transcriptome of Procambarus clarkii: adult - SRA

Links from BioSample

SRX2452757: transcriptome of Procambarus clarkii: adult
1 ILLUMINA (Illumina HiSeq 2500) run: 34.5M spots, 10.3G bases, 5.2Gb downloads

Design: Total RNA was extracted using TRIzol. mRNA was purified with magnetic oligo(dt) coated Dynabeads. Fragmented cDNA library with 200 bp fragment sizes was constructed using SuperScript III reverse transcriptase and the PrepX library preparation kit on an Apollo 324. The PrepX kit was used for indexing with indices: AAGATCGGAAGAGCACACGTCTGAACTCCAGTCACGATCAGATCTCGTATGCCGTCTTCTGCTTG, GATCGTCGGACTGTAGAACTCTGAACGTGTAGATCTCGGTGGTCGCCGTATCATT (indices are reverse-complimented to be used directly in Trimgalore). The library was PCR amplified with the KAPA Library Amplification kit and assessed and quantified with the HSDNA Bioanalyzer and qPCR (KAPA Library Quantification). The speciemen has been registered with the Museum of Comparative Zoology, and can be accessed at http://mczbase.mcz.harvard.edu/guid/MCZ:IZ:141408

Submitted by: Harvard University

Study: Procambarus clarkii Neurogenesis

PRJNA358277 • SRP095858 • All experiments • All runs

show Abstracthide Abstract

Recent evidence suggests that cells originating from the innate immune system play a crucial role in neurogenic processes in the brain of adult crayfish. This project investigates transcriptomic data of Procambarus clarkii tissues that have been indicated to be involved in these developmental processes. It aims to identify and characterize key cell types of the adult neurogenic pathway based on specific gene expression patterns.

Sample:

SAMN06169700 • SRS1886119 • All experiments • All runs

Organism: Procambarus clarkii

Library:

Name: MCZ IZ 141408

Instrument: Illumina HiSeq 2500

Strategy: RNA-Seq

Source: TRANSCRIPTOMIC

Selection: cDNA

Layout: PAIRED

Runs: 1 run, 34.5M spots, 10.3G bases, 5.2Gb

Run	# of Spots	# of Bases	Size	Published
SRR5136647	34,488,466	10.3G	5.2Gb	2019-01-01

ID:: 3561388

SRA

Sequence Read Archive

Result Filters

Send to:

Links from BioSample

Supplemental Content

Related information

Recent activity