Entry - *612330 - MICRO RNA 610; MIRN610 - OMIM

 
 
* 612330

MICRO RNA 610; MIRN610


Alternative titles; symbols

miRNA610
MIR610


HGNC Approved Gene Symbol: MIR610

Cytogenetic location: 11p14.1     Genomic coordinates (GRCh38): 11:28,056,815-28,056,910 (from NCBI)


TEXT

▼ Description

MicroRNAs (miRNAs), such as MIRN610, are approximately 22-nucleotide noncoding RNAs that target mRNAs for translational repression or mRNA cleavage (Cummins et al., 2006).


▼ Cloning and Expression

Using a large-scale cloning approach to identify putative miRNAs in human colorectal cancer cell lines, Cummins et al. (2006) identified MIRN610.


▼ Mapping

Cummins et al. (2006) mapped the MIRN610 gene to chromosome 11.

Hartz (2008) mapped the MIRN610 gene to chromosome 11p14.1 based on an alignment of the mature MIRN610 sequence (UGAGCUAAAUGUGUGCUGGGA) with the genomic sequence (build 36.1). The KIF18A gene, which Taylor et al. (2006) mapped to chromosome 11p14.1, overlaps the MIRN610 gene in the antisense orientation.


▼ REFERENCES

  1. Cummins, J. M., He, Y., Leary, R. J., Pagliarini, R., Diaz, L. A., Jr., Sjoblom, T., Barad, O., Bentwich, Z., Szafranska, A. E., Labourier, E., Raymond, C. K., Roberts, B. S., Juhl, H., Kinzler, K. W., Vogelstein, B., Velculescu, V. E. The colorectal microRNAome. Proc. Nat. Acad. Sci. 103: 3687-3692, 2006. [PubMed: 16505370, images, related citations] [Full Text]

  2. Hartz, P. A. Personal Communication. Baltimore, Md. 9/29/2008.

  3. Taylor, T. D., Noguchi, H., Totoki, Y., Toyoda, A., Kuroki, Y., Dewar, K., Lloyd, C., Itoh, T., Takeda, T., Kim, D.-W., She, X., Barlow, K. F., and 22 others. Human chromosome 11 DNA sequence and analysis including novel gene identification. Nature 440: 497-500, 2006. [PubMed: 16554811, related citations] [Full Text]


Creation Date:
Patricia A. Hartz : 9/29/2008
Edit History:
mgross : 09/29/2008

* 612330

MICRO RNA 610; MIRN610


Alternative titles; symbols

miRNA610
MIR610


HGNC Approved Gene Symbol: MIR610

Cytogenetic location: 11p14.1     Genomic coordinates (GRCh38): 11:28,056,815-28,056,910 (from NCBI)


TEXT

Description

MicroRNAs (miRNAs), such as MIRN610, are approximately 22-nucleotide noncoding RNAs that target mRNAs for translational repression or mRNA cleavage (Cummins et al., 2006).


Cloning and Expression

Using a large-scale cloning approach to identify putative miRNAs in human colorectal cancer cell lines, Cummins et al. (2006) identified MIRN610.


Mapping

Cummins et al. (2006) mapped the MIRN610 gene to chromosome 11.

Hartz (2008) mapped the MIRN610 gene to chromosome 11p14.1 based on an alignment of the mature MIRN610 sequence (UGAGCUAAAUGUGUGCUGGGA) with the genomic sequence (build 36.1). The KIF18A gene, which Taylor et al. (2006) mapped to chromosome 11p14.1, overlaps the MIRN610 gene in the antisense orientation.


REFERENCES

  1. Cummins, J. M., He, Y., Leary, R. J., Pagliarini, R., Diaz, L. A., Jr., Sjoblom, T., Barad, O., Bentwich, Z., Szafranska, A. E., Labourier, E., Raymond, C. K., Roberts, B. S., Juhl, H., Kinzler, K. W., Vogelstein, B., Velculescu, V. E. The colorectal microRNAome. Proc. Nat. Acad. Sci. 103: 3687-3692, 2006. [PubMed: 16505370] [Full Text: https://doi.org/10.1073/pnas.0511155103]

  2. Hartz, P. A. Personal Communication. Baltimore, Md. 9/29/2008.

  3. Taylor, T. D., Noguchi, H., Totoki, Y., Toyoda, A., Kuroki, Y., Dewar, K., Lloyd, C., Itoh, T., Takeda, T., Kim, D.-W., She, X., Barlow, K. F., and 22 others. Human chromosome 11 DNA sequence and analysis including novel gene identification. Nature 440: 497-500, 2006. [PubMed: 16554811] [Full Text: https://doi.org/10.1038/nature04632]


Creation Date:
Patricia A. Hartz : 9/29/2008

Edit History:
mgross : 09/29/2008



NOTE: OMIM is intended for use primarily by physicians and other professionals concerned with genetic disorders, by genetics researchers, and by advanced students in science and medicine. While the OMIM database is open to the public, users seeking information about a personal medical or genetic condition are urged to consult with a qualified physician for diagnosis and for answers to personal questions.
OMIM® and Online Mendelian Inheritance in Man® are registered trademarks of the Johns Hopkins University.
Copyright® 1966-2024 Johns Hopkins University.

NOTE: OMIM is intended for use primarily by physicians and other professionals concerned with genetic disorders, by genetics researchers, and by advanced students in science and medicine. While the OMIM database is open to the public, users seeking information about a personal medical or genetic condition are urged to consult with a qualified physician for diagnosis and for answers to personal questions.
OMIM® and Online Mendelian Inheritance in Man® are registered trademarks of the Johns Hopkins University.
Copyright® 1966-2024 Johns Hopkins University.
Printed: May 9, 2024