Alignment last updated: 11/20/2008 16:56:51

Join Legend

Serious alignment problem, requires review. (details...)
- Zero, or more than one, overlaps
- Half dove-tail >50 bp
- Alignment identity <98%
- Alignment length <50 bp
- >2 gaps, each gap >25 bp, not marked as an SSR
- >0 gaps, each gap >50 bp, not marked as an SSR
- >0 gaps, each gap >500 bp, not marked as an SSR
- >0 gaps, each gap >500 bp, marked as an SSR
Minor alignment problem. (details...)
- Exactly one overlap
- Half dove-tail >0 bp and <=50bp
- Alignment identity <99.1%
- Alignment length <2000 bp
- >0 gaps, each gap >25 bp, not marked as an SSR
- >0 gaps, each gap >50 bp, not marked as an SSR
- >0 gaps, each gap >500 bp, not marked as an SSR
- >0 gaps, each gap >500 bp, marked as an SSR
Excellent alignment, meets all defined criteria. (details...)
- Exactly one RuleInfo
- Half dove-tail <=0 bp
- Alignment identity >=99.1%
- Alignment length >=2000 bp
- <=0 gaps, each gap >25 bp, not marked as an SSR
- <=0 gaps, each gap >50 bp, not marked as an SSR
- <=0 gaps, each gap >500 bp, not marked as an SSR
- <=0 gaps, each gap >500 bp, marked as an SSR
Certificate submitted, not yet approved.
Certificate submitted and approved.
Valid, contained clone
Join not evaluated due to one accession not being finished.

Alignment for AL596110.15 and BX248411.3

Download Genome Workbench

Swap Rows Rotate Orientations

AL596110.15 Mouse DNA sequence from clone RP23-330N10 on chromosome 11, complete sequence [htgs_phase3]

Length: 214,834 bp

BX248411.3 Mouse DNA sequence from clone RP23-130D7 on chromosome 11, complete sequence [htgs_phase3]

Length: 72,368 bp

Alignment Summary

Join evaluation: green

Alignment count: 1

Go to Endhit Table

Alignment 1
Align ID: 4204
Total Length: 2000
Aligned Length: 2000
Percent Identity: 100
Number of Gaps: 0
Number of Mismatches: 0
Source: CtgOverlap Seq-Align
Valid Switchpoint: true (A)

Switch Points

Type	Point1	Point2	Orient1	Orient2	Curator	Comment	Time	Id	Alignment	Releases
A	1	2001	-	+	chenhc	Taxid 10090 chrom 11 Primary assembly	2008-11-20 16:56:51.566	63872	4204	GRCm39, GRCm38, MGSCv37

Alignment 1 of 1

 AL596110.15 : - : 2000..1
 BX248411.3 : + : 1..2000
 Mismatches = 0, Gaps = 0, Length = 2000
 Percent identity = 100%
 Score = 3965 bits (2000), Expect = 0
  0 BAC and 3 Fosmid bridging clones.
  0 BAC and 3 Fosmid concordant clones.
  0 BAC and 0 Fosmid discordant clones.

AL596110.15 <2000    acagtcagccatactcacaaaacttctcgcaggcaaaaaacaggggtggactctttacct 1941   
BX248411.3  >1       ............................................................ 60     

AL596110.15 <1940    ataggcactgcctaagcctgcagacactatgacatgggaagccttctctttacctgcagt 1881   
BX248411.3  >61      ............................................................ 120    

AL596110.15 <1880    ccaacctctttcttcctacaaggtcaatgctgcttatctatcgatcttcagcatggctta 1821   
BX248411.3  >121     ............................................................ 180    

AL596110.15 <1820    tcctctactattctaataatttttcagagtctgtcaaggactgcatcttctattgcgtgc 1761   
BX248411.3  >181     ............................................................ 240    

AL596110.15 <1760    tataattccctcacttgtacatgaccttaccaatttttcaatctagttaatttccaagtt 1701   
BX248411.3  >241     ............................................................ 300    

AL596110.15 <1700    tcacttgcatctggatatttacttagaaaacttttgagatatcaggggattttgtaacta 1641   
BX248411.3  >301     ............................................................ 360    

AL596110.15 <1640    caagatgatttattttacaattgagaatgcttttttcagctctgacttcatatttctaac 1581   
BX248411.3  >361     ............................................................ 420    

AL596110.15 <1580    agaaggtaaatataagacttgtttcaaatgctaatataataacctagaagctggagagaa 1521   
BX248411.3  >421     ............................................................ 480    

AL596110.15 <1520    ggctcagcagttaggagcactgggtgttcttccaggagttctgagttcaactcccagcac 1461   
BX248411.3  >481     ............................................................ 540    

AL596110.15 <1460    ccatttttggtgtgtagacaggcattcagacacaatacccatatatattaaataaacaaa 1401   
BX248411.3  >541     ............................................................ 600    

AL596110.15 <1400    tctaggaagggagagagggagggagggagggagggagggagcaagcagaaggttgattca 1341   
BX248411.3  >601     ............................................................ 660    

AL596110.15 <1340    aatgctaatagcccaacccctatacaaatacagtatcagtctgttgctctgaaggagcaa 1281   
BX248411.3  >661     ............................................................ 720    

AL596110.15 <1280    ggtggcatgctaatgacaaagtctgctttttctttagtgtattagctgtgtgatcaataa 1221   
BX248411.3  >721     ............................................................ 780    

AL596110.15 <1220    aaaggttcataactcaaatacatgatgggtcatggcagttaaatataagaaaggggttaa 1161   
BX248411.3  >781     ............................................................ 840    

AL596110.15 <1160    aatttcccatagaattcaatgatacaagtaatctttcctttatttttcactgttttaaaa 1101   
BX248411.3  >841     ............................................................ 900    

AL596110.15 <1100    tcccacacattttcctgctgcctgaaacctagacaaggtctgatttcagttccctggtat 1041   
BX248411.3  >901     ............................................................ 960    

AL596110.15 <1040    tagggagaaacaagcaactgcactcctgcactagctcagagagtgggaaggcggcggcag 981    
BX248411.3  >961     ............................................................ 1020   

AL596110.15 <980     ctcccaactctgcagagattgtggcaaagaccacagaaactgatagtcatgttactcaag 921    
BX248411.3  >1021    ............................................................ 1080   

AL596110.15 <920     tgcagaaaggacacttttctagaggttttctcattgttttgcatgctgatgaggttgtgg 861    
BX248411.3  >1081    ............................................................ 1140   

AL596110.15 <860     tcgtagcaaagaaggcagagatttaaatcttacttctgggcaatttgatggagacctatc 801    
BX248411.3  >1141    ............................................................ 1200   

AL596110.15 <800     ataacagtgagtggtttaaacaagaggtagttgaagttcctctgtttcaggcaaatatgt 741    
BX248411.3  >1201    ............................................................ 1260   

AL596110.15 <740     agagagccaccagtacatgtggttttaggatgtggtaggttctaacctcaatttactcct 681    
BX248411.3  >1261    ............................................................ 1320   

AL596110.15 <680     gacaggctggctgcagcagaataggcccattcaaaaggaaactttctctaagtgctttca 621    
BX248411.3  >1321    ............................................................ 1380   

AL596110.15 <620     atagacccagcggctcttgtatgggtttctttccttcagaacggatactcacagtcaaaa 561    
BX248411.3  >1381    ............................................................ 1440   

AL596110.15 <560     aaacaagtttcatttagctaggcaaggtcctcctagcatgaaataagatattctctacaa 501    
BX248411.3  >1441    ............................................................ 1500   

AL596110.15 <500     ataaaaaaataaaaagccaggcgtggtggcacacgccttaatcccagaactcgggaggca 441    
BX248411.3  >1501    ............................................................ 1560   

AL596110.15 <440     gaggcaggcggatttctgagttcgaggccagcctggtctacaaagtgagttccagaacag 381    
BX248411.3  >1561    ............................................................ 1620   

AL596110.15 <380     ccagggctacacagagaaaccctgtctcgaaaaaccgaaaaaaaaaaaaaaattcaaagt 321    
BX248411.3  >1621    ............................................................ 1680   

AL596110.15 <320     aaaaaaaataaataaaaggtgcctgtattcagtgtgaacattgcctggggaattttaggg 261    
BX248411.3  >1681    ............................................................ 1740   

AL596110.15 <260     tagcatcaagaactgctgtatctaactgtattcctaacacctgtagatatattctatttt 201    
BX248411.3  >1741    ............................................................ 1800   

AL596110.15 <200     tttatagccaaaaaatctcaagttaaacctggcagtggtgtatacctttaatcttagcac 141    
BX248411.3  >1801    ............................................................ 1860   

AL596110.15 <140     tagggaggcagaggcaggtggatctctgtactctctacggagtgatttccaggacagcca 81     
BX248411.3  >1861    ............................................................ 1920   

AL596110.15 <80      tagctacacagggaaaccatgtctcaaagaaggaggggaaaacccctcaaattaataaga 21     
BX248411.3  >1921    ............................................................ 1980   

AL596110.15 <20      cagaaaaaaatactgaattc 1      
BX248411.3  >1981    .................... 2000

Events

Id	Type	Date	Whodid	Comment
7882	ImportOldDb	09/02/2005 19:18:00	f_old_db
7883	ReSetShortOvlp	09/04/2008 10:31:48	dbo
174629	CreateSwitchPt	11/20/2008 16:56:51	chenhc	tpf_builder 1.6 Toolkit wrapper version: built Nov 19 2008 using /netopt/ncbi_tools64/c++.by-date/20081119/GCC401-Release64/lib

BAC Ends

Clone	R			F
Clone	Accession	%id	Position (strand)	Accession	%id	Position (strand)
C3H-114K11				AL596110.15	99.72%	pos 192514 (F-)
C3H-124M9	AL596110.15	99.25%	pos 6056 (R+)	AL596110.15	99.34%	pos 137740 (F-)
C3H-178O21	AL596110.15	99.02%	pos 36504 (R+)	AL596110.15	99.63%	pos 190125 (F-)
C3H-17G19	AL596110.15	99.35%	pos 54252 (R+)	AL596110.15	99.72%	pos 209175 (F-)
C3H-17H19				AL596110.15	99.58%	pos 209165 (F-)
C3H-195E5	AL596110.15	99.46%	pos 11434 (R+)
C3H-59M23	AL596110.15	100%	pos 66512 (R+)	AL596110.15	99.86%	pos 134896 (F-)
C3H-76K18				AL596110.15	99.52%	pos 179710 (F+)
C3H-79F7	AL596110.15	100%	pos 105668 (R+)
C3H-80E23	AL596110.15	99.75%	pos 136477 (R+)
C3H-80E24	AL596110.15	99.64%	pos 136483 (R+)
C3H-92C13	AL596110.15	99.46%	pos 18004 (R+)	AL596110.15	99.25%	pos 149204 (F-)
C3H-98F21	AL596110.15	100%	pos 209682 (R+)
CH29-148B16				AL596110.15	99.22%	pos 136797 (F-)
CH29-186L22	AL596110.15	99.74%	pos 95098 (R+)
CH29-30H7	BX248411.3	99.5%	pos 48043 (R-)
CH29-492C21	BX248411.3	99.03%	pos 27389 (R-)
CH29-494J9				BX248411.3	99.21%	pos 21180 (F-)
CH29-503I18				AL596110.15	99.86%	pos 137622 (F+)
CH29-518L3	AL596110.15	99.85%	pos 197211 (R+)
CH29-579D8	AL596110.15	100%	pos 75132 (R-)
CH29-5K4	AL596110.15	99.03%	pos 32986 (R+)
RP23-319J21	AL596110.15	99.19%	pos 39642 (R+)
RP24-169E13	AL596110.15	99.62%	pos 54220 (R+)
RP24-177A10				AL596110.15	99.51%	pos 175139 (F+)
RP24-265H19				AL596110.15	99.85%	pos 38824 (F-)
RP24-290D24				AL596110.15	99.36%	pos 50345 (F+)
RP24-309D17	AL596110.15	99.26%	pos 193109 (R-)	AL596110.15	99.5%	pos 14913 (F+)

Fosmid Ends

Clone	R			F
Clone	Accession	%id	Position (strand)	Accession	%id	Position (strand)
WI1-1042J16	BX248411.3	99.79%	pos 61376 (R+)
WI1-1099L13	AL596110.15	99.76%	pos 12846 (R+)	AL596110.15	100%	pos 53360 (F-)
WI1-1117I8	AL596110.15	100%	pos 82678 (R-)	AL596110.15	100%	pos 44589 (F+)
WI1-111P24	AL596110.15	100%	pos 52195 (R+)	AL596110.15	99.85%	pos 96531 (F-)
WI1-1225D10				BX248411.3	100%	pos 6089 (F-)
WI1-1228L17	AL596110.15	100%	pos 170885 (R+)	AL596110.15	99.74%	pos 211533 (F-)
WI1-1289D1	AL596110.15	100%	pos 187505 (R-)	AL596110.15	100%	pos 145020 (F+)
WI1-1297C3				AL596110.15	99.83%	pos 36920 (F-)
WI1-1382G17	AL596110.15	100%	pos 38100 (R-)	BX248411.3	99.62%	pos 5819 (F-)
WI1-1424J7				AL596110.15	100%	pos 33341 (F+)
WI1-1444D4	BX248411.3	100%	pos 70137 (R-)	BX248411.3	100%	pos 27302 (F+)
WI1-1493C11	AL596110.15	99.25%	pos 188185 (R-)	AL596110.15	100%	pos 149727 (F+)
WI1-1526O21	AL596110.15	99.63%	pos 70919 (R-)	AL596110.15	100%	pos 33543 (F+)
WI1-1539L7	AL596110.15	100%	pos 12894 (R+)	AL596110.15	100%	pos 53360 (F-)
WI1-1664G12	AL596110.15	100%	pos 200767 (R-)
WI1-1744L10	AL596110.15	100%	pos 135594 (R+)	AL596110.15	99.82%	pos 177383 (F-)
WI1-1751G7	AL596110.15	99.77%	pos 153524 (R+)	AL596110.15	99.8%	pos 195699 (F-)
WI1-1757P19	AL596110.15	99.42%	pos 67016 (R-)	AL596110.15	99.7%	pos 26949 (F+)
WI1-1759C8	AL596110.15	100%	pos 68990 (R+)	AL596110.15	100%	pos 107144 (F-)
WI1-1847D10	AL596110.15	100%	pos 35069 (R-)	BX248411.3	99.63%	pos 9061 (F-)
WI1-192F2	AL596110.15	99.56%	pos 117208 (R+)
WI1-1936L4	AL596110.15	100%	pos 188181 (R-)	AL596110.15	99.75%	pos 149737 (F+)
WI1-1983E4				AL596110.15	100%	pos 132786 (F-)
WI1-2013D2	AL596110.15	100%	pos 108913 (R-)
WI1-2054I5	AL596110.15	100%	pos 155388 (R-)	AL596110.15	99.85%	pos 117584 (F+)
WI1-2200I15	AL596110.15	99.78%	pos 148008 (R+)	AL596110.15	100%	pos 185611 (F-)
WI1-2255A21				BX248411.3	99.67%	pos 69070 (F+)
WI1-225O10	AL596110.15	99.84%	pos 143110 (R+)
WI1-2292O18	AL596110.15	100%	pos 122069 (R-)	AL596110.15	100%	pos 82598 (F+)
WI1-2328K22				AL596110.15	100%	pos 177400 (F+)
WI1-2337I20				AL596110.15	100%	pos 213807 (F+)
WI1-2355A22				AL596110.15	100%	pos 207971 (F+)
WI1-2355N16	AL596110.15	100%	pos 96172 (R-)	AL596110.15	100%	pos 54410 (F+)
WI1-240A7	AL596110.15	100%	pos 100813 (R-)	AL596110.15	100%	pos 55795 (F+)
WI1-2554B10	AL596110.15	100%	pos 29632 (R-)
WI1-255J20				AL596110.15	99.4%	pos 21479 (F-)
WI1-2664C4	AL596110.15	100%	pos 154025 (R-)
WI1-2752L23	AL596110.15	100%	pos 170946 (R+)	AL596110.15	99.61%	pos 213778 (F-)
WI1-2763A23	AL596110.15	100%	pos 22485 (R-)	BX248411.3	99.82%	pos 18163 (F-)
WI1-2764J19	AL596110.15	99.56%	pos 106554 (R-)	AL596110.15	100%	pos 60165 (F+)
WI1-2824I24				BX248411.3	100%	pos 50371 (F+)
WI1-2839E15				AL596110.15	100%	pos 100638 (F-)
WI1-2857F12				AL596110.15	99.18%	pos 21165 (F+)
WI1-291P13	BX248411.3	100%	pos 41386 (R-)	BX248411.3	100%	pos 6091 (F+)
WI1-376I18	AL596110.15	100%	pos 71384 (R-)	AL596110.15	99.81%	pos 34187 (F+)
WI1-376P18	AL596110.15	100%	pos 71421 (R-)	AL596110.15	100%	pos 34145 (F+)
WI1-422N19				BX248411.3	99.54%	pos 56 (F+)
WI1-422N19				AL596110.15	99.54%	pos 1945 (F-)
WI1-440E6	AL596110.15	100%	pos 70022 (R+)	AL596110.15	100%	pos 110796 (F-)
WI1-451N16				AL596110.15	100%	pos 45074 (F+)
WI1-477C8	AL596110.15	99.52%	pos 158502 (R-)	AL596110.15	99.85%	pos 120265 (F+)
WI1-484E19	AL596110.15	100%	pos 143161 (R+)	AL596110.15	100%	pos 186767 (F-)
WI1-611O18	AL596110.15	99.67%	pos 17466 (R+)	AL596110.15	99.86%	pos 58465 (F-)
WI1-620C15	AL596110.15	100%	pos 175282 (R+)
WI1-857O20				AL596110.15	100%	pos 107407 (F+)
WI1-872N19				AL596110.15	100%	pos 187734 (F+)
WI1-996N8				BX248411.3	99.55%	pos 69157 (F+)

Repeats

Too repeats, not showing repeat table.

Join Legend

Curator Links

Alignment for AL596110.15 and BX248411.3

Alignment Summary

Alignment 1 of 1