NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Platform GPL15030 Query DataSets for GPL15030
Status Public on Dec 30, 2011
Title Agilent Human, KSHV, and EBV 44K AMADID #027774
Technology type in situ oligonucleotide
Distribution custom-commercial
Organisms Homo sapiens; human gammaherpesvirus 4; Human gammaherpesvirus 8
Manufacturer Agilent Technologies
Manufacture protocol Refer to Agilent Technologies website for custom 4X44K array printing with Sure Print technology (www.genomics.agilent.com/GenericB.aspx?PageType=Custom&SubPageType=Custom&PageID=2011)). This platform contains control probes for background correction and spike-in hybridization.
Tiling of KSHV, EBV, and control cellular and reporter genes were initially tiled with 60bp oligomers with 30bp overlap (straight tiling). Major repeats were represtented once. Initial experiments (not associated with the corresponding article) were performed to determine regions with significant background hybridization. These regions were retiled according to Best-Tm and Best-Distribution methodologies available on the eArray website for custom microarray design (earray.chem.agilent.com). Gaps were tolerated at <300 bp, with some exceptions as described in the methods section of the corresponding article. All non-Agilent based probes were present in triplicate.
 
 
Citation(s) 22185355
Submission date Dec 19, 2011
Last update date Dec 30, 2011
Contact name Lindsay Renee Dresang
E-mail(s) lid26@pitt.edu
Organization name University of Pittsburgh
Department Cancer Virology Program
Lab Chang Moore
Street address 5117 Centre Ave, Hillman Cancer Res. Pav. 1.8
City Pittsburgh
State/province PA
ZIP/Postal code 15213
Country USA
 
Samples (8) GSM850708, GSM850709, GSM850710, GSM850711, GSM850712, GSM850713 
Series (1)
GSE34538 Coupled Transcriptome and Proteome Analysis of Human Lymphotropic Tumor Viruses: Insights on the Detection and Discovery of Viral Genes

Data table header descriptions
ID
Probe Name Probe name based on grouped sequence for probe design (eArray, AMADID #027774)
Probe UID Unique Probe ID Number
Feature Num-1 First numerical feature number for indicated Probe UID
Feature Num-2 Second numerical feature number for indicated Probe UID
Feature Num-3 Third numerical feature number for indicated Probe UID
Sequence Source Sequence origin, brief description (EBV, KSHV, cellular, or reporter sequence)
Brief Transcript and ORF Descriptions Probes associated with transcripts and open reading frames (ORFs) are indicated (minimum 10% sequence hybridization) and multiple overlapping transcripts and ORFs per probe are separated by +
RANGE_GB GenBank accession
RANGE_START
RANGE_END
SPOT_ID
Accession Accession number
Direct Direction or Strandedness: FW = forward direction or top strand; RC = reverse complement direction or bottom strand
Begin Position of the first nucleotide
Sequence 60bp sequence per unique probe
End Position of the last nucleotide (Null if not EBV or KSHV)

Data table
ID Probe Name Probe UID Feature Num-1 Feature Num-2 Feature Num-3 Sequence Source Brief Transcript and ORF Descriptions RANGE_GB RANGE_START RANGE_END SPOT_ID Accession Direct Begin Sequence End
1 CUST_1_PI424987113 8943 12154 29444 33801 ACTA1 ACTA1 NM_001100.3 61 120 NM_001100.3 FW 61 AGCCGAGAGTAGCAGTTGTAGCTACCCGCCCAGAAACTAGACACAATGTGCGACGAAGAC (null)
2 CUST_2_PI424987113 12578 21469 32273 32868 ACTA1 ACTA1 NM_001100.3 76 135 NM_001100.3 FW 76 AGCAGTTGTAGCTACCCGCCCAGAAACTAGACACAATGTGCGACGAAGACGAGACCACCG (null)
3 CUST_3_PI424987113 1304 1648 6878 14718 ACTA1 ACTA1 NM_001100.3 241 300 NM_001100.3 FW 241 ATGGTCGGTATGGGTCAGAAAGATTCCTACGTGGGCGACGAGGCTCAGAGCAAGAGAGGT (null)
4 CUST_4_PI424987113 6110 7618 15938 40780 ACTA1 ACTA1 NM_001100.3 286 345 NM_001100.3 FW 286 AGGCTCAGAGCAAGAGAGGTATCCTGACCCTGAAGTACCCTATCGAGCACGGCATCATCA (null)
5 CUST_5_PI424987113 2883 3497 5885 27963 ACTA1 ACTA1 NM_001100.3 301 360 NM_001100.3 FW 301 ATCCTGACCCTGAAGTACCCTATCGAGCACGGCATCATCACCAACTGGGATGACATGGAG (null)
6 CUST_6_PI424987113 9601 13502 16074 24245 ACTA1 ACTA1 NM_001100.3 316 375 NM_001100.3 FW 316 TGAAGTACCCTATCGAGCACGGCATCATCACCAACTGGGATGACATGGAGAAGATCTGGC (null)
7 CUST_7_PI424987113 2581 3069 37333 37625 ACTA1 ACTA1 NM_001100.3 331 390 NM_001100.3 FW 331 GGCATCATCACCAACTGGGATGACATGGAGAAGATCTGGCACCACACCTTCTACAACGAG (null)
8 CUST_8_PI424987113 5287 6360 11893 41724 ACTA1 ACTA1 NM_001100.3 346 405 NM_001100.3 FW 346 CCAACTGGGATGACATGGAGAAGATCTGGCACCACACCTTCTACAACGAGCTTCGCGTGG (null)
9 CUST_9_PI424987113 6697 8403 34797 40389 ACTA1 ACTA1 NM_001100.3 451 510 NM_001100.3 FW 451 GCCAACCGCGAGAAGATGACCCAGATCATGTTTGAGACCTTCAACGTGCCCGCCATGTAC (null)
10 CUST_10_PI424987113 3719 4514 19267 25389 ACTA1 ACTA1 NM_001100.3 466 525 NM_001100.3 FW 466 AGAAGATGACCCAGATCATGTTTGAGACCTTCAACGTGCCCGCCATGTACGTGGCCATCC (null)
11 CUST_11_PI424987113 10445 15373 17255 29627 ACTA1 ACTA1 NM_001100.3 667 726 NM_001100.3 FW 667 ACCGACTACCTGATGAAGATCCTCACTGAGCGTGGCTACTCCTTCGTGACCACAGCTGAG (null)
12 CUST_12_PI424987113 3291 3823 31433 43877 ACTA1 ACTA1 NM_001100.3 916 975 NM_001100.3 FW 916 TCGGTATGGAGTCGGCGGGCATTCACGAGACCACCTACAACAGCATCATGAAGTGTGACA (null)
13 CUST_13_PI424987113 7001 8886 27234 28242 ACTA1 ACTA1 NM_001100.3 931 990 NM_001100.3 FW 931 ATTCACGAGACCACCTACAACAGCATCATGAAGTGTGACATCGACATCAGGAAGGACCTG (null)
14 CUST_14_PI424987113 1590 1900 7791 43078 ACTA1 ACTA1 NM_001100.3 946 1005 NM_001100.3 FW 946 CCACCTACAACAGCATCATGAAGTGTGACATCGACATCAGGAAGGACCTGTATGCCAACA (null)
15 CUST_15_PI424987113 671 843 12491 30983 ACTA1 ACTA1 NM_001100.3 970 1029 NM_001100.3 FW 970 ATCGACATCAGGAAGGACCTGTATGCCAACAACGTCATGTCGGGGGGCACCACGATGTAC (null)
16 CUST_16_PI424987113 7191 9206 20951 31304 ACTA1 ACTA1 NM_001100.3 1043 1102 NM_001100.3 FW 1043 ACCGCATGCAGAAAGAGATCACCGCGCTGGCACCCAGCACCATGAAGATCAAGATCATCG (null)
17 CUST_17_PI424987113 1812 2193 13646 24990 ACTA1 ACTA1 NM_001100.3 1235 1294 NM_001100.3 FW 1235 TCTAGACACACTCCACCTCCAGCACGCGACTTCTCAGGACGACGAATCTTCTCAATGGGG (null)
18 CUST_18_PI424987113 4888 5843 28621 40395 ACTA1 ACTA1 NM_001100.3 1321 1380 NM_001100.3 FW 1321 AGTCACTTTCTTTGTAACAACTTCCGTTGCTGCCATCGTAAACTGACACAGTGTTTATAA (null)
19 CUST_19_PI424987113 2391 2874 5331 10015 ACTA1 ACTA1 NM_001100.3 1336 1395 NM_001100.3 FW 1336 TTTGTAACAACTTCCGTTGCTGCCATCGTAAACTGACACAGTGTTTATAACGTGTACATA (null)
20 CUST_20_PI424987113 426 533 19040 29214 ACTA1 ACTA1 NM_001100.3 1351 1410 NM_001100.3 FW 1351 TGCCATCGTAAACTGACACAGTGTTTATAACGTGTACATACATTAACTTATTACCTCATT (null)

Total number of rows: 14601

Table truncated, full table size 2494 Kbytes.




Download family Format
SOFT formatted family file(s) SOFTHelp
MINiML formatted family file(s) MINiMLHelp

Supplementary data files not provided
| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap