NM_000117.3(EMD):c.-161CAACGATTCGGCTGTGACGCGA[1] AND EMD-related disorder
- Germline classification:
- Likely benign (1 submission)
- Last evaluated:
- Jun 26, 2023
- Review status:
- Somatic classification
of clinical impact: - None
- Review status:
- Somatic classification
of oncogenicity: - None
- Review status:
- Record status:
- current
- Accession:
- RCV003966234.1
Allele description [Variation Report for NM_000117.3(EMD):c.-161CAACGATTCGGCTGTGACGCGA[1]]
NM_000117.3(EMD):c.-161CAACGATTCGGCTGTGACGCGA[1]
Condition(s)
- Name:
- EMD-related disorder
- Synonyms:
- EMD-related condition
- Identifiers:
Assertion and evidence details
Last Updated: May 12, 2024