Characterization of the rainbow trout transcriptome using Sanger and ... - SRA

SRX007396: Characterization of the rainbow trout transcriptome using Sanger and 454-Pyrosequencing approaches
2 LS454 (454 GS FLX) runs: 1.3M spots, 609M bases, 1.4Gb downloads

Design: Messenger RNA was isolated from total RNA using the Oligotex mRNA Mini kit (Qiagen, CA). First and second strand cDNA were synthesized from 200ng of mRNA using the SuperScript® Double-Stranded cDNA Synthesis Kit (Invitrogen, CA) with 100 µM random hexamer primers (Fermentas, USA). Double-stranded cDNA was cleaned up with a QIAquick Minelute PCR purification column (Qiagen, CA). Double-stranded DNA was nebulized with the nebulization kit supplied with the GS Titanium Library Preparation kit (Roche/454 Life Sciences, CT) following their recommendations (30psi for 1 minute) and cleaned up with a QIAquick PCR minelute column and eluted in 50ul EB. Nebulized cDNA was blunt-ended (25 µl water, 10 µl 10x T4 DNA Ligase buffer (NEB), 4 µl 10 mM dNTP mix, 5 µl T4 DNA polymerase (3 U/µl) (NEB), 1 µl Klenow polymerase (5 U/ µl) (NEB), and 5 µl Polynucleotide kinase (10 U/µl) (NEB) and cleaned up with a Qiaquick PCR minelute column and eluted in 32ul EB. A dA-overhang was added at 3’ end of cDNA by adding the following to the blunt-ended cDNA: 5 µl 10x buffer 2 (NEB), 10 µl 1 mM dATP and 3 µl Klenow exo-minus polymerase (5 U/µl) (NEB). The reaction was incubated at 370C for 30 minutes and then cleaned up with a QIAquick MiniElute column and eluted in 10 µl EB. The cDNA was adaptored with Titanium adaptors (Roche/454 Life Sciences, CT) by adding 9 µl water, 25 µl 2x Rapid Ligase buffer (Enzymatics, MA) 5 µl (50 µM) Titanium adapter A/B mix and 1 µl T4 DNA Ligase (600 U/µl (Enzymatics, MA) and incubated the ligation reaction at room temperature for 15 minutes. The reaction was cleaned up using a Qiaquick MiniElute column (Qiagen), eluting the cDNA in 20 µl EB. Adaptored cDNA was run on a E-GEL EX 2% agarose (Invitrogen, CA) following the manufacturer instructions and cDNAs in the size range of 400-800bp were excised from the gel and purified with a Qiagen’s Gel Extraction kit and the cDNA was eluted in 30 µl EB. One µl of the gel- purified cDNA was used as template for amplification in 50 µl PCR reactions containing 10 µl 5x Phusion Buffer HF (NEB), 25 µM Adapter A_For primer (5’CCATCTCATCCCTGCGTGTCTCCGACTCAGACGAGTGCGT3’), 25 µM Adapter B_For primer (5’CCTATCCCCTGTGTGCCTTGGCAGTCTCAGT3’), 3% DMSO, 10 mM dNTPs and 1 U Phusion polymerase (Finnzymes/NEB, USA). The PCR conditions were as follows: 980C for 30 seconds, followed by 15 cycles with 980C for 10 seconds, 680C for 30 seconds and 720C for 30 seconds, with a final extension of 720C for 5 minute and cleaned up with a Qiaquick minelute PCR column. Normalization of cDNA library The cDNA library was normalized according to the protocol described in the Trimmer Direct Kit (Evrogen, Russia). In brief, 300 ng of cDNA were incubated at 950C for 5 minutes followed by incubation at 680C for 4 hours in the hybridization buffer included in the kit (50 mM Hepes, pH7.5 and 0.5 M NaCl). After the incubation, the reaction was treated with ¼ units of duplex specific nuclease (DSN). The normalized cDNA was then amplified from 1 µl of DSN-treated cDNA by PCR reactions (10 cycles) described above and gel purified for the fragment size of 400-800 bp as described above.

Submitted by: West Virginia University,

Study: Characterization of the rainbow trout transcriptome using Sanger and 454-Pyrosequencing approaches

PRJNA79455 • SRP001007 • All experiments • All runs

show Abstracthide Abstract

Background: Rainbow trout is important fish species for aquaculture and biomedical research but has no genomic data. Until genome sequence becomes available, transcriptome sequencing is a rapid and efficient means for gene discovery and genetic marker development. Large-scale EST (258,973) Singer sequences are publicly available for rainbow trout. However, the nature of duplicated rainbow trout genome hinders assembly and annotation of the EST sequences. Additionally, previous efforts aimed at SNP discovery for rainbow trout using ESTs were unsuccessful, mainly, due to difficulties parsing allelic variation from the high frequency of duplicated genes. Results: High-throughput shotgun deep sequencing of the rainbow trout double-haploid transcriptome using DNA 454-pyrosequencing technology has been successfully applied yielding about 1.3 million reads with an average length of 344bp, a total of 447 million bases. De novo assembly of the sequences yielded 151,847 Tentative Consensus sequences (TCs) (Average length 662 nt) and 224,391 singletons. A combination assembly of both the 454-pyrosequencing ESTs and the pre-existing Singer sequences resulted in 161,818 TCs (Average length 758 nt) and 261,071 singletons. Gene Ontology analysis of the combination assembly showed similarity to the expected transcriptome of other fish species with known genome sequences, suggesting a genome-wide representation of the rainbow trout transcriptome sequence. Conclusion: The 454 library added great amount of new EST sequences and identified new genes. In addition, it improved assembly and annotation of the rainbow trout Sanger EST. The 454 library is a new tool for functional genome research in rainbow trout. It provides a reference sequence to identify gene duplications, allelic variations; distinguish true/false SNPs as well as for digital gene expression and proteomic research in rainbow trout.

Sample: Generic sample from Oncorhynchus mykiss

SAMN00002956 • SRS004650 • All experiments • All runs

Organism: Oncorhynchus mykiss

Library:

Name: 454

Instrument: 454 GS FLX

Strategy: EST

Source: TRANSCRIPTOMIC

Selection: cDNA

Layout: SINGLE

Spot descriptor:

5 forward

Runs: 2 runs, 1.3M spots, 609M bases, 1.4Gb

Run	# of Spots	# of Bases	Size	Published
SRR020739	642,488	301.3M	686.2Mb	2010-02-23
SRR020740	656,423	307.8M	701.2Mb	2010-02-23

ID:: 7670

SRA

Sequence Read Archive

Result Filters

Send to:

Supplemental Content

Related information

Recent activity