| Data table |
| ID |
ORF |
Description |
Sequence |
| GT_Sp_CAGL0A01193g_3 |
CAGL0A01193g |
CAGL0A01193g;Product: hypothetical; Gene present in protein in the region 119731..120042 in + of length 103; Next best Hit: CAGL0L04114g(alignment length 14bp with 100.00%identity) |
ACATCACACAGAACATCACAAAAAGTAGCACTCTTAACAGTGCCACACACAACTGTACAA |
| GT_Sp_CAGL0A01284g_20 |
CAGL0A01284g |
CAGL0A01284g;Product: hypothetical; Gene present in protein in the region 131362..135567 in + of length 1401; Next best Hit: CAGL0A01045g(alignment length 16bp with 100.00%identity) |
CTAGCTCAAGAATTAGTGATTTAGAATCTTCAAGAAGAACATCAATCTTAGGTGACGACC |
| GT_Sp_CAGL0A01366g_37 |
CAGL0A01366g |
CAGL0A01366g;Product: hypothetical; Gene present in protein in the region 140305..144693 in + of length 1462; Next best Hit: CAGL0A01284g(alignment length 27bp with 100.00%identity) |
CCAGAACCTAGAACGACCACTATTACAACAATAATTACAGAAGATGGTCAAATAATAACC |
| GT_Sp_CAGL0A03051g_43 |
CAGL0A03051g |
CAGL0A03051g;Product: hypothetical; Gene present in protein in the region 312728..313334 in - of length 115; Next best Hit: CAGL0K04895g(alignment length 18bp with 94.44%identity) |
TACGAGCATCCAAACAACAACCTATTGAAGAAGTACGCCAGCGATGTGTTTCTGAGAGGT |
| GT_Sp_CAGL0A03117g_53 |
CAGL0A03117g |
CAGL0A03117g;Product: hypothetical; Gene present in protein in the region 320671..322666 in + of length 232; Next best Hit: CAGL0J10252g(alignment length 14bp with 100.00%identity) |
TGAACATCGTTGTTGACCCAACCGTTCAACCAGCTAGACCTTTGACCGAAAGAATTAGAG |
| GT_Sp_CAGL0B01203g_73 |
CAGL0B01203g |
CAGL0B01203g;Product: hypothetical; Gene present in protein in the region 108965..109892 in + of length 88; Next best Hit: CAGL0H03597g(alignment length 16bp with 100.00%identity) |
GATACTTGAAGCACGTCGCTAGAAGATTCAAGAACGGTTTCCAATCTGGTACCGCTTCTA |
| GT_Sp_CAGL0B01589g_83 |
CAGL0B01589g |
CAGL0B01589g;Product: hypothetical; Gene present in protein in the region 145132..145488 in + of length 77; Next best Hit: CAGL0J00363g(alignment length 13bp with 100.00%identity) |
AATGACGATACGATATCCACCGCTAAGTTATCAGATGGCATGCAACTGCATCTGGTGTTG |
| GT_Sp_CAGL0B01875g_93 |
CAGL0B01875g |
CAGL0B01875g;Product: hypothetical; Gene present in protein in the region 172117..172341 in + of length 74; Next best Hit: CAGL0L11286g(alignment length 14bp with 100.00%identity) |
CATTTCTAACAGTTACTTTAGGCTGGCCATTTGGTATTTACTTCTGGAAAAAGCCAAACT |
| GT_Sp_CAGL0B02755g_103 |
CAGL0B02755g |
CAGL0B02755g;Product: hypothetical; Gene present in protein in the region 264963..265178 in + of length 71; Next best Hit: CAGL0A04477g(alignment length 14bp with 100.00%identity) |
AAAGACGTTCATGGTAAGGAATCCAATAATGGCAATGCAGGCGGGTTGCTGCAAAATGAT |
| GT_Sp_CAGL0B03611g_113 |
CAGL0B03611g |
CAGL0B03611g;Product: hypothetical; Gene present in protein in the region 360764..360952 in - of length 62; Next best Hit: CAGL0J08734g(alignment length 14bp with 100.00%identity) |
ACTCCCTGGCCTTGCGTATTCGGAGCACAGTGGTACTGTGTCAGCGACTTCAAAGGACAG |
| GT_Sp_CAGL0B03855g_123 |
CAGL0B03855g |
CAGL0B03855g;Product: hypothetical; Gene present in protein in the region 382111..382395 in - of length 94; Next best Hit: CAGL0H07799g(alignment length 14bp with 100.00%identity) |
GTTTTTTGTTGTAACACTTATAGTAACTCTGCCACCGTACTCCTGTTACAAGAAAAACCA |
| GT_Sp_CAGL0B03899g_133 |
CAGL0B03899g |
CAGL0B03899g;Product: hypothetical; Gene present in protein in the region 384701..384955 in - of length 84; Next best Hit: CAGL0L04836g(alignment length 15bp with 100.00%identity) |
AATACTGAATCACAAGGTTCAGGGGCTGATGTCAAGACTGACATGGAAAAGGAACTGAAG |
| GT_Sp_CAGL0C01325g_143 |
CAGL0C01325g |
CAGL0C01325g;Product: hypothetical; Gene present in protein in the region 140060..140509 in + of length 149; Next best Hit: CAGL0M09581g(alignment length 14bp with 100.00%identity) |
AGTACTTGAAGTCCAAGAATGCAAACCCATGGGGTGGTTACTCTCAAGTGCAATCCAAGT |
| GT_Sp_CAGL0C01435g_153 |
CAGL0C01435g |
CAGL0C01435g;Product: hypothetical; Gene present in protein in the region 156370..156618 in + of length 82; Next best Hit: CAGL0E01793g(alignment length 21bp with 95.24%identity) |
AGAAAAGGTAGAGTGTATGTCTACTGTAAGTCCAACAAGAAGCATAAACAACGCCAAGGA |
| GT_Sp_CAGL0C01919g_163 |
CAGL0C01919g |
CAGL0C01919g;Product: hypothetical; Gene present in protein in the region 202384..202488 in - of length 34; Next best Hit: CAGL0M00594g(alignment length 18bp with 94.44%identity) |
GAAAAGAGGGACAATTATATTGTCAAAGGGTTTTTCTGGAGTCCAGATTGTGTAATCGCT |
| GT_Sp_CAGL0C02623g_173 |
CAGL0C02623g |
CAGL0C02623g;Product: hypothetical; Gene present in protein in the region 268568..268789 in + of length 73; Next best Hit: CAGL0L12980g(alignment length 15bp with 100.00%identity) |
TCGGTTTCGCTGTTCCATTTATTGCATGTTACGTCCAAATGAAGAAAGCTGGTAACATTT |
| GT_Sp_CAGL0C03369g_183 |
CAGL0C03369g |
CAGL0C03369g;Product: hypothetical; Gene present in protein in the region 339146..341203 in + of length 494; Next best Hit: CAGL0K01001g(alignment length 15bp with 100.00%identity) |
ATATTTTTGATCGACTGTCCTGGTATCGTTCCCCCATCCACCAAAGATAGCGAAGAGGAT |
| GT_Sp_CAGL0C04933g_193 |
CAGL0C04933g |
CAGL0C04933g;Product: hypothetical; Gene present in protein in the region 461278..461520 in + of length 80; Next best Hit: CAGL0K02167g(alignment length 15bp with 100.00%identity) |
CTCAATGGTAAACGTTCAAATGCATCTGATGCCAGTGAAGACATGAAAAGAAAAAGACCA |
| GT_Sp_CAGL0C05461g_203 |
CAGL0C05461g |
CAGL0C05461g;Product: hypothetical; Gene present in protein in the region 521725..521838 in - of length 37; Next best Hit: CAGL0F06743g(alignment length 14bp with 100.00%identity) |
TGGTAGTTCTGGTCGTTGTTTACCACGCAGTTGCATCAACTATGGCTGTAAAAAGAGACT |
| GT_Sp_CAGL0D01265g_213 |
CAGL0D01265g |
CAGL0D01265g;Product: hypothetical; Gene present in protein in the region 142000..142191 in + of length 63; Next best Hit: CAGL0J03102g(alignment length 15bp with 100.00%identity) |
GTTCCCACGGTTCCAGCTGTCACGGTTCTTGTGGATGCGGTGACAAGTGTGAGTGCAAGT |
Less...
More...