Warning: The NCBI web site requires JavaScript to function. more...
An official website of the United States government
The .gov means it's official. Federal government websites often end in .gov or .mil. Before sharing sensitive information, make sure you're on a federal government site.
The site is secure. The https:// ensures that you are connecting to the official website and that any information you provide is encrypted and transmitted securely.
Inhibition of C-terminal biotin-labelled human DNMT3A by multilabel plate reader analysis
Assay data:2 Active, 1 Activity ≤ 1 µM, 2 Tested
SummaryCompounds, ActiveCompounds, activity ≤ 1 µMPubMed CitationRelated BioAssays by Target
Inhibition of DNMT3A (unknown origin)
Assay data:1 Active, 1 Activity ≤ 1 µM, 1 Tested
Inhibition of human recombinant DNMT3A (214 to 912 residues)expressed in Sf9 insect cells using lambda DNA as substrate by scintillation/filter plate assay
Assay data:1 Tested
SummaryPubMed CitationRelated BioAssays by Target
Inhibition of recombinant human DNMT3A-3L expressed in Escherichia coli Rosetta2(DE3)pLysS at 100 uM using Poly(dI-dC)-Poly(dI-dC) as substrate measured at 150 mins by liquid scintillation counting analysis
Assay data:6 Tested
Inhibition of DNMT3L-mediated wild type full length recombinant human DNMT3A hetero tetramer expressed in NiCo21(DE3) competent Escherichia coli cells to DNMT3L protein-protein interaction assessed as DNA methylation using poly dl-dC as substrate incubated for 1 hr
Assay data:1 Active, 1 Tested
SummaryCompounds, ActivePubMed CitationRelated BioAssays by Target
Inhibition of wild type full length recombinant human DNMT3A expressed in NiCo21(DE3) competent Escherichia coli cells assessed as decrease the fluorescence anisotrophy of DNA bound protein using FAM/TGGATATCTAGGGGCGCTATGATAT as substrate and high concentration of protein incubated for 5 mins by microplate reader based fluorescence anisotropy assay
Assay data:2 Tested
Inhibition of wild type full length recombinant human DNMT3A expressed in NiCo21(DE3) competent Escherichia coli cells assessed as decrease the fluorescence anisotrophy of DNA bound protein using FAM/TGGATATCTAGGGGCGCTATGATAT as substrate incubated for 5 mins by microplate reader based fluorescence anisotropy assay
Assay data:2 Active, 2 Tested
Inhibition of H3 peptide activated human full length DNMT3A expressed in NiCo21(DE3) competent Escherichia coli cells at 60 uM
Activation of wild type full length recombinant human DNMT3A expressed in NiCo21(DE3) competent Escherichia coli cells to DNMT3L protein-protein interaction
Inhibition of DNMT3L-mediated wild type full length recombinant human DNMT3A homo tetramer expressed in NiCo21(DE3) competent Escherichia coli cells to DNMT3L protein-protein interaction assessed as DNA methylation using poly dl-dC as substrate incubated for 1 hr
Inhibition of DNMT3L-mediated wild type full length recombinant human DNMT3A expressed in NiCo21(DE3) competent Escherichia coli cells assessed as DNA methylation using H1SO4. Poly dl-dC as substrate incubated for 1 hr
Inhibition of wild type full length recombinant human DNMT3A expressed in NiCo21(DE3) competent Escherichia coli cells to DNMT3L (unknown origin) protein-protein interaction
Inhibition of human recombinant DNMT3A (214 to 912 residues)expressed in Sf9 insect cells at 50 uM using lambda DNA as substrate by scintillation/filter plate assay relative to control
Inhibition of human recombinant DNMT3A (214 to 912 residues)expressed in Sf9 insect cells at 10 uM using lambda DNA as substrate by scintillation/filter plate assay
Inhibition of human DNMT3A methylation
Inhibition of DNMT3A (unknown origin) at 1 to 10 uM
DNA Methylation Assay from Article 10.1074/jbc.M113.480517: "Laccaic acid A is a direct, DNA-competitive inhibitor of DNA methyltransferase 1."
Inhibition of DNMT3A (unknown origin) using biotinylated DNA oligonucleotides as substrate in presence of [3H-SAM] preincubated for 15 mins followed by substrate and [3H-SAM] addition and measured after 4 hrs by liquid scintillation counting method
Uncompetitive inhibition of human DNMT3A using poly dl-dC as substrate
Uncompetitive inhibition of human DNMT3A using AdoMet as substrate
Filters: Manage Filters
Your browsing activity is empty.
Activity recording is turned off.
Turn recording back on