Compound Links for PMC (Select 3338701) - PubChem Compound - NCBI

Warning: The NCBI web site requires JavaScript to function. more...

Links from PMC

Items: 1 to 20 of 26

<< First< Prev

Page of 2

Select item 161338991.

an image of a chemical structure CID 16133899

oligonucleotides; ACACCCAATTCTGAAAATGG; 5'-ACACCCAATTCTGAAAATGG-3' ...

MW:: 6094.000
MF:: C₁₉₅H₂₄₅N₇₈O₁₁₄P₁₉

IUPAC name:: [3-[[3-[[3-[[3-[[3-[[3-[[3-[[3-[[3-[[3-[[3-[[5-(2-amino-6-ox...

Create Date:: 2007-07-04

CID:: 16133899

Summary Similar Compounds Same Parent, Connectivity PubMed (MeSH Keyword)

Select item 101490062.

an image of a chemical structure CID 10149006

SCHEMBL24427; SCHEMBL24428

MW:: 150.140
MF:: C₅H₁₃NO₂P⁺

IUPAC name:: trimethyl(2-phosphorosooxyethyl)azanium

Create Date:: 2006-10-25

CID:: 10149006

Summary Similar Compounds Same Parent, Connectivity Mixture/Component Compounds

Select item 2225283.

an image of a chemical structure CID 222528

DEOXYCHOLIC ACID; 83-44-3; Desoxycholic acid ...

MW:: 392.600
MF:: C₂₄H₄₀O₄

IUPAC name:: (4R)-4-[(3R,5R,8R,9S,10S,12S,13R,14S,17R)-3,12-dihydroxy-10,...

Create Date:: 2005-03-26

CID:: 222528

Summary Similar Compounds Same Parent, Connectivity Mixture/Component Compounds PubMed (MeSH Keyword)

Select item 1050654.

an image of a chemical structure CID 105065

CBiol_001737; Bio1_000023; Bio1_000512 ...

MW:: 379.500
MF:: C₁₈H₃₈NO₅P

IUPAC name:: [(2S,3R)-2-amino-3-hydroxyoctadec-4-enyl] dihydrogen phospha...

Create Date:: 2005-06-08

CID:: 105065

Summary Similar Compounds Same Parent, Connectivity Mixture/Component Compounds

Select item 732435.

an image of a chemical structure CID 73243

10191-18-1; N,N-Bis(2-hydroxyethyl)-2-aminoethanesulfonic acid; BES ...

MW:: 213.250
MF:: C₆H₁₅NO₅S

IUPAC name:: 2-[bis(2-hydroxyethyl)amino]ethanesulfonic acid

Create Date:: 2005-03-26

CID:: 73243

Summary Similar Compounds Same Parent, Connectivity Mixture/Component Compounds PubMed (MeSH Keyword)

Select item 696766.

an image of a chemical structure CID 69676

4-Iodoanisole; 696-62-8; 1-Iodo-4-methoxybenzene ...

MW:: 234.030
MF:: C₇H₇IO

IUPAC name:: 1-iodo-4-methoxybenzene

Create Date:: 2005-03-26

CID:: 69676

Summary Similar Compounds Same Parent, Connectivity Mixture/Component Compounds PubMed (MeSH Keyword)

Select item 652467.

an image of a chemical structure CID 65246

fructose-1-phosphate; 15978-08-2; D-Fructose 1-phosphate ...

MW:: 260.140
MF:: C₆H₁₃O₉P

IUPAC name:: [(3S,4R,5R)-3,4,5,6-tetrahydroxy-2-oxohexyl] dihydrogen phos...

Create Date:: 2004-09-16

CID:: 65246

Summary Similar Compounds Same Parent, Connectivity Mixture/Component Compounds PubMed (MeSH Keyword)

Select item 312708.

an image of a chemical structure CID 31270

CBiol_002028; KBioGR_000246; KBioSS_000246 ...

MW:: 299.500
MF:: C₁₈H₃₇NO₂

IUPAC name:: (2S,3R)-2-aminooctadec-4-ene-1,3-diol

Create Date:: 2005-06-08

CID:: 31270

Summary Similar Compounds Same Parent, Connectivity Mixture/Component Compounds

Select item 82599.

an image of a chemical structure CID 8259

2,2,2-TRICHLOROETHANOL; 115-20-8; Trichloroethanol ...

MW:: 149.400
MF:: C₂H₃Cl₃O

IUPAC name:: 2,2,2-trichloroethanol

Create Date:: 2004-09-16

CID:: 8259

Summary Similar Compounds Same Parent, Connectivity Mixture/Component Compounds PubMed (MeSH Keyword)

Select item 642210.

an image of a chemical structure CID 6422

Trifluoroacetic acid; 76-05-1; Perfluoroacetic acid ...

MW:: 114.020
MF:: C₂HF₃O₂

IUPAC name:: 2,2,2-trifluoroacetic acid

Create Date:: 2004-09-16

CID:: 6422

Summary Similar Compounds Same Parent, Connectivity Mixture/Component Compounds PubMed (MeSH Keyword)

Select item 621211.

an image of a chemical structure CID 6212

CHLOROFORM; Trichloromethane; 67-66-3 ...

MW:: 119.370
MF:: CHCl₃

IUPAC name:: chloroform

Create Date:: 2004-09-16

CID:: 6212

Summary Similar Compounds Same Parent, Connectivity Mixture/Component Compounds PubMed (MeSH Keyword)

Select item 604912.

an image of a chemical structure CID 6049

EDTA; Edetic acid; Ethylenediaminetetraacetic acid ...

MW:: 292.240
MF:: C₁₀H₁₆N₂O₈

IUPAC name:: 2-[2-[bis(carboxymethyl)amino]ethyl-(carboxymethyl)amino]ace...

Create Date:: 2004-09-16

CID:: 6049

Summary Similar Compounds Same Parent, Connectivity Mixture/Component Compounds PubMed (MeSH Keyword)

Select item 599713.

an image of a chemical structure CID 5997

cholesterol; 57-88-5; Cholesterin ...

MW:: 386.700
MF:: C₂₇H₄₆O

IUPAC name:: (3S,8S,9S,10R,13R,14S,17R)-10,13-dimethyl-17-[(2R)-6-methylh...

Create Date:: 2004-09-16

CID:: 5997

Summary Similar Compounds Same Parent, Connectivity Mixture/Component Compounds PubMed (MeSH Keyword)

Select item 596214.

an image of a chemical structure CID 5962

L-lysine; lysine; 56-87-1 ...

MW:: 146.190
MF:: C₆H₁₄N₂O₂

IUPAC name:: (2S)-2,6-diaminohexanoic acid

Create Date:: 2004-09-16

CID:: 5962

Summary Similar Compounds Same Parent, Connectivity Mixture/Component Compounds PubMed (MeSH Keyword)

Select item 596115.

an image of a chemical structure CID 5961

L-glutamine; glutamine; 56-85-9 ...

MW:: 146.140
MF:: C₅H₁₀N₂O₃

IUPAC name:: (2S)-2,5-diamino-5-oxopentanoic acid

Create Date:: 2004-09-16

CID:: 5961

Summary Similar Compounds Same Parent, Connectivity Mixture/Component Compounds PubMed (MeSH Keyword)

Select item 595116.

an image of a chemical structure CID 5951

L-serine; serine; 56-45-1 ...

MW:: 105.090
MF:: C₃H₇NO₃

IUPAC name:: (2S)-2-amino-3-hydroxypropanoic acid

Create Date:: 2004-09-16

CID:: 5951

Summary Similar Compounds Same Parent, Connectivity Mixture/Component Compounds PubMed (MeSH Keyword)

Select item 586217.

an image of a chemical structure CID 5862

L-cysteine; 52-90-4; cysteine ...

MW:: 121.160
MF:: C₃H₇NO₂S

IUPAC name:: (2R)-2-amino-3-sulfanylpropanoic acid

Create Date:: 2004-09-16

CID:: 5862

Summary Similar Compounds Same Parent, Connectivity Mixture/Component Compounds PubMed (MeSH Keyword)

Select item 346918.

an image of a chemical structure CID 3469

2,5-DIHYDROXYBENZOIC ACID; gentisic acid; 490-79-9 ...

MW:: 154.120
MF:: C₇H₆O₄

IUPAC name:: 2,5-dihydroxybenzoic acid

Create Date:: 2004-09-16

CID:: 3469

Summary Similar Compounds Same Parent, Connectivity Mixture/Component Compounds PubMed (MeSH Keyword)

Select item 287919.

an image of a chemical structure CID 2879

4-methylphenol; P-CRESOL; 106-44-5 ...

MW:: 108.140
MF:: C₇H₈O

IUPAC name:: 4-methylphenol

Create Date:: 2004-09-16

CID:: 2879

Summary Similar Compounds Same Parent, Connectivity Mixture/Component Compounds PubMed (MeSH Keyword)

Select item 101420.

an image of a chemical structure CID 1014

phosphocholine; PHOSPHORYLCHOLINE; choline phosphate ...

MW:: 184.150
MF:: C₅H₁₅NO₄P⁺

IUPAC name:: trimethyl(2-phosphonooxyethyl)azanium

Create Date:: 2004-09-16

CID:: 1014

Summary Similar Compounds Same Parent, Connectivity Mixture/Component Compounds PubMed (MeSH Keyword)

<< First< Prev

Page of 2

Supplemental Content

Filters: Manage Filters

Actions on your results

View or Download Structures in PubChem

Refine your results

• Subsets of your results

Chemical Properties

Rule of 5 (21)
Compounds satisfied Lipinski's Rule of Five in evaluating druglikeness. Query: (-5:5[LOGP]) AND (0:500[MOLWT]) AND (0:5[HBDC]) AND (0:10[HBAC]).

BioActivity Experiments

BioAssays, Active (17)
Compounds identified as active in screening experiments

BioAssays, Tested (21)
Compounds identified as tested in screening experiments

Protein 3D Structures (19)
Compounds bound to proteins in atructure biology experiments

BioMedical Annotation

Pharmacological Actions (7)
Therapeutic use and National Library of Medicine (NLM) compound classifications
BioSystems (18)
Compounds involved in biological pathways

Depositor Category

Find related data

Recent activity

Clear Turn Off Turn On

Compound Links for PMC (Select 3338701) (26)
PubChem Compound
Nucleotide Links for Gene (Select 1200) (25)
Nucleotide

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...

You are here: NCBI > Chemicals & Bioassays > PubChem Compound