Instrument: 454 GS FLX Titanium
Strategy: RNA-Seq
Source: TRANSCRIPTOMIC
Selection: cDNA
Layout: SINGLE
Construction protocol: Extractions of nucleic acids from Eutrema proved to be unsatisfactory using methods commonly employed for Arabidopsis. These issues were circumvented using a modification of the method described for cotton leaves in Wan and Wilkins (1994). Briefly, approximately 0.5 g of frozen leaf tissue in liquid nitrogen was ground to fine powder in a mortar and pestle and RNA was extracted according to the manufacturer's recommendation with 8 mL Tri Reagent (Sigma). This first crude preparation of total RNA was resuspended in 1 mL nuclease-free water and purified of polyphenolics and carbohydrates using a "hot borate" step (200 mM sodium borate decahydrate, 30 mM Na-EGTA, 1% (w/v) SDS, 1% (w/v) sodium deoxycholate, 2% (w/v) polyvinylpyrrolidone (PVP 40000), 0.1% (w/v) DEPC, pH 9.0) followed by sequential RNA precipitations with 2 M lithium chloride then ethanol. From approximately 150 μg of this high quality total RNA, mRNAs were purified in 3-4 repeated rounds of oligo-dT selection using a Sigma mRNA miniprep kit (MRN-10). Abundance and quality of RNA following total RNA extraction was assessed using RNA 6000 Nano chips (Agilent) on a Bioanalyzer 2100 instrument and mRNA selections were continued until no rRNA peaks were visible on Bioanalyzer electropherograms. Procedures for RNA fragmentation, cDNA synthesis, sequencing adaptor ligation andsize selection closely followed the Roche cDNA Rapid Library Preparation Manual,December 2010. Briefly, 200 ng of mRNA was chemically fragmented with ZnCl2 andused as a template to synthesize double-stranded cDNA using Roche Primer "random". The product of each cDNA synthesis was end-repaired and indexed with the regularRapid Library Adaptor with one exception: Libraries Shandong-2 and Shandong-3 wereindexed by ligation of Roche MID Adaptors 2 and Adaptors 3, respectively. Each cDNAlibrary was quantified by fluorometry on a Biotek Synergy 2 fluorometric plate reader.Size selection of each library in the 600-1200 bp range was verified by running a smallaliquot on a High Sensitivity DNA chip (Agilent) on the Bioanalyzer 2100. All sequencing libraries were in the range of 108 to 109 molecules/mL and stored in this concentrated form in TE buffer at -80 °C for several days to approximately 1 month until further analysis. Quantitative real-time RT-PCR was conducted on a Bio-Rad CFX96 instrument using primers specific for Eutrema ACTIN1 (F -ACAGGGTGCTCTTCAGGAGCGAT; R - GCATGGTGTTGTGAGCAACTGGG), whose product spans an intron. Contaminating genomic DNA was not detected in any sequencing library.