Warning: The NCBI web site requires JavaScript to function. more...
An official website of the United States government
The .gov means it's official. Federal government websites often end in .gov or .mil. Before sharing sensitive information, make sure you're on a federal government site.
The site is secure. The https:// ensures that you are connecting to the official website and that any information you provide is encrypted and transmitted securely.
Solanum chacoense, M6, mature leaf, replicate 1, 2, 3, CHA_AN_01_ONT, Oxford Nanopore Technologies PCR-cDNA Barcoding Kit SQK-PCB109 (BP01 AAGAAAGTTGTCGGTGTCTTTGTG)
1 OXFORD_NANOPORE (MinION) run: 0 spots, 0 bases
Solanum chacoense, M6, seedling, above ground, CHA_AJ_01_ONT, Oxford Nanopore Technologies Genomic DNA by Ligation Kit SQK-LSK110
Solanum chacoense, M6, seedling, above ground, CHA_AI_01_ONT, Oxford Nanopore Technologies Genomic DNA by Ligation Kit SQK-LSK110
Solanum chacoense, M6, seedling, above ground, CHA_AH_01_ONT, Oxford Nanopore Technologies Genomic DNA by Ligation Kit SQK-LSK110
Solanum chacoense, M6, seedling, above ground, CHA_AG_01_ONT, Oxford Nanopore Technologies Genomic DNA by Ligation Kit SQK-LSK110
Solanum chacoense, M6, seedling, above ground, CHA_AF_01_ONT, Oxford Nanopore Technologies Genomic DNA by Ligation Kit SQK-LSK110
Solanum chacoense, M6, seedling, above ground, CHA_AE_02_ONT, Oxford Nanopore Technologies Genomic DNA by Ligation Kit SQK-LSK110
Solanum chacoense, M6, seedling, above ground, CHA_AE_01_ONT, Oxford Nanopore Technologies Genomic DNA by Ligation Kit SQK-LSK110
Solanum chacoense, M6, mature fruit, replicate 1, 2, 3, CHA_AT_01_ONT, Oxford Nanopore Technologies PCR-cDNA Barcoding Kit SQK-PCB109 (BP06 TTCTCGCAAAGGCAGAAAGTAGTC)
Solanum chacoense, M6, tuber, flesh and peel, replicate 1, 2, 3, CHA_AS_01_ONT, Oxford Nanopore Technologies PCR-cDNA Barcoding Kit SQK-PCB109 (BP06 TTCTCGCAAAGGCAGAAAGTAGTC)
Solanum chacoense, M6, root, replicate 1, 2, 3, CHA_AR_01_ONT, Oxford Nanopore Technologies PCR-cDNA Barcoding Kit SQK-PCB109 (BP05 CTTGTCCAGGGTTTGTGTAACCTT)
Solanum chacoense, M6, stolon tips, replicate 1, 2, 3, CHA_AQ_01_ONT, Oxford Nanopore Technologies PCR-cDNA Barcoding Kit SQK-PCB109 (BP04 TTCGGATTCTATCGTGTTTCCCTA)
Solanum chacoense, M6, open flower, replicate 1, 2, 3, CHA_AP_01_ONT, Oxford Nanopore Technologies PCR-cDNA Barcoding Kit SQK-PCB109 (BP03 GAGTCTTGTGTCCCAGTTACCAGG)
Solanum chacoense, M6, stem, replicate 1, 2, 3, CHA_AO_03_ONT, Oxford Nanopore Technologies PCR-cDNA Barcoding Kit SQK-PCB109 (BP02 TCGATTCCGTTTGTAGTCGTCTGT)
Solanum chacoense, M6, stem, replicate 1, 2, 3, CHA_AO_02_ONT, Oxford Nanopore Technologies PCR-cDNA Barcoding Kit SQK-PCB109 (BP02 TCGATTCCGTTTGTAGTCGTCTGT)
Solanum chacoense, M6, stem, replicate 1, 2, 3, CHA_AO_01_ONT, Oxford Nanopore Technologies PCR-cDNA Barcoding Kit SQK-PCB109 (BP02 TCGATTCCGTTTGTAGTCGTCTGT)
Solanum chacoense, M6, seedling, above ground, CHA_AD_01_ONT, Oxford Nanopore Technologies Genomic DNA by Ligation Kit SQK-LSK110
Solanum chacoense, M6, seedling, above ground, CHA_AC_01_ONT, Oxford Nanopore Technologies Genomic DNA by Ligation Kit SQK-LSK110
Solanum chacoense, M6, immature leaf, CHA_AL, Arima HiC Kit (UDI0003 GGACTTGG-CGCAGACG)
1 ILLUMINA (Illumina NovaSeq 6000) run: 366.9M spots, 110.8G bases, 36.7Gb downloads
Solanum chacoense, M6, immature leaf, CHA_AM, Arima HiC Kit (UDI0004 AAGTCCAA-TATGAGTA)
1 ILLUMINA (Illumina NovaSeq 6000) run: 388.1M spots, 117.2G bases, 38.5Gb downloads
Filters: Manage Filters
Your browsing activity is empty.
Activity recording is turned off.
Turn recording back on