NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Platform GPL10654 Query DataSets for GPL10654
Status Public on Jul 13, 2010
Title Ralstonia phage RSL1 Array
Technology type in situ oligonucleotide
Distribution custom-commercial
Organism Ralstonia phage phiRSL1
Manufacturer Combimatrix
Manufacture protocol CustomArray™ uses a specially modified “CMOS” semiconductor to direct the molecular assembly of a specific sequence of DNA bases in response to a digital command. Each feature on the array (a microelectrode) is digitally addressed to selectively generate acid, by means of an electrochemical reaction which, in-turn, controls the detritylation reaction during phosphoramidite synthesis. A software program is used to control the microelectrodes, and thus, the detritylation pattern applied on the chip during synthesis.
 
 
Web link http://www.filgen.jp/
Submission date Jul 08, 2010
Last update date Jul 26, 2010
Contact name Manabu Harada
E-mail(s) harada@filgen.jp
Organization name Filgen,Inc.
Department Biosciences
Street address 15-1 Nakanoshima, Ohdaka-cho, Midori-ku
City Nagoya
State/province aichi
ZIP/Postal code 459-8001
Country Japan
 
Samples (5) GSM567022, GSM567023, GSM567024, GSM567025, GSM567026
Series (1)
GSE23017 Characterization of transcription patterns of bacteriophage fRSL1 genes during infection cycle.

Data table header descriptions
ID
Gene Description gene description
SEQUENCE Probe Sequence
Probe Length
SPOT_ID spot identifier

Data table
ID Gene Description SEQUENCE Probe Length SPOT_ID
ORF001_58_92 ORF001 actgaagagcaagtcgcacatcgtgcagaacaacg 35 ORF001
ORF002_117_151 ORF002 gttgaccaccattcgtgaaggcgtctacctgaaag 35 ORF002
ORF002_312_346 ORF002 tgaaggacaattatcagggtaccgcactgcatgcc 35 ORF002
ORF002_462_496 ORF002 ctgtgatccacgatcagttggtactgggcgtcagt 35 ORF002
ORF003_136_170 ORF003 aaggacaattatcagggtaccgcactgcatgccct 35 ORF003
ORF003_286_320 ORF003 gtgatccacgatcagttggtactgggcgtcagtcg 35 ORF003
ORF003_529_563 ORF003 aagcagatcaaaatccaacgattcgggtttgcctt 35 ORF003
ORF005_153_187 ORF005 ggatgtcggtacgtgcctgatcctgaccgtctttg 35 ORF005
ORF005_73_107 ORF005 gtcttgcaagcactggtttcgtcatgtgttgggct 35 ORF005
ORF006_3_38 ORF006 gatcgcagcccttctctgtatcgtggtccacatcac 36 ORF006
ORF006_97_132 ORF006 tgtgtcaccatcctcgcaatctgggtcatctaccta 36 ORF006
ORF007_181_215 ORF007 aatgtgtactacgattctgcgaccggcgacaacag 35 ORF007
ORF007_289_323 ORF007 ttctatggcaatgcgtacttcccgttcctcgtggt 35 ORF007
ORF007_401_435 ORF007 gctatccgctgacgttcgacgctgaactggtgttg 35 ORF007
ORF008_221_255 ORF008 atctgctgactggcgaagacatcgaacgtcagaag 35 ORF008
ORF008_281_315 ORF008 tccatgaagcgttcaacctgacgaaagacgatccg 35 ORF008
ORF008_329_363 ORF008 tggccatcttgactttggatcgtcgccgtcaacaa 35 ORF008
ORF009_187_221 ORF009 ctcgacacgttggactacccttcggaccatgtgtt 35 ORF009
ORF009_33_67 ORF009 tggacaggttgttctcactcgcattaccgcaatca 35 ORF009
ORF010_193_227 ORF010 actgaccagttcgttcaactcgtttcgctgttcca 35 ORF010

Total number of rows: 1104

Table truncated, full table size 73 Kbytes.




Download family Format
SOFT formatted family file(s) SOFTHelp
MINiML formatted family file(s) MINiMLHelp

Supplementary data files not provided
| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap