U.S. flag

An official website of the United States government

Format

Send to:

Choose Destination

Links from BioSample

ERX210542: Metagenomics of eubacteria
1 LS454 (454 GS FLX Titanium) run: 6,203 spots, 2.5M bases, 6Mb downloads

Submitted by: VETMEDUNI_POPGEN
Study: Pyrosequencing reveals shifts in gut mucosa-associated bacteria linked to dietary calcium-phosphorus in weaned pigs
show Abstracthide Abstract
The porcine gut mucosa-associated microbiota has a major impact on bacterial colonisation and host-microbiota interactions; yet, little is known about the mucosa-associated bacterial communities at different gastrointestinal sites. 16S rRNA gene amplicons were sequenced using 454 GS FLX Titanium barcoded single-end technology to compare the microbial community of stomach, ileum and colon mucosal samples from 31 weaning pigs fed with different basal diets and with different calcium and phosphate contents (total number of samples: 93). This study was conducted to characterize the gastric, ileal, and colonic mucosa-associated bacterial communities and to investigate community shifts as response to different dietary cereals (wheat-barley versus corn) and calcium-phosphorus (Ca-P) contents (100% versus 190% of the Ca and P requirements) in weaned pigs. 16S rRNA genes were amplified using FLX 454 one way read fusion primers with the template specific sequence F27 - AGAGTTTGATCCTGGCTCAG and R357- CTGCTGCCTYCCGTA targeting the V1-V2 hypervariable region of the 16S rRNA gene.
Sample: Pyrosequencing of 16S rRNA amplicons from pig gastrointestinal mucosal scrapings
SAMEA2169158 • ERS219945 • All experiments • All runs
Organism: Bacteria
Library:
Name: unspecified
Instrument: 454 GS FLX Titanium
Strategy: AMPLICON
Source: GENOMIC
Selection: PCR
Layout: SINGLE
Spot descriptor:
          B2
Group tagBasecalls
ATGC
 P3
Group tagBasecalls
CGTTT
15  forward

Runs: 1 run, 6,203 spots, 2.5M bases, 6Mb
Run# of Spots# of BasesSizePublished
ERR2360086,2032.5M6Mb2014-05-14

ID:
734437

Supplemental Content

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...