show Abstracthide AbstractThe porcine gut mucosa-associated microbiota has a major impact on bacterial colonisation and host-microbiota interactions; yet, little is known about the mucosa-associated bacterial communities at different gastrointestinal sites. 16S rRNA gene amplicons were sequenced using 454 GS FLX Titanium barcoded single-end technology to compare the microbial community of stomach, ileum and colon mucosal samples from 31 weaning pigs fed with different basal diets and with different calcium and phosphate contents (total number of samples: 93). This study was conducted to characterize the gastric, ileal, and colonic mucosa-associated bacterial communities and to investigate community shifts as response to different dietary cereals (wheat-barley versus corn) and calcium-phosphorus (Ca-P) contents (100% versus 190% of the Ca and P requirements) in weaned pigs. 16S rRNA genes were amplified using FLX 454 one way read fusion primers with the template specific sequence F27 - AGAGTTTGATCCTGGCTCAG and R357- CTGCTGCCTYCCGTA targeting the V1-V2 hypervariable region of the 16S rRNA gene.