UCE target enrichment of Leptanilla_TH04_D0801_ACCTCAGT+TGTTCCGT (CAS... - SRA

SRX8296375: UCE target enrichment of Leptanilla_TH04_D0801_ACCTCAGT+TGTTCCGT (CASENT0129695) [raw reads].
1 ILLUMINA (Illumina HiSeq 2500) run: 2.5M spots, 622.6M bases, 277.7Mb downloads

Design: DNA was extracted non-destructively using a DNeasy Blood and Tissue Kit (Qiagen Inc., Valencia, CA) according to manufacturer instructions. DNA was quantified for each sample with a Qubit 2.0 fluorometer (Life Technologies Inc., Carlsbad, CA). Phylogenomic data were obtained from these taxa using the hym-v2 probe set, with libraries being prepared and target loci enriched using the protocol of Branstetter et al. (2017). Enrichment success and size-adjusted DNA concentrations of pools were assessed using the SYBR FAST qPCR kit (Kapa Biosystems, Wilmington, MA) and all pools were combined into an equimolar final pool. The contents of this final pool were sequenced by an Illumina HiSeq 2500 at the University of Utah's High Throughput Genomics Facility. For trimming raw reads, use i7:GATCGGAAGAGCACACGTCTGAACTCCAGTCAC*ATCTCGTATGCCGTCTTCTGCTTG and i5:AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT*GTGTAGATCTCGGTGGTCGCCGTATCATT, where * indicates the index sequence.

Submitted by: University of California, Davis

Study: Systematic revision of the ant subfamily Leptanillinae (Hymenoptera: Formicidae) grounded in phylogenomic inference

PRJNA629360 • SRP260854 • All experiments • All runs

show Abstracthide Abstract

Here, I present raw reads for my ongoing systematic revision of the ant subfamily Leptanillinae, a group that suffers rampant parallel taxonomy. I will resolve this parallel taxonomy using phylogenomic inference with ultra-conserved elements (UCEs) and male morphology in conjunction.

Sample: Refer to AntWeb (https://www.antweb.org/) to confirm voucher metadata.

SAMN14792694 • SRS6617300 • All experiments • All runs

Organism: Yavnella sp. TH04

Library:

Name: Leptanilla_TH04_D0801_ACCTCAGT+TGTTCCGT

Instrument: Illumina HiSeq 2500

Strategy: WGS

Source: GENOMIC

Selection: Hybrid Selection

Layout: PAIRED

Runs: 1 run, 2.5M spots, 622.6M bases, 277.7Mb

Run	# of Spots	# of Bases	Size	Published
SRR11742958	2,490,419	622.6M	277.7Mb	2020-10-05

ID:: 10798954

SRA

Sequence Read Archive

Result Filters

Send to:

Supplemental Content

Related information

Search details

Recent activity