NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Platform GPL1444 Query DataSets for GPL1444
Status Public on Nov 05, 2004
Title Hopkins Tag Array
Technology type spotted oligonucleotide
Distribution non-commercial
Organism Saccharomyces cerevisiae
 
Description Comprehensive array of all 6018 UpTag/DnTag pairs designed for incorporation into yeast deletion strains by the Yeast Deletion Project (June 2002).
Custom-designed negative and positive controls comprise almost half of the 215x105 array.
Keywords = yeast, deletion, knockout, tag, barcode, synthetic, control, oligonucleotide
 
Contributor(s) Yuan DS, Boeke JD
Citation(s) 15994458
Submission date Sep 13, 2004
Last update date Jul 20, 2005
Contact name Xuewen Pan
E-mail(s) xpan2@jhmi.edu
Phone 410-955-2477
Organization name Johns Hopkins University School of Medicine
Department Department of Molecular Biology and Genetics
Lab Boeke Lab
Street address 733 N. Broadway, Room 331
City Baltimore
State/province MD
ZIP/Postal code 21205
Country USA
 
Samples (218) GSM30549, GSM30550, GSM30551, GSM30552, GSM30553, GSM30554 
Series (16)
GSE1752 Benomyl dose-response
GSE1754 CIN8 Synthetic Lethality
GSE1757 SGS1 synthetic lethality

Data table header descriptions
ID Serial identifier for probe
ROW Row number in the array as scanned with GenePix scanner
COLUMN Column number in the array as scanned with GenePix scanner
TAGTYPE Code for whether tag is 5' (Up) or 3' (Dn) relative to the open reading frame (ORF)
PROBE Code for singleton probes arrayed in ORF order (ArrA, ArrB), five-fold replicate probes arrayed in randomized order (Rpts), systematic mutations arrayed across the center of the array (Muts), negative controls (NegT), or probes peripheral to the array as specified by the manufacturer (Edge)
ORF Systematic ORF name (from SGD, Feb 2003)
GENE Standard gene name (SGD) (or ORF if not available)
SEQUENCE DNA sequence of probe (includes custom-designed sequences for 193 YA* and YM* ORFs missing DnTags)
SGDID Unique ORF identifier from SGD; 'S000000000' denotes missing value
SPOT_ID spot identifier; ('YQL' ORFs denote custom-designed sequences; 'NegA', 'NegB', 'PosA', 'PosB' denote proprietary sequences specified by the manufacturer)

Data table
ID ROW COLUMN TAGTYPE PROBE ORF GENE SEQUENCE SGDID SPOT_ID
1 213 104 Up ArrA YAL001C TFC3 ACTATATGTGAAGGCATGGC S000000001
2 211 104 Up ArrA YAL002W VPS8 ATACTGACAGCACGCATGGC S000000002
3 209 104 Up ArrA YAL003W EFB1 GACATATCAGCATACATGGC S000000003
4 207 104 Up ArrA YAL004W YAL004W TATGGCACGGCAGACATTCC S000002136
5 205 104 Up ArrA YAL005C SSA1 AGGCATACTACACAGATTCC S000000004
6 203 104 Up ArrA YAL007C ERP2 GAGTGATCCATACACATTCC S000000005
7 201 104 Up ArrA YAL008W FUN14 ATGAACTTGCGCTCAATTCC S000000006
8 199 104 Up ArrA YAL009W SPO7 GCCAGATCATCAATAGGCAC S000000007
9 197 104 Up ArrA YAL010C MDM10 CACTATATGTCAACAGGCAC S000000008
10 195 104 Up ArrA YAL011W SWC1 CAGTAATCAGAAGCTCGCAC S000000009
11 193 104 Up ArrA YAL012W CYS3 TAGCACACGGTCGAATTTCC S000000010
12 191 104 Up ArrA YAL013W DEP1 GATACGCGCCAATCTCTATA S000000011
13 189 104 Up ArrA YAL014C SYN8 CCGCATACCGAATTGCTATA S000000012
14 187 104 Up ArrA YAL015C NTG1 GCGCAGAAGGCAATGCTATA S000000013
15 185 104 Up ArrA YAL016W TPD3 CGCCTAAGACCGGATAAAGC S000000014
16 183 104 Up ArrA YAL017W PSK1 GCACATCTGACAACAGGCGA S000000015
17 181 104 Up ArrA YAL018C YAL018C CATACACGTAAAGTGCGCGA S000000016
18 179 104 Up ArrA YAL019W FUN30 TGCACAGCGACAATACGCGA S000000017
19 177 104 Up ArrA YAL020C ATS1 CGATTCGATAAATGACGCGA S000000018
20 175 104 Up ArrA YAL021C CCR4 CAGTCGATCACAAGCGAGCA S000000019

Total number of rows: 22575

Table truncated, full table size 1494 Kbytes.






Download family Format
SOFT formatted family file(s) SOFTHelp
MINiML formatted family file(s) MINiMLHelp

Supplementary data files not provided

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap