#ID_REF = Signature - 20 nt sequence including DpnII site (GATC)
#VALUE = Mean abundance for a signature derived from all MPSS runs for the sample, in transcripts per million (TPM)
#ST_DEV = Standard deviation of the mean abundance from multiple MPSS runs
#REP = Replication_global
ID_REF	VALUE	ST_DEV	REP
GATCATAGTGGACGTTGTTA	1	1	yes
GATCATACCCTAGCCGGGCA	58	32	yes
GATCAGTGTGTGCCAAGGAG	37	7	yes
GATCAGTCAGTGACAACCAA	115	26	yes
GATCAAGAGAAAGAAGTGGG	54	12	yes
GATCAGTAGAGCTTGGACCC	344	298	yes
GATCAGGGCAATGGTCACTG	70	7	yes
GATCAAGACGCAGGTCGAGG	60	51	yes
GATCAGGCTGTTGTAAAATC	1	1	yes
GATCAGGCGTGAGCTTCAGA	10	9	yes
GATCTGGCCAACGGCAACAT	77	22	yes
GATCTGGCACTAACAGAACC	8	9	yes
GATCTGGCAAAAACTACGGG	108	5	yes
GATCTGGATTTGGTTGAGAT	48	6	yes
GATCTGGAGTCTGGTGTGGC	111	75	yes
GATCTGGAGCTCGCCCCCAG	14	12	yes
GATCTGGAGCGTATGGGTCT	4	4	yes
GATCTGGAGCCCTGGAATCC	10	9	yes
GATCTGGACTGGTGTTTCTT	32	4	yes
GATCTGGACTCACCTGGGAG	25	22	yes
GATCTGGACTCAAGGGGCAT	33	8	yes
GATCTGGACGATTCTGAGCC	194	32	yes
GATCAGGCCCACTCCAGGAG	83	59	yes
GATCAGCCTACGCTCACATT	32	27	yes
GATCAGCAGGTATTATCAGA	1	1	yes
GATCAGACTGTTGCTTTCGC	52	43	yes
GATCAGCAGCAGCGGGGCCT	11	9	yes
GATCAGCACCAAGTGACTTG	25	1	yes
GATCAACTCCTTGAGACACT	10	9	yes
GATCAACTCCCGTACTAGAA	52	45	yes
GATCACTACTGACTTGTTGG	9	6	yes
GATCTGCTTTGTGCTTGGCT	64	13	yes
GATCTGCTTTCTCAGGACTC	21	4	yes
GATCTGCTTTCCCTTTGTAA	22	19	yes
GATCTGCTTGTGTTGTGTTG	3	2	yes
GATCTGCTTGCCCCAAACAA	207	17	yes
GATCTGCTTCTACCTCCCTA	52	3	yes
GATCTCGGACGCTCAGTGGG	173	57	yes
GATCTCGCTGGTTCGCACCT	64	2	yes
GATCTCGATTCTACAGTGGT	49	35	yes
GATCAACGCGTTTCTGAAAT	55	14	yes
GATCACTGTGTCCCAGGCTG	23	4	yes
GATCACTGACATCTATACCC	19	4	yes
GATCACTCTTCCCGCTGCTG	4	4	yes
GATCACGAAGAAGGCAGCCT	21	18	yes
GATCTCCTCTCTTCCCACGG	21	4	yes
GATCTCCTCTCCAGGGAGCT	74	2	yes
GATCACCAGAAAGTTTGTTA	23	6	yes
GATCACAGGGGAACTAATTC	19	16	yes
GATCACAGAGTGGGAATCTC	20	8	yes
GATCACACTGTCTGAGGCGT	5	4	yes
GATCACACTCTGGCCCCCAA	7	1	yes
GATCACACCAGAGTCCAGGT	24	5	yes
GATCTCATCGAAACAAAGCT	61	9	yes
GATCAAGGCCCCCAAGAGAG	3	3	yes
GATCAAGGACATCCATGTGC	27	19	yes
GATCTCAGGTCTTCAAGCAA	41	35	yes
GATCAAATCCGACGACGAGG	47	34	yes
GATCAAGAGCAGTGCTGCTC	44	52	yes
GATCAAAGTTCCCAGAAATG	13	11	yes
GATCGCTGCCAACATCCAGG	24	5	yes
GATCAAACCGCAAAAAAAAA	11	7	yes
GATCAAACCCAGGGCTTTGT	47	40	yes
GATCACTTTATTTGCTAGGG	110	16	yes
GATCAAAGGAAATGGAGCCA	157	53	yes
GATCAAAGCACTGGCGGGCT	12	4	yes
GATCAAACGTGGCTGAGCGC	55	42	yes
GATCAAACGTGGCTGAGCGA	20	28	yes
GATCCTGGGCATTCAACTCA	2	0	yes
GATCATCTTGTGAAAACCCA	217	56	yes
GATCCACCTGAGAGGGATGG	79	22	yes
GATCTTTTCCACCTTCAGAG	12	14	yes
GATCAAACAGGCTGTCAAGA	20	24	yes
GATCAAACACACACAAGCAT	2	2	yes
GATCTCAACTGTAAGAGTTG	10	9	yes
GATCTTTGTAAGTTCAAGGC	15	18	yes
GATCTTTCTGGCAAGGAAAC	1238	333	yes
GATCAAAATCGCAGTTACTT	12	10	yes
GATCATCCAGAACACAGCCT	238	89	yes
GATCCAGAAACACAAAAAGG	82	0	yes
GATCTGCGCTTCCAGAGTGC	822	111	yes
GATCCGCTCGACAAGACAGG	29	3	yes
GATCCACTCAGCCGTGGTTT	9	3	yes
GATCCTGAGCCAGATGTCAT	165	30	yes
GATCCTGAGATGCAGCTCAT	25	3	yes
GATCCTGAGAGCCTCATCCT	15	3	yes
GATCCTGACTTTGCCAGCTG	6	7	yes
GATCCTGACTCTGACACTAC	106	20	yes
GATCCTGACCTGGGCTTCCT	98	2	yes
GATCCTGACCACATGAACAA	474	204	yes
GATCCTGACAGTGCACCTAA	55	16	yes
GATCCTGACAGAGCCTTGGT	198	8	yes
GATCCTGAATTCAAATCCCA	39	12	yes
GATCCTGAATGACGTTCAGG	93	16	yes
GATCCTGAAGTGGCCTCAGC	23	2	yes
GATCCTGAAGTAGACAAAAA	21	0	yes
GATCCTGAAGGTCATCCGCA	89	18	yes
GATCCGTGGCAAAGGGAACC	15	11	yes
GATCCACGGCTCTTCACACT	6	5	yes
GATCCGCATCCTCAACCCAT	43	8	yes
GATCCTGAAAGCCAAGTTAG	156	25	yes
GATCCTCTTTGCCAACCCCA	176	11	yes
GATCCTCTTTGCACAGAAGA	39	12	yes
GATCCTCTTGTTCCACGATG	7	6	yes
GATCCTCTTGTCCACTCCAC	20	19	yes
GATCCTCTTGCTGCAGCTTC	87	13	yes
GATCCTCTTGCTGAAGAAAA	24	4	yes
GATCCTCTTGATTCCTTCTG	3	3	yes
GATCCTCTTGATGCAGAGAG	584	71	yes
GATCCTCTTCTTCCTCGTGA	74	9	yes
GATCCTCTTCTTCAGCACAC	201	22	yes
GATCCTCTTCTGCTGTTCTG	10	5	yes
GATCCTCTTCCTGCTCCAGC	52	5	yes
GATCCTCTTCCCATCCATCC	65	45	yes
GATCCTCTTCATCTTGGGCA	47	16	yes
GATCCTCTTCAGCCCTGTGA	25	14	yes
GATCCTCTGTTGGGGCCTCG	161	4	yes
GATCCTCTGTGTCCTTATTT	86	23	yes
GATCCTCTGTGGACTCATCT	98	20	yes
GATCCTCTGTGCCTCACTCC	148	47	yes
GATCCTCTGGAAAGGCAGCA	4	4	yes
GATCCTCTGAGGCAGTATTG	82	23	yes
GATCCACCCCTTAAGAACCA	43	8	yes
GATCCACCACCTAGAATCTA	6	5	yes
GATCCTCTCTTGTGCTACCT	50	13	yes
GATCCTCTCTGAACCTCCTG	37	5	yes
GATCCTCTCTCGGTGTGGTT	7	3	yes
GATCCTCTCATTCAGTCTTC	65	2	yes
GATCCTCTAGGGGTTATGGG	6	7	yes
GATCCTCGTGCCTGTCTCCC	319	57	yes
GATCCTCGTCCACCCTAACT	14	8	yes
GATCCTCGTCACCACAGTTG	56	13	yes
GATCCTCGGGGTTCAGCCTC	37	6	yes
GATCCTCGGGCAAGCCAAGA	770	141	yes
GATCCTCGGGAGACCACTGG	237	29	yes
GATCCTCGGGAATTTTTACC	125	15	yes
GATCCTCGGAGGCTACCGAG	6	0	yes
GATCCTCGCAGCTTCTATGA	126	19	yes
GATCCTCGACAGGAAGCCAC	24	13	yes
GATCCTCCTTGTCAAGTACA	305	66	yes
GATCCTCCTGTGTCTTCCTC	31	16	yes
GATCCTCCTGTGAAGTGCCA	7	1	yes
GATCCTCCTGCGTGCTGACA	88	15	yes
GATCCGAAACCAACCTACAG	51	11	yes
GATCTGAGCTGAATTTGAAG	8	4	yes
GATCCTCCTGCCCCGACAAG	82	25	yes
GATCCTCCTGAGTGCTGGGA	24	9	yes
GATCCTCCTCCTGTGTTTCT	28	3	yes
GATCCTCCGTGAGTATGCCT	67	15	yes
GATCCTCCCTGGTGTCTGGG	61	18	yes
GATCCTCCCCTTTACGGACA	158	18	yes
GATCCTCCCCCTCTCCCACC	40	2	yes
GATCCTCCCCAGGGATGGGG	259	11	yes
GATCCTCCCAAGTGAATGAC	99	12	yes
GATCCTCCAGTCAGTCTATT	55	6	yes
GATCCTCCAGGACAAGGGGT	158	23	yes
GATCCTCCAGCAGAGTGGAC	22	10	yes
GATCCTCATATGAGGACCAT	22	4	yes
GATCCTCAGTTACTCGCTGC	24	5	yes
GATCCTCAGTGGGTAAGTGC	15	5	yes
GATCCTCAGTGCTACTTGCG	23	2	yes
GATCCTCAGGGTCTGCCCTT	4	4	yes
GATCCTCAGGAGTTGCAATG	18	1	yes
GATCCTCAGGAAACAGTCTC	36	14	yes
GATCCTCAGCTGGCTGGAGC	65	21	yes
GATCCTCAGCTGCCCTGCCT	3	1	yes
GATCCTCAGCCCTAACCCAG	28	3	yes
GATCCTCAGATTAGATGTTT	1	1	yes
GATCCTCAGAGACGTGCTCG	144	13	yes
GATCCTCACCATCCACGTTT	23	12	yes
GATCCTCACCAGCCGCGGGC	894	162	yes
GATCCAGTGCCTGTGTAGAA	18	2	yes
GATCCAGGCCCTGGGAGGCT	4	3	yes
GATCCTCAACTCCTCCAAGG	61	7	yes
GATCCTCAACATCCGCCTGC	10	9	yes
GATCCTCAACAAGATGCTAT	17	3	yes
GATCCTATTCTTAGGTCTAA	12	10	yes
GATCCTATTCCAGCCAAATG	176	32	yes
GATCCTATGTGTTGGCCATT	85	19	yes
GATCCTATGTGGCTCTAAAA	11	9	yes
GATCCTATGTAGCCCAGGCT	2	2	yes
GATCCTATGGTGTCCACACT	35	8	yes
GATCCTATCTCCCGGTTGGG	47	7	yes
GATCCTATCATTGCTGGTGG	180	49	yes
GATCCTACTTTGGGAACATG	11	8	yes
GATCCTACTGTGGATGACAC	438	2	yes
GATCCTACTGATGAAGTGCC	128	15	yes
GATCCAAGGGGTGGTAGGGC	136	10	yes
GATCCCTCTCCCAGGAACAA	67	6	yes
GATCCAAGCTGTCAAGAAGG	136	19	yes
GATCCAAGCAGCCTTCAGGG	21	5	yes
GATCCTACGGAGCAAGTCTA	47	5	yes
GATCCTACCTTCTGCTTTCG	8	2	yes
GATCCTACCTGAGTGGCAGC	699	47	yes
GATCCTACATCCATTCGGCT	79	3	yes
GATCCTACAGTGGCTGGCAA	168	17	yes
GATCCTACAGTCACTTCACA	8	2	yes
GATCCTACACTCCTGGCAGT	18	5	yes
GATCCTACACATGGAGGCTG	63	7	yes
GATCCTACACAGCTAATCCA	2	0	yes
GATCCTACACACCTACCAGA	39	3	yes
GATCCTACACACAGTGGTGA	11	7	yes
GATCCTACAAGCCTGTCCGT	107	15	yes
GATCCTAATGATTTCAGCCC	4	4	yes
GATCCTAAGCAGATTCTGGG	1	1	yes
GATCCTAACTGTGGAACCTC	7	3	yes
GATCCTGCACTTTGCTCCTC	1	1	yes
GATCCTAACCTAAGATGCCT	152	12	yes
GATCCTAACCCAGTGGACTC	9	4	yes
GATCCAACTTGCCCCAAGAA	2	4	yes
GATCCCGTGTCCTGCAGACG	57	49	yes
GATCCTGTCCGAGAGGCGCG	31	5	yes
GATCCTAAAGTTCTTTCAGG	12	5	yes
GATCCTAAAGGCCGGTCACA	109	3	yes
GATCCTAAACTCTGTTGCCA	106	5	yes
GATCCTAAACTCCAAGGGGA	73	5	yes
GATCCTAAAACCAAGGGAAT	61	7	yes
GATCCGTTGGAAGGTTTACC	50	10	yes
GATCCGTTGCCTCCTTAAAG	30	8	yes
GATCCGTTGCCAGTTACCTG	239	16	yes
GATCCGTTCCTAGGGTACCT	217	44	yes
GATCCGTGTGTGTGTGGGAG	378	49	yes
GATCCGTGTGAAACTGGATG	2707	243	yes
GATCCGTGTCAACCCCTTTT	13	5	yes
GATCCGTGTATGTCTAAACA	4	5	yes
GATCCGTGGCTGCAGCAGAA	201	34	yes
GATCCGTGGAGAAACTTGCC	2	3	yes
GATCCCGGAAGGGGAGAAAG	443	43	yes
GATCCGTGCTGAGCGTCGGC	133	26	yes
GATCCGTGCATCTCATTGGC	56	1	yes
GATCCGTGAAGAACAAAAAG	28	33	yes
GATCCGTCGCCTGGAGGTGG	145	29	yes
GATCCGTCCGAGATGGCAGA	9	1	yes
GATCCGTCATCTCCAGGACA	3	4	yes
GATCCGTCAGTGGTCAGTGC	12	14	yes
GATCCGTATCAGGTTCATGT	4	5	yes
GATCCGTAGTCTGAGTGATG	211	32	yes
GATCCGTACCCTGGTGCTGA	164	1	yes
GATCCGTAAGAAAGAGAAGG	66	7	yes
GATCCGGTTCTGGGACAGCA	2	2	yes
GATCCGGTCCCAAGACCGCT	636	117	yes
GATCCGGTCCAAGGCTCTTG	195	36	yes
GATCCGGGTGTCCAGTGACA	136	22	yes
GATCCGGGTGATGCGAATCG	2	2	yes
GATCCGGGGGTTCAATTTAT	127	16	yes
GATCCGGGGGAAATTGGGAT	3	2	yes
GATCCGGGGCACACATTCTC	2	2	yes
GATCCGGGCAAAGCCTGCTC	239	16	yes
GATCCGGGAGGTGTGCGGCT	3653	304	yes
GATCCGGCTGTGCCAGGTGT	21	9	yes
GATCACAGGACTTGCTCCAA	10	1	yes
GATCCGGCAGAAGGATGAGG	84	2	yes
GATCCGGACTCACCTGGGAG	95	18	yes
GATCCGGAAGAAGATGATGG	159	185	yes
GATCCGCTTGGCAGCCATTC	298	43	yes
GATCCGCTTACAGAGACTTT	3	2	yes
GATCCGCTGTCAGGAGCTGA	3	4	yes
GATCCGCTGCAACCCGGTGC	11	9	yes
GATCCGCTCTGTGGTCGCCT	262	58	yes
GATCCGCTCTGAGGTTCTGT	2	2	yes
GATCCGCTCTCTGCATCTGT	3	4	yes
GATCCGCTCCTGGCGACTCC	101	1	yes
GATCCGCTCAGAGCCCAGCA	19	0	yes
GATCCGCTCACGCCCAGCAG	118	19	yes
GATCCGCCTTCTACTCGGAA	8	0	yes
GATCCGCCGCTAAGACCTGG	12	13	yes
GATCCGCCCTGTGAGTCACC	61	4	yes
GATCCGCCCACACCCACGTG	445	81	yes
GATCCGCCAAAAAAATGCAC	11	5	yes
GATCCGCATGATGGGAGGAG	11	7	yes
GATCCGCATCCGCAAGCCCT	89	0	yes
GATCCGCAGGTCAGATGACA	60	10	yes
GATCCGCAATTATGAAGAAC	8	7	yes
GATCCGCAAGGTGCTGGACG	170	26	yes
GATCCAGACAGCCATCAAGG	184	80	yes
GATCATTGTCTTCTGTCTTC	50	0	yes
GATCCGCAACTGTCCGGAAG	34	14	yes
GATCCGATTTCTGATTTTGC	9	11	yes
GATCCGATTGAAGCCTCAGG	2	3	yes
GATCCGATGGGCCAGCCTTT	177	15	yes
GATCCGAGTGAAAGCCGGAG	22	26	yes
GATCCGAGGCTAGAGGGAGC	59	43	yes
GATCCGAGGCAGATTTTCTT	6	2	yes
GATCCGAGCGACTGTCACCA	51	22	yes
GATCCGAGCCTCACTACCTG	15	3	yes
GATCCGACAGGAGGGTGTAA	414	24	yes
GATCCGAATTGCAGAGCTGT	74	13	yes
GATCCGAATAATCCAGGAGG	6	7	yes
GATCCGAAGCTCATTCCAAG	34	7	yes
GATCCCCAAAGCCCCTAGAG	20	24	yes
GATCGTGTGTTGTCTGGAAG	2	2	yes
GATCCCCCTCCTAGAACACA	37	4	yes
GATCTGCTTCCTGAAGAGTG	8	4	yes
GATCTGCTTCCCATTGTGGT	104	22	yes
GATCTGCTTCCCAACTGTTA	88	15	yes
GATCTGCTTCCATCCATCTC	40	7	yes
GATCGAGCGGCAGCGGCTGG	30	19	yes
GATCCTAGGCTTCCTTCCCA	21	33	yes
GATCTGCTGTTCCTCACGAA	345	0	yes
GATCTGCTGTCTACTACCTA	32	12	yes
GATCTGCTGGTCATTAAGGG	142	27	yes
GATCTGCTGGCAGTAGTAGT	6	5	yes
GATCTGCTGGAAGATAATCT	51	1	yes
GATCTGCTGCCAGGTTTTGC	4	4	yes
GATCTGCTGCAGGGTTCTGT	154	15	yes
GATCTGCTGCAGCTAAAGTA	10	9	yes
GATCTGCTGATGTTACGTCG	14	12	yes
GATCTGCTGATGATGGAACA	57	9	yes
GATCTGCTGATATTCCGGGC	44	38	yes
GATCTGCTCTTGCTAATAAC	18	2	yes
GATCTGCTCTGTAGAAAGAA	9	1	yes
GATCTGCTCTGATGGTATGT	45	0	yes
GATCTGCTCTCAAAAATTCC	2	2	yes
GATCTGCTCCTTCTGTCCCA	79	4	yes
GATCTGCTCCTTAACGTTTT	47	5	yes
GATCTGCTCCTGGAGGTGGT	25	4	yes
GATCTGCTCCCAAGTTATCT	28	8	yes
GATCTGCTCCAACTACAGGA	63	7	yes
GATCTGCTCAGTGACTTGTG	28	1	yes
GATCTGCTCAACAACTCCTT	23	2	yes
GATCTGCTATGTACTCCAGG	214	0	yes
GATCTGCTAGAGCTGTAATA	569	81	yes
GATCTGCTACTGGAGATGTT	46	8	yes
GATCTGCGTATGGCGGCCAT	3426	121	yes
GATCTGCGTACACCTGCGTC	115	6	yes
GATCTGCGGTGACTTGATGT	2521	172	yes
GATCTGCGCTATAGAAAAAA	8	7	yes
GATCTGCGCCTGCCTTGTCT	34	11	yes
GATCTGCGCCTGAGCCAAAG	324	25	yes
GATCTGCGAAGCCAGGCTTC	4	4	yes
GATCTGCCTTGGATTTCCTC	23	2	yes
GATCTGCCTGTTACCTCTTC	11	9	yes
GATCTGCCTGTCACTGTGGC	42	13	yes
GATCTGCCTGCCTCTGCCAC	27	19	yes
GATCTGCCTCAGGAAAAATA	46	5	yes
GATCCTGTGCAGCGCTACAA	10	1	yes
GATCCTGCAGCACGTTATCG	57	5	yes
GATCTGCCCTTTCTGGGTGA	169	34	yes
GATCTGCCCTTGCACCCGGC	86	1	yes
GATCTGCCCGAAGCCATGAG	58	15	yes
GATCTGCCCCATGGTGTTTT	14	8	yes
GATCTGCCATTCCCATCTGT	67	10	yes
GATCTGCCATGGAGGAATCT	3	3	yes
GATCTGCCAGTTTTGGTGCC	43	32	yes
GATCTGCCAGTCCGAGGTTC	122	55	yes
GATCTGCCAGGACAAGCTGG	9	7	yes
GATCTGCCACTGCTTCTCTA	124	88	yes
GATCTGCCACAGCAAGAGTG	185	17	yes
GATCTGCCAATGGTGCCGTT	13	11	yes
GATCTGATTGCCTTCATGGA	20	24	yes
GATCCTGGGCAAGCTGGGCG	4	1	yes
GATCTGATGTATGCCAAGCG	231	3	yes
GATCTGATGCCCTTTTGTGG	43	37	yes
GATCTGATGCCCTCTTCTCG	17	14	yes
GATCTGATGACTCCATATTT	2	2	yes
GATCTATCCTAGCCGGGAGG	391	53	yes
GATCTGAGTTCTGTGCCAGC	11	9	yes
GATCTGAGTCCTCACACTGG	12	10	yes
GATCTGAGGGTTGATTGACA	201	5	yes
GATCTGAGGCCTTGTTTTTT	212	1	yes
GATCTGAGCTGCCCTCTGCT	116	4	yes
GATCTGAGCTAAATGTCTAC	9	8	yes
GATCTGAGCCTCCACCTGTG	11	2	yes
GATCTGAGCCTACTAAATGT	8	7	yes
GATCTCAGCCTTCCCAGCAG	9	1	yes
GATCTACTGTGAAAAGCATG	2	2	yes
GATCTTTGGGTTTGAGGATA	39	4	yes
GATCTTTGCCAAAATGTGTG	17	2	yes
GATCTTTCGGAGGAGATGTC	38	28	yes
GATCTATACAGTCGGGAAAC	462	441	yes
GATCTGAGCAGGTGAAAAGT	13	11	yes
GATCTGAGCAGCAATGCGCT	48	3	yes
GATCTGACCTGTCCCAGCAA	25	22	yes
GATCTGACCTCTCCTGGCAC	11	13	yes
GATCTGACCGCTTTGGCCAA	26	2	yes
GATCTGACCAACAAGACCAC	27	32	yes
GATCTACCGTGCAGGGACTG	225	26	yes
GATCTACACATGGGGCAACC	214	153	yes
GATCACTGACTGCCCCAAAC	30	22	yes
GATCTTTACAAGTCTGGCAC	17	20	yes
GATCTGAATTTCTTCCTCTT	55	9	yes
GATCTGAATGTCCGAGAGAG	248	48	yes
GATCTGAATGCTGCCGAGTC	46	40	yes
GATCTGAAGTCTGAATGGCA	12	1	yes
GATCTGAAGTATCTGTACAG	12	1	yes
GATCTGAAGCTGCTGATGAA	190	38	yes
GATCTGAACTCCAGAGAACA	115	13	yes
GATCTGAACCTGCCTGGAAA	6	5	yes
GATCTGAACACCCAGCGAGG	13	11	yes
GATCTCTTTGTGTTCAAGAC	2	3	yes
GATCTAATTGCAGTGGTTAA	9	11	yes
GATCTACCGTGCACACCCAG	153	180	yes
GATCTTGTCTCACCCTGAAT	19	2	yes
GATCTACCCGGGACACGGAC	17	14	yes
GATCTTGTATTCTCTGGCTT	21	24	yes
GATCTTGTACAAACCGGTTT	15	13	yes
GATCTTGGTTTTGAGTTCTT	15	5	yes
GATCTCTTTGAGTTTGAGGG	10	14	yes
GATCTGCGGCAGGAATTGGC	2	2	yes
GATCTCTTGCCCAAGGCTTA	24	21	yes
GATCTCTTCTCGCGCTCTCC	31	27	yes
GATCTCTTCCATGTTACAAG	1	1	yes
GATCTCTTCACTGTTTTTCT	160	14	yes
GATCTTGGGGAGTTTGACTG	33	29	yes
GATCTTGGCTCTGTGGAATG	67	1	yes
GATCTCTGTGTTCAGGCTCT	52	1	yes
GATCTCTGTGGGCCTTTGGG	82	36	yes
GATCTCTGTGCTTTCTTCCT	18	7	yes
GATCTCTGTGCTGGCGCCTG	4	4	yes
GATCTCTGTGCGCCTTCCTG	25	22	yes
GATCTCTGTGAGTTTGAGGG	120	144	yes
GATCTCTGTGAGCCTAGGAG	10	9	yes
GATCTTGCTTCAGCCAACGC	17	14	yes
GATCACCTTTTTTGACGAGT	3	3	yes
GATCGTACGGGGCTGGAAAC	62	17	yes
GATCGGTGGGACCCGGGCGA	101	102	yes
GATCGTGGGCTTCAGCACCC	36	31	yes
GATCACACTGAAGATGCCTC	74	36	yes
GATCGGCTTTGAGAGAGGGT	68	6	yes
GATCGGCGTGGCAGCTGTGG	8	6	yes
GATCTTCGGCCCCAAAAAAA	56	23	yes
GATCTTCGAGACTTTGTTAG	20	24	yes
GATCAGTTGACAGTGGCAAT	715	48	yes
GATCGGTGCTCTGAAGGGAA	31	2	yes
GATCGCTGGACAGGTGGCAA	84	78	yes
GATCGGCTCTGAAGATTTCA	71	16	yes
GATCACCAGCCTTTTGCAAA	55	11	yes
GATCGGCGGGAAATGGCGGA	118	12	yes
GATCGGCGCCGTGAGATTCG	24	11	yes
GATCTTCCCAGTTATGGCCA	52	45	yes
GATCGCTCATTGGAACAGCT	1192	129	yes
GATCTGAAGCAATGTGACTG	18	15	yes
GATCTTCAGCCTCTTGGGGA	57	6	yes
GATCTTCACTCACGTCCGGC	83	24	yes
GATCGCCTGCTAGTGCGGGA	30	7	yes
GATCTTCACAGTGCATGGCT	41	35	yes
GATCTTCACACACAGCAGAT	18	3	yes
GATCAGCATGAACCATACAA	6	5	yes
GATCCTAATCTCAGAGCCCT	11	3	yes
GATCTCTTTTCAGAAGTGTC	49	34	yes
GATCGTGTGGGACCTGGCAG	4	4	yes
GATCTGCCTGACTTCCCTGA	297449	51564	yes
GATCTGTTGCTCCAAGACCC	54	63	yes
GATCTGAGCCGGTCGAGCCC	24	28	yes
GATCCCTCCGTTTCACCTCT	72	16	yes
GATCCCATTGGTGCGGGAGG	3	2	yes
GATCATGTTCACAACGCAGG	11	9	yes
GATCTCTGTGCTGTAAACTA	80	3	yes
GATCCCTTTTCCATTCTGGA	29	2	yes
GATCCCTTTGGGGTGTGGAA	202	15	yes
GATCCCTTTCTCTGGCCCAG	257	8	yes
GATCCCTTTCCACCTAAAAC	19	0	yes
GATCCCTTGTGAGCCCTAGT	104	1	yes
GATCCCTTGTAGCCAGAGTT	55	5	yes
GATCCCTTGGGCAAGTATCA	71	10	yes
GATCCCTTGCTTGCCTCTTG	25	1	yes
GATCCCTTGCTTCAACCTCC	39	1	yes
GATCCCTTGCTACATCTCCT	22	1	yes
GATCCCTTGCCTCCTGAGTT	74	9	yes
GATCCCTTGCCCTTGCATTC	27	32	yes
GATCCCTTGCAGTTCTGTGC	83	20	yes
GATCCCTTGCACACAGCCCA	1322	7	yes
GATCCCTTCCTGCCCTCTTT	229	32	yes
GATCCCTTCCCCAGCGGTTC	20	17	yes
GATCCCTTCCAGCTGAGCCC	188	8	yes
GATCCCTTCCAAATCTGCTC	2	2	yes
GATCCCTGTTCCCCTGAGAA	103	16	yes
GATCCCTGTGGTCACTTAGC	80	26	yes
GATCCCTGTGAGTTCAAGGC	8	15	yes
GATCCCTGTCTCGGGAGGTC	3	2	yes
GATCCCTGTCTAGTCCCTGT	41	1	yes
GATCCCTGTCCCCCTACCCC	4	4	yes
GATCATGGGTTGGGAGCTCA	115	35	yes
GATCATGGGCAAAAAGCCCG	116	2	yes
GATCAGGAGCTGGAGAGGAA	296	128	yes
GATCCCTGGTTGCATCTTCG	3	3	yes
GATCCCTGGTGGCTGCCCTT	441	10	yes
GATCCCTGGGTGCCAGTTTT	23	10	yes
GATCCCTGGGGGCTGTGATG	54	3	yes
GATCCCTGGGGCTGCCTGTC	128	14	yes
GATCCCTGGGGCATGTTGTA	126	10	yes
GATCCCTGGGAGGATATGAG	23	3	yes
GATCCCTGGCTCAGTGAACA	83	1	yes
GATCCCTGGCGTCCCTATCA	139	15	yes
GATCCCTGGCCCCTGTGCCA	222	16	yes
GATCCCTGGCCAGAAGTACA	19	0	yes
GATCCCTGGCACTGCTGCCT	19	7	yes
GATCCCTGGCACCCAGCATC	36	14	yes
GATCCCTGGAGTGACCAGAG	550	98	yes
GATCCCTGGAGTCTCTGAAG	48	5	yes
GATCCCTGGACTGGAACAAA	80	17	yes
GATCCCTGGAAGCTGTGATG	17	4	yes
GATCCCTGGAACAGAGTTAT	8	6	yes
GATCCCTGCTTTTGTGGCCT	37	4	yes
GATCCCTGCTTGCCCCGCAC	25	7	yes
GATCCCTGCTTCCTGCCCAG	142	14	yes
GATCCCTGCTCTTAGGTGCT	32	12	yes
GATCCCTGCTCTGGACCCTC	144	3	yes
GATCCCTGCTCCCCTCTGGG	45	5	yes
GATCCCTGCTCCAGGTCCTC	265	42	yes
GATCCCTGCTAATGGAAGAA	114	20	yes
GATCCCTGCCTGTGGGGGGT	45	2	yes
GATCCCTGCCTGTCCTGAAA	7	6	yes
GATCCCTGCCTCGTCTGCCT	39	10	yes
GATCCCTGCCGAGGTGCTCA	583	35	yes
GATCATGGCGGTCAGCAGAA	7	1	yes
GATCATGGCCTGGTGCAGTA	61	2	yes
GATCATGGCAGGGATACGCA	37	4	yes
GATCCCTGCCCTTTGGCCTG	53	7	yes
GATCCCTGCCACCTCATTGG	88	51	yes
GATCCCTGCATTTCCTCAAG	229	43	yes
GATCCCTGCAGTACCATCTG	6	2	yes
GATCCCTGCAGGTCGCTCAG	110	16	yes
GATCCCTGCAGCGCTGTTTG	173	12	yes
GATCCCTGCAGAGGCTTCCA	68	2	yes
GATCCCTGCACAAGGTGTTT	63	21	yes
GATCCCTGAGTTTACCAGCG	15	5	yes
GATCCCTGAGTTCAAGGCTA	39	5	yes
GATCCCTGAGTTCAAGGCCA	30	8	yes
GATCCCTGAGTAAACTTCTT	3	4	yes
GATCCCTGAGGTCTCCTGCC	369	15	yes
GATCCCTGACATAGCAGGAC	15	0	yes
GATCCCTCTTACCTGCAACG	195	34	yes
GATCCCTCTGGTGACTCCAC	112	29	yes
GATCCCTCTGGGTCATGTCT	224	27	yes
GATCCCTCTAAGCCCCCTCC	164	24	yes
GATCCCTCGGTGACCACATT	260	51	yes
GATCCCTCGACGGCCAAGCC	42	36	yes
GATCCCTCCTTGTGAGCAGC	95	0	yes
GATCCCTCCTGGGCATTGCT	29	9	yes
GATCCCTCCTCAGGCATCTG	776	123	yes
GATCCCTCCCTTGGGCCTCC	63	12	yes
GATCCCTCCCTCCGAGGCCA	19	3	yes
GATCCCTCCCCTCCCTGGCT	73	8	yes
GATCCCTCCCAGAAACCTGC	3144	286	yes
GATCCCTCCCACTCTGGCTC	23	9	yes
GATCCCTCCAGCCTCTACTG	18	1	yes
GATCCCTCCAGACACCAAGG	64	3	yes
GATCCCTCCACAAGATTCTG	1	1	yes
GATCCCTCAGGAACAGAGGG	268	50	yes
GATCCCTCACCTCCTTCATC	32	27	yes
GATCCCTATGCTGACCCCAA	8	0	yes
GATCCCTATGAAGTGTCTTA	2	2	yes
GATCCCTAGGGAGAAGGTGG	17	4	yes
GATCCCTAGCATTCTGTACT	80	10	yes
GATCCCTAGAGCCAGCACAT	48	6	yes
GATCCCTACTGCACCACCTT	7	8	yes
GATCCCTACTCGTTTCAACA	12	1	yes
GATCCCTACTATTGATTCTG	7	1	yes
GATCCCTACTACGTGCTGGA	442	71	yes
GATCCCTACCTACAACCCTA	128	1	yes
GATCCCTACCCCACATGCTG	10	9	yes
GATCCCTACCCATGGGAATG	133	35	yes
GATCCACATCTCAAAGAAAT	629	507	yes
GATCATGAGCTGGAGGCACC	50	5	yes
GATCTTCGGTGCCACCGGCA	6	5	yes
GATCCCAAGTGGCACTGTTT	18	10	yes
GATCCCTACCCATGGACCCT	10	1	yes
GATCCCTACCACCTGCCCGA	79	27	yes
GATCCCTAATGAGAGCAGAG	19	2	yes
GATCCCTAAACTACCTCTTG	35	8	yes
GATCCCGTTTGTGAAGCCTG	10	7	yes
GATCAGTTTTTGGTGTCATC	7	8	yes
GATCCCGTGGACTGTTTGCT	3	4	yes
GATCCCGTCCAAGGAGCATC	572	34	yes
GATCCCGCGAGGCCCGGAAG	3720	499	yes
GATCCCGCCTGCCCAGCTGA	141	17	yes
GATCCCGCCGTTCCACCCTC	7	5	yes
GATCCCGCCCACCCAAAGCT	211	64	yes
GATCCCGCCAAAAGAATTAC	25	1	yes
GATCAAGCTGGAGGTGCCAG	12	8	yes
GATCCCGCACATCCACAAGT	101	26	yes
GATCCCGAGATTGCCAGCCT	748	18	yes
GATCCACAAACTTCCTGACA	18	3	yes
GATCCCGACACCAAGGAGAT	3152	292	yes
GATCCCGAAAACCAGAACTT	13	4	yes
GATCCCCTTTTTGAACAGGT	56	4	yes
GATCCCCTTTCCTGTGAATG	11	3	yes
GATCCCCTTTACCTTCTGGG	1458	116	yes
GATCCCCTTGGTTGCTGGAT	107	8	yes
GATCCCCTTCTCAGGGTCTA	17	1	yes
GATCCCCTGTATATGTTGAA	9	4	yes
GATCCCCTGGGTTGAGAGAT	25	4	yes
GATCCCCTGGGGCAAGCTGC	206	22	yes
GATCCCCTGGGAGGAGACAG	1100	128	yes
GATCCCCTGGATACATGGTC	35	30	yes
GATCCCCTGCTACACTGATG	19	7	yes
GATCCCCTGCCTCAGCTCCT	133	6	yes
GATCCCCTGCAACAGACATT	4	2	yes
GATCCCCTCTGGGCCTCCGA	12	1	yes
GATCCCCTCTCCTGCCCACA	21	18	yes
GATCCCCTCGGACCCCCTTG	3000	262	yes
GATCCCCTCCTTTCTGCCTG	19	4	yes
GATCCCCTCCTCCAGGCAGT	260	28	yes
GATCCCCTCCCTTGCTTTCT	77	8	yes
GATCCCCTCCCTCTGATTTT	9	1	yes
GATCCCCTCCCACAGAATAG	5443	372	yes
GATCCCCTCACATGTGCTAT	24	4	yes
GATCCCCTATGGGGAGGAGG	76	16	yes
GATCCCCGTGTGTTTGCAGG	52	19	yes
GATCCCCGTGCCCCTGCCTA	465	62	yes
GATCTTCACTGCAGATGTGG	68	2	yes
GATCAAACTGAATGAAACAC	10	12	yes
GATCCCCGTCTGTGTCTGTG	86	12	yes
GATCCCCGGTGCTCTTCGTG	731	76	yes
GATCCCCGGGAAAGTGTAGT	2	3	yes
GATCCCCGCAGAATCAGGAA	10	3	yes
GATCCCCGCAAAGTGAGCGA	4	5	yes
GATCCCCCTTTGCTGCCTCC	3	4	yes
GATCCCCCTCCCTGCTCTCA	41	3	yes
GATCCCCCTCCCCCCAGTGG	108	32	yes
GATCCCCCCCTTTTTTTGTC	12	3	yes
GATCCCCCCCAGCACACTCT	54	1	yes
GATCCCCCCACCCCACCACC	1231	101	yes
GATCCCCCCAACTGTGTGCC	25	8	yes
GATCCCCCAGGTCTCAGAGG	311	50	yes
GATCCCCCAGGGAAAGACTT	29	25	yes
GATCCCCCACCCCCACCCCC	12	4	yes
GATCCCCCACATCCTGGGGC	14	5	yes
GATCCCCATTTGCAGTAAGA	80	17	yes
GATCAGAGCGCAAGGACACC	8	7	yes
GATCCCCATGTTGAGCTCTG	193	47	yes
GATCCCCATCTGCAGTACAA	1	1	yes
GATCCCCATCTGACTCAGTA	11	2	yes
GATCCCCAGTCTTTAGTCCC	112	6	yes
GATCCCCAGTATGCAGTAAT	3	3	yes
GATCCCCAGGGGCTCCCGGT	10	2	yes
GATCCCCAGGGAGGGAATGT	26	0	yes
GATCCCCAGCTGGTAGAAAT	6	2	yes
GATCCCCAGCTCCTTTCAAA	36	5	yes
GATCCCCAGCCTTGGATAGT	115	8	yes
GATCCCCAGCATTAGGCCAT	2	2	yes
GATCCCCAGCAGTAACACTT	24	7	yes
GATCCCCAGAGTCCCCTGTG	349	28	yes
GATCCCCAGAGCCTTGGGGA	9	6	yes
GATCCCCAGAATCCCCAATA	57	5	yes
GATCCCCACTGTGCCTTTTT	708	89	yes
GATCCCCACCAGCCACCCCC	332	47	yes
GATCCCCACAGCTGCGTATG	424	31	yes
GATCCCCAAGTCTGTGACAC	179	23	yes
GATCCCCAACTCCTGCCCAG	6	7	yes
GATCCCCAACAATGTGAAGA	579	84	yes
GATCCCCAAAGCCTGGAGCC	227	21	yes
GATCCAGTCCAAGCTGGGTC	17	1	yes
GATCCCATTTTTGACAGCAA	65	10	yes
GATCCCATTTCAGAGTATGC	1	1	yes
GATCCCATGTGTCTTTTTGC	77	2	yes
GATCCCATGTGTCTCCCCCA	15	5	yes
GATCCCATGTGCCACCATCA	64	1	yes
GATCCCATGTCCTGCTTTCT	9	6	yes
GATCCCATGTCCTGCTAAAA	24	0	yes
GATCCCATGTCCTCTTCTGG	18	15	yes
GATCCCATGCTAGCCTCTTG	382	15	yes
GATCCCATGCCTGGAATTTG	36	5	yes
GATCCCATGCAGAGCGGCCT	159	22	yes
GATCCCATGAATCATTTGCC	25	1	yes
GATCCCATGAAATCCCCAAA	5	8	yes
GATCCCATCTTCAGAGCTTA	3	1	yes
GATCCCATATCCCTGTGAAA	105	19	yes
GATCCCATACAATGCCGCCC	85	54	yes
GATCCCAGTTTGCTTCATGA	34	16	yes
GATCAAGGCCACGGGGAGGA	103	18	yes
GATCCCAGTGTTGCTACGTG	4	1	yes
GATCCCAGTGGTATTCCGCC	2	2	yes
GATCCCAGTGGATGAAGTGT	6	0	yes
GATCCCAGTGCTGTGGAAGT	6	5	yes
GATCCCAGTGCTGGTCAGTT	110	9	yes
GATCCCAGTGAGATGCTGGT	46	7	yes
GATCCCAGTGAAGGGTTTCT	123	20	yes
GATCCCAGTCTGAGTGATTA	2	3	yes
GATCCCAGTCCTCCTGGGCA	51	6	yes
GATCCCAGGTGTCCCCATTT	35	1	yes
GATCCCAGGTGGAGCAACCC	748	43	yes
GATCCCAGGTCCCTCTGGGA	206	25	yes
GATCCCAGGGGTCCTAGGGG	63	2	yes
GATCCCAGGGGCTCTTCTGC	49	13	yes
GATCCCAGGGAAAGTGCTAT	131	0	yes
GATCCCAGGCTCCACCAGCG	19	0	yes
GATCCCAGGCTAGCAAGCAA	193	13	yes
GATCCCAGGCGTCAAGCTCG	73	12	yes
GATCCCAGGCAAGGGATGGT	50	4	yes
GATCCCAGGAGTCAAGCTCT	42	4	yes
GATCCCAGGAGAGAGGCTTC	181	37	yes
GATCCCAGGAAAGTTCTAAT	31	1	yes
GATCCCAGCTATGATGTAGC	137	23	yes
GATCCTCAACCTGGACCCAG	8	4	yes
GATCCTAGAAGGACAGCTTT	9	6	yes
GATCTCTGTCTTTCCCTGGT	20	17	yes
GATCTCTGTCACATCCGATG	65	77	yes
GATCTCTGGTTGCTTTCAAG	28	24	yes
GATCTCTGGGCAGTCATGGT	29	3	yes
GATCTCTGGCCTGTGGAGTA	176	32	yes
GATCTCTGGCCAGGCAAGTT	128	6	yes
GATCTCTGGAAGGTGAGCCT	75	89	yes
GATCTCTGGAAAATTGCCAT	63	16	yes
GATCTCTGCTGTGGGAAAGG	139	5	yes
GATCTCTGCTGTCGGTTTCT	20	1	yes
GATCTCTGCCCCAAATCCAA	55	0	yes
GATCTCTGCCCAAACCAGGC	720	21	yes
GATCTCTGCCACCCACCCAC	87	75	yes
GATCTGGGCGTGGTGGCACA	8	7	yes
GATCTCTGCAGCTGGAGTCT	6	5	yes
GATCACGTTCTCCAGGAACA	32	6	yes
GATCTCTGCAAGCAGTTGTC	13	15	yes
GATCTCTGCAAAATAGACTT	1	1	yes
GATCTCTCTTGTTGGAAGGA	36	31	yes
GATCTCTCTTCCCAGAGGAA	1834	51	yes
GATCTCTCTGCTCATACCCT	396	2	yes
GATCTCTCGAGCAGCAGCAG	51	53	yes
GATCTCTCCCGTTCTCAGCA	11	9	yes
GATCTCTCCCCAGAGCAACG	114	39	yes
GATCTCTCCATATCAAGCGA	736	39	yes
GATCTCTCCAAGCTCACAAG	7	6	yes
GATCTCTCAGTTGAATACAT	26	17	yes
GATCTCTCAGGCCAGGATTT	6	7	yes
GATCTCTCAAATCTTGGATT	15	10	yes
GATCTCTAGCTGCTGTGTAT	17	14	yes
GATCTCTACTTTGGAGTCCT	6	5	yes
GATCTCTACTGGCAGGCCAT	173	8	yes
GATCTCTACTCCCAGGAGAT	157	19	yes
GATCTCTACCCAACTGTCCA	2	2	yes
GATCTCTACAGACAAAATCT	66	2	yes
GATCTCTAAACTGTGACACA	8	7	yes
GATCTCGTGCAACTGTTGTC	181	30	yes
GATCTCCTTTCTGTAATTCA	2	2	yes
GATCTCCTTTCCGGAAGCAA	50	7	yes
GATCTCCTTGGGGAGGTGGG	31	27	yes
GATCTCCTTGGAGTCTCAAG	1460	1027	yes
GATCTCCTGGAAGCTAGCAG	36	31	yes
GATCTCCTCGCTGGAAAAAG	72	10	yes
GATCTCCTCCTTGCTTTCCT	7	6	yes
GATCTCCTCCTTATTCCCCA	96	1	yes
GATCTCCTCAGAGAAGTCTG	63	3	yes
GATCTCCGTCCCTCAGCTCC	256	34	yes
GATCGCAGAGAGGCGAGAGC	42	30	yes
GATCTCCCTTTCCTGTAGAG	76	7	yes
GATCTCCCTCTTGGAGGCCA	41	3	yes
GATCTCCCTCTGAACACCTG	75	10	yes
GATCTCCCCTTTGTAGGACT	4	4	yes
GATCTCCCCTGGACCAAAGG	50	43	yes
GATCCTTTCAACTCAAAAGC	15	11	yes
GATCTTATCTTGCCAGGCCG	55	2	yes
GATCTTAGTAATGGATGGTG	39	29	yes
GATCCCTCTGTGCTCTACAT	3	4	yes
GATCGCATACATCATGACTG	3	4	yes
GATCTTAGAGAAAGGCCAAC	7	8	yes
GATCGCAGCACTGAAAACAA	14	1	yes
GATCTCCATCGTGCAGGGAT	127	29	yes
GATCTCCAGCTTCTCTGCCT	1240	37	yes
GATCTCCAGAGTCGCTTGGA	12	1	yes
GATCTCCACTTTCTACAACA	29	3	yes
GATCTCCACTCTCCCTCTGG	28	3	yes
GATCTCCACATCCTAACCCT	7	6	yes
GATCTCCACAGGCCAGCCTT	95	16	yes
GATCTCCACACAACAGGTGA	103	7	yes
GATCTCCAATGTTGTGCTAA	17	5	yes
GATCACAGCCAGTTCAAAGC	177	10	yes
GATCACAGCAGTAAATGTGA	44	3	yes
GATCACAGCAGCTGAGCTGT	106	11	yes
GATCACAGATTTAAGGGGAG	51	4	yes
GATCACAGAGGGACACACTA	34	28	yes
GATCACAGACTTCGGCCTTG	35	10	yes
GATCACAGACTGTTGGCCCC	77	14	yes
GATCACAGACACCTGCACTG	20	10	yes
GATCACAGAAGTGAGCGGAT	118	15	yes
GATCCTTCTCAGAAGAGTCT	1	1	yes
GATCACACTTCCCACAACCC	84	14	yes
GATCACAGGGAGCCTGTGTT	12	8	yes
GATCACAGCAGAGATGGCCA	54	8	yes
GATCTCATTCCGGATGAAGC	2	2	yes
GATCTCATGTGTACCAGCCA	3	3	yes
GATCTCATGTCTCTGGAGGA	15	4	yes
GATCTCATCCATTGAATTTG	74	9	yes
GATCTCATCCAGTCTGCTGT	2	3	yes
GATCTCATCACAGGAGCATC	23	4	yes
GATCTCAGTTTTCATCAAGT	33	6	yes
GATCTCAGTTCTGTGTTTAC	3	3	yes
GATCTCAGTTCACGGGGTGG	380	42	yes
GATCTCAGTTCAACAGCTCC	83	3	yes
GATCTCAGTGGGGGTGGGAG	117	33	yes
GATCTCAGTGCTGGGGAGGT	99	22	yes
GATCACACTGAGCAACACCC	24	7	yes
GATCACACGGCAAAACAGTA	101	33	yes
GATCACACCTGTCCCTACAC	767	29	yes
GATCACACCTGCAGTTTGGG	2	0	yes
GATCACACCGTTTCTTCCTA	25	3	yes
GATCACACCGAGACCAGTGG	129	14	yes
GATCACACCAGTCCTGTGAG	2	0	yes
GATCACACCACCGTGTCAAA	30	1	yes
GATCACACCAAGCCCCAGGA	35	5	yes
GATCACACATTTGCAAGGGA	71	16	yes
GATCACACACTCAGTCCTTG	35	23	yes
GATCACACACGGCAACCGAC	27	19	yes
GATCACACAAGTGTGGGTTT	29	3	yes
GATCACACAAAACTGTCAGC	58	13	yes
GATCACAATCAGGAACTCAC	26	5	yes
GATCACAATACAACTTTATG	1	1	yes
GATCACAAGTTTGCATTCAG	3	3	yes
GATCACAAGTTTGAGACCAG	99	26	yes
GATCACAAGTTGTTTCCTGT	2	2	yes
GATCACAAGTGCAGCATTCT	26	23	yes
GATCCTTCATGTTGAGCCAG	52	8	yes
GATCACAAGCTTGGGGCAAC	42	2	yes
GATCACAAGAGTTACTAGTT	3	3	yes
GATCCTTGGGGTCTTAGGCA	8	2	yes
GATCTGTTGTTTGCGTTGAA	8	7	yes
GATCCTTCTGTCCTGGATTT	4	4	yes
GATCTGTTACTTTGGCGAGG	182	132	yes
GATCCACGTGCCATCTTGCT	100	18	yes
GATCCCCTGGGAGTGGGAGG	4	1	yes
GATCCCAGACAGATGGGGTT	1	1	yes
GATCCTTCCTTTCCCTTGGC	65	1	yes
GATCCTTCCTTCTTCTCTTC	103	27	yes
GATCTCAGTAACTGTCGAGC	92	69	yes
GATCTCAGGGTTCCCATGGT	12	10	yes
GATCTCAGCTTGCATAGCAT	274	3	yes
GATCTCAGCTCCACTGTGAA	9	11	yes
GATCTCAGCTAAACTTTCAA	2	3	yes
GATCTCAGCCCCTACTCCCA	30	1	yes
GATCTCAGCCATAGTCGTTG	9	8	yes
GATCTCAGCACTTGGGAGGT	23	20	yes
GATCTCAGCACTGTGGCTGT	276	14	yes
GATCTCACTGTTTCATGCTG	17	14	yes
GATCTCACTGCCTCCCTCTC	15	10	yes
GATCTCACTCAGCAACAAGT	26	19	yes
GATCACAAGAGGCCCGTTTG	17	14	yes
GATCGGGGGGATGACCAGCT	96	1	yes
GATCACAACTTCTGAAACAC	13	4	yes
GATCACAACTGTAGGGAATA	150	12	yes
GATCACAACTGATTCCTGCT	46	10	yes
GATCACAACGGCTTGCGTGT	6	7	yes
GATCACAACCCTGATGGCAG	195	52	yes
GATCACAACCCCCAAGTCAG	133	20	yes
GATCACAAATACAGATTCTG	20	24	yes
GATCACAAAGTTTGAGAATG	236	17	yes
GATCACAAAGGTGGAATGTT	104	15	yes
GATCACAAACTTCTGCAAAA	40	0	yes
GATCACAAACATCACAGAAG	8	2	yes
GATCACAAAATGAGTCACTC	20	6	yes
GATCACAAAAGGCTGTTTTG	52	17	yes
GATCAATGGCTTTGATGCAG	15	4	yes
GATCTGTGTATACCCCACTC	39	45	yes
GATCTGTGGACGACGAGAAC	18	21	yes
GATCTGTGGACCCCCTGACA	6	5	yes
GATCTGTGCCATCCCATACA	131	7	yes
GATCTCACCGTGAGGCCCCG	54	1	yes
GATCTCAACTGACTCCTCTT	258	2	yes
GATCTCAAACTCAGAGGTTT	138	59	yes
GATCAATGCAATGACGTGGG	112	14	yes
GATCAATGATGAGGACAAAC	221	164	yes
GATCAATGACAACCAGAAAG	16	19	yes
GATCCTGGTAGGAGCACTTG	27	18	yes
GATCCTGGGTACTGCACAGT	3064	338	yes
GATCAATCGCCTTGCCTTGT	379	256	yes
GATCCTGGGGGTGGACTGCA	15	13	yes
GATCCTGTCAGTGTTGGCCA	12	1	yes
GATCCTGGTGAAACACATGG	28	1	yes
GATCCTGGGAAGCCTCCTCA	45	7	yes
GATCAATAGCTTGAGTCACT	7	6	yes
GATCAATAAAGTGGGTTTTT	87	2	yes
GATCAAGTTTTGGCTCTTGG	23	11	yes
GATCAAGTTTGTGGTGTGTT	12	11	yes
GATCAAGTTTGGTGTTTCCT	32	27	yes
GATCAAGTTTCAGGAAGGCT	25	3	yes
GATCCTGCAGCAGGAGTGCA	2	2	yes
GATCTGTCCTGATGAAGGCT	66	57	yes
GATCCTGATTTAGGAAGTGT	5	8	yes
GATCTGTCCATCTTGGAGTT	13	0	yes
GATCCTGCTCAGACCATACC	6	2	yes
GATCCTGCCAGCCAGACCAA	8	2	yes
GATCTGTAGCAACCTGACAG	34	29	yes
GATCAAGTTGAAAGAGTGTG	75	12	yes
GATCAAGTGTCGGATGGAAT	800	60	yes
GATCAAGTGGATTCGGCGGT	29	18	yes
GATCAAGTCTTGTCAGTTTG	3	3	yes
GATCCTGAGTGGCTTGCTAG	9	6	yes
GATCAAGTCGTGCTTCTGGC	3714	425	yes
GATCAAGTCCTTTGTGAAAG	494	56	yes
GATCCTGAGAGCATCTTCGA	8	10	yes
GATCAAGGTCCAGGTGGAAG	35	4	yes
GATCCTGAATGGGCAAGAGT	123	3	yes
GATCCTGACTCCTTGAAGCC	34	4	yes
GATCTGGTCACTGGTCAGAG	17	14	yes
GATCTGGGTTGTGAGGAGGT	36	6	yes
GATCAAGGTCCACTTAGTGG	21	18	yes
GATCAAGGGGTTCTCGCGCT	29	25	yes
GATCAAGGCTCCCGGTTTTG	272	5	yes
GATCAAGGCCTTTCTGTCCT	467	24	yes
GATCAAGGCCTTTCTGCCCT	17	2	yes
GATCAAGGCCCACTGTGGAG	44	2	yes
GATCAAGGCACTGCCCTGAA	2	2	yes
GATCAAGGAAAACCATTCAT	1	1	yes
GATCAAGCTTAGCAGTCAAG	3	3	yes
GATCAAGCGGGCTTTCCTTA	500	113	yes
GATCAAGCCTGTTAGCCCTG	17	2	yes
GATCCTGAACTCCCCAGAGA	6	5	yes
GATCTGGGGCTTTTTGTGTG	22	1	yes
GATCCCTTTGGTGCCCCTGA	448	5	yes
GATCTGGGCTGAGCTTGGTT	25	3	yes
GATCTGGGCACCGAGGCTGG	86	74	yes
GATCCTCTGCCTTTACCTCC	22	19	yes
GATCGGCGATGTGATGTGCA	24	4	yes
GATCAAGCCCTTCTTCCATT	186	1	yes
GATCAAGCCATCCATCAACT	302	10	yes
GATCAAGCAGCGAGAGGCTG	275	21	yes
GATCAAGCAGAACCTGGAGA	111	24	yes
GATCCTCCTCACTTAGCACC	25	21	yes
GATCAAGACTGTGACTTTTG	10	2	yes
GATCAAGACTCTCCTGGAGA	91	6	yes
GATCAAGACCTGGGAAAAAT	2	3	yes
GATCAAGACCCTCCAGAGGT	22	1	yes
GATCAAGACCACCACTGCAT	197	34	yes
GATCAAGACAGCTTGTTGGT	105	9	yes
GATCCTCCCAAAAGCCATCT	31	6	yes
GATCAAGACAACCAAGGCTA	5	5	yes
GATCAAGAATTCAGGGTCAT	2	2	yes
GATCCTCACTGGCAGCAGCT	190	29	yes
GATCCTCACCCACCTGCTGG	86	3	yes
GATCTGGGAAGACTTCTCTA	4	4	yes
GATCTGGCTTTTGTTTTCCA	62	19	yes
GATCTGGCCTGAGCCTGTCC	4	4	yes
GATCTGGCCCTTTTGTCCTT	10	3	yes
GATCAACTTTCAGCTGGGAA	48	8	yes
GATCAACTTGCTGGGACCTA	235	46	yes
GATCAACTGTGCAGACAACA	2369	523	yes
GATCAACTCTTGGCTTTGAC	17	14	yes
GATCAACTACCTGCAGGAAG	57	2	yes
GATCTGGCCCAGGAGATGGA	2	2	yes
GATCTGGCCAGGGTGCCTTT	15	4	yes
GATCTGGCCAACACAAGAAC	8	0	yes
GATCTGGCAGATGTGAGGTT	76	3	yes
GATCAGCCAGGGCCTGTGCC	7	8	yes
GATCTTCACTCTCTGACTCA	1	1	yes
GATCAACGCGATTTAGCTGA	2	2	yes
GATCAACCTGAGAGGGAGAT	39	10	yes
GATCAACCTCGTCGACTGGG	3	3	yes
GATCAACCGACAGCTGGAGG	36	11	yes
GATCAACCCACAGGAGTACC	7	6	yes
GATCAACCACTGCAAATTCG	10	9	yes
GATCAACCACTGACCTGCCT	69	1	yes
GATCAACAGCTGCCCTGCCT	37	9	yes
GATCAACAGCTACAGAAAAT	30	26	yes
GATCAACACTTACGTTAGGA	15	13	yes
GATCAAGCCTGGAGAGGTGG	6	5	yes
GATCCACGCGGTAAGAGAGA	7	6	yes
GATCCTTTCAATGTACGCTC	12	14	yes
GATCACAGAGTTGGGAAGAT	87	75	yes
GATCCAGGCTCCTGGCCCAC	31	21	yes
GATCCAGGCTCCCCTTGTCT	3	2	yes
GATCCAGGCTATCTCCTCTG	13	0	yes
GATCAGTCCTTCCCTCGAGA	49	1	yes
GATCCAGGAGGCTCTGCACG	12	10	yes
GATCAGTTTCAAGAAGCGTG	44	2	yes
GATCCCAGCATTTCTCAATT	33	10	yes
GATCCCAGCATCGGCAAGCG	89	9	yes
GATCCCAGCAGCTGTTACCT	127	4	yes
GATCCCAGCACTGCAAAAGA	54	1	yes
GATCCCAGCACACACCGTGA	106	13	yes
GATCCCAGATGGACATGGCA	6	5	yes
GATCCCAGATGATACCCACT	6	5	yes
GATCCCAGAGGAAAGGGTTT	117	33	yes
GATCCCAGACGCCTCAAATG	2	0	yes
GATCCCAGAAGCACACTGGC	13	9	yes
GATCCCAGAACCATTGCCTG	215	26	yes
GATCCCACTTCACCTGTTAT	62	8	yes
GATCCCACTGTTGATAAGGA	58	11	yes
GATCCCACTGCTCATTTGAC	8	6	yes
GATCCCACTAACCTGCAGTG	2	2	yes
GATCCCACGGTAGAACCTGA	249	38	yes
GATCCCACGAGCCAGAGAAC	122	5	yes
GATCCTAGCGGACCTCAACC	9	7	yes
GATCTGTCTGTAGCGGTCAA	2	3	yes
GATCTGTCTCTTTCACGGAA	7	6	yes
GATCTGTCCAGGGGACATTA	2	2	yes
GATCCCACCTCACGTGTGAT	56	26	yes
GATCCCACCGCAGCTACCAG	53	0	yes
GATCCCACCCCAGTAGGAAG	19	16	yes
GATCCCACCATTCTCCTTGG	45	15	yes
GATCCCACCATCCTACCTAC	20	6	yes
GATCCCACATTTCCCTTGCC	19	14	yes
GATCCCACAGTGTGACTGAT	18	4	yes
GATCCCACAGGCCGGTGGAG	1	1	yes
GATCCCACAGCCAGGCTCAC	21	7	yes
GATCAGGTCCTAAACATGGC	99	4	yes
GATCCAGCAGCCGAGACTGA	49	8	yes
GATCCCAATTGGTGGAAAGG	11	2	yes
GATCCCAATTCTGTCCCAAT	82	9	yes
GATCCCAATGGTCACACACC	71	10	yes
GATCCCAATGCTGCCCCATC	48	10	yes
GATCCCAATGAGCCCACCTA	96	3	yes
GATCCCAATAAACCCATGAG	42	0	yes
GATCCCAAGTTCAAAGCCAG	28	15	yes
GATCCCAAGTGCTGGGAAAG	9	1	yes
GATCCCAAGCCTCACCGGCT	8	5	yes
GATCCCAAGCCAAGAAACAC	35	8	yes
GATCCCAAGAGAAAGGAGTG	5	7	yes
GATCCCAAGAAAGGATGGAA	2	2	yes
GATCCCAACTGTCAGTGCCA	72	4	yes
GATCCCAACGTGACCATCAT	14	3	yes
GATCCCAACATTTGAGAGGC	51	6	yes
GATCCCAACATTGTTGGCAA	21	5	yes
GATCCCAACACAGCGATATG	235	29	yes
GATCCCAAATTGGGTTGTCA	57	16	yes
GATCCCAAATCTGTGGTGTG	35	8	yes
GATCCCAAAGCACAATGGTG	6	4	yes
GATCAGGGGCCAAGGTCCTT	41	8	yes
GATCTCATCCAAGCAAATGG	8	0	yes
GATCAGGGCTCCAGTGGTCC	72	23	yes
GATCCCAAACTGAGGCAGCA	82	11	yes
GATCCCAAACAACTAAGAAT	130	20	yes
GATCCCAAAATGCTGCGGAG	169	16	yes
GATCCCAAAATAGGTGTTGA	63	9	yes
GATCCCAAAAGGGACATTGT	35	1	yes
GATCCCAAAAACCGTGCAGC	67	12	yes
GATCCATTTTTCTGTGACAT	2	3	yes
GATCCATTTGCTTACACTGT	61	9	yes
GATCCATTTGATGCTTCCAG	4	5	yes
GATCCATTTCTTCTGCATGA	79	0	yes
GATCCATTGAGACGTATGAA	13	2	yes
GATCCATCTTCAGCTGACTG	76	7	yes
GATCCATCTTCAAACCTCAA	7	1	yes
GATCCATCTCTTTCCTTCTG	47	2	yes
GATCCATCTCCTCTGGCTCT	202	26	yes
GATCTGGTGTGTCTGAAGAC	10	9	yes
GATCAGGCCGGGGCGGCAGG	138	28	yes
GATCCATCCTTACTTGGTTT	91	26	yes
GATCCATCCTATCCATCCGT	4	4	yes
GATCCATCCCCGGCAAAGAG	62	6	yes
GATCCATCCCAGAGGGACTG	89	20	yes
GATCCATCCAGCAAAGAGGA	64	8	yes
GATCCATCCACCAGCAGGAG	25	6	yes
GATCCATCCAATGGCTTACC	184	27	yes
GATCCATCAGGGCTGAGCCT	9	6	yes
GATCCATCACAGGACTATGT	12	14	yes
GATCCATCACAAGGCAAAAC	26	4	yes
GATCCATAGCACAAAGCCAC	11	9	yes
GATCAGGAGCAGGCAACACC	2	4	yes
GATCCACTCACAGCACCTCC	19	2	yes
GATCCATACCCACCACTGTG	8	5	yes
GATCCATACAGCATTTTGCG	4	4	yes
GATCCATACAATTTGTGCCA	315	12	yes
GATCCATAAGTTTGCCCAGT	121	18	yes
GATCCAGTTTTGGGAAAGGA	139	23	yes
GATCCAGTTTCTGACTCGGG	35	15	yes
GATCCAGTTGTGCAGTAGAG	1	1	yes
GATCCAGTTGGAGAGATTTG	42	7	yes
GATCCAGTTCTGCTCAACTA	78	17	yes
GATCCAGTTCTACGAGCGGC	52	14	yes
GATCCAGTTCTAAAACTTGT	292	31	yes
GATCCAGTTACCAGAAGATG	52	3	yes
GATCCAGTGTGTTGCTGGCA	163	2	yes
GATCCAGTGTGCTGGTCTTT	14	17	yes
GATCCAGTGGCAGCCTCAGC	57	3	yes
GATCCAGTGCTGGGGAGATG	94	8	yes
GATCCAGTGCCTCATTGTTG	12	1	yes
GATCAGGACCCTTAGGAAAT	13	11	yes
GATCCAGTGAGAGCCAGACA	7	3	yes
GATCCAGTCTGTCCTAGATG	107	19	yes
GATCCAGTCCTGGAGGACAG	925	174	yes
GATCCAGTCCATTCAGCAGT	18	1	yes
GATCCAGTCAGCCCCTGGGG	149	44	yes
GATCCAGTACTACCAGAATG	14	1	yes
GATCCAGGTTCAGTAAATTA	19	7	yes
GATCCAGGTTCACCACCGGG	28	1	yes
GATCCAGGTTCAATTTCCAG	12	3	yes
GATCCAGGTGTGCTGAGTGG	131	21	yes
GATCCAGGTCCGTGAACCCC	55	7	yes
GATCCAGGGTGTGCAGTGGG	192	12	yes
GATCCAGGGTGCCCCTCCAA	71	5	yes
GATCCAGGGTCCTCTGCCTG	104	17	yes
GATCCAGGGCTCAGGAGCAC	23	0	yes
GATCCAGGGCGATGTTGGGG	14	6	yes
GATCCAGGGCCTGTGAATCA	10	2	yes
GATCCAGGGCCTGGTGGAGG	218	52	yes
GATCCAGGGCCTCTGCGCCT	8	7	yes
GATCCAGGGCCACTTTGTCT	50	5	yes
GATCCACCACAGCAGGCAGG	3	4	yes
GATCAGCCGGGGCTTTGAGG	148	47	yes
GATCCAGGCTGAGGACATCA	8	6	yes
GATCCAGGCTCTGATGTTTC	157	17	yes
GATCCAGGCTCGGGAGCTAA	2	0	yes
GATCCAGGCTCACAGTGTGA	20	1	yes
GATCCAGGCTAAAATCCCCG	26	11	yes
GATCCAGGCGGCCCTGCCAG	130	18	yes
GATCCAGGCGGCCAAGAACT	11	13	yes
GATCCAGGCCTCCCTTCTTG	170	24	yes
GATCCAGGCCTACTTCGCGT	56	1	yes
GATCCAGGCAGCTGTGTACA	3	4	yes
GATCCAGGCAGAGCTCTTCA	1	1	yes
GATCCAGGAGTTCAAAGAGG	578	45	yes
GATCCAGGAGGGGTTTGCTC	25	5	yes
GATCCAGGAGCAGGAGCTGC	6	7	yes
GATCCAGGAGCACGTGAAGA	1	1	yes
GATCCAGGACTTCTTCATCC	2	2	yes
GATCCAGGACCTGGAAGTAT	3	4	yes
GATCCAGGAACTACTCCACA	12	1	yes
GATCCAGGAAAGCAGCCTGT	58	9	yes
GATCCAGCTGGGCGAGGATG	101	24	yes
GATCCAGCTGGGCAAAATTC	182	2	yes
GATCCAGCTCCTAAACTGTT	43	4	yes
GATCCAGCGCTCTCGGGACT	86	10	yes
GATCCAGCGAGAAAGAAGAA	202	8	yes
GATCCAGCCTTAATAAAAGG	2	2	yes
GATCCAGCCTGACCTGCACA	104	6	yes
GATCCAGCCCATACAGAAGA	17	2	yes
GATCCAGCCATTTGTGGGTG	71	6	yes
GATCCAGCCAGTCTCTCATT	103	14	yes
GATCCAGCAGTTAAAGCAGT	87	4	yes
GATCCAGCAGCATCCTCTCT	3	3	yes
GATCCAGCAGAGAGGGCAGG	2	3	yes
GATCCAGCAGAGACTCCACA	1	1	yes
GATCCAGCACCGTGTGTACC	154	5	yes
GATCCAGCACATACAAGTCT	78	5	yes
GATCCAGCAAACTTGGTTGG	56	10	yes
GATCCAGCAAAACTACTGCT	28	8	yes
GATCCAGATTTCCAGCCGGA	3	3	yes
GATCCAGATGCCGGCTTTCA	8	7	yes
GATCCAGATGATGGTTCTTT	149	33	yes
GATCCAGAGTGGCACAGGGT	274	54	yes
GATCCAGAGTGGAACTGTCC	21	4	yes
GATCCAGAGTGACGTGCTCA	4	2	yes
GATCCAGAGGTGTTAGCTAC	54	1	yes
GATCCAGAGGTAACTGTGGA	48	3	yes
GATCAGCAGATGCAAAAGAT	4	4	yes
GATCCAATCCTCCTGCCTTC	1	1	yes
GATCACCATGGATAGAGCAA	40	34	yes
GATCCAGAGCTGGGCTCAGG	8	2	yes
GATCCAGAGCTGGAATAGCA	2	3	yes
GATCCAGAGAAAGCAAAGGC	29	25	yes
GATCCAGACTTGCCTTATAA	3	1	yes
GATCCAGACGAATCTTGTCA	7	1	yes
GATCCAGACCTCTTCATGTT	1	1	yes
GATCCAGACCCGGGAAGGGA	125	20	yes
GATCCAGAATTGCTTTCCCA	60	5	yes
GATCCAGAAGCAGTGGAATC	16096	1439	yes
GATCCAGAAGAACCTACCAC	1	1	yes
GATCCAGAACATTCTAGAAA	3	4	yes
GATCCAGAACAGTACAGCGT	208	0	yes
GATCCAGAACAGCGACGATG	4	5	yes
GATCCAGAACACATTAACCT	32	5	yes
GATCCAGAAAGAACGATTTG	67	8	yes
GATCCACTTTGTGATATTTG	56	4	yes
GATCCACTTGGGCTCTGTCA	85	2	yes
GATCCACTTGGAACTGGCCA	6	0	yes
GATCCTGAGAGTTAGTTCTG	15	0	yes
GATCGCCACCTACCGCAAGC	10	12	yes
GATCCCTGAACTTTCTAAGT	6	2	yes
GATCAAGTTTGCCGTCCATG	1	1	yes
GATCAAATTCCCACTGCCCG	224	318	yes
GATCCTGTGTGTGGGAGTGA	3167	3066	yes
GATCCCCACACGCCCGAAGC	1	1	yes
GATCCTCAACGAGGATGGCA	154	17	yes
GATCAACTTCACCTGCATCA	3	3	yes
GATCCTATGTTGCTGGAGCT	102	18	yes
GATCCTAGTGGGTCTACCAG	166	69	yes
GATCCTAGGTGTCTTCTGTT	12	9	yes
GATCCTACCGCCTTTAACAA	54	3	yes
GATCTGGAGCTCCTGGGATG	341	42	yes
GATCTGGAGCCTCCACGATG	154	10	yes
GATCTGGAGCCCACAGACCA	3	3	yes
GATCTGGACCTCACCTCTGA	91	79	yes
GATCTGGACAGCCTGCTCAG	50	5	yes
GATCCTATCAAAAACACAGA	3	3	yes
GATCTAAAACTCACTCCATG	5	6	yes
GATCAACAAATCTCCTAGGC	995	358	yes
GATCAAATTGGTACAGAAAT	12	14	yes
GATCAAATGTTCTCTTACAT	18	22	yes
GATCCGTGTCCCTGCGTGCA	378	21	yes
GATCTGGAAGAGACTTTGGC	500	424	yes
GATCTGGAACAGTTTTTGGC	3	4	yes
GATCTGGAAAGCTCTGGGGA	22	25	yes
GATCCGGGTGTTGTGCCTAA	52	3	yes
GATCTGGAAAACGCTGGAGA	22	26	yes
GATCAAGAATTTGGTGTGGA	242	11	yes
GATCTGCTTCCAGGTCCTCA	43	6	yes
GATCTGCTGTCCAGAGCAAG	131	6	yes
GATCTGCTGGAGGGACTTCA	60	1	yes
GATCTGCTGCTGGTGCTTGC	8	8	yes
GATCAAATCACTGGCAGACA	72	7	yes
GATCAAATATGTGGAGATTT	10	9	yes
GATCAAAGTTGTTTCACTGT	7	1	yes
GATCAAAGTGCCAACAGCGG	33	28	yes
GATCAAAGTCTCCATAGTTG	17	1	yes
GATCAAAGTACTTGTTAGGG	64	5	yes
GATCAAAGGGGGCAAAGTCT	15	13	yes
GATCAAAGGCTTCAATCACA	215	40	yes
GATCCGGCCCTACTGTGTGT	320	42	yes
GATCAAAGGAAAGGGGAGGG	97	65	yes
GATCAAAGCTGGCAAGGTTC	141	17	yes
GATCAAAGCTGGCAAGGTAC	152	109	yes
GATCAAAGCGGGAGAAGAAA	1	1	yes
GATCAAAGCCTACTTTTCTT	70	21	yes
GATCAAAGCCCGGAAAGGCA	3470	508	yes
GATCAAAGCCACGGGGTCAG	91	8	yes
GATCAAAGCCAAGTATCCTG	17	1	yes
GATCAAAGCCAAACCCTTTC	24	21	yes
GATCTGCTGCAGGACCTGGG	88	6	yes
GATCCGCGAATGCTCGGAGG	1063	118	yes
GATCTGCTCCCTGTATGTGC	2	2	yes
GATCCGCAGTGGCATGTTCT	89	22	yes
GATCCGCAGCGCCTCTTCTT	104	35	yes
GATCACTGGTCCCCTACCAG	26	0	yes
GATCTGCGTCTCAGCTCAGC	14	16	yes
GATCCTAACTTACTCCATTT	4	3	yes
GATCCGTTGCTGACCTTGCG	23	4	yes
GATCCAGCTGATGCATCGCG	30	6	yes
GATCAAACTTGGCAGTGGTG	26	2	yes
GATCAAACTGAGTCTGAAGG	39	45	yes
GATCCGCAAGTTTTCTATGA	23	12	yes
GATCAAACTAATCAGGCATC	6	5	yes
GATCAAACAGTAAAGGTGTG	98	19	yes
GATCAAACAGCAGCCAAGTG	5	6	yes
GATCCGAGAAAGAGAGAGGC	2	3	yes
GATCCGACTGCAAAATTCAT	25	4	yes
GATCAAAATGTGGTGCCAGA	93	4	yes
GATCTGCCTTAAGGACCTGG	2	2	yes
GATCCGTGGTATCAGTGGGA	8	4	yes
GATCAACTCAGATTTGGCTC	30	26	yes
GATCTGCCTCAGTCCACAAG	18	6	yes
GATCCGTACAGCGGCAAAAC	1	1	yes
GATCTGCCCCTGACCCTCCA	18	4	yes
GATCCAGAGGCTGGGCCTCT	88	24	yes
GATCAAAATGCTTGGAGAAA	43	2	yes
GATCAAAATGAGGCAGAGGA	18	22	yes
GATCAAAATCGCAGTTACTG	30	2	yes
GATCAAAATATGCTGCAGAC	33	28	yes
GATCAAAACTCAAGAAAAGG	21	0	yes
GATCAAAACACGATGTCCAA	1	1	yes
GATCAAAAACAAAAGCGAAA	274	24	yes
GATCCGGGGCCTCTGGAAAG	10	1	yes
GATCTGCCCACTGAGACTCC	6	5	yes
GATCTGCCCACCATATTCCT	52	36	yes
GATCACAAAACCATATGGAT	19	23	yes
GATCTGCCAGGAACATGAGA	15	4	yes
GATCTGCCAGCCGTACATCC	15	18	yes
GATCCCTGATTGCCTCCATG	196	24	yes
GATCCGGCTCCAGATTCAGG	8	0	yes
GATCTGCAGGTGCCTGGGAA	62	46	yes
GATCCAGAGCGAGCATCCAT	7	1	yes
GATCCAGCAGTGCAGGCAGG	15	5	yes
GATCCCTCTGCAAACCAAAC	144	42	yes
GATCTGCAGGAGGATGCCTG	85	13	yes
GATCTGCAGGAGCCGTTTGC	2	4	yes
GATCCGCTGGTGTGTGTGAA	7	8	yes
GATCCCTCAGTGTAGCATAG	5	5	yes
GATCTGCAAACGGGAAGGAG	4	5	yes
GATCTGATTTTGACCAAGAT	42	2	yes
GATCCCGTCAACTTCAAGCT	1284	184	yes
GATCCCGGGGGCTCCAGGAA	30	25	yes
GATCCGCAGACGTCACTCTG	116	21	yes
GATCCCGGGGCAGTCCAGCC	130	84	yes
GATCCGAGTTGGGGAGCCTG	28	9	yes
GATCAAATTCCCACTGCCCC	1232	355	yes
GATCCGAGGGCAGAGGAAAG	148	4	yes
GATCCTTTGGACCGGGGCTT	4	5	yes
GATCTGTGGATGAGACAGTT	5	6	yes
GATCCCCTTGGGATTAAAGG	31	17	yes
GATCCCCTGAGAAGCTGTAT	11	14	yes
GATCCCCTGACTCACATCCT	6	2	yes
GATCCCCGGCGTCTGTTTGA	3332	172	yes
GATCCCCCAGCCAGGCCAAA	29	7	yes
GATCTGAGCCCCCTGAGGTT	152	22	yes
GATCCCTGGAGCCACCAGCT	61	52	yes
GATCCCTGCTTTCATGGAAG	70	13	yes
GATCCTAACCGTGTTACAGA	1	1	yes
GATCCCTGATAATACCTTAG	7	6	yes
GATCCCTGAGAAGTTCCAGC	30	5	yes
GATCTGACTCCACTGCCCAG	10	9	yes
GATCTGACGCCGAGGAGGTA	26	9	yes
GATCCGCCCAGAAGCCTTCA	12	10	yes
GATCTGACCTGGGTCCTGAC	34	40	yes
GATCTGACCTCAGGTTCCCA	23	4	yes
GATCCCTATGGACACTGACA	164	24	yes
GATCCAAGGGAAACCACCGT	1	1	yes
GATCCACTTGAAACCGGGAG	46	8	yes
GATCCACTTCAGAAGCAGCC	90	13	yes
GATCCACTGTTGTCCAGAGG	46	10	yes
GATCCACTGTGTGTCTGGTA	100	20	yes
GATCCACTGTCTTCCTAGAG	60	21	yes
GATCCACTGGGCCAAGGAGC	46	5	yes
GATCCACTGGCTGGATATAG	3	3	yes
GATCCACTGCTGGAAGTACC	325	15	yes
GATCCACTCTTTTCATACCC	105	7	yes
GATCCACTCGGGGGCTGTGA	31	10	yes
GATCCACTCCTGCAGAGCAC	68	11	yes
GATCCACTCCAGGCTGCGAG	209	35	yes
GATCCACGTCTCGTCGTCAG	108	16	yes
GATCCACGGGCTGGAATCTG	80	1	yes
GATCCACGGACACCAAGTTA	35	4	yes
GATCCACGACTACTTGGACA	19	9	yes
GATCCCAGCTTCAGGACACC	3	3	yes
GATCCCAGCACCGTCTGTGG	12	3	yes
GATCAGAGCAATGCTGGAGC	11	13	yes
GATCCACCTGCTTCTCCCTT	67	3	yes
GATCCACCTGCTTCTACCTC	45	4	yes
GATCCACCTGCCTGTGCCTC	405	62	yes
GATCCACCTACTTTTTCAGC	21	0	yes
GATCCACCCTGAAAGTGTCT	1	1	yes
GATCCACCCCTATCTGAGAA	3	4	yes
GATCCACCCACCCTGGGCAT	22	1	yes
GATCCACCATCTGTAATGTC	32	2	yes
GATCCACCAGTGCTTCTGCT	35	4	yes
GATCCACCAGTCCTTGAAGC	208	2	yes
GATCCACCAGGATGTTTGAT	9	1	yes
GATCCACCACATGTGCCAAA	21	2	yes
GATCCACCAAGTCCTGGCCC	4	4	yes
GATCCACATTTGCTGGTTTG	45	10	yes
GATCCACATTACCATCAAGC	80	10	yes
GATCCACATGTGCTCGCAAA	165	4	yes
GATCCACATGTACCATCAAC	82	18	yes
GATCCACATGCGTGTAGCAG	217	17	yes
GATCCACATGAGGAGATACT	14	1	yes
GATCCACATCTCCCTCCCCT	22	8	yes
GATCAGACCGACGTATGCAG	18	21	yes
GATCTGCCTTGTGAAGTTGG	20	1	yes
GATCCACAGGGTACCTCCCT	55	16	yes
GATCCACAGGCAGTTGTGCC	26	23	yes
GATCCACAGGAGGGTTCCAA	79	9	yes
GATCCACAGATTCTGCCTGT	946	140	yes
GATCCACAGAAGCACTGCAG	8	2	yes
GATCCACACTTCTGAAGACT	3	2	yes
GATCCACACTGCCACTAAAA	2	2	yes
GATCCACACGGAAGGGGAAA	1	1	yes
GATCCACACCTGAAATGCTA	155	16	yes
GATCCACACCCTAACTCCCA	132	20	yes
GATCCACACACGACTCTCCA	40	0	yes
GATCCACAAGTCTTAGCTGT	12	3	yes
GATCCACAAGCGACTCATTG	1993	273	yes
GATCCACAACCTGATTCCCG	40	7	yes
GATCCAATTGTGGTGTTCTG	7	8	yes
GATCCAATGGTTTTGCCTCA	2	2	yes
GATCCAGAGGCAGGTGCAGA	34	9	yes
GATCCAATGCCATCTTCTGG	36	2	yes
GATCCAATCTTTGTCTTAGG	31	5	yes
GATCCAATCGACTGGGTTTC	183	53	yes
GATCCAATCCCTGTGCAGCA	106	13	yes
GATCCAAGTTTGGATAATGA	15	5	yes
GATCCAAGTTGTACATGAAT	2	0	yes
GATCCAAGTGTTTAACCATA	80	1	yes
GATCCAAGTGAGTCTATGAA	77	22	yes
GATCCAAGTCCAGGAACCCT	1271	42	yes
GATCCAAGTCATGATTTGAA	8	7	yes
GATCCAAGTCACCCCCCGAA	34	18	yes
GATCCAAGTATTGGCACCCA	2	3	yes
GATCCAAGTACACCTAAGGG	76	9	yes
GATCCAAGGTCAAGGCAGAG	160	23	yes
GATCCAAGGCCTCAGGTCAC	280	4	yes
GATCCAAGCTCATCATTTGC	20	1	yes
GATCTGCCAAACGCTATGGC	2	3	yes
GATCCAAGCGTGAGCCAGTC	21	4	yes
GATCCAAGCGGACAGAGTGA	3	4	yes
GATCCAAGCAGGCTTGAATA	21	5	yes
GATCCAAGCAGGCCCCTTAT	97	0	yes
GATCCAAGAGGAGGAGCACA	29	14	yes
GATCCAAGAGCCCACACAAG	20	3	yes
GATCCAAGACCAGGGTGGCT	182	9	yes
GATCCAAGAAGTCAGTCGGC	15	13	yes
GATCCAAGAAAGGAAGAAGA	22	1	yes
GATCCAACGTGTTAGCCTTG	47	11	yes
GATCCAACGTGGTCTTTAAG	212	38	yes
GATCCAACGAGTAGGAGTGT	4	3	yes
GATCCAACGAAAAACACTTG	37	6	yes
GATCCAACCAACCTGAAGAA	53	7	yes
GATCCAACATTGACTTTCTT	20	6	yes
GATCCAACATGGAAGGTGTA	97	14	yes
GATCCAACAAAGGTTGTGAG	84	16	yes
GATCCAACAAAACACGCAGG	7	6	yes
GATCACTTCCTTCTGGAATC	13	11	yes
GATCACTGTCGTGTTTGGTA	6	0	yes
GATCACTGGCCCCGATGGTG	105	11	yes
GATCCAAATCTTCAGTGTAG	3	3	yes
GATCCAAATATTGTCATAGC	222	36	yes
GATCCAAAGTTGGCCAGCAT	245	14	yes
GATCCAAAGTCACACCTCCA	20	3	yes
GATCCAAAGGCAGCAAGAAG	42	11	yes
GATCCAAAGCTGCTTAAATC	18	1	yes
GATCCAAAGCCCCAGTAGAA	29	9	yes
GATCCAAAGCAGTGCTCCCA	280	45	yes
GATCCAAAGACTCAGGTGTT	4	2	yes
GATCCAAAGACACAGTCTGT	74	16	yes
GATCCAAAGAAGACAAAATG	34	6	yes
GATCCAAACTTAACGAGCCC	61	2	yes
GATCCAAACCCCAGTGTACC	47	41	yes
GATCCAAACCCAGAGACCAA	12	8	yes
GATCCAAACAAAGACACAAG	10	12	yes
GATCCAAAAGGTTACTGAAA	35	10	yes
GATCCAAAAGGAGACTTCTA	10	3	yes
GATCACTGCAGCCCCAAACT	34	11	yes
GATCTCCATGCTCAGCCTCA	14	12	yes
GATCCAAAAGAGCCTGATGG	22	6	yes
GATCCAAAACAGCAAATAGG	33	6	yes
GATCCAAAAATGGGGATGTT	30	2	yes
GATCCAAAAATGCTGGACTT	30	2	yes
GATCATTTTTCTGTAGCCAT	11	3	yes
GATCATTTTGTCGAGTGAGT	18	6	yes
GATCATTTTCTGCCGTACCA	3	3	yes
GATCACTCAGGACGGTACCC	9	11	yes
GATCACTAAAGGGTTTCCTG	77	19	yes
GATCATTTGCGTTTGGAGGT	30	26	yes
GATCTGCGCTTCCAGAGTGA	35	49	yes
GATCATTTCTTTCTGGCCTG	19	4	yes
GATCATTTCTCGCTCAGATT	2	0	yes
GATCATTTCAGTGAGATTGG	3	3	yes
GATCATTTACCTTCTTCTTC	15	13	yes
GATCATTTACAAACTCACAT	7	5	yes
GATCACGGCATCGAAAGGAA	95	13	yes
GATCACGCTGAGGGTGTCTG	15	0	yes
GATCACGATAAGCTCATCAG	3	3	yes
GATCATTGTGAACACCTCGT	17	14	yes
GATCATTGCCACGGAAAACA	19	16	yes
GATCATTGCATTTGTTGTCT	20	1	yes
GATCATTGCAGACAGTGCTA	8	9	yes
GATCATTGAGAGCAAGCGAG	16	11	yes
GATCACCGCTGCCGCCTGGG	1	1	yes
GATCACCGCCTGCACCGCAG	407	56	yes
GATCATACCCGTCCCTCTCT	29	7	yes
GATCCCTGGAACCTGCAGTT	37	30	yes
GATCATTCTCCAAAGGCAAC	82	58	yes
GATCATTCAGGACAAAGGAG	73	52	yes
GATCATTAGGGGTTTGGTCT	684	136	yes
GATCATTAGCCCACATACCC	43	37	yes
GATCATTACACGGAGAACAC	3	3	yes
GATCCCCTCCTCCTCAAGAG	35	10	yes
GATCTCTGTGCGTTTGAGGC	12	14	yes
GATCATTTGAGCCAAGAGGT	8	10	yes
GATCCAGAAGTCCTGAGGAG	6	7	yes
GATCCTGCACTCAAGTCCCT	19	34	yes
GATCCCTTCCCTCCAAACTA	4	3	yes
GATCAGCGAGCCCACGGTGG	6	5	yes
GATCCACTTGACGATGAAGA	17	4	yes
GATCCTTCTGAATGCCTGCT	207	32	yes
GATCCCTGCTGCTCCAGGAT	2	3	yes
GATCCCCAATATGCTGTTGA	50	35	yes
GATCCCCAAGGCAGCTACCA	16	23	yes
GATCCCTTCTCTGACCTTTG	126	11	yes
GATCCCTCAGGATACAGGCT	9	8	yes
GATCCCAGTGGATGAGCATG	8	10	yes
GATCAGTCTTATCTGGGCAT	7	8	yes
GATCCCAGCACCGAGGGGAA	45	6	yes
GATCTCCTTTGACCTCCCAC	11	9	yes
GATCCCACTGCACCGCCATT	30	7	yes
GATCCCACTGCACATAGGAC	1009	537	yes
GATCCCACGGGGTGCAGTGA	185	41	yes
GATCCCACGAAGAATTCTTC	40	31	yes
GATCCCACCTAGCAGCCACC	62	43	yes
GATCCCACCACCATGTTCAG	1	1	yes
GATCTGAAGGAGTCCAGGGT	6	7	yes
GATCCCCTCCCTCATGTTAA	2	2	yes
GATCAAACAACCCAACAGGA	808	99	yes
GATCCCCGTGTCTGTGGAAA	2	3	yes
GATCCCAAGTTTTTCCTTAA	3	4	yes
GATCCCAAGACCACCCACCT	168	10	yes
GATCTCTTTTCCTGACCCTC	122	93	yes
GATCCCAAAGCCTCGTATGC	40	28	yes
GATCCCCAGTCCAGGATGTG	7	1	yes
GATCCATTCGCTGTAACATG	12	8	yes
GATCCATTCCAGAGGGACAT	9	2	yes
GATCCATGTTTTCCAGGTAT	6	1	yes
GATCCATGTGTTGGTTGAGA	32	13	yes
GATCACGTACTGTGCCTTGT	5	5	yes
GATCCATGGTAGTCAGATAG	92	10	yes
GATCTCTGTCCGAACTGTGA	11	3	yes
GATCTCTGTCAAGGTGGTGG	6	7	yes
GATCCATGGGCCTTAGGGCT	13	19	yes
GATCCATGCTCTGATGAGCG	159	16	yes
GATCCATGAAGTTTTCAGTC	23	17	yes
GATCCATCTGCATTTGCGGC	3333	1430	yes
GATCTCTGGCATAGCAATTG	1	1	yes
GATCTCTGCTCCCCGCCTTT	4	4	yes
GATCTCTGCTCCAATCACAG	549	38	yes
GATCTCTGCTATGAGGCTAC	330	18	yes
GATCCCAGGAAGTCCCACGA	46	3	yes
GATCTCTGAGGTCCAGGCCA	13	11	yes
GATCTCTCTGTTCTCCTGTG	5	5	yes
GATCTCTCTCCCTCTACACA	11	9	yes
GATCTCTCCAAAGCACACGC	12	14	yes
GATCTCTCAGGCCATGGGTC	65	28	yes
GATCCAGTGTGGAAGAGGTG	136	22	yes
GATCTCGGGAATCAGAGTTC	30	26	yes
GATCTCGGAATGGACCCCAA	363	312	yes
GATCCCACCTCCCCCCAGTC	291	39	yes
GATCTCGCCCTGTCAAGCAT	30	2	yes
GATCTCGCAGCCTTCCCCTC	12	14	yes
GATCTCCTTGGAAAGCGACT	10	9	yes
GATCCAGGGTGGGAAGGAAG	127	11	yes
GATCCAGGAGACTCGAAGAT	154	16	yes
GATCTCAGCACATGCTACCA	9	8	yes
GATCACCAATCTCCTGACCA	3	3	yes
GATCTCCTGTCTCTATGAGG	1	1	yes
GATCCAGCTTCCCTCCGAGA	193	15	yes
GATCCCAAGGCTCAAAGAAG	6	0	yes
GATCACAGGCCTGAGGAAGG	64	4	yes
GATCCAGCGAGGGAGCTGCC	130	6	yes
GATCTCCGCCCGAGCCTACG	46	3	yes
GATCCAGCATGGGTGTCCCG	100	9	yes
GATCCAGCATCACCCAGACA	42	0	yes
GATCCAGCAGACCCAGCACA	190	11	yes
GATCCATTTTGTTCGTGGAC	8	0	yes
GATCTCCCGCAAGCCAGAGC	11	13	yes
GATCTCCCCTCTTCCTGGAT	55	2	yes
GATCTCCCCACCACCCCAGG	118	22	yes
GATCTCCCAGGAGACAACCG	8	7	yes
GATCCATGCTTTGCCCGAGA	14	3	yes
GATCTCCAGGGTGGATTTCT	12	4	yes
GATCTCCAGACGCTAGGTCT	8	7	yes
GATCTCCACACAGCACACAG	292	50	yes
GATCTCCAATGCTGGGTCTG	12	10	yes
GATCTCCAACTGTGCTTTCA	30	4	yes
GATCTCATTGCTGGAAGGAG	18	15	yes
GATCGCTGACAAAGCGTTCT	9	8	yes
GATCGCCTCACATTTTCATT	3	1	yes
GATCAAGCCAAAGAACTCCA	5	6	yes
GATCCCGCCCCGCTGGCATG	2	2	yes
GATCACCAGAAGCCATGCTC	36	26	yes
GATCATGTTCTTTCCGCAGG	64	2	yes
GATCATGTTCGCCTGGACAC	236	8	yes
GATCATGTTCCTGGAGGTCA	45	3	yes
GATCATGTGTAAGTGTCAAA	15	2	yes
GATCATGTGCTCACCTGCAT	1	1	yes
GATCTCCACGGATGGGAAGG	74	2	yes
GATCATGTGAGAACAGGCAT	82	18	yes
GATCATGTGACAAGTGAGAG	1	1	yes
GATCATGTCTTCTCCATGTT	139	10	yes
GATCATGTCTGTGAAATGAC	3	3	yes
GATCATGTCTATCTCAGGGG	111	16	yes
GATCATGTCCCACAGGCATT	6	2	yes
GATCATGTCATTGCCTGTTA	32	4	yes
GATCATGTCAGAGGGAGATG	12	5	yes
GATCATGTACTGGCTGCAGG	3	3	yes
GATCATGGTTCAAGTGACAA	69	1	yes
GATCATGGGTGTTGCTACCA	118	12	yes
GATCATGGGTGTGCCAGGGG	161	27	yes
GATCATGGCCTTTACGATGC	3	3	yes
GATCATGGCCTTCAGATATG	42	0	yes
GATCATGGCCCAGACCTGAG	93	5	yes
GATCATGGCAAAGGATGACC	118	2	yes
GATCATGGACATGAAGGAAG	74	32	yes
GATCATGCTGTGTTCGTGAT	10	2	yes
GATCATGCTCCTGCAGCTGA	111	14	yes
GATCATGCTCCTGAGTGGCA	34	2	yes
GATCATGCTCATCTTCACTG	79	13	yes
GATCATGCTACCACTGCATC	15	13	yes
GATCATGCGCCTTTCTAAGC	34	7	yes
GATCATGCCTTCTGTAAAGC	32	6	yes
GATCACAGCTGTGATGGGAG	19	4	yes
GATCGTGTGTTGCCATTTTG	12	1	yes
GATCACCAAACCAGTGCACA	21	18	yes
GATCATGCCGTGCTACGCTC	32	27	yes
GATCATGCCGCCCCTTAGTG	10	9	yes
GATCATGCCCCAGGACACAA	12	10	yes
GATCATGCCCAAAACAACCA	90	15	yes
GATCATGCAGACTGTTCCTT	244	80	yes
GATCATGCAGAAGAACGGTG	123	25	yes
GATCATGCACTGTATTCACA	3	3	yes
GATCATGATTCTCCCTCAGC	17	14	yes
GATCATGAGTGACCACAGTT	3	3	yes
GATCATGAGGGAGTTCCGGT	214	50	yes
GATCATGAGCCATTTTTAAC	14	12	yes
GATCATGACGCTGGTAGATG	34	9	yes
GATCATGACCCTTAGACTCA	3	3	yes
GATCAGCTGAGCGTCAGGGT	5	5	yes
GATCACAGACCATGGTCTCA	48	1	yes
GATCACAGAATGGAAACAGC	4	5	yes
GATCCAGCGCAGGGGGACCT	2	2	yes
GATCATGAACATCATCCAGG	24	21	yes
GATCATCTTGAAGTGTGCAA	22	1	yes
GATCATCTTCATCCTGGGTT	68	14	yes
GATCATCTGACAAAGTGCTA	1	1	yes
GATCATCTCTTCTGAGAGTG	13	2	yes
GATCATCTCCCTGATGAGAC	29	25	yes
GATCATCTCACAGGACAGGG	192	19	yes
GATCACACCACTCTCAACCA	4	2	yes
GATCACACATCTGGGCAGTG	17	1	yes
GATCATCGTGTCGGGATGAT	9	8	yes
GATCATCGGCATGGCATACG	79	0	yes
GATCATCGGAAGGATAGATG	5	6	yes
GATCATCCTTGTGTTGTGAA	152	28	yes
GATCATCCACCTGCTCACTG	1097	107	yes
GATCATCCACAAACTTCCAG	8	7	yes
GATCATCATGGAGCTGGTGA	36	2	yes
GATCACAAGATGGCGTTATC	2	3	yes
GATCAGGTCATCGCCTCCTT	367	12	yes
GATCAGGGTTAAGGAGGAGC	16	14	yes
GATCAGGGAAGCAGACATTG	19	23	yes
GATCAGGACTTGAGGGTTAT	15	11	yes
GATCAGCTGTGGGCTCTGGG	57	40	yes
GATCATCACTGCTGCCCTAT	1	1	yes
GATCATCACAACATGAGGAA	41	8	yes
GATCTCTCCCAGGCTTGCTG	18	22	yes
GATCAGAGGCCACATAGCTT	3	3	yes
GATCAGCGTGCGCCTAGCGG	198	13	yes
GATCAGCGGTGGGAATGACG	77	29	yes
GATCAGCGCTGAGCTCCAGA	43	22	yes
GATCAGCCTTCAATAGCCAT	11	2	yes
GATCAGCCTCTTTCCCATCA	4	4	yes
GATCAGCCCTGGCAAGGAAG	124	17	yes
GATCAGCCCCATTGCGGTGC	15	2	yes
GATCAGCCATCCTGGATGGA	102	74	yes
GATCCCAGCTGTTTGGGGCT	19	16	yes
GATCAGCCAAGCCAGACTTG	2	2	yes
GATCAGCATTCCACCCCGGA	7	3	yes
GATCATAGCAAAGATGGACG	64	1	yes
GATCATACGTAGTTGTGAAA	48	17	yes
GATCATACGCCCAGGGAGAG	13	5	yes
GATCATACCAAGAGGTGAGG	184	27	yes
GATCTCGACCCCCAAGTTTG	8	10	yes
GATCAGCAGGTGGTTATCAA	71	3	yes
GATCAGCAGCTGCTTTTGCA	77	5	yes
GATCAGCAGCCGGAGACGAC	177	5	yes
GATCAGCACTCTCGGTATGC	17	6	yes
GATCAGCACCACACTGGACT	11	9	yes
GATCAGAGTGTCACGGTAGG	16	10	yes
GATCAGACCCAGGCTCTTGC	161	38	yes
GATCAGACCATGGTACTGGC	58	20	yes
GATCAGTTTTTGGTGTCATT	151	7	yes
GATCAGTTTCAGCCAGGAGT	6	7	yes
GATCAGTTCTGAGCCGAGGA	15	18	yes
GATCAGTTCCTGGTATACAG	12	14	yes
GATCTCAGGAATTTTTGTAG	47	5	yes
GATCAGAACTTTTCCCTATA	20	13	yes
GATCAAGGTCGGAAAGAAAT	335	167	yes
GATCTGTGCAGGGTATTAAC	579	393	yes
GATCACTTTGACTTCATCCT	29	21	yes
GATCTGTGCAAAAGCAGTGA	337	41	yes
GATCACTGTGCGCCCCCTCC	10	9	yes
GATCACTGGCAAGCACGAAG	14	1	yes
GATCACTGCTGTAGGAAAGC	19	0	yes
GATCACTGCTCTGGACCTAA	39	3	yes
GATCACTGATACTTCCTGGG	29	24	yes
GATCACTCTTCAGAGAGTGA	36	12	yes
GATCAGTTCCATGTTACACA	10	12	yes
GATCAGTTACTGCCACACCC	2	2	yes
GATCAGTGTTTCTGCGAAGG	207	24	yes
GATCTCCCAGCTACTGTGTT	116	75	yes
GATCAGTGGCTTCAGTCACA	41	35	yes
GATCAGTGCTCTGCTAACGC	611	90	yes
GATCAGTGCCTTTGTTGGCA	157	8	yes
GATCAGTGAGTGTGAGTGTG	19	15	yes
GATCATACGGAGCATGAGAG	8	10	yes
GATCACTACTCCTTAGACGT	36	43	yes
GATCACGTTCTGATTGAGCT	9	7	yes
GATCACGTGTATGTGTCGTG	13	15	yes
GATCACGTGGGCTGCGTTTC	260	184	yes
GATCACGTGCCTGAGGTATG	2	4	yes
GATCACGTGACCACCCTTTC	9	11	yes
GATCACGGTGCCTGGTTACA	20	17	yes
GATCACGGGAGCTGAGCAAC	32	22	yes
GATCACGACGACGCCCACGC	39	46	yes
GATCACCTGCCAGACTGTTA	31	2	yes
GATCACCTCCCAGATTCTGA	1	1	yes
GATCACCGTTCCCATCCCCG	19	2	yes
GATCACCAAGGAATCCAAGG	17	8	yes
GATCACCAACTCACGTCATG	126	89	yes
GATCACCAACCACCCCAGCA	103	18	yes
GATCACAGTGGAATCTTCGG	7	1	yes
GATCACAGGTCTGAGCAAAG	32	4	yes
GATCACAGAGCCAAGCCCAT	1	1	yes
GATCCTCTTTCCAGGCCTCT	50	12	yes
GATCACACTTGGGGAAGATG	49	8	yes
GATCACACCTGTGGGGTCAA	22	26	yes
GATCACACAGGGAGGCCTTG	123	17	yes
GATCACACACTACTGAGGGC	7	8	yes
GATCACAATGTTGTCTATCC	14	12	yes
GATCACAACTGATGGCGGGT	675	54	yes
GATCTAAGCGGGACTATGAG	4	5	yes
GATCAATTCTAACTGGTCAG	7	5	yes
GATCAATCACCAGCGCGAAG	27	32	yes
GATCAGGAGGTGAACAGAGA	5	5	yes
GATCACGTGCTTGTGCCAGG	7	8	yes
GATCAACTCATGGAGCTGGC	38	44	yes
GATCAACGCCATGACCTACC	190	27	yes
GATCAACCCCTACCAGCCAG	38	7	yes
GATCAACACACTGGAATGGA	147	4	yes
GATCCAGCTGGAATCTAAAG	9	3	yes
GATCCGAATCTGTGCCCAGC	104	13	yes
GATCCTGAAGGAAGTCCTGA	125	4	yes
GATCCCAGCATCGGCAAGCA	14	11	yes
GATCAAAGAATTTGGTTCTG	20	24	yes
GATCCTCCTGGGCTTGAACT	296	60	yes
GATCCAGCATGCCAACGTGC	9	8	yes
GATCTGGTGCGTGTGGCCCT	17	14	yes
GATCTGGTCCTGCTCCTACC	7	8	yes
GATCCAGAGGCAGTTCCAAG	2	2	yes
GATCCCCAGCCTAGGTTGCC	2	2	yes
GATCCCTCTCCAAAGTGGTT	9	13	yes
GATCTCATGGTTGACTCTCT	11	9	yes
GATCCACCGTACCAGGAAGC	106	69	yes
GATCCACCAAGGTAGAAAAC	23	20	yes
GATCCACACGGGCGAGAAGC	2	2	yes
GATCCACACAGGAGAGAAGC	43	2	yes
GATCCAGGAGTCCTGTCAGA	53	9	yes
GATCTCACTGTGTCGCTCTG	32	38	yes
GATCCAGGACAAGAATAAGT	6	2	yes
GATCCAGGAACCGAAGAATG	3	4	yes
GATCTCACTAACCTGCCACC	38	24	yes
GATCTCACGCCTCTGTGCAT	14	1	yes
GATCAAGCCTAGCCAGGACC	15	10	yes
GATCAGCGCCGACCTGGACC	4	4	yes
GATCCAAGGAGCTGGGGAGG	32	13	yes
GATCCAAGGACAAGACACCA	11	9	yes
GATCCAGCCGAACGTGTTCT	2	0	yes
GATCGAGTGTATCACGCAGG	21	2	yes
GATCCAGCAAATCGGGACAG	10	4	yes
GATCTCAAAGGGAAACTGAC	53	10	yes
GATCCAACTCAGTTAGGCTT	45	6	yes
GATCCAACTCACCCCATCAG	9	8	yes
GATCCAACGCAGCACCGTCT	62	11	yes
GATCCAACCCCCTCTCCTGA	3	1	yes
GATCTCAAACCTGCACTACA	12	10	yes
GATCCAGAGAAGGCTCAGTG	1	1	yes
GATCCAAACGTCACAGAATT	50	3	yes
GATCCAGACCCTTCCCAGAA	17	14	yes
GATCTATGTCATGGCCACGC	21	24	yes
GATCTTGGTGGTAGTAGCAA	3	3	yes
GATCCCCGTTCCTTGTCCAG	2	2	yes
GATCCAAAAGGAAGCAAATT	33	15	yes
GATCGAAGCCTGCCGGGGTA	33	9	yes
GATCTAGCCTTATGCCCGGG	1	1	yes
GATCTACTTGTGTGTGTGTG	10	12	yes
GATCTACTACCAGACAGACA	14	3	yes
GATCTACGGTTCCCACGCAT	66	57	yes
GATCTACGGCCTGGACTTCT	45	39	yes
GATCCCCAAATTCCAGCATC	15	10	yes
GATCTACCTTGAAATCCCTC	9	9	yes
GATCCTGTCTCTGGCAACCC	13	5	yes
GATCTACCTACCCGTGGTGT	8	7	yes
GATCTACCTAAAAGCAACAG	13	15	yes
GATCTACCAGGTGGACACCC	69	11	yes
GATCTACAGCGTGCCCTGGA	29	18	yes
GATCTACAGCACTGCCTTTC	52	62	yes
GATCTACACACTCCCTTTTT	6	5	yes
GATCCACCAGCGTGTGCATG	104	8	yes
GATCATTCCAAGTTTCACGT	219	24	yes
GATCCACACTTGGACACTGT	33	6	yes
GATCCACACAATGGAGACCT	33	3	yes
GATCTAAACTGTGGTGTGAA	47	28	yes
GATCGTGTGGAGTGAAAGGC	2	2	yes
GATCGTGTCCGGCATGAAGT	243	31	yes
GATCCAAGGCGGCGACCCGA	8	2	yes
GATCGTGGCACCTCCGGGCT	4	4	yes
GATCGTGAGGATGGAGAAGG	32	21	yes
GATCGTGACGGCACTGACGT	4	3	yes
GATCGTGAAGCCGCTGAATC	75	55	yes
GATCGTCTCCGTGCTGGTGA	3	3	yes
GATCATCCCCTGCACACAGT	722	66	yes
GATCGTATCACAGACAGGAC	44	38	yes
GATCGTACGGCTGTAACAGG	34	40	yes
GATCGTAAGTTCTGGGACGC	27	32	yes
GATCCGTGACATTTTATTTG	2	3	yes
GATCCGGTGACTCGTTGGCT	12	8	yes
GATCAAACCTACCAGCCGGT	13	11	yes
GATCTGCTGCTGTTCTTTGG	137	12	yes
GATCAGTCTTTTCAGTATTT	8	6	yes
GATCAGTCTTGGTTGCTTAG	2	3	yes
GATCAGTCCTACAAAGTTCC	129	59	yes
GATCAGTCCCTTCCCCCAAC	33	3	yes
GATCAGTCCAGTTTTGGCTG	28	24	yes
GATCAGTCACCACTGGCACT	61417	2748	yes
GATCAGTCACAGGCAAACTC	13	9	yes
GATCAGTACTACTGTGGTGT	4	3	yes
GATCAGGTTTGGACTCCTTC	18	22	yes
GATCAGGTTTGCACCAAGGT	45	8	yes
GATCAGGTGTTCAAAGTCAC	4	5	yes
GATCTGCGATGAACTGGGAG	494	12	yes
GATCAGGTCAGAGATGCGGT	144	23	yes
GATCAGGGTGGAATGTGCCT	8	2	yes
GATCAGGGGGAAGGGGTCAG	848	94	yes
GATCAGGGCGTGGTAGAGAA	20	3	yes
GATCAGGGCCGTGTGGATGC	60	51	yes
GATCAGGGCCGAGTGATGAG	44	3	yes
GATCAGGGCCCATTAGTGAG	75	6	yes
GATCAGGGCCAGGGGAGGTC	536	125	yes
GATCAGGGCAGAGATGGAAG	83	3	yes
GATCAGGGCAAGAGGATTGT	3	1	yes
GATCAGGGAAGTTCATTGTG	46	1	yes
GATCAGGCTGAGCTGAATGT	2	2	yes
GATCAGGCTACTACAAAGTT	1041	50	yes
GATCAGGCCTGAACCCGTCC	119	102	yes
GATCAGGCCATCAAGTCACA	2	2	yes
GATCAGGCCATACGTAGCCT	80	4	yes
GATCAGGCCAAACACTTGGG	163	21	yes
GATCAGGAGTTCCAGGACAG	12	10	yes
GATCAGGAGTTACTATCCAG	7	8	yes
GATCAGGAGGGTCAGCTGTG	68	2	yes
GATCTTTCTCAAGAGCAGTG	2	2	yes
GATCAGGAGCCAGGGAGCTA	40	2	yes
GATCAGGAGCACCTGTGGCT	1	1	yes
GATCAGGACTCCTGTGACTC	82	25	yes
GATCAGGACCTCATTTCACG	1	1	yes
GATCAGGACCTACTGCCACC	39	33	yes
GATCAGGACAGCAAAGACAG	192	9	yes
GATCAGGAAAGTTGTGGAAG	43	37	yes
GATCAGCGGTGGGAATGACA	1980	14	yes
GATCAGCGCTATTTCCTGAG	121	11	yes
GATCAGCGCCTCCAGTTCCT	3058	351	yes
GATCAGCCTTTTCTGTCTTG	33	4	yes
GATCAGCCTGGGCCACCTTG	37	32	yes
GATCAGCCTGCTCCTGGGGC	75	46	yes
GATCAGCCTCCATCCGCTCA	94	13	yes
GATCAGCCGTTCCTCTGGTG	22	15	yes
GATCAGCCGCTCAAGATTCT	414	101	yes
GATCAGCCCTCCCCTGTGTC	34	4	yes
GATCAGCCCTAATCCTCTGG	979	47	yes
GATCAGCCCGACTGTCTGCT	13	11	yes
GATCAGCCCATCCACTCTTT	10	1	yes
GATCAGCCCAGCCCATGTGA	203	9	yes
GATCAGCCCACTCAGCCTAA	7	1	yes
GATCAGCCATTTCTTGGGGT	4	5	yes
GATCAGCCAGTTGACTTGGA	4	4	yes
GATCAGCCAGTGATACCACA	36	27	yes
GATCTCTCTTCCCAGATGAA	12	16	yes
GATCAGCCACTTAGAATTCA	2	2	yes
GATCAGCCACACTATTCTTA	59	54	yes
GATCCACATGTGAGAAGCAG	1	1	yes
GATCAGCCACAAGATTTCAT	29	5	yes
GATCAGCCAAGGGTTCAGAG	23	27	yes
GATCAGCATTCTTGAGCTGG	150	7	yes
GATCAGCATTCACAAATTAC	11	9	yes
GATCAGCATGGTTGTTCTTC	22	1	yes
GATCAGCATGCCCTTCCATT	9	8	yes
GATCAGCATAGTTGTAGATT	11	9	yes
GATCAGCAGTGTCGGCCATT	7	6	yes
GATCAGCAGTGCCTTGTGTT	72	12	yes
GATCAGCAGGGATTATTCCA	2	2	yes
GATCAGCAGGAACCCCACCT	17	14	yes
GATCAGCAGAGTGGTTATGG	63	12	yes
GATCAGCAGACTACAACTGA	60	1	yes
GATCAGCACTTGCCTGGAAA	8	2	yes
GATCAGCACTAAGACTGCTA	84	7	yes
GATCAGCACCTTGAAGAAGT	57	4	yes
GATCAGCACAGGGTCAACTA	262	17	yes
GATCAGCACAGACACCATTT	7	1	yes
GATCAGCAAGTGACATTGAT	3	3	yes
GATCAGCAAGTCAGGAGTCA	177	44	yes
GATCCTCAAGAGAAGCTTCA	19	3	yes
GATCAGATTCTTTTCTTTCC	7	6	yes
GATCTCCCTGAACCACCAAC	5	5	yes
GATCAGAGTCGCCCTCCCAT	40	34	yes
GATCAGAGGTTAGGACGTGA	6	7	yes
GATCAGAGGCTCCCAACTGG	298	84	yes
GATCAGAGGAGACTTCCTCG	22	19	yes
GATCAGAGCCAAGAAACGCC	91	33	yes
GATCGCTGGAAAGGTGGCAG	10	12	yes
GATCCACTCTCTCTGCTACA	6	2	yes
GATCAGACCTGTGGCTGAGT	46	33	yes
GATCAGACCGTTGGGTGGAC	1	1	yes
GATCAGACCCAAAGAAAAGT	122	24	yes
GATCAGACACTGACTGGTGA	11	13	yes
GATCAGAATGAACTTGCCAA	61	9	yes
GATCATCCAGTATTTCATCC	8	9	yes
GATCCAAGGCCTCCACGTCT	69	8	yes
GATCCAAGGAAGAGCCCATG	17	3	yes
GATCCAACCAGGACAACGGG	2	3	yes
GATCTGGTCATACAGCAGGT	12	10	yes
GATCCGTCGCCACTGGGGAG	3550	485	yes
GATCTGGCCATCCCAGGGGG	63	4	yes
GATCCCATTGCCAAGGAGGA	4	7	yes
GATCGGCGCCTCCGGAGTAC	39	33	yes
GATCTATACCATGTTCTTTG	15	18	yes
GATCTGGGCTATGAGCCACT	41	3	yes
GATCTGGCTTTGTTCCCTGG	6	7	yes
GATCGCCATATGGACCACCT	98	12	yes
GATCCTTGAGAGGCAAGACG	23	5	yes
GATCAGGTGGAGTTGAAGGA	5	5	yes
GATCGGGAACAGAAAGGGCG	25	20	yes
GATCGGCGCTTTCAGACTAA	52	19	yes
GATCGCTGTGGCCGAAACTT	230	67	yes
GATCGCTGGGGAGTCGGGTC	228	3	yes
GATCCAAAGAGCAGGGATGG	13	5	yes
GATCCAAACTAAAGGCAGAG	15	3	yes
GATCGCTACCAAGCAGTTCT	241	51	yes
GATCGCCTTCTCCACCAATT	99	10	yes
GATCCTCAGGGCCTGAGCCT	8	0	yes
GATCGCCTCCTCCCTCTCTT	184	27	yes
GATCTGGTGCTGCGCGGATG	21	18	yes
GATCGCCACTTACCGGAACC	3	2	yes
GATCATCTTTCTGAGGGCTG	37	6	yes
GATCGCCACCTACCGCACCC	70	99	yes
GATCATCTGCTTCAGCATAT	1	1	yes
GATCGCATGCGCCCCATCTG	30	43	yes
GATCGCATGAAGAAACCATG	6	7	yes
GATCGCAGTAGCCAGCGCAG	98	22	yes
GATCGCAGAGTCCGCCAACT	2	3	yes
GATCGCAGAGGAGGGTTTTG	3	1	yes
GATCGACGAGAACTGGTATG	56	17	yes
GATCCCCTCTTATAGTCCAA	1	1	yes
GATCCTTTTCCACTCCCAGG	122	1	yes
GATCCTTTGCTCCTAGTGGA	105	14	yes
GATCCTTTCTACTATGATTG	21	9	yes
GATCCTTTCCTTGGACTCAC	11	13	yes
GATCCTTGTTGTGCCTCTTC	3	4	yes
GATCCTTGTGGCTGTGAAAA	39	13	yes
GATCCTTGTCCACCCCTCCC	42	36	yes
GATCCTTGGGGTAAGCAGAA	9	3	yes
GATCCTTGGCTGCTGGGGAA	1	1	yes
GATCCTTCTTGTGGAACAAC	137	14	yes
GATCCTTCCTGCGGGCGGTG	3	2	yes
GATCCTTCCCATGTGTGCCT	80	26	yes
GATCCTTCAGATAGTGGACA	8	2	yes
GATCCTTCAGAATCTCTGTT	83	13	yes
GATCTGCTGCTGATTCTGTG	3	1	yes
GATCCTTACCCTGTCCCTGT	78	1	yes
GATCAGTGTGTCTGTCTATG	16	19	yes
GATCAGTGCCTGGCGCCAGA	136	25	yes
GATCCTGTGGGACCATCTAG	48	8	yes
GATCCTGTCCCAGGGGCTAG	76	16	yes
GATCAGGTCTCTCCAACTCA	31	4	yes
GATCCTGTCCAAAGACATCC	29	4	yes
GATCCTGGTTGGGGGCAAGG	163	27	yes
GATCCTGGTGGTTCACCTCA	20	8	yes
GATCCTGGTGAATGAACCAT	1	1	yes
GATCCTGGGTGCCTCTGATG	2	3	yes
GATCAGGACTTCTACTGGCA	1	1	yes
GATCCTGGGTCCCTCGTAAG	8	2	yes
GATCCTGGGTACTAAGGTCA	89	76	yes
GATCCTGGGGACCCAGAATG	24	2	yes
GATCCTGGGAGCGAGGAAAC	41	15	yes
GATCCTGGCTGCCCACTTGG	2	2	yes
GATCCTGGCGCTGGCTGTCC	90	24	yes
GATCCTGGCAGTGGACCGCC	14	4	yes
GATCCTGGCAACAGCTGTTT	2	3	yes
GATCAGCTGATGTGGGTGCT	36	11	yes
GATCCTGGAGAGTCTTCTCT	1	1	yes
GATCAGCTCTACCCAGAGAT	3	4	yes
GATCCTGGAGAAGCATGTTC	3	4	yes
GATCCTGGACCGCCACAATT	46	10	yes
GATCCAGAAGACGAAAGAAG	187	4	yes
GATCTGTCCTCCAACAAGCT	3	4	yes
GATCCTGGAACACTTGGACA	9	3	yes
GATCCTGCTGACACGGTGCG	22	4	yes
GATCCTGCTCCAGGAGATTG	6	5	yes
GATCCTGCTAAGCACTGAGG	64	6	yes
GATCCTGCAGCGGTTCCTAC	7	6	yes
GATCGCCAAGTTCAAAGCTG	471	33	yes
GATCCCAACAATGCAGCCAT	211	86	yes
GATCATGTCTTTATCGAGGA	17	14	yes
GATCTCTCCCCAGGGAAGGA	45	12	yes
GATCAGAAGTTCAGGGTTAT	64	20	yes
GATCAGAAGTTCAAGGTAAT	216	33	yes
GATCTCGTCGCCAGACCCTC	23	20	yes
GATCAGAAGTAGCCAAGTAG	1	1	yes
GATCAGAAGCTGTGTGCGTT	6	5	yes
GATCAGAAGCTGGAGGGTGT	122	24	yes
GATCAGAAGCCACAGGCAGG	50	22	yes
GATCAGAACATCTCTGGCTA	4	4	yes
GATCAGAACAACAGACAGTG	18	15	yes
GATCAGAAACTGTCCTCTGA	39	33	yes
GATCACTTTGAGGAAGCCAT	358	66	yes
GATCACTTTCTAGGTTCCTA	22	10	yes
GATCTCATCTTCCTACCCAG	17	3	yes
GATCACTTTATTGCTGAACA	4	4	yes
GATCACTTGTTTGTGGTGAG	91	1	yes
GATCACTTGTCAGTGTTCAG	56	12	yes
GATCACTTGGCGGTGACTTT	23	27	yes
GATCACTTGAGTTCTGGTAG	30	12	yes
GATCACTTCGGCCTGTACAC	94	33	yes
GATCACTTCGCCCTTTTTTG	187	18	yes
GATCACTTCCTTCAAAAAAA	33	5	yes
GATCACTTCCGTGCCTCCCT	18	4	yes
GATCACTTCCCAGGGCCTGT	18	21	yes
GATCACTTAGTGGGGGGTTT	24	28	yes
GATCACTTACTGCCTAATGC	5	5	yes
GATCACTGTGTTGGACACTC	123	16	yes
GATCACTGTGTACACATTGG	12	3	yes
GATCACTGTCTCAGGCCTTT	18	15	yes
GATCGACCACATCCTGGATG	148	14	yes
GATCACTGGTGTTTCCCATT	15	4	yes
GATCACTGGTGGCATCGCTG	9	8	yes
GATCACTGGTGGAGAAAAGA	15	18	yes
GATCACTGGGTGTGTTTCAG	43	51	yes
GATCACTGGGGGCTCTTGTG	10	9	yes
GATCACTGGGAACAAACGGC	173	123	yes
GATCACTGGAAACGATTGCT	160	4	yes
GATCACTGCGTTAATCTTGG	1	1	yes
GATCACTGCGAAGTTTCGTT	47	7	yes
GATCACTGCCTTTCCCCCTC	57	6	yes
GATCACTGCAGGGGGTGCCA	127	31	yes
GATCACTGCAGGCGCAGCGG	972	61	yes
GATCACTGCAACCTTGTGCT	87	4	yes
GATCACTGATTCAGAGCTCA	2	2	yes
GATCACTGATGGCCAGAATG	44	37	yes
GATCACTGAGGAGACATTTT	77	14	yes
GATCACTGACCTTGGAGCTT	174	0	yes
GATCACTCTGGCCGCTCTTC	657	200	yes
GATCACTCTGGCCAAGTAAG	10	7	yes
GATCACTCTGGAGTTCAGCG	444	46	yes
GATCACTCTAGTCCCCACCC	14	12	yes
GATCACTCCTTTTGAGGAAA	261	5	yes
GATCACTCCGTGCACCTGCT	18	15	yes
GATCACTCCCTGCCTGAGCC	278	24	yes
GATCACTCCAAGTTGACATT	6	5	yes
GATCACTCAGCAGCCAGGAC	140	82	yes
GATCACTATGTCCAGGCTTC	30	3	yes
GATCACTATGCTGGAAGGAG	1	1	yes
GATCACTAGTGACTGTTGGG	53	5	yes
GATCACTAGGGGCTTTCAGC	4	5	yes
GATCACTAGCTTCGAGGAGG	249	35	yes
GATCACGGTTTTCTCTGTAA	56	13	yes
GATCACGGTGAACCCCCAGT	104	23	yes
GATCACGGTCCCGTGACCGC	7	8	yes
GATCACGGTATTTGACCGTG	23	20	yes
GATCACGGCAGTGGATTGGG	56	1	yes
GATCACGCGTCCAGATGTGC	15	13	yes
GATCACGAAGGAGGAGCTGG	84	5	yes
GATCACGAAGATGTTGGGCG	31	20	yes
GATCACCTTTGTCTGATAGC	68	9	yes
GATCACCTTGCTGGCATCAG	40	16	yes
GATCACCTTCCTGTCTCATC	91	5	yes
GATCACCTGTTTCGCTGTGG	806	4	yes
GATCACCTGTGCCAAAGACA	21	18	yes
GATCACCTGTAAATGGCCAC	22	19	yes
GATCACCTGGGCCAGTCCAG	74	52	yes
GATCACCTGGGATTTCTCAG	107	15	yes
GATCACCTGGATTGAAACGG	29	7	yes
GATCACCTCTTAGGGATGGT	3	3	yes
GATCACCTCTGGGCCTAATG	62	3	yes
GATCACCTCTGCCAGCTCTC	29	8	yes
GATCACCTCTCATCCATGTG	2	0	yes
GATCACCTCAACGTGGGTGT	153	13	yes
GATCACCTCAAACTAATTTG	4	4	yes
GATCAAGCCAGAACAAATCT	13	0	yes
GATCACCGTTTCAAGGCCCA	10	9	yes
GATCACCGGGGATGAATTCT	75	6	yes
GATCACCGCTCACCTTTCCA	6	0	yes
GATCACCGCAATGATGGGTG	1	1	yes
GATCACCGAGGAGGGAGACA	26	7	yes
GATCACCGACTCCCTTACTA	17	8	yes
GATCACCGACCGCATCGAGA	3021	63	yes
GATCACCGAACTAGACACAG	21	5	yes
GATCACCCTCAGGTGCAGGT	160	8	yes
GATCACCCCTCTGCCTTTGT	37	32	yes
GATCACCCCCTTCCCTCTGT	48	8	yes
GATCACCCCCAATTGTATGG	294	63	yes
GATCACCCCACAGTGAGGCG	127	7	yes
GATCACCCCAAAGCCTTCAA	37	6	yes
GATCACCCATCATTCTGAGG	93	12	yes
GATCACCCAGAAGTGGCTCT	186	22	yes
GATCACCCACATTGGGTGAG	7	6	yes
GATCACCATTTCCGACTGTG	2223	59	yes
GATCACCATTCCGGTTACTT	362	40	yes
GATCACCATCTAGTGAGTCG	137	7	yes
GATCAGTAACCAAATTGGAG	35	41	yes
GATCACCAGTGGGAAAGCAG	6	0	yes
GATCACCAGGGGCTGATGGG	69	12	yes
GATCACCAGGAAGAAAGAGT	17	14	yes
GATCACCAGGAACTTCTATG	24	4	yes
GATCACCAGCCTGAAGCTGA	48	3	yes
GATCACCAGCAAACAGCTTT	276	14	yes
GATCACCAGAGGGCGGGGCT	21	18	yes
GATCACCAGAGGAGATAGGA	19	12	yes
GATCACCACCCCTGTTAAGC	252	18	yes
GATCACCACCAGGACGCTGA	265	10	yes
GATCACCAATGTTGTTTTTG	4	1	yes
GATCACCAAGGTTGATGCAC	1124	108	yes
GATCCGGGCTCTAGACAGCG	11	3	yes
GATCACCAACAGTGCTTGCT	32	7	yes
GATCACCAAAGGTACAGTTA	41	1	yes
GATCACATTTGCTTTGTGTT	2	2	yes
GATCACATTCTGGGCTTCCA	7	1	yes
GATCACATGTATATGTCTTC	12	10	yes
GATCACATGTAGTGGGGAGG	35	5	yes
GATCACATGACAATGAAACA	13	0	yes
GATCACATGAACGTCTCCTG	39	45	yes
GATCACATCGAGGTGTCGGA	19	5	yes
GATCACATCCAAAAAGTCAT	5	8	yes
GATCCCTGGTGCAAGATACC	4	4	yes
GATCACATCAAAGGATGATG	29	2	yes
GATCACATACGCAGGAGTGG	3	3	yes
GATCACAGTTCCAGGAACAG	66	16	yes
GATCACAGTGCGTGCCTGGC	32	38	yes
GATCACAGTGAACGGAGATA	28	3	yes
GATCTTGGGAAGTTTTCCCT	4	7	yes
GATCACAGTCTTCCATTTCA	4	3	yes
GATCACAGTCCTTCCTCTGG	444	8	yes
GATCACAGTATTGTCTCAGA	10	9	yes
GATCACAGGTGTGCATACCA	32	4	yes
GATCACAGGGATGCGGCGTC	40	34	yes
GATCACAGGCAGTCCAGGGG	29	2	yes
GATCACAGGACTCTTTCCCT	4	1	yes
GATCACAGCCTGGATTTTTC	5	6	yes
GATCACAGCTCAGTTCCTAT	84	3	yes
GATCACAGCGTTCGTGCCCA	53	0	yes
GATCCCAATAACCCGGCTGC	18	13	yes
GATCCCGTTGAAACTGCTGC	182	27	yes
GATCCACGTTGAGGTGCATG	2	2	yes
GATCGTGTTGTGAGTGTGTG	1	1	yes
GATCCAAGCCCGGAAAGGCA	47	32	yes
GATCCCCTTCTACCTACTCC	380	49	yes
GATCTCTGCACAATGTGAAC	122	1	yes
GATCAGTTACCACTGGCACT	556	478	yes
GATCCATCTGTGTAGTTTCT	37	2	yes
GATCAAGAAGTGGGGGCCAT	6	7	yes
GATCTCATGTCAGGTTCCTG	6	7	yes
GATCCTGCCAAGAGGAGCAA	124	112	yes
GATCCCTGCTCCTCTGGAGG	86	19	yes
GATCCTGGGCAAGGACCACA	1	1	yes
GATCCGGGCTTCTTTCCCAA	7	6	yes
GATCTGACGGTGCCCTTGGC	230	107	yes
GATCCTGATTGCCTGCCCCG	29	9	yes
GATCCTGAGATGGCTCTGAG	21	2	yes
GATCCTGACCATCACTATAC	19	16	yes
GATCCTGAATTGCTGGAGAG	42	0	yes
GATCCTGAAGTCTGCAGACC	146	57	yes
GATCCTGAAGATGTGGACAC	19	4	yes
GATCCTGAACCCACCCCCGT	13	4	yes
GATCCTGAAACGACAGTGGT	86	17	yes
GATCCTCTTGTCTGCTTCGC	237	82	yes
GATCCAGGACCTGGTAGCAA	238	4	yes
GATCCAGGAAGTTGGTGAAC	242	29	yes
GATCCTCTTCTCCGCGTGCC	82	61	yes
GATCCTCTTCCACGAGACAC	1366	194	yes
GATCCCAACATTGTTGGCAG	2	2	yes
GATCCTCTGCAGTATCCAGG	44	10	yes
GATCCTCTGCAGAGGAGTAT	55	18	yes
GATCACTTTCCTCCCACGTG	31	1	yes
GATCCTCTCCAAGGAGGAGC	134	0	yes
GATCCTCGTTCCTTGTCCTA	1	1	yes
GATCCTCGGGGTGCCAGCCA	154	10	yes
GATCACTGAGGATGGCTGAC	4	5	yes
GATCCTTCCTAGAGTCACTC	7	6	yes
GATCCAGCAGCGCAGGCAGG	32	2	yes
GATCACGTTCTGCTTGGAAG	129	7	yes
GATCCTCCTCCCCCTACCTT	42	12	yes
GATCCTCCTCCAAGTCTGAC	85	8	yes
GATCCTCCTACCTGTTTCTA	121	54	yes
GATCCTCCCTGTTAGTTCTT	4	5	yes
GATCCTCCCTCAGGACTACG	69	23	yes
GATCCTCCCGTATGCCAACC	30	26	yes
GATCCTCCCCTGGCCTCAGT	7	8	yes
GATCCTCCCCTGCCCTACAC	3	4	yes
GATCCTCCCCGCTCGCTCAC	159	17	yes
GATCCTCCCAGACCCTCTGA	213	23	yes
GATCCTCCAAGGAAGGCAAA	12	3	yes
GATCCTCAGGAGTCAGTATT	2	2	yes
GATCCTCAGGACAGCATAAG	19	22	yes
GATCCTCAGCCTCCCAGAGC	111	10	yes
GATCCTCACTTTTCAGTGCG	52	6	yes
GATCCTCACTGAGAAGGAAC	53	2	yes
GATCCTCACTGACAGATGGG	75	10	yes
GATCCTCACCCCGCCTGCTG	53	0	yes
GATCACAGTTCCTTATTGTG	68	2	yes
GATCCTATTCGTGGTTTGGA	103	7	yes
GATCCTATCTCGCCCAGTGA	106	6	yes
GATCACACTTACCAGTCAGC	2	2	yes
GATCACACTGTCTTGGAATT	2	2	yes
GATCCTAGCCAGATTACTAG	5	5	yes
GATCCTAGACTCTCCTTGTT	170	30	yes
GATCCTAGAAGTGGTCCTTG	7	8	yes
GATCCTACGCAGGGGGGACT	51	7	yes
GATCCTACCTGCTCATCTGG	8	9	yes
GATCCTACCAGCTACCACAG	26	18	yes
GATCCTAAGCAAATGCCTTC	6	5	yes
GATCCTAAGCAAAGGGACTC	227	11	yes
GATCCTAACTTGGAAACTGT	27	5	yes
GATCCGTTTCTCTCTGCCTT	56	6	yes
GATCCGTGTGAGGTGTGCTG	23	0	yes
GATCCGTGTCATTCACACAC	4	5	yes
GATCCGTCGGTGCCTGCTGG	116	30	yes
GATCCGTCCATGTCTGCCAC	81	50	yes
GATCAGAGCAAGGCTCTTTG	7	6	yes
GATCCGGCTTCCCAAGAGTA	48	3	yes
GATCAACCTGGAGTTGTATG	50	32	yes
GATCCGGACTTCTGGGGAGG	54	8	yes
GATCCGGACACGCTCCCCCA	295	29	yes
GATCACTGGCCTCTCTGAGT	3	4	yes
GATCAACACGCTCGAGTCCA	63	18	yes
GATCCGCTGGGAGCTCACAC	48	13	yes
GATCCGCGGGGCTCAGTGTG	156	36	yes
GATCCGCCTCTTCCTGGTCA	96	1	yes
GATCCGCCGTTCTCTGGAAC	48	9	yes
GATCCGCCAGGACCGAGAAC	41	6	yes
GATCCGCAGTTACATCAATG	11	2	yes
GATCCGCAGTGTCTTGGATG	114	16	yes
GATCCGCAGGCGCAAGGCCC	2059	116	yes
GATCCGCAGGCGCAAGGCCA	183	56	yes
GATCCGCAGCCGCCTAACTG	293	15	yes
GATCCCCGCGCAGAAGTAGG	759	24	yes
GATCTTCGTACTAGAGGCTG	9	1	yes
GATCTGGGCTTCCTGGGTGA	36	9	yes
GATCTGGGCTGTCACTACGA	185	12	yes
GATCTGCCCAGGGAAAGGGC	15	13	yes
GATCTGAGACTTTTGTGCAT	1	1	yes
GATCAGACAGAGGTCAGAGG	8	9	yes
GATCTCCAGGGAGACTCCAT	1	1	yes
GATCTCATCAATCGTCAGAC	2	3	yes
GATCTACACAGAGAAACCCT	22	3	yes
GATCGGCTCATTGAGGTGAA	65	14	yes
GATCTGCCCATCTCTGCTGC	7	1	yes
GATCGAGAGCGTGGATGACT	17	4	yes
GATCGACCGCATGGTCAGCC	36	5	yes
GATCCTTCTTGCTCATAAGC	42	0	yes
GATCTGCAACGAAATTCCAA	6	7	yes
GATCCTGTCCCACAAAGGAA	91	6	yes
GATCCTGAGCTTGAGGCTGT	14	1	yes
GATCCTGACACCTACACTCA	24	21	yes
GATCCTCTCCACACTTAGGA	4	4	yes
GATCCTCCCCACGTAACCCA	41	11	yes
GATCCTGATGCTGCCAAAGC	284	30	yes
GATCCCGAAGTCTGTGACGC	55	2	yes
GATCCCGAACTGTTCAAACA	18	3	yes
GATCCCAGCCATCTCAGCCC	48	10	yes
GATCCCAACGAACCCACATA	60	5	yes
GATCCAGTGTAAGCTGTTTG	3	1	yes
GATCCAGATTTTCCCAATAA	7	6	yes
GATCCACTAATGCTGAGCAC	20	3	yes
GATCCACAGCCCGTTTTGTA	11	0	yes
GATCGGCCGGAGCCCTTCCC	23	7	yes
GATCTGGGGTTAAAGGGGTA	12	10	yes
GATCCAAGCACTGACACTGG	197	4	yes
GATCCAACGCTACATGTATT	18	12	yes
GATCATATCCACCCTCCCAC	2	2	yes
GATCCTAGTTAATCATCAGC	8	10	yes
GATCAGTGCTACCATGGACC	9	11	yes
GATCAGCTGCTCACGCTGAT	65	9	yes
GATCCTGCACTCACCATGAC	17	14	yes
GATCCACTCCAAGTCGCACA	6	0	yes
GATCCCAAGTACTGCCTGAA	458	26	yes
GATCAAGAAAGAGATGGGAG	872	41	yes
GATCCAGTTTCATACAAACA	43	2	yes
GATCAACAACAGGGCATCGG	51	34	yes
GATCCCTGGCAATACAAAAA	37	4	yes
GATCCCGTCACTCAACATGG	52	3	yes
GATCTTGTGTGTGGGACTGA	133	159	yes
GATCCCCTTCTCAGGGTCTG	6	9	yes
GATCCCCTGAACTGCAGTTA	1	1	yes
GATCCGCACCAAGGTCATGG	39	8	yes
GATCCGCAAATACGGGCTGA	14	3	yes
GATCAAAAAGCGGAGAACAA	56	16	yes
GATCCGAGCCCCAGCGGGAA	24	0	yes
GATCCGAGAGACCAGCCAGA	446	311	yes
GATCCGAGACCTGGCAGAGC	162	3	yes
GATCCGAGAATTCCAGGACT	8	11	yes
GATCCGACTTCAAAAGGCAG	24	13	yes
GATCCGACTGTGCCCGGATG	1	1	yes
GATCTCTCTGAGGGGCTGAT	3	5	yes
GATCTTGATTTCACCGTTTT	8	7	yes
GATCAGTACCTGGGAAGTAC	5	5	yes
GATCCAGCACTCTCTTTAGC	9	7	yes
GATCTAACAGTCACACCATT	75	55	yes
GATCAAGCATTTGCGCCTGA	2	2	yes
GATCCCTTCTGAAGAGTCCT	6	0	yes
GATCCCTTCTAAGTGCCAGT	4	3	yes
GATCCCTTCCCTTCCTTGTG	50	5	yes
GATCCCTTCCCTGATGTTGG	76	9	yes
GATCCCTTATCGAAGTGTCT	3	3	yes
GATCTTTGGTGGATTGTGTC	4	5	yes
GATCCCTGTGGACAACAAGG	121	9	yes
GATCCCTGTCAAGTGGACGG	23	5	yes
GATCCCTGGACACTTACATT	18	1	yes
GATCCCTGCTTCCAGCTTCG	12	1	yes
GATCCCTGAATGCCAACCTG	55	16	yes
GATCCCTCTCTTGCTGTAGA	2160	71	yes
GATCCCTCTCCACAGGGTCT	36	4	yes
GATCCCTCTCACAGGCTTCG	8	9	yes
GATCCCTACTCCAAGGTGAA	2	2	yes
GATCCCTACCGATTCAAGAA	33	3	yes
GATCTGTGTGCAAAGATTTG	16	19	yes
GATCCCTAACCCTGGGCTGG	71	36	yes
GATCCCGTTCGAGACGCAGA	87	16	yes
GATCACCACACAGCGTCACT	2	3	yes
GATCCCGTATGCTTTCCACC	7	5	yes
GATCCCGGTGTATCATGGCA	84	68	yes
GATCCCGGTGGTGACCGTGA	17	12	yes
GATCCCGGCAAGAAGAGCAC	91	54	yes
GATCCCGCAGTGGCAAGGTC	102	24	yes
GATCCCGAGGGTGGCACTGG	9	11	yes
GATCCCGAGCAGACACTGCA	17	15	yes
GATCCCGACACGGACTCTGA	1	1	yes
GATCCCGAATTTTCCTAAGG	1	1	yes
GATCCCGAAACCCACCAAAG	25	1	yes
GATCCCCTTGATTGCCCTGA	40	4	yes
GATCCCCTTACAGCTGGCAT	25	10	yes
GATCCCCTCCCCTGGTGAAC	71	5	yes
GATCCCCTACAGTTTCTTCA	103	7	yes
GATCCCCGTTTTCTCTGCAG	115	10	yes
GATCCCCGCTGTGGCAGCCA	4	4	yes
GATCCCCCTTTTCAGCCCTG	150	18	yes
GATCCCCCTTACAAACACCA	14	1	yes
GATCCCCCTCTGGGAGAGCC	90	3	yes
GATCCCCCCTCTGGAAGGCG	95	9	yes
GATCCCCCCTCACTGACTGA	51	1	yes
GATCCCCCAGTTGTCACCCT	46	17	yes
GATCCCCATTGCTCCCCAGT	25	4	yes
GATCCCCATCTCCATCAACA	604	63	yes
GATCCCCAGGGCCTCAATGA	2	3	yes
GATCCCCAGCTTCTAGGAAA	1	1	yes
GATCCCCAGCCACAGAATGG	55	7	yes
GATCCCCAGAGGCTACCACC	8	0	yes
GATCCCCAGAAAGGTGGTCG	46	1	yes
GATCACACTGCCCAGAGGAA	18	3	yes
GATCCCCAAGACCAAGTTCT	36	6	yes
GATCCCCAAACCCACTCCAA	37	13	yes
GATCCCATGTACCCAGGAAT	15	1	yes
GATCCCATCCCCTTGCCACA	25	1	yes
GATCCCATCCAGCCCTCCAG	168	19	yes
GATCCCATCATGGGTTTCCA	28	24	yes
GATCCCATCATGCCCTGAGC	173	77	yes
GATCCCATAGCAAGAGAGGG	20	1	yes
GATCCCAGGAGAGTCTGCCC	2	2	yes
GATCCCAGCATGGTCAGCGC	86	61	yes
GATCCCAGCAGCAGCATCGT	1	1	yes
GATCCCAGCAATGAGCTTCC	65	10	yes
GATCCCAGAGACATCAGGCA	8	14	yes
GATCCCAGAACTTGGAAGCT	62	6	yes
GATCACCCTTGCAGCAAACA	1	1	yes
GATCAGTCACTCACAGAGGC	8	9	yes
GATCCCACTGGTTAGGAATA	53	4	yes
GATCCCACCTCAAACTCGGT	2	2	yes
GATCCCACCCTCACCCCACC	15	12	yes
GATCCCACATTACCTCTGCC	58	27	yes
GATCCCACAGGTCTTTCATG	92	13	yes
GATCCCACACAGGTGACAGG	8	10	yes
GATCCCAAGTGGCAAGAAAG	12	3	yes
GATCCCAAGGTTTCAACACA	46	15	yes
GATCCCAAGGGCCTCGAATG	12	1	yes
GATCCCAAGGCCTATGTCTG	462	40	yes
GATCCCAAGCTCATCATATG	45	0	yes
GATCCCAACCCTGAGAACTT	41	6	yes
GATCCCAACACAGCCTATGC	8	2	yes
GATCCCAAAGCACAATCTCC	131	3	yes
GATCCCAAACAGGCGCACGA	5	5	yes
GATCCAAGACAAGCAACAGA	1660	47	yes
GATCCATTGGTGGAGTATTC	15	13	yes
GATCCATTGCCTGGACTGAG	15	2	yes
GATCCATGTCTACCTCCAAG	25	9	yes
GATCCATGTAACTGTTCCAG	52	45	yes
GATCCATGCTGTGCGCTACC	92	14	yes
GATCCATCTCCCAGACTTAT	59	5	yes
GATCCATCCTGTAGTCTGAT	2	2	yes
GATCCATCCTAGGGTCTGTG	94	5	yes
GATCCATCCCCAGTGCCCCT	99	21	yes
GATCCATCCCACTTTGTCTT	34	7	yes
GATCCAGTTTTGACAGTGAC	116	0	yes
GATCCAGTGTCCTGAGCAAG	13	2	yes
GATCCAGTGTATTTGGTGAA	11	3	yes
GATCCAGTGGTTGGAAGAAA	60	10	yes
GATCCAGTGCTTCAATGATG	6	5	yes
GATCCAGTCGAGAAGGACGC	57	1	yes
GATCCAGGTGCTGTGGACTT	25	3	yes
GATCCAGGTGAAGAACGAGG	1822	179	yes
GATCCAGGGTCCTGCATCGG	19	27	yes
GATCCAGGGGCTGCAGCAGT	172	38	yes
GATCTCAACAGGGTGTCGTA	54	3	yes
GATCGCCCGGAATTTCTATG	22	7	yes
GATCGCAAGGGGCCTGAATT	8	4	yes
GATCAAACTGTAGGGAAAAA	37	26	yes
GATCGACAACTTCGCCCACA	1	1	yes
GATCCTGTAGGTCAGATGGT	1	1	yes
GATCAGCAGGGGAATGAGGA	83	21	yes
GATCAGACAGGGTGGTGGTT	2	2	yes
GATCTGATGTCCCCTTCTGA	9	8	yes
GATCACCCTCTCCGGTCCCA	1	1	yes
GATCTGAGCCAAGCTTGGAA	14	12	yes
GATCACAGAATGGACAGGAA	49	24	yes
GATCACAAAAGGCCTTGCAA	29	25	yes
GATCCTCTCTCTAGGGCAGC	30	4	yes
GATCCTCCTTTGAAAAAGTC	45	21	yes
GATCAATACCAAAAGACACG	4	4	yes
GATCTTTGGTTTCGTGGCCA	33	1	yes
GATCTTTGACAACCCTGTGG	14	16	yes
GATCTTGTTTTGAACTCAGA	23	20	yes
GATCCATCTTGTGTCCCTCT	54	10	yes
GATCTCTTCCCAGCCGTGGA	12	10	yes
GATCTGTGACAAGAACCTGG	11	13	yes
GATCACATCTGTGTCACTGC	11	13	yes
GATCAAAACTCAGCAATAAT	14	13	yes
GATCCGCCCTTGTGCCCACT	41	3	yes
GATCCCCACGGCTGGTCTGA	25	8	yes
GATCTGGTGCCCTGCTGCTT	44	14	yes
GATCTGGGGTAGATTCTGAT	360	197	yes
GATCTGGAGGAAGCCTGAGG	445	68	yes
GATCTGGAGACCCCAAAGAG	8	7	yes
GATCCAGTTCTAAGCAGATT	510	87	yes
GATCTGCTCAGGGTCTACAG	69	4	yes
GATCTGATGTGTTGAAGTTG	6	5	yes
GATCTGCTGGCTGTCAGGGG	26	7	yes
GATCTGAGACTTCTCCTGCT	13	11	yes
GATCTGAAATGAACCAGCCC	705	527	yes
GATCCAAACATGAAAGCTGG	35	10	yes
GATCTGCTCCTGAAAAAAAA	28	8	yes
GATCCAGCTGCTCACGCTGA	110	9	yes
GATCCCACATAACCAGACGT	10	3	yes
GATCCTGGTTCTGTTCTGAC	18	15	yes
GATCCAGAGGGGACTGATAA	50	0	yes
GATCAAGCTACAGATATGGG	50	38	yes
GATCTTTCGGACTCTGGGGA	18	12	yes
GATCTTCTCTGCCTATATCA	3	3	yes
GATCAACTCGAGCGCCATCA	14	12	yes
GATCTGTCCTGTGACACAGA	79	16	yes
GATCAGTCACCAATGGCACT	874	1211	yes
GATCTGGCCCCCATGTGTGG	13	11	yes
GATCTGACTTTCCAGAGCTG	138	3	yes
GATCTGGGCCTGGAGAGACT	176	16	yes
GATCTTTTGGATGAAAGGAC	15	18	yes
GATCTGGCTACGTCTCCAGG	28	3	yes
GATCCTTTTGGTTTGGACAA	10	1	yes
GATCTGCAGATGCTGTCCTC	216	147	yes
GATCTGGAACTTCCTGAGCA	25	5	yes
GATCTGGAAAATGAGTGTTT	11	0	yes
GATCTGCTTGCCTCTGCCAC	13	11	yes
GATCTGCTGAGGTGGAGAAT	26	0	yes
GATCCGGTCTGCTCCGAGCT	24	21	yes
GATCTGCTACTCTGTGTTGT	2	2	yes
GATCTGCGGATGACTGCAAG	3	1	yes
GATCACTTCTGAGGCTCCGT	41	6	yes
GATCACTTCATCTCCCTTCA	4	4	yes
GATCCAGGAGCACCTGCCTG	33	8	yes
GATCCAGGACTACAAGCATC	5	3	yes
GATCCAGGACAACGCCACGG	77	5	yes
GATCCAGCTTCAGGGCCAAT	11	19	yes
GATCCAGCTCATACCCCTGC	6	5	yes
GATCCAGCTAGTCCTCAAAC	1	1	yes
GATCCAGCCTAGATGGGGGT	11	13	yes
GATCCAGCCCTCCTTTGCCT	39	3	yes
GATCTGCCCGCCTGGCGCGA	13	4	yes
GATCTGCCCAGCTCTGCCTC	8	7	yes
GATCCAGAGTCGGTCAGCTC	8	7	yes
GATCCAGAGTCCCCGTATTC	7	8	yes
GATCCAGACGGCCACCCGAG	8	7	yes
GATCCAGACCGTGAGATGTT	66	13	yes
GATCCAGACCAATCCAGTGT	9	4	yes
GATCCAGACAGCACCCACTG	7	8	yes
GATCCAGACAGCAATCCTTA	37	10	yes
GATCCAGACACCCAGACTAT	43	10	yes
GATCCACTTGTCTTCGGAGA	15	5	yes
GATCTGAGATGAACATGGTG	1	1	yes
GATCTTTGCCGGCAAGCAGC	3156	1739	yes
GATCCACTGGGAGAGAGTGG	52	10	yes
GATCCACTGCCAGTGGTGTG	5	3	yes
GATCCACTCCTTACCGTTTT	103	32	yes
GATCCACGTGGGTATCCTGA	82	9	yes
GATCCACGTGCTCCCACATG	64	2	yes
GATCCACGGGGTGCCCGAAG	10	9	yes
GATCCACGGAGTGCAGCAGA	3	3	yes
GATCCACCTGCCTTTGTGAG	75	15	yes
GATCCACCGAAGGACATCTA	532	63	yes
GATCCACCCTCAGGCACCAG	131	12	yes
GATCCACCCGGCACACAGGA	7	6	yes
GATCCACCCACCTCTGTTAC	224	41	yes
GATCCACCTGCCTTGGAAAA	1	1	yes
GATCTCTGCTGCCACCAGAT	87	25	yes
GATCTCTGCCTCCAAATATG	13	2	yes
GATCTCTCTCTTTCTTCTGA	4	5	yes
GATCTCTCTCACTTCTCTGA	141	31	yes
GATCCACCAGTGCTCAGCAC	35	1	yes
GATCCACCAGTATTACCCAG	24	21	yes
GATCCACAGCGATATCCAGA	23	10	yes
GATCCACACTGGACAGTTCG	9	4	yes
GATCCACACAGGAGAGCGGC	79	5	yes
GATCCACAATGTATCTGGCT	2	3	yes
GATCCACAAGTACCACCATG	1	1	yes
GATCCACAACAGTGCGTGGG	190	41	yes
GATCCACAAACTGGTTCTAC	20	17	yes
GATCTCTCGAGTTCAACCAG	1	1	yes
GATCTCCTTCTCCAGCACCA	7	8	yes
GATCTCCTGTTTTAGTCTCT	3	3	yes
GATCAAGATGTGGAACCTGG	9	11	yes
GATCCAAGCCCGGGGCCCGG	63	18	yes
GATCCAAGACCAGAGGGACA	74	2	yes
GATCCAAGAAGGTTTCTCTG	58	13	yes
GATCCAAGAAAGCGCCAAGG	41	12	yes
GATCCAACTGGCAGGAACCA	20	12	yes
GATCCAACGGAAGCCTCTGC	180	31	yes
GATCCAACGAGGCGCCCTGA	11	4	yes
GATCCAAAGCACATGTTTCT	43	3	yes
GATCAACAAGGACAAGGAGG	34	10	yes
GATCTCCATGAGTGCGAAGC	13	2	yes
GATCTCATCTTCATCCACTT	25	5	yes
GATCTCAGCGCAATTACAGT	3	1	yes
GATCCAAACCATCTTCCCGG	18	13	yes
GATCATTGCTCCCCCTGAGC	4	4	yes
GATCATTCCCTGGGTTGGTA	103	12	yes
GATCTCAGCAACCGTGGTAG	338	10	yes
GATCATGTGTTCCGCTGGCT	134	18	yes
GATCATGTCTATGCTATCCG	1	1	yes
GATCATGCCTTGGCAGAGCG	18	1	yes
GATCATGCCCTATGGTGGGT	29	7	yes
GATCCAGCAGCTGCTTAGCA	14	9	yes
GATCATGCACTGGGTTGGCT	31	1	yes
GATCATCCTCACTGGGCGCC	20	24	yes
GATCATCCGTGAGGCGTACA	19	16	yes
GATCATCCCGTTGCAGACTC	12	10	yes
GATCATCCCCTCTGAGAAAC	147	38	yes
GATCTTAGCCTCCTCGGTCT	11	9	yes
GATCATCCAGTCCAACGGGC	349	67	yes
GATCATCACACCAAACTCTG	47	5	yes
GATCATCAAACAGGGCTTTG	20	17	yes
GATCATAAAAGCTTTTCCCG	8	9	yes
GATCCTCAATCAGTGGGTGG	54	10	yes
GATCTGGGGAAAGGTAACTA	320	258	yes
GATCCGAGAAAGCTTTGAGG	2	2	yes
GATCAGTTCCAACATCAGCT	60	22	yes
GATCAGTGTGATAGGCTCCT	5	5	yes
GATCAGTGTCAACTGCTTGT	45	33	yes
GATCAGTGCTGTCTACTTTG	131	14	yes
GATCAGTGCCAAGGATGCAG	22	18	yes
GATCAGTCTGACTGTTCTTG	2	3	yes
GATCAGGTGCCCATGGAGTT	25	22	yes
GATCTTTACTTGCTGGAGAA	10	12	yes
GATCGCCAGGGCAGTGGTAG	2	3	yes
GATCCTAATCTATGAACCAG	9	6	yes
GATCAGCCACTTCTCAGAGC	35	3	yes
GATCTGTGTTACCCATCCAT	11	4	yes
GATCACATTTTGAAATGCCT	6	2	yes
GATCTCCTCTTGTTCCCCTT	83	3	yes
GATCTCCCTGGCCGACATCG	31	27	yes
GATCTCCAGAGACCATGATT	9	8	yes
GATCTCAGAGTGAGAAGCAT	41	30	yes
GATCTAGTGGAGCCATGGGA	11	9	yes
GATCCCCACTACCTCCAGCT	11	9	yes
GATCTAGGCTGACCTGAGAG	47	9	yes
GATCTACACTGCCTGGCACA	24	5	yes
GATCTCAACACAGACTCTCA	162	17	yes
GATCTGCCTGACTTCCCTGG	85	69	yes
GATCCGCAGAGAACTGTTCA	17	11	yes
GATCTAAACCTGAATGACTG	163	12	yes
GATCGGACAACCCCATGGAG	47	41	yes
GATCGCCTGGATGGTGCTTT	525	52	yes
GATCGAGAAGATAGCCGAGC	12	9	yes
GATCCTGTGTTACCCGGCAA	325	6	yes
GATCCTGTACCATCTGCAAC	34	0	yes
GATCCTGGTGGCTGTGGTGA	16	13	yes
GATCTGCCTTACGTGCACGG	26	19	yes
GATCCCTGGGCTCGGGCGAT	31	19	yes
GATCCTAAGGGTTCCTATGT	1	1	yes
GATCCTGCAGGCCCACAGCC	6	5	yes
GATCCTGCACTCACACTTGG	83	14	yes
GATCCTGATACTCTTGACTT	21	2	yes
GATCCCGGGGACACACAATT	42	3	yes
GATCCTCTTCTGGCTTCTTT	4	1	yes
GATCCTCTTCCTGACTCGCA	39	5	yes
GATCCTCCTGGGAGGACAGG	231	61	yes
GATCACCAAGCAGGAGTACG	1900	103	yes
GATCCTCCCCGCCCCCCGAT	31	4	yes
GATCCACTGTGAAGGATGGC	1004	124	yes
GATCCTCAGCAGAGGTATTC	18	4	yes
GATCTTCACTTTGTTGAGAG	3	3	yes
GATCCTAACCCTCCTTTTAC	10	1	yes
GATCCGTCTAGCCCGACAGA	34	9	yes
GATCCGCCCAGGAGGCTCCA	8	9	yes
GATCCCTTGGGAGGTAGGGG	10	2	yes
GATCCAGACAGAAACTTCAG	8	2	yes
GATCTCTAGAAGTTGAAGTC	4	5	yes
GATCCCTCTACACACTGTCA	15	0	yes
GATCCCTCGCTGAGAGCCCG	51	2	yes
GATCCCTCACTGTGGAATCT	56	3	yes
GATCCCGCCAGCGTTCTGTG	58	11	yes
GATCCCGAGTTCAAGGCCAG	20	6	yes
GATCCCCTGGAACTGTAGTT	1	1	yes
GATCCCCTCACAGTGAAGGA	11	4	yes
GATCCCCTCAAAGCTCAGGC	94	5	yes
GATCCTGTGTGTGGGAATGA	488	92	yes
GATCACAACAAATCTTCCAA	7	8	yes
GATCCCCATCTGCGAGCCAC	3	3	yes
GATCCCCAGGGCCCAGACTC	37	1	yes
GATCCCCACCTACGGGTTGG	163	27	yes
GATCGCCTTCAAAGAGAAAT	9	11	yes
GATCCCATTCCTCAAGACTA	47	14	yes
GATCCCACTGATGCCAAGTA	193	9	yes
GATCCCACTGAGACTTAAGC	102	22	yes
GATCGCAAAATTGGACAAAC	1	1	yes
GATCCCAACTCGACGGTCCA	65	17	yes
GATCCAGTCCTGCAAATGTA	1	1	yes
GATCCAGGAGTTCAAAGAAG	514	88	yes
GATCCAGGAGGTCTCAGGAC	20	1	yes
GATCCAGCTGGACAAGCTCA	79	36	yes
GATCCTCCCTCCCCAAGTGG	29	3	yes
GATCTGAGCCGTTCTGCGTG	86	33	yes
GATCTGACATCCCTGAGGGG	6	5	yes
GATCTGAACTTGAGTTAGGG	8	4	yes
GATCCTAGTGGGTGAAGCAA	75	5	yes
GATCGGCCGGAGCCCTTCCT	12	17	yes
GATCCACATCCAGCAGCAGG	9	1	yes
GATCTGTACTGGGGAATTGA	2	3	yes
GATCCTGAGGGCCATGCTGA	149	21	yes
GATCCTCTTGGCTTAAATGT	15	21	yes
GATCCTCACCACATACCCAG	19	16	yes
GATCTGCCGCTCCCTCTACA	3	3	yes
GATCGACCAGCTCTGTGCTA	9	11	yes
GATCCTGACTACTGGGAGAA	6	5	yes
GATCGAATCCGGTTCCTTAA	13	15	yes
GATCAGAAACTCCTGTGGGC	1	1	yes
GATCCAACTCCAATTCAACA	80	19	yes
GATCCCTTACTTCTTTCAGG	28	3	yes
GATCTACCCGGGACACGGGC	1565	220	yes
GATCCCTATGGTTCAGGAGG	52	1	yes
GATCAGCCCTACAGTGTATT	43	4	yes
GATCACTAGGTAGGAGCAAC	1	1	yes
GATCGTGGCTCCCATCAGTG	218	9	yes
GATCGTCGTTCTGGTAGGAA	9	11	yes
GATCCCATCCCCTGCAGAGG	18	13	yes
GATCCCAGGTCACACCTATG	88	8	yes
GATCTTGCAAGGGGAAAACT	195	39	yes
GATCACTGTCCTGCGGCAGC	3	3	yes
GATCACACAGGACCATCAGG	13	2	yes
GATCGGGCCGCTGCTGACTG	186	28	yes
GATCCACCCCAAGGACTGCG	4	4	yes
GATCGCTTTGATGACCACAA	100	20	yes
GATCGCCGGATTGGAACAGA	14	12	yes
GATCGCAGAACCAGGGCATC	129	111	yes
GATCCATGCTGGGGCTGGGC	23	16	yes
GATCCATGCGAATGTTTCAG	2	2	yes
GATCCCACTTAGGATACCAT	20	24	yes
GATCAAAGGAGCTCAAGGAC	206	153	yes
GATCCATGACATCCGCTGGA	341	22	yes
GATCTGCCTCCAGCGATACC	4	5	yes
GATCCATGAGTACTACAGCA	324	57	yes
GATCCTTGGGGACGTCTTTT	4	1	yes
GATCCTTGCTGCAAAGCTTT	2	1	yes
GATCCTTGCCTTCTGGCAGA	8	0	yes
GATCCTTGCCGTGGCAGCTG	3	1	yes
GATCCTTCCTCGGGCGACAT	7	1	yes
GATCCTTCCAGAAAAGCCTT	1	1	yes
GATCCTTCAAGGACTGGCTG	149	30	yes
GATCCTGTTTCTTTTCTGTT	1	1	yes
GATCCTGTTGTTTGCTCCTA	9	4	yes
GATCCAGTTTGTCCTGGTCT	208	43	yes
GATCTGAAATGAACCAACCC	44	53	yes
GATCTCTTCCGCTCTCCTTC	48	34	yes
GATCCTGGGGTGGTGTGGGG	43	4	yes
GATCCTGGGCCGCCTCCATT	20	8	yes
GATCCTGGCTTGGGGTGCTT	37	9	yes
GATCCTGGCGTAGTTCCAGA	1	1	yes
GATCCTGGCCCGGCAGCTGG	43	4	yes
GATCCTGGCCAAGCACCCGA	143	18	yes
GATCCTGCGGAAACGCGAAT	105	20	yes
GATCCTGCCCTTCATAGAGG	20	12	yes
GATCTTCCCGTTGGCCGCTC	968	416	yes
GATCTCTGGCAAACAAAACA	7	6	yes
GATCTCGGGGAAACTCAGCG	260	12	yes
GATCCTCTCCCCCACTGGCA	136	10	yes
GATCCTCCCATCTCCCTCTT	8	9	yes
GATCCTCAGTTCCTGTTGTT	64	1	yes
GATCATCAGAGCCACAGCTA	30	26	yes
GATCCTATCCAGCTAGCTCT	73	63	yes
GATCCTAAGCCCAGGGCTGT	52	12	yes
GATCCGTGCCATGGACGAGA	6	5	yes
GATCTCACCCAAAGGCAGCC	31	23	yes
GATCTATGAAACCACCGTGG	13	15	yes
GATCCGAAGCCTCCTGGTGT	9	8	yes
GATCCAGCAAGTCACCATGC	33	4	yes
GATCCCTTCTATTCTGAAGG	17	13	yes
GATCCCTTACCTGGATGGAA	2	2	yes
GATCCCTTACAGAAACAGTC	6	5	yes
GATCCCTGGGGGAAGCAGAT	61	23	yes
GATCTGCACTTAAGGTGAGA	11	7	yes
GATCCCTGCTCCTCCTCAAG	945	216	yes
GATCCCTGCGTAGCCCCTAG	39	33	yes
GATCGCTTCTGCCTGGGTGG	2	3	yes
GATCGCTTCATCAATGGACT	3	1	yes
GATCGCGGGCTCGGCGGCAA	2	2	yes
GATCTCTGCGTCTGCTTTGG	174	16	yes
GATCCAAAGCCAAAGCCGAA	47	7	yes
GATCAGCTGGTCCAGGCAGA	18	21	yes
GATCATCTTCACCTACTACA	7	6	yes
GATCATGTTGATAATGCTCG	226	2	yes
GATCCTGGGCTAGAGTTGTG	224	20	yes
GATCAGGACCCTCGTACAGC	19	16	yes
GATCAGTGTCGACTGCACAG	12	12	yes
GATCACCTTTGACAGCATGA	19	4	yes
GATCTGCCAGTGTGACTTCC	42	6	yes
GATCTACGCTCACCTGTTCG	10	1	yes
GATCTGTACCTTCTTCGAGG	9	11	yes
GATCTGCTGGGTCACCAAGG	64	12	yes
GATCTGGCCATCTGGGGCAC	22	19	yes
GATCTTGCCAAAGCAGTAGC	4	4	yes
GATCCTGGTAAACCCTGTGT	9	13	yes
GATCTGCCTGTCTCTGCCTT	40	34	yes
GATCGTGGAAATGGGAGAGA	23	20	yes
GATCCTGAGGATTAACCGTG	3	2	yes
GATCCTAGCCTAGGACACTG	88	69	yes
GATCGGCTCCCGGAGGAGCA	33	3	yes
GATCGCTGCCCTGCTGGCTA	64	6	yes
GATCCTTGGGGTGGGACCCC	6	7	yes
GATCTCGCGCCAGGAGCTGG	248	31	yes
GATCTGCCTGGGAGGATGCA	10	9	yes
GATCCTGGGGGAAAAGGGAG	21	2	yes
GATCCTGAGGACCTGGACAG	11	5	yes
GATCCAAGACAAGGAAGGCA	15	5	yes
GATCTCGAGAGGCTTTGTGG	85	67	yes
GATCTCCTCCATTCCTAGCT	174	123	yes
GATCTCATCATGGCTCTGGC	6	7	yes
GATCTGCCTGTCTCAGCCTC	5	8	yes
GATCTCACTGGTCCCGGGAA	160	33	yes
GATCATAGAAGGTTGGGGTT	25	18	yes
GATCATCCTGTGGCTACTAG	53	44	yes
GATCCTGAGATTCCTGCAGC	22	1	yes
GATCCCGACTCCACACCTCT	3	3	yes
GATCCCCGACCCAACATTTT	3	2	yes
GATCCCCCTGGACAATGTGG	28	6	yes
GATCCCCCCTTCCCTGGGCA	453	41	yes
GATCGCAAGTACACCCTAAC	50	36	yes
GATCCCCACTTATGTGACTA	104	119	yes
GATCCCATTGGCACTCTCCC	22	1	yes
GATCCCATCTGAGGTGCCAC	4	4	yes
GATCCCAGTACGACTACGTC	64	8	yes
GATCAACCCTCCTAACTGGA	10	9	yes
GATCAAACTCAGGTGGGCAG	44	32	yes
GATCAGTTTGCGAGTTTTGA	15	11	yes
GATCCCAGGATGCCCCTGCC	2	3	yes
GATCGAGGAAACCAAGCCTC	2	3	yes
GATCCCACGCCAGCGTCCAC	139	60	yes
GATCCCACAGTTTACACTTG	103	4	yes
GATCCCACAACCACTCCAGG	1934	60	yes
GATCTTTCTTCCTGAATGTG	20	24	yes
GATCCATTGCTCCAGGACAA	12	9	yes
GATCCATCAGGGGCAGGCAT	6	6	yes
GATCCAGTGTGCTCAGTAGA	9	6	yes
GATCCTCCGAGACATTGCAA	4	5	yes
GATCCTCAAGCCCGCTGATA	7	1	yes
GATCTGTGTAGGTGAGGTGG	49	6	yes
GATCACACAGGAGACGAGGT	38	27	yes
GATCCAGGTGTGCGGGCACA	23	2	yes
GATCACCCTCGACCTGCCTG	72	8	yes
GATCCAGGCCCTAGCACTCT	51	6	yes
GATCCAGCTCAGCCTGGGGG	196	19	yes
GATCCAGCCCTGAGACACTG	438	38	yes
GATCCAGAGCAAACACTGGA	11	9	yes
GATCCGGTCCCTGCCCACCA	400	32	yes
GATCTGTTCTTTCTCCCAGG	28	24	yes
GATCCGTTCCTTTTCCTGCA	42	7	yes
GATCCGAAAAGGCCGAGACC	62	13	yes
GATCCTGTGCCACAGCTCTT	26	4	yes
GATCCCTGTGCTGAAGGCAG	8	2	yes
GATCCGAGGCCACCCTTCAC	224	84	yes
GATCCACTGCCTCCTTGTTC	112	14	yes
GATCCACCACAGGATGTTTT	6	2	yes
GATCCAATTCCAGGAGGAAC	5	3	yes
GATCCCTGATTTATCCATCC	11	13	yes
GATCCCCTCTCGGCCCCACA	1	1	yes
GATCTGTACTGACCCCAAGC	3	4	yes
GATCATTTTCCCAACGTTAG	1	1	yes
GATCCCCGATTTCTAGCGTA	21	2	yes
GATCCCCAATGCTTCGCAAC	77	15	yes
GATCCCCAACACGAGGACCT	90	29	yes
GATCCAGGACAAGGAGGGCA	18	2	yes
GATCCGCTGGCAGAGTCTGG	61	16	yes
GATCATTGTTGCCCATGTGC	7	6	yes
GATCCCTGCTTCCTGCCCAC	46	52	yes
GATCCCACGTATCCTGGGCC	1289	354	yes
GATCCATTATCAGGGTGTGG	293	20	yes
GATCCATCAGGTGCAAAGTT	31	5	yes
GATCCAGGCCAAGTACCTGG	32	37	yes
GATCATGCAGATAAGTCTGT	9	8	yes
GATCATGATGGAGAAGGTGA	3	3	yes
GATCTGGTTGGAAGTGGTTT	19	2	yes
GATCATCTGAACCTGATGTT	2	3	yes
GATCATCGTCCGCTTCGATG	62	17	yes
GATCCACGTCTCTCGTTCAA	35	1	yes
GATCCACCGGCAGTACGTGG	39	25	yes
GATCCACCACTTCTACCACT	7	6	yes
GATCACAGACTCCAGCTTCC	319	226	yes
GATCATAGCTGCTGTGTGCT	7	1	yes
GATCTGGCCTAGCAGCTCAA	20	24	yes
GATCATACGAGGAGGCGTTC	38	44	yes
GATCAGTTGCTTTGAGTTTC	5	3	yes
GATCTGCTTCACGCCCTCTG	7	6	yes
GATCTGCTGCAGGGTTCTGG	11	2	yes
GATCCAACAGTGCAGTAATT	83	13	yes
GATCATCCCCACGCTGGAGC	18	13	yes
GATCAGTGCCTTTGGCTACC	13	9	yes
GATCAGTGGGAAGAGCCCCC	15	17	yes
GATCAAAGCCTCTGCTGCTG	1	1	yes
GATCACCAATCACCAACACT	3	1	yes
GATCAGGAGTTCAAGGCTAG	7	8	yes
GATCAGGACACTTAGACTCA	14	12	yes
GATCACTGTGAAAAGGTCAC	2	3	yes
GATCTCCCTGAATCTCAATA	24	21	yes
GATCGGCTTCATGCTGTGTA	12	1	yes
GATCAACACAAAGCACAATG	29	25	yes
GATCTTTCTTAAGTTCCTTC	1	1	yes
GATCAAGGCTGGAAAAGCAG	4	5	yes
GATCTGGGGGAGATGGAGGG	256	61	yes
GATCCTCAAACAGTCTGACC	4	4	yes
GATCCCCTTCCTTCTACAAA	4	1	yes
GATCCGACTTTGTTTTGGAA	7	1	yes
GATCGCTGAGTTCAAGGCTG	9	1	yes
GATCCCTACCCTCTTTCCCA	1	1	yes
GATCAGCACTCCCCACAGGT	7	6	yes
GATCAAACAGAAGCAGCCGT	2	2	yes
GATCACTCCAAACCCTTGCT	15	7	yes
GATCATGCTAGTCTTTGTAC	144	79	yes
GATCATTTGCGCGCCCCATG	74	9	yes
GATCCTTTGGAAAAGTACCG	48	4	yes
GATCCTTTAGTTGGGTTTGG	6	2	yes
GATCACCACTGCCGTCTCTG	19	7	yes
GATCCATCCGTTCAGGCAAT	7	1	yes
GATCACCTAAGTGTCTCCTT	1	1	yes
GATCGCCAAAATCCCAAATT	64	2	yes
GATCATATCCAGCCCAACTC	5	4	yes
GATCGGTCTCTGCAGAGTGT	36	1	yes
GATCGGCAGAACAAACCAAC	391	72	yes
GATCCAGCTGGTCTCCGTTA	5	3	yes
GATCTGTCCTGTGCTTGACG	8	0	yes
GATCGCCCGCTGCCGCAGCT	49	5	yes
GATCCCACATTCCATGCCCA	53	43	yes
GATCCAGAAACTGGAGGCCA	25	3	yes
GATCTGGCCTTGGCAAGCCA	17	3	yes
GATCTGGCCTCCCTCCCTTA	9	8	yes
GATCAGGTTGCGGATAGACT	8	7	yes
GATCATGGGACTCCCTTGCA	29	25	yes
GATCCATCCTAGCCGGGAGG	3	5	yes
GATCATCACCAGCAGCATCA	63	18	yes
GATCATCAGCGTAAATGGGG	417	14	yes
GATCACTCAGTCTTGAGGTT	45	7	yes
GATCAGCCTTTTCGTGCCTT	18	2	yes
GATCAGCCACTAGCTGGAAT	14	4	yes
GATCAGCATTCTCTACAGCT	77	11	yes
GATCAGACCCACAGGGACCG	13	15	yes
GATCAGAATAGCCACGTTTG	189	95	yes
GATCTGACTATTGGCTGAGC	4	4	yes
GATCCAGTGACATCCTACCG	7	6	yes
GATCACTGTCTGGAAGCTCA	35	1	yes
GATCACTGAAATGTGCCAGC	7	6	yes
GATCTCTGGGGTTCAGGTGA	2	2	yes
GATCACTAGGACAGGAGGAG	8	9	yes
GATCACCGCGCCCACCACAA	9	1	yes
GATCACCCCTCAGTCATTTG	7	1	yes
GATCGCAGACTTTGGCCTCT	87	0	yes
GATCTGCTGGACCCTCGGCA	3	3	yes
GATCCAGAGAAAGCAAAGGA	15	22	yes
GATCGCCCAACTAGAGGAGG	708	31	yes
GATCTGCCTCCCGAGTGCTG	20	1	yes
GATCACACCGAGGCTCCAAG	8	0	yes
GATCACACCATTCCTGAAGT	11	0	yes
GATCAATACAAATGCCTTCA	19	16	yes
GATCAAGGTGCGCAGGCGCG	22	19	yes
GATCAACCAGGCATTGGGCA	5	6	yes
GATCAACCTCTTAGAGCGTT	13	11	yes
GATCAAACGCCTGTTTAAGG	6	5	yes
GATCAAGGCAGGACGCCACT	22	19	yes
GATCAAGGAGGAAGGGAACG	2	3	yes
GATCAAGCCTGGGATGACGA	1	1	yes
GATCCTGACGGTGCAGCAGC	6	2	yes
GATCGGCCCAGTGTCGGGGG	8	9	yes
GATCGGCCAGCGCCCTACAA	2	2	yes
GATCAAACGCTCTTGCAGAC	104	21	yes
GATCCCTGGAGGCTCAGAGT	201	15	yes
GATCATTCTCACTCTTCCTC	16	19	yes
GATCTGTGTGAGAGAGAAGT	43	32	yes
GATCTGCGGGCTTCCATTTC	23	5	yes
GATCGTGGAGATGCTGGTGC	123	106	yes
GATCTGCCCCAGTGAAAATG	44	5	yes
GATCCTCTAGGACTCATGTA	3	4	yes
GATCCTGGGCAGCAGGATGG	1	1	yes
GATCGCCATCTTCCCCTACG	6	0	yes
GATCGCCACCTACAGGAAGC	7	6	yes
GATCCAAAAGCAAACACCTG	6	0	yes
GATCCGTCTGTATGCCGCCA	8	12	yes
GATCCGCAGGGGCTGGTTGA	26	0	yes
GATCCTGGGGAGTTACTTAC	60	6	yes
GATCGAATCCCTGATGAAGG	49	34	yes
GATCCCTCAGTTACTCACCC	35	4	yes
GATCGAAAACATCACAAATG	168	5	yes
GATCCTTAGTAAGGCAATCC	40	11	yes
GATCCTGTGACTCGGAATGG	56	4	yes
GATCCTGGCTCGGAATTTTG	3	2	yes
GATCACCTCGCCAAGCACGT	55	47	yes
GATCCCCTGGAGCCAAGGTT	4	5	yes
GATCAAAAACCTGCGGGAAG	1	1	yes
GATCCATTAGCCAAGGACAG	2	2	yes
GATCATCATCGGGAAAAGTA	50	3	yes
GATCCCCAAGAAGGAGAAGC	6	2	yes
GATCCCATTACAGAAGGTTG	4	4	yes
GATCACAGCCGGTCCTGTAG	15	18	yes
GATCCCGGCCGTACGTGCTG	3	4	yes
GATCCATACTACAGCTACTG	8	9	yes
GATCAGAGGAAAGTTCACCA	33	39	yes
GATCCAGGCTGAGCGAGCAG	115	10	yes
GATCCTGGCTGAGCGAAACC	32	0	yes
GATCAATTACGGGATGACAA	5	7	yes
GATCACTGCTGATAAGCCCT	2	2	yes
GATCCCAAGACCGAGCTGCT	15	2	yes
GATCCATTCAGAGAACCTCC	10	9	yes
GATCCATATGCTAGCACCAT	1	1	yes
GATCTATCACCTGTCACCAT	308	85	yes
GATCCTGCACAGGTATGAGA	18	10	yes
GATCACAGAACTTGTGCAGG	3	3	yes
GATCCTTTAGGGCTTTGTCC	20	17	yes
GATCCTTCCCACAAGACCTA	3	5	yes
GATCAAGGAAGCCCAGGGAC	2	3	yes
GATCCTGGTGAGAGGAGAGG	62	4	yes
GATCCACCGCTATGTCCCTG	6	5	yes
GATCCACACTTCCCTTCCTG	7	1	yes
GATCTGCTCAGACTGGAAGG	10	3	yes
GATCACCACCTTCATCGATG	8	0	yes
GATCCTGCGGGAACGCTTTG	19	7	yes
GATCCAAGCCTGAGGAGAAA	162	24	yes
GATCATTCTGCCAAAATACT	3	4	yes
GATCCTCCACCACACCTGCC	19	4	yes
GATCCTGTTCTAGAGGACAT	2	4	yes
GATCTCACTGAGGAATTTGT	8	10	yes
GATCCTGAAGACTCTGCCTG	300	33	yes
GATCCTGGAACAAGCATCCA	6	7	yes
GATCCCAAGGTGACTTTGAC	18	5	yes
GATCCCCTTTCTCTACAGTC	1	1	yes
GATCAGCACCCTGTGCCCAT	142	16	yes
GATCCGGCAGCAGCAGTACA	110	9	yes
GATCCCACAGTTGAGTGAAG	3	1	yes
GATCCATTCTGTTCATCCTT	67	1	yes
GATCCGTCGCCACTGGGGAC	7	12	yes
GATCCAGATGACCGTGGTGG	174	0	yes
GATCCACTATCAGAAGAACT	22	6	yes
GATCCACCAAGAAGATTGCT	7	1	yes
GATCCTGGAGCTGGCGGGCA	401	39	yes
GATCCCAAGTCTCCATCCCC	24	2	yes
GATCCATCAGGAAGTAGAAG	2	4	yes
GATCTACAGGGGCTTTGAAG	6	5	yes
GATCCCTTCAACCAGTGACC	3	4	yes
GATCCCCAACAACGTCAAGA	96	3	yes
GATCTTTGCTTGTGGCAGCT	6	5	yes
GATCTTTCTTGGTCTGAGGG	139	24	yes
GATCTGACCTGGCTCCGCCC	57	67	yes
GATCTGTGAAAATTGAAAGC	6	7	yes
GATCCATCTGCATGTGCGGC	136	150	yes
GATCAGTGTTTGACAGCCCT	15	10	yes
GATCTGTGTAAATGGGGACG	353	73	yes
GATCTCAGTGGTCCAGGACA	4	4	yes
GATCTGGCTGACCTGGGGGC	3	3	yes
GATCCTCAGCTCGGTGGTCT	144	19	yes
GATCCTAAAGATGGTTCTAG	63	3	yes
GATCCGACACCCTCGTCTGA	4	5	yes
GATCCCTGCGAACTGCATTT	56	5	yes
GATCCCTGCCCTACTGCTCA	8	7	yes
GATCATTTGAAGCCAGGTGT	6	7	yes
GATCCCGGGCTGGAAGCCTT	32	12	yes
GATCCTCCTGCTTCAACCTC	152	12	yes
GATCTTTCCCTGTGGGTGGT	20	14	yes
GATCAGGCTTCCTGGTTGTG	19	4	yes
GATCCCTGACCCTAGCGATA	3	4	yes
GATCCCTACGTACGGAGCCG	1	1	yes
GATCCCCAGGGCCAAGGACA	1	1	yes
GATCCCTTGGTCTCGCTGGA	3	4	yes
GATCCCATCCGAGCTGGGGT	31	6	yes
GATCACAGAAACGGTCTGCA	2580	402	yes
GATCCACGGGGTGGGAACAT	2	3	yes
GATCTAGCCAGACCTCCTGC	7	6	yes
GATCCGTGCTCCCACTACCA	12	14	yes
GATCCTAGCTTGAGGATTTT	67	20	yes
GATCTGCTGTGGAATTGGTA	1	1	yes
GATCTGCTGTCGAGTGAATG	31	9	yes
GATCCCCGCTCGCCGTCCCT	73	10	yes
GATCTGTATTTCAGTGTTTA	5	5	yes
GATCCGCCTGCCTCTGTCTC	693	430	yes
GATCCCAACATCCCTTTCTA	309	29	yes
GATCCAGAAGGAGCAGGATT	17	5	yes
GATCAACAACTACATACAAG	3	3	yes
GATCTGAGCCACCTGCGGCG	2	2	yes
GATCACAGCCTGGGCATCCA	13	11	yes
GATCTGGCCATTTGGTACAT	101	8	yes
GATCACAGACACCTTGTGTG	12	10	yes
GATCACACCAGGGTCCCCTG	1	1	yes
GATCCACGGCCAAGAATCAA	30923	2749	yes
GATCTGGACGGGCCAAAGGA	28	24	yes
GATCCGGGATGCCTTGCGCA	2	2	yes
GATCTTTCCACATCCTGGCA	25	22	yes
GATCACATCCATGTGAGTTG	7	3	yes
GATCCACAACAGCCAGGGCA	65	5	yes
GATCTGCTGCAAGACAGGCA	20	3	yes
GATCTTGCCAAGCCAAAATG	32	4	yes
GATCCACACTGACCGAGTCT	3	2	yes
GATCTTGCCAGTAATCCTGT	1819	187	yes
GATCCACACAACACCAGAAT	25	10	yes
GATCTGATGATGAGGAGGAA	465	40	yes
GATCACTATCATCCAGTGCC	42	9	yes
GATCACCTTCAATGTGGGTT	2	2	yes
GATCTGTGGACCAGGATTTG	15	13	yes
GATCCATACTGGGGAGAAGC	4	3	yes
GATCCCCTCATCAAGGTGAA	64	15	yes
GATCCCTGAGCTGGTGCCTT	45	15	yes
GATCCAGCCTGCTACTTCCC	25	1	yes
GATCTGGTTTCACGTCTGAT	1	1	yes
GATCCGAAAATGTCAGCAGA	70	34	yes
GATCCCCCTGCCCAGGTGAG	153	6	yes
GATCGCTGCGGTCAGCCTGG	3	3	yes
GATCCTAGATAGTTTTCCCT	8	10	yes
GATCATCTGTGTGGAGTTTT	2	2	yes
GATCCCACTGTCCCGGTGTC	118	47	yes
GATCAAAGGAGGGAAAGGTC	7	8	yes
GATCCAGAGGGTCACTTCCA	1	1	yes
GATCCATGACTGTCCTCTGA	37	26	yes
GATCCAAAGAGGCCCAGGTC	41	6	yes
GATCCATCCCTGGTTAGCAA	17	5	yes
GATCTGCCACTGTGCAGGTG	7	6	yes
GATCCAGCTGTGTCATTAAA	12	14	yes
GATCAGAGTCCTCAAGCAAA	6	5	yes
GATCTATCTCAGAGGCTATA	23	27	yes
GATCTGAGCCTGTGTTTGCT	22	1	yes
GATCAGGGCCTTGCCATGTA	40	0	yes
GATCTGAAATGAACCAGCCA	237	18	yes
GATCACTGCCAAGGACAGGC	1	1	yes
GATCTCTCTTCAGAAGAGCT	42	2	yes
GATCTCGCCCGGCTGGCAAT	37	26	yes
GATCACCTCGGTGCAGGCTA	4	2	yes
GATCTCCACACGCACATCAC	54	12	yes
GATCCAAATCAGGAAAGACG	83	6	yes
GATCCAAAGACAGACCACAG	206	7	yes
GATCATGCTTCAAACTGAGG	26	2	yes
GATCCAGCGGGTGTGAGGAT	18	5	yes
GATCACCGCCCAGCTCCTGG	2	2	yes
GATCCGTGACAAGCGCACAG	2	3	yes
GATCTAACTCTGGTTGTCAA	8	6	yes
GATCCATGACTAGAGTCCTG	40	6	yes
GATCATCCAGTCTAACTTGG	9	11	yes
GATCTACTCAGACAAGGGCT	4	4	yes
GATCATTTCCCCCATCTGCC	5	6	yes
GATCGTTTCCCTGCTGGCGG	55	12	yes
GATCAGACAGTCTTGGAGTG	10	12	yes
GATCGGCCATCCTTGGACTA	24	28	yes
GATCATTCTGAACTGTACAT	2	2	yes
GATCGCCTGGAGAAATGACG	429	281	yes
GATCGCCATTGGTGTAGCGG	539	53	yes
GATCGCATTGCCAAGGAGCA	19	22	yes
GATCATACCCAGAGGAATCT	9	1	yes
GATCCTGTGAGGTCAGTGAA	35	4	yes
GATCCTGTCACTGCAAAGCC	69	8	yes
GATCCTGGAGGCAAATGGGT	59	6	yes
GATCATCCAGCGGGCTGAGA	6	5	yes
GATCATGTAAAACCGTTTGG	64	24	yes
GATCCACCGGCCTCCGCCGC	19	23	yes
GATCAGTGCTTACCCAGCTC	2	2	yes
GATCTGCGCTTACAGAGTGC	2	3	yes
GATCTACCTCCGCTAGCTGT	70	45	yes
GATCTGGCTCCAGGGTCATC	2	2	yes
GATCATCTAAACTGAGTCCA	37	32	yes
GATCTGCAAGTCCCGGAGAG	19	15	yes
GATCAGCCGCCGCGCGCACG	21	18	yes
GATCAGGGGAATGGTGCATA	22	6	yes
GATCAGGCTGAGAGGATTTC	5	5	yes
GATCCAGCTTACACTGCACA	32	22	yes
GATCACACCATGACTGTAGT	45	5	yes
GATCCCAGCCTGTTCTCAAG	3	1	yes
GATCTGTTGTGCAGCTGTTG	11	13	yes
GATCAGCAAGCAGGAGTACG	1185	41	yes
GATCATCTCCCCCAGGAGCG	21	2	yes
GATCAGCCTCCCGAGGGAGC	2	2	yes
GATCAGCCTCAGTCTTCACT	33	1	yes
GATCAGCAGGTCAAAAAGTT	32	9	yes
GATCGGAATCACGTGTTACC	6	7	yes
GATCTGAAGTGTCCCACCAA	2	2	yes
GATCATGCTTGCTTCCAATG	32	9	yes
GATCATGCTGGGAGGGGTAA	12	10	yes
GATCTGTCCCAGTGTCAACC	123	14	yes
GATCTCTGCTTCCTGTACCT	65	21	yes
GATCATAGTCAACCTGTCTG	9	11	yes
GATCATAGCAACCTGCTCTT	1	1	yes
GATCACGTTCACGGAAGCCT	2	2	yes
GATCAGTCACGCCGTAGCTC	36	26	yes
GATCTCCTTCATCCCTCTCC	1455	995	yes
GATCTGGCCTGTCTGTAGTT	34	7	yes
GATCTATACCTTCCGAGGTG	4	5	yes
GATCTTTTGTGGGATTAATC	2	3	yes
GATCAGGACGCTCTGGCTCT	2	2	yes
GATCTGCGGGTGCAGTGTAA	2	2	yes
GATCTGCCCCTTCCGCCAGG	23	0	yes
GATCAGATGGCTCAGTGGGT	30	3	yes
GATCTCAGTTTGCTCCTTTT	50	4	yes
GATCTTTTTTGTGAGGGTTT	19	2	yes
GATCCACCTGGAGCTGAGGA	22	8	yes
GATCTTGGCCTCCCTGCAAA	15	2	yes
GATCCATTTCATGTGCCCAC	59	38	yes
GATCCAGAAACACGATGGCA	2	2	yes
GATCACTTTTGACCAGGGAG	25	14	yes
GATCACTGTCTACTGATGGG	13	2	yes
GATCTATGAAGGCCAAGTGG	20	24	yes
GATCTGAAAAGCCTTCCTCG	12	10	yes
GATCTCTGGCTTCGAGCTCA	1	1	yes
GATCTCTCCACGGGTCACGA	39	33	yes
GATCTGTGGCCAAACCCACT	14	12	yes
GATCTGTGGCAAAGTTGGAG	13	0	yes
GATCTGTGCACAGACTGACT	84	9	yes
GATCCAGACCTACCAGCGCA	12	1	yes
GATCTACAGCTAGAATCATG	2300	1108	yes
GATCCCTATGACTCTGCTTC	3	4	yes
GATCGGAAGAACCCAGGGAA	19819	2780	yes
GATCACCACAGGATGGAGCA	45	4	yes
GATCTGTACCTGGAAGCAGC	11	9	yes
GATCCACGCAGAGCTCTCAA	179	28	yes
GATCCTGTGCCCATTGGGCA	22	1	yes
GATCAAGCCGTATGCTAAAC	12	4	yes
GATCAAAGTCTGAAGTTGGG	2	2	yes
GATCCTAGAGTGGACCCTGC	42	15	yes
GATCTTTTGGAAGTAGGGTG	3	4	yes
GATCTGTCCAGGCTTCAGAG	24	0	yes
GATCCTGCTGAGCCTGGGTG	8	5	yes
GATCTGCTATCGGTCTAGAA	10	1	yes
GATCCTGCCAACATTGTGCA	11	13	yes
GATCCTGAGGAAAGGGAAAA	10	2	yes
GATCCTGACTGCCTATGTGA	95	16	yes
GATCTGCCCTTCGGTGGGGT	1	1	yes
GATCAACTGGCCAGGTGATG	16	19	yes
GATCCGTCAGTTCCACTCCC	109	6	yes
GATCCGCTCACTGGGGAGCT	6	5	yes
GATCCGCCTTGCATGTGGCT	15	2	yes
GATCTTCATGAGGACTTCTG	52	1	yes
GATCCAACTAACACTGCTGC	27	14	yes
GATCCCGATGGAGGCTGCAC	48	15	yes
GATCCCCTTAGGTGGTTGTA	9	3	yes
GATCCCCACCCCGTGGCACA	28	30	yes
GATCCCATCAATTCGATGTT	41	26	yes
GATCCCAGTTAGGACTGAGT	119	3	yes
GATCAGGCTGGCTTTGGGTG	143	28	yes
GATCCCAGGAATGTCGTGTG	10	1	yes
GATCCCAGAAGCCTCTCTGT	45	10	yes
GATCCCAAGCCACGCGGGTC	3	4	yes
GATCTGTCAGCCGAGGTTCC	6	7	yes
GATCCCCACTTATGTGACTT	2654	315	yes
GATCTCTGCAGTCAGAAGCT	420	1	yes
GATCCAGTTTGCCTGTTTGC	73	12	yes
GATCTCTCTCCTGAGAGAGA	2	2	yes
GATCCAGTGCAGTCCGGTTT	126	4	yes
GATCCAGGTCCGAAAGGCAG	2	2	yes
GATCCAGGGTCTGAGGAGGC	29	3	yes
GATCCAGCCTTTTGTTTCAG	1	1	yes
GATCCAGCCGGAGGTCCCTT	2	3	yes
GATCCAGAGTAACTGACTGT	18	6	yes
GATCCCCATAGGATGGGCAG	14	17	yes
GATCCAGACAAAGCAAGCCA	14	1	yes
GATCCACTACCGCTGTTGTG	2	0	yes
GATCCACCTCCCAAAGTGCT	19	7	yes
GATCCACCAGTGCTGTGCTG	21	5	yes
GATCCACCAACTGCAAAGGC	6	5	yes
GATCAGAACTCCCCAGAAAG	1	1	yes
GATCTCCCAGGCTGTGGAGT	15	11	yes
GATCCAATCCAACATTTCGG	20	24	yes
GATCCAAGTAGGGAGCCATC	20	16	yes
GATCAGGAGCTCTTGTCCCT	3	3	yes
GATCACTCTTAGCGGCTGCT	13	12	yes
GATCATGTCTGTGGACCAGG	37	9	yes
GATCAGCCCCGCCTGTCACA	128	26	yes
GATCACCTCCCCTGCCCTGC	76	65	yes
GATCTAGCCATTCAGAAAAC	11	5	yes
GATCATCACGGGACTGTGTT	24	9	yes
GATCATCAATCCTTCGGGGG	194	17	yes
GATCAGCATTGTGACTTGGA	34	4	yes
GATCCTGCCTATGAGCTCCT	8	9	yes
GATCCCAACTGGTTTATGAA	32	6	yes
GATCACCAATCAGATGCTGC	29	25	yes
GATCCTTTCCCGAAGTATTT	1	1	yes
GATCCAGACGGCCGTGCGCC	4	5	yes
GATCACACATTCTTGGACGC	14	12	yes
GATCACAACCCTCCAGGCTG	2	2	yes
GATCTAGCTCTGCCAAGGCT	1	1	yes
GATCCTGGGAAGCCTGAGCG	5	8	yes
GATCAGAAGTCTCAGGAAGT	33	3	yes
GATCCTGCAGTTTGAAGCAA	14	4	yes
GATCACAAACCTCCTGAATG	22	4	yes
GATCAATGAAGGCCAATCAT	2	3	yes
GATCCTGGAGCAGCTTCTTG	7	3	yes
GATCCTCTGCCCGCCTTGCA	143	15	yes
GATCCTGCTCCTGCGCTGGC	2561	339	yes
GATCAAGGGTTGAGGAGGGT	34	4	yes
GATCCTCAGTTCTGTGTGGA	4	1	yes
GATCTCCAAGGTTTGTAGGT	11	9	yes
GATCACTCTGTCTTGTACGT	92	22	yes
GATCACTCTCTTAGACCATG	12	8	yes
GATCACCTTTCAGAAGTGCC	12	8	yes
GATCACCCTGAACCAAGACT	8	7	yes
GATCACCAGGGAGTGAGCTG	77	5	yes
GATCTCACAGGCTGAGAAAT	674	165	yes
GATCCCGGGGTGTGCCTTAC	23	4	yes
GATCACAGCTAGCATTGGAA	14	4	yes
GATCCCCAGGAGGACATAGT	4	3	yes
GATCCCCACAGACTGTGGGA	6	0	yes
GATCACACAGACCTTGCCAT	3	2	yes
GATCACAAGTTCAAGACTAG	4	5	yes
GATCCTGGGCCTCAGCTACG	72	4	yes
GATCATTAGCATGCCAGGAG	12	4	yes
GATCAAGTGACCAGATGCCT	10	9	yes
GATCTCAGTGATGGCAGCCT	26	23	yes
GATCAAGGACCTCCGGGACC	101	119	yes
GATCCGCAAAGAAGAAGACA	8	2	yes
GATCAAGCAGAGCTGTGGAA	40	28	yes
GATCCTAAAACTCCGCCACA	93	9	yes
GATCCCTGAGATAGCAACAG	46	8	yes
GATCCAACCCTGTCCGCGTC	1	1	yes
GATCTCAGGCAGAGTGTGCG	1	1	yes
GATCTCACACATGCCAGGAC	2	2	yes
GATCAACTCAAGGAAACGCT	23	20	yes
GATCCCAGATAAAGGACGAT	44	5	yes
GATCCCAAGGAGGTTAGAAA	29	4	yes
GATCCAGATTGGACTTTTCT	13	0	yes
GATCCAGATGAAGTATGACA	62	4	yes
GATCATGGCTTTTGGAGGGA	44	2	yes
GATCCAGAGCTGCCTGTCGG	160	4	yes
GATCGGGTACCCAACTGTTT	12	22	yes
GATCCAAGTGCCACCTTGCT	69	15	yes
GATCCCCATCTTCTGTACCC	64	15	yes
GATCTACCGCTCACTGCTGG	19	8	yes
GATCAGGTTCTGCCATGGAG	21	5	yes
GATCAGCCACCTACCGTGAC	61	52	yes
GATCACCATCCCCACAGCAA	1835	159	yes
GATCGTTCCCTACCAACCTG	7	8	yes
GATCCTGGAGTTTCCCCCAA	24	2	yes
GATCCCGAGCGCCTGCAAGC	99	10	yes
GATCAACTCACACTGAAACA	39	1	yes
GATCGTGACTTACAAGTGGC	2	2	yes
GATCGTCTCAGGCCAACCAG	6	0	yes
GATCGTCTACCCCAGTAGCG	2	2	yes
GATCGTCCCCAGCGTGAGCC	28	21	yes
GATCCTTGCCAGTGTAAAAA	15	22	yes
GATCTCTTGGAGCTGGAGTT	2	2	yes
GATCGCCTTTTCGACACCTC	26	7	yes
GATCTGGGCACATTATTCTA	33	3	yes
GATCGCCATGAGTTCCAGGC	8	7	yes
GATCGAGCTTCTAGAGGCCG	20	3	yes
GATCCGCTGGTTTGGAGTGG	19	5	yes
GATCTGCTTGGGCCTGTGCA	75	6	yes
GATCCCAGGTTTCTGGCTTC	2	2	yes
GATCTCAATTCCTTTTGGTG	172	148	yes
GATCTCAACACAGGAAACTC	60	8	yes
GATCTTTTTCTGCCTGAGAT	5	5	yes
GATCCCTTCTCAAGACACAT	69	10	yes
GATCTCTCCGCATCTGAAGG	29	0	yes
GATCTGCTACCTCAGACAGC	22	1	yes
GATCCTCCCCTTTGAACACT	10	4	yes
GATCTGCATGCCCTGGGTTC	157	129	yes
GATCTTTGGTGAAGTGGCCA	22	19	yes
GATCTCCTACAGCACACCAC	4	5	yes
GATCTGCAGGAGGATGAAGC	67	48	yes
GATCTTTGCCTTTCTGTTCC	26	9	yes
GATCTTTCTTTTTGCCTTGT	22	26	yes
GATCTTTCTTCTGCCTGAGT	17	20	yes
GATCTTTCTTCCCGCCGCTT	19	14	yes
GATCCAGCCAAAGGTGACGG	2	2	yes
GATCAGCACCGTGGTGAGCT	267	14	yes
GATCTCCATGTGGAAGAGAA	20	3	yes
GATCCAGACCTAGAACCTTC	2	3	yes
GATCACAAGTGTGAAGACAG	9	8	yes
GATCGTGCCAGCCGCCATGG	12	10	yes
GATCCACCTGTCTCAGCACC	51	11	yes
GATCACAGTGCCCCCTGCTG	5	6	yes
GATCACAAGTTCCAGGCTAG	57	49	yes
GATCGCTGCCTTGCTGGACC	4	5	yes
GATCCTCTACCCCCAGGATG	23	20	yes
GATCCCAGCCACTGCCTGTC	5	5	yes
GATCGAGAAGATGCAGGAAT	213	55	yes
GATCTCCGACCTCGGTGTTG	2	3	yes
GATCCAGGATGAGAAGACTG	22	9	yes
GATCTCCATGCTCATGGACT	26	23	yes
GATCAGTTATTGCCCACCCT	2	3	yes
GATCACTGTCTACAGTGGTT	71	19	yes
GATCACTGCAGCTTCTAGGA	95	9	yes
GATCACTGAGTGTACAGAAG	33	28	yes
GATCTTGTCTGTGGACTGTT	41	1	yes
GATCCAGCACTTCAAGTTCG	50	18	yes
GATCATGGCTTCTCTAGCTG	15	13	yes
GATCAAAGCTGTCTACAGCT	8	7	yes
GATCCTCTGCACCTCTTGCT	12	10	yes
GATCTTTATTCTGTGGCCTT	50	25	yes
GATCCTAATTTCAAGGGGAC	9	8	yes
GATCCGTTCCTGGCTCAGCC	11	7	yes
GATCACCAAACCAGTCCACC	250	203	yes
GATCACCAAACCAGTCCACA	1338	0	yes
GATCCAGCACTGGGGAATGA	14	10	yes
GATCCCGGTCAAGTACCTGG	16	10	yes
GATCTGCAGATGCTGTCCTT	19	27	yes
GATCACCCTTAGCGGCTGTG	53	14	yes
GATCCAACCTTCCCACCCAC	3	4	yes
GATCTTGGCTTGTAGGCGAG	14	1	yes
GATCTCCAGCGGGATGCAGT	3	3	yes
GATCTCACACTCCGAGCCCA	10	12	yes
GATCTATCTCAGGCTCCCTT	3	4	yes
GATCTCGTGGCCGTGCTGTG	24	28	yes
GATCATATGGTGCGTCAATT	22	5	yes
GATCCAGCGCAGGGGGCCCG	472	656	yes
GATCACCAACGAGAAGCTGG	240	6	yes
GATCAATGCCCTCATTAAAG	2724	1076	yes
GATCGTCCGCACATTAAAGA	49	35	yes
GATCGGCTCATCGCAGACAC	31	22	yes
GATCGGCCTCGAAAATGGAC	7	8	yes
GATCAGCGAGTACTCCCGCA	8	7	yes
GATCTGGGCTCTCAGTTTCA	22	3	yes
GATCCCCAAGGCGTCAGCCA	22	1	yes
GATCCATGCAGGTGATTGTC	48	33	yes
GATCTAAAGAAACAGTTGGC	4	5	yes
GATCACGAAGGAGGAGTGCC	5	5	yes
GATCGACGGATGCTTGGAGG	30	6	yes
GATCTGAAACTTGTGGAAAA	9	11	yes
GATCGAAGAGCGGATGTGCT	8	10	yes
GATCACACTTTCCCCATCAA	4	7	yes
GATCGCTTGGAAGAGTCCCT	2	3	yes
GATCGCTGTTCACAGCCAGA	6	5	yes
GATCGAGAGGAGCTGCGATT	10	12	yes
GATCAACCATTCTGAGCTGA	12	9	yes
GATCCCTGCCACATAGAAGG	1	1	yes
GATCCTTTGGAAGACCAGAG	120	12	yes
GATCGGGCGGAACTGGCCCT	14	13	yes
GATCCTGGTCCTGAGTCCCA	12	6	yes
GATCCTGGCCTACTCATGAG	14	1	yes
GATCCTGGGGCAACCCATCT	330	12	yes
GATCTTGTTGTGAGTGTGTG	468	51	yes
GATCTTGTTGCTTTTTGCTG	66	21	yes
GATCCTGGAGAAGACAGAGA	1	1	yes
GATCTTGTGGGACTCGGGCT	23	20	yes
GATCTTGTGGATTCGTTAGT	17	14	yes
GATCCTGCTGCCGTTCCCAT	61	8	yes
GATCCTGACCATCGAAGTGA	6	0	yes
GATCCTCCGGCTGTGGCTAA	34	2	yes
GATCCTCCAGGAGCTGCAGA	22	4	yes
GATCCAGAGTGGAGATACTT	132	17	yes
GATCTTGGTTGTCCCTGCGT	35	3	yes
GATCCTGCACCTTGTCGTCA	9	1	yes
GATCTTGGCACTTTGTAACT	19	0	yes
GATCCCCACAAGACTGCTGT	14	1	yes
GATCTTGCTGTATTGTTACT	3	3	yes
GATCCCCACCAGGAAAGTAA	1	1	yes
GATCTTGCCCTCAGCAAACG	10	9	yes
GATCTTGCCCAATTACCACC	76	3	yes
GATCTCAGACCGGGGTGGAG	19	16	yes
GATCCTGAAATCCCGCAAAC	22	5	yes
GATCTTGACTTTGCCGGGCT	12	4	yes
GATCTTGACTCTGAGGAGAG	122	12	yes
GATCCTCTGCACCCCTCAAG	2	2	yes
GATCCTCTGATTCCAGGTAC	1	1	yes
GATCTGTCTCCTGGGTCCTT	73	17	yes
GATCTGCTTGCTTCTGCCTC	51	10	yes
GATCCTCTCTCTGAGTCTGC	1	1	yes
GATCCTCTAGATGTCACCTG	4	4	yes
GATCTTCTGCTTGTCAGTGG	28	3	yes
GATCACTAACGGTCAAATGG	37	29	yes
GATCCTCACAGGTCAGGGGT	110	7	yes
GATCAGCAGAAAGAGAGAGT	5	6	yes
GATCAGAGTGAACCATGAGC	50	43	yes
GATCTTCATCTCACTGTCTA	17	14	yes
GATCTTCAGGTGTCTGCCAT	41	35	yes
GATCTTCACCTCCACCATGC	28	24	yes
GATCCTAAGTGTAGATGACT	3	3	yes
GATCTCAACCCGCCCAGGTA	119	16	yes
GATCTACTTCAACGTTGGGG	56	1	yes
GATCTTAGCTTCCTGTCAGC	24	21	yes
GATCTTAGCCACTGCTCTGG	11	13	yes
GATCTTAGCCAAAAACTTTT	16	19	yes
GATCTGTTTTCCCTGGCTTG	8	10	yes
GATCGTGCGTTGCAGAAAAC	9	11	yes
GATCACTCATCTCACATGGG	6	5	yes
GATCACGGGCGACCCCAACA	13	11	yes
GATCTGTTGTTGGGGAGGGT	4	4	yes
GATCACCGCGTCAGGGTCCT	2	2	yes
GATCACCCTGGTCTACAGAG	4	4	yes
GATCTGTTCTGTTTATCTCA	87	2	yes
GATCTGTTCGTGCTGAAAGT	7	8	yes
GATCTAACCAGGCCTTAGTT	8	10	yes
GATCACAGATGACCTGCACT	6	2	yes
GATCTGTGGAGAAGATGATT	22	17	yes
GATCTGTGCTTCAGCCGGGT	3	3	yes
GATCCGAGCTGGACTCCTCC	2	2	yes
GATCAAGTTCGACCAATAGC	12	14	yes
GATCGTACAGAAAGGAGGGC	67	48	yes
GATCTGTGAAGGTTTCGGTA	2	3	yes
GATCTGTCTTGTGAACCAAG	20	24	yes
GATCTGTCCTCAGCAGGCTC	54	25	yes
GATCTGTCCCCACCTTCACC	15	13	yes
GATCTGTCCACTAAGCCCTC	17	14	yes
GATCGGCCGGGGCTCTTGGA	147	96	yes
GATCAAGGCCCAGGTGGCCG	20	22	yes
GATCAAGGCATTTCCTCTCT	1	1	yes
GATCCAGAAGCTGATGGATG	86	22	yes
GATCCCTAAGGAGGAGGCGC	3	4	yes
GATCGCATGCGGACTCGGCA	78	6	yes
GATCCTTAGTCTTCAGCTTT	100	29	yes
GATCTTTTCCCCACTTGGAA	1	1	yes
GATCCCATGGCTGACACGCT	64	20	yes
GATCGCACCTAAGATTAAGG	3	3	yes
GATCCTTATTGTCAGGTTTT	34	0	yes
GATCGAGCTCAGAGGCGAAG	198	19	yes
GATCGTGTGTTGCCATTTTT	4	5	yes
GATCCCACTGTCACCCTCGG	2	3	yes
GATCGTTCCAAAGCCAGAAG	2195	24	yes
GATCCTTTGCAATTCATTTT	40	5	yes
GATCGGACTAAAGAAGAGCG	2	2	yes
GATCCTTGTCCTCCAGACTG	66	2	yes
GATCTGTCAAGAGAGCTTTT	30	35	yes
GATCCATGCACTGATGCTGT	3	4	yes
GATCCTCAGCAAAAAGTGGA	41	6	yes
GATCCTGAAAAAATAGCCAG	54	3	yes
GATCCAGGCCCTGTGCTTTG	3	3	yes
GATCCAGCCCTGCCCGGAAG	2	0	yes
GATCCAGCAAAACGGGCAGA	1	1	yes
GATCTTCAGGAACTGTTTCT	2	2	yes
GATCCTTCTGCCTCTGCATG	96	21	yes
GATCCAATCTATCCCCAACA	2	3	yes
GATCAACCTGAGCGTGGAGA	297	92	yes
GATCCTGGCAGCAAAAACGG	1	1	yes
GATCCCAACTCATCCTGACT	31	1	yes
GATCTTAGCCATCTCAGTGT	3	3	yes
GATCGCCACCTACCGCAGCC	1227	20	yes
GATCTGTCTGGAGGCTCCAG	8	7	yes
GATCAGGTGGCTGCGTAGGT	24	0	yes
GATCTGGAGGTGGATGTGGA	5	5	yes
GATCATCTCAAAGCCATCCT	2	2	yes
GATCAAGCCATATTCAGGTC	10	9	yes
GATCAGGAGCTGGAGAGAAA	223	10	yes
GATCCACAGTCATGAAAGGG	6	5	yes
GATCCAAACGCTTACCCTCA	1	1	yes
GATCCAGCTACTACCTTGAG	18	5	yes
GATCAAAGCGTCTGCAGGTT	6	5	yes
GATCCTCACCTGTCTGCACG	1	1	yes
GATCGGCCACTACCTGGGCG	62	10	yes
GATCAGAAGTTCAAGGTTGT	3	3	yes
GATCGCCTCAGAAGCAGCAG	186	5	yes
GATCCCTGACTCTACGAAGA	11	0	yes
GATCGCTCTCCATCCCCCCT	80	6	yes
GATCCCGTTGTTTCTGAGCA	3	3	yes
GATCAGACAAGGCAAAGCGA	1989	233	yes
GATCCCGTCGCCGTCTTCGT	18	17	yes
GATCTCTGTCTCGGTGGGAT	11	9	yes
GATCAAGACTGACCCGTCAA	313	25	yes
GATCCCACAACGAAACGCTC	71	8	yes
GATCCCCGGAGTGGTTATAG	1	1	yes
GATCCTGTTGGCTTTGCGTT	4	5	yes
GATCTCCATGTGCCAGAGGA	8	2	yes
GATCACTGCTCACGTGTACT	2	0	yes
GATCCCAGCCTCCATAAGGC	39	5	yes
GATCCTGCAACAGCCCCTGG	110	45	yes
GATCACAGACAAGCTGGGGC	19	16	yes
GATCCAGGGATTGTTCCAGC	37	18	yes
GATCCAGAACTGGACCCTTG	20	12	yes
GATCCGCAGGGCCCAGAACT	28	3	yes
GATCCAGCAGTTCGCAGCTC	203	5	yes
GATCGAGGCATTGTCTACTC	55	0	yes
GATCCCTGCTAAGAATATTG	1	1	yes
GATCCCTGTTCGGTTGCAAG	4	2	yes
GATCGACCCCAACTGGGTGG	34	5	yes
GATCAAGCGCAACCTCTCCT	21	24	yes
GATCCCTACCGCCAGCTGCG	528	15	yes
GATCCTGAGCTCCGAGACTT	88	17	yes
GATCCTGAGTCCTGGGCACT	18	2	yes
GATCGGGCACATGCCTGAGG	4	5	yes
GATCAGGCTGTCAAGCAGAA	35	25	yes
GATCATTCTTCACCAGGGCA	2	2	yes
GATCCCCTTTCTCTATGTCG	371	61	yes
GATCCCCTTGAGCAGAGAAA	10	5	yes
GATCTGTCACTGTGTGAAGG	12	14	yes
GATCCCGTGAAGGTGAAGGT	11	2	yes
GATCCCGTCTCCCCGCGAGT	5	8	yes
GATCTGTAGAAAACGGGAAT	1	1	yes
GATCGGCAAAGCAGTGGAGC	4	3	yes
GATCCCAGCCCAGTTCTCTC	99	10	yes
GATCTGGTTTCCTTTCACAT	2	2	yes
GATCCCCTTCCCCCAACCCC	13	11	yes
GATCGCTGCGGAAGATGTCG	1	1	yes
GATCCCCATGCTAAGAAAAT	30	5	yes
GATCCCCATCATCATTCGCC	186	4	yes
GATCCCCTCCAGCCTAGCAT	2	0	yes
GATCTGGTGCACCGTGCACT	7	1	yes
GATCTGGTCTTGAACAAGAA	28	1	yes
GATCCCCTAGAGCTGGAGCT	6	7	yes
GATCTGGTCTGTGCTACCAC	11	9	yes
GATCTGGTAGGAAATGTGAG	10	9	yes
GATCTGGGTACACCCCCCCG	23	20	yes
GATCTGGGGCTAGGGGTACA	10	9	yes
GATCTGGGCCTCCAGGGACT	118	16	yes
GATCTGGGCCAGTAAGTTGC	28	33	yes
GATCTGGGACTGAGGCCTTC	15	18	yes
GATCTGGGACCTTGACGAGA	6	5	yes
GATCGCTCTGGACGAAGTTT	1	1	yes
GATCGCCTCTTAATTCAAGG	91	7	yes
GATCCAGGCTGTGGTGGACA	2	2	yes
GATCCCAGTTTCCCCTCCCT	64	24	yes
GATCTGGCTCCTTCTGACAA	26	23	yes
GATCTGGCGCTACCACTTCG	8	2	yes
GATCTGGCCATAGAAGGCAG	8	7	yes
GATCTGGCCAAGTCTTAGAG	83	4	yes
GATCTGGCACCTTGGGATTG	4	3	yes
GATCCCCAGAACCCAACCCA	12	10	yes
GATCTGGAGCTGGCCATCTG	22	1	yes
GATCTGGAGCTGCCCTGGGG	19	5	yes
GATCTGGAGCCTGAAGCCAT	9	8	yes
GATCTGGAGCAATATGACCG	40	34	yes
GATCCTTGGAAACTGTCTAG	45	9	yes
GATCCCAAACTCAGAGAAGC	37	5	yes
GATCTGGAACACCAACTGCT	37	32	yes
GATCTGCTTTTCTGCAGAAC	203	116	yes
GATCCCATGGGTCAGGCACT	23	2	yes
GATCTGCTTGCCTATGGCAG	73	5	yes
GATCCAATGCGGAAAAATCT	7	8	yes
GATCGAGCGCCGGGGTATGG	42	0	yes
GATCCTGGGTCTGGGACCAC	134	0	yes
GATCCCAGTCCAGCTGAGAG	2	2	yes
GATCCCAGGTTAGGCACAGC	47	2	yes
GATCTGCTGAATAAGTGCAT	4	2	yes
GATCTGCTCTGAAAAACTGC	15	3	yes
GATCGACCAGTCCGAATTTG	5	6	yes
GATCCTGGCCTCACCTATAT	149	6	yes
GATCTGGAATTTACTACCCT	14	1	yes
GATCCTGCCCCTTGGACCAG	4	2	yes
GATCTGTTGGTCACATTGTT	8	8	yes
GATCTGCTCGCAGCCCACAC	63	6	yes
GATCTTTGTGAAGACCCTGC	4	7	yes
GATCCCAGACTGGTTCCTGA	3420	300	yes
GATCTGCTAACCTGGAGTCA	26	23	yes
GATCTGCGAGCGAAACCTAC	37	43	yes
GATCCTGCACAGCAGGATAT	15	9	yes
GATCCAAGATGCTGGGCTTG	42	12	yes
GATCCGGGTTTTGTGTAGCT	1	1	yes
GATCTCCAGCAGAGGAGCTC	3	3	yes
GATCTGCCGAAGATTAGAAG	69	29	yes