTACTAGTCCCA	1
ACCACGATGACAATGCCGACAACG	1
ACCACGATGTCGCCGAACTGCCGC	1
ACCACGCAATCTGCGCGAGCCACC	1
ACCACGCCAACCTGAATCTGTCAC	1
ACCACGCCTAAACTACCAGATACT	1
ACCACGCGTGGGAGAGGTGTCGGG	1
ACCACGGAAAAGGCAGAGAAATAGA	1
ACCACGGAAAGAAAATAAATGCCA	1
ACCACGGATGGGAGGCTGAGTCGG	1
ACCACGGGAAGGGTATTGGGTAAC	1
ACCACGGTGCTTCGCTGTCGATGG	1
ACCACGGTGGCACGAGGACAGCGC	1
ACCACGGTTACCGGCGGTTCTGCA	1
ACCACGTAATGTGATAGACAGTG	2
ACCACGTAGGATCCTAGAGGGGA	1
ACCACGTAGGTGTCATGGCAGCAA	3
ACCACGTCGGTGTGTTAAGGTTTC	1
ACCACGTGGGGTCACATACTAAGC	1
ACCACGTGGGTGATGACATGGCAC	1
ACCACGTGTATGCCACGTAGGAGC	1
ACCACGTGTGCATACACATACCCA	1
ACCACGTGTGGCCTGCTGTAGTAG	1
ACCACGTTCGCTGTGGGAGGCTAG	1
ACCACTACTGCTGGTAAGGGT	1
ACCACTCAACCGTACGTGTAGTGA	1
ACCACTGAAAATTGGTCGGTTCCT	2
ACCACTGAAAGTTGCTGGTGCACT	1
ACCACTGAAGGACCTATTATGACC	1
ACCACTGAATATGGTAAGGGTGT	1
ACCACTGAGGACGTGCGCGGTGCG	1
ACCACTGAGGGACCTGCTTTGCACC	1
ACCACTGGAGCCACATATCATATA	1
ACCACTGTGACGGAAAAGGGGGAA	3
ACCACTGTGACTGGTGAGATTGAT	2
ACCACTTAAGAGGTCCGCCT	1
ACCACTTACGAGGACTTGATTGGT	1
ACCACTTCAATGGTATGTCTACATA	1
ACCACTTCAATGGTATGTCTACATG	1
ACCACTTCCAAGTAGCCATGTTA	1
ACCACTTGGGTTTGAGGTTCTGAC	1
ACCACTTTCAACTGAGCCCAACCC	1
ACCAGAAACGGTGGTGGAGAA	2
ACCAGAAACGTTGGTGCTAAGGTC	3
ACCAGAAATGTATGAAGTAGC	1
ACCAGAACCTAAGGTGCTCCTGAG	1
ACCAGAACTTCCGGTAGCCTCCA	1
ACCAGAAGATCGGGCCACGAGAGA	1
ACCAGAAGTGGAGCCAGTAGGAAG	1
ACCAGACACAATACTGCTGAGGGA	1
ACCAGACAGGGTGTTGTTGTTGAG	1
ACCAGACAGTGGTGGCCGGTCAGA	1
ACCAGACCCAAATGTCCAGGC	1
ACCAGACCTAGGACCTAGCCTGGC	1
ACCAGACGACTGGGTGTGTGCGG	1
ACCAGACTGGGTCAACGGTTGAAC	1
ACCAGAGAAGGGTGAATGGTTGG	1
ACCAGAGAGGAATGGGAGGTGTTC	1
ACCAGAGAGGCCGTGGTAGGAGGA	1
ACCAGAGAGGTGCGGGTTTAATGT	1
ACCAGAGATTTTGGGTGAATGTGA	2
ACCAGAGCCAACGTAACCTCAGGG	1
ACCAGAGCCAGTGTATTGACCTAA	1
ACCAGAGCCAGTGTGTTGCCCTGA	1
ACCAGAGTCCATGAAAGGTGTACA	1
ACCAGATAGGTGTGAGAATAACAAG	1
ACCAGATATACATGGTCCCTTACC	3
ACCAGATATGCGGAGTCCCTTAAC	1
ACCAGATATGCGGGGTCCCTCAAC	1
ACCAGATATTAATAGTATAGTAA	1
ACCAGATATTCGGTGTTTCTTAAC	1
ACCAGATCCATTCAAGGTGCTG	1
ACCAGATCTGGTGTCGACGGGCCT	1
ACCAGATGTCGGAAGGGCTTTTC	2
ACCAGATGTGATGTACCATAGTAC	3
ACCAGATGTGCAATATGAAACGAT	1
ACCAGATTATGGTCTGTAGGGCAC	1
ACCAGATTGGTGCTTCGACGTCAT	1
ACCAGATTGTAGGTGTTGACGTTT	1
ACCAGATTTGCAGCGAGTGCCAGA	1
ACCAGCAAATGGGGCAACAATGAT	1
ACCAGCAACACTTCTAGTGGCAGA	1
ACCAGCAACGGTCGAGGGGTT	1
ACCAGCAAGAATTGAGTCGATGCC	3
ACCAGCACTAACTGGTTCCAGGCA	1
ACCAGCAGAGCCTGCGGCGCTACC	2
ACCAGCCAAGCGCACCATGCCT	4
ACCAGCCAAGTTCTTGTACCGTGG	1
ACCAGCCACCTATACTGTTTTGGG	3
ACCAGCCACGTAGGCGTCACATCA	1
ACCAGCCAGGCTGAGTAAGGATGC	1
ACCAGCCATGTAGGCGCCACGTCA	1
ACCAGCCATTGGGCTGGGCGCCCC	1
ACCAGCCGGGACTAAAGATAGTGA	2
ACCAGCCGGGTACACAAACGACA	1
ACCAGCCTAGAATTGGATGTGACA	1
ACCAGCCTATCCGACGGGCCACTT	2
ACCAGCGACAACAACTTCGCATGC	1
ACCAGCGACTATGGTTTGTGTGCA	1
ACCAGCGATTATAATGGTAGTGAC	1
ACCAGCGGCCTCAAGGCGATTGGA	1
ACCAGCTAATTAAGCTGCTGCTGC	1
ACCAGCTACAAGCCTACTTTATGG	1
ACCAGCTACGGTGATTTTTAGTGA	1
ACCAGCTAGGTGATCCGGGTGCA	1
ACCAGCTATAACCACACATCGAGA	1
ACCAGCTGATACCTATAGGTGCTA	1
ACCAGCTGCATGGTACCCGATACC	1
ACCAGCTGCATGGTGTATGGTACC	5
ACCAGGAAACGGGAACCCGGGTCAG	1
ACCAGGAAGATGGTGAGGACAAGG	2
ACCAGGAAGTTATAGCCGCGGTTG	1
ACCAGGAAGTTTAAAGAAAGTTGG	1
ACCAGGACTAAAGAATATGGTCCC	1
ACCAGGACTAAAGATATTGGGGG	1
ACCAGGACTAAAGATGGTAGCGCC	1
ACCAGGACTGACCTCCAGATGGAC	1
ACCAGGAGGGCATTGTAAAGGG	1
ACCAGGCAACTATACTGACTTGGG	1
ACCAGGCCGAAGTGAGTGCAGATG	2
ACCAGGCCTCTATGTACCGGACTA	1
ACCAGGCCTGGTACCTAGCAGTAA	1
ACCAGGCGTGCTGCGGATGGGCCA	1
ACCAGGCGTGGAGCCTGCGGCTTAA	1
ACCAGGGCTAAAGATCACCGGGAT	1
ACCAGGGGTCCAATACATACTAAT	1
ACCAGGGGTGGTTTAGATTGATG	1
ACCAGGGTTTACGTTACCGCCGGTA	1
ACCAGGGTTTCCCAAACCGTCGGG	1
ACCAGGTAACATGTATCACAGGT	1
ACCAGGTAGCTAGGGGTGGTGGCG	1
ACCAGGTCTCTATACTGCCTTGGG	2
ACCAGGTCTGATACTTATGGGTACCA	1
ACCAGGTGTCAAATCTGATACTGG	1
ACCAGGTTATATGCGAGATTGAGG	2
ACCAGGTTGACCTGCCTACGTGAC	2
ACCAGGTTGCTTGGGGCCTTGAAT	1
ACCAGGTTTCTATATTATGGGA	1
ACCAGTACAATATTTGAGGTAGCC	1
ACCAGTACACTACATATGTTGGTC	1
ACCAGTAGTAATAAAAGGTGACCA	1
ACCAGTCACAATAGGTCCTTCGGC	1
ACCAGTCAGAATTGGGGGGTGTCA	1
ACCAGTCAGTGTGAGTAACAGGT	2
ACCAGTCAGTTAACAGCCGACCGC	1
ACCAGTCATGCACAGCGATGGTC	1
ACCAGTCCAACCGCCTGCGTGCCA	1
ACCAGTCGGCAACAGTCAGGTCAGC	1
ACCAGTCTATCTACGGTAATGGG	1
ACCAGTGAGCAGAGCCGGCGTGGT	3
ACCAGTGATATATGTGCTATTCCC	1
ACCAGTGCTTTAAAGTCCAGGTT	1
ACCAGTGGCTGTAATGGTAGTGAC	2
ACCAGTGGGGGCTCAATATGTGCC	2
ACCAGTGTTATTGGCGGGCGAGA	1
ACCAGTTGGGCAAGGTGGTGTTGT	1
ACCAGTTGTCGACATGTTGGTGAA	1
ACCAGTTTATGAAGCGTACGTGCG	1
ACCAGTTTTAATAGTTGAGGGACT	1
ACCAGTTTTAGGAGTTTGGGGGTC	1
ACCATAAAGTGTCTCATCCGGTCC	3
ACCATAAGCAAAATACTTCTCGGG	1
ACCATAAGGACTTGTACTTTTGTG	1
ACCATAAGGTGCCATATATGTATA	1
ACCATAAGTGGAGCCAGTAGGAAG	1
ACCATAATAGGTGTGGAATCAATC	1
ACCATAATAGGTTGCTACATTATA	2
ACCATAGAGGCCTAGTATATTATG	1
ACCATAGATATTGAGTGTACTAGTA	1
ACCATAGATGTCTAATACGGCTGC	1
ACCATAGCAAATGCGGTGTTTGGA	1
ACCATAGCCGACCGGCTAGCCGCT	1
ACCATAGCTGGACCAGCCGACCCA	1
ACCATAGGACCTTGAGTGCACAG	1
ACCATAGGTCCTGGGTTTGACTCC	1
ACCATAGGTTCTGGTTGTTGTGGA	1
ACCATAGTGCCAGTTAGGAACCCC	1
ACCATATACACGACAGCTGTGATC	1
ACCATATATAAAGTGCAGTATAAA	1
ACCATATATAATATCTGATGTGAC	1
ACCATATATAGTTAGAAGGAGGGC	1
ACCATATCATTGTCTAAACGTCAA	1
ACCATATCGGGTTTAACCATGCCT	1
ACCATATGCCAACCGTGCTAG	1
ACCATATGGTAATAACTCAAGTGC	1
ACCATATGTAGATGTTAGGGGGAC	1
ACCATATGTTATTGAGATGGTGAG	1
ACCATATTATGGATTTGGGTCGAC	1
ACCATATTGCTAAATCAGGCGCAA	1
ACCATCAAGGGTAACTACATTAGT	2
ACCATCAAGTACACAAGCAGCAGC	1
ACCATCACCTTGATGCCGGTGT	1
ACCATCATCTAGTGCCCCGGGCCC	1
ACCATCATGAGCCTATATTACATC	1
ACCATCATGGCATGCTACATCAAC	1
ACCATCCCAAGTAACTGGCGGTAC	2
ACCATCCCCAATAGTGCCATCAAG	1
ACCATCCTACTACCATATGGAACC	1
ACCATCCTAGTTATTGGGTTGGGA	2
ACCATCCTTCGGAGCTTTAAGATC	1
ACCATCGGAGCGCGATAACCCTGG	2
ACCATCGTTGCCGATGTAGGTGAA	1
ACCATCTTAGTGCTAATCACTC	1
ACCATCTTATGGAGCTAGCCGGAA	3
ACCATCTTTTTCCTTAACACACC	2
ACCATGACAGGAAAACGTGTGCGT	1
ACCATGAGGTACCAAATTTAGAGC	2
ACCATGAGGTACCAAATTTTACAC	1
ACCATGAGGTACCAATATAATCTA	1
ACCATGAGTGCATGATTTTAGGAG	2
ACCATGCATTTCGCTAGGAGGTGG	1
ACCATGCCAAAGGTGATTGAGGA	1
ACCATGCCACACTTTTAGAGTCAC	1
ACCATGCCATACAAATTTTGCAAA	1
ACCATGCCCCAAGTACCGCCACGA	1
ACCATGCCGTGTGGGTATGCGGTA	1
ACCATGCCTAGCGAGGAAGGGGGA	1
ACCATGCCTATGCATGAGGGTAGC	2
ACCATGCCTGCGCAATTGCGACAC	1
ACCATGGAGCAACGATAATTCAAT	1
ACCATGGATGCAAACAATGGT	1
ACCATGGATTGGGAGTGCACTCAG	1
ACCATGGCACCAAGAGAAAATGGT	1
ACCATGGCGCACGCGAACCGACGT	2
ACCATGGCTGTTTACATTGCA	1
ACCATGGGTGTTCACTGCAATGCT	1
ACCATGGTATCTAGGTGTATGCATG	1
ACCATGGTGCCCCATATGAGTGTC	4
ACCATGGTGCGACCGTCTAATCTG	1
ACCATGGTGGCAGCAGTATTGCGG	1
ACCATGGTGTCTTTGAAGGTAGAG	2
ACCATGGTGTTGCCTACGTGGCAC	4
ACCATGTACTCCTTTTGTCTCCAG	1
ACCATGTACTTACCGTCATAGGA	1
ACCATGTAGTGTGATGAGCGTTCC	3
ACCATGTATGTGCCTATAATCGCC	2
ACCATGTCTCACGCAAGAACCGG	1
ACCATGTGAACAATGTTCTGTGCTA	1
ACCATGTGACGGAAAATTTGGAA	1
ACCATGTGCATCTACAATCTCCCC	1
ACCATGTGGTCAATCTGCTGA	1
ACCATGTGTGCACTGCGAACCGAT	1
ACCATGTGTTCTATGGTATTGGTA	1
ACCATGTTATGGTAGGTAAGGTAC	1
ACCATGTTGACGACATATGTGTTA	1
ACCATGTTGGATAGTACAGGAAG	1
ACCATGTTGGCATGCCACGTAGG	1
ACCATGTTTTGGTGCTTTTTGAAC	1
ACCATTAAGGTGGTGTTTGGATTC	1
ACCATTACAGGTTATCTTCATGTC	1
ACCATTACGGGTGCTCTAACACAT	1
ACCATTAGGAGCGCCACGTGGTCC	1
ACCATTAGGTCCAAAACAACATCA	1
ACCATTATAAATACACTAGGTGAA	1
ACCATTCATACCAGACATATAACC	1
ACCATTCGCTTTAGGTCCTTTGGT	1
ACCATTCTAGGTGGAGGATTTGGG	2
ACCATTGAATCTCAATAGAGTGAC	1
ACCATTGACACGTGTGCCATCTAC	2
ACCATTGACTAAGGCTGACCTCAA	1
ACCATTGAGGACCTAAGGGTGTGTT	1
ACCATTGATTGTTGTTTGCCC	2
ACCATTGCGGATGCTCTTACATGT	1
ACCATTGCGGGTGCTCTAAGGAAG	3
ACCATTGCGGGTGCTCTTAATCTC	1
ACCATTGCGGGTGCTCTTAGCTAG	1
ACCATTGGTGGCTTAGATAATATA	1
ACCATTGTCTCAAGCCTACGACAT	1
ACCATTGTGAGAGGTGGCATTAGG	1
ACCATTGTGGGTGCCCTAACTGA	1
ACCATTGTGGGTGCCCTAATCTT	1
ACCATTGTGGGTGCTCTTATGCAA	2
ACCATTTAGGGCCCATTTTGTGAA	1
ACCATTTCAGCTGTGTTGCCTA	1
ACCATTTCGGGGTCCTACATGTCGT	1
ACCATTTGGATGCCGCCTATGAGG	1
ACCATTTGTAGTGCCGGTTGGGAA	2
ACCATTTTCGCAGACGTGAGGTC	1
ACCATTTTTTACTCTAGGTTGCCA	1
ACCCAAAAAGGTGGAGTGGGGTCC	1
ACCCAAAACCTACACCACAGCCT	1
ACCCAAAACGGACAGCCTGGTGAA	2
ACCCAAAACTCTCTATGAAGTGAC	3
ACCCAAAATTTTTCACTATGTCAC	2
ACCCAAACCCAAGAAAGCTAAGAC	1
ACCCAAAGCAATCAGCTAGACTGG	1
ACCCAAAGGTGGTAAATCTGTTGC	1
ACCCAAAGTTTATAAGGTTGCCA	1
ACCCAAATGTCTGTCTGGGAGGTCC	1
ACCCAACAGGTCAACATATACTGG	2
ACCCAACAGTGAGGGCCTTTTGAT	1
ACCCAACATTGAGGTTGCCCTAAT	1
ACCCAACCCTTACAACCAACACAA	1
ACCCAACCTAGAAAGAGATGTAAG	1
ACCCAACCTAGGAGAGAATGTGAC	2
ACCCAACCTAGGAGAGAATGTGACC	1
ACCCAACCTAGGATATGATGTGAC	3
ACCCAACCTAGGATGTGATGTGAC	2
ACCCAACCTGATATTAGATGTGAC	1
ACCCAACCTGTGGTGTCGGTGTGT	1
ACCCAACCTTTGGTGTTGAGATGG	1
ACCCAACGAGGATGCCATGGTGTT	1
ACCCAACGTAAAAGGTAATGTGACC	1
ACCCAAGAGCTGGTAGGTGCTATA	1
ACCCAAGATACCGGGTGGTACCTA	2
ACCCAAGCCTCGATCACTAGGGTA	1
ACCCAAGGTACCGGGTATCAGGAG	1
ACCCAATAATTAAGATGATGTCCA	1
ACCCAATAATTCGGGTGGTTGTTG	2
ACCCAATCCACGGTGGTTTTGGTC	2
ACCCAATGACTACGATGGTGTCCA	1
ACCCAATGACTAGAATGGTGTCTA	3
ACCCAATGACTAGGATGATGTCTA	1
ACCCAATTCCAAGGTCGCCATCTA	1
ACCCACAATGGTAAAGTAAGGTGCT	1
ACCCACACGATACCTACAGCTGGC	1
ACCCACACTAGGAATGATATTGG	2
ACCCACAGTTATGATGGACGGTA	1
ACCCACATAGTACTGCTAGGTGAC	1
ACCCACATCAACACTGCCACCGGT	2
ACCCACATGTGCTAATGACGAA	1
ACCCACCTACCAAGTTGATGCACC	2
ACCCACCTACCAAGTTGATGTACC	1
ACCCACCTACGTACTGTGGAGGAC	2
ACCCACCTGTCAAGTTGATGTACC	1
ACCCACGAAGAAAACGATGTGCAA	3
ACCCACGCCGTAATATATACAGGG	1
ACCCACGCGAAATCAACGGCCAGA	1
ACCCACGGGTATAAAATGGAGAAC	6
ACCCACGTGACATACCAACATGGT	1
ACCCACGTGTCAGGTACCACGTCA	1
ACCCACGTGTGCCAATATATGCCA	1
ACCCACGTTTCGCAGCCATCGCCC	1
ACCCACTTACAGGTGATTGGAA	1
ACCCACTTGAGCCCGATTGCT	1
ACCCACTTTTTGAGGATGGCACAA	2
ACCCAGCCTATACATCCAACCGGA	1
ACCCAGCCTTACAGTAAACATGGT	1
ACCCAGCGTGTTGCTACGGGAGA	1
ACCCAGCTGCTAGATGGTGTAAGG	1
ACCCAGCTTTTGATTTGATGTCCA	2
ACCCAGGAGTGATATGATTGGAAA	1
ACCCAGGGCGACGATGATGTTCG	1
ACCCAGGGTTTGCCTTTTTTTGAG	1
ACCCAGGTACCTTATACCTAGAGA	1
ACCCAGGTATTGAAAAGGAGGGAG	1
ACCCAGGTCGGGTTGCCAGTTC	1
ACCCAGGTTGTCTAGCCCACCACC	1
ACCCAGTAAAAAGGGGCCGTGCCT	1
ACCCAGTCAGACTATACATGCCGT	2
ACCCAGTTTGTCATCTAAATGGTT	4
ACCCAGTTTTACGATTGAAGTGCA	1
ACCCATAAACATATGAGTTGCCTA	2
ACCCATAATCTCCACGTACCGCGC	2
ACCCATACGAGGAAGGTGTCTTAG	2
ACCCATAGGTGTCGGCCATAAAGG	1
ACCCATATCCACCACTAGGCTTC	1
ACCCATATGGCCAAGAGTAGGC	1
ACCCATCACATCGAATGTTTGGAC	1
ACCCATCTAAAGATGCCTAGACCC	1
ACCCATCTTCGTTTAAAGGTGTCA	1
ACCCATGACATGGTTGCCCCAAA	1
ACCCATGCGATTCTACAGCTGCTA	1
ACCCATGGGTACTAAATAGAGAAC	2
ACCCATGGGTCTACTAACGGGTAA	1
ACCCATGGGTCTACTGACGGGCGA	1
ACCCATGGTGGCGAGGAGATGGCC	1
ACCCATGGTGTCCATAAGTAGTGT	1
ACCCATGGTTCTAAGGTTGGTGGT	1
ACCCATGTGGTCTTGATCGATGTC	1
ACCCATTACTACATGACGGGTAAG	1
ACCCATTCGATGTGTCTAGTTACT	1
ACCCATTTACGCAGGCGGTCCTT	1
ACCCATTTTTCAGGGTGTTTGGTTT	1
ACCCCAAAAGCTAGCCAATGAGGT	2
ACCCCAAAAGCTAGCCATTGAGGT	1
ACCCCAAAAGGTAGCCATTGAGGT	1
ACCCCAAAAGGTAGCTAATGAGGT	1
ACCCCAACCTAGCTCGCCTTTGAT	1
ACCCCAAGAAGACAACCGCAA	1
ACCCCACATAGGTGTCGGTTGGAG	1
ACCCCACCCTCGATGTTTTTGTAA	1
ACCCCACCCTGTCAACGCTCCTAC	1
ACCCCACGAGTATGTAGGTGGCGA	1
ACCCCAGTTGAGCTGCCTGTGGGA	5
ACCCCATAAACTACGAAACCGGAC	3
ACCCCATGAGCAATGGACAGGTGG	1
ACCCCCACTTTTTAGGGCTTGC	1
ACCCCCATCAGCAAGCAGCTTCGA	1
ACCCCCATCGGTGCCGGATTTCCC	1
ACCCCCATTGTGACTGGCCTTAGT	1
ACCCCCCTCGATGTTGCTCCAGCT	1
ACCCCCGTCATCCCCAATGGTGCT	1
ACCCCCTAAACTATCGAGGTTGAC	1
ACCCCCTAAGTCGTGCTAAC	2
ACCCCCTAATCAATCCGGAGTGGT	1
ACCCCCTATAGGTGTCCATATATC	1
ACCCCCTCTAGGATCTACTTCATC	1
ACCCCGATACAGCAAATGAACATG	1
ACCCCGATGGCGGATGGTGACAGC	1
ACCCCGATTTTGGTCTAGGTGGC	1
ACCCCGCATATCTGGTTTTGTGGT	1
ACCCCGCGAGGTGCACCCGGTCCA	1
ACCCCGGCCCAAAATATATAA	1
ACCCCGGTGAAGGGGAGGAGCCTG	1
ACCCCGGTGACTATTTATCGTGGC	1
ACCCCGGTTTTAGTCTACGTGGT	1
ACCCCGTTGTTGGCTACGTGATGG	2
ACCCCTAAGGAAGCGCTTTATGAG	1
ACCCCTACAAGTTTAAGAACCGCC	1
ACCCCTACAGTATGGAGAGGTTGC	1
ACCCCTACGTAAGGGTAAGTGCGC	1
ACCCCTACGTCGTCTACCACTGAA	2
ACCCCTACTACCTTTTAATCCGGC	1
ACCCCTAGTAGAGAGTGGTAAGAC	2
ACCCCTATAGCTATAGATTGGTCC	1
ACCCCTATAGGTGCCGGTTGGGA	1
ACCCCTATCTCAATGACATGTGGG	2
ACCCCTATGAAGACCTCCGAAAGA	1
ACCCCTATTAAATGTGCATGACAC	2
ACCCCTATTTAAGGGACAAGGCCG	1
ACCCCTATTTAAGGGACAAGGTC	1
ACCCCTCGATAACGAGACGCCTGT	1
ACCCCTCGTCTCTCTTCAGCCGCC	1
ACCCCTGAAGTATTGGGCCTGGTC	1
ACCCCTGAATTTTACTTGGTCCC	1
ACCCCTGAATTTTACTTGGTCCCC	1
ACCCCTGCTATAGCTGTTTGAGAA	1
ACCCCTTAATGTTTTTCGTGCTGC	3
ACCCCTTAGGCCCAAGCACTTGAA	1
ACCCCTTCTCGTGCCGCTAGATCC	1
ACCCCTTCTGTTCGGAGCGGATA	1
ACCCCTTGATGGTGAGGTGTACGC	1
ACCCCTTTGTAACCATATGTGCAC	1
ACCCGAAAGATGGTGAACTATGCC	2
ACCCGAAATGGTAAAGTAAGGTAC	1
ACCCGAAGACACTTTTGGACCTGC	1
ACCCGACAACTCAGGGGCCCGAAC	1
ACCCGACGAGAGCTGCACGTGAAG	1
ACCCGACGTATGATGTACTTTCTC	1
ACCCGAGCCTGTGAGGAAGAGGGG	1
ACCCGAGGACCAAGAGTGAATGGT	1
ACCCGATACTGAGTGAGACTGG	1
ACCCGATAGTGATGAGGCTTTCAG	1
ACCCGATCTGATGGGCACGGACAT	1
ACCCGATGATGAGTGAGGCTGAC	1
ACCCGATGTGGCCTGTGGAAGAGG	1
ACCCGCAAACCCTAACCTAGCCGC	1
ACCCGCAATAATAAAATAAGGTGT	1
ACCCGCAATGGTAAAGTAAGATGC	4
ACCCGCAATGGTAAAGTAAGGTAC	2
ACCCGCAATGGTAAAGTAAGGTGA	2
ACCCGCAATGGTAAAGTAAGGTGCT	2
ACCCGCAATGGTAAAGTAAGGTGT	3
ACCCGCATCTCATTAACCTTTGGA	1
ACCCGCCTACCCGTGCAGATCTCA	1
ACCCGCCTGTGCAAATACCTTAGC	1
ACCCGCGACGTGAAGAGGATGGAC	1
ACCCGCGATCTGACCGGTCTGTGA	1
ACCCGCGATGGGTGTGAGTATGGG	1
ACCCGCGGTGTCTGGACAAAGGTC	1
ACCCGCGTGCTCTCAACTGTTGAG	1
ACCCGCTCCGTGAGATGACGTGGC	1
ACCCGCTGAGTACTTCTAAAC	1
ACCCGCTGCCGATCGCCCTTTTCC	1
ACCCGGAACCTCCTGGTGGTGAAC	1
ACCCGGACCGTTGGACTACACAAG	1
ACCCGGCACGATACGTTGGCGACC	1
ACCCGGCCTCTACATCCAACCGGA	3
ACCCGGCGATTACACTGTTAGACC	1
ACCCGGGACTAAAGGGGGTTGTAA	2
ACCCGGGACTAAAGGGGTTGCAA	1
ACCCGGGACTACCTAGATTTGGAC	1
ACCCGGGAGCGGTTACGATGGTA	1
ACCCGGGGATACCATGGTTGGAGC	1
ACCCGGTACCTGGTATAGCATGGT	2
ACCCGGTACCTGTGATACCTAGGA	1
ACCCGGTCTTGGCCGAGCTGGCGC	1
ACCCGGTGAGAGCTGTACGTGAAG	1
ACCCGGTGGGAATTATCCTGA	1
ACCCGGTTGTCGATGGGTATGCCA	1
ACCCGGTTGTTGCCCATGATGCCTA	1
ACCCGGTTTTATGGTTGGTGGTCA	2
ACCCGGTTTTGCGGTCAAGGGAC	1
ACCCGGTTTTGCGGTTCAGGGATG	1
ACCCGGTTTTGCGGTTGAGGGATG	1
ACCCGTAATGGTAAAGTAAGGTAC	1
ACCCGTATGTGGGAGGTGCATCGA	3
ACCCGTATTAATGGTGACCTGAGC	1
ACCCGTCCTGCCTGTACAGGTGTG	1
ACCCGTCGACAGTGAGGTGTCTAT	1
ACCCGTGCCCATGAGATTATTTGT	1
ACCCGTGGTGTAAGAAAAACCGGA	1
ACCCGTGTACTATTTTGGATGGAT	1
ACCCGTGTCTAACTTTGATCGTCC	1
ACCCGTTGACAGCGAGGTGTTTGT	1
ACCCGTTTCTTGCATGCCACCTAA	1
ACCCGTTTGCTTCACGGCCTGCCT	1
ACCCGTTTGGACCTACATGACACC	2
ACCCGTTTGTCCGTTTACCCGTGG	1
ACCCGTTTTGATTACCCAGGTGTA	1
ACCCTAAAATCAAGGATGGTTCCA	1
ACCCTAAACTATTGAAACCGGA	1
ACCCTAAATTTCGATGTGCTTCAA	2
ACCCTAAGAAAATACCGGTGCAAA	1
ACCCTAATGTGTCTATGATATATA	1
ACCCTACAAACACTCCTACACCGC	1
ACCCTACAAACACTCCTATGCCGC	1
ACCCTACAAACGTTCCTAAGCCAC	1
ACCCTACAATAAAATTTAACACC	1
ACCCTACATAATATCTGATGTGAC	1
ACCCTACATCCTGTTGGCCGAAGC	1
ACCCTACATCTGTGACGGCACACC	3
ACCCTACATCTGTGACGGCACACCA	1
ACCCTACATGTTTAAGGACTGCTA	1
ACCCTACATTGAGGTCACTTTGCA	1
ACCCTACCGCTGGAAACCCCTACC	1
ACCCTACCTAGGTGTGTCCTAGCA	3
ACCCTACGCGTGAGTGCCA	1
ACCCTACGGTGACAAGGGCAGAGT	1
ACCCTACGTAATATCCGATGTGAC	3
ACCCTACTAAAGTTTTGGTAGCCC	1
ACCCTACTAGGATGATCGATGAAC	1
ACCCTACTCCTGTGTTCTGGTGGA	5
ACCCTACTCCTGTGTTTTGGTGGA	2
ACCCTACTCTGTGCTCTGCCGAA	1
ACCCTACTGAGGGCGCTGTTGAG	1
ACCCTACTGATGACCGTGCCG	1
ACCCTACTGATGACCGTGCCGCGA	1
ACCCTACTGATGGAGTTTCTGTCT	1
ACCCTAGCTGATAGATTGTGGACC	1
ACCCTAGGTGTAATACAATTGAAA	1
ACCCTAGGTGTGGGTTGAGGGAAA	2
ACCCTAGTGAGTTAAACCCGTGGG	1
ACCCTAGTGATCGAGGCTTTGGTA	1
ACCCTAGTTAAGGGCAAGTGCTA	1
ACCCTATAAAATATCCGATGTGAC	1
ACCCTATACGAACAACCTATACGA	1
ACCCTATAGGAGAAACCTCTCGGT	1
ACCCTATATAATAACCGATGTGAC	6
ACCCTATATAATACCCGATGTGAC	2
ACCCTATATAATACCTGATGTGAC	2
ACCCTATATAATATCCGATGTGAC	6
ACCCTATATAATATCCGATGTGGC	1
ACCCTATATAATATCGATGTGACA	2
ACCCTATATAATATCTGATGTGAC	1
ACCCTATATAATATTCAATGTGAC	1
ACCCTATATTTTGAAACGGAGGGA	1
ACCCTATCGAACCTGTCGAACTGC	1
ACCCTATGTAATAATTGATGTGAC	4
ACCCTCATGGTAAAGACGGTAACC	2
ACCCTCATGTGTCTATTAACGATC	1
ACCCTCCACCTAGGATAGTGTCTA	2
ACCCTCCACCTAGTATGGTGTCTA	8
ACCCTCGAAATCGATGGAGA	1
ACCCTCGACTACGATCTCGTCGGT	1
ACCCTCGATCTAATCTGCGGTGGT	1
ACCCTCGCAACTGTCTGCCACCAC	1
ACCCTCGGAATACTCTAAGGTGAA	2
ACCCTCTAATTGGATGCCTGACCA	1
ACCCTCTATATTCGGTGTACGGGT	1
ACCCTCTCCAATCAGCTACATCCG	2
ACCCTCTGTCCAGCCTAAGCCCGA	1
ACCCTCTGTTGCCCGACTTACTAC	1
ACCCTGAACAGCAGGAATCGCCTC	1
ACCCTGCACGATACATTGACGACC	1
ACCCTGCCACTGCGTTAAACACGT	1
ACCCTGCCTAATGGGTAGATCTGCC	2
ACCCTGCCTAGAACCGGTCAGACC	1
ACCCTGCGAAGGCAATATGGTCAC	1
ACCCTGCGATTCAAATGGGCCCTCA	1
ACCCTGCTCGTAGAGAATGAGAGG	2
ACCCTGCTCTACGTTGTCTGTGGT	1
ACCCTGGAGGAGACGGTGAGACGC	1
ACCCTGGATTATGGAGGATTGCCT	1
ACCCTGGCAGTGTGAAAGGCTGTG	1
ACCCTGGCTGCGATGTCTATGGTA	1
ACCCTGGGGCCGATAACATGGGAC	1
ACCCTGGGGTGCTATTCAGGTCAC	1
ACCCTGGTGAGACATGCGAGTTGC	1
ACCCTGTCACATCACATCGAACAT	1
ACCCTGTTTTGGGGATGCCCATAG	1
ACCCTTAGGTAAACTACGTCCTCC	1
ACCCTTCGCCAGCGGTTTTGGTCC	1
ACCCTTCTCGGAGGCGCCATGTGA	2
ACCCTTGAGCTGTTTATGGGAA	1
ACCCTTGATGTGCAGACGGGAGAG	1
ACCCTTGATTTGGAAAATGGATGG	2
ACCCTTTAGATGGCGTGGTGTCTA	3
ACCCTTTGATTAGGAGTAGGTCCT	1
ACCCTTTGATTTTATAGGACCTAT	1
ACCCTTTGTAGTCCCGGTTCGTAAC	1
ACCCTTTGTAGTCCTGGTTTTCCA	1
ACCCTTTTGCCACAAGCCTTGCCT	1
ACCGAAAACGAAGCGAAAACGAAC	1
ACCGAAAATGAATGGGGAATGTGC	2
ACCGAAACGCCTGCCCGGGTGGGA	1
ACCGAAACGGTGCCGCGCTTCCAT	1
ACCGAAACGGTTTGGTGCACGA	1
ACCGAAAGAATGCCTCTACGAGAT	1
ACCGAAAGATTGTGGCCTTTACTG	1
ACCGAAAGATTGTGGCCTTTGCTG	1
ACCGAAAGTCATCGGTGTCGCCTG	1
ACCGAAATACACCTACAAAATCGA	2
ACCGAAATGCCTGGTCATCGAGAA	1
ACCGAAATTGGAAGTATGGTTGAA	1
ACCGAACAAATTACCTACGCGATG	1
ACCGAACAGGGCCCATATTATCAA	1
ACCGAACCATACAGATACACGAG	1
ACCGAACCTATAGGACCTGGTTGG	1
ACCGAACGAGGGCCACTACATTAC	1
ACCGAACTAACAAAAGGAGCCGGT	2
ACCGAACTCCAGGGTTAAGCGTGC	2
ACCGAACTGTGCCAGTTCCAGGA	1
ACCGAAGAACTTTGGGTGACCGGT	5
ACCGAAGCCTGTTTTAAGAATGAC	2
ACCGAAGCTCCGGATTGTTGGTAC	1
ACCGAAGGAACGGACGCCACTGGT	1
ACCGAAGGACCTAAAGCGAATGGA	3
ACCGAAGGACCTAAAGTGAACAAT	1
ACCGAAGGACCTATTGTAATCGGT	1
ACCGAAGTACCAGGTGACCGGGAG	1
ACCGAATAAGGTTATATCTACGGA	1
ACCGAATCACTTTGAGTCCTCGGG	1
ACCGAATGAGGAGAACGGTGTTTA	1
ACCGAATGATCTGGTGTGTGGAGC	1
ACCGAATTGATGACCGAATTTCTC	2
ACCGACAAAGGTGTGAATGGATCC	1
ACCGACAACATTGGTGCTGGA	5
ACCGACAACATTGGTGCTGGAG	3
ACCGACAACGAGGACGGTGGTACC	1
ACCGACAACTAGGATGTCATGTGG	1
ACCGACACAAATTCTATTGAT	1
ACCGACACTGGTGGAGAAACCATC	1
ACCGACAGCAAAGGAGAAGGGGAG	1
ACCGACATCTGGTCAAACGTCCGA	2
ACCGACCCAATCCCGCCTACGGCC	1
ACCGACCGAGAAGTCCCGGGTGCA	1
ACCGACCGATACTTGGTACCTGGA	1
ACCGACCGCCTCGACATCTCGAAC	1
ACCGACCTACTGCACCGGGGAGCC	1
ACCGACCTTCAGATGGGTAGTTGG	2
ACCGACGAAAGATGGTTTCTCCAC	1
ACCGACGAAAGATGGTTTCTCCACC	1
ACCGACGAAAGATGGTTTTTCCAC	1
ACCGACGAAAGATGTTTTCTCCAC	3
ACCGACGAACCGACCTCGATGATG	2
ACCGACGAATATTAGCCTTTAGAT	1
ACCGACGACACGGACGAGGCGAA	1
ACCGACGAGGATACGAGGTGATGG	1
ACCGACGAGGGCAGATGATGTGCA	1
ACCGACGATCACACGGGATGGTCA	1
ACCGACGATGGAGATGATGTGCAT	1
ACCGACGCGAATACGGTAACGAAA	1
ACCGACGCTCCGAACTCTGACGAC	1
ACCGACGGTTTGGGAAACTCTGGT	1
ACCGACGTACTTGACAGCTGC	2
ACCGACGTGACAGGAGGAGGGCGC	1
ACCGACGTGGCAGGAGGAGGGCGC	3
ACCGACGTGGCAGGTTGACTTGGT	1
ACCGACGTGTGGTGCAATGGGAG	1
ACCGACGTGTGGTGCAATGGGAGG	1
ACCGACGTTGTAACCATGGGTGGA	1
ACCGACTACTGATGGGATTGGTAC	1
ACCGAGAAAGTACAGAGCGTACGA	1
ACCGAGAAATTCTTTCCGGGTGCA	1
ACCGAGAACTAAACGCCTACAATC	1
ACCGAGAACTTGGTGTCCTGTGC	1
ACCGAGAATATCACGGGGGAATGTC	1
ACCGAGACCGAGAAATTCGGTGA	1
ACCGAGAGGGTACTGGACGGGTGG	1
ACCGAGAGGTACTACAAGGTGTCA	1
ACCGAGAGTGCTAGCTGGATAGTG	5
ACCGAGATTTATTCTGGGCAGGGA	1
ACCGAGCAAACAAATAAAGAAGGA	1
ACCGAGCAAATTGGATTGACATAC	1
ACCGAGCATCTTCAGCAGAGCACC	1
ACCGAGCCGCCAAGGTTGTGCCA	1
ACCGAGCCTTAGGTGGTGTTTGG	1
ACCGAGCGAAACGATGGCTCCGCA	1
ACCGAGCGGGAACAGCTGCGTAGA	1
ACCGAGCGGGTACACTAACACGGT	1
ACCGAGCTTGCCTTGGATGGTAGT	1
ACCGAGCTTGTTACGAGCCGAGC	1
ACCGAGGAACCTAAAATGAACGGT	1
ACCGAGGAGACTAACCGAATTGAC	2
ACCGAGGATGGACCTTGTTGGAGG	1
ACCGAGGATGGCTATAGTTGGGCC	1
ACCGAGGGACCTAAAGCGAACGAT	1
ACCGAGGGACCTAAAGCGAATGGT	1
ACCGAGGGACCTATTGTGACCGGT	3
ACCGAGGGACTTAAAATGAACGGT	1
ACCGAGGGAGCTAAGGCAAACGGT	1
ACCGAGGGTACCTGCAATATTCAC	2
ACCGAGTAGAGGCGGTCCTCGAA	1
ACCGAGTATTATGGGCCTGTTTGG	1
ACCGAGTCAAATTAGCCACGTAGG	1
ACCGAGTGATAATGTGCATCTAGC	2
ACCGATAAAGATGGACTAAACTAGG	1
ACCGATAACCACTCAGACTGGGCA	1
ACCGATAACGCGAATTGTAATGGT	1
ACCGATACAAAAAGCGATACCGGG	1
ACCGATACTAAAGATGCCTCCAGG	1
ACCGATAGAAGTTTACGCGAAATC	1
ACCGATAGATTTACGTGGCACGGT	1
ACCGATAGGTGCCAAGTCTGATAC	6
ACCGATATATCTTGAGTTTGACGA	1
ACCGATATCGTGAACAGTGATGG	3
ACCGATATGAATGGCCACCACT	1
ACCGATATGCTGAATAGTAGTGGT	1
ACCGATATGTGCCGGTTATTTTAA	1
ACCGATATTAGTGCCAGGTAACCA	1
ACCGATATTGGGCCTATATCCAGC	1
ACCGATCAAGTATGGTGGCCTGGG	1
ACCGATCCTCTTTTCCCGTCCACA	1
ACCGATCGCTATACTACTGAGGG	1
ACCGATCGGTGAGATTGTAAGTGC	1
ACCGATCGGTGTTCCCATTGACGGC	1
ACCGATCTACGTGTGGTTGGCCGG	1
ACCGATCTGATGGTGATTGTG	4
ACCGATGAAACATTATGGTACATA	3
ACCGATGACCGAAGTGATCAGTGC	1
ACCGATGACGGCAAACCTAACGAC	1
ACCGATGAGCCGATTGGTGGAGTC	1
ACCGATGAGGCTGTTAGATATGGT	1
ACCGATGATGGTAAACCTAACGA	1
ACCGATGATTGAGGGAGTAATATA	1
ACCGATGCGCCTGCAATTGGCTGA	3
ACCGATGCGGTACCTATGTACCTA	2
ACCGATGGAGTGAACACCGAA	1
ACCGATGGAGTGATTCTAGCCGAT	1
ACCGATGGAGTTGGCTCGCTAGAT	1
ACCGATGGGTGGTGATGTTGTTGC	1
ACCGATGGTACCCGCTGGATGGGA	2
ACCGATGGTACCTGCTGGATGGGA	1
ACCGATGGTAGTTAAGATGGTAGG	1
ACCGATGGTGGATGGTAGTGAAGT	2
ACCGATGGTGGTCATCTGGTCCGA	1
ACCGATGGTGTGTGTGTGTGCGTA	1
ACCGATGTGCTAGGGAGAGGTGTA	1
ACCGATGTGGTGCTTAAATCTTCT	1
ACCGATGTTATAGTACGTACGA	1
ACCGATTCAGTGCAGCGGCGTGCA	1
ACCGATTGAGCTGGTTGCCATTGT	1
ACCGATTGCCCACACGTTAACAAG	2
ACCGATTGGGGTGGTGAGTACGAG	1
ACCGATTGGGTGAAGATGGAAGCA	2
ACCGCAACATGTGAGGTGTGTGC	2
ACCGCAACATGTGAGGTGTGTGCA	4
ACCGCAACCAGGTTGAAAAGGGAA	1
ACCGCAACCTACTGAATCTGAATC	1
ACCGCAAGATGATGGTAACCTATC	1
ACCGCAAGATTAAGGGCCCCTT	1
ACCGCAATAGTATCCTGCAATCC	3
ACCGCAATTCGACAGGTTACTTGT	1
ACCGCAATTGTTCACGAGTGCAAT	1
ACCGCACACGGCCAAACGTTCGAC	1
ACCGCACAGCTACAAAAGGGTGAT	1
ACCGCACAGGATAAGACGACCGCA	1
ACCGCACCATGCGTCTACGACTGA	1
ACCGCACCTCCCCATGCCGCCGCC	1
ACCGCACGTGATAACCGCGATAAA	2
ACCGCAGATGGGAGACTAAGTCAG	1
ACCGCAGGATACCCAGTATAGTGA	1
ACCGCAGTGGTGCATAAAGGCGGG	3
ACCGCAGTTTGTTTGATATGGGCC	1
ACCGCATAGGTGAGGACACCAGTC	1
ACCGCATCTGCGAAAATGGTACCT	1
ACCGCATCTTATTTTCGCGTGC	1
ACCGCATGCGACTAACCTGCCACA	2
ACCGCATGGCGACTTAGCATAGCGA	2
ACCGCATGTCAGGGTTATGGATAC	1
ACCGCATTGGTGATAGCCTAAGGA	1
ACCGCCAACCAAGTTAATGGCAGG	1
ACCGCCAACTTCGGCCTGTGCA	1
ACCGCCAAGTCGACCACAGTTAAA	1
ACCGCCAAGTCGATGACAGCTAGA	1
ACCGCCAATTACACGATTTTCGGG	9
ACCGCCACATGGTAGTCCTACAAA	3
ACCGCCACGCGCACCGAGAACGCC	1
ACCGCCACGTAGGTGTCACGTCAG	1
ACCGCCAGGTACTTTGGGATGGTA	2
ACCGCCAGTTACTTGGGATGGTACC	1
ACCGCCATCAAAACCGTTGAGGGA	1
ACCGCCATCACTGAAACGATTGCA	2
ACCGCCATCCAAACTGCCTTAGAT	1
ACCGCCATTGGTGCTTGAGGACCT	1
ACCGCCCACATACCTGCGGTCAGA	1
ACCGCCCATTATGGACAACCA	1
ACCGCCCGATTGAGATGATGGTAT	2
ACCGCCGAAGGACCTATTGTGACT	1
ACCGCCGAGGGACCTACTTTGTAC	1
ACCGCCGATGGACCTATTGTGACC	2
ACCGCCGGCTGTGAGCTTCTCAGT	1
ACCGCCGGTGCATTTTACTCTATA	1
ACCGCCGGTGGCCTCATCGGAGGG	1
ACCGCCGGTGTCGCCGCTGGTGGC	2
ACCGCCGTCCAAACCGTCAAGGGA	2
ACCGCCGTCCTAGGAGGAATGGAG	1
ACCGCCTAGTACAAGTACCTGTAG	1
ACCGCCTATGAAAATGATTTTCGT	2
ACCGCCTCCAAAACTGTTAAAGGA	1
ACCGCCTCGGCAACTGGTGGGCCA	1
ACCGCCTCTGAAAGAAGTCCC	1
ACCGCCTGCATGATGGTCAGGATG	2
ACCGCCTGCGATGATGGGGGAGCA	1
ACCGCCTGCTACAGGTGTGGTTGC	1
ACCGCCTGCTGTTTTTTGAACCGG	1
ACCGCCTGGTTGCCGTCGGTCTGAC	1
ACCGCCTTAGGACCTTATGTGTCC	1
ACCGCCTTCGGTCAATAGGAGTAGG	1
ACCGCCTTGGGACCTATATTGCAC	3
ACCGCGACGCGAGCCTGCCGTCTC	1
ACCGCGAGACGAATTTAAGGCCTG	1
ACCGCGAGTAGTTCCTGCCGAGCAA	1
ACCGCGATCCGTCGAATTTGAGGG	1
ACCGCGATGATGGGTTGTCGGCGA	3
ACCGCGCAATCTGTGTAGGCCACC	1
ACCGCGCCCGATTTAAACGATTGA	1
ACCGCGCCCTGGCTGCTACGTTGC	1
ACCGCGCCTGCGAAAATGGTACCT	1
ACCGCGCGAGATGGTGTTGTGTTGC	1
ACCGCGCGGTTACCGACGTAATGC	1
ACCGCGCTGGCTGTTGCCTCCCCA	1
ACCGCGGCCAAAGCCCATGGATGC	1
ACCGCGGTCTACGGCTGACATGGC	1
ACCGCGGTGGACCACATAACGGTA	5
ACCGCGGTGTCCAATAACCGTGCC	2
ACCGCGTCAGTACGGAGGTGTT	1
ACCGCGTCCTAGCTAGGTTTC	1
ACCGCGTTGATCCGAGGTGACGAA	1
ACCGCTAAACCGTGAGGTGATGGT	1
ACCGCTACAATAAATAGATAGAAG	1
ACCGCTAGCTTGAAGATAAGGACA	1
ACCGCTAGGTACCAAATCATGGTC	1
ACCGCTAGGTACCATGGTTTGATA	1
ACCGCTATGGGACCTATATTGCAT	1
ACCGCTCGCCTACTAACCCCCTGG	1
ACCGCTCTCCAAAACCGCTGGAGG	1
ACCGCTGAAGTTGAGCAAGGTGTG	1
ACCGCTGAGGGACCTAATCTGCAC	2
ACCGCTGAGGGACCTCGTCTACAC	1
ACCGCTGCTAGTTGCCGCCGTGGA	1
ACCGCTGGAATAGGGACTACTGAA	1
ACCGCTGGTCCGCCGTCTTTCAGG	1
ACCGCTGGTGCATTTTACTCTAGA	1
ACCGCTGGTTGATGGCCGGTCAAA	1
ACCGCTGTGTCATCTCGGTCCCTA	1
ACCGCTTACAAAACCACTCAGGGA	2
ACCGCTTCATGAACTTTCAGG	2
ACCGCTTCGACGCTGAGATGGCCA	1
ACCGCTTGGGCCGCCAAGCCGCCT	2
ACCGCTTGTCGATGGTGTTCTTGA	2
ACCGGAATTGTAAGGTACGTGCAC	3
ACCGGAATTGTAAGGTACGTGCACC	1
ACCGGACATAAATACTGCCATGGG	1
ACCGGACCTCACTGGAAGATGGCC	1
ACCGGACTAATGGTGCTGCCATCT	1
ACCGGAGCCAATAAGCTGTCCTGA	1
ACCGGAGCCAATAAGTTGCCCTG	1
ACCGGAGCCAATATGTTGCCCTGA	3
ACCGGAGCCAATTTGTTGCCCTGA	1
ACCGGAGCCACAACTTTAGGTCCT	1
ACCGGAGCTTCTTGCGGATGTTGC	1
ACCGGAGTTTCCCCATTATTAGAG	1
ACCGGATAAATAGGATATTGGGGT	1
ACCGGATACAGAGGGTATTGGGGT	1
ACCGGATAGGTATCGTGCCTCTGG	1
ACCGGATATAGATAATCCACCACA	1
ACCGGATCACTGTTGTGCTTACGG	1
ACCGGATCACTTTTGGTCCTCGGG	3
ACCGGATCTACGGTTTAGGAGATA	1
ACCGGATCTAGGAAGGGGAGGGGA	1
ACCGGATCTATTTGTCAGCCACTG	1
ACCGGATGAATAGAGTATTGGGGT	1
ACCGGATGAGACACTTTATGGTAC	1
ACCGGATGGGACACTTCATGGTAC	1
ACCGGATGGGATGTATCCTAGTAC	1
ACCGGATGTACCGATAAACATGGT	1
ACCGGATGTAGTTAATGGGGGGCA	1
ACCGGATGTCGGAAGGGGTTCGGA	1
ACCGGATGTGCAAGAAGTGTGTGT	2
ACCGGATTCGAGGGGTGACGTGAC	1
ACCGGCAAAGGGGGGCCTGCGCGG	1
ACCGGCAAAGGGGGGCCTGCGCGGC	1
ACCGGCACATATAAGGGTTTCCCA	1
ACCGGCACCTATAGAATAAGTGTC	1
ACCGGCACCTATAGCTTAAGCCGA	1
ACCGGCAGAGCACAAAGTTGGGG	1
ACCGGCAGCGATCTGGTGGTGTAA	1
ACCGGCATTGATAAGGTGCTATGT	1
ACCGGCCGACTTGGTGGTGTTTGC	1
ACCGGCCGGGGTACACAAACGACA	2
ACCGGCGAAACAGCCCTTAAGAGC	4
ACCGGCGAGGTGATCGATAGACAG	1
ACCGGCGGGGTGGAGAAAAATCGG	1
ACCGGCGGTTGGGAACACACACGA	1
ACCGGCTAAAGACCACAGCTGGCC	1
ACCGGCTAAATACTAAGATGGAGG	1
ACCGGCTAGCTTTTGGAGGTGAGA	1
ACCGGCTTCGGCCAACAGGATG	1
ACCGGCTTCGGCCAACAGGATGTA	1
ACCGGGAAATATTTGCCGTGG	1
ACCGGGAATAAAAAGAGTAGGGGG	1
ACCGGGAATAAAGTTTAGCCTAGC	1
ACCGGGACTAAAAATAGGGTTGAT	1
ACCGGGACTAAAAATGGTGGAGCA	1
ACCGGGACTAAACATGGTAGTGCA	1
ACCGGGACTAAAGATCCCAAGCCT	1
ACCGGGACTAAAGATGGTAGCGCC	1
ACCGGGACTAAAGATGGTTGGTAAC	1
ACCGGGACTAAAGATTGATAATAC	1
ACCGGGACTACAAATTGATCTTTA	1
ACCGGGACTACTGTGAAATCTGGT	2
ACCGGGACTATAGGGGGTTACCAA	1
ACCGGGACTATTGTAGATTTGGGT	3
ACCGGGACTATTGTGAAATCTGGT	1
ACCGGGACTATTGTGGAATTTGGT	1
ACCGGGACTATTGTGGATATGGGT	2
ACCGGGACTATTGTTGTTTTTGGG	1
ACCGGGAGATTGGGTGGGTGAGAC	1
ACCGGGAGCACAGAGTGGCAAAAG	1
ACCGGGATAAAGATGGTGTTACCA	1
ACCGGGATCCGCGTGGTTGGAGGC	1
ACCGGGCATACATAAAGATCATAT	1
ACCGGGCCCTGATGGTTTTCCTCC	1
ACCGGGCGCTTTAGTGTCTG	1
ACCGGGCGGTAGTGTTAGGATGGT	1
ACCGGGCTTACCGCGGGGTACGG	1
ACCGGGGCTAAAGATGATCTTTA	1
ACCGGGGTGGTAGTATAAATAGAT	1
ACCGGGGTTCGACAGGGTACTGCG	1
ACCGGGTAAATGTGGTCCTATGGC	1
ACCGGGTAACAAGTATCACAGGTA	1
ACCGGGTAACAGGTATCAGGTAC	1
ACCGGGTAAGCGTGGTCCCTTGA	1
ACCGGGTAAGTCGGAAATGGTGGT	1
ACCGGGTATGATGGGTCTCCCAAC	1
ACCGGGTCACTTTAGGTCCTCGAG	1
ACCGGGTCATTGCCCTATTGCCGG	1
ACCGGGTCCACACTAGCCATGCGC	1
ACCGGGTCTATTGTGAAATCTGGT	1
ACCGGGTCTATTGTGGAATTCGG	1
ACCGGGTGACGAAGTTGGATACA	1
ACCGGGTGACGAAGTTGGATACG	1
ACCGGGTGACGAAGTTGGGTACGA	1
ACCGGGTGATCTAGTCGAACCAAC	1
ACCGGGTGATGAGACGGAATTGCC	1
ACCGGGTGATTACGGAGTGTGTAC	1
ACCGGGTGATTACGGAGTGTGTAT	5
ACCGGGTGATTGGTGATGTGTACA	1
ACCGGGTGCTGGTTGATGGAGGAA	1
ACCGGGTGTTGACGACGACGCGT	1
ACCGGGTTAATACGGCATGTGGAC	3
ACCGGTAACTTTCGGTACTATAAA	1
ACCGGTAACTTTCGGTGCTATAAA	2
ACCGGTAAGATAAGGGGTCCGAAC	1
ACCGGTACGCCAAGGTCTCCGCGTG	1
ACCGGTACTAAAGATAAATGAGGG	3
ACCGGTACTAAAGATCCAGGAGGG	1
ACCGGTACTATAGATAGGTGATCT	3
ACCGGTAGTGCACTGAGTTGGGGG	1
ACCGGTATACTATAAGATTTTAGA	1
ACCGGTATATCATGAGATTGACG	1
ACCGGTATATTTACGATCAGAAAG	1
ACCGGTATCTTTCGGTGCTATAAA	2
ACCGGTCACAATAGGTCCCTCGGT	4
ACCGGTCACAATAGGTCCTCTGGT	1
ACCGGTCACAATAGGTCTCTCGGT	1
ACCGGTCACAGTAGGTCCCTCGGT	1
ACCGGTCACCCAAGGTCCTTCGG	2
ACCGGTCACCCGAGGTCCCTTGGT	3
ACCGGTCACCCGAGGTCCTTCGG	1
ACCGGTCACTTTAGGTCCTCCGGT	4
ACCGGTCACTTTAGGTCCTTCGGT	1
ACCGGTCAGACCGTAGTGGGTTCC	1
ACCGGTCAGGGTGTTGGGCTGGAC	1
ACCGGTCCGATAGAGGAGGTGAAG	2
ACCGGTCCTAATAGGTACTTCGGT	2
ACCGGTCCTATCTCTCATATACAC	1
ACCGGTCCTCAAGCAACGATCTGA	1
ACCGGTCCTGAGGTCGTGCCCTCG	1
ACCGGTCCTTAAAGTTGGAGCGTG	1
ACCGGTCCTTAATTGCCATGGGT	3
ACCGGTCCTTAGCTTCTGAGCTAG	2
ACCGGTCGCTTTGGTCAGACATCC	4
ACCGGTCTGGCTGATTGTGTTGTG	1
ACCGGTCTTAGGAGTTTGGGGGTC	1
ACCGGTCTTTTCGTCACCTCGGTA	1
ACCGGTGAACAAAGAAGTACTGGC	1
ACCGGTGAACCACGCGAGCTGGT	1
ACCGGTGACAATAGGTCCTTAGGT	2
ACCGGTGACACTCATCTGTGATGG	1
ACCGGTGACCAAAACGGCGGCGGA	1
ACCGGTGACCAAATTTCATTGAGT	3
ACCGGTGACTAGGGGTGGTCTGAC	1
ACCGGTGAGAAACAATGTCTACGG	4
ACCGGTGAGTGCACGGCGGTCAGA	1
ACCGGTGATGTAATTTTATACTTA	3
ACCGGTGCAAACAATGTCTCTCGG	1
ACCGGTGCAAACTAGATGCCTCGG	1
ACCGGTGCAAGCCTATTAGTCGTC	1
ACCGGTGCAATTTAGCTCCTTGGT	1
ACCGGTGCAATTTGACTCCCTCAG	1
ACCGGTGCAATTTGACTCCCTGAG	1
ACCGGTGCAATTTGACTCCCTGGG	1
ACCGGTGCAATTTGACTCGCTCAG	1
ACCGGTGCAGATGAGGTCCCTCGG	1
ACCGGTGCTAAAGAAGGTCTTTAG	2
ACCGGTGCTAGTCGGCCTCATCCC	1
ACCGGTGCTCGCATTTATGGCTAA	1
ACCGGTGCTTGCACTGTGAATGGC	1
ACCGGTGGCAGTGGTGTGTGCTCCC	1
ACCGGTGGGATACTTGCGATACGG	1
ACCGGTGTACTCTGGTATGTTGAG	2
ACCGGTGTGCACTTCAAGAGATGG	1
ACCGGTGTGTATTGCGCGGTC	1
ACCGGTGTTAAAGATGGGTTGTGC	1
ACCGGTGTTAACATTTCTCCTGGT	1
ACCGGTTAGAGTACGTGGGATGGG	1
ACCGGTTAGTGTTACCAACCAGGA	1
ACCGGTTAGTGTTACCAACCAGGAC	1
ACCGGTTGAATGACCGATGGGACC	1
ACCGGTTGAGCTACAGTGAGAGAA	1
ACCGGTTGGATAGCCATGATGGAT	1
ACCGGTTGGGAACCTACTGTTGTC	2
ACCGGTTGGTGTTTTACGTGTGCA	1
ACCGGTTGTGCCGTTGTTGCTTGC	1
ACCGGTTGTGGACGTAATGGTGAA	2
ACCGGTTTATGGATGAGTGCTA	1
ACCGGTTTCCATAGTTTGGGGGTC	1
ACCGGTTTGGTCCTACGTGGCTGC	2
ACCGGTTTGTCAAGCGGTGTGCAC	1
ACCGGTTTTAACAATTGAGGAGGT	1
ACCGGTTTTAACAGTTGAGGGACC	1
ACCGGTTTTATACAGTTGAGGGAC	1
ACCGGTTTTATCCGATATGGCAGC	2
ACCGGTTTTCGAAGATGGTAGATG	1
ACCGGTTTTGATAGTTGAGGGACA	1
ACCGGTTTTGTATAGTTGAGGGAC	1
ACCGTAAAATCAGGTATCCAGCA	1
ACCGTAAAGCCTAGTATATCGACT	1
ACCGTAACAGTATCGAGGGCCTA	1
ACCGTAAGGTACTGGTACCTCGAC	1
ACCGTAATAAATGCGGTTAGGTGA	1
ACCGTAATACCGACGGGGCTCAAA	1
ACCGTAATAGAGACGGTGGTTGGC	1
ACCGTAATATGTGCCAGTTGTACC	1
ACCGTAATGAACGAGGCGCAGGAC	1
ACCGTACAACGTCAGGGGAGCCTC	4
ACCGTACACTCAAGATCCTACGGC	2
ACCGTACACTTAAGGTCCTATGGC	2
ACCGTACCCTGCGGTAAGCCCAGT	1
ACCGTACCCTTTCAGTAAGCGCGG	1
ACCGTACGTGGTGACCTAGAGAGG	1
ACCGTACTATTAAGAGGGGTTCCA	1
ACCGTAGCTGGTCGGTGCCGAGGT	1
ACCGTAGGAGACTAGCCGTGTCTA	1
ACCGTAGGCGTCTCGCTGTTGGGT	1
ACCGTAGGTCAGACAGCATGTGTT	2
ACCGTAGTCCCAGTGAACTTCCCA	2
ACCGTATAATACGTCTGCCTGCGA	1
ACCGTATACTCAAGGTTCTATGGC	1
ACCGTATATAACATATTCTAGTAC	1
ACCGTATATAGGGCCTGTTTTAG	2
ACCGTATCAGCCGATAACTACGAG	1
ACCGTATCCCACGGTAAGCGAGCG	1
ACCGTATTGGTTAAGGTTTCTATC	2
ACCGTATTTCTAGGTGAACTAAAAA	1
ACCGTCAACATAGTATTAGGATGC	2
ACCGTCAGAGATGACCTGATTCGG	1
ACCGTCATTGGAAGAGGAGTGCAG	2
ACCGTCCGCTTTAGGTCTCTCGGT	6
ACCGTCGAATAATACTGGGTGCAT	1
ACCGTCGAGGGACCTAGTTTGCAC	1
ACCGTCGAGGGACCTGATATGCAC	1
ACCGTCGCCACTAATGTTGATGAT	1
ACCGTCGGTATGCAGTGTCTA	1
ACCGTCTAAGGACCTGAGTGACCA	1
ACCGTCTACTGATAGTTTTGGAGG	1
ACCGTCTATGGTAACCGTGATAAC	1
ACCGTCTCTGTGTACTCGGTCCAC	2
ACCGTCTGCGAAGATGGTGATGCC	1
ACCGTCTTGGTGCTGATGAGTCCC	1
ACCGTCTTTACCATGAGGGTAC	4
ACCGTGAAAGCGTGGCCTATCGAT	1
ACCGTGACTGGCGTTGCCAAACTA	1
ACCGTGAGGTACCGGCAATTTGAA	1
ACCGTGAGGTACCGGTACCTCGAG	2
ACCGTGAGGTACTGGTACCTCGAG	1
ACCGTGAGTTTGCGATAGGCTGGT	1
ACCGTGATCCGGCCAGTGAGTGTC	1
ACCGTGATGTAATTACAACGTAAC	1
ACCGTGCAATCAAGGTCCTATGGC	1
ACCGTGCACTCAAGGTTCTATGG	1
ACCGTGCACTGCTAGGTTGACCTC	1
ACCGTGCAGACTACGTCCCTCGGC	1
ACCGTGCAGGCAAAGCTGTGATGGC	1
ACCGTGCATGGTAACCACGATAAC	1
ACCGTGCATTGTAAGGTTTGGTCC	1
ACCGTGCCAACCACAAGCCAGCGT	1
ACCGTGCCAACTTTGACCGCGCCT	1
ACCGTGCGTTACGGTTGGTATGAC	1
ACCGTGCTCTTGTCCAAAACGATA	1
ACCGTGCTGCCCCAATGGTGGGCG	1
ACCGTGCTTACCACTGGGGTGCGG	6
ACCGTGGAAGGTTTCCAAGGAGGC	2
ACCGTGGACCTTCGGATTGGGCCT	1
ACCGTGGCCCAACCGGCAAGGTGT	2
ACCGTGGTACCTGCTGGATGGGAG	1
ACCGTGGTCCAACATGACGGT	1
ACCGTGGTCCAACATGACGGTGTC	1
ACCGTGGTCTCTACCGTTACGAGT	1
ACCGTGGTCTTGCCTACGTGACAC	1
ACCGTGGTCTTGCCTACGTGGCAC	2
ACCGTGTAAAGGCTAAGGGTAC	2
ACCGTGTAGACGAAGTTGGATGC	1
ACCGTGTATACGTATGATGATGG	1
ACCGTGTCTATAACGTGTGGGCCT	1
ACCGTGTCTATGACATGTGGGCCC	2
ACCGTGTGATGATTGTAGGTGGA	2
ACCGTGTGCCGGATTATGACTGAA	3
ACCGTGTGCCTGGTGCACCTCTCA	1
ACCGTGTGCGTGTTGGCTAAACAG	1
ACCGTGTGGTAACCGTGCTTACCG	1
ACCGTGTGTCTAGATTTGTAGCCA	2
ACCGTGTGTTAGTGATACGTGGGT	3
ACCGTTAAGAGGCCTGTCTGCGAA	4
ACCGTTACTAAAGATGCCACGGTA	3
ACCGTTAGGAACACATGGGTGCAG	1
ACCGTTAGGTGATATTGTGTTGAC	1
ACCGTTAGTTGATCATCAGTTGAC	1
ACCGTTCAAAGGAGGTCCCATAGC	2
ACCGTTCAGGATATTTGCGCTGGA	2
ACCGTTCGCTTTAGGTACTTCGGT	1
ACCGTTGAGGTTAGGGGCTGTCGG	1
ACCGTTGATGCCGCCTGTGCGCCT	3
ACCGTTGATTGAACCGAGGGAGG	1
ACCGTTGGATGATGCCAGATCAAC	1
ACCGTTGGCCTTGCGAATAGTAGT	1
ACCGTTGGGTGCATTGCGGAGAAC	1
ACCGTTGTCCTGCTTGGTGGCTTC	1
ACCGTTGTCTGGTGCTAATTCGTC	4
ACCGTTTAAATAAGGTACCTCGGC	1
ACCGTTTAGGAGACGTACGAGTGA	1
ACCGTTTAGTAGTTTGGGAAGCGT	1
ACCGTTTGATTGAACCACAGGAA	1
ACCGTTTGCTTTAGGTCCTTCGGT	3
ACCGTTTTGTCTTTTGTGCCGAAG	1
ACCTAAAAAGGGATGTGACCCTCC	1
ACCTAAAACATAAAAGGTTCAGGT	1
ACCTAAAACGGAGAGAGTGCTAAC	1
ACCTAAAAGCCTAAACTGATAGGA	2
ACCTAAAAGCCTAAGCTGATAGGG	1
ACCTAAAAGGTGCCGGTTAATTCT	1
ACCTAAAAGTGGATGGATGTGGA	2
ACCTAAAAGTGGATGGATGTGGAG	1
ACCTAAAATAAGAGTATAGCCGG	1
ACCTAAACCCTAGAAGGTGTAAGC	1
ACCTAAACGATAATGCCACCTAGT	1
ACCTAAAGCCTGCATGTTTTACAT	1
ACCTAAAGTTGTGGCTCCGGTTGG	1
ACCTAAATGGCGACGGACGGTGAC	1
ACCTAAATGTGGGGTGTGGACGAC	2
ACCTAAATTTTACAAGATATGCTC	1
ACCTAACAAACTGTGACAGCCACA	1
ACCTAACACGTGCCACTGGTGGA	1
ACCTAACCAAAGAATCACCAAATA	1
ACCTAAGAAACAATACTGGCTGGT	1
ACCTAAGAACCTCGGGTGACCGGT	1
ACCTAAGAACTGGTGTTGGTAAAA	1
ACCTAAGATATAAGTGGAGGAGCC	1
ACCTAAGATATAAGTGGGGAAGCC	1
ACCTAAGATATAAGTGGGGAGCC	1
ACCTAAGATGAAAAAATGATGTGG	1
ACCTAAGATTAGATGTTAGTGCCA	1
ACCTAAGCTAGGTGCTACTGAGG	1
ACCTAAGCTAGTAGAGAATGGGAC	1
ACCTAAGCTTAAACGATAAGGTGG	1
ACCTAAGGGAACTTCGGTTGGGAC	2
ACCTAAGGGACCGCCAGTGAAAAT	1
ACCTAAGGTCCTGGGTTCGACTCC	1
ACCTAAGTGAAACCTCACGACAAG	2
ACCTAAGTGAAACCTGCTGACAAG	3
ACCTAAGTGGAGTAGGGTTACCTA	1
ACCTAATACGCACTACTTTCAGGA	1
ACCTAATAGGATGGCATACATGTG	1
ACCTAATCGGCTGCCTTCTATTAA	1
ACCTAATGGTTGCAGTGACCTGAG	1
ACCTAATTGGTGCAACCACCAGGT	3
ACCTAATTTCTTAATACCCGTGAC	1
ACCTAATTTTGATGGCCTATAA	1
ACCTACAAAAATATAAATTGGGGT	1
ACCTACAAAAATGGGATGGACCTA	1
ACCTACAAAGGGGTGTCGCACTCT	2
ACCTACAACACGTGTGCACTCA	1
ACCTACAACACGTGTGCACTCACC	1
ACCTACAACTACCTACAATTAACT	1
ACCTACACAGGAGCTAAGCAGATC	1
ACCTACACCTATGAGTTATATCT	1
ACCTACACTGAATTATTTGAGAACG	1
ACCTACACTGTGGAGTTGACGTGC	1
ACCTACAGAAGGATAAGTCTGTG	1
ACCTACAGATGAAGATGCCGGGCC	1
ACCTACAGGGTGTCGACGATTGAT	1
ACCTACAGTAGTCGGGGTAACAGC	6
ACCTACATACAGGATATAGATGG	1
ACCTACATAGCAGTGGTGATTGGT	2
ACCTACATATAGGAAACAGATGGT	1
ACCTACATGGCATGTATTGTCCGA	1
ACCTACATGTCAGTGACAATAGCA	2
ACCTACATTACAAACTTGAATGAC	1
ACCTACCACTCTATACCGAGGCCT	1
ACCTACCACTTGATGTGATATATC	1
ACCTACCATGGTGTGGCCGCAATG	1
ACCTACCTACGGTCAGACCGGCCA	1
ACCTACGAAATGACATGGTTGCTT	1
ACCTACGAACCTGGACATGTGTGT	1
ACCTACGAGTTACAATGGGTA	1
ACCTACGCCATCAACCAAACAGAT	1
ACCTACGCGTATACGGACACTTTC	1
ACCTACGTAGCTAGTTTGACTAGG	2
ACCTACGTATACCAAACTATTCTA	1
ACCTACGTGGCGGTTTTGACCGGG	2
ACCTACGTGGTGGTGTTGACCT	1
ACCTACGTGGTGGTGTTGACCTGG	1
ACCTACGTGTTAGCCGGATCCA	2
ACCTACGTTCCGTACGAGGTTGG	2
ACCTACTCTTCTTTTGGGTGG	1
ACCTACTCTTGCAGACGATGTGGT	1
ACCTACTGACACAGGATCTACACC	1
ACCTACTGTGGAGATTATGGGTAC	1
ACCTACTGTGGGATACGAAGCAAT	1
ACCTACTTATATGCTAAAATAAGC	1
ACCTACTTGTCGACTCCGGATTTC	1
ACCTACTTTGAGAATAAGGGTGGG	2
ACCTAGAACCCACAAAGGGTGTTGG	3
ACCTAGAACTTGATGGGACATTTC	1
ACCTAGAAGAGGTCGGCCCCTCC	1
ACCTAGAAGATTGTGCTTGGATGT	1
ACCTAGAATGAAAAATGATGTG	1
ACCTAGAATGTATCTACATGGACC	2
ACCTAGAATTAAAGATGATGTGGC	1
ACCTAGACAAGTTTTGGTAGTGCC	2
ACCTAGACATGGATGTGACACTGC	1
ACCTAGACGGGAGCCTAGGGTTGC	3
ACCTAGAGCTAGAGTTGTGCCAAA	1
ACCTAGATAGGAGCGGATGGGACG	1
ACCTAGATGGATGAAATACAAGTA	2
ACCTAGATTGAAAAATGATGTGAC	1
ACCTAGCCTAGCTGATATCGCGAA	2
ACCTAGCTAGTACCGAATGTGGCA	1
ACCTAGCTGATATGATGACAAAAC	2
ACCTAGGAAAAAAAATGATGTGGC	1
ACCTAGGACCGAATTGATGACCGA	2
ACCTAGGACCTGATACCTGTGATA	1
ACCTAGGAGCATGTGTTAAGCTAGC	1
ACCTAGGAGGGGATGTGATCTAGA	2
ACCTAGGAGGGGTCACGTCCTGTA	1
ACCTAGGAGGTGCAGATTTACACC	1
ACCTAGGATAAAAAATGAGGTGACA	2
ACCTAGGATATGATGGGACATTA	1
ACCTAGGATATGATGGGACATTAC	35
ACCTAGGATATGATGGGACATTACC	1
ACCTAGGATCGCCACTGGGTGCGC	1
ACCTAGGATGAAAAATGATGTGAC	2
ACCTAGGATGAAAAATGATGTGGC	2
ACCTAGGATGAAAAATGATGTGGCA	1
ACCTAGGCGCTTGTGCAATCGCT	1
ACCTAGGGGTGGATGTAGAAAGTA	1
ACCTAGGGTCTAGGATGTGGCTGA	2
ACCTAGGGTGTCTATGGTTGTGCT	1
ACCTAGGGTTCGAATGCTCATGGG	1
ACCTAGGGTTTGCCTTTTTTTGGA	1
ACCTAGGTACTACGAGGTACCATGT	1
ACCTAGGTACTATGAGATACCATG	3
ACCTAGGTACTATGAGATATCAAA	1
ACCTAGGTCATTTGGATGGCA	2
ACCTAGGTGGGGATGGGACAC	1
ACCTAGGTGGTGTAACGAATAAGG	2
ACCTAGGTGTAATGTGAATGGTCT	1
ACCTAGGTGTATGCATGTAATTTA	1
ACCTAGGTGTATGCTTACGGTTAA	1
ACCTAGTACAACGAATCTGGACAGC	1
ACCTAGTACATATAGATGGACCA	1
ACCTAGTACTACGAATCTGGACAG	1
ACCTAGTAGGTATACCTCGAAGGT	1
ACCTAGTATGGGACATGGGGGTAT	1
ACCTAGTATGTGGGTTGACGTGAC	1
ACCTAGTATTAGATGGACATTTTC	2
ACCTAGTCTTTTGGGTGGTGTAGG	1
ACCTAGTGCGCCACTGTCGACGGG	1
ACCTAGTGCTGGATGGGACGTATC	1
ACCTAGTGGTTACAAGAGCCTCAG	1
ACCTAGTTCGATGGATTTGATGGA	2
ACCTATAATGTTTAAAGGTGTCGG	1
ACCTATAGTGCTTAAAGGTGTCGG	1
ACCTATATATAGGTGCCGGGTCTT	1
ACCTATATTTATGCCATATTAG	2
ACCTATCAACAGCGAGACGTGCC	4
ACCTATCATTTGCATGCAACTCAA	1
ACCTATCCACGGATTGATTGATGT	1
ACCTATGACTAAATTGATGACCGA	1
ACCTATGAGACAGTACCTGATACC	1
ACCTATGAGGTATGAGGTGTATGA	1
ACCTATGCCTAGTGGGCCGGGTA	2
ACCTATGGAATACTCCCGGGTGAA	1
ACCTATGTAGTGGTGTGTGTGCA	1
ACCTATGTCAACCATGATTTCAGC	1
ACCTATGTGGATGGATATCATGAC	1
ACCTATTAAGATACATCTTCTCAGG	1
ACCTATTACATATAGATGGACCA	1
ACCTATTAGGTAGCCGGGACCAAC	1
ACCTATTAGGTAGGGTGCGTGGA	1
ACCTATTAGGTGATGGGGATGGTT	1
ACCTATTAGGTGCATCTAGTCGGT	2
ACCTATTCAGAGAGTGTTCTA	3
ACCTATTGTGACCGGTTTTATATA	1
ACCTATTTTCTTAGGTATGCCAAAA	1
ACCTCAAAGCGATCTGATGGTCAC	1
ACCTCAAAGGTGTCGGTTTCTAAA	1
ACCTCAACATCTATGAGTTCAGGA	3
ACCTCAACATGGTATCAGAGC	1
ACCTCAACATGGTATCAGAGCTGG	6
ACCTCAACCGGTCAACAGGGAGCC	1
ACCTCAACTGGTCAACAGGGAGCC	1
ACCTCAAGGGGATACCACATGCAC	1
ACCTCAAGTATGGTAAAATGTGAC	1
ACCTCAAGTGTGGCAAAATGTGGC	1
ACCTCAATAATGATGGTGGTGAGT	1
ACCTCAATAGTATGTCTACATGGG	1
ACCTCAATCTCGCGTATACCTT	1
ACCTCACACAATGGGATTTGGTAC	1
ACCTCACACCGACCCACCACCGGC	1
ACCTCACACGAATACATGGGCCTT	2
ACCTCACCAAAATTAGGCATGCCA	1
ACCTCACCTGTGACAGGTGTTAAA	1
ACCTCAGAGTTCTTTCGAAATCGG	1
ACCTCAGAGTTCTTTCGATGCAAC	2
ACCTCAGGAATGTCAGAGGTGGTC	1
ACCTCAGGTATATGGGCGGTCTG	1
ACCTCATAAGAACGGTGCTAGTGT	1
ACCTCATAAGGTTAAGGTGTGCGC	1
ACCTCATAGTACCTAGCTATTAAG	1
ACCTCATAGTACCTAGGTACCAAG	2
ACCTCATAGTACCTAGGTACCGAG	1
ACCTCATATAATACCCGATGTGAC	3
ACCTCATATAATACCTGACGTGAC	1
ACCTCATGGTACCTCGAATTGTAA	1
ACCTCATGGTACCTCTTCAAGAAC	1
ACCTCATGGTAGCTTTTTAAGGAC	3
ACCTCATTCATTGGAGAAAGGTGG	2
ACCTCATTTGTGTGCTGACATAAG	1
ACCTCCAGGAAGCTCATGGTTGG	1
ACCTCCAGTGATGCCGGTGCAAAC	2
ACCTCCGATCTGTGCCGTTTCCGT	3
ACCTCCGGGTGTAGGTGTCATGGC	1
ACCTCGACAACCAGTGAATGCCT	1
ACCTCGACTACTTGGAAGAGCGAA	2
ACCTCGAGGTACCTAAGTTCTGCA	1
ACCTCGAGGTACTTTTTGTTGGAC	2
ACCTCGAGGTACTTTTTGTTGGAT	1
ACCTCGATAAGACCTTTTGGAGGG	1
ACCTCGATGATGGCAACCTTACGA	1
ACCTCGCAGTACCTAGGTACCATG	1
ACCTCGCTGTTGATGGGTACAT	1
ACCTCGGTAGCATGGTAGAACAAA	3
ACCTCGTGCTACAGTGTCACTGAC	1
ACCTCGTGGTACCTCCTCAAGGAC	1
ACCTCTAACCCAACATCTTGTGAA	1
ACCTCTACTGGAGTAGCCAGATGC	2
ACCTCTACTGTATAACAGGGACGC	1
ACCTCTCACAGGGCCGGTTAGACT	1
ACCTCTCACCGTAATAAATGATGC	1
ACCTCTCAGGGAGGTGCAGTTGAG	1
ACCTCTCTCCTCCACGTAAGCTTA	1
ACCTCTGCATAGCCAGGCGCC	1
ACCTCTGGTGCATGGTGAGAAGGG	1
ACCTCTTAAGGAGCCGTATGTGAA	1
ACCTCTTGGATTGCTCTGGTTTGG	1
ACCTCTTGGTGCATTACATGATGA	1
ACCTCTTGTGTGGTCCACCTGCGA	1
ACCTGAAACAGAGGTAGTGCGTGC	2
ACCTGAAACGAAGGGAGTACTATG	2
ACCTGAACGATTTGAGGATGGCCA	1
ACCTGAACGGGTAGGCGGGCGATC	1
ACCTGAACTGTTGGTGCAGCCTGT	2
ACCTGAAGAGGAGCTGAACACACA	1
ACCTGAAGCACAGAAGGCCTTCGA	1
ACCTGAAGGGAGCATACGGTGACA	1
ACCTGAATTGATGTTGAACGATAC	1
ACCTGACAATTCAGGGGCCCGAA	1
ACCTGACAATTCAGGGGCCCGAAC	5
ACCTGACAATTCAGGGGTCCGAAC	1
ACCTGACAATTTAGGGGCCCGAAC	1
ACCTGACAGCTCAGGGGCCCGAAC	2
ACCTGACATGTGTGCGATTCGACT	1
ACCTGACCAACGAAGATATAATGC	2
ACCTGACGATGTGGTGGGTAGCAG	1
ACCTGAGGTCCTGGGTTCGACTC	1
ACCTGAGGTCCTGGGTTCGACTCC	1
ACCTGAGGTGCTGATTGGGTCGG	1
ACCTGAGTAAGGATGTGACATCTC	2
ACCTGAGTAGCAGCCTAAGGTCCT	1
ACCTGATAACTCAGGGGCCCGAAC	1
ACCTGATACATGTTGTGGTACTAC	1
ACCTGATACCCGGTGCCAAGGTA	2
ACCTGATACCTGTGAAACTCGTGC	1
ACCTGATACCTGTGATACTCGTGC	1
ACCTGATAGTCGTGCTTCATGTAG	1
ACCTGATAGTTGAGTTGACGTGCA	1
ACCTGATCAGACGTGCTTTGGACC	3
ACCTGATCGATGAGAGTGGGCTTC	2
ACCTGATGATTTGCTGCCCGGCC	1
ACCTGATGCTGGATTGGGGGG	1
ACCTGATGGACCGTGGGTGCTTGC	2
ACCTGATGGCTTCGAGGAAAACTA	1
ACCTGATGTGTGTGTACTTCGTG	1
ACCTGATTAATGGTGGGTTGTGAG	1
ACCTGATTGAATAGTGCCAGCCTT	1
ACCTGATTGGTGGATTGATATTGG	2
ACCTGCAACGTTGGTGAAGATGCA	1
ACCTGCAAGAAGTAAGAAGTGGG	1
ACCTGCAAGTTACAGTGTAATTAC	1
ACCTGCACATTCGATGAGTGCGAG	1
ACCTGCACGAGCTTTCTGTTGGAA	1
ACCTGCATATAGAAAAATGATGGT	1
ACCTGCATATATGAAACAGATGGT	1
ACCTGCATGAAGGGCCTGATCCAC	1
ACCTGCCAAGCTGTTGTACCGTGG	1
ACCTGCCAAGTTGATGTACCGTGG	1
ACCTGCCAAGTTGTACCGTGGGT	1
ACCTGCCAAGTTGTTGTACCGTGG	1
ACCTGCCACCTGCCTCGGTCTACTC	1
ACCTGCCATGTGTCTCCACGAAAA	3
ACCTGCCCAAAGAAAATGGCGCGA	1
ACCTGCCCGACCGTCGTTGGTTGCC	1
ACCTGCCCTATTGAAAAGGAGGGA	1
ACCTGCCGAAACCCATGGCGAAGG	1
ACCTGCCTAGGGCTTCACGAGAGA	1
ACCTGCCTCATAGCGGTGGTGAAA	1
ACCTGCCTGATCGGACGGTGGGAA	1
ACCTGCCTTCACTATACTTTTATA	1
ACCTGCGAAAATGACAACCATGG	1
ACCTGCGAGGTATCAAGTATCATG	1
ACCTGCGGGTGCCGTATCCTCAAT	1
ACCTGCGGGTTTCTGATGTACTGC	1
ACCTGCTAAGTTGTTGTATCGTGG	2
ACCTGCTCGTGATGGATGCTCAA	1
ACCTGCTCTAAGGTGGTGTTTAGG	1
ACCTGCTGATTGGACTATTATGCA	1
ACCTGGAGAGAGTCGCCACGGGA	1
ACCTGGAGATTGATAGCGATAAAG	1
ACCTGGATTGGACTGAAATCTGCC	1
ACCTGGCAACGTTTGATGGGCAGA	2
ACCTGGCTACAACACAGGCCTCGG	1
ACCTGGCTCTGTTTGCACCTA	1
ACCTGGGAGCTACGGAGAAGAACA	1
ACCTGGGCCCACATGTCCGCCTCC	1
ACCTGGGCCCTGTTTGGTTCCATG	1
ACCTGGGGTGGTCTCTCGAAACAC	1
ACCTGGGTGCAGACGGGCAGGACC	1
ACCTGGGTGCGGTATAGGATGTGC	2
ACCTGGGTGTACGGAAGAGTCGTC	1
ACCTGGTAATAGCCATTGTGGAA	1
ACCTGGTAATGGGATGGAAATAAG	1
ACCTGGTACCCGATACCTGATACC	2
ACCTGGTACCTCATTACACCTCAT	1
ACCTGGTATCCGATACCCTGGTA	2
ACCTGGTCAAAACCATCGAAGGAC	1
ACCTGGTCCACCTATTATACACA	1
ACCTGGTCTATAGGGTTGACGTGG	1
ACCTGGTCTGGCTTACATGTGGGC	1
ACCTGGTGCTATATAAAATATGAG	1
ACCTGGTGGCTCGCTTGATTGGCA	1
ACCTGGTGTTGACGGTCGTTAAGT	1
ACCTGGTTTAACCATGTAGGTGTA	1
ACCTGGTTTTACGGTTGAGGGAAG	1
ACCTGTAAAAGAGGGAAGGCTGCA	5
ACCTGTAAGATAAGGGGCCCGAAC	1
ACCTGTAATAGTAAAGTAAGGTAC	1
ACCTGTAATCACTACGGAGT	1
ACCTGTAGGTACCAGCCGAGCCAT	1
ACCTGTATTTCACTATTAGGTGTA	1
ACCTGTCACGCCCGATGAGTGTG	1
ACCTGTCAGTGACCACGTCAAGGG	1
ACCTGTCGATAGTGAGTCGCCTGT	1
ACCTGTCTGGTTCGCGCGTTCTCC	1
ACCTGTCTGTGCCGATAATATGAA	1
ACCTGTGACGGGCCGAGAATGGAA	2
ACCTGTGACGGGTGGAATTATAGC	1
ACCTGTGAGAATCCTGCAAAA	1
ACCTGTGATGAAGTGAGCGAACC	1
ACCTGTGATGGATTTTAGTTGCGG	1
ACCTGTGATGGGTCGCCACTGGAT	1
ACCTGTGCATTTCACGCATGT	1
ACCTGTGCTGATTTGGGAGAC	1
ACCTGTGTCGCTATGGTAGCA	1
ACCTGTGTGGATGAGGTGCATGTG	2
ACCTGTGTGTATAGGATATGTTGC	2
ACCTGTGTGTATATGATATGTTGC	1
ACCTGTTAATCGATACTAGTCCCA	2
ACCTGTTACGATGCACTCATCTAG	1
ACCTGTTAGAGTGCGCAGCCTGGC	1
ACCTGTTGTGGTTGTTCGGGTGGG	1
ACCTGTTTGGATTCTTAAGGGCTA	2
ACCTGTTTTGACAATTCAGGGCCA	1
ACCTTAAGGGCCTATGTCACCGAG	1
ACCTTAATGTAAAAAAATGGTGCA	1
ACCTTACAAGTTTAAGGACCGCCT	1
ACCTTACAGATAAGGGGCCCGAAC	1
ACCTTAGAATATTTCCGGGTGAAA	1
ACCTTAGGGTGCTATTCAATTCAC	1
ACCTTAGGGTGCTATTTAGGTCAC	1
ACCTTAGGTGGTGTTTGGGAAGGA	1
ACCTTATAGTACCTAGGTACCAAG	1
ACCTTATATAATAACCGATGTAAC	1
ACCTTATATTGTGGGACAACTAGA	1
ACCTTATCGGCTGGTGTAAAGGAT	1
ACCTTATGGAACGGAAAGCGGGTA	1
ACCTTATGGTGCTACGTATTAGGT	3
ACCTTCAATAAGGATGGGCTTGGA	1
ACCTTCATTTTTAATGGATGACGC	1
ACCTTCCCACGGTGTGTAAATGAA	1
ACCTTCCTAGTTTACACAAGCGGT	1
ACCTTCGCACATACCTTGCCCTGA	1
ACCTTCTTGGTGCGTTTCAATGAC	2
ACCTTGAATCGTCCTGCCCTAGAG	2
ACCTTGACAAATGGAAGGTGAT	1
ACCTTGACGACGATGATGGCGGCC	1
ACCTTGAGGGTCCTATTTATAGGC	1
ACCTTGAGGTACCAATTTAAATCC	1
ACCTTGCCATAACGAGGATGGGAG	1
ACCTTGGAATACTACTGGGTGGAG	1
ACCTTGGGGTACTACTCAGATGTG	1
ACCTTGGGGTGCTACTCAGGTCAC	1
ACCTTGGTATGGGCTGGTTGT	2
ACCTTGGTGGCCTAGCTCGTAATG	1
ACCTTGTAATTGTGTCGTGGGCTA	1
ACCTTGTAGCAGATCAGGTACTCC	1
ACCTTGTCACATCAAACGTTTAAA	1
ACCTTGTCGCTGGTGCCCTGGGCC	1
ACCTTGTCGGCAGGTGCAGATACA	1
ACCTTGTGTCCAATCTTGTCACCC	2
ACCTTGTGTCTAGCTGGGTGGGC	2
ACCTTGTGTGGTCCGCCTGCGAAA	1
ACCTTTACACATTCGTGCTTGGC	1
ACCTTTACGATGGAAGCAAGCACCC	1
ACCTTTAGTGGAAGGAGGAGTGCT	1
ACCTTTCTCTGATACAGGTAC	1
ACCTTTCTGAAAAGGACAGGCGGC	1
ACCTTTGACGGGTGCAAACTTAAA	6
ACCTTTGCGTACGTGTTGGGCCTC	1
ACCTTTGGCCATGCTAGCCCGCCT	1
ACCTTTGTGCTATCGGGATGGCCT	1
ACCTTTTAGAGGTGTTTGGTTGAG	3
ACGAAAAAAGATTTGCATGTGTAC	1
ACGAAAAACACAGTGGCTTCGAAA	1
ACGAAAAACCATGGCTGCACTTAA	1
ACGAAAAACGATAGGGAGGGATT	1
ACGAAAAATTTTAAAATAGGGTGG	1
ACGAAAACAGACTCGGACTTAGAC	3
ACGAAAACATGGTGATTAGCTGC	1
ACGAAAACCCTACAAAATCAATAT	1
ACGAAAACCGACGTGCTGGTGTCC	1
ACGAAAACCGAGCAAATGTGGTCC	1
ACGAAAACCGCTGAGGGATCTCGG	1
ACGAAAACGAATACAGTAAGGGTA	1
ACGAAAACGATAAAGATGGTTTCA	1
ACGAAAACGATAAAGATGGTTTCC	4
ACGAAAACGCCACACGCACCACC	1
ACGAAAACTCACGGTTGCACTTAA	1
ACGAAAACTCATGGTTGTCCTTAA	2
ACGAAAAGAAATGTGGGCCCACAG	2
ACGAAAAGAATTTTTTTGGGTGTC	1
ACGAAAAGACGGTGACAAGGATGTG	1
ACGAAAAGAGAGAATTTTGGTGCA	3
ACGAAAAGAGTGCAAACGAACCGG	1
ACGAAAAGGTGTGCTTAAAGTA	3
ACGAAAAGTATTTCGAGGTACCGGT	1
ACGAAAAGTCTAAGCCTAAACAA	4
ACGAAAATCGGTGTTGCCTATTAA	2
ACGAAAATCTATTTTCGCAGGTGG	1
ACGAAAATGGTATTTTGATGAACA	1
ACGAAAATGTAAGTGTGAAATGGT	1
ACGAAAATTTATTATCGCAGGTGG	2
ACGAAAATTTTTGACGTGTCACAT	1
ACGAAACAGTGCTACAATCGTGTT	3
ACGAAACATGCCTTCTCGAGCAAG	1
ACGAAACCATTACGGGTAGGTCGC	1
ACGAAACCCAGCACATTGGGAAGC	2
ACGAAACCCTAATGGTGATGGCA	1
ACGAAACCTGTCGTGTCGAGTGA	1
ACGAAACCTTAACGGCGATGGTAT	1
ACGAAACGACGGTGTTGCCATGGC	1
ACGAAACGATAACGGAGGTGGTC	2
ACGAAACGATAACGGAGGTGGTCT	1
ACGAAACGCACCGTTTAGCAGTTT	1
ACGAAACTTATAGCCGATCCGATG	1
ACGAAAGAGCATGTAGCCTAGTGA	1
ACGAAAGAGCCGTCCTATATATA	1
ACGAAAGAGTGTGCACAATTTGAT	3
ACGAAAGATGATGTTGTGCAGACG	4
ACGAAAGCAGATTGTTGGATACAC	1
ACGAAAGCCCCCGAGCACAGAACA	1
ACGAAAGGGAAACATGGTTGCTAC	1
ACGAAAGGTCAAAACGTTGGTTAA	1
ACGAAAGGTCAAACATGTGCTTAA	1
ACGAAAGGTCAAACGTTTGTATAA	1
ACGAAAGGTGTATCGTTTAACAGT	2
ACGAAAGTTGCCAAAGCGAAAAGC	1
ACGAAAGTTGCTTACAAAAATCAT	1
ACGAAAGTTGGGCTCATGGTATACA	1
ACGAAATAAAAGAGGTGTCATCCA	1
ACGAAATAAACTACAGAGGTGGAG	1
ACGAAATAGGGTCGGACCTGATCT	1
ACGAAATATAGAGGGATGTCAGC	1
ACGAAATCACTAGTTAGCGTGTGC	1
ACGAAATCTGCTGAGTGCCACTGG	1
ACGAAATCTTAGGTGGGCCCGAGG	1
ACGAAATCTTAGGTGGTATTCCGA	1
ACGAAATGAAAATTTTTGGGTGTC	1
ACGAAATGAAAATTTTTGGGTGTCA	1
ACGAAATGAGTTTTGGGGGAAGAC	1
ACGAAATGCCACCCACTAGAATGC	1
ACGAAATGGTGATTGAGAGTGCT	1
ACGAAATGTCGAGTAGTGAGTGCA	1
ACGAAATGTGGCTAGTGTTTGGT	1
ACGAAATGTTTTGGTGTGTCAC	1
ACGAAATTCTGTAGGTACTACGCC	2
ACGAAATTGGAGAGGTCAACGTTC	1
ACGAAATTTGTGGTGTGGGTGAAA	1
ACGAACAACACTAAAAGAGTGCAG	2
ACGAACAACGGGTATCTCGGTGCA	1
ACGAACAAGACTACTGGTGATGGG	3
ACGAACAAGAGGAGTAAACGACGC	1
ACGAACAAGTTGGTGTCATTGTCG	1
ACGAACACAACGGTGTAATCGG	1
ACGAACACAACGGTGTAATCGGA	3
ACGAACACAACGGTGTAATCGGAT	2
ACGAACACAATGGTGTAATCGGA	1
ACGAACACAATGGTGTAATCGGAT	5
ACGAACACAATGGTGTAATTGGA	4
ACGAACACTACGGTATTCCCAGC	1
ACGAACAGAGCCTAAATGAAGTGC	2
ACGAACAGCGAGGAACCGGGCCTA	1
ACGAACAGGGCCGTCCGTACACAC	6
ACGAACAGTCAAACATGTGCTAAA	2
ACGAACATAATGGTGTAATCGGA	1
ACGAACATGGGGCTGTTTGGCCAA	1
ACGAACATGTAAACCTGTGCTTAA	1
ACGAACATGTGCATTATGTGGCAA	2
ACGAACATTGCCAAGCTATTTTAG	1
ACGAACATTGTGGTGCGAATGGTC	2
ACGAACCAAGAGGTGCCCAGCCA	1
ACGAACCAGTAAAAACAGGCAAGC	1
ACGAACCATTATGTCGAGGGGATC	3
ACGAACCGACGTGACAGGAGGAGG	1
ACGAACCGCCGCTAATACCGAGGG	1
ACGAACCGCGGACAGGGAGTGAAC	1
ACGAACCGGGACTACAAAGGGTT	1
ACGAACCGGGACTACAAAGGGTTT	1
ACGAACCGGGACTACATAGGGTT	1
ACGAACCGTGAGTGAAGACACTTT	1
ACGAACCTAGACACACGCGTGTCC	1
ACGAACCTATTGCAGTGCCACCT	3
ACGAACCTCTAATGAACAGTAGTA	1
ACGAACGATCAAAGTTAGGCGCGG	1
ACGAACGATTAAAGTTGAGTGCGA	1
ACGAACGCAGCGACGATATTGTGG	1
ACGAACGCCCTAAGAGAGGTGGTA	1
ACGAACGGACGGTGGCTGCGGCGA	1
ACGAACGGAGACAACGACGATGGA	1
ACGAACGGATGGATGGATGACGCG	1
ACGAACGGGTACAACGCAGTTTGT	1
ACGAACGGTAAAAACATGTGCTAA	1
ACGAACGGTCAAACATATGCTAAA	1
ACGAACGGTCAAACATGTAAGTCA	1
ACGAACGGTCAAACATGTGCTAAA	5
ACGAACGGTCAAAGTTGGGCGCGG	3
ACGAACGGTCATATATGTGCTTAA	1
ACGAACGGTCCAACGTTGAACGTG	2
ACGAACGGTGAAACGTTGAACGTG	1
ACGAACGGTGCAGTAACATGACGA	1
ACGAACGGTTAAACATGTACTAA	1
ACGAACGGTTAAACATGTGCTAAA	1
ACGAACGGTTAAACATGTGCTAAG	2
ACGAACGTGGTGTTTCATTTCAAA	1
ACGAACTAAACAGGCCCAGCCCTA	1
ACGAACTAAACGGGGCCTTAGAGC	1
ACGAACTATGGCAACGGTCTAAC	5
ACGAACTCCAAGACGCAGTGTGTG	1
ACGAACTGAGGCCTCATTGCTGAA	1
ACGAACTGCCTTAAGGAAGTCGAT	1
ACGAACTGCGGGTTTGTCTGGATG	2
ACGAACTGGTGCAGGTCCGCTCAA	1
ACGAACTTACAAGGTGTGTATCGA	1
ACGAACTTAGAATTGGGTGTGACA	1
ACGAACTTTGTAAGGTGGGTGTA	1
ACGAACTTTGTAAGGTGGGTGTAG	1
ACGAAGAAATCGGTGTCGCCA	2
ACGAAGACAGCGTTGTGCTACTGC	1
ACGAAGACCAGGTCAATGCGACGC	1
ACGAAGACCTAGTCAAAGGAGCCA	1
ACGAAGACTACAGGGGAGGTGAGG	1
ACGAAGAGATGGCGACGGGAGCA	1
ACGAAGAGGGTGCCAGTGGAGCC	1
ACGAAGAGGTGGCAAAAAGGTTGC	1
ACGAAGAGTGCTTACAATCTGTCT	1
ACGAAGATGCCAGCATTGCTA	1
ACGAAGATGGCCTGGGCTCTCCA	1
ACGAAGATGGGTGTCGTTTTACAG	1
ACGAAGCAAAACGAATACGGTGAC	1
ACGAAGCAGACCTACAAAGATATT	5
ACGAAGCCAATATGTTGCCTTGAA	1
ACGAAGCCCTGAGGATTGAATTGC	1
ACGAAGCCTTAGTACTAGATGTGA	5
ACGAAGCGAAACGAATACGGTGAC	5
ACGAAGCTGTGGTGTAGTGATTGC	1
ACGAAGGAAGTAAGGTGCTAAGAG	1
ACGAAGGAAGTATATATGATCTGC	1
ACGAAGGATTTGCCCGGGTATTAC	1
ACGAAGGCGGTCGACGGTGAAAGC	1
ACGAAGGGACACGCGGGTCTTCAC	2
ACGAAGGGAGTAACTCGTAGGTGA	1
ACGAAGGGAGTAGCTAGTTAGCTA	1
ACGAAGGTACCATTTATAGTGAAGG	1
ACGAAGGTAGTATTAAGATGTGTC	1
ACGAAGGTGACATGGCATGTCCAT	1
ACGAAGGTTGGTCTCATTCGAAAG	1
ACGAAGTAACTTTTGGGGAAACAC	1
ACGAAGTCACAACGGATGTATTGC	1
ACGAAGTCACTAAGAATATCGTGC	1
ACGAAGTCACTTTTGGGGAAA	1
ACGAAGTCATCACGGGTGTTTCGC	2
ACGAAGTCGATCCTCTCCATCAAA	1
ACGAAGTGAGTTGTTGCCACGATCGT	1
ACGAAGTGATTTTTTGCCACGAAC	1
ACGAAGTGCGAATACGGCCATGGC	2
ACGAAGTGGCACCTCACGCCGTGC	1
ACGAAGTGGTGCTAACTATGTTGG	2
ACGAAGTTAGATACGAGATGGCAC	1
ACGAAGTTGATTTAGGGTGTGTTT	1
ACGAAGTTGGATACGAGATGGCAC	3
ACGAAGTTTGTTTTGCTGTGGCCC	1
ACGAATAAAGGTTTAGACAGGTTC	1
ACGAATACAACGGTGTAATCAGAT	1
ACGAATACAACGGTGTACTCGGA	2
ACGAATACAACGGTGTGATCGGAT	2
ACGAATACAACGGTGTGATCGGTTC	1
ACGAATACCTAGTCAAAGGAGCCA	1
ACGAATACGAATATGGTACCAGAG	1
ACGAATAGGTGAATTGTAATGGT	1
ACGAATAGTCAAACAGTGCAAGTAA	1
ACGAATAGTCAAACGTTACAAATA	1
ACGAATAGTGCTTAACGATTTGTC	1
ACGAATATAATGGTGTAATCGGA	2
ACGAATATAATGGTGTGATCGGA	1
ACGAATATCGTGTTTAGATTCATT	1
ACGAATATGGATAATGCTAGAAAG	1
ACGAATATGGTATCAGGGTTTCCG	1
ACGAATATGGTATCAGGTTTCCGC	3
ACGAATATGTTCCGTGCCACTGAA	2
ACGAATCAGGGACAGCCTTACCGA	1
ACGAATCCAGGACTAAAAATACAC	1
ACGAATCCAGGATAAAGATGGTTA	1
ACGAATCCGGACATGACATGTGAG	1
ACGAATCCGGGACTAAAGACCGGT	1
ACGAATCGAAACGAATACGGTGAC	1
ACGAATCGACTCTCTGTCCAGATT	1
ACGAATCTAAACAGTTTATGTGTC	3
ACGAATCTAAATAGGAGGGTGTCT	4
ACGAATCTAATCAGGGAAACCGTC	1
ACGAATCTACGAATGGTTGGCTGC	2
ACGAATCTACGACTAGATATGATA	1
ACGAATCTAGAAATGATGGGTCA	2
ACGAATCTAGAATGTGTCACATCC	1
ACGAATCTAGACAAAAGAGCTGTC	2
ACGAATCTAGACAGGAAGGTGGAC	2
ACGAATCTAGACCATCCAACCAAA	2
ACGAATCTAGATAGGACAGTGGAC	1
ACGAATCTAGATCGAGATGTGTCA	1
ACGAATCTAGGATGGGACGTGAC	1
ACGAATCTATAGAGGTAGGCCG	2
ACGAATCTATAGAGGTAGGCCGCT	1
ACGAATCTATAGAGGTAGGCCGCTA	2
ACGAATCTCCTGTGTGTCACACTA	1
ACGAATCTGGAATATGTCACGTC	1
ACGAATCTGGAATATGTCACGTCC	1
ACGAATCTGGACAGAGGTGTGCTA	1
ACGAATCTGGACAGGTACTAGGAA	1
ACGAATCTGGACATGTCCTAGGAT	1
ACGAATCTGGACTAGGATGTGTCA	1
ACGAATCTGGATACTAGTATGTGT	4
ACGAATCTGGATAGAGAGGTGTCT	2
ACGAATCTGGATGGGAAGCTTGTC	1
ACGAATCTTGGCGTTGAGGTCTAA	1
ACGAATCTTTTGAGCCTAATTAGT	1
ACGAATGACCGTTTGATTGGACCA	1
ACGAATGCGAACAGGAGGAGGCCA	1
ACGAATGGAGTTTATGGACGTCAAC	1
ACGAATGGTCAAACATGTGCTA	1
ACGAATGGTCAAACGAATATCAA	1
ACGAATGGTCAAACGTTAAATAAA	1
ACGAATGGTCAAACGTTAATCGA	1
ACGAATGGTCAAACGTTGAACGTG	1
ACGAATGGTCAAACGTTGATCGAA	1
ACGAATGGTCAAACGTTGGTCGAA	3
ACGAATGGTCAAAGATGTCAACGG	1
ACGAATGGTCAAAGTTGGACGCG	1
ACGAATGGTCAAAGTTGGACGCGG	1
ACGAATGGTCAAATATTAGACAAA	1
ACGAATGGTCAAATGTTGAATGTG	1
ACGAATGGTCAAATGTTGGTTGA	1
ACGAATGGTCCTTAACGATTTGCC	1
ACGAATGGTCGAACGTTATGTGAA	1
ACGAATGGTGAAACGTTGAACACG	1
ACGAATGGTGAAACGTTGAATACG	1
ACGAATGGTGCTTAACGATTTGC	1
ACGAATGGTGCTTAACGATTTGCC	1
ACGAATGGTGCTTAACGATTTGCT	1
ACGAATGGTGCTTAATGATTTGTC	3
ACGAATGGTGGATGATTGTGATTG	1
ACGAATGGTTAAACGGTGCAATCA	1
ACGAATGGTTAAACGTTGGTCGAA	1
ACGAATGGTTGTCCTAAGTTGGGT	1
ACGAATGGTTTGTGGGCTCGA	7
ACGAATGTGGACAGACTTATTCGT	1
ACGAATGTGGTGCAGTACAAGATA	1
ACGAATGTTGCTTAACGATTTGTC	1
ACGAATTAGAAGTGATAGTGGA	1
ACGAATTAGGATTGTATTAGGAGG	1
ACGAATTAGGTTGGGTGGATCAGA	1
ACGAATTATAAGACGCAGTGTGTA	1
ACGAATTATCATAGGTGAGATGTA	1
ACGAATTCCCACAGTGAATTTTAC	2
ACGAATTCCTACCTACGAACTTGG	1
ACGAATTCTTGTGTTGTGTTGTGG	1
ACGAATTGAATCTGGATAAATGGT	1
ACGAATTGAATGGTAAATAGTCTA	1
ACGAATTGGATCGGTGGCTTACAG	1
ACGAATTGTATGTGCCAATTGCCA	1
ACGAATTGTGAGAAGAAGTACTGC	1
ACGAATTTAATGGTGCAATCGGA	1
ACGAATTTAATGGTGCAATCGGAT	3
ACGAATTTAATGGTGTAATCGGAT	1
ACGAATTTAATGGTGTAATTGGA	1
ACGAATTTAGTGGTGCAATCGGA	1
ACGAATTTGAACATAGTCATGTTT	2
ACGAATTTTTAGGAACAGGTCGTC	1
ACGACAAAGTGTTGGATGGCAAAA	1
ACGACAACAAATTTTGGACGGAGC	1
ACGACAAGCTCTGATGGTGAACAC	1
ACGACAAGGACTACTCGGATTGTA	1
ACGACAAGGATAGTCGTGCCAAGC	1
ACGACACATTGGGCCAAAATTCAC	1
ACGACACCCTTCAGATGAGACAGA	1
ACGACACCGAGGCACGATATTTGA	1
ACGACACCTTCGTCCATACAGTGC	1
ACGACACGAGGTGGTTGGGTGACC	1
ACGACACGGACGACTGTACGATGG	1
ACGACACTGGTGCGGTGTGTTGGA	2
ACGACAGAGTGTCTAAGATGTGTC	3
ACGACAGCCCGCCCGGCCGCCGC	6
ACGACAGCGCTGGTAACATGTTGT	1
ACGACAGCTCTAGTGTCACGGTGG	1
ACGACAGCTTGGGTGAAGGTGGAC	1
ACGACAGGAGCGTCCGATGCATGC	1
ACGACAGGGACATTTATATGGGCA	1
ACGACAGGGCTAACGGCTTGGAC	1
ACGACAGGTGCACATTACGTTTGC	1
ACGACAGGTTGATGTGATGGAAAA	1
ACGACAGTGAGGTCACACCGTGCC	1
ACGACATAACCGACTAGGTGGCCA	1
ACGACATCGACCGCGTCCTCTACG	2
ACGACATGACCAATCAGGTTG	2
ACGACATGAGAAAGACGATGCGAG	1
ACGACATGTCCAGCTTCGGTGGAG	2
ACGACATGTGTTGCCCTACACCTC	2
ACGACATTCAGCGCCAGTTGATGT	1
ACGACATTTGCTAGTTGGTGTGCA	1
ACGACCAAATTATACTGAGACTGC	1
ACGACCAAGGCCTACGTTTAATAC	1
ACGACCACATGGGTGGAATGGGAC	2
ACGACCACCCTGCCAAGATTGAAG	1
ACGACCACGGTATTTAGATGGTAT	3
ACGACCACTGCAGCAGTTCCCTAGA	1
ACGACCAGGAACCATGGATGCGTA	1
ACGACCCATCATTTGACCCAGG	1
ACGACCCGACAACTGGTGGGCTGT	1
ACGACCGCGATAATTCAGGGGTGTA	2
ACGACCGCGATAATTCGAGGGGTA	1
ACGACCGCGATAGTTCAGGAGGGG	2
ACGACCGCGATAGTTCAGGGGT	1
ACGACCGCGATAGTTCGGGGGTAA	1
ACGACCGGTCTCTAAACTTGTGCG	1
ACGACCGGTGGGGATGGAAACGAC	2
ACGACCGGTGTCCTATAACCAAT	4
ACGACCGTAACTAAGACCTACTGA	1
ACGACCGTTTGGTAAGGTGGCTGG	1
ACGACCTACGGATATAGGAGGAG	1
ACGACCTAGGAGTGTTTGTAGAAA	1
ACGACCTAGGTTCGAAGCCTCACC	2
ACGACCTATGTCCGGTGGTGTGG	1
ACGACCTATGTCCGGTGGTGTGGT	1
ACGACCTCGTCCTACGCCGCGTCC	1
ACGACCTGATGGACCACCACCTAA	1
ACGACGAAATAGGAGGGTGTTGGC	2
ACGACGAACTGCTACTGTTGCTGC	2
ACGACGACCGACGGGTTGAGGGAC	2
ACGACGACGACGGTGTGAAGACAG	1
ACGACGAGAATCTGTAGGTGAC	1
ACGACGAGATGGGGATATAATGTA	1
ACGACGAGCTGAACGATGGTGTAG	1
ACGACGAGGATGCTGTTGGGATGG	1
ACGACGAGTATGGTATGGTGGACC	3
ACGACGCAAGTGACAGGTAGTCGA	1
ACGACGCAAGTGGCGTGATGTGAT	1
ACGACGCAGGGCGCTGACTGTCGG	1
ACGACGCATCCTATTGCTACGAA	1
ACGACGCTCGATGGATCGTGACCA	1
ACGACGCTGTGGATGATCTTGGTC	1
ACGACGGAAGTGTTACGGGGTGAA	1
ACGACGGAGCTCGCAATAGGTGTA	1
ACGACGGCGAATATTAAATATTCA	1
ACGACGGGAGTGACCAATGGGTGA	1
ACGACGGGGACACCGTCAGTGCCA	3
ACGACGGTGGATCCTGGGTGGCGGC	1
ACGACGGTGTTGAGTGCGGAGATA	1
ACGACGTACATATAAGCAGGA	1
ACGACGTAGTATTTTGTGTGGTAC	1
ACGACGTATATCGGTGTTCGC	3
ACGACGTGCCTATGAGTGATCATG	2
ACGACGTTGAGGTGCGCTCTTCAC	1
ACGACGTTTTGGAGTCCGTGCTGC	4
ACGACTAAAGTATTCTGTGGGCCA	1
ACGACTAATTTGTTGTCGGGCTGC	2
ACGACTAGAGGTTGAGGTAGTG	1
ACGACTAGCAGCGTGTTGGGACCC	1
ACGACTAGTTAAAAAAGATGGTAC	1
ACGACTAGTTTTTGAGGGGCTCGA	2
ACGACTCACACGAGACGGTGCGAA	1
ACGACTCACACTAGACGGTGCGAA	1
ACGACTCACAGTATATAACAGCGG	3
ACGACTCACATGAGACGGTGCAAGA	1
ACGACTCAGTACGAGACGGTGCGA	1
ACGACTCATGTCTGGATTGTGCAC	1
ACGACTGAGGTGGTGTTTGGATAC	2
ACGACTGATGTCGGTGACCAAGGC	1
ACGACTGATTGCTTGTGGATTGAG	2
ACGACTGGGTGCGTGCGGGCCGTC	1
ACGACTGGTGACGATAATCGAGAG	2
ACGACTGGTGTGTGCGGGTGGTGG	1
ACGACTGTGCAGGTGCGAGCCAGC	1
ACGACTGTGGTGATATGAGAGAAGG	1
ACGACTTAGCATAGCGAGAGGTAGC	1
ACGACTTATAGTCTGAAACAGAGG	1
ACGACTTCAGCGTCTTGGTCGGTC	1
ACGACTTGATGTAGAGCCTGACC	3
ACGACTTGCACGGTGCAGACCA	1
ACGAGAAATGTTGATGAGTAC	2
ACGAGAAATTGAACAAAAAGCTGC	1
ACGAGAAATTGGAGTTAGGGCGAC	1
ACGAGAAGTTGCGAACATGGTGTT	1
ACGAGAATGATTATCGTCGGGTGA	1
ACGAGAATGGTGAGTACTTATAGG	1
ACGAGAATTGGTAAATGGACCAGC	1
ACGAGACACTTCATAATACAACGA	3
ACGAGACACTTTATAGTACAACGA	2
ACGAGACATGGTTTCTACACAACA	1
ACGAGACCTAAAAGTGAATGGATG	6
ACGAGACCTAAAAGTGGATGGAT	2
ACGAGACCTAAAAGTGGATGGATGA	1
ACGAGACCTAAAGTGGATGGATGC	1
ACGAGACTATGCATGATTACTCAT	1
ACGAGAGAAAATATAATGATGCCA	1
ACGAGAGAGAATAGCTGCCGGTGA	1
ACGAGAGATGTTAATAGTTGTGCA	1
ACGAGAGCTCCAATAACAACGACT	1
ACGAGAGGAACTCGAGTGCCATTC	1
ACGAGAGGATGTCGCCTTGAGGGA	1
ACGAGAGGGTGCGCAAATTTGGAC	1
ACGAGAGGGTGCGCAAATTTGGAT	1
ACGAGAGGTGCACTGGTCACAGAC	1
ACGAGAGGTGTAGCTAGATTTA	1
ACGAGAGGTGTGACCATATATTAA	1
ACGAGAGTTGGCCTGAGATTGCAC	2
ACGAGATAGATAGGTGGACCATAT	1
ACGAGATCTCAACCCTACGATTAA	3
ACGAGATGACACACGGTGGATGGA	1
ACGAGATGACATACGGTGGATGGA	2
ACGAGATGACGGCCTGATTTGTAG	1
ACGAGATGAGCCATTAGCACATGA	2
ACGAGATGCCCATGGTGAACTTAG	1
ACGAGATGCTCGTGGTGATGTCA	1
ACGAGATGGACTACGATGATGGAT	1
ACGAGATGGCATACGGTAGATGGA	1
ACGAGATGGCATACGGTGGATGGA	9
ACGAGATGGCTCTGGTACCACAGA	1
ACGAGATGGTATACGGTGGATGGAC	1
ACGAGATGTGCAGTGAGGTTCTTA	1
ACGAGATTAGGAGCGCCACGTCAG	3
ACGAGATTGTGACGGTTATTTTAA	3
ACGAGCAAATACTTCGGGTGTCCC	1
ACGAGCAAGGACGCGGAAGAGGAC	1
ACGAGCAGATTTGTGCTGTGGGTA	1
ACGAGCAGTGAAAGCACGCTCAGC	2
ACGAGCATAGAGCGGTTGAATTGG	1
ACGAGCCAATGAGGTAAGGGGTTC	1
ACGAGCCATGGTTGTGACCCGTCA	1
ACGAGCCGAGCCGAGCCAGTCACA	1
ACGAGCCTATGACAGTGGAACCCA	1
ACGAGCCTATGTGGTTCGGGATGC	1
ACGAGCCTGTACCAATGGATATGG	1
ACGAGCGAGGACTACCCACTAT	1
ACGAGCGGATGATGGCGGAGGCGG	1
ACGAGCGGCCCGATGGCGTCAGTC	1
ACGAGCGGTGCTTAACAATTTGCT	1
ACGAGCGGTGGCAGCGATCCACGT	1
ACGAGCTACTACACCGACAATGAC	1
ACGAGCTCACGAAGGTGTGGTCAC	2
ACGAGCTCCTGCTTGTGCCATAGG	1
ACGAGCTGGATTGAGGATTGAGGA	1
ACGAGGAATGCCTAGTAAGCGCGA	1
ACGAGGAATGTCTATCAATTTCAG	3
ACGAGGACGGCCTCACCAGCGCAC	1
ACGAGGACTAAACGGGTGAATGGT	1
ACGAGGACTTGATTGGTCCGCCTA	1
ACGAGGAGTGCAACGCAACTAGG	1
ACGAGGAGTTTGTTGTCGATACGA	4
ACGAGGATATTTTCGGTGTGTCTG	1
ACGAGGATCTACACGATATGGCAT	1
ACGAGGATGGAGGATAGCGGTGGG	1
ACGAGGATTGGTGTACCTTGCAG	2
ACGAGGATTGGTGTACCTTGCAGC	2
ACGAGGCAATGCATGAGAGAGCT	1
ACGAGGCCACGCAGAACAAGGCGG	1
ACGAGGCCTAAATTGGTTACCGGT	1
ACGAGGCGGCCAGTCGGTGATGA	1
ACGAGGCTGTTTAAAACGGATGGA	1
ACGAGGGAACTAGCCGACATTGAC	1
ACGAGGGAAGGTGCAGATTTGGCA	1
ACGAGGGAGTACTCTGTAGGTCGC	2
ACGAGGGGGCGAAATAATGGGCGC	1
ACGAGGGTGAAGCTTAGGGTGCTA	3
ACGAGGGTGCGATGTTTTCTACT	2
ACGAGGGTGCGATGTTTTCTACTG	1
ACGAGGGTTGCTCATTGATCGGAG	1
ACGAGGTAAGCCATTAGCGCATAA	1
ACGAGGTAATATGAGGTACGAGA	1
ACGAGGTACCAAATTTTACACTAA	1
ACGAGGTACTACTAGTAAGATGCA	1
ACGAGGTATGTGTGCAAGCGT	1
ACGAGGTCGTCGACGCAGAGTGAT	3
ACGAGGTCTTAAGATGGTTTGGAT	1
ACGAGGTGAATCATTAGCGCATG	1
ACGAGGTGACCCGATGTGAGGATTGA	1
ACGAGGTGAGCCATTAACACATG	1
ACGAGGTGAGCCATTAACACATGA	1
ACGAGGTGAGCCATTAACATATGA	1
ACGAGGTGAGCCATTAGCACATGA	1
ACGAGGTGAGCCATTAGCATGTG	1
ACGAGGTGAGCCATTAGCATGTGA	1
ACGAGGTGAGCCATTAGCGCATG	1
ACGAGGTGAGCCATTAGCGCATGA	2
ACGAGGTGAGCCATTAGCGTATAA	1
ACGAGGTGAGCCATTAGCGTATGA	3
ACGAGGTGAGCCATTAGTACATGA	1
ACGAGGTGAGCCATTAGTGCATGA	1
ACGAGGTGAGCCATTAGTGTATG	1
ACGAGGTGAGCTATTAGAGTATGA	1
ACGAGGTGAGCTATTAGCGCATGA	2
ACGAGGTGAGCTATTAGCGTATGA	1
ACGAGGTGAGCTATTAGTGCAT	1
ACGAGGTGAGCTATTAGTGCATGA	3
ACGAGGTGAGGGACCAATCAAGGA	1
ACGAGGTGAGTCATTAGCGTATGA	1
ACGAGGTGAGTCATTAGTATATGA	1
ACGAGGTGAGTCATTAGTGCATGA	1
ACGAGGTGAGTCATTAGTGTATGA	5
ACGAGGTGAGTTGACACGTGGCCT	1
ACGAGGTGATAAGCAGATACGTGC	2
ACGAGGTGATAATAACGTGTGATT	1
ACGAGGTGCAGCGAAGAAGCTTGA	1
ACGAGGTGCATGATTAATCAAGT	1
ACGAGGTGCTATACCTGATATGGG	1
ACGAGGTGCTATATCTGACATGGG	2
ACGAGGTGCTCGTAATGACTTTGT	1
ACGAGGTGCTTGCACTGTTACTGC	1
ACGAGGTGGATCTAGGTTTAGGCA	4
ACGAGGTGGTACTAACATATTGTA	1
ACGAGGTGGTATTAACGTATGATT	1
ACGAGGTGGTGAGCGAGGCCGTTC	1
ACGAGGTGGTTAGTATAGTGATGGC	1
ACGAGGTGGTTATGATGACTTCAT	1
ACGAGGTGTAGCGTGTGGTTCC	1
ACGAGGTGTATCGCGAGACGC	1
ACGAGGTGTCTCTGGTGACTTTGT	2
ACGAGGTGTGATGGGTTAGACTCA	1
ACGAGGTGTGCGTGCAAGCATCGG	1
ACGAGGTGTGCGTGCAAGCGTCGG	4
ACGAGGTGTGGTGGGCTAGACGAC	2
ACGAGGTGTGTAGTTTCAATTCTA	1
ACGAGGTGTTGTGCAAGTATAGAA	1
ACGAGGTTCAGCCGAAGCTACATCC	1
ACGAGGTTGGGGCCGATCAGATC	1
ACGAGGTTGGTGGGGTATTTTCGA	2
ACGAGTACCTTCGGAAGATTGAGC	1
ACGAGTACGCCTCCTGTTGTGCCC	1
ACGAGTACGTCGCCTATCACTGAA	2
ACGAGTACTAAATATGTATGGGAT	1
ACGAGTAGTGCCGTGTTGTACGTA	1
ACGAGTATCGACCTACACAAGTTA	1
ACGAGTATTTGGGGATACAAATGG	1
ACGAGTATTTTACAAGTTCGTGCA	1
ACGAGTCAAACGTTGGGCACGGAT	1
ACGAGTCAGGCTAGTCTCAGGTC	2
ACGAGTCGTAGCTGAGTGGTCGAC	2
ACGAGTGAGGACAAAGTGTGCAGA	3
ACGAGTGATCAAACGTTGATTGAA	3
ACGAGTGATCTACAAGTTTAGG	1
ACGAGTGATCTGCAAGTTTAGGGA	1
ACGAGTGATCTGCAAGTTTAGTGA	1
ACGAGTGATCTGCAAGTTTATGGA	1
ACGAGTGATCTGTAAGTTTAGGGA	1
ACGAGTGATGGCGGCGTATACCTG	1
ACGAGTGATTGTGGTGACCTCGAC	1
ACGAGTGCAAGCTGATTGACCAGA	2
ACGAGTGCAAGGAGGTGCGTCTGG	1
ACGAGTGCACGCTGTCATTGGTCG	1
ACGAGTGCATCCGGCCAATTTGGT	2
ACGAGTGCCAGATTCTATACTTAT	7
ACGAGTGCGCTTATTTTCTAAGTA	1
ACGAGTGCTCTAAATTGACTCCGC	2
ACGAGTGCTTGTATTTATGGCTAA	1
ACGAGTGGGGCTGCTATACAACGG	2
ACGAGTGGTCAAACAAGGAAAGCA	1
ACGAGTGGTCAAACAGTAAAAGTA	1
ACGAGTGGTCAAACAGTGCAAGCA	1
ACGAGTGGTCAAACGTTGCAAGTA	1
ACGAGTGGTCAAACGTTGCAATCA	1
ACGAGTGGTGAAACGTTGCAAGCA	1
ACGAGTGGTGAGGACACGTGGTAC	1
ACGAGTGGTGCTAAATAATTTACC	1
ACGAGTGGTGCTAAATTATTTAC	1
ACGAGTGGTGCTAAATTATTTACC	1
ACGAGTGGTGCTAAATTATTTATC	1
ACGAGTGGTGCTAAATTATTTGCC	5
ACGAGTGGTGCTAAATTATTTGCT	2
ACGAGTGGTGCTAAATTATTTGCTA	2
ACGAGTGGTGCTAAATTATTTGTC	7
ACGAGTGGTGCTTAACAATTTGCC	2
ACGAGTGGTGCTTAACGATTTACC	1
ACGAGTGGTGCTTAACGATTTGCC	15
ACGAGTGGTGCTTAATAATTTGCC	2
ACGAGTGGTGCTTAATGATTTGCC	4
ACGAGTGGTGTTAAATGATTTGCC	1
ACGAGTGGTGTTGACGTGACACTT	1
ACGAGTGTACTACAGACCAGGTTC	1
ACGAGTGTCCTCAAGAGGTGGC	1
ACGAGTGTCTAAGTTTGTATTGAG	1
ACGAGTGTCTGAGTTTGGATTGAG	1
ACGAGTGTGCACATGATCCCCTTC	3
ACGAGTGTTAGTGCTATAGATAAG	1
ACGAGTGTTGGTGTATATTAGTAT	1
ACGAGTTCGTGAAAGAGATGGCCT	1
ACGAGTTCTATCGGGTAAAGCCA	1
ACGAGTTCTTCTATGCCGCTATCA	2
ACGAGTTCTTGCTTTCGAGTTGGG	5
ACGAGTTGCAAAACAGGATGGTGAT	1
ACGAGTTGGGGTCTTACAAACTG	2
ACGAGTTTGGGTGGTCTCGCAGAC	1
ACGATAAAAAATTGAATGGATAG	1
ACGATAAATAATAGCCATGATCAC	1
ACGATAAATGTAATGGATGAC	1
ACGATAAGATTTAGAACCAGGTAC	1
ACGATAAGGACTACTCGGATGGTA	1
ACGATAAGGTAAGTGTGATGTGCT	1
ACGATAAGTATTATCAGCCTGGAG	1
ACGATAATGGGTCTACTCATGCGG	1
ACGATACCACTGTTGTGACTAGAT	1
ACGATACCCTATATAACATCTGAT	1
ACGATACCCTTGGAATATTCTCGG	2
ACGATACCGGGAAGCCTCACTCTC	1
ACGATACGATATTACTTTGAGCAA	1
ACGATACGATCCTACAATCCGATA	1
ACGATACGCTCATGGTAGCTTCAT	1
ACGATACTGGGAAGCCTCACGCTC	1
ACGATAGAAATGGCCGCCGGTGGG	1
ACGATAGACGGAGCTCTAGGCGGC	1
ACGATAGACGGTGTGGTGCAATGCC	1
ACGATAGCAATACTGAAGGGGTGA	1
ACGATAGCCAATAAGGTAGGATGC	1
ACGATAGGACACTCGTATGGGGCA	1
ACGATAGGACTTCTAATTGCA	1
ACGATAGGGTGTGCATGTGTATA	1
ACGATAGGGTGTGCATGTGTATAT	1
ACGATAGTGGCATGAAAGGGTGTA	2
ACGATAGTGTACGTGCTGCGT	1
ACGATAGTTTTGTGAGTAGTTTGC	1
ACGATATCCTATATAATACCCGA	1
ACGATATCGAGGTTCCTGATGGA	1
ACGATATCGGTTGGGTGCCACTAC	2
ACGATATCGGTTGGGTGCCACTCC	1
ACGATATGATGCCAGCCGATGCGC	1
ACGATATGCAACGGAATGATGGA	2
ACGATATGGTAAGTTGGGAATCCC	1
ACGATATGTCCACCATAGTGTCTC	1
ACGATATGTGTTGTGTTTGATTGC	1
ACGATATTAGCTGGGTGCCATTGA	1
ACGATCAAAAATGATTTGGTGTC	3
ACGATCAAAAATGATTTGGTGTCA	3
ACGATCAAAATTGAGCGCGGGTAC	1
ACGATCAAAGTTGAACGTGCAAAC	1
ACGATCAAAGTTGGGTGCGAAAAC	1
ACGATCAAGGATGCCGGGTGACAA	1
ACGATCAAGGATGCCGGGTGACAAG	1
ACGATCACGTGACGATGGAAACGC	1
ACGATCAGAAATGATTTGGTACCG	1
ACGATCAGGACGCGTTTACATGGA	1
ACGATCAGTTGGATGGGCAACCCC	3
ACGATCCACTGAGATCCAGCCCCGC	1
ACGATCCAGGAGAAGTTGACGGGC	1
ACGATCCGAAACGATTTGGTACCA	8
ACGATCCGGATTTGGGAGCGATGC	1
ACGATCCGGGTGCCACGTTTGGAG	1
ACGATCCTACAATTGATATCAGAG	1
ACGATCCTACGTGGTTTTGTAGAA	1
ACGATCGAGAATTGATGGAAGTGT	1
ACGATCGGAAACGATTTGGTACCA	5
ACGATCGGAAACGATTTGGTACCG	1
ACGATCGGCTGTTAGAGACTTGGA	3
ACGATCGGGTTGGCACAACAAGGC	1
ACGATCGGTGCTTGACTACAGCAA	1
ACGATCTAAACACTAGGGTTGCTC	1
ACGATCTGCGGTGGGATGACGTGA	1
ACGATCTTTGTATGCGGCCGGCGC	1
ACGATGAAGGGAGTAACGAGGT	1
ACGATGACGGTGACGATGACGACG	2
ACGATGAGACGGAAAAGTAGGAAG	1
ACGATGAGATTATAAAATGCCA	1
ACGATGAGCAGATCAAGGTGTTGAC	1
ACGATGAGCAGTTCAGTGTTGCAGT	1
ACGATGATGTGGCATCTTTGCATG	1
ACGATGCGATGGAAAAGTTAGAAG	1
ACGATGCGATGGAAAAGTTGGAAG	1
ACGATGCGGATTGAGAGCCCAACC	1
ACGATGCGTATGACAGGTTGATGT	1
ACGATGCGTCTATGGTGATCTCGT	2
ACGATGCGTTGAGACTTATTTGTT	1
ACGATGCTCCTGCGGAACGTTGAG	1
ACGATGCTGTGCATGGTCCTCGTG	1
ACGATGGAAAAACAGATGGTA	11
ACGATGGAGGCAACGAGCGCGGGC	1
ACGATGGAGGTATTATGTGCGTA	3
ACGATGGAGGTTGCAATTGACAAG	1
ACGATGGCACTGTTGGTGTTGGGC	1
ACGATGGGACAGCCGTTGAGGTAG	1
ACGATGGGTGAGAGACGAACCTGC	1
ACGATGGTCATTCGATAGGTAC	1
ACGATGGTCCATGATATGAGTAAC	1
ACGATGGTCCATGATTGGTAGGAA	1
ACGATGTACCTGTCGATAGCAAG	1
ACGATGTACTAGGATGTGATACAT	1
ACGATGTAGGGGTTTCATTTTC	1
ACGATGTAGTCCAAAAGGGTCCTG	1
ACGATGTCATAGCTAATTACACGT	1
ACGATGTCTTGGAGTCCGTGCTGC	1
ACGATGTGACATGTGACAGAAAAG	1
ACGATGTGACGGAAAAGTTGGAAG	1
ACGATGTGATAAAAAAATTGGAAG	1
ACGATGTGATAGAAAAATTGGAAG	1
ACGATGTGATGGAAAAGTTAGAAG	2
ACGATGTGATGGAAAAGTTGGAAG	2
ACGATGTGCTTAAAATAGGACTGA	1
ACGATGTGTATCTACAAGACTACA	1
ACGATGTGTCTGACCCTATGT	1
ACGATGTGTTCCTATCTATCTG	3
ACGATGTTCCACCAAGTATATCGG	1
ACGATTAACGAGGATTGGTGTACC	8
ACGATTACGTATCTTACGCTGTGT	2
ACGATTAGAGGGTGTCTGGTTGAT	1
ACGATTCAAAGTAGTGGTGCTTGTG	1
ACGATTCATGGGGCTATATAAGTG	5
ACGATTCCTGAGTTTGTACTTGCA	1
ACGATTCGGGATTTGAGGTATGCT	1
ACGATTCTACTACCACTAAGTGTG	1
ACGATTGAAAATGTTTTGGTACTG	1
ACGATTGAAGGACCACGAGAATGC	1
ACGATTGAATACGAGTTTGCGAGC	2
ACGATTGACAAGGATTGGTGTACC	2
ACGATTGAGATCTGCAGCTGTTAA	1
ACGATTGATTGGTTGTTGTTTCAA	1
ACGATTGCAAAAATCAAAGGTGTC	1
ACGATTGGCGAAAGTGTGCCATC	1
ACGATTGGGGCCATGAATCAAGG	1
ACGATTGGTCAAACGTTGGTTAAA	1
ACGATTGGTGCAAGCACACTCTAG	1
ACGATTGTAGGAGTGCTATATGAC	1
ACGATTTACGGTGCAAATCAA	2
ACGATTTAGGTGAAACGTTGACGA	1
ACGATTTAGGTTGTTTGACGGCC	1
ACGATTTAGTACCGTGAGATGCCG	2
ACGATTTGAGGGCAACAAGGTGGA	1
ACGATTTGATATCGTGAGGTAC	1
ACGATTTGATGGGTACACTTATGA	1
ACGATTTGGAAGAAACGTTGACGA	1
ACGATTTGGGACCTACATGACACA	2
ACGATTTGGGAGAAACGTTGACGA	2
ACGATTTGGGAGATACGTTGACGA	2
ACGATTTGGGGATCTGGTGTTTG	1
ACGATTTGGGTGGAGTCGCGACAC	1
ACGATTTGTATAAGTTTTGGTGTA	2
ACGATTTGTCACTGAACCCACATG	1
ACGATTTGTTCGATATGGTGTTAA	2
ACGATTTTGGTGGTGGGTATTTCA	1
ACGATTTTTACGTGTCTTGTAGCA	2
ACGATTTTTCATGGCGTTGGTCTA	2
ACGCAAAACGAGATGAGCCATTAG	1
ACGCAAAACGAGATGATAATAACG	1
ACGCAAAACGAGGAGAGCCATTA	1
ACGCAAAACGAGGTAAGCCATTAG	2
ACGCAAAACGAGGTGAGCCATTA	2
ACGCAAAACGAGGTGAGCCATTAG	1
ACGCAAAACGAGGTGAGCCATTAGC	1
ACGCAAAACGAGGTGAGCTATTA	2
ACGCAAAACGAGGTGAGCTATTAGC	2
ACGCAAAACGAGGTGGGCCATTA	1
ACGCAAAACGAGGTGGGCCATTAG	6
ACGCAAAACGAGGTGGGCCATTAGC	1
ACGCAAAACTCAACTGGGGTCTG	1
ACGCAAAACTTGATAGTGTCTA	1
ACGCAAAATAAGATCCTTGTACCG	1
ACGCAAACACTACACCTATGTGCA	1
ACGCAAAGAGATGATGGTGTTGGA	1
ACGCAAATGAGGTGCTGTGAATGG	4
ACGCAACACCACACACGATGTGTC	1
ACGCAACAGTGATACGATGGCGAC	1
ACGCAACCTTCAGACGCCGGCTAG	1
ACGCAACGAGAATGATGAGATCAA	1
ACGCAACGGTGTAATCGGATCGTA	1
ACGCAACGTGTAGGTGCTGCTCGG	1
ACGCAAGAGTATATTGAGGTGTA	1
ACGCAAGGGAGGCGAGATGTCGGC	2
ACGCAAGGGTGAGCGATATCGTGC	3
ACGCAAGGTGTTCGACGAAATGTC	1
ACGCAATATATGTATTACAGGTGG	5
ACGCAATATGTGTATGATAGGTGG	1
ACGCAATCGATGAGGATGTGGTTC	1
ACGCAATGTATGTATGACAGGTGG	1
ACGCAATGTGTATATGACAGGTGA	3
ACGCAATGTGTATATGACGGTGG	1
ACGCAATGTGTATATGATAGGTGG	2
ACGCAATGTGTCTATGACAGGTGG	1
ACGCAATGTGTGTATAACGGGTGG	5
ACGCAATGTGTGTATGACAGGTGA	3
ACGCAATGTGTGTATGACAGGTGGA	1
ACGCAATGTGTGTATGATATGTGG	2
ACGCAATTAGTTATTTTTAGCCTA	1
ACGCACAAATCGAGAAATGGTCCA	2
ACGCACAACGAGGAGATGTCAGCC	1
ACGCACAATCGATATGGTGGCGGC	1
ACGCACAGTAAAGCCGATTGAGAT	1
ACGCACATTGCATCTTGGAGTC	1
ACGCACCCTGTTGTACGTGAA	1
ACGCACCGTCGCCACTTGCGCATC	1
ACGCACCGTTTATTAGTTTAGGAA	1
ACGCACGAGGTTGGTTGATATGGG	1
ACGCACGGAAAAAGATAGAGGTGA	1
ACGCACTAATTTAGCTAGGTGTAC	1
ACGCACTCAAGCTGCCACGTGGGA	1
ACGCAGAAGGCTATTCGATGTGTC	1
ACGCAGACGCTTGGTGACGATATA	1
ACGCAGAGCACTGCTAGTTGT	1
ACGCAGCCTATAGTGGTGAGTTC	1
ACGCAGCGTCCGGCATGCCG	1
ACGCAGCTTATGTGGTCCGCCTGC	1
ACGCAGGAACAACGATAGGTGTGC	2
ACGCAGGAATTAGATGAGAGATATA	1
ACGCAGGATGGGCTGATAGGATGG	1
ACGCAGTGTCTGTATGACAGGTGG	1
ACGCAGTGTGTATATGACATGTGG	1
ACGCAGTGTGTCTATAACATGTGG	1
ACGCAGTGTGTCTGTGACAGGTGG	1
ACGCAGTGTGTGTATAACAGGTGG	1
ACGCATAAGGTGTCCCATTTCA	1
ACGCATAATTGTTGATAGGTACG	1
ACGCATAGTAAGACGTTGGGTTGC	1
ACGCATAGTAAGACGTTGGGTTGCA	1
ACGCATATAGTAATAATAGTGTAC	1
ACGCATCGGGACACCGTATTAGGT	1
ACGCATCTCTTGGGGCCTGTTCAC	1
ACGCATGCGTAAGGAGGTTGGGGG	1
ACGCATGGAAGAAACCGATGTAGC	2
ACGCATGGATTTGATGAGTGAGAT	1
ACGCATGTACACTCATTCCCATGA	1
ACGCATGTGCATTTGGAAATGAAG	1
ACGCATGTTGATAATGGTTCGTGC	1
ACGCATTGCAGCCTATTCAGTGTA	1
ACGCATTGTGGATACCTACGTTTGT	2
ACGCCAAAACTTTACACCCCTGGA	1
ACGCCAAAACTTTATGACTCTGGA	1
ACGCCAAAATTGAAAGTTTGGTTGA	2
ACGCCAAACAATAATACGTAAG	1
ACGCCAAAGGTAAACTTATCTGGA	1
ACGCCAAATGAAAGATGGAGGATC	1
ACGCCAACAACGGTATTAGGGCCC	1
ACGCCAAGCTAGCAGACTTCGGGC	1
ACGCCAAGTGGCAGTCTAGAAATC	1
ACGCCAATAAGGCTGATGCCACCC	1
ACGCCAATCCGCCTGAAAAGATGG	1
ACGCCAATGAGATCGGCATGGTC	1
ACGCCACACCATCGACTACATGGC	1
ACGCCACCGATTGGGTAGCTCGA	1
ACGCCACCGCCTCTCTAGCCGCCG	1
ACGCCACGCGCAGATATGCTAGCA	1
ACGCCACGGTGGCGCTTACGTGTC	2
ACGCCACGTAGACAAGACCACTGT	1
ACGCCACGTAGACCAAAACCACC	2
ACGCCACGTAGGATCCGGAAGGGA	1
ACGCCACGTAGTCCAAACCACCGC	1
ACGCCACGTCAATGCCACATCGGA	1
ACGCCACGTGGACGATGACATGGA	1
ACGCCACGTGGACGATGACATGGC	1
ACGCCACGTTAGCAAAACCGCCTC	1
ACGCCACTCATAATATATGGGTA	2
ACGCCACTCCTTAGGCCCGGTGAC	1
ACGCCACTCTTTAGGCCTGGTGAC	1
ACGCCACTGGAGAGATGTGGTGGGA	2
ACGCCAGAACCCTACATCTGTGAC	1
ACGCCAGAAGCCAGCTTACAGAAG	1
ACGCCAGATCCTCACACCTCTGAC	2
ACGCCAGATCCTTGCACCTGTGAC	2
ACGCCAGATTGAGGTGCTTGGGAA	1
ACGCCAGCTAACGATCATAGATGG	1
ACGCCAGGAATGCTAATTGATGCA	2
ACGCCAGGGAGTAGTTCACGTCAG	1
ACGCCATACACAGTGGACGTGAC	1
ACGCCATAGTAGTAGTACTAGCAG	1
ACGCCATATCAACGACACGTGTAA	1
ACGCCATATTTGGAGGTCCTCCAA	1
ACGCCATGATTGGTTAGCAATGTG	1
ACGCCATGATTTGACAATGTGATG	1
ACGCCATGCCCGATTGAGATGAGG	4
ACGCCATGCCTAAAGATACACA	2
ACGCCATTGGTGATCCGCACATG	1
ACGCCCAAAGAAAACGGACGGTAC	1
ACGCCCAACCTCAGCGCCAATGAG	1
ACGCCCAATTTAAACGATTGAAAC	2
ACGCCCATCCATGTTTACCGAAGA	2
ACGCCCCTACAAGTTCAGGAGG	1
ACGCCCGCGAGCAGAGGAAGGCGG	1
ACGCCCGTGAGGTGTAAAGATGGA	1
ACGCCCGTTGGGTTATTTCCGGTC	1
ACGCCCTGGTGGGTTGGTGGCAGG	1
ACGCCCTGTAGTTTAGGTGTGTGT	2
ACGCCGAAACTTTACACACATGGA	1
ACGCCGAAAGTGCCGTCGTCGC	1
ACGCCGACATACAGGTTAGTGAGT	2
ACGCCGACATGAGTAGTTGGGTGA	1
ACGCCGACGAGTGGGATGGAGTAG	1
ACGCCGACTTAGCTGCCACGTAGG	2
ACGCCGATGAGGGTGCACATGTCC	2
ACGCCGCCGACAGGAGCTGGTGCG	1
ACGCCGCCTGACACACTAACAGGG	2
ACGCCGCCTTTGAATCGCTCGTGC	1
ACGCCGCTAGTGTGTCGCCGTTGC	1
ACGCCGCTCGACCACCCTGTGCCT	1
ACGCCGGACACGAATATCTATGGT	1
ACGCCGGCGAACGGGATGGAGTAG	1
ACGCCGGGGCAGCTATAGCCT	1
ACGCCGGTAGGACTGGTCCTACTA	1
ACGCCGGTGCTCGATACTGATGCG	1
ACGCCGGTGTCCAAATGACCGTAA	1
ACGCCGGTGTTGGTGATGTCGTC	1
ACGCCGGTTATGACGATCTAT	1
ACGCCGTCCCTCGCTTGACATGGG	2
ACGCCGTCTTAACACTGGTGGAGA	2
ACGCCGTTGTGGTGTTGTTGGCCC	1
ACGCCTAAAGCTTAAGTAGAGCTC	3
ACGCCTACACTATGCAGGCCATGC	7
ACGCCTAGTAGTAGTTAGCGGTC	1
ACGCCTATATTTATTGCGTTGCCA	2
ACGCCTATCCAGATTCGTTGTACT	1
ACGCCTATGATATATTATATGTGT	1
ACGCCTATGGTGACTTCATCAATC	1
ACGCCTATTTTAAGAAATGACACC	1
ACGCCTCCCTGACCCGGATTCTGG	1
ACGCCTCCTTCGTCAAGGGGTGGG	1
ACGCCTCGTTGCTAGCTAGCCATC	1
ACGCCTCTACAGGGTGGTGGGCTA	1
ACGCCTGACATATTTTGAACCGAG	1
ACGCCTGATGATGGAGACGGATA	1
ACGCCTGATTGAGATGTGGGTGAC	1
ACGCCTGCTTGGTGTTATCGAGGA	1
ACGCCTGGCAAAGATGTTACCGTA	1
ACGCCTGTGAAATTGGATTTCGTA	1
ACGCCTTAAACTTAACGCCGTGG	1
ACGCCTTAATTCTGAGGATGTTGC	1
ACGCCTTAGACATGGTTTGGCTAA	1
ACGCCTTATAGCCTGAAAAGGGAG	2
ACGCCTTATCAGCCGGTGTAGCTC	1
ACGCCTTCGAGCCCCGCGCCCTGT	1
ACGCCTTCTGATAAATGCCTGTAA	1
ACGCCTTGATAGTTATGGTCACGA	1
ACGCCTTGCGGTGATATGGAGTC	1
ACGCCTTGCGGTGATTGTAGTGTC	1
ACGCCTTGTGGTGATAAGGAGTC	1
ACGCCTTGTTGTTGACATATACGT	1
ACGCGAAAATGGGCCGATTTTCCC	1
ACGCGAAAGTGACGTGGGAATGAC	1
ACGCGAAATCAATCTAGGGTTTGC	1
ACGCGAAATGGGCCCTATTTTCTC	1
ACGCGAAATGGGTGCTTATGTCA	1
ACGCGAACCGATGTGGCAGGAGGA	1
ACGCGAAGGTCTGTGTGTATATGA	1
ACGCGAATATTAGAGAATGGCCTA	1
ACGCGAATGGCCCTACTAAATGCA	4
ACGCGACACTCACAACGCACGTGC	1
ACGCGACGAGGGACGGTTGGGGCA	1
ACGCGACTTCGGCATGGCGTGTTC	1
ACGCGAGCTATATGGTTTGGGGTA	1
ACGCGAGGTGGAAACCACGGGGAC	1
ACGCGAGTGTCGCTGCCACATCAC	1
ACGCGATAACAGCAACTGTGGAGC	1
ACGCGATAATTTATGGTGTGT	1
ACGCGATACTTCGGGCACTGGCCA	1
ACGCGATATCTAGGTACTGTTTGG	1
ACGCGATGGTAAGATGGTCCACGC	1
ACGCGATGTAACACCTATGCCGC	1
ACGCGATGTAACGTTGATACGAGT	1
ACGCGATGTGCGCCTGCGACGTGA	1
ACGCGCAATTAGCATTCTCGTGGC	1
ACGCGCAGGTATACCATATCGATA	1
ACGCGCATCGGAGATGATGACCTG	1
ACGCGCCCGTGAAACCGTGAGAGT	1
ACGCGCCGAAAGTTTACTTGTCGT	1
ACGCGCCTCATTCTTATAAATATA	1
ACGCGCGCTACACTGATGTATCC	1
ACGCGCGTGCACTCACACGGGTGG	1
ACGCGCGTGCACTCACACGGGTGGA	1
ACGCGCTAAACAGTCTAGTAGTGT	1
ACGCGCTCTACTATGTACCCAGAC	1
ACGCGGAAAACGAGGAAGATGAGT	1
ACGCGGAATAAGGTGTGTCTAGT	2
ACGCGGACAAATATTATGCGCCTA	1
ACGCGGAGGAAACGAGAAGTGCGT	1
ACGCGGAGTGGCTGCGTGTGGATC	1
ACGCGGCATGCGGCTCAATCGTGC	1
ACGCGGGAGGTTAGCGAGAAACGC	1
ACGCGGGATTGATGCGTCATCTGG	1
ACGCGGGTAACCTATTAATTTGAC	2
ACGCGTAAACGACGTAAGGGTTGA	1
ACGCGTAGATGTCAGACGGAGGGC	1
ACGCGTAGGCGGATGGCACTGTAA	2
ACGCGTCGGTGACATTGGGCTAGC	1
ACGCGTGAGGTGTCAACTAGTTAT	4
ACGCGTGCGACGTGAAGTAGGCGG	1
ACGCGTGGTGTTGAATACATGTGT	1
ACGCGTTCGTAAGATGTGAGGTGT	10
ACGCGTTCTTGCGGTGTCTCCTAA	1
ACGCGTTTGATGTCTACTTGTGGG	2
ACGCTAAAACTTTACACCACTGGA	1
ACGCTAAAATTGAAACGATGTGA	3
ACGCTAAAATTGAAACGATGTGAC	10
ACGCTAAAATTGAAATGATGTGAC	1
ACGCTAAAATTGGAACGATGTGAC	1
ACGCTAAACACGGATATCTATGGC	1
ACGCTAAATGCACCGGTGCTGAACT	1
ACGCTAAATTGATGGACGTTTAAG	1
ACGCTAACTCAGCAGCCACGTTGG	1
ACGCTAAGCTAACAATCTGTGCCA	1
ACGCTACATTGGATTGGGTGATA	1
ACGCTACATTTTATGTGAAGTGA	1
ACGCTACGTGACATCTCACAACAGC	1
ACGCTAGAAGAGCAGCAGTGGTGG	1
ACGCTAGCCAGATTGATGTGATAA	1
ACGCTAGGATTGTGCCACGTATAC	2
ACGCTAGGTGCTAGGTAAGATGCC	1
ACGCTAGTATGGATGGCAGGGCGA	1
ACGCTAGTCAATAATAAGGGGGAG	1
ACGCTATCAATTACACTACGCCAC	1
ACGCTATGGTGGCAGGAGGATGGC	1
ACGCTATTCTGATGGCTTCGAGGA	1
ACGCTATTTAGCGCTGAGGTGTC	1
ACGCTATTTGGCGCTGAAGTGTCT	1
ACGCTATTTGGTGCTGAGGTGTC	2
ACGCTCACGGTGCTCAGTGGCAGA	1
ACGCTCAGGTATTCCGGCTAGCTC	1
ACGCTCCTAATCCGCCACGTGGCA	1
ACGCTCCTAGATTGCCACGTGGCA	1
ACGCTCGATTGAGATATGGTCGCA	1
ACGCTCGCGTCTCTAGGTTTTAGC	2
ACGCTCGCTCGATCGTCGATGGGA	1
ACGCTCGTGGGGTGCCTTCTGCTC	3
ACGCTCGTGGTGAGGATGGCGACC	1
ACGCTCTCACGTCACCATGTGTCA	3
ACGCTGAAGGATAAGGCAAGGTGG	1
ACGCTGAAGTGCTATGCCCATGAA	2
ACGCTGACGGGATTGCCACGTGTG	1
ACGCTGACTCAGCCGCCACATAGG	1
ACGCTGACTCAGCCGCCACGTAAG	1
ACGCTGACTGGTGTGACATGATAA	2
ACGCTGAGGTGACATTTCAATTAA	1
ACGCTGAGGTGACATTTCAATTAAA	1
ACGCTGAGGTGTCTAAATTCAGCGC	1
ACGCTGATGGCCACCCCTGCGCCC	1
ACGCTGATTGGTGTGTCAATTGAG	4
ACGCTGCACCACCCTTAGCTA	2
ACGCTGCACGATATGGACGAC	3
ACGCTGCCCGAAGGGAGATGC	1
ACGCTGCTCCACGACTGTTGCATG	8
ACGCTGCTGTCGGTGATATGGGAC	1
ACGCTGGAAACCAACTCCGCACGC	1
ACGCTGGATATCGACTTCAGGGA	2
ACGCTGGCGTCGCGTGAGATGGTC	1
ACGCTGGGAATGTAGTTGCCT	3
ACGCTGGTCCCTTGTGGTGGCGGT	2
ACGCTGGTGGGTACGGCGGGGTGA	1
ACGCTGGTTGCTGACATGGTAAGG	1
ACGCTGGTTTGCCGACAATGTCAC	1
ACGCTGTCTCTAGTGATCTGAGC	1
ACGCTTACTCGGCTTTGCCGGCAA	1
ACGCTTAGGGTGACGCGTGATGAC	1
ACGCTTCAAGTGAGTAGGAGGGCA	2
ACGCTTCATAGCGGCCCAAACCTG	1
ACGCTTCCCAAACTACTAAACGGT	1
ACGCTTCTAGAAAATGCCTGC	1
ACGCTTGACCAGAAGGTGGAGTGT	2
ACGCTTGACTAACTTGTAAGGTGG	1
ACGCTTGAGACGATGGTTATGCA	2
ACGCTTTGCAAGTTCGTGGACCTA	2
ACGCTTTGTTTAGCATGGGTGATC	1
ACGCTTTTCAAACTGCTAAACGGT	1
ACGCTTTTCAAACTGCTAAATGG	2
ACGCTTTTCAAACTGCTAAATGGT	3
ACGGAAAAAAGGCAGGTTGAGAAG	1
ACGGAAAAACTGCCTAGGGTGACA	1
ACGGAAAAATAAAAAATGAAAAGC	1
ACGGAAAAATAGAGGGACCGGCGC	1
ACGGAAAACGAGGAAAACACCAGC	1
ACGGAAAACGGAGCAGTACATTAG	1
ACGGAAAAGTTAGAAGTTTGTGG	1
ACGGAAACCAGGGTTTGTCTTTTT	1
ACGGAAACCCAGAGTTTGCCTTTT	1
ACGGAAACCCTGGTACCATATTCG	1
ACGGAAACCTAGGAATTGGGACGG	1
ACGGAAACGATTTGGTACCCTCCA	1
ACGGAAACGGAAAGAGATTAGGGC	1
ACGGAAACGGGCAAACGACGGGT	1
ACGGAAACTGACCTCGGATATGGA	1
ACGGAAAGCATAGGAAGATGGAAC	1
ACGGAAATGCTGATGGGCGATCGA	1
ACGGAAATTCTCGATGGACCGAAC	1
ACGGAACAACCGACGGTGTGTGCC	3
ACGGAACAGGCAATCTGAAGCCTC	1
ACGGAACATCCGACTTGGTCTTGC	1
ACGGAACCCTAACATCGATGGTAT	1
ACGGAACCCTAACGGCGATGGTA	1
ACGGAACCCTAACGGCGATGGTAT	1
ACGGAACCCTAACGGTGATGGTA	1
ACGGAACCCTAACGGTGATGGTAT	1
ACGGAACCCTAACGTCGATGGCAT	2
ACGGAACCTTAACGGCGATGGTA	2
ACGGAACGAGGTGAGACAGCAGGAC	3
ACGGAACGCCACGCGCAGATGTGC	1
ACGGAACGGAGGATAGCGGGACGG	1
ACGGAACGGTGTTACGGCGGTGGC	1
ACGGAAGAACCTCGGTTAACCGGT	2
ACGGAAGAAGTAGGCCTGTGATA	1
ACGGAAGACAACATAATGGTGATG	1
ACGGAAGATAATAAGAGTGACC	1
ACGGAAGATTAAAATTGGGTGCGA	1
ACGGAAGCATAACGGCGATGGCA	1
ACGGAAGCCAATAGGTTGCCCTGA	1
ACGGAAGCCACGGTTCATATGCAC	1
ACGGAAGCCGACATAGAGGAAGAC	1
ACGGAAGCTATATTTTGGGATGGA	3
ACGGAAGGAGTAGGTGCCAAACAG	1
ACGGAAGGGAGTTGTACAGGA	1
ACGGAAGGTGTTGATGATACCATA	1
ACGGAAGTGCGACACTGATGGTAT	1
ACGGAAGTGCTTATAGTGATAGGA	1
ACGGAAGTGGTCGCCTACCGCCCT	1
ACGGAATACTACAAGATGAAAGAG	2
ACGGAATATTGGTGTGTGCAATGC	1
ACGGAATATTTTCAGGATAAACC	2
ACGGAATCCCATTGGGACAGGATA	1
ACGGAATCGACAGGAACTACACCC	1
ACGGAATCTAGGAACTAGTAGTGC	1
ACGGAATGAAAACAACGAGGTGGT	1
ACGGAATGACTGTTTGATTGGACC	1
ACGGAATGGACGGAACCCTAATGG	1
ACGGAATGGGCATAGAGGAGATCA	1
ACGGAATTTGGCAGGGTTTACCT	1
ACGGAATTTTGAAGGTAACTAAAG	1
ACGGACAGGAGGCTAGAGGGTCTA	1
ACGGACAGTCAAACGGTGGACACA	2
ACGGACAGTCAAACGTTGGACACG	1
ACGGACAGTCAAACGTTGGCACGC	1
ACGGACAGTCAAACGTTGGGCACG	1
ACGGACAGTGATGGTAAATCGTAG	1
ACGGACAGTTAAAGTTGGACATGG	1
ACGGACATACCCCTTAGAACCAAA	1
ACGGACCACGCACACGCATGTTG	1
ACGGACCACGTAAGCGACGCCTGC	3
ACGGACCATAACGGTGTTCCCGTC	1
ACGGACCATACGTGAGTGAGC	1
ACGGACCGCCCCGGGTAGTCTGGC	3
ACGGACCTAAAGTTGTGGCTCGTC	2
ACGGACCTAGCTGCTGATCTAGAA	1
ACGGACCTGCCATGGTATCGGTGA	1
ACGGACCTTGATGAACGCTTTGCA	2
ACGGACGAAAAAGTGCACGGACGA	1
ACGGACGAAAACGTAATGACGGAC	2
ACGGACGAAATATGTGGTATGTGG	1
ACGGACGAACAGAAGTATGCAGTG	1
ACGGACGAAGCGGACGATTGGAAG	1
ACGGACGACGAGAGGCGAAGGCGA	1
ACGGACGATCAAAGTTGGGTGTGA	2
ACGGACGATCAATATTGGGTGCGA	1
ACGGACGATCGAAGTTGGGCGCG	1
ACGGACGATCGAAGTTGGGCGCGG	1
ACGGACGATTAAAGTTGGGTGCGG	1
ACGGACGCCAAGACGTAATGTGTC	2
ACGGACGCCATGCCTGATTGAGAT	1
ACGGACGCCGTGCCCGATTGAGAT	1
ACGGACGCCTCACTATCGATGGGT	1
ACGGACGCTGCCGATGTGACGGTC	1
ACGGACGGAAACATGTCGGTGCAG	1
ACGGACGGAGTTGGAGCTCACGTG	2
ACGGACGGTCAAACGTTGGGCGCA	1
ACGGACGGTCAAATGTTGAACATA	2
ACGGACGGTCAAATGTTGTACACA	1
ACGGACGGTGCCAGGTAACATGTC	1
ACGGACGTCTCCGGTTGCCACCCC	1
ACGGACGTTTCCTGGGCCATGGT	1
ACGGACTACAAGATGCAGTGTGTG	1
ACGGACTACAAGATGCATGTGTGA	1
ACGGACTACATATCTGTAGCTAGC	1
ACGGACTATAAGACGCAGTGTGCA	1
ACGGACTCAGTACGTTATGTGCGT	1
ACGGACTCCAAAACGTTACGTGTG	2
ACGGACTCCAAAACGTTATGTGTG	1
ACGGACTCCAAGACGTACGGTGT	2
ACGGACTCCAATACGTAATGTGT	1
ACGGACTGATGAGGCCGCGGATGC	4
ACGGACTTCAAGACGCAGTGTGTG	1
ACGGACTTTAAGATACATGTGTGA	1
ACGGAGAAAGTAGCTGTGAAGGTC	1
ACGGAGACCCTACGGATAGGCAAC	1
ACGGAGACCGTGGTGAACATGGCC	1
ACGGAGACCTAGTCAAACAAGCC	1
ACGGAGACCTAGTCAAACCATCCA	1
ACGGAGACGACTACTACGCTAGAC	1
ACGGAGACTAACTGGACGGCGATG	1
ACGGAGAGAGTACTACTGACTCTA	1
ACGGAGAGCAAGAAAAAAGATGAA	1
ACGGAGAGGGATGCTTCTCACTGC	1
ACGGAGAGGGATGCTTCTCACTGCC	1
ACGGAGAGGTGTATCGATCGATA	1
ACGGAGATGGTGGTTGATCGCATC	1
ACGGAGATGTATAGCGTGATTGGT	1
ACGGAGCAAACTTTGGGTGGTATT	1
ACGGAGCAATTGGTTGATAGGTA	1
ACGGAGCAATTGGTTGATAGGTAT	1
ACGGAGCAGACCATTAACGCGTGC	1
ACGGAGCCACTACGAAGAAATTCC	1
ACGGAGCCGATGGACCTATATGAC	2
ACGGAGCCGTCAGAGCGACAGATT	1
ACGGAGCGATTGCGGGCGGTGGGT	1
ACGGAGCGATTTATTAGCGCGTGA	1
ACGGAGCGGGTGAACTTCGATGTG	1
ACGGAGCTCACAGATGGAGGCGG	4
ACGGAGCTGTAACGTGTCGGTGAG	2
ACGGAGGAAATGGTAGGAAGGTGG	1
ACGGAGGAAGTAGCCGGTAGTTGGC	3
ACGGAGGCAGTTCGAAAGGGTACC	1
ACGGAGGGAGTAAAGTGGTAG	1
ACGGAGGGAGTACTCACTGGTGAA	1
ACGGAGGGAGTAGATAAGTATACT	1
ACGGAGGGAGTATGGGAT	1
ACGGAGGGAGTATGTACACTGTAC	1
ACGGAGGGGCTTGTTTTAAGACG	2
ACGGAGGGTGTAATACTTAGCTG	1
ACGGAGGGTGTATGTCAGTATGAC	1
ACGGAGGGTGTATGTCTAAACTA	1
ACGGAGGTAGCAAAACTAAAGCCG	1
ACGGAGGTAGTACTAGATATGTAT	2
ACGGAGGTAGTAGATGTGACAGGC	1
ACGGAGGTCGTATGCAGATTCGG	2
ACGGAGGTCTTGGAAGACGGTC	1
ACGGAGGTCTTGGAAGACGGTCGC	9
ACGGAGGTGAGGATTTTTATACA	1
ACGGAGGTGCAAGAGGATAAGGAG	1
ACGGAGGTGCTTAGGTAAGCAGGC	1
ACGGAGTCAGCGTGAGTTCCCGTG	2
ACGGAGTCTAGATTGGGCATTCGTT	2
ACGGAGTGTGCACGAGATGTTTGT	1
ACGGAGTGTGCCGCTGACGATGAT	1
ACGGAGTTGTTGCTGAGTGATTGA	1
ACGGAGTTTGTTACATCGACGTGAA	1
ACGGATAAATCCGGCCTCCAGAAG	1
ACGGATAAGTACCTGAGATGATGC	1
ACGGATAAGTGACCTGGTGGAGCA	1
ACGGATACAATACCTAAACAGGAG	2
ACGGATACGAATACGGATATGGTA	1
ACGGATACGAATACGGATATTTTC	1
ACGGATACGAATATGGATATTTTC	2
ACGGATACGCCGCCTACCACTGAA	1
ACGGATACGTTGCATACCATTGAA	1
ACGGATAGACATAGTGCCTTTGTA	1
ACGGATAGAGAGATGTCAGTGATA	6
ACGGATAGAGTACAATCCTGCCGC	1
ACGGATAGAGTATATTTTAGGA	1
ACGGATAGATAGATGAATGATGAT	3
ACGGATAGTGCCGAATAAGGATAC	4
ACGGATATGGTATCGGGGTTTCCG	1
ACGGATATTAAGAAAGTAGGTGAA	2
ACGGATCCATTGGTTGTTGACCAA	2
ACGGATCCCAAGATACAGTGTGCG	1
ACGGATCGTCTTCAATCTGGA	1
ACGGATCTAGCGCCTTCATGCCAA	1
ACGGATGACACCTATCAGTGAC	1
ACGGATGACACCTATCATTGACGG	2
ACGGATGACCCATACCTGTGATGG	1
ACGGATGACCTATCTCAATCGGGC	4
ACGGATGACCTATCTCAATCGGGCC	4
ACGGATGACTCAATTGTGATGGGT	1
ACGGATGAGAAATTGGGATATGGC	1
ACGGATGAGAATCCTCGGTACTGC	11
ACGGATGAGACAGTGCGTCTCGT	1
ACGGATGATGCTTAACCATTTGGG	1
ACGGATGATTTGTTGCAACGGCGC	1
ACGGATGCAGGTCCTCTGCAGTGC	2
ACGGATGCCTTGGATACTAAAGT	1
ACGGATGCTTACATTTACGGTTAA	4
ACGGATGGACTACGTGTGTTTGGG	2
ACGGATGGAGGTGACGAGAAGTGA	1
ACGGATGGAGTATTAAAAGTGTAC	1
ACGGATGGCTGAGATTTGTTTAGG	1
ACGGATGGCTGAGATTTTGCTTAG	1
ACGGATGGTCAAAATGCTAAACAC	1
ACGGATGGTGATAAATGATTTGC	1
ACGGATGGTGATAAATGATTTGCC	1
ACGGATGGTTGGGTGTTGGTGTAG	1
ACGGATGGTTTCGCTAGAATACT	2
ACGGATGTAGAAATTGGTGAT	2
ACGGATGTAGTAGGAGAAAAGTGG	1
ACGGATGTGAATGGACATGAC	2
ACGGATGTGAGATGTGGCCATTGC	1
ACGGATGTGTGAGTATGGTGATA	1
ACGGATGTTCGACGAAACACGTGC	3
ACGGATGTTGCTTAACGATTTGCC	15
ACGGATGTTGCTTAATGATTTGCC	4
ACGGATGTTTGCTTTCATTAGGAT	1
ACGGATTACAGATATGTAGCTAGC	1
ACGGATTATACAGGTTCGGGCCGC	1
ACGGATTCAACATGGGTGCAAG	2
ACGGATTCCAAGATACATGTGTGT	1
ACGGATTGACGGGCTAGATACATG	1
ACGGATTGACGGGCTGGATACATG	1
ACGGATTTCAAGACGCTGTG	1
ACGGATTTTTATACGGGTAGCGGG	1
ACGGATTTTTGCAAGCGGGCA	1
ACGGCAAACCTAACGATCCGGCAA	2
ACGGCAAACTGATGGGCTGGCGAC	2
ACGGCAAATGGCGCATGTGTGTCG	1
ACGGCAAGATCAAGACACGTTGCCTA	1
ACGGCAAGCTAGTTAGCTACTCCC	1
ACGGCACCCTGCTGATGGTGAGGC	1
ACGGCACTACAGAAGATGGGCAAA	1
ACGGCACTATTGCTATGGGTTGCG	1
ACGGCACTGCAAGAGCTTGGTGGC	1
ACGGCAGCGCCTAGATGCTGGTGG	1
ACGGCAGGTGAAAACCTAATACGG	1
ACGGCAGTGATATGGTTAGTGGTA	1
ACGGCAGTTGTGCGGAAGCGATGC	1
ACGGCATGGTTATCCGACTAG	1
ACGGCATTCAGCGCCAGTTGATGT	1
ACGGCATTGGTGTTGAGGTCCTAT	1
ACGGCATTGTGCTTTCAGTGGCAG	1
ACGGCCAAATGAACACGCAGCTGC	1
ACGGCCATCCTGGCTTGTTGCCA	1
ACGGCCATTCCTGTGTTTTTCTTG	1
ACGGCCCATAACAAGACTGGAA	1
ACGGCCCATGTGGCAAAGGTCAGC	1
ACGGCCCGACTAGGGTTGTGCCTG	1
ACGGCCCGTCACTGATAGGTGTCA	2
ACGGCCCGTCACTGATATGTGTCA	1
ACGGCCCGTTACGGATAGATGTCA	1
ACGGCCCTAAGAGATGTGTAATGC	1
ACGGCCCTTCTGTGGATGAGCTGA	1
ACGGCCGACTTGGTCGCAGGAAGC	1
ACGGCCGCCGAATCTGCATACGAC	1
ACGGCCGGATTTAAATTGGTACC	1
ACGGCCGTTGATTTAGAATGGA	1
ACGGCCTACACAAATGCAGCG	1
ACGGCCTATTAGTGATGGACCA	2
ACGGCCTCAAGGATCCTATGGTAC	1
ACGGCCTCACCGCCTCATCTCCGC	1
ACGGCCTCTGTCGCTTTTGGATTCA	1
ACGGCCTCTTACGTCGGGTGGATG	1
ACGGCCTGACAGCTGATGGGTC	1
ACGGCCTGCTAATCGTGCTGGGCC	1
ACGGCCTGCTATTTATAGACATGT	2
ACGGCCTGTGGATGGCGATGGCAC	6
ACGGCCTGTTTGGTTGGAGGGA	1
ACGGCCTTCTGAGTGGATGGAATC	2
ACGGCCTTGGACATTGGAATGTG	1
ACGGCGAAACAAGGGACTCGGCGA	2
ACGGCGAACCAGTTGATGTAGTGA	1
ACGGCGAGTTCAAGTGCACCGGCCC	1
ACGGCGATGGGCATCAGTATATGC	1
ACGGCGCAAACCGACAAAGATGGA	1
ACGGCGCAAACCGATAAAGATGGA	3
ACGGCGCAAAGAGGGAGCCTCGTG	1
ACGGCGCAGCACAGAGTAGGAGGC	1
ACGGCGCATGTAGGGGAGCTTGCGG	1
ACGGCGCCAAATATTCAGTGATGG	1
ACGGCGCGGGAGTAATCTCTCCGG	2
ACGGCGCGGTGACAAGCAGCCAAC	1
ACGGCGCTGTCTTGATTCCAACAT	1
ACGGCGCTTGATTGTGGGCCCCAC	1
ACGGCGGCCAGATACTGACGTAGC	1
ACGGCGGCGCTGCTTGATCGTGAC	2
ACGGCGGCTTACAAGAGGTATATA	2
ACGGCGGGCGGTTTACTACTGTGC	1
ACGGCGGTATATTAGAAGAAAGC	1
ACGGCGGTCTGCTCGGGTGTCA	1
ACGGCGGTGCTAGATTAGGGGCGC	1
ACGGCGTCAAACATTTAGAGATGG	1
ACGGCGTCAAACATTTAGAGGAGG	1
ACGGCGTCAAACATTTAGGGATGG	3
ACGGCGTCAAACATTTCGAAACGG	3
ACGGCGTCAAACATTTTAGGATGG	1
ACGGCGTCAAACATTTTGGGATGG	1
ACGGCGTCAAATATTTAGAGAGGG	1
ACGGCGTCAAATATTTAGATATGG	1
ACGGCGTCAAATATTTAGGGATGA	2
ACGGCGTCAAATATTTAGGGATGG	4
ACGGCGTCAAATATTTTAGGATGG	1
ACGGCGTCAAATTTTTAGAGATGG	1
ACGGCGTCAGATACTTGAGATGGA	1
ACGGCGTCATACATTAAAATACGG	3
ACGGCGTCATACGTTAAAACACGG	1
ACGGCGTCATGAGGTCCTGGGTTC	1
ACGGCGTCATGTAGCGAGGTTGGT	1
ACGGCGTCCTACAGTATGGAGGGA	1
ACGGCGTCCTAGACTTATTCTGGT	1
ACGGCGTCTGCTGAATCGGCTGTA	1
ACGGCGTGCACTGATGAACAC	1
ACGGCGTGGGGTTTACGATACTGG	1
ACGGCGTTATAGATTAAAATATGG	1
ACGGCGTTGAGAGGATGGCGGGTC	1
ACGGCTAGATTAGATTGATACCTC	1
ACGGCTAGATTTCAACAGGTACTG	1
ACGGCTAGGTGACTATAGGGATGG	3
ACGGCTAGTAGTACTCGTTACTGT	2
ACGGCTAGTCCCCTACGGTGTCT	1
ACGGCTATGTCGATATGACGTGCA	2
ACGGCTATTACTGAGTTGATGGCA	1
ACGGCTATTGAAGTAGGGAACTTA	1
ACGGCTCACTGACAGATGGATCC	1
ACGGCTCTCAGACGAACGGGTGCTCT	1
ACGGCTGACACACACCTCTATGG	1
ACGGCTGACCTAAGGTGGGTTGTA	2
ACGGCTGAGTCAACGTGGGCCTC	1
ACGGCTGATAAACGTTGGTACC	1
ACGGCTGATGGACACTACAAAAAA	3
ACGGCTGATGGACACTACAAAAAT	1
ACGGCTGATTCTAGGTGGGCCC	1
ACGGCTGCACTTATTTTGAGACGG	1
ACGGCTGCCGAATCTGCATACGAC	1
ACGGCTGCGAGGTAGGAGGAATGGG	2
ACGGCTGGAGGTGTCTAGATCCGC	1
ACGGCTGGCCACGGGCGACGGCAC	1
ACGGCTGGGTATGCTTAGCGGTGG	1
ACGGCTGTCACAAGTGAGGGTAGA	4
ACGGCTGTCACGGATGAATCTATC	1
ACGGCTGTCTAAGTTTGTATTGAG	1
ACGGCTGTTCGAACAGTTTAATAA	1
ACGGCTTAAGATGTGCGCCTAGAA	1
ACGGCTTACAAGAGGTATATATAC	1
ACGGCTTACATTAAGTATGGCAGA	1
ACGGCTTATAAAAGAATGGTACCA	1
ACGGCTTATGAACGACAATGTCGT	1
ACGGCTTGAGGACGGAGGACAGTG	1
ACGGCTTGATGGAGCGACGAACGC	1
ACGGCTTGTGGAGGTGTTGCCCGG	1
ACGGCTTTGTGCTTTTAATGGTAG	2
ACGGCTTTTGGTACTCCCTAGCAC	1
ACGGGAAAAAACCACGGGTGTCT	1
ACGGGAAAACAGTGTTTGCTATGGT	1
ACGGGAAAATAGGGGGACCGGCGC	1
ACGGGAAACATACAGTACCACCG	1
ACGGGAAATGAGAAAGTGGAGCCG	1
ACGGGAACGTTCTTGATGTCGCGA	5
ACGGGAACTCGGTGTTGTTCTGGG	1
ACGGGAACTGACTTCGGATATGAA	3
ACGGGAAGATGTCCGTTGGGCTGC	1
ACGGGAAGGGCCGATTTGTTAGGG	2
ACGGGAATCCCGTTATCGATGGAT	1
ACGGGACAAACCTACAAAGGGGTA	1
ACGGGACAACGCGTGAGGAGGATG	1
ACGGGACACCTCGGCTAGAACCGG	2
ACGGGACCTCAGAGTGATAGGTT	1
ACGGGACCTTGGTATGTAAAATGA	1
ACGGGACGTAATATAGGTGTGTAA	1
ACGGGACTGGCGCTGACATTGTGC	1
ACGGGAGACACACGTGCACAGATA	1
ACGGGATAAATCCACAGGGCCA	1
ACGGGATAATTCGTGCCATCGCCC	1
ACGGGATAGGTAGCCTCACAGCTC	2
ACGGGATATTGGGGCGGTTCAATC	1
ACGGGATCAAACCTTACAGTGCT	1
ACGGGATGATACCTCTGAGACAGT	1
ACGGGATGTATCCTAGTACTACG	1
ACGGGATTGAGCTTCGGCATGTGC	1
ACGGGCAAACGGGCACAATTGCCA	4
ACGGGCAAAGCGGGCATGGGTAGT	1
ACGGGCAACTGGGCGTGGAGCTCG	1
ACGGGCACGACAGATCATGGGTTA	3
ACGGGCAGGAAGATTGACGGTGAG	1
ACGGGCAGTGTTACGTTTTTACGG	1
ACGGGCATAAGTGCTGGTCAGTGA	1
ACGGGCATGGGCAATGTTCCTTGC	1
ACGGGCCAACTGGGGTAGATCTGT	1
ACGGGCCAAGCTGTGTGCTATTCC	2
ACGGGCCATGCCATTCTTGGGTCG	1
ACGGGCCATTTTTTGTGGAGCTGG	2
ACGGGCCCTGCGTTTGCTTCGTGC	1
ACGGGCCGGTTTGGTTTGAGTCCT	1
ACGGGCCGTCCTAGCAGAGCAC	1
ACGGGCCGTTCTCATTTTAGGTAA	1
ACGGGCCTAGTTGTTATCTCAATC	1
ACGGGCCTAGTTGTTATCTTAAAC	1
ACGGGCCTAGTTGTTGAGATATGG	1
ACGGGCCTCAAGTTGGTGCACGTC	5
ACGGGCCTGCCTGTTTGACACAGC	1
ACGGGCCTGTTCACTTTGATGTAA	1
ACGGGCCTGTTCACTTTGATGTCA	1
ACGGGCGACGGCATTGAGCTGCCT	3
ACGGGCGACGTAGACAAGTTCGG	1
ACGGGCGACGTAGACAAGTTCGGG	1
ACGGGCGCCCTGATCAAGTGACCT	1
ACGGGCGGATGCATGATTGGCTGC	1
ACGGGCGGCCGATCAGGGACAGTC	1
ACGGGCGGGTGACGTAGGAGC	1
ACGGGCGGTGGACGACGATGATGG	1
ACGGGCGTCCTACAACCTTGCAAC	1
ACGGGCTAAGCACAAAGATGTTAC	1
ACGGGCTAGTTCAGATTGATGTCA	1
ACGGGCTCCAATACACAGTGTGTG	2
ACGGGCTGCGGTTGATGGCACGAG	1
ACGGGCTGTCATAAGAAACTCGG	1
ACGGGGAAACTTACCAGGTCCAG	1
ACGGGGAACGGACGAATCGGTGCA	1
ACGGGGACCCTAGGTGTACATATT	1
ACGGGGACGGGGGAGCACTCTCCG	1
ACGGGGATACGGACACGGATACGC	1
ACGGGGATTGGAAGTAACCCGCGG	1
ACGGGGCAAGAAACGATCGGGTTG	1
ACGGGGCAATCGCATCGTAGTGAC	1
ACGGGGCAGGTAGGATCACAGAGC	1
ACGGGGCATTGTAAGTGGCAGA	1
ACGGGGCCACCATTAATACGATGC	1
ACGGGGCCATAGTCGTTCGGACAT	1
ACGGGGCCTAGGTGGCTGAATGAA	1
ACGGGGCCTCAGGTGGTGTTTAGA	1
ACGGGGGCGAACCCTAAGGTGTGG	1
ACGGGGGCTGCTAGCTAATTGGCG	2
ACGGGGGCTTCATTTGCTGAATGG	1
ACGGGGGTACTCCAGGTTGTTGGG	1
ACGGGGGTCCTACTTGATAGAGAT	2
ACGGGGTCTCGGGTTTGAAACCA	1
ACGGGGTGCGTCCTTGATGGCCTC	1
ACGGGGTGCTAGACTTAATCTGTG	1
ACGGGGTGGATGTACAACACTGGT	1
ACGGGGTGTCAACTAGTTTTCCAG	1
ACGGGGTGTCTGTTGGGATTTCCA	1
ACGGGGTGTTTGGTTTATGACCAC	5
ACGGGTAAATGGGCAAACGGGTAC	1
ACGGGTAACAACCAGATATGGTAC	1
ACGGGTACCAGGTTTGACACCTA	1
ACGGGTACCTTTGTTTGTGCTTGT	1
ACGGGTACGGGACTATCTTCGGA	1
ACGGGTACGTCGCCATGTGTGTCA	1
ACGGGTACGTCGCCTACCACTGAA	3
ACGGGTACGTCGCCTATCACTGAA	1
ACGGGTACTTACTAACCGCCTGCC	1
ACGGGTAGAGCAAAACCATGCCTG	2
ACGGGTAGCGGGTTCGAATACGG	1
ACGGGTAGGTGTATACGTAAGACA	1
ACGGGTATAGCCGGTGATAGGA	1
ACGGGTATAGGTATGGGTAGGTAC	1
ACGGGTATGAGACGGATTGAGTGA	1
ACGGGTATGAGGATGTTTTACGAA	1
ACGGGTATTAAGAAAGTAAGTGA	1
ACGGGTATTAAGAAAGTAGGTGAC	1
ACGGGTATTAAGAAAGTATGTGAG	1
ACGGGTATTCAAACGTTCGATGTG	2
ACGGGTATTTCGCTGTCGATGGAT	1
ACGGGTCAACGAAAGTTGGGCTCA	3
ACGGGTCTACTGGAGCTGGAAACC	1
ACGGGTCTGCCATTGTACTCCTGT	5
ACGGGTCTGTGTGACCTAGGGTGT	1
ACGGGTGACAGCCTGATGCCGATC	1
ACGGGTGACGGAGAATTAGGGTTC	2
ACGGGTGACTAAAATAGATTTTTG	1
ACGGGTGAGGAGCCGCGTTGGGAGA	1
ACGGGTGATAGTTAGCAATTCAAA	1
ACGGGTGATCGATTGAGGAGGCGC	1
ACGGGTGATGTATACAGGTTCGG	2
ACGGGTGATTAAACGTTAGACACG	1
ACGGGTGCAGTTCGATAGGGCGCC	1
ACGGGTGCATGGTGGCATTGGCA	1
ACGGGTGCGAGGGATCGAACT	1
ACGGGTGCGATGCTTTTGACCGGA	1
ACGGGTGCGATGTTTATGACCGGA	1
ACGGGTGCGATGTTTTTGACCGAA	2
ACGGGTGCGATGTTTTTGACCGGA	5
ACGGGTGCGATGTTTTTGACTGGA	1
ACGGGTGCGGCAAGGTCTACAAGG	1
ACGGGTGCGGGAGCATTGCTGCC	1
ACGGGTGCTAAAACTGTCTCTACC	1
ACGGGTGCTCGTATTTACGGCTA	1
ACGGGTGCTCGTATTTACGGCTAA	1
ACGGGTGCTCGTATTTATGACTAA	1
ACGGGTGGAACTCGGTGGTGGCCA	1
ACGGGTGGAGTACATGGACTACTC	2
ACGGGTGGGGTGTATAAGAGTATA	1
ACGGGTGGTCCTTAAACTTGTAGC	1
ACGGGTGGTCCTTAAACTTGTAGG	5
ACGGGTGGTGAAATGGGCAATCGA	1
ACGGGTGGTGACGGATGGAGGTTT	1
ACGGGTGGTGTCCTGACAAAGGGT	1
ACGGGTGTACTGTTCTGATCTAGC	2
ACGGGTGTCCAGCAGCTAATTACC	1
ACGGGTGTCTAAATTTATATTGAG	1
ACGGGTGTCTAACTTTAAACTA	1
ACGGGTGTCTAAGTTTAAACTGAC	5
ACGGGTGTCTAAGTTTATATTAAG	1
ACGGGTGTCTAAGTTTATATTAGG	1
ACGGGTGTCTAAGTTTGTATTGAG	3
ACGGGTGTCTAGATTTATCGTATT	1
ACGGGTGTCTCGTTGTCGACGAGT	1
ACGGGTGTGAAAAAGCTCGGTGCA	1
ACGGGTGTGACTGACAAAGGGCAA	1
ACGGGTGTTGGCATTTACGGCTAA	1
ACGGGTGTTTACATTTACGGCTAA	2
ACGGGTGTTTATATTTATGGCTAA	2
ACGGGTGTTTGTATTTACTGCTAA	1
ACGGGTTAACTGCCGTTGGGTTGC	1
ACGGGTTACAAGCATACGTGGGCT	1
ACGGGTTACCGGAAAGAAGGCAAG	1
ACGGGTTACCTCTTCCAAGTTCCA	1
ACGGGTTAGGTGCCCAGATGGAGG	1
ACGGGTTATTTCCGTATGTGTTGT	1
ACGGGTTCAGCGCCAACGGATGTG	1
ACGGGTTCTTCCGATAAACAGCCT	2
ACGGGTTGCAATCGGAAGGCCCATA	1
ACGGGTTGCACTGTATTGGTGAAA	2
ACGGGTTGCGCAACGGTTGTTGG	2
ACGGGTTGCTATAATGGTAGAGAA	1
ACGGGTTGGCCTGGATAACCTGGA	1
ACGGGTTGTCGCATTTGGTGTA	1
ACGGGTTTAAATAATTACAGGTGA	1
ACGGGTTTCCTTCACAGGGCCGGT	2
ACGGGTTTTTACTCTATTAGGAGC	1
ACGGGTTTTTATGCGGGTAGTGGG	1
ACGGTAAAACATGTGCTAAAACGT	1
ACGGTAAAACGCGGGTTTACACC	1
ACGGTAACCCACATGTGACACCTA	1
ACGGTAACCGCACGGTTTGGTAC	1
ACGGTAACGCCTGCGTGTTAGTGG	1
ACGGTAACGTCATGATGGAATGGT	2
ACGGTAAGATCTGGCAGTGAACGC	2
ACGGTAAGCTACACACGAACGCGG	1
ACGGTAAGGTGAACCCTGGTGTCA	1
ACGGTAAGGTGGTTACCGCGGTAA	1
ACGGTAAGTCGAACCCTGGGTCTG	1
ACGGTAATACGCGGAGACGGTTGT	1
ACGGTAATATTAGTTGGTGTCC	1
ACGGTACAACAACTTGACAGGTGG	2
ACGGTACAACAACTTGGCAGATGG	1
ACGGTACAAGAACTTGGCGGGTGG	6
ACGGTACAAGAATTTATCGGGTGG	2
ACGGTACAAGGATCGGTGATGGAC	5
ACGGTACAAGTTTAGACGGTGATG	1
ACGGTACAATATACTATCAGTATA	2
ACGGTACAGACGGAGGTGCTGATA	1
ACGGTACAGTACCTGGTTGGCCTC	1
ACGGTACATCAACAAGGTGTTTGA	2
ACGGTACCTATTGGTTGTGGAACC	1
ACGGTACCTCGGAAAGGAACTGTG	1
ACGGTACGAACTAACTTTGATGCA	1
ACGGTACTATGCGAGCTTGACCGG	1
ACGGTACTTAACATAATGCAA	1
ACGGTAGAATACAGTGTTGATGAC	1
ACGGTAGAGCGAGATCGATGGTAT	1
ACGGTAGCACTGCAGCGGTCGTGA	1
ACGGTAGCCGACGTGATGAAGTGG	1
ACGGTAGCCTATGCTGATCAGCAA	9
ACGGTAGCCTCCGCTCTTGTTGAC	2
ACGGTAGCGGCGTAAGTGGGACATG	1
ACGGTAGCTGCGCCAAATCGGGGT	1
ACGGTAGCTTCGCGCCACTGG	9
ACGGTAGGAGTGGGATGACGGGAC	2
ACGGTAGGGGTATGTAGGGGATCC	1
ACGGTAGTGCTTTACATCAGAGG	1
ACGGTAGTGCTTTGCAACAGAGG	1
ACGGTATAAAACCGGTGACCCGAG	1
ACGGTATACTTCATAGCATCTGTA	1
ACGGTATAGTGTTGCGGACTTGAC	1
ACGGTATATCCGTGTGCTTGTGGA	1
ACGGTATCACGTGATAAAAGTGCG	5
ACGGTATCTCGGAAAGGAACTGTG	1
ACGGTATCTTCACCGGGGCGTGTC	2
ACGGTATGCATGATTTTTTCAG	1
ACGGTATGTACACGCGAGGGCCTG	1
ACGGTATTGTAATTTGAGGAACGC	5
ACGGTCAAACACGTGCTAAAAAGTT	2
ACGGTCAAACACTGGACATGGTTC	3
ACGGTCAAACATGTGCTAAAAAGC	1
ACGGTCAAACATGTGCTAAAATGT	1
ACGGTCAAACGTGGGGCACGGATA	1
ACGGTCAAACGTTCGATGTGATACC	1
ACGGTCAAACGTTGAACATGGATA	1
ACGGTCAAACGTTGAACATGGGTT	1
ACGGTCAAACGTTGAACGTGAATA	1
ACGGTCAAACGTTGGACACGGAAA	4
ACGGTCAAACGTTGGACATGGATA	1
ACGGTCAAACGTTGGATATGGGAA	1
ACGGTCAAACGTTGGGCACAGATA	1
ACGGTCAAACGTTGGGCACGGAAA	2
ACGGTCAAACGTTGGGCACGGATA	3
ACGGTCAAACGTTGGGCATGGAAA	3
ACGGTCAAACGTTGGGCATGGATA	1
ACGGTCAAACGTTGGGTATGGAAA	2
ACGGTCAAACGTTGTATATGGATA	1
ACGGTCAAACGTTTGATATGGATA	1
ACGGTCAAATGTTGGGCACGGATA	2
ACGGTCAACACACGGTCAACTGAC	1
ACGGTCAACTAGCGGAAAGGGCAT	1
ACGGTCAATAGATACGGTTGGGAC	1
ACGGTCACCACATGCATGGCTGCA	2
ACGGTCACCACCCGCACACGTGAA	1
ACGGTCACCACGCACACACGAACG	1
ACGGTCACCGTGTAGTAACACTGT	1
ACGGTCACGATTTGGTACTGCAC	2
ACGGTCACTGCATTTAAAATGGTT	2
ACGGTCAGATCATTGCCGATGGTT	1
ACGGTCAGATCTTCAATCAGCAGT	1
ACGGTCATGACAGATTTCCAT	1
ACGGTCCAAATTAACAGAAGAGAC	1
ACGGTCCACATGGAAAAATGATGG	3
ACGGTCCACGGAGAGCCTAACGGC	1
ACGGTCCACGGCTCACCCCTGGGC	1
ACGGTCCACTTAAGGAGCCGCATA	1
ACGGTCCAGATCATCTGTGTGTAA	1
ACGGTCCAGCAGATAGTACCTCGA	2
ACGGTCCATTAGCACATGATTGAT	2
ACGGTCCCGCGGAACGGTGGTGCG	1
ACGGTCCCGTTGATGACGGCGCCA	1
ACGGTCCGCCTGGAATCAAATATG	1
ACGGTCCGCCTGTAACTTATAGGG	2
ACGGTCCGTGAGTAGGTACCATGA	2
ACGGTCCTACAATTGATATCAGAG	1
ACGGTCCTCCACTTGGTGCATCTG	2
ACGGTCCTCCACTTGGTGCTTGCA	1
ACGGTCCTTGAGCAGGTACCATAA	1
ACGGTCGATGGGTACGTCGCCTAC	1
ACGGTCGATTTACGAGTTTAGGGA	3
ACGGTCGATTTGCAAGTTTAGGGA	1
ACGGTCGATTTGCGAGTTTAGGGA	1
ACGGTCGCGCTACATGATGCGACA	1
ACGGTCGGCTCACATAAGCCTACA	1
ACGGTCGTTTTCGATGATGTGGCA	2
ACGGTCTACTCTAGTTTTGGCTGT	3
ACGGTCTATTGGTGGCTATCGATG	1
ACGGTCTCCAAAATACAACTTTG	1
ACGGTCTCCTGGATGCGTTTGTGC	2
ACGGTCTGAGTGCACTCCCAATCC	1
ACGGTCTTCACCAAGTTTCGCTAC	1
ACGGTGAAAGTACATTATGTGTGA	2
ACGGTGAAATGGTTGATGTGGACC	1
ACGGTGAAATTTGGTAAGCCCAAA	1
ACGGTGAACTCACAGGAACCCTGG	1
ACGGTGAACTCACTGTGGAGGTAG	1
ACGGTGAAGGGCTGAGGGACACT	1
ACGGTGAAGGTGGTGTCAGCGACA	3
ACGGTGAAGTAAGGACTGAGGGAC	1
ACGGTGAATAGGAGCTAAAGTGCA	1
ACGGTGAATTTGGATAGACATAAC	2
ACGGTGACAAACATTTAGGGAAGG	1
ACGGTGACACCATGAAAACGAGAG	1
ACGGTGACCCTGATTGATTTGGAA	3
ACGGTGACGAATATGAATCATTGT	2
ACGGTGACGAGTATGGTGTGGGAC	1
ACGGTGACGCTTACATGTCAGTGG	1
ACGGTGACGGCGACTCGGTACTGG	1
ACGGTGACGGTGGGGTTGAGGTGG	1
ACGGTGACTAGTTGATGAATACGT	1
ACGGTGACTATATTGTTTCTACAC	2
ACGGTGACTCACAAGACTGGGTGG	1
ACGGTGACTGAAATTTTCTGT	1
ACGGTGAGAAAGTGTGGCTTGCTA	2
ACGGTGAGAAGCCTGACTAAGGCCC	1
ACGGTGAGATTAGATAGTGCCATG	2
ACGGTGAGCTTGAAAGAGGTGTAG	1
ACGGTGAGCTTGAGGAAGTCGGG	1
ACGGTGAGGCTGGGGGTTGGTGTT	3
ACGGTGAGGGTGCTGACTCGGCGA	1
ACGGTGAGGTCCACATGCCAGCGA	1
ACGGTGAGTTCGATGGTGTGCGGA	5
ACGGTGATAAATGATTTATTACTGG	1
ACGGTGATACTGCACGTGAAAGGC	1
ACGGTGATCAGCGTTGGAGGA	7
ACGGTGATCATATCAAGCTAATAA	1
ACGGTGATCATTGCCGGTCGGCGC	3
ACGGTGATGATGACGGCGCGGCGA	1
ACGGTGATGATGGCGGATGCTGTT	1
ACGGTGATGGCATTTTTGGAAGAA	1
ACGGTGATGGTGATGGCGTTGCTA	3
ACGGTGATGTGCACGGTTGTGGAC	1
ACGGTGATGTGCTAAAAAGTCAAC	1
ACGGTGATGTTTGAAACTCACGTA	1
ACGGTGATTCTCCTATGGTTGCT	2
ACGGTGATTTCGCGAGAGGTGTGA	1
ACGGTGCAAACCGACAAAGATGGA	1
ACGGTGCAAGAGATGATGTCACC	2
ACGGTGCAAGGCAGAGGATGCTGG	1
ACGGTGCAATCGAATTTTAGATGG	1
ACGGTGCACCACATTAACCTATAC	1
ACGGTGCACCCAGGTCACATTGGG	6
ACGGTGCAGATCGATTATGTTTGT	4
ACGGTGCAGTAACGCGACAGTCA	1
ACGGTGCAGTAGTTACAATACCCG	2
ACGGTGCATCCTTAACAAGGAGGG	3
ACGGTGCATGAACGCACATGTGAC	1
ACGGTGCCAAGGCATTGGCCTAGG	1
ACGGTGCCCGAGCTCATCCGCTCC	1
ACGGTGCGAAATTCTATTGGTAGA	3
ACGGTGCGTACACGCGAGGGCCTG	1
ACGGTGCGTATCTAGTCAATATA	1
ACGGTGCGTGGGTGCGGTGCAATG	4
ACGGTGCTAGATTGGTGGGAGGCT	2
ACGGTGCTAGCTTTCTTATAGGTT	1
ACGGTGCTATTTACTTAGGTCATT	1
ACGGTGCTCAGCCATGAGGTAGGC	1
ACGGTGCTCAGTGGCAGAATTGAG	2
ACGGTGCTGACCATATATGTGGG	1
ACGGTGCTTTGGGTTTACGACTTC	1
ACGGTGCTTTTCTCAAAACCAGAT	1
ACGGTGCTTTTGGTCTACGTGACA	6
ACGGTGGAAACTACCTATCACTGG	1
ACGGTGGAAAGGCGACCTGCG	2
ACGGTGGAACCCTAAAAGGGATGAC	2
ACGGTGGAAGAGGATGATGCCATC	1
ACGGTGGAAGTGGTGGTTCGGCCG	1
ACGGTGGACCTGTATTAGCGGTGA	1
ACGGTGGACGGTATTCTTCGTCGC	1
ACGGTGGAGATGGTTGTTGATCAC	1
ACGGTGGAGGGGTATTGGAAAGGG	1
ACGGTGGAGGTGTGCATGACGGA	1
ACGGTGGAGTAACATGACGACCAC	1
ACGGTGGATACCTCAGTTGGTAGG	1
ACGGTGGATACGCTAAACGGTGT	1
ACGGTGGATACGCTAAACGGTGTA	1
ACGGTGGATCCGCCACTGAGGTTC	1
ACGGTGGATGGACACTGTGTGGAA	1
ACGGTGGATGGATATCGTGTGGGA	1
ACGGTGGATTGAGATCAAATACA	1
ACGGTGGATTTGACGATGGCGGC	1
ACGGTGGCAGCGCTGGTGGTGTCT	1
ACGGTGGCCAACTAGATCAACTTG	1
ACGGTGGCCGCTATGTAAGGGATA	1
ACGGTGGCCGCTGTAGGCGTAGAG	1
ACGGTGGCCGTTGTGGTTGATCGG	1
ACGGTGGCGAGAGAGATTAGTGCG	1
ACGGTGGCGCTTACGTGTCAGTGG	1
ACGGTGGCTAGAAGAAAAGCTC	1
ACGGTGGCTCGTATTTATGGCTAA	1
ACGGTGGCTTGGTAGAGCGCGTGT	1
ACGGTGGGAGACGAGATGGATGG	1
ACGGTGGGTTAAGTGTCCGCCTAC	2
ACGGTGGTAGATCGTGATGGGCGG	1
ACGGTGGTATCTCGACAGTTGGAC	1
ACGGTGGTATGATTACTCGAATCA	2
ACGGTGGTATGCTTATCGATGA	2
ACGGTGGTATGCTTATCGATGAGC	1
ACGGTGGTCCATATTTTGCTGGAT	1
ACGGTGGTGCTTTGCAACAAAGGC	2
ACGGTGGTGCTTTGCAACAGAGGC	3
ACGGTGGTGTCTTGTTCGCTCTCT	2
ACGGTGGTTACGTCTTACCCCCTC	1
ACGGTGGTTTTGGTCTACGTGGCA	1
ACGGTGTAAAACATTTTGAAATGG	1
ACGGTGTAAACCAACAAAGATGG	1
ACGGTGTAAACCAACAAAGATGGA	1
ACGGTGTAAATTGATTTGATTTTT	1
ACGGTGTAACAGATCGTAAATCAG	3
ACGGTGTAACGGAAAAGTTGGAAG	1
ACGGTGTAACTACATTGTAACTACT	2
ACGGTGTAATCGGATCGTAGATCG	2
ACGGTGTAATCGGATTATAAATCG	1
ACGGTGTAGAGAAAACAGGGTCAGA	1
ACGGTGTAGGATGTGTCATATTCA	2
ACGGTGTATACATGAATTCTGAAT	1
ACGGTGTATATTTTTTGTAAAAAA	1
ACGGTGTATCGGCTCCAAAGCTAG	1
ACGGTGTATCTCTAACGGTTGGTC	1
ACGGTGTCAAACATTTAGAGAATGA	1
ACGGTGTCAAACATTTAGGAAATG	1
ACGGTGTCAAACATTTAGGGAAGG	1
ACGGTGTCAAACATTTAGGGATGG	1
ACGGTGTCAAACATTTAGTGAATG	1
ACGGTGTCAAACATTTCAAAACGG	1
ACGGTGTCAAACATTTCGAAACGG	8
ACGGTGTCAAACATTTCGAAACGGAGG	1
ACGGTGTCAAACATTTCGAAATGG	4
ACGGTGTCAAACATTTTAAAACGG	2
ACGGTGTCAAACATTTTAAAATGG	1
ACGGTGTCAAACATTTTGAAACGG	24
ACGGTGTCAAACATTTTGAAATG	2
ACGGTGTCAAACATTTTGAAATGG	8
ACGGTGTCAAACGTTTCGAAACGG	1
ACGGTGTCAAACGTTTTGAAACGG	1
ACGGTGTCAAATATTTAGAAACGG	2
ACGGTGTCAAATATTTAGGGA	1
ACGGTGTCAAATATTTCGAAACGC	2
ACGGTGTCAAATATTTCGAAACGG	5
ACGGTGTCAAATATTTTAAAACGG	1
ACGGTGTCAAATATTTTAAAATGG	1
ACGGTGTCAAATATTTTAGGATGG	1
ACGGTGTCAAATATTTTGAAACGG	12
ACGGTGTCAAATATTTTGAAATAG	1
ACGGTGTCAACTATTTAGAAATGG	3
ACGGTGTCAAGTATTTTGAAACGA	1
ACGGTGTCATACATTAAAATACGG	7
ACGGTGTCATACATTAAAATACTG	1
ACGGTGTCATACATTAAAATATG	1
ACGGTGTCATACATTAAAATATGG	2
ACGGTGTCATACATTTAAAATACG	1
ACGGTGTCATATATTAAAATATGG	4
ACGGTGTCATCTATTAAAAAACGG	1
ACGGTGTCATCTATTAAAAAATGG	1
ACGGTGTCATCTATTAAAAACAGA	2
ACGGTGTCATCTATTAAAAACGGA	1
ACGGTGTCATCTATTATAAAGAAA	1
ACGGTGTCCATCCACCATGTGCCA	1
ACGGTGTCCATGGGCAAATTACC	1
ACGGTGTCCATTGGTAAATTACC	1
ACGGTGTCCATTGGTAAATTACCA	2
ACGGTGTCCGTCACAGTCTAGAA	1
ACGGTGTCCTGTCAACTGTTGTGG	2
ACGGTGTCGAAAGCGGACAGCGGG	1
ACGGTGTCGAATATTTTGAAAGGA	1
ACGGTGTCGGGATCGATGTTGTT	1
ACGGTGTCTAACAGAGTGAAAGTG	1
ACGGTGTCTAACATTTAGAGAATG	3
ACGGTGTCTATCAATAAATAACCA	1
ACGGTGTCTATTGGCAAATTACC	1
ACGGTGTCTCACAACTAATTACAT	1
ACGGTGTCTCACGGAATTGTTCGA	1
ACGGTGTCTCTTAGCCAATTACAC	1
ACGGTGTCTGGTTTTAGATTTAGG	1
ACGGTGTCTTTGAAAGCAGAGGAT	1
ACGGTGTGATTAAGTAAGAATGAT	1
ACGGTGTGATTTATGAAAAGCTTT	1
ACGGTGTGCACATTTTGCAATGAG	1
ACGGTGTGCAGGTGGGCCAAATGAC	1
ACGGTGTGCCATAAATGTTCGG	1
ACGGTGTGGAGTAAGAGCAGGTAC	2
ACGGTGTGGCAAATCGTTAATTGC	1
ACGGTGTGGTGGAGGCCACGTGCTG	1
ACGGTGTGGTGGTGGAGTCGTGGA	1
ACGGTGTGTACACGCAAGGGCCTG	1
ACGGTGTGTACACGCGAGGGCCTG	3
ACGGTGTGTACACGTGAGGGCCTG	1
ACGGTGTGTATACGCGAGGGCCTG	1
ACGGTGTGTATGTTTTATGCTATA	2
ACGGTGTGTCTACAATCTAAAGAG	1
ACGGTGTGTGTATAACAGGTGGGA	1
ACGGTGTGTGTATGACAGGTGGGA	1
ACGGTGTGTGTTTTGCAAAAGGTT	1
ACGGTGTGTTGACAGCGATGGCAT	2
ACGGTGTTAAACATTTTGAAACGG	1
ACGGTGTTAAATATATGTTAAATG	1
ACGGTGTTAAATATTTTGAAACGG	1
ACGGTGTTAGTCTATGCTGTGAG	1
ACGGTGTTATACATTAAAATATGG	2
ACGGTGTTATACATTTAAAATATG	1
ACGGTGTTCCGGCGAAACCGAGGA	1
ACGGTGTTCTAAGTAACAGCACTT	2
ACGGTGTTGCAAGCTTCCACGTCA	1
ACGGTGTTGCATGTTAATCAATGT	1
ACGGTGTTGCGCTAACCTCGCCTC	2
ACGGTGTTGGTTAAGTGAGATCGG	1
ACGGTGTTGTAGCGAAAATACTGT	1
ACGGTGTTGTGCTCATAACCTCTG	1
ACGGTGTTGTGCTTTCAGTGGTAGG	5
ACGGTGTTTTGTTTTGGCCCATCA	3
ACGGTTAAACGTTGGGCACGAATA	1
ACGGTTAAAGATGTGCTAAAAAAT	1
ACGGTTAACTATTGTTTGAGTGGT	1
ACGGTTACCACATAACTGCCAAAC	2
ACGGTTACCACGGTTACCGCGCGG	1
ACGGTTACCGCGGGGTATGGTAAG	1
ACGGTTACTACCGGGGTGCGGTGT	1
ACGGTTACTACGGTTACTGTGCGG	2
ACGGTTACTGCCGTGAAAAATCGT	1
ACGGTTAGATTAGATTGGTACCTC	2
ACGGTTAGATTTTGATCAGATGGA	1
ACGGTTAGGGTTAGCTTAATTTGG	1
ACGGTTAGGTGGCGACTGGTGGTC	1
ACGGTTAGTGCATGATTTATTAAG	1
ACGGTTATGCCCAATGAAGTGGTC	1
ACGGTTCAGCCGGAGGTAGGGTCC	1
ACGGTTCAGCGATATATAACGTGC	1
ACGGTTCGTCCGAACTGGAGGTTC	1
ACGGTTCTGTAAGGTTCAGTGGAG	1
ACGGTTGACCAATACGTCAGTACC	1
ACGGTTGAGAATAGGTGCCCCC	2
ACGGTTGATAGTATTAATTTGGTA	1
ACGGTTGCGACTGCGCACAGTGAG	1
ACGGTTGCGTTGCCCGCATGGAGA	1
ACGGTTGCTGTGGTGAGACTGCTC	1
ACGGTTGGGGGACGATTGTGTAAC	1
ACGGTTGGGGGACGATTTTGTAAC	1
ACGGTTGGGGTGTAGTGGCCAGAG	1
ACGGTTGGGTGCAAGGTTTTTCTG	1
ACGGTTGGTAACGAAATTCATTGC	1
ACGGTTGTAAACGGTCGCAGTGCA	1
ACGGTTGTCTGCCGATGACGTGAC	2
ACGGTTGTCTGCCGATGATGTGAC	1
ACGGTTGTCTGCTGATGACGTGAC	1
ACGGTTGTGATTGGTGAGACTTGA	1
ACGGTTGTTCGACAGGGTGCTAAA	1
ACGGTTGTTGCACTGTATTGTTGC	1
ACGGTTGTTTTGTCTGATTGTGTA	1
ACGGTTGTTTTGTCTGATTGTGTG	1
ACGGTTTAGGACCTGTTTGGTAC	1
ACGGTTTAGGCCAAACGATGAGGC	1
ACGGTTTATAGATGATGTGGCTCA	2
ACGGTTTCGCTGACGTGACGGTGT	1
ACGGTTTCTCGAAGACGTTGTTGTG	1
ACGGTTTGAAACCCAAAAAGGTGG	1
ACGGTTTGAGGAGATGATCAAGCA	1
ACGGTTTGCAGAAGTGAAACCTAC	5
ACGGTTTGCGCATTGAACGATTGA	3
ACGGTTTGGCCGTGGTTACCGC	2
ACGGTTTGGTAAACCCTGGGCAGAC	1
ACGGTTTGTCACGGTTACCGCGGT	2
ACGGTTTTATCCTACGTGGCGTAC	1
ACGGTTTTCGAGATGCTACTTTGC	2
ACGGTTTTGCAAGTTGAATGATGT	1
ACGGTTTTGGCTAACGTGGCGTCT	1
ACGGTTTTGGCTAAGGCGGCACCA	1
ACGGTTTTGGTCCTATATGACAGT	3
ACGGTTTTGTCCTGCATGTGTGCG	1
ACGGTTTTGTTAGTTGAGGGACGC	2
ACGGTTTTGTTAGTTGAGTGATGC	1
ACGGTTTTTCACGGTTACCGCGGT	1
ACGGTTTTTTACGGTTACGGTAAC	1
ACGTAAAAAGTAAGGTGGTATGAC	3
ACGTAAAACGAGGTGAATCATTA	2
ACGTAAAACGAGGTGAGCCATTAA	4
ACGTAAAACGAGGTGAGCCATTAG	2
ACGTAAAACGAGGTGAGCTATTA	1
ACGTAAAACGAGGTGAGCTATTAG	3
ACGTAAAATAAGGTGAGCCATTAG	1
ACGTAAAATGAGGTGAGCTATTAG	1
ACGTAAAATGTAAGGTGGTATGAA	1
ACGTAAACCGTGCACACAAGGTCC	1
ACGTAAACGCCACGTCAATGCCAC	1
ACGTAAACGGTAAGGGCATTAGAT	1
ACGTAAAGTGGTGGGCGAGTTGGA	1
ACGTAAATACGGTATGAACCCCAC	1
ACGTAAATCGGGTGCTGACGTCAT	1
ACGTAAATGCCACGTAGGATGATG	1
ACGTAAATTGGTGTGCCACTAGCT	2
ACGTAACGAAATATATAGAGATGG	1
ACGTAACGGTGTTGGCTCGGTCTT	1
ACGTAACGTGTGTATGATAGGTAGG	1
ACGTAAGATTTTGGTAGGAATGC	1
ACGTAAGCCGACTACACGCGAAAA	1
ACGTAAGCGCCACGTTGATGCCAC	1
ACGTAAGCTAAAATAGGGCATAA	2
ACGTAAGTGCCACGTAGGACAAAG	1
ACGTAAGTGTGTATTTTTATTGAC	1
ACGTAAGTTTACGGTAGGCTTAGC	1
ACGTAATATGTATATGACAGGTGG	4
ACGTAATATGTGACCTATAGAATT	1
ACGTAATATGTGACCTGTAGAATT	1
ACGTAATATGTGCATGACAGGTGG	1
ACGTAATATGTGTATGACAGGTGA	1
ACGTAATGGGTGTATGATATATG	1
ACGTAATGTGAATATGATAGGTGG	1
ACGTAATGTGTATATGACAGGTAG	1
ACGTAATGTGTATATGACAGGTGG	2
ACGTAATGTGTATATGATAGGTGA	1
ACGTAATGTGTATATGATAGGTGT	1
ACGTAATGTGTGTATGACAGGTGG	1
ACGTAATGTGTGTATGAGAGGTGG	1
ACGTAATGTGTGTATGATAGGTGG	1
ACGTAATGTGTTTATGATAGGTAGG	1
ACGTACAAAACAAAGGATTGGAAC	1
ACGTACACATTGGGAGATATGCCA	1
ACGTACACCGAGTGGTGTGGTGCG	2
ACGTACCGAGGTGACGGAAAGACC	1
ACGTACCTGACTATTCAGTGACCT	1
ACGTACCTGTCGGTGATATGGGCC	1
ACGTACGCCCGCGATCGCAAGCA	1
ACGTACGCGCGCGTTAGGTATCCC	1
ACGTACGCGTCAAATGGTCCGCAA	1
ACGTACGCGTCGAATGGTCCGAAA	1
ACGTACGTAGATGTAGGTGGC	15
ACGTACGTATATAGGGCTAAGAGA	1
ACGTACGTGCATCCTGAAGAC	1
ACGTACTAAAAAGTAAACGGTGTC	1
ACGTACTAAAAAGTCAACGGTGT	1
ACGTACTAAAAAGTCAACGGTGTC	3
ACGTACTAAAAAGTTAACGGTGTC	3
ACGTACTACCATAATTGCGAACC	1
ACGTACTATAAAGTCAACGGTGTC	1
ACGTACTCCCTCCGTTTCACGATG	1
ACGTACTGAAAAGTCAACGGTGTC	1
ACGTACTGGTGATATAGTTAGCGC	1
ACGTACTTGGAGTGCCACACTAAA	1
ACGTAGACCAAAAGTGGAGCTGAT	1
ACGTAGACGCGTGGTGTAGATGT	1
ACGTAGAGACAATAAGATCTCTAA	1
ACGTAGATCTGGTGACGAATCGAA	1
ACGTAGATGCCACTGCAATCTTCT	1
ACGTAGCATGCCACGTAGACAAGA	2
ACGTAGCATGTGAATGATGACGAC	1
ACGTAGCCTAGTGGTTGTAGTGAC	1
ACGTAGCGCTAGAATGTCCTATCC	1
ACGTAGGACAAAAAATGATGTGGC	1
ACGTAGGACAAAATCGGGGCCAAA	1
ACGTAGGACACCTACTGCCATGGA	1
ACGTAGGACCGAAACCACCCTGGA	1
ACGTAGGACGAAAGCACCAGTGAC	1
ACGTAGGAGCAGAAAATGGCTCAC	1
ACGTAGGCCTATCCGACACCACCT	1
ACGTAGGCGCCACGTCAACAAA	1
ACGTAGGGCCTACATGTCAGCTGC	2
ACGTAGGGGAATAACAATGGGAAC	1
ACGTAGGGGAATCACAATGGGAAC	1
ACGTAGGTCAAACACGTAGATGG	2
ACGTAGGTGTCATGGCAG	1
ACGTAGTCCTACTATCCTCACCAC	1
ACGTAGTCTACTTGCGTATGTGAA	1
ACGTAGTGGCCATGTACGGG	1
ACGTATAATGTAAATATAGGTGTC	1
ACGTATACGGTCCTACTAACTTAC	1
ACGTATACGGTGGATTCTATTAGA	1
ACGTATAGCCTTTTCCATTGTGAA	1
ACGTATAGGAGGGCCTGTAGAGG	1
ACGTATAGGGGACCAAAGGTGACA	1
ACGTATAGGTGCCGGTTTTTTAA	1
ACGTATATAGGAGGACGTGGGGAA	3
ACGTATATCAAGCAAGGTGAG	1
ACGTATCCTAGTACTACGAATCT	2
ACGTATCCTGGTACTACGAACCTG	1
ACGTATCGGCATGGCCTACCCACG	1
ACGTATCGTGCTGGTGCAAGGCTA	1
ACGTATGAATATGGGTAATGATA	1
ACGTATGATAGGTGAGACTAGATA	2
ACGTATGGGCCTATGAAGGTGAGC	3
ACGTATGTAGATGATGGTCTC	1
ACGTATGTTGGTGTGTGCTGTGTC	1
ACGTATTAAAAAGTCAACGGTGTC	4
ACGTATTAAAATGTGATGGGTTAA	2
ACGTATTAAATGACACCTGATACA	1
ACGTATTACGGTACCATTGAGGAC	2
ACGTATTCGTATCCGTTCACGTA	1
ACGTATTCTAGTACTACGAATGAC	1
ACGTATTGGAGCCTGTGTTATAGC	2
ACGTATTTTGAAACGGAGGGAGT	1
ACGTATTTTTAATCCATTCTGAAC	1
ACGTCAAAAATTGGAAGTTTGGTTGA	1
ACGTCAAAAGTCAAATGCGATCGT	2
ACGTCAAACAAACTGGGGCCACAATC	1
ACGTCAACACAAGTGAAGATTAAG	1
ACGTCAACGCCACGTGGATCGAAG	2
ACGTCAACGGCAGACAAGGTGAAC	2
ACGTCAACGTCACGTGGAACGAAG	1
ACGTCAATATATTTGACACGGGTG	1
ACGTCAATGCCACGTGAAAAGAAG	2
ACGTCACAATACATGAATGGATGG	2
ACGTCACAGATGATGGTCATGCCC	1
ACGTCACATCCGGTCCTAGATTAC	2
ACGTCACCACACCGCCAGCGAAGA	1
ACGTCACGAGGTACGGCATCGGGCA	1
ACGTCACGAGGTGACACAGGGTGA	1
ACGTCAGAAAAAATTGGGGTCAA	1
ACGTCAGATAAAACCGGGTGCAAA	1
ACGTCAGCAAAGTCTGTAGGTGTC	1
ACGTCAGCCCGTCTGGTATGGTCA	1
ACGTCAGCGGATGGAGCGGGTCGG	1
ACGTCATACATACTAGTGCAACAA	1
ACGTCATATCCAATCCTATGTTGC	2
ACGTCATATCGATATAGGTGTTGT	1
ACGTCATGATAGTACGGATGCCC	1
ACGTCATGCATTGCCAATTTGCCA	1
ACGTCATTGGGTGCTAAAATTGAC	1
ACGTCCACCCGAGTGTTTAAAACA	1
ACGTCCAGCCACCTTGCTCATCGT	1
ACGTCCAGTGGAAACTACTGAAGT	1
ACGTCCCATCCGGTATTAGGTTGT	1
ACGTCCCGAGAGGAATGCGGTGAC	1
ACGTCCGAGAGCAGCAAGCCCGGCA	1
ACGTCCGATGTGATGATGTGACAC	2
ACGTCCGCGGGCAATGGGCATGGG	1
ACGTCCGGCTAGCTTGTTTGTAGG	1
ACGTCCGTAGAGGATTGGTGGTAT	1
ACGTCCGTCCATGGCTTGATCCCC	1
ACGTCCTAATACTACGAATCTAGA	1
ACGTCCTATATGTTCTACAGTAAC	1
ACGTCCTATTATGGAGGCCTT	1
ACGTCCTCGTACCACGGTATGTGT	1
ACGTCCTGGGTGATGTTTGTTGGA	2
ACGTCGAACACGTACCGAGGTGGC	1
ACGTCGACAATTTGATAAGGGCTT	1
ACGTCGAGACTGGTGCTGTGG	1
ACGTCGATAATTTGGTCCACTGTG	1
ACGTCGCATGTGATAGCCTAAGAT	2
ACGTCGGTTCGCGTGCGCCATGGT	1
ACGTCGTAGGACATGTGCTTTTA	1
ACGTCGTCGATGTTGCTGTGTTTC	1
ACGTCGTCTATCAATTGTTGAGGT	1
ACGTCGTGCTGATAACGTATTACGT	1
ACGTCTAAGGAAACATGCCACGTC	1
ACGTCTACGCGTCGGATTTTCGAT	1
ACGTCTAGATTTGTAGTATGTGTC	1
ACGTCTCGCGATGATCTTGGTGTA	2
ACGTCTCGTGTTGGAGGTTGTACT	1
ACGTCTCGTTGTTGATGGGTACAT	1
ACGTCTGAAGAGGGATATGGGAGA	1
ACGTCTGCCCACACCACATTAAA	1
ACGTCTTAGAATTTGTGCTGTAGC	1
ACGTCTTAGAGTCCGTACTGCAGC	1
ACGTCTTAGAGTCCGTGCTACAGC	1
ACGTCTTATGTCAAGCCTATGTCC	1
ACGTCTTCGGGTCTCGGGCGGACA	1
ACGTCTTCTTAATATACGGTGTCA	1
ACGTCTTGCAGTCATGTCATTCAA	1
ACGTCTTGGAATATGTGCTGCAGC	1
ACGTCTTGTGTCAGTGCTGTCTAC	1
ACGTCTTGTTGTCGACGGGTACGT	1
ACGTCTTTGGGTGGACGGAGTGGC	1
ACGTGAAAAACGAGGGAGATGGGT	1
ACGTGAAAACTATGAGAGCCCCAC	1
ACGTGAAACCTTATGTGCATAGG	1
ACGTGAAATTCTACGCATTGCTGC	3
ACGTGAACAACAAAGTGGTGGGCG	1
ACGTGAACACAAGTGCAATAGAGG	1
ACGTGAACTTGTTTGGTGGGTGCA	1
ACGTGAAGAGGGAATTGTGCCGATT	1
ACGTGAAGGTATACCTTATCGGTA	1
ACGTGAATAGATTTGTCTTACAAA	1
ACGTGAATATTAAGAAATTGCCTA	1
ACGTGAATGATAGTTTGATTGAAC	1
ACGTGAATTACGTGGGATGATGAT	2
ACGTGACAACGAACATCGACACAC	1
ACGTGACACTTACGTGACGGTGGA	4
ACGTGACAGGAACGATGTGACGGA	1
ACGTGACAGGTTGATCGTGGTTGA	4
ACGTGACATTTTTATCACCGGCGC	1
ACGTGACCCCATGAGCGATGGGAT	1
ACGTGACCCTTTTGGACTACTTCG	1
ACGTGACCTATAACCCCTTCCGAC	2
ACGTGACGCACAAGTGGTAGTCCA	1
ACGTGACTACACAACTAGTGGTAC	1
ACGTGACTCATTCTAATACTATGA	1
ACGTGACTGAAAAAAATTGTGTGT	1
ACGTGAGAAACATGGTATTGAGTC	1
ACGTGAGAATGGACACCACAACT	1
ACGTGAGAATGGACACCATAACTA	1
ACGTGAGATGCCTTTGACCGACCT	1
ACGTGAGATGTGCAGACGGTTGAA	1
ACGTGAGATTGAGGTAAAAGAGAC	1
ACGTGAGATTGAGGTAGAAGAGAC	1
ACGTGAGGGCCTATGTGCATAGGA	4
ACGTGAGGGCCTGTGTGCATAGGA	4
ACGTGAGTATGGTGTTACGTGTAT	1
ACGTGAGTGTAATACGTAGACCAA	1
ACGTGATACGGCTGATGGACACAA	1
ACGTGATACGGCTGATGGACACTGC	1
ACGTGATAGAGATTATGGCATGAA	1
ACGTGATCTTCGCTACCGGCGCCA	1
ACGTGATGAGATGAAAAGTGCTGA	1
ACGTGATGATATCGGTGCTAATAG	1
ACGTGATGTCACGAACGGTATTGC	1
ACGTGATGTGTGTGGTAATGTCTA	4
ACGTGATTAATTAAGGTGGTGTT	1
ACGTGATTAGTCTAATGAGGTGAG	1
ACGTGATTTAGGGACTTACAATGT	2
ACGTGCAAAAACTACTTTAAACTG	1
ACGTGCAACCCGAGGTTGTGGGCC	2
ACGTGCAAGTTACAGTGTAATTA	1
ACGTGCACAGAAATCTTAATTTTC	1
ACGTGCACATGATTTCTCTTCCCG	1
ACGTGCACGCGGAGGTTGTAGGGCT	1
ACGTGCACTGCACTGCGAATGGAG	1
ACGTGCAGATGGGGAAGAGATGAA	1
ACGTGCAGCTCTCGTCGGGTGTCG	1
ACGTGCAGTGCTGCCTAGCTGACC	2
ACGTGCATCGAATATCCTGCA	2
ACGTGCCAAGTCTAGAACCTGAACC	1
ACGTGCCAATGAAACATACCCATG	1
ACGTGCCAGGCCGTGCCAGTCCAC	1
ACGTGCCAGTTGGTTTGATCCTGTA	1
ACGTGCCGCATACCACCACGGTAT	1
ACGTGCCGCTCTTTTAATAGGTCC	1
ACGTGCCGGCTGCCTGTGACGAAG	1
ACGTGCGACCTTATGCTCGAGCGG	1
ACGTGCGAGCATACGGATTGAGGA	5
ACGTGCGAGGTAGGAACCATGCCC	1
ACGTGCGCACGCTTCCTCAGTGTT	1
ACGTGCGCACGGAAGACTGGGCCGG	1
ACGTGCGCTTACTTGGTAATTCGA	1
ACGTGCGGAAAGAGATCTAGGGAC	2
ACGTGCGGCGCTAGCTGGAGGTAC	1
ACGTGCGGTAGGTTAGGTGGCCA	1
ACGTGCGGTGGGGCCCGTTTGACT	1
ACGTGCGGTTACCGTAAGATGTACC	2
ACGTGCGTACGTTAATGGAAGCCA	3
ACGTGCGTGCGTTCATATGGGTGA	1
ACGTGCTAAAAAGTCAACGGTGTC	1
ACGTGCTAAAAATTTAACGGTGTC	1
ACGTGCTACTCGGATAACCGTAG	1
ACGTGCTAGGGAGTGACGGTTCCC	1
ACGTGCTAGTTTGGATTGAAACCA	1
ACGTGCTATAACCTAAAACGGAGG	1
ACGTGCTATGGTGACGAGTTTGTT	1
ACGTGCTCCGATGGTATGCCAATG	1
ACGTGCTCTATATTAAAGTTGTAG	1
ACGTGCTGCTTACAAATTTGCTGA	1
ACGTGCTGTGATTCTTTATGGTTT	1
ACGTGCTTACGAACTTTTTACCCT	1
ACGTGCTTATTTGCCACTGGACAC	1
ACGTGCTTTAAGTTTGACTAACTT	1
ACGTGGAACCTACATATCAGCTGC	1
ACGTGGAAGAAAGAGATGGAAGA	1
ACGTGGAAGGGAGTGATATATCA	1
ACGTGGAATCCACGCGGGTTGCAC	6
ACGTGGACAGCTTAAATGTGATGG	1
ACGTGGACATTTGGGTTCCTCTC	1
ACGTGGACCGCTCAGGGCGAATGC	2
ACGTGGACGACCTTATCTTCTGG	1
ACGTGGACTGTCAGGCGATATGGT	1
ACGTGGAGCCTTCTTTCAAAGCTG	2
ACGTGGAGGAATACAAATGATGG	1
ACGTGGAGGCCAAAACATCAAGAT	1
ACGTGGAGTTTATGAAAAATATGT	1
ACGTGGATGCCCATGTACGGTGGT	1
ACGTGGATTGGGCTGAAGACGACG	1
ACGTGGCAACGGTGATGATGATGA	1
ACGTGGCAATGATGTGGCGCATAC	1
ACGTGGCACCTACGTGGTGGTGTT	1
ACGTGGCAGGGTAAGTGGGCGGC	1
ACGTGGCAGTCTTGGCGCTTACGT	1
ACGTGGCATATACGTGGCGCCGAC	1
ACGTGGCATTGACGTGGTGCTTAT	2
ACGTGGCCAAATAACGGTGTCACG	1
ACGTGGCCACCGTAATTGATGCTA	1
ACGTGGCCTGGCACCTTCGGGGAC	1
ACGTGGCGGTATTGACCTGGTCTT	1
ACGTGGCGTCCTACAAACGCTCCT	1
ACGTGGCTACTAGATTAAGGGTGT	2
ACGTGGCTCCACAAATACCGG	2
ACGTGGCTCCCTTTGACTAGGTCC	1
ACGTGGCTCTGAGGTGTCTAAATT	2
ACGTGGCTGCTGAGTCAGCATAGG	1
ACGTGGCTTGTTTGACTAGGTCTC	1
ACGTGGCTTGTTTTGCAGATTCCC	1
ACGTGGGACCTGCTTGTAAGTATG	1
ACGTGGGACTCACATGTCAGCTGC	1
ACGTGGGAGCTCGGTTGTCGGT	1
ACGTGGGAGGGTGAGGCTGAACGC	1
ACGTGGGCCCTCATGTGTCTATGA	1
ACGTGGGCCTGTATTTGTTACGG	3
ACGTGGGCGTTGGATTTGATTGGG	2
ACGTGGGCTGCTTTTATAGTTTGG	1
ACGTGGGCTGTGGGCAGGATTGGC	1
ACGTGGGGACACTATACCCAGGTA	1
ACGTGGGGCCCATATGTCAGCGGG	1
ACGTGGGTCCACAAGTTATGAGAT	1
ACGTGGGTCCATATGTGTCATAAC	1
ACGTGGGTCCTACGCTGAGTCAGC	1
ACGTGGGTGACTGTCACATTGCGT	1
ACGTGGGTGATTTGTTGCAATGGA	2
ACGTGGGTGCATAGATCCTCGGGC	1
ACGTGGGTGCGATGTTTTCGACAG	1
ACGTGGGTGCGTAGTTTTTAACC	1
ACGTGGTAAAGTGAAGCAATCAAC	1
ACGTGGTAACTACGTGGCGGTGTT	1
ACGTGGTAATTTGCCGATGGACAT	1
ACGTGGTAATTTGTCAGTGGACAC	1
ACGTGGTATTCACACGGCGGTGTT	1
ACGTGGTCCGCCTAGAAAAATCGT	1
ACGTGGTCTGCCTGCAAAAATAAT	1
ACGTGGTGACCGAGGGTTATGGAT	1
ACGTGGTGACTTCTTTCAAGCCTG	1
ACGTGGTGAGAGTCGATTTGGCTG	1
ACGTGGTGATAAGGTGCAAGGCC	1
ACGTGGTGCCACCTTTCAAGGTTG	1
ACGTGGTGCCTTCTTTTCGAGCTG	1
ACGTGGTGCTAACGTCATGCTGAC	4
ACGTGGTGCTTTCTTTTAAGGCTG	1
ACGTGGTGGACAAGAATGACCGGT	1
ACGTGGTGGCCGCGGTATGGTTGG	1
ACGTGGTGGCTCCTTTCAAGGCTG	2
ACGTGGTGGCTGACATGTGGACCC	1
ACGTGGTGTAAACTTGGTGATCCA	1
ACGTGGTGTAACGTTGGACAGTGA	2
ACGTGGTGTAGCGTTGGACAGTAA	2
ACGTGGTGTCTAGATTACAGGATA	2
ACGTGGTGTCTAGATTATTAAGTA	5
ACGTGGTGTCTCCTTTCAAAACTG	1
ACGTGGTGTCTCCTTTCAAGGCTG	1
ACGTGGTGTCTCCTTTTCGAGCTA	1
ACGTGGTGTCTCCTTTTCGAGCTG	1
ACGTGGTGTCTTCTTTCAAAGCTG	1
ACGTGGTGTCTTCTTTCAAGGCTG	1
ACGTGGTGTCTTTATTCAAAGCTA	1
ACGTGGTGTTTAGATTATTAAGTA	1
ACGTGGTGTTTGGATACAGGACTA	1
ACGTGGTTACTGATAGGTGGGCAT	1
ACGTGTAACTCACGATGTGCTTGG	1
ACGTGTAAGATAATAGTAGGGTGA	1
ACGTGTAAGTCTGAGGCCAACCGA	1
ACGTGTACCTTACCTCTACAAGCA	1
ACGTGTACGACATGCAACACCACA	1
ACGTGTACTTAAAAAGTTAGGTGA	2
ACGTGTAGATGGAAAGAAGATGGA	1
ACGTGTAGGTGCCAGTTTATTAAC	1
ACGTGTAGTGTGTGTATATATTA	1
ACGTGTAGTTAGATGGTTGTTGGT	1
ACGTGTATAGTGGTGTGTGGATGT	2
ACGTGTATATGTTTATAGGAGTGA	1
ACGTGTATTAAGAAAGTATGTGA	1
ACGTGTATTAAGGAATGGTAAGAG	1
ACGTGTCACGGCTGAAAGACATCC	1
ACGTGTCACGGTTAAAAGATACCC	4
ACGTGTCAGTGGGGACTCACATGT	1
ACGTGTCATAAACACATGAGGGCC	1
ACGTGTCATAGACATATGGGTGGC	1
ACGTGTCATGCTCTCAAATTTAGA	1
ACGTGTCATTAAGATAGGGGTGG	2
ACGTGTCATTATGAATTTAAACA	2
ACGTGTCATTGAGATACCGATGGC	1
ACGTGTCATTGAGATACGGGTGAC	1
ACGTGTCATTGAGATAGGGGTGGT	2
ACGTGTCATTGAGATAGGGTGGT	1
ACGTGTCGCTCATACCACCCCTCC	1
ACGTGTCGTTAGCGCGGTGGTCAA	1
ACGTGTCGTTGATATGGCGTTTAG	1
ACGTGTCGTTTTGTTCTGGCGAA	1
ACGTGTCTACACGTGAGGTCCTGT	1
ACGTGTCTATAGATAGCGAGACGT	1
ACGTGTCTATGACATGTGGGCCTA	2
ACGTGTCTATGACATGTGGGTCC	1
ACGTGTCTATGACATGTGGGTCCA	1
ACGTGTCTATGACATGTGGGTCTA	2
ACGTGTCTATTGTAACTGTATGG	1
ACGTGTCTGTATATTCGATGTGAC	1
ACGTGTCTTTGAACGAGGGGGTTC	1
ACGTGTGACCATAAGAAATACCA	1
ACGTGTGAGGTAATAAAATAGTGG	1
ACGTGTGCCATCTACTCAGTAGAC	1
ACGTGTGCCGATTATATATACTAC	1
ACGTGTGCGGTGATGTGTACGCGT	1
ACGTGTGCTTAGCAATCTAAATGC	1
ACGTGTGGACCTGGACCCATATGT	1
ACGTGTGGCGTGCTAAACTAACGC	1
ACGTGTGGGAAAAACGAGTGGCGC	1
ACGTGTGGGACCCACGTGGATCC	1
ACGTGTGGGTCTACATGTGTCTAT	1
ACGTGTGGTGCAATGGGAGGGTAG	1
ACGTGTGGTGCAATGGGAGGGTAGG	1
ACGTGTGGTTTCAACCCAGAGGTC	1
ACGTGTGTACACGTGAGGGCCTGT	1
ACGTGTGTACATGTGAGGGCCTGT	1
ACGTGTGTAGTGGTGTGTGCGCAT	1
ACGTGTGTATACGTGAGGGCCTG	1
ACGTGTGTATGACAAATTGATGT	1
ACGTGTGTCTAATATGCGCGCGAA	1
ACGTGTGTGCCACGTAGGCTGAAA	2
ACGTGTGTGGTTTTCTACAACTTG	1
ACGTGTGTTTATAATGTTGAGTG	1
ACGTGTGTTTGTGAATGTGAAGTT	1
ACGTGTTAAAAAATTAACGGTGTC	1
ACGTGTTAAGTGGCCCGCACACGA	1
ACGTGTTAGGGTGGTTGTATAATA	1
ACGTGTTATGAAACAACAGGGTGA	1
ACGTGTTATGCCGCTAATCTAGGT	1
ACGTGTTCTTAGCGGTGTAAAAGC	3
ACGTGTTGCCTATTTTTTAAGTAA	1
ACGTGTTGTTGCATCCTTAGCCTA	1
ACGTTAAAATTGGAAGTTTGGTTGA	1
ACGTTAAAGATGTTGTGTGTCGGG	1
ACGTTAACGCCACGTGGACCGAAG	1
ACGTTAGACACGGAAACCTAGGGT	1
ACGTTAGACACGGATATCCACGGC	2
ACGTTAGGTACGTTATGACCTTGG	1
ACGTTATCTGCTGAGTGCCACTAC	3
ACGTTATGCGAAAAGTTAATGG	2
ACGTTATGTGTGTATGACAGGTGA	1
ACGTTATGTGTGTATGATAGGTGG	2
ACGTTATGTTTGTATGAGAGGTGG	1
ACGTTATTTGTATGGTATGGAGAT	1
ACGTTCACCGTAGAGGCCTAGAAA	1
ACGTTCCTAAGCTACCACGTAGCA	1
ACGTTCCTCAGTGAAAGGAGTGTA	1
ACGTTCGATGTGACGGGGTGAAAA	1
ACGTTCGATGTGATAAGGTGTAAA	1
ACGTTCGATGTGATAGGGTGAAAA	1
ACGTTCGATGTGATAGGGTGTAAA	1
ACGTTCGATGTGGTACCTAAAATT	1
ACGTTCGCAGATTAGACATGCCTA	1
ACGTTCGCTCTCATGGCCTAGAAA	1
ACGTTCGGGATCATCAACCGCGCG	1
ACGTTCGGGATTATTTGAAATCTG	1
ACGTTCGTTGCCTCCTCTTCTGTT	1
ACGTTCTGCTAGGGGCCGCTGTTGA	1
ACGTTGAACACGGATTCCTACGGC	2
ACGTTGAACGTGAATAGTGTAAAA	2
ACGTTGACGTGGCGCTTATGTGAC	1
ACGTTGAGAGTAAGGTTGAATGTG	1
ACGTTGAGGTATGTGGTGGTGGCT	1
ACGTTGAGTGACTGACATGTGAAC	1
ACGTTGATGTGATGTGATGTGGCA	2
ACGTTGCAAAAATCCTTGGTCTAC	1
ACGTTGCATAGGGTGTTTGGACA	1
ACGTTGCTTTTTGATCCTTCGA	1
ACGTTGGAAGTGTCTACGTTGTA	1
ACGTTGGAAGTGTCTACGTTGTAC	2
ACGTTGGACAAAAATGGTGCAAAA	1
ACGTTGGACACGAAAACATGGTTT	1
ACGTTGGACACGAATACATATAGC	1
ACGTTGGATACGGAAGACAGAGCC	2
ACGTTGGATACGGATACCTATGGC	1
ACGTTGGCCTCACGTATCGGTTGG	1
ACGTTGGTACAAGGATCTACATAG	1
ACGTTGGTAGCAACATATGGGAC	1
ACGTTGGTGCTTTTACGAGGGTAT	1
ACGTTGGTGTCACGGAACTGGTCC	2
ACGTTGGTGTCGGTTTCCTCCTCGA	1
ACGTTGTAGTTGTAGATTTCAGA	1
ACGTTGTATATGGATACCCACGAA	2
ACGTTGTCGGTGGCTGATAGGCGG	1
ACGTTGTGAACTTGTTGTCATGGA	1
ACGTTGTGAGTGTCTACGTTGTAC	1
ACGTTGTGAGTGTCTGCGTTGTAC	2
ACGTTGTGAGTGTCTGCGTTGTACT	1
ACGTTGTGAGTGTTTACGTTTGTA	1
ACGTTGTGTTATATGAGAGGTGGG	2
ACGTTTAATACTTCAAATGTGTGC	1
ACGTTTAATGCTCTGTGCATATGT	1
ACGTTTACGACGTGACTACCAACC	1
ACGTTTAGATTGAAGCCAAAATAGC	1
ACGTTTATAGGGGTGAGTGTGCAT	1
ACGTTTATATTGGTGTTAATGAATC	1
ACGTTTCCCAAACAGCTAAATGGT	1
ACGTTTCTCAGCGGCCCGAACCTG	2
ACGTTTGAACACCTGCATAAAGT	4
ACGTTTGACCAGATGTCGAAAGG	1
ACGTTTGACCAGATGTCGGAAGG	2
ACGTTTGACCAGATGTTGGAAGGG	1
ACGTTTGACCGGATATTGAATGG	1
ACGTTTGACCGGGTGTTGGAAGG	1
ACGTTTGACTGGATGTCGGAAGA	1
ACGTTTGATCGGATGTCGGAAGA	1
ACGTTTGATCGGATGTCGGAAGGG	5
ACGTTTGATCGGATGTCTGAAGG	1
ACGTTTGATCGGATGTCTGAAGGG	1
ACGTTTGATGTCACGATTTCGGTA	1
ACGTTTGATGTCGTCATTCTGGTA	1
ACGTTTGGGCCCAACCTTTATGGG	2
ACGTTTGGTGTCGCAATTCAGGT	1
ACGTTTGGTGTCGCAATTCAGGTA	1
ACGTTTGGTGTTAAAGAGTGTAAG	1
ACGTTTTAGACAATGATATGGTC	2
ACGTTTTCGTAATATGTGGGTGAT	1
ACGTTTTGCTTGGCGATGTGTCTT	2
ACGTTTTGGGGTGTCTAGATCCAG	1
ACGTTTTTAGGAGGTACAACAAGA	1
ACGTTTTTTAAAAAGCTGGGGTCG	1
ACTAAAAAAGTCAACGGTGTCAAAC	3
ACTAAAAAATGGTGTAATTGGCTA	1
ACTAAAAAGTCAACGGTGTCAAAC	4
ACTAAAAAGTCAACGGTGTCAAAT	2
ACTAAAAAGTCAATAGTGTCAAAT	2
ACTAAAAAGTCAATGGTGTCAAAC	4
ACTAAAAAGTGAACGGTGTCAAAC	1
ACTAAAAAGTGCTAGAATGGTAAA	2
ACTAAAAATAGGGTTGATGTTACT	1
ACTAAAAATAGTGGAGGGCCTGAC	2
ACTAAAAATATGGCACCTATTGAT	1
ACTAAAAATGTGGCTTATTAGCGC	1
ACTAAAAGGGAGTTCGCCAGGTCC	1
ACTAAAAGTCCTACATGGCAATGT	2
ACTAAAAGTCCTACATGGTAATGT	1
ACTAAAAGTGCTTATATTTTGG	1
ACTAAAAGTGGATGGATGCGGAGA	1
ACTAAAATAGGAAAGTAATGCGGT	2
ACTAAAATCTAAACTTTGTGCTGA	1
ACTAAAATGCCTTTAATCACTGAA	1
ACTAAAATTTAGGTGTATGTAAGG	1
ACTAAACAAATAGACGCGGTGTCC	1
ACTAAACACAGCCGGCCATGGAAC	1
ACTAAACACCGAACGATGATGGAT	1
ACTAAACACGATAAAGATGGAGCG	1
ACTAAACACGGTGTTACAAAACCA	1
ACTAAACAGAGTCTACGTAATGAA	1
ACTAAACAGCAGACACATACTCCC	1
ACTAAACAGGCCCTAACTATATGG	1
ACTAAACAGGGCCCTAGTAACCAC	1
ACTAAACAGGGCCCTAGTATAGCA	2
ACTAAACAGGGCCTATATAAACG	2
ACTAAACATAGCCTTGATATGATG	1
ACTAAACATGCCTATAATAGACTC	1
ACTAAACATGCCTTACTACGTCAG	1
ACTAAACATGGAAGGTGGAAGAGG	1
ACTAAACATGGCCTAGAATTGTAG	2
ACTAAACATGGTAGTGCAACCAAC	1
ACTAAACCACATCCATGGTGTGTA	1
ACTAAACCAGTAGCATCTTCC	1
ACTAAACCATACCTGAATTCTGAA	1
ACTAAACCGTATTTAGGAGGTGTT	2
ACTAAACCTACGAGGGGATGTGAC	1
ACTAAACCTAGGATAGAATGTGAC	1
ACTAAACGAAACATTTTTGATGGA	1
ACTAAACGAATGGAACTTTCCAAC	2
ACTAAACGGGGCCAATATTAG	1
ACTAAACGGGGCCTATATCCTCTC	1
ACTAAACGGGGCCTTACTTATCAG	1
ACTAAACGGGGCCTTAGAGCTACA	2
ACTAAACGGTATGTGTTTTGCCA	1
ACTAAACGGTGGATTGAGATCAAA	1
ACTAAACGGTGTATTTTGTTTGAA	3
ACTAAACGGTGTATTTTTTGTAAA	1
ACTAAACGGTGTGTTTTTTGTAAA	1
ACTAAACTAACCCCTACGTAGACT	1
ACTAAACTGGGCCTCATTAGACAC	1
ACTAAACTTCTAATTTTGGTGTCA	2
ACTAAAGAGGGCCACACCGAAAAA	2
ACTAAAGATAATAGGGGTCCTGAT	1
ACTAAAGATAGTAAGGGGCTGCAC	2
ACTAAAGATAGTAGAGGGGTCTGA	1
ACTAAAGATGATAGGGGTTGGTAA	1
ACTAAAGATTCCGGGGGGCCTGAC	4
ACTAAAGCCGATGATTATCAGCAA	1
ACTAAAGGAATTGATTTGCACCGG	1
ACTAAAGGGGTAGGGTGCGTAGAC	2
ACTAAAGGGGTTGCGAACCGGTGT	2
ACTAAAGTGGGGTTACGAATCGAG	1
ACTAAAGTTAATTGTTTACAAGGT	2
ACTAAATAAGACGGTGGGTGCAAC	4
ACTAAATACGAAGGAGGTCGCACC	1
ACTAAATAGAGAGGTGCTACCTGC	1
ACTAAATAGGAGGTGCCGGCAACC	1
ACTAAATAGGGCCTAATACTTCT	1
ACTAAATAGGTGAAAGGAATGCCA	1
ACTAAATAGTAAGGTGGAGGAGAG	1
ACTAAATAGTCGACGGTGATGCA	1
ACTAAATATGGAAAGTGCTCATGG	1
ACTAAATCAGAAGACTGTGGATGG	1
ACTAAATGAGACCACTGATGGCAC	1
ACTAAATGCTGAGGTGAAGAAGAG	1
ACTAAATGGTGTATTTCGTGCGAA	1
ACTAAATGGTGTCCTGCGTGTTGC	1
ACTAAATGTAGCCACTGTTTTGGT	1
ACTAAATGTAGGTGGAACAATATA	1
ACTAAATTGTACCTACCTAATAAG	1
ACTAAATTGTGAGGTGGAGGAGAG	1
ACTAAATTTTAGTAAAGTTGCCAA	1
ACTAAATTTTTGGTACTCAAGGTA	1
ACTAACAAATCTGGATAAATGGTA	2
ACTAACAAATTGTGACATGTCTA	1
ACTAACAACAGGGTAGCCACTAGT	3
ACTAACAAGCGGGTTTTTATGTG	3
ACTAACAAGTCAACGGTGTCAAAC	2
ACTAACACACAAGTTTAGGGGCCG	1
ACTAACACTAGGAAGGTAGCCCGC	3
ACTAACAGCAATAGGGGTAGATGG	1
ACTAACAGGAACTGAGAGATGACC	1
ACTAACAGGTTCACATGTGAGTAA	1
ACTAACATGTGGGTCTACTGAGT	1
ACTAACCAGATGATACTATTGCCC	1
ACTAACCGAAGCCACTCCGTGGGAC	1
ACTAACCGGGAATAAAGATAGAGC	1
ACTAACCGGGACTAAAGTTGC	2
ACTAACCTAGATAAGGATGGAAC	1
ACTAACCTAGTACTGGATGTGACA	1
ACTAACCTAGTATTAGATGTGAC	2
ACTAACCTAGTATTAGATGTGACA	2
ACTAACCTGTTGCCGTAATGAACA	1
ACTAACGAAGGCTAACTGGACGAC	1
ACTAACGGAGACTAACTGGACGGC	1
ACTAACGGTGTGATGGCATTTCTG	1
ACTAACGTGTACGTATGGGATGGT	1
ACTAACGTGTGGGCCTTTAAAGG	1
ACTAACGTTAGGTAAGTTGTGAC	1
ACTAACTAGTGGTGCTAATTTGGA	1
ACTAACTCGTAGCCTATAACCCC	2
ACTAACTGGGACTACAAATAGATC	1
ACTAACTGGGCCTAGTACATGCAA	1
ACTAACTGGTATGCCTGCATCTCA	1
ACTAAGAAAGAATATGGAAGTGAG	2
ACTAAGAAGACTCTACCGGTGACG	1
ACTAAGACCTACTGAGCGCCATCG	2
ACTAAGAGGTGACATATTGTATGG	1
ACTAAGAGGTTGGTGTTTACAAAG	1
ACTAAGAGTAGAGTTAGGTGCAGC	1
ACTAAGATACGGGAGAGTGCTAAA	1
ACTAAGATAGAAGGAAAACGAGGTA	1
ACTAAGATGAAGAAAGGAGCCAAT	1
ACTAAGATGCTGGATGAGTGTATC	1
ACTAAGATGTGTCATATCGGTATT	1
ACTAAGATGTTCATGGTGACTTTGT	1
ACTAAGCAAAGGTCAGTGATGTGA	1
ACTAAGCCAACCAGAGGGGGGTGA	1
ACTAAGCCACACATATATGGGTAC	1
ACTAAGCCCGTAAAAGGTGATGGT	2
ACTAAGCCGGTTGGACCAGGTCAA	1
ACTAAGCTAAGTGGAGAAAGAA	1
ACTAAGGCCCTGTTTGGGAGAACT	3
ACTAAGGGCCTATCGCATAATGTG	2
ACTAAGGGGGTGATACTAATACAG	2
ACTAAGGTGGTGTTTGGTTGGAGG	1
ACTAAGGTGTGCTTGGTTTGTTAC	2
ACTAAGGTGTTCACTTTGCTGCCA	1
ACTAAGGTTAGTTTTTTTAAGGAC	1
ACTAAGTATGGTTCACCTATATTA	1
ACTAAGTCCTACTGATAATAGATT	1
ACTAAGTGAAACAATTTTGGTGG	1
ACTAAGTGGGTAGCAAGATAGGAC	1
ACTAAGTTCGATAGGGTAGTGCAC	1
ACTAAGTTGCAGTCTAGATGAACT	1
ACTAATAAATGCCGCATAATAGAG	3
ACTAATAACCGGCACCTATGAGA	1
ACTAATAAGGTAGAGTCGATGGCG	1
ACTAATAATTCTTTCAGTGCTAGG	1
ACTAATAGCCTGCTATTTTACCTGC	1
ACTAATCACACAGCCACCGGTGTG	1
ACTAATCACATAGTCAGGGGCTAC	1
ACTAATCACCTACATATTTTGGAA	2
ACTAATCACGGTGAATCTGGTCGA	1
ACTAATCCAAACCTGCCACTGATC	1
ACTAATCCTACCTGGATGGGACAA	1
ACTAATCTAATAGCCTATTTATAC	1
ACTAATCTAGTACTGGGTGTGA	4
ACTAATCTAGTACTGGGTGTGACA	2
ACTAATGCGGGTGTCTAAATTTGT	2
ACTAATGGGCCGGCCGGCCCGGAG	1
ACTAATGGTAGTACTACATATGAA	2
ACTAATGGTCAACTAACTGAATGG	1
ACTAATGGTGGGTGCGGCGGATCC	2
ACTAATGGTGTATTGGTTTTCTAC	1
ACTAATGTTGATGGTATTGTTGTA	1
ACTAATTAAGGTCACGAGTGAAAG	1
ACTAATTAGGGCAAGTGCTATGGT	2
ACTAATTATATAGATCGTGTGTAA	1
ACTAATTATTCTTTCAGTGATAGG	1
ACTAATTATTCTTTCAGTGGTAGG	2
ACTAATTATTGGTCAGATGCTGTC	1
ACTAATTGCACAGCATAAGGAATC	1
ACTAATTGGACCCATCACTAAGAG	1
ACTAATTTGGTCAGGTGGTCTGTC	6
ACTACAAAAACCATCTTTCGTGGC	2
ACTACAAAAGTGTGAGGAAGATGGA	1
ACTACAAAGTTGTAGGTCGTGTCA	1
ACTACAAATCTAGAGCGGATGTGT	1
ACTACAAATCTGGAGATGTGTCCC	1
ACTACAAGAAGCATTATGGAGCAG	1
ACTACAAGTAAGAAGCAAGGTGAC	1
ACTACAATACGATCTTACGATACG	1
ACTACAATATGGTTGCCTTGTTAC	1
ACTACACAGGGTGTCAAGAAACGG	1
ACTACACCGAGAGTGCTAGCTGGA	1
ACTACACCGATGTTTGTGCCGTTG	1
ACTACACGGTGTACTTTTTTGCAA	2
ACTACACGTCAAGTGCAAGCGTGC	1
ACTACACTATTAATACTTGGTCC	1
ACTACAGATGGGTTGCGTTGTATT	1
ACTACAGATTTGTAGCCAGCTATA	1
ACTACAGGAGCAACTGTTCATGGT	1
ACTACAGGTTTCGGTTGTGGGGTA	3
ACTACATAAAGGGTAAGGATGGT	1
ACTACATAACGGGTAAGGATGGT	2
ACTACATACGTGTGGTTGGGTTGTC	1
ACTACATATATCAAACAATTG	1
ACTACATGACGGGTAAGGATGG	1
ACTACATGACGGGTAAGGATGGT	2
ACTACATGACGGGTAAGGATGGTT	1
ACTACATGATGAGCCAGTAAACT	1
ACTACATGATTGATTTTTCTGGA	1
ACTACATGGTGTAACAAATCGAGC	1
ACTACATGTGAGTGCTAAACCGAC	1
ACTACATGTTCAAAGGTGGTCGCC	2
ACTACATTACGGGTAAGGATGGT	1
ACTACCAATCCGGGACTAAAGATC	1
ACTACCACCCGTCTTAAAATGGAG	1
ACTACCACGTGTTGGTATAGTTGC	1
ACTACCACTGGTGGACGAATGGTC	3
ACTACCAGCCTAGTTAGCGGTGGT	1
ACTACCAGGGTTTAGGTTGTACAGG	2
ACTACCAGGTTACAAGTTTATTGC	1
ACTACCATTACAAGCACTGACGTG	1
ACTACCCAGATGATACTATTGCCC	1
ACTACCCATCTGAAGGTCGGTGCA	1
ACTACCGCGGAAGGGATAAGAAAC	1
ACTACCGTGACATGCCACATCAAC	1
ACTACCTAGGACCGAATTGATGAC	1
ACTACCTGGTATTTGTGCTATTGC	1
ACTACCTTGGTGACAAATTTGAA	1
ACTACCTTGGTGACAAATTTGAAA	1
ACTACGAATCCGGGACTAAAGATC	2
ACTACGAATCTAGACAGAGGGCAT	2
ACTACGACATTGTTGCGTGCGATA	1
ACTACGATTGAATTTGGTAGA	1
ACTACGATTGAATTTGGTAGACT	1
ACTACGATTGAATTTGGTGGACT	10
ACTACGATTTAGGAGAAACGTTGA	1
ACTACGATTTGGGAGAAACGTTGA	1
ACTACGGAGCACGGTGATGGCCGA	1
ACTACGTAACATGTTTGAGGACCA	1
ACTACGTAGTACTAGGATATGTCC	1
ACTACGTATTATGGACCTGGTAGG	1
ACTACGTGTTGGTGTTTATGTCGC	1
ACTACTAAACGGTGCGTTTTTTTGT	1
ACTACTAGGTGGGTGGTGGTGGTA	1
ACTACTAGTATTAGGTGTTGGCC	1
ACTACTAGTATTAGGTGTTGGCCC	2
ACTACTATTATACTACTACCA	4
ACTACTCCACCTTGGACGCCGTGC	2
ACTACTGATTGGCAGTGTCGGTGA	2
ACTACTTACCTACTCTACCATGGA	1
ACTACTTCAGGATTGAGGGAT	1
ACTACTTGTCACATCCATCATCTC	1
ACTAGAAACCAGATTCTTAGAAGC	1
ACTAGAAAGGGTGAGGCTTTAAAC	1
ACTAGAAATAGGGTACGCGTTTAG	1
ACTAGAAATGCCATCGACAAGTGT	1
ACTAGAACCGGGTGAAAAATGAGA	1
ACTAGAACGGTGCCACTGCAA	7
ACTAGAAGATGGGTGTATGTACAG	1
ACTAGAAGATGGTGTCTGTATAGC	1
ACTAGAAGCCAGAAGCTGGAAAAC	1
ACTAGAAGGTGTGGGGCTTCGAAC	1
ACTAGAAGGTTGAGTTTTTGTGGA	1
ACTAGAATATATCACATCCAGCCC	1
ACTAGAATGCTGTCTGCGCGTTGC	1
ACTAGAATGTGTCACATCCGGTAC	2
ACTAGACACTACTCTTCCCATGCA	1
ACTAGACAGGCTCCAAAATATGCC	1
ACTAGACTACTAGTATTAGGTGTT	1
ACTAGACTATGCACGGGCCCTCA	2
ACTAGACTGCCACGCGTAAGCTAC	1
ACTAGACTGTAAGTGGTGATGAGT	1
ACTAGAGATATGTGTGTAGGCCTG	1
ACTAGAGGAAAGCTACACTACAAC	1
ACTAGAGGATGCCCCGCGTGTTGC	1
ACTAGAGGTGAAAACGGGTCTGGT	1
ACTAGAGGTGACATATTGTATGAG	2
ACTAGAGGTGATACATTGTATAGG	1
ACTAGAGGTGATACATTGTATGAG	4
ACTAGAGGTGCAAGCGGGCCGATC	1
ACTAGAGTCTGGATTCTTGGAGG	1
ACTAGAGTGTGTGTCAGAAATTGG	2
ACTAGATAGTCGCCATTGTGCTAC	1
ACTAGATAGTTTCTGGGTTGGGGA	1
ACTAGATATAACTAGAAAGGTAGC	1
ACTAGATATTAGAACAGGACG	1
ACTAGATCAGCGTGGCCAAATGGT	1
ACTAGATCCAACGATCGGAAACGA	1
ACTAGATCCCATCCTTCGTCCTAT	1
ACTAGATGAAACCCGGTGCGTTGC	1
ACTAGATGAAAGTGTGCTAAAGAA	1
ACTAGATGACTGAATGGAATAGTT	2
ACTAGATGAGAAAACCTACACAAG	1
ACTAGATGAGTGCATCGTAACAGG	1
ACTAGATGATGTGTCAATTTTTAG	1
ACTAGATGGAGGGCATATATAGGG	1
ACTAGATGGCATGCACGAAATGAG	2
ACTAGATGGCTAGACTAGATGGAA	1
ACTAGATGGTGTCGACCTATCTCC	1
ACTAGATGTGTAGTTACGTCCGAT	1
ACTAGATGTTTCTATTATGGCAGT	1
ACTAGCAAAATGCCTGTGAGTTGC	1
ACTAGCAAAGGGCACTACATTAGT	1
ACTAGCAGCGGCTTATTGGTGGAC	1
ACTAGCATAGTCAGGATGTTC	1
ACTAGCATCCGACAAAGATGTCCC	1
ACTAGCATCTTACAACAGTTAGA	1
ACTAGCATGCGACCGGTATGTGAC	1
ACTAGCCACATTCTACAACAC	1
ACTAGCCAGAACAAAAGGGGATGC	1
ACTAGCCAGATGGATGTGCCAGTG	1
ACTAGCCCCAATGTTTGTTTGCCC	1
ACTAGCCCGAAGCTGTCCTGATGG	1
ACTAGCCCTACTAGCCGGTCAGAC	1
ACTAGCCGGCCTGGGTTCGAAACC	1
ACTAGCCGGGACTAAAGATTGATG	3
ACTAGCCGGGTTTGCCTCCTACTC	1
ACTAGCCGGTGTGCTAACAAACAT	1
ACTAGCCTAAGAAATTGTGGCGCG	1
ACTAGCCTAGCTGGTTGTTGTGCA	1
ACTAGCCTATTAGGTTTTCTATGG	1
ACTAGCGCGAGGTGCCACCCACGG	1
ACTAGCGGTCCTTAAACTTGTAA	1
ACTAGCGTGGTGACTTGTATAGAT	2
ACTAGCTAGTTATTACACGATTGA	1
ACTAGCTATTGATTTGTCCTTCCA	1
ACTAGCTGAATGCCCATGTGTTGT	1
ACTAGCTGATGGACTGCCGCTACC	4
ACTAGCTGGCCTAGCGACGATGG	1
ACTAGGAAAAGGCTAGCACCGGAC	1
ACTAGGAAATGTGTCTCATCCTT	1
ACTAGGATCTATGGCCTATGCC	1
ACTAGGATGGATGTCTACCCGTTT	1
ACTAGGATGTGAGTACGGGGTTGG	1
ACTAGGATGTGTCACATATACAGT	1
ACTAGGATGTGTCACATTCACTCA	2
ACTAGGATTCTAGATAAAGGTGTG	1
ACTAGGATTGGTACGTTATGGCAA	1
ACTAGGCAGGTGAAAAATGTCTCC	1
ACTAGGCCCGTCAAAGATGACTCA	1
ACTAGGCCTAGTTAGTAGTTGG	1
ACTAGGCTCAGGGAAATAGTGTGA	1
ACTAGGCTCCATCGGAATGGGCGA	1
ACTAGGCTGTCTAGTGATGATGTC	1
ACTAGGCTTCAAACGGGCTGGGTG	1
ACTAGGGCTATAGTTGGGGAATGG	2
ACTAGGGCTGTCGTGGAGGTGCTG	1
ACTAGGGTGAGACTAATCACGGTA	1
ACTAGGTAAGGTGCTGACTCGGTA	1
ACTAGGTATCAAGATGGAGTGCAC	1
ACTAGGTATGTAGTAAGGGTGGGA	1
ACTAGGTCCCTGTTGGAGCAAAGG	1
ACTAGGTGAAACATTTTTGGTGGA	1
ACTAGGTGAAACCCCGTGCGTTGC	1
ACTAGGTGAAACCCTACGTGGTAC	1
ACTAGGTGAAACTATAGTTGGTCC	5
ACTAGGTGATATCTGCGCGTTGC	1
ACTAGGTGATTGATCTGTTGGAGC	1
ACTAGGTGGTGTCTAATCGAGTAC	1
ACTAGGTGTAACATTTTTGGTGGA	1
ACTAGGTGTTAATTATACGTAAGC	1
ACTAGGTTGTTTTTTTATGGGAC	1
ACTAGGTTTGTTTATTTTGAGACG	1
ACTAGGTTTGTTTATTTTGGGA	1
ACTAGGTTTGTTTATTTTGGGAC	3
ACTAGGTTTGTTTATTTTGGGACG	4
ACTAGGTTTTGGACACTGGCGCAA	1
ACTAGTAAGGTGGTACTAAACATG	6
ACTAGTACAAAAGTGGGTAGGTGG	1
ACTAGTACATGAGAGAAGGTCCTG	1
ACTAGTACTACTGTGGTGGCGCTC	1
ACTAGTAGTACTAGGATGTGTCA	1
ACTAGTATACGGTGCACATAG	1
ACTAGTATGTGAGAGAAGGTCCTG	1
ACTAGTATTGAAGCCTCGAAGCAA	2
ACTAGTCAAGAGGTGTGGAACTAA	1
ACTAGTCCAATAGAGGAAGGGTGG	2
ACTAGTCCAATAGGGAAAGGGTGT	1
ACTAGTCCGATAGAGGAAGGGTGG	2
ACTAGTCGAGGATAGATGATGAAC	1
ACTAGTCTAGTGGTTGCAGTGATC	1
ACTAGTCTATAGATGTGGGACCCA	2
ACTAGTCTGATGGGTAAGGACTGC	2
ACTAGTCTTTTAGGGTGATTGGGCC	1
ACTAGTCTTTTGAGTTGTGTAGGC	1
ACTAGTGAAGGTGTGCTAATCAAT	1
ACTAGTGAATTGGGTGCCATTATC	1
ACTAGTGACTGTAATGATGATGAC	2
ACTAGTGAGTGGTCCGATAGAGCC	1
ACTAGTGATGCCATCACCACCCT	1
ACTAGTGCAGGTGAAGACAAACAT	1
ACTAGTGCGGTTGGAAGTGGCCA	1
ACTAGTGCTGATGTGTCATCTAGG	1
ACTAGTGGCGTCTGCAAAAAATCGA	1
ACTAGTGTAGTTCAGGTGGTTTGG	1
ACTAGTGTCTAATATCTATTTTGC	2
ACTAGTGTGAAGACTACCCCACGA	2
ACTAGTGTGATTATGGTGAATAAG	1
ACTAGTGTGGAGATTATGGATACC	1
ACTAGTGTTGGTGGCCGTGAACGA	1
ACTAGTTAACTTAGCCAGGGTGTC	1
ACTAGTTACCTATGACGGGTTGCA	1
ACTAGTTACTGGTACGTGCATTTT	1
ACTAGTTAGGTCACTTGTGATGGA	1
ACTAGTTAGGTTCCTTGTGGTGGA	1
ACTAGTTATACAGATTGCGACTAC	1
ACTAGTTCAACATCTCTGACCCGA	1
ACTAGTTGACCGCGTAAAACTGGA	1
ACTAGTTGGTAGCCAATTTCTGAG	1
ACTAGTTGGTGATGATGTGGCACA	2
ACTAGTTGGTGTTTAGATGTATGT	1
ACTAGTTGTAATAGGTGGTAAGG	1
ACTAGTTTCTTGATGATGTGGAGT	1
ACTAGTTTTGTCTTTCGGAGATGC	2
ACTAGTTTTTTGGGTTGTGTAGGC	1
ACTATAAAATATCACATCCGGTACT	1
ACTATAAACTTATATGGAGAAGAG	1
ACTATAAACTTCTAAAGGTGCAAG	1
ACTATAAATAGGATCTGCCAGCGA	1
ACTATAAATGATAAACTAAAGGTC	1
ACTATAACAGGTAAACAGGCATGC	1
ACTATAAGCTTAGGTAGAGGTGAC	1
ACTATAAGTGCCGGTTTTAGCTA	1
ACTATACAACCGGGACTAAATACG	2
ACTATACAGAGGTGCCATATTGCC	1
ACTATACAGGCTATCGAGATGCCA	1
ACTATACATCACAATCACTCTG	1
ACTATACGGTTTGTCACGGTTACC	1
ACTATACTACTAATATATGGTCC	1
ACTATACTATGAAGTGTCTCATCC	1
ACTATACTATTAATATATGGTCTC	1
ACTATACTATTAATATCTGGTCCC	1
ACTATACTTGCCATGTGAGGCTGC	1
ACTATAGATCTGCATAGATATGTA	1
ACTATAGATTGATACGCCGCCTATC	1
ACTATAGATTTAGGGCCTGTTCGG	1
ACTATAGCATATGGCGCCATATTT	1
ACTATAGCTGGCTACAAATCTGTA	1
ACTATAGGGGGTTACGAACCGGG	1
ACTATAGGGTAGATCCATGATGG	1
ACTATAGGTGTCGGTTCTTCTTGA	1
ACTATAGGTGTTGGAATAGCTACA	2
ACTATAGTGTAACTACAATGTAAC	1
ACTATAGTTGCCGGTTTTACCTAC	1
ACTATATAATCGATAGTAACTGGC	1
ACTATATACATTGGTGATGACCTA	1
ACTATATCATTCCTACTCAACCA	2
ACTATATCCGTTTCAGGTTATAAG	1
ACTATATCTGGGGTGAGGTTACAA	1
ACTATATCTGTGTAGCCATATATG	1
ACTATATGATTGGTGTCCACTAGC	1
ACTATATTAAAGGTGTTGGGGT	1
ACTATATTTTAGGACGGAAGGTAG	2
ACTATATTTTAGGACGGAGGTAGT	3
ACTATATTTTAGGATGGAGGACGC	1
ACTATCAAAACCGGTGAAGATGAG	1
ACTATCAAAACCGGTGCAAATGAG	1
ACTATCAAAACCGGTGCAGATAAG	1
ACTATCAAAACCGGTGCATATTAG	1
ACTATCAAAAGTAGATGGGTGG	1
ACTATCAAGTGCAAATCAAATGTG	1
ACTATCACGAGTAATTCGATCGTA	1
ACTATCAGATCTGATACGGGTACC	1
ACTATCAGGCAAAGCCATGGTAA	1
ACTATCATAGGACCTTGTGTGCAC	1
ACTATCATGGTCGACCGAATTACA	2
ACTATCCATAGGCAAGGAATGCA	2
ACTATCCTGATCTACCACTGC	1
ACTATCGCGGTCGATTGAATTACA	1
ACTATCGGGAACGAGAACGGTGCG	1
ACTATCTAGTGGTGAGTTGGTCCT	1
ACTATCTCCAGGTTAGTAGATAGC	2
ACTATGAAAACCGGTGCAATTTGA	1
ACTATGAAAGGACACACCAGAACA	1
ACTATGAAATGTCTTGTCCGGTCC	1
ACTATGAAGATGTCAACATATATG	1
ACTATGAATCTGGATATACCTATG	1
ACTATGAATCTGGTCCAAGTGCA	1
ACTATGACAGGTATGAACGGTGAG	2
ACTATGACCCGAATATAATTCACG	1
ACTATGAGAGCCCCCACGAAGATA	1
ACTATGAGGTATTGGTACCTTGAG	1
ACTATGAGGTGCCGATATCTCGAG	1
ACTATGAGGTGTAATGAGGTA	1
ACTATGAGGTGTAATGAGGTACCA	1
ACTATGATGGGTCCACAAGTATAG	1
ACTATGCCAAAATTTAGTAAGGT	1
ACTATGCCACTACAACTCTTTGAA	1
ACTATGCCTGAGCGGGGCGAA	1
ACTATGCGTGTGGGCCACATCATG	1
ACTATGCTTTTACGGTCTGGGTGG	1
ACTATGGATGCATACTGTGGTACT	1
ACTATGGCTGATATATGGTGTCA	1
ACTATGGGCTTAATGATGATGCTG	2
ACTATGGTACCGGATGTCTGATT	1
ACTATGGTATGACTAAAGTGTGG	1
ACTATGTAGTGTCTAATCGTTGTC	1
ACTATGTATATAATGGATGGTGTC	1
ACTATGTATCAGCATCTAGGGTGT	3
ACTATGTGAAAGTTGCTTTAA	1
ACTATGTGAATGACAGGTGGGACC	3
ACTATGTGAGTGGCCCTTGTACGG	1
ACTATGTGCCGGTACCTATGTGTC	1
ACTATGTGCCTAATCAATATAGA	2
ACTATGTGCTGCCACATGGTAGGA	1
ACTATGTGTATAACAGGTGGGACC	3
ACTATGTGTATGAGAGGTGAGATC	1
ACTATGTGTCACATCCACAAGTAC	2
ACTATGTTGCTATATTATGGGA	1
ACTATGTTTCTGCATTTTGGTGAA	1
ACTATTAAAACCGGTGCAATTTGA	1
ACTATTAAAACCGGTGCAGATTAG	1
ACTATTAAAATCGGTGCAAAATGA	3
ACTATTAAGGTGGTTTACTATTAA	2
ACTATTAATACATGGTCACACCTA	2
ACTATTAGACCTCACATAAAGACC	1
ACTATTAGGTATATGGTATTGCCG	5
ACTATTATATGCATGGTCCCACA	1
ACTATTCAAATAGTTGTGCCCGC	1
ACTATTCATCTGAATGGGCCTTGC	1
ACTATTCATGATATCGGCTACGTA	1
ACTATTCCACCCAAGAGGTGCTAA	1
ACTATTCGAATAGCCGTGCCCG	2
ACTATTCGCTTTTACGTGTTGCCA	1
ACTATTGAACTGGTGGATCATGAG	1
ACTATTGACAAGTACTACAAGCCT	3
ACTATTGAGGTGATTTACTATTAAT	1
ACTATTGAGGTGGTTTACTATTAA	7
ACTATTGAGGTGGTTTACTATTAAT	1
ACTATTGCGGGTGCTATAAATGTA	1
ACTATTGCGGGTGCTCTTACTACA	1
ACTATTGGTAGTTGATGTGTTGGC	3
ACTATTGGTGCTGGTTTTTGTTAT	1
ACTATTGTGAAAATAGGCCGACCG	1
ACTATTGTGAAATCTGATGGACCA	1
ACTATTGTGAGTTGATGTCGTTGA	1
ACTATTGTGCCAATCCGATTTACC	3
ACTATTGTGGAAATCGGCCGA	1
ACTATTGTGGAAATCGGCCGACCG	2
ACTATTGTGGGTGCACTAAGAGT	1
ACTATTTAGGTGACATGCAAGAAA	1
ACTATTTAGGTGGTATGCACGAAA	1
ACTATTTAGGTTGTTATTTGAGGT	1
ACTATTTGGGTGACACGCAAACA	1
ACTATTTGGGTGATATGCAAACAA	1
ACTATTTGGTTAGTCCGAG	1
ACTATTTGTATAAAAAGAGGTGTC	1
ACTATTTTATATAGGTGTTTTAGC	2
ACTATTTTCGGGCTCACATGTTAG	1
ACTATTTTGGTTCTTTTTGGTTGC	1
ACTATTTTTTGAGAGTGGCCGAAG	1
ACTATTTTTTGGTGAAAAATATGG	1
ACTCAAAAACCCTTATATTATGAG	4
ACTCAAAAAGTAATTATAGGTTGC	1
ACTCAAAAGTGTGACTGTAATGTT	1
ACTCAAAATGACTACAAACAG	1
ACTCAAACACGGATGACGGACCGC	1
ACTCAAACGGACAAAATATGTGAC	1
ACTCAAATGGACCTAATATGTGAC	1
ACTCAAATGTGAAATAGGTGTAAC	2
ACTCAAATTTGGGTCGCACTCTGC	1
ACTCAACAGTTGTTGGAAACGGTG	1
ACTCAACATTGAGCAGGGATAAG	1
ACTCAACCGGAGCCACAACTTGAA	1
ACTCAACCTAAAAGAAGATGTGAC	1
ACTCAACCTAAGAGGTGATGTGAC	1
ACTCAACCTACGAGAAGATGTGAC	4
ACTCAACCTACGAGTTGGATGGTA	3
ACTCAACCTACTAGGAGATGTGAC	2
ACTCAACCTAGAAGAAGATGTGAC	1
ACTCAACCTAGAAGGGACGTGACC	4
ACTCAACCTAGAAGTGGATGTGAC	1
ACTCAACCTAGGAGGGAATGTGAC	2
ACTCAACCTAGGAGGGGATGTGA	1
ACTCAACCTAGGAGGGGATGTGAC	1
ACTCAACCTAGGATGAGATGTGA	1
ACTCAACTTAGGTGGGGATGTGAC	1
ACTCAACTTAGTAGGGGTGGGGAC	2
ACTCAAGATTGAAAGTGTGCATGC	1
ACTCAAGCGTGAAGACGGTTCAGT	1
ACTCAATAAAAGTGAAGAAATCGT	1
ACTCAATAAGAGCGAAATGGCCTA	1
ACTCAATAGGCTCCTTAAACTCGC	2
ACTCAATCCGCGGTGGTTTTGGTC	1
ACTCAATGATCGGTGCCTTGTTGC	1
ACTCAATTCGATGGGCACGAGTGT	2
ACTCAATTGGTGATGATGAACAAC	3
ACTCAATTTAGGTGACTGGGGGCA	1
ACTCACACGGGTGGATTGGTTCC	1
ACTCACACTTACGTTGTCGCTTCG	1
ACTCACCAAGTGTGGTACCTGC	1
ACTCACGAGGTATCATACGATACA	1
ACTCACGGGTTGTTTAGATGGTA	1
ACTCACTCCGTCCCACAATATAG	1
ACTCACTTATCAGGCTACACTTA	1
ACTCAGAACTTTAGGTACTACTCC	1
ACTCAGACCCATCACGGATGACATC	1
ACTCAGATAGTACTAGGTGTCACA	1
ACTCAGATTTTACACCACGTATGC	1
ACTCAGCCTAAGTTTGCCTTCGCG	1
ACTCAGCCTACTGCTGCGGTTGCC	1
ACTCAGCTAGTCAACGGAGGGTCC	3
ACTCAGCTCGCAATGGTGGACACC	2
ACTCAGGACCTTTGGGTACTCAGG	2
ACTCAGGAGCTTGCCAATATGAGG	1
ACTCAGGTACTGCCAAAACTCTGA	1
ACTCAGTGTGTATGATAGATGGGA	1
ACTCAGTTATTGGGTAGGTGTGTG	2
ACTCATACCTATAAACACACGCGC	1
ACTCATAGGGGTAGGTTTTACGTG	1
ACTCATATGGGGTGCTTGCACTGTG	1
ACTCATCTCATACATGGTTGCCTA	1
ACTCATCTGGTGGCTTCGGTTCGA	1
ACTCATCTGTATCGGTGTCGGTTC	1
ACTCATCTTAGAAAAGAACGTGAC	1
ACTCATGAAGGTAGGGTGTGTGCG	2
ACTCATGAGTAAATCTACGAGTGA	1
ACTCATGCCAAGAGAGGAGGGGAA	2
ACTCATGCCATCGTTACCCAACGG	1
ACTCATGGATGCCGTACCTATTAA	1
ACTCATGGGCCTAGTACTATACAC	2
ACTCATGGTGAAGTGGACGAATC	1
ACTCATGTGGAGTTCGAGGTCGAC	1
ACTCATGTTGATAGATTCAGGGAGC	1
ACTCATTGGTTGTATGTTTGCATT	1
ACTCCAAATTAGTGTCCAAATATC	1
ACTCCAACAGAGTGGCTAAATGGC	1
ACTCCAAGACGCAGTGTGTGTGAC	1
ACTCCAAGAGATAGTGGGTGTATG	1
ACTCCAATTAACTGGAAGGAGCCG	2
ACTCCACCTCCGACAGTAAGAGAA	1
ACTCCACCTTTCATAGAGCTCAGC	1
ACTCCACGATAGGTGCTGGTGGTC	1
ACTCCACGGGTGCCCTTCGATGGG	1
ACTCCACTCCCAGTTTTGGTGGA	1
ACTCCACTGTTTAGCCGTTTGAAA	2
ACTCCAGACTGGTCTAGATGGGCA	1
ACTCCAGCGTCGCCAGCCTGGCCC	1
ACTCCAGGAGTTGAGTCTGAAGTG	1
ACTCCATACAGAGAAACAGGAATG	1
ACTCCATTTGATGTGACAGGAAAG	1
ACTCCATTTGTGGACTGAGCCAAA	2
ACTCCCACAGCGGATCTGGTGTCA	2
ACTCCCACAGGCAGCTCAACTGGGA	1
ACTCCCAGTTTTGGTGGAGCTGAA	1
ACTCCCCATCCTACCCCCACCAAG	1
ACTCCCCGCAAGCCCATCCATGGA	1
ACTCCCGGGTGAGATGCTACAATG	3
ACTCCCTAGAAACGCTCTTAAGCC	1
ACTCCCTATGCCTGACGCCGTCGC	1
ACTCCCTATGTGTCTAAATATT	1
ACTCCCTCGGCATGGTGGGCCAGC	1
ACTCCCTCGGTTCAAACCTAGACA	1
ACTCCCTTGTGTGGGATAGGAAGC	1
ACTCCGACGGCTGTCCAACGGTGG	1
ACTCCGATAATGGTGCGAGTGAGG	1
ACTCCGCCAGTGAATTGAGTGCCA	1
ACTCCGGGGGTATGATCCAGTGGC	1
ACTCCGGGTCAGGGACAATGGGCG	1
ACTCCGGTATAGGGCCTGTTTGAA	1
ACTCCGGTCTAACCGCTGGGTTGC	1
ACTCCGTGTGGATGACAAATGGGC	1
ACTCCGTTCTGTGGAGGTGTGTCA	1
ACTCCTAAACGGAATACCGGGTAC	1
ACTCCTACCTACTTTCTTAATAAC	1
ACTCCTCCTATATCCGCAGGTTGT	2
ACTCCTGCAGGCGCTTGATCTGGT	1
ACTCCTGTCCGGGGATGATTCCGC	2
ACTCCTGTCCGGGGATTGATCCGC	1
ACTCCTGTCTGGGGATTGATCCGC	1
ACTCCTGTGCTACCTGGTCGAAAC	1
ACTCCTGTTGGTCGAAGCCGGTGT	1
ACTCCTTTATGCAAACATAGCGGC	1
ACTCGAATAAAGGTGGGTGGTAGA	1
ACTCGAATCGTATCCATACATGGT	1
ACTCGACCGTAGGTGGGGATGTGT	1
ACTCGAGCTTTAGGCGGCGCGGTC	2
ACTCGAGGCTAGCCTTGGACCTGC	1
ACTCGAGGGACCTAAAATAGACTT	1
ACTCGAGGGGTAGAGATTTTTGGT	1
ACTCGAGGGTGTATATAGGATGAC	1
ACTCGAGGTCCTAGATAAGATGGT	2
ACTCGAGTGATATAGGGTGGAAGC	1
ACTCGAGTGCTCAAAGTATGGAGT	2
ACTCGAGTGGACGTCTACCCGTTT	1
ACTCGATAGTGCAGTAATATGGG	1
ACTCGATATTGATAGGTACGCCGT	1
ACTCGATCTGCGCGAGATCTTTGA	1
ACTCGATGAACCCCTACATGGCGC	1
ACTCGATGTCTATGATATGTGGTC	2
ACTCGATGTGATAAGATGGGAGG	2
ACTCGCACCGGGTGCACGAATATC	1
ACTCGCACGATCAATGGTGTAGTC	1
ACTCGCCAAAATACAAGACGA	1
ACTCGCCACATTAGTCAAAGCCGG	1
ACTCGCGAGGTTGGTGGTGGAGGA	1
ACTCGCTGTCTATAACATCTGAGC	1
ACTCGCTGTCTATAATATGTGGGT	3
ACTCGCTGTCTATGATATGTGGGC	1
ACTCGGCCGCCTGGAGAGGATGAG	1
ACTCGGGCTATAGATAGTTGGAGG	1
ACTCGGGTCGTGCCGGGCCGGTCC	1
ACTCGGTAGAACAATGGTGGAACC	1
ACTCGGTGAGTCCTATATTCCAAG	1
ACTCGGTTGAGCAATGGTGGACT	1
ACTCGTAATGTTGGTGTCGGTGGT	1
ACTCGTACAATTAGCATGTACTGC	1
ACTCGTCCGGGTAGCGCTGGTGAA	1
ACTCGTGGCTACCGATTCTAAGAG	1
ACTCGTGGTGACTTCGTTAATCTC	1
ACTCGTGGTGGGTCATCCGATTGC	1
ACTCGTGTATCAAGTGTTGGA	1
ACTCGTGTGCCACGTAGGACAAAA	1
ACTCGTGTGTGTTGTGTTGCC	1
ACTCGTTAGGCTATTAGGGGTA	1
ACTCGTTAGGTGGGTGCAATTTAA	1
ACTCTAAATGAATTGTGGATAC	1
ACTCTACCATAGTTGATACGGTGA	1
ACTCTACCGGTATACGTGTGCACA	1
ACTCTACGTGAAAATTGATGACAC	1
ACTCTACTACAGAGGTGTTTGGGA	2
ACTCTACTTTAGACCAAGTTTAGG	1
ACTCTAGAAGCGGTAGAGTGCCAA	1
ACTCTAGGGTTACCCACGGAAGAG	1
ACTCTAGGTGCTAAATTTGGGTGT	1
ACTCTAGTAGAGATGGAGCTGTGC	1
ACTCTATAGAGTGGTGAGTTAGAC	5
ACTCTATATAGAGTGTTGTCT	1
ACTCTATGGGTCGTGCCATATAAT	1
ACTCTCCCTGCCCGATGTCTGTTT	1
ACTCTCCGTTGAGGTGCTCCACAG	1
ACTCTCGAAACCGGTGCAATTTAA	1
ACTCTCTGAGCCGTCACAGGTGAG	1
ACTCTCTGTCCTAAATGTGCTT	1
ACTCTCTTGACGGTTTGCTGACGT	2
ACTCTGATAATGGTGGGAGCACGA	3
ACTCTGATTTAGGTGATCTTGGAC	1
ACTCTGCAGGATGTGTCTTATTTG	1
ACTCTGCCTCTAGCACCGGTGAGC	2
ACTCTGCGGGAAGTCGCTGTCGTA	2
ACTCTGCGTGTTCAGCGTACCAGA	1
ACTCTGCTTTTGGGGTCTCTGGAA	1
ACTCTGGAATGTTGATTGGAAAGG	1
ACTCTGGTACAGTCTCCGAGATGC	1
ACTCTGTCGATGCTACTACACCAC	2
ACTCTGTGAGAGAGACAAGCGGGC	1
ACTCTTAAATTTAGTTTCAGGAGT	1
ACTCTTAATATGATCTATGGTCAC	1
ACTCTTACAGATGTTGCTTAACGA	1
ACTCTTAGAAGAAAAAGAGGTGAC	1
ACTCTTAGAGTGATTTCGGGTAGG	1
ACTCTTAGCTAGAACAAGTGTGAC	2
ACTCTTATGAGGACCTCCGAAAGA	1
ACTCTTCCAATGCAAACACTAC	1
ACTCTTCGAAGCTTTTAGGGTTGT	1
ACTCTTGCCCCTACACTTTATCGA	1
ACTCTTGTAAGCCGTACGGGAAGG	1
ACTCTTTACCTACATATCACTCT	1
ACTCTTTTGAGTAAAGGCCGGGA	1
ACTGAAAAGTCAACGGTGTCAAAC	1
ACTGAAAAGTTACGTGTGTATGA	2
ACTGAAAAGTTATGTGTGTATGAC	3
ACTGAAAAGTTGGGTGTGTATGA	2
ACTGAAAAGTTGTGTGCGTATGAC	1
ACTGAAAAGTTGTGTGTGTATGAC	2
ACTGAAACATGCCACTAATGTTGC	1
ACTGAAACATGTCGCTAAAGTTGC	1
ACTGAAACCACATGCTTTTGATGG	2
ACTGAAACTGTGTGCCTGGAATCC	1
ACTGAAACTTAGCATGTGCCAGCC	2
ACTGAAAGACCTCGGATGACCGGT	1
ACTGAAAGATCGGGCCAACAACAGC	1
ACTGAAAGATGGTTGGGGATG	1
ACTGAAAGCAGAGGTAGAGGATGC	1
ACTGAAAGCCTACTTGGCTGTTGT	1
ACTGAAAGGGAGAATCCAGGCAGC	1
ACTGAAAGGTGGGCTTAGTGATAG	1
ACTGAAATACGCCGTACTTTGCAC	1
ACTGAAATGGAATAGCAGCAGTGC	1
ACTGAAATTTGGAAGTTGGTTGA	1
ACTGAACAAGTTGGAGGACCTAAA	2
ACTGAACCTAGGATAGGGTGTGGC	1
ACTGAACGCATGTGTCTATGCA	1
ACTGAACTGTTTGGGGAGCTTCTG	1
ACTGAACTTGTGGTGAGCTACCAG	2
ACTGAAGAGTTTTGGGCCACTAGG	1
ACTGAAGATAACCTATTGAGTGAC	1
ACTGAAGATTTTAGAAGAAGCTGC	1
ACTGAAGCCACTGGGATGGAGGA	1
ACTGAAGCCTACTAACCTGAC	2
ACTGAAGCTAGCCCGTAGAAGAA	1
ACTGAAGCTAGGAGGCTGATGCTG	2
ACTGAAGGCTGCGCAGGAGCTGTA	1
ACTGAAGTGAAACCTACGTGACCA	1
ACTGAAGTTTAAAAGCTTGGTTGA	1
ACTGAATAGTACAGGTGTCACTCT	1
ACTGAATATGATTTAACTTATGGC	1
ACTGAATATTTCTTGCCACAGTGT	2
ACTGAATGCTGAGATGGATGAGAG	1
ACTGAATGGTGGATGGTTGTGATT	1
ACTGAATTGCAAAATAAGATGGA	1
ACTGACAAAATCGTGGTGTTCCTA	1
ACTGACAAAGGCTTGCATGGATGA	1
ACTGACAATGCCGGTCCACGGGGA	1
ACTGACACACGGGGGCCGGTCGGA	1
ACTGACATCGATTGATAGAGACAC	1
ACTGACATGACGTGATAAATGGAA	1
ACTGACCACGAATAAGTACACCGG	1
ACTGACCAGCGGTATAAAAGGGAC	1
ACTGACCGCCTGTCAAGTGGCATG	1
ACTGACCGGATTGTTGTGCCATGC	1
ACTGACCTGTGCAAAGAATGA	1
ACTGACGGGGTGTATATATATATA	1
ACTGACGGTCAAATTCAGTGT	2
ACTGACGTGACGGTGTTATTTGG	1
ACTGACGTGCAAACATATTTACAG	2
ACTGACGTGTAAGATAATAGTAGG	1
ACTGACGTGTAAGCCTAATAAATC	1
ACTGACTAGTTATGATGTTCCTCC	2
ACTGACTCAGCTGTCACGTAGGAT	1
ACTGACTGGTACGCCCGCATCTCA	1
ACTGACTTGGGACCTAAATTAGAC	1
ACTGACTTTAAGGTGTATGTGTGT	1
ACTGACTTTAAGGTGTATGTGTGTA	1
ACTGAGATCGATCTGATCAGATG	1
ACTGAGATCGATCTGATCAGATGC	1
ACTGAGATGTAAAGTAAGGGCAGA	1
ACTGAGCCCGTCACAGATGAGTGT	3
ACTGAGCTACTTAGTCAGGTGTGG	1
ACTGAGCTGCCTAACCCGTGGAAC	1
ACTGAGGAAAATGATGACATGGCA	1
ACTGAGGAGGTGCACATATAGTAA	1
ACTGAGGCTGAAGGCCAGGTGAAC	1
ACTGAGGGACCTAGTTTGCCCTGG	1
ACTGAGGTACCTCATCTACGACGG	1
ACTGAGGTTTGATGATTATTGCA	1
ACTGAGTATTGGTGACGTTAAATT	2
ACTGAGTGAAAATAAGGGCAGCCG	1
ACTGAGTGTCTTAGTATAATAAAA	1
ACTGAGTGTTGTTTTGCCTGGCAT	1
ACTGATAAATAATTAGGTCGTGCC	6
ACTGATAACAATCCGGCAGGCCTA	1
ACTGATAATCGGGTCCACATGTCA	2
ACTGATACATATTATACAGGTGCA	1
ACTGATACGTGAATTATACCGACA	1
ACTGATAGATGATATTAACAGCGGGAC	2
ACTGATAGGGTGGACTCCATTAAG	2
ACTGATAGGTGGGCATACGAGCAG	2
ACTGATAGGTGTCATCCGTGACGG	1
ACTGATAGGTGTCATCCGTGATG	1
ACTGATAGGTGTTATTCGTGAC	1
ACTGATAGTGCTAATACAACTGGT	1
ACTGATATCTGATATCTGTTGTGGT	1
ACTGATATGTGGACCTAGGGACAA	1
ACTGATATGTTCACAAAAGCCGGT	1
ACTGATCCAGGGCTTGATACAAT	3
ACTGATCCTACAAAGAAACTTAGT	1
ACTGATCTAACGGCGAAACTGTTC	1
ACTGATCTGAAAGTGGTGGCA	1
ACTGATCTTTTATCGTGGTACCTA	3
ACTGATGACCGTGCCGCGATAGTA	2
ACTGATGAGAATTTAGCAGGTGAG	1
ACTGATGAGGAGGACTAAAAATGC	1
ACTGATGCAAGGGTGCGCTATATA	1
ACTGATGCAATATAGGTCCATGGA	2
ACTGATGCGGGTGATTAAGTTTGC	1
ACTGATGCGTCGAACCTAGCAATA	2
ACTGATGTCCATGAAGCCTGA	1
ACTGATGTGGCATGCCATACGTGC	1
ACTGATGTGGCCTCATCAATACCT	1
ACTGATGTGTGCTACGTACTACTA	1
ACTGATGTGTTATGCTACGAGTG	1
ACTGATGTTGTACGGGATTGGTGG	1
ACTGATTAAATAGGGTATTGGGGT	1
ACTGATTAGGTTTCTTGTGGTGGA	1
ACTGATTATTTGGTGCACCGTCGT	1
ACTGATTGTTTGGTGCGTCGTCCA	1
ACTGATTTTCAGGGTGGTAGATGC	1
ACTGATTTTCAGGGTGGTGGATAC	1
ACTGCAAAAGGAGGCTGCATCTGC	1
ACTGCAACCACTAGGCTATATGCC	1
ACTGCAAGGTTAGGATATGGTGGA	1
ACTGCAAGTAAAACACGGTGTTAC	1
ACTGCAATAGCATAGGTGAC	2
ACTGCAATCTAGGATATGATGGGA	1
ACTGCACATGCAGTTGAGTCACTG	1
ACTGCACCAGATCTTGATCCGACA	1
ACTGCACCAGGGACAGAATTGGTA	1
ACTGCACCATATAAAAGGGATGGA	1
ACTGCAGAGGATCCTGATATGAGC	1
ACTGCAGGTGCAGTACAGCGGTGG	1
ACTGCATACGTACAACATGTTGCA	1
ACTGCATACTTGTACTAACGCGCA	1
ACTGCATATGATAACCGCGATAAC	2
ACTGCATATTGAGTTAGAGGGTTC	1
ACTGCATGATGGAAGCCTAAAAAT	2
ACTGCCAAGGGACCTCCGGTGAAC	1
ACTGCCAATGAAGTTCATTCGATG	3
ACTGCCAATGGATACTACAAAATT	1
ACTGCCACGGGTGCGTGCGTCCGA	1
ACTGCCACGTGTACGCCACGTAGA	1
ACTGCCAGAATAGAGCAATGGTAC	1
ACTGCCAGAATGAATACTTGTGGA	6
ACTGCCATAGGACCTTGAGTGCAC	2
ACTGCCATGGGACCTAATGTGACC	2
ACTGCCCCGCCTCGTCCTCCCCGC	1
ACTGCCCGCCACGGGGCCGGTGGT	1
ACTGCCCTGGTAGTTGATTTGCA	1
ACTGCCGAAGATGTACAAGACGTA	1
ACTGCCGAGCTTGATTTTTAAGTA	2
ACTGCCGAGGGACCTCCGGTGAA	1
ACTGCCGAGGTTGCCCAGCTAGCC	1
ACTGCCGGTTGATGACCTCCATAG	1
ACTGCCGTGAAATGAGAATTGAGA	1
ACTGCCTAAGGATGGATGTATGTA	2
ACTGCCTAGCAAGGTTGATGTTGT	3
ACTGCCTATGTGGTCTTGTTTGTA	1
ACTGCCTCAAACTCCAGTGGAGGG	1
ACTGCCTCAGCGTGTTACCGATAC	1
ACTGCCTGGGGAGATGGTAAACGC	1
ACTGCCTGTAACATCTACCATGA	1
ACTGCCTTAATCACTCACAGCCGA	1
ACTGCCTTATAGATAAGTGGTCGC	1
ACTGCCTTTACGTGTTGAGCTGGG	3
ACTGCGAAAGTGAAAAGGAGGCCC	2
ACTGCGAGATGAATTTATTAAGCC	1
ACTGCGCGCTAATTACAAGTCAGG	1
ACTGCGGGCGGGGTGTATAAGAGT	1
ACTGCGTCGACGAGCTATCATCCG	1
ACTGCGTCTTGGAATCTGTGCTGC	1
ACTGCGTCTTTATAGATGGAA	1
ACTGCTAAAATAAGAGAAGATGCA	1
ACTGCTAAACATGTTACGATACCA	1
ACTGCTAAACGGTAAGTTATGTGA	1
ACTGCTAAACGGTGCAATTCGTGC	2
ACTGCTAAACGGTGCGGTTTTTGC	2
ACTGCTAAATGGTGCGTTTTTTG	1
ACTGCTAAATGGTGCGTTTTTTTG	1
ACTGCTAATAGGGTGTCTAAAAAC	1
ACTGCTAGACTTACAACAACACCA	1
ACTGCTAGCCAACAGGGAAATCCC	1
ACTGCTAGGATGATGGACATGCTC	1
ACTGCTATAGGACGTTGAGTGCAC	1
ACTGCTATATATACGGTCTCTTGA	1
ACTGCTCCATGCATGTGCCCAAAG	1
ACTGCTCGATTGAGATGATGGTAT	2
ACTGCTCTAAGCTGATTGGTGTAC	1
ACTGCTGAAGGGCGCCCATGGTTC	1
ACTGCTGAAGGTGGTGCTAATCAA	1
ACTGCTGCCGGCGCCTACACACATC	2
ACTGCTGCTTCTAGTGTTGGTGGG	5
ACTGCTGCTTGCTGATTGGGTGCT	1
ACTGCTGGTGCTGCTGTTCGGCG	1
ACTGCTGTAGGCACGGAAGGGTAC	1
ACTGCTGTGTCGGTGCCATGAACC	1
ACTGCTGTTGATTTGTGTGGGGGA	1
ACTGCTTATGGACATTATGGGTTA	1
ACTGCTTGAGATTGGTAATGT	1
ACTGCTTGCTAGTGGGTGGCTGAC	1
ACTGCTTGTGGGTTGTGCCATGGG	1
ACTGCTTTAACAGATGTGCTTAAG	9
ACTGCTTTGGGATTTGTACGGGAC	1
ACTGCTTTTAGTATAGGTGCGCAT	1
ACTGCTTTTCGTACGAAGGTTGGT	1
ACTGGAAAGGTTACCGCGCGTGGT	1
ACTGGAACCATCCCATCCCACAAA	1
ACTGGAAGTTTGTGTGTGTAAGA	1
ACTGGACAGAATGATTAGGGGCAC	1
ACTGGACCGGCCGCCGCTAAACGT	1
ACTGGACCTTGAGCGGTGCTTTGT	1
ACTGGACGTTACCTACACAACAT	2
ACTGGACTCAACTACAAAGGTGTG	1
ACTGGACTGCCATGCGTACGCC	1
ACTGGAGACTCAAACGTGATCAGC	1
ACTGGAGATGAAACTAAGGTGGCC	1
ACTGGAGATGCTCTAAGGTGTTC	1
ACTGGAGATTCTAGGAGAAGCTGC	1
ACTGGAGCACATGTATATTGTAGC	2
ACTGGAGCCCGTCCATATCGCTGC	1
ACTGGAGTCTTACCAAACACGTC	1
ACTGGATATTTGGGTCCACATGTC	1
ACTGGATGACCTGATTGAGGTGGA	1
ACTGGATGACTACGGTTCCGATGG	1
ACTGGATGGGATACCGATTGGTTC	1
ACTGGATGTCTAGATTCGTTGTAT	2
ACTGGCAAGTCTATGGGCGTTCTT	1
ACTGGCAATCCGACCTGGGTCC	1
ACTGGCAGACAGTGTGCAGACCAA	1
ACTGGCAGCCGATTTAACACAGCC	1
ACTGGCAGCGCTAAGATGATGGC	1
ACTGGCCCATAGCCTGATAGGTTC	2
ACTGGCCGTCTAGCCAATTGAGGA	1
ACTGGCCTGAGAGATCTGCTTAAC	1
ACTGGCCTGGAGATTTCCTTAGCT	1
ACTGGCCTTAAAAATATTAGCAAA	2
ACTGGCGAGAACACTGTGGCTGTC	1
ACTGGCGCTTGGGTCTCGCAACCC	1
ACTGGCGGCCACGCTAAGAGGTCC	1
ACTGGCGGTGTCACCACAAGCTGC	1
ACTGGCTACAAATCTGTACCCCGC	1
ACTGGCTAGGTTTCTTGTGGTGGA	1
ACTGGCTCAGGTCTTGGGTACTGC	1
ACTGGCTCCTGTTATGGGCACAGC	1
ACTGGCTTATGCCTAAAAAGGGAG	2
ACTGGCTTTTCCTGACGTGTGGGC	1
ACTGGGAAGTAAATGTCAGAGGA	1
ACTGGGACTATATGGGGCTTACCA	1
ACTGGGACTCTACCCTACCTTGGA	1
ACTGGGACTGACCTTCAGATGGAC	1
ACTGGGAGCCTTGTTTTGTATGG	2
ACTGGGAGGAAAGCGCCGATGGTC	1
ACTGGGAGTTATGATGACCTGGA	1
ACTGGGAGTTCCGGTTGGTGGTAC	2
ACTGGGAGTTCCGGTTGGTGGTACC	1
ACTGGGATGCCACGTGTATGCCACA	1
ACTGGGCATGGACGTTTGGAGGGA	1
ACTGGGCCAATATATCTTACGATTA	1
ACTGGGCCAGCATATATTGAGATT	1
ACTGGGCCGATGACAGAACGTCAGC	1
ACTGGGCCGGACTGGGCCGAGGGA	1
ACTGGGCCTAGTACATGCAATCTG	1
ACTGGGCTCGATCGACTGGGCCAA	1
ACTGGGCTGCCATGCGTATGCCA	1
ACTGGGCTTACTGCGGGGGTAC	1
ACTGGGCTTTGGGCTTACACCACC	1
ACTGGGGAAGATGAGACCTCGGGC	2
ACTGGGGACACTCACCTCTGG	2
ACTGGGGCCTCTTCGTCTCACGCC	1
ACTGGGGGCCTCGCAAATATGCA	1
ACTGGGGTATAAGCCAAACGTC	1
ACTGGGGTATAAGCCAGGACTCCA	1
ACTGGGTACCAAAACAAATCTAAC	1
ACTGGGTACCAACTGGTATTTGGT	2
ACTGGGTGCCGGTATGTGCTT	4
ACTGGGTGTACTAGAAGGAAACAAG	2
ACTGGGTTGTAGTAGTAACTA	3
ACTGGTAAATGTGCCACCACTCCC	1
ACTGGTAACCGCGGTTGCTGATGG	1
ACTGGTACACAATGGAATGGTCTG	1
ACTGGTACATGAGTAAGCAACAAT	1
ACTGGTACCAAGATAGTAAACATA	1
ACTGGTACCTTACTTTTTGTTGGA	1
ACTGGTACGCACTGTATGGATGTC	1
ACTGGTACTACATGGAGTATGGA	1
ACTGGTACTACATGGAGTATGGAC	1
ACTGGTAGAGTTGCTAATGTGAAG	1
ACTGGTAGCGTGGACAATCTGGAA	3
ACTGGTAGGTGATACCTATAAGGT	1
ACTGGTAGTCTATAAATAGCAGAA	1
ACTGGTCAACAGGGAGCCTCCAAT	1
ACTGGTCACCGATGTTGCCGATAA	1
ACTGGTCACGCGCTCCTACTACTG	1
ACTGGTCACGGAGGAGGAAATGGT	1
ACTGGTCAGGGCAAGTTATATGCG	1
ACTGGTCATTCCTCGTAAACAAGC	1
ACTGGTCCTATAAAAAACTTCAAT	2
ACTGGTCCTGATAATTCTGATGAT	2
ACTGGTCCTGCAAAAATTAGGGG	1
ACTGGTCGAGCGGAGCATGGACGC	1
ACTGGTCTCTACCATTGAACATGC	1
ACTGGTGACAGTGAGGGCGGGAGT	1
ACTGGTGACATCAATATTGGAGGT	1
ACTGGTGACATGGAGGTGGTCCAA	2
ACTGGTGACATTTGTGCTGATTGG	1
ACTGGTGAGAAACTAACTGGTAAG	1
ACTGGTGAGTAGGTGTCGAAAAAA	1
ACTGGTGAGTATCTGGAGAAGCTG	1
ACTGGTGATATTTTTGTTTAGGGT	1
ACTGGTGATTCTCTGTTTGTGGAA	3
ACTGGTGCAATTTGACTCCCTCGG	1
ACTGGTGCGATTATGATGAATAAG	1
ACTGGTGCTACATAGAGTATGGGC	1
ACTGGTGCTACATGGAGTATGGG	1
ACTGGTGCTAGCTTGCAGGAGTGG	1
ACTGGTGGAACTTCTCTTGTGGCA	2
ACTGGTGGAAGCAGATGGTATGGA	2
ACTGGTGGAGAAACCATCTTTGGT	1
ACTGGTGGAGAAATGCTTTTTAGT	2
ACTGGTGGGCCTCATGTTGATGG	1
ACTGGTGGGTCCATTATTTTACAC	1
ACTGGTGTAGTAAGGGTTTTGCCA	2
ACTGGTGTAGTTCAAGTGGTTTGG	1
ACTGGTGTCCTCGCCTATACGGTT	2
ACTGGTGTCTGGTGCTTCATTCAC	1
ACTGGTGTGACATGTTAGACAGAT	2
ACTGGTGTGATTATGGTAAATAAG	1
ACTGGTGTGATTATGGTGAATAAG	3
ACTGGTGTTACAATGTTATTTGGT	1
ACTGGTGTTGCTATTATATATCAA	1
ACTGGTGTTTAATATTGAGATGAT	1
ACTGGTGTTTCCGCCTGCACGGCT	1
ACTGGTTAAGTTCTTTATGGTGGA	1
ACTGGTTACCAACATATTGACGGC	1
ACTGGTTAGGTACATGTAGTGGAA	1
ACTGGTTAGGTTCCTTATGGTGAA	1
ACTGGTTAGGTTCCTTGTGGTGG	1
ACTGGTTAGGTTCCTTGTGGTGGA	5
ACTGGTTAGTTTACTTGTGATGGA	2
ACTGGTTCAGGGTTATGGATTAGA	1
ACTGGTTCCCATGAGAGACAGAA	1
ACTGGTTCGTCAAGCGGTGTGCAC	1
ACTGGTTCTATAATGAGGGTGACA	1
ACTGGTTGACTGGCTGGTGATGAC	2
ACTGGTTGATGGTCAGCTTCTGAG	1
ACTGGTTGCCCTGTGGGAAGCGGT	1
ACTGGTTGTCTTTCCTTATCCGGA	1
ACTGGTTTTATAGAAAATTAAGG	2
ACTGGTTTTCAACGAGGTGGTTAGG	1
ACTGGTTTTGATAGTTGAGGGACCC	1
ACTGGTTTTGTAAGTTGAAGGATC	2
ACTGGTTTTGTAAGTTGGGGGACA	1
ACTGGTTTTGTGGTGTCAGAGAAG	3
ACTGTAAAACATAGGAATGGTCGT	3
ACTGTAAAGGGGTACCTAACTATT	1
ACTGTAAATGTGACAAATCAGAA	1
ACTGTAACCTGTATGTGGCGC	4
ACTGTAATGCCTCGTATCTTGAAC	1
ACTGTAATGTGTGCTGCTTGCTAT	2
ACTGTACCTACCTAAAAGACGCGA	1
ACTGTACTACTCCTACGTACCAAG	1
ACTGTAGGTGCAGTAATGTAAAT	1
ACTGTAGGTGCAGTAATGTAAATA	1
ACTGTATATTGTTTCTCCGGTTGT	1
ACTGTATCAGGGTGAGGTTACAAC	1
ACTGTATGCATGTGTCGAACAGGG	1
ACTGTATTAGGGTGGTGAGGTTAC	1
ACTGTATTGAAGAAGTGCTGT	1
ACTGTCAAAGGCATGTCAGGGGAC	1
ACTGTCACAATTATTCAGGGGGTA	2
ACTGTCAGGGAAGCTGATGAAGGA	1
ACTGTCATACAGTTGCCCTTATTC	1
ACTGTCATGTAGATGTCACGTTAGC	1
ACTGTCCAACCGACACGCCTAGTC	1
ACTGTCCCCTGTGTCAGGCGAGAG	3
ACTGTCCGATGACCGTCCTGTTAC	2
ACTGTCCGATGATGCACGCTA	1
ACTGTCCGGTTTACTGCATGCAAG	1
ACTGTCCTGTTGGACGACGGCGCC	1
ACTGTCCTTGGGGTTGTGCAGTAC	1
ACTGTCGAGCATCGGCGGGGTGTC	1
ACTGTCGATGGATACGTTGCCTA	1
ACTGTCGATGGGTACGTTGTCTAC	2
ACTGTCGATGTACGGTGAAGGCGG	1
ACTGTCGATGTACGGTGAAGGGAC	1
ACTGTCGGTCCCGCGTTTTGGAGC	2
ACTGTCGGTGATATGGGACCGGGA	1
ACTGTCTTGATGTGAGGTAATACC	3
ACTGTCTTGTATGGTGTTGGACGG	1
ACTGTGAAACGGTCGACTTGGGCA	1
ACTGTGAATGGCCTAAAAGGATAT	2
ACTGTGAATGGCCTAATCGAT	1
ACTGTGACGATGTTGGTGCGCTTG	2
ACTGTGACGGGTGTACTGTTCTGA	2
ACTGTGAGAGAATGTGTACATGGT	2
ACTGTGAGATTAGATAGTGCCATG	1
ACTGTGAGATTCGATGCCTTAGGT	1
ACTGTGAGGTACCAAATTTTACAC	1
ACTGTGAGGTACCGGTACGTCGAG	1
ACTGTGAGGTACCGGTAGCTCGAG	2
ACTGTGAGGTTAGCGGAAGGAGG	1
ACTGTGAGTGCTCTAGGTGAAACA	2
ACTGTGATAGGGGGTGTTTAGAT	1
ACTGTGATAGGGTCTGTTTGGTAC	2
ACTGTGATCAGGAAAAAGAATAAA	1
ACTGTGATCGATGAGAATTAAAGC	1
ACTGTGATGGTATGTTTCTAGGAC	1
ACTGTGCAATTGGTTTTTTTCGTC	2
ACTGTGCACAATACGAGGAAAGAG	1
ACTGTGCAGCGATAGATCCCGCC	1
ACTGTGCATGTCTACACTTTTGGC	2
ACTGTGCCACGTGTAATATTCGAAC	2
ACTGTGCCCAATGATATATTGAAC	1
ACTGTGCCTTGTGAATGAAACTGT	1
ACTGTGCGCGCTACTGGATATGGC	1
ACTGTGCGCGGTGTGTCTCATCGG	1
ACTGTGCGTGCTTCCAATTTCATC	1
ACTGTGCTGAAGGGAATTGGCTGA	2
ACTGTGCTTATTATGGGACGG	3
ACTGTGGAGGGTGTTTCTTAGTC	1
ACTGTGGCAAAGTGTGGCTTGCAA	2
ACTGTGGTCTAATCTCTAAAGTGA	1
ACTGTGGTGTTGCGTATGTAGTGA	1
ACTGTGTAGGCCTACGTCGACGAG	1
ACTGTGTCGGTTTCGGTGATGGAC	2
ACTGTGTCTAACGTTTAACTATCT	1
ACTGTGTCTTATGTGTAATAACAA	2
ACTGTGTGATTACAACATCTTTGC	1
ACTGTGTGCGAGCTGTGAAGGGCTG	1
ACTGTGTGCGGTACGGAGTGAGG	1
ACTGTGTGTAAAATTTAGGAGTGA	1
ACTGTGTGTATGACAGGTAGGGCC	1
ACTGTGTGTATGACAGGTGGGATC	1
ACTGTGTGTCCAGATTCATAGCCA	1
ACTGTGTGTGCGCCTTCATAAGGA	1
ACTGTGTGTTCTGATTCATCTGAC	1
ACTGTGTTGCCAAGGAACCCTGCC	3
ACTGTGTTTGCGAAACTGGTGGGT	2
ACTGTTAAAAGGTGTGTTTCGTGC	2
ACTGTTAAACGATGTGTTTCGTGT	1
ACTGTTAAACGGTGCGTTTTGTGC	2
ACTGTTAAATGGTGAATGGTGTGT	1
ACTGTTAAATGGTGTCACTGCTAA	1
ACTGTTAAGTATAGTAGGGCCATA	1
ACTGTTAATGTGTTAACGAGGTAC	2
ACTGTTACCGTCGATTGTGGAGCA	1
ACTGTTAGCATCAGGGTGTGT	1
ACTGTTATGGTCACTGCCTAGTTC	1
ACTGTTCATTATGGCGTAGGTGTT	1
ACTGTTCCGGTTGGGATCTGGAGA	1
ACTGTTCTTCTCTTTTCCTTTATC	1
ACTGTTGACCAATCGATCTTACAG	2
ACTGTTGACCACGGTTAAGTTGCC	2
ACTGTTGATAGAAAACACGATGCC	1
ACTGTTGATAGAGGTGAGTGTGA	1
ACTGTTGATCTTTTAGATTGAGAC	1
ACTGTTGATGGAAGGTGAGAGAGA	1
ACTGTTGCGAGACATTAACCGTGC	1
ACTGTTGGCTTGGATCCAGATGGT	1
ACTGTTGGTAACTAGGTACAG	3
ACTGTTGGTCCTTCGTCGCTCTTG	1
ACTGTTGGTGCAAACATTACCTTT	1
ACTGTTGTCGACATGGCGGTCTGA	1
ACTGTTTAGAACGTAGCGCCTTAA	2
ACTGTTTATATGGTTGCCTTTGGT	1
ACTGTTTATGTTGTGCCTTTC	1
ACTGTTTCAACATTGGCCCATTCC	1
ACTGTTTGCCACTAGACTCACATG	1
ACTGTTTGCCATGGTTAGCGCGGT	1
ACTGTTTGGACGAATGAATTGATA	1
ACTGTTTGGGGCAGCTTCTAGCAG	1
ACTGTTTGGGGGAGTTTATGATTCT	1
ACTGTTTGTCCTATGAGTGTTGAA	1
ACTGTTTTAAACACTCAGGTGGAC	1
ACTGTTTTAAACACTCGGGTGGA	2
ACTGTTTTAAACACTCGGGTGGAC	5
ACTGTTTTAAACATTCGGGTGGAC	1
ACTGTTTTAACAAGACGAATGGT	1
ACTGTTTTCTGGGACTGGTATCGA	1
ACTGTTTTGTAAGTTGGGGGACCC	1
ACTTAAAAAAAATCAACGGTGTCA	1
ACTTAAAAAGTCAACGGTGTCAAAC	1
ACTTAAAAAGTCTGTAGTGGTGGTC	1
ACTTAAAAAGTTAACGGTGTCAAA	1
ACTTAAAATAGGACGGAGGGTGTA	1
ACTTAAAATAGGATGGAGGTGTAG	1
ACTTAAAATGAGAGGAAGGGAGAC	1
ACTTAAACAAGATGGTGGACCTAG	1
ACTTAAACAGATGATGCACACGAT	1
ACTTAAACTTGTAGCGGTGTGTCA	1
ACTTAAAGGGGCTAATGTTTTGAG	2
ACTTAAATTTAGGTGGATTGGTTC	1
ACTTAACAAGTAAGGGTGTGTTTA	1
ACTTAACAGGTTGATGTGATGGAA	1
ACTTAACCTAAGAGAAGATGTGTC	1
ACTTAACCTAAGATGAGATGTGAC	1
ACTTAACCTACTTAGTGTATGTAC	1
ACTTAACCTAGAAGAGGATGTGAC	1
ACTTAACGGCGCAAAATGGATGAA	1
ACTTAACTTCAGCGACATAGTGC	1
ACTTAAGACAATATGCCACCTAAG	1
ACTTAAGAGGACCGCACGGAAAAA	5
ACTTAAGATAGATAATGTGCCAAG	1
ACTTAAGATTTTAGGAGAAGCTGC	1
ACTTAAGGGACCTGCATATCTGAT	2
ACTTAAGGGAGTGTTTGAGGAGA	1
ACTTAAGGTGATATACTGTAGAG	1
ACTTAAGTAAGGCATTAGGGGTGG	1
ACTTAAGTGCCAAGTATCAAAGT	1
ACTTAAGTGCTCTTGAGGTTGTCA	2
ACTTAATACGGGTGCTCATATTTA	2
ACTTAATAGTATGTCTACATGGGTA	1
ACTTAATAGTGGGAGGTGCGCGGC	1
ACTTAATCTGGACACTATAAAAGA	2
ACTTAATGAGGATGAACTATATAA	1
ACTTACAAATGGTGTATTGAGGT	1
ACTTACAAGATGGGTGCAATTTAG	1
ACTTACAATAGGTCACGAAGCAGC	1
ACTTACAGAACTCTCGTTCAGGTC	1
ACTTACATAAGTGAAACTGGTGAA	2
ACTTACATATGGGGTCTATAGAAA	2
ACTTACATATTTGTGGGCTGATAT	1
ACTTACATTATGAAACGGAGGGAG	2
ACTTACATTGTGAAACAGAGGGAG	1
ACTTACATTTTGGGACGGAGGAAG	5
ACTTACCACGTATATGGAGTGTCT	1
ACTTACCATAGGCCACGAAGCAGC	1
ACTTACCTGGAGCCGAAACTATGA	1
ACTTACGATATTAGAGTAGGACGC	2
ACTTACGATGCTTGTCCAATGGAA	1
ACTTAGAACATTAAAACCACCGGC	1
ACTTAGAACCGGATGGGGCATTTCA	1
ACTTAGATCATGGTGTTATAACAT	1
ACTTAGCCGCCACGTCGGACAAAA	1
ACTTAGGATGGGATGTATGTAGAT	1
ACTTAGGGGCCAGATGCACTTGTA	4
ACTTAGGTCCACGAACTTGCA	1
ACTTAGGTCCTTAGATTCTTTGTC	1
ACTTAGTAAGTTGGTGTAATTTAGT	1
ACTTAGTTGGGAGTGTCTTATCGA	1
ACTTATAAACTTGGGGGTGCTACTC	1
ACTTATAATCTAAAAGAAGGTGAC	1
ACTTATATGAGGTAGACGTATGAC	1
ACTTATATGGGTGTGTCGTATAGA	2
ACTTATATTGTGGAACAGAGGA	1
ACTTATATTTTGGTAGTGTCGTTTC	1
ACTTATATTTTTGGGACGGAGGAA	2
ACTTATCAAGTTGTTGCACTCGAA	1
ACTTATCAGACTAGTCTTTTAGGT	1
ACTTATCTCACAGGATGTCTTGAA	1
ACTTATGAATACTATGGGTTGGGAC	1
ACTTATGAATGAATGGGCCAAGG	1
ACTTATGCATGGTTGTTAGTTGAA	1
ACTTATGGACACTATGGGTTGGGA	4
ACTTATGGCTGTGTGTCTTATGA	1
ACTTATGGGGCCCATCTTTTATGG	1
ACTTATGGTGATGTGGATGAATC	5
ACTTATGGTGTATCTCCACAATGG	1
ACTTATGGTTGTGCTTATTTTGAG	1
ACTTATGTGCACGGATATGTTCCA	1
ACTTATGTGTAGTCCCTTTGGTCC	1
ACTTATGTTTTTGTGAGAGGGACT	1
ACTTATTAACAACGAGGTGCTAGA	2
ACTTATTAGGTGCATCTAGTCGAG	1
ACTTATTGCTACTGTGTCTGAAAC	2
ACTTATTTTGGGACGAATGGAGTA	1
ACTTCAAATGTGTGTCCGTATATC	4
ACTTCAATCAACGAGATGGTGAAG	1
ACTTCACCGGGCCTGCTTGCCATG	1
ACTTCAGATTAGGAGAGGGGCTAT	1
ACTTCAGTGTGAATTAAACACAGC	1
ACTTCATATCACAGTAGGTGT	1
ACTTCATGCATGTGTCTAGAGACT	1
ACTTCCAGCTAAGTGGCCTGATGT	1
ACTTCCGGGTGAAATGCTACAATG	1
ACTTCCGTCGCATCCTGAGGTAAC	2
ACTTCCTACAAACGCTTTTAAGCC	1
ACTTCCTACAAATGCTCTCAAGCC	1
ACTTCCTAGTACTACGAATCTGAT	1
ACTTCCTCAGTGATGGCAGCAGAC	1
ACTTCCTTTATAAGTATGGAGAGA	1
ACTTCGAAGTTGTAATAGGTGTAA	1
ACTTCGAATATACGTCCATATCCC	1
ACTTCGATGATAAGCAAGGTGACC	1
ACTTCGGTTAAGCTTCATGGTACA	4
ACTTCGTGCCTGCTGTGGTGATGC	2
ACTTCGTTGGTGTTGATATTTCTT	1
ACTTCTACAATGGTGAACCAA	1
ACTTCTCCTGTGCTAGAGGAAGAG	1
ACTTCTCGAGATGGCAACGGGTGT	1
ACTTGAAAGTGTTTATAGGGTGAC	2
ACTTGAAATGTGTGTCCGTATACA	1
ACTTGAACCATCCAGTGCCTTGAC	1
ACTTGAAGAATAATATGTATCAGG	1
ACTTGAAGCGTGTGAGGTGGAGAG	2
ACTTGAAGTGTCAAAACAACGAAG	1
ACTTGAAGTTGTAATAGGTGTTAG	2
ACTTGAATACATAAGGTTGTCCAG	1
ACTTGAATGGAGTGCTAACTAGTA	2
ACTTGACAAGTGGGTGCGTTCTAGT	1
ACTTGACGGTACTACTCGCAT	1
ACTTGAGAGGTGTAGGATAAGTGGGAG	1
ACTTGAGGATGATATAATGATGAA	1
ACTTGAGGCCCGTTTGAGATATGG	1
ACTTGAGGGGGTCTCGCGTGAGGG	1
ACTTGAGGTACTGCATTGTGAAGC	1
ACTTGAGGTGCATAAATTTACTAA	1
ACTTGAGGTGTACAAACTTTAGGT	1
ACTTGAGGTGTACAAACTTTTGGT	1
ACTTGAGGTGTATAAACTTTAGAT	1
ACTTGAGGTGTATAAACTTTAGGG	4
ACTTGAGGTGTATAAATTTACTAA	4
ACTTGAGGTGTATAAATTTTAGGT	3
ACTTGAGGTGTGGCAAAGTGTGGC	2
ACTTGATACATGAGTATTTGGGGA	1
ACTTGATAGGTGGGTGCAATATAG	1
ACTTGATAGTGTCTAGTGCATAGC	1
ACTTGATCTAGGGAAATGGTAC	1
ACTTGATTACTCGAGAACGGTTGG	1
ACTTGATTAGGGTAGCCGCATCTC	1
ACTTGATTGGCATGCGACAAACGG	2
ACTTGCAAAACGCATATCGAGGTC	1
ACTTGCAAAATAGGTGTACCTGAG	1
ACTTGCATCAACTGGTTTCTA	3
ACTTGCCAAATTAGATGGAGAGT	1
ACTTGCCGACTAGGTGTATTCCTG	1
ACTTGCCTAGTGGTTGCTGAGACA	1
ACTTGCGCTTTGCATGTAGTGCTA	3
ACTTGCGTGGTGGGTGCAAATAGG	3
ACTTGCTCCAAATGTTGTGAC	1
ACTTGCTCGAATGGTGTTTTCCA	1
ACTTGCTCTAATGCCACTGCAAAT	1
ACTTGCTTTACGAGTATGGAGGGA	1
ACTTGGAGTTGTAATAGGTGGTAG	2
ACTTGGAGTTGTAATAGGTGTTAG	4
ACTTGGAGTTGTACTAGGTGTTAGGA	1
ACTTGGCAGCGTGCCGATGGGACA	1
ACTTGGCAGTGTGCCGATGGGACG	1
ACTTGGCTGCCAAGGAAGCTGGGA	1
ACTTGGGACACTCAATTACAGATG	2
ACTTGGGATTGTGTCTATATTGGT	1
ACTTGGGCCAGAGTGGGATTCTCTC	1
ACTTGGGGAAAAAAACGATAGCAG	1
ACTTGGGGTTAAGATGATCCACGG	1
ACTTGGTACATGGTGTGCCCTACC	3
ACTTGGTACCACGTATTTATACGG	1
ACTTGGTACGTCATCCGTGTATGA	1
ACTTGGTGAAACAGTGCCCGAAAA	1
ACTTGGTGCTAAATTATTTACCAC	1
ACTTGGTGCTTGCATCCACTTATG	1
ACTTGGTGGCCTGTTTGGTACGG	1
ACTTGGTGGCCTGTTTGGTACGGC	1
ACTTGGTTTATTGTATCATCCTGG	1
ACTTGGTTTTATAAGTTGAGGTC	1
ACTTGTAAATGTGAAGGTGTAGAG	1
ACTTGTACCGGTGTGTCATCTAGA	1
ACTTGTACTACATTGTAAGCTGGT	2
ACTTGTAGAGGTGTAGTGGTTGCT	1
ACTTGTAGGAGCATTTGCCATATG	1
ACTTGTAGGGTTGTGTCATCTA	2
ACTTGTAGTGGTGTGTCATCTAGG	1
ACTTGTATGGGTGTGTCAACTAGG	1
ACTTGTCAAAGTGTGTCATCTAGG	1
ACTTGTCAGTGACAAAAGCATGGT	1
ACTTGTCGATGACATTTCTGGGAC	1
ACTTGTCGGAGGTGCTAAGGCTGT	1
ACTTGTCGTCAAGTGTCCGTGCCA	1
ACTTGTCTAGAGTTTGGCACTACC	1
ACTTGTCTGGATTCGATTCATGGT	1
ACTTGTCTGGTGCATGCGGAGGAA	1
ACTTGTGAAGATGACATGTGGGAC	1
ACTTGTGACTCAACGGTGGCAGCA	1
ACTTGTGAGGTGGGTGCAATCTAG	1
ACTTGTGAGGTGGTGTCACTTAGG	3
ACTTGTGATCGATAAAATGATAAG	1
ACTTGTGATGGTGTATCACATAGG	3
ACTTGTGCACACTCACACGGGCGC	1
ACTTGTGGCTGGGTCGAAGGGAAGC	1
ACTTGTGGTGCTAGCTGATAAGAC	2
ACTTGTGGTGCTTATACAAACAGCC	1
ACTTGTGTTGCTTTGTGAGGGTAG	1
ACTTGTTAGGTGGGTGCAATTTAG	1
ACTTGTTAGGTGGGTGCAATTTAGT	2
ACTTGTTAGGTGGGTGTAATTTAG	1
ACTTGTTATAGTATGCCATCTAGG	1
ACTTGTTCAGTTGTGTCACACCGG	1
ACTTGTTCAGTTGTGTCACCCCGG	1
ACTTGTTTTGAGTGCTAGATTATA	3
ACTTTAAAAAATAGTTGTGCCT	3
ACTTTAAATGTGTGCCCGTATATC	1
ACTTTAACTATAGCAACCT	1
ACTTTAAGCTGATGCGGATGCCT	1
ACTTTAAGTGGTGTTTATTTAGAC	2
ACTTTAAGTTGATTGATTGTTTGC	1
ACTTTAATACAGGTTACGACGTGC	3
ACTTTAGATGTGTAAACTTGAGGT	3
ACTTTAGATTCTGGACCTACACAAC	1
ACTTTAGATTCTGGGCCTATACAA	1
ACTTTAGCCATAAGAGAGGAGCCT	1
ACTTTAGCCTATGTCTAAAAAACA	1
ACTTTAGGTGCACAAATTTTAGAT	1
ACTTTAGGTGCATAAATTTACTAA	1
ACTTTAGGTGGTGTTTGGTTGGAGA	1
ACTTTAGGTGTATAAATTGACTAA	1
ACTTTAGGTGTATACACTTTCTGT	1
ACTTTAGGTTGCATGAGTTTGTACT	1
ACTTTAGTGCTAGAATGGCAAAAC	1
ACTTTAGTGTGAACTAGGCGTGGA	6
ACTTTATAGGACTACGAATCTACG	1
ACTTTATAGTAAGATAGGATGC	1
ACTTTATGGTACAACGAATTTAGA	1
ACTTTATTATATGTAGGGCCCGCC	1
ACTTTATTTTCTGGTGAAGCTAAA	1
ACTTTCACGTACGAACCTACTAAG	2
ACTTTCAGGAGGGAGAGCTGGGCC	1
ACTTTGAAGGTGCCGGAAGAGGAG	1
ACTTTGAATCAAAGGGGGCCTTAA	1
ACTTTGAGTGACTGACATATAGAC	1
ACTTTGCACGAGATGGGCCTA	1
ACTTTGCAGTACGAACATGTGCAT	1
ACTTTGGAAGGGTGAGTGGCTATA	1
ACTTTGGAGAAAGACCTACAAAAG	1
ACTTTGGGTGCTATTAAAGTGAAC	2
ACTTTGGGTGTTACTAAAGTGAAC	1
ACTTTGGGTTTTACCTGACGTGGC	1
ACTTTGGTCTACGTATTACACTC	2
ACTTTGGTGACATCAGTATGGTCC	1
ACTTTGGTTGTCTCGGACTTGTGG	1
ACTTTGTTGTATGCTTAGGATGGA	1
ACTTTTAAGATGTGTCAATTAAGA	2
ACTTTTACCTACTTTCTTAATAAC	1
ACTTTTAGAAGAAACGAACAGGGC	1
ACTTTTAGAGGTGTTTGGTTGAGA	1
ACTTTTAGGTCTCCTGCGCTACCC	1
ACTTTTATATAGATGTTGTTGGTC	1
ACTTTTCAAGGTGGATTGAGGCAGA	1
ACTTTTCGTGATTTTGGGTGTATG	1
ACTTTTGAACGAGTTGCCTTTTAA	1
ACTTTTGACATGTGCTAACTTGAG	1
ACTTTTGGAGGTTGCTTCTATTGT	2
ACTTTTGGATGGAGGGAGTACTAG	2
ACTTTTGGGTTGCAATGGGCTGAA	1
ACTTTTGGTATGTGCTAACTTGAG	1
ACTTTTTGGTGGCCCAGTACGGAA	1
ACTTTTTGTTGGACCGGAGCAAAT	1
ACTTTTTTAAATATGGTTGACCGT	1
ACTTTTTTGGGACGGAAGGGGTA	2
AGAAAAAAAAGCCATACGGAACTAA	1
AGAAAAAAACAAGGGTGTTGGCTC	1
AGAAAAAAAGTACACTGAAGGTCC	1
AGAAAAAAAGTGCAGTAACATAGA	1
AGAAAAAAATAACAGGCCAGCAAC	1
AGAAAAAAATGGAACCTAGATCTCT	1
AGAAAAAAATTTAGGGAGAGAAAGA	1
AGAAAAAAGTCAACGGTGTCATCTA	1
AGAAAAAATAGGTGGAATATAAAT	1
AGAAAAAATGGCCGTGCGTTGCAA	2
AGAAAAAATGGTACCTCATGG	1
AGAAAAAATGGTACCTTCTTGGCT	2
AGAAAAACAATTTTTCATGGCGTC	1
AGAAAAACCGGACGATTGGCGCCG	1
AGAAAAACGCCATAATGACGCCTCC	1
AGAAAAACGGCGATAGGGCCTCGG	1
AGAAAAACTTGCGAAAGGGCCTG	1
AGAAAAAGAAAGACTGACAGGTGG	1
AGAAAAAGAGGCCACAAAAGGTAC	1
AGAAAAAGATGGATTGTTTTGCGA	1
AGAAAAAGCATGCCACACACAGAG	1
AGAAAAAGCTTAGGCCTGATGGTA	1
AGAAAAAGGAAAGCCTCTATTTGA	1
AGAAAAAGGAGCCTACACGTTCGC	1
AGAAAAAGGAGCCTCCACGTTCGC	1
AGAAAAAGGCTTGTGCAACGGTA	1
AGAAAAAGGGTTAGCGCATGAGAC	1
AGAAAAAGGTATACAAGGAATATC	1
AGAAAAAGGTCAATGCGTAAGGAA	3
AGAAAAAGTAGGGTCAGATTGGTA	1
AGAAAAAGTGAATGGTGGAGAGTTG	1
AGAAAAAGTGACCTCTCCTATGGT	2
AGAAAAAGTGATACCTCATGGTAC	2
AGAAAAAGTGATACCTGATGGTA	1
AGAAAAAGTGCTTGTGCGTTACAA	1
AGAAAAAGTGGTACCTCATGATAC	1
AGAAAAAGTGGTACCTTATGGTAA	1
AGAAAAAGTGTCCGTACGTTGTA	1
AGAAAAATACATTTTCCTGTGCG	1
AGAAAAATACCTGTGTGCATGACA	1
AGAAAAATACGGGGTGGTTGTGA	1
AGAAAAATACGGGTCAGATTAGAG	1
AGAAAAATATATAGTGCAAACCCC	1
AGAAAAATCGATTTTCACGTGCAA	1
AGAAAAATCTACGCAAGGTGGTCT	1
AGAAAAATGCCATTACAATTTGCC	1
AGAAAAATGCCGTTCGATCCA	1
AGAAAAATGCTATTACAATTCGTC	1
AGAAAAATTCGATGTGATGGAAAA	1
AGAAAAATTGACGGAAGTGCTAAA	1
AGAAAAATTTTAGGTGTCACATCA	1
AGAAAAATTTTGGGTGTCACATCGG	1
AGAAAACAAGGTCCTGAGTGAAAC	1
AGAAAACACGCCTAAGATCAGAGA	1
AGAAAACATAGAGCGCATGAATGC	1
AGAAAACCACGGATGTCAACCAGC	2
AGAAAACCAGGGCCCACGCATAGA	1
AGAAAACCATTGGGGCATCAACTA	1
AGAAAACCCTGCGCGCGTGGCCTT	1
AGAAAACCGTGGTGTACTCTGAAC	1
AGAAAACCTATAAACGACAGGCCC	1
AGAAAACGAGAGGAAAGTGTTGGG	1
AGAAAACGAGGAAGATGGGTTGGG	1
AGAAAACGATGAAAAATGTGATGG	2
AGAAAACGATGTGCAAACAAAGAG	1
AGAAAACGATTGACTGATGGTTTAA	1
AGAAAACGGGCACTGCCTAATCTC	1
AGAAAACGGGCTACATATTCGGGT	1
AGAAAACGTGTAGTGCCTGGTTGC	1
AGAAAACTATACGTTTTGTGGTCC	2
AGAAAACTATGATTTTTGCAGGCG	1
AGAAAACTGATTCGTTAGATGCCA	1
AGAAAAGAAGGCGGATTATGGG	1
AGAAAAGACTGCTGGTGAAGAAGT	1
AGAAAAGAGAAAGATGGTTGCTA	1
AGAAAAGAGAAAGATGGTTGCTAC	1
AGAAAAGAGTCCTACCCCTACATC	1
AGAAAAGAGTTATAGTGATACGAC	1
AGAAAAGATGCACTAGAAGATGGA	1
AGAAAAGATGCGAACCAGGGTGCA	1
AGAAAAGATGTCACAAGATGAAAT	1
AGAAAAGATGTCTCACATATCAG	1
AGAAAAGATGTCTCACATATCAGT	2
AGAAAAGCAGTGAGCTACAGATTTA	1
AGAAAAGCCAAACGGAAAAGCTGC	1
AGAAAAGCCGTCGGCTGAAGGTGT	1
AGAAAAGCCTAATCTCTCAACGAA	1
AGAAAAGCGTGCCACGAGTATCCA	1
AGAAAAGCTATTGTACGCAGATGC	1
AGAAAAGCTGCCAAATGTAAGTGG	2
AGAAAAGCTGCCAGATGTAAGTGG	1
AGAAAAGGAAGGACTACTACGATG	1
AGAAAAGGAGCGGTGGTGGGGCAA	1
AGAAAAGGGACGACTCTCGATTGC	1
AGAAAAGGGCCTCGACATTACTCC	1
AGAAAAGGGTCTACGTAGTACTTA	1
AGAAAAGGGTGGAATTGAATTGTT	1
AGAAAAGGTACGAACCAGGGTGTG	1
AGAAAAGGTGATATCTTATGGTAC	2
AGAAAAGGTGATATCTTATGGTACC	1
AGAAAAGGTGCAGTAACTATTGTG	1
AGAAAAGGTGGTACATCATGGTAC	2
AGAAAAGGTGGTACCTCATGATAC	1
AGAAAAGGTGGTGGGGTTGGCCTA	1
AGAAAAGGTGTCATACAAGTAGCA	1
AGAAAAGGTTTGCAGAATGAGAAG	1
AGAAAAGTACAAGGCCAAAGTCGA	1
AGAAAAGTAGCTTACAACTGTGAC	1
AGAAAAGTGATTGTGTCTTATATT	1
AGAAAAGTGTATGGGTTTGGAGA	1
AGAAAAGTTGTGTGTGTATGAAAG	1
AGAAAAGTTTCGATGTGATGGAAA	1
AGAAAAGTTTTAGATGTGATGTGA	1
AGAAAAGTTTTCGATGCGATGTGA	1
AGAAAAGTTTTGATGTGATAGAA	2
AGAAAAGTTTTGATGTGATGGAAA	2
AGAAAATAGGTAAAAGTGAGGGC	1
AGAAAATAGGTGGAAAAGAATGGT	1
AGAAAATAGTGGTGCAAATAGATT	1
AGAAAATAGTGTGGATGATGCATG	1
AGAAAATATAATGATGCTAGCCGC	1
AGAAAATATCCCATCCGGGTTCTA	1
AGAAAATATCCTAGAGTGGACTGC	1
AGAAAATATGGCACCTCTAGGTAC	2
AGAAAATATGTACTACGAGTGAAC	1
AGAAAATCAATTCGTTGGTGTCAT	1
AGAAAATCAGAACATGCATTGCCA	1
AGAAAATCGATTCGTTGGTGTCAT	1
AGAAAATCGATTTATTGGTGTCAT	1
AGAAAATCTCTGGTGCTGAGGCGG	1
AGAAAATGATTTTTGGCTGCCTG	1
AGAAAATGCCACAAGATTTAA	1
AGAAAATGGTAGGTAAAAAAATAG	1
AGAAAATGGTGTTAACCTGGTTGG	1
AGAAAATGTCTCATCCGGTCCTAA	1
AGAAAATGTGATATGCCACCCTGA	1
AGAAAATGTGGTACCTCCTCAAGG	1
AGAAAATGTGTTCCTAACATAGGC	1
AGAAAATGTGTTGAACAGAGGAGC	1
AGAAAATGTTGGGCAACGCTTGGG	3
AGAAAATGTTGGTAAATAAGTTGT	2
AGAAAATTAAGGTCTACTGCT	1
AGAAAATTATACTGTAGCACCATA	2
AGAAAATTATTGAGTGTCACATC	1
AGAAAATTGCAATATTGGGGCTGC	1
AGAAAATTGTAATATTGGGACTGC	1
AGAAAATTGTTGGGAGCTAGAGAG	1
AGAAAATTTACGAGATAGATAGGT	1
AGAAAATTTTAGTGGGGGCTTTAC	1
AGAAAATTTTGGGAACTCGATCGG	1
AGAAAATTTTTGGGTGTCATTTG	1
AGAAACAACAGATGCCCTGTGCCC	2
AGAAACAACCGAAGAGCTTGTCGC	1
AGAAACAACGGGTTGCCAGTGCTT	2
AGAAACAAGAAGCCAAAGTTGTGC	3
AGAAACAAGCCTCGGTTCGCCAAA	1
AGAAACAAGGTGTGCTTTGAACAG	2
AGAAACACAGTAGGAACATAGGCG	1
AGAAACACCGGTAAACGATGTCAG	1
AGAAACAGCCAACGAGAAGCTAGT	1
AGAAACAGGAATGGAGGCGGCGGC	2
AGAAACAGGTGACTGAGGTGATGG	2
AGAAACAGTCTACAACATAGGGAG	1
AGAAACAGTGCCAGATCGGACAAG	1
AGAAACATACAGGGGTCTTTCAGC	1
AGAAACATGGTGAACTTTGGGTGCTA	1
AGAAACATTTCGGGCCTATTCAGA	2
AGAAACCAACAGGGGATCGGATGC	1
AGAAACCAATGGATCCTTCTGAGCCTG	1
AGAAACCATCGCCCAAAGGTGCTT	1
AGAAACCATCTTTCGTCGGTCGGG	1
AGAAACCATCTTTGGTCGGTCGAC	1
AGAAACCATGGGTTGTAGAGTGTA	4
AGAAACCCAGCTAGCTCAGTTGGC	1
AGAAACCCAGTGTCAGATATGTG	2
AGAAACCCTGAAAGGTACCTGTGC	2
AGAAACCGAATCCTCACCGCGTGC	1
AGAAACCGAGTGCATGGGAGGATA	3
AGAAACCTAACCAGTTGAGGTGCG	1
AGAAACCTAGGTGTAGATGGGCCA	1
AGAAACCTAGTGCTGGATGGGACG	1
AGAAACCTGATAGGGAACACCTAC	3
AGAAACCTGGAGGTGCCGGTTGGA	1
AGAAACGAAAGGTAGCCTTACTAA	1
AGAAACGAATTTGAGATTGGGTT	2
AGAAACGAGAGTGTATACGCGAAA	1
AGAAACGCATAACAAAAGTGGGTC	1
AGAAACGCGAAACACTCTGGGTGT	1
AGAAACGCTCTTAAGCCGCCACGT	1
AGAAACGGTAGAGATTGTGCATGC	1
AGAAACGGTCGATCGATGGGCTA	1
AGAAACGGTGGATCTACAAGGAGG	2
AGAAACGTCTCCACATCCTCCGAC	1
AGAAACGTGTGCATGAAAATCGAT	1
AGAAACTACCTATTCAATGGATGT	1
AGAAACTAGGCCCAAAACGTAGAG	1
AGAAACTATGTCTAGTGTTATGGG	1
AGAAACTATTTTAGGTGGAGGGTTG	1
AGAAACTATTTTTAACAGAGGTTT	1
AGAAACTCAACTGTCTACGTTGCA	2
AGAAACTCAGGGTTTGCCTTGTTT	4
AGAAACTCATGAAGAGGCCTAGAG	1
AGAAACTCTGAGTTTCCGTGTCTA	1
AGAAACTGAAGAAACAAGGTGCTG	2
AGAAACTGAAGGCCTGAGGACGTG	1
AGAAACTGAAGTGCACATTCGCAT	1
AGAAACTGATCCAGACAGTCCACA	1
AGAAACTGGACAGAAGTGGCAAGG	1
AGAAACTGTTTGTTGCCAGCGAGA	1
AGAAACTTGTAAAGGGTGCTGTGG	1
AGAAAGAAATCAAGCGACAAGGAG	1
AGAAAGAATTGGGTTGAACTA	1
AGAAAGAGAAAAGGAGTATGGTTG	1
AGAAAGAGACAATATTAGTGGTAA	1
AGAAAGAGCTGGGTGATGGAAATA	1
AGAAAGAGTGTAGCTAATAGGTGG	2
AGAAAGAGTGTAGCTAATAGGTGGA	1
AGAAAGATACGTAAAACGAGGTGA	1
AGAAAGATGAAATGGAAGGAGCTAC	1
AGAAAGATGAAGTAGTGTTTAGAC	2
AGAAAGATGGTTGCTACGCATGAC	1
AGAAAGATGTGAAGTACAAGTGGT	1
AGAAAGATGTGTCTTGTGGGTAAA	3
AGAAAGCAACAATATCGATGGCAA	1
AGAAAGCAAGGGACCTAGCTACAC	1
AGAAAGCAGAAATATGAAAGGTTC	1
AGAAAGCCTTATAATATACTCCCT	1
AGAAAGCCTTATAATATGAAACGG	1
AGAAAGCGAGAAGCGGCGAATGTG	1
AGAAAGCGCGTTGTCTTGGAA	1
AGAAAGCGGTACCAAAAAATAGCA	1
AGAAAGCTAAAATTAAGATGCCGA	1
AGAAAGCTACCTAGTACATGATGA	1
AGAAAGCTACTACTCATAGGGTGT	1
AGAAAGCTAGCACCGTACCGACCA	1
AGAAAGCTCGGATGGGTGTGTAGG	1
AGAAAGCTGACTGGACTGCCACGT	1
AGAAAGCTGATGATTTACGGTGTA	1
AGAAAGCTGTGTGCACCCTGT	1
AGAAAGGAAAGATGCCAGAAACAG	1
AGAAAGGACTACGAAACAAGTGAG	2
AGAAAGGAGCTAATCTAATCTAGA	1
AGAAAGGATGAGGCTTCGAAC	1
AGAAAGGCCGGTGTTAGGTGACAC	1
AGAAAGGCCTACAAGATTTGAAGC	1
AGAAAGGGAGTGGCATTTCAGCCA	1
AGAAAGGGCATGTAGCTTAGTGGT	1
AGAAAGGGCTACGAAACAAGTAAG	2
AGAAAGGGGCAATACTAGAAAGTC	1
AGAAAGGGGGTACTACGCATAGCGG	2
AGAAAGGGTGATGCTTCGAATCCAG	1
AGAAAGGGTGGTAATTCCTGGTAC	1
AGAAAGGTAAGTGCATGCCTAGAC	1
AGAAAGGTGAAACTGGGTTTATGC	1
AGAAAGGTGAACTACTCTGAGTAG	1
AGAAAGGTGAGAGATGAGAAGCG	1
AGAAAGGTGCCGGTTCGTGCTAAC	1
AGAAAGGTGCTTAAAATAGAAAAG	1
AGAAAGGTTGAGCGGTCTTCAGGC	1
AGAAAGGTTGCCAAATTTTAGTAA	1
AGAAAGGTTGGCGCCAATGGGGA	1
AGAAAGTAGATGAAGAAGAATGGT	1
AGAAAGTAGCATGAGTGGAGGCCA	1
AGAAAGTAGGAGTCTGGAGCGTC	1
AGAAAGTAGGTGAAAAGAATGGT	1
AGAAAGTAGGTGAAGAAGAATGGT	5
AGAAAGTAGGTGAGAATGATTGG	1
AGAAAGTAGGTGAGAATGATTGGA	4
AGAAAGTAGGTGAGAATGGTTGA	1
AGAAAGTCAGCAACATGGGCACTT	1
AGAAAGTCCTACACTGTGAAACGG	1
AGAAAGTCTCTGTATCCGGTGGAC	2
AGAAAGTCTGAAGAATGGTGATACC	1
AGAAAGTCTGGTAAGCTGAACGTA	1
AGAAAGTCTTACAAAACAGATGGA	2
AGAAAGTCTTACATTGTAAAATAG	1
AGAAAGTGAGCTTCCACGAGAGAG	1
AGAAAGTGCAAGCCCATGTATA	1
AGAAAGTGCCCAATTAGTATAGG	1
AGAAAGTGCCCAATTTGTATAGGA	1
AGAAAGTGGGTGGGAATGATTGGA	1
AGAAAGTTAAGTGCCGAACTCAGC	1
AGAAAGTTCCCTCGAATCCTT	1
AGAAATAACAAGAACTACCCATAA	1
AGAAATAACTATATTTTAGGACGG	1
AGAAATAAGCCTGATGGAGATTGG	2
AGAAATAAGTCTAAAGGTGTCATG	3
AGAAATAATACCCTACTCCTGTCC	1
AGAAATAATGTGGTTGCAGGTGGA	2
AGAAATAATTTGGTGTCATGAAGT	1
AGAAATACCAAAGTGACGAGGAGC	1
AGAAATAGAGAGGGGTGCTACTCGC	1
AGAAATAGCAGTAGAGCACTAAGG	1
AGAAATAGCCGAAGAGCATGTTGC	1
AGAAATAGCCTACTGGTTAGTGCC	1
AGAAATAGCTTTATTTTGGACAAG	1
AGAAATAGCTTTATTTTGGGAC	1
AGAAATAGGAAAAGGTAATTGATG	4
AGAAATAGGAGGATGGGTGAGGGA	3
AGAAATAGGGAACATATGTATCGA	1
AGAAATAGGTGCCGGTTTAACAACC	1
AGAAATAGTGGTAGACCGAGCAAG	1
AGAAATAGTGGTTGCCATCGGAGC	1
AGAAATAGTTAAGGTGATATGAC	1
AGAAATAGTTGCATTGGAGGTGAT	4
AGAAATATCAGTGGGGTCTAAGC	1
AGAAATATGGCGCCATATACTACA	1
AGAAATATGGGCCACTGACATGTG	1
AGAAATATGGTGTGAACGAAATAGG	1
AGAAATATGGTTGCTACGCATGA	1
AGAAATATGTGATACATAGGGGCA	4
AGAAATATGTGTGACCTGTAGAAT	2
AGAAATATTCATGGTATGGCCT	2
AGAAATATTTGAGGTGATGTAGC	2
AGAAATCAAAGTCTTTGGGTTC	1
AGAAATCAAGTTCGGGGTCTTACT	2
AGAAATCATTTGGGTGTGGAA	2
AGAAATCCTGGTGTAACAAGTGAA	1
AGAAATCCTTGATCCTAAGGGTGA	1
AGAAATCTAGGTCCGGATATGATA	2
AGAAATCTATTCCAATGTGTGCTT	1
AGAAATGAACCTTCTTGCCACGCC	1
AGAAATGAACGGGATTGAGGAGGC	1
AGAAATGAAGCAGGGTTCGAGCCA	1
AGAAATGACGTGATACTACTTCGG	1
AGAAATGATATCCCTGCACCCACC	1
AGAAATGATATGGTTTTTGACAAG	1
AGAAATGATTAGGTGAACTTTCAA	1
AGAAATGCACAAAGATGACGGCAC	1
AGAAATGCACGGTGTTGATAGTTC	2
AGAAATGCCATTGACAAGCGTCCA	1
AGAAATGCCATTGCCATTAGGGTT	1
AGAAATGCCCATGAATATATGAAG	2
AGAAATGCCTCAACGAATCCC	1
AGAAATGCTGGTGCTGTTGTACAA	1
AGAAATGGCCAAAACATCCACACC	1
AGAAATGGGCATTTGGGTGCA	1
AGAAATGGGTGCCTGCGTTTGTAC	1
AGAAATGGTACTGTTTACACGATT	3
AGAAATGGTAGCTACATTAGCCTG	1
AGAAATGGTCGTACATATAGATG	1
AGAAATGGTGCATGTGGTATCCCC	1
AGAAATGGTGTACTAAATTTTATG	1
AGAAATGGTGTCGAAACCTTGACA	1
AGAAATGGTTGATTTCCGGGTGGC	1
AGAAATGGTTGCCACACTAGGAGG	1
AGAAATGTGCTCACAAATTACTTC	1
AGAAATGTTGGGAGCCATAAAAT	1
AGAAATTAAAACGATGTGATGGAA	1
AGAAATTAATTCTTTTTGGGACGG	1
AGAAATTACAGAGAGCCTACTGCAC	1
AGAAATTAGAACGATGTGACAGAA	1
AGAAATTAGGTGAGAATGATTGAA	3
AGAAATTATATGTGCCGGTTATAT	1
AGAAATTATTTGGTGTCACATCGG	2
AGAAATTCGGTCCTAGGTAGTGAA	1
AGAAATTGAAACGATGTGATGGAA	2
AGAAATTGAAACGGTGTGATGGAAA	1
AGAAATTGAAGTGTAAAACAGAG	2
AGAAATTGAGTCTTCTAGGATGGA	1
AGAAATTGAGTGTGTGGTGTA	3
AGAAATTGGAACGATACGACGGAA	1
AGAAATTGGAACGATGTGACGGAA	1
AGAAATTGGAACGATGTGATGGA	2
AGAAATTGGTGTTCCATCTACGAG	1
AGAAATTTAGGTGTTACATTTGAC	1
AGAAATTTTAAAGTCCTACTCGGT	1
AGAAATTTTGGTGGGATAAGGA	1
AGAAATTTTTTGGGTGTCACATCG	1
AGAACAAAAGTGCCGCACCGAAGT	2
AGAACAAATTGAAGGAGGTGCACC	3
AGAACAAATTGAAGGGGGTGCACC	1
AGAACAACCCTCTTCAAGAGTGAC	1
AGAACAAGACTAACATGCACGTGC	1
AGAACAAGATTGTGCTTACCAAGG	5
AGAACAAGGATAACAAGGTGATGG	1
AGAACAAGTCTAGAACGTCGTGCA	1
AGAACAAGTGGCTGATAGATGGGA	1
AGAACAAGTTATCTACGATGG	1
AGAACAATGACTATGAGTGCAGGC	1
AGAACAATGGTTACTGATATGGTA	2
AGAACAATTAGCTCATAAGGAC	1
AGAACAATTGATGAAGTCGTCGGT	1
AGAACACAGCTAGGCCTACGACAA	1
AGAACACCATCAACGATCAACAGC	1
AGAACACGCTAGGTCTGCCACCAC	1
AGAACACTGCAGGTGCCGCCAAGC	1
AGAACAGAGGTAGAGGTTGTTGGT	2
AGAACAGATTGTTCGATTGGGCTT	1
AGAACAGGATCTACGTAGTACGAC	1
AGAACAGGGTGTTGCATTTTTTA	2
AGAACAGGTCTGGGAGGAATTCCA	3
AGAACAGTCAGATGTCTGCCT	2
AGAACAGTCAGTTGTCTGCCT	1
AGAACAGTGAAATGGGCTTTACGG	1
AGAACAGTGCGTTCCGAGGTGTGA	1
AGAACAGTTGGATGCCGACAAAAC	4
AGAACATAACAAATCCACTGCC	1
AGAACATAGATGGAAAAAGGTGAC	1
AGAACATGAATAGAAATCAGGTTC	3
AGAACATGCTAAAGCCAGTGACAA	1
AGAACATGGGATAAATCGCGTT	1
AGAACATGGTGAACCGGTCCTATA	1
AGAACATGGTGAACCTCGCAAG	1
AGAACATGGTTGGGCAGATGGATA	1
AGAACATGTGCTTTATTAATCTCA	1
AGAACATTCGATGTGATAGGTGTC	1
AGAACATTCTTTCGCTAAGTGCTA	1
AGAACATTTCAGATACGGTAGAGC	1
AGAACCACCACCACCACTTTATAA	1
AGAACCACGGTAGGGGAAACCCCC	1
AGAACCACTTAACTGGTCCGCCTA	2
AGAACCAGACAGGGCCTAGAAACT	1
AGAACCAGACCGTGTCGTCCACCA	1
AGAACCAGAGGTGCAAATTGTGGC	3
AGAACCATGCCACCGCAATGGTAC	1
AGAACCCAAAACCATGGCTGC	1
AGAACCCAGCTGCTAGATGGTGTA	24
AGAACCCGCATACGAAAAGAGAGG	1
AGAACCGCACAACACGACGCATCC	1
AGAACCGCTCCGGTTTCGATGTCC	1
AGAACCGGGACTAAGAATATCTTT	1
AGAACCGGGACTACTGATAAGC	1
AGAACCGGTACCTATAACATATTA	1
AGAACCGGTTGAGGACAAGGAGAC	1
AGAACCGTGGGTGTGTAGAGCTCG	1
AGAACCTAAGATTGGATGGGACAG	1
AGAACCTACAACCTGTGGTATGAC	1
AGAACCTACAAGGACTAAGGTGAG	1
AGAACCTACAAGGACTGAGGTGAG	3
AGAACCTAGAGTGCACCGTGGGAA	1
AGAACCTAGGACCGGATGGGATAT	1
AGAACCTAGGGTGTGGCTAATTGG	1
AGAACCTAGTATAGGATGGGACA	1
AGAACCTAGTATAGGATGGGACAC	2
AGAACCTATCGGTGAAGGGTGGGA	1
AGAACCTCATGGGTGATGGCTCCC	1
AGAACCTTACGGCCTGTTTGGCAA	1
AGAACCTTCGAACCCGGCGCGTGA	1
AGAACCTTTAGGTGGCGGGCACAC	1
AGAACGAAAAGAAGAGAGATGCCA	1
AGAACGAAAATCGGACTGAGTGAC	1
AGAACGAAAGGTTGTGGCCTATGC	1
AGAACGAAAGTGTAAATGGGTCCA	1
AGAACGAAAGTGTAAGCAGGGTAC	4
AGAACGAAAGTTGGGGGCTCGAAGA	1
AGAACGAAATAGAAGAGGGTGTCT	7
AGAACGAACGGTCAAACGTTGCAC	1
AGAACGACAAGTTTGCCTGATATG	1
AGAACGACACTATTAGGGACGCCA	1
AGAACGACTTACATTGTGAAACGG	2
AGAACGAGAATTTGCTGATGGGCA	1
AGAACGAGATCGCCGTGGAGGAAC	1
AGAACGAGTAAGTAGCCACTTCGG	1
AGAACGAGTACAGTTAGTGATGC	1
AGAACGATATGATGGAAAAGTTGA	1
AGAACGATATGATGGAAAAGTTGG	1
AGAACGATCAAGGATGCCGGGTGAC	1
AGAACGATCGAGGCTGAAACTGAA	2
AGAACGATGACGGAATGCGATGAG	6
AGAACGATGAGGGATTGTGATGGA	1
AGAACGATGGCCTGAATTTGTCTG	1
AGAACGATGTGACAGAAAAGTTG	1
AGAACGATGTGATGGAAAAGTTA	2
AGAACGATGTGATGGAAAAGTTGG	1
AGAACGATGTGATGGGAAAAGTT	1
AGAACGATTGATGATCTTGATGCT	2
AGAACGATTTGATGGAAAAGTTAA	1
AGAACGCACTGTTTAACCGTCTGA	2
AGAACGCAGCCTAAGGTGGTGTTT	1
AGAACGCCAGTGGCAGTCGCGGGA	1
AGAACGCGGGACGGCATGGGTGTA	1
AGAACGCGGTTGCAGCAATCACCC	1
AGAACGCTACTATGCTGGGTGTCA	1
AGAACGCTTGTGGTGACTTTATCA	2
AGAACGGAGGGAGTACGATGGTAC	1
AGAACGGCTCATAGGTGTCGGTTC	1
AGAACGGGACCTTACTATCTTACC	1
AGAACGGTGAGAGTGTAACTAGCT	2
AGAACGGTGCAGTAGTGAGGACTG	1
AGAACGGTTGTTTTGTCTGATTGT	1
AGAACGTACACACCTCTTTTGGTA	1
AGAACGTCATGGATAGTTGGTGTC	2
AGAACGTGCCTCTTGTTGAGCTGA	1
AGAACGTGCTGGTGAACAGGGTCC	1
AGAACGTGGGGGCCATCGTCAAAG	1
AGAACGTGGTGCCTTCTTTTCGAGC	2
AGAACGTGTATGTCTAGATTTATA	1
AGAACGTGTTGTCGCAAGTGC	10
AGAACTAAACCAGGCCTATGTAGA	1
AGAACTAAACGCCTACAATCGCAT	1
AGAACTAGAACTAGGATGTGTCAC	1
AGAACTAGAAGATGAGATGGCTC	1
AGAACTAGATATATGGTGTCCCC	1
AGAACTAGATGGGACATCACCTAG	1
AGAACTAGGTGGTTGGTAGGTGGA	1
AGAACTAGTGATGCTTGCAATGCG	1
AGAACTATAGAAAGCTTAGGTTCA	2
AGAACTATAGTTGCACTATAAAA	1
AGAACTATGATTTGGGCGTGCAAG	1
AGAACTCCACTTCGATGGTTCCTG	1
AGAACTCTACGGCCCGTCAGAGAT	1
AGAACTGAATGAGACATGTCTAGT	1
AGAACTGACGTGGGTGTAGAGTGT	1
AGAACTGATATCGTCTACTAATCC	1
AGAACTGCCTTAAGGAAGTCGATGC	1
AGAACTGCTAAACGCTACACCGTA	1
AGAACTGGAGCCAATGGAATTGAG	1
AGAACTGGCACCAATAAAATTGAG	1
AGAACTGGCGAACAGATGAGGATG	1
AGAACTGGTAGTCGACGGGATGTA	1
AGAACTGTGATGGAACATAACCTA	1
AGAACTGTGCAGCCGGGATGGTT	1
AGAACTGTTAAAACCGGTGCAAAG	1
AGAACTTAAGTATAAGGTGCACCC	1
AGAACTTACTAAGCCTAAGGGAA	1
AGAACTTGAAGTTGTACTAGGTGT	1
AGAACTTGAATTCGGGTGGACTA	1
AGAACTTGATGCCATGACTAGATG	1
AGAACTTGCCTAGTGAAACACTTC	1
AGAACTTGGGAAGTGCATAGGATA	1
AGAACTTGGTGCTATAGCTGTTGC	5
AGAACTTTGATGTTAAGTGTGCTT	1
AGAACTTTTTTAACCATGGGTCGC	1
AGAAGAAAATTGCAGCCAACCTTA	3
AGAAGAAACAATGAGTTGCCC	1
AGAAGAAACGGCTCCGCAAGATGG	1
AGAAGAAAGCCTCGACAATTACAGC	1
AGAAGAAAGTCTAGATTAGTGCC	1
AGAAGAAATTCAGTATGGAGCTAC	1
AGAAGAAATTGTAAATGTGCTGAG	1
AGAAGAAATTGTGAACGTGTTAAG	2
AGAAGAAATTGTGAGTGCATTGGA	2
AGAAGAACAATTTCACGGAGGAAC	1
AGAAGAACCCCCTTCAAGAGTGAC	1
AGAAGAACGATGGGTTGTTGTGCC	1
AGAAGAAGAGAGGGAGGGGCATGC	2
AGAAGAAGAGCTAGCCACCGTGAA	1
AGAAGAAGAGGTGCGTGTTGTTTA	1
AGAAGAAGCAGAACTCTAGGGTGT	1
AGAAGAAGCCGTATCTGACTGGT	1
AGAAGAAGCCGTATGCAAAAGTGA	1
AGAAGAAGGATTCCTGCATTAGAT	2
AGAAGAAGGTGTCTTATTTTAAGG	1
AGAAGAAGGTTGGGTGCAAAGGA	1
AGAAGAATGCCTGGTACGCCGAAC	1
AGAAGAATGCCTGGTACGCCTAAC	1
AGAAGAATGGTTAGCATTGGTTGA	1
AGAAGAATTTTGCCACAACTGTGA	1
AGAAGACAAAGATTATACTGGTTC	2
AGAAGACAAATGAGGTAGCGCGA	1
AGAAGACAACATGTGTTGATCGAT	1
AGAAGACACGTAAAATAAGATGAGC	2
AGAAGACCAAAATGACTACTCCTA	1
AGAAGACCACCGATTGGACTGCTT	1
AGAAGACCGCTATTGAGTGGAGTA	1
AGAAGACCTGTAGGGATGGGGCAG	1
AGAAGACGACACCTGGGTGCATGA	1
AGAAGACGATGCCTAGTACAACGA	1
AGAAGACGTATGGAATGTCAGGCC	1
AGAAGACTGCCAAGGAGGTCTGGGA	1
AGAAGACTTGCCACGTCGTGCCAA	2
AGAAGAGAATTCCTGCTAAGGTGA	1
AGAAGAGAGAAAACCAGGCGCCA	1
AGAAGAGAGAGAGTACAGCCT	32
AGAAGAGAGCAGCGTCGGGGTAGA	1
AGAAGAGATAAGCCATGGTGTAGG	2
AGAAGAGATAGTGCATTCTCTCTT	1
AGAAGAGCCAGACGGTAATGGACC	1
AGAAGAGCGTGGAACGCTGGTGGG	1
AGAAGAGGACGGCAACAACGATGT	1
AGAAGAGGAGGAGCAGGAGCAGGA	1
AGAAGAGGAGGTCACCAGTGGTCC	1
AGAAGAGGCCGACAACACTAGGGA	1
AGAAGAGGGATAGCTAGGGTGCAC	1
AGAAGAGGGGAAACACACGTGCGC	2
AGAAGAGGGTGTACATACATCTAG	1
AGAAGAGGGTTTCTAGAGTAAGGG	2
AGAAGAGGTGCTTAGTCGGTTAGTC	1
AGAAGAGGTGGATGAAATTGAA	1
AGAAGAGGTGGCTATAATTTTATA	1
AGAAGAGGTGTTATCGTTACCGAG	2
AGAAGAGGTGTTATCGTTGCTGAG	2
AGAAGAGGTTAGGTGTTACAAGG	1
AGAAGAGGTTCTGCGCTCAGTGGA	1
AGAAGAGTACGTATATTGAGAAGC	1
AGAAGAGTGAATGCTAAGGTGGA	2
AGAAGAGTGAATGCTAAGGTGGATG	1
AGAAGAGTGGTATCTCGATAGTGC	1
AGAAGAGTGGTATCTCGATAGTGCC	2
AGAAGAGTGGTCAAATAGGATAAA	1
AGAAGAGTGTGCTTTTGATAAGGA	1
AGAAGATAACTTTTCGCTGGTGGC	1
AGAAGATAAGGTGCATATCTCGCC	4
AGAAGATACGCAAAACGAGATGAG	1
AGAAGATACGCAAAACGAGGTGAA	1
AGAAGATACGCAAAACGAGGTGAG	9
AGAAGATACGCAAAACGAGGTGAGC	1
AGAAGATACGCGTTCTTTGGGTGT	4
AGAAGATACGTAAAACGAGGTGAG	4
AGAAGATACGTAAAACGAGGTGAT	2
AGAAGATACGTAAAATGAGGTGAG	1
AGAAGATACGTGTTCTTTGGGTGT	1
AGAAGATAGAAAATGTGACGGTAGC	1
AGAAGATAGGGCCTTGTTTGGATC	1
AGAAGATAGTGTGCCCTTTAGGAC	1
AGAAGATATAGGGCATGTTTAGA	1
AGAAGATATATGTTCTTTAGGTGT	1
AGAAGATCGATAGATAGATGGTAC	2
AGAAGATCGGGCCACGAGAGATAG	1
AGAAGATCGGGCCATAAGAGAGAG	1
AGAAGATGACAAACGTGTGATGA	1
AGAAGATGACATACACGAAACGAG	1
AGAAGATGAGGGTGGACACACAGT	1
AGAAGATGATGACATAAAGGGTAGC	1
AGAAGATGCATGCTACAAGAAGAG	1
AGAAGATGCCAAAATGGATCTGGT	1
AGAAGATGCCAAGGGAAGATTCCC	1
AGAAGATGCCATTTATATGAAACA	1
AGAAGATGCGTAAAATGAGGTGAG	4
AGAAGATGCTTATAGAGATAGGG	1
AGAAGATGGTAGGGTGCTGAACAC	1
AGAAGATGGTATAATATTTTGGGT	1
AGAAGATGGTCCTATAAAATGTCC	1
AGAAGATGGTGTCTGTATAGCTGC	4
AGAAGATGGTTGTGAGCTTGG	1
AGAAGATGTCGAACGAGGTGAACC	1
AGAAGATGTCTTAGGTGGAGTCCT	1
AGAAGATGTGAGGCTTCGAACTCA	1
AGAAGATGTGTCTTGCTTGTGTG	1
AGAAGATGTTTGGGACAGAGGGAC	1
AGAAGATTAATCTGAGTGCTAGCT	2
AGAAGATTGATAGCGGGGTGCTTA	1
AGAAGATTGCCGGTTGACTTGTA	2
AGAAGATTGGGAGTATACGTAAA	1
AGAAGATTGGGCCACGAGAGAGAG	2
AGAAGATTTGAACTAAGGACCTTG	1
AGAAGCAAATGCCACAACATGAGA	1
AGAAGCAACCGGTGGTGTCTCGCTC	1
AGAAGCAAGAGAATCATGTGTGGC	1
AGAAGCAATGCCTGCTAACAACCA	2
AGAAGCAGATGGCGCCAAATATAG	1
AGAAGCAGTTGCAGCCTCACGGTC	1
AGAAGCATAGACTGTCGCAGGGCC	1
AGAAGCCAAGGTTAGTTAGGGCCT	1
AGAAGCCACTGCAGCCACTTGGGG	1
AGAAGCCAGAAGTTGGAGAAACTG	1
AGAAGCCAGATCGACTTGTGTTGC	1
AGAAGCCAGGAACTCACCCCTCAG	1
AGAAGCCATAAGCTGGAGAAGCTG	2
AGAAGCCATGTGTACTCTCTGGCT	1
AGAAGCCCCAGATGATAGCCAAGC	1
AGAAGCCGCAAAGGTTGGTGGCAGG	1
AGAAGCCGCTCAGTGTTCACCAC	2
AGAAGCCGCTGGGTTGACCCCGAG	1
AGAAGCCGGATCGATTTGTGTCGC	2
AGAAGCCGGATTGATTTGTGTCGC	1
AGAAGCCTACATACGTCAAGACAC	1
AGAAGCGACCCCACAGGCTTGTGC	1
AGAAGCGACGTCGTGATGTGCACC	1
AGAAGCGCAAACTGGGGACACGAC	1
AGAAGCGCAATACCCTACTCCTG	1
AGAAGCGCAGCATTGATAGTCACT	1
AGAAGCGGATGGCACGATTACAGC	1
AGAAGCGTGCCCTGTTTGTAAAGC	1
AGAAGCTAAGGACCGGTGAATTGT	1
AGAAGCTAATGTGGATGGTGAAAA	1
AGAAGCTAGCTGGTGGAAAAACTG	1
AGAAGCTAGTGAAGCTATGGGTCC	1
AGAAGCTAGTGAGATTAGTACGTG	1
AGAAGCTATAGACTGTTTGGGGCA	2
AGAAGCTATATTGGTTGGGGAGGA	1
AGAAGCTGACCTTTATTATGTGCA	1
AGAAGCTGACTGGATGCATGGCGG	1
AGAAGCTGAGGCCTGATGGTACCA	1
AGAAGCTGGCTACCAAACAGCTGC	3
AGAAGCTGGTCTGCGTGGAGCGAA	1
AGAAGCTGTGAATTGTTTGGGGCA	1
AGAAGCTGTGGACTGTTTGGGGCA	1
AGAAGCTGTGGACTGTTTGGGGGA	1
AGAAGCTGTGGATTGTTTGAGGTA	1
AGAAGCTTACAATGGAGTATGTTG	4
AGAAGCTTAGAGATGGTATCGC	3
AGAAGCTTAGGCCTGACGGTACTA	1
AGAAGCTTATAAAACTATGGCGGC	1
AGAAGCTTTTTGAAAAGGACCTA	1
AGAAGGAAAACGTGACAGAGATGG	1
AGAAGGAAAAGACCGAGCTACACC	1
AGAAGGAAACCTAGCGACAAGTGA	1
AGAAGGAAAGAGAAATATGGTTGC	1
AGAAGGAACAAAGTCTATCGTGCT	2
AGAAGGAACCTGATTGACGAATGG	1
AGAAGGAAGCCGGCTGGACCTTGC	1
AGAAGGAAGGAGGGGTTAAGGCCA	1
AGAAGGAAGGTGTCCCCGTGTGGG	1
AGAAGGAATGGTAATCTTGTGTGC	1
AGAAGGAATTAGGTGAACTTTCA	2
AGAAGGAATTTTGAGGCCTATGAG	1
AGAAGGACACGACTACAAAGCGAC	1
AGAAGGACATGGGTGTGGTCA	2
AGAAGGACCTGTAGAGGGCAAGACC	1
AGAAGGAGGCTAACTAGTGGGTCC	1
AGAAGGATCTGCCCACCCGGTGAC	1
AGAAGGATGCCTCACTGATGAC	1
AGAAGGATGCCTCACTGATGACGA	1
AGAAGGATGCCTCACTGATGACGG	2
AGAAGGATGCGTTACATTGAGAAC	1
AGAAGGATGTGATATGGATGAC	1
AGAAGGCATTAGCCTGGGTTCTA	1
AGAAGGCATTAGCCTGGGTTCTAC	2
AGAAGGCCGTCAGAGGTGTTGGTC	1
AGAAGGCGCTATACCTGGTATTGC	1
AGAAGGCTGAATGCTAAGGTGGA	2
AGAAGGCTGAATGCTGAGGTGGA	5
AGAAGGCTGAATGCTGAGGTGGAT	1
AGAAGGCTGAATTCTGAGGTGGA	3
AGAAGGCTTACGAATTGAGTGGTA	1
AGAAGGGAGCTTGACTGCAAGACT	1
AGAAGGGATTAGGTGAACTTTCAA	1
AGAAGGGATTGAGGAGACTGAGA	2
AGAAGGGATTGAGGAGATTGGG	1
AGAAGGGCCGGTGTCAGGCGATACC	1
AGAAGGGGATCATTGCCCCAACCTG	7
AGAAGGGGATCGAGGAGATTGGGA	1
AGAAGGGGCCAAATGAGATCGACA	1
AGAAGGGGCGTACAAATTGATCAG	1
AGAAGGGGTATATAAAGTTGTGCA	1
AGAAGGGGTCCTACTAGATTGG	1
AGAAGGGGTCCTACTAGATTGGCT	1
AGAAGGGGTGAAGCTGGAGCTGGA	1
AGAAGGGGTGAGGCTTTAAACCTA	1
AGAAGGGGTGAGGCTTTGAATCCA	1
AGAAGGGGTGAGGTTTCAAACCTA	1
AGAAGGGGTGAGGTTTCGAATCCA	1
AGAAGGGGTGATGCTTCAAATCCA	1
AGAAGGGGTTGACCTGTTTGTGTG	2
AGAAGGGTAGTAACATCATATGTT	2
AGAAGGGTATTTTCTACCCAGCCT	1
AGAAGGGTCCTGTGTCAACTGA	1
AGAAGGGTGCATGTGGTATCCCCT	1
AGAAGGGTGCTAAGGATGCAAGA	1
AGAAGGGTGTAAGTATGCGCATTT	1
AGAAGGGTGTAGCTATATTTATGG	1
AGAAGGGTGTAGCTGTATCTATGG	2
AGAAGGGTGTTCAGACGTTATACT	1
AGAAGGTAATTCAGCCAACCGTGA	1
AGAAGGTACAGTAGCAAGCTAA	2
AGAAGGTACCAGGTTTGATCC	1
AGAAGGTAGGAATGTTGTGGG	1
AGAAGGTAGGTGCTATCATTTCGT	1
AGAAGGTATCTGCACTTTTGATGG	1
AGAAGGTCATTCGGACGGCAACCA	1
AGAAGGTCCTGTGCTGCTAGTA	1
AGAAGGTCTTGATTTGGTCACCAA	1
AGAAGGTGAAGGACTGGGTGCTAG	2
AGAAGGTGACTAGAGTCAGGATTC	1
AGAAGGTGACTAGATGAGTAGCTT	1
AGAAGGTGACTCGGACGACAACGA	1
AGAAGGTGAGTATACACGTATGTA	1
AGAAGGTGAGTTATGGTGAAGCAA	1
AGAAGGTGATGTTGTTCTTGACGG	1
AGAAGGTGATTGATATATTGATTC	1
AGAAGGTGCAATAGACGTTCT	1
AGAAGGTGCAATGTTGTAAAAACG	1
AGAAGGTGCTATACAAATTAGGAC	1
AGAAGGTGGAGCCCTGTTGCGGGT	1
AGAAGGTGGATTGATATTTTGGA	1
AGAAGGTGGATTGATATTTTGGAG	4
AGAAGGTGGCTGCTGATGGTGATG	1
AGAAGGTGGTACGTCAAGGTGATC	1
AGAAGGTGTATAATGGAGGGGTAC	1
AGAAGGTGTATGGTGCAATTCGC	1
AGAAGGTGTATTAACATGTGATAT	1
AGAAGGTGTCGAATGTTCCACGA	1
AGAAGGTGTCTGCGCATGTGCGTG	1
AGAAGGTGTCTTATTTTAAGGAG	3
AGAAGGTGTGAGACTTCGAATCCA	2
AGAAGGTGTGAGGATTCGAACCCA	1
AGAAGGTTAAAGCAACAAGTA	1
AGAAGGTTAACGGTGCCCAACGG	1
AGAAGGTTAATCATGTTTGTCGTT	1
AGAAGGTTAGCACCGGACCGGCCG	1
AGAAGGTTCAGGTGGGTGCTTTCTG	1
AGAAGGTTGAGATCCACGTACCGG	1
AGAAGGTTGAGATGATAACTA	1
AGAAGGTTGCGATCATTTTATGGT	1
AGAAGGTTGTGTGCACAAAATATG	1
AGAAGGTTTCTCGCATGTGAA	1
AGAAGGTTTTAGATCTGCAGTTTG	1
AGAAGTAATCGAGTGAAGGTACCT	1
AGAAGTACAGGGGCAACAACAGCA	1
AGAAGTACATAAGGGATAGAGAC	1
AGAAGTACATAAGGGTGGCCCAAA	1
AGAAGTACCAGGATTGGAATGGGA	1
AGAAGTACTACTGATGGACAAGAG	1
AGAAGTAGACAATGAACACAGATA	1
AGAAGTAGAGATGCTAGATGATGC	1
AGAAGTAGTGCGTATTGGGTGTTA	2
AGAAGTAGTTGTGCCTTATATTA	1
AGAAGTATGGCCTGGTGATTGTGT	1
AGAAGTCAAACAGTGCAAGCTAAA	1
AGAAGTCCAAGATACACAGTGCTA	3
AGAAGTCTAACACTGGTGGCCGG	1
AGAAGTCTGCCCTAGAGCGGCTT	1
AGAAGTCTTCACCCATTAAATGGT	1
AGAAGTGAAACCTACGAAAATCTT	1
AGAAGTGAAGATATGTTGAATGGT	1
AGAAGTGAATGGTGCAGGTTTGTG	1
AGAAGTGAGGATAATGCCAACGTA	3
AGAAGTGATTCCCTGCATTACGT	1
AGAAGTGATTTGAGTAGGACCTAGC	1
AGAAGTGCATGCATTAACGTTACG	1
AGAAGTGCCTCCTGTTACCAGGGA	1
AGAAGTGCCTTTTAGTCCCGGTT	1
AGAAGTGCTAATTGAGGATATTTC	1
AGAAGTGGAGGCTCCTATGGTTAC	2
AGAAGTGGTCCTCTGGTTCCTAAG	1
AGAAGTGGTGATAGTTGAAGATGA	2
AGAAGTGTAAAAGAAAATGGAT	1
AGAAGTGTAAAAGAAAATGGATTC	1
AGAAGTGTAGAACAGTTGGACAGC	1
AGAAGTGTCCAGCAGCTAATTACC	1
AGAAGTGTCTAGATAGGGAACTT	1
AGAAGTGTGATGGTATTCTCTCGA	1
AGAAGTGTGCTCAATAAAACCAAG	1
AGAAGTGTGTGAGGATGATAGTGA	1
AGAAGTGTGTGTATGACAGGTGGG	1
AGAAGTGTTCGATGGAGAATCAGC	2
AGAAGTTAATGGTGAAGAATGTC	1
AGAAGTTCGAGCAGATGTTTCTGA	1
AGAAGTTCGGGACCTGTTGATGGA	2
AGAAGTTCGGGGACCTAGATGATAC	1
AGAAGTTCTATGTGAAGTGCTTGC	1
AGAAGTTGCAACCTGTTGATATGA	1
AGAAGTTGCAACTTATTGATATGA	1
AGAAGTTGCAACTTGTTGATATGA	2
AGAAGTTGCTATATTATAAGATAA	1
AGAAGTTGGGTGATTGATAATGGA	1
AGAAGTTGTGGACTGTTTGGGGCA	1
AGAAGTTTAGAGGTGAAACATTGG	1
AGAAGTTTGTGGTGTATGAAAGTT	1
AGAATAAAAATAGGAGCATGGTCC	1
AGAATAAAATTCTTGAGCCTG	1
AGAATAAACTTGATGTCGCGAAAG	2
AGAATAAAGGTGCCGGTTCTACCA	1
AGAATAAATAGCCATAAATGCGAG	1
AGAATAAGAGGTTTGCTCTGGTCC	1
AGAATAAGCAAGGTGGTACTAAAC	1
AGAATAAGGTGGGATGTAATGGG	1
AGAATAAGTAAGGTGGTACTAAAC	2
AGAATAAGTAGCCGTAAATATGAG	1
AGAATAATGAGTACTACATTCGTC	1
AGAATAATTAGCCATAAAGATGAG	1
AGAATAATTAGCCGTAAATATGA	1
AGAATAATTAGCCGTAAATATGAG	1
AGAATAATTGAAGAAGGTGTGTGA	3
AGAATACAAATTTGATGTGCTTG	1
AGAATACAATTGATTTGTGCCGAC	5
AGAATACCGGATATACGATGATACC	1
AGAATACCGGGTGACGAAGTTTGA	1
AGAATACGGTGCATGGGTATCCC	1
AGAATACGTATCTATTGTGGGGAC	1
AGAATACGTGTATGATGGGTGGGA	1
AGAATACTAGATAGGATCGGTATC	1
AGAATACTCCCGGGTGAAGTGCTA	2
AGAATACTCTCGGGTGAAGTGCTA	2
AGAATACTGCCGAAGATGTACAGC	1
AGAATAGACCGCCGATGACCAAAC	2
AGAATAGATGTGATTAGTTGAGAG	1
AGAATAGATTATAGGGATTGTGGA	1
AGAATAGGCATAGCACATTGTGA	2
AGAATAGGCTTCTACTAGATGAGC	1
AGAATAGGGCTTAAGGGTTGGGAA	2
AGAATAGGTGGTTGGATTGAAATA	2
AGAATAGGTGGTTGTTGTGATATA	2
AGAATAGGTGTCAAATCTACTAGT	1
AGAATAGTGAACTAGCACAAGATT	1
AGAATAGTGCTCTGGGTATAAAGG	3
AGAATAGTGGTGTTTGTATTGGAA	1
AGAATAGTTTTGTTTGGGTTGATA	1
AGAATATAAACAAGGCCTCAGTTT	1
AGAATATAATAACTAGGAAGGTAG	1
AGAATATAGGATGGCTGTTGGTGA	1
AGAATATAGGTGCCGGTTCTTCAC	1
AGAATATATGGTACTTCTTCACGG	1
AGAATATGAAACAGGGTAAAGCCGC	1
AGAATATGAGCCGTTGATCGTATT	1
AGAATATGATGCCTCTTGTTAAGG	2
AGAATATGCCACATACAATACTAG	2
AGAATATGGAAAAGCTACGGTGGC	1
AGAATATGGGCCTGTTTGGTTGGT	2
AGAATATGGTGCATCGAATAGATG	1
AGAATATTAGAGGAATGGGTGCTA	1
AGAATATTCTCTATCTGGTAGCCA	1
AGAATCACAGGAACAAGGTGTTGC	1
AGAATCAGATTTGATTTTGCCTA	1
AGAATCAGCTTATGAGAATATGGA	2
AGAATCATGTGTGGCATACAACTG	1
AGAATCCATTATATAACACTGAGT	1
AGAATCCTATATTTTCCTATTCC	1
AGAATCGACGACAAATTGAGGAAC	1
AGAATCGAGTGCCTTTTCCTGCTA	1
AGAATCGGATCGAGGTGTTACTGC	1
AGAATCGGGACCTATGACTAGTAC	2
AGAATCGGGGTGGTCCAAAGTGA	1
AGAATCTAAATAAAGGCGCATACG	1
AGAATCTAGGTGAGAATTGAGAGA	1
AGAATCTCAGGTGACCGGTTTTGT	2
AGAATCTCATTGTGCGGATTATCC	1
AGAATCTCCTAGATATGGTAC	42
AGAATCTGAGGGGAAGAATGTGAA	1
AGAATCTTGATGATGCTGCAT	49
AGAATGAAATGGAGAGGGGTGCTA	1
AGAATGAAATGTGCCATAATCTAG	2
AGAATGAACTGATGTTGATGTGCT	2
AGAATGAATGGCTAGAATGTAATA	2
AGAATGACTTACATTGTAAAACGG	1
AGAATGACTTACATTGTGAAACA	4
AGAATGACTTACATTGTGAAACAG	1
AGAATGACTTACATTGTGAAACG	1
AGAATGACTTACATTGTGAAACGA	1
AGAATGACTTACATTGTGAAACGG	5
AGAATGACTTACATTGTGAAACGT	1
AGAATGACTTACATTTGAAACGGA	1
AGAATGAGATGCCAAGTGGTCACC	1
AGAATGAGATTGAAAGTCAAGTGC	1
AGAATGAGTAAGGGACAAATGGTA	1
AGAATGATATGGAGAGGGTGTCAC	1
AGAATGATGAAGTGGCTTTATACA	1
AGAATGATGGCAGAGACTGCTTGC	1
AGAATGATTGAAGAAGGTGTGTGA	3
AGAATGATTGGAGAAAGTGTGCGA	1
AGAATGATTTAGATGGTGTTTGGA	1
AGAATGCAAACTCTGGGCCTGAAC	1
AGAATGCAAATCAGACTGGGTGAC	6
AGAATGCAGGTCCTACTTTTCAAC	2
AGAATGCCACAATGGATTGGGTGA	1
AGAATGCCACATTGGATTGGGTGA	1
AGAATGCCCGTGCGTTGCAACAGG	2
AGAATGCCCTAACCAGCTGGGTAC	1
AGAATGCCTTTGTAAACTGTGCCA	1
AGAATGCGAGCCGGCAACAGTTTT	1
AGAATGCTAACTGGACTACCACGC	1
AGAATGCTAGCCGCGCAATTTACG	1
AGAATGCTGACTGGACTGCCACGC	1
AGAATGCTTAGGTGTACCAGGTGAA	2
AGAATGGAAAAAGTTTAGGATGC	2
AGAATGGATAAGGTGCTTGATAGC	1
AGAATGGCTTACATTGTGAAACAG	1
AGAATGGGAAGATACGTAAAACG	1
AGAATGGGGTTGTCTATGCGGT	1
AGAATGGGTCATACCTATGGATGA	1
AGAATGGTACCGGCACGTTTGAGG	1
AGAATGGTGAACTTATGAAGGTTG	4
AGAATGGTGCGTAGAATGTAACTG	1
AGAATGGTGGACTTAGAGATTGTA	1
AGAATGGTTGCGATTGATTGAGAG	1
AGAATGGTTGTGATTAGTTGAGA	1
AGAATGGTTTCTGCGAGTGACAAC	4
AGAATGTAATAATTTATAGGTGAT	1
AGAATGTACAGGTGCAAAGTTTGA	8
AGAATGTAGCAATCTAGGATGTGA	1
AGAATGTCCTATCCGATACTAGAT	1
AGAATGTCTTACATTACGAAACGG	1
AGAATGTGAAAGGGCCTCCACGAA	1
AGAATGTGGTAGGAATTGTCTTGC	3
AGAATGTGTAGAGCTTGTGTGCCG	1
AGAATGTGTCACATCCAATCTAGG	1
AGAATGTGTCACATGTGGTCCTA	1
AGAATGTGTCACGTTCCGATTGG	1
AGAATGTGTCACGTTCCGATTGGT	1
AGAATGTGTCACTATGGTGTATGT	2
AGAATGTGTGCATGGTGTCTTGAT	1
AGAATGTTGCGATGATTAGATGAT	1
AGAATGTTGGTAGAGAAGTTGCT	1
AGAATGTTGGTGAAGAAGTTGCTA	1
AGAATGTTGGTGGAGAAGTTGTTA	1
AGAATGTTTGTTTAGATTTGTGGT	1
AGAATTAAAAACGTTTGAGTGCA	1
AGAATTAAAACACTAACTTGGGTAC	1
AGAATTAAATGGACGATGTGGAGA	1
AGAATTAATCTTCGAATGGGCCTT	1
AGAATTAGATGGGACACTTTATAG	1
AGAATTGAAAGTGAGGGTAAGAAC	1
AGAATTGAACGTCCGAGTGCAACA	1
AGAATTGAACGTCTGAGTGCAACA	1
AGAATTGACACGATGGATTGGGCC	1
AGAATTGAGGGACGCAAAATGGAC	1
AGAATTGATGATGAGATTAAGA	1
AGAATTGCCTCCAAAAACCATACC	1
AGAATTGGAAATTCGAGGGTGTTT	1
AGAATTGGAGGCAACAGACATGG	1
AGAATTGGGACCAACTAACTGAAC	1
AGAATTGGTGACAAATAGTAG	1
AGAATTGTAAATGAGTGTCTTTGG	1
AGAATTGTAAATGGGTGTCTTTAG	6
AGAATTGTCACTTACGATTGCTGC	1
AGAATTGTGCGAGCTAGGTCTACA	1
AGAATTGTGTTATTTCTTAGCCTA	1
AGAATTGTTAGTGCTTTCTAGGT	1
AGAATTTAGCCACAAGATGGCCCA	3
AGAATTTAGGTGACAAACTATATT	1
AGAATTTAGGTGACAATCTGAACT	1
AGAATTTAGTAGGGTGAAGGGCA	1
AGAATTTCAAAAGCTCAACCTGG	1
AGAATTTCCAAGCTGAATGTGCA	1
AGAATTTCTAAAAAGGGTGTATGC	2
AGAATTTCTCGGCCATGAGAGCGA	1
AGAATTTGAGGGGCAGCGGTTCGG	1
AGAATTTGATTCCAGGTGGTATGG	1
AGAATTTGCATAGTGCTAATAAGG	1
AGAATTTGCTGACGTGTTTAAAAC	3
AGAATTTGGAAGAGTTGGGCGCCT	1
AGAATTTGGGGCCTGTTCAGATTG	1
AGAATTTTAGGAGCTACCGAATAG	1
AGAATTTTCAGTTACTAAGGTGGT	1
AGAATTTTGGTAGGATGGGATGG	1
AGAATTTTGGTGAGATGGGGATGG	1
AGAATTTTGGTGGAATGGAGATGG	1
AGAATTTTGGTGGGATGAGCAT	1
AGACAAAAAGAAACGGGTGAGTGA	1
AGACAAAAATACTGTCGAGGGACC	1
AGACAAAAATGAAGCCGAGCGGA	1
AGACAAAACTATATCATGGGTGT	1
AGACAAAAGCCTAAGTTATTTTAC	1
AGACAAAATAGCAAAGGTCAAGC	1
AGACAAAATAGTTCTGATAGTAGC	1
AGACAAAATCATCACGGGTGTCT	1
AGACAAACAGTTGTCTAGATTGGA	1
AGACAAACCATGATTTTCGTGTCC	1
AGACAAACCCTGGATTTACGTGTC	2
AGACAAACCCTGGGTTTCTATATC	1
AGACAAACCCTGGTTTCCGTGCCC	1
AGACAAACCCTGGTTTCCGTGTCC	1
AGACAAACGGTCAAACATGTGCTA	2
AGACAAACGGTTAAACATGTGCTA	2
AGACAAACGGTTAAAGATGTGCTA	8
AGACAAACTCTGGGTTTATGTGTC	1
AGACAAACTGTCAACCATGTGCTA	2
AGACAAAGCGGTGCCTCACTCTCC	2
AGACAAAGCTTGCCAGATTGC	1
AGACAAAGGATTTATACAGGT	2
AGACAAAGGCCTGTTTGACAGAAG	1
AGACAAAGTAATACGGTGCTTAAA	1
AGACAAATAGAACAGGCGTGTCCC	1
AGACAAATCCGGCGTCAATACTGC	1
AGACAAATCTTTTAAGCCTAATTG	1
AGACAAATGATGGACTGAAGTCAC	3
AGACAAATGGTCAAACATGTGATA	2
AGACAAATGGTCAAACATGTGCTA	1
AGACAAATGGTGAAACGTTATGC	1
AGACAACACTATAGGTGCTTGAAC	1
AGACAACAGGTAAATACATGTAGG	1
AGACAACATGGTCCGCTTGATTGG	1
AGACAACCGCAGTTTGATAGGTAC	1
AGACAACCGTAAGAGTTCAAGTGT	1
AGACAACCTAATATACTACAATGA	1
AGACAACCTAGGAAGAGATGTGGC	2
AGACAACGATGTGATATAACTTAGG	1
AGACAACGCCGATGATGGAGGTGG	2
AGACAACGGTCAAATATGTGCTA	1
AGACAACGGTGACCTCATCTCTGT	1
AGACAACGGTGTGCAGGTGGGCCA	1
AGACAAGAAAGACGCTAAGGATGG	1
AGACAAGAGCTTGTTTGCCGCATC	1
AGACAAGCCAATGCAACATCTAGC	1
AGACAAGCCATGATGATATGATTC	3
AGACAAGCTTGGAGGATGTCGGT	1
AGACAAGGAGAAGCCAATGTAGCC	1
AGACAAGGGCAAGGGCAAGGTGAA	1
AGACAAGGTACTGTGCTAGAAATA	2
AGACAAGGTGTATCTCAGTCAAGC	1
AGACAAGGTTTGACTAAAAGATGG	3
AGACAAGTGGCCAAACGTTGTAAG	2
AGACAAGTGGTCAAACGTTACAAG	1
AGACAAGTGGTCAAACGTTGTAAG	1
AGACAAGTGGTCAAATATTGCAAG	1
AGACAAGTTAAGGTGACAAGGAGC	1
AGACAAGTTTTGGGTGGATTTGAA	2
AGACAATAACATGGCCTACCAAAT	1
AGACAATATTGTAGGTGTTTTCGC	1
AGACAATCTAGGATGGATGTGACC	1
AGACAATGCTCTAATTCAGGCTGT	2
AGACAATGGAGCATCCAAGGGTGT	1
AGACAATGGTGTGGATCTTGATGG	1
AGACAATGTGCTAGTTCCGTGGGA	2
AGACAATTAGATGTTCAGAATGC	1
AGACAATTAGTAGGGTAAGGGTTC	1
AGACAATTCAAATGTGCATGGGTC	4
AGACAATTTTTGGAGCTACTGCCT	1
AGACACAAATGTTTAGGGTGTGAC	1
AGACACAAGATACATGGATGCCT	1
AGACACAAGATACATGGATGCCTG	1
AGACACAATGTATGACAGGTGGAC	1
AGACACACGATTGGTAGATGAGCC	1
AGACACAGGATGTAGGGGTGAGAC	1
AGACACAGTGCTTATATTTTGGGA	3
AGACACAGTGTGTATGATAGGTGG	2
AGACACAGTGTGTATGGCAGATGA	1
AGACACATAAACTCATGGCTATGC	1
AGACACATAGATGCTTGCATGTGA	1
AGACACATCTTTGTACTAGGTTGC	2
AGACACATGCATTGTGAGGTGTGG	1
AGACACATGGCAGGTGTTTACGGG	1
AGACACATGTTGAATTGGATGCCG	1
AGACACATTCTAGTACTATGATGT	1
AGACACCACCTGGTACTACGAATG	1
AGACACCACGAAAACGTTATACGG	1
AGACACCATCGTCGTGTGGGATGC	1
AGACACCGACGCTGTGATGATGGT	2
AGACACCGTAAGGACTAGCCGTGC	1
AGACACCTCACTGTCGACGGGTAC	1
AGACACCTCAGCGCCAAATAGTA	1
AGACACCTGGGTGTAGACGGGCGC	1
AGACACGAAAATCCAGGTTTGCCT	1
AGACACGAATTTCCACGGCTGCAC	1
AGACACGCAAGGAGATGATGGCGG	1
AGACACGGAAACCTAAAAATTAAG	1
AGACACGGCGACGTATACAGGTTC	1
AGACACGGCTGATGGACACTACAA	1
AGACACTAATTATGGACACTATGG	1
AGACACTACTATTTCAATACAAAC	1
AGACACTACTCTTTCAATGCTAAC	1
AGACACTACTGATTGTTTGGCTTC	1
AGACACTCACAACACACACACTCA	2
AGACACTCACAACGCATGCGCACT	1
AGACACTCTGGTTGAGGATGGTAT	1
AGACACTGGGAGAAGGCCAGCTGC	1
AGACACTTCGCTGTCGACGGGTAC	2
AGACACTTGGGTGTAGGTGGGCCA	1
AGACAGAGTGTGCCATTGCTTCGC	1
AGACAGATGGTCAAAACGTTGAGC	1
AGACAGATTTATAGTAGGGTGTGT	2
AGACAGGAGTCTATACAGATTCGT	1
AGACAGGATTTGGATATCTGT	2
AGACAGGCTAGCTCACCACCTTGT	1
AGACAGGGGACTTACGTGTTGA	1
AGACAGGTAGTAGAGCAGCACAGA	1
AGACAGGTGTCACCCAATGACTGT	1
AGACAGGTTCATGCCCTCTCGATGA	2
AGACAGGTTCGTCGGGGGTTATGC	1
AGACAGTAGTGTCTATAGTGACAG	1
AGACAGTATGGTCCTGATAGTAGC	3
AGACAGTCTGCACAATGGTGTACC	1
AGACATAAAGTTTAGGGGTGAGAC	1
AGACATAACATACTGTTTGGGTTG	1
AGACATAATTTGTTTCTGGTGTT	1
AGACATACAGTGCTTGCCACAAG	1
AGACATACGGTCAAAGTTAGGCGC	1
AGACATACTATTAAGGTGGTTTAC	3
AGACATACTATTGAGATGGTTTAC	2
AGACATACTATTGAGGTGGTTTAC	1
AGACATAGATAAAAGGCCTGTTTG	1
AGACATAGTGTGTGTATGATAGG	1
AGACATATAAGGGCTCACATGCCA	1
AGACATATATGTACGGAGGTAG	2
AGACATATGGTGTCCTATCCCCAC	3
AGACATATTGAACAAAGGTAGCCA	1
AGACATATTGGGTGTATGATAGGT	1
AGACATCAATCGGGAAGGGGCGCC	2
AGACATCAGGTGAAAGTATGTTGC	1
AGACATCCTAATAAAACAAAATGC	1
AGACATCGGTTTAAAGGTAGCAAG	3
AGACATCGTGGGTGTGGGTATGGG	1
AGACATGAATGCCTCTCTAACGGA	1
AGACATGACTACACAGCTAGTGGT	1
AGACATGATATGTGATGGGTCCTG	1
AGACATGCCTAAGGTGGAGTCTAA	2
AGACATGCTAGGTGACGACATAGG	1
AGACATGGCAATGAGCAGTCGTGC	1
AGACATGGCCTAATAGATTGAATG	2
AGACATGGTGGACGACGAGACAAC	1
AGACATGGTGTCTGCTGATGGCGA	1
AGACATGGTGTGCCTTTAAAGGTA	1
AGACATGGTGTTACTGCACGATGA	2
AGACATGGTGTTGTGATTGCAGGG	1
AGACATGGTTTCCTTCTCTTTCCT	1
AGACATGTGCGTTTGATGTGACCC	1
AGACATGTGGAAGTACGGTAGTGC	1
AGACATGTGGGTGAGCAACATCCA	1
AGACATGTGTGTGATGATCAA	1
AGACATGTGTTGGTCTGTGAGGGC	1
AGACATGTTAGATGGGTATAAAAC	1
AGACATGTTTTTCAAGGGACGGAA	1
AGACATTACGTACAAACCAACAAA	1
AGACATTACGTCGCCTACCACTGA	1
AGACATTGTGTGCGTAAAAGGTAG	1
AGACATTTCTGGTTTTGTGGTTAA	1
AGACCAAAAGTGGAGCCAGTAGG	1
AGACCAAAAGTGGAGCCAGTAGTA	1
AGACCAAAATACGGCGACGCAGCA	1
AGACCAAAATTTTCAGTCTGAGCGA	1
AGACCAAATAGAGATTGTGCCAGC	1
AGACCAAATCGGAAAGCATGTGAC	1
AGACCAAATGTTGATGAGATGCGG	1
AGACCAACCCGCCAAGTTGGAGAA	1
AGACCAACCTAGTACCGGATGTGA	1
AGACCAAGAGGTGCTAGTTAATGT	1
AGACCAAGTCAAATTAGCCATGA	1
AGACCAATCCTACCTACGAACCGG	3
AGACCAATGATATTTCCGTGCACA	1
AGACCACAATCTTTGAGTGTCCTG	1
AGACCACACAGGTGTTGGGCA	5
AGACCAGAATTGAAATGAAGTGAC	2
AGACCAGCCTGATACCTGGGGTAG	1
AGACCAGCTTATGATGCTAGGG	1
AGACCAGGACCTTGAGTGAGCTGC	1
AGACCAGGGCAGATAAAGGTAGCA	1
AGACCAGGGCATATGATAGGTACT	1
AGACCAGGTACACAGAGACGGTCC	1
AGACCAGGTCAACACGGCTACGTA	2
AGACCAGGTGTCGGTTTCTAGTGA	1
AGACCAGTGGGCTACGGATTTATA	1
AGACCATAGTGATTACTACTGAA	1
AGACCATATAAGATTGTATTGTGA	2
AGACCATATATGTGAACAGTGCTA	1
AGACCATGATGGGTGTTTCTAAGG	3
AGACCATGCTTTGGTTGTGCTAGG	1
AGACCATGTCGCTGTCCAAAACTA	1
AGACCCATTTTGGGTTTGGGTGCT	1
AGACCCCACCATATCTGATGTCTA	1
AGACCCCACCGGGCGCCTTTGAAG	1
AGACCCCAGTAGGTTGCAGGTGAT	1
AGACCCGAACAAGGGAGAAGCTGC	1
AGACCCGAGAACATAGCGGGCAGC	1
AGACCCGAGCGATTTGAGGATGGA	1
AGACCCGATACCCTCAGGCCCAGA	2
AGACCCGCAAGGGAACACTGGTTC	1
AGACCCGGTCAATACCGCCACGTA	1
AGACCCGTGAGCGTTTCTCTATCA	1
AGACCCTACACGATACATTGACGA	3
AGACCCTAGTTGTTGATGCCGGAA	3
AGACCCTGCCACGGTGACCGTTGA	1
AGACCCTGCCGTTCAAGTAGAGGG	1
AGACCGAAAACGTGGGTGCGATCA	1
AGACCGAACCGAAAAGACCGAGA	1
AGACCGAAGTGCCATTGTTGGTTT	3
AGACCGACCAAAGATGGTTCCT	1
AGACCGAGACCGAATTTGTTGGTC	1
AGACCGAGCTGAGCAATACTAGGA	1
AGACCGAGTTGCCCAACTCCACAC	2
AGACCGCCATGTCTTATACACCC	1
AGACCGCCGTTGTCGTTGCCTCCC	2
AGACCGCCTACATTATTGGGCCGT	1
AGACCGGATAAACGAGCGTGCCAT	3
AGACCGGATAAACGAGTGCACTGC	2
AGACCGGATAAACGAGTGCGCTGC	2
AGACCGGCCAGGTTGAGTGGGCTC	1
AGACCGGCCTATGCCAAGGAAGGA	1
AGACCGGCGGCATACCTGTGGTC	1
AGACCGGGACCAACTATAGTTTCA	1
AGACCGGGCCTAAGAATATGCAAC	1
AGACCGGGTCAACATTGCCACGTC	1
AGACCGGGTTAGTATCGCCACGTC	2
AGACCGTATCGATGTATAAAAATA	1
AGACCGTGAGAGCGAATGTGGATG	1
AGACCGTGCTAATTTGACCGCGTC	1
AGACCGTGCTCTTGTCTAAAACGA	1
AGACCGTGCTCTTGTTTAACAGGG	1
AGACCGTGTAACCAAAGATGGTCA	1
AGACCGTGTAGTGCAATCTGA	1
AGACCGTTGTCTGGTGCTAATTCG	2
AGACCTAAAAAGTAGATGGATGCG	1
AGACCTAAAAGTAGATGGATGTGG	2
AGACCTAAAAGTGGATGGATAC	1
AGACCTAAAAGTGGATGGATGCA	3
AGACCTAAAAGTGGATGGATGCAG	4
AGACCTAAAAGTGGATGGATGCG	1
AGACCTAAAAGTGGATGGATGCGA	3
AGACCTAAAAGTGGATGGATGCGG	4
AGACCTAAAAGTGGATGGATGT	1
AGACCTAAAGTTAGGTGACCCGA	4
AGACCTAATATATAAGTGGGGAGC	2
AGACCTACATTTCAGTGATAAAGT	1
AGACCTACCTAGATAGGATGTGAC	2
AGACCTACGAGCGGTGGAGTTCAC	1
AGACCTATGACAAACTCAGTGGCA	1
AGACCTATGCTTTAGGGTGGGACA	1
AGACCTATGGTGACTTCGTAAATT	2
AGACCTATTGACGGACGAAAACTC	1
AGACCTATTTTCCCAGTTGGTGGT	1
AGACCTCACCGCAGCTGCAGTGTC	2
AGACCTCCTTAAAAGAGAGGATGC	1
AGACCTCGATATGCGTTTTGCAAG	1
AGACCTGAACGGTTGATGGACCGG	2
AGACCTGAGGGCCTGTTTGATATA	2
AGACCTGGCGCCGCCGGAGATGGG	1
AGACCTGGTGACAGGTGGGACCGG	1
AGACCTGGTGCTCGGTACTAGGGT	2
AGACCTGTCAGCGAGGCATGCA	1
AGACCTTAAGGTACTACTTAGATC	1
AGACCTTACGAAGGGTGGGCCAGA	1
AGACCTTGAGGTGCTACTCAGATC	1
AGACCTTGTGATATGGGGACGTAC	1
AGACGAAAGGTCAAACGTTTGTTA	1
AGACGAAAGTGCCCATGTTGCTGA	2
AGACGAAATGTCAAACATGTGCTA	1
AGACGAAATGTGTCTACGTATGCA	1
AGACGAAATGTTAAACATGTGCTA	2
AGACGAAATGTTTTGGTGT	1
AGACGAACAATCAAAGTTGGGTGT	1
AGACGAACACTCAAACATGTGCTA	1
AGACGAACAGTCAAACACGTGCTA	1
AGACGAACAGTCAAACATGTGCTA	9
AGACGAACAGTCAAAGTTGGACGC	1
AGACGAACAGTCAAATATGTGCTA	2
AGACGAACAGTCAAGAATGTGCTA	1
AGACGAACAGTTAAACATGTGCTA	2
AGACGAACAGTTAAACTTGTGCTA	1
AGACGAACGACATGTGCTAAAAAG	1
AGACGAACGATCAAAGTTGGGCGC	1
AGACGAACGATTAAACATGTGCTA	1
AGACGAACGATTAAAGTTGGACAC	1
AGACGAACGGTAAAAGATGTGCTA	3
AGACGAACGGTAAAATATGTGCTA	1
AGACGAACGGTCAAAACTGGGCGC	1
AGACGAACGGTCAAACATATGCTA	1
AGACGAACGGTCAAACATGCGCTA	2
AGACGAACGGTCAAACATGTGCT	1
AGACGAACGGTCAAACATGTGCTA	88
AGACGAACGGTCAAACATGTGCTAA	1
AGACGAACGGTCAAACATGTGCTT	2
AGACGAACGGTCAAACATTTTTAA	1
AGACGAACGGTCAAAGTTGAATGC	1
AGACGAACGGTCAAAGTTGGACGC	1
AGACGAACGGTCAAAGTTGGGCGC	2
AGACGAACGGTCAAATATGTGCTA	19
AGACGAACGGTCAAATATGTGCTT	1
AGACGAACGGTCAAATGTGTGCTA	2
AGACGAACGGTTAAACATGTGCCA	1
AGACGAACGGTTAAACATGTGCTA	25
AGACGAACGGTTAAACATGTGCTAA	1
AGACGAACGGTTAAAGTTGGACGC	1
AGACGAACGGTTAAAGTTGGGCGC	3
AGACGAACGGTTAAATATGTGCTA	4
AGACGAACTGGATGACTTTGGTAC	1
AGACGAATAGTCAAACACGTGCTA	1
AGACGAATAGTCAAACATGTGAGA	1
AGACGAATAGTCAAACATGTGCTA	2
AGACGAATAGTCAAATATGTGCTA	1
AGACGAATCTAGCATGGGTGATGG	1
AGACGAATCTTTTAAGCCTAATTGC	1
AGACGAATGATCAAACATGTGCTA	1
AGACGAATGATCAAAGTTGGACGC	1
AGACGAATGCATGAATGGAGGCCT	1
AGACGAATGCGGCCGGTAGGATGG	1
AGACGAATGGTCAAAAGTGTGTCT	1
AGACGAATGGTCAAAAGTTAGGTA	1
AGACGAATGGTCAAACACGTGCTA	1
AGACGAATGGTCAAACAGTACAAG	1
AGACGAATGGTCAAACAGTGTAAG	1
AGACGAATGGTCAAACATATGGTA	1
AGACGAATGGTCAAACATGTGAAA	1
AGACGAATGGTCAAACATGTGAGA	1
AGACGAATGGTCAAACATGTGCT	1
AGACGAATGGTCAAACATGTGCTA	22
AGACGAATGGTCAAACGTTAGGTA	1
AGACGAATGGTCAAACGTTGGACA	1
AGACGAATGGTCAAAGTTGGGCGC	2
AGACGAATGGTCAAATATGTGCTA	3
AGACGAATGGTCAAATGTGTGAGA	3
AGACGAATGGTCAAATGTTGGGCA	1
AGACGAATGGTGAAACACATACTA	1
AGACGAATGGTGAAACGTTGGACA	2
AGACGAATGGTTAAATACGCACTA	1
AGACGAATGGTTAAATATGTGCTA	1
AGACGAATGTCCATATGGGTGTATT	1
AGACGACATACAGATAACGGGTTG	1
AGACGACCAGTGTGCTACCGTGAA	2
AGACGACCGATGAGCGTGTCGTGC	1
AGACGACCGCGATAGTTCGGTGGG	1
AGACGACCGGTACGCACATGGTTC	1
AGACGACCGGTCAAACATGTGCTA	1
AGACGACCGGTTAAACATGTGCTA	1
AGACGACCTGCGTTTGAACCTCAC	1
AGACGACCTGGATTCAAAGCCTCA	1
AGACGACCTGGATTCGAAGCCTCA	2
AGACGACGTCCTGGGTGATGTTTG	1
AGACGAGCGGTCAAACATGTGCTA	3
AGACGAGCGGTCAAAGTTGGGCA	1
AGACGAGCGGTCAAATATGTGCTA	1
AGACGAGGTATTAAACAGTGTAGC	3
AGACGAGGTCCTGCGATGAGGAAA	1
AGACGAGTGATCAAAGAGTGCAAG	1
AGACGAGTGGTCAAAACAGTGCAA	1
AGACGAGTGGTCAAACAGTGCAAG	1
AGACGAGTGGTCAAACAGTGTAAA	2
AGACGAGTGGTCAAACAGTGTAAG	1
AGACGAGTGGTCAAACGTTACAAG	1
AGACGAGTGGTCAAACGTTAGAAG	2
AGACGAGTGGTCAAACGTTGAAAA	1
AGACGAGTGGTCAAACGTTGCAA	1
AGACGAGTGGTCAAACGTTGCAAG	3
AGACGAGTGGTCAAACGTTGGTTG	1
AGACGAGTGGTCAAAGTTGTGCGC	1
AGACGAGTGGTCAAATATGTGCTA	1
AGACGAGTGGTTAAACGTTGCAA	1
AGACGAGTGGTTAAATAGTGCAAG	1
AGACGAGTGTCCATATGAGTGTCT	1
AGACGATCAAAATTGGGTATGGAA	1
AGACGATCAAAGTTGGACGCGGAA	1
AGACGATCGGTCAAACATGTGCTA	1
AGACGATCTGAGTTTGAAGCCTTA	3
AGACGATGAGAATGGTGATAGCCA	1
AGACGATGGAGTAGGTGAGAGCCA	1
AGACGATGTCATTCAGACCCTGCA	3
AGACGATGTGAATGGATGCCT	3
AGACGATGTGACTGAAATATTATG	1
AGACGATGTTCTGGTCGACAACAAG	6
AGACGATTAAAATTGAACATGGAA	1
AGACGATTAAAATTGGGTACGAAA	1
AGACGATTAAAGTTGGGCGCGGAA	1
AGACGATTAGGTGTCACTCTTGA	1
AGACGATTAGGTGTCACTCTTGAG	1
AGACGATTTTGGTTTGAAGCCTT	1
AGACGCAAAAGTCCAAGTGGGTGT	1
AGACGCAACTAGTTGGTAGCCA	1
AGACGCAATCATTTATGGTGTTAA	1
AGACGCAATGTGTATATGACAGGT	1
AGACGCAATGTGTTTATGATAGGT	2
AGACGCACACACCACACGGAAGGA	1
AGACGCACCACGTTGATGTGATGG	2
AGACGCACCGTGTATATGATAGGT	1
AGACGCACTGGATAGAATGGCAA	1
AGACGCAGCCAGTTATGATCCATC	1
AGACGCAGCGTGCATATGACAGGT	1
AGACGCAGTGTGCGTATGATAGGG	1
AGACGCAGTGTGTATATGACAGGT	2
AGACGCAGTGTGTATATGACGGG	2
AGACGCAGTGTGTATATGACTGGT	1
AGACGCAGTGTGTATGACAGATGT	1
AGACGCAGTGTGTATGACAGGTGG	2
AGACGCAGTGTGTATGACATGTGG	1
AGACGCAGTGTGTCTATGACAGGT	3
AGACGCAGTGTGTCTATGATAGGT	1
AGACGCAGTGTGTGTATGATAGGT	1
AGACGCATCGCTGTTGATAGGTAC	1
AGACGCATTGCTGTCAATGGGTAC	1
AGACGCCACGTCAGCGAAACCGCC	1
AGACGCCCAGCTTTTCATAAAGCA	1
AGACGCCCGTGGTGATATGTTGGT	1
AGACGCCGAAGTAGAGAGGGGTGT	1
AGACGCCGCTGATGTGGTGCTGGA	1
AGACGCCGGCGATCGACGTGTGCC	1
AGACGCCTCACTATTGATAGGTAC	1
AGACGCCTCGCTCCTACCACTGAA	2
AGACGCCTCGGTGTCGACGGGTAC	2
AGACGCCTCTATGCGCTGGATGCA	1
AGACGCCTGCGAAAAGTTTCGACC	3
AGACGCCTGCGCTGTTTCTTTTAA	1
AGACGCGAGTGGCCTGATGATGCG	2
AGACGCGCCGAAAGTGTCCTCGTC	1
AGACGCGGTCAAAATTGGCACGGT	1
AGACGCGGTGTCTACGTAGTTAAT	1
AGACGCGGTGTGTGTATGATAGGT	1
AGACGCTCAACAAGTTCAGGGTCT	1
AGACGCTGCTAAGAGTGACCCGAC	1
AGACGCTGCTTCGTTTTACGTGT	3
AGACGCTGGTGATGGGATGGGCGA	1
AGACGCTGTGGAATAAAGAAACGG	1
AGACGCTGTGTGTATGACAGATGG	1
AGACGCTTATAACAGGCCGAGTGG	1
AGACGGAACCCTAACGGCGATGGC	1
AGACGGAATAAGACGAGATTGATA	3
AGACGGACAAGAGGATGAGGATGC	1
AGACGGACAGTCAAACGTTGGGTAC	1
AGACGGACAGTCAAACGTTGGTAC	1
AGACGGACAGTCAAAGTTAGGCGC	4
AGACGGACCACGTAAGGTGCGCCT	1
AGACGGACCATAACTAGTCGCATC	3
AGACGGACCTCTTAAGTAATCACC	2
AGACGGACGATAGTGATGTGCTTT	1
AGACGGACGATCGAAGTTGGGCGC	7
AGACGGACGGTCAAACGTTGGCCA	1
AGACGGACGGTCAAACGTTGGGCA	2
AGACGGACGGTCAAACGTTGTGCA	2
AGACGGACGGTCAAAGTTGGGCGC	1
AGACGGACGGTCAAATGTTGGGCA	1
AGACGGACTGTCAAAGTTGGGTAC	1
AGACGGAGAGGTCCTAAAAGTTGC	1
AGACGGAGTGCAAGACTCGATCGT	1
AGACGGATCGGATTTTTTTGGCGG	1
AGACGGATGATCAAAGTAGGGCGC	1
AGACGGATGATCAAAGTTAGGTAG	1
AGACGGATGATTAAAGTTGGACAC	3
AGACGGATGCTTAAACGTTGGGCAC	1
AGACGGCACTGTCAACGGGAACGC	1
AGACGGCCAAACATTGGCTACGGA	1
AGACGGCCTAGGTTTGAAGCCTCA	1
AGACGGCCTATGATGACACGTGCA	1
AGACGGCCTGAGTTCAAAGCCTTA	1
AGACGGCGTACCTATCAATATCGA	1
AGACGGGACGTGTCGATTTGGGAC	1
AGACGGGAGCCACTAACAAGATTC	1
AGACGGGAGGTGTATTGTCCACGA	2
AGACGGGATGATACCTTTGAGGTA	2
AGACGGGGGATAATGAAATAGTGA	1
AGACGGGGTGCTAATGCAAACTAA	1
AGACGGGTAAGAAGTATGGTTGA	1
AGACGGGTATGGTCTCTTAAATAA	2
AGACGGGTATGGTGATAGGCACAA	1
AGACGGGTGGAGCTAGACCGTTGTC	1
AGACGGGTGGCAGTCTCAGACTG	1
AGACGGGTGGTCAAAACAATGAAC	1
AGACGGGTTACCTACTAATTTGAC	1
AGACGGTACTACTGAAGTGCACAC	1
AGACGGTCAAACGTTGGACACGGA	2
AGACGGTCAAACGTTGTGCACAGA	1
AGACGGTCAAAGTTGTGCACGGAA	1
AGACGGTCAACCATAGTAGGGCGC	2
AGACGGTCAAGAATACCGGGTGAC	1
AGACGGTCAAGGAGACTGGGTGAC	1
AGACGGTCAAGGATACCGGGTGAC	6
AGACGGTCAAGGATGCCGGGTGA	1
AGACGGTGAAAGGGATGAGGATGG	2
AGACGGTGAATAACTCATTGG	3
AGACGGTGAGACGCATCTACGAGA	1
AGACGGTGAGCGACAACGAGCTAT	1
AGACGGTGAGCTGCTCATGGTGG	2
AGACGGTGAGGACTATAATACCAA	2
AGACGGTGATTGAGATTTCTCGGT	1
AGACGGTGGGCTAGACGACCTGCG	1
AGACGGTGTACCTGTTGATAGTGA	1
AGACGGTTAAGGATACCGAGTGAC	1
AGACGGTTAAGGATACCGGGTGAC	4
AGACGTAACAGGTCATTGCTATGG	2
AGACGTAACGTGCGTATGATAGGT	1
AGACGTAACGTGTGTATGATAGG	1
AGACGTAATGTGTGTATGACAGGT	1
AGACGTAATGTGTGTATGATATGT	1
AGACGTACGGTCAAACGTTGGGCA	2
AGACGTAGCTCGATACACAATGGG	1
AGACGTAGGAGTACTTGATAGTCC	1
AGACGTATGGTCAAACGTTGTGCA	1
AGACGTCAAGATTTTGCCTATGGA	1
AGACGTCAGTACATGCCGTGGGAC	1
AGACGTCATGTGTGTATGAGATGT	1
AGACGTCCTGTCAGCATGTGTGAT	2
AGACGTCGAACCCAGGTCGTCTAGC	1
AGACGTCTCGCTGTCGACGGGTA	2
AGACGTCTCGTTATCGAAGGGTAC	1
AGACGTCTTGCTGTCGATAGGTAC	1
AGACGTCTTGTTGTCGACGGGTAC	1
AGACGTGAACCACATCCTACTCGA	2
AGACGTGAATTTGTCTGAGGACAC	1
AGACGTGCAATTCAAACTTAGATA	6
AGACGTGCATTGTGCGACAGGCCA	1
AGACGTGCGGACTGCGGATATGGT	1
AGACGTGGAACGCCTCCCTGTGCC	1
AGACGTGGGTCGCTGATAGGTGGG	1
AGACGTGGTACTAGAATATATTAC	2
AGACGTGGTGTCTAAATTACGGGA	1
AGACGTGGTGTCTAGATTACGGGA	1
AGACGTGGTGTCTAGATTATTAAG	2
AGACGTGGTGTCTATATTGTTGAA	7
AGACGTGGTGTTTAGGTAATTGTT	1
AGACGTGTCACACGAGGTGCTCGT	4
AGACGTGTGCTAACATAACAAGGC	1
AGACGTGTGGTGCGCCTAACCGAC	1
AGACGTGTGTATGAGAGGTATGAC	1
AGACGTGTTGTAACCTGAAATGGG	1
AGACGTGTTTGCATATGGCTG	1
AGACGTGTTTGCATGGCTATGGGC	2
AGACGTTGAAGTTGGTACCTATAG	1
AGACGTTGCTTGATGGAATAGTAC	1
AGACGTTTAGGTGCTGCGATCGTGC	1
AGACGTTTCATCTGCTAATACCAC	2
AGACGTTTGACCGGATATTGGAAG	2
AGACGTTTGACCGGATGTCGGAAG	1
AGACGTTTGACCGGATGTTGGAAG	2
AGACGTTTGACCGGATGTTGGAAGG	1
AGACTAAAAAAGAATTGGGGTCTA	1
AGACTAAAAATAGTAAGGGGTCGC	1
AGACTAAAAGTGGAGCCAGTAGGA	1
AGACTAAACCCAACAATCAGGACA	1
AGACTAAATGGTGAGGGTGGAGAG	1
AGACTAACATTGGTCAGGTTGCGA	1
AGACTAACGGTCCTGCGTTTTGGT	1
AGACTAATAACTGTCGATGGGTAC	1
AGACTAATCTTATAGTAGCAGC	1
AGACTACAAACAGTCACAGGGTGG	2
AGACTACAGGTGGCAATGGTGTAA	1
AGACTACATATATCCAGTTGGATG	2
AGACTACATGAGGACCCATCAGG	1
AGACTACATGGTGATCGGTTTCAG	1
AGACTACATTGTGGATGCCCTA	1
AGACTACATTGTGGATGCGCTCAC	1
AGACTACGACAGTCGAATGTGCGA	1
AGACTACGGATGTAGTACAGGGGT	1
AGACTACTAGTATTAGGTGTTGGC	1
AGACTAGAGTAGGGAGCCCCTAAA	1
AGACTAGATGATGGGTTAGGTGCT	1
AGACTAGATTAATAGTAAACCACT	1
AGACTAGCAAAAGTGCCCGTGCGT	3
AGACTAGCAACCAGAGGATGGCCA	1
AGACTAGCCGGAATTGATTGTAAA	1
AGACTAGCCTGGATTCAAAGCCCC	1
AGACTAGGAGTGATGGCCAAGCCT	1
AGACTAGGGTGGGTTGTGAGTACA	1
AGACTAGGTCAACGAGCCATGTCA	2
AGACTAGGTGGATGTGGAGGTCCA	1
AGACTAGGTGTGTCCATGATGGTC	1
AGACTAGTAAAATGCCCGTGCA	1
AGACTAGTACTCCCTCCGTCCCAA	1
AGACTAGTCTAATGGGTGAGGACC	1
AGACTAGTCTTTTAGGTTGTGTAG	1
AGACTAGTGATCAAACGTTGTGCA	2
AGACTAGTGGTCAAACGTTACAAG	1
AGACTATACACTATACAGAGTGCG	1
AGACTATACGCGTGTGTGTCGT	2
AGACTATCCTCCTACAATAGTAGA	1
AGACTATGTGAATGACAGGTGGGA	1
AGACTATTGTAGTTTTTAGGCGAC	1
AGACTATTTTCTAGACGATGGCAA	2
AGACTCACGTGGGAATTGGTAAGC	1
AGACTCAGATGATGGCAGCCATGA	1
AGACTCAGGGAGGAGTTGAGGTCC	5
AGACTCAGGGAGGGGTTGAGGTCC	1
AGACTCATGGAGAGACATAGGTGT	1
AGACTCCATGGTGAATACATATTA	1
AGACTCCGGGTCAGGGACAATGGG	1
AGACTCGTGTCCAGATTTGTTGGA	2
AGACTCTAGGCGGATACACGATCC	3
AGACTCTAGTACCGGCTGATGGT	1
AGACTCTATTTGGTGTACGTGTA	1
AGACTCTGAAGTGCTTGATGGGAA	1
AGACTCTGGATCGGCGGTGGAGAC	1
AGACTGAAAATAATCGGCGTGCCA	1
AGACTGAATGCTGAGGTGGATGGA	1
AGACTGACAGGTGCTGAAACATAA	1
AGACTGACTAACAAGCGTGCCAAC	1
AGACTGAGCCGGCATACACAAAG	2
AGACTGATACTTCGGGTTGCTTTC	1
AGACTGATGGTCAAAACGCTGAGC	2
AGACTGCACGGAAAAATGGTGGGAG	1
AGACTGCCACTAGAAAACTGCAAAA	1
AGACTGCGGGACTGTTTGGATGGA	1
AGACTGGGCCACTAACATATTGGG	2
AGACTGGGCCAGCATATATTGAGA	2
AGACTGGGCCTATGAACACACGTA	1
AGACTGGGCTTCTTGGTTTGATGG	1
AGACTGGGTGACAAATAGAGGGAC	1
AGACTGGTCAATTAGATATTTGGA	2
AGACTGGTCAGGTCAAATATAGAA	1
AGACTGGTCTGTATGAGATTGAAG	1
AGACTGGTGGTCGCGAAGTTGGAG	1
AGACTGGTGTTGATGGGCTGCAAC	1
AGACTGGTTGTGCTGTCAGGACGG	1
AGACTGTCTTCCAAATCGGTGTTT	1
AGACTGTGAGAATTGCCTTGGACA	12
AGACTGTGCACGTGTGTGAGTCCC	1
AGACTGTGCCAAGTTTAATCATGC	1
AGACTGTGGCCCTGTTTAGATGG	1
AGACTGTGTCGTGATGAACCGTGC	1
AGACTGTGTTGGTGAACTATAGG	1
AGACTGTTGGAGTGCGATTTTCGT	1
AGACTGTTTGAGGGACCTTCTGAT	1
AGACTTACGGTCAAACGTGTGTAA	1
AGACTTAGAGTTGTAATAGGTGTC	1
AGACTTAGTCCTAGTCCAATGTGA	1
AGACTTATGTATGAATGGGCCAA	5
AGACTTATGTATGAATGGGCCAAG	1
AGACTTCGAACTTAGACAGGCTAGC	1
AGACTTCTGTGGTGACTTTATGAT	1
AGACTTGAAACGGGTGTTTATGTT	1
AGACTTGAGGGGGTCTCACGTGAG	1
AGACTTGATTGCCTGCCTACCCGT	1
AGACTTGGATATGCATTTTGAGAG	1
AGACTTGTGCTTGATGAGGTACGGT	3
AGACTTGTGGTGTTGAACACGATT	1
AGACTTGTGTGATCGTGTATGGTC	3
AGACTTGTGTGCATATGATACGTT	1
AGACTTTAAGCTTAAGGTGTGGCC	1
AGACTTTAATCCAGGTCGGCTAGC	1
AGACTTTCTAGTATTGCCCACATA	1
AGACTTTTCTGGGATCCACAAGGT	1
AGAGAAAAAACCACGGGCGCCAACC	1
AGAGAAAAACAAATACATGATGCA	2
AGAGAAAAACAGCGGACTACAGAC	1
AGAGAAAAATGGAAAAGGGTGAA	2
AGAGAAAACACAGTGTCTGGA	1
AGAGAAAACGCACGATTGATATGG	2
AGAGAAAACTAACGGATGGCCGGG	1
AGAGAAAAGAAAAGGGATGGATGG	1
AGAGAAAAGACATTTTTTCAGTGG	1
AGAGAAAAGGAAGGTAGGTTCTGC	1
AGAGAAAAGTGAGAAGATTGATG	1
AGAGAAAATGACCATGCGTTGCAA	2
AGAGAAAATGTGTCTTTTTCTGAG	2
AGAGAAAATGTTGCACGATTAGTG	1
AGAGAAACGTGCTACATATTTAT	1
AGAGAAAGAAAGCGTGCTACATATT	1
AGAGAAAGACCAGCTAGGGCAGCA	1
AGAGAAAGATAGTGTGCTCACGCG	1
AGAGAAAGGTGAACACGTCAGCAC	1
AGAGAAAGGTGCATGTGGTATCCC	2
AGAGAAAGTGAGTTAGATTGGTCC	1
AGAGAAATGCTCAAATAGTATGG	1
AGAGAAATGCTGGTGCTGTTGTAC	1
AGAGAAATGGGATACAAACGCAAG	1
AGAGAAATGTCTGGGACAAAAGC	1
AGAGAAATTCAGAGTAGTACATGT	1
AGAGAAATTGATAGTCGGTGCTGA	1
AGAGAAATTTTAGGAGTTGAGGGA	1
AGAGAACAAAAGCAGAAAGGTGCA	6
AGAGAACAAAGATGATTAGATGAG	1
AGAGAACAAAGGGTACCTTATATA	1
AGAGAACAAAGTTGTCTGTGATGC	1
AGAGAACAATACACGTGGTGATGA	1
AGAGAACACTGGTACACAATGGAA	1
AGAGAACATGGGCGCTTTACAGG	1
AGAGAACCATATAATGTGTCTAGA	1
AGAGAACCGATCGGTGAAGGGTGG	1
AGAGAACCTCAAAAGGAGTAGTGC	1
AGAGAACGATGATGCCACTGTCGA	1
AGAGAACGATTCTTTTGGCCGAAG	1
AGAGAACGATTTGCCTGACTCAAG	1
AGAGAACGCGTGCGAATTAGATTT	1
AGAGAACTACTATATGGCGCCTTA	2
AGAGAACTCTACGGATTAGGGTCC	1
AGAGAAGAAAAGCGGGCTATAGAT	1
AGAGAAGAAGGGGAACACACGCG	1
AGAGAAGAATTGGTCGTCTGGTCC	1
AGAGAAGACCATACCGCAAATACA	1
AGAGAAGACTGCTCTACTGGCCCTA	3
AGAGAAGAGCAGCGGGCTACAGAG	3
AGAGAAGAGGTACCATCGCACAGG	1
AGAGAAGAGTAACTTAAAAAACTA	2
AGAGAAGAGTAGCGGGCTACAGATA	1
AGAGAAGAGTAGTGTGCTATAGAT	1
AGAGAAGCGCGATCGGTCTGTGAC	2
AGAGAAGCTGATGGCCGCTGAAAC	1
AGAGAAGGCAGCTGTGCCCTGTGA	1
AGAGAAGGCCTGTTAATTCATGAG	1
AGAGAAGGGCCTATAGAGGGTAAG	1
AGAGAAGGGGATTGAGGAGATTGA	1
AGAGAAGGGTCCAGAGGATAAGGA	1
AGAGAAGGTACACGCAAAGGA	3
AGAGAAGGTCCTGTGCTGCTAGTA	1
AGAGAAGGTGGATTGATATTTTGG	1
AGAGAAGTGTGGTTGATAGTGG	1
AGAGAAGTTCGGAACACAGGATGC	1
AGAGAATAAATTGAGGAGCAAACC	1
AGAGAATACACGTTCTTTGGGTGT	2
AGAGAATACGGTAATACGGTGTAC	1
AGAGAATATGGTGAAGAAGTTGT	1
AGAGAATATTATACAGGTGTGTCA	1
AGAGAATATTGGGGTTGGAGCAGC	1
AGAGAATCCCTTACAACTAGGTGG	1
AGAGAATCTACTCTATACCACCGA	1
AGAGAATGAGAAACATACTATCTA	1
AGAGAATGGTTGCGATTGGTTGA	1
AGAGAATGGTTGTGATTGGTTGAGA	1
AGAGAATGTGCAGCTGACATGTAG	1
AGAGAATGTGTACATGGTGTCTT	1
AGAGAATGTTGGTAGAGAAGTTGC	1
AGAGAATGTTGGTGGATAAGTTG	1
AGAGAATTCGATGTGAAACCAAAC	1
AGAGAATTGAACGTCCGGGTGCAA	2
AGAGAATTGTGTGTCCCAAGAAG	1
AGAGAATTTTGGTGAGATGGGGAT	1
AGAGAATTTTGGTGCAAAGCAGAA	3
AGAGACAAACGGTCAAACGTGGTAC	1
AGAGACAAAGGTGGATTTGGTGAT	1
AGAGACAAATGACCAAAATGCCTC	1
AGAGACAAGTGTCCCTATGAGTGT	3
AGAGACAGGAAAGCATCACTCGTG	1
AGAGACAGGGTGTACGTATGTGTA	1
AGAGACAGGTATTGTGGTGGTTCC	1
AGAGACATAAATTTCATGGCTGCA	4
AGAGACATGGTACTGCGATTGCAG	1
AGAGACCACCCCGGGTTGCCGAGT	1
AGAGACCAGGATGACACAGTGGTA	2
AGAGACCCGAGTGCATGGGGCGCA	1
AGAGACCCGCACATGAAAATAGTT	1
AGAGACCGATTGAGATATGGACGC	1
AGAGACCGGGGTGACACAACTGAAC	2
AGAGACCGGTGATGGGCTTTACTC	1
AGAGACCTAGATGGTTGATAGCCA	1
AGAGACGCATGATGGTAACACCAA	1
AGAGACGCCTATGATAACTTTGTC	1
AGAGACGGACCGCGGAAGATGATG	1
AGAGACGGGCAGTGCTTCAATGTA	3
AGAGACGTACCAAAGATTGTGGCA	1
AGAGACTGGCGCTCACGGTGATGG	1
AGAGACTGTGGCAGCCACAAGTGT	2
AGAGACTTACAATGTAAATACATG	2
AGAGACTTGCAGAATTACTATCGG	2
AGAGACTTGGGCCAACTTTCAGCC	1
AGAGAGAAAAGAGCAGCGGGCTA	1
AGAGAGAAAAGTGTGCACCTCCTCC	1
AGAGAGAAATGCTCTGCCTGAAAG	2
AGAGAGAACGGCAGCGGGCTACAGA	1
AGAGAGAAGAGCAGCGGGCTACAG	1
AGAGAGAAGGGAACGATGTGCCAA	2
AGAGAGAAGGGTAGCGGGCTACAG	1
AGAGAGAATGCCACAGATCGC	2
AGAGAGAATTGCTACTAAAGGTGT	1
AGAGAGAATTTGAAGCCACACTAG	1
AGAGAGAATTTTGGTGCAAAGCA	1
AGAGAGAATTTTGGTGCAAAGCAG	3
AGAGAGACCACGCCAGCGACTCTG	1
AGAGAGAGAGAGTGCCTAGTAGCG	1
AGAGAGAGCCATGTGGGGGTC	1
AGAGAGAGCCTAAAATTGATTTCC	1
AGAGAGAGCTCAAAGATCCAAAGC	1
AGAGAGAGGAGCGTCTCGGTGTGG	2
AGAGAGAGGATAAAGCGGGCTACA	1
AGAGAGAGGTAAGATGCTTCTGC	1
AGAGAGAGTAATATGCTATGTGCC	1
AGAGAGATGAGAAACGGGTTGT	1
AGAGAGATGATGAGCCACCCCTAA	2
AGAGAGATGCCTGCTAAAATACG	1
AGAGAGATGTATCTGCCTTTGAG	1
AGAGAGATTAGGCGTGCATGCTGC	3
AGAGAGATTCATTACAATGACCCC	1
AGAGAGATTGGGCCTTTCCCTGAG	1
AGAGAGCAGCCACAGCATAGTGGG	2
AGAGAGCATATCTAGGTGGTGTTT	1
AGAGAGCCTATAAATAACCATTG	2
AGAGAGCCTATAGATAACCATTGC	1
AGAGAGCGAAGATGGTCACGCGGC	1
AGAGAGCGAATAGTGAATAGGTGT	1
AGAGAGCGATGACCTATATAAGTC	2
AGAGAGCGTCATCAGACCCCGCCT	1
AGAGAGCTCTTGCTTGAGGTGTAT	1
AGAGAGGACTTCTGACATCCGGTC	1
AGAGAGGAGAGGAAAGGAGGTGAC	1
AGAGAGGAGGCGGCGAGTGATGAC	1
AGAGAGGAGGTACCACAATGTAAC	1
AGAGAGGATGTGTCAATTTGGGAC	1
AGAGAGGCCTCTCAATTTTGCCTT	1
AGAGAGGGCTGCCTTTTTATGGTC	1
AGAGAGGGGACACCACAATGTAA	1
AGAGAGGGTAAACATATATGTAAG	2
AGAGAGGGTGATTTCGAAGAAGG	1
AGAGAGGGTGGTACCACAATGTAA	1
AGAGAGGTACTAAAGAAGCAAGGG	1
AGAGAGGTAGCGCACTGAGTTAGG	1
AGAGAGGTAGTGAAAAATTAAGG	1
AGAGAGGTATACTGCGTAATGTG	1
AGAGAGGTCCAGTTTATAAGGAA	1
AGAGAGGTGCCATGTGTCCAACAC	3
AGAGAGGTGGCCTAGTTTTTAGGG	1
AGAGAGGTGGCGCTTCGAACCCAA	3
AGAGAGGTGTGTACTTCGGGAGCA	1
AGAGAGTACATGATTGGTGTCCA	1
AGAGAGTACTGCATCATTTTCAGG	1
AGAGAGTCTAGGATAGAGTTCGGC	1
AGAGAGTGAAACATTCATGGT	1
AGAGAGTGAGCGTATGACAGGTGG	1
AGAGAGTGCCACTCTGATGCATGC	1
AGAGAGTGCCTTGACCAACCTAGC	1
AGAGAGTGCTTGATTACTTGGGGT	1
AGAGAGTGTTCCACTGGTGGAGAA	1
AGAGAGTTGGAACTTTCTAGGTGT	1
AGAGAGTTTCCAAACTATATGGGT	1
AGAGATAACTAGAAGATGGGTGTA	1
AGAGATAAGGGTGATGAGGACTC	2
AGAGATAAGGTGCACACGTATGTG	2
AGAGATAAGGTGTACGTGTGTATCC	1
AGAGATAATTTCCTAGTGAGGAAC	1
AGAGATAATTTTCCCGCTAGGCGC	1
AGAGATACTGCCAACAACTGTGTA	2
AGAGATAGAGATAGTGATGCACAT	1
AGAGATAGGGTACACATGATTTC	1
AGAGATAGGTGTAGATATGAAATA	1
AGAGATAGTACGCGATGTGTCTAG	1
AGAGATAGTTTTCCCGCTAGGCGC	1
AGAGATATAGAAATGTGAAGCCA	1
AGAGATATAGGGCCTGTTTGGTAT	1
AGAGATATGGTCCGATTGAAACAC	1
AGAGATATGGTTTAGTTAAGATGA	1
AGAGATATTAATGAATCTAGGTGT	1
AGAGATCAAGAGCTTACATGTCAC	1
AGAGATCCGGTGAATGAAACGAAT	1
AGAGATCGAGGTAGAAACAGGTTC	1
AGAGATCGCGGGTGCACTTCACTC	1
AGAGATCGCTGTCACAAAAGATGG	3
AGAGATCTAAAGAAGGTATGTTGA	1
AGAGATCTACAGCTTGATGTGTC	2
AGAGATCTACGATGGGCCTGTTCA	1
AGAGATCTCAGCATACTTGGTGAA	3
AGAGATGACAATGGAGACCCGATC	1
AGAGATGACCTCGACTACTTAGAA	2
AGAGATGACCTCGACTACTTGGA	1
AGAGATGACCTCGACTACTTGGAA	8
AGAGATGAGAAGCGGGCTATAGG	3
AGAGATGAGTGTTCACGCGTTGTGA	1
AGAGATGCAATCAAGGATGGTGAG	1
AGAGATGCCACCAAATACTTGTGA	1
AGAGATGGAGACAAGGATTTTTGT	1
AGAGATGGAGCTAGAGCTGTGCCA	1
AGAGATGGAGCTGCGATTTAAGAG	1
AGAGATGGAGCTGTGCTAAACTGA	1
AGAGATGGCCGAAAGAAATGAGGG	1
AGAGATGGGACCCACGTATATGAA	2
AGAGATGGGCAGGTGTCACTG	1
AGAGATGGGTCTAGTTCTGAAATG	1
AGAGATGGTAAAAAGTTGCCT	1
AGAGATGGTTACAATTAGCGTGAT	1
AGAGATGGTTGTGTGCTCTATGAA	1
AGAGATGTAACAAAATATTAAGAG	1
AGAGATGTAACCTGCCATTGTTAG	1
AGAGATGTGACAAAAAGTTAAGGG	1
AGAGATGTGCACACATGATGAAAA	1
AGAGATGTGCTAGTTAATTGGATG	1
AGAGATGTTTTACGGTGTTTGCGA	2
AGAGATTAGACCTCTTAGGGCCTG	1
AGAGATTAGCCTAAACATACC	1
AGAGATTCATCTTAGAGCTGGTTGC	1
AGAGATTCCTATAGTCCGGGAGTA	1
AGAGATTGAGGGGTTGTTTGGTTC	1
AGAGATTGATGAAGCCATCATGGA	1
AGAGATTGCTGCGTACTGGTGCGA	1
AGAGATTGTACATCTGGCATGTGC	2
AGAGATTGTAGGACTACTTTCAGG	1
AGAGATTGTGCCAACCAAGGATAG	1
AGAGATTTTAGGTGAATGCAATA	2
AGAGATTTTGATCAAGTGCTGTTA	4
AGAGATTTTGGGTAGATGTGACAT	6
AGAGATTTTGGGTGAATGTGACAC	1
AGAGATTTTTCCTAGTGTGGTTAC	3
AGAGCAAAATCGGGTGCTCTCCC	1
AGAGCAAAGATGGTGTTTTGATGT	1
AGAGCAAATTTTGTGCAGCGCTTA	1
AGAGCAACGGTAGCAGCAATGGTGT	1
AGAGCAAGGGTGAGTACTTACGTAC	1
AGAGCAAGGGTGAGTACTTTCGTA	2
AGAGCAAGGTTAATGGTATAGCCA	1
AGAGCAAGTATAATAGTGAGCTA	1
AGAGCAATCTTACGGGACGCGCAC	3
AGAGCAATGTATTGCCTCTGGTGT	1
AGAGCAATTGAGGGTGTGTTTGG	1
AGAGCAATTTGCCAGTGCCCAATA	1
AGAGCACATCCGGTAGTTGCCAAA	1
AGAGCACCAGCCAAGCGGTCGCCG	1
AGAGCACTAAAACGATGCGGGCGA	1
AGAGCACTCTCGGACACTTATCTC	2
AGAGCAGAAACAGTTTGGTGGC	1
AGAGCAGCAAACGCCATGGTC	1
AGAGCAGCAAATAGCCGATGGCGCC	1
AGAGCAGCCCATTCGGGAGAC	1
AGAGCAGGAACAAGCAAGCGGCGC	1
AGAGCAGGACTAGGAAGTGTC	1
AGAGCAGGGGCAAAAGATAGGTAC	3
AGAGCAGGTACAATAGTAGGCTAT	1
AGAGCAGGTATAGTAGTAGGCTT	1
AGAGCAGGTGTGGATGGTGTGCAG	1
AGAGCAGTGCACAGTATTGAGACC	1
AGAGCAGTTTTGATTCTACGTGAC	1
AGAGCATACAGCCTAGTGGTTAC	1
AGAGCATAGCAGTGTATTGCAGCT	1
AGAGCATATCTAGGTGGTGTTTGG	1
AGAGCATATGGTGAAGATATGTGG	1
AGAGCATCATCAACAGTCTAGCTA	1
AGAGCATCCGGTTTCGAATCAGGG	1
AGAGCATCGCGTTTGGTGGTCGCC	1
AGAGCATCTCGCTTATGGGTAGGC	1
AGAGCATGTATAATAGCGGGCTA	1
AGAGCCAAAACATGATTTTTGGAC	1
AGAGCCAAATAGCCGCCTACAAAA	1
AGAGCCAACCATACCGCGTAATAC	1
AGAGCCAACCGGATCCAAGATGGA	1
AGAGCCAAGATGATACTATGT	1
AGAGCCACCCTTCCCCTATTGGAC	1
AGAGCCAGAACTGGGTTTTCGCC	1
AGAGCCATATCTGGGAGCAGCGGG	1
AGAGCCATCCGCTATAGGTGAGTA	3
AGAGCCATCCGCTGTGCTAGGAAG	1
AGAGCCCAACACCGTTCGGATGGA	3
AGAGCCCAATATATATATTGCAGA	2
AGAGCCCACCTATAGTCCCGGTTA	1
AGAGCCCAGATGGAGATACTATA	1
AGAGCCCGAGGCGGCCGAGCCGCAC	1
AGAGCCGAGCCATGGACTAAGCAG	4
AGAGCCGCTGATGGTTGGTGGGTC	2
AGAGCCTACATGTCATAGACAGCG	2
AGAGCCTAGTAGCTGTGGACCC	1
AGAGCCTATAGATAACCATTGCGG	1
AGAGCCTCTCTTGAAGGATAGTGC	1
AGAGCCTGCAGAAGGTCCATGGTA	1
AGAGCCTGTGTGCATAGGATACGC	2
AGAGCGAAAATAGCATTTTGGTGA	4
AGAGCGAAACAGAGCGTAGTGCCA	2
AGAGCGAAATGGCCTATAATCTAG	2
AGAGCGAACGGATTTATATGGCTG	1
AGAGCGAATAGTGAATAGGTGTCG	1
AGAGCGAGAGTGCCACGTGATGGA	1
AGAGCGATCAAGGATGCTGGGTGA	1
AGAGCGCAGTCTAAGAGTGGTCCT	2
AGAGCGCCACAACTGTTGATGCTA	1
AGAGCGCCCGCCATCGGTGGTTGT	1
AGAGCGCGTGCGTTGTGAGTGTCT	1
AGAGCGGAACAGGTGGCCGGTGCG	1
AGAGCGGACACTTGTAGGGTGCAG	1
AGAGCGGATTCGGACGGATAGTAG	2
AGAGCGGGTACAATAACCGGTAGC	1
AGAGCGGTCCATTAATACGTGAT	1
AGAGCGGTGAAAATAGAGGAGCA	2
AGAGCGGTGCGTAGAGTGGCAGTT	4
AGAGCGGTGGGGTCCACATACCAG	1
AGAGCGGTTGTGGTCACTAT	1
AGAGCGTCCACAATGTAGGTTTT	1
AGAGCGTGCAGGGCTGCACCGTGC	1
AGAGCGTGCTTGCACCAATTGCTC	2
AGAGCGTGTATGACATTTTGGCGA	1
AGAGCGTTAAGGGACCTAAATGCA	3
AGAGCGTTAGGTGTCATCTTTGCA	1
AGAGCGTTGACTCGAATGGAATGC	1
AGAGCTAACAAGGACAGAGGTGCA	1
AGAGCTAACAGGGACAGAGGTGCA	1
AGAGCTAACGGCACTGGATACTGC	1
AGAGCTAACTATTATATGGGTGTG	1
AGAGCTAACTATTATTTAGGTGGA	1
AGAGCTAACTATTGTATGGGTAGG	1
AGAGCTAAGGACCTAAGATATAAG	1
AGAGCTAAGGCCTAAGAACATGTA	1
AGAGCTAGAGCCTAGCCTAACAAT	1
AGAGCTAGAGCTAGAGCTGTGCCA	1
AGAGCTATTGCTTGAGGTGTGTGG	1
AGAGCTCTGATTGAGTGAAGTGCT	2
AGAGCTCTGTCGCGGTGGTGGGAG	1
AGAGCTCTTGCTTGAGGTGTGTGT	1
AGAGCTGAAACTGTTTGGGTGAAC	1
AGAGCTGAAGCTGAAGTTGTGCCA	1
AGAGCTGAATCTCCTGTGTGTCCA	1
AGAGCTGAGGAGAATCGGATGTAA	2
AGAGCTGATGGTGTGAACCCTTGA	2
AGAGCTGCTTCGTTGTGATGCGAT	1
AGAGCTGGAGATCCTACGATCTGA	1
AGAGCTGTACAAAATTACATAAGC	1
AGAGCTGTGTTGGTCTACTGGACTG	1
AGAGCTTACTATTAGAAGCAGTGC	2
AGAGCTTATACTTTCTATATACT	2
AGAGCTTGAATTCCATTTGGGATA	1
AGAGCTTGATGCCCATGTCTTCGC	1
AGAGCTTGATGCTGTGGATGCCTT	1
AGAGCTTGTGCCTGGGAGTGACCG	1
AGAGCTTTGTCACCATTGGCGGT	1
AGAGCTTTTTGGTGAGAAGCCAGC	1
AGAGGAAAACATGAGGTGAGACCT	1
AGAGGAAACCTAAATATTGTTGGT	2
AGAGGAAAGCTACAATACAAGTAC	1
AGAGGAAAGCTACACTACAAGCCCA	1
AGAGGAAAGTACACGGCAGGTCCT	1
AGAGGAACACCGGTTTCGGCCA	1
AGAGGAACCCTATTTGATACAGA	1
AGAGGAACCCTATTTGATACAGAC	9
AGAGGAACCTACCAGCGTCCTGGGA	1
AGAGGAAGAAACTGGGCCTCATGC	1
AGAGGAAGAATACGACTTTGGGCC	1
AGAGGAAGAGTTCTACAGTGATGC	2
AGAGGAAGCCTGTCCTGGTCGTCT	1
AGAGGAATACCGGTCACCGATTGC	2
AGAGGAATATTCCTCTCCAGGGAC	1
AGAGGAATATTCCTCTCCAGGGACC	1
AGAGGAATATTCCTCTTTAGGGAC	1
AGAGGAATATTTCTCTCCAGGGAC	3
AGAGGAATCTTGCCACACTTATGG	1
AGAGGACATAATCTACGAGGA	1
AGAGGACCACGCCTTTCGACATGG	1
AGAGGACCCATATGTCAACCACCC	1
AGAGGACCGCCTGTGAAGATCCGA	3
AGAGGACCTAAACGAGTGATCTAC	1
AGAGGACCTACAGGTTATGGTCCC	1
AGAGGACCTAGACAGTATTGTGAC	2
AGAGGACCTATATGGACAAAACGA	1
AGAGGACCTGCTGCAGATTGGTGG	1
AGAGGACCTGGAGCCGCCTCACCA	2
AGAGGACGCGATTGAGATGCTCCC	2
AGAGGACGGTCACACCATGGTGGA	1
AGAGGACTAAATGCAGTGTCTGGA	1
AGAGGACTCCAAGATATGGTAGAA	1
AGAGGACTGGCAATCTCGGGCTGC	1
AGAGGAGAAAGGTTCCATGTGA	3
AGAGGAGAATAATGAGGGTGTTG	1
AGAGGAGATAATTGGGGTAATCCA	1
AGAGGAGCAAGTGATGGGTAGCAC	1
AGAGGAGCAGCTTGGAACAAC	1
AGAGGAGCATAAATAGGTGGGCCT	3
AGAGGAGCCTATCAGACTTGGTAC	3
AGAGGAGCCTGACAACACTTGACA	1
AGAGGAGCTAGAGTAGGTGGGCCT	1
AGAGGAGCTCTATGTTGTCGCCGG	2
AGAGGAGCTGCTGGGATGATCTAA	1
AGAGGAGCTGGATCGGGTGGCCGG	2
AGAGGAGCTTCTGGATTTGGGAGA	3
AGAGGAGGCCAAATCGTGGTCCTT	1
AGAGGAGTAGCTCGATAGCGTGGA	1
AGAGGAGTGAGCGACTACATTTGT	3
AGAGGAGTGCCGTTCCATGTGCTG	1
AGAGGAGTGTCTCGACATCCCGCC	1
AGAGGAGTTAGATACAAACGCAGG	1
AGAGGATAGAATTCAAGTGCTAAG	1
AGAGGATAGCCTAACACAGTTGAG	1
AGAGGATATTGTTGATACGGAGGA	2
AGAGGATCCTGGTCCTAACTGCCT	1
AGAGGATCGTGACGTGGACGTGAG	1
AGAGGATCTCAGTCCCATCTTGG	1
AGAGGATCTTAATCCGTGCGGTAC	2
AGAGGATCTTTAGTCCGGGTTGGT	1
AGAGGATGACCTCTCGTTGTTTGC	2
AGAGGATGACGGCATGGCCATGGA	1
AGAGGATGACTGAAGGGTAGTTGA	1
AGAGGATGACTTTAGATCGTTGGA	1
AGAGGATGAGGAGTAAGGCCGGAC	1
AGAGGATGAGTTCTATAAGTAGTG	1
AGAGGATGCAAGCGTTATCCGGAA	8
AGAGGATGCCATTGGAAACGTCTT	1
AGAGGATGCCATTGGGGACGTCTT	2
AGAGGATGGAGTCTTCGATAGCTA	1
AGAGGATGGGAATTGGGGATGA	1
AGAGGATGGTGCGTAGCGACAGGC	2
AGAGGATGTGCCTGGTAGGGGTGG	1
AGAGGATGTGCGTCGATTACCGCG	1
AGAGGATGTGCTCGTGGCCGTGGA	1
AGAGGATTGCAAAACACAGGAAAA	2
AGAGGATTGCCGACAACTTTGGAA	1
AGAGGATTTAGGTTGTGTTCGGGA	1
AGAGGATTTGGGTGTCCATGTCCA	1
AGAGGCAACCTCCACACAAACCC	1
AGAGGCAAGGATGGATCCAGATATA	1
AGAGGCAATGCCATGCAGGACCGC	1
AGAGGCAATGGTGCTGCGTAACCC	1
AGAGGCAGAGTTGCTGATGGGTCA	1
AGAGGCAGGTTAGAAAACGTATGT	2
AGAGGCAGTGCTGTGGTGATGGA	5
AGAGGCATCACCTGATATCTGGTA	1
AGAGGCATCTAAGGGTAGTGGGTC	1
AGAGGCATGCCCAGATTCAGTTTGG	1
AGAGGCCAACAAGCAGGGATGCGG	1
AGAGGCCATGTGACAAGGTGGGAC	1
AGAGGCCATTGTGTTGGGGCTTCA	2
AGAGGCCCCCGAGCCGAACGGTGG	1
AGAGGCCCGCACGTGAAAATCGG	1
AGAGGCCCGCCTGCGAAAATCGATT	1
AGAGGCCCGTCTGTGAAAATATG	1
AGAGGCCGACGAGGGATCTAGCGT	2
AGAGGCCGTGACAGGACCCTTTGC	1
AGAGGCCTAACATATCTTCATGAG	1
AGAGGCCTACCAAATAGAATGCGT	1
AGAGGCCTACCTGTCATTCACTGG	2
AGAGGCCTCGTCAGTAGTGTTCTA	1
AGAGGCCTCTAATGATCAACAT	1
AGAGGCCTTTTAAAGGTCCGCCTA	1
AGAGGCGACGGAAGATGATAGAGC	1
AGAGGCGATCGATGATGATGCAGT	1
AGAGGCGGATCCAACGTAGGTGCG	1
AGAGGCGGATCCAACGTGGGTGCA	1
AGAGGCGTCATGGATGATTTC	6
AGAGGCGTCCTCAGCGACGGACCGG	1
AGAGGCTCCAAAAACGATGCCACC	1
AGAGGCTCCGATGTTGTTGGTATC	2
AGAGGCTCTGTCTTCTCTAGCACA	2
AGAGGCTCTTGTGGTAGTGTCCTA	1
AGAGGCTGCCTGATTCTTTCGACT	1
AGAGGCTGGCGCTGTGGTCGCGAA	1
AGAGGCTGTTTGGTTGGTTGTCTA	1
AGAGGCTTCATGTGACGGTTTGA	1
AGAGGCTTGATGTCCATATTCGT	2
AGAGGCTTGCCTGCGAAAATTGAT	1
AGAGGCTTGCTGGTGTCATCCTTG	2
AGAGGGAAATGCCACATTGGAGA	1
AGAGGGAAGGCTGCACATGTAGGC	1
AGAGGGAATATTCTACGAAGATGC	1
AGAGGGAATATTTCACGAAGATGC	2
AGAGGGACGCGACGTATCTATGAC	1
AGAGGGAGACCTGTCGATGTTTGC	1
AGAGGGAGAGCCCGCTAGATGTGT	1
AGAGGGAGGTTGGCCAGAAGAGAA	1
AGAGGGATCCCCTTATAGGTTGGC	1
AGAGGGCAACCGTGTGGTGAGCAG	1
AGAGGGCCATAATACCCGATGTGA	1
AGAGGGCCCGTCCTTGGT	2
AGAGGGCCGACGAATTAGGTCCCG	1
AGAGGGCCGCATGTGAAAATCAA	2
AGAGGGCCTTACTGGATGAGCGGG	1
AGAGGGCGATTTTCTACTGTGCGG	1
AGAGGGCGGCAAGGGTTTTCCTGC	1
AGAGGGCGGCGAAAATGACGTGGC	1
AGAGGGCGGTTTCGTTGATGTGAC	1
AGAGGGCGTCCTATAATTTGGGAC	1
AGAGGGCGTTCGATGTTTTACTTGA	1
AGAGGGCTATGGTAATATTGAAGG	1
AGAGGGCTGATATACAACGGAAT	2
AGAGGGCTTACTATCAAAAACTGA	1
AGAGGGGAAAATCAGGGTGCTCGC	1
AGAGGGGACCGACACTGAGCCAGA	1
AGAGGGGAGAACTGGATCTAGGAG	1
AGAGGGGAGGAGGTGCTATTGTAT	1
AGAGGGGATTGAAGAGAATTGGAG	1
AGAGGGGCCGGCTGAGGACAAGCC	1
AGAGGGGCGAACATGCAGATTGAT	1
AGAGGGGCGGTGTGTGCAGTGAGA	1
AGAGGGGCTATGTCAATTTGGGAC	1
AGAGGGGCTCATCGGGGATGATGG	3
AGAGGGGGAGGGAGCCACCATGCC	1
AGAGGGGTTGACGGGGTGGTAAAA	3
AGAGGGTAAATAACGGGTCCACCA	1
AGAGGGTACCGGCACATGTTGCGG	1
AGAGGGTACCGGTAAACGATTAA	2
AGAGGGTAGTTTCGTTGACATGGA	1
AGAGGGTCACGTGATATGGTTTAG	1
AGAGGGTCTACACATTAAGGTTCC	1
AGAGGGTCTACGTGTCAGTAACAA	1
AGAGGGTCTAGAATGGTGTTGCCT	1
AGAGGGTGACCTTCACTAGTCCTG	1
AGAGGGTGCGTCGTAGAAATCGGT	1
AGAGGGTGCTGACGTGGCCACGCG	1
AGAGGGTGGCCGGACTCATTGGAA	1
AGAGGGTGGTCCGGTTGAATTATG	1
AGAGGGTGGTTGCTGTCGAATTG	1
AGAGGGTGTACATACATCTAGGT	2
AGAGGGTGTCTGGTTGATTGCTTC	6
AGAGGGTGTGCAAATTTGGACCAA	1
AGAGGGTGTGCAAATTTGGAT	1
AGAGGGTGTGCAAATTTGGATCAA	2
AGAGGGTGTTACCTTGATGTATAG	1
AGAGGGTGTTCCGGGTGGTCCTGGA	1
AGAGGGTGTTCTCTACGAGTGTAAA	1
AGAGGGTGTTTGGAAATTAGAGA	2
AGAGGGTGTTTGGGAACTAGGGA	1
AGAGGGTGTTTGGGAACTAGGGAC	2
AGAGGGTGTTTGGGAGAGAGACCC	1
AGAGGGTGTTTGGTTGCGAGCCACA	1
AGAGGGTTCCTGGTACAGTTGTT	1
AGAGGGTTTCCATAATATGTGGGA	1
AGAGGGTTTGAGAAGATATGGAC	1
AGAGGTAACCTATACAATATGTCA	1
AGAGGTAACTTGTTCACAGGA	1
AGAGGTAAGTGTGCACGTTATGAG	1
AGAGGTAATACCCTACTCCTGTTT	2
AGAGGTACCAAATGTTGGATGGTA	1
AGAGGTACCAAATTTACAATAGA	1
AGAGGTACCAAATTTATAACAGAA	3
AGAGGTACCAAATTTATAATAGAA	1
AGAGGTACCAAATTTGCAATAGA	2
AGAGGTACTGTCTTGTGATGCCAA	2
AGAGGTACTTGCTTGGGCGAAAGA	1
AGAGGTACTTGCTTGGGCGAAGG	2
AGAGGTACTTGTACAGTAAGGCCG	1
AGAGGTAGAGCTGTACCAAACAGG	1
AGAGGTAGAGTTAGAGCTGTGCCA	1
AGAGGTAGATCTATAGGGCATA	1
AGAGGTAGCCTGGTAGGCGAGATA	1
AGAGGTAGCGCACTGAGTTAGGAC	2
AGAGGTAGCTTATCTAAAGTGGA	1
AGAGGTAGGGTTTACGTGCGTGCA	1
AGAGGTAGGGTTTGCTTGCGTGCA	1
AGAGGTAGTACTATGAACCCATAC	1
AGAGGTAGTAGCGAACTCGTGTGT	2
AGAGGTAGTGTAGATGTGATGTAT	1
AGAGGTATAGAAGGGATTAGGTGA	1
AGAGGTATATACAGGGTTAGCCAA	4
AGAGGTATCTATAGGTCTGGTGG	3
AGAGGTATGCCTGCGAAGATAGA	2
AGAGGTATGGCTACTGATGTGGTA	1
AGAGGTATGTCCAGATTCATAGTA	1
AGAGGTATGTCTGCGAAATAGATT	1
AGAGGTATTTTCGTAAGTGGATC	1
AGAGGTCAAACGGAGAGTGATTGT	1
AGAGGTCACTAATACAGAGGATGG	1
AGAGGTCAGAAACAATAAGAGAAC	4
AGAGGTCAGCAATGGCATGTGCCA	1
AGAGGTCAGTTGATACATTTTGTA	2
AGAGGTCCACCTACGAAAATAGGC	1
AGAGGTCCACCTACGAGAATAGG	1
AGAGGTCCACCTATGATAATAGGT	2
AGAGGTCCACTGCCACTATAGCGG	1
AGAGGTCCGCCTGCAAAAATACCT	1
AGAGGTCCGCCTGCGAAAATTGAT	1
AGAGGTCCGCTCATTTTTGCATAC	1
AGAGGTCCGCTTTACAAAATACAG	4
AGAGGTCCTCGGTGGTGAGTGTT	1
AGAGGTCGAAGCGATACAGTCTTG	1
AGAGGTCGACGTGGTGGTGTAGAG	2
AGAGGTCGAGCGTAAGGAATGCAT	1
AGAGGTCGCTGACACGTAGGTCCC	1
AGAGGTCTAGTACGGTCGGGATAC	1
AGAGGTCTGCCTGCGAAAATACCT	1
AGAGGTGAAAATGAGTCAGATGCT	2
AGAGGTGAAACTGTGCCAAAGTGCC	1
AGAGGTGAAGCTGGAGCTGTGCTA	1
AGAGGTGAAGTTAGGTTTAGCCTGC	1
AGAGGTGAATGAATGTTGTGCTCC	2
AGAGGTGACCACACCTACAAATCC	1
AGAGGTGACCACATCTGCTCATCC	1
AGAGGTGACCTACCTGTGACGGGC	1
AGAGGTGACGACTGGGTGGTCTGG	1
AGAGGTGACGCGTGGATGGATAAA	1
AGAGGTGACTGGTTAGTCCTGGGT	3
AGAGGTGAGACTATATATTAGGGC	1
AGAGGTGAGAGGAATGGTTGAGTG	3
AGAGGTGAGCCATTAGTATATGAT	3
AGAGGTGAGCTCGGATTGGGGGT	1
AGAGGTGAGGCTTCGAACCCGGA	2
AGAGGTGAGGGCAATCTATGTCCA	1
AGAGGTGAGGGTTACAGGAAAGAG	1
AGAGGTGAGGTGAGGCCAATCTGC	1
AGAGGTGAGTATGCGTGTTGTAA	1
AGAGGTGAGTGTGCGCACGTTGTG	1
AGAGGTGAGTTGTGCTGGGTGCAT	1
AGAGGTGATACATACTACTTACAC	1
AGAGGTGATACATTGTATGGGTT	2
AGAGGTGATATGTATAATAGATTA	1
AGAGGTGATATGTATAATAGGTC	1
AGAGGTGATATTGTGGGAAGCCAA	1
AGAGGTGATGAACTACTTGCCATA	1
AGAGGTGATGCATTGTATAGGTT	1
AGAGGTGATGGAAATTGATAAGG	1
AGAGGTGATGGAAATTGATAGGGA	3
AGAGGTGATGGGCCGTCTCGAGAT	1
AGAGGTGATGTAGATGTGGTGTA	1
AGAGGTGATGTAGATGTGGTGTAT	1
AGAGGTGATGTGGGGTCGCTTGAA	1
AGAGGTGATTCGCCAAGGGTGTA	1
AGAGGTGATTTGTGTATTAACAGT	2
AGAGGTGCAAGGAGATTAATGAGA	1
AGAGGTGCAAGGCTTACAGAAGTG	1
AGAGGTGCAAGGGGTGTATGCA	1
AGAGGTGCACAACTAGTTGTATTA	1
AGAGGTGCACACATGGTGAAGATA	2
AGAGGTGCAGTGAGAGGTCCACCA	1
AGAGGTGCAGTTTGAGCTAGAGT	1
AGAGGTGCTAGTTAATGTATGTAT	1
AGAGGTGCTCACGGGGGTATCCAT	1
AGAGGTGCTCATAAGGGTATGATG	1
AGAGGTGCTCATAGCGATAGAATA	1
AGAGGTGCTCATAGGGATAGAGTA	1
AGAGGTGCTGATGCAGGTCGCTAC	1
AGAGGTGCTTTCATAGGAGTAGA	1
AGAGGTGCTTTTGATTTGTACTAC	1
AGAGGTGGAAAGCATTTATTTGCA	2
AGAGGTGGAACTATATATTAATGG	1
AGAGGTGGACCTGAGTTTAAACAG	1
AGAGGTGGACGAGGTCGGCGAGGT	1
AGAGGTGGAGCCTAGCTGGCGCTG	1
AGAGGTGGAGCTAAGTTTTGAGTT	1
AGAGGTGGAGCTAGAGCTATGCCA	2
AGAGGTGGAGCTAGTGCTAGTCAG	2
AGAGGTGGAGCTGAGTTTTGACAG	2
AGAGGTGGAGCTGGAGCTATGCCA	1
AGAGGTGGAGCTGGATTTAGGCAG	1
AGAGGTGGAGCTGGGTTTAGACTG	1
AGAGGTGGAGCTGGGTTTAGGCAG	1
AGAGGTGGAGCTGGGTTTAGGTAG	1
AGAGGTGGAGCTGGTTTTAGACAG	1
AGAGGTGGAGGGCCGTTTCCTGGG	1
AGAGGTGGAGTTAGGTTTAAGCA	1
AGAGGTGGATTTAGGTTTAGACTA	1
AGAGGTGGCAGGAACAGAGGTGAT	2
AGAGGTGGCCTCCACATAAACTCT	2
AGAGGTGGCGATGGTGTTGGTTCG	1
AGAGGTGGCTGGTGCACTCATTGT	2
AGAGGTGGCTGTGTATTCCTCAGG	1
AGAGGTGGCTTCTTAACTAGTTGG	1
AGAGGTGGGCAGCGTTAAGGGCA	2
AGAGGTGGGCCACTGATGATGACA	3
AGAGGTGGGCCGCTGACGGTGACA	2
AGAGGTGGGCCGCTGATGGTAACA	1
AGAGGTGGGCCGCTGATGGTGATA	2
AGAGGTGGGGTGGCTATGTGCAGT	1
AGAGGTGGGTGTCACCTGTGACGG	1
AGAGGTGGGTGTCACCTGTGATGG	2
AGAGGTGGTCGATGATGACATTGG	1
AGAGGTGGTCGGCGACGAGTACGG	1
AGAGGTGGTCTTAGAGCTCATGGC	2
AGAGGTGGTGACAACCTCAAGAGC	1
AGAGGTGGTGGGTTACACGAGAGG	1
AGAGGTGGTGTAGATATGGTGTAT	1
AGAGGTGGTGTAGATATGGTGTG	2
AGAGGTGGTGTAGATGTGGTGTA	1
AGAGGTGGTTTTGGCTGACGTGGC	1
AGAGGTGTAACTAGTTATCTGT	1
AGAGGTGTAACTAGTTATCTGTGA	2
AGAGGTGTACAACTGGGTAATGCG	1
AGAGGTGTACCACTGTACCCACAA	3
AGAGGTGTAGCTGGATTTAGGCT	1
AGAGGTGTAGGATAAGTGGGAG	1
AGAGGTGTATCATCTAGGTCCCTA	1
AGAGGTGTATCGATCGCTAAGGCG	1
AGAGGTGTCAGAAGTGTTAAGCAT	1
AGAGGTGTCGCACTCTCACAGCGG	1
AGAGGTGTCGCACTCTCGCAGCGA	1
AGAGGTGTCGCACTCTCGCAGCGG	2
AGAGGTGTCGCCGGAGAGACGGAG	1
AGAGGTGTCGTTCTAAATTTAGAG	2
AGAGGTGTCTCACTGGTGCTGATG	1
AGAGGTGTCTTGCTTAAACCAATG	1
AGAGGTGTGACGTGAGAATGGACA	3
AGAGGTGTGAGTTGTAGCTCTGGT	1
AGAGGTGTGCCAGAGTTGTTGGTA	1
AGAGGTGTGCCTGTGATAATGCAT	1
AGAGGTGTGGAACTAATCCCGGTC	1
AGAGGTGTGGCTCTATTAGGCTAG	1
AGAGGTGTGGCTCTATTTGGCAAG	2
AGAGGTGTGGTCGGACTGGCCTGA	1
AGAGGTGTGTGCGTATGCGTCTAC	1
AGAGGTGTGTTTAGTTTACGTCAA	1
AGAGGTGTTATCGTTGCCGAGCTA	1
AGAGGTGTTATTATGGGCTGGTT	1
AGAGGTGTTCATAAGGTGCGAG	1
AGAGGTGTTCATAGGGATAGGGTG	1
AGAGGTGTTGTATGCATATGGA	1
AGAGGTGTTGTCTATAACGTACGA	2
AGAGGTGTTTAGTTTAGAGGTGAG	2
AGAGGTGTTTATAGGGTTGTGAGT	1
AGAGGTGTTTATTACCTTTGATGG	1
AGAGGTGTTTGGGTCATCGGAGCA	1
AGAGGTGTTTGGTTGACGGACGAG	1
AGAGGTGTTTGGTTGAGGGGTGAG	1
AGAGGTGTTTGGTTTGCTACCTA	1
AGAGGTTAAATGATTCAAAGGGTA	1
AGAGGTTAGGAACATGGGTTGC	1
AGAGGTTGAAGGTGAAGGATGTC	1
AGAGGTTGACACGTCAGATGATGA	1
AGAGGTTGAGAGGGTGTTCTTGAG	1
AGAGGTTGCCCCTTACATGAGGG	1
AGAGGTTGCTAACACCGCCTGCTA	3
AGAGGTTGCTGAATAGGAGCTCGG	1
AGAGGTTGTCTATATATCTTGTGA	1
AGAGGTTTCCTACTTTCCTGGTCC	1
AGAGGTTTCTTCAAAGCGGTGCCC	1
AGAGGTTTTCGGATACGAATGA	1
AGAGTAAAGTGCACGGACGGTCCA	2
AGAGTAAATTAAGTAGGTGGTACC	2
AGAGTAAATTGCATTGGTGGTACA	2
AGAGTAACCTTTAAGATGGGTCCC	1
AGAGTAACTATGCCAACTCCGCTCC	1
AGAGTAAGACGTGAATGAGCAAGC	2
AGAGTAAGGGTGAGTACTTTTGT	1
AGAGTAATACTACGGATGATGCG	1
AGAGTAATATTGATACGCCCCGAC	3
AGAGTACCCGCAATGGTAAAGTGC	1
AGAGTACCGACCCAATCCTACCTA	1
AGAGTACCGCACGCGAAAATCCCC	1
AGAGTACTGATCGGTGGTCGGATC	1
AGAGTAGAAAGAGAGCCAAACATA	1
AGAGTAGAGGTGCCAATGTACTGAT	1
AGAGTAGATTTATCTCTAGGGTTC	2
AGAGTAGCTTCGGTTAGTGAGGAC	1
AGAGTAGGAGCGGTGATGGCGAGC	1
AGAGTAGGGCTCAATTGATGTAAT	1
AGAGTAGGGTATTATGCCTCCAAG	1
AGAGTAGGTAAGTAGTCGGTTGG	1
AGAGTAGTACAGATGATGCGGTGA	1
AGAGTAGTCCATATGAGAGGTGTA	1
AGAGTAGTTTGACTTTGACTAAAG	1
AGAGTATAAGGACCTAGATGACAC	2
AGAGTATATGCGAGATTGAGGTAA	1
AGAGTATATGGAACACGACACACC	1
AGAGTATATGGGCCTGTTTGAGGA	2
AGAGTATCTGAACTGCGTGTT	5
AGAGTATGAAGATGAAGGCGTCGA	1
AGAGTATGACGCGTGGGCCAATGT	1
AGAGTATGGCATGCGGGTCCTACA	1
AGAGTATGGTGGATCTAGGTATA	2
AGAGTATTAAGGAGGGTGCCAAGG	1
AGAGTATTGGCAGATGGCGGCGAA	1
AGAGTATTTCGTTGACGAGGTAGT	1
AGAGTATTTGCGGTGATGGACCA	1
AGAGTATTTGCGGTGATGGACCGG	1
AGAGTCAAAGTAGGAATGATGGA	1
AGAGTCCAAATTGGTGACGGACAAA	1
AGAGTCCGCCTAAGGGATTTGTTC	1
AGAGTCCTATTAGATAACTAATC	1
AGAGTCGAATGTGCCTGTGATGAG	1
AGAGTCGAATGTGCCTGTGATGAGC	1
AGAGTCTATGACTAGTGGGACCAA	1
AGAGTCTATGTAAGAGTCCTTGTG	1
AGAGTCTATTCGTTATTTGTG	1
AGAGTCTTGATGATGGTGATTGGT	5
AGAGTCTTGTCTAACTGATTGGTA	1
AGAGTCTTGTCTCTGTGGTGTTGC	1
AGAGTCTTTTCAAAGGTTTGGTTC	5
AGAGTGAAATTAGATGTGTTTGAA	1
AGAGTGAAGAGGGTACTTGAAAGC	1
AGAGTGAAGGTGGTCCAATGTGAA	1
AGAGTGAAGTTATGGAGCTGCCTA	1
AGAGTGAATCTATATATGGAGCGG	1
AGAGTGAATGTAACGTGTGTGTA	1
AGAGTGAATTCTAGGGTAAACAGC	1
AGAGTGACACGAAGCAAAGAACTC	1
AGAGTGACCACATTAGCTTTGTGA	1
AGAGTGACTGAGTGACTGGCGCCT	1
AGAGTGAGATAAGTAGACTGTTGG	1
AGAGTGAGATAGAGAAGCTGTTGGA	1
AGAGTGAGATGAGTTGGGAACT	1
AGAGTGAGGCGAGGGTGCAAAGG	1
AGAGTGAGGGTGGTCTAATGTGAT	2
AGAGTGAGTGATGGTAATTGTATT	1
AGAGTGAGTGCATGTACGTTGTGA	1
AGAGTGATATCTGGATAGTGCTA	1
AGAGTGATATCTGGATAGTGCTAA	1
AGAGTGATATTTTGGAATGGAGGG	2
AGAGTGATCCAAACGAGGAGGTGA	1
AGAGTGATGTACAAGCTTCGGTAT	1
AGAGTGCACACATCCAACAGGAATC	1
AGAGTGCACGAATATCGAGGCGCA	2
AGAGTGCCACATTGGATTGAGTGA	1
AGAGTGCCACGTGACGATATAGG	1
AGAGTGCCACTTGGTGATCTAGGA	1
AGAGTGCCAGAAGGGGTATGTACA	1
AGAGTGCCATGCATAGCTAATTTG	1
AGAGTGCCCTTAGTTAGTGAAGTC	1
AGAGTGCCTTTTCATTGAATAGAG	1
AGAGTGCGACCCAAATTTGAGTGT	3
AGAGTGCGAGTCATCTGTGTAGGTT	1
AGAGTGCGCCGCGGTTTTCTGCTG	1
AGAGTGCGGACTACAGACTTGTAG	1
AGAGTGCGTATGATTAATTAAGTA	1
AGAGTGCTATTCAGGTCACTGCAA	1
AGAGTGCTCAAAGCAAGCCATCGCTCTGG	2
AGAGTGCTGGCCAAGGAAGAACGC	3
AGAGTGCTTATGCCAGTCATCCG	1
AGAGTGCTTTTTTCTTGATAA	2
AGAGTGGAAAGATGGTTGAGGGT	1
AGAGTGGACTCTGAAGAAAGTGAC	1
AGAGTGGAGGTAAAAATATCAGGA	1
AGAGTGGCATTTGAGAACTGGTAT	1
AGAGTGGCCGAAGCTAACAGGCA	2
AGAGTGGCGGCGCGACGGTGACCC	1
AGAGTGGGTGTGTCTATGAACTGT	1
AGAGTGGTCAGCGGCGTATGTGTC	1
AGAGTGGTGCACTATTTTTTTCGG	1
AGAGTGGTGGCGGTTGATATGACA	1
AGAGTGGTGTCTATTACTAGTTTC	2
AGAGTGGTTACCCAAAGTGAGGAA	1
AGAGTGGTTGTGCCTTATATTTTG	2
AGAGTGTAACAAGCAGGGCCTTGC	1
AGAGTGTAGAGGAAGACGAGCCGT	1
AGAGTGTAGATGGTAAGCCCTGAC	1
AGAGTGTAGTTTCTATTGTGATGT	1
AGAGTGTAGTTTTTATTGTGATGT	1
AGAGTGTCACATTGGATTGAGTGA	1
AGAGTGTCCAAAATTGGTGGGAAA	1
AGAGTGTCCTCGGGTAAATTCACG	1
AGAGTGTCCTCGGTTAGTGAGGA	1
AGAGTGTCGTATGGGTTGTTCGG	1
AGAGTGTGACCCACGTTGGACCCT	1
AGAGTGTGCAAATTTAGATCAATG	1
AGAGTGTGCACAATTTGATGTTCT	1
AGAGTGTGGTTGTGGAGTAGCCTA	1
AGAGTGTGTAAGGCCATGGATTG	1
AGAGTGTGTAAGGCCATGGATTGG	1
AGAGTGTGTAATATTGACTGGTTC	1
AGAGTGTGTATCGGCTACGGATGG	1
AGAGTGTGTCTATCAAGTAAG	1
AGAGTGTGTCTATCAAGTAAGCCA	1
AGAGTGTGTTTAGATGGTGGAGAA	1
AGAGTGTTGACAATGAAATTGTGC	1
AGAGTGTTGGTGATATGCCCTAGA	1
AGAGTGTTTTATAAGTGCCATTTG	2
AGAGTGTTTTGAGGTAGCCACATG	1
AGAGTTAAAGGTGTTGCAAGTGAG	1
AGAGTTAAATGCCACATCAAAGAG	1
AGAGTTAAATTTAGGAGTTGAAGC	1
AGAGTTAAGAGTTCAGGGTGTGAA	2
AGAGTTAAGGGACCTAAATGACAC	1
AGAGTTAATAACAGGGTAGGATGG	1
AGAGTTAGAGCTGTGCCATCTGTG	1
AGAGTTAGCTATATCGGTGTTTAA	1
AGAGTTAGGGTTAATACATCTGCA	1
AGAGTTCAAGATGCACGTGTGTA	1
AGAGTTCCTGCTAAGGTGATGTGA	3
AGAGTTCCTGGAACTAGCAACTA	1
AGAGTTCGTCCATCGCTGGTGTCG	2
AGAGTTCTCCTCGATCTACACCGC	2
AGAGTTGAATAAGAAGGTTGTTGG	2
AGAGTTGAGGAGGGTGGTTAACA	1
AGAGTTGATCAGCTGCTGTGA	1
AGAGTTGATGCACGTGGTTGATGG	4
AGAGTTGATTAGGTAGAGAGTGGT	1
AGAGTTGCCTGCCTACGTCTCCTC	1
AGAGTTGCTCGAACTGGGCGGCCA	1
AGAGTTGCTCTAAAGCATCCGTGC	1
AGAGTTGGAAAGTGGATATATGC	1
AGAGTTGGAGGGTGTAAAATGGAC	1
AGAGTTGGCCTTTGAAATGTGGA	1
AGAGTTGTAGGAAACTGAACT	1
AGAGTTGTATGATTGGGTGAA	1
AGAGTTGTGATTGGATGAGTAGT	1
AGAGTTGTGGAGCTAGATTTAGAC	2
AGAGTTGTTCGATGGATTGATGC	1
AGAGTTTAAGGACCTACATGACAC	1
AGAGTTTACTGTGTTGTTGGGTT	1
AGAGTTTAGGACCTAAATGGCGCA	2
AGAGTTTAGGGACCTAGATGACAC	1
AGAGTTTAGGGACCTATATGACA	1
AGAGTTTAGGGACCTATATGACAC	3
AGAGTTTAGGTAGCTAGATGACAC	1
AGAGTTTATGGACCTAGATGGCAC	3
AGAGTTTATTGACGGCGTGCACTA	1
AGAGTTTATTGTTTCTTGTGCCA	2
AGAGTTTCTTGACTCTTGTGTCTA	6
AGAGTTTCTTGGTTCTTGTGTCTA	1
AGAGTTTGCCATGATCTTCGAGAT	1
AGAGTTTGCCTCGATTTGGTACC	1
AGAGTTTGCCTTTTTGTTGGATGG	1
AGAGTTTGGGGACCTAGATGATAC	2
AGAGTTTGGGGACCTATATGACAC	2
AGAGTTTGGGGTGTCAAATGTCTG	1
AGAGTTTGGTGTCAGTTGTTAGG	1
AGAGTTTGTGGAAAGTTTGGTGCG	1
AGAGTTTTGCAATTTCGTGGACCT	1
AGAGTTTTGCCCATTAGTATACCC	1
AGAGTTTTGCCTAATCTATAAGAG	4
AGAGTTTTGGGCCAGAATTTTGGG	1
AGAGTTTTGTATGTTGGACCGTAT	4
AGAGTTTTTGCTTGCAACGTTTGA	1
AGATAAAACAGAGCTGTGTTGGTC	1
AGATAAAAGAAGAGAGAAGAGCA	1
AGATAAAAGAGGAAATAAAAGAGC	2
AGATAAAAGATTGAGTCTATGACG	2
AGATAAAATAGAAGAGAGAAGGGCA	1
AGATAAAATCATGTACCTGGTTGC	1
AGATAAACCCTGGGTTTACGTGTC	3
AGATAAACCTACAAGAGTATTGAA	1
AGATAAACGATGAGAGAGAAGAGC	2
AGATAAAGATGCTAAGATTTGTGCA	1
AGATAAAGCCGTTGCCCACGCTGG	2
AGATAAAGCTGATTCAGATCTGAGCCAA	1
AGATAAAGGGACAGTTGATGGCAA	1
AGATAAATATGGGCTCATACCAAA	1
AGATAAATCTTGATCTAATGCCTA	1
AGATAAATGAGGTTGATTGGGATA	2
AGATAAATGGTCAAACATGTGTGA	1
AGATAAATGGTTCTTCTGAATGAC	1
AGATAAATGTGTATATAAGGATGC	1
AGATAAATTCGGGTGCTGTGA	2
AGATAAATTGGAGCTTGTAGTGGG	1
AGATAACAACATTAAGGGTGCTA	1
AGATAACAACATTAAGGGTGCTAT	1
AGATAACATACAATAAACGGGTGA	1
AGATAACATGAGGTACTTGAGAAG	1
AGATAACATGTAAGGATGAACGCC	1
AGATAACCATAGCGGGTGCCCTAAG	1
AGATAACCATTATGGGTGGCCTAA	1
AGATAACCATTGCGGGTGCCCTAA	1
AGATAACCATTGCGGGTGCCCTTA	1
AGATAACCATTGTGGATGCCCTAA	1
AGATAACCATTGTGGATGCCCTT	1
AGATAACCATTGTGGGTGCTCTAA	1
AGATAACCTAGAAACGGATGTGAC	2
AGATAACCTAGTACTATGATGTGA	2
AGATAACTGCTATCGGTGACGGTA	1
AGATAACTTCGGTCCTATGTTCAT	1
AGATAAGCAGGAGGCACAGGCGAC	1
AGATAAGCCACTACATGAAAACCT	2
AGATAAGCCTTTCTCCAGTAGTGG	1
AGATAAGGACCGTGTGGTGTGGAC	1
AGATAAGGAGACGTCCGGACGGTC	1
AGATAAGGGGCCCGAATCTGT	2
AGATAAGGTCGTCCACGTCAGGT	2
AGATAAGGTCGTCCACGTCAGGTC	2
AGATAAGGTCGTCGACATTAGGT	1
AGATAAGGTCGTCGACATTAGGTC	6
AGATAAGGTGATACCTGTGACAGA	1
AGATAAGGTTGTCCTCCATCCGAG	1
AGATAAGTATGGATCTTGGTGGTC	1
AGATAAGTGTTATCCGTGACGGGC	2
AGATAAGTTAGGTATAATTGTAGC	1
AGATAAGTTTAATGCCCGTCACAGA	1
AGATAAGTTTTGGGACCTGGATAC	1
AGATAATAAATCGGGGCTACGAAT	1
AGATAATAAATCTGGTTAAGCCTG	2
AGATAATACATGCATCTAGGTGGC	1
AGATAATAGGGTATACACACGTAC	1
AGATAATATAGTTGTGCGGAAGTT	1
AGATAATCCACTTAGTGCCACTGA	1
AGATAATCTGGAGCTAGTAGTTGG	1
AGATAATGATATAAAGGCGGCTGA	1
AGATAATGGGAAAGTATATTCGAG	1
AGATAATGGTGTAGATCTTGA	1
AGATAATGGTGTAGATCTTGATGG	1
AGATAATTAGGGCCTGAATTCGAC	2
AGATAATTTAGGTAGCACATATGA	1
AGATAATTTGGAGCCAGTAGTTGG	2
AGATAATTTTATATAGGTGCTAGC	1
AGATACAAGATATAAGGGTGTGGC	2
AGATACAATAATTGGCAAGTGCAA	1
AGATACACAAAATCATCCACTGCG	1
AGATACACGTAGTAGGTGGCTGAA	1
AGATACAGATAGGCCTATTTGCC	1
AGATACAGTGTGTATGACAGATGA	1
AGATACATAAAGCCACCTAAGGAC	1
AGATACATAGCCAGGGTTTGTCT	4
AGATACATTGGCCTAGTCTCTAGA	1
AGATACATTGTCTACCACTTGTCA	1
AGATACCACAGATAATTGATGCTC	1
AGATACCGATCGCCATGTGGATGT	1
AGATACCGGGTTGATACATCTTAG	3
AGATACCTACAAGACTTCGGGTTT	1
AGATACGCAAAACGAGATGAGCCA	5
AGATACGCAAAACGAGATGAGCCG	1
AGATACGCAAAACGAGATGAGCT	1
AGATACGCAAAACGAGGTGAGCC	2
AGATACGCAAAACGAGGTGAGCCA	4
AGATACGCAAAACGAGGTGAGTC	1
AGATACGCAAAACGAGGTGATTAA	1
AGATACGCAAAACGAGGTGCATGA	1
AGATACGCAAAACGAGGTGGGCCATTAGCAT	1
AGATACGCAAAACGAGTTGGGCC	2
AGATACGCAAAATGAGGTGAACCA	2
AGATACGCAAAATGAGGTGGGCCA	1
AGATACGCGTTTTTATGGTGTCCC	1
AGATACGGAGCGAATACGAGACGG	1
AGATACGGGAGAGTGCTAAATACG	1
AGATACGGGTACATATGGTTGAAG	1
AGATACGGTGTCCACTAGCAAAT	1
AGATACGTAAAACGAGGTGAGCC	1
AGATACGTAAAACGAGGTGAGCCA	2
AGATACGTGGTGCTAATAGGGGAC	1
AGATACGTGTGTATGATAGGTGAG	1
AGATACTAATATCTCACGGTACC	1
AGATACTACAGCAGCATCGGATGC	1
AGATACTATGAGGTACCAAATTTT	2
AGATACTATTTAATAGTAGGTGCA	2
AGATACTGCGTGGTGAAATTTTAA	1
AGATACTTATAAAGGTAGGGTGTG	1
AGATACTTGGGTGCAAACGGGTGG	2
AGATAGAAGTGAATGGTGGAATGT	1
AGATAGAATGCCGAAAATCAAGAG	2
AGATAGACCGACCGGTTGAGGTGT	3
AGATAGACGATTAAAATTGGGTAC	1
AGATAGACTAAGGAAGTAAAAAGT	2
AGATAGAGAAGCTGTTGGAGATGC	4
AGATAGAGGCTGTCCAAAGTTTGG	1
AGATAGAGGTGACTACCACATCC	1
AGATAGAGTGTTAGAAGTTGATTT	1
AGATAGATATGCTGTTGGAGATGC	1
AGATAGATGATAAAAGTGAATGGT	1
AGATAGATGCCAGTTTTGAAACCG	1
AGATAGCAAAAAGCCTACCTTTTTA	1
AGATAGCACGTCCACGTACCTAGA	1
AGATAGCATGCAAAAAACGGGTGG	1
AGATAGCCATCTCGATCGAGACGC	1
AGATAGCCATGCTGTTGGAGATGC	2
AGATAGCCATTGAGGTGAGGGACT	1
AGATAGCCGGTGATTCGGGTTGTC	3
AGATAGCCTAAATTCAATCC	1
AGATAGCGAGAATACTGTGGCGCA	1
AGATAGCGAGATAGCCACTACAAG	1
AGATAGCGGGTGATATTATGGATG	1
AGATAGCTACCGATGGGCCTA	1
AGATAGCTAGTGGCAAATAATTAA	1
AGATAGCTCTAACTCAGTAGGTAC	2
AGATAGGAAGGTGTCTAGATTTAT	1
AGATAGGACCTACATTTAAAGGAG	1
AGATAGGACCTGCTTTATAACATG	1
AGATAGGATGTGCCTTAACGCTAT	1
AGATAGGATGTGCGTGTGTGATGA	2
AGATAGGCCGGCCGACCTCTCT	1
AGATAGGGATATGTGACACACACA	1
AGATAGGGGCAAACATACATCATG	1
AGATAGGGGCGCCACAATATAGCT	1
AGATAGGGTGAAATTTACTCTGGA	1
AGATAGGTAACAGCGAAAAATGGT	1
AGATAGGTAGCTAAGGTAATCTAG	1
AGATAGGTCCACCTACTAAACTGG	2
AGATAGGTGAAACTTGCTTACAAG	1
AGATAGGTGGTGTTTGAATCTTCTG	1
AGATAGGTGTCGGTTAAAAAAAAC	1
AGATAGGTGTCGGTTTTAGAGAAA	1
AGATAGGTGTGTGCATAGGATAC	1
AGATAGGTGTGTGCATAGGATATG	1
AGATAGGTGTTGGTTGGGAATCCC	2
AGATAGTAAAGAGGAGGTGGCCA	2
AGATAGTAAGGGGCCGGTCACTT	1
AGATAGTAGAATCTAAGCAGATAG	2
AGATAGTAGATGCCATTACAAAAG	2
AGATAGTGAAAAATCAAAGGTGT	1
AGATAGTGAGAATTTGGTTTAGAC	1
AGATAGTGATGGAGCTAGTTAGGT	1
AGATAGTTAGGTGTCGCTCTTGAG	5
AGATAGTTTGGACGGTGGTTTCGG	1
AGATAGTTTTTGAGCAAACGAGGG	1
AGATATAAAAGGAGGACCTTGCC	1
AGATATAAAAGTAGGACCTTGCCC	1
AGATATAAATAAATGGTGCAGGGT	1
AGATATAACGCGTGGTGTTGAATA	1
AGATATACCAGTCGAAAGGATGCA	1
AGATATACGTGTCGAACAACGGCC	1
AGATATACTATTAAGGTGGTTTAC	1
AGATATACTATTGAGATGGTTTAC	1
AGATATAGGACTAGATTCGGGTGG	1
AGATATAGGCTTGGATATGTGTAT	2
AGATATAGGGTGGGACTTCTCTTC	1
AGATATAGGTGCACATATTTACGA	1
AGATATAGGTGCTCGTATTTACAG	1
AGATATAGTTGTTCTTGGTCTACGT	2
AGATATATAAATAGCAAGGGTGAG	1
AGATATATATGGGCATTACGTACG	1
AGATATATCCCGGCCTTTACTCAA	1
AGATATATGAGGGTCCACATGTCA	1
AGATATATGGTCCACATGTCAGT	1
AGATATCCGGTATCGTGGTTCAGG	1
AGATATCTGAAGTGAGTCAGCTGC	1
AGATATCTGGTGTCCCCCAACTTA	1
AGATATGACCGAGGAGATGGGCAT	1
AGATATGAGCTCTACGTTATCTAG	1
AGATATGAGGGTGTGGCCATGTT	1
AGATATGAGGTGCCCTTGATGCGC	1
AGATATGATAAGAGAGTACTGTGC	2
AGATATGATTTTGTTTGGGTGTT	1
AGATATGCCACTGAAAATATGTCG	1
AGATATGCCGGCCTAATATTTTAG	1
AGATATGCCTGGACTGACCCTATC	1
AGATATGCTATTGAGGTGGTTTAC	1
AGATATGGAGGCTACTACTAGACA	1
AGATATGGCTAATACGATTCTGAT	1
AGATATGGCTTACACTATATGAGG	1
AGATATGGTATCGATTATGAAGA	1
AGATATGGTCCAGGAACGAGCAGC	2
AGATATGGTGCAATTGTTACTACA	3
AGATATGGTGCATCCTAGTACGAT	1
AGATATGGTGCGAGCGGAACTGAA	1
AGATATGGTGTCTCTAAAATCCGG	1
AGATATGGTGTCTTGGTTAAAAGT	1
AGATATGGTGTCTTTGAAGACAGA	1
AGATATGTCTGGACATCATGGTAC	4
AGATATGTGAGAAAAGTGAATGGT	1
AGATATGTTATATCCAGTGCTAG	1
AGATATTAGGTGGAAGGATTCAAC	1
AGATATTATATAGGGTGTCATATG	1
AGATATTATCTGGTACTCTCAAGG	1
AGATATTGAGTGTACTACTAGCTA	2
AGATATTGGGCTTAGAGGATGAGG	1
AGATATTGTCAAAGGTGAGAAGTC	3
AGATATTGTTGAGGATGTCGGTAA	1
AGATATTTATAGCCTATCTCTCAG	1
AGATATTTCTGGGTGTTGGTTTGC	2
AGATATTTTATCTACATATGGTAC	1
AGATCAACACCGCCACGTAGATGC	1
AGATCAAGATGTTTGATGGCTGTA	1
AGATCAAGGCTGACTATATTCC	1
AGATCAATACTACAATCGGCGAAA	1
AGATCAATGCACGTGGTTGGTGAA	3
AGATCAATGTTGCCACAATCTTAA	1
AGATCAATTTTATCTAAGGGTGTA	3
AGATCACATCAAGATTCGTGCAGG	1
AGATCACCCCAGATAGGTCCGCCA	1
AGATCACGGTGGAGAAAAAGGTGG	1
AGATCAGAAGGTGAGGGCCAGGAC	1
AGATCAGAGGTGTAAAGTTTTAGC	1
AGATCAGATGTATGCGATGTGTCA	1
AGATCAGCACGGTTGCTGTCCGAA	6
AGATCAGCCTTGGTCAATGGTGAG	1
AGATCAGGGTGTAAAGTTTTGGT	1
AGATCAGGTGGAACAGTTGGCCAG	1
AGATCAGTTAATGTCTCAGTGGTA	1
AGATCATATAGGTGAGACTGATAA	1
AGATCATCAGGTCCACATGTCAGT	1
AGATCATCTTTTGTCTCGGTTGGT	2
AGATCATGACTTGGGTGTTACGTT	1
AGATCATGGTGTTATAACATATAC	1
AGATCATGGTGTTATAATATATGG	1
AGATCATGGTGTTATGACATATG	1
AGATCATTATTGATCAAGGGTTC	1
AGATCCAACGTGATTTTGGTCCTA	1
AGATCCAACTAGGAACCGTGTGCA	1
AGATCCAATAGTGGAGAGGTCCTA	1
AGATCCAATGTGGGTGTAGGAGGA	1
AGATCCACTTTGTGCAGTCTGCGC	1
AGATCCAGCAGGGACCCTACTAGA	1
AGATCCAGGGCAGGGCTGTAAAAT	1
AGATCCAGTGAGGAGGGTACGTG	1
AGATCCCGTGATTAGAAATGGAAC	1
AGATCCCTATATGGTTGGAGGTT	1
AGATCCCTATATGGTTGGAGGTTG	1
AGATCCCTTAGCCAGTTGTAGCAC	2
AGATCCGAAACCTATGATACCTAT	1
AGATCCGGTGAATGAAACGAATCG	1
AGATCCGGTTGTCGCCGACCTAAG	1
AGATCCGTCACAGATGAGTGCTT	1
AGATCCGTCCTACAAGTTAAATTG	2
AGATCCTGAACCTACACAATCCAA	1
AGATCCTTCCATCTGTGATGGCCC	1
AGATCGACACAAGGGAAAAAGTGA	1
AGATCGACGGTAGCAAACTCATGC	1
AGATCGAGCCGATGACTGCCTGAG	2
AGATCGAGTATTATAAAGGGTGTC	2
AGATCGAGTGCTAGCAACAAAACC	2
AGATCGAGTGGTGTATATATGTGA	1
AGATCGCTAATTTAGTTGGGCCTT	1
AGATCGCTGTCTGCGCTGACGTGT	1
AGATCGGATCTGCGGGGCCTGAGC	1
AGATCGGCTATAGATGAATTGGAG	1
AGATCGGCTTGGCTTAGAGAGGC	2
AGATCGGGACTAGACTCAGGGAGG	1
AGATCGGGCCACGAGAGAGAGCGT	1
AGATCGGGGTGAGGTTACAACGCC	1
AGATCGGTAACTATGAGTGCACTT	3
AGATCGGTCAACCGTTGGTGT	1
AGATCGGTGAGCAAAGTGTGGAGA	1
AGATCGTCACGGATATTAAGATGC	1
AGATCGTGGACCTATGTGAAACCT	1
AGATCGTGTTGATGGCAATATCGT	1
AGATCTAAGGTGCTACTGAGTTTC	1
AGATCTAAGGTGCTACTGAGTTTCT	1
AGATCTAATGATGCCTATAAAAGA	1
AGATCTAGCCTAACCTGCGCGGGA	1
AGATCTAGCCTAGTGGTGAAAGCC	1
AGATCTAGTGCACGATAAATTTGT	1
AGATCTCAAACCTACGATTAAATA	1
AGATCTCAATGTGCGTTTTACAAG	1
AGATCTCGACCTAAAGATGCATAGC	1
AGATCTCGATAGCCTGGTGGGGGA	1
AGATCTCGGGTGTGGATACGGGAG	1
AGATCTCTGTGTCTGACGTTTAAC	2
AGATCTGCTTAACTCCTGTGC	3
AGATCTGGGAGACGGCTACGACGC	1
AGATCTGTGTATGAAGGAGCTACA	1
AGATCTGTGTGTTTACATGCTCTG	1
AGATCTTAATTTGATGAGGTAC	2
AGATCTTGAGCCTACACAACCCAA	1
AGATCTTGTGGGTGTAGAAGGGA	1
AGATGAAAAACTGCTAATTTATG	1
AGATGAAAAATGTGGCGGTGATGG	1
AGATGAAAACTCGAGGACACGTAG	2
AGATGAAAGTGTGAATCTAGTGCA	1
AGATGAAAGTGTGCTAAAGAAATC	1
AGATGAAATAGTAAGATCAGGTAC	1
AGATGAAATGGCCGATTTATCAAT	1
AGATGAAATTGTTGTCTGCGA	2
AGATGAACAAGAAAGATGGGAGGA	1
AGATGAACAGTCAAACATGTGCTA	1
AGATGAACCTATTTTCGCTGGCGGC	1
AGATGAACGGTCAAACATGTGCTA	2
AGATGAACGGTCAAAGATGTGCTA	2
AGATGAACGGTCAAATATGTGCTA	2
AGATGAACGGTGGATGATTTTGGA	1
AGATGAACGGTTAAACATGTGCTA	2
AGATGAACGGTTAAGCATGTGCTA	1
AGATGAACGTTAAGGAGGACA	1
AGATGAACTAATGTGCACGAT	2
AGATGAAGAATAAATATGATTGGT	1
AGATGAAGAGTTGGCTATATGGGT	1
AGATGAAGATTAGGTCACGTGCCA	1
AGATGAAGCACTCGATACAGGAAA	3
AGATGAAGGTGAAGTTTTATACG	1
AGATGAAGGTTTCTCCGAGGAGTA	1
AGATGAAGTCCGTCATGCGGGTGA	1
AGATGAAGTGCAAATGAATTTGGA	1
AGATGAAGTGGTCTATATAGAAGG	1
AGATGAAGTGTCACTACAAAGCCG	1
AGATGAAGTTTAGGTTGATATGAG	1
AGATGAATACAAGGAATGGTGTAA	1
AGATGAATAGTAATCTGGTTTGCA	1
AGATGAATATTCTATGCCTATAGC	1
AGATGAATCTTTAAGCCTAATTGC	1
AGATGAATCTTTAGTGCCGATTAT	1
AGATGAATGCTAAAATATTGTGAA	2
AGATGAATGGCCAAACGTATGAAG	1
AGATGAATGGTCAAACACGTGCTA	1
AGATGAATGGTCAAACATGTGCCT	1
AGATGAATGGTCAAATACGTGCTA	1
AGATGAATGGTCAAATGTTGTGAA	3
AGATGAATGGTGTCTTTGTTTTGT	1
AGATGAATTGGAGCCAGTAGTGG	1
AGATGAATTGGAGCCAGTAGTGGA	1
AGATGAATTGGAGCTATTAGTTG	1
AGATGACACCTATCAGTGACGGGC	1
AGATGACACTGCAAAAATATGGAA	1
AGATGACAGATTTGAGAGAGGGAT	1
AGATGACATACAAGAAACAGGTGG	1
AGATGACATACAAGAAACGAGTGG	2
AGATGACATACAATAAACGGGTGG	1
AGATGACATGAAAGAAACGGGTGG	1
AGATGACATGCAAATAACGAGGGG	4
AGATGACATGCAAGAAACGGATGG	1
AGATGACATGCAAGAAACGGGTGA	1
AGATGACATGCAAGAAACGGGTGG	19
AGATGACATGCAAGAAATGGGTGG	3
AGATGACATGCAATAAACAGGTGG	1
AGATGACATGCAATAAACGGATGA	1
AGATGACATGCAATAAACGGGTGA	1
AGATGACATGCAATAAACGGGTGG	5
AGATGACATGTAAGAAACGGGTGA	1
AGATGACATGTAAGAAACGGGTGG	1
AGATGACATGTAATAAACGGGTGG	3
AGATGACATGTGCTTCTAATCGAA	1
AGATGACATGTTAGAAATAGGTGG	1
AGATGACCACTGTTTCTGTGCCAC	1
AGATGACCCTATGAGTGGATGGAC	1
AGATGACCCTCCGAGAGGATGGAT	1
AGATGACCGACGGCGTGCTGTGAT	1
AGATGACCTAGGTAAAAGTGTTTC	1
AGATGACCTATCTCTATTGGGCCA	1
AGATGACCTCGGGATTGAAACCAC	1
AGATGACCTGGATTTAAAACCTCA	1
AGATGACCTGGGTTCAAAGCCTCA	1
AGATGACCTGGGTTCGAAGTCTCA	1
AGATGACCTGGGTTTAAAGCCTCA	1
AGATGACCTGGGTTTGAAGCCTCA	2
AGATGACCTGTGTTTAAAGCCTCA	1
AGATGACGCGGTGTCTATCGGCAA	2
AGATGACGCTATTGACTTTTTCTCA	1
AGATGACGTGATTGTTTCACCTA	2
AGATGACGTGCTGCCTACGTGGCT	1
AGATGACGTGCTTGCCGCAATGGG	1
AGATGACGTGGCATGCCATGGTGA	1
AGATGACTAAATGTATGTGTGCAG	3
AGATGACTAATAGCTGATAGTGAC	1
AGATGACTACTAACCTCAATCGGA	1
AGATGACTATGCTACGTATATTCC	1
AGATGACTCATCAGTGACGGGCTA	1
AGATGACTTGGAGCCAGTAGTGGA	1
AGATGACTTTGACAAGTTATGGGA	1
AGATGAGAGGTGGGCCGCTGATGG	1
AGATGAGATGTAAAGAGCCTTGGG	2
AGATGAGCCAGCCAATAAAACGAT	1
AGATGAGGAAGAAGCTGGAGGTGG	1
AGATGAGGAGTCTGAGGGGCTTGC	1
AGATGAGGCCGCGTATGTGAGCA	1
AGATGAGGGAAGCCTAGGAGAGCC	2
AGATGAGGGACGTAAAGTTTTAGC	1
AGATGAGGGTAATTTCGCATGCGG	2
AGATGAGGGTGCGCTAGGATCTGC	1
AGATGAGGGTGTTCAAGCGCGAAC	2
AGATGAGGGTTCCATATTTCAATC	1
AGATGAGGTGATACCTGTGACGGG	1
AGATGAGTCATCAGTGACGTGTC	1
AGATGAGTCATCTCAATCGGGCCT	1
AGATGAGTCCATACCTAGATGAAA	1
AGATGAGTCTACGAAATTCAGTGA	1
AGATGAGTGCTTACGTTTGACGGG	2
AGATGAGTGGTCAAACGTTGCAAG	1
AGATGAGTGGTTAAACGTTACAAG	1
AGATGAGTGTCATCGGTGTCGGGC	3
AGATGAGTGTGCGTGTGTTACGAG	1
AGATGAGTGTGCGTGTGTTGTGAA	1
AGATGAGTTCAGGAGCATTGTGCA	3
AGATGAGTTTATGCGTGGCGT	1
AGATGATAAGATGGTCCCACACGC	1
AGATGATAAGTTGCTGGATTGAAA	1
AGATGATACATTCCAACTGAGCTC	2
AGATGATACGGAGCCATGGAGGTC	1
AGATGATAGAAAATCTACAGGAGG	1
AGATGATAGGTTGTTGGATTGAAA	1
AGATGATATGCAATAAACAGGTGG	1
AGATGATATGCAATAAACGGGTGG	3
AGATGATATGGGGACTTATATATG	2
AGATGATATGTAAGAAACGGGTGA	3
AGATGATCTACCTGTTGATAACGG	1
AGATGATCTTTAGTCCTAGTTGGT	1
AGATGATGACATGTGGGGCACACA	1
AGATGATGACGGTGACCATATCTG	1
AGATGATGATGGACTGGTGGTGAG	1
AGATGATGCCAGATCAACGGTTAG	1
AGATGATGCTCTGCGCTTTGCTGC	1
AGATGATGGAAACTTGCCCGTGCA	3
AGATGATGGAAATTGATAGGGAGT	1
AGATGATGGAGAGCTTATGAAGGT	1
AGATGATGGATGAAACGATTTGGT	1
AGATGATGGGCTAGACGATCTGG	1
AGATGATGGGCTAGACGATCTGGG	2
AGATGATGGTCATCTGTGACGGG	1
AGATGATGTATTTATTACTGGGCC	1
AGATGATGTCCTACAAATATCCCA	1
AGATGATGTGACTGAAAAGTTGTG	1
AGATGATGTGCAATAAACGGGTAG	1
AGATGATGTTCTACTATGTACTA	1
AGATGATTAAGGGTGTGTTTGG	2
AGATGATTGAGGTGTTAATTTGGG	1
AGATGATTTGGAGCCCATGGTAGG	1
AGATGATTTGGTGCTGAATAAAAG	1
AGATGATTTTGCCTGTATTTTGGT	1
AGATGCAAAAGAACTACACAC	1
AGATGCAAGGTGTACTTGTAC	1
AGATGCAAGTGACTCAATTCGTGA	2
AGATGCAATGTACGTATGATAGG	1
AGATGCACTTAAACCCCCTGGTGG	1
AGATGCAGAAGAAACCTTGCACGG	1
AGATGCAGATGGTCCACTTAACAG	2
AGATGCAGGAGCTACAAGCACAAT	1
AGATGCAGGCTAAAAACGAGAACA	1
AGATGCAGGTGAAAGTTGTTTGGT	1
AGATGCATGATTGACACGGGCCTG	1
AGATGCATGCGTACAAAACCACT	1
AGATGCATGGGAATTGTCTGT	1
AGATGCATGTGGACAATGTTA	1
AGATGCATTCCTGATGGCGGTTGG	1
AGATGCCACGTAGACCAAAACCGG	1
AGATGCCATGGCACCTAGGTGTA	2
AGATGCCCGTATAGTTGACAAAAA	1
AGATGCCGACCGATGTACCACACC	1
AGATGCCGATGGACGGTGGCCTAG	1
AGATGCCGATTGGGAAACCCTTAT	1
AGATGCCGCTGTCGCCAAACCTAG	1
AGATGCCGGATCGATTTGTGTCGC	1
AGATGCCGGTTCTACATTTTTGCT	1
AGATGCCGGTTCTAGGGTGGGTCC	1
AGATGCCGTCGAACGGTAGTGACC	2
AGATGCCGTGACAAGATACCACT	2
AGATGCCTATGTTGACTTTATCTA	2
AGATGCGAAATGCACGTACGGTGAG	2
AGATGCGCCGCCAGCAAAGATGAA	1
AGATGCGCTCTAGGATTCGTGCAA	1
AGATGCGGATATGTGATCATGTGTA	1
AGATGCGGGACCTATGTTATATA	3
AGATGCGGGACCTATGTTATATAG	24
AGATGCGTTGTACTATGAAACATC	1
AGATGCTAAAAGATGATATGATGG	1
AGATGCTAACTGTTCTGTGATGGC	1
AGATGCTAAGGACCTGAGTGGACT	5
AGATGCTAATGGATCGATGGT	1
AGATGCTACCGATTACGACCGTTT	1
AGATGCTACTTAACTAGGTGACAT	1
AGATGCTATACGCTATTCTGATGG	1
AGATGCTATGCAGGACACTGCAAC	1
AGATGCTATGGGCTCTATCGGA	2
AGATGCTATGGGCTCTATCGGACA	1
AGATGCTATGGTAAATGTGGCAGC	1
AGATGCTATTAAAGTGAACCGGTA	1
AGATGCTCAACGAGAAGGACAGGA	1
AGATGCTCATAAGGATATGGTGTG	2
AGATGCTCATAGAGATAGGAGTTGC	1
AGATGCTCATAGAGGTAGGGTGTA	2
AGATGCTCATAGGGGTAAGGTGTG	1
AGATGCTCATAGGGGTAAGTGCGC	2
AGATGCTCATAGGGGTAGGGTGTA	2
AGATGCTCATAGTCATAGGGGTGA	1
AGATGCTCATATAAACACGTGCAC	1
AGATGCTCTAGAAGTAGGTTGGG	1
AGATGCTCTAGGACAGTTTGTTGG	1
AGATGCTGACAAGGGAGTTGGACG	1
AGATGCTGAGAAGTTAGCTGATGA	1
AGATGCTGAGGAAAGTGTTGGGGA	1
AGATGCTGCTTGGATGATGGA	1
AGATGCTGTGGTGACTTCGTCAAT	1
AGATGCTTAGATGCAGTTGGCTGC	1
AGATGCTTAGGTAAGCAAGTCCTA	1
AGATGCTTAGTGTATTGAATATAAG	1
AGATGCTTATAGAGATAGGGTGTG	1
AGATGCTTCTACGACTGTATCTGG	2
AGATGCTTGTGTCAAAGAAGGCCA	1
AGATGCTTTACGCTATTCTGATGG	18
AGATGCTTTGGGATTAGCCCAGA	1
AGATGGAAAACGATGTGAGAG	2
AGATGGAAAGCCCAACGAAGAACG	5
AGATGGAAAGCTTGACGGCGGTGA	1
AGATGGACAGGTTGCTGCAGACCA	1
AGATGGACGATTAAAGTTGTGCAC	1
AGATGGACGGTTAAACTTTGGCGC	1
AGATGGAGAATTCCTGAGTGTTGC	1
AGATGGAGCTGAAACTATTTGGCT	1
AGATGGAGGGAGTACTACTAAGGT	1
AGATGGAGTGCACACCAACGCCGG	1
AGATGGATACCCTGCGCGTTGATG	1
AGATGGATCTGACTACGAATCTGG	2
AGATGGATGGTGTCACCATTGGT	1
AGATGGCACACGGTGGATGGACAC	1
AGATGGCACATGGTGGATGGACCC	2
AGATGGCAGCCCTGTAAAGAAACC	1
AGATGGCATGCAAGAAACGGTTGG	1
AGATGGCCACGTTGGATGGGCTAG	1
AGATGGCCCTCTGAGCGGATGGAC	1
AGATGGCCCTTTGAGTGGATGGAC	2
AGATGGCCGTTGGTAGTATAGTGC	1
AGATGGCCTATCTAAATCAGGTAC	1
AGATGGCCTTCCGAGTGGATGGA	2
AGATGGCCTTCCGAGTGGATGGAC	1
AGATGGCCTTGGTTGATGGAACT	2
AGATGGCGACTCTGACTATTCAGC	2
AGATGGCGTACCTATAAACAACGA	1
AGATGGCGTGGTGTCTATCGGTAA	3
AGATGGCTGACCGCGATGAGGAAC	1
AGATGGGACACTTCATGGTACAAG	1
AGATGGGACCAGGTATTAATAGTG	1
AGATGGGACGTATGATGTGATGGA	1
AGATGGGACTAAAACTTTTAAGTC	1
AGATGGGACTCATCCTAGTACTAC	3
AGATGGGATATTTTTTAGGAGCGT	1
AGATGGGATTTGCCCAAACGCCA	1
AGATGGGCTGGCTACGTTGTTCTA	1
AGATGGGGTAGCCTGGAATAGGGA	1
AGATGGGGTGGGCACTAAATAGTT	1
AGATGGGTACCTGAGATCTCCAAA	1
AGATGGGTGGTAGAGATGAGCA	1
AGATGGGTGTCTTATGAATAATCT	1
AGATGGGTGTGATTTCTCGGT	1
AGATGGGTGTTTCAAGATCCGTGC	1
AGATGGGTGTTTGATGAACTCGTA	2
AGATGGGTTAGCTTCAACATGAGT	11
AGATGGTAAGATGGTAGTATTGCT	1
AGATGGTACCCTGCGTGTTGCTGC	2
AGATGGTACTTGCGAGATATCAGG	1
AGATGGTAGCGCCACGTGACTGAC	7
AGATGGTAGGCTAGATAACCTGGG	1
AGATGGTAGGCTAGATGACCTGGG	1
AGATGGTATAAGAATGGATAAGAA	1
AGATGGTATAATATTTTGGGTAGC	3
AGATGGTATGCACGAAACGAGAGG	1
AGATGGTATTAACGAATGATTGA	1
AGATGGTATTAACGTATGATTGAT	2
AGATGGTCAAAACGATAAACACGG	1
AGATGGTCAAACGTTGGATACGGA	1
AGATGGTGAAAGTGGAGATGATGA	1
AGATGGTGAACGAGACGATCTGGG	1
AGATGGTGAATTAGACGATCTGG	1
AGATGGTGATAACATTGAAGAGGG	2
AGATGGTGGCTGACTTTGTGCCA	4
AGATGGTGGGCTAGATGACCTGGG	1
AGATGGTGGTTTTGGATGATGTGG	1
AGATGGTGTCTGCCTCTATGCCAC	1
AGATGGTGTGAATATGTGGTGAA	1
AGATGGTGTTGAATACGAATACTC	2
AGATGGTGTTGGACGACACGTGGC	2
AGATGGTGTTTGGTTGGAGGGACT	3
AGATGGTTACCGCGTAAATCGTGT	1
AGATGGTTAGTGTCTTCAAACGCC	1
AGATGGTTGTCTGGCGATGAGCGG	2
AGATGGTTTTTAAGCAAACGAGGG	1
AGATGGTTTTTGAGCAAACGAGGG	6
AGATGGTTTTTGGATAGCATGCGA	2
AGATGGTTTTTTAGCAAACGAGGG	1
AGATGTAACACTATACAACAGGAG	1
AGATGTAACGTGCGTATGATATGT	1
AGATGTAACTGGTGGTTGAACGTC	1
AGATGTAAGCAGGTCGACCTGTGA	1
AGATGTAAGTGCACCTGGCATGGG	1
AGATGTAAGTGGGCCTGGTCTGGG	1
AGATGTAATTTACTGCGAGAGTTC	1
AGATGTAATTTTTGGGGCGTATGG	1
AGATGTACATGTTTTAGATAGCAC	1
AGATGTACATGTTTTATAGATAGC	1
AGATGTACTACGTAGGATGATCTC	1
AGATGTAGAGGGTCCTATCAATGC	1
AGATGTAGCCTATGAAATGTACCT	2
AGATGTATAGCGAAGGGTAATCCA	1
AGATGTATAGGTACTCCCATGGC	1
AGATGTATCTGCCGTAGTTGGG	1
AGATGTATGACAACGGTGATGGTC	1
AGATGTATGCGTTTTGGTTGTGAC	1
AGATGTATTGTTGTCGATAGGTAC	1
AGATGTCAAGGCAATTGCTTGCAA	1
AGATGTCAATACGTAGTTAAGCTA	1
AGATGTCAATGGTACTGCTAACCC	1
AGATGTCACATGATAGATGGACAC	1
AGATGTCACTGACACATGGGTCTA	4
AGATGTCATCCGTCATGGTCATAA	1
AGATGTCATGCAAAAAATGGGTGG	1
AGATGTCCCCTCCTTCTAAGTGCA	1
AGATGTCCTAGGATTGCAGACTT	1
AGATGTCCTATATCTGGTTTTGTG	1
AGATGTCCTGATTCAAGTCGCCAC	1
AGATGTCCTGGCGATGAGGTGTGG	1
AGATGTCGACTGTAAACTGCGAGA	1
AGATGTCGAGTGCGCATTTGGTGT	1
AGATGTCGATATGGAGCACAATCA	1
AGATGTCGATGATGGAGAAGGTAA	1
AGATGTCGGCACAGGGTAGAGTGC	1
AGATGTCTACACAGTGCTTGTGGT	4
AGATGTCTAGTGCGATTGGGATAC	1
AGATGTCTCGCTGTTGATGGGTAT	1
AGATGTCTGGAATAGTGACTTGAC	1
AGATGTCTTCTGATGGGTGGGAAA	2
AGATGTCTTGATGTGCCTGAGCAT	3
AGATGTCTTGCAAGAGGATGC	2
AGATGTGAAATATGTTGGGAC	1
AGATGTGAAGTCATCTGTGACGGC	1
AGATGTGACAATTAACTTTTTGC	1
AGATGTGACACACCATATGGGCTA	1
AGATGTGACACTACTAATACCATG	1
AGATGTGACGTGAGATGTGACTGG	1
AGATGTGAGTGCGCGCGCGTTGTG	1
AGATGTGATATATTCTAGTGCAGA	1
AGATGTGATCAAGTCCCTATAAAC	1
AGATGTGATGTGATGTGATGGAAA	1
AGATGTGCAATACTGTGATCACTT	1
AGATGTGCACATATAGGTCTGTAG	1
AGATGTGCAGGCTGCTGAGCCGTTC	1
AGATGTGCTAATAGTAGATAGTGA	1
AGATGTGCTAATTGTAAAGGATGC	1
AGATGTGCTAGAAATGTATAGATTC	1
AGATGTGCTCGATATTAATGATGT	1
AGATGTGCTCGATTTTTGGATCGG	1
AGATGTGGAGGGTCCTAGCAATGC	1
AGATGTGGCCTTTCGAACGATACA	1
AGATGTGGGACCATATATTAATGG	1
AGATGTGGGGAGAAATGGCTGCTA	1
AGATGTGTAAACTTAAGGTGTATA	2
AGATGTGTAAACTTGAGGTGT	1
AGATGTGTAAACTTGAGGTGTA	1
AGATGTGTAAACTTGAGGTGTATA	4
AGATGTGTAAACTTTAGGTGTAT	1
AGATGTGTAAACTTTAGGTGTATA	1
AGATGTGTAAATTTTAGGTGTATA	2
AGATGTGTAGCTATGAATCTGGAC	1
AGATGTGTCACATTTGGTAACTAG	1
AGATGTGTCACATTTTATACGAAG	5
AGATGTGTCATATTTAATACTAGA	1
AGATGTGTCATGCGTGCATGGAA	1
AGATGTGTCTAATCCCATCCTAGG	2
AGATGTGTCTATGATAGATGGATC	1
AGATGTGTCTCATCCAGTACTAGG	1
AGATGTGTCTCATCTTAGTGTCCA	4
AGATGTGTCTTTTGTATTAAGTT	3
AGATGTGTGAGACGTGGAAGTCGT	1
AGATGTGTGATATATTATGGTACA	1
AGATGTGTGATTGGTAGAAAAGA	1
AGATGTGTGTGAAGAAGGCCTTTA	1
AGATGTGTTCTTTTGGAGGGGTTGG	1
AGATGTGTTTGGTTGAGAGGCTA	1
AGATGTTAAAGGTGGCCCAATGGG	1
AGATGTTACGGTGGTTTATGGTAC	1
AGATGTTAGAGGATGCCATTGGAG	1
AGATGTTAGCCGCGCAATCTGTAC	2
AGATGTTAGGGCCTTACCAAGCAC	1
AGATGTTAGTCGATTTAAGGTTAG	1
AGATGTTCAGAATGCCTTCCTCCA	1
AGATGTTCAGTCCAGTTGTCAAGC	1
AGATGTTCAGTTAACAGGTTGATG	1
AGATGTTCATAGTGTAGGGTGTT	1
AGATGTTGATAGATGGTACTGATA	1
AGATGTTGATGGTGTGAATAACCC	2
AGATGTTGCCCATTGTGCCTCAAA	2
AGATGTTGCCTCTTGACTTAGGGA	2
AGATGTTGCTAGATTTTCCTATAA	3
AGATGTTGGGCGGTTTCAAGGTTC	1
AGATGTTGGGTAGTATACGGATA	1
AGATGTTGGTTTAGGAAATGCTTA	1
AGATGTTTACAGCTATGGGATGGT	1
AGATGTTTCATCTAGTGTACTTAC	1
AGATGTTTGACCGGATGTTGGAAG	1
AGATGTTTGACCGTATATCGGAAG	2
AGATGTTTGATTGGATGTCGGAAG	2
AGATGTTTGCATATGGTCGTCTGG	1
AGATGTTTTGGAGTCAGTAGTTGG	1
AGATGTTTTTACCGGTATTTTGGT	1
AGATGTTTTTGCAGGTATTTTGGT	1
AGATTAAAAATCTGTGTGATACGA	1
AGATTAAATGATTGGAACGAGAGG	1
AGATTAACGGGCGACTAATTAGGG	1
AGATTAACTAAATCCTAGGGTTGC	1
AGATTAAGTGATTTTTCAGGGGTA	1
AGATTAATATTTTCGTGGCATGC	1
AGATTAATTTGAACTTGAAGTTGC	1
AGATTACAAGGAAGGACAACAGG	1
AGATTACATAGGCCCTGGGTGTAC	1
AGATTACATTGGTACCTCATGATA	1
AGATTACATTGGTACCTCATGGTA	2
AGATTACGACTTTTAAAGTGTGCT	1
AGATTACGCCTATAAACTACAAGA	1
AGATTACTTTTGGAGACCGTGCTA	3
AGATTAGACATGCCTAAGGTGGAG	2
AGATTAGACTGTGCCACGTAGCGA	1
AGATTAGATAGTGCCATGTGGCGA	1
AGATTAGATAGTGCTATATGATGG	1
AGATTAGCTATAAGATTGACTATA	1
AGATTAGCTATTAGGTGGTGTTTG	1
AGATTAGCTGTAGATGATGTGCC	1
AGATTAGGGCTGGGGAGGAGCGATC	4
AGATTAGGGGACGATTTTGATGAC	1
AGATTAGGGTTACGTCTTGGTTCC	1
AGATTAGGTGGTAAATAAATCAAG	1
AGATTAGTGCTAGCACGTTGGTGG	1
AGATTATAGGGCCCACATGTCAGT	1
AGATTATTTTCAGATTTATGTCCA	1
AGATTCAAAGTCCTAGGATGGGTC	1
AGATTCACCCGCGAGATGATGTGG	1
AGATTCAGAATTGTGCAAGAGTAG	1
AGATTCAGCAGTTGATTGAGTAAC	1
AGATTCAGGGGGTGCTGTAAAGT	1
AGATTCAGTCCTAGGATGAGCCTA	1
AGATTCAGTGAGATTCTCGGTGAC	1
AGATTCAGTGTCTTCGTTTATCAC	1
AGATTCATTGTATTAGGAGGGGTC	1
AGATTCATTGTATTAGTAGGGATC	1
AGATTCATTGTGCTATGAAACATC	1
AGATTCCGGATGGCTATTTAATAG	1
AGATTCCGTCAGGAAACTGCGAGC	1
AGATTCGAGCTATCGAGCGGATGC	1
AGATTCGATGCCTTAGGTCCTCCC	1
AGATTCGGTGGCCGTTTGAAGTCA	1
AGATTCGTAGGACTAGATTGTGCA	1
AGATTCGTAGTACTAGGATGTGTC	1
AGATTCGTAGTACTATGATAGGTTC	1
AGATTCGTAGTATGAAGGTGTGTC	1
AGATTCGTAGTATTAGGATGCGCC	1
AGATTCGTAGTGCTACAATATGTC	1
AGATTCGTAGTGCTAGAAAGTATC	1
AGATTCGTAGTTCTAAGATGTGTC	1
AGATTCGTCATACTAAAGTTGGT	4
AGATTCGTGGTGCTAGGATATGAG	1
AGATTCGTGTTACGGTTTGGGTCC	1
AGATTCGTTAAACTATTAAGTGTC	1
AGATTCGTTCTGCTAGGATATGTG	1
AGATTCGTTGAACTAGGATATGTC	2
AGATTCGTTGTACTAGGATGTGTC	1
AGATTCGTTGTACTGTAATGTGTC	5
AGATTCGTTGTATTAGGATGTGTC	1
AGATTCGTTGTCCTAAAAAATGTC	1
AGATTCGTTGTCCTAAGATGGCCC	1
AGATTCGTTGTCCTATGAAATGTC	2
AGATTCGTTGTCTAGGATGGGTCA	1
AGATTCGTTGTGCTAAATTATGTC	1
AGATTCGTTGTGCTATGATATGTC	1
AGATTCTAACAGGAATGCAGGTGT	1
AGATTCTAAGGGTCTGTTTGGAGG	1
AGATTCTACAGGGCTATTTAATAG	1
AGATTCTGAGAAGCAGCTGATTGA	1
AGATTCTGAGAAGCAGCTGGTTGG	1
AGATTCTGTTGTGCAACAGACTGA	1
AGATTCTTAGAAGGAGCTGGTTGA	1
AGATTCTTTTTATGTGCTGTAGAG	1
AGATTGAAAAGCGTGCGCACGGAA	1
AGATTGAAAGGGGCTGTTTGC	1
AGATTGAAGAGTGCCGGTAAGATC	1
AGATTGAAGGTGTTAGTCTGTTTA	1
AGATTGAAGTGTGGAGTTATATGG	2
AGATTGAATATAGGTGAATTGGAG	1
AGATTGACATATTGAACAGAAGTT	1
AGATTGACCACAATTCGTGTGCTA	1
AGATTGACGAAGTCACTACAGGCG	1
AGATTGACGAAGTCACTACGAGCG	1
AGATTGAGAAATGAATGAAGGGTT	1
AGATTGAGCTAACTGTGTCTGTGA	2
AGATTGAGGACAGCTTGTGTAGTG	1
AGATTGAGGTATGCGAGATTGAGG	1
AGATTGATGCAGACAACAAAACAG	1
AGATTGATTCTAGTTTTAGGTGTA	1
AGATTGATTGTAGATGATGTGTTA	1
AGATTGATTTATTTTAGGACAGA	2
AGATTGCAGACGAACCATAATTGG	1
AGATTGCCCCAAGCTGATGGAGAT	1
AGATTGCCGGTTGACTTGTGAGGT	1
AGATTGCGAGAAACAGTTGGTTGC	1
AGATTGCGGGCCTGTTTGGTACAG	1
AGATTGCGTGTAGACGATAACTCG	1
AGATTGCTAGCCAAAGTGTGGTAC	2
AGATTGGACACAAGGTTGCACACG	1
AGATTGGAGGAGCGCATACGTAAG	1
AGATTGGAGGTAGTTCTAGATCCC	3
AGATTGGAGGTGATCTGGAACCGC	1
AGATTGGATACAAGGTTGCACAGG	2
AGATTGGATGATATTGGGTTGGCC	2
AGATTGGATGGGTGAACTCTG	1
AGATTGGCTATAAATGAATTGGAG	1
AGATTGGCTATAGATGAATTGGAG	4
AGATTGGCTATAGATGGATTGGA	1
AGATTGGCTATAGATGTTTTGGAG	1
AGATTGGCTATGGATGAATTGGAG	4
AGATTGGCTGAGGTTCTTGCCGTT	1
AGATTGGGAAGATACGCAAAACG	1
AGATTGGGAAGATACGCAAAACGA	2
AGATTGGGAAGATACGCAAAACGAG	1
AGATTGGGAAGATACGTAAAACGA	6
AGATTGGGACAAATGGAAAGCAGC	2
AGATTGGGAGTATACGTAAAATGA	3
AGATTGGGCAAACAAACATTAGGG	2
AGATTGGGGTGTGACAAGAGATGG	1
AGATTGGGTGTAGTGAAGAATCGA	2
AGATTGGGTGTGTATATTCATATG	1
AGATTGGGTTTTTATAGAATA	2
AGATTGGTCAAGTTAGCATTG	1
AGATTGGTCAGGCACACTACACGC	1
AGATTGGTGGCCACTTTAACTCC	6
AGATTGGTGGCCACTTTAACTCCC	1
AGATTGGTTTCAGTTGAACCTAGA	1
AGATTGTAGCCAAAATAAACCTAG	1
AGATTGTGACTGGTTGAGAAGTGA	1
AGATTGTGAGGTGCCGACGGGGAG	1
AGATTGTGATTGAATGAGTAGTGA	3
AGATTGTGGCCTTTACTGTGGGAC	1
AGATTGTGGGCCCGATGTGTGACG	1
AGATTGTGTCCTAAATACGTGCAG	1
AGATTGTGTTGGGAGTTTGGC	1
AGATTGTTCGGGGATGCCTTCTAT	1
AGATTGTTTTTTGGGACGGACGGA	1
AGATTTAAAAGGGTGAGCTATTTG	1
AGATTTAAACGGTCCGCATGTGAA	1
AGATTTACAAGCGTCCTCCTCCT	1
AGATTTAGGGGTGCAATTTATGTC	1
AGATTTAGTAGTGCCAAAACTTAC	2
AGATTTATAGCGTGCTACTCTTCT	1
AGATTTATAGCTAAAAATGGGAAC	1
AGATTTATTTTTAGTCCAGGTGTA	1
AGATTTCCAATCAACGGAGGGTGT	2
AGATTTCGGAGGACTATTTAATAG	1
AGATTTCGGATGGCTATTTAATAG	1
AGATTTCTAAGGTGCTTGGGAGGC	1
AGATTTGAACCTAGAACCATGGGA	1
AGATTTGAGAAGGTTGTTCGAGGT	1
AGATTTGAGGTACCATATAGCTGA	3
AGATTTGATCCAGATGGTGTTGAT	1
AGATTTGATGCGATGTTTTTGGG	1
AGATTTGATGTGATGTTTTTAGGA	1
AGATTTGATGTGATGTTTTTGGGA	1
AGATTTGCTTTTTATAGGATGGT	2
AGATTTGTAGCCAGCTGCAGCACG	1
AGATTTGTAGTCAGCTGTAGTACG	2
AGATTTGTGAGAATACAGGTGGCA	1
AGATTTGTGGTTGAAATGTTGAAC	1
AGATTTGTTGTGCTAGATTATGTC	1
AGATTTTAGGGGTGACGGTATGAA	1
AGATTTTAGGTTTCTGGTGGTATA	1
AGATTTTCGTGGTACGCTTTTCAA	1
AGATTTTCTTGGTTCCTGTGTCTA	1
AGATTTTGACCTATTATACCCCC	1
AGATTTTGATAGGAATTTAGGTGT	2
AGATTTTGGGTGGATGTGACACATC	1
AGATTTTGGTGATCTATAACAAAG	1
AGATTTTGGTGCGATACGTGGCTG	1
AGATTTTGGTGTAGCGAATTCGCA	1
AGATTTTGTGGCATCGGGTGGCGG	1
AGATTTTTCACGCCTTGATCTAAA	1
AGATTTTTGGGAAGCGCTTCGCGC	1
AGATTTTTTAAGCCACAACTCAAC	2
AGATTTTTTGGGCTAATCGAAGAG	1
AGATTTTTTGGTGACATTTTTTAG	1
AGATTTTTTGGTGATATTTTTTAG	1
AGATTTTTTTATTTTGGGGCGAGA	2
AGCAAAAACGAGCCGGTGCAGATA	1
AGCAAAAACTGGGACTAAAGAGAA	1
AGCAAAAAGCTGGTGGCATTGGGC	1
AGCAAAAAGTGTGGCTGCCACAAC	1
AGCAAAAATAGCCTTCGATGGCGG	2
AGCAAAACATAAGAACTACGCAGC	2
AGCAAAACGATACTACCTAGTATC	1
AGCAAAACTGATATGAGATGTGAC	1
AGCAAAAGGTGCAGTGTCTGTCAG	1
AGCAAAAGTGCCCGTGCGTTACAC	1
AGCAAAAGTTTTGGTGGTAAAAGT	2
AGCAAAATCGAGTGGAAGAGGGGC	2
AGCAAAATTGTGCGGTTGTATGGT	2
AGCAAACCAAAAGTGATAGAAACA	1
AGCAAACCAATCGCTGAAGATGC	1
AGCAAACCTGTGATGAAGTGAGCG	1
AGCAAACGAGTAAGGTGGTTGCCG	1
AGCAAACGGATTTTTATGCGGGTA	1
AGCAAACGTGGTGTCTCCTTTCAT	1
AGCAAACTAGATAGAGTTACAGCC	1
AGCAAACTAGTATTAGGATGTGAC	1
AGCAAACTGAAACATGCCGCTAAT	1
AGCAAACTGGGGACCACTATGCCT	1
AGCAAACTTTGTTGTTGTTGC	3
AGCAAAGACCCGGCTCTTAGTGAG	1
AGCAAAGAGGTGCTCAAATGCCAG	1
AGCAAAGATGTTGTCCTGCAGAGC	1
AGCAAAGATGTTTAGGTGTGTTTGA	1
AGCAAAGATTGTGAGGGGAAACTA	1
AGCAAAGGCAAGCCTGTCGGTGAA	1
AGCAAAGGGAACGAAGCGAAAGAG	1
AGCAAAGGTGGATAATCAGCTGAG	1
AGCAAAGTGGGATCTACATGTCAG	1
AGCAAAGTGGTGGGCGGGTTTGAC	1
AGCAAATAATAAATTGTGTGCCAA	1
AGCAAATACACGTTTTTACGGTGT	1
AGCAAATACATGATCTTCGGGTGT	1
AGCAAATACTGCAAAGATCGGGAC	1
AGCAAATAGGTGTCGCCATTATAG	1
AGCAAATATAGATTTAGATGGGAC	1
AGCAAATATGACGAATAGTGGTGG	4
AGCAAATATTTACTGTAGTGTCAC	1
AGCAAATCAAGATATTGCATGTGG	2
AGCAAATCACTAATTTTCTAGGATG	1
AGCAAATGAGAATAGGGTGCTCGA	1
AGCAAATGATAGGCCAGGATAGAG	1
AGCAAATGCCAAATGCCAAACTGC	1
AGCAAATGCCAAATGCCAAATTGC	1
AGCAAATGGTGAATAGTCGGCAA	1
AGCAAATGTATTAGGTGTAGTGT	1
AGCAAATGTCAAATGCCAAATTGC	1
AGCAAATGTGGTGTGGTAAAATAG	1
AGCAAATTCGCAATCTTACGGTGT	2
AGCAAATTTTGCCAAAAAGTGCTC	1
AGCAAATTTTGCCTAAGAACAACC	1
AGCAACAACATGGTGCAATTTGTG	1
AGCAACAAGTAAAGGGGGTGTCA	1
AGCAACAATATGGTGCAATTTGTG	1
AGCAACACACTGCATGGCTGG	1
AGCAACACTTGTACTACATGCCTA	2
AGCAACATAGTGTTCAGGTTTGTA	1
AGCAACATGATATCGCTACTTGGC	1
AGCAACCGACGAGGATGAGGATGC	1
AGCAACCTAAAACCACCGGATGTG	4
AGCAACCTGGTACCGGATGTGACA	2
AGCAACCTTCAGATATAGGAGGAG	3
AGCAACGAGTCACATATGGTAC	1
AGCAACGATGAGGTCAAATACTCC	1
AGCAACGATGTAGATGGTCAAGCGC	1
AGCAACGGGCCACAGATCTGGAGC	1
AGCAACGGTAACCCCTTTGGGCGC	1
AGCAACGGTGCAAACGGTAGCTGC	1
AGCAACGTTGGTGTTCACGATCTT	1
AGCAACTAGATATGAGATTGAGGT	1
AGCAACTCCGGTGACAGTAAATGC	1
AGCAACTGGTGGACTACGCCGACA	3
AGCAACTTTGGGTGGATGGGACAT	1
AGCAAGAAAACATACTTCCAGCGA	1
AGCAAGACAGCAAATGCACAGTGC	1
AGCAAGATAGATGTACAGGATGGA	1
AGCAAGATTATAAATAGTAATAAG	3
AGCAAGATTCTCTTAGGCGCCTCA	2
AGCAAGATTGAATTGGATGAATGG	2
AGCAAGCAAATAAAGAAGGGTGAC	1
AGCAAGCACTGATGGATGTTGTC	1
AGCAAGCAGGTTGCGGATGGACAT	1
AGCAAGCATGCGATTAGGAGGCGAC	1
AGCAAGCATTTGGGTCGTCGCTAA	1
AGCAAGCTCTGCTTCTGGTGCTGG	3
AGCAAGGCAGTTAGTTAGGTGCAC	1
AGCAAGGGGGTGCCAAAACGACGT	1
AGCAAGGGTGAGTACCAACCGTAC	2
AGCAAGGGTGCGCCCTTATAAGGC	2
AGCAAGGTCTACTACAACCAACAA	2
AGCAAGGTGACCAATCTGTCTACA	1
AGCAAGGTGAGCATATGTGGTGAT	1
AGCAAGGTGATAGTAAACATACG	1
AGCAAGGTGGACACTGACGGCAGC	1
AGCAAGGTGGTACTACACATGCGC	2
AGCAAGTAGCCAAGAAGGATTAGC	2
AGCAAGTATGGGTACCTAAAACT	4
AGCAAGTCAATTGCCACGTAGGAC	1
AGCAAGTCTAGTGGGGAGCCGTAG	1
AGCAAGTGCTATGGTGTTAATTTC	2
AGCAAGTGCTATGTGAGATGTGAC	1
AGCAAGTTTTTGGAGACAGGCCTA	1
AGCAATAAGAGCCGGGTAGCAGTA	2
AGCAATACGTGATGGTACTATTGG	1
AGCAATAGAAATGTAAGGGGCTGC	1
AGCAATAGGAGGGTGACTTATGTG	1
AGCAATAGGCTGCTTTGTTGGTTT	1
AGCAATAGTTTGGTGATGTATGG	2
AGCAATATAGACCTACACATAACA	1
AGCAATATAGTTTGATAGTGTGCA	2
AGCAATATTGCCATCTTGCCAAA	1
AGCAATCAAGGGACGACCAAACGG	1
AGCAATCCCACGGTGTTTAAGTAA	4
AGCAATCCGTCGGCTCGGGTC	1
AGCAATCTAGTGTCAGATATGACG	2
AGCAATCTGTTGCTGATGATGAGG	1
AGCAATGAACCATGTGCTAGGTGT	1
AGCAATGAATAGAGGGTAGGGGCA	1
AGCAATGATGTGAGACATACCTGT	7
AGCAATGCCAGCTAAAGATCATAG	1
AGCAATGGCTAGTCCACGGGGC	1
AGCAATGGGTAAACATAAGTGGTC	2
AGCAATGGTGCAGAAATATTTCTG	1
AGCAATGGTTGATGTCTCTGC	1
AGCAATGTACTCTGTGGATGATAA	1
AGCAATGTTGATGTTGACTGCCCA	1
AGCAATTGGGTGTGATGGGAAC	1
AGCAATTTCATAACTACAAGATGG	1
AGCAATTTTATGGTCATTGAGGA	1
AGCAATTTTTGGATGCATGGGACA	1
AGCACAAACTTCAAGACGTACTGT	1
AGCACAAATGAAAGATGTGGGTGT	1
AGCACAACAGGTTTAACTGATAAG	1
AGCACAACCCGACTCTTATTGGG	1
AGCACAACCCGACTCTTATTGGGC	1
AGCACAACGAATCTAGATAGGAGC	2
AGCACAAGAAGTTTCCGCTTTC	1
AGCACAAGGGTGGTATATATATGA	1
AGCACAATATGACTGCGAGATGGT	1
AGCACAATGGTGGTCTATGTTTAC	11
AGCACACGAAATACCACTGTTGCA	2
AGCACACGCAGAAGACCGATGCCA	1
AGCACACGGGTCAACGAAAGTTGG	1
AGCACAGAAAAAGAGATGGTACC	1
AGCACAGACTACAAGATGTATGTG	2
AGCACAGAGTTGGGGGATTTCGCC	1
AGCACAGCCGTACTGTATGAGTGC	1
AGCACAGGCAGCCAAACAGGTCC	1
AGCACAGGGCTGCGTCCTTCTGTT	1
AGCACAGGTATATTACTAGTTGTG	1
AGCACAGTGTGGCCATATGGTGAG	1
AGCACATAGATGGAGCATTCA	1
AGCACATGAAAATTGAGGGCCA	1
AGCACATGAACGGAACAGGAAC	1
AGCACATGATGACTACAAATAGGA	1
AGCACATGTCCTACGACGTATGTG	2
AGCACATGTGCAGTGGATGAGATG	1
AGCACATGTGGGTTCTACGTGATG	1
AGCACATTATACCATATTCTTGTG	1
AGCACCAATTAACAGTTTGAAAAG	1
AGCACCACTGCTCTCCATCATCCC	1
AGCACCAGTTGTCTTGTTGATGGA	1
AGCACCCACGTTGGATTACTATAT	1
AGCACCCGCAACTATGATGTCTGC	1
AGCACCCGTAGCACTACCGAACGC	1
AGCACCTAGCTTAGGTCCTGGATA	2
AGCACCTGAGGTGTTGGGTTCGAC	1
AGCACCTGATACAGCCTCCAGCCC	1
AGCACCTTGTGATGATTGCTGGCG	1
AGCACGAAATGGGTTGGTGTCA	1
AGCACGAACGTGGCGTGGATTCTG	1
AGCACGACTTAAAAGGTGTGGGCA	2
AGCACGATTGACGATTGGTTTGTG	1
AGCACGCGATCCCAACCACGTGTC	1
AGCACGCGTATAGTGTATGGCAGC	2
AGCACGGAATTGAGATGACTGCAC	1
AGCACGGACCTACAATTAAATAAG	1
AGCACGGACTAAAAGACGCGGTGT	1
AGCACGGACTACAAGACACAGTG	1
AGCACGGACTCCAAAACGTAATGTG	1
AGCACGGATCTAAGACAGCATGTG	1
AGCACGGATGATACGATGGTGTAG	1
AGCACGGATGGGACATTACATAGC	1
AGCACGGCTAGTACCCTACGGTGT	1
AGCACGGGCTCCAAGACATAATGT	1
AGCACGTAGATGGAACCTGAGGAA	2
AGCACTAAGAAGGTTACAGGTTGG	1
AGCACTAAGGGTGTGTTTGAGGAG	1
AGCACTACACCACTGATCCAT	1
AGCACTACATGGGACAAAGATAAG	1
AGCACTAGTATTCGTGGTGA	1
AGCACTCATCAGTACCGCCTCCGT	1
AGCACTCATGGTGGATGAAGTGG	1
AGCACTCGAGGAGGTATTTAGGGC	1
AGCACTCGAGTGGGTTGTGGTCAA	1
AGCACTCTTGAGCCGCCACGTGAC	1
AGCACTCTTTGACTCTCTTT	3
AGCACTGAAGCAGCAGCACCAAAG	1
AGCACTGACTATGATGGTGTAGAG	1
AGCACTGACTTCAAACGGACCTAG	1
AGCACTGGATGTAACGTATAATT	1
AGCACTGGTGTTCTACATTCAATC	2
AGCACTGTATGGACGGAGGTGTCG	1
AGCACTGTTTCCTGGGACTGGT	2
AGCACTGTTTTCTGGGACTGG	1
AGCACTTACGTGATGGGTTGACTT	1
AGCACTTGAGGCAAGCCTTGGAC	1
AGCACTTTAGACTAGAGGTGGCCT	2
AGCAGAAAAGCCTGAAGGATGGAC	1
AGCAGAAAGGGCCCATACCAGAGA	1
AGCAGAACCTACAACCTGTGGTATG	1
AGCAGAACGGGACTACGTGATACC	1
AGCAGAACTGAAGAATGTGCCGA	1
AGCAGAACTGATGGCACTGGATAC	1
AGCAGAACTGCCTGGTGTGTTTGA	3
AGCAGAAGGTGGCGGCATCGGCTG	1
AGCAGAAGTGTTGTTTCAATGGTA	1
AGCAGAATTCACCAAGTGTTGGA	1
AGCAGACACAAAAGTGTGGGTGAC	1
AGCAGACACAAAAGTGTGGGTGACA	1
AGCAGACATCGCCCGATGGGTGGG	1
AGCAGACGATGACACTGTAGGCGC	1
AGCAGACGGGTATGATCGTGTTTA	1
AGCAGACGGTACCTTTGAGGTGAC	1
AGCAGACGGTTGATTGATTATCTA	1
AGCAGACTACTGGTTGCATGAGCC	2
AGCAGACTTGATAAAATGGCTAAA	1
AGCAGACTTTGGGAGGGAGATGGT	1
AGCAGAGACAGCGTTTATGGCAGC	2
AGCAGAGCTATATATGTCCTA	3
AGCAGAGCTGGATCCAGTGTGGGT	1
AGCAGAGGAGTAGATCCGCAGTGC	1
AGCAGAGGTGCTGGTGATGATGTC	1
AGCAGATAAAGTGATGAATAGTT	1
AGCAGATACGCGTTTTTATGGTGT	1
AGCAGATAGATGTAGGTGACGAAC	1
AGCAGATGAATTGCAGCGATACC	1
AGCAGATGACATGAGGGCAACACC	2
AGCAGATGATTGGTCCGATGAGGT	4
AGCAGATGCGATGAGCAGATCGGC	3
AGCAGATGCTGGTGCTGACAAAGG	2
AGCAGATGGATAGGATGAAGGCCT	1
AGCAGATGGGGCTTCGTTTGG	1
AGCAGATGTAAGCGTGGTGTCAAA	3
AGCAGATGTAAGTGTGGTGTCAAA	1
AGCAGATGTTGCCTAGAAAATAAA	1
AGCAGATTGAAAAGCCCAACCAGA	2
AGCAGATTTGATGATGTGGAAGA	3
AGCAGCAAGTGACCCATTGAC	1
AGCAGCAAGTGTTTGCGATTGTGG	1
AGCAGCAATGGTGGGAAATTAATC	1
AGCAGCACAAACAACGGAGCTA	1
AGCAGCACCATGCCGGCAGATCAA	1
AGCAGCATAGATGCCTGGTTTTGC	1
AGCAGCATGGTGGAGGATAGTAGT	1
AGCAGCATTTAGGTGGTGTTTGAA	1
AGCAGCCAGATATAAGTGGGCCTG	1
AGCAGCCAGATGATTTGATCGATC	1
AGCAGCCAGCCAACAGTTGTTCTA	1
AGCAGCCATTACCCTTCAGACTAG	1
AGCAGCCCTTGGTAGTGAAGCCTG	1
AGCAGCCGCATGCGATAATGGATC	1
AGCAGCCTGGGTCAAAGTTGATGG	1
AGCAGCCTGGTAGAGTGTGGTAGA	1
AGCAGCGAGATGGATATCCTGGAGC	1
AGCAGCGGACTACGATTCTGTCGCC	1
AGCAGCGGACTAGCGGACCTACGG	2
AGCAGCGGCATGGAAGCCAAACAG	1
AGCAGCGGGCTACAGATCTAGTGC	1
AGCAGCGGTCGCAGGGTGTGA	1
AGCAGCGGTGTCGGTGTCGGTGTC	1
AGCAGCTGGATGGTGGATGATTT	1
AGCAGCTTGAAAAGCAGGTGCGTG	1
AGCAGGAACAGAGGCAGCGGGAGG	1
AGCAGGAAGGGTACAACGAATCTG	1
AGCAGGAATCGCTAGTAATCGCC	1
AGCAGGACAAGCCAAACAAATGAA	3
AGCAGGATAGGAGCTAAAAAGAGC	8
AGCAGGATCTACTTGAGATGATGT	2
AGCAGGATTGATATGGTTTTTGAC	1
AGCAGGCTCAATGTGACCTGGTGG	1
AGCAGGGAGGATGGTCGGATAGGG	1
AGCAGGGGCTAAGCGGCTGCGCGA	1
AGCAGGGTGATTCATTTACTG	1
AGCAGGGTGCTATAGCGGTTGTGA	1
AGCAGGGTGGGGGTACTTTACCGC	1
AGCAGGGTTTTAAATCTCGAA	3
AGCAGGTACAATAGCAGACTATAA	1
AGCAGGTCAACGATAATGGCTTGG	1
AGCAGGTCCTTTTAACGCAGCCGG	2
AGCAGGTCTTGCATGAGATATGGT	5
AGCAGGTGATGAAAGCAAGAC	1
AGCAGGTGGCCGAACTGGATTGCA	2
AGCAGGTGGCCGAATCGGATTCAA	1
AGCAGGTGGTTGATATTTTCAAGG	1
AGCAGGTGTACGTACTCCTGGGAA	2
AGCAGGTTACAGATTTGTAGGCAGC	1
AGCAGTAATTGCTCAAAGATGCCA	2
AGCAGTACAAGTTTAGGGACCGAT	1
AGCAGTATTGTCCTACGTGGTATG	1
AGCAGTCATAGGTAGGGATGGCAG	1
AGCAGTCGGGTCCCAGTTGGAAGC	1
AGCAGTCTACTATGGCAGAGGTCA	1
AGCAGTGACACAATTTTACGGTGT	1
AGCAGTGAGAGCATGTGCTGGGCC	1
AGCAGTGATGATGGTGAGTGATG	2
AGCAGTGATGATGGTGAGTGATGA	1
AGCAGTGCATGAATTGTTGGT	1
AGCAGTGCCATGCTGAGGTCATGT	1
AGCAGTGCGCGGGGTTTCACCTAG	1
AGCAGTGCTATGACCTGATTGTAA	2
AGCAGTGGTACCCATGGTCACATC	1
AGCAGTGGTGATTGGTGGTACGCA	1
AGCAGTGGTGCTCGGTGACAGCAA	1
AGCAGTGTAGCAGGTGGCCGAATA	1
AGCAGTGTAGGGTGATCTTAACGT	1
AGCAGTGTCGCCTGCGATGGGCGG	1
AGCAGTGTCTAAAGGTTGGAGTCT	1
AGCAGTGTCTATGGTGTCATGTC	1
AGCAGTGTTGTGTACCGGCGGTGT	2
AGCAGTTAGCCGTTACATTTGTAG	1
AGCAGTTGGATGAAGGTACTCAAG	1
AGCAGTTGGTAGCCTAGACACTAT	1
AGCAGTTGGTATGCTGAACAGGCCT	1
AGCAGTTGTGAAACTGTAGGTTGT	2
AGCAGTTTAGATGATGGTTTCGGC	1
AGCAGTTTATGGGTGTAGATGTGG	1
AGCAGTTTGAAAAGCGTGAGTGCG	1
AGCAGTTTGAAAAGCGTGTGCGAA	1
AGCAGTTTTCCAAGTGGTTTTGGT	1
AGCATAAACGAAAAGATGAGGTCC	3
AGCATAAACTTAGGCCCGATTGAG	1
AGCATAAGAGCCTCACTCAGTTG	1
AGCATAAGGAAATAGCTCTCCAAT	2
AGCATAAGGTGCACCCTAAGCTAA	1
AGCATAATGATGTCCACATGTAGC	1
AGCATACCACACATCAGGTAGGGC	1
AGCATACGGTGATGGTTTCATGTC	1
AGCATACTACAAATATGCAGTGGC	1
AGCATACTATGACACCGATAGACA	1
AGCATACTGTAAATACTCCCTCCA	1
AGCATAGAAATAACCGTTGATTG	1
AGCATAGACGAGAGGTACCAGCT	1
AGCATAGCCTACCATGGCTGATGG	2
AGCATAGGAGACGGAAGCCCGATG	1
AGCATAGGTGTGGTGTATTTTGTC	1
AGCATAGTCTCATAGGTGTCACAT	1
AGCATATAGGCTTCTTACACGTGC	1
AGCATATAGGTGCAACAACTTGGC	1
AGCATATATGTAAATGTGTCTAAA	1
AGCATATCGTTTGTTAGGTGATAC	1
AGCATATGGCGCCATATTTCTAGC	2
AGCATATGGGTTGCTCATAGAGAA	1
AGCATATGTGGTGATAGGGATAAC	3
AGCATATTTCACCTAGGTCCACAA	1
AGCATCAGGGCCGTCATCAAGCCG	1
AGCATCCACTCGGTCAGACCGGCA	1
AGCATCCTACAACAGTTAGAGACA	1
AGCATCCTCATCATCAGCGCGGTC	1
AGCATCCTCGATATTTGTGGTGTA	2
AGCATCCTGAGCGCCATTTGATGA	1
AGCATCGAGGCTGAATATGGT	1
AGCATCGGGAGTGCTAGCCATAGA	1
AGCATCGGGGTGATGAAGTCTGGG	3
AGCATCGTCTTCACCAACCTTGAA	1
AGCATCGTGAGCTACGTAGATTGC	1
AGCATCGTGCTGCGCATGAGGTTC	3
AGCATCTATAATCCAGCGTGCTAC	1
AGCATCTCAGGTTATGGGTTTG	1
AGCATCTGATGGTTCTTCTCC	1
AGCATCTGTGTAAAGTCCTAGTAC	1
AGCATCTTCATGTGCTTGGAGTTG	1
AGCATCTTTGTGGTGGAACCAGC	1
AGCATGAAAAGTGGATGGGTT	1
AGCATGAACATTGGGTAGTAC	1
AGCATGAATGGTCACAAAAACGG	1
AGCATGACGCTGAATGTACGTTGG	1
AGCATGAGAGATGGAGCCCGTCAG	2
AGCATGCATATAAGACAAATGGTA	1
AGCATGCCTAGTATTTTGGAGATG	1
AGCATGCGCATGGAAAACGACAGG	1
AGCATGCGTACTAAGATTTGTGGT	2
AGCATGCGTGTAGAAAATGAGGAG	1
AGCATGGAAGAATGTGTGCATGC	1
AGCATGGAAGTATGGAGCATATGG	1
AGCATGGACTTCATGACAGGTGTG	2
AGCATGGATACAAAAATAAGGAGC	1
AGCATGGATGGTTGTTGTGAC	1
AGCATGGGAGTAAGAAGCCGCGGC	1
AGCATGGGGTGGATATACCTAGG	1
AGCATGGGTATTAAGAAAGTAGG	2
AGCATGGGTGTGTTGCTCAGTGTT	2
AGCATGGTGACCCGCGCAGATTGC	1
AGCATGGTGCATTTGAAGGTAGAG	2
AGCATGGTGGCCCACATAGATTGC	1
AGCATGGTGGCCCACGCAGATTGC	1
AGCATGGTGGCCCGCGCAGATTGC	1
AGCATGGTGGCCTGCGCAGATTGC	1
AGCATGGTGGCCTGTACAGATTGC	1
AGCATGGTGGCTCACGCAGATTGC	1
AGCATGGTGGTGGTTGAGTTGCCA	3
AGCATGGTGTAAGATGATGTAATA	3
AGCATGGTGTAATCGAAATTC	3
AGCATGGTGTATTCGAATATGGTA	1
AGCATGGTTGGTGATTGTTAAGCA	1
AGCATGTAGTGTGCCATGTATGAA	1
AGCATGTCTGAATACGATAAATTG	2
AGCATGTGCATTCATATGGGTGAG	1
AGCATGTGCGGGTTGAGTGGGCGC	1
AGCATGTGCTCAAGAAATCGTGAG	2
AGCATGTGCTTGTGGTGTAGTGAA	2
AGCATGTGGCATGATGTTTGGTTC	2
AGCATGTGTCCTTGGATGATCATG	1
AGCATGTGTCTAAATTTATAGCTA	1
AGCATGTGTCTTGGTGTCTCC	3
AGCATGTTATCGCATTACTGGTAT	1
AGCATGTTCTCTTGCATCAGCTGC	1
AGCATGTTGGTGTGTATGTGATTT	1
AGCATTAAACAGCTTACAGATGGC	2
AGCATTAAATAAGCTATCACCTA	1
AGCATTAAATAAGCTGCCACCTAG	1
AGCATTACGCTGGTTGCTATTGAT	2
AGCATTATAGGTGCCAGTTTAGCT	1
AGCATTATCGTCTGCGGTGCTGCT	1
AGCATTCGGTGCATATATAGTGAC	1
AGCATTGAATGCCTATTACCTGGT	1
AGCATTGACATGTGCCATGTGCCA	1
AGCATTGACGATGGATGGAAGCCA	1
AGCATTGCACATATGTGTGTCTA	1
AGCATTGCCCATATATAGATGTTG	1
AGCATTGCCTATCAGATATATCGA	1
AGCATTGCTCATATTCATATTGAT	2
AGCATTGGTGCTACGCTATTTCTA	1
AGCATTGTAGGCAACAGGTCC	5
AGCCAAAAACGGTATGGTCGGAAA	1
AGCCAAAAAGGGTAATGGTCGAAA	1
AGCCAAAAAGTACTAGGCCTGGGC	1
AGCCAAAACAACTTATAATCTGAA	1
AGCCAAAACCACTATCCAAACCGCC	1
AGCCAAAACTGCCTCTAATTCAGC	2
AGCCAAAAGATGGAGCTGATACAA	1
AGCCAAAAGGATGCGATGGTATG	1
AGCCAAAAGTTACCTAAGGTGTG	2
AGCCAAAATAGCCTAAGTTCACTA	1
AGCCAAAATTGGAAGTTTGACTAA	1
AGCCAAACAATTGATAGTGCACAC	2
AGCCAAACAATTGGTAGTGACCA	1
AGCCAAACAATTGGTAGTGCCCAC	1
AGCCAAACAGCTGTAAGTAGAGTTG	1
AGCCAAACGAGATACTCACTCCAA	1
AGCCAAAGAGTACAATGGTCGGAA	3
AGCCAAAGATGTTGAACTAGTTAG	1
AGCCAAAGATTTAGCATGCCACAC	1
AGCCAAAGCTAAAATCATGGTGG	1
AGCCAAAGTTTGCCATAGTTGTGG	1
AGCCAAATAGGAAGGTGGTGGTGGA	1
AGCCAAATATAGTGCTCGGAT	1
AGCCAAATCAAATGGAGAGTTGGC	3
AGCCAAATCAGATGGAGTGTTGAC	1
AGCCAAATCGATCGGATACACTCA	2
AGCCAAATTAAATAGGGAGTTGGG	1
AGCCAAATTAGATGGAGAATTGG	1
AGCCAAATTAGATGGAGAATTGGC	4
AGCCAAATTAGATGGAGAGTTGGC	3
AGCCAAATTTTAATAGGATGGT	1
AGCCAACAAAAGGGAAGTGTCCA	1
AGCCAACACTTAGACCCAGCTCT	1
AGCCAACATAGAAAAAAAAGGAGC	3
AGCCAACATGCGCCAAGACAAGAC	1
AGCCAACCTAAAAAGGGATGTGAC	2
AGCCAACCTAAGTACAGATGGGAC	2
AGCCAACCTAGGAGGGGATGGGAC	1
AGCCAACCTAGGCATGGATTTGAC	1
AGCCAACCTGCTATACATGTTAGC	3
AGCCAACCTTGACATAGATGGGAC	1
AGCCAACCTTTAATATGGATAGGA	1
AGCCAACCTTTAATATGGATAGGAC	1
AGCCAACGACTGTGAAGATCGCTG	1
AGCCAACGTCTCTAGGGAGAGAAG	3
AGCCAACTAACGGGGAAAAGTGAC	1
AGCCAACTACTAGTGCCAATTTAT	1
AGCCAACTACTATCAGGTATGTGG	1
AGCCAACTAGAGAGGGGTGAACGC	1
AGCCAACTATAAATTTATGTGGAA	1
AGCCAACTCTCCAACTGATTTGGG	1
AGCCAACTGATAAGCCGATTGATG	1
AGCCAACTGTGATGTGGTGTGCCC	1
AGCCAACTTAGATGGGGATGGGAC	2
AGCCAACTTGAGCACATATGAGGG	2
AGCCAAGCCAACCGAGCTCGAGCC	1
AGCCAAGGAAACGGGCGAGGTCAC	1
AGCCAAGGAGATAAAAGATGTAGC	2
AGCCAAGTATAAGGTAGATGTGAC	1
AGCCAAGTCATCTACAGTAAGCAG	1
AGCCAAGTGCTCAGAAATATCATT	1
AGCCAAGTTATATGTATGAGCGAC	2
AGCCAATAAAAAATTAATGGA	1
AGCCAATAACCGAATTGCCCGGAA	1
AGCCAATAGTGATAGGTACCTGCA	1
AGCCAATCATGTATGGAAGAATGG	1
AGCCAATCATGTGTGGAAGAATGG	1
AGCCAATGAGGTGAGAGGTTCCCC	1
AGCCAATGAGGTGAGGGACTCCC	2
AGCCAATGAGGTGAGGGACTCCCC	1
AGCCAATGAGTTACCTTGTGACGA	1
AGCCAATGATGTCAAATATTTAGA	1
AGCCAATGATGTGAGGGGCTTCT	1
AGCCAATGATGTGAGGGGCTTCTC	1
AGCCAATGCCAAGCTGCAGATGAT	1
AGCCAATGCGAGGAACTGATGGGA	1
AGCCAATGTGTGTTGTGATCCAAC	1
AGCCAATGTTACCAACAACACTGC	2
AGCCAATTAGACGATATTTGAGTG	1
AGCCAATTAGATAACCAACCCTGC	1
AGCCAATTAGGTGAGGGGCTCCCC	1
AGCCAATTCACGTTTTTCAATGTC	3
AGCCAATTGATGTCGATGAGGAGC	2
AGCCACAAAAGTGTGGTGGACAAA	2
AGCCACAACTTTAGGTCCTGGG	1
AGCCACAACTTTAGGTCTTGGG	2
AGCCACAACTTTAGGTTCTGAGCC	1
AGCCACAAGTATGATGTGATAAAG	1
AGCCACAATAACACCGGTCGGTCC	1
AGCCACAATGTAAGAAAGTGCAAG	1
AGCCACACAACTATCGGTGCTTGC	1
AGCCACACACACGATATGACGTTTC	1
AGCCACACATATATGGGTACTTGC	2
AGCCACACATATATGGGTGTTTGC	1
AGCCACACCAATGATGCAAACGTG	1
AGCCACAGATGTGCCTGTTGTTGC	1
AGCCACAGTTAGGACTGCAGTGGA	1
AGCCACATAAAAGAGTGTATTTGC	1
AGCCACATCTCAATCGGATACGGC	1
AGCCACATCTGTTTAACCAAACAA	1
AGCCACATGACAATTTGGCCTAGA	1
AGCCACCATTGAACAAACATTTGA	1
AGCCACCCCTCATGCAATGGGCAA	1
AGCCACCCCTCGTATAAGGGGAAC	1
AGCCACCCTTCAATACCTGGTGCA	1
AGCCACCGGGTAACTAAGGTGATA	2
AGCCACCGGTGTGATTTTTCGGAT	2
AGCCACCTAGCAATATTGTGGAA	3
AGCCACCTTAAAAGGGAGAGCCAC	1
AGCCACGAAAGAAGAGCGGCGGCG	1
AGCCACGATTTCCTAAGGCCGAAA	1
AGCCACGCGACCCTACAGCCTGGC	2
AGCCACGGATTTATAGCCAGCTAC	1
AGCCACGTAGATGTCATGTCGGTC	1
AGCCACGTAGGCGCCACGTCGGCC	1
AGCCACGTAGGTGCCACGTCAGCC	1
AGCCACGTCAGATCTGGTTACGGT	1
AGCCACGTTTGATTGTGGTCTTGC	1
AGCCACTAAATAGCTAGGAAGAGC	1
AGCCACTAACAGGTGGGGCCGTGA	1
AGCCACTAACATAGAATGAACAGG	1
AGCCACTAAGTATGGATGCAT	1
AGCCACTACAGCGAACGTGGAGCC	11
AGCCACTACATGAGACACTATTCT	2
AGCCACTCTGCTTGCCCCTTTTGC	1
AGCCACTGATTATGGGTTGGGATG	1
AGCCACTTGCCCTGCCTACTTAGC	4
AGCCAGAACGTCAAGTTTAAAGGG	1
AGCCAGAAGGACACGAAGTGGAGC	1
AGCCAGACTATATAATAGCAGGTA	1
AGCCAGAGCTGGACCTAATGTCGA	1
AGCCAGAGTTTGGTTTTTTGGGAC	1
AGCCAGATGGTACTGAAAACGGTC	3
AGCCAGCACAACAAATCTGTC	1
AGCCAGCACGAATGGATTGGGTC	1
AGCCAGCACTCCTACATATATACC	1
AGCCAGCAGGACATACGTACGTGC	1
AGCCAGCGTGAGACCTTACGTGGG	1
AGCCAGCGTGGGCAACGATTTTAC	3
AGCCAGCTACACTCTTAGCAAGGC	1
AGCCAGCTAGGTGGCACCATGGTC	1
AGCCAGCTGCAGTACGGACTCCAA	1
AGCCAGCTGTAGTACGGACTCCAA	2
AGCCAGCTGTGTATGACAAGTGGG	2
AGCCAGGACAAGGTTTTCACCTG	1
AGCCAGGAGTGTCATACATTTTAG	1
AGCCAGGATAAAATTATAGTGG	1
AGCCAGGTTCGATGGTGGACGTGA	1
AGCCAGTATAAGGAGGTGGGCCAA	1
AGCCAGTCTTTCCGCCACCTCGGTA	2
AGCCAGTGAAAATGATGACCGGAA	1
AGCCAGTGAAACGGTGAAGTGA	1
AGCCAGTGGGTGGGCTTGAATGGA	1
AGCCAGTGGTACTAATAAGTGAAT	1
AGCCAGTTGCAGTACGGACTCCAA	1
AGCCAGTTTGATGGTGTTAGTTGT	1
AGCCATAAATGATACAGTAACCCA	1
AGCCATAACATATGGACGTGTCTA	1
AGCCATAAGACCTAACCAGTGTCG	1
AGCCATAAGGGGATTGACTGC	6
AGCCATAAGGGGATTGATACTGCC	2
AGCCATAAGTGCTACAGTAACC	2
AGCCATAAGTGCTACAGTAACCCA	1
AGCCATAATCACGGTAGTGGTGGA	2
AGCCATACAAAGCATATCGAG	1
AGCCATACATTTTTATAGAATGGA	1
AGCCATACTTTACTAGCACATTGG	1
AGCCATAGCGGCAAAAGGTAAGCA	1
AGCCATAGTGGAGTTACGTCTGAA	1
AGCCATATGGGAAGTATGTGATGG	2
AGCCATCATGAGGGGACATCCATC	1
AGCCATCATGTGGTTGCCAGCCTA	1
AGCCATCCAAGAATGGGAGGTGTCC	1
AGCCATCGGCTACGTGTGAGAA	2
AGCCATCTAGTATGATATGGGACG	1
AGCCATGATGATGGGAAGATTGGT	1
AGCCATGGAATGATTGAGTTG	4
AGCCATGGAATGATTGAGTTGC	1
AGCCATGGATATAAGTATCCCCAG	2
AGCCATGGGTTAGGATGCAAGTGA	1
AGCCATGGTCGCGACAGTTTGGGA	1
AGCCATGGTTGTGAGTTGAATCGG	1
AGCCATGTATTTCGTGTCATAAAA	2
AGCCATGTCTTGAAGAGAACTAGT	1
AGCCATTAAGATGATAAGTTGTTGG	2
AGCCATTAGATGTCACACCCTGTC	1
AGCCATTATCTGGCAAATAAGGCTA	1
AGCCATTGAGGTGAGGGACTCTTA	1
AGCCATTGAGGTGAGGGGCTCC	1
AGCCATTGAGGTGAGGGGCTCCC	2
AGCCATTGAGGTGAGGGGCTCCCC	5
AGCCATTGAGGTGAGGGGCTCTCC	2
AGCCATTGATCGTATTTAATCGTA	1
AGCCATTGGGTGCTTGATAGTGGA	1
AGCCATTGGTTGGAAAATAACCTG	1
AGCCATTGTCCAGATACGATTAGC	1
AGCCATTGTGACTGGCCTAATAGC	1
AGCCATTGTGACTGGCCTAATGGA	1
AGCCATTTCACGTTTTTTTAGTCG	1
AGCCATTTCTTGACAACTTTGCCA	1
AGCCATTTGATTGTGACTTGCCAT	1
AGCCCAAACATACTGAGATACCCT	1
AGCCCAAAGAGGTGCATATGGTAC	1
AGCCCAAAGATGATGGTGTTCGTT	1
AGCCCAATACAACTATACCGGTTG	2
AGCCCAATCTAGAGCAGTGGTTCC	1
AGCCCAATGTGATCTGGGTGGTCC	2
AGCCCACATCGATCTTTGAAGAAT	1
AGCCCACCACCATATGAAGCTAGC	1
AGCCCACCACCTTAAGGTATTGAT	2
AGCCCACCACCTTATGAAACTAGC	2
AGCCCACCACCTTATGGTGCTAGC	1
AGCCCACCTAATGGGATGGCATGC	1
AGCCCACCTATCAGTGACCACGTC	2
AGCCCACCTCATAGGATGGAATGC	1
AGCCCACCTCATGAGATGGCATGC	1
AGCCCACCTCATGGGATGGCATGC	13
AGCCCACCTCATGGGATGGTATGC	1
AGCCCACTTCTTACTATTAGCCTA	1
AGCCCACTTTAAGAAACCATGGGG	1
AGCCCAGTAGAAGATAAAGTGCCC	1
AGCCCATAGTGAGCGTACCCTAGC	1
AGCCCATCATGACCATACAACCGG	1
AGCCCATGATGGTGGAGGGGCCAA	1
AGCCCATGTTAAGAAAAGAGATGG	1
AGCCCATTTGTGTAAGTGAAGAAA	2
AGCCCCAACCGATGGCGCGAGTAC	2
AGCCCCAATCCGCGCCGCTGATGG	1
AGCCCCACACGTGTAGATTTTCTG	1
AGCCCCACAGCGAACGTGATGCCT	1
AGCCCCACATCTTTAAAAGGTACA	1
AGCCCCAGACCGGTCGCCGCCAAG	1
AGCCCCATGGAAGGAGGTTGCTGC	2
AGCCCCCACGAAGATACCACTAAA	1
AGCCCCGCTGTGCTCACCTAACC	1
AGCCCCGGTTGGATGGTCATGATG	3
AGCCCCGGTTGTATGGTCATGACG	2
AGCCCCGGTTGTATGGTCATGATG	1
AGCCCCTACAGTGAACATAGTGCC	2
AGCCCCTGTGAAGTTTATGGA	1
AGCCCCTTTAGGATCCTACGCGGC	1
AGCCCGAATGTAAAAGTAGCCTT	1
AGCCCGATGCTGGCAACCTCGTGC	1
AGCCCGCCTGCGAAAATGGAAGGG	2
AGCCCGCGGACCGCTCAGGTGGGC	1
AGCCCGCTCCTCTTCTCTCTCATC	1
AGCCCGCTCTGATACCATATTGAA	1
AGCCCGCTGCTATTCTCTCTCCTT	1
AGCCCGCTGCTCTTCTCTCTTCTC	1
AGCCCGCTTCTCATCTCTCTCCTC	1
AGCCCGGAGGATCCAAACAAGGCC	1
AGCCCGGATCACCAGCTAAGGCCC	1
AGCCCGGTTACCCACTAATTAGGT	1
AGCCCGTCAAGAATCGTATTGCG	1
AGCCCGTCACATACCTGGTGCAA	8
AGCCCGTCACGGATGACACCTATC	1
AGCCCGTTTGAGATGACTTCTGCC	1
AGCCCGTTTTGTGGCAAGCCGAAC	1
AGCCCTAAAAGTGGATGGATGCGG	1
AGCCCTAAGGGTACTCACAGTGCA	1
AGCCCTACAAGTTTAAGGACCGCC	1
AGCCCTACATATGTACACACTATA	1
AGCCCTACATCCTGTTGACCGGAG	1
AGCCCTACTCTTAACATAATCCTG	1
AGCCCTACTTGCAACTATTCGTGA	1
AGCCCTAGAGGTGTTTGGATGGAA	1
AGCCCTAGCCTAATTAGTATGGGA	1
AGCCCTAGTCAAGCTGCCTGTGGA	1
AGCCCTATTCGGTAGGCAGGTGTA	1
AGCCCTCAGAGATTAGCAGCGGC	2
AGCCCTCGATACCTAAAAGTGTA	1
AGCCCTGATCTCATAACGGAGATA	3
AGCCCTGATTGAGCCACAATCAAC	1
AGCCCTGGTTAGATGGCCATGACT	1
AGCCCTGGTTGAGATGCCTGCGGG	1
AGCCCTTAGAAGGTTGGTAGCTCT	1
AGCCCTTTATCCTCTTTGTGCAAT	1
AGCCCTTTGATTATACCACAGGAT	1
AGCCGAACACAGCCTAAGAGATGG	1
AGCCGAACATGATTGATTGACGCC	1
AGCCGAACATGCCCGAGGTCGACT	1
AGCCGAAGAAATATGAGAAATCCA	1
AGCCGAATGGTTGTCTCTGCA	1
AGCCGACACACGCGAGTACAAGGA	1
AGCCGACACCTGAGGGGGTATCCC	1
AGCCGACACGAAGATGTTCAAGTA	2
AGCCGACACTGATACTATAGATGCC	1
AGCCGACAGGTTCGGGCCGCTCCA	1
AGCCGACATAGAGGAAGACCAC	1
AGCCGACCCCGCAGTTTATGCATA	1
AGCCGACGACACTGGTGCGGTGTG	1
AGCCGACGATGAAGGTGTAGTACA	1
AGCCGACGCCACTAGGGTTCAGCC	1
AGCCGACGGCCTAGTTTTGGTTGA	1
AGCCGACGGTGGAAGAAGGTGGAA	3
AGCCGACTAAATGATGACGTGTAGG	1
AGCCGACTCGTGGTATCAGACCAA	1
AGCCGAGATACGATGGGCGAAGT	1
AGCCGAGATTGATGAAACGACTGC	1
AGCCGAGCACAGAATGACCATGCA	1
AGCCGAGCTTGGATATTGATCGAG	1
AGCCGAGGATGTAAAACCCAACT	1
AGCCGAGTATATTGAACCTACAGG	3
AGCCGATAACGCGAATAGTGGTGG	2
AGCCGATAATCCAAGATGTGCGGC	1
AGCCGATACGAGTGGTACAGGAGTC	1
AGCCGATACGATGAATAGCAGTG	2
AGCCGATAGGTGGGACCAGTAGAC	1
AGCCGATATGACGAATAGTAGTGG	2
AGCCGATATGATCTTTATATATGC	1
AGCCGATATGATGAATAGTAGTGG	3
AGCCGATATGTAAGAAACGGGTGG	2
AGCCGATATTGCGAATAGTAGTGG	1
AGCCGATATTGGGTGATACCTAAC	1
AGCCGATATTGTAAATAGTAGTGA	1
AGCCGATATTGTAATTCCAGCCT	1
AGCCGATATTGTGAATAGTAGTGA	1
AGCCGATCAGGGTTCGAAGCCTCA	1
AGCCGATCGACTAACAAGCCGATG	1
AGCCGATCTTTTAGCTGGACAGGA	1
AGCCGATGAGGCGAAGAGGTTGGC	3
AGCCGATGATGAAGGATATTGAGG	1
AGCCGATGGCTGCCTACCCTCCCC	1
AGCCGATGGGTACTTACCTCTGCA	1
AGCCGATGGTGATGTTCTGACTGA	1
AGCCGATGGTTCTCAAAATAACC	1
AGCCGATGTCTAAGATGATGGTCGA	6
AGCCGATTAGATTAGATATCGACG	1
AGCCGATTGACCTGAATAACCCAC	1
AGCCGATTGGACTTAAACGGC	1
AGCCGATTGGGAAGATTGTCCTAG	1
AGCCGATTGGGCCGACTATGGATT	1
AGCCGATTGGTGATTAGATGATGT	1
AGCCGATTGTAGGTTAGATAGCGA	1
AGCCGATTGTAGGTTAGATAGTGA	1
AGCCGATTGTCCTGCTGCCACCAC	3
AGCCGATTTGATGAATAGTAGTC	4
AGCCGATTTGGACACAAGAACCAA	1
AGCCGATTTTTAGCTCAGTGTGGT	1
AGCCGATTTTTCCATACGGGCCTA	1
AGCCGCACAATCTGCATGGGGCAA	2
AGCCGCATATTGGGGATACACGCA	1
AGCCGCATGCGAAAATGGAGCA	1
AGCCGCATTGTGCTACACATCACA	1
AGCCGCCACAACGAACGTGGTGTC	2
AGCCGCCACCACCATTTTTACACC	2
AGCCGCCACGTCAGATAAAACCGG	1
AGCCGCCACGTCGCATAAAACCGG	1
AGCCGCCACGTCGGATAAAACCGG	2
AGCCGCCGCCTGGACACGCTTGAT	1
AGCCGCCGCGTAGGATATAACCGG	1
AGCCGCCGGTTAGAACATTACGCC	3
AGCCGCCGTGTGACGTTGTAACCT	1
AGCCGCGATAGTCACACGATTT	1
AGCCGCGATGGATAAAGCGCTAGT	1
AGCCGCGTGGTGGAGCATGGAGGC	1
AGCCGCTATTTTCTCGATGGATGT	1
AGCCGCTGACATATGGGATCGGGT	1
AGCCGCTGACGGTTTGGTGGGACT	3
AGCCGCTGGTGATTGCAATGGCGC	1
AGCCGCTTAGGTTGGTCGCCGTCC	1
AGCCGGACGGTCAAAGTTGTGCAA	3
AGCCGGAGATGGTGGGACTTTGGT	1
AGCCGGATAACCATGTCGTGTGGG	1
AGCCGGATACATGTAGATGTGTGT	4
AGCCGGATCTGCTCGGTGGGGAAG	4
AGCCGGATGAGAGCGCGGAGGTGG	1
AGCCGGATTAGTATAGGTATAGAT	2
AGCCGGCACCAATATGATGTTGTG	1
AGCCGGCCACGAAGCTGACAACGA	1
AGCCGGCGGTGAAGACGTAGACGC	1
AGCCGGCGTATCTTAAAATTGATG	1
AGCCGGCTAAATGCTGAGGTGGAG	2
AGCCGGCTAAATGCTGATGTGGAG	3
AGCCGGCTATAAATATGTAGCATG	1
AGCCGGCTGTAACACAAACTTCA	1
AGCCGGTATAGGTGCTGGTGTTGG	1
AGCCGGTCCTTAAAGTTGGAGCGT	2
AGCCGGTCGATCATGCTTGAA	3
AGCCGGTCTGGTGATTACGTTGTG	1
AGCCGGTGGACTTATAGTTATAAG	2
AGCCGGTGGAGAGGAGGATGATGG	4
AGCCGGTGGGACTATTTGGCTAGC	1
AGCCGGTGGTGAAGACGTAGACAC	1
AGCCGGTGGTGACGTTCTGACTGA	1
AGCCGGTGGTGATGTTCTGACTGA	2
AGCCGGTGGTGGTGTTACTAGCAC	5
AGCCGGTGTTCGTCGATACACTCC	1
AGCCGGTGTTGCTCTTTATTCATC	1
AGCCGGTTGGTAGCCAGCTTCTG	1
AGCCGGTTGTAAGTTACAGTCCGC	1
AGCCGGTTGTAGGTTTACAGCTCG	1
AGCCGGTTGTGCAAGTTGGGCCTG	1
AGCCGTAAATACGAGCACCCGTGC	2
AGCCGTAATACCAGAAATGTGTAC	1
AGCCGTACCGCAAGTGTTTGCCAA	1
AGCCGTAGAGAGATGATCGAA	1
AGCCGTAGCTATACGATATGATGG	1
AGCCGTATAATCTGCATAGGTCAC	1
AGCCGTATGTAAAAATGGGAGGTC	1
AGCCGTCACCACCAGAATCAGCGG	1
AGCCGTCCCTCTCCCTCTTGTGGA	1
AGCCGTCGAACTTGCGCCAAATGG	1
AGCCGTCGTTCGGTGTTGTAACCT	1
AGCCGTCTATCCCCACTTGTGACA	1
AGCCGTCTGCTGTGTCGCCATGGA	1
AGCCGTGAGAACGAACGTGGAGGC	2
AGCCGTGATACAGTTTTTAGATGT	1
AGCCGTGATATGACGTGGGTGTTCC	1
AGCCGTGCCCGCGGTTATGGGCGA	1
AGCCGTGGATTCGCAGGTGGTGAG	2
AGCCGTGGGTAGGACTGTGGATGG	2
AGCCGTGGTAAATTTGCAATTGCC	1
AGCCGTGGTGAACTGGGCAGAGAC	1
AGCCGTGGTGGTGTTTGCCGATGCT	1
AGCCGTGTCAGACATTGTCAGGGC	2
AGCCGTTAGATTTATTTTGGAGGG	2
AGCCGTTGACGACGAGGAGGGTTG	1
AGCCGTTGACGATGTGGTCGGCAG	1
AGCCGTTGATCGTATTTAATCATA	1
AGCCGTTGGAATATGAAGAGTCCA	1
AGCCGTTGGTGTAGCCCGTGGCCC	1
AGCCGTTTGATTGGACCATACGAA	1
AGCCGTTTGGAGAACACTAGAGGG	1
AGCCTAAAAATTGAGACATCTTGT	2
AGCCTAAACATGGGTTAAGTGCAA	1
AGCCTAAACCTGAATTTGTGGAGA	1
AGCCTAAAGCCACGAACCAAACT	1
AGCCTAAATGTTGCCTATTCAAAT	1
AGCCTAACAATAGACAGAGTCCAC	1
AGCCTAACTAGTCCTGAAAATCT	1
AGCCTAACTGCATTTTTGTCAGGA	1
AGCCTAAGATGATATGTTTGG	1
AGCCTAAGCCTAAACAAAGAGGGC	2
AGCCTAAGCGGTTTAATTAGTCGA	1
AGCCTAAGTAGCTCGGCCTAAATG	1
AGCCTAAGTGCACCATGATTTGAC	1
AGCCTAAGTGTAGAAATTGATGTA	1
AGCCTAAGTGTAGGATTATGGATG	1
AGCCTAATACCATAGTATACATAT	1
AGCCTAATAGGTGCCAAATAACAC	1
AGCCTAATGGTTATAAGAGCCTCA	1
AGCCTAATTACATTATGATTTGAT	1
AGCCTAATTACGATATGGTTTGAC	1
AGCCTAATTACGTCATGATTTGAC	1
AGCCTAATTAGCTAAGACTTGGAC	1
AGCCTAATTAGTCTATTATTTGAC	1
AGCCTAATTGAGATGTTCAAACGT	1
AGCCTAATTGCGCCATGATTCGAC	1
AGCCTAATTGCGCCATGATTTGAC	1
AGCCTAATTGGTCTCTTGCGATGC	1
AGCCTAATTGTGACCTGAGAGGCC	1
AGCCTAATTGTGCCATGATTTGAC	1
AGCCTACAACCTTGATTTGGGGAG	2
AGCCTACACATGTTATCGTTGCCA	1
AGCCTACAGGAATCTCTCCCTGCA	1
AGCCTACCATAAGCTTAGATGGA	2
AGCCTACCATCTTGTGGAGCTAGC	1
AGCCTACCGACGGTGCTGTGGTCG	1
AGCCTACCTATCTCACTATTCGGG	2
AGCCTACCTCATGGGATGATATGC	1
AGCCTACCTCATGGGATGGCATGC	1
AGCCTACCTTGAGTTTTAGGTGGT	1
AGCCTACTATATTTCTTCGACTAC	1
AGCCTACTGTGACTGTGATTGAAG	3
AGCCTAGAACGTAACTCAATTGAG	1
AGCCTAGAAGTTATGGAATAGGTT	1
AGCCTAGAGTGGTAAGTTTGGATC	2
AGCCTAGATAAAGTATGGTTGGGC	1
AGCCTAGATGATCGACAAGCAAGA	1
AGCCTAGATTATATTTTAGTGGGA	1
AGCCTAGCCCGAATTTAAACGGTA	1
AGCCTAGGGGGTTAAATGGACTGG	1
AGCCTAGGGGTTATGGAATGGGTT	1
AGCCTAGGGTGGTATGTTTGGATC	1
AGCCTAGGTATACGGGGTGGGCAA	1
AGCCTAGTAAAAGAGTTCCAACAC	2
AGCCTAGTACGTCGTGGTGGTGTG	1
AGCCTAGTCCGTAAGGCATATGGG	1
AGCCTAGTCGTGGTTTGTTGTGAC	2
AGCCTAGTCTATGATGCCCGCAGA	2
AGCCTAGTGCAGTGACCTGAGTAG	1
AGCCTAGTGGTCGCAGTGACCTGA	1
AGCCTAGTGGTGTGCCAGATGTAA	1
AGCCTAGTGGTGTTTGGATTCAGG	1
AGCCTAGTGGTTACAAGAGCCTA	1
AGCCTAGTGGTTACAGTAACCTAA	1
AGCCTAGTGGTTACAGTGACCTAA	1
AGCCTAGTGGTTACAGTGACCTGA	3
AGCCTAGTGGTTATAGTGACCTA	1
AGCCTAGTGGTTATAGTGACCTGA	1
AGCCTAGTGGTTGCAGCACTCTACT	1
AGCCTAGTGGTTGCAGTGACCTGA	2
AGCCTAGTGGTTGCAGTGACTTAA	1
AGCCTAGTGGTTGCAGTGATCTGAG	1
AGCCTAGTGGTTGCGGTAACCTCA	1
AGCCTAGTGGTTGTAGTGACCTG	1
AGCCTAGTGGTTGTAGTGACCTGA	1
AGCCTAGTGTTTGCTTGATTGCC	2
AGCCTAGTGTTTGCTTGATTGCCA	2
AGCCTAGTTGTTACAATGACCTAA	1
AGCCTAGTTTGTTGTGAGCCA	2
AGCCTATAAATAGAAAGCCAGTGC	2
AGCCTATAACGAGTCGAGTTCGAG	2
AGCCTATACAAGAAATGAGTT	2
AGCCTATACAATACAAATGGA	1
AGCCTATACTAAAGTCAACACATA	1
AGCCTATACTGAGTTGGGCTCAAA	1
AGCCTATAGATAACCATTGTGGG	1
AGCCTATATGTAATACTTCAGATG	1
AGCCTATATGTCATAAACGCAGGG	1
AGCCTATATTGCCTGATCACAGTA	1
AGCCTATATTTAATACTTCAAGCA	1
AGCCTATATTTAATACTTCAT	1
AGCCTATATTTAATACTTCATGTA	1
AGCCTATATTTAATACTTTACGTA	2
AGCCTATATTTAATATTTCATGTA	1
AGCCTATCAGTAATTTTGGTGTG	1
AGCCTATCTAAGTGTTGTCGACAT	1
AGCCTATGACATGTGGGTCATGCT	2
AGCCTATGATTTGGCTAAGGTGGT	1
AGCCTATGGGACAAAGTGGACACA	1
AGCCTATGTCCTACAAGTTAGTG	1
AGCCTATGTGGCAGATGGATGACC	1
AGCCTATGTGTGTCTCACGCTGAC	3
AGCCTATGTTATCTGATGCAGAGG	1
AGCCTATTAGGTACCAGCCTGTGC	1
AGCCTATTATAAACTTATGTGGAA	1
AGCCTATTATAAGCTTAGGTGGAG	1
AGCCTATTATAAGCTTATGTGGAG	1
AGCCTATTCAGTTGATAACTAACT	1
AGCCTATTGTTGCTCGAGTAATGC	1
AGCCTATTTAATGCTATGGACACC	1
AGCCTATTTAGATTCATAGTCTAG	1
AGCCTCAACGATGTGACTCACTTA	1
AGCCTCAAGTAAGGTGGGTGGTCG	1
AGCCTCAATTATTGCACCAACGAT	2
AGCCTCACCGTACGTGCATTTCGC	1
AGCCTCACTAGAAGCTGCGGCC	1
AGCCTCACTCAGTTGGCACGATGG	2
AGCCTCAGATGAAATTTGGAGGAC	1
AGCCTCAGGTATAGGATGTGCCAA	1
AGCCTCAGTGGTGTGGTATGGTAA	3
AGCCTCATATTAGATGTGCCCAC	2
AGCCTCATCAGGGACAGAAGGGCA	1
AGCCTCATCTGATGTCTTGCCTGT	1
AGCCTCATTGTTTAGCTTATGCT	6
AGCCTCCACAGCGAACGTAGTGCC	2
AGCCTCCACAGCGAACGTGATGCC	1
AGCCTCCACAGCGAACGTGGTGCA	1
AGCCTCCACAGCGAACGTGGTGTC	1
AGCCTCCACGGTAAACGTGATGTC	1
AGCCTCCATCCTTTGCTGTCGC	1
AGCCTCCATCGGGTCTAACGGGGG	1
AGCCTCCCATTTTCACGTGCGGAC	1
AGCCTCCTCCTCCAGCCCCCACCA	1
AGCCTCGAATCCGCGTACATGGTA	1
AGCCTCGAGCTTTTTTGATAGCC	1
AGCCTCGATCACTCGGGGTAGTTC	1
AGCCTCGCCGGTGCAAACCTAGGG	1
AGCCTCGGTTGGTAACACTAATCG	1
AGCCTCGTACCACGTGGTAGTGCA	2
AGCCTCGTGCGGGCACCTAAAGG	1
AGCCTCGTTTGACCGTGGTCTTGC	1
AGCCTCGTTTGACTGTGGTCTTGC	1
AGCCTCGTTTGATCATGGTCTTTT	1
AGCCTCTACAGCGAACGTGGTGAC	1
AGCCTCTACAGTGAACGTGGTGTC	3
AGCCTCTTATAACCACTAAGCTAC	3
AGCCTCTTTGAGTCACTACTC	1
AGCCTGAAATTCATCCATGAATCG	2
AGCCTGAATTCTGTATATGTGTA	1
AGCCTGACACGATGCGTTGAGACT	1
AGCCTGACATCTTTAGAACCGGGA	2
AGCCTGACTGTTAGGCTGTGTCTA	2
AGCCTGAGAGCATGAAACCATGTG	1
AGCCTGAGCGATTTGAGGATAGCA	1
AGCCTGATAAGTGAGTTGGTTCAA	1
AGCCTGATACTATCATATGCATAT	1
AGCCTGATTTGGAATTGGTAACCA	2
AGCCTGCAACGATTTGGAGTGGG	1
AGCCTGCATATATTTGATTGGATG	1
AGCCTGCATCTAGGACGGAGTACA	1
AGCCTGCATGATCCGCAAGGG	1
AGCCTGCATGGAATTCTTCCGTTG	1
AGCCTGCATGTTCGCTCTTATGGC	1
AGCCTGCGAGACCACCCGCGTGTA	1
AGCCTGCGTGGATACAATGGTGAG	1
AGCCTGCGTGTAAATTGTGAGACG	1
AGCCTGCTAATGGGTTGGGTTGAA	1
AGCCTGCTACTGTACCTGCTCAAA	1
AGCCTGCTATTGTACCTGCTCTAA	2
AGCCTGCTGATATGGATTTATTGT	1
AGCCTGCTTGGCCACCTTCAA	1
AGCCTGGAAGCCACTAGTGTT	1
AGCCTGGAGGTGCTGTGTTCGAGC	1
AGCCTGGATAAAAGAGATGGGCCA	1
AGCCTGGCCTATCTATGGTGTAGC	1
AGCCTGGGAAAAGACAGGAAGGCT	1
AGCCTGGGCCTGGCGCACCCCAA	2
AGCCTGGGTGTGCTAACTTGGAAC	2
AGCCTGGTAAGGATGGTGTGGAAA	1
AGCCTGGTCTGACCGAACCCAAAC	1
AGCCTGGTGAAGTCCGGAAGCGGG	1
AGCCTGGTGTTTGGTGACTAGCGC	1
AGCCTGGTTACGGTGCCGAACTGC	1
AGCCTGGTTGCATGATATTGCTGC	1
AGCCTGTAAAACTGCAAAAAGGAA	1
AGCCTGTATATGAACGATATGAAT	1
AGCCTGTGATGATTAGCATATTGTTGG	1
AGCCTGTGGTGGTATTGTTGGTCC	1
AGCCTGTGTTTAGTTACACGCTAA	1
AGCCTGTTGGAATTAATGAATGGG	1
AGCCTTAAACGCAATGCCTTCAAG	1
AGCCTTAACTTGAACTGCAGCGGG	2
AGCCTTAAGAGTTGGGTCTGGAGT	1
AGCCTTAATCAGTAGCAAAAGATC	1
AGCCTTACAGTAAACATGGTAC	2
AGCCTTACAGTAAACATGGTACAA	2
AGCCTTACATTATGAAACGGAGGG	3
AGCCTTACATTATGAAATGAAGGG	2
AGCCTTAGAGTTGGGGTTGGTGTA	4
AGCCTTATCACGATGGCGCAGGCTA	1
AGCCTTATCCGGTGAAGATGCGGG	1
AGCCTTCGAGGTGAGTTGAGGTGA	1
AGCCTTCTACGTGATAAGAATCGC	1
AGCCTTCTCAGTGAACGTGATGTA	1
AGCCTTCTCCTGGGCTTGTGTGTTA	1
AGCCTTCTTACTGAGAGCGGTAAC	1
AGCCTTGATCGCTATTGACCCAGC	1
AGCCTTGATGACGTGCGACCTGAC	1
AGCCTTGCTCTAAGTCGGTTGGGA	1
AGCCTTGCTCTAATTGATCTGCAC	1
AGCCTTGTGCAATGGTTGCTTCGT	1
AGCCTTGTGCTACTTGTTTGTTGG	1
AGCCTTGTGTGTTTAGGATACGTA	2
AGCCTTTACACTACTTAGAGTCTA	1
AGCCTTTAGATCTGATCCAATCAA	1
AGCCTTTCGGAATCTTGCTATTTAG	1
AGCCTTTGCTATAATGACACTGGA	2
AGCCTTTGGATCTGATCCAATCAA	1
AGCGAAAACATGGCGCTATGGTAC	1
AGCGAAAAGAAGGGTGTCATCCAC	1
AGCGAAAAGATGATGTATCAAACA	3
AGCGAAAATAATGGTATAAACGAA	1
AGCGAAACTGAGTCATCTTGAGGG	1
AGCGAAACTTACCGAAAATGGAGA	1
AGCGAAATTCGGTGGAGCGCTCTC	1
AGCGAACAAGAGGTGAGGTGAGG	1
AGCGAACAGATGAGGATGAGCTGA	1
AGCGAACCAAACAAGAGGCAACCA	1
AGCGAACGACTCAACAACGGCTGC	1
AGCGAACGTGGAGCCTTCTTTCAA	5
AGCGAACGTGGTGTCTCCTTTCAA	12
AGCGAACGTGGTGTCTCCTTTTAA	1
AGCGAACGTGGTGTCTGCTTTCAA	6
AGCGAACGTGGTGTCTTCTTTCAA	5
AGCGAACGTGGTGTCTTTATTCAA	1
AGCGAACGTGTTGCCTTTTTTCAA	1
AGCGAACTGTAAGAACTGTGCTAA	1
AGCGAACTGTGCGATGTGCTTTGG	1
AGCGAAGACCGGAAAGATGATGGA	1
AGCGAAGCCTAGACGGTCGTTCGA	1
AGCGAAGGCAGCTCTCTGGGTCCC	1
AGCGAAGTGACTCATCATCCCCTC	2
AGCGAAGTGGCAGCGGGTGCTAAA	1
AGCGAAGTGTCTGTGGTGACTTTG	3
AGCGAAGTTGTGGTGGCCGATGGT	1
AGCGAATAGTGAATAGGTGTCGAA	4
AGCGAATATGGTGTCTCCTTTCAA	1
AGCGAATATGGTGTCTCTTTTCAA	7
AGCGAATCGCGTGCGATGGGATCA	1
AGCGAATCTGGACAGGAGGATGTC	1
AGCGAATGGATGTCGGCGGTGTCG	1
AGCGAATGTGCTTATGGAATGTGC	5
AGCGAATTCCAGCGGTGAATTTCA	1
AGCGAATTCCTCAGGATTTAACGA	1
AGCGAATTTAATGGTGTAATCGGA	2
AGCGAATTTGTTGATGTTGCAC	4
AGCGACAAGAGATTGACTAAACGG	1
AGCGACAATTCTGGAACTCCTCCA	1
AGCGACATATTGCAAGACGGTGAC	2
AGCGACATATTTCAGATTGCTGCA	1
AGCGACATGATTGACACGGGCCTT	1
AGCGACCATGGGCCAATGTGATAG	1
AGCGACGAAGGTGTTCGATGTTCC	1
AGCGACGAATTGCTGCCACAAGTC	1
AGCGACGAGTTAGGAAGTGGTGAC	1
AGCGACGATGATGATAGTAGCCC	1
AGCGACGATGTCATAGGTGCGAAG	1
AGCGACGCGACGGCGATGATGGC	1
AGCGACGGAATAGTGTGGAGGGCG	1
AGCGACGTCGACGATGAGTAC	2
AGCGACTACTAATTTAGAATGGAG	1
AGCGACTACTGTGGCTGCGATGGG	2
AGCGACTTACAATGTAAATACATG	1
AGCGAGAACGAAAGTGTAAGTGCA	1
AGCGAGAAGCGATATGGATTGCC	1
AGCGAGAAGGTGCGGAGTATACGA	1
AGCGAGATACGAGGGAGCGAGGTA	1
AGCGAGATATGATGGACCGCTGGA	2
AGCGAGATCGATGGTATATTTATG	1
AGCGAGATGCTCTCGGAAGACGAC	2
AGCGAGCGAGATTGGTGAATTGAA	1
AGCGAGGAAAACAACAACGAG	3
AGCGAGGACTAGAGACAAGGTGAA	1
AGCGAGGAGAACGCACGAGGAGGA	2
AGCGAGGAGGAGACGAGCGGCAGA	1
AGCGAGGCGTCTGTGGTGACTTCG	1
AGCGAGGGGAGCCGTCAAAGATGA	1
AGCGAGGTGATATGTGTAAGTTGG	2
AGCGAGGTGCCCATGATTCGTCAA	1
AGCGAGGTGGTACACGGTAATCGA	2
AGCGAGGTGTTTGTGGTTACTTCA	4
AGCGAGTGGCAGGGTGACAACAAG	1
AGCGAGTTTGAATCAGGCTGCTAT	1
AGCGATACAGGGAAGCCTCACGCT	1
AGCGATACCGGGAAGCCTCACGCT	1
AGCGATACCGGGAAGCCTCACGCTA	1
AGCGATACCGGGAAGCCTCATGCT	2
AGCGATACGGTCTCCAAAACACAA	1
AGCGATACTGGGAAGCCTCACGCTC	1
AGCGATATGGAGCAGTATTTAGTA	1
AGCGATATGGTCTACAAAATACAA	2
AGCGATCGATCGTCGTTAGGTGGG	1
AGCGATCGCTACCTAAATAGCCTG	1
AGCGATCTCCGGCGGCAATGGATC	1
AGCGATCTTTAGTCTCGGATTGGT	1
AGCGATGAATAAAGGAGGAGGTGG	1
AGCGATGATGGAGGCAACGTGGCC	1
AGCGATGATGTGGTCTGGTCGACC	1
AGCGATGCCACTAGAATTTTATAA	1
AGCGATGCCCCCAAGGAGGATGCG	1
AGCGATGGTGATACTACGTGTTGC	1
AGCGATGTATACAGGTTCGGGC	1
AGCGATTAGCGGGTGATTAATTAA	1
AGCGATTGTTTTGGGTGGTTTGT	1
AGCGATTTATTCAGATGATGTGGT	5
AGCGATTTTGGTCCTACGTGACGT	1
AGCGCAATGGTGCTGGACTAGTC	1
AGCGCAATTCTGGTGTTGATTGAT	1
AGCGCACGAATATACCGATGTAGC	1
AGCGCACGGATATACCATTGTAGC	2
AGCGCACGGATATACTATTGTAGC	1
AGCGCACGGGTATACAGATGTAGC	2
AGCGCACTAATATACCGATGTAGC	1
AGCGCAGGTGAGTATGGAGGCACG	1
AGCGCAGTGCGATTCATGGTTGG	1
AGCGCATGGCCTGGGTCCACTAGA	1
AGCGCATGGGACATACGGTTGCT	1
AGCGCCAAAAGATATGGGGACCAC	1
AGCGCCAAATAGCATGGTGCTGAA	1
AGCGCCAAATCGTATGGTTTAGCA	1
AGCGCCAATATCGTTGGAGCCGA	2
AGCGCCAATTCTTACTACACGGGC	1
AGCGCCACAATAGTAGAGTGAC	1
AGCGCCACATAGGATTCTATAGGG	1
AGCGCCACGTGGAATGAAGACCGG	1
AGCGCCAGATTACGTAGGTGTAGA	1
AGCGCCATGTCATTGCCACGTGGG	1
AGCGCCATTCAACCAGGTGCACGG	4
AGCGCCATTGGAATTAGTGCTGAG	1
AGCGCCCAAGCGGTAGTTGTCTCC	2
AGCGCCCGACGCCTGATGGCGACG	1
AGCGCCCGATTGATTGATCGTCC	1
AGCGCCCGCCATCGGTGGTTGTGC	1
AGCGCCCGCTATAGCATTTCGCTA	1
AGCGCCCTTGCCCTGAAGATGAAC	1
AGCGCCGAAAGTGTGTTGTTGTGA	1
AGCGCCGAATGGATAGGGTTGGGC	1
AGCGCCGACTTCACCACTGCAGCG	2
AGCGCCGATGCTGCTGGTGCTGGC	1
AGCGCCGCGTCGGTCATGGGATGA	1
AGCGCCTCTAATCAAATCAGAAGC	1
AGCGCCTGCTCACACGCATCATCC	1
AGCGCCTGGAAGCGGGCTATTTTC	1
AGCGCCTGGCCTGGTCGCCGGTGA	1
AGCGCGACAGATAGTGCGAGGTGT	1
AGCGCGACGGCAAGCGACGATGGA	2
AGCGCGATGTAGGTGTTGGTGGCG	1
AGCGCGGAATCTAAGACACATTGT	1
AGCGCGGGCACTTGGACTGGAGAA	1
AGCGCGGGGTATCTGCAGAATGTG	1
AGCGCGGGTGTCACTTAGGTCCAT	1
AGCGCGTACTTAGGGCCTGTTTGG	1
AGCGCTAATGCAAAACTAGGTAGC	2
AGCGCTACGTCAATGTCACGTGGG	1
AGCGCTACGTGGTGACTTATGAAC	1
AGCGCTAGCTGTTGCCTTGTTGGG	1
AGCGCTAGGTGAGGGTGCGGTCCC	1
AGCGCTCCACGGTGGATCGGTGCT	1
AGCGCTGAATCTTTAGGACCGGTG	1
AGCGCTTAAAGATATAGTTTTCTT	1
AGCGCTTACATGTGTGTTAAACC	1
AGCGCTTCCGTAATATGCGGGTGA	1
AGCGCTTGAGGAAGAGGCGGTGCT	1
AGCGCTTGTAGGAAGATTAATGGA	1
AGCGCTTTCAAGCCGCCACGTGGC	1
AGCGGAACGGTACCTAATGGTGTC	1
AGCGGAAGACTAGGGCGATGACCA	1
AGCGGAAGAGTCTCGTGAGGTGGT	1
AGCGGACAGAAGGCCACGACGGCG	6
AGCGGACAGGTAAACCGGTGTGGT	1
AGCGGACCCCACACGATATGGTAA	3
AGCGGACGGAATGGTGTGAAGGG	1
AGCGGACGTGTTTGCTAGGTTCTC	1
AGCGGAGACATGATGGCATCTACT	1
AGCGGAGCGTAGGGGGGCATGTGC	1
AGCGGAGCTAGTTCGTACATGCCA	1
AGCGGAGCTGTGTGATCTTGAGGG	1
AGCGGAGGCCTCATCTGATGTGTC	1
AGCGGAGTCTGTTGAAAGCGGTGG	1
AGCGGAGTTTGGTTATACAACACA	2
AGCGGATCGTGGATAGTGGGTGCT	1
AGCGGATGATAGTGGTCTCCACA	3
AGCGGATGGGAGCGAGCATTGGAG	2
AGCGGATGTAGAGCGGGTGTGGA	1
AGCGGATGTATGAGATGTGAGCAA	1
AGCGGATTCGAACGGATAGTGGT	1
AGCGGATTGCCACATGCGACGAGG	1
AGCGGATTGTTGTGCTGATGGGCA	1
AGCGGCAACAGTGGGAGCTCCGAG	1
AGCGGCACCTTGACTGATGGCGTC	2
AGCGGCAGTCAGACCGGCGGGAGC	1
AGCGGCCAAAAGCAATTTTTGCAG	2
AGCGGCCCGAACCTGTCTACGTCG	1
AGCGGCCTACAGATTTGTAGCCAG	1
AGCGGCCTGGAGTGGTGTATAGAG	1
AGCGGCCTGTTTGGTTGGAGGGAG	1
AGCGGCGAATTAGGTTAGAAGGAA	1
AGCGGCGATGTTAGGGTTTCGTCC	1
AGCGGCGCTGACGACGACGGCACC	2
AGCGGCGGTCGGTTCGATGCTAGC	1
AGCGGCGTCTGCATGTCCACGTTG	1
AGCGGCGTGCAGTTGCCGACGGGC	1
AGCGGCGTTGTTCTATGTGGCTGA	1
AGCGGGAGCTGTGCCAAACGGTCC	3
AGCGGGAGGCCCTTGTGGTGACCC	1
AGCGGGAGTACTATGTAGTAGGAA	1
AGCGGGATGGTGTGGCCTTTCGCC	5
AGCGGGCGTTGCTTTCTTTGGGGA	1
AGCGGGCTACATATTTTTAGCGGG	1
AGCGGGCTCGCTGTTGTTGGAGGC	1
AGCGGGGTGTCACTCTGTTATGGT	4
AGCGGGGTTTAGGCAGCTCCACAA	2
AGCGGGTGAAAATCGTTGAGGGCG	1
AGCGGGTGAGATTCAAGGATTTG	1
AGCGGGTGCACAGACTTTTGGCTA	1
AGCGGGTGCTAAGCGATTGCGCGA	1
AGCGGGTGCTAATGCAATCGCCGA	1
AGCGGGTGGCAATGTCGATGCAGC	1
AGCGGGTGGTGATAGAGAGGGCGA	1
AGCGGGTGTGAAGCCGTCTTGGCT	1
AGCGGGTGTGACAGTTTTGTCCTG	2
AGCGGGTGTGGGCCCGAGGTGTCA	1
AGCGGGTTACAGATATATAGCC	1
AGCGGGTTTTGGTTGATGGCGCAT	1
AGCGGTACAAGTTTAGAGAGGGAC	1
AGCGGTATTGCGTAGCGAAAGTGC	1
AGCGGTCAAACATATGCTAAAAAG	1
AGCGGTCCTTAAAATTATCGTGAG	1
AGCGGTGAACATGAACTGTGGCGC	1
AGCGGTGAACTCCGTGGCGAATTCC	1
AGCGGTGAAGTTTTTGAGGAGGTC	1
AGCGGTGACGATGCTGTGTGCTC	1
AGCGGTGACGATGCTGTGTGCTCC	1
AGCGGTGAGAGGAACGGTTGAGTG	1
AGCGGTGAGCATGTAAATGGAGGC	2
AGCGGTGGATGTGTTCTGGCTGCT	1
AGCGGTGGCAGTTGGTGGACATGC	1
AGCGGTGGCGCAAAGCGGCTGAAG	1
AGCGGTGGCTGCATCGATGATGGC	2
AGCGGTGGTCGTTTGCATACGGT	1
AGCGGTGTCGGAGATATGGGCCCG	1
AGCGGTGTGTCATATAGGTTCTA	1
AGCGGTGTTAAATATTTAGAAACG	2
AGCGGTGTTCGCAAGGAAAAGGTA	1
AGCGGTGTTCTACGGCTAAAACC	1
AGCGGTGTTCTACGGCTAAAACCA	1
AGCGGTTCAGAAACGTAGGTGCGG	1
AGCGGTTGAGCTTGGGGACGATA	1
AGCGGTTGCCAATCAGATAGTGCC	1
AGCGGTTGCTGTTTGTGATAGTGC	1
AGCGGTTGGCGCTGAGGTAGCTGC	1
AGCGGTTTATGTCCTCGAACCAGC	1
AGCGGTTTGAAAAGAGTGCGC	1
AGCGGTTTGGATGGTGGTTTTGGC	2
AGCGGTTTGGATGGTGGTTTTGGCTG	1
AGCGGTTTGTCCTACGTGGCGTACG	1
AGCGGTTTTGGATGGCGGTTTTGCT	1
AGCGGTTTTGGCTGATGTGGCACC	1
AGCGGTTTTGTCCTACGTGGCGTA	1
AGCGTAAATTGTGCTGAGATGCCT	1
AGCGTAAGGTGAGAAGCGTTGGAA	1
AGCGTAATACCCTACTCCTGTGCA	1
AGCGTACTATAAGCTTACGTGAAA	2
AGCGTAGAAACTGATAGTTGCACT	1
AGCGTAGAATAGGGTCCAAATCA	1
AGCGTAGACCGGAAAGACGATGGA	2
AGCGTAGCCATCTGGGTCCACGTC	2
AGCGTAGGTCCTAAATTTTGATGA	1
AGCGTAGGTGCTGTGGGACTCGAG	1
AGCGTATGCTAATGGAAACAATGG	1
AGCGTATTAGCGATGTAGGGGAGA	2
AGCGTATTGTTGATGGTATCAGCC	1
AGCGTCAAACATTTAGGAAATGAG	1
AGCGTCAAGTGGTGCATTTGAGGT	1
AGCGTCAGAGCTATATGCGAGCCG	1
AGCGTCATGTCAATGCCACGTGGG	1
AGCGTCCAAACATCCGATGTGACA	2
AGCGTCCAAAGTGTGGGTGCAGAG	1
AGCGTCCGGACAAGCCACAATGGA	1
AGCGTCGACCAAATGTGGTACACA	1
AGCGTCGAGACCTACAAGATCTAT	1
AGCGTCGCCTATCCATCCGTCACC	1
AGCGTGAAACCCATGTGGACCCAC	1
AGCGTGAACTAAGGTGGTGTTTGG	1
AGCGTGCACGAAGAGAGATAGGA	1
AGCGTGCATGGAGAGGGAGGAGGC	1
AGCGTGCCAGTTAGTTTGATGCTA	1
AGCGTGCCAGTTGATTTGATCATG	2
AGCGTGCCAGTTGATTTGATCTT	1
AGCGTGCGGCAGTATGGTGGAGGG	1
AGCGTGCGTGCGGTAAACGAGAGA	1
AGCGTGCGTGTGGAAATCGAAGGA	1
AGCGTGCTAACGGAAAACGAGGAC	2
AGCGTGCTATAGATATGTAGCCAG	1
AGCGTGCTCACGGAAAACGAGGGA	1
AGCGTGCTGTGGAGTTAACGACCC	2
AGCGTGGCTGATGATGGACATGAC	2
AGCGTGGGACCCACGAGGTGTCG	1
AGCGTGGGATCCACGTGGGCGCCA	1
AGCGTGGGTGCTACTCCGTTGAAT	1
AGCGTGGTAGCGTTATTTGGTCAC	1
AGCGTGGTGGAGATGCATGGAGCG	1
AGCGTGGTGTCACTTAGATCTATG	1
AGCGTGTAACCGTATATTGATAGT	1
AGCGTGTCACATCGGATATACAGA	1
AGCGTGTCCCATCGGATACACAGA	2
AGCGTGTCTACCGTTGTCGATGCC	2
AGCGTGTGCCTGGTGCCCGCG	1
AGCGTGTGCGCGGAAAACGAGAGA	1
AGCGTGTGTCCTCTGAGCTCTCGC	1
AGCGTGTGTGCTGATGCCCCATGA	1
AGCGTGTGTGGTGGTGTGTGTCT	1
AGCGTGTTGAGAATTGAACATGG	1
AGCGTGTTGGCTGCTTAGACCGGA	1
AGCGTTACGCCGGTGGTCATACAC	1
AGCGTTATAGCCTATCAAGTTAGA	1
AGCGTTGGACCATGTTGTTAGATA	1
AGCGTTGGTACGAGTGCCATGTGG	2
AGCGTTGTCGTGATATTCAGTTT	1
AGCGTTGTGGTCAATTGCGTGTAA	1
AGCGTTGTTGTCTAGGTATGAA	1
AGCGTTTATAGGAAATTTAATGGA	2
AGCGTTTATAGGATGCCATGTGAC	1
AGCGTTTATAGGATGTCTATGTGG	1
AGCGTTTATAGGGTGCTACGTGAC	2
AGCGTTTCGTCTTGTGTCTAATGT	1
AGCGTTTCTGCTGCAGATGGAATC	1
AGCGTTTGTTCAGGAACAAGGGGA	1
AGCGTTTTGAGATGTCCATGATGG	1
AGCGTTTTTAGCGCCAGGGTCGGC	2
AGCGTTTTTGCCACTACACACCGT	1
AGCGTTTTTGCGGTGTCTTTCAAC	6
AGCTAAAACGAAATGAAATGAGTG	1
AGCTAAAATAGTGAGGTGGAGGA	1
AGCTAAAATTAAGATGCCGATGAG	1
AGCTAAACCCGAGTGGGCTGGTTC	1
AGCTAAACCCTGCCTGAACTGAAC	1
AGCTAAACTAGGATGGTTAAGGA	1
AGCTAAACTAGTGAAGGTGTGCTA	2
AGCTAAAGCTGGATATAGACCTA	1
AGCTAAAGGTTAGCATGGTGTGGG	2
AGCTAAATCAGATGGAGAGTTGGC	1
AGCTAAATGCTGAGGTGAAGGA	1
AGCTAAATTGGGATACTAAGGTGG	1
AGCTAAATTTCAAATTATGGTGAA	1
AGCTAAATTTGGTGGTTCTCTCTC	2
AGCTAAATTTTGGCATGCCTA	1
AGCTAACAAGGGGGGTTATGGGGA	1
AGCTAACAATCTGTAGCATGCCTA	6
AGCTAACAATCTGTGGCATGCCTA	3
AGCTAACAATTTGTGGCATGCCTA	1
AGCTAACCACCTCCAAGGTAGAGG	1
AGCTAACCCCTACGTGAGGATCCC	1
AGCTAACCGGAAGACCCCTGCGCA	2
AGCTAACCTAGAAGGGGATGTGAC	1
AGCTAACCTGGCAACGTTTGATGG	1
AGCTAACGAAGATGGACGAACTAG	2
AGCTAACGAAGGTGACCCGAGGAA	1
AGCTAACGTGGCAGACGGTGGGTC	2
AGCTAACTATGGATAGACTGCTGA	6
AGCTAACTATTATATGGGTGGGCT	2
AGCTAACTATTGTATGGGTAGGCTA	1
AGCTAACTTAGATGCGGATGGGTC	1
AGCTAACTTAGGTGGTGTTTACATC	2
AGCTAACTTGTAGCCTGCTATTGT	1
AGCTAACTTGTATAATAGGTTAG	2
AGCTAAGAAACTTTTATTGGGGGA	1
AGCTAAGACGATATCGAGAGCAAG	1
AGCTAAGAGAAGACTACACAGAAC	1
AGCTAAGAGAGGTGCGATGGATCC	1
AGCTAAGCAAAGTGGGATTATTCA	1
AGCTAAGCCCAATCGATGGGTGGG	1
AGCTAAGCCGCAGCTCATCCTTGA	1
AGCTAAGGACCTAAGATATAAGTG	2
AGCTAAGGCAAGCAGCAGAGGTGA	1
AGCTAAGGGCCTGTTTGGTACAGC	3
AGCTAAGGTAGTGTATGCATGGGC	1
AGCTAAGGTGAAATTCACTGTGGG	3
AGCTAAGGTGAATGCTGACAAGAG	1
AGCTAAGGTGTGGCTCACTTTTTGT	1
AGCTAATACTGCAAAAGATGGAAG	1
AGCTAATAGATAGTTAGGTGT	1
AGCTAATAGTAGGAAGAGATGCCG	1
AGCTAATCTATTATATGTGTTGAT	1
AGCTAATGACAGAAGGGATGGGCC	1
AGCTAATGCCAGAGAAACTAGAGA	1
AGCTAATGCGGGTGTCTAAATTTG	1
AGCTAATTACGCATTTGAGTGTCT	1
AGCTAATTATCACTGTTGGAGGT	1
AGCTAATTCAGGGCTAAAAGGTGG	3
AGCTACAAATCGACTGGTGATGGC	1
AGCTACAAATCTGTAGCCTGCTGC	1
AGCTACAACCAGGTGAGTGTCT	1
AGCTACAATCAGCACCACAGGAGC	1
AGCTACACAAGATGATGGACTAGA	1
AGCTACACGGCTGAGCTACTTTCT	1
AGCTACACTAAGAAACAGGTGTGG	2
AGCTACAGATCTGTGGCCAGCTGC	1
AGCTACAGATTGATGGTCTAGCTG	4
AGCTACAGTAATAAGGCTGGTGTC	1
AGCTACATGCTAATTTGATGTCAC	1
AGCTACATTGAGGGCCTGTTTGGT	1
AGCTACATTTTAGGACGGAGGTAG	1
AGCTACCAAGGTGGATGATGTCAA	1
AGCTACCAGGATACCAGGACTAGA	1
AGCTACCATCGACGATATAGGCAC	1
AGCTACCATGGTAGGAAGAGTGTC	1
AGCTACCCGTGGATGCCACATGAC	1
AGCTACCTAGTACAGGATGGGACA	1
AGCTACCTAGTACATGATGTGACA	1
AGCTACCTTATTCGTCAGTGGTAC	1
AGCTACGTGCGGAAAGTTGGGAAC	1
AGCTACTAGGTGGCAGTTGTGCAA	1
AGCTACTTTGTGGGGATTGGGGGA	1
AGCTAGAAAAGTGGATGGGTTTAG	1
AGCTAGAAAATAGGAAAAGTTAGC	1
AGCTAGAACAAAATGAAGGGGG	1
AGCTAGAACAAAATGAGGGGGTTC	1
AGCTAGAACAAATTGAAGGGGGT	1
AGCTAGAACGAAATGGAAGAGGGT	1
AGCTAGAATGAGGTGTCACTTAGC	1
AGCTAGAATTGGTTGCGAACCCGT	1
AGCTAGAGCGAAACAGAGGGTGGT	1
AGCTAGAGCTGTGCCAAACGGAGC	1
AGCTAGAGCTGTGCTAAATAGGAC	1
AGCTAGATAGTCTACCCGGGGTAC	1
AGCTAGATAGTGCTAAAGAGAGGC	1
AGCTAGATCTAGGATAAGATTGAG	1
AGCTAGATGATGGTCAACATTGAT	1
AGCTAGATGGCACAATATGACAAG	1
AGCTAGATGGTGGTTGTACAGCTG	1
AGCTAGATGTTGATGGAATCATGG	1
AGCTAGATTCATTTATTGCAGGAC	1
AGCTAGATTGAATGAGTGATGGCA	1
AGCTAGCAACATGTTGTCATGGT	2
AGCTAGCCAATGAGGTGAGGGGCT	1
AGCTAGCCATTGAGGTGAGGGGCT	1
AGCTAGCGAACGAGCGGAACCGAC	1
AGCTAGCGGTGGCCGAAGATCGAT	1
AGCTAGCTAGATGTCTAGGTGCGA	1
AGCTAGCTAGGATGGGCATTATTG	1
AGCTAGCTGTTGATTGGTACGGTA	1
AGCTAGCTTCATAAGTTGGTGGTC	1
AGCTAGCTTGCGATGTAAGTTGGT	2
AGCTAGGAGGCTGATGCTGGGAAC	2
AGCTAGGATTAAATGAGATGTGA	1
AGCTAGGATTAAATGAGGTGTGAA	1
AGCTAGGCCTAGATCTGGGACATG	1
AGCTAGGGCTCCTAGGTGGAATGA	2
AGCTAGGGTTTAGATAGCCGAGAG	1
AGCTAGGTACTTTACGGGAATGCT	1
AGCTAGGTGGCAGTAGGTGGTGGT	1
AGCTAGGTTTTATGCGGGGTAG	1
AGCTAGTAACTGGGAACCTTC	1
AGCTAGTACTTATTAGTGGTGTCG	1
AGCTAGTATCAGACCGACCGCCGC	1
AGCTAGTCATTGAGGTGAGGGGTTC	1
AGCTAGTCGAGCGGCGGCAGTGGC	1
AGCTAGTCGGTGAGAATTTGGAGA	1
AGCTAGTGACTTTATGTGGAGTGG	1
AGCTAGTGCATACAACTTGGCGCCA	1
AGCTAGTGGTAGCTGGTTTGTCT	2
AGCTAGTGGTAGCTGGTTTGTCTA	1
AGCTAGTGTTATAGCATTGGTGTC	1
AGCTAGTTACTCAGCCAGGGGTGT	2
AGCTAGTTGTGTCCTCATCATGAA	1
AGCTATAAACGTGCGGTCTACAAG	1
AGCTATAAGATGGTCTGTGTGTGG	1
AGCTATAATATATTAAAGGTGTCG	1
AGCTATAGATGAATTGGAGCTAGT	1
AGCTATAGGAGAGGTGAAGCTGAA	1
AGCTATAGGTATGGCTTCAAGTTC	1
AGCTATATTGGTTGGGGAGGAGCG	1
AGCTATCAAAACCGGTGCAAACAA	1
AGCTATCACCATCAGTGGCCCACC	1
AGCTATCAGATATAAGCGGGCCTA	1
AGCTATCAGATGTAAGTGGGCCCG	1
AGCTATGAAATGCTTCTGGGTGAG	3
AGCTATGAATCGGGACATGCATCG	1
AGCTATGGATGAGCCTTCTGT	5
AGCTATGGGCACCTCACAATTCTT	1
AGCTATGGTGTAGTTTTTGATTGC	4
AGCTATGTAGGGTACTTATTATGG	1
AGCTATGTGGGCACTATTTCC	1
AGCTATTCTACTTTGCAGGAGCGG	1
AGCTATTGGGAATGCACGGCTACA	1
AGCTATTTACAACTAATACAGGGC	1
AGCTATTTAGAATAAAAGAGGTGT	4
AGCTATTTCTAGCACAGTGTCTT	1
AGCTATTTCTAGCAGAGTGTCTT	1
AGCTATTTGCGATGTGAGTGTAGC	1
AGCTATTTGGCCATTACAGGTGGG	1
AGCTATTTTTCTACCTACATTCTT	1
AGCTCAAAGAGTTGGGTCTGGAGT	2
AGCTCAAATTGGGCCAGAGAATGA	1
AGCTCAACCATTAAAGGAGGCCTA	1
AGCTCAAGATGATGACGGTGACCA	1
AGCTCAAGTGGATGTCCACCCGTT	1
AGCTCAATCAGATGGTGAAAAATC	1
AGCTCAATCCACGGTGGTTTTGAC	2
AGCTCACATGAATTGTCGTGCCTG	1
AGCTCACTAGCTGGCTGAGCACGA	1
AGCTCAGCGGTTGCTGCATGGCGC	1
AGCTCAGGAGGGATAGCGCCT	1
AGCTCAGGATTATTACAGATTGGC	1
AGCTCAGGGCCGATCTTTTGGGCT	1
AGCTCAGTGGTGGGGTTGCTTGAG	1
AGCTCATAGAGAACCAAGGTGTCA	1
AGCTCATATGGGCCACACATGCCT	1
AGCTCCAATTTGACCTACTAGCAA	1
AGCTCCACTCCCAGTTTTGGTGGA	2
AGCTCCACTCCCATTTTAGGTGG	1
AGCTCCAGCTCCATCTTTCTTGAG	2
AGCTCCAGCTGGTGTCGAGATGGC	1
AGCTCCAGGGAAGGTGGATGTGGA	1
AGCTCCAGGGGTTACTGGTTGC	2
AGCTCCCACGAAGACCTCACTAAA	1
AGCTCCGATTGGACCTATGGTAGA	2
AGCTCCGGCTCTAGGTAAGTTGGA	1
AGCTCCGGGTGCTGAGCTAGCTAG	1
AGCTCCTGCGGTGGTGCGTGGAGG	1
AGCTCCTGGTTGTGGTGTTTTCTG	1
AGCTCCTTCTGTTGCCATCACATC	1
AGCTCGAAGGTGCAATAGACTCAG	1
AGCTCGACGCCACAACGCTCGGTT	1
AGCTCGACGCCTTGTTCCCGAGGA	1
AGCTCGATAAGAGTGATGGAGCG	1
AGCTCGCGTAGTCTCTTGGCACC	1
AGCTCGGGACAAGCGTTAATCGGG	1
AGCTCGGGTACTTGCACCTTGGTC	1
AGCTCGGTCAGGCTTGGTAGAAGC	1
AGCTCGTCCGCTCGTTCTCATTTC	1
AGCTCGTGAGGTAGATGGACGAGG	1
AGCTCGTGTGAGAGTGCCAATGCC	1
AGCTCTAAGATAACGGTAGTGCTA	1
AGCTCTAATCCGAGGTGGCATGGA	1
AGCTCTACTCCAAACTATGGTCCT	1
AGCTCTAGCTCTAGGAGAGGTGG	1
AGCTCTAGTAAAACTGGGGGTGA	2
AGCTCTCAACCGGTGTAAGGTATG	1
AGCTCTCCAAATAACTCTGGGCTA	1
AGCTCTCCGAACTACTCACTCCGT	1
AGCTCTGATACCAATTGTTGGACC	4
AGCTCTTCTTATCCTCCTGGTGTT	1
AGCTCTTCTTGAGCAAAGGCCGG	1
AGCTCTTGAAGAAGAGATAGTGCA	2
AGCTCTTGCATGAAAGCCAGTATC	1
AGCTCTTGTCTTTTGGTGTAGTAA	2
AGCTCTTTACCATTAATACAGGGC	1
AGCTGAAAAGTAGTGGGAATGCC	1
AGCTGAAACAAACAGGACCT	1
AGCTGAAACAAGATGGTAACGCAG	8
AGCTGAAACATTGTTGGTAAAAAA	3
AGCTGAAACTAGGCCTAATGGTAC	1
AGCTGAAAGAAACAGGACCATGAC	1
AGCTGAATCGAGATGGATCCCTAC	1
AGCTGAATCTGCGGGTTTGAT	2
AGCTGAATCTTGCGATACGGTGAA	1
AGCTGAATCTTGCGATACGGTGAAA	1
AGCTGACAACTACGTACTAACATA	1
AGCTGACACGACGCCTACGTGACT	1
AGCTGACAGATGTAAGCGGGCCTG	3
AGCTGACATGCAATAAACGGGTGG	1
AGCTGACATGCGGGCCCAAGGGAA	2
AGCTGACATGTGTGTCCTGTGTAC	1
AGCTGACCATATGCGATAATAGCC	1
AGCTGACCTGGTGCTAGGTGGGCC	4
AGCTGACGACATGAACTCCGGTGG	1
AGCTGACGTGGCACACGGGTGTAT	1
AGCTGACGTGGCAGACGGTGGGTC	1
AGCTGACTATATAGGTGTTTGGAG	1
AGCTGACTATATGGGTGTTTGGAG	1
AGCTGACTTGCTGTAGTGTGTCCA	2
AGCTGAGATTGCATCGGTCTA	3
AGCTGAGCTGGTGATGCATGTTGG	1
AGCTGAGGAATACAGATTTGGTCC	1
AGCTGAGGGTGAACTAAACACGGC	1
AGCTGATAAGATAATAGGTAGCAA	3
AGCTGATATGTGGCTACTAGGCGC	1
AGCTGATGAGAAAAGACGAACAAT	1
AGCTGATGAGTGACTTAATTCTAC	2
AGCTGATGATTATGGTATTAGGCC	1
AGCTGATGATTGATGGGAATATAG	1
AGCTGATGCGAGTATGTGGTCCTG	1
AGCTGATGGGGTGCTGATGTGACC	1
AGCTGATGGTGGAACACACAGAGC	1
AGCTGATGTGCACGAGGGTGTCCC	1
AGCTGATGTGGAGCAGGTCTGCCA	1
AGCTGATGTGTTTAAGGTCGTGCT	1
AGCTGATGTTGATTAGATGTGACG	1
AGCTGATGTTGATTAGGATGTGAC	1
AGCTGATGTTGATTAGGATGTGGC	1
AGCTGATTCTCCGGCATGGAAGA	1
AGCTGATTGCATTGTGTAACTATA	1
AGCTGATTGCGGTGTATAATTAAA	2
AGCTGATTTAGGTTCTTGCAA	1
AGCTGATTTTGATGTGCTTCATGA	2
AGCTGCAACGATGAGTTGGCGGAG	1
AGCTGCAGCAGTTGGCCTGCCGAA	1
AGCTGCATGCGATAATGGGCCTA	1
AGCTGCATGCGATAATGGGCCTAT	1
AGCTGCGGGGTTGATGGTCACTAG	4
AGCTGCTAGACCTAGCGGGTGGAG	1
AGCTGCTATATACGATTTAGTGAC	1
AGCTGCTCCATGGTCTGAGGT	1
AGCTGCTCTAGCTACAGTTTCGGA	3
AGCTGCTGAGGACATGATCGGTAC	1
AGCTGCTGTGCCTTTTTTCGAGGG	1
AGCTGCTGTGTGGGACGAAGTGAG	1
AGCTGCTTGCTGATGGGGTGCGGC	1
AGCTGGACTGGCGATAGGAGAAAC	1
AGCTGGACTGTTTGGGGGAGCTT	1
AGCTGGAGAAGAAGGTGTCACTGG	1
AGCTGGAGAAGCTGAGTTTCAGAG	1
AGCTGGAGCTATGCCAAACAGGTC	1
AGCTGGAGCTGTGCCAAACAGGG	1
AGCTGGAGGGTGAATGGAAAAGAG	1
AGCTGGAGGTGTTGATGGATCCGG	1
AGCTGGATAGGAAAATGGGTC	6
AGCTGGATAGTGCTAAAAAGAGAC	2
AGCTGGATATACGGTACCAAATAC	1
AGCTGGATCCGGAGCTGGTGCGCC	1
AGCTGGATGAACTAGGGAGGTGGA	1
AGCTGGATTTAGGCTGCTTCACAA	1
AGCTGGCGAGCAACGCAGTGCCC	1
AGCTGGCGATACTATTGAACCTGC	1
AGCTGGCGGTGTCTTATGTGTGGC	1
AGCTGGCTTATAGCATGCTATTGTA	2
AGCTGGGCTGAGCTGAATTGGCGC	1
AGCTGGGTGAAGCGTTATCACAAA	1
AGCTGGGTGGCCTCTTCCTCGA	1
AGCTGGTCCACCCGTTGGTGCGCA	1
AGCTGGTGAATACATGGGCCCCA	1
AGCTGGTGAGGTGAGCTGTAAAGG	1
AGCTGGTGAGGTTCCTAGTTCTA	1
AGCTGGTGGACTCACAAGAACGTG	1
AGCTGGTGTGTGTGGTAACTGAGA	2
AGCTGGTTCCTTGCTGTCGACGGC	2
AGCTGGTTGATGTGACTATACTAG	1
AGCTGGTTGTCGAGGAAGGATGTG	3
AGCTGGTTTTAGAACTGGTGGCCA	1
AGCTGTAAGTAGAGTTGAGTGAAG	1
AGCTGTACAAACCTACAAAACATC	1
AGCTGTACTGCTGTGCCTAGTGGT	1
AGCTGTAGGACACTGCACGTAGTC	1
AGCTGTCACGTAGGTTAAAATCAG	1
AGCTGTCAGGGATTCTGTCGGA	1
AGCTGTCCGATTGGGGGAAGATGC	1
AGCTGTCGCAAGACGATTAGGGAG	1
AGCTGTCTACAAATCTGTAGCCCG	1
AGCTGTCTGATGGCTGAAGGTTGA	2
AGCTGTGATTGGGATGGGGATGAG	2
AGCTGTGCCAATCTGATAGGACGG	1
AGCTGTGGAATATGGGCTAT	1
AGCTGTGGCCTCCATTGTGAGCTG	1
AGCTGTGGGCTGTGACATTTTGAA	2
AGCTGTGGGTTCCTATATTTTATA	1
AGCTGTGTGCTGTGACTTTTTGAA	3
AGCTGTGTTTAGATTGGTCCAAAG	1
AGCTGTTACACGTAATATGTACAC	1
AGCTGTTAGATTGGTGATGTC	22
AGCTGTTAGATTGGTGATGTCT	1
AGCTGTTCCAATGGATTGCCTG	1
AGCTGTTCGGCGAGCGATACCGCC	1
AGCTGTTGATACCTTAGGATTGAG	1
AGCTGTTGGCCTTCGGAGTAGTGT	2
AGCTGTTTGGCACCTACTCCTTCC	1
AGCTGTTTTGCCGGTGGTTTTTGCA	1
AGCTTAAGGGCTACCTGATTTGGA	1
AGCTTAAGGGGATACCACATGTGC	1
AGCTTAAGGTGCTGCGATCGTGCT	1
AGCTTAAGGTGTGGTCACAAGACA	1
AGCTTAAGTAGCAAGTGGCCAAGC	1
AGCTTACACGGGGAGGTAGCGAA	1
AGCTTACGGTGCGGCAACAAGCTA	1
AGCTTACGTGAACTGGTAGGGGAC	2
AGCTTACGTTGTGTCTTGCGCATC	1
AGCTTACTGTAAGCTTACGTGAAG	1
AGCTTAGATGGTTGCACTGCTCAA	1
AGCTTAGATTTTGCACTGGGGCGA	1
AGCTTAGCGTGGCTGAATACGGT	2
AGCTTAGGCCTTATTTAGATGGGA	1
AGCTTATGATCTAAGAGTGATGGA	1
AGCTTATGTAGGTAGTAGGGTGGA	1
AGCTTATGTATGAGTGCCATTTGG	1
AGCTTCAAAGGTGGTGGACTAGAC	1
AGCTTCACGGCAAGTTGTGCAC	1
AGCTTCAGAAGGGATGGAGCTGGA	1
AGCTTCAGATTGTTCATGTGGTCC	1
AGCTTCATCCCTCTAAATTCC	2
AGCTTCCGTATAAGACATGGTATG	1
AGCTTCCGTTTGCCCGAGTAGCAA	1
AGCTTCCTTGTTAGCCTAGCGGTG	1
AGCTTCGAACCCAGGTCGTTTAGC	1
AGCTTCGAGGCATCGACGGTGATC	1
AGCTTCGGACCACGAGGGAGGTGA	1
AGCTTCGGATGAAATGGTACCTCA	1
AGCTTCGGCGAGATTAAGGTTGAC	2
AGCTTCGGGCTAGTCCATGTGAAG	1
AGCTTCGGTGTTGTTTTACTGGAG	1
AGCTTCGTGTCCTTGGATGAACCT	2
AGCTTCTAAAATCTTGTGGATG	1
AGCTTCTACGGTGTGGATCGAAGC	2
AGCTTCTAGAGGTGGTGCTGTCGG	1
AGCTTCTATTTGATGGTCGGCTGG	1
AGCTTCTCAAACAGCTATAGCGAC	1
AGCTTCTCCTACGGATCTGGCGGC	1
AGCTTGAAACGATGATTATGCAAA	1
AGCTTGACAAATGTTGATGTGTAA	1
AGCTTGACCAGGGCTACACCTAATC	2
AGCTTGACGAGGTGTTTCGACAGG	1
AGCTTGAGAAATCTATAGGTGAGA	1
AGCTTGAGGGGATTGTTGACGGTC	1
AGCTTGATGCAAAGACGGCCA	1
AGCTTGCAATGGGAGGTATCTCTA	1
AGCTTGCCTGCAGTCGATCGTGCC	1
AGCTTGCCTTGAGAGTATGGCGCC	2
AGCTTGGAAACAACGGTTTGAGGA	1
AGCTTGGAATGGTGTCTGAGAAGG	1
AGCTTGGACACCTACAACAGTGGT	1
AGCTTGGGAGCGTTTGTAGGGTAC	3
AGCTTGGGGGCCGCCGGATCTGGC	1
AGCTTGGTAGGAATTTTGACATGG	1
AGCTTGGTCTATATGAACGATTG	1
AGCTTGGTGTAGTTTGTCCTAAAA	1
AGCTTGGTTAGGTTGCTGGCG	1
AGCTTGGTTGGGGTGCTGTATTAA	1
AGCTTGGTTTGACCAGGTTTCTCC	1
AGCTTGTACTGTGGTGCTGTAAGA	1
AGCTTGTCTATCAACTGCAGGTGG	1
AGCTTGTGAAGATGCCTCATACCA	1
AGCTTGTGACGGACGCTGTGCCC	1
AGCTTGTGTTCTATAGGATGGTA	1
AGCTTTCACGTGTAGCCTATTAAG	1
AGCTTTGAAAGAGGGGTACGCCT	1
AGCTTTGCTCATGTCCAGCTTGAT	1
AGCTTTGGTCTAAGTTGGGTGCTA	1
AGCTTTGTATTCTGACTCTGTGCT	1
AGCTTTTAGGTGGTGTTTGGATC	1
AGCTTTTGATTTGATGTCCATATA	2
AGCTTTTGGTACAGATTCTCAGAA	1
AGCTTTTGGTCCAGATTCTAAGAA	1
AGCTTTTGGTCCAGATTCTGAGAA	1
AGCTTTTTGGTGATTGTCGTAGCT	1
AGGAAAAAAGGAAATGACGGCAGC	2
AGGAAAAAATGATGTGGCAGGTGA	1
AGGAAAAACATAGGAATCGGATGA	1
AGGAAAAACGCAGGATTTTGATAGG	1
AGGAAAAACGTAAGATTTTGGTAGG	1
AGGAAAAACGTAGGAATTGAATGC	1
AGGAAAAAGAAGGCCTAAGGATTG	1
AGGAAAAAGGAAGAACATGGTGAT	1
AGGAAAAATAGCAAGAGGTGTCAC	1
AGGAAAAATTCAATGTGTGGATGC	1
AGGAAAACCACGTGCAACATTTAC	1
AGGAAAACCCTTAGGGCCTGCTTGC	2
AGGAAAACTTGTGGGATATGGAGC	2
AGGAAAAGAAATATGGTTGCTACG	1
AGGAAAAGACCACGGACGCCGACC	2
AGGAAAAGGAGCCTCCACGTTCGC	1
AGGAAAATATGGGTTAGAATATGA	2
AGGAAAATCAAACTTGGTAGCTT	1
AGGAAAATCTATTTTCGTGTGCGC	1
AGGAAAATGATGGTGATTTGTCAA	1
AGGAAAATGGTACTGATTACACGA	1
AGGAAAATGTACCTAGGATCGCCA	1
AGGAAAATGTGTTGATGGGCTATG	1
AGGAAAATTAACGGGTGTCACTAG	2
AGGAAAATTAATCCTGACGTGCGC	1
AGGAAAATTTTGATGTGATGAAA	1
AGGAAAATTTTGGGTGTCACATCG	1
AGGAAACAGATGTTGCAATGG	2
AGGAAACAGTCCTACTCCGGTGTT	1
AGGAAACCCAACAACGACAGATGG	1
AGGAAACCCCTATAGCAGGAAGGC	1
AGGAAACCGGTGGTCCACGAAGGC	1
AGGAAACCTATGGGCTTGGGCC	2
AGGAAACGCCTGTTGAACCCACTG	1
AGGAAACGGCAGCCGCGTTGTGTC	1
AGGAAACGTGTATGTGAAAAGTTG	2
AGGAAACTCTGGTGGAGGCTCGAA	2
AGGAAACTGAGGCGTCTGAGAGAA	1
AGGAAACTGGCCAAATTCTAGTGG	2
AGGAAAGAAAGCTCGGCTTGTCTC	1
AGGAAAGAAGTTAAAGCGGGGTGG	1
AGGAAAGAATGCTCTCCGGTGTCC	1
AGGAAAGACCAAAACAACGAAGAG	1
AGGAAAGACCATTTACGATCCTAA	1
AGGAAAGAGAAAGATGGTTGCTAC	6
AGGAAAGATAGGTGTTTGATGAAC	1
AGGAAAGATATGTGCCAGATCCGG	1
AGGAAAGATTAACAGGAGGGTCTG	1
AGGAAAGATTACTGTTGTGCTGAC	2
AGGAAAGCACACCGGATTGATCTA	1
AGGAAAGCGATTTACTCCGGTTGA	1
AGGAAAGCTTATGGGCCTGTTCAC	1
AGGAAAGCTTTGATGTGATGGAAA	1
AGGAAAGGAGATAGGGTTTCTGCC	1
AGGAAAGGGAACGCCAGATGTGCG	1
AGGAAAGGGATCCTCTGACGTGAA	1
AGGAAAGGTGCGCTGCTTTGAGTT	1
AGGAAAGGTGCGCTGTAATGGGTT	1
AGGAAAGGTGGAGCTGGAGCTGAA	1
AGGAAAGGTGTTTGCAGGCTGCTA	3
AGGAAAGTAAAGCGGTGCCAAGAA	2
AGGAAAGTAATGCGGTGCCAAAAA	1
AGGAAAGTACCAAGGTGCACTAGG	1
AGGAAAGTGGATGGGTTTGGAGAC	1
AGGAAAGTTCGATGTGATGGAAAA	2
AGGAAAGTTTCGACGTGATGGAAA	2
AGGAAAGTTTCGATGTGATGAAAA	1
AGGAAAGTTTCGATGTGATGGAAGA	1
AGGAAAGTTTGATGCGATGGAACA	2
AGGAAAGTTTTCGATGTGATATGA	1
AGGAAAGTTTTCGATGTGATGTGA	6
AGGAAAGTTTTGAGATGTGATGGA	3
AGGAAAGTTTTGATGTGATGGA	2
AGGAAAGTTTTGATGTGATGGAA	1
AGGAAAGTTTTGATGTGATGGAAA	1
AGGAAAGTTTTGATGTGATGTAAA	2
AGGAAAGTTTTGGATGTGATGTGA	7
AGGAAATAAAGGGGCCTCAGCAAT	1
AGGAAATAGAAAGATGGTTGCTAC	1
AGGAAATAGTGAGAATGGTGTATG	1
AGGAAATATGTGAATGGTTGCTTA	1
AGGAAATATTCCAAGAGGTTAGAC	1
AGGAAATCATGAGCTACAATTAGG	2
AGGAAATCCGATCGCCTATAAGAC	3
AGGAAATCGGACGCTTCAAAACGC	1
AGGAAATGAAAATTTTTGGGTGT	1
AGGAAATGAAACGCGCTGGATGGT	1
AGGAAATGAAATTTTTTGGGTGT	1
AGGAAATGGACAACCCTATAGGGA	1
AGGAAATGGGTGCGCTAAAATGAG	1
AGGAAATGGTGACTTGGTGAGTAC	1
AGGAAATGTCCTATCCGGTCCTA	1
AGGAAATGTTCCAAGAGGTTAGAC	1
AGGAAATGTTCCATCCGGTCCTA	3
AGGAAATGTTCCATCCGGTCCTAAG	2
AGGAAATGTTGGTACTAGGAAATG	2
AGGAAATGTTGGTGAAGAAGTTGT	1
AGGAAATTATTGGTGCTTCTGATC	2
AGGAAATTCAAACAAGCCGAGCCT	1
AGGAAATTCACCAGGTGACACCTC	1
AGGAAATTCTTCCCGGGTGCACAC	1
AGGAAATTGATCTACTAAAGGAAG	3
AGGAAATTTAACGTGAGGTAGGAC	1
AGGAAATTTTCCAAGAGGTTAGAC	1
AGGAACACGTATCGTGCTAGTGCA	1
AGGAACAGCTGAAGTGGAGGCCT	1
AGGAACAGGAAAAGAGGTGGTCCA	2
AGGAACAGGGAAGCCGCATCCAGA	1
AGGAACATGGTGTCACACAAACAT	1
AGGAACCCTAGGTTTTGGGCCAAA	1
AGGAACCTAAGGGTGCCGATGTGC	1
AGGAACCTAATCAGTTGAGCTATG	2
AGGAACCTTTGATTCGCGGATGGA	1
AGGAACGAACAGAGCCTGCGTGTG	1
AGGAACGCTCCAGTGTGGATGCCT	1
AGGAACGGATCCAACGTGGGTGCA	2
AGGAACGTGGTGGAGTGGAGCTGA	1
AGGAACTAAACAAAGCCTTAGTGC	1
AGGAACTAAACACAGCCTAAGCC	1
AGGAACTACGTAACACGGGAA	2
AGGAACTACTACGACGGTTGTGTC	1
AGGAACTCATGTATTGTGGAATG	1
AGGAACTCGGCAACCCGGGGTGGT	1
AGGAACTCGGCAATCAAGAGTGGC	1
AGGAACTGATTTGATGTTGTTGAC	1
AGGAACTGCTGCGGTTTGGGTTCGG	1
AGGAACTGGGGCTACATTTCTTTT	1
AGGAACTTACAATGTAAATACATG	1
AGGAACTTAGCCTATCGAATTGGG	1
AGGAACTTCTTTTATGTCTAAGGA	1
AGGAAGAAACTGGGTCTCATGCAA	1
AGGAAGAAATATGGGACTTGGAGA	1
AGGAAGAACATGGAAGAAGATGGG	1
AGGAAGAACCCTGGTAACTGC	1
AGGAAGAAGATAGGAGCCTTACAT	1
AGGAAGAAGGAAAGAGGAAGATGGT	1
AGGAAGAAGGAAAGGAGAGTTTGC	1
AGGAAGAAGGCCTCCGGTGAACAG	1
AGGAAGAAGTGTGGAAAACATGAC	2
AGGAAGAATGAGGTAGCAGTTGAC	1
AGGAAGACGAAAGTGCCCATGTTGC	2
AGGAAGACGGATAAAGAGGGGCCA	1
AGGAAGAGAGAGAATAGTAGCGGG	1
AGGAAGAGAGGTACTGAGAATGGG	1
AGGAAGAGATGTGATCCCTCATAG	1
AGGAAGAGCGTACGTTGTTTCGATA	1
AGGAAGAGGGTGGCAATGCTAGGC	1
AGGAAGAGTGTAAAAAAGGGCCG	1
AGGAAGATACGCAAAACGAGGTGA	1
AGGAAGATATAAGTGGTGTCCATA	1
AGGAAGATGAGCCATGGTGCGTTC	2
AGGAAGATGCATAAATGACATGGA	1
AGGAAGATGCGATGCAAGTTGATC	1
AGGAAGATGGTTGCTACGCATAAC	4
AGGAAGATGTGTCTTGTGGGTAAA	1
AGGAAGCAAAATGGTCTACTGGTT	1
AGGAAGCAACGCTTGCGGTCGCCA	1
AGGAAGCAGAGAATTGTAGTAGTG	1
AGGAAGCAGTACGCAGTGAAATGG	1
AGGAAGCCAACGCCCTATTCGCCA	1
AGGAAGCCATTACTTGAGTCCAGC	1
AGGAAGCCCGAGGGTTCTACCCGA	1
AGGAAGCCGATACCGTATTGGTTA	1
AGGAAGCCGCCTGTAAAATATGCA	1
AGGAAGCGGAAGCGGAGGAGGAGC	2
AGGAAGCGGCAGCCCGATGTCCCT	1
AGGAAGCGGCTTGAGAGGGATGGA	1
AGGAAGCGGGCTGCTAACACCGAA	1
AGGAAGCGGTACGTAGTGAGATGG	1
AGGAAGCTCATGTTGCTTGAGAGA	3
AGGAAGCTGTTGCAGACAGGTGTC	1
AGGAAGCTGTTGGTGTGTGGATCC	2
AGGAAGCTTCTAATTCTGGGTGAA	1
AGGAAGCTTGACATTCTTCTGGGC	1
AGGAAGCTTGGTCACTACTTTTAG	1
AGGAAGGACCATGCCGTGTGGGTA	1
AGGAAGGACGACTGTGAGATGTGT	1
AGGAAGGAGCGCTATAAGGAGGAA	1
AGGAAGGAGCTTATTGGGACTGAA	2
AGGAAGGAGGTGCTAGCAACAAC	2
AGGAAGGATTCAAGTATGGGCC	1
AGGAAGGCCTACAAGAATTGAAGC	1
AGGAAGGCTCTTGAGTGCTGTGAA	1
AGGAAGGGCTAGGTTTGGAGGACC	1
AGGAAGGGGCCTCAAAACATGGGT	1
AGGAAGGGTCTCTACAAAATTAGC	1
AGGAAGGTACCGTGTGGGCAAGGA	1
AGGAAGGTGACTATGCTGAGGAGT	1
AGGAAGGTGCATTGTTAGGGCGAG	1
AGGAAGGTGTCAAATAGATTTTTC	1
AGGAAGGTGTCTTAGGATTATATA	1
AGGAAGGTTCTTTCTAGGGTGAT	1
AGGAAGGTTGACTGAAAGATGGTC	1
AGGAAGGTTTGCCAGATAAGTAAA	1
AGGAAGTAACGATAGTATGAGTGA	1
AGGAAGTAATTATTATTAAGGTGG	1
AGGAAGTACGGACACCTCGCA	1
AGGAAGTAGAAACGTAGTTGTGGT	1
AGGAAGTAGCTTACTGACATGGGA	1
AGGAAGTCGGAGTTGCTCGATGTC	1
AGGAAGTCTTAGCCACGCCGATGC	1
AGGAAGTCTTATAATATAAAACGG	1
AGGAAGTGGGTGCACGAAGAATGA	2
AGGAAGTGTGGTTACGGTTTGAGA	1
AGGAAGTTGGATACGAGATGGCAC	1
AGGAAGTTGGTGAACTGATGAC	1
AGGAAGTTGGTGAACTGATGACAGG	1
AGGAATAAAAGTCCAGAACAGAGC	1
AGGAATAATCGTACGGATAAGCGC	1
AGGAATACTACAGGAATACATGTG	1
AGGAATAGAAAAAGGAGCCTCCAC	1
AGGAATAGAAAACGAAGCCTCCAC	1
AGGAATAGAGTATGAGTCGGACTA	2
AGGAATAGAGTGTCCACTAGTTGG	1
AGGAATAGCCGTTTGATTGGACCA	1
AGGAATAGGTCCCACTACGATGAG	2
AGGAATAGTCACCTGGAGCTGGTC	1
AGGAATAGTCAGACGTGTGACAAA	1
AGGAATATCACATGGTGACATAGG	1
AGGAATATGTGTCGACCAATTGGT	1
AGGAATATTCCTCTCCAGGGACCA	1
AGGAATCCAGGATGACGATCTTTA	1
AGGAATCCCACGTGACGGTTTGAG	1
AGGAATCTCGATGTGCGCTTTG	1
AGGAATCTTGCCACAAGTGTGACT	1
AGGAATGACATAAAAAAGGTATGA	1
AGGAATGACCGATTGATTGAACCA	1
AGGAATGACCGTTTGATTGAACCA	1
AGGAATGACCGTTTGATTGAGCCA	1
AGGAATGACCGTTTGATTGAGCCG	1
AGGAATGACCGTTTGATTGGACC	1
AGGAATGACCGTTTGATTGGACCA	6
AGGAATGACCGTTTGATTGGACCGC	1
AGGAATGACCGTTTGATTGGACTA	1
AGGAATGACTATTTGATTGGGCCA	1
AGGAATGACTGTTTGATTGGGCCG	1
AGGAATGATCGTTTGATTGAGCCG	1
AGGAATGATGCATAGAGGTGCTG	1
AGGAATGCATGGATGATTGAAGAA	1
AGGAATGCCACGTGGTGACTTGAG	2
AGGAATGCCTAGTAAGCGCGAGTCA	1
AGGAATGCCTAGTAAGCGCGAGTCATC	1
AGGAATGCTGGTGGAACTTCTACA	2
AGGAATGGAGCATAAAAAAGGTGT	1
AGGAATGGGCTGAGCCACACCGGC	1
AGGAATGGGTGCTATAGAAAAGGA	1
AGGAATGGTGATGTAGCTGCTACA	2
AGGAATGGTGCTACATTGGTGAGG	1
AGGAATGTGTGTTTAGTGTCCGATAA	1
AGGAATGTGTTGATGATTGAGTGG	4
AGGAATGTTTTGCTGACGTGGTCC	1
AGGAATTAGGTGAACTTTCATGCA	1
AGGAATTATACGATGTGATTC	1
AGGAATTGAAGTGTAAAATAGAG	1
AGGAATTGCCTGTGCCCTATAGCC	1
AGGAATTGGAACGATGTGACAGAA	1
AGGAATTGGATTGTGCACATGGAG	1
AGGAATTGGTGTGCGCTCATTGTG	2
AGGAATTGTGGCCCGGTGATCCCT	2
AGGAATTTCTGGAAGGTGCAGGCC	1
AGGAATTTTTCCAAGAGGTTGTAC	2
AGGACAAAACTGCTCTGGATTGGG	1
AGGACAAAAGGTGACCTTATGTAG	1
AGGACAAACCGACGTAATGTTGGG	2
AGGACAAACCTACAAAGAAGTGTC	2
AGGACAAACCTACAAAGAGATGTC	9
AGGACAAACCTACAAAGAGATGTCA	1
AGGACAAACCTACAAAGAGGTGTC	43
AGGACAAACCTACATAAAGGTGTC	2
AGGACAAACCTACCAAGAGGTGTC	1
AGGACAAACCTACGAAGAGGTGTC	2
AGGACAAACCTATAAAGAGGTGTC	1
AGGACAAAGCGATATGATGTA	1
AGGACAAAGGACCTAAGATATAAG	1
AGGACAAATGGTCAAACAGTGCAA	2
AGGACAAATTCATGTCTAAGGTGG	1
AGGACAACCTTATCTGGCGGTGGT	1
AGGACAACGTATTTGGACTGTCTA	1
AGGACAACTTTGTTGATGGCGATA	3
AGGACAAGAAGGTTCTACGGATGG	1
AGGACAAGGAGTGCCTATTCT	1
AGGACAAGGCCTCTTGTGGTGTGG	1
AGGACAAGGGACCTAACATATAAG	1
AGGACAAGGTGCTGTACTAGAAAT	1
AGGACAAGTGCCTTTGAGATGCC	2
AGGACAAGTGGTCAAACGATATAA	1
AGGACAATATTGGTTAGGGTGTCA	1
AGGACAATTCAAGTGATAGTTGTC	1
AGGACACAACTACACCGAGAGTGC	6
AGGACACACCTTATTACTACGA	1
AGGACACACCTTGCTGCTACAACC	1
AGGACACAGCTCGGGAGGCCTTCC	1
AGGACACCGTGAAAACGTGACGCT	1
AGGACACCTACCGCTGATGGGCA	1
AGGACACCTGTAGTGTTGGTGGGA	1
AGGACACGCCATACTACTTATAAC	2
AGGACACGCTGCGTGTGTTGTGGT	1
AGGACACTATGTGGGATCGGTATC	2
AGGACACTCATATGGGGCACCATG	1
AGGACACTCGTATGGGGCACCATG	1
AGGACACTCTGGACATTGGATGC	1
AGGACACTGCAAGGTTGATGGCTA	1
AGGACACTGTGCAATCGCTACACC	1
AGGACACTGTTATGGGGTATTGAC	1
AGGACAGACAGGTTTGCTCCT	1
AGGACAGAGGTGTGATGCTGAGCC	1
AGGACAGATGGTCAAACGTTAAAC	1
AGGACAGCAAAAGAAGAGGTGCAC	1
AGGACAGCAGGTTAACCTAGTCTC	1
AGGACAGCCGCATGCGATAATGGG	2
AGGACAGCGGAGACAGGGTGCGGA	1
AGGACAGCGGGTTGCAGATTTGTA	1
AGGACAGGATGTGACGTATCTGTA	2
AGGACAGGGTGGATAAACTCGGTA	1
AGGACAGTCGATGACCTATAAAAG	1
AGGACAGTCTATGACCTATGAAAG	1
AGGACAGTTTGTTGGGATGCTGAC	1
AGGACATATAGCCTAGTGGTTGCA	1
AGGACATCGCCAGCGAGACGCTAG	1
AGGACATCGTGCTCACTGTAG	1
AGGACATGCTTGCCGCAGAGGTACC	1
AGGACATGGGGGCCACTCAGGGGG	1
AGGACATGGTGCTACCGGTGCATG	1
AGGACATGTAGCCTAGTGGTTGCC	1
AGGACATGTAGTCTAGTGGTTGCA	1
AGGACATGTTTACGGGTCGGGCGC	1
AGGACCAAAACCACTCAGTGTTGC	1
AGGACCAAAACTACCGCAGATTGA	1
AGGACCAAACTTTGCCGGTGGAAC	3
AGGACCAACCCTAACCCTAGATGT	1
AGGACCAATCTGAGTTATGGG	1
AGGACCAATGAGTGTATGCATGC	1
AGGACCACGTAAGGGCGCAGTTGC	1
AGGACCACTCCTCCCAATTGGGCA	1
AGGACCATAGGGTGCTACTCAGGT	1
AGGACCCACCACATACCATGTCCT	1
AGGACCCGCTGGTGATTGGTGGGA	1
AGGACCCTGCCCACTGAGATGGGA	1
AGGACCCTGTTTAGATGGGACTAGA	1
AGGACCGAATTGATAACCGAATTT	1
AGGACCGGATATTAATGGTGTAGT	1
AGGACCGGATATTAATGGTGTAGTA	1
AGGACCGGATGGGACATTTCCTA	1
AGGACCGGATGGGATATTTCTTAG	1
AGGACCGTCACAGCTTGATGAACC	1
AGGACCTAAACGAGTGATCTGCAA	1
AGGACCTAAATGCAAATTTTCCAG	2
AGGACCTAAGGTGCTACTGAGACT	1
AGGACCTAGAGGTGCTACTTGA	1
AGGACCTAGATGACACACCCACAC	1
AGGACCTATATGACACACATGACA	2
AGGACCTATGTGGACAAAATGAAA	1
AGGACCTATTATGACCGGTTTTGA	1
AGGACCTATTGAGACCGGTTTTAA	1
AGGACCTCAATGTAAGATTACATG	1
AGGACCTCGGGTGACCGGTTTTGT	1
AGGACCTCGGGTGACTGGTTTTGT	1
AGGACCTCTGACCGGATTGACTGA	1
AGGACCTCTGTGTTGCCGACAAGA	2
AGGACCTCTTTATATTGCAGACGA	1
AGGACCTGCTGTGACTGGTTTTGA	2
AGGACCTGTTTGGTAGAACTCTAA	1
AGGACCTTGCCCACTTAAGAGGCG	1
AGGACGAACAAGTTGGTGTCATTG	2
AGGACGAACACAACAAGATGGGTC	1
AGGACGAACCTCAACCTGTGC	1
AGGACGAACGATCAATTATGTTTA	1
AGGACGAATATCCAATGCCAGTAG	1
AGGACGAATATGGGAACCCGGA	1
AGGACGACACCACCGTGCCACTCC	2
AGGACGCCAATGTACTGATGTAGC	1
AGGACGCGACTACACCGAGAGTGC	2
AGGACGCGTGGTGGGGACGGCACG	1
AGGACGCTAAGACCAAGCTGTGGC	1
AGGACGCTGTGAAGCAAGATGCCA	1
AGGACGGAGGGAGTACTGGTTAGGTC	1
AGGACGGAGTACGGGATGGAGTTG	1
AGGACGGATCAAGCGTAGGTGCTG	1
AGGACGGATCCAACGTGGGTGCTG	1
AGGACGGATCCAGCGTGGGTGCTA	1
AGGACGGCAAGAAAGTGTGGCTTG	1
AGGACGGCCATTCTATACACCTAG	1
AGGACGGCCTTGGTCAATAGTGAG	1
AGGACGGGTAGTGCTGTGTTGTGC	1
AGGACGGGTCCTCTCTACATTAGC	1
AGGACGGTGCAGACGTATTATTG	1
AGGACGGTGGTCATGGAAGTCGAA	1
AGGACGGTTTTGCTGACGTGGTAC	1
AGGACGTAACTACGTAGCTAGTGG	1
AGGACGTAACTGTGCTTGTAGAGG	1
AGGACGTGAACTATGGTGGTGTT	1
AGGACGTGACTACACAGCTAGTGG	2
AGGACGTGCCACCTGACTTATCGA	1
AGGACGTGCTTTTAAAATTTAGGA	2
AGGACGTGGGACTTGGATGGATGT	1
AGGACGTGTCAACGTATAGAACGG	1
AGGACGTGTCACATTCGGTCTTA	1
AGGACGTGTCCTATATAGTACAAG	2
AGGACGTTGCCGCATAAACCGGTC	1
AGGACGTTTCTGGCCTAGGGTTGA	1
AGGACGTTTGATCAGATGTCGGAA	1
AGGACTAAACCAAGCCTTAGGTGA	1
AGGACTAAACTGAGCCTCAGATGA	1
AGGACTAAATAGTAAGGTGGATGA	2
AGGACTAAATGATAAGGTGGAGGA	4
AGGACTACGAATCTGGATATGCCT	1
AGGACTACGATTGGCTCATCCCGG	4
AGGACTACGGTGATATCAAGGGTT	2
AGGACTACTCGGATCGTATCCATG	1
AGGACTACTCGGATTGTTGGTTTC	1
AGGACTACTTGGATTGTATCTATA	1
AGGACTAGAAACAAGGTGAATGAC	1
AGGACTAGAGACAAGGTGAATGGC	1
AGGACTAGAGCTGTGCCAAACAGG	1
AGGACTAGGAGAAGTATGGATATGT	1
AGGACTAGTAGAGAAAAATATGCA	1
AGGACTAGTATGTTTGGGAC	1
AGGACTATGAATCTGGACAGACTC	4
AGGACTATGAATTTTGGTGCTA	1
AGGACTATGAATTTTGGTGCTAGA	1
AGGACTATGGTTGCCCTTACTAAA	1
AGGACTATGTTAGCCTACATGACA	1
AGGACTATGTTTATATTGTGCTGC	2
AGGACTATTGTGGAATTCGGCCGAC	1
AGGACTCCTTACATCTGTGGACTC	1
AGGACTGAAGTTATAGATGGGAAG	1
AGGACTGATAAGGGGCTTGTTGGA	1
AGGACTGATTCTGACTGAGTGTAA	1
AGGACTGCCACCACACAGCACCAA	1
AGGACTGCGAAAGTGAAAAGGA	1
AGGACTGGGTCGTCAATGTATGGT	1
AGGACTGGGTCGTTACTATATTGT	1
AGGACTGGTGGCCATCTTCTAGGG	1
AGGACTGGTTCTTTGAACAGGGA	1
AGGACTGGTTCTTTGAACAGGGAG	1
AGGACTTAACGCTGGGGACGGAGC	1
AGGACTTAAGTGCTCTTGAGGGTT	1
AGGACTTACAAGGACTAAGGTGAG	1
AGGACTTAGGGGCTGTTTGGTTG	2
AGGACTTATTGGGTGCTTCAA	1
AGGACTTCAAGATGAGGTGTGTGT	2
AGGACTTCCACCCGAAAACCCGAG	1
AGGACTTCGGGTGACCGGTTTTGT	1
AGGACTTGATTCCGGGTGGACTGG	1
AGGACTTTAAGGTGCTACTCAGGTC	1
AGGACTTTCAGAAATTCCGAT	1
AGGACTTTGGGTGCTACTCAGGTC	3
AGGACTTTGTGCCTAGGATCTGCG	1
AGGAGAAAAACCGCTCAGGATTGA	1
AGGAGAAAAAGAACTAAGATAGTC	1
AGGAGAAAATTGTAATATTGGGAC	3
AGGAGAAAGCCAATTTTGAGTGGT	2
AGGAGAAATACCGCCACCACGACT	1
AGGAGAAATGCTGTTACCGGTGAT	1
AGGAGAACAGTGTTGCAGGAGGTA	1
AGGAGAACTAAATTGGGTGCATAA	1
AGGAGAACTTATGAATCGAGATGG	1
AGGAGAAGAAGAAGCCGTATCTGA	1
AGGAGAAGAAGAGGACGCTTGCTG	1
AGGAGAAGACTGCTTTCTGGTGCG	2
AGGAGAAGATAAGATCGGTGCGA	2
AGGAGAAGCAAATACAAGGGGTAC	1
AGGAGAAGCCCACGTTCATGGTAG	1
AGGAGAAGCTACCGCTACAAAGCT	1
AGGAGAAGCTGATTGAATGGTGGG	1
AGGAGAAGGCTAGCATCGGACCGG	1
AGGAGAAGTCATGGGCCTGTTTGG	1
AGGAGAAGTGAAGTTAGGTGGGAA	1
AGGAGAAGTGGGCTGTAAACTTG	1
AGGAGAATAGTGATGATTGGTTGA	2
AGGAGAATAGTTGTGATTGGTTGA	2
AGGAGAATATCCTGGGATGCCAGA	1
AGGAGAATCCTTACCTGCAGATGA	1
AGGAGAATGAATAGAAATAATGGT	1
AGGAGAATGTTGCCATGAGGTGTA	1
AGGAGACACCACAAAAACGTGCCA	1
AGGAGACATCCTTTCGTTGTTTGC	1
AGGAGACATGGTGCTGCGATTGCA	1
AGGAGACATGGTGTTGTGATTGCA	1
AGGAGACCCACATATCAGGTGTCC	1
AGGAGACCCTAGGAGCGACAATGC	1
AGGAGACCCTTGAGGCCCGTGCCA	1
AGGAGACCGAGGTGGCTGCTAACA	4
AGGAGACCGGTCGCCTTGTATAGG	1
AGGAGACGACACGGTGATGACGGC	1
AGGAGACGTAGGGTGCAGGACTGG	1
AGGAGACGTGGCTAAAGGTGTCCC	2
AGGAGACGTGGTGCTGCGATTGCG	3
AGGAGACTACGCGATGTTGCGCCG	3
AGGAGACTGAGGGTGTGTTTAGA	1
AGGAGACTTACATTGGGTCCTGCC	1
AGGAGAGAAAAAACCACGGGCGC	1
AGGAGAGAAAAACCACGGGCGCC	2
AGGAGAGAAAAGAGCAGCAGGCTA	1
AGGAGAGAACCAGATGGGCCGAAA	1
AGGAGAGAAGACGATTTGTGTGG	1
AGGAGAGAATTTGTAATGGAGCT	1
AGGAGAGACATGATGAGCCAACCC	1
AGGAGAGAGAAAGATGGTTGCTAC	1
AGGAGAGAGATGATGAGCCACCCC	1
AGGAGAGAGGCCATCTTAATGAAC	2
AGGAGAGATGGAATGACGAAGCCG	1
AGGAGAGATGGAGCTGAACTGA	5
AGGAGAGCAATGCCGGTGGTGCAG	2
AGGAGAGCAGTGATGATGAGGA	1
AGGAGAGGATGATGTGACCATGCC	1
AGGAGAGGATGGTTAAGTCGGT	1
AGGAGAGGCTGGTTGATGAGGATG	1
AGGAGAGGGTCGGGGAAAAGGAGG	1
AGGAGAGGGTGATCTCATGAGTCC	2
AGGAGAGGTGTGAGATTCGATCTG	1
AGGAGAGTATCTCTTTTGAGGCAC	1
AGGAGAGTATTTGTGGTGATGGAC	1
AGGAGAGTGAGGAGGTAGTCCCAC	1
AGGAGAGTTCCTATGGCGCAGTTC	2
AGGAGATAAATGAGGGGAGAGGAG	1
AGGAGATAAATGGTGTCAATTCTG	4
AGGAGATAATATGGCGGTGAT	1
AGGAGATAATCCATTTGATGCCAC	1
AGGAGATCCAAACACGATGATGAC	1
AGGAGATCCAAACATGATGATGAC	4
AGGAGATCCCACGGCAGTATCGAC	1
AGGAGATCCCTGCAATAAGAGT	1
AGGAGATCCTAGGCATGGTGAGAA	1
AGGAGATCGAGCCGTTGGTGACCG	1
AGGAGATCTAAACATGATGACAAC	1
AGGAGATCTGCTTAGCTCCAGTGC	1
AGGAGATGCCGATGGACGGTGGCC	2
AGGAGATGCTAGATGCTGTCCTA	1
AGGAGATGCTAGCTAGTAGGTTGA	1
AGGAGATGGGAACTTGCTGTGCCA	2
AGGAGATGGGACTCATACATGAAT	1
AGGAGATGGGTGGATAAAAGGAGA	2
AGGAGATGGTCCTAGATGCTGTC	1
AGGAGATGTCCCTTCGTTGTTTGC	1
AGGAGATTCAGTGGTGGGCATCAG	1
AGGAGATTCGCCATGGTTGTGGA	1
AGGAGATTCTAACAGCAGATAGG	1
AGGAGATTGAGGCCGGTGTGGGG	1
AGGAGATTGAGGCCGGTGTGGGGG	5
AGGAGATTGTGCTTGGATGCCCAT	2
AGGAGATTTGCCGCTGTGAATATG	2
AGGAGCAAAGACGCGGAGGGCCTG	1
AGGAGCAAATAATAACACTGAATT	1
AGGAGCAAGCGGGTTGGATTGGCC	1
AGGAGCAAGGTGTTACGCTTCTCA	1
AGGAGCAATTCTACGGTCCTTGAA	1
AGGAGCACAGTATTTTGAGTCCCG	1
AGGAGCACATTTGGTGGTGTTTGG	1
AGGAGCACCTAAGAAGAGGGGAGC	1
AGGAGCACGATTTTCTCTCTCTTA	2
AGGAGCACTAAGGGGTTGAAGCCG	1
AGGAGCAGAAGAGGAAGAGGTGCT	1
AGGAGCAGCGATACGATGATGTGA	1
AGGAGCAGCTGCTACTTGTTGGTC	1
AGGAGCAGTGACTGATACAGA	1
AGGAGCATGCGTGGTGATCTAGTC	1
AGGAGCCAACCGATGGGCTGTTGC	1
AGGAGCCAACTTTGACGTGGGAAC	1
AGGAGCCAAGACTGGGCTTTCGC	1
AGGAGCCACACCTCTTGAGGATGC	1
AGGAGCCACGCAACAGATTTGCTT	1
AGGAGCCAGCAGATAGATAGATAG	2
AGGAGCCATCAAAAACATATGTGA	1
AGGAGCCATCTGCGAAAATGGCGC	1
AGGAGCCGCTGTTGACACGTGGAC	2
AGGAGCCGTATGAAACTAAGGTTT	1
AGGAGCCGTATGGGAAAATGCCTC	1
AGGAGCCGTCGAACTGCATCACCC	1
AGGAGCCGTCTGTGAAAATGCAGC	2
AGGAGCCGTTTGCGAAAATGCCAC	3
AGGAGCCTAGTATAGCCTCGGCTG	1
AGGAGCCTGTTGGAGATACGCTCA	1
AGGAGCGAATTTCAGATTGGGTTA	1
AGGAGCGACATGGGTGTGATGCGA	1
AGGAGCGATCCATTAGCGCGTGAT	1
AGGAGCGCGATCCGGGGGAACT	1
AGGAGCGCGTGCCTGCATGGTGGA	1
AGGAGCGTGTCGACGTTTGATGTC	5
AGGAGCGTGTCGTAGGAATAACGG	1
AGGAGCGTGTCGTAGGGAAAACGG	1
AGGAGCGTGTCTAGATTTATTGTA	1
AGGAGCTAAGGGGCCTAAGTGAGC	1
AGGAGCTACCGGAGAGGGGGGCAA	1
AGGAGCTACTTAGTGACATACACC	2
AGGAGCTAGCAGTTACCGGTGTCA	1
AGGAGCTATACCTGGTGGAGCTGC	1
AGGAGCTATATTGGTTGGGGAGG	1
AGGAGCTATATTGGTTGGGGAGGA	1
AGGAGCTCAAGCAGTTGAGTGCAA	1
AGGAGCTCCTTCCGTGTGGTGTGT	4
AGGAGCTCGATTCTAATCAGAGCA	1
AGGAGCTGAAACTGGAGCCTGAGC	2
AGGAGCTGCCAGCAACGACTGGA	2
AGGAGCTGCCAGCGGTGCTCTGGG	2
AGGAGCTTCATCGAGGCTGGTTGA	2
AGGAGCTTCTATCATATGTTGGGC	1
AGGAGCTTCTCACCTAGGTGTCAC	1
AGGAGCTTCTGCCATATGTTGGTC	1
AGGAGCTTGAACAAATGATGAGCA	1
AGGAGCTTGCGGGGGAGTAGGTGT	1
AGGAGGAAATAGCTGCTGATGGTA	3
AGGAGGAACCAATCGGTGCCGCC	1
AGGAGGAAGCCACCTTAAAAGGGA	2
AGGAGGAAGGATTTGATGTACAGG	2
AGGAGGACCCCGCCCTGCGTGTAA	1
AGGAGGACCTTGCCCACTTAAGAG	1
AGGAGGACCTTGGCTTGAGTTGCC	1
AGGAGGACGCTATATCAGCACATG	1
AGGAGGACTACGAAAGTGAAAAGG	1
AGGAGGAGAATGTCTGAAGGATGA	1
AGGAGGAGACTACGGATCGGTCGC	3
AGGAGGAGCTCACCGGTGGCGACA	1
AGGAGGAGCTCCGTCGCCTAACC	1
AGGAGGAGGGGAGGCTAACGGTGT	1
AGGAGGAGGTGTTGGCGATGAGGT	1
AGGAGGAGTCCTTCCCGGCGGTGA	1
AGGAGGATCAAGTGATCAAGGTGCA	1
AGGAGGATGACAGTGAAGCTCCTC	1
AGGAGGATGATGGTGAAGAACACG	1
AGGAGGATGGATACTGCCATGGAG	1
AGGAGGATGTCTAGATTTATTGTT	1
AGGAGGATTGTGGTGACGGGCTCC	1
AGGAGGCAAACCCTAGATTGATTTC	1
AGGAGGCAAGCCGCCGGACACCCC	1
AGGAGGCACCACGTTCGCTGTGGG	1
AGGAGGCACCACGTTTACTGTGGG	1
AGGAGGCACCACGTTTGCTGTGGA	2
AGGAGGCACCATGTTCGCTGTGGA	1
AGGAGGCAGAGAGTTGGGCTGA	1
AGGAGGCAGCATACCTGATGATGG	1
AGGAGGCAGCGATCGATGGTTGAG	1
AGGAGGCCAGACTAAGGTGGTGTT	1
AGGAGGCCCAAGGTTGCATTCGTC	1
AGGAGGCCCGAGTGATGGATCCTA	3
AGGAGGCCCGCACGTGAAAATAGG	1
AGGAGGCCTAAGACAAGTGTGTTC	1
AGGAGGCCTACCTGTGAAAATTGA	1
AGGAGGCCTGTATGCGAAAATTGT	1
AGGAGGCCTGTTAATTCGTGAGAC	1
AGGAGGCGTGGGCCACGCGAGGTC	1
AGGAGGCTCCACGTTCATTGTGGG	1
AGGAGGCTGCCGCTGTTCTGAACC	2
AGGAGGCTGTCCGTAGTGAAATGG	3
AGGAGGGAATTGGAAGCGTCCA	1
AGGAGGGACATGCCAGAAATAGAG	1
AGGAGGGACTGCTCGGCTCAATGC	1
AGGAGGGAGGTTAATTAATTTAGC	1
AGGAGGGAGTAAGTGGTACTC	1
AGGAGGGAGTTGCGGCGTTCTGAC	3
AGGAGGGAGTTTTCCCGTTGGCCT	1
AGGAGGGCAACACACTTCGGGTT	1
AGGAGGGCCACATGACGATATGAG	1
AGGAGGGCCCAAATGTAATGCGTC	1
AGGAGGGCCTATGGGATCTATGG	3
AGGAGGGGCATTGTAACATCCTGA	1
AGGAGGGGCTTATGTTTTTGTGAG	1
AGGAGGGGGCTGCCGGTAGAAGGG	2
AGGAGGGGGGTCACATCCTCTC	1
AGGAGGGGTCGACAACGAATTTAG	1
AGGAGGGGTGTAGCTAGAGCTGGA	1
AGGAGGGGTTCCTTTCTAGGTTGA	1
AGGAGGGTAGCCACCGAGTTGGAG	3
AGGAGGGTAGTACCTGGATTTGGT	1
AGGAGGGTAGTCTGCTATGGTACC	1
AGGAGGGTATTATGGGGACTCTAA	1
AGGAGGGTGAATGGTAGGGAAAAC	1
AGGAGGGTGAGCAAATAATGTTG	16
AGGAGGGTGAGCAAATAATGTTGC	434
AGGAGGGTGATCATCGTTGTCGGT	2
AGGAGGGTGATGAAGACAATGGCA	1
AGGAGGGTGCAGCAATAGGCTTGC	1
AGGAGGGTGCGATATGATGGATAT	2
AGGAGGGTGGATGTAGCATCTGCG	1
AGGAGGGTGGGACCACATTATAGT	1
AGGAGGGTGGGATTACACTTGTGC	3
AGGAGGGTGGGCCACTAAAGGTT	1
AGGAGGGTGTCTAGATTTATTGTA	1
AGGAGGGTTCCTGAGGCGAAGGGA	1
AGGAGGGTTTACGTCGTTAGGCG	1
AGGAGGGTTTGGCCAGCCAAATA	1
AGGAGGTACCAGAATATTTCGAGT	1
AGGAGGTACCATGAGATACCAAAA	1
AGGAGGTACCGGGAGCTTTCCCAC	1
AGGAGGTACGATAAGAAATAAAGA	1
AGGAGGTAGCTCTGGGTATTTCCA	1
AGGAGGTAGTATACACTGGTGGAG	1
AGGAGGTCAAGGACTTTCTGTCCA	1
AGGAGGTCAATAGTGCAGATGATG	1
AGGAGGTCACCACGCCAAAGATGC	1
AGGAGGTCACGACATCAAGGATGC	1
AGGAGGTCAGCCCAACTGCAATGC	1
AGGAGGTCATCGGATAGAGGGTAT	1
AGGAGGTCGGCGACACTATTGCCA	2
AGGAGGTCTAGGCCTAGTGGTGGA	1
AGGAGGTGACATATTCTAGGACTA	1
AGGAGGTGAGTGTCACAATTGTTC	3
AGGAGGTGATTCGCTATCAAGCGG	1
AGGAGGTGCAGGGTTGTTTTCTGG	1
AGGAGGTGCAGTACCATGAGGTAC	5
AGGAGGTGCCAATCAAAGTTTGGT	1
AGGAGGTGCTAGCAACAACTGTGC	4
AGGAGGTGCTGAGCTTGAGCTAGC	1
AGGAGGTGCTTTTAGTTTGTACTA	1
AGGAGGTGGACCATGAGTTTTGGT	3
AGGAGGTGGATAGAGGAGTGTTGC	2
AGGAGGTGGCACCGAATATTTGGT	1
AGGAGGTGGCCGTACGTCGTCG	1
AGGAGGTGGCGATTGATCTGTGGG	1
AGGAGGTGGCTCGTAAGATTTGC	2
AGGAGGTGGCTCGTAAGATTTGCC	4
AGGAGGTGGCTGCAAAGGCATTCA	1
AGGAGGTGGTCAGGAGTGTCGTGG	1
AGGAGGTGGTTCGGAGTAGGGTCA	1
AGGAGGTGTGATCTCGGCCTAC	2
AGGAGGTTATACAGGTTCAAGCCA	2
AGGAGGTTGCATATGCGCAAGGTG	2
AGGAGGTTGCTAAGTGTAGGCCTA	1
AGGAGGTTTGACTATGGCGTGCAC	1
AGGAGTAAAATAGGAGTACTA	1
AGGAGTAAGGCCGGACAAAATAAG	1
AGGAGTAATACATATAGATATCAG	1
AGGAGTAATATGTGGTCGGACGA	1
AGGAGTACACATGGCGGCTTAGGA	1
AGGAGTACCTGTATTGATTGCCCA	1
AGGAGTACTCTACATGTAAGTTCG	1
AGGAGTACTGCGACACCAACCTGC	1
AGGAGTACTTTATGTGTGACTA	1
AGGAGTAGGGTGTGCGTGTGTGCG	1
AGGAGTAGGTTGCTAGGCTAGT	1
AGGAGTATGAGAACCTAGAAGTATG	1
AGGAGTCAGATGAGGAGCAAGAGA	1
AGGAGTCCCCAAGTTGCATAACC	1
AGGAGTCCTACTCGAATAGAACTG	1
AGGAGTCCTAGACTAAGGGGCTGT	1
AGGAGTCCTTTGATAGTGCTATAG	1
AGGAGTCGACCCGATGAAAAGCGG	1
AGGAGTGAAGATTTCTGATATTGC	1
AGGAGTGACACGTGGCGGATTGAG	1
AGGAGTGACACGTGGCGGATTGAGA	1
AGGAGTGACATAGTTGGAGGGATA	1
AGGAGTGACTTATATTGTAGATGC	2
AGGAGTGATCTAGGAGTGACTTAT	1
AGGAGTGCAGCCTGCTGGTGGG	1
AGGAGTGCCGTCGCAGACGATGGA	1
AGGAGTGCCTTACTTTCTGTGCTC	2
AGGAGTGCTGTGGTTATACCTTGT	2
AGGAGTGGATTGAGGAGAATGGG	1
AGGAGTGGCTCACATTGTAGATGC	1
AGGAGTGGCTTACATGGTAAGT	1
AGGAGTGTCTTACATTGTAGATG	1
AGGAGTGTTGATGGCTTGTTTCAC	1
AGGAGTTACAACCAGGATCGCCTA	1
AGGAGTTAGGAAGCTGGTTTGCCA	1
AGGAGTTAGGATGCCTACTGTAGT	2
AGGAGTTCACCCGTATACCAGAGC	1
AGGAGTTCCTATTTGGTGTCTTTC	1
AGGAGTTCGCAGGGAGGTGGACAG	2
AGGAGTTCTACACCTACTTTGAG	2
AGGAGTTCTGGTGCTGGCCGTATG	1
AGGAGTTCTTCCAGGAGCAAGCCG	1
AGGAGTTGCATGGCGGTCATTGAT	1
AGGAGTTGCCCGGTGACCTCTCTG	1
AGGAGTTGCCGCACTGAGTTTTCA	1
AGGAGTTGCGACGGTCTTGCAAGT	1
AGGAGTTGCGCTGATTGTAGATGC	1
AGGAGTTGGGAACATGTGGTGTC	1
AGGAGTTGTCGTTTGATTGGA	1
AGGAGTTGTTGGTACGAATATCGC	1
AGGAGTTTCGCACAAGGAAGGATG	1
AGGAGTTTGGAGCTAGGAATTGGG	1
AGGAGTTTGGAGCTGGGAGTTGGA	3
AGGAGTTTGTTGTGTGGACGGGAA	2
AGGAGTTTTAGAGTTGGACACGAC	1
AGGATAAAACCGGGTGACAAATGG	1
AGGATAAAACTGCCCTGGATTTGG	1
AGGATAAAATTGAAGTCAAATCCA	2
AGGATAAGTGTGCACATGTTGTGA	2
AGGATAAGTTTTTCTAGGGGTCTA	1
AGGATAATAGTGGACTATAAGCC	1
AGGATAATCGTGCTACAATTGTGG	1
AGGATACACCTCAGTTGTTGGACC	1
AGGATACCACATGGCGACCTAGGA	2
AGGATACCCCTGATAGCCCAAGAA	1
AGGATACCCGAGCAGGTATGGCCT	1
AGGATACCGGGTGACGAAGTTGGA	2
AGGATACGATGGGCCCGATGTTGG	1
AGGATACGCGGTCCACCTATGGCC	1
AGGATACGGATACGGTGGTGGGTA	1
AGGATACTAAAGCCGGGTGCTGTC	1
AGGATACTAAAGGGCTATATCGAT	4
AGGATACTAGGTGGGATCGGTATC	1
AGGATACTATGCGCAATGGTGCTA	2
AGGATACTGGATGACGAAGTTGGA	1
AGGATAGAAAAGAAAACAGTGCA	1
AGGATAGAAGGCATGGGCTGTCAG	2
AGGATAGAATCACAGAAAGGTCAC	1
AGGATAGACCTAGTCGAGATGGG	2
AGGATAGATGGATTTGCCTTGCCC	1
AGGATAGCCAATACGAGCACCCGT	1
AGGATAGCCGAGTAATCAATGATG	3
AGGATAGCCTAACAGACTGATATCA	1
AGGATAGCGAACGGGTTACCTACT	1
AGGATAGCTGCCAGATGTAGAGAG	1
AGGATAGCTGTTAGGTTAGCTGTT	1
AGGATAGGATGGCCTGAAATATC	1
AGGATAGGATTGATTTGTGTGGAC	1
AGGATAGGGCGGCCCAAAGAGGGA	1
AGGATAGGTCTCTACGAATCTGGA	3
AGGATAGGTCTTGGATTTGAATCC	2
AGGATAGGTGCAGAGACTCAATGGA	1
AGGATAGGTGGTGTCTTGATTGCG	1
AGGATAGGTTCCCTAATTTGAGAA	1
AGGATAGGTTTCAACGCTAGGTGT	1
AGGATAGTCGTGCCAAGCCAACAA	1
AGGATAGTGGTCCAACGGGTGCTG	1
AGGATATATCCTACGTGGTGCTGA	1
AGGATATCGGGTGACGAAGTTGGA	1
AGGATATGCGGGTTGGCATGATGG	1
AGGATATGGTACGTGCTTTTAGAA	1
AGGATATGGTCCAGATTGGTACTC	3
AGGATATGTCACATATGAAGGGTC	3
AGGATATGTCACATCCGGTGCTAGG	1
AGGATATGTGGTGGAGTGATTGCT	1
AGGATATGTTGCCTAGATATTGAT	1
AGGATATTCATACCTGCCCGGGAG	1
AGGATCAAACCGACTGGTGTGCCC	4
AGGATCAGAGGAGGAGTTTATGGT	1
AGGATCAGGCTTAGAGGGATGGTC	1
AGGATCATGGCGACGTCCTCCAGA	2
AGGATCCAAACAAGACCATTGTGC	1
AGGATCCAAGAAGGGCTATGTCGA	2
AGGATCCAGCCGGTTGATGTTACC	1
AGGATCCATCTGAGGTGACCTGAG	1
AGGATCCCAACGATGACGGTGGCC	1
AGGATCCTACGCGGCATGATGTGG	3
AGGATCCTACGTGGCGTTGATGTA	1
AGGATCGAGGCCTCCTAGTACAAC	1
AGGATCGATGGCCCTGCGCGCGGA	1
AGGATCGCAGTGGTGATGGCATGC	2
AGGATCGGACTAGTTATGGGTTA	2
AGGATCGGGAGAGAAAAGATGAGCAA	1
AGGATCGTATCGTAGTATCGGGA	1
AGGATCGTCTGCGCCGTCTGAGTC	1
AGGATCGTCTTTTTCCGCTGTTGC	1
AGGATCGTTTCTCCACCAGTGTGCA	1
AGGATCTACGTAATACGACATCA	2
AGGATCTACGTAGTGCTGATGTGG	2
AGGATCTCGGGTGACCTGTTTTGT	1
AGGATCTGACTAGTAAGATGTGCA	1
AGGATCTGCGGGGATTGCATGATG	1
AGGATCTGCTATATTGCTACACGC	1
AGGATCTTAATCCGTGCGGTAC	1
AGGATCTTAATCCGTGCGGTACGA	1
AGGATCTTGATATGCGATTTGTAA	1
AGGATCTTTTTGTAGGGGTGCTGA	1
AGGATGAAAAGTACAAATGGAGAG	3
AGGATGAAAATCAAACTGGGTGAC	1
AGGATGAAAATCGAATTCGGTGTA	1
AGGATGAAAATCGGACTCGTCGAC	1
AGGATGAAAATTAGACTAGGCGAC	1
AGGATGAACAATGTATTTGACGG	1
AGGATGAACGGTGAAGACGACGAC	1
AGGATGAAGCAGCAAAGGCCT	1
AGGATGAAGGTGTGACATATTCTA	1
AGGATGAATGTATTACATGTGTGC	1
AGGATGAATTACATGGAAGCCGAA	1
AGGATGAGAATCTAGAGCGTGCT	1
AGGATGAGCAAGGAACTGTATGGT	1
AGGATGAGGAGCAAGACGATACCG	1
AGGATGAGGTGAACCAGATTGGAC	3
AGGATGAGTGTGGCCTTATGAGTG	4
AGGATGAGTTCTATAAGTAGTGAG	1
AGGATGATACCTATCTATTTGTTG	1
AGGATGATATGATGGGGATTGGGC	1
AGGATGATGAAAGTTCAAGGTGAG	1
AGGATGATGTTGTTGGGCATGCTA	1
AGGATGCATGTGGAGTGGTGTTCC	1
AGGATGCCAATGAAGCTTTAGTGG	1
AGGATGCCACTCGAATGATAGTT	2
AGGATGCCACTTGAATGACAGTTA	1
AGGATGCCAGATTTTTGTGGGGAT	1
AGGATGCCCTCCTAGCCACTTGAA	2
AGGATGCCGCTACCTTACTGTAGG	4
AGGATGCCGGGTGACAAGATTGGA	2
AGGATGCCTGTGGAGTGGTGTTCC	4
AGGATGCGAGGATGTGGTGGCAAC	1
AGGATGCGGAAGAAAGGTGGGGTGG	1
AGGATGCGGAGTGGATTGTTTCG	1
AGGATGCGTCACATCAAAAGGTAC	1
AGGATGCTACGTGGTGGTGTAGGA	1
AGGATGCTAGGGATTGTATCCCAA	1
AGGATGCTCGAGCTGCCTCAGAAG	1
AGGATGCTGACATACTGTGTGACC	1
AGGATGCTGGGTGACGAAGTTGGA	1
AGGATGCTGTCCTAAAAGGGAGAA	1
AGGATGCTGTCCTAAAAGGGGAAA	2
AGGATGCTGTTAGTTTTGAACCAG	1
AGGATGGACAGGTGTAGGATGGAC	1
AGGATGGATCAACGCCGGCGCCTA	3
AGGATGGATTGAGAAAAGGCGTAA	1
AGGATGGCCGAGGGTTTTGGGCTT	1
AGGATGGCCTGAAATATCTTGGA	1
AGGATGGCCTGAAATATCTTGGAA	1
AGGATGGGAAAAATGCTCGTCTACG	1
AGGATGGGATGGGATGGGATGAGA	1
AGGATGGGCGTTGCTAGATCCAAC	1
AGGATGGGTCCACCTAAAATGGGA	1
AGGATGGGTCGGACTACGAATCTG	6
AGGATGGGTGTCGGTTTTAACTGA	1
AGGATGGTAGCGGATATGAGTGG	1
AGGATGGTCATGGAATGGACTGCA	1
AGGATGGTGTGCTAAATTTGTAGG	1
AGGATGTAAACATTTGTATGTCCA	1
AGGATGTAACTAAAATGGGGTGT	1
AGGATGTAACTAAAATGGGGTGTT	1
AGGATGTAAGCCACTAGTAGC	1
AGGATGTAATAGGGTTGCTGATGA	1
AGGATGTAGGTACACGACGAT	1
AGGATGTATCTAGATACTGTGCA	1
AGGATGTCAATCATGCTATAAAAG	1
AGGATGTCACGTTAGCGAAACAAG	1
AGGATGTCACGTTAGCGAAACCAG	1
AGGATGTCATGTGTACGCCACGTA	1
AGGATGTCCACGTGGCAGCTTGAG	1
AGGATGTCCTACTGATATACTCCT	2
AGGATGTCCTCATCAGAGTGTCAC	1
AGGATGTCCTCCTAGCCACTTGAA	1
AGGATGTCGCATGGGGTGTTTGGC	1
AGGATGTCGCCGCCCGCTGCCGCA	1
AGGATGTCTGTAGTCTGATGGATC	1
AGGATGTCTTATTCTATGGGTGGT	1
AGGATGTCTTTCAGTCGTGACATA	1
AGGATGTGAAAATTTTGAAGTGAG	1
AGGATGTGACCTACGTGGCCCATG	1
AGGATGTGACGTGCATACGTGTAG	1
AGGATGTGCCATATCCCAGTGCTA	1
AGGATGTGCTCATAAATGCGATA	1
AGGATGTGCTCATAAATGCGATAG	1
AGGATGTGCTCATAAATGCGATAGG	1
AGGATGTGGCCGGATTTTACGGAG	2
AGGATGTGTCACATATAGTAGTAC	1
AGGATGTGTCACATCTAGGTTGGT	1
AGGATGTGTCACATGCTAATACGA	3
AGGATGTGTCACATTCAATACTGG	1
AGGATGTGTCACATTCTTTGCCTA	1
AGGATGTGTCATATCCGGTGCTAG	1
AGGATGTGTCGGCACGAGATTGAT	1
AGGATGTGTCTAATCTGGTACTA	1
AGGATGTGTCTAATCTGGTACTAA	1
AGGATGTGTCTTGCGGCCTAATAC	3
AGGATGTGTGATTTCAAACTTGAG	1
AGGATGTGTTCAGGATGTGACTCG	1
AGGATGTGTTTAATCCGGTCCTAA	1
AGGATGTGTTTGGATAATGGAAAA	1
AGGATGTGTTTGGCAGATGGGTTA	1
AGGATGTTAAATTGGGGTTATTAA	3
AGGATGTTAACTGCAATTGAGTAC	1
AGGATGTTATAGATACCAGTGAGA	1
AGGATGTTGCGTGGCTTGATGTCG	1
AGGATGTTGGTATATGTAGGATGT	1
AGGATGTTTCAGCAGGTGTTTGACA	1
AGGATGTTTGGACCGGGGTGGTAC	1
AGGATGTTTGTGTTTGTATTTACA	2
AGGATTAAGTAACAAACGACAGAA	1
AGGATTAATTGCCTATTAGGACGG	1
AGGATTACAATTTGAGGTGTCGAC	3
AGGATTAGATGTAGGAGTAGTTAG	1
AGGATTAGGTGTAGCCCTGGTCAA	1
AGGATTAGGTGTAGCCTTGGTCAA	2
AGGATTATACTGGTTTAGGCCCCTT	4
AGGATTATAGAGGTTGGGGTGACC	1
AGGATTATATCTGTCAGGTGTAG	1
AGGATTATCTACACCTAGGTGCTA	2
AGGATTATGGGCCTATTCGGCTGC	2
AGGATTCCAATGGTGGTGGTGGG	1
AGGATTCCCTGAGTGTTGGAGCCA	3
AGGATTCCGGTCCTATTGTGTTGG	1
AGGATTCCTAGATGATGTTGACAA	1
AGGATTCTAAAGGGGTTGTGGT	1
AGGATTCTACAGGAATTGAAGTGT	3
AGGATTCTAGATAAAGGTGTGTCC	1
AGGATTCTGATAGGAATATAAGTG	1
AGGATTCTGATAGGAATTGAAGTG	2
AGGATTGAAGTGTATAGGGTGCAG	1
AGGATTGACCGTCCTACGTGGCTG	1
AGGATTGAGAAAATGTAGAAATA	1
AGGATTGATTTGTCCGACGGTTGC	1
AGGATTGCAAAACACAGGAATGGC	2
AGGATTGCACTTTGTTGTGGGAGC	1
AGGATTGCGCAAGGGAATACGAG	1
AGGATTGGGTCCCACAAGTCAGTC	1
AGGATTGGTGTGATGTACGAAATT	1
AGGATTGTCTAATCTGTTGGTACA	1
AGGATTGTGTACAGGGTGGTCCA	1
AGGATTGTGTACAGGGTGGTCCAA	1
AGGATTGTTTGTGCTGGGTTGCCA	4
AGGATTTAAACTATGGCTGGTGAT	1
AGGATTTAAATCGTGGTGGGTGAA	1
AGGATTTCGCTGTCTCTTCGGTCT	1
AGGATTTCTTATATAGTTTACCAA	2
AGGATTTGAACCTGGGTGTGTGTG	1
AGGATTTGGGACCTAGATGACATA	4
AGGATTTGTTGAACTATAGGGTAC	1
AGGATTTTCTACACCTAGGTACCA	2
AGGATTTTGTACGCCTAGATGCCA	4
AGGATTTTTATACAGGTCCGGGCC	1
AGGATTTTTGATGCTACTCAGGTC	1
AGGCAAAACCCGGTGCTCCTCTTG	1
AGGCAAAACGATACTGTCACGCCG	1
AGGCAAAAGGAGTCACGTAGGCGC	1
AGGCAAAATCCGGATGGGATGGGA	1
AGGCAAAATTTGCTACAGAACACT	4
AGGCAAACCCTAGATTGATTTCAC	1
AGGCAAACCCTAGATTGATTTCGC	2
AGGCAAACCCTAGATTGATTTTGC	3
AGGCAAACCCTAGATTTACGTGTC	1
AGGCAAACCCTAGGTTTCCGTGTC	1
AGGCAAACCCTGGGTTTCCGTGCC	1
AGGCAAACCCTGGGTTTTCATGTC	1
AGGCAAACCGTGGGTTTCCGTGCCA	1
AGGCAAAGCAACTACACTTAGTGA	1
AGGCAAATAATATATCCATGGGCA	2
AGGCAAATCCAGAGGGTGGTCCCA	2
AGGCAAATGATTGATGTCACGGCA	1
AGGCAAATGGCACGAGATGGATGA	1
AGGCAAATGTCCACGGTTATGGGA	2
AGGCAAATTTGACAGGTGTTTGG	1
AGGCAACAATAACATGTGAGACGG	1
AGGCAACATCTGCGCAAGGGTGAC	1
AGGCAACCGCTATTTAAGGCAGAG	1
AGGCAACCTAGAAGGGGATGTGAC	2
AGGCAACCTAGTACTAGGATGTGA	1
AGGCAACTATAGCCACGAAGGGCA	1
AGGCAACTGCTTACTGTATAAATC	1
AGGCAACTGGACTTACTTATGAAG	1
AGGCAACTGGGTCACGCCAGCTAA	1
AGGCAAGAACCTGGATAATGGCAG	1
AGGCAAGAACTCTGCTAGGTGTTT	2
AGGCAAGACCACGGTCAAACGCGG	1
AGGCAAGACCTACCAGCTGCCGGA	1
AGGCAAGACGAGGTGCCCTCTTGG	1
AGGCAAGACTTGTGGCCAAGGGTTA	1
AGGCAAGAGATTGATGGGAATTGG	1
AGGCAAGAGTAGGACGATGATGGA	2
AGGCAAGATGTTGTGTGAAGAAGGG	1
AGGCAAGCGGTGGCAATAGGCAGC	1
AGGCAAGGGGTGTAGGTCTATAGC	1
AGGCAAGGTGCTAGACGAGGCTGG	3
AGGCAAGTCTGCGATGAATGCCT	1
AGGCAAGTGCTATGATAGATGCGA	1
AGGCAAGTTCGGTGTTTAGAGGT	1
AGGCAATAGCTCATGAAAAGGTGT	2
AGGCAATATATTTATGGAGGTGTA	1
AGGCAATCAAGCACAAAAGGGCAT	2
AGGCAATGGAGGGATAGGGAAAAC	1
AGGCAATTTAATTTTGTCAGATGC	2
AGGCACAACGTTTACTGTGGAGGC	1
AGGCACAAGTGATAATTATTTTAA	4
AGGCACAATATCAAATAAGGTC	1
AGGCACAATATCTATTCCGAGTCT	1
AGGCACACCAATTTGGACCGCCTA	1
AGGCACACCCATATGTAACACCGC	1
AGGCACAGAGAGATATGGTGATGA	1
AGGCACCAGTGGTCTAGTGGT	2
AGGCACCATACATATTTGATTGCA	1
AGGCACCTCGCTGTTGACGGGTAC	1
AGGCACCTGGGTGCAAACGGGCCG	1
AGGCACGATGGGCTATATTGCACC	1
AGGCACGGTGCTGCACTACAG	2
AGGCACGTAGCCTAACGGTTGCA	1
AGGCACGTGGGTCATTGATATGTG	1
AGGCACGTGTCGATTGAGGATGCA	1
AGGCACTAACAGGTCGCCAATGG	1
AGGCACTTACAAGTGTAGAAGAGG	1
AGGCACTTCGCTGTTGACGGGTAC	1
AGGCAGACGGAGTGGCGGTGGTAG	1
AGGCAGAGGACCTAAAGTTGTGGC	1
AGGCAGCACGGATGATACATTGGT	1
AGGCAGCCACCAGTGACCTTGGGC	1
AGGCAGCCTAAAGCCACAAACCAA	2
AGGCAGCGACGACGTTGATGG	1
AGGCAGCGAGTGAAAGTTGAGGAG	1
AGGCAGCGATTAGGGTAGGCGATG	1
AGGCAGCGCAGTGCAGCGGGGTTG	1
AGGCAGCGCCGAAAGTTGATAGTG	1
AGGCAGCTATGTCCTAGATGTGAT	2
AGGCAGCTGAGGGATTTGGGGGTT	1
AGGCAGGATGTCTGGATGATAGGC	1
AGGCAGGATTGCGTGATTGGGAGC	1
AGGCAGGGGTATCTACCGCAAG	2
AGGCAGGTTTCGAGGCCTATGTGGC	1
AGGCAGTATTGCCTCCGTTGGTGT	1
AGGCAGTCTTAGCGCAGTCGGGTA	1
AGGCAGTGACCTGATGTTGGCAAG	1
AGGCAGTGGTCAGGTGGTAAGCGC	1
AGGCAGTTAGACCGGCCGGGTGTT	1
AGGCAGTTGCCCTCTATGTCGAAG	1
AGGCATACACCTAGGTGCCATGTC	1
AGGCATACCTTGCCAGAGCTGAAG	1
AGGCATAGAATAAATCCCCTCCAA	1
AGGCATAGTGGCGTCAAGATGGGT	1
AGGCATATCGTAAGGCATAGGGAC	1
AGGCATATGCAGGATGCTGGGCCA	1
AGGCATATTTTTTGGCCTAGGCCT	2
AGGCATCCTCAATGTTTGTGGTGT	1
AGGCATCGCTTATGTGGTCCGCCT	2
AGGCATCTGAGGCGAGGAATTTGG	1
AGGCATCTTGTAGTGAGAGATGGA	2
AGGCATGGAAAGGGAAGAGATAGC	1
AGGCATGGGAACGACGACGACGAA	1
AGGCATGGTGCGCATGGCTGGTAC	2
AGGCATGGTGTCTAGATTACGGGA	1
AGGCATGGTTTACTGGTTGATGG	1
AGGCATGTAGTCTAGTGGTTGTAG	1
AGGCATGTAGTCTAGTGGTTGTAGT	1
AGGCATTAATTTAGGCCCGATTG	1
AGGCATTATAGATAAAGTTAGCGG	1
AGGCATTGCTAATGATCACTGCTG	1
AGGCATTGGTTGTCAACGAAGGTC	14
AGGCATTGTCCTATAAATAGATGG	1
AGGCCAACAAATCTTAAATTGATG	2
AGGCCAACCACTGCACCAGGCGGT	1
AGGCCAACCCTGAGAAGATATGGG	1
AGGCCAACTTCGGGATTAGCCTAC	1
AGGCCAAGGGATTTTGAGTGGATG	2
AGGCCAAGGGTGGTGATGTACGTC	7
AGGCCAATGAAGATGAAGCATCTG	1
AGGCCAATGTATGCAGAGTGTGCA	1
AGGCCAATTTATGTCGTAGTGGA	2
AGGCCACAAACAAAACGGGCGTGC	2
AGGCCACACAACAACTTTCAGGCCC	2
AGGCCACACCTAAAAATATGGGCT	2
AGGCCACACCTGAAAATATGGGCT	2
AGGCCACAGTGTACGGGAAACGTG	1
AGGCCACCCAATTCAAGCGCCTGA	1
AGGCCACCGATGGTCTGATGGCAT	2
AGGCCACCGCTGTTATGACCAGAG	2
AGGCCACCTCGCGCGTGCCATTGG	2
AGGCCACCTGCCGAATATGGGCC	1
AGGCCACGTGCTGCCAATGCCTGT	2
AGGCCACGTGGGCGATTCCATCTG	1
AGGCCACGTGGGCGATTGCGTCTG	1
AGGCCACGTGGGTGATCGTGTCTG	1
AGGCCACGTGGGTGATTGTGTCT	1
AGGCCACGTGTGCGATTGTGTCTG	1
AGGCCACTGACAAAGGATGAACCG	1
AGGCCACTTAGTAGATTGGATGAC	1
AGGCCACTTGATGGAGAAACGCCA	2
AGGCCAGACGATGATAATGGCTTC	1
AGGCCAGATTTCTACAACTCGAAG	1
AGGCCAGGTAACAAGTCTTCGG	1
AGGCCATACCAGGGTTTCTCATAC	1
AGGCCATGAAGCAGCGATTGTTTC	1
AGGCCATGAGAGCGAACGTGGAGA	1
AGGCCATGAGAGCGAACGTGGAGG	1
AGGCCATGGGACTATATTAAGTTA	3
AGGCCATGGGAGTATAGCTAGTGA	2
AGGCCATGTTTAGATTGTAGCCAA	1
AGGCCCAATATGACCTAGGTAGCC	1
AGGCCCAATGATTTGTAAGGTGGG	2
AGGCCCAATGTGACCTAGGTGGCC	1
AGGCCCATATGTCATAGACACATA	1
AGGCCCATGAACCGATCACAGGGA	1
AGGCCCATTAGAGATGTCATCTCA	1
AGGCCCGAGGTAGGGCAGCGGCCA	1
AGGCCCGATTGAGATGACTCATCT	1
AGGCCCGCCAGATGTGGGTGTGCG	3
AGGCCCGCTGTTATATACTGTGAG	1
AGGCCCGGTTTATTTTCCACGCA	2
AGGCCCGGTTTGGCACGGCTATGC	1
AGGCCCGTATGTGCCTATGTGTT	1
AGGCCCGTCTGTGAAAATATGTTT	1
AGGCCCTAACAACTTCGACCCGAC	1
AGGCCCTAAGGGTTGTTTGGTTGA	1
AGGCCCTAGATGAAGTTACAAGTA	2
AGGCCCTATACAAAGCTCTGGTGT	1
AGGCCCTATATATCCCTTCTTCCT	5
AGGCCCTATATTGATTGACTGGTA	1
AGGCCCTATTTGAAGAAGTACTTT	1
AGGCCCTCACGTGTACACACGTAC	1
AGGCCCTGTTGGGAGCTTGTGCCA	1
AGGCCCTGTTTAGATGGGACTGAA	2
AGGCCCTGTTTGATTCAGCTTAGG	2
AGGCCCTTTCGCGGCTTTGGGTC	1
AGGCCGAAGTTGAGTTAAGCT	1
AGGCCGAATACTTTATGAAATGGG	1
AGGCCGACCAACGAAAGATGGT	2
AGGCCGACGTCGGTGAGCCGGGAT	1
AGGCCGAGACCGAATTTATCGATC	3
AGGCCGAGATGGACGGCAGACGGC	1
AGGCCGAGTTTAGACTGATATGAG	1
AGGCCGATAAGTCAGACTAGCCGG	2
AGGCCGATAGCGCATCATTGATGG	1
AGGCCGATTTTCTAGTGTACTA	1
AGGCCGCAACTTGCTGCTGGTGAA	1
AGGCCGCGTCCGATGGTCATGTT	1
AGGCCGGCTACAAAATTGCCATAG	1
AGGCCGGGATATTTATTTATTCCA	3
AGGCCGTACCTACAAATTGAAGGC	1
AGGCCGTATGTGCAACCCGTGGGC	1
AGGCCGTCAGAGGTTGAGGTCTC	1
AGGCCTAAACATGTGTAAAACTCC	2
AGGCCTAACAGTTCGACCAGCAGC	1
AGGCCTAAGAGTGATGGGTCCACA	1
AGGCCTAAGATGACGAGATAGCTA	1
AGGCCTAAGCAGGCTCTGTGTGTC	2
AGGCCTAATGTGACCTGGGTGGCC	1
AGGCCTACCTCCCAACATGTTCAA	1
AGGCCTACTAAGGTGGTGTTTGGT	2
AGGCCTAGAATAGTCCTTGGGTCC	1
AGGCCTAGATGGACTTTATAAGA	1
AGGCCTAGGATCTAAAGTTGTGGC	1
AGGCCTAGTCATATATTTTTGATG	1
AGGCCTATCAAGATGATATTCTG	1
AGGCCTATCAAGATGCATGTGATG	1
AGGCCTATCTGGTTGATTGTGCTG	5
AGGCCTATGATGGGGAGAGGAAAG	1
AGGCCTATGTCGATTGAAACAGT	1
AGGCCTATTATCGTATGCATGCGG	1
AGGCCTATTGGTGTTGGTTTTAGC	1
AGGCCTCAAACCAAACCAGCTCTT	2
AGGCCTCAAGTGGTGCACATATGG	1
AGGCCTCAATAGCGTTGTTGCACC	1
AGGCCTCGGCTTTAGCTAGCTCTC	1
AGGCCTGACGGAGGTCTTGGAAGA	1
AGGCCTGAGGATGCCTCCTGCCCC	1
AGGCCTGATGGACCGTAGGTGCT	1
AGGCCTGATTAGATGATTGATAAC	1
AGGCCTGCGCGGTCTCCCGGTGAG	1
AGGCCTGCGGAGAGAACATTTCAG	1
AGGCCTGCTGATAGAGCTGGGCGG	1
AGGCCTGGATCAGGTGGTGTTTGG	1
AGGCCTGGGTATTGCACTCTAACA	1
AGGCCTGGTGTTGATTGTGAGTGG	1
AGGCCTGTGTGATCACGTGCACGT	1
AGGCCTGTTCACTTTGATGTCAAA	1
AGGCCTGTTTGATAGGGCTCTGAC	1
AGGCCTGTTTGGTACAGCTCCAAC	1
AGGCCTGTTTGGTTGGTGACCTGA	1
AGGCCTGTTTGGTTGTTGCCTAA	1
AGGCCTGTTTTAGCGAAGCCGAAGC	1
AGGCCTTAGTCTGATCGTTTGTGC	2
AGGCCTTATTGTTGGACCATTTAC	1
AGGCCTTATTTTCATCACTAAGCC	1
AGGCCTTCTTGAGTAGATGAA	4
AGGCCTTGATGCTTTTTATAGCTA	1
AGGCCTTGATGTGCGTTTTGCAAG	1
AGGCCTTGGATTCACACGTCTGGT	1
AGGCCTTGGGTTAAGGCAGGTTC	1
AGGCCTTGGTCGTGTTTAGTTCCT	2
AGGCCTTGTTGGGTTAATCCCCATG	1
AGGCCTTGTTTACAGCGCTCTGGT	1
AGGCCTTGTTTGGCTAATGGGATA	2
AGGCCTTGTTTGGTTGGGGAAAAA	1
AGGCCTTTAGATACAGTCGGAAGG	1
AGGCGAAACCCACTTTTGACGATA	1
AGGCGAAAGGTGATGTTGCTGGCC	2
AGGCGAACATGCTTCGTAGGCTGC	1
AGGCGAACCTCTTAAAGGGCCACA	1
AGGCGAAGAAAAATTGATGGCCTA	1
AGGCGAAGAAAATGATGGATTTAC	2
AGGCGAAGCCCTGCCAGTTTCAAA	1
AGGCGAAGTGCGGTTGGTATGCCC	1
AGGCGAATAAGATCGGCATGATGC	1
AGGCGAATAGTACTCCACTGTACT	1
AGGCGAATAGTTACTCCACTGTACT	1
AGGCGACAAATGAACGATATGTGA	2
AGGCGACAGCAGGTGATATCAGCG	1
AGGCGACGACTGGAACTGATGCGC	1
AGGCGACGGCCTATTTTTGGTTGA	3
AGGCGACGTACCCATTGACAGTGA	2
AGGCGACTCACTATCGACAGGTAC	2
AGGCGACTCTTTATCACCGGGTAC	1
AGGCGACTTGACAAAATAGCTGAA	1
AGGCGAGAAGACCGCAGTTGGAGC	1
AGGCGAGAATAAACTTAAGGTATC	1
AGGCGAGGGTGATTGTGACATTTC	3
AGGCGAGGTGCTAAAATGTGTTAA	1
AGGCGAGTCTCGACAACTGGTTAA	1
AGGCGAGTGCTTAACAAAGGTGTA	1
AGGCGATAAGGTTTGCGTGGTGTG	1
AGGCGATCAAGAACCGTGGGTGT	1
AGGCGATCCATTTGCCTGCTGGTC	6
AGGCGATCGGAAACCGTGGATGCG	1
AGGCGATCGTAGGTTGGGGCTTGG	1
AGGCGATCTCCATGATGGACGTGC	1
AGGCGATGACGGTGTTCTTGTGCG	1
AGGCGATGCAAGGTGTCCGTGGTA	1
AGGCGATGGTACATTATGGATGCC	1
AGGCGATGGTAGCCGACGACACTG	2
AGGCGATGTCCGTTGCTCCGGTGG	1
AGGCGATTAGGAACCATGGATGCG	1
AGGCGATTGAGGAACTTTACTCGG	1
AGGCGATTTCGTCGGTTCGACCGA	13
AGGCGCATCGAGTCACGGTGGTTA	1
AGGCGCATTGCTGTCGACGGGTAC	3
AGGCGCCCGCGGGCAATGGGCATG	1
AGGCGCTAGTGAGTTCCTACGTCT	1
AGGCGCTATCTATCCTGAGCTCCA	2
AGGCGCTTGAATTGGGTGGCCTGA	1
AGGCGGACAGCAAATTTCACTCCG	1
AGGCGGACATGACCATTGGAGCCA	3
AGGCGGACCACTTACGAGGACTTGA	1
AGGCGGACCACTTGTAAAAATTGT	1
AGGCGGATAGCTAGAGCCGGTGAC	1
AGGCGGATTGTGTCCCTAGCA	2
AGGCGGCAGCGAGGACGGTGG	1
AGGCGGCATGGTTTATTTTTGTAA	1
AGGCGGCGACCAGATGTGTTACA	1
AGGCGGCTAAGAACTGGAATATGC	1
AGGCGGGTGCAATCTAGTACACGA	1
AGGCGGTCAGACCGGTGCTACTAC	1
AGGCGGTCCGCAAAATTGGCTCGA	1
AGGCGGTCTTGTTATGTGGTTCGC	2
AGGCGGTGATAGATGTGATGGGCA	1
AGGCGGTGATCAACATATATTCAG	2
AGGCGGTTTGGATAGCGGTTTTGG	1
AGGCGGTTTTGTCCTACGTGGCAC	1
AGGCGTATCCTATCAATGTGTCT	1
AGGCGTCAACTTCTCGGGCCGGGT	1
AGGCGTCCGATAAGAAGCAGGAAG	1
AGGCGTCCGCTATTACTACCTCCG	1
AGGCGTCCGTGCCTCCGTGATGAC	1
AGGCGTCGACGGCTCAATGTGCGG	6
AGGCGTCGTGTAGGTGCCGATGGA	2
AGGCGTCTCACTGTTGACGGGTAC	1
AGGCGTCTCGCTATCGATGTGTAC	2
AGGCGTCTCGCTGTCGACAGGTAC	1
AGGCGTCTCGCTGTCGATGGGAAC	2
AGGCGTCTCGTTGTCCATGGGTAC	1
AGGCGTCTGCTTAATAGGTCCGCA	1
AGGCGTCTGGCTCATGGGCGAACC	1
AGGCGTCTGTGGTGACTTCATTAA	1
AGGCGTCTGTGGTGACTTCGTCAA	1
AGGCGTGCCGGTTGGTTTAATCCT	1
AGGCGTGGTGTCTAGATTACGGAA	1
AGGCGTGTCGATGCTGACCTGC	1
AGGCGTTGGTGGCATTAATTGTAT	1
AGGCGTTGTAACGTTCCCGTATGC	1
AGGCGTTGTGTCTAGATTACGGGA	1
AGGCGTTTAGGTATCCTGATTGTG	1
AGGCGTTTAGGTGCTGCGATCGTA	1
AGGCGTTTAGGTGTTGCGATCGTG	1
AGGCTAAAAGGGACTAATTTGAA	3
AGGCTAAACATTAGCATAGGGTGG	6
AGGCTAAACATTAGCCTAGGGTGG	1
AGGCTAAACATTAGCTTAGGGTGG	2
AGGCTAAACATTAGCTTAGGGTGT	5
AGGCTAAACATTAGTCTAAGGTGG	1
AGGCTAAACATTAGTCTAGGGTGG	9
AGGCTAAAGTTAGAGGAGCCAGAT	1
AGGCTAACCGAATAGCGATGGTAA	1
AGGCTAAGATGGATGGTCTAGGAG	1
AGGCTAAGGAGGTGTGGCAGCCTA	1
AGGCTAAGTTCCTACTTTAAAAAG	1
AGGCTAATAATTAGCCCATGGAAC	1
AGGCTAATAGTAGACAGTGAGCT	1
AGGCTAATGAAGAGTCAGGTCAGG	1
AGGCTAATTCACGACTGGTTGC	1
AGGCTACAAAAGCTGTCTGGGTTA	1
AGGCTACTGTTGTCCTCGGGTCAC	3
AGGCTAGCCTTGGACCTGCACTGA	1
AGGCTAGCCTTGGACCTGCACTGG	5
AGGCTAGGTCCTAGGTCTGGTTGC	1
AGGCTAGTGGTGGATGGTGGGCAC	1
AGGCTATACGACCTGGGTTTGAA	1
AGGCTATTAAGTGTTTTGTTTGGT	1
AGGCTATTGTCCAAGGTGCTCAAC	1
AGGCTCAAACGTGGGCTAGGCGAC	1
AGGCTCAACGCAGCGACGGGACC	1
AGGCTCACTGTACCACGGGTGGCA	1
AGGCTCAGGACCTAAAGTTGTGGC	3
AGGCTCAGGATCTAAAGTTGTGGC	1
AGGCTCATGCAACCAGTAGTCTGC	3
AGGCTCGAACAGAAAACTGGTGAA	1
AGGCTCGAGCTCAGATTGTACGTC	2
AGGCTCGGTGACTATGTGTCAG	1
AGGCTCTTATAACCATTAGGCTAC	2
AGGCTCTTCGCGAATGTGGGCAAC	4
AGGCTGAAAAATAAATTTTGATGA	2
AGGCTGAATACTGAGGTGGATGAG	1
AGGCTGAATGCTGAGGTGGATGA	2
AGGCTGAATGCTGAGGTGGATGG	1
AGGCTGAATTCTGAGGTGGATGA	1
AGGCTGACATGTGAGTTCAGTGGC	1
AGGCTGACTTATATATGGCGA	1
AGGCTGAGATGGGCGCTAACACCA	1
AGGCTGAGTGCTCTAAATAGGTGT	1
AGGCTGATAAGATATTTGATTTGC	1
AGGCTGATATGTGGGCCCGGGTGG	2
AGGCTGATGGAAGTCTAGATAGAT	1
AGGCTGATTCGGTGGAAAGAGCA	1
AGGCTGCACTTATTTTGGGGTGGA	1
AGGCTGCAGACGTTGCCTCACGA	1
AGGCTGCATCTGTGTAAGGGTGAG	1
AGGCTGCCAAAACCTGGTGGGCTC	1
AGGCTGCCATGTATGCCATATAGA	1
AGGCTGCCATGTTGTCGACTACAA	1
AGGCTGCCCCCTGATGCCACGTGG	1
AGGCTGCCGAACCGAAACGTCTG	1
AGGCTGCGAGGTGTGGTTCAACTC	1
AGGCTGCTAAATTGCTAATGATGG	1
AGGCTGGATTCGGATCCCAGAACG	1
AGGCTGGGCCTGGTCTATAGTGAA	1
AGGCTGGTGGATAAATGTACAAAG	1
AGGCTGGTGTGTTTATTTTGTAAA	1
AGGCTGGTGTTGAGGCTGTGCTTC	1
AGGCTGTAAATGGGTCTACAAAAC	1
AGGCTGTGGGCCAATCGGCAAGGG	1
AGGCTGTGTTCGGAACTCAAGTTC	1
AGGCTGTGTTTAGTTCACACTAAA	2
AGGCTGTTTGATGGTAGCGGCGGA	1
AGGCTTAAAGTGCTGCGATCGTGC	1
AGGCTTACAATGCCCATTCTGGTCC	1
AGGCTTAGGTCTGATCGTGGTGGA	2
AGGCTTATAAGGGTAGGAATAGGA	2
AGGCTTCAGGAGCTCTTGTGGTAC	1
AGGCTTCGAACCCAGGTCGTCTAGCC	2
AGGCTTCGAACTCAGGTTGTCTAGC	1
AGGCTTCGAACTTTGGTCGGCTA	1
AGGCTTCGGGTGGCAACGGGCTTC	2
AGGCTTCGTGGTGTGAGCGATGA	1
AGGCTTCTAGGTGCAACTGGCTGG	1
AGGCTTGACCTAGCACAGGAGGAG	1
AGGCTTGCGCGATTGGATCGAGGT	2
AGGCTTGCTTCCCGGCCCGTG	1
AGGCTTGGCAGCTAGAGGGACAAC	1
AGGCTTGGGAGAAGTTAAGGTCCA	1
AGGCTTGGGCTCTGTTGGTGATGG	1
AGGCTTGGTACCATTGATCGGACGC	1
AGGCTTTAAACAACGGTATGGTAT	1
AGGCTTTGAACCCAGGTTGTCTAGC	1
AGGCTTTGAGAACTCAGGGCATGC	1
AGGCTTTTAGAGCAGGTGCAATAG	1
AGGGAAAAAATTGAACTCACCAAA	1
AGGGAAAACCGTATGTAAGCCT	3
AGGGAAACCACGTGATTGGAGGAA	1
AGGGAAAGGTGAGGTTACGGAGAA	1
AGGGAAATGCACGAATCATGGCGC	1
AGGGAAATGGCAGCGCAAAAGGTGT	1
AGGGAAATGGGATCAGGAGAGAGG	1
AGGGAACACCTATGGGTATAAATA	1
AGGGAACTCCATGCTATGAGGAGG	1
AGGGAAGAAAGGATGGCATTGAAA	3
AGGGAAGAGCCGATTTTCAGTGAC	1
AGGGAAGAGTTGATGCCAAGTGCC	1
AGGGAAGATGCCTTATAAATTGGT	1
AGGGAAGATGGCCCTATAGGTGTC	1
AGGGAAGCCCGAGTGGGTCCTCGA	1
AGGGAAGCCGCCTTCTCGACTGGC	2
AGGGAAGCCGTGCAACTACATCGC	2
AGGGAAGCTGTTTGATTTCATGGT	1
AGGGAAGGACCTAATATCAAATAA	1
AGGGAAGGAGTAGGTGTGTAGTGA	1
AGGGAAGGTACTGATTGAAGGATA	1
AGGGAAGGTACTTGTCTGCACTGA	2
AGGGAAGTAGTAACATTATGGGAC	1
AGGGAAGTCTAACGTTATCTCTGA	2
AGGGAAGTGCTATGATAGATGTGA	1
AGGGAAGTTTTCGATGTGATGTGA	1
AGGGAAGTTTTGGCCTAGCAGTGTTG	1
AGGGAATACTATTTTCGCGTGCGG	1
AGGGAATATCCCCTCGGTTCATGC	1
AGGGAATATGGTTCACACACGCAT	2
AGGGAATGCTAGTAGATGGGATCC	1
AGGGAATTAGGGCAGCTACAATAC	1
AGGGAATTGCGAACGAATACCGAA	1
AGGGACAAAAATCGGACTGGGCGAC	1
AGGGACAAAACTGGTACCCCGCGAT	1
AGGGACAATGCCTTATAAGTTGGT	1
AGGGACACCGCAAAAATGTGACA	1
AGGGACACGACTGCGAGGAGGTGA	1
AGGGACAGCGAGAATGAGCGGCGG	1
AGGGACAGGGTTGGTCCGGACTGC	1
AGGGACATTTAAACGGTTGTTGCT	1
AGGGACATTTACAGGGGTGCATAA	1
AGGGACCAGGGTGACACAACTGA	1
AGGGACCGCGGTTGTTATGGA	1
AGGGACCGGGATGACACAGTCAAAC	1
AGGGACCGGGGTGACACAACCGAA	3
AGGGACCGTACGCGCGCCGTTGCC	1
AGGGACCTAAATGACACACTCC	1
AGGGACCTAACATATACGTAGTGG	1
AGGGACCTAATTGCAAATATGCGG	3
AGGGACCTAGATGATACATCCGT	2
AGGGACCTAGATGCGCGCTTTGCA	1
AGGGACCTAGGTTTTCAAGGTTTC	1
AGGGACCTCGAGGAGATGATGATG	1
AGGGACCTCGATGTGCGCTTTGCA	1
AGGGACCTCGCATATCTAGTTTTG	1
AGGGACCTCGTATATCTGGTTTTGC	2
AGGGACCTCTAACACGACGCCTCT	1
AGGGACCTGGGTGACACAACTGAA	1
AGGGACCTTGAGTGAACGGTTTTG	1
AGGGACCTTTTTTGCATGGTTTTG	1
AGGGACGAGTGCCTAGAGGCTCTC	1
AGGGACGGCCCCGATCGATGCAGC	1
AGGGACGGCCTAGTGGATGTTGGT	1
AGGGACGTAGGTTATGGGCTCAAT	1
AGGGACGTGGGTCACTGACGTGTC	1
AGGGACTAAAGATTATTAATTGCA	1
AGGGACTAGTGTCATAGTGTCGG	1
AGGGACTATTGGGGGATGCGCGAA	1
AGGGACTGCCTCTTGCATGAGAGG	2
AGGGACTGTCGGAGATATGGGCCT	1
AGGGACTGTCTACAAAATTACCAC	1
AGGGACTGTCTATATAGGATTTGA	1
AGGGACTTAAAAGTTTTAGTCTCA	2
AGGGACTTACAATATAAATACATG	1
AGGGACTTACAATGTAAATACATA	1
AGGGACTTACAATGTAAATACATG	13
AGGGACTTATGTTTTTGTGAGAGG	2
AGGGACTTATGTTTTTTTAGAGGG	1
AGGGAGAACTCATCGGGATACGCC	1
AGGGAGAAGCCAATTTTAAGTGGC	3
AGGGAGAAGCCAATTTTGAGTGG	1
AGGGAGAAGCTAATTTTGAGTGGC	1
AGGGAGAAGGAGATGGAAGATGAA	1
AGGGAGAAGGATTTGTCCTGGTGT	1
AGGGAGAAGTGTTGGGCCCAACAG	1
AGGGAGAATAGCTAATATGGTCAC	1
AGGGAGAATTCTGATCCTCGGGTAA	1
AGGGAGACACTTCCGAGATAGGTC	1
AGGGAGACCTGTCGATGTTTGCCA	1
AGGGAGAGTATTATCAGTGCATGC	1
AGGGAGATTGGGCCTTTCCCCGAG	1
AGGGAGATTTTGGTGCTTTAGGAT	1
AGGGAGCAACGTTGACGACCCGAC	1
AGGGAGCAAGTATGGATCTGATCC	1
AGGGAGCACCATGAACCTGGACCA	1
AGGGAGCACGGGAAAGGTCGCCGCC	1
AGGGAGCACTTTGTTGGCGGTTGC	1
AGGGAGCAGATTGTTGGCGGCTTG	1
AGGGAGCAGGCCGATGGGTTCGCA	3
AGGGAGCCCGTTAATTTAGAGTGG	1
AGGGAGCCGCTTGCAACATTTCAG	1
AGGGAGCCGTCGAACTGCATCACC	1
AGGGAGCGCTCTGTAATTTGGGAG	1
AGGGAGCGGCTATCGATCAGTGGC	1
AGGGAGCGTAAAGCGGCAGGTGTC	1
AGGGAGCTACGGCAATGTCGCAA	2
AGGGAGGAGCAGAGGTCTAGTGCG	1
AGGGAGGAGCAGATGTCTAGTGCA	1
AGGGAGGAGCTTATTGGGACTAA	2
AGGGAGGAGTAGAGGTCTAGTGCG	1
AGGGAGGAGTGCCTATAATCAGAG	1
AGGGAGGCAAGATCAAATTTGATG	2
AGGGAGGCACTATTAGGGCAGTAG	1
AGGGAGGCTAAAGGTTCATTTGCA	1
AGGGAGGGGTCTATAATAGAGCT	2
AGGGAGGTAGGGAGAGAGCATGGG	2
AGGGAGGTAGTGGATTGGTCTAGG	1
AGGGAGGTGAAGTTGGAACTGACA	1
AGGGAGGTGACTAGGTGAGTAGA	1
AGGGAGGTGGATTAGGAACCCATG	2
AGGGAGGTTCCTCTTGTAGTGCC	1
AGGGAGTACATGACTATGCTATGC	2
AGGGAGTACTAACATATGGGTCCT	1
AGGGAGTACTACTACTACTGCTT	1
AGGGAGTACTACTTTGGTTGTAAA	1
AGGGAGTACTAGTTTCTTCGTGAC	2
AGGGAGTACTTGAAGTGATATGGC	1
AGGGAGTAGCTAGATGCCTAGTCA	1
AGGGAGTAGCTCTGATGTGCTTGT	2
AGGGAGTAGCTGTTAGGCCATATC	1
AGGGAGTAGTATATACAGGCTATA	1
AGGGAGTAGTTGAGAAGGCCCACTA	1
AGGGAGTATGAAGTTGAATTCGTA	1
AGGGAGTATGTGCCACGTTTGCTA	3
AGGGAGTCCGAATTCGGGAAGTTTG	1
AGGGAGTCGACGACGATTGCTGGA	1
AGGGAGTCTATCCAGATGCGTTGT	3
AGGGAGTGATGATAGCAAGGTGA	1
AGGGAGTGGTTAGGAGGCGATGGA	1
AGGGATAACCAGAAGTGATGGCAT	1
AGGGATAAGCCGATTGATGATCCC	1
AGGGATACTATTTAGATTCGGTGA	2
AGGGATAGCATTAGAGGCGGTGGA	1
AGGGATAGCGTGGTGGTCCAACAA	1
AGGGATATGAATACGGATATGGT	1
AGGGATATGCTTGATGGAAGACAT	1
AGGGATATGGGCTGTACTACGGAC	2
AGGGATATTGGGAGCCAACCAACA	2
AGGGATATTTCCTAGTATCTGTCC	3
AGGGATCCTCACGTAGGGGTTAGC	2
AGGGATGAACTTGATGTTGTTGAA	3
AGGGATGACCTATTGTATATCTTG	1
AGGGATGAGTGTGGATGTGTTGTA	1
AGGGATGATGATCCGTACGGCAGA	1
AGGGATGCGAAAACTTTGTGGGAG	1
AGGGATGGCCTAAGCCAGCTATAA	1
AGGGATGGTGTCGTGCCCTGCGAG	1
AGGGATGTCAAACAAACTCGGTGT	1
AGGGATGTCTAACAAACTCGGTGT	1
AGGGATGTGCACAGGATGCAGGTA	1
AGGGATGTGTGACCCGTGCGATCAC	1
AGGGATGTTCAAGACCTGTGCTTT	1
AGGGATGTTTAGATCCAGGGGTGTA	1
AGGGATTAGGTGAACATTCAGAGA	2
AGGGATTGCTAAAGGGTATTCAAA	2
AGGGATTGTGATGATGATAATGGT	2
AGGGATTTGAAGCCGCCGGGTGTAG	1
AGGGATTTGAATCCGCTGGGTGCA	1
AGGGATTTGTAATAGTCTAGGATG	1
AGGGATTTTAGGTGGATGTGACAT	1
AGGGATTTTATGTTGATGCGACA	1
AGGGATTTTTTTTATGGATGTGAC	2
AGGGCAAAAACTTATATGGAGGCC	1
AGGGCAACAAATTGGCTCCGGTTC	1
AGGGCAACATATTGGCTCCGGTGT	1
AGGGCAACATATTGGCTTCGACGG	1
AGGGCAACATATTGGCTTCGGCGG	1
AGGGCAACATATTGGCTTCGGCTG	1
AGGGCAATACTGTATTTTCGCGTG	2
AGGGCAATTTTGATCCTACGTGGA	1
AGGGCACAAAACCGACTTGTCAGG	1
AGGGCACAAATGATTGGAATGGAA	1
AGGGCACACACACGAAGTTGGTCC	1
AGGGCACACGTGGGTCCAATGCTG	1
AGGGCACATGAAACATGAAAGTCA	1
AGGGCACCCGCAATGGTTATCTA	2
AGGGCACCCGTAATAGTAAAGTA	1
AGGGCACGACGGTGAGGAGGTGAC	1
AGGGCAGATGGATATACGATACGG	1
AGGGCAGCCGATTAGGTTAAATA	1
AGGGCAGCTGATGGACACGATGAC	1
AGGGCAGGGCAACGTTGTCCTAGA	1
AGGGCAGGGGGCGAAAAGGGGCTA	1
AGGGCAGTCCCAACCCATAGTGTC	1
AGGGCAGTGTGATAAATCACTGAC	1
AGGGCATACGAGATTGGTTTTGCA	1
AGGGCATACTGTGGGTGAGGGGAC	1
AGGGCATATATCCGCGCCCAGG	3
AGGGCATATTCAGACTGTAGCCAA	1
AGGGCATCCACAATGTGACCAAAA	2
AGGGCATGTACAAATAGGGATACTG	1
AGGGCATGTAGCCTAGTGGTTGCA	2
AGGGCATGTAGCCTAGTTGTTGTA	1
AGGGCATGTAGCGGTGTAGCCTA	1
AGGGCATGTAGCTTAGTGGTTGCG	1
AGGGCATGTAGCTTAGTGGTTGTA	1
AGGGCATGTTGTGGTAGAGCTCTA	1
AGGGCCAAATAGGAAATTTTCCTA	1
AGGGCCAACAAATTGGAGCAA	3
AGGGCCAACATATGTCTTTTCTGC	1
AGGGCCAATAACACAGTACGAA	2
AGGGCCAATATCTAAGAGCAGATG	1
AGGGCCAATATTAAGGATGGATTC	1
AGGGCCACAAAGAGAATATGGGCA	1
AGGGCCACGTGACTAGACGGGAAG	2
AGGGCCACGTGGTATTGGGGGGCA	2
AGGGCCACTTTAAAAATTGACTA	1
AGGGCCAGCCTTTAGGAGGGGCGAG	2
AGGGCCAGGAGAGTGGCGGTTGCC	2
AGGGCCAGGTGAACCTGCACATGA	1
AGGGCCAGTATGGTTTGAGGTCTA	1
AGGGCCATAGGCTCTGGTTGCTT	1
AGGGCCATAGGTTCGAATCCTGTCA	1
AGGGCCATAGTACAATGCAGATAC	3
AGGGCCATCTTGATCGGACGGCGC	1
AGGGCCATTGCTTACGAGCAGGCA	1
AGGGCCCATTCGGATTGTAGCCAA	1
AGGGCCCCGGAGGTGTCGGGTGCA	1
AGGGCCCCTTTGAATCGTATGATTG	1
AGGGCCCCTTTGATTTGAAGGAAA	2
AGGGCCCCTTTGATTTGGGGGAAA	1
AGGGCCCGAAAACGGTATTGGGTC	1
AGGGCCCGATTGAGATAACTCT	1
AGGGCCCGTCATAGATGACCATCATC	1
AGGGCCGAAGGAGGATGGATCCACC	1
AGGGCCGATGACTTATTGTCAGGA	4
AGGGCCGATGATGCCGTCGAACCA	1
AGGGCCGCTTTGTTGTAGGGCGGG	1
AGGGCCGGATGGAATATTTCCTA	2
AGGGCCGGATGGGATGCATTCTAA	1
AGGGCCGGCTCTACAATCTTGAGG	1
AGGGCCGGTATCAGGTGATATTAC	2
AGGGCCGGTCCGGAGATTTGGGAG	1
AGGGCCGGTCCTGTGGTTTTGGGG	1
AGGGCCGGTTTGGTACAGCTCCAA	1
AGGGCCGTATCGGTTGAGGACGCC	1
AGGGCCTAAGACTCTCACCGTCTC	2
AGGGCCTAGCACGGTTGTGGCACA	1
AGGGCCTATCGTCTAGTGGTTACA	1
AGGGCCTATTTGGTACAGCTCCAA	3
AGGGCCTCGTTGCTAAGTGCTA	1
AGGGCCTGAGCACTGCAGACTGCA	3
AGGGCCTGATTGGTACAGCTCCAA	1
AGGGCCTGGATGTTCATCTTCATG	1
AGGGCCTGGGTACTGTATACCATA	1
AGGGCCTGTAGCCTAGTGGTTACA	1
AGGGCCTGTAGCTTAGTGGTTATA	1
AGGGCCTGTGTGCATAGGATACGC	8
AGGGCCTGTGTGCATAGGATATGT	1
AGGGCCTGTGTTCCTATGTTGCCA	1
AGGGCCTGTTAAGATGTGATCGG	1
AGGGCCTGTTCACTTTGATGTCAT	2
AGGGCCTGTTCAGATTGTAGCTTA	1
AGGGCCTGTTTGATATAGCTTCAA	1
AGGGCCTGTTTGGATGAGCTTTAA	2
AGGGCCTGTTTGGATGAGTTTGAG	1
AGGGCCTGTTTGGCACAGCTCCAG	2
AGGGCCTGTTTGGTACAGCTCCAA	2
AGGGCCTGTTTGGTACAGTTCCAA	1
AGGGCCTGTTTGGTATAGCTCCAA	1
AGGGCCTGTTTGGTTAGTGTCACA	3
AGGGCCTTACCAAGCACAGATGGG	2
AGGGCCTTAGTACCCTTGGGTATG	1
AGGGCCTTGGGTGCTACTCAGGTC	1
AGGGCGAACATGCAGATTGTTAAA	1
AGGGCGATACGCGACGAATGGAGG	1
AGGGCGCTGCTCGTGATGTCGTGC	1
AGGGCGGATCCAACGTGGGTGCA	1
AGGGCGGCAAGGGTTTTCATGCAA	1
AGGGCGGCGAAAATGACGTGGCAG	1
AGGGCGGCGACGTGCCAGGAGTGA	1
AGGGCGGTTTCGCTGACGTGGCGC	1
AGGGCGGTTTTGCTGACGTGGCG	1
AGGGCGTCGTATAGGGTGTTCGAG	1
AGGGCGTGCTCGACGATGAGAGGG	1
AGGGCGTGGTCTACTTTGGTTGG	1
AGGGCGTTGAGCTATAGGGCGTCA	1
AGGGCTAAAACTACACATTAGCAG	1
AGGGCTAAATAGTGAAGTGGATGA	1
AGGGCTAACTATTATATGGGTGGA	1
AGGGCTAATTTGGATTGCTACCAA	1
AGGGCTACAAATGTAAAATTGATA	1
AGGGCTACAAGACTACAAGCTCGG	1
AGGGCTACGTAGGAAAATATGTTC	2
AGGGCTACGTGGCTGGATGGGAAG	1
AGGGCTAGATTTGGAGGACCTCCA	3
AGGGCTATGTTCCTATGTTGAGGC	1
AGGGCTATTACCTGATAAAGGGCC	1
AGGGCTATTATCTTACAAGTGGTC	2
AGGGCTATTTCATTGAAGGGCTAT	2
AGGGCTCACTGTCCCCTGGTGTCG	1
AGGGCTCAGTGATCTGATGGGATA	1
AGGGCTCGACCAGCCGTGCCGTAG	1
AGGGCTCGACTCGGCGCAGCTCAC	1
AGGGCTGATCCCCGCGTCCGTGGT	1
AGGGCTGATGTGGCAGATTGAGCA	1
AGGGCTGATTCGGTTTGTAGGATT	1
AGGGCTGATTTTCTTATAGAAGAG	3
AGGGCTGCTACAAAACAGGGTCCT	1
AGGGCTGCTACAAAATGGGATCCC	2
AGGGCTGGTTTGGTTTGTGACCTA	1
AGGGCTGGTTTGGTTTGTGATCTA	1
AGGGCTGGTTTGGTTTGTGGTCT	1
AGGGCTTAATAGGATTAATAGAAT	1
AGGGCTTACAAGATATGATGTTGT	2
AGGGCTTGAGAGGTTGGTTGATGTA	1
AGGGCTTGATGATGCGGAGCCGAG	1
AGGGCTTGCCTTTTATTTGGATGG	1
AGGGCTTGCTTAGAAATGTTGAAC	1
AGGGCTTGGTTGGATGTATAGGCT	2
AGGGCTTGTTCATATTGATGTCAT	1
AGGGCTTGTTCGTCACGTGGTGAG	2
AGGGCTTGTTTGGTTTGGAGCCA	1
AGGGCTTTACCAAGTAAGGTGTCA	1
AGGGCTTTAGGGCCTGTTTGGTAC	1
AGGGGAAAATCCACGGAGGGTCAG	1
AGGGGAAAATTGCCAAAGTTTGGA	2
AGGGGAAACACTAAGGAAGGCCGA	1
AGGGGAAACGTGACATGGGCCTAA	1
AGGGGAAAGCGACTAAAACATCAA	1
AGGGGAAATATGTGTCGGTTCTA	1
AGGGGAACACGAATGATAAGGCCC	2
AGGGGAAGAGCCATACTACACTCC	1
AGGGGAAGTCTATGTCGGACCTCT	1
AGGGGAAGTGCTACATCGG	1
AGGGGAATATTCTTCTAAAGGGAC	1
AGGGGAATGCTACATGATGGTATC	1
AGGGGACAATATAGGGTGCGGTGA	1
AGGGGACACCTATGGGTATAAATA	1
AGGGGACAGGGAGACATGTGGAGA	3
AGGGGACCACGTTGGTTGTGCCTA	1
AGGGGACCGTACCAATATCATTGG	2
AGGGGACCTCAGGGTGACCTCGGA	3
AGGGGACGGCTGATACGCGATCAG	1
AGGGGACTAACCGAATTGACCGAA	1
AGGGGACTAGCCATGCCTATCTCT	2
AGGGGACTGCCTGCAAAAATGCTA	1
AGGGGACTGCGGCATTGCCACGAC	1
AGGGGAGAGTGAGTACATGATAAT	1
AGGGGAGCGACCGATTTTCCCACC	1
AGGGGAGCGTATATAGTTATGGAT	2
AGGGGAGCTGTTTCCGACCATGGA	1
AGGGGAGGAATGGAAAGGGAGGT	1
AGGGGAGGACTTATTAAAATGTGG	1
AGGGGAGGCTGACTTTGACCTGGC	1
AGGGGAGGTCGCTGTCGAACAGCC	1
AGGGGAGTGTATTCGTGACGGTGT	1
AGGGGATACCTAGGTGTCGGTGAC	1
AGGGGATACTACATGTGCTGCGAG	1
AGGGGATATGCATGTGTATGCCTT	1
AGGGGATATTCGGGTGAACTCGGA	1
AGGGGATGACGATCCGTTTCGT	1
AGGGGATGATAAGGTTTGGTCT	1
AGGGGATGCCGTGCCATGGACGAT	1
AGGGGATGCCTGCAAAATTGCCAC	1
AGGGGATGGGTAGAGAAGTTGCGT	1
AGGGGATGTCAGGAGGGGATGTCA	1
AGGGGATGTCCTATTGTTGTTTGC	1
AGGGGATTCCCTGCGATTTACTG	1
AGGGGCAAACATGCAGATTGATAA	1
AGGGGCAAGTAATTGGGGGATTCC	1
AGGGGCACAAAAAGTTGAGTACCA	1
AGGGGCACAATAAATGGATGTCGA	1
AGGGGCACAGACGAGATCGCCACA	1
AGGGGCAGATCCAACGTGGGTGCA	3
AGGGGCAGATCCAATGTGGGTGTA	1
AGGGGCAGGGGATGAGGAAGGG	1
AGGGGCAGGGTTTTTCCTGTCCAA	1
AGGGGCATCCACAATGTACTCTAA	1
AGGGGCATGCTATGATGTGACAAG	1
AGGGGCATGGAAGAGATCAAGTTA	4
AGGGGCATTTGTCTCACTCGCTGC	1
AGGGGCCAAGGATCTACCGCTCAG	2
AGGGGCCACACAAATTGAAGCAAA	1
AGGGGCCACTTATCAGTTTGTCTC	2
AGGGGCCATCGCCGATGTCGACGA	1
AGGGGCCATCGTGATGAGTTCGCA	2
AGGGGCCATGCAGTGCCAGATGAA	1
AGGGGCCATTAGATTGCAGGCGAG	1
AGGGGCCCACCTATCAATGTTTGG	1
AGGGGCCCCAATGACGAGACTGGT	1
AGGGGCCCGCGAGTGAAGATGCCA	1
AGGGGCCCTAAATAGTGAACTTAT	1
AGGGGCCCTAAGAAATGCCACGAG	1
AGGGGCCCTTACAGAGGATGGTCT	1
AGGGGCCCTTAGACAGATACCATT	1
AGGGGCCCTTAGTATGCTAGTGGA	2
AGGGGCCGCATGTATTAGGGCATG	2
AGGGGCCGCCTGCAAAATAGCCGG	1
AGGGGCCGCCTGCAAAATGGCCGG	1
AGGGGCCGCCTGCAAAATGGCTGG	1
AGGGGCCGCTGTTGACGCGTGGAC	1
AGGGGCCGTCAACAAAATGGTCA	1
AGGGGCCTAGTGATCTATACTGTT	2
AGGGGCGAAGCCAGGATTATGTT	3
AGGGGCGCAAATGGGACTGGGAC	1
AGGGGCGCTAATGATGATGGGCA	1
AGGGGCGGAGGTAGAGTATGGGAC	1
AGGGGCGGATCCAACGTGGGTGCA	4
AGGGGCGGATCCAACGTGTGTGAA	1
AGGGGCGGATCCAACGTGTGTGCA	2
AGGGGCGGATTCAACGTGGGTGCA	1
AGGGGCGTGCCTGTTGTAACCGCA	1
AGGGGCTAATATAGACTTTGTTTG	1
AGGGGCTACAACGGTCGTGCACTT	2
AGGGGCTACTGTAGAGATTACGGA	1
AGGGGCTACTGTCAGGGTTACGGG	1
AGGGGCTACTGTGGAGATTATGGA	4
AGGGGCTACTGTGGAGATTATGGG	5
AGGGGCTAGATCCGACACAACCGG	2
AGGGGCTAGCATACTAGAGCATTG	1
AGGGGCTAGTGAGGGTGATCCCTA	1
AGGGGCTAGTTGTACACTATACAA	1
AGGGGCTCACAGGGGCCATGGTGT	1
AGGGGCTCACCGACGTGCAAGGAA	1
AGGGGCTCCCCTACGTATATATTA	1
AGGGGCTCTCAAAGTATGGTTGCG	1
AGGGGCTGAAGAATGGGTGACCAT	1
AGGGGCTGCCAAGACGACGTCTCC	1
AGGGGCTGCTCAGACTAACTCGGC	1
AGGGGCTGGCGGTGTTAGATCCGT	1
AGGGGCTGGTCACCACTGATGGCC	2
AGGGGCTGTGACGACTTGGGACTT	1
AGGGGCTGTTCAGATTGATGTCAT	1
AGGGGCTGTTCGGATTGTATCCAA	1
AGGGGCTGTTTAGATTCATGGGT	1
AGGGGCTGTTTGGTTGAGCGCCAA	2
AGGGGCTGTTTGGTTGATGGCTA	1
AGGGGCTGTTTGGTTGATGGTCAT	1
AGGGGCTGTTTGGTTGGTTACCAC	3
AGGGGCTGTTTGGTTGGTTGCCAC	3
AGGGGCTGTTTGGTTTCCAGGGAC	1
AGGGGCTGTTTGGTTTCTAGGGAC	1
AGGGGCTTCCCACATACCAGTGCC	1
AGGGGCTTGCATATTCTACCA	1
AGGGGCTTTACTCCCGGTTGGGAA	1
AGGGGCTTTGTTGTGACTGCCTCA	1
AGGGGCTTTGTTGTGTTCCATTTCA	1
AGGGGGAAACAGCGACGAGGTCAC	5
AGGGGGAACCCAGACGTAGTGGGA	1
AGGGGGAGAAAGCTAGATGACGGT	1
AGGGGGAGTAATAAACGTTACAATG	1
AGGGGGATGGAAGGGAGAAGGAGA	2
AGGGGGCACTACAATATAACTATG	1
AGGGGGCAGTTGGAAAGATAGAC	2
AGGGGGCATCGCCTCGTTGTTCGC	1
AGGGGGCCCAGTTAGGTTAGGATG	1
AGGGGGCCGAAAAGTGATGCTGCA	2
AGGGGGCCGCCTGCAAATTTCGTT	2
AGGGGGCCGCCTGTAAAAGACTGG	1
AGGGGGCCGCTGTTGACGCGTGGA	1
AGGGGGCCTGAGAGTTGATGTGAC	3
AGGGGGCCTTAAAGATGTTTGACC	1
AGGGGGCCTTAGTTGTGTTTCTCC	1
AGGGGGCCTTGTATTTATACCTAT	1
AGGGGGCTGAACACAAAAGTGTTG	1
AGGGGGCTGCCTAGACGATGTCTC	1
AGGGGGCTGGTTTATTTGATTCAG	1
AGGGGGGAAACTTCAGGGTGTGAC	1
AGGGGGGTTCCCAACCAGGAGTAA	1
AGGGGGTAATAGGGGGTAAATACA	1
AGGGGGTAATTCAGATGACCGCGA	1
AGGGGGTGCTACATTGACATTGTC	1
AGGGGGTGCTATGGACTGTCCAGA	1
AGGGGGTGGCTATCAAGCTAGGAA	1
AGGGGGTGGCTATCAAGCTGGAAA	3
AGGGGGTGTAAGTGGGTTAGCCAC	2
AGGGGGTGTATTCTAGTTGGGGTT	1
AGGGGGTGTCACTTGTTTAATTTA	1
AGGGGGTGTCCACATGTATTGTCC	3
AGGGGGTGTCTAAAGTGCCGCTAA	1
AGGGGGTGTTGGGTCTGTTGGC	1
AGGGGGTGTTTAGATCCTGGGTGTA	1
AGGGGGTGTTTAGATCTAAAGGT	1
AGGGGGTGTTTGGAAACTAGGGAC	1
AGGGGGTGTTTGGGAACTAGGGAC	1
AGGGGGTGTTTGGGAACTAGGGTC	1
AGGGGGTGTTTGGTTGATTGCTTC	2
AGGGGGTTACCAATCGGGACTACA	1
AGGGGGTTGCTTATTGGGCCTC	1
AGGGGTAAAAGGACTTGGTTGCCT	1
AGGGGTAAAGTTGATCGGGTGGGC	1
AGGGGTAACTGATATGACACGCCA	2
AGGGGTAAGGGTAAGCCACCGTGC	1
AGGGGTAAGTAGTGGCATATCTC	1
AGGGGTAATTCGGACGACCGTGATA	1
AGGGGTACACTGTCGCAGTGGTAA	1
AGGGGTACCAATTTTGTGAGAGTG	1
AGGGGTACCTACCTATTTATAGGG	1
AGGGGTACCTATCGAACAACTACA	1
AGGGGTACGAATTAGATTGGACCA	1
AGGGGTACGCTCTGGTGCATTCTA	1
AGGGGTAGGCTTTTCGAGAGATGG	1
AGGGGTAGGGTGTACGTGTGTGCG	1
AGGGGTAGGGTTTGCGTGCGTGTG	2
AGGGGTAGGTATGACGGTTGGCGA	1
AGGGGTATATATACCACAGGGGCA	1
AGGGGTATATGTTACTCTCTCCTT	1
AGGGGTATCCATAGATCTTGTGGG	1
AGGGGTATGAAAGAGATTGAGTGA	1
AGGGGTATGATCGGGCTAACGAAA	4
AGGGGTCAAGATATCTGGTTTTAG	1
AGGGGTCATCTATGGGTATAATAC	1
AGGGGTCATGTTAGCTTTTTTTA	1
AGGGGTCCACATGTTGCAACGGCC	1
AGGGGTCGCCGACTGCGGCCGTGC	1
AGGGGTCGCCGCTAAGTAGAGTAG	1
AGGGGTCTAGGACAATAAATCT	1
AGGGGTCTATTTGCGAAACAAGTT	2
AGGGGTCTCGATCCCGTTGGCTGC	1
AGGGGTCTGACATAGCCTGTCTTC	1
AGGGGTCTGATACCTCGAGGGTAT	1
AGGGGTCTGTGTGCCTCTCGGGGC	1
AGGGGTCTTGGAGTCGTGGGGCGA	1
AGGGGTCTTTAGATCCACGGGTGT	1
AGGGGTGAAAACGATCGGAAACGG	1
AGGGGTGAAAACGGACAGCTGCCG	1
AGGGGTGAAAACGGTAACGGTAA	1
AGGGGTGAAAAGTTTTGGCGTGAC	3
AGGGGTGAAGATGGTCCTAGGCGA	1
AGGGGTGAAGCTAGGATAAATGG	1
AGGGGTGAATGGTTGTAGTAGCCA	1
AGGGGTGACGTACTGCATGGGTTA	1
AGGGGTGAGACTTCGATTCCAAGC	1
AGGGGTGAGCTCGAATAGTTTGTC	1
AGGGGTGAGTGAGATGGGTTAGTC	1
AGGGGTGAGTGCGCATGCGTAGTG	3
AGGGGTGAGTGGGATGAGTTGGTC	1
AGGGGTGAGTGTCACGCGTTATGAG	1
AGGGGTGAGTGTGCGTGCGTTGTA	1
AGGGGTGATGGACTATTGTGTCTA	1
AGGGGTGCAAGTGGGTTTACCTGC	1
AGGGGTGCAGCCGATGGCAATGGA	1
AGGGGTGCAGGAGATTATGCGGCC	1
AGGGGTGCCATGTATCGACTTAGG	1
AGGGGTGCTATATCTCAATGGGAC	1
AGGGGTGCTCATTTGTGTACACTTG	1
AGGGGTGCTCCGGGGTATCCATGGG	1
AGGGGTGGACGGGGTGGATCTCGG	1
AGGGGTGGAGCTGGAGCTATGACA	1
AGGGGTGGCCTAGATAGAACCGCT	1
AGGGGTGGCTATCAAGCTGGAGAA	1
AGGGGTGGCTTCTCGATACACTAG	5
AGGGGTGGCTTGCTTTGGCTTTG	1
AGGGGTGGGATCGAGATTGGTCGT	2
AGGGGTGGGATTGAGATTGGTCAT	1
AGGGGTGGGCATTCGGTCTAACTG	1
AGGGGTGGGCGTTCGGTCAGGACC	2
AGGGGTGGTAATGGGTTATGGC	1
AGGGGTGGTTGACATATGAGTCC	1
AGGGGTGTAAACTTTTGGTGTGTCA	1
AGGGGTGTAAATTTTTGGCGTGTC	1
AGGGGTGTAAGTGGGTGAGCCGCG	3
AGGGGTGTAGAATAGTTATTCTA	1
AGGGGTGTATAATAGAGCTACTAT	1
AGGGGTGTATAGTTTCGACAACAT	1
AGGGGTGTATTTGGTTGTCAGCCA	2
AGGGGTGTCAGATCTGGCCGCGAC	1
AGGGGTGTCAGTTTTTCTTTAGGA	1
AGGGGTGTCTAGATAGGGCTAAAA	1
AGGGGTGTCTTGTCGAAGTACCAA	1
AGGGGTGTGCGCGTATACGTCTGC	1
AGGGGTGTGTCATCTAGGTCCCTA	1
AGGGGTGTGTGGTACTTATTACGG	2
AGGGGTGTGTTTAGTTCACGCTAA	1
AGGGGTGTGTTTGGATAATGGTAA	1
AGGGGTGTTTAGATACATGGTATA	1
AGGGGTGTTTCTCAGAGAGTGCCT	1
AGGGGTGTTTGGATGATAATTTAA	1
AGGGGTGTTTGGTTGAGAGGTGAG	1
AGGGGTGTTTGGTTGAGGGGTGAG	4
AGGGGTTAACGAACGCAGCCTAAA	1
AGGGGTTATGTCGATTTGGGACCTA	1
AGGGGTTATTACGACCACAGTGTA	1
AGGGGTTCACCTATATCGTCGAAG	1
AGGGGTTCCTTACAAATGGACTCA	2
AGGGGTTCTGTCTCCTCTAGGGAG	1
AGGGGTTGAGATGTTAGTTGATGT	1
AGGGGTTGCATAACACGTTCTCAC	3
AGGGGTTGCCGTGGAGATCATGGA	1
AGGGGTTGCCTATTGCATGAGAGG	1
AGGGGTTGCCTGCAAAATGACCGG	1
AGGGGTTGGTAACCATGGGTGTGT	1
AGGGGTTGTGACATATGATAGTAC	1
AGGGGTTGTGACGATTTGGGATCT	1
AGGGGTTGTGTGGTCTAGGATGAT	1
AGGGGTTGTTGGGGCTAGAGCATC	2
AGGGGTTGTTTGGATGAGTGCCAA	2
AGGGGTTGTTTGGTTCTTAACTAA	1
AGGGGTTGTTTGGTTGATGTCTA	1
AGGGGTTGTTTGGTTGATGTCTAA	1
AGGGGTTGTTTGGTTGGTTGCCAC	1
AGGGGTTTTCGGACACGAATGGA	1
AGGGGTTTTCGGACACGAATGGAA	1
AGGGGTTTTGAAAGAGGAAGAGAG	1
AGGGGTTTTGGCCAGCCGGAT	1
AGGGGTTTTTGGACACGAATGAAA	1
AGGGGTTTTTGGATACGAATGGAA	1
AGGGTAAAACTAACCTGTCTCA	3
AGGGTAAAGCCGCTGGTTTCGC	1
AGGGTAAATGTGCACATGTTGTG	2
AGGGTAACACGTGACTCATCCCTA	2
AGGGTAACCTTTGGTGTTTAGCGG	1
AGGGTAACTACATTAGTGCATAA	1
AGGGTAACTACATTAGTGCATAAG	3
AGGGTAAGGACCGAGAAACGTGCA	1
AGGGTAAGTCCTAAGTTCCGCTAG	1
AGGGTAAGTTAGCTTTACAAGGCC	1
AGGGTAATCCAGATTCGTTGTCCT	1
AGGGTAATTAGCTTACAAACCAGA	2
AGGGTACACAAAACGACAAGTAAT	1
AGGGTACACAAACGACAATTGTTG	3
AGGGTACACCGACAGAACAGCGAC	1
AGGGTACACCTTCAGTGCTTCCCT	1
AGGGTACAGAAGGGATTAGGTGAA	1
AGGGTACCATGGCGATACGCTGGT	3
AGGGTACCCTGCGTTGGCCATGCCC	1
AGGGTACCTATCGAACAACCGCGG	2
AGGGTACCTATTGAACAACCGCAG	1
AGGGTACCTCATACTATCTAGGTA	1
AGGGTACCTTTGCATAGCAAGAAG	1
AGGGTACGAAATACAGTTGTAACA	1
AGGGTACGCACGACTGGTCGCC	1
AGGGTACGCCCTATAATTTGGGAC	1
AGGGTACTACTCAGGTCACTGCAA	1
AGGGTACTATCCGTCGGAATCGGA	1
AGGGTACTATCCGTTGGAATCGGA	1
AGGGTACTATTCACCGATTGAGTC	2
AGGGTACTTATTATGGAGGAGC	2
AGGGTACTTTACACGTTTTATGTA	1
AGGGTACTTTGATTGGATGTGACA	3
AGGGTAGAATTGTAAATGAGTGTC	1
AGGGTAGACGTGTGTGTGT	1
AGGGTAGAGCTACTAGTGATGGAA	1
AGGGTAGATTGTTGGGTTTAGTCC	1
AGGGTAGCACTCTGTAAGGGG	2
AGGGTAGCCGTAGGTGTTTAGCTC	1
AGGGTAGCCGTTTGCAGAACA	1
AGGGTAGCTATTATGCAATATGCA	3
AGGGTAGGATGGATGGAACCTTA	1
AGGGTAGGCGTGATGGAGTTTGGA	1
AGGGTAGGGTGAGACATCTAAAGT	1
AGGGTAGGTCCCGTAGTTGGGATA	1
AGGGTAGGTGCTCTATTCAACAGT	1
AGGGTAGTCGCTCGATAGTGCCGCA	1
AGGGTAGTTCTGGGCCTACCTGGA	1
AGGGTATACAAGTCCTTCTACTGC	1
AGGGTATACATATGGTTGAGTTAA	1
AGGGTATAGAAGGGATTAGGTAAA	1
AGGGTATATGCGAGATTGAGGTAA	1
AGGGTATCAACATACTACAGGTGT	1
AGGGTATCATATGGGGTGTTT	1
AGGGTATCGATAGGCCTGCTGAGA	2
AGGGTATCGCTTCCATCACATGGT	1
AGGGTATCTAGATAGAACTAGGGT	1
AGGGTATCTTTTCGATTGAAGGAC	1
AGGGTATGATGTGTGTCTGTTCAC	1
AGGGTATGCATCGGATGCGAAGGC	2
AGGGTATGGGTGAACGATGCAGAC	1
AGGGTATGGTGAACGTAAGGAGGC	1
AGGGTATGTTCAGATTATAGCCA	1
AGGGTATGTTTGGTACAGCTCCAA	1
AGGGTATGTTTGGTAGAGCTCCAA	1
AGGGTATTAATAGCCCCAAGGACC	1
AGGGTATTACACCTCCGGGTGATC	1
AGGGTATTACGCTTCTCAGCGGCC	2
AGGGTATTGAGGTACGTTGGTAC	1
AGGGTATTTAATACAAGTGTGCAA	1
AGGGTATTTCTGTCCACGATGGTA	1
AGGGTATTTGAGAGCGTAAATACA	1
AGGGTATTTTGGTATTTTCCTGTC	1
AGGGTCAAAACCACCAAAGGACCTA	2
AGGGTCAAATGGTGCAAAATTGAA	1
AGGGTCAACCACAATAGCACTTAC	1
AGGGTCACGGATTAGATTTCGATC	1
AGGGTCACTGGTTGATTGTGCTCC	1
AGGGTCATTACCTGACAATTCAGG	1
AGGGTCATTTTTGAAATAAGTTT	1
AGGGTCCACATGTTATATACAGCG	1
AGGGTCCACGTGTCAACCACCTCC	1
AGGGTCCATGTGCCTCTCGGGGC	1
AGGGTCCATTTGGTAACTGACTCC	1
AGGGTCCCACATACCTTACGTGCA	2
AGGGTCCCGTAATGTTTACAAGAA	1
AGGGTCCGCCTACAAAATTGCCAT	1
AGGGTCCTCCTAGGTTGTTTATTA	1
AGGGTCCTTCTGGGATGTTGGCGGT	1
AGGGTCCTTTGGGATCTGTGTGAC	3
AGGGTCGCTGGAGTCTGAGGCTGT	1
AGGGTCGTATACTCGTATGTGGTC	1
AGGGTCGTCTACGCTCGCATCGGC	1
AGGGTCTACATATCAGTGATTCAA	1
AGGGTCTACATGTTATAGATAGCG	1
AGGGTCTACTATGATTGAGAAACC	1
AGGGTCTGATGCCTCCGAGTCCTA	2
AGGGTCTGTTTGGTTGTTGCCTAA	1
AGGGTCTGTTTTCGGATACGGTAC	1
AGGGTGAAAATCTAGTTCTGGATA	1
AGGGTGAACATGCAGATTGTTGAA	1
AGGGTGAACCAAACTACGGAAGC	1
AGGGTGAACCCATGGATTGTCGGT	1
AGGGTGAAGCGCTGTAGCAAATG	1
AGGGTGAATAGCCAATACGGTCCT	1
AGGGTGAATAGCTAATACGGTCCT	1
AGGGTGAATAGCTAATATGGTCC	3
AGGGTGAATCCAGCGTGGGTGCTA	1
AGGGTGAATCCATCATATGATTGT	2
AGGGTGAATTCTACTACGACGGAA	1
AGGGTGAATTCTACTATGACGGAA	1
AGGGTGACACAACTGAACAAGTTG	1
AGGGTGACACAACTGAACAAGTTGG	2
AGGGTGACACTTTCGAGATGAGCC	2
AGGGTGACCACGTTTTCGTGCTG	1
AGGGTGACGAGATCGGAGCGGATC	1
AGGGTGACGTGGACGAATCTCGAA	1
AGGGTGACTGTACGTGCGTTGTGG	2
AGGGTGAGAATCTAGAGTGTGCT	1
AGGGTGAGACTTCGAACCCAGGTCA	1
AGGGTGAGATCTAAACAGGGCCTA	1
AGGGTGAGATTGTTGAATAGTCCC	1
AGGGTGAGGAGCCAATTTTTCGGA	1
AGGGTGAGGAGCCAATTTTTTCGG	1
AGGGTGAGGAGTTAGGAACTCCAG	1
AGGGTGAGGATTCGAACTTAGGTC	1
AGGGTGAGGCCATCATGGGATGG	1
AGGGTGAGGCTTCAAATAATTAGC	1
AGGGTGAGGTTACAACGCCGCA	1
AGGGTGAGTACTGAACTGAAGGA	2
AGGGTGAGTAGCTAATTTTGCGGA	1
AGGGTGAGTGACGACGTGAGCTC	1
AGGGTGAGTGTGCGCACGTTGTGA	1
AGGGTGAGTGTTTACTTGTTGTGA	2
AGGGTGAGTTAGAGCTCGAGTGTC	3
AGGGTGAGTTCCGGTGTCTCCGG	1
AGGGTGAGTTCGCTGGTTCTG	2
AGGGTGATCCAAACTAGGAGATGA	1
AGGGTGATCCAAAGTGAAAATTGG	1
AGGGTGATCTAGTGACAACATGTA	3
AGGGTGATCTCGTAGTTCTTGGTC	1
AGGGTGATCTTAACATAACCAGT	1
AGGGTGATCTTAACATAACCAGTA	1
AGGGTGATGGAGACGATGGCGCTC	8
AGGGTGATGGCAGTAGCAAGCAAG	2
AGGGTGATGTAGATTAGAGAGTA	1
AGGGTGATGTTGGGTTTAGTCCCA	6
AGGGTGATTGGCTGTTGAGGCGGA	1
AGGGTGATTGGGCATTTTCCCGA	1
AGGGTGCAAACGGGACAATC	1
AGGGTGCAACGTCTGTGGCATT	1
AGGGTGCAAGCGACTACCCGCGAA	2
AGGGTGCAAGCGGGTCGATCCGTG	1
AGGGTGCAAGGCGAAGACCGTCTG	1
AGGGTGCAAGGGTGCGTTTTCTA	2
AGGGTGCAAGTGGGTAGACTCACG	1
AGGGTGCAAGTGGGTTTACCCGCG	1
AGGGTGCAAGTGTAATCTCACATG	1
AGGGTGCAATACGGTTGACCGCGA	2
AGGGTGCAATTAGTGACGGCATGG	1
AGGGTGCACCACGTTAGATCAATT	1
AGGGTGCACGGTTTCAACCCCAAG	1
AGGGTGCAGCAATAGGCTTGCAG	1
AGGGTGCAGCCGGTCAGACTGGTC	1
AGGGTGCAGGTGGATCGACCCACG	1
AGGGTGCATGAACATATTCAGTGT	1
AGGGTGCATGTGTGTTAGAGTTA	1
AGGGTGCCCGTGCGTTGCTACGGG	1
AGGGTGCGACAAGCCATGGCTCTG	1
AGGGTGCGAGATGCAGATTCTACA	1
AGGGTGCGATGGTTTAATACCGTC	1
AGGGTGCGATGTTTTTGAACGGA	1
AGGGTGCGATGTTTTTGAACGGAA	1
AGGGTGCGCCGGATTTATTTCCAA	1
AGGGTGCGCTATATATATTATAGG	1
AGGGTGCGCTCTGTTGAAGGACAT	1
AGGGTGCGGTGAATGACATATCCC	1
AGGGTGCGGTGAATGACATATTGT	1
AGGGTGCGGTTGATCTTTACTGGT	1
AGGGTGCGTACTGTTTTACAAGCT	1
AGGGTGCGTTATGTCTGGTTTCGG	1
AGGGTGCTAAACTTGTGATTTCGT	1
AGGGTGCTAAATTTGTGATTTCGT	1
AGGGTGCTAATTGGTGCTATCTGG	1
AGGGTGCTAGACGGACTTTT	1
AGGGTGCTAGGCAACATGGTTTGT	1
AGGGTGCTATGGAAGGTATCCATG	2
AGGGTGCTCATGGGGTATCCATGG	7
AGGGTGCTGATAGTGAACTAGAAA	1
AGGGTGCTGCTGGTTGTGGTGGAC	1
AGGGTGCTGTCTATATCGTCGCC	2
AGGGTGCTTGAATAGATGTCAAAA	1
AGGGTGCTTGTTGTTTAGCCAGTA	1
AGGGTGGAACCAACTTATAAGGCC	1
AGGGTGGAATCTAGTGAGGACAAC	1
AGGGTGGACCTTTGACTACAAGAG	1
AGGGTGGAGCTAGAACGAAATGGG	1
AGGGTGGAGCTGAGTTTTTCTGCT	4
AGGGTGGAGCTGGTTTTTCTGCTC	1
AGGGTGGAGGATTCTGACGATAGA	1
AGGGTGGAGTCCGTCGGTGATGG	2
AGGGTGGATCTAGCATAGGAGCGA	1
AGGGTGGATCTGCCAGCTTGGTTT	1
AGGGTGGATGAAAAATGAATTTAT	1
AGGGTGGATTTTTGTTGCATGCAA	1
AGGGTGGCAACTCGTAGATGAATC	1
AGGGTGGCACGCATTCACCATGTG	1
AGGGTGGCCATGTATTGGGTCTAC	2
AGGGTGGCCCATTATACCCCTGGG	3
AGGGTGGCGAAGCGTAGGCTC	1
AGGGTGGCGAATCCTATTTAGACA	1
AGGGTGGCGGACAGTCCAGATGGT	3
AGGGTGGCTGGGATTTTCTCCCAA	2
AGGGTGGCTTCGGTGAGGTGTACAA	1
AGGGTGGCTTTGCTGACGTGGCAC	2
AGGGTGGGAGTGGGATATGGTCACC	1
AGGGTGGGATCGAGATTGATCGTC	1
AGGGTGGGCATTGCCATGTTGCCA	1
AGGGTGGGCCCTATGTTAATGGGT	2
AGGGTGGGCTAGACGATCTGGGTC	1
AGGGTGGTAATCAATATAAATGGC	1
AGGGTGGTAGTATAAATAGATCTG	1
AGGGTGGTATGTTTGGATCCATGT	1
AGGGTGGTCCAAATTGAAACTTG	1
AGGGTGGTCCGGTTGAATTATGG	1
AGGGTGGTCCGGTTGAATTATGGA	5
AGGGTGGTCGCGTATGCCTCGCGG	1
AGGGTGGTCGGCCAACATTGGCGA	1
AGGGTGGTCTTAGAATAATTGTA	1
AGGGTGGTGGCATTGGTCATTGGG	1
AGGGTGGTGTCGACGTTTGATGTC	1
AGGGTGGTGTTCTCGAAGCTGGT	1
AGGGTGGTTGAGGGTAAAACAGA	1
AGGGTGGTTGCTGATGAAAGTTGG	1
AGGGTGGTTGTGACTTATATTTTG	1
AGGGTGGTTGTGCCTTATATATA	1
AGGGTGGTTGTGCCTTATATTTTG	1
AGGGTGGTTTCACTAACATGGCGT	1
AGGGTGGTTTCGCTGACGTGGCGA	1
AGGGTGGTTTCGCTGACGTGGCGC	2
AGGGTGGTTTTGCTGACGTAGCGG	1
AGGGTGGTTTTGGCTGACGTGACA	1
AGGGTGTAAAGTTTTGGCGTGTC	1
AGGGTGTAAAGTTTTGGCGTGTCA	1
AGGGTGTAAAGTTTTGGTGTATCAC	2
AGGGTGTAAAGTTTTGGTGTGTC	1
AGGGTGTAAGTGGGTCAGCCGCG	1
AGGGTGTAATTCGGACTTTTCGTA	1
AGGGTGTAATTCGGTAGACCGCA	1
AGGGTGTACATACATCTAGGTGTA	1
AGGGTGTACATTCGCCGGTGT	1
AGGGTGTACGATGGATATTACCAA	10
AGGGTGTACGCCGGAGGATATGCC	1
AGGGTGTACGCGTGTTTTAAATG	1
AGGGTGTACTCACAAACTAGAGGT	3
AGGGTGTACTCCTATTATTGGGCC	2
AGGGTGTAGCTATATTTATGGCA	1
AGGGTGTAGCTATATTTATGGCG	1
AGGGTGTAGCTATATTTATGGCGTC	1
AGGGTGTAGTTAATGGGTATTGGC	1
AGGGTGTATAACTTTTGATGGTTA	4
AGGGTGTATATGCTATCGTTGGCT	1
AGGGTGTATGACAAGTGGGTCCC	2
AGGGTGTATGTGTATTCATTGGAA	1
AGGGTGTATTATATCCGGTTTTGT	1
AGGGTGTATTCAAGAATAGTGTGA	2
AGGGTGTATTCTCCTTGAGGTC	1
AGGGTGTCAAAGAGCTTACTCGGC	1
AGGGTGTCAAATGTCTAGTTTTAA	1
AGGGTGTCAACGTGGCTGTTTGG	1
AGGGTGTCAACGTGTCTGTTTGGC	1
AGGGTGTCATTGATTGTGCGAATC	1
AGGGTGTCCATGCGTTGCCACGGA	2
AGGGTGTCCTAGCTGAGACGCTGG	1
AGGGTGTCCTCCATTGCGAAGGGA	1
AGGGTGTCGAAACATGAATTCGG	2
AGGGTGTCGAAGGCATATTTTTTG	1
AGGGTGTCGCATAGGGTGTTCGG	1
AGGGTGTCGCATAGGGTGTTTGGG	1
AGGGTGTCGCATCGGATATACGGA	1
AGGGTGTCGCATGAAGTGTTCGA	1
AGGGTGTCGCATGGGGTGTTCGAA	1
AGGGTGTCGTACGTGGTGTTCGGA	1
AGGGTGTCGTATAAAATGTTCGGA	1
AGGGTGTCGTATAGAGTGTTTGGC	1
AGGGTGTCGTATAGGTCCAAACA	1
AGGGTGTCGTATGAGGTGTTCGG	1
AGGGTGTCGTATGAGGTGTTCGGAC	2
AGGGTGTCGTATGAGGTGTTCGGG	1
AGGGTGTCGTATGGGATGTTTGG	1
AGGGTGTCGTATGGGGTGTTCAAG	1
AGGGTGTCGTATGGGGTGTTCGAG	1
AGGGTGTCGTATGGGTGTTCGGA	1
AGGGTGTCTATTATTGCGAGCTA	2
AGGGTGTCTCACACCATGTGGTC	1
AGGGTGTCTGGTTGATTGCTTCAT	1
AGGGTGTCTTTGACACGTGGGCCC	1
AGGGTGTCTTTGAGCTAAATGTCT	1
AGGGTGTGAAATGTATGGCTTCGC	1
AGGGTGTGACAAATCGTTAATTGT	2
AGGGTGTGACAGAGATGGTATCAG	1
AGGGTGTGACATCCTCAGTGGCGG	1
AGGGTGTGACTGATATAGTGATGT	2
AGGGTGTGAGAGTATTAGATACTC	1
AGGGTGTGATAGGGTTCAGAGGGT	1
AGGGTGTGATGATACGAGACTTCA	1
AGGGTGTGATGGTACGAGACTTCA	1
AGGGTGTGCATTCATAAACGGATG	1
AGGGTGTGCTCTGCTTATTAGTTA	1
AGGGTGTGCTTGTGTTTTATAGG	1
AGGGTGTGGAACGCGGTTGGAGGA	1
AGGGTGTGGCAAATCATTAATTGCC	2
AGGGTGTGGCAAATCGTTAACTGC	1
AGGGTGTGGCAAATCGTTAATTGC	1
AGGGTGTGGCAAATCGTTATTTGC	2
AGGGTGTGGCAAATCGTTATTTGCC	1
AGGGTGTGTCATCTAGGTCCCCAA	1
AGGGTGTGTCATTTAGGTCTCTAA	1
AGGGTGTGTCCTGTCGTATCGGAA	1
AGGGTGTGTTTAGATTTAAACTTT	1
AGGGTGTGTTTAGTTCACGCTAA	1
AGGGTGTGTTTAGTTCACGCTAAA	1
AGGGTGTGTTTAGTTCACGTGAA	1
AGGGTGTGTTTGAGGAGAAGGGGA	1
AGGGTGTGTTTGATTTGGTTGACA	1
AGGGTGTGTTTGGTTCTCGGAAGG	1
AGGGTGTGTTTGGTTGCTCGCATC	1
AGGGTGTGTTTGGTTGGGCTGTGG	2
AGGGTGTGTTTGGTTGGGCTTTTC	2
AGGGTGTGTTTGGTTTCTCGTATG	1
AGGGTGTTACAATCTTGGTGATCA	1
AGGGTGTTATATGGGGTGTTCGG	1
AGGGTGTTATGTTTGGCTCTCTTT	1
AGGGTGTTCCTACTGCGCGCGCAC	1
AGGGTGTTCTATTACTTGCTTCAC	1
AGGGTGTTGACCTAGTCTGTAGGG	1
AGGGTGTTGAGGTTTGTGATGGCC	1
AGGGTGTTGCATAGGGTGTTCTGA	1
AGGGTGTTGCATGAAGTGTTCGGA	1
AGGGTGTTGCATGAGGTGTTCGGG	1
AGGGTGTTTAGATACGTTGTATCA	1
AGGGTGTTTCTGTTATATCCGGAC	2
AGGGTGTTTGGGACTTATGTTTCT	1
AGGGTGTTTGGGTGAGAGTCACT	1
AGGGTGTTTGGTAAGGGTGGGCAG	1
AGGGTGTTTGGTTGGTGGGCAAAG	1
AGGGTGTTTGGTTTGAGGACAGGT	3
AGGGTGTTTGTTGATGGCATTTC	2
AGGGTGTTTTTTGATGGCATGGCG	1
AGGGTGTTTTTTTACTAGGATGG	1
AGGGTGTTTTTTTACTAGGATGGC	9
AGGGTTAACCCGAGACTGATATGC	1
AGGGTTAACCTGAAAGTGATATGG	1
AGGGTTAATGAGGCGACAGAGAGC	1
AGGGTTACCAACCGGGAACAGTGC	1
AGGGTTACTAAAGCGCGGTTTGAG	2
AGGGTTACTGTGGATTTTGGCCGA	1
AGGGTTAGACCTGGTGTCCTGGAC	6
AGGGTTAGCCCGCGAGTGATATGG	2
AGGGTTAGTCACGATTGATGAGCC	1
AGGGTTATAGTCTTCGACTCAATC	1
AGGGTTATCCCGGTGTCAGGCGAA	1
AGGGTTATCCGGTTATGGTGTCTG	1
AGGGTTATGAATGGTTAAGAAGAG	1
AGGGTTATGATTGGATGAGTAGT	1
AGGGTTATTACCTAACAATTCAGG	1
AGGGTTATTACCTGACAATTCAGG	1
AGGGTTATTCTGTCTATCCGAACA	1
AGGGTTCAATGTGACAGGGTGTAA	1
AGGGTTCTGATTGGTTAGTAAGAG	1
AGGGTTGAACTACTGCTATATGGA	2
AGGGTTGAGATCTAGTTCTACTA	2
AGGGTTGAGGTACACCAATGTGTG	2
AGGGTTGATACTTGTGCTGTA	2
AGGGTTGCATGCGCCGATGGTTGA	1
AGGGTTGGCACCTGTGGTATC	1
AGGGTTGTCATTGGTTGGAAAGA	1
AGGGTTGTCCCCGGTGTCAAGAGA	1
AGGGTTGTGATTGGATGAGTAGT	2
AGGGTTGTGATTGGTTGAGAAGAC	1
AGGGTTGTGATTGGTTGGGAAGAC	1
AGGGTTGTGATTTGTTGGGAAGAG	1
AGGGTTGTGGCGATTTGGGACCTA	1
AGGGTTGTGTCGAGGAGTGACCT	4
AGGGTTGTTTGAGATCTGTGTGAC	1
AGGGTTGTTTGGGATCTGTGTG	2
AGGGTTGTTTGGGATCTGTGTGAC	3
AGGGTTTACAAAATATCTGGGTGA	1
AGGGTTTACATTACTGGTTGACCA	1
AGGGTTTAGAACCAGGACGTGCT	1
AGGGTTTAGGTCCGTCACAGGTGA	1
AGGGTTTATACAGATTCGGGCCA	1
AGGGTTTCCAAAATATGTGGGTGA	1
AGGGTTTCCGTAATATGTGGGTGA	1
AGGGTTTCTAAAATATGTGGATGA	2
AGGGTTTCTCAAACCGTCGGGCCA	1
AGGGTTTCTGAATTCTGATGCTAC	2
AGGGTTTGCAAAATATGTGGTTGA	2
AGGGTTTGCCGAAGGTGCGATGTC	1
AGGGTTTGCCTTGTTTTTTTGGGA	1
AGGGTTTGCCTTTTTTTTGGGACGG	1
AGGGTTTGCTGTTTTGTCAGGACC	1
AGGGTTTGTCTTTTTTTTGGACGG	1
AGGGTTTTGATCGGACGGCCGAGC	1
AGGGTTTTGGTGCATACAATCTGC	1
AGGGTTTTTCTACGTAAAATTCGT	1
AGGTAAAAAAATGTTTCATGTCTC	2
AGGTAAAACTGCTAATTACAAGTG	1
AGGTAAACAAAAGAGAAGGGTGTT	1
AGGTAAACCCTAACTACGAATCTG	6
AGGTAAACCCTAGATTGATTTTGC	1
AGGTAAACCCTGGGTTTCTGTGTC	1
AGGTAAACCCTGGTAAGTAGTGCTA	1
AGGTAAAGATGTCACATGTGTTGT	3
AGGTAAAGCCGTTGCCCACGTTGG	1
AGGTAAAGGGTATTGAAGGGGTA	3
AGGTAAAGTCCACCTACACCTAGC	1
AGGTAAAGTGTGGAGTCTGACTAC	1
AGGTAAAGTTGGGCCTTATGAGTGT	1
AGGTAAAGTTGTCAAAGATGTGCA	4
AGGTAAATTTTGGGACCATGGTTC	1
AGGTAACAAACTACACTGTTTGGA	1
AGGTAACATCCAATCCTAGGTGTA	2
AGGTAACCACGTATCTAGAGTGCC	1
AGGTAACCCGCGAGCCAACCCACG	1
AGGTAACCGTTTGGATGGAGCACA	1
AGGTAACCTCACCTGTGATGGACC	1
AGGTAACCTCTTATCTGCGATGGG	1
AGGTAAGAGACAGGTAAGCCATGG	1
AGGTAAGAGATTGGTGGGAATTGG	3
AGGTAAGATGGTAGAAGTTAGTTT	1
AGGTAAGCATGTCCTAAAAGATGG	1
AGGTAAGGCAAACTTGATAGGTGT	1
AGGTAAGTACTCATCTATGACGGA	1
AGGTAAGTTGGAGTTGGGAGCTGG	1
AGGTAATAAAATGTGGTCCAAAGC	1
AGGTAATAACCCTACATCCTGTT	4
AGGTAATAGGGTACACACACGTG	2
AGGTAATATTTATAGGTCCTATAT	2
AGGTAATGCACACGTTGGTAGCGA	1
AGGTAATGCAGCCGATGATGATGA	3
AGGTAATGGGCTAGACGACCTGGA	1
AGGTAATGTGCATGTTGGTCCTTC	1
AGGTAATTCTAATATATGTGGCTA	1
AGGTAATTGACGGTGCAAGGTATG	1
AGGTAATTTATGCAACTAAGGTAC	1
AGGTAATTTATTGAAATAACGTTC	1
AGGTAATTTGTCCGGTTCGCATAG	1
AGGTACAAACCTGCCATGGGATGC	2
AGGTACAAGATCGGAGAGAGTGCA	3
AGGTACAAGGTTGCTATATTTGAG	1
AGGTACAATAGGTTGTTTAAGCGG	1
AGGTACACCAAAAGTTGATACA	1
AGGTACACTGTCACAGGTTCAAGG	1
AGGTACAGAGTTGGTGGAAATGGT	1
AGGTACAGTTTTAGTAGAGGTGTT	1
AGGTACATTTTGTAGACCGTGTCA	2
AGGTACCAAATTTTACACTAGAAA	1
AGGTACCAATATAAACACGTGCAC	2
AGGTACCACATACCCATATGGCAT	2
AGGTACCACATATGTATCGGATGG	1
AGGTACCACATGATACCTTATGAG	1
AGGTACCACCTATGTAATGACACC	1
AGGTACCACGAGGTACTATGAGGT	1
AGGTACCAGGTCCTAGATATGGTA	2
AGGTACCAGGTTACTCCGTGATGA	1
AGGTACCATATAGCTGACCTAAA	1
AGGTACCGGATATATGATGATACC	1
AGGTACCGGTATACCTCACAGTAC	1
AGGTACCGTGATAGAAATAGCTAT	1
AGGTACCTATAAGGGTAGGGTGTA	1
AGGTACCTGCATAATTCTGACTTA	1
AGGTACGTCGCCTACTACTTAAA	2
AGGTACTACAAAGGATGGTCTCAAC	1
AGGTACTACAGATGACCGACCTGC	1
AGGTACTACGCTATCCAAAATGAA	1
AGGTACTACGTTCGGATGCTCTGA	1
AGGTACTACTGGATTTGTGGTCCG	5
AGGTACTAGACTAGTATTAGGTGT	1
AGGTACTAGCCTGGTACCAGGTACC	1
AGGTACTATACTATTTGATGTTGG	1
AGGTACTATCCGTCGGAATCGGAA	1
AGGTACTATGAGGTGTAATGAGG	2
AGGTACTATGAGGTGTAATGAGGT	6
AGGTACTCATAGGGGTAGAGTGTG	1
AGGTACTCATAGGGTATAGTGTGC	2
AGGTACTCATCTTCTAATGGAGGC	1
AGGTACTCTAATCCACAGTGCGTAT	1
AGGTACTCTTGGTGCTCATGCTGC	1
AGGTACTCTTTGTTATGGACCCAC	6
AGGTACTGATAAGGGTGAGGTGCT	1
AGGTACTGATTTTAGAACCGGCGC	2
AGGTACTGCTGGAATTGGGTCTGG	1
AGGTACTGCTGGATATGTGGTCCG	1
AGGTACTGCTTCAATACAAGGTCC	1
AGGTACTGTGGAATTGGGGCTTCA	1
AGGTACTGTGTAAGGTTAGCTCTA	1
AGGTACTGTTCAGGCCTAGGCCCA	2
AGGTACTTATACCACTGGGAGTGT	2
AGGTACTTTAAACATGAACATGA	1
AGGTACTTTTTGTTGAACCAGAGC	1
AGGTAGAAATGGTGTATGTGGTAT	2
AGGTAGAACTAAATGATGGAGGAT	2
AGGTAGAAGTGAGTGGTGTATGG	2
AGGTAGACTCGTGCCATGTGGTAA	1
AGGTAGACTGTTGGTGATGCTCTC	1
AGGTAGACTGTTGGTGATGCTCTT	1
AGGTAGAGAACAACACCGGTGCTG	1
AGGTAGAGAAGAGAGATGATGTAT	1
AGGTAGAGACGGTGCATGTGGTATC	1
AGGTAGAGCTGAAACTGTTTGGCT	1
AGGTAGAGTATGGGACGGGGGTGT	1
AGGTAGAGTGATTGAGATACTGAA	2
AGGTAGAGTGTCTGATAGTGAAGA	1
AGGTAGAGTTTTAGCAGAGGTGTT	1
AGGTAGATACCAAAGTTTGATGGA	14
AGGTAGATCAATTTGAAATGGAGG	3
AGGTAGATCGTGTTGTTGTGGGCT	1
AGGTAGATCTATGGGGTGGCTCAG	1
AGGTAGATGCCACTGAACGAACAC	1
AGGTAGCAAAGTTGGTCCCTGCAA	1
AGGTAGCAACATTTTGGGACAGAG	1
AGGTAGCACATGTCAACTAAAGGG	1
AGGTAGCATCTCGGAAACCGTGTC	1
AGGTAGCATCTTCACGATTGCCTC	1
AGGTAGCCAAAAACCTCTGGGTGT	2
AGGTAGCCAAACGCTGGGCTGCGG	2
AGGTAGCCAAGGTGTATAATCAGA	1
AGGTAGCCAATATATATTTAGAGG	1
AGGTAGCCAATATTTGTGCACGGC	2
AGGTAGCCATGCCTGTAGAATTGG	1
AGGTAGCCCCGTTTATGTGTGTAG	2
AGGTAGCCGATGTTCAACAATTGA	1
AGGTAGCCGATTAGGTTAAATACC	1
AGGTAGCCTTTAATTAAGAGTGAT	1
AGGTAGCGGCTCGATAGTGAGTAG	1
AGGTAGCGTAGAGGCGGGGGTGGA	1
AGGTAGCGTCTGTATGCACCCAGA	2
AGGTAGCTACATTTTGGGACGGA	1
AGGTAGCTCCCTGTATACATGGTA	1
AGGTAGCTTATGTGGTCCGCCTGCA	1
AGGTAGCTTTATGGGTATTAAAGC	1
AGGTAGGAAAAGGCCTATGGGTAC	4
AGGTAGGATATGCGCCGACATGTT	1
AGGTAGGCCGCTAATGGTGACAGC	2
AGGTAGGCGAAGCCACTAGTTTACTTGC	1
AGGTAGGCTGAGAGAAGGCTACAA	1
AGGTAGGCTGAGAGAATGGTGCAA	1
AGGTAGGGGGTTTGGTGCTAAAAG	1
AGGTAGGGGTGCAAGTGGATACTA	1
AGGTAGGTACAGGGTATTGAAGGA	2
AGGTAGGTCCCGATTTTCCGA	2
AGGTAGGTCGCTGACATGTGAACC	1
AGGTAGGTGAGAAAAATGAATGGT	1
AGGTAGGTGATAAAATTGAATGAT	2
AGGTAGGTGGAAAAATTGAATGGT	1
AGGTAGGTGGCCTCACACGAAGA	1
AGGTAGGTGGGAAAAATGAATGGT	1
AGGTAGGTGGGAAAAGTGAATGGT	1
AGGTAGGTGGGAAAATTGAATGGT	2
AGGTAGGTGGGAAATTGAATGGT	1
AGGTAGTAAACATTGGTGATGCCC	1
AGGTAGTAAGGGTCAAATCACTAC	1
AGGTAGTACCGCCCAAGATGCCTC	1
AGGTAGTACCTATCACTAAAGCGT	1
AGGTAGTAGCTAGTATATGTGCGT	3
AGGTAGTAGGGTGGATCCAACGTG	2
AGGTAGTGACGTTTGACCGGTTGT	1
AGGTAGTGATCTTTTTGCGCGTGG	3
AGGTAGTGCTGGTCGGTGACAGA	2
AGGTAGTGGGCTAGATGACCTGAG	1
AGGTAGTGGTGGTGGTACTCTC	2
AGGTAGTGTTTGAGAACTTCTGCT	2
AGGTAGTGTTTGGTTTGGGGACGA	1
AGGTAGTTAATTTTCGGTGTTTGC	1
AGGTAGTTATGACGGTTGTGGAAG	1
AGGTAGTTGTGATGAATTGGCTTA	1
AGGTAGTTTTGTATGGATACTAGC	1
AGGTATAAATTGAAGGAGGGTGAG	1
AGGTATAAGACTTTTTAGCATTGC	1
AGGTATAATGGGTATTGAAGGAAT	1
AGGTATACAAGGTGTGAACGTCC	1
AGGTATACCGCGTAATATAGGACA	1
AGGTATATAGGTTAGGTGAATGCA	2
AGGTATATCTGCGAGCTGGAAAAC	1
AGGTATATCTTGTAGAGCGTGTCA	1
AGGTATATGGGCAGTCTGACCGG	1
AGGTATCAATAATGTGTTTATTTA	1
AGGTATCACAAGTATCAGGTACCA	1
AGGTATCACATGTACCAAGTGCCA	1
AGGTATCATTTGGCGGTTTAGGGA	1
AGGTATCCCTATGCATATGGACT	1
AGGTATCGGTTGGTACCTGGTACC	1
AGGTATCTAGTCAGACGGGTTCCA	5
AGGTATGAGGTGTATGAGGTGTA	1
AGGTATGCCAGCCCAGTTTTCGGA	2
AGGTATGCGTGATCGGATCGAGGT	1
AGGTATGCTCTACACATCAGATTG	1
AGGTATGGGGTACCCATAATCTCC	1
AGGTATGGGGTACCTATAGATGGC	1
AGGTATGGGTAACACTACGTATGC	1
AGGTATGGGTTCTTGGATTGTGAA	1
AGGTATGGTCTCTACGTTAATTAA	1
AGGTATGGTCTCTAGTATAGGTAA	1
AGGTATGTCCAGATTCATTGTA	1
AGGTATGTCCAGATTTGTGTACTA	1
AGGTATGTGGCTACCTGGGGTGTT	1
AGGTATGTGGGAAAAGTGAATGGT	1
AGGTATTAAAAGGGTGGGCTGGAA	1
AGGTATTAAATGAAGAGAGAGAGC	2
AGGTATTAGGTCCTAGGTATCACA	1
AGGTATTAGTCGATACCGGGGTAC	2
AGGTATTCAAACGTTCGATGTGAC	2
AGGTATTCAAACGTTTGATGTGAC	1
AGGTATTCAAATGTTCGATGTGAC	2
AGGTATTCAAGGAATGTCAATGGT	1
AGGTATTGCCGTCCTCTTTGTTGG	1
AGGTATTGGCGTGCCTCAATC	1
AGGTATTGTGTGCGTATGGGATGC	2
AGGTATTTAAACGTTCGATGTGAC	1
AGGTATTTAATTACCAGTGATTGC	2
AGGTATTTCTTCTACAACATACAG	1
AGGTATTTTGGGTGGATATTATAC	1
AGGTCAAACATATGAGAAAAGGTC	1
AGGTCAAACGTTAAGCACGGATAT	1
AGGTCAAATTGGCCACGTAGGCGC	6
AGGTCAACACGGCTACGTAGGCGC	1
AGGTCAACACTATAGGTGCCATAC	1
AGGTCAACCCTACCATGTGAGCGC	1
AGGTCAACCCTGCCACGTCAGCAT	1
AGGTCAACGGTGCCAAATATTTTG	1
AGGTCAACTTCGGTCAATGGTGGG	2
AGGTCAACTTCGGTTAACGGTGGG	1
AGGTCAAGGTAGCCAAACGCTGGG	2
AGGTCAAGGTAGCCAAACGCTGGGC	1
AGGTCAAGTTTAACAAATGATGCT	1
AGGTCACAAATTGGGGTTCCACAG	1
AGGTCACACTACCCACAGTGAAAA	1
AGGTCACAGACTGATTGCCGCATACA	2
AGGTCACAGATACGAAACGAGGG	1
AGGTCACATTATGGAGATTATGGG	2
AGGTCACCACCATGGACATGTTGC	1
AGGTCACTGACGTGTGGGTGGGTC	2
AGGTCACTGATTGAGAAACAAGCA	1
AGGTCACTGCAACCACTAGTCTGC	1
AGGTCACTGTAACCACTGGACTGC	1
AGGTCACTTGTGGTGGGTCTCAGC	1
AGGTCAGAGTTGTTGATGGAGGAC	1
AGGTCAGCCTTAGTCAATGGTGAG	1
AGGTCAGCCTTGGTCAATGGTGAG	5
AGGTCAGGAGAGAAATCGCGTGAA	1
AGGTCAGGCATACCTCACAGGAAG	1
AGGTCAGGTCGGCTCAGTGATGG	1
AGGTCAGTTTGTGTCTATTGTTGG	1
AGGTCATACCAATCTTAAGGTGTA	1
AGGTCATCACGGATGTGGAGGGGA	1
AGGTCATCAGTGACGGGTCTGTAC	1
AGGTCATCTGCACGTGATGGTTT	1
AGGTCATCTGTGATGGGCCCAAAC	1
AGGTCATCTGTGATGGGCTATAGT	1
AGGTCATGAAGGGAGGTGTTGTGG	1
AGGTCCAAAAGTTGTTGAGATGCG	1
AGGTCCAAACGAGTTCTAACCCGT	2
AGGTCCAAAGGTTGATGAGATAC	1
AGGTCCAAGCCTACTTAGGGAGGG	1
AGGTCCACATGTGTCTATGACATG	2
AGGTCCACCAAAACTTGATGACGC	1
AGGTCCACGAACTTACGAAGCGCA	1
AGGTCCACGAACTTGCAAAGCGCA	4
AGGTCCACGAACTTGCAAAGTGCA	1
AGGTCCACGAACTTGTAAAGCGCA	1
AGGTCCAGACGGTCAAGGATACCG	1
AGGTCCAGGACCTAAAATTGTGGC	1
AGGTCCAGGACCTAAAGTTGTGAC	2
AGGTCCAGGCCTAGTGGTGGAGGG	1
AGGTCCAGGGCATACAGCCATACA	1
AGGTCCATCCCGTTTCACAATGGG	1
AGGTCCCAAGGCGGTTTGGATGAC	1
AGGTCCCTCGGAGATTTGGAAGAC	1
AGGTCCCTCGGTAGTATTGTGGCC	1
AGGTCCCTTGACAGTATTGTGCCC	1
AGGTCCGCACGCGAAAATAAGATG	1
AGGTCCGCACGCGAAAATAAGTGG	1
AGGTCCGCCCCTCTATTTAAGAGA	1
AGGTCCGCCTGCGAAAATAGCTTC	1
AGGTCCGGATATGATATATTCTAG	2
AGGTCCGTTTGAAGTCAGTGCTGT	1
AGGTCCTAAGACTATAAGTGGGTC	2
AGGTCCTAAGTATCACAGGTACCG	1
AGGTCCTACATGTCATTGAGATACC	1
AGGTCCTCCAACTTATTCAGTTGT	1
AGGTCCTCCAACTTGTTCAGTTGT	1
AGGTCCTGAGCCTACACAGCCCAA	1
AGGTCCTGCGAGATTTAGTCAACT	1
AGGTCCTTTGATGGTTTTGACCCC	1
AGGTCGAACACGATTCTTGTTGGG	1
AGGTCGACGTTGGCAAGGCCGTGC	1
AGGTCGAGTTTGTCTAAGGTTCAC	3
AGGTCGATGGCGAAGCTAGGTCGG	8
AGGTCGATGGTACTGGTGGTTGCA	1
AGGTCGCCATGTCTATGAACTGCA	2
AGGTCGCCCTCACCACCTGTTTC	1
AGGTCGCCGCTGTTGTCGGTGTC	1
AGGTCGCCTGCTCTGATACTATGT	1
AGGTCGCGAGGAGGAGGAAGAGGG	1
AGGTCGCTATCTTTAGGTGGTGTT	1
AGGTCGCTGATGTCGAGGAGCGTC	1
AGGTCGCTTGTTTATGTTGGCTTC	1
AGGTCGGAACGAACTGCCTTAAGG	4
AGGTCGGATAGTCCTATGTGATCA	1
AGGTCGGTGGTGTCGGTCTTACA	1
AGGTCGGTGTCGCTGCTGTTGCTC	1
AGGTCGGTGTTGTCTACTTTGATC	1
AGGTCGTCGATGCAGAGTGATCGG	2
AGGTCGTCTAACTTTGAAACT	2
AGGTCGTCTCTGCTGTTAGATCTG	3
AGGTCGTCTGATCTGCCTCTCCCC	1
AGGTCGTTGGATTGAAATATGCCT	1
AGGTCTACAGCCAGTGTGCCTCGA	1
AGGTCTAGAATTGTCCTTGGGTCC	1
AGGTCTAGCTACGGGTGCTGTCGC	1
AGGTCTAGTCTATTACAAGATCTAA	1
AGGTCTATAAATTGAACTGACAAA	1
AGGTCTCAATGTGCAGTACATCCC	1
AGGTCTCCAAGTGCTGGAATCCGA	1
AGGTCTGACGGTGACTGGTCTAAC	1
AGGTCTGATACCTAGGTACCATGC	1
AGGTCTGATCTCCTGTCTTAGCCG	1
AGGTCTGCCAGCGAAAACAAAGG	1
AGGTCTGGAATTTGGAAAGTTTCT	1
AGGTCTGGAGAGCCTACGACACCC	1
AGGTCTGGAGTGAAGTTGTGGAGC	1
AGGTCTGTAAGGAATACCGGTGCT	1
AGGTCTGTTAGGGAAGCTTCCGGC	1
AGGTCTGTTTAGTTGAAGGACAAG	1
AGGTCTGTTTGAAGTTGATGTTAT	1
AGGTCTTATAAGGACTAAGGTGAG	1
AGGTCTTCTGGCTGATGATTTGGG	1
AGGTCTTGGTGGCGGAGGACCGCCC	1
AGGTGAAAAATAATGGTTGTGAAG	1
AGGTGAAAACCATGTCCTGCACCC	1
AGGTGAAAAGTTTTAACGTGTCAC	1
AGGTGAAAATTGCCAAAGTTTGGA	1
AGGTGAAACATCTTTTGTGGAAAA	1
AGGTGAAACATTTTTCGGTGGAAC	1
AGGTGAAACATTTTTGATGGAATA	1
AGGTGAAACATTTTTTATGGAAAA	1
AGGTGAAACCTACGGTGGGTATGC	1
AGGTGAAACGGTTGATTTTCGACC	2
AGGTGAAACTAAAACTGTTTGGCTA	1
AGGTGAAACTCTACAAAACGGACC	1
AGGTGAAACTTGGAGGACTACTTT	3
AGGTGAAAGAAACTACGTAATTGA	1
AGGTGAAAGCTGTGTTCTGGTTTCC	1
AGGTGAAATAAATAAGTTAGACCA	2
AGGTGAAATATGCTTACAAGTTTA	2
AGGTGAAATCTGCTTACAAGTTTA	1
AGGTGAACCACTTAAGAGTTCTGC	1
AGGTGAACCATATATTTATAATGA	1
AGGTGAACCCGAGAGCGGTGGAGC	2
AGGTGAACCTGCGGAAGGATCATTG	1
AGGTGAACGATGACTGGTTTTCGG	1
AGGTGAACGGTCAAACATGGTTAA	1
AGGTGAACGGTCAAACATGTGCTA	1
AGGTGAACTCCTTTTGCGCATGGT	1
AGGTGAACTGCATATTTGTCGAC	2
AGGTGAACTGCATATTTGTCGACA	4
AGGTGAACTGCTCGATGCATCGGC	1
AGGTGAACTTATCGTTGGTGCAAT	3
AGGTGAACTTTCATGCATACATAG	2
AGGTGAAGAAGCGGACCTGCACGC	1
AGGTGAAGACGACTTAGGGCGTCA	2
AGGTGAAGACTCGCTCTGATGG	2
AGGTGAAGATGGAACTGTTTTCGT	1
AGGTGAAGATGTGACTCCTCCTTA	1
AGGTGAAGCCGATGGTGTTCTTTC	1
AGGTGAAGCTGAAACTGTTTGGCT	5
AGGTGAAGCTGAAACTGTTTGGTT	2
AGGTGAAGGACTGGGTGCTAGAGC	1
AGGTGAAGGCCTCCCGGCTTGGTGG	2
AGGTGAAGGGCTCAGTTTGTACCG	1
AGGTGAAGGGCTTTAGGTTAGACC	1
AGGTGAAGGGGCTACAACGGTCGT	1
AGGTGAAGGTAACATGCCATGTAC	1
AGGTGAAGTCGTCCTCTTTCAAGG	1
AGGTGAAGTGCTACATCGGTATAT	2
AGGTGAAGTTACCTGTGACGGATG	1
AGGTGAAGTTGAAACTGTTTTGAT	1
AGGTGAAGTTTAGTCCCGGTTGGT	1
AGGTGAATATAGACATTGTCTATA	1
AGGTGAATCCATTTATCGATAGTG	1
AGGTGAATCTGTTGGTAGTGGCTA	1
AGGTGAATGCACACGGCTAACGAT	2
AGGTGAATGCAGATGCAGCCATGC	1
AGGTGAATGCTTGATGAGGACTAG	1
AGGTGAATGGTGGAGGATTATGAT	1
AGGTGAATGGTTAAACGTCATTTT	1
AGGTGAATGTGATATATGGTAGGA	1
AGGTGAATTCTGACGAGGCGA	1
AGGTGAATTTATCCCCGGGGCGG	1
AGGTGACAAAAAACATTGACGAAA	1
AGGTGACAACTGTAGCAGCATATA	2
AGGTGACAAGCGGTTGTCTGCAAAA	1
AGGTGACAAGGGCCTAGCTCTGAT	2
AGGTGACAAGGTCCTGGTGTCTTA	1
AGGTGACAAGTGAATAAATGAGGA	1
AGGTGACAATAGGTGAAGGTCGC	2
AGGTGACACAACTGAACAAGTTGG	2
AGGTGACACAGTGTGCTTAGGGAA	1
AGGTGACACCAACGACTTTCGGTA	1
AGGTGACACCGACGATTTTCGGTA	1
AGGTGACACCTTGCCGGCGGCAGC	3
AGGTGACACGCGAAAACTTTTGCG	2
AGGTGACACGTAGGATAAAGAG	1
AGGTGACACGTGACAACATGATAG	1
AGGTGACACTTCAGTACAACGAAC	1
AGGTGACAGCTTATTTAATGCTAT	1
AGGTGACAGGCCGACGAGGTCG	1
AGGTGACAGTCGGTGATGGCGGA	5
AGGTGACAGTTTATTTAATGCTAT	1
AGGTGACATATTGTATGGGTTGCC	1
AGGTGACATCATCTGTGACGGCCC	1
AGGTGACATGCAAGAAACGGATGG	3
AGGTGACATGCAAGAAACGGGTGG	1
AGGTGACATGCACGAAACGAGGGG	3
AGGTGACATGCGAGAAATAAAGGA	1
AGGTGACATGCTCGAAACAAGAGG	1
AGGTGACATGGTATCTACACTCCA	1
AGGTGACATGTAAGAAACGGGTGA	1
AGGTGACATGTAAGAAACGGGTGG	9
AGGTGACATGTACGAAACAAGTGA	5
AGGTGACATTATGATGGGCTACCC	1
AGGTGACATTGATATATATGTAGA	1
AGGTGACCCAATTTATCCACCTGG	1
AGGTGACCCACGGTTGGTGGGCTA	5
AGGTGACCCTCATCACTGATCAGC	1
AGGTGACCGACCGGGAAGTTTGAA	1
AGGTGACCGAGTAAAGATGGTTTC	3
AGGTGACCGAGTAGGCGGCTGGGCCA	1
AGGTGACCGATAATTAATATGCGT	1
AGGTGACCGATCGGGAAATTGTTC	1
AGGTGACCGCATGCGAAATTCCGG	2
AGGTGACCGCTAATTAATATGCG	1
AGGTGACCGGTAGGTCGATGTGGC	1
AGGTGACCGGTATTGTATTGTTA	1
AGGTGACCGGTATTGTATTGTTAA	3
AGGTGACCGGTTTTGTATAGTTAA	3
AGGTGACCGTCTATGAAAATTCGA	1
AGGTGACCTAGGTGTGAGGAGGAG	1
AGGTGACCTGGGGACGAAATCCAT	1
AGGTGACCTGTTGGGGGTTTTGGA	1
AGGTGACCTGTTTTATACAGTTAA	1
AGGTGACGAAGTTGGATACGAGAT	1
AGGTGACGACTGGGTGGTCTGG	1
AGGTGACGACTGGGTGGTCTGGTT	1
AGGTGACGAGCTAAAAGATCG	1
AGGTGACGATCTGGAGGATTAGGC	1
AGGTGACGCACTATGAATGCCGTA	2
AGGTGACGCATTTAGCGGCTCGCA	1
AGGTGACGCCATGTGTGCCTTCAT	1
AGGTGACGCCGTTCGCTGGTCCCA	1
AGGTGACGGCACAAGATCTAGCGG	1
AGGTGACGGGACGACGATGGCAAC	1
AGGTGACGGTGATTCCGTTCTGTC	1
AGGTGACGTACCCAGTCTTTCGGG	1
AGGTGACGTACCGTCGATAACGAG	1
AGGTGACGTACGAAAGTTTCTGGT	1
AGGTGACGTACGAAATTTATCGGG	1
AGGTGACGTATATGTTGACAGCGA	1
AGGTGACGTGGATGAATTTTGGA	4
AGGTGACGTGGGTTTGACCGCTTG	1
AGGTGACGTTTCCGTTGATAGCGA	2
AGGTGACTAGCATGAATTGTTGCA	2
AGGTGACTAGTTACCTATGACGGG	1
AGGTGACTATAGGGATGGACATAA	1
AGGTGACTCACCTGTGATGTGTAG	7
AGGTGACTCGATGCCTCGAGAGAG	1
AGGTGACTCTAAACTTTTTTGTGG	1
AGGTGACTGACCTCACAGTGCA	1
AGGTGACTGACCTCACAGTGCAGC	1
AGGTGACTGATTGGGCTTACTACC	1
AGGTGACTGGAGATAGGATTCTTG	1
AGGTGACTGGCGGTGATACTCCGG	1
AGGTGACTGTAATTTGGGACGGAG	1
AGGTGACTGTATGCGGTTGCGCTG	1
AGGTGACTGTGATAATCATATTGG	1
AGGTGACTGTGGTGACTTTATCGA	1
AGGTGACTGTTTGAATTTGACTAA	2
AGGTGACTTAATTTCTCCTTGGTC	1
AGGTGACTTCTCCGAGGGAGGTGG	1
AGGTGACTTGAGATCAGCCTTGGT	1
AGGTGACTTGAGGTCAGCCTTGGT	2
AGGTGACTTGAGGTCAGCCTTGGTC	1
AGGTGACTTGAGGTCAGTCTTGGT	1
AGGTGACTTGAGGTCAGTCTTGGTC	1
AGGTGACTTGGAGAATTCCTCCCA	1
AGGTGAGAAAAATGAACGGTGGAG	3
AGGTGAGAAAAATGAATGGTGGAG	1
AGGTGAGAAAATTAAATGGTGAAG	1
AGGTGAGAAATTTGGGATTATACC	1
AGGTGAGAACAAAACAATGTT	4
AGGTGAGAACGAATGACTC	1
AGGTGAGAATTTATCTGGTTGAA	1
AGGTGAGAATTTATCTGGTTGAAA	3
AGGTGAGACACTTGTGACGGGTCC	1
AGGTGAGACATGTATGTCGCTGCC	1
AGGTGAGACCAACCCGACGATGGC	1
AGGTGAGACCAGATATTAATGGT	1
AGGTGAGACCATATATTAATAGT	5
AGGTGAGACCATATATTAATGTT	1
AGGTGAGACCATGTATTAATAGTG	2
AGGTGAGACCCACATGCAGATGAG	1
AGGTGAGACCGAGTATTAATGGT	1
AGGTGAGACCTACATACCAGTGAC	4
AGGTGAGACGGCATGGAAAACCGC	1
AGGTGAGACTATATTAAAGGTGTA	2
AGGTGAGAGAAGAGCAACGGGCTA	1
AGGTGAGAGAGAAGATGGAACCGC	1
AGGTGAGAGAGATGGAGAGGATAA	1
AGGTGAGAGATTTCGAAATGATGG	1
AGGTGAGAGGGTCCAACTGGCAGC	1
AGGTGAGATAATACCAGTGACGGG	1
AGGTGAGATCAGGTATTAGTA	1
AGGTGAGATCTAAACAGGCCATGA	1
AGGTGAGATCTAAACAGGGCCATA	1
AGGTGAGATGATACCAGTGACGGG	2
AGGTGAGATGGGACAAACCCCCAA	2
AGGTGAGATGGGACAAATCCCCAA	2
AGGTGAGATGGGGAGTGCGCTCCA	1
AGGTGAGCAAGTGAGCAACAC	1
AGGTGAGCATATGACATACTTAGC	1
AGGTGAGCATTTACATGTGAGATG	1
AGGTGAGCCCGTCAGACGTTTCGG	2
AGGTGAGCCTCGGTCTTGCGCGAC	1
AGGTGAGCGACATGGAACTCTGCT	1
AGGTGAGCTATCTGAGAAGATTCC	2
AGGTGAGCTATGTCTGGTTTCTGA	1
AGGTGAGCTGAAGACAGTAGTGTC	7
AGGTGAGCTGCCTGTGAGAGTGGA	1
AGGTGAGCTTGCCATCTGTGTATC	1
AGGTGAGGAAACTGGTAGGTGCTA	1
AGGTGAGGACAAGAGATATGTGGT	1
AGGTGAGGAGACAGAAATCACGACC	2
AGGTGAGGCATACGGTGAGTACCG	5
AGGTGAGGCCCACTGAAAAGTGTC	1
AGGTGAGGGCTAAACATTAGCC	1
AGGTGAGGGCTAAATATTAGCCCATG	1
AGGTGAGGGGATACTTGTGACGGG	1
AGGTGAGGGGTTTATATAGCACCC	4
AGGTGAGGGTGATAGAACAACAAT	1
AGGTGAGGTCATATTTATAGTTGA	2
AGGTGAGGTCATCAGGCACGGGAG	1
AGGTGAGGTGAGGGCAATCTGCCA	1
AGGTGAGGTGATAAGGGCAGCTCC	1
AGGTGAGGTGCTATTGCTGCATGC	1
AGGTGAGGTTAAGTCATCACTGAC	3
AGGTGAGTAGACTAGTGGTGAT	1
AGGTGAGTAGTTCAGGAATTGAAC	1
AGGTGAGTCATTAGCGTATGATTA	1
AGGTGAGTCCATGTAAGATGACA	1
AGGTGAGTCCATGTAAGATGACAA	2
AGGTGAGTGAGGGTTTGCCGATGG	2
AGGTGAGTGCATATCGGCAACGCA	2
AGGTGAGTGCTAATAATTAGCCCA	1
AGGTGAGTGCTTCTCAAACGACATG	2
AGGTGAGTGTAAGTGTATTGTGAG	1
AGGTGAGTGTGAGTACATTGTAAG	1
AGGTGAGTTATCAGGTTTAGGTAG	1
AGGTGAGTTCGGATGGCCCTTTTC	1
AGGTGAGTTTATTCTTGAGTGCATG	1
AGGTGATAAAAGTGAAAGGTGCAG	1
AGGTGATACAAGGCTGCAGCTCAA	1
AGGTGATACATGTGACGGGCCA	1
AGGTGATACATTGTATGAGCTGCC	1
AGGTGATACCCCGCGTTTTACTT	1
AGGTGATACCTCGATGGTACCAGG	1
AGGTGATACTGACCAATTATGTGA	1
AGGTGATACTTGCGAAATATCAGG	1
AGGTGATAGACGATCTGGGTTCGA	2
AGGTGATAGAGTGAAAGTCGGACT	1
AGGTGATAGATGGTTGGATGCAGC	2
AGGTGATAGCTTATTTAATGCTAT	1
AGGTGATATAATTATTCTGAGAAC	2
AGGTGATATAGCGTAGATCTCAGC	1
AGGTGATATATTGTATGAGTTAAC	1
AGGTGATATCCCGATTGTACGATC	1
AGGTGATATCGCCTCGAGGGATGA	1
AGGTGATATCTCCTAGAATAC	2
AGGTGATATGGCACTTAGGTGTAG	1
AGGTGATATGTGTAAGTGGGTCCG	1
AGGTGATCAAATATTTGATGTGAC	1
AGGTGATCAAATTGTTAGCCATAA	2
AGGTGATCAACCACCAAAGTTGGG	2
AGGTGATCACTTTGATCCTGTCCA	1
AGGTGATCCTAAGGCCATGTATAG	1
AGGTGATCCTGTTGATAAGGAAGC	1
AGGTGATCTACCTGTGATGGCCCC	1
AGGTGATGAACAGGGTTTACTGTT	1
AGGTGATGAACTAGACAACCTAGG	2
AGGTGATGACATGGGCCCGTCAAT	1
AGGTGATGACGATGGCGAACTATA	1
AGGTGATGACGGGCAATGATAGAA	9
AGGTGATGAGGAAGCATATCGGATG	1
AGGTGATGAGGATTTTTGGAGGCA	2
AGGTGATGAGGTGGAGGAGAGAAG	1
AGGTGATGATATATAATGGAAGT	1
AGGTGATGATGCAAGTCAGGAGG	2
AGGTGATGCATTGATTGTATGGGT	1
AGGTGATGCCAGGTGCCACCGCAG	1
AGGTGATGCTCTAAGATATGTCAA	1
AGGTGATGGACTAGATGATTTGGA	1
AGGTGATGGCTTGAAGGAAATTGG	1
AGGTGATGGGATGGTTAATATATA	1
AGGTGATGGGCTAGACGATCTGAG	2
AGGTGATGGGCTAGACGTCCTGAG	2
AGGTGATGGGCTAGGTGACCTGAA	2
AGGTGATGGGCTAGTTGGTTTGG	1
AGGTGATGGGTAGCGCCTTGTGAG	1
AGGTGATGGGTTAGCTAGTCTGGG	1
AGGTGATGGTGATGGTATCAATTG	1
AGGTGATGTACCTGTCGATAACGA	2
AGGTGATGTACTAGTTGTCCTAGA	1
AGGTGATGTGACCATGGCTACTAC	1
AGGTGATGTGACTGAAAAGTTGTG	2
AGGTGATGTGGCGCTGAGGTGTCT	1
AGGTGATGTGTTTTCTCACAAGAG	1
AGGTGATTACTAGGGTAAACCGTC	1
AGGTGATTAGATGATATACTGTAT	1
AGGTGATTCTTATTCTGTGATGAA	1
AGGTGATTGTAGAAGATCCTCGCA	1
AGGTGATTTAATTTCTCTCTGGTC	1
AGGTGATTTCACCAGTACGATTGG	1
AGGTGATTTCACCTGTAGGATTGC	1
AGGTGATTTGTTGCAACGGAGTAT	1
AGGTGATTTGTTGCAATGGAGTT	1
AGGTGATTTTATGTAGATGTGAAG	1
AGGTGATTTTGGCTGATGTGGCGA	2
AGGTGATTTTGGGGATTCCATCTC	3
AGGTGATTTTGGTACCTCATGGTA	2
AGGTGCAAACGGTGCATGTGGTAT	1
AGGTGCAAAGACCGTTGTGAC	1
AGGTGCAAATGGTGGTCTGGCACA	1
AGGTGCAACGACCAGTCTATTACA	1
AGGTGCAACTGGTCGGTGCATGCA	1
AGGTGCAAGATTCAATTGTCTAGG	1
AGGTGCAAGCCAAGTTTTGGTCAA	2
AGGTGCAAGCGTTTACAATCCCAA	1
AGGTGCAAGGCAAAGAGGAGACTC	1
AGGTGCAAGGGGGGCTGCCCACTG	1
AGGTGCAATCTCATGTAGTTTGTC	1
AGGTGCAATTATTATTTTGATGTT	1
AGGTGCACCTATGGTATTCGGTAT	1
AGGTGCACGTGTGTATATGGGCCT	1
AGGTGCACTGACAAACTGACTA	1
AGGTGCACTGCTTTGAGTTGAGCT	2
AGGTGCACTGGCGCTGAGTTTGGA	1
AGGTGCAGAACGTTCAAACGTTAA	1
AGGTGCAGACGGGCAAGACCTCCG	1
AGGTGCAGAGGGTATAATCGTCAA	1
AGGTGCAGAGTTTGAATGGTACCT	1
AGGTGCAGATGTCGGTGACGGCAGG	1
AGGTGCAGGCAAGAAGCCACTATA	1
AGGTGCAGGGTTAATTATGGAATA	1
AGGTGCAGGGTTTACCAAACCGTT	2
AGGTGCAGTACCATGAGGTACGGA	3
AGGTGCAGTAGCCGTGTCCACGAG	1
AGGTGCAGTAGCGAGTTACATCTT	1
AGGTGCAGTCATAACTGCGGCTG	1
AGGTGCAGTCCGAAACTGGCT	1
AGGTGCAGTGCGTACAACAGCTAA	1
AGGTGCATAAACTTTAGATGTGAA	1
AGGTGCATAAATTTACTAAAATAG	1
AGGTGCATAAATTTATTAAAATAG	1
AGGTGCATAGAGCCTAAGTCAACA	2
AGGTGCATCAGGAGATTGGCA	1
AGGTGCATCGCTGTCAACGGGTAC	1
AGGTGCATGATGTGTTGTGTGTTC	1
AGGTGCATTATTCCGTTGGCTGAC	1
AGGTGCATTGCGAGGGAATCGCCA	1
AGGTGCATTGGTGAGTTCAAAAGA	1
AGGTGCCGGTTTTTAGTATGCCGG	1
AGGTGCGAACCGGTCAGACCGGGC	1
AGGTGCGACCATATATTGTGTGAA	2
AGGTGCGACGTGGGATTATGGCTG	1
AGGTGCGAGCATCAGTTACGCGAG	1
AGGTGCGAGCCAGGTGCATACCGG	1
AGGTGCGATGGTTTGATTGGGTCG	2
AGGTGCGCACATGGGGAGAGGGAC	1
AGGTGCGCTTAGAGTTATACCATG	1
AGGTGCGCTTATGGGATCTTTTTC	1
AGGTGCGGCATTCTATGGGATGGA	2
AGGTGCGGCCTTCCCGCAGTGGCC	1
AGGTGCGGTGGAGCTTAGCAATAA	4
AGGTGCGGTTGCCTTAATCCACCA	1
AGGTGCGTGGTGTGGCCATGAACC	1
AGGTGCTAAATTTATGATTTTAG	1
AGGTGCTAATACCCGCCTTGGGCC	1
AGGTGCTAATGGGACTAATTTTGT	2
AGGTGCTAATTGGGGCTATTTCGG	1
AGGTGCTAGCAACAACTGTGCACA	2
AGGTGCTAGGTAAGATGCCGTGAC	1
AGGTGCTAGGTATCACAGGTACCA	1
AGGTGCTAGGTATCACAGGTACCG	2
AGGTGCTAGGTCCGTTTGAAGTCA	1
AGGTGCTAGGTTTTGAACCCTGAT	1
AGGTGCTATACAATCGTGTGTTTC	1
AGGTGCTATCTATAAAAAATGTAC	1
AGGTGCTATCTATAAAACATGTAC	13
AGGTGCTATCTATAAAATATGTAC	2
AGGTGCTATGCATATCGCTCTTCC	1
AGGTGCTATGCGGTAAGAGGCACA	1
AGGTGCTATGTTTATTGGGGTGGA	1
AGGTGCTATTTATAAAACATGTAC	1
AGGTGCTCAGGTAAACATACCCTA	1
AGGTGCTCATAAGGGTATAGTGTA	1
AGGTGCTCATACGGATATGGTGTT	1
AGGTGCTCATAGAACCATGTGTGA	3
AGGTGCTCATAGATGTAGGGTATA	1
AGGTGCTCATATGCGTAAGTTATG	1
AGGTGCTCGTCCTGGATCAGGGCT	1
AGGTGCTCTCTATAAAACATGTAC	2
AGGTGCTCTGTCTTGATGTAGTGG	2
AGGTGCTGACTGGGCAGAAAGGGG	2
AGGTGCTGAGGTAGAGTGCGAACA	1
AGGTGCTGATTTTAACTGTTTCGG	1
AGGTGCTGCAAATTAAGGTGAAAG	1
AGGTGCTGCGTATTAAACGAGGCG	1
AGGTGCTGCGTCATCTATAATGGG	1
AGGTGCTGCTCCATACTATTGCTG	2
AGGTGCTGCTGCATCTAGGTGTA	1
AGGTGCTGCTGCATCTAGGTGTAG	1
AGGTGCTGGTTTTAAATGAACCGG	1
AGGTGCTGGTTTTTATTTAGAACC	1
AGGTGCTGTCTATAAAATATGTAC	1
AGGTGCTGTTTGGGTTTTTAAGCA	1
AGGTGCTGTTTGGTTTAATACTTC	1
AGGTGCTTAACAAGACATAGTTTG	3
AGGTGCTTAAGGAGGAGACAGCCG	1
AGGTGCTTATACGGTGAATCCAGAC	1
AGGTGCTTATAGAGGTAGAGTATA	1
AGGTGCTTATAGGGATATGGCAGG	1
AGGTGCTTGGGAGGCATGACAGCC	1
AGGTGCTTTTGATTATTATTCTGT	2
AGGTGGAAAAATTGAATGGTGGAG	1
AGGTGGAAAGCATTTATTTGCAA	1
AGGTGGAAAGCATTTATTTGCAAG	1
AGGTGGAACTGAAACTGTTTGGTT	3
AGGTGGAACTGAAATTGTTTGGTT	2
AGGTGGAACTGCTATTTCATGGAA	1
AGGTGGAAGAAGATTGCCGGTTGA	1
AGGTGGAAGACAATGGCATTGCC	3
AGGTGGAAGGAGCCTCAGGGTAGC	1
AGGTGGAAGTTGATTTATTTTGGA	1
AGGTGGAATACAAGAAACGGGTGG	1
AGGTGGAATAGCAACGTGGCAATT	1
AGGTGGAATCTATAATTTGTTTT	1
AGGTGGAATGACGGATATGATTGC	1
AGGTGGAATGGCGATGCTGACAAG	1
AGGTGGAATTGTAAATGTGTGTCT	1
AGGTGGACACGGTGACGACAC	1
AGGTGGACATATTAAACTGTGT	1
AGGTGGACATGACGGGTGTGCTAGC	1
AGGTGGACCAATTATTAATGATGT	3
AGGTGGACCACATAAACGGTGCAT	1
AGGTGGACCACATAAGAGGTTTGC	3
AGGTGGACCACTTAAGAGGTCTGC	1
AGGTGGACCATATATTTATAACGA	1
AGGTGGACCCTATGAATAGTGAGC	5
AGGTGGACCTCTTATGTGGACCTC	4
AGGTGGACGAAGACTGGCCTA	3
AGGTGGACGCGTAAAGCGTGTGCA	1
AGGTGGACTATATATCTATAGTGA	1
AGGTGGACTGGTTAAGCTGTTCGC	1
AGGTGGACTTCATCAGCTGCCGGA	1
AGGTGGAGACTACCATTGGTGACG	2
AGGTGGAGAGTTGTGATTGGTTGG	1
AGGTGGAGATGATTGAAGAAAGG	1
AGGTGGAGATTGTTAAATATGTGA	2
AGGTGGAGCACTGTTGCAGATGGA	1
AGGTGGAGCACTGTTGTAGGTGG	1
AGGTGGAGCGAGATAGCATGGCT	1
AGGTGGAGCGATGGTGGAGTCACC	2
AGGTGGAGCGTCTGAAATGATTGG	1
AGGTGGAGCGTGGGAACCATGTGA	1
AGGTGGAGCTAAAACTATTTGGCT	1
AGGTGGAGCTAAAACTGTTTGGCT	13
AGGTGGAGCTAAAACTGTTTGGTTG	1
AGGTGGAGCTAAAATTATTTGGCT	1
AGGTGGAGCTAAAATTGTTTGGCT	2
AGGTGGAGCTAGAACTGTTTGGCT	11
AGGTGGAGCTAGGTTTAGGGCCT	2
AGGTGGAGCTAGTTTTTGTCAGCT	1
AGGTGGAGCTGAAACTATTTGGCT	11
AGGTGGAGCTGAAACTGTCTGGCT	1
AGGTGGAGCTGAAACTGTTCGGCT	1
AGGTGGAGCTGAAACTGTTTAGCT	4
AGGTGGAGCTGAAACTGTTTGGCT	43
AGGTGGAGCTGAAAGTGTTTGGCT	1
AGGTGGAGCTGAAAGTGTTTGGCTG	1
AGGTGGAGCTGAAATTATTTAGCT	2
AGGTGGAGCTGAAATTATTTAGCTA	1
AGGTGGAGCTGAAATTGTTTAGCT	1
AGGTGGAGCTGAAATTGTTTGGGT	1
AGGTGGAGCTGGGTTTAGGCTGC	1
AGGTGGAGCTGGGTTTTTGCTGCT	1
AGGTGGAGCTTAAACTGTTTGGCT	1
AGGTGGAGGCTAATAATTAGCCC	1
AGGTGGAGGGTTGAGACTGCCCTA	1
AGGTGGAGGGTTGGGACTACCCTA	1
AGGTGGAGGTCAAGATTGCCAACC	1
AGGTGGAGTCATGGAAGATGGGTA	3
AGGTGGAGTTACCATTACCTCAAG	1
AGGTGGAGTTAGATTTAGACTGCT	1
AGGTGGAGTTGAAATTGTTTAGCT	1
AGGTGGAGTTGGGTTTAGACTGCT	2
AGGTGGAGTTTGTTGAGTTGTGAT	1
AGGTGGAGTTTGTTGGAGTTGTTC	1
AGGTGGATATGACCATTGGAGCCA	2
AGGTGGATCATGCCTGCGAGCCCC	1
AGGTGGATCTAAAACTGTTTGGCT	3
AGGTGGATCTGACTTGGCGATTGT	2
AGGTGGATGAGATTCTTTGAT	3
AGGTGGATGCCGCCGGATACGTGC	1
AGGTGGATGTAGAGGTGTTTGACA	1
AGGTGGATTTGGATCGGTCTTCGA	1
AGGTGGCAACTGCATAATTTGCAA	5
AGGTGGCAACTGTGGGTGCGATGG	1
AGGTGGCAAGTGGTGTCTAATCGA	3
AGGTGGCACAACTGATAATATGTG	1
AGGTGGCACCTAGGATATGATGCT	2
AGGTGGCACTGATGATTTTGGTCA	1
AGGTGGCAGATATGGCAGTGTCGG	1
AGGTGGCAGCAATATACTGTA	2
AGGTGGCAGCTTATTTAATGCTATG	1
AGGTGGCAGGATGTATGTACTTAC	1
AGGTGGCATACACGAAATGAGGGG	1
AGGTGGCATGCAAGAAACGGATGG	5
AGGTGGCATGCAAGAAACGGGTGG	26
AGGTGGCATGCAAGAAACGGGTTG	7
AGGTGGCATGCAAGAAATAGGTGG	1
AGGTGGCATGCAATAAACGGGTGT	6
AGGTGGCATGTAAGAAACGGGTGA	2
AGGTGGCATGTAAGAAATGGGTGG	8
AGGTGGCCAGGTTATATCGTCCGC	1
AGGTGGCCCAAAGTACAGTTTACT	1
AGGTGGCCCGAGAAAACGTCTAGG	1
AGGTGGCCCTCTTGGAGGATGGA	1
AGGTGGCCGAACGTGCTCCAGATG	1
AGGTGGCCGAATCTGATTCCAGCA	1
AGGTGGCCGAATTGGATTTTGGCA	1
AGGTGGCCGATCACTATGGATGG	1
AGGTGGCCGCCTGCAAAATTTCAG	1
AGGTGGCCGGGACTTCAACTCCAC	1
AGGTGGCGACCAGATGTGTTACAC	3
AGGTGGCGACTGGTGGTCTGACGC	1
AGGTGGCGATGCGATGAAAGTTGT	1
AGGTGGCGATGGTGGAAGAAGGGT	1
AGGTGGCGATTACGGCACTGGGTC	1
AGGTGGCGCCGATGGGATTGAGGA	1
AGGTGGCGCTTCCTATGCGCTGAT	1
AGGTGGCGGTTGATGAGACATCTA	1
AGGTGGCGTACCCGTCAACAGCGA	1
AGGTGGCTCAAAAGATGCTATGGG	1
AGGTGGCTCCACTTGTGTTGAGGA	6
AGGTGGCTCCTTAAAAGGCCTCCA	1
AGGTGGCTGAAACAAATATTGTAT	1
AGGTGGCTGAATAGAATATTCTAT	1
AGGTGGCTGAATGGAATATTCT	1
AGGTGGCTGAATGGAATATTCTAT	5
AGGTGGCTGACATATGGGTCTGGA	1
AGGTGGCTGAGAATATGGTGGATA	1
AGGTGGCTGGCGTGACAGAGACGG	1
AGGTGGCTGTCGAACTACGGTTGT	1
AGGTGGCTGTGTCACTGTCGGGTC	1
AGGTGGCTTATGGCGGTTGTATGG	1
AGGTGGCTTGATTGAGGACCGTTC	8
AGGTGGGAAAAGCACTATATGTGT	1
AGGTGGGAAAAGGCCTATAGATGC	1
AGGTGGGAACCAGAAAGATGGCTA	1
AGGTGGGAATGTGTAAAAGCTTTA	6
AGGTGGGACACGATCATTAGATGCC	1
AGGTGGGACATGACATAAGTGTGA	1
AGGTGGGACATTACCTAGTCCAG	1
AGGTGGGACATTACCTAGTCCAGC	5
AGGTGGGACCAAATATTAATGGTA	2
AGGTGGGACCAAGTATTAATAGTG	1
AGGTGGGACCAGTTATGTAACTGT	1
AGGTGGGACCATATATTAATAGTA	1
AGGTGGGACCATATATTAATGGT	3
AGGTGGGACCCACATATCAGTAAC	1
AGGTGGGACCGGATATTAATGGT	1
AGGTGGGACTAGATATTAATAGT	1
AGGTGGGACTAGATATTAATAGTA	3
AGGTGGGACTAGGTATTAATAGTG	3
AGGTGGGAGGCTATCTGTGGGAGG	2
AGGTGGGATCGATATCGTTTCGGC	1
AGGTGGGATCGATATCGTTTTGGT	1
AGGTGGGATCGGTATCGTTTCGGC	4
AGGTGGGATGAGATGGACCCTGAC	1
AGGTGGGATGGGATGAAACCATT	1
AGGTGGGATGTAATGGGGACGAAC	1
AGGTGGGATTAGAATCGATGGGAT	1
AGGTGGGATTGGATGACATTCATT	1
AGGTGGGCAAGATAAGAAGTT	1
AGGTGGGCATACTGCCAATGG	1
AGGTGGGCCAATGATGGTGATAGC	1
AGGTGGGCCACTGATGATGACAGC	8
AGGTGGGCCACTGATGGTGAAAGC	1
AGGTGGGCCACTGATGGTGATAGC	3
AGGTGGGCCATATTTTTAGGTGTA	1
AGGTGGGCCCATGTTAGATGGTAA	1
AGGTGGGCCCTATAAATAGTGAGT	1
AGGTGGGCCCTATGAATAGTGAGC	3
AGGTGGGCCGAGGTACACACGTGG	1
AGGTGGGCCGCTGATGGTAACAGC	1
AGGTGGGCCGCTGATGGTGAAAGT	1
AGGTGGGCCGCTGATGGTGATAAC	1
AGGTGGGCCGCTGATGGTGATAGC	4
AGGTGGGCCGCTGATGGTGTCAGC	1
AGGTGGGCCGCTGATGGTTACAGC	2
AGGTGGGCCGGATTTAGTAGTCGC	1
AGGTGGGCCGTTGATGTTGACAGC	3
AGGTGGGCCTTATGAATAGTGA	1
AGGTGGGCCTTATGAATAGTGAGC	2
AGGTGGGCTAATTTTGGGCTAATA	1
AGGTGGGCTTTTGTGATTTTCCAA	1
AGGTGGGGACATGGTGGTGTATC	1
AGGTGGGGACCTCTTCTGTGTCCA	2
AGGTGGGGAGCGAATCTGATCGCT	1
AGGTGGGGATGACGTCAAGTCCGC	2
AGGTGGGGCTCACTTTCATTGGGT	2
AGGTGGGGCTCTATTTAGGTTGAC	1
AGGTGGGGGGTATTTATAGATCCC	1
AGGTGGGGTAGCAGATTCACTGCC	1
AGGTGGGGTTGGGTCGGTACTCTC	1
AGGTGGGTAGGCCTCTCGGAGCCA	1
AGGTGGGTAGGTAGAGAATACCTA	1
AGGTGGGTCAGAATATTGTGTGCA	2
AGGTGGGTCCCACACGATAGTGGA	1
AGGTGGGTCCTATGTTCAGACGAG	1
AGGTGGGTGCAATTTAGTACATAA	1
AGGTGGGTGCAATTTAGTACGTGA	1
AGGTGGGTGCGATATAATTCAAGA	1
AGGTGGGTGCGATATAGTATAAGA	1
AGGTGGGTGCGGTATAGTGCAAGA	2
AGGTGGGTGCGTTCTTAAAGGAGT	1
AGGTGGGTGCTAATTTTTATACAA	1
AGGTGGGTGGATACGACGCCTACG	1
AGGTGGGTGGTGGTGGTAGAACCA	1
AGGTGGGTGTAATTTGGTGCAATA	4
AGGTGGGTGTATCTAGCACCTGCA	1
AGGTGGGTGTCACTTGTGATGGT	3
AGGTGGGTTAGCATTACCTGGTGG	1
AGGTGGGTTGAATCCAATGTGCCA	1
AGGTGGGTTGGGTTGGACCCAGA	1
AGGTGGTAAGCCATGATGCGGTT	1
AGGTGGTAAGCCATGATGCGGTTA	1
AGGTGGTAAGGTACTGTCACATGG	1
AGGTGGTACACACATAGCACAGTA	1
AGGTGGTACTAAACTCCACATGCA	1
AGGTGGTACTAAACTCCACATGTA	2
AGGTGGTACTAACGTATGATTGAT	1
AGGTGGTACTACACATGTGCACAC	1
AGGTGGTACTAGCCTATGACACCC	1
AGGTGGTACTTACTATTTAAGGAG	1
AGGTGGTAGGCTAGATGATCTGGG	2
AGGTGGTATATGGTATCGGGTATG	1
AGGTGGTATCCCGATTCTACGATC	2
AGGTGGTATGTTTGTACGTTGAGC	1
AGGTGGTATTAACTTATGATTGAT	1
AGGTGGTATTAATGCATGATTGAT	1
AGGTGGTATTATTTGTGCACTGAC	1
AGGTGGTCAATGCGTATGTTTC	1
AGGTGGTCAGACTGACGGACTGG	1
AGGTGGTCATTTGGCTTCAAAGGTC	1
AGGTGGTCCAAAGTGAAACTTGGG	7
AGGTGGTCCAAAGTGAAACTTTGG	1
AGGTGGTCCACCTGTTGGTGTCTG	1
AGGTGGTCCACTATACAATTTTTA	2
AGGTGGTCCAGGGATTATACCCGC	2
AGGTGGTCCATTTGTATGTAATAT	1
AGGTGGTCCCGAATTTATTCCACA	2
AGGTGGTCCCTAAATAAATAGGGA	1
AGGTGGTCCGCCTGCGAAAATGA	1
AGGTGGTCCGCCTGCGAAAATGAT	1
AGGTGGTCCTCCTGAAGGCCTC	1
AGGTGGTCGATTTTTATGACTGAC	3
AGGTGGTCTAAGATTGGTGCGGAC	1
AGGTGGTCTACTATTAATCTAGT	1
AGGTGGTCTCTGGAAGCTAACCAA	1
AGGTGGTCTGAACGACAGTTTCGA	1
AGGTGGTCTGATGGGTCACTTTGG	1
AGGTGGTCTGCGTGTTAGCGTGGG	1
AGGTGGTGACAGCCCTATTTGTCA	1
AGGTGGTGACTGGACTTCAGATCG	1
AGGTGGTGAGCGATATGTATTCGA	1
AGGTGGTGAGCTAGACGATC	1
AGGTGGTGAGCTAGACGATCTGGG	1
AGGTGGTGAGGATTATCGAGTTGA	1
AGGTGGTGAGTGTTGATGATACCG	1
AGGTGGTGAGTTATGATTGGTTGA	3
AGGTGGTGATAGACGATCTGGGTT	2
AGGTGGTGCGCTAGATGACCTGGG	1
AGGTGGTGCTAGTTAATGGATGCA	1
AGGTGGTGCTGCGTATTAAACGAC	1
AGGTGGTGGACTAGACGAATTGGG	1
AGGTGGTGGACTAGACGATCTGGG	1
AGGTGGTGGACTAGATGATCTGGA	1
AGGTGGTGGCCTAAATGATCTGGG	1
AGGTGGTGGCTTTGGGTGTGCAGG	1
AGGTGGTGGGATACATGATCTGAG	1
AGGTGGTGGGCTAAACAACCTGG	1
AGGTGGTGGGCTAGACAACCTGGG	3
AGGTGGTGGGCTAGACGACCTAGG	2
AGGTGGTGGGCTAGACGACGTGGG	1
AGGTGGTGGGCTAGACGATCTGAG	2
AGGTGGTGGGCTAGACGATCTGGG	6
AGGTGGTGGGCTAGACGATCTGTA	3
AGGTGGTGGGCTAGATAACCTGGG	1
AGGTGGTGGGCTAGATGACCTG	1
AGGTGGTGGGCTAGATGACCTGGG	3
AGGTGGTGGGCTAGATGATCTGGA	4
AGGTGGTGGGCTAGCCGATACTA	1
AGGTGGTGGGCTAGGCAACTTGGG	1
AGGTGGTGGGCTATACGATCTGAG	3
AGGTGGTGGGTTAGACGACCTGAG	1
AGGTGGTGGGTTAGACGATTTGGG	1
AGGTGGTGTCGGTGATATGGGTCT	1
AGGTGGTGTCGTGTGTTACCGAGT	2
AGGTGGTGTCTAATCGAGTACTAC	3
AGGTGGTGTGATGACGTACAAACA	1
AGGTGGTGTGCTAGATGATCTGGG	1
AGGTGGTGTTACCCCAGTCACGG	1
AGGTGGTGTTTATGTGGCATTAGA	1
AGGTGGTGTTTGAATGTCCTGAAG	1
AGGTGGTGTTTGGAAAGAAGGGAC	1
AGGTGGTGTTTGGATAAGAGACTA	1
AGGTGGTGTTTGGATCAGTGACAA	1
AGGTGGTGTTTGGTTGAAGGGACT	1
AGGTGGTGTTTGGTTGGAGGGAC	2
AGGTGGTTAGTATAGTGATGGCAA	1
AGGTGGTTGATAGTATTGAGAAAC	1
AGGTGGTTGATGTGTGGACCCTTT	1
AGGTGGTTGGTTGGGCCTGTTGCA	1
AGGTGGTTTACTATTAATCGAGTC	5
AGGTGGTTTACTATTAATCTAGTC	4
AGGTGGTTTACTATTAATTTAGTC	1
AGGTGGTTTATGCGGTTTATCGG	1
AGGTGGTTTCGTCCGACGTGACAA	2
AGGTGGTTTTAGCTGATGTGATGG	2
AGGTGGTTTTGGCTGACGTGGCGTC	1
AGGTGGTTTTGGCTGATGTGGCCC	1
AGGTGTAAAACCGGATGGATACAA	1
AGGTGTAAAATGTTATACATA	2
AGGTGTAAAGTTTTGACGTGTCAC	1
AGGTGTAACGACGGTCTCGTACGG	1
AGGTGTAACTACTATGTAAGTGGC	3
AGGTGTAACTACTGCGTAAGTGGC	1
AGGTGTAACTACTGTGTAAGTGA	1
AGGTGTAACTACTGTGTAAGTGG	5
AGGTGTAACTACTGTGTAAGTGGC	8
AGGTGTAACTGGCTGATGCATGCA	1
AGGTGTAACTGGTTGGTGCATGCA	1
AGGTGTAACTGTCCGGAAACCACA	1
AGGTGTAATACTGTTGGAAGTATG	1
AGGTGTAATATGGAACGAAACCTC	1
AGGTGTAATATGTCTGGTTTTGTA	1
AGGTGTAATGAGGTACCAGGTAC	1
AGGTGTAATTAGCATGGTGTTTTA	1
AGGTGTAATTAGCTGAGAGACACC	1
AGGTGTAATTATAGTGTATTTACA	1
AGGTGTAATTGGTTGAGATGAGA	1
AGGTGTACAATATGAGCATCCCTC	1
AGGTGTACCACTGTATCCACAAGA	1
AGGTGTACCATGGTTTTAAAATTG	1
AGGTGTACCCATAAGCATTCGTGT	1
AGGTGTACCCGACTATCGGAGTA	1
AGGTGTACCTGAATTGATGTTGAA	2
AGGTGTACCTGGATGACATGTA	1
AGGTGTACGTGAGAGGTAGAGTA	1
AGGTGTACTAATTCTGCGTGGTTA	2
AGGTGTACTCACAGGTTTACACGA	1
AGGTGTACTCGGTATGTTTAGTCC	3
AGGTGTACTTATATTAGGACGGA	2
AGGTGTAGAAACTATTTGGTTGGA	2
AGGTGTAGAAAGTTTTTGTAGACA	3
AGGTGTAGACGTAAAACACGAGGC	1
AGGTGTAGACGTGCATTGTGCAGC	2
AGGTGTAGAGGCTGACATGTGGGC	2
AGGTGTAGAGGTGGTGATAGCCCT	2
AGGTGTAGAGTAGAGCTGTCATA	2
AGGTGTAGCACTGCATCTGTACATG	1
AGGTGTAGCACTGCTGCAGGTGGA	1
AGGTGTAGCTGAAATTGTTTGGCT	3
AGGTGTAGGACCGATTCTGTAGAA	1
AGGTGTAGGCTTACTCGCATCCAT	1
AGGTGTAGGTAGGAATGGTGCATG	1
AGGTGTAGTGTAGGATACTTCCTG	1
AGGTGTAGTTTGTGGATTTCCGTA	1
AGGTGTATAAACTTACTAAAAGAG	5
AGGTGTATAAACTTTAGGTGCATA	1
AGGTGTATAAATTTTATGTGTATA	2
AGGTGTATATGGAAAGTCGAAAGA	1
AGGTGTATCACTGATGACAGGTA	1
AGGTGTATCCCATGTTGGCCGAAA	1
AGGTGTATCGATCGCTAAGGCGCA	3
AGGTGTATCGATCGCTAAGGGCGC	1
AGGTGTATCGTTTAACAGTTTTAA	1
AGGTGTATGTGAGACTACGCGTGC	1
AGGTGTATGTGGAGAAGGATGGTT	1
AGGTGTATGTGTGTATGACAGATA	1
AGGTGTATTACACAATGCTGGTGG	1
AGGTGTATTTCTTGTTTTCTGCAA	2
AGGTGTATTTGTCCATGTCATCAC	1
AGGTGTCAAAGTAATATCTGCAAG	3
AGGTGTCAAAGTCCTATCTGAGAG	1
AGGTGTCAAATATTTTGAAACGGA	1
AGGTGTCAACGGCACCGATGAATC	1
AGGTGTCAAGTCCAATTTGATAGA	1
AGGTGTCAATCTGGTATAAGTCTG	1
AGGTGTCACACTATCAAACGGTGT	1
AGGTGTCACACTGGTGGAGAAACC	1
AGGTGTCACATAAGCTAAAATAGT	1
AGGTGTCACATAGGACGTTTGACC	3
AGGTGTCACATAGGATATTTTACC	1
AGGTGTCACATCAAACGTTTGACC	1
AGGTGTCACATCAAACGTTTGATC	4
AGGTGTCACATCGAACGTTTAACA	1
AGGTGTCACATCGAACGTTTGATC	3
AGGTGTCACATCGAACGTTTGATT	1
AGGTGTCACATCGAATATACGGAC	1
AGGTGTCACATCGGACGTTTGACC	2
AGGTGTCACATCGGAGATTTGATT	1
AGGTGTCACATTGGACGTTTGATC	1
AGGTGTCACCCAACTTACCGGGTA	2
AGGTGTCACCGGTGAGCACCCAAG	2
AGGTGTCACCTGTTTTGGGCGATG	1
AGGTGTCACGTCGGATGTTTGATC	2
AGGTGTCACTGATATGTGGGTCTC	1
AGGTGTCACTTAGATTGCATGGTA	1
AGGTGTCAGACTGAATATATCATG	1
AGGTGTCAGAGTCTAACTCGGAGG	2
AGGTGTCAGCGCCAAGTGCATTGG	1
AGGTGTCAGCTTATTTAATGCTAT	1
AGGTGTCAGGTATCACAGGTACCA	1
AGGTGTCAGGTGTGTGAACTTCCG	3
AGGTGTCAGTCGATACCCAGGTAC	1
AGGTGTCAGTCTTAGTATATAGCA	1
AGGTGTCAGTTAATTAAAAAACTG	1
AGGTGTCAGTTAATTAAAAACCAA	1
AGGTGTCAGTTAATTTAAAACCAA	1
AGGTGTCAGTTTAGGAACCGA	1
AGGTGTCATACCCGCTTTATACTG	1
AGGTGTCATATCAAGGTTCTAGAT	1
AGGTGTCATATCGGACGTTTGACC	1
AGGTGTCATATCGGATGTTTGATC	2
AGGTGTCATCCATGACGGGGTTGA	1
AGGTGTCATCCATGATGGGTCTGA	4
AGGTGTCATCCGGTTGATATTCCA	1
AGGTGTCATCCGGTTGATATTCCG	2
AGGTGTCATCCGTGACGGGCTTAA	1
AGGTGTCATCCGTGACGGGTTTA	3
AGGTGTCATCCGTGACGGGTTTAA	1
AGGTGTCATCGGCCGAGTTGCC	1
AGGTGTCATCTTTGGAGGCCCAAC	1
AGGTGTCATGTCGAACGTTTGACC	2
AGGTGTCCAAAATTGAAAGATGAA	1
AGGTGTCCAAGTAGAAATCTTGAA	1
AGGTGTCCACATACATTAATTGGA	3
AGGTGTCCATGGTGACTTTGTCTA	1
AGGTGTCCCATGGATACAATCCGA	1
AGGTGTCCCCGTGTGGGACGAGGA	1
AGGTGTCCCCTTGTCCAAGTAGAA	1
AGGTGTCCCCTTGTCCAAGTTGAA	1
AGGTGTCCCGAGATATTTTTCTCA	1
AGGTGTCCCTTTGTTCAAGTAGAA	1
AGGTGTCCGATGGTTACAATAGGA	2
AGGTGTCCGTATTACAATAGTATA	1
AGGTGTCCTCTTGTCCAAGTAGAA	1
AGGTGTCGAAACTCTTGTAGTCGT	1
AGGTGTCGAAGCGCTTGTAGCATT	1
AGGTGTCGATAGTGTTAAAACCGG	1
AGGTGTCGATTGTGGCATCATAGG	1
AGGTGTCGCCACTATAGGTGTCGG	1
AGGTGTCGCCATCTAGGCTTTCA	1
AGGTGTCGCCATTATAGGTACGGG	4
AGGTGTCGCCGAGTGGGGAGGAAG	1
AGGTGTCGCCGCAAATGAACTCGC	1
AGGTGTCGCGATTTGATTTGGCCT	2
AGGTGTCGCTACGCTGGAGAAAAA	1
AGGTGTCGCTCTAAAGTGTTACTA	1
AGGTGTCGCTTTGTCCAAGTAGAA	1
AGGTGTCGGAATAGCTAAAACCGG	1
AGGTGTCGGAGCTTTTCCCACCTC	1
AGGTGTCGGCACCCGTTATTTGCA	1
AGGTGTCGGCACTATAGATGCCGG	1
AGGTGTCGGCGCCAAAGCCACAAG	2
AGGTGTCGGGAAGTCTAAGGCCTC	1
AGGTGTCGGGTCCTATTTATACC	1
AGGTGTCGGGTCCTATTTATACCC	1
AGGTGTCGGTCTATGGTGAGTGGC	1
AGGTGTCGGTCTGTTACTAATAAGG	1
AGGTGTCGGTTAATTAAAAACCGG	3
AGGTGTCGGTTAGAAAACCGGTAC	1
AGGTGTCGGTTCTAAATAAAACC	1
AGGTGTCGGTTCTAGTTAAGAACC	1
AGGTGTCGGTTCTATCATAAGAAC	1
AGGTGTCGGTTCTTAATTAATCGA	1
AGGTGTCGGTTCTTATTTAGAACC	2
AGGTGTCGGTTCTTCTTGAGAACC	1
AGGTGTCGGTTCTTCTTTAAAACC	3
AGGTGTCGGTTCTTCTTTAGAACC	4
AGGTGTCGGTTCTTGCTATTAGCG	1
AGGTGTCGGTTCTTGGTATAGAAC	1
AGGTGTCGGTTCTTTAATTAACTG	3
AGGTGTCGGTTCTTTTTAAAAACC	1
AGGTGTCGGTTGATTAAAAACCGA	1
AGGTGTCGGTTGGTGTCGGTTTT	1
AGGTGTCGGTTGGTGTCGGTTTTT	1
AGGTGTCGGTTTCCGAGCTGGAAC	1
AGGTGTCGGTTTCTCAGCCGGAACC	3
AGGTGTCGGTTTGGTTTTATACGA	2
AGGTGTCGGTTTTATGTGTTTTCA	1
AGGTGTCGGTTTTGTATAAAAACC	1
AGGTGTCGGTTTTTAATTAACCGA	1
AGGTGTCGGTTTTTAATTAACCGG	2
AGGTGTCGGTTTTTATTTGGAACC	1
AGGTGTCGGTTTTTTAAAGAACAG	2
AGGTGTCGGTTTTTTTAAAAACCAA	2
AGGTGTCGTAACGACGTACCCATT	1
AGGTGTCGTATGGGGTGTTCGAGC	1
AGGTGTCGTATGGGGTGTTTGAC	1
AGGTGTCGTCTAGTTAATCAGAGA	1
AGGTGTCGTGCGGTTGTTAGCTG	2
AGGTGTCGTGCGGTTGTTAGCTGC	6
AGGTGTCGTGCGGTTGTTAGCTGCC	1
AGGTGTCGTGTGCCGTAGAAGGAA	1
AGGTGTCGTGTGCTTGTTTTGTT	1
AGGTGTCGTTTGTAGAACCAGCAC	1
AGGTGTCTAAATTCAGCGGCACAC	1
AGGTGTCTAAGTTTGTATTGAAGG	1
AGGTGTCTATGCTTGGATCTAGA	1
AGGTGTCTCATAGTAAAAGCCACA	2
AGGTGTCTCATTCTTATTTAGGTT	1
AGGTGTCTCGCTGTCAACAGATAT	1
AGGTGTCTCGCTGTCAACGGGTAC	5
AGGTGTCTCGCTGTCGACGGGTAT	1
AGGTGTCTCGCTGTCGATGGGTAC	1
AGGTGTCTCTGAGGAGTAGGCTTC	1
AGGTGTCTCTTGTATGTTTACGGT	1
AGGTGTCTGAGGAGGAGAGGTGAG	1
AGGTGTCTGATCGTCTCAAGTTAG	1
AGGTGTCTGCTGCCCGATTGGTA	1
AGGTGTCTGGAGAATCGGTATCCG	2
AGGTGTCTGTGTGTGCGTTATAGA	1
AGGTGTCTGTTTTAGCGTAAAACC	3
AGGTGTCTTACTGTCGACAGGTAC	1
AGGTGTCTTCGGTGGTCGCATCGA	1
AGGTGTCTTGTAGCAAATTTTGCC	1
AGGTGTGAAACCCGATGTGTCAGC	1
AGGTGTGAACGTCCAGCTGATTAG	2
AGGTGTGAAGCGATCTCGTACTAAA	1
AGGTGTGAAGTTCTCATTGTTCT	1
AGGTGTGACAACTTTTGTTGGCAA	1
AGGTGTGAGCATTGTGTCCGATGG	2
AGGTGTGAGCGTAGTGATGTGTA	1
AGGTGTGAGCTCTTATGCAAGAGC	2
AGGTGTGAGGCTTCAAACCTAGGC	1
AGGTGTGAGTACGGTGTTACGTGT	1
AGGTGTGATCACCGAAACTGAGAA	1
AGGTGTGCCATTGATTATATTTT	1
AGGTGTGCCTAAAAACTGTTAGGG	1
AGGTGTGCGAAGATGGCCAACGTC	1
AGGTGTGCGCATGTTGCACTGAGA	1
AGGTGTGCGTGCAAGTGCCGGTGT	1
AGGTGTGCTGGTGCTAGCAATAAG	1
AGGTGTGCTTTCTATTAAACTAGA	1
AGGTGTGGAAATAAATCCCCTCGA	1
AGGTGTGGAATAAATCCCTTCCAA	1
AGGTGTGGACGCTGTTATAATACA	1
AGGTGTGGATGAGACGTATTGTAG	2
AGGTGTGGCAGCTACGGTTTCGGC	1
AGGTGTGGCATGCTACAATTCATG	1
AGGTGTGGCTCACTTTTTGTAAGC	1
AGGTGTGGCTCTATTAGACTAGA	1
AGGTGTGGGCCCGAGAGTGAGACA	1
AGGTGTGGGCCTATGTCAATGGTT	1
AGGTGTGGGTTTTAGAACTATAGG	1
AGGTGTGGTCGGACTGGCCTGACA	1
AGGTGTGGTGAAACCATGTGTCTT	2
AGGTGTGGTGTACTTGGTTAGAGG	1
AGGTGTGTACGTGATGAGTAGTGA	1
AGGTGTGTAGCCTATAAATGGTAC	1
AGGTGTGTAGTCGTACCTCGACCA	1
AGGTGTGTATCTGACTATCATGTC	2
AGGTGTGTATGACAGGTTGAACCC	1
AGGTGTGTCACCAAGGCATTACA	1
AGGTGTGTCGTCGTCAGTTCCGAC	1
AGGTGTGTGATTGATTGAAAAGAG	3
AGGTGTGTGATTGGTTGAAAAGA	1
AGGTGTGTGATTGGTTGAAAAGAA	2
AGGTGTGTGATTGGTTGAAAAGT	1
AGGTGTGTGCATAGGATAAGTTGC	1
AGGTGTGTGCATAGGATACATTCC	1
AGGTGTGTGCATAGGATACGTTGC	1
AGGTGTGTGTATATGTTTACAGGG	1
AGGTGTGTGTCCTTGACTCAATGG	1
AGGTGTGTTAGGTAGATCACTCTA	1
AGGTGTTAAACGTTTGACGTGATA	1
AGGTGTTAAAGTCCTGTTCAGGAA	2
AGGTGTTAATTGAAGTTGTATCAG	1
AGGTGTTACGCTGCCATGGTCACC	1
AGGTGTTACGTAAGATGTTTTTAC	1
AGGTGTTACGTGCGTGCGAGCGGG	2
AGGTGTTACTCAGGTCACTGCCAC	2
AGGTGTTACTTTTGTAATAATTGG	1
AGGTGTTAGGGGTGGAGTTAGAG	1
AGGTGTTAGGGTCCTATTTGGGGA	1
AGGTGTTATACCCGGTTTTATGGT	1
AGGTGTTATACCCGGTTTTGTGGT	4
AGGTGTTATACCGGTGGCTTCAAG	1
AGGTGTTATATTGGTTGGGGAGGA	1
AGGTGTTATCGTTGCCGAGCTAGC	1
AGGTGTTATGTGGATTCCTATTCC	2
AGGTGTTATTAGATCAGGGTGTGA	1
AGGTGTTATTCGTGACGGGTTTA	1
AGGTGTTATTCGTGACGGGTTTAA	1
AGGTGTTATTTACTGTTCAGCAGC	4
AGGTGTTCAAACGTACGATGTGAC	3
AGGTGTTCAAACGTCCGATGTGAC	1
AGGTGTTCAAACGTTCGATGTGAA	1
AGGTGTTCAAACGTTCGATGTGAC	2
AGGTGTTCAAACGTTTAATGCGAC	1
AGGTGTTCAAACGTTTGATGTGAT	1
AGGTGTTCAAATGTTTGATGTGAC	2
AGGTGTTCAAGCGTTTGATATGAC	1
AGGTGTTCACCCGTCACATGTGAG	1
AGGTGTTCAGACGTTTAATGTGAT	1
AGGTGTTCATGGTGAATTCATTAA	1
AGGTGTTCCCTATCAGGTTTCTAA	6
AGGTGTTCGAACATTCGATATGAC	1
AGGTGTTCGGTCTTGTTGCGTTGG	1
AGGTGTTCGTGCGTTGCCACTGGG	1
AGGTGTTCTAAGATTGCATATCAGG	1
AGGTGTTCTGCCGACTCCTCAACC	1
AGGTGTTCTTAATGATCTAAATGC	2
AGGTGTTCTTGTCTAGATTGTAGA	1
AGGTGTTGAACTAATTCGAATGTT	2
AGGTGTTGACGCTTTTTCGTGGTC	1
AGGTGTTGACGGGAAACCGTTTTA	2
AGGTGTTGAGACTTGAGCAGGTC	1
AGGTGTTGATATGGTCTTTGTCGA	3
AGGTGTTGATGGGACGTTGACCC	1
AGGTGTTGATTTTATATGTTTTCC	1
AGGTGTTGCAAAATCAAGGAGTGA	1
AGGTGTTGCCGACGGGATGCGCCA	1
AGGTGTTGCCTAGGAGGTCTTTG	1
AGGTGTTGCGATCGTACTTGTCGA	1
AGGTGTTGCGATCGTGCTTGTCGA	5
AGGTGTTGCGATTGTGCTTGTCGA	2
AGGTGTTGCGGAGTCATCGCAGGC	2
AGGTGTTGCTACTGGAGCCCTCAT	1
AGGTGTTGCTTGAGGCCTCGGGAG	1
AGGTGTTGCTTGTGGCTATGGGAG	37
AGGTGTTGCTTTGGGGGCCTTCGG	1
AGGTGTTGGGCCTGAAACCGATAC	1
AGGTGTTGGGTCTGGGGATTTGTC	1
AGGTGTTGGGTTAAGTCTCGCA	1
AGGTGTTGGTCCTCTTGCGGCGGC	1
AGGTGTTGTATCCATAATCATGGC	1
AGGTGTTGTATCGATCTGACGATC	1
AGGTGTTGTCATCTATAATGGGCC	1
AGGTGTTGTCTTTTTGGTCTCGAA	2
AGGTGTTGTGATCGTGCTTGTCGA	1
AGGTGTTGTGCCGTTTCAAGGTT	1
AGGTGTTGTGCGACTCAACCCGTG	1
AGGTGTTGTGCTTGATCGATATAT	2
AGGTGTTGTGGGCCGTTTTCCC	1
AGGTGTTGTGGGTTATTGTTACCC	1
AGGTGTTGTGGTTATTTTGGACCA	1
AGGTGTTGTGGTTGTACAGCCGC	3
AGGTGTTGTTAGATCTAATGATCG	1
AGGTGTTGTTCTAAGCTAGACTAG	2
AGGTGTTGTTGCCTCATTTTGAGT	1
AGGTGTTGTTTGACTTTCAAACCA	1
AGGTGTTGTTTTGGGGACATCCC	1
AGGTGTTTAAACGCTTGATGTGAC	2
AGGTGTTTAAACGTTCGATACGAC	2
AGGTGTTTAGATCCATGGGTGTAA	1
AGGTGTTTATAGGGTTGTGAGTGT	1
AGGTGTTTCCACCAGTACTTTGGT	1
AGGTGTTTGACGAGGTCTTCTCGG	1
AGGTGTTTGATCAAGGTCCTGCAC	1
AGGTGTTTGGATGGTGGGCAGCAC	1
AGGTGTTTGGCTCCCGCCAAAGC	1
AGGTGTTTGGGTTTTGCAAAACTC	1
AGGTGTTTGGTTGAGGGGCGAGTG	1
AGGTGTTTGGTTGTAGCCACAGTT	1
AGGTGTTTGGTTGTAGGGCAGGAC	1
AGGTGTTTGTAGCTCGTATTTACG	1
AGGTGTTTGTGAAATCTGTGGTAC	1
AGGTGTTTGTGGGATAGATACCCA	1
AGGTGTTTGTTCACTTTTGCTTAC	1
AGGTGTTTTACTATTAATCTAGTC	1
AGGTGTTTTCAGTTTGTACCAGAG	1
AGGTGTTTTGAAGTGTGTTTTCTC	1
AGGTGTTTTTAAGATTATATATA	2
AGGTGTTTTTACCGATACTTTGGT	2
AGGTGTTTTTCGTCGCATGGCGGT	2
AGGTGTTTTTGATTGTTATTCTGT	1
AGGTGTTTTTTCAGTGATACAACA	1
AGGTTAAACATTAGTCTAGGGTGG	1
AGGTTAAACTAGGAAGATGGCCCA	1
AGGTTAACATAGACAGCTGGGCAG	2
AGGTTAACCCTTTTACACGAAGCG	1
AGGTTAACCTATTGCGTGTGATGC	1
AGGTTAATTATATTATGGGACGGA	2
AGGTTAATTGTAGGGTCATTAGTC	1
AGGTTACAACGCCGCACGATGGTT	2
AGGTTACACGACAACTTTGGTCA	3
AGGTTACAGAGCTCGACTCTAACT	1
AGGTTACCTCACCTCAAACGGGTT	1
AGGTTACGGTGTGCTTGATCTGGC	4
AGGTTACTATACGGATAGCGAGAC	3
AGGTTACTTGTTAAACTATGGATG	1
AGGTTAGATAAATCAAAGGTGTCA	1
AGGTTAGATCTAGTCGGGTGGTTC	1
AGGTTAGCACTAGACCGGCCACCG	2
AGGTTAGCTGGAGGTGATACTGGA	1
AGGTTAGGACTGCCATAAGATTGG	1
AGGTTAGGATCTTGCCATTTAGGA	2
AGGTTAGTTATAGATGAATTGGAG	1
AGGTTAGTTTTACCCTACTGATGA	3
AGGTTATACCTCACTAGTCAGAAT	2
AGGTTATAGATTTCGGTTGTGGAA	1
AGGTTATAGCACTCTGTGGTGGGT	1
AGGTTATAGCTGGACCGACCGACC	1
AGGTTATGATTAGATGATTAGTGA	1
AGGTTATGGAATGTGTTTTATGAT	1
AGGTTATGTCAAAGTGTTAGAAAG	1
AGGTTATGTGTGCTGGATTTGAAG	1
AGGTTCAAGTGCATGTGCTGC	1
AGGTTCAATGTGACCTGGGTGGCC	1
AGGTTCAGGCCACCTAAAGGTGTA	1
AGGTTCAGGCCATCTGGAGGTGTA	1
AGGTTCAGGTTACCTGGAGGTGTA	4
AGGTTCAGTCTACAGATGCGGGAA	1
AGGTTCATGTTCCGTTGTGCGAGT	2
AGGTTCCCCTTACTGTTTTTGGCA	1
AGGTTCCTCATCGATAATCTCGAC	1
AGGTTCGCCTGTGAAAATAATGTT	1
AGGTTCGGGCCGCTATCAAGCGTA	1
AGGTTCGGGCCGCTCGGAAGCGTA	1
AGGTTCGGGCTGCTGAGAAGCGTA	2
AGGTTCGGGGTCTGGTTTAGGCTC	1
AGGTTCGTAGATAGGGCGTGTGCA	1
AGGTTCTAGGGTGTCAATTTCCA	1
AGGTTCTCATGTTGAAGCTGTGTCT	1
AGGTTCTCGTGTTGAAGCTGTGTC	1
AGGTTCTCTATACAGGGTGTGACA	1
AGGTTCTGTACTAGTGAAATGTCC	1
AGGTTCTTATATTTTGGTACGG	1
AGGTTCTTATCATGAATTGGTTGG	2
AGGTTCTTGTAGCCAAAGGAAGCC	3
AGGTTCTTTGGTGGTTTTGACCCC	1
AGGTTGAAAATGGTAGCAAAGTGA	1
AGGTTGAAACCGACTGCATGGTAG	3
AGGTTGAAATTAAAACGATGTGAC	2
AGGTTGAAATTAGTACGATGTGAC	4
AGGTTGAACCTGATATTAGAGAGC	1
AGGTTGAAGAAGGATGCCCACCAC	1
AGGTTGAAGACGTGGCATGGAGGT	1
AGGTTGAATATTGAAATACGTGCA	1
AGGTTGAATCTAGAGGCCGGGTAA	1
AGGTTGAATCTTGAAATACGTGCA	2
AGGTTGACCTATTTGGGAATCTCC	1
AGGTTGACTAGATATAGTTGCTGC	1
AGGTTGAGAAAAGTGGCATCACCA	1
AGGTTGAGGGAGCCGTCGAAATGC	1
AGGTTGAGGTTAAACTTTTATAAC	1
AGGTTGATAATGTTCTGTGCGG	1
AGGTTGATATGATGGAAAAGGACT	1
AGGTTGATGGCAGGTGGTGAGGAG	2
AGGTTGATGTGATGGAAAATGAC	1
AGGTTGATGTGATGGAAAATGACT	1
AGGTTGATTGAAGTGCTATCACAG	1
AGGTTGATTTTAATTATCGTGCAA	1
AGGTTGATTTTTATGGGATAGAGA	1
AGGTTGATTTTTTTATGGGACGGAG	1
AGGTTGCACTTGGCTTGTTACCTT	1
AGGTTGCAGGGTAAGGTCGCTTAT	1
AGGTTGCATGCCTACTGGAGCTA	2
AGGTTGCATGTACTCGAGCTCGG	1
AGGTTGCCGGTGTAGAAGCAGATGG	1
AGGTTGCCGTTGCCGTCGTCTGGA	1
AGGTTGCGATAACTGTGCCTAGA	1
AGGTTGCGGACGGACTATAACTGA	1
AGGTTGCTACAGAAGGAGATGGAA	1
AGGTTGCTACATTATAGGACGAAA	3
AGGTTGCTATATTCTAAGACGGAG	2
AGGTTGCTGGTGCACGTCGTGGTC	1
AGGTTGCTTATACAGTGTTTTCTG	1
AGGTTGCTTGGGGCCTTGAATAAT	1
AGGTTGGAAAAGGCCTATAGGTGT	1
AGGTTGGAAACCGTAGATGGTGAG	1
AGGTTGGAGAAACTTTTTTGGTTT	1
AGGTTGGAGTCGATGGTTATGCAA	3
AGGTTGGCCGAAGATGTGGCGGAC	9
AGGTTGGCCTGAGAAAGGTGGGACG	3
AGGTTGGCGTAATCTTAGGTGAAC	1
AGGTTGGCTCCACAAAATGTGTG	1
AGGTTGGCTGTAGATGATATGTGT	1
AGGTTGGGACTGCTCTAGTATTGA	1
AGGTTGGGCCACACATGGATGT	1
AGGTTGGGCCCAAACGTAAGTGGC	1
AGGTTGGTCCTGGTTTTGGA	1
AGGTTGGTGTGACCCTTGGGAGGG	1
AGGTTGGTGTTTACACTCTGATA	2
AGGTTGGTTTATGCCAGGTTGTGC	1
AGGTTGTAATTGATTTAGAAGTGA	1
AGGTTGTCACATCGGATGTTTGAA	1
AGGTTGTCTGCTAGAGTTTGGGTT	1
AGGTTGTGACTGAGAGTGATCGGT	1
AGGTTGTGATTAGATAAAGGTGG	1
AGGTTGTGATTGGTTGAGAACTGA	1
AGGTTGTGATTGGTTGTGAAGTGG	1
AGGTTGTGCCTGAGGTAGCAGCCA	1
AGGTTGTGCCTGTATGAAAGGTGG	1
AGGTTGTGCGTGCGTGTTAGGTT	1
AGGTTGTGTCTGTGCCGTTTTTCC	2
AGGTTGTGTGCATATTGCTATTGC	1
AGGTTGTTCGACAGGGTTGTTGGT	1
AGGTTGTTGATGGTAATCCTG	1
AGGTTTAAAACCACCTAAGGTCCT	1
AGGTTTAACATTTGGAGTATCCAA	1
AGGTTTAACCCTGCCTGCGTAAAC	3
AGGTTTAAGCTTCATGAGAGATGG	1
AGGTTTAATGTGATGGAAAGTTAA	1
AGGTTTACAGGACACCGGGATGGA	1
AGGTTTACCATATGCCGACGAGAG	1
AGGTTTAGAAGGTTGTTAAGAACA	1
AGGTTTAGATCTAGTCGGGTAGAA	2
AGGTTTATACCAAAATAGGCTAGC	1
AGGTTTATGAAGGTAATAAAATGA	2
AGGTTTATTGTACTATGTTGTGTC	1
AGGTTTCAACCGGTAGTTGTGCGA	2
AGGTTTCCAAAATATGTGGGTGA	1
AGGTTTCCCTAGTTCTACTTAGAC	1
AGGTTTCCTGCTGTGCATTTGAAC	1
AGGTTTCGAACCTAGGTCGTCTAG	1
AGGTTTCGAATCCAGGTCGTCTAG	2
AGGTTTCGCTATGTATGTGTGCTC	1
AGGTTTCTATCTTGTAACCCTGCC	2
AGGTTTCTTGTGGTGGAATTTGCC	1
AGGTTTGACTTAAACATTGTCCTA	2
AGGTTTGATGTGATGGAAAGTTG	1
AGGTTTGATTTATGCTGATGTAGT	1
AGGTTTGCATAATCTAGATAATGC	1
AGGTTTGCCGGCGTCTTCACGAGG	1
AGGTTTGGATGATGGTTGAGTGGC	1
AGGTTTGGTGCATGCAATGCTTA	1
AGGTTTGTACTTTGATGTGATGG	1
AGGTTTGTCTACATTGATGGCTAC	1
AGGTTTGTGATTGGTTGGGAAGA	1
AGGTTTGTGATTGGTTGTGAAGA	2
AGGTTTTAATCTAACTGCAGGTGT	1
AGGTTTTACTGGAGACCCGGGCCA	1
AGGTTTTACTTGCCAGGTGATGA	1
AGGTTTTCACTGATACGGAGGGCT	1
AGGTTTTCCAGATCAGTGGTGTGA	3
AGGTTTTGATAGGTTTATGGGTGA	3
AGGTTTTGGGTCAGCAACCATGCA	2
AGGTTTTGTTTATGATTAGGTGGT	1
AGGTTTTTAGGTGTAACTGGCTGA	1
AGGTTTTTGAATAGATTAGTGCAT	2
AGGTTTTTGGGTTCCTATGACAAA	1
AGGTTTTTTTTGACGATGGAAGCA	1
AGTAAAAAGTGGTTGATGATTGCA	1
AGTAAAAATACATCGGACTTGCTA	1
AGTAAAAATGGACCGGGTCAGA	1
AGTAAAAATTGCAACAAGGTGCAC	1
AGTAAAACCAGCATCGCATCGCTG	1
AGTAAAACGAAGGATGGATTGAAG	1
AGTAAAAGTGTCAAGCTAATAATG	1
AGTAAAATGGAGAGGGATACCAC	1
AGTAAAATTTTACTCTGGGTGACG	2
AGTAAACAGGCCCTACACCTCGA	1
AGTAAACATACAATAAACGGGTGA	3
AGTAAACGGTGTCATGCATTTTA	1
AGTAAACGTGGTGTCTTCTTTTAA	1
AGTAAACTTCAGATCTACCGTGCC	2
AGTAAAGATACCACGGAGCCTAGC	1
AGTAAAGATGGCTTGGTGTTACCA	1
AGTAAAGCAAGCATGTGATACATC	1
AGTAAAGCTTCAAGCAGAGGCTAGC	4
AGTAAAGGGGCCCTAATTAGTTAC	1
AGTAAAGGGGCGGTGAACGGCTGA	2
AGTAAAGTAAGGTGCTATCTATAA	1
AGTAAAGTTTTGATGTGATAGAAA	1
AGTAAATAGACATTGATGCATGCA	2
AGTAAATATCAGTGACCTATTAGC	1
AGTAAATATGTGATACATGATGGA	3
AGTAAATCTAGGAGCATTGCGAAC	1
AGTAAATGAAAGTAAAAGGGTGGC	1
AGTAAATGCTGTATGGGACTTATC	1
AGTAAATGGACATTGATGCATGCA	2
AGTAAATTTGGTGACATGGAGGA	1
AGTAAATTTGGTGTTGTGGAAGA	2
AGTAACAAAAAAATGAGGGCT	1
AGTAACAAAAAAATGAGGGCTG	2
AGTAACAAAAAGGACTACATACAG	1
AGTAACACTGCCATGAGAGAGGAA	1
AGTAACAGGACGGTGATCGTGCA	1
AGTAACATACTGAGGTGGAAATGC	1
AGTAACATGTGTTATAGGTGCTAG	1
AGTAACATTGTGTCTTACGTGCAG	1
AGTAACCCACATGTGCTAACGATA	1
AGTAACCGCTAAAGCGTGGGGTGA	1
AGTAACCGTCGTTGGCTTGGGCCTA	2
AGTAACCGTGCCTAACGTTTCATC	2
AGTAACCTAAAATCGGATGGAACA	2
AGTAACCTACATGTGCTAATGACG	1
AGTAACCTTGGTGACCCACGGTTG	2
AGTAACGAGGCCGATACTGTAGTA	1
AGTAACGCCAACGAATCTCATCC	2
AGTAACTGAGTTGTGAAGTGGTGT	2
AGTAACTGCACCGTGCCTTTATCA	1
AGTAACTTCAGATCTACCGTGCCA	1
AGTAAGAAGGCTGATATGAGTGCT	2
AGTAAGAATCTTGTGTCTTGGTCC	1
AGTAAGACATGGTGTTACTGCAC	1
AGTAAGACATGGTGTTACTGCACG	1
AGTAAGACCCTGTTTAGGTCCCAC	3
AGTAAGACCTGAACGGTTGATGGA	4
AGTAAGAGGTAAAGCTAAGGTGAA	1
AGTAAGAGTAACTAATACAAGGTA	3
AGTAAGCACTATTGTATGAGTTGG	1
AGTAAGCTGAAATCGTTGCCA	1
AGTAAGGACGCTGATTGGGGAGA	1
AGTAAGGACGGTGCTGACGGACAA	1
AGTAAGGAGAAACATTGTTGGTAC	1
AGTAAGGATACTGACGTGGTTGAA	1
AGTAAGGGAAATAACATTATGTGC	1
AGTAAGGGGTAACAACTGATGTGT	1
AGTAAGGGGTGTCTTCATTTGATA	1
AGTAAGGTGCTATCTATAAAACAT	1
AGTAAGGTGCTATCTATAAAACATG	4
AGTAAGGTGCTATCTGTTTTATAC	1
AGTAAGGTGCTCTCTATAAAACA	1
AGTAAGGTGGAAGACAAGCTAGGT	1
AGTAAGGTGGTACTAAACATGCGC	1
AGTAAGGTGGTACTAAACATGTA	1
AGTAAGGTGGTACTAAACATGTGC	1
AGTAAGGTGGTATACTAAACATGC	1
AGTAAGGTGGTATGACTTTATGGA	4
AGTAAGGTGGTGTTTGGATCCAAG	1
AGTAAGGTGGTGTTTGGTTGGAGG	1
AGTAAGGTGTGTGTATATGTTTAC	1
AGTAAGGTTTATTTTGTCTATGGT	3
AGTAAGTAAACATATGCATGTGCA	1
AGTAAGTGCAAACCTAAGAAGGG	1
AGTAAGTGCACGTAACACGATACA	1
AGTAAGTGTTTACTGTTGACGGAG	1
AGTAAGTTGCTGTCGCACTATGCG	2
AGTAAGTTTGATGACATGGAAGA	1
AGTAATAAATATATAGAGGTGCAA	1
AGTAATAAGATGTGCCACATCCGC	2
AGTAATAGGCTAGGCCGATTGTG	1
AGTAATAGGTAGCTGAATGGAATA	1
AGTAATATGTGCAACTTTTATGGA	1
AGTAATCATGTACTGAGCTGC	1
AGTAATCTATGATTGGATGGGATA	2
AGTAATGCGGTGCCAAAAAAGGAA	1
AGTAATGCGGTGTCAAAAAGGAAA	1
AGTAATGCTTAAAGATCGGTGCAG	1
AGTAATGGGGTGTCATAATTCATC	1
AGTAATGGGTATACCCACGGGCA	1
AGTAATGGGTATACCCACGGGCAC	1
AGTAATGGTGTAGAAATATTCATG	1
AGTAATGTGTGCATGACAGGTGTG	1
AGTAATTCTAAAGGATTTGCTACTA	1
AGTAATTGCCTATACTGATTCGCC	1
AGTAATTGCTACCATTTGAGGTCC	1
AGTAATTTAGGAAACGTGTGCG	1
AGTAATTTATTTTGTGGTTAGTCT	1
AGTAATTTGAAATGTGTGCAAAGT	2
AGTAATTTGAGATAGGTGACAGAC	1
AGTAATTTTATGGTCTGTAAGAAG	1
AGTACAACAGATGACGACCTCACC	1
AGTACAACGAATTCGGGCATTAACC	1
AGTACAATCTTAGGGCCTGTTCAC	1
AGTACAATGGTGGAGAATAGCTCT	2
AGTACACAGGACACACATGTCAGC	1
AGTACACCTTAGGCTGCACTCGA	1
AGTACACGGATGGAGATGGACGAA	1
AGTACACGGCAGGTCCTTAAAGT	1
AGTACACTAGTACACGAGTCCTCC	3
AGTACAGATATGATATAAGGTGTA	1
AGTACAGATGGGACATGTCTAGAT	1
AGTACAGATGTGTGTCCCGTGGGG	1
AGTACAGGAAGTCCTTGGATGGTA	1
AGTACAGGATGATGTTTAGATCCG	1
AGTACAGTGATAAGATGTGTGTGG	1
AGTACATAGGGCCCATATGTCAGC	1
AGTACATAGTAGCAAATTGTGCCA	2
AGTACATGAGAGAAGGTCCTGTGC	4
AGTACATTGTGGGACCCATCTTAA	1
AGTACCAGAAGTGCAAGAAGTGTG	1
AGTACCAGGTGTTGTACCTACGTA	1
AGTACCAGTGGCTGACGTGTGGGC	1
AGTACCCAACTATTGTGTGGCA	1
AGTACCCGTTGCCACGGATTGATG	1
AGTACCGATGCATGCATGATACA	1
AGTACCGATGGTGTAGATTCTTTC	2
AGTACCGCCCGGTACAACCTGC	1
AGTACCGGTAACTCACAGTACCAA	2
AGTACCTATTTAGCTTGGTGGATC	3
AGTACCTCTAAGAGTGACTAATGG	1
AGTACCTCTTTTGATCGAGATGGT	1
AGTACCTGTGAGGCGTGAGGTGGA	1
AGTACGAGGGTGAGTTTTTTCTAG	1
AGTACGATGAATATGTACATGCCT	1
AGTACGGATTCTAAGACGCAGTGC	1
AGTACGGGAACGCCATGTAACTGC	1
AGTACGGGAGTACTCAGCAAGCCA	1
AGTACGGTAGTGCTTTGCAACAGA	2
AGTACGTCTAGAGCTCATCCC	2
AGTACGTCTCTGAGTTTGGGCCA	1
AGTACGTGAGTGGGGAAGCCA	1
AGTACGTGGGGCCTGTATGTCAGC	1
AGTACGTGTCTATATATCATCACA	1
AGTACGTTAGAGGTTGGTGTAGAG	1
AGTACGTTTCGGAGTCCAGGACTA	1
AGTACGTTTGAGGTAGGTGTAGAG	1
AGTACTAAGATGTGTCTCATCCCA	1
AGTACTACGAATCTGGACAATC	1
AGTACTAGATCTAGACACTGTAGC	1
AGTACTAGGTGATGTCTAATCGAG	2
AGTACTAGTATGTGTTACATCCC	1
AGTACTAGTTGGTGTTTAGATGC	1
AGTACTAGTTGGTGTTTAGATGCA	2
AGTACTATGAAAGATGGCCGCACC	2
AGTACTCCATCCGTTTTAGGTTA	1
AGTACTCCTACTATTTGGTGTTC	1
AGTACTCGAGGGCGGCAACCCAGA	1
AGTACTCTAGCCGACTAGGACCGC	1
AGTACTGAGGGTACGAGGGCCT	2
AGTACTGATTAAGGTGGAAATGGA	2
AGTACTGCCGAGGGACCTTTTCTG	1
AGTACTGCTCACTGACAGGTGGGA	1
AGTACTGGCAAGTCTATGGGCGT	1
AGTACTGGGGGCTCGATCGAGAC	4
AGTACTGGGTTGCTATATTTTAGG	1
AGTACTGGTACCATGACCAAGAAC	1
AGTACTGTGTCTAGATTCGTAGTG	1
AGTACTTACATTGCTGGTGGT	3
AGTACTTACGTGAACTTTCTACCA	2
AGTACTTCATGGTACCTCATGGTA	2
AGTACTTGATAGAATAGGTGTCAA	1
AGTACTTGCTTAGATTGATACATA	2
AGTACTTGGTAATGTCACATTAGC	2
AGTACTTTGTGCATGTGCTTTCTC	1
AGTAGAAAAGGTAAAAGGTGGCGA	1
AGTAGAACCTCTTGGATTA	1
AGTAGAACTCGGAGACAATGAACC	1
AGTAGAAGTGTAGAACTAGGATGC	1
AGTAGAATCAAGGGTACAGAGT	1
AGTAGAATTGCCACGTAAACGCT	1
AGTAGACATGGTGCTGCGATTGCG	1
AGTAGACGTAGCCACGTAGGTGAG	1
AGTAGACTAAGTGGTATGCTAGA	2
AGTAGACTGTGTGAACTGCGGTTA	1
AGTAGAGAGAGGGGATGGAATGGC	1
AGTAGAGATGCCTGGTTTCACTGA	2
AGTAGAGATGCTAGATGATGCA	1
AGTAGAGGATGAGGGCGATGGGCA	1
AGTAGAGGTGACTATCACATCCAA	1
AGTAGAGGTGTCTTCTCTTTA	1
AGTAGAGGTGTCTTCTCTTTAC	1
AGTAGAGGTGTGACGTGAGAATGG	1
AGTAGAGGTGTTTGGTTTGCTACC	1
AGTAGATAACCACGGCTGCAT	1
AGTAGATATCTATTGAAAAAGTGT	1
AGTAGATCTCTACGGCAAGTGCA	1
AGTAGATGATAGAAATAGTTGCGT	2
AGTAGATGGAAGGAGTACCTCGGA	1
AGTAGATGGAAGGAGTATTACAGG	1
AGTAGATGGGGGCATGGCAAAGGG	1
AGTAGATGGGGTTGCTATATTTTG	1
AGTAGATGTAAGTGCCCCAACTGG	1
AGTAGATGTGCCTTATATTATGG	1
AGTAGCAAATTGTGCCAAAAAAGTG	1
AGTAGCAAGATTAAGGTGATGTGA	1
AGTAGCAATGGTTCCTCTGGTCAC	1
AGTAGCAGGTTGCTGGTGCACGTC	1
AGTAGCAGTGGCTAGTAGGTGGAC	4
AGTAGCAGTGGCTGATAGGTGGAC	1
AGTAGCATCAGAGGCAAACATGGC	1
AGTAGCATCCCAGGTCCTGAGTTC	1
AGTAGCATCTCGAAGATCGTGTCA	2
AGTAGCATGAGTTGATGGAGATAA	1
AGTAGCCAAATGTGTTTGAACTGA	1
AGTAGCCACCGGAGATGGAGGGGA	1
AGTAGCCACGTACCTAGAGTGCC	1
AGTAGCCAGGGTTGTGGAAGGCCG	1
AGTAGCCCATCTTTGTCGAGCCTA	1
AGTAGCCGAATGGAGATCCGCTCA	3
AGTAGCCGACGAGCTATGGCGCCA	1
AGTAGCCTAAAACGATGTTTATTT	1
AGTAGCGATGGGCTATGAGCAGAT	1
AGTAGCGGACTACAGATTTATAGC	1
AGTAGCGTTGCGGCTGTGCTGTAG	1
AGTAGCGTTGGATGCTTGGGGGAC	1
AGTAGCTAATACGTGATGGTTTGA	2
AGTAGCTATCATCCACTCAGTGCG	1
AGTAGCTCATCGAGTCGCGTCCGCA	1
AGTAGCTGCCTAGCTAGATGCTGC	1
AGTAGCTGCGTAGCGCGACGGTGA	1
AGTAGCTTACTTAGGGACTGCTA	1
AGTAGCTTACTTAGGGACTGCTAA	1
AGTAGGAAAAAGGCCTATAGGTAC	1
AGTAGGAATATTTGTTGTGCACCC	1
AGTAGGAATCCTATTAGGTGTCT	2
AGTAGGAATGATAGGGTTTTTGAC	2
AGTAGGACTACGTAATCACCAGGC	3
AGTAGGAGAAGATAAGATCGGTGCG	2
AGTAGGAGATCTCTTGTGAAGTGG	2
AGTAGGAGCCATGCTTGACGAGAG	1
AGTAGGAGTCCTATTAGGTGTCT	1
AGTAGGAGTCCTATTAGGTGTCTT	6
AGTAGGAGTCCTATTATGTGTCT	1
AGTAGGAGTCCTATTATGTGTCTT	1
AGTAGGAGTTTCTATCAGGTGTAT	1
AGTAGGAGTTTCTATTAGGTGTC	1
AGTAGGATACATCCTATTCGGTAC	1
AGTAGGATGAGGCTCGATTTGATG	1
AGTAGGATGGTAGAAACTGGTTTT	2
AGTAGGCAACCTACTGCGTAGTGA	1
AGTAGGCCTGAATATGATGTCTA	1
AGTAGGGCGAAAGGATTGCGGCGG	1
AGTAGGGCTATTACCTGGTAAGGG	1
AGTAGGGCTATTACTTGATAAGGG	1
AGTAGGGGATTGAAAAGTGTGGTC	1
AGTAGGGGCGAGAGTGGTAGTGAC	1
AGTAGGGGGAGTAAATTAGACTTA	1
AGTAGGGGTACTTACTGAGATGGC	1
AGTAGGGTATTACGCTTCTCA	1
AGTAGGGTGTTACGCTTCTCAGCG	5
AGTAGGGTGTTACGCTTCTCAGCGG	1
AGTAGGGTGTTACGCTTCTTAGCG	1
AGTAGGGTTGGACGGTTGGTGATC	1
AGTAGGTAAAGAGAATAGTTGTGA	1
AGTAGGTAAATATGCTGACATGGA	1
AGTAGGTAAGGTGTCTATTTTGAT	1
AGTAGGTAGAAGTGAATGATGGA	7
AGTAGGTATAGATGAATGGTGGA	1
AGTAGGTATGTTGAGGTCGAAA	1
AGTAGGTGAAAATGGACCATTGTC	1
AGTAGGTGATGTTACCTCTCTGGT	1
AGTAGGTGCCAAAGATGGTAGTGC	1
AGTAGGTGCTATAATATTATTTA	1
AGTAGGTGCTATTGCGGATGCTAA	1
AGTAGGTGCTGAGGTAGAGTGCGA	12
AGTAGGTGGCCGAATTGGATTCCA	2
AGTAGGTGGGCCTATGGTAGGTGA	1
AGTAGGTGGTGAATTGAAATGTAC	1
AGTAGGTGTATGAGTATGATACT	1
AGTAGGTGTTTTACTATGGTCTC	1
AGTAGGTTGGTGTATTCTAAGGAT	1
AGTAGGTTGGTTTTTATGGTACGA	2
AGTAGGTTGTGCTAATACTCCTTC	1
AGTAGGTTTGTAGGCCACGTACGC	1
AGTAGTAAGATGGGTCCCGATGTC	1
AGTAGTAGCTAGTAGGTGATACAC	1
AGTAGTAGTGTGCTGTGGGATGGG	1
AGTAGTATCTCGAAGACTGTGTCA	1
AGTAGTATGGATGTCAGAGACTAG	2
AGTAGTCACGCCTTGCGCTCCCCA	2
AGTAGTCGACGATGGAATCATGGA	1
AGTAGTGATGATGCGTGGGCCA	1
AGTAGTGGGCTACATATATGTAAC	1
AGTAGTGGGTCTCACCGGTGACAA	1
AGTAGTGGTGGTGACAAGTCTATC	1
AGTAGTGTCTATGGTGTCATGTAA	2
AGTAGTGTTTTGGTAGGTGTATGC	1
AGTAGTTAAGTGGGTGTTAACTAA	1
AGTAGTTAATTTCCGGTGATTGC	1
AGTAGTTATGGTGTCCATTCTCAC	3
AGTAGTTCGAATGGTGTAAGGTT	1
AGTAGTTTACTTGGGGAGCAGAGC	2
AGTAGTTTGCTACAGTGCTATGAC	1
AGTAGTTTGGGAAGTGTGCGCGCA	2
AGTATAAAGATTTGGTGTCAGATG	2
AGTATAACGCTATAGAGAGGGTCC	1
AGTATAACTAATGTGCCCACAAAC	1
AGTATAAGCCGGATTTGTAGAT	1
AGTATACCTCAGCCGGAGCACATA	2
AGTATACTCCGTACGTGGCTGCCT	1
AGTATACTGGTGATTTATTGCAAA	3
AGTATAGATGCCTGGTTTCGCTGA	1
AGTATAGATGTCTGGTTTCGCTAA	1
AGTATAGATTTGAGGTAGGGTAC	1
AGTATAGCAGGTGGCCGAATCGGA	1
AGTATAGCCCTTAGCGACAAGCCT	1
AGTATAGGACTACTTGTGAGACTA	1
AGTATAGGATGTGCTAGATTTTCT	1
AGTATAGTATATTTAAGGGTGTGT	4
AGTATAGTGCCTAGTTTAGTTGAT	1
AGTATAGTGTTTGGTTGGTTGTCA	1
AGTATATAAAAGGGCATATTAGAA	1
AGTATATATGTAGAGCTTGGGAGG	1
AGTATATCTAAATACAGGTGTAAG	1
AGTATATGAGAGGAACCGATTGAC	1
AGTATATGATAATCAGGAAGGTGG	1
AGTATATGGATATGTCACAGGTAC	1
AGTATATGGCGCCATATTTCTAGC	3
AGTATATGGGCTGCCCATAGAGAA	1
AGTATATGGTGAAGATATGTGGCA	1
AGTATATGGTTAGACACGATTAC	1
AGTATATGTAGATGGTAGGGGG	1
AGTATATTAACTGGGGCGCCCATA	1
AGTATATTAAGATAGGGCAAAGAA	1
AGTATATTGTTTCTCGGCTGTGAC	1
AGTATATTTAAGGGTGTGTGTATA	1
AGTATCCCGATACTACGATACGAT	1
AGTATCCCGATTCGTATTCTAGTA	1
AGTATCCGACAGGGCTAGCTAGA	1
AGTATCCGGGTGATCTGTGATTCT	1
AGTATCCTACAATAGTTAGAGATAA	1
AGTATCGAGGGCCTAGATGATACC	1
AGTATCGATGTCTGGATAGAGGAG	1
AGTATCGGTGCGTCAGCCGTGGAC	1
AGTATCTAGGTACTACGAGGTAAC	3
AGTATCTCGATCCTACTATTCATT	3
AGTATCTGGTACAGAATAGGGTCC	1
AGTATCTTATGGTACCTAGGTACTA	1
AGTATGAAAGTGAGTTGTATGCCA	1
AGTATGATATCAGGCTCTTTC	1
AGTATGATGTGATAAAGTGTGGCT	3
AGTATGCATGGAGCCTCTATCGAC	4
AGTATGCCGTGGTTTAAAAAACTG	1
AGTATGCCTGGTGTGGTTGTACT	1
AGTATGGAAGTTTTAATCAGATGCC	1
AGTATGGAGCCCGTCACCGATGAC	1
AGTATGGAGCCCGTCACCGATGAG	1
AGTATGGAGGTAATACTACATGGT	3
AGTATGGATTCCAAGATACCTGTG	1
AGTATGGCTAGCCGGTTCAACCA	1
AGTATGGCTTGACTTAACTGCGAC	1
AGTATGGGAAAAAGATGTGGCCTG	1
AGTATGGGGATCGTTGGTGCTAGG	1
AGTATGGGGGTGTTTAGATATAGG	1
AGTATGGTGTAGTCACGGTAGCAA	1
AGTATGTATAGGTGGTTACATGCA	2
AGTATGTCTACATGAGTATCTATA	1
AGTATGTCTACATGGGTATCTA	2
AGTATGTCTACATGGGTATCTATA	2
AGTATGTCTACATGGGTATTTATA	1
AGTATGTCTAGATACGTTGTACT	1
AGTATGTCTAGTACTGAGAAGAGC	1
AGTATGTGGAATGATCCAGGTGGT	1
AGTATGTGTAACACATCTGGTTGC	2
AGTATGTTAGAGGTAGGTGTAGAG	1
AGTATGTTGAGTTGAATGGAAGA	2
AGTATGTTGGTTCCTCACGTA	1
AGTATTAGATAGGAGACACACACA	1
AGTATTAGGAAATAGGAGGTGATC	2
AGTATTATAAAGGGTGTCGTATGG	2
AGTATTATATAGGGTGTCGCATGG	1
AGTATTATGATGCCTCACATCCCT	1
AGTATTATTGGTGGGTCCAAGGAC	1
AGTATTATTTTGAATCTGGGTGCT	1
AGTATTCGATGTAACAGCGTGAC	1
AGTATTCTGTGGGCCATATACGGC	2
AGTATTGAATGTGCCTTGATTCGT	1
AGTATTGACCCCGGTTTAACTGAC	1
AGTATTGAGGTGTATAAAATCGGT	2
AGTATTGCCACCAGTTTAGCTGAC	1
AGTATTGCTGATGTGTGGGCCG	1
AGTATTGCTGGTGTCGTTCTCTAG	1
AGTATTGGGCTTTTTTTTTTGGGAC	1
AGTATTGGGGAGCGAGGTATTAGC	1
AGTATTTAAATTGAGTGTCTAGAT	2
AGTATTTAGTAATGTCATGGATGC	1
AGTATTTCACGTAAAACAAGGTGG	1
AGTATTTGAGTGAACTGTTGATGG	1
AGTCAAACCCAAGACCTCAAGTGC	1
AGTCAAACGTTGGACATGGAAACC	1
AGTCAAACGTTGGCACAGGAACCC	1
AGTCAAACGTTGGGTACGAATATC	1
AGTCAAAGCGCTTATGATATGAAA	1
AGTCAAAGGGGTTGGCTCTCATGC	1
AGTCAAAGTTGGACACGGAAACTC	1
AGTCAAATACACGGTGCATTTGTC	1
AGTCAAATGTACGGTGCCTTTGTC	1
AGTCAACACAGGGGTAGTCCTTGC	1
AGTCAACAGTGTCAAATATTTCG	1
AGTCAACCACGATCAACCTGTCAC	1
AGTCAACCTACCTAGTATAATGAA	2
AGTCAACGGCGTCATCTATTAGAA	2
AGTCAACGGTGATAAATATTTAGC	1
AGTCAACGGTGTCAAACATTTAGG	1
AGTCAACGGTGTCAAACATTTCGA	3
AGTCAACGGTGTCAAACATTTTAA	2
AGTCAACGGTGTCAAACATTTTG	1
AGTCAACGGTGTCAAACATTTTGA	28
AGTCAACGGTGTCAAACATTTTGG	1
AGTCAACGGTGTCAAACATTTTTAA	1
AGTCAACGGTGTCAAACGTTTCGA	1
AGTCAACGGTGTCAAATAGTTTGA	1
AGTCAACGGTGTCAAATATTTAGA	1
AGTCAACGGTGTCAAATATTTGGA	2
AGTCAACGGTGTCAAATATTTTAA	4
AGTCAACGGTGTCAAATATTTTGA	5
AGTCAACGGTGTCATATATTTATA	3
AGTCAACGGTGTTAAACATTTCGA	1
AGTCAACGGTGTTAAACATTTTGA	3
AGTCAACGGTGTTATACAATTAAA	1
AGTCAACTACTATTAGGTATGTGA	1
AGTCAACTGACGGGAGGGGTCAAA	2
AGTCAAGAACGACAAGTTTGCCTG	1
AGTCAAGAGGACAAGGTTGGGGT	1
AGTCAAGAGGTGTGGAACTAATCC	1
AGTCAAGCCATACTTTACTAGCAC	1
AGTCAAGGTGTCAAACATTTTGAA	1
AGTCAATGGCGTCAAATATTTCGA	1
AGTCAATGGTGTCAAATATTTAGA	1
AGTCAATGGTGTCAAATATTTCGA	1
AGTCAATTCATACAATAGTTGCTT	2
AGTCAATTGCACTGTGCCTTTGTC	1
AGTCACACATATATGGGTGCTTGC	4
AGTCACACTTGTCTAACATTGCCT	1
AGTCACCACATGTGTCTAGCTGTC	1
AGTCACCACGAACGCCTCGCTGTC	1
AGTCACCCACGAGTGTCTCGATGG	1
AGTCACCTGCACACAATCAGATAA	1
AGTCACCTTCTGATGGGACGGCCC	1
AGTCACGCACAATGGTGGTGTTCT	1
AGTCACGCTACGTGCCTACAACCC	1
AGTCACGGTGGTAGAGTGGTAGAG	1
AGTCACTGGTACGTGGGTCTCACC	2
AGTCACTTTAGGCGTCTCACTGTC	2
AGTCAGAGGTGAAATTCTTGGAT	1
AGTCAGATGTACATAGCCACTAAC	1
AGTCAGCAAAATTGTGCGGTC	1
AGTCAGCGTGTCTACTTCGTCTGA	2
AGTCAGGTGGACCATATATTTATA	1
AGTCAGTGGCAAATCGTAGACTTG	5
AGTCAGTGGGTGTTGTTGATGGCA	1
AGTCAGTTGACATGCGGGCCCGAT	1
AGTCATAGGTGGTGTTTGGTTGAA	1
AGTCATCTGTGACGGGCCTAGCTG	1
AGTCATGTGATTGTGTTGTAA	1
AGTCATTGCTTACATGGTCATGAA	2
AGTCATTTAAATTGGGAACTTAGC	1
AGTCCAACTCATAAGTCATAATGC	2
AGTCCACTAATGGAAAGGTTCCT	2
AGTCCAGAAAGCGTGCACAATAAA	2
AGTCCAGAACCGGTGAAAGGAGGG	2
AGTCCAGCTACTACATGGTACT	1
AGTCCATAACGATGATACGACCTG	1
AGTCCATACAGAAGACAGAGTGCA	1
AGTCCATACGAATGCACACACGCA	1
AGTCCATAGTAGCAAATTGTGCCA	1
AGTCCATGAGGGTGTGCGATGCGC	1
AGTCCATGCCTCTGGTTTTTGAGG	1
AGTCCCACATCGGTAATTGATGA	4
AGTCCCAGGAAACAGTGCTGGTATC	1
AGTCCCAGGTTGTAAACCGACCTA	1
AGTCCCATTGCCATCCCTAATACA	2
AGTCCCGAGGATTGAATAGATGTG	1
AGTCCCGGTTGATGGCTACAACGG	1
AGTCCCGGTTGGTGTACTAAAGAT	1
AGTCCCTAGATGGCTGAAGGTTGA	1
AGTCCGCGTGGATTGGTGGGCGAA	1
AGTCCGGAAAAGGCTAGTGCCGTC	2
AGTCCGGACTGCGATGGTGGAGGC	2
AGTCCGGGACCAAGAATTCGGGAC	1
AGTCCGGTAAGTCTACGTACGTA	1
AGTCCGGTCCGCCTGCGAAAATAG	1
AGTCCGGTGCTAGCCTTCTCCTGG	1
AGTCCGTACTACAGCTGGCTATAA	1
AGTCCGTGCTACAGCTGGCTATA	2
AGTCCGTGTGATGTGAATACCAAC	1
AGTCCTACAGTGATGGATATAAGC	2
AGTCCTACGTTTCGCCGGCCCTGG	1
AGTCCTAGAATTGATTGATGGGAA	1
AGTCCTAGGATGGGTCTCATCCCA	1
AGTCCTAGGTGAAATAATCGGGAC	1
AGTCCTATGTGACATTTTGGGGCT	1
AGTCCTCGGGCCCGGTGTACTCCT	1
AGTCCTGGCGGCAAGTGCGACA	1
AGTCCTTTAAATTTGTCATGTGGG	1
AGTCGAACCTAGGACGTAAAGTGC	1
AGTCGAAGAATGGAAGCCATAAGG	1
AGTCGAAGCTGTCGCGGAGGTGCT	1
AGTCGAAGTACCTAGAAACATCTT	1
AGTCGAATGTGCGAGCTGGGCCTA	1
AGTCGACATGATTGATGTAGTC	1
AGTCGACGACGATGGTGTGTGGCA	1
AGTCGACGGTGTCAAACATTTTGA	1
AGTCGACGGTGTCACATAGTAAAA	1
AGTCGAGATGAGGTTGGCACTGCC	1
AGTCGAGCCTGTTTAAACTACAAG	1
AGTCGAGGATAGATGATGAACACT	1
AGTCGAGTGGGCCAATGGGATAGT	1
AGTCGATAGTCGATACCAGGGTAC	1
AGTCGATCCCAAATATGTGCA	1
AGTCGATCGATGGACACACGTAAA	1
AGTCGATGCATCGGATGGACGCC	2
AGTCGATGCGATATGTGGATGCCA	1
AGTCGATGGTAGACAACTGTGC	1
AGTCGATGGTGTGAAATGACTGGT	1
AGTCGATTAGTGGCTGCCATTCT	1
AGTCGCACAGTCGGCTCAGGTGAC	1
AGTCGCACGCCGGGTTGGTATACA	1
AGTCGCCGCCTGACTTTTGCCAGC	1
AGTCGCCGGTTGATCTAGTCGAAT	1
AGTCGCCTTGGGAATAAAATCCTG	1
AGTCGCGCCTGTGATGATTGGTCC	1
AGTCGCGCCTGTGATGTTTGGTC	1
AGTCGCGCCTGTGTTGATTGGTCC	4
AGTCGCGCCTGTGTTGTTTGGTC	1
AGTCGCGCCTGTGTTGTTTGGTCC	2
AGTCGCTAACACTGTGCCAAATAG	6
AGTCGCTCAACATTGAAGTCGCCT	1
AGTCGCTGGTGTCATCTATTAGGA	2
AGTCGGAGAGCAGACTGGTGTTGA	1
AGTCGGCGGTCTAACCCAGATGGC	2
AGTCGGCGTGCTAGTTGCAACGAC	4
AGTCGGCTAAATGCTGAGGTGTA	1
AGTCGGGAAGCTGATGTTGAGGTA	1
AGTCGGGGGCTACACCTATTAGGT	2
AGTCGGGTTGTGCTGACCCAAAAG	2
AGTCGGTGCGGACTCTGTTCGGAA	1
AGTCGGTGGTAGATTGTAGAAGCA	1
AGTCGGTGGTGCATGCGTCACATG	1
AGTCGGTGTTGCCACGTGGCTCTA	1
AGTCGGTTGATGCAGTGTCGCGAG	1
AGTCGTAGGTGCATGACTCTATGT	1
AGTCGTCATGATAGGAGATGGAAC	1
AGTCGTGCTAGTTGGGAATAC	2
AGTCGTGTCTGGACCGATGGTGTA	1
AGTCGTTGGTGATGAAGTTGAGGC	1
AGTCGTTGTAGGCCCGATGATGAC	1
AGTCTAACAGATAGTCGGTGCTCA	1
AGTCTAAGGCTGAAGTTGACTGACA	1
AGTCTAAGTCAAAACAAACAAGC	1
AGTCTAATAAAGGAAAGATGACTA	1
AGTCTAATTGTGCCATAATTTGAC	1
AGTCTACAGATTGATAGCCACTAT	1
AGTCTACATTTAGTCTAAGTGTCC	1
AGTCTACGGTGTCAAACATTTTGA	1
AGTCTACGGTTGATGGGCTGGGCT	1
AGTCTACGTAACGGCTGAGTCAGC	1
AGTCTACGTCTTCACCGACCGGCT	1
AGTCTACTCAATACATGATAGAAA	2
AGTCTAGAGGGGTTGCATAATGTA	1
AGTCTAGAGTGCAGTTGTGGAGCT	1
AGTCTAGATCAGCTAAAGGTGCAA	1
AGTCTAGGTGTCGTCGGCGCTGGA	1
AGTCTAGTGGGCAACTACCGGTGT	1
AGTCTATACACAAACATGCGGGAC	2
AGTCTATTATTGAGGTGTACATGT	4
AGTCTATTGTTGAGGTGTACATGT	1
AGTCTCAACTAGAAATAGGGTACGC	1
AGTCTCAGTGAAAATCGAGGGCTA	1
AGTCTCCACAATAGCGACGGTGCA	1
AGTCTCGATTGTGCAACAGGGATA	1
AGTCTCGGGTGAAATAACCAGGAG	1
AGTCTCGTAGCAAGATGTGGGGTA	1
AGTCTGAACCGTTCGATGGCTGCA	1
AGTCTGAAGAATGAGGGGTGATGC	1
AGTCTGACCGCAGGTATGTGGGCG	1
AGTCTGAGAGGGAAGTAAGAATTG	1
AGTCTGAGGGTGTGTTTGGTTCA	1
AGTCTGCAACTGAGTGGGCCA	2
AGTCTGCAATCAAGATATGGATCC	2
AGTCTGCAGTTGAGTGTCACTGAC	1
AGTCTGGCTGATTACGTTGTGCAA	1
AGTCTGGTCAAGCGTGTCACGCTG	1
AGTCTGGTTCTCGACATCGTCTGA	1
AGTCTTAAGATGTGTCTAATCCCA	1
AGTCTTACATCGTGAAACGGAGGG	1
AGTCTTAGGGGCTGTTTGGTTGGT	1
AGTCTTCACCGAGTCTTTGTCCTA	1
AGTCTTCGAGGTAAGGTTTGCGTG	1
AGTCTTCGTGAGGGGCAGCGTGCA	1
AGTCTTGACAAACATGTGCTTCAG	1
AGTCTTGTACTAGTGGCACGAAAG	1
AGTCTTGTCGGTGGTGTCGTTGAC	1
AGTCTTGTGCTTGACGATGGCTCC	2
AGTCTTGTTATGGGCCGTCATAGA	1
AGTCTTTAAGGTTGTGTAGGCCCA	1
AGTCTTTCAGATGCTGGTGCTAGC	1
AGTCTTTTGGGCAGCGATTGTTGG	2
AGTGAAAAAATCGAAGAAGGTGCT	2
AGTGAAAAACAGGAACGGGGATGG	2
AGTGAAAAATATGGCGCCATAAAT	2
AGTGAAAAATCATGGGTGTTGGC	1
AGTGAAAACGAGTTAAGTGTTGG	1
AGTGAAAAGTTTGCTACCGGTGGG	1
AGTGAAAATGATCTTCGCTGGCGC	4
AGTGAAAATGATGACCGGAATCTCT	2
AGTGAAAATTAAATGAGAGGTGGT	1
AGTGAAACAGATGATTGTCCTGGT	1
AGTGAAACAGTCTGACGCGCCGAA	1
AGTGAAACATTATAAGTGCACTAG	1
AGTGAAACCAGGGATGTGCCACTG	1
AGTGAAACCCCCATTGTGACTGGC	2
AGTGAAACCTCGTTACAAGTTTAA	1
AGTGAAACGCCTATGATAACTTCG	1
AGTGAAACTTAACGGTTAGATTGAA	1
AGTGAAAGAGGTCGACGTATATGT	1
AGTGAAAGCACCCATATATGTGTG	1
AGTGAACAGCTGCCATATCGAACG	1
AGTGAACAGTGGAGGGTTGTGAT	1
AGTGAACATGGTGTCTCCTTTCAA	3
AGTGAACCTTCACGAGAGATGGAC	1
AGTGAACGTGGTGCTTCCTTTCAA	2
AGTGAACGTGGTGTCTTATTTCAA	1
AGTGAACGTGGTGTCTTTTTTTAA	1
AGTGAACGTGTGTTCTGAGTGTCT	1
AGTGAACTATCAACTTTCAGTGAC	1
AGTGAAGAAGAAAAGGTGTAAGAC	1
AGTGAAGAAGAGTGTTTTTCGA	1
AGTGAAGATAGGTGAGAAAAGTGA	1
AGTGAAGATAGTGATAGCGTGCTG	1
AGTGAAGATCACGAGTCTTGTGCA	2
AGTGAAGGGGTCTACAACCACGCA	2
AGTGAAGGGTAGCTTTGTGGGTAC	1
AGTGAAGTTGCCACCATTGGTAGG	1
AGTGAAGTTGTGGAGCAGCCTA	1
AGTGAATACATCCTAACATTTGCC	1
AGTGAATAGTACCCGTACAGTGCG	1
AGTGAATCAGTTTGAAGCGATGGG	1
AGTGAATCGTCCGGTATTAAAAG	1
AGTGAATGAAGCGGGAGGTAA	3
AGTGAATGATGGTTAATTTGT	1
AGTGAATGATGTTGCGTAGATCGG	2
AGTGAATGGTAGTGATCCCTTCTA	1
AGTGAATGGTTTTGTAAGTTGAGG	1
AGTGAATGTGAATGAATGAGTTGG	1
AGTGAATTGCCTATATTTCCC	2
AGTGAATTTAGTAGGCGGTGCAC	1
AGTGACAAAAACACGGTGCAATAA	2
AGTGACAAAGGCATGGTGCAGTC	1
AGTGACAAAGTCCTGCAAATTGGG	1
AGTGACAAGAGGTATGTGGTTTCA	1
AGTGACAATAGGTGCCGGTTTCCC	1
AGTGACAATGACACGGTGCAATGA	2
AGTGACACGCTTTTCAAACTGCTA	1
AGTGACACGGGAGATGATGATGAC	2
AGTGACATATAAGGGATATAAGGG	1
AGTGACATGAGGTGTCGTTCAGCC	1
AGTGACATGCAAAGAACGAGGGGA	1
AGTGACATGGGCGAATCTCGGACG	1
AGTGACCTGGCAGACCTGCTCCAC	1
AGTGACCTGGGAGATGGCGCCGAG	1
AGTGACGCTTACGTGTCAGTGCGA	1
AGTGACGGCAGTCTTGGGGTGGTC	2
AGTGACGGGCCGTTGAATAGAAGC	1
AGTGACGGTGATAGTATGGTTCT	1
AGTGACGGTGTTTTGTTTTGGCCC	2
AGTGACGTGGCAGACGGCCGTTCG	1
AGTGACTCAAATGCGGATATGTA	1
AGTGACTGACTGGTAATGGGTGAT	1
AGTGACTGATTGCTGGTGGGCCT	1
AGTGACTGGGATAGATCGGTGGGA	2
AGTGACTTACAATGTAAATACATA	2
AGTGACTTCGTTGATCTCAAGATA	1
AGTGACTTCTAGCCTGTGACGGAC	1
AGTGAGAACACTGAAAGCTGGTAC	1
AGTGAGAATCTTGTGTCTCGGTAC	1
AGTGAGACGTACGCTGGATCGAAG	1
AGTGAGAGAAAATAATGTGGCCCC	1
AGTGAGAGAAATCCTAGGTTGC	1
AGTGAGAGGTGACGTACCCATCGA	1
AGTGAGATAAGAAATGTGCCGCTA	1
AGTGAGATGATAGGGAGTGTT	2
AGTGAGATGTCCTATGTCCTACCCA	1
AGTGAGCAATGCAGTCGATATGGG	3
AGTGAGCACTGTATTAACTGTGAA	1
AGTGAGCCCCACGCAGAGGTGTAG	2
AGTGAGCCGTAGTTTGGAAACCTA	1
AGTGAGCGTAACTCAACAGGGTTC	1
AGTGAGCTAATGTTTCTAAGCAGG	1
AGTGAGCTTAAGATTTTGAGAAAC	1
AGTGAGGAAAGAGAAGGTGAGCC	1
AGTGAGGACAAAGTGTGCAGAAAT	1
AGTGAGGATTGTCTGCAGTACTGC	1
AGTGAGGCAAATGGTGAAGAATG	1
AGTGAGGCCCATTATAAAGTGAGA	1
AGTGAGGCCCTATTGATGACTTCG	1
AGTGAGGCGTCTGTGGTGACTTCA	1
AGTGAGGCTGAATAAACTACATCA	1
AGTGAGGGTACTATTTAGAGTGTC	3
AGTGAGGGTTGTCCTGGCACGGAA	2
AGTGAGGTATCTACAATTGGTAGG	1
AGTGAGGTCAGACCAGTCAGGTA	1
AGTGAGGTCGCTGGATATAACTA	1
AGTGAGGTGGAAGAAGATTGCTGG	4
AGTGAGGTGTTTGTGTTAACTATG	4
AGTGAGGTTGTCTTTAGTTCCAC	1
AGTGAGGTTTGCAGCAAATTGAA	1
AGTGAGTCCATCAGCTGCCATGAA	1
AGTGAGTGAGCGAAGTGATGAGAA	1
AGTGAGTGATTTTTGCAAGGTGTG	1
AGTGAGTGCATGACGTATGGGTAA	1
AGTGAGTGGTACTACATATAGAGG	1
AGTGAGTGGTGAAAGATTGTGATT	1
AGTGAGTGTATGACATATGGACCA	1
AGTGAGTGTATGACATGTGGGCCA	2
AGTGAGTGTGCGTGCGTTATGAGT	1
AGTGAGTTTACGGGTTAGCCACT	1
AGTGAGTTTGGGTAGTGTCCTAGG	1
AGTGATAAAAGCACGGTGCATTGA	2
AGTGATAAACGGTATAACGCTGGC	2
AGTGATAAAGGAAGTGTATACAT	1
AGTGATAAAGGCACGGTGCAGT	2
AGTGATAAGATGTGTGCGCGTATA	1
AGTGATAAGTATTGTATGGATCTC	1
AGTGATAATTTGTGGTAGATCCTA	1
AGTGATACAGGTGGTACTAGGGCT	1
AGTGATACATGGTGATGTGAGAGT	1
AGTGATACCGGGAAGCCTCACACT	1
AGTGATACTAATCATACTACCTGC	1
AGTGATACTAGCCACGTAATCTGC	1
AGTGATAGAGAGATGGTAGACCTCA	1
AGTGATAGGAGTGGTGGTGACAG	1
AGTGATAGGCTTGCCACGGTACCA	1
AGTGATAGGGTGTACATGTGTGAG	2
AGTGATAGGTGATTGCTGGATGA	1
AGTGATAGGTGCCGGTTTAGAA	1
AGTGATAGGTGTCGTAACGACGTA	1
AGTGATATGCTAAAGATGTAAGG	1
AGTGATATGGACTACAAAGGGAAT	1
AGTGATATGGTCCACATAAACAGA	1
AGTGATATTGATGAGTACGCC	1
AGTGATCAGAGATGATTTGGTACC	2
AGTGATCAGGAGCGTCCACGTGGA	2
AGTGATCATTGCCGGTCGGCGCCC	1
AGTGATCCCTAGAGCAGGTTCCCTA	1
AGTGATCGAGGATGCCGGGTGACA	1
AGTGATCTAGTGATTAGATGGCCA	1
AGTGATCTCGAGGGTTGTCACCAC	1
AGTGATCTCGGCGTGCATTTGACC	1
AGTGATCTGGTGTAGTTGTCGATA	2
AGTGATGAATCTGCCATAGCTTGC	1
AGTGATGCCACTAATGAACTGCCA	1
AGTGATGGGAACTAGATTTTAGGA	1
AGTGATGGTACCATGTTAATGTCC	1
AGTGATGTGGTGTTGAAGTTATGG	1
AGTGATTAGCACTAAGATGGTTGCCATGGA	1
AGTGATTATAGGTGTCGGTTATGT	1
AGTGATTCCCTGCATTACGTCA	1
AGTGATTGGGATAGATCGGTCGCC	3
AGTGATTGGTGTTGTGCTTGT	2
AGTGATTTAGTGCTTACTACCTG	1
AGTGATTTGGGACCTAGATGACAC	2
AGTGATTTTAAAGTCAGGAGGTAC	2
AGTGATTTTAGAGAGTTGCACTA	1
AGTGATTTTGGGTGGACGTGACAC	1
AGTGATTTTGGGTGGATGTGACA	2
AGTGATTTTGGTGGTATGTGACAC	1
AGTGATTTTGTGCATTAGATACCA	1
AGTGATTTTTCTGTACGAGACCCC	1
AGTGCAAACCATATATGTGGTGGA	1
AGTGCAAATACTAGTAGTGGGTCT	1
AGTGCAACGAATCTGAACCGTCT	2
AGTGCAAGAACTTGAGAATTGAGC	1
AGTGCAAGAAGTGTGTGCGTAGA	1
AGTGCAAGAAGTGTGTGCGTGGAC	2
AGTGCAAGGAGTGCAACTAACACC	2
AGTGCAAGTACTAGTAGGGGGTCC	2
AGTGCAAGTGGCTATGCGAGTGG	1
AGTGCAAGTGGTGAGTGTAAGCTG	2
AGTGCAAGTTCGTTGTAGTGGGCC	1
AGTGCAATCGGATCATGATTTGGA	1
AGTGCAATGACAAAGGGTGTGTGA	1
AGTGCACAAGATCAGTCATTTGCG	1
AGTGCACAAGGATACCAAAGGATG	1
AGTGCACACTCTCCGAACACACGC	1
AGTGCACAGAAAAAATGAGGGGAC	1
AGTGCACAGGATACCAAAGGATGG	1
AGTGCACATTTGAGTATTCGCGTC	1
AGTGCACGAACTTGTAAAATGCTC	1
AGTGCACGTCACAGATGATGGTCA	1
AGTGCACTCTCAGTTACCACACAC	1
AGTGCACTGGAGATGACATCATTA	1
AGTGCACTTGTAGATTTATCTGTA	1
AGTGCACTTTACATTACATCCC	1
AGTGCAGACCATGAAACATCATGC	1
AGTGCAGCCATGAGTTTTCGTCT	2
AGTGCAGCCATGGTTTTCCACGCC	1
AGTGCAGCCGTGGATATCCATGCC	1
AGTGCAGTGCAGGGAATCAGATGC	1
AGTGCAGTGGTAAGTGGTGTGTAA	1
AGTGCAGTTCAACAGGTACCTGTC	2
AGTGCAGTTTCGATGTTACTCG	1
AGTGCATACTAAGGTTGGTGATGC	1
AGTGCATAGGTTCTCGTGTTGAAG	1
AGTGCATCTTGTCTGATACAGCGA	1
AGTGCATGATGGAGAATTGTGTGA	1
AGTGCATGATTAATTAAATATTA	2
AGTGCATGGCCATGCCAAAGGTGA	2
AGTGCATGTAAGAACATACGAACA	1
AGTGCATTCTGAGAGTTCAGGGAC	1
AGTGCCAAAACATACGTAAGTTTT	1
AGTGCCAAATATGTGTAACATGAG	3
AGTGCCAAGGCGGTTAGTGCTGAA	1
AGTGCCAATGTTGTGCACAAGGC	1
AGTGCCACAATGGCATGGGGACGG	2
AGTGCCACAATTTCTGTATCAGAG	1
AGTGCCAGTCACCAATATATCTA	2
AGTGCCAGTTTTTCTCTAGAACCG	1
AGTGCCATCGTAAATTAGAGAGGA	1
AGTGCCATGGCTAGGGTGAGAC	1
AGTGCCGAATACGGAAACGGATA	1
AGTGCCGACCAATAGATGTCGATTG	1
AGTGCCGAGAAGTTTGGCGCTCAG	1
AGTGCCGAGGTGACTAGACGGGGT	2
AGTGCCGATGACATTTTGGTTGGA	1
AGTGCCGATTATTTTATTTTTAGT	1
AGTGCCGGAGTGGTAGAAGTTGGG	1
AGTGCCGGTTTTAGATAAAAACCG	3
AGTGCCGTCATGATTTTCTATGCA	1
AGTGCGACTATGAGTTGGGGTGAG	1
AGTGCGATCAGGATACCATATGAG	1
AGTGCGATCATAATTTTGATATGG	1
AGTGCGATCCTGTACTGCCCTAAG	1
AGTGCGATTGTACCGTGAGTTGCT	1
AGTGCGCACGCATGGTTGACATGG	1
AGTGCGCCACATATGAGCCTCCTGA	1
AGTGCGCGTGCATTGTGAGTGTC	1
AGTGCGCGTGCGTTGTGAGTGTCT	2
AGTGCGGAATCGAGATGGTCCCGC	2
AGTGCGGGGAGGCATAGCTGTCAA	1
AGTGCGGGTTTCCGAAGATGGA	1
AGTGCGTAGATCTTCCCAAACGAA	1
AGTGCGTATGATAGATGAGACCAG	1
AGTGCGTATTGTAGATATCGGTAA	1
AGTGCGTGAGATTGAGGGGCACAG	1
AGTGCTAAAACTTGCCTAGGGTTC	1
AGTGCTAAAACTTGGTAAGGTTTA	1
AGTGCTAAACTAGCAAGATGGTACT	1
AGTGCTAAATATGCAATTGGCCC	2
AGTGCTAACCACTACACTATGGAA	2
AGTGCTAAGAAGCCTGCACAAACA	1
AGTGCTACACTCTTGAAATTGGTA	1
AGTGCTACAGATGGGTTGATGAG	1
AGTGCTACATCGGTATACCCGTGC	1
AGTGCTACATCGGTATATCCGTGC	1
AGTGCTACATGTCATTAAGATACG	1
AGTGCTAGATTGTTATATTTTTGT	1
AGTGCTAGGATGTGTCACATCACA	2
AGTGCTAGTATCTAACTGGAT	1
AGTGCTAGTTGATGGTAGTTTTGC	1
AGTGCTATAGTGCTTCATGTGCTG	1
AGTGCTATTCGGATATCCGCAGGA	1
AGTGCTATTCGGATATCCGCAGT	4
AGTGCTCACTTTGTATTACTCTAA	1
AGTGCTCATATATGCGTGGTGGA	1
AGTGCTCCAACGAGAATTGGAGGG	1
AGTGCTCGATTGAGATATGATTGC	3
AGTGCTCTTGAGGTTGTCACCACC	1
AGTGCTGAGTGTAAATTTTGGATC	1
AGTGCTGATTTGTGTTTCTTTGCA	1
AGTGCTGCTTGCTTGATGCGACAGT	1
AGTGCTGTCGGTGATATGGGCTC	1
AGTGCTGTGATTGCGGGCCTAAGT	2
AGTGCTGTTGGTGAGTTTGCCA	2
AGTGCTTAGGTTATATAAATGCCA	1
AGTGCTTATAGAGGTAAGGTGTA	1
AGTGCTTCTAAAGGATTTGCCACT	1
AGTGCTTCTAAAGGATTTGCCACTA	1
AGTGCTTCTATATGTTTGGATTGG	1
AGTGCTTCTGAGCTGAAGACGAAG	1
AGTGCTTGAACGCTACATACGACA	1
AGTGCTTGACAACTAAGAGTTG	1
AGTGCTTGACAACTAAGAGTTGAA	3
AGTGCTTGAGTAGGTATCATGGGT	1
AGTGCTTGCACTGTGAAGAGAGGG	3
AGTGCTTGGTGCTCCACCAATGCC	1
AGTGCTTGTTTAGCATGGGACTGA	2
AGTGCTTTATGAACTTTAGGGAAC	2
AGTGCTTTCAGAAATATGCAAACA	1
AGTGCTTTGGCGACGGCGAGGACG	1
AGTGCTTTTAGGTTTTTGAACCGG	1
AGTGGAAAGCCAGTATTTTTCGAA	1
AGTGGAAAGTGCTAGAGCGAC	1
AGTGGAAATAAAAACCCTAGGTGG	1
AGTGGAACATGATATATGTAGGC	1
AGTGGAAGAATAGCCTTGTGGATC	2
AGTGGAAGCCTAGGTAGTAGTCCA	1
AGTGGAATTGAGCCTAAACCCAGC	1
AGTGGACAAGCGATTGATGCTATC	1
AGTGGACATGTAATAAACGGGTGG	1
AGTGGACCAACCAAAGATGGTTTC	1
AGTGGACCCCACCTGAAATAGCCT	2
AGTGGACCCGAGCTGTTGATGACC	1
AGTGGACCCGCCTATCGGATGGGA	1
AGTGGACCGCACGCGATGTGGACG	1
AGTGGACTGCACGTAATATGGGCG	1
AGTGGACTTAACTTAGAGATGGAC	1
AGTGGACTTACATTGTGAAACGGA	1
AGTGGAGAAAGCGATAACGTAAGC	1
AGTGGAGAACAATCAGTTACAGAG	1
AGTGGAGAAGAGCCTTAAGGATGC	1
AGTGGAGCCTGACAATGGGTCTGA	1
AGTGGAGCGGTAAGAACCTAACTC	1
AGTGGAGCTGAAACTGTTTGGCTG	1
AGTGGAGCTGTCTGAGGCTGTATT	1
AGTGGAGGACGGAAAGGTGACGTG	1
AGTGGAGGGTGTCGCCGTCGATGC	1
AGTGGAGGTAGTTGCGTTGCGGCA	1
AGTGGAGGTCGCCAAATCTAGAGG	1
AGTGGAGGTGGCTAGTATGGTGGG	1
AGTGGAGTGTAAATGAGGTGTAAC	2
AGTGGAGTTGTGGAGCTGCCTAA	1
AGTGGAGTTGTGGAGCTGCCTAAA	1
AGTGGATAGCGTATTGGCATGTGC	1
AGTGGATATGACTATGGATCGGGC	1
AGTGGATGAATGCGGAGACAAGGA	1
AGTGGATGACATGTAGGTCCGGCC	1
AGTGGATGAGGTGTAACATGGAGG	2
AGTGGATGATAGTGATAATGTGAC	1
AGTGGATGATGTCGAACAAGGGTT	1
AGTGGATGCGGATGGTTGATGGAC	1
AGTGGATGGATGCGGAGACAAGG	1
AGTGGATGTCGACCCGTTGATTGT	1
AGTGGATGTGCCAAAGAACTATTG	2
AGTGGATGTGCCTATGAACTGTT	1
AGTGGATTGAAAAGGATTGGAGCG	1
AGTGGATTGATTGTATTGAGCCT	1
AGTGGATTTGACTGCACGAGGTAC	2
AGTGGCAAATCGTAGACGTGTGAT	2
AGTGGCAAATCGTAGATGTGTGAC	1
AGTGGCACGCAGCCGATATGCTGAA	1
AGTGGCACTCTAATAAACAGATGG	1
AGTGGCAGACTTATGGTTGAATGG	1
AGTGGCAGAGGCCTACGTGCGG	1
AGTGGCAGAGTGGCCTTGCTGC	5
AGTGGCAGATGCTGAGACATGTGA	1
AGTGGCATATTGTTGAACCGTGAC	1
AGTGGCATCGCTACGAATAGATGA	1
AGTGGCATGAGAGGGTGTGCAA	1
AGTGGCATGCAAGAAACGGGTGGA	2
AGTGGCATGCAAGAAACGGGTGTA	1
AGTGGCATGGTTGGAGGGACAAGC	1
AGTGGCCAAGACTGCATTACTCATG	1
AGTGGCCACCCCATCTTCTTCCTC	1
AGTGGCCACGACAAGGAACTGTGC	1
AGTGGCCGACAAGTGGACTCCACT	3
AGTGGCCGAGATTGATTGATTGAT	1
AGTGGCCGAGTGCATGAGTGCACC	1
AGTGGCCGCCGGATGATGGCTGAC	1
AGTGGCCGTAGTGGGGTCTCAA	1
AGTGGCCGTGTGATGATATCAAGA	1
AGTGGCCTCATAGCATGCTATAAA	1
AGTGGCCTCGACAGATGTCATAGT	2
AGTGGCCTGCCCAGTTAGGGTTAA	1
AGTGGCCTTATGCGATAATACGCC	1
AGTGGCGAGAAGTCCATGGGGGTC	1
AGTGGCGCTTACGTGACAAATTCG	2
AGTGGCGGATCTAGAGGGTGGTC	3
AGTGGCGGATCTAGAGGGTGGTCC	9
AGTGGCGGTCGGTTCGGTGCTAGC	1
AGTGGCGTCTACGTGTCGATGAGG	1
AGTGGCGTTGGTGCAGGTTCTGGG	1
AGTGGCTAACAGGTGGACCCGGTC	1
AGTGGCTAAGTCAACGTGAGACC	2
AGTGGCTACGTTTAGTTTGTTGCT	2
AGTGGCTGACAGGTGGACCCGATC	1
AGTGGCTGAGTCTGCGTGAGACCC	2
AGTGGCTGCATATCTGATGAG	1
AGTGGCTGCCCAAGTGACCTGCCC	1
AGTGGCTGCCGGCTATGAGTCGTT	1
AGTGGCTGTACAGCCGCAGTGCTG	1
AGTGGCTTTGGTTAGTGAGGGCA	1
AGTGGGAAGTTTGAAACTAAGGTTC	1
AGTGGGAATATACAAGAGTGCAGC	1
AGTGGGACCCATATATCAATGACT	3
AGTGGGACTGTATGTTTCTCGTGC	1
AGTGGGAGTAGGTAGGACAGATGC	1
AGTGGGCCATGTATTAATTGTGAA	5
AGTGGGCCTCGTATAGTTCAAAGC	2
AGTGGGCCTTAGAATTGATGTCT	1
AGTGGGCCTTCATGTTTATATGGG	1
AGTGGGCGAGCCGTAGAGGAGTAA	2
AGTGGGCGCCGGCGGTATTCGCGG	1
AGTGGGCGCGTAGCATAGATGG	1
AGTGGGCGCTAGCTGAAAAGATA	1
AGTGGGCGGTGGTGGTATAGCACC	1
AGTGGGCTAAAACTATTTGGTTAG	1
AGTGGGCTAGACGATCTGGGTTCG	1
AGTGGGCTGCACTATTGACCTTGC	1
AGTGGGCTGCTACTTTCTTTATGG	1
AGTGGGCTGTAAACTTACAGTCGG	1
AGTGGGGAAGTTAAATGGTGAGGG	1
AGTGGGGACCGTTCTTTCCATTGC	1
AGTGGGGATGATGCATACATTGAG	1
AGTGGGGCCACTCATCAGATGGGT	1
AGTGGGGCTTGATTGATTTCGCCA	1
AGTGGGGGCAAATACAACTTGATA	1
AGTGGGGGCTAAACAAATTAGGAG	1
AGTGGGGGCTTAGAGGGTTCTCGA	1
AGTGGGGGTGTTAAGATATTAGG	1
AGTGGGGTCTTCGTAGGGCTCTAA	1
AGTGGGGTGTAAATGAGGTGTAAC	1
AGTGGGGTGTGCACAATCTCTGG	1
AGTGGGTAAGGCTTAGTTTGTGGC	2
AGTGGGTACCAACTATATAGGAAGA	2
AGTGGGTCGCCAACAAAAATGGA	6
AGTGGGTCGTCTGTCGCATATTTG	1
AGTGGGTCTTTTGGGTTGGAGTGG	1
AGTGGGTGAAATTAGATGGAATGA	2
AGTGGGTGACTAGTTTATCGCCGA	1
AGTGGGTGAGTCCAATAGGTGTGC	1
AGTGGGTGATGATGTGGCATACT	2
AGTGGGTGATGGCGGAGATGATG	1
AGTGGGTGCATAGATATAGAGCTA	2
AGTGGGTGCATTCTAGTACAAGAA	1
AGTGGGTGCTAAGGATGTTCACGC	1
AGTGGGTGGGTTGAGGATTGTGAC	1
AGTGGGTGGTAGGTCTTGTACCTG	1
AGTGGGTGTAGCCTTAGGTTATG	1
AGTGGGTGTAGCTGTTTTATCCT	1
AGTGGGTGTGCCAAAGAACTGTTGG	1
AGTGGGTGTGCCTATGAACTGTT	1
AGTGGGTGTGGATAGTGTACGGAT	1
AGTGGGTGTTCAAGAAGAAGCTTA	1
AGTGGGTTAATAAAATTAAGCCTG	1
AGTGGGTTGATATATAAAATTAAT	1
AGTGGGTTTGATCTACATGGCATC	1
AGTGGGTTTGTCCTACATGGTGTA	2
AGTGGTAAAAGGACAAGACATGGT	1
AGTGGTAAAGTTTTTGTAAG	1
AGTGGTAAATCGTAGATGTGCGAC	2
AGTGGTAAGCCTAGTTAACTTTGG	1
AGTGGTAAGTACCTGAAGGGTCCG	1
AGTGGTACCTCACCCGGATGTGCT	1
AGTGGTACTACTTCATGAAAGGCA	1
AGTGGTACTCCGGTTGATGGTTAT	1
AGTGGTAGATCAGGATAGTTGGCAGTTGCC	1
AGTGGTAGCTGACCGGTAGGGTTG	1
AGTGGTAGTAGAAATGTGCAAGG	1
AGTGGTAGTCGCTGGAGGGGGAG	1
AGTGGTATGCATGAAGAGTTGGGC	1
AGTGGTATGTGCTCCTCTCAC	1
AGTGGTATTTCGGCGAATCCCAAC	1
AGTGGTCAAACATTGCAAGCAAAA	1
AGTGGTCCCAAAGCACTTTTTGGC	1
AGTGGTCCGCCTGCAAAATACGAG	1
AGTGGTCCGCCTGCGAAAATAGAG	2
AGTGGTCCGTCTGCGAAAACAGC	1
AGTGGTCCGTCTGCGAACAGCTAA	1
AGTGGTCGCCCTATATAACAA	1
AGTGGTCGCTTTCGGATAGACGGA	1
AGTGGTCGGATCTTATTCGCATCC	1
AGTGGTCGGTCCGGTGCTAATCTT	2
AGTGGTCTACCTACGAAAATAGGG	1
AGTGGTCTATATAGATGGGATCC	1
AGTGGTCTCACATGGTGTATC	1
AGTGGTCTCTCGGTAGTACATGTG	1
AGTGGTGAGGAACGCGTCCCCTAG	2
AGTGGTGAGGCGATGCAAATTTGG	2
AGTGGTGAGTGTAAGCTGGTCCTG	1
AGTGGTGAGTGTGAGAATGATCCG	2
AGTGGTGATCGAAATTGTCAAGTG	2
AGTGGTGATGGTACTTCTTCTTGG	2
AGTGGTGATGGTGAGTCCTAGGTA	1
AGTGGTGCAAAATGATAGCAACAA	1
AGTGGTGCAGATGAGGTCCCTCGA	2
AGTGGTGCTGACGGAGAGATGGT	1
AGTGGTGCTTAACGATTTTCCACT	1
AGTGGTGGACCCTCGTAGTGGAGT	4
AGTGGTGGGCTAAACGATCTGGGT	2
AGTGGTGGGCTAGACGATCTGAAT	1
AGTGGTGGTAGCCAATTGAATGAG	1
AGTGGTGGTCATGCTGGCAATGAG	1
AGTGGTGTATAATAAATTAAGTTTG	1
AGTGGTGTATGGTTGTGATTAGA	1
AGTGGTGTCATTTATATCCGTGAA	2
AGTGGTGTCGTATTACCTGCC	4
AGTGGTGTCTCAAAGCTAGCAAAA	1
AGTGGTGTCTTCAAAAATTGAGCG	1
AGTGGTGTGGGTGGTATAGAATTA	1
AGTGGTGTGGTATGGTAACCA	2
AGTGGTGTGTGCGCATGTGCGTCT	1
AGTGGTGTTACGCTGTAAGACTAA	1
AGTGGTGTTACTATTGTCGGTGGA	12
AGTGGTGTTATGAAGCAGTCT	1
AGTGGTGTTGTGGTGGAGTCGTGG	1
AGTGGTGTTTACATTGGAAGAGTA	1
AGTGGTGTTTGATGAGATGGCGTA	1
AGTGGTGTTTGCATTGGAAGAGT	3
AGTGGTGTTTGCATTGGAAGAGTA	1
AGTGGTGTTTGCATTGGAATAGT	1
AGTGGTGTTTGCTGTTTGAGCTTA	1
AGTGGTGTTTGTATTGGAAGGGTA	1
AGTGGTTAATGCGGTAAGTATGGG	1
AGTGGTTCCAGCGCCGGCGGTGGC	1
AGTGGTTCTGGATGCCATGGGTGG	1
AGTGGTTGCAGTGACCTGAGTAGC	1
AGTGGTTGCAGTGATCTGAGTAGC	2
AGTGGTTGCCTCTATATTGGGCA	1
AGTGGTTGCGAATTTTACTCCCA	1
AGTGGTTGCGCTTATACGTGG	1
AGTGGTTGCTATTACGGACGCTAA	1
AGTGGTTGGAACAATTAGGTGGTT	2
AGTGGTTGTGCCTTATATTATGGA	3
AGTGGTTGTGCCTTATATTTTACG	1
AGTGGTTGTGTCTTATATTATGGA	2
AGTGGTTTATGTTGGTGTTGATGG	1
AGTGGTTTTACACATATGGGTAGC	2
AGTGGTTTTGTCCTATGTGGCGTA	1
AGTGTAAAACAGAGGATTGCAAA	1
AGTGTAACACTACTGGATAAAGGG	2
AGTGTAACCTTAAGGTGGGCC	1
AGTGTAACTACGATGTAACTAGCA	1
AGTGTAACTCATACAATCGTGCTA	1
AGTGTAACTGCATTGTAACTACAC	2
AGTGTAAGAAAAAGTTAAAATCCC	1
AGTGTAAGATTTGAAACGAAGGTAC	1
AGTGTAAGCTGGTCCTGGTAGTGA	2
AGTGTAATTGATAGCGTGGAGGAG	1
AGTGTACATCCACTACAGTGTGAG	3
AGTGTACCAACCAGTGTGCAAGTA	1
AGTGTACCTAATATGTAGATCAA	1
AGTGTACGCGGGAGGTGAATTTAG	1
AGTGTACTAGTACTACTGTGGTGG	1
AGTGTACTCGTGATGTTTCACTATG	1
AGTGTACTGTTTGTGTCTGTAGCT	1
AGTGTAGATACAGATGATGTGCAT	1
AGTGTAGCAGGTGGCCGAATCGGA	1
AGTGTAGGATTGTGATTGAATGAG	1
AGTGTAGGTGGAGACCAAAAGGTCA	1
AGTGTAGGTGTCTATGTAATCGAC	2
AGTGTAGTAGGTGGCCGAATCGGA	1
AGTGTAGTGCTTCTGAGCTGAAGA	1
AGTGTAGTTTCTATTGTGATGTCT	1
AGTGTATATGGATGAGCATGGAA	1
AGTGTATATGGATGAGCATGGAAC	1
AGTGTATATGGGCTGGGCCTTCAT	2
AGTGTATGGCCTGGCCTGATGTTG	1
AGTGTATGGTGAACGAATGTTAG	2
AGTGTATGGTGAACGAATGTTAGT	8
AGTGTATGTATGACAGGTGGGACC	1
AGTGTATGTCGGAAGACGGGTGGA	1
AGTGTATTGGGTGCGTTTGTGGCA	1
AGTGTCAATAATTGAAATGGATGA	1
AGTGTCACCGAGAATCTCACTGAA	1
AGTGTCACCTCGACATGGACGTGA	1
AGTGTCACGACCGGAATTAACCCA	1
AGTGTCACGTAGGATAAAACCGCT	1
AGTGTCAGACCGGTCACAAATCGG	2
AGTGTCAGGGGCGGTCAGACCGTA	1
AGTGTCATATAAGTCCCAAACGGG	1
AGTGTCATGTGCTTCTGGTCGAAG	1
AGTGTCCAAACATCAGATGTGATC	1
AGTGTCCAAACATCCGATGCGATA	2
AGTGTCCAAACATCCGATGTGATA	2
AGTGTCCAAACATCTGATGTGACA	1
AGTGTCCAAACATCTGATGTGATA	1
AGTGTCCAAATATCAGATGTGATA	1
AGTGTCCAATATTGATTCTACCCT	2
AGTGTCCACGAGCAAATACATGAT	1
AGTGTCCATCAGCCGTATCATGGT	1
AGTGTCCATTTTCAACAGCAG	1
AGTGTCCCTCTTATCCGAGACGCG	1
AGTGTCCGAACATCTGATATGATA	1
AGTGTCCTTATGGTAGAACCAACC	1
AGTGTCCTTGGCAAATTGATGTCT	2
AGTGTCCTTTACATGTATGGGCCC	1
AGTGTCGCCATGGATTGAGGT	1
AGTGTCGGCCGGTCAGACCGCGG	1
AGTGTCGGCCGGTTAGACCACGGG	2
AGTGTCGTGTTTGTAGGGACTCGG	1
AGTGTCTAAACATCCGATGTGACA	2
AGTGTCTAAACATCCGATGTGATA	1
AGTGTCTAAACATCTGATGTGATA	2
AGTGTCTAAACATCTGATGTGGT	1
AGTGTCTACCATGGTCCATGGTTA	1
AGTGTCTACTAATTTCTTGATGAT	1
AGTGTCTAGACATCCGATGTGACA	1
AGTGTCTAGAGGGGCGTTGATACA	1
AGTGTCTAGGCATTAAAGCCA	2
AGTGTCTAGTACTAGTTTCTTGATA	1
AGTGTCTATACATCCGATGTGACA	1
AGTGTCTATCATCTGCCACGACGC	1
AGTGTCTATTTGATTTGAAGCTAA	1
AGTGTCTATTTGGGGCTTGTTCA	1
AGTGTCTATTTGGTTTGAAGCCAA	4
AGTGTCTATTTGGTTTGAAGCCAAA	1
AGTGTCTATTTGGTTTGAAGCTAA	1
AGTGTCTATTTGGTTTGAATCCAA	1
AGTGTCTCACTATTGGTGATGTCA	2
AGTGTCTCATAAGTGCCATTTGGT	1
AGTGTCTCATCTGGTAATAGGTTA	3
AGTGTCTCATGTTGGATCTATCCA	1
AGTGTCTCATGTTGGGTCTATCCA	1
AGTGTCTCCTGATGATCGGGACAA	11
AGTGTCTGAACATTCAATACGATA	1
AGTGTCTGAACCGTTGACCCGGTC	1
AGTGTCTGCGAGGATTGTGGTGAG	1
AGTGTCTGCGTTGTACTGTGTAA	1
AGTGTCTGCTTCCACCGATTGGA	1
AGTGTCTGTAAAGATAAAGCCGTA	1
AGTGTCTGTAATGGTAGTGTAA	1
AGTGTCTGTATGACAGGTGGAACC	6
AGTGTCTTCGCTAAAATGCCATCC	1
AGTGTCTTGACATGGACTTCGTGA	3
AGTGTCTTGGATTGGGACTGGCCT	1
AGTGTCTTGGCCTTCAAATAGAAC	1
AGTGTCTTGGGTTGAGAATGCTCT	1
AGTGTCTTGTAGAACTCAGGGTTC	1
AGTGTCTTTTAGGGAGATTGGGCC	1
AGTGTGAAAAAGGATTGGATGGAC	1
AGTGTGACTTTGGTATAAATGCTG	1
AGTGTGAGGTGATTCAATATCAGG	1
AGTGTGAGTCCGCTTGTCACTCT	1
AGTGTGATAATTTGAGACGGGCTC	1
AGTGTGATCGCTTGGATGCTAGTTT	1
AGTGTGATGAACAAATTGCTGGCC	1
AGTGTGATGTTACATATGTAGTG	1
AGTGTGCAATTGGTTTCTTTCGTC	1
AGTGTGCATTCGGATATACCGCAG	2
AGTGTGCCCTATATTAATTGTGAA	1
AGTGTGCGCAACACGGTGTGTGAA	1
AGTGTGCGCACGTTGTGATCGTCTA	1
AGTGTGCGTATGACAGGTGGGACC	3
AGTGTGCGTATGGCGTGTGCCAA	1
AGTGTGCGTCCCTATACTACTTAC	1
AGTGTGCGTGCGTTGTGAATGTAT	1
AGTGTGCGTGTATTGTGAGTGTATG	1
AGTGTGCGTGTGTTGTGAGTGCCC	1
AGTGTGCTGGTGTCCTCGACCAT	1
AGTGTGCTGTGGGATGGGATGGCT	2
AGTGTGCTTAATATGTGTTCTGTA	2
AGTGTGGACATCTCCATAGCGTGC	1
AGTGTGGACCCGTTTGGGAGGC	1
AGTGTGGATTGACTCAATTGCGGC	1
AGTGTGGCATGACACAACTGTGAC	1
AGTGTGGCTTACAATTTATAGGC	1
AGTGTGGCTTGCTGAGTACGGTGG	1
AGTGTGGGGGTGTTGTTGACGGTC	1
AGTGTGGTCTCAATTGAGGGTTTC	1
AGTGTGGTGACCTAGATAATACAC	1
AGTGTGGTGGACAAATTGTTAGT	1
AGTGTGGTGTCACTACTACAACAG	1
AGTGTGGTGTTGCACGTGTAGTG	1
AGTGTGGTTTACATTTTGTTGGTC	1
AGTGTGTAACTATTGTATGAATTG	1
AGTGTGTACGTGATGAGTTGGAA	1
AGTGTGTACGTGATGAGTTGGAAG	1
AGTGTGTACTTCGCGAGCGGCCTA	1
AGTGTGTAGACATGCATGATGTGA	1
AGTGTGTATAAACCTACTGGAAAC	1
AGTGTGTATATGGCATATGGGACC	1
AGTGTGTATGACAGGTGGGACCAG	1
AGTGTGTCACGATAATCTTAATCT	2
AGTGTGTCCTGTTTAGCTGAACTA	1
AGTGTGTCTATGGCAATAAACTAC	1
AGTGTGTCTCACTTCTCCTTAGAG	1
AGTGTGTCTTAGAGTATGTGCTG	1
AGTGTGTCTTGGAGTCCGTGCTAC	1
AGTGTGTGAAGGCCTGATGGACCC	1
AGTGTGTGATTGGTTGAAAAGAA	1
AGTGTGTGATTGGTTGAAAAGAGA	2
AGTGTGTGCAATAACTAAAACGCT	1
AGTGTGTGCGATGTGTCTTTACA	1
AGTGTGTGCGATGTGTCTTTACAT	1
AGTGTGTGCGTAGACTAACATTGG	2
AGTGTGTGCGTGGACTAACATTGG	1
AGTGTGTGGTTTCAACTTTAAGAT	1
AGTGTGTGTATGACAAGTGGGACC	2
AGTGTGTGTATGACAGATGGGACC	1
AGTGTGTGTATGACAGGTGGGACC	4
AGTGTGTGTATGACAGGTTGATGT	1
AGTGTGTGTATGACATATGGTACC	2
AGTGTGTGTATGACTGGTGGGACT	1
AGTGTGTGTGTGCTTTATTTGCT	1
AGTGTGTTCGTGCCTATCCATCGT	1
AGTGTGTTGCCAAATTTGATCAATA	1
AGTGTGTTTCGTCACCCTCGACTC	1
AGTGTTAAAAAGAGAACGGGGTGA	1
AGTGTTAAATCACTACTCGTGCAA	2
AGTGTTACTGCATAGTGGTCGTTG	4
AGTGTTACTGCATGTAGAGGGTTA	1
AGTGTTACTGCCGGCAAGAGACAA	1
AGTGTTAGGTGTGGTATCGATCCA	1
AGTGTTAGGTGTTTCAACAGGAAG	1
AGTGTTAGTGGATGATGATGTATC	1
AGTGTTATACTGATTTTGTGGGCC	1
AGTGTTCACAGAGGACGAGTGTGC	1
AGTGTTCGACATGTTGGTGAAGATA	1
AGTGTTCGGTAGGCCGGCGGCTGC	1
AGTGTTCTAGACTATTAGTACC	1
AGTGTTGAAAGTTTTCAATTTGGA	1
AGTGTTGAGCTAGATGAGTGAGAA	1
AGTGTTGAGCTGGATGAGTGAG	1
AGTGTTGAGGTGTCTAAATTCAGC	1
AGTGTTGAGTTGAAGGCTGTGGAC	1
AGTGTTGATGCAGTTGGAGGTAGA	1
AGTGTTGATGGGCCACGATAGCCA	1
AGTGTTGCCCTAACGAATTGGTCC	2
AGTGTTGCCTATGGAGTGGAGCTG	2
AGTGTTGGTGAAGAAGACGAGGGC	3
AGTGTTGTGCTAGGTAGCAGCAGA	1
AGTGTTGTTAGGTGGCTGAATGGA	1
AGTGTTTATAGGAAGTTTTATGGA	1
AGTGTTTATAGGAGGTTTGATGGA	1
AGTGTTTCGGTGAAGACTGTTAAG	1
AGTGTTTGACATGTTGGTGAAGA	1
AGTGTTTGACATGTTGGTGAAGAC	1
AGTGTTTGCATGATGTTACGTGAC	1
AGTGTTTGCTTGGTTGCCATATCT	1
AGTGTTTGTAAACAGGATTGACAC	1
AGTGTTTTACGTAAAACGAGGTGT	1
AGTGTTTTGTCAGAGATAACCTCA	1
AGTGTTTTTTTGGTGATCGACTA	1
AGTTAAAAAGCTCGTAGTTGGACC	3
AGTTAAAACTGGCCACGATACTGC	1
AGTTAAAAGTCCTACATAGCAATG	1
AGTTAAAATTGAAACGATGTGATGG	1
AGTTAAATGCCCCGCAATCTACAC	2
AGTTAAATTTTAACTCAGGGTGAC	1
AGTTAACAGAAGATTAGGGGGGTC	1
AGTTAACATGTAATAAACGGGTGG	1
AGTTAACGGTGTCAAACATTTTGA	1
AGTTAACGGTGTCAAACGTTTTGA	1
AGTTAACGGTGTCAAATATTTAGA	1
AGTTAACGGTGTCAAATATTTTGA	1
AGTTAACTGTAGGTGATTTGGAGC	1
AGTTAAGAGGCCCATTTGTGAAA	1
AGTTAAGAGGTGTGGAAACAATCC	1
AGTTAAGATATAGGGTGTGCTAA	1
AGTTAAGGCGGTGCCAGTATGACA	1
AGTTAAGTGTCTGGATCCAAACA	1
AGTTAATCCCGCACTATGTATAGT	1
AGTTAATTACTCTAGGCGGTTGCA	1
AGTTACAGAATTTGGTTGCTA	2
AGTTACAGTGTAATTACATATAAG	1
AGTTACAGTGTAATTACATGCAAG	5
AGTTACGATTGGTTGATAAGAGA	2
AGTTACGGTGAGATATACTGTGGT	1
AGTTACTACCTGGTATTTGTGCTA	1
AGTTACTACTCAGGAAACAGGTCC	1
AGTTACTTCCTACATCCAGATTC	1
AGTTAGAATCTACACAGGGCAGGC	1
AGTTAGACAGGTGGGTGAGCAATG	1
AGTTAGAGAGGCCTATATGTCAGT	3
AGTTAGAGTTTAGGGTCCCAGATC	1
AGTTAGATCAGATGGCATATTGT	1
AGTTAGATGTTTTCTGGTGGACAC	1
AGTTAGATTTGCATATACGGGAAC	1
AGTTAGCTATAGGTTGTGCCGTA	2
AGTTAGGGCGACTCGGACAGAGTA	1
AGTTAGGGTGACAAATTTTAGAGT	2
AGTTAGGGTGTCGTCGGTGCCGGA	1
AGTTAGGTGGGACCCACTCGGTGG	1
AGTTAGGTGTGTATGATAGGTTGA	1
AGTTAGTGCAGTGGAAAGGGGTGT	1
AGTTATAAAAGGAGGACCTTGCCCA	1
AGTTATAAGACCGGTGTCAGGCGA	1
AGTTATACGTGCTCAATATTTTAA	1
AGTTATAGGGTTGGATACGGTTA	1
AGTTATGAAATACTCAGCAGT	1
AGTTATGCCACTGGTGTTATGCCA	4
AGTTATGGAGCAGTCTAAACCTAG	1
AGTTATGTGGATGGCAAAGTTAGC	2
AGTTATGTGTCTAGATTTATTAAC	1
AGTTATTAGTTGTACTAGGAGGGG	1
AGTTCAAGGGGATACCACATAGGC	1
AGTTCAAGGTGAATGGTGTCTGG	1
AGTTCAAGGTGGATACGGCATGAC	1
AGTTCAGCAGACGCCACCAAGACG	3
AGTTCAGGGAAACCTCGCTTGCCA	1
AGTTCAGGGACCTAATGACACACC	1
AGTTCAGGGTGAACAATATCTGGT	1
AGTTCAGGGTGAACGATGACTGGT	1
AGTTCAGGGTGCTAGACGAACTACC	1
AGTTCAGGGTGCTAGACGGACTTT	3
AGTTCATGGAGCGGGTACTGCCAG	1
AGTTCATGGTACGCTATTTACGAA	1
AGTTCATTCTGTGCTCTATAAAGT	1
AGTTCCAAAAAGTGTGTGCGTGAA	1
AGTTCCACAATGTTGCTAGGTGGC	1
AGTTCCATAAGTGATGGGAGAGTG	1
AGTTCCGTTGATGGACGAGGAGAG	1
AGTTCCTATTAGAAAAAAGGCTGC	1
AGTTCGCAAGGGCTATTTGATTGC	1
AGTTCGCCCGTGGGCCAGATATCT	1
AGTTCGGGGCGTGACAATTTCGGT	1
AGTTCGGGGGTGTAATTCAGTCGA	1
AGTTCGGGTGGAATGGTTGGGCCT	1
AGTTCGGGTGTCAAGATTTCTATT	1
AGTTCGGTGTTTGCTTCCAAAGAC	1
AGTTCTAGAAAGTGTCACATCCTC	1
AGTTCTGAGTCACTTCATCCT	1
AGTTCTTAAAATGGTGTTCTAGC	1
AGTTCTTACATACTTCCTCCGTT	1
AGTTGAAAATAGGGTGGACCACGA	3
AGTTGAAAATTTATGTGCGTAGAA	1
AGTTGAAAGTGGTAGCAAAGTGAA	1
AGTTGAAATTGGACGATGTGATGG	1
AGTTGAACACGAAAAATCATGGCT	1
AGTTGAACACGGAAACTCATGGCA	1
AGTTGAAGGCTTGGATTTCGGTGA	2
AGTTGAAGGTGAAAGATGTCCGGT	1
AGTTGAAGGTGTAAAATGTTCGGT	1
AGTTGAATGTAGAGGCCAGGTAAA	4
AGTTGAATGTGGTGTATTCTAATA	1
AGTTGAATTATTTGGGGGAGCTTC	2
AGTTGACATACAACAAATGGGTGT	1
AGTTGACATATAATAAACGGGTGG	1
AGTTGACATGCAATAAACGGGTGG	14
AGTTGACATGCAGTAAACGGGTGG	1
AGTTGACCTCCAAGAATCCTATCT	1
AGTTGACGTGCAATAAATGGGTGG	1
AGTTGACGTGGTGCTGAGGTGTCT	3
AGTTGACTAAATCACGGCAAGACCC	1
AGTTGACTGGGTGCATGGCGGCGC	1
AGTTGAGCCACCGGTCAGGACTAA	1
AGTTGAGCGCGGGTGCCACTTAGG	2
AGTTGAGCTGCATGTGGGGGTGGA	1
AGTTGAGGCCAAATGCAAAATTCT	1
AGTTGAGGGGTACACATTTATGGT	1
AGTTGAGGGGTATTGAAAGAATA	1
AGTTGAGGGTGAAAAACGTCCGGT	1
AGTTGAGGGTGAAAAATAACTGGT	1
AGTTGAGGGTGAACGATGGCCGAT	1
AGTTGAGGGTGAAGAATATCTGGT	1
AGTTGAGGGTGAAGAATGTCTGG	1
AGTTGAGGGTGAGGAATGTCCTAT	1
AGTTGAGGGTGGTCTAAAATACC	1
AGTTGAGGTCCAGAATGATCGACA	3
AGTTGAGGTGCTGCCTAAAACCAG	1
AGTTGAGTGCATATGAGACATGGT	1
AGTTGAGTTGCCACTGGTTGAGGT	1
AGTTGATAAGATAGGAGGTGCTAA	1
AGTTGATAGGACTTTTAGGTAGTA	2
AGTTGATATGACATATAAGTGCAC	1
AGTTGATCGTTGCTGATAGGTGGT	1
AGTTGATGAGTGATTGATTTCTTG	2
AGTTGATGATAACTACGATTTGGG	2
AGTTGATGCACGTGGTTGGTGAAG	1
AGTTGATGCTGTCAAGAGACCCGA	1
AGTTGATGTGATGGAAAGGACTGA	1
AGTTGATTGTAGGACGGATGTAAA	1
AGTTGCAACTTTTTTCCGGAAGCC	1
AGTTGCAATCTTGGGGTGGTCCGC	1
AGTTGCACAATGGCAATAGGTAGC	2
AGTTGCACAATGGTAATAGATGG	1
AGTTGCACAATGGTAATAGGTAGC	3
AGTTGCATCCACCGGGTGACCTTCT	1
AGTTGCCAAAAGGCCAAGGGCTGG	1
AGTTGCCAAAATTTCAACAATGCC	2
AGTTGCCACATAGGATAAAACCGG	1
AGTTGCCATGGCCACGAAGGCCCA	1
AGTTGCGCCTCGGAAATCGTGCA	1
AGTTGCGTATGTAGTGGTGTGTGT	1
AGTTGCTACAGTTTGGTTACCGGC	1
AGTTGCTCAGTTATGTGTAAGACA	1
AGTTGCTGTATGTGCCTTTGTTTA	1
AGTTGCTTACTATACTATTAA	1
AGTTGCTTGGAATCGCGACTACAA	3
AGTTGGAATGGTCAACTAGCTTCT	1
AGTTGGAATGGTGATTTTGTA	1
AGTTGGAGCTATAACAAACAGGCC	1
AGTTGGAGGAGCCGATATACCCGG	1
AGTTGGAGGGAGCTTTCACAAAGC	2
AGTTGGAGGTGCAGTTCCTACTGCT	1
AGTTGGAGTCTAGGTGTTCGAGTA	1
AGTTGGATATTTGCTGGTGGACAC	1
AGTTGGCATGAAGACGCTAGGTCC	1
AGTTGGCATGAAGGTGCTAGGTCC	1
AGTTGGCGACTCTACTATCACCGC	1
AGTTGGCTACACTATTAAACTTGC	1
AGTTGGCTACTGATTTGATTCTCC	1
AGTTGGCTATATAGGTGTTTGGAG	2
AGTTGGCTTGGTTTGGTGGGCTGA	2
AGTTGGGAGGTAGAGCTGTGCCAA	2
AGTTGGGAGTTGGGAACTGGGGCA	2
AGTTGGGGCGCCGCGTATTTATGG	2
AGTTGGGGCGTGTCCTCATTGATG	1
AGTTGGGGGTGAACTAAACACGG	1
AGTTGGGGTGTTGTTTAGTTGTAC	1
AGTTGGGTGCGGAAACTCATGGCT	1
AGTTGGTACACTTACGTGAGAGAC	2
AGTTGGTGCACGTCACAGATGATG	2
AGTTGGTGCGCACTGGAAGATTGT	2
AGTTGGTGCTAAATTTGATTGAGT	2
AGTTGGTGGAGCGATTTGTCTGGT	1
AGTTGGTGTAACGATTACTAAGGC	1
AGTTGGTGTATTTGATACGGTCTG	2
AGTTGGTGTCATTGTCGGTGCAAC	4
AGTTGGTGTGTACGGAAAATTTGT	1
AGTTGGTGTGTTGATTTGCCGGGT	1
AGTTGGTGTGTTGCGAAATCGGAG	1
AGTTGGTGTTATTTTTTCCCGGT	1
AGTTGGTGTTCCGGAAGCCAC	2
AGTTGGTGTTCGCCGAGAAAGCGA	1
AGTTGGTGTTGCGAAAGATGCCGG	2
AGTTGGTGTTTAGATGTATGTTAA	1
AGTTGTAATAGGTGTAGGACTAGA	1
AGTTGTAATAGGTGTTAGGGGTGG	1
AGTTGTACCGTGGTGTTCTTTCTC	3
AGTTGTACTGGTGTTTTTTACAAG	1
AGTTGTCAAAGTTGAGTGCGGAAA	1
AGTTGTCATGGTAGTCCAAACCGC	2
AGTTGTCCAGTGCCTAATCGTCCC	1
AGTTGTCTGATAAAGCATGGGTGG	1
AGTTGTCTGTAGTGGAGTTGTGGA	1
AGTTGTGAAGCTGCCTAAACCTAG	1
AGTTGTGAAGCTGTTTAAACCCAG	1
AGTTGTGACCCTAACAATTGAGAC	2
AGTTGTGAGCTGCCTAAACCCAAC	1
AGTTGTGCAGTTGTTGTCTCA	2
AGTTGTGCCACTTAAAATTTACAA	1
AGTTGTGCCCAAGACCGGAGTCAA	1
AGTTGTGCCTGAAAACTAAGCCAA	2
AGTTGTGCTCACTATTTGGGTTGT	1
AGTTGTGGAGCAGCCTAAACCCAG	2
AGTTGTGGAGCTGAGTTTAGGCAG	1
AGTTGTGGAGCTGCCTAAACCCAG	2
AGTTGTGGAGCTGTCTAAACTTAG	1
AGTTGTGGAGTTGCCTAAACCTAA	1
AGTTGTGTCACCCTGGTCCTTAAA	2
AGTTGTGTCAGGGTTATGGATACCA	1
AGTTGTGTCGGTAAGTAGTGATGA	1
AGTTGTGTGCTGCCTTATTTGAAC	2
AGTTGTGTGTGTATGACAGATTGA	1
AGTTGTGTGTGTATGATATGTTG	1
AGTTGTGTGTGTATGATTGGTTGA	1
AGTTGTGTTTTAAAAACGGTGTCG	3
AGTTGTTAAGGCTGCCACAATTAG	1
AGTTGTTAGGCATGCCTTATACTA	1
AGTTGTTAGGTGGTGTTTGGGAAG	1
AGTTGTTAGTGAGTGATGATGTGA	1
AGTTGTTATGCCTTATATTTTAGA	1
AGTTGTTGAAAGCTCTAGGGCAGC	1
AGTTGTTGAATAAGATGAATGGTC	1
AGTTGTTGGGGCTTATATACCGGT	1
AGTTGTTGGTATTTCTTACGAT	1
AGTTGTTGTAGCCACAATGATGAA	1
AGTTGTTGTGTGGCCTGAAAGTTG	1
AGTTGTTTGGTTGGTTGCATTGGT	1
AGTTGTTTTGGAGCCAATAATTGG	1
AGTTTAAATTAGAGATGATGTGAC	1
AGTTTAACGGTTTGAAAAGCGTGC	1
AGTTTAAGCTAATACGGGTGTCTA	2
AGTTTAAGCTGATATGAGTGTCTA	2
AGTTTAAGCTGATGTGGATGTCTA	1
AGTTTAAGGGTCCTGAAGATTGAA	1
AGTTTACAATGGCCACGGGTGTAC	1
AGTTTACATACAAGAGTTGCTTAA	1
AGTTTAGACGTGGTGTCTAGATTA	1
AGTTTAGAGTGTGCTTGGTCTGTA	1
AGTTTAGGCCAGATTGAGGTTAGT	1
AGTTTAGGGACCGGGGTGACACAA	1
AGTTTAGGGACCTACATGACACAA	1
AGTTTAGGGACCTATATGACACAG	1
AGTTTAGGGACCTATGTGATACACC	1
AGTTTAGGGGTGCCATTCAAACTA	1
AGTTTAGTGGTGGAGTCATACAT	1
AGTTTATAAAAAGGGTGTAGCTA	1
AGTTTATAGATGGACTGTCCTTA	1
AGTTTATCGAATCGCACTACGCCA	1
AGTTTATGTGTCACATCCTCCAAA	2
AGTTTATTGTAGGTGCTGGTTATA	1
AGTTTCGATGTGATGGAAAAGTT	1
AGTTTCGGTGGTAAAAGTTTTGAC	1
AGTTTCGTTCGGTGACCGCTACTC	1
AGTTTCTTGACTAGAAGTGCTAGG	1
AGTTTGAAAAACGTGCCACGAAAAA	1
AGTTTGAAAAGTGTGCTAACGGAA	1
AGTTTGAAGGGAACTAAGGGTGT	1
AGTTTGACTGTCTGCCATGCACTA	1
AGTTTGAGAAGATGTAACCGAT	2
AGTTTGAGGACCTAGATGACACAC	1
AGTTTGAGGTGAACTTAACATGGC	1
AGTTTGAGGTGTCAAATGTCCGGT	2
AGTTTGAGTAAGCTGTATCCTGAC	1
AGTTTGATAAGGTCCTAGATTTGG	2
AGTTTGATGTGACAGAAAAGTTAA	2
AGTTTGATTGAAATAGAGCCACAC	1
AGTTTGCCATAGTTGTGGCCAACA	1
AGTTTGCGAGTCCGTCACAGGTGA	2
AGTTTGCGCGGGCCACAATACTAG	1
AGTTTGGAACTAAACAAGGCCTA	1
AGTTTGGACCTATCATACACGCAA	1
AGTTTGGAGAGGTGGAGAGCAGC	3
AGTTTGGGGACCTAAAAATACATA	1
AGTTTGGGGACCTAGACGACACAT	1
AGTTTGGGGACCTAGATGATACAC	2
AGTTTGGGGACCTATATGACACAC	2
AGTTTGGGTCACACGACGGCGCCA	1
AGTTTGGGTCCATTGATGTTAGT	1
AGTTTGGTAAATGTGCTAACGAAA	1
AGTTTGGTCCGTCCTACGCAGACA	1
AGTTTGGTGATACATGGAGCATGC	1
AGTTTGGTTGAGGCGCCCCACGAC	1
AGTTTGTCCACTTTGATGGTTTGA	5
AGTTTGTGTGAATGTTGGTGTGA	1
AGTTTGTGTGCAGGAAAGTTCGAT	2
AGTTTGTGTGTATGATAGGTTGAT	1
AGTTTGTTGGGTTGCTCTGCTCTA	1
AGTTTGTTTATCGGGCCAACTATC	1
AGTTTTAGATGTTATGTGATGGAA	1
AGTTTTAGTTTCTAATAGGTGTTA	1
AGTTTTATACGTAAAACGAGGTGG	1
AGTTTTGATGTGATGGAAAAGTT	1
AGTTTTGGGAATCAGATAGGTGG	1
AGTTTTGGTATGACTAATTTTGGT	1
AGTTTTGGTCTACGTGGCGTACAC	1
AGTTTTGTATAGTTAAGGGACCCC	2
AGTTTTGTGATAAATTTGGTGCTA	5
AGTTTTTCAAGTAAGACGGACAGT	1
AGTTTTTGAGTTAAGGTGGTTATA	1
AGTTTTTGATGTGATATGATGTG	1
AGTTTTTGATGTGATATGATGTGA	1
AGTTTTTGCTTGTAACGTTTGACT	1
AGTTTTTGTAGACACAAAGAGGAA	1
AGTTTTTGTGGTGTCCTATAGCA	1
AGTTTTTTGATAATCGGTAGCTGT	2
AGTTTTTTTATTAGTGCCCGAACA	1
ATAAAAAAAATAAGTGAGGCCATA	1
ATAAAAAAATGCAAACATGAGAAA	1
ATAAAAACATAAGTTCCTACATAG	2
ATAAAAACGGATGGTTGAGATTTG	3
ATAAAAACGGGGGTCCACATTATC	1
ATAAAAACTTACGACCGGATGTGA	1
ATAAAAAGAGGGTCTACATCCGAT	1
ATAAAAAGATGTAGTGTAAAGTGA	1
ATAAAAAGCGAAAAGTTGTGCCTA	1
ATAAAAAGTATGTCGAGGTACCAG	1
ATAAAAAGTTAAGGTGTTGGCTC	1
ATAAAAATAGAGAGAGGTGGACTA	1
ATAAAAATATTGTATGGGTAGGCT	1
ATAAAAATTCATACACGAGATGGT	1
ATAAAACACGGCGGGGGCGGTTGC	1
ATAAAACAGGGATGGACCTAACCC	1
ATAAAACAGTGTAGCTAATGTCTA	1
ATAAAACCAGTGCCATGGATGCA	4
ATAAAACGAATGGTCAAACGCTGA	1
ATAAAACGAATGGTCAAACGTTGC	1
ATAAAAGAAAAAAGCAATTGGAAC	1
ATAAAAGCATAAGGTGGTGTTTGG	1
ATAAAAGGTCTAACAAGTTAACAC	1
ATAAAAGGTGGGCTGGTTGGGCCG	2
ATAAAAGTAAAGCCTGAAATATAA	2
ATAAAAGTGAATGGTGAAGAGTT	2
ATAAAAGTGTGGTGAACAAATTAGC	1
ATAAAATAATATTACGGGTGTCT	1
ATAAAATATTGTTTTCGGTGTCC	1
ATAAAATGAATGGTCAAACGTTGA	1
ATAAAATGAATGGTCAAACGTTGG	1
ATAAAATGCCATTGACAAGCACC	1
ATAAAATGCCATTGACAAGCACCC	1
ATAAAATTAGAAACATAAGGATGA	1
ATAAAATTGAAACCATGCCATCAC	3
ATAAAATTGGTAGAACACTAGTGC	1
ATAAAATTGGTGTGTTGCAACGAG	3
ATAAAATTTGGTCGGCCGCCTCC	1
ATAAACAAAAGTACACGGATGG	1
ATAAACAAAAGTAGGGTGTATTGG	1
ATAAACAATGTGAAGGGTGCGATG	1
ATAAACAGAAATGCTTATTGGTAT	1
ATAAACAGGTATGAGCTCTATGCT	4
ATAAACAGGTGGGCTATTTTTTGG	1
ATAAACAGTGTCTATAGTGTCATG	1
ATAAACAGTGTCTATGGTGTCATA	1
ATAAACAGTGTGTTTATACGAAA	1
ATAAACAGTGTGTTTCGTGCGAAA	1
ATAAACATGGCCAGCTTAAGTGCA	1
ATAAACATGGTGGCTCCTTTAGGG	1
ATAAACCACCTACCCTACGCGCCC	1
ATAAACCAGCCAAAAGCCTATAGC	2
ATAAACCCCTACATATTGCCCTTA	1
ATAAACCGGGACTAAAATGAT	1
ATAAACCTGGACTCCCAGATGGAC	1
ATAAACGCCACGTGAGATGAAGAC	1
ATAAACGGGCAACAATTTGCCGCA	1
ATAAACGGGTGAGTCCACTCGAGCC	1
ATAAACGTGAGTGCCAAACATTAG	1
ATAAACTAAAGGTCCCTAGATGGC	1
ATAAACTACAAGACGCAGTGTGTG	1
ATAAACTAGAGAGGTGGAGCTGAG	1
ATAAACTTTAGGTGCATAAATTTA	1
ATAAAGACAGAATACCACGTGTGC	1
ATAAAGAGTGTACTACTTATCTAT	1
ATAAAGATATGGGTTAATTAGA	1
ATAAAGATCATAAAGTGCCATTGG	1
ATAAAGATGTCACATTTGCAATGT	1
ATAAAGCAGTTTGTTAGGTTC	1
ATAAAGCGGGCTACATATTTATAG	1
ATAAAGCTAAATTTTAAGAGGATG	2
ATAAAGGAAACACTGGCTTCGACC	1
ATAAAGGACCCTAGCAAGATTGAG	1
ATAAAGGAGATGCTAGATGTTGTC	1
ATAAAGGAGATTTTGGGTGGATGT	2
ATAAAGGAGGGCATCACAATGTAA	1
ATAAAGGATCAGCCTAATTTTCAG	2
ATAAAGGATTTGGGTGGACGTGACA	1
ATAAAGGATTTTGAAACGATGTGA	2
ATAAAGGCAATCGGCTGATGATGA	1
ATAAAGGCACGGTGCAGTTACTGC	1
ATAAAGGGACTGTCTATATGG	1
ATAAAGGGCTATGATTCATTATCA	2
ATAAAGGGTGATATGCTCCGAAGT	2
ATAAAGGTAGGCCGCTGATAGTGA	1
ATAAAGGTCACACAACCCACAGTG	1
ATAAAGGTGACGGAGCATATGTCT	1
ATAAAGGTGCCGGTTGATAACTGG	7
ATAAAGGTGGAAAATGCTAGAATG	1
ATAAAGGTGTAAGGGTGGACCCTA	1
ATAAAGGTGTAGTGGACAAATTGT	1
ATAAAGGTTGGGCCCAAACGTAAG	2
ATAAAGTACAGGCTGCCGCTAGT	1
ATAAAGTAGAGTCCTATTAGATAA	1
ATAAAGTATTTTAAGTTGATGTAC	1
ATAAAGTGCCAGTGATGTTTCTGA	1
ATAAAGTGTCGTGCCGCTTTTGAA	5
ATAAAGTGTGCTTTTGGTGTATCT	1
ATAAAGTTATAAAAAAATGGCTGC	1
ATAAAGTTCGACGATGACATAGA	1
ATAAAGTTCGACGATGGCATAGAG	3
ATAAAGTTCGACGATGGTATAGAG	1
ATAAAGTTGACTAGGAAAAATACC	1
ATAAATAAATTAGAGATGTGGAGC	1
ATAAATAACCCTACGGTACGACAA	4
ATAAATAAGGTGCTGACTGGTTGC	1
ATAAATAAGTGTAGCCGTGAATA	1
ATAAATAATAAATCAACTAGTTGC	1
ATAAATACTTGTGTGCATGGATGC	1
ATAAATAGAAAGCTGACTGTACTG	1
ATAAATAGATAGGGGCTGAAATGC	1
ATAAATAGATGGGGAGAGGGCTA	1
ATAAATAGGATGTAGGGCTATTACC	1
ATAAATAGGTAGGGCCCGTAACAC	1
ATAAATAGGTTTATGGGTCGGTCC	1
ATAAATAGTGAGCCGAATTTTGG	1
ATAAATAGTTGCGGGTGTAAAA	2
ATAAATATATGGTCCACATGTCTG	1
ATAAATATGACAGTTAATAGGTTC	1
ATAAATATGAGAAATGCTAGAATG	1
ATAAATATGATTGGTAGAGAATAA	1
ATAAATATGGACAACGCTAGCTAG	2
ATAAATATGGGCAATGCTAAAATG	1
ATAAATATGGGCAATGCTAGAAAG	3
ATAAATATGGGTAATGCTAGAAAG	1
ATAAATATGGTGCGTAGCGCAGAC	1
ATAAATATGTTCTTGGTGACTTAA	2
ATAAATCAGGGTGTATTTTCGTC	1
ATAAATCGAAACATCTCACATATA	1
ATAAATCTAGATAACTGTGTGTCC	1
ATAAATCTAGCCAGGAATATGGGA	3
ATAAATCTGAATAGAATATTGGTC	1
ATAAATCTGGACATAGGAGAGGTC	1
ATAAATCTGTAGCCTGCTTTCTTC	3
ATAAATGAATTGGAGCTCGTAGTT	1
ATAAATGAGAGAGGTGGAGCTGGA	1
ATAAATGAGCCCGACGACACATCA	1
ATAAATGATCAAATGTGTGTCTAA	1
ATAAATGATGCGATATAACTTATA	1
ATAAATGATTTGGAGCCGGTTGTT	1
ATAAATGCTTGTGTGCATGGATGC	1
ATAAATGCTTGTGTGTATGGATGC	1
ATAAATGGAGCCCATTTTACGGGA	1
ATAAATGGTCAAACGTTATGTTA	1
ATAAATGGTGACTTGGTGAGATGC	2
ATAAATGGTGCAGAGGACTCAATG	1
ATAAATGGTGTCAATTCTGTTACA	1
ATAAATGGTGTTGGTAAAATTTG	1
ATAAATGTATTGTCTACGTGGAAT	1
ATAAATGTGCTGTAGGTGATACTG	3
ATAAATGTGGACAATGCTAGAAAG	2
ATAAATGTGGTAATTTGCCAACGGA	1
ATAAATGTTTTGGAGCCAGTAGTT	1
ATAAATTGAGAGGTGTTGCATAAA	1
ATAAATTGATGACTGATGATTGAC	3
ATAAATTGGGGCTAGTAGTTGACA	1
ATAAATTGGGGTGATGTTCGTTGT	1
ATAAATTTGATCTCTACTTTATCC	1
ATAAATTTGGTGCTAAATATCTGT	1
ATAAATTTTGATGAAATCCAAACA	1
ATAACAAAGTAGGGCCCATATAAT	1
ATAACACCATGATCTAAGGGCCT	1
ATAACACCCATAAAACCGAGCCAA	1
ATAACACCTAGGACTAGCTCGGAA	1
ATAACAGATACAATGGTGCAATCG	1
ATAACAGCGGGCCTTACGTGTACA	1
ATAACAGGTGGGACCATATATTAA	3
ATAACAGTAAATTGTTTTAGGTCC	1
ATAACAGTGTTATTGGATCATAGA	1
ATAACATATGGGCCATTTTAGTAG	1
ATAACATCGGAAACGATTTGGTAC	1
ATAACATGGCCTACCAAATATA	1
ATAACCAGGACAACAAACGGTTGC	1
ATAACCGAGCAGTGGTGAGGTGCA	1
ATAACCGGACCCGTGGCTGAC	1
ATAACCGGGACTAAAGATCAGGTT	1
ATAACCGTGGTTCGACAGGGCCTG	1
ATAACCTGGTGTTGACGGTCGTTA	1
ATAACCTTTCCTAGTATATAAGCC	1
ATAACGGGTGTATTGGTGTCATAG	1
ATAACGTGTCTATCGGTGTCATATT	1
ATAACGTGTTTATCGGTGTCATAG	1
ATAACGTGTTTATTGGTGTCATAG	1
ATAACGTTTTGAAGTCTGTGTTGC	1
ATAACTAACATTTGACCACTCGT	3
ATAACTAATTACACAGGTTGTGAC	1
ATAACTAGCATGGTGGCCCGCACA	1
ATAACTCAATTGGTTAGCTTCCT	1
ATAACTCATAGGTGTAGGTTATAC	2
ATAACTTGTGCCACAATTTCC	1
ATAACTTTCGGTGGTATAAAACAAA	1
ATAAGAAAACTAAATGGTGAGTGG	1
ATAAGAAACGAAAGGTAGCCTTAC	2
ATAAGAAATGGTGCAATAAGGCCA	1
ATAAGAACATAGGATTAGATGTGA	2
ATAAGAACCTGAGGTAGGTGCTA	1
ATAAGAACGATGATGCCATCAAGC	6
ATAAGAACGATGATGCCATTAGG	2
ATAAGAATGGTCACATAAGCTCTG	1
ATAAGAATTGATGTGTAAAATAGA	2
ATAAGAATTTTAGGTGGATGTGAC	1
ATAAGACAACGGTCAAATATGTGC	1
ATAAGACAAGTGGTCAAACAGTGC	1
ATAAGACAAGTGGTCAAACGTTGC	1
ATAAGACAGGGGTAGGCCATAGCT	2
ATAAGACATACGGTCAAATGTTGG	1
ATAAGACATGGTATGTGGTGGGTC	1
ATAAGACATTTTAGGATTGCCCAC	1
ATAAGACATTTTATAGTACAACGA	1
ATAAGACCTAGAGTAAGATGTGA	1
ATAAGACCTAGAGTAAGATGTGAC	1
ATAAGACGAAAGGTTAAACGTTGA	1
ATAAGACGAACAGTCAAAGTTGGA	1
ATAAGACGAATGGCCAAACATATG	1
ATAAGACGAATGGTCAAACAGTGC	1
ATAAGACGAATGGTCAAACATGTG	3
ATAAGACGAATGGTCAAACGTTAG	1
ATAAGACGAATGGTGTCAAACATG	1
ATAAGACGAGTAGTCAAACAGTGC	2
ATAAGACGAGTGATAAAGAGTGCA	1
ATAAGACGAGTGATCAAACAGTGC	1
ATAAGACGAGTGGTCAAACAGTGC	1
ATAAGACGAGTGGTCAAACGGTAC	1
ATAAGACGAGTGGTCAAACGTTAC	1
ATAAGACGAGTGGTCAAACGTTGC	4
ATAAGACGAGTGGTCAAACGTTGG	1
ATAAGACGAGTGGTGAAACGTTGC	2
ATAAGACGAGTGGTTAAACGTTGC	1
ATAAGACGATTGGTCAAACATGTG	1
ATAAGACGGACAGTCAAACGTTGG	2
ATAAGACGGACAGTCAAAGTTGGA	7
ATAAGACGGACAGTTAAAGGTGGA	2
ATAAGACGGACGATCAAACGTTGA	1
ATAAGACGGACGATCAAAGTTGAG	1
ATAAGACGGACGGTCAAACGTTGGA	1
ATAAGACGGATAGTCAGACGTTGG	1
ATAAGACGGGCAGTCAAAGTTGGA	2
ATAAGACGGGTGGTAAATGTTGGA	1
ATAAGACGGTTGATTTTGTGA	1
ATAAGACGTTTTAACTTTGGTCA	2
ATAAGACTAGAATGTTACGCTCCC	1
ATAAGACTTGGAGAAGGTGTTGGT	1
ATAAGACTTTCTAGCATTGTCCA	1
ATAAGAGAGACGATTATGGTTGCG	2
ATAAGAGAGTACTACGCTAATAG	2
ATAAGAGATTTTAGGTGGATCACA	1
ATAAGAGATTTTGAAAGGGTGTGAC	1
ATAAGAGATTTTGGATGAATGTGA	1
ATAAGAGATTTTTGATAGGATGTC	1
ATAAGAGCGTGTTGATGTCAAAAC	1
ATAAGAGGGTGTTGTATATATGTA	2
ATAAGAGGTAGAAACGTCATATT	1
ATAAGAGGTCCCTTAACTATACAA	1
ATAAGAGGTCCGCCTGCAAAAATA	2
ATAAGAGGTGAGGCTTCGAAGCTA	1
ATAAGAGGTGCGTACAATTAGTAA	2
ATAAGAGGTGTTACATATGGGTGT	1
ATAAGAGTGTTTGTAGGGTGT	1
ATAAGATATTTTAGGTGGATGTGA	1
ATAAGATGAATGGTCAAACGTGAG	2
ATAAGATGAATGGTCAAACGTTAT	2
ATAAGATGAGTGCTCAAACGTTAG	1
ATAAGATGAGTGGTCAAACGTTGG	1
ATAAGATGAGTGGTCAAATGTTGG	1
ATAAGATGGACAGTCAAACGTTGG	1
ATAAGATGGACGATGAAAGTTGGG	1
ATAAGATGTGACCCCTAGAACAAC	1
ATAAGATGTGGGTGTGCCAACTAG	1
ATAAGATGTTGTGACTTTGGTT	1
ATAAGATTAGATGATGAGGTGTAA	3
ATAAGATTGCCCGATAATAGATCGA	1
ATAAGATTTGGGTGGATGTGACA	1
ATAAGATTTTTGAGGATGAGGTGT	1
ATAAGCAAAAATATGATGTAGCAA	1
ATAAGCAAGGTGATACTAAAATCC	1
ATAAGCAAGGTGATACTAAACTCT	1
ATAAGCAAGGTGGTACTAAACTCC	1
ATAAGCACAGTTGTGGGTTCCAGT	1
ATAAGCACATGATGGCCTAGACTC	1
ATAAGCAGCTGATTGGTAGCCAAC	1
ATAAGCAGGTATGCAGTGTGCTTA	2
ATAAGCATACTACTAGATTATTGG	1
ATAAGCCAACTTATAAGCCGAAAA	1
ATAAGCCGATGCAACGTCCAGATA	2
ATAAGCCGTCACCTAGAATGAAAG	1
ATAAGCCTAAACAAAGAAGGCCTA	1
ATAAGCCTAAACAAAGAGGGCCTA	1
ATAAGCCTAAATAAAGAGGGCCTT	1
ATAAGCCTGGATGGGAGATAGCCG	1
ATAAGCGAAAAGATGAGGCCGTAT	1
ATAAGCGGGTTTGTGGGTCGGTCC	1
ATAAGCGTCGCGTTAATGCCATGT	1
ATAAGCTCCTCCAAACAGGACCT	2
ATAAGCTGGTGGATTTCATGTCTT	1
ATAAGGAAACCTGATGGGTATGCA	1
ATAAGGAATGCATGGATGATTGAA	1
ATAAGGAATTTTGGTGGGATGTGA	1
ATAAGGACATGGGCCGAAAACGCG	1
ATAAGGACTACTCGGATGGTATC	1
ATAAGGACTGAAGAGGTAGAACAC	1
ATAAGGAGAGGAGGCAGCGGATGG	1
ATAAGGAGGTTGTGGCTGATCAAG	1
ATAAGGATGGGCTACGCATGCGC	1
ATAAGGCCAGTCACAATGGGGGT	1
ATAAGGCGAATGGTCAAACATGTG	1
ATAAGGCTCAGAAGGCTGAGGAGC	1
ATAAGGCTGGCCACTTATCGAGAT	1
ATAAGGGAATTTAAAGGGATGTGA	1
ATAAGGGATTTTGGGTGGATGTGA	1
ATAAGGGCCCCTTTGAATCAAAGG	3
ATAAGGGCCTAACATGAATGTATG	1
ATAAGGGCTCCTCCAACAAGGATG	2
ATAAGGGGATTTTAAGTTTTACTT	1
ATAAGGGGTTTTGGATGGATGTGA	1
ATAAGGGTACTACCAAATATTTGG	1
ATAAGGGTCCACGTGTTATAGATA	1
ATAAGGGTGGGCGCGTGGGGTGG	1
ATAAGGGTTAACCTGAGAGTGCAC	1
ATAAGGTATTTTGATTGAATGGAA	1
ATAAGGTCGTCGACATTAGGTCCA	2
ATAAGGTGAACATGCAATATAGAC	1
ATAAGGTGAACTATTAGCGTATGA	1
ATAAGGTGAATGAAACTGAAGTGC	4
ATAAGGTGACTCATTAGCGTATGA	1
ATAAGGTGAGTCCATGTAAGATGA	1
ATAAGGTGATGGGACAAATTCCCA	1
ATAAGGTGGACAGGGTAATTCCGT	1
ATAAGGTGGACCTGTATGGGCTGA	1
ATAAGGTGGTGAGAATAAATCTCG	1
ATAAGGTGGTTTGATTGCTTTAAA	1
ATAAGGTGTCACATGGTGAATGGA	1
ATAAGGTGTGCCTGCGAATGTGCG	1
ATAAGGTGTTGCGTCACCGGGGGA	1
ATAAGGTTGTGCATCTGGCTCGGG	1
ATAAGTAAGGTGGTACTAAACTCC	3
ATAAGTACGTCGCCTAGAATTGAA	1
ATAAGTATTTTTGGACTCTGGTAC	1
ATAAGTCACGAGTAAATTACATTC	1
ATAAGTCAGGTTGGATACGGATATC	1
ATAAGTCCATAACAGTAGTGTGCA	1
ATAAGTCGGTCTGACTGATTATGG	1
ATAAGTCTAAACAAAGATGGCCTA	1
ATAAGTGAAAAGATGAGGCTGGAA	1
ATAAGTGAATGCTGAGGATTGTGA	1
ATAAGTGAATGGTGAAGGGATTGG	1
ATAAGTGAATTCACGAGTCGGCCC	2
ATAAGTGAGGAAAGAGAAAGTG	1
ATAAGTGAGTGCTTGGTGAGGACC	4
ATAAGTGAGTGCTTGGTGAGGAGC	4
ATAAGTGCAGCCATGGTTTTCAGC	1
ATAAGTGCAGCCGTAGATATCTG	1
ATAAGTGCAGCCGTGGATATCCGT	1
ATAAGTGCATATTGTTGGAACACC	2
ATAAGTGCCATTTGGTGAATTGTC	1
ATAAGTGCCGGTTTTTAAAAACTG	2
ATAAGTGCTGGTCAGTGATGATG	1
ATAAGTGGGTCCTGTATTAATTGT	1
ATAAGTGTAGCCATGGTTTTCTG	1
ATAAGTGTCATACGTGTTTGTTCA	1
ATAAGTGTCATCGGTGATGGGCTA	1
ATAAGTGTCTTATGGTGAATTGTC	1
ATAAGTGTTGCCATAGATATCCGT	1
ATAAGTTAATTTTACAGGTGTTTC	1
ATAAGTTGAATCTGGGAGCTGGAG	1
ATAAGTTGGCTTATAAGCCTAAAC	1
ATAATAAAATAAGGCCGCGAGTGT	1
ATAATAAAATAAGGCTGTGAGTGT	1
ATAATAAAATAATCTCGTGGGTGT	1
ATAATAAAGGCATGGTGTCTAAAT	1
ATAATAAATGGGAGACGTCTACGC	1
ATAATAACCAAGAACTAGATGTGA	1
ATAATAACCTACGATTGAATGAGA	2
ATAATAAGGAAAGAGCTACGAGAC	2
ATAATAATAGGTGGCTCAATGGAA	1
ATAATACAACAAATCTGGTCAGAC	1
ATAATACAAGAGATTTTAGGTGGA	1
ATAATACAATTGGTAGATCGATGC	1
ATAATACACTGGTGGAGAAAGGG	1
ATAATACAGATATCCCTATGGCCA	1
ATAATACCCGATGTGACACACCAA	1
ATAATACCTCCGGTGTCTAGTAGC	1
ATAATACTTCAATTCCTACGTTTT	1
ATAATAGATAGATATATAGATAGA	2
ATAATAGATTAGTTATAAGGTTGG	1
ATAATAGGTGGTCTAATTTGGATA	1
ATAATAGTAGAGATTAGGGTAGGC	1
ATAATAGTGGAGAAGTGTTTGC	1
ATAATATAAACTAGCTGGGTGACC	1
ATAATATAGGGGTGGGACTTTAGTC	1
ATAATATATTATAGGTGTCGGTTC	1
ATAATATCAGATGTGACATATCCC	1
ATAATATCCGATGTGATACGCCAA	1
ATAATATCGTATCAGAGGGGTCTA	1
ATAATATGAAACGGAGGGAGTAGC	1
ATAATATGGTAGTGTTGTTTCTCA	1
ATAATATGTAGGCCTAGAATGAGA	1
ATAATATGTCAATTAAAAGGGTGG	1
ATAATCACATGCCTGGTTATTACC	2
ATAATCCAGCGTGCTACTATAGT	1
ATAATCCGATGTCTCGGAAAGTCC	1
ATAATCTGTATGCCAATAGAGAAT	1
ATAATGAAACATTCGACGTCTCGA	1
ATAATGAATCTGGACAAGGGTGT	1
ATAATGAATGATAGGTGTGTCTAG	1
ATAATGAATTAGCTATAAGGTTGG	1
ATAATGACCTACAAGATGTACCAA	1
ATAATGAGGTGTTGTTTGAATCTAC	1
ATAATGATAGTGGTTGTCTCTGAC	1
ATAATGATGCTAGCCGCGAATCTG	1
ATAATGATGGTGTCATTATGAAG	1
ATAATGCCTCAGCCAATCGGTTA	2
ATAATGCGACCGGTGTTCTACAG	1
ATAATGCGTACACGAAATGGT	2
ATAATGCTCTAAGTACACATCTAT	1
ATAATGGAAATGGGGTTGGGTGTT	4
ATAATGGAAGGTTGATGCGGTTGG	1
ATAATGGACGCGGTGTCCACTGG	2
ATAATGGAGTAGTGTGACACACAG	2
ATAATGGATGTCGACGAAGTCAGT	1
ATAATGGATTTTAGAAGAATGTGA	1
ATAATGGGTCACTATAAAATAGTA	1
ATAATGGGTCCACCAATTTATTAG	1
ATAATGGTGATGCCGGGTTGATG	2
ATAATGGTGTAATCGGATGATAGA	1
ATAATGTAAAGTTCGGGTGTCCTC	1
ATAATGTATGGGCTAGTAGATTGC	2
ATAATGTCTGATGTGACACGCCAA	1
ATAATGTGGAGTTTATGAAAATCA	1
ATAATGTGTGATTAATTGAGTTT	2
ATAATGTGTTACCACAGGTGTGCT	2
ATAATTACAAAGAGAGGACGC	1
ATAATTAGAGCCTAGCTAACCCAT	1
ATAATTAGATCACTTGATGACGAC	1
ATAATTATATTGGAGAAGTGCTAG	1
ATAATTCTACACGTTCGCTGGTCC	1
ATAATTCTTTGTTGGTTGTTGTGT	1
ATAATTGAAGAAGGTGTGTGATT	1
ATAATTGAGGGTGTAGAATGTCTG	1
ATAATTGCTTGTAGGTCCTACTGA	1
ATAATTGGGGTGAACTGGCACTGA	1
ATAATTGTTTGGTGTATATTCATA	1
ATAATTTAAAGTATTATGGGTCG	1
ATACAAAACGAGAGATAGTGATGG	1
ATACAAAACGCATGGTGCAGTAAC	2
ATACAAAACTGTTCACTCAAGGTC	1
ATACAAAATGCAGGCCACACAAG	1
ATACAAACGCAGGGGATACATTGG	1
ATACAAACTTGCTTCCGCGTT	1
ATACAACCGGGGCTAAATACGAAG	2
ATACAACGAATCTAGATGTGTCAT	1
ATACAACGAGGTTGACACATTGTG	1
ATACAACGTATCCCTAAACTTAGA	1
ATACAACTGCAGGTACATCCACCA	1
ATACAAGAAACCTGCAAGAC	2
ATACAAGAAGGGCTTGCACAAGA	1
ATACAAGAATGACCGTTTGATTGG	1
ATACAAGGGGTTTGGGATGGGGAA	1
ATACAAGGTAGCATTAGGAGATGA	1
ATACAAGGTCACCTGTTAGAGTGC	1
ATACAAGGTTAGCTACATGGGTAT	2
ATACAAGTAGCTTGTAGTGGGTCC	1
ATACAATAAACAGGTGGACGTCTA	1
ATACAATAAACGGGTGCATATCTA	1
ATACAATAAAGTATACTAGAGCCT	2
ATACAATGTGTATATGACAGGTGG	2
ATACAATTCGATGTGCCTGTTGTT	1
ATACACAAAACAAAACAAGGTGAC	2
ATACACAATTATTGTTGAGGTTGC	1
ATACACACACTGTGTCTTAGAGTCC	1
ATACACACACTGTGTCTTGGAGTC	1
ATACACACAGGTCCTCACGTGTAC	1
ATACACACAGTGTGTCTTGGAGTCC	1
ATACACACATAACTTTTCAGTCAC	1
ATACACACATAGTGTCTTGGAGTC	1
ATACACACTGTGTCTAGAGGCGGA	1
ATACACATAGTGTGTCTTGGAGTC	1
ATACACCTAGGTGCAGACGGGACA	2
ATACACCTCAAGTTCACACATCT	1
ATACACGAAGCCACGGAGTGATGA	2
ATACACGGAGAGGTGTGCGCGCGG	1
ATACACTAAAATACTTCTAGGTGG	1
ATACACTATACAGAGTGCGGGA	1
ATACACTCATCCCTATGAATGCAC	1
ATACACTCATGAATGATGGATGTA	2
ATACACTCGTGGTGGGAGCAGGTA	1
ATACACTTGGTTGCCTATTTATAG	3
ATACACTTTAACAAGTTCGGGGAG	2
ATACAGAACATGACCTCGGTAGTG	1
ATACAGACATAACTTAAAGTGCCA	1
ATACAGAGTGTGCGTGCGTTGTAC	1
ATACAGATTGACGGGCTGAATACA	3
ATACAGATTGGGAGCTTAGAGTC	1
ATACAGCCCTAGTGTGGGATGCGA	1
ATACAGGAAGACGAAAGTGCCCA	2
ATACAGGACCGTGATAGTGAGCAA	1
ATACAGGTGTTTAAACGTTCGATA	1
ATACAGGTTCGGGCCGCTGAGAA	2
ATACAGTGCTACTGTTGGGCT	1
ATACAGTGTGTATAATAGGTGGGA	1
ATACAGTGTTAAATGGGGTGGTTA	1
ATACAGTTGTCTGAAGAATGTGCA	1
ATACATAGATGTGAAAATAAGTGA	1
ATACATAGTGAAACATCATGAGTA	1
ATACATATGATTGAAGGATGTCT	1
ATACATCATGTGTCACATATGCCA	1
ATACATCCTGTTGGGTGTAGAGGC	1
ATACATCTAGGTGTATAGAATGGC	1
ATACATCTTAGGCGGGCCGGATAA	2
ATACATGATTAGCCTATGTGATGC	2
ATACATGGACATGGTATAGGTGCT	2
ATACATGGATTAAACAAAAGATGG	2
ATACATGGCATGCGCAAGTAT	1
ATACATGGGCTTGCACTTTCTT	1
ATACATGGTGATATAGTTTGTTGC	1
ATACATTCAACCAACTGTGTGCCA	1
ATACATTGAGGCCAAACGACGTGT	1
ATACATTGTATGCATTTAGTGAAC	2
ATACCAACAACGATGATGTGTCTA	1
ATACCAACCGAGATTAAAGATCTA	1
ATACCAACCGGGACTACAAATCAG	2
ATACCAACCGGTACTAACGATGTC	1
ATACCAACTAGGAAGGTGGCCCGC	1
ATACCAAGCTGGACAAGGTGGGCC	3
ATACCAAGGCTCAATACAATCAAG	1
ATACCAATGTTGGGGCTCTTGGAA	1
ATACCACAAGATAGGGCCTGTGAA	1
ATACCACATCAGTGCCACGTATAG	1
ATACCACGAATCTAGATAGATGCC	1
ATACCACGCATAGGATGGGCA	3
ATACCACGTGGGACAGAGACCTAG	1
ATACCAGACATGAGGGGTGTGTAC	1
ATACCAGATAGGCCACTTTTCTAC	1
ATACCAGGACTATTTCTGGCGCCA	1
ATACCAGGCAACACTGCCACGTAG	1
ATACCAGTCACATGGTGTTGGCCTA	1
ATACCATCAAAAGATCTCGGTGCA	2
ATACCATGAGGTACCAAATTTGAT	1
ATACCATGCCAGGGTCACGTGCCA	1
ATACCATGGCTGCACTTATTTGAG	2
ATACCATGGTGTCTCATATGAGTG	1
ATACCATGTGAGAAGGTGAGTA	1
ATACCATTACTGTTCACGATATC	1
ATACCATTGTCGTGAAATGAAAGC	1
ATACCATTTAATATTCGATGTGAC	1
ATACCCAAGGTAGCCAGTATAAAG	1
ATACCCAAGGTGACACGCGAAAACT	1
ATACCCAATAGTGATTGACTAAGC	1
ATACCCAATGTGACACGCCAAAA	1
ATACCCAGGTACCAAGGCCTGATA	1
ATACCCAGTGCAAGTTTTTGGGTC	1
ATACCCAGTTGATAGATGGTGTAA	1
ATACCCATAGGTGTCCTCTTGTCC	2
ATACCCATCTTTAGTCCCGGGTGA	1
ATACCCATTAGGCAGGGTGGGTC	2
ATACCCCAGTTGAGCTGCCTGTAG	2
ATACCCGGTTTTACGGAGGGATGC	1
ATACCCGTCGACGGTGAGCGCCTG	1
ATACCCTATATAATACCATATGTC	1
ATACCCTGGTACTAACGATAATAA	1
ATACCGACATGGAAAGCTCAGCTG	1
ATACCGATACACCCGTGGTGACTT	2
ATACCGATGCTGCTACGTGAA	2
ATACCGATGGGGCTCGAAATTTAG	3
ATACCGATTGATAGAATGCCGTAT	1
ATACCGCACGGTCTCGCGCTTT	2
ATACCGCGCGTGGTAACTGTACGG	2
ATACCGGAACGTGTCTCCGTCACC	1
ATACCGGAATAGGTGTATGATGCA	1
ATACCGGAGCCAGTTGAAACACAT	1
ATACCGGGCGCTTTAGTGTCTGGT	2
ATACCGGGTGACAAAGTTGGATAC	1
ATACCGGGTGACGAACTTGGATAC	4
ATACCGGGTGACGAAGTTGGATA	4
ATACCGGGTGACGAAGTTGGATAC	2
ATACCGGGTGACGAAGTTGGATAT	1
ATACCGGTCAGAGATGGGTTATCT	1
ATACCGGTCCAATCTTATTTCGTA	1
ATACCGGTTAGGTATTAGGACCTG	1
ATACCGTGCCACCGCGGATGGGAG	1
ATACCGTGTCTCTAGATATATGTC	1
ATACCGTTAGGGATATGGACTGTA	1
ATACCGTTCGGACGGTACAGGCCT	1
ATACCGTTTGATGTGGGTATGTCC	1
ATACCTAACAAACTGTGACAGCCA	1
ATACCTAACTTTTTCAGTCTTTAG	1
ATACCTAAGAGCCGAACAACGCAC	1
ATACCTAAGGTAGTGTTTGGTTGC	1
ATACCTAGTCGGTATCAAAGGTAC	1
ATACCTAGTGGAACATCGTGCAAA	1
ATACCTCAAAGGTGTCGGTTTCTA	1
ATACCTCAAGGGGATACCACATGC	1
ATACCTCCACGAGGGTAAAGGTAC	1
ATACCTCCCACTAGGGGTGGCAAT	1
ATACCTCCGAGGTGTCGCCTAATA	1
ATACCTCGGTATCGATGGGTAC	8
ATACCTCTATGAAGGTGCGGGACC	1
ATACCTGAACTGTTGGTGCAGCCT	1
ATACCTGATGGACCGTGGGCAGG	1
ATACCTGGTGGAACATCGTGCAAC	1
ATACCTGGTGTGAATTGCAGAA	2
ATACCTGGTGTGCAGGAAAGGTGT	2
ATACCTTGGAATACTACTGGGTGG	1
ATACCTTGGTCTCAGAATATGGT	1
ATACGAAAATATAAATCGGGGTGA	1
ATACGAAAATTGATTTTCCTGTGC	1
ATACGAACGGTCAAAGTTGGGCGC	1
ATACGAAGACTGTGGAGGGCTGAA	1
ATACGAAGCGATGATGAAAGTGTA	2
ATACGAATACCACTGCTGACGGCG	1
ATACGAATATGGAAAATGGTAGA	2
ATACGAATGATGAGTTTACGTCCA	1
ATACGAATGGTCAAACATATGTTC	1
ATACGACAAGTGCTTTATGGACAA	2
ATACGACATAACCGACTAGGTGGC	1
ATACGACGTGGTGGCTGAATTACC	1
ATACGAGAATGATAAGATTTGGTC	1
ATACGAGATGCACGTGAATGGTCC	1
ATACGAGGTGGTAATAACGTGTGA	2
ATACGAGTGAGGACAAAGTGTGCA	1
ATACGAGTGATCTACAAGTTTAGG	1
ATACGAGTTATTGCCTTACACTTA	1
ATACGATAAATCTGTACACACGTA	1
ATACGATACCGATATGATTAAGAC	1
ATACGATATCTGATGGACCCACCT	1
ATACGATGCCTTAAGTGATCCGCA	1
ATACGATGTGATAGGGACTTAAAA	1
ATACGATTGTGATCCTACTTGGAA	1
ATACGATTTTACGGTTGAGGGTCA	1
ATACGCAAGATAATTGGGGATAGC	2
ATACGCATCAAGGTGTGGGGTGAC	2
ATACGCGAACCGACGTGGCAGGAG	1
ATACGCGCAGATATACCACACCGA	1
ATACGCTATAGGGGAGGCGGAGATC	1
ATACGGCATGCGGTTGGTAGATTC	1
ATACGGCCAAACATTGGACACGGA	1
ATACGGCCGGCCCTTAAAATTGGA	1
ATACGGCTGTCGTTGAGGAGGTAC	2
ATACGGCTTTGTAATCCCGGGTGT	2
ATACGGGGCCCAGCAAATTGATTC	1
ATACGGGGGCCGCCTGCAAATGGG	2
ATACGGGGTCCCTTAACTATACA	2
ATACGGGTATTCCTCCACACCGGTA	1
ATACGGGTGGTCCACACATTTCAT	1
ATACGGGTGTAGAGCAGATTGTT	1
ATACGGTCAAATGCTGGATACGGA	1
ATACGGTGAAGGGCTTACGGATAC	1
ATACGGTGGATGGATACCGTGTGG	1
ATACGGTGTGTTTTCTTTTGCAAA	1
ATACGGTTGGTTCCTATGTTCTCC	1
ATACGTAAAATGAGGTGAGCC	1
ATACGTACCCATCTTTAGTCCCGA	1
ATACGTACTGTAGATTGAGTGCTA	1
ATACGTAGATGTCCTTATCAATCC	1
ATACGTATTCTTAGGGTGTGTTT	2
ATACGTGCGTCTAGAGGGAGTGAA	2
ATACGTGGCGGTATTGACCTGGTC	1
ATACGTGGTGACTTAAGAGTGCTA	1
ATACGTGGTGCTAACGTCATGCTG	2
ATACGTGGTGCTAATAGGGGACGT	1
ATACGTGTATAACAGGTGGGACCA	1
ATACGTGTCTCACATCCGTGGTC	1
ATACGTGTGCGTGTTTAGTGGGAC	3
ATACGTGTGTACCCTATTTCTAGT	1
ATACGTGTGTCCAAATATTTAATG	1
ATACGTGTTAAATATATAGGGTGA	1
ATACGTTGATGTGATGTGATGC	2
ATACGTTGGGCCACCAATATGTGCC	1
ATACGTTTTTTGGATGTCCTGTAG	1
ATACTAAAATGTGTCACATCCGA	1
ATACTAAATTGCACCTACCTGCCA	1
ATACTAAATTGTTGGTGTGCG	6
ATACTAACGCCGATACTATATTCA	1
ATACTAATAGGCATGAACGAAG	1
ATACTAATTATAAGATTGACGGTC	1
ATACTACACTATTAATACCTGGTC	1
ATACTACGAGAGAGGAATGTGTGG	1
ATACTACGGATGAGAGGTGGACCT	3
ATACTACGGTGCCACTACTAGTAC	2
ATACTACGTTGTATGCTGATAGA	1
ATACTAGGTTGCTATATTTTGGGA	1
ATACTAGTGGTACCATGAGTAGAG	2
ATACTAGTGTGACCCACAAGCCA	1
ATACTATATAGGTGCCAGAAATGG	1
ATACTATCTATATTTGTTGGGGTC	1
ATACTATGAATCTGGACAGGGAGC	1
ATACTATTATGGTGGTATCTTGAC	1
ATACTATTGAGGTGGTTTACTGAG	1
ATACTCAAACAGGGCATTGCA	1
ATACTCATCTGTGACGGGCCATAA	1
ATACTCATTGGAAGTATGTGTCTA	1
ATACTCCAACAAGAGTTAGGGTGT	1
ATACTCCATGCATGTGCCCAAACA	1
ATACTCGGGCATGCATCAATTGGG	1
ATACTCTTGGAAGTATGTGTCTA	1
ATACTGACTGGACTGCCACGTGT	1
ATACTGACTGGATTGCCACACGTA	1
ATACTGACTTGGGACCTAAATTAG	3
ATACTGAGAGAAAATAGGGTGCTA	1
ATACTGATGGTGGTGCAAAATAGC	1
ATACTGCATTGATAAGATGATCATC	1
ATACTGCCACGTAGGAGCCATGTC	2
ATACTGCCGTTACGGGATGTTGC	1
ATACTGCGATATTAGGTGCTGGTT	2
ATACTGGGAGTGGAGTTGGGTGG	6
ATACTGGGGCCAATGTACATGTT	1
ATACTGGTGGATTTGACTGATAGC	1
ATACTGTATTAGGTGGTGTTTGG	1
ATACTGTCGGTGATATGGGCCT	1
ATACTGTGACCTAAATATTCTT	1
ATACTGTGCACATGTTATCAT	1
ATACTGTGCATGAACGATCTCGAG	1
ATACTGTGGGCCTAAAATTCGGA	1
ATACTGTGGGCCTAAAATTCGGAT	1
ATACTGTTGGAAGTATGTGTCTA	1
ATACTGTTTAGGTTTGGTGTTATG	2
ATACTTAAAAAAATCAACGGTGTC	2
ATACTTACGGTCGCGCTACATGA	1
ATACTTAGGGACAGATGGAGTAA	1
ATACTTCAAATGTGTGTCCGTATA	1
ATACTTCAAGTGGCTAGGAGGGCA	1
ATACTTCATATAGGTGATCAAAC	2
ATACTTTAAATGTGTGTCCGTATA	1
ATAGAAAAAAGGTACCTCATGGTA	1
ATAGAAAAAATGGTACCTCATGGT	1
ATAGAAAAAGGAGCCTACACATTC	1
ATAGAAAAATAAAGTACAGGCTGC	1
ATAGAAAAATAATGCGGTGCCAAAA	1
ATAGAAAAGGAGCCTTCACGTT	1
ATAGAAAAGTAAATATAGGGGTG	1
ATAGAAAAGTAATGCGGTGCCAAA	2
ATAGAAACAAATACGGTAAGTGCA	1
ATAGAAACCAAGTTCTCGCA	1
ATAGAAACGACCTACGACCTATGC	1
ATAGAAAGGAATAGGTGTCTGAGC	2
ATAGAAAGGATGAGCCAATTTCGA	2
ATAGAAAGTTTTTGCACGAAACGC	1
ATAGAACAAAGGGTACCTTATAGA	3
ATAGAACAGTTCTTATGGTTGCA	1
ATAGAACATGAAATGCACCTATGA	1
ATAGAACCTGGTCTAGATTGCATC	1
ATAGAACGTGACAAAGTCAGTGGC	1
ATAGAACGTGATAAAGTCAGTGGC	1
ATAGAACGTGGTGTCTCCTTTCAA	1
ATAGAACTAGGGGCCTGTTTTATC	1
ATAGAAGGGCGTCGTGATTGAAAT	1
ATAGAAGGGTTACAAGTGCTATC	1
ATAGAAGGTGGTATGGCATATATA	1
ATAGAATATAATTCCGGGCTTTGC	3
ATAGAATATGTTGCCAATATGTAA	1
ATAGAATGACTTGTAGTGTGAAAC	1
ATAGAATGTAATAGAGTGCATGTA	1
ATAGAATGTATGCCTTATCCGTAA	1
ATAGACACACTGCGTCTTGGAGTC	1
ATAGACACAGATGGGCCCATTTG	1
ATAGACACTATAGGTTGGGACTGC	2
ATAGACACTATGGGTTGGGACTGC	1
ATAGACACTGCTTATGAACACTAT	1
ATAGACACTGCTTATGGATACTATG	1
ATAGACACTGTTTATTAGTTTGTA	1
ATAGACCATAAACAGGATGTGCCA	1
ATAGACCGAAATTGGTTGGGGCGC	1
ATAGACCTAAGTGACACCACCTCA	1
ATAGACGAAGATGATGGAAATTAC	1
ATAGACGACTGATCAACTACAATG	2
ATAGACGCTGATACTTATGGGCCA	1
ATAGACGGGACCCACATGTATGGA	1
ATAGACGTGAAGCGTGTCTCTATG	2
ATAGACGTGTCACACGAGGTGCTC	2
ATAGACTAGCAATCGGGTTTTTAT	2
ATAGACTAGCATGATAACCCATGA	1
ATAGACTCAAAAGTGTGACTGTAA	1
ATAGACTGACATATGATCTGCGAT	1
ATAGACTGGGCCATACAACGTAGC	3
ATAGAGAAAGTAAGGGCCTGGATC	1
ATAGAGAAGATTGGGAAGATACGC	1
ATAGAGAATTGACGGAAGTGTTAA	2
ATAGAGACATGGAACCCTAACGGG	1
ATAGAGAGAAAATAATGGCGCAC	1
ATAGAGAGAATCCACTCAGTGCCA	1
ATAGAGAGGTGCCATGTGTCCAAC	1
ATAGAGAGTTGGCTATATAGGTGT	2
ATAGAGATAAATGGGCCCGCATCG	1
ATAGAGATATCAGGACGCTTGATC	1
ATAGAGATGATAAGTGAACCC	1
ATAGAGATGGTGCAGTACATCCCG	1
ATAGAGATTGCCTAAACTAATACT	1
ATAGAGATTGTGTTGCTTTTGTG	1
ATAGAGATTTAGTGTAGAACTGTC	1
ATAGAGCCACGTGGCAGCCTAGGA	1
ATAGAGCTTTGTCTACATTCCTGC	2
ATAGAGGAAACGCCAATCGACAAG	1
ATAGAGGACCATGTTGCGAGAATA	1
ATAGAGGATCTTGATGTTGGTGT	1
ATAGAGGCATTGGTTGTCAACGAA	1
ATAGAGGGATGTGCCTGTTGTAACC	1
ATAGAGGGGCTACGTTGCAAAGAG	1
ATAGAGGTCCTCGGTGGTGAGTGT	1
ATAGAGGTCGGCTCTATAGGTGTC	1
ATAGAGGTGCATTTATGTCTTATT	1
ATAGAGGTGGGTGCTACATCTAAT	1
ATAGAGGTGTTTCAAAATATATGG	1
ATAGAGTATTAAATATAGACAATA	1
ATAGAGTGAAAAATTTTAGGGTGG	1
ATAGAGTGAGTGGTTAGCAGGTAG	1
ATAGAGTGCTATATAGCAAAGTGA	1
ATAGAGTGTCGTATGGGGTGTTCA	1
ATAGAGTGTGTGTCCAGATTTGTT	2
ATAGAGTTGGTGTCACTTTACAC	1
ATAGAGTTTGTGTCGAATACGTGT	2
ATAGAGTTTTGATGAGGCACTGAC	3
ATAGATAAATGAGGGGTCTGACAC	1
ATAGATAACTAGCAAAAGTGCCCG	1
ATAGATAATTTGTGGAGCTAAGAG	1
ATAGATAATTTTGTATGGGTGCTA	1
ATAGATACGGTGTCCACTAGCAAA	2
ATAGATACTGTGTGCACTTGAATA	1
ATAGATAGATAGATAGATGCC	1
ATAGATAGCCGAGTTACTGCACCA	1
ATAGATAGCTGAGGGCATTATAGA	1
ATAGATAGGTGATACCATTAGAG	1
ATAGATATGAAGTAGAGGGTGTAA	1
ATAGATATGATCCTGCTAGTGC	1
ATAGATATTGTTAGTCAAAGTAGC	2
ATAGATCACATCTTGGTTGGCTGC	1
ATAGATGAATTGGAGCCAGTGGTT	1
ATAGATGACCCTATGAGTGGATGG	1
ATAGATGACCTCACATTTTGTGAC	1
ATAGATGACGCCGTTGACTTTTA	1
ATAGATGAGAAGGAATCGTGCCAC	1
ATAGATGAGCCTGCTGCCTGC	2
ATAGATGAGGATGGTTGCTCAGA	2
ATAGATGAGTGTTTACAAATAGAC	1
ATAGATGATATACTACGCATGTGC	1
ATAGATGATTTGGAGCTAGTAATG	1
ATAGATGCAAGAATGTTGGTCACC	1
ATAGATGCATTGTAAACGCCCTTA	1
ATAGATGCCATGGCACCTAGGTGT	1
ATAGATGCTACTTAACTAGGTGAC	2
ATAGATGGCATTGCGATGGCACCA	1
ATAGATGGCCAAATGGGTCGCCCA	1
ATAGATGGGACCACGTATACATAG	1
ATAGATGGTTATAAGGCCCGCCT	1
ATAGATGTAGGCCGCTGATGCTG	1
ATAGATGTGCTAGAAATGTATAGA	1
ATAGATGTGGGACCCACTGCTGGG	1
ATAGATGTTAATAAATCTAGGCGC	1
ATAGATTGAATCGAAAACCAGAAG	1
ATAGATTGATAATGGTCTGCGTTG	1
ATAGATTGGTAACACGTGTTGGTA	1
ATAGATTTTAGGAAGATGTGTGGT	2
ATAGATTTTCAGAATCTGGGTGAC	3
ATAGATTTTGGTTTGATGTGACA	1
ATAGCAAAAGGACGCTTGAGATGC	1
ATAGCAAATGCCACAAACTTTGAG	1
ATAGCAACCTAAAATCAGATGGAA	1
ATAGCAACCTAGGATCGGATGGGA	1
ATAGCAACCTAGTACTAGACGGGA	1
ATAGCAACCTATGACTAGATGGGA	1
ATAGCAACCTATGATTGGATGGGA	1
ATAGCAACCTGGTACCGGATGTGA	1
ATAGCAATAGGTGATGGTGGTAGA	1
ATAGCAATCTAGGACTGGATGTGA	1
ATAGCAATCTAGGATATGATGGGA	3
ATAGCACGAGGAAAAGGAGATGGA	1
ATAGCAGAACTCGATGATACCGAC	1
ATAGCAGAATACTAGTGTGCC	5
ATAGCAGTGCAGGCTTGAGATTGG	1
ATAGCATACTATAAGGCAGCTATA	1
ATAGCATGGATACGAATATATGAA	1
ATAGCATGTTAAGGGCCTGCTCGG	1
ATAGCCAAATATTATTGTGGCAAG	2
ATAGCCAACTCACGATATTGTGCC	1
ATAGCCAATCTGTTGGAGATGTTC	1
ATAGCCAATTTAATATATGGTCCC	1
ATAGCCACGTGGTGGTCTAGGAGC	1
ATAGCCAGCTACAGCACGGACTCC	1
ATAGCCAGCTGTAGCACGGATTAC	1
ATAGCCAGTCAGATAACTATGCCA	1
ATAGCCAGTCGGATAACTATGCC	2
ATAGCCAGTTACAGCACGGTCTCC	1
ATAGCCATAAAAGAATAACAAGAG	1
ATAGCCCAACCTCCATGATGGCAA	1
ATAGCCCATACAGACGGCCCATGA	1
ATAGCCCATCTAGCCACGTTGTGC	1
ATAGCCCGCTGCTCTTCTCTCTTC	1
ATAGCCCGTCACAGATGACCTATC	1
ATAGCCGACTGTCGACAGTACTAT	1
ATAGCCGATGACAGGAGGAGATGG	1
ATAGCCGCTTTCTTCTCTCTCTTC	1
ATAGCCGGGACCCCGAATCCGGGA	1
ATAGCCGGGCACGACTAGCTAGCC	2
ATAGCCGTGCCCGCGGTTATGGGC	2
ATAGCCTACAAAGATGTGCAGGG	1
ATAGCCTACTATTGTACCTGCTCT	1
ATAGCCTAGGGGTTATAAAATGGA	1
ATAGCCTAGGGGTTATAGAATGGG	1
ATAGCCTAGGGGTTATGGAATGGG	2
ATAGCCTGCTATTGTACCTGCTAT	1
ATAGCCTTGTGAGAGGGTCCACGT	1
ATAGCCTTTAGCCTATATTTATCT	1
ATAGCCTTTGATGACTGTTGTGAT	1
ATAGCGAATCTACACCGTTTGGCG	1
ATAGCGATGTTACTGTAAGAGTGC	1
ATAGCGCATGTGGGCTCTGTGTGA	1
ATAGCGGCTAGGTGCTATGTTGGT	2
ATAGCGGGAACAGTTGATTATGGT	1
ATAGCGGTCGCTAAATTCCAACGT	1
ATAGCGTGGTGGTTGATGTCTTAGG	1
ATAGCGTTTAGTGTCTATTTGGTT	2
ATAGCTACCATAGCAGTTGTT	2
ATAGCTACCATTATGAGACTA	1
ATAGCTACCTAGTATTAGATGTGA	1
ATAGCTACGTTGCCTACTACTTAA	2
ATAGCTAGTTGATAGGTGTTATGG	1
ATAGCTATCTATATCCGCTGCCTA	1
ATAGCTATTACAGGTTGTCGTAAG	1
ATAGCTATTTCTAGCACAGTGTCT	2
ATAGCTATTTGGTGGATGTGGATG	1
ATAGCTCAAAACCCTAGCGCCATC	2
ATAGCTCAAGGGGATACCACATG	2
ATAGCTCAGGAGAGATCGATCGAT	1
ATAGCTCCAAGTCGGACTATGGTCCTA	1
ATAGCTCTAAGCTTAATCTGTGCA	1
ATAGCTGCTGTTCGGTGGTGGATA	1
ATAGCTGGTGAAAAATAAATGGAA	2
ATAGCTTCAAGAAATAGAGTG	1
ATAGCTTGAGTATGATGGTTGGAA	1
ATAGCTTTGCCATATCACTTCAAG	1
ATAGGAAAGTAACGCGGTGCCAAA	1
ATAGGAAAGTTTCGATGTGATGG	1
ATAGGAACGTTACAAGATGAGACC	1
ATAGGAATCAGAAGTCTGGAAGC	1
ATAGGAATGACCGTTTGATTGAGC	1
ATAGGAATGACCGTTTGATTGGAC	6
ATAGGACAAATGGTCAAACAGTGC	1
ATAGGACAAGCGATAGTGCCCCCA	1
ATAGGACAGAGTGAGTATGTTAGA	1
ATAGGACATAGTATGTGGTGGGTC	1
ATAGGACATGGTATGTGGTGGGTC	1
ATAGGACCTACCTGTTAGGGATAT	2
ATAGGACGCCCAGATAGGACTCCA	1
ATAGGACGCGAGTATACATATTGG	1
ATAGGACGTTGAGTGCACGGTTTG	1
ATAGGACTAAATGATAAGGTGGA	2
ATAGGACTAAATGATAAGGTGGAG	4
ATAGGACTCCTACTAGGAAACTAA	1
ATAGGAGACATAGTAGGCCTATGC	1
ATAGGAGATTTGAACTCAGGACCT	1
ATAGGAGCACTACAATTTATTGGG	1
ATAGGAGCATGTGGTCTATCTGTC	1
ATAGGAGCCAATGCAATTTCATAT	1
ATAGGAGCGAAATTCAGAGTGGAT	1
ATAGGAGCGAATTTCAGATTGGAT	2
ATAGGAGCGAATTTCAGATTGGGT	2
ATAGGAGGGTGCGATATGGATGAT	2
ATAGGAGGTACACTTGATAGTGCA	1
ATAGGAGGTCTACCAGCATTGGA	2
ATAGGAGTACAATGACAGAGCTGC	1
ATAGGAGTACATACGGGATAGAGA	1
ATAGGAGTACTGTAGAAGCAA	1
ATAGGAGTAGGGTATTGCCTCTCA	1
ATAGGAGTCCTTTGATAGTGCTATA	2
ATAGGAGTGTTTGTAGGGTGCTAC	1
ATAGGAGTTGCTAGAGGATTGTTC	1
ATAGGATATATTGCCCTGATGGAC	1
ATAGGATATGTTGCCCATATGGAC	1
ATAGGATCCTAGAGGGGATGTGTC	1
ATAGGATCCTGAAGGGGATATGGT	1
ATAGGATGTGGGGACTGAAGGTTC	1
ATAGGATTCAGGGCTGTCACCAAC	1
ATAGGATTCTGACAGGAATGAAGG	2
ATAGGATTGCTTATGTAAGATGTA	1
ATAGGATTGGCGAAGGATTTTCA	1
ATAGGATTGTTGATGCTAGTTGCG	2
ATAGGCAAAATGAGTGGGGAACCT	1
ATAGGCAAAGCCAAATTTATAGCA	1
ATAGGCAGCCACATGGTACTGTCT	1
ATAGGCGAACCGCTTAAGTGGTAG	1
ATAGGCGACCAAGCGAGAAGGTAC	1
ATAGGCGATCAGGAACCGTGGATG	1
ATAGGCGGTCAAGGGTGCAAGGAC	1
ATAGGCGTCACCATGTAGGAGCCA	2
ATAGGCGTGCTAATGATGATAT	1
ATAGGCGTGCTAATGATGATATT	1
ATAGGCTAACAAGCAAGTGTGCCA	12
ATAGGCTAACCGGACAGCGATGGT	1
ATAGGCTAGATAATGAAGAAA	1
ATAGGCTCATAGGGTAAGGTGTAC	1
ATAGGCTCTCGGGCCTACTGGGAC	1
ATAGGCTGGCTACCAACCAGCTGC	1
ATAGGCTGTCAGCGATAACCACGT	1
ATAGGCTTACATACGGTTTTCCCT	1
ATAGGGAATATTCCCTCAATATGC	1
ATAGGGAATTGGGCGACGATATAC	2
ATAGGGACCTTAAATATATGAA	1
ATAGGGAGTATGACCTCAGATGGT	2
ATAGGGATACCTTTGTTGGATGA	1
ATAGGGATCTTTAGTCCCGGGCCT	1
ATAGGGCATGCCCAACAACTCAGG	1
ATAGGGCATGTTTGGGGGAGCTT	1
ATAGGGCCCGTGCTAAGGTCA	2
ATAGGGCCTTCCTCTAGCTTAGGG	1
ATAGGGCCTTTAACCGATAAGAGC	1
ATAGGGCTAAATGAGGTAGAGGAG	1
ATAGGGCTGACTGTAAGGTGGCCA	2
ATAGGGGCGCGTAGGTTTGATCTG	2
ATAGGGGGACTTGACATGTGGATC	2
ATAGGGGGTGTCCACATGTATTGT	1
ATAGGGGTGAGCCTATGTGCA	1
ATAGGGGTGGCAAATAGTTATTTG	2
ATAGGGGTGTCTTGGGATGTAGGA	1
ATAGGGGTTGGTCTTACTTCCTCA	1
ATAGGGTATGCCAGGGCCGAGTGC	1
ATAGGGTATTTCTATATGTGCT	1
ATAGGGTCCTAGATTGCACGGTAA	1
ATAGGGTGATGCTTTTCTTGAG	1
ATAGGGTGCCACTTGATGGTTTGG	1
ATAGGGTGCTACGTGACGATACGG	1
ATAGGGTGGCATGGTTCGAACAAA	2
ATAGGGTGGCTCATTAACGTATGA	1
ATAGGGTGGTTCAAACTTAATGTA	1
ATAGGGTGTAAACTATATATGCAG	3
ATAGGGTGTAAAGTTTTAGATTAG	1
ATAGGGTGTACTCACAAACTAGAG	1
ATAGGGTGTCGCATAGGGTGTTT	2
ATAGGGTGTGGAACAAAAAGATCTA	1
ATAGGGTGTGTTCGCCAGAAGCGG	1
ATAGGGTGTGTTTGTATGCATTTA	1
ATAGGGTGTTATACTATTTTAGA	1
ATAGGGTGTTTCCGTACTATGTG	1
ATAGGGTGTTTCCGTTATATCCGG	1
ATAGGGTGTTTGATGGTTGATTGC	1
ATAGGGTTGATTGTTGGGCCTGTC	1
ATAGGTAAATTTTCGATGTGATGG	3
ATAGGTAACCTTATGATGAGCTAC	1
ATAGGTAACTATATTACGAGACA	1
ATAGGTAACTATTGTATGGATTAG	1
ATAGGTAACTATTGTATGGATTGG	1
ATAGGTAACTATTGTATGGGTAAG	4
ATAGGTAACTGGAGAAGGGTACAC	1
ATAGGTACAGTTAATAGATTTCGA	1
ATAGGTACTCCCAACAGTTTTGTG	1
ATAGGTAGAAGTGAATAATGGA	2
ATAGGTAGATGGTGTCTCTTATAA	1
ATAGGTAGTAGAGTCTCGAGACCC	1
ATAGGTAGTCTATATGCATATGGA	2
ATAGGTATTCTATACAAGGGTGTA	1
ATAGGTATTGAACTAGCGCTATGC	1
ATAGGTCACTGACGTGTGGGTGGG	1
ATAGGTCCAAACGGGCTAACGGGC	1
ATAGGTCCATCTGTGTAGAAATA	1
ATAGGTCCCCGTCAAACCACGGT	1
ATAGGTCCCGCATCTGGCTTGCCT	1
ATAGGTCCCGCATCTGGCTTGCCTG	2
ATAGGTCCCGCCTAGCGTTCTCCA	3
ATAGGTCCTAAGTATCACAGGTAC	1
ATAGGTCGGTTAGGCGAAATCGT	1
ATAGGTCGTACTAGGTGATGTCCC	1
ATAGGTCGTTACTACACTTTTTGC	1
ATAGGTCTTACATAGTAGTTAGG	3
ATAGGTGAATTGGAGCTAATAATG	1
ATAGGTGACACTGTTAACTTCTGG	1
ATAGGTGACCCACAGTTGGTGGG	1
ATAGGTGACGTCGATGTGTGATG	1
ATAGGTGAGAAAAGTAAATGGTGG	1
ATAGGTGAGAACATAATAAAATGT	3
ATAGGTGATATCCGTCGGATATTA	1
ATAGGTGATGTGCTTATTTTGGGA	1
ATAGGTGCCAGTTTATAAAACCGG	1
ATAGGTGCCGATTGTGGGGTTTCA	1
ATAGGTGCCGGTTTTAGTTGTTCT	3
ATAGGTGCTCGCATTTACGGCTAA	1
ATAGGTGCTGGTTGTAGATCCGAC	2
ATAGGTGCTTAAGGGATTTTCCTG	3
ATAGGTGGACTATTGGTGATGCT	1
ATAGGTGGACTATTGGTGATGCTC	1
ATAGGTGGATCCATGAGTAGTGGG	1
ATAGGTGGATGGTACCTCTTATAG	3
ATAGGTGGATGGTTGGGCCTGTTG	1
ATAGGTGGCGGTTCTTCTATAGAACC	1
ATAGGTGGCGTTTTAGGCTATGGT	4
ATAGGTGGGACCACATATTACTAA	1
ATAGGTGGGACCATATACTAATAGT	1
ATAGGTGGGACCCACATAAGTGGT	1
ATAGGTGGGATTGCGATTTTCTAA	1
ATAGGTGGGCATACGAGCAGTGATA	1
ATAGGTGGGGGCTGACATCAGCGC	1
ATAGGTGGTACAAATGATATTGAA	1
ATAGGTGGTACGCAAACTTGTTAG	1
ATAGGTGGTATGCGACGTACTCAT	1
ATAGGTGGTCCCTTCTACGTAGGA	2
ATAGGTGGTCCGATACTGAAATAT	1
ATAGGTGGTGTCTGGATCCAGGGA	1
ATAGGTGGTGTTTGAATCTTCTGA	1
ATAGGTGGTTGGATTGAAATATGC	1
ATAGGTGTAACTCTTATGGATGG	10
ATAGGTGTAACTTTTATGGATG	3
ATAGGTGTAACTTTTGTGAATGGA	1
ATAGGTGTACTGATTAGTGTTCG	2
ATAGGTGTAGCCATGAGTTTCTGC	1
ATAGGTGTAGCTGAAATTGTTTGG	4
ATAGGTGTCAGTTTTCTAACCGAG	1
ATAGGTGTCATCCGTGATGGGCTT	1
ATAGGTGTCCAAAATTGAAAGATG	1
ATAGGTGTCCGAATATATGAGTCA	1
ATAGGTGTCCTCTTGTCCAAGTA	1
ATAGGTGTCGGTCACAAAGGTGCT	1
ATAGGTGTCGGTTCTTGGTATAGA	1
ATAGGTGTCGGTTGATTAAAAACC	2
ATAGGTGTCGGTTTGGTTTTATAC	1
ATAGGTGTCTGTTTTAGCGTAAAA	1
ATAGGTGTGACTATATACTAATAG	1
ATAGGTGTGTTCCTTCTGAGATGT	1
ATAGGTGTTAGGGGGTGGAGTTA	1
ATAGGTGTTCATTAGGTCAACAGG	2
ATAGGTGTTGGTTTCTAGAAAAGC	1
ATAGGTGTTTGAGATAGGGTGTGT	1
ATAGGTGTTTGGTTGTAGCCACAA	1
ATAGGTTATTCTACAAAAGTGTGA	1
ATAGGTTCTCTATACAGGGTGTGA	1
ATAGGTTGATGTGATGGAAAAGT	1
ATAGGTTGCTAAGTGGTAGTCCAT	1
ATAGGTTGCTATATTGTGGGACAG	1
ATAGGTTGTTGAAGTGAAATATGC	1
ATAGGTTGTTGGATTGAAATATGC	2
ATAGTAAATTTGTTTGGTGCTCCA	1
ATAGTAACGTCACGATGAATGGTA	1
ATAGTAATAATGGCGTAGATGGAT	1
ATAGTAATATATCAAGTAGAGGTC	2
ATAGTAATATGTGGAGTGCAG	1
ATAGTACAACGAATATGGACACAG	1
ATAGTACTGAGATGTGTCACTTCC	1
ATAGTAGAGATGCTCGTGCGTTGC	1
ATAGTAGGGAGTAATTGAAGTAGA	2
ATAGTAGTCATGGGCGTAGGCA	4
ATAGTATAGCCAACTACTAGCTCC	1
ATAGTATAGGTGCCGGTTTTTATA	1
ATAGTATATATTATACTCGGGCTA	2
ATAGTATATTTAAGGGTGTGTGTA	4
ATAGTATGCTACTGGTTATGTTAA	1
ATAGTATGTTTAGTGCCCCCACCC	1
ATAGTATTAAATAGGTTGCCAC	1
ATAGTCAACGCGCTTGCCATCCAC	1
ATAGTCATGTGGCTTACAAATCAA	1
ATAGTCCAACTGGGTATGGGGTGT	1
ATAGTCCAGCCATGGCCGGTGCT	3
ATAGTCCATCCGATGGGAGCCCAC	1
ATAGTCGGCGAGGTGGCACCAGC	2
ATAGTCTACGTTTAATATTTATTA	1
ATAGTCTATAGAGAAAAACGAGG	1
ATAGTCTATGAGCTAATGGAAACC	1
ATAGTCTGACGAACGATGTGATGG	1
ATAGTGAAAATAGGTGATATATAG	1
ATAGTGAAACATTGTGAGTACACTA	1
ATAGTGAACTAAAATAATGAAGG	3
ATAGTGAAGATATTTTGCTGGCGC	3
ATAGTGAAGGTGGTCCAAGATGCA	3
ATAGTGAATACCATGGTGTTTGG	1
ATAGTGACAAAACTATCAGTTTGC	1
ATAGTGAGCCTATCGATTTATTA	1
ATAGTGAGCTATAAACCTACTATA	1
ATAGTGATATGGACGAATCTTGGA	2
ATAGTGCAATGACAAAGGGTGTGT	2
ATAGTGCAGTGACAAGAGGTGTGT	1
ATAGTGCAGTGGTAAGAGGTGTGT	2
ATAGTGCAGTGGTAAGGGGTGTGT	1
ATAGTGCCACGTAAACTAAAAGTC	1
ATAGTGCCACGTAAGCTAAAAGTC	1
ATAGTGCCATGTCAATAAGACATC	1
ATAGTGCCCATATCAAAATTATGA	1
ATAGTGCGTCATACTGAGAAGTGG	1
ATAGTGCGTTTTGATATTTAGTA	1
ATAGTGCTATTCGGATATCCGCAG	2
ATAGTGCTCATAAGCAGTGTCTAT	2
ATAGTGCTGCTGCTACAGTAGTTC	1
ATAGTGCTGGATGGCTTCATGGTC	1
ATAGTGCTTTTTAAGTCTGATGGT	1
ATAGTGGCTCGCGCAGATTGCGCA	1
ATAGTGGCTTTGGGTGCTGAA	2
ATAGTGGTCTATATTTTGTTAGA	2
ATAGTGGTGTTTGCATTGAAAGAG	1
ATAGTGGTGTTTGCATTGGAAGA	1
ATAGTGGTGTTTGCATTGGAAGAG	1
ATAGTGTATATCTAGAAGTGGAGT	1
ATAGTGTGCAGATAAATGTGTATA	1
ATAGTGTGCCAGACTGTGAAGCGG	1
ATAGTGTGTCTAGATTCATTAACAT	1
ATAGTGTGTGTATATAAGTGTTA	1
ATAGTGTGTGTCTAGATTTATTAA	1
ATAGTGTTGGCCAGATTAAGATA	1
ATAGTGTTTACAAATTGCACCAAC	1
ATAGTGTTTAGTGTCTATTTAGTT	2
ATAGTTAAGGGACCTGCATATCTG	1
ATAGTTAATAAAATATGAGGTGCT	1
ATAGTTAATAGCAAGGGTGAGTAC	1
ATAGTTATTTGCCAAATCTAAAAG	3
ATAGTTCACATGACATGAGCACC	1
ATAGTTGAGGCCCAATTGAGATG	1
ATAGTTGAGGGACCAGTTGTATC	1
ATAGTTGAGGGTGAAGAATGTCTG	1
ATAGTTGAGGGTGAGGAATGTCCT	1
ATAGTTGCCACGGTAATTAGGTGT	1
ATAGTTGCCGTAAAATTCACC	1
ATAGTTGGGGTGAAGAATGTCTG	1
ATAGTTGGGGTGTAGAATGTC	1
ATAGTTGGTACAATAATGGGGACA	1
ATAGTTGTCCCTGGACATGGTGGA	1
ATAGTTGTGTGTACACTGGGTGAA	1
ATAGTTTAGGCCCGATTGAGATAG	1
ATAGTTTTAAATGGTTAGGTGCAA	2
ATAGTTTTAGGATAAGTCTAATCC	2
ATAGTTTTCAACTTGCGGTGATGG	1
ATATAAAAGGAGGACCTTGCCCAC	1
ATATAAAATAATTAGAATGGGTGA	1
ATATAAAATCGGTGTACTAAATAC	1
ATATAAAGAGGGGTGGAGGACGGG	1
ATATAAATACATGATGGCCTAGGC	1
ATATAAATGCGGCGAATAAATGAG	1
ATATAAATGTAGGCCAAAGGGTAG	1
ATATAACCAATGAGAAAACATCCC	2
ATATAACCATTGTGGATGCCCTT	1
ATATAACGTGTGTCGTCGGTGTCT	3
ATATAAGACGGACAGCTAAAGTTG	1
ATATAAGAGAAAATATAATGATGC	1
ATATAAGATTATTGGTTTTGATAT	1
ATATAAGGGATCGGGCCAATTTTT	1
ATATAAGTGTAAAACAGATGATTG	2
ATATAATAAGTGAGGTGCGTTA	1
ATATAATACTAAATGGTGTCCTG	1
ATATAATCAGACGTGTAAATGATG	1
ATATAATCGGGACCACAAATTTT	1
ATATACACACATATATAGGGCCTG	1
ATATACACGGTGCGTCTTGGAGTC	1
ATATACAGTATAAGGGCCACCG	1
ATATACATCACAGTCTACGTAGGG	3
ATATACCAGCGATTCGATGGAGAC	1
ATATACCAGCGGTTCGATGGAGAC	1
ATATACCATTTCTACCTACCCTT	4
ATATACCCTGGTACCGACGATCTC	2
ATATACCTGGTGCGGTAGAGGTGG	1
ATATACCTGGTGGAACATCGTGCA	1
ATATACGGTTGAGGTGGTGCACCC	2
ATATACTACTATTTCTGGGCCGAA	1
ATATACTAGAAAAAATACCTGTGC	1
ATATACTAGAACAAATGCCCGTGC	1
ATATACTGTGGGCCTAAAATTCGG	1
ATATAGATATAATGTTGCAGTGAA	1
ATATAGATGTCTATATGTATGTGG	1
ATATAGATGTGTCTAGATTCATA	1
ATATAGCAACCTAGGACCGGATG	1
ATATAGCCAATCTAGTAGCCAATT	1
ATATAGCCTAGTGGTTATAGTGAC	1
ATATAGCGGTCTCCTAGATGTGCA	2
ATATAGGACACTCATATGGGGCAC	1
ATATAGGGTTTCTATAATATGTGG	1
ATATAGGTGGACTGCTGATGGGTC	1
ATATAGGTGTTGTTTTATTTAAAA	1
ATATAGTAATGACCGTTTGATTGG	1
ATATAGTACATATTCATAGGTAAC	3
ATATAGTAGGACTCTTAAGGGTGT	1
ATATAGTGATCTATAGACAGTAAC	1
ATATAGTGCAATCTAATATATGGA	1
ATATAGTGTGCACAGGAAACTTGT	1
ATATAGTGTGTACCACAAACGATA	1
ATATATAAGTAGGCTATAAGGTAC	2
ATATATAATGAATGATAGGTGTGT	1
ATATATAATTTTATATGGGTGCTA	2
ATATATACTATGGTACCAAGTCTG	1
ATATATACTGCTAAGGGACCTCCG	1
ATATATAGCTCAACCGATACA	1
ATATATAGGGGTGGGACTTTAGTC	5
ATATATAGTAGTAGTGCCCTTGAG	1
ATATATAGTGAACACCGATAT	1
ATATATATAAATGTGGGCAATAC	1
ATATATATATTGACGGAGCGTG	1
ATATATATTGTTGGGGAGGTTGCA	1
ATATATCCGGTTGGATGTAGATGC	1
ATATATCGGTGCTTGCCCTGTAGG	1
ATATATGAATGTGGATAATGGTAG	1
ATATATGAATGTGGGCAATGCTAG	1
ATATATGACAGGTGGAACCATATA	1
ATATATGATTTTATCTGGGTGCTA	1
ATATATGATTTTGTTTGGGTGCTA	1
ATATATGCAGGTGGAATTTCAGGA	1
ATATATGGGCCCATTGAGTAGAGG	1
ATATATGGGCCTGTATTTTTCGTC	1
ATATATGGGTCCAGCGATTATCGG	1
ATATATGGGTGGTTTCGCTAACG	1
ATATATGGTATCGTATGGGTGTT	1
ATATATGGTGAAACGGCGTCCTA	1
ATATATGTATTCTCGGTGACTTAA	1
ATATATGTGTGTCTAGATTCATTA	1
ATATATGTTTGATGGCTGTT	1
ATATATTAATAGAGGTGAGTGTGC	1
ATATATTATGGACCGATTCTACGT	1
ATATATTATGGGCCCAAAATTCGG	1
ATATATTGGTGGTACGGTATGGAC	1
ATATATTGTGGGCCCAAAATTCGG	1
ATATATTGTTTGGTAGAGGTGATG	1
ATATATTTACTATTTGATGTGCGC	1
ATATATTTAGATGCGGCAAATTAG	2
ATATATTTATAGAGGTGAGTGTAC	1
ATATATTTTAGAGGTCCAGTGCGG	1
ATATATTTTGAGATGGAGGTGTA	2
ATATATTTTGAGTGTATTGAAGGC	1
ATATATTTTTTGAGTGTCCTGTAG	1
ATATCAAAGAAATAGAAAGGGTGA	1
ATATCAAATAATTAGAATGGGTGA	1
ATATCAACCGATACGGTGCTGCGG	1
ATATCAATGGTGATCTAGTGGAAT	1
ATATCACATAGGACTAAATGATAA	1
ATATCAGATTTGGGTTAATGGGCC	1
ATATCAGCCCGCGGTGATGTGCCA	1
ATATCAGCTGGTATACGTGGGTC	1
ATATCAGGATGAGTTTACAATGCG	4
ATATCAGGCTTGACTGATTGAGGG	1
ATATCATCAGTCACTCAGATGGT	1
ATATCATGACGGTAAAAGGTGTGC	1
ATATCATGAGATTGATGAAGTCAC	2
ATATCCAACATTTGAGAGTGTCTA	1
ATATCCAACCAGAATATATGCAGC	1
ATATCCAACCGGATATATGTGACC	1
ATATCCAATGTGACAACCAAACCC	1
ATATCCAGATTCGTTGTGCCATGA	1
ATATCCAGTGGGTACCCTATGGAT	1
ATATCCAGTTGGATATAGAGGCCG	1
ATATCCATGGGTCTTGTGGGTGTA	4
ATATCCATTAGGTGTTGTATCGAT	1
ATATCCATTCGGGAAATGTGGTC	1
ATATCCCAACCTAGGATGAGATGG	1
ATATCCCACTATGAATCTGGTACTA	1
ATATCCCTAACAGGTAGGTCCTA	1
ATATCCCTAGATGGGAGATGGCGA	1
ATATCCCTGGTTGGTTTTGGAAGC	3
ATATCCGATGTGACAACCAAACCC	6
ATATCCGATGTGACAACCGAACCC	1
ATATCCGATGTGACACGCTAAAAC	1
ATATCCGATTATCCGGTGTGC	4
ATATCCGATTGGATGTAAAGGCTA	1
ATATCCGCTGCTCTTTTCTCTCTT	2
ATATCCGGTCATATTCTATTATAT	2
ATATCCGGTTGGATGTAGATGCCA	1
ATATCCGTGCATTACAACCTACTC	1
ATATCCGTGTCTAATGTTTAACC	3
ATATCCTAATACTACGAATCTGAA	1
ATATCCTACCACTGGTGGAGAA	1
ATATCCTAGTACTACAAATCTGGA	3
ATATCCTAGTACTATGAATCTGGA	2
ATATCCTATGACAGTATGGGTGGC	1
ATATCCTCTGGGTATTAGCCTGCA	1
ATATCGACCGAGATATTGACTTGC	2
ATATCGAGGTGAGGTTATAACGCC	1
ATATCGATATAGAACTGACGGTGG	1
ATATCGATATCCGGTGGCTTGCCT	1
ATATCGATGTATTCCTGGAGCCTG	1
ATATCGCCAGATATGACGGGTAGA	1
ATATCGGACCTCTCACGATATGGT	1
ATATCGGGCCTCTACATCTAAGCT	1
ATATCGGGTGTTATATAGGGTGTC	1
ATATCGGGTTGGATTGAGGTGCTT	1
ATATCGGTCCTATATAAATATTCT	1
ATATCGGTGTACTCGGTATGTTGA	1
ATATCGGTTGGGTGTCACTATAAT	6
ATATCGGTTTATCAAGCCTATAAA	1
ATATCGTAAAAAGTGTCACGGTTG	2
ATATCGTAAACTTGAGTCGACGAT	1
ATATCGTGCATGCGTCTTGATCAC	1
ATATCGTGCTATCGATGGAGTTGG	1
ATATCGTGTTGTGCGCTAGGTTGT	1
ATATCTAACTAGTGTTGTCCA	1
ATATCTACTACCTATGCCCCATAA	1
ATATCTAGTGAAGGGTAGATGCTA	1
ATATCTGAGGTGAGGTTACAACGC	1
ATATCTGATACGGGACTATTAGGG	1
ATATCTGATATGTGGGCCATGTGC	1
ATATCTGTACGATGCCAAAACCGA	1
ATATCTGTCTACGAAAATATATTT	1
ATATCTGTGGTGCAAATTGTAAGG	1
ATATCTGTGTGCCCGCGCGTCTTT	1
ATATCTGTTGAAGAAAGAGGTGTA	1
ATATCTTAAGGGGTTACCACATGG	1
ATATCTTAATTGCCTTTTGTTGAA	1
ATATCTTCGCTAGCGGCCGGTATA	1
ATATCTTGCATGAGACATGGGTTC	1
ATATCTTGTAGAGAGCCTATAGAT	1
ATATCTTTATTCAGATTTGTGTTC	1
ATATGAAAATTCTGAAGTGTC	1
ATATGAAAATTTCTAGGTGCTGAG	1
ATATGAAACAAGAACGAAGGTGTA	1
ATATGAACGTGGGCAATGCTAGAA	1
ATATGAAGAGGTGTTTCAACAGGA	1
ATATGAATAATGTAATATGGATGA	1
ATATGAATAATTGAGGGTATAAAA	1
ATATGAATATGGACAGTGCTAGAA	1
ATATGAATATGGGCAATGCTAG	1
ATATGAATATGGGTAATGCTAAAA	1
ATATGAATGCGGGCAATGCTAGAA	1
ATATGAATGGGCTATTAGATTGGC	1
ATATGAATGTGGAAAATGCCAGAA	1
ATATGAATGTGGACAATGCTA	2
ATATGAATGTGGACAATGCTAG	1
ATATGAATGTGGGCAATGCTAGAA	2
ATATGACAGCTCTACTCTACACCT	1
ATATGACAGGTGGGACTATATATT	1
ATATGACAGGTTGATGTATTGGAA	1
ATATGACAGGTTGATGTGATGGAA	1
ATATGACGGGTGAGGATTGATCCT	1
ATATGACGGTCCGATCAAAACCTG	1
ATATGACGTACGTGATGGAGGTTC	1
ATATGAGAAGGTGGTCTAGTTTGT	2
ATATGAGAGAAAATATAATGATGC	1
ATATGAGAGATAGGGGTGAATTAG	1
ATATGAGAGCAAATATAATGATGC	1
ATATGAGAGCGGGCAAGCACTCGG	2
ATATGAGCGCCTTAGTTTGTA	3
ATATGAGGAAGAAGATGGCAATGA	1
ATATGAGGTTGGTGCTTATTTTGG	1
ATATGAGTGTCCTATATATATATA	2
ATATGATACGTAGGTGGTGTTTG	5
ATATGATATTGTGGTTTTTAACGG	1
ATATGATGATCAAAAATAGATGGA	3
ATATGATTTTGTTTGGGTGCTAGC	2
ATATGCAAGTGATGAAGTGAAGCC	1
ATATGCACGCCACGAGCCAAAGAA	1
ATATGCACGGGTATCAAGTATGGT	1
ATATGCATGAGATAGATGGAAGAG	2
ATATGCCACAGGTTAGTCTTACTA	1
ATATGCCACATTGGATTGAGTGAT	3
ATATGCCACGTAGACTAAAAACCA	1
ATATGCCATGAAGTTTCTAC	1
ATATGCCGATGACGTGCCGTG	1
ATATGCCTAGCTAATTGATGAGTA	1
ATATGCCTATCAAAAACAATTTT	1
ATATGCCTGTTTATATCGCGAAAA	1
ATATGCGAGATTGAGGTAAAACAG	1
ATATGCGCTAGCAGTCGAACTCAC	1
ATATGCGGGGTGGTGTGTGTAACCA	1
ATATGCGTGGGACCTGTTTGTCA	1
ATATGCGTGTCTATATTTATTAAC	1
ATATGCTAAAAAGTTAACGGTGTC	1
ATATGCTAAAGGGTAGATGCTGTC	1
ATATGCTACGTGGACAAGTGTGGG	1
ATATGCTCCATCACATATCGCCTA	1
ATATGCTGCGGGATAGTAGAGGTG	1
ATATGCTTGTAATGGATGGCCC	1
ATATGGAAGGTTTTGGTGTTGACC	1
ATATGGAATTAGGCCTCACTTATG	1
ATATGGAGGCTGCTGACTAGTGAC	2
ATATGGAGTGAAGTTGTGGAGCA	1
ATATGGATCACACTTTAGTATGGT	1
ATATGGATCTACGATTACCTGTAT	1
ATATGGATGCCGACAATCGTAGTG	2
ATATGGCAAAAGTGGTCTATATAG	1
ATATGGCATTGCCACATCAGCGCC	1
ATATGGCGCCATAAATATATCTAC	1
ATATGGCGCCATATTTCTAGCAAC	1
ATATGGGACACTACATAGTACTAA	1
ATATGGGAGCTTCGTTGTTTTGA	1
ATATGGGCCCGATGAATCATGGAT	1
ATATGGGCTGTACTTTGTAATACG	1
ATATGGGGTCTATAGAAAAGATGT	1
ATATGGGTAGACTATTATATAGG	1
ATATGGGTATGGGTATGATATGGC	1
ATATGGGTCCATAAATGATGAGTC	1
ATATGGGTCTCCATGTGTCTATAA	1
ATATGGGTCTCTTAAGTGGTCCAG	1
ATATGGGTGAACGTATTGAGAATG	1
ATATGGGTGGTTTCGCTAACATGG	1
ATATGGGTGGTTTCGCTGACGTGG	1
ATATGGGTGTAAAGTTTTAGC	1
ATATGGGTGTCTAGGTTTGAACC	1
ATATGGGTGTTTGCACTGTGGGGT	2
ATATGGTACTGAATATGACACATT	1
ATATGGTAGTCTGGATCACAGTAG	1
ATATGGTATGCCACGTGGACGAT	1
ATATGGTCACACCTGTCATACACA	1
ATATGGTCTAGATGTTATATCCAG	1
ATATGGTGCATTTGAATTAGGTAT	1
ATATGGTGGAACCCTAAAAGGGAT	1
ATATGGTGGAAGCTGTAACGAACA	1
ATATGGTGGAATCCTAAAAAGGAT	2
ATATGGTGGGAGATTATGTGTGG	1
ATATGGTGTAAATTGATGAACTAT	3
ATATGGTGTAGCGTTGTTCAGTGG	1
ATATGGTGTATTTGTGTTGAGCTA	1
ATATGGTGTCTCCTTTCAAAGCTG	1
ATATGGTGTCTCTCAGCAATGACC	1
ATATGGTGTCTCTTTTCAAAGCTG	1
ATATGGTGTCTTTGAAGACAGAGG	1
ATATGGTTCATATGTTTGCCGAA	1
ATATGTAACAAATGGTCACGATC	1
ATATGTAATAGATGGTGATTTGT	1
ATATGTAATATTAGGATGTGTCA	3
ATATGTAATGTAGGGACTTACAAT	1
ATATGTAGATGCCACATTGGATAG	1
ATATGTATACGATAGGTGGGAC	1
ATATGTATGTGTGCAATGCTAGA	1
ATATGTCAATTAAAAGGGTGGTCC	2
ATATGTCATATACACATGAGGGCC	1
ATATGTCCAAACATTCGATGTGAC	2
ATATGTCCGAATCCGAAAAATGAT	1
ATATGTCCGGTTGGATGTAGAGGC	1
ATATGTCGGTGATAAGTTAGAGGA	2
ATATGTCTATGACATGTGGGCCTA	1
ATATGTCTGTTGGTGGTAGATTGG	1
ATATGTGACTTCGGGATGGCAACC	1
ATATGTGATACATGATGGAATTA	1
ATATGTGCAACTTTTATGGATGGA	1
ATATGTGCACTAGTTTACAACAGA	1
ATATGTGCACTGCATGGGTGATGG	4
ATATGTGCTACCTAAATTATCTAT	4
ATATGTGCTAGATTCATTAACATC	1
ATATGTGCTTGCATAAAAGGGT	1
ATATGTGGGATCCACAAAGGTTGA	2
ATATGTGGGTCCTATTTATATGG	1
ATATGTGGGTCTGGGTGCTAATGA	2
ATATGTGGTATCTATGGTGATTAC	1
ATATGTGTAAACGGAGAACTGAAG	1
ATATGTGTAAACTTGAGGTGTATA	1
ATATGTGTAACATGAGGGAGGTAG	1
ATATGTGTATATATATGTGTCTA	1
ATATGTGTATGACAGGTTGATGTG	1
ATATGTGTCAAATAAGAACATGGG	1
ATATGTGTCGTTTTAAAAAACAAA	2
ATATGTGTCTAAACATTCAATCTG	1
ATATGTGTCTCGCACATTTGGCCA	1
ATATGTGTCTGTATATTTGATGTA	1
ATATGTGTGCCTAAATTCATTAACA	1
ATATGTGTGTGCTGTGATTTTTT	1
ATATGTGTTGCTAGTGATCTTAA	1
ATATGTGTTTGTTGGAGATGT	3
ATATGTTATGGTTACGGATAAGG	1
ATATGTTCAAAAGTCAACGGTGTC	2
ATATGTTCCAACTTATGATGGGT	1
ATATGTTGCTTGCCCTGATTCAAA	1
ATATGTTGGCTGCATACAATATA	1
ATATGTTGGCTTTAAGATGGGCT	2
ATATGTTGGGCTCTATGGTTGAGT	1
ATATGTTGTGTTGTCTTTTGGTAC	4
ATATTAAAATTATGGTGTTATAAT	1
ATATTAAGTGCTGCGAGAAAATTG	1
ATATTACGATGAGTATAATGGTGT	1
ATATTACGTGCGAAGAGATGGAGG	1
ATATTAGGTCCTTTCCTAACGTTC	1
ATATTAGGTGAAGTGTAATAACA	1
ATATTAGTGATGGCTATAGGTGAC	2
ATATTATAGGTACCGGTTATTAAC	1
ATATTATAGGTGCCGGTTAATTAA	1
ATATTATAGGTGTCGGTTGATTAA	1
ATATTATAGGTGTCGGTTTTTAA	1
ATATTATATAAGGTGTCGTATGGG	1
ATATTATGGAACGGCCTAAAGTTC	1
ATATTATGGATGCCTGGGAAC	3
ATATTATGGTACTACGAATATGTC	2
ATATTCAGAGAAGATTGGTGATAG	1
ATATTCAGGGCCGGCCTTAGGGCA	1
ATATTCATCCGGCCGCGCACTTCA	1
ATATTCCAGCTGGATATACGGTAC	4
ATATTCCATACGATCGACCTA	19
ATATTCCTACTATGTCAGATGAAA	1
ATATTCCTACTGGTAGCAACTAGC	1
ATATTCGATGCCTTAGGTCCTGCC	1
ATATTCGATGGTTTGCCACCCAGC	1
ATATTCGTAGTCTACATGTTGGGA	2
ATATTCTTGTGTGAGAATTGAGGT	1
ATATTGAAAGTTGAAGGTGAAC	2
ATATTGAACAATAATACGTAGTGC	1
ATATTGAACGTACGATTGGTAGGC	1
ATATTGAGAGGGTACATACATGAT	1
ATATTGATCACGGAAGCCAAACAC	1
ATATTGATCTGAGTAGCACCCTAA	1
ATATTGATGTACTCGGTATGTTGA	1
ATATTGCACTGGTGTGATTATGG	1
ATATTGCCTGCTATTTCTTGT	2
ATATTGCGCCTCGGGGGCCAGTAT	1
ATATTGCTATATTATGGGACGGAA	1
ATATTGCTTATGGACTACTTTTGG	1
ATATTGCTTGACAGATGTGTCCT	1
ATATTGGACACGAAAATTTAAGGT	2
ATATTGGAGAAATGATGAAATGA	1
ATATTGGGTCCCACGTGTCAATG	1
ATATTGGGTTCGTTGATAAACATA	2
ATATTGGTAACACGCTGATGG	2
ATATTGGTGTCTGTAACTACTTCC	1
ATATTGTAAGCCTAAAATTTAGAT	1
ATATTGTAAGGATGCCACTCGAAT	1
ATATTGTACATGATTGGGTTCCGC	1
ATATTGTACTGGTGTGATTATGG	1
ATATTGTATTATGGTGTTGTATGG	3
ATATTGTCCTATATAGACGGTGCT	1
ATATTGTCGGGGTCACATGGGTT	4
ATATTGTGACGATGATTATGACAG	1
ATATTGTGCAAATGATATGGTTGA	2
ATATTGTGCTAGAACCGGATGGGA	1
ATATTGTGCTTCCATAACTAAATA	1
ATATTGTGGGTGTCCTAATTATAT	1
ATATTGTGTCTAAGTATCGTCATG	1
ATATTGTGTGATAATGGCAGTAAA	1
ATATTGTTGAAGTGTGTCGAACTC	1
ATATTGTTGGTCGCCCGAAAGTCG	1
ATATTTAAATCTGTGGTGTTGTGT	1
ATATTTAGAAAAATTAACGGTGTC	1
ATATTTAGAATATGGGTGGTCTGA	4
ATATTTAGATGCGGCAAGCCAGAC	1
ATATTTAGATTCATTGTACTAAGA	1
ATATTTAGGGTCTAGAACATTGAG	1
ATATTTCAAATGTGTGTCCATATA	1
ATATTTCATAGATACAGATGGGTC	2
ATATTTGAACTTTTATTTTGGTA	1
ATATTTGATGCCGTTAACTTTTTT	1
ATATTTGGAAGCTGATGGGACA	1
ATATTTGGGCAATTCCTCCGCTAA	1
ATATTTGGGCTGAATATAGGATAC	1
ATATTTGGGGTAGCCTATCCAACT	1
ATATTTGGTGCCCATGATTGGTGT	1
ATATTTGTAGCTAGCCACAACACA	1
ATATTTTAGGACGGAGGTAGTAAC	1
ATATTTTCGGGTGTGGTGAAACCA	1
ATATTTTGAGATTTTGGGGACCTA	1
ATATTTTGGACCTACAACATCAT	2
ATATTTTGGATGAAAAGAGTGCAT	1
ATATTTTGGGTAGCCGTGCAATG	2
ATATTTTGGTAGTGTAGTTTTACA	1
ATATTTTGGTGAAAAATATGGCGC	3
ATCAAAAATTTAGGACCTGCACTG	1
ATCAAAACCATTCGCTTTAGGTCC	1
ATCAAAACCGGTGCAAACAATGTC	1
ATCAAAACCGGTGCAAAGCAGATC	1
ATCAAAACCTCAAAGGTGAAATGA	3
ATCAAAACTAGTGCAGATGAGGTC	1
ATCAAAAGGCGTAATTTAATATTA	1
ATCAAAAGTTTACGGTGCACTTTAA	2
ATCAAAAGTTTAGGGAAGAAGGGA	1
ATCAAAATCCTACGTTTTTTCTA	1
ATCAAACCTTATAGATTGAACCAC	1
ATCAAAGATGGCCTGACCTATGAC	1
ATCAAAGCCTTGGTGGGAGATAGA	1
ATCAAAGCTTGTATTGTTGGA	2
ATCAAAGGTTGCTATGTGGTTGG	1
ATCAAAGTGCAGAGTTTGTAAGTG	1
ATCAAAGTGGCCTATATATAGTGT	1
ATCAAAGTTAGGTGCGGAAACATA	1
ATCAAATAATTAGAAGAGGTGAAGC	1
ATCAAATAATTAGAAGAGGTGAGG	2
ATCAAATAATTAGAAGGGGTGAAG	1
ATCAAATAATTAGAATGGGTGA	1
ATCAAATAATTGATAGCACCAAAA	1
ATCAAATATATGACGAGGTTGCCT	1
ATCAAATCATGGTGTAATTAGGCT	1
ATCAAATGTAATTACAGGTGGCGGT	1
ATCAAATTATGGTGCAATTAGCGA	1
ATCAACAATTATAGGGGCCAGTTC	1
ATCAACAATTCGGTAGACAGGGCA	1
ATCAACAGATGGCTGGTGGTGGTA	1
ATCAACAGCACTAAGTGAGGGTAC	2
ATCAACAGGAACTTACCTCAGGTC	1
ATCAACATTTTTATGTGCGGGTGG	1
ATCAACCGAGCTGGCGCCACTGC	1
ATCAACCGGGACTACAAATAGATC	1
ATCAACCTAGTACGGGATGTGACA	1
ATCAACCTGGGTGGTGGAGATAGG	2
ATCAACGCAGTGGTTGCTAAGGAC	1
ATCAACGCCGATGACATGCGATGG	1
ATCAACGGTGTCAAACATTTTGAA	5
ATCAACGGTGTCAAATATTTTGAA	1
ATCAACGGTGTTAAATATTTAGGA	2
ATCAACGTGGGTGCAGAGGGGCTC	1
ATCAACTAAAGGTGCATATGTTCT	1
ATCAACTGGCGCTGAATGTCGTGC	1
ATCAACTGTGTCGAAACCTGGCTG	1
ATCAAGAAGTGCGATGGAATCAAC	1
ATCAAGATTCGGATAGAGATGAGC	1
ATCAAGATTCTAGAGAAGAGGGAG	1
ATCAAGCTATTCGCAAGGGCCA	1
ATCAAGGAGGAACTCGGAGAGTGC	1
ATCAAGGCAGCTTTGGTGGTGGACT	1
ATCAAGGCATAAAACATTGATGAA	1
ATCAAGGGGCAGATCCTGTGTGGA	1
ATCAAGGGTAACTACATTAGTGCA	6
ATCAAGGGTTGTCACCACCTCTAC	1
ATCAAGGTGATACAATTATTCGAA	1
ATCAAGGTGATACAGAATGCTAGC	3
ATCAAGTAGTCTGGTACACACGAG	1
ATCAAGTGATTGGGATAGATCGGT	2
ATCAAGTGTGACGGAGGGGGCCAA	2
ATCAAGTTGCTAGTTGATGGACA	1
ATCAATAGATTGACGAACTTGCTA	1
ATCAATAGTTTGAGGTGTAATATG	1
ATCAATATATTAGATGCCTAGCT	2
ATCAATATTTTTGTGTGCGGGTAG	1
ATCAATCAAGTTGGTGGAAGTGGA	1
ATCAATCTAGCTGGAAACAAGTGA	1
ATCAATCTGGTTGAGTCAGCGTGA	1
ATCAATGATAAAGGTACGGTGCAG	1
ATCAATGGTCCAGATCTAAAGCTA	1
ATCAATGGTGATCTAGAAGGATAA	1
ATCAATGGTGTCAAACATTTTGAA	1
ATCAATTAAAAAACAGAGGTGCTA	1
ATCAATTGAGCTGCCTATATGAGG	7
ATCAATTTTCACTGGTGGTCACTTA	1
ATCAATTTTGGGTAACAATCTGAT	2
ATCAATTTTGTGCAGCATTTATAC	1
ATCACAAAACTACATATTTAGCAC	1
ATCACAACCCCCCGATGCAAACCA	1
ATCACAGAGGAGCCGACCGATGAG	1
ATCACAGCTGGTGATGTTTGAATC	1
ATCACAGGAAATTGATTGCTTAGGA	1
ATCACAGGAGTCTATGTAACATT	2
ATCACAGGTATCGGGTACCATGCA	1
ATCACAGGTGTGGGATAGTGATAC	2
ATCACATCCATTAGATCGATTCCT	1
ATCACATGGGCTTGCAGATTGGGC	1
ATCACATTCGGGATGGCGCATGTT	1
ATCACATTGTCAAATCATGGTGTA	1
ATCACATTGTGGATGCTCTTATAC	1
ATCACATTGTGGATGTCCTTAGAG	1
ATCACCAATTAGTGAAGAGTGACT	1
ATCACCACGAGCCACTGATGAGTC	1
ATCACCACGATCTGACAAGTGTGA	1
ATCACCAGCACCCTACGACCGCAAC	1
ATCACCATAACTGTGAGGGTGTAG	3
ATCACCGCAAGGCGTTTAGGTATC	3
ATCACCGGGTGTAATAATCAA	3
ATCACCTACCGAACTATTAAGCCA	1
ATCACCTCCAGAGTGCCCCCA	1
ATCACCTGTCCAGGAACGAATGG	1
ATCACGACAGTCATGGTGTGTGGT	1
ATCACGAGAGTGGGAGGATTGCCA	1
ATCACGGACGCGCGCGACGGATGC	1
ATCACGGGACTACGTAACATGTT	1
ATCACGGTCCAAAATCTTATTTGA	1
ATCACGTGAATACGGATGAATGGT	2
ATCACGTGAGGCTTCGATGGGAAG	1
ATCACGTGATTAGGTGGTGTTAGG	3
ATCACGTGTGTCAACGGGTGGTAC	1
ATCACTATCTTTAGTTCCGGGTGA	1
ATCACTCGCTGGATGTCTCCT	1
ATCACTCTTTTATGATGCCTTCCA	3
ATCACTGACATGTGGGCCCGACGA	1
ATCACTGAGAACGCCTGACGAGCG	1
ATCACTGTTGCGTCAGGTGGTGTC	1
ATCAGAAACAAAAAGTTGGGGGA	1
ATCAGAAATGATTGGGTGTTC	1
ATCAGAAATGATTTGGTACCGTGA	1
ATCAGAAATGCAATCGATGATGGT	1
ATCAGAACGTGGATTGAAGTG	2
ATCAGAACTGATACTCATAGGTAT	1
ATCAGACGCAGATGCGTGGTGTGG	1
ATCAGAGATGCAATCGATGATGGT	2
ATCAGAGATGGTGCTAGATCTCTC	1
ATCAGAGGTGCTGGTTGTGGAACC	1
ATCAGAGGTTGGTTGGACGTTTGA	1
ATCAGAGTGCACATTTAATTTGAC	1
ATCAGAGTGGCGCAGCGGAAGCGTGGTGG	1
ATCAGAGTTCTGGCTGAGGT	1
ATCAGATATTATACAAGGTGTCGTA	1
ATCAGATGATCTGACTTAGTTTGC	1
ATCAGATGTCTACAGCTTTGGTGT	1
ATCAGATGTGGCTGTGATTGGTCC	2
ATCAGATTGAGAGTTGGCTATAGA	1
ATCAGATTGGAGGTGATCAAGAGA	1
ATCAGATTTGCTTGATATGGTACC	1
ATCAGCACACGAAGTGAGTTGGAG	2
ATCAGCATGACGATGGCGTGGTGG	1
ATCAGCATGAGACCCACGTGGCCC	1
ATCAGCCAGACTGGCTTATGCCTA	1
ATCAGCCGGTGCTGTTGCTGTAAG	1
ATCAGCCTAGTACTGGATGTGAT	1
ATCAGCCTATGTGGTAGATGGATG	1
ATCAGCCTGGTGCCAATGTCGATC	1
ATCAGCCTGGTTGTGTTGATATGC	1
ATCAGCGTAGCCTTACAGTACATG	1
ATCAGCTTAGGCTTTTAGGTGTAA	1
ATCAGCTTATGAATAGTGATGTAC	1
ATCAGGACGTGACAGTTGCATTGC	1
ATCAGGCCAAACTGCTCGCTCCGT	2
ATCAGGCGTCGGGCGCTTGCATGC	2
ATCAGGGGTGGTTTCTCGATATAC	1
ATCAGGGTGAGATTACAACGCTGA	2
ATCAGGTGATGGAGGTCGACGACG	1
ATCAGGTGGGTGCAATCTAGTGCA	1
ATCAGGTTTTACCGTTGGGGGATG	1
ATCAGTAGATGGTATACACATGGC	1
ATCAGTAGGACTGCCATGAGAGAA	1
ATCAGTATGTGTGGGATGCGCAAA	1
ATCAGTATGTGTGGGATGCGCAAAA	1
ATCAGTGACCATTTCGTTTGCCCG	1
ATCAGTGACGGGCCGTAGTTTAGG	1
ATCAGTGACTCAACTGCATGTGCA	1
ATCAGTGATAAAGATACGGTGCAA	1
ATCAGTGATGATACGTAGGTACTA	1
ATCAGTGATTCCAAACATGCGTGC	1
ATCAGTGCCGCATTCATTGTGCTG	2
ATCAGTGGGCAGCACTATATGTGC	2
ATCAGTTGCGAGATTTATTGGTCC	1
ATCAGTTTAGGCTTTTAGGTGTAA	3
ATCATACAATGAAGTACGGTGG	1
ATCATACGTGAGTAAAAAGATTGG	1
ATCATAGCATGGGTTCGGTGTAGG	1
ATCATAGGAATATGATAGGAATGC	3
ATCATAGGTGGGACCAGATATTAC	1
ATCATAGTACGATAAATAGGGTGT	1
ATCATATGGTGCATTTGAATTAGG	2
ATCATATGTAGATAGGAGGGGGAC	1
ATCATATTGCCATGGTCGCCC	1
ATCATCAAAGGTGATGTTTGGTTG	1
ATCATCAAGTACTAGACACTACTC	1
ATCATCCATCCATGATCCACGATCT	1
ATCATCGCTCCAGTCTACGTGGCC	1
ATCATCTACACTATTGACGCATCA	1
ATCATCTATATAAAACAGTGTAGC	1
ATCATCTGGTCTTCAATTTGGAGC	1
ATCATGACGGTAAAAGGTGTGCTA	3
ATCATGACTAAATTGGTTTCCGGC	1
ATCATGAGGTTGATACAAGACAAG	2
ATCATGATAGTGCACACAACCAAG	1
ATCATGATGCTAGCCTTTACC	1
ATCATGCACGAGCTGATGGACCAC	1
ATCATGCGCTAATAGACCGCTCC	1
ATCATGCGGGATACTTTTGCTAGA	1
ATCATGGAAGAACAAGATGAT	1
ATCATGGTGCTATAACATATGGAT	2
ATCATGGTGTCTCGTGCAGATAGC	2
ATCATGTACTAATAGCTCACCTCG	1
ATCATGTCGTGTACTCTACATCCC	3
ATCATGTGATTGGGTGGTGTTAGG	1
ATCATGTTGCATGTTGATGGATAA	2
ATCATGTTTCGACAGGTGGAAGAC	1
ATCATGTTTGGACAGATGCATGGG	1
ATCATGTTTTAACAATACGAATGC	2
ATCATGTTTTGGTGCTTTTTGA	1
ATCATTAACATGTTGGTAGCTG	1
ATCATTAGCAATGATATGCCAGAA	1
ATCATTCTAGGTGGAGGATTGGGA	1
ATCATTGAGATACCGATGGCATA	1
ATCATTTAGGTGGCATGCAATAAA	1
ATCATTTCATTTTCCGTGCCC	1
ATCATTTCTGTTCTGTGCCCAAA	1
ATCATTTTAAGTGTAACGATGGTA	2
ATCATTTTAATGGGTGCGATGTCC	1
ATCCAAAACGTGCAGAACTTTATC	3
ATCCAAAAGGGTGGGCTATTTGAG	1
ATCCAAAGATGTACACAAAGTGAG	1
ATCCAAATACAGGTGAAATGGGTC	1
ATCCAACATGCATGGCAAGGGCCT	3
ATCCAACCATGGAGCAACGATAAT	1
ATCCAACGGGTGCTGAATCTTAGC	1
ATCCAACGTGGGTGCAAGAAGTCC	1
ATCCAAGCTAGCAAGCGGCGCC	1
ATCCAAGCTTGACCGGGAACCAAA	1
ATCCAAGGAGGTGCTCAAGTCAGC	1
ATCCAAGGGGCATACAAATACACA	1
ATCCAAGGTGTTAAAATGGACTGT	2
ATCCAAGTCTAAGGGTTAGTTGG	1
ATCCAAGTGTAAAGTGTCTATCAC	1
ATCCAATTTTGCTAGCTAAGGTGT	1
ATCCACACGTACAGGAGTCGGATG	1
ATCCACACTGTCGGGGGCTATTGA	1
ATCCACATATAATGCTCCATGCATG	1
ATCCACATGGCGTGCCACGTAA	1
ATCCACCACGGAGTGCTGCCT	3
ATCCACCAGCGATGATGATGGGAG	1
ATCCACCCTGCCCTCCAACCAAAC	1
ATCCACCTACGAAAATAAATCTAT	1
ATCCACGAATGTGTCCCTAACTAT	1
ATCCACGAGGCGATCTGACGTGCA	2
ATCCACGGCTGTACTTGTTTTGAG	2
ATCCACGGTGACGATGATAATGAC	1
ATCCACGTATTGAAAGAGGTGTT	1
ATCCAGAACGATGTTGTTGGTACT	1
ATCCAGAAGGAGAAGACGTTTGG	1
ATCCAGACACAGGGATTCCTCGGT	2
ATCCAGATTACTGGTAGGGGCCAA	1
ATCCAGCAGGGATCCTATTAGAGC	2
ATCCAGCATGAGGGCGGCGGGGTC	1
ATCCAGCCAGCAGAGTAGAGGAAC	1
ATCCAGCCTCTACATCCAACTGGA	2
ATCCAGCGTGGGTGCTGGGGGGAC	1
ATCCAGGACTATTGTGGAATTC	1
ATCCAGTAGACTAGCAGGTATCCA	1
ATCCAGTGCCACGTTTACTTCTAG	1
ATCCAGTGGTCTAACTTTACATGT	1
ATCCAGTTTATAAGGAAAGCCGGA	1
ATCCATACAGATGCCTGATATCAC	1
ATCCATAGCTTCGTGTCCTTGGATG	1
ATCCATAGTTAGCTGTAACACGGA	1
ATCCATATGATGATTTTGGTGGAC	1
ATCCATCAAAGGTGATGACATGGG	1
ATCCATCATTTGAGAGGTGTTTCA	2
ATCCATGATGCCGGTTGCTATGCA	1
ATCCATGATGTGAGCAATGGTTGCA	1
ATCCATGGGCCTTGTGGGTGTA	1
ATCCATGTAGCCAATCTTACGTGA	1
ATCCATGTTTTACTGATGTGCTA	1
ATCCATTAATTAGAGTAAGGGGAA	1
ATCCATTATGGTGTAGGATATGGT	1
ATCCATTGGGTACCCGCCGGATA	1
ATCCATTGTGGATGTAGAGGCCGC	1
ATCCCAAAGGTGTAAATAGGGTTG	1
ATCCCAAATAGGATATGGACTAAC	2
ATCCCAACGATAATAAGGAGTGGA	1
ATCCCAACTTTAACCTAGTGCGGC	3
ATCCCACGTGTCATTAACATGTCG	1
ATCCCAGTACATATATTAAGAATAA	1
ATCCCATATCTACACGGCGATGAT	1
ATCCCATCCGGTGCCTGTCTAGAT	1
ATCCCGACGATATATGGCGTGGAG	1
ATCCCGATGGGTTCGGTGTGCATC	1
ATCCCGCATCAACGCGTGAGGTGT	2
ATCCCGGCCTAGGGCTTAATAGGA	2
ATCCCGTGAATTAGAACCTGGGAA	1
ATCCCTAATGTGTCACATTCAATA	1
ATCCCTCAACAGATGGCCGTGGTA	1
ATCCCTGATGGATGCCATGCGACA	1
ATCCCTTACATTTTGGGTCAGGGA	1
ATCCCTTATAATCCGGGTACCTGC	1
ATCCCTTATATTATGGGACAGAGG	1
ATCCCTTCTAGCCTCTCAACCAAA	1
ATCCCTTCTATTATGGGACAGAGG	1
ATCCGAACCGCTGCTTGCTACGAT	4
ATCCGAATATATTGTGGGCCTAAA	1
ATCCGAATGACCTTCTGATGGGAC	1
ATCCGACACCTACGAACCCTTGCA	1
ATCCGACGTGGATGAGGAGCTCGC	1
ATCCGACGTGGGCTGAAAGATTCC	2
ATCCGAGGTTGCAGCTGGATAGGC	1
ATCCGATAACCGTTAAACTGTGAG	1
ATCCGATATGTTCGCCGCACGCCT	1
ATCCGATCAAACATCCGATGTGAC	2
ATCCGATCAAACGTTCGATGTGAC	1
ATCCGATCAAACGTTTGATGTGA	2
ATCCGATCAAACGTTTGATGTGAC	1
ATCCGATCAAGCATTCGATGTGAC	1
ATCCGATGAAAATCCAACGGTCAG	1
ATCCGATGAAATGTCTGATGTGAC	2
ATCCGATGGCCCAAAATCTGTAAG	1
ATCCGATGGGAGCCTAAATATAAC	1
ATCCGATGTGACAACCAAACCCAA	1
ATCCGATGTGACAACGAAACTCTA	1
ATCCGATGTGATATAAAGGGGCA	1
ATCCGATTACAGATAGGTGGTGAG	1
ATCCGATTAGAGATAGGAGGTAGA	1
ATCCGATTGAGATGTGGCTTAC	1
ATCCGCACGAGCAGATGGATGGAT	1
ATCCGCCACAGGGTAAACCACTGG	1
ATCCGCCGAGTATAGTATAGATATG	1
ATCCGCGGAGGGGTGACAATACAA	1
ATCCGCGTTTCGGTACGGGTGATA	1
ATCCGCTAAAAGTAGCAGGTGGC	1
ATCCGCTCCGTTTTCATCCCTAGC	1
ATCCGCTGAGGACCTAGTTTACA	1
ATCCGGCAAATTCTGGCGGACGA	1
ATCCGGCACACGGTAGCTTCGCGC	2
ATCCGGCAGTATGCGGATAGTTGC	1
ATCCGGCCAAACGTTCGATGTGAC	2
ATCCGGGACTAAAGATGGCGGTCT	4
ATCCGGGACTACTGTGGAAATCGG	2
ATCCGGGACTATTGTGGAAATCGG	5
ATCCGGGACTCAAGATCGCTATCT	2
ATCCGGGCCAGTTCCTTGACGTGC	1
ATCCGGTATTACGGTTTAGGGTCA	1
ATCCGGTCAAACACCCGATGTGAC	1
ATCCGGTCAAACGGCCGATGTGAC	1
ATCCGGTCAAACGTATGATGTGAC	2
ATCCGGTCAAACGTCCGATGTGAC	11
ATCCGGTCAAACGTCCGATGTGCC	1
ATCCGGTCAAACGTCTGATGTGAC	9
ATCCGGTCAAACGTGCGATGTGAC	1
ATCCGGTCAAACGTTCGATGTGAC	1
ATCCGGTCAAATATCCGAGGTGAC	1
ATCCGGTGAATGAAACGAATCGGC	2
ATCCGGTGAGCTCATGACCGA	1
ATCCGGTGATCCGCTAATAGGCGC	1
ATCCGGTGTCCGATGGCCGGGG	1
ATCCGGTGTTGAAAGTTCAGGGTA	1
ATCCGGTTAAACGTCAGATGTGAC	1
ATCCGGTTGAACGTTCGATGTGAC	1
ATCCGGTTGGCTAGTTTGTTGAAG	1
ATCCGGTTTTACGGTTGGAGGAC	1
ATCCGGTTTTGCCTGATAGATGGA	1
ATCCGGTTTTGCGGTTGGGGGAAC	1
ATCCGGTTTTGTCCGACGTGACGG	1
ATCCGTAATGATACGGTTAGGCAC	1
ATCCGTAGTCTAGAGAGGTTGTGT	1
ATCCGTATGGTGGATATGAACGGT	1
ATCCGTGATAACAAGATCCGGCGC	1
ATCCGTGATGGGCTATATTTTAGG	1
ATCCGTGGTCCACTGAGCTTTGGG	2
ATCCGTGTGCAGCCCACCTAATAC	1
ATCCGTGTGTGGATGCCCTAAGAA	1
ATCCGTGTTTAGCGCTTTGACCATC	1
ATCCGTTCGTGATAGCAAGGGTAG	2
ATCCGTTTACGGGGAATTTAACTA	1
ATCCTAAGTGGTGTTTGGTTGGAG	2
ATCCTACAAACGCTCCTAAGCCGCCA	1
ATCCTACATCGGATATACGGGTAC	1
ATCCTACATGACACGTGGATGGAC	1
ATCCTACGTGACTGGTGAGTCAGC	1
ATCCTACGTGGCGGCTAAGTCAGC	1
ATCCTACGTGGCGTTGATGTGG	1
ATCCTACGTGGTGCTAATGTGACC	1
ATCCTACGTGGTGTTGATGTGGCA	1
ATCCTACGTTTTTCCTATTCCTAC	1
ATCCTACTATTCATTACTACACGA	1
ATCCTACTGAGTACAAGAGCCTCG	2
ATCCTACTTACCAACCTAGACATA	1
ATCCTAGAATAAGTAAGGTGGTAC	2
ATCCTAGATGGCAACTTATTTAAT	1
ATCCTAGGTGACAGCTTATTTAAT	1
ATCCTAGGTTGCTATATATTGGGA	1
ATCCTAGTACTACAAATCTGGACA	1
ATCCTAGTACTACGAATCTGGACA	1
ATCCTATATAATAACCGATGTGAC	2
ATCCTATATAATATTCGATGTGAC	2
ATCCTATGTGGCGTTGATGTGGCA	1
ATCCTATGTGGTGCTGATGTGACA	1
ATCCTATGTGTTGGTGACACGATC	3
ATCCTATGTTATGATATTTTGGGA	1
ATCCTATTGGTGAACCTCTAAGTA	1
ATCCTATTTTAGTAGCTAAGGTGA	1
ATCCTCGTCAAACAGCTGGAATGC	1
ATCCTCTGCACTTTGGGCCTCGAG	1
ATCCTGAGTGCCAAAAGTTGTTAT	2
ATCCTGCTGTTGCGACCGGGC	1
ATCCTGGACTCTGCTAGGTGGATC	1
ATCCTGGTATATTGTGGTCACAGA	1
ATCCTGGTGGCTGTAAATATTACG	1
ATCCTGGTGGGTGGAGTCATGTAC	4
ATCCTGTTAGGAGGCGAACCGGA	1
ATCCTGTTTAGGGACCGGGGTGAC	1
ATCCTTAATTGCCACATCTTCGAA	1
ATCCTTCTTGGGCCGCCTACCACC	1
ATCCTTGATGACTACAACAACGAC	1
ATCCTTTTGGTGTAGCTCGGTCTT	2
ATCGAAAGAGAACAACCAGGGCCT	1
ATCGAAAGATATAAGTGGGTCGTC	1
ATCGAACAGAACTATTGCGGGTAC	1
ATCGAACGGTTCAGACCGCCGCCT	2
ATCGAAGCGGTGTCTATTGGCAAA	1
ATCGAAGGCTGCTTAGCACTCGGG	1
ATCGAAGGCTGTGTTTAGATTCAA	1
ATCGAAGTCGGGGGCTACTGTCAG	1
ATCGAATAGCCAGCTGTCGGGTCC	1
ATCGAATGAGAGATGCACAAGGGA	1
ATCGAATGATGCCCGGTTCGT	1
ATCGAATGGTGGTTGTTCGACAGG	2
ATCGACACTGAGGGTGGAAGGTAC	1
ATCGACAGTGAGGCGTTTATGATG	1
ATCGACGGATAAATGTATAGGTGT	3
ATCGACGGTGAGATTAGATAGTGC	2
ATCGACTAAACTCGACGGGGCATA	2
ATCGACTAGCCTAGGCTGTAGGAG	1
ATCGACTCGGACACGGATGATGTA	1
ATCGACTGATACCTGGTACCCT	1
ATCGAGAGGGTCTGAACCTGTCTA	1
ATCGAGGCTAGCGATGATGTAGGA	1
ATCGAGGGAATGCCAATCAGACAA	3
ATCGAGGGACCTTGTTTGTTTTGA	1
ATCGAGGGCGACAGAATCGGTGGA	1
ATCGAGGGCTCCGCGCGTGCGTAC	3
ATCGAGGTGAAATTTGATGTCCGC	1
ATCGAGGTGGTTGGCGACTCTAGG	1
ATCGAGTAAGTGATATGGATTTGC	1
ATCGAGTCAATAGACGCCACGTGA	4
ATCGAGTGCTCTAGACCAGC	2
ATCGAGTGGGCTGCCAATGGGCC	1
ATCGATAAGAACGATGATGCCA	1
ATCGATAAGATGCTGGAAGATGGT	1
ATCGATAATTGATGATGAGGGAG	1
ATCGATACAGGAAAACGGCGGCGC	1
ATCGATAGGGTTTTTAACAATCGA	1
ATCGATAGTGGTGGTAGGTGGAGC	1
ATCGATATCGTTACGATGGTGTT	1
ATCGATCGCCGTGGGGATGGGGTA	2
ATCGATCGTGCGAGGGTGGATCTA	1
ATCGATGAATGGATTCACTCGTGA	2
ATCGATGACTGATGGGGAAGCACT	1
ATCGATGCCTTGGCGAACACTTGT	1
ATCGATGGGGTCTCGAGGTGATGG	1
ATCGATGTTTGGAAAATCTGCAGC	1
ATCGATTCATTTGCTCAATTTGAT	1
ATCGATTCGTTGGTGTCATAACGT	1
ATCGATTGAGATATGGTCGCACA	1
ATCGATTGCATCTCTGATGGACGG	1
ATCGCAAGAGTAGCAGCCTGTCGA	1
ATCGCAATACTTCAGGCATTGG	1
ATCGCAGCAGGTGACGCGTGACCA	1
ATCGCAGGTATCCTCGGTGTGCAG	1
ATCGCAGTGTTGTTGGTGCTTTGC	1
ATCGCATAAGATGGGATTCGCTCA	1
ATCGCCAACACGAGAGATTGAGGT	1
ATCGCCAACGACGTCCTCTGACAT	1
ATCGCCAACTAAATAAGACGGTGG	1
ATCGCCACCATCGATATGACCACA	1
ATCGCCACCGTAACCGTGGGCCT	2
ATCGCCACGTAGCACCACGTCAGC	1
ATCGCCAGGGCCGGCTGCAATCGA	1
ATCGCCAGGTACTTGGGATGGTA	1
ATCGCCATATGATTGGAATGC	1
ATCGCCATCGCGGTAGACCGCCA	1
ATCGCCATGGTGATTAAGAAGTAA	1
ATCGCCCTTCAAGATGCGACATGG	1
ATCGCCTGACTCTGAGAAGGGAGG	1
ATCGCCTTGAGGTCGCGATGGCTC	1
ATCGCGCAAGGACGATATGGGACA	2
ATCGCGCACCTGCGATGCGAGCCC	1
ATCGCGCTCGGCCTTGGTGAGTAC	1
ATCGCGGCGGTAAAATTCAAACAG	1
ATCGCGTGGGTGGCTAATTTGCGCG	1
ATCGCTCCGGTCTACGTGGTCTGC	1
ATCGCTGAAAGAATAATTAATGGT	1
ATCGCTGTCATGTTCTTCCTTGTC	1
ATCGCTTTAGAGGATTTGTGCGAT	1
ATCGGAAACGATTTGGTACCGTGA	1
ATCGGAACCCATACACATCACTGC	3
ATCGGAATCGGGTTGGATACGGA	1
ATCGGACCCCACACGATATGGTAA	2
ATCGGACCCCTCACGATATGGTAA	6
ATCGGACCCTGCACGATATAGTAAC	1
ATCGGACCTACATGTAAATGATAA	1
ATCGGACGTCCGATAGGTAGCTTC	1
ATCGGACTCCTCACGATATGGTAA	1
ATCGGAGATGTCACTGGTGAAAAT	1
ATCGGAGCACGTGCCCAACTTCCC	1
ATCGGAGGACATCCTTTAGGTGAA	1
ATCGGAGGTGCTAATGGGCCTAGG	1
ATCGGAGTCTGCGTGTGCACCT	1
ATCGGAGTGCGGCGTTGATAGTGG	1
ATCGGATATTACGTAGGGTGTCG	1
ATCGGATATTATATATGGTGTTGC	1
ATCGGATGAGGTACTAGACTACTA	4
ATCGGATGATCGAGGCGAGGGGCG	1
ATCGGATGGAGCCTCTGCTGGAGC	1
ATCGGATGGATGACTAGATAGAAG	1
ATCGGATGTTATGCGGATGATGAA	1
ATCGGATGTTTGACCGGATGTTGG	1
ATCGGATGTTTGATCGAATGTCGA	2
ATCGGATGTTTGATCGGATATTGG	1
ATCGGCAAGCGCATCGATGAAGCC	1
ATCGGCAATACCTACACACAGCCA	1
ATCGGCAATGGTAACTCGGCTGTC	1
ATCGGCAGACAACCGTGCTCCCAC	1
ATCGGCAGACATAGTTGTTCGACC	2
ATCGGCCACCTAGTGATGAATCTA	1
ATCGGCCGACCGACGAAAGATGG	2
ATCGGCCGACCGACGAAAGATGGT	8
ATCGGCCGTAATACTGTCTATGGA	1
ATCGGCCTAGACTTTTAAGTCAGC	1
ATCGGCGAAGGGCCTGCTGGTAGC	2
ATCGGCTAACAATGACATGATAGA	1
ATCGGCTAAGGAAACATGGTC	5
ATCGGCTAAGGCAGACAAGGGTTC	1
ATCGGCTGAGTCCGAATCGGCTGC	1
ATCGGGAAAAAAGGAAAATGTTGC	1
ATCGGGAAGATTGAGAAGATACGC	1
ATCGGGACTAAAGATTGATGCACC	1
ATCGGGAGCCAAATTCTTCTCGGC	1
ATCGGGAGGCTGAATTACGTCGGT	1
ATCGGGCAGACAATATGTGAGAG	1
ATCGGGCAGCAGTTTGTGGGTGAC	1
ATCGGGCCCACATACTTCGACTGC	1
ATCGGGCCTATACGTGAGTGACAA	2
ATCGGGCGACCGACGAAAGATGG	1
ATCGGGCGACTGAGGAAATCTGGC	1
ATCGGGCGATCTATACTGGTCAGA	1
ATCGGGCGTCTGATCCGTAGGTG	1
ATCGGGCGTCTGATCCGTAGGTGT	122
ATCGGGCGTCTGATCCGTAGGTGTA	4
ATCGGGGATGACACGACCGATGAG	1
ATCGGGGCTATTGTGGAATTTGGC	1
ATCGGGGTCTAGTGTTTTCTTTGA	1
ATCGGGGTGAAATTTACGGTCCGC	1
ATCGGGGTGAGGTTACAACGCCAA	1
ATCGGGTACTTAGGTACCATGCCT	1
ATCGGGTCTGATACTTATGAGTA	1
ATCGGGTGACGAAGTTGGATACGA	2
ATCGGGTGAGGTTACAACGCCGCA	1
ATCGGGTGGTCACAGGTGATTGGA	2
ATCGGGTTGGACACGGATAGTGCC	1
ATCGGTAATGCACGACAAAGGTGG	1
ATCGGTAATTAGGATTGGTGGCAG	1
ATCGGTAATTGATGATGGGGAGC	1
ATCGGTATATCCGTGTGCTTG	1
ATCGGTATCAGGTAATTCCGACGA	1
ATCGGTATCCAATGAGCTTCGGG	1
ATCGGTATTTCAATGATATGAGG	1
ATCGGTCACCGAAGATCCTTCGG	2
ATCGGTCACGCCTGCTATAGGTGA	1
ATCGGTCGACCGACGAAAGATGG	1
ATCGGTCGATCTCCCTACTAGTCC	1
ATCGGTGACCATGGTGCTCTTGAA	3
ATCGGTGACGAGGTTTGAATGCGG	1
ATCGGTGAGCCATCCGGCTATGGC	1
ATCGGTGAGCTATTCAGCTCTGTG	1
ATCGGTGATGGACTTTACTCTGAA	1
ATCGGTGCAAAAATAGGTTGTG	1
ATCGGTGCATCCAAACATGGGCA	1
ATCGGTGCGAGCGGTTTAGGATGG	1
ATCGGTGCTTGCCCTGTAGGCTAG	1
ATCGGTGGACCCATTAATTCAGAC	1
ATCGGTGGTCACATACAAGTGTAG	1
ATCGGTGTCGGTTTTTCCAACCGA	1
ATCGGTGTTGCATTTAGTATTTCT	1
ATCGGTGTTGCCGGTATCTGGTCC	1
ATCGGTGTTGGGCCTATATATGGC	1
ATCGGTTAACCGTTCGATGTGACA	1
ATCGGTTAGATTGACTATAGGTGA	1
ATCGGTTCTCCCTGACCAGCGAGA	2
ATCGGTTGAGATAAGGGAGGTGAA	1
ATCGGTTTGAGTGTTCTGGAA	1
ATCGGTTTGTCAAGCGGTGTGCAC	1
ATCGGTTTGTGGTGCATTGAATTG	2
ATCGGTTTTTACAAACGGTTGTGG	1
ATCGTAAAAACGTGTCACGGCTGA	1
ATCGTAAAATAAGTGTAGCCATG	1
ATCGTAAACGATTTGGTACCGTGA	1
ATCGTACCCTCGTCGTGTACAGGA	1
ATCGTACGACGACATGTCCAGC	1
ATCGTAGCGTGTTCCCTCATTGAA	2
ATCGTAGGATATCTCAAGTTCTA	1
ATCGTATAAAGTATCACCAACGTC	1
ATCGTATCAAGTGTGCCATGCGTA	1
ATCGTATGTGCCATGCATCCT	1
ATCGTATTCGTGATAGGTGAGGCAT	1
ATCGTCACCGTGAAAGGGGGTTGC	1
ATCGTCACCGTGAAAGGGGTTGC	1
ATCGTCATGTCGAAAGAGGTTGC	2
ATCGTCCTTTGGATTTGATGGCCA	1
ATCGTCGAGGAGGATGTTGGTTGG	1
ATCGTCGCTGTCGGGTGAGATCCT	1
ATCGTCGGCGGGGTGTCGTTTCTC	1
ATCGTCTATTTATTTGCATCTTGA	1
ATCGTCTGCGACGGCACTCCTACC	2
ATCGTGAAAACCGCACAGTTATAGC	1
ATCGTGAAATTCATGGATGCC	1
ATCGTGAAGCGCTATAATAGACTA	3
ATCGTGACTACGGTATTTGGATGG	1
ATCGTGAGCAATAATGATGTG	2
ATCGTGATGATTTGTCAACAAGT	1
ATCGTGATGGACTGAACCAAAGTT	1
ATCGTGCACTCAAGGTTCTATGGC	3
ATCGTGCCAGTTTGTTGATCTTGT	1
ATCGTGCGTGCATATAATTGTAAT	1
ATCGTGCTGATAACGTATTATGTA	2
ATCGTGCTGTACTATGATGTGTCT	1
ATCGTGGTTGTGCTTGTTGAATT	1
ATCGTGTAACTACTCTGTAACTA	1
ATCGTGTACTACGAATTTGGATAC	1
ATCGTGTCCTCCTTGGGGGTGTCG	1
ATCGTGTCTTGGTGTCGTCATTGT	1
ATCGTGTGGTGCTGAATTTAGATA	2
ATCGTTACCCAACGGAGATTGCCT	1
ATCGTTCTGGTCACACGGTGTCTC	1
ATCGTTGACTACACAGACGGATGG	1
ATCGTTGGTGTCGACGTTTGATGTC	1
ATCGTTTCACAAGTGACCGATGAA	4
ATCGTTTGCTGTGGCCTACCGAGG	1
ATCGTTTGTGGTGTAGCGATTGCA	1
ATCGTTTTCGATTGTTGGATCAGT	1
ATCGTTTTGAGGATGTCACATGTC	1
ATCTAAAAAGACTACCTACATCCG	1
ATCTAAAAGAAGGTGACTAGATGA	1
ATCTAAAATAAAAAATGATGTGAC	2
ATCTAAACAGACCTATAGTAGTAC	1
ATCTAAACAGGGCCTTAGTCCCTCC	1
ATCTAAATACTAGGAGGTACCAAA	3
ATCTAAATAGGGCCTATAATTATA	1
ATCTAAATGGTGTACTACTCGCAA	2
ATCTAAATTAGAACGATGTGATGG	1
ATCTAACCAGGGCCATATTGATAC	1
ATCTAACGGTGTAGATTGATTTAA	1
ATCTAAGGCGTGCATATATTCCAA	1
ATCTAAGTTTCTTAGACGGGTGAC	2
ATCTAATATTTAGAATATGGGTGG	1
ATCTAATGGTGTATACTAATGGAT	1
ATCTACAAGGTGCAAGATGCTAAC	2
ATCTACAAGGTGCAAGATGTTAAC	2
ATCTACACGGCGATGGTATTCGAA	2
ATCTACAGTGTAAGGACCGGTGTT	1
ATCTACATTCAGACCCTACAATC	1
ATCTACCGGTGTTTATGGGTC	2
ATCTACGGCTACACTTATTTTGGG	1
ATCTACGGTTTAGGAGATATGGGC	4
ATCTACGTATCTAGTTTGACTGGA	1
ATCTACTGATCCAGGGCTTGATAC	1
ATCTACTGTTGGGATACGCGTAGG	1
ATCTACTTCATTGTTCCTAACAAA	1
ATCTAGAACCAGATGTGACACATC	1
ATCTAGAATTTGAACCGGGTGAAC	1
ATCTAGAGGGTGGTCCTTTCGCCA	1
ATCTAGATGAATGTGGGCAATGCT	1
ATCTAGCAAGATGCCTATCCA	2
ATCTAGCAATGCTCTTAGAGATGC	1
ATCTAGCCAAGTTGGTGCACCGGT	1
ATCTAGCCTAGGTATTGTAGTGAC	1
ATCTAGCGCTGATGTGACGGTCCA	1
ATCTAGGAAAGGGAGGGTGTATC	1
ATCTAGGTACTACGAGGTAACATG	1
ATCTAGGTACTATGGTACTATGAG	1
ATCTAGGTTGTTGGCAAACTG	2
ATCTAGTCTATTGCTGAGGTGTA	1
ATCTATAAGCTGTTATAGGTGTCA	1
ATCTATACAGATGCATGTCCAGA	1
ATCTATAGATGATGTGGAGGATAC	1
ATCTATAGCCAGCTGCAGCACAGA	2
ATCTATAGTGGAGCAGGTTTGCCA	1
ATCTATATGAATGTGTGCAATGCT	1
ATCTATATTTGTTGGGGTCACATC	1
ATCTATGACAGGATGTGACATTAC	1
ATCTATGACAGGTTGATGTGATGT	1
ATCTATGATATGGTTTATTGTAAC	2
ATCTATGCCGCCAAGTCGATGGCA	1
ATCTATGGGCCCATATATCAGCCA	1
ATCTATGTCTAGATTTGGTGATGT	1
ATCTATTATATTTTGGGACGGATA	1
ATCTATTATGGGTGGGCAGAT	6
ATCTATTCACGTGTGTAGCTCTGC	1
ATCTATTCGGTTGATGGTATAGGT	1
ATCTATTGATGACATGGTAAACAC	2
ATCTATTTAGTGCCAACTTCAATG	1
ATCTCAATCGGGACTAAACTACG	1
ATCTCATGGTACCTCCTCAAGAAC	1
ATCTCCCTAGCTGGGTCCTGGATC	1
ATCTCGAGGTAATACATGGAGGTA	2
ATCTCGAGTAGGTATCAGGTGTGA	1
ATCTCGGACGTCCATTTCTCGATC	2
ATCTCGGCAGGACCTACCACATAC	1
ATCTCGTGCTATAACTGTTTGAGA	1
ATCTCTGAGGGCTAATTTGAG	1
ATCTCTGAGTTAATTGTAGGTAGT	1
ATCTGAAAAATGAACTAGGGGTCT	1
ATCTGAACATATGTATGTCTGGAT	3
ATCTGAGCAACGTGATGGCAGCCG	3
ATCTGATATGTGGACCATGTGCC	1
ATCTGATCGATCCATGGACTA	3
ATCTGATTAGGTGTCAATATTCTT	2
ATCTGATTCAAATGGGGCTGAACA	1
ATCTGATTGGGAATAGCCTATTAG	1
ATCTGATTGGGACGGGATGATACC	1
ATCTGATTTACAGTGTGTGTCCAA	1
ATCTGATTTTACGATTGAGAGATA	4
ATCTGCAGCGTTGCTGGATATGAT	3
ATCTGCAGTTTGGTACACATACTG	1
ATCTGCCGAAGCTGTGGGATGTCA	1
ATCTGCGAAATCATCTGGTGGAAC	1
ATCTGCTAAACAACGTAGAAATGC	1
ATCTGGACAGAGGTGTGCTAGA	2
ATCTGGACATGTCTGGATGGGTC	1
ATCTGGACATGTGTACTAGGATGG	3
ATCTGGACTAGGTAGATGGTA	7
ATCTGGAGCCTATATCTGGATACA	1
ATCTGGAGGTACGAAGATTTTACA	1
ATCTGGAGGTCTTCGAGCTCGGAC	1
ATCTGGGAATCAGTTGATACCTAC	1
ATCTGGGCTGACCTATGGTGGGAA	1
ATCTGGGGTGAGGTTACAACGCCG	2
ATCTGGTCAAACGTCCGATGTG	1
ATCTGGTCAAACGTCCGATGTGAC	2
ATCTGGTCAAACGTCCGATGTGAT	1
ATCTGGTCAAATAACCGATGGAC	1
ATCTGGTCTACTTCTGAGCCTGGA	1
ATCTGGTGGACCCGATATTTTTAA	1
ATCTGGTGTCATGCGTACGTA	3
ATCTGGTTAAACGTCTGATGTGAC	1
ATCTGGTTCAGGTGGGGTTGGCCG	1
ATCTGGTTGAAACAACAAAGTGCT	1
ATCTGGTTTGTGGTTGCAGGAGGA	1
ATCTGTAATAGTAAAGTAAGGTGT	1
ATCTGTAATGGCCCTAAAACAATC	1
ATCTGTAGCCAGCTGCAGCATAGA	1
ATCTGTAGCCAGCTGTAGCACGGA	1
ATCTGTATTAGTGTGTGTACGCA	1
ATCTGTCACATTCAGTGCTAGGCC	1
ATCTGTGAAAAGAGTACGGGGGCA	1
ATCTGTGACAGTAACACGATATGT	1
ATCTGTGATATCTAGGACCTGATAC	1
ATCTGTGCCAGTTTTTGTTTAACT	1
ATCTGTGCCCGTGGGTATACCCAT	1
ATCTGTGGTGTCAGCTACGTT	1
ATCTGTGTATGTCACCATACTGTG	1
ATCTGTGTTTATGAAATGTGGGTC	1
ATCTGTTCGGTCCTATAATATAAC	1
ATCTGTTCGGTTGATGGTATAGGT	1
ATCTTAAGATTGATATGATGCCTT	1
ATCTTAATCTTTAGTGCCGGTTAG	1
ATCTTAATGAGCACGGTGTCCATG	2
ATCTTACCAATGTAGATGCCGGTT	1
ATCTTACGGATAAGGGGCCCGAAC	1
ATCTTAGACGGTTTCTACTTTCGA	1
ATCTTAGGCCCGGTAGGTTA	1
ATCTTAGGTTGCTACATATTGGGAC	1
ATCTTATACTGGATGGGACAAGT	1
ATCTTATATGTAATACGGGTGTCT	1
ATCTTATGATACTACGATCCTACC	1
ATCTTATTCCTACATGGAAGGGAG	1
ATCTTATTGAGGAGCCCAAATGTC	2
ATCTTCGGGCCGTGCCTTATAAGG	1
ATCTTGAGATTGACGAAGTTGCC	1
ATCTTGAGCAACATGCTGAATTGA	1
ATCTTGAGGTACTACTTAGGTCAC	1
ATCTTGATGGCAGTAGGGACC	2
ATCTTGCATAGGCGTCTGGAGAAC	1
ATCTTGCTGTGAGTATGAGATGAG	1
ATCTTGGGCCCCTGCGAAATGCAA	1
ATCTTGGGTGTGCTAGTTAAGTCA	1
ATCTTGGTGACAACGGATATTGCA	1
ATCTTTAGTCCCGGTTGGTGAGGG	1
ATCTTTCGAGTGAGATATAGTAAA	1
ATCTTTTAAGTAGGAAAATATGAT	1
ATCTTTTTGTTTAGGTTGGTGTTA	1
ATGAAAAAAATTGAGAAGGTGTAT	1
ATGAAAAAGAAGATGCCACTA	2
ATGAAAAAGAATGGTTGTGATTGGT	5
ATGAAAAATGATGTGCCAAGCAAT	1
ATGAAAAATGATGTGTCAAGTGAA	1
ATGAAAACAAAATGATAGGTGAA	1
ATGAAAACAAGTGGTGTGATCTCT	1
ATGAAAACATAATTATCTTGCTGC	1
ATGAAAACGAAAGGACTACTCAAA	1
ATGAAAACGAATATGGTATAAGCA	1
ATGAAAACTTATGGTTGCACTTAA	2
ATGAAAAGAATGGTTAAAGGATGA	1
ATGAAAAGGACTGCTTTGTATGGT	3
ATGAAAAGGCATGTAGCCTGGTGG	4
ATGAAAAGGCGGCAGTACGGTGGT	1
ATGAAAAGGTGCATTAAAAGCC	1
ATGAAAAGTTGAGAATTTGGGAAC	1
ATGAAAATGTAAGTTAGGTGGATC	1
ATGAAACAGGGTGTTACTCAGATC	1
ATGAAACATTCAACGGTGTTGTGC	1
ATGAAACCTATCGAAATTCCAAAC	1
ATGAAACTAACTAGGTGTCCGTAC	1
ATGAAACTAGAACTTTCGGAT	1
ATGAAAGAAAGGACTACGAAACAA	1
ATGAAAGAGAGAAGGAAAGCGGGC	1
ATGAAAGATGGGTCGCAATGTGATG	1
ATGAAAGCCACAAAGAGTGAAGAG	1
ATGAAAGCGGCATAGATGAGTCC	1
ATGAAAGGAGTATAGGTGGTGTTT	1
ATGAAAGGGCCTACTCCCTCCGTC	2
ATGAAAGGTAGCGGTTATTTAACC	1
ATGAAAGGTGTGACCATATGTTAA	1
ATGAAAGGTTCGGATCATGTGATC	2
ATGAAAGGTTTGATGGAATGGAA	1
ATGAAAGTTGCCAAATGTAAGTGG	1
ATGAAAGTTGCCAGATGTAAGTGG	2
ATGAAAGTTGTCCATAGCATT	1
ATGAAAGTTTGTAATGTGTGTCTG	3
ATGAAATAACCGGGACTAAAGATC	2
ATGAAATAAGATTAATGGTTC	1
ATGAAATGAAGGGAGTACTATAGA	1
ATGAAATGAGGGCACACGAACATG	1
ATGAAATTGAAAACACCAATGAAG	1
ATGAACAAAACTGGTGTACT	1
ATGAACAAGTTGATATGGCCCTGA	4
ATGAACAGGAAAGAGGGATGGAGA	1
ATGAACATGATTTTTGGTGAACTA	1
ATGAACCAAGAGTGCAACTGGTGG	1
ATGAACCCGATTGATAAGACCTGC	1
ATGAACCGGAAGCCTGGTTACG	1
ATGAACCGTATAGGTAGGGTGGA	2
ATGAACCGTGCACTCAAGGTCCTA	2
ATGAACCTTTTGAGCCTACTTAGT	1
ATGAACGAGATGCGAAGCTGATC	2
ATGAACGGAACAACGGATGGGAGA	1
ATGAACGGCCTCGACATCATATA	1
ATGAACGGTGGTGGTGATGGTCCG	2
ATGAACGTGGACAATGCTAGAAAG	1
ATGAACGTGGATGGATGTTTAGGA	2
ATGAACTAGAGTTGTGGAGCTG	2
ATGAACTAGATAGGTGGTGCTGAG	1
ATGAACTCGGCGGCAGCGATGGC	1
ATGAAGAATAAATATGATTGGTAG	1
ATGAAGACATGGGACCTCATCGGC	1
ATGAAGAGGAAAACATGAGGTGAG	2
ATGAAGATAAAGGTGTTTGCATGG	1
ATGAAGCAGAGGTGTTGGTGATGA	1
ATGAAGCCCAACAAGTGAAGAGTA	1
ATGAAGCGGGTCCTGCTGATGAGG	1
ATGAAGCGTAACCGAAGCGAGTGT	1
ATGAAGCTAGTTTAGTTTGTGAA	1
ATGAAGGACGTACATCTTGCTTAA	2
ATGAAGGAGCTACAAAGTGTGAGC	1
ATGAAGGCGCTCTGTGCAACCGAG	1
ATGAAGGGTACTTAAGATCTTATG	1
ATGAAGGGTGTTACTCTTGTGCAA	1
ATGAAGGTAAACATATGAAAAGAT	1
ATGAAGGTGAGCCATGGTGGACAA	2
ATGAAGGTGGGACATTACCTAGTC	3
ATGAAGGTGGTTGACACGGAGTCA	1
ATGAAGGTGTTAAAATGTTCGATG	1
ATGAAGTAATATGTTATTGGTGAA	1
ATGAAGTCAGACCAAGATGAGATG	1
ATGAAGTCGTGATGTCCTGTAGAA	1
ATGAAGTGAAGATTGATCATGCA	1
ATGAAGTGTAAAACAGATGATTGC	1
ATGAAGTTACTATGGATGCCTTGC	1
ATGAAGTTGACTATAGATGATTTA	1
ATGAAGTTTGAGGGCACTATGTAT	1
ATGAATAAGATGGTGATCTAACAC	1
ATGAATAATGTGGATAATGCTAGA	1
ATGAATACAATCCGAGTAGTCCTT	1
ATGAATACAGTAGGGTGGGGGCAC	1
ATGAATACTAGGTGTAGTGTCT	5
ATGAATAGGGTGTATGTGTATTCA	1
ATGAATAGTTGAGGGTGTAATATG	2
ATGAATATAATGGTGTAATCGGAT	1
ATGAATATGGACAATACTAGAAAG	1
ATGAATATGGGAAATGCTAGAATG	3
ATGAATATGGGCAATGCTAGAAAG	5
ATGAATATGGGCAATGCTAGAATG	3
ATGAATATGGGCAATGTTAGAAAG	1
ATGAATATGGGTAATGCTAGGAAG	1
ATGAATATGGTCCGTCGTCTGC	1
ATGAATATGTGGATATATATGTGT	2
ATGAATCGGTTCATATAAGGTGTC	1
ATGAATCTAGATAGCCACATTCAT	1
ATGAATCTATTTGAGGAGCTTCTG	1
ATGAATCTGCTAACTGCGATAACC	1
ATGAATCTGGTTTAGGCCCAATTT	1
ATGAATGAGCTATTAGATTGGCT	1
ATGAATGATGTGTGCTGCCTTACA	1
ATGAATGGAGAGAAAATAGTGTGGC	1
ATGAATGTGAGTAATGCTAAAAAG	1
ATGAATGTGATAGCACAGGGGTTC	1
ATGAATGTGGAAAATGCTAGAATG	1
ATGAATGTGGAAATGCTAGAATGA	1
ATGAATGTGGACAATACTAGAAAG	1
ATGAATGTGGGAAATGCTAGAATG	2
ATGAATGTGGGCAATGCTAGAAAG	1
ATGAATGTGGTGTTACGTGTGCAG	1
ATGAATTAGCTACACCGGTGGAGA	1
ATGAATTATGGTCCTAGGTTGAG	1
ATGAATTGAAACATTCTTTTGCAA	1
ATGAATTGAGGCGTCGAGTGGCAA	1
ATGAATTGGTAGGCTAAACATTAG	2
ATGAATTGTTTATTGGATTGGCTA	1
ATGAATTTAATAAAGGTACGTGCA	1
ATGAATTTGAAGATGTGATTTTGC	1
ATGAATTTGTCTGATGTGTGCGG	1
ATGACAAAATATGTGGGGCTCAAG	2
ATGACAAATAGGTCCATCTGTGTA	1
ATGACAAATGGGCCTATATGTTAC	1
ATGACAACAGTGATGGTCGCTATC	2
ATGACAAGTAGGACCTACATGAGT	1
ATGACAAGTTCTGTGATTTGGATA	1
ATGACAAGTTGAGGGACCTTAGGT	1
ATGACACAGATAGATACCAGTTGC	1
ATGACACAGGTGGTGCTAGATATG	1
ATGACACAGTCTACGAGATATATC	1
ATGACACGTAGGACCCACATGAGT	1
ATGACACGTGCTAACACATACTAC	2
ATGACACTCCGATGGGACGGGTCA	2
ATGACAGATGATATTGCATGGTAC	1
ATGACAGATGGTAGTGGTACGAGA	1
ATGACAGATTGAGCGGCGGTGGTC	1
ATGACAGGGACACTATTAAGGGCA	2
ATGACAGGGTTCCGTCTATTTTGC	1
ATGACAGGGTTGTCTCCCGTGTC	1
ATGACAGGTGACGTAGTGTACGT	1
ATGACAGGTGAGACTAGGTGACAC	1
ATGACAGGTGAGATCATATATAGC	1
ATGACAGGTGGAACCGGGCATTAA	1
ATGACAGGTGGGACCAAGTATTAA	1
ATGACAGGTGTATGATGGTTGTCA	1
ATGACAGGTGTTGATGTGATGGAA	1
ATGACAGGTTCTGTAAAAGATGGG	1
ATGACAGGTTGATGTGATAGAAAA	2
ATGACAGGTTGATGTGATGAAA	1
ATGACAGGTTGATGTGATGAAAAA	1
ATGACAGGTTGATGTGATGGAA	1
ATGACAGGTTGATGTGATGGAAA	1
ATGACAGGTTGATGTGATGGAAAA	4
ATGACAGGTTGATGTGATGGAGA	1
ATGACAGTAGTGATGATGCGTGGG	1
ATGACAGTGTGGTTATGCATAAGT	1
ATGACATAAGGGGTAGCAATTGGT	1
ATGACATACAAGAAACGGGTGGAC	1
ATGACATATATCATAAACGGGTGG	1
ATGACATGAAAGAAACGGGTGGA	1
ATGACATGCAAAAAACGGGTGGAC	1
ATGACATGCAAGAAACGGGTGGAC	4
ATGACATGCAAGAAATGGGTGGAC	1
ATGACATGCAATAAACAGGTGGAC	1
ATGACATGCTAGGAATGGGTGAAC	1
ATGACATGGAAGAAACAGATGGAC	1
ATGACATGGAGTGGGCCAAGAGCC	1
ATGACATGTAAAAAACGGGTGGAC	1
ATGACATGTAGATGACGACATGGC	1
ATGACATGTGATGTTGCAGATGAC	1
ATGACATGTGGGCCATGAGAGTAG	1
ATGACATGTGGGCCTTTGAATTGA	1
ATGACATGTGGGTCAGGATGGCAT	1
ATGACATGTGGGTCAGGATGGCATA	1
ATGACATGTGGGTCCACATATGTC	1
ATGACATGTTGATGTGTGATGGAA	1
ATGACATTGATAGACACATTATGA	1
ATGACCACATCTCAACACGGTGAA	1
ATGACCACATGACTGATCACC	1
ATGACCATATAGCGGCAGCGATGC	1
ATGACCATATCAGGACAGGGGTGA	2
ATGACCCATGGAACTGGCTAGTGCG	1
ATGACCGAGCGATGTCTTTGTGCA	1
ATGACCGCGACGGCGGGATGATGG	1
ATGACCGGAGCCGTTTCGATAGG	3
ATGACCGGCCAAATGACAGATGA	1
ATGACCGTGCGTTACAATAGGTGA	2
ATGACCTATGAAAGCTATCAGATG	1
ATGACCTCGAAGGCCTTGGATGAC	1
ATGACCTGGTGACCACTCGTCTG	2
ATGACGACAACAGAGATGGGAAAC	1
ATGACGACAGTGCCTTGGGGAGC	1
ATGACGATAATGCCATGTCTCCGC	1
ATGACGATGATTGTGATGATGACG	1
ATGACGATGGCGCCGACGTTGCGG	1
ATGACGATGTCCTCTGGTGGTCAC	1
ATGACGCCGCACGAAGTGACTTTT	1
ATGACGCCGTTGACTTTTTCT	1
ATGACGCGTGGGCCAATGTGCTAG	1
ATGACGGCTCCCGTTGAAGATGG	1
ATGACGGGCAATGATAGAAACTGT	1
ATGACGGTATACTGGTATCAGCTG	1
ATGACGGTGTTTTTCGATAAATAT	1
ATGACGTACAAAATAGTTGGGCAA	1
ATGACGTGGGCTACTATAAATTTA	1
ATGACGTGGTCACTGATAGGTGGG	1
ATGACGTGGTTGATTGAGATAAGC	1
ATGACGTGTGTCCTCGGTTGC	1
ATGACGTTGATGTGGCGCTTATGA	1
ATGACGTTTTCGTATCTCGGTGAC	1
ATGACTAATAGCGTGCTTAAATGA	1
ATGACTACCAAGAATGGTACTTAA	1
ATGACTAGGATGGTGTCCATAGCA	1
ATGACTATAGGACCTACTTATCT	1
ATGACTGAACGCCTCTAAGTC	1
ATGACTGATGAGTGAACGGTACGG	1
ATGACTGGACTGCCACGTGGACGT	1
ATGACTGGGCACTGACGAGGCAAA	1
ATGACTGGTGGAACCATATATTA	1
ATGACTGTGCGACCATATCTCA	1
ATGACTTACATTGTGAAACGGAGG	1
ATGAGAAAAGGTTGGTGCACCTGAG	2
ATGAGAAACATTATTGGTCTTAC	1
ATGAGAAACATTATTGGTCTTACC	1
ATGAGAAATAATTTGTTCCCACGA	1
ATGAGAAATTTGGTAGGATGGAGA	1
ATGAGAAGTAGAGGTATATGAGA	1
ATGAGAAGTTAGATTGAAGAGTGC	1
ATGAGAATAACTCAAAGGTGTCTG	1
ATGAGAATAATTGAAGAAGGTGTG	2
ATGAGAATTGAACGTCCGAGTGCA	1
ATGAGACAAAAGGTGTTTATATA	1
ATGAGACAAGCTAGCCTTTACTA	1
ATGAGACACCCCTACAAGTTTAAG	1
ATGAGACATGGTTTCTACACAACA	2
ATGAGACATGGTTTCTACACAATA	1
ATGAGACTGGTTATGATAGGAGCC	1
ATGAGAGAAAAGTGACTGTGCCT	2
ATGAGAGGGTACGCAAATTTAAGC	1
ATGAGAGGGTGCACAAATTTGGAC	1
ATGAGAGGGTGCGCAAATTTGGAC	2
ATGAGAGGGTGCGCAAATTTGGAT	1
ATGAGAGGGTGTACAAATTTGGAT	1
ATGAGAGGTGTTACATTGTTTTGG	3
ATGAGAGGTTTGGAACTGATACTT	1
ATGAGAGTACTATGATATGACGAG	1
ATGAGAGTATGGTGATTTCAAGAG	3
ATGAGAGTGCTAATATGTTGTTTC	1
ATGAGATAACTAGAAGATGGGTGT	1
ATGAGATGAGAGTATGGTGATTTC	1
ATGAGATGAGGTGCAGGTCGCTGA	2
ATGAGATGGTCCGCCAAAATCGGA	2
ATGAGATGGTGTGCAAATTTGGAT	1
ATGAGATGTAAAGAGCCTTGGGGA	1
ATGAGATGTAGTGCCGACTTCAGA	1
ATGAGATTATTGTAATAAGTGCCT	1
ATGAGATTGAGGTAGCTAGTTATG	1
ATGAGATTGGCTCTGCTGGTACCT	1
ATGAGATTGGTTGCCAAGTATAGC	1
ATGAGCAAGCTGATCGATTGTGCA	1
ATGAGCAATGCTAGATGAAACGGA	1
ATGAGCACGGTAGATGGTACAC	5
ATGAGCAGCTAGCCTGGTGCACTT	1
ATGAGCATACTGAAGAGCATAGGG	1
ATGAGCATCTTCGAAGAGTGGACC	1
ATGAGCATTCTCGGTTGGGTTCCTG	1
ATGAGCCTAACAAATCGTGATCAC	2
ATGAGCCTATCAAATTAGAATTGT	1
ATGAGCCTGCATCGACTTCCT	1
ATGAGCCTGGATGGGAGATGGCCG	1
ATGAGCGAATATGGGCAATACTAA	4
ATGAGCGAATTTCAGATTGACTAA	2
ATGAGCGGGCTAGACGATACTTGG	1
ATGAGCGGTGATGGTAACAACTAGG	2
ATGAGCGGTTTTGTGTAGTGGTCC	1
ATGAGCGTCATCGGTGACGGGCAC	1
ATGAGCGTGCCAGTTGATTTGATA	1
ATGAGCGTGCCAGTTGATTTGATC	1
ATGAGCTAGAATGTGTAGAGTGAC	1
ATGAGCTCAACGTAGCTGTCGTGC	1
ATGAGCTCAACTGCTAGAGGTGGT	1
ATGAGCTCTTGTTGGTTGCCAAAC	1
ATGAGGAAAGCTACGAATCGGAC	1
ATGAGGAATCTACCGAAAGTATGT	3
ATGAGGAATGATTTGGTACTGTGA	1
ATGAGGACTACGCAAAGAAGTGAA	1
ATGAGGAGGTGATGGGTGATGTGA	1
ATGAGGAGGTGCTTTTGATTCTGC	1
ATGAGGATCTTCGAAGACTGGGCC	1
ATGAGGATGCACGGAGAATGGCCA	1
ATGAGGCGTCCATTAGAAAAAGAT	1
ATGAGGCTGTTTGGATCCATCCCA	1
ATGAGGCTTGTGAACTGCTGCACG	6
ATGAGGGAAGTCTATGACCTATGA	2
ATGAGGGCATGCACTAGGACTCGT	1
ATGAGGGCCTGTTTACATTCCTGA	1
ATGAGGGGCTAATGTAGACTTTGT	1
ATGAGGGGTGAGACCATATATTGG	1
ATGAGGGTCTGCGTTTGTAATGCG	1
ATGAGGGTGAGCAGCCGCATGTAC	1
ATGAGGGTGATTGTGATTTGTCGG	1
ATGAGGGTGTTTAGATACGTTGTA	1
ATGAGGTAAGTGTCACGTGCAAGT	3
ATGAGGTACCAAATTTATAAAAA	1
ATGAGGTACCAAATTTTACACTAA	1
ATGAGGTACCAGGTACTATAAGGT	1
ATGAGGTACCTCATGGAGTCATGG	1
ATGAGGTATACGGATATGGTGTAT	1
ATGAGGTATTTTCCTGTACAGTCC	1
ATGAGGTCCAAACCATTGAGCTGC	1
ATGAGGTCCAAGGTAGCCATCGTC	3
ATGAGGTCCCTCGATGGTTTTGAC	1
ATGAGGTCCTGGGTTCGACTCCTC	1
ATGAGGTCTACTTTGGTGTCGTAA	1
ATGAGGTGACATTGATATATATGT	1
ATGAGGTGAGCCATTAGCTTATA	1
ATGAGGTGAGTGCTTTTGAGGAAG	1
ATGAGGTGATTAGCAGTTGTATGG	1
ATGAGGTGCTCCGGAAAACTGGGT	1
ATGAGGTGCTTGTACTGCTACTGC	1
ATGAGGTGCTTGTACTGTGAATGG	1
ATGAGGTGGAACCCTAAAAGGGAT	4
ATGAGGTGGAGCATATCGACGTTG	2
ATGAGGTGGCTGAGTCAGCGTGGAC	1
ATGAGGTGGGACCTTAAAAGGGAT	1
ATGAGGTGGGATGGGTTGGTCCC	3
ATGAGGTGGGCCATTAGCATATGA	1
ATGAGGTGTTGGGTTCAGTCCCAC	1
ATGAGGTTGACTTGTGGGCCCGGA	1
ATGAGGTTTTCCGAAAATGCCTAG	1
ATGAGGTTTTTGTTGTCGTGC	1
ATGAGTAATAAAGATGTGTCGTAG	1
ATGAGTACTGGCTGCTGATGATG	2
ATGAGTAGTAATGCTTGTGTGTCA	1
ATGAGTCAATGACATGTGGGGCAG	1
ATGAGTCACTACGCAGTAGGTTGC	1
ATGAGTGACATATACATTATCCTA	1
ATGAGTGACTATGTGGCATGA	1
ATGAGTGGCCGTCCGCTGAAGTGA	1
ATGAGTGTCACATCATATGTTTGA	2
ATGAGTGTCGAAACTAGATTTC	1
ATGAGTGTCTCGCGATGTGAACGT	1
ATGAGTGTCTGAGTTTGGATTGGA	1
ATGAGTGTCTTTAGATCAATGTC	2
ATGAGTGTCTTTAGTTAGTGAGGA	1
ATGAGTGTCTTTGGATTGATGCTA	1
ATGAGTGTGCGTACGTTGTGAGT	2
ATGAGTGTGGTGTTACGTATGTAG	1
ATGAGTTCTGCCATGGTCCAGGTCA	1
ATGAGTTGGCGGCTCAGGGTGTA	2
ATGAGTTGGTGCATTATAGGGTA	2
ATGAGTTTATGGGTGCTAAATTAA	2
ATGAGTTTGTCTTGAAAGGTGGTC	1
ATGATAAAATTGGTGTGCTTGTGA	1
ATGATAAAGTAACGTGCCATCTAC	1
ATGATAACTTCATAATGCCGGTGT	2
ATGATAAGGTGAAACCGAGGACGG	1
ATGATAAGTTGAGGGACCTTGGG	1
ATGATACCTATGTACCATGATGGC	3
ATGATACGCCAAAACTTTACACC	2
ATGATACGTGCACTAGTGGAGAAG	1
ATGATAGATACAATGATAGACC	1
ATGATAGCCATTAGAGGAGGTGG	1
ATGATAGGACAAAGATATGGC	3
ATGATAGGATGGGATATTTCATAG	1
ATGATAGGTGAGACCGTATATTAA	1
ATGATAGGTGGAACCAGATATTAA	1
ATGATAGGTGGGACCGCGTATTAA	1
ATGATAGGTGGGACTATGTATTA	1
ATGATAGTTATGTATCTTGCTGAC	1
ATGATATAGGTGATATCCGTCAGA	4
ATGATATATATTAGGGCCTATTTA	1
ATGATATGGTGATTGAGAGTGCAA	1
ATGATATGGTGTTTGACAAAAGAA	1
ATGATATGTGTGTCCAATGATTAA	1
ATGATATGTGTTATTATAGTGTCT	1
ATGATATTGGAATAGATGGTGGAT	1
ATGATATTGTCGATGATAAGATGG	1
ATGATATTGTGTTGATGAATTGAA	1
ATGATATTTAGTCCAGGTTGATAAC	1
ATGATCAAACGTTGGGTAC	1
ATGATCAAATCTAGCATGTGCATC	1
ATGATCAAGGGCCTAGATTACTT	1
ATGATCAAGGGTGGAGATTGCCTCA	1
ATGATCAAGGGTTTGGTGGTGTTC	1
ATGATCATCATTGCCACCTTCCT	1
ATGATCCACATCTTCGGGTCAGGC	1
ATGATCCACCAGGATCGTGGTTGC	1
ATGATCCCACCTGTCATACACACA	1
ATGATCCGTGCCGTCCTACATCCC	1
ATGATCGAGGAGCCAATAATGCAT	3
ATGATCGCCTACAAAAATGTAAAC	1
ATGATCGGATGAAGCGAGTGCTGA	2
ATGATCGTCATGCGGGTATGTTGC	1
ATGATCTATGTGGCGCTGATGTG	1
ATGATCTTTAGTCCCGTATTCGT	1
ATGATCTTTATGATGGAGGCCTA	1
ATGATGAAAGAGGGTAGCACACGA	4
ATGATGAAGGTTCTAGGTGTTAGG	1
ATGATGACAAGGTTGTTCATAGTA	1
ATGATGACGCCGCCTGGATCTAG	1
ATGATGAGATTGCTCTCGTGCCTG	2
ATGATGAGGTGGAAGAAATAAGTG	1
ATGATGAGTGTAGCAAAAAGTGAA	1
ATGATGATAGTAGAAACGTGGAGG	1
ATGATGATATTGTTGTCTGATTGATGTCTAAC	1
ATGATGATCGAGCAGGGTGTA	1
ATGATGATGTGTCAAACTTGTATG	2
ATGATGCTTACTTTGTCAGTTGTC	1
ATGATGCTTCTTTGTGCCCATTAC	1
ATGATGGGCGCTAATTACAATCTG	1
ATGATGGGCTAGACGCCTTGGGTTC	1
ATGATGGGCTTAGGATGGCTGCGA	1
ATGATGGGTTGATGTGACGGA	1
ATGATGGTAGTGACGTTATGGTA	1
ATGATGGTGGGTTGTGTCTTATAC	1
ATGATGGTGTCAGCATGGTAC	1
ATGATGGTGTTGGTACCTGGGGGT	1
ATGATGTAAAGTCCTACTCGGTAC	2
ATGATGTCCGCCTGCGAAAATTGG	1
ATGATGTCTTGAATGTTGTGTAGA	2
ATGATGTCTTGTATGTTGTGTAGA	1
ATGATGTGACAAGAAAAGTTGGAAG	1
ATGATGTGATGAAAAGTTAAGAA	1
ATGATGTGTATCGTAGATTGGTGG	1
ATGATGTGTCAACTTGTTAGTGAA	2
ATGATGTGTCATGCTTGCATGTG	1
ATGATGTTTCCTATGATGAGCTT	1
ATGATGTTTGTCTCTGTGCCACTA	1
ATGATTAAATTGATGGTTTGAAAT	1
ATGATTAACTGAGTGTACCATGGG	1
ATGATTAGAAACGATTTGGTAC	1
ATGATTAGAGGTGTCGGGTCACGG	1
ATGATTATGTTGTCTTTCTTTGAT	1
ATGATTATTGCAAGGTGAGCATA	1
ATGATTGAGCTATTAGAGGATGGC	1
ATGATTGATTACATGGGCATTGAG	1
ATGATTGCCTATCCTTGTGGATCG	1
ATGATTGGAGAAGGTGTATGATTA	1
ATGATTGGCTACATAGGTATTGAG	1
ATGATTGTAGTTGGGGTTTATCTC	1
ATGATTGTGCGAGATCGATGGTA	2
ATGATTGTGCGAGATTGACGGTAT	1
ATGATTTAGTGAACAGGTGGTTGG	2
ATGATTTGACAATATGGTGCTA	1
ATGATTTGATAATGTGGTGCTA	2
ATGATTTGTTAGGAATGATTGGTC	1
ATGATTTTCGGGCCAGGTTTTCCT	1
ATGATTTTGGTCTACGTGGCGTAC	1
ATGATTTTTTGTGGCCAACTTTGA	1
ATGCAAAAAAGCCAGTCGGGGCC	1
ATGCAAAACTTGATAGTGTCTA	2
ATGCAAAATACGTTTTGGAGTGGC	1
ATGCAAACAAACGAGATGATGTCC	2
ATGCAAACAACGAGGTGATATCCC	1
ATGCAAACGATGGGTGCCATGACA	1
ATGCAAACGCTGTACCTAGAGG	2
ATGCAAAGATGCTACATCATCATC	1
ATGCAAATCAGGTACTGAGCAGGCA	1
ATGCAAATGATAAAATACCACTCA	1
ATGCAAATGATGGGTGTCATAGCA	1
ATGCAACGTAGTTGGGTCCTCA	1
ATGCAACTGGGACTACGAATCCA	1
ATGCAAGAAACGGAACAGGATGGC	2
ATGCAAGAAAGGGGTGGACATCCA	1
ATGCAAGGCTAAAGTAATATAATA	1
ATGCAAGGGCCCATATTTTGT	1
ATGCAAGTATTAATTTATGGTGTA	1
ATGCAAGTGATGAAGTGAAGCCATA	1
ATGCAAGTGTAAAACAAAGGATTG	1
ATGCAAGTTCGTGGACCTAAGTGA	1
ATGCAATAAACGGGTGGACATCTA	1
ATGCAATAGAAGGGGTGAATGGG	1
ATGCAATATGCATATGCCTCTGAG	6
ATGCAATATTTAAATTGGGTGTTG	1
ATGCAATCGATGATGGTGAGTCAA	1
ATGCAATGCTTACGAATTGACTTT	1
ATGCACAAAACATTGCTGGTCC	1
ATGCACAAAAGATGCGGTTGCCTT	1
ATGCACAATTTTTTAGGTATGTG	1
ATGCACATTTTGGAGGAAAGTTAG	1
ATGCACGTGGGCCGGGTTAACCCA	5
ATGCACTAGGCTGGTAGGCTTGCA	1
ATGCAGACCGATATTGCAGGGGAG	1
ATGCAGAGATGGACCGGGACTGAC	1
ATGCAGATAGAAAGAGGACTTGTC	1
ATGCAGCCAACAGCTTGGATTTGC	1
ATGCAGCCAGATATTGAACAACAG	1
ATGCAGGAGCTTCCTGGAGTTGGA	1
ATGCAGGCTTGTCCATAGTTTTTG	1
ATGCAGGTCGTAGAATGCCACAAA	1
ATGCAGGTGGTGTGATGACGTACA	1
ATGCAGGTGTTCAAATGTTTGATG	1
ATGCAGGTTGTACTGCCTGGTGAA	1
ATGCAGTGCTTTAGCCGAAACTGA	1
ATGCAGTGTAGTGTGCTGATACTG	2
ATGCAGTGTATGTATAACAGGTGG	1
ATGCAGTGTCTCGTTTTTCGC	1
ATGCATAAACTGCGGGGTCGGC	1
ATGCATAAGAGTAGGGTGATGA	1
ATGCATACCGATCTGGCCTAGTTA	1
ATGCATAGAATATTAAATGTAGGC	1
ATGCATATGCATGTGGGGTTCCTT	2
ATGCATCACTGTTCATGGGCATAGC	3
ATGCATGCATGGGCTAATTAT	1
ATGCATGGCCAGAGTATATGGATG	1
ATGCATGGGTTAAAAATTGTAGA	1
ATGCATGGTGCATATTATGTGTGT	2
ATGCATGGTGTATTAGGGTAGA	1
ATGCATGTCTCTAAAGATTCGATG	1
ATGCATGTGCTTTGCAACGGGTGAA	1
ATGCATGTGTCTAAATATTCGA	1
ATGCATTCGGTAGAATGAGGTGAC	1
ATGCATTGATGGATTCTTGAGAGG	3
ATGCATTGCTGATGTGCCAAACGGG	2
ATGCATTTGCCTGCATTTGTGCAA	1
ATGCATTTTTCAAGAGTATGGGC	1
ATGCCAAAACATGTCCACTGT	1
ATGCCAAAATGTGCCAAAATTGGT	1
ATGCCAAAATTTGATAAGTTGCCA	1
ATGCCAAAATTTTGACAAGATGGTA	1
ATGCCAAAATTTTGGTATAGTTGC	1
ATGCCAAAGAACTGTTGGGGTCCG	1
ATGCCAAATGGAGGGAAGTAGGCC	1
ATGCCAACCTGACACTGAACAGCA	3
ATGCCAACGAATCTGGACATAGGT	2
ATGCCAAGTTGTTATATGGTGGGT	1
ATGCCAAGTTGTTGTACCGTGGGA	1
ATGCCACAACTAGTATTTGATTGG	1
ATGCCACAGGACTGACGTGAGAAA	1
ATGCCACATCAACGCCACATAGGA	1
ATGCCACATCAATACATGGAATGA	2
ATGCCACCACTGATTAGGAGGTTA	1
ATGCCACCCGTATCTCAATGACGT	2
ATGCCACCCTATTTACACTTTCGT	1
ATGCCACCTGGACCCAACCACAC	1
ATGCCACGCGCAGATGTGCTAGCA	1
ATGCCACGTAAACCAAGAACGGTA	1
ATGCCACGTAGGATAGAGACCT	1
ATGCCACGTCAGATGAAGACCTAGT	1
ATGCCACGTCAGATGAAGACTGAG	2
ATGCCACGTCCTCATCCCAGATGG	1
ATGCCACGTCGATTCGTTGGTCAT	1
ATGCCACGTGGGATGAAGACCTAG	3
ATGCCACGTGTATGCCACATAGAC	1
ATGCCACGTTGGACAAAACCGC	1
ATGCCACTATAACTGTCATTCAAG	1
ATGCCAGAATGACTTACGCTGTGA	1
ATGCCAGATTACAACATATGTGCC	1
ATGCCAGCTCATAAGGAAGGACGG	1
ATGCCAGTGACGTTGTATTGC	1
ATGCCATCCCATGAGGTGGGCTT	1
ATGCCATCTAAGATTAGTGAGTCC	1
ATGCCATGGTACCTATCAATTACA	2
ATGCCATGTCCTATACGGAAATAAC	1
ATGCCATGTGTGAAGATGATGACC	1
ATGCCATGTGTGTATCGGGTTGTG	1
ATGCCATGTTGGACACCGCGGGAC	2
ATGCCATTAAAAAGAGATAGGTGA	1
ATGCCATTTATATGAAACAAGGAA	2
ATGCCCACCTACTTTCTTAATACC	1
ATGCCCAGTACCAAATATGGCACC	2
ATGCCCATGGTGAACTTAGTCAAT	1
ATGCCCCAACAGATTGATCGCTAG	1
ATGCCCCCAGGAAGAATTTCCCGA	1
ATGCCCGATTGAAATATGGTCGCA	1
ATGCCCGTGAGATTATTTGTGCCC	2
ATGCCCTCCTAGCCACTTGAATC	1
ATGCCCTCGCAAGCCTATATGTAC	1
ATGCCGAGATTTTAACAAGTTGAT	5
ATGCCGAGCCTCACGCCCAGCAAC	1
ATGCCGCAGGTTGGAGTCGATGGT	1
ATGCCGCATGTGGACAGGGGACGG	1
ATGCCGCGTCTAAGGGCGATGGT	1
ATGCCGCTGTGTACAACTGTAGTA	1
ATGCCGCTTGCAGATTGGTGGATC	4
ATGCCGGAAGGGGTGAGTGTGCGC	1
ATGCCGGCAAGATGGATCTAGCGC	1
ATGCCGGCCTAGTATTGCGAAGGT	1
ATGCCGGCCTTTATTAGATATGGA	1
ATGCCGGGTGACAAGATTGGACAC	1
ATGCCGGGTGACGAAGTTGGATAC	1
ATGCCGGTTTTGCGATGAAGTGAT	1
ATGCCGTGTGGGTATGGGGTAC	1
ATGCCTAAAATGCTGAGGAGCCT	1
ATGCCTAATAGATGTTACAAACTG	1
ATGCCTAATGCAGTAGCACACATG	4
ATGCCTAATTACTCTATGTTATCCAA	1
ATGCCTAGATTCATTTTGATATA	1
ATGCCTAGGTAGTTAATTACCAGC	1
ATGCCTATAATTCTATTGTTCTGG	1
ATGCCTATCGAGAAAAGTGATT	1
ATGCCTATCGAGAAAAGTGATTGG	3
ATGCCTATTATGCTAACACTTATA	3
ATGCCTCAACTTTGTGCATAGCAT	2
ATGCCTCTCAAGTTCTGGGATGAG	1
ATGCCTCTGAGATTTGCCCATTCC	1
ATGCCTCTGCTGCCATTCAGGAAT	1
ATGCCTGACCGCGTGAGCGACTGGG	1
ATGCCTGCGGTCAAACCGGTCCTA	1
ATGCCTGGTGCCCCCTGAGATGGA	1
ATGCCTGTGAGATTTGCTCATTCC	1
ATGCCTGTGGAGTGATATGTGCAC	1
ATGCCTGTGGAGTGGTGATCCC	1
ATGCCTTACTGGAATAGAGATGG	1
ATGCCTTACTGGAATAGAGATGGT	1
ATGCCTTATATTTTGGAATGGAGG	1
ATGCCTTATCTGTGGATGAGACTC	1
ATGCCTTGAGGCGACCAATTGCC	1
ATGCCTTGCGGTGATCCTAGAGTC	1
ATGCCTTGTTTTATAAGGGGGTGAT	1
ATGCCTTGTTTTATAAGGGGTGA	1
ATGCCTTTACACTGTTCGAATTGG	1
ATGCGAAAAGATGAGGCTGTATGT	1
ATGCGAAAATAGGCCCATTATCGC	3
ATGCGAAACTGATAGGTGTCCAAA	3
ATGCGAAAGATGGAATAGCGAACT	1
ATGCGAAAGGCAAAAGGTGCAGAC	2
ATGCGAACCACTTAAGGAGCCGCA	1
ATGCGAAGTGCGGGGGAGTTACCT	1
ATGCGACAAAGCCTGAGAGCCAAA	1
ATGCGACAGTGTCGAGGGGGGTCT	1
ATGCGACATGGAGGAGTCACTGGA	1
ATGCGAGCTGGGCCTACAACTTTA	1
ATGCGAGGGTGACCGAAAAACTGG	1
ATGCGAGGTACTAGAAGGTGGAAC	1
ATGCGAGTAGTACCGTCAAGTGAG	2
ATGCGAGTTGAGCCTATATCTCCC	1
ATGCGAGTTGCTCTTAAGGAAT	1
ATGCGATAATGGGCCTATTTTC	1
ATGCGATAATGGGCCTATTTTCGC	4
ATGCGATACTGGCAACGGTCCGA	1
ATGCGATATCTATATCTGTGCTAA	1
ATGCGATATGTGATTTGGTGTCAA	1
ATGCGATCAAACGTCTGATGTGAC	3
ATGCGATTACAACAGGCACGCCCC	1
ATGCGATTGTTTGATACATGTAGA	1
ATGCGCAACATATTGAACACGTAC	1
ATGCGCACGGGTGCAGTCGTCGTC	1
ATGCGCAGCCACGAAGGTGTTGGC	1
ATGCGCATGACAGGTGGGACCATA	1
ATGCGCCCCGCTGTCGAGTGGTAC	1
ATGCGCGGGGAGGAGCAAAGTTCT	1
ATGCGCTCTTAATATATGGCTTGT	1
ATGCGCTGGTACTGGACGGGTTAA	1
ATGCGGAACTTCCACTCGTCGG	1
ATGCGGACCCTTAAGAGACCTGCA	1
ATGCGGAGAGCGCTACGTGTCGGA	1
ATGCGGATACGAAGCCGGATGTGA	1
ATGCGGCCGGCAATTTTATCGCCA	1
ATGCGGCGGGGGACGGTTGGGGCG	1
ATGCGGCTCGCATCGTGCCGA	1
ATGCGGCTGACAACGATGTGGTAC	1
ATGCGGGCCTCTTAAAGATCTGCA	1
ATGCGGGCCTGTTAGGAAGTTCGC	1
ATGCGGGTCGCTGGTGGCAGCAAG	1
ATGCGGGTGTATTATCTAGCTAGA	2
ATGCGGGTGTTAAACATTCAATGT	2
ATGCGGTAGCTGATGGTGGAACAC	2
ATGCGGTGCAGCCGTTGACGGTGG	9
ATGCGGTGTCAAAAATGGAAACCA	1
ATGCGGTGTGCAAAGTGGTTGCCT	1
ATGCGGTTCTTTAGGGTGTTG	2
ATGCGTGCATATACTGTGTGGGT	1
ATGCGTGCGAAAAACAAGGAATGT	1
ATGCGTGCTTTGGGCTTGCATGAC	1
ATGCGTGTGTTGTGGTGTGTGTT	1
ATGCGTTGTGAGTGTCTGCGTTGT	1
ATGCTAAAAAGTTATTGATGTTAA	1
ATGCTAAAACATGTGCTACCCTAT	1
ATGCTAAACATTAGCCTAGGGTGG	3
ATGCTAAACTGACGCGTGGTAGAC	1
ATGCTAATTACTAGGAAAGGGTGT	1
ATGCTACAATGGTATATACGTGCG	1
ATGCTACTAACGTGATATCAGCCA	1
ATGCTAGAAAGTCTTGTAATCTGA	1
ATGCTAGCGCCGCCTCATCCTTGC	1
ATGCTAGTGTGGGTGGCATGGC	3
ATGCTATAGTAAACATTAGGGCCG	1
ATGCTATCGTAAATATTGTATGG	1
ATGCTATGCTATGTACACGTCCA	1
ATGCTATGGGCTAGATGCTGCTGC	1
ATGCTATTGTGCGTAGGTGGGACT	2
ATGCTATTTGACGTTGAGGTGTCT	1
ATGCTATTTGGCGCTGAGGTGTC	1
ATGCTATTTGGCGCTGAGGTGTCT	1
ATGCTCAATTTTCCTTATCTTCAG	1
ATGCTCATAGGGGTAGGATGTGCG	1
ATGCTCATCAATCCATTGTGTGTC	1
ATGCTCGCACTTACGCGTGGTGAC	1
ATGCTCGCCAACGGAAAACTACCC	1
ATGCTCGGTGCTTGCTGGATCTAG	4
ATGCTCGTGCGTTGTAACAGCTAGA	3
ATGCTCGTGCTTGTTGTTGGTTCC	1
ATGCTCTACCACAGGCCCAACCGG	1
ATGCTCTGCCGCCTCACACTCATG	1
ATGCTGAATAATGTAGATGGATCA	1
ATGCTGACTGGAGTGCCACGCGTA	2
ATGCTGACTGGGTTGTCACGCGTA	2
ATGCTGAGCCACATGGTGATCAGC	2
ATGCTGATGAATTGCAATGGTGTT	1
ATGCTGATGGCTAACCTGGTGAT	1
ATGCTGATGGTAGCTGATGGCCTC	1
ATGCTGCACAAAGTGCCATCT	1
ATGCTGCAGAACTCGATGCGGC	2
ATGCTGCGGTCCATCCAATGGTTG	1
ATGCTGCTGCGTTAGGAGATGGAC	1
ATGCTTAAAGAACATTGGATGACG	3
ATGCTTATCCAACTTGGTGGCTGA	1
ATGCTTATGGCTAGTCCTTGTGCA	1
ATGCTTCAAGTGGCTAGGAGGGCA	2
ATGCTTCAAGTGGCTAGGTGGGCA	1
ATGCTTCATTTTGCGTGCTGGGAC	1
ATGCTTCGAGTGGCTAGGAGGTCA	1
ATGCTTGGATGTCGGCCAGCTTCT	1
ATGCTTGGGAGAAATTGAGGTCTA	1
ATGCTTGGGAGTAACCGCGAA	5
ATGCTTGGGCTGTAGGTGCACCTT	1
ATGCTTGGTTGTGGTAAGTATGGT	1
ATGCTTTACGCTATTCTGATGG	2
ATGCTTTACGCTATTCTGATGGCC	1
ATGCTTTAGGGAAAAATCGGATGC	1
ATGCTTTTGAGGATGCTCGAGGAG	1
ATGGAAAAACATAAATGATGCCTA	1
ATGGAAAAGCTGGCTTACGCCTTG	1
ATGGAAAATGCTAGAGTGACTTAC	1
ATGGAAACCGGTTTTTGGACACGA	1
ATGGAAACGACAAGGACTACTCGG	1
ATGGAAACTATAGTGCTACTGAGC	1
ATGGAAACTCCATCAACCACGTGC	1
ATGGAAAGAGTGACTGTTGTGCTA	1
ATGGAAAGCGAATATGGTGTCA	1
ATGGAAATGAATAGTCCTGGATGC	1
ATGGAACAATGCTTAAGATGTGAA	1
ATGGAACACGACACACCGGCTACG	4
ATGGAACACTTTATAGTACAACGA	1
ATGGAACAGGCCTACAAATAGGAG	1
ATGGAACCAAACAGGACCCTA	2
ATGGAACCGACTTATAGTGACAA	1
ATGGAACTAAACACAGCCTATGGA	1
ATGGAAGCAAGTACTACAGGT	1
ATGGAAGCTGGTATGGGTCCGGAC	2
ATGGAAGGCTATTTACCAAGTGA	1
ATGGAAGGTGCGGGTACTGCTGTT	3
ATGGAAGGTTGTGATTGGTTGGGA	1
ATGGAAGTAATGCACGAACGTAA	1
ATGGAAGTATAGATTTGAGGTAGG	1
ATGGAATAGTGGTGTTTGCATTAG	1
ATGGAATAGTGGTGTTTGCATTGG	1
ATGGAATATTGGTGTTTGTATTGA	1
ATGGAATGAAGCGATGGTGTACCC	4
ATGGAATGAGTGGAACTGGTCGCA	2
ATGGAATGCCTGAATGTTTCGATA	1
ATGGAATGCTTTCGACATGTAGGT	1
ATGGAATGTGCTAGTGACGAATAG	2
ATGGAATGTTGATAGGGTGAA	1
ATGGACAAAGTTGGGCCAGATTGC	1
ATGGACAAGTACTATGATGTGTTA	1
ATGGACAATGTTGTAAAGGAA	1
ATGGACACCGTGGAGAAATGG	1
ATGGACACCTGATTGAATACTGCA	3
ATGGACACGAAAGATTCAGTGAGC	1
ATGGACACTATGAGTTGGGACTGC	1
ATGGACACTATGGGTTGAGACTGC	1
ATGGACACTATGGGTTGGGACTGC	1
ATGGACACTCCATCACTACCACGA	2
ATGGACAGAGTGAAGTCCGGTGTC	1
ATGGACAGAGTGACACATACATCC	1
ATGGACATAAGCCTAAGCCAACAA	1
ATGGACATCTTATTGAGGACACTA	3
ATGGACATGCCTTTACCAGGA	1
ATGGACCAAAAGTGATGTGGTGAG	1
ATGGACCCACTGCCAACCTCTGCC	1
ATGGACCGAGATGACACAGCGATA	1
ATGGACCGCAACGAAAATGAG	1
ATGGACCGCACATACCTTCGGGTC	1
ATGGACCGCATACGAAAACCTATG	1
ATGGACCTAAAGAGGTGTAAGTAG	1
ATGGACCTAATGGAAACTGCA	1
ATGGACCTAGATGGCACATCCCTA	1
ATGGACCTATAATCATTGTTA	1
ATGGACCTATCATGATTGAACGGT	1
ATGGACCTGTCGAGATCAGAGATG	1
ATGGACGATACATATGCAGGGTAC	1
ATGGACGCTTGTGCCCCTGGCTGA	1
ATGGACTACACATTGTGGATGCCC	1
ATGGACTACCCTTTGGGTTCGCCA	1
ATGGACTGTGATACGCTAGGT	1
ATGGACTTAGACTGGTGTAACGCA	1
ATGGACTTCCAAAGGATTGTAAAG	1
ATGGAGAAATATAGGAAGGGCCAG	1
ATGGAGAACCGATTGATGTAGTGA	2
ATGGAGAATCTGGATGATGGGACT	1
ATGGAGAGGATCGCGGCGGGGAAG	1
ATGGAGAGGTATATGCCGCTGAAT	3
ATGGAGAGTGACCTGGACAGAGAC	1
ATGGAGAGTGCACCATGTTGGCGG	1
ATGGAGATGAACTGAATGCTC	1
ATGGAGATGATTGAGCTAATCCCA	1
ATGGAGATGGATGGAAAAAGTGAC	1
ATGGAGATGTTAGTTAGACTTTAA	1
ATGGAGATTAAGTGTTTTACGTAA	1
ATGGAGCCACCTATATATAGGTAC	1
ATGGAGCCCGTCACCGATGAGTCA	1
ATGGAGCGAATTTTAGATTGGGTT	1
ATGGAGCGCTCGGGTTGAAAGCCA	1
ATGGAGCTCTTGATGGACGCC	1
ATGGAGCTGAAACCGTTAGGTGAT	1
ATGGAGCTGAAACTATTTGACTGA	1
ATGGAGCTGAAACTGTTTGGCTA	1
ATGGAGCTGAAACTGTTTGGCTGA	1
ATGGAGCTGAAGCCCTGCTAGGATC	1
ATGGAGCTGGAGCTGTGATAAATA	1
ATGGAGCTGTGTTTGAGGGCTA	1
ATGGAGGAGATTGTGATGTGTCCA	1
ATGGAGGAGCAGAAGTCTAGTGCG	1
ATGGAGGAGGGTATCGGACGGTGT	2
ATGGAGGAGTGATGAGGACACAAC	1
ATGGAGGATCCCTAATAGAGAGTA	2
ATGGAGGATGGAGAGGGTGTA	1
ATGGAGGATTTTCGGGACGGAGGA	1
ATGGAGGCCCAAGGATTCAGTCG	1
ATGGAGGCCGGCGGAGACACAAGC	1
ATGGAGGCCGGGTCACCATCGT	1
ATGGAGGCTACCGACTAGTGATGA	1
ATGGAGGCTAGCTTGATTGAGAGG	1
ATGGAGGCTGCCGAATAGTGACGA	1
ATGGAGGGAGTACATGGTTTGCAT	2
ATGGAGGGAGTTTCGGAT	2
ATGGAGGGATATGGGTGGATAGG	1
ATGGAGGGCGACAGAAGGTGGAGA	2
ATGGAGGGGCATTATTGTTAGAAA	1
ATGGAGGGTATCCCTGGATGGGCT	1
ATGGAGGGTGCTATCATGATACAG	2
ATGGAGGGTGTGGCGCAACTCGCC	1
ATGGAGGTATGTGGGGCTTAT	2
ATGGAGGTGAATTCTGAGCTTA	1
ATGGAGGTGCATGCGCTCACGCTTC	2
ATGGAGTAGCTGATGGGGGACTCA	1
ATGGAGTCTCATGTGTCTTATGGT	2
ATGGAGTCTTCGCCAACTTGATGT	1
ATGGAGTGACTTGAGTAGCCAAAT	1
ATGGAGTGGGATGCCATCATCAGC	2
ATGGAGTGTCCTGATGAAGTCCCA	1
ATGGAGTTCAGCCGTAGCCTAC	1
ATGGAGTTGCCTAAACCTATCTCC	1
ATGGAGTTGCTTTACAGGTTGATG	2
ATGGAGTTGGGTCAACCGGGGTGT	1
ATGGATAAAATTAGATGTGACAAC	1
ATGGATAACCGCCATATGGATGG	1
ATGGATAATTCTGTTTTACGTGCA	1
ATGGATACTATAGGTTGAGACTGC	2
ATGGATAGGCTATGGTTATGGT	3
ATGGATATGCCTAACTCTAGCTCT	1
ATGGATATTACCAATTTGAGTGTTA	2
ATGGATCATCATGTGCAACTTCAA	1
ATGGATCGCTTCGTCTGATGG	1
ATGGATCTGTACTATATGAGAGCG	1
ATGGATGAAATAGCGAGGTTC	2
ATGGATGAAATGTGTCGGCTAC	1
ATGGATGACCCGATTGTGGGCCTT	1
ATGGATGATCTATTAGATTGGCTA	1
ATGGATGCATGGTTCGATTACGAT	1
ATGGATGCCGCGATGAAATGAG	1
ATGGATGGCTGAGATGATGTGCAG	1
ATGGATGGGGATTCACAAATAGA	1
ATGGATGTGATGAAAAGTTGAGAA	1
ATGGATGTGTAGCTAAGATGAAGG	2
ATGGATGTTTTGAATGTGATGTGA	2
ATGGATTAGTGCATGATTAATTAA	1
ATGGATTCACCTGCGAGATGAC	1
ATGGATTGATGATTTTATCAGTGA	2
ATGGATTGGGACTACCCTTAGAGC	1
ATGGCAACATGTGTGGAATCGT	1
ATGGCAACGATAACAATAGTGCGC	1
ATGGCAAGCCACACTTTCTTACCA	1
ATGGCAAGTAGCACTATTATCAAG	1
ATGGCACCAGGTTTTCTGTTGCAG	1
ATGGCACCTAGGTGTAAGAAAGTG	1
ATGGCAGCCTATATCTATTTTGAA	1
ATGGCAGCTAAGACGATTGAG	1
ATGGCAGCTGACTGTTTTGGGGT	1
ATGGCAGCTTACATGGAATAAATA	1
ATGGCAGCTTGCTAGGGTGGGAGG	1
ATGGCAGGATTGATTATGTGCCTG	1
ATGGCAGGTAGGGCCGTAGGGGGC	1
ATGGCAGGTGAAGGTAACATGCCA	1
ATGGCAGTGGTGCGGGTGATGGCA	1
ATGGCATAAGGTGCATCTAGAATG	1
ATGGCATACGGTGGATGGACATC	2
ATGGCATAGCTACAAATAGACGAA	1
ATGGCATATGTGGTATAAAATCCG	1
ATGGCATGACTACATGGTATTCCT	1
ATGGCATGCCACGTAAGACCATGG	1
ATGGCCACCGCCTTTGATCATGTA	1
ATGGCCACCTGCAAAAATAACAAC	1
ATGGCCACGAACGCTTCGGCGATG	1
ATGGCCATGTGTGGGTGACTTTGT	1
ATGGCCCGCCTGGAAACAAACAGA	1
ATGGCCCGTCACGGATGATGGTCA	1
ATGGCCGAATATAACACAATGGTT	1
ATGGCCGATTGCTCACATACTTGG	2
ATGGCCGGTTCTTAAACTTGTGAG	1
ATGGCCTATTATACAAATAATTA	1
ATGGCCTATTATATGTGCCTTGG	1
ATGGCCTATTTTTGATTAAAGTTT	1
ATGGCCTCACCTTTTGATGGGTCC	1
ATGGCCTCTCGAAGAAAGCTGTGC	1
ATGGCCTGCATTGTAGATGTGAGT	2
ATGGCCTTACACACTCTTTAGTAC	1
ATGGCGAACAAACATTGATATGAA	1
ATGGCGAAGTCGAAGTTGAGTTGA	1
ATGGCGAATCGTGATGGGACCGTC	1
ATGGCGACCAACTACTACTTTGAC	1
ATGGCGCATATATGGATGGTTCAC	1
ATGGCGCCATAAATATAGCTACAC	1
ATGGCGCGGTGTAGGTATGTTCTC	1
ATGGCGCTGAACTTAGATACCTCA	1
ATGGCGCTGAATGTACGTTGGCAC	1
ATGGCGCTGGGAACTTTATTCCCG	2
ATGGCGCTGTGTGAGATGGGCCCA	1
ATGGCGCTTGAGGTGACCTGTACC	1
ATGGCGCTTTAATAAAATTGTGAA	1
ATGGCGGAAAACATGATGGCGA	1
ATGGCGGCGACTGCTCGGTGGTGG	2
ATGGCGGCTTACAAGAGAATCAAA	1
ATGGCGGCTTACAAGAGAATCAAG	1
ATGGCGGCTTACAAGAGGTATATA	1
ATGGCGGCTTAGGAGTGTTTGTA	4
ATGGCGGGCGAGGGTGAGTTCTGC	1
ATGGCGGTGAACTACTACCCACA	1
ATGGCGTAATCGATATTGTACTAT	1
ATGGCGTCATCTATTAAAAAACGA	1
ATGGCGTGCAACATTCTTGCCCAA	1
ATGGCTAAGTAGGAACGATATGGT	1
ATGGCTAATTATTCTTTCAGTGGA	1
ATGGCTAGCTTTTGGGGTGGAAAA	1
ATGGCTAGTCATAAGATCTTATGG	1
ATGGCTAGTGTCTTGGGTTGGGAA	1
ATGGCTATACTGTTAGAGGAGTGG	2
ATGGCTATGATGATTTGGCTG	1
ATGGCTATGGGTTTGCCCACAAGA	1
ATGGCTCAAAGCCGTGAAGTGTAA	1
ATGGCTCACCTCATTTTACGTATC	2
ATGGCTCCTTGTGTCACAGTACAC	1
ATGGCTGAGGGACACCAATATGTG	1
ATGGCTGCACTTAAAATGGGACAA	1
ATGGCTGCACTTGTAGTGAGATGG	1
ATGGCTGCATCTGGTTGAAGGGTA	1
ATGGCTGGTCTGATGGTAGACGAC	1
ATGGCTGGTGCCAATGCGTTGCCC	1
ATGGCTGTGGGGTTTTTAACCGGG	1
ATGGCTGTTGACGAAAAATCCGCGCC	1
ATGGCTTAGTACAAATGATAGTGT	1
ATGGCTTGCTCTTTGGTGGAATCG	1
ATGGCTTGTCCCATACGGTGTCTA	1
ATGGCTTGTCTTGTTTTGTGTGC	2
ATGGCTTTGCAGGAATGATATGGT	1
ATGGGAAAAGACAAAATCATGTGT	2
ATGGGAAAAGTTGCGAGATAGATT	1
ATGGGAACGATGCGACGGAAAAGT	1
ATGGGAATAGCAAAATGCCCGTGC	1
ATGGGAATGGTTACCTGAGGTTGC	1
ATGGGACAAGGGGGGAATGGATGG	1
ATGGGACACATACTAATACAACGA	1
ATGGGACACATTGTATTGAGCCTC	1
ATGGGACACCCGAAGAAATTAGAC	2
ATGGGACACTACATTGTACAACGA	1
ATGGGACACTCATATGGGGCAC	1
ATGGGACAGAGGGACTACGTGTGG	1
ATGGGACATAAGATTGGTGTTGCA	1
ATGGGACATAATCTAATACAACGA	2
ATGGGACATCACATCTGGAGTCG	5
ATGGGACATTTCATAGTACAACGA	1
ATGGGACCACCTGTGAGACTCTTA	2
ATGGGACCATGTATTAATTGTGTA	3
ATGGGACCCACCAAACGGCTGTCA	2
ATGGGACCTAACTTGAACGGTT	2
ATGGGACCTAGGAATGCGAGGCCA	2
ATGGGACCTAGTTGTGGAGATCGG	1
ATGGGACCTATGTTGCACCGGGTA	1
ATGGGACGAATCTACTTTTAGAGG	1
ATGGGACGTATCCCAGTACTACAA	1
ATGGGACGTATCCTAGTACTACGAG	1
ATGGGAGAATAGCCACTATGGTCC	1
ATGGGAGCGACCTGGGATCGAGC	1
ATGGGAGGAATTTCAAAAGTGTGC	1
ATGGGAGGCGCAATTATTTAGTAC	1
ATGGGAGTCTATGATATCTGGGAG	1
ATGGGATAAGCTTATTTGATTGGT	1
ATGGGATACTTCATATTACAACGA	1
ATGGGATACTTCCTAGAACAACGA	1
ATGGGATATTCCCTTAAGGTATGA	1
ATGGGATCTTATGTCTGCGCC	1
ATGGGATGACCCATCCTAGGTTGC	1
ATGGGATGACCCGATAAGGATTGC	3
ATGGGATGCCCTGTACATGTGTAA	1
ATGGGATGGCAGCGAGAATTAGGG	2
ATGGGATGGCTGTGGCGTAATTAA	1
ATGGGATGGGTGTCTTAGGACCAA	1
ATGGGATGTCCCTAAAAAGGTGTT	2
ATGGGATGTTGATGTTGATGAAAA	1
ATGGGATTCCTACAAACGCTCCTA	2
ATGGGCAAGGCTAAAAGGTGGAGA	1
ATGGGCAATGCTACAAAATCTTAT	2
ATGGGCAATGCTAGAAAGTCTTA	1
ATGGGCAATGCTAGAAAGTCTTAC	1
ATGGGCACATTTGCATAGGTA	1
ATGGGCACCTCCCAGCAAGCGCCA	1
ATGGGCACGATGATGTCGGATGCG	1
ATGGGCACTATAACAAGAACGTTG	1
ATGGGCAGAGAAGGAAGTCTGCGC	1
ATGGGCAGCCCATATGTTTATGGA	1
ATGGGCATCTACATGGTTGAGTTA	1
ATGGGCATGGGCAACCATCCTTAC	1
ATGGGCATTGATGACAGTATGGTC	2
ATGGGCCAATTAAATAGGTGGTCC	1
ATGGGCCACAACTGTGATGGGCCA	1
ATGGGCCACATGATGGCTGGC	4
ATGGGCCATAGCAAAGTGGGACTC	1
ATGGGCCCAATGGATTGGTTTCAG	1
ATGGGCCCATCAAGACAAGGAGTA	1
ATGGGCCCCAAAATCATAGATACG	1
ATGGGCCCCACTATATTACGGAGA	2
ATGGGCCCCCCGAGATATGTTGGG	1
ATGGGCCCGTAGATTCAGAGTGTA	4
ATGGGCCGAAACTGATGTGAGGAG	1
ATGGGCCGGTATGACAACGACGG	2
ATGGGCCGTAGAGTAGGATGGTTT	1
ATGGGCCTCTAAAAATTAGGGG	2
ATGGGCCTGCTAATGCGCAGATGG	1
ATGGGCCTGTTCACTTTGATGCCA	1
ATGGGCCTGTTCAGATTGATGACA	1
ATGGGCGAAAAATTGGTGAGCTGA	1
ATGGGCGAAAGCCATGGCCTGAAG	4
ATGGGCGACATGATTTGAACCTTG	1
ATGGGCGCTGGTAACGTATTACGT	1
ATGGGCGCTGTGTTGATCTGT	1
ATGGGCTAACTACAAAGCGCGCCA	1
ATGGGCTAGAATAGTAATTATTAG	1
ATGGGCTAGACGACCTGGATTCGA	1
ATGGGCTAGACGATTTGGGTTCGA	1
ATGGGCTAGCTACGTGCTTCTGGA	1
ATGGGCTATGTACATTGTTGATGC	1
ATGGGCTGACATGTAGAATACGGT	1
ATGGGCTGAGTTAAGACGGTCCCA	1
ATGGGCTGAGTTTATGGGCCTTCT	1
ATGGGCTGCCAAGTTGAGGATTGC	1
ATGGGCTGTAAGCGATGTAGTAGT	1
ATGGGCTGTCTATCTAGATTCGTAG	1
ATGGGCTTAATGATGATGCTGGCT	2
ATGGGCTTCTAAAATATACTATA	1
ATGGGCTTCTGATGGGTTAGGCTA	1
ATGGGCTTGCCAACGTGGAATGGG	1
ATGGGGAAAGCGATAAGGAGCCTG	1
ATGGGGAACGCACATGTTGTCTAT	1
ATGGGGAATTCCTAAAGGCTGCAT	1
ATGGGGACCTTACAAATGAAACAT	1
ATGGGGAGATATGATAGGATGG	2
ATGGGGAGCCTCAAGAACTACACC	2
ATGGGGCAAATCTTACGAGCCACC	1
ATGGGGCAACAATGATGATGGCTC	2
ATGGGGCACCTTATACGTGATTGC	1
ATGGGGCCATGGTGGCGACTCGAG	1
ATGGGGCCCTGGAAGGGAAAAGGA	1
ATGGGGCCGGGTGTAGATCTCCTC	1
ATGGGGCCGGTTGGTGCTAATAGA	1
ATGGGGCCTGTAATACTAAGATGT	1
ATGGGGCTAATTTTGTGTGAGGAC	2
ATGGGGCTAATTTTGTGTGGGGAC	2
ATGGGGCTGAACACATAAAAGGTC	1
ATGGGGCTGTGGGACCGCCTCGG	1
ATGGGGCTTGTGTAAATGTAGCAA	2
ATGGGGGCCCTAATGATTCATTAG	1
ATGGGGGCTATTGCTGGAGATGAT	2
ATGGGGTAGCGGCATGGATGTAGC	1
ATGGGGTATGTCTCATGGGTCCT	3
ATGGGGTCATTACAATACGGGTAG	1
ATGGGGTCTATAGAAAAGATGTC	2
ATGGGGTCTTCGAACACTAA	1
ATGGGGTGACGGGCAAGACAGAGA	1
ATGGGGTGATCCATTAACACGTGA	1
ATGGGGTGCCAGACTGTGAAGCGG	2
ATGGGGTGCCATGTATAGATATA	1
ATGGGGTGTCAGATGGGACAT	2
ATGGGGTGTCATGTATAGATAGAA	1
ATGGGGTTGCCTATCTAACTGTTA	1
ATGGGGTTGCGTATGTAGTGATGG	1
ATGGGGTTGCTGCGAGCCTGT	1
ATGGGGTTGTTTGGTTGATGGCTA	1
ATGGGTAACTATGGTATGAATTGG	1
ATGGGTAATCCTATGCACATTTTGG	1
ATGGGTACACCTAAAATAGGACGG	1
ATGGGTACCATTGACGATACCTAT	1
ATGGGTACGGGCACAGAGTTTTGC	1
ATGGGTACGGGCATGGAGTTTTGC	3
ATGGGTACGTCGTTTACCATTGAA	1
ATGGGTACTATGGGTTGGGACTGC	3
ATGGGTAGCCCATATGCTTATGGA	2
ATGGGTAGCCTATCTAACTGTTGT	1
ATGGGTAGCTGGCTATATGGATGT	1
ATGGGTAGCTTCAAGGGTTGAGCA	2
ATGGGTAGGCTGAGAGAAGGCTAT	2
ATGGGTAGTCCATATGCATATGGA	1
ATGGGTAGTCCATATGCATATGGG	3
ATGGGTAGTCCATATGTATATGGG	3
ATGGGTCAAGAGATGCGTGAGCGT	2
ATGGGTCAGAACTCATGGGTCCT	1
ATGGGTCCGTAATAGGTGAGGTCC	2
ATGGGTCGACCGACTAAAGATGGT	1
ATGGGTCTACTGACGGGCGAAAAC	1
ATGGGTCTCATCCCATTATGGGAC	1
ATGGGTCTGGAGTGGAGTTGTGGA	1
ATGGGTCTGTTTGGCACAGCTCCAG	3
ATGGGTGACCGACCGGGAAATTCT	1
ATGGGTGATGGATTGTGGACTTTTGA	1
ATGGGTGCAATTTACTTCCTAGA	1
ATGGGTGCATCCGGTCGAATTGGT	1
ATGGGTGCCCTCACTAACTGAGGG	1
ATGGGTGCGGGCACAGAGTTTTGC	1
ATGGGTGCTATAGCATATAGGTGT	2
ATGGGTGCTCATGGCTCTGGCTTC	2
ATGGGTGCTTCGGGGGTATCCATA	1
ATGGGTGCTTGCACTATGGGATGG	1
ATGGGTGCTTGCACTGTAGGGTGG	4
ATGGGTGCTTGCACTGTGGGGTGA	1
ATGGGTGCTTTCACTGTGGGGTGA	2
ATGGGTGGACATCATGACGACGTG	1
ATGGGTGGATACCGAACTGGCTCG	1
ATGGGTGGATGGGCTTACAAACCC	1
ATGGGTGGCCTGAGCATTTCGCTC	1
ATGGGTGGGCCTTTTGGTTGATCC	1
ATGGGTGGGTAAACAACGGATCCA	1
ATGGGTGGTAGACATTAGTGATGG	1
ATGGGTGGTCGCCAATCGAACGGA	2
ATGGGTGGTTCTGGGAACGGTAAGC	2
ATGGGTGTAGAATAGTTATACTAT	1
ATGGGTGTAGTTAGAAGTTACTA	1
ATGGGTGTATGATATATGGGACCA	1
ATGGGTGTCATAGCACTTAGGTGT	1
ATGGGTGTCGGTTCTAAAAGACCA	1
ATGGGTGTCGTCTACGAAAATTGT	1
ATGGGTGTCTAAGTTTGTATTGAG	1
ATGGGTGTCTAGGTTTGAACCGA	5
ATGGGTGTCTAGGTTTGAACCGAG	20
ATGGGTGTCTGTATTCGTAGCTAC	1
ATGGGTGTCTTGCATTGTAGATG	1
ATGGGTGTGCTGTTCAGTGTTGA	1
ATGGGTGTGCTGTTCAGTGTTGAT	1
ATGGGTGTGTACCTCTTTATGAGA	1
ATGGGTGTGTTTAGTTCATGCTAA	1
ATGGGTGTGTTTATTTCACGTCA	2
ATGGGTGTGTTTGGTTGCAAGCCA	1
ATGGGTGTGTTTGGTTGTAAGCC	2
ATGGGTGTTAACAGATACTAG	1
ATGGGTGTTAGACTGATCTAGGT	1
ATGGGTGTTATATTATAGGTGTCA	1
ATGGGTGTTGGCCGCTAGGTTTGA	1
ATGGGTGTTGGCTCTCATGCAA	1
ATGGGTGTTGGGAAACTCAAGTCC	1
ATGGGTTAGGTTGACTGGTGGAGG	1
ATGGGTTATCATGCTAGTCTATCC	1
ATGGGTTCCATACTACGACTATGA	2
ATGGGTTCCATGGTATCCAATTAC	6
ATGGGTTCCTAACCCAGGTTGCCA	1
ATGGGTTGATGTGACGGAAAAGG	1
ATGGGTTGCCGATAACAGAACAAT	1
ATGGGTTTGCTACTGATATGG	1
ATGGTAAAAAACGAGATTACACCA	1
ATGGTAAACCTGTGTCGGCTTT	1
ATGGTAAAGTAAGGTGCTATCTAT	1
ATGGTAACGTGCGTAAGGAATGAG	1
ATGGTAAGGCCCATTGAGCTGC	1
ATGGTAAGTCGCTATACGATTACA	1
ATGGTAATGGATGCCAATCAT	1
ATGGTACAACTCAGGACGCACACA	1
ATGGTACACTATTAATATCTGGTC	1
ATGGTACAGGCACGAGATTGTTCG	1
ATGGTACCAAGCCTGCGTTGATG	1
ATGGTACCCCATATGAGTGTCCTA	1
ATGGTACCCTACTCCTGTGTTCTC	1
ATGGTACCTCTTTAAAAACGGTAA	1
ATGGTACTGAAGGGCAATACACGA	1
ATGGTACTGTTTACACGATTGATA	1
ATGGTACTTCGAAACAAGGTTGCA	2
ATGGTAGACGCACATGCATACACA	1
ATGGTAGAGCAAATGTTAGAA	1
ATGGTAGATGATGAACTAAGGTGCT	1
ATGGTAGATTATGGTAGAGGACG	1
ATGGTAGCAACTATGAGTACACGC	1
ATGGTAGCCTCTAATTGACGTAGA	1
ATGGTAGCCTTGGTACATGGTCTC	1
ATGGTAGCGATACTCAGTGTCGG	1
ATGGTAGCGTATGAAAACAGATGG	1
ATGGTAGGAGTTACTGGTATT	2
ATGGTAGGCTAGACGACCTGGGTT	1
ATGGTAGTGCCATTATAGTAGAGG	2
ATGGTAGTTAATTTTATGGTCTA	1
ATGGTATACAAAGCGTATGATGGA	1
ATGGTATACCTCACGATAATCATA	1
ATGGTATATGGTGGGTCATGCCGA	1
ATGGTATCTACTCCAGGACCGTA	1
ATGGTATCTTAGAGTTTGTTAGAG	1
ATGGTATGCACGAAACGAGAGGAT	2
ATGGTATGGATATAGAGATATAAG	2
ATGGTATGGTGGACCGCCGAGTAG	1
ATGGTATGTCTACATGGGTATCTA	4
ATGGTATGTGATGGGCCCTGCCGA	1
ATGGTATGTGGTGGGTCCTACCGA	1
ATGGTATGTGGTGGGTCTTGTCGA	1
ATGGTCAAACACGTATTAAAAGGT	1
ATGGTCAAACATTTTTAAAAAGGT	1
ATGGTCAAACGGTGATTGAAAAGT	1
ATGGTCAAACGTTGAACACGGATA	1
ATGGTCAAACGTTGAGCACGGATA	5
ATGGTCAAACGTTGTGCACGGAAA	1
ATGGTCAACACAGATTGGTGGCAG	1
ATGGTCAACGGTTATGATTGGTTGG	1
ATGGTCACGCCTTCAATACACTCA	2
ATGGTCAGCCCGATAGCGACCGCC	1
ATGGTCATCTCACCACTGGGGAGG	1
ATGGTCATGACGGATTGTCGTAAG	1
ATGGTCATGATGGGCTGTCGTAAG	3
ATGGTCATGTGGTGGCCTATGCCT	1
ATGGTCATTGACATGTAGAACCCA	1
ATGGTCCAAAATGCAAACAGATCC	1
ATGGTCCACATATCAGTGACTTA	1
ATGGTCCACCTACAAAGATAGTT	1
ATGGTCCACTATTCATAGGGCCCA	2
ATGGTCCAGATTGGTACTCGGGGA	1
ATGGTCCATCTATATGTAATATGT	1
ATGGTCCCGATCTCCCGGTAGGTA	1
ATGGTCCGCCTATAAACTATATGG	1
ATGGTCCGGTGAAGTGTTCGGA	1
ATGGTCCGTTTGCAAAAATCAAGG	1
ATGGTCCTGCTTGTCATACACACA	1
ATGGTCCTGTTTGGGGGAGCTT	1
ATGGTCGAAGCGAATGAACTGCTA	1
ATGGTCGACACGATCGCTACGGCG	2
ATGGTCGAGAATTGACGGAAGTGC	2
ATGGTCGCACATACATGTTAGATG	1
ATGGTCGGTGACGACATGGTAGCC	1
ATGGTCGTGCTCTGAATTTTGGGA	1
ATGGTCTATCTACGTATATTTGCT	1
ATGGTCTCAATGTTGCATTTTATA	1
ATGGTCTCACGTGTCATACACACA	1
ATGGTCTCCGAGATGCTATTTTGA	1
ATGGTCTGGGACCTAACCTGGTGT	2
ATGGTCTGGGACCTAATCTGGTGT	1
ATGGTCTTGCTTATGTGGTATGTC	1
ATGGTGAAAACCCTGAACAGCGG	2
ATGGTGAAAATAGATAAACTATAG	1
ATGGTGAAAATAGATGAGGTATA	1
ATGGTGAAAATAGATGAGGTATAG	1
ATGGTGAAAATAGATGAGGTATAGC	1
ATGGTGAAAATCGGTGAGTTATAG	3
ATGGTGAAACAAAGAAAACAACAA	1
ATGGTGAAACGTTATGCGAAAGGG	6
ATGGTGAAATAATTGGTTAGG	1
ATGGTGAACCTGTGTCGGCTTTCG	1
ATGGTGAACTATGCCTGAGCGGGGCG	1
ATGGTGAACTTTGGGTGCTATTAA	1
ATGGTGAAGGATATGGTAAAGGTT	1
ATGGTGAAGTTAACGGTGTTAAGT	1
ATGGTGAATAAGAGCAACGATCGG	1
ATGGTGAATAAGAGTAATACCGGC	1
ATGGTGAATACTACTTGCTGTATA	2
ATGGTGAATATTGCTAGGCCAATG	1
ATGGTGAATCGAGCGAAGCAGGCA	1
ATGGTGAATCTCTTGGATGACATT	2
ATGGTGAATGGGTTGATGCCCTAG	1
ATGGTGAATTCCATTTGGGACGC	1
ATGGTGAATTGAGGAAGGAACTCC	1
ATGGTGAATTGTCTCTACAAACGA	1
ATGGTGACACACTCTCAATACTAG	1
ATGGTGACAGACAATAAATGTGCA	3
ATGGTGACAGATATGATTCACAAG	1
ATGGTGACATAGGGTGAATCTCGG	1
ATGGTGACCGTAGAAACTAACA	1
ATGGTGACCTGAGCAGGTTTTGTG	1
ATGGTGACGCAGGTGTTTATCCTA	1
ATGGTGACGCCTATGTGTTAGTGG	1
ATGGTGACGTAGATGAATCTCAGA	1
ATGGTGACGTGAATGAATCTCGGA	2
ATGGTGACGTGTCTGTGCGGACAC	1
ATGGTGAGCCATCTGGTGTATCC	1
ATGGTGAGTTATAAGTCTACTATA	1
ATGGTGAGTTCTATGAAGATTAGG	1
ATGGTGATACCGCGTTGTTGGG	1
ATGGTGATAGATAGTTAAAGAGTA	1
ATGGTGATAGCTCAGTATGGGTAT	1
ATGGTGATATAAGTGCATGCACAA	4
ATGGTGATATATATGGATTGT	4
ATGGTGATCTAGATTTTTGTTTGG	1
ATGGTGATCTAGTGGAATACGGAA	2
ATGGTGATGAAGATAAGTGCAACA	1
ATGGTGATGATGGTATCCTAGAT	1
ATGGTGATTACTAACTGAGGGTCT	1
ATGGTGATTAGTTGTGTACCGATA	2
ATGGTGATTCAAACGTAAAAAGTA	1
ATGGTGATTCAATTTTTTGTTTGG	4
ATGGTGATTGTCAAATAAAAGTAC	1
ATGGTGATTTTTGAGAATGTT	3
ATGGTGCAAAATCGAACCCAGATG	1
ATGGTGCAAGATATTGTGTGATTG	1
ATGGTGCAAGTGATGGATCCATA	1
ATGGTGCAAGTGATGGATCCATAT	1
ATGGTGCAATCGAATCATGATTTG	1
ATGGTGCAATCGGATCATGATTTG	3
ATGGTGCAATTGGATTATGATTTG	1
ATGGTGCACCTATATTTCCGT	2
ATGGTGCACTGTGGTGAGTTGTG	1
ATGGTGCAGCTGCTGCCACGGA	1
ATGGTGCAGTAACGTTTGTTCAAA	1
ATGGTGCAGTCAATTGTAGAGGAT	1
ATGGTGCAGTCCGTGCGAAAACT	1
ATGGTGCATAAAGTTGACTGACCA	1
ATGGTGCATGCATCTAGTTTGCT	1
ATGGTGCATTGTACGGTTTGGTCC	2
ATGGTGCGGTTTCTTGTTATGGA	2
ATGGTGCTATATTATGGGACGGAA	1
ATGGTGCTTAATGATTTGCCACTA	1
ATGGTGGAAACAGGTGGTGTGTA	1
ATGGTGGAAAGCATGAGCTCT	1
ATGGTGGAAGCTGTAACGAACAGA	1
ATGGTGGACCTAGATGTGCAATTT	1
ATGGTGGAGGTTGTGATTGTTTGG	1
ATGGTGGATACTGTGTGAATGCGT	2
ATGGTGGATATGAACGGTTATGAC	2
ATGGTGGATGGTTATGATTGGTTC	1
ATGGTGGATTAGAAAATGAGTGAT	1
ATGGTGGATTCCTTTTACGCAACA	1
ATGGTGGATTTGTAGATGATCGAT	1
ATGGTGGCCCCTATAAAGTACTCA	2
ATGGTGGCCCGAGGAGACCTCAGG	1
ATGGTGGCCCGCGCAGATTGCGTG	1
ATGGTGGCCGGAATAGTTGTCGGC	1
ATGGTGGCGAGAAATTGGTCTA	2
ATGGTGGCGGCATGATATGGACAA	1
ATGGTGGCTTAAGAGTGTTTTTAA	1
ATGGTGGCTTGCGCAGATTGCGCAG	1
ATGGTGGGATTGGTCATAGGAGT	1
ATGGTGGGCAATGTAGCTATTGAC	1
ATGGTGGGCGATCAGCCATAAGCG	1
ATGGTGGGCTATACGATATGGATT	2
ATGGTGGGTTCTGTCGAGATGTAG	1
ATGGTGGTAATCGTGAAACAGGGA	1
ATGGTGGTACAAAATCTCGC	1
ATGGTGGTACACTCTGTTGTGATG	1
ATGGTGGTAGAGTGATGAAACCTT	1
ATGGTGGTAGATTGATAGTAGC	1
ATGGTGGTCTATGTTTACATCA	1
ATGGTGGTGATTGGTGAATCTGCC	2
ATGGTGGTGCATTGACTCATCGCG	1
ATGGTGGTGGCGGATCGAAGCGGC	1
ATGGTGTAAAGTGATGTTGTTTC	1
ATGGTGTAAATTGATGAACTATA	1
ATGGTGTAACTTTTTTGCAAATGT	1
ATGGTGTAAGAGGAGGTGAAGAGC	1
ATGGTGTAAGCCAAAAATGAGTGA	2
ATGGTGTAATAAATAAGTAAGTAC	1
ATGGTGTAATCGGATTATAGATCA	1
ATGGTGTAATCGGATTATAGATCG	1
ATGGTGTAATCGGATTATATATCG	1
ATGGTGTAATCGGATTGTAGATCG	2
ATGGTGTAATCGGATTGTAGGTCG	1
ATGGTGTAATTGGATTGTAGATCA	2
ATGGTGTACTATATTTTTATAGTC	1
ATGGTGTAGATACAGGGTGTGTTC	1
ATGGTGTAGCGTTGATCAGTGGAG	2
ATGGTGTAGCGTTGTAATTAGTTG	1
ATGGTGTAGCTGAGTTGCTGGAAC	1
ATGGTGTAGGATCGTAAATGGTCT	1
ATGGTGTAGTATATAGTTATAGGT	1
ATGGTGTAGTCTTAGCCTTTGCTA	1
ATGGTGTATGCATCTAGTTTGTT	1
ATGGTGTATTGTGATGCTTCGC	1
ATGGTGTCAAAATTTTGAAACGGA	1
ATGGTGTCAAACATTTCGAAACGG	1
ATGGTGTCAAACATTTGGAAACGG	2
ATGGTGTCAAACATTTTGAAACGG	5
ATGGTGTCAAATATTTACAAACGG	1
ATGGTGTCAAATATTTAGAAAGGG	1
ATGGTGTCAAATATTTTGAAACGG	2
ATGGTGTCATACATTAAAATATGA	1
ATGGTGTCATATATCAAAATACGG	1
ATGGTGTCCATTAGTAAATATCCA	1
ATGGTGTCCTGGATATTTGTTCTA	1
ATGGTGTCGATGTATCATCGGTAT	1
ATGGTGTCGCGCCATGTGCTGCAA	1
ATGGTGTCGCTATTGTGCAGT	1
ATGGTGTCGTATGGAGTGTTCGG	2
ATGGTGTCTAGATGGTTAATTACT	1
ATGGTGTCTAGGTTAGAGATTACC	1
ATGGTGTCTATAGCATTAACTACA	1
ATGGTGTCTATTATTCTAAAGGGT	1
ATGGTGTCTCATAGATGAAGTGGT	1
ATGGTGTCTCATATGAGTGTCATA	1
ATGGTGTCTCCGGATATTGTCAGG	1
ATGGTGTCTGACTTTAACTTTACT	1
ATGGTGTCTGTTGATTTTTAA	1
ATGGTGTCTTGATGTTGTGTAGAA	1
ATGGTGTCTTTGAAGGTATAGG	1
ATGGTGTCTTTGAAGGTATAGGA	1
ATGGTGTGAAATGATAGAGAGTC	1
ATGGTGTGACCAAATAACATTGTC	1
ATGGTGTGAGCCGATTAGGTTGGG	1
ATGGTGTGAGCTAAAGTTTATTAT	1
ATGGTGTGATATGTTTGCGTGTT	1
ATGGTGTGCGTATGTGCGTTCGTA	2
ATGGTGTGGAATATTAATCTTTTA	1
ATGGTGTGGAATGTCAAACTTCAG	1
ATGGTGTGGCAAATCGTTAATTGC	1
ATGGTGTGTACACGCGAGGGCCTG	1
ATGGTGTGTAGTACCTGGTACCTA	1
ATGGTGTGTCACTGAAGCTGAATA	1
ATGGTGTGTCCTAATGTTGTACTA	1
ATGGTGTGTGGTACCTAGTACCTG	1
ATGGTGTGTTCTTCTCCGAGAGAT	1
ATGGTGTGTTTAATACTAAGATGA	1
ATGGTGTTATGTGCTTAGAGATGC	1
ATGGTGTTATTTGTACGTTTCAGT	1
ATGGTGTTCATTAAATTAGGTGGA	1
ATGGTGTTCCTACAAACGCTCTTA	1
ATGGTGTTCGCATTGAAAGAGTAG	1
ATGGTGTTCTGAAGCCCTCTAGGC	3
ATGGTGTTGATCTGTCAGATTTT	1
ATGGTGTTGATCTGTCAGATTTTG	1
ATGGTGTTGATCTTCTATTAAGTT	4
ATGGTGTTGCTGAAACTTCGCA	2
ATGGTGTTGGCACGGTAGATCTGA	1
ATGGTGTTGGCTCACACGGTAGTGCA	1
ATGGTGTTGGTATTTCTTAATGAC	1
ATGGTGTTGTCATTGTGACTATAA	1
ATGGTGTTGTCCATGATAGTGCA	1
ATGGTGTTGTTGTAAGTCTAGCA	2
ATGGTGTTGTTTGGGAATGAGGGA	1
ATGGTGTTTATGGTATTAACTACA	3
ATGGTGTTTCCGTTATATCCGGAA	1
ATGGTGTTTGCATTGAAAGAGTAG	1
ATGGTTAAGCTAACGTAGACACA	2
ATGGTTAATTACTAGTGTTTGCTG	1
ATGGTTACACTTAAAATGCGACGG	1
ATGGTTACATTGCCTTTGTTGAAG	1
ATGGTTAGAACGCAATGTTGC	1
ATGGTTAGAACTTAGTGTTGC	14
ATGGTTAGACATCGATCCTCGATA	1
ATGGTTAGTCTACAATTAGTGCTT	1
ATGGTTCAATCATGTGCTTCATCA	3
ATGGTTCACTTCTTGAGTTGC	1
ATGGTTCCAAACAAAGTTACAAGC	2
ATGGTTCCGGCTATAGCTCTATGA	1
ATGGTTCGTGATACGAGGATGGCA	1
ATGGTTCTTCATGTGCCCGTC	1
ATGGTTGACATATACGATATGGGA	1
ATGGTTGACTAGGAATGATATGGT	1
ATGGTTGAGATCGCCCGATACCTA	1
ATGGTTGAGGTACGACTACGACTGG	1
ATGGTTGAGTTAAGGTGGTGTCCA	1
ATGGTTGCACTTAGAATAGTATGG	1
ATGGTTGCACTTATTTTGGGAC	4
ATGGTTGCAGGGATGAACTCTTA	2
ATGGTTGCATATATCTGATTGGAT	1
ATGGTTGCCAAAAGCACACGTAGC	1
ATGGTTGCTACGCATGACAACGGG	1
ATGGTTGCTACTTCATACTATGAG	1
ATGGTTGCTGTCTATCTTCGAACC	1
ATGGTTGCTTGCTTGCTGGGCGTC	1
ATGGTTGCTTTCAACAAGGAGACG	3
ATGGTTGCTTTGGATAGATCCCTC	1
ATGGTTGGCAGTTAGGTGGATCC	1
ATGGTTGGGCCTATACAACAGGGT	2
ATGGTTGGTCGCCAAAGAAAGGTA	1
ATGGTTGGTGAGTACAAATGCTAT	1
ATGGTTGTACCTTTCTGATAGTGT	1
ATGGTTGTATGACACGTGGGCCT	1
ATGGTTGTGCCTTATATTATGGA	2
ATGGTTGTGTGCTCTATGAACTGA	1
ATGGTTGTTCAACAGGGTAGTTGG	1
ATGGTTGTTGATGAAGTTGAGGAT	1
ATGGTTGTTTGACTTGTTGCCTGT	1
ATGGTTGTTTTTCAAGGATAGCAG	3
ATGGTTTAAACTCAGGTGAGCTGG	1
ATGGTTTACCGGATGTCGGAAGA	1
ATGGTTTGCCATGGTTATCGCGGT	1
ATGGTTTGCCTTTTTTAAGACGGA	1
ATGGTTTGTCTTACAATATAGGTT	1
ATGGTTTTGTACGGTTTTTCACGG	1
ATGTAAAACGAGATGGTAATAATG	2
ATGTAAAACGAGGTGAGCCATTAG	1
ATGTAAACAACGAAGGGATGTCGC	5
ATGTAAAGATTATAGGTGCATGTT	1
ATGTAAAGCAACGATTGGATAGA	1
ATGTAAATAACGATGGGATGATCC	1
ATGTAAATATGGGTAATACTCGAA	1
ATGTAAATTACTTTTAGGCTTTAC	2
ATGTAACCTATGAATTGATCTGCA	4
ATGTAACCTCAAAGGTAGGTGTC	1
ATGTAAGAAACGGGTGGACGTCCA	1
ATGTAAGATAAGAGGTGATATACT	1
ATGTAAGTGATAAAGTCACGTGAC	2
ATGTACAATGGTGTCTAATAACGG	1
ATGTACACTACACAAGGTGCGGG	2
ATGTACAGTGATAAAAATGATGCC	1
ATGTACAGTGCCGACTAATCAATG	1
ATGTACCAAATATTTGATGTGACC	1
ATGTACCACCAATAAACATTTCTG	1
ATGTACCGAAACATGCCATGTAGA	1
ATGTACGATTACATGGTGGACTC	1
ATGTACGGGTTGTTGTACACGTAA	4
ATGTACGGTGGTATGCTTATCGAT	2
ATGTACGGTTGAGTGGTGCACCCC	1
ATGTAGAGAGGGTCCTTTAAAAGA	2
ATGTAGAGGAAAATTAACGGGTGT	6
ATGTAGATTGTAACGGTTGCCTG	1
ATGTAGCCTAATAGTTGCAGTGAC	1
ATGTAGCCTAGTGATTACAGTGAC	2
ATGTAGCCTAGTGGTTATAGTGAC	1
ATGTAGCCTAGTGGTTGCAGCGAA	1
ATGTAGCCTAGTGGTTGCAGTGAC	6
ATGTAGCCTAGTGGTTGTAGTGAC	1
ATGTAGCGGGACAACGACGCA	1
ATGTAGGACCCACATCATGGTGAA	1
ATGTAGGAGGGTACTGGATCA	1
ATGTAGGATAACAGTATACCACC	1
ATGTAGGCCTGCGAATATATTTCA	1
ATGTAGGGCCCCTTTGAATCGCAG	1
ATGTAGGGGTGTCTAGTCTGCAAGT	1
ATGTAGGGTAGCGCTAAACCGCA	1
ATGTAGGTAGGTTTTCAACGGAAC	1
ATGTAGGTGAAGAATAATGACTGT	1
ATGTAGGTGATTTGTTACATGTGG	3
ATGTAGGTGTTAAACGTTTGACGT	1
ATGTAGGTTTGATAGTGCTATTGC	5
ATGTAGTACATACGTGGTCTCGAT	1
ATGTAGTATTACTAAGACGTGTC	1
ATGTATAAGGTGCACTAGCAAAGG	2
ATGTATAATATACACGGGCAGCCA	1
ATGTATATAGGTAGACGACGTAAG	4
ATGTATATCTTGTAGAACGTGTCA	1
ATGTATCCAACGGGTGCAAGTGC	1
ATGTATCGATGTGATCACGAGCTC	5
ATGTATCTATGACAAGTGGGGTC	1
ATGTATCTGGTTCGCTACCGTAAT	1
ATGTATCTTGGAGCCTATACTGCA	1
ATGTATGAGTCACAGGTGTAG	2
ATGTATGATAGGTGGGACCATGTA	1
ATGTATGATGGGTGGAGCCATAT	1
ATGTATGATTCTATTGCACTGAAC	1
ATGTATGCTTTAACCTTCAGATGA	3
ATGTATGGTGTTACATAGGGTGTT	1
ATGTATGTGCAAAACTTAGGATA	1
ATGTATGTGCACTTGATATTTCAG	1
ATGTATGTGTTTGGTGACGTCTCC	1
ATGTATTAAGACACACACGGGTGG	1
ATGTATTTAAATAGAGGTTGT	1
ATGTATTTTTAAGTACCGATTGG	1
ATGTCAACGTATTCTTGTCAC	1
ATGTCAATCGGTGTTTATGGGCC	1
ATGTCAATTGAGTACAGATGG	1
ATGTCACATCAGATGTTTGGACGC	1
ATGTCACATCAGATGTTTGGCCG	2
ATGTCACATCCGGTACTATGTTGG	1
ATGTCACATCCGGTGCTAGGTTGG	1
ATGTCACATCGTGTGCTAGGTGAA	1
ATGTCACATTGAATGTTTAGATGC	1
ATGTCACCAAATTTACCTACATGA	1
ATGTCACCGTCATCTTAGAATACA	4
ATGTCACCTTGATTGATCGAG	1
ATGTCACGTGACTTATGGGGTGGA	4
ATGTCACGTTAGATGAAGATCGAG	1
ATGTCAGATATGCGGTGTTTAGAC	1
ATGTCAGGAATAGCCGGATAG	1
ATGTCAGGGGATTGCTGTGACATC	1
ATGTCAGGTCATCTGTGACGGGCC	1
ATGTCAGGTCATGTTGTGTTGGTC	1
ATGTCATAGACACATGTGGACCTA	1
ATGTCATAGACACATGTGGGTCCA	1
ATGTCATAGGTGGTGGGAATTGGA	1
ATGTCATATACACATGAGGGCCCA	1
ATGTCATGAGTGTCACATAGGTCC	1
ATGTCATGTCTGTGTGGTATGCCA	1
ATGTCATTGAGATAGGGGTGGCAA	1
ATGTCATTGAGATATGGGTGTCAT	1
ATGTCATTGATATATGAGGGCTCA	1
ATGTCATTGTGATAGAGGTGATAA	1
ATGTCCAGATTCACAATGCTAGAA	1
ATGTCCAGATTCATAGCACTAGGA	2
ATGTCCAGATTCGTTGTACTAGA	2
ATGTCCATGGCCTATTCGGAAA	1
ATGTCCATTGTTGGATATCGGAGC	1
ATGTCCATTTTTGGATGTCGGAGC	2
ATGTCCCCGATCTACAGCCGGTCC	1
ATGTCCGAATTCGTTGTGTGTCC	1
ATGTCCGCCTGCGAAAATGAGACC	2
ATGTCCTACATGTCATAGACTCA	1
ATGTCCTAGATGTGATGCTGCTGT	1
ATGTCCTATACGGAAATAACCTGC	1
ATGTCCTGGGACTGGTACTGAG	1
ATGTCCTGTTTCAGGTCATATGGT	2
ATGTCGATGAGGTCGCAGATCTGG	1
ATGTCGATTGTGTTGGGTGTTGAT	1
ATGTCGCATCAGATATTAGATTGA	1
ATGTCGCATCTGGTGCCAGATTTG	1
ATGTCGCATGGGGTGTTTGAGCA	1
ATGTCGCCACTATAGGTCATGTGCA	1
ATGTCGGAGAGGACGAGGTGTGCG	1
ATGTCGGTAACAGCCGGTGTCTGC	2
ATGTCGGTGATATGGGTCCGGGGG	1
ATGTCGGTGCTACTAGATGTTGCA	1
ATGTCGGTGTCATAATAAGGTGAT	1
ATGTCGGTGTCTATAATAATAATG	1
ATGTCGGTGTTGTAGTCTTATTTC	1
ATGTCGTAGATCGCTCGTGTGCCG	1
ATGTCGTATCGGGATGGTCCACCA	2
ATGTCGTCTACCACTGAAAGCACA	1
ATGTCTAAGCCTGCTTGTCATCCA	1
ATGTCTACAATGTATCATCAGCAG	2
ATGTCTACATGGGTATCTATAGC	1
ATGTCTACATGGGTATCTATAGCTA	1
ATGTCTACCCACGGGCTACACCTA	2
ATGTCTACGCTGTTATGATTCGGT	1
ATGTCTACGTTTAGTTTGTTACTA	1
ATGTCTACTTTGCATTAATACATG	1
ATGTCTACTTTGGCCCAACACTGC	1
ATGTCTAGATTCATCTATAGTGTA	2
ATGTCTAGATTCGTGGTACTAGGA	2
ATGTCTCATAATATAAGATGTGCA	1
ATGTCTCGAGCATTGTGGTCCACA	1
ATGTCTCTATGACATGTGGGCCC	1
ATGTCTGATCTGGGGCTTCGCGCT	3
ATGTCTGTACGTTGCAGTGGGTGA	1
ATGTCTTAGATGTTGTGTAGAAAC	1
ATGTCTTAGGTGATCTATGACTGA	2
ATGTGAACATAGACATGGTGTCGG	1
ATGTGAAGATATAGGGCCAGTTTG	1
ATGTGAAGGAACCGACAACGTGCC	1
ATGTGAAGGTGAGAAGAACGCTAT	1
ATGTGAATGGTCTCGTCAAAATTG	1
ATGTGAATGTGATATGTTCTAGTA	1
ATGTGACACATATGGAGGGAGCA	1
ATGTGACACATCATAGTATTACGA	2
ATGTGACACATCCTAGTATAACGA	1
ATGTGACACATTATACTACAACGA	1
ATGTGACATATCCTATTACAACGA	1
ATGTGACATATTCTAGTACAACGA	1
ATGTGACATGGTGTAAAATTTTTG	2
ATGTGACCAAACATTTGATGTGAT	1
ATGTGACCACGGTTGGTGGGCCGG	1
ATGTGACCCATACTACATGCA	2
ATGTGACCCTACCAAAATTTTGGT	1
ATGTGACCTGCTAGTAGAACGAA	1
ATGTGACGGAAAACTAGACGGCAG	1
ATGTGACTGAAAAGTTGTGTGTAT	2
ATGTGACTGAAAAGTTGTGTGTGT	1
ATGTGACTGACATATATATGGTTC	3
ATGTGAGAAAAAGTCAACGGTGTC	3
ATGTGAGAAGGCGACTAGAGTCAGG	1
ATGTGAGACCCACAAAGGTTAGGC	2
ATGTGAGACCCACATGTGTCTGGA	1
ATGTGAGAGGATGATTGAGGGTA	1
ATGTGAGCTATGGGTTCCTTGCCA	2
ATGTGAGGAAAACATTAATGATGC	1
ATGTGATAAATCTAAAGGCCTA	1
ATGTGATAACTGTGCAAATTATAG	1
ATGTGATACGATGAAAAGTTGAG	1
ATGTGATACGATGTGATGTGATGA	1
ATGTGATACGTCACTGGATGTGAT	1
ATGTGATAGAAAAGTTGTGTGTA	1
ATGTGATAGGGTGTAAAGTTGTAG	1
ATGTGATATGATGGCAAGTTGGG	1
ATGTGATATGATGTGATGTGATGG	1
ATGTGATATGGTGTAAAATTTTGG	1
ATGTGATCGAAATAGTTGAGAAAA	1
ATGTGATGAATGGATGGCTAGTAT	1
ATGTGATGCGTCTGAATTCCT	3
ATGTGATGCTACAGTAAACATTTG	1
ATGTGATGGAAAAGGACTAAAGT	1
ATGTGATGGGTGAAAAGTTTTTGT	1
ATGTGATGTAAATATTAGCATGGT	1
ATGTGATGTGATACGATGGAAAGT	1
ATGTGATGTGATGGAAAGTTAGGA	1
ATGTGATGTGATGGAAAGTTGGA	1
ATGTGATGTGATGGAAAGTTGGGA	1
ATGTGATGTGATGTGATAGAAAG	2
ATGTGATGTTTTATAATACAACGA	1
ATGTGATTGAAAAGTTGTGTGTAT	1
ATGTGCAACGAAAGGCAGCGTGA	1
ATGTGCAAGAGCGATGCAGTGCGG	1
ATGTGCACACGTATACCGGTAGA	1
ATGTGCACATGAAACTTAACCTAA	1
ATGTGCAGAAAAGTTCGATGTGAC	1
ATGTGCAGTAAAAAAGATTGGTTT	1
ATGTGCATACACGTTATATTACAG	1
ATGTGCATTATGTGGCAAATGGTA	2
ATGTGCCAATGCTGATTGTGTCTG	2
ATGTGCCAATGTAGGACATGTGCA	1
ATGTGCCACTACACGTACAGTTGA	1
ATGTGCCAGTCAGTTTGATCCTG	1
ATGTGCCATGCATGTGTGTCCTAA	1
ATGTGCGAATGACTTTATGCAGAA	1
ATGTGCGAGCGCTGTCACCGGCGG	1
ATGTGCGGTAGTCGGCGCGTCGAC	1
ATGTGCGTCCTATCTATTCCGGGC	1
ATGTGCGTCTTTAGTGTGTTTCA	1
ATGTGCTAAAAAATCAACGGTGTC	1
ATGTGCTAAAAAGTCAACAGTGCC	2
ATGTGCTAAAAAGTCAACGGTGT	1
ATGTGCTAAAAAGTCAACGGTGTC	5
ATGTGCTAAAAAGTTAACGGTGTA	1
ATGTGCTAAAAAGTTAACGGTGTC	3
ATGTGCTAAAAGTCAAGGGTGTCA	2
ATGTGCTAAATGTTCTGTGGCAT	1
ATGTGCTAACTTGAAATATGGTAA	1
ATGTGCTAACTTGAGATGATCGGA	1
ATGTGCTAATAAAGTGTGGATTGA	1
ATGTGCTACGTCAGTTTAATGTCA	1
ATGTGCTAGAAAGTCAACGGTGTC	2
ATGTGCTAGTCCGCCTGCGAAAAT	1
ATGTGCTAGTTAATATAGTAAAAA	2
ATGTGCTCTGTAGCCCGCACTACGC	1
ATGTGCTGAAGGTCTGACCGCCCA	1
ATGTGCTGTTCAGGGTAGCCTGCA	1
ATGTGCTTAGGTACATAAGACTGA	1
ATGTGCTTCAGGAAAATTCTGCAA	1
ATGTGCTTGAGATTGGTTTGT	2
ATGTGCTTGGTTGAGGCAGGAACA	1
ATGTGGACCACTTAAGGAGCCGCA	1
ATGTGGACCCTAGTTTGGTATGAC	2
ATGTGGACCTGACGATACATCAGG	1
ATGTGGACTCTACATACTCTCGAG	1
ATGTGGAGTTTAGTACCACCTTGC	1
ATGTGGCAACAAAGAGCAGCCGA	2
ATGTGGCAATAGCTATGAAGGCCT	1
ATGTGGCACTCCTACAAACACTCC	1
ATGTGGCATGGGGTGTTCGGATAC	1
ATGTGGCCTGCATTGTAGAGGTGA	1
ATGTGGCGCAAAGCAATAGGTGAA	1
ATGTGGCGGTGTTCCTTCGGCTA	1
ATGTGGCTGACATATGGGTTCTAC	1
ATGTGGGACCAAAGTGCTAGAAA	1
ATGTGGGACCCACGTTATGGTGAA	2
ATGTGGGATGGTGGTTGGGTGTA	1
ATGTGGGCAAAAGTGGCGAATAGT	2
ATGTGGGCCCGACGATACATCGGA	4
ATGTGGGCCCGATGTGTCGTCGGA	1
ATGTGGGCCCTCATGTGTCTATG	2
ATGTGGGCCCTCATGTGTCTATGA	1
ATGTGGGCCTTTGAATCGAAAAAC	1
ATGTGGGCGTTAGCGGGTGCTAAG	1
ATGTGGGGCAATAAAAGGGTGAGA	1
ATGTGGGGCCCACATGTGGTAGGC	1
ATGTGGGGCCTACGCGCTGACTCA	1
ATGTGGGGTAGCCTATCTAATTGT	1
ATGTGGGTCAGGATGGTATATCTC	1
ATGTGGGTCCACATGTGTCTATGA	1
ATGTGGGTCCATAACAAAGAGTA	1
ATGTGGGTCCATAACAAAGAGTAC	2
ATGTGGGTCCTACATATCATTGAG	1
ATGTGGGTCCTACGTGTCATTGAG	1
ATGTGGGTCCTACTTTGGTATAGC	2
ATGTGGGTCCTATATGTCATTAAG	2
ATGTGGGTCGCTGACATATGGGCC	1
ATGTGGGTCTCACGTGTATGGGTA	3
ATGTGGGTCTCACTTTGGTATGGC	2
ATGTGGGTGATTTGTTGCAACGGC	1
ATGTGGGTTCACATGTGTCTATAA	1
ATGTGGGTTTTTTTGTTACAATGA	1
ATGTGGTAAGATAGGGTTTGTTGT	1
ATGTGGTAATGATGCTAGGAAGTT	1
ATGTGGTATCTAGAAGATTGTGCT	2
ATGTGGTCGACGGTTAGCAGTTGT	1
ATGTGGTCTAGATGTGATGTAGAT	1
ATGTGGTGATTTTGGTGGGACCAA	1
ATGTGGTGCTTACTATCCTCCGCC	1
ATGTGGTGTCAAATCTTCACCTAG	1
ATGTGGTGTCCGGTAGCTACGAAC	1
ATGTGGTGTGCATATGTATAAATG	1
ATGTGGTGTGGTAAAATAGAGAGG	1
ATGTGGTTCGGATTGTAAGTGACA	1
ATGTGGTTGACCAAAAACAGGGA	1
ATGTGGTTGGTTACAGGGTGGATG	1
ATGTGGTTGTGCCTTATATTTTGG	1
ATGTGTAAACTTAAGGTGTATAAA	1
ATGTGTAAACTTGAGGTGTATAAA	1
ATGTGTACCCTATTAGCTAGCCGG	1
ATGTGTACCTTTTGATGTGACGCA	1
ATGTGTACTCGACTGGATCTGATC	2
ATGTGTAGGTAGACTTTTAACAGG	3
ATGTGTATACGACAGGTTGATGAG	1
ATGTGTATATGACAGGTGAGAGT	1
ATGTGTATGACAGGTTGATGGGAT	2
ATGTGTATGACAGGTTGATGTGAT	2
ATGTGTATGATAGATGTGACCAAG	1
ATGTGTATGATAGGTTGATGTGAT	5
ATGTGTATGATGGGTTGATGTGAC	1
ATGTGTATGTTCAGTTTGTTCTGG	1
ATGTGTCACACCCCAATCCGGCA	2
ATGTGTCACATCCAATATTAGGTT	1
ATGTGTCACATCCAGTACTAGGT	2
ATGTGTCACATCCAGTATGAGGT	1
ATGTGTCACATGTTTGATGGCAGG	1
ATGTGTCACTACACGTACGGTTGA	3
ATGTGTCAGGTCAATTTCATTGCA	1
ATGTGTCATACCCGGTATTAGGTT	3
ATGTGTCATGCCAGTACAAACCGC	1
ATGTGTCATTCGTGACGGGCCTG	1
ATGTGTCCAAACATATGATGTGAC	1
ATGTGTCCAAACATTCGATATGAC	1
ATGTGTCCAAACATTTGATGTCAC	4
ATGTGTCCAAACATTTGATGTGAC	10
ATGTGTCCAAACATTTGATGTGAT	1
ATGTGTCCAAATATTTGATGTGAT	1
ATGTGTCCAAGCATTTAATGTGAC	1
ATGTGTCCTATCCAGTAAAGGTTG	1
ATGTGTCCTATTCTGATTGGCTGT	1
ATGTGTCGAAACATTTGATGTGAT	1
ATGTGTCGACGGGGGATACCTGTA	1
ATGTGTCGATGTATCTTTCTATGT	1
ATGTGTCGGTGGATAAATAATCAC	1
ATGTGTCGTAGAGTGATATATCAC	1
ATGTGTCTACGTTTAGTTTGC	2
ATGTGTCTAGATATTTGATGTGAT	1
ATGTGTCTAGGACATATGGATCCA	1
ATGTGTCTATAATATTTGAATCTA	4
ATGTGTCTATCACATATGGGTC	1
ATGTGTCTATCACATATGGGTCTA	1
ATGTGTCTATCGGTGTCATAGCAT	1
ATGTGTCTATCGGTGTTATAGGA	1
ATGTGTCTATGACATATGGGCCT	1
ATGTGTCTATGACATATGGGTCCA	1
ATGTGTCTATGACATGTGGATCC	1
ATGTGTCTATGACATGTGGGCCT	2
ATGTGTCTATGACATGTGGGCCTA	2
ATGTGTCTATGACATGTGGGTCC	2
ATGTGTCTATGACATGTGGGTCCA	5
ATGTGTCTATGATATGTGGGCCT	1
ATGTGTCTATGATATGTGGGTCT	1
ATGTGTCTATGATGTTTGGGTTCA	1
ATGTGTCTCGGATAAGATGGACAC	1
ATGTGTCTGTAAATCCGATGTGAA	1
ATGTGTCTGTACCAGTGAAATGGA	1
ATGTGTCTTGTGCTACAATGCTAC	1
ATGTGTCTTGTTTGACGAGGGCAA	1
ATGTGTCTTTTTACTATAGAGTTA	1
ATGTGTGAAATTGAGGCCTAG	2
ATGTGTGAGTTTTTGTTGAGTTGG	1
ATGTGTGCAAACTTGATAAGGCCT	1
ATGTGTGCAAGTGTCTGAAATGTA	1
ATGTGTGCACGCTTTATATTATG	3
ATGTGTGCATTCATAGAGGTGAGT	1
ATGTGTGCGTGAACTAACATTGGT	1
ATGTGTGGAGCTGTCATTGAC	1
ATGTGTGGTCTCAGCTTGTATGAC	1
ATGTGTGGTTTTGGTTGCAGATGC	1
ATGTGTGTATGACAGATGGGACC	2
ATGTGTGTCAATATATCCAATGTG	1
ATGTGTGTCCTACATATCATTGAG	1
ATGTGTGTCCTATATCCGATGTGA	1
ATGTGTGTCTAGATTCATTAACAT	4
ATGTGTGTCTAGATTCATTATCAT	1
ATGTGTGTGCTATGATTTGTTTTC	1
ATGTGTGTGCTATGATTTGTTTTT	1
ATGTGTTAGGTATCGTGTGCA	5
ATGTGTTATTGGTGGACCTTACAC	1
ATGTGTTCAAACATTTGATGTGACG	1
ATGTGTTCCTATAGATATGTGTT	1
ATGTGTTCTATCACCTTTTTTGGT	1
ATGTGTTGATGGGCTATGAAGGGT	1
ATGTGTTGCTGAATTGGCGGGTCC	3
ATGTGTTGCTTTATGGCGGGATGG	1
ATGTGTTGGAGACTTCAGTGCA	1
ATGTGTTGTGCCAGGGACAGCCC	1
ATGTGTTGTGTCATCAGTGATCT	1
ATGTGTTTATATCGGTGTACTCAA	1
ATGTGTTTATTGGTGTTATAGTA	1
ATGTGTTTGGTTGGTGGGCGAGAA	2
ATGTGTTTGGTTGGTGGGCGAGG	1
ATGTGTTTGGTTGGTGGGCGAGGA	1
ATGTTAACTTACGTGGTTGGACTA	2
ATGTTACATCGCACGGCGCACGAA	1
ATGTTACCCATGGTGCTGGTGTCC	1
ATGTTACGCATGGTACCATACAAA	2
ATGTTAGAAAGTGTTATAATATG	1
ATGTTAGACACTGTAGGGCTTTCC	1
ATGTTAGGCACTACTGTAGGAGGGA	1
ATGTTAGGGCCTATTACAGATGAT	1
ATGTTAGGGTGATCTCGAAGTTGC	1
ATGTTATGAAACAACAGGGTGATC	1
ATGTTATGTGGTGTACTAGTAGG	1
ATGTTATTGAGATAGGGGTGGCAA	1
ATGTTCAGATTGGTGCTAAAATAA	1
ATGTTCCTTATGCATTGCCGGTCC	2
ATGTTCGATGTGATATGATGAAAA	3
ATGTTCGGGACCTACAAATACATT	1
ATGTTCGGGAGGTGAGGTTGGGAA	1
ATGTTCGGTATAGCCATGGTAGGC	1
ATGTTGAAGCTGTGTCTTGTATGA	6
ATGTTGAGATGATGTGTTTAATAC	1
ATGTTGAGGAGGCTGCGACTGC	1
ATGTTGCAGCGATATGGAGCAGTA	2
ATGTTGCATGTTGATGGATAACCT	3
ATGTTGCATGTTGATGGATAACCTA	1
ATGTTGCCACAATTTTAAAATCGT	1
ATGTTGCCTTGAAAAGAACCTACA	1
ATGTTGCGACACACGAATGTATGG	1
ATGTTGCTAGGTGGCTAAATCAA	1
ATGTTGCTATAATGCTTGTGGTTG	1
ATGTTGCTATGTGGCTGAATGGAA	1
ATGTTGCTGAAGATGAGCCACATC	1
ATGTTGCTTAACGATTTGCCACTA	2
ATGTTGGCGCACAACCCAGTTGCC	1
ATGTTGGTGAACATGTTGTTGGA	1
ATGTTGTCACGTCGAATGTTTGG	1
ATGTTGTGAGTGTCTGCGTTGTAC	2
ATGTTGTGATAAGCCGGGTGACTG	1
ATGTTGTGATTGGTTGAGAAGTGG	1
ATGTTGTGGTGCCATCGCAATGCC	1
ATGTTGTGTACACATGGAGGTCCT	1
ATGTTGTTGACGCAGGATATCCTA	1
ATGTTTAAAAAAGGTTAACGGTGT	2
ATGTTTAAGGGTGGTCCAAAGTGA	1
ATGTTTACAGTGTCAACTTAGTCTA	1
ATGTTTAGTAATGAATTGGTAGG	1
ATGTTTATCAAACTACTAAACGGT	1
ATGTTTGACACCGTTGACTTACATG	2
ATGTTTGACCGTTCGTCTTAAA	1
ATGTTTGACGGGCCCAATTTACAG	1
ATGTTTGATGAACCTTGATTATGA	1
ATGTTTGATGCCGTTGACTTTTT	1
ATGTTTGCATACATATGGGTACC	1
ATGTTTTGAGCGGGGCTAATTCAC	1
ATGTTTTGAGGGGGCTAATTCAC	1
ATGTTTTGCTCTATAGCATACGTT	1
ATGTTTTGGACACATCTATAGAGT	1
ATGTTTTGGGTTTCCTTTAGTTTC	2
ATTAAAAAACATGATGCCTGCCTC	1
ATTAAAAAGGTCCTTCATCAATTC	2
ATTAAAACTGGTGCAGATTAGGTC	1
ATTAAAAGGAGTCGGGTACGAACC	1
ATTAAAAGGGTGGTCCACTATACA	1
ATTAAAAGTTTAGGGTGCGTTATG	1
ATTAAAATAATAAAGACGGTGTCC	1
ATTAAACACGGAACCTCAGGGTTG	1
ATTAAACATAAAACTGGATGTGAC	1
ATTAAAGAAAAGGGGCAATTGCAT	1
ATTAAAGAGCAATGGTGACAAAGG	1
ATTAAAGGTGTGATTCTTGGATGT	1
ATTAAAGTTTGTATAGGGGCTGC	1
ATTAAATAAGCTGCCACATAGAAT	1
ATTAAATAAGTTGCCACATAGGAT	1
ATTAAATATCTGTTTAATTCGTGC	1
ATTAAATATGTAGTGTCTAGTTAA	3
ATTAAATGAAAATTAACGGTGAGA	2
ATTAAATTCATGGTGAGAGAAAGA	1
ATTAACAGGTGATGAATAATATTT	1
ATTAACGCCAAAATTTGGTAAGCC	1
ATTAACGGTGTCAAACATTTTGAA	1
ATTAACTGGTGCTACATGGAGTATGG	1
ATTAAGAGGTGGTGAGGCTCAAAC	1
ATTAAGATGGGGTGAGGCTTCGAA	1
ATTAAGGAAATACAATGGATAAAG	1
ATTAAGGAATGATCTAATATGGTA	1
ATTAAGGATGGGCTCACTTTACAG	1
ATTAAGGGCATTGTGGTCTTTTGT	1
ATTAAGGGGGAGCACAATAAAATT	2
ATTAAGGTAAAAGAGATGGGAGA	1
ATTAAGGTGGTTTACTATTAATCG	1
ATTAAGTCTTAGATTTGACACAGG	1
ATTAATAATACAATGGTTGCCCGA	1
ATTAATATAGTGTCACATAAGTTA	1
ATTAATATGGGCAAAGGTAGAAAG	1
ATTAATATGGTAGTTACGATTCGG	1
ATTAATCATACGTTAATGGACCGC	1
ATTAATCATGTGTTAATGGGTCGC	1
ATTAATGGAATTCTGGTCCTTTA	1
ATTAATTGCGTAGACGCGGTGTCT	1
ATTAATTTGAGGTGTTAGTGTACTC	1
ATTAATTTTGGATGGCCAAGATGG	1
ATTAATTTTGGATGGTCAAGATGG	1
ATTACAACGAATACAATGGTGCGA	1
ATTACACAAGGTGGTCAAAGTGGC	1
ATTACAGGATTGATCAGTTGCTTA	1
ATTACAGGCACTGACGTGTGGGAC	1
ATTACATATATAAGTGAGGTGTAA	1
ATTACATATGTACATGGGAGCGTA	1
ATTACATGGTATGACGCACACACG	1
ATTACATGTGTAAGTGGTGTGTAA	1
ATTACCACGCGGTAACTGTGCTTA	1
ATTACCATTGCTAGAGTACACGA	1
ATTACCCGGTGCAACGCATGGGCA	1
ATTACCGGTTGGATGGGCATGACG	1
ATTACCTGCCGATAGTGAAGTGTC	2
ATTACGAGAAAAGTGAAGAAGAG	1
ATTACGGAGATGGATACTGATAGC	1
ATTACGGGGTGCCAAGGAATCTGG	1
ATTACGGGGTGCCAGAATGAGAAG	1
ATTACGGTGTAGTATTTTTGATGT	1
ATTACTAAACGGTGTATTTTTTGC	1
ATTACTAACCTTTTATACACCTCA	1
ATTACTTTAATAGGTGTGGTGTC	1
ATTAGAAAATATGGTACCTTCTGG	2
ATTAGAAAGAGATGACGACGCGTC	1
ATTAGAACCGTGCCACTATCATC	1
ATTAGAACGATGCGATGGAAAAG	1
ATTAGAACTAGCATGGTGGCCCGC	1
ATTAGAAGGGGTGAGGCTTCGAAA	1
ATTAGAAGGGTGTTGATGTAG	2
ATTAGAAGTTTGTGTGTGTAGAAA	2
ATTAGAATGTGTCATATTCAATAC	2
ATTAGACATCAAAGTAGGGGCGA	1
ATTAGACCTAGTGGGCATTTATAC	1
ATTAGACGCAGTGTGTATGACAGA	1
ATTAGAGTAACCAAGGTCGTC	1
ATTAGAGTACGTCTGATTCAGGTA	1
ATTAGATGTTTGACTGAATGTTGG	1
ATTAGATTGACTATAGGTGAATTG	1
ATTAGATTGGCTATAGATGAATTG	1
ATTAGCCACGTAGGCGCCACGTC	1
ATTAGCCTACCTGAATTCAAGTCC	1
ATTAGCTAGATCGGCCAAACCGAC	1
ATTAGGAGTCTAAGGCCGATCTTC	1
ATTAGGAGTGTGCCATATCAT	1
ATTAGGATGTGCCACATCCAGTAC	1
ATTAGGCAATAATAAAAGGGGTAGC	1
ATTAGGCAGTATCAGCACTTTGTA	1
ATTAGGCCATTAGCGCATGATGAA	2
ATTAGGCTCCTTGGTGGAACCAGA	1
ATTAGGGAAGTCCTATTGATTGCT	1
ATTAGGGCCTATTCAATTTGATGC	2
ATTAGGGCTATTACCTATCAAGGA	1
ATTAGGGCTATTACCTATTAAGGG	1
ATTAGGGTGATGTGGCTTAATGAG	1
ATTAGGTAAGATTACAATGACAGC	1
ATTAGGTATATGGTATTGCCGTAT	2
ATTAGGTCATGTGACGGCTTAGCA	1
ATTAGGTGGTGTCTGCGTAGGACG	1
ATTAGGTGTATAAATAGTGAAACA	1
ATTAGGTGTGAGAGAGAGAGAGAG	2
ATTAGGTTGCAGGTCCGTTGGA	1
ATTAGGTTGCTTGATTAATTTAGT	1
ATTAGTATACTATGACACTGATAG	1
ATTAGTATCAGAGCTAGGTGAAA	1
ATTAGTCTACGTTTAATACTTTAA	1
ATTAGTGATGGTGAAGCCAAAGTA	1
ATTAGTGCCCGAATAACCCATACG	1
ATTAGTGCCTGATTAATTAAGTA	1
ATTAGTGCGTTACAACTTTATAGT	1
ATTAGTGGGTAAGTCACGGATTGA	1
ATTAGTTGCTCGGGCTCGATGATG	1
ATTAGTTTAAGGACTACCTGTGCA	1
ATTATAAAGGATTTTAGGTGGATG	1
ATTATAAATTTGGTACCTAGGTAG	2
ATTATAATATATTATAGGTGTCGG	1
ATTATAATGAAAAATAATGGTCAA	2
ATTATACGGTTTAGATAAGGTGAA	1
ATTATAGACTGTGCCAAGTTTGAC	1
ATTATAGGTGTCTGTTTTAGCGTA	3
ATTATAGTCTGATGGGTGATGACC	1
ATTATATGGGGTGTCACATGGAGT	1
ATTATATGGGTAGACTAAGAGAAG	1
ATTATATGGTTTTAGCTCAGGGA	1
ATTATATGTTAGGTGGAAAGGTGT	1
ATTATCACATGTCTAATAGGTAAG	2
ATTATCAGTGGATGATGATGTGAC	1
ATTATCGGTGTCTTAATAGGAGAA	1
ATTATCTTCACCGGGTTCCTGGGC	4
ATTATGATAGAGGGTGTGGACCG	1
ATTATGCTTAGATTATGGTGTTA	2
ATTATGGACGGAGCAGCAAGACAG	1
ATTATGGTCAGGCCTCATATGGCG	1
ATTATGGTTTTAGCCGATCGGACA	1
ATTATGTGTGTCACGCTTGCAGG	3
ATTATTATGTTCTAGTGCAAGGTT	1
ATTATTGTATAGGTGGGCTATTAG	1
ATTATTGTCTACACTACTCTAGAA	1
ATTATTTAGGTGACACGCACAAAA	3
ATTATTTGTTTGGTGCTCCATGGT	1
ATTCAAAAAATATTGACGGTCC	1
ATTCAAATGTGTGTCCGTATATCC	1
ATTCAACCAACTGTGTGCCATGAA	1
ATTCAACCTAGTACGAGAGGA	1
ATTCAAGCGGTGAAAATAGTGATA	2
ATTCACAGGTACTGAAGTGCGCGG	1
ATTCACCGAGATGGTTGATGGTAA	1
ATTCAGATTCTGAGAAGCCGTAGT	1
ATTCAGCCGAACCGCTGCCTA	1
ATTCAGCTTATAGTAATTTGACTC	1
ATTCAGGCCTTTACATCAGAT	1
ATTCATGGGCCATCGGTGTTAGC	1
ATTCATGGGTAGGATAAAGTTGAC	2
ATTCATGTCTAAGGTGGTGTTTGG	1
ATTCATTCCCTTGCAATAAGGTGG	1
ATTCATTGTCCTAGATGGTGTCCC	1
ATTCATTTGGTGTTTTCATTTTA	1
ATTCCAACTGTGCCTTGTGAATGA	2
ATTCCAAGGACGAGTACAGTGGAC	1
ATTCCACCAGTGAAATGTCACTTT	1
ATTCCACGTAGCGTTGATGTGGCA	1
ATTCCATGAGGAGGTGCGTTGCTG	1
ATTCCATGCCCTGAATCATGTGAG	1
ATTCCCGATATCGGTTGGGTGTCA	1
ATTCCGGACCTATTTTCAAAA	1
ATTCCGTTAGGGATATGGTCTGTA	1
ATTCCTACTGTTGATGTGCCAGAA	1
ATTCCTATCCTTCATCCTACCCAT	1
ATTCCTCAACTGCCGTCGTGTTGC	1
ATTCGATAGACCTACAACTAATGC	1
ATTCGATGTGACCTATCTAAACAG	2
ATTCGATGTGATAGGAAGTCCCTG	1
ATTCGATGTGATGGAAAAGTTGGA	1
ATTCGATGTGATGGGTGAAAAGTT	1
ATTCGATGTGATGTTTTTGGCGAA	3
ATTCGGATGATACCTCAATTTGAAA	1
ATTCGGCCGACCGACGAAAGATGG	4
ATTCGGCCTACCGATGAAAGATGA	2
ATTCGGGACTAGCATTCCAGCGAA	1
ATTCGGTCAAACGTCCGATGTGAC	1
ATTCGGTCTTGTGCCGTGTGC	1
ATTCGGTGATAAGATGAGGGACAT	1
ATTCGGTTGCTCGATATTGGATGC	2
ATTCGTAAGTTCCTGCACTATATC	1
ATTCGTACTTACGATGATGTGCAA	1
ATTCGTAGTATTAGAATGTGTCAC	1
ATTCGTAGTGCTAGGATACGTCCC	1
ATTCGTGATCTTACGGTGTCCACT	1
ATTCGTGTCTCCACTGAGCCTCGA	1
ATTCGTGTGTTTACGTGTCAGTGA	1
ATTCGTGTTCTTGCGATGTCCACCA	2
ATTCGTTGGTGTCATAATGTGTCT	1
ATTCGTTGTACTAGGTTTGGTCAC	1
ATTCGTTGTACTATGAAGTGTCTT	2
ATTCGTTGTGCCATGAAATGTCTT	1
ATTCGTTGTGTGTCCTCATTCGAT	1
ATTCTAAAATGTAGCCAAATTGAG	1
ATTCTAACAGGAATGCAGGTGTAA	1
ATTCTACCATCCAATGAGCTCTGC	1
ATTCTAGAGGTGCTCATAGGGATA	1
ATTCTAGATTTGGTACCGGTGCTC	3
ATTCTAGGGTCCTGTTTGGTTCCA	1
ATTCTATGCGGTTGGTGTGACTTT	1
ATTCTCGAGGACAAGTAAAAGGAC	1
ATTCTCGGGCAGCACGCCGATGGA	1
ATTCTGACAGGAACTAAAGTGTA	1
ATTCTGACGGTGCAATTACAAAT	1
ATTCTGAGAAGCAACTGATTGGT	1
ATTCTGATATTAGATTGGTTCCTG	1
ATTCTTATATTTTGCGACGGGGGA	1
ATTCTTGGTCTGTGTGTCAAGATA	1
ATTGAAAAAGTATCAGGATGTAA	1
ATTGAAATATTTTGTTGCATCGGT	1
ATTGAAATGATTAATGTAGGGGCAC	1
ATTGAAATGGCCTATGTTATATAG	1
ATTGAAATTGAAACGATGTGATGG	1
ATTGAACAAATTCAGTAGGTGCT	1
ATTGAAGTGCCATGTGATGAATTG	1
ATTGAAGTGTTGTCTACATCAATA	5
ATTGAATGTGACACATCATAGTA	1
ATTGAATTTGAACTATTGTGACAA	1
ATTGAATTTGCCAGCACTACCCC	1
ATTGACACGGGTGCTTGTATTTAC	1
ATTGACAGGCTGGATGCATATAGA	1
ATTGACATAAATGCTTGGTTTGAG	1
ATTGACCATGTGTCAGGCGGTGTG	1
ATTGACCTTCTGAAAGATAGCCCA	2
ATTGACGATTGGTTTGTGCTGCAC	3
ATTGACTATAGATGAATTGGAGCC	1
ATTGAGAGGAGCGCACACATGATC	2
ATTGAGATAAACTGCGATTAGTGG	1
ATTGAGATGTCTAACATCAGCGAC	1
ATTGAGCCTAGATATGATTTTATA	2
ATTGAGCCTCGGGGACCGATGTA	1
ATTGAGCGAGTTTGGTCTAATGTG	2
ATTGAGCTCCCTTTCAGATAGGG	1
ATTGAGGAGACTGAGAAGATGCGT	3
ATTGAGGAGATTGAGAAGATACGC	4
ATTGAGGGCCCATTTGAATCGCAGG	1
ATTGAGGGGGTGCATACATGATGA	1
ATTGAGGGGTGAATATATGGTGTA	1
ATTGAGGTGCTTCAAGATGATTGC	1
ATTGAGGTGGAATTACTCTGGTAC	1
ATTGAGGTGGCGTATGATTCTGGT	1
ATTGAGGTGTATTATGGAGTAGTA	1
ATTGAGGTGTGAGTTTTTATGAAT	1
ATTGAGTCATTTCATGTGAGGTACC	1
ATTGAGTCTTGTGGCGATGCT	1
ATTGAGTGGCTAAAGACCCACTAC	1
ATTGATAATGGTCTGCGTTGTAAA	1
ATTGATATGTGGACCTGATGTGTC	1
ATTGATCACGGAAGCAACCTA	1
ATTGATCTTGGTGTACCTATGAA	1
ATTGATTAAAATGTCTACGGCGTC	1
ATTGATTGTCCTGTGTGCGTAGG	1
ATTGCAAAAATAAGATGGAGGCAT	1
ATTGCAAAAGTACTAGTTGGTGTT	2
ATTGCAATTACCGATCCGATGCAA	3
ATTGCACGGATGGTGTATGTGCGG	1
ATTGCAGATGACCTGCATGGCTGC	1
ATTGCAGATTTGTGCACGAAAGGA	1
ATTGCATCCGGGACTATTGTGGAA	2
ATTGCATCCGGGACTATTGTGGAAATCGG	1
ATTGCATGGACTCTCTATGAG	2
ATTGCCACCTAGATTTGGATGCC	1
ATTGCCACGTAAGCGTCACGTCAA	2
ATTGCCTATTAGATGATGTTGTAT	1
ATTGCCTCACAACGTCAGATTGGG	1
ATTGCCTGCTACTGTGTTGATGAA	1
ATTGCCTTGGACAAATTTTTTGTT	1
ATTGCGAATTGGTGGTATGTTTC	1
ATTGCGAGTAGTACACCATTTAGA	1
ATTGCGCTGCTTGCAAGTGGA	1
ATTGCGTGTAAATTGTGAGACGAA	1
ATTGCTAAAATATGGTGTGTGTGT	1
ATTGCTAATCGAGTCTATTGCTGA	2
ATTGCTACGTTTAAAATGGGTCGG	1
ATTGCTATAACTACCTTAGTC	2
ATTGCTCGGATGGCGCTATTACTT	1
ATTGCTTCTGGGGTGGGCAGGTGA	3
ATTGGAACGATGTGACGAAAAAG	3
ATTGGAACGATGTGATGGAAAAGT	1
ATTGGACACTTGTGGGAATGGATA	2
ATTGGACATTAATCCATACGACGA	1
ATTGGACGATTGTTGTTGCCTTGG	1
ATTGGACGCATCGATATGGTGGAA	1
ATTGGACGTGTGCTAAGAGGG	1
ATTGGACTGGTACCTCGAGGTACA	1
ATTGGAGATGAGCCTACTAAGCCC	1
ATTGGAGATGTAATCGATAGTGCA	1
ATTGGAGATTTATCTGGTGTTTT	1
ATTGGAGGTAGTAGCAAAATCAGC	1
ATTGGAGTGTATTGGGTGCGTTT	1
ATTGGATGCAAATCGGATGGTCAG	1
ATTGGCACATGAGTGTATTCCAA	1
ATTGGCCGCACTTTGCGTAGCTTA	1
ATTGGCCTTCCGACAGCTTTCGGT	1
ATTGGCGCCTGTATTGCAATTTCC	3
ATTGGCGGTCCTTAAACTTGTAGG	1
ATTGGCTAGCTTTTAGGATGGGAA	1
ATTGGCTATTGATGAATTGGAGCTA	1
ATTGGCTCCGATGAAGGAGGTGGT	1
ATTGGCTGTCGACAAGGGTGTTGGC	1
ATTGGCTTCGGCGGTGGGTTCAAC	1
ATTGGGAAATGAATGAAGGGTTAG	1
ATTGGGAAGGTGTCGCCGCAAATG	1
ATTGGGACCTAGATGATACACTTT	1
ATTGGGATTGATCGGTCGCCATGC	1
ATTGGGCATGATATCTCGGGGTAT	1
ATTGGGCCAAAATTTACAAGTCTG	4
ATTGGGCCGCCAAATGTTAATGGG	1
ATTGGGCTGACCTTAGAGCAGGTA	2
ATTGGGCTGTGCTTGGGCCGATGC	1
ATTGGGGAGGTAGCCAGAAGCGAT	1
ATTGGGGCGGTTCAATCAGAAAGC	1
ATTGGGGTGCGATGAAGCTTGGCA	1
ATTGGGTCAAAAGCTATGCCCGATA	1
ATTGGGTGAGTGCGAATTGTTCGA	2
ATTGGGTGCAAATGAAGTGGTGAG	2
ATTGGGTGCATGATAGTAGATAGG	2
ATTGGTAACTGATGATGTCGATG	1
ATTGGTAATGCTAAATTTGGAGGC	1
ATTGGTACATGGCGGCATAATGAA	1
ATTGGTACCATGGATCCCTC	1
ATTGGTAGTGTATTTGATCTTTGT	1
ATTGGTAGTTTATATGTGTAGTAA	1
ATTGGTCGGTGCTAGATCTGGAA	2
ATTGGTCTCCGATCTGTTGTGCGC	1
ATTGGTGAAGATTTAGCAATGGGT	1
ATTGGTGACGTGACAATGTAACTA	1
ATTGGTGAGATGCGAGTGTGCCAG	1
ATTGGTGCGTGATCAAATCATTGG	1
ATTGGTGGACCCGATATTATGGAC	1
ATTGGTGGACCTATTTTTGGATGG	1
ATTGGTGGCAAACTGGGCCTCCA	1
ATTGGTGGGCTGTGGGTGCATGGT	2
ATTGGTGGTTTCGCTGACGTGGCA	2
ATTGGTGGTTTGATGCTGTTTGCT	1
ATTGGTGTCAAAATTAATTGCTAC	1
ATTGGTGTCATAACATGTCTGTCA	1
ATTGGTGTCGGCGAATGTGAGGAA	1
ATTGGTGTCTGTAACTACTTCCA	2
ATTGGTGTGCAATGACCAACAAGC	3
ATTGGTGTGCCTATGAAATTTGTA	1
ATTGGTGTGGCTTTTGGAAAAGCT	1
ATTGGTGTGTTGCAACGAGACGTA	1
ATTGGTTATAGATGATTTGGAGC	1
ATTGGTTCGGGCCTCCATGGTGGA	1
ATTGGTTGTCCTAGTATATATCGC	1
ATTGGTTGTGAAGAGAATGTTGGT	1
ATTGGTTGTGGAAGGGAAAAGGAC	1
ATTGGTTTGATATGGTTGTGGTAC	1
ATTGTAAAATAGAGGATTGCAAAA	1
ATTGTAAAGGGGTGTATGTTACAC	1
ATTGTAAATTTGGTACCTCTTAGT	1
ATTGTAAGGGGGCTAAAATAGACT	1
ATTGTAAGTGTCTGCGTTGTACTG	1
ATTGTAATTATAAGTTGTGAGAT	1
ATTGTACTATAGGGACTACTCGAA	2
ATTGTAGAATGGTGATTCAACAG	1
ATTGTAGGTGATGACGGGCAATGA	1
ATTGTAGTGTGACCTTTCTGGGGT	1
ATTGTATAAATGTGCTATTAGATG	1
ATTGTATATATAGGTGATGGACTC	1
ATTGTATGAATGTGCTATTAGAT	2
ATTGTATGTTTACTAGATGGTTAC	6
ATTGTCATGCATAACAACCATACC	1
ATTGTCGATTGGAAAACCACTAAA	1
ATTGTCTATTTGTTTTGGAGCCAA	1
ATTGTCTCTAACTGTTGTAGGATG	1
ATTGTCTTAGTGTGCTGATCA	1
ATTGTGAAAGATGCTTTGTTCCCC	1
ATTGTGAAATCTGTGTGACATCAA	1
ATTGTGACCCAATAGACCTAGAAG	1
ATTGTGACTGACATATGGGACCCA	1
ATTGTGATGTCTTATTGATATGGC	1
ATTGTGCAACTAGTCCATATGGAG	2
ATTGTGCAGCATGCTACAAGGTGA	1
ATTGTGCAGGGACGGTTGATATTC	1
ATTGTGCGAAGCCATACATGATAA	1
ATTGTGCGCTGCCATCTTTTGTCC	1
ATTGTGGAATTTGCTAGACTGAC	1
ATTGTGGAATTTGGCCGACCAACC	2
ATTGTGGAGCTAGCCGAAAAACC	1
ATTGTGGGTATGGCTTTAACAATG	2
ATTGTGTAGTACCCATTAATAGAC	1
ATTGTGTGAGCTACACAAGGTTGC	1
ATTGTGTGCAGGTGACTTGAGGTC	1
ATTGTGTGTAAGGGCAACCACAATG	2
ATTGTGTGTGTATGAAATATAGAA	1
ATTGTGTGTGTATGATAGGTTAAT	1
ATTGTGTTGAGGATTGAACATGGG	1
ATTGTGTTGTCACAAAAGAGAGGT	1
ATTGTGTTTGTTACTCTTGGGGAT	1
ATTGTTAGTGGGTACCAACTATAT	1
ATTGTTATAAACACAACGGTGTAA	1
ATTGTTATATGACACATGGTT	1
ATTGTTCACGGAAAATTATGGATG	2
ATTGTTCTTGGGCGTTCTCCTGCA	1
ATTGTTGACAATGATATTGTTGGA	1
ATTGTTGACGGGGATACTCGTAGA	1
ATTGTTGAGGTGTACATGTTTTAT	1
ATTGTTGCCCCGGTGCCCGCTCCT	1
ATTGTTGTTGAAGATATGCATGGA	1
ATTGTTTAAAATGCTTTGGGTTCC	1
ATTTAAAATTGGAACGATGTGATGG	1
ATTTAAAGGGTGGTCCACTATACA	1
ATTTAAATAGGTGCGAGAGGATAC	1
ATTTAAATTGGGTCTACCTGATCA	1
ATTTAACAAAAATAGGTCGTGGGC	1
ATTTAACGATGTTGTGCTTTCAGT	2
ATTTAACTATTTGCCACTTTTAGA	1
ATTTAAGATTTTAGGGTGTGACA	1
ATTTAAGCTGATGGAGAAGGGTGG	2
ATTTAATAGTTGGTGTGCACGTAG	1
ATTTAATGTTCACGTTGGTGTAGT	1
ATTTACTATTGATTTTGTCGTG	1
ATTTACTTGGTGCAAATTGAGGAC	4
ATTTAGAAGTTCGGGAAACGTGCG	2
ATTTAGAATTAAAGGTGTTGCAAG	1
ATTTAGATCGGTGCCAAAATGAAC	1
ATTTAGCAGTTTGAAATACGTGCG	1
ATTTAGGTGAGTGCTTTTGTAGAC	1
ATTTAGGTGATATGCACGAAACGA	1
ATTTAGGTGTTTGATGCAAGCTTG	2
ATTTATAAAATAGATAGGTGATAC	1
ATTTATAATATAATAGGTGTCGG	5
ATTTATAATATAATAGGTGTCGGT	1
ATTTATAGAATTGTAGGTGCTCAC	1
ATTTATAGGTCAAAATAAGTGGAC	1
ATTTATAGGTGCCAGTTTTTGTGA	1
ATTTATAGGTGGTTAATAAACTGC	1
ATTTATATTGGAATGGAGTGTCTA	1
ATTTATCTTTGATCTGTGTGCCA	1
ATTTATGACCTCGAATTTGAA	1
ATTTATGAGTGAATGATGTGGATA	2
ATTTATGGGTGCACTAGATCTAGG	1
ATTTATTGACCGGTTGCCATTGCA	1
ATTTCACCCGGAACTAAAGATTGC	1
ATTTCCGCTTCCTTCGTGCGGCCA	1
ATTTCCTAGTGAGGAACAGTGTCT	1
ATTTCCTATCTTTTCTTTCAA	1
ATTTCGAAACTAACCTCTGCCAAA	1
ATTTCGAGGAGATAAGAGATGAGA	5
ATTTCGGGTGAAGTGCCGCATGTC	1
ATTTCTCGGTGAGGTGAGGTGCTA	2
ATTTCTTTGGTGACTAGACTGCTA	1
ATTTGAAGTGGCATATAAGGGAGC	2
ATTTGAATCGGGACTAAAGATAGC	1
ATTTGACGCCGTTGATTTTTTAA	1
ATTTGAGATCTCTGCCTATGTCAT	1
ATTTGAGGGCTATTTGAAAACAAC	1
ATTTGAGGTGTCGACATCATCTGG	1
ATTTGATGTGACGGAAAAGTTATA	1
ATTTGCAATTGTGATAGTGAC	2
ATTTGCATGAAATGGGGATGAGAG	1
ATTTGCCAAATCTAAAAGTGGTAA	1
ATTTGCCACATTTAGATGTGGTAA	1
ATTTGCTAATGATGGATTAATTAG	1
ATTTGGACCTACACTGGAGCTAAG	1
ATTTGGAGTGTTGTTGAATGC	1
ATTTGGATGATCTACTGTAGTGAG	1
ATTTGGGACGATTTGACAGAAAAG	1
ATTTGGGACTACGAGCTATAC	1
ATTTGGGCTGCTTAAAATTCTGAG	1
ATTTGGGTGAATTTGTACTTTGTA	2
ATTTGGTCCTCAAATGTAAATGAA	2
ATTTGGTCGACCGATCAAAGATGG	1
ATTTGGTGAAGTCGCAACACAAG	1
ATTTGGTGACATTGCGCCGGTGAC	1
ATTTGGTGTAGTAGTGTATGTTA	1
ATTTGGTGTAGTAGTGTATGTTAG	1
ATTTGGTGTCCGTATGTTGTTTAC	1
ATTTGGTGTCTAATCTGTTGTTT	3
ATTTGGTGTGTGTGTGTACTA	1
ATTTGGTGTTTGCCAGAATGATGG	1
ATTTGGTTGCGGTTTTTTTGGCCC	1
ATTTGTAGCCAGCTGTAGCACGGA	1
ATTTGTGTTATCGGCTGGGTACCA	1
ATTTGTTAGTTGATGTGCACGGAA	1
ATTTGTTGCCAAATTTGATAAATA	1
ATTTGTTTTTTATATGGCCTAGTC	1
ATTTTACCCAAAGGTATAGGTGAC	1
ATTTTAGCATTGCCGAAATTTTGG	1
ATTTTAGGATGTTTATATTTTAAA	1
ATTTTAGGCCTGCAATATATTCGG	1
ATTTTATAGATGGGATACGATAAA	1
ATTTTCAAATAAGACGGATGGTCA	1
ATTTTCGCTATGGTGCACATATAA	2
ATTTTCGCTGGTGGTCACTTAAGA	2
ATTTTCGTGCTGACTAGACGAGAA	1
ATTTTGAACAATGTGCTATGAGAC	1
ATTTTGACGTGAACTAAACACAGC	2
ATTTTGCATCGGTGTGGCATCAAG	2
ATTTTGCCAAAATGTTAAGTACTA	1
ATTTTGCCACATCGATCTGACTGA	2
ATTTTGGTACCTGCTAAAATTTTG	1
ATTTTGGTGGTCGCTTGGTGAGGA	1
ATTTTGTACCTACTGGTTCTACTG	1
ATTTTGTAGAAAATGGTTAAACTGGC	1
ATTTTGTGGCCACTGCTTTCT	2
ATTTTGTGGGGTCTAATTGGATGG	1
ATTTTGTTGCATGGTGGTGAAAGA	1
ATTTTTACAGAAAGCCGCCTGCAA	1
ATTTTTGCAGACGGGTCTCATAGA	1
ATTTTTTGTTTGATGAGGTATGGT	1
CAAAAAAAGAAAACCAGGTGGAGGG	1
CAAAAAAAGGCAAACCCTGGGTTT	1
CAAAAAAAGTAAGGTGGGAACA	1
CAAAAAACAAAAGATATGTGTGAC	2
CAAAAAACTGGTGACCGTGGATAT	1
CAAAAAACTTTACTGGTTGCCCA	4
CAAAAAAGGAAACTAGGTGGAGG	1
CAAAAAAGGAAACTAGGTGGAGGG	1
CAAAAAATAAAATGTTGCCTGGAT	1
CAAAAAATGGTATGGTGTGAA	1
CAAAAAATTTCAGTTCCACATGAA	1
CAAAAACAGAACCTACATGTCGAA	1
CAAAAACAGTAAGGGAACCCTGCT	1
CAAAAACATCGCATCCGTGTTTGC	1
CAAAAACATGACACGGCTGATGGA	1
CAAAAACATGTAGCCTAACCCAAC	1
CAAAAACCATGGCCGAACAACCC	1
CAAAAACCTGTGTGTGTGCACT	2
CAAAAACGAGACACGGCTGATGGA	1
CAAAAACGATTTGGTACCGTGAGG	2
CAAAAACGGTGCAAACAATGTCCC	1
CAAAAACGTGAACTTTCGATGCT	1
CAAAAACGTGATACGGCTGATGGA	1
CAAAAACTGTACACTATACAAGGT	1
CAAAAACTTTTATGAAATGTGCAA	2
CAAAAAGAAAATTTTTGGGTGTCAC	1
CAAAAAGAAGATTGAGGACCACC	1
CAAAAAGATTAAAAGGGTGAGCT	1
CAAAAAGCCAAACGGAAAAGCTGC	1
CAAAAAGGGCAGCAGTAGGGTCAT	1
CAAAAAGTAGGGTCAAATTGGCA	1
CAAAAAGTGCCCGATTGAGATA	2
CAAAAAGTGCTTGGTGGTCATTGT	1
CAAAAAGTGCTTTGGACCACTCCC	1
CAAAAAGTGCTTTGGGACCACTCC	1
CAAAAAGTGTGTTGGGAGCCGTGC	1
CAAAAAGTTAATTGCCACATCCAA	2
CAAAAAGTTGTTTAAGGATGTGCA	1
CAAAAATATAAATTGGGGTGAATG	1
CAAAAATATAAGTCCCTATGGTAGG	1
CAAAAATCCAAACTATTTAGGTGA	2
CAAAAATCTGATGTGACATAAAAA	1
CAAAAATGACAAATCTAAAAGTGT	2
CAAAAATGATCGGGGCATTGCAAG	1
CAAAAATGCCATCGACAAGTGTGA	1
CAAAAATGGATTATTGCCAGCGGC	1
CAAAAATGTGACACGGTTGATGG	2
CAAAAATGTTGTTTTGGTGTTTGG	2
CAAAAATGTTTTGGTGTTTGGAAA	2
CAAAAATTCCTAGGTGATATGC	1
CAAAAATTTAGGAGGTTTGAAG	1
CAAAAATTTGACAGGTGTAATTAC	1
CAAAAATTTTGGGTTTGGTTGT	1
CAAAAATTTTGGGTTTGGTTGTCA	1
CAAAACAACTTTATTGGTGCTATA	3
CAAAACAAGGTGAGCCATTAACGC	1
CAAAACACGGGAGCGACGATCCC	1
CAAAACATAAGAACTACGCAGCGG	2
CAAAACATGGTGTCATTCTCTTTT	1
CAAAACATTACGTGTGTATGAGA	1
CAAAACATTATGTGTGCATGAGAG	1
CAAAACCAATAATCACAGATGCCA	1
CAAAACCACACTTGATAGGCA	3
CAAAACCACCGCAGATTGGGTCG	1
CAAAACCACCGCGGATTGAGTCGG	1
CAAAACCACCGCGGATTGGATTGA	1
CAAAACCACGGCGGATTAGGTCGA	2
CAAAACCACTCCGGATTGAGTCGA	1
CAAAACCAGTGCAGATGAGATCAC	1
CAAAACCATGTGTCTATACTACT	1
CAAAACCCCTTCTCTTCGGGTGGT	1
CAAAACCGCTTTGGATTGGGTCGA	1
CAAAACCGGATAGGATAGGATGAC	2
CAAAACCGGTGCAAACAATATCCT	1
CAAAACCGGTGCAAACAATGTCTC	1
CAAAACCGGTGCAAACGAGGTCCC	1
CAAAACCGGTGCAAATTATATCC	5
CAAAACCGGTGCAGATTAGGTCC	3
CAAAACCGGTGCATATGAGGTCCC	1
CAAAACCTGCCAGCAAAGCTT	2
CAAAACGAAAATAAAGGGTGGC	1
CAAAACGACGACAGAGGGCATGAC	1
CAAAACGAGATGAGCCATTAGCGC	1
CAAAACGAGATGAGCTATTAGCAC	2
CAAAACGAGGTAAGCCATTAGGTC	3
CAAAACGAGGTGAGCCATTAGCG	1
CAAAACGAGGTGAGCCATTAGCGC	6
CAAAACGAGGTGAGCCATTAGCGT	1
CAAAACGAGGTGAGCCATTAGCT	1
CAAAACGAGGTGAGCCATTAGTGC	2
CAAAACGAGGTGAGCTATTAGCAC	1
CAAAACGAGGTGGGCCATTAGCAT	2
CAAAACGAGGTGGTATTAACGT	1
CAAAACGAGGTGGTATTAACGTA	3
CAAAACGATAAGTATTTTGGGAC	1
CAAAACGATCCACGTGTTGGTGAC	7
CAAAACGATGTCTTCAAGAAGAGA	2
CAAAACGGCCGAAACCTACGCGAC	1
CAAAACGGGGTCCCGTTGCGATGG	1
CAAAACTAAAGGACCTAAAATGAA	1
CAAAACTACATGTACTTTGTACAG	1
CAAAACTACTCTGGATTGTGTCGA	1
CAAAACTGCAGCCCCGGTGTTGAC	1
CAAAACTGTCGGTGATATATTGC	1
CAAAACTGTGCAGACGAGGTCCGT	1
CAAAAGAAAATTTTTGGGTGTCAC	1
CAAAAGAACCTAGGTTTTGAGTGA	1
CAAAAGAATGTTTCAGTTCACTGC	1
CAAAAGACTAGTCTGAAGGGTGAG	1
CAAAAGACTAGTCTGATGGATGA	1
CAAAAGACTAGTCTGATGGGTGAC	1
CAAAAGACTAGTCTGATGGGTGGG	1
CAAAAGACTGGGCCCTACATCTTG	1
CAAAAGAGGCAGTAGGTCGGTGAG	1
CAAAAGAGTGAGGTCTATGTTC	1
CAAAAGATCAAAATTGGGCACGGA	1
CAAAAGATCGGGCCACGAGAGAGA	1
CAAAAGATGGAGCATACTGAAGG	2
CAAAAGATTAGTCTAATGGGTGAG	1
CAAAAGCAATCCAGATCAATATGG	1
CAAAAGCATGGTGCATTTGAAGG	2
CAAAAGCATGGTGCATTTGAAGGT	4
CAAAAGCCAACCAAAGGGCCCAAA	1
CAAAAGCCCACCTCATGGGATGGT	1
CAAAAGCCTCTCGGGCAAACACAC	1
CAAAAGCTAAACTGATTGGGGACC	1
CAAAAGCTAGCCAATGAGGTGAGG	1
CAAAAGCTAGTCATTGAGGTGAGG	1
CAAAAGCTGGACTGTTTGGGGAG	1
CAAAAGCTTGTTATCATATAGGGA	1
CAAAAGGAAATTTTTGGGTGTCAC	1
CAAAAGGAAGGTGGAACCCATTGT	1
CAAAAGGAGGAGTATAAGCCTGTG	1
CAAAAGGCAAAAGTGCAGACGTGC	1
CAAAAGGGATGAGGCAGGGAAGAC	1
CAAAAGGGCATGTAGCCTAGTGGT	1
CAAAAGGGGAAAAGGGGGAGGGT	1
CAAAAGGGGGTGCCGCATACCATA	1
CAAAAGGGTAAGAAGGGCTAT	1
CAAAAGGGTGAGCTATTTGAAGG	1
CAAAAGGTAAGCAATGGAGCCAA	1
CAAAAGGTAAGGTAATGCGTA	4
CAAAAGGTAGTTAATGAGGTGAGG	1
CAAAAGGTGCTAAGTTTAAGCTTG	1
CAAAAGGTGGAGCCTGATGAAGC	1
CAAAAGGTGTCAACTGTCAACCAG	1
CAAAAGGTGTCGATCTGGTCTACC	3
CAAAAGGTGTGGGCTTGATAGCTC	1
CAAAAGGTTGGAGTCTAGTGCAAG	4
CAAAAGTAAGTGGTCGGACTC	6
CAAAAGTACACGGATGGAGATGGA	1
CAAAAGTAGATGGAGGGAGTACAA	1
CAAAAGTAGATGGAGGGAGTACAC	1
CAAAAGTCAACAGATGGATGCTAC	1
CAAAAGTCGCCAACTTGGCGGGCC	1
CAAAAGTCTAAACGCGATGAGTTC	1
CAAAAGTCTATGACATATGGGTCC	5
CAAAAGTGACTTCGTGCGGTGTCC	1
CAAAAGTGACTTCGTGCGGTGTCT	1
CAAAAGTGAGTTTGGGCTGTGTG	1
CAAAAGTGATAGAAACATAGTGGA	1
CAAAAGTGATATCTGACGTGGTAT	2
CAAAAGTGATGTGGGACCCGATGC	1
CAAAAGTGGAGCCAGTAGAAAGAC	1
CAAAAGTGGGTTTCGCCTAAATGC	1
CAAAAGTGGTTTTCGCCCAAATGC	1
CAAAAGTGTGAAGAGAATGGTGAA	2
CAAAAGTGTGAAGATGATGGAGA	1
CAAAAGTGTGGTGAATAAATTGC	1
CAAAAGTGTGGTGGACAAATTGCT	1
CAAAAGTGTGGTGTGACAAAGTGT	4
CAAAAGTGTGGTGTGGTAAGTTAA	1
CAAAAGTGTTGTTTGGTCTAGCAA	3
CAAAAGTTATATTTTAGGACGGTC	1
CAAAAGTTGGATATTTACTGGTGG	1
CAAAAGTTGGATGGTAAAATTGCA	1
CAAAAGTTGGTGCTATCCTCGCGA	1
CAAAAGTTTGCCGCGCGAATCACG	1
CAAAATAAACTAGAGAGATGTGGC	2
CAAAATAACTAAACTTACGATGAA	1
CAAAATAAGGATGTTGCCAAAAGA	2
CAAAATAAGTGCAGCCGTGGATATC	1
CAAAATAATGGTAGCCGTGGATAT	1
CAAAATAATTCTGATAGTAGCTGC	1
CAAAATACAGGGTCGAAACGC	2
CAAAATACATGATCGGATGGACGG	1
CAAAATAGACGTGAAGCGTGTCT	1
CAAAATAGCTGGTGGGACGTACGC	1
CAAAATAGGTGTTCATTAGGTCAA	1
CAAAATAGTGGTATATTCTTA	1
CAAAATAGTTTGCAATGGTGGTA	1
CAAAATAGTTTGCAATGGTGGTAG	6
CAAAATATAAAGGATTTGGGTGTA	1
CAAAATATAATAATTTTAGGGTGG	1
CAAAATATAGCAACTTTGGGTGGA	1
CAAAATATATGTACTCAAGTGCCA	5
CAAAATATATGTACTTAAGTGCCA	2
CAAAATATATGTACTTAAGTGCTA	1
CAAAATATGTGTGGTTTTGTGTGT	1
CAAAATATGTTGGTGATTTGTTGC	1
CAAAATATTAAATGGTGTGTTTTG	1
CAAAATATTGAGGTGGAGGAAAAA	1
CAAAATCACCCTGGATTAAGTCGGG	3
CAAAATCAGGCGAAAATACTGCC	1
CAAAATCGAGGAAGAGGTGCGGAC	1
CAAAATCGAGTGACGGATTGC	1
CAAAATCGGAGGACAAATAAGTC	1
CAAAATCTACAAGATTTGGGGATG	1
CAAAATCTATGATGAATTGTCCAA	1
CAAAATGAAAATTTTTGGGTGTCA	2
CAAAATGAAATGAGAAGGTGTTAT	1
CAAAATGAACTAGAGAGGTAGAGC	1
CAAAATGAACTAGAGAGGTGGAGC	1
CAAAATGAACTAGAGAGGTGGAGCT	1
CAAAATGAACTAGAGAGTTGGAGC	1
CAAAATGAACTAGAGTTGTAGAGC	2
CAAAATGAACTAGAGTTGTGGAG	1
CAAAATGAGGTGGTATTAACGTA	2
CAAAATGAGGTGGTATTAACGTATG	2
CAAAATGAGGTGTACCATTAGCGT	1
CAAAATGATGTGCCGGATTGAAGA	2
CAAAATGATTTAGGTTCCTGC	2
CAAAATGCCCATACGAAGTCAA	1
CAAAATGCCTACAAGGAACGTGGT	1
CAAAATGCCTCTACGTCGTTTTG	2
CAAAATGCTAATCTGAGGCCA	2
CAAAATGCTAATCTGAGGCCAG	1
CAAAATGGAAAAAGTGACGGTGAA	2
CAAAATGGTACCTGAGATGCT	7
CAAAATGGTGGATCTGGATATGGT	1
CAAAATGTAAGGATTGCGGGGTAGA	1
CAAAATGTATTTTTGGGTCCCCGA	1
CAAAATGTGCATAGGATTACCCA	1
CAAAATGTGCCACATGTTTGATGG	1
CAAAATGTGGTCTACTAAATCGG	1
CAAAATGTGTGTGCTTTTCTGTAA	1
CAAAATTACATATGTAAGTGGTGT	1
CAAAATTAGGTATAACAAGGTGAA	1
CAAAATTATGTGCAGTTTCCCCA	2
CAAAATTGAACGGGGACCAAGGC	2
CAAAATTGATTTGGTACCGTGAAGT	7
CAAAATTGCCTCAAAATTCCA	3
CAAAATTGGACACGCAAATATATG	1
CAAAATTGGATTGTGCCACACTT	1
CAAAATTGGGCGCGGAAATTTATG	1
CAAAATTGTGATAAGCTTCGAGGA	1
CAAAATTTCCTAATGAAAGTGAAC	1
CAAAATTTCGCCGAAAAAGGGTCC	1
CAAAATTTGCTTAGATGAGCCCGA	1
CAAAATTTGTGATATGCCACCTG	1
CAAAATTTTGGTAACTACTTTGGC	1
CAAACAAAAAATGGCCATAGCGAT	1
CAAACAAATGAATGATGCAATATC	1
CAAACAAATTTTAGGGGCGTAGAA	1
CAAACAACCGGGACTAAAGTATT	2
CAAACAAGAGTGTAGATGGACAGC	1
CAAACAAGCTTTGTCCTTCGT	1
CAAACAAGGTGGGGCTCTTTATAC	1
CAAACAAGTAAGTCAACGGTGTC	1
CAAACACACGCTACAGAGAGGAAGC	1
CAAACACAGCCTAATAGTAGAGC	1
CAAACACATTGGTGCTGACTGTTG	1
CAAACACCACCTAAGGTACAGAGC	1
CAAACACCCCATGCGATATGCTAT	4
CAAACACCTATATAGCCAACTATC	3
CAAACACCTATCTAACATGGTC	1
CAAACACCTGTCAAATCTGCCTAAC	1
CAAACACTACAGGAGCAGGCTGCC	1
CAAACACTAGTAGCAAAAGTTGGC	1
CAAACACTATGACGTAGGGCCTG	1
CAAACAGAAGTTGTGCATTCAAGT	1
CAAACAGAATAGCGACGGAATGGT	1
CAAACAGAATAGTGACGGAATGGT	1
CAAACAGAATTGGATGTGATGGAT	1
CAAACAGACCCTACAACTCTAC	1
CAAACAGACCCTACGACTCTACGG	1
CAAACAGACCCTAGGTTAGCGCGC	1
CAAACAGAGAGTTATTGGGTTGC	2
CAAACAGAGGGTACTGTGTTGCAG	1
CAAACAGCAGAAGCGTACCCG	2
CAAACAGCTCAACTGGTTCGGCGC	1
CAAACAGGAGGGACTAAAGTGCT	1
CAAACAGGCCCTAAATTAGACACC	1
CAAACAGGCCCTGATTGATGATTA	1
CAAACAGGGCCTAAATTTGTTTAG	1
CAAACAGGGTCTAAAAAGTGTGAC	4
CAAACAGGTGAGCTAATTTTGAGC	1
CAAACAGGTGGACTAATTTTGAG	1
CAAACAGGTGGGCTAATTTGAGGC	1
CAAACAGGTGGGCTAATTTTGAGC	1
CAAACAGTCTCGTGTCTGGCCTA	1
CAAACAGTGGGATACACAACAGAT	1
CAAACAGTTAAGCAGCATGTGCC	1
CAAACATAGCCTAGATGGTTTGAG	2
CAAACATAGTTTTAGTTGGTC	1
CAAACATATAATTATTTCGGTGTC	6
CAAACATATGGTGTCGTCCAA	1
CAAACATGATGATGATACCAAGGC	1
CAAACATGCGGCACAACAGTTTGG	1
CAAACATGCGGCTGCCACAACAGT	1
CAAACATGGGCTAGCCTACTTTAC	6
CAAACATGGTGAATTTCATTTGGA	1
CAAACATGGTTACCGACAAAACAG	1
CAAACATGTACTTAAAAAGTTAGC	4
CAAACATGTGCTAAAAAGTCAAC	1
CAAACATGTGCTAAAAAGTCAAT	1
CAAACATGTGCTAAAGAGTCAA	1
CAAACATGTGCTTAAAATGTCAAC	1
CAAACATTCGATGGTAGGGTGTA	1
CAAACATTCGATGTAACAGGTGAA	1
CAAACATTCGATGTGACAGGGTGA	1
CAAACATTCGATGTGATAGGTGAA	2
CAAACATTTAGGGAAAGAGGGAGT	1
CAAACATTTGATGTGACAGGGTGA	1
CAAACATTTGATGTGATGGGTGAA	1
CAAACATTTTAAAATGGAGGGAGT	1
CAAACCAAACACCTACATTTTCG	1
CAAACCAAACCAGCCTAAGACCGC	1
CAAACCAAACCGTATGTTTCGTGC	1
CAAACCAAAGGGGATTGAGTGGAT	1
CAAACCAATTCGACCTCGGGTGCA	1
CAAACCAGGGCTACAAGAACAGGA	1
CAAACCAGTTAGGCATTGAGAGAC	1
CAAACCATATGAAGGTGTTGGGCA	1
CAAACCATGGGCTGGTTGGGCCG	1
CAAACCCAAACGCAGGGCCATGGT	1
CAAACCCGACAGTGTTGGTGGCAC	1
CAAACCCTAGCTACGAATCTGGA	1
CAAACCCTCATCTTTGACGGCTT	1
CAAACCGAGAAAATATGTAGTGCA	1
CAAACCGATGGTCTCTACGTAAC	2
CAAACCGCAAGATGATGGTAACCT	2
CAAACCGGTAGTCCTCAGGGTAAA	1
CAAACCGTCGAGGGACCGCGTTTG	1
CAAACCGTCTAATTTAGGTCTCA	2
CAAACCGTGTGTCACTCTCAG	1
CAAACCTAATACTAGATGTGACAC	1
CAAACCTACAAAGAGATGTCGCAC	1
CAAACCTACAAAGAGATGTTGCA	1
CAAACCTACAAAGAGATGTTGCAC	1
CAAACCTACGCAGTAGATGATGGA	1
CAAACCTACTACGTGATGTGACAC	2
CAAACCTACTGTGGGATACGAAGC	1
CAAACCTGTGGTACCTTGTAA	1
CAAACCTTTGATGGATGTGACC	1
CAAACGAACAGCCGGTGTCAT	3
CAAACGACACGGATGAGACAGTG	1
CAAACGAGAGGATTTGAGCCGGAA	4
CAAACGAGATGTATGTGGCTC	1
CAAACGAGTTGCCTGTAAAATAGC	1
CAAACGCCTAGCGGAGATGTTGCC	2
CAAACGGACCATAACTAGTGGCGC	1
CAAACGGACCTTAGAATTGAG	4
CAAACGGATCTATCTGTGAGCTA	1
CAAACGGCTGTCACAAGTGAGGG	1
CAAACGGGCCTCAAGTTGATGCAC	1
CAAACGGGGCCTAATATTTTGAGA	1
CAAACGGGGCCTATATACAAGATA	1
CAAACGGTGCATGCAATACATACC	1
CAAACGGTGCCGGGTAGGACTATC	1
CAAACGGTTGAACACCTGTATGGA	1
CAAACGGTTGAGATTGCTCGGTAC	1
CAAACGTATTAAACGGCACCTGAT	2
CAAACGTGAGTTCGTGCGGTGTCC	1
CAAACGTGTCTGTGTTCTTATCAC	1
CAAACGTTAAACGTGGATAGTGCA	1
CAAACGTTCGATGCAACGGGGTGT	1
CAAACGTTCGATGTGACGGGGTGT	1
CAAACGTTCGATGTGATTGGGTGA	1
CAAACGTTGAACGTAAATAGTGCA	2
CAAACGTTGAACGTGAATAGTGCA	8
CAAACGTTGCGCATGAAAAATCAT	1
CAAACGTTGGACACGGATATCCAC	1
CAAACGTTGTGCACGGATATCCA	1
CAAACGTTTGATGTGATAGGGTGT	1
CAAACGTTTGATTTAATAGGGTGT	1
CAAACGTTTTGGTTGCTTGTC	1
CAAACTAAACACACCCTTGGTTGC	1
CAAACTAAGATGAAGAAAGGAGC	1
CAAACTAAGATGAAGAAAGGAGCC	1
CAAACTAAGCGTGCCTCGGTTGGT	1
CAAACTACTAAACGGTGCGTTC	4
CAAACTACTGAGGGCCGCTTTGAA	1
CAAACTAGGGTCCACATATCAGT	1
CAAACTAGGTTGCCATATTTTGG	2
CAAACTAGGTTTTTGGGTTGCTTA	1
CAAACTCATTTGACTTTAGCTGCT	1
CAAACTGAACGAAGTTTGTTTTGC	1
CAAACTGAAGATGAGGCTGCACAA	1
CAAACTGCTAAACGATGTGTTC	1
CAAACTGCTAGATGGTGTGTTTC	1
CAAACTGGACGACAAATTGAGGGA	1
CAAACTGGGACTACCAATCCGGGAC	1
CAAACTGGGCCAGCGTCCAGGAAA	1
CAAACTGGTAGCAGGTAAGGCCA	1
CAAACTGTTGTCTACTTTTCTGAA	1
CAAACTTAATATAGCCTTCAAGAC	1
CAAACTTACAAAGAGGTGTCGCAC	1
CAAACTTATTCGTAGGCGCAGGC	1
CAAACTTCAAACTAATGTGACGAT	1
CAAACTTGAGGCGCCGCAAACTGT	1
CAAACTTGGTATACATACGAATA	1
CAAACTTGTTAGGTGGGTGTAAT	1
CAAACTTTAGAAATGAGGCCCA	1
CAAACTTTGAGTGTCCTGTAG	1
CAAAGAAAAAGGTGCATGCCGC	2
CAAAGAAAACCTGAAACATGCCT	1
CAAAGAAAAGATGTTGGATGGTC	1
CAAAGAAAAGTAGTTGTGCCTTAT	1
CAAAGAAAATATCTAGTGGTGTAC	1
CAAAGAAACCATAGGTGCGAA	4
CAAAGAAATTTACGTGATCAGTGC	1
CAAAGAACCAACCTACGCAACCT	2
CAAAGAACTACTAACATGCAT	3
CAAAGAAGAAGAAGGTGTCCAGGAG	1
CAAAGAAGAGGAGTGCTATGCGAG	2
CAAAGAAGGGTAGCATTATGAC	1
CAAAGAAGTTGATTGGGGACCATA	1
CAAAGAATTGGTAACAATAGTTGG	1
CAAAGACATCTCGAAAACTGTGCC	3
CAAAGACCCTAGTTGTTGATGCC	1
CAAAGACGTGGTATGGAACTA	4
CAAAGACTAGTCGGAGGAGGCTGCC	4
CAAAGAGAGGTAGCGGCGGTGAGA	1
CAAAGAGAGTGCTTGATTGCTTGG	1
CAAAGAGGAGGCCAAAACTTGGGC	1
CAAAGAGGGTGAATACGAAAAGAG	1
CAAAGAGGTGAGGTTGCTTATCAG	1
CAAAGAGGTGTCGCATTCTCGCAA	1
CAAAGAGTGAAAGAGAGATGGAAC	3
CAAAGAGTGTTAACGGATTGAAAC	2
CAAAGAGTTGAGGATTTAGGTGTA	1
CAAAGATAAGTGGTCTCGTGCATA	1
CAAAGATATGTGGTGCTAAGTGAG	1
CAAAGATGAGGGGTCATCGGTGAC	1
CAAAGATGAGTGCATTGTAGAGAG	1
CAAAGATGATGGATGAAGTGT	3
CAAAGATGCTTATAGGGGTATGGT	1
CAAAGATGGACTAAACTAGGGTAAA	9
CAAAGATGTGAATTTGCCCGATGA	1
CAAAGATGTGTCACCTGTGACGGG	2
CAAAGATTGATGAGATGCGGGCGT	1
CAAAGCACTAATTAATCATCCAAC	1
CAAAGCATCGTCGCCAGTGGTCCC	1
CAAAGCATTAATCAGGGATGC	1
CAAAGCCAGTGCGTGGAAACTCTC	1
CAAAGCCGACCCTGTACATGTGGA	1
CAAAGCCGTCACAAATGAGGTCAC	1
CAAAGCCGTCACTGGTATGGTTAC	1
CAAAGCGGTGCCCCCAAAGAGGA	1
CAAAGCGTTCATCAAGGTCCGTAA	1
CAAAGCTATCTACTAACATGGAGA	1
CAAAGCTCGATCCGCCGCGGTTGC	1
CAAAGCTCTACCGAAAAGTCATTC	1
CAAAGCTGATGGAATTTTGGAA	1
CAAAGCTGGCAGATGGGCTTCA	1
CAAAGCTTGCATAGATGGATTCTT	1
CAAAGCTTTGGATTGGGATGATGC	1
CAAAGGAAACACGAAACCTGCCT	1
CAAAGGAAAGTTACCAAGAGGTT	1
CAAAGGAAGGCCTACAAGAATTGA	1
CAAAGGAATATTAGACATAGATGT	1
CAAAGGAATGGTGTCTTTGAAGG	1
CAAAGGAATGGTGTCTTTGAAGGT	1
CAAAGGACCTGTTGTAGAAACCAA	4
CAAAGGATGTAAAGCGAACGGT	1
CAAAGGATGTGCTTTTTGGAG	1
CAAAGGATTCCTTGTGGCTCCCG	1
CAAAGGATTGAATGATGAGGTGGA	1
CAAAGGCAGATTAGGAGGCTG	1
CAAAGGCCAGCAAGGCAAGTCACA	1
CAAAGGCTCGCCTCCTCTTTGAT	1
CAAAGGGAAAACCTTGGTGGCCTA	2
CAAAGGGACGTCTTGGTGATGTGT	1
CAAAGGGAGATCCTAGCGTGC	1
CAAAGGGATTCTAGTATGGTC	4
CAAAGGGCAAGATCAGATCCA	1
CAAAGGGCCCAAAAGCAACAGCTG	1
CAAAGGGCTATCCAGATTCGTTGT	1
CAAAGGGTAGGTTGACACACTGAA	1
CAAAGGGTGATACTAGCATTAGAA	1
CAAAGGGTGCTAATTGGGGCTATT	1
CAAAGGGTGGCTGCTAACACTGTA	1
CAAAGGGTGTTGGTCGATTAA	1
CAAAGGGTTACAGAGACCACCTA	1
CAAAGGTAACCTAACCTACGGACT	3
CAAAGGTAAGCGACACACAGAAAA	2
CAAAGGTACCGAGATGTATCAAA	1
CAAAGGTACTACGAATATGGACA	2
CAAAGGTATGGTGTCTGTGAAGG	1
CAAAGGTATGGTGTCTGTGAAGGA	2
CAAAGGTATGGTGTCTTTGAAAG	2
CAAAGGTGACCGGTCTGTGACTGG	1
CAAAGGTGACTGGACTCACCAGTG	1
CAAAGGTGATGTTTGGTTGGAGG	1
CAAAGGTGATGTTTGGTTGGAGGG	2
CAAAGGTGCCGCAAACTTGCTGCA	1
CAAAGGTGCCGGTTCCAAGACCG	1
CAAAGGTGCTAGTTCCAAAACTGG	1
CAAAGGTGGAGTCTATCTGTGAGG	1
CAAAGGTGGGCTGTACTTGAG	1
CAAAGGTGGGGGCTAATAATTAGC	1
CAAAGGTGGTCGCCATGGGAGC	1
CAAAGGTGGTCGCCATGGGAGCAA	2
CAAAGGTGTATATGTTCTATATT	2
CAAAGGTGTCGGTTTCTAAATCGA	1
CAAAGGTGTGACGAAGACGGAGAG	2
CAAAGGTGTTGGCTCTTATGTAAG	1
CAAAGGTGTTGGTTTAGGAACCAG	1
CAAAGGTGTTGTTTAGAGCTCTAC	2
CAAAGGTGTTTATTATCGAACCAAG	1
CAAAGGTTGATGAGATACGTGCGT	1
CAAAGTAATTTTGGTGACGTGGAC	1
CAAAGTACAATGGAAACCTATGAA	1
CAAAGTACTATGAAAGATGGCCGC	1
CAAAGTAGGAATGATGGAGTTGGG	1
CAAAGTAGGGCGCTGAAACTCATG	2
CAAAGTCAGTGGTATATTGTTGAA	1
CAAAGTCCAAAACATGTGCCA	3
CAAAGTCCTGGCTGGCTGGTGT	1
CAAAGTGAAAAGGTGGACTCTGAA	1
CAAAGTGAAAATTTGGGGGTACAC	1
CAAAGTGACCCGGTTTTATAAGA	1
CAAAGTGAGCAATTTGTAAGTTGT	1
CAAAGTGATCCATTAGTGTGTGA	1
CAAAGTGATGTTGAGGTTTTGA	1
CAAAGTGCGTGTGGTTTTCTACA	1
CAAAGTGGGTGATTTGCCTCTCA	1
CAAAGTGGTGGGCTAAACGATCTGG	1
CAAAGTGGTTGGTGCCGTCGTCCA	1
CAAAGTGTGTGTGGTTTTCTGCA	2
CAAAGTTAACCCTAGGAGAGGAGG	1
CAAAGTTGGACACGAAAACTCAGG	1
CAAAGTTGGACGCGGAAAACTATG	1
CAAAGTTGGGCACGGATATTCATG	1
CAAAGTTGGGTGCGAAAACTTATG	3
CAAAGTTGGGTGCTGAAACTTATG	1
CAAAGTTGGTGCCCTCGAGGTGAC	1
CAAAGTTGTGGCAAAGTATGGTC	1
CAAAGTTGTGTTTTGGAGACCGTT	1
CAAAGTTGTTGTACTATGTAATGT	1
CAAAGTTTGCCTAGACTTTAGCA	2
CAAAGTTTGCCTAGACTTTAGCAC	1
CAAATAAACCCGGTAGCTTTTGA	2
CAAATAAACCGATTGCACCAGGAC	1
CAAATAAATGGCATTACGTACAAT	1
CAAATAACGTTGTCACGTTAGCCA	1
CAAATAAGTGGTGCACACTATCAGT	1
CAAATAATAATAAAAATGGGTGAG	1
CAAATAATGGGTGTTTGAGAGCAA	1
CAAATACCGATGTGGGACTAAAGC	2
CAAATAGAGGTACTTTGTAGAGGC	3
CAAATAGATGTCAAAACAGGGTGA	1
CAAATAGGAGAATTGTCTCGT	2
CAAATAGGGTGCAATAATTGTGAA	1
CAAATAGGTCTTCAGGAGAGAGG	2
CAAATAGGTGCCGGTTTTGAGGTC	2
CAAATAGGTGTCACCACTATAGGT	3
CAAATAGGTGTCGCCACTATAGGT	1
CAAATAGGTGTCGCCATTATAGG	1
CAAATAGGTGTCGCCATTATAGGT	1
CAAATAGTATGGTGATACCGCGTT	4
CAAATATAAAATTAGGTGGGCTGCC	1
CAAATATGCAAGGATGGAAGGCGA	1
CAAATATGGCCCGATTGAGATGAC	1
CAAATATGGGACGCCTCGCAA	2
CAAATATGTAGCCAGCTGCAGCAC	1
CAAATATGTGCCGCCACTATAGG	1
CAAATATGTGCTAAAAAGTCAAC	1
CAAATATGTGCTAAAAAGTCAACG	2
CAAATATGTGCTAAAAAGTTAAC	1
CAAATATTGGTAAGCCTAATTTAA	3
CAAATATTGGTAAGCCTAATTTAG	5
CAAATATTGGTAAGCCTATTTTAG	1
CAAATATTTAGGAACGATGGGAGT	1
CAAATCAATTGGTGTAGCCTGGTC	1
CAAATCAGATGGATAGTTGGCTAT	1
CAAATCAGCCTATATTTCCACA	2
CAAATCAGGGATAAAAGTGGTACC	1
CAAATCATGCATGGATATGTGGTC	5
CAAATCATGGTGTAATTAGGCTTA	1
CAAATCATGTGGGGTATGGGTC	1
CAAATCCAAAGGACGATGGGCTTA	1
CAAATCCAAGCCTGGATCTGGTGGG	1
CAAATCCATTCATCACTTCTA	1
CAAATCCGCGGTGGTTTTGGTCTA	1
CAAATCCGTCAAAGGTGAGGGTTA	1
CAAATCCTTGAATTCAGGGTGTGT	1
CAAATCGGCTACGGTGATATCGAC	2
CAAATCGGGACTACTAATACGGGA	1
CAAATCGGTGTTTGGGATTAGCAGC	1
CAAATCTCCAGGTGAAAACCTTGT	1
CAAATCTCGAGACGATTCGATGGT	2
CAAATCTGAAAACGTGTTCTA	1
CAAATCTGAGAGGTGTCTGTTTGT	1
CAAATCTTCGAACATATGTATGGA	2
CAAATCTTGGTGGGATGCGGACGT	1
CAAATGAACCACATAGGCGCCACA	1
CAAATGAAGGGCATATGTATAGAT	1
CAAATGACTGATGTGGCCGGGGTA	1
CAAATGAGACTAAAGAGAGGGTAGC	1
CAAATGAGGACTATTAAAGAAGAG	1
CAAATGAGGATGGAGAAATATGCA	1
CAAATGAGTGGATTGTTGGAG	9
CAAATGATATGTGCTAGACTGGA	3
CAAATGATCGCCTACAAAAATGTA	1
CAAATGATTAAAAGAGGTGAGGCT	1
CAAATGCAATGAAATTTCCATCATGA	1
CAAATGCATGGTGTCTTCATCAGG	1
CAAATGCATTCAGAAGCTTTG	6
CAAATGCCACCTGCCCAAGAT	1
CAAATGCCCACAGCTCATGTGCCT	2
CAAATGCGGTGAGCTGATGATGGC	1
CAAATGCTAGCTTTGGATGTG	1
CAAATGGAGGTGCTTATTGGGAA	1
CAAATGGGATTCGCCCAAACGCCA	1
CAAATGGGGGCCTCAATTTTTTGT	1
CAAATGGGTAGCTGGCTATATGTA	1
CAAATGGTATAGCAGGTGAGATGA	3
CAAATGGTCAAGCGTCGATAC	5
CAAATGGTGAAACGTTATGCGAAA	1
CAAATGGTGACAAAGTGTGGCTAG	1
CAAATGGTGACTATGGGGTGTTTA	2
CAAATGGTGTAAAATAATGGGTCC	1
CAAATGGTGTCAAATATTTACGGT	1
CAAATGGTTGTCGGTGTACTGTA	1
CAAATGTAAGAGATGCCAGCA	3
CAAATGTGCCACCCTTGCAGAGGT	1
CAAATGTGCCTTAACGAATCTGAA	1
CAAATGTGGTGACCATAAAATTGT	1
CAAATGTGTGTACGTATATCCGAT	2
CAAATGTGTGTCCGTATATCCGAT	1
CAAATGTGTGTCTATATATCCGAT	2
CAAATGTGTGTCTATGTATCCTAT	1
CAAATGTGTGTCTGTATACTTAGA	1
CAAATGTGTGTCTGTATACTTTTG	1
CAAATGTGTGTCTGTATATCCGAT	1
CAAATGTTAAAGTGTGTGCGATGT	1
CAAATTAAAACGATGTGATGGAAA	1
CAAATTATGGTGCAATTAGGCTTA	1
CAAATTCAAATTTGAATCGGGTACG	1
CAAATTCAAATTTGAATCGGGTAG	1
CAAATTCTTGATGTTTTGGGTGTGG	1
CAAATTGAAATTTCAGGGGTACA	1
CAAATTGAATTGTGGTCTCTA	1
CAAATTGACCAAGCCACGAAACCC	1
CAAATTGATTGTGTCGATGCA	1
CAAATTGCATGGAAATTGGTA	1
CAAATTGCTAAACGGTGTATTTC	1
CAAATTGCTTAACGTACGTTTCGT	1
CAAATTGCTTCAGGCCAAGCATGC	1
CAAATTGGAGGACCTAAACGAGT	2
CAAATTGGTAGCAGCAAACTGGAG	1
CAAATTGGTGACATGTAGGGCGTT	1
CAAATTGTATGGTCCGGTTTTGGA	1
CAAATTTAAGGACCAGGGTGACAC	1
CAAATTTCTGCCCTATCAACTTTCGATGG	1
CAAATTTGTGTGAAGTAAGATGAA	2
CAAATTTGTTTGGTGATCTAGTCT	1
CAAATTTTAATAGGATGGTGAGGA	1
CAAATTTTCAAGGGCACACAAGG	2
CAAATTTTGGGCAGTTGGAAGACC	1
CAAATTTTGGTAACTATATAAGA	1
CAAATTTTTAGGTGGTCCATAGA	1
CAAATTTTTAGGTGGTCCATAGAC	1
CAAATTTTTATGGACCAAGAA	1
CAACAAAAAAGTAGCTCGTGGTAC	1
CAACAAAACCTGGATGGTCCCATC	1
CAACAAACCAAACACACAGGTGGA	1
CAACAAACCGTTGTCTTGGCGCCA	1
CAACAAACTAGCCAACCGGATGG	1
CAACAAAGAAAAAAGAAGGTGTT	1
CAACAAAGATGGCCTCATATGCAG	2
CAACAAAGGTGAAACATACTGGAA	1
CAACAAATACAATGGTGTGATCGG	2
CAACAAATCGAAACAAGCTGAGCC	1
CAACAAATGTATAGGTGGTCCCT	1
CAACAAATGTGAGCCTCCATTGAA	1
CAACAAATTTAAAATGTCGGGTAC	26
CAACAACAGATGGACAACGAA	1
CAACAACATCGGAGCCTCTTGAGT	1
CAACAACCCATGGAGAGGTGTATC	1
CAACAACGATGATTTTTGCCA	1
CAACAACTCGTAGAAGTTGGGGAC	1
CAACAACTGGGACGCGACGACGAC	1
CAACAACTGTGCACAATACGAGGA	2
CAACAACTTGACAAGTGGGTGCAT	1
CAACAACTTGACAAGTGGGTGCG	2
CAACAACTTGACAAGTGGGTGCGT	1
CAACAACTTGATAAGTGGGTGCGT	1
CAACAACTTGGCAGGTGGGTGTAA	1
CAACAAGAAGGTGACTGTGGTGAC	1
CAACAAGACAACTGGTGCTGTCCA	1
CAACAAGATAAGATGCAATCTAAA	1
CAACAAGCCACACAGCAAATATGC	1
CAACAAGCTGGCGAGCAACGA	1
CAACAAGGTGGATCTACTGCA	3
CAACAAGTACTGATGGGAGCTGAG	1
CAACAAGTATGTTGCCTATCACTA	1
CAACAAGTCTGGCGTTGTTGGA	1
CAACAAGTTGAGGTGTTACGCTGC	2
CAACAAGTTGAGGTGTTACGCTGCC	1
CAACAAGTTTAAAGGTGGCTCCAC	1
CAACAATAGAGCTGGTGTGCGCGC	1
CAACAATAGTCGGGTGGATTACAG	2
CAACACAAAAGGGCACATGATGGT	1
CAACACAAGATGTGCTACTACTGC	1
CAACACACAAACCCAGGAGAAGGC	1
CAACACACAGTCAACTGACGGTAG	1
CAACACACGGTCAACTGACGGT	1
CAACACACTCGTACCCTCAACATG	1
CAACACATGAAGGCTGAACTCGAG	1
CAACACCACCACGTAAAGTGCCA	2
CAACACCGATGGATGGAGAAGCAG	1
CAACACCGATGGTGCTGAGGCGG	2
CAACACCTACGCTAGATCCACCC	1
CAACACCTGATAGAATGCCTTGGT	1
CAACACGAGAATCTATGCACTAGA	4
CAACACGAGTGGGCCGGTTGAGGT	3
CAACACGCCTTTGCTGGTCCG	2
CAACACGGAAATGCATGGTAGG	1
CAACACGGACACGCGGTGATGGA	1
CAACACGGCGGCAGGCGGAGGTC	1
CAACACGGTGGTTGCTAAGGACAG	1
CAACACGTAAAGGCAGTGCATCGC	1
CAACACTTTCATGTGCGGGTGGTC	6
CAACAGAATCAGGTCCCAGTG	1
CAACAGAGATGCGTCCGTGGTGAT	4
CAACAGAGCTCAGTGGTTGTC	1
CAACAGAGGGTGTGTTTAGTTCAC	2
CAACAGATACAAAAGGTCCTA	2
CAACAGATGGCTGACCGCGATGAG	1
CAACAGATGGCTGGTGGTGGTAAA	1
CAACAGATGGGGCACGATGACGGT	3
CAACAGATGTGTCATTGTGA	1
CAACAGATGTGTCATTGTGAT	28
CAACAGCAAGACTGTCGAGGTGAA	1
CAACAGCATTCTGGTGGTAGTGGA	2
CAACAGCGAAGGGTGGTGGCGCAC	1
CAACAGCGACGAAGCTGGGTGCAG	1
CAACAGCGAGACCACTATTGTGAC	1
CAACAGCGAGGCGTACGTGGTGAC	2
CAACAGCGGCAAATTTGGTTGGGT	1
CAACAGCGTCAAATATTTAGGGAC	2
CAACAGGATGTAGGGTTATTACCT	1
CAACAGGGAGTGGTCTCTCGGT	1
CAACAGGGGTGCCATAGTTGCTAG	3
CAACAGGGTACCTATCAAACTGTG	1
CAACAGGTAGCCGCGTTAAAGCA	1
CAACAGGTCGGATCGGGCACAGGC	2
CAACAGGTGAGCCTACTTACACATA	4
CAACAGGTGGCCCCTAGGTAGGGG	2
CAACAGGTTACCTGATGGAAAGTA	1
CAACAGTAAAGTGTTTATGGTAAC	1
CAACAGTCCTACAAAATGGTTCC	1
CAACAGTGAGACACTCGTGGTGAC	5
CAACAGTGAGGCTGAATGGGGAAG	1
CAACAGTGGGCCCACTTCTCTCGG	1
CAACAGTTAGATAGGCAACCCTA	1
CAACAGTTCTTTGGCACACCCACT	1
CAACAGTTGTATGCACTGACCGGT	1
CAACAGTTGTTGTGAACTTATGGT	8
CAACATAACGGCAAGCCAAAACAC	1
CAACATAAGGTGGACTATTGCAAA	2
CAACATACGACGTCGGGGTGCT	1
CAACATATAATGTCGGGACAAGC	1
CAACATATGAGATGGGCTGGCCAG	1
CAACATATGCCAAGACAAGACG	1
CAACATCGAGGTGCCCATGGTGAC	1
CAACATCGGAGATTAGCCTAGCCA	1
CAACATCGTGCCGATCTATGT	3
CAACATCTTGTTGGGTCCTGTGAG	1
CAACATGAGAAGGCCTATAAACC	1
CAACATGAGAAGGCCTATAAACCC	1
CAACATGAGTGCAGGAGGACTAGC	1
CAACATGCTCAAAGGATTGTTTGGA	1
CAACATGGAAGCCTACATACGCC	1
CAACATGGTCAATGGTGTAGAGG	1
CAACATGGTCGCAACGGTTGGCGG	1
CAACATGGTGCTAATGTGGCAGTC	1
CAACATGTCACCATGCGCCTCAGT	1
CAACATGTGAGGTACGGTGTCATC	1
CAACATGTGTGCCTGATCGTCCAT	1
CAACATGTGTTGATCGATCGGGG	1
CAACATGTGTTTGGATTGAAGCC	1
CAACATTGAAATAGCAGTTGCGGC	1
CAACATTGAGTAGCCGCTGCAGCC	2
CAACATTGCGATAATGCACGGTGA	3
CAACATTGTTGGATACGGAAACCC	1
CAACATTTATAGATTGAGTGGT	1
CAACATTTGTCAGGGCATTTA	2
CAACATTTTTATGTGCGGGTGGCC	1
CAACCAAAAACAAGGGGTGGT	1
CAACCAAAAATAAAAGGTGTTGGC	1
CAACCAAACAAGGATAGGACCA	1
CAACCAAACACCACCTAAAGTT	1
CAACCAAACAGAGCCTAACTCAAT	1
CAACCAAACCTACCGGGGGGTGAA	1
CAACCAAACGAATGCCTAACTAAG	1
CAACCAAACTACAGATTTAAACTT	1
CAACCAAAGATGAGTGCATTGTAG	1
CAACCAAATTGCTCTCGAAATCGC	1
CAACCAACTGTGTGCCATGAAAAT	1
CAACCAAGCCTGGTGGTGTCGCGT	2
CAACCAATAGGTGGCCAAAACTGG	1
CAACCAATCAGGAGTCTTGGTGAA	2
CAACCAATCGGTGGATGTGAG	1
CAACCAATGAGTATTTAGATGTC	1
CAACCACAAGCCAGCGTGGGCAAC	1
CAACCACAAGCTAGTATGGGCAAC	1
CAACCACCTCGATCTAGCCAAAG	2
CAACCACTCTAACCACTGGTCCC	1
CAACCAGAACTAAAGATAGTGCTA	1
CAACCAGAGAATTGGTGAGTGACG	1
CAACCAGAGCCACAACTTTAGGTC	1
CAACCAGAGTGAACTCGCAATGGA	1
CAACCAGATACGAGGAGATGAGGT	2
CAACCAGATAGTTATAATAGGGCA	1
CAACCAGATCAGGGAGGGTCCAAG	1
CAACCAGATGGAGCACGACCTTAG	1
CAACCAGCACCGATGATGGAACTC	2
CAACCAGCCGAGCTCGAGACCTGC	1
CAACCAGGACTAAAGATCCCGGGG	1
CAACCAGGACTAAAGATCCTCGAC	2
CAACCAGGGCTAAATACGGAGGAA	1
CAACCAGGGTTTACATTACCGGTT	1
CAACCAGGTTTTTATGCGAGTAGC	1
CAACCAGTACTTTTACAATGCCAA	1
CAACCAGTTAGGTTGGGTGCGCGC	1
CAACCATAACAACCAGCATGATGC	1
CAACCATAACAATCAGCAACGGT	3
CAACCATAAGCCAGCGTGGGCA	1
CAACCATACAAGTTTAAGGACCGC	1
CAACCATACAGCAAACAGGGCCA	1
CAACCATACCCGGCTGCACAGATC	1
CAACCCAAATATGGGGTTGGTGAC	1
CAACCCAAGCCAATACGGAGGGGA	1
CAACCCAATGACTAGGATGGTATC	1
CAACCCACCTCATCTACTTCTAAG	1
CAACCCAGAGAGAAAAGTGTGCAC	1
CAACCCATAACACTAGACATAG	3
CAACCCATTGGTCCTGCATGTCAG	2
CAACCCCTGGACACAGCTATAGA	1
CAACCCGATGGTGAGTTGTTCCAA	1
CAACCCGGGGTAGTCTTGCGATGC	2
CAACCCTGAAATGATAGGCGTGGC	1
CAACCGAAATTGTGCAGGTGGTCC	2
CAACCGAACAAGTTGGAGGACCTA	2
CAACCGAACACAGCCTTGCATGGT	1
CAACCGAAGGGCTACGTGCAA	1
CAACCGACAGCAGTCAGATGGCAC	1
CAACCGAGACTAAAGATGGGAGCA	1
CAACCGATGGAGATTGGATCCAGC	1
CAACCGCACGGAAAAATAGGGTGG	1
CAACCGCCATAGGGAGTCGATCTC	1
CAACCGCCATAGGGAGTGAATCTC	1
CAACCGGAACTAAAGAGAGGGTAGC	1
CAACCGGAACTAAAGTGGTGATC	1
CAACCGGACTACGAATCCGGGAC	1
CAACCGGAGCCACAACTTTAGGTC	1
CAACCGGGAATAAAGATCATCGGC	1
CAACCGGGACTAAAGATAGCGATC	1
CAACCGGGACTAAAGATGGACATG	1
CAACCGGGACTAAAGATTACGGGA	1
CAACCGGGACTAAAGATTGAT	2
CAACCGGGACTAAATCAACGTGTG	4
CAACCGGGACTACGAATCCGGGAA	3
CAACCGGGACTATAGATATATCTG	1
CAACCGGGAGTAAAGATCCCTGGG	1
CAACCGGGGCTACATATAGAGGA	1
CAACCGGGTGTGGCTAATGGGCGA	1
CAACCGGTACTGATGATAGCGATT	1
CAACCGGTGTCAGATTTCTAGTC	1
CAACCGTATGGGATAATGGACCGC	2
CAACCGTGTCGTTTGAGAAGCA	1
CAACCGTTCCGTGGATTGGGTC	1
CAACCTAAGTACAGATGGGACATG	1
CAACCTAATACTGAATGTGATAT	1
CAACCTACCAACGAAGACCGACGAC	2
CAACCTACCCTTGAACTCTTT	1
CAACCTACGAGTTGGATGGTACA	1
CAACCTACGAGTTGGATGGTACAC	6
CAACCTACTCGAGTGCATAATTGT	1
CAACCTAGATGGTGATTTTACACC	1
CAACCTAGCTAATACAGATTTTAC	1
CAACCTAGGACCAGATGGGACATT	1
CAACCTAGGATGTGATGTGACATA	2
CAACCTAGGATTTGCTGGGCC	1
CAACCTAGTACTAGAATGGGACAC	2
CAACCTCGATAGTTTAGGGGGTA	3
CAACCTCTGGTTGTGTGGGCTGTC	1
CAACCTCTTTGTGCGATTCTT	4
CAACCTGAAGGGAGCATACGGTGA	1
CAACCTGAATAAGGATGGGACGTA	2
CAACCTGCCTCTTATCCACTCGAC	2
CAACCTGCCTGCGTGGACAAACC	1
CAACCTGTCGATGTTTGAGATCGC	1
CAACCTGTGCAAGAGAAACCACCT	1
CAACCTTAATTTGTTGAGCCTCGG	1
CAACCTTAGTGGTAGCGAGGATGG	1
CAACCTTCTACAAGATGGGCA	3
CAACCTTGGGGTACTACTCAGGTC	5
CAACCTTTGGACCTGCATTGGAGC	3
CAACGAAAACCTAATTTGGCCGC	1
CAACGAAATCAAGGATCTAGTCGA	1
CAACGAAATGGAGCCAATCATGCA	1
CAACGAACTATCCTTTTGCTG	1
CAACGAAGATGTAGGATTGGTGGA	1
CAACGAAGGATTGGTATCATGCAC	1
CAACGAAGTGTGCAGCTGTATGGC	2
CAACGAATACAATGGTGTGATCGA	1
CAACGAATCTGAACAGAAGGTTGC	2
CAACGAATCTGGACAAAGGGCTAT	1
CAACGAATTTAATGGTGCAATCGG	1
CAACGAATTTAATGGTGTAATCGG	1
CAACGAATTTACAGTCAAGGTGAT	1
CAACGAATTTTAATGGTGCAATCGG	1
CAACGACAGGACTGCCACCACACA	1
CAACGACAGGACTGCCACCACACAG	2
CAACGACCGGCTTCGGCCAACAGG	1
CAACGACGCTAAACATTTAGGGA	1
CAACGAGATTGCGAATGGGCGAACA	1
CAACGAGCAGACCGGTTATGTGCA	1
CAACGAGCCGAGCCTATAAAATAT	1
CAACGAGGATGAATATGACTTAAG	1
CAACGAGGGTGGCGTGATCAACTA	1
CAACGAGGTGCAATGCCGTCTCAG	1
CAACGAGGTGCAGCGAAGAAGCT	1
CAACGAGGTGCCGTGACTTCGTC	2
CAACGAGGTGTGCATGTGGACATG	1
CAACGAGTTTGGTGCGATGGCGGC	1
CAACGATAAAAAATGATTTGGTACC	1
CAACGATAATTGGCATCGTCCCCA	1
CAACGATAGCTGACGACGGGTGGC	1
CAACGATATCGGAATAGTAGTGGT	1
CAACGATATTGAAGTCCACTC	1
CAACGATCGGAAACGATTTGGTACC	1
CAACGATGAGCGCGGTGGTGCTTG	3
CAACGATGTGCCTGTGATGACTTC	4
CAACGATGTGTAGGGTGGTCGGAC	3
CAACGATTGGTTTGGTTTGGGCTT	4
CAACGCAACCGCTCTTGTATGGG	1
CAACGCAGTGTAGCGGGGTTAGC	1
CAACGCATGATGGTTAATGAG	9
CAACGCATTTATGTTTTGGGGCAA	1
CAACGCCAGCAAGCAGGATGA	1
CAACGCCTACTTGGGGGTGAA	4
CAACGCCTAGAGTGTTGGTGTGA	1
CAACGCCTAGAGTGTTGGTGTGAC	4
CAACGCGATGATTTGAAGCCT	1
CAACGCGTGAGGTGTCAACTAGTT	1
CAACGCGTGATGTTGGGTGTTGTC	1
CAACGCGTTTCCGATCGTTGGATA	1
CAACGCTGAGTCAGCTGCCACGTC	1
CAACGCTGGTGACGTATGGTGTC	1
CAACGCTTTTGGGCTACATTC	7
CAACGGAAAGCTTGATGAAGGCTC	1
CAACGGAAGTGCAACACCGATGGT	1
CAACGGAGGTTTAACGAGGACTAA	1
CAACGGATGAACGGACGCGGC	1
CAACGGCACGGTGATCCTACGCAC	1
CAACGGCGTCAAACATTTAGGGAA	1
CAACGGCGTCAAACATTTTGGGA	1
CAACGGCGTCTCACATTTAGGGAA	1
CAACGGCTACAACTAAACCGGTGA	1
CAACGGCTAGCTTTTGAGATGGGA	2
CAACGGCTAGTTTTGGTTGGTGGG	1
CAACGGCTTAGAATTATTGATGAT	2
CAACGGGAACCACCTCACATCCGC	1
CAACGGGAAGCGTACATATCAGA	1
CAACGGGACAGACATGGTGAT	5
CAACGGGACAGACATGGTGATGCC	1
CAACGGGACTAAAAATAACATTGG	1
CAACGGGAGGGTAGCACATACATA	1
CAACGGGCTTCACGAGATATGCGT	1
CAACGGGGTGGCGGCGTTTGAGAA	1
CAACGGGTAATAGTGGAGGATGCC	1
CAACGGGTATATTTGCAGACTAAA	1
CAACGGGTGAAGCTAGGATGAAATT	2
CAACGGGTGGTAATTGCTAAA	1
CAACGGGTTTTATGAGGTGTGCGT	1
CAACGGTACACAAAGGAGGTTGCA	1
CAACGGTACGGTGCAGTCGACTG	1
CAACGGTAGAGCGAGATCGATGGT	1
CAACGGTAGGAGGCAACTGAA	2
CAACGGTATGAACGTGGGAAATGC	1
CAACGGTCGACGACGGTGGTAGGC	1
CAACGGTGAGATTAGATAGTGCC	1
CAACGGTGAGATTAGATAGTGCCA	11
CAACGGTGATGAGTCCTACAGAC	2
CAACGGTGCATCCTTAACAAGGAG	1
CAACGGTGCTAGATTGGTGGGAGG	1
CAACGGTGGCGTTGATGTGGTAGT	1
CAACGGTGTAAGTTGTGGTCC	2
CAACGGTGTAATCAGATTGTAGAT	1
CAACGGTGTCAAACATTTAAGAAA	1
CAACGGTGTCAAACATTTAGAAA	1
CAACGGTGTCAAACATTTAGGGAA	4
CAACGGTGTCAAACATTTCGAA	1
CAACGGTGTCAAACATTTCGAAAC	3
CAACGGTGTCAAACATTTTGA	1
CAACGGTGTCAAACATTTTGAAA	2
CAACGGTGTCAAACATTTTGAAAC	1
CAACGGTGTCAAACATTTTGAAGCT	1
CAACGGTGTCAAACATTTTTGAAA	1
CAACGGTGTCAAATATTTAGGAA	1
CAACGGTGTCAAATATTTAGGGA	1
CAACGGTGTCAAATATTTAGGGAA	1
CAACGGTGTCAAATATTTTGAAA	1
CAACGGTGTCAAATATTTTGGAAC	2
CAACGGTGTCAATCGGAGTCACGG	1
CAACGGTGTGATCGGTTTGTAGATC	1
CAACGGTGTTGGCATGGACTTAT	1
CAACGGTTGTGCGAAATCGATGGT	2
CAACGGTTGTGCGAGATTGACGGT	2
CAACGGTTTGATGGTTATCGCGA	1
CAACGGTTTTGGTGACGACTAGGG	1
CAACGTAAGTGTGAGTAAGGTGAT	2
CAACGTACGCGTCTAATGGTCCGC	1
CAACGTAGGTGCTGAGTGACTGAG	1
CAACGTCAGCGCCAATGTGTTTGG	1
CAACGTCAGTTGACGTGGCGCTG	1
CAACGTCATTGATATTGTGGTCCA	1
CAACGTCCTCATCCTAGATGGAAC	1
CAACGTCGGAGGCTTTATTGTGGC	1
CAACGTCTCGGTAGACAATGGTAT	3
CAACGTGACGACACAATGCCA	2
CAACGTGAGAGAAACACTATGGGT	1
CAACGTGCTCAAGGTGTGACTGA	1
CAACGTGCTCGCTTAGATGAG	1
CAACGTGGACAGCTTAAATGTGAT	1
CAACGTGTAACTCACGATGTGCTT	1
CAACGTTGCCGCAACAGGAATTG	1
CAACTAAACAAGGCCTGAACTA	1
CAACTAAAGTGTATGCGCATCC	4
CAACTAAATAAGACGGTGGGTGCA	4
CAACTAACAAGGATTAGCCGGGTC	8
CAACTAACGGAGATGGGTATAGAG	1
CAACTAATCTAGATAGGAAGGTGT	2
CAACTACAAAGGCACGATGATGA	1
CAACTACAAGGTGCCATGAAGCGG	3
CAACTACACAAGTATTGTTGGGAT	1
CAACTACACGTTGGGCGCTCGA	6
CAACTACACGTTGGGCGCTCGATCC	3
CAACTACACGTTGGGCGCTCGATCCA	1
CAACTACCCACTCACCACAACCAA	1
CAACTACCCTGCATGGAGCTG	1
CAACTACGACCTGTCATAGATGAC	2
CAACTACGAGGAGACAGCCAGTCTG	1
CAACTACTAACTGGGCCTAGTACA	1
CAACTAGAAAACTACAACTAC	3
CAACTAGATCTCTGGAAATGTGGC	1
CAACTAGATGGATTTGGTGTGGCA	1
CAACTAGATTTTGGACCTCAA	2
CAACTAGCACAGTTGATAATGAA	1
CAACTAGGAAGTAAGGGCCTGGTTG	1
CAACTAGGCATGCCATTGGTTGGA	1
CAACTAGGGTGGAAGCTAGCCTGC	5
CAACTAGGGTGGTGGTATAAGTA	1
CAACTAGTATTGAAGCCTCGAAGC	3
CAACTATACTGACTTGGGACCTAAA	1
CAACTATATGCGGGTCGATGTAGC	1
CAACTATGGGCCCGTCACAAGTGG	2
CAACTATTGGTAGGCTAGCTAGGC	3
CAACTATTTGTACCAGATGGATGT	1
CAACTCAACCCAAGAGCAGGTGTA	1
CAACTCAATAGATGACATTAACGC	1
CAACTCATCCGGTGCACAAGTATG	1
CAACTCCCGCACGGATTAGGTGGC	1
CAACTCGAGGAGAGGTGGAGCTGA	1
CAACTCGATGTTGGTGTTGGCAGC	7
CAACTCGGGAATGGAGATGATGGT	1
CAACTCGTGTCTACGTCATGTACG	1
CAACTCTACAAGTATGGTCGA	8
CAACTCTACTTCTTGATGT	2
CAACTCTAGCCTATGTGTTGTGC	1
CAACTCTGGTGAGATTTGCTGA	1
CAACTGAACAAGTTGGAGGACCT	1
CAACTGAACAAGTTGGAGGACCTA	22
CAACTGAACGAGTTGGAGGACCT	1
CAACTGAAGTTGATGAGTCATGGA	1
CAACTGAATAAGTTGGAGGACCTA	1
CAACTGAATAAGTTGGTGGACCTA	1
CAACTGACGGTAGTGGCATGAGAG	1
CAACTGACGGTGGATTGACGGTAA	1
CAACTGACGTTGAATGCCGTGCCA	1
CAACTGACTAGGAGAATGAGTGAC	1
CAACTGAGACCTAACGGGTATGGT	1
CAACTGAGTTTTCGGGGCGGGTA	1
CAACTGATACTAAAGATTCGGGAG	1
CAACTGATGCTGAATGATGTGCC	1
CAACTGATGCTGAATGATGTGCCA	4
CAACTGATTAGTAGCAGGGGGTGT	2
CAACTGCATATTAGTGGTGGTGGA	1
CAACTGCCCAAGTAGAACTCA	1
CAACTGCGACACACGTGCCCGTGA	1
CAACTGCGAGTACATTCTGGTGGC	1
CAACTGCTAATAGATGAATTATG	1
CAACTGGAATTGAATGTCGTGCCA	1
CAACTGGACAAGTTGGAGGACCTA	1
CAACTGGATGCATGGCAAGACTGC	1
CAACTGGGAGTTCCGGTTGGTGG	1
CAACTGGGAGTTCCGGTTGGTGGT	11
CAACTGGGTGGCTTATCAACAAT	1
CAACTGGTCCGCCTGCGAAAGGAG	2
CAACTGGTCCGCCTGTGAAAATA	1
CAACTGGTGCATTGTTTACAT	2
CAACTGGTGCTGAATGCTGTGCCA	3
CAACTGGTGGACTACGCCGACATC	3
CAACTGGTGTGAAAATGAGTGT	1
CAACTGGTGTGAAAATGAGTGTCC	2
CAACTGTACTGGTCGATATTTGAG	1
CAACTGTCGACAGTTTTTGGGATG	1
CAACTGTCGACTGCAACAAGGTAC	1
CAACTGTCGAGCCGTGCCATGCTT	1
CAACTGTGATTCGATTTTGGTGCT	1
CAACTGTGCTAGTTGGTTTTGGAA	1
CAACTGTGTCTGCGATGGGGAGA	1
CAACTGTTTTGATGGAAATAACG	1
CAACTTAAAAGGTGGTGGCAGTT	1
CAACTTAAAGCTGGTGGGTGTAAT	1
CAACTTACGGATTGCATGGAAA	1
CAACTTACTAAGCCTAAAGGAAT	1
CAACTTCATCGCCCCGCTGTTGGT	1
CAACTTGAGAGTGCACACATC	1
CAACTTGAGGCCCGTTTGAGATAA	1
CAACTTGAGGCCCGTTTGAGATAAC	1
CAACTTGGTAGCATTTCTGGC	1
CAACTTTGGTGTGTTTAGTTC	3
CAACTTTTGAAGGTGTTTGATTGG	2
CAACTTTTGGGACTATGAAATCGA	1
CAAGAAAACTGTAACTTTAGTGAC	2
CAAGAAAAGGTCTTGCAAGGTC	3
CAAGAAAAGTAAAAGGGTGGCGA	1
CAAGAAACGAGTTAGTGTTTGAC	1
CAAGAAACTAGTACTAGACACTAC	1
CAAGAAAGCAGACGCACAGTGC	1
CAAGAAAGGACACCTACCAATAG	1
CAAGAAAGGAGGGGATATGCACGT	1
CAAGAAATGTGTGCGTGGACTAAC	1
CAAGAAATTTTATACAGGTTCAGG	1
CAAGAACAAGGCGAGCATGTACAC	2
CAAGAACAAGTCAGGACAACGCC	1
CAAGAACACCGCCACGCCACGCCA	1
CAAGAACAGACCGTGGGTGTGTAC	3
CAAGAACATGAGCCTAGGGATGTAA	1
CAAGAACGTGTTGAAGATGATGGA	1
CAAGAACTCATTGTGCCTGTTCCC	1
CAAGAACTTAAAAGTTAGGTGCG	2
CAAGAACTTAAGGTGCTGCTGAG	1
CAAGAACTTGATAGGTGCATGTGA	1
CAAGAACTTTGGGTGCCAGTA	3
CAAGAAGCAACCGGTGGTGTCTC	1
CAAGAAGGAGATGTGCCCAAGAAG	2
CAAGAAGGGCCGAGTGACAAACAC	1
CAAGAAGTAATGTGTGCATGACAG	1
CAAGAAGTGTGTGCGTGAACTAAC	1
CAAGAATAGGCCTGCAACAACGTGT	1
CAAGAATATAGGTGAATAAAAGGA	1
CAAGAATATTAAATGTGGGGAAAA	1
CAAGAATATTGGCCACCTATCGAA	1
CAAGAATATTTGGTGACGTGAA	1
CAAGAATCAGCTAGCTGTGATGCC	1
CAAGAATCCAAACAGGTGGGCTA	2
CAAGAATCCAAACAGGTGGGCTAA	2
CAAGAATGCCGAATAGTCAAG	1
CAAGAATGGAAGTGATTGAAGTGT	1
CAAGAATGTATAATGTGCTTCAGA	2
CAAGAATTAGTGGTGGGGCTGCAC	1
CAAGAATTGAAGCCTACAAGGACA	1
CAAGACAACAACAACTACGTAGGG	1
CAAGACAACCAAGATGGTGTTTGG	1
CAAGACACAATGTGTTGACAGATG	3
CAAGACACGCCGCCGGATATCAAC	1
CAAGACACGCCGCCGGATATCGAC	1
CAAGACACTAGACATGGTTTCCA	1
CAAGACAGCTGGTGGATGACA	1
CAAGACAGTATATATGTGGGTGG	1
CAAGACATCATGTGAGATAAGTGG	1
CAAGACATGTGGTTGGACGGCCGG	1
CAAGACCAAGGATAATTTTAACGC	1
CAAGACCACGGTAAAACGCGGGTT	2
CAAGACCCATGAATATCCCCGGA	2
CAAGACGAGTGTCCTCATGGCCGA	4
CAAGACGATGGAGCCTATCCGCC	1
CAAGACGCAGTGTGTATATGGTAA	1
CAAGACGGGTGATGGTGGTAGTGT	1
CAAGACTAATGGGCAAGGTTCAAC	1
CAAGACTGGGATCAATTACCA	1
CAAGAGAAAAGGAGCACACAGAC	1
CAAGAGAAACAACTGACGGCTGC	1
CAAGAGAAATATGAGGGCTTA	1
CAAGAGAGAAAATGGAGCTGGAAA	1
CAAGAGAGGGAATACATCAGGAGG	2
CAAGAGAGGGGCAAGGTATGGAAC	1
CAAGAGAGGTGGAGCTAGAGCTAG	3
CAAGAGAGGTGTGAGTTGTACGA	2
CAAGAGATTCAGCCCTCGATGGA	2
CAAGAGATTGAACCAGTGTGTCTT	1
CAAGAGATTTTGATGGTATGTGAC	1
CAAGAGCAAACGGTGGGGAGCGAC	1
CAAGAGCATATAGGGTCCGTTTGGC	1
CAAGAGCATGATTAGAGGTGTCG	1
CAAGAGCATGATTAGAGGTGTCGG	1
CAAGAGCTCTTCCGGCGTTGTTGC	1
CAAGAGGATCCCGTAATTCCACA	1
CAAGAGGCCAACTTGGAGGAGCTG	2
CAAGAGGGAGCTTCAAGTAAC	2
CAAGAGGGTCCCGTAATGTCTATA	1
CAAGAGGTAATCTGTCTCGATGG	1
CAAGAGGTACCAAATTTATAATAG	2
CAAGAGGTATATATACGGTGGAAC	2
CAAGAGGTATATATATGGTGGA	1
CAAGAGGTGCACGGATCGCTCCGG	1
CAAGAGGTGTGGAACTAATTCCG	1
CAAGAGGTTGAACCCTAGTTG	2
CAAGAGTAATGAACTAGGTGCTGA	1
CAAGAGTAATTGCCTAATTGG	1
CAAGAGTAGAGTGACACACAAGC	1
CAAGAGTGTATCCGATGGGTT	1
CAAGATAAGAATCTTGAGCTGCCA	1
CAAGATAAGCAGAGATGGTACCTG	1
CAAGATAATGCAATGGAGTGCCAA	1
CAAGATAGGACCTGCTTTATAAC	1
CAAGATAGGTGGAGCTAGAACTGT	1
CAAGATAGGTGTGTGCATAGGATA	2
CAAGATAGTTGGCTACAAATTTGT	1
CAAGATATATGGTATTGCGATTGA	1
CAAGATATGATATGCCGGTTCAGT	1
CAAGATCAAGATACGTACTGAAGC	1
CAAGATCAAGATACTGAAGGATGC	1
CAAGATCGGTGTAGGTTGCCCCAA	1
CAAGATCGTCTGCCTTCACTC	2
CAAGATCGTGGACCTATGTGAAAC	1
CAAGATCTTACATGATTATGGTAC	2
CAAGATGAGGGACCTCTGGTGTAC	1
CAAGATGATGGACCTTGATGTGCA	1
CAAGATGCAAATTGTGTGGCTCAA	1
CAAGATGCAAATTGTGTGGCTTAA	1
CAAGATGCCGGATCGATTTGTGTC	1
CAAGATGCCTGTGATGATTGCTGC	1
CAAGATGCTACTTTGATCAACAAT	2
CAAGATGGACACAAATACTATTG	2
CAAGATGGAGGGCTAGATGACTTGG	1
CAAGATGGGGAGGAATGTATGGTC	1
CAAGATGGGTGACTAAATTGCA	1
CAAGATGGTAGATATGATGTATAG	1
CAAGATGGTGGGCTAGACGACCTG	1
CAAGATGTAATGTATCTATGATA	1
CAAGATGTCCATGCGTTACAACGG	1
CAAGATGTGCTAATTGGGGTTATT	1
CAAGATGTGTACAAGTATGGC	1
CAAGATGTGTATTGTTAGATCCAA	2
CAAGATGTGTGATATATTATGGTA	1
CAAGATGTGTTCATGAGGGGT	1
CAAGATTAATACTTTGTGGGTGAC	1
CAAGATTACAACCCTAGAGAGTC	1
CAAGATTATAATGGGATTATGGA	1
CAAGATTATAGAGTGCCTTCCCAA	1
CAAGATTATGCTCATGCTGTGCTA	1
CAAGATTCAAATCTTGGTGCTTAT	2
CAAGATTCAGAGGGTGTTTGGTT	1
CAAGATTCTAGGCCTGTTTGGTAC	2
CAAGATTGAAAGTGTGCATGCATG	1
CAAGATTGGTGAGAATACAGGTGG	1
CAAGATTTAGCAGCAAGACTCTGA	1
CAAGATTTATGGTGCATCGACCGC	1
CAAGATTTGTGTAAGAATTGGTGG	1
CAAGATTTTGGACCTGCACTGAAGT	1
CAAGATTTTGTTGTGCCGCAT	1
CAAGCAAAATGTGCAACATGACAG	1
CAAGCAAATCCAGATGATGTCGAC	2
CAAGCAACCTCAGACTGCTTG	2
CAAGCAAGATATTGTATGAAGAAG	1
CAAGCAAGATTGGTGGGATTA	2
CAAGCAATTGGGGGATTGGAGG	1
CAAGCACCCAGTAATATTGCCA	1
CAAGCACGTGCTTAAAAGATGGAT	1
CAAGCAGAAGTGCAGCTGGGCA	1
CAAGCAGACCGGAAGCCAGAA	1
CAAGCAGCAGCAGGTGGCCCAACC	3
CAAGCAGCCGGATGCCTTACACAG	1
CAAGCAGGTTGCTCATGAGGTGGG	1
CAAGCATCACGTGGCTAGACGGGT	2
CAAGCATCTATACTGTATCGGGAC	1
CAAGCATGATCGACCGGCTAA	1
CAAGCATGCTTGCAGATCATG	1
CAAGCATGGTGAGGTGCCCCTGTC	1
CAAGCATGGTGTGAGAAAGAC	3
CAAGCCAAGACATAGAAGGACCGC	1
CAAGCCAATACGGAGGGGACTTCG	1
CAAGCCAATCATGATCGGCCTGCC	1
CAAGCCACAACTGTTGCAGTGAAC	1
CAAGCCACACACACTTTAGAGGCA	1
CAAGCCACAGCTGGAGTGGAG	1
CAAGCCACATCTTTAGCACTTC	1
CAAGCCACCACAGCAACAATGCAC	1
CAAGCCACGTAGGTGCCACGTCAG	1
CAAGCCAGGAGCTACATTGGGCAC	1
CAAGCCAGGAGTACGATATTACA	1
CAAGCCAGGGAAGAATTTA	1
CAAGCCAGTTGTAAGTGTTCA	1
CAAGCCATCTCTACTCATGGTCAC	2
CAAGCCATGATGACTGATGATGAC	1
CAAGCCATGGTATACAAAGCGTATG	1
CAAGCCATTGTGACATCTGTGTGA	1
CAAGCCCCCAAGGGCCCGTGC	1
CAAGCCCTACCGAACTATTAG	1
CAAGCCCTGTCAACCTATGGAAA	2
CAAGCCCTTAGAGATTCATGGTAC	1
CAAGCCCTTAGTTTATTACCCTA	2
CAAGCCCTTCCTTTGGAGCCGAGC	1
CAAGCCGAAACGATGCCGATTCTA	2
CAAGCCGATCTGATGTCCAGACTC	1
CAAGCCGTCAAGCTTGTCGGTGCA	1
CAAGCCGTCACATGCGACAAGGA	3
CAAGCCGTGCTAGTAGTGATACAG	1
CAAGCCTATCGCTGCACTCTCC	1
CAAGCCTATTGGGAAATAGAACA	1
CAAGCCTCATCTATAATTCAA	1
CAAGCCTGTGGACAGTTCGTC	4
CAAGCGAAACAGGATTGCTGTGCC	1
CAAGCGAAAGCCTAGTCCGGTGGT	1
CAAGCGAGGGTGCAGTAGCGGAGA	4
CAAGCGATGATTGCACGGATCGAT	1
CAAGCGATGGGCGAACGAAGCGGC	2
CAAGCGATTGTGGGCCCACGTGAG	1
CAAGCGCGGGTAAACGGCGGGAGTA	2
CAAGCGGCCCTACTTGTTCTC	1
CAAGCGGGAGGTGGCCAAGCTC	1
CAAGCGGTGATTCCGTCTCAA	1
CAAGCGGTGTACGACACGATGAGA	1
CAAGCGTGCCATGGTGTTTCCAGC	1
CAAGCGTTCCAGAGAGTGATGCCA	2
CAAGCTAAAGATGTGAGGTTCCCC	1
CAAGCTAACAAAGGAGCATGGTAC	1
CAAGCTACATTGTTTGATTGGTAC	1
CAAGCTAGAAAAGTGGATGGGTT	1
CAAGCTAGAATGTGATGGCAC	1
CAAGCTAGCAAGCGGCGCCTG	1
CAAGCTAGCTAGGCGAGGTGGGAC	1
CAAGCTAGCTTACGATGGAAGTC	1
CAAGCTATAAAGCTACAGCTAGGT	1
CAAGCTATTTATAGCTAGGTGTAA	1
CAAGCTATTTGGCAGGAAGAG	1
CAAGCTCATACCCATTATGGTA	1
CAAGCTCGAACGACAAGTGGT	2
CAAGCTCGAATCAAGCCTTGGACG	2
CAAGCTCGGACAAGGTGTCTT	9
CAAGCTCGTGCCCAAGTGTCGCCC	1
CAAGCTCGTGCGACGAGTGGTGGT	1
CAAGCTCTTGTCTTTTGGTGTAG	1
CAAGCTGAAAGAAATAGGGCCTAA	4
CAAGCTGAACGTTTTGGTGGGCTC	1
CAAGCTGACATGGCAGACGACAGC	1
CAAGCTGACGTAGCAGACGGTGGC	1
CAAGCTGACGTGGCACATGGACGC	3
CAAGCTGACGTGGCAGACGGTGGG	1
CAAGCTGACTTGCTGTAGTGTGTC	4
CAAGCTGCAAAGGGTGTTTTA	2
CAAGCTGCCACATAGCACTCCTAT	1
CAAGCTGCCGCTGGTAGGGAAGAG	2
CAAGCTGGAGGAGTTGATGGGTCC	1
CAAGCTGGATAAGTGTATGGGTT	1
CAAGCTGGTCCTTGGTGTTGATGT	1
CAAGCTGGTGTTTGGATCCCCGCC	1
CAAGCTTGACACAGCGTTGAT	1
CAAGCTTGCCTAAGGTTAGACGAA	2
CAAGCTTGTGCTCCAAGAGACCCA	1
CAAGCTTTTGACGGTTGAGGC	1
CAAGGAAAGAAGAAGTCACTGGTC	1
CAAGGAAAGTTGCGAGATGGCCC	3
CAAGGAACCCTAGGTTTTGGGCCA	1
CAAGGAACTAAGACGGTGTTT	3
CAAGGAAGAACACTATGGGTC	1
CAAGGAAGTTGGTGAACTGATGAC	2
CAAGGAATGCAACTGTGATGCCT	1
CAAGGACAACAACTATTGGTAGGC	1
CAAGGACACGAAGCTAAGATAAGC	1
CAAGGACACGAAGCTATGGATAGG	1
CAAGGACACTGATGGCCCAGCTA	1
CAAGGACAGCGGTGAATTGAGAAC	1
CAAGGACATTTATTGATGTTGTT	1
CAAGGACCGTAAAATTGATCTTGT	1
CAAGGACGTAAGGTGCATTGATAC	1
CAAGGACGTGAATGTTTGCCC	1
CAAGGAGAAGGAGACTCCCGTCAA	1
CAAGGAGACAAACGCCGATGC	2
CAAGGAGAGGATTATGGTGCATG	1
CAAGGAGATCTAGATTAGGTGTGA	1
CAAGGAGCCGATGGAGTAGTTCAG	2
CAAGGAGCCGTAGGAGCAAGTTCA	1
CAAGGAGCGTAAAAAAGTGGGCCT	3
CAAGGAGGCCTTGGGGTTGATGGC	1
CAAGGAGTGGTCACTGTGGTT	1
CAAGGAGTTGCTTGCCGAACTAGA	1
CAAGGATCCAAACAGGTGGGCTAA	1
CAAGGATCCAAATATGTGGGCTAA	1
CAAGGATCCTACGTGGCGCTGATG	1
CAAGGATGAGCCGATGATTTCAGC	1
CAAGGATGATTTTATACTTGC	1
CAAGGATGCCTGTGGAATGGAGTC	1
CAAGGATGTGAAGCCTACCAGG	2
CAAGGATGTTTTCCGATTGGGTGT	1
CAAGGATTCCGAGGATTGGTTCGC	1
CAAGGATTGCCTGTGGAATGGAGT	2
CAAGGATTGGTGGGAAACGCTTG	1
CAAGGCAACCTGTGGAGGGCA	1
CAAGGCATAGAAGATTGAAATGAA	1
CAAGGCATTGGCTGGAATTGGTAG	1
CAAGGCCAACACTGATGGGCTCA	1
CAAGGCCAAGGGTGGTGATGTACG	2
CAAGGCCAAGGGTGGTGATGTACGT	1
CAAGGCCAGCAATAAGAATGA	1
CAAGGCCAGGATAAACCCAGA	1
CAAGGCCATCGAAGCGGAGGTGGA	1
CAAGGCCGACACGGCTACGGTGAC	1
CAAGGCCGCAAGGTGATGACTCAA	1
CAAGGCCGGTTCATTGTAAAACC	2
CAAGGCCTCACGGTTGACAACTTT	1
CAAGGCGGTAGAGAGGATTTCT	2
CAAGGCTCATGCAACCAGTAGTC	2
CAAGGCTCGTGTAAATCATGTCGC	3
CAAGGCTGGATCACTGCGATAAAT	2
CAAGGCTGTTGTCGGCCATGGAGC	1
CAAGGGAAACCGAGATGGACGCA	1
CAAGGGAAGTGATCGTTGCTG	2
CAAGGGAATCTACGAACTATACC	1
CAAGGGAATTGGATGGTTGAGATT	1
CAAGGGAATTTTAGGACAGGTGGC	1
CAAGGGACCCAGATGAAAAAGTAC	2
CAAGGGACGAAAATCGGACTGGGT	1
CAAGGGACGAAAATTGGATTGGGC	1
CAAGGGATCATCTTCTTATAT	1
CAAGGGATGCCTGTGGAGTGGAGT	2
CAAGGGCAAGAACCTATGTGCTGT	1
CAAGGGCACAATGGTAAGTAGTAC	4
CAAGGGCCAAGAAGTGTGGCA	1
CAAGGGCCAGAGAAGCAGTC	1
CAAGGGCCTAAGACAAAAAGTCAA	1
CAAGGGCCTAATCGCAATTTTGG	1
CAAGGGCTGTATAGATTTAGGGGT	1
CAAGGGGACGGTTTATCGGAGCT	1
CAAGGGGCACATTGTAAACCC	1
CAAGGGGCCGCCTGCAAAATGG	1
CAAGGGGCTCCTAGGTTATTTCTG	1
CAAGGGGGCACTTATGGGTATAAA	1
CAAGGGGGCCGCCTGCAAAATGGC	1
CAAGGGGGTGCCAAAACGACGTCT	1
CAAGGGGTGGCTCTCATGTAAGAG	1
CAAGGGGTTACCACATAGGCCCAA	5
CAAGGGTAAAACTGTGATGAAGGC	1
CAAGGGTAAACCTACTTATTAGAC	1
CAAGGGTAACTACATTAGTGCATA	4
CAAGGGTAGAGTGCCACAAAGCAA	2
CAAGGGTATTGAATCCAAGGGAAC	1
CAAGGGTATTGAGCTGGATTTGGC	1
CAAGGGTGAATTCTACTACGAC	1
CAAGGGTGAGTACAAGCCGTACTC	1
CAAGGGTGGATAGGGCGGTCCGG	1
CAAGGGTGGATGCGATGTCGGCAA	2
CAAGGGTGGTGATGTACGTCTCTC	3
CAAGGGTGTAAAAAGTTTTGGCGG	1
CAAGGGTGTAAATTTGAGGAGTGA	2
CAAGGGTGTAATTCGGTTGACCGC	3
CAAGGGTGTAGCTATATTTATGG	2
CAAGGGTGTAGCTATATTTATGGC	1
CAAGGGTGTCGTGCTCATTTG	1
CAAGGGTGTGTGATCCGAAAGGTC	1
CAAGGTAACTCAGATGAGGTGC	2
CAAGGTAACTCAGATGAGGTGCT	1
CAAGGTACATGCAGTATTGATGAT	1
CAAGGTACTGGTACCCTGTGGTAC	1
CAAGGTAGAAGTACATTGTGTCTG	2
CAAGGTAGCAGAATACTTCGA	3
CAAGGTAGGTTGCATTGGTTTGCA	1
CAAGGTAGTACAAAATGGTTTAGA	2
CAAGGTATAATGAGCAGTGCG	3
CAAGGTATACGCGAGATTGAGGTA	1
CAAGGTATCGAATCCACAGGGAAC	1
CAAGGTATCGATTTCTACAGGGAA	7
CAAGGTCAAATTCTGGAGTGC	5
CAAGGTCAACACCGCCACATAGGC	1
CAAGGTCATCCGGCATAGCTACGT	1
CAAGGTCCAGTGGAGCAATCACGCC	1
CAAGGTCCGAGTACCAAGCGCTGC	1
CAAGGTCGACCGAAATACACCTAC	1
CAAGGTCGTGATACACTGAAAGA	1
CAAGGTCTTGGGTTTGTCTCT	1
CAAGGTGAAGATGAATCAAATCAT	1
CAAGGTGACCGTGCGATTCGCACA	1
CAAGGTGACGAAAAGACCGGCTGC	1
CAAGGTGACGAGGGAGATTTTGGA	1
CAAGGTGACGTAGGCGATAGCTG	1
CAAGGTGACTTTATGATTCGTGATC	1
CAAGGTGAGCCATTAACGCATGA	3
CAAGGTGAGCTCAACAGCAGCAGC	2
CAAGGTGATCCTCTGGTTCAA	2
CAAGGTGATGACAGTATGTTGGT	1
CAAGGTGATGACGGGTGAGGGTCA	1
CAAGGTGATGGGCTAGACGACTTG	1
CAAGGTGCAGGATCCAATTCC	10
CAAGGTGCTGTTTGGGTTTATCAA	1
CAAGGTGGAGTCGAAGGCAGATA	1
CAAGGTGGATCCTACTTGTCGGCC	2
CAAGGTGGCCTTGGTTGATGGAAC	1
CAAGGTGGCTCGCGTAGATTACGC	1
CAAGGTGGGCCCTATATATCGC	1
CAAGGTGGGCCCTATATATCGCAT	1
CAAGGTGGGCTAATTTTTGGGTAA	1
CAAGGTGGTGACTGGTGAGTGAGA	1
CAAGGTGGTGAGCTAGATGACCTA	1
CAAGGTGGTGATAGACGATCTGG	1
CAAGGTGGTGCCGCATACTACCAG	2
CAAGGTGGTGGAGGTTTCTACCTC	1
CAAGGTGGTGGGATACATGATCTG	2
CAAGGTGGTGGGCTAGACAACCTG	1
CAAGGTGGTGGGCTAGACGACCCG	2
CAAGGTGGTGGGCTAGACGACCTA	1
CAAGGTGGTGGGCTAGACGACCTG	2
CAAGGTGGTGGGCTAGATGACCTG	1
CAAGGTGGTGGGCTATACGCTCT	1
CAAGGTGGTGGGTTAGACGATCT	1
CAAGGTGGTGGGTTAGTCGGTCTG	1
CAAGGTGTATATAGAGAAGATGG	1
CAAGGTGTATATAGAGAAGATGGA	3
CAAGGTGTCATACTAAATTCT	12
CAAGGTGTCCTAGTGATTGTC	13
CAAGGTGTCGTACTACAAGAAGGA	1
CAAGGTGTGGCAACTTTTGTTGGC	3
CAAGGTGTGGCAATTTTGTTGGC	2
CAAGGTGTGGCAATTTTTGTTGGC	1
CAAGGTGTGTATCGAGGTCTCTAA	1
CAAGGTGTGTATGACAGGTGAGAC	2
CAAGGTGTGTCCTAGACTGTGC	1
CAAGGTGTGTTAGTCTTGCCGTGT	1
CAAGGTGTGTTGACATATGATCGT	1
CAAGGTGTTACGCTTCTCAGCGG	1
CAAGGTGTTGGCTCTAAGAAGGGC	1
CAAGGTGTTGGGCCACAAGGGGTC	1
CAAGGTTCTTAGGTGGCTTTGTGC	2
CAAGGTTGAAGCAAGGTAGAA	1
CAAGGTTGAAGCCATACATAGCT	2
CAAGGTTGCCAAGATCAACTC	3
CAAGGTTGCTATATTTTGGGACGG	1
CAAGGTTGCTATGGAGTTATTCAC	1
CAAGGTTGCTTACGTCACAAGGTT	1
CAAGGTTGGATGGGATATGATGG	1
CAAGGTTGGATGGGATATGGCGGT	1
CAAGGTTGGTGTTTACACTCTGAT	1
CAAGGTTGTGCCTGTTTGATATAC	1
CAAGGTTTGACTTAGGTGGTGTTT	2
CAAGGTTTGCCTGTGGAGTGGAG	1
CAAGGTTTTAGAGGTTGAGGTGGA	1
CAAGTACCAGGGCCCTGTTTAGA	1
CAAGTACCTTGTACCTAGATTGGT	1
CAAGTACTAAATTGAGCCCGAAGC	3
CAAGTAGATAGATCGGGTGCTA	1
CAAGTAGCCGTTAGTGCCACGTGG	1
CAAGTAGGACGATAGCGAGCCTGT	1
CAAGTAGGTGAGGTGCCCCGGTACC	1
CAAGTAGGTGCAATGTTTTTAGTG	1
CAAGTAGTAGTACTCCAAGTCACC	1
CAAGTAGTCTTTGTAGTGTCCGAG	1
CAAGTATAATGTGCAATGATGACC	1
CAAGTATACATCGAGGTGATCC	1
CAAGTATAGACATGTCCTATGATA	3
CAAGTATCAGATACTAGGTGTCA	1
CAAGTATCCGGGTGGTCTAGCCGA	1
CAAGTATCTGTGTCTAGGTTCATA	2
CAAGTATGGCACAAAAAGTATGG	1
CAAGTATGTGCCAACAACAGTGGA	2
CAAGTATGTGTCTAGATTTATAAG	1
CAAGTCAAACCATATCGGCTC	1
CAAGTCAACAAGCCCGTAGGATGG	1
CAAGTCACAATAAAATAAATGGTA	1
CAAGTCACTGACACATATGGGCC	1
CAAGTCACTGCTGAGTGCCGCGCA	1
CAAGTCATCCTCGCATGCAGCGGT	2
CAAGTCCAGGACGTCGTGCAATCGC	1
CAAGTCCGCAACACCATACCGTGC	1
CAAGTCCGTACTACAACTGGCTAT	1
CAAGTCCTAGATTTGATATGAGTG	1
CAAGTCCTTTAAGGGGGTGTCTG	1
CAAGTCGACAACGGTTAGATAGGC	1
CAAGTCGACCGACGGAGCTTACAC	2
CAAGTCGATCGATGTTGCTGGCAC	1
CAAGTCGGTGTACTATATTGTGGT	1
CAAGTCGTTACGTTAGAGGAAGGC	2
CAAGTCTACATCCTAGGTGGAA	1
CAAGTCTCTAGCTAGGTCCTGAA	2
CAAGTCTTGGACCTGCACTGGAGC	1
CAAGTGAAGGTGTATGGTTGCTTG	1
CAAGTGACCATTAAGCAATTG	1
CAAGTGACCGTAACTAGTACTGCA	1
CAAGTGACTCGTAAGGGCACCCAAA	1
CAAGTGAGGGTAGACGGTTGGTTC	1
CAAGTGAGTGCATGACGTATGGGT	1
CAAGTGAGTGCATGACGTATGGGTA	2
CAAGTGATAGAAGCAAAAGATGGT	2
CAAGTGATCTACAAGTTTAGGGAC	2
CAAGTGATTGATAGGACGACGGCA	2
CAAGTGCAACGCGCGGTGTGGAGC	1
CAAGTGCAGAAAATGTTCGTC	2
CAAGTGCATTGAGATTGGAAAGA	1
CAAGTGCCAAGTGTCAAAGTGCGT	1
CAAGTGCCAGAATTAATTTTGT	1
CAAGTGCCCGTTGTGTAAGGATAA	1
CAAGTGCCGGATGGCAATGCA	1
CAAGTGCGACCACATGGGTGGAAT	1
CAAGTGCGGGTGTTCACACTT	1
CAAGTGCGTGCGGTGATTGGCCGA	7
CAAGTGCTATAATGCTTCATGTG	1
CAAGTGCTCATAAGGGTGGTGGTT	1
CAAGTGCTTATGTGTTCGGGGTGA	2
CAAGTGGAGAAGAATGACCTG	1
CAAGTGGAGCAGAATGACCTG	1
CAAGTGGGCCCAAGTCATGGTGGT	1
CAAGTGGGTGTGCTCTGATACAAG	1
CAAGTGGTGCCAAGACGACATTGC	1
CAAGTGTAAAACAGATGATTGCA	1
CAAGTGTACAAGTGTGAGGTGAGC	1
CAAGTGTACATAGCTAAGGGTGG	5
CAAGTGTACATAGCTAAGGGTGGT	1
CAAGTGTACGTACGCCATGTGCTG	1
CAAGTGTATCACCATGGCAGC	3
CAAGTGTATGGTGAACGAATGTTAG	1
CAAGTGTATGTTTGGTGTGCTACC	1
CAAGTGTATGTTTGGTTTGCTATC	1
CAAGTGTATTGGGACTAGTGTAT	2
CAAGTGTATTGGGTGTAGTATAA	1
CAAGTGTCAAAGTGTGTGTGGTT	1
CAAGTGTCTTCTGGCTAGCTTCAC	1
CAAGTGTGAAACATAGGATTACAA	1
CAAGTGTGATCAGGGACATAAATC	1
CAAGTGTGCTCACTTATATAGGC	1
CAAGTGTGTATGATTGGCCTAGAG	2
CAAGTGTTAAAATGTGTGTGGT	1
CAAGTGTTAAAGTGTGTGTGGTTT	1
CAAGTGTTTGCCGAATCAGTA	1
CAAGTTAAAGCTGATACGGGTGTC	1
CAAGTTAAATGAGTGTCTTTGGA	1
CAAGTTACCCTACCCTACTAGATC	1
CAAGTTCACAGACCTAAACGTG	1
CAAGTTCCGTCGGATGATAAGTAA	1
CAAGTTCGCCAATGTTGGCACAGT	1
CAAGTTGAAATTGGTTGAAAGGTA	1
CAAGTTGACAAAGGGACATGGTAC	1
CAAGTTGACAGGAAACAAGGTGAC	1
CAAGTTGAGAGACCTTCGGTGTAC	1
CAAGTTGAGAGACCTTGGGTGTAC	1
CAAGTTGAGGAACCTTTGGTGTA	1
CAAGTTGAGGGACCTATGGTGTAC	1
CAAGTTGAGGGACCTTCGGTGCAC	1
CAAGTTGAGGGACCTTCGGTGTAC	1
CAAGTTGAGGGACCTTGGGTGTA	2
CAAGTTGATATGAATAGGGAGGAC	1
CAAGTTGCATCCAACGGGGCCTA	1
CAAGTTGCCTGTGGAGTAGAGCC	1
CAAGTTGCTATAAGTATGGACAAC	1
CAAGTTGCTGGGATCATTTGTACC	1
CAAGTTGCTTCTTGTGGGTCCCA	1
CAAGTTGGAGGACCTAAACGAG	1
CAAGTTGGAGGACCTAAACGAGT	1
CAAGTTGGTGCACGTCACGGATGA	1
CAAGTTGGTGTCATTGTCGGTGTA	3
CAAGTTGGTGTTACATATGGAT	2
CAAGTTGGTGTTCAGATGTATGGT	1
CAAGTTGGTGTTTAGATGCATGA	1
CAAGTTGTCGACGTTTGAGATCGT	1
CAAGTTGTCGATGACGATGATGG	1
CAAGTTGTCGATGACGATGATGGT	1
CAAGTTGTGCAATTAGATCAT	1
CAAGTTGTTATACCATGGGTGCAA	1
CAAGTTGTTATACCGTGGGTGCA	1
CAAGTTGTTATACCGTGGGTGCAA	1
CAAGTTGTTGAATAGAGACGGGTC	2
CAAGTTGTTGTACTGTGGGTGTAA	2
CAAGTTGTTTGTATCGTGGGTGGA	2
CAAGTTTAAGCTAATGCGGGTGT	3
CAAGTTTAAGCTGATACGGGTGT	1
CAAGTTTAAGGACCGCTAGTGTAAT	1
CAAGTTTAAGTTGATACGGGTGTC	1
CAAGTTTACACATCTGAAGTTTGG	1
CAAGTTTACGGACCTTGATGAACG	1
CAAGTTTAGACTGATGCGGGTGAT	1
CAAGTTTAGGGACCGTGGTGACA	2
CAAGTTTAGGGACCTGGATGA	1
CAAGTTTAGGGACTGGGGTGACAC	3
CAAGTTTAGGGATCGGGGTGACAC	1
CAAGTTTAGGTTGATGCACGCGTC	1
CAAGTTTATGGACCTAGATAACAC	1
CAAGTTTCTCGGCTGTTTGAACGG	1
CAAGTTTGCTGGTCCTACTGCATG	1
CAAGTTTGGGCCGCTATGAAGCGT	1
CAAGTTTTAGGACCGCCAGTGCAA	1
CAAGTTTTATAGTAGAGGTGAC	1
CAAGTTTTGGTAACTATGGGCTTA	1
CAATAAAAAGGTGAACCTACTGCC	4
CAATAAAAGTTGCCACACCTTGCC	1
CAATAAAATAATTGCTTACTATAC	1
CAATAAAATGATATGATTGGTGAA	1
CAATAAAATTACGGGTGCCATGCA	1
CAATAAAATTTGGTTGTGCACCGG	1
CAATAAACCAAGTTTAGGGACCT	1
CAATAAACCATGGGCCCACTTGTC	1
CAATAAACTATGGGTGTGTTTGGA	1
CAATAAAGATGGATTTGGTGAA	1
CAATAAAGGTTGTGTTGTTGCTGC	1
CAATAAATCTGAACAAGGGCCTGT	2
CAATAACCAATTTTTGCCCTT	1
CAATAACTAGAATGGTGTCCATA	1
CAATAACTATATTAGTGTAAAGGA	1
CAATAACTTGTGGGCCTATGACGG	1
CAATAAGAAGAGGGTGTACATACA	2
CAATAAGCTAAGATGAATGGTCAA	1
CAATAAGCTTACACAGTTTCCAAC	1
CAATAAGTAATTATAGGTGTTGGT	1
CAATAAGTACGTCGCCTACCACTG	1
CAATAAGTTGAAGTAAAGGATGCC	2
CAATAATAATAGGTGGCTCAATGG	2
CAATAATATGTGGATGAGTGTACG	1
CAATAATTAGAATGGTGTTCATAGC	1
CAATAATTAGAGCCTAGCTAACCC	1
CAATAATTGAGACATGGTGTGTTT	1
CAATAATTGAGGGTGTAGAATGTC	1
CAATAATTTGAGTGAGGTGTTCAA	2
CAATAATTTGGTGAAAAATGC	12
CAATACAAAACTTGATAGTGTCTA	1
CAATACAAACAGAAGTGCATGCA	1
CAATACAAGGTGGAACAAGATTGG	2
CAATACACGAGCGATGAGGATGAC	1
CAATACAGGGACATGGGGTGAC	1
CAATACATGCCAATCCATCCC	1
CAATACCCAGTTGATAGATGGTGTA	1
CAATACCTAGGTGGTGTGGTGGT	1
CAATACCTGAGCCGCTGAGCC	1
CAATACCTTAAGGTGGTGGGCTA	1
CAATACGACAGGTAATATGGGAC	1
CAATACGACAGGTAATATGGGACA	1
CAATACGAGAAATCTGAGATGCAA	1
CAATACGCGCGGATGGGGAAACT	1
CAATACGGTGCTATTAATAAACTG	1
CAATACGTGTTGGTCGGTATTAGG	5
CAATACTAGATGGTGGCATCTATA	1
CAATACTGATAGGGATTGGAGGAT	1
CAATACTTCAGCAGAAATTCT	1
CAATACTTCATTGGGTGGGATGGC	1
CAATAGAAAAAGTGGTACCTCATG	1
CAATAGAAAGTGCATTTTCGT	1
CAATAGAATTTGTGTCGGTCC	2
CAATAGAGAGCATCGTAGTGGGAC	1
CAATAGATGGTAACAACACAAGTG	2
CAATAGATTCGACGGGACCGACGA	2
CAATAGCAGGGATTAGTGAGGTC	1
CAATAGCAGTGGGAATGGGAAC	1
CAATAGCAGTGGTGGCGAGACGAC	1
CAATAGCGGGCTCACAAAGAT	1
CAATAGCTAGAATGGTGTCCATAG	1
CAATAGCTGCTGTTCGGTGGTGGA	4
CAATAGGATAGCCCACTACTAGTT	1
CAATAGGATGAACTAGCGTGA	1
CAATAGGATGATGTGTTGTCA	9
CAATAGGGGCAATAGCACAAT	1
CAATAGGTCTCCAACTCCAACAGG	1
CAATAGTAATAAGAATAACGTGTG	1
CAATAGTAGAAGTTGATCGACGCA	1
CAATAGTATGTCTACATGGGTATC	3
CAATAGTGCAGATGATGCGTCAAT	1
CAATAGTGCCCATAAATACGTAAC	1
CAATAGTGGGTGGTCCTCGCTC	2
CAATAGTGTGCGGTTGCGGTTCGT	1
CAATAGTGTTTAGTGTCTATTTGG	1
CAATATAAAGCCAAAGTTGAGTAG	1
CAATATAATTGGGTGTTCTAAGA	1
CAATATAGGGTGTGTTTAGTTCA	1
CAATATATGGTGAAACGTTCGATG	1
CAATATATTATTGGTGTCGGCTT	1
CAATATCATGTGGGATGGGTCCT	1
CAATATCGGCCATTGTACATCGGC	1
CAATATGAAAAGGGGGTAGCGCAC	1
CAATATGCATGTGGGAAATAC	1
CAATATGCCATCGGTTGTTGTT	1
CAATATGCCGAGGTGGTGTCCAGG	1
CAATATGCGGATATGAGGTGCTAAC	2
CAATATGCTATGATAAGATGAGG	1
CAATATGGTGTAGCGTTGTTCAGT	1
CAATATGTGATCATCCATTCCGCT	1
CAATATGTGTGCAGTAGTTGT	3
CAATATGTTTATGATAGGTGGGAC	3
CAATATTGAGTTAATTGGATGCA	1
CAATATTGGAACTGCAAACATG	1
CAATATTGTAAGGATGCCACTCGA	4
CAATATTTGGGGTAGCCTATCTAA	1
CAATATTTGGGTAGCCTATCTAA	1
CAATATTTTTGTGTGCGGGCAGCC	1
CAATATTTTTTGGGTGTTCTCTGT	1
CAATCAAAACGGTCGCCTCAATGG	1
CAATCAAACCTGGTTGAGTTGGCA	1
CAATCAAGAGCAAGAGTTGAGGGAA	1
CAATCAATTAGGTAGGATTGC	2
CAATCACGCGCTAAATGATCGAAC	1
CAATCACGGACTAGGGGACTA	1
CAATCAGAATATGACACATTACAC	1
CAATCAGGTGGTATGTACGTT	1
CAATCAGTGCGTCTACTTTCTAA	1
CAATCATACTAAATTTGGGCATGC	1
CAATCATGTGCTAATGGACAGCTC	6
CAATCATGTTGCTGCTGCAGAAGC	1
CAATCCACGGTGGTTTTGGTCTA	1
CAATCCACGGTGGTTTTGGTCTAC	2
CAATCCAGATAAAAGATCAGCC	2
CAATCCCCACGTGCATGGTTTGAC	1
CAATCCGAAATCAAAGTGCAA	1
CAATCCGGCCTAGGTGGGGTTGG	2
CAATCCGTAGAGACTAGGTCGCCA	1
CAATCCTACCTACGAACCTAGACA	1
CAATCCTAGATGGAGGGTTGGGAC	1
CAATCCTAGTACGAACTTGAACAC	1
CAATCCTCGGAATCCTTGGAGCTC	1
CAATCGAATCCGATGGGTGTCTAA	1
CAATCGACACCTTACAGGTTGATG	1
CAATCGATCGGCGACGGACGGCA	1
CAATCGATTTCAGTTGTTGGCTAA	1
CAATCGCAAAACCGGATACAACGC	1
CAATCGCCCATGATAGTTCAAGGG	1
CAATCGGAGGTAGCCAGTTTGGCC	1
CAATCGGCTACCACGTGCCACGGC	1
CAATCGGGACTAAAGATTGATGCA	2
CAATCGGGACTACGAATCCGGGAC	1
CAATCGGGCCTAGTTGTTGAGATA	1
CAATCGGGTGGCACAGAGGCGCA	1
CAATCGGTAGCAATCTAGGATGGG	2
CAATCGGTTAAGACGGTTGGTGGG	1
CAATCGTAAACCTTGTAATGC	3
CAATCGTGACTGCAGGATATGCCT	2
CAATCTAAAAGAGGACGTGTCACC	1
CAATCTACACCGTGACTTGCCGTA	1
CAATCTAGGATAGGGATGTGACCT	1
CAATCTAGTACCGTATGTGACATA	1
CAATCTAGTACTGATGTGTGACAC	1
CAATCTAGTCCTAGATTGGTCCTA	2
CAATCTAGTGCACGAACTTGTAAA	2
CAATCTCAAGATATGCCGGCCCAG	1
CAATCTCAAGATATGCCGGTACAA	1
CAATCTCAAGGATTTGCCGGCCC	2
CAATCTCCGCCTTCGACTCCAACT	1
CAATCTCCTCCATCACTTCGA	1
CAATCTCTCTAGGATTTGCTGGTC	1
CAATCTGAACAAGTCCTATGTGCT	1
CAATCTGAACAGGCCTATGGAAG	1
CAATCTGAATAGGCTCTATGTCC	1
CAATCTGATATGTGCCAAATCTG	1
CAATCTGCAGAGATGAGGGTACCA	2
CAATCTGCCATGCATGTAATTGAT	1
CAATCTGGTACCGCCGTACAACG	1
CAATCTGTGATGCTTCGTGTA	3
CAATCTTAACGATTTGATGGCCCA	1
CAATCTTACGGTCCTTGAGGAGAT	1
CAATCTTCAAAGCAAGGTGGGTC	1
CAATCTTGATCAGAAACCAGATTT	2
CAATCTTGGTTGCGAGGGAACTCA	1
CAATCTTTTGGTGTCTTCTAGCA	1
CAATGAAACAATATGCCTCAAAGG	1
CAATGAACTTGCCATCATGAA	6
CAATGAAGTTTACGGATAGTGCAC	1
CAATGAATACAATGGTGTAATCGG	2
CAATGAATATAGACAAAGGTATGC	2
CAATGAATCTAAACAGAGGTGTCT	2
CAATGAATCTGAATAGAAGGGTGT	1
CAATGAATGAAGTGTCAAGCT	1
CAATGAATTGAAGGGCTATATCAG	1
CAATGAATTTAATGGTGCAATCGA	1
CAATGAATTTAATGGTGTAATCGA	3
CAATGACAAAACCAGTGTTAA	2
CAATGACAACCACACATTGGAGC	1
CAATGACAGGTGGGCCAAGATTAC	5
CAATGACATATGGGTCAGGGTGGC	2
CAATGACATGTGGGTCAGGATGG	1
CAATGACATGTGGGTCAGGGTGAC	2
CAATGACATGTGGGTTAGGATGGT	1
CAATGACATGTTGGTCAGGATGGC	1
CAATGACATTGGCGCCGCGATAAG	1
CAATGACGAGGTCAGTGGCAACAGC	1
CAATGACGGGTGGAAGATGCA	2
CAATGACGGTTGTGACGGTTGGA	3
CAATGAGCCTTGGCAACATACCAC	1
CAATGAGGACGACGTGAGTGATGG	1
CAATGAGGGAGCCACACGGAGCAT	2
CAATGAGGTGTGGATATGCAA	13
CAATGATAATAAAGAGTAGGCGGC	1
CAATGATAATTGGGTCCTACACAT	2
CAATGATAGCCATGGTCACATCAC	2
CAATGATATTGTTGAACTACACAG	1
CAATGATGCATACATACACAC	3
CAATGATGGGACGCTACATAGTAC	1
CAATGATGGTTGGAGGGTATTACC	1
CAATGATGTTAGCATGATACTTA	1
CAATGATTCAAAAGGTGGGCTAAT	1
CAATGATTCTCATCGCCTCCCTTC	1
CAATGATTTGCCATCGACTTTGTC	1
CAATGCAAAACTTGATAGTGTC	1
CAATGCAAAACTTGATAGTGTCTA	3
CAATGCAACGGTCCGCGAACACGC	1
CAATGCAACGTAGTTGGGTCC	2
CAATGCAAGAAGCATATTAGGTGA	1
CAATGCACTGTGCTTTGTAGGC	1
CAATGCCAAGGAACGTGTGCTCAC	2
CAATGCCAATTGGAGTGCTGATGC	4
CAATGCCAATTGGAGTGCTGATGCC	1
CAATGCCACGTCAGATGAAGACTG	1
CAATGCCACGTGGAAAGAAGACCG	1
CAATGCCACGTGGAACGAAGACTC	1
CAATGCCAGACAAGAGCCTATGGG	1
CAATGCCATCTGATTAGCCGA	1
CAATGCCATGGTTTTTGACTC	1
CAATGCCCTGTTTGAGTATGC	1
CAATGCCGATGACAAATTGTTGAA	1
CAATGCCGTGAACGGGATTGGGGA	1
CAATGCCTGAGCCCAAACACAGCC	1
CAATGCGAAGAGGTTGCCTAAGG	1
CAATGCGCTTGGCTGACGTATGAG	2
CAATGCTAAAGGTGCCGGTTCTA	1
CAATGCTATATGGAACGATTTC	1
CAATGCTGGGTAGCGGATCGGTC	1
CAATGCTGGTGCTATATGTCATGC	1
CAATGCTTGCCTAATTGTAACATT	1
CAATGGAAAAGCCTGCAGGGC	2
CAATGGAAAGAGAATATGGTGCAC	1
CAATGGAAGTTACGGTGCGAGAGA	1
CAATGGACGGGCCTACGAACCTAC	1
CAATGGAGAACCGATTGATGTAGT	1
CAATGGAGCACGAAAGAATAGAGA	1
CAATGGAGGATGCCGACGCTCCGT	1
CAATGGAGGGTATCCCTGGATGG	1
CAATGGAGGGTATCCCTGGATGGG	1
CAATGGATCGGCCACACAGAG	2
CAATGGATCTAAACAGGGCCA	1
CAATGGCAAAGCCGCTGATGGTTT	1
CAATGGCAGCTACTGTAGGTGCAG	1
CAATGGCATAAAAATGAGGTGATA	1
CAATGGCTAATTATTTATGGGTCC	1
CAATGGCTCAAAAAAGTGTGGCAA	1
CAATGGCTGTGTTCTCTCCGA	1
CAATGGCTTGTCTTGTTTTGTGTG	1
CAATGGGAACCAAGGTATGGATGG	1
CAATGGGCAACATCTACAACAGTA	1
CAATGGGCCTTCAAATTTCATCGG	3
CAATGGGCTGGAACACTACAT	1
CAATGGGTACATGAAAACTGT	3
CAATGGGTAGGGGATAAGCCCCT	1
CAATGGGTGAATGAAAATCATTGC	1
CAATGGGTGATTATACAGCCGATT	1
CAATGGGTGTCAAATTCAATTGAA	1
CAATGGTAAAGTAAGGTGCTA	3
CAATGGTAATCAAAGGTGGCTCAA	1
CAATGGTACCTTAAATTCGATGA	1
CAATGGTACTGCTTGTTTGATGG	1
CAATGGTAGAAAGTCTTATAACT	1
CAATGGTAGAGACGAGTATGGTC	1
CAATGGTAGGCGACGTACCCGTC	1
CAATGGTAGTGCCTAAATTTAAAT	1
CAATGGTATAACCTCATGTGCTTC	1
CAATGGTATATCCGTGCGATTGGG	1
CAATGGTATGTCTACATGGGTA	1
CAATGGTATGTCTACATGGGTATT	1
CAATGGTCGTATATATCCGGTTA	1
CAATGGTCTTGTGAGTTGTGG	1
CAATGGTGAAAGAACAAAAGTGA	1
CAATGGTGAAAGAACAAAAGTGAG	1
CAATGGTGAACCAGCTAGTAGGGC	1
CAATGGTGAACCAGGTAGTAGGGC	2
CAATGGTGACCTAGACGGGTAGGA	1
CAATGGTGAGAGGGGCAGTGGCCG	1
CAATGGTGATAGCAACTATGGTAC	1
CAATGGTGATCCAGCGTGGTAGA	1
CAATGGTGATGGTGAGTGGTGAAT	1
CAATGGTGTAATCGGATTGTAGA	5
CAATGGTGTCAATTAATAGAGGAT	2
CAATGGTGTCTGTCTATTTGAGTA	1
CAATGGTGTGATCGGTTCGTAGAT	1
CAATGGTTAGACGCCGGGGTGTTG	1
CAATGGTTCAGCATTTGCTTA	2
CAATGGTTGTGCGAGACCGATGGTA	1
CAATGTAAGAATCAGTAGTAGGCC	1
CAATGTATGTATAACAGGTGGGAC	1
CAATGTATGTATATCAGGTGGGAC	1
CAATGTATTATAGCGCTATAGATA	1
CAATGTATTTACCCTATGATTGT	2
CAATGTCAACAAGGCGGCCATGGA	1
CAATGTCACCGAGAATGTCATGGG	1
CAATGTCACCTTTTGCAACAA	1
CAATGTCACGATGGTGACCCGGCC	1
CAATGTCACGCCTACTTATAATCT	1
CAATGTGACCACGGTTGGTGGGCC	1
CAATGTGACCAGTTGATTACAATC	1
CAATGTGAGTACACTAGGTGAAC	1
CAATGTGAGTATGACAGGTGGGAC	1
CAATGTGAGTTGCCTACCTTTTG	1
CAATGTGCTAGTACTGATGAGGAT	1
CAATGTGCTTAGCGGCGGCTGGTC	1
CAATGTGTGTATAACGGGTGGGAC	1
CAATGTGTGTATGACAGATGTGAC	1
CAATGTGTGTATGACAGGTGGGAC	1
CAATGTGTGTATGACAGGTGGGAT	2
CAATGTGTGTATGACAGGTGGTACC	1
CAATGTGTGTATGATAGATGGGAC	1
CAATGTGTGTATGGGTGGGACCA	1
CAATGTGTTGCCCTGAAAACTACC	1
CAATGTGTTTTGTTGTGCTTTGAG	3
CAATGTTATCGAGCTTGATGTTGG	1
CAATGTTGGGTGGATCTTTGCTTG	1
CAATTAATGCCGATATTGCCAC	1
CAATTACATCTCCTAAAGTGGTCC	1
CAATTACTCCATGATGGACGC	2
CAATTACTGATGATGGCTGGCCAA	1
CAATTAGATAATGTGTTTGGTGAG	1
CAATTATATGTTAATGTTGTCCTA	1
CAATTATTGTGCATAACGGGCAGA	1
CAATTCCTCCTAATCAAATACTCC	1
CAATTCCTCTATAGTGATCATTGC	1
CAATTCGAAGGTGCAGTTGCAACAT	1
CAATTCGATGCGGACTACTAACTG	1
CAATTCGTTAGGGCAACACTACAG	1
CAATTCTAGGTGGTTTTGTTTGAC	1
CAATTCTGATGTGCAATATGAGAT	4
CAATTCTGGAGGTTTACATATTAA	2
CAATTCTGTGGACCTACACTGGAG	1
CAATTGAAAACGTAAGATCGGAAA	1
CAATTGACATGGAGCTCGAGAGGG	1
CAATTGAGATGTAAAGTAAGGGCA	1
CAATTGAGCATACAATCTACACA	1
CAATTGAGCTGCCTATATGAGGAA	1
CAATTGAGGACGCTCTAGATGTGCT	2
CAATTGAGGGGAAACGATCTTCGG	3
CAATTGAGGGTTCTGGTGAAA	2
CAATTGAGGTCAAGGGATGGA	1
CAATTGATCTGTGGGTGACAT	1
CAATTGATGATGAGATTAAGATGG	2
CAATTGATTAAAATTTATGTTGAC	1
CAATTGATTGATAAAGTTGCCGGT	1
CAATTGCATGCGTCTAATCAAA	3
CAATTGCCGAACTCCAATCCTTA	1
CAATTGCCTGGGCCGACGGAACAT	1
CAATTGGATGAGTCTAGCGAA	5
CAATTGGTCACGCTTAGCGGTGG	1
CAATTGGTGGATCTGTTAGAC	7
CAATTGGTGGGTGTTGATAGAT	1
CAATTGTAAAACAGAGGAGTGCAA	1
CAATTGTGAACCTAGACGATGCAT	1
CAATTGTGAGACTACGTTTTGACC	3
CAATTGTGTGAATCAACGGTTC	1
CAATTGTTGCTGAAGAAGATTGGT	5
CAATTGTTGTAGCGAGGAGGTGGG	1
CAATTGTTTGGGTGACGATCTCT	1
CAATTTAAATGAAATTTGACGGT	1
CAATTTAAGTGAAAACGGATGGAC	1
CAATTTAGGTGTGGATGAGACGTA	1
CAATTTATTAGAGAGCCACGTGG	1
CAATTTCTGTCAGAATCATGTGTT	1
CAATTTGAGGTGTCGACATCATCT	1
CAATTTGATGATGACGTGGAAGC	1
CAATTTGATGTCCTGATTCTG	2
CAATTTGATGTGATGGAAAAAGAC	1
CAATTTGGATGAGGTTGTCAGGG	1
CAATTTGGGACCTAGATGACACA	1
CAATTTGGGACCTAGATGATACAT	1
CAATTTGGTCGACCACGATAGT	1
CAATTTGGTGCAAGAACTTGAGAA	1
CAATTTGTCTATTTGGAAAGTTT	1
CAATTTGTCTTCCTCGGTGGTTT	1
CAATTTTACAGCGAGTGGGGACA	1
CAATTTTACGGTCCTTTAGAAGT	1
CAATTTTAGCGTGACCTGCACACA	1
CAATTTTGGCGCGAACTAAACACA	1
CAATTTTGGTGGGATGGGGATGG	1
CAATTTTGGTGTGAACTAAGGTGG	1
CAATTTTGTGCCGTTAAATACACT	1
CAATTTTTATTATGATGTTACTGC	1
CACAAAAAAGTGTTCAAGATGCGC	1
CACAAAAAGAGGTGGTATTAACGT	1
CACAAAACCAGATATGCGGGGTCC	1
CACAAAACCGGACATTCTTCACCC	1
CACAAAACGATATGGTATCAACAT	1
CACAAAACTTGACGAGGCGATACT	3
CACAAAAGATGGGATCATGTC	1
CACAAAAGATTAAACCTGCCA	1
CACAAAAGGAGAAACTACGTTGGC	1
CACAAAAGTATGATGGACAAAT	1
CACAAAAGTGTGGTGGATAAATTG	3
CACAAAAGTTGGGTGTCCTATAGC	1
CACAAAATAAACTAGAGAGGTGAA	1
CACAAAATAGATCAGTTGCAA	2
CACAAAATATAATAGGTGCTGG	1
CACAAAATGAAATGAGAAGGTGTT	2
CACAAAATGAACTAGAAAGGTGAA	1
CACAAAATGAACTAGAGAGGTGG	1
CACAAAATGAACTAGAGAGGTGGA	2
CACAAAATGAACTAGAGTTGTGGA	1
CACAAAATGAATTAGAGAGGTGGA	2
CACAAAATGGACTAGAGAGGTGAA	1
CACAAAATGTACTAGAGTTGTGGA	1
CACAAACAACCCCTTGCTACCCAC	1
CACAAACACCGCGTCATACCC	2
CACAAACATTGAGGATGCCCTAAT	2
CACAAACCTGCCAGGTTCGGTTG	2
CACAAACGCTCATGATGCACTTAC	1
CACAAACGGGTCTCTTAAGTGGAC	1
CACAAACTAATGGGCCGTTTGAG	1
CACAAACTTATTAGGTGGGTGCAA	1
CACAAACTTGGTAAGTGGGTGCG	1
CACAAACTTGGTAAGTGGGTGCGA	2
CACAAACTTGTAAGGTGGGTGCA	1
CACAAACTTGTATGGTGGGTGCAA	1
CACAAACTTGTCAGGTGGGTGCAA	1
CACAAACTTGTCAGGTGGGTGTA	1
CACAAACTTGTTAGGTGGGTGCAA	6
CACAAACTTGTTAGGTGGGTGTA	1
CACAAACTTGTTAGGTGGGTGTAA	15
CACAAAGAAGGATGTTGCTTGAGG	2
CACAAAGAGATTATTGGGCTG	3
CACAAAGATAAGCACCAGAGTTGC	1
CACAAAGGTAGTGTCTTGTGTTCG	1
CACAAAGTGATGTTGAGGTTT	9
CACAAATAAACTAGTAGTGCGCCA	2
CACAAATGATGATGGGGGAGACAA	1
CACAAATGGACCTTCGAGAGCACA	1
CACAAATGGTACAACAAATATGGA	1
CACAAATGTGCTTGGTCTGATCCA	1
CACAAATTGAACTAAAAAGGTGAC	1
CACAAATTTAGGTTCGGGCCACGG	1
CACAAATTTCACGCCGTGCTA	1
CACAAATTTGTTAGGTAGGTGCA	2
CACAAATTTGTTAGGTAGGTGCAA	4
CACAAATTTTGCAGTGTCCTGGAA	1
CACAAATTTTGGTGAGCGAATGAT	1
CACAACAAAGGTGACGGGGTGTAC	2
CACAACAAATTACAGGTTTTGCC	1
CACAACAAGACCTCGATGATGCG	2
CACAACACAACTCACCACAGTGCA	1
CACAACACAGACTACAAGTATGAC	1
CACAACACAGCACAGACACGATGC	1
CACAACAGGCAGCAAAAGAAGAAG	1
CACAACATACAAGCCTACATACGC	4
CACAACATACCTGAAGCTGCCACC	2
CACAACATATATGCAGATTGTGGA	1
CACAACATCTAAGACATCATGTGA	1
CACAACCAAACAGGCACAAATCTA	1
CACAACCACCATAGCCTACAAGAG	1
CACAACCGCAGCGAGGAGGATGGG	1
CACAACCTCTAATAGTTGGTGTA	1
CACAACCTTAGTTGAGATGGTCAC	1
CACAACGAACGTGGTGTCTTCTTT	1
CACAACGACAGGGTCTACTCGA	1
CACAACGTATGTGCGCTCACCCC	1
CACAACTAAAGTGTATGCGCATCC	3
CACAACTAATCAAAACCGGTGACA	2
CACAACTAGAGAATTGGTGAGTGA	1
CACAACTAGGGTATTTGGATGGT	1
CACAACTCGATAAGGATGTGATAGT	3
CACAACTGCTCCACCATGGACCGA	2
CACAACTGGAACCGTATTAGGAAG	1
CACAACTGTTGCTACAACCAAAC	1
CACAACTTGCCTAACGTTAGTTGT	1
CACAACTTTCTTGTTCCATGGGCC	1
CACAAGAACTAAGCCAACCAGAGG	1
CACAAGAAGGAAAGTGGATGGGTT	1
CACAAGAGGATCTTATGGGAGGTA	2
CACAAGAGGGGACGGATCGTTGAC	2
CACAAGAGGGGCGTGCATGATGAT	1
CACAAGAGGTCATTGATTGGA	1
CACAAGATGGTGAACGAGACGATC	1
CACAAGATGGTGGACTAGCCGGTC	5
CACAAGATGGTGGGCTAGACGATC	1
CACAAGATGTGCAACGAAAGGCAG	1
CACAAGATTGCCATGGACATCGAG	1
CACAAGATTGGCTACATGGGC	1
CACAAGCAAGTGAGGTGACTGGTC	1
CACAAGCAGATTGTGGTGACCA	1
CACAAGCATCCACGGTCCATCATG	1
CACAAGCCAAAATTTCTGGAGCCA	1
CACAAGCGCCACGTCAAATGACAC	1
CACAAGGAATAAAGTGTACGTGTG	1
CACAAGGGGACAATGGGGGCAC	1
CACAAGGGTAGGATGGTTGAT	2
CACAAGGTAGAGGTTGAGAGGGGA	1
CACAAGGTGGTCGGTTAGCCTGAC	1
CACAAGGTGGTGGGCTAAACGAAC	1
CACAAGGTGGTGGGCTAGACGATC	1
CACAAGGTGGTGGGCTAGCTAGTC	2
CACAAGGTGGTGGGCTATACGATC	2
CACAAGGTGGTGGGTTAGACGATC	1
CACAAGGTGTCGTAGATGTAGTT	1
CACAAGGTGTGGCCGGTAAATGAC	1
CACAAGGTTAAAGAGGTGTGACAG	1
CACAAGGTTGCCACACAATAGTTG	4
CACAAGGTTGTGCTACTTTTTCAA	1
CACAAGGTTGTGCTACTTTTTGAA	5
CACAAGTAAAGACAAAGTGTGCA	1
CACAAGTAAGGCAATGTCTGGC	1
CACAAGTACAACTTCATGGTCCTA	1
CACAAGTACACGGATTGAAGGACC	1
CACAAGTATCAGATACTAGGTGTC	2
CACAAGTATGATGTGATAAAGTGT	1
CACAAGTATGCTTAAGTGATGG	1
CACAAGTGACTCCTTATCTGTGAT	1
CACAAGTGACTCGTTGTGGATGGT	3
CACAAGTTATGTGTTAAACGTGTG	2
CACAAGTTGCAAGATGATGGGTCT	2
CACAATAACTTAAGGTTGCCCGAA	1
CACAATACGTCGATTGCGCGTGCA	1
CACAATACGTGTATGACAGGTGG	1
CACAATACGTTCGAGGTGGGTGTA	1
CACAATAGGTGTGAAATAAATCCC	1
CACAATAGGTGTGGAATAAATCC	2
CACAATAGGTGTGGAATAAATCCC	1
CACAATATGTGCAATTAAGGTGGG	2
CACAATATGTGTACGATAGGTGG	1
CACAATATTTTGGTGTGATCCTA	1
CACAATCGCAGTTGCTAGTGCTAC	2
CACAATCGGACTTAAACTAGTGCC	1
CACAATCTTTGGTACGTCTCTCC	1
CACAATGAGAATAGGTGGCTGAAT	1
CACAATGATCAAACGCCTGAGGAA	1
CACAATGCCTAACCAAACTAA	1
CACAATGCGGCTTGTCAATGGT	1
CACAATGCGGGACTTATGATGGGT	1
CACAATGGAGGACACCTAGATGGG	1
CACAATGGCGCCGTAGTGCTGTGC	1
CACAATGGGGGTTTCACTAGTGTG	1
CACAATGGTAAAGTAAGGTGCTATC	1
CACAATGGTCGTGGCCTATAGTC	1
CACAATGGTGGTCTATGTTTAC	1
CACAATGGTGGTCTATGTTTACAT	6
CACAATGGTGTAATCGGATCGTAG	1
CACAATGGTGTAATCGGATTGTAG	1
CACAATGGTGTAATTGGATTGTA	1
CACAATGTAAGAAAGTGCAAGCCC	1
CACAATGTGGTGAGGTAGCTGAAT	1
CACAATGTGTGTAATTAAGGTGGG	1
CACAATGTGTGTATGACAGGTGGT	1
CACAATGTGTGTATGATAAGTGG	1
CACAATGTGTGTATGATAGGTGG	2
CACAATGTTGCATGATGTGGT	8
CACAATGTTGTAGCCAATGTG	1
CACAATTACAGACTGCACAAAGT	1
CACAATTAGTAGTGTATAGAA	1
CACAATTATGCAGGTAAGCTA	1
CACAATTATTAAAACCGGTGCAGA	1
CACAATTCGTGTGCTACTTTCCC	2
CACAATTGAATGGCCAAACTGAAC	1
CACACAAACCCAAAGAAAAATGAG	1
CACACAAACGAACGCAGCCTTAGA	1
CACACAAACTTCCAACTTTTCCGT	1
CACACAAAGGTGCCGGTTTTTGAT	1
CACACAAATTTCAAGAGAGGTGT	1
CACACAACAATGTCAGGTGACCAC	1
CACACAACGCGTGGCTTATGTGGC	1
CACACAATCGATTGTGCTGCATGC	1
CACACACATAATGTATTGGAGTC	1
CACACACATGTAAATAGGTGTCA	2
CACACACCGCCGGTCTGACTGGCC	1
CACACACGAGCAGATAGATGAGGC	1
CACACACGCAAGGACATGGCACACC	1
CACACACGGGTGCGATGTTTTCA	2
CACACACTGTGTCTTGGAGTCCGT	1
CACACAGATCCACCAGAACACAGG	1
CACACAGGCACATGATATGATGG	1
CACACAGGCACATGATATGATGGT	1
CACACAGGCTAAGTCCTAATTGG	1
CACACAGGCTAAGTCCTAATTGGG	2
CACACAGTAGGATAATTGAATGGT	1
CACACAGTATGGCACATGCGTTGG	1
CACACAGTGTGTCTTGAAGTTCGT	2
CACACAGTGTGTCTTGGAGTCCAT	1
CACACATAACGAATGTCCTGTAGC	1
CACACATAAGATGGCATGCTA	8
CACACATAGTGGATGCTAAGCTGC	1
CACACATATTAGTGATAAAGGCGC	2
CACACATCACAAAGGGCCACGAAC	1
CACACATCAGCCACTGCTACCGCA	1
CACACATCTTACAGTGCAGGGT	1
CACACATGCTTCAAATGGCTAG	1
CACACATGGTATATTCCGACGA	1
CACACATGTGGCTTACAATTTGTA	3
CACACATTATGTCTTGGAGTTCGT	1
CACACCAAAATTGGAAGTTAGGTT	1
CACACCAAATAGGGCGACGTGGAC	3
CACACCAATTTACGTGCGTGAGAC	3
CACACCACCGTTGATGGGCATCGT	1
CACACCAGAGGTGCTAGTGATGGA	1
CACACCAGTAGTGGGGCCTCGAGA	1
CACACCCACCACAGCCTACGGAGT	2
CACACCCTAACTTTGGTGCAC	2
CACACCCTAAGGGATTTGGTGGA	1
CACACCCTATATATATCGCCA	1
CACACCGCGTAGGCACAGGATCT	1
CACACCGGTCCAACTACGTGAACA	1
CACACCGTGTCTATAACATATGAA	1
CACACCGTGTCTATGACATGTGGG	1
CACACCTAGGACCGACCACCACC	1
CACACCTAGGACTGAGCTAATAGG	1
CACACCTCCACAGTGTGGCCAAAG	1
CACACCTCGAGGCTGATTCATTGC	1
CACACCTGCGACAGGTCGATGGA	1
CACACCTTGCCTAAGGTGAGGTGA	1
CACACCTTGTCTAAGGTGAGGTGA	2
CACACCTTTGTAGCTGTGCCCAA	1
CACACCTTTGTAGTTGTGCCTAAA	1
CACACGAAACCTACCATTTAACAG	1
CACACGAACCTGCCTTAACCCAAG	1
CACACGAACGATGACAGATGGCGA	1
CACACGAAGAATAGCGAGGATGG	1
CACACGACTCTCGGCAACGGATA	1
CACACGACTCTCGGCAACGGATATC	2
CACACGAGGGTGCGATGTTTTCTA	1
CACACGAGTGAGGAGCCTGAAGC	1
CACACGAGTGTGGTGCTGTGCGAGT	1
CACACGATATGACAGCCGGTGCT	1
CACACGATGATGAGATGTGTTGGA	2
CACACGATTTGGTGCTGAACAGAA	1
CACACGCGATGGTGCGCCTGACAT	1
CACACGCTGCCAGTTGAACCACC	1
CACACGGACTATGGTGGCCGCTA	1
CACACGGCCATCCATGTCGGTGTC	1
CACACGGGACACGCTATTTAGTAG	1
CACACGGGTGCGATGTTTTTGACC	5
CACACGGTCAACTGACGGGAGTG	3
CACACGGTCAACTGACGGGAGTGG	2
CACACGGTGAGTGTCAAGGGGGAG	1
CACACGTAACGTAAGATGGTC	3
CACACGTACAGGAAAAAAGAATGC	1
CACACGTACAGGGACGGAACGCCA	1
CACACGTATAGATACTGGCATA	1
CACACGTCAGTGTCTATAATGGT	1
CACACGTCCGATTTTTTGTTCGAC	3
CACACGTGGGTGCGATGTAATATA	1
CACACGTGGGTGCGATGTTTTTCA	2
CACACGTTATGTATTAGAGTGCA	2
CACACTAAACATTAGGCGTGCCA	1
CACACTACATGTGGAGGGAATCGG	1
CACACTAGCGAGTGCATGGCGGTC	1
CACACTAGTACAAATGACATGGTA	3
CACACTAGTACAGATCCTTCTATC	7
CACACTAGTCTTTTGGGTTGTGTA	1
CACACTATTGGGTGACTTGTGCTA	1
CACACTGAAAGGTAGAAGTGCTGC	1
CACACTGACTATCCTGTGCCGCTGC	1
CACACTGCTACCACACTTCAC	1
CACACTGGATGAGACACTGAA	1
CACACTGTGTGTATGATAGGTGGGA	1
CACACTTAAGCCGCCACATGACAG	1
CACACTTACGTTGTCGCTTCGTGT	2
CACACTTGCATGGTGAGTAGTGAG	1
CACACTTGCCTAAGTTGTGGC	2
CACACTTGGGTGCCAGTGTAGGAC	1
CACACTTGTGACAAAGTTAGGCAA	1
CACACTTGTGGCCAACTATTTCTA	2
CACACTTTGCCTAAGGTGGGGTGA	1
CACACTTTGTCTAAGGTGAGGTGA	6
CACACTTTTGTGGATGCCTCGACT	1
CACACTTTTTTGAGCCATTGACAC	1
CACAGAAACTGTTAGCCGAATAAG	2
CACAGAAGAGGTGTTATC	2
CACAGAATGAACTAGAGAGGTGGA	2
CACAGAATGGTGACGAGTGAAGGT	2
CACAGACACAGGTGTTAGTGG	3
CACAGACATGTTAGATGGGCAT	1
CACAGACCGGATAAACGAGTGCA	1
CACAGACCGGATAAACGAGTGCAC	2
CACAGACCGGATAAATGAGTGCA	1
CACAGACCGGATAAATGAGTGCAC	2
CACAGACCGGTTGAGTGCACTGCA	3
CACAGACTGGTTTGACCGAGGTGG	1
CACAGAGACCATACCCGGGAACG	1
CACAGAGAGATAGAGTGCCTT	1
CACAGAGGCTAACATGTGTGGTA	1
CACAGAGGTGAGTGCGTGTGCTT	1
CACAGAGTTTGTTGGTTCTTGTGT	1
CACAGAGTTTTTGGTTCTTGTGTC	1
CACAGATAAATAGTCACGAGCCA	1
CACAGATAACGCCTGGGTGCAAGA	1
CACAGATGACCCGTCACTGAAGCC	1
CACAGATGACCCTCATATGTGACG	3
CACAGATGACCTTATCTTTGATGG	1
CACAGATGACTCATCAGTGACGGG	2
CACAGATGAGTGCTTACGTTTGA	7
CACAGATGAGTGCTTACGTTTGAC	1
CACAGATGATGGATGGGTGTGG	1
CACAGATGCATGGACCGCACCAAA	1
CACAGATGCTCTATCGTACGGTGA	1
CACAGATGGAAGGATACGTACT	3
CACAGATGGACGCCTACGTACGCC	2
CACAGATGGGTCTAGTAAGGTCGG	2
CACAGATGGTATCAGATAATAAAT	1
CACAGATTCTATCAACTAGTGCCG	1
CACAGATTGTGTGTAAATTACGAG	1
CACAGCAAATATGCAAGTGCACAA	1
CACAGCAATTGAATCCACCCA	2
CACAGCATCGTCACCGCTTACGGC	1
CACAGCATGCCACAAGAGAGGGTC	1
CACAGCCCTAGAGATGGGCCTGGC	1
CACAGCCGCCGGATTGACTGGTC	1
CACAGCCGTACAAGGGTTAGGTGA	1
CACAGCCTAGTACTTGGAGTGGTC	1
CACAGCCTTACTGAACTACCAGT	3
CACAGCCTTTGCCTAATTTTGAA	1
CACAGCGAACGTGGTGTCTTTTTT	1
CACAGCGGTATAAGTTTAGGGACC	1
CACAGCTAAATACTGGGGTGT	1
CACAGCTAATGATGTTGATGATGG	1
CACAGCTAATTGCGGAATTGC	1
CACAGCTACTGTAGCGATGGTACT	1
CACAGCTAGTGGTCTAAACCAGC	2
CACAGCTGTTCTAACCAAATGGGC	2
CACAGCTTCGAGGGTTCGGCCCCT	1
CACAGCTTTAAAATATAGATGGGA	1
CACAGCTTTGCACCGGGATGATAC	2
CACAGCTTTTCCTTCTCGCGT	2
CACAGGAAAAACACAGGAATGGTC	4
CACAGGAAAAACACATGAATGGTC	1
CACAGGAAAAACAGAGGAATGGTC	1
CACAGGAAAAACATAGGAATGGTC	1
CACAGGAAAACACAAGAATGGTC	2
CACAGGAATAACCGTTTGATTGGA	1
CACAGGAATAACTGTTTGATTGG	1
CACAGGAATAGCTGTTTGATTGGA	2
CACAGGAATGAAAAAACGGAGAAA	2
CACAGGAATGACCATTTGATTGAA	1
CACAGGAATGACCGTTTGATTAAA	1
CACAGGAATGACTGTTTGATTGAA	1
CACAGGAATGGCTGTTTGATTGGA	1
CACAGGAATGGTCGTTTGATTGG	1
CACAGGACATGGTGAGAAAAAGGT	1
CACAGGATACACTCAACAAAGGA	1
CACAGGATCTAAATGCTTTGC	2
CACAGGATGTAGGGGTGAGACTCT	2
CACAGGATTATGACAGGAATTGAA	1
CACAGGATTCTAACATGAATACAA	1
CACAGGATTCTGACAGGAATACAA	5
CACAGGATTCTGATAGGAATTGAA	1
CACAGGATTGAAAAAACGTAGGAA	1
CACAGGATTGTCTGTGCTTGCTT	1
CACAGGCAACAAGCCTGAGTCGGC	1
CACAGGCAGCGACTGGTGAACCT	1
CACAGGCTCATGTGTACAGGCGGG	1
CACAGGGAATGTCACTGAATCTGT	1
CACAGGGATAACTGGCTTGTG	1
CACAGGGATAACTGGCTTGTGGC	1
CACAGGGTCAACAGTGGACGGTGG	1
CACAGGGTTCTCATGTAGTGCTAA	1
CACAGGTAAAATATAGGAATGGTC	1
CACAGGTAAATTACTAGTAGAGGG	1
CACAGGTAAGAGGTCATCAGTGAC	1
CACAGGTATAGTCACATGTGAGGT	1
CACAGGTGAGCGGATACCAGTGAC	1
CACAGGTGGTGCTAGATATGGTAT	2
CACAGGTGTCTCGCTGTCGACGGG	1
CACAGGTGTGATGTGTTATGGTA	1
CACAGGTTATAGCTGGACCGACCG	1
CACAGGTTCTAACAAAGAGTACTG	1
CACAGTAAGTGTAAGGAGGGTGTA	1
CACAGTAATGATCAGATGGGAGA	1
CACAGTAATGATCAGATGGGAGAG	1
CACAGTACGTAGGTGGGTGTAGAG	2
CACAGTAGCCCCTGAGACCTTCGC	1
CACAGTAGGTGTGAGGTGTGTGTA	3
CACAGTAGGTGTGCAGTGGGTGTA	1
CACAGTAGTGCTAAGAAACATGAC	1
CACAGTATGTGAAGGTTTGATGG	1
CACAGTCGAGCCATTGGAGGACTT	6
CACAGTCTATGATATGTGGGTCCT	2
CACAGTGAATCAGGAGAGATGCAA	1
CACAGTGACACGTAGGATGAAGA	2
CACAGTGCAACAAAGGATGAA	2
CACAGTGCAAGTACTAGTAGTGGG	1
CACAGTGCAAGTGGCTATGCGAGT	1
CACAGTGCCAAAACAAGAAAGCTA	1
CACAGTGCCACATATTGGAAACGC	1
CACAGTGGGAGTGCGATATGGCGC	1
CACAGTGTAGCTGGCTTGCCT	1
CACAGTGTCTTGTCCTAAAATGAA	1
CACAGTGTGCTTAGGGAAGTCCAA	2
CACAGTGTGTATGATAGGTGGGAC	2
CACAGTGTGTCTTGGAGTCCGTGC	1
CACAGTGTGTGAACGCTTGATGGA	1
CACAGTGTGTGTATGACAGATGGG	1
CACAGTGTGTTGTGTCTGCCAGGG	1
CACAGTTATCGGGTACCATGTAGC	1
CACAGTTTGCCACACCTAAGGTTA	1
CACAGTTTGTTAGGTATGTGTCT	1
CACAGTTTGTTAGGTATGTGTCTG	1
CACATAAACCTGGATAGATACTGC	1
CACATAAACGCCACGTCAATGCCA	2
CACATAAAGCCTAGACTTGTATGC	1
CACATAACAGAACAGTGTGCAA	1
CACATAAGAGGTCCACATAAGAGG	1
CACATAAGGTTGGCTACGTGGGCA	4
CACATAAGTAGGTTGGTAGCTGTG	1
CACATAAGTGCCACGTGTAATGAA	1
CACATAATGGTGTTACACGTAGAA	1
CACATACCACCACGGTATACGGAC	1
CACATACCGTGCACAAGGTCCTA	1
CACATACCTAATAGTTGTTGACTA	1
CACATACTAGCACTACGAATTTG	1
CACATAGACGCACTGTGAATGGTC	1
CACATAGACGCCACGTTAGCCAAA	2
CACATAGATATTATGTAGGGTGT	1
CACATAGATTTTGAGAATATGTA	2
CACATAGGAAAAATACTTGTGGGA	1
CACATAGGATAGATACACAACGAA	1
CACATAGGCCCTCACGTGTACACA	1
CACATAGTATTAGGTGATGAGTTGG	1
CACATAGTTGTGAATGAGTGATGA	1
CACATATAACAAGTGTCCTGTAGC	4
CACATATATCGGTGCTTGCCCT	1
CACATATATTTTGGGACGAAGGGA	1
CACATATCAAGAACCGGTGCGC	2
CACATATCAGTGTGGCCACATCAG	1
CACATATCTGTAGAGGTAGGCCGC	2
CACATATGATATTATATAGGGTGT	2
CACATATGTCTAGTGGTCGTTGCA	2
CACATATTAAATAGAGGGTGCGT	1
CACATATTAATAAGTGCGGGCGAG	1
CACATATTAGGTGGTTGTCTGGCC	1
CACATATTCTTGAGTAGGCTT	1
CACATCAAAACTTTCCTACACGCA	1
CACATCAACCTATCATACACATGC	1
CACATCAACGCTAGTGTACGGG	1
CACATCAATGAATGAGTTAGGCGT	3
CACATCAATGGTGGTAGTAGTGAT	1
CACATCACAGTGTGTCGTTTTGTG	2
CACATCACATCTAAAACTTTTCTA	1
CACATCACATTACATCACATCGAA	2
CACATCACTGGTGCCCATGGCTG	1
CACATCAGAAAGTGCCTAGAATAC	1
CACATCAGATATGTCGAAAGATG	1
CACATCAGCGAATACTACATGGAC	1
CACATCAGGTATTATATAGGGTGT	2
CACATCAGTGCACTGTGAAGGGAC	1
CACATCATATGTGACTCTTGTGCT	1
CACATCATCTTCAATTTCAACTAA	1
CACATCATGGTACTAAATCTAGAC	1
CACATCATGGTGAAGGAATCTTGC	1
CACATCATTGCTACGTAGGTGTCA	1
CACATCATTTCGGGCTTGTTTGGT	4
CACATCATTTTTTATTCTAGGTGG	1
CACATCCATCCACTTTTAGGTCTC	1
CACATCCATGGTGTGTAACAACTA	2
CACATCCCGTACTACGTTTGTGTA	1
CACATCCTGGTACTACGAATCTGA	2
CACATCGAACGTTTGAACACCTGC	1
CACATCGAACGTTTGACCGGATGT	1
CACATCGAATGTTTGATCAGATG	1
CACATCGACAGCGCCTAAACACA	1
CACATCGAGTACTATATAGGGTGT	2
CACATCGAGTATTATATAGGGTGT	1
CACATCGAGTATTATATAGGGTGTC	2
CACATCGGACGTTTGACCGGATGT	2
CACATCGGATATACGGACACATA	1
CACATCGGATATTACGTAGGGTGT	1
CACATCGGATATTATATAAGGTGT	1
CACATCGGATATTATATAGGGTGT	3
CACATCGGATATTATGTGGGGTGT	5
CACATCGGATATTATGTGGGGTGTC	2
CACATCGGATATTGTGTAGGGTGT	1
CACATCGGATGTTTGACCAGATG	1
CACATCGGATGTTTGACCAGATGT	2
CACATCGGATGTTTGACCGGATGT	2
CACATCGGATGTTTGACTGGATG	1
CACATCGGATGTTTGATCGGATG	1
CACATCGGCTATTATGTAGGGTGT	1
CACATCGGGTACTATATAGGGTGT	1
CACATCGGGTATTATATAGAGCGT	1
CACATCGGGTGTTATATAGGGTGTC	1
CACATCGGTTATTATATAGGGTGT	1
CACATCGTTGTAATTTCAACCAAA	2
CACATCGTTTCAATTTCAACCAAA	1
CACATCTAATACTACGAATATGGA	1
CACATCTCGTGAAGCCCGTTGCGA	1
CACATCTGACCTCACGCCGACCTC	1
CACATCTGTCATACACACATTGTG	1
CACATCTTGTCTAAGGTGAGGTGA	1
CACATGAAAACAGTCACTACATGT	1
CACATGAATGACCGGTTGATTGG	1
CACATGAATGGCCGTTTGATTGGA	1
CACATGAATGGTCGTTTGATTGG	1
CACATGACATCCTAGTCGGCGTT	1
CACATGAGCCTCGAGTGCTACTGT	1
CACATGAGGGCCCACATGTCATA	3
CACATGAGGGCTCACATATCATA	1
CACATGAGTCAATGACATGTGGGT	4
CACATGAGTCAATGATATGTGGGT	1
CACATGATAAGGACTGCCTTACC	1
CACATGATGCCAACGTGACAA	1
CACATGATGCCACATATGCCCGTA	1
CACATGATGGTCCCTTGTGGTGGC	2
CACATGATGTCTTAGATGTTGTGT	2
CACATGATGTCTTGAATGTTGTGT	1
CACATGATTAGGGTGTGCGTGTG	2
CACATGATTGCCAGTTAAGCC	1
CACATGCAGGTGACGTCGCTCC	3
CACATGCCAAGTTGTTGTACCATG	1
CACATGCCAGTGACAGAGACACGT	1
CACATGCCATACGCCAGCCAACGC	1
CACATGCCATAGACAGTGAGTGAC	1
CACATGCCTCATCCTAATTGGACC	1
CACATGCCTGGACAACGTGGGCC	1
CACATGCGTGCAAAATGACTTTAA	1
CACATGCTCTACGACAGCACGTAC	1
CACATGCTTACATTTTAGGACGG	1
CACATGCTTCAAGTGGCTAGGAGG	1
CACATGGCAGGTGTTTACGGGGAC	1
CACATGGGTGCAAATTTCTACAAG	1
CACATGGGTTGATGTGACGGGGAG	1
CACATGGTAGATGCATGATGGGTA	2
CACATGGTGCACGCGAGCGAGACC	2
CACATGGTGGAGATTGTTGGGCCC	1
CACATGGTGGATTTATTCTGGAGC	1
CACATGGTGGGCTGGTGTTGGTA	1
CACATGGTGTCCGCTGAGTGATG	2
CACATGGTGTCCGCTGAGTGATGT	1
CACATGGTTTTGATGGTCGTGCTC	4
CACATGTAAGTGGTCTACGTCAAA	1
CACATGTATAATATACACGGGCAGC	1
CACATGTCAGTAGTAGAGGTGTG	1
CACATGTCAGTAGTAGAGGTGTGA	1
CACATGTCAGTGATAAGTATTGTA	3
CACATGTCAGTGTCTGTAATGGTA	1
CACATGTCATAGACACATGAGGGC	1
CACATGTCATTGACAGGATGTGGC	2
CACATGTCATTGACAGGGTGTGGC	1
CACATGTCATTGAGATAGGGGTGA	1
CACATGTCATTGAGATAGGGGTGG	4
CACATGTCATTGAGATAGGTGTG	1
CACATGTCATTGAGATAGGTGTGG	2
CACATGTCATTGATAGGGTGTGGC	4
CACATGTCCCCTCGGGTCTACATG	1
CACATGTCGACTAATCTTACCAAT	2
CACATGTGGGGTATGTGTGGGTCC	1
CACATGTGTATGATCGTTTGAGAA	2
CACATGTGTCTAGCTGTCGACGAG	1
CACATGTGTCTATGATATGTGGGTC	1
CACATGTTAGTGATTGTAATGGTA	2
CACATGTTATAGACGGCGAGTGG	1
CACATGTTATTGAGATAGGTGTGA	2
CACATGTTGATGCACTCCTGGTGG	1
CACATGTTGCCTAGGACTTCGATC	1
CACATGTTTGGATACTTGAGGGCC	1
CACATTAAGGGCCTGCTTGGGAGT	1
CACATTAAGTAAGGTGCCCGCGCA	3
CACATTACGATGGTTGATTTGCGA	1
CACATTACGTCTTAGAGTCTGTGT	1
CACATTCATTGCATTGTGGCAG	1
CACATTCTGGTACTACAAATCTG	2
CACATTCTTGTGGTGTCTATTAGC	1
CACATTGAATCTGGATAGATGGA	1
CACATTGAATTAGATACGGGTGAC	3
CACATTGCCGTTGTTGTCGCTGCC	1
CACATTGGAGATTCTGTTCCACGTC	1
CACATTGGATGTTTGACAGGATGC	1
CACATTGGATTGAATGATGAGATG	2
CACATTGGTCTCCGATCTGTTGTG	2
CACATTGGTTGGAGGTATTAC	2
CACATTGTGAGTGCCTGCGTTTGT	1
CACATTGTGCTGCCTGCATACAAC	1
CACATTGTGGATGCCCGAAATGCC	1
CACATTGTGGATGCCCTGACTGAT	1
CACATTGTGTCTTAGAGACTGTGC	1
CACATTGTTCCAATTTCAACCAAA	1
CACATTGTTGCTAGGTAGCTGAAA	1
CACATTTAAAAAGTAGTTGTGCCC	1
CACATTTACATAGTATGTTTCC	1
CACATTTCAGAGTGGCGGTGGTTC	1
CACATTTCTACGCCGTGCACTGAT	1
CACATTTGTTGGACTTTTTGGC	1
CACCAAAAAGTGCTAGAATGGCAA	4
CACCAAAACACAGGAGTAGGGTGT	1
CACCAAAACTGGAAGTGGAGCTG	1
CACCAAAACTGGGAATGGAGCCGG	3
CACCAAAACTGGGAGTGGAGTTGG	1
CACCAAAATTAGGAATGGAGTTGG	1
CACCAAAATTGGAAGTTAGGTTG	1
CACCAAAGGACCTCGGGTGACCAA	2
CACCAAAGGACCTTCGGTGACCGG	1
CACCAAAGGGCCTACTGTGACCGA	1
CACCAAATCCGGTGTTGTTGAGCC	2
CACCAAATCTGATGTGACCACGGC	2
CACCAAATCTTAGGCGTGCCACAA	1
CACCAAATGAGATTGATGAGTACA	1
CACCAAATGTCACCTACACACCGA	3
CACCAAATTCACCCGCCTGCGAA	1
CACCAAATTTGGTAGTGCCAAAAC	2
CACCAACAACAGTCCTACATTCTA	1
CACCAACACAGTAAAGCCGTACAT	1
CACCAACCGGGACTAAAGATCCTC	1
CACCAACCGGGACTAAAGATGGTA	2
CACCAACCGGGACTAAAGATTGC	2
CACCAACCGGGACTATTGTGGA	1
CACCAACCGGTACTAAAGATTGAA	1
CACCAACCGTAGGCGTCTGGTCCA	1
CACCAACGAGACTTTTGTGGTTGG	1
CACCAACGTTGTTTGATACCGGC	1
CACCAACTATTAAAATCGGTGCAA	1
CACCAACTGGTACAAAAGATCTCC	1
CACCAAGAAGCTTGATGGATC	1
CACCAAGAGCGGTGCCTTGGAGGA	1
CACCAAGAGTGGAGCCAATTGAA	1
CACCAAGAGTGGAGCCAATTGGAA	2
CACCAAGATCTCTGAGGCTC	1
CACCAAGATTTGGACCTGCAAGC	1
CACCAAGGCCTCAACCATGGA	2
CACCAAGGGACCTCGGGTGACCGG	1
CACCAAGGTACGTCACCGTGACTGG	2
CACCAAGTAGATGTGCCATTTGTT	2
CACCAAGTCAAATAAGCCACGTAGG	1
CACCAATAGCAAAACCCGGCACCT	1
CACCAATATATATGGTAAAGTGAC	1
CACCAATCAGGAATACTCCATGGG	2
CACCAATCGGCTCATCGGTGCAGC	1
CACCAATGTACCACACCGCTG	1
CACCAATTACGCTGGTGCTGAGAC	1
CACCAATTAGGACTAAAGATCGT	1
CACCAATTTTTAGACGTGCCACAA	1
CACCACAACCAGTGATCAGACACC	1
CACCACAAGTGAGCCGCAAGTGAG	1
CACCACAATGTCAAATCATGGCGC	1
CACCACACAAGTTTAGGGACCGGC	1
CACCACACATGCTTCAAGTAGCTA	1
CACCACACATGCTTCAAGTGGCTA	3
CACCACACGAGTCGCCGCCGATGC	1
CACCACACGATGATGGCAGCCAGC	2
CACCACAGACAGCCACCACAA	2
CACCACAGACGCCTCACTGTCGAC	1
CACCACAGAGATGGAGAGGGCCAA	1
CACCACATACCATGTCTTATACGG	1
CACCACATGATGTGATCCCTG	2
CACCACATGGCAGGACAGGAA	1
CACCACATTGAAGTGCATGTC	3
CACCACCAAAGGGCCTACTGTGAC	1
CACCACCAATTGAAGGACAAGTGC	1
CACCACCACCCAACTATCATGCGG	1
CACCACCAGGCGTGGAGCCTGCGGC	1
CACCACCATAGCCAATGGTCGCCT	1
CACCACCCTTGCCACGTTCCTCGA	2
CACCACCTATGCAAACCCAACA	1
CACCACCTTCATCCTGCCAAGAAG	1
CACCACGAAACAAAGACTGGTCA	1
CACCACGAGTGCCTATCTGTCGAT	3
CACCACGCAACCTAGCCAGGTGGT	2
CACCACGCACGCACGTGACTGAGT	1
CACCACGCATATGGGGTTAGGTGG	1
CACCACGCCCCTTAACTTGCCAGG	2
CACCACGCGTGGGAGAGGTGTCGG	1
CACCACGGATTGAGGAGCATTGGC	1
CACCACGGTATACGGACGGAAGAC	1
CACCACGTACGTCTCGCTATCGAC	2
CACCACGTAGGTGTCATGGCAGCA	2
CACCACGTCAACGCCACGTAGGA	2
CACCACGTCAATGCCACGTGAGAC	2
CACCACGTGGACAATGACATGT	1
CACCACTAAACTATGTACTTC	1
CACCACTACCGAGCCCCGTC	1
CACCACTAGTTCTCCGCCATCCAC	1
CACCACTATAGGTGCCGGAACAGC	2
CACCACTCCACAGGCATCCTCGAC	2
CACCACTGATGGACTGACCGGGC	1
CACCACTGGGCACTAGATCTCCAA	3
CACCAGAAAGTCCAGATCCCGTC	2
CACCAGAACGATGGGACGGATGAG	1
CACCAGACCTATAGATACCTCTGG	1
CACCAGATCCATGTTTGCCACCGC	5
CACCAGATCTGGTGGCCCCGAGAC	1
CACCAGATGTTGCATTGATTTGAC	3
CACCAGATTGTGTTTGGTAGGTTC	1
CACCAGCAACCGCATTGCCTGTGC	1
CACCAGCAATTACTAAGGCCCCGT	1
CACCAGCCAATTACACCTAAAAGC	1
CACCAGCCAGTGGCAGATGTACCT	1
CACCAGGAGGACATTGGGTACGGG	1
CACCAGGAGGGCACTGTTAGGGG	1
CACCAGGATGCACCGACGACGA	1
CACCAGGCGTGGAGCCTGCGGCT	1
CACCAGGCGTGGAGCCTGCGGCTT	2
CACCAGGGGGATTTGCAGCAC	1
CACCAGGTCTAGTACCTGTAGGTA	1
CACCAGGTCTGGTCGATGCCGGAA	1
CACCAGGTGCAGAGGCTGTGTGCA	1
CACCAGTGTTGTGGGCCCAGTCAC	1
CACCAGTTTTGACTGTTGAGGTAC	1
CACCATAAAAGGTGACCTATAATA	3
CACCATAAATATTGAGGATGCCC	1
CACCATACGATTTGGGTGCACAAA	1
CACCATACGTTGGGGCCTGAG	2
CACCATATTGAAACAAGTTGAGGT	1
CACCATCACGTAGGATGAAGACCA	2
CACCATCAGGGATGAGCGTCCCCG	1
CACCATCGGAAGTAGCCATTGGA	1
CACCATCGGAAGTAGCCATTGGAG	4
CACCATCTAGCAGCTGGGTTCTGC	1
CACCATCTCGGTACCCGAATTGGA	1
CACCATCTTGTAAAGCCAGCTGGA	1
CACCATGAATAATAAACTAAAGGT	1
CACCATGAGTTTGGGGTTGGCCAG	1
CACCATGCAGACCGATTGGGGTGG	1
CACCATGCTAGTTGAATATTAGAG	1
CACCATGCTGTAGGAATGGATGCC	1
CACCATGGGCGTCTCGTTGTCGAA	1
CACCATGGGTCCACGTGTCCTGGT	1
CACCATGGTATCTAATGCACAAA	2
CACCATGGTGAAACGAGTTTACTC	1
CACCATGGTGACACGAGATAGCGC	1
CACCATGTGTGTACCTTACTG	1
CACCATGTTGGGATGAAGTTTGCC	1
CACCATTAGCTGGGTGACGCTA	1
CACCATTCCGCCATCCTACGTGGC	1
CACCCAAAATATTTTGCAGGCGGG	2
CACCCAACTAGCTAGCCGGGGAGC	4
CACCCAAGAAAGAGGTAGCCTAGC	1
CACCCAAGAGGTGCTAATTGGAG	2
CACCCAAGATATGCCAGATGACGA	1
CACCCAAGATGTGCTAATTGGGGT	1
CACCCAATCAGATCAGATGTATGC	1
CACCCACACTGGATCCAGCTCTGC	1
CACCCACCCAATACACAACATGAT	1
CACCCACCTACGGTGGCCATGGC	1
CACCCACCTACGTACCGTGAGATA	1
CACCCACCTACGTACTGTGGAGGA	2
CACCCACCTATACTGCTAAGGGAC	1
CACCCACGCACCAACAACGCCAAC	1
CACCCACGTTGGGATCCGGTGGGA	4
CACCCACTAGCAATTATTATCTA	1
CACCCAGATACCGACAGCGCCAAC	1
CACCCAGCACTATACTACCAACGG	1
CACCCATAATTGGCAAAAGGTTGC	2
CACCCATATCCAAGGAGGTGCT	1
CACCCATCAGACTAGTCTTTTAGG	1
CACCCATGGGCAGATCGATCGCGC	2
CACCCATGTCGGCCATGCATGCGT	2
CACCCATTTGGTGCATGTCAACT	1
CACCCCATGTCCGATTCGCGCCAC	1
CACCCCCTGGTAGATTTGTTTGGT	1
CACCCCGCAGACGGTACGATGACC	1
CACCCCTACGTAGGTCTTTATTA	1
CACCCCTTGGTGACCTGGACTGAG	1
CACCCGAAACGAAAGAGTGGA	1
CACCCGACGGATGAGCAGCGGTGG	1
CACCCGAGGTCCTTCGGTGGTT	1
CACCCGATCTGTGGTATGGAGCGA	1
CACCCGCAATGGTAAAGTAGGGT	1
CACCCGCAATGGTAAGTAAGATGC	1
CACCCGCCTATTAGGTGTCCCCA	1
CACCCGCTTCATGTTCTGATGTTC	1
CACCCGGATCGCTGTGTTCTTTGC	1
CACCCGGTGACTAATGGGTTGGGC	1
CACCCGGTGAGAGCTGAACGTGAA	1
CACCCGGTGTTTGGGATGGGAGG	1
CACCCGTAAAAGGTGACTGGACT	1
CACCCGTCAAAGGTGAGGTGTTGT	1
CACCCGTCCAGACTATGGTGGGCC	1
CACCCTAAACTTTTAATACCAGA	1
CACCCTAACCCTAGGCTACTGTTG	1
CACCCTAACCGAGTGCACCGGCGTC	2
CACCCTAAGCTTCACCCTCGTAAG	3
CACCCTACCTATGGTGGCCGTGAC	1
CACCCTACTGGTGGATCACTGGCG	1
CACCCTAGACTAATGTTTAGCCTA	2
CACCCTATAACGGGGGCGCGGGACCA	1
CACCCTATATAGCTTTAGTGGC	1
CACCCTATCGAACAACCGTGGT	1
CACCCTCAAGGATGGTAAAAATGC	3
CACCCTCTAGATCCGCCACTGCTT	2
CACCCTGGTGCTTTTGAAGAT	1
CACCCTGGTGTCTGTGAAAATAAA	2
CACCCTGGTTGATCGGCAAAAGCA	1
CACCCTGGTTTTGTCCCACGTGAC	1
CACCCTTTAGCCTACCAATTCATA	1
CACCCTTTTCAGGTTGTAGGCGCC	1
CACCGAAAAGTGCTAGAATGGTA	1
CACCGAAACCAGAGCCATCGAAGC	1
CACCGAAACCGATAAATCGTGGAA	2
CACCGAAATGCCTATTTCTGA	1
CACCGAACTTCTTACGTGCGG	5
CACCGAAGAACTTTGGGTGACCGG	3
CACCGAAGCTCCGGATTGTTGGTA	1
CACCGAAGCTGGATCTGATGGT	1
CACCGAAGGACCTAAAGTGAACGG	5
CACCGAAGGACCTATTGTAACCGG	1
CACCGAAGGATCTATTGTGACCGG	9
CACCGAAGGGTAGTGGGTATGCCT	1
CACCGAATCTGAGCGAGGGAGG	1
CACCGACATATGGGCCCGATGAAT	1
CACCGACGTAGAGGTGGCCGTCGA	1
CACCGACGTATGGTGTGTCGCCG	1
CACCGAGAAAACATGAAACTGCC	1
CACCGAGAAATTTAGGGGAGGGAG	1
CACCGAGAGGCTGGCCAGTGACGA	1
CACCGAGATGGTGTGGACTCGTGGT	3
CACCGAGCGAAGTGGTGGTCG	1
CACCGAGGCATCTTCATTCAC	1
CACCGAGGGACCTATTGTGACCGG	1
CACCGATATCGTGAATAGGTGTAGC	1
CACCGATATGCGTCATCATCAA	1
CACCGATCTACGTGTTGTTGGCCG	1
CACCGATCTATGGGCTGGGATGGT	1
CACCGATGAAAAATCAAAGGG	1
CACCGATGGACCAGCGATGTGCGT	3
CACCGATGGGAGGATGAGTGCGCA	1
CACCGATGGTGATTAGTTTGGGAC	1
CACCGATGTAGCCGAATTTATCTC	1
CACCGATGTTGCGAGATTGTGGAA	1
CACCGATTACAATAGGTCCTTCGGT	1
CACCGATTACGGACCACGGAAAC	1
CACCGATTGTGCACTGTTCGTGGC	1
CACCGCAAGGCATTTAGGTGTTAC	3
CACCGCAAGGTCCTTAGTTCAAAT	2
CACCGCAATGGTCTTGTTCTGG	1
CACCGCACGTTGATACCGACAATA	1
CACCGCATCGGCCAACCCTATGAG	1
CACCGCATCTAAGCAATTAATAGC	1
CACCGCATTTAATGTGGTCAGGAC	1
CACCGCCACCACCACTACCACTGC	1
CACCGCCACTAGAGCCACGGGGTC	1
CACCGCCAGATGGACGACAGAGAG	1
CACCGCCGGTTTGACCTGATGCGC	1
CACCGCCGTTTGGACGACAGAGCA	4
CACCGCCTGCTGTTTTTGAATCGG	1
CACCGCGAGATGATGGATACAC	1
CACCGCGCGTTAGGATTTTCGGGA	1
CACCGCGGATGGGAGGCTAAGTC	1
CACCGCTAAACGTGACCGATCGCC	1
CACCGCTCGACGGTAGCGTGCTGCC	1
CACCGCTGATGTATGGTGTACTGC	1
CACCGCTTAACTATCATTCAT	3
CACCGCTTTATTGAAGATGTTTCT	1
CACCGGAATAACAGGATACTACGC	1
CACCGGAATTGTAAGGTACGTGCA	1
CACCGGACCCTTTAGTTCGTCGAG	2
CACCGGACTTGGAGATGGATAGA	1
CACCGGATACTTTATTTGGGA	1
CACCGGCCAGAACCGTTGGGTTGC	1
CACCGGCCGGTTGATCGAGATAAC	2
CACCGGCCTTGAAGATGGATAGAA	1
CACCGGTAAGTTGTATGTGTGCA	1
CACCGGTACACGAACTTGTCAGAT	1
CACCGGTAGAGAGATGATCGGAGC	3
CACCGGTCCCTAAACTTATATCGC	1
CACCGGTCCCTAAACTTGTACCGC	2
CACCGGTCTGACCGCCGATGTGCC	1
CACCGGTGAAAGCCTTGCCAGGCC	1
CACCGGTGAACCCTACACAGTTAG	2
CACCGGTGACCAAAACCACGGCGG	1
CACCGGTGTGATTTTTCGGATCGG	1
CACCGGTTTCCATAGTTTGGGG	1
CACCGTAAATCGTCGGATCTCGAT	2
CACCGTAAGTGGTCGCGTCTGCAA	1
CACCGTAATGATCGGCTAAGGTGG	1
CACCGTACTGAGCAAGCCACACCA	1
CACCGTAGCATATAGGTGTAGAAA	1
CACCGTAGCCCTCATGGCCTCTGT	1
CACCGTATGTAGGGAGAGCCCTGA	1
CACCGTATTGTCATAGGTAGCCT	1
CACCGTCCGATGACTCTGAAGAGT	1
CACCGTCCTTAAGAAAGTAGGT	1
CACCGTGACTGACATGTGGGCTTC	1
CACCGTGCCGATTAAAATGATGAT	1
CACCGTGGCTAGGGGTGAAACGGA	1
CACCGTGTCTATAACGTGTGGGCC	2
CACCGTGTCTATGACATGTGGGC	1
CACCGTGTCTATGACATGTGGGCC	1
CACCGTGTGCCATCTTGTATCCAA	1
CACCGTTATACGTGATTGGTCGCC	1
CACCGTTCAAACTGCCTTGGGACC	1
CACCGTTGAATCGGCGCCGACAGC	1
CACCGTTGTGTGGTACGGGAAGTT	1
CACCGTTTAGCGGTTTGAAAAGTG	1
CACCTAAAATGCTATCCTACCAAA	2
CACCTAAAATGGGAGTGGAGCTA	1
CACCTAAGCGCTACGTCAATGCCA	1
CACCTAATCCCTTCTATATCTCTG	1
CACCTAATTCGAGTGATATGGCGCC	1
CACCTACAAAAATGGGATGGACCT	1
CACCTACAAAAGAAGATCAAGTTC	1
CACCTACAACAATATTGATTTCGA	1
CACCTACAACAGTGTTGACTTCAA	1
CACCTACAATGGTAAAGTAAGGT	1
CACCTACAATTTAGTCCTGACCGG	2
CACCTACACACTGACAGTGCCAAC	1
CACCTACACATCAGTTCTGTTGGA	1
CACCTACCTCAAACGTACTGTGGG	1
CACCTACCTGCCAAGTTGTTGCA	1
CACCTACGCGGTGAGGTCAACGAG	2
CACCTACGTACCGTGAGATACACA	5
CACCTACTAGCCACTGCTACTGCA	1
CACCTACTATGATAAAACCTGCA	1
CACCTACTCAGGAAAATGCCCAAT	1
CACCTACTGGTGGACGACGGAGCA	1
CACCTAGAAAAAAAATGATGTGAC	1
CACCTAGAATGAAATATGATGTGA	1
CACCTAGCCAAGTCACAACACCGA	1
CACCTAGCGAAAAGATGATGGACC	1
CACCTAGCGCTAGGAGGTTGGTCC	1
CACCTAGGATGAAAAGTGATGTGA	1
CACCTAGGTGTACTTTGAATGGTC	1
CACCTAGTATGGTGTCTATGACAT	1
CACCTAGTTAGAAAATGTGGGTA	1
CACCTATACTGCTAAGGGACCTCC	2
CACCTATCGATAGTGGTGGTAGGT	1
CACCTATGAATGAAATGATTTGAA	1
CACCTATGACAAGCCGTGACCGGA	1
CACCTATGACGGGCTGAATCTGAC	1
CACCTATGAGGCCGGTCTATAGGA	1
CACCTATGCTTGTGGTGACTTTAC	2
CACCTATTAGGTGACGGAGATGGT	1
CACCTATTAGGTGACGGGGATGGT	3
CACCTATTAGGTGATGGGGATGGT	1
CACCTATTCTCATCATATCACAAC	1
CACCTCAAACGGGTTTAAGTCCTA	1
CACCTCAACCAGTCAACAAGGAGC	1
CACCTCCAAGCTGGAGCTGTGCCA	2
CACCTCCATGGTGCTGATAAAAAC	1
CACCTCCCACAATGGTAAAGGTAC	1
CACCTCCTAGGAACTACGAGGGGT	1
CACCTCCTTGTGATGTTGCAA	1
CACCTCGACAACCAGTGAATGCCT	7
CACCTCGACCACCAAATCATATGC	1
CACCTCGCTGTCGACGGGTACGTT	1
CACCTCGTAGTGCAGCGATATGGT	1
CACCTCTACACCCACCTACGTACC	1
CACCTCTATCTCCACATGTGTCTA	1
CACCTCTCAGGTTGTGAGTGCGGT	1
CACCTGAAACACCTGAAA	2
CACCTGAAAGAGTCTGTTGATG	1
CACCTGATACGTGGTAGGAATCGC	1
CACCTGATGGATTATGCCTATGTA	3
CACCTGATGGTCCACGAGCAGCCC	1
CACCTGATTTGTGCCAAGATGTAC	1
CACCTGCAAAAGGGCGGCGAGGGC	1
CACCTGCATGTGCATAATATTCG	1
CACCTGCCAAGTTGTACCGTGGGT	1
CACCTGCCACAACTGCGGGAAGA	1
CACCTGCCGAAAATGGGCCAGAAA	2
CACCTGCCTGCCAAGGCTGATAGA	1
CACCTGCGACGTGTGGCAGTTAG	1
CACCTGCGACTGGTGATGCCACGG	1
CACCTGCGAGATGACATGACTGT	1
CACCTGCGCATGCAAATTCAACAT	1
CACCTGCGTTGCGAGGGATGGACG	1
CACCTGGATGGTTATGGTTGGCAC	2
CACCTGGCAAGTTGGTTGGATGG	1
CACCTGGGAGCACAGTTGGTCAGC	1
CACCTGGGATCACCGTGAGGACGC	1
CACCTGGTCCAAACGTCACGATA	2
CACCTGTCATACACACATTACGTC	2
CACCTGTCGATAACAATGTGTCT	1
CACCTGTGATAGGTTGCGATGCCA	1
CACCTGTGATGGGTTGCAATGCCA	1
CACCTGTGGGTTGGGCCAAAGAGA	1
CACCTGTTAGTGGCTACGTCAGG	1
CACCTGTTGCTAGATTGACCACAA	1
CACCTGTTGGGTGCTGGTTGGGAA	3
CACCTGTTTCTGGATACTCTTTC	1
CACCTTACACTGTGCCCGATGATG	1
CACCTTAGGTCAGCCGTGTGGGTA	1
CACCTTATATAGGATGGGGGGCAG	1
CACCTTATATAGGGTGGGGGCAG	1
CACCTTATGGGATGGTATGCA	1
CACCTTCAATCAGGGGCAACGTG	1
CACCTTCGAGTGGTTTGACGGGTA	1
CACCTTCGATTGGTACCTGCTGCC	1
CACCTTGACGGTAGCGGTGATGGT	1
CACCTTGACGGTTTCTACTGTGGG	1
CACCTTGATTACGATGGAGCT	15
CACCTTGCAAGTTTAGCACGAGTG	1
CACCTTGCTTAAAAGGGAGGATGC	1
CACCTTGCTTATTCTAGGAGAGGG	2
CACCTTGTGGAGCTAGACGGAAGA	1
CACCTTTATATTGATGCTAATGAA	1
CACGAAAACCCACCTCATGGGATG	1
CACGAAACAAACACGCCTAGTGG	1
CACGAAACCTAAAAGTGGATGGAT	1
CACGAAACTATAGATGTAAGGTGTC	2
CACGAAAGCTATGGTACTTGC	4
CACGAAATAATTTGATCCATG	2
CACGAAATGACTTTTGGGGAAAG	1
CACGAAATTATGTGGTGGGTGTA	3
CACGAACAAAAATAGGAAGGGCGA	1
CACGAACAAGATCGGGTATAGGCC	1
CACGAACATTTGAATCTGAGCGAG	2
CACGAACGAAGCCTACTCCTCGG	1
CACGAACGAATTTGTGATGCCA	1
CACGAACTACGGGCTTACATACCG	2
CACGAACTTATCAGGTGGGTGCAA	2
CACGAACTTATTAGGTGGGTGCAA	7
CACGAACTTGTCAGGTGGGTGCAA	1
CACGAACTTGTGAGATGAGTGCAA	3
CACGAACTTGTTAGGTGGGTGCA	3
CACGAACTTGTTAGGTGGGTGCAA	4
CACGAAGCATTGGATTGGTTTGAT	1
CACGAAGCCAGGCCTTTTAGGGAG	1
CACGAAGCGAGAACGAAAGTGCA	1
CACGAAGCTAAGCGACGTGGTGAC	2
CACGAAGGGTCCAAATAACATAG	1
CACGAAGTGAGAATGAAAGTGCA	1
CACGAAGTGAGTTTTTGCCTCGAA	1
CACGAATAGCGGGCGCTATAGCG	1
CACGAATAGGCCGTGACCTCAAC	1
CACGAATCCTATGTGTTGGTGACA	1
CACGAATGAGTGTGGTTATGGACC	1
CACGAATTGCATGCCACCGTGGAA	1
CACGAATTGCGGGAGCATAGAAAA	1
CACGAATTTGTACTACGGGGGTGG	1
CACGACAACACGCAGTGGTTGTG	1
CACGACAACAGGACGGGAGTGC	1
CACGACAGCCATAGTGCCACGGTG	1
CACGACAGCGCATTGTGCTTCTCC	1
CACGACATCTGTCGAAGCCGCTGC	2
CACGACATGGTTGCCTTTGTG	2
CACGACATGGTTGCCTTTGTGAA	1
CACGACATGGTTGCCTTTGTGAAG	1
CACGACATGTGGAGCTTATTGGAA	1
CACGACATTAGCATGGTATCGTA	1
CACGACCACCGTAGACCACAGCCA	1
CACGACCGATGAGAATGCCTTCAA	2
CACGACGAGAGTAAACCAAGGGCC	1
CACGACGATGCAGAAATGGTGGAA	2
CACGACGCAGACCTGCTAGCTGGG	1
CACGACGCCTTCGTTTGCTTCGGA	1
CACGACGTACGCGTCGAATGGTC	1
CACGACGTCTTTAGGTAGAGGTA	3
CACGACTACGGAATTTGCATGGTA	2
CACGACTGCCCGCTTGTGCTTGAG	3
CACGACTTAAAAGGTGGAGGTGGT	1
CACGAGAAAAAGATTGTTGGAGGC	1
CACGAGAAAAGTTGATTACATTGC	1
CACGAGAACCTATGCACTAGAC	1
CACGAGAACCTATGCACTAGACAC	1
CACGAGAACCTATGCACTAGATAC	1
CACGAGAACCTGTGCACTAGACTG	1
CACGAGACCTAAAAGTGGATGGA	4
CACGAGACCTAAAAGTGGATGGAT	5
CACGAGACGGTGTGAAGTTCTAGA	1
CACGAGATGAATATTTTGAGCCTA	2
CACGAGATGGTGGACTAGATGACC	2
CACGAGCAAACAGCGCCGCCGTGC	1
CACGAGCAAATACTTCGGGTGTC	1
CACGAGCCACTAGAGTTGCCGGGA	1
CACGAGCCCTGATGATGCTGCTGT	1
CACGAGGGTGCGATGTTTTGTA	1
CACGAGGGTGCGATGTTTTTGTC	1
CACGAGGTTCTTTGGAGATTGAAG	1
CACGAGTACCTCGCTGTTGATGG	1
CACGAGTGAGGACAAAGTGTGCA	3
CACGAGTGAGGACAAAGTGTGCAG	2
CACGAGTGAGGACAAAGTGTGCT	1
CACGAGTGTCTCACTGTTGATGG	1
CACGAGTGTTGGTGCATATTTGGA	1
CACGATAAAATTCGACGATGGCAT	1
CACGATAAATGAAGCCTGGGCCT	1
CACGATAACCACGAGACATATCGT	1
CACGATACCAGGTGCGTCGTTGAA	1
CACGATAGGTGATTGCAAGTGCAC	2
CACGATAGTTCGGTGGTGGGTGGT	2
CACGATATATTTTAGTTGGTGACA	1
CACGATATCAGAACCGTACTGCCT	5
CACGATATCGTCGCTGCATCTGCC	1
CACGATATGGACTCTGAATAACGA	2
CACGATATGTGCGCCAATTAAGAG	1
CACGATATTATAGTTGGGTGTCAC	2
CACGATATTATAGTTGGGTGTCACT	1
CACGATATTTATTAACGAGGTT	1
CACGATCACCACGCGCACACTGAC	1
CACGATCATGAGCTACAATTAGGA	1
CACGATCCACTGAGATCCAGCC	1
CACGATCTTTGGGTGTCTTACAGC	2
CACGATGAAATACCTGATCTTGAT	1
CACGATGATGGTGATGAGATCAAC	1
CACGATGATTCAGGGTAACTCGTA	1
CACGATGCGTTGAGACTTATTTGT	2
CACGATGGCTGCGGTGCTGGGGAA	1
CACGATGGGTGAGAGACGAACCTG	4
CACGATGGGTGTCTTATTGTCGAC	4
CACGATGGTCCATGATTGGTAGG	1
CACGATGGTGTTGCATTGCATGGA	1
CACGATGGTTTTAGCTGACGTGGC	1
CACGATGTAAGGTCCAACCACTA	1
CACGATGTATTGTGTGGTCAGTGA	1
CACGATGTCTGCGGGTCTCGGGTA	1
CACGATGTGACAGGCCGACTGACA	1
CACGATGTGATGGAAACATGATGC	1
CACGATGTGTCCTAACTCCAACCC	1
CACGATGTGTCTGACCCTATGT	1
CACGATTGTGAGATGAAAGGTGTA	5
CACGATTTGATGGTTACCGTGCTA	1
CACGATTTTTAGCCGATAAAAGA	1
CACGATTTTTGGTACGCCACAGC	2
CACGCAAAAACCGATTCCGACCAC	1
CACGCAAAGTGAGGTGGGTAGCA	1
CACGCAAATCAAATAATGGTACCA	1
CACGCAATGCGGCGTGCTGAGCGT	1
CACGCACAAATCGAGAAATGGTCC	1
CACGCACAAGGTTCTTAGGTGGC	1
CACGCACAGGAGTAGGGTATTACA	1
CACGCACAGGGCACCGACGGAC	1
CACGCACGCGCACTGTGAATGGCC	1
CACGCAGGAGAGGAGCAGGGTGAT	1
CACGCAGTGAAGTATGTACGGTGT	1
CACGCATACGACAGGTTGAGAGTG	1
CACGCATCGGCGATGGATTTAGCA	2
CACGCATCTAAAAATTGTCCT	1
CACGCCAAAAACGGTAAGGTGAAC	1
CACGCCAAATTGGAACGATGTGAC	4
CACGCCAACTAGATCAGCGTGGCC	1
CACGCCAAGCCACCTACAGGCGAA	1
CACGCCAATCCACCTGCTACCGAC	1
CACGCCAATGAGATCGGCATGGTC	1
CACGCCACTCCAAATCTGTGCCAC	1
CACGCCAGCCGGACTGACATGGCA	2
CACGCCATACAGTTATTACAGCGA	1
CACGCCATAGAGAGAGGAGGTGGA	1
CACGCCATATGCAAACTGACTGAC	1
CACGCCGAAAACGGTAAGGGGAAC	1
CACGCCGCATTTAATGTGATGTG	1
CACGCCGGTCAGACCGCCACTAT	1
CACGCCTAAGGTTTGGTGTGGTAA	1
CACGCCTCCATCGTGCCTGTGCTC	1
CACGCCTCGATGCGTATAGTGGTC	1
CACGCCTGCGAAAATCAACTATT	1
CACGCCTTATTGGACTGTGCCTAA	1
CACGCGAAAACCGATTTTTGTGTG	1
CACGCGAAGTGACTTTTGGGGAAA	1
CACGCGAGGTGTTAAATATGTGAT	1
CACGCGCAAAAATAGAAGGATGAT	1
CACGCGCTAGATGGCTCTTGC	2
CACGCGCTCTTGTGCTGCCACGTG	1
CACGCGGACATTCCTGATGGACTC	1
CACGCGGGGAGAGACCGAATGGGC	2
CACGCGTACGCCACGTAGACCAAA	3
CACGCGTACGGGATTAGGTGGGCA	1
CACGCGTATTGGGTGAGTGGGCTT	1
CACGCGTGTGTATAGTTGATAGG	1
CACGCTACATCACGCATCGGTGGT	1
CACGCTACTTTACTAACCGTGA	1
CACGCTAGCAGAGTTGATTGTGG	1
CACGCTAGCCAGATTGATGTGATA	1
CACGCTAGTTGGCGCTGAGGTGTC	1
CACGCTATTTAGCGCTGAGGTGTC	6
CACGCTATTTGGCGCTGAGGTGTC	7
CACGCTATTTGGTGCTGAGGTGTC	2
CACGCTGAAGAGCGTCAACAGGAC	1
CACGCTGAGGTGGTGCTTTAT	2
CACGCTGTCGGCCAATCATCACA	1
CACGCTTAGGAAAGGTGAGGTGAA	1
CACGCTTCCCAAACTACTCAACGG	1
CACGCTTTGGGAACCTCCGGAACG	3
CACGCTTTTCAAACTGCTAAACGG	1
CACGGAAAAATAGAGGAGTGTCGC	1
CACGGAAAAATAGGGAACCGGCGC	1
CACGGAAAACGAGGGAGCAGCCAA	1
CACGGAAAATCATGGCTGCACTTA	2
CACGGAAAGTTTGTGTGCATAGGA	1
CACGGAATCTATAGATGGGAAGA	1
CACGGACATATTAGATGGGCA	3
CACGGACCGAACGAGTGTGCTGTG	1
CACGGACCGAGTAGCAGACGGCGC	1
CACGGACGATGTAGACAGGTTCG	1
CACGGACGCATAAGATGGTGAGGT	1
CACGGACGGATGGAGTAGGTGTGA	1
CACGGACTCCAAGACAGTGTGTGT	1
CACGGACTCCAAGACGTCATGTG	1
CACGGACTCTAATACGTTGTGTGT	1
CACGGACTTATCAGGTGGATGTAAT	1
CACGGACTTCGCTGGAGATGGACC	1
CACGGACTTTAAGAAGAAGTGTGT	1
CACGGAGATATATTTTGGGACGG	1
CACGGAGCACCAGTGCTTAGTC	1
CACGGAGCCACTTCGCGATGTTGC	1
CACGGATATTCGATAGAGTGCCAA	1
CACGGATCCTCTGCAGTACTGCA	2
CACGGATGAACTACATCGAGGCGCC	1
CACGGATGACTGTCCCGGGTGCAC	1
CACGGATGGAATGGTTAGTTGATA	1
CACGGATGGTTAAAAGTTGTGCAC	1
CACGGATGTATTATTCGTGGGTGT	1
CACGGATTGAAGTGCCCCCAAGT	1
CACGGATTGCATGTGGTTGGTGAA	1
CACGGATTGGATAGGAATCGGCGA	2
CACGGCAAGAAGTGCGATGGCCTA	2
CACGGCAAGGGTGGACGTGATGGA	1
CACGGCACAGTCCGATTGGGTGAC	1
CACGGCAGCAAGTGGTGGCAGCAG	1
CACGGCAGCCGTTTTTGGGTGGGT	1
CACGGCATTCAGCGCCAGTTGATG	1
CACGGCCAAGGTTAGATGGGATAT	1
CACGGCCAGGACAGGATCTAGCCA	1
CACGGCCATCTGCGACATCAC	1
CACGGCCGATTCACGTTAGGGTGT	1
CACGGCCGCAAAATTTTAAGGGAC	1
CACGGCCGTAAGCGGTGACGATGCT	1
CACGGCCTAAGATGAGGTGTTGG	2
CACGGCCTCTTTCCGGTATGTCGT	1
CACGGCCTTCAGGAGTGCTGCTGCA	1
CACGGCGCACATACTATTCGACGA	1
CACGGCGGCTTACAAGAGGTATA	1
CACGGCGTCTCGCTATCGATGGTA	1
CACGGCGTCTCGCTGTTGATGGAT	1
CACGGCGTGGTGCTTGCTTGCCGA	1
CACGGCTACGGTATTTGGATGGTA	2
CACGGCTACTACTGCTGCATCGAC	1
CACGGCTGATATATGGACATCA	1
CACGGCTGATGGACACTACAAAA	1
CACGGCTGCACTTATTTTGGGA	1
CACGGCTGTGCGAGTTGGTGTTGC	1
CACGGCTGTTGATCGTTGATGG	1
CACGGCTGTTTGCATCGGTGGGAC	1
CACGGGAATTCGACTGGGCCCACA	1
CACGGGACACCTCGGCTAGAACC	1
CACGGGCGACGTAGACAGGTTCGG	3
CACGGGCGATGTATACAGGTTC	1
CACGGGCGATGTATACAGGTTCGG	2
CACGGGGTGCGTCCTTGATGGCC	1
CACGGGTAAACGGGCATGGGTAGT	2
CACGGGTATATCCGGCGGGTAC	2
CACGGGTATTAAGAAAGTAGGTA	2
CACGGGTCAGCGGCTTAAGGGGG	1
CACGGGTGACCCTAGATGCTTGTT	1
CACGGGTGCGATATTTTTGACCGG	1
CACGGGTGCGATGCTTTTGACCGG	4
CACGGGTGCGATGTTTATGACCGG	1
CACGGGTGCGATGTTTTCAAGCG	1
CACGGGTGCGATGTTTTTGAC	2
CACGGGTGCTCGTATTTACGGCT	2
CACGGGTGCTGAAGACAAGCTTCTGA	1
CACGGGTGCTTGTATTTACGACTA	1
CACGGGTGGTCATGATAAGAGGTC	1
CACGGGTGTCATACGTCATGCGAT	1
CACGGGTGTCCAGCAGCTAAATA	1
CACGGGTGTCTCGTTGTCGACGA	1
CACGGGTGTTTTACATGTTCTCAC	1
CACGGTACCAAATCATTTCTGATC	1
CACGGTACCAAATCGTTTACGATA	1
CACGGTACCTCAGAAAGGAGCTGT	1
CACGGTACCTCGGAAAGGAGCTGT	2
CACGGTAGCTTCGCGCCACTGG	4
CACGGTATACAGACGGAAGACGTG	1
CACGGTATTAGCCGATGATTGGAG	1
CACGGTCAACTGACGGTAGTGGT	1
CACGGTCAAGGGTGAATGTGAGGT	2
CACGGTCACAACGGTTGGTGGG	2
CACGGTCAGGACGGACCATGGTGG	1
CACGGTCAGTCTGTGCCTTGATCC	1
CACGGTCCGATATAGGTGATGTGG	1
CACGGTCGTGTGGCGGTTGAT	2
CACGGTCTGGATGGTTGTCAC	1
CACGGTCTGTCAACTACACGTTGT	1
CACGGTGAATCTGATTGATCGCC	4
CACGGTGACACGTGTTAATGGGAT	2
CACGGTGACGTACCTTGGTGTGGC	3
CACGGTGCACCCAGGTCACATTGGG	2
CACGGTGCAGTCAACTGTAAAGGA	2
CACGGTGCTTTTGGTCTACGTGAC	1
CACGGTGGAGTGCCACGTTGAATG	1
CACGGTGGCCCGCGTAGATTGCGC	1
CACGGTGGCTAAGAAATCTCCAGC	1
CACGGTGGTGGCGCTGTGTGTCGC	2
CACGGTGGTTTTAGTCTACATGGC	1
CACGGTGGTTTTGATCTACGTAGC	1
CACGGTGGTTTTGGTCTACGTGGC	3
CACGGTGTAAGGGGACGAGTCCCC	1
CACGGTGTACTTTTTTGTAA	1
CACGGTGTATCAACTTGGTAGGTG	1
CACGGTGTCTACTGGCAAATTACC	1
CACGGTGTCTATTGGCAAATCCT	1
CACGGTGTGCAAGCGTGAGAGCGA	1
CACGGTGTGTACACGCGAGGGCC	1
CACGGTGTTGGTGATGCTTGA	4
CACGGTGTTTGCTCTCAATAGATA	3
CACGGTTACCGCGGTGGTAAGCA	1
CACGGTTACCTACCGTCGGGGTAC	1
CACGGTTACTAAGAAAGTAGGTTG	1
CACGGTTACTAAGAATAGGCGT	2
CACGGTTAGATCGACGCGGGTC	1
CACGGTTATAGGTTGATTGATGT	1
CACGGTTATTCGACAGGGTGCTAA	1
CACGGTTGACCTACTTTGCAAA	1
CACGGTTGCCAAACGGTTAAGTG	1
CACGGTTGTTCGACAGGGTGCTAA	2
CACGGTTGTTTGACAGGGTGCTAA	1
CACGGTTTTCGACTACTCACTCTT	1
CACGTAAACGCCACGTCAATGCCA	1
CACGTAAGACAAAACTGGTGTCAA	1
CACGTAAGACATGGTGTTACTGTAC	1
CACGTAAGCCAAAACCACTTCCAA	1
CACGTAAGCGACACGTCACGTCA	4
CACGTAAGCGATACGTCAGTGCCA	1
CACGTAAGCTCCACATCAGTGCC	1
CACGTAAGGGCCACGTCAATGCC	1
CACGTAAGGTGTAATATGAACGA	1
CACGTAAGTACCACGTAGGATAA	1
CACGTAAGTGCCACGTATGATGAC	1
CACGTAAGTTAGACCACGGTCAAA	1
CACGTAATCGGTGGACGTGGACCA	1
CACGTACCAGAGATTGAGAGTCGC	1
CACGTACTAAAAAGTTAACAGTG	1
CACGTACTCCAAAACACTATGTG	1
CACGTACTTGCACGGTTGGTTGAT	1
CACGTAGAATAAAATCGGTGTCAA	1
CACGTAGAGGGTGATACTTGTAAG	1
CACGTAGATAAAGTGCTTGTCTAG	1
CACGTAGATGAGTTTTCAACAGAC	1
CACGTAGCATTGACGTGGCGCTTA	2
CACGTAGCCCTTCGGTTGCAC	1
CACGTAGCCTAGTGGATGTAGTGA	2
CACGTAGCCTAGTGGTTGCAGTG	2
CACGTAGCCTAGTGGTTGTAGTG	1
CACGTAGCCTAGTGGTTGTAGTGA	8
CACGTAGGAAATGCCAATGAC	1
CACGTAGGAATGTATTGTTTGGTT	1
CACGTAGGACAAAACTGGTGTCAA	1
CACGTAGGATAAAACCAAGGTC	1
CACGTAGGATAAAACCGGTGTCAA	1
CACGTAGGATACTATAGGGGCTA	1
CACGTAGGATCCTAGAGGGGATG	1
CACGTAGGCGTCACGTCAGCTAAA	1
CACGTAGGTGCCACATCATTTAA	1
CACGTAGGTGCCACGTCAACGCCA	1
CACGTAGGTGCCACGTCAGCGAAA	1
CACGTATATGGAGTGTCTTTCCC	1
CACGTATGGATATAGTGTCGGCAC	1
CACGTATGTGCGTGTGTCGTGGAC	1
CACGTATGTGGTGTTGTTATGAGA	1
CACGTATTACTTACCATAATATGG	1
CACGTCAAATGACACGTGGGATG	1
CACGTCAATGCCACGTAGGACGG	1
CACGTCAATGCCACGTCAGATGAA	1
CACGTCAATGCCACGTGAGACGGA	1
CACGTCAATGCCACGTGAGATGGA	1
CACGTCAATGCCACGTGGAACGAA	1
CACGTCAATGCCACGTGGGACGAA	3
CACGTCAATGCCACGTGGGACGGA	1
CACGTCAATGCCACGTGGGATGA	2
CACGTCAATGCCACGTGGGATGAA	4
CACGTCAATGCCACGTGGGGACAC	1
CACGTCAATGCCACGTGGGGTGAA	3
CACGTCAATGCCACGTGGGTCGAC	2
CACGTCAATGCCACGTTGGACGAG	1
CACGTCACGTCAGTTAAAACCGC	1
CACGTCAGCCCGTCTGGTATGGTC	1
CACGTCAGCGAAACCGCCCT	1
CACGTCAGGTGAGACGGTGCGTGT	1
CACGTCAGTACCACGTGAGATGGA	6
CACGTCAGTACCACGTGGAATGAA	1
CACGTCAGTGACCTATGTTCCTATG	1
CACGTCAGTGCCACGTGGGACGAA	2
CACGTCAGTGCTTGTAATGGTAGT	1
CACGTCAGTGTCTGTAATGGTA	1
CACGTCATCTACGACTACAACGAC	1
CACGTCATGGCAGCTTGGATTGGT	1
CACGTCATTGCCATGTCATGTGAA	1
CACGTCATTTTCGCCGCCCTCTGA	1
CACGTCGAATTGGATATGGGTGAC	1
CACGTCGGATGGGTCGAGGATGGT	1
CACGTCGGATGTTTGATCGGATGT	1
CACGTCGGTCTGCCCTCTATGTGC	1
CACGTCGTGCTGTGTCGTGCCTG	1
CACGTCTACACTTAAAATGGGAC	1
CACGTCTGCATCGTTGGTGTGGCT	1
CACGTGAAAATAGAAATCAACAAG	1
CACGTGAAAGTTTTGAAATGCCT	1
CACGTGAACATGCCTACTGCCCAC	1
CACGTGAATGATGACATGGAA	1
CACGTGACATGTGAGCCCGATGAT	1
CACGTGACGACGTTCCGCATGCCC	1
CACGTGACGTGGTGATTGATAGG	1
CACGTGACGTGGTGATTGATAGGT	2
CACGTGATATTGACGTGGTGCTTA	1
CACGTGATGTGCCACGTAGGCAAG	2
CACGTGCACTGAGGTTAATGTGGA	1
CACGTGCAGGTGGACATTAGGTAC	4
CACGTGCCATAGACTGTAGGTGAC	1
CACGTGCCGCATTTAATGCAGCGT	1
CACGTGCGTCTTGCTTTAATGGTC	1
CACGTGCTAATGGACCACTCCGTT	1
CACGTGCTAATGGACCGCTTCGTT	2
CACGTGCTTATTGACGGCCCC	3
CACGTGGAAAACGAGCGAGGTGAG	1
CACGTGGAACGAAGAGTGTGTCA	2
CACGTGGACGCTATCCGAGATGCA	1
CACGTGGCAGGTGAGGGAAGGAC	1
CACGTGGGACGAAGACTGGGTCAA	2
CACGTGGGACTCCTACAAACGTTC	1
CACGTGGGTGCGATGTAATATACC	1
CACGTGGGTGCGATGTTTTCGA	1
CACGTGGTACTGACGTGGTGCTTA	1
CACGTGGTGACCGCGAGGGGGATC	1
CACGTGGTGTCATACTGGTGTATA	1
CACGTGGTGTTACCAACCGGGAC	2
CACGTGTACGCCACGTAGACCAAA	1
CACGTGTAGCCTATTAAGAGAGCC	1
CACGTGTATGGGTTAGGTGAGCAC	2
CACGTGTCAACACACAGATGGCGG	1
CACGTGTCATAGACAGTGAGTGAC	4
CACGTGTCATTAAGATAGGGGTGG	1
CACGTGTCATTGACATATCGGTGG	1
CACGTGTCCTTTTAATAGACGGGA	1
CACGTGTCGATCGATGGTTGCATC	3
CACGTGTCTAGTCACGCGGGCGAC	1
CACGTGTCTATGACATGTGGGTCC	1
CACGTGTGAAGGCCTGATGGACC	1
CACGTGTGCATACATTTGGTCCC	1
CACGTGTGTACACATGAGGGCCTG	2
CACGTGTGTACACGTGAGGGCCTG	1
CACGTGTGTACATGTGAGGGCCTG	1
CACGTGTGTGCACTGTGAATAGTC	1
CACGTGTGTGCCACGTAGGCTGAA	1
CACGTGTGTGCCATGTGTAGTGCT	2
CACGTGTGTGTATAGTTGATAGGT	1
CACGTGTTATAGATAGTGAGTGGC	1
CACGTGTTATAGATTGTGAGTGG	1
CACGTGTTCAAAGCACCCGTGCCA	1
CACGTTAGGTGAGCACAATTAATG	1
CACGTTAGTGGCTATGTACATCTG	1
CACGTTATACGTTTGACCGGATGT	1
CACGTTCCGCAGGAGCAGGGTGGG	3
CACGTTCGCTGTGAGGGCTAGAA	1
CACGTTCGCTGTGGTGGCTAGAAA	1
CACGTTCGTTATGGGTGATGTGAC	2
CACGTTCTACAGTGCTGGGCC	3
CACGTTGATGCCACATAGAATGAA	1
CACGTTGGACCGCCATGTAAGTGA	2
CACGTTGGAGCCTATGATCTCACA	2
CACGTTGGTGGGATGGTCAGCGTC	1
CACGTTGGTGTAATACTATTGGA	1
CACGTTTAACCGTGGTCTTGCCTA	2
CACGTTTACTGTGGGGGCTAGAAA	1
CACGTTTAGTGATGGTCGATCAG	1
CACGTTTATGTGTTTATATGGGCG	1
CACGTTTGACCGTGGTCTTGCCTA	1
CACGTTTGATGGTCACCACATTGC	1
CACGTTTGATTGTGGTCTTGCCTA	2
CACGTTTTTTCGATGCCCTATAGC	1
CACGTTTTTTGCGTGTCTTGTGAC	2
CACTAAAATAAACCAACCTCGTGC	1
CACTAAAATTTAGGGAAATTGGAT	1
CACTAAACACAAAAGCCATGCCTA	1
CACTAAACGGTGGATTGAGATCAA	1
CACTAAAGTTGTGGCTAGTTGGG	2
CACTAACAAGTCGGATAGGAGTGC	1
CACTAACCGAAGCCACTACATGAG	1
CACTAACTCTATAGATCGATGGCC	2
CACTAAGATGTGTCATATTTATA	1
CACTAAGCAAATGGGTGCGGTGTC	1
CACTAAGGGTGTGTTTGAGGAGAA	1
CACTAATAGGTGGGTCTCGCTA	1
CACTAATATGTGTGCTCGGATATC	1
CACTAATGGACCGGAGGGAATGAG	1
CACTAATGTGAGATTTAATGCAAG	2
CACTACAAAAGTCTTGATTGTGGC	1
CACTACAAAATGGAATGAGTGACC	1
CACTACAAACAGTGGACGTGCCA	1
CACTACAAGAAGCAGGTCATGAAG	1
CACTACAAGAAGCATTATGGAGCA	2
CACTACAATAATTGTCATACGATC	1
CACTACACATATGTTCTGACTGC	1
CACTACACATGCTTCAAGTGGCTA	1
CACTACACCAGAGTGTTAGCTAGC	1
CACTACAGCGTTGCCAAATTGAAA	1
CACTACATACCCAACTCCTGGAGC	1
CACTACATATAACAGTGAGGTATC	1
CACTACATGTACGGTTGAGGTGGT	1
CACTACCACAGCGTCCAAGAA	1
CACTACCCAGTGGCCAGTGATACC	1
CACTACGAGTGACATGACGGTGTT	1
CACTACGGACTAACACATGTCGGC	1
CACTACGGGTGTCTTGTTGTCGAT	1
CACTACGGTAGTGTTTGGTTGCAA	5
CACTACGTACATAGGTTGGGTGAA	1
CACTACTAACAATTCAGTGAG	1
CACTACTCCCCAGCTGGTCGCCA	1
CACTACTGCCGTAAAGAAGATGAG	1
CACTACTGTTTACGATATTGGCTA	1
CACTACTTTCAGATGGTTGGTGTG	1
CACTAGAACTATCATTCGAGTGGC	1
CACTAGAAGATGGATACAATACGG	1
CACTAGAATTGTGGGGTGAA	4
CACTAGAGTCCAGAACCGGTGAA	1
CACTAGATAAGAACATGCAGTGCA	1
CACTAGATGTTTCTATTATGGCAG	1
CACTAGCCATGGTGAATATATGAC	1
CACTAGCCCACAATTATGCATGGC	1
CACTAGCCCCAATGTTTGTTTGC	1
CACTAGCGACCTATCTAATGCAGC	1
CACTAGCGGTTGCTTACGTGGGCC	4
CACTAGGAGTGCAAGTGGTGAGTG	4
CACTAGGCTACATGCGATTTGGTA	1
CACTAGGGACTGCAGGTGAACCGA	2
CACTAGTGAAAATAGGTATGGTC	1
CACTAGTGATCACTCGTGAATTGC	1
CACTAGTGCACGTATCATGGCCGC	1
CACTAGTGCAGAGTTATATAATA	1
CACTAGTGTGAATGATCGATGAGT	1
CACTATAATACATGCCCGCACGAA	1
CACTATACGTGCCGATTATACCAC	1
CACTATAGGTGCCAGACTAGCTA	2
CACTATAGGTGCCAGTTTTACCAC	1
CACTATAGGTGCCGGAACAGCTAA	1
CACTATATGTACGGTTGAGGTGGT	1
CACTATATTGTGATAGGACCTCAG	1
CACTATCAACGAAGCCACACAGAG	1
CACTATCATTACAGTCACTGGTAC	2
CACTATCTAGGTGTTGGTTGGGAA	1
CACTATGACGCTGCTAGATGGTT	1
CACTATGAGACAGGTGGAAATGAC	1
CACTATGAGTTTGAGATGCCTCCC	1
CACTATGCCAAGTGATTTGGGATC	2
CACTATGGACTAGCAAATGCCAAA	2
CACTATGGGATGGGTGTCTTAGG	1
CACTATTGCAGTGTGTTAGGGATA	1
CACTATTGGTACTAGCTGCGGTGCA	1
CACTATTTATTGGTGTGTGTGAGG	1
CACTCAAATGATAATTCTAGTGGC	1
CACTCAACATTGAGCAGGGATAAG	1
CACTCAATTTAGGTGACTGGGGGC	1
CACTCACCGTCTATGATATGTGGG	1
CACTCACCTGCTAAGTTGATGCAC	1
CACTCACTTGTATGTTTTTATGCA	1
CACTCAGAATGTCAAAACAGTGAA	1
CACTCAGGACACTGGTTGGCTGGT	1
CACTCAGGTGGTCGGGATATTCAC	1
CACTCATGGACCGGGTGGAGGAGC	1
CACTCATTTATGATGGGCATTAGT	1
CACTCCACCATCAGTTGACCGT	1
CACTCCATGGAGAAGATGTGTGTC	1
CACTCCCACGACGACATGAGGGCC	11
CACTCCTAGGTTGCCACGTGGTAT	1
CACTCCTCGTGCAAACATGTCCAA	1
CACTCCTGTGCCTATAGATATGAG	1
CACTCGAAGGTGAAGTGCTACAGC	1
CACTCGAATGATGGTTCTAGTAGC	1
CACTCGACATGGTGACGTGTGCAT	2
CACTCGAGTAAAGCCATGGGCCGG	1
CACTCGATCTACACAGCGTTGATA	1
CACTCGATGTTTGCTTTTGGGAAG	1
CACTCGCAGGTGACTCGTGGGGCC	1
CACTCGCTGTCTATGACATGTGG	1
CACTCGCTTGAGGGTGGCGAACTC	1
CACTCGGAGTGTCAAAACAACGAA	2
CACTCGGCTAAACTAGTAAGGTGG	1
CACTCGGGAGACCGACATGTGGTC	1
CACTCGTATGTCTACTAGCCGAAA	2
CACTCGTGAATTGCGATAGTGGTC	3
CACTCGTGACTGTTGGGCTTCAAA	1
CACTCGTGCTGCACCAGTGGTGGT	1
CACTCGTGGGTGCGTTGTTTTTAA	1
CACTCGTTGAAAGAAGACATGTGC	1
CACTCTAAATGTGTCAACTCTGGT	1
CACTCTAACAAATGGTATCAGAGC	1
CACTCTACAGATTATATGGATGCT	1
CACTCTATGTGTGTCTTTGATTG	1
CACTCTCAACTAGGGTGTATTCG	1
CACTCTCAGATTAACTGCCCG	3
CACTCTCGACGTAGTTGTGTCCT	1
CACTCTCGGGTCCACCTGTCAGTG	4
CACTCTGCCACAAAATCGGCGAGG	1
CACTCTGCCTCACCGTGATTAAGT	1
CACTCTGCTAAAAGATATATAGAG	1
CACTCTTACGGAGTGCCACTCTTG	1
CACTCTTACGGATGGTGATAAAG	1
CACTCTTGGAAGGTTGGACGA	1
CACTCTTTTGTGGTGTCCTATAGC	4
CACTGAAGAATCCTGCTGGTC	3
CACTGAAGAATCTCAGGTGACCGG	1
CACTGAAGGACCTCAAGCAAACGG	1
CACTGAATTCAGGAAGATGTGGAG	5
CACTGACACACTGGGGGCCAGTC	1
CACTGACACGTCGCGAGATGGCCA	1
CACTGACAGGTGGGCCCATGAGTG	1
CACTGACATACGGGACCCACTGAT	1
CACTGACATGTGGGCCCATATGAG	1
CACTGACATGTGGGTCCTTAAAGG	1
CACTGACCCCACTCGCCCGTTTGC	1
CACTGACCGGTGTCAGAGGTTCGC	1
CACTGACGCAGGCCGGACATATAA	2
CACTGACGGTGAGGAAAAAGGGCG	1
CACTGACGTTAACAAAAGGTA	1
CACTGAGAAGTAGGGGCTGCTGAA	1
CACTGAGATTGAAGAGAGTGCAG	2
CACTGAGCGGCGTGAAAAAGGGAC	1
CACTGAGGGCAAGTGTTATGGTAG	1
CACTGAGTCACTGTGGTTGCA	1
CACTGATAATCGGGTCCACATGTC	1
CACTGATAGGAGAACCACGGTGG	1
CACTGATAGGCCTCTAAGATACAA	1
CACTGATGACCTCTTACCTGTGA	1
CACTGATGATCTATTTGTGGTGGT	1
CACTGATGCAAAGGTGCAGATGGA	2
CACTGATGCATACCAGCCATCGGT	2
CACTGATGCTGCTCTATCCGAGGG	1
CACTGATGGACTGATGTGCGTTGC	1
CACTGATTAGGCCTGCTTGTTATG	1
CACTGATTTGGTGGCTAACATG	1
CACTGCAAAAGTGGTGCTGTG	2
CACTGCAAAATTGAGTGGGGGCTA	1
CACTGCAACCACTAGGCTACACCG	1
CACTGCAACCAGTAGAATACGTGC	1
CACTGCAAGCTCAGGGTGCACTGG	1
CACTGCAAGGGCTACTCGAATCGT	1
CACTGCACGGGCATTTTGTTGGTC	1
CACTGCATGGGTGATGGATTGT	1
CACTGCCAATGACAACACTGATAT	1
CACTGCCACACGTGTTGAGCCCGT	2
CACTGCCACGTGCTCGGCTGCCA	2
CACTGCCAGGGTGGTAATGGGCC	1
CACTGCCAGTAAAAATGAGGAACC	3
CACTGCCCGAAGCATTGATCTGAT	1
CACTGCCCTACTCACACATGGCAA	1
CACTGCCGTTGCCTAGGTCAATGT	1
CACTGCCTTTGCGAAGCGTGC	1
CACTGCCTTTGTTCACGCGTGGGT	1
CACTGCTTAGGGTACCGGCTTGAG	1
CACTGCTTATGGGTACTATGGGTTG	1
CACTGCTTGCTAGTGGGTGGCTGA	1
CACTGCTTTAACAGATGTGCTGGT	1
CACTGCTTTCACATGATGCTT	1
CACTGGACGTACGTGGTGATGTGA	1
CACTGGATACAAGGAGAAGGAGGC	1
CACTGGCCATGGTGAATATACGGT	1
CACTGGCCTAGTAGATCTGCTTAG	1
CACTGGCGCACTGCTACGGAGGC	1
CACTGGCGGCCACGCTAAGAGGTC	1
CACTGGGGAAGATGAGACCTCGGG	1
CACTGGGGTGTATGAGATGGTCAA	1
CACTGGGTGCGCTGAAAATGAGAG	1
CACTGGTAAGCAGCCGTCCTGCAC	1
CACTGGTGGAGAAAGCGTTTGTAG	1
CACTGGTGGAGAAATACTTTTTAG	1
CACTGGTGGGTCATCAAAGATGAG	1
CACTGTAAACTTTTCAAACAGGAC	1
CACTGTAAAGGGATTGAGCAGGGT	1
CACTGTACATGGTGACCTAGAGAG	1
CACTGTACGATGGTAGATGTTCAG	1
CACTGTAGGGTGGGTGTCTTTGG	1
CACTGTATGAGTGAGCTGAGAGA	2
CACTGTCAGGAGATAAGGCCGAGC	1
CACTGTCAGGATGTCAGAGGTGGT	1
CACTGTCAGGGTTATGAATACCAC	1
CACTGTCGATGGATACGTTGCCT	2
CACTGTCGATGGATACGTTGCCTA	3
CACTGTCGCCCAAGCTGTCTTCCG	3
CACTGTCGCCTTCAACGCTGACGGG	1
CACTGTCGGATCCACCCACAGGAG	1
CACTGTCTACGTGTGATGTCGCG	1
CACTGTCTGCCGAAGTTACAGTA	1
CACTGTGACATGCATGAAGCAGC	1
CACTGTGAGGATGCCAAGGTGCG	1
CACTGTGCCGGCGCGTCTCAT	1
CACTGTGGTTAAGAGCATGGT	8
CACTGTGTCTTGAAGTTCGTGCTA	1
CACTGTGTGTATGATAGGTGGGAC	1
CACTGTGTTAGAGTTATGGGTGTA	1
CACTGTGTTTAGCCTACCTTGAG	2
CACTGTTACTGGTCATGGTGTT	1
CACTGTTCACGATATCGGTTGGGT	1
CACTGTTCTTGCAGCCTGGTGCGC	2
CACTGTTGAGTTAGCCGGTTGGA	1
CACTGTTGCTCTTATGATCTA	1
CACTGTTGGTGCTCTTCTCCGCCT	1
CACTGTTGTGCTAGCTTAGACCGG	1
CACTGTTTAGAGCAGGTGTGCTTC	1
CACTGTTTTCTAGCTGGGCTA	1
CACTGTTTTTGTGGTGTGCTTTAG	1
CACTTAAAGTGGAAATAGTGGGAG	1
CACTTAAGTATGGTACCGCGCTTC	1
CACTTACAGTCTATGACATGTGCG	1
CACTTACATATGGGGTCTATAGAA	1
CACTTACTTGAGGAATGGCGG	2
CACTTAGGATGAACTTGCGAC	1
CACTTAGGTCCGTAAACTTGAAAA	1
CACTTAGGTGTGTGGACGAACAAG	1
CACTTATAATGGGACTAAATAGAG	1
CACTTATATATTTAGATGCGGCA	1
CACTTATATCTTAGGTCCTTTACC	1
CACTTATATCTTAGGTGCTTTGCC	1
CACTTATCCTTGGTTTGTGTGCC	2
CACTTATGATTGTTGTAGCCAAGC	1
CACTTATGGTGGAGAGGGGGCAAC	1
CACTTCAGTGCACGAACGGTTGGA	1
CACTTCCCAGATCAGATGTCGGTC	1
CACTTCGATGATAAGCAAGGTGAC	2
CACTTCGATGCCATATGGAAGTAAA	2
CACTTCTACACAAAATCACTTCTG	1
CACTTCTATCAGTGACCTTGGAGC	3
CACTTCTTACCTTTCAAGCCT	1
CACTTCTTCATGGATAGGGCG	1
CACTTGAACCACTTACATTCC	1
CACTTGACGCTTAGGCTCATCAGG	2
CACTTGAGGTACTGCATTGTGAAG	1
CACTTGATGATGGGCGAGATACT	1
CACTTGATGCAGCAACGGGGGTTC	2
CACTTGATGTTGTGCCAGATCGAG	1
CACTTGATTGGTGCACCTAGGTC	1
CACTTGATTTTAAGTGGAGCTGAA	1
CACTTGCAAAATGTCGTAGGTCGC	1
CACTTGCAGCATACGACAGGAGC	1
CACTTGCATTGCGAAGCTCAAGA	5
CACTTGCCGCCTACCTCTGACAAA	1
CACTTGGTGGCACGCGGTTTCGTG	1
CACTTGGTGTGCCCTTATGGACGG	2
CACTTGTATGGTGGAAATGAGCGA	1
CACTTGTCCTCATGTGAGCGGTGG	1
CACTTGTGCTTAGTTCACGCTAAA	1
CACTTGTTACGGGCTGTCGATGGA	1
CACTTGTTGAGCGATTGAGGTGGT	1
CACTTGTTGTCTATGACATGTGGA	1
CACTTTAGGTCCCGTACGCTACCC	1
CACTTTATATATGGTGCAGCGAGT	1
CACTTTCATGTGCGGGTGGTCCAA	1
CACTTTGACAAGTTTTGGGACCT	1
CACTTTGTCTAAGGTGAGGTGATC	1
CACTTTTAGAGGTGTTTGGTTGAG	1
CACTTTTCACGTTCGGTTGTGCTG	1
CACTTTTGAGGGTCACCAAGTGAA	1
CACTTTTTGTGTCCTATAAATTGT	1
CAGAAAAAATCAAGGGTGTTGGCT	1
CAGAAAAAGAAAGAAAGTGGTGTC	1
CAGAAAAAGGGAGGAAGAGGGCCT	1
CAGAAAAATTTTGATGTGATGGA	2
CAGAAAACCGGATAAGATGGCTCC	1
CAGAAAACTACCAGATGGGGTGAA	1
CAGAAAAGAGGGTGTCGAATTGAA	1
CAGAAAAGTGAGGTTTATGTGCTG	1
CAGAAAATAAATCCCACGATCTGG	1
CAGAAAATAAGTCAGGTGGGAATA	1
CAGAAAATCATATACAACGGGTC	1
CAGAAAATCGATTCGTTGGTGTTA	1
CAGAAAATCGATTTATTGGTGTC	1
CAGAAAATTTACTGCCGGCAT	1
CAGAAACAAAAAATTGAGGGACT	1
CAGAAACACGATGTATGTGCCGAGC	1
CAGAAACCCCATGTGTCTTACAGT	1
CAGAAACTAAACACAGCCTAGATG	1
CAGAAAGACTCGAATGCCCTCTAT	1
CAGAAAGCATAATGGTGACTTGG	2
CAGAAAGCCTACGCAGATCGGACT	2
CAGAAAGGCTGCGAGAGTGCTAAC	1
CAGAAAGGGATTGATGAGATTGAG	1
CAGAAATACTGTTAACGGTTGGGC	1
CAGAAATATTTGGAAATGGGTGG	2
CAGAAATGTGCAATATGTTCAGGA	2
CAGAAATTATCTGCAAACGATGG	1
CAGAAATTATGGTCCTAGATACAC	1
CAGAACAAATTGAAGGGGGTGCAC	2
CAGAACAACGGCAATTGATAGCTC	1
CAGAACAATGGTTACTGATATGGT	23
CAGAACACAGGAGTAGGGTGTTA	2
CAGAACACCACGTTAGATGCCACA	1
CAGAACAGGATGTGTGATAAGAAT	1
CAGAACATAGGAGTAGGGTGTTAC	2
CAGAACATTAGTAACATAAACTGC	1
CAGAACCAAGATGGAGGCGGCTAA	1
CAGAACCCTACATCTGTGACGGCA	1
CAGAACCTAATTTGATCAGGTAGA	1
CAGAACCTTGGGGTACTACTCAGG	1
CAGAACCTTGTGGTGCTACTCAGG	1
CAGAACGAACCGAACGACGATGGA	1
CAGAACGAGACAATTAATGAGCTG	1
CAGAACGGGTGGTGGATTGAGCAG	1
CAGAACGTAGAGCTATTACCTGAC	1
CAGAACGTCTTAATGGATGCGTC	1
CAGAACTAGGTGGAACGCTGTCA	1
CAGAACTATTGTGCTTTTTGGTCA	1
CAGAACTCTGGTGCAGTGGCA	1
CAGAACTGAAGAACTTTCGGTGGC	1
CAGAACTGAAGAGGAGGAGGTAGA	5
CAGAAGAAATAAAGGTGGAGTTAC	1
CAGAAGAAGAGGAAGGTGCGTGCG	1
CAGAAGAAGTTGTAGAAGAAAGG	1
CAGAAGAATAGGGAATTGGGGTAC	1
CAGAAGACAAAAAGAAACGGGTGA	1
CAGAAGACAAACAAGATGGGTGAA	2
CAGAAGACTGGACCTACCACCCTA	1
CAGAAGATAGTGGGGATGGTGTAT	1
CAGAAGATCGGGCCACGAGAGAGA	1
CAGAAGATCGGGCCACGAGAGAGC	2
CAGAAGATCGGGCCATAAGAGAGA	1
CAGAAGATGACCTAGCACATGCCC	1
CAGAAGATGAGGTACCAGCAGAGC	1
CAGAAGATGCCATTTATATGAA	1
CAGAAGCCACATAAGAGGATACTG	1
CAGAAGCCCGTTTGGTTAGAGCAGC	1
CAGAAGCTGTTGACTGTTTGGGAC	2
CAGAAGCTTACTTGCCAAATGG	1
CAGAAGGACCAGAGAGTCGAAGCC	1
CAGAAGGAGGCACGGTCTTGCACG	1
CAGAAGGATCCATGGGTCTTGTGG	4
CAGAAGGCTCAAACTGATGATGG	1
CAGAAGGGGTAGCTAGTTTCTGAG	1
CAGAAGGTGAAGCACTGATTCGT	1
CAGAAGGTGCACATCATGACAGAA	1
CAGAAGTAAGACAAAAACACCTGC	1
CAGAAGTGCCACAATTACTCTCA	1
CAGAAGTGGAGCCAGTAGGAAGAC	1
CAGAAGTGGTAGCTACTCATGTGT	1
CAGAATAATGCATTTGTTGATGGC	1
CAGAATAGGTGGAGCTAGAACTGG	1
CAGAATCAGATGTAGACGCGTGGT	1
CAGAATCCGTCAGTAAACCGCGA	1
CAGAATCGTGCTCCAGGGGTTCAA	1
CAGAATCTGGGTGACAATCTGAAC	1
CAGAATGAATGAAAGGTGCAGCAA	1
CAGAATGATACTCTGCTGCTC	1
CAGAATGGATAACAATGTCACGCC	1
CAGAATGGCGATGTCTCGTGT	2
CAGAATGGCGGCCAACGAATTAGC	1
CAGAATGGGACTCGCGCGAGAAAG	1
CAGAATGGTCAAAGTCTTGGA	1
CAGAATGGTGGATCCGGATATGGT	1
CAGAATGGTTGTGTGATTTAC	1
CAGAATGTCTAAGCTGAATGTGCA	1
CAGAATTAGAGTAAGTCTGATTA	2
CAGAATTGTTGTACTAGGTTCTAG	1
CAGAATTTGTACCAGATATGAGAA	1
CAGACAAAACGACCGTTACTGGG	1
CAGACAACGGTGTGCAGGTGGGCC	1
CAGACAACTTGATGTACAGAATGC	1
CAGACAACTTTTAATCATTCTTGT	1
CAGACAATGGATACCGTTGCCCGC	1
CAGACACACACAGTGCTGAAGCC	1
CAGACACAGGTGGTAGTAGTC	7
CAGACACTATTTTCTTAGGGACGCC	1
CAGACAGAAGAAGGGTGAGCAA	1
CAGACAGAGAAGAGGTACCATCGC	2
CAGACAGCATGGTGAAAGTCAGGG	1
CAGACATAAGGATGGCCTACCCGC	1
CAGACATGCTTTGGACCGTAATGA	1
CAGACATGGGTACGGGCACGGAGT	1
CAGACATGTGTGACTGAGTCTGG	1
CAGACATTAGACCTTTAGGCA	1
CAGACCAAACACACGAGCCTCAAA	1
CAGACCCAGCGCGTGATTCTTCGC	1
CAGACCCGATGGAGACTACTTCCT	1
CAGACCCTAAATCTGGACAGGCTC	1
CAGACCCTTAATTACTACCAACGA	1
CAGACCGACGATCTTCAGGTGGTC	2
CAGACCGGCCGTAACTAAGCGTAA	1
CAGACCGGCGGGTACACTACGGTC	1
CAGACCGGTGCAACTACTTTGGTC	2
CAGACCTCACGTACTACGCTGGTC	2
CAGACCTGATACGATACGTAGGTA	1
CAGACCTGATAGGCTTAGAGGAAA	1
CAGACCTGGAATGGTGATAAT	1
CAGACGAACCTGTTTGCGGGAGGC	1
CAGACGAAGCCAATATGTTGCCT	3
CAGACGCTCCGGATGAGTGAC	3
CAGACGGATGGTCAAAACGCTGAG	2
CAGACGGGACAACAGATTAAGTGC	1
CAGACGGTCAAACATTGACACGGA	1
CAGACGGTCAAGGATGCCGGGTGA	1
CAGACGGTCTGGATATCTGT	1
CAGACGGTCTGGATATCTGTT	2
CAGACGGTGGCCCAAACGATGACA	1
CAGACGGTGTACGCACCGGGGTGG	1
CAGACGGTTTAGCTCATGGCGC	5
CAGACGTCGATGGCGATGGACGGC	1
CAGACGTGAGAGGCTGAGCTGCC	1
CAGACGTGGCGAGAAAGAGGGAGA	1
CAGACGTTGTGATGGGTATGTTCT	1
CAGACGTTTGACCGGATGTCGGAA	1
CAGACTAGCCTGATGGTGTTGTTT	2
CAGACTAGTCTTTTGGGCTGCGTA	1
CAGACTAGTCTTTTGGGTTATGTA	1
CAGACTCAGGGACTTCAAGGT	1
CAGACTCATGTCTGCCTGCGAAAA	1
CAGACTCGGGTGCTGAGGCGATA	2
CAGACTGAGCCACAAACTAAGCCT	10
CAGACTGATGGACTGTGATACGCT	1
CAGACTGATGGTCAAACGTTGAAT	1
CAGACTGGATGCCACCACCTGACC	1
CAGACTGGCCACTGTACCTCGGTC	1
CAGACTGGTCGACAAATTGAGAGA	1
CAGACTGTGAGAATTGCCTTGGA	1
CAGACTGTGAGAATTGCCTTGGAC	1
CAGACTTATGACTAGGTCCGTGCC	1
CAGACTTATGTATGAATGGGGCAA	1
CAGACTTGTAGCCAGCTGTAACA	1
CAGAGAAAATGGATCTACGCTGGC	1
CAGAGAAAGGTGCCGGTTCTAGAC	3
CAGAGAAGCCAGGAAAGATGTGAA	1
CAGAGAAGCCTATGGCGACAGGAC	1
CAGAGAAGGTGTCCAATTTTATAG	1
CAGAGAAGTGCCCCGCGAGTAGAT	1
CAGAGAAGTGTATGGATTATAAGC	1
CAGAGAATCCTGGATGGCGTGCAC	1
CAGAGAATGAGCGGTGGTGGG	2
CAGAGACATCCCTACAACAAGACA	1
CAGAGAGACTCAGTCCTAGGTTGC	1
CAGAGAGAGGTCTCTCGGTAGTGC	3
CAGAGAGATATATGTCCCTATGGT	1
CAGAGAGCGCCAGATTCTTCT	1
CAGAGAGGAACATAGGTCCAGTGC	1
CAGAGAGGAGAGAGCTCAGGTGGT	1
CAGAGAGGATTTGGGCAATAGCA	1
CAGAGAGGGGTGAATGGTTGGTAT	1
CAGAGAGGTACTACAAGTAAGAAG	1
CAGAGAGTTTAGCACAAGCGTCCA	1
CAGAGATGATAGTGTGCTATGAGT	1
CAGAGATGCTTATAGAGATAGGGT	1
CAGAGATGGACCAGGACTGACCT	1
CAGAGATGTGTCACCTGTGACGGG	1
CAGAGATTAGTGGTCAGTGATGA	1
CAGAGCAAAGGGCACTGATATGGT	1
CAGAGCAAGCAATGCATGGTC	6
CAGAGCAAGCGACGAGCGGGGTGG	1
CAGAGCAGGTGAAGATGGCAGAAA	1
CAGAGCATTGACTTGAGCCAA	1
CAGAGCCACAACTTTAGGTCCTGA	1
CAGAGCCCAAGTTGTGTTATCTG	1
CAGAGCCCTGGATGATGATGA	3
CAGAGCCCTGGGGATGTAGGCTTC	1
CAGAGCTGGGTTGTCACCGATGGA	1
CAGAGGAAGTACACCTTAGGCTGC	2
CAGAGGAGATGAGCGCAGGTGTA	2
CAGAGGAGCCTATCAGACTTGGTA	1
CAGAGGATATTGTTGATACGGAGG	2
CAGAGGATCCTCCTCGGGCGCC	2
CAGAGGGAAGTCACTGATATGTGG	1
CAGAGGGAATACAATGTTGTTGGT	1
CAGAGGGAGTACAATGGTATGGT	1
CAGAGGGGTCTAAGAATTCAG	1
CAGAGGGTAGTTTGCGCCAGTCTG	3
CAGAGGGTGTGAGAATAACTA	21
CAGAGGTAAACGACAGTTGGTGAC	1
CAGAGGTAGTACGTGATGTGATG	1
CAGAGGTCACGCCAGATGAGGA	1
CAGAGGTCGTCGTTACCTTCGCAC	2
CAGAGGTGACCTACCTGTGACGGG	3
CAGAGGTGACTAGTTACCTGTGAC	1
CAGAGGTGAGTCACCTGTGACGGG	1
CAGAGGTGATCATGTTTAGACTAA	3
CAGAGGTGATGAACTACTTGCCAT	1
CAGAGGTGCGTACATCGATTTAT	1
CAGAGGTGCTCATAGGGGTATGG	1
CAGAGGTGCTGGTTGTGGAACCAA	1
CAGAGGTGGAGCTGGGTTTAGGCT	1
CAGAGGTGGATAATAGATCGATA	1
CAGAGGTGTACAACTGGACCCACA	2
CAGAGGTGTCTGGAGGAGCTT	2
CAGAGGTTACAAGCCAAGGGATGG	1
CAGAGGTTCTCTACATGGCAA	1
CAGAGGTTGATTTACCATGGGTGT	1
CAGAGTAAAACTATTCGAATAGC	1
CAGAGTAAATTAAACAGGTGACAC	2
CAGAGTACCTAGCTAGGTGTT	1
CAGAGTACTATACCCGATGCGGA	3
CAGAGTGAGAATGGTGCAACGGAG	1
CAGAGTGCGCCTAAGTTGTTTCTA	1
CAGAGTGGCAAAATAACAGTGCC	1
CAGAGTGGTCCATTAGCGAATGAT	1
CAGAGTTAGATCTGGGGTGAGATT	1
CAGAGTTAGTGGTAGTAGAAATG	1
CAGAGTTGAGCTAGGCGGTAGGG	1
CAGAGTTGAGTCCAAGGCGGTCGAG	1
CAGAGTTGTTTCGGAACATGGATG	1
CAGATAAAGTGCTTTTGTTTTCAG	1
CAGATAACTAGACCTAACATTGCC	1
CAGATAAGATTGGGCCTCTATGGA	1
CAGATAATAAATCTGGTTAAGCCT	2
CAGATACATGGTGTTTGGCCTCGC	1
CAGATACCTGGATAGGGGTGTGCA	2
CAGATACGAGACGATGGTGTGCAT	1
CAGATACGGATAGTGCCAATACGG	1
CAGATACTAGATATCTCGAGGTAC	1
CAGATACTAGGTGCTAGGTGTCAC	1
CAGATAGAGGTGGTAAATAGTTA	1
CAGATAGCTGAGGGCATTATAGA	4
CAGATAGGAAAGCCACACAAGTCC	1
CAGATAGGACGCCCTAACTTTGA	1
CAGATAGGTGGTGGGTGCGATGAC	1
CAGATAGTGGTGTATGTGTATCT	1
CAGATATAAGCGGGCCTACCTAGG	2
CAGATATAAGGTGTTAGAGTTCTA	1
CAGATATACACACTGTGCACGTAC	1
CAGATATACCCCCTCAAGCTA	2
CAGATATAGAAGATGGGCCAGATC	1
CAGATATCGGAAGGGGTTTTCGGA	2
CAGATATGCAGATGGACGGATGGG	1
CAGATATGCTTACAGAGGTATGGT	2
CAGATATTATATAGGGTGTCGCAT	5
CAGATCAAATTCTGTAGATGCCGC	1
CAGATCAACAGAATGAAAGGGAGG	1
CAGATCAACATAAGTCTTTTCTG	1
CAGATCAAGCCATGTGTATTCTCA	1
CAGATCAAGGCTATAGACGAA	1
CAGATCAGCCCGATAGCTGTGGTC	1
CAGATCAGGGTTTCGTCACAC	1
CAGATCATACTTGAGTTGGTA	2
CAGATCATATTGGGCCTGTTCTA	1
CAGATCATATTGGGCCTGTTCTAC	1
CAGATCCAATGAAGGTGACGGTGG	1
CAGATCCAATGTGACCTGGGTGG	1
CAGATCCACCTTGCTCATGGGCCG	2
CAGATCCACTAAGACGATGGCTCC	1
CAGATCCATTGTACTACTCCC	1
CAGATCCTAAACTTGTGCGGGTGT	1
CAGATCCTGGCTGGTGCTGGGGAA	3
CAGATCCTGTGCGTTCATCCTC	1
CAGATCGAGTATTATAAAGGGTGT	1
CAGATCGATCGTCCTGCGTGCGGC	1
CAGATCGATGAGAGCCGAAACACG	1
CAGATCGTCCACTACACTACAAGA	5
CAGATCTACACGACTGGGATCGAG	1
CAGATCTAGCGCGTAGTGGGTGGA	1
CAGATCTATACTACACCCGGTGAC	1
CAGATCTATACTACACCCGGTGGA	2
CAGATCTGATACGGGTACCAACCA	2
CAGATCTGCCACAGATAGACCTGC	1
CAGATCTGGCGGAGGGGAGGG	2
CAGATCTGTAGCCAGCTGCAGCA	1
CAGATCTGTAGCCAGCTGCAGCAC	1
CAGATCTGTCTAGTGATGTCGGTT	2
CAGATGAAAATGAAATACAGTAGC	1
CAGATGAACTACTAATAGGCTGGG	1
CAGATGAAGACCGAGTTAAATTA	1
CAGATGAATCCGGTGCACTGA	3
CAGATGACAAATTAAGGGACCTAA	1
CAGATGACAAGTCTGATAAGGAGC	1
CAGATGACATGTCATCGGGTGTA	1
CAGATGACCTCTGGTATTGGTATC	1
CAGATGACCTTAGATGCTGTGCC	1
CAGATGACTACAAGATATAGGGA	2
CAGATGACTCATCAGTGACGGGCC	1
CAGATGAGGTCCTTATGCCACCAG	1
CAGATGAGGTGCTTGTACTGCTA	3
CAGATGAGGTGCTTGTACTGCTAC	3
CAGATGAGTATGTGGGTGACCACC	1
CAGATGAGTGCTTACGTTTGACGG	2
CAGATGATCAAGGATGCTGGTGAC	2
CAGATGATCCACCGAGTGCGA	2
CAGATGATCTAAACAGGGCCTAAG	1
CAGATGATCTGAATTTTGTGAA	2
CAGATGATGAGACGGTATTGTGAC	1
CAGATGATGCCAAAGAAACTTGAG	1
CAGATGATGTAGCAAAGTACCGAC	1
CAGATGATTGGTGTCTTCGAAGG	1
CAGATGCAACAGATGATTGGTCCA	1
CAGATGCACACTATTTTGGAAGTA	1
CAGATGCACTGTCCGGTAGGGTGG	1
CAGATGCATTGGCGCTGAGGTGGG	1
CAGATGCGGTGCCGCATATAATGT	2
CAGATGCTACTTGGATGATGGACC	2
CAGATGCTCATGGCGACTTCGTCA	1
CAGATGCTGATGGGTTTCTAG	1
CAGATGCTTCTGGATGGGGTTCAA	1
CAGATGGAAATGATGGGTTCAC	1
CAGATGGATATACGATACGGGTGT	5
CAGATGGATCGGTAGAATGTCCAC	1
CAGATGGATGCGTGGTATGAGAGG	1
CAGATGGCATGGCACGTATGTAAC	1
CAGATGGCCCTCAGAACGGATGGA	1
CAGATGGCTGACCGCGATGAGGA	2
CAGATGGGACATGTCTAGATTTGT	2
CAGATGGGACGGTGAGCTCTGGAT	1
CAGATGGGGCACGATGACGGTGGC	1
CAGATGGGTGACCTGGGTGGTTAT	1
CAGATGGGTGAGTTAAGCCTA	1
CAGATGGGTGCAATCTAGTGTATG	1
CAGATGGGTGCATGGCGAGGTGCA	1
CAGATGGTGCATCAATAACTG	2
CAGATGGTGGCTTTTCCGAGGAGT	1
CAGATGGTGTTTGGGAAGGACTAA	1
CAGATGTAAGTGGGCCTGGTCTGG	1
CAGATGTAAGTTAGGATTTGAGTG	1
CAGATGTAATTATAGTATAATCAT	1
CAGATGTAGACGGCGATGTAGAGA	1
CAGATGTCCAACCAATGGCTTGTG	1
CAGATGTCGGAAGAGATTTTTGG	1
CAGATGTCGGAGGAGGTTTTCGGA	5
CAGATGTGATAGCCACCTACTGAC	2
CAGATGTGTACTGGTACCGAGCGG	1
CAGATGTGTGCTTTGTCTGTGCCA	1
CAGATGTTAAGGTCTATGGTTGGG	2
CAGATGTTCCTCTATTGAGTGA	1
CAGATGTTGGTGGTATAGAATCGG	1
CAGATGTTTGACGCTGGGAGAAGC	1
CAGATGTTTGTCTGTATGTCGGAA	2
CAGATTACCTGATGATGGGTCTA	1
CAGATTACGGGTAAACTGCGAGAC	2
CAGATTAGGACAGCAAAACGA	2
CAGATTATGTAGAATGTCCGA	1
CAGATTATTGAGTGGCTAAAGATC	1
CAGATTCAACTCACTCGGGCCGC	1
CAGATTCGTAGTCCCGGTTGGAAA	2
CAGATTCGTAGTCCTAAGATGGGT	1
CAGATTCGTAGTGTTAGGATGTGT	1
CAGATTCGTTGTCTAGGATGGGTC	1
CAGATTCTCATAAACTGGTTACC	2
CAGATTCTGCCTATAAATTGCGA	2
CAGATTGAATTATTTAAGGGCTA	2
CAGATTGAGTGCCTAGAAGGAGGG	1
CAGATTGATCCTATGAACTGA	1
CAGATTGATGTAATGAAAAAGGAC	1
CAGATTGATGTGATGGAAAAGGA	1
CAGATTGATGTGATGGAAAAGGAC	2
CAGATTGATTTCGATGGCTATGA	1
CAGATTGGATGGAGATGCTACCT	1
CAGATTGGGGTGTGACAGTACTGC	1
CAGATTGGGTTGTTTGCGGGGCTA	1
CAGATTGGGTTGTTTGTAGGGAGA	1
CAGATTGGTAGGTGCTGAAACGAG	1
CAGATTGGTGGTAGTATCTTTGTC	1
CAGATTTACTGTACTATGATGTG	1
CAGATTTATACCCAGCTGCAGTA	1
CAGATTTATAGTAATACGATGTGAC	1
CAGATTTATTACACTAGGTGAT	1
CAGATTTCGCAAGTGATGGGT	1
CAGATTTGAAATACTACAATGCG	1
CAGATTTGATTGCAGCCGTACAGC	1
CAGATTTGTAACCGGTTGCAACAC	1
CAGATTTGTTGTACTAGAATGTGT	1
CAGATTTTATTTTAGAAAATAGAT	1
CAGCAAAAACTGAAACAGGACTGCC	1
CAGCAAAACTGCACTATATCAGA	1
CAGCAAAATGACGTTGGTGAC	8
CAGCAAAATGACGTTGGTGGC	22
CAGCAAATAACTACATTTTGAGA	4
CAGCAAATTTTGTTGCATGGTGGT	1
CAGCAACAACCGATGAGATGCAA	1
CAGCAACGGACGGCGGCGACACA	1
CAGCAACGGAGCTGGAGTGTCTGC	2
CAGCAACTACCCACGAAATCAAA	1
CAGCAACTGGTGGACTACGCCGA	1
CAGCAACTGGTGGACTACGCCGAC	2
CAGCAAGCCAAAGTTGCCGAA	4
CAGCAAGCCACACAGCAAATATG	1
CAGCAAGGCCACTCTGCCACTT	1
CAGCAAGTGAGGGCGCATATGAGT	1
CAGCAATGAAGATGAAGGCGCC	1
CAGCAATGAAGATGAAGGCGCCC	2
CAGCAATGATTTTAGCCTGGA	4
CAGCAATGGCGCCGAAATATTCTC	1
CAGCAATTTGATGATATGGATGCA	1
CAGCACAACATGGCCTAGGAATAG	2
CAGCACAATGGTGGTCTATGTTTA	8
CAGCACAGACTCTAAGACGCAGT	1
CAGCACAGGCTGGTACCTAATAGG	1
CAGCACCACGTCTAGAGGGACCTA	1
CAGCACCATGAGAGGTGGAGTTGG	1
CAGCACCTACCGATCGACCACCAC	2
CAGCACCTACCGCCTTGCATTGGC	2
CAGCACCTCTGATGCACACACGA	2
CAGCACGAAATGGGTTGGTGTCA	1
CAGCACGAAATGGGTTGGTGTCAC	1
CAGCACGAAGTGCCGATCGGACC	1
CAGCACGGTACTCAGCTTCGGCGCT	2
CAGCACGGTAGAGATTGATCAAGA	1
CAGCACGTTGCGATGTATGCC	1
CAGCACTAACTTTAAATGGACCT	1
CAGCACTAATGCTCTCGGTGA	2
CAGCACTGATGCTTGGAGACGGTA	1
CAGCAGAAATAATCTTGTGCT	1
CAGCAGAAATGTAATGGATGC	2
CAGCAGAAGCATAATAAGGTAGGC	1
CAGCAGAAGGTAGCGGTGAGGTAA	1
CAGCAGAATATCTACGGTGAGGTC	1
CAGCAGACCTGCATAGTGCAA	5
CAGCAGATGACGTCGGGACTCACC	1
CAGCAGATGGAAAAAGAATCGATC	1
CAGCAGCCACCCTGTTGTGGGCAC	1
CAGCAGCCTCTTGTCGAAGCCTGA	3
CAGCAGCTAATTACCGATTTTCTG	1
CAGCAGGGAAACGAATGGCAG	1
CAGCAGGTCCTTCGGTGGTTTTG	1
CAGCAGGTGGTGGCCCTATCC	1
CAGCAGGTGGTGGCCCTATCCAGC	1
CAGCAGTACATTGACGATTGGG	1
CAGCAGTGAAAAATGATGTAGG	2
CAGCAGTGAGCTCGCGCTGATGGT	1
CAGCAGTGATATGATGAGCCG	2
CAGCAGTGTAGCAGGTGGCCGAAT	1
CAGCAGTTGCAGAAGTGGTGGTAC	1
CAGCATAATTTAGATGGTTATAGC	1
CAGCATAGCCCATTGGTGACGTTG	1
CAGCATATGATTTGGTGGTCGAGG	1
CAGCATATGGTTGCGAATTGGTGG	1
CAGCATCGAGGGCGGTGCTTGGGCA	1
CAGCATCGCCACACACAACGA	1
CAGCATCTAGGGTTCACGGTGGAC	1
CAGCATCTGCGGGGGAAACGGTACG	1
CAGCATGACGATGGTAGGAAAGGC	2
CAGCATGATGCCTATTGTACCAGA	1
CAGCATGTAAGATGCCGCCGGTGCG	1
CAGCATGTGTCTTGGTGTCTC	1
CAGCATGTTGCTCAACCTGATGG	1
CAGCATGTTTAGCTCAATTTGCAG	1
CAGCATTGGATGGCAGTCAAGAGG	1
CAGCATTTAAGGCGGATTGAGCGG	3
CAGCATTTATACGATTTCGCAGTG	1
CAGCATTTATTGCAGTCTGGTCAA	1
CAGCCAAACCCTGCATCGGATGGC	1
CAGCCAACCCTACAAATTATACAT	1
CAGCCAACCTCTAGTTGCTCTGGT	1
CAGCCAAGCCACGGGACCGGCG	1
CAGCCAATCCCTAATCCTATGTAC	2
CAGCCAATGGTGTTATGGGTGAGT	1
CAGCCACAATAAATTGCTAGCCAC	1
CAGCCACACACACGATATGACGTT	1
CAGCCACATAGCCCAACATATGGC	2
CAGCCACATTGAGCTCGGTGTCA	1
CAGCCACCATAGAGTACTGACGATC	1
CAGCCACCTAGCAATATTGTGGAA	2
CAGCCACCTATTAATATTGTGCAA	1
CAGCCACGCGTACGCCACGTAGAC	1
CAGCCACGTTATACCGGCCGCCA	1
CAGCCACTACGTAGGATAAAACCG	1
CAGCCAGACCAGCTTATGATGCTA	1
CAGCCAGGGTACACAAAACGACAA	1
CAGCCAGGTGGCGATGGTACCTAA	1
CAGCCAGTACTCAGTCAGTAGCAA	1
CAGCCAGTTCTAGCAGGTCTA	1
CAGCCATAAGTTTCCGTGTCCAAT	2
CAGCCATACCAATAGAGACGGAGC	1
CAGCCATATGATCAGGCAAGCTTC	1
CAGCCATATTTGATTGCCTGC	2
CAGCCATGAGTTTTCGTGTCTAA	1
CAGCCATGCTCTAGGGGATGTGCA	1
CAGCCATGGTCCGCGCAAATCAAC	1
CAGCCATGTCCTAGATGTGAGGCT	1
CAGCCATTGAATGCCATAGCTACA	1
CAGCCCAACGCTGCCACATCTGCG	1
CAGCCCAACTCTCTGCCTCCTCGC	1
CAGCCCAATGTGGATTGATTGGAA	1
CAGCCCAATTTGAGCCAAGCTG	1
CAGCCCCCTCCAAGTTGGTAGCCA	1
CAGCCCCGCGTCGCACGGATTCGT	1
CAGCCCGCTACTCCCAGATATGG	1
CAGCCCGCTTGATCGATATGGGAC	1
CAGCCCTACGTATACTCGCCTTTG	1
CAGCCCTACGTTAGTTGGAGTTGG	1
CAGCCCTACTAGCTAGCTGCTGGT	1
CAGCCGAACTGGTTGATCGAACT	1
CAGCCGAACTGTGAGTTGGCGGT	1
CAGCCGAATCTGGTGCCGCCC	1
CAGCCGACCTGCTGGCTATAAGGT	1
CAGCCGACGAGCTCGCACGACTGC	2
CAGCCGAGAGGTTTGCCATAGGT	2
CAGCCGATGTATGCCTTAACCTT	2
CAGCCGATTAATTGCAAAGGG	1
CAGCCGCACCCGTCGTTGGGTCC	1
CAGCCGCCGCTAAGCGTGACCGAC	1
CAGCCGCGTAACGGGTGGAATGCT	1
CAGCCGGAGATTGGTGGGACACGT	1
CAGCCGGATAGGGTTTAGGGTTAG	1
CAGCCGGATTAAATGGTGGGCGAC	1
CAGCCGGTCGGTGAAGATGTGGAC	1
CAGCCGTGAATCTATTTATAGGTC	1
CAGCCGTGCCGCTGAGATGTTGCA	2
CAGCCGTGGTGCCGCGTTTTGGC	1
CAGCCGTGTCACGTTTTCGCGGT	1
CAGCCGTGTCTCGTTTTTGCGGA	1
CAGCCGTGTCTCGTTTTTGCGGAC	1
CAGCCTAAATGTAGCTCCACTCATT	1
CAGCCTAATAATGAACAGTTTCAG	1
CAGCCTACCCATATAATAGTTAGC	1
CAGCCTACCCTGAAACGAATTGGA	1
CAGCCTACGTGGCAGATGGATGAC	3
CAGCCTAGTATTGGATGTGATACA	1
CAGCCTAGTTTTTAGGAGGTGCTT	1
CAGCCTATAGAGAGCGAAGATGGT	1
CAGCCTATGTGGCAGATGGATGAC	3
CAGCCTATGTGGTAGATGGATGA	1
CAGCCTATTTAATGCTATGGACAC	1
CAGCCTCAGTACAGATCTATACGT	1
CAGCCTCCAAGAGTGGTGATG	1
CAGCCTCTATTAGGGTACTTTCC	1
CAGCCTGCTAACTAGCTATGCG	3
CAGCCTGGAATATGCGGGATGTGC	1
CAGCCTGGTATTGATATTGACGTA	1
CAGCCTGTAAAACTAGGTGGGCAC	1
CAGCCTGTGTCGATGATGCTA	4
CAGCCTTAGATTGATGAGGAGCGA	1
CAGCCTTAGTGGACTGATGATGA	1
CAGCCTTCGCAGGTGGATAGCGAG	1
CAGCCTTTGGTGCCGGATTCGC	2
CAGCCTTTTGCATCTAAGCTA	2
CAGCCTTTTTAAGATTGGTTGGAC	1
CAGCGAAAAGGCCGAGTTAAGATA	1
CAGCGAAACCATGGATCATACTGC	1
CAGCGAAATCGGGGATAGCGG	7
CAGCGAACCACGGTACGATGATGC	2
CAGCGAAGGCGAGCCGGTGGTGAA	2
CAGCGAATGATGGCCAACATGT	1
CAGCGACGCTTCTGCCTACCGCCC	2
CAGCGACGTAGGGAGATGGTACC	1
CAGCGACTTTGAACTGCGGCCGCA	1
CAGCGAGGATGCCTACTAACTGAT	5
CAGCGAGGCCTAGTCTTTCGGAGG	1
CAGCGAGGTGCAGTGGCCACGACG	1
CAGCGAGGTGCCTGGGTGATGTC	1
CAGCGAGTACTACTACTACGTCGA	1
CAGCGAGTGTCACTGCTCTGCCGC	1
CAGCGAGTTGCTAGTGCCTGAAG	1
CAGCGATAACCACGTGGAGGAGGA	1
CAGCGATGAAGCAGAAGCGGAGGC	1
CAGCGATGTGTACTTTTGCAA	5
CAGCGATTATTGGAAGGGTCTAGC	2
CAGCGATTTTTGGCCTTACACGAC	1
CAGCGCAAACCGATAAAGATGGAC	1
CAGCGCACATGGATTGGGGAGCCC	4
CAGCGCATGTGCTGATGTGTAGTC	1
CAGCGCATTGGGGGCTTCTAC	2
CAGCGCCAATATCTATGGTGTTG	1
CAGCGCCACATGATTTGACGTTGA	1
CAGCGCCACATGATTTGACGTTGAG	1
CAGCGCCCTGTGCTAATCTTC	1
CAGCGCCGCCCCCATTGCACCGCC	1
CAGCGCCTGCTCCACAACGGATGC	1
CAGCGCGAATGCGAATGATGATGG	2
CAGCGCTACGGATGGTGATGCTGG	1
CAGCGCTGAGACGTTATGACGGTC	1
CAGCGCTGCAGCAAGAATGGCAGC	2
CAGCGGAATGAATTGGTGACCAGG	1
CAGCGGACTACAGATTTATAGCAA	1
CAGCGGAGCAGAGGCATGACGGCG	4
CAGCGGAGGACCATTCTTGGGGTA	2
CAGCGGATGGAGTGGGTCGGTACC	1
CAGCGGATGTGCTTCGTGATTCGT	1
CAGCGGCAAATGGTGCATGGGTAAG	1
CAGCGGCAGCGCGAAGAAGTTGGC	1
CAGCGGCCAGCAGAGCAATAGCGA	1
CAGCGGCTTATTGGTGGACCTCAT	1
CAGCGGGAGTGGATTTTAATCGAT	1
CAGCGGGCCTTACGTGTACATGAT	1
CAGCGGGCTACAAACATATTTTA	1
CAGCGGTGTTAGAAAGATATCGA	1
CAGCGGTTTGTGCTTGGGTGGTAGT	1
CAGCGGTTTTGCTGATATGGCGTC	2
CAGCGTAGGTGCTGTGGGACTCGA	7
CAGCGTCATTGAGACAAATGGGGA	1
CAGCGTCGTGAGGATAGGATGG	1
CAGCGTGAGACCCATCTAGGCCCC	1
CAGCGTGCATAAACGTGGCGGTGG	1
CAGCGTGCCGAGTGACCACCTCGT	1
CAGCGTGCTATAGATATGTAGCCAG	1
CAGCGTGGGTGCTACTCCGTTGAA	3
CAGCGTGTGCGACTAGGTGGATGC	1
CAGCGTGTGTATGACAGGTGGGAC	1
CAGCGTTGTGTTGGGCGGTATGGT	1
CAGCGTTTACGAAACCACGTGGTT	2
CAGCTAAAGGCATGCGACAGATGG	2
CAGCTAAAGTCAAATGAGTTTGGC	2
CAGCTAAATACTGAGGTGTAGGAG	2
CAGCTAACAACCAAAGATGGTCCT	1
CAGCTAACGGTTAGGATTTGGTAC	2
CAGCTAAGAGAAGGGACATGATTA	1
CAGCTAAGGGGCCCGAATCTGTAT	1
CAGCTACAAAGGTGTGAGGATGA	1
CAGCTACATAGTACCCGATAACTG	1
CAGCTACATCCGACACTGATGGGT	1
CAGCTACCACTCTATGTATGAGA	1
CAGCTACTTGTGGTTGATGAGGAA	1
CAGCTAGACTGGCTTATGCCTAA	1
CAGCTAGATAGGCTTATGCGAGGG	1
CAGCTAGATCCAACGATTGGAAAC	1
CAGCTAGATTGTGGAGCCAAACAT	1
CAGCTAGCAACGCAAACTGCGAGC	2
CAGCTAGCCCTACAAGGTGGTGG	1
CAGCTAGTTATGATAAAATCTG	1
CAGCTAGTTTGTTGCTCACAA	1
CAGCTATAAATATATTTTAATAAG	1
CAGCTATACTGCCTTGGGACCTA	1
CAGCTATATTGGTGTGGTTACGCT	1
CAGCTATCACAGGATCAACGT	1
CAGCTATGCCACTGATATGTGAGC	1
CAGCTATGGTGGATGATGGTCTT	1
CAGCTATGGTGGTAGGGTGAAGC	1
CAGCTCAATACCCTTGTGGACGGG	3
CAGCTCCACGAGATGGTGGGTTAG	1
CAGCTCCCTAGTAGTTTGCACAC	1
CAGCTCCGTTCCTATTTTAGGTGG	2
CAGCTCCTGAGGATTGAGGTCTA	1
CAGCTCGGGGCCACACATTGAGAA	1
CAGCTCTACATCTTGGTGTATGTG	2
CAGCTCTACTCTCAGTTTTGGTGG	1
CAGCTCTTCGAGGCCTGTTGTTGC	1
CAGCTGAAAACAAAGAGGTGA	1
CAGCTGAAGTACGGATTTCAAGA	1
CAGCTGAATATGATGATGCAA	4
CAGCTGACATGACGCTGAGGTGTC	2
CAGCTGACATGGTGCTGAGGTGTC	1
CAGCTGACCTTACCGAGAAGACT	3
CAGCTGATCTGACCCTGGTGCTAG	1
CAGCTGATGAAAGCCTACCCACGTC	1
CAGCTGATGATCTAATCAAGATGC	1
CAGCTGATGTGTGCTTTAACCCTC	1
CAGCTGATTGGCTGCCTTTATCAT	4
CAGCTGCAAACATATTTTAAGGAG	1
CAGCTGCAGCACAGACTACAAGAC	1
CAGCTGCATGCGATAATGGGCCTA	1
CAGCTGCATGGTACCCGATATCTG	1
CAGCTGCATTATGGACTCCAAGA	1
CAGCTGCCAAATGCAATTCGAA	1
CAGCTGCCAAATGCAATTCGAATG	11
CAGCTGGCTCCAGGATTGGTGGTC	1
CAGCTGGGCTATTGGTGGAGGGCA	1
CAGCTGGGTGCAGTGGCACGTAGC	1
CAGCTGGGTTCTGGTTGGGGTTGC	1
CAGCTGGTACCTGATACATGTGAC	1
CAGCTGGTGTGTACTATGTAGTC	8
CAGCTGGTTAGAGCTACGTGCTGA	1
CAGCTGTAAAGGTGTGATGATGAC	1
CAGCTGTAAGTAGAGTTGAGTGAA	1
CAGCTGTAGAACGGATTTCAAGA	3
CAGCTGTAGGCGAAATGATGGGAC	1
CAGCTGTCGTGTATATGGTTCAGC	2
CAGCTGTCTATAAATATGTAGCTC	1
CAGCTGTGCTTCCTCGGTTACT	1
CAGCTGTGTCGGCCTGATTGATGT	2
CAGCTGTGTGTCTGTGTAGCTGAA	2
CAGCTGTTGATTGCTGAGGGGTAC	1
CAGCTGTTTGATGACACCCTA	1
CAGCTGTTTTTTAGAATCTTACGC	1
CAGCTTAACGGTTGGGTGCAAGG	1
CAGCTTAATGGACATACGAGATAC	1
CAGCTTAATGGGTCTATGAGTGG	1
CAGCTTAATTGAGAAACGTGCC	1
CAGCTTACAACCGATGTGTAA	8
CAGCTTACTCTCAATAATCTGGAT	3
CAGCTTATGAACATGATGATGCAG	1
CAGCTTATGGTGGAAGCCTCTAAC	1
CAGCTTCATGCCTCACTTTCCT	1
CAGCTTCGTTTTCAAAAAGGAGG	2
CAGCTTCTATTCTAGCTAGGGTGT	1
CAGCTTCTCAGAATCTGGATGAAA	1
CAGCTTCTGAATGCAATTCGAATG	2
CAGCTTCTTGGTAGCCAGCTTCT	3
CAGCTTGACCAGGGCTACGCCTAA	1
CAGCTTGACGGCGTTGTTGGGCCG	1
CAGCTTGAGAATGTTTATAGGGAG	1
CAGCTTGCACTTATTTCCACGGCA	1
CAGCTTGCTAAGATCACAGGTTGC	2
CAGCTTGGGTACCGAGTTTGGA	1
CAGCTTGTGTGCCGTGCTTCATA	4
CAGCTTGTGTGCCGTGCTTCATAT	14
CAGCTTTAGAAGAGGTGGAGCTAG	1
CAGCTTTCTTGATAATCGTGTCTA	2
CAGCTTTGAAAGAAGACAGGTGGA	1
CAGCTTTGATTAGTTAAGGGACGC	1
CAGCTTTGTAAGTTGAGGGTTGT	1
CAGCTTTTGTCTGTGCCATGATGC	2
CAGCTTTTTTAGGATGGAAGGAGT	3
CAGGAAAATTAATCCTGACGTGCG	1
CAGGAAAATTTTGATGTGATGAAA	1
CAGGAAACGATGATATGTGCAA	1
CAGGAAACTCAGTTGGTGTAGCT	1
CAGGAAACTGCATAGCTTAGGGCA	1
CAGGAAAGGTGCGCCGTAGTGGA	1
CAGGAAAGTTTTGATGTGATGGAA	1
CAGGAAAGTTTTGATGTTATGG	1
CAGGAACACCCACGTGAATTTTCA	1
CAGGAACCCACGGACCGGCACCGA	1
CAGGAAGAATTTGAGGGGCAGCGG	1
CAGGAAGAGGTGCTGTTTGAA	16
CAGGAAGCTATCCTGGTGGGCATT	1
CAGGAAGGATTTTCCTGGGTGTCC	1
CAGGAAGGGCGGCACCAGTGTGA	2
CAGGAATAAATGCTATTGGAT	1
CAGGAATACAACGGTTAGGGGCA	1
CAGGAATCGGATGGAGTGCATG	2
CAGGAATGAAAGCCTAAGGTGTAG	1
CAGGAATGAAAGTGCAAAATAGA	1
CAGGAATGAACTTGAGAGGTAC	1
CAGGAATGCAGGTGTAAAACATA	1
CAGGAATGGCTGTTTGATTGGACC	1
CAGGAATGGTGCGCTGTGGTGAGT	1
CAGGAATGTGCTATATTACTC	10
CAGGAATGTTTAGAAGGATCCCAA	1
CAGGAATTGAAACAATAGGTGCAT	1
CAGGAATTGAAGTGTGAAACAGAG	1
CAGGAATTTGATGGAGAAGAAAAA	1
CAGGACAAACCTACAAAGAGGTGT	2
CAGGACAAGGGCAACCGGATACGG	1
CAGGACACCGAAAGATTGTGGCCT	1
CAGGACACTGCAACCACTAGACTA	1
CAGGACATAAGTCCTTTGAGGGAG	1
CAGGACATCAGTGTGCCACCCTGC	1
CAGGACCAATTGGAGAGTCCCTCC	1
CAGGACCATTTCTGGCGCCATTGC	1
CAGGACCTAAAGTTGTGGCTCC	1
CAGGACCTAAAGTTGTGGCTCCAG	1
CAGGACCTAAAGTTGTGGCTCTG	1
CAGGACCTAAGGTGCTACTGAGA	1
CAGGACCTATTTTCCTGATGGTAT	1
CAGGACCTGATGGATGCTGATGAC	2
CAGGACGGTCACACACAGCTG	1
CAGGACTAAATTGTAGGTGATGA	1
CAGGACTAAATTGTAGGTGATGAC	3
CAGGACTATTGTGGAATTCGGCCG	1
CAGGACTCCAAACGGTTTCTCCAC	1
CAGGACTGCTCACTAACATGTGGG	1
CAGGACTGTCTTCCGGAGGTTGAA	2
CAGGACTTCGTCATCTGTCTC	1
CAGGAGAAACTGTGTTGCCAT	1
CAGGAGACATGGTGCTGTGATTGC	1
CAGGAGAGAAAAACCACGGGCGC	2
CAGGAGAGCGAGATGGTAGCA	1
CAGGAGATCAGCAGAGGTGGC	1
CAGGAGATGAATATGCCTCTTCTA	1
CAGGAGATTCAAACACCACCTA	1
CAGGAGATTTTTGATGGATGTGAC	1
CAGGAGCAGTGATGGCAATGACT	1
CAGGAGCATGTACCTTCTTAACGC	1
CAGGAGCGAATCCAACATGGGTGT	1
CAGGAGCGTACACGTGGAAACAGA	1
CAGGAGCGTGTCGTAGGAAAACGG	1
CAGGAGGATTATTTGGTCGACCGC	1
CAGGAGGCAAAGCCGCCATGGCGC	1
CAGGAGGGACTAAAAAGGGACTA	1
CAGGAGGGCTAATTTGAGGTTAAA	1
CAGGAGGGTAGCCTGCAAAATGGC	2
CAGGAGGTACCACGAAGCGGTGAA	1
CAGGAGGTAGATTGGTTGTGCTGA	1
CAGGAGGTGAACACCATCAATGGT	2
CAGGAGGTGCTAAACAAACTATAC	2
CAGGAGGTGGTGTAAAGGAGGCGT	1
CAGGAGGTGTCTACTTATACCGTG	9
CAGGAGGTTCCGGGCAAAAGTGCA	1
CAGGAGGTTTCACTTAGGTCCACA	1
CAGGAGTAGGGTATTACGCTTCT	1
CAGGAGTATTATAGAGAGGGTGAT	1
CAGGAGTCCAGGTTTATTCAC	1
CAGGAGTCTAACGGTGTACTGGAA	1
CAGGAGTCTGACCAGATTCGTTGT	1
CAGGAGTGCATCGGATAGAGGGTA	1
CAGGAGTTGAGTCTGGAGTGGAG	1
CAGGAGTTGCTACCTGAAGACGAA	3
CAGGAGTTGGGTCTGGAGTGGAGT	1
CAGGAGTTTCCGTTTGATTGTACC	2
CAGGATAAATGATCGCAGGGGTC	1
CAGGATAACGAGGTGATAAGCAGA	2
CAGGATACGTTTACACGGATTGGA	1
CAGGATACTAGAGGGGCTATGTCA	1
CAGGATACTCGATGTACTCGA	2
CAGGATAGAAGAGGCGCTACTCGT	1
CAGGATAGCACTTGTTGTATGGA	2
CAGGATAGCCATTGTTAGATCCAA	1
CAGGATATCATACGGCGTGCTTAG	1
CAGGATATCCTCTAGTGATCGGTC	1
CAGGATATGATGGAGTGCTTA	12
CAGGATATGGCAAGCCCCCCTAAT	3
CAGGATCAAAACTGTCTAAGGACC	1
CAGGATCAATAGATAAGGTGAGTG	1
CAGGATCAGACAATAAGCGTTGAA	1
CAGGATCATTCCATTGTGCTG	1
CAGGATCCTACGTGGCGTTGATG	1
CAGGATCGGGATACTAGGTAGTA	1
CAGGATCTAAGGTGCTACTGAGAC	1
CAGGATCTTTCCATTGTGCTG	2
CAGGATGATACAGAAGTTGCA	2
CAGGATGATACGGTCGAACAAGT	1
CAGGATGGTCTCACAAGGGAG	2
CAGGATGTATCTTGTGGAGCTAGC	1
CAGGATGTGATTAGGACTGTTGCA	1
CAGGATGTGGCACTGGATATGGGC	1
CAGGATGTTGTTCAAACTGTT	2
CAGGATTGATCAGTTGCTTAAGCA	1
CAGGATTGTTACGCCTCTGGA	2
CAGGATTTATCGGCGTTGTGCTT	1
CAGGATTTGGAAGTCTGGCAA	1
CAGGCACATGATATGATGGTAT	1
CAGGCAGAAGTAGCATGTCTG	1
CAGGCAGACCTACTTAAGTGCCTG	3
CAGGCAGCAAGATTTGATAGGCCC	3
CAGGCAGGCGCTGGTTGGTTGGTT	1
CAGGCATGTGCTGCCGGTCAGACC	1
CAGGCATTGGATAGCAGCTGGCGC	1
CAGGCCATATGTGTTGTGGAG	2
CAGGCCATCGCATCAGATCCTAGC	1
CAGGCCATCTGGGCGAGCGCCATG	1
CAGGCCCAATGTGATCTGGGTGGC	1
CAGGCCCCAACGTATGGTGAT	3
CAGGCCCCAATTATTTTTAGTTCC	1
CAGGCCCGAAATTTGTCTGGTCTA	1
CAGGCCCGGTCACTACAAATTGGC	1
CAGGCCCGTCCACTTGTTCTTCGC	1
CAGGCCGTAAAGAAGTAGGGTGGC	1
CAGGCCTAATGTGACCTGGGTGGC	1
CAGGCCTAATGTGATCTGGGTGAC	1
CAGGCCTATACATCCAACCGGATA	1
CAGGCCTGATAGGTTACTTTGTGC	1
CAGGCCTGGTACCTGGGTTGCTGC	1
CAGGCCTGTAGTGAGCTGCTGCTG	1
CAGGCCTTACTAGGTGGTGGTC	2
CAGGCCTTGGTGGATCTGGTGGTA	1
CAGGCGAAGTGCGGTTGGTATGCC	3
CAGGCGACACCAGGAGCGACTGTG	1
CAGGCGGCGGAGCTAGCTAAGGCA	1
CAGGCGGTATCGCATGGTGAAAGC	3
CAGGCGGTCTTGTTATGTGGTTC	1
CAGGCGGTTGATGAGAATGCT	1
CAGGCGTACGCATGGACCACCGCC	2
CAGGCGTCGCTTATATGGTCCGCC	1
CAGGCGTGCCAGTCAGTTTGAT	1
CAGGCTACCAGCCAAACTCGAGGC	2
CAGGCTACTGTCAACCATCC	1
CAGGCTAGAAGTCACTCATGTGAA	1
CAGGCTAGAAGTCACTGATGTGAA	2
CAGGCTAGAATCCTCAGGGTAGCA	1
CAGGCTAGAGATTATGGTTCTAAG	1
CAGGCTAGGTTGCCTGATGGACC	1
CAGGCTATAAGCCAGCTATAAACA	1
CAGGCTGCCGGTGTCCACAGCGCC	2
CAGGCTGCTCAGAAGTGTACCCT	1
CAGGCTGTTCCTCGGTGATGGCAC	1
CAGGCTTATAAGCTACACCGCC	1
CAGGCTTCAAGGCAAGGCTGTTGT	2
CAGGGAAAATGAAGATGATGCTC	2
CAGGGAAATGCACGAATCATGGC	1
CAGGGAACCTATTGAACCACTGCT	1
CAGGGAATCTTTGATGTGGAAGC	1
CAGGGAATTGATTTGCAACGGTGT	1
CAGGGAATTTGATGGATCGTA	9
CAGGGAATTTTCAGCAGTGATGGT	1
CAGGGACAAAAAATTTTGGGTGGG	2
CAGGGACGGCCTAGTGGATGTTGG	25
CAGGGACTACAGGCGGGTGATGTA	1
CAGGGAGCTAGGGATGTATGGTC	2
CAGGGAGGAGTTGAGGGGTCTAGA	2
CAGGGAGGATGATGTACCGCCTGC	1
CAGGGAGGGAGACCGTCATCCTCCGT	1
CAGGGAGGGTGCGACATCCAAATA	1
CAGGGAGTACTTTGTGTCATTCA	1
CAGGGAGTTTTCCTCTGCGCC	4
CAGGGATAAATACGGAGGAGTACC	2
CAGGGATAGTGTGACCAATGAGGT	1
CAGGGATGGGCCTATTACATGGTT	1
CAGGGATGGGCGAATCTGGGAGGT	1
CAGGGCAAGTGGCTGACTCGACGT	1
CAGGGCATGTTTGGATTGATGTCA	1
CAGGGCCGGTCCTGACTTTTCAGG	1
CAGGGCGCAACACCGATCTTT	1
CAGGGCGCCCTGGTTTATGTGTGT	1
CAGGGCGGTTTTGTTCAACGTGGC	1
CAGGGCGTGTCCTGAACTGTGCAA	1
CAGGGCTAAAGATAATAAGGGGCT	3
CAGGGCTAAAGATCACCGGGATC	1
CAGGGCTCAATAGGATAAATAGA	1
CAGGGCTCACTGTCCCCTGGTGTC	1
CAGGGCTGAAGGAGATGCCGCTGT	1
CAGGGCTTGATTCACGTCCTA	3
CAGGGGAGCTCCAAAAAGGGTGAC	1
CAGGGGAGGGGCTGAAATTTTGAC	1
CAGGGGCATTTCCGTCCAGGATGG	1
CAGGGGCGATTCTAGTGTAATGAC	1
CAGGGGCGCACTCGACTTCTGTGC	1
CAGGGGGCGTGCAGTTTTGCAGGC	1
CAGGGGGTGCTATGGACTGTCCAG	2
CAGGGGTAAGCGATGCATGTT	2
CAGGGGTACCGTGCTTGAAGGGGA	2
CAGGGGTACGAAAGGGACTGAGTG	1
CAGGGGTCGACTTCGCACTGGGAG	1
CAGGGGTGAGTGGGACGGATTGGT	1
CAGGGGTGTAAAGTTTTGGTGTGT	1
CAGGGGTGTGAGATGCAGATTCT	2
CAGGGGTTTCGATCCTAGGGCCA	1
CAGGGTACACATGACAGTTTAGG	1
CAGGGTACCAAATATAGATAGAAT	1
CAGGGTACCAGTACCTTGAGGTA	1
CAGGGTACTATGTATAAGTGGGTC	1
CAGGGTACTGTAACCACTATGCTA	1
CAGGGTACTTAGTGTTAAGTTGGA	1
CAGGGTAGCATGTACGGTATCGGA	2
CAGGGTAGGAACTGCATAGAG	1
CAGGGTAGTCAAACTGGACCA	3
CAGGGTATATGCGAGATTGAGGT	6
CAGGGTATCTGGATCTTTGTACAG	1
CAGGGTCAAATCGTATGGCGCT	2
CAGGGTCAACGATGCCATATCGGA	1
CAGGGTCACAAGCAAAAGGAG	1
CAGGGTCGCTCTGAAGATCTA	2
CAGGGTGAACCCATGGATTGTCGG	3
CAGGGTGACCTGGATGGAGCC	22
CAGGGTGACTGATGGGTTGGCCTC	1
CAGGGTGCATACAATGTCAATGAG	1
CAGGGTGCATGGGGTATTAGGTAC	1
CAGGGTGCGCTATAACTAAACTAC	1
CAGGGTGCTAGACGGACTTTTATCT	1
CAGGGTGCTATAGCGGTTGTGAAG	1
CAGGGTGGCGGCTTGAGAGAGGGC	1
CAGGGTGGTAACTAAGGGGAGGT	1
CAGGGTGGTGGGCTAGACGACCTG	1
CAGGGTGGTGGGCTAGATAACCTG	2
CAGGGTGTATATGCTATCGTTGGC	1
CAGGGTGTCAAGGTTTGCCATCA	1
CAGGGTGTCATGTAGCAATTA	1
CAGGGTGTCCGTCGGAGTACCA	1
CAGGGTGTCGTATGTGGTGTTCGG	2
CAGGGTGTGAAAAACCGCCGGTAA	1
CAGGGTGTGACATCTAATGGCTAA	1
CAGGGTGTGGATCTTACTGGTTCA	3
CAGGGTGTGGCACTGGCTTTGGTT	1
CAGGGTGTGTTTAATTTACGCCAA	1
CAGGGTGTGTTTCAGCAATAA	1
CAGGGTGTTTGGTTTATAGCCACA	1
CAGGGTGTTTGGTTTGAGGACAG	2
CAGGGTGTTTTAAATGGACCACGC	1
CAGGGTTAATTATGGAATATCGC	1
CAGGGTTACAGGTAAGGTTGTCAC	1
CAGGGTTATAGCACCATGGAG	1
CAGGGTTGTGATTGGTTAGGAAG	1
CAGGGTTTAAATCCTGGTGTCTA	1
CAGGGTTTGTTGTTGGGTTTAGT	1
CAGGTAAATTTTAGGGGTATGAAA	1
CAGGTAACAAGTATTCGGGGTCAC	1
CAGGTAACATGCGATTCTTGCCAC	1
CAGGTAAGCGCTCCACAGATGGAT	1
CAGGTAAGCTTTAAAGCCAGCTG	1
CAGGTAAGTTAGTTGATGCCA	2
CAGGTAATGACCTGGTTGCCGGC	1
CAGGTACAATAGTGGGCGGTATAA	1
CAGGTACACAACATGGTGAAGGAC	1
CAGGTACGCCTGTCGAATAACAAC	3
CAGGTACTAGGTGCTAGGTATCAG	1
CAGGTACTTATCGAACAATATGGT	1
CAGGTAGACAGTTTCTATGGGGCG	7
CAGGTAGATCTATCTGTTAGTGAC	3
CAGGTATAACAACTCGCTATTGAC	1
CAGGTATAAGACCAGTAGTGCCAC	1
CAGGTATACGGGCCCCGCAGACAC	1
CAGGTATCACAGGTATGGTATCGG	1
CAGGTATCAGGTATCAGGTATCAG	2
CAGGTATTATATAGATTGACGCAT	1
CAGGTATTATATAGGGTGTCGCAT	1
CAGGTATTTGGTCACGTGTGATGG	1
CAGGTCAACAAAGCCACATAGGCC	1
CAGGTCAACACTGCCACGTGTGCA	1
CAGGTCATTGCTTATTACTGTTG	1
CAGGTCCAAAGCCGAAGAGGTCCG	1
CAGGTCCACAACTTGATGAGATGT	1
CAGGTCCACACGCGCGAGTGCGA	1
CAGGTCCACATGTTAGTGACTCAC	1
CAGGTCCATCCATCTTGTCGTTGC	1
CAGGTCCGTTGGTTGAGTTGAAGCA	1
CAGGTCGCTATGGTGTTGTGA	4
CAGGTCGGGCCGCATAACTGCTGG	1
CAGGTCGTCTAGCCCACCATCTT	1
CAGGTCTACAGCACCAGGTCA	1
CAGGTCTCTTGAATGTGTAACACA	1
CAGGTCTTAATAACAGATTGATGC	1
CAGGTGAAAACCCAGCTCGGC	2
CAGGTGAAACTGCATGACCAC	1
CAGGTGAAATAATGGCACAGGAGA	1
CAGGTGAACCTTGGCGGCTGGGAA	1
CAGGTGAAGCAGCGATAGGACCAC	1
CAGGTGAATGAGAAGATGGCCACA	7
CAGGTGACACTGATGACTTTCGGT	1
CAGGTGACATCGACGATTTTCGG	1
CAGGTGACATCGACGATTTTCGGT	1
CAGGTGACATGAATTGATCGA	1
CAGGTGACCTATTCGGCAAGTGCA	1
CAGGTGACTCACCTATGACGGTC	1
CAGGTGACTTGAGGTCAGGCTTAA	1
CAGGTGAGCCCGGTGATCCGATCC	1
CAGGTGAGGCCTGCGGGTATCAAG	1
CAGGTGAGGTTGCAATGTTGAACA	3
CAGGTGAGTGTATGTGTGTTGTGA	1
CAGGTGATCTACTTGTGACGGCCC	1
CAGGTGATGCATTGATTGTATGGG	1
CAGGTGATGGCGTGGCGGCTGC	1
CAGGTGATGTGGCGCTGAGGTGTC	1
CAGGTGATGTTCTGTTAAGATCTG	1
CAGGTGCAAAGGCAACACGACGCC	1
CAGGTGCATGCGTTGACCGCTGGT	2
CAGGTGGAATGACGAAGGTGGGCA	1
CAGGTGGAATGGTGGTGTCAAGGT	1
CAGGTGGACATATTAAACTGTGT	1
CAGGTGGACGTAGAGGTGCTCAAC	1
CAGGTGGACTACTTAAGCGGCGCC	1
CAGGTGGACTTCGATGTGGCGGAC	1
CAGGTGGAGGCGCGACGATGTGAG	3
CAGGTGGCTGGCTGTTTTCTA	2
CAGGTGGGACACGTTCGGGTCAGC	1
CAGGTGGGACCAGGTATTAATGGT	1
CAGGTGGGACTATATATTAATGGT	2
CAGGTGGGATCAGACATTAATGAT	1
CAGGTGGTACTGCGCAAAGGATGC	1
CAGGTGGTCGACGGATAACATGTG	1
CAGGTGGTGATTGAGCTTATTTAG	1
CAGGTGGTGGCCTAAATGATCTG	1
CAGGTGGTGGTTTGGGCCTGTTGC	1
CAGGTGGTGTACTCTTTTTAGGGC	1
CAGGTGGTGTTGAGTAGGCCTATG	1
CAGGTGGTGTTTACATCTAGGGAC	1
CAGGTGGTGTTTGGTTGGAGGGAC	1
CAGGTGGTTCAGATGGTGATTGTC	1
CAGGTGGTTGAGAAGGTGGTATAC	1
CAGGTGTACAATTGGAAGGTAGA	1
CAGGTGTAGCGCTCGTTCCGTCGT	1
CAGGTGTATGGATGAAAATGGTAC	1
CAGGTGTCACAGGTATCAGGTACC	1
CAGGTGTCACGGTCTACAGACCGA	1
CAGGTGTCATAGCATTAAGGTGTA	2
CAGGTGTCCATGTGAGATCTT	2
CAGGTGTCCCCTGGTACATGGTCC	1
CAGGTGTCCTCCCTTTTCGGGTA	1
CAGGTGTCCTTTACTGTATCGATG	1
CAGGTGTCTAAGTTTGTATTGAAG	3
CAGGTGTGCCATATATGAATTGTA	1
CAGGTGTGGCTTGAACGTAATCGC	1
CAGGTGTGTGGGCGGTCTGATCGGC	1
CAGGTGTTACGTGCATAAGCACAA	1
CAGGTGTTAGCCGATGACTCCTTG	1
CAGGTGTTCAAACACATGGTGTAA	1
CAGGTGTTCTCGATGGCTTCC	2
CAGGTGTTGGTTGGATCTAATTGT	1
CAGGTGTTGTTGCCTCATTTTGAG	3
CAGGTGTTTTTGTCTTACTTCTGG	1
CAGGTTAGGTTACTTGTGGTGGA	1
CAGGTTCAGGCCCTCTCGATGAGA	1
CAGGTTCATAGTCCTAGGATGGGT	1
CAGGTTCCAAGCAAGCAACAA	1
CAGGTTCGAGTGAATGATTGAGCTG	1
CAGGTTCTTACTACTAGGGTTTA	1
CAGGTTGAGTCCTTGACGTTGCC	2
CAGGTTGATATGATAGAAAAGGA	1
CAGGTTGATCCATATAGATCTCCT	1
CAGGTTGATGTGATAGAAAAGGAC	3
CAGGTTGATGTGATGAAAAAGGAC	3
CAGGTTGATGTGATGAAAAATGA	1
CAGGTTGATGTGATGGAAAAAGT	4
CAGGTTGATGTGATGGAAAAGGA	1
CAGGTTGATGTGATGGAAAAGGAC	2
CAGGTTGATGTGATGGAAAAGGACT	1
CAGGTTGATGTGATGGAAAAGTAC	1
CAGGTTGATGTGATGGAAAATGA	1
CAGGTTGATGTGATGGAAAATGAC	1
CAGGTTGCCACAGTGGGTGTG	2
CAGGTTGGCCGAAGATGTGGCGGA	1
CAGGTTGGTTGTGCAACGAGTGCA	1
CAGGTTGTACTGGCAAAGTGATGG	1
CAGGTTGTGATGGAAATAACATGC	1
CAGGTTTAACCTTATGATGTGACC	1
CAGGTTTAGGGATCTCGATGTGCG	1
CAGGTTTGTGGAGCGATATGCCAT	1
CAGGTTTTACATGATACTTCGC	1
CAGGTTTTTACGGTGTCCTATAGC	1
CAGTAAAAACAGTAGGTGTCGATG	1
CAGTAAAGATGGTTTCTCTAGCAG	1
CAGTAAAGCCGTGGAGCAATTCAC	1
CAGTAAATCTATACGAGAGATGGA	1
CAGTAAATCTGTGCTGCCAGC	2
CAGTAACACACATGTGCTAATGAT	1
CAGTAACCCACATGTGCTACTGAC	2
CAGTAACGGTGCACTGTTTTGAGT	1
CAGTAAGAAGTTGATCAGATGGTG	1
CAGTAAGGGCACCTACAATGGCAC	1
CAGTAAGGTTGGTTTTTCTAGGAC	1
CAGTAATGATGGTGGTGATTCCTA	1
CAGTAATGGAATAAGTGTTGC	1
CAGTAATTTTTGTTCTGGATTCGC	2
CAGTACAATATTTGGGGTAGCCT	1
CAGTACACAAACTTGTCAGGTGGG	2
CAGTACACCCACACCAGTGCCA	1
CAGTACATGCTGTGTGGTTCA	2
CAGTACCGTGAGGACGTGCCTTAC	1
CAGTACTACATGAGAGGCGATGAC	1
CAGTACTAGAAAGTCTTACATGGT	1
CAGTACTTACTACGTACTACCTCC	1
CAGTACTTGAACGAGGAGGGGAAC	1
CAGTAGAAACCACGTGGAGGGCAA	2
CAGTAGAAACCGATCGGCTAACAC	1
CAGTAGACTAGGGGCCTGTTTAGA	1
CAGTAGAGGTGGGCCGCTGATAGT	2
CAGTAGATGTACGCGTACACGTGC	1
CAGTAGCACACGTAGAAGATATGC	2
CAGTAGCACTTGAGGTCCTGGGTT	1
CAGTAGCAGTAGTTGACGGGTGGT	1
CAGTAGCAGTGGCTAGTAGGTGGA	1
CAGTAGCATCTAAGGTCCTGGGT	1
CAGTAGCGGTGGCTAACATATGGG	1
CAGTAGGAGTTTCTATCAGGTGTA	1
CAGTAGGGTAAAACTAACCTGT	1
CAGTAGGGTGGTATCCGACGGATA	1
CAGTAGGTGCTGAGGTAGAGTGCG	2
CAGTAGGTTTGAGGTGGGTGTAGA	2
CAGTAGTAGAGGTGTGACGTGAGA	1
CAGTAGTATGGTTGAACCGAACGT	1
CAGTAGTGGCCTGTTGTATGATGG	1
CAGTAGTGGGCTATACTATTAA	2
CAGTATAAGGAGGTGGGCCAAGCA	1
CAGTATATTGCTGCCACCTTC	1
CAGTATCGCAACTGTAAACTGCAT	1
CAGTATGCCTTCAAGTCTACTC	1
CAGTATGCTGCGTGTAGCACTGCA	2
CAGTATGGGGTCTAGGGGTCTCGA	1
CAGTATGGTGGATCAGGGTCTGGT	1
CAGTATTGAGGCTTCGACTTCTGC	1
CAGTATTGCATCCACGATGGT	2
CAGTCAAAAGTGTGGTGTGGCC	1
CAGTCAAAGGTGAGGTTTTACAGC	1
CAGTCAAATCAGTAGTGCTTTCAT	1
CAGTCAACAATGTTCAGGATT	1
CAGTCAAGGTGGACTACTAATGGT	1
CAGTCACATCGTACCAATTTCAAC	1
CAGTCACGATCTGACGGTGTG	1
CAGTCACGTAGGCGTCGTGTCAGC	4
CAGTCAGAGTATACAAACGATAA	1
CAGTCAGCACGCAACATAGAACAT	1
CAGTCAGGAATGACCGGTCTGTG	1
CAGTCAGGGGTGGCTTCTCGAAAC	1
CAGTCATGGATGAATGAACTA	1
CAGTCATGGTCGATGGTGGTCAGG	1
CAGTCCACGGATTGAGTGAGTCTG	1
CAGTCCAGTTCTGGCTATGCCTGA	3
CAGTCCCAACCCATAACACTAGA	2
CAGTCCCAGGAAACAGTGCTGGTA	2
CAGTCCCATTGGCGCTGATATGAA	2
CAGTCCCTTCTGGTATGTGTG	4
CAGTCCGATAGCCAGGGAGCAGCA	2
CAGTCCGGTTGGCGCTGAGGTAGC	1
CAGTCCTACCACCAATAATGCTGC	1
CAGTCGAACAAGATAATGGGGTAC	2
CAGTCGATTTCACTGTGCCATTGT	1
CAGTCGATTTGTGAGTTTAGGGACC	1
CAGTCGCCGCTGAATCGCTGGTCC	1
CAGTCGGATATACATGCCGTGTAG	1
CAGTCGGGAATTGTTAGGTGGTAT	2
CAGTCGGTTGGATCGGGTTGAAAC	1
CAGTCGTTGGCTTACAGGTGGAC	1
CAGTCTATCTGATGGTAGCACAAT	1
CAGTCTATGAAGATTTTGGGTGAA	1
CAGTCTCAAGCAAGAGCTGGGTAC	1
CAGTCTCAATAGGATTGTGTGGAG	1
CAGTCTCGACTAGAAATAGGGTAC	1
CAGTCTGAACTTGCCTACGAGGA	1
CAGTCTGAAGGTGTGTTTATAGG	1
CAGTCTGACCGCAGGTATATGGGC	1
CAGTCTTGAGGGCGATGCGGGTGT	1
CAGTCTTGAGGGCGATGCGGGTGTC	2
CAGTCTTTTGGAGGTACCTATAAG	5
CAGTGAAAAGAGTGCTAGTTAATA	1
CAGTGAAACCCCCATTGTGACTGGC	1
CAGTGAAACCTCCATTGTGACTG	1
CAGTGAAACGAATCTGAGAGGTGT	1
CAGTGAAACGCCTATGATAACTT	1
CAGTGAAAGTGCCACGGACAACGA	1
CAGTGAACAAGCGGAGGTGTGCAC	1
CAGTGAACATTTGCTAATGACGGA	1
CAGTGAACCCTACTGTTAGGG	1
CAGTGAACGGTCTAGATCTGATGC	1
CAGTGAACTGGTGATGCATGC	1
CAGTGAACTTCGCCTTGTTTG	2
CAGTGAAGCCAAAGCATTGGTGG	1
CAGTGAAGGTATTTTGCTAGCTGG	2
CAGTGACAAAGACATGGTACCTT	2
CAGTGACAAAGCTAGGCACCATA	1
CAGTGACGGGCCATTGAATAGAAG	1
CAGTGACGGGCCTATGAATTAGT	1
CAGTGACGGGCTGTAGTTTAGGC	1
CAGTGACGGGCTTAAGGATTGGTC	1
CAGTGACTGTAATGATAGTGACATT	1
CAGTGACTTCTAGCCTGTGACGGA	2
CAGTGAGAGAGACTAGATGGCGCA	1
CAGTGAGATGAAGTGGATGTCT	1
CAGTGAGATGATAGGGAGTGT	1
CAGTGAGTTTGGCAAAGATGACGC	1
CAGTGATAAAGGCACGGTGCAGTC	1
CAGTGATAAATGTATGGTGTCTTT	1
CAGTGATAGTTTTATGCTGGTGCA	2
CAGTGATGCTGATGGTGTGAAGG	1
CAGTGATGCTGATGGTGTGGAGGA	2
CAGTGATGGCATCTACAATGTGAG	1
CAGTGATGGCCCTATGAATTAGTC	1
CAGTGATGGGCCGTAGTTTAGGCT	1
CAGTGATTGTAATGGTGAAATTAT	1
CAGTGATTTGTCTTTAGAGTT	1
CAGTGCAAAGGTGTTGATAGCTTG	1
CAGTGCAAATACTAGTAGTGGGTC	1
CAGTGCAAGCACCTTTGACGGCGC	2
CAGTGCAAGGATTGTTTGGAAA	1
CAGTGCAAGTAAGGTCCCAAGACG	3
CAGTGCACACGGAGAATGGAA	1
CAGTGCACTTACATGTTATATCA	1
CAGTGCAGAAACGAGTGAGGG	3
CAGTGCAGAATGACTCAGTAGTCA	2
CAGTGCATGTACAATGGTATGTAA	2
CAGTGCCCAAACAGGACATATCGA	1
CAGTGCCGCAATCAGGGTAGCACT	1
CAGTGCCGCTGAAAATATGTG	2
CAGTGCCGGGTAAAGCATATCCAC	1
CAGTGCCGTGGTGGTACTTCGG	2
CAGTGCGATGACGAGTTGCGTCAA	1
CAGTGCGTCTATTTGTAGCCGTGT	1
CAGTGCTACCATATCATGGGTCTA	1
CAGTGCTACGTAGACGCCACGTTA	3
CAGTGCTCTGAATGTCAAAGTGAA	1
CAGTGCTGAAGCTGAATATCGCGC	1
CAGTGCTGAGGGACACCAATGTATG	1
CAGTGCTTGACATTTGACCGTTC	1
CAGTGCTTGGTAGTCTGTGGAGTC	1
CAGTGCTTGTAATGGTAGTGCTGC	4
CAGTGGAACCAAGCCAATGGTGTA	1
CAGTGGAACCAAGCCAGTGGTGTA	1
CAGTGGAACGCCTATCATCCAGAC	2
CAGTGGAATGGGGTGTCTGAACGG	1
CAGTGGAGCGGATCGAGGCTGGCC	1
CAGTGGCAAATCATAGACGTGTG	1
CAGTGGCAAATCGTAGAGGTGCAA	1
CAGTGGCAAATTGTAGACCTATG	2
CAGTGGCAGATTGTGGATCTAGA	1
CAGTGGCAGCCACGATGTTGTCAA	1
CAGTGGCCGAGTGCATGAGTGCAC	1
CAGTGGCCTGGTGCTGCTGGTGGC	2
CAGTGGCGCGAAGCTACCGTGTGC	2
CAGTGGCGGATCTAGAGGGTGGT	1
CAGTGGCGGATCTAGAGGGTGGTC	3
CAGTGGCGTAGCTAGCTAGGTGGC	1
CAGTGGCGTCTACGTGTCGGTGAG	1
CAGTGGCTAACAGGTGGACCCGG	1
CAGTGGCTTTAGGCCAATCGTGC	1
CAGTGGGACCCACATCATGGTGAA	1
CAGTGGGACTCAAATGAGGAGAG	1
CAGTGGGAGCTAACTCTAGTTGGA	2
CAGTGGGAGGAAGCCCGGTCAGTC	1
CAGTGGGCCATGAGCAGTAGTGAC	3
CAGTGGGGCCCGGATATGATGAAG	1
CAGTGGGTCAACTAGATGCGC	1
CAGTGGGTGTCGCTGTTACTG	4
CAGTGGGTTTGCAACGAGCAGA	1
CAGTGGTACGTGATATTGTGTAGT	1
CAGTGGTAGCTTGATGATCAG	3
CAGTGGTATAGTAGTTGTCACTA	1
CAGTGGTATCTGCCCGATTTCATG	1
CAGTGGTATGCGACGTATCCGTCA	1
CAGTGGTCAGTGGTGGACTTCAGC	2
CAGTGGTGAAGCCAGGATTTGGG	1
CAGTGGTGAAGGGCGAGTGACGAC	1
CAGTGGTGCAAAGTTTTAGCGTGT	1
CAGTGGTGCGATATGTGCGATGGG	1
CAGTGGTGCGGCGAAACGTGTGGC	2
CAGTGGTGGGTGGTTGACTCTACC	2
CAGTGGTGTAAAGTTTTAACG	1
CAGTGGTGTAAATGGGTAAACCG	1
CAGTGGTGTACTAGATTTGTGGT	1
CAGTGGTGTCATGTTGAGTTGTT	1
CAGTGGTGTGATGTGAGTCGA	2
CAGTGGTTGCTACGTAGTTAGAGG	1
CAGTGGTTTGTATGATGTGCA	1
CAGTGTAAACTAGCATGGTGGCCC	1
CAGTGTAAAGAATGGTGAGGCAAC	1
CAGTGTAAAGTTTGGATTTTGGT	1
CAGTGTAAATGAAAATCGAGGGT	2
CAGTGTAACCAAAGATAATAGAAT	1
CAGTGTAAGACTTGTAGCCTC	1
CAGTGTAATTGAGGGTCACCACC	2
CAGTGTAGGGTATCCCTGGATGG	3
CAGTGTAGGTCCACAGAATTGCTT	1
CAGTGTAGGTGCATGGTGAAACAG	1
CAGTGTAGTCGCTTTGATCGGAC	1
CAGTGTATTTGGGAATGTCCA	6
CAGTGTCAGAGTATGTAGCCA	1
CAGTGTCAGTGTCAGTGACCTCCA	2
CAGTGTCATAACCGCGTAGGAGGA	2
CAGTGTCATAGATTCAGAATGGAA	1
CAGTGTCATTGGGTTGGGAGTGGA	1
CAGTGTCCAAACATCTGATGTGAA	1
CAGTGTCCATTGGTAAATTACCAT	1
CAGTGTCCTCCTAGTGTATCGAGA	1
CAGTGTCGATGGGGGAGAGACGAC	2
CAGTGTCTAAGGAAAGGTTAACTT	1
CAGTGTCTACAAATAATCTTGTA	1
CAGTGTCTACTACTGCATCAGTAG	1
CAGTGTCTATTTGGTTTGAAACCA	2
CAGTGTCTCATCCAGTGTGTC	2
CAGTGTCTGGATTCTGGCAATCCA	1
CAGTGTCTGTAGTGGTAGTGCCAT	1
CAGTGTCTTTATAGGAGTGAGTGT	1
CAGTGTGAGCAACAGCAATGGCGC	1
CAGTGTGATATGATGTGCCAGTCC	1
CAGTGTGATGGTGGTGTCATGGCC	2
CAGTGTGCGGGCATATGACGCATG	1
CAGTGTGCGTATGGCGTGTGCCAA	2
CAGTGTGCTTGTGGATTATATCTG	3
CAGTGTGGACTCTGGATGAGATGG	2
CAGTGTGGCGTCTAGTGCTTC	1
CAGTGTGGGGCACGATAAAACTGT	1
CAGTGTGGGGCTCTCTTGACTTT	1
CAGTGTGGGTAAGACGGTCTAGA	1
CAGTGTGTCAACCTACCCTTTGAA	1
CAGTGTGTGAAGGCCTGATGGACC	1
CAGTGTGTGTATAACAGGTGGGA	2
CAGTGTGTGTATGACAGGTGAGA	1
CAGTGTGTGTATGACAGGTGGGAC	3
CAGTGTGTGTATGACAGGTGGGATC	1
CAGTGTGTGTATGACAGTTGGGAC	1
CAGTGTGTGTATGATAGGTGGGAC	1
CAGTGTTAAAACCGTGGGCTGG	1
CAGTGTTACTGCACAGTGGTCGTC	1
CAGTGTTCTGTATGATCTGTGCAA	1
CAGTGTTGCAGTTATGGTCTA	8
CAGTGTTGTGTACCGGCGGTGTAG	1
CAGTGTTTAGTTGTCATTCTGA	1
CAGTTACAGACTGTGAGAATTGCC	1
CAGTTACAGATAAAATCCGCAAGC	1
CAGTTACTAATTCATGATCTGG	3
CAGTTACTAATTCATGATCTGGC	3
CAGTTAGAATGTATCACATGGTCA	2
CAGTTAGAGGACGGTGCCAGCCAC	2
CAGTTATGGGTTTTATTGCGA	3
CAGTTCAGTTAACTCTGCGCA	1
CAGTTCATGGTGTGTGTTGAC	1
CAGTTCGAAGCTGAGCTTGGGTGT	1
CAGTTCGGCCTCCGAAGGCAGTGC	1
CAGTTCTACAAAGGTGGTGTGATG	1
CAGTTCTTGCTTTCGGGTTGAGCT	1
CAGTTGAATGCATAATGCCTTTGT	1
CAGTTGACATAGCGCTGAGGTGTC	1
CAGTTGAGATGAGGCGAGCGG	2
CAGTTGAGCGCCTGTGAAGATGGA	1
CAGTTGAGGGATTGTCCTGCCATG	1
CAGTTGATACGAAGGAGATTA	2
CAGTTGATACGAAGGAGATTAC	1
CAGTTGATGCAGACGCAGATGCAG	1
CAGTTGATTATGGCCGAAGATGAC	3
CAGTTGATTCTACTTACGATTGTA	2
CAGTTGCAGCACGGATTTCAAGAC	2
CAGTTGCAGTTACAAGAGGATGGA	1
CAGTTGCTGTATCTAGGGGTTGGT	1
CAGTTGCTTGTAACTGGGTTCTAGC	1
CAGTTGGCGAGGATTTGAGGTTGG	1
CAGTTGGGCAAGGTTGTTGGTCCA	1
CAGTTGGTGAACTATATGGTAGG	1
CAGTTGGTGCAGTCGACGATCAAG	1
CAGTTGGTGGTAGCTAGCTTCTG	1
CAGTTGGTGTTACTAATTGGGA	1
CAGTTGGTGTTTACATGCATGGTA	1
CAGTTGTGCAACTGTCTAGGGTCC	2
CAGTTGTGCCGGATGTAACATTC	2
CAGTTGTGCTACTGATATGTGGGC	1
CAGTTGTTAAGCCACATGGAT	3
CAGTTGTTGATTTTGTGTGTT	1
CAGTTGTTGGAAAAGAAAGACGAT	1
CAGTTGTTGGTGCGGAGATGGCGA	3
CAGTTTAGCTAAGCGAGGTGGTAC	1
CAGTTTATCGAAAAAACGGGCCGG	1
CAGTTTCTGCAACAACCGGTGCAA	1
CAGTTTGAAAAGCGTGCTAACGAA	2
CAGTTTGAAAAGTGTGCCACCAGT	1
CAGTTTGACGTGCTTGATGCTTGC	4
CAGTTTGCATGGTGCTTATGTCGA	3
CAGTTTGGATGGCGTAGTACCTA	1
CAGTTTGTTGGTGTCATAACGTAT	1
CAGTTTGTTGGTGTCATAACGTG	1
CAGTTTTAGCTCCATCAAAACTAG	1
CAGTTTTGAATTGAGTTAGGTGGA	1
CAGTTTTGTGTCCGTATGATAAC	1
CAGTTTTTGTACCAAAGGTGTGGC	1
CATAAAACCAGATATGTGAGGTCC	1
CATAAAAGTTTGGTATCTTGAGAT	1
CATAAAATAAACTAGAGAGGTGAA	1
CATAAAATACTACTCAGGTCACTG	1
CATAAAATAGGTGTCGGTGCTA	1
CATAAAATGAACTAGAGAGGTGAA	1
CATAAAATGTGAATCGGTTCCCA	1
CATAAAATTGACAATCACGTGCAT	1
CATAAAATTGCCCTATAAAGAAAG	1
CATAAAATTGGTGTGTTGCAACGA	2
CATAAACACATGCCCGGACTT	1
CATAAACGATTTGGTACCATGAGG	1
CATAAACTTTGATGTATACAAGTA	1
CATAAAGAGGATAACCTAGCC	1
CATAAAGAGTGACTAGAGGTCGG	1
CATAAAGGATTGTGCCACAACATC	2
CATAAAGTGCAGAAGATCTTAGTC	3
CATAAATAACACATGTGGTTGCAC	2
CATAAATACGAGGATATGTGCC	1
CATAAATATCTGTGTCTAACATT	2
CATAAATTGAGGACCCACGATTGA	1
CATAACAGGTAAATATATGGGTA	2
CATAACAGTGCCAAACCCGAGCT	1
CATAACCATTAGGATGACGTACA	1
CATAACCGCGTAGGAGGATGGAAC	1
CATAACCTCCGGAATAGCCTAGTG	2
CATAACGGGGCTGCTCAGATTGAT	1
CATAACTCAGATTGGTCCTTT	2
CATAACTCATGCCCTATGTTT	1
CATAACTTGTACCGTTCCTACGAC	1
CATAACTTTTGGGTGGATGGGACA	1
CATAAGAACAAAGATAGGTCCACC	1
CATAAGAATATGGTGTGCGTGTGT	1
CATAAGACAGGTGGCAAGTGGT	1
CATAAGACATGGTTTCTATATAGC	1
CATAAGACGGTGCCAATTTTAGT	1
CATAAGAGCGTGCATACATATGG	1
CATAAGAGGGTGTTGTATATATGT	1
CATAAGATATTTGTGTTGGGTTGA	1
CATAAGATGATGGGCTAGACCTA	1
CATAAGCAGTGTCTATGGTACCA	1
CATAAGCATTATCAGCAGGAG	1
CATAAGCTAAAAGTCCTACATGG	1
CATAAGCTAAAATAGTGAGGTGGA	11
CATAAGGACTTGTACTTTTGTGCG	1
CATAAGGGTAGGGTTTATGTGCG	1
CATAAGTGTGTCGCTGTCGATGGA	2
CATAAGTTAATGCCCGTCACAGA	1
CATAAGTTACTGATGTTGTGGCAC	1
CATAAGTTTAAGGGTCTGTTTGAA	1
CATAATAAACTATGGTACTTCAC	1
CATAATAAACTATGGTACTTCACA	1
CATAATATAAGTGATTTTGGGTGG	1
CATAATATATACATTGTGCAA	1
CATAATATGGTGATAACAAGATGA	1
CATAATATGTTAGAGGTTGGTGTA	1
CATAATCCAACGTGTTGATGGGA	1
CATAATCTTCAGATGTTGCAA	2
CATAATCTTTCAATGGCCTATGAC	2
CATAATGCCGGTGTGAATATGAAC	1
CATAATGTTGCAACCTAGAATGGG	4
CATAATTAGCCTATGTGATGATAC	1
CATAATTTGATGATGACGTGGAAG	1
CATACAAATAACGATGACGATGAG	1
CATACAACTGGGGCTAAATACGGA	1
CATACAAGAGCTAGCTTAACACAAG	2
CATACAAGATTGGCTACATGGGCA	1
CATACAAGCCTACATACGCCAAGA	1
CATACAAGGACAAACGGTGTATAC	1
CATACAAGTATGGAGCATGATGAT	1
CATACAAGTGTGCCACATCATCAC	1
CATACAATAAACGGGTGAACGTC	1
CATACAATAAATGGGTGGACGTC	1
CATACAATTGAATGGGACAAGTGA	1
CATACACACAACTTTTCAGTCGTA	1
CATACACACACTGCGTCTTGGAGT	2
CATACACACACTGTGTCTTAGAGT	1
CATACACACAGTGTGTCTTGGAGT	1
CATACACACATTGTGTCTTGGAGT	2
CATACACACCGGCCTACCAGAATG	1
CATACACAGTGTGTCTTGGAGTCC	1
CATACACCACCGTAGACAGGGGA	2
CATACACCTAGGTGCCATGGTAC	1
CATACACCTTCCTAGATGCGATGTC	2
CATACACTTCGGTGCAGACGGGCG	4
CATACAGAATGGTTCAATTATGA	1
CATACAGAGAAACAGGAATGGAGG	2
CATACAGATTGGTACTAGGTAGA	1
CATACAGGGATGATGTGTGCATGT	1
CATACAGTCCTCGGACCCGGTGTA	2
CATACATAATATGTTAACAGATGG	2
CATACATATACGTATGTGGCCTA	1
CATACATCTCTTAGGCATGTA	1
CATACATGATGCTTACTGGATATG	1
CATACCAAAGGTGATTGAGGAGT	1
CATACCAAAGTGGGGCCCACATGT	2
CATACCACAAGATAGGGCCTGTGA	2
CATACCACGCGTCTACGTCTGATC	1
CATACCATGGTGTCTCATATGAGT	2
CATACCCGATCATGTGCTATTGCA	1
CATACCGCTGCATGCAAGGATGAC	1
CATACCGGAATAGGGGTATGATGC	1
CATACCTATTGACAGCGAGACACC	1
CATACCTTTGTAGTTGTGCCCAAA	1
CATACGAATCGACGACAATAGCT	1
CATACGAATCTAGATATACTTATG	2
CATACGAGCCTATCTACTGAT	1
CATACGCAAGTAGACTACGTAAAC	2
CATACGCAGTGTTGCACTTAGAGG	1
CATACGCGTGGATGTGTTGTGGA	1
CATACGGGATGACCTTGTGGATTG	2
CATACGGGCCTATTAAGAGAGCCG	1
CATACGGGCCTCTTAAGAGGGTCA	1
CATACGTCGCCGGTGTCATGGAGG	1
CATACGTCTATGACACGTGGGTTC	1
CATACGTGGGCCTGTATTTGTTACG	1
CATACGTGTAAGTGACCACGTGTG	1
CATACTAAACTCCTACAGCAACGC	2
CATACTACAGTAGCAGTGGTC	2
CATACTAGTGGTGTGGTGGTATA	1
CATACTATAAACGATATTGAGTGG	1
CATACTGACTATGACCTATATGAA	1
CATACTGCAGCTGGCTACAGATATG	2
CATACTGGCTGGTGCATTGTGTGG	1
CATACTGGGGTGCGGTTTTTAGGA	1
CATACTGGTTCCACAATGTTAGGA	1
CATACTTGCATCCATGTAGGTGAC	1
CATAGAAAAGCGGGAGGTGTGT	1
CATAGAAATTTTGGTGGGATTGGA	1
CATAGAAGAAAACAGACCCGGTGA	1
CATAGAATTGGATGATGAGGCGGA	1
CATAGACACCAAACCCTCCAC	1
CATAGACACGGTGTCTTTGAAGG	1
CATAGACACTGCTTATGAGCACTA	1
CATAGACACTGCTTATGGGTACTA	1
CATAGACACTGCTTATGGGTACTATG	2
CATAGACCCACATGTAAGAGGCGC	1
CATAGACGTGTGACAAAGTTAGTG	1
CATAGACTAGTCGGAGGAGGCTGC	1
CATAGACTGCCCTCACAGACCAAA	1
CATAGAGAATATGTGCCTCATGAC	1
CATAGAGACCTACTAGACTAGTAC	2
CATAGAGATAAAGGTGTGTGTGCA	1
CATAGAGATGGACCACGAATGGCT	1
CATAGAGGTGAGTGCACGCGCGTT	1
CATAGAGGTTCTGGACTTACAATC	1
CATAGATAAGTATAGTGGTAGC	1
CATAGATCGGTGACACACTATAGC	1
CATAGATCTAGGGTCAATGGAGT	1
CATAGATGCGCTCTCCTTGGTCAC	3
CATAGATGCTAGCCTTGATAC	1
CATAGATTGCAAGGGTGCATAGAT	1
CATAGATTGTATCTGTGCGGCTAGC	1
CATAGCATACATATATGGGGTTGG	1
CATAGCATAGAGTGTGGGCCACGC	1
CATAGCATTGTGGGTATGGCT	1
CATAGCCCTTAAAGCCAAATGACC	1
CATAGCCTGCCATTGTGATATATC	1
CATAGCTAAGGGTGGTGCAGCGT	1
CATAGCTAGTTATGTGGTACCTTC	1
CATAGCTCCAATGGTGCTGTTGCC	4
CATAGCTGGTCGAAAACCAGGTGT	1
CATAGCTTGCACTATGAGAGGCCT	1
CATAGGAACCTATTGTTATACGAC	2
CATAGGAACGTCTTCGTTTGGACC	7
CATAGGAATGACTATTTGATTGGG	1
CATAGGAATGGCCGTTTGATTGGA	2
CATAGGAATGTATGTGCAAAACT	1
CATAGGACAAACCTTGGGTTTCC	1
CATAGGACTAAATAGTGAAGTGGA	3
CATAGGACTAAATAGTGAGGTGGA	1
CATAGGACTAAATGATAAGGTGGA	3
CATAGGATGTGTGTGGTCCGG	1
CATAGGATTGAGTGATGAGGTGGA	2
CATAGGCGTCTAGTTGTTGATGG	1
CATAGGCTCATAGTCAGTTGGTGT	1
CATAGGGACGAATTGAATAGTGAC	1
CATAGGGATAAACTATTTATGTGG	1
CATAGGGCAGAAGGTGTTTTA	1
CATAGGGGTAGGATGTGTGTGTA	2
CATAGGGGTGAGTGAACGTGTGTT	1
CATAGGTCAGACCGGTAGGACGGA	1
CATAGGTCATAGACTCCTCACAGG	4
CATAGGTCATATGTACAGTTGGGC	1
CATAGGTGACTAACTCTGGTGTAG	2
CATAGGTGATGTCACTTGTGATGG	3
CATAGGTGATGTGCTTATTTTGGG	1
CATAGGTGCCGGTTCTAAATCTGA	1
CATAGGTGCCGGTTTTCCTAACCA	1
CATAGGTGCTAAATTTGGGTGTA	1
CATAGGTGCTAAGTTTCGGTTGGG	1
CATAGGTGGTACGCAAACTTGTT	1
CATAGGTGGTATGCTAAGAGGTTC	1
CATAGGTGTCTCGCTGTCAACGGG	1
CATAGGTTGCTATATTATGGGACA	1
CATAGTACTGATGGGAGTTCCTC	1
CATAGTAGTGGTTGCCAAGAC	2
CATAGTATGTGTATGACAGGTGAG	1
CATAGTCAGTGCTCCTTACCACG	3
CATAGTCTATATGATACTGGTACA	1
CATAGTGTATATGACAGGTGGGAC	1
CATAGTGTATATGACAGGTGGGACC	2
CATAGTGTCCATAAGTAGTGTCT	1
CATAGTGTCTACGGTTGCCACCC	1
CATAGTGTCTATAAGTAATGCCTA	2
CATATAAATGGGACCTATGTATAG	1
CATATAAATGTGGGCAATGCTAGA	1
CATATACAAAATTAGGTGCAATAG	1
CATATACGAAATATGGAAAGTTGC	1
CATATAGAGAGCGAAGATGGTCAC	1
CATATAGATCATGGATATTAGCCA	1
CATATAGATGAGCCTGCTGCCTGC	1
CATATAGATGTGTGTGGAGATGG	1
CATATAGTAGCCACATGCCATTAA	1
CATATATAAGTTGGTGTCGTGCCC	1
CATATATAGTTAGAAGGAGGGCTA	1
CATATATAGTTGAGGGACCTTGGG	5
CATATATATGATGTGACATGCCAA	2
CATATATGGAGCATTAAATGTGG	1
CATATATGGTGCTCCTATGGTGGG	1
CATATATGTGCATGTATGGCAAAG	1
CATATATGTGCCTAGATTCATTAG	1
CATATATTATATGGGGTGTCGCAT	1
CATATATTGAGATTGTCAAAGT	1
CATATATTTGGAAAAAAAATGCCT	1
CATATCATGACGGTAAAAGGTGTG	1
CATATCCTAATACTACGAATCTG	1
CATATCGGTGCATACGAGGATGAC	1
CATATCTAAGCTAGTTGTGTCCT	1
CATATCTCCAAGGCGACCAACAAC	1
CATATCTGTGGAGATTATGGGTAC	1
CATATCTTTTGTTCATGGTAC	1
CATATGAGGCGTGTCTCTGTGACG	1
CATATGAGTAAGATGTGCGTGTGT	1
CATATGATAGCAATAGGTGATGGT	1
CATATGATAGGCCAAAGTCGC	3
CATATGATTGAACTGTGTGCG	1
CATATGATTGCGAATTGGTGGTAT	1
CATATGATTTGGTGGTCGAGGTGA	1
CATATGCAATCTGCAGCGTCACCT	1
CATATGCGGTGGCATGTACGGTGG	2
CATATGGAGTATGATGGGGTA	3
CATATGGCATATATGTGGTGATGT	1
CATATGGCTTGGATGTGGATGG	1
CATATGGGCCCGTACGATGATTGA	1
CATATGGGCCGACTTGTCAGACA	1
CATATGGGCTGCCTATAGAGGATA	2
CATATGGGTCTAGTGGCAAATCA	1
CATATGGGTCTGGATCTATACGTC	1
CATATGGTCTTACGCAATGCGAAT	1
CATATGGTGATGCGTTCTTTTGG	1
CATATGGTGGGACTGAGCAGCAGC	1
CATATGGTGTGCTGTGTCGGTTAA	1
CATATGTATGTGTCTAGATTCATT	1
CATATGTCATAGACACGGTGTGGC	1
CATATGTCCTCATGGAGATGGTA	1
CATATGTCTATGATATGTGGGTCC	4
CATATGTGATGATGGTTTTGCTGT	1
CATATGTGCACTAGTTTACAACAG	1
CATATGTGTAGATGGGAGGGGGG	1
CATATGTGTCATAACATTTGGGCC	3
CATATGTGTCTTGATGGGTTTCGC	1
CATATGTTATAGACAACAAGTGGC	2
CATATGTTATAGACACGGTGTGAC	1
CATATGTTATTGAGATAGAGGTGG	1
CATATGTTGGGCCCTATGGTTGAG	2
CATATGTTTATGGGTGACTTTTGC	1
CATATTAAGAGGCCCGTCTACGAA	1
CATATTCAAACCGGGACTACTGTG	1
CATATTCATATATGTCGGTGATAA	1
CATATTCGAAATGCCAGATCA	1
CATATTCGGGAAATTGAAGATGGT	1
CATATTCTAATACAACGAGGTTGAC	1
CATATTGAGAGCGTTTTGAGGAAG	1
CATATTGATGTGATGGAAAATGA	1
CATATTGGTGCCGTCCGCGATGAC	1
CATATTGTCCGTGCCATGCTC	2
CATATTGTTGTGTGCTAATGTGAG	1
CATATTTATATGGGTGTCAATGAA	4
CATATTTATATGGGTGTCAATGAT	2
CATATTTGCAGGGATATGGTGGT	1
CATATTTGCAGGGATATGGTGGTC	1
CATATTTTAGTACTACGAATCTGG	1
CATCAAACGATGCCACTATACTCC	1
CATCAAACGATTGAACATGTGCAT	1
CATCAAAGGTGATGACATGGGCC	1
CATCAAAGGTGATGTTTGGTTGGA	2
CATCAAAGTGAACAGGTCCGGTCC	1
CATCAAATAGGTGTCGCCACTAC	1
CATCAAATAGGTGTTGGCACTATA	1
CATCAAATCTGCTTCCATGGCAAT	1
CATCAACAGATGGCTGGTGGTGGT	1
CATCAACAGGTACACCGAAGGATG	1
CATCAACGATTGGCCTACACTTAA	1
CATCAACTTGACAGGTGGGTGCAA	1
CATCAACTTGACAGGTGGGTGTAA	1
CATCAACTTGGTAGGTGGGTGTA	1
CATCAAGTGTTAGGATGGATGTA	1
CATCAATAGAGATGGGCGCGC	2
CATCAATATGAATGTAGGAAATGC	1
CATCAATATGAATGTGGAAAATAC	1
CATCAATGTGGACCGTCGGATGAA	1
CATCAATTACCGATGTGGGACTA	1
CATCAATTCGGTCATAGATAGTGA	1
CATCAATTGGGCCTGCGACGATG	2
CATCAATTTAAGTGAAAATCGATG	1
CATCACAACCCACAGATTGGTGAC	1
CATCACAATAGAAACTACACTCTA	1
CATCACACCTTTGTAGTTGT	2
CATCACACGAAATTAATAGGATGC	1
CATCACACTCTAGGTGGAGTCCTG	1
CATCACAGATGCACCGACTGAGAT	1
CATCACAGGTGAGGTTGATGTGAT	2
CATCACATCAACCTGCCATACACA	1
CATCACATCTGGTCTTAGGTTGC	1
CATCACCAATCTAACAGCTAC	1
CATCACCACATATATGCCATATGA	1
CATCACCGCCTAGAACCCAGCCGC	1
CATCACCTACAATGGGTCTATGG	2
CATCACCTGATGGTCCTGATGTGT	1
CATCACCTTTGATGATTTGATGGA	1
CATCACGAATCTGCGAGATGC	4
CATCACGTCGATGGCGTGGCGGAC	1
CATCACTAAACATGGAAGGTGGAA	2
CATCACTAAACGTGACCGGTTGCA	1
CATCACTCTTGAGGCCATAGGTGA	1
CATCACTGCAGGGTCTACTATGTA	3
CATCACTGGTGTGCCGTCACAGA	2
CATCACTTCCTCGAAATGCTG	1
CATCAGAAAAGGAGCGGTGGTGGG	1
CATCAGAAATTGGCATGAGCA	1
CATCAGAGAAAATTTCAGGAT	1
CATCAGATGTTAGACCGGATGTC	2
CATCAGATTGGTGTTGCAAAGTAG	1
CATCAGCCAAACTGTTGTGGCAGC	1
CATCAGCCCTGCGATCAACTG	1
CATCAGCCTCAAAGAGTGGTA	2
CATCAGCCTGTGCCCCTGACCGAG	1
CATCAGCTGCTATAGTCCTGA	1
CATCAGGAATAGGAGGGGCGTGT	1
CATCAGGCCGTGTCTACATCTCAA	1
CATCAGGGTTAGCGCTGAGGTCAC	1
CATCAGGTTTGTCTACATTGATGG	1
CATCAGTACACAGTCCTTCAA	1
CATCAGTGGACTAGATGGTGTTAC	1
CATCATAAAAGTGGTGCAGGGTTC	1
CATCATAGGCTGCCCGAAGATGAG	1
CATCATATAACGGTGTTGTGTGGC	1
CATCATATGCAGAAATCTCGAGG	2
CATCATCAATTACCAAGGTGA	1
CATCATCCAACGGGACGGCGCCA	1
CATCATCGATTCTTGATGC	1
CATCATGAGAATATTAAGGGCCTA	1
CATCATGATCGATGCACACAAAT	1
CATCATGCCTCGGGGTGTGAGGTC	1
CATCATGGTAAGGTGGTCGTGT	1
CATCATGTGATTGGGTGGTATTAG	1
CATCCAAACTCATGTGCTAGATGG	1
CATCCAACCATGGAGCAACGATAA	1
CATCCAACTACCATTCGGGACC	1
CATCCAAGAATTCAGTCACAA	1
CATCCAAGACGAGGTTGGTGGGGTA	1
CATCCAAGGACACGAAGCTATGGA	1
CATCCAAGGACTAGGATGGGTCTC	2
CATCCAATACGCACTGCCTTCACG	1
CATCCAATGTGGCATTGACGTGGC	1
CATCCACATCTCAATCAGGCGGCA	1
CATCCACTTTTAGGTCTCGTGCGC	5
CATCCAGTATGGGTGTTGGGAAAC	1
CATCCATATAAATACATGATGGCC	1
CATCCATATAAGACACAGCCCAAA	1
CATCCATCATTTGTTGATCGA	1
CATCCATCGGTCATATCAAGTAGC	3
CATCCATGGTGTTTTCTGGAA	1
CATCCATTACATTTCTGCTGC	1
CATCCCAAGTCAGCCCTCTCTCCCT	1
CATCCCAATAGGGGTGCCCTGAGC	1
CATCCCACAACTGTGATGTTC	2
CATCCCACGTGGCATTGACGTGAC	1
CATCCCCGACACTTGAGGTGCCAC	1
CATCCCTAGTGCAGAGTGGAGACA	1
CATCCGAAGATCGTGTATTTGCTC	1
CATCCGATCAACGTCCGATGTGAC	1
CATCCGATGCAGGGTTTGGCTGGA	1
CATCCGATGGGAGCCTTATACAGC	1
CATCCGATGTGATAGGAACTTAAA	2
CATCCGATTGGATGAAGAGGCTGG	1
CATCCGCCTCGCCCCGCAGAAGAA	1
CATCCGGACATGGTGCTTTATTAT	4
CATCCGGAGTTTGCGAGTCCTGAA	1
CATCCGGGTTAAACGTTCGATGTA	1
CATCCGGTCAAACGTATGATGTGAC	1
CATCCGGTCAAACGTTCGATGTGA	1
CATCCGGTGATGGATGGTCCT	9
CATCCGTGATGGCCGGATACCTGA	1
CATCCTAATACAACGATCTGGGTGG	2
CATCCTACCGCCGACGTCGCTGCC	2
CATCCTAGTACTACGAATCTGGA	1
CATCCTAGTACTATGAATTTGGA	2
CATCCTATATAAGGTGGGCAGGAG	4
CATCCTCGAGCCCTAGGGATGCCA	1
CATCCTCGTGGTGGTGGAGGAGGC	1
CATCCTCTGAAGGATCGGTGAT	1
CATCCTGACCCACATGTCATTGAC	1
CATCCTGGTGGGGCGATGAACGGT	1
CATCCTGTAGAGGTGGGAAATGGT	1
CATCCTTGGGTGACTATTGAA	4
CATCCTTGTGACTATGATTATGGA	1
CATCCTTTAGAAGGTACCGGGTGG	1
CATCGAAACGAAAAGAATGCC	1
CATCGAAACGAAAAGAATGCCT	1
CATCGAAATTATGGGTGTTTGGAG	1
CATCGAACCCCTTTTCACAACAGC	1
CATCGAACGTTTAGACACTTACATG	1
CATCGAACTGGAGTCAGTATCGGC	2
CATCGAAGCTGTGCGGTTGGTGGT	2
CATCGAAGGAGTCGATTTGCACCG	1
CATCGAAGGGCCTAATGTTACCGG	1
CATCGAAGTGATTTTAGTGGC	1
CATCGAATATTATATAGGGTGT	1
CATCGAATGGGCTAGGTACGCAGC	1
CATCGAATTGCATTCATGAGCTGC	1
CATCGACCACTACGAGCACGC	1
CATCGACGAAAAGTAGTTCGA	2
CATCGACGACATCCTGGTGTACTC	1
CATCGACGTCCGGTTAGCCTCCGA	1
CATCGACTTGAGGAAATCCTA	1
CATCGAGACAGAGGCATCGGC	2
CATCGAGGTGTAAGCATTCCA	2
CATCGAGTGGGCCGCGGTGATGAG	1
CATCGATATGAATATGGGAAATGC	1
CATCGATATTATATAGGGTGT	1
CATCGATCACGTCATCTACGACGA	1
CATCGATCGGGTACGGTGTCACAC	2
CATCGATTATTATATAGGTGTCG	1
CATCGCACGAAATTAATATGATGC	1
CATCGCCACATCAAAGCCTTGG	1
CATCGCCATGTAGATATGGGATA	1
CATCGCCCACACAGGAAAATCATT	1
CATCGCCCACGGTACATATTCAGA	1
CATCGCCGAGTTTGGCTACATCCG	2
CATCGCCGGTAGTGAGAGGAGGGT	1
CATCGCCTCGAGCGGATTGGGTTA	1
CATCGCGTCTTCGGTTGCCACCTC	1
CATCGCTACGATGAGGTGGAA	4
CATCGCTGCCGCCATGGACCAACT	4
CATCGCTTCCTAGGGTGGGGAC	1
CATCGGAGCGGAGAATGGTGATGA	1
CATCGGATATTACGTAGGGTGTC	1
CATCGGATATTACGTAGGGTGTCG	1
CATCGGCCACCTAGTGATGAATCT	1
CATCGGCTAATCTCAGGACGTCGA	1
CATCGGCTAGATCTGGGAGGTGGG	3
CATCGGGGTGCGGCAACATCGAGC	1
CATCGGGTACTTCATTTGGGA	1
CATCGGGTATTATATAGGGTGTC	1
CATCGGGTATTGCATCCTTGCTGC	1
CATCGGGTGTTATATAGGGTGTC	1
CATCGGGTTTGAGTTGGTGTGCT	1
CATCGGTAATTGATGATATGTGA	1
CATCGGTACACGAACTTGTGAGGT	1
CATCGGTATCTCAATGATATGTAG	1
CATCGGTGCTGGCACAGATTTGT	1
CATCGGTTTTAAGAGTTTAGGGGT	1
CATCGTACCTAAGTGGAGTAGGGT	1
CATCGTCCTTTGGATTTGATGGCC	1
CATCGTGGCTAAGACTTGTGATG	4
CATCGTGGTGGTGGTGTCCTCGAG	1
CATCGTTCTCGGTGTGAGGACCGA	1
CATCGTTGCTGTGTTGGCCAAAAA	1
CATCGTTGGATGTGTGATATGATG	2
CATCGTTGGTCTCATACTTACGTA	1
CATCGTTGGTGTGGCTTGCTGAGT	1
CATCGTTGTGTTGTTTTTCTT	2
CATCGTTGTTAGTTGTGTAGCGAT	1
CATCGTTTATGATATTGGTGTCGC	1
CATCTAAACGGACCTATATTGCA	1
CATCTAAATGAATGTGGGCAATGC	1
CATCTAAGTAAATGAAAGTGGGTC	1
CATCTAATCATGGACTAAAGATGC	1
CATCTACAAGGTGCAAGATGCTAA	1
CATCTACAAGGTGCAAGATGTTAA	1
CATCTACACGTAGAGGATGAC	1
CATCTACAGACTACTAATCATGTG	1
CATCTACGATTGGCGAAAGGGTAC	1
CATCTACTATATGATTGTGT	1
CATCTAGAACTGCCACGTTAGACC	1
CATCTAGATTGCTACATTATGGAA	2
CATCTAGCCTGACACAGATGAGA	1
CATCTATAATGAGGTGAACCGAAA	1
CATCTATACGGGAGACCGTTGGTC	1
CATCTATAGATGGGACATGAAGCT	2
CATCTATAGGGTGTAAGTGTGCA	1
CATCTATATGAATTTGGACGATGC	1
CATCTATATTTAATTCTCCATGCA	1
CATCTATGGTGAATGGGTTGATGC	1
CATCTATTAGGTGACGGGGATGGT	2
CATCTCACTTGTGCCTCCTTTCGT	1
CATCTCAGGAGAGTAAAACCT	1
CATCTCATGAAATTAATAGGATGC	3
CATCTCATGGGTGAATCGGAAGGT	1
CATCTCCTGGCTCTTTATTGGCTC	1
CATCTCGCTGGCGCCTGGAATCCC	1
CATCTCGGTGTACGCTGACGATGC	1
CATCTCTTGATGACCAAACTG	2
CATCTGAAAGAAAAGTATGTGCCA	1
CATCTGAACAAGTTGGAGGACCT	1
CATCTGAAGCGAGATCGAAGCTAC	1
CATCTGAAGGGCCAAGATGAGGGG	2
CATCTGAGGATATGCCTGCCTTTT	1
CATCTGAGTATGTGCGTGGACCA	1
CATCTGAGTGAATGAAAGTGGGAC	1
CATCTGATAGAGAACCTACTTCAG	1
CATCTGATCAACCTGACAACGAG	1
CATCTGATGTGATATTGACGTGGC	2
CATCTGATGTTGTCTACTATGCAT	1
CATCTGCTTGATTTGGGCGAA	1
CATCTGGGTCCCACGCTGAGTCAGC	1
CATCTGGTATTAAAGTTGATGGAA	1
CATCTGGTGTGACATGGACTTGG	1
CATCTGGTTGAAGGGTAGAAACAC	1
CATCTGTCCTAGTGTGAGATG	2
CATCTGTGATGGGCGCTAGTTGTG	2
CATCTGTGCCTGGTATATACTGTG	1
CATCTGTTAAAGCAGTGTGCGCAT	1
CATCTGTTTAAGTATGGTGACCTCA	1
CATCTGTTTTCAGGTTGGGTC	2
CATCTTAGAGGGAACTGTTTG	1
CATCTTCGGGATGTATGTTGA	5
CATCTTCTCCGAGGTTGGCCG	1
CATCTTGAGTGCACGGTTTGTGGA	1
CATCTTGCAGGTGGAATGATGG	1
CATCTTGGGGCTTGTACTTGGATG	1
CATCTTGGTGTATGTGAGAATGAA	1
CATCTTGTGTTGTGGTGGAATCGG	1
CATCTTTTGCAAGGGTGGGTTCCA	1
CATGAAAACCCAGGGTTTGTCTTT	3
CATGAAAAGAGTGCTTGTGGTGTA	1
CATGAAAAGTATTTTATGTGTGAC	1
CATGAAACCTACACTTGTCGATAG	1
CATGAAAGAGTGCGCAAATTTGGA	2
CATGAAAGCCAGATGGAAGAACACT	1
CATGAAAGTGAGGATCTTGAA	1
CATGAAAGTTGTGTGTGCATGTTTG	2
CATGAAATTAATAGGATGCCA	1
CATGAACAGAGTTGGGTGGAACGC	1
CATGAACCAAATGGTCCTATGC	1
CATGAACTGATCATGATGCCT	1
CATGAACTTATCATGTGGGTGCAA	1
CATGAACTTGTCAGGTGAGTGCAA	1
CATGAAGAGGAAAACATGAGGTGA	4
CATGAAGATATGTCTACATGGGTGT	2
CATGAAGCTTATGGTTCACGA	2
CATGAAGTAGTACCACTATTGTG	3
CATGAAGTATTAAATATGGGCTAA	1
CATGAATAAATTGGTTCCTGGC	2
CATGAATAATATTTTGTGTGTGAC	3
CATGAATAGTATTTTATGTGTGAC	2
CATGAATATTGCCTCTGCTCGGC	1
CATGAATCCCTCGTAGGGCGGCGC	1
CATGAATGGTACTTATGTATGACT	1
CATGAATGTGTGTCCTAATTGTAC	4
CATGAATTGTGTGATGTGTAG	2
CATGAATTTGGAGCCTTCGTATA	1
CATGAATTTGTCAGGTGGGTGT	2
CATGAATTTGTCAGGTGGGTGTA	1
CATGAATTTGTCAGGTGGGTGTAA	1
CATGACACGGCTGATGGACGCTAC	1
CATGACACTGATAGATGATTGCA	1
CATGACAGAATAGCGGGGTGGTT	1
CATGACAGGTTGATGTGATGGAA	1
CATGACATGGTACGGAAGGTGGTA	2
CATGACATGTTTCATGAGTCA	1
CATGACATTGCAGATGTAAACTA	1
CATGACATTGTTATGGCCGACGTG	1
CATGACCTGATTGATTGCCAA	29
CATGACGAAAAACGGTGGTGGAAG	1
CATGACGGAGTGCCACGTTTACAA	1
CATGACGTACGTGTCGAATGGTC	1
CATGAGACATCATGTTAGGCTAGC	1
CATGAGAGAAGGTGGCCCAGCGA	1
CATGAGATGATTGATACCCTT	1
CATGAGCAGTGAGAAGAGATGGA	1
CATGAGCGGAGCCAACATGTAGAT	1
CATGAGGACTGGTCCAGATAGGGT	1
CATGAGGCGCATGCCACCGGTCCT	1
CATGAGGGCCCACATATTGTAGA	1
CATGAGGGCCCACTGGACAGTGAC	1
CATGAGGGCCTAGATATGATAGA	1
CATGAGGGCCTTTGGTTAACCTGC	1
CATGAGGTAGCCGTTTCTCAT	1
CATGAGGTATACTTCTGGGAA	1
CATGAGGTGTTGGGTTCAGTCCCA	3
CATGAGGTTGCAGTGATAAGGAAT	1
CATGAGTAAATTGGTTCCCGGTCC	1
CATGAGTAAGGACAAAGTGTGCA	2
CATGAGTAGAGCCTATATGTAGT	1
CATGAGTCAATGACATGTGGGTC	4
CATGAGTCAATGACATGTGGGTCA	1
CATGAGTGCCTCACTGTCGATGG	1
CATGAGTGTCTTGACGTTTTC	3
CATGAGTTTTGTAGGTGTAGGGG	1
CATGAGTTTTTCCTGTGTGCTA	1
CATGATACAATTACAAGGCCCAAA	1
CATGATACCCCGATATAGCATG	1
CATGATACCTCGCGAGTATCACGC	1
CATGATAGGTCCTAGGAATGCGG	1
CATGATAGGTTGTCGTATGGAACT	1
CATGATAGTGGTGATGAGTGATG	3
CATGATAGTGTGTATATCTGC	1
CATGATCAGTTCATGAGGCCTA	1
CATGATGAGGAAACCTTACGTTT	1
CATGATGCCGCTGAATTGAGTATA	1
CATGATGCCTGCCTCTGTGCCACT	2
CATGATGGCCTCCGGTGATGATG	1
CATGATGGCGATGGCATGGTTCCA	1
CATGATGGGTGTGGTTTTAATTA	1
CATGATGGTCAGGATGTTGGCG	1
CATGATGTCTTGGATGTGGTGTAG	1
CATGATGTCTTGGATGTTGTGTAG	2
CATGATGTGACTAGTTGTGTGT	2
CATGATGTGCATAAGTAGTGTCTA	1
CATGATTAAATTGTGCATCAG	4
CATGATTATGCCTTTTTCTGT	1
CATGATTGACTGGTTACTCGA	2
CATGATTGATAAGATAGGAGGTGCT	1
CATGATTGCGTGCTAATATTTT	1
CATGATTGGTGATACATTGGTGAT	1
CATGATTTAATAATATGGTGGTAC	1
CATGATTTCCTTCAGTCGGGTGTA	1
CATGATTTGACAATGTGGTGATA	1
CATGATTTGACAATGTGGTGCTGC	1
CATGATTTGAGGTTTCGTCCA	1
CATGATTTGATAATACGGTGCTAC	1
CATGATTTGATAATAGGGTGCTAC	1
CATGATTTGATAATATGGTGCTAC	1
CATGATTTGATAATATGGTGTTA	1
CATGATTTGATAATGTAGTGCTAC	1
CATGATTTGGCAATGTGGTGCTA	1
CATGATTTTAGCCTACGTGACTGC	1
CATGCAAACTGAGTGCTATAA	5
CATGCAAACTTGGTGTCATGA	1
CATGCAAAGTTGATGGATGTGTGT	1
CATGCAAATGATAGGTGCTATGGC	1
CATGCAACTGAGAGGTGATGGCAT	1
CATGCAATGGATTGATTGGGAG	1
CATGCAATTGTATGGTTTTCGGGC	1
CATGCAATTTTCTTCCGGTCA	2
CATGCACATGGTGCTGTGGGACGC	1
CATGCAGCAACAGGGGCATGCAAA	1
CATGCAGTTGGTGCGTGGGTTACG	2
CATGCAGTTGTGTACCGAGCC	1
CATGCATAATTGTGGGCTAGTGAT	1
CATGCATAGGGCATGGGATGC	1
CATGCATCCACGACTCCACCACC	1
CATGCATGAAATTGGATGTGG	2
CATGCATGAGGGCAGCAGGTGGAA	3
CATGCATGGGGCATTAAATGTTG	2
CATGCATGGTGCAAAAGGTACGAA	1
CATGCATGTGTCCAAACATTTGA	1
CATGCATGTGTCCAAACATTTGAT	1
CATGCATTATATTTATTAGGATG	1
CATGCCAAACCCCAGCCTGAACGG	1
CATGCCAAAGCGTACATGAATGG	1
CATGCCAAAGGTGATTGAGGAGTC	2
CATGCCAACTATTGGTGACGTGAC	1
CATGCCAAGCATGGATGGAGTACT	1
CATGCCAAGTGTGGAATGCATCAA	1
CATGCCACACGGATATGATATGGC	1
CATGCCACATCAGCGCCACGAAGG	1
CATGCCACATGGACATGATGGGTC	1
CATGCCACGTAAGCGCCACATAGG	1
CATGCCACGTTGATGGGTCTGGAG	1
CATGCCAGCAGTGGTGGCGTGAGA	1
CATGCCATAGGGTTTGGATGCTGG	1
CATGCCATCATGTATGCATAA	1
CATGCCATCGTGACTTATGTCATT	1
CATGCCATGTAGTTCTGCCAA	1
CATGCCATGTGGGTATGGGGTACC	1
CATGCCCATATGGGTACAGGCATG	2
CATGCCCATATTAGTCACGCCCCA	1
CATGCCCATGACAGTGAGCACGAT	1
CATGCCCTTTTGTGCTTGATTGCC	2
CATGCCGATGTAGTATGGGTCAGA	4
CATGCCGCCGGATCTGGTGGAGGC	1
CATGCCGCTTGCAGATTGGTGGAT	1
CATGCCGTAAAGGGGGTGGTA	1
CATGCCGTATGGATATGGGGTAC	2
CATGCCGTATGGGTATGAGGTACC	1
CATGCCGTATGGGTATGGGGTAC	1
CATGCCGTGTAGGTATGGGGTAC	1
CATGCCGTGTCGTATGAAGATGGT	1
CATGCCGTGTGGGTATGGGGTAC	5
CATGCCGTGTGGGTATGGGGTATC	1
CATGCCGTGTGGGTATGGGTAC	1
CATGCCGTGTGGGTATGGGTACC	2
CATGCCTAAGAGATGTATGCTA	1
CATGCCTAGGCATATGGAGAA	1
CATGCCTATATGACAAAAGACGAC	1
CATGCCTGACTTTTGAAGCAT	2
CATGCCTGATGGTTAAGCGTTGAA	1
CATGCCTGGAGCTGCCTAGTATG	1
CATGCCTGGGATATAGGTGTAGGC	1
CATGCCTGGGCCGTGTATGCAACC	1
CATGCCTTATATTATGAGATGAA	1
CATGCCTTATGGGTATGGGGTACC	1
CATGCGAAACATACCCTACAACAA	1
CATGCGATGTTGACAGCGCACGTG	1
CATGCGCAAGTACAAGGATTGGAA	1
CATGCGCGCAGTAGTAACGGTAGC	1
CATGCGCTAATGATGGAGTGTGA	1
CATGCGCTAATGGACTACTCTGTT	1
CATGCGGAAGCTATGCAGACCCAC	1
CATGCGGCTCGCATCGTGCCGA	1
CATGCGGTAAGCGTGCTACCCAAA	1
CATGCGTAGGTATGTCTTGGTGGA	1
CATGCGTAGTCATGGGAGTGCA	1
CATGCGTAGTCATGGGAGTGCAA	1
CATGCGTGCATATACTGTGTGGGT	1
CATGCGTGCCCACCCATGTTCGAA	1
CATGCGTGGAGCATTAAATGTGGG	1
CATGCTAACTTGAGATGATCGGG	1
CATGCTAATAAGAGCGGTATGGTC	1
CATGCTAGAGCTTAGATGGGATC	1
CATGCTAGCTAGGGTGTCATGGTC	1
CATGCTAGGAATGGGTGAACGTC	1
CATGCTAGTCTAAGAGGGTGCTGT	1
CATGCTATTTAGCGCTGAGGTGTC	1
CATGCTCTACAATATGGATGGGAA	1
CATGCTCTTAACCACAGTGTT	1
CATGCTGAGCAACGGGGGTGGCA	1
CATGCTGAGTGGCAGATTGGCCT	1
CATGCTGGTGTCCTCCTTGTGCGA	1
CATGCTGTGTATTGGGTGGGTGGT	2
CATGCTGTGTGGGTATGTGGTACC	2
CATGCTTACACTTTGATGATGACA	1
CATGCTTCAAGTGGCTAGGAGGGC	1
CATGCTTCGAGAGGTGCCTGGATA	1
CATGCTTCTGTTCATGGTGTTG	1
CATGCTTGGCCGGACGATGACAACC	1
CATGGAAAAATAGGGAACTGCCAT	1
CATGGAAACAAAATGGGGTGACG	1
CATGGAAACACTTCTTGGGGCATA	2
CATGGAAACCAGATAAGTGAA	1
CATGGAAACGACAAGGACTACTC	1
CATGGAAAGAATATGCATCTA	1
CATGGAACTCACGGAGCATG	1
CATGGAAGTGAAGTTTATTTTGGT	1
CATGGAAGTGTTGGTGCTAGTGGT	2
CATGGACAAACTCGATGTGGGCGA	1
CATGGACAAAGGCCGTAGATGTAA	1
CATGGACAACTTCCTGCACAG	1
CATGGACAGCCATGATGGAGAGGC	1
CATGGACCGGCCTAGTGAAATGAC	1
CATGGACCTACCCCTCACTCACCA	2
CATGGACGCCATGCAAACACAGGA	1
CATGGACGGGGCACACAACATGAG	1
CATGGACTATGATCATACAAGTGG	2
CATGGAGATGCCGCAAAATGTTAG	1
CATGGAGCATTAAATGTGGACGAA	1
CATGGAGCTAACTACATCGTT	4
CATGGAGCTAACTATACCGTT	1
CATGGAGCTGACATATAATCTC	1
CATGGAGGAGCAGAAGTCTAGTGC	1
CATGGAGGCACCGGTGGAGAGACC	3
CATGGAGGCTATTTGAGTTGC	2
CATGGAGTAAGGGGCGGATTCAAC	1
CATGGAGTCTAATATGTGGGCCTC	1
CATGGATACTCCTACAAGATGGAA	1
CATGGATAGGGTGAGACCATGGA	1
CATGGATATTAACAAAGTAGGTAC	1
CATGGATGAAATGTTATTGGT	2
CATGGATGACAAGTGATGATGT	2
CATGGATGCATATGATTTTACAAA	2
CATGGATGCCTAGGTGTTCTGCCG	2
CATGGATGCCTCTCAAAAACTAGT	1
CATGGATGCTGACAAAGGTGTGGC	1
CATGGATGGACAACAAGATATCAA	1
CATGGATGGATCTGCTAGACTTGG	1
CATGGATGGCCAGCAGGAGGAGCA	2
CATGGATTGCCTAATGCCATACA	1
CATGGCAAGTGCACTCACACAAGT	2
CATGGCAATATGAGGATAGGTCGC	1
CATGGCAGCAAGTAGCAACAT	1
CATGGCAGTCCTACCGATGGCGAC	3
CATGGCCACAATTCTGCCGTG	1
CATGGCCACTGAGCTTGACCTTGA	1
CATGGCCTTACACACTCTTTAGTA	1
CATGGCGAGAAATGATGATGCGGC	1
CATGGCGCTGAATGTACGTTGGC	1
CATGGCGCTTACGTGGCAATTCGA	1
CATGGCGGAGCAAGCGGTGATGG	3
CATGGCTAAAAAGTCAACGGTGTC	1
CATGGCTACGTGATATACGGTGAC	2
CATGGCTAGTCCCCTACGGTGTC	2
CATGGCTCCAATGAGTGTTTG	1
CATGGCTCGGCTTACAACTGGATC	3
CATGGCTGACGGTGCTGTAGTTAA	1
CATGGCTGCACTTAAAATGGGATG	1
CATGGCTTGGGTGTTACGTTTCCT	1
CATGGCTTGTCCCATACGGTGTCT	2
CATGGCTTTGTGCCTCTGTGTGAT	1
CATGGGAACGAACTACGAAGACAG	1
CATGGGAGGAGACACATCGGTGGC	2
CATGGGATGGCATACATGTGGAGT	1
CATGGGATGGCATGCATGTGGAGT	1
CATGGGCAACAGTGCTGCTGATGG	1
CATGGGCACATGATGACGCGGTGA	3
CATGGGCACTGCATCGTGGTTGTG	1
CATGGGCGTCTCGATGTCGATGG	1
CATGGGCGTCTTGCTGACAATGG	1
CATGGGCTGATCCAAACAGGTGGG	1
CATGGGCTTCCGATGGGTTGGG	1
CATGGGGAGGATATTACAATGTG	1
CATGGGGCATAATGTATACTGGA	1
CATGGGGTAGGCCTGCTCCAC	2
CATGGGGTGTAAGTATGGTGTTAC	2
CATGGGTAGGGATGGCAGTTTTGC	1
CATGGGTAGTAGGAAATGCAG	1
CATGGGTCTATTAATGGGTACTAC	1
CATGGGTGACCGTCTTTGGATGCC	1
CATGGGTGCATCATCAGACCAAAG	1
CATGGGTGCTAGGGGGACTTGAGT	2
CATGGGTGCTATCGCGCGTTGAAA	1
CATGGGTGGCCCATGGTTGATGG	1
CATGGGTGGTGTAAAGTTTTGGC	1
CATGGGTGGTGTGGGATCCGA	1
CATGGGTGTATAGCTGGTGATGG	1
CATGGGTGTGTACCTCTTTATGAG	8
CATGGGTGTGTACCTCTTTATGAGA	1
CATGGTAAGGTGGTTACGTACCG	1
CATGGTACACTCAGTTAATCATG	1
CATGGTACGCTATTTACGAAAGG	1
CATGGTACTGTAGCTCATAGCTG	1
CATGGTAGCTTCTCAAGGATAGA	5
CATGGTAGCTTGTTTTCACAG	7
CATGGTATACAAAGCGTATGATGG	1
CATGGTATACCTCAACGAATTTGA	2
CATGGTATATGGGTGTTTCTC	6
CATGGTATCCCTACAAACACCC	1
CATGGTCACCGACGTATGGGCCGG	1
CATGGTCCCTCAAAAACCGGCGG	2
CATGGTCCTAAGATGTGTCGCATC	1
CATGGTCCTTCGACTTCTACATG	1
CATGGTCGCACACATGGAGTCCCA	1
CATGGTCGCCAAGATGTTATTTT	2
CATGGTCGCCGCAAGGAAGAG	1
CATGGTCGCGACACTGAGGGTGGA	1
CATGGTCGCTGATATATGTGAGC	1
CATGGTCGTCTCGCTCCAACCGGG	2
CATGGTCTGGATAGAGTTCCA	5
CATGGTCTTCTACAAACGCTCCT	1
CATGGTGAAAAAATTGAAGGGGT	1
CATGGTGAAAATAGATCAGGTAT	1
CATGGTGAAAATAGATGAGGTAGA	1
CATGGTGAAATGGATGGAACCCT	1
CATGGTGAACCGGTTCGAGTCGGC	1
CATGGTGACATAGACGAATCTCAG	2
CATGGTGACATATTCGTGCAAAAG	1
CATGGTGACATGATGTGGGGCTGT	2
CATGGTGACATGATGTGGGGTTGT	1
CATGGTGACATGTACGAATCTCGG	1
CATGGTGACATGTTGTGGGGCTGT	2
CATGGTGACCATGAGTAGGTGTAG	1
CATGGTGACCCGCGTAGATTGCGC	1
CATGGTGACGCCTATGTGGCTCCT	1
CATGGTGACGTAGATGAATCTCAG	3
CATGGTGACGTGAATGAATCTCGG	3
CATGGTGACGTGGACGAATCTCGG	1
CATGGTGACTTCGATATGCTAGCTA	1
CATGGTGAGCTGAAATCCGGGGCC	1
CATGGTGAGTGGTGACTTCGTAAA	1
CATGGTGATAGGCTTCGACGCTGC	2
CATGGTGATATTACAAATGTAAGC	2
CATGGTGATCAGTAAATTGGTGAT	1
CATGGTGATGGTAAGCACTAGTGC	2
CATGGTGATGTGGACGAATATCGG	3
CATGGTGCACTGGTAGAGAAAGGG	2
CATGGTGCAGTAACGTTTGTTCAA	3
CATGGTGCAGTCTGAGAATACTTG	1
CATGGTGCATTTCTCTTTGCATGG	1
CATGGTGCGCATGGCTGGTGT	1
CATGGTGCGTAGATGATATGCAAG	1
CATGGTGCGTAGTATGCTAAGCCA	1
CATGGTGCTAGACCGATGATACCA	1
CATGGTGCTATAACATATGGATAA	1
CATGGTGCTCGGCAGTGTAAGAGC	1
CATGGTGCTGCTACAACATGTTGC	1
CATGGTGCTTAACTTCATAGCTAG	2
CATGGTGGAAATCTTGAGTGGTT	2
CATGGTGGAAGTGATGGATGGA	1
CATGGTGGACTCCGAGAAGGGAT	2
CATGGTGGATGAAGTGGCACAGAT	1
CATGGTGGCCCGCATAGATTGCGT	1
CATGGTGGCCCGCATAGATTGTA	2
CATGGTGGCCCGCGAAGATTGCGC	1
CATGGTGGCCCGCGTAAATTGCG	1
CATGGTGGCCCGCGTAAATTGCGC	1
CATGGTGGCCCGCGTAGATTGCGC	1
CATGGTGGCCCGTGCAAATTTCGC	1
CATGGTGGCCCGTGCAGATTGCG	1
CATGGTGGCCCGTGCAGATTGCGC	2
CATGGTGGCCTGTACAGATTGCGC	1
CATGGTGGCGAATGATTATCA	3
CATGGTGGTCCATACAAATTACGC	1
CATGGTGGTCCGCGCATATTGCAC	1
CATGGTGGTGGCAGAATGTAGCCA	2
CATGGTGGTGGTTGGTTGATATGC	1
CATGGTGGTTGGAACACGGGGCCA	1
CATGGTGTATACCCGTGAGTAGG	1
CATGGTGTATCTACAAGAGGCGAC	1
CATGGTGTATTGAATATAGGCTAA	1
CATGGTGTCACCGTAAGTACGAAG	1
CATGGTGTCACTTAGGTCTATGAT	1
CATGGTGTCATAATATATGGATAA	2
CATGGTGTCCGCGCTCATGGAGCC	1
CATGGTGTCTACACAATATCCAAG	1
CATGGTGTCTATAGATAGTGTCTA	2
CATGGTGTGAAGACAAAAACTGCA	1
CATGGTGTGACCAAATTGCTCCT	1
CATGGTGTGGCGCATTCAGTGCGG	1
CATGGTGTGGCGGAGGACGGTGAG	1
CATGGTGTGTTTTAGATTCTGAAA	1
CATGGTGTTAACGCCAAAATTTAG	1
CATGGTGTTATAACATATGGATAA	1
CATGGTGTTATAGCATGTGGATAA	1
CATGGTGTTATTGTATATGGATAA	1
CATGGTGTTCTAATAAATTAGGA	1
CATGGTGTTGTATAGGATGTTCG	1
CATGGTGTTGTATAGGATGTTCGG	2
CATGGTTAATAAGATAAGAGGTAC	1
CATGGTTACATTGTGGTGCTCCCC	1
CATGGTTAGGTTCCTTGTGGTGGA	1
CATGGTTGACCTCGTCAAAATGGT	1
CATGGTTGAGATATACGACTA	1
CATGGTTGATGGGTAGAGTGACTA	1
CATGGTTGCACTTAAAACAGGACG	1
CATGGTTGCATGTTGATATTTAGA	2
CATGGTTGCGTATTTAATAAGAAC	1
CATGGTTGTACACAACATTGTGGT	1
CATGGTTGTACTGTCCATAAGAG	1
CATGGTTGTTATGCATGATAATGC	1
CATGGTTTCTATCCTTTGGTGGTA	1
CATGGTTTGATGTTAATAGGATAT	2
CATGGTTTTTGAAGGTAGTCGT	1
CATGTAAAACGAAGGTGCTTG	1
CATGTAAACAAAATAGGGTGGC	1
CATGTAAACAAAATAGGGTGGCGT	2
CATGTAAACTGTGTAATTGGTGTT	1
CATGTAAAGGGGTGTCGTTTGAGA	1
CATGTAAATGATAGGTGACATGGC	1
CATGTAAATGATAGGTGCCGTGGC	1
CATGTAAATGATGGTAATTGATGC	1
CATGTAATTGACCTACCTGCC	2
CATGTACAAAACGAGATGATGCCC	1
CATGTACACCAACTAAAAATTATC	2
CATGTACATTGGTCAATGGGTGGA	2
CATGTAGAAAAGCATTCTTGA	1
CATGTAGAAAGGGGCTGTGGTGAA	1
CATGTAGATGTGTATGGAGATGG	1
CATGTAGATGTGTGTAGAGATGG	1
CATGTAGATTGCCAATGCCTAATG	3
CATGTAGCCAATCATGTGTGGAAA	1
CATGTAGCCAATCTTGTGTGAAAG	1
CATGTAGCCTAGTGGTTATAGTGA	2
CATGTAGGATGTCTTATGGGGTGT	1
CATGTAGGCTAAAACCGGGGTCAA	1
CATGTAGGTGAGCTTAAATATTGG	1
CATGTAGTCCTCGGACCCGGTGTA	1
CATGTAGTGGCTTCGGTTAGTGAG	1
CATGTATAACGTTTGACCGTCCGT	2
CATGTATACTAGCTAACTTAATAG	1
CATGTATAGAGCATTAAAGGTGGA	1
CATGTATGGGGCATTAAATATGAG	1
CATGTATGTGTCTAAAGATTCGA	1
CATGTATTGGTGTCGTGCAAT	1
CATGTCAAAAACAGAAAGGTGAAA	1
CATGTCAATGCCACGTGGGACGAA	1
CATGTCAATTAGATGGTTACGAAA	1
CATGTCAATTGGATGGTTACGA	1
CATGTCAGAGCTGCCAAACGGTTA	1
CATGTCAGGGAATTGACTAGTGGT	1
CATGTCATACACACATGTGGGTCC	1
CATGTCATAGACACATGTGGACCC	1
CATGTCATAGATACGTGAAAGCCT	1
CATGTCATAGGTATGTGATGGCCC	1
CATGTCATCGTCTACGTGGCGTGC	1
CATGTCATTGACAAGGTGTGGTAA	2
CATGTCATTGACAGGGTGTGGCA	2
CATGTCATTGACAGGGTGTGGCAA	4
CATGTCATTGACTCATGTGGGTTC	1
CATGTCATTGAGATACGGGTGG	1
CATGTCATTGAGATAGGGGTGGT	1
CATGTCCATAACCGAGGACGCGG	1
CATGTCCATCAGTTGTCTCTA	2
CATGTCCCTATTAACATATTCGAA	1
CATGTCCGATCTCTTGGTGGCGCC	3
CATGTCCGCCTGCGAAAATGAGAC	1
CATGTCGATGCATTTGGTGGGATA	1
CATGTCGATGGTCTGCCACTGAACT	2
CATGTCGCGCAGTGTAGCACATA	1
CATGTCGCGGAGGCCATATGATGC	2
CATGTCGGGCAACGAGTCGGTGTA	1
CATGTCGGTGTCTATAATAATAAT	2
CATGTCGTGCTATGAGTGTGTCT	1
CATGTCTAACATGTGGTGTGGCA	1
CATGTCTAGAAGTAACTGTGC	1
CATGTCTAGCGGCAAGCCGGTGAG	1
CATGTCTATGATATGTGGGTCCA	2
CATGTCTCGTACGAAGTTGGT	1
CATGTCTGTGCATTACAATGGGAT	1
CATGTCTTAGGAGGCTTACCACC	1
CATGTGAAAACGGAGATAATGGTA	1
CATGTGAAATAGGCCTATTATCGT	1
CATGTGAACAGTACCTCGTGCTAC	1
CATGTGAACCCAGAGATTATCAGG	1
CATGTGAACGCCACGTGGAACGAAGA	1
CATGTGAATTTTGGTGGGATGGG	1
CATGTGAGCATGATGGTTGGGGAC	1
CATGTGAGCCTCTGAATAATCCCA	1
CATGTGAGGGCACTATAGTTGTA	1
CATGTGAGTGTCTCAGTTGGCTGC	1
CATGTGATAGATAGGATGTGGCA	3
CATGTGATAGCATGACTGATAAGC	1
CATGTGATCTATGGAGGCGGC	4
CATGTGCAGCTGACATGTGGGCC	3
CATGTGCATTATTGCTGTGGTGGC	1
CATGTGCATTGCTGATTAGATGAT	2
CATGTGCCAATCTAGTAGTTTA	1
CATGTGCCCGTCTTCTCCACC	2
CATGTGCGCGGAAGAGCTGGAGAA	1
CATGTGCGTAATATTGGTGGACAC	3
CATGTGCGTCCTATCTATTCCGGG	1
CATGTGCGTTAGTACACTGGTGGA	1
CATGTGCTAAAAAGTCAACGGTGT	1
CATGTGCTAAAAAGTCAACGGTGTC	1
CATGTGCTAACTTGAAATATGGTA	1
CATGTGCTGCAGTGATGCTGTGAT	1
CATGTGCTGTGCAAGCTGCTTAAG	1
CATGTGGACCTTACCAATGTATGG	2
CATGTGGACTATTATATTAAAGAG	3
CATGTGGAGGAATTCTTCGTCACC	1
CATGTGGCAATGACGTGCCGCTGC	1
CATGTGGGAGGCAGTCCGGTACGG	1
CATGTGGGATCCACATCATGGTGAA	2
CATGTGGGCCCCACTTTGGTATGG	1
CATGTGGGCCCGACGATACATCGG	1
CATGTGGGCCTAGTGGCAAATCGT	3
CATGTGGGCGTTAGCGGGTGCTAA	1
CATGTGGGGTCGGTATCGTTTCGG	1
CATGTGGGTCCACATGTGTCTATG	1
CATGTGGGTCCATATGTGTCTATGA	1
CATGTGGGTCCTACATGTCATTAA	1
CATGTGGGTCTAGTGGCAAATTA	1
CATGTGGTTGACATATGGGGTCC	1
CATGTGTAACATGTGGTGTGGTA	1
CATGTGTAGAATTGGGGGTGTCAA	1
CATGTGTAGTCATGGTACTGCAAT	1
CATGTGTATAAACATTTGATGTGA	1
CATGTGTATATGATAGATGGGTC	1
CATGTGTATGACAGGTGGGACCA	1
CATGTGTCACGGCAATCGGGCTGC	4
CATGTGTCCAAACATTTGATCTGA	1
CATGTGTCCAAACATTTGATGAG	1
CATGTGTCCAAACATTTGATGTGA	1
CATGTGTCCATGACATGTAGGTCC	5
CATGTGTCCTATGCTAAGTTTGAG	1
CATGTGTCGATAACATGTGGGTCC	2
CATGTGTCTATAACATATGGGTCC	11
CATGTGTCTATAACATGTGGGCC	2
CATGTGTCTATAACATGTGGGTC	3
CATGTGTCTATAACATGTGGGTCC	45
CATGTGTCTATAACATGTGGTTAC	2
CATGTGTCTATACATGTGGTTCGA	1
CATGTGTCTATCACATATGGGTC	1
CATGTGTCTATCACATATGGGTCT	2
CATGTGTCTATGACATATGGGCCT	2
CATGTGTCTATGACATATGGGTAC	1
CATGTGTCTATGACATATGGGTCC	3
CATGTGTCTATGACATATGGGTCT	5
CATGTGTCTATGACATGTAGGTCC	2
CATGTGTCTATGACATGTGGGCC	4
CATGTGTCTATGACATGTGGGCCC	1
CATGTGTCTATGACATGTGGGCCT	22
CATGTGTCTATGACATGTGGGTA	1
CATGTGTCTATGACATGTGGGTAC	5
CATGTGTCTATGACATGTGGGTC	1
CATGTGTCTATGACATGTGGGTCC	20
CATGTGTCTATGACATGTGGGTCCA	1
CATGTGTCTATGACATGTGGGTCT	1
CATGTGTCTATGACATGTGGGTT	1
CATGTGTCTATGACATGTGGGTTC	3
CATGTGTCTATGACGTATGG	2
CATGTGTCTATGATATATGGGTCC	2
CATGTGTCTATGATATGTGGGTC	4
CATGTGTCTATGATATGTGGGTCC	4
CATGTGTCTATGATATGTGGGTCCA	1
CATGTGTCTATGATATGTGGGTCT	2
CATGTGTCTATGGCATGTGGGTCC	4
CATGTGTCTATGGTATGTGGGTC	1
CATGTGTCTATGGTATGTGGGTCC	10
CATGTGTGCCACAACATGCGCCTT	1
CATGTGTGCTCGCTTTCAAGCGG	1
CATGTGTGTAACGTGGGGTGTATT	1
CATGTGTGTACACGTGAGGGCCTA	1
CATGTGTGTATGACAGATGGGAC	1
CATGTGTGTATGACAGGTGGGAC	1
CATGTGTGTATGACTGGTGGGACC	1
CATGTGTGTATGATTGGTGGGACC	1
CATGTGTGTCAGCTCTTCTCCAGG	1
CATGTGTGTCCATAGCAAAGAGGG	1
CATGTGTGTCTGGACCCACGTTTC	1
CATGTGTGTTCATATGGGTGGGT	1
CATGTGTTAAGTGTAAAGGATGGC	1
CATGTGTTATTGATATATGGGTGT	2
CATGTGTTTATGACATCTGGGCCT	1
CATGTGTTTATGATATATGGGGT	1
CATGTGTTTATGATATGTGGGTC	1
CATGTGTTTATGATATGTGGGTCC	4
CATGTGTTTTTATTCCCGCAGGAT	1
CATGTTAAATGTGTGGTGGTC	5
CATGTTAAGAAGACCGCCTGCTGT	1
CATGTTAATGATGGAGTCTTCC	1
CATGTTACCATGTGCCTCAATACC	1
CATGTTAGAATTCCTCCAAAACAT	1
CATGTTAGATGGGCTCAAAACTTAG	1
CATGTTAGTGTGTAGTTTGTGGGA	1
CATGTTATAGACACGTGTGGACCC	1
CATGTTATAGATAGGGTGTGGCA	1
CATGTTATCTGGTGGATGTCACTG	1
CATGTTCCACTACAGAACGGTCA	2
CATGTTCCTTATGTGCTGCTC	1
CATGTTCTAAGACATTGTGTGCGT	2
CATGTTCTAGACCATTGATCA	1
CATGTTGATGCGATGAAAAAAAG	1
CATGTTGATGTGATGGAAAAGGA	2
CATGTTGATGTGATGGAAAAGGAC	3
CATGTTGATGTGATGGAAAATGAC	1
CATGTTGGATCTGCCCCTGCCTAA	1
CATGTTGGGGTACGGCGCCAGCCA	2
CATGTTGGGTGCTCCTTGGGTGGA	1
CATGTTGGTGAACATGTTGTTGG	2
CATGTTGGTTTTGAAGGAAATGAC	1
CATGTTGTCGTGCGCCGTGCTGTC	2
CATGTTGTGAGTGCCTGCGTTTAT	1
CATGTTGTGTTGATGTCATTTCTT	2
CATGTTGTTGGGATACTACGATGC	1
CATGTTTAAAAATGTCAACGGCGT	1
CATGTTTATATGGTGTCTCTCAGC	1
CATGTTTATGTTCCTACTGCC	1
CATGTTTGGATACTTGAGGGCC	1
CATGTTTTAGGTGATACTTGCGAG	1
CATGTTTTCGGTAATGTTGTTGGG	1
CATGTTTTGGTGCTTTTTGAACT	2
CATGTTTTGGTGCTTTTTGAACTT	1
CATGTTTTGGTGTGTTCTGGTGAA	1
CATGTTTTGTCCATGGTGTTC	3
CATGTTTTTGGTTGGTGTTTTGC	1
CATTAAAAAAATAATTAGCCGT	1
CATTAAAACAGGTTGTTTGAAGTG	1
CATTAAAAGAATAGGTGGTTGG	2
CATTAAACCATGGTGTACTCG	1
CATTAAAGCTTTAGGCTGCATCGC	1
CATTAAATGGTGTTTATGTGAGA	2
CATTAACGTTAATACGAATGTGAG	1
CATTAAGGTGAGGGGCTTCCCCA	2
CATTAATATCAAGATATGCCGGAC	1
CATTAATGAAGGTGGTCGTAGAAG	1
CATTAATGCCCGGTCCTACCTCTC	1
CATTACAGGTGGACTATTCTAGGG	1
CATTACAGTCACCGATATATGGGT	4
CATTACCTGTTATGCCTGCAATAG	1
CATTACGGGTGCTCTAAGCTTAAC	1
CATTAGATGCAAATCGGATGGTCC	1
CATTAGATGTATTGGGGTGTGAGA	1
CATTAGGATGACGTACAAATAATG	1
CATTAGTATGAGCGGTGTCAGGCG	1
CATTAGTGCATAAGCTATCTCTGC	1
CATTAGTGGAGAGGTGCGCAT	1
CATTATAATATGGGAAGAAGGGA	1
CATTATATAAAAAGATGCAGATGC	1
CATTATATGCAAGCATTGACGGTC	1
CATTATCTTTCTTTGGTTGAGTGG	1
CATTATGCAATGGAAAATGGAGTC	1
CATTATGCCTGCTACTTGATTTG	1
CATTATGCGAAAATGATATGGATG	1
CATTATGGATATACCTCTATGAGT	1
CATTATGGTAGAGGATGTGAACC	1
CATTATTATATGGTAGTGCCCCTC	2
CATTATTTGATGGGATATGTCGGG	1
CATTCAAAATAGTGTTTAGGGGGT	1
CATTCAAATGGTAGCGTACATGCG	1
CATTCAACGGTGCGGGATGAACAA	1
CATTCAAGAATTGAGGTACTG	1
CATTCAATATGACAGGGTGAAGAA	1
CATTCATGGTTGCTATTTCGTAG	1
CATTCATGTTGACTATGATGATGG	1
CATTCCAGCTAAGATGTTCTCTAA	1
CATTCCCTGTGAAAATCGATGCCT	2
CATTCCTCATATGGTGGGACTGAG	1
CATTCCTGCCTCGCCAGTGTGGAA	1
CATTCGACTGGTGGCGAGGGGAAG	1
CATTCGATCGGTTGGCATGTT	2
CATTCGATGGTGATGAACGTTGTT	1
CATTCGATGTGATGGGTAGGTGAA	1
CATTCGCGAGGGTGTGAAAATGGT	1
CATTCTAAACTGAGAGGTGTTTAC	1
CATTCTAGTACGAGATTTGCTCCG	1
CATTCTAGTTGGAGGGTTGGGACT	1
CATTCTCCATATTGTGTGCTA	1
CATTCTGAGTGGATGATAAATGG	1
CATTCTGATTACAATGCTCAT	1
CATTCTGCTTAGGAATCTTGTGCA	1
CATTCTGGCAGTTCAGTTATGGC	1
CATTCTTTTCGTTTCGATGAA	2
CATTGAAAACGATGTGAATAA	2
CATTGAAAGATGGGTGTCTTATG	1
CATTGAACTGGTTCTTGGGCA	1
CATTGAACTTTTAGAGCTGGTAAC	1
CATTGAATGGTGTGATACCAACAAC	1
CATTGACAGGGTGTGGCAAATCGT	1
CATTGACATGCACTACTGGAGAAG	1
CATTGACATGTGTACTACGTTTGG	1
CATTGACGTATGGTGCAATAGGAG	1
CATTGACGTGTGGGTGTCAGTGA	1
CATTGACTTTGTTAATGGTGGTAC	1
CATTGACTTTGTTAATGGTGGTACC	1
CATTGAGATAGGTATGCCAAATAG	1
CATTGAGATAGGTGTGGCAAATAG	1
CATTGAGCCATCTAAGGGCAAGTG	1
CATTGAGGGCGGAGCTAGAACGAA	1
CATTGAGGTCATTGATTTGAA	1
CATTGAGTGATGGGATGCCTAGAG	1
CATTGAGTGTAGACTCTAGGGGCA	1
CATTGAGTTGGGAATGCCCTTAAG	1
CATTGATAGGGTGTGGCAAATCGT	2
CATTGATGGGATCGATCGAGGCGC	1
CATTGCAACGACGGTGCGGAGATG	3
CATTGCCACGACCTTCGACATTGG	1
CATTGCCATTGTGAACCGATGGGA	1
CATTGCCTGTAAAAACGTATGCAA	1
CATTGCTAAACTAGTAAGGTGGTA	1
CATTGCTATTGCTTGGTGGGT	1
CATTGCTTGTAATAACATGGA	1
CATTGGAACATATGGGCTGGGCCA	1
CATTGGAGCCAAATGACCACCTA	1
CATTGGATGCAAATCGGATGGTCC	2
CATTGGATGGTCCAGATTGCATGC	2
CATTGGCAACGCGGCGATTGTGGT	1
CATTGGCAGCGACATGACGGTGAG	1
CATTGGCCTGCACTTTGCTTA	1
CATTGGCTACAACATTGTGTA	1
CATTGGCTAGACGAGTTGCCTATG	2
CATTGGCTCCTGTTTTGGGCACAA	2
CATTGGGAAGGTGTCGCCGCAAAT	1
CATTGGGCCCATATGTCATGTGAC	1
CATTGGGGACCTGTTTAGATTGTA	2
CATTGGTAAGGTCCACATGTCAGT	1
CATTGGTAGGTGGTATAGGTGATA	1
CATTGGTATGGTATGTGAGTCCA	1
CATTGGTCAGCCAAATAGAGTGGC	2
CATTGGTGAAATGGTGGTCTAAAG	1
CATTGGTGACGTGAAATTTGTCGT	1
CATTGGTGCTGACCAATTGGTGTC	1
CATTGGTGCTGGTTGTAGAACCG	1
CATTGGTGTAGCTATTGGAAAGAC	1
CATTGGTGTCGGGTATTACTGCC	1
CATTGGTGTTACCCTTAGCCGGAA	1
CATTGGTGTTGCCCTAATTGAAAGA	1
CATTGTACACTCGATGGTCTG	2
CATTGTCGCGTGCCTATCTCTAAG	2
CATTGTCTATATCACAAGCCC	1
CATTGTCTATGGGTGTAATACGGA	1
CATTGTGACTGGCCTAACGAACGT	1
CATTGTGACTGGCCTTACAGGTAC	1
CATTGTGAGGATTGCTATAGGTAA	1
CATTGTGAGGATTGCTATAGTTAA	1
CATTGTGAGTGTCTGCGTTGTAC	1
CATTGTGAGTGTCTGCGTTGTAGT	1
CATTGTGCCATTACCTAATTAGGG	1
CATTGTGGATGCCCTAACACAGT	1
CATTGTGGCTAGACAATTGGTGGC	1
CATTGTGGGAGAATGTGTGCA	1
CATTGTGGGCCTGTTTGGTACAGC	1
CATTGTGGGTGCCCTAATGGTGAT	1
CATTGTGGGTGCCCTTAAGGTGGT	1
CATTGTGTAAGAGGTGCTATATAG	1
CATTGTGTACGAGTCGAGGAATCT	1
CATTGTGTGCCTCGGTTGATTCCT	1
CATTGTGTGCTTGTAAACTTCCAG	1
CATTGTGTTGTGAACGGTTTGCGT	1
CATTGTTGTTTCCTTCTAAATCGC	1
CATTGTTTAAAATGCTTTGGGTTC	1
CATTGTTTCGTGATGGAGAAGCGG	1
CATTGTTTGTCTACCATCCAT	2
CATTGTTTTTCAATTTGGTTGCTG	1
CATTTAAATTAGGAACTTAGCCCC	1
CATTTAACTGTGGTGGGTTGTGTT	1
CATTTAATAGTTGGTGTGAACGGA	1
CATTTACACCTGGTGCGTTCTTGC	2
CATTTACGCGCATCCCGCATCTGC	1
CATTTATCAGGAAGTGATGGGAGA	1
CATTTCACCGAACAGGTTGTGGGC	1
CATTTCCTTCTTTATTTGCTTGCT	1
CATTTCTGATGCGTCTAGTTTGGC	1
CATTTGAATAGCAGGAATGGAAAA	1
CATTTGAATGATGGTATTTTTGCG	1
CATTTGAGTGACATGCAAATAAC	1
CATTTGATCCAACGTGGGTGCTGA	1
CATTTGCATGGATGTGTGTATGA	1
CATTTGCCATGGTAGTAGCTA	1
CATTTGGCCAGGAGGTGTAAGGA	3
CATTTGGCTATCCATACT	2
CATTTGGGTGTCCAAATAGAA	3
CATTTGGTCCATCTTGCAGAA	1
CATTTGGTGTACACATTATTG	1
CATTTGTGACGGGCTACTTTTAGG	1
CATTTTGTCAACGGCATTTTT	1
CATTTTTGATCGGTTGCCAAAAAGC	1
CATTTTTGTTTCAAGTTTGCTGGT	1
CCAAAAAAACCTAAAGATGGCGGCG	1
CCAAAAAAAGACAAACCTTAGG	1
CCAAAAAACTAGTCTGATAGGTGA	1
CCAAAAAAGCCAATCTAGTAGGAC	1
CCAAAAAAGTGCCCGATTAGTATA	5
CCAAAAAATTGGTAGTGCTAAAAG	1
CCAAAAACGATTCAAATCCTG	1
CCAAAAACGCATAGTTTCCCCT	1
CCAAAAAGACTAAACTGGTAGGTG	1
CCAAAAAGAGGCCGACAAAGATAT	1
CCAAAAAGTCAACGGCGTCATACA	1
CCAAAAATAACTTTGTGCGGTGTC	1
CCAAAAATCATGCTAGGGTGTAAA	1
CCAAAAATCATGTGTTAACTGC	2
CCAAAAATCATGTGTTAACTGCCT	1
CCAAAAATCATGTTTTGGTGCTTT	1
CCAAAAATGGTGCGCCAGAGTGGC	1
CCAAAACAAGATTTAAGGGGGGAC	1
CCAAAACAGAGGTGAGATGAATAA	2
CCAAAACAGGAGCCAATGTGTTGC	5
CCAAAACAGGGACATATTTGGTAC	1
CCAAAACATAGCCTGCCATTGTGA	1
CCAAAACCACAAGTGCTACTGAGG	2
CCAAAACCACCGCGGATTGGGTC	3
CCAAAACCAGTGCATATGAGGTC	1
CCAAAACCCCCCCACCTCGGT	1
CCAAAACCGAAGCCAATGGGTTGC	1
CCAAAACCGGAGCCAATGAGTTGC	2
CCAAAACCGGAGCCAGTGCGTTGC	1
CCAAAACGGTCATTGGGAGTGCAT	1
CCAAAACGGTTTGGTGAACCCTGC	1
CCAAAACGTGCAGAACTTTATCTC	3
CCAAAACTACCGCGGATTGGGTC	1
CCAAAACTAGCAGTTGGGGGCGA	2
CCAAAACTCTGGTGCTGATTCCCC	1
CCAAAACTTGTATGGGAAGAGGCA	1
CCAAAACTTTATGCCAACATCGAA	1
CCAAAAGAAAACCAAGGGCCAGAA	1
CCAAAAGAATCTGGGACGCTGTA	1
CCAAAAGACTAGTATTATGGTGAG	2
CCAAAAGAGAGGTGACCACTATGC	1
CCAAAAGAGGGGGGCTAGAGAGA	1
CCAAAAGAGTGCGCGAGTGTG	1
CCAAAAGATCGGGCCAAACAACTG	1
CCAAAAGATTTGCCTACTTTGCT	1
CCAAAAGCCAAACAGTGATAGTCC	5
CCAAAAGCCAACCAAAGGGCCCAA	1
CCAAAAGCCTATAGCAAGACAAG	1
CCAAAAGCGACTTTGTGCGGTGTC	1
CCAAAAGCTAGATCAGAAGGTGAG	1
CCAAAAGCTAGCCATTGAGGTGA	1
CCAAAAGCTAGCCATTGAGGTGAG	1
CCAAAAGCTTAAGTTGATGGAGAA	8
CCAAAAGCTTAGCCTGGTTGGGAA	2
CCAAAAGGAATGGTGATTTTGGGT	1
CCAAAAGGATATTGAACTCAGGGA	1
CCAAAAGGCAACCGAGACATGGGC	1
CCAAAAGGGTCCTGAGTTGGTGGT	2
CCAAAAGGGTGAGCTATTTGAGA	1
CCAAAAGGTACAAACACGAGTACG	1
CCAAAAGGTAGTTAATGAGGTGAG	1
CCAAAAGGTGGACTGTTTGGGGGA	2
CCAAAAGGTGGTGGACTAGCCGAT	1
CCAAAAGGTGTACTGTTTTAGGA	3
CCAAAAGTCACTTCGCGCGGTGTC	1
CCAAAAGTGAAGTGGTGAGATGGA	2
CCAAAAGTGACTTTGTGCGGTGTC	3
CCAAAAGTGCTTAGCACCCTC	2
CCAAAAGTGGAGCCAGTAGAAAG	1
CCAAAAGTTAATTGCCACATCTA	1
CCAAAAGTTTTGGGTTGGGCTCGAC	1
CCAAAATAAAGTGACCGAAAGACA	1
CCAAAATAACAGGATGGTTTGCAA	1
CCAAAATAAGTGCAGACATAAGT	1
CCAAAATAAGTGCAGCCATGAGTT	1
CCAAAATAAGTGCAGCCATGGAAA	1
CCAAAATAAGTGCAGCCGTAGGAA	2
CCAAAATAAGTGCAGTCGTGG	1
CCAAAATATAAGGGTGTGTTTGG	1
CCAAAATATGGTGCTCGAAGCTGC	1
CCAAAATATTGGTAGTGCCAAAAC	1
CCAAAATCGGGAGACGTTGGCCC	1
CCAAAATCGGTCACCTGACTCAGG	1
CCAAAATCTAGACTGTTTGGGGA	2
CCAAAATCTATTATATTTTAGGAG	1
CCAAAATGCGAAAAGTGGGCT	1
CCAAAATGCTAATCTGAGGCCA	2
CCAAAATGCTGCTCCGAAGGA	1
CCAAAATGGTAAAGCCTAACGGAT	1
CCAAAATGGTTGGTGACAATTGAC	1
CCAAAATGTGCAGCCTGTATGAAG	2
CCAAAATGTGCATAGGATTACCTA	1
CCAAAATGTTTGATGCCATTGA	1
CCAAAATTACATTGTAAGTGGTGT	1
CCAAAATTACCAGTTGTACTA	1
CCAAAATTGAGGTGTCTATTTTCC	1
CCAAAATTTAAGGGCATAAAAGT	1
CCAAAATTTACTGTGCTTGAG	18
CCAAAATTTACTGTGCTTGAGT	1
CCAAAATTTCGGGATTTCGGTGAC	1
CCAAAATTTGATAAGGTTGAAAAT	1
CCAAAATTTGGTAAGCCCGAAGTC	1
CCAAAATTTGGTAAGGTTGAAAAT	1
CCAAAATTTTAGCAAGGTTGCCAAA	1
CCAAACAAAAAATAGGGTGCGCTC	1
CCAAACAACATCTTACAGAAACCA	2
CCAAACAACGATAGCCCTTGTGAG	1
CCAAACAACGGGAAGGGGCCGAGC	1
CCAAACAACTCAGTGTAGATC	1
CCAAACAAGATTGGCTACATGGGC	1
CCAAACAAGGACGATGGATGG	3
CCAAACAAGGCCTATACGACGATC	1
CCAAACAATAAGATTGAGGGCCT	3
CCAAACAATACATTCCTACGTGCC	1
CCAAACAATATGTGGGGTGAAGCT	1
CCAAACAATTGGTAGTGTCGTTGC	4
CCAAACACAAGGCTAAGGAGGTGT	1
CCAAACACAGGAGTAGGGTGTTAC	3
CCAAACACAGGAGTAGGGTGTTGC	2
CCAAACACCATCTTGGTTGTCTTG	1
CCAAACACCTAACGGAGATGTTGC	1
CCAAACACCTGTCAAATTTGCCTA	2
CCAAACACTAGCCTAAGAATTTGT	2
CCAAACAGAGAGTTATTGGGTTGC	110
CCAAACAGGACCTATATATTGACC	1
CCAAACAGGAGGGACTAAAGTGCT	4
CCAAACAGGAGTAGGGTATTACCT	1
CCAAACAGGCCCATAGTTATGGT	1
CCAAACAGGCCTACACGAGGGAAT	1
CCAAACAGGCCTATAACTCCACT	1
CCAAACAGGGACGGAGCCAGCATT	1
CCAAACAGGGCCATAGTTATCTA	1
CCAAACAGGGCCGATGTGATGGAA	3
CCAAACAGGGCCTACATTGCCATC	2
CCAAACAGGGCCTACGTAAAATA	1
CCAAACAGGGCCTCAAATTGATA	1
CCAAACAGGTGAGCTAATTTTGAG	1
CCAAACAGGTGGACTAATTTTGAG	2
CCAAACAGGTGGCCTAATTTTGAG	1
CCAAACAGGTGGGCTAATTTAGG	1
CCAAACAGGTGGGCTAATTTGAG	1
CCAAACAGGTGGGCTAATTTGAGG	2
CCAAACAGGTGGGCTAATTTTGAG	7
CCAAACAGGTGGGCTAATTTTGG	2
CCAAACAGGTGGGCTAATTTTGGG	1
CCAAACAGTGGCCACTAGTGA	1
CCAAACATATGTTTAGAAGGGTAC	1
CCAAACATCCAATGTGACATGGGC	2
CCAAACATCCGATGTGACAGGGAC	1
CCAAACATCCGATGTGACAGGTAC	1
CCAAACATCCGATGTGACATGGAC	2
CCAAACATCCGATGTGACATGGGC	2
CCAAACATCCGATGTGACATGGTC	1
CCAAACATCCGATGTGATAGGGAC	1
CCAAACATCTGATGTGATAGGGAC	1
CCAAACATGTGGGCTAATTTTGAG	2
CCAAACATTCGATATGACAGGGAC	3
CCAAACATTCGATGTGATGGGTAA	1
CCAAACATTTGATGTGACGTTTT	1
CCAAACATTTGATGTGACGTTTTT	2
CCAAACATTTGTAGCTTGCCG	1
CCAAACCAAACGGTTTAGCTTCAC	1
CCAAACCATGTCTAAGGTGTGG	1
CCAAACCCAGCCTACCCTGAAACG	4
CCAAACCCGAGGATAGCGACGAGA	1
CCAAACCGAACCGGCTGCCTAAC	1
CCAAACCGACCATTGCTGGATTAC	1
CCAAACCGTTTCTGGGTGTGACTA	1
CCAAACCGTTTGAGGTGGGGTTAC	2
CCAAACCTAATATGCCGCGGTGGA	3
CCAAACCTGATATCTATGGTATC	1
CCAAACCTGATGGAAGTGCTATGG	1
CCAAACCTTCCCGTCGATGTG	1
CCAAACGACGGTGAGGGAAGTGGT	1
CCAAACGAGTTGGGTGTTAGAGCA	1
CCAAACGCCTAGCGGAGATGTTGC	1
CCAAACGGATAGCCTTGGAATACT	1
CCAAACGGGAGATTGAACGGGGCA	1
CCAAACTAAGATGAAGAAAGGAGC	1
CCAAACTACCAACTTTTCCCAAAC	1
CCAAACTACTAAACGGTGCGTTT	1
CCAAACTACTAAATGGTGCGTGG	1
CCAAACTAGCATGGTGGCCCGCGT	1
CCAAACTAGCATGGTGGCTCGCGC	1
CCAAACTAGTGCTCCGTGCCA	1
CCAAACTCACAAAGGGGGGACGTG	1
CCAAACTGATGGGATTCTTTG	2
CCAAACTGCTAGCCAACAAGGAAA	1
CCAAACTGGTGTCTTTGATAGTGT	1
CCAAACTGTCGGGGCTGGGGTTAC	2
CCAAACTTCAGTGTGACTAAACAC	1
CCAAACTTCCAAACTTCAGTGTGA	1
CCAAACTTCCAATTTTAGGGTGAA	1
CCAAACTTGTTTTGGGTGTCATA	1
CCAAACTTTTAACTTTAGAAGGAA	1
CCAAACTTTTAATTTTGGCGTGAT	1
CCAAAGAACTGTTGGGGTCCAGAC	4
CCAAAGAACTGTTGGGGTCCGGAC	1
CCAAAGAAGCTGCAAGTGGGGCAC	2
CCAAAGAAGGGAGGGCCACTGAAG	2
CCAAAGAATTGTTCGGAATCG	1
CCAAAGACACCTAGCCTACAGGGC	2
CCAAAGACATTGGAGGGTGTTGAA	3
CCAAAGAGGCACTGTCCTACGTGA	1
CCAAAGAGTATGGTACTTCACGAT	5
CCAAAGAGTTTATTGACGGCGTGC	1
CCAAAGATAAATGATGATGGACGG	1
CCAAAGCAGTTTAGATGATGGTTT	1
CCAAAGCTCAGGTAGACGAGGTGG	1
CCAAAGCTCTACAGATTTGATTGC	1
CCAAAGCTGAAAGAAACAGGGCCT	1
CCAAAGCTGATGATGGCATCCCAC	3
CCAAAGCTGGCCGCTACGGAAGA	2
CCAAAGCTTCCCTTCTTGCACGAT	1
CCAAAGGATGAGGGCCACATTGTG	1
CCAAAGGCTAAAAAGAATTGAGGT	1
CCAAAGGGGTGAGACAAGAAGTC	1
CCAAAGGGTAACAAGTTTGAC	1
CCAAAGGGTACCACAATAGCAAT	1
CCAAAGGGTGCTAATTGGAGCTA	1
CCAAAGGTGCCGCAAACTTGCTGC	2
CCAAAGGTTGTTTACACAAGTGCA	1
CCAAAGTAAAAAGATTGTGTACAG	1
CCAAAGTAGGGATGAGCCGCACAA	1
CCAAAGTCATATACTTACAGCTGG	1
CCAAAGTCATCGGTGCCGGTTTAG	2
CCAAAGTCCAAAACATGTGCC	1
CCAAAGTCGCATTTCACCGTGGTC	2
CCAAAGTGACTTTGGGGTGAAGA	1
CCAAAGTGCAAATGATGGTAACTA	4
CCAAAGTGCCTCGTCAGAGATAAC	1
CCAAAGTGCGATAGCGATGATGGC	1
CCAAAGTGCTACAAAGGTAAAGA	1
CCAAAGTGGGTGAATGGTTGATG	1
CCAAAGTGTGTCATCGATTATATC	1
CCAAAGTTGATGCGGTACTACCAC	2
CCAAAGTTTGCCTAGACTTTAGCA	1
CCAAAGTTTGCTAAAGGTTGCCAC	1
CCAAAGTTTGGATCTAAATACAGC	1
CCAAATAAAGTATCCGGTGTC	24
CCAAATAACTCAGGAATGCTA	1
CCAAATAATGGAGTGCATCTG	4
CCAAATAATTGGAGGAGCCTTGGA	2
CCAAATACAGGTGAAATGGGTCGC	1
CCAAATACATTGGAGTTGGCCTA	1
CCAAATACCACCTGGGTCCACATG	2
CCAAATACCACTTTCAACTGAGCC	1
CCAAATAGAAAAGGTGTTGATTGG	1
CCAAATAGCAGGACTACTTTAGAG	1
CCAAATAGGCCTAGGTGGAGTGAA	1
CCAAATAGTATGGTGCGCTTTCG	1
CCAAATAGTTGGTGTGTTGATTTGC	1
CCAAATATCCGATGTGATAGGGA	1
CCAAATATGGTGCTTGGGCAAGA	1
CCAAATATGTGTAACATGAGGGAG	3
CCAAATATGTGTTTATAGAGGTGA	2
CCAAATATTAAGGATGTCGGTGA	1
CCAAATATTCTAGTACCGATGGTA	1
CCAAATCAAGAGGGATTGCCTTA	1
CCAAATCAAGTGGGATGCATATGC	1
CCAAATCAATACTGCCACATAGG	1
CCAAATCACCGGGACCAGGGTTAC	1
CCAAATCAGAGTCGCCACGCCACC	1
CCAAATCAGGCTGGAGATGTGCAC	4
CCAAATCAGGTTTTGGGAAGAC	1
CCAAATCATGGTGCTGCACTTCTC	1
CCAAATCCCACTCCCAGATGTTGC	1
CCAAATCCTTCTGGTGCAGCTCGG	1
CCAAATCGGATGGCCGAGATTGAT	1
CCAAATCGGCCGGATGCACTCATC	4
CCAAATCTAATACTTACGGTAC	1
CCAAATCTGGAGGCCTGCTAAGC	1
CCAAATCTTGATGAGGTGTGGGC	1
CCAAATGAAGGATGGAGGATCGGT	1
CCAAATGAAGTACCCGATGTC	1
CCAAATGACCAGAAAGCCCGACGA	1
CCAAATGACCGTCTACAAAAATA	1
CCAAATGAGCGGTTGCCATGA	1
CCAAATGAGGACGATGGATGG	11
CCAAATGAGTGAGGTGCATATGAA	1
CCAAATGATAACAATCCGGTCCA	1
CCAAATGATAATAATCCGGCCTA	1
CCAAATGGCCCAGTACAGCAC	1
CCAAATGGGAGCACATAAGTCGAA	1
CCAAATGGTCCAATAAAGCTA	3
CCAAATGGTGAGAACTCAATACAT	1
CCAAATGGTGGGCGGCAAGCTGAC	1
CCAAATGGTGTGTACTACTAAGAG	2
CCAAATGGTTCCTCCGATGCGTAC	1
CCAAATGTACCTACAAGCGCAGA	1
CCAAATGTACGGTGTCTTTATCAC	1
CCAAATGTATAGGTGAGTTCC	1
CCAAATGTGGCTAGTGTTTGGTT	1
CCAAATGTGTGCCTGATACATGAT	2
CCAAATTAAAGGGTGTGTGTTATG	1
CCAAATTCCCAACTTTTCATC	2
CCAAATTGAAAGAAACAGGGCCTA	1
CCAAATTGAGACCCACGTGTCAG	1
CCAAATTGGCAAAAATCGGGTGCT	1
CCAAATTGGGTGGGATGCATATC	1
CCAAATTGGTTGGGTAGGCAAGGT	2
CCAAATTTGGTATGGTACGCTAGC	1
CCAAATTTGTAAGTGCAATAG	12
CCAAATTTTAGCATGCCTAACAAA	2
CCAAATTTTATGTTGAATGTCGTT	1
CCAAATTTTGGATCTAAACACAGC	3
CCAAATTTTGGCATGCCTAAGAAA	1
CCAAATTTTGGTAAATGTGCTAAA	2
CCAAATTTTGGTAAGGTTGTCAA	1
CCAAATTTTGGTAATGTCTATGAAA	1
CCAAATTTTGGTAGCTATATAGAA	1
CCAACAAAAAGTGGACGCAAGTGC	2
CCAACAAAGATAATAGGGTGAC	2
CCAACAAAGGTACTACAATTGGGA	4
CCAACAAAGGTGCTACTGATGGTT	1
CCAACAAATTGGGTCCCACGTGT	2
CCAACAACAGTGGCCTAAATTGCA	1
CCAACAACATCGGAGCCTCTTGAG	2
CCAACAACATGGTCAATGGTGTA	1
CCAACAACCGTGCTTACCAGTATT	1
CCAACAAGAACAGTGTGTTGT	2
CCAACAAGATGATCGGAGTGCGG	2
CCAACAAGATGTCTATAATGGTTC	2
CCAACAATAGGGATAATGCTGTGCA	1
CCAACAATCAGAGAGATGAGACGA	1
CCAACAATGCTCATTACAGAG	1
CCAACACCGGAGCCAATACGTTGC	1
CCAACACCGGAGCCAATATGTTGC	2
CCAACACGGTTTAAATAAATTGAG	1
CCAACACGTTTGAGGTGAGGTATC	2
CCAACAGACTAGTATGATGGGTGA	1
CCAACAGACTGGTTAGACTATGGA	2
CCAACAGATCGATGATGTGCACCT	1
CCAACAGATGGTTGTAGGATCGAA	1
CCAACAGCGCCTTCGAGCCGTCCTCCATGATGG	1
CCAACAGGATGAGTCCCTCTGTGC	1
CCAACAGGCATGCTCATGGTC	8
CCAACAGGGAGACGGCCTGCTGAA	1
CCAACAGGGATTAAAGATGGTTAG	1
CCAACAGGGTTGTGCGGTACCTA	1
CCAACAGGTACATGGATTTGAA	1
CCAACAGGTATGGGGATGGGAGAC	1
CCAACAGGTGAGCCTACTTACACA	1
CCAACAGGTGGTACCTCTGGCAAC	1
CCAACAGGTTTACGACTAGAT	1
CCAACAGTATCACTGCGCGCGGGG	1
CCAACAGTTACAGTGTGTGGA	1
CCAACATACGCCAAGACAAGACGC	1
CCAACATATATGGTTCTGCGGTT	1
CCAACATATTGGTAGGGTGCTAAA	1
CCAACATGGGATGGTCGCCAGCGC	2
CCAACATGGTGCTAATGTGGCAGT	1
CCAACATGGTGTATTTGTGTTAAG	1
CCAACATTAGTGGTTGTGTGCTGG	1
CCAACATTGAGGTTGCCCTTATAA	1
CCAACATTTGAGAGTGTCTACACC	5
CCAACCAAACAGGCCTAAGAAGAT	1
CCAACCAAACGGGCCGCTTGGGA	1
CCAACCAACTAGTGGCCACGGGA	1
CCAACCAAGGTAGTGCCACCAGTC	1
CCAACCAATAGGCTGTAGCTGAAA	1
CCAACCACAAGCCAGCGTGGGC	1
CCAACCACGGTGGCTTGGTAGAGC	1
CCAACCAGAACAAGTCCAGAACGCC	1
CCAACCAGCTAGACAACGGTGGT	1
CCAACCAGGACTAAAGAATATGGT	1
CCAACCAGGAGAAAGCCTTACTAC	1
CCAACCATAATACATGCGGGTTAA	1
CCAACCATGGTGCTAGCTTGTGGC	1
CCAACCATTGTTGAGTGACCACGT	1
CCAACCCAATGACTAGGATGATGT	1
CCAACCCATAACACTAGACATGGT	1
CCAACCCATCAGGTACCGGGTGAG	2
CCAACCCCTAGAATCAGATGGAAC	1
CCAACCCGCAGCCTAGTATGCCAC	1
CCAACCCTAGCCTTTGATGTACAC	1
CCAACCCTAGTAAGGGATGGGCTC	1
CCAACCGATTGGAATGTGTCAAGC	1
CCAACCGCCGTGGTAGTGCAA	1
CCAACCGGCACTACGAATCCGGGA	1
CCAACCGGGACTAATAAGGGTTTC	1
CCAACCGGGACTACGAAGATCGCT	1
CCAACCGGGACTACGAATCTG	1
CCAACCGGGAGAAAGCCTTAGTAC	2
CCAACCGGGGCTAAATACGGAGG	1
CCAACCGGTACTAAAGATGATAGC	1
CCAACCTACATATAGATGGCACA	1
CCAACCTAGATAAGAATGGGACA	1
CCAACCTAGATGGTGATTTTACAC	1
CCAACCTAGATTGAGTTATTTTGG	1
CCAACCTAGATTGGATGTGACACA	1
CCAACCTAGGATAAGATGGAATGT	2
CCAACCTAGGATATGATGTGACC	2
CCAACCTAGGATATGATGTGACCT	3
CCAACCTAGGATATGATGTGATT	1
CCAACCTAGGATGGGATGGGACAC	1
CCAACCTAGGGTGTGTTCGGTGGA	1
CCAACCTAGTACCGGATGTGACGC	1
CCAACCTATAGTGTCCACATACAG	2
CCAACCTATTACTGGATGTGACAC	1
CCAACCTCATATGGGATGTGACGC	1
CCAACCTCTGGTTGTGTGGGCTGTC	5
CCAACCTGGCCAAAGCTTGCAAGA	1
CCAACCTTATTCACAGATGCATGC	1
CCAACGAAGATGATAGTGACTGGT	1
CCAACGAAGGGTGTATTAAGTGCT	1
CCAACGAGATTGCGAATGGGCGAA	3
CCAACGAGCCCCCGGGTGCTAGGA	1
CCAACGAGCCTGAAGCCGGATATA	1
CCAACGAGGATGCCATGGTGTTG	1
CCAACGATCGCAAACGATTTGGTA	1
CCAACGATGAAAAGGATTTGGTACC	1
CCAACGCAAGTTAAGGTGTCC	2
CCAACGCAAGTTAAGGTGTCCA	1
CCAACGCATGCTGGACCACGACGCT	1
CCAACGCTATTTGGGGGCCTTGGG	1
CCAACGCTCTTGAGTGATGGGCAC	2
CCAACGCTGGTGACGTATGGT	1
CCAACGCTGTGTGGGCCTCAAATG	2
CCAACGGCTGTCATCGCTGGGTAC	1
CCAACGGCTTAGAATTATTGATGA	1
CCAACGGCTTCGCCACATGTGGTC	1
CCAACGGGAAGATTTGTGCTGTGG	1
CCAACGGTGCTAGGATGGGTTCGG	1
CCAACGGTGTCAAATATTCAGTAA	1
CCAACGGTTCCTCGGTCAGACCGT	1
CCAACGTCCCTCGGTGATTTTGAC	1
CCAACGTGATGTGCCCGCATGGA	2
CCAACGTGCCGGGCCAACATATC	1
CCAACGTGGCCAACTTGCAGAAGT	1
CCAACGTGGTAAACTCGGGTGAAA	1
CCAACGTGTAACTCACGATGTGCT	1
CCAACGTGTGATATTTTGATTAAG	1
CCAACGTTTGAACGTGTCCAGCGG	1
CCAACGTTTGACCGTTCGTCTTAT	1
CCAACGTTTGATGGTCAGTTTTA	1
CCAACGTTTGATGTCACGATTCCG	1
CCAACGTTTGCCCGTTTGCCTTAT	1
CCAACGTTTGGCAGGCCTGAAA	1
CCAACTAAAGTGCAACTGAATGGT	2
CCAACTACCATACGGGACCCATG	1
CCAACTACGAGGAGACAGCCAGTC	1
CCAACTACTAACTGGGCCTAGTAC	2
CCAACTAGGAAGGTAGCCCGCGCA	1
CCAACTCAAAAATCAGGGATGGT	1
CCAACTCAACAACAACAAAGGTAC	1
CCAACTCCCACAGGAGCGAGTGAG	1
CCAACTCCGCGTCTCCACCTCGC	1
CCAACTCCTAAGGGCCTGTTTGG	1
CCAACTCCTACAGAACCAAGATGC	1
CCAACTCGTCAAGCTTAGGGTGGT	2
CCAACTCTCATGGGCCACACATGC	1
CCAACTCTCTCGCTGAGCAGCTGC	1
CCAACTGCCCATCCTACCTCCT	1
CCAACTGCGAATAAAGAGAGGGTA	3
CCAACTGGCGGCCTCAACATCCA	1
CCAACTGGGACTAAAGATGGCAGC	1
CCAACTGGGTATGGGGTGCCATGT	1
CCAACTGTGGAAGCCGCATCTGCC	1
CCAACTTACAAAACCGGTGCAC	3
CCAACTTACCAAAACTGTGCAG	1
CCAACTTCGGTGTTGTTGGTTGAA	1
CCAACTTGGGTGGTCGGACCAAA	1
CCAACTTGTCTAGCCTACCAACT	1
CCAACTTGTTCAGTTGTGTCACCC	1
CCAACTTTACTAAGAAAACACTGC	1
CCAACTTTCGAAAGCGCCAAGAAA	2
CCAACTTTGAAGGTGAAGTTGAA	1
CCAACTTTTCGGCATTGGTCCTG	2
CCAACTTTTTGTTTCTGGATCTGC	1
CCAAGAAACAAATGCAGAGTGG	1
CCAAGAAACTGCGAATCTGAGTGA	1
CCAAGAAAGTAGCCTAGCTAGGCC	1
CCAAGAAATATGGGCCTGCTACAT	1
CCAAGAAATGAAGAAAAGGTTGAC	1
CCAAGAAATGATAAAGCCAGAAGC	1
CCAAGAAATGCCATTGACAAGTG	1
CCAAGAAATTTATCAAGCCCA	1
CCAAGAACAGGTGACCAACTTTGG	1
CCAAGAACTTAAGGTGCTGCTGAG	1
CCAAGAAGCCGCTCCACTACAAAG	1
CCAAGAAGGATATGGTGGGTTGAG	1
CCAAGAAGGGCTATGTCGATTTGG	1
CCAAGAAGTAATGTGTGCATGAC	1
CCAAGAATTAGTGGTTGATGTGAC	1
CCAAGACATATTGGGTGTATGATA	1
CCAAGACATGCCAGATGACGACAC	2
CCAAGACATGCCAGATGACGATA	1
CCAAGACATGCCAGATGATGACAC	1
CCAAGACCGGAGCCAATATGTTGC	1
CCAAGACCGGAGCCGGTATGTTGC	4
CCAAGACCTGGACACGGTGGA	4
CCAAGACGACAGACATAGCATCGT	3
CCAAGACGCAGTGTGTCTATGAC	1
CCAAGACGCAGTGTGTGTATGACA	2
CCAAGACGCGGTGCAGTCGACTG	1
CCAAGACGTAATGTGTGTATGGCA	1
CCAAGACGTATTGGGTGCATGAT	1
CCAAGACTAGAGATAGATTCGTGG	1
CCAAGACTGGAGCTAGTATGTTGC	1
CCAAGACTGGTGGACTGCAATAGC	2
CCAAGACTGGTGGACTGTAATAGC	1
CCAAGAGAAATGAATAAGATGGAC	1
CCAAGAGACTTCGCAGGCGTGGG	1
CCAAGAGAGGGTTTCCCACGTGGT	2
CCAAGAGAGGTGGAGCTGGAGC	1
CCAAGAGCAGCAGTAGTACCT	1
CCAAGAGCAGGTGTATGCAGTTGG	1
CCAAGAGCTTACACACGTGGTGTC	1
CCAAGAGGTCGAGCCGTTGGTGAC	2
CCAAGAGGTGCTAATGGGACTAAT	1
CCAAGAGGTGCTAATTGGAGCTA	1
CCAAGAGGTGCTAGTTAATGTATG	1
CCAAGAGGTGTGGCTCTATTTGGC	2
CCAAGAGTAGAGTGACACACAAGC	2
CCAAGAGTGGACCGACGCGGGTGG	2
CCAAGAGTGGGAGAAGCAGCTGCT	1
CCAAGATAACTGGAAGCGTTTAAG	1
CCAAGATAAGTCGAGCCGGCAC	1
CCAAGATAATTATCACCGGTGGAG	2
CCAAGATACACAGTGCTACTAGAA	2
CCAAGATAGCACTACTACTGAACC	2
CCAAGATCGGAGCTAATATGTTGC	1
CCAAGATGAGTCGAGTGCGTGGAG	1
CCAAGATGCATGTGTGTATGATAG	1
CCAAGATGCGTTTGGGGGCTGTAA	2
CCAAGATGCTTGAGTTGATAACCT	1
CCAAGATTACATAGTGTCTTACCC	1
CCAAGATTACCCGGGCCTGTC	1
CCAAGATTGAGGTTCATGAAGCCG	1
CCAAGATTGGCGCCAGAAATTTGC	2
CCAAGATTTGTCTTTTTTTTGGGAC	1
CCAAGATTTTGCGGTGTCCCACAG	1
CCAAGCACAATTGGGCCTGTGCTG	1
CCAAGCAGCGACGAGTCACACCGT	1
CCAAGCATCAGAAGATTGCCTTGA	2
CCAAGCATCAGAGATGTACAA	1
CCAAGCCAATACGGAGGGGAC	1
CCAAGCCGATTTCAAGGAACCTGC	9
CCAAGCCTAACCAAACAATGCGTA	2
CCAAGCCTCATAGGTGGTTAC	4
CCAAGCCTTGACCCATGGGCCATG	1
CCAAGCGAGTAGCCGGCGGTGTA	1
CCAAGCTAACTGACCAGATGTGAC	1
CCAAGCTAGCAAGCGGCGCCTG	1
CCAAGCTAGGCATGTCTGGATCCT	1
CCAAGCTAGTGAGGTGAGGCCGAA	1
CCAAGCTATAAGGGTGTGTTTGG	1
CCAAGCTGACTCAGCCGCCACGTA	1
CCAAGCTGTCAAGCGACGAGGGG	3
CCAAGCTGTCATCGTTGAGGGCAA	3
CCAAGGAAATGGAACGACCTT	1
CCAAGGAACTAGAGGCTATTTAGC	1
CCAAGGACCTGAGAGCGTTGGAAC	1
CCAAGGAGAATGGCACGGGAGCCT	1
CCAAGGAGAGCGCATCTATGGAAC	3
CCAAGGAGCCTAATCAATTGAGTT	1
CCAAGGAGCTAGAGCGACAGCGGC	1
CCAAGGAGGAGTGTTAGGAAACC	1
CCAAGGAGTCTGACATGCGTGCGA	4
CCAAGGAGTGGTGAGTGTGGTCGA	1
CCAAGGATGGCCAATGGACGAGAG	2
CCAAGGCAGCCTGAATTATCCCA	4
CCAAGGCAGTATATATGGGTGGT	1
CCAAGGCATAAGCAGATGGGAGAA	1
CCAAGGCCAAGGGTGGTGATGTAC	1
CCAAGGCCTGCAAAAATCACCGAT	2
CCAAGGCGGTGCATGTGGTATCCC	1
CCAAGGGAATTTTAGGACAGGTGG	2
CCAAGGGACTTGAGCTGCCTGTCC	1
CCAAGGGAGGTCTTGAGATGTTGA	2
CCAAGGGATCAGCGCCACATTCG	1
CCAAGGGGTGATGGGCACGACTGA	2
CCAAGGGGTGCTAATGGGGCTAAT	1
CCAAGGGTAGTCTATGTTTATACA	5
CCAAGGGTATAGAATGGATGTGAC	1
CCAAGGGTCATGTCCGCCTGCGAA	1
CCAAGGGTCTCATAGACACTGTGC	1
CCAAGGGTGTGTTTAGTTTGAGGG	1
CCAAGGTAATAAATAGTGGTGGT	1
CCAAGGTACACAAGACGACAAGTA	1
CCAAGGTACACATGATTCATAGAT	1
CCAAGGTATACGCGAGATTGAGGT	3
CCAAGGTCCCAAGCAGTATGGTTC	1
CCAAGGTCCCTTGGTGGTTTTCAA	3
CCAAGGTCCTGAGTTCAAATCTCC	2
CCAAGGTCCTGAGTTCAAATCTGC	1
CCAAGGTCCTTTGGTGGTTTTGAC	1
CCAAGGTCGGTTGCCAGCTTCTGA	1
CCAAGGTGAATCCAACAACACGGG	1
CCAAGGTGACGTGAGGACGCTGAG	1
CCAAGGTGCAGCAGGAGGACACGG	1
CCAAGGTGCTAAGTTCAAATCTC	1
CCAAGGTGGAAGCATAGAATATGT	1
CCAAGGTGGTGGGCTAGCTAGCTA	1
CCAAGGTGGTGGTGACGATGCTCT	1
CCAAGGTGTCGCTACGGTGTCGA	1
CCAAGGTTAGATGGGATATGGCGA	1
CCAAGGTTCGCCGTGTACACACAC	1
CCAAGTACACTTGATGCCCCGAAA	1
CCAAGTACCAGGGGTCTTGGGGTC	1
CCAAGTAGAACTCGGAGATATCGG	2
CCAAGTAGAGGGCAGCAAGGTGAC	1
CCAAGTAGGTGCCTTCTTTGAAGC	1
CCAAGTATAGAGCAGCAAGGTGAC	1
CCAAGTCAAATTAGCCACGTAGAC	2
CCAAGTCCACGGGGTGGATGGGAG	1
CCAAGTCGTGTCTGAGAGGGTCCT	2
CCAAGTCTGATACCATGTGGTGAC	2
CCAAGTGAAGGACGGCAAGGTGTG	1
CCAAGTGAGGTGGAGGTGCAATAG	1
CCAAGTGATTATCCTAAGCTA	2
CCAAGTGCTACGGCGTAGGTA	4
CCAAGTGCTGAACTGACCTCC	1
CCAAGTGCTGATGTATTTCAT	6
CCAAGTGCTGGAATCCGATTCGGC	1
CCAAGTGGAGAGCGATAAAGGTGT	3
CCAAGTGGAGGCTGTGACCGTGCA	1
CCAAGTGGTGTGCCGATTCGGTAT	1
CCAAGTGTCACTTTGTTGCCAAGG	2
CCAAGTGTGAAGCCACTGGGTGAC	1
CCAAGTGTGGGAGTATGGTGTTGC	1
CCAAGTGTTAAAATGTGTGTGG	1
CCAAGTGTTTGACGCGGGTGTTGA	1
CCAAGTGTTTGGGATGTTGGA	1
CCAAGTTAATGAGGGGGTGTTTG	1
CCAAGTTAATGAGGGGGTGTTTGG	2
CCAAGTTAGGAAGGACGATGATGA	3
CCAAGTTATTTGGCACTAAGGTCC	2
CCAAGTTCCTGTAGCAGAGTTGG	1
CCAAGTTCTTGGTGTCTAGCAGA	1
CCAAGTTGGCTACAAAGGTTATGGT	1
CCAAGTTGGTGTTACATATGGATC	4
CCAAGTTGGTTCGTCGTTCAG	1
CCAAGTTGTTGAACAGAGATGGGT	1
CCAAGTTGTTGCGATCTGAAGAGC	1
CCAAGTTTACGGACCTTGATGAAC	1
CCAAGTTTAGGGACCGGGGTGAC	2
CCAAGTTTAGGGACCGGGGTGATA	1
CCAAGTTTAGGGATACCGATGTG	1
CCAAGTTTGCCACCGGTTCGTCGT	1
CCAAGTTTTCGGGGGACAAGGTGG	1
CCAAGTTTTCTGGTGCAGGCA	1
CCAAGTTTTGATAAAGTTGCCAA	1
CCAAGTTTTGGGGGCATACCTATC	1
CCAATAAAACTCGGGCCGTGTCGT	1
CCAATAAACCATGGGCCCACCTG	1
CCAATAAACCATGGGCCCACCTGC	3
CCAATAAAGTTGAGATAAAGGCGC	1
CCAATAACCTCTATATCCGGCCT	1
CCAATAACTAAGATGATGTCCATA	1
CCAATAACTTAAGGTTGCCCGGAC	1
CCAATAACTTAAGGTTGTCCGGA	1
CCAATAAGATGTGGGCCTTGCCGT	2
CCAATAAGTTGCCATGCCAGTGCT	1
CCAATAATAAATTATAGGTGTC	1
CCAATAATATAACACTGGTGTCGC	1
CCAATAATATAGCCTACTACCAGC	1
CCAATAATATATCAGGGAAGTAGC	1
CCAATAATGGTTAGGGGTGTTAAC	1
CCAATAATTCAAAGGTGCTGGTTC	1
CCAATAATTCAAAGGTGCTGGTTCT	1
CCAATAATTTAAGGTTGCCTGGA	1
CCAATAATTTAAGGTTGCCTGGAC	1
CCAATACCCTTGGTGCGTGTTCAG	1
CCAATACCTCCTGAAGGATGGTAA	1
CCAATACGATCACACCGTCCGCAC	1
CCAATACGTGTAAAGAGGAGGCCT	1
CCAATACTGGGTGCGCTTATATGGG	1
CCAATACTTCAGGGGTGAAGTAGA	1
CCAATAGAGAATGGGGCTGTCTAT	1
CCAATAGATATATGGTCCACATGT	1
CCAATAGATGGAACCAGGTCAATG	1
CCAATAGATGTAGCCACGTCTCGA	2
CCAATAGCGCCGGTGCCAGTGGAA	1
CCAATAGGGGTAGGGTGGTTCTC	1
CCAATAGGGTAGGGGTCCTCC	1
CCAATAGGTGCCGGCTATGGGGGT	1
CCAATAGGTTCTACGAATATC	3
CCAATAGTGTTCGTGGAGATTAGC	1
CCAATAGTGTTGTCGTTGCCTTAA	1
CCAATAGTTGGTGTGTTGATTTGC	5
CCAATAGTTTAGAGGTGTAATTCG	2
CCAATATAAATGATGTTCAGCTGT	2
CCAATATATGGTACTTAGGGGCA	1
CCAATATATGTGAACTGGGTGGCC	1
CCAATATATTACAACCTAGGATGG	4
CCAATATGGCTGCCATGAAAGATG	2
CCAATATGTAGCAACCTAGGATGG	1
CCAATATGTGAAGAGGGTGATTGG	1
CCAATATGTTGCCCTGAAAATTAC	1
CCAATATTCCGAGTGTGGCCTA	3
CCAATATTGGAGCGGTGGGGTGTC	1
CCAATATTTTGGTAGTGCCAAAG	1
CCAATCAAACCGGTGGTGTGGGG	1
CCAATCAAACGGTAATTCCTATAT	2
CCAATCACCAGAGGTCCTTCGGC	1
CCAATCAGGAAAAAAGATCGC	4
CCAATCAGGAGTCTTGGTGAATAC	1
CCAATCAGGTGATGGAGGTCGAC	1
CCAATCAGTGCGTCTACTTTCTA	1
CCAATCATCAGATGTCGAAATAGC	1
CCAATCATCGCCGGCCTACATCGC	1
CCAATCCAAAGGGACGACGTC	1
CCAATCCAAATACTAGGTTGCTA	1
CCAATCCACGGTGGTTTTGGTCTA	1
CCAATCCTACTGTGCCTGAAGACG	1
CCAATCCTGGGTTTGAATCGTGTC	1
CCAATCGATCTACATCGGTCAGAC	2
CCAATCGGGACAAAAGATGGCAGC	1
CCAATCGGGACTACGAATCCGGGA	1
CCAATCGTTATGGTTGTGGCGGCC	1
CCAATCTAATTTTATTGGGTGCAT	2
CCAATCTACTAAACGGTGTGTTT	1
CCAATCTAGATCAATGTTGCT	1
CCAATCTGCCTTGCAGACGGGAC	1
CCAATCTGCGGTGGTTTTGGTCTA	1
CCAATCTTGTGCGGAAGAATGGAG	2
CCAATCTTGTGTAGAAGAATGGA	1
CCAATCTTTCGGAAGTGCTTATAG	2
CCAATGAAAGTAAGGCCAGGAG	1
CCAATGAACATGCTGGAAGGT	1
CCAATGAAGGAGGTGGCTCATAGA	1
CCAATGAAGGTACTCCAACCCACA	1
CCAATGACAATAAAGTGTATGCGG	2
CCAATGACGGTGAGGTAGCAGCGC	1
CCAATGACGGTTGGTGGGTATTAC	1
CCAATGAGGTGAGGGACTCCCCCA	1
CCAATGATAAAGAGGGGAGGCAGC	1
CCAATGATAGTAACAGTAACCGTGC	1
CCAATGATGAGTGAGGCTGACA	1
CCAATGATTTCATAACTTAGTGAC	1
CCAATGATTTGGTAAGGTAGAGA	1
CCAATGCAAAACTTGATAGTGTC	1
CCAATGCAAAACTTGATAGTGTCC	2
CCAATGCAAAACTTGATAGTGTCT	1
CCAATGCAGCTAAAGGTGCTATAC	2
CCAATGCAGTTGCCTACATATCAAG	1
CCAATGCCTAAAGGTAGGGGTGAA	1
CCAATGCCTAAAGTATAGCGAT	1
CCAATGGAGCAGCAAGGCCAA	1
CCAATGGCAAGCCAAAAAGATCAC	1
CCAATGGCATAGGATAGGGAGCAA	1
CCAATGGGTGCAGCGATCGGCGAA	1
CCAATGGGTTAGGTTGACTGGT	2
CCAATGGTTACGTAAGCTACACGT	1
CCAATGGTTGCTGCGTATCCTACA	2
CCAATGTCATTGGCGCCGTGGTCC	2
CCAATGTCCAACGTATGTGCT	2
CCAATGTCTTATTGGGAGTGTCCT	1
CCAATGTGACAACTCGGGGTGAA	1
CCAATGTGACATTTTTAGGGGCAA	1
CCAATGTGACCACGGTTGGTGGGCC	1
CCAATGTGACTAGGGTGGTCTTC	1
CCAATGTGATAGGATAGATGC	4
CCAATGTGCACGGGTTAGGTGGGC	2
CCAATGTGCTAATGAAGTGTGGCT	1
CCAATGTGGCGCAAAACGGTACT	4
CCAATGTGGCGGCGAGGTAGCA	1
CCAATGTGGCGGTGTTCCTTCGGC	1
CCAATGTGGTGTAGCGTTGAGC	1
CCAATGTTGTACTACACCTGCAGT	1
CCAATGTTTGACCGTCCGTCTTA	1
CCAATGTTTGGGCCACATTAACAG	5
CCAATTAAGGATTTGCCACTCAAAG	2
CCAATTAAGGGAAACGAATGGGCC	3
CCAATTAATGAAGACTAGCTATGC	1
CCAATTAATTGATTGTGGGCGT	2
CCAATTAGGAGGCGAGGATGGT	1
CCAATTATAGGATCGTAAAGGGCA	1
CCAATTATGTGGTTGCTGCTC	1
CCAATTCATATTTTTGTGGTGTAT	1
CCAATTCGAGGTGGCCCACATAAC	1
CCAATTCGGAATGGGGCGATGAA	1
CCAATTCTGGAGATTAAGGTGTAA	4
CCAATTCTTTGCTGTGGTGTTGCG	1
CCAATTGAAGTGAAAATCAACGGT	1
CCAATTGACGTGGCGCTGAGGTGT	1
CCAATTGAGATATGGTCGCACAG	2
CCAATTGCCTTGGCGCTGAGGTCC	3
CCAATTGCTACCCCAGTGCCC	3
CCAATTGGAGCCACAACTTTAGG	2
CCAATTGGGCAGGCCTACATATAC	1
CCAATTGGTCCATAGTGTGCATAA	2
CCAATTTAAATGAAAATCGATGGT	1
CCAATTTAAGTAAAAATCAAGGG	1
CCAATTTAAGTGAAAACGGATGG	1
CCAATTTAAGTGAAAACGGATGGA	2
CCAATTTACTTGGTGGGTGCAGGG	1
CCAATTTAGAATCCATGATGC	1
CCAATTTAGATGGCTGATGTAAA	1
CCAATTTAGGTGGAGCTGAAACT	1
CCAATTTATGGGCCTCCTTTTCAC	1
CCAATTTCGAATGGTATATATGG	1
CCAATTTGGATTCCTACTTGATCA	1
CCAATTTGGCTGACCAAATGTGG	1
CCAATTTGGTACCTGCATGCGAAA	1
CCAATTTTCAGTGGCATATAAGG	1
CCAATTTTCCTCCAGGTGCTC	1
CCAATTTTGCAAGGATGCCACTCG	2
CCAATTTTGCCTTTAAAGATCGAG	1
CCAATTTTGGGCTGGCCTAATGAA	1
CCACAAAACCAGATATGCAGGTCC	1
CCACAAAACCAGATATGCGGGGTC	2
CCACAAAACTCAAGCGCGGGTGAC	1
CCACAAAATTATACTACGGGATGG	1
CCACAAACATTGAGGATGCCCTA	2
CCACAAACATTGAGGATGCCTTAA	3
CCACAAACCCAACTAGAGCCA	1
CCACAAACGGTGCTACGCCTGGA	1
CCACAAAGATAGGTCTAGGTAAAA	1
CCACAAAGGGTGTTGGTCGATTAA	1
CCACAAATAATAGTTGGCAGTGAC	1
CCACAAATCAAATATTAGGACTGC	1
CCACAAATTTGTACTACGAGGGT	1
CCACAACACTCGGCCTACTATTGC	1
CCACAACACTCGGCCTACTATTGCC	1
CCACAACACTGGAGAAACGCCTA	1
CCACAACCAAAATTTTGGGGAAGC	1
CCACAACCGCCATCTAAGAGTGCA	2
CCACAACTAATCAAAACCGGTGAC	1
CCACAACTCACAAGACACTGC	2
CCACAACTGAAACTTGGATGGGAT	1
CCACAACTTTAGATTCCGGGCCT	1
CCACAACTTTAGGTCCTGGGCCT	2
CCACAAGAAAAGGAGGATGCCAAC	1
CCACAAGACACAGCCCCACGACAC	3
CCACAAGAGATGTCTGGTGTGCCA	1
CCACAAGATGATGGGCTAGCCGG	1
CCACAAGATGATGGGCTAGCCGGT	1
CCACAAGATGGTAGACTAGACGAC	1
CCACAAGATGGTGAACGAGACGAT	1
CCACAAGATGGTGGGCTAGACGAC	1
CCACAAGATGGTGGGCTAGACGAT	1
CCACAAGATGGTGGGCTAGCCAAC	1
CCACAAGATGGTGGGTTAGCCGGC	1
CCACAAGCAAGATTGAATTGGATG	1
CCACAAGCATTGGTGCGTCCGTA	1
CCACAAGCTAGCCCGTGCCTCAAA	1
CCACAAGGAACCTAACTAGTTGAG	1
CCACAAGGAACGTGTGTGCTCAGC	2
CCACAAGGATGAAGTGCAATGG	1
CCACAAGGTGATAGACGATCTGGG	2
CCACAAGGTGATGGAATAAACGAC	1
CCACAAGGTGATGGGCTAATTGGT	2
CCACAAGGTGGTGGGCTAGACGAC	2
CCACAAGTCGAGGGGTACATTGTC	1
CCACAAGTTAGTGGGCTAGACGAT	1
CCACAAGTTGATGGGCTAGGTGAC	2
CCACAATAACGATCCAAACTC	2
CCACAATAGACTTGGTGATGTGAG	1
CCACAATGGGTGTCTCAACCAAAA	2
CCACAATGGTAAAGTAAGATGCTA	1
CCACAATGGTAAAGTAAGGTGCT	1
CCACAATGGTAAAGTAAGGTGCTA	2
CCACAATGGTAAAGTAAGGTGCTC	1
CCACAATGGTAAAGTAAGGTGTT	1
CCACAATGGTTATCTATAGCCTC	1
CCACAATGGTTATCTATAGGCTCT	1
CCACAATGTAAGAAAGTGCAA	1
CCACAATGTACTACAAAAGTAGT	1
CCACAATGTAGTCCAAAAGTGGTA	1
CCACAATGTATGAAAAAGGTGACC	1
CCACAATGTATGAAAAAGGTGATC	1
CCACAATGTGAACATAAGGGTGG	1
CCACAATGTGAAGTTTGCCGGTAC	1
CCACAATGTGCATGCAAATATGAT	1
CCACAATGTGGTTAGGTAGCTGAA	1
CCACAATGTTGGAAAAAAGGTAGC	1
CCACAATTAAACAACATCGCAGGC	2
CCACAATTAGATGATGTCCCT	1
CCACAATTCGTGTGCTACTTTCC	1
CCACAATTGATGCTACATATATG	1
CCACAATTTGATGCGATATGTTGC	1
CCACACAAAATTCAAGAAGGGTGT	4
CCACACAAGATTGACTACATGGAC	1
CCACACAAGATTGGCTACAGAGAC	1
CCACACAAGATTGGCTACAGGGAC	1
CCACACAAGATTGGCTACATAGGC	1
CCACACAAGATTGGCTACATGGAC	1
CCACACAAGATTGGCTACATGGGC	2
CCACACACACAGACCCCTACACGC	1
CCACACACTAACTCTCTCTTTCCA	1
CCACACACTTCAAACCAGGGTTGG	1
CCACACAGCAAAATGGGGGCCAGA	1
CCACACAGCAGCTGTGAAGGGGCA	1
CCACACAGGATGAGATAGATGGGA	1
CCACACAGGCACATGATATGATGG	1
CCACACATAAATAAATTCAGCAC	1
CCACACATACCCTACCTCTATGAA	1
CCACACATATATGGGTGCTTTCAC	3
CCACACATATCGGGCATACGATA	2
CCACACATCAAACAATACTACAAA	1
CCACACATGATTTGCTACATAGAC	1
CCACACATTTTCTCTATATGGCCC	1
CCACACCAGGTGGATTGGCGTGAC	2
CCACACCATCCTGGTTGCCGTGGT	2
CCACACCATGCGGGTAACGGGTAC	1
CCACACCGATCCTAACAACATCAC	2
CCACACCGCTAGGAGCGACGCAGC	1
CCACACCGTGGCTACCGGATCTGG	1
CCACACCGTGTCTATGACATGTGG	1
CCACACCTCTTGACTAGTGGATTG	2
CCACACCTGAAAATATGGGCTGC	1
CCACACGAAATGACTTTTGGGGAA	2
CCACACGAGTCAATGACATGTGGA	3
CCACACGAGTGTGGTGCTGTGCGA	1
CCACACGGATGGATGCCACGGCAC	1
CCACACGGCATGGTTATCGACTA	1
CCACACGGCTGATTGGATGAA	2
CCACACGGGTGCGATGTTTTTGAC	2
CCACACGTAACGTAAGATGGT	24
CCACACGTATACGGCCGCCTCGAC	1
CCACACGTCAGCCACTGCTACTGC	3
CCACACGTCAGTGCTTGTAATGGT	2
CCACACGTGGGTGCGATGTAATAT	1
CCACACTGACTCAGCAGACACGAA	2
CCACACTGAGATTTCAGTCCTGG	1
CCACACTGTAAACTCTCCTTC	1
CCACACTTCCTTAGGCACGCAAGC	1
CCACACTTTGTCTAAGGTGAGGT	2
CCACACTTTTAGAGTGTCCTTGGC	3
CCACACTTTTGTGGATGCCTCGAC	2
CCACAGACGAAGCCAATATGTTGC	4
CCACAGATCTGTAGCTTACTGCTC	1
CCACAGATGGTTCCTGCTCTCAGC	2
CCACAGCAAAAAAGGAGCACACA	1
CCACAGCAATGCCTCGGTAGTGGC	2
CCACAGCATCGCCTATTAACCAG	1
CCACAGCCGAAGCTAATATGTTGC	1
CCACAGCGAATATGGTGTCTCTTT	1
CCACAGCGGTAGGAGCTCGGTGAC	1
CCACAGCTACATTCACTTGCCTCC	1
CCACAGCTTAGAAGATTGATTGAC	1
CCACAGCTTTAAGCTGCCAAGTGC	1
CCACAGGAACCTGCATGGTACTGT	1
CCACAGGAGGAAGAAATCTAGAG	1
CCACAGGATGGACGGTGGAGATGG	1
CCACAGGCAGCTCAACTGGGGTA	1
CCACAGGGATAACTGGCTTGTG	1
CCACAGGTGGCAGCACTGGCGGAC	1
CCACAGGTGTGTGGACGGTCTGAC	2
CCACAGGTGTGTGGGCAGTCTGAC	1
CCACAGGTGTGTGGGCGGTCTGAC	1
CCACAGGTGTGTGGGCGGTTTGAC	2
CCACAGTACGTAGGTGGGTGTAGA	1
CCACAGTACGTTTGAGGTGGGTGT	1
CCACAGTAGGTGTAAGGTGGGTGT	2
CCACAGTATGTTAGAGGTTGGTGT	1
CCACAGTCATCTTGCCAAGCGAAT	1
CCACAGTCGAAGCCAATATGTTGC	1
CCACAGTCTAAGCCAATATGTTGC	1
CCACAGTCTTCTGATTTGGTGAA	1
CCACAGTGTGCGGGTAACGGGTAC	1
CCACAGTGTTAAGGTATGTATTGC	3
CCACAGTTAGAAAAGCGCGGGAGC	2
CCACAGTTGGTGGGCTAGGTTGCG	1
CCACATAAGATTGGCTACATGGACA	1
CCACATAAGCTTAAATAGTGAGGT	1
CCACATAAGGCAGCCGCCAGTGAA	1
CCACATAAGGTTCCACCTGCGAAA	1
CCACATAAGTAGGTGTTTGGGAGA	1
CCACATACCAGCGATTATAATGGT	1
CCACATACCATGTCTTATACAGA	1
CCACATACGACGACGGGTTGCCA	1
CCACATAGAGAGAAGCTGGTCTGC	2
CCACATAGATGCCATGTCTGCC	1
CCACATAGCAAGATATATGGGGAT	2
CCACATAGGTGCCAAAAACGTGAC	1
CCACATAGTGAAGTGTCTACTTTC	1
CCACATATAGGTGATACTTGAGAG	5
CCACATATCACAGTGAGTGGCGAC	1
CCACATATCATTGAGTCCTATGTG	1
CCACATATGATTAGATGATGAGA	1
CCACATATGTGGAGTGTGCGTAGG	4
CCACATATTAGTGAGCAGTACGGC	1
CCACATATTATAGACACATATGG	2
CCACATCAATGCCACGTGGGATGC	1
CCACATCAATGCCACGTTGGTGAA	1
CCACATCAGGGACAAAACTGGTAC	1
CCACATCAGTGCCAGGCCTTGGT	1
CCACATCATACTATCCGCATCCGC	1
CCACATCATCTCACAGCTGTA	1
CCACATCATCTCACGGGTGAATCT	1
CCACATCCACGACCTAGCCTA	3
CCACATCGCAATCACAAGGTC	1
CCACATCTAGTGCAACTTCTG	1
CCACATGCACTGAGCGAAGGTTGT	2
CCACATGCCATAGATATATGAGGG	2
CCACATGCCCTGGTAATTCAG	1
CCACATGCCTTATTTAGGACCGG	1
CCACATGGAGAGAAGTTGGTCTGC	1
CCACATGGAGGTCATGAGATGCC	1
CCACATGGCATGCCACATAGGTAA	1
CCACATGGTACAACTACAAACTGC	4
CCACATGGTGGATTGATTCTGGAG	2
CCACATGGTGTGCCACGTAGGCAA	3
CCACATGTAAGTGGTCTACGTCAA	1
CCACATGTATACCACGTAGGACA	2
CCACATGTCAGTGCCACATGGAGC	2
CCACATGTCATTGACAGGGTGT	4
CCACATGTCATTGAGATAGGGGT	1
CCACATGTCGGTGATATGGGCCT	1
CCACATGTCGGTGTCTATAATAA	1
CCACATGTGCTAATGATGGATTAA	1
CCACATGTGCTCTTATGGGGGG	2
CCACATGTGTGGCCACGTAAATGCA	1
CCACATTAGATATATGAGGGTCC	1
CCACATTAGATTGCTAGACTT	1
CCACATTAGATTGGGTGATGAGGT	1
CCACATTAGCCTTGCCGGGATGGT	1
CCACATTAGCTTTGTGTCCTTGGA	1
CCACATTAGTGTAGTGTAAATGG	1
CCACATTAGTTGTGTAAGGACAAA	1
CCACATTATCAAATCAAGGTGTAA	1
CCACATTGAGTGCCATGTGAGGAG	1
CCACATTGTGGATGCCCTAATGGT	1
CCACATTGTGGATGCCCTTACAGC	1
CCACATTTAGAGGCATGCGGTTGA	1
CCACCAAAATCATCATATGGATATG	1
CCACCAAAATCGGATGCCTAAGAA	1
CCACCAAAATCTTTAGGCCTGG	1
CCACCAAACATCCTCTAGTGGAG	1
CCACCAACAATTGGCGGCGCTGGC	1
CCACCAACACTACTTGATACCAGC	1
CCACCAAGAACGATGGGTGCAC	1
CCACCAAGACTAGCCTGGCAAAA	1
CCACCAAGCCTGGAAGATGTTGGG	1
CCACCAAGCTGTCTAGAGATGATG	1
CCACCAAGGCTTTGATGTGGCGAT	1
CCACCAATATATGGGGCTTGATGG	4
CCACCAATGATTGTAAGCCGGCCT	1
CCACCACAAAGTGCTATAACTTGG	1
CCACCACACAAGTTTAGGGACCGG	1
CCACCACACTGCGCCAGCCATCC	1
CCACCACACTTTTGTGGCTGCCAC	1
CCACCACATCGTACTGCAGGTGAG	1
CCACCACCCCACCTTGTGGAGCT	1
CCACCACCGAACTATCGTCTC	1
CCACCACCTTGTGGAGCTAGCCGG	2
CCACCACGGATTAGATTGAGGG	1
CCACCACGTAGGTGTCATGGCAGC	3
CCACCACTATCGATAGGTGACCCA	2
CCACCAGAAAACTGCGATACAAAT	1
CCACCAGAAATGATTGATATAAGC	1
CCACCAGTCCTCGAGGGATGTTG	1
CCACCATATTCAAGTCTTATACGG	1
CCACCATCAGAAGAATGCCGCTAA	1
CCACCATCATGTCACTGTGTCCGC	1
CCACCATCGAAGGGAGTTGGCGGC	2
CCACCATGCCACTGGGCCAATGA	3
CCACCATTTGACAATATGGTACTA	1
CCACCCAAAAACCCGCGGGAGTGC	1
CCACCCACATATACTGCCATAGGA	1
CCACCCATATATACTGCCTTGGG	1
CCACCCATGCCGAAATATTGAG	1
CCACCCATGTATACTGCGACGGGA	1
CCACCCCTGCCTTCTTTGTATAGA	1
CCACCCGAGGGGTAGTCTACAGA	1
CCACCCTCTTTTCTGAAGGTT	2
CCACCCTGCCTAATGGGTATATC	2
CCACCCTGCTTAATGGGTAGATCC	2
CCACCCTGGCTTCGTTGGCGATGC	1
CCACCCTTGCATGTCTGCCAT	1
CCACCCTTTGTGCTCTGGTGAGAC	1
CCACCGACTAAACAAAGCTACGGC	1
CCACCGAGAAGATGTAGTGCACGA	1
CCACCGAGGGACCTAAAACGAATG	1
CCACCGAGTGGCCAGTGATGGATC	1
CCACCGATGAGAGGGATTTGGGTC	1
CCACCGATGCATAAGTACCAC	2
CCACCGATGTCGACAGCAACGGC	1
CCACCGCAATGCCTTCGATTCTGC	1
CCACCGCCGCGTGCTAAGTAGTGA	1
CCACCGCTAGGCTGATGTCACCCC	1
CCACCGCTCAACCACGAAGCCAC	1
CCACCGCTGGAGCCACTTTTGCAC	1
CCACCGGAGAATGTAGAACAGCGCC	1
CCACCGGATCTGGCCAGAGGGTAC	1
CCACCGGATGCCGCCATCATTGAA	1
CCACCGGGTGTAGTATAGATCTGA	1
CCACCGGGTGTGTATTGATCTGAC	2
CCACCGTACGTGGTGACCTAGATA	3
CCACCGTGGTGCCATGATGGAGCT	1
CCACCGTTTGGGTGTGGATGGGAG	1
CCACCGTTTGTCCAGATTCATTGT	1
CCACCTAAAATGAGAATGGAGCTA	1
CCACCTAACAAGTTTGCGTACCAC	1
CCACCTAAGGACCCAAAGTGACCCG	1
CCACCTAAGGACCTTGTGCGTGA	3
CCACCTAAGGACCTTGTGCGTGAC	1
CCACCTACAACAGTACTTTCACCA	1
CCACCTACACTGGACAAAGATCGC	1
CCACCTACCAGATCTGGCCGATG	1
CCACCTACCCGCATTTATGGCGAC	1
CCACCTACCCTGTCGAACTGACGC	1
CCACCTACCTGGGGTCAAAATGGT	1
CCACCTACGAATGGGGAAGAGGAG	1
CCACCTACTGATCCAGGAAGTGGT	1
CCACCTAGAGTGTGATGGTCTTGC	1
CCACCTAGCAATATTGTGGAACT	1
CCACCTAGGTCATATTGGGTCTGC	1
CCACCTAGTATAGTGTCTATGG	1
CCACCTAGTGGTGTTTATGGGCA	1
CCACCTATATATACTGCCGTAGGA	1
CCACCTATCGCATGAATTCAG	1
CCACCTCAAACGTATTGTGGG	1
CCACCTCAACCGTACATATAGTGG	1
CCACCTCAATGGTGCTGCACCGAC	1
CCACCTCATGATGGAGATCGATGA	1
CCACCTCATGGGCCATGTATACAC	1
CCACCTCCAAACACAGCCTTAGAG	1
CCACCTCCACCACTGGAGAATCC	1
CCACCTCGCGCGTGCCATTGGTCC	2
CCACCTCGGTACCTTACCCAAG	1
CCACCTCGTTGTCGTCTTCGCTCC	1
CCACCTCTAGATTTCCGTGTCCAA	2
CCACCTCTCCTCCGATGACGACTG	1
CCACCTGACGTACCAGATGTGCG	1
CCACCTGATAGAGTCCCGTTTGG	1
CCACCTGCCAAGTTGATGCACCG	3
CCACCTGCCAAGTTGTTGTACCGT	1
CCACCTGCCTGAGTAAAATCACCG	1
CCACCTGCGGTGAGAGATTGTT	1
CCACCTGCGTGGAAAAATAGTGGT	1
CCACCTGCTACGTTATTGTAC	1
CCACCTGTCAAGTTGATGTACCG	1
CCACCTGTCATGTGCATTACGTCT	2
CCACCTGTTTGGATTATTGAGGG	1
CCACCTTACAAGTTTATGTACCGC	1
CCACCTTAGGGGGTGTTTGAGAAC	1
CCACCTTAGTAGGCCTAGTCACA	1
CCACCTTATATAGGTTAGGGGGCA	1
CCACCTTCACACACGGCACCCTA	1
CCACCTTCCATTGACGGCAAGGAT	4
CCACCTTGCTTACAGATGGACCT	2
CCACCTTGGGATGCTAGGAATGG	1
CCACCTTTGCTGGCAGATGCA	2
CCACGAAACAAGAGTAGGGTATGC	1
CCACGAAACTGCCTGGCGGACTGC	1
CCACGAACAATAGGTTGTTGGGAA	1
CCACGAACGCCTTAGTGTTGATGG	1
CCACGAACTTGTAAAGCGCACATC	1
CCACGAAGAAACACGCACGAGGGG	1
CCACGAAGATGCTGGATGAGTGTA	1
CCACGAAGATGGACCAGTTTGGCA	1
CCACGAAGGCGGTGATGATGCGGC	1
CCACGAAGTTATGGTGTACTGTAG	2
CCACGAATCATCGGGGGTCCACGT	1
CCACGAATCCAGGACTAAAGATGC	1
CCACGAATCCAGGATAAAGATGG	1
CCACGAATCCAGGATAAAGATGGT	1
CCACGAATCGATGCTACCGTTGG	1
CCACGAATCTGGACAGAGTTGTG	1
CCACGACAAGGAGATGGCTGGGC	1
CCACGACAATAGCGCTGGTACCC	1
CCACGACTACGAGGATGCGGACAG	1
CCACGAGAGACAGATGGACTTTGA	1
CCACGAGATGGTGGACTAGATGAC	3
CCACGAGATTAAAATCACCAGGG	1
CCACGAGGAGAACCTGATGGGCGA	2
CCACGAGTGTCTCACTGTTGATGG	2
CCACGATACCGACGCAACAACGGG	1
CCACGATAGTTCAAGGGTGTA	1
CCACGATAGTTCGAGGAGGTAA	1
CCACGATGATGCAAGCAACGATGG	1
CCACGATGGTATAGAGGAGAGGCT	1
CCACGCACAGGAGTAGGGTGTTA	1
CCACGCACATTGCAGATTCCACTG	1
CCACGCAGGTGGCGTAGATGCGGC	5
CCACGCCATCTAGACCGGCATGAC	1
CCACGCCGACGCACGAAGATGTGG	1
CCACGCCGGATTGATTAGAGTGAC	8
CCACGCCGTTCCCTCTCGACGA	1
CCACGCCTGGAGAGAGGATTGA	2
CCACGCCTTATTGGACTGTGCCT	1
CCACGCCTTTGGGATTGAAAGGG	1
CCACGCGACTATGATCTCGCCGAA	1
CCACGCGAGTGAGAGTGGTGTGAC	1
CCACGCGATATGTTTGTGCAT	3
CCACGCGATGGTAAGATGGTCCA	1
CCACGCGCACACTTTTCAAACTGC	1
CCACGCGTACGCCACGTAGACCAA	3
CCACGCGTACGCCACGTAGGACGA	1
CCACGCGTATCAGAGTTTGTGGAA	1
CCACGCGTGCCAAGTCAGTCTGGA	3
CCACGCTACCAAGGTTGCAATGGT	1
CCACGCTACCTCACATCTGCTCGC	1
CCACGCTGACACTCGCTACACCA	1
CCACGCTGGATGTTGGCCTGCTGC	1
CCACGCTGTAATGGATTGGTTTGC	1
CCACGCTGTCTGCATCGTCCTCGC	1
CCACGCTTTTTGGGACAGGTC	7
CCACGGAAAGCCTAGTTTTGGTGGT	2
CCACGGAAGCAGTATGGATGAC	1
CCACGGAATACCATACGATAGA	3
CCACGGAGTTTCCGATAATGGGGT	1
CCACGGATTGATTGATGTCACTAG	1
CCACGGCCCACACACTAACAACA	1
CCACGGCGTCTCGCTGTTGATGGA	1
CCACGGCTACACTTATTTTGGGAC	1
CCACGGCTGCACTTATTTTGGGA	1
CCACGGCTGCACTTATTTTGGGAC	1
CCACGGCTGTACTTATTTTGGGAC	1
CCACGGGAGAATGGGGGCGGGG	1
CCACGGGAGTACTGGTTCTTGGCC	1
CCACGGGCCACGAATTGACATGTT	1
CCACGGGCCAGACGAGAAAATTGC	1
CCACGGGGTACGGTAATATAA	1
CCACGGGGTGCGTCCTTGATGGCC	1
CCACGGGTAAACGGACAAACGGGC	1
CCACGGGTACCAGTGGTCTCAGCA	1
CCACGGGTACCTGTGTGGATGGA	1
CCACGGGTACCTGTGTGGATGGAA	1
CCACGGGTGATACCTTGAGGATAC	2
CCACGGTCTACTGGGTGCACCTA	5
CCACGGTGAACGTGGTGCCTTTGT	1
CCACGGTGATAGCGATGCGTGCAG	1
CCACGGTGCAACAACTTGGTAGGT	1
CCACGGTGCAGCATACTTGGGTGG	1
CCACGGTGCATTAACTTGGCAGGT	1
CCACGGTGCTTTTGGTCTACGTGA	1
CCACGGTGGCAGGAGGACGGCGCC	1
CCACGGTGGTTTGGTCTATGTGGC	1
CCACGGTGGTTTTGGTCTACGTGG	2
CCACGGTGTGTGCGTGTTGGTGTG	1
CCACGGTGTTTTGGTCTACGTGGC	1
CCACGGTTGGTGGGCCGAGCTGCG	2
CCACGTAAACCAAAACCACCGCGG	1
CCACGTAACACGGTTGGGCCACCC	1
CCACGTAAGCGATGAACGAAATAA	2
CCACGTACGCAGCGGGTGTGG	1
CCACGTACGTTTTAGGCGCTTGT	1
CCACGTAGGACAAAACCGCTCTGG	2
CCACGTAGGAGCGTTAGGTATGCC	1
CCACGTAGGTCCGGTTGGTGTGAC	1
CCACGTAGGTGACACGTCAGCCAA	1
CCACGTAGGTGCCATGTCAGCCAA	2
CCACGTATATGGAGTGTCTTTCC	1
CCACGTATATGGGTTAGGTGAG	1
CCACGTATGGTGTCGGAGCTCC	2
CCACGTCAATGCCACATGGGACG	1
CCACGTCCAACTTTGATGATCTG	1
CCACGTCGGAGTGTCTAGGGGAGA	1
CCACGTCTACGGGGTCTGATGGAA	1
CCACGTGAAGGAGAGAGGGGCGAC	1
CCACGTGACATACCAACATGGTA	1
CCACGTGAGAAGGTGACTAGAGT	3
CCACGTGCACACATTGGCTAA	1
CCACGTGGACAAGGTGGGATGCCT	1
CCACGTGGATGCTCAAAGATTTGG	1
CCACGTGGCATGCTACATCAGCGC	2
CCACGTGGGTACTATGCTGAGTCA	1
CCACGTGGTGCACTATGAAGGGC	1
CCACGTGTACAGGGTTAGGTGGAC	1
CCACGTGTCAGATATACGAGGGCC	1
CCACGTGTCATTGAGATAAGGGT	1
CCACGTGTGAGGATGGAAAGAGAA	1
CCACGTGTGTAGGGTTAGGTGGGC	1
CCACGTGTGTGCACTGTGAATGG	1
CCACGTGTTATAGATTGTGAGTGG	4
CCACGTGTTGCTTCCGCGCGACAG	1
CCACGTTCGCTGTGAGGGCTAGAA	1
CCACGTTCGCTGTGGGGGCTAGAA	1
CCACGTTGAGTCAGTTGCCACATC	1
CCACGTTGCAACAGGTCCAACCAA	1
CCACGTTGCTAGTGTAGGAGGTAG	2
CCACGTTGTGTGGTGTAGTGAGGA	2
CCACGTTTAAACTACCAGATACTA	1
CCACGTTTGCGTACGAGCCTGC	1
CCACTAACATCTGGGTGAAGCCG	1
CCACTAAGCTAGCCTACGTTCGA	2
CCACTACAAAGGTGTGATGATGA	1
CCACTACAGCGAACGTGGAGCC	2
CCACTACCAAGCCTACTGAACCAA	1
CCACTACCGGAGCCAATATGTTGC	1
CCACTACGTCCTCATCTGGGCTCA	1
CCACTACTGGTGGCCAACATATCA	1
CCACTACTTGTGCGCGTGGTCAG	3
CCACTAGAACTCCTACATTCA	1
CCACTAGAACTGTCATTCGAGTG	1
CCACTAGACGCCACGTCAGCCAAA	1
CCACTAGGAATCCAGGATGGTGAG	1
CCACTAGGCAGTGAATTTGAGGTC	1
CCACTAGGGCTAGCTTAGATGAGG	1
CCACTAGTCAAGAGGTGTGGAACT	2
CCACTAGTTAAGAGGTGTGGAA	1
CCACTAGTTGCGTAGTCACGTCCA	1
CCACTATAGGTGCCGGTAACCTTT	2
CCACTATAGGTGCCGGTAGTACTA	2
CCACTATGACGGGTCGGGATGCC	1
CCACTATTACCCGCTGGCAAAGAC	1
CCACTATTGCATACTATTCGTGAAC	2
CCACTCAAGGGGTGCTAATTGGAG	1
CCACTCAGAGTGTCAAAACAGCGA	1
CCACTCAGGAAATACCGAGGATGC	2
CCACTCAGGTACAGTGGTTGACCT	1
CCACTCCAGACTCAACTCTTGAAGC	1
CCACTCCGGATTGATTCAGGGAGG	1
CCACTCCGTAAGCATGTTGT	1
CCACTCCTTAGGCCCGGTGACA	1
CCACTCGCTGTCTATGACATGTGA	1
CCACTCGCTGTCTATGACATGTGG	1
CCACTCGGCAGGTGTACTCCTC	1
CCACTCGGGTGGTTAGATATTGGC	2
CCACTCGTTGTCTATAACATGTGG	1
CCACTCTCCCACGGTGAGCGATGC	1
CCACTCTCGGGCCCACATGTCAAC	2
CCACTCTGTGTGTTGACGTGGCAT	2
CCACTCTGTTAGGTTTTCACGGAC	1
CCACTCTGTTGCACGACGGGTGGG	1
CCACTCTTACGGATGGTGATAGA	1
CCACTCTTGGTGTATGATGCTT	1
CCACTCTTGGTGTATGATGCTTTC	1
CCACTCTTTCGTTACTGCCAC	10
CCACTGAAGGACCTCGGTGACCG	1
CCACTGACAAGTGATGGAGCTCTG	1
CCACTGACATGAGCTGTAGATGGT	1
CCACTGACCACTGGACTGACCGG	1
CCACTGAGATTTGCCTTTTCCAAT	1
CCACTGAGCCAGTCAGCATCCGTC	2
CCACTGAGGGCAAGTGTTATGGT	2
CCACTGATGCCCAACTGTTGTGAC	1
CCACTGATTATTGAAAGGGCA	1
CCACTGCAGATAGGGTGTGGTTGC	1
CCACTGCCGCAATCGCGCGTGAGA	1
CCACTGCCGCATATGCGATCGGTC	1
CCACTGCCTAAGGCGGATGTGTCT	1
CCACTGCCTAGGGCAAATCCCCGC	2
CCACTGCGCAGGAAGATGTGCCCC	1
CCACTGCTGCCAACTCCATGGTC	1
CCACTGCTTCCCCTTCGATGCCG	1
CCACTGCTTGCCACCGGTTGCA	1
CCACTGCTTTTGTTGTGGCGGGTA	1
CCACTGGAGATGGGGTGTCATCAT	1
CCACTGGCATATTCAGAGAATGT	1
CCACTGGGCTTACCTGCCATGTGCC	1
CCACTGGGTGCTCCACCTGATTGG	1
CCACTGGTAGTAGCTGGATTGTA	4
CCACTGGTGATAGAGGGTGATAGA	1
CCACTGGTGTGCATATACTGCAG	1
CCACTGTAAGTAAGTAAGAGTGAC	1
CCACTGTGAAGGGCCTTACTGCT	1
CCACTGTGTCACCCAATGGATGG	1
CCACTGTTGCACTTCACCTTCGGG	2
CCACTGTTTGGCCATCCTCTAGCT	1
CCACTTAAAAAGACCGCACGTGAA	1
CCACTTAAACGGCGTCTACAAAA	1
CCACTTAAATTGGAACGATGTGAC	1
CCACTTAAGAGAGGGGGCTGAAAG	1
CCACTTAAGAGGCCCGCATACGAA	1
CCACTTAAGAGGTCCGCTTGCGAA	1
CCACTTAAGCGGCGCCTGCGAAA	1
CCACTTACGACACTACCTGAC	3
CCACTTACGAGGACTTGATTGGT	1
CCACTTAGGTAGTGTTTGGTTGCA	1
CCACTTATATATCTTAGATGTGAC	1
CCACTTATCAGGGAGTTGGTGGT	1
CCACTTATGATATTTGATCAGGGA	1
CCACTTATTTCGGGACGGATGG	1
CCACTTCAATGAGGAGGTGCAGTA	1
CCACTTCTTGTGTTTGTGGAA	5
CCACTTGAAATGGTAGGGTATGGT	1
CCACTTGAGGTTGGGAAAGGATGT	1
CCACTTGAGTCAATAGGAGGAC	1
CCACTTGATAGTGTCCCCCTCCT	1
CCACTTGTGTCAAAAGTGCGAAA	1
CCACTTTAAGAAACCATGGGT	1
CCACTTTAGGAGATGTAATTGATG	1
CCACTTTCGTTGGGTGCTTCT	2
CCACTTTGGATATAGAGGCTGGAT	1
CCACTTTTAGGGGTGTTTGGTTGA	1
CCACTTTTAGGTCTCGTGCGCTAC	1
CCACTTTTGAGGATGGCACAATGT	1
CCACTTTTTTTACGGACGATGGAA	1
CCAGAAAACACCATGGATGCA	4
CCAGAAAAGATGTATGGTGGT	1
CCAGAAAAGGTGTGAGCATAGCAG	1
CCAGAAAATCAAATACAACGGGTC	1
CCAGAAAATCAGTGTGCTGTTGGC	2
CCAGAAAATGAAGTAGAAATCAGG	1
CCAGAAACAGATGTACGATGCGA	1
CCAGAAAGTTGAGTGTGCCGGG	1
CCAGAAATGGGTGTCCATATTCAA	1
CCAGAAATTGTGCAAGGTTGAGGT	1
CCAGAACAACTTCTCTGGGTGTCA	1
CCAGAACACAGGAGTAGGGTGTTA	2
CCAGAACACCACGTTAGATGCCA	1
CCAGAACAGCAGAAATGCGACTGA	1
CCAGAACAGTTTGTCCTACGTGAC	1
CCAGAACCCTACATCTGTGATGGC	3
CCAGAACGATCAAGGATGCCGGGT	1
CCAGAACGATGTTGTTGGTACTGG	2
CCAGAACGGTAGATGTTGTGCT	1
CCAGAACGTGCTCGACAATGAC	1
CCAGAACTTGAGAAATGCTTAGGG	1
CCAGAAGAAAAGGGTGTCTGGAC	1
CCAGAAGAGGGTGCACGTCAG	7
CCAGAAGAGGTGGAGCTAGAGCT	1
CCAGAAGATCACAGGATTGTCTGT	1
CCAGAAGATCGGGCCACAAGAGAG	1
CCAGAAGATTGGGCCACGAGAGAG	1
CCAGAAGCATCCCTTGGTGTAGA	1
CCAGAAGCCACTGAACAAGGTGA	1
CCAGAAGGAGAAGACGTTTGGC	1
CCAGAAGGAGAGGGCGTTGTGCAG	1
CCAGAAGGCCACAGCGAAGGGGCA	1
CCAGAATATAAGAAGTTTTAGG	1
CCAGAATATAGCAATATAGAACT	1
CCAGAATATATTTTAGGTGTTGGT	2
CCAGAATCTGTCCCGGTGCTGCAT	1
CCAGAATGCGCTCTACTCTGTACC	1
CCAGAATGTCTAAGCTGAATGTGC	1
CCAGAATTGTTAATCTCTCTG	1
CCAGAATTTCTAAGCTGAATGTGC	2
CCAGAATTTGCCGGATCGGTTGGT	1
CCAGAATTTTGGGACCGGCCA	1
CCAGACAGGCCTCACTGGTGGAGA	3
CCAGACAGGGCCTAGAAACTGAAT	3
CCAGACATCTATACTATTTTGGGA	1
CCAGACATGAGGGGTGTGTACCTA	1
CCAGACATTATAATGGTAGGTGAT	1
CCAGACCATACTGTGCCAGGAAGC	1
CCAGACCATAGAGGTGACGAATA	1
CCAGACCGCATCGCCCACTCCG	1
CCAGACCGGCTTATGCCAAGGGAA	1
CCAGACGACGGGGTGCTACAACCT	1
CCAGACGAGTGGTTGCAGGCGGG	2
CCAGACGCACCACATTGACATGGT	1
CCAGACGGGTGAATCGACTAC	1
CCAGACTATGACGTGAAAACCCGC	1
CCAGACTGTGCCTGGCCGATTGAC	2
CCAGAGAAAAAGCCCGTGTGTTGC	1
CCAGAGAACTACTTGACTAACAAA	1
CCAGAGAATTGAACGTCCGGGTGCA	1
CCAGAGAATTGGTGAGTGACGCAA	1
CCAGAGAGGTACAATGGTGTGGGT	1
CCAGAGATGATAGCATAGGGATG	1
CCAGAGATGTGCATTGGTGTGGGT	1
CCAGAGATTTTGGGTGAATGTGAC	2
CCAGAGCAACGGTTGTGATTTGGC	1
CCAGAGCCACAATTTTAGGTCCTG	1
CCAGAGCGGTTTGTCCTACGTGA	1
CCAGAGCGGTTTTGTCCAACGTGG	1
CCAGAGGAGAATATTCTCTCCAGA	1
CCAGAGGAGAGACACGACACCGAG	2
CCAGAGGAGAGTAGGAGGGTGGAG	1
CCAGAGGCAGATCCTAGTGCA	1
CCAGAGGGAGGTGTGAATGGTTGG	1
CCAGAGGTAGCCGAATCGCGCCC	1
CCAGAGGTGTACCACTTTACCCAC	1
CCAGAGTCAGTCTATGGGTGTCC	1
CCAGAGTCGCTGGCGCCATGGTCC	1
CCAGAGTTGCAACCGATCAATCGT	1
CCAGAGTTTCCTGCTGATTAA	1
CCAGATAAGGTGGAACACTGCGA	2
CCAGATAATGCAGCGTGAGTGT	1
CCAGATACCTGTTTGGAAGAC	1
CCAGATATAGCCGATCCGCCAA	1
CCAGATATCAATGATATTGGCGC	1
CCAGATATGTTGATGTGCTCA	9
CCAGATATTGTAAGACGATGTGTC	1
CCAGATCAACTTTGCTTGCATTTG	2
CCAGATCCATTCAAGGTGCTG	7
CCAGATCCGGTGAGGGGCTGCGA	1
CCAGATCCGGTGTCTTCTGTCAAG	1
CCAGATCGAATTGCCACGTAAGCG	2
CCAGATCTGGACGCGGGCAGCAGT	2
CCAGATCTGGGAGGAAGCCGATGC	1
CCAGATCTTTCTGGTGCAGCTCGG	1
CCAGATGACCTATCTCAATCGGGC	1
CCAGATGAGAGTGTACCCAAG	2
CCAGATGAGGTGTCCCTCTATTGC	1
CCAGATGAGTACGGGCCTAGCAG	2
CCAGATGCAATGGGTGTGGAGAGA	1
CCAGATGCATTTGAAAGGTAGCGA	1
CCAGATGCGGGACCTATGTTATA	1
CCAGATGCGGGACCTATGTTATAT	2
CCAGATGCGGGACCTATGTTATATA	1
CCAGATGCTACTTGGATGATGGA	1
CCAGATGCTACTTGGATGATGGACC	1
CCAGATGCTGCTTGGATGATGGAC	1
CCAGATGGGACACTACATAGTACA	2
CCAGATGGGTGCATAAACTGTTAA	4
CCAGATGGTGTACACGCCCGTGTT	1
CCAGATGTAAGCGGGCAGTCTATG	1
CCAGATGTAAGTGGTGTGAGGGCA	1
CCAGATGTAAGTGTAACTAGGAAG	4
CCAGATGTCGAAAGGGGTTTTGG	1
CCAGATGTCGGAAGGGGTTTTCA	1
CCAGATGTCTCGAGCACGCAGCT	1
CCAGATGTGACCTGCATTATAGA	2
CCAGATGTGAGGAAGAGATGGAGG	3
CCAGATGTGCAATATGAAACGATT	2
CCAGATGTTGCTTGGATGATGGAC	1
CCAGATGTTGGAAGGGGTTTTCGG	1
CCAGATGTTTTGGTATAGACGGAC	2
CCAGATTATTAGGAGTAAGCTGAA	1
CCAGATTATTGAGAGTAAGCTGAA	2
CCAGATTATTGGGAGTAAACTGAA	1
CCAGATTCATAGTGTTAGGATGAG	1
CCAGATTCGTAGTACTACGAAGTGC	1
CCAGATTCGTAGTACTAGGATGA	1
CCAGATTCGTAGTCCTAGGATGGG	1
CCAGATTCGTTGTCCTAAAAGGGG	1
CCAGATTCTACTAGGATACGTCCC	1
CCAGATTGATGGCCAACTCAT	1
CCAGATTGCTGATAAGGATGCCA	1
CCAGATTGGTGAGATTGGTGGAAT	1
CCAGATTGGTGTCACCAACCGGGA	1
CCAGATTGTATTAAAGGTGTCGG	1
CCAGATTTAGCGAAAAGGGTG	3
CCAGATTTAGCGAAAAGGGTGA	1
CCAGATTTGATGAGTGGAATTCGT	1
CCAGATTTGCAGTGCCCGTTGACC	2
CCAGATTTTAGTGGAGGAGGAAGC	1
CCAGCAAAACTAAGAAACGGGAGC	1
CCAGCAAACATGGTATGATGA	4
CCAGCAAATAATGGATGCCCTCGC	1
CCAGCAACGATGTAGATGGTCA	1
CCAGCAAGATTGGAGAAGTGCAAG	2
CCAGCAAGCTTAGGGATGTGCA	1
CCAGCAAGGAGGTGTTCACCTGGG	1
CCAGCAATACTGCAGGCAATTCC	1
CCAGCAATAGCTCCTATTTTAGA	1
CCAGCAATCTGACCGATCGGTGAC	1
CCAGCACAGTTTGGACTGCCA	2
CCAGCACATCTGATGGATGGATCC	2
CCAGCACCGGGTGTCTGTCTT	2
CCAGCACCTAGATAGCGACACTAA	1
CCAGCACTGTTTCCTGGGACTGG	1
CCAGCAGAGGAAACAGGGGAAGGC	1
CCAGCAGATGGTGTTGGTATGGTC	3
CCAGCAGATTGTACCAGGTGTTGG	2
CCAGCAGATTTAGTAATGTGCCAGG	1
CCAGCAGCAAGAGGTGGTACATAC	1
CCAGCAGCAGCAACTGAAATGGAA	2
CCAGCAGCGGCAACCACGAAC	2
CCAGCAGGAATTGAACCCGCA	2
CCAGCAGGTGTGGAGCTATAACGA	2
CCAGCAGGTTGTACTGGGTGGTAC	3
CCAGCAGTAATCTTTCTCGAT	1
CCAGCAGTGTTGTGCTAGGGTTGC	2
CCAGCATAAGTTGTCCCTCTG	1
CCAGCATAGGTACTGGGGGGAC	1
CCAGCATATCATCAGAAAGAG	1
CCAGCATATCTTGAGATTGATGAA	2
CCAGCATGAGTGCGACGTGGTGAG	6
CCAGCATTCATTTGCCTGAGCTG	1
CCAGCATTTACTGTAGCTAGGGAG	1
CCAGCCAAACCGGTTTATGCTAGG	1
CCAGCCAAATGTTAAAGCAGGACT	1
CCAGCCAAATTAGATGGAGAGTTG	1
CCAGCCACAACCATGGCCTGATCC	2
CCAGCCACCTATACTGTTTTGGGA	2
CCAGCCACTCTGATGCCGTCAC	1
CCAGCCAGAATTCGAACTCGAGA	1
CCAGCCAGGCTGTTGGAGTGCAAA	1
CCAGCCAGTGAAACGGTGAAGTGA	1
CCAGCCAGTGGATTCATCAGCGAC	14
CCAGCCATCAGGTATGTAGGTGGA	1
CCAGCCATCTAAGGACCTTTAGAT	2
CCAGCCATGCTGGCGCCGTGGTAT	1
CCAGCCATTGAGGTGAGGGGTTCC	2
CCAGCCCAAGCCCAGCATTGTTGC	1
CCAGCCCAATGGTTGGTGAGTCC	1
CCAGCCCGCAATCTGACCGACGAC	1
CCAGCCCTACATTTAGTTTGCTGC	1
CCAGCCGATAACGCGAATAGTGGT	2
CCAGCCGATAGCCGATAATAGCA	1
CCAGCCGATAGCGATAGGGTGTAA	1
CCAGCCGCTGAGAACGACTACCTC	1
CCAGCCGTCAGGGTTGATGATGTC	2
CCAGCCGTGGTGACTGTGCTCA	1
CCAGCCTAATACTAGATGTGACA	1
CCAGCCTAGTACCGAATGTGACGT	1
CCAGCCTAGTTAGCGGTGGTAGA	4
CCAGCCTATCAGCCCATTAAAGGC	1
CCAGCCTATTATATTAGTGATGG	1
CCAGCCTCGAAGGGGATGGTGTGG	1
CCAGCCTGCAAAGTTGTGTAAGCG	1
CCAGCCTTACAGTAAACATGGTAC	7
CCAGCCTTGGAGATTGATGCACGA	1
CCAGCCTTTACTCAAAAAAGCTAC	3
CCAGCGAAACCACAGCCAAGGGA	1
CCAGCGAATGGCGGTAGGTAAGA	1
CCAGCGACGGTGGATACGCGG	1
CCAGCGAGATGGGCCTATTCACGT	1
CCAGCGAGGTAAGGAGGACTCGAG	2
CCAGCGATCTGACCGGTCTGTGAC	1
CCAGCGCAGAGGTGGGTTGACGGC	1
CCAGCGCCACAATAGTAGAGTGAC	1
CCAGCGCTCACACAAAGCTGGCGG	1
CCAGCGCTGTATGTGCCTCATGGT	1
CCAGCGGACCTATCATTCTACGAC	3
CCAGCGGAGGTGGAGCGGGATGGT	1
CCAGCGGGGTGCGACGAAGTACAT	2
CCAGCGGGTAATAGTGGAGGATGT	1
CCAGCGGTCTAGCTGAGTAGCTGC	2
CCAGCGGTGAGGACGACGGTGG	1
CCAGCGGTGTGGTAGTGAAGTTAC	1
CCAGCGTAGAGGATGGGCAAGGC	1
CCAGCGTAGGTAGGCCTGGTAC	1
CCAGCGTAGGTGCTAGGGGGAC	1
CCAGCGTGACAGCGATTGGAGGA	1
CCAGCGTGTCAACACTGGCGCGGG	1
CCAGCGTTGTGACGATAGGGGGAG	1
CCAGCGTTTTGGGACATTGTGTGA	1
CCAGCTAAAATTCGTAGGTGTCA	1
CCAGCTAAATACTAAGGTGGAGGA	1
CCAGCTAAATGCTGAGGTGGAGAA	1
CCAGCTAAATGTTGAGGTGGAGG	1
CCAGCTAATGGTGGGTTGTATGG	1
CCAGCTAATGGTGGTGTCCATGTC	1
CCAGCTACACAATGACGAAGCCAG	1
CCAGCTACACTCCCATTTGGTGGA	1
CCAGCTACGAGGAGTTTAAGCGAC	1
CCAGCTACGGACACTAGGGAGTAA	2
CCAGCTAGAGTACAGTGGTTC	1
CCAGCTAGCCCTACAAGGTGGTGG	2
CCAGCTAGCTCTACAAGGTGGTTG	1
CCAGCTAGGTAAAAGTACTGA	1
CCAGCTAGTAGGATGTTGTTGCC	2
CCAGCTATTTGTTGCCATGGCAGC	1
CCAGCTCAATACCCTTGTGGACGG	1
CCAGCTCGGCTCTACTCGTTGGAA	1
CCAGCTGACATGACGCTGAGGTGT	1
CCAGCTGAGGAACTACTAGTC	3
CCAGCTGAGGATAGGGGTGGACA	1
CCAGCTGATATGATGACAAAGCC	2
CCAGCTGATATGATGACAAAGCCA	1
CCAGCTGATGGTGAAGAGATCTCT	1
CCAGCTGATGTGGAGCAGGTCTGC	1
CCAGCTGATGTGGAGCAGGTTTGCC	1
CCAGCTGATTTTGATGTGCTTC	1
CCAGCTGCTCGATGAATGGTTCGT	1
CCAGCTGGCGATTGGTGGGAT	2
CCAGCTGGTCGCCTAGTTGGTAGC	1
CCAGCTGGTGACACATTGGATGG	1
CCAGCTGTAGTAGGCCAGCCTCAC	1
CCAGCTGTGGCGACGGGATGGCTA	1
CCAGCTGTGTTTGTTGTGCGG	3
CCAGCTGTTGGATTGGGCCAGATC	1
CCAGCTTAAGATGAGGAAGGC	1
CCAGCTTACACTCACCACTTGCAC	1
CCAGCTTACGAGAGATGGAGGTGG	3
CCAGCTTCTGGCTTTTAGTTCAT	1
CCAGCTTGGAGGAGCTCTGTGC	1
CCAGCTTGGATGCCTTGATGAGAC	1
CCAGCTTTACCCATACGATGCCC	1
CCAGCTTTTGGTATAGATTCTGA	1
CCAGGAAATGCCATTGTACGAGTC	1
CCAGGAACAAACATTGGTGTA	5
CCAGGAACGTCCTCTCTTGGCCAC	1
CCAGGAAGAAATAATAGGAGGGTC	1
CCAGGAAGACCAATATGGATACAA	3
CCAGGAATAAACACCCTGAGGTGT	1
CCAGGAATAACTGGGCGGCCT	1
CCAGGAATGGTGCACTCTGGTGAG	1
CCAGGAATGGTGCACTGTGGTGAG	3
CCAGGACATACAACGCGCTTGGTC	1
CCAGGACCAAAGCGCAAAATACGC	2
CCAGGACCACAGGGACTGAAGAGA	1
CCAGGACCACCCGGAACACCCTCT	1
CCAGGACCCACAGTGCCACCTAGC	1
CCAGGACCTAAGGTGCTACTGAGG	2
CCAGGACCTGAGCCAATTGTCAAA	1
CCAGGACTAAAGATGGTAGCGCC	1
CCAGGACTAAAGATTATATTTGG	1
CCAGGACTAAAGGGGTGGTTGCCA	1
CCAGGACTTGAACCCTGGTCGCCT	1
CCAGGAGAGGTGATGCTGGAGCTG	1
CCAGGAGGATGTTGAGGTGAGGAC	2
CCAGGAGGGGTGGAGTTGGAGCTG	1
CCAGGAGTATTCCAAGGTTATTGC	1
CCAGGATACATGTGGAAGGGCGGC	2
CCAGGATCTAAGGTGCTATTGAG	1
CCAGGATGCTTCGTGTTTTGC	5
CCAGGATGGATTTACGGGGTGAGT	1
CCAGGATGTCACATGGGATGGTA	2
CCAGGATGTCACATGGGATGGTAT	1
CCAGGATTCGAACCTGGGTCCTGC	3
CCAGGATTTAACGGAGTTGTGCTT	1
CCAGGATTTTGGACGGATGATGAC	1
CCAGGCAAGAGATTGATGGGAA	1
CCAGGCCACGTGGGCGATTATGTC	1
CCAGGCCATAAGGGAAAAGGTGGA	1
CCAGGCCCACCTGATAGCCACAAT	1
CCAGGCCTACCTACGCTGGTACC	1
CCAGGCCTATTTCGTGGAGTCGAC	1
CCAGGCGGAGCTAGCCATTGTTGC	1
CCAGGCGTGGAGCCTGCGGCTTA	1
CCAGGCTCTAATAATCGATGGGAA	2
CCAGGCTGCTCAGAATGACGAA	1
CCAGGCTTCTGTAGGATAGCCC	1
CCAGGGAAATGGTACTATTAACAC	1
CCAGGGAATTGAGTGTATGGC	10
CCAGGGAGCACAAACGATCAA	2
CCAGGGAGCCAGATGGGATTGGGC	1
CCAGGGATCCAAACAGGGGCTTGG	2
CCAGGGATTGGTACGGATAAACAC	3
CCAGGGCAACAATCTACTGATCTG	2
CCAGGGCTATGGAATGGGTTTTGT	4
CCAGGGGAAACCATCGACCAA	1
CCAGGGGAGGTACCGCCAAACGGG	1
CCAGGGGCCCTTTTGCAAAATCGC	1
CCAGGGGCTAAAACGAATTACCTA	1
CCAGGGGTACCCATTGTGGATGGC	3
CCAGGGGTGCCGAACATAGCGTAA	1
CCAGGGGTGTTCTCCATTGCGAGC	1
CCAGGGTAGCCTGTAAAAGATTGG	1
CCAGGGTATATGCGAGATTGAGGT	2
CCAGGGTATATGCGGGATTGAGGT	2
CCAGGGTCTACATGTCAGTGGTC	1
CCAGGGTCTACATGTCAGTGGTCG	1
CCAGGGTCTCGGAAAACACCCGGT	1
CCAGGGTGCGTAATAACTAAAAC	1
CCAGGGTGGAGTGCTACATCGGTA	2
CCAGGGTGTTGTCTACTGTGTGGC	1
CCAGGGTTATCGCGCTCCGATGGT	1
CCAGGGTTTGCCTTTTTTTAGGAC	1
CCAGGTAAGACCATTGTGAAGGCC	1
CCAGGTACGGTCCAGTGAGATGAG	2
CCAGGTACTACAAAGGATGGTCTC	1
CCAGGTAGCACGAGTATTTCT	1
CCAGGTAGCTTCGGATGAAATGGT	1
CCAGGTATAAACCTTGGGGTGGCC	1
CCAGGTATAACTCTTGGTATGGCC	1
CCAGGTATCACAGATATCAGGTAGC	2
CCAGGTATCATAAGTATCGGGTAA	1
CCAGGTATGCTGGCTGATGGTCGT	1
CCAGGTCAACACGGCTACGTAGGC	1
CCAGGTCAATACCGCCACGTATGC	1
CCAGGTCCAATACTCTGGTG	1
CCAGGTCGTCTAGCCCACCACCT	1
CCAGGTCGTCTAGCCCACCACCTC	1
CCAGGTCTAAGATGAGTCTCTGGT	1
CCAGGTCTAGAAGAGGTGGATCT	1
CCAGGTGAAAAATGCCACCCCTGC	1
CCAGGTGAAATAATCACTCGG	1
CCAGGTGAAATAATCACTCGGTGT	3
CCAGGTGAATCTGGTTGGTGAGAC	1
CCAGGTGAGATTGGTCGAGGTCCA	1
CCAGGTGATCACAATTATGAT	4
CCAGGTGCACACAACATAGTAGA	1
CCAGGTGCTCATAATGCGCACGT	1
CCAGGTGCTGCATTGAACTGC	5
CCAGGTGGTAGCGAGCGGTCAGC	2
CCAGGTGTATAGCCTGAACGGCGC	1
CCAGGTGTCACTTTGGAATTA	1
CCAGGTGTCCGCGTCGTCGCGTA	2
CCAGGTGTGTGGATACGGGTGTAGA	1
CCAGGTGTTCGGTGAAATGCCGAG	1
CCAGGTTAGTAGATAGCTTTGCTC	1
CCAGGTTCAAACTTAGGATTGGG	1
CCAGGTTCAGCAGCTTCCATGGT	1
CCAGGTTCTAAGAAGCTACCAACC	1
CCAGGTTGAATTCTTTGAGCC	1
CCAGGTTGAGTGAGGTACCTGCAT	1
CCAGGTTGATGTGATGGAAAAGGA	1
CCAGGTTGCTATATTATGGGATGG	1
CCAGGTTTTAGCCTACGTGGCAGC	1
CCAGTAACCACGGTAACCGCGCGG	3
CCAGTACACTATGCTGATGGGCAC	2
CCAGTACAGATTAGGTTCCTCGGC	1
CCAGTACTGTAAAAATAAGATGGA	1
CCAGTAGAAGATAAAGTGCCCCAT	4
CCAGTAGATGATAAAAATAGTTGC	13
CCAGTAGCATTCCCGGTCGTAGGC	1
CCAGTAGCCTTGCCAACCGGATGG	2
CCAGTAGGTCTTAGTTACGGTCGT	3
CCAGTAGTGATGTTTACTTGC	12
CCAGTAGTGCATTGTGCGAGGTGT	1
CCAGTAGTGCTGTCTGCCTTTCAA	1
CCAGTAGTGTTAGGATATCGGTAC	1
CCAGTATATTGTAGTGGCATGCCG	1
CCAGTATCCATGGGTACCATGTGC	1
CCAGTATCGAAAACCCTCCGCC	1
CCAGTATTGAAACACATCCATGGC	2
CCAGTCACACGAGTCCACCACGCA	1
CCAGTCAGACCGACGGTATGTGGT	1
CCAGTCAGCGACGACGAAAGCGGT	1
CCAGTCAGTGCCCTGTTCAGAATG	1
CCAGTCCACAAACGGGTAGTA	2
CCAGTCGACAGCGAGGTGTGTGGC	1
CCAGTCGATCGAGCCCAGTAGAAG	1
CCAGTCTAAACTAGGTTCCTTGGC	1
CCAGTCTATAGTCTATTGGTGAA	2
CCAGTCTATGATGGAAAGTATGAT	2
CCAGTCTCCGGTGTGCATTCC	1
CCAGTCTGACCGCTGCGTTGC	1
CCAGTCTGTGACCGGTTGAATGAC	1
CCAGTCTTATAGGTGCCGGTTCAT	1
CCAGTCTTCCGGAGGTGCTCATAG	2
CCAGTCTTCTGAGGTGCCCTTACCC	1
CCAGTCTTCTGGAGGTGCTCATA	1
CCAGTCTTGTAAGTTAAGGGATGC	2
CCAGTCTTGTTATGGGCCGTCACA	2
CCAGTCTTTCGGAGGTGTTTATA	1
CCAGTCTTTCGGAGGTGTTTATAC	1
CCAGTGAAAATAATATGGTACCGC	1
CCAGTGAAAATGATAAGGTGACGC	1
CCAGTGAACCTATTGCATTGATG	1
CCAGTGAAGAGGACAATGGAGATG	1
CCAGTGAAGGTACCCTTGCATTGC	1
CCAGTGACAAAGACATGGTGTG	4
CCAGTGACAATAAAGAGAGGAGGC	2
CCAGTGACGGGCCTATGAATTGG	2
CCAGTGACTCAACTGCATGTGCA	1
CCAGTGAGACTGCCAAGGGGTGAT	3
CCAGTGATACATAGGAGAAAGCC	1
CCAGTGATCTTGGCTTATGAATGC	1
CCAGTGATGGACGCTGCTGGGAAC	1
CCAGTGATGGGCTAGAGATGCCA	1
CCAGTGATTCTAATGGTAGCGAC	1
CCAGTGCAAACTAGGTCCCTCGG	1
CCAGTGCAAATAAGATCCCAAGGT	2
CCAGTGCAAATTAGGTCCCTCGG	1
CCAGTGCAACAGACCAGTGGAGCC	2
CCAGTGCAATATAGGTCCCATGGC	1
CCAGTGCAGATGAGATCCCTCGG	1
CCAGTGCAGGTCCAAAACTCGCCT	2
CCAGTGCATACTACTACTACTTGG	1
CCAGTGCCACGTTTACTCCTGGGC	2
CCAGTGCGACACATATTCCTT	1
CCAGTGCGCACGCATGGTTGACAT	1
CCAGTGCGTGGAAACTCTCGGTT	1
CCAGTGCTACAGGAGGTGATGTGT	1
CCAGTGCTAGCGCATGTGCCATGC	2
CCAGTGGATAACTGAAGTGGCTGC	2
CCAGTGGCCACGACAAGGAACTGT	2
CCAGTGGCGGACCCAGGATTTGAA	1
CCAGTGGCGGATCCAGAAAATCG	1
CCAGTGGCTATGTCCTATCTACTC	3
CCAGTGGGGAAACGGCGACGAAGA	1
CCAGTGGGTGTGCCTATGAACTGT	1
CCAGTGGTATAGTAGTTGTCACT	1
CCAGTGTAGTGCTGGGGGACTCGA	2
CCAGTGTCCTATAGCCAATTACA	2
CCAGTGTCCTCCTGGTGTTTCGAG	1
CCAGTGTCCTGTGGCAAATTACCA	1
CCAGTGTCTGGTTGGTTTTGTGGG	2
CCAGTGTGATTGATTGTGCTGTAT	2
CCAGTGTGGGACTATAAATCAAAA	1
CCAGTGTGTGCCAGAAAGAGGAC	1
CCAGTGTGTGTTTAGCTGTGTGCA	2
CCAGTGTGTTGGCGCTGTCGGTGT	2
CCAGTGTTCCCTCTATCTTCCCC	1
CCAGTTAAGTGGTTCTATTTTCGC	1
CCAGTTAAGTTGAGAGATGTTTGC	1
CCAGTTACACATGAGAGATATAAG	2
CCAGTTAGACTGGTGGCTTCTAGG	1
CCAGTTAGTCTCCGTTAGTACTGT	1
CCAGTTATGGGGAGCCACGGGAAG	1
CCAGTTCAAATGGGCCAATAG	5
CCAGTTGAGCGCCTGTGAAGATGG	2
CCAGTTGAGGTGCTCATTTGGCC	2
CCAGTTGAGTTACGCACACCTTGC	1
CCAGTTGATACCTACTATAGTAG	1
CCAGTTGATAGATGGTGTAAGGAG	3
CCAGTTGATGTCCTAATTCTG	1
CCAGTTGGATATAGAGGCCGGACA	3
CCAGTTGGTGTTACTAACCGGGAC	1
CCAGTTGTCTGTTTGGTTTATGGT	2
CCAGTTGTGCATGCTTTCTGTGAA	1
CCAGTTGTGTGTTTGGTTTATGGT	1
CCAGTTGTGTGTTTGGTTTGTGG	1
CCAGTTGTGTGTTTGGTTTGTGGT	1
CCAGTTGTTAATGTGTCATGT	1
CCAGTTTAAATGAAAATTGAGGGT	1
CCAGTTTAAGAACCTTGGTGTAA	1
CCAGTTTATATAGTTGGGGGTGAA	1
CCAGTTTATGCCATGTGCTGT	2
CCAGTTTCTTGTTTGGTTGGGTGG	2
CCAGTTTGCATAGTTGGGGGTGAA	2
CCAGTTTGGAAAGAGAAAGGTGCA	1
CCAGTTTGGAAAGAGAAGGGTGCA	1
CCAGTTTGGAAAGGGGAGGGGCA	1
CCAGTTTGTTGAGTTCAGCTG	2
CCAGTTTTAATAGTTTGGGGTCAA	1
CCAGTTTTGGTCTAGATGATGTGT	1
CCAGTTTTGGTGGAGCTGAAACTA	1
CCAGTTTTTAAGGGTGTTTGGTT	1
CCAGTTTTTTGGAGGTGCTCTTAG	1
CCATAAACAAAGGAGGGGCTA	1
CCATAAACCGGGAGTAAAGATGGT	1
CCATAAACTTGTACGGGTGTGTCA	1
CCATAAAGGAGGTGTTTTCCAGAA	1
CCATAAATAGAACTGCATGAAAA	1
CCATAAATAGAGAAGTAGGGAGGA	1
CCATAAATATCACGTGGAAACCGT	1
CCATAACAGGAGCCAGTGTGTTGC	2
CCATAACAGTATAGTGGGGTGGCT	1
CCATAACATTAAATAAGATGCCAC	1
CCATAACATTAAATAAGTTGCCA	1
CCATAACCCAAGGTGAAGCGGCC	2
CCATAACTAGTGTCTATGGTGTC	1
CCATAAGATGTGGGTGGTAGATGA	1
CCATAAGGGCATCTATAATCAGA	1
CCATAAGGTGGTGGGCTAGACGA	1
CCATAAGGTGGTGGGCTAGACGAC	1
CCATAAGGTGGTGGGCTAGATGAC	1
CCATAAGGTGGTGGGTTAGACGAT	1
CCATAAGTAGTGTCTATAGTGCCA	1
CCATAAGTCTGCCACTCGATGGTC	1
CCATAAGTGAGTGCTTGGTGAGGA	24
CCATAATAGCAGTAAAAGGATGGT	1
CCATAATAGGTGTGGAATCAATC	1
CCATAATCAGAGCTCTGGGGATGT	1
CCATAATGGCGCTGACCGTGGG	2
CCATAATGTAATTATGAGGACTGC	1
CCATAATGTGCATCTAAAGTGGGT	3
CCATAATGTGGGTGCCGGTTTATC	1
CCATAATTCTGAGACGGTGCAAAC	1
CCATAATTTGGTGTTCTTGGC	1
CCATACAAGAAACGGGTGGACGTC	2
CCATACAGAGAAACAGGAATGGAG	1
CCATACAGCAAACAGGGCCATGC	1
CCATACAGGTTAGGGTTTGGTTGG	2
CCATACAGTGTTGTGGAGGTGCGG	3
CCATACATGTGTCAAATATTTGAT	1
CCATACATGTGTCTAAATGTGACG	1
CCATACATTAGTTACGTTAGGTAC	1
CCATACATTGGGTGGGCACTGGGC	2
CCATACCAAGATAATCATCCAAAA	1
CCATACCAATTGGATGATGAGCCA	1
CCATACCATAAGCTGCCCTGTTC	1
CCATACCCGATAAGGCGATAAGGC	2
CCATACCCGGGGATAGTTGGTGGG	1
CCATACCGTGGGACTAGTGGTTGC	1
CCATACCGTGTGGGCATGTGGTAC	1
CCATACGAAATCAAGAAGCCAGGA	1
CCATACGACTAGTGTGTACGAC	1
CCATACGAGGAAGGTGTCTTAGGA	2
CCATACGATGTGAACAGTTTGCAA	1
CCATACGATTTTAGATTGCTATG	1
CCATACGCCCGAGTTGGAGATGGA	1
CCATACGGGGTGTTGGATTTGTCC	2
CCATACTGGTTCCACAATGTTAGG	2
CCATACTTAGATTGGTTTCACTGA	1
CCATACTTGTATGCGTTGGTAGT	1
CCATAGAGACCCCAACAGAGCTGC	1
CCATAGAGATGATTACTCGAT	1
CCATAGAGTGTGATCCATGGGGAA	1
CCATAGATATATGAGGGCCCACAT	1
CCATAGATCAGGAACGAGGGTA	1
CCATAGATCAGGAACGAGGGTAC	1
CCATAGATCTTGTGGGTGTAGAAG	1
CCATAGATGATGGATATTGGCAA	1
CCATAGATGATTGGCCTACCCGGT	1
CCATAGATTCGCAGGTGGTGAG	2
CCATAGATTTGATAAGGTGTCAAA	1
CCATAGCATTAAATAAGGTGATAC	1
CCATAGCCCGACTGGGTGTAGTGC	1
CCATAGCTTCGTGTCCTTGGATGA	2
CCATAGCTTGCCATTGACGGGATG	1
CCATAGGAAAAGCCGAAAAGGGA	1
CCATAGGAATGAAAGTGGGTGCAC	2
CCATAGGAATTCAGTAAGTGTGGC	1
CCATAGGACCTGACTTGAATGGT	1
CCATAGGATGTGGGGATTAGAGGT	1
CCATAGGCCCATTATAGGTGATGC	4
CCATAGGTCCAGAGAGGGTGGGGG	1
CCATAGGTCTTATGGGTGTAGGGA	2
CCATAGGTGCCAAATTTGGGTGTA	1
CCATAGGTGCCGGTTTTAAATGAA	1
CCATAGGTGCTAAATTTGGGTGTA	1
CCATAGGTGGACATTGTTGGTTGG	1
CCATAGGTGTTGGTTTTAAATGAA	1
CCATAGGTTTTGTGGGTGCAGAGA	1
CCATAGTGCTACGGGGTTGTGGTT	1
CCATAGTGTCCATAAGTAGTGTCT	1
CCATAGTGTGCCTCGATCTAC	4
CCATAGTGTGGGGATCGTTGGTA	2
CCATAGTGTTTGATCGGTTGAGT	2
CCATAGTTGGTGGGCTGGGCTG	1
CCATATACATTGTGAGGATTGCTA	1
CCATATATACCGTCGGATTGTCGA	1
CCATATATACTGACATAGGTCGAC	1
CCATATATAGATGGGAGGGGGCTA	1
CCATATATCGGTGACTGTAATGG	3
CCATATATCGGTGACTGTAATGGT	1
CCATATATGTGCCGGTTCATAGTA	2
CCATATATGTGTGGCTAAATGGGA	1
CCATATATGTGTGGCTTAATTGGA	1
CCATATATTATTGGACGGGGAGA	1
CCATATATTTGTGGCGAATGGAAC	1
CCATATCAGCTAAAACCAGGGACA	1
CCATATCATGACGGTAAAAGGTGT	1
CCATATCCACAATGGACGTGCCT	1
CCATATCGTGTCGGTTGCTGTGGG	2
CCATATCTCCCATTCTCTGTT	1
CCATATCTCTTTGAGCGTGTGCCA	1
CCATATGAATATGAGAAATGCTAG	1
CCATATGAGTGTCCTATATATATA	1
CCATATGATGATTTTGGTGGACAC	1
CCATATGATGATTTTGGTGGACCC	1
CCATATGGCATGCCACATCAGCGC	1
CCATATGGTGCACGCATAGCGGCC	1
CCATATGGTGTGTCACATCTACAA	1
CCATATGTCATGCCAGTGAGCTGC	1
CCATATGTGTGCACTGTGAGTGG	1
CCATATTAGGCAAGGTGTGGC	1
CCATATTAGGTTGCTATATTTTGG	1
CCATATTCGGTGAATAAGCAG	2
CCATATTGAAACAAGTTGAGGTAC	1
CCATATTGATTCGGTGATTCCTAC	1
CCATATTGCCTCAAATGTTGTAAG	1
CCATATTGGTGCCGGCTAGTGCC	1
CCATATTGGTTGTGGAAGTGGGCA	1
CCATATTGTCAAATCATGGAGC	1
CCATATTGTGCTCGTGGTTGGGGA	3
CCATATTGTGGTGTGTGGTGG	1
CCATATTTAAGGGCCTTTTGAG	1
CCATATTTATATAGGTGTTAATGA	2
CCATATTTATATGGGTGTCAATGA	2
CCATATTTATATGTGCCATTTGAA	1
CCATATTTCTACACAGATGGACCT	1
CCATCAAAAGATCTCGGTGCACTT	1
CCATCAAACCCTAGTGCATCACC	1
CCATCAACCGGAAAACCAGATAAG	1
CCATCAACTATTAAAACCGGTGCA	1
CCATCAAGGGGGAGATTGTGAAAC	1
CCATCAAGGGTAACTACATTAGTG	3
CCATCAAGTACTCACGGGCCGAAA	2
CCATCAAGTGGTGCACGAGGTGTC	3
CCATCAAGTTATTGCTAGTTG	1
CCATCAAGTTGATGAACTGGCCAA	1
CCATCAATTGGACTAGTGCTACCA	1
CCATCACATCAAAACTTTCCTACA	2
CCATCACCACTATTCTATATGCAC	1
CCATCACCTACAGGTCTACTTCCT	1
CCATCACCTACGTGATCGGGCGGC	1
CCATCACTAGCCATGAGAGAAAGA	1
CCATCAGAAATGGTGCGCCTGGGC	1
CCATCAGTTGATCTAGGGCTC	1
CCATCATAGGTGGAGGGTTGGGAC	1
CCATCATGGGTGTGAGTATGGG	1
CCATCATGTCTACGGTTGCCA	1
CCATCATGTGATTGGGTGGTGTT	1
CCATCATTAACATGTTGGTAGC	1
CCATCATTGGATCGTCGTGCGGAG	2
CCATCCAAATGACCTAGGTGG	3
CCATCCAACCCATTCTCCTCTCC	1
CCATCCAAGTCATCAGCTGCA	1
CCATCCAATTGGACCACGGCGC	1
CCATCCACTTTAGGTCTCGTGCG	1
CCATCCAGAGGTGTCCACCATTGC	1
CCATCCATACAACCAAACACAAA	1
CCATCCATCCGACTAGTGTATGTG	1
CCATCCATGGTGCGTATAAAACTG	1
CCATCCCACCGCTTTGTCCCACGT	1
CCATCCCACCTCGTCCCCAAA	1
CCATCCCATTCCAAAAAACAGGG	1
CCATCCCCTGTTGCCAACGCTTTC	1
CCATCCCTACGCATATAGGATGGA	1
CCATCCGATGGTATTAAGATACGA	1
CCATCCGGTTAGAGAGGTTGTTGG	2
CCATCCGTGCCTAACGTTTGACC	1
CCATCCGTGTTGGCCTAATGGGAT	1
CCATCCTAGGACTACGAATCTGGA	1
CCATCCTAGGACTACGAATTTGGA	1
CCATCCTAGGTAGAGGGTTGGGAC	1
CCATCCTAGGTGGAAGATTGGGAC	1
CCATCCTAGGTGGAGGGTTGGGAC	1
CCATCCTTAAAAAGATACCGGGA	1
CCATCCTTACGAGTGAAGTGCATG	1
CCATCGAACAGTGCTTCCGTACGC	1
CCATCGAAGGACCTCGGGTGACCG	1
CCATCGAAGTTGGTGTCATTAGAT	1
CCATCGACGTATGTGTGTTTATA	1
CCATCGAGGAGGATGCCGATCGAT	1
CCATCGCGTCTCCGGTTGCCACCC	1
CCATCGCTGCTAGGCCAACAAA	1
CCATCGGAGTAGTTGGCACGGGGC	1
CCATCGGGTGCCGGGTGATGGC	1
CCATCGGTGACGAATATAGATGAG	1
CCATCGGTTACCGGCTTACCGCGG	1
CCATCGTACGGTAGCCACTATGTG	1
CCATCGTACGGTGGCCACTATGTG	1
CCATCGTAGGAAGGTGGGAAAAGC	1
CCATCGTGACATTGTTGCAGCCTG	1
CCATCGTGCGGCGTTGTAACCTT	1
CCATCGTGTCCATGGATGCTA	25
CCATCGTTCGATAGAGGTACCTA	1
CCATCTAAAATAGGGGTAGGGTAA	1
CCATCTAAACAACGTTCTTCA	1
CCATCTAAACAGGGCCTAAGGTGG	1
CCATCTAAACCCGACCTAGTCAGA	2
CCATCTAGTCCATGATGCGATGG	1
CCATCTCAATCGGGCCTTCTTTG	1
CCATCTCATCTGGTAGGTCCC	1
CCATCTGTGTCTATAAAATGTGAG	1
CCATCTGTTCGTCGGGTTCGTT	1
CCATCTGTTTTTCCATCGTGC	2
CCATCTTAAAAGGGAGAGCCACCC	1
CCATCTTCAGTTTAGACCCCGTT	1
CCATCTTGAGAGTGACATTATAGC	2
CCATCTTGGACCATTGAACTC	1
CCATCTTGGCTCGAGTGATGC	4
CCATCTTGGTCACACACGGGTGGA	1
CCATCTTTAGTCCCGGTTGGTGTT	1
CCATCTTTAGTCCTGATGGTTGAG	1
CCATCTTTAGTCCTGGTTGGTTA	2
CCATCTTTCGTCGGTCGGC	1
CCATCTTTTACGACTTGTGTGGGC	3
CCATGAAAAGCCGTAGCGAATGTG	1
CCATGAAACAGGGACGAGGAGGGC	1
CCATGAAAGGATTTAGCTGAA	1
CCATGAACAAAAGATATGTGA	1
CCATGAACTGTGAGTTGCTTGTC	1
CCATGAATGGAATGGTGCAGTGGA	1
CCATGACATGTGGGTCTGATCAAT	1
CCATGACGGGTTGTCGTAAGGGAC	4
CCATGACTGGTGATGATAAGAAGG	1
CCATGAGAAGGGATGTGCATAGGC	1
CCATGAGACCCATCCTAGGACTA	1
CCATGAGATGACGGGCCTATTCAC	1
CCATGAGATGCCATCGTACAAGCG	1
CCATGAGCAAGGTGACGTGGAAGC	1
CCATGAGCAATAAGAGTGGGGTCC	1
CCATGAGCATGCCTGTTGGAA	9
CCATGAGGCCCACATGATGCATGC	1
CCATGAGGTAATGTTTTTGGTGAT	1
CCATGAGGTACCAAATTTTACAC	1
CCATGAGGTACCAATATAATCTA	1
CCATGAGGTGTTGGGTTCAGTCCC	1
CCATGAGGTTTGTTTGGATGGAAA	3
CCATGAGTTTTGTAGGTGTAGGG	1
CCATGATAGTGTTTTAGGGACGGT	1
CCATGATATGATGATGGATCA	1
CCATGATCGTTTTGGTGCTAA	1
CCATGATCTAAGGGCCTG	1
CCATGATGCCACAACTAGATGGAA	1
CCATGATGTAAACACTACGATTGA	2
CCATGATGTGAGCAATGGTTGCA	2
CCATGATGTGTATATGTGCTTTCT	1
CCATGATGTGTGAGCTCGCTG	4
CCATGATTAGCCTATATGATGCT	1
CCATGATTGGAAGGTGGGCTGAGT	1
CCATGATTGGTGGGTCGAGCTGCGC	1
CCATGATTTAACAATGTGGTGCTA	1
CCATGCACGAGTGCAGCAGGTGGA	1
CCATGCACGGTGTATGGGTGTGGC	1
CCATGCAGACCGATATTGCAGGGG	1
CCATGCAGATGCAGATTGTTGGGT	1
CCATGCAGCAACAGTGCCGAGCAG	2
CCATGCAGCTGGTACCACGACAGG	1
CCATGCAGGGATTGATTGAACTAG	2
CCATGCAGGTGGTGTTGAGTAGGC	1
CCATGCATGGTGTACTCGGGCGAT	1
CCATGCATGTGTCCAAACATTCGA	3
CCATGCCAAAGGTGATTGAGGAGT	1
CCATGCCAACGTTTGACTGTCCGT	1
CCATGCCACAACTAGTGAATGAAC	1
CCATGCCACAACTAGTGAATGGAC	1
CCATGCCACAGGACTGACGTGAGA	1
CCATGCCACATCCTACTTGAACTC	1
CCATGCCACTATGGATGGGAGGC	4
CCATGCCACTGATCTGAGAATTCT	2
CCATGCCACTGCAACTTTGCGAAA	1
CCATGCCAGTGAGGATGGTGTGG	1
CCATGCCATGGATTACTAGATCGG	1
CCATGCCATGTGGGATCGGGCCA	1
CCATGCCATTATAATTTTGTAAA	2
CCATGCCCGTCTAGCCTCGATAGG	1
CCATGCCGGCTGCCATCACGTTGC	1
CCATGCCGTATGGATATGGGGTAC	1
CCATGCCGTGTAGGTATGGGGTAC	1
CCATGCCGTGTAGGTATGGGGTACC	2
CCATGCCGTGTGGATATGGGGTAC	1
CCATGCCGTGTGGGTATGGGGTAC	1
CCATGCCTAAATCCTTAACGGTGG	1
CCATGCCTATCGAGAAAAGTGA	1
CCATGCCTGAATTGGAGGAGCTT	1
CCATGCCTGCGCAACTACGACACA	2
CCATGCGAAGGTTGAGGGAGGTAC	1
CCATGCGGTGGTGTCTCGAGAGAT	1
CCATGCTAATATTTACATCACATG	2
CCATGCTAATCAGAACTGGTGGTA	1
CCATGCTAATGGTGGCAAGACAGC	1
CCATGCTCACCAGGACGCCTTGAA	2
CCATGCTGTGCCATTTACCAGGT	1
CCATGGAACAACTATTGTGCTATA	1
CCATGGAACCAAACAGGGCCCAGG	1
CCATGGAACTAAAGCTTCGCC	3
CCATGGACAAGACGACACGGTGAA	1
CCATGGAGATGCCAAGGGTGTTGA	1
CCATGGAGGCCGACTAGAGAAGAA	1
CCATGGATGCCTAGGTGTTCTGCC	1
CCATGGATGCCTAGTGAACTCAC	2
CCATGGATGGACGACCTCATT	1
CCATGGATGGGTGTGTTGGATGG	1
CCATGGATTCTGGTCTTCTATGG	1
CCATGGCAAAGATGATTGAAGTAC	1
CCATGGCACCTAGGAATATGCATG	1
CCATGGCACTGTGCCTGTGCCACC	1
CCATGGCAGTACAGCGGGTGGTTC	2
CCATGGCCTTATGGGTGTAGGGGG	3
CCATGGGAAGGTTTGTATGGGAGA	1
CCATGGGAGGCTGTATTACAAAAA	1
CCATGGGATACTATGAACGGTGAA	1
CCATGGGCATGATTTGATTTTGGT	1
CCATGGGCCACTGAGGGCAAGTGT	2
CCATGGGCCGTATGACTGCACGAA	1
CCATGGGCGAAGCTATAACGAAAT	1
CCATGGGGAAGAGGTTCGCCTTGA	1
CCATGGGGCTGTTCAGATTGATGC	1
CCATGGGGTCACATGGTGGAGAG	1
CCATGGGGTGCGGTAATCGTGTA	1
CCATGGGGTGTTTGGGTACTAGT	1
CCATGGGTAGCCTTGGACGACAAC	2
CCATGGGTATCTTATTGGGTCAAA	1
CCATGGGTATGCCTGTTACTACAT	1
CCATGGGTCCAACGGGTGTAGGGG	1
CCATGGGTCTACTGACGGGCGAAA	1
CCATGGGTGCCATGCTGTTAACGG	5
CCATGGGTGGTCACCGGTGGTGAA	1
CCATGGGTGTCTCGATGTCAATGG	1
CCATGGGTTCGGGTATCTGTGGA	1
CCATGGTAAAAGCGGTAACCGC	1
CCATGGTAACTTCGTCAATCTCAA	1
CCATGGTACCCTGGAGGGTGATGC	1
CCATGGTACTAAGGTTAGTGGTA	1
CCATGGTACTCATGTAAGCTAGAG	1
CCATGGTAGTCCGGCCAATAGGCG	1
CCATGGTATACAAAGCGTATGAT	3
CCATGGTATATGCGAGATTGAGGT	3
CCATGGTCGCCGTGGTAGAAGCC	2
CCATGGTCTTTCAGCTAACTTCAC	1
CCATGGTGAAAATTGTTGCATTAG	2
CCATGGTGAAGAGTGCAAGGCTG	1
CCATGGTGACCAGATGGAGATGCA	1
CCATGGTGACGACGTGTTATTGAC	2
CCATGGTGAGGTGTCGTCAGGC	1
CCATGGTGAGTCAGTATGGTTGGG	1
CCATGGTGATCTTGCTCGGGTAGA	1
CCATGGTGCAACATGGATGGAGCT	1
CCATGGTGCAATCGAACACAGATG	2
CCATGGTGCAGCCAAGGATGAC	2
CCATGGTGCATTAAATGTGGGAAA	1
CCATGGTGCCCCATATGAGTGTCC	1
CCATGGTGCTATAACCCTGCG	2
CCATGGTGGAATTGTGTGACTGAA	2
CCATGGTGGACACAGTGGTCGATC	2
CCATGGTGTAGCAATTGGGAGGAT	1
CCATGGTGTCCATAACTAGTGTCT	1
CCATGGTGTCGCCTACGTGTTAGT	1
CCATGGTGTCTTTGAAGGTAGAG	1
CCATGGTGTCTTTGAAGGTAGAGG	2
CCATGGTGTGAAGACAAAAACTGC	1
CCATGGTGTGATGACAAAAACTGC	1
CCATGGTTGACCTCGTCAAAATGG	1
CCATGGTTGCATGCGTGCATCTGC	1
CCATGGTTGCCACGATGAGGAAGA	1
CCATGGTTGCTCCTGTTGGGCCT	1
CCATGTAAACAGTGTTGAGGACGA	1
CCATGTAAATTTGTGCTGGGA	2
CCATGTAATGTGATAGACAGTGC	1
CCATGTACCTATCAACAGCGATGC	1
CCATGTAGAAAGGGGCTGTGGTGA	2
CCATGTAGAACTCTGGTTGTCTT	1
CCATGTAGACATACTATTGAGGT	1
CCATGTAGCCATGAAAGAAGGAGC	2
CCATGTAGCCGATCTTGTATGGA	1
CCATGTAGCCTGCTGGTAGAGTC	2
CCATGTATAGTGTCTTGGGTTGGG	1
CCATGTATGGGCATGGTGCATATC	2
CCATGTATGTGCCTATAATCGCCA	2
CCATGTCAATGCCACGTGGGACGA	1
CCATGTCACATCGGATGTTTGAC	1
CCATGTCACCGACAGTATGGATGC	1
CCATGTCACTTGTCATTGTGGTAC	2
CCATGTCAGCACTGCCATTGG	1
CCATGTCATAGACACATGTGGACC	1
CCATGTCCGATCAATCAAGGTGAG	2
CCATGTCCGTGTTGGAGAAAGTGA	1
CCATGTCGACGTCAGATGGACTGG	1
CCATGTCGGTGAGATGCGCAT	1
CCATGTCGTCTCGATCTCGTG	1
CCATGTCTAGTGTGTATGGGTGG	1
CCATGTCTAGTGTGTATGGGTGGT	3
CCATGTCTAGTGTTATGGGTTGG	2
CCATGTCTAGTGTTATGGGTTGGG	2
CCATGTGAACAGTACCGTGTGTG	1
CCATGTGAGAAGCACTGATGTTGT	1
CCATGTGATGTCAAACTGAGTTATGGAC	1
CCATGTGCAGCTACCCTCTTTCA	1
CCATGTGCAGGGGTGGTAATGGGT	1
CCATGTGGAATGAAGATCGAGTC	1
CCATGTGGATAGCTTACTATGAC	1
CCATGTGGCGTGCCACGTAGGCAA	1
CCATGTGGGTGCGATGTTTTCGA	1
CCATGTGGGTGTGGCATTGTTGGT	2
CCATGTGTCCAGTGCCAGCGCATG	1
CCATGTGTCTATGGCAATCGGCCT	1
CCATGTGTCTATGGCGATCGGCC	1
CCATGTGTGGAGGTGACTGAT	4
CCATGTGTGTAACGTGGGGTGTAT	1
CCATGTGTGTATGAGATGGACAAA	1
CCATGTGTGTATGTGTGTGTGTGT	2
CCATGTGTTCTATGGTATTGGTAGG	1
CCATGTGTTGCAACGTGTGAAGA	1
CCATGTGTTGGCGCATCGATTGAT	1
CCATGTTCCTTATGTGCTGCT	2
CCATGTTGACCCCTCACTGGCCAC	2
CCATGTTGTTAGGAAAATAGATGC	2
CCATGTTTTTTAAGTGTCCTCAAG	1
CCATTAAAGTTTTGGCCCAAC	1
CCATTAAATCAGTGCCGATTGACA	1
CCATTAAGCGTGCGACCCTGTAGG	1
CCATTAAGGGGGCCATATATGTAA	1
CCATTAAGTAATTATAGGTGTCGG	1
CCATTAAGTGAGGTGGTAGTAGAG	2
CCATTAATAGCTCCGCTCCGCCGA	1
CCATTACAGGTGGGCTGACACAA	1
CCATTACATTTGAGGGGCTAAGT	1
CCATTACTACATGACGGGTAAGG	2
CCATTAGAAGGTGGGGGTGGTATA	1
CCATTAGCCGTGTTATGTGTTTAC	1
CCATTAGCTGTGATGGAAGCGATA	1
CCATTAGGATTACCCTACGGGCGC	1
CCATTAGGCCTAGAAACTCGTGGA	2
CCATTAGGGTTGACGCTGAGGTC	1
CCATTAGTGAATGATCAGGGA	1
CCATTATATTATGGTACGGAGGG	1
CCATTATATTGTGCGAAAGGGCCT	1
CCATTCAAACGTAAAAAAGAGGTCC	1
CCATTCACCTGTGCTACCGGCAGC	1
CCATTCAGCAATACGTAAACCCAG	3
CCATTCATGGTGCTCATTGAGGT	1
CCATTCCGCGCCGTTAAGTCCTA	1
CCATTCGACCAGGGCAGATGAAGC	1
CCATTCTAGTCATTGGATTGGAAA	5
CCATTCTTTTGCGGTGTCATATAG	1
CCATTGAAAAAGTGTTTGGCTGAC	1
CCATTGAAAATCAAGGTTGGC	1
CCATTGAAAGATGGGTGTCTTATG	1
CCATTGAAAGGACAAAGCCGTT	3
CCATTGAATGTCCTAAGGAACAA	1
CCATTGACCGAAGTTAACCTC	1
CCATTGAGAGAGGTGAAAGAACCAG	2
CCATTGAGGTATGGTCTGGTATGC	2
CCATTGAGGTGAGGGGCTTCCCCA	1
CCATTGAGTAGGATGTGTATGTGT	1
CCATTGAGTCTTTGTGGGGGACGA	1
CCATTGAGTTTTGCCTACTTCTAC	1
CCATTGATAGGGTTGTCTATTGGA	1
CCATTGATTCATGTGTTGATCAAT	1
CCATTGATTGCTCTCTGAAAATGC	1
CCATTGCACTGGTAGAGGAAGCA	2
CCATTGCAGGTCCTGATCTATGAT	1
CCATTGCGATGGTATGGCTGGCGC	1
CCATTGCGGGTGATCTTAGCACGG	1
CCATTGCGGGTGCCCTTACAGCAG	2
CCATTGCGGGTGCTCTAAGGAAGA	1
CCATTGCGGGTGCTCTAAGTGATA	1
CCATTGCGGGTGCTCTAATGTGG	1
CCATTGCTGTGTCTAGGGGATGGT	1
CCATTGGATTGGGCCGAAATACAG	1
CCATTGGGCCCACATGTCAGTGAT	1
CCATTGGGGTACTTGCGGTCGCGC	3
CCATTGGGTACATGGGTATGGGTC	1
CCATTGGGTTGTGCACCTGGGGAC	2
CCATTGGTAACATGATGGCTGTA	1
CCATTGGTGTTACTGTCTGGA	1
CCATTGTAACCTCCCATGCGGCGC	1
CCATTGTAGGTGCCCTTACTGGCC	5
CCATTGTGAAACGGGATGGACCT	2
CCATTGTGACTGGCCTTACATGAA	1
CCATTGTGACTGGCCTTAGA	1
CCATTGTGAGATGGGTGTCCCATA	1
CCATTGTGATTCCCCTACGTTTG	1
CCATTGTGATTCCCCTACGTTTGT	7
CCATTGTGCAACTGGTCCATATAA	1
CCATTGTGGGTACCCTAAGAAGAT	1
CCATTGTGGGTGCACTAATAGTA	1
CCATTGTGGGTGCCCTAACAGCT	2
CCATTGTGGGTGCCCTTAGAGCAA	1
CCATTGTGGGTGCCCTTAGGCTG	1
CCATTGTGGGTGTTCTTAGGTACT	4
CCATTGTGTATTATGGTTTGATCG	1
CCATTGTTTTTAAGGCGGTGTGGT	1
CCATTTACAGTGCAAGGACGTGAC	1
CCATTTAGATAGCATGCAAAAAA	3
CCATTTAGCTTTATGCAGTGTTGC	2
CCATTTATGAGGCCCGTCTACGAA	1
CCATTTCAGGGTTTGGTGGAACGA	1
CCATTTCAGGTGGAGCTGTTTGGC	1
CCATTTCGGGGTCCTACATGTCGT	1
CCATTTGACAACAAATACAAGTGC	1
CCATTTGATTGGACTGCAGGAAAA	1
CCATTTGCCACATTTAAATGTGA	1
CCATTTGCTGAATATCTTGGA	1
CCATTTGGTGTAACTATAGGTGAA	2
CCATTTGTAGTGCCGGTTGGGAAC	1
CCATTTTAGAGTTTTTGCTGGCGA	1
CCATTTTAGGTGGAACTGTGCCAA	1
CCATTTTAGGTGGAGCTAAAACTG	1
CCATTTTAGGTGGAGCTGAAACAG	1
CCATTTTAGGTGGAGCTGAAACTG	2
CCATTTTGATGAGGTCAACCATG	2
CCATTTTGGTCCTGGCATTTTGAG	1
CCATTTTGTAGGGTGGTATTTGGG	1
CCATTTTTGGTAAGCAGAACTG	1
CCATTTTTGTGGGTGTTTGGTTC	1
CCCAAAAAACAGTGCCAAGGCCC	1
CCCAAAAAGATGGGGATTTGC	1
CCCAAAAATCAGGGATGGTTCCAT	3
CCCAAAACAAAATGGCTGAGCGA	1
CCCAAAACATAGAGAACCACAGGG	1
CCCAAAACCGGGAGACGTTGGTCC	1
CCCAAAACTAACGATTCAGAAAC	1
CCCAAAACTTGTAAGGTGTGTCA	1
CCCAAAAGCCTAAGCTGATAGGGA	1
CCCAAAAGCTAGCCATTGAAGTG	1
CCCAAAAGCTAGCCGTTGAGGTGA	5
CCCAAAAGCTAGCCTTTGAGGTGA	2
CCCAAAAGCTTAAGCTGATGAGGA	1
CCCAAAAGGCTGAGGAGCTCCCAC	1
CCCAAAAGGGTGAGCTATTTGAGG	1
CCCAAAAGTCTAACAAATATGAGC	1
CCCAAAAGTGGCTTTGGACAGTGT	1
CCCAAAATAAACCGGTGACGATGT	1
CCCAAAATAAGTGCAGCCGTGGAA	1
CCCAAAATAATGGTAGCCGTGGAT	1
CCCAAAATACAGGGCCTATCTAGA	1
CCCAAAATGAGTGTCTAGACCGAA	1
CCCAAAATGTGGCCGTTGGGAGAG	1
CCCAAACACAAGCTACAGAAAGGG	2
CCCAAACAGGAGGGACTAAAGTGC	1
CCCAAACAGGCCCAGTTGTA	1
CCCAAACAGGCCCATAGACACGAA	1
CCCAAACAGGGCATAAGACGGAC	1
CCCAAACAGGTGTTGGATTTGGTA	1
CCCAAACATACTAGTCCTTGC	2
CCCAAACGGGTGGTCTGACTGGC	1
CCCAAACTACTAAACGGTGTATTT	1
CCCAAACTATACAGCACGGATGGG	1
CCCAAACTGAAAGGAGATGATGTC	1
CCCAAACTTGAAGTGATATTTGG	1
CCCAAATACAATGTTTCAGAA	1
CCCAAATATAGTGCCTGTTTAGAT	1
CCCAAATATTGTACTGGTGTGATT	1
CCCAAATCAAACTCGGGCTGGATG	1
CCCAAATCAAGGTTGTAGGCTCCA	2
CCCAAATCGAGGAGGCGGTGGTC	1
CCCAAATGCCATGCTGGAAGTGGG	3
CCCAAATGGTAATAAGGTGTTCAC	1
CCCAAATGGTTAGGGTACCCACAC	1
CCCAAATGTGTCAAAGGGTGGCTG	1
CCCAAATTCGGTTTGTAATGC	1
CCCAAATTGCTAGATGATGTGTT	1
CCCAAATTTACAAAACCGGTGCAA	2
CCCAAATTTAGGCGGCAGCGGCT	1
CCCAAATTTGGGTGTTGGGACGGC	1
CCCAACAAAATGGGTGCCGTGAGA	1
CCCAACAAAGTGCTGTAGACATAG	1
CCCAACAACGGCGCCAGAAATGCT	1
CCCAACATTGAGTAGCCGCTGCAG	1
CCCAACATTGAGTGCTAAAAGGAC	1
CCCAACCACACAGGATATTCCTA	2
CCCAACCCAATGACTAGGATGGT	1
CCCAACCCATGGTGTCCATAAGT	1
CCCAACCCATGGTGTCCATAAGTA	1
CCCAACCCTCCATCTAGGATGGTA	1
CCCAACCCTGGGAACCACGGATC	1
CCCAACCTAGAGTAGGGTATTACC	1
CCCAACCTAGTATCAGATGTGAC	1
CCCAACCTGCCTGCCATTAGACC	2
CCCAACCTTTGGTGTTGAGATGGT	2
CCCAACGAGCATACGAGCACAGG	2
CCCAACGAGGTTGATGGATCTGGC	1
CCCAACGTAAAAGGTAATGTGACC	1
CCCAACGTCACGGATAAGATTGGG	1
CCCAACGTTTGACCGTCCGTCTT	1
CCCAACTCGCTGTGTCATTGCGG	1
CCCAACTCTCATGCGCCACACATG	1
CCCAAGAAGGTAACAAGGTGAGAC	1
CCCAAGACAGTGCAGTAATACGAC	1
CCCAAGACCTAAGGTGCTACTGAA	1
CCCAAGACCTAGTGCTAAAAACC	1
CCCAAGACCTATGGTGTTACTGAG	1
CCCAAGAGGCTTGCTGGTGTCA	1
CCCAAGAGGCTTGCTGGTGTCATC	1
CCCAAGATGGGTGTCACAAGGGCC	1
CCCAAGCCTACCAGCGACGGGCCT	1
CCCAAGCGATGGCGGTGACCTTAT	1
CCCAAGGACTTGCCATGGTAAGGG	1
CCCAAGGAGGATACGACGTGAAAC	1
CCCAAGGATAGGAATGCCTCTGG	1
CCCAAGGCCTACAATGATTCGGAC	3
CCCAAGGGAAGATGATAAGAGTG	1
CCCAAGGGAGTCGTCGTTGGTAGC	2
CCCAAGGGTAAGAAAGTGTGGTAT	1
CCCAAGGGTGAATTCTACTACGA	1
CCCAAGGGTGAATTCTACTACGAC	1
CCCAAGGTACCAGGGAGGATTGGA	1
CCCAAGGTACTGAGTTTAAATCTC	2
CCCAAGGTCACGGACAAGATTGGG	1
CCCAAGGTTTGACTTAGGTGGTGT	1
CCCAAGTACAAGCACAGGTCGCCG	2
CCCAAGTCTTATTTAACTGGTGGC	1
CCCAAGTTTTCGGGGGACAAGGTGG	1
CCCAATAACTTAAGGTTGCCCGG	1
CCCAATAACTTAAGGTTGCCTGGA	1
CCCAATAACTTAAGGTTGTCTGG	1
CCCAATACAGAGTGATAGTGCGCC	1
CCCAATACAGGGACATGGGGTGAC	1
CCCAATAGAGGGCGGCAAGGGACC	1
CCCAATAGCTTACGAGCTAAACGA	1
CCCAATAGGTGTCGGTTTCGGG	1
CCCAATCAGTGTAGGTAAGGTGAA	1
CCCAATCCGCGGTGGTTTTGGT	1
CCCAATCTCCTGGCCTCTATTCCC	1
CCCAATGACTAGAATGGTGTCCA	1
CCCAATGACTAGAATGGTGTTCAT	1
CCCAATGACTAGTATGGTGTTTA	1
CCCAATGCAAAATTTGATAGTGTC	8
CCCAATGTAACCTGGGTGGCCTA	1
CCCAATGTGACCACAGTCGGTGGG	1
CCCAATGTGACCTGGGTGGCCC	2
CCCAATGTGATTCGGGTGACCCAC	1
CCCAATTATTTTAGGATGAATGG	1
CCCAATTGAGATATGGTCGCACAG	1
CCCACAAAGGGTGTTGGTCGATT	1
CCCACAAAGGGTGTTGGTCGATTA	1
CCCACAACTGTGCTTATTATGGGA	1
CCCACAAGACCCATGGATACCCCC	1
CCCACAAGTGCAACTGTAGGCCT	1
CCCACAAGTGGAGTTGTAGGCTC	1
CCCACAAGTTTAAGGGCCGCTAC	1
CCCACAATATAAGGGATTTTGGTA	1
CCCACAATCTCTAGTGCTTGTGC	1
CCCACAATGCATGTGTCGATTAAA	1
CCCACAATGGTAAAGTAAGGTGCT	1
CCCACAATGGTAAAGTTAGGTGCT	1
CCCACAATGGTTATCTATAGGCTC	1
CCCACACAAGATAGTGCAAAGTT	1
CCCACACATGAGAGGATTGCA	9
CCCACACCCACGCATGTTGCCTCC	1
CCCACACGCACAGATTTGCCGGT	1
CCCACACGGGTGCGATGTTTTTGT	2
CCCACAGAAACCAAGCCGAGCGGG	1
CCCACAGCTTATAGATTGAATGGC	2
CCCACAGGATCGGCTATGTAGGT	1
CCCACAGGTACTCATTGGGATGGT	1
CCCACAGGTTCTAACAAAGAGTA	1
CCCACATCCAACGGTGGTGGTGGT	1
CCCACATGATGCCTTGGATGTTGT	1
CCCACATGATTAGGCGGTTGGTACC	1
CCCACATGATTGTAGCCGTCA	6
CCCACATGCGATAATTGGTGTAT	1
CCCACATGGATCCACAGATGGCGT	1
CCCACATGGTGCTGGATTTTCCAA	2
CCCACATGTAAGTGACAAAGGCAGC	3
CCCACATGTCAACGTGCCACGTCA	1
CCCACATGTCAGAATGCCACGTC	1
CCCACATGTCAGTGTCTCAAAGT	1
CCCACATGTCGGTGATATGGGCC	1
CCCACATGTCGGTGATATGGGCCT	1
CCCACATGTGAACCGTACTGAGCT	1
CCCACATTCATATTGATGCTAATA	1
CCCACATTCATTCGGGAGGGTAC	1
CCCACATTGCCCTGTGACAGTGGT	1
CCCACATTGGTTGAGGAAGGGTA	1
CCCACATTGGTTGTGGCAAATGAC	1
CCCACATTTTTGTGGTGTCTTGTGG	1
CCCACCAAACAAAGTGCCAAGC	1
CCCACCAAGATTGTGGACTATGGA	1
CCCACCAGGATAGCTTCCTGATGC	1
CCCACCAGTAGTCGGGCCATGC	3
CCCACCCACTCTGGTTCAAGTCGT	2
CCCACCCATCAAATTGGCCTC	1
CCCACCCTACGTGCCGTCATCCC	1
CCCACCGAGAAAGGGGATGACTC	1
CCCACCTAATTGCTACGAGTTACA	1
CCCACCTACCAATACACTTGTCGG	1
CCCACCTACGTACTGTGGAGGACT	1
CCCACCTAGAACTACGAATTTGAA	1
CCCACCTAGATTGTTTTTTGGGA	1
CCCACCTAGATTGTTTTTTGGGAC	1
CCCACCTCATGGGATGGCATGCA	1
CCCACCTCGTGCTTGGGCGGCTA	1
CCCACCTGTCTGGGTGACCACGTC	1
CCCACCTTGTCGGAGATATGGGCC	2
CCCACCTTGTTTGATGTCTAGAA	1
CCCACGAAATGATGGTTACCGCAA	1
CCCACGAACAGTCGGAGAGGTGTA	1
CCCACGAACTGTGGCACATGTGCG	1
CCCACGAAGAAAACGATGTGCAAAC	1
CCCACGAAGCAGGAACTGGGTGCG	1
CCCACGATTGGTGGGACGGACTGC	1
CCCACGCAAAGCAAAGGTAGGCGA	1
CCCACGGAATGGTAGTGCGGGAC	1
CCCACGGCTCAGAAGAGCAGCACT	1
CCCACGGGTAAACGGACAAACGAG	1
CCCACGGGTACCTGTGTGGATGGA	1
CCCACGGGTCGCTTGGTAGCCAGC	1
CCCACGGTAAAGCGGTTATTGCGG	1
CCCACGGTATCCTAGGACCTCGGA	1
CCCACGGTCCATTAGGTATACGGG	1
CCCACGGTGCAACAACTTGGTAGG	1
CCCACGGTTTGCCTTGGACGGAGG	1
CCCACGTAGGAGCGTTAGGTATGC	1
CCCACGTCGGTAGTTGATGATGCG	1
CCCACGTCTACGGGGTCTGATGGA	2
CCCACGTGCAGATAAGGAGATGGA	1
CCCACGTGCGTTTCGTGCAGTTGC	1
CCCACGTGTACAGGGTTAGGTGGG	1
CCCACGTGTCTACTTGGGCCCACC	1
CCCACTAAACGTGCACGCGTGTAT	1
CCCACTAAGTACCTGTACGTGGA	1
CCCACTATTATCGGAGTAAATGAT	1
CCCACTCAATTTAGGTGACTGG	1
CCCACTCATGTGCTACTGCGGTAC	1
CCCACTCGATCATCCAGTCTACCA	1
CCCACTCGCCTACTGGTTCGATGG	1
CCCACTCGTCAGTTGCAGCACATG	1
CCCACTCTGAACTATAACAGCTAC	1
CCCACTGGAGTCTGGAGGAGATGG	1
CCCACTGGCAATGGAATGGTCCT	1
CCCACTGGTTGGAGTTGAGTCTGC	1
CCCACTTCTGCAGGTTGAAATCGC	1
CCCAGAAATGCCATCGACAAGTG	1
CCCAGAAATTAAGGTGCTACTGAG	3
CCCAGAACCTAAGGTGCTACTGAG	1
CCCAGAACTACGGTGGTGTTTGG	2
CCCAGAACTACTATTTTTGGCGCA	1
CCCAGAAGAAAAGGGTGTCTGGACA	2
CCCAGACTCATGTCTGCCTGCGAA	2
CCCAGATCCGCTCTCTACATCCC	1
CCCAGATGCATCCCTGATGGCGGT	1
CCCAGATGGCTACGCTGAAGCTGC	2
CCCAGATGTCGCTCTACTACGTAC	1
CCCAGATGTCTATAGGGATAAGG	1
CCCAGATTTTCTTGGTGTATCTGC	1
CCCAGCAAACTTAGGGATGTGCAA	1
CCCAGCAAATCCTAGGTTGAT	2
CCCAGCAAGCTTAGGGATGTGCAA	1
CCCAGCACCTACGTTGGATCCGGC	1
CCCAGCAGTGCATGAATTGTTGGT	1
CCCAGCCCATGGTTGGCGGCC	1
CCCAGCCGGCCAGTCTTCACGTGC	1
CCCAGCCTTACAGTAAACATGGT	1
CCCAGCGAAATGGATGTGTGCAGA	1
CCCAGCGAGGTGGTGGTGGCA	1
CCCAGCTAGGGAGATGCCTCACAC	1
CCCAGCTATTCGTGGGAAGGTGAA	2
CCCAGCTCTAGGTGAGGCTGAAAC	1
CCCAGCTGATATGATGACAAAGC	1
CCCAGCTGTCTGGACAAGGGTGAT	1
CCCAGGACCTAAAGTTGTGGCTCC	1
CCCAGGACCTAAGGTACCACGGAG	2
CCCAGGACTTAAGGTGTCTGGAAA	1
CCCAGGAGAGCTGGACGTTGTTT	1
CCCAGGAGGCAAGGTACACCAAAA	1
CCCAGGATCCTGCGGATGGCTGGA	1
CCCAGGATCCTGCGGATGGTTGG	1
CCCAGGATCTAAGGTGCTACTGAG	1
CCCAGGGTACCAGAATTCTGAAA	1
CCCAGGTAAGAGATTGGTGGGAA	1
CCCAGGTAAGAGATTGGTGGGAAT	4
CCCAGGTAAGAGATTGGTGGGAGT	2
CCCAGGTACACAATGGTCCCGAGG	1
CCCAGGTGAAATAATCGGGACTAA	1
CCCAGGTGAAATACTCGGGACTAA	1
CCCAGGTGGGCTGCGTACACGGCA	1
CCCAGGTGGTGTTTATGTGGCATT	1
CCCAGGTGTCGGGTTTTCCAAGTC	2
CCCAGGTGTGGAGATTATGGGTAC	1
CCCAGGTTCATTGCACTAGAAGGG	1
CCCAGGTTGGTGTTGGTGTTACC	2
CCCAGTACGGTGGCTATTTCAGAA	1
CCCAGTATAACGCTATAGAGAGG	1
CCCAGTATAACGCTATAGAGAGGG	2
CCCAGTATCAACGGTGGTGGTCA	1
CCCAGTATTGACTGGAAGCAGCCT	1
CCCAGTCTATGACATGTGGGCCT	1
CCCAGTCTTACGAATTTGGACAGC	1
CCCAGTGTTAGGGTGCTCGTCGTC	2
CCCAGTTGACTACGTCGTGGATGCC	1
CCCAGTTGCTGAAGAAGATGAAGC	1
CCCAGTTGGTAAGATGGTAGCGCT	1
CCCAGTTGGTGTTACGAATCGGGA	1
CCCAGTTTACAACCAGAGACTGAA	1
CCCATAAAGGAGATGAGTGACATT	1
CCCATAAAGTGGTGGACTAGACGA	1
CCCATAACCGTGGACATTTGCCTA	1
CCCATAACTATTGAAATCGGTGTA	1
CCCATAAGCAGTGTCTATGGTGTC	2
CCCATAAGTGAGTGCTTGGTGAGG	2
CCCATAAGTGAGTGCTTGGTGAGGA	1
CCCATAATAGGTGACGTTTTTGAC	1
CCCATACATGTAAAGGACACTATG	1
CCCATACATTCACGAGTACCGTA	2
CCCATACGAGGAAGGTGTCTTAGG	6
CCCATACGCTTTGCTGCGTGCCC	1
CCCATACGTCATAGACACATGAGG	2
CCCATAGAAAAGGATGGCCGCTC	1
CCCATAGAGGAGGAGCCATACAC	1
CCCATAGCCACAAGCAACACCTGC	10
CCCATAGCCACGTACTTGGAGTGC	4
CCCATAGGATGGCCTATTCAACC	1
CCCATAGGGAGCTCACCATGGTGT	1
CCCATAGTGGTAGTGGGAGGGGAC	1
CCCATAGTGGTGGTGAGCTTTCATT	1
CCCATATAAACTGGACTAGGGCT	1
CCCATATACTGTGAAAACCCGAAA	1
CCCATATATCAGGAATCAGGATGC	1
CCCATATATCGGTGACTGTAATGG	1
CCCATATCCAAGGAGGTGCTCAAG	2
CCCATATGAGTGTCCTATATAGTA	1
CCCATATGAGTGTCCTATATATA	2
CCCATATGGGTGTGTGTGTGTGTA	1
CCCATATGTGGGTCCTACATCTAT	1
CCCATATGTGTCGGGTATGGCGC	1
CCCATATTCGTAGTCCCGGTTGAA	1
CCCATCAAAGGTGAGGATTTGGAC	1
CCCATCAACGGGGTGTCTCTCAGC	1
CCCATCAAGATGACGGGAGGCGC	1
CCCATCATCCAAGCTTTCCATCCA	1
CCCATCATGAACGACTCGGGT	1
CCCATCATTTGGTCGGCGGTGTA	2
CCCATCCATTGTGACTCTGTGAGC	1
CCCATCCCAGCATATATACTA	1
CCCATCCCCTACGAGTGTGTTTGC	2
CCCATCCGGTCGTGCGATATGGAA	1
CCCATCCTACGGGCCGATTGATGA	1
CCCATCCTAGGACTACGAATCTGG	1
CCCATCCTATGCGTGGTATGC	2
CCCATCGGTGCCGGATTTCCCAA	2
CCCATCGTCGGTGTTCTACTACAG	1
CCCATCTAAACAGGGCCTGAGCAC	1
CCCATCTAAACAGGGTCTGGCT	3
CCCATCTAGTATCCTACGTGGCGC	2
CCCATCTCATGGGATGGCATGCA	1
CCCATCTCTGGAATTTTGCGGGGCC	1
CCCATCTGTGATGGCCTACCTGTG	1
CCCATCTTGTAGAAGGTTGT	1
CCCATCTTGTAGAAGGTTGTC	6
CCCATGAACCAAACAGGGACTGAA	1
CCCATGAACCGATCACAGGGAAGC	1
CCCATGAACGGTGGTGTGACCAAC	1
CCCATGACCTATAGTGTTGTTGAG	1
CCCATGACCTTAAAAGCAGCCTGC	1
CCCATGACGTCTTCAGGTCTCGGG	1
CCCATGAGATGTTGTCGTAGCCAC	1
CCCATGATGACCTACACCTGCAAC	1
CCCATGATTGGTGGATTGGGTCAC	1
CCCATGCATTTGATGTGACGGAA	2
CCCATGCCACTTATGGTGACGGAA	1
CCCATGCGATAGCCTATATACCAC	1
CCCATGGATCTACTAACGGG	1
CCCATGGATGGTAGTCTTGTGGAG	1
CCCATGGCTGTTGATGGCCTCATT	1
CCCATGGGTATAAATATGTACACC	1
CCCATGGGTCTACTAACGGGCGA	3
CCCATGGGTCTACTAACGGGCGAA	1
CCCATGGGTGACTCTAAGATGCAA	1
CCCATGGTGAGTCAGTATGGTTGG	1
CCCATGGTGCGGTATTTTCTCCTC	1
CCCATGGTGGATCCGCCACTTGG	1
CCCATGTAACCTCCATGATATGTG	1
CCCATGTAAGGGGCTGTTTGGTAC	1
CCCATGTAATGCCTGGTATGGAGA	1
CCCATGTAGCTAATCTTGTGTGGA	1
CCCATGTGCAGATGAGGAGATGG	2
CCCATGTGCTCATTGATGTACCC	1
CCCATGTTGGTGGTGATGTTGTCA	2
CCCATGTTTGGTGGGCCTGTGCAG	1
CCCATTCTAGAAACTGCGGTC	1
CCCATTCTTGAGGTGTAGGCCTAA	2
CCCATTGGAAACCTGGATGTC	1
CCCATTGGCCCAATACAGGTGAC	1
CCCATTTAACAGGGGGTGCTATGG	1
CCCATTTGTGTCTATGAAATGTGG	2
CCCATTTTGTGAGGTACCAAGACC	1
CCCATTTTTACAGGTGTTTGGTTG	1
CCCCAAAAAACGAGGGCCCTGTGC	1
CCCCAAAACTTAAAAGTGGGCCCT	1
CCCCAAAAGCTACATCAAGAGGTGA	1
CCCCAAACAGGGCCTCAAATTGAT	1
CCCCAAATCAAGGTTGTAGGCTCC	1
CCCCAACAGATTGATCGCTAGCTC	1
CCCCAACGGAAGAGGGAACGGTGG	1
CCCCAACTATTTAAACCGGTGCAA	1
CCCCAACTGTTGCTGTTAGAG	1
CCCCAACTTACAGAACCAGTGCAA	1
CCCCAACTTATAAAACTGGTGCAA	2
CCCCAAGCTGGAACAGTGATGCA	3
CCCCAATCTGATACCGCCGTACAA	1
CCCCACAAGTCTCCCTGCTAA	1
CCCCACACTAGTGTTGCTCTGGGC	2
CCCCACAGCGAACATGGTGTCTCC	1
CCCCACATCGGGAAAAATGCCTA	1
CCCCACGAGGAAAATTGTCACCCC	1
CCCCACGAGGCACTATACCGTTGA	1
CCCCACGTCCGTACCTATTGCGCC	1
CCCCACGTGCGTACTGTTGGGCC	1
CCCCACTCTCCAACGGTGATCTC	1
CCCCACTGTGGAACAAGGGTAGC	1
CCCCAGAGTAGGGATTAGGTACGC	4
CCCCAGCAAGCTTAGGGATGTGCA	1
CCCCAGGTAAGAGATTGGTGGGAA	7
CCCCAGGTGACAGCCCACACAACC	1
CCCCAGTACCCGTGTACCGGTGTC	1
CCCCAGTACGGTGGCTATTTCAGA	2
CCCCATAGGTGCCGTATTTTCCAG	1
CCCCATCAATAAAGGTAGCTGTAC	1
CCCCATCGGTAGCATTTTTTA	1
CCCCATGGAAAACGGAGCGATGGA	1
CCCCATGGAAAGTGAGGTAGGTGG	1
CCCCATGGGTGTAGGTGTTAGTCA	1
CCCCATGGTGCCGATTATTGCCAC	1
CCCCATTAAAAGGAAGAGTGCTA	1
CCCCCAAACAAGCCTTACAGTGTG	1
CCCCCACAACTTGACCTAGAAGGC	1
CCCCCACATTGATTTTGGATGGTC	1
CCCCCACCCCTCAAAAGGCAGTGG	1
CCCCCACTTTTGCCTATGCAGCT	1
CCCCCAGGTAAGAGATTGGTGGGA	2
CCCCCAGTTGCTGAAGAAGATGAA	1
CCCCCATGTACTACGAATCCGGGA	2
CCCCCCTAGGAGGAGAGATGGCAC	1
CCCCCCTGAACTATCGCGGTCG	2
CCCCCGACCGGTGCTCTGGAG	1
CCCCCGATAGGATTGCCTGACATG	1
CCCCCGATGATGGATAATGGAGGC	1
CCCCCTACAAACGCTCCTACGCC	1
CCCCCTATCCATAAATCATCAGGA	1
CCCCCTCGGATCGTTTGGGA	1
CCCCCTTTTCAGAAGTGTAGTGCT	1
CCCCGAAAATGGATGGCGCTGAA	1
CCCCGAACTATCGAAACCGGTGCA	1
CCCCGAATCAGGTACTAAAGATGG	1
CCCCGAATTGTGGGCGCAGGGTAGC	1
CCCCGACACCGGTATACTAGTAC	1
CCCCGACATGGCTGCCAGTGGTCC	1
CCCCGACGTAAATACCAAAGGAAG	1
CCCCGAGTGGGTGTGCCTATGAAC	2
CCCCGATGGTGATAACTATGCAAC	1
CCCCGATGGTGATGGGTTTTAGAC	1
CCCCGCCATCCAGAAATGCAA	1
CCCCGCCCCTTTACTGTATAACGA	1
CCCCGCCTTTGGGATTGAAAGGAG	1
CCCCGCGACTTTGGAATAGATGGC	4
CCCCGGCACATGGGTGGTGTTCTA	1
CCCCGGGGCTCTGATTATGAGCGC	1
CCCCGGTGAAAACAAATATTAGA	1
CCCCGGTTGTATGGTCATGACGGG	1
CCCCGGTTTAGGGAACCCTGTTGC	1
CCCCGGTTTTGGTCTACGTGG	1
CCCCGGTTTTGGTCTACGTGGCG	1
CCCCGTCACCAATAGGTTTGATCC	1
CCCCGTCGAGTCGACAGTGGTGCA	1
CCCCGTGATGGAGGTCGAGATCAA	2
CCCCGTGGTGATCGAAGCTTATGGG	1
CCCCGTGTGTCGTTGACGTCGTGC	1
CCCCGTTGCAACAGTTGCCCGGAT	1
CCCCTAAATTTGCCACATAGGA	1
CCCCTAACTCTTAAAATCGGTGCA	1
CCCCTAATTCTACGGGACGGCCTG	3
CCCCTACAAACGCTCCTACGCCGC	1
CCCCTACACCCACGTTGAATCCGC	1
CCCCTACGGACTGGTTTTGCACGG	1
CCCCTACTATAGTCGTGGGCCATA	2
CCCCTAGTGGGTGTGCCAAGAAAC	1
CCCCTATGAACGCACGCACGCAAA	1
CCCCTATGATAGCTTGGGAAA	3
CCCCTATGTAAGGGAAAAGGCCGG	1
CCCCTATTTAAGGGACAAGGCCG	1
CCCCTATTTAAGGGACAAGGCCGG	1
CCCCTCACGAATATATAGGATCCA	1
CCCCTCATTGAAGCACGCGCTGGC	1
CCCCTCCAACGCGTCATCACCGG	1
CCCCTCCTAGATTGATGTATGTGGA	1
CCCCTCCTCCCCTATTATGGACGG	1
CCCCTCTCGTGCCTAGGTGAATCC	1
CCCCTCTTTTGAGGTGTTGGCTGT	1
CCCCTGAATTGTCAGGTAATAACC	1
CCCCTGATGATGATGGTGGTGAT	1
CCCCTGATTCAGGTGGTGTTTGGG	1
CCCCTGCACTGCAGTAAGGTGAGA	1
CCCCTGCCTTCTGTTCTGTACAGT	1
CCCCTGTCGACGGTGACCATCAAC	1
CCCCTGTCGTTTTCATGTTGAGGT	1
CCCCTGTGCACAGAGGATGGAGTA	2
CCCCTGTGGTGATGATACATGCGC	2
CCCCTGTTGCGACTACACATCAGC	2
CCCCTTAGGTGCCAGTTTTTCCAA	1
CCCCTTATATTATAGGACGGAGGG	1
CCCCTTCAGAAGGTGACACTCGGA	1
CCCCTTCCACTTCCATCTCTTCCC	1
CCCCTTCTCTTGTGTCGCGGGCCGG	1
CCCCTTGAGATATAAAAGGAGGAC	3
CCCCTTGGACTATAAAAGGAGGAC	1
CCCCTTGTAAGGAGATGTGCATGG	1
CCCCTTGTGATTCAGATGGATGGG	1
CCCCTTGTGGGTTTTGCGCCGCGT	2
CCCCTTTCAATGACGGATAGGGTC	1
CCCGAAAACCGATCAGGGCCCTGC	1
CCCGAAAATGGATGGCGCTGAAGC	1
CCCGAAACCGACACAGGTGGG	1
CCCGAAACGATTTGGTACTATGAG	1
CCCGAAACTACAAGGGGTTACGAA	3
CCCGAAATTGACATCAGTAGCTA	1
CCCGAACCTGTCTACATCGCCC	1
CCCGAACGACCCGATGATCGCGCC	1
CCCGAACTATTCAAACCAGTGTAA	1
CCCGAACTATTGAAACCGGTGCA	1
CCCGAACTATTGAAACCGGTGCAA	1
CCCGAACTCACTTTTAGGGAAGAC	1
CCCGAACTTACAAAACCGGTGCA	1
CCCGAAGGCCAACACAATAGGA	1
CCCGAAGGTGAAGTGCTACATCGG	1
CCCGAAGTCCCGGTTTGTGAAGGA	1
CCCGAATCAGGTACTAAAGATGGG	4
CCCGACAGATATGGATTATCCGGT	2
CCCGACATATGGGTGGCGACCTA	1
CCCGACCCACGTTAGGGGCGC	1
CCCGACCCTCTGTGGTATTGGCGC	1
CCCGACCTACACATCGGGCCGTGC	1
CCCGACCTATTGAAACCGGTGCAA	4
CCCGACGAGTACATCTACAACGGC	4
CCCGACGATGATGATGACTGTCGC	2
CCCGACGGTGAATTCTACTACGAC	1
CCCGACGTGGGGTCTTTTTTT	1
CCCGACGTGTAGGCGAGCCGTGCC	1
CCCGACTGTGTGCCTCTATAGG	2
CCCGAGAGATTGGTGGTATGTAAA	4
CCCGAGATTAGGGCATCTCCACAA	1
CCCGAGCAAAAATGGTGGACCCAA	1
CCCGAGCAATTCAGGATATGGTC	4
CCCGAGCAATTCAGGATATGGTCC	2
CCCGAGCTCAAGTGTGCTTGCGGG	1
CCCGAGGGTGGTATGGTTGGAGGG	2
CCCGAGGTTGCAGCTAGGGATGGC	2
CCCGAGTACGTGGGAAAAGGCCTA	2
CCCGAGTAGGTGCTCGAGGTCGAG	2
CCCGATAACTCTTGGCCTGATCA	2
CCCGATAAGAGACCCATGGGTGCA	1
CCCGATAAGTGCGTGTTCGGTGT	2
CCCGATAAGTGCGTGTTCGGTGTA	1
CCCGATACACGATACTTAGGTGGT	1
CCCGATACCCACATGATATGGTTA	1
CCCGATATCTGGTTTTATGGTTGA	1
CCCGATATTGATAACCTCAGCGGT	1
CCCGATGATGGTTGCAGGGGAGAC	1
CCCGATGGATATGCACCCGTTGCC	1
CCCGATGGGGTACCTACGCTCGAC	1
CCCGATGGTGAATTCTACTACGA	1
CCCGATGTGGACGGAAAAGGTGAA	1
CCCGATTGAGATATGGTCGTACAG	3
CCCGATTGAGGTATGCGAGGTCAT	1
CCCGATTGTGGGCCTTTGCCGA	1
CCCGATTTAGTACTGCACACCC	2
CCCGATTTATATTTTTGTAGGTGG	1
CCCGATTTTTGAATGCCTGGA	1
CCCGCAAGATGGGGGAGACAGAAC	1
CCCGCAAGCCTATTTATATTCAAG	1
CCCGCAATAGTAAAGTAAGGTGCT	1
CCCGCAATGGTAAAGTAAGGTGAT	1
CCCGCAATGGTAAAGTAAGGTGCT	11
CCCGCAATGGTAAAGTAAGGTGTT	3
CCCGCAATGGTAAAGTAAGTTGCT	3
CCCGCAGACAGATGGACAGACCGA	1
CCCGCAGACGGTACGATGACCAAA	1
CCCGCAGCCGCGAGTAATTCCTGC	1
CCCGCATCAACGCGTGAGGTGTC	2
CCCGCATCAACGCGTGAGGTGTCA	5
CCCGCATCTGGCTTGCCTGACATA	1
CCCGCATGAACTGGGTATAGGGAC	1
CCCGCATGGACTACATACACTGAC	1
CCCGCATGTCAGTGCAGTGGTGTC	3
CCCGCCAAGTTGTTGTACCGTGAG	2
CCCGCCACCGCGAGATTGATTACA	1
CCCGCCTAGTTAGATCCAACGATC	1
CCCGCCTGCGAAAATGGAAGGGA	1
CCCGCCTGCGAAAATGGTTTTGGG	1
CCCGCCTTGCACCAAGTGAAT	11
CCCGCGAAACGGTCGACGCATTGC	1
CCCGCGACGTGAAGAGGATGGAC	1
CCCGCGATCTGACCGGTCTGTGAC	4
CCCGCGCACGGAAAATAGAGTGGT	1
CCCGCGCCAGTGGTAGTGAAGTTC	1
CCCGCGCCTTTCGAAGACTGGGA	1
CCCGCGGAAGTAGGAAAATGCCTA	1
CCCGCGGTAAGATGGTAACTGTAG	2
CCCGCGGTACTACGTATACTTCC	1
CCCGCGGTCCACTAGGCTTTGGGC	2
CCCGCTAGTATAGAAGAGGATGGT	1
CCCGCTCTACCTAGGATGTGCTA	1
CCCGCTGCTCACCGCCTTTCTGG	1
CCCGCTGGATGAATTTTGGAGAAC	1
CCCGCTGTTCTGAAGATGATGCT	1
CCCGCTTACATCTGTCAGCTTT	1
CCCGCTTGATAAACGGTGAGGTGT	1
CCCGGAACCGCCATCAGGAAGTAA	1
CCCGGAAGAACTTGAAAGGAGCAA	1
CCCGGACAAGAACTGGGTTGCCTA	1
CCCGGACACCTGGGTACAGATGGG	1
CCCGGACAGGAGTAGGGTATTACT	2
CCCGGATACGAATACGAATATGGT	1
CCCGGATACGAATACGCACATGGT	1
CCCGGATCTTTAGTCTCGGTTTGC	1
CCCGGCCAGGGTGGTTAGGTCAGG	1
CCCGGCCAGTGAGAGAGAAAGAAG	1
CCCGGCCCCGAACCCGTCGG	1
CCCGGCCGGTTGGCTTAAATAGGG	1
CCCGGCCTCCATATCGAGC